University of Southern California Dissertations and Theses

The role of RhoGEFs in glutamatergic synapse development and human cognitive disorders

(USC Thesis Other)

The role of RhoGEFs in glutamatergic synapse development and human cognitive disorders

PDF

Download a page range

Download transcript

Copy asset link

Request this asset

Transcript (if available)

Content

The Role of RhoGEFs in Glutamatergic Synapse Development and Human Cognitive Disorders

by
Sadhna Rao

A Dissertation Presented to the
FACULTY OF THE USC GRADUATE SCHOOL
UNIVERSITY OF SOUTHERN CALIFORNIA
In Partial Fulfillment of the
Requirements for the Degree
DOCTOR OF PHILOSOPHY
(NEUROSCIENCE)
August 2022

Copyright 2022 Sadhna Rao

ii
DEDICATION

To my grandmother Kusuma, a survivor and storyteller, who taught herself English with the
combined powers of curiosity, a dictionary, and the daily crossword puzzle.

iii
ACKNOWLEDGEMENTS

Many thanks to Manuel Cerpas Lua for his technical expertise that made this research possible.
To Judith Hirsch, who as a graduate student advisor is most excellent at pointing to the more
judicious choices in trying times. To my excellent committee members for their good-spirited
audience and advice: Don Arnold, Seva Katrich and Dion Dickman. Last but not the least, to my
graduate advisor Bruce Herring who has been a generous and kind in working together.

From the many people closest in my heart: I want to thank my beloved grandfather who shared
and nurtured my curiosity for science and bought me a toy microscope so I could examine ants.
My friends, who have helped me make a home away from home. Thank you for the adventures
and believing in me when I did not believe in myself. Most of all, I want to thank my parents
who taught me to keep dreaming. Onward and upward!

iv
TABLE OF CONTENTS

Dedication…………………………………………………………………………………ii
Acknowledgements………………………………………………………………………iii
List of Tables……………………………………………………………………………..vi
List of Figures……………………………………………………………………………vii
Abstract…………………………………………………………………………………...ix
Chapter 1: Tiam1 plays a critical role in glutamatergic synapse structure and function
in the hippocampus……………………..……………………………………………...…1
a. Introduction
b. Results
i. Tiam1 is required for AMPAR-mediated neurotransmission in DG
granule neurons
ii. AMPAR- and NMDAR-mediated neurotransmission are normal in
CA1 pyramidal neurons following Tiam1 knockdown
iii. Loss of Tiam1 expression in DG granule neurons results in increased
spine length
iv. Tiam1’s PHn-CC-Ex domain negatively regulates Tiam1 function at
DG granule synapses

Chapter 2: Tiam2 is a subregion-specific regulators of glutamatergic
synapse development and function in the hippocampus…………………………………21
a. Introduction
b. Results
i. Tiam2 knockdown disrupts baseline neurotransmission in CA1 pyramidal
neurons
ii. Tiam2 knockdown produces loss of dendritic spines in CA1
pyramidal neurons
iii. Tiam2 has a DH-dependent role in neurotransmission in CA1
pyramidal neurons
iv. Tiam2 knockdown has no influence on long-term potentiation in
CA1 pyramidal neurons
v. Tiam2 knockdown results in a DH-dependent increase in AMPAR
and NMDAR neurotransmission and dendritic spine number in DG
granule neurons

Chapter 3: Detection of Autism Spectrum Disorder-related pathogenic variants by a
novel structure-based approach………………………………………...…………...……42
a. Introduction
b. Results
i. Structure-based modeling predicts mutations disruptive for TRIO stability
v
and RAC1 binding
ii. Mutations predicted to compromise TRIO-RAC1 binding disrupt
TRIO-9’s influence on glutamatergic synapse function
iii. Mutations predicted to compromise TRIO-RAC1 stability disrupt
TRIO-9’s influence on glutamatergic synapse function
iv. Mutations predicted to be benign to TRIO-RAC1 interaction do not
interfere with TRIO-9’s effect on glutamatergic synapse function.

References………………………………………………………………………………..58
Appendices
Appendix A: Materials and Methods…..……………………………………….........66
Appendix B:Tables……...…………………………………………………………...77

vi
LIST OF TABLES

Table 1. Mutations predicted to compromise TRIO-RAC1 binding interface…………………..97
Table 2. Mutations predicted to compromise TRIO-RAC1 stability………………………….....97
Table 3. Comparison of predictions from modeling and Polyphen2…………………………….98

vii
LIST OF FIGURES

Figure 1. Tiam1 expression in the hippocampus is primarily in the DG granule neurons..............6
Figure 2. Tiam1 shRNA reduced Tiam1 expression in HEK293 cells and hippocampal
neurons….........................................................................................................................................7
Figure 3. Tiam1 knockdown reduces AMPAR-mediated neurotransmission in DG granule
neurons………………………………………………………………………………………….....9
Figure 4. Tiam1 knockdown produces a post-synaptic disruption in AMPAR-mediated
neurotransmission………………………………………………………………………………..10
Figure 5. Tiam1 knockdown does not affect AMPAR or NMDAR-mediated neurotransmission
in CA1 pyramidal neurons………………………………………...…………………………….11
Figure 6. Tiam1 knockdown increases dendritic spine length in DG granule neurons but not in
CA1 pyramidal…………………………………………………………………………………...14
Figure 7. Full-length Tiam1 but not Tiam1 ∆DH expression rescues Tiam1 shRNA mediated
effects on glutamatergic synapses of DG granule neurons………………………………………15
Figure 8. Tiam1 ∆PHCCEx expression increases AMPAR-eEPSC mediated neurotransmission
in DG granule neurons…………………………………………………...……………………...17
Figure 9. Tiam2 knockdown reduces AMPAR- and NMDAR-mediated neurotransmission
in CA1 pyramidal neurons……………………………………………………………………….28
Figure 10. Tiam2 shRNA expression results in loss of spine density in CA1 pyramidal
neurons………………………...………………………………...…………………………….…31
Figure 11. Full-length Tiam2 but not Tiam2 ∆DH expression rescues Tiam2 shRNA
mediated effects on glutamatergic synapses of CA1 pyramidal neurons…………………..........34
Figure 12. Full-length Tiam1 rescues Tiam2 shRNA mediated effects on baseline
viii
glutamatergic neurotransmission but does not affect Long-Term Potentiation in CA1
pyramidal neurons………………………………………...……………………………………...36
Figure 13. Tiam2 knockdown increases AMPAR- and NMDAR-mediated baseline
neurotransmission in DG granule neurons……………………………………..…………..…….40
Figure 14. Tiam2 knockdown is rescued by full-length Tiam2 and increases spine number in
DG granule neurons……………………………………………….……………………………..41
Figure 15. Tiam2 knockdown is rescued by full-length Tiam1 and Tiam2 ∆DH in DG
granule neurons……………………………………………...…………………………………...42
Figure 16. Mutations predicted to compromise TRIO-RAC1 binding disrupt TRIO-9’s
influence on glutamatergic synapse function…………………………………………………….48
Figure 17. Mutations predicted to compromise TRIO-RAC1 stability disrupt TRIO-9’s
influence on glutamatergic synapse function……………………………………………………51
Figure 18. Mutations predicted to be benign to TRIO-RAC1 interaction do not interfere with
TRIO-9’s influence on glutamatergic synapse function……………………………………..….54
Figure 19. Workflow for structure-based prediction method to identify pathological ASD
-related de novo mutations in TRIO’s DH1 domain in patients…………..…………………….55

ix
ABSTRACT

RhoGEF proteins have been recently reported as powerful modulators of glutamatergic synapse
function and have been implicated in the pathobiology of neuropsychiatric and
neurodevelopmental disorders like Autism Spectrum Disorders (ASD), Schizophrenia (SCZ),
and Intellectual Disability (ID). However, most studies that characterize the function of synaptic
proteins employ a prototypical synapse as a model, overlooking diversity in synaptic
composition and function. Reports suggest numerous glutamatergic synapse subtypes exist in the
brain, and that these subtypes differ in molecular composition and are defined by unique
molecular regulatory mechanisms. This study aims to (1) characterize the role of RhoGEFs
Tiam1 and Tiam2 at glutamatergic synapses in the hippocampus and (2) investigate unique
synaptic regulatory mechanisms within hippocampal subregions. Furthermore, this study (3)
identifies a structure- and function-based approach to predicting mutations that disrupt catalytic
activity of the autism risk-gene RhoGEF Trio.

Here we investigate whether the RhoGEF proteins Tiam1 and Tiam2 play a unique role in the
regulation of glutamatergic synapses in dentate granule neurons using a combination of
molecular, electrophysiological, and imaging approaches in rat entorhino-hippocampal slices of
both sexes. We find that inhibition of Tiam1 function in dentate granule neurons reduces
synaptic AMPA receptor function and causes dendritic spines to adopt an elongated filopodia-
like morphology. We also find that Tiam1’s support of perforant path-DG synapse function is
dependent on its GEF domain and identify a potential role for Tiam1’s auto-inhibitory PH-
domain in regulating Tiam1 function at these synapses. In marked contrast, reduced Tiam1
expression in CA1 pyramidal neurons produced no effect on glutamatergic synapse development.
x
We find that Tiam1’s homolog Tiam2 is essential for normal glutamatergic neurotransmission at
CA1 pyramidal neuron synapses, and that Tiam2 regulates synapse number and strength in a
DH1-domain dependent manner. Interestingly, we find that Tiam2 negatively regulates synaptic
function at dentate granule-perforant path synapses, indicating that it may be involved in
subregion-specific, non-canonical function at these synapses. Contrary to prior reports, we also
find that neither Tiam1 nor Tiam2 are essential for Long-Term Potentiation (LTP) at CA1
pyramidal neurons. Taken together, these data identify a critical role for Tiam1 and Tiam2 in the
hippocampus and reveal unique molecular programs of glutamatergic synapse regulation at CA1
pyramidal neurons and dentate granule neurons.

Glutamatergic synapse dysfunction is believed to underlie the development of Autism Spectrum
Disorder (ASD) and Intellectual Disability (ID) in many individuals. However, identification of
genetic markers that contribute to synaptic dysfunction in these individuals is notoriously
difficult. Based on genomic analysis, structural modeling, and functional data, we recently
established the involvement of the TRIO-RAC1 pathway in ASD and ID and identified a hotspot
of ASD-related missense mutations in TRIO’s catalytic GEF1 domain. ASD/ID-related missense
mutations within this domain compromise glutamatergic synapse function and likely contribute
to the development of ASD/ID. The number of ASD/ID cases with mutations identified within
TRIO’s GEF1 domain is increasing. However, tools for accurately predicting whether such
mutations are detrimental to protein function are lacking. Here we deployed advanced protein
structural modeling techniques to predict detrimental and benign mutations within TRIO’s GEF1
domain. These mutant TRIO-9 constructs were generated and expressed in CA1 pyramidal
neurons of organotypic cultured hippocampal slices. AMPA receptor-mediated postsynaptic
xi
currents were then examined in these neurons using dual whole-cell patch clamp
electrophysiology. Missense mutations in TRIO’s GEF1 domain that were predicted to disrupt
TRIO-RAC1 binding or stability greatly impaired TRIO-9’s influence on glutamatergic synapse
function. In contrast, missense mutations in TRIO’s GEF1 domain that were predicted to have no
effect on TRIO-RAC1 binding or stability did not impair TRIO-9’s influence on glutamatergic
synapse function. This study shows that a combination of structure-based computational
predictions and experimental validation can be employed to reliably predict whether missense
mutations in the human TRIO gene compromise TRIO’s role in glutamatergic synapse
regulation. With the growing accessibility of genome sequencing, the use of such tools in the
accurate identification of pathological mutations will be instrumental in early diagnostics of
ASD/ID.

1
CHAPTER 1

Tiam1 plays a critical role in glutamatergic synapse structure and function in the
hippocampus

INTRODUCTION

Glutamatergic synapse maturation and function are governed by a diverse assortment of synaptic
molecules. Of these, Rho guanine-nucleotide exchange factor (RhoGEF) proteins have been
increasingly implicated in supporting glutamatergic synapse structure and function through their
ability to catalyze actin polymerization [2-12]. However, efforts to characterize the role of
RhoGEFs and other synaptic proteins have been largely restricted to synapses between neurons
of unknown identity in dissociated neuronal preparations, or to Schaffer collateral- CA1
synapses that are used as models for all glutamatergic synapses. This reductionist approach to
studying synaptic proteins overlooks a growing body of evidence that points to the existence of
heterogenous populations of glutamatergic synapses in the brain [13-17].

Recent whole brain synaptome cartography has identified substantial divergence in molecular
composition between commonly studied CA3 to CA1 Schaffer collateral synapses and entorhinal
cortex to dentate gyrus (DG) perforant path synapses of the hippocampus [18]. Such data suggest
that pathway-specific molecular programs regulating glutamatergic synapse maturation and
function are likely to exist. In fact, little is known of the unique molecular mechanisms that may
operate within perforant path-DG synapses. This pathway serves as the primary gateway of
information flow from the cortex to the hippocampus and delivers glutamatergic input to granule
neurons of the dentate gyrus (DG granule neurons).

2
Interestingly, the RhoGEF protein Tiam1 has substantially higher transcript expression in DG
granule neurons relative to CA3 and CA1 pyramidal neurons [16, 19], predicting possible
differential influence between hippocampal subregions. Although previous reports have
implicated endogenous Tiam1 in synapse regulation [20-24] , the synaptic role of Tiam1 in
dentate granule neurons has not been explored.

In this study, we examine whether Tiam1 plays a pathway-specific role in the regulation of
synaptic transmission in the hippocampus. We use a combination of molecular, imaging and
electrophysiological techniques to compare the role of Tiam1 in perforant path-DG and Schaffer
collateral-CA1 hippocampal synapses. We find that inhibition of Tiam1 function in DG granule
neurons results in a significant and selective reduction in synaptic AMPA receptor function that
is accompanied by dendritic spines adopting an elongated and filopodial appearance. In marked
contrast, inhibition of Tiam1 in CA1 pyramidal neurons produced no detectable effect on
glutamatergic synapse development.

Previous work has suggested that Tiam1 regulates actin polymerization in dendritic spines via
activation of the small GTPase Rac1 through its GEF domain [25, 26]. However, a recent study
delineates a GEF-independent mechanism by which Tiam1 regulates neurons [27]. Here, we find
that Tiam1’s GEF/DH domain is essential for its influence on perforant path-DG synapse
development. We also find that Tiam1’s PHn-CC-Ex domain, an auto-inhibitory region that
restricts Tiam1’s GEF activity, negatively regulates Tiam1 function at DG granule synapses.
Taken together our data identify a pathway-specific and GEF-dependent role for Tiam1 in the
3
hippocampus and reveal a unique RhoGEF-mediated molecular program of glutamatergic
synapse regulation in DG granule neurons.

RESULTS

Tiam1 is required for AMPAR-mediated neurotransmission in DG granule neurons

In situ hybridization and RNA-seq data show a significantly higher level of Tiam1 mRNA
expression in the DG relative to CA1 and CA3 subregions of the hippocampus [28, 29] (DG vs.
CA1 p= 0.0014, DG vs. CA3 p=0.0013, One-way ANOVA and post-hoc Tukey HSD; Figure
1A, B; modified from Allen Brain Atlas). As expected, we observe robust Tiam1 protein
expression in Prox1 positive DG granule neurons in hippocampal slices (Figure 1C).
Figure 1. Tiam1 expression in the hippocampus is primarily in the DG granule
neurons A Hippocampal Tiam1 mRNA expression data from the Allen Mouse Brain
Atlas (scale bar: 200μm). B Tiam1 RNA sequencing data in CA1 and CA3 pyramidal
neurons and DG granule neurons from the Hipposeq RNA-seq database. **p<0.01,
One-way ANOVA with post-hoc Tukey HSD. C Immunolabeling of Prox1 and Tiam1
in DG granule neurons in hippocampal slices. GL-granule layer, ML-molecular layer.
4
To examine whether Tiam1 depletion affects
glutamatergic neurotransmission in the DG, we generated
a Tiam1 shRNA construct based on a previously validated
Tiam1 shRNA target sequence [21]. We find that this
Tiam1 shRNA construct produces a substantial reduction
of recombinant Tiam1 expression in HEK293 cells and
endogenous Tiam1 in hippocampal neurons (Figure 2A,
B). Then we biolistically transfected DG granule neurons
in rat organotypic entorhino-hippocampal slice cultures
[30, 31] with our Tiam1 shRNA. Six days after
transfection a dual whole-cell patch clamp approach was
used to simultaneously measure AMPA and NMDA
receptor-mediated evoked excitatory postsynaptic currents
(AMPAR- and NMDAR-eEPSCs) in transfected and neighboring untransfected DG granule
neurons in response to perforant pathway stimulation (Figure 3A). This simultaneous pair-wise
measurement of currents from both transfected and untransfected control neurons allows an
internally controlled test of the genetic manipulation.
Using this approach, we found that DG granule neurons expressing Tiam1 shRNA exhibited a
~50% reduction (Figure 3B; n= 12 pairs, p = 0.00049, Wilcoxon signed-rank test) in average
AMPAR-eEPSC amplitude compared to paired control neurons. A significant effect on
NMDAR-eEPSC current amplitudes was not observed (Figure 3C; n= 12 pairs, p = 0.09,
Wilcoxon signed-rank test;). Together, these data establish Tiam1 as an important regulator of
synaptic AMPAR- mediated glutamatergic neurotransmission at perforant path-DG synapses. To
Figure 2. Tiam1 shRNA reduced
Tiam1 expression in HEK293 cells
and hippocampal neurons. Western
blot showing shRNA-mediated
reduction of Tiam1 expression in
HEK293 cells (top) and hippocampal
neurons (bottom).
5
determine whether knockdown of Tiam1 in DG granule neurons alters presynaptic
neurotransmitter release we examined paired-pulse facilitation (PPF) in neurons transfected with
Tiam1 shRNA and neighboring control neurons. We observed no changes in paired-pulse
facilitation resulting from Tiam1 knockdown (Figure 4A; p= 0.216, n= 7, Student’s t-test). Thus,
the synaptic effects we observe in DG granule neurons are due to alteration of the paired-pulse
facilitation following knockdown of Tiam1 in the postsynaptic side of the synapse.

Following Tiam1 knockdown we observe a reduction in synaptic AMPAR function but not
NMDAR function. This selective reduction in AMPAR function may be caused by a reduction in
AMPARs across all functional glutamatergic synapses or arise from a subset of functional
synapses losing all their AMPARs and thus becoming “silent synapses”. To determine which of
these possibilities had occurred we first performed Coefficient of Variation analysis on AMPAR-
eEPSC current amplitudes. Coefficient of Variation analysis can be used to determine the quantal
parameters of glutamatergic transmission in control and transfected neurons. By comparing the
normalized variance in AMPAR-eEPSC amplitudes from two neurons receiving the same
stimulus, it is possible to estimate relative quantal size and quantal content [32-36]. Changes in
quantal size precisely change both the mean eEPSC and the variance such that the normalized
ratio of mean
2
/variance, also known as coefficient of variation (or CV
-2
), remains constant.
Changes in quantal size cause the marker of the mean to fall on the horizontal line seen in Figure
4B, and in the context of this preparation indicate a change in the number of glutamate receptors
at all synapses. In contrast, changes in quantal content will produce proportional changes of
equal magnitude in CV
-2
and mean eEPSC amplitudes that cause the marker of the mean to fall
on the diagonal line. Here, changes in quantal content indicate a change in the number of
synapses expressing glutamatergic receptors. We observed proportional reductions in CV
-2
and
6
mean AMPAR-eEPSC amplitude following Tiam1 knockdown in DG granule neurons (Figure
4B). This result identified a clear reduction in quantal content rather than quantal size as
responsible for the reduction of AMPAR-eEPSC amplitude we observe (Figure 4A). Such data
suggest that knocking down Tiam1 results in a reduction in the number of synapses that contain
AMPARs.
To more directly determine whether Tiam1 knockdown reduces the number of glutamatergic
synapses that contain AMPARs, we performed failure analysis of AMPAR-eEPSCs from Tiam1
knockdown neurons and neighboring control neurons (Figure 4C).

Changes in AMPAR-eEPSC failure rate are produced by alterations of the number of synapses
containing AMPARs [33, 37]. Consistent with our CV analysis we find that knocking down
Tiam1 results in a significant increase in the number of failures we observe relative to control
cells (Figure 4C; p=0.0059, n= 12, Student’s t-test).
Figure 3. Tiam1 knockdown reduces AMPAR-mediated neurotransmission in DG granule neurons A
Schematic representation of electrophysiological recording setup for DG granule neurons. B, C Scatterplots show
eEPSC amplitudes for pairs of untransfected and transfected cells (open circles) with corresponding mean ± SEM
(filled circles). (Insets) Representative current traces from control [1] and transfected (green) neurons with
stimulation artifacts removed (scale bars: 20pA for both AMPAR-eEPSCs and NMDAR-eEPSCs, 20ms for
AMPAR, 50ms for NMDAR). Barplots show average AMPAR and NMDAR-eEPSC amplitudes (±SEM) of DG
granule neurons expressing Tiam1 shRNA normalized to their respective control cell average eEPSC amplitudes.
Tiam1 shRNA expression decreases AMPAR-eEPSC amplitude in DG granule neurons (n= 12 pairs) but has no
detectable effect on NMDAR-eEPSC amplitude (n= 12 pairs). ***p<0.001, n.s. – not significant, Wilcoxon
signed-rank test.

7
Taken together, our findings strongly suggest that reducing Tiam1 expression in DG granule
neurons decreases the number of glutamatergic synapses that express AMPARs.

Figure 4. Tiam1 knockdown produces a post-synaptic
disruption in AMPAR-mediated neurotransmission A
Paired-pulse facilitation ratios (mean ± SEM) for Tiam1
shRNA expressing DG granule neurons and paired control
neurons with no detectable difference in facilitation (n= 7
pairs). n.s. – not significant Student’s t-test. Representative
scaled current traces from control and transfected (green)
neurons (scale bars: 20pA, 20ms). B Coefficient of
Variation analysis of AMPAR-eEPSCs from pairs of
control and Tiam1 shRNA expressing DG granule neurons.
CV
-2
values are plotted against corresponding ratios of
mean amplitudes within each pair (open circles) with
mean± SEM (filled circle). Red line represents “best-fit”
linear regression and grey shaded area indicates 95%
confidence interval for regression (n= 12 pairs). C Failure
analysis of AMPAR-eEPSCs from pairs of control and
Tiam1 shRNA expressing DG granule neurons with DG
granule neurons exhibiting higher failure rates than control
neurons (n = 12 pairs). **p<0.01, Wilcoxon signed-rank
test.

8
AMPAR- and NMDAR-mediated neurotransmission are normal in CA1 pyramidal neurons
following Tiam1 knockdown

Figure 5. Tiam1 knockdown does not affect AMPAR or NMDAR-mediated neurotransmission in
CA1 pyramidal neurons. A Hippocampal Tiam1 mRNA expression data from the Allen Mouse Brain
Atlas (scale bar: 200μm). Dashed blue box shows enlarged CA1 region. B Immunolabeling of Tiam1 in
CA1 pyramidal neurons (top) and DG granule neurons (bottom) in hippocampal slices. SP-Stratum
Pyramidale, SR-Stratum Radiatum, GL-granule layer, ML-molecular layer. C Schematic representation of
electrophysiological recording setup for CA1 pyramidal neurons. D, E Scatterplots show eEPSC
amplitudes for pairs of untransfected and transfected cells (open circles) with corresponding mean ± SEM
(filled circles). (Insets) Representative current traces from control [1]) and transfected (green) neurons
with stimulation artifacts removed (scale bars: 20pA for both AMPAR-eEPSCs and NMDAR-eEPSCs,
20ms for AMPAR, 50ms for NMDA). Barplots show average AMPAR and NMDAR-eEPSC amplitudes
(±SEM) of CA1 pyramidal neurons expressing Tiam1 shRNA normalized to their respective control cell
average eEPSC amplitudes. Tiam1 shRNA expression did not significantly affect AMPAR-eEPSC
amplitude (n= 9 pairs) or NMDAR-eEPSC amplitude in CA1 pyramidal neurons (n= 8 pairs). n.s. – not
significant, Wilcoxon signed-rank test.

In situ hybridization and RNA-seq data for Tiam1 shows high transcript expression levels in the
DG, but considerably lower levels in other hippocampal sub-regions (Figure 1A, B and 5A).
While we observed robust Tiam1 protein expression in DG granule neurons, Tiam1 expression in
CA1 pyramidal neurons was below the detection threshold of our antibody (Figure 5B).
Consistent with the Tiam1 mRNA and protein expression data we observed no detectable
9
differences in AMPAR- or NMDAR-eEPSC amplitudes in Tiam1 shRNA expressing CA1
pyramidal neurons following Schaffer collateral stimulation (Figure 5D, E; for AMPAR-eEPSCs
p = 0.8, n= 9 pairs; for NMDAR-eEPSC p = 0.5, n= 8 pairs, Wilcoxon signed-rank test).
Together, these data suggest that Tiam1 plays a pathway-specific role in the regulation of
glutamatergic synapse function in the hippocampus.

Loss of Tiam1 expression in DG granule neurons results in increased spine length

RhoGEF proteins have been previously implicated in glutamatergic synapse regulation.
Generally, these proteins influence synapse function through their ability to regulate actin
polymerization in dendritic spines. The actin cytoskeleton in dendritic spines plays a critical role
in determining spine morphology. Previous studies examining the function of synaptic regulatory
RhoGEFs frequently report changes in dendritic spine number and morphology due to alterations
of the synaptic actin cytoskeleton [2, 4, 24]. Tiam1 is a well-known and Rac1-specific RhoGEF
[38, 39]. Therefore, we reasoned that the reduction in AMPAR-eEPSCs we observe following
Tiam1 knockdown may stem from actin-mediated alterations of dendritic spine morphology. To
quantify and compare the effect of Tiam1 knockdown on dendritic spine morphology in CA1
pyramidal and DG granule neurons, Z-stacks of confocal images were collected, and spine-
bearing dendrites were reconstructed (Figure 6A, B, D, E). We found that knocking down Tiam1
expression in DG granule neurons had no effect on spine density (Figure 6B, C; p = 0.6 for spine
density, for GFP n = 19 segments, for Tiam1 shRNA n = 17 segments, Wilcoxon rank-sum test).
However, quantitative morphometric analysis revealed a significant increase in spine length,
largely accounted for by an increase in spine neck length in DG granule neurons relative to GFP
expressing controls (Figure 6B, C; p = 0.00024 for Spine Length, p = 0.0014 for Spine Neck
10
Length, for GFP n = 19 segments, for Tiam1 shRNA n = 17 segments, Wilcoxon rank-sum test).
Thus, Tiam1 knockdown in DG granule neurons causes spines to take on a filopodia-like
appearance. Filopodia represent immature precursors of glutamatergic synapses exhibiting
reduced AMPAR expression [40-44]. This finding is consistent with the reduction we observe in
the number of synapses expressing AMPARs following Tiam1 knockdown (Figure 4C).
Together, our data suggest that downregulation of Tiam1 function in DG granule neurons results
in the inhibition of glutamatergic synapse function by impeding synaptic maturation. In marked
contrast to DG granule neurons and consistent with our electrophysiological results, we found no
significant differences in any spine parameters in Tiam1 shRNA expressing CA1 pyramidal
neurons (Figure 6E, F; p = 0.26 for Spine Length, p = 0.55 for Spine Neck Length, p = 0.17 for
Head Volume, p = 0.7 for Spine Density, for GFP n = 12 segments, for Tiam1 shRNA n = 25
segments, Wilcoxon rank-sum test;).

11

Figure 6. Tiam1 knockdown increases dendritic spine length in DG granule neurons but not in
CA1 pyramidal neurons. A, D Schematic representation of areas of image acquisition from DG
granule neuron dendrites and apical CA1 pyramidal neuron dendrites respectively. B, E
Representative dendritic segments, and corresponding reconstructed filaments from GFP and Tiam1
shRNA expressing DG granule neurons and CA1 pyramidal neurons (scale bars: 4μm). C, F Boxplots
show significant differences in Spine Length and Spine Neck Length in DG granule neurons
expressing Tiam1 shRNA (colored boxes) compared to GFP expressing control neurons (grey boxes)
(p = 0.00024 for Spine Length, p = 0.0014 for Spine Neck Length, for GFP n = 19 segments, for
Tiam1 shRNA n = 17 segments), no significant differences in Head Volume or Spine Density were
detected (p = 0.9 for Head Volume, p = 0.6 for Spine Density, for GFP n = 19 segments, for Tiam1
shRNA n = 17 segments). No significant differences were detected in any spine parameters in Tiam1
shRNA expressing spines in CA1 pyramidal neurons compared to corresponding GFP expressing
control neurons (for GFP n = 12 segments, for Tiam1 shRNA n = 25 segments, p = 0.26 for Spine
Length, p = 0.55 for Spine Neck Length, p = 0.17 for Head Volume, p = 0.7 for Spine Density,
Wilcoxon rank-sum test) ***p<0.001, **p<0.01, n.s. - not significant, Wilcoxon rank-sum test.
12

Figure 7. Full-length Tiam1 but not Tiam1 ∆DH expression rescues Tiam1
shRNA mediated effects on glutamatergic synapses of DG granule neurons. A, B
Scatterplots with AMPAR- and NMDAR-eEPSC amplitudes for DG granule neurons
co-expressing Tiam1 shRNA and Tiam1 ∆DH, respectively plotted against paired
control neuron eEPSCs (open circles) with corresponding mean ± SEM (filled circles).
Barplots show average AMPAR and NMDAR-eEPSC amplitudes (±SEM) of DG
granule neurons expressing Tiam1 shRNA (grey bars) and DG granule neurons co-
expressing Tiam1 shRNA, Tiam1 cDNA (yellow bars) and Tiam1 ∆DH (blue bars)
normalized to respective control cell average eEPSC amplitudes (black bar).
***p<0.001, *p<0.05, Wilcoxon signed-rank test. A Tiam1 cDNA expression restores
AMPAR-eEPSC amplitude in DG granule neurons co-expressing Tiam1 shRNA (n=
10 pairs) (Inset) Representative current traces from control and transfected (yellow)
neurons stimulation artifacts removed (scale bars: 20pA for AMPA, 20ms for
AMPA). B Tiam1 ∆DH expression does not restore AMPAR-eEPSC (p= 0.02148, n=
13 pairs, Wilcoxon signed-rank test) and has no significant effect on NMDAR-eEPSC
amplitudes in DG granule neurons co-expressing Tiam1 shRNA (p=0.47, n= 7,
Wilcoxon signed-rank test) (Insets) Representative current traces from control [1] and
transfected (blue) neurons (scale bars: 20pA, 20ms for AMPAR-eEPSCs). C Average
AMPAR and NMDAR-eEPSC amplitudes (±SEM) of DG granule neurons expressing
Tiam1 shRNA (grey bar) and DG granule neurons co-expressing Tiam1 shRNA,
Tiam1 (yellow bar) and Tiam1 ∆DH normalized to respective control cell average
eEPSC amplitudes (black bar). ***p<0.001, *<0.05, Wilcoxon signed-rank test. D
Western blot showing Tiam1 ∆DH is expressed in HEK293 cells. E Representative
dendritic segments and corresponding reconstructed filaments from control neurons
expressing GFP and Tiam1 and Tiam1 shRNA expressing DG granule neurons (scale
bars: 4μm). F Boxplots show no detectable differences in any spine parameters in DG
granule neurons co-expressing Tiam1 and Tiam1 shRNA (colored boxes) compared to
GFP expressing control neurons (grey boxes). (p = 1 for Spine Length, p = 0.96 for
Spine Neck Length, p = 0.60 for Head Volume, p = 0.14 for Spine Density, for GFP n
= 28 segments, for Tiam1 rescue n = 29 segments). n.s. - not significant, Wilcoxon
rank-sum test.

13
To confirm that the effects we observe on glutamatergic synapses in DG granule neurons are due
to the specific knockdown of Tiam1, we co-expressed Tiam1 shRNA with a shRNA-resistant
form of Tiam1 in DG granule neurons. We then performed paired recordings with DG granule
neurons co-expressing the Tiam1 shRNA and shRNA-resistant Tiam1. We found that AMPAR-
eEPSC amplitude in these neurons was restored to wild type levels (Figure 7 A, C; n= 10 pairs, p
= 0.56, Wilcoxon signed-rank test). We then examined whether shRNA-resistant Tiam1
expression rescues the filopodia-like spine morphology observed with Tiam1 knockdown.
Analysis of dendritic segments from DG granule neurons co-expressing Tiam1 shRNA and
shRNA-resistant Tiam1 revealed no detectable differences in spine density or morphology
compared to GFP expressing controls (Figure 7 E, F; p = 1 for Spine Length, p = 0.96 for Spine
Neck Length, p = 0.60 for Head Volume, p = 0.14 for Spine Density, for GFP n = 28 segments,
for Tiam1 rescue n = 29 segments, Wilcoxon rank-sum test). From these results, we conclude
that the synaptic phenotypes observed in DG granule neurons following Tiam1 knockdown result
from the targeted depletion of Tiam1.
Generally, RhoGEFs are believed to regulate synaptic function through their influence on the
actin cytoskeleton. RhoGEF proteins promote actin polymerization by activating small GTPases
through their GEF domains. However, a GEF-independent role for Tiam1 in neurons was
recently reported (Tang et al. 2019). Does the ability of Tiam1 to support glutamatergic synapse
function in DG granule neurons depend on its ability to activate small GTPases? To answer this
question, we generated a shRNA-resistant Tiam1 construct lacking the DH domain (Tiam1
DH). This domain alone binds directly to the small GTPase Rac1 and is required for Tiam1’s
ability to activate Rac1 and influence the actin cytoskeleton [45-47].

14

When expressed in heterologous cells, we find that our Tiam1 DH construct produces levels of
protein expression that are comparable to our wild type Tiam1 construct (Figure 7D). We then
examined whether Tiam1 DH rescues the Tiam1 knockdown phenotype. When Tiam1 shRNA
and Tiam1 DH were co-expressed in DG granule neurons we found that AMPAR-eEPSC
amplitude was reduced to a degree very similar to that observed in DG granule neurons
transfected with the Tiam1 shRNA alone (Figure 7B, C; p=0.02148, n= 13, Wilcoxon signed-
rank test). Together, our data demonstrates that the region necessary for Tiam1-mediated small
Figure 8. Tiam1 ∆PHCCEx expression increases AMPAR-eEPSC mediated neurotransmission in DG
granule neurons. A Illustration of Tiam1’s protein domains; full length Tiam1 (upper) and Tiam1 ∆PHn-
CC-Ex (lower) B, D Scatterplots with AMPAR-eEPSC amplitudes for DG granule neurons expressing
Tiam1 plotted against paired control neuron eEPSC (open circles) with corresponding mean ± SEM (filled
circles). (Insets) Representative current traces from control and transfected (blue for Tiam1 OE, vermillion
for Tiam1 ∆PHn-CC-Ex) neurons with stimulation artifacts removed (scale bars: 20pA for both AMPAR-
eEPSCs and NMDAR-eEPSCs, 20ms for AMPAR-eEPSCs, 50ms for NMDA). B Tiam1 OE produces no
detectable differences in AMPA-eEPSC amplitude (p =0.67, n= 9 pairs); Tiam1 ∆PHCCEx expression
increases AMPAR-eEPSC amplitude (p=0.04, n= 12 pairs) D NMDAR-eEPSC amplitudes were not
significantly affected in Tiam1 or Tiam1 ∆PHn-CC-Ex expressing neurons and paired controls (p =0.38, n=
7 pairs for Tiam1 OE; p =0.50, n= 8 pairs for Tiam1 ∆PHCCEx) C, E Bar plots of average AMPAR and
NMDAR-eEPSC amplitudes (±SEM) of DG granule neurons overexpressing Tiam1 (blue for Tiam1 OE,
vermillion for Tiam1 ∆PHCCEx OE) respective control cell average eEPSC amplitudes (Levine et al.).
Wilcoxon signed-rank test was used to compare across independent conditions. *p<0.05, n.s. - not
significant, Wilcoxon signed-rank test

15
GTPase activation is required for Tiam1’s influence on glutamatergic synapse function in DG
granule neurons.
Tiam1’s PHn-CC-Ex domain negatively regulates Tiam1 function at DG granule synapses

It has been previously shown that increasing the expression levels of synaptic regulatory
RhoGEFs (i.e. Kalirin-7 and Trio-9) in CA1 pyramidal neurons produces synaptic activity-
dependent increases in the strength of glutamatergic neurotransmission [4]. Such effects have
been used as evidence supporting the role of these RhoGEF proteins in bidirectional regulation
of synaptic strength. In contrast to Kalirin-7 and Trio-9, overexpression of Tiam1 in CA1
pyramidal neurons was found to have no effect on AMPAR- or NMDAR-eEPSC amplitude [4].
Given that endogenous Tiam1 plays a synaptic regulatory role in DG granule neurons, we were
interested in whether increasing Tiam1 expression and presumably function in DG granule
neurons might lead to the strengthening of glutamatergic neurotransmission. To answer this
question, we overexpressed wild type Tiam1 (Figure 8A) in DG granule neurons for six days
before recording AMPAR- and NMDAR-eEPSC in these neurons. We found wild type Tiam1
overexpression produced no change in AMPAR- or NMDAR-eEPSC amplitudes (Figure 8B-E;
for AMPAR-eEPSCs p =0.22, n= 14 pairs; for NMDAR-eEPSCs, p =0.38, n= 7 pairs, Wilcoxon
signed-rank test). Unlike Kalirin and Trio, Tiam1 contains a PHn –CC-Ex domain (Figure 8A). It
was recently shown that Tiam1’s GEF activity is auto-inhibited by this PHn –CC-Ex domain [48,
49]. We wondered whether removing the PHn –CC-Ex domain from Tiam1 would allow Tiam1
overexpression to increase AMPAR-mediated neurotransmission at performant path-DG
synapses. To answer this question, we generated a Tiam1 construct lacking the PHn –CC-Ex
domain (Tiam1 ∆PHCCEx, Figure 8A), and expressed this construct in dentate granule neurons
of entorhino-hippocampal slices for six days. In marked contrast to wild type Tiam1,
16
overexpression of Tiam1 ∆PHCCEx in DG granule neurons produced a 70% increase in
AMPAR-eEPSC amplitude (Figure 8B, C; p =0.04, n= 12 pairs, Wilcoxon signed-rank test). No
effect of Tiam1 ∆PHCCEx overexpression on NMDAR-eEPSC amplitude was observed (Figure
8 D-E; p =0.50, n= 8 pairs, Wilcoxon signed-rank test). Such data suggest that Tiam1’s PH n-CC-
Ex domain exerts a negative influence on Tiam1 function at DG granule neuron synapses and
potentially reveal a mechanism by which synaptic Tiam1 function is dynamically regulated.

DISCUSSION

Previous studies have relied on dissociated hippocampal neurons to characterize the role of
endogenous Tiam1 in glutamatergic synapse development [20-23]. In these preparations,
glutamatergic synapses form between neurons of uncertain identity. Thus, the role of Tiam1 in
synaptic maturation at naturally occurring glutamatergic synapses is unknown. In situ studies
suggest Tiam1 expression is enriched in granule neurons in the dentate gyrus [29], suggesting
that Tiam1 regulation of glutamatergic neurotransmission may be most relevant at perforant
path-DG synapses in the hippocampus. In the present study, we find that inhibition of Tiam1
function in DG granule neurons results in a significant reduction in glutamatergic synapse
function. In marked contrast to dentate granule neurons, Tiam1 expression appears to be very
low in CA1 pyramidal neurons. Consistent with Tiam1 mRNA and protein expression data, we
find that knocking down Tiam1 in CA1 pyramidal neurons has no impact on baseline
glutamatergic neurotransmission at Schaffer collateral-CA1 synapses. Together, these results
strongly support a pathway-specific role for Tiam1 in glutamatergic synapse regulation in the
hippocampus. Going forward it will be interesting to determine whether Tiam1 differentially
supports medial and lateral perforant pathway function in the dentate gyrus and whether
glutamatergic pathways in other brain regions are regulated by Tiam1.
17
In addition to a reduction in synaptic AMPAR function, we found that knocking down Tiam1
expression in DG granule neurons resulted in the elongation of dendritic spines. This alteration
of spine morphology was not observed following Tiam1 shRNA expression in CA1 pyramidal
neurons. Tiam1 promotes Rac1 activation [21]. Rac1 activity is thought to be critical for the
maturation of glutamatergic synapses, resulting in the conversion of immature elongated
filopodia into shorter more mature spines [50-52]. The elongated dendritic protrusions we
observe following the reduction of Tiam1 function are consistent with descriptions of immature
filopodial spines, suggesting that inhibition of Tiam1 function results in the inhibition of
glutamatergic synapse maturation. Filopodia-like spines are proposed to be the structural
correlates of NMDAR-expressing but AMPAR-lacking “silent” synapses that mature through the
synaptic insertion of AMPARs [40-44]. Consistent with this idea, we performed Coefficient of
Variation and failure analysis on AMPAR-eEPSCs from Tiam1 shRNA expressing neurons and
found that reductions in AMPAR-eEPSC amplitude in these neurons result from a decrease in
the number of synapses expressing AMPA receptors. Inhibition of Tiam1 function in DG granule
neurons did not affect presynaptic neurotransmitter release or NMDAR-eEPSC amplitude.
Together these data strongly suggest that inhibition of Tiam1 function increases the number of
silent synapses of DG granule neurons and are consistent with our morphological data supporting
a role for Tiam1 in perforant path-DG synapse maturation. It will now be important to identify
which Tiam1-dependent synaptic regulatory pathways are required for normal glutamatergic
synapse maturation in DG granule neurons. It will be particularly interesting to examine the role
of Tiam1 in glutamatergic synapse plasticity. While the present study was under review, a study
was published where Tiam1 knockdown was shown to inhibit structural long-term potentiation
(sLTP) in CA1 pyramidal neurons [53]. Surprisingly, this finding suggests that Tiam1 plays an
18
important role in activity dependent structural changes of synapses in CA1 pyramidal neurons
despite very low expression in these cells. The outcome of future studies comparing and
contrasting Tiam1’s role in functional LTP in dentate granule and CA1 pyramidal neurons will
be of great interest.
Generally, Tiam1’s influence is thought to be through GEF domain-mediated regulation of the
actin cytoskeleton. Tiam1’s GEF domain activates the small GTPase Rac1 which ultimately
promotes actin polymerization. However, it was recently reported that Tiam1 is able to influence
neuronal morphology through a GEF-independent mechanism [27]. To determine whether the
GEF domain is required for Tiam1’s influence on glutamatergic synapse function in the dentate
gyrus, we engineered a mutant form of Tiam1 lacking its GEF/DH domain (Tiam1 DH). This
mutation eliminates the entire binding site for Rac1 [45] and thus represents a truly “GEF-dead”
form of Tiam1. Despite exhibiting a level of expression comparable to wild -type Tiam1, we
found that Tiam1 DH cannot rescue the synaptic phenotype produced by knocking down Tiam1
expression. Thus, Tiam1’s support of synaptic function in dentate granule neurons is dependent
on an intact GEF domain. The most cogent explanation for this observation is that Tiam1’s
support of perforant path-DG synapse function is dependent on Tiam1’s ability to activate small
GTPases like Rac1. However, we acknowledge that we cannot rule out alternative explanations
such as protein misfolding or improper trafficking that might be produced by deleting the
GEF/DH domain.

Previously, overexpression of synaptic regulatory RhoGEF proteins in CA1 pyramidal neurons
was shown to result in a significant increase in synaptic AMPAR function [4]. Overexpression of
Tiam1 in CA1 pyramidal neurons, on the other hand, was found to have no impact on Schaffer
19
collateral-CA1 synapse function. Here, we overexpressed Tiam1 in DG granule neurons to
determine whether elevated Tiam1 function can augment the strength of perforant path-DG
neurotransmission. We found that the function of these synapses was also unaffected by Tiam1
overexpression. One explanation as to why Tiam1 overexpression fails to increase glutamatergic
neurotransmission in DG granule neurons is that Tiam1 may exist in an inactive state in neurons
and require additional molecular mechanisms for activation [54-57]. In this case, a rate-limiting
molecular mechanism may exist within neurons preventing excess Tiam1 function at synapses
following overexpression. Previous in vitro studies have shown Tiam1’s PHn-CC-Ex domain
can negatively regulate Tiam1 GEF-activity, suggesting that this domain is auto-inhibitory (Xu
et al., 2017). Consistent with this idea, we found that the expression of a Tiam1 mutant lacking
the conserved PHn-CC-Ex domain produced an increase in AMPAR-eEPSC amplitude. Our data
suggests a potential role of the PHn-CC-Ex in auto-inhibition of Tiam1 and reveals a possible
regulatory mechanism that permits Tiam1-mediated increases in glutamatergic synapse strength.

Recent evidence suggests that glutamatergic synapses exhibit remarkable molecular diversity in
the brain, with commonly studied Schaffer collateral-CA1 synapses differing substantially from
perforant path-DG synapses of the hippocampus. However, we know very little about the unique
regulatory mechanisms that exist at perforant path-DG synapses. The present study demonstrates
that perforant path-DG synapses are under the control of a RhoGEF-mediated molecular program
that is distinct from Schaffer collateral-CA1 glutamatergic synapses in the hippocampus. Going
forward, it will be interesting to determine whether various RhoGEF proteins are a part of a
unique complement of synaptic proteins that are specific to different glutamatergic synapse
subtypes. Moreover, differential expression of RhoGEF proteins may define distinct molecular
20
and functional glutamatergic synapse subtypes in the brain. RhoGEF proteins seem particularly
well suited for this task. The RhoGEF protein family has many members that exhibit
considerable variability outside of their GTPase activation (GEF) domains, suggesting unique
molecular regulatory mechanisms are likely to govern the function of specific RhoGEF proteins
[58]. In future studies, it may be useful to look to specific RhoGEF proteins as potential targets
for treating brain-related disorders that stem from glutamatergic synapse dysfunction in specific
regions of the brain.

21
CHAPTER 2
Tiam2 is a subregion-specific regulator of glutamatergic synapse development and
function in the hippocampus
INTRODUCTION
Studies have revealed variety of glutamatergic cell types in the brain (Zeng and Sanes, 2017).
Recent large-scale transcriptome and proteome analyses have uncovered heterogeneity in the
molecular composition of glutamatergic synapses in the brain, with each class of synapses
expressing a specific complement of proteins [17, 18, 59-62]. RhoGEFs are one such family of
molecules that are increasingly implicated in the development and function of glutamatergic
synapses [7, 8, 26, 63]. Despite the multitude of RhoGEFs and their distinct patterns of
expression, efforts to characterize their function have typically been limited to dissociated
neurons of heterogenous origin [22, 24, 64-69]. We previously characterized the RhoGEF Tiam1
in an intact hippocampal preparation and showed that is critical for the structure and function of
glutamatergic synapses at perforant-path-dentate granule (DG) neuron synapses [70].
Tiam1 and its homolog, Tiam2, are multi-domain proteins that contain the catalytic DH1-domain
and regulate the small GTPase Rac1 and subsequent GDP-GTP exchanges that drive actin
polymerization [71-73]. This Rac1-mediated regulatory pathway has been widely implicated
atypical glutamatergic synapse development and suggested as a critical element in the
neuropathology of Autism-spectrum disorders. However, Tiam1 and Tiam2 have significant
amino acid sequence variations in their PDZ domains that confer distinct ligand specificities in
vitro, suggesting that the two proteins may have divergent functions in vivo [74, 75]. Tiam1 is
known to be involved in neuronal migration, neurite outgrowth, axon guidance and
22
synaptogenesis [19, 64, 76]. While our previous study identified Tiam1 as essential for synapse
formation and baseline neurotransmission at DG granule neurons, in CA1 pyramidal neurons we
found very low Tiam1 protein expression and no effect on synaptic structure or function. In
marked contrast, significantly less is known about the function of Tiam2 in neurons. Previous
reports have characterized Tiam2’s role in cell migration, neurite extension in vitro and the
development of serotonergic neurons in vivo [77-80].
Here, we find that Tiam2 protein is widely expressed in CA1 pyramidal neurons of the
hippocampus. We find that knocking down Tiam2 in CA1 pyramidal neurons significantly
reduces AMPA receptor (AMPAR) and NMDA receptor (NMDAR) mediated
neurotransmission. Our data indicates that unlike Tiam1, Tiam2 is critical for normal
glutamatergic neurotransmission at CA1 pyramidal neuron synapses. In addition, we find that the
loss in AMPAR and NMDAR neurotransmission in CA1 pyramidal neurons arising from Tiam2
knockdown results from a loss in dendritic spines. In our experiments, we also show that the
function of Tiam2 in CA1 pyramidal neurons is DH1-domain dependent. To our knowledge, this
is the first evidence of Tiam2’s role in regulating the development of glutamatergic synapses.
While endogenous Tiam1 is not involved in baseline neurotransmission in CA1 pyramidal
neurons, we find that Tiam1 expression can readily substitute for Tiam2 in regulating the
function of these neurons. Previously characterized RhoGEFs. Kalirin and Trio are necessary for
the normal expression of long-term potentiation in CA1 pyramidal neurons [81]. Some reports
have suggested a role for Tiam1 in neuronal plasticity [82, 83]. Contrary to these reports, we
found neither inhibition of Tiam1 nor Tiam2 has an adverse effect on Long-Term Potentiation
(LTP) in CA1 pyramidal neurons. In summary, we find that Tiam2 is a RhoGEF that is critical
for normal glutamatergic neurotransmission at CA1 pyramidal neuron synapses. Taken together,
23
we provide evidence to support a subregion-specific role for the RhoGEFs Tiam1 and Tiam2 in
the hippocampus.
The hippocampus is a non-uniform structure possessing functionally distinct regions, with non-
linear and asynchronous postnatal development of subregions [84]. Recent studies report the
molecular diversity of glutamatergic synapses and found distinct and segregated expression
patterns for synapse regulatory proteins in the hippocampus, that are likely related to specific
functions [17, 18, 60, 62]. Consistent with these reports, we found that Tiam2 was critical for
glutamatergic synapse function in CA1 pyramidal neurons in the hippocampus, while we have
previously demonstrated that Tiam1 is not. We also found that unlike previous reports that
suggested a role for Tiam1 in synapse plasticity, we could not detect a role for Tiam1 in neuronal
plasticity. The data from this study, taken together with our previous findings point to the
expression of specific cohorts of synapse regulatory proteins such as RhoGEFs, as critical for
normal function in specific subregions of the hippocampus.

RESULTS

Tiam2 knockdown produces significant reduction in AMPAR and NMDAR baseline
neurotransmission but has no effect on long-term potentiation in CA1 pyramidal neurons
Our experiments with Tiam1 demonstrated negligible Tiam1 protein expression in CA1
pyramidal neurons [70]. Since Tiam2 is a homolog of Tiam1, and our initial effort was to
evaluate the expression of Tiam2 in CA1 pyramidal neurons. We used an antibody in rat
hippocampal slices to detect Tiam2 protein and found robust Tiam2 expression in CA1
24
pyramidal neurons (Figure 9A, inset). This finding was consistent with reports of Tiam2
transcript expression reported in CA1 pyramidal neurons [72]. To determine whether the Tiam2
expression is linked to glutamatergic neurotransmission in CA1 pyramidal neurons, we depleted
Tiam2 protein expression in these neurons. We did this by utilizing a shRNA that effectively
depletes Tiam2 protein expression in dissociated hippocampal neurons (Figure 9B) and
biolistically transfecting rat hippocampal slices with the shRNA construct. We then performed
paired recording experiments from transfected and untransfected CA1 pyramidal neurons and
measured AMPAR- and NMDAR-eEPSCs amplitudes (Figure 9C). Our data revealed a
substantial ~50% and ~40% reduction in AMPAR-eEPSCs and in NMDAR-eEPSCs amplitudes
respectively (Figure 9D and E, for AMPAR-eEPSCs p = 0.04, n= 10 pairs; for NMDAR-eEPSC
p = 0.03, n= 8 pairs, Wilcoxon signed-rank test). This finding was in striking contrast to our
observations in CA1 pyramidal neurons where we knocked-down Tiam1 and observed no
significant effect on either AMPAR- or NMDAR-eEPSC amplitudes in CA1 pyramidal neurons
[70].
Previously characterized Rho-GEFs Trio and Kalirin were implicated not only in baseline
neurotransmission but were also found to be critical for long-term potentiation at glutamatergic
synapses. Given the effects of knocking down Tiam2 on baseline glutamatergic transmission, we
were interested in whether Tiam2 plays a role in long-term potentiation in CA1 pyramidal
neurons. We induced the expression of Tiam2 shRNA in the rat hippocampus via in utero
electroporation in embryonic day 15 (E15) mice, and then prepared acute hippocampal slices
from postnatal 18-25 mouse pups. We measured baseline AMPAR-eEPSCs from CA1 pyramidal
neurons, and then induced LTP using a previously described protocol. We found that the
25

Figure 9. Tiam2 knockdown reduces AMPAR- and NMDAR-mediated baseline
neurotransmission but does not impact Long-Term Potentiation in CA1 pyramidal neurons. A
Hippocampal Tiam2 immunolabelling in whole hippocampal slice (scale bar: 200μm). GL-granule
layer, ML-molecular layer. B Western blot showing shRNA-mediated reduction of Tiam2 expression
in dissociated hippocampal neurons. C Schematic representation of electrophysiological recording
setup for CA1 pyramidal neurons. D, E Scatterplots show eEPSC amplitudes for pairs of untransfected
and transfected cells (open circles) with corresponding mean ± SEM (filled circles). (Insets)
Representative current traces from control (black) and transfected (yellow) neurons with stimulation
artifacts removed (scale bars: 20pA for both AMPAR-eEPSCs and NMDAR-eEPSCs, 20ms for
AMPAR, 50ms for NMDAR). Barplots show average AMPAR and NMDAR-eEPSC amplitudes
(±SEM) of CA1 pyramidal neurons expressing Tiam2 shRNA normalized to their respective control
cell average eEPSC amplitudes. Tiam2 shRNA expression decreases AMPAR-eEPSC and NMDAR-
eEPSC amplitude in CA1 pyramidal neurons (n= 10 pairs for AMPAR-eEPSC, n= 6 pairs for
NMDAR-eEPSC). *p<0.05, Wilcoxon signed-rank test.
26
induction protocol produced no significant difference in potentiation between wild-type and
Tiam2 shRNA- expressing CA1 pyramidal neurons (Figure 9F), indicating that Tiam2 does not
play a role in long-term potentiation of CA1 pyramidal synapses.

Tiam2 knockdown produces a post-synaptic loss of dendritic spines in CA1 pyramidal neurons
To examine whether the impact on glutamatergic neurotransmission resulting from Tiam2
knockdown was the result of either a pre- or post-synaptic alteration, we performed a paired-
pulse facilitation analysis. If the knocking down Tiam2 had any impact on the dynamics of pre-
synaptic release of neurotransmitter, then the consecutive stimulation of Schaffer-collateral
afferents would interfere with the facilitated release of neurotransmitter and the corresponding
increase in AMPAR-eEPSC amplitude recorded in post-synaptic neuron. We found that the loss
of Tiam2 protein expression in CA1 pyramidal neurons had no effect on paired-pulse facilitation
resulting from the stimulation of Schaffer-collateral afferents (Figure10A; p = 0.9, n= 5,
Student’s t-test). This indicates that the pre-synaptic mechanisms involved in glutamatergic
neurotransmission are unperturbed by Tiam2 knockdown, and the Tiam2 impact of Tiam2
knockdown on neurotransmission is postsynaptic. The reduction in AMPAR- and NMDAR-
eEPSCs and the post-synaptic localization of the effect suggests that the loss of Tiam2 protein
expression may result in the alteration of either quantal size or quantal content. To investigate
both possibilities, we performed Coefficient of Variation (CV) analysis. We found that the
average data points corresponding to Ratio of CV
-2
and Ratio of Mean Amplitude for both
AMPAR and NMDAR excitatory currents fell on or above the diagonal (Figure 10B and C),
indicating that the loss in in current amplitudes can be attributed to a change in quantal size.
27
Taken together these data suggest that Tiam2 knockdown in CA1 pyramidal neurons results in
the loss of synapses.
Like Tiam1 and Trio, Tiam2 catalyzes Rac1 activation, which mediates actin assembly. Since the
modulation of actin is essential to the formation and maturation of dendrite spines in
glutamatergic neurons, we hypothesized that knocking down Tiam2 expression will produce an
alteration in dendritic spine development. To test this, we biolistically transfected organotypic
hippocampal slices with a construct expressing Tiam2 shRNA and recombinant GFP. For control
neurons, we transfected neurons with GFP alone. We identified transfected neurons and imaged
dendrites from both wild-type and control neurons and analyzed several spine parameters (Figure
2A). We found a severe loss in spine number in CA1 pyramidal neurons expressing Tiam2
shRNA relative to control (Figure 10D, E, for spine density p = 0.00004; for spine head volume
p = 0.05, for spine neck length = 0.07, for spine length= 0.22; n= 9 filaments Wilcoxon rank-sum
test), and a significant increase in spine head volume in neurons with reduced Tiam2 expression.
Spine neck length and overall spine length remained unchanged between the groups (Figure
10F). This depletion in spine density is consistent with our CV
-2
analysis that indicates a post-
synaptic loss of quantal size. Taken together, these data clearly demonstrate that the loss of
AMPAR and NMDAR neurotransmission resulting from reduction in Tiam2 expression in CA1
pyramidal neurons is accompanied by a depletion in the number of glutamatergic spines.

28

Figure 10. Tiam2shRNA expression results in loss of spine density in CA1 pyramidal
neurons. A Paired-pulse facilitation ratio (mean ± SEM) for Tiam2 shRNA expressing CA1
pyramidal neurons and paired control neurons with no detectable difference in facilitation (n= 5
pairs). n.s. – not significant Student’s t-test. Representative scaled current traces from control
and transfected (green) neurons (scale bars: 20pA, 20ms). B, C Coefficient of Variation analysis
of AMPAR- and NMDAR-eEPSCs from pairs of control and Tiam2 shRNA expressing CA1
pyramidal neurons. CV
-2
values are plotted against corresponding ratios of mean amplitudes
within each pair (open circles) with mean± SEM (filled circle) (for AMPAR-eEPSCs, n= 10
pairs; for NMDAR-eEPSC, n= 8 pairs,). D. Schematic representation of areas of image
acquisition from CA1 pyramidal neuron dendrites respectively. E. Representative dendritic
segments and corresponding reconstructed filaments from GFP and Tiam1 shRNA expressing
DG granule neurons and CA1 pyramidal neurons (scale cars: 10µm). F. Boxplots show
significant differences in Spine Density and Spine Head Volume in CA1 pyramidal neurons
expressing Tiam2 shRNA (green boxes) compared to GFP expressing control neurons (grey
boxes) (p = 0.00004 for Spine Density, p = 0.05 for Spine Head Volume, p= 0.22 for Spine
Length, p= 0.07 for Spine Neck Length, for GFP n = 9 segments, for Tiam2 shRNA n = 9
segments, Wilcoxon rank-sum test). ***p<0.001, **p<0.01, n.s. - not significant, Wilcoxon
signed-rank test.
29

Tiam2 has a DH-dependent role in neurotransmission in CA1 pyramidal neurons
Our results establish a role for Tiam2 in glutamatergic neurotransmission in CA1 pyramidal
neurons. Tiam2, is a multi-domain RhoGEF. The catalytic DH1 domain is common to all
RhoGEFs and is responsible for mediating actin polymerization via Rac1. Before we tested
Tiam2’s DH1 domain-dependent small GTPase activity in CA1 pyramidal neurons, we wanted
to verify that the reduction in AMPAR- and NMDAR function was in fact due to the loss of
Tiam2 expression.
To test this, we co-expressed Tiam2 shRNA and a recombinant shRNA resistant form of Tiam2
in CA1 pyramidal neurons and recorded AMPAR- and NMDAR-eEPSCs. We found that
AMPAR- and NMDAR-eEPSCs were indistinguishable between control and transfected
neurons, that shRNA resistant Tiam2 was sufficient to rescue the phenotype we observed from
Tiam2 knockdown (Figure 11C, D; for AMPAR-eEPSCs p = 0.4, n = 9 pairs; for NMDAR-
eEPSC p = 0.2, n = 8 pairs, Wilcoxon signed-rank test). This supports our conclusion that the
shRNA against Tiam2 was specific for endogenous Tiam2, and the loss-of-function phenotype
we observed was a result of knocking down endogenous Tiam2 expression.
In previous work from our lab, we found the DH1 domain-dependent Rac1 activation was
critical to the function of Rho-GEFs Trio and Tiam1 in the hippocampus. To examine the role of
the DH-domain in Tiam2’s function in CA1 pyramidal neuron synapses, we designed a DH-
domain lacking construct (Figure 11A), Tiam2 ∆DH and co-expressed recombinant Tiam2 ∆DH
with Tiam2 shRNA in HEK cells to demonstrate that the Tiam2 ∆DH construct is expressed at
levels similar to shRNA-resistant Tiam2. Then, we recorded AMPAR- and NMDAR-eEPSCs
30
and found that Tiam2 ∆DH did not recapitulate the rescue phenotype we observed with full-
length Tiam2. We found that CA1 pyramidal neurons expressing Tiam2 ∆DH and Tiam2 shRNA
showed a ~60% and ~40% reduction in AMPAR- and NMDAR-eEPSCs amplitudes respectively
(Figure 11H, I for AMPAR-eEPSCs p = 0.015, n= 8 pairs; for NMDAR-eEPSC p = 0.015, n= 7
pairs, Wilcoxon signed-rank test). These data clearly demonstrate that the DH domain is
necessary and critical to Tiam2’s function at glutamatergic synapses in the hippocampus. Taken
together, our data show that the shRNA-mediated knock down in CA1 pyramidal neurons is
specific to the target gene Tiam2, and that function of this small GTPase in glutamatergic
synapses in dependent on its DH1-domain.

31

Figure 11. Full-length Tiam2 but not Tiam2 ∆DH expression rescues Tiam2 shRNA mediated
effects on glutamatergic synapses of CA1 pyramidal neurons. A. Illustration of Tiam2’s protein
domains; full length Tiam2 (upper) and Tiam1 ∆DH (lower) B Western blot of shRNA-resistant
Tiam2 and Tiam2 ∆DH co-expressed with Tiam2 shRNA C, D, H, I Scatterplots with AMPAR- and
NMDAR-eEPSC amplitudes for DG granule neurons co-expressing Tiam2 shRNA and Tiam2 ∆DH,
respectively plotted against paired control neuron eEPSCs (open circles) with corresponding mean
± SEM (filled circles). Barplots show average AMPAR and NMDAR-eEPSC amplitudes (±SEM) of
CA1 pyramidal neurons expressing Tiam2 shRNA (grey bars) and CA1 pyramidal neurons co-
expressing Tiam2 shRNA, Tiam2 cDNA (green bars) and Tiam2 ∆DH (orange bars) normalized to
respective control cell average eEPSC amplitudes (black bar). ***p<0.001, *p<0.05, Wilcoxon
signed-rank test. C, D Tiam2 cDNA expression restores AMPAR- and NMDAR-eEPSC amplitude in
32
CA1 pyramidal neurons co-expressing Tiam2 shRNA (for AMPAR-eEPSCs p = 0.4, n = 9 pairs; for
NMDAR-eEPSC p = 0.2, n = 8 pairs) (Inset) Representative current traces from control (black) and
transfected (green) neurons stimulation artifacts removed (scale bars: 20pA for AMPA, 20ms for
AMPA). H, I Tiam1 ∆DH expression does not restore AMPAR-eEPSC or NMDAR-eEPSCs
amplitudes (p= 0.02148, n= 13 pairs, Wilcoxon signed-rank test) in CA1 pyramidal neurons co-
expressing Tiam2 shRNA (for AMPAR-eEPSCs p = 0.016, n = 8 pairs; for NMDAR-eEPSC p =
0.016, n = 7 pairs) (Insets) Representative current traces from control (black) and transfected (orange)
neurons (scale bars: 20pA, 20ms for AMPAR-eEPSCs). *p<0.05, Wilcoxon signed-rank test.

Tiam1and Tiam2 have no influence on long-term potentiation in CA1 pyramidal neurons
The homologs Tiam2 and Tiam1 both possess similar domains – a PH1-CC-Ex domain, an RBD
and PDZ domain, and a DH1-PH2 domain (Figure 12A). However, while Tiam2 is robustly
expressed in CA1 pyramidal neurons, our previous study [70] detected negligible levels of
Tiam1 expression in CA1 pyramidal neurons. This is contrary to studies that report detecting
Tiam1 expression in CA1 pyramidal neurons. Here we found, Tiam2 knockdown in CA1
pyramidal neurons resulted in a pronounced reduction in post-synaptic AMPAR and NMDAR
current amplitudes. This contrasts with Tiam1, a homolog from the RhoGEF family, which we
previously found to have no role in baseline neurotransmission in CA1 pyramidal neurons [70].
Since these proteins have highly similar domains and function in vitro [8], we sought to
determine if the impact on neurotransmission in CA1 pyramidal neurons from knocking down
Tiam2 could be rescued by Tiam1. We co-expressed Tiam1 with Tiam2 shRNA in CA1
pyramidal neurons and measured AMPAR and NMDAR currents while stimulating Schaffer-
collateral afferent. We found that neurons expressing Tiam1 and Tiam2 shRNA have AMPAR-
and NMDAR-eEPSCs comparable to control neurons (Figure 12B, C; for AMPAR-eEPSCs p =
0.8, n= 9 pairs; for NMDAR-eEPSC p = 0.5, n= 8 pairs), demonstrating that Tiam1 is sufficient
to restore the loss of AMPAR and NMDAR receptor function resulting from Tiam2 knockdown.
33

Figure 12. Full-length Tiam1 rescues Tiam2 shRNA mediated effects on baseline glutamatergic
neurotransmission but does not affect Long-Term Potentiation in CA1 pyramidal neurons. A.
Illustration of Tiam1 and Tiam2 protein domains; full length Tiam1 (upper) and Tiam2 (lower) B, C
Scatterplots with AMPAR- and NMDAR-eEPSC amplitudes for CA1 pyramidal neurons co-
expressing Tiam2 shRNA and Tiam1, respectively plotted against paired control neuron eEPSCs
(open circles) with corresponding mean ± SEM (filled circles). Barplots show average AMPAR and
34
NMDAR-eEPSC amplitudes (±SEM) of CA1 pyramidal neurons expressing Tiam2 shRNA (grey
bars) and CA1 pyramidal neurons co-expressing Tiam2 shRNA, Tiam2 cDNA (maroon bars)
normalized to respective control cell average eEPSC amplitudes (black bar). ***p<0.001, *p<0.05,
Wilcoxon signed-rank test. B, C Tiam1 cDNA expression restores AMPAR- and NMDAR-eEPSC
amplitude in CA1 pyramidal neurons co-expressing Tiam2 shRNA (for AMPAR-eEPSCs p = 0.5, n =
8 pairs; for NMDAR-eEPSC p = 0.8, n = 6 pairs, Wilcoxon signed-rank test) (Inset) Representative
current traces from control (black) and transfected (green) neurons stimulation artifacts removed
(scale bars: 20pA for AMPA, 20ms for AMPA). (Insets) Representative current traces from control
(black) and transfected (orange) neurons (scale bars: 20pA, 20ms for AMPAR-eEPSCs). D
Knockdown of Tiam1 expression does not prevent LTP induction in CA1 pyramidal neurons. Plots of
mean ± SEM AMPAR-eEPSC amplitude of control untransfected CA1 pyramidal neurons (black)
and CA1 pyramidal neurons electroporated with Tiam1 shRNA (yellow) normalized to the mean
AMPAR-eEPSC amplitude before an LTP induction protocol (arrow) (control, n = 9 neurons; Tiam1
shRNA, n = 7 neurons). Sample AMPAR-eEPSC current traces from control (black) and
electroporated (yellow) neurons before and after LTP induction are shown to the right of the graphs.
(Scale bars: 20 ms, 20 pA.) *p<0.05, Wilcoxon signed-rank test.

This suggests that Tiam1 and Tiam2 are equivalent in their ability to maintain normal synaptic
function at CA1 glutamatergic synapses. Since studies have reported Tiam1 expression in CA1
pyramidal neurons and found a role for Tiam1 in normal baseline neurotransmission and in
structural long-term potentiation (sLTP) at these synapses. In our experiments, we detected very
low Tiam1 protein expression in CA1 pyramidal neurons and have demonstrated that Tiam1 is
not necessary for normal baseline neurotransmission at CA1 pyramidal neuron synapses. We
were curious if Tiam1 played a role in long-term potentiation at CA1 pyramidal neurons in an
intact circuit preparation. We tested this as previously described, using an acute slice preparation
from mice electroporated in utero with a previously validated shRNA against Tiam1 [70]. We
found that the loss of Tiam1 expression had no effect on the induction or maintenance of LTP in
CA1 pyramidal neurons. This finding is consistent with our previous protein expression and
baseline neurotransmission data for Tiam1 at CA1 pyramidal neurons synapses. Taken together,
these data demonstrate that while Tiam1 can reliably substitute for Tiam2 and restore normal
35
baseline neurotransmission in CA1, the loss of neither Tiam1 nor Tiam2 expression has an effect
on long-term potentiation in CA1 pyramidal neurons.
Tiam2 knockdown results in a DH-dependent increase in AMPAR and NMDAR
neurotransmission and dendritic spine number in DG granule neurons
Unlike Tiam1, Tiam2 is expressed in both CA1 pyramidal neurons and DG granule neurons. To
examine the role of Tiam2 in DG granule neurons, we biolistically transfected hippocampal
neurons with the previously validated Tiam2 shRNA and recorded postsynaptic currents from
DG granule neurons while stimulating the presynaptic perforant path afferents. Using this
approach, we found that AMPAR and NMDAR currents we increased 7-fold and 1.5-fold
respectively in DG granule neurons where Tiam2 expression was reduced (Figure 13B, C, for
AMPAR-eEPSCs p = 0.03, n= 7 pairs; for NMDAR-eEPSC p = 0.03, n= 6 pairs, Wilcoxon
signed-rank test). This is in striking contrast to the effect we saw in CA1 pyramidal neurons,
where the loss of Tiam2 resulted in a reduction in AMPAR and NMDAR neurotransmission
(Figure 13B, C).
To determine whether this increase in AMPAR and NMDAR currents is caused by the shRNA
mediated knockdown of Tiam2, we co- transfected hippocampal neurons with Tiam2 shRNA
and full-length Tiam2 cDNA and recorded post-synaptic currents as described above. We found
that the expression of Tiam2 cDNA restored AMPAR and NMDAR currents to levels
comparable to control neurons (Figure 14A, B; for AMPAR-eEPSCs p = 0.8, n= 9 pairs; for
NMDAR-eEPSC p = 0.5, n= 8 pairs, Wilcoxon signed-rank test). Having confirmed that the
increase in glutamatergic neurotransmission resulting from Tiam2 knockdown in DG granule
neurons was due to the loss of Tiam2, we sought to determine if this was accompanied by an
increase in spine number. By transfecting DG granule neurons with Tiam2 shRNA and GFP and
36
imaging dendritic segments (Figure 14C), we found that the expression of Tiam2 shRNA did in
fact increase dendritic spine density 1.25-fold above neurons expressing GFP (Figure 14D; for
AMPAR-eEPSCs p = 0.9, n= 8 pairs; for NMDAR-eEPSC p = 0.9, n= 7 pairs, Wilcoxon signed-
rank test; compared against increase in NMDAR-eEPSC amplitude).
Like our experiment in CA1 pyramidal neurons, we asked if the function of Tiam2 in DG
granule neurons could be performed by its homolog Tiam1. To test this, we knocked down
Tiam2 in DG granule neurons and co-expressed Tiam1 along with the Tiam2 shRNA. We found
that Tiam1 reliably rescued the effect of Tiam2 knockdown (Figure 15A, B; for AMPAR-
eEPSCs p = 1, n= 9 pairs; for NMDAR-eEPSC p = 0.7, n= 6 pairs, Wilcoxon signed-rank test).
We were curious whether this effect of Tiam2 on neurotransmission in DG granule neurons was
dependent on the function of its catalytic DH-domain, as was the case for Tiam2 function in CA1
pyramidal neurons. We co-expressed Tiam2 shRNA with Tiam2 ∆DH in DG granule neurons
and measured post-synaptic responses to perforant path afferent stimulation. We found that
AMPAR and NMDAR-eEPSC amplitudes were restored to levels comparable to current
amplitudes in control neurons transfected with GFP (Figure 15C, D; for AMPAR-eEPSCs p =
0.2, n= 9 pairs; for NMDAR-eEPSC p = 0.8, n= 6 pairs, Wilcoxon signed-rank test). This
suggests that, unlike the function of Tiam2 in CA1 pyramidal neurons, the function of Tiam2 in
DG granule neurons is independent of the DH-domain.

37

Figure 13. Tiam2 knockdown increases AMPAR- and NMDAR-mediated baseline
neurotransmission in DG granule neurons A Hippocampal Tiam2 immunolabelling in whole
hippocampal slice (scale bar: 200μm). GL-granule layer, ML-molecular layer. B, C Scatterplots show
eEPSC amplitudes for pairs of untransfected and transfected cells (open circles) with corresponding mean
± SEM (filled circles). (Insets) Representative current traces from control (black) and transfected (yellow)
neurons with stimulation artifacts removed (scale bars: 20pA for both AMPAR-eEPSCs and NMDAR-
eEPSCs, 20ms for AMPAR, 50ms for NMDAR). Barplots show average AMPAR and NMDAR-eEPSC
amplitudes (±SEM) of DG granule neurons (orange) and CA1 pyramidal neurons (grey) expressing
Tiam2 shRNA normalized to their respective control cell average eEPSC amplitudes. Tiam2 shRNA
expression increases AMPAR-eEPSC and NMDAR-eEPSC amplitude in DG granule neurons (for
AMPAR-eEPSCs p = 0.03, n= 7 pairs; for NMDAR-eEPSC p = 0.03, n= 6 pairs, Wilcoxon signed-rank
test). *p<0.05, Wilcoxon signed-rank test.
C
38

Figure 14. Tiam2 knockdown is rescued by full-length Tiam2 and increases spine
number in DG granule neurons. A, B Scatterplots show eEPSC amplitudes for pairs of
untransfected and transfected cells (open circles) with corresponding mean ± SEM (filled
circles). (Insets) Representative current traces from control (black) and transfected (blue)
neurons with stimulation artifacts removed (scale bars: 20pA for both AMPAR-eEPSCs and
NMDAR-eEPSCs, 20ms for AMPAR, 50ms for NMDAR). Barplots show average AMPAR
and NMDAR-eEPSC amplitudes (±SEM) of DG granule neurons (blue) and CA1 pyramidal
neurons (grey) expressing Tiam2 shRNA normalized to their respective control cell average
eEPSC amplitudes. Full-length Tiam2 shRNA expression restores AMPAR-eEPSC and
NMDAR-eEPSC amplitude in DG granule neurons (for AMPAR-eEPSCs p = 0.8, n= 9 pairs;
for NMDAR-eEPSC p = 0.5, n= 8 pairs, Wilcoxon signed-rank test) C Schematic
representation of areas of image acquisition from DG granule neuron dendrites D Barplots
show significant differences in Spine Length and Spine Neck Length in DG granule neurons
expressing Tiam2 shRNA (green) compared to GFP expressing control neurons (black) (p =
0.00022 for Spine Density, for GFP n = 9 segments, for Tiam1 shRNA n = 9
segments)**p<0.001, **p<0.01, n.s. - not significant, Wilcoxon rank-sum test.
39

Figure 15. Tiam2 knockdown is rescued by full-length Tiam1 and Tiam2 ∆DH in DG
granule neurons. A, B Scatterplots show eEPSC amplitudes for pairs of untransfected and
transfected cells (open circles) with corresponding mean ± SEM (filled circles). (Insets)
Representative current traces from control (black) and transfected (blue) neurons with stimulation
artifacts removed (scale bars: 20pA for both AMPAR-eEPSCs and NMDAR-eEPSCs, 20ms for
AMPAR, 50ms for NMDAR). Barplots show average AMPAR and NMDAR-eEPSC amplitudes
(±SEM) of DG granule neurons (maroon and green) expressing Tiam2 shRNA normalized to
their respective control cell average eEPSC amplitudes. A, B Full-length Tiam1 shRNA
expression restores AMPAR-eEPSC and NMDAR-eEPSC amplitude in DG granule neurons (for
AMPAR-eEPSCs p = 1, n= 9 pairs; for NMDAR-eEPSC p = 0.7, n= 6 pairs, Wilcoxon signed-
rank test) C, D Full-length Tiam2 ∆DH expression restores AMPAR-eEPSC and NMDAR-
eEPSC amplitude in DG granule neurons (for AMPAR-eEPSCs p = 0.25, n= 9 pairs; for
NMDAR-eEPSC p = 0.84, n= 6 pairs, Wilcoxon signed-rank test). **p<0.001, **p<0.01, n.s. -
not significant, Wilcoxon rank-sum test.
40
DISCUSSION

RhoGEFs are widely expressed in the human body, and as key mediators of Rho GTPase
activation and modulation of actin dynamics, it unsurprising that they are implicated in many
cancers and diseases of the central nervous system. The Dbl- family is the largest family of
RhoGEFs with 70 members, many of which target the same small GTPase, but differ in tissue
expression patterns and functional roles. These factors, along with the diversity in sequences and
domains within RhoGEFs produce a variety of signaling mechanisms and functional outcomes.
In in vivo studies, Tiam2 has been associated with invasiveness and metastasis in several forms
of cancer [85-87], like its homolog Tiam1, which has been proposed as potential druggable target
for anti-cancer therapies [63, 88, 89]. In addition to their well described roles in the progression
of cancers, studies that measure the effect altered protein expression on synaptic function and
behavior, implicate Tiam1 and Tiam2 in growth cone dynamics, axon guidance and synaptic
development [REF]. Therefore, improved understanding of RhoGEFs like Tiam1 and Tiam2 is
critical to the development of therapies that target their activity to treat disease.
Our experiments find a sub-region-specific role for Tiam2 in CA1 pyramidal neuron structure
and function and find that neither Tiam1 nor Tiam2 are essential for normal NMDAR-mediated
LTP induction and maintenance. Previous studies reported that Tiam1 is required for NMDA
receptor-mediated increases in spine density in dissociated neurons [24]. Contrary to such
reports, we found that NMDAR-dependent synaptic potentiation resulting from the induction of
LTP did not rely on normal expression levels of Tiam1 or Tiam2 in CA1 pyramidal neurons.
Another study found that Tiam1 knockdown in CA1 pyramidal neurons produced deficits in the
induction and maintenance of structural Long-Term Potentiation (sLTP). sLTP, which is the
measurement of increases in spine size, is considered the structural correlate of functional LTP.
41
However, our experiments find that the loss of protein expression of Tiam1 or Tiam2 produce no
alterations in the expression of LTP in CA1 pyramidal neurons.

42
CHAPTER 3

Detection of Autism Spectrum Disorder-related pathogenic variants by a novel
structure-based approach

INTRODUCTION

Autism Spectrum Disorder (ASD) is a heterogenous neurodevelopmental disorder that affects 2-
3% of the western population [90]. Large-scale population-based cohort studies, the high
recurrence of ASD within siblings, and the discovery of several genetic risk factors have shown
that 5-20% of ASD cases have identifiable genetic etiology and are frequently comorbid with
Intellectual Disability (ID) [91-94]. Scientific progress in recent years has produced rapid
advances in human whole exome sequencing and the discovery of more ASD/ID risk-genes [95-
98]. In particular de novo variants (i.e. new variants that arise from spontaneous germline
mutations that confer five-fold higher risk than commonly inherited variants) may contribute to
15-20% of population-wide ASD-risk [94, 99]. These results, along with a demonstrated increase
in diagnostic yield from genetic testing have influenced diagnostic recommendations for ASD
[100, 101]. While behavioral testing is the basis for diagnostic evaluation, the case for inclusion
of genetic testing for ASD/ID in healthcare practice standards and guidelines is gaining
momentum [102-107]. The ability to identify pathogenic mutations in individual genes that
contribute to patient symptomatology stands to uncover specific syndromes within larger
populations of individuals with neurodevelopmental disorders. The identification of such
syndromes will be invaluable to clinical genetic testing and the development of personalized
therapeutic interventions for treating these disorders.
In the past decade, exome sequencing studies have detected a strong enrichment of ASD-related
de novo mutations in synaptic regulatory genes suggesting that glutamatergic synapse
43
dysfunction is one of the primary contributing factors to the development of ASD [108]. We
recently discovered a hotspot of ASD-related missense mutations in TRIO, the gene encoding the
glutamatergic synapse regulatory protein TRIO [109, 110]. These missense mutations are
clustered within the region of the TRIO gene that encodes the GEF1 domain of the TRIO protein.
TRIO’s GEF1 domain binds to and activates the small GTPase, RAC1. Through its ability to
activate RAC1, TRIO promotes the polymerization of actin at glutamatergic synapses and exerts
a strong influence on glutamatergic synapse function [111]. The hotspot of de novo mutations in
TRIO’s GEF1/DH1 domain we identified exhibits more ASD-associated missense mutations per
sequence base than well-known ASD genes such as SCN2A, SYNGAP and SHANK2 [109]. Our
structural analysis suggested that these ASD-related missense mutations in TRIO either interfere
with conformational stability of the GEF1 domain or disrupt the GEF1/RAC1 interface.
Moreover, mutants interfering with GEF1/DH1-mediated RAC1 activation were experimentally
shown to impact glutamatergic neurotransmission [109]. None of the predicted disruptive
mutations in TRIO in the region encoding the GEF1 domain were present in family member
controls [109, 112-115], or found in the Genome Aggregation Database (gnomAD) of control
genomes [116]. Given the strength of these predictions for disrupting mutations in TRIO, we
reasoned that our structure-based approach may be able to effectively predict whether new
missense variants in TRIO’s GEF1 domain are detrimental to TRIO protein function in the
RAC1 pathway.

In this study, we generated structure-based modeling predictions and used organotypic slice
electrophysiology to test whether mutations predicted to be deleterious to TRIO function affect
TRIO’s influence on glutamatergic neurotransmission. This combination of computational
44
predictions and experimental validation allowed us to identify new TRIO variants that disrupt
TRIO-RAC1 signaling, compromise synapse function, and are likely to confer high ASD and/or
ID risk. The approach uses energy-based structural modeling to predict the effect of mutations at
the TRIO-RAC1 interface in TRIO’s catalytic GEF1 domain on the stability and binding of the
TRIO-RAC1 complex. The method was validated by experimentally testing the effect of these
mutations on glutamatergic transmission in rodent neurons in vitro. Experimental validation of
eight mutations predicted as disruptive showed a 75% prediction success rate. Control mutations
predicted to be benign were found to have no impact on TRIO function. As more individuals
with ASD/ID are identified with mutations in TRIO’s GEF1 domain, this combination of in
silico prediction with in vitro validation can provide a fast and reliable approach to screen these
mutations and predict a potential contribution to synaptic dysfunction and ASD/ID development.

RESULTS

Structure-based modeling predicts mutations disruptive for TRIO stability and RAC1 binding

A structure-based approach was used to predict mutations compromising TRIO’s interface in
complex with RAC1 and mutations destabilizing the TRIO-GEF1 domain. The structure of
TRIO’s GEF1 domain in complex with RAC1 has been solved [28], which allows accurate
conformational modeling and evaluation of the mutations’ effect on TRIO GEF1 domain
stability and RAC1 binding. We performed a comprehensive screening of the possible TRIO-
GEF1 domain mutants and selected four mutations predicted to reduce binding to RAC1 (Table
1) and four mutations predicted to reduce stability of the domain (Table 2). The predicted values
of ∆∆Gbinding or ∆∆Gstability were used as the main criteria for mutation selection. Priority was
45
given to the mutations with high values (in bold) for one of these properties (∆∆G stability or
∆∆Gbinding) and values below threshold (< 3) for the other property (Table 1 and 2). To diversify
selection, we considered and sampled mutations located in distinct subregions of the GEF1
domain. All the mutation positions tested in our previous study were excluded from
consideration [109]. In addition, two GEF1 domain mutations from gnomAD database were
predicted to have negligible impact on TRIO stability and RAC1 binding and were used as
control benign mutations (Table 1 and 2).

Figure 16. Mutations predicted to compromise TRIO-RAC1 binding disrupt TRIO-9’s influence on
glutamatergic synapse function. A GEF1 mutations predicted to disrupt Rac1 binding. TRIO-9 is shown
in grey, RAC1 is shown in cyan. B Electrophysiological recording setup. C Average AMAPR eEPSC
amplitudes (±SEM) of neurons expressing wild-type (WT) TRIO-9, TRIO-9 E1299W, TRIO-9 C1387W,
TRIO-9 T1430W and TRIO-9 A1464W normalized to their respective average control AMPAR-eEPSC
L
46
amplitudes. Wilcoxon signed-rank was used to compare related samples (* = p < 0.05). D, F, H, J, L
Scatterplots show AMPAR-eEPSC amplitudes for single pairs of control and transfected neurons (open
circles). Filled circles show mean ± SEM. (Insets) Current traces from control (black) and transfected
(various colors) neurons (Scale bars: 20 ms, 20 pA). D TRIO-9 expression increased AMPAR-eEPSC
amplitude (n = 8 pairs, p < 0.05, Wilcoxon signed-rank test). E, G, I, K TRIO protein is shown in grey,
RAC1 is shown in cyan. Mutated residue and close contacts are shown in sticks, with TRIO residues in
grey, RAC1 residues in cyan, and mutation in orange. Hydrogen bonds are shown as blue dotted lines. E
Interactions of E1299 amino acid residue in WT and mutant protein. F TRIO-9 E1299W expression
showed a significant reduction in AMPAR-eEPSC amplitude (n = 7 pairs, p < 0.05, Wilcoxon signed-rank
test), G Interactions of C1387 amino acid residue in WT and mutant protein. H TRIO-9 C1387W
expression showed no increase in AMPAR-eEPSC amplitude (n = 9 pairs, p < 0.05, Wilcoxon signed-rank
test), I Interactions of T1430 amino acid residue in WT and mutant protein J TRIO-9 T1430W expression
showed no increase in AMPAR-eEPSC amplitude (n = 7 pairs, p < 0.05, Wilcoxon signed-rank test), K
Interactions of A1464 amino acid residue in WT and mutant protein. L TRIO-9 A1464W expression
showed an increase in AMPAR-eEPSC amplitude (n = 7 pairs, p < 0.05, Wilcoxon signed-rank test)

Mutations predicted to compromise TRIO-RAC1 binding disrupt TRIO-9’s influence on
glutamatergic synapse function
Structure-based modeling predicted four mutations that would reduce free energy of TRIO
binding to RAC1 (Table 1, Figure 16A). Mutation E1299W was predicted to reduce TRIO-
RAC1 binding by disruption of the comprehensive H-bond system between TRIO’s GEF1
domain and V36, T35, Y32 residues of RAC1 protein (Figure 16E). Three other mutations
(C1387W, T1430W, and A1464W) were predicted to interfere with TRIO-RAC1 binding by
introducing steric clashes on the interaction interface. Specifically, mutation C1387W clashes
with the sidechain of RAC1’s L70 residue (Figure 16G), mutation T1430W clashes with the loop
formed by residues A59, G60, and Q61 (Figure 16I); mutation A1464W introduces steric clashes
in the region of R66 and L67 residues of RAC1 (Figure 16K). In summary, our computational
model produced four mutants predicted to have a damaging effect on TRIO-RAC1 binding; three
with the presence of a bulky residue instead of a small polar residue on the interaction surface
(C1387W, A1464W and T1430W) and one mutation that disrupts an H-bond (E1299W) (Figure
16A, E, H, I and K).
47
To determine whether these mutations predicted to disrupt TRIO-RAC1 binding would impact
TRIO function, we designed individual TRIO-9 mutant expression constructs, which harbored
mutations identified by our structure-based modelling. Since TRIO-9 is the predominant TRIO
isoform found in the brain we individually expressed WT TRIO-9 and TRIO-9 mutants in CA1
pyramidal cells in organotypic hippocampal slice cultures using biolistic transfection in
organotypic slices [117]. To assess whether these mutations compromise TRIO-9’s influence on
glutamatergic synapses, simultaneous whole-cell voltage clamp recordings of AMPA receptor-
evoked excitatory postsynaptic currents (AMPAR-eEPSCs) were made from fluorescent
transfected CA1 pyramidal neurons and neighboring untransfected control neurons during
Schaffer Collateral stimulation (Figure 16b). This approach allows for a pairwise, internally
controlled comparison of the consequences from genetic manipulations in an intact tissue
preparation [70, 81, 118]. As shown previously we find that expression of WT TRIO-9 results in
a ~2-fold increase in AMPAR-eEPSC amplitude (Figure 16C and D, p = 0.03, n = 8, Wilcoxon-
signed rank test) [81]. In marked contrast and as our modeling predicted, TRIO-9 mutants
E1299W, C1387W and T1430W failed to produce increases in synaptic AMPAR-eEPSC
amplitude relative to neighboring control neurons (Figure 16C, F, H and J; for C11387W p =
0.76, n = 9; for T1430W p = 1, n = 8, Wilcoxon-signed rank test). Interestingly, TRIO-9
E1299W expression in neurons resulted in a marked decrease in AMPAR-eEPSC amplitude
(Figure 16C and F, p = 0.03, n = 7, Wilcoxon-signed rank test). This is indicative of a severe
reduction in TRIO-9 GEF1 activity resulting in a dominant negative effect on neurotransmission.
In contrast, TRIO-9 A1464W expression produced a significant increase in AMPAR-eEPSC
amplitude that was comparable to WT TRIO-9 (Figure 16C and l, p = 0.007, n = 8, Wilcoxon-
signed rank test). Thus, our physiological approach established that 3 of 4 predictions were
48
correct. These data establish that our electrophysiological validation, along with the
computational model can reliably predict and demonstrate the effect of mutations that are
predicted to disrupt the binding of TRIO-9 to RAC1 at glutamatergic synapses.

Figure 17. Mutations predicted to compromise TRIO-RAC1 stability disrupt TRIO-9’s influence
on glutamatergic synapse function. A GEF1 mutations predicted to disrupt domain stability. TRIO
protein is shown in grey, RAC1 is shown in cyan. B Average AMPAR-eEPSC amplitudes (±SEM) of
neurons expressing WT TRIO-9 Y1318G, TRIO-9 E1304G, TRIO-9 G1453W and TRIO-9 Y1383A
normalized to their respective average control AMPAR-eEPSC amplitudes. Wilcoxon signed-rank test
was used to compare related samples (p < 0.05). D, F, H, J Scatterplots show AMPAR-eEPSC amplitudes
for single pairs of control and transfected neurons (open circles). Filled circles show mean ± SEM.
(Insets) Current traces from control (black) and transfected (various colors) neurons (Scale bars: 20 ms,
20 pA). C, E, G, I TRIO protein is shown in grey, RAC1 is shown in cyan. Mutated residue and close
contacts are shown in sticks, with TRIO residues in grey, RAC1 residues in cyan, and mutation in
49
magenta. Hydrogen bonds are shown as blue dotted lines. c Interactions of E1304 amino acid residue in
WT and mutant protein. D TRIO-9 E1304G expression showed no increase in AMPAR-eEPSC amplitude
(n = 6 pairs, p < 0.05, Wilcoxon signed-rank rest), E Interactions of Y1318 amino acid residue in WT and
mutant protein. F TRIO-9 1318G expression showed no increase in AMPAR-eEPSC amplitude (n = 11
pairs, p < 0.05, Wilcoxon signed-rank test), G Interactions of G1453 amino acid residue in WT and
mutant protein. H TRIO-9 G1453W expression showed no increase in AMPAR-eEPSC amplitude (n = 8
pairs, p < 0.05, Wilcoxon signed-rank test), I Interactions of Y1383 amino acid residue in WT and mutant
protein. J TRIO-9 Y1383A expression showed an increase in AMPAR-eEPSC amplitude (n = 6 pairs, p
< 0.05, Wilcoxon signed-rank test)

Mutations predicted to compromise TRIO-GEF1 stability disrupt TRIO-9’s influence on
glutamatergic synapse function
In addition to mutations that disrupt binding, our structure-based computational predictions
identified mutants that would disrupt the stability of the TRIO GEF1-RAC1 binding site. Our
model predicted three mutations (E1304G, Y1318G, and Y1383A) to reduce GEF1 domain
stability by interrupting the network of internal hydrogen bonds (Table 2, Figure 17A). Mutation
E1304G prevents formation of an extensive H-bond network between the sidechain of four
residues, E1304, H1351, Y1432, and R1428 (Figure 17C). Mutation Y1318G destroys the H-
bond interaction with the backbone of N1416 residue (Figure 17E). Mutation Y1383A abolishes
the H-bond interactions with the side chains of Y1307 and H1351 (Figure 17E). The fourth
mutation, G1453W, leads to the destabilization of the TRIO’s GEF1 domain by introducing
internal clashes between α-helices, specifically with residues L1436 and F1373 (Figure 17G). In
summary, the predicted mutations affect binding by disrupting H-bonds to specific residues
(TRIO E1304G and Y1383A), distort the α-helix conformation and a backbone H-bond (TRIO
Y1318G), and harbor a modification resulting in a larger hydrophobic core (TRIO G1453W)
(Figure 17A, C, E, G and I).
To determine the effect these mutations have on TRIO-9 function, we designed individual TRIO-
9 mutant expression constructs, each of which harbored a mutation predicted to disrupt the
50
stability of TRIO-9’s GEF1 domain. By recording post-synaptic currents as described
previously, we found that three out of four TRIO-9 mutants we tested showed a pronounced lack
of increase in AMPAR-eEPSC amplitude relative to WT TRIO-9 (Figure 17B). Specifically,
TRIO-9 E1304G, Y1318G and G1453W mutations prevented TRIO-9 mediated potentiation of
synapses (Figure 17D, F, H; for E1304G p = 0.69, n = 6; for Y1318G p = 0.32, n = 11, for
G1453W p = 0.84, n = 8; Wilcoxon-signed rank test). This finding is consistent with the
predictions from our structure-based computational model. A significant effect was not observed
on AMPAR-current amplitudes for all mutants except TRIO-9 Y1383A, which increased
AMPAR-eEPSC amplitude similar to WT TRIO-9 (Figure 17J, p = 0.3, n = 6, Wilcoxon-signed
rank test). Taken together, our combined structure-based and electrophysiological approaches
can accurately predict and confirm the impact that GEF1-domain mutations predicted to affect
stability have on TRIO-9 function at glutamatergic synapses.
51

Figure 18. Mutations predicted to be benign to TRIO-RAC1 interaction do not interfere with
TRIO-9’s influence on glutamatergic synapse function. A GEF1 mutations predicted to be benign B
Average AMPAR-eEPSC amplitudes (±SEM) of neurons expressing WT TRIO-9, TRIO-9 Y1394A and
TRIO-9 T1394A normalized to their respective average control AMPAR-eEPSC amplitudes. Wilcoxon
Rank Sum Test was used to compare related samples (* = p < 0.05). C E In Residue Models, TRIO
protein is shown in grey, RAC1 is shown in cyan. Mutated residues and close contacts are shown in
sticks, with TRIO residues in grey and mutation in green. c Interactions of T1394 amino acid residue in
WT and mutant protein. D, F Scatterplots show AMPAR-eEPSC amplitudes for single pairs of control
and transfected neurons (open circles). Filled circles show mean ± SEM. (Insets) Current traces from
control (black) and transfected (various colors) neurons (Scale bars: 20 ms, 20 pA). D TRIO-9 T1394A
expression increased AMPAR-eEPSC amplitude (n = 7 pairs, p < 0.05, Wilcoxon signed-rank test), e
Interactions of S1403 amino acid residue in WT and mutant protein. F TRIO-9 S1403F expression
increased AMPAR-eEPSC amplitude (n = 7 pairs, p < 0.05, Wilcoxon signed-rank test)

52
Mutations predicted to be benign to TRIO-RAC1 interaction do not interfere with TRIO-9’s
effect on glutamatergic synapse function.

Figure 19. Workflow for structure-based prediction method to identify pathological ASD-related
de novo mutations in TRIO’s DH1 domain in patients. A Mutation identification from neonatal or
prenatal clinical gene sequencing. Example image below shows cluster of missense, nonsense and CNVs
in TRIO, identified in individuals with ASD-related disorders. The different protein domains are
indicated, starting with the N-terminus: Sec14 domain (dark green), Spectrin repeats (maroon), GEF1
domain composed of a Dbl homology domain (DH1, in orange) and a Pleckstrin homology domain (PH1,
in pink), Src homology 3 domain (SH3) (green), and the GEF2 domain (composed of a Dbl homology
domain (DH2, in blue) and a Pleckstrin homology domain (PH2, in grey). For each mutation, the
individual’s diagnosis is given along with information about the alteration of TRIO’s amino acid
sequence. Position of amino-acid mutations from NP_009049.2, B An in silico prediction from our
structure-based method on whether a patient’s mutations impacts the free energy change in protein
stability (∆∆Gstability) or binding (∆∆Gbinding) of the TRIO-RAC1 complex. Representative mutations
shown in images below are E1299W and E1304G predicted to impact protein binding (∆∆Gbinding)
respectively. TRIO protein is shown in grey, RAC1 is shown in cyan. Mutated residues and close
contacts are shown in sticks, with TRIO residues in grey, RAC1 residues in cyan, and mutations in
orange or magenta. Hydrogen bonds are shown as blue dotted lines. C Electrophysiological recording
setup shown in image. Experimental validation of the impact of the mutant TRIO variant on
glutamatergic neurotransmission assessed using dual-whole cell voltage-clamp of paired CA1 pyramidal
neurons.
53
We identified mutations from the gnomAD database that are identified as missense
mutations within the GEF1 domain but were predicted to be benign by our computational model.
These mutations were T1394A, on the TRIO-RAC1 binding interface within the DH1 domain,
and S1403F on the surface of TRIO’s DH1 domain (Figure 18A, C, E). To determine whether
our computational predictions were accurate, we biolistically transfected hippocampal slices with
each control TRIO-9 mutant. We recorded AMPAR-eEPSCs from CA1 pyramidal neurons while
stimulating Schaffer collateral afferents and found that both mutants produced average current
amplitudes significantly larger than controls similar to the synaptic phenotype observed with WT
TRIO-9 (Figure 18B, D, F; for T1394A p = 0.02, n = 8; for S1403F p = 0.03, n = 6; Wilcoxon-
signed rank test). These data demonstrate that these control mutations do not affect TRIO-9-
mediated potentiation of AMPAR-eEPSCs.

DISCUSSION

With the increasing availability of prenatal and neonatal human genome sequencing, there is a
growing demand for effective and robust computational tools predicting genomic mutations
carrying increased risk of ASD or related neurodevelopmental disorders. Since individual de
novo missense mutations are all exceedingly rare or unique, they are not amenable to genome-
wide association (GWAS) analysis and require other approaches based on functional knowledge
about the protein. While frameshift mutations, nonsense mutations and copy number variations
(CNVs) in a gene are relatively easy to identify as they eliminate key domains or the whole
protein and may result in loss-of function, the impact of missense mutations on protein function
are more difficult to assess. In silico prediction tools including PolyPhen2 and SIFT [119-123]
have been developed to predict whether a missense mutation in a gene impacts protein function.
54
These tools rely heavily on comparative analysis of sequence variations, while using structural
information only in form of general descriptors of protein residues such as surface area and B-
factor. While fast and useful, these in silico prediction tools are prone to false positives, often
incorrectly classifying mutations as damaging or significantly overestimating the damaging
effect of missense mutations [119, 120].

Our approach is based on a detailed all-atom energy-based structural model of
mutations to predict their effect on protein stability, interaction with a functional partner, and
thus on the biological function defined by these interactions. In the case of the TRIO-RAC1
pathway, we use a high-resolution structure of TRIO’s GEF1 domain with RAC1 for modeling.
Our previous study identified clustering of de novo ASD-associated mutations in the GEF/DH1
domain of TRIO, a region that binds directly to RAC1, and used this type of structure-based
computational analysis to predict that these mutations would produce pathological disruptions in
glutamatergic neurotransmission. We experimentally characterized the ASD-related de novo
mutations within this hotspot and implicated the bi-directional alterations in neurotransmission
produced by these mutations in ASD pathology. In the present study, we use this structure-based
computational approach as a predictive tool to suggest new potentially deleterious mutations in
TRIO-9. To test the computational predictions experimentally, we used dual whole cell voltage-
clamp in hippocampal slice cultures to assess the effect of these mutations in neurons. We show
that 75% (6 out of 8) of mutations that were predicted as deleterious do indeed disrupt TRIO-
RAC1 mediated glutamatergic synapse function.
Employing direct structural modeling makes it possible to distinguish between disrupting
and benign mutations on the functional interface more accurately compared to using just general
55
structural descriptors, and thus overcome the high false-positive rate of sequence-based
approaches. A comparison of our results with PolyPhen2 predictions (Supplementary Table 1)
shows that PolyPhen2 predicts two GEF1 mutations of healthy individuals from the gnomAD
database as potentially deleterious. We show that both mutations predicted to be neutral by our
approach, were experimentally validated as lacking any significant effect on TRIO-9 function
(Figure 18, Supplementary Table 1). The fact that these mutations were predicted as potentially
deleterious by PolyPhen2, supports the assertion that our structure-based approach will reduce
false positive predictions.
This incidence of false positives from existing prediction algorithms demonstrates a need
for more sophisticated and accurate predictive approaches as described in the present study, that
account for protein structures and residue interactions on the protein-protein interfaces. In the
clinic, advanced structure-based modeling as described here, could be used to analyze mutations
identified by variants detected in pre- or neonatal genomic sequencing. Combined with in vitro
experimental validation, this can provide a reliable assessment of whether a given mutation will
be detrimental to protein and synaptic function (Figure 19). Such information will aid
significantly in identifying those mutations in individuals that confer elevated disease risk. In
turn, this will enable better identification and classification of syndromic forms of ASD/ID,
leading to improved prognosis estimates and more personalized treatment strategies.
In the present study, experimental validation has informed retrospective analysis of
predictions from our model and can be used to further improve the accuracy of the model. Out of
four mutations predicted to affect TRIO-RAC1 binding, three were confirmed in vitro. Mutation
E1299W, which shows a dominant-negative effect, stands out as one disrupting a comprehensive
network of hydrogen bonds between TRIO and RAC1 proteins, in agreement with the high
56
importance of polar interactions for selective binding. The effect of the other three mutations
(C1387W, A1464W and T1430W) was predicted based on introducing steric clashes between the
proteins. While C1387W and T1430W were indeed disruptive, mutation A1464W did not have a
significant effect. Although the model predicted that the A1464W mutant would produce a steric
clash interfering with the TRIO-RAC1 protein interaction, our retrospective analysis suggests
that a minor backbone movement in this region might mitigate the steric hindrance and avoid the
detrimental effect. Similarly, out of four mutations predicted to affect protein stability, the
experimental data for the Y1383A mutant did not recapitulate our model’s prediction. Even
though the mutation was predicted to disrupt polar interactions to two residues, this might be
compensated by some backbone adjustment and more tight packing, preserving the protein
stability. Thus, accurately considering some limited backbone adjustments might further
improve the predictive power of the approach.
The strength of our study is that it provides a relatively simple and accurate method to determine
whether missense mutations in TRIO’s GEF1 domain in individuals may compromise TRIO
function and contribute to an increased risk of developing ASD/ID. While this new diagnostic
tool represents a vast improvement over those currently available, the penetrance of missense
mutations in TRIO’s GEF1 that compromise TRIO function is presently unknown. As such,
missense mutations identified as detrimental to TRIO function by our new method does not
provide conclusive evidence that ASD/ID will develop in individuals who have yet to exhibit
symptoms of such disorders. Additionally, missense mutations identified as detrimental to TRIO
function by our new method in individuals diagnosed with ASD/ID does not guarantee that such
mutations are solely responsible for the disorder. As a greater number of individuals both with
and without ASD/ID are identified that harbor missense mutations within TRIO’s GEF1 domain,
57
estimations regarding the accuracy of our new method in predicting ASD/ID risk will become
possible.
CONCLUSIONS

The structure-based approach described here may be applied to other critical protein-
interactions, that are causally involved in ASD/ID. One key requirement for our structure-based
approach is the availability of accurate structural models of the protein complexes. Currently,
this field is being rapidly populated by new structural biology techniques like high-resolution
cryo-Electron Microscopy [124, 125], X-ray Free Electron Laser XFEL [126], or hybrid
structural modeling methods [127]. Advances in ab initio structure-determination methods like
Alpha-Fold [128] may help to fill this gap, providing high-resolution structural information for a
vast majority of proteins. This will facilitate the development of sophisticated structure-based
approaches like ours, to identify pathological missense mutations more accurately in the human
genome which will lead to better diagnostic predictions for ASD.

58
REFERENCES

1. Levine, E.S., et al., Brain-derived neurotrophic factor rapidly enhances synaptic
transmission in hippocampal neurons via postsynaptic tyrosine kinase receptors.
Proceedings of the National Academy of Sciences of the United States of America, 1995.
92(17): p. 8074-8077.
2. Fu, W.Y., et al., Cdk5 regulates EphA4-mediated dendritic spine retraction through an
ephexin1-dependent mechanism. Nat Neurosci, 2007. 10(1): p. 67-76.
3. Hamilton, A.M., et al., A dual role for the RhoGEF Ephexin5 in regulation of dendritic
spine outgrowth. Mol Cell Neurosci, 2017. 80: p. 66-74.
4. Herring, B.E. and R.A. Nicoll, Kalirin and Trio proteins serve critical roles in excitatory
synaptic transmission and LTP. Proc Natl Acad Sci U S A, 2016. 113(8): p. 2264-9.
5. Kang, H. and E.M. Schuman, Long-lasting neurotrophin-induced enhancement of
synaptic transmission in the adult hippocampus. Science, 1995. 267(5204): p. 1658-62.
6. Margolis, S.S., et al., EphB-mediated degradation of the RhoA GEF Ephexin5 relieves a
developmental brake on excitatory synapse formation. Cell, 2010. 143(3): p. 442-55.
7. Martin-Vilchez, S., et al., RhoGTPase Regulators Orchestrate Distinct Stages of Synaptic
Development. PloS one, 2017. 12(1): p. e0170464-e0170464.
8. Miller, M.B., et al., Neuronal Rho GEFs in synaptic physiology and behavior. The
Neuroscientist : a review journal bringing neurobiology, neurology and psychiatry, 2013.
19(3): p. 255-273.
9. Penzes, P., et al., Rapid induction of dendritic spine morphogenesis by trans-synaptic
ephrinB-EphB receptor activation of the Rho-GEF kalirin. Neuron, 2003. 37(2): p. 263-74.
10. Penzes, P., et al., Convergent CaMK and RacGEF signals control dendritic structure and
function. Trends Cell Biol, 2008. 18(9): p. 405-13.
11. Ryan, T.J., et al., Memory. Engram cells retain memory under retrograde amnesia.
Science (New York, N.Y.), 2015. 348(6238): p. 1007-1013.
12. Xie, Z., et al., Kalirin-7 controls activity-dependent structural and functional plasticity of
dendritic spines. Neuron, 2007. 56(4): p. 640-56.
13. Coultrap, S.J., et al., Differential expression of NMDA receptor subunits and splice
variants among the CA1, CA3 and dentate gyrus of the adult rat. Brain Res Mol Brain
Res, 2005. 135(1-2): p. 104-11.
14. Datson, N.A., et al., Expression profiling in laser-microdissected hippocampal subregions
in rat brain reveals large subregion-specific differences in expression. European Journal
of Neuroscience, 2004. 20(10): p. 2541-2554.
15. Datson, N.A., et al., A molecular blueprint of gene expression in hippocampal subregions
CA1, CA3, and DG is conserved in the brain of the common marmoset. Hippocampus,
2009. 19(8): p. 739-52.
16. Lein, E.S., X. Zhao, and F.H. Gage, Defining a molecular atlas of the hippocampus using
DNA microarrays and high-throughput in situ hybridization. J Neurosci, 2004. 24(15): p.
3879-89.
17. Zhao, X., et al., Transcriptional profiling reveals strict boundaries between hippocampal
subregions. J Comp Neurol, 2001. 441(3): p. 187-96.
59
18. Zhu, F., et al., Architecture of the Mouse Brain Synaptome. Neuron, 2018. 99(4): p. 781-
799.e10.
19. Ehler, E., et al., Expression of Tiam-1 in the developing brain suggests a role for the Tiam-
1-Rac signaling pathway in cell migration and neurite outgrowth. Mol Cell Neurosci,
1997. 9(1): p. 1-12.
20. Chen, X. and I.G. Macara, Par-3 controls tight junction assembly through the Rac
exchange factor Tiam1. Nat Cell Biol, 2005. 7(3): p. 262-9.
21. Tolias, K.F., et al., The Rac1-GEF Tiam1 Couples the NMDA Receptor to the Activity-
Dependent Development of Dendritic Arbors and Spines. Neuron, 2005. 45(4): p. 525-
538.
22. Zhang, H. and I.G. Macara, The polarity protein PAR-3 and TIAM1 cooperate in dendritic
spine morphogenesis. Nat Cell Biol, 2006. 8(3): p. 227-37.
23. Um, K., et al., Dynamic control of excitatory synapse development by a Rac1 GEF/GAP
regulatory complex. Developmental cell, 2014. 29(6): p. 701-715.
24. Tolias, K.F., et al., The Rac1 guanine nucleotide exchange factor Tiam1 mediates EphB
receptor-dependent dendritic spine development. Proc Natl Acad Sci U S A, 2007.
104(17): p. 7265-70.
25. Duman, J.G., et al., The adhesion-GPCR BAI1 regulates synaptogenesis by controlling the
recruitment of the Par3/Tiam1 polarity complex to synaptic sites. J Neurosci, 2013.
33(16): p. 6964-78.
26. Penzes, P. and I. Rafalovich, Regulation of the actin cytoskeleton in dendritic spines. Adv
Exp Med Biol, 2012. 970: p. 81-95.
27. Tang, L.T.H., et al., TIAM-1/GEF can shape somatosensory dendrites independently of its
GEF activity by regulating F-actin localization. eLife, 2019. 8: p. e38949.
28. Cembrowski, M.S., et al., Hipposeq: a comprehensive RNA-seq database of gene
expression in hippocampal principal neurons. eLife, 2016. 5: p. e14997.
29. Lein, E.S., et al., Genome-wide atlas of gene expression in the adult mouse brain. Nature,
2006. 445: p. 168.
30. Elias, G.M., et al., Differential trafficking of AMPA and NMDA receptors by SAP102 and
PSD-95 underlies synapse development. Proc Natl Acad Sci U S A, 2008. 105(52): p.
20953-8.
31. Schnell, E., et al., Direct interactions between PSD-95 and stargazin control synaptic
AMPA receptor number. Proceedings of the National Academy of Sciences, 2002. 99(21):
p. 13902-13907.
32. Malinow, R. and R.W. Tsien, Presynaptic enhancement shown by whole-cell recordings of
long-term potentiation in hippocampal slices. Nature, 1990. 346(6280): p. 177-80.
33. Gray, J.A., et al., Distinct modes of AMPA receptor suppression at developing synapses by
GluN2A and GluN2B: single-cell NMDA receptor subunit deletion in vivo. Neuron, 2011.
71(6): p. 1085-101.
34. Del Castillo, J. and B. Katz, Quantal components of the end-plate potential. J Physiol,
1954. 124(3): p. 560-73.
35. Bekkers, J.M. and C.F. Stevens, Presynaptic mechanism for long-term potentiation in the
hippocampus. Nature, 1990. 346(6286): p. 724-9.
60
36. Levy, J.M., et al., Synaptic Consolidation Normalizes AMPAR Quantal Size following
MAGUK Loss. Neuron, 2015. 87(3): p. 534-48.
37. Goold, C.P. and R.A. Nicoll, Single-cell optogenetic excitation drives homeostatic synaptic
depression. Neuron, 2010. 68(3): p. 512-28.
38. Habets, G.G., et al., Identification of an invasion-inducing gene, Tiam-1, that encodes a
protein with homology to GDP-GTP exchangers for Rho-like proteins. Cell, 1994. 77(4): p.
537-49.
39. Michiels, F., et al., A role for Rac in Tiam1-induced membrane ruffling and invasion.
Nature, 1995. 375(6529): p. 338-40.
40. Matsuzaki, M., et al., Dendritic spine geometry is critical for AMPA receptor expression in
hippocampal CA1 pyramidal neurons. Nature Neuroscience, 2001. 4: p. 1086.
41. Dailey, M.E. and S.J. Smith, The Dynamics of Dendritic Structure in Developing
Hippocampal Slices. The Journal of Neuroscience, 1996. 16(9): p. 2983-2994.
42. Cohen-Cory, S., The Developing Synapse: Construction and Modulation of Synaptic
Structures and Circuits. Science, 2002. 298(5594): p. 770-776.
43. Durand, G.M., Y. Kovalchuk, and A. Konnerth, Long-term potentiation and functional
synapse induction in developing hippocampus. Nature, 1996. 381(6577): p. 71-5.
44. Okabe, S., A. Miwa, and H. Okado, Spine Formation and Correlated Assembly of
Presynaptic and Postsynaptic Molecules. The Journal of Neuroscience, 2001. 21(16): p.
6105-6114.
45. Worthylake, D.K., K.L. Rossman, and J. Sondek, Crystal structure of Rac1 in complex with
the guanine nucleotide exchange region of Tiam1. Nature, 2000. 408(6813): p. 682-8.
46. Zheng, Y., et al., The pleckstrin homology domain mediates transformation by oncogenic
dbl through specific intracellular targeting. J Biol Chem, 1996. 271(32): p. 19017-20.
47. Karnoub, A.E., et al., Molecular basis for Rac1 recognition by guanine nucleotide
exchange factors. Nature Structural Biology, 2001. 8: p. 1037.
48. Matsuzawa, K., et al., PAR3-aPKC regulates Tiam1 by modulating suppressive internal
interactions. Mol Biol Cell, 2016. 27(9): p. 1511-23.
49. Xu, Z., et al., The Tiam1 guanine nucleotide exchange factor is auto-inhibited by its
pleckstrin homology coiled-coil extension domain. J Biol Chem, 2017. 292(43): p. 17777-
17793.
50. De Rubeis, S., et al., CYFIP1 coordinates mRNA translation and cytoskeleton remodeling
to ensure proper dendritic spine formation. Neuron, 2013. 79(6): p. 1169-82.
51. Nakayama, A.Y. and L. Luo, Intracellular signaling pathways that regulate dendritic spine
morphogenesis. Hippocampus, 2000. 10(5): p. 582-6.
52. Tashiro, A. and R. Yuste, Regulation of dendritic spine motility and stability by Rac1 and
Rho kinase: evidence for two forms of spine motility. Mol Cell Neurosci, 2004. 26(3): p.
429-40.
53. Saneyoshi, T., et al., Reciprocal Activation within a Kinase-Effector Complex Underlying
Persistence of Structural LTP. Neuron, 2019. 102(6): p. 1199-1210.e6.
54. Bollag, A.M.C., et al., Regulation of Tiam1 Nucleotide Exchange Activity by Pleckstrin
Domain Binding Ligands. 2000.
55. Exton, I.N.F., et al., Ca2+/Calmodulin-dependent Protein Kinase II Regulates Tiam1 by
Reversible Protein Phosphorylation. 1999.
61
56. Mertens, A.E., R.C. Roovers, and J.G. Collard, Regulation of Tiam1-Rac signalling. FEBS
Lett, 2003. 546(1): p. 11-6.
57. Terawaki, S., et al., The PHCCEx domain of Tiam1/2 is a novel protein- and membrane-
binding module, in EMBO J. 2010. p. 236-50.
58. Schmidt, A. and A. Hall, Guanine nucleotide exchange factors for Rho GTPases: turning
on the switch. Genes Dev, 2002. 16(13): p. 1587-609.
59. Farris, S., et al., Hippocampal Subregions Express Distinct Dendritic Transcriptomes that
Reveal Differences in Mitochondrial Function in CA2. Cell Reports, 2019. 29(2): p. 522-
539.e6.
60. Gerber, K.J., et al., Specific Proteomes of Hippocampal Regions CA2 and CA1 Reveal
Proteins Linked to the Unique Physiology of Area CA2. Journal of Proteome Research,
2019. 18(6): p. 2571-2584.
61. Franjic, D., et al., Molecular Diversity Among Adult Human Hippocampal and Entorhinal
Cells. bioRxiv, 2020: p. 2019.12.31.889139.
62. Fort, P. and A. Blangy, The Evolutionary Landscape of Dbl-Like RhoGEF Families:
Adapting Eukaryotic Cells to Environmental Signals. Genome Biology and Evolution,
2017. 9(6): p. 1471-1486.
63. Cook, D.R., K.L. Rossman, and C.J. Der, Rho guanine nucleotide exchange factors:
regulators of Rho GTPase activity in development and disease. Oncogene, 2014. 33(31):
p. 4021-4035.
64. Um, K., et al., Dynamic control of excitatory synapse development by a Rac1 GEF/GAP
regulatory complex. Dev Cell, 2014. 29(6): p. 701-15.
65. Penzes, P., et al., The neuronal Rho-GEF Kalirin-7 interacts with PDZ domain-containing
proteins and regulates dendritic morphogenesis. Neuron, 2001. 29(1): p. 229-42.
66. Tolias, K.F., et al., The Rac1-GEF Tiam1 couples the NMDA receptor to the activity-
dependent development of dendritic arbors and spines. Neuron, 2005. 45(4): p. 525-38.
67. Nishimura, T., et al., Role of numb in dendritic spine development with a Cdc42 GEF
intersectin and EphB2. Mol Biol Cell, 2006. 17(3): p. 1273-85.
68. Tyagarajan, S.K., et al., Collybistin splice variants differentially interact with gephyrin and
Cdc42 to regulate gephyrin clustering at GABAergic synapses. J Cell Sci, 2011. 124(Pt 16):
p. 2786-96.
69. Rao, A., et al., Heterogeneity in the molecular composition of excitatory postsynaptic
sites during development of hippocampal neurons in culture. J Neurosci, 1998. 18(4): p.
1217-29.
70. Rao, S., Y. Kay, and B.E. Herring, Tiam1 is Critical for Glutamatergic Synapse Structure
and Function in the Hippocampus. The Journal of Neuroscience, 2019. 39(47): p. 9306.
71. Hoshino, M., et al., Identification of the stef gene that encodes a novel guanine
nucleotide exchange factor specific for Rac1. J Biol Chem, 1999. 274(25): p. 17837-44.
72. Chiu, C.Y., et al., Cloning and characterization of T-cell lymphoma invasion and
metastasis 2 (TIAM2), a novel guanine nucleotide exchange factor related to TIAM1.
Genomics, 1999. 61(1): p. 66-73.
73. Habets, G.G.M., et al., Identification of an invasion-inducing gene, Tiam-1, that encodes
a protein with homology to GDP-GTP exchangers for Rho-like proteins. Cell, 1994. 77(4):
p. 537-549.
62
74. Shepherd, T.R., et al., Distinct ligand specificity of the Tiam1 and Tiam2 PDZ domains.
Biochemistry, 2011. 50(8): p. 1296-1308.
75. Maltas, J., et al., Mechanisms and consequences of dysregulation of the Tiam family of
Rac activators in disease. Biochemical Society Transactions, 2020. 48(6): p. 2703-2719.
76. Kawauchi, T., et al., The in vivo roles of STEF/Tiam1, Rac1 and JNK in cortical neuronal
migration. The EMBO journal, 2003. 22(16): p. 4190-4201.
77. Matsuo, N., et al., Characterization of STEF, a guanine nucleotide exchange factor for
Rac1, required for neurite growth. J Biol Chem, 2002. 277(4): p. 2860-8.
78. Yoshizawa, M., et al., Expression of stef, an activator of Rac1, correlates with the stages
of neuronal morphological development in the mouse brain. Mechanisms of
Development, 2002. 113(1): p. 65-68.
79. Rooney, C., et al., The Rac activator STEF (Tiam2) regulates cell migration by
microtubule-mediated focal adhesion disassembly. EMBO reports, 2010. 11(4): p. 292-
298.
80. Woroniuk, A., et al., STEF/TIAM2-mediated Rac1 activity at the nuclear envelope
regulates the perinuclear actin cap. Nature Communications, 2018. 9(1): p. 2124.
81. Herring, B.E. and R.A. Nicoll, Kalirin and Trio proteins serve critical roles in excitatory
synaptic transmission and LTP. Proceedings of the National Academy of Sciences, 2016.
113(8): p. 2264.
82. Fleming, I.N., et al., Ca2+/calmodulin-dependent protein kinase II regulates Tiam1 by
reversible protein phosphorylation. J Biol Chem, 1999. 274(18): p. 12753-8.
83. Kojima, H., et al., The role of CaMKII-Tiam1 complex on learning and memory. Neurobiol
Learn Mem, 2019. 166: p. 107070.
84. Bond, A.M., et al., Differential Timing and Coordination of Neurogenesis and
Astrogenesis in Developing Mouse Hippocampal Subregions. Brain Sci, 2020. 10(12).
85. Zhao, Z.Y., et al., TIAM2 enhances non-small cell lung cancer cell invasion and motility.
Asian Pac J Cancer Prev, 2013. 14(11): p. 6305-9.
86. Chen, J.-S., et al., Expression of T-cell lymphoma invasion and metastasis 2 (TIAM2)
promotes proliferation and invasion of liver cancer. International Journal of Cancer,
2012. 130(6): p. 1302-1313.
87. Li, S., et al., The Fibroblast TIAM2 Promotes Lung Cancer Cell Invasion and Metastasis. J
Cancer, 2019. 10(8): p. 1879-1889.
88. Vigil, D., et al., Ras superfamily GEFs and GAPs: validated and tractable targets for
cancer therapy? Nature reviews. Cancer, 2010. 10(12): p. 842-857.
89. Barrio-Real, L. and M.G. Kazanietz, Rho GEFs and Cancer: Linking Gene Expression and
Metastatic Dissemination. Science Signaling, 2012. 5(244): p. pe43-pe43.
90. Baio, J., et al., Prevalence of Autism Spectrum Disorder Among Children Aged 8 Years -
Autism and Developmental Disabilities Monitoring Network, 11 Sites, United States,
2014. MMWR Surveill Summ, 2018. 67(6): p. 1-23.
91. Bai, D., et al., Association of Genetic and Environmental Factors With Autism in a 5-
Country Cohort. JAMA Psychiatry, 2019. 76(10): p. 1035-1043.
92. Hansen, S.N., et al., Recurrence Risk of Autism in Siblings and Cousins: A Multinational,
Population-Based Study. Journal of the American Academy of Child & Adolescent
Psychiatry, 2019. 58(9): p. 866-875.
63
93. Rylaarsdam, L. and A. Guemez-Gamboa, Genetic Causes and Modifiers of Autism
Spectrum Disorder. Frontiers in Cellular Neuroscience, 2019. 13: p. 385.
94. Devlin, B. and S.W. Scherer, Genetic architecture in autism spectrum disorder. Curr Opin
Genet Dev, 2012. 22(3): p. 229-37.
95. Veenstra-Vanderweele, J., S.L. Christian, and E.H. Cook, Jr., Autism as a paradigmatic
complex genetic disorder. Annu Rev Genomics Hum Genet, 2004. 5: p. 379-405.
96. Grove, J., et al., Identification of common genetic risk variants for autism spectrum
disorder. Nature Genetics, 2019. 51(3): p. 431-444.
97. Feliciano, P., et al., Exome sequencing of 457 autism families recruited online provides
evidence for autism risk genes. npj Genomic Medicine, 2019. 4(1): p. 19.
98. Satterstrom, F.K., et al., Large-Scale Exome Sequencing Study Implicates Both
Developmental and Functional Changes in the Neurobiology of Autism. Cell, 2020.
180(3): p. 568-584.e23.
99. Stein, J.L., N.N. Parikshak, and D.H. Geschwind, Rare inherited variation in autism:
beginning to see the forest and a few trees. Neuron, 2013. 77(2): p. 209-211.
100. Volkmar, F., et al., Practice Parameter for the Assessment and Treatment of Children and
Adolescents With Autism Spectrum Disorder. Journal of the American Academy of Child
& Adolescent Psychiatry, 2014. 53(2): p. 237-257.
101. Munnich, A., et al., Impact of on-site clinical genetics consultations on diagnostic rate in
children and young adults with autism spectrum disorder. Molecular autism, 2019. 10: p.
33-33.
102. Du, X., et al., Genetic Diagnostic Evaluation of Trio-Based Whole Exome Sequencing
Among Children With Diagnosed or Suspected Autism Spectrum Disorder. Frontiers in
genetics, 2018. 9: p. 594-594.
103. Herman, G.E., et al., Genetic testing in autism: how much is enough? Genetics in
Medicine, 2007. 9(5): p. 268-274.
104. Abdul-Rahman, O.A. and L. Hudgins, The diagnostic utility of a genetics evaluation in
children with pervasive developmental disorders. Genetics in Medicine, 2006. 8(1): p. 50-
54.
105. Schaefer, G.B. and R.E. Lutz, Diagnostic yield in the clinical genetic evaluation of autism
spectrum disorders. Genetics in Medicine, 2006. 8(9): p. 549-556.
106. Barton, K.S., et al., Pathways from autism spectrum disorder diagnosis to genetic testing.
Genetics in medicine : official journal of the American College of Medical Genetics,
2018. 20(7): p. 737-744.
107. Schaefer, G.B., et al., Clinical genetics evaluation in identifying the etiology of autism
spectrum disorders: 2013 guideline revisions. Genetics in Medicine, 2013. 15(5): p. 399-
407.
108. Volk, L., et al., Glutamate Synapses in Human Cognitive Disorders. Annual Review of
Neuroscience, 2015. 38(1): p. 127-149.
109. Sadybekov, A., et al., An autism spectrum disorder-related de novo mutation hotspot
discovered in the GEF1 domain of Trio. Nature Communications, 2017. 8(1): p. 601.
110. Paskus, J.D., et al., Synaptic Kalirin-7 and Trio Interactomes Reveal a GEF Protein-
Dependent Neuroligin-1 Mechanism of Action. Cell Rep, 2019. 29(10): p. 2944-2952.e5.
64
111. Blangy, A., et al., TrioGEF1 controls Rac- and Cdc42-dependent cell structures through
the direct activation of rhoG. J Cell Sci, 2000. 113 ( Pt 4): p. 729-39.
112. O'Roak, B.J., et al., Sporadic autism exomes reveal a highly interconnected protein
network of de novo mutations. Nature, 2012. 485(7397): p. 246-50.
113. de Ligt, J., et al., Diagnostic exome sequencing in persons with severe intellectual
disability. N Engl J Med, 2012. 367(20): p. 1921-9.
114. Sanders, S.J., et al., De novo mutations revealed by whole-exome sequencing are
strongly associated with autism. Nature, 2012. 485(7397): p. 237-241.
115. De Rubeis, S., et al., Synaptic, transcriptional and chromatin genes disrupted in autism.
Nature, 2014. 515(7526): p. 209-15.
116. Karczewski, K.J., et al., The mutational constraint spectrum quantified from variation in
141,456 humans. Nature, 2020. 581(7809): p. 434-443.
117. McPherson, C.E., B.A. Eipper, and R.E. Mains, Multiple novel isoforms of Trio are
expressed in the developing rat brain. Gene, 2005. 347(1): p. 125-135.
118. Tian, C., et al., An Intellectual Disability-Related Missense Mutation in Rac1 Prevents LTP
Induction. Frontiers in Molecular Neuroscience, 2018. 11(223).
119. Zhao, N., et al., Determining effects of non-synonymous SNPs on protein-protein
interactions using supervised and semi-supervised learning. PLoS Comput Biol, 2014.
10(5): p. e1003592.
120. Gnad, F., et al., Assessment of computational methods for predicting the effects of
missense mutations in human cancers. BMC Genomics, 2013. 14 Suppl 3(Suppl 3): p. S7.
121. Khurana, E., et al., Interpretation of genomic variants using a unified biological network
approach. PLoS Comput Biol, 2013. 9(3): p. e1002886.
122. Reva, B., Y. Antipin, and C. Sander, Predicting the functional impact of protein mutations:
application to cancer genomics. Nucleic Acids Res, 2011. 39(17): p. e118.
123. Kumar, P., S. Henikoff, and P.C. Ng, Predicting the effects of coding non-synonymous
variants on protein function using the SIFT algorithm. Nat Protoc, 2009. 4(7): p. 1073-81.
124. Merk, A., et al., Breaking Cryo-EM Resolution Barriers to Facilitate Drug Discovery. Cell,
2016. 165(7): p. 1698-1707.
125. Fernandez-Leiro, R. and S.H.W. Scheres, Unravelling biological macromolecules with
cryo-electron microscopy. Nature, 2016. 537(7620): p. 339-346.
126. Johansson, L.C., et al., A Bright Future for Serial Femtosecond Crystallography with
XFELs. Trends in biochemical sciences, 2017. 42(9): p. 749-762.
127. Webb, B., et al., Modeling of proteins and their assemblies with the integrative modeling
platform. Methods Mol Biol, 2011. 781: p. 377-97.
128. Senior, A.W., et al., Improved protein structure prediction using potentials from deep
learning. Nature, 2020. 577(7792): p. 706-710.
129. Schapira, M., M. Totrov, and R. Abagyan, Prediction of the binding energy for small
molecules, peptides and proteins. Journal of Molecular Recognition, 1999. 12(3): p. 177-
190.
130. Stoppini, L., P.A. Buchs, and D. Muller, A simple method for organotypic cultures of
nervous tissue. J Neurosci Methods, 1991. 37(2): p. 173-82.
65
131. Prang, P., D. Del Turco, and J.P. Kapfhammer, Regeneration of entorhinal fibers in mouse
slice cultures is age dependent and can be stimulated by NT-4, GDNF, and modulators of
G-proteins and protein kinase C. Exp Neurol, 2001. 169(1): p. 135-47.
132. Bonnici, B. and J.P. Kapfhammer, Modulators of signal transduction pathways can
promote axonal regeneration in entorhino-hippocampal slice cultures. Eur J Pharmacol,
2009. 612(1-3): p. 35-40.
133. Lu, W., et al., Subunit composition of synaptic AMPA receptors revealed by a single-cell
genetic approach. Neuron, 2009. 62(2): p. 254-68.
134. Schnell, E., et al., Direct interactions between PSD-95 and stargazin control synaptic
AMPA receptor number. Proc Natl Acad Sci U S A, 2002. 99(21): p. 13902-7.

66
APPENDICES

Materials And Methods

EXPERIMENTAL CONSTRUCTS

Previously characterized shRNA target sequences against rat Tiam1 (5’-
GAGGGAGAAGGAAGTGGTCT-3’) (Tolias et al., 2005) and Tiam2 (5′-
GGAGCTGCCTTTCTCACTTTA-3[34]) were used. Tiam1 and Tiam2 shRNA were
respectively subcloned behind the H1 promoter region of a GFP-expressing pFHUGW
expression vector.
Human Tiam1 cDNA sequence was acquired from a construct containing human Tiam1
cDNA (Open Biosystems; accession no. BC117196). Rat Tiam2 cDNA sequence was
acquired from a construct containing rat Tiam2 cDNA (GenScript cat# ORa14059; accession
no. XM_017589890.1).
The shRNA resistant Tiam1 and Tiam2 were generated by introducing 5 silent point-
mutations within the RNAi target sequence in Tiam1 (AAGAGAAAAAGAGGTGGTCT)
and Tiam2 cDNA (GAAGTTGTCTATCACACTTTA). All cloning was performed using
overlap-extension PCR followed by In-fusion Cloning (Clontech, Takara Bio USA, Inc.,
Mountain View, CA). Rat shRNA-resistant Tiam1 and Tiam2 cDNA were cloned into a
pCAGGS-IRES-mCherry expression vector and co-expressed with a pFHUG vector
containing GFP for easy visualization of transfected neurons.
The Tiam1 ∆DH mutant was generated by deleting the approximately 200 residue Dbl-
homology (DH) domain (Lys1040-Glu1233) and Tiam2 ∆DH mutant was generated by
deleting the approximately 200 residue Dbl-homology (DH1) domain (Arg1117-Met1312).
Overlap-extension PCR was used followed by In-fusion Cloning (Clontech, Takara Bio
67
USA, Inc., Mountain View, CA) into a pCAGGS-IRES-mCherry expression vector and the
constructs were co-expressed with a pFHUG vector containing GFP. The GFP construct also
served as a control vector for spine imaging experiments.
The Tiam1 ∆PHn-CC-Ex mutant was generated by deleting the approximately 300 residue
Pleckstrin homology coiled-coil extra (PHn-CC-Ex) domain (Ala428-Thr702) using the
same method as described above. The GFP construct also served as a control vector for spine
imaging experiments.
Human TRIO-9 (or TRIO-9s in McPherson CE et al., 2004) was generated from a TRIO-FL
cDNA generously provided by Dr. Betty A. Eipper (University of Connecticut). TRIO
mutations were made from TRIO-9 cDNA using either overlap-extension PCR followed by
In-fusion cloning (Clontech) or by Genscript™ using their gene synthesis services. All
plasmids were confirmed by DNA sequencing. TRIO-9 cDNAs were cloned into a pCAGGs
vector containing IRES-mCherry. A pFUGW vector expressing only GFP was co-expressed
with pCAGG-IRES-mCherry TRIO-9 mutant constructs to enhance identification of
transfected neurons.

IMMUNOHISTOCHEMISTRY

For Tiam1 experiments involving frozen slice immunohistochemistry, P15 rat hippocampi
were dissected and fixed in 4% paraformaldehyde in 1xPBS for 30 minutes, followed by
overnight suspension in 60% sucrose in 1xPBS. The tissue was then frozen in cryoprotectant
freezing media (Electron Microscopy Services, #72592) and sectioned to 15µm slices at -
20˚C. For Tiam2 experiments involving whole-slice immunohistochemistry, P15 rat
hippocampi were dissected and fixed in 4% paraformaldehyde, 1xPBS solution overnight at
68
4°C then transferred into 1XPBS solution. The fixed tissue was sliced to 100-150µm slices
using a MX-TS tissue slicer (Siskiyou, Grants Pass, Oregon).
Tissue sections were mounted on microscope slides and probed with antibodies against
Tiam1 (sheep anti-Tiam1, 1:100, R&D Systems #AF5038) and Prox1 (anti-Prox1, 1:2000,
Millipore #ab5475) or Tiam2 (mouse monoclonal anti-Tiam2, 1:100, sc-514090, Santa Cruz
Biotechnology, Dallas, Texas). Fluorophore-coupled secondary antibodies were used for
detection. Slides were imaged using a Zeiss 510 confocal microscope equipped with an EC
Plan Neofluoar 40x/1.3 Oil DIC objective for frozen immunohistochemistry experiments and
imaged using a Zeiss LSM-780 inverted microscope equipped with a 10x/0.45 M27 objective
for whole-slice immunohistochemistry experiments. Z-stacks were captured at 0.5 µm
intervals and processed to create maximum intensity projections. For whole-slice
immunohistochemistry, 15 16-bit images were processed using Zeiss Zen Software to
produce a single image file.

ELECTROPHYSIOLOGY

Organotypic entorhino-hippocampal slice cultures were prepared from P6 to P8 Sprague-
Dawley rats of both sexes as previously described (Stoppini et al., 1991; Prang et al., 2001;
Bonnici and Kapfhammer, 2009). Tissue was isolated and a MX-TS tissue slicer (Siskiyou,
Grants Pass, Oregon) was used to make 400 μm transverse sections. Tissue slices were
placed on squares of Biopore Membrane filter roll (Millipore) and placed on Millicell Cell
Culture inserts (Millipore, Burlington, MA) in 35 mm dishes. The slices were fed on
alternate days with 1 ml culture media (MEM + HEPES (Gibco 12360-038), horse serum
(25%), HBSS (25%) and L-glutamine (1 mM)).

69
Sparse biolistic transfections were performed on DIV1 as previously described (Stoppini et
al., 1991; Schnell et al., 2002; Lu et al., 2009). Recordings were made on DIV 7 or 9 in slice
cultures on an upright Olympus BX50WI microscope and perfused at 2.5 mL min−1 with
artificial cerebrospinal fluid containing 119 mM NaCl, 2.5 mM KCl, 1 mM NaH2PO4, 26.2
mM NaHCO3, 11 mM glucose, 4 mM CaCl2, 4 mM MgSO4 supplemented with 5 μM 2-
chloroadenosine to dampen epileptiform activity and 0.1 mM picrotoxin to block GABA (A)
receptors. Borosilicate recording electrodes were filled with an internal solution containing
135 mM CsMeSO4, 8 mM NaCl, 10 mM HEPES, 0.3 mM EGTA, 5 mM QX-314, 4 mM
Mg-ATP, and 0.3 mM Na-GTP adjusted to pH 7.3–7.4 and osmolarity 290–295 mOsm. The
aCSF was bubbled with 95% (vol/vol) O2 and 5% (vol/vol) CO2 to maintain pH. For acute
slice experiments, in utero electroporation was performed as previously described [40] and
2.5 mM CaCl2 and 1.3 mM MgSO4 were added to the aCSF, while 4mM CaCl2 and 4 mM
MgSO4 were added for organotypic slice cultures. Osmolality was adjusted to 305-315
mOsm for organotypic slices and to 290mM for acute slices. For organotypic slice
experiments, aCSF was supplemented with 5μM 2-chloroadenosine to dampen epileptiform
activity and 0.1mM picrotoxin to block GABA (A) receptors. The aCSF was bubbled with
95% (vol/vol) O2 and 5% (vol/vol) CO2 to maintain pH.

All electrophysiology experiments were performed on an upright Olympus BX50WI
microscope. DG granule neurons and CA1 pyramidal neurons were identified using
differential interference phase contrast microscopy, while GFP expressing transfected cells
were identified using epifluorescence microscopy. Postsynaptic currents were elicited by
stimulation of either stratum radiatum or perforant pathway afferents with a monopolar glass
70
electrode. Membrane voltage was held at -70 mV to measure AMPAR-eEPSCs, and at +40
mV to measure NMDAR-eEPSCs. While both AMPAR and NMDAR currents were usually
measured from the same paired recording, NMDA current amplitudes were measured at
150ms after stimulation to avoid contamination with the AMPAR current. No more than one
pair was recorded from a single entorhino-hippocampal slice. For LTP experiments,
potentiation was induced by holding neurons at 0 mV during a 2-Hz stimulation of Schaffer
collaterals for 90s. To minimize runup of baseline responses during LTP, cells were held
cell-attached for ∼1–2 min before breaking into the cell. Membrane holding current, pipette
series resistance and input resistance were monitored throughout recording sessions.
Membrane holding current, pipette series resistance and input resistance were monitored
throughout recording sessions. Data were gathered through a MultiClamp 700B amplifier
(Axon Instruments), filtered at 2 kHz, and digitized at 10 kHz.

CV analysis was performed on AMPAR-eEPSCs by calculating the mean (M) and standard
deviation (Kokaia et al.) of 20 consecutively recorded current amplitudes for both control
and transfected cells within a pair from a dual-whole cell patch clamp recording. From
several such pairs, the coefficient of variation (CV) was calculated as SD/M. It has been
shown both theoretically and experimentally that CV-2 (M2/SD2) is invariant with changes
in quantal size (i.e., the number of AMPA receptors at all synapses) and that CV-2 varies
predictably with changes in quantal content (i.e. the number of functional synapses
containing AMPA receptors) according to the following equation CV-2= n x Pr/ (1-Pr) where
n is the number of vesicle release sites, and Pr is the probability of presynaptic release. To
compare the eEPSC variance with changes in mean amplitude, the CV-2 values for
71
transfected and control cells were plotted on the y-axis, against the ratios of means for
transfected and control cells that were plotted on the x-axis. Values above the 45⁰ (y=x) line
indicate increases in quantal content while values approaching the horizontal line (y=1)
indicate a change in quantal size as ultimately responsible for the difference in AMPAR-
eEPSC amplitude between the control and transfected cells.

Failure analysis was performed by analyzing AMPAR-eEPSCs from dual-whole cell patch
clamp recordings where stimulation levels elicited failures that could be easily distinguished
from currents by eye. Events were assigned as failures if their absolute magnitudes were less
than or equal to noise for each sweep. The number of failures for each cell was estimated as
the number of events with absolute current amplitude greater than noise divided by the total
number of events to yield the % Failure Rate.

IMAGING AND SPINE ANALYSIS

Cultured entorhino-hippocampal slices were transfected with FHUGW-GFP shRNA
constructs alone or FHUGW-GFP shRNA and pCAGGS-mCherry cDNA constructs ~18-20h
after plating using biolistic transfection. Experimenter was blinded to genotype during
subsequent processing and imaging. Slices were fixed in 4% PFA, 4% sucrose in PBS, and
washed 3 times with PBS, then cleared with an abbreviated SeeDB-based protocol (Ke et al
2013) and mounted on microscope slides. High-resolution confocal Z-stacks of spine-
containing DG granule neuron apical dendrites and CA1 pyramidal neuron apical dendrites
were acquired on a Zeiss 510 using a Plan Apochromat 63x/1.4 Oil DIC objective. Z-stacks
were collected at maximum X-Y pixel dimensions (2048px x 2048px) at 12-bits with X-Y
72
spatial resolution of 70 nm and axial resolution of 500 nm with a 488 nm laser excitation
wavelength. Automated analysis of dendritic segments and spines was performed using the
commercially available software Filament Tracer (Imaris 9.1.2, Bitplane, Belfast, UK). For
each cell, an approximately 60 μm dendritic segment was manually selected for analysis, and
thresholds for dendritic surface and spine rendering were set (minimum spine diameter and
maximum spine length were set to 0.2 μm and 10 μm respectively). Data were exported into
Microsoft Excel and graphed using R Studio (Version 1.1.423 and 1.1.153).

WESTERN BLOTTING

Embryonic E16.5 hippocampi were dissected, dissociated, and cultured in DMEM with 10%
FBS. The neurons were plated onto six-well plates and treated with 20µl virus (pFHUG-
IRES-GFP lentivirus or pFHUG-Tiam1-IRES-GFP lentivirus or pFHUG-Tiam2-shRNA-
IRES-GFP) at DIV0 and at DIV21 cell lysates were prepared. In experiments involving
expression of Tiam1 and Tiam1 ∆DH in HEK 293T cells (ATCC, Manassas, VA), cells were
transfected with 2µg DNA (pFHUG-IRES-GFP alone, pFHUG-IRES-GFP and pCAGGS-
Tiam1-∆DH-IRES-mcherry, pFHUG-IRES-GFP and pCAGGS-Tiam-IRES-mcherry) and
cell lysates were prepared after 72h of expression. For knockdown experiments in HEK cells
a Tiam1 shRNA: Tiam1 cDNA DNA ratio of 20:1 was used, and lysates were prepared 40hr
later. All lysates were run on a 4–15% Mini-PROTEAN® TGX™ Precast Protein Gel (Life
Technologies, Carlsbad, CA) with 50 µg of protein loaded per lane. Membranes were probed
with antibodies specific for Tiam1 (1:100; sc-393315, Santa Cruz Biotechnology, Dallas,
Texas) or Tiam2 (1:100; Santa Cruz sc-514090, Santa Cruz Biotechnology, Dallas, Texas)
and β-actin (1:1000, (13E5) Rabbit mAb #4970, Cell Signaling Technology). Horseradish
73
peroxidase-coupled secondary antibodies were then used for detection. Membranes were
scanned using Bio-Rad Chemidoc Imaging System and exported using Image Lab Software.

EXPERIMENTAL DESIGN AND STATISTICAL ANALYSIS

For all experiments, at least 3 male and female rat pups were used. All electrophysiological
data are expressed as mean ± SEM. For all experiments, at least 3 male and female rat pups
were used. All imaging analysis was performed blind to genotype. Statistical significance
was determined using Wilcoxon signed-rank test for paired dual whole-cell patch clamp data,
Wilcoxon rank-sum test for imaging data, and Student’s t-test for paired-pulse facilitation
data. For RNA-seq data in hippocampal subregions, post-hoc analysis was performed on data
downloaded from the Hipposeq RNA-seq Atlas (Cembrowski et al., 2016) and imported into
R Studio (Version 1.1.423). For CV-2 analysis linear regression analysis was performed
using least-squares method using GraphPad Prism. Coefficient of variation (CV) analysis
was performed by calculating the mean (M) and standard deviation (SD) of AMPAR-
eEPSCs [42]. Twenty consecutively recorded current amplitudes for both control and
transfected cells within a pair from a dual whole-cell patch-clamp recording were used to
obtain the CV, calculated as SD/M. Theoretical and experimental work has shown that CV−2
(M2/SD2) is invariant with changes in quantal size (i.e., the number of AMPA receptors at
all synapses) and that CV−2 varies predictably with changes in quantal content (i.e., the
number of functional synapses containing AMPA receptors) according to the following
equation CV−2 = n × Pr/(1 − Pr) where n is the number of vesicle release sites, and Pr is the
probability of presynaptic release. To observe the eEPSC variance with changes in mean
amplitude, the CV−2 values for transfected and control cells were plotted on the y-axis, and
the ratios of means for transfected and control cells were plotted on the x-axis. Values above
74
the 45° (y = x) line indicate increases in quantal content, while values approaching the
horizontal line (y = 1) indicate a change in quantal size as ultimately responsible for the
difference in AMPAR-eEPSC amplitude between the control and transfected cells.
All p-values less than 0.05 were considered significant and denoted with a single asterisk, p-
values less than 0.01 were denoted with a double asterisk, and p-values less than 0.001 were
denoted with a triple asterisk. All error bars represent standard error measurement. Sample
sizes in the present study are like those reported in the literature (Herring and Nicoll, 2016;
Incontro et al., 2018).

STRUCTURE-BASED COMPUTATIONAL PREDICTIONS

The effects of mutations on stability and binding were predicted using MERSI protocol [129] as
described in Sadybekov et al 2017 [109]. Calculations were performed using ICM molecular
modeling software (Molsoft LLC). We used the high-resolution crystal structure of TRIO-GEF1
in complex with RAC1 (PDB code: 2NZ8) to model the interactions, with the all-atom model of
TRIO-GEF1 generated by the ICM conversion algorithm that adds and optimizes hydrogens and
optimizes His, Asn and Gln side chain isomers. Specifically, energy optimization of mutant
protein side chain conformations in 8 Å proximity of the mutation was performed using a biased
probability Monte Carlo algorithm. The free energy change in protein stability ∆∆Gstability (1) and
protein binding ∆∆Gbinding (2) was then calculated as a difference in folding or binding free
energies of mutant and WT protein:

∆∆𝐺 𝑠𝑡𝑎𝑏𝑖𝑙𝑖𝑡𝑦 = (∆𝐺 𝑓𝑜𝑙𝑑𝑒𝑑 𝑚𝑢𝑡𝑎𝑛𝑡 − ∆𝐺 𝑢𝑛𝑓𝑜𝑙𝑑𝑒𝑑 𝑚𝑢𝑡𝑎𝑛𝑡 ) − (∆𝐺 𝑓𝑜𝑙𝑑𝑒𝑑 𝑊𝑇
− ∆𝐺 𝑢𝑛𝑓𝑜𝑙𝑑𝑒𝑑 𝑊𝑇
) (1)
∆∆𝐺 𝑏𝑖𝑛𝑑𝑖𝑛𝑔 = ∆𝐺 𝑏𝑖𝑛𝑑𝑖𝑛𝑔 𝑚𝑢𝑡𝑎𝑛𝑡 − ∆𝐺 𝑏𝑖𝑛𝑑𝑖𝑛𝑔 𝑊𝑇
(2)
75
As per MERSI protocol, the free energy of the unfolded states was approximated by a sum of the
residue-specific energies, derived empirically using a large set of experimental data. A positive
free energy ∆∆G value indicates that the mutation is likely to be destabilizing.
ELECTROPHYSIOLOGY

P6 to P8 Sprague Dawley rats of both sexes were used to prepare organotypic hippocampal slice
cultures as previously described [130-132]. Tissue was isolated and a MX-TS tissue slicer
(Siskiyou) was used to make 400 µm transverse sections. Tissue slices were placed on squares of
Biopore Membrane Filter Roll (Millipore) and placed on Millicell Cell Culture inserts
(Millipore) in 35 mm dishes. The slices were fed on alternate days with 1 ml of culture media
(Invitrogen MEM + HEPES; catalog #12360–038, Thermo Fisher Scientific; horse serum (25%);
HBSS (25%); and L-glutamine 1 mM).

Sparse biolistic transfections were performed on day in vitro 1 (DIV1) as previously described
[133, 134]. Recordings were made on DIV7 or DIV9 in slice cultures on an upright Olympus
BX50WI Microscope and perfused at 2.5 ml min
−1
with artificial CSF (aCSF) containing 119
mM NaCl, 2.5 mM KCl, 1 mM NaH2PO4, 26.2 mM NaHCO3, 11 mM glucose, 4 mM CaCl2, and 4
mM MgSO4 adjusted to osmolality of 305–315 mOsm, supplemented with 5 μM 2-
chloroadenosine to dampen epileptiform activity and 0.1 mM picrotoxin to block
GABAA receptors. Borosilicate recording electrodes were filled with an internal solution
containing 135 mM CsMeSO4, 8 mM NaCl, 10 mM HEPES, 0.3 mM EGTA, 5 mM QX-314, 4
mM Mg-ATP, and 0.3 mM Na-GTP adjusted to pH 7.3–7.4 and osmolarity of 290–295 mOsm.
The aCSF was bubbled with 95% (v/v) O2 and 5% (v/v) CO2 to maintain pH.
76

Untransfected CA1 pyramidal neurons were identified using differential interference phase
contrast microscopy, while GFP-expressing CA1 pyramidal neurons cells were identified using
epifluorescence microscopy. Postsynaptic currents were elicited by stimulation of stratum
radiatum afferents with a monopolar glass electrode. AMPAR-evoked EPSCs (eEPSCs) were
recorded by holding membrane voltage at −70 mV and measured from the same paired
recording. No more than one pair was recorded from a single hippocampal slice. Membrane
holding current, pipette series resistance, and input resistance were monitored throughout
recording sessions. Data were gathered through a MultiClamp 700B amplifier (Molecular
Devices), filtered at 2 kHz, and digitized at 10 kHz. Data were analyzed and plotted in Microsoft
Excel and in R Studio (versions listed previously).

77
Tables
TABLE 1. MUTATIONS PREDICTED TO COMPROMISE TRIO-RAC1
BINDING INTERFACE

Prediction Mutation Effect on binding ∆∆Gstability ∆∆Gbinding
Deleterious E1299W Disrupts H-bond with Y32 and
T35 and V36 backbone
0.46 4.24
Deleterious C1387W Bulky residue instead of small
polar on the interaction
interface
-1.71 16.22
Deleterious T1430W Bulky residue instead of small
polar on the interaction
interface
-1.06 6.82
Deleterious A1464W Bulky residue instead of small
hydrophobic on the interaction
interface
-0.12 14.12
Benign T1394A TRIO-RAC1 binding interface,
DH1 domain
0.55 1.90

TABLE 2. MUTATIONS PREDICTED TO COMPROMISE TRIO-RAC1
STABILITY

Prediction Mutation Effect on stability ∆∆Gstability ∆∆Gbinding
Deleterious E1304G Disrupts H-bonds to R1428
and H1351, Y1432
3.92 1.00
Deleterious Y1318G Distorts a-helix conformation,
Disrupts H-bond to N1416
backbone
5.46 1.02
Deleterious Y1383A Disrupts H-bonds to H1351
and Y1307
3.83 0.98
Deleterious G1453W Small to big in hydrophobic
core
3.94 4.57
Benign S1403F TRIO surface, DH1 domain 1.45 .97

78

TABLE 3. COMPARISON OF OUR MODEL’S PREDICTIONS AND
POLYPHEN2

Mutation Residue
on TRIO
Predictions
Our
Model
Our Data PolyPhen2 Prediction
T1394A Not
Damaging
Not
Damaging
This mutation is predicted to be POSSIBLY
DAMAGING with a score
of 0.479 (sensitivity: 0.89; specificity: 0.90)
S1403F Not
Damaging
Not
Damaging
This mutation is predicted to be POSSIBLY
DAMAGING with a score
of 0.845 (sensitivity: 0.83; specificity: 0.93)

Abstract (if available)

Abstract RhoGEF proteins have been recently reported as powerful modulators of glutamatergic synapse function and have been implicated in the pathobiology of neuropsychiatric and neurodevelopmental disorders like Autism Spectrum Disorders (ASD), Schizophrenia (SCZ), and Intellectual Disability (ID). However, most studies that characterize the function of synaptic proteins employ a prototypical synapse as a composition and function. Reports model, overlooking diversity in synaptic suggest numerous brain, and that these subtypes glutamatergic synapse subtypes exist in the differ in molecular composition and are molecular regulatory mechanisms defined by unique . This study aims to (1) characterize the role of RhoGEFs Tiam1 and Tiam2 at glutamatergic synapses in the hippocampus and (2) investigate unique synaptic regulatory mechanisms within hippocampal subregions. Furthermore, this study (3) identifies a structure activity of t he and function autism riskgenebased approach to predicting mutations that disrupt catalytic RhoGEF Trio.
Here we investigate whether the RhoGEF protein s Tiam1 and Tiam2 play a unique role in the regulation of glutamatergic synapses in dentate granule neurons using a combination of molecular, electrophysiological, and imaging approaches in rat entorhinohippocampal slices of both sexes. We find that inhibition of Tiam1 function in dentate granule neurons reduces synaptic AMPA receptor function and causes dendritic spines to adopt an elongated filopodia like morphology. We also find that Tiam1’s support of perforant path-- DG synapse function is dependent on its GEF domain and identify a potential role for Tiam1’s autoinhibitory PH-domain in regulating Tiam1 function at these synapses. In marked contrast, reduced Tiam1 expression in CA1 pyramidal neurons produced no effect on glutamatergic synapse development. We find that Tiam1’s homolog Tiam2 is essential for normal glutamatergic neurotransmission at CA1 pyramidal neuron synapses, and that Tiam2 regulates synapse number and strength in a DH1-domain dependent manner. Interestingly, we find that Tiam2 negatively regulates synaptic function at dentate granule-perforant path synapses, indicating that it may be involved in subregion-specific, non-canonical function at these synapses. Contrary to prior reports, we also find that neither Tiam1 nor Tiam2 are essential for Long-Term Potentiation (LTP) at CA1 pyramidal neurons. Taken together, these data identify a critical role for Tiam1 and Tiam2 in the hippocampus and reveal unique molecular programs of glutamatergic synapse regulation at CA1 pyramidal neurons and dentate granule neurons.
Glutamatergic synapse dysfunction is believed to underlie the development of Autism Spectrum Disorder (ASD) and Intellectual Disability (ID) in many individuals. However, identification of genetic markers that contribute to synaptic dysfunction in these individuals is notoriously difficult. Based on genomic analysis, structural modeling, and functional data, we recently established the involvement of the TRIO-RAC1 pathway in ASD and ID and identified a hotspot of ASD-related missense mutations in TRIO’s catalytic GEF1 domain. ASD/ID-related missense mutations within this domain compromise glutamatergic synapse function and likely contribute to the development of ASD/ID. The number of ASD/ID cases with mutations identified within TRIO’s GEF1 domain is increasing. However, tools for accurately predicting whether such mutations are detrimental to protein function are lacking. Here we deployed advanced protein structural modeling techniques to predict detrimental and benign mutations within TRIO’s GEF1 domain. These mutant TRIO-9 constructs were generated and expressed in CA1 pyramidal neurons of organotypic cultured hippocampal slices. AMPA receptor-mediated postsynaptic currents were then examined in these neurons using dual wholecell patch clamp electrophysiology. TRIOMissense mutations in TRIO’s GEF1 domain that were predicted to disrupt RAC1 binding or stability greatly impaired TRIO9’s influence on glutamatergic synapse function. In contrast, missense mutations in TRIO’s GEF1 domain that were predicted to have no effect on TRIO synapseRAC1 binding or stability did not impair TRIO function. This study show s9’s influence on glutamatergic that a combination of structurebased computational predictions and experimental validation can be employed to reliably predict whether missense mutations in the human TRIO gene compromise TRIO’s role in glutamatergic synapse regulation. With the growing accessibility of genome sequencing, the use of such tools in the accurate identification of pathological mutations will be instrumental in early diagnostics of ASD/ID.

Linked assets

University of Southern California Dissertations and Theses

Conceptually similar

PDF

The role of Rho-GEF signaling in synapse function and autism-related disorders

PDF

Uncovering synapse-specific roles of proteins implicated in complex brain disorders via novel and targeted approaches

PDF

Uncovering cell type-specific roles of proteins involved in glutamatergic synapse regulation

PDF

Characterizing the hippocampal synaptic and sleep abnormalities of a mouse model of human chromosome 16p11.2 microdeletion

PDF

Presynaptic glutamate receptors and auxiliary subunits in neurotransmission and homeostatic potentiation

PDF

Dual genetic screens for mutants in synaptic homeostatic plasticity and a characterization of insomniac as a regulator for retrograde homeostatic signaling

PDF

Synaptic plasticity during neurodegeneration and axonal injury

PDF

Molecular mechanisms underlying the bi-directional control of presynaptic homeostatic plasticity

PDF

Computational investigation of glutamatergic synaptic dynamics: role of ionotropic receptor distribution and astrocytic modulation of neuronal spike timing

PDF

Engineering genetic tools to illustrate new insights into the homeostatic control of synaptic strength

PDF

Synapse maintenance and function at the mouse neuromuscular junction: implications in diseases

PDF

The role of the cofilin/Limk1 signaling pathway in axon growth during development and regeneration

PDF

Translational regulation and endosomal trafficking in synaptic adaptation to stress

PDF

The role of Schwann cells in the development of the neuromuscular junction

PDF

Elucidating neurodevelopmental consequences of syngap1 mutations and inactivated functional regions in human iPSC-derived neurons

PDF

Emergent visualization technology: evolution of PSD95.FingR

PDF

Otopetrin-1, a proton selective ion channel in taste cells

PDF

Synaptic integration in dendrites: theories and applications

PDF

Axon guidance cues in development of the mammalian auditory circuit

PDF

Signaling networks in complex brain disorders

Asset Metadata

Creator Rao, Sadhna (author)

Core Title The role of RhoGEFs in glutamatergic synapse development and human cognitive disorders

School College of Letters, Arts and Sciences

Degree Doctor of Philosophy

Degree Program Neuroscience

Degree Conferral Date 2022-08

Publication Date 06/27/2024

Defense Date 06/27/2022

Publisher University of Southern California (original), University of Southern California. Libraries (digital)

Tag ASD/ID,glutamatergic,OAI-PMH Harvest,synapses

Format application/pdf (imt)

Language English

Contributor Electronically uploaded by the author (provenance)

Advisor Arnold, Don (committee chair), Dickman, Dion (committee member), Herring, Bruce (committee member), Katritch, Vsevolod (committee member)

Creator Email sadhnara@usc.edu,sadhnaraobio@gmail.com

Permanent Link (DOI) https://doi.org/10.25549/usctheses-oUC111352080

Unique identifier UC111352080

Legacy Identifier etd-RaoSadhna-10793

Document Type Dissertation

Format application/pdf (imt)

Rights Rao, Sadhna

Type texts

Source 20220706-usctheses-batch-950 (batch), University of Southern California (contributing entity), University of Southern California Dissertations and Theses (collection)

Access Conditions The author retains rights to his/her dissertation, thesis or other graduate work according to U.S. copyright law. Electronic access is being provided by the USC Libraries in agreement with the author, as the original true and official version of the work, but does not grant the reader permission to use the work if the desired use is covered by copyright. It is the author, as rights holder, who must provide use permission if such use is covered by copyright. The original signature page accompanying the original submission of the work to the USC Libraries is retained by the USC Libraries and a copy of it may be obtained by authorized requesters contacting the repository e-mail address given.

Repository Name University of Southern California Digital Library

Repository Location USC Digital Library, University of Southern California, University Park Campus MC 2810, 3434 South Grand Avenue, 2nd Floor, Los Angeles, California 90089-2810, USA

Repository Email cisadmin@lib.usc.edu