University of Southern California Dissertations and Theses

Pseudotyped viral vectors: HIV gene therapy applications and basic studies of SARS-COV-2

(USC Thesis Other)

Pseudotyped viral vectors: HIV gene therapy applications and basic studies of SARS-COV-2

PDF

Download a page range

Download transcript

Copy asset link

Request this asset

Transcript (if available)

Content

PSEUDOTYPED VIRAL VECTORS: HIV GENE THERAPY APPLICATIONS AND
BASIC STUDIES OF SARS-COV-2

by

Hsu-Yu Chen

A Dissertation Presented to the
FACULTY OF THE USC GRADUATE SCHOOL
UNIVERSITY OF SOUTHERN CALIFORNIA
In Partial Fulfillment of the
Requirements for the Degree
DOCTOR OF PHILOSOPHY
(MEDICAL BIOLOGY)

December 2022
ii
DEDICATION

I would like to dedicate this dissertation to my beloved family. To my dad, who gave me
absolute freedom and support in choosing my field of study and career path. Who fought
bravely with cancer to extend the time the family could have together. Even though you
could not celebrate with me for my Ph.D. journey in the US, as I have always dreamed
and talked to you since I was a little girl, I know you are always with me. To my mom, who
became the sole support and safe harbor for the family after dad passed away. Thank
you for being strong and inspiring us to pursue our career dreams even though those
dreams require us to travel far away from you and our home. Thank you, and dad raised
and educated us to be independent, self-driven, and full of positive energy, which is the
essential ingredient to completing my Ph.D. training. To my two brothers, who are always
there for me virtually in different time zones, so I’m never bored. Thank you for making
me laugh and sorting out the complicated life with me. To my husband, who loves me for
better or worse, for crazy or crazier. Thank you for welcoming me home every day with a
glass of fun drink. Thank you for listening to my non-sense story of the day while preparing
dinner for us. Thank you for being there with me and pulling me out of the dark when I’m
stressed and depressed. Thank you for embracing me, the whole me.

iii
ACKNOWLEDGMENTS
I thank my adviser, Dr. Paula Cannon, for her eight years of guidance and mentorship
since I was a shy and quiet master student in the lab. I would not be able to achieve and
become who I am today without you. Thank you for your time, support, patience, and
selfless devotion to mentoring. Thank you for sharing your experiences in your career or
life with me; it allows me to understand better how to achieve excellence in this
competitive country. You are my role model in my scientific career and life, and I hope I
can make you proud one day.
I thank my best friend Meng Chen Lee, who answers my phone whenever I call, day and
night, and share anything we have in mind. Thank you for creating a safe space for me in
this unsafe world.
I would also like to thank all the past and present Cannon lab members for all the helpful
discussions, advice, and technical support. This dissertation would not be possible
without them.
I am also grateful to my committee members, Dr. Ansgar Siemer, Dr. Joseph Hacia, and
Dr. Takeshi Saito, for their guidance and constructive criticism.
Additionally, I thank Dr. Jing-Lieh Wu, my advisor when I was back in Taiwan, for his four
years training and support in both science and work ethic, which shaped me into a
passionate young scientist and ready for the Ph.D. journey, the most exciting challenge
in life.
Finally, I would like to thank my country for the USC-Taiwan fellowship that supported my
Ph.D. training in the US for the first four years of my Ph.D. training.

iv
TABLE OF CONTENTS
DEDICATION ................................................................................................................... ii
ACKNOWLEDGMENTS ................................................................................................... iii
LIST OF FIGURES .......................................................................................................... vi
ABSTRACT ..................................................................................................................... vii
CHAPTER 1: INTRODUCTION ........................................................................................ 1
1.1 Overview of pseudovirus and applications .............................................................. 1
1.2 HIV gene therapy .................................................................................................... 2
1.3 CRISPR delivery ..................................................................................................... 5
CHAPTER 2: CYTOPLASMIC TAIL TRUNCATION OF SARS-COV-2 SPIKE PROTEIN
ENHANCES TITER OF PSEUDOTYPED VECTORS BUT MASKS THE EFFECT OF
THE D614G MUTATION .................................................................................................. 9
2.1 Introduction ............................................................................................................. 9
2.2 Materials and methods .......................................................................................... 11
2.3 Results .................................................................................................................. 19
2.4 Discussion ............................................................................................................. 28
CHAPTER 3: CD4-TARGETED CRISPR/CAS9 RNP DELIVERY FOR ANTI-HIV GENE
EDITING ......................................................................................................................... 33
3.1 Introduction ........................................................................................................... 33
3.2 Materials and Methods .......................................................................................... 35
v
3.3 Result .................................................................................................................... 39
3.4 Discussion ............................................................................................................. 52
CHAPTER 4: CONCLUSION AND FUTURE PERSPECTIVES .................................... 55
REFERENCES ............................................................................................................... 56

vi
LIST OF FIGURES
Figure 1. Example of pseudovirus: SARS-CoV-2 Spike pseudotyped lentiviral vector. ... 2
Figure 2. Impact of Spike protein cytoplasmic tail truncation on LV and VSV vectors. .. 20
Figure 3. Transduction of cells by Spike VSV pseudovectors. ....................................... 21
Figure 4. Concentration methods for Spike VSV pseudovectors. .................................. 23
Figure 5. Impact of D614G mutation is only observed with full-length Spike protein. .... 25
Figure 6. ACE2 and TMPRSS2 expression on different cell lines. ................................ 27
Figure 7. Sensitivity of different Spike proteins to convalescent serum neutralization. .. 28
Figure 8. Cas9 RNP packaging and gene disruption in vitro. ........................................ 40
Figure 9. Poly-A signal in homology donor reduced HDR and vector production. ......... 42
Figure 10. Ligand for targeted LV engineering. .............................................................. 44
Figure 11. Comparing different vectors' titer and specificity. .......................................... 46
Figure 12. CD4-targeted gene delivery in CD34 humanized mouse model. ................. 48
Figure 13. Comparison of VSV-G and NiV
CD4
delivery of Cas9 RNP via aptamer/ABP. 50
Figure 14. Co-expression of non-functional VSV-G restores NiV
CD4
/VLP production. ... 51

vii
ABSTRACT
Pseudotyped viral vectors are powerful tools for basic virology studies or as the delivery
vehicle for therapeutic reagents. This dissertation examined different pseudotyped viral
vectors for their applications (1) in SARS-CoV-2 viral entry and neutralization studies and
(2) as a delivery vehicle for CRISPR/Cas9 for HIV gene therapy.
The high pathogenicity of SARS-CoV-2 requires it to be handled under biosafety level 3
conditions. Consequently, Spike protein pseudotyped vectors are a useful tool to study
viral entry and its inhibition, with retroviral, lentiviral (LV), and vesicular stomatitis virus
(VSV) vectors the most commonly used systems. Methods to increase the titer of such
vectors normally include concentration by ultracentrifugation and truncation of the Spike
protein cytoplasmic tail. However, limited studies have examined whether such a
modification impacts the protein’s function. Here, we optimized concentration methods
for SARS-CoV-2 Spike pseudotyped VSV vectors, finding that tangential flow filtration
produced vectors with more consistent titers than ultracentrifugation. We also examined
the impact of Spike tail truncation on transduction of various cell types and sensitivity to
convalescent serum neutralization. We found that tail truncation increased Spike
incorporation into both LV and VSV vectors and resulted in enhanced titers but had no
impact on sensitivity to convalescent serum inhibition. In addition, we analyzed the effect
of the D614G mutation, which became a dominant SARS-CoV-2 variant early in the
pandemic. Our studies revealed that, similar to the tail truncation, D614G independently
increases Spike incorporation and vector titers, but this effect is masked by including the
cytoplasmic tail truncation. Therefore, full-length Spike protein, combined with tangential
viii
flow filtration, is recommended to generate high titer pseudotyped vectors that retain
native Spike protein functions.
For HIV gene therapy, improved in vivo gene editing will provide significant advances to
engineer anti-HIV resistance in uninfected cells and target integrated viral genomes in
infected cells. To do in vivo gene editing, a delivery vehicle that can target CD4+ T cells
is desirable. This study explores strategies to develop lentivirus-based vector-like
particles (VLPs) pseudotyped with engineered CD4-targeted paramyxovirus. The CD4-
targeted VLP were examined for their ability to package CRISPR/Cas9 ribonucleoproteins
(RNPs) and cell type-specific delivery. The goal is to allow delivery specifically to resting
CD4+ lymphocytes without long-term expression of the Cas9 protein for safer in vivo gene
editing.
As proof of principle, we targeted CCR5, an essential co-receptor for HIV entry. Using
resting CD4+ T cells ex vivo, we found that CD4-targeted paramyxovirus glycoproteins
provided significantly higher delivery rates than VSV-G and were able to specifically
transduce CD4+ T cells in vivo in a humanized mouse model. For Cas9 packaging and
delivery, the aptamer/ABP approach resulted in the best gene editing efficiency. It was
then tested for its compatibility with a lentiviral genome packaging to deliver a homology
donor template for homology-directed gene editing. Unexpectedly, switching from VSV-
G to CD4-targeted glycoproteins in VLP production resulted in a reduction in particle
amount and loss of RNP function in target cells. Interestingly, co-expression of a non-
functional VSV-G mutant could restore VLP production. These findings provide insights
into the potential of lentiviral VLPs to function as a transient all-in-one delivery system
ix
and the challenges of optimizing an in vivo gene editing system targeting resting CD4+ T
cells.
1
CHAPTER 1: INTRODUCTION

1.1 Overview of pseudovirus and applications
A pseudovirus is a vector particle that combines elements from at least two different
viruses. Figure 1 shows an example of a SARS-CoV-2 Spike pseudotyped lentiviral vector.
This vector system has SARS-CoV-2 spike protein as the envelope but lentiviral vector
genome and structural proteins. Therefore, the vector entry is controlled by the SARS-
CoV-2 spike. Once the cells enter, a reporter gene designed in the lentiviral vector
genome can serve as the reporter function to help examine the entry efficiency and
mechanism.
The advantage of using a pseudovirus, in general, is that it creates a replication-
incompetent vector system, and therefore gives us a safer platform to study viral entry
controlled by the envelope protein.
For gene therapy specifically, pseudoviruses are good tools because we can easily
manipulate the vector tropism by engineering the envelope protein. And also easy to
insert the gene of interest due to the vector core, like lentiviral vectors, being well studied.

2

Figure 1. Example of pseudovirus: SARS-CoV-2 Spike pseudotyped lentiviral vector.
Red: SARS-CoV-2 Spike protein as vector envelop protein which controls cell entry. Green:
lentiviral vector structural proteins and genome containing functional or reporter genes depending
on the application.

1.2 HIV gene therapy
For the vast majority of the estimated 38 million people living with HIV (PWH) worldwide,
the virus is a lifelong infection that will be deadly without continuous antiretroviral therapy
(ART). Although ART is capable of suppressing HIV to levels that are both undetectable
and non-transmissible, access to and adherence to ART can fail at multiple stages in
even resource-rich countries (1). Consequently, one-shot or limited-time treatments to
provide sustained virus control or even eradication are important goals of the current HIV
research (2).
Genome editing has been investigated intensively to provide a “one-shot” treatment for
HIV infection. Major strategies include but are not limited to targeting essential receptors,
such as CCR5 for viral entry to prevent new infection or targeting latent provirus in latently
infected cells to prevent viral rebound. As a powerful gene-editing tool, CRISPR/Cas9 is
one of the popular nucleases to be applied in these HIV gene therapy approaches.

3
1.1.1 Disrupting CCR5.
The first clinical application of human genome editing was using zinc finger nucleases
(ZFNs) to disrupt the CCR5 co-receptor gene to confer HIV resistance to the CD4+T cells
that the virus infects. Preclinical studies editing CD4+T cells (3) or precursor HSPC (4, 5)
demonstrated reduced viral load in xenograft mouse models and nonhuman primates
(NHPs), with evidence of selective survival of the CCR5 knockout cells. Progress to
clinical trials has suggested factors that will require optimization for this strategy to work,
in particular, achieving sufficient frequency of CCR5 disruption - in individuals receiving
T cells with 11-28% of ZFN-edited alleles at the time of infusion, ART interruption four
weeks later led to viral rebound. Although intriguingly, in one individual who was naturally
heterozygous for CCR5del32, some evidence of control was observed before the
reinstitution of ART (6). In contrast, the Berlin patient received fully myeloablative
conditioning, resulting in the complete replacement of any HIV-infected or HIV-
suspectable cells with those of the donor. Mathematical analysis suggests that >50% bi-
allelic KO will be required to achieve a functional cure (7).
Specificity is also an essential consideration for gene editing approaches. The ZFNs used
in these early studies had high levels of off-target disruption of the closely related CCR2
locus, for example with conditions achieving ~60% of CCR5 disorder in HSC also causing
~20% disruption at the CCR2 locus (8). However, more recently developed genome
editing tools, including CRISPR/Cas9, are able to target much more unique sequences
(9). Another consideration for CCR5 editing is the possibility that HIV variants may be
selected that use the alternate entry co-receptor, CXCR4, as has been observed following
a CCR5delta32 transplantation (10). Such X4-tropism typically develops later in the
4
disease and is associated with clinical progression (11). The presence of X4-tropic
viruses is, therefore an exclusion criterion for these trials. Finally, it is unknown whether
the phenotypes associated with being CCR5Δ32 homozygous such as enhanced risk
from West Niles virus infection (12), or increased susceptibility to several cancers (13),
will also be a concern if only a subset of hematopoietic cells is edited.
Recently, CRISPR/Cas9 has been developed for CCR5 disruption, achieving editing in
cells (9, 14–16) and demonstrating anti-HIV effects in humanized mice (16). A first clinical
study used CRISPR/Cas9 to edit allogeneic HSCs, transplanted into an HIV-infected
individual undergoing HSCP transplantation for acute lymphoblastic leukemia (17). At 19
months post-transplantation, the edited cells showed successful engraftment and
differentiation into multiple lineages that retained the gene editing signature. Following
ART interruption between days 221 to 249 post-transplantation, the frequency of CCR5
editing in peripheral CD4+ T cells showed a slight increase from 2.96% to 4.39% (1.5-
fold), while total CD4+ T cells decreased, hinting at a survival advantage of the CCR5-
edited cells. However, similar to the observations from the ZFN clinical studies, a rapid
viral rebound was observed, suggesting that this level of CCR5 disruption was insufficient
to control HIV (17).

1.1.2 Targeting the latent provirus
The ability of genome editing tools to recognize sequences has opened the door for the
possibility of delivering reagents to precisely identify and disable sequences in integrated
HIV proviruses. Editing tools to disable the provirus have relied on using nucleases to
create DNA breaks, disabling the provirus through the resulting indel scars, by cut and
5
drop out strategies at the duplexed LTR targets, or by targeting more than one sequence
(18–22).
A concern for HIV gene editing approaches is the potential for virus escape (23).
Subsequent studies showed that such escape could be prevented in several cases by
multiplexing guide RNAs (20). The other common strategy to avoid viral escape is to
choose highly conserved targets in critical areas of the HIV genome such as the LTR and
sequences for proteins such as Gag, reverse transcriptase, and integrase. This is
evidenced by the slower virus escape when, the more conserved sequences were
targeted in the Wang et al. (20).

1.3 CRISPR delivery
Different delivery strategies, including viral and non-viral methods, have been reported
for CRISPR/Cas9 9 delivery. Today, successful removal of latent HIV provirus in vivo has
been reported using adeno-associated vectors and lentiviral vectors as platforms for Cas9
delivery.
1.3.1 Adeno-associated vector (AAV)
To date, AAV has been used preferably in HIV in vivo gene therapy due to its broad, non-
pathogenic nature and good safety profile in the clinical setting. AAV is a nonenveloped,
single-stranded DNA virus mediating episomal gene expression. However, AAV has a
packaging capacity of 4.7kb, a major limitation for its use in CRISPR delivery. To allow
packaging, modifications including splitting Cas9 into two vectors (24, 25) or using smaller
Cas9 orthologs such as saCas9 are needed (21)s. More CRISPR variants have been
6
discovered in recent years with smaller size that could facilitate in vivo delivery by AAV,
such as Cas12a (26) and Cas CasΦ (27).
In addition to packaging capacity, other challenges using AAV for in vivo therapy include
off-targeting, pre-existing immunity (28), immunogenicity that can potentially be triggered
by high dose treatment (29–32), and finally, the cost of manufacturing for the required
high dose (33).
1.3.2 Lentiviral vector (LV)
LVs are enveloped vectors carrying RNA genome that mediated transgene expression
after reverse transcription and integration into the host genome. LV has a packaging
capacity of ~8kb and allows simultaneous delivery of both Cas9 and gRNA using a single
vector (15, 34).
Most common LVs used in gene editing are pseudotyped with VSV-G ,which use LDL
receptor (LDLR), a receptor broadly expressed in various cell types, for virus entry (35).
VSV-G pseudotyped LVs has been shown to have broad tissue tropism and low
immunogenicity in humans (35). However, LDLR has low to no expression on cells at
quiescent or resting state (36). As a result, stimulation conditions or chemicals aiding
vector entry is often required in CD34+ or CD4+ T cells gene editing (36). The requirement
of additional cell treatments in ex vivo setting could introduce risk in contamination or
impacting the stemness and also limited the vector application in vivo. Alternative
pseudotypeing includes using the glycoprotein of measles virus (MV) (37) or the envelope
protein of Baboon endogenous retrovirus (38, 39) has been explored and provided
substantial progress for efficient gene transfer in resting lymphocytes. For in vivo
7
application, receptor-specific targeted LVs were also developed using envelope protein
engineering (40, 41). The receptor-targeted LV not only has the potential to provide tissue
specificity but also could prevent loss of the functional particles to therapy-irrelevant cells.
In an example of CD4-targeted LV, vectors were pseudotyped with MV glycoproteins
where the gene of MV attachment protein H was mutated to blade natural receptor binding
and a CD4-binding ligand, Designed Ankyrin Repeat Protein (DARPin), was inserted to
redirect the vector tropism. The CD4-LV showed promising result in exclusive
transduction of human CD4+ T cells when delivered systemically in vivo in humanized
mouse models (42). However, the gene editing efficacy of using the receptor-targeted
vectors for in vivo delivery of CRISPR-Cas9 and gRNA remain to be investigated.
Application of LV-mediated delivery of CRISPR has shown promising result toward HIV
control in both in vitro and in vivo preclinical studies. For in vitro gene editing, LV has
been used to delivery CRISPR/Cas9 and gRNAs targeting CCR5 and/or CXCR4 in
human CD4+ T cells lines and achieve resistance to HIV-1 infection (34, 43). Using a
single vector expression both Cas9 and gRNA targeting CCR5, Wang et al. was able to
achieve efficiency gene disruption efficiency in a human CD4 T cell line that is comparable
to dual-vector system that separated Cas9 and gRNA in different vectors. CCR5 edited
cells are resistant to HIV-1 infection and have selective advantage over CCR5 gene-
undisrupted cells during R5-tropic HIV-1 infection (34).
More recently, LV-mediated in vivo delivery of CRISPR was access in a humanized
mouse model engrafted with PBMC derived from HIV-1 positive patients and showed
ability to remove HIV DNA in vivo (44). In this study, VSV-G pseudotype was used. Cas9
and two gRNA targeting HIV LTR and gag sequence was delivered separately in a triple-
8
vector system. Results showed LV-mediated in vivo CRISPR delivery successfully viral
DNA from the blood, spleen, lung and liver of the engrafted animals. The excise of viral
DNA leads to reduce or eliminate replication competent HIV-1 proven by viral recovery
assay. However, a reduction of elimination efficacy was observed when compared blood
and spleen sample (>90% and ~40% replication competent HIV-1 removed respectively
compared to sample from non-treated animals). This finding suggest in vivo editing of the
HIV-1 proviruse by LV delivered CRISPR may not completely eliminate replication-
competent virus from solid tissue and a combination therapy with additional inhibitors
such as ART may be required (44).
Depside this progress, data for in vivo LV delivery is still limited due to a few major
challenges of this platform. First, VSV-G pseudotuped LV lacks tissue specificity. Second,
it has low transduction efficiency in the resting cells, the major cell types constitute the
HIV latent reservoir, due to the restriction factors from these cell types (45). Third,
CRISPR function from LV delivery relies on viral integration. Even though it provides
stable and long-term expression, gene insertions carry a safety risk for mutagenesis and
persistent expression of CRISPR was known to lead to off-target mutations (46). Finally,
there is expected inhibition of the gene disruption efficacy when LV-mediated CRISPR
delivery is co-treated with ART.
To address these issues, we are developing a lentivirus-based vector-like particle (VLP)
system for CRISPR/Cas9 and gRNP RNP delivery. More detail on RNP delivery using
VLPs will be discussed in Chapter 3.

9
CHAPTER 2: CYTOPLASMIC TAIL TRUNCATION OF SARS-COV-2 SPIKE PROTEIN
ENHANCES TITER OF PSEUDOTYPED VECTORS BUT MASKS THE EFFECT OF
THE D614G MUTATION

2.1 Introduction
Coronavirus disease 2019 (COVID-19) is caused by severe acute respiratory syndrome
coronavirus 2 (SARS-CoV-2) and was first reported in Wuhan, China, in December 2019
(47). The disease rapidly spread worldwide, causing over 150 million confirmed cases
and more than 3 million reported deaths by May 2021 (48). The accompanying worldwide
research effort has resulted in a large number of vaccine candidates, and both national
and international clinical trials to assess novel and repurposed drug regimens (49). In the
United States, the SARS-CoV-2 Spike glycoprotein has been a primary target of such
efforts. Spike is a major viral antigen that induces protective immune responses in
COVID-19 (50–52) patients and mediates cell entry by binding to angiotensin-converting
enzyme 2 (ACE2) (47, 53, 54) or other receptors (55, 56) and employs the cellular
proteases such as TMPRSS2 to prime the Spike protein for membrane fusion (57, 58).
ACE2 is expressed in the human respiratory system (59), especially on type II
pneumocytes (60), which are the main target cell for SARS-CoV-2 infection. Expression
of ACE2 in other organs also allows infection outside the lung (59).
Due to the high pathogenicity of SARS-CoV-2, biosafety level 3 (BSL3) labs are required
for studies that involve replication-competent virus. Therefore, investigators often use
Spike protein pseudovirus vector systems, based on replication-incompetent vector
particles and attenuated or conditional viruses. Identification of an optimal pseudovirus
10
system for any particular viral entry glycoprotein typically involves comparing the most
commonly used systems: replication-incompetent lentiviral (LV) or retroviral (RV) vectors,
or conditional vesicular stomatitis virus (VSV) viruses that are deleted for the VSV
glycoprotein (G) (61, 62). SARS-CoV-2 Spike protein can pseudotype all three vector
systems, which have been used to investigate viral entry (57, 63–65), neutralization by
monoclonal antibodies or convalescent plasma (50, 51, 63, 66–74), entry inhibitors (63,
70, 75, 76), and to characterize surging viral variants (77–91). In approximately one third
of these studies, deletions of 18-21 amino acids from the cytoplasmic tail of Spike were
used to enhance vector titers and thereby facilitate the study.
Cytoplasmic tail truncation of viral glycoproteins is a common strategy to enhance
pseudovirus formation since this can remove steric interference that may occur between
the heterologous viral glycoproteins and the vector matrix or capsid proteins (92–97). Also
employed are cytoplasmic tail swaps, whereby the tail from the natural viral glycoprotein
is used to create a chimeric glycoprotein with enhanced incorporation properties (95, 98).
However, we and others have shown that tail modifications can also have functional
consequences, for example, removing endocytosis signals that lead to increased cell
surface levels and enhanced incorporation into vector particles (99, 100), alterations of
the ectodomain conformation (99, 101), changes to fusogenicity (95, 101–103) and
altered antigenic characteristics (104, 105).
SARS-CoV-2 Spike contains a putative ER retention signal (KLHYT) at its C-terminus,
which is removed by the tail truncations of 13 amino acids (106) or 18-21 amino acids
that are frequently employed (69, 71, 107–109). Compared to the full-length Spike, such
truncations were reported to generate ~10-20-fold higher titers of both LV vectors (69,
11
106, 107, 109) and VSV vectors (71, 107, 108). Truncated Spike also enhances RV vector
titers, albeit with a smaller effect when compared side by side with LV and VSV vectors
(107). Havranek et al. (108) and Yu et al. (106) investigated the mechanism for such an
effect for VSV and LV pseudoviruses, and found that tail truncation enhanced both Spike
incorporation into the viral particles and cell-cell fusion for Spike-expressing cells, but
without altering cell surface expression levels. However, the impact of Spike tail
truncations on any other ectodomain functions remains unclear.
In this report, we compared the practicality and functionality of using Spike pseudotyped
vectors based on LV and VSV, and pseudotyped with either full-length or tail truncated
proteins. We compared methods to prepare such vectors and identified tangential flow
filtration as a facile method that is superior to ultracentrifugation and allows efficient
production at a larger scale. An optimized system based on VSV vectors was used to
assess the impact of the Spike mutation D614G (81), and to assess neutralizing activity
in convalescent serum. Our studies determined that although Spike tail truncation boosts
incorporation into vectors and enhances the titers achieved for unconcentrated
supernatants, it also blunted the ability to observe differences caused by this specific
Spike mutation. We therefore recommend that studies using Spike pseudotyped vectors
retain the natural full-length cytoplasmic tail and use other strategies, such as
concentration method and vector system choice, to achieve the required vector titers.

2.2 Materials and methods
2.2.1 Plasmids. Full-length (S) and 18 amino acid cytoplasmic tail truncated (SΔ18)
Spike proteins for the Wuhan-Hu-1 isolate of SARS-CoV-2 (GenBank: MN908947.3) were
12
provided by Dr. James Voss (The Scripps Research Institute) in a plasmid pcDNA3.3
backbone. D614G mutants were generated by site-directed mutagenesis. A VSV G
protein expression plasmid was obtained from Addgene (Watertown, MA; Cat.# 8454).
2.2.2 Cell lines. 293T, HeLa, HeLa-ACE2, Vero, VeroE6 and Huh7.5 cells were
maintained in Dulbecco’s modified Eagle medium (DMEM), and Calu-3 cells were
maintained in Eagle's Minimum Essential Medium (EMEM). All media were supplemented
with 4 mM glutamine and 10% fetal bovine serum (FBS). HeLa-ACE2 cells were provided
by Dr. James Voss, and were generated by transduction of HeLa cells with a lentiviral
vector packaging a CMV-ACE2 expression cassette. The Huh7.5 cell line was provided
by Dr. Jae Jung (Cleveland Clinic). All other cell lines were obtained from ATCC.
2.2.3 VSV vector production, concentration and transduction. Replication-deficient
VSVΔG vectors (110), containing expression cassettes for firefly luciferase or GFP in
place of the VSV G protein, were provided by Dr. Jae Jung and Dr. Oscar Negrete (Sandia
National Laboratories), respectively. To generate Spike pseudotyped VSV vectors, 4 x
106 293T cells were seeded in DMEM plus 10% FBS in a 10cm plate and transfected
with 15 μg of Spike expression plasmid 24 hours later, using the calcium-phosphate
transfection method (110). Media was replaced 16 hours later with 10 ml fresh media,
and after a further 8 hours, 5 ml was removed and 2x108 vector genomes of VSVΔG
particles were added for one hour at 37 °C. Following this incubation, cells were washed
three times with PBS and incubated for a further 24 hours before harvesting supernatants.
For larger scale production, quantities were adjusted to seed 3x107 cells in 500cm2
plates, transfection with 124.5 μg of Spike expression plasmid and infection by 1.7x109
vector genomes of VSVΔG particles per 500cm2 plate. To propagate VSVΔG particles,
13
the same protocol was followed but replacing the Spike expression plasmid with the same
quantity of a VSV G expression plasmid, and no PBS washes were performed after
infection by VSVΔG.
Vector supernatants were harvested and filtered through 0.45 μm syringe filters, and
either aliquoted or concentrated by ultracentrifugation using 20% (w/v) sucrose cushions
for 2 hours at 25,000 rpm in an SW41 or SW28 rotor (Beckman, Indianapolis, IN).
Alternatively, large-scale supernatant preparations were concentrated by tangential flow
filtration (TFF) using a polyethersulfone membrane hollow fiber unit with 100 kDa
molecular weight cut off and 115cm2 filtration surface (Spectrum Laboratories, Rancho
Dominguez, CA) and a KR2i peristaltic pump (Spectrum Laboratories). To perform buffer
exchange and prevent filter blockage, every 100 ml of vector supernatant was followed
by 100 ml PBS. A 10- to 12-fold concentration from the original volume to approximately
8 ml final volume was achieved. All vectors were stored at -80oC in aliquots.
VSV-luciferase vector transductions were performed on tissue culture treated, 96-well
half-area white plates (Corning, Corning, NY), seeded with various cells lines to achieve
50%-75% confluency at the time of transduction. Vectors were serially diluted and added
to the culture to achieve final dilutions of 1:5, 1:15, 1:45, 1:135, and 1:405 and incubated
at 37 °C for 16-24 hours. Transduction efficiency was quantified by measuring luciferase
activity in cell lysates using Britelite Plus (Perkin Elmer, Richmond, California) and
following the manufacturer’s protocol. To calculate the fold-change in transduction
efficiency between D614 and G614 mutants, data from the 1:45 dilution points was used.
To titer VSV-GFP vectors, HeLa-ACE2 cells were seeding as 1x104 cells per well in 96-
well plates, and the following day, 50 μl of serially-diluted unconcentrated vector stocks
14
were added. The final dilutions in the cultures were 1:2, 1:6, 1:18, and 1:27. Transduction
efficiency was determined by GFP expression 16-24 hours after transduction using flow
cytometry (Guava easyCyte, MilliporeSigma, Burlington, MA). and transducing units (TU)
per ml calculated from the dilutions showing a linear relationship between the dilution
factor and the number of GFP-positive cells.
2.2.4 Lentiviral vector production, concentration and transduction. Lentiviral vectors
were generated by transfection of 10 cm plates of 293T cells at 75% confluency with 2 μg
of Spike expression plasmid, 10 μg of packaging plasmid pCMVdeltaR8.2 (Addgene
Cat.# 12263) and 10 μg of a GFP-expressing vector genome plasmid FUGW (Addgene
Cat.# 14883). Media was removed 16 hours later and replaced with 10 ml fresh DMEM
plus 10% FBS. Supernatants were harvested 48 hours after transfection and filtered
through 0.45 μm syringe filters, and either aliquoted or concentrated by ultracentrifugation
using 20% (w/v) sucrose cushions for 2 hours at 25,000 rpm in an SW41 rotor (Beckman).
HeLa-ACE2 cells were transduced with Spike pseudotyped LV by seeding 1x104 cells
per well in 96-well plates and adding 50μl of unconcentrated vector stocks the next day.
Transduction efficiency was determined by GFP expression 48 hours after transduction
using flow cytometry, as described above, and reported as transducing units (TU) per ml.
2.2.5 LV and VSV vector genome titration. RNA from 160 μl of LV or VSV vector stocks
was extracted using Viral RNA mini kit (Qiagen, Hilden, Germany) and reverse
transcribed into cDNA using SuperScript (Invitrogen, Carlsbad, CA), according to the
manufacturer’s instructions. Genome copy number was determined by ddPCR for the
WPRE sequences in the LV genome, or for Phosphoprotein (P) sequences in the VSV
genome, using the QX200 Droplet Digital PCR system (Bio-Rad, Hercules, CA) and
15
primer/probe set: WPRE-forward (CCTTTCCGGGACTTTCGCTTT), WPRE-reverse
(GGCGGCGGTCACGAA), WPRE-probe (FAM- ACTCATCGCCGCCTGCCTTGCC-
TAMRA), P-forward (GTCTTCAGCCTCTCACCATATC), P-reverse
(AGCAGGATGGCCTCTTTATG), P-probe (FAM-TCGGAGGTGACGGACGAATGTCT-
IOWA BLACK). Briefly, 6.25 μl of 1:10 and 1:100 diluted cDNA was mixed with forward
and reverse primers (final concentration 900nM), probe (final concentration 250nM), 2x
ddPCR supermix (Bio-Rad), and made up to 25 μl with water. Twenty microliters of each
reaction mix was converted to droplets by the QX200 droplet generator, and droplet-
partitioned samples were transferred to a 96-well plate and sealed. Thermal cycling was
performed with the following conditions: 95 °C for 10 min., 40 cycles of 94 °C for 30 sec.,
60 °C for 1 min., and 98 °C for 10 min. Plates were read on a QX200 reader (BioRad)
and DNA copies quantified by detection of FAM positive droplets.
2.2.6 Lung bud organoid differentiation and transduction. Lung bud organoids were
generated from human pluripotent stem cells (hPSCs) and validated as previously
described (111). hPSC differentiation into endoderm was performed in serum-free
differentiation (SFD) medium of IMDM/Ham’s F-12 (3:1) (Life Technologies, Carlsbad,
CA) supplemented with the following: 1 x N2 (Life Technologies), 0.5 x B27 (Life
Technologies), 50 μg/ml ascorbic acid, 1 x Glutamax (Gibco), 0.4 μM monothioglycerol,
0.05% BSA, 10 µM Y27632, 0.5 ng/ml human BMP4 (R&D Systems), 2.5 ng/ml human
FGF2 (R&D Systems, Minneapolis, MN), and 100 ng/ml human Activin (R&D Systems),
in a 5% CO2/5% O2 atmosphere at 37 °C for 72-76 h. On day 4, endoderm yield was
determined by the expressions of CXCR4 and c-KIT by flow cytometry. Cells used in all
experiments had > 90% endoderm yield. For induction of anterior foregut endoderm,
16
embryonic bodies were dissociated into single cells using 0.05% trypsin/0.02% EDTA and
plated onto fibronectin-coated, six-well tissue culture plates (80,000–105,000 cells/cm2).
Cells were incubated in SFD medium supplemented with 100ng/ml human Noggin (R&D
Systems) and 10μM SB431542 for 24 hours followed by switching to SFD media
supplemented with 10 μM SB431542 and 1 μM IWP2 (R&D Systems) for another 24
hours. At the end of anterior foregut endoderm induction, cells were maintained in SFD
media supplemented with the following: 3 μM CHIR 99021 (CHIR, R&D Systems), 10
ng/ml human FGF10, 10 ng/ml human KGF, 10 ng/ml human BMP4 and 50nM all-trans
retinoic acid for 48 hours, when three-dimensional cell clumps formed. Clumps were
suspended by gently pipetting around the wells to form lung bud organoids, which were
maintained in Ultra-Low Attachment multiple well plates (Corning) and fed every other
day, and used for vector transduction after day 35.
To transduce lung bud organoids, 10 to 20 organoids were picked manually and
transferred to 96-well U-bottom plates and transduced with 50 μl of GFP-expressing VSV
vectors (1.7x104 TU/ml). Transduction efficiency was examined by GFP expression 24
hours later by fluorescence microscopy.
2.2.7 Western blot analysis of Spike protein incorporation. Vector supernatants were
concentrated by ultracentrifugation (100-fold), electrophoresed on 4-12% Bis-Tris protein
gels (Bio-Rad) and transferred to PVDF membranes using Trans-Blot Turbo Transfer
System (Bio-Rad). Membranes were blocked with 5% milk in PBST buffer (PBS plus 0.1%
of Tween®20). The S1 subunit of Spike was detected using SARS-CoV-2 (COVID-19)
Spike S1 antibody at 1:1000 (Prosci, Cat.# 9083); the S2 subunit was detected using
anti-SARS-CoV/SARS-CoV-2 (COVID-19) spike antibody clone [1A9] at 1:1000
17
(GeneTex, Cat.# GTX632604); HIV-1 p24 was detected using a polyclonal anti-HIV-1 SF2
p24 rabbit antiserum at 1:6000 (obtained through the NIH HIV Reagent Program, Division
of AIDS, NIAID, NIH: ARP-4250, contributed by DAIDS/NIAID; produced by BioMolecular
Technologies). VSV M protein was detected using anti-VSV M antibody clone [23H12]
(KeraFast, Boston, MA, Cat.# EB0011) at 1:1000. HRP-conjugated goat anti-mouse and
goat anti-rabbit antibodies were used as secondary antibodies (Santa Cruz
Biotechnology, Dallas, TX). Blots were imaged by Amersham ECL Prime Western Blotting
Detection Reagent (GE healthcare, Chicago, IL) and Chemidoc (Bio-rad). Densitometry
was measured using ImageJ software (http://rsb.info.nih.gov/ij/).
2.2.8 ACE2 and TMPRSS2 cell surface expression by flow cytometry. Cells were
detached from culture flasks by 0.05% trypsin (Corning) and washed once with PBS. One
million cells were re-suspend in 100 μl PBS and either immediately incubated with anti-
ACE2 antibody (1:100 dlution, R&D systems, Cat.# AF933) and anti-TMPRSS2 (H4)
antibody (1:50 dilution, Santa Cruz, Cat# sc-515727 PE) or first incubated at 37 °C for 6
hours with shaking to allow recovery of cell surface proteins after trypsinization. Alexa
Fluor 647 conjugated donkey anti-goat antibody (1:200 dilution, Thermo Fisher Scientific,
Waltham, MA, Cat.# A21447) was used as a secondary antibody and ACE2 expression
was determined by flow cytometry (Guava easyCyte).
2.2.9 Spike protein cell surface expression. VSV pseudovector-producing 293T cells
were harvested to examine cell surface expression of the Spike protein. The S1 subunit
was detected using SARS-CoV-2 (COVID-19) Spike S1 antibody at 1:100 (Prosci, Fort
Collins, Colorado, Cat.# 9083) and the S2 subunit was detected using anti-SARS-
CoV/SARS-CoV-2 (COVID-19) spike antibody clone [1A9] at 1:100 (GeneTex, Irvine,
18
CA, Cat.# GTX632604). APC-conjugated goat anti-mouse and ducky anti-rabbit
antibodies were used as secondary antibodies (1:100 dilution, Invitrogen), and expression
was detected by flow cytometry (Guava easyCyte). The expression levels of different
Spike proteins were reported as mean fluorescence intensity (MFI).
2.2.10 Convalescent serum neutralization. Convalescent serum from COVID-19
patients or healthy donors (collected before April 30, 2020) was obtained from Children’s
Hospital Los Angeles. Convalescent sera was confirmed to be positive for IgG class
antibodies against SARS-CoV-2 Spike using anti-SARS-CoV-2 ELISA (IgG)
(EUROIMMUN, Lübeck, Germany) (112).
A suitable dose of Spike pseudotyped VSV-Luc vectors was used in the neutralization
assays to produce approximately 105 relative light unit (RLU) of luciferase activity on
HeLa-ACE2 cells in the absence of serum. Five x103 HeLa-ACE2 cells were seeded in
tissue culture-treated, 96-well half-area white plates (Corning) to achieve 50%-75%
confluency the following day. Convalescent or control sera were 3-fold serially diluted
from 1:10 to 1:7290 and 50 μl incubated with the predetermined dose of the VSV-Luc
vectors for 30 mins at 37°C, before addition of the mixture to HeLa-ACE2 cells. Cells were
incubated at 37 °C overnight for 16-24 hours. Vector transduction efficiency was
quantified by measuring luciferase activity as described above and neutralization (%)
calculated by normalization to the values obtained on cells transduced without serum.

19
2.3 Results
2.3.1 Spike cytoplasmic tail truncation facilitates vector incorporation and
enhances titer
Cytoplasmic tail truncation of SARS-CoV-2 Spike has been reported to enhance the
transduction efficiency of pseudotyped LV and VSV vectors (69, 106, 107, 109) with the
effect suggested to be the result of enhanced incorporation and/or fusogenicity of Spike
(106, 108). Using both the full-length Spike (S) and an 18 amino acid cytoplasmic tail
truncation (SΔ18), we generated pseudotyped LV and VSV vectors carrying reporter GFP
or luciferase genes, respectively. We compared the ability of the two Spike proteins to be
incorporated into the vectors and to transduce HeLa cells expressing human ACE2
(HeLa-ACE2). Transduction by LV-GFP vectors was analyzed at 48 hours post-
transduction, while VSV-Luc vectors were analyzed as early as 16-24 hours post-
transduction.
Consistent with previous findings, we found that the cytoplasmic tail truncation
increased vector transduction efficiency on HeLa-ACE2 cells, by approximately 4- and
30-fold for the LV-GFP and VSV-Luc vectors, respectively (Fig. 2A). We also observed a
significant increase in incorporation for the truncated Spike protein in both vector systems
(Fig. 2B), while having no impact on other viral particle proteins (Fig. 2B) or vector
genome copy number (Fig. 1C). Together, these results suggest that cytoplasmic tail
truncation increases Spike incorporation into both LV and VSV particles and this results
in higher infectivity per particle. Since the VSV-Luc vectors have a faster read-out time,
we chose this pseudovirus system for the rest of our studies.

20

Figure 2. Impact of Spike protein cytoplasmic tail truncation on LV and VSV vectors.
(A) Transduction of HeLa-ACE2 cells by equal volumes of unconcentrated vector supernatants of
LV-GFP or VSV-Luc vectors, pseudotyped with full-length (S) or truncated (SΔ18) Spike proteins.
Shown are mean and standard deviations from 3 independent vector stocks, *p<0.05, unpaired t-
test, one-tail (B) Spike protein incorporation into vector particles, analyzed by Western blot using
antibodies against the Spike S2 subunit and vector particle components p24 (LV) and M (VSV).
Full length Spike (S) and S2 subunit are indicated. (C) Genomic copy number for indicated
vectors. Shown are mean and standard deviations from 3 independent vector stocks.

2.3.2 Susceptibility of different cell lines and lung organoids to Spike protein
pseudovectors
Next, we tested the permissivity of different cell lines and a lung organoid model to SΔ18
pseudotyped VSV vectors. In agreement with previous findings, several ACE2-
expressing cells were found to be susceptible to the vectors (47, 57), while ACE2 over-
expression was required to support transduction of HeLa cells (Fig. 3A). We also
evaluated an alternative transduction protocol with a shortened timeline, whereby
trypsinized HeLa and HeLa-ACE2 cells were incubated with vectors simultaneously with
seeding onto plates instead of transduction occurring 24 hours after seeding (113).
However, this protocol significantly reduced the transduction efficiency (Fig 3B), which
we hypothesize is a result of reduced cell surface ACE2 after trypsinization (Fig. 3C).
Finally, we tested the susceptibility of a 3D lung bud organoid model to SΔ18 VSV
pseudovectors carrying a GFP reporter. Compared to cell lines, lung organoids provide
21
more physiologically relevant models of virus infection and have been used to identify
candidate COVID-19 therapeutics (76). SΔ18 pseudotyped VSV-GFP vectors were able
to efficiently transduce the cells, with GFP expression observed throughout the organoid
by 24 hours (Fig. 3D).

Figure 3. Transduction of cells by Spike VSV pseudovectors.
(A) Indicated cell lines were transduced with equal amounts of SΔ18 VSV-Luc vectors and
luciferase activity in cell lysates analyzed 24 hours later. Shown are mean and standard
deviations from 3 independent vector stocks. (B) HeLa and HeLa-ACE2 cells were detached from
culture flasks by trypsin, seeded into 96 well plates and transduced (Td) with equal amounts of
SΔ18 VSV-Luc vectors, either immediately (0 hr) or 24 hours after seeding, and luciferase
measured 24 hours later. Data from 9 different wells in a single experiment are shown.
****p<0.001, multiple T test. (C) ACE2 expression levels on cell surface measured by flow
cytometry. Cells were stained with anti-ACE2 antibody at 0 or 6 hours after trypsinization. Means
and standard deviations for MFI from four (HeLa) or five (HeLa-ACE2) independent experiments
are shown. (D) Lung bud organoids were transduced with equal amounts of VSV-GFP vectors
pseudotyped with SΔ18 or control (bald) vectors with no Spike protein. GFP expression was
visualized 24 hours later. Scale bars represent 100µm.

22
2.3.3 Tangential flow filtration facilitates scale-up of vector production and
concentration
To identify an optimal method for concentration of Spike protein pseudovectors suitable
for a research laboratory, we compared ultracentrifugation through a 20% w/v sucrose
cushion with tangential flow filtration (TFF). Ultracentrifugation is limited by the capacity
of a rotor, for example SW28 rotors have a maximum capacity of ~230 ml of vector
supernatant per 2 hours run. In contrast, TFF can process much larger volume (114,
115) and a single TFF filter with 1000 cm2 surface area can process up to 3000 ml in 2
hours. Larger filter systems with capacities up to 15 L are also available. In addition, VSV-
G pseudotyped LV vectors produced by TFF are reported to have a higher recovery rate
than when prepared by ultracentrifugation (115).
To compare these approaches, 100 ml of SΔ18 pseudotyped VSV-Luc vector
supernatants were subjected to either ultracentrifugation (Ultra) or TFF and concentrated
into a 8ml final stock (12x, v/v). Vector genome copies in the unconcentrated and 12x
concentrated vector stocks were measured by ddPCR, which revealed slightly better
recovery rates following TFF (~70%) compared to ultracentrifugation (~60%) (Fig. 4A and
4B). At the same time, the transduction efficiencies of the three vector stocks were
measured on HeLa-ACE2 cells, using serially diluted vectors (1:5 to 1:450 dilutions) (Fig.
4C). At the higher dilution points, both 12x Ultra and 12x TFF vector preparations
produced about a 10-fold higher luciferase signal compared to the unconcentrated
vectors. Interestingly, at the lower dilutions (1:5 and 1:15), the 12x Ultra vector stock
showed no enhancement over unconcentrated vectors, while the 12x TFF vector stocks
retained their 10-fold higher transduction rates. This observation is suggestive of the
23
presence of an inhibitory factor that is concentrated during ultracentrifugation but was not
retained following TFF.
In summary, we found that TFF facilitates large-scale processing of vector stocks, with
similar genomic copy number recovery rates as the more typical ultracentrifugation
method. More importantly, TFF results in vector stocks that retain a more consistent titer
throughout a broader range of different dilutions than those produced by
ultracentrifugation.

Figure 4. Concentration methods for Spike VSV pseudovectors.
(A) Genome copy numbers of VSV-Luc vectors pseudotyped with SΔ18 Spike protein, from
unconcentrated supernatants (1x Uncon.), or following 12x concentration (v/v) by either
ultracentrifugation (Ultra) or tangential flow filtration (TFF). Shown are mean and standard
deviations from 3 independent vector stocks. (B) Vector recovery, calculated by comparing
genome copies in concentrated versus unconcentrated vector stocks. Shown are mean and
standard deviation from 3 independent vector concentrations for each method, *p<0.05, one-
tailed Paired T test. (C) Transduction of HeLa-ACE2 cells by serial dilutions (1:5 to 1:405) of
indicated vectors. Shown are mean and standard deviation from three independent vector stocks.
*p<0.01, two tail Paired T test, for comparison between 12x Ultra and 12x TFF at the same
dilutions.

2.3.4 Cytoplasmic tail truncation alters Spike protein functional properties
We used the VSV pseudovirus system to examine the impact of the D614G mutation of
Spike protein. This mutation was first detected in China and Germany in late January and
24
became the dominant circulating variant of SARS-CoV-2 globally by April 2020 (81). It
has functional consequences for the virus, resulting in higher viral loads in the upper
respiratory tract of patients (81, 116). In parallel, in vitro studies have shown that D614G
enhances replication of the virus on human lung epithelial cells and primary airway tissue
(88), and increases replication or transmissibility in human ACE2 transgenic mice and
hamster models (88, 117, 118). Effects were also observed using Spike protein
pseudoviruses, where the D614G mutation increased Spike incorporation into vector
particles, despite minimal or no effect on Spike expression in vector-producing cells (90,
119), and increased transduction rates on various cell lines (77, 79, 81, 84, 90, 109, 120).
Of interest, residue 164 is not located within the receptor binding domain (RBD) of Spike,
and it has been suggested instead that it impacts Spike protein structure and stability,
leading to downstream effects on cell entry (81, 119, 121).
Since we had noted that cytoplasmic tail truncation of Spike protein had similar effects as
the D614G mutation, and also increased incorporation rates and transduction efficiencies
(Fig. 2), we next examined the impact of the D614G mutation in the context of both full-
length and truncated Spike proteins. For the full-length Spike protein, we observed up to
18-fold higher transduction rates for the G614 variant on HeLa-ACE2 cells, with less
striking effects on the other cell lines we tested. In contrast, transduction rates for the
variants in the SΔ18 backbone showed minimal to no differences across the range of cell
types tested (Fig. 5A and B).
The discrepancy between the behavior of the full-length S and SΔ18 vectors occurred
despite similar genome copy numbers (Fig. 5C), ruling out an effect on vector production.
We also observed minimal effects on cell surface expression levels of Spike when
25
comparing the different variants in vector-producing cells (Fig. 5D). Instead, in agreement
with previous studies using full-length Spike pseudotyped RV and LV vectors, we found
that the D614G mutation enhanced Spike incorporation, albeit with a much larger effect
for the full-length Spike versus the truncated protein (~9-fold versus ~2-fold effect) (Fig.
5E and F).

Figure 5. Impact of D614G mutation is only observed with full-length Spike protein.
(A) Indicated cell lines were transduced with G614 or D614 variants of VSV-Luc vectors, for both
full-length and truncated Spike protein versions. Three preparations of all 4 vectors were
produced and tested independently (vector prep. 1 to 3), using the same serial dilutions and
volumes of vectors applied to the cells for transduction. For the full-length Spike variants, both
unconcentrated (1x) and 12x concentrated vectors were tested. Luciferase activity was measured
after 24 hours. Means and standard deviations for 3 technical repeats on the same plate are
shown. Arrows indicate the luciferase activity (RLU) data points used to compare G614 and D614
variants of specific Spike protein and cell line combinations. (B) Ratio of luciferase activity for the
G614:D614 pair combinations indicated, on different cell lines, calculated using the RLU data
points arrowed in (A). Each pair of compared vectors were produced in the same way, and equal
volumes applied in transduction. Means and standard deviations for ratios calculated from each
of the three independent vector preparations are shown. (C) Ratio of genomic titers of G614
26
versus D614 vectors, for both full-length and truncated Spike proteins. Shown are mean and
standard deviations from equal volumes of 3 independent vector stocks, produced in the same
way for each pairwise comparison. (D) Cell surface expression levels of different Spike protein
variants on 293T vector-producing cells, measured by flow cytometry using anti-S1 or anti-S2
antibodies at the time of vector harvest. Expression levels are reported as mean fluorescence
intensity (MFI) and normalized to the level of S-D614 in each independent experiment. Means
and standard deviations from 3 independent experiments are shown. **p<0.01, one-way ANOVA
with Tukey’s multiple comparisons. (E) Representative Western blot showing incorporation of
Spike proteins into VSV particles, from equal volumes of 100x concentrated vector supernatants,
using antibodies against S1 or S2 subunits of Spike, or VSV M protein. (F) Comparison of Spike
subunit incorporation into vectors, normalized to VSV M. Data from 2-3 independent vector
stocks, indicated by individual dots. S1 and S2 subunits were only detected in one stock of S-
D614 vectors.

To further investigate the observation that the magnitude of titer enhancement caused by
the G614 mutation in full-length Spike protein varied between different cell types, we also
measured the levels of the cellular receptor ACE2 and the protease TMPRSS2 (Fig. 6).
This revealed that the largest impact of the mutation occurred in the cells with the highest
levels of ACE2, namely HeLa-ACE2 and to a lesser extent, Calu-3 cells. We hypothesize
that higher ACE2 expression renders such cells more susceptible to vectors with higher
Spike densities due to enhanced avidity between the Spike protein and receptors. In sum,
these observations suggest that a primary effect of both the tail truncation and the D614G
mutation is on Spike protein incorporation, which in turn leads to enhanced titers, at least
on cells with high enough levels of ACE2. Furthermore, it is likely that an upper limit for
these effects reduces the impact of the D614G mutation when combined with a tail
truncation.

27

Figure 6. ACE2 and TMPRSS2 expression on different cell lines.
Cell surface levels of ACE2 and TMPRSS2 on indicated cells lines, measured by flow cytometry
using anti-ACE2 or anti-TMPRSS2 antibodies. Unstained cells were used as negative controls.

2.3.5 D614G mutation or cytoplasmic tail truncation does not alter Spike protein
sensitivity to convalescent serum
Spike protein pseudovectors are a useful tool to measure antibody neutralizing activity in
COVID-19 patient or convalescent sera (50, 51, 63, 66, 67, 69–71, 73, 74). We examined
whether the D614G mutation or the cytoplasmic tail truncation altered sensitivity to
neutralization by a panel of convalescent sera. VSV-Luc vectors displaying the four
different Spike proteins were incubated with serially-diluted sera for 30 minutes before
being applied to HeLa-ACE2 cells. After normalizing values to the luciferase signals
obtained from cells transduced in the absence of sera, we observed that all four Spike
proteins exhibited similar sensitivities to each serum (Fig. 7). This suggests that neither
the D614G mutation nor the cytoplasmic tail truncation alter the sensitivity of the Spike
protein to neutralization.

28

Figure 7. Sensitivity of different Spike proteins to convalescent serum neutralization.
Indicated VSV-Luc pseudoviruses were incubated with serially-diluted sera (1:10 to 1:7290 fold)
from control or convalescent COVID-19 patients (CCS) for 30 mins. before addition to HeLa-ACE2
cells. Luciferase activity was determined 24 hours later. All values were normalized to the
luciferase signal from cells transduced with the same pseudovirus without serum. Means and
standard deviations from 3 technical replicates of single vector stocks are shown.

2.4 Discussion
Pseudotyped vectors are a useful system to study the entry glycoproteins from highly
pathogenic viruses such as SARS-CoV-2, as they remove the need for BSL-3 laboratory
conditions. We confirmed that the SARS-CoV-2 Spike protein was able to pseudotype
both LV and VSV vectors, and determined that the combination of using a conditional
VSV vector and a luciferase reporter gene had the advantage of allowing titers to be read
at 16 hours post-transduction. Such Spike pseudotyped VSV vectors supported entry into
a variety of mammalian cell types, including lung organoid systems, making them a useful
system with which to study SARS-CoV-2 entry under standard laboratory conditions.
Optimization of pseudotyped vectors includes selection of an appropriate concentration
method, such as centrifugation, PEG precipitation or ultrafiltration. For VSV
29
pseudovectors, we found that concentration by TFF produced vector stocks with higher
recovery rates and more consistent titers throughout a dilution series than those produced
by ultracentrifugation. TFF also has the advantage of providing a partial purification due
to the selective loss of potential contaminants below the cut-off value of the filter, and
provides a larger processing capacity than ultracentrifugation. As a result, TFF is
frequently used to facilitate large-scale vector production, including for clinical use (114,
115, 122). In our own experience, 3L of supernatant can be concentrated down to 50ml
in 2 hours.
Since pseudovector titers can be impacted by incompatibilities between a viral fusion
protein and the heterologous viral particle (92–97), an additional strategy to enhance
vector titers has been to truncate the fusion protein’s cytoplasmic tail. We found that this
approach increased the titers of Spike protein pseudovectors based on both LV and VSV,
in agreement with previous reports (69, 71, 106–109). Furthermore, as others have also
noted (106, 108), the enhanced vector titers correlated with increased levels of Spike
protein incorporation that were not simply the result of higher levels of cell surface
expression following tail truncation, and tail truncation has also been reported to enhance
the fusogenicity of Spike (106, 108). Together, this suggests that truncation of the
cytoplasmic could also alter the conformation or function of the protein’s ectodomain, as
has been reported for viral fusion proteins in HIV (104), measles virus (103), simian
immunodeficiency virus (102) and gibbon ape leukemia virus (95), where truncation of
the cytoplasmic tail impacted ectodomain conformation or functions such as receptor
binding, or fusogenicity.
30
Our comparison of techniques to enhance vector titers also identified an area for caution;
although cytoplasmic tail truncation enhanced pseudovector titers, they can also have
unintended functional consequences. Specifically, we found that the impact of the D614G
mutation on Spike protein incorporation and vector titer was obscured by the cytoplasmic
tail truncation. A similar lack of effect of the D614G mutation on titer was also reported in
another study using a 21 amino acid deletion of the Spike protein cytoplasmic tail in VSV
pseudovectors (108). These findings suggest that tail-truncated Spike proteins should be
used with caution for studies analyzing the impact of Spike mutations, or to test potential
therapeutics targeting SARS-CoV-2 entry.
The mechanism for enhanced incorporation and/or titer by D614G is not entirely
understood but structural analyses have suggested that it could impact Spike protein
structure and stability, both within and between Spike monomers. For example, it has
been suggested that a glycine at this location could strengthen the association between
the S1/S2 subunits through an impact on the epistructure that decreases the
intramolecular wrapping in the S1 subunit but promotes intermolecular wrapping between
S1 and S2 (121). In an alternative model, the D614G mutation could alter the structure
and/or stability of the Spike trimer by abrogating the hydrogen bond connecting D614 in
the S1 subunit of one monomer with T859 in the S2 subunit of a neighboring monomer
(81). These alterations were hypothesized to result in a greater tendency of the G614
monomers to form stable trimers which, in turn, could facilitate their incorporation into
virions. As evidence, a mixture of equal amounts of D614 and G614 Spike variants
expressed in vector-producing cells resulted in a higher level of G614 proteins in the
incorporated Spike trimers (119).
31
Finally, we also used the VSV pseudovectors to evaluate the impact of the D614G
mutation on infectivity of different cell types and sensitivity to antibody neutralization.
Consistent with previous findings using pseudoviruses (79–81, 84, 90, 91) or SARS-CoV-
2 virions (88, 117), we found that the G614 variant exhibited enhanced transduction of
various cell lines when compared to the D614 variant, and that this correlated with
increased Spike incorporation into the VSV particles (90, 119). Interestingly, the
enhanced transduction effect was more profound in cells with higher ACE2 levels, which
may reflect increased enhanced avidity between the receptor (ACE2) and the ligand
(Spike). Finally, as previously noted, these effects were significantly abrogated when tail
truncated variants were used, consistent with an upper limit for the enhancement of Spike
incorporation and transduction.
In contrast, the serum neutralization studies revealed no differences in sensitivity for
either residue at position 614, and in either of the cytoplasmic tail configurations. This is
in agreement with the majority of reports testing the impact of the D614G mutation with
full-length Spike pseudovectors or SARS-CoV-2 virus against human convalescent
serum (77, 81, 90, 117), serum from convalescent animals (88), or vaccinated human or
animals (91, 117, 123).
In summary, we found that although cytoplasmic tail truncations enhance SARS-CoV-2
Spike protein incorporation into both LV and VSV vectors, and enhance the titers of
unconcentrated vectors, they can also mask the phenotype of the D614G mutation.
Pseudotyped vectors are increasingly being used to study newly emerging SARS-CoV-2
variants, where both full-length (89, 124) and truncated Spike proteins (72, 82, 86) have
been used in studies investigating the impact of mutations on Spike protein properties
32
such as ACE2 binding, transduction efficiency or sensitivity to neutralization. To better
ensure the authenticity of the Spike protein functions being investigated in such vectors,
we recommend using a full-length Spike protein, and combining vector production with
TFF if higher titer vectors are required.

33
CHAPTER 3: CD4-TARGETED CRISPR/CAS9 RNP DELIVERY FOR ANTI-HIV GENE
EDITING

3.1 Introduction
Increased in vivo gene editing capabilities would represent significant advances for many
therapeutic applications, but lack of cell-type specific delivery and reduced ability to
modulate cell status in vivo limits possibilities. For example, although VSV-G
pseudotyped lentiviral (LV) vectors are highly effective when used ex vivo with stimulated
cell cultures, they cannot efficiently transduce resting lymphocytes in vivo due to lack of
receptor expression, low endocytosis rate, and the presence of dominant antiviral
restriction factors (45). Moreover, using LV vectors to express nucleases such as
CRISPR/Cas9 from integrated lentiviral genomes also raises concerns that long-term
expression could lead to unwanted immune responses or increased off-target editing (46).
As an alternative, we are developing lentivirus-based vector-like particles (VLPs) that can
both target specific cell types and package CRISPR/Cas9 ribonucleoproteins (RNPs) with
high efficiency. Our goal is to allow delivery to resting lymphocytes without long-term
expression of the Cas9 protein. Cell targeting was achieved by replacing VSV-G with
engineered CD4-targeted paramyxovirus glycoproteins. Incorporation of CRISPR/Cas9
was compared using (1) passive incorporation of RNPs expressed in producer cells (125),
(2) by exploiting an aptamer/ABP interaction to package RNPs via the guide RNA (126),
and (3) incorporation of Cas9 using the FRB/FKBP12 interaction (127) (Fig. 8A). In
addition, the ability of the aptamer/ABP approach to support HDR was evaluated by
34
including homology donor designs in a co-packaged LV genome to enable “all-in-one”
vector designs (Fig. 2A).
In the “passive” packaging, Cas9 and gRNA were simply over-expressed in the 293T cells
during particle production. The Cas9 and gRNA can be passively incorporated into the
budding particles either by themselves or as the RNP complex. This design is based on
a finding that VSV-G stimulated vesicles can incorporate functional Cas9 RNP
overexpressing in the particle-producing cells (125). Passive packaging is simple,
however, it has the concern of low efficiency in gRNA incorporation. In the previous report,
optimization in gRNA expression, such as using the T7 promoter instead of the well-
established U6 promoter system, was needed to achieve sufficient gene editing in target
cells (125). In addition, repeated administration was required to achieve effective gene
disruption, indicating the limited Cas9 RNP delivery using this method. Two other
methods using “active” incorporation strategy were selected to enhance the delivery. The
aptamer/ABP method utilizing the interaction between a short RNA, aptamer, and
aptamer binding peptide (ABP) to recruit gRNA into the vector particle actively. Aptamer
“com” and its specific ABP were found in the bacteria phage. To apply this specific
interaction for Cas9 RNP incorporation, the com sequence was inserted into the gRNA
scaffold, and an ABP was inserted to the C’ end of the lentiviral vector nucleocapsid
protein (126). During particle production, the gRNA-aptamer is expressed in the
producing cells and is incorporated into the VLP particle by binding to the NC-ABP fusion
protein. Cas9 proteins are overexpressed in the producing cells and can be incorporated
passively or by associating with the gRNA. The third incorporation strategy uses the
interaction between FKBP12 and FRB (variant T2098L) induced by the rapamycin analog
35
AP21967, which has been extensively used for protein translocation studies and applied
as a strategy for Cas9 RNP packaging in extracellular nanovesicles (127).
Gene editing can be directed against several cellular and viral targets for anti-HIV
applications. As proof of principle, we targeted CCR5, an essential co-receptor for viral
entry (128). We observed that the aptamer/ABP approach resulted in the best CCR5
disruption in the CD4+ reporter cell line, TZMbl, compared to other packaging strategies.
When transducing unstimulated PBMC in culture to mimic in vivo conditions, we found
that using CD4-targeted paramyxovirus glycoproteins provided significantly higher rates
of delivery to resting CD4+ T cells than VSV-G. Interestingly, switching from VSV-G to
CD4-targeted glycoproteins resulted in a 2-fold reduction in Cas9 incorporation, which
could be restored by co-expressing a truncated, non-functional VSV-G protein. The VLPs
also retain the possibility of exploiting the vector genome to incorporate donor sequences
for homology-directed repair. Taken together, these findings provide a guideline for
selecting the best delivery strategy for gene editing in resting CD4+ T cells.

3.2 Materials and Methods
3.2.1 Cell lines.
293T and TZMbl cells were maintained in Dulbecco’s modified Eagle medium (DMEM),
and MOLT4.8 cells were maintained. All media were supplemented with 4 mM glutamine
and 10% fetal bovine serum (FBS).
36
3.2.4 Lentiviral vector and vector like particle production, concentration, and
transduction. All particles were generated by transfection of 10 cm plates of 293T cells
at 75% confluency. Table 1 shows different plasmids and the amount used in the
production of different types of particles.

Table 1. Plasmids used in different particle production.

Media was removed 16 hours later and replaced with 10 ml fresh DMEM plus 10% FBS.
Supernatants were harvested 48 hours after transfection and filtered through 0.45 μm
syringe filters, and either aliquoted or concentrated by ultracentrifugation using 20% (w/v)
sucrose cushions for 2 hours at 25,000 rpm in an SW41 rotor (Beckman, Indianapolis,
IN).
Vector type NiV-G NiV-F VSV-G
Cas9/gRNA
(10ug)
Packaging
Donor/
Genome
CaCl2 H2O
Cas9 RNP
VLP
(passive)
2 ug
pX330-dgRNA
10 ug
pUC19-gRNA-
R5(3)
10 ug
pCMVdeltaR8.
2
10 ug
62
Fill
up to
500
Cas9 RNP
VLP
(aptamer/ABP)
2 ug
pspCas9-3'UTR-
ST2-com-R5(3)
10 ug
PAX2-D64-
NC-COM
10 ug
62
Fill
up to
500
Cas9 RNP
VLP
(FKBP12/FRB)
2 ug
pX330-FRB-Cas9-
dgRNA
10ug
pUC19-gRNA-
R5(3)
10 ug
pCMV-
FKBP12-gag
10 ug
62
Fill
up to
500
All-in-one
vectors
2 ug
pspCas9-3'UTR-
ST2-com-R5(3)
10 ug
PAX2-D64-
NC-COM
10 ug
10 ug 62
Fill
up to
500
Donor only
vector
2 ug
pspCas9-3'UTR-
ST2-com-R5(3)
10 ug
PAX2-D64-
NC-COM
10 ug
10 ug 62
Fill
up to
500
NiV
CD4
/LV
(GFP)
0.08
ug
0.4 ug
pCMVdeltaR8.
2
10 ug
EFS-
GFP
10 ug
62
Fill
up to
500
NiV
CD4
/VLP
(Cas9)
0.08
ug
0.4 ug
pspCas9-3'UTR-
ST2-com-R5(3)
10 ug
PAX2-D64-
NC-COM
10 ug
62
Fill
up to
500
37
For larger-scale production, quantities were adjusted to seed 3x107 cells in 500cm2
plates and all reagents were scale up to 8.3-fold. Vector supernatants were harvested
and filtered through 0.45 μm syringe filters, and concentrated by tangential flow filtration
(TFF) using a polyethersulfone membrane hollow fiber unit with 100 kDa molecular weight
cut off and 115cm2 filtration surface (Spectrum Laboratories, Rancho Dominguez, CA)
and a KR2i peristaltic pump (Spectrum Laboratories). To perform buffer exchange and
prevent filter blockage, every 100 ml of vector supernatant was followed by 100 ml PBS.
A 10- to 12-fold concentration from the original volume to approximately 8 ml final volume
was achieved. All vectors were stored at -80oC in aliquots.
3.2.5 p24 and Cas9 ELISA
P24 ELISA was performed using Lenti-XTM p24 Rapid Titer Kit followed manufacture’s
manual (Takara Bio, USA).
For Cas9 ELISA, particles were first diluted (1:10) and lysed in RIPA buffer (with 1%
PMSF) for 20 mins on ice. The lysate were spin down with 11000 rpm for 10 mins. The
supernatant were then transfer to a fresh tube and proceed to Cas9 detection using Cas9
ELISA Kit following manufacture’s protocol (#PRB-5079, Cell BioLabs).
3.2.7 LV genome titration. RNA from 160 μl of LV vector stocks was extracted using
Viral RNA mini kit (Qiagen, Hilden, Germany) and reverse transcribed into cDNA using
SuperScript (Invitrogen, Carlsbad, CA), according to the manufacturer’s instructions.
Genome copy number was determined by ddPCR for the GFP sequences in the LV
genome. Briefly, 6.25 μl of 1:10 and 1:100 diluted cDNA was mixed with forward and
reverse primers (final concentration 900nM), probe (final concentration 250nM), 2x
ddPCR supermix (Bio-Rad), and made up to 25 μl with water. Twenty microliters of each
38
reaction mix was converted to droplets by the QX200 droplet generator, and droplet-
partitioned samples were transferred to a 96-well plate and sealed. Thermal cycling was
performed with the following conditions: 95 °C for 10 min., 40 cycles of 94 °C for 30 sec.,
60 °C for 1 min., and 98 °C for 10 min. Plates were read on a QX200 reader (BioRad)
and DNA copies quantified by detection of FAM positive droplets.
3.2.8 Cas9 mediated indel analysis
To determine the Cas9 mediated indel, cells were harvested at day 3 and lysed with 50ul
of quick lysis buffer at 50 C for 15 mins. The lysate were then subjected to PCR using
primer sets to amplify the target region. Amplicons were submitted to sanger sequencing
and the result were uploaded to Synthego ICE for % indel analysis.
3.2.9 PBMC isolation and transduction
Cells were ordered from Gulf Coast (http://www.giveblood.org) and isolated using
spinning method with FICOLL and Leucoseb tubes. Isolated cells were cultured in RPMI
1640 medium supplemented with 10% FBS, P/S, and IL-2. Cells were transduced with
indicated vectors at the MOI of 2 by spin inoculation at 2500 rmp for 2 hrs.
3.2.10 In vivo delivery
12-16 weeks old CD34 humanized mice with over 50% of hCD45 and over 20% of hCD4
expression in lymphocyte were selected for the experiment. Mice were injected with 200
ul of different vectors with indicated dose systemically by tail vein injection. One week
after injection, mice were bleed and different tissues were harvested for transduction
efficiency examination by FACS.

39
3.3 Result
3.3.1 Cas9 RNP packaging and delivery in VSV-G pseudotyped VLPs
To establish an efficient Cas9 RNP delivery system, three previously reported methods
were re-created in the lab for direct comparison. These strategies include (1) Passive
incorporation by simply overexpressing Cas9 and gRNA in producing cells that allow the
trafficking of assembled RNPs into the budding particles (125). (2) FRB/FKBP12
incorporation by fusion of an FRB peptide to the N terminus of Cas9 to allow its binding
to the FKBP12-fusion Gag protein in the particles (127). (3) Aptamer/ABP incorporation
by inserting an aptamer sequence into the gRNA scaffold to allow its binding to the ABP-
fusion Gag protein in the particles (Fig. 8A). Different VLP particles were produced in
293T cells and characterized for yield, Cas9 incorporation, and gene editing efficiency.
Quantification of VLPs by p24 ELISA showed comparable particle concentration between
passive and aptamer/ABP VLPs. FKBP12/FRB VLPs have a 10- to 15-fold lower p24
concentration (Fig. 8B). Interestingly, FKBP12/FRB present the best Cas9 incorporation
efficiency calculated by the ratio of Cas9 to p24 (Fig. 8C). To examine the functional RNP
delivery, different VLPs were added to 1e4 TZMbl cells with indicated Cas9 amount.
Cas9-induced indels on the CCR5 locus were quantified on D3. Surprisingly, only
aptamer/ABP derived VLPs showed successful and efficient CCR5 disrupting (Fig. 8D).
The result indicates aptamer/ABP as the best method for Cas9 RNP delivery.

40

Figure 8. Cas9 RNP packaging and gene disruption in vitro.
(A)Schematic of different packaging methods for Cas9 RNPs. (B) VLP production, quantified by
Gag p24 ELISA, shows comparable levels for the passive and aptamer/ABP approaches but 10-
15 fold less for the FKBP12/FRB approach. (C) Cas9 incorporation in different VLPs, detected by
ELISA (D) CCR5 indels following VLP application to TZMbl cell line. Only the aptamer/ABP VLPs
showed successful and efficient CCR5 disruption.

3.3.2 All-in-one vector for homology-directed repair (HDR)
We next explore the possibility of creating an all-in-one vector to deliver both Cas9 RNP
and homology donor for HDR gene editing. The aptamer/ABP approach was chosen for
Cas9 RNP delivery. A lentiviral genome encoding homology donor expression cassette
41
was included in the particle. To generate integration deficient vectors, packaging plasmid
with D64V mutation was used for production (Fig. 9A). To optimize the transgene
expression, two transcription termination signals including bovine growth hormone
polyadenylation (bGH-polyA) and woodchuck hepatitis virus posttranscriptional
regulatory element (WPRE) were tested. The polyadenylation signal is important for
mRNA stability and translation efficiency. However, an internal polyadenylation signal
included in the lentiviral vector genome has the potential to reduce vector transducing
titer (129). To prevent immature transcription termination of the lentiviral genome in the
producer cells, the internal polyadenylation signal is commonly replaced by WPRE.
However, the effects of the WPRE can be variable and highly dependent on the context
of their use (130). As proof of principle, the internal poly-A or WPRE termination signal
was added to a GFP expression cassette driven by the PGK promoter. The left and right
homology arms for CCR5 gene editing were used to flank the GFP expression cassette
to allow HDR gene editing (Fig. 9B). Produced vectors were tested for particle production
and gene editing efficiency.
Interestingly, particle production evaluated by p24 ELISA revealed a significant reduction
when poly-A is included internally in the lentiviral genome. This was observed both on the
all-in-one vector (containing donor template lentiviral genome and Cas9 RNP) and the
vector that contains only the lentiviral genome (Fig. 9C). Gene editing efficiency was
measured by GFP expression at day 10 after transduction. As expected, vectors
containing donor templates with WPRE as a termination signal resulted in a higher
expression level (Fig. 9D). These results suggested that WPRE is a better termination
signal for donor expression cassette in the all-in-one vector for HDR gene editing.
42

Figure 9. Poly-A signal in homology donor reduced HDR and vector production.
(A) Schematics of all-in-one IDLV vector for site-specific GFP insertion at CCR5 locus. (B) Donor
designs and rationale. (C) TZMbl cells treated with different particles were harvested on day 10
to measure HDR-mediated GFP expression. Poly-A tail included donors showed no successful
gene editing. (D) p24 ELISA reveals unexpected reductions in particle production when the poly-
A tail is included in the donor design. (E) GFP expression analyzed by FACS on day 6 shows no
gene editing with both RNP and Donor-only control vector and minimal gene editing for the all-in-
one vector design.

43
3.3.3 CD4-targeted delivery q23 by lentiviral vectors pseudotyped with engineered
paramyxovirus glycoproteins
Next, we ask if we can replace the VSV-G pseudotyping with the targeting ligand-
engineered paramyxovirus glycoproteins for CD4-specific delivery. Paramyxovirus
mediates cell entry through its attachment (H or G) and fusion (F) protein for receptor
binding and cell-virus membrane fusion, respectively (92, 93). The attachment proteins
from the measles virus (MeV) and Nipah virus (NiV) have been successfully re-
engineered for cell type-specific targeting by mutating their natural receptor binding sites
and adding alternate targeting ligands. Previous studies found NiV-based targeted
vectors can have 100-fold higher titers than their counterpart MeV vectors and are 10,000
less sensitive to pooled human intravenous immunoglobulin. However, NiV vectors have
the preference for membrane-proximal cell attachment, which is a crucial consideration
when selecting targeting ligands (92).
The ligands have been tested for this application include single chain antibodies (scFvs)
and Designed Ankyrin Repeat Proteins (DARPins) (40, 41) (Fig. 10). However, scFv
displayed vectors often have an inherent structural stability problem which can lead to
vector and producer cell aggregation and low titers (131). DARPins are a much more
stable ligand, but selecting molecules with appropriate binding characteristics from
synthetic libraries is expensive and time-consuming. To address these issues, we
examined the potential of an alternative ligand based on human fibronectin domain III
(FN3). FN3s offer many advantages, including their smaller size and reduced complexity,
which facilitates the selection of ligands with appropriate specificities from smaller
libraries while displaying antibodies Field's high-binding affinity and specificity (132). In
44
addition, binding domain mapping revealed that CD4-binding FN3 has different binding
sites than the CD4-binding DARPins (133, 134). This expands the options for ligand
selection and could benefit targeted-NiV development. Cell entry efficiency was reported
to be restricted by the distance between the receptor binding site to the cell membrane
(92). Finally, we hypothesized that their smaller size and lack of disulfide bonds should
facilitate incorporation into chimeric viral proteins.

Figure 10. Ligand for targeted LV engineering.

To ask if FN3 can be used as a targeting ligand for CD4-targeted vector design, we tested
different ligands and glycoprotein combinations to develop CD4-targeted lentiviral vectors
(Fig. 11A). This included using MeV or NiV glycoproteins and incorporating CD4 binding
DARPins or FN3 as the targeting ligands. As a control, we included a CD4 DARPin MeV
vector previously described (42). Consistent with the previous report, NiV-based vectors
showed higher titer compared to their paired MeV in the initial screening. Therefore, the
45
rest of the ligands were only constructed in the NiV form. The vectors were tested for their
transducing unit titer on MOLT4 cells. The titer of NiV-FN3(G06) and NiV-FN3(C06) are
compatible with NiV-D23 and NiVD55 vectors and were more than 10-fold higher than
MeV-FN3(G06) (Fig. 11B). The NiV-FN3(G06) was selected to examine specific
transduction of CD4+ T cells on non-stimulated PBMCs and compared with MeV-D29 and
VSV-G as positive and negative control respectively. When compared with the non-
specific vector pseudotyped with VSV-G, both MeV-DARPin and NiV-FN3 vectors had a
markedly enhanced ability to transduce resting T cells, which was specific for CD4-
expressing cells (Fig. 11C).
46

Figure 11. Comparing different vectors' titer and specificity.
(A) List of tested ligands and paramyxovirus glycoprotein combinations. (B) The titer of 100-fold
concentrated CD4-targeted MeV or NiV with FN3 or DARPin was tested on Molt-4 cells. (B)
unstimulated PBMC were transduced with VSV-G or selected CD4-targeted LVs at an MOI of 2.
Both CD4 targeted vectors had a markedly enhanced ability to transduce resting T cells compared
to the control VSV-G pseudotyped vectors, which was specific for CD4 expressing cells.

47
Finally, the in vivo targeted delivery of the selected vectors was also tested on a human
HSPC engrafted humanized mouse model. We observed specific human CD4+ T cell
transduction in blood, lymph node, spleen, and bone marrow. The CD4 FN3 NiV vectors
displayed compatible titers and in vivo transduction efficiencies as the control CD4
DARPin MeV vector (Fig. 12A). The data from the spleen also showed exclusive
transduction in CD4 expressing T cells by both CD4 targeted vectors (Fig. 12B). Further
analysis of the spleen samples showed that FN3-NiV vectors were able to transduce
resting and memory CD4 T cell subsets, which are important subsets for several
therapeutic applications, including HIV latent cell targeting (Fig. 12C). These findings,
therefore, demonstrate that FN3 is a useful ligand with great potential for targeted vector
development.

48

Figure 12. CD4-targeted gene delivery in CD34 humanized mouse model.
(a) NSG mice were engrafted with CD34+ cells as pups. Resting and memory T cells were
identified with activation and subtype markers and analyzed by FACS. (b) Vectors were i.v.
injected into 16 wks old CD34 humanized mice at the indicated dose. Tissues were harvested
one week after injection. GFP expression in human CD4+T cells from different tissues was
analyzed by FACS. (c) Representative FACS plots from the spleen show CD4 target specificity
(d) and (e) GFP expression in different T cell subtypes showed that both vectors can transduce
resting and memory T cells in vivo.

3.3.4 Cas9 RNP delivery by NiV
CD4
/VLP
Next, we asked if the CD4-targeted NiV glycoproteins can be used to pseudotype Cas9
RNP incorporated VLPs. NiV-F and engineered NiV-G glycoproteins with CD4-binding
DARPin or FN3 were used to replace VSV-G to produce NiV
CD4
/VLP. Cas9 RNP was
incorporated by aptamer/ABP strategy. Particles were examined for p24 titer, Cas9
incorporation, RNP delivery efficiency, and gene editing efficiency in target cells.
Quantification of VLPs by p24 ELISA showed significantly reduced NiV
CD4
/VLP particle
concentration compared to VSV-G/VLP and had similar amount of particles with the
49
production that is lacking glycoproteins (no GP) (Fig. 13A). Consistent with the p24 result,
NiV
CD4
/VLP has lower Cas9 protein concentrations (Fig. 13B). To evaluate the Cas9
delivery efficiency, VSV-G or NiV
CD4/
VLPs were quantified by Cas9 ELISA and added to
1e4 TZMbl cells. Six hours later, part of the cells was harvested to evaluate the Cas9
protein amount in cell lysate. The ratios of Cas9 amount in lysate and input VLPs were
calculated. NiV
CD4
/VLP has reduced delivery efficiency compared to VSV-G/VLP,
suggesting a less efficient viral entry (Fig. 13C). Finally, to examine if the delivered Cas9
were functional RNP, cells were harvested again at D3 for sequencing. No indel was
detected in NiV
CD4
/VLP treated cells (Fig. 13D). These results indicate two challenges
using current CD4-targeted vectors, (1) reduction of the particle release and leads to
lower Cas9 concentration of the VLP prep compared to VSV-G vectors and (2) dramatic
reduction of protein transfer into the target cells efficiency indicating non-efficient viral
entry and resulted in no detectable gene editing. Strategies to enhance particle release
and viral entry are required to overcome these challenges.

50

Figure 13. Comparison of VSV-G and NiV
CD4
delivery of Cas9 RNP via aptamer/ABP.
(A) p24 ELISA shows reduced NiV
CD4
/VLP particle production compared to VSV-G/VLP and has
similar level with the control VLP without glycoprotein pseudotyped (no GP) (n=3) (B) Consistent
with the p24 result, NiV
CD4
/VLP has lower Cas9 incorporation. (C) VSV-G or NiV
CD4/
VLPs
normalized by Cas9 ELISA were added to 1e4 TZMbl cells. Six hours later, cells were lysed, and
delivery efficiency was calculated as the ratio of Cas9 in lysate to input VLPs. This showed
reduced delivery by NiV
CD4
/VLP compared to VSV-G/VLP (n=2). (D) To examine if the delivered
Cas9 RNPs were functional, cells were harvested on day 3 for indel sequencing. No indels were
detected in NiV
CD4
/VLP treated cells.

3.3.5 VSV-G restores NiV
CD4
/VLP particle release and Cas9 concentration
To address the challenge of reduction in particle release, we tested co-expression VSV-
G in enhancing VLP production. VSV-G was known to stimulate vesicle release from
producing cells when expressed on the cell surface. It was suggested that the vesicle
release is stimulated by the membrane proximal region of the VSV-G stem to trigger
membrane curvature or viral protein (135). We, therefore, hypothesize that co-express
VSV-G could enhance the particle release during NiV
CD4
/VLP production. To retain the
CD4-targeting specificity, two receptor binding mutations, K47Q and R354A, were
introduced to the VSV-G (136). The depletion of receptor binding and cell entry of VSV-
G mutants were validated on MOLT-4 cells using pseudotype LVs expressing GFP.
Compared to the wildtype VSV-G, VSV-G
K47Q
has the best cell entry depletion (Fig. 14A).
Next, we tested the ability of different VSV-G mutants in enhancing particle release
51
compared to the no GP condition also using pseudotype LVs expressing GFP. The results
showed that VSV-G and receptor binding mutants retain the ability to enhance particle
release (Fig. 14B) significantly. Finally, we co-express NiV
CD4
with VSV-G
K47Q
for VLP
production incorporating Cas9 RNP using the aptamer/ABP method. The Cas9
concentrations in the VLP preps were examined using ELISA and compared to the
controls, including no GP and VLPs with VSV-G or NiV
CD4
glycoproteins only. As
expected, co-expressing of VSV-GK47Q successfully restored Cas9 concentration in the
VLP prep compared to both NiV
CD4
only or no GP VLPs (Fig. 14C).

Figure 14. Co-expression of non-functional VSV-G restores NiV
CD4
/VLP production.
(A) Two different VSV-G receptor binding mutations inhibit entry of pseudotyped LVs expressing
GFP, compared to VSV-G control (n=3). (B) VSV-G and receptor binding mutants significantly
enhance LV particle release, detected by p24 ELISA (n=3). (C) Addition of VSV-G mutant to
NiV
CD4
/VLP production enhanced Cas9 incorporation (n=2).

52
3.4 Discussion
As a powerful gene editing tool, CRISPR/Cas9 has been applied for HIV gene therapy
either by disrupting co-receptor such as CCR5 sequences to prevent new infection (128)
or the latent proviral genome to prevent viral rebound (137). However, up to date, most
gene therapy strategies still rely on the extraction of the target cells from a patient,
modifying and expanding ex vivo through physical or viral gene delivery methods before
re-infusion. In addition, ex vivo therapy does not allow targeting of the latently infected
cells. Even though in vivo delivery of Cas9 targeting provirus by viral methods has been
tested by LV or AAV, the application of viral vectors has limitations, including (1) non-
specific delivery potentially reducing the on-target editing efficacy and enhancing the
safety concern, (2) integration of the viral genome leads to prolonging expression of Cas9
and the potential off-targeting issue. (3) packaging capacity prohibits all-in-one delivery
vector development. (4) limited ability to transduce cells in resting state, a major cell type
of HIV latent reservoir.
In this report, we investigate the delivery system that can allow (2) Cas9 RNP delivery in
vivo that has a higher safety profile due to transient expression to reduce off-targeting, (2)
strategies to include both RNP and a homology donor in one vector to create an all-in-
one delivery vehicle for gene editing. (3) Cell type-specific targeting to reduce off-target
delivery.
Comparing three reported Cas9 RNP incorporation methods, we found FKPB12/FBR
strategy gave the highest Cas9 per p24 amount, however, it has the lowest p24 yield. In
addition, no gene editing was detected with the condition tested. On the other hand, the
aptamer/ABP strategy has a compatible level of particle production and Cas9
53
incorporation compared to the non-modified VLP (passive incorporation), resulting in
efficient gene editing. A few factors can contribute to the different observations between
aptamer/ABP with other RNP delivery strategies: (1) The gRNA scaffolded in
aptamer/ABP construct was optimized to facilitate gRAN expression and Cas9 protein
assembly. (2) Different from the FKBP12/FRB modification for the “active recruit” of Cas9,
the aptamer/ABP strategy is an “active recruit” for gRNA. The previous report has shown
that gRNA incorporation is a bottleneck for efficient gene editing for RNPs delivered by
VLPs (125). The “active recruit” of gRNA could provide a boost to overcome this limitation.
Another Cas9 RNP delivery strategy fusing Cas9 directly to Gag, the structural protein of
a lentivirus-based VLP, has been also reported to successfully package Cas9 RNP for
efficient gene editing (138–140). A direct comparison between aptamer/ABP and Gag-
Cas9 fusion strategy will provide valuable information for future studies in selecting the
best Cas9 RNP delivery strategy.
When transgene is delivered using the lentiviral vector, the internal polyadenylation signal
is commonly replaced by WPRE to prevent immature transcription termination of the
lentiviral genome in the producer cells. However, the effects of the WPRE can be
promoter and cell line specific (130). In this study, we tested both poly-A and WPRE as
the termination signal for the HDR donor template with a PGK promoter. We found WPRE
signal resulted in higher GFP expression in target cells. Unexpectedly, we also found a
reduction in particle production when the poly-A signal was used. This is opposite from
the finding of Hager the group’s report, where a reduction of functional viral titer but not
physical titer was observed when poly-A signals were included in the viral genome with
54
CMV or EF1a driven transgene (129). Further study is needed to investigate the impact
of poly-A on particle production.
Finally, when replacing the envelope from VSV-G to NiV
CD4
, we observe a significant
reduction in particle release and protein transfer efficiency. Interestingly, co-expression
of a non-functional VSV-G mutant was able to restore the Cas9 concentration in the VLP
prep, likely due to an increase of the particle production stimulated by mutated VSV-G.
Future directions for the project include investigating strategies to enhance vector entry
and overcome the reduction of the protein transfer by the NiV
CD4
envelope.

55
CHAPTER 4: CONCLUSION AND FUTURE PERSPECTIVES
Pseudotype viral vectors are powerful tools for (1) basic virology studies and (2) delivery
tools for gene therapy. The findings in this manuscript provide insights into the strategies
for particle engineering, especially as a delivery tool. So far, a lot has been done on Cas9
RNP delivery. Still, little is demonstrated for their potential in vivo or combined with a
homology donor template to create an all-in-one delivery particle. In addition, for in vivo
application, the capability for receptor- or tissue-specific delivery is important for efficacy
and safety measurements.
This is the first study on Cas9 RNP delivery in a receptor-specific VLP. More and more
studies have shown that using AAV for ex vivo or in vivo delivery has several
disadvantages, including non-specific transduction, the high dose required for efficient
gene editing, and triggering cell arrest by p53 stimulation. A recent study comparing AAV
and IDLV for gene delivery on HSC showed a lower p53 response in IDLV treatments,
suggesting an advantage for its application compared to AAV (Luigi Naldini’s group, under
revision).
The future plan for this project includes (1) optimizing the all-in-one delivery vector for
efficient HDR gene editing, (2) testing particles for in vivo delivery (3) replacing the
reporter gene with a functional gene sequence for anti-HIV gene editing, and (4)
improving CD4-targeted delivery through hyperfusogenic NiV glycoproteins (141). (5)
testing alternative targeting ligand or cell surface receptor targeting for better viral entry
efficiency.

56
REFERENCES
1. E. M. Gardner, M. P. McLees, J. F. Steiner, C. Del Rio, W. J. Burman, The
spectrum of engagement in HIV care and its relevance to test-and-treat strategies
for prevention of HIV infection. Clin. Infect. Dis. 52, 793–800 (2011).
2. S. G. Deeks, N. Archin, P. Cannon, S. Collins, R. B. Jones, M. A. W. P. de Jong,
O. Lambotte, R. Lamplough, T. Ndung’u, J. Sugarman, C. T. Tiemessen, L.
Vandekerckhove, S. R. Lewin, S. Deeks, S. Lewin, M. de Jong, Z. Ndhlovu, N.
Chomont, Z. Brumme, K. Deng, L. Jasenosky, R. Jefferys, A. Orta-Resendiz, F.
Mardarelli, M. Nijhuis, K. Bar, B. Howell, A. Schneider, G. Turk, R. Nabatanzi, J.
Blankson, J. V. Garcia, M. Paiardini, J. van Lunzen, C. Antoniadi, F. H. Côrtes, S.
Valente, O. S. Søgaard, R. S. Diaz, M. Ott, R. Dunham, S. Schwarze, S. P.
Patrigeon, J. Nabukenya, M. Caskey, B. Mothe, F. S. Wang, S. Fidler, D.
SenGupta, S. Dressler, M. Matoga, H.-P. Kiem, P. Tebas, C. Kityo, B. Dropulic, M.
Louella, K. T. Das, D. Persaud, A. Chahroudi, K. Luzuriaga, T. Puthanakit, J. Safrit,
G. Masheto, K. Dubé, J. Power, J. Salzwedel, U. Likhitwonnawut, J. Taylor, O. L.
Nuh, K. Dong, E. N. Kankaka, Research priorities for an HIV cure: International
AIDS Society Global Scientific Strategy 2021. Nat. Med. 2021 2712. 27, 2085–
2098 (2021).
3. E. E. Perez, J. Wang, J. C. Miller, Y. Jouvenot, K. A. Kim, O. Liu, N. Wang, G. Lee,
V. V Bartsevich, Y.-L. Lee, D. Y. Guschin, I. Rupniewski, A. J. Waite, C. Carpenito,
R. G. Carroll, J. S. Orange, F. D. Urnov, E. J. Rebar, D. Ando, P. D. Gregory, J. L.
Riley, M. C. Holmes, C. H. June, Establishment of HIV-1 resistance in CD4+ T
cells by genome editing using zinc-finger nucleases. Nat. Biotechnol. 26, 808–816
(2008).
4. N. Holt, J. Wang, K. Kim, G. Friedman, X. Wang, V. Taupin, G. M. Crooks, D. B.
Kohn, P. D. Gregory, M. C. Holmes, P. M. Cannon, Human hematopoietic
stem/progenitor cells modified by zinc-finger nucleases targeted to CCR5 control
HIV-1 in vivo. Nat. Biotechnol. 28, 839–847 (2010).
5. C. W. Peterson, J. Wang, C. Deleage, S. Reddy, J. Kaur, P. Polacino, A. Reik, M.
L. Huang, K. R. Jerome, S. L. Hu, M. C. Holmes, J. D. Estes, H. P. Kiem,
Differential impact of transplantation on peripheral and tissue-associated viral
reservoirs: Implications for HIV gene therapy. PLOS Pathog. 14, e1006956 (2018).
6. P. Tebas, D. Stein, W. W. Tang, I. Frank, S. Q. Wang, G. Lee, S. K. Spratt, R. T.
Surosky, M. A. Giedlin, G. Nichol, M. C. Holmes, P. D. Gregory, D. G. Ando, M.
Kalos, R. G. Collman, G. Binder-Scholl, G. Plesa, W.-T. Hwang, B. L. Levine, C.
H. June, Gene Editing of CCR5 in Autologous CD4 T Cells of Persons Infected
with HIV . N. Engl. J. Med. 370, 901–910 (2014).
7. V. Ratti, S. Nanda, S. K. Eszterhas, A. L. Howell, D. I. Wallace, A mathematical
model of HIV dynamics treated with a population of gene-edited haematopoietic
57
progenitor cells exhibiting threshold phenomenon. Math. Med. Biol. 37, 212–242
(2020).
8. D. L. DiGiusto, P. M. Cannon, M. C. Holmes, L. Li, A. Rao, J. Wang, G. Lee, P. D.
Gregory, K. A. Kim, S. B. Hayward, K. Meyer, C. Exline, E. Lopez, J. Henley, N.
Gonzalez, V. Bedell, R. Stan, J. A. Zaia, Preclinical development and qualification
of ZFN-mediated CCR5 disruption in human hematopoietic stem/progenitor cells.
Mol. Ther. Methods Clin. Dev. 3, 16067 (2016).
9. P. K. Mandal, L. M. R. Ferreira, R. Collins, T. B. Meissner, C. L. Boutwell, M.
Friesen, V. Vrbanac, B. S. Garrison, A. Stortchevoi, D. Bryder, K. Musunuru, H.
Brand, A. M. Tager, T. M. Allen, M. E. Talkowski, D. J. Rossi, C. A. Cowan, Efficient
ablation of genes in human hematopoietic stem and effector cells using
CRISPR/Cas9. Cell Stem Cell. 15, 643–652 (2014).
10. L. Kordelas, J. Verheyen, S. Esser, Shift of HIV Tropism in Stem-Cell
Transplantation with CCR5 Delta32 Mutation . N. Engl. J. Med. 371, 880–882
(2014).
11. R. I. Connor, K. E. Sheridan, D. Ceradini, S. Choe, N. R. Landau, Change in
Coreceptor Use Correlates with Disease Progression in HIV-1–Infected
Individuals. J. Exp. Med. 185, 621 (1997).
12. J. H. Ellwanger, B. Kulmann-Leal, V. de L. Kaminski, A. G. Rodrigues, M. A. de S.
Bragatte, J. A. B. Chies, Beyond HIV infection: Neglected and varied impacts of
CCR5 and CCR5Δ32 on viral diseases. Virus Res. 286, 198040 (2020).
13. Y. H. Lee, G. G. Song, Association between chemokine receptor 5 delta32
polymorphism and susceptibility to cancer: a meta-analysis. J. Recept. Signal
Transduct. Res. 35, 509–515 (2015).
14. S. W. Cho, S. Kim, J. M. Kim, J. S. Kim, Targeted genome engineering in human
cells with the Cas9 RNA-guided endonuclease. Nat. Biotechnol. 2013 313. 31,
230–232 (2013).
15. C. Li, X. Guan, T. Du, W. Jin, B. Wu, Y. Liu, P. Wang, B. Hu, G. E. Griffin, R. J.
Shattock, Q. Hu, Inhibition of HIV-1 infection of primary CD4+T-cells by gene
editing of CCR5 using adenovirus-delivered CRISPR/Cas9. J. Gen. Virol. 96,
2381–2393 (2015).
16. L. Xu, H. Yang, Y. Gao, Z. Chen, L. Xie, Y. Liu, Y. Liu, X. Wang, H. Li, W. Lai, Y.
He, A. Yao, L. Ma, Y. Shao, B. Zhang, C. Wang, H. Chen, H. Deng, CRISPR/Cas9-
Mediated CCR5 Ablation in Human Hematopoietic Stem/Progenitor Cells Confers
HIV-1 Resistance In Vivo. Mol. Ther. 25, 1782–1789 (2017).
17. L. Xu, J. Wang, Y. Liu, L. Xie, B. Su, D. Mou, L. Wang, T. Liu, X. Wang, B. Zhang,
L. Zhao, L. Hu, H. Ning, Y. Zhang, K. Deng, L. Liu, X. Lu, T. Zhang, J. Xu, C. Li,
58
H. Wu, H. Deng, H. Chen, CRISPR-Edited Stem Cells in a Patient with HIV and
Acute Lymphocytic Leukemia. N. Engl. J. Med. 381, 1240–1247 (2019).
18. and K. K. Rafal Kaminski, Ramona Bella, Chaoran Yin, Jessica Otte, Pasquale
Ferrante, Howard E. Gendelman, Hailong Li, Rosemarie Booze, Jennifer Gordon,
Wenhui Hu, Excision of HIV-1 DNA by Gene Editing: A Proof-of-Concept In Vivo
Study. 123, 4757–4763 (2016).
19. R. Kaminski, Y. Chen, T. Fischer, E. Tedaldi, A. Napoli, Y. Zhang, J. Karn, W. Hu,
K. Khalili, Elimination of HIV-1 Genomes from Human T-lymphoid Cells by
CRISPR/Cas9 Gene Editing. Sci. Rep. 6 (2016), doi:10.1038/srep22555.
20. G. Wang, N. Zhao, B. Berkhout, A. T. Das, A Combinatorial CRISPR-Cas9 Attack
on HIV-1 DNA Extinguishes All Infectious Provirus in Infected T Cell Cultures. Cell
Rep. 17, 2819–2826 (2016).
21. C. Yin, T. Zhang, X. Qu, Y. Zhang, R. Putatunda, X. Xiao, F. Li, W. Xiao, H. Zhao,
S. Dai, X. Qin, X. Mo, W. Bin Young, K. Khalili, W. Hu, In Vivo Excision of HIV-1
Provirus by saCas9 and Multiplex Single-Guide RNAs in Animal Models. Mol. Ther.
25, 1168–1186 (2017).
22. P. K. Dash, R. Kaminski, R. Bella, H. Su, S. Mathews, T. M. Ahooyi, C. Chen, P.
Mancuso, R. Sariyer, P. Ferrante, M. Donadoni, J. A. Robinson, B. Sillman, Z. Lin,
J. R. Hilaire, M. Banoub, M. Elango, N. Gautam, R. L. Mosley, L. Y. Poluektova, J.
McMillan, A. N. Bade, S. Gorantla, I. K. Sariyer, T. H. Burdo, W.-B. Young, S.
Amini, J. Gordon, J. M. Jacobson, B. Edagwa, K. Khalili, H. E. Gendelman,
Sequential LASER ART and CRISPR Treatments Eliminate HIV-1 in a Subset of
Infected Humanized Mice. Nat. Commun. 10, 2753 (2019).
23. G. Wang, N. Zhao, B. Berkhout, A. T. Das, CRISPR-Cas9 can inhibit HIV-1
replication but NHEJ repair facilitates virus escape. Mol. Ther. 24, 522–526 (2016).
24. L. Swiech, M. Heidenreich, A. Banerjee, N. Habib, Y. Li, J. Trombetta, M. Sur, F.
Zhang, In vivo interrogation of gene function in the mammalian brain using
CRISPR-Cas9. Nat. Biotechnol. 33, 102 (2015).
25. S. S. C. Hung, V. Chrysostomou, F. Li, J. K. H. Lim, J. H. Wang, J. E. Powell, L.
Tu, M. Daniszewski, C. Lo, R. C. Wong, J. G. Crowston, A. Pébay, A. E. King, B.
V. Bui, G. S. Liu, A. W. Hewitt, AAV-Mediated CRISPR/Cas Gene Editing of Retinal
Cells In Vivo. Invest. Ophthalmol. Vis. Sci. 57, 3470–3476 (2016).
26. Z. Gao, M. Fan, A. T. Das, E. Herrera-Carrillo, B. Berkhout, Extinction of all
infectious HIV in cell culture by the CRISPR-Cas12a system with only a s. Nucleic
Acids Res. 48, 5527–5539 (2020).
27. P. Pausch, B. Al-Shayeb, E. Bisom-Rapp, C. A. Tsuchida, Z. Li, B. F. Cress, G. J.
Knott, S. E. Jacobsen, J. F. Banfield, J. A. Doudna, CRISPR-CasΦ from huge
phages is a hypercompact genome editor. Science. 369, 333–337 (2020).
59
28. K. Rapti, D. Grimm, Adeno-Associated Viruses (AAV) and Host Immunity – A Race
Between the Hare and the Hedgehog. Front. Immunol. 12, 4298 (2021).
29. C. Hinderer, N. Katz, E. L. Buza, C. Dyer, T. Goode, P. Bell, L. K. Richman, J. M.
Wilson, Severe Toxicity in Nonhuman Primates and Piglets Following High-Dose
Intravenous Administration of an Adeno-Associated Virus Vector Expressing
Human SMN. Hum. Gene Ther. 29, 285–298 (2018).
30. High-dose AAV gene therapy deaths. Nat. Biotechnol. 38, 910 (2020).
31. C. H. Hakim, S. R. P. Kumar, D. O. Pérez-López, N. B. Wasala, D. Zhang, Y. Yue,
J. Teixeira, X. Pan, K. Zhang, E. D. Million, C. E. Nelson, S. Metzger, J. Han, J. A.
Louderman, F. Schmidt, F. Feng, D. Grimm, B. F. Smith, G. Yao, N. N. Yang, C.
A. Gersbach, S. jie Chen, R. W. Herzog, D. Duan, Cas9-specific immune
responses compromise local and systemic AAV CRISPR therapy in multiple
dystrophic canine models. Nat. Commun. 12, 1–12 (2021).
32. P. Colella, G. Ronzitti, F. Mingozzi, Emerging Issues in AAV-Mediated In Vivo
Gene Therapy. Mol. Ther. - Methods Clin. Dev. 8, 87–104 (2018).
33. E. Dolgin, News Feature: Gene therapy successes point to better therapies. Proc.
Natl. Acad. Sci. 116, 23866–23870 (2019).
34. W. Wang, C. Ye, J. Liu, D. Zhang, J. T. Kimata, P. Zhou, CCR5 gene disruption
via lentiviral vectors expressing Cas9 and single guided RNA renders cells
resistant to HIV-1 infection. PLoS One. 9, 1–26 (2014).
35. D. Finkelshtein, A. Werman, D. Novick, S. Barak, M. Rubinstein, LDL receptor and
its family members serve as the cellular receptors for vesicular stomatitis virus.
Proc. Natl. Acad. Sci. U. S. A. 110, 7306–7311 (2013).
36. F. Amirache, C. Lévy, C. Costa, P. E. Mangeot, B. E. Torbett, C. X. Wang, D.
Nègre, F. L. Cosset, E. Verhoeyen, Mystery solved: VSV-G-LVs do not allow
efficient gene transfer into unstimulated T cells, B cells, and HSCs because they
lack the LDL receptor. Blood. 123 (2014), pp. 1422–1424.
37. C. Lévy, F. Amirache, A. Girard-Gagnepain, C. Frecha, F. J. Roman-Rodríguez,
O. Bernadin, C. Costa, D. Nègre, A. Gutierrez-Guerrero, L. S. Vranckx, I. Clerc, N.
Taylor, L. Thielecke, K. Cornils, J. A. Bueren, P. Rio, R. Gijsbers, F.-L. Cosset, E.
Verhoeyen, Measles virus envelope pseudotyped lentiviral vectors transduce
quiescent human HSCs at an efficiency without precedent. Blood Adv. 1, 2088–
2104 (2017).
38. A. Girard-Gagnepain, F. Amirache, C. Costa, C. Lev
́ y, C. Frecha, F. Fusil, D.
Neg
̀ re, D. Lavillette, F. L. Cosset, E. Verhoeyen, Baboon envelope pseudotyped
LVs outperform VSV-G-LVs for gene transfer into early-cytokine-stimulated and
resting HSCs. Blood. 124, 1221–1231 (2014).
60
39. C. Levy, F. Fusil, F. Amirache, C. Costa, A. Girard-Gagnepain, D. Negre, O.
Bernadin, G. Garaulet, A. Rodriguez, N. Nair, T. Vandendriessche, M. Chuah, F.
L. Cosset, E. Verhoeyen, Baboon envelope pseudotyped lentiviral vectors
efficiently transduce human B cells and allow active factor IX B cell secretion in
vivo in NOD/SCIDγc-/- mice. J. Thromb. Haemost. 14, 2478–2492 (2016).
40. C. J. Buchholz, T. Friedel, H. Büning, Surface-Engineered Viral Vectors for
Selective and Cell Type-Specific Gene Delivery. Trends Biotechnol. 33, 777–790
(2015).
41. A. M. Frank, C. J. Buchholz, Surface-Engineered Lentiviral Vectors for Selective
Gene Transfer into Subtypes of Lymphocytes. Mol. Ther. - Methods Clin. Dev. 12,
19–31 (2019).
42. Q. Zhou, K. M. Uhlig, A. Muth, J. Kimpel, C. Lévy, R. C. Münch, J. Seifried, A.
Pfeiffer, A. Trkola, C. Coulibaly, D. von Laer, W. S. Wels, U. F. Hartwig, E.
Verhoeyen, C. J. Buchholz, Exclusive Transduction of Human CD4 + T Cells upon
Systemic Delivery of CD4-Targeted Lentiviral Vectors . J. Immunol. 195, 2493–
2501 (2015).
43. S. Yu, Y. Yao, H. Xiao, J. Li, Q. Liu, Y. Yang, D. Adah, J. Lu, S. Zhao, L. Qin, X.
Chen, Hum. Gene Ther., in press, doi:10.1089/hum.2017.032.
44. R. Bella, R. Kaminski, P. Mancuso, W. Bin Young, C. Chen, R. Sariyer, T. Fischer,
S. Amini, P. Ferrante, J. M. Jacobson, F. Kashanchi, K. Khalili, Removal of HIV
DNA by CRISPR from Patient Blood Engrafts in Humanized Mice. Mol. Ther. -
Nucleic Acids. 12, 275–282 (2018).
45. X. Pan, H. M. Baldauf, O. T. Keppler, O. T. Fackler, Restrictions to HIV-1
replication in resting CD4 + T lymphocytes. Cell Res. 23 (2013), pp. 876–885.
46. C. S. J. Teh, Z. Suhaili, K. T. Lim, M. A. Khamaruddin, F. Yahya, M. H. Sajili, C. C.
Yeo, K. L. Thong, Latest Developed Strategies to Minimize theOff-Target Effects
in CRISPR-Cas-MediatedGenome Editing. Nature. 388 (2018), pp. 539–547.
47. P. Zhou, X. Lou Yang, X. G. Wang, B. Hu, L. Zhang, W. Zhang, H. R. Si, Y. Zhu,
B. Li, C. L. Huang, H. D. Chen, J. Chen, Y. Luo, H. Guo, R. Di Jiang, M. Q. Liu, Y.
Chen, X. R. Shen, X. Wang, X. S. Zheng, K. Zhao, Q. J. Chen, F. Deng, L. L. Liu,
B. Yan, F. X. Zhan, Y. Y. Wang, G. F. Xiao, Z. L. Shi, A pneumonia outbreak
associated with a new coronavirus of probable bat origin. Nature. 579, 270–273
(2020).
48. Johns Hopkins, Coronavirus Resource Center. Johns Hopkins Coronavirus
Resour. Cent. (2021), , doi:https://coronavirus.jhu.edu/.
49. S. Umakanthan, V. K. Chattu, A. V Ranade, D. Das, A. Basavarajegowda, M.
Bukelo, A rapid review of recent advances in diagnosis, treatment and vaccination
for COVID-19. AIMS Public Heal. 8, 137–153 (2021).
61
50. D. F. Robbiani, C. Gaebler, F. Muecksch, J. C. C. Lorenzi, Z. Wang, A. Cho, M.
Agudelo, C. O. Barnes, A. Gazumyan, S. Finkin, T. Hägglöf, T. Y. Oliveira, C. Viant,
A. Hurley, H. H. Hoffmann, K. G. Millard, R. G. Kost, M. Cipolla, K. Gordon, F.
Bianchini, S. T. Chen, V. Ramos, R. Patel, J. Dizon, I. Shimeliovich, P. Mendoza,
H. Hartweger, L. Nogueira, M. Pack, J. Horowitz, F. Schmidt, Y. Weisblum, E.
Michailidis, A. W. Ashbrook, E. Waltari, J. E. Pak, K. E. Huey-Tubman, N. Koranda,
P. R. Hoffman, A. P. West, C. M. Rice, T. Hatziioannou, P. J. Bjorkman, P. D.
Bieniasz, M. Caskey, M. C. Nussenzweig, Convergent antibody responses to
SARS-CoV-2 in convalescent individuals. Nature. 584, 437–442 (2020).
51. B. Ju, Q. Zhang, J. Ge, R. Wang, J. Sun, X. Ge, J. Yu, S. Shan, B. Zhou, S. Song,
X. Tang, J. Yu, J. Lan, J. Yuan, H. Wang, J. Zhao, S. Zhang, Y. Wang, X. Shi, L.
Liu, J. Zhao, X. Wang, Z. Zhang, L. Zhang, Human neutralizing antibodies elicited
by SARS-CoV-2 infection. Nature. 584, 115–119 (2020).
52. L. Mohamed Khosroshahi, M. Rokni, T. Mokhtari, F. Noorbakhsh, Immunology,
Immunopathogenesis and Immunotherapeutics of COVID-19; an Overview. Int.
Immunopharmacol. 93, 107364 (2021).
53. Y. Wan, J. Shang, R. Graham, R. S. Baric, F. Li, Receptor Recognition by the
Novel Coronavirus from Wuhan: an Analysis Based on Decade-Long Structural
Studies of SARS Coronavirus. J. Virol. 94, e00127-20 (2020).
54. M. Letko, A. Marzi, V. Munster, Functional assessment of cell entry and receptor
usage for SARS-CoV-2 and other lineage B betacoronaviruses. Nat. Microbiol. 5,
562–569 (2020).
55. S. F. Masre, N. F. Jufri, F. W. Ibrahim, S. H. Abdul Raub, Classical and alternative
receptors for SARS-CoV-2 therapeutic strategy. Rev. Med. Virol., 1–9 (2020).
56. K. Wang, W. Chen, Z. Zhang, Y. Deng, J. Q. Lian, P. Du, D. Wei, Y. Zhang, X. X.
Sun, L. Gong, X. Yang, L. He, L. Zhang, Z. Yang, J. J. Geng, R. Chen, H. Zhang,
B. Wang, Y. M. Zhu, G. Nan, J. L. Jiang, L. Li, J. Wu, P. Lin, W. Huang, L. Xie, Z.
H. Zheng, K. Zhang, J. L. Miao, H. Y. Cui, M. Huang, J. Zhang, L. Fu, X. M. Yang,
Z. Zhao, S. Sun, H. Gu, Z. Wang, C. F. Wang, Y. Lu, Y. Y. Liu, Q. Y. Wang, H.
Bian, P. Zhu, Z. N. Chen, CD147-spike protein is a novel route for SARS-CoV-2
infection to host cells. Signal Transduct. Target. Ther. 5, 1–10 (2020).
57. M. Hoffmann, H. Kleine-Weber, S. Schroeder, N. Krüger, T. Herrler, S. Erichsen,
T. S. Schiergens, G. Herrler, N.-H. Wu, A. Nitsche, M. A. Müller, C. Drosten, S.
Pöhlmann, SARS-CoV-2 Cell Entry Depends on ACE2 and TMPRSS2 and Is
Blocked by a Clinically Proven Protease Inhibitor. Cell. 181, 1–10 (2020).
58. D. Bestle, M. R. Heindl, H. Limburg, T. V. L. Van, O. Pilgram, H. Moulton, D. A.
Stein, K. Hardes, M. Eickmann, O. Dolnik, C. Rohde, S. Becker, H.-D. Klenk, W.
Garten, T. Steinmetzer, E. Böttcher-Friebertshäuser, TMPRSS2 and furin are both
essential for proteolytic activation and spread of SARS-CoV-2 in human airway
62
epithelial cells and provide promising drug targets. Life Sci. Alliance. 3,
e202000786 (2020).
59. M.-Y. M. Li, L. Li, Y. Zhang, X. X.-S. Wang, Expression of the SARS-CoV-2 cell
receptor gene ACE2 in a wide variety of human tissues. Infect. Dis. Poverty. 9, 45
(2020).
60. C. G. K. Ziegler, S. J. Allon, S. K. Nyquist, I. M. Mbano, V. N. Miao, C. N. Tzouanas,
Y. Cao, A. S. Yousif, J. Bals, B. M. Hauser, J. Feldman, C. Muus, M. H. Wadsworth,
S. W. Kazer, T. K. Hughes, B. Doran, G. J. Gatter, M. Vukovic, F. Taliaferro, B. E.
Mead, Z. Guo, J. P. Wang, D. Gras, M. Plaisant, M. Ansari, I. Angelidis, H. Adler,
J. M. S. Sucre, C. J. Taylor, B. Lin, A. Waghray, V. Mitsialis, D. F. Dwyer, K. M.
Buchheit, J. A. Boyce, N. A. Barrett, T. M. Laidlaw, S. L. Carroll, L. Colonna, V.
Tkachev, C. W. Peterson, A. Yu, H. B. Zheng, H. P. Gideon, C. G. Winchell, P. L.
Lin, C. D. Bingle, S. B. Snapper, J. A. Kropski, F. J. Theis, H. B. Schiller, L. E.
Zaragosi, P. Barbry, A. Leslie, H. P. Kiem, J. A. L. Flynn, S. M. Fortune, B. Berger,
R. W. Finberg, L. S. Kean, M. Garber, A. G. Schmidt, D. Lingwood, A. K. Shalek,
J. Ordovas-Montanes, N. Banovich, A. Brazma, T. Desai, T. E. Duong, O.
Eickelberg, C. Falk, M. Farzan, I. Glass, M. Haniffa, P. Horvath, D. Hung, N.
Kaminski, M. Krasnow, M. Kuhnemund, R. Lafyatis, H. Lee, S. Leroy, S. Linnarson,
J. Lundeberg, K. Meyer, A. Misharin, M. Nawijn, M. Z. Nikolic, D. Pe’er, J. Powell,
S. Quake, J. Rajagopal, P. R. Tata, E. L. Rawlins, A. Regev, P. A. Reyfman, M.
Rojas, O. Rosen, K. Saeb-Parsy, C. Samakovlis, H. Schiller, J. L. Schultze, M. A.
Seibold, D. Shepherd, J. Spence, A. Spira, X. Sun, S. Teichmann, F. Theis, A.
Tsankov, M. van den Berge, M. von Papen, J. Whitsett, R. Xavier, Y. Xu, K. Zhang,
SARS-CoV-2 Receptor ACE2 Is an Interferon-Stimulated Gene in Human Airway
Epithelial Cells and Is Detected in Specific Cell Subsets across Tissues. Cell. 181,
1016-1035.e19 (2020).
61. Q. Li, Q. Liu, W. Huang, X. Li, Y. Wang, Current status on the development of
pseudoviruses for enveloped viruses. Rev. Med. Virol. 28, e1963 (2018).
62. M. Chen, X. Zhang, Construction and applications of SARS-CoV-2 pseudoviruses :
a mini review. Int. J. Biol. Sci. 17, 1574–1580 (2021).
63. M. E. Dieterle, D. Haslwanter, R. H. Bortz, A. S. Wirchnianski, G. Lasso, O.
Vergnolle, S. A. Abbasi, J. M. Fels, E. Laudermilch, C. Florez, A. Mengotto, D.
Kimmel, R. J. Malonis, G. Georgiev, J. Quiroz, J. Barnhill, L. anne Pirofski, J. P.
Daily, J. M. Dye, J. R. Lai, A. S. Herbert, K. Chandran, R. K. Jangra, A Replication-
Competent Vesicular Stomatitis Virus for Studies of SARS-CoV-2 Spike-Mediated
Cell Entry and Its Inhibition. Cell Host Microbe. 28, 486-496.e6 (2020).
64. X. Ou, Y. Liu, X. Lei, P. Li, D. Mi, L. Ren, L. Guo, R. Guo, T. Chen, J. Hu, Z. Xiang,
Z. Mu, X. Chen, J. Chen, K. Hu, Q. Jin, J. Wang, Z. Qian, Characterization of spike
glycoprotein of SARS-CoV-2 on virus entry and its immune cross-reactivity with
SARS-CoV. Nat. Commun. 11, 1620 (2020).
63
65. A. C. Walls, Y.-J. Park, M. A. Tortorici, A. Wall, A. T. McGuire, D. Veesler,
Structure, Function, and Antigenicity of the SARS-CoV-2 Spike Glycoprotein. Cell.
180, 1–12 (2020).
66. J. Nie, Q. Li, J. Wu, C. Zhao, H. Hao, H. Liu, L. Zhang, L. Nie, H. Qin, M. Wang,
Q. Lu, X. Li, Q. Sun, J. Liu, C. Fan, W. Huang, M. Xu, Y. Wang, Establishment and
validation of a pseudovirus neutralization assay for SARS-CoV-2. Emerg.
Microbes Infect. 9, 680–686 (2020).
67. F. Wu, J. Xun, L. Lu, S. Jiang, H. Lu, Y. Wen, J. Huang, Neutralizing antibody
responses to SARS-CoV-2 in a COVID-19 recovered patient cohort and their
implications. medRxiv (2020), doi:10.1101/2020.03.30.20047365.
68. C. Wang, W. Li, D. Drabek, N. M. A. Okba, R. van Haperen, A. D. M. E. Osterhaus,
F. J. M. van Kuppeveld, B. L. Haagmans, F. Grosveld, B.-J. Bosch, A human
monoclonal 1 antibody blocking SARS-CoV-2 infection. Nat. Commun. 11, 2251
(2020).
69. F. Schmidt, Y. Weisblum, F. Muecksch, H. H. Hoffmann, E. Michailidis, J. C. C.
Lorenzi, P. Mendoza, M. Rutkowska, E. Bednarski, C. Gaebler, M. Agudelo, A.
Cho, Z. Wang, A. Gazumyan, M. Cipolla, M. Caskey, D. F. Robbiani, M. C.
Nussenzweig, C. M. Rice, T. Hatziioannou, P. D. Bieniasz, Measuring SARS-CoV-
2 neutralizing antibody activity using pseudotyped and chimeric viruses. J. Exp.
Med. 217, e20201181 (2020).
70. J. B. Case, P. W. Rothlauf, R. E. Chen, Z. Liu, H. Zhao, A. S. Kim, L. M. Bloyet, Q.
Zeng, S. Tahan, L. Droit, M. X. G. Ilagan, M. A. Tartell, G. Amarasinghe, J. P.
Henderson, S. Miersch, M. Ustav, S. Sidhu, H. W. Virgin, D. Wang, S. Ding, D.
Corti, E. S. Theel, D. H. Fremont, M. S. Diamond, S. P. J. Whelan, Neutralizing
Antibody and Soluble ACE2 Inhibition of a Replication-Competent VSV-SARS-
CoV-2 and a Clinical Isolate of SARS-CoV-2. Cell Host Microbe. 28, 475-485.e5
(2020).
71. H. L. Xiong, Y. T. Wu, J. L. Cao, R. Yang, Y. X. Liu, J. Ma, X. Y. Qiao, X. Y. Yao,
B. H. Zhang, Y. L. Zhang, W. H. Hou, Y. Shi, J. J. Xu, L. Zhang, S. J. Wang, B. R.
Fu, T. Yang, S. X. Ge, J. Zhang, Q. Yuan, B. Y. Huang, Z. Y. Li, T. Y. Zhang, N.
S. Xia, Robust neutralization assay based on SARS-CoV-2 S-protein-bearing
vesicular stomatitis virus (VSV) pseudovirus and ACE2-overexpressing BHK21
cells. Emerg. Microbes Infect. 9, 2105–2113 (2020).
72. A. J. Greaney, T. N. Starr, P. Gilchuk, S. J. Zost, E. Binshtein, A. N. Loes, S. K.
Hilton, J. Huddleston, R. Eguia, K. H. D. Crawford, A. S. Dingens, R. S. Nargi, R.
E. Sutton, N. Suryadevara, P. W. Rothlauf, Z. Liu, S. P. J. Whelan, R. H. Carnahan,
J. E. Crowe, J. D. Bloom, Complete Mapping of Mutations to the SARS-CoV-2
Spike Receptor-Binding Domain that Escape Antibody Recognition. Cell Host
Microbe. 29, 44-57.e9 (2021).
64
73. J. Klingler, S. Weiss, V. Itri, X. Liu, K. Y. Oguntuyo, C. Stevens, S. Ikegame, C.
Hung, G. Enyindah-asonye, F. Amanat, M. Bermudez-gonzalez, V. Simon, S. Liu,
B. Lee, Role of IgM and IgA Antibodies to the Neutralization of SARS-CoV-2.
medRxiv (2020), doi:10.1101/2020.08.18.20177303.
74. L. L. Luchsinger, B. Ransegnola, D. Jin, F. Muecksch, Y. Weisblum, W. Bao, P. J.
George, M. Rodriguez, N. Tricoche, F. Schmidt, C. Gao, S. Jawahar, M. Pal, E.
Schnall, H. Zhang, D. Strauss, K. Yazdanbakhsh, C. D. Hillyer, P. D. Bieniasz, T.
Hatziioannou, Serological Assays Estimate Highly Variable SARS-CoV-2
Neutralizing Antibody Activity in Recovered COVID19 Patients. J. Clin. Microbiol.
58, e02005-20 (2020).
75. Y. Higuchi, T. Suzuki, T. Arimori, N. Ikemura, Y. Kirita, E. Ohgitani, O. Mazda, D.
Motooka, S. Nakamura, Y. Matsuura, S. Matoba, T. Okamoto, J. Takagi, A.
Hoshino, High affinity modified ACE2 receptors prevent SARS-CoV-2 infection.
bioRxiv (2020), doi:10.1101/2020.09.16.299891.
76. Y. Han, X. Duan, L. Yang, B. E. Nilsson-Payant, P. Wang, F. Duan, X. Tang, T. M.
Yaron, T. Zhang, S. Uhl, Y. Bram, C. Richardson, J. Zhu, Z. Zhao, D. Redmond,
S. Houghton, D. H. T. Nguyen, D. Xu, X. Wang, J. Jessurun, A. Borczuk, Y. Huang,
J. L. Johnson, Y. Liu, J. Xiang, H. Wang, L. C. Cantley, B. R. TenOever, D. D. Ho,
F. C. Pan, T. Evans, H. J. Chen, R. E. Schwartz, S. Chen, Identification of SARS-
CoV-2 Inhibitors using Lung and Colonic Organoids. Nature. 589, 270–275 (2021).
77. S. Ozono, Y. Zhang, H. Ode, K. Sano, T. S. Tan, K. Imai, K. Miyoshi, S. Kishigami,
T. Ueno, Y. Iwatani, T. Suzuki, K. Tokunaga, SARS-CoV-2 D614G spike mutation
increases entry efficiency with enhanced ACE2-binding affinity. Nat. Commun. 12,
848 (2021).
78. A. Muik, A.-K. Wallisch, B. Sänger, K. A. Swanson, J. Mühl, W. Chen, H. Cai, D.
Maurus, R. Sarkar, Ö. Türeci, P. R. Dormitzer, U. Şahin, Neutralization of SARS-
CoV-2 lineage B.1.1.7 pseudovirus by BNT162b2 vaccine–elicited human sera.
Science. 371, 1152–1153 (2021).
79. Z. Daniloski, T. X. Jordan, J. K. Ilmain, X. Guo, G. Bhabha, B. R. Tenoever, N. E.
Sanjana, The spike d614g mutation increases sars-cov-2 infection of multiple
human cell types. eLife. 10, e65365 (2021).
80. T. Zhou, Y. Tsybovsky, A. S. Olia, J. Gorman, M. Rapp, G. 8 Cerutti, G.-Y. Chuang,
P. S. Katsamba, A. Nazzari, J. M. Sampson, A. Schön, P. Wang, J. Bimela, W.
Shi, I.-T. Teng, B. Zhang, J. C. 10 Boyington, M. Sastry, T. Stephens, J. Stuckey,
S. Wang, R. A. 11 Friesner, D. D. Ho, J. R. Mascola, L. Shapiro, P. D. Kwong,
Cryo-EM Structures Delineate a pH-Dependent Switch 4 that Mediates Endosomal
Positioning of SARS-CoV-2 Spike Receptor-Binding Domains. bioRxiv,
doi:10.1101/2020.07.04.187989.
81. B. Korber, W. M. Fischer, S. Gnanakaran, H. Yoon, J. Theiler, W. Abfalterer, N.
Hengartner, E. E. Giorgi, T. Bhattacharya, B. Foley, K. M. Hastie, M. D. Parker, D.
65
G. Partridge, C. M. Evans, T. M. Freeman, T. I. de Silva, A. Angyal, R. L. Brown,
L. Carrilero, L. R. Green, D. C. Groves, K. J. Johnson, A. J. Keeley, B. B. Lindsey,
P. J. Parsons, M. Raza, S. Rowland-Jones, N. Smith, R. M. Tucker, D. Wang, M.
D. Wyles, C. McDanal, L. G. Perez, H. Tang, A. Moon-Walker, S. P. Whelan, C.
C. LaBranche, E. O. Saphire, D. C. Montefiori, Tracking Changes in SARS-CoV-2
Spike: Evidence that D614G Increases Infectivity of the COVID-19 Virus. Cell. 182,
812-827.e19 (2020).
82. Y. Weisblum, F. Schmidt, F. Zhang, J. DaSilva, D. Poston, J. C. C. Lorenzi, F.
Muecksch, M. Rutkowska, H.-H. H. E. Michailidis, C. Gaeble, M. Agudelo, A. Cho,
Z. Wang, A. Gazumyan, M. Cipolla, L. Luchsinger, C. D. Hillyer, M. Caskey, D. F.
Robbiani, C. M. Rice, M. C. Nussenzweig, T. Hatziioannou, P. D. Bieniasz, Escape
from neutralizing antibodies by SARS-CoV-2 spike protein variants. J. Chem. Inf.
Model. 53, 1689–1699 (2020).
83. P. Wang, M. S. Nair, L. Liu, S. Iketani, Y. Luo, Y. Guo, M. Wang, J. Yu, B. Zhang,
P. D. Kwong, B. S. Graham, J. R. Mascola, J. Y. Chang, M. T. Yin, M. Sobieszczyk,
C. A. Kyratsous, L. Shapiro, Z. Sheng, Y. Huang, D. D. Ho, Antibody resistance of
SARS-CoV-2 variants B.1.351 and B.1.1.7. Nature. 593, 130–135 (2021).
84. J. Hu, C. L. He, Q. Gao, G. J. Zhang, X. X. Cao, Q. X. Long, H. J. Deng, L. Y.
Huang, J. Chen, K. Wang, N. Tang, A. L. Huang, D614G mutation of SARS-CoV-
2 spike protein enhances viral infectivity. bioRxiv (2020),
doi:10.1101/2020.06.20.161323.
85. Z. Ku, X. Xie, E. Davidson, X. Ye, H. Su, V. D. Menachery, Y. Li, Z. Yuan, X. Zhang,
A. E. Muruato, A. G. i Escuer, B. Tyrell, K. Doolan, B. J. Doranz, D. Wrapp, P. F.
Bates, J. S. McLellan, S. R. Weiss, N. Zhang, P.-Y. Shi, Z. An, Molecular
determinants and mechanism for antibody cocktail preventing SARS-CoV-2
escape. Nat. Commun. 12, 469 (2021).
86. Z. Wang, F. Schmidt, Y. Weisblum, F. Muecksch, C. O. Barnes, S. Finkin, D.
Schaefer-Babajew, M. Cipolla, C. Gaebler, J. A. Lieberman, T. Y. Oliveira, Z. Yang,
M. E. Abernathy, K. E. Huey-Tubman, A. Hurley, M. Turroja, K. A. West, K. Gordon,
K. G. Millard, V. Ramos, J. Da Silva, J. Xu, R. A. Colbert, R. Patel, J. Dizon, C.
Unson-O’Brien, I. Shimeliovich, A. Gazumyan, M. Caskey, P. J. Bjorkman, R.
Casellas, T. Hatziioannou, P. D. Bieniasz, M. C. Nussenzweig, mRNA vaccine-
elicited antibodies to SARS-CoV-2 and circulating variants. Nature. 592, 616–622
(2021).
87. C. K. Wibmer, F. Ayres, T. Hermanus, M. Madzivhandila, P. Kgagudi, B.
Oosthuysen, B. E. Lambson, T. de Oliveira, M. Vermeulen, K. van der Berg, T.
Rossouw, M. Boswell, V. Ueckermann, S. Meiring, A. von Gottberg, C. Cohen, L.
Morris, J. N. Bhiman, P. L. Moore, SARS-CoV-2 501Y.V2 escapes neutralization
by South African COVID-19 donor plasma. Nat. Med. 27, 622–625 (2021).
66
88. J. A. Plante, Y. Liu, J. Liu, H. Xia, B. A. Johnson, K. G. Lokugamage, X. Zhang, A.
E. Muruato, J. Zou, C. R. Fontes-Garfias, D. Mirchandani, D. Scharton, J. P. Bilello,
Z. Ku, Z. An, B. Kalveram, A. N. Freiberg, V. D. Menachery, X. Xie, K. S. Plante,
S. C. Weaver, P. Y. Shi, Spike mutation D614G alters SARS-CoV-2 fitness.
Nature. 592, 116–121 (2020).
89. T. N. Starr, A. J. Greaney, S. K. Hilton, D. Ellis, K. H. D. Crawford, A. S. Dingens,
M. J. Navarro, J. E. Bowen, M. A. Tortorici, A. C. Walls, N. P. King, D. Veesler, J.
D. Bloom, Deep Mutational Scanning of SARS-CoV-2 Receptor Binding Domain
Reveals Constraints on Folding and ACE2 Binding. Cell. 182, 1295-1310.e20
(2020).
90. L. Zhang, C. B. Jackson, H. Mou, A. Ojha, H. Peng, B. D. Quinlan, E. S.
Rangarajan, A. Pan, A. Vanderheiden, M. S. Suthar, W. Li, T. Izard, C. Rader, M.
Farzan, H. Choe, SARS-CoV-2 spike-protein D614G mutation increases virion
spike density and infectivity. Nat. Commun. 11, 6013 (2020).
91. D. Weissman, M. G. Alameh, T. de Silva, P. Collini, H. Hornsby, R. Brown, C. C.
LaBranche, R. J. Edwards, L. Sutherland, S. Santra, K. Mansouri, S. Gobeil, C.
McDanal, N. Pardi, N. Hengartner, P. J. C. Lin, Y. Tam, P. A. Shaw, M. G. Lewis,
C. Boesler, U. Şahin, P. Acharya, B. F. Haynes, B. Korber, D. C. Montefiori, D614G
Spike Mutation Increases SARS CoV-2 Susceptibility to Neutralization. Cell Host
Microbe. 29, 23–31 (2021).
92. R. R. Bender, A. Muth, I. C. Schneider, T. Friedel, J. Hartmann, A. Plückthun, A.
Maisner, C. J. Buchholz, Receptor-Targeted Nipah Virus Glycoproteins Improve
Cell-Type Selective Gene Delivery and Reveal a Preference for Membrane-
Proximal Cell Attachment. PLoS Pathog. 12, e1005641 (2016).
93. S. Funke, A. Maisner, M. D. Mühlebach, U. Koehl, M. Grez, R. Cattaneo, K.
Cichutek, C. J. Buchholz, Targeted cell entry of lentiviral vectors. Mol. Ther. 16,
1427–1436 (2008).
94. F. Mammano, F. Salvatori, S. Indraccolo, A. De Rossi, L. Chieco-Bianchi, H. G.
Göttlinger, Truncation of the human immunodeficiency virus type 1 envelope
glycoprotein allows efficient pseudotyping of Moloney murine leukemia virus
particles and gene transfer into CD4+ cells. J. Virol. 71, 3341–3345 (1997).
95. I. Christodoulopoulos, P. M. Cannon, Sequences in the Cytoplasmic Tail of the
Gibbon Ape Leukemia Virus Envelope Protein That Prevent Its Incorporation into
Lentivirus Vectors. J. Virol. 75, 4129–4138 (2001).
96. S. R. Witting, P. Vallanda, A. L. Gamble, Characterization of a third generation
lentiviral vector pseudotyped with Nipah virus envelope proteins for endothelial cell
transduction. Gene Ther. 20, 997–1005 (2013).
97. M. Höhne, S. Thaler, J. C. Dudda, B. Groner, B. S. Schnierle, Truncation of the
human immunodeficiency virus-type-2 envelope glycoprotein allows efficient
67
pseudotyping of murine leukemia virus retrovital vector particles. Virology. 261,
70–78 (1999).
98. M. J. Moore, T. Dorfman, W. Li, S. K. Wong, Y. Li, J. H. Kuhn, J. Coderre, N.
Vasilieva, Z. Han, T. C. Greenough, M. Farzan, H. Choe, Retroviruses
Pseudotyped with the Severe Acute Respiratory Syndrome Coronavirus Spike
Protein Efficiently Infect Cells Expressing Angiotensin-Converting Enzyme 2. J.
Virol. 78, 10628–10635 (2004).
99. H. C. Aguilar, W. F. Anderson, P. M. Cannon, Cytoplasmic Tail of Moloney Murine
Leukemia Virus Envelope Protein Influences the Conformation of the Extracellular
Domain: Implications for Mechanism of Action of the R Peptide. J. Virol. 77, 1281–
1291 (2003).
100. D. Khetawat, C. C. Broder, A functional henipavirus envelope glycoprotein
pseudotyped lentivirus assay system. Virol. J. 7, 1–14 (2010).
101. H. C. Aguilar, K. A. Matreyek, D. Y. Choi, C. M. Filone, S. Young, B. Lee, Polybasic
KKR Motif in the Cytoplasmic Tail of Nipah Virus Fusion Protein Modulates
Membrane Fusion by Inside-Out Signaling. J. Virol. 81, 4520–4532 (2007).
102. K. Zingler, D. R. Littman, Truncation of the cytoplasmic domain of the simian
immunodeficiency virus envelope glycoprotein increases env incorporation into
particles and fusogenicity and infectivity. J. Virol. 67, 2824–2831 (1993).
103. T. Cathomen, H. Y. Naim, R. Cattaneo, Measles Viruses with Altered Envelope
Protein Cytoplasmic Tails Gain Cell Fusion Competence. J. Virol. 72, 1224–1234
(1998).
104. J. Chen, J. M. Kovacs, H. Peng, S. Rits-Volloch, J. Lu, D. Park, E. Zablowsky, M.
S. Seaman, B. Chen, Effect of the cytoplasmic domain on antigenic characteristics
of HIV-1 envelope glycoprotein. Science. 349, 191–195 (2015).
105. E. White, F. Wu, E. Chertova, J. Bess, J. D. Roser, J. D. Lifson, V. M. Hirsch,
Truncating the gp41 Cytoplasmic Tail of Simian Immunodeficiency Virus
Decreases Sensitivity to Neutralizing Antibodies without Increasing the Envelope
Content of Virions. J. Virol. 92, e01688-17 (2017).
106. J. Yu, Z. Li, X. He, M. S. Gebre, E. A. Bondzie, H. Wan, C. Jacob-Dolan, D. R.
Martinez, J. P. Nkolola, R. S. Baric, D. H. Barouch, Deletion of the SARS-CoV-2
Spike Cytoplasmic Tail Increases Infectivity in Pseudovirus Neutralization Assays.
J. Virol. 95, e00044-21 (2021).
107. M. C. Johnson, T. D. Lyddon, R. Suarez, B. Salcedo, M. LePique, M. Graham, C.
Ricana, C. Robinson, D. G. Ritter, Optimized Pseudotyping Conditions for the
SARS-COV-2 Spike Glycoprotein. J. Virol. 94, e01062-20 (2020).
68
108. K. E. Havranek, A. R. Jimenez, M. D. Acciani, M. Fernanda, L. Mendoza, J. Mary,
R. Ballista, D. A. Diaz, M. A. Brindley, SARS-CoV-2 Spike Alterations Enhance.
Viruses. 12, 1465 (2020).
109. X. Fu, L. Tao, X. Zhang, Comprehensive and systemic optimization for improving
the yield of SARS-COV-2 spike pseudotyped virus. Mol. Ther. - Methods Clin. Dev.
20, 350–356 (2020).
110. M. A. Whitt, Generation of VSV pseudotypes using recombinant ΔG-VSV for
studies on virus entry, identification of entry inhibitors, and immune responses to
vaccines. J. Virol. Methods. 169, 365–374 (2010).
111. Y. W. Chen, S. X. Huang, A. L. R. T. De Carvalho, S. H. Ho, M. N. Islam, S. Volpi,
L. D. Notarangelo, M. Ciancanelli, J. L. Casanova, J. Bhattacharya, A. F. Liang, L.
M. Palermo, M. Porotto, A. Moscona, H. W. Snoeck, A three-dimensional model of
human lung development and disease from pluripotent stem cells. Nat. Cell Biol.
19, 542–549 (2017).
112. B. Chandrasekaran, S. Fernandes, A Cross-Sectional Study Examining the
Seroprevalence of Severe Acute Respiratory Syndrome Coronavirus 2 Antibodies
in a University Student Population. Diabetes Metab Syndr. 67, 763–768 (2020).
113. M. Sarzotti-Kelsoe, R. T. Bailer, E. Turk, C. li Lin, M. Bilska, K. M. Greene, H. Gao,
C. A. Todd, D. A. Ozaki, M. S. Seaman, J. R. Mascola, D. C. Montefiori,
Optimization and validation of the TZM-bl assay for standardized assessments of
neutralizing antibodies against HIV-1. J. Immunol. Methods. 409, 131–146 (2014).
114. A. R. Cooper, S. Patel, S. Senadheera, K. Plath, D. B. Kohn, R. P. Hollis, Highly
efficient large-scale lentiviral vector concentration by tandem tangential flow
filtration. J. Virol. Methods. 177, 1–9 (2011).
115. M. Geraerts, M. Micheils, V. Baekelandt, Z. Debyser, R. Gijsbers, Upscaling of
lentiviral vector production by tangential flow filtration. J. Gene Med. 7, 1299–1310
(2005).
116. R. Lorenzo-Redondo, H. H. Nam, S. C. Roberts, L. M. Simons, L. J. Jennings, C.
Qi, C. J. Achenbach, A. R. Hauser, M. G. Ison, J. F. Hultquist, E. A. Ozer, A clade
of SARS-CoV-2 viruses associated with lower viral loads in patient upper airways.
EBioMedicine. 62, 103112 (2020).
117. Y. J. Hou, S. Chiba, P. Halfmann, C. Ehre, M. Kuroda, K. H. Dinnon, S. R. Leist,
A. Schäfer, N. Nakajima, K. Takahashi, R. E. Lee, T. M. Mascenik, R. Graham, C.
E. Edwards, L. V. Tse, K. Okuda, A. J. Markmann, L. Bartelt, A. de Silva, D. M.
Margolis, R. C. Boucher, S. H. Randell, T. Suzuki, L. E. Gralinski, Y. Kawaoka, R.
S. Baric, SARS-CoV-2 D614G variant exhibits efficient replication ex vivo and
transmission in vivo. Science. 370, 1464–1468 (2020).
69
118. B. Zhou, T. Thi Nhu Thao, D. Hoffmann, A. Taddeo, N. Ebert, F. Labroussaa, A.
Pohlmann, J. King, S. Steiner, J. N. Kelly, J. Portmann, N. J. Halwe, L. Ulrich, B.
S. Trüeb, X. Fan, B. Hoffmann, L. Wang, L. Thomann, X. Lin, H. Stalder, B. Pozzi,
S. de Brot, N. Jiang, D. Cui, J. Hossain, M. Wilson, M. Keller, T. J. Stark, J. R.
Barnes, R. Dijkman, J. Jores, C. Benarafa, D. E. Wentworth, V. Thiel, M. Beer,
SARS-CoV-2 spike D614G change enhances replication and transmission.
Nature. 592, 122–127 (2021).
119. W. A. Michaud, G. M. Boland, S. A. Rabi, The SARS-CoV-2 Spike mutation D614G
increases entry fitness across a range of ACE2 levels, directly outcompetes the
wild type, and is preferentially incorporated into trimers. bioRxiv (2020),
doi:10.1101/2020.08.25.267500.
120. L. Yurkovetskiy, X. Wang, K. E. Pascal, C. Tomkins-Tinch, T. P. Nyalile, Y. Wang,
A. Baum, W. E. Diehl, A. Dauphin, C. Carbone, K. Veinotte, S. B. Egri, S. F.
Schaffner, J. E. Lemieux, J. B. Munro, A. Rafique, A. Barve, P. C. Sabeti, C. A.
Kyratsous, N. V. Dudkina, K. Shen, J. Luban, Structural and Functional Analysis
of the D614G SARS-CoV-2 Spike Protein Variant. Cell. 183, 739-751.e8 (2020).
121. A. Fernández, Structural Impact of Mutation D614G in SARS-CoV-2 Spike Protein:
Enhanced Infectivity and Therapeutic Opportunity. ACS Med. Chem. Lett. 11,
1667–1670 (2020).
122. M. Cavazzana-Calvo, E. Payen, O. Negre, G. Wang, K. Hehir, F. Fusil, J. Down,
M. Denaro, T. Brady, K. Westerman, R. Cavallesco, B. Gillet-Legrand, L.
Caccavelli, R. Sgarra, L. Maouche-Chrétien, F. Bernaudin, R. Girot, R. Dorazio, G.
J. Mulder, A. Polack, A. Bank, J. Soulier, J. Larghero, N. Kabbara, B. Dalle, B.
Gourmel, G. Socie, S. Chrétien, N. Cartier, P. Aubourg, A. Fischer, K. Cornetta, F.
Galacteros, Y. Beuzard, E. Gluckman, F. Bushman, S. Hacein-Bey-Abina, P.
Leboulch, Transfusion independence and HMGA2 activation after gene therapy of
human β-thalassaemia. Nature. 467, 318–322 (2010).
123. A. J. McAuley, M. J. Kuiper, P. A. Durr, M. P. Bruce, J. Barr, S. Todd, G. G. Au, K.
Blasdell, M. Tachedjian, S. Lowther, G. A. Marsh, S. Edwards, T. Poole, R. Layton,
S.-J. J. Riddell, T. W. Drew, J. D. Druce, T. R. F. F. Smith, K. E. Broderick, S. S.
Vasan, Experimental and in silico evidence suggests vaccines are unlikely to be
affected by D614G mutation in SARS-CoV-2 spike protein. npj Vaccines. 5, 96
(2020).
124. X. Deng, M. A. Garcia-Knight, M. M. Khalid, V. Servellita, C. Wang, M. K. Morris,
A. Sotomayor-González, D. R. Glasner, K. R. Reyes, A. S. Gliwa, N. P. Reddy, C.
Sanchez, S. Martin, S. Federman, J. Cheng, J. Balcerek, J. Taylor, J. A. Streithorst,
S. Miller, G. R. Kumar, B. Sreekumar, P.-Y. Chen, U. Schulze-Gahmen, T. Y. Taha,
J. Hayashi, C. R. Simoneau, S. McMahon, P. V. Lidsky, Y. Xiao, P. Hemarajata,
N. M. Green, A. Espinosa, C. Kath, M. Haw, J. Bell, J. K. Hacker, C. Hanson, D.
A. Wadford, C. Anaya, D. Ferguson, L. F. Lareau, P. A. Frankino, H. Shivram, S.
K. Wyman, M. Ott, R. Andino, C. Y. Chiu, Transmission, infectivity, and antibody
70
neutralization of an emerging SARS-CoV-2 variant in California carrying a L452R
spike protein mutation. medRxiv (2021), doi:10.1101/2021.03.07.21252647.
125. C. Montagna, G. Petris, A. Casini, G. Maule, G. M. Franceschini, I. Zanella, L.
Conti, F. Arnoldi, O. R. Burrone, L. Zentilin, S. Zacchigna, M. Giacca, A. Cereseto,
VSV-G-Enveloped Vesicles for Traceless Delivery of CRISPR-Cas9. Mol. Ther. -
Nucleic Acids. 12, 453–462 (2018).
126. Z. Lu, X. Yao, P. Lyu, M. Yadav, K. Yoo, A. Atala, B. Lu, Lentiviral Capsid-Mediated
Streptococcus pyogenes Cas9 Ribonucleoprotein Delivery for Efficient and Safe
Multiplex Genome Editing. Cris. J. XX, 1–15 (2021).
127. P. Gee, M. S. Y. Lung, Y. Okuzaki, N. Sasakawa, T. Iguchi, Y. Makita, H. Hozumi,
Y. Miura, L. F. Yang, M. Iwasaki, X. H. Wang, M. A. Waller, N. Shirai, Y. O. Abe,
Y. Fujita, K. Watanabe, A. Kagita, K. A. Iwabuchi, M. Yasuda, H. Xu, T. Noda, J.
Komano, H. Sakurai, N. Inukai, A. Hotta, Extracellular nanovesicles for packaging
of CRISPR-Cas9 protein and sgRNA to induce therapeutic exon skipping. Nat.
Commun. 11, 4–20 (2020).
128. A. G. Allen, C.-H. Chung, A. Atkins, W. Dampier, K. Khalili, M. R. Nonnemacher,
B. Wigdahl, Gene Editing of HIV-1 Co-receptors to Prevent and/or Cure Virus
Infection. Front. Microbiol. 9, 1–14 (2018).
129. S. Hager, F. M. Frame, A. T. Collins, J. E. Burns, N. J. Maitland, An internal
polyadenylation signal substantially increases expression levels of lentivirus-
delivered transgenes but has the potential to reduce viral titer in a promoter-
dependent manner. Hum. Gene Ther. 19, 840–850 (2008).
130. R. Klein, B. Ruttkowski, E. Knapp, B. Salmons, W. H. Günzburg, C. Hohenadl,
WPRE-mediated enhancement of gene expression is promoter and cell line
specific. Gene. 372, 153–161 (2006).
131. T. Friedel, L. J. Hanisch, A. Muth, A. Honegger, H. Abken, A. Plückthun, C. J.
Buchholz, I. C. Schneider, Receptor-targeted lentiviral vectors are exceptionally
sensitive toward the biophysical properties of the displayed single-chain Fv.
Protein Eng. Des. Sel. 28, 93–105 (2015).
132. a Koide, C. W. Bailey, X. Huang, S. Koide, The fibronectin type III domain as a
scaffold for novel binding proteins. J. Mol. Biol. 284, 1141–51 (1998).
133. A. Schweizer, P. Rusert, L. Berlinger, C. R. Ruprecht, A. Mann, S. Corthésy, S. G.
Turville, M. Aravantinou, M. Fischer, M. Robbiani, P. Amstutz, A. Trkola, CD4-
specific designed ankyrin repeat proteins are novel potent HIV entry inhibitors with
unique characteristics. PLoS Pathog. 4 (2008), doi:10.1371/journal.ppat.1000109.
134. D. Wensel, Y. Sun, Z. Li, S. Zhang, C. Picarillo, T. McDonagh, D. Fabrizio, M.
Cockett, M. Krystal, J. Davis, Discovery and characterization of a novel CD4-
71
binding adnectin with potent anti-HIV activity. Antimicrob. Agents Chemother. 61,
1–19 (2017).
135. E. Jeetendra, C. S. Robison, L. M. Albritton, M. A. Whitt, The Membrane-Proximal
Domain of Vesicular Stomatitis Virus G Protein Functions as a Membrane Fusion
Potentiator and Can Induce Hemifusion. J. Virol. 76, 12300–12311 (2002).
136. J. Nikolic, L. Belot, H. Raux, P. Legrand, Y. Gaudin, A. A. Albertini, Structural basis
for the recognition of LDL-receptor family members by VSV glycoprotein. Nat.
Commun. 9, 1–12 (2018).
137. H. S. De Silva Feelixge, K. R. Jerome, Excision of Latent HIV-1 from Infected Cells
In Vivo: An Important Step Forward. Mol. Ther. 25, 1062–1064 (2017).
138. J. G. Choi, Y. Dang, S. Abraham, H. Ma, J. Zhang, H. Guo, Y. Cai, J. G. Mikkelsen,
H. Wu, P. Shankar, N. Manjunath, Lentivirus pre-packed with Cas9 protein for
safer gene editing. Gene Ther. 23, 627–633 (2016).
139. P. E. Mangeot, V. Risson, F. Fusil, A. Marnef, E. Laurent, J. Blin, V. Mournetas, E.
Massouridès, T. J. M. Sohier, A. Corbin, F. Aubé, M. Teixeira, C. Pinset, L.
Schaeffer, G. Legube, F. L. Cosset, E. Verhoeyen, T. Ohlmann, E. P. Ricci,
Genome editing in primary cells and in vivo using viral-derived Nanoblades loaded
with Cas9-sgRNA ribonucleoproteins. Nat. Commun. 10, 1–15 (2019).
140. J. R. Hamilton, C. A. Tsuchida, D. N. Nguyen, B. R. Shy, E. R. McGarrigle, C. R.
Sandoval Espinoza, D. Carr, F. Blaeschke, A. Marson, J. A. Doudna, Targeted
delivery of CRISPR-Cas9 and transgenes enables complex immune cell
engineering. Cell Rep. 35 (2021), doi:10.1016/j.celrep.2021.109207.
141. H. C. Aguilar, K. A. Matreyek, C. M. Filone, S. T. Hashimi, E. L. Levroney, O. A.
Negrete, A. Bertolotti-Ciarlet, D. Y. Choi, I. McHardy, J. A. Fulcher, S. V Su, M. C.
Wolf, L. Kohatsu, L. G. Baum, B. Lee, N-glycans on Nipah virus fusion protein
protect against neutralization but reduce membrane fusion and viral entry. J. Virol.
80, 4878–89 (2006).

Abstract (if available)

Abstract Pseudotyped viral vectors are powerful tools for basic virology studies or as the delivery vehicle for therapeutic reagents. This dissertation examined different pseudotyped viral vectors for their applications (1) in SARS-CoV-2 viral entry and neutralization studies and (2) as a delivery vehicle for CRISPR/Cas9 for HIV gene therapy.
The high pathogenicity of SARS-CoV-2 requires it to be handled under biosafety level 3 conditions. Consequently, Spike protein pseudotyped vectors are a useful tool to study viral entry and its inhibition, with retroviral, lentiviral (LV), and vesicular stomatitis virus (VSV) vectors the most commonly used systems. Methods to increase the titer of such vectors normally include concentration by ultracentrifugation and truncation of the Spike protein cytoplasmic tail. However, limited studies have examined whether such a modification impacts the protein’s function. Here, we optimized concentration methods for SARS-CoV-2 Spike pseudotyped VSV vectors, finding that tangential flow filtration produced vectors with more consistent titers than ultracentrifugation. We also examined the impact of Spike tail truncation on transduction of various cell types and sensitivity to convalescent serum neutralization. We found that tail truncation increased Spike incorporation into both LV and VSV vectors and resulted in enhanced titers but had no impact on sensitivity to convalescent serum inhibition. In addition, we analyzed the effect of the D614G mutation, which became a dominant SARS-CoV-2 variant early in the pandemic. Our studies revealed that, similar to the tail truncation, D614G independently increases Spike incorporation and vector titers, but this effect is masked by including the cytoplasmic tail truncation. Therefore, full-length Spike protein, combined with tangential flow filtration, is recommended to generate high titer pseudotyped vectors that retain native Spike protein functions.
For HIV gene therapy, improved in vivo gene editing will provide significant advances to engineer anti-HIV resistance in uninfected cells and target integrated viral genomes in infected cells. To do in vivo gene editing, a delivery vehicle that can target CD4+ T cells is desirable. This study explores strategies to develop lentivirus-based vector-like particles (VLPs) pseudotyped with engineered CD4-targeted paramyxovirus. The CD4-targeted VLP were examined for their ability to package CRISPR/Cas9 ribonucleoproteins (RNPs) and cell type-specific delivery. The goal is to allow delivery specifically to resting CD4+ lymphocytes without long-term expression of the Cas9 protein for safer in vivo gene editing.
As proof of principle, we targeted CCR5, an essential co-receptor for HIV entry. Using resting CD4+ T cells ex vivo, we found that CD4-targeted paramyxovirus glycoproteins provided significantly higher delivery rates than VSV-G and were able to specifically transduce CD4+ T cells in vivo in a humanized mouse model. For Cas9 packaging and delivery, the aptamer/ABP approach resulted in the best gene editing efficiency. It was then tested for its compatibility with a lentiviral genome packaging to deliver a homology donor template for homology-directed gene editing. Unexpectedly, switching from VSV-G to CD4-targeted glycoproteins in VLP production resulted in a reduction in particle amount and loss of RNP function in target cells. Interestingly, co-expression of a non-functional VSV-G mutant could restore VLP production. These findings provide insights into the potential of lentiviral VLPs to function as a transient all-in-one delivery system and the challenges of optimizing an in vivo gene editing system targeting resting CD4+ T cells.

Linked assets

University of Southern California Dissertations and Theses

Conceptually similar

PDF

Improving adeno-associated viral vector for hematopoietic stem cells gene therapy

PDF

Engineering viral vectors for T-cell immunotherapy and HIV-1 vaccine

PDF

Rational selection of CRISPR/Cas9 guide RNAs for homology directed genome editing and its utility in the development of gene therapies

PDF

SARS-CoV-2 suppression of CD1d expression and NKT cell function

PDF

Non-viral and viral hematopoietic progenitor cell gene therapy

PDF

The role of envelope protein in SARS-CoV-2 evasion of CD1d antigen presentation pathway

PDF

SARS-CoV-2 interaction with the CD1d/NKT cell antigen presentation system

PDF

The interaction of SARS-CoV-2 with CD1d/NKT antigen presentation pathway

PDF

Using engineered exosomes and gene-editing to target latent HIV

PDF

Mechanism of ethanol-mediated increase of SARS-COV-2 entry through GRP78 induction

PDF

The analysis and modeling of signaling pathways induced by the interactions of the SARS-CoV-2 spike protein with cellular receptors

PDF

Engineering lentiviral vectors for gene therapy and DC-vaccine

PDF

Engineering lentiviral vectors for gene delivery and immunization

PDF

Molecular characterization of the HIV-1 Vpu protein and its role in antagonizing the cellular restriction factor BST-2/tetherin both in vitro and in vivo

PDF

Identification of molecular mechanism for cell-fate decision in liver; &, SARS-CoV replicon inhibitor high throughput drug screening

PDF

Discovery of mature microRNA sequences within the protein- coding regions of global HIV-1 genomes: Predictions of novel mechanisms for viral infection and pathogenicity

PDF

Design and characterization of multiplex anti-HIV single domain antibodies for genome editing of the immunoglobulin locus

Asset Metadata

Creator Chen, Hsu-Yu (author)

Core Title Pseudotyped viral vectors: HIV gene therapy applications and basic studies of SARS-COV-2

School Keck School of Medicine

Degree Doctor of Philosophy

Degree Program Medical Biology

Degree Conferral Date 2022-12

Publication Date 09/21/2022

Defense Date 06/02/2022

Publisher University of Southern California (original), University of Southern California. Libraries (digital)

Tag CRISPR-Cas9,gene editing,HIV,in vivo delivery,lentiviral vector,OAI-PMH Harvest,pseudoviral vector,SARS-CoV-2,vector-like particle

Format application/pdf (imt)

Language English

Contributor Electronically uploaded by the author (provenance)

Advisor Siemer, Ansgar B. (committee chair), Cannon, Paula (committee member), Hacia, Joseph G. (committee member), Saito, Takeshi (committee member)

Creator Email dolphinazure@gmail.com,hsuyuche@usc.edu

Permanent Link (DOI) https://doi.org/10.25549/usctheses-oUC112013939

Unique identifier UC112013939

Legacy Identifier etd-ChenHsuYu-11237

Document Type Dissertation

Format application/pdf (imt)

Rights Chen, Hsu-Yu

Type texts

Source 20220921-usctheses-batch-983 (batch), University of Southern California (contributing entity), University of Southern California Dissertations and Theses (collection)

Access Conditions The author retains rights to his/her dissertation, thesis or other graduate work according to U.S. copyright law. Electronic access is being provided by the USC Libraries in agreement with the author, as the original true and official version of the work, but does not grant the reader permission to use the work if the desired use is covered by copyright. It is the author, as rights holder, who must provide use permission if such use is covered by copyright. The original signature page accompanying the original submission of the work to the USC Libraries is retained by the USC Libraries and a copy of it may be obtained by authorized requesters contacting the repository e-mail address given.

Repository Name University of Southern California Digital Library

Repository Location USC Digital Library, University of Southern California, University Park Campus MC 2810, 3434 South Grand Avenue, 2nd Floor, Los Angeles, California 90089-2810, USA

Repository Email cisadmin@lib.usc.edu