University of Southern California Dissertations and Theses

Immune responses by glia during neurotropic coronavirus induced encephalomyelitis

(USC Thesis Other)

Immune responses by glia during neurotropic coronavirus induced encephalomyelitis

PDF

Download

Open document

Flip pages

Download a page range

Download transcript

Copy asset link

Request this asset

Transcript (if available)

Content

IMMUNE RESPONSES BY GLIA DURING NEUROTROPIC CORONAVIRUS INDUCED
ENCEPHALOMYELITIS

by

Karen Emmerette Malone

A Dissertation Presented to the
FACULTY OF THE GRADUATE SCHOOL
UNIVERSITY OF SOUTHERN CALIFORNIA
In Partial Fulfillment of the
Requirements for the Degree
DOCTOR OF PHILOSOPHY
(PATHOBIOLOGY)

December 2008

Copyright 2008 Karen Emmerette Malone

ii
Dedication
This thesis is dedicated to my parents, Kevin and Karen Malone, who have
strongly supported me as an independent thinker.
iii
Acknowledgements
I would like to acknowledge my committee members, Dr. Florence
Hofman, Dr. David Hinton and Dr. Judy Garner as well as the USC
Department of Pathology for allowing me to complete my dissertation
research at the Cleveland Clinic under the direction of Dr. Cornelia
Bergmann, who oversaw my research, thesis and manuscript writing.
I thank Dr. Stephen Stohlman for his technical training, particularly in
working with mice and virological methods. I also appreciate Dr. Stohlman’s
guidance during the preparation of my proposal for Ph.D. research.
I would also like to acknowledge the faculty of the Lerner Research
Institute at the Cleveland Clinic for their guidance in research, manuscript
preparation and professional training, particularly Dr. Richard Ransohoff, Dr.
Bruce Trapp and Dr. Marcia Jarrett.
I thank Hal Soucier and Jennifer Powers for their time and technical
expertise in flow cytometry activated cell sorting (FACS).
iv
Table of Contents

Dedication ii
Acknowledgements iii
List of Tables vi
List of Figures vii
Abstract x
Chapter 1: Coronaviruses and the central nervous system 1
Chapter 1 References 12
Part 1: Host-virus interactions
Chapter 2: Viral spread in the CNS and the establishment of persistent 17
infection of oligodendroglia
Chapter 2 References 45
Chapter 3: Innate immune responses by oligodendroglia and microglia 50
Chapter 3 References 71
Part 2: Interacting with the adaptive immune response
Chapter 4: Induction of MHC class I antigen processing components 76
by oligodendroglia and microglia during JHMV infection of
CNS

Chapter 4 References 105

Chapter 5: Regulation of PD-L1 inhibitory ligand transcription by 110
oligodendroglia during JHMV infection
Chapter 5 References 120

Chapter 6: MHC class II expressing antigen presenting cells in the 122
CNS and the mystical dendritic cell
v
Chapter 6 References 146
Chapter 7: Early events in JHMV infection and the roles of interferons 151
Chapter 7 References 166

Chapter 8: Experimental methods and design for the investigation of 171
glial responses to JHMV infection

Chapter 8 References 184
Bibliography 186
Appendix: Real-time PCR primers 210
vi
List of Tables
Table 6.1 Fas and Trail-R transcript levels in microglia and 129
oligodendroglia.

Table 6.2 Unique feature of myeloid dendritic cell regulation of MHC 143
class II.

Table 7.1 ISGs induced by mature oligodendroglia during JHMV 154
infection in vivo.

Table 8.1 Classification of cell types for identification by flow 175
cytometry.

Table 8.2 Antibodies utilized for flow cytometry. 175

Table 8.3 Number of cells isolated per organ by FACS. 177

vii
List of Figures
Figure 2.1 The JHMV Genome 19
Figure 2.2 Viral spread in resident glia during acute infection of JHMV. 23
Figure 2.3 Genomic-length vRNA associated with leukocytes 25
infiltrating the brain.

Figure 2.4 Genomic-length vRNA remains at high levels in mature 27
oligodendroglia from the brain and spinal cord during
the persistent phase of infection.

Figure 2.5 Evaluation of subgenomic vRNAs in vitro. 30

Figure 2.6 Evaluation of subgenomic vRNAs encoding structural 34
proteins in vivo.

Figure 2.7 Expression of nucleocapsid and membrane encoding sub- 37
genomic vRNAs in microglia and oligodendroglia.

Figure 3.1 Overview of PAMP-receptor pathways capable of detecting 52
vRNA and initiating early inflammatory responses including
IFNαβ.

Figure 3.2 Overview of IFN responses in the brain during JHMV 57
Infection.

Figure 3.3 IFNαβ transcripts are upregulated by a variety of populations 59
during JHMV infection, except oligodendroglia.

Figure 3.4 Induction of IFNβ by microglia strongly correlates with their 60
viral burden.

Figure 3.5 Microglia and oligodendroglia upregulate PAMP-receptors 61
that may detect vRNA during infection.

Figure 3.6 Oligodendroglia require IFNαβ signaling for the early up- 62
regulation of Mda5 and RIG-I transcripts during JHMV
infection.

Figure 3.7 Failure to induce IKKε also supports a limited expression 65
of ISGs in oligodendroglia.

viii
Figure 4.1 Schematic of peptide processing for MHC class I 78
presentation.

Figure 4.2 Delayed MHC class I expression on oligodendroglia 82
compared to microglia during infection.

Figure 4.3 Disparate basal levels of class I antigen presentation 85
associated transcripts in microglia and oligodendroglia
isolated from naïve mice.

Figure 4.4 Absence of intracellular MHC class I heavy chain 86
expression by naïve microglia.

Figure 4.5 Cell-type specific regulation of MHC class I antigen 89
processing genes.

Figure 4.6 Transcript levels for MHC class I pathway genes in microglia 90
and oligodendroglia from the spinal cord during infection.

Figure 4.7 Transcription of MHC class I-related genes is 93
coordinated via shared promoter elements.

Figure 4.8 Kinetics of IRF-1/2 mRNA upregulation following infection. 95

Figure 4.9 IFNγ dependent MHC class I expression on oligodendroglia. 98

Figure 5.1 CD54 is predominantly expressed by microglia and 113
infiltrating leukocytes.

Figure 5.2 Oligodendroglia upregulate PD-L1 transcripts in parallel 114
with MHC class I.

Figure 5.3 IFNγ strongly regulates PD-L1 expression by O4+ glia. 115

Figure 5.4 Oligodendroglia exhibit prolonged expression of PD-L1 116
in association with MHC class I following acute infection.

Figure 6.1 Promoter organization of the MHC class II transactivator 125
(Ciita) gene.

Figure 6.2 MHC class II is not expressed by GFP+ oligodendroglia. 128

Figure 6.3 MHC class II expression in vivo by resident microglia and 130
infiltrating F4/80+ cells in the presence or absence IFNγ
during viral infection.
ix

Figure 6.4 MHC class II transcript levels correspond with class II 132
surface expression in microglia and infiltrating F4/80+ cells.

Figure 6.5 Cell-specific expression of Ciita-isoforms. 134

Figure 6.6 MHC class II and Ciita transcripts are similarly induced in 135
populations purified from infected Balb/c mice.

Figure 6.7 MHC class II expression by J774.1 macrophage cells is 137
upregulated in response to IFNγ.

Figure 6.8 CD11c expression by infiltrating F4/80+ cells is associated 138
with increased MHC class II expression, but CD11c is not
exclusively expressed by this population.

Figure 7.1 A model of the interferon responses by glia during the acute 157
phase of JHMV infection.

Figure 7.2 Effects of immunodeficiency on viral infection. 159

Figure 7.3 The decline of IFNαβ expression coincides with up- 161
regulation of IFNγ expression.

Figure 7.4 Overview of IFN kinetics in relation to infection of 164
oligodendroglia and control of infectious virus.

Figure 8.1 GFP+ cells identify mature oligodendroglia in PLP- 175
GFP/B6 mice by flow cytometry.

Figure 8.2 Effect of viral infection on Gapdh expression. 183

x
Abstract

The data presented in this thesis is incorporated into the model of
early events of coronavirus infection and focuses on the innate responses by
glia and their potential interactions with the mounting adaptive immune
response. By utilizing transgenic mice to purify distinct populations of glia at
different times during coronavirus infection of the central nervous system, the
unique cell-specific responses can be evaluated in vivo to provide a fuller
picture of the events leading to persistent viral infection. These new findings
emphasize the protective role of microglia in providing early IFNαβ
expression and the indirect modulation of this response by T cell activity.
Microglia express a broad repertoire of pathogen associated pattern
receptors (i.e. TLRs and RIG-I family helicases) and thereby trigger IFNαβ
expression in direct response to viral infection. IFNαβ expression declines in
correlation with effective clearance of virus from microglia by T cell activity.
Oligodendroglia upregulated their expression of cytosolic receptors for viral
RNA products, RIG-I and Mda5, during infection. However oligodendroglia
were incapable of recognizing coronavirus infection and did not induce IFNαβ
expression. Reliance on exogenous IFNαβ by mature oligodendroglia
appears to be a prevailing factor driving the preferential infection of
oligodendroglia during the acute phase of infection. IFNγ can only partially
compensate for the loss of IFNβ mediated anti-viral protection for infected
oligodendroglia. Rather IFNγ functions primarily in regulating MHC
xi
expression in a cell-specific manner thereby facilitating necessary T cell
interactions that are also required for control of viral infection. A combination
of factors support the persistent infection of oligodendroglia including their
lack of autocrine IFNαβ activity as well as their limited response to
exogenous IFNαβ, and their coordinated expression of the inhibitory ligand
PD-L1 with MHC class I in response to IFNγ. The contribution of these
findings to the current model of coronavirus infection in the central nervous
system identifies previously unknown roles for glia and underscores the
requirement for an intact innate immune response by resident cells in finally
attaining a successful adaptive immune response.

1
Chapter 1: Viral infections in the central nervous system: unknowns
and potential links.

Introduction
The impetus for the experiments presented in this thesis stems from
the identification of the myriad of viral infections in the central nervous
system (CNS), the limitations faced by the immune response in dealing with
such infections and the potentially pathological consequences of when these
interactions between virus, the immune system and the CNS goes awry.
The biology of the CNS poses unique constraints for mounting an
immune response to control infection. As a key organ system governing the
function of the whole organism the brain must be protected against infection.
The architecture of the blood brain barrier prevents circulation of agents,
including toxins and pathogens from the periphery from entering the CNS.
However this also limits access of the CNS to leukocytes and antibodies that
are important aspects of adaptive immunity. In general the CNS is an
immune dampening microenvironment characterized by minimal expression
of major histocompatibility complex (MHC) required for T cell recognition
(Dorries 2001; Fuss et al. 2001; Hickey 2001). Also cells of the CNS are slow
to regenerate from damage caused by infection or overly aggressive immune
activity. Furthermore, exposure of self-epitopes during inflammatory
conditions or molecular mimicry by pathogens could potentially trigger auto-
2
reactive T cell responses. All of these constraints require a balance between
protection against infection and potentially damaging immune activity.
Still a variety of pathogens can invade the CNS, including viruses. A
number of human herpesviruses can cause chronic or latent infections
particularly in neurons including human HSV-1, -2, -6 and -8, and varicella
zoster virus (Steiner et al. 2007). Additionally measles virus can lead to rare
post-infection encephalitis complications (Rima and Duprex 2005). West Nile
virus is a neurotropic flavivirus transmitted by mesquito that has become
endemic in the western hemisphere within the last ten years (Klein and
Diamond 2008). It can lead to acute neurological disease in a small
percentage (<1%) of those infected (Sejvar et al. 2003).
Interestingly, evidence for several types of viral infections, in the CNS
of humans with no obvious symptoms have been documented, including JC
virus, herpes viruses, and coronavirus (Arbour et al. 2000; Caldarelli-Stefano
et al. 1999; Dessau et al. 2001; Furuta et al. 1997; White et al. 1992). Often
associated with stress of some variety, HSV-1 reactivation can occur often
over the course of a healthy individual’s lifetime but remains limited in the
region of a single dorsal root ganglion (Steiner et al. 2007). But under
conditions of immune suppression or dysregulation some viruses can cause
serious and potentially fatal damage to the CNS. Approximately 80% of
Americans are seropositive for JC virus, but in immunosuppressed
individuals this virus can lead to fatal, although rare, progressive multifocal
3
leukoencephalitis (PML) (Caldarelli-Stefano et al. 1999). Subacute sclerosing
panencephalitis (SSPE) is also a rare complication from persistent measles
infection occurring on average 8 years following the initial exposure resulting
in infection of neurons as well as oligodendroglia, astrocytes and endothelia
(Rima and Duprex 2005). In contrast, SSPE is associated with
hyperimmunity characterized by robust antibody responses (Smith-Jensen et
al. 2000). These findings hint at latent or persistent viral infections being
common within the population but a coincidence of factors, especially
dysregulation of the immune response, must occur for infections to manifest
as serious or unresolved illnesses, particularly within the CNS. Conversely
this also suggests the CNS may tolerate some chronic or latent infections in
an effort to minimize potentially harmful immune responses.

Parallels with Multiple Sclerosis.
The human demyelinating disease, multiple sclerosis (MS), has no
known cause although several groups have attempted to link a variety of viral
infections to this disease. Currently MS is generally considered an
autoimmune disease (McFarland and Martin 2007), although this is still open
to debate (Lipton et al. 2007). Risk factors associated with MS support a
multi-factorial constellation of influences. Environmental factors, genetic
predisposition and gender bias are all indicated in this disease (Kurtzke
2000; Schwendimann and Alekseeva 2007; Sospedra and Martin 2005).
Pathologically, MS is characterized by lesions in the CNS where neuronal
4
axons have lost their myelin sheaths (Dutta and Trapp 2007; Miller and Leary
2007). The myelin sheaths are compact layers of lipid envelope and proteins
required for insulating the electrical impulses carried along the axon.
Oligodendroglia are the specialized cells within the CNS that produce and
maintain these myelin sheaths. One oligodendroglia cell generally myelinates
as many as forty neuronal axons. Although myelogenesis occurs early during
neonatal development, myelin must be maintained for the life of a healthy
individual.
In most cases the demyelinated lesions in MS are also associated
with infiltrating leukocytes, particularly activated microglia/macrophages.
Microglia are the resident macrophage-like cell within the CNS that
constantly survey their microenvironment. They can be activated to
phagocytose debris and present antigen in the context of MHC class I and
class II to CD8 or CD4 T cells, respectively. Current treatments of MS involve
limiting immune responses by preventing leukocyte infiltration into the CNS
(Buttmann and Rieckmann 2008) as well as treatment with IFNβ (Bermel and
Rudick 2007). Although IFNβ is often used as an anti-viral treatment, the
mechanism of IFNβ in this setting is not entirely clear. IFNβ treatment is
associated with preventing blood-brain barrier leakage and increasing
expression of ligands on antigen presenting cells that downregulate T cell
activity (Bagnato et al. 2007; Wiesemann et al. 2008).
Besides the many confounding factors associated with MS, several
experimental models suggest a plethora of circumstances could lead to
5
demyelination. Perhaps there is no one cause to MS however a recurring
theme in many models involves the regulation of endogenous inflammatory
responses in the CNS. Experimental autoimmune encephalomyelitis (EAE)
generally involves the immunization of mice with myelin-derived peptides in
conjunction with adjuvant triggering auto-reactive T cell activity against the
CNS. Although this model does not involve pathogens directly it upholds the
role of aberrant adaptive immune responses and leads to questions
regarding why the CNS is susceptible to this type of autoimmunity. Variations
on the EAE model suggest inflammation originating in the CNS can elicit
transient demyelination by previously sensitized T cells (exposed to MOG in
incomplete Freund’s adjuvant) that would otherwise not cause disease
(Merkler et al. 2006).
Alternatively some models of demyelination are induced by viral
infection. Theiler’s murine encephalomyelitis virus (TMEV) infects
oligodendroglia and leads to epitope spreading indicating direct interactions
between different glia and T cells are critical. Recently development of
another model points to the role of viral infection as merely a trigger for
providing inflammatory conditions for an immune response in the CNS.
Infection with an avirulent strain of Semiliki forest virus (SFV) in the CNS of
mice is self-limiting with no apparent symptoms. Transfer of β-crystallin auto-
reactive T cells to healthy mice doesn’t cause any disease. However when
avirulent SFV infection precedes transfer of auto-reactive cells by one week,
symptoms similar to EAE appear (Verbeek et al. 2007).
6
MHV: A coronavirus model of demyelination.
To address basic questions regarding the nature of immune
responses occurring during a localized viral infection of the CNS, strains of
murine hepatitis virus (MHV) can be employed. This family of coronaviruses
can also lead to persistent viral infection in the CNS and demyelination in its
natural murine host.

Coronaviruses represent a ubiquitous family of viruses with unique biology.
Coronaviruses belong to the order Nidovirales. These are positive
sense, single stranded RNA viruses and include the largest unsegmented
genomes (~32Kb in length). ‘Nido’ is Latin for nested and describes the
shared feature of these viruses: transcription of nested RNA molecules to
express viral gene products. The RNA produced by these viruses resemble
eukaryotic mRNAs in that they have 3’-prime poly-A tails and 5’-prime caps
(Lai and Cavanagh 1997; Masters 2006). Structurally, virions are composed
of a lipid enveloped, nucleocapsid coated genome and unlike many other
viruses do not package a polymerase (Masters 2006). Virions assemble
within the intermediate compartments of the Golgi-endoplasmic reticulum
(Masters 2006), such that their lipid envelope is derived from intracellular
membranes. Once virions are fully assembled they are exocytosed as
opposed to budding off from the surface of the host cell (Masters 2006).
The most infamous human coronavirus is severe acute respiratory
syndrome (SARS-Cov) that was first identified following an outbreak in 2002.
7
Prior to that outbreak only two human coronaviruses were identified, causing
approximately 30% of common colds. Since that outbreak further
examination has identified two additional human coronaviruses that also
cause respiratory infections, particularly in children (Kahn 2006). Currently
there are four strains of human coronaviruses identified as circulating in the
worldwide population, suggesting all adults have encountered at least one
strain at some point in life. Coronaviruses are ubiquitous within the human
population, as well as most other mammalian species investigated. Given the
integral nature of coronaviruses within our environment investigation into
their biology and host interactions is warranted.
The John Howard Mueller virus (JHMV), a strain of MHV, was first
isolated as a naturally occurring virus in the mouse colony housed at Harvard
University (Cheever et al. 1949). Infection of the mouse CNS by JHMV
(variant 2.2-1) directly by intracranial (i.c.) injection is characterized by
increasing degrees of hind-limb paralysis beginning approximately one week
post infection (Fleming et al. 1986). Originally the direct infection of
oligodendroglia by several MHV strains was believed to cause their cell
death leading to the loss or destruction of myelin. While MHV-A59 and JHMV
have a propensity to infect oligodendroglia, cell death of oligodendroglia is
not a prominent feature of infection in vivo (Gonzalez et al. 2006) although it
may be difficult to detect. Similarly, persistent infection of primary glia cell
cultures supports productive infection without overt cytopathic effects (Lavi et
al. 1987).
8
Although the direct infection of oligodendroglia does not appear to
induce demyelination itself as indicated by robust infection of resident cells in
SCID mice that do not develop demyelination (Houtman and Fleming 1996),
the function of oligodendroglia is clearly impaired on some level in wild type
mice. Extensive analysis of myelin gene expression during MHV infection of
wild type mice demonstrated a decline in myelin related transcript levels
concurrent with viral spread and subsequent demyelination (Jordan et al.
1989; Kristensson et al. 1986). Furthermore it is not until viral infection is
restricted to limited foci within the CNS (~3 weeks post infection) that myelin
gene expression robustly increases prior to remyelination (Jordan et al. 1989;
Kristensson et al. 1986). It is possible additional stresses caused by an
intense immune response in the CNS may impair the ability of
oligodendroglia to maintain myelin integrity and especially repair myelin once
its been damaged. Other lines of investigation into oligodendroglia biology
suggest they are particularly sensitive to ER stress (Lin et al. 2007).
Microglia and astrocytes are also targets of MHV infection (Knobler et
al. 1981; Wang et al. 1992). Microglia as well as macrophages have been
implicated in phagocytosing myelin, potentially contributing to increased
pathology (Fleury et al. 1980; Muzio et al. 2007; Templeton et al. 2008).
Neuronal infection is less common with attenuated MHV strains (such as
JHMV), but a characteristic of more virulent strains.
Later experiments in mice that had undergone irradiation to ablate
their bone marrow, subsequently impairing adaptive immune responses or
9
infection in severe combined immunodeficient mice (SCID) that lack both T
and B cells demonstrated a requirement for the adaptive immune response in
the progression of viral infection to demyelination (Houtman and Fleming
1996; Wang et al. 1990). Adoptive transfer of T cells (CD8 and/or CD4) into
infected SCID or RAG-/- mice is sufficient to drive demyelination (Bergmann
et al. 2004; Stohlman et al. 2008; Wu et al. 2000). However the adaptive
immune response is required to control viral infection and preserve the life of
the animal (Houtman and Fleming 1996). This seemingly paradoxical
relationship has lead to extensive evaluation of the mechanisms of leukocyte
recruitment to the CNS, the specific effects of T cell activity and the role of
the humoral responses in maintaining anti-viral immunity (Bergmann et al.
2006).

The role of resident CNS cells during viral infection.
What is almost entirely unknown however is the responses by the glia
themselves during infections even in general. In this virus model glia are
both the target of viral infection as well as intimately associated with the
pathological consequences of the ensuing immune response. Recent
advances in understanding pathways leading to innate immune responses
suggests all cells are capable of responding to pathogens on a basic level,
including glia. “Danger” signals can be supplied by molecular motifs common
to groups of pathogens such as LPS or dsRNA, as well as endogenous
ligands exposed from resulting tissue damage. Identification of the receptors
10
(e.g. Toll-like receptors) for recognition of “danger” signals and their
downstream signaling pathways has opened the door towards understanding
early immune events. And this understanding can be applied specifically to
investigate the innate immune responses by resident CNS cells.
These “danger” signal pathways trigger classical anti-viral interferon
responses. In addition to direct anti-viral activity by blocking infection or
replication of viruses within a cell, interferons help coordinate interactions
between infected cells or neighboring cells and the incoming adaptive
immune response. Interferons can stimulate the expression of a wide variety
of genes including those involved in MHC pathways. Because there is little
expression of MHC in the healthy CNS, these pathways must be upregulated
in resident CNS cells for T cells to recognize antigens and target cells. The
pathways for peptide presentation employ a host of proteases, transporters
and chaperones to generate peptides from viral proteins and stably present
them on the cell surface. The capacity of specialized cells such as
oligodendroglia to perform these immune related functions is also considered
in depth during this viral infection.
At first glance the aims in this thesis may appear far removed from the
ultimate quest to uncover the pathological mechanisms driving
demyelination. However new theories regarding the regulation of immunity
on a global level are suggesting the innate immune response is critical for
tipping adaptive immune responses towards pathological or successful
outcomes in general and in the CNS (Axtell and Steinman 2008; Hoebe et al.
11
2004). Consequently in order to understand the end disease processes we
must first grasp the early initiating events. However the capacity of glia to
initiate and contribute to immunity through innate responses to infection in
the CNS remains largely unknown. As such the experiments presented here
begin at the beginning of viral infection of glia (chapter 2) to address basic
questions regarding the timing and magnitude of viral infection of these
specialized cells in the CNS and provide context for the evaluation of
subsequent responses. Next I proceed to ask whether or not glia can
recognize this viral infection by responding viral RNA products to induce anti-
viral interferons (chapter 3). The ability of infected and neighboring glial cells
to respond to interferons to block viral infection or replication (chapter 3) and
induce the expression of MHC pathways for peptide presentation to T cells
(chapters 4, 5 and 6) is examined in specific glial subtypes.
All together these experiments address the initiation of inflammatory
cascades by the glia themselves in response to local CNS infection and the
potential interactions specific glia may have with the T-cell arm of the
adaptive immune response. The following data provides additional
framework to a viral model of demyelination by addressing basic questions
that have previously gone unanswered regarding the biology of glial
responses to infection in vivo, driving initial innate responses upon which the
emerging adaptive immune response is founded.
12

Chapter 1 References

Arbour N, Day R, Newcombe J, Talbot PJ. 2000. Neuroinvasion by human
respiratory coronaviruses. J Virol 74(19):8913-21.
Axtell RC, Steinman L. 2008. Type 1 interferons cool the inflamed brain.
Immunity 28(5):600-2.
Bagnato F, Evangelou IE, Gallo A, Gaindh D, Yao K. 2007. The effect of
interferon-beta on black holes in patients with multiple sclerosis.
Expert Opin Biol Ther 7(7):1079-91.
Bergmann CC, Lane TE, Stohlman SA. 2006. Coronavirus infection of the
central nervous system: host-virus stand-off. Nat Rev Microbiol
4(2):121-32.
Bergmann CC, Parra B, Hinton DR, Ramakrishna C, Dowdell KC, Stohlman
SA. 2004. Perforin and gamma interferon-mediated control of
coronavirus central nervous system infection by CD8 T cells in the
absence of CD4 T cells. J Virol 78(4):1739-50.
Bermel RA, Rudick RA. 2007. Interferon-beta treatment for multiple sclerosis.
Neurotherapeutics 4(4):633-46.
Buttmann M, Rieckmann P. 2008. Treating multiple sclerosis with
monoclonal antibodies. Expert Rev Neurother 8(3):433-55.
Caldarelli-Stefano R, Vago L, Omodeo-Zorini E, Mediati M, Losciale L,
Nebuloni M, Costanzi G, Ferrante P. 1999. Detection and typing of JC
virus in autopsy brains and extraneural organs of AIDS patients and
non-immunocompromised individuals. J Neurovirol 5(2):125-33.
Cheever FS, Daniels JB, et al. 1949. A murine virus (JHM) causing
disseminated encephalomyelitis with extensive destruction of myelin. J
Exp Med 90(3):181-210.
Dessau RB, Lisby G, Frederiksen JL. 2001. Coronaviruses in brain tissue
from patients with multiple sclerosis. Acta Neuropathol 101(6):601-4.
Dorries R. 2001. The role of T-cell-mediated mechanisms in virus infections
of the nervous system. Curr Top Microbiol Immunol 253:219-45.
13
Dutta R, Trapp BD. 2007. Pathogenesis of axonal and neuronal damage in
multiple sclerosis. Neurology 68(22 Suppl 3):S22-31; discussion S43-
54.
Fleming JO, Trousdale MD, el-Zaatari FA, Stohlman SA, Weiner LP. 1986.
Pathogenicity of antigenic variants of murine coronavirus JHM
selected with monoclonal antibodies. J Virol 58(3):869-75.
Fleury HJ, Sheppard RD, Bornstein MB, Raine CS. 1980. Further
ultrastructural observations of virus morphogenesis and myelin
pathology in JHM virus encephalomyelitis. Neuropathol Appl Neurobiol
6(3):165-79.
Furuta Y, Takasu T, Suzuki S, Fukuda S, Inuyama Y, Nagashima K. 1997.
Detection of latent varicella-zoster virus infection in human vestibular
and spiral ganglia. J Med Virol 51(3):214-6.
Fuss B, Afshari FS, Colello RJ, Macklin WB. 2001. Normal CNS myelination
in transgenic mice overexpressing MHC class I H-2L(d) in
oligodendrocytes. Mol Cell Neurosci 18(2):221-34.
Gonzalez JM, Bergmann CC, Ramakrishna C, Hinton DR, Atkinson R,
Hoskin J, Macklin WB, Stohlman SA. 2006. Inhibition of interferon-
gamma signaling in oligodendroglia delays coronavirus clearance
without altering demyelination. Am J Pathol 168(3):796-804.
Hickey WF. 2001. Basic principles of immunological surveillance of the
normal central nervous system. Glia 36(2):118-24.
Hoebe K, Janssen E, Beutler B. 2004. The interface between innate and
adaptive immunity. Nat Immunol 5(10):971-4.
Houtman JJ, Fleming JO. 1996. Dissociation of demyelination and viral
clearance in congenitally immunodeficient mice infected with murine
coronavirus JHM. J Neurovirol 2(2):101-10.
Jordan CA, Friedrich VL, Jr., Godfraind C, Cardellechio CB, Holmes KV,
Dubois-Dalcq M. 1989. Expression of viral and myelin gene transcripts
in a murine CNS demyelinating disease caused by a coronavirus. Glia
2(5):318-29.
Kahn JS. 2006. The widening scope of coronaviruses. Curr Opin Pediatr
18(1):42-7.
14
Klein RS, Diamond MS. 2008. Immunological headgear: antiviral immune
responses protect against neuroinvasive West Nile virus. Trends Mol
Med.
Knobler RL, Dubois-Dalcq M, Haspel MV, Claysmith AP, Lampert PW,
Oldstone MB. 1981. Selective localization of wild type and mutant
mouse hepatitis virus (JHM strain) antigens in CNS tissue by
fluorescence, light and electron microscopy. J Neuroimmunol 1(1):81-
92.
Kristensson K, Holmes KV, Duchala CS, Zeller NK, Lazzarini RA, Dubois-
Dalcq M. 1986. Increased levels of myelin basic protein transcripts in
virus-induced demyelination. Nature 322(6079):544-7.
Kurtzke JF. 2000. Epidemiology of multiple sclerosis. Does this really point
toward an etiology? Lectio Doctoralis. Neurol Sci 21(6):383-403.
Lai MM, Cavanagh D. 1997. The molecular biology of coronaviruses. Adv
Virus Res 48:1-100.
Lavi E, Suzumura A, Hirayama M, Highkin MK, Dambach DM, Silberberg
DH, Weiss SR. 1987. Coronavirus mouse hepatitis virus (MHV)-A59
causes a persistent, productive infection in primary glial cell cultures.
Microb Pathog 3(2):79-86.
Lin W, Bailey SL, Ho H, Harding HP, Ron D, Miller SD, Popko B. 2007. The
integrated stress response prevents demyelination by protecting
oligodendrocytes against immune-mediated damage. J Clin Invest
117(2):448-56.
Lipton HL, Liang Z, Hertzler S, Son KN. 2007. A specific viral cause of
multiple sclerosis: one virus, one disease. Ann Neurol 61(6):514-23.
Masters PS. 2006. The molecular biology of coronaviruses. Adv Virus Res
66:193-292.
McFarland HF, Martin R. 2007. Multiple sclerosis: a complicated picture of
autoimmunity. Nat Immunol 8(9):913-9.
Merkler D, Ernsting T, Kerschensteiner M, Bruck W, Stadelmann C. 2006. A
new focal EAE model of cortical demyelination: multiple sclerosis-like
lesions with rapid resolution of inflammation and extensive
remyelination. Brain 129(Pt 8):1972-83.
Miller DH, Leary SM. 2007. Primary-progressive multiple sclerosis. Lancet
Neurol 6(10):903-12.
15
Muzio L, Martino G, Furlan R. 2007. Multifaceted aspects of inflammation in
multiple sclerosis: the role of microglia. J Neuroimmunol 191(1-2):39-
44.
Rima BK, Duprex WP. 2005. Molecular mechanisms of measles virus
persistence. Virus Res 111(2):132-47.
Schwendimann RN, Alekseeva N. 2007. Gender issues in multiple sclerosis.
Int Rev Neurobiol 79:377-92.
Sejvar JJ, Haddad MB, Tierney BC, Campbell GL, Marfin AA, Van Gerpen
JA, Fleischauer A, Leis AA, Stokic DS, Petersen LR. 2003. Neurologic
manifestations and outcome of West Nile virus infection. Jama
290(4):511-5.
Smith-Jensen T, Burgoon MP, Anthony J, Kraus H, Gilden DH, Owens GP.
2000. Comparison of immunoglobulin G heavy-chain sequences in
MS and SSPE brains reveals an antigen-driven response. Neurology
54(6):1227-32.
Sospedra M, Martin R. 2005. Immunology of multiple sclerosis. Annu Rev
Immunol 23:683-747.
Steiner I, Kennedy PG, Pachner AR. 2007. The neurotropic herpes viruses:
herpes simplex and varicella-zoster. Lancet Neurol 6(11):1015-28.
Stohlman SA, Hinton DR, Parra B, Atkinson R, Bergmann CC. 2008. CD4 T
cells contribute to virus control and pathology following central
nervous system infection with neurotropic mouse hepatitis virus. J
Virol 82(5):2130-9.
Templeton SP, Kim TS, O'Malley K, Perlman S. 2008. Maturation and
localization of macrophages and microglia during infection with a
neurotropic murine coronavirus. Brain Pathol 18(1):40-51.
Verbeek R, van Dongen H, Wawrousek EF, Amor S, van Noort JM. 2007.
Induction of EAE by T cells specific for alpha B-crystallin depends on
prior viral infection in the CNS. Int Immunol 19(3):277-85.
Wang FI, Hinton DR, Gilmore W, Trousdale MD, Fleming JO. 1992.
Sequential infection of glial cells by the murine hepatitis virus JHM
strain (MHV-4) leads to a characteristic distribution of demyelination.
Lab Invest 66(6):744-54.
16
Wang FI, Stohlman SA, Fleming JO. 1990. Demyelination induced by murine
hepatitis virus JHM strain (MHV-4) is immunologically mediated. J
Neuroimmunol 30(1):31-41.
White FA, 3rd, Ishaq M, Stoner GL, Frisque RJ. 1992. JC virus DNA is
present in many human brain samples from patients without
progressive multifocal leukoencephalopathy. J Virol 66(10):5726-34
Wiesemann E, Deb M, Trebst C, Hemmer B, Stangel M, Windhagen A. 2008.
Effects of interferon-{beta} on co-signaling molecules: upregulation of
CD40, CD86 and PD-L2 on monocytes in relation to clinical response
to interferon-{beta} treatment in patients with multiple sclerosis. Mult
Scler 14(2):166-76.
Wu GF, Dandekar AA, Pewe L, Perlman S. 2000. CD4 and CD8 T cells have
redundant but not identical roles in virus-induced demyelination. J
Immunol 165(4):2278-86.

17
Chapter 2: Viral spread in the CNS and the establishment of persistent
infection in oligodendroglia

Chapter 2 Abstract
Infection by gliatropic JHMV results in abundant virus replication with
eventual control of spread culminating in persistent detection of viral antigen
and vRNA in the CNS. Using FACS purified populations of glia, vRNA levels
were monitored by real-time PCR over the course of infection. Mature
oligodendroglia were preferentially susceptible to JHMV infection compared
to other glia, including microglia and infiltrating F4/80+ cells. Oligodendroglia
exhibited the highest viral burdens by day 7 p.i. in both the brain and spinal
cord and genomic-length vRNA remained detectable months after infectious
virus was cleared, confirming oligodendroglia are the source of chronic viral
infection. Lastly, attempts to characterize viral gene expression in vivo
associated reduced membrane (M) encoding subgenomic vRNA expression
relative to genomic-length vRNA with the decline in virus titers, both globally
within the whole brain and specifically in oligodendroglia. This suggests viral
replication is limited by restricting the expression of M, which is required for
virion assembly.
18
Introduction
JHMV is a murine coronavirus of which there are multiple strains
derived from a variety of attenuation schemes. Different strains exhibit
varying plaque size phenotypes as well differences in tropism and ability to
induce demyelination and mortality. The variant 2.2-1 was used in the
following experiments and was previously isolated following antibody
selection against the spike (S) protein (Fleming et al. 1986). This variant is
gliatropic when introduced directly into the CNS. It causes limited mortality,
however mice exhibit signs of paralysis characteristic of demyelination by
day 10 p.i. from which they never fully recover (Wang et al. 1992). A common
feature of this strain and many other MHV variants is the continued presence
of viral RNA (vRNA) in the murine central nervous system following acute
infection for the duration of life (Fleming et al. 1993).
JHMV carries a single stranded, positive-sense RNA genome
approximately 31.5Kb in length. It is 90% percent homologous to the
archetypal MHV-A59 strain that also replicates in glia and causes
demyelination (Jordan et al. 1989), with some differences in the spike gene
(Bos et al. 1995). Figure 2.1 depicts the open reading frames (ORFs)
encoded in the viral genome. The basic organization of the genome has the
structural proteins on the far 3’ end. Non-structural proteins and S follow the
large gene encoding all the transcription machinery (ORF1a/b). The 5’ end
contains an ~ 80bp leader sequence. Each major ORF is preceded by a
seven base sequence repeat that serves as a transcription regulatory
19
Figure 2.1. The JHMV Genome. The dark bar at the 5’end represents
the leader sequence. The first two thirds of the genome encode the
large ORF1a/b polyprotein, that contains the polymerase and several
accessory proteins required for transcription. The remaining ~10Kb
encode non-structural proteins 2 and 3 (NS2/3) followed by Spike (S).
Then non-structural proteins 4 and 5 (NS4/5). The small envelope
protein (E), is followed by the membrane protein (M). The last gene
encodes the nucleocapsid (N).
ORF1a/b NS2/3 NS4/5 M E S N
sequence (TRS). In order for virus to express these downstream ORFs, it
produces a nested set of subgenomic vRNAs. Subgenomic vRNAs are
produced by a process of discontinuous transcription. They encode the
leader sequence at their 5’-prime end before skipping to a TRS at the
beginning of an ORF and continuing through to the 3’end of the genome
(Sawicki and Sawicki 2005). The first ORF of each subgenomic vRNA is the
gene that is subsequently translated (Brian and Baric 2005).
While nucleocapsid (N) protein is readily detectable, particularly in
oligodendroglia, by immunohistochemistry following JHMV infection,
detection continues to decline though day 30p.i. (Gonzalez et al. 2006; Parra
et al. 1999; Wang et al. 1992). By applying FACS purification of glia to
assess vRNA levels over the course of infection we can achieve an
additional degree of quantification and specificity for tracking viral spread in
vivo.

20
Results
Overwhelming infection of oligodendroglia occurs early during the acute
infection.
Despite the difficulties in assessing specific vRNAs for coronavirus
infections in vivo, probing the 5’ prime end of genomic-length vRNA is
specific only to the genomic-length vRNA species. In addition to providing
specificity, measurement of genomic-length vRNA by real-time PCR also
provides quantification and a high degree of sensitivity, without being
confounded by the potentially different capacities of particular cell types to
support viral replication. By FACS purifying specific populations of glia, viral
spread at the RNA level can be followed during infection in vivo.
The concern that this technique may also measure genomic vRNA
contained in viral particles that have adhered to the cell’s receptor yet not
infected the cell is remote given the methods utilized to isolate and purify the
cells. First, the organs undergo trypsinization to gently dissociate cells.
Unlike homogenizing organs manually, this protocol maintains the integrity of
cells such that more than 75% are alive and limits the release of free virus
particles. Additionally enzymatic digestion degrades surface proteins as well
as viral proteins. Lastly the protocol is carried out in high serum conditions in
order to quench trypsin activity and maintain cells for processing but serum
prevents the adherence of MHV in vitro. So the data presented here primarily
represents intracellular vRNA measured within isolated cells and may be
interpreted as the average viral burden in different cell populations.
21
Purified populations of microglia and mature oligodendroglia were
obtained from the brains and spinals cords of naïve and infected mice at
different times post infection using transgenic mice (PLP-GFP/B6)
expressing green fluorescence protein (GFP) under control of an
oligodendroglia specific promoter for proteolipid protein, PLP, to identify fully
differentiated oligodendroglia (Fuss et al. 2000) in conjunction with CD45
surface staining. Following RNA purification from isolated cells and reverse
transcription, the levels of genomic-length vRNA were assessed relative to
Gapdh levels by real-time PCR. No PCR products for viral sequences from
uninfected samples were ever detected. During acute infection genomic
length vRNA was detected in all populations analyzed at levels of 0.02 and
above relative to Gapdh (Fig. 2.2 & 2.3). At day 3 p.i. both oligodendroglia
and microglia in the brain exhibited similar levels of genomic-length vRNA,
with continued spread in both populations by day 5 p.i. (Fig. 2.2A). By days 7
and 10 p.i. oligodendroglia exhibited at least 1000-fold higher levels of
genomic-length vRNA relative to the very low levels still detected in microglia
(Fig. 2.2A). Viral spread into the spinal cord was slightly delayed relative to
the brain, however by days 7 and 10 p.i. a similar divergence in viral burden
between oligodendroglia and microglia was observed.
Although PLP-GFP/B6 mice exhibit similar clinical symptoms as wild
type mice, viral spread in resident glia isolated from wild type B6 mice was
also assessed to ensure there were no alterations in viral spread or tropism
due to transgene expression. O4+ glia include mature oligodendroglia
22
Figure 2.2. Viral spread in resident glia during acute infection of JHMV.
(A) Genomic-length vRNA levels were assessed in FACS purified CD45
lo

microglia and CD45
-
, GFP
+
oligodendroglia from the brains and spinal cords
of PLP-GFP/B6 mice during acute infection. Lines represent the average
value and floating boxes represent the spread of values from two (days 3 &
5) or three (days 7 & 10) independent experiments for each population. (n=6-
8 mice pooled per timepoint) (B) Similar experiments were conducted in wild
type B6 mice as above. Mononuclear cells from the brains and spinal cords
of B6 mice during acute infection were stained with CD45-PerCP and O4
with secondary anti-IgM-PE for FACS purification into the following groups of
cells: O4+CD45-, CD45-O4- and CD45
lo
. The dot plot depicts cells from the
spinal cords of mice infected at day 5 p.i. (top left panel) providing an
example of how these populations were identified by flow cytometry. The
legend indicates the color coding for each population corresponding to both
the dot plot and bar graphs below. The bar graphs indicate the spread of
genomic-length vRNA values measured in each population of glia for two
independent experiments (n=6 mice pooled per timepoint). vRNA was
detectable in all populations analyzed for A & B at levels of 0.02 or greater
relative to Gapdh.

23
A

PLP-GFP/B6
Microglia
Oligodendroglia
Figure 2.2
O4 (+anti-IgM-PE)
CD45-PercP
Spinal Cord (d5pi)
B
Wild type (B6)
24
that would be reported by PLP-GFP transgene expression, as well as
oligodendroglia precursor cells (Fuss et al. 2000). In naïve mice O4+ cells
are composed of ~70% GFP+ cells in the CNS (Fig. 8.1). CD45
lo
microglia
were also compared, as well as the remaining resident CNS cells (CD45
-
,
O4
-
) representing an astrocyte enriched population of which ~60% are
GFAP+ (Zhou et al. 2005).
Evaluation of genomic-length vRNA in fractionated populations from
B6 mice revealed similar patterns of viral spread as compared to PLP-
GFP/B6 mice. All glia appeared susceptible to initial viral infection, however
by day 5 p.i. O4+ glia exhibited higher viral burdens than microglia or CD45-
O4- populations from both the brain and the spinal cord (Fig. 2.2B). Viral
burden in both microglia and the remaining glia declined to very low levels by
day 7 p.i. (Fig. 2.2B). This coincided with the infiltration of T cells, supporting
previous work that viral infection of microglia and astrocytes can be
controlled by CD8 T cell functions (Bergmann et al. 2006). Although O4+ glia
exhibited higher viral burden at days 5 and 7 p.i. than other populations
evaluated, there also appeared to be an overall decline in genomic-length
vRNA levels by day 7 p.i. (Fig. 2.2B). This indicates a contribution of T cell
effector functions in controlling viral infection in the broader population of
O4+ glia, but not in the mature oligodendroglia (Fig. 2.2A).

25
Infection of infiltrating leukocytes.
The potential for infiltrating leukocytes to be targets of JHMV infection
was also considered in B6 wild type mice. Macrophages as well as T cells
and B cells express the receptor for MHV (Ramakrishna et al. 2004; Singer
et al. 2002). Infiltrating F4/80+ cells are difficult to distinguish from resident
microglia by immunohistological means. However they can be discerned by
flow cytometry, based on higher levels of the haematopoietic lineage marker,
CD45, than resident microglia (Ford et al. 1995). Mononuclear cells were
stained for F4/80 and CD3 in addition to CD45. Infiltrating CD45
hi
, F4/80+
cells were purified from the brains of infected B6 mice for analysis of
genomic-length vRNA levels in comparison to CD45lo microglia as well as
CD45
hi
, CD3
+
T cells populations.
Genomic-length vRNA was detected in all populations evaluated at
levels of 0.08 or greater relative to
Gapdh. Infiltrating F4/80+ cells

Figure 2.3. Genomic-length vRNA
associated with leukocytes
infiltrating the brain. B6 mice were
perfused and brains excised for
mononuclear cell preparation (n=6
mice combined per timepoint). FACS
purified populations of CD45lo
microglia; CD45hi, F4/80+ infiltrating
monocytic cells and CD45hi, CD3+ T
cells were evaluated for genomic-
length vRNA levels. Bars indicate the
spread of values for two independent
experiments, otherwise lines denote
a single data point.
26
appear to exhibit a similar viral load as resident microglia, indicating they
may also be infected by JHMV. However there appears to be more variability
in their viral burden as they infiltrate the CNS (Fig. 2.3). This may reflect the
kinetics of their infiltration and subsequent exposure to virus, as opposed to
the direct, immediate exposure of microglia to viral spread. It is also possible
they are phagocytosing infected cells and virions (Wang et al. 1992).
Interestingly CD3+ T cells may also experience some degree of infection,
although far lower than other cell types evaluated (Fig. 2.3).

Mature oligodendroglia are the primary reservoir for persistent viral infection
in both the brain and spinal cord.
Mature oligodendroglia are particularly susceptible to JHMV infection
even during the acute spread (Fig. 2.2). Continued evaluation of GFP+
oligodendroglia months after infectious virus is no longer detectable indicated
a continued and steady burden of genomic-length vRNA specifically in
mature oligodendroglia (Fig. 2.4). At day 21 p.i., vRNA levels were still
broadly reflective of the receding acute infection (Fig. 2.4). From day 30 to
day 60 or 70p.i., vRNA levels in oligodendroglia recovered from the brain
steadily remained at least 1000 times higher than that detected in
corresponding microglia populations (Fig. 2.4). Similarly the viral burden in
oligodendroglia from the spinal cord remained high until declining at day 60
or 70 p.i. (Fig. 2.4).
27
Figure 2.4. Genomic-length vRNA
remains at high levels in mature
oligodendroglia from the brain and
spinal cord during the persistent
phase of infection. GFP
+

oligodendroglia and CD45
lo
microglia
were FACS purified from the brains
and spinal cords of PLP-GFP/B6 mice
at the indicated times post infection
(n=6 mice pooled per timepoint). Data
is from one continuous timecourse.
Boxes indicate the spread of values
for independently repeated start/end
points.

Most noticeably the population
of oligodendroglia from the brain
appears to be more infected on
average than oligodendroglia isolated
from the spinal cord. During persistence, genomic-length vRNA levels
remained 2-7 fold higher in the population of oligodendroglia from the brain
as compared to the spinal cord and by day 60 or 70 p.i. this disparity
increased to an average 80-fold difference (Fig. 2.4). This data indicates that
mature oligodendroglia, whether found in the brain or the spinal cord, are a
primary reservoir for JHMV infection.

Monitoring viral gene expression in vitro by real-time PCR
Measurements of genomic-length vRNA levels in purified glia
populations in vivo provided insight to the kinetics and magnitude of viral
spread in the CNS indicating differential susceptibility of glia. Yet this

Microglia
Oligodendroglia
28
approach does not address the ability of different glia cell types to support
viral replication. Given the nature of coronavirus replication it is
experimentally challenging to address expression of viral genes in vivo.
However a PCR method was devised to distinguish between different vRNA
molecules and was first tested in vitro using DBT cells. DBT cells are an
astrocytoma cell line that readily support MHV replication. MHV replicates
several nested-set subgenomic RNAs usually totaling seven distinct RNA
species. The longest subgenomic RNA (~9.6Kb) encodes a non-structural
protein and in some variants a functional hemaglutanin esterase (Sawicki
and Sawicki 2005; Yokomori et al. 1991). The next longest encodes the spike
peplomer (Brian and Baric 2005; Sawicki and Sawicki 2005). The fourth
encodes a protein of unknown function that does not appear crucial for virion
assembly or virulence of JHMV (Ontiveros et al. 2001). The last subgenomic
vRNAs encode the remaining structural proteins: the small envelope protein
(E), the larger membrane protein (M) and the nucleocapsid (N) protein (Brian
and Baric 2005).
Using the real-time PCR strategy outlined in figure 2.5A to differentiate
between subgenomic vRNA species, viral gene expression was followed
during a one-step virus infection of DBT cells by the DM variant of JHMV. As
expected, mock infected cells (those that had undergone a similar degree of
serum-deprivation) did not express any genes bearing sequence similarity to
virus genes, demonstrating the specificity of primers to viral sequences (Fig.
2.5B). At 2 hours post infection (h.p.i.), genomic-length viral RNA (vRNA)
29
levels remained ~100 times higher that other viral genes detected, indicating
the initial establishment of viral infection in these cells (Fig .2.5B). Over the
course of the one-step viral infection all subgenomic vRNA levels increased
exponentially (Fig. 2.5B). By 6 h.p.i. the nucleocapsid encoding subgenomic
vRNA was the most abundant (Fig. 2.5B) indicating viral replication was
underway and corresponds to the time-frame when virion structures can be
initially detected (Choi et al. 2002; Krijnse-Locker et al. 1994; Tooze et al.
1984). By 10 h.p.i., all subgenomic vRNA levels exceeded genomic-length
vRNA (Fig. 2.5C). Furthermore, at 10 h.p.i. the quantification of vRNA genes
by real-time PCR (Fig. 2.5C) reflected the proportional distribution of vRNAs
detected by northern blotting in similar one-step viral infections (Baric and
Yount 2000; Jeong et al. 1996; Taguchi and Siddell 1985). Quantification of
the molar ratios of vRNAs have been measured by incorporation of
radiolabeled nucleotides during the latter period of one-step viral infections.
Regardless of the cell line infected or MHV variant, the molar ratios of N
encoding subgenomic vRNAs range between 10-87 fold higher than
genomic-length vRNAs (Baric and Yount 2000). Quantification by this PCR
approach represents all of the vRNA that has accumulated for a particular
subgenomic or genomic-length vRNA species since the initial infection to the
time of RNA isolation. Consequently by 10 h.p.i. nucleocapsid vRNA levels
were 115 times higher than genomic-length vRNA levels (Fig. 2.5C).
To further consider the specificity of this approach in distinguishing the
relative proportions of vRNA species, given their overlapping sequences,
30
A. Real-time PCR strategy for the discrimination of
subgenomic vRNA species
B. Monitoring viral replication in a one-step virus infection.
Figure 2.5. Evaluation of subgenomic vRNAs in vitro.

0.001
0.1
10
1000
100000
mock 2 4 6 8
genomic N S2 Spike N S4
E M N
hours post infection
Transcripts relative to Gapdh
31
C. Proportion of subgenomic vRNA species at 10 hours post infection.
D. Detection of vRNA species in supernatant
Figure 2.5. (continued)

Figure 2.5. Relative quantification of subgenomic vRNAs in vitro. (A)
Depiction of nested subgenomic vRNAs with common leader/anti-leader
sequences. Distinct vRNAs are amplified with a common leader primer and a
unique reverse primer, allowing for the efficient generation of amplicons
approximately 300 base pairs in length. Each subgenomic species is
interrogated separately. (B & C) DBT cells were infected with JHM-DM at a
multiplicity of infection (MOI) of 0.4 and 0.1, respectively. RNA was collected
at times indicated post infection and reverse transcribed. Subgenomic
vRNAs were quantified using real-time PCR. (D) RNA was isolated from the
supernatant of DBT infected cells, containing ~4x10
5
plaque forming units
(PFU) and analysed as above. Values are depicted relative to genomic-
length vRNA. Data is from one experiment.

0
0.2
0.4
0.6
0.8
1
genome
NS2
Spike
NS4
E
M
N
Transcripts relative to
genomic-length vRNA
388 523
2683
960 626
10715
44934
0
10000
20000
30000
40000
50000
genome
NS2
Spike
NS4
E
M
N
transcripts relative to Gapdh
transcripts relative to Gapdh
32
RNA was isolated from the supernatants of infected DBT cells that provided
the initial viral pool for the in vitro infections. Genomic-length vRNA was
preferentially amplified from the virion-enriched supernatants (Fig. 2.5D).
Residual levels of subgenomic vRNA species were also detected, though the
most abundant N encoding vRNA remained 3 times lower than the genomic-
length vRNA (Fig. 2.5D). This data indicates the above approach may
distinguish subgenomic vRNAs and allow their relative quantification during
more complex in vivo infections.

JHMV replication in the brains of B6 mice.
Using the approach described above the relative levels of subgenomic
vRNA species encoding structural proteins were evaluated during infection in
vivo. RNA was extracted from whole brains of infected B6 mice and genomic-
length vRNA, N, M and S encoding vRNAs were measured. Unlike one-step
viral infection curves in vitro consisting of relatively synchronous viral
replication in a homogenous population of cells with only limited innate
immune responses, in vivo infection is drastically different. Infection in vivo is
ongoing in multiple cell types of varying susceptibility and aggressively
countered by an intact immune response, therefore it should not resemble
the ideal conditions for robust viral replication measured in one-step viral
infections in vitro. This concept is supported by the relatively high proportion
of genomic-length vRNA maintained over the course of infection as
compared to subgenomic vRNAs (Fig. 2.6), suggesting less efficient viral
33
replication on a per genome basis is occurring in vivo, as compared to in vitro
infections and may also reflect abundant virions within the system.
While there remains a degree of variability between individuals a clear
pattern of viral gene expression emerges over the course of infection (Fig.
2.6A). This variability is reduced once subgenomic vRNA levels were
normalized to the respective viral burdens for each individual (Fig. 2.6B). For
example individuals with higher genomic-length vRNA levels also had higher
levels of corresponding subgenomic vRNAs, but the relative ratios of
subgenomic to genomic-length vRNAs were similar between individuals.
Overall N gene expression was most abundant, followed by M and then S
vRNAs (Fig. 2.6). By day 7 p.i. M vRNA levels dropped more than 10-fold
and were detectable in only one of three individuals (Fig. 2.6). This
precipitous decline in M vRNA levels coincides with the decline of infectious
virus particles (Gonzalez et al. 2006; Parra et al. 1999; Wang et al. 1992).
This correlation may be expected as molecular investigations of coronavirus
assembly have identified the M protein as a critical requirement for virion
assembly, coordinating interactions among the other structural proteins (de
Haan et al. 1998).
Additionally the data derived from this approach concurs with the
limited amount of data published for in vivo infection of the CNS by MHV.
During CNS infection with another JHMV variant (ts8, also known as MHV-4)
that also exhibits preferential tropism for oligodendroglia and causes
demyelination, protein expression was quantified by western blot using
34
Figure 2.6 Evaluation of subgenomic vRNAs encoding structural
proteins in vivo. (A) RNA was isolated from whole brains of infected B6
mice at days indicated post infection. Values are calculated relative to
Gapdh. Boxes indicated the spread of values for 3 individuals per time point,
with bars indicating the average. At day 10, M is not detectable (ND) for 2 of
3 individuals. (B) The same data as in A is now plotted relative to respective
genomic-length vRNA levels for each individual.
35
genomic-length vRNA
nucleocapsid (N) vRNA
membrane (M) vRNA
spike (S) vRNA

(2 of 3 ND)
(2 of 3 ND)
A
B
Figure 2.6
36
monoclonal antibodies at day 3 p.i. N protein was most abundantly
expressed followed by lower levels of M protein. S, however, remained below
the level of detection by western immunoblot of the total brain protein even
during the peak of infection (Talbot et al. 1984). Similar proportions of
structural proteins are expressed in vitro (Raamsman et al. 2000).
Supposedly, S protein can be detected by immunohistochemistry even
during chronic infection by JHMV (V2.2-1) in H2
b
xH2
d
mice, however
histology was not shown (Bergmann et al. 1999). Detection of N protein by
immunohistochemistry is however clearly prominent throughout the acute
infection (Gonzalez et al. 2006; Wang et al. 1992). Although detection of
different proteins may be confounded by antibody affinities, this data
suggests that while nucleocapsid expression remains relatively abundant key
structural components such as membrane proteins may decline in
expression as infectious virus is controlled.

JHMV replication in purified glia.
The correlation of M encoding vRNAs levels in vivo with infectious
titers supports the requirements for virion assembly, as without membrane
protein expression virions or virus-like particles (VLPs) cannot be produced
(de Haan et al. 1998). Therefore M vRNA levels were measured in purified
glial populations as a measure of their potential to produce virus particles. N
vRNA levels were also measured to compare to the known expression of
nucleocapsid protein. Although viral spread is significantly different between
37
oligodendroglia and microglia (Fig. 2.2) both cell types appear to exhibit
similar ability to support viral replication on a per infection basis and this is
maintained even as the overall levels of viral infection are declining.
N subgenomic vRNAs remained most abundant and proportionally
similar in both cell types during infection (Fig. 2.7). At day 5 p.i.
oligodendroglia expressed a higher proportion of M vRNAs suggesting they
are capable of producing virions, and potentially even more so than microglia
Figure 2.7 Expression of nucleocapsid and membrane encoding
subgenomic vRNAs in microglia and oligodendroglia. Purified
oligodendroglia and microglia from the brains of infected PLP-GFP/B6 mice
were also assayed for nucleocapsid and membrane encoding vRNA species.
Values are depicted as a ratio of subgenomic to genomic-length vRNA
levels. ND denotes not detected. Data is from a single experiment.

Viral Gene Expression in Glia
days post infection
5 7 14
ratio of subgenomic vRNA relative
to genomic-length vRNA
0.01
0.1
1
10
Nucleocapsid (Microglia)
Nucleocapsid (Olidodendroglia)
Membrane (Microglia)
Membrane (Oligodendroglia)
ND
38
(Fig. 2.7). At day 7 p.i. oligodendroglia are the primary cell type infected and
their proportion of M vRNAs declined 10-fold from day 5 p.i. (Fig. 2.7)
supporting the overall decline in M vRNA expression also seen in the whole
brain at that time (Fig. 2.6). By day 14 p.i. viral burden in microglia is so low
that only N subgenomic vRNAs were detectable, however they remained
proportional to genomic-length vRNA detected in microglia (Fig. 2.6).
Interestingly, at day 14 p.i., expression of M encoding vRNAs appeared to
rebound in oligodendroglia suggesting they may continue to produce virions
following acute infection (Fig. 2.6).
Discussion
Mature oligodendroglia are the site of persistent JHMV infection.
Oligodendroglia are a haven for persistent viral infection in this model
(Fig.2.3). A finding previously indicated by the continued detection of N
protein specifically in oligodendroglia (Gonzalez et al. 2006). Furthermore
infection of B-cell deficient mice initially controls virus following the acute
infection, but by day 45 p.i., infectious virus reemerges even in mice
previously immunized (Ramakrishna et al. 2006). N protein expression is
detected in cells resembling oligodendroglia at this time (Ramakrishna et al.
2006). This indicates virus remains genetically in tact and replication
competent during the persistent phase of JHMV infection of oligodendroglia.
Oligodendroglia susceptibility to infection is evident during the acute phase
as they sustain high levels of genomic-length vRNA while infection in other
39
glia is being effectively controlled by an escalating adaptive immune
response (Fig. 2.2). Similarly preferential infection of oligodendroglia occurs
as early as 2 days p.i. in related JHMV strains (MHV-4) as compared to
infection with fatal encephalogenic strains of MHV (Knobler et al. 1981). This
data also indicates astrocytes are not persistently infected in this model, in
contrast to infection of suckling mice, where 20-40% of vRNA positive cells
are GFAP+ during chronic infection (Perlman and Ries 1987).
Furthermore chronic infection appears to be limited primarily to mature
terminally differentiated oligodendroglia identified by transgenic GFP
expression, and also points to a particular population in the brain serving as
the long-term reservoir (Fig. 2.4). Preferential detection of vRNA in the brain
more so than the spinal cord during later stages of viral persistence is well
established during infection of B6 mice with this V2.2-1 variant of JHMV
(Adami et al. 1995; Fleming et al. 1993; Rowe et al. 1997), in addition to
more abundant expression of N protein in the brain overall as compared to
the spinal cord (Wang et al. 1992). By day 100 p.i. vRNA is readily detectable
in the brains of all mice evaluated but found in only 10% of their spinal cords
(Rowe et al. 1997), and vRNA persists in the brain as late as one year post
infection (Fleming et al. 1993). In addition to vRNA persisting in the brains of
B6 mice infected with V2.2-1 variant of JHMV specifically, this phenomenon
is not unique as vRNA is also detected in the brain following acute infection
with different combinations of viral strains and murine genotypes, including
BALB/c mice and MHV-A59 or the small plaque variant of JHMV, DS
40
(Bergmann et al. 1998; Fleming et al. 1993; Marten et al. 2000a; Marten et
al. 2000b). Aside from infection of suckling mice that clearly exhibit increased
astrocyte susceptibility with limited chronic infection in the brain (Perlman et
al. 1988; Perlman et al. 1990), another scenario where vRNA persists more
abundantly in the spinal cord rather than the brain is during infection of less
characterized cross of mice. JHMV (V2.2-1) infection by intracranial
inoculation of adult (H2
b
xH2
d
) mice results in prolonged detection of vRNA in
the spinal cord while it appears cleared from the brain, however these
experiments did not address potential alterations in tropism under these
circumstances nor propose another explanation for these disparate results
(Bergmann et al. 1999).
Lastly, in situ hybridization for vRNA in the CNS for different MHV
infections also points to specific areas in the brain being most vunerable to
infection and these are often associated with the limbic system (Gombold
and Weiss 1992; Lane et al. 1998; Perlman et al. 1988; Perlman et al. 1990).
Additionally the first N protein positive glia are detected in the periventricular
region of the corpus callosum at day 3 p.i. (Wang et al. 1992). This suggests
oligodendroglia in particular regions of the brain may be more exposed to
viral infection than those residing in other regions of the CNS.

Evaluation of viral genes during JHMV infection in vivo.
In an attempt to better characterize viral behavior in vivo, a real-time PCR
strategy was developed first in vitro to distinguish between different
41
subgenomic vRNAs in a manner providing improved relative quantification
and levels of detection over conventional northern blotting or in situ
hybridization methods. This technique appears to recapitulate data from
better characterized, one-step viral infections in vitro, as well as provide a
substantial degree of specificity (Fig. 2.5). Application of this method to more
complex in vivo infection yielded promising preliminary data. Although not all
viral genes were analyzed in vivo including HE, E and the remaining non-
structural encoding genes, analysis of abundantly expressed structural genes
(N, M and S) corresponded with available western blot and
immunohistochemistry data (Talbot et al. 1984; Wang et al. 1992).
Furthermore the sharp decline in M subgenomic vRNA levels strongly
correlated with the decline in virus titers supporting the requirement for M
protein expression in the production of infectious virions (de Haan et al.
1998) (Fig. 2.6). Surprisingly genomic-length vRNA levels remained relatively
high compared to subgenomic vRNAs evaluated. While the specificity for
PCR amplification of sequence from the 5’-prime end of the viral genome is
fairly indisputable, it’s possible competition and artifacts of the PCR reaction
may limit efficient amplification of subgenomic targets, particularly from in
vivo samples. However, amplification of all subgenomic vRNAs during
infection in vitro exhibited robust amplification even compared to genomic-
length vRNA over a broad range of quantification, instead suggesting that the
relatively abundant expression of genomic-length vRNA in vivo is the
consequence of less efficient viral replication under non-ideal conditions. Still
42
it must also be considered that the vRNA levels for a particular gene may not
reflect the protein expression.
Evaluation of N and M encoding subgenomic vRNAs in purified microglia
and oligodendroglia by real-time PCR suggests both cell types are similarly
capable of supporting productive viral infections despite their dramatically
different degrees of susceptibility. This is not surprising given much earlier
work on MHV susceptibility studies, where resistance is conferred by limiting
initial infection and not by limiting viral replication once a cell is infected
(Bang 1981; Kooi et al. 1988). Most notably oligodendroglia exhibited a
strong decline in their relative expression of M vRNA at day 7 p.i. (Fig.2.7),
implying that while oligodendroglia are the predominant cell infected at this
time they become hampered in expressing high levels of infectious virions.
The rebound in M vRNA expression by oligodendroglia at day 14 p.i.
(Fig.2.7) implies oligodendroglia can continue to produce at least low levels
of virions following in the initial clearance of virus following acute infection.
Evidence for virus remaining genetically intact and supporting ongoing
replication in oligodendroglia is supported by viral recrudescence in the
absence of neutralizing antibody responses (Lin et al. 1999; Ramakrishna et
al. 2006). Similarly infection of BALB/c mice by MHV-4 results in continued
detection of infectious virus and virion particles can be identified by electron
microscopy specifically in oligodendroglia one year post infection (Knobler et
al. 1982). Also persistent infection of primary glial cultures with MHV-A59
43
results in productive non-lytic infections that can be maintained at least 45
days in vitro (Lavi et al. 1987).
Indirect evidence by in situ hybridization for total vRNA from MHV-A59
infected B6 mice evaluated at 10 months post infection also implies
continuing viral transcription (Lavi et al. 1984b). It was also noted the
amount of vRNA per infected cell is similar in both the acute and persistent
phases but is finally limited to small foci of chronically infected cells in both
the brain and spinal cord (Lavi et al. 1984a). This observation suggests cells
still infected during persistence are supporting viral RNA synthesis similarly
as during acute infection but control of virus is due to limiting the number of
infected cells.
While several avenues suggest prolonged productive infection of
oligodendroglia in vivo, the eventual decline or clearance of vRNA from the
spinal cord (Fig. 2.3) (Rowe et al. 1997) from day 60 onwards, in addition to
not detecting N protein at such late time points (Gonzalez et al. 2006; Wang
et al. 1992) suggests continued anti-viral activity. Alternatively
oligodendroglia turnover may eventually begin diluting the number of infected
cells over time, but this mechanism would work slowly as oligodendroglia
exhibit a very long half-life. Similarly infection of rats with JHMV is also
associated vRNA in the absence of structural viral proteins during the
persistent phase (Sorensen and Dales 1985). In some cases, JHMV
persistently infected DBT cells generated in vitro can also harbor vRNA
without expression of viral proteins or virions, though many continue to
44
express N protein without producing infectious virions (Maeda et al. 1995).
Also in JHMV induced retinopathy in mice, vRNA is detected in the retina 140
days p.i. by in situ hybridization with no detection of structural viral proteins
(Komurasaki et al. 1996).
Nevertheless this data confirms mature myelinating oligodendroglia are
the site of persistent JHMV infection and identifies preferential infection of
oligodendroglia occurs very early during the acute phase. It also suggests
oligodendroglia support productive infection of JHMV and must be the
primary source of virus during recrudescence (Ramakrishna et al. 2006).
Lastly controlling infectious virus appears due to hampering the ability of
oligodendroglia to produce virions but not clearing them of viral infection.
45
Chapter 2 References

Adami C, Pooley J, Glomb J, Stecker E, Fazal F, Fleming JO, Baker SC.
1995. Evolution of mouse hepatitis virus (MHV) during chronic
infection: quasispecies nature of the persisting MHV RNA. Virology
209(2):337-46.
Bang FB. 1981. The use of a genetically incompatible combination of host
and virus (MHV) for the study of mechanisms of host resistance. Adv
Exp Med Biol 142:359-73.
Baric RS, Yount B. 2000. Subgenomic negative-strand RNA function during
mouse hepatitis virus infection. J Virol 74(9):4039-46.
Bergmann CC, Altman JD, Hinton D, Stohlman SA. 1999. Inverted
immunodominance and impaired cytolytic function of CD8+ T cells
during viral persistence in the central nervous system. J Immunol
163(6):3379-87.
Bergmann CC, Dimacali E, Stohl S, Marten N, Lai MM, Stohlman SA. 1998.
Viral evolution and CTL epitope stability during JHMV infection in the
central nervous system. Adv Exp Med Biol 440:751-7.
Bergmann CC, Lane TE, Stohlman SA. 2006. Coronavirus infection of the
central nervous system: host-virus stand-off. Nat Rev Microbiol
4(2):121-32.
Bos EC, Heijnen L, Luytjes W, Spaan WJ. 1995. Mutational analysis of the
murine coronavirus spike protein: effect on cell-to-cell fusion. Virology
214(2):453-63.
Brian DA, Baric RS. 2005. Coronavirus genome structure and replication.
Curr Top Microbiol Immunol 287:1-30.
Choi KS, Huang P, Lai MM. 2002. Polypyrimidine-tract-binding protein affects
transcription but not translation of mouse hepatitis virus RNA. Virology
303(1):58-68.
de Haan CA, Kuo L, Masters PS, Vennema H, Rottier PJ. 1998. Coronavirus
particle assembly: primary structure requirements of the membrane
protein. J Virol 72(8):6838-50.
Fleming JO, Houtman JJ, Alaca H, Hinze HC, McKenzie D, Aiken J,
Bleasdale T, Baker S. 1993. Persistence of viral RNA in the central
nervous system of mice inoculated with MHV-4. Adv Exp Med Biol
342:327-32.
46
Fleming JO, Trousdale MD, el-Zaatari FA, Stohlman SA, Weiner LP. 1986.
Pathogenicity of antigenic variants of murine coronavirus JHM
selected with monoclonal antibodies. J Virol 58(3):869-75.
Ford AL, Goodsall AL, Hickey WF, Sedgwick JD. 1995. Normal adult ramified
microglia separated from other central nervous system macrophages
by flow cytometric sorting. Phenotypic differences defined and direct
ex vivo antigen presentation to myelin basic protein-reactive CD4+ T
cells compared. J Immunol 154(9):4309-21.
Fuss B, Mallon B, Phan T, Ohlemeyer C, Kirchhoff F, Nishiyama A, Macklin
WB. 2000. Purification and analysis of in vivo-differentiated
oligodendrocytes expressing the green fluorescent protein. Dev Biol
218(2):259-74.
Gombold JL, Weiss SR. 1992. Mouse hepatitis virus A59 increases steady-
state levels of MHC mRNAs in primary glial cell cultures and in the
murine central nervous system. Microb Pathog 13(6):493-505.
Gonzalez JM, Bergmann CC, Ramakrishna C, Hinton DR, Atkinson R,
Hoskin J, Macklin WB, Stohlman SA. 2006. Inhibition of interferon-
gamma signaling in oligodendroglia delays coronavirus clearance
without altering demyelination. Am J Pathol 168(3):796-804.
Jeong YS, Repass JF, Kim YN, Hwang SM, Makino S. 1996. Coronavirus
transcription mediated by sequences flanking the transcription
consensus sequence. Virology 217(1):311-22.
Jordan CA, Friedrich VL, Jr., Godfraind C, Cardellechio CB, Holmes KV,
Dubois-Dalcq M. 1989. Expression of viral and myelin gene transcripts
in a murine CNS demyelinating disease caused by a coronavirus. Glia
2(5):318-29.
Knobler RL, Dubois-Dalcq M, Haspel MV, Claysmith AP, Lampert PW,
Oldstone MB. 1981. Selective localization of wild type and mutant
mouse hepatitis virus (JHM strain) antigens in CNS tissue by
fluorescence, light and electron microscopy. J Neuroimmunol 1(1):81-
92.
Knobler RL, Lampert PW, Oldstone MB. 1982. Virus persistence and
recurring demyelination produced by a temperature-sensitive mutant
of MHV-4. Nature 298(5871):279-80.
Komurasaki Y, Nagineni CN, Wang Y, Hooks JJ. 1996. Virus RNA persists
within the retina in coronavirus-induced retinopathy. Virology
222(2):446-50.
47
Kooi C, Mizzen L, Alderson C, Daya M, Anderson R. 1988. Early events of
importance in determining host cell permissiveness to mouse hepatitis
virus infection. J Gen Virol 69 ( Pt 6):1125-35.
Krijnse-Locker J, Ericsson M, Rottier PJ, Griffiths G. 1994. Characterization
of the budding compartment of mouse hepatitis virus: evidence that
transport from the RER to the Golgi complex requires only one
vesicular transport step. J Cell Biol 124(1-2):55-70.
Lane TE, Asensio VC, Yu N, Paoletti AD, Campbell IL, Buchmeier MJ. 1998.
Dynamic regulation of alpha- and beta-chemokine expression in the
central nervous system during mouse hepatitis virus-induced
demyelinating disease. J Immunol 160(2):970-8.
Lavi E, Gilden DH, Highkin MK, Weiss SR. 1984a. Detection of MHV-A59
RNA by in situ hybridization. Adv Exp Med Biol 173:247-57.
Lavi E, Gilden DH, Highkin MK, Weiss SR. 1984b. Persistence of mouse
hepatitis virus A59 RNA in a slow virus demyelinating infection in mice
as detected by in situ hybridization. J Virol 51(2):563-6.
Lavi E, Suzumura A, Hirayama M, Highkin MK, Dambach DM, Silberberg
DH, Weiss SR. 1987. Coronavirus mouse hepatitis virus (MHV)-A59
causes a persistent, productive infection in primary glial cell cultures.
Microb Pathog 3(2):79-86.
Lin MT, Hinton DR, Marten NW, Bergmann CC, Stohlman SA. 1999.
Antibody prevents virus reactivation within the central nervous system.
J Immunol 162(12):7358-68.
Maeda A, Hayashi M, Ishida K, Mizutani T, Watanabe T, Namioka S. 1995.
Characterization of DBT cell clones derived from cells persistently
infected with the JHM strain of mouse hepatitis virus. J Vet Med Sci
57(5):813-7.
Marten NW, Stohlman SA, Atkinson RD, Hinton DR, Fleming JO, Bergmann
CC. 2000a. Contributions of CD8+ T cells and viral spread to
demyelinating disease. J Immunol 164(8):4080-8.
Marten NW, Stohlman SA, Bergmann CC. 2000b. Role of viral persistence in
retaining CD8(+) T cells within the central nervous system. J Virol
74(17):7903-10.
Ontiveros E, Kuo L, Masters PS, Perlman S. 2001. Inactivation of expression
of gene 4 of mouse hepatitis virus strain JHM does not affect virulence
in the murine CNS. Virology 289(2):230-8.
48
Parra B, Hinton DR, Marten NW, Bergmann CC, Lin MT, Yang CS, Stohlman
SA. 1999. IFN-gamma is required for viral clearance from central
nervous system oligodendroglia. J Immunol 162(3):1641-7.
Perlman S, Jacobsen G, Moore S. 1988. Regional localization of virus in the
central nervous system of mice persistently infected with murine
coronavirus JHM. Virology 166(2):328-38.
Perlman S, Jacobsen G, Olson AL, Afifi A. 1990. Identification of the spinal
cord as a major site of persistence during chronic infection with a
murine coronavirus. Virology 175(2):418-26.
Perlman S, Ries D. 1987. The astrocyte is a target cell in mice persistently
infected with mouse hepatitis virus, strain JHM. Microb Pathog
3(4):309-14.
Raamsman MJ, Locker JK, de Hooge A, de Vries AA, Griffiths G, Vennema
H, Rottier PJ. 2000. Characterization of the coronavirus mouse
hepatitis virus strain A59 small membrane protein E. J Virol
74(5):2333-42.
Ramakrishna C, Atkinson RA, Stohlman SA, Bergmann CC. 2006. Vaccine-
induced memory CD8+ T cells cannot prevent central nervous system
virus reactivation. J Immunol 176(5):3062-9.
Ramakrishna C, Bergmann CC, Holmes KV, Stohlman SA. 2004. Expression
of the mouse hepatitis virus receptor by central nervous system
microglia. J Virol 78(14):7828-32.
Rowe CL, Baker SC, Nathan MJ, Fleming JO. 1997. Evolution of mouse
hepatitis virus: detection and characterization of spike deletion
variants during persistent infection. J Virol 71(4):2959-69.
Sawicki SG, Sawicki DL. 2005. Coronavirus transcription: a perspective. Curr
Top Microbiol Immunol 287:31-55.
Singer BB, Scheffrahn I, Heymann R, Sigmundsson K, Kammerer R, Obrink
B. 2002. Carcinoembryonic antigen-related cell adhesion molecule 1
expression and signaling in human, mouse, and rat leukocytes:
evidence for replacement of the short cytoplasmic domain isoform by
glycosylphosphatidylinositol-linked proteins in human leukocytes. J
Immunol 168(10):5139-46.

49
Sorensen O, Dales S. 1985. In vivo and in vitro models of demyelinating
disease: JHM virus in the rat central nervous system localized by in
situ cDNA hybridization and immunofluorescent microscopy. J Virol
56(2):434-8.
Taguchi F, Siddell SG. 1985. Difference in sensitivity to interferon among
mouse hepatitis viruses with high and low virulence for mice. Virology
147(1):41-8.
Talbot PJ, Knobler RL, Buchmeier MJ. 1984. Western and dot
immunoblotting analysis of viral antigens and antibodies: application to
murine hepatitis virus. J Immunol Methods 73(1):177-88.
Tooze J, Tooze S, Warren G. 1984. Replication of coronavirus MHV-A59 in
sac- cells: determination of the first site of budding of progeny virions.
Eur J Cell Biol 33(2):281-93.
Wang FI, Hinton DR, Gilmore W, Trousdale MD, Fleming JO. 1992.
Sequential infection of glial cells by the murine hepatitis virus JHM
strain (MHV-4) leads to a characteristic distribution of demyelination.
Lab Invest 66(6):744-54.
Yokomori K, Banner LR, Lai MM. 1991. Heterogeneity of gene expression of
the hemagglutinin-esterase (HE) protein of murine coronaviruses.
Virology 183(2):647-57.

Zhou J, Marten NW, Bergmann CC, Macklin WB, Hinton DR, Stohlman SA.
2005. Expression of matrix metalloproteinases and their tissue
inhibitor during viral encephalitis. J Virol 79(8):4764-73.

50
Chapter 3: Innate immune responses by microglia and oligodendroglia
during JHMV infection

Chapter 3 Abstract
The interferon αβ response is a first line of defense against viral
infection. To ascertain the contribution of glia to this response during JHMV
infection in vivo, oligodendroglia and microglia were purified from infected
mice and assayed for IFNαβ induction. Microglia induced IFNβ and IFNα4
transcripts in direct response to viral infection while oligodendroglia did not,
despite their robust infection. Furthermore oligodendroglia only expressed a
limited repertoire of receptors for detecting viral RNA products suggesting
they are less sensitive to detecting coronavirus infection. However,
oligodendroglia responded to exogenous IFNαβ in vivo as indicated by early
upregulation of Mda5 and RIG-I transcripts in O4+ glia during infection in wild
type mice but not in O4+glia from IFNαβ-receptor deficient mice. Lastly
oligodendroglia expressed a limited panel of interferon stimulated genes
(ISGs) supporting IKKε-independent JAK/STAT mediated IFNαβ signaling
potentially leading to an inadequate anti-viral state. This data is the first to
describe such limited responses in a natural infection and supports a strong
role for innate immunity in the CNS.
51
Introduction
This past year marked the fiftieth anniversary of the discovery of
interferon by Aleck Isaacs and Jean Lindenmann. In pioneering experiments,
they demonstrating a secreted substance produced by a virally infected cell
could protect neighboring cells from the same fate, thereby preventing further
viral spread (Isaacs and Lindenmann 1957). However, early MHV
experiments did not reiterate this finding, as mixing cultures of genetically
susceptible macrophages with those that were from resistant strains of mice
did not afford protection to susceptible cells during infection in vitro (Shif and
Bang 1970). Still the effect of interferon treatment directly on cells or of mice
demonstrated a profound sensitivity of MHV strains to the anti-viral activity of
IFNαβ (Garlinghouse et al. 1984; Smith et al. 1987; Taguchi and Siddell
1985). Most importantly the role of endogenous IFNαβ production was
identified as a key host factor in determining susceptibility of different mouse
strains to MHV infection in vivo (Virelizier and Gresser 1978).
Recently the role of IFNαβ during MHV infection of the CNS or
periphery has been revisited by genetic means of experimentation and
confirmed as a critical response in controlling initial viral spread. IFNαβ
receptor-deficient mice exhibit widespread infection and extreme, rapid
mortality (Cervantes-Barragan et al. 2007; Ireland et al. 2008). Although
IFNαβ is critical in controlling many viral infections, aspects of its initiation
52
and effects on distinct cells in the CNS during JHMV infection remain to be
investigated.
Since its initial discovery new insights continue to elucidate pathways
initiating the type I class of interferons (primarily composed of IFN α and β),
separate from the downstream interferon signaling pathway. The recognition
of common molecular motifs that serve as signatures of viral infection or
encounter allows the initiation of innate immune responses. These triggers
are broadly referred to as “pathogen-associated molecular patterns” or
PAMPs, and can be recognized by several families of receptors, most
notably Toll-like receptors (TLRs).
A hallmark of viral infection is viral RNA products and double
stranded intermediates of viral replication. During JHMV infection vRNA is
readily detectable in several glia cell populations and particularly in
oligodendroglia (Chapter 2). TLR7 is capable of responding to single
stranded RNA (ssRNA) in endocytic vesicles (Uematsu and Akira 2007). It is
implicated in eliciting responses from plasmacytoid dendritic cells (pDCs) that
are strong IFNαβ producers in response to a variety of viral infections,
including MHV (Cervantes-Barragan et al. 2007; Uematsu and Akira 2007).
TLR7 utilizes the MyD88 signalling adaptor protein for downstream gene
regulation, similar to the majority of TLRs (Fig. 3.1) (Hemmi et al. 2002).
TLR3 is involved in the recognition of dsRNA both in endocytic vesicles and
in the extracellular environment, depending on the cell-specific localization of
TLR3 (Matsumoto et al. 2003). Unlike TLR7, TLR3 does not signal via
53
Figure 3.1 Overview of PAMP-receptor pathways
capable of detecting vRNA and initiating early

MyD88, and instead utilizes the TRIF adaptor complex leading to TANK-
binding kinase one (TBK1) and IκB kinase epsilon (IKKε, also known as
inducible IKK or IKKi) to effect downstream gene regulation (Fig. 3.1) (Hoebe
et al. 2003; Yamamoto et al. 2003). TLR3 is also expressed by pDCs, as well
as macrophages, microglia, astrocytes, neurons, and oligodendroglia (Bsibsi
et al. 2002; Olson and Miller 2004; Prehaud et al. 2005; Uematsu and Akira
2007).
More recently a cytosolic pathway for the recognition of dsRNA and
uncapped RNA was identified in the DEAD-box helicase family composed of
RIG-I and Mda5 helicases that also possess caspase activation recruitment
domains (CARD) (Plumet et al. 2007; Yoneyama et al. 2005). These
54
pathways have been identified in recognizing RNA from Sendai, influenza,
measles and other viral infections (Takeuchi and Akira 2007; Yoneyama et
al. 2004). The RIG-I/Mda5 pathway utilizes the IPS-1 signaling adaptor
molecule (also known as MAVS) that also leads to the TBK1/IKKε pathway
(Fig. 3.1) (Kumar et al. 2006). RIG-I and Mda5 are expressed by a variety of
cells except pDCs (Kato et al. 2005). Initiation of any of these pathways
leads to IFNαβ expression, as well as expression of other innate
inflammatory cytokines such as interluekins 1 (IL-1), IL-6 as well as multiple
chemokines, triggering the initial cascades of the immune response.
Interferon signaling and the anti-viral state. Upon the induction of
IFNαβ expression its subsequent signaling can act in an autocrine and
paracrine manner by binding the IFNαβ receptor complex. This leads to
JAK/STAT activation and classically the formation of the ISGF-3 hetero-
complex composed of STAT1/STAT2 and IRF-9 (Schindler et al. 2007). This
complex translocates to the nucleus to drive transcription of a wide variety of
interferon stimulated genes (ISGs) by binding the interferon stimulated
response elements (ISREs) in their promoters (Platanias 2005). Several
ISGs have been identified as directly impairing viral replication within the cell,
including the classical 2’-5’ OAS and PKR pathways, that contribute to
establishing an anti-viral state (Randall and Goodbourn 2008). Additionally,
expression of many PAMP-receptors is increased by IFN signalling,
presumably to increase the sensitivity of neighboring cells to potential danger
55
signals associated with infection (McKimmie et al. 2005; Miettinen et al.
2001). Many of these genes have overlapping gamma activated sequences
(GAS) in their promoters that bind the similar STAT1 homo-dimer
characteristically activated by IFNγ signaling (Platanias 2005; Schindler et al.
2007). While IFNαβ expression can be induced in most varieties of cells,
IFNγ is predominantly expressed by effector T cells and to a lesser extent by
natural killer cells (Schoenborn and Wilson 2007). IFNγ binds its own unique
receptor complex expressed by most cells, including oligodendroglia, and
while it can amplify IFN responses, it represents a related but different
signaling pathway (Platanias 2005; Schindler et al. 2007).
Currently the initiation of IFNαβ responses by MHV remains a
conundrum. To date the only pathway identified as recognizing MHV
infection is TLR7 expressly by pDCs in vitro (Cervantes-Barragan et al.
2007). Other members of the coronaviridae family have been shown to
initiate IFN responses through recognition of structural components without
nucleic acid involvement suggesting other routes are possible (Baudoux et
al. 1998). Furthermore in vitro studies indicate TLR3, RIG-I and Mda5
pathways are not triggered nor impaired by MHV infection (Zhou and
Perlman 2007). However in vitro infection of astrocytes is associated with
IFNβ transcription suggesting glia are capable of initiating IFNαβ directly in
response to MHV infection (Wang et al. 1998) and IFNβ protein is detected in
the brains of mice early during infection with different MHV strains (Roth-
56
Cross et al. 2007). Herein the contribution of microglia and oligodendroglia to
the initiation of the IFNαβ response was evaluated during JHMV infection in
vivo. Microglia appear the primary early responders to JHMV infection
whereas oligodendroglia did not induce IFNαβ despite their overwhelming
infection. Additionally oligodendroglia expressed a limited repertoire of
PAMP-receptors that may recognize vRNA. Moreover expression of RIG-I
and Mda5 by oligodendroglia was found to be in response to exogenous
IFNαβ and not associated with viral infection. Lastly the IFNαβ response by
oligodendroglia appears limited to a subset of ISGs, recently identified as
due to a lack of IKKε interactions directly with STAT1.

Results
Global kinetics of interferon responses: IFNαβ precedes IFNγ.
Typical of many viral infections the IFNαβ response during JHMV
infection also occurs very early. Transcripts specifically encoding IFNα4 and
IFNβ can be detected by RT-PCR from infected brains at day 3.p.i., the
earliest time point evaluated (Fig. 3.2). IFNγ expression peaked at day 7 p.i.
(Parra et al. 1999; Zuo et al. 2006), following the kinetics of T cells infiltrating
the brain (Fig. 3.2 and Chapter 1)(Bergmann et al. 2001). A similar, though
subtly delayed, pattern of interferon expression is also seen in the spinal cord
(Lin et al. 1999; Malone et al. 2008).
57
Microglia upregulate IFNα/β in
direct response to viral infection,
while oligodendroglia do not.
FACS purification of
oligodendroglia and microglia also
allowed the evaluation of IFNαβ
induction at the transcript level
during JHMV infection in a cell-
specific manner in vivo.
Interestingly, mature
oligodendroglia did not upregulate
expression of IFNβ or IFNα4
transcripts at any time during the
acute infection (Fig. 3.3A). Both
message levels remained near basal levels for naïve oligodendroglia in the
brain and spinal cord throughout infection, despite increasing viral burdens
(Fig. 3.3A & Chapter 2). Microglia displayed induction of both IFNβ and
IFNα4 transcripts early during infection (Fig. 3.3). Although the overall
induction of these transcripts by microglia was very low relative to Gapdh,
they consistently upregulated them 10-30 fold higher than naïve levels by
day 3 p.i. in the brain for both IFNβ and IFNα4 (Fig. 3.3A). Peak IFNβ
message levels occurred slightly later in the spinal cord than in the brain
Gapdh
IFNα4
Naïve d3 d5 d7 d10
vRNA
IFNβ
IFNγ
Brain
Figure 3.2 Overview of IFN
responses in the brain during
JHMV infection. Total RNA was
isolated from brains of naïve and
infected B6 mice. cDNAs from
two individuals per timepoint
were assayed for genomic-
length vRNA, IFNα4, IFNβ, IFNγ
and Gapdh by RT-PCR. IFNα4
and IFNβ were only detected
after 35 PCR cycles whereas all
other transcripts were detected
by 30 cycles.
58
following the pattern of viral spread into microglia (Fig. 3.3A & Chapter 2).
IFNα4 induction also appeared to subside earlier than IFNβ transcripts in
microglia for both the brain and spinal cord (Fig. 3.3A).
Evaluation of additional populations of cells isolated from the brains of
infected B6 mice demonstrated microglia are a predominant source of IFNβ
during JHMV infection. Transcripts for IFNβ were not detected in O4+ glia,
but these transcripts were detected in the remaining resident glia (CD45-,
O4-) at days 3 and 5 p.i. (Fig. 3.3B). Infiltrating F4/80+ cells, consisting
mostly of macrophages, also contributed to the IFNβ response, and even
CD3+ T cells express IFNβ transcripts in association with vRNA in this
population (Fig. 3.2B & Fig. 2.3). Of all populations evaluated microglia
expressed the highest levels of IFNβ transcripts early during the acute
infection, reflecting the global pattern of IFNαβ expression (Fig. 3.2 & 3.3B).
Not only did the induction of IFNβ transcripts by microglia correspond
to the kinetics of their viral infection, the magnitude of IFNβ induction also
correlated with the intensity of their viral burden (Fig. 3.4) suggesting they
respond directly to viral infection. This tight correlation between IFNβ
upregulation and the magnitude of viral infection (as measured by vRNA) has
also been identified during severe acute respiratory syndrome coronavirus
(SARS-CoV) respiratory infection of macaques (de Lang et al. 2007). IFNβ
induction is even more strongly correlative with SARS-CoV vRNA levels than
59

Figure 3.3 IFNα α α αβ β β β transcripts are upregulated by a variety of populations
during JHMV infection, except oligodendroglia. (A) IFNβ and IFNα4
transcripts were measured by real-time PCR from purified microglia and
oligodendroglia isolated from the brains and spinal cords of PLP-GFP/B6
mice. Floating bars indicate the spread of values from three (IFNβ) or two
(IFNα4) independent experiments. (B) IFNβ transcripts were also measured
in populations purified from B6 brains during acute infection. ND denotes not
detectable, and NA denotes not available. Data is from one experiment.
Microglia
Oligodendrocytes
naive 3 5 7 10
0
1
2
3
4
naive 3 5 7 10
0.0
0.5
1.0
1.5
2.0
2.5
0
1
2
3
4
naive 3 5 7 10
0
1
2
3
4
Spinal Cord
IFNβ IFNβ
Brain
IFNα4
Transcripts relative to Gapdh
IFNα4
days post infection
days post infection
3 5 7
0.0
0.2
0.4
0.6
3.0
3.3
3.5
CD45-, O4+
CD45-, O4-
Microglia (CD45lo)
CD45hi, F4/80+
T cells (CD3+)
IFNβ transcripts measured from populations
purified from B6 brains
Transcript relative to Gapdh
ND NA ND ND
A
B
Microglia
Oligodendroglia
60
Figure 3.4 Induction of
IFNβ β β β by microglia
strongly correlates with
their viral burden.
Genomic-length vRNA
values for isolated
microglia as determined in
chapter 2 are plotted
against their respective
IFNβ message levels.
Microglia samples were
isolated during acute
infection (days 3, 5, 7, &
10) from the brains and
spinal cords. Trendline
denotes linear regression
analysis with R
2
value of fit
for n=24 samples.

other inflammatory cytokines and chemokines, such as IL-6 and CXCL10 (IP-
10) (de Lang et al. 2007).

Oligodendroglia require exogenous IFNαβ to express a limited repertoire of
PAMP-receptors during infection.

To ascertain the potential for oligodendroglia to detect vRNA
during infection profiling of transcripts for TLR3, TLR7, Mda5 and RIG-I was
conducted in purified oligodendroglia as compared to microglia during the
acute infection. Microglia upregulated all transcripts 2-5 fold as compared to
levels in naïve microglia (Fig. 3.5). Peak expression for TLR3, Mda5 and
RIG-I occurred early at day 3 p.i. in microglia, while TLR7 expression was not
upregulated until day 5 p.i. (Fig. 3.5). This pattern of gene expression was
0
5
10
15
20
25
30
35
40
45
50
0 1 2 3 4
R
2
= 0.8063
n= 24
Microglia
Genomic-length vRNA
relative to Gapdh
IFNβ transcripts relative to Gapdh
61

Figure 3.5 Microglia and oligodendroglia upregulate transcripts
encoding PAMP-receptors that may detect vRNA during infection. Glia
were purified from the brains of PLP-GFP/B6 mice and assayed for
transcripts encoding TLR3, TLR7, Mda5 and RIG-I during the acute infection.
Data is a profile from a single experiment.

reproducible in microglia isolated from infected wild type B6 mice as well
(data not shown). TLR7 transcript levels in oligodendroglia remained below
0.2 relative to Gapdh during infection and did not change relative to levels in
naïve oligodendroglia (Fig. 3.5). This is consistent with the inability to detect
TLR7 message in human oligodendroglia (Bsibsi et al. 2002). TLR3 mRNA
0
50
100
150
200
250
300
350
naïve 3 5 7 10
TLR3
0
10
20
30
40
50
naïve 3 5 7 10
TLR7
0
50
100
150
200
250
300
naïve 3 5 7 10
RIG-I
0
50
100
150
200
250
naïve 3 5 7 10
Mda5
days post infection
Transcripts relative to Gapdh
Microglia Oligodendroglia
62
expression was detected in human oligodendroglia (Bsibsi et al. 2002), and
this was also detected at higher levels in murine oligodendroglia. However
TLR3 transcript levels remained similar to basal levels for oligodendroglia
during infection (Fig. 3.5). Most notably Mda5 and RIG-I were upregulated
approximately 5-fold in oligodendroglia early during infection (Fig. 3.5).
Surprisingly this pattern of gene regulation in oligodendroglia
appeared completely unrelated to viral infection of these cells and more
closely reflects the kinetics of IFNαβ expression. This suggested the
expression of Mda5 and RIG-I represents a specific response by
oligodendroglia to exogenous IFNαβ and conversely implies Mda5 and RIG-I
are not triggered directly by MHV in vivo. To verify the former speculation,
Figure 3.6 Oligodendroglia require IFNα α α αβ β β β signaling for the early
upregulation of Mda5 and RIG-I transcripts during JHMV infection.
O4+glia were purified from the brains of wild type B6 and IFNαβ receptor
deficient mice during JHMV infection. n=6-8 mice per sample and data is
from a single experiment.
0
20
40
60
80
100
120
140
160
naïve 3 5 7
RIG-I
0
100
200
300
400
500
600
naïve 3 5 7
Mda5
days post infection
transcripts relative to Gapdh
O4+ glia
wt B6 IFNαβR
-/-
(B6)
63
O4+ glia were purified from B6 mice and IFNαβ-receptor deficient mice
during JHMV infection and assayed for Mda5 and RIG-I transcripts. Similar to
oligodendroglia from PLP-GFP/B6 mice, O4+ glia upregulated Mda5 and
RIG-I by days 3 and 5 p.i. (Fig. 3.6). During this infection peak expression in
O4+ glia from wild type mice occurred at day 5 and Mda5 appears more
prominently upregulated than in PLP-GFP/B6 mice (Fig. 3.5 & 3.6). Still the
pattern of Mda5 and RIG-I upregulation in O4+ glia from wild type mice was
strikingly different than that detected in O4+ glia incapable of responding to
IFNαβ (Fig. 3.6). Mda5 transcripts remained similar to naïve levels until day 7
p.i,. when expression only reached 20% of the peak expression detected in
wild type O4+ glia (Fig. 3.6). RIG-I transcripts were upregulated less than
two-fold in IFNαβR
-/-
O4+ glia over the course of infection (Fig. 3.6) This data
indicates oligodendroglia respond to exogenous IFNαβ in vivo and this
response drives their early expression of Mda5 and RIG-I during JHMV
infection.

Oligodendroglia express a profile of interferon stimulated genes (ISGs)
reflecting IKKε-independent IFNαβ signaling.
The finding that oligodendroglia express Mda5 and RIG-I early during
infection yet fail to induce IFNαβ suggests JHMV is not triggering this
pathway or is impairing it in some way. To further investigate the potential for
PAMP-receptor signaling oligodendroglia were assayed for expression of the
64
downstream signaling kinase, inducible IKKε (or IKKi) (Fig. 3.1). Microglia
upregulated IKKε transcripts early during infection and maintained their
expression while oligodendroglia did not induce expression of IKKε (Fig.
3.7A). This further implies oligodendroglia are unable to recognize viral
infection is underway to activate downstream signaling pathways.
Recent reports have identified IKKε has broader reaching effects than
supporting PAMP-receptor pathways as it also modulates incoming IFNαβ
signaling (Tenoever et al. 2007). By phosphorylating STAT1, IKKε improves
the binding of the ISFG-3 transcription complex to ISRE promoter
sequences, supporting upregulation of a larger number of ISGs (Tenoever et
al. 2007). ISGs that contain additional elements in their ISRE sequences can
still be efficiently upregulated independent of IKKε activity, dividing ISGs into
IKKε-dependent and independent groups. To ascertain if the lack of IKKε
expression in mature oligodendroglia also influenced their ability to respond
to IFNαβ signalling, expression of two key ISGs affected by IKKε were
measured. Adenosine deaminase specific for RNA (ADAR) was previously
shown to require IKKε-mediated phosphorylation of STAT1 for its
upregulation in response to IFNαβ, whereas Ifit2 (also known as ISG54) does
not (Tenoever et al. 2007). When assayed for these genes oligodendroglia
were found to upregulate Ifit2 transcipts early during infection while Adar1
levels remained unchanged (Fig. 3.7B). This data suggests the
oligodendroglia response to IFNαβ is limited by the lack IKKε, such that they
65
Figure 3.7 Failure to
induce IKKε ε ε ε also
leads to limited
expression of ISGs
in oligodendroglia.
(A) Purified microglia
and oligodendroglia
isolated from the
spinal cords of PLP-
GFP/B6 mice were
assayed for induction
of IKKε transcripts
during infection. Bars
indicate the spread of
values from two
independent
experiments. (B)
GFP+ oligodendroglia
were also assayed for
Ifit2 and Adar
transcripts during
infection for a single
experiment. ND
denotes not
detectable.

can only express the core set of IKKε-independent ISGs during coronavirus
infection. While it is not clear if oligodendroglia may express IKKε under
different circumstances the convergence of pathways at IKKε suggests the
lack of danger signals is related to a limited interferon response.
IKKe (IKKi)
days post infection
naive 3 5 7 10
0
2
4
6
8
10
12
Microglia
Oligodendroglia
transcript relative to Gapdh
0
2
4
6
8
10
12
naïve 3 5 7 10
Ifit1 (ISG54)
ADAR1
Oligodendroglia
days post infection
transcripts relative to Gapdh
ND
A
B
Ifit2 (ISG54)
Adar
66
Discussion

Microglia are predominant innate responders to JHMV infection in vivo.
Microglia consistently induced expression of IFNβ and IFNα4
transcripts early during JHMV infection. Furthermore they expressed higher
levels of these transcripts than other cells in the brain including resident glia
that were also highly susceptible to infection. In addition, very few pDCs have
been identified in the CNS during JHMV infection (unpublished data from
Derek Ireland) suggesting microglia are a primary source of IFNαβ. The
strong correlation between the timing as well as the magnitude of IFNαβ
induction in microglia with their viral burden indicates microglia are
responding directly to their viral infection. This also supports the IFNαβ
response as a local phenomenon (Randall and Goodbourn 2008) and
indicates a protective role for microglia against viral spread prior to
involvement with adaptive immune responses.
Previous misconceptions regarding the regulation of IFNβ gene
expression did not reflect the nature of what we know understand regarding
PAMP-receptor signaling and IFNβ gene regulation. IFNβ expression does
not beget more IFNβ rather its expression is a short-lived, direct response to
PAMP-related signals. This tightly regulated response was exemplified by
microglia during JHMV infection (Fig.3.4). The IFNβ gene itself is not directly
interferon inducible, as it lacks interferon responsive elements (ISRE) or
gamma activated sequences (GAS) in its promoter region characteristic of
67
classical ISGs. In order for IFNβ to be expressed several transcription factors
including ATF/c-JUN, NFκB (p50/RelA), IRF-3 and/or IRF-7 must converge
at the IFNβ promoter region to form an enhanceosome facilitating chromatin
rearrangement in order to promote IFNβ gene transcription (Panne 2008).
IRF-3 is constitutively expressed by most cell types however IRF-7
expression is largely restricted to dendritic cells and B cells (Dai et al. 2004;
Izaguirre et al. 2003) and can be induced in other cell types by IFNαβ. These
transcription factors are directly downstream of PAMP-receptors (Fig. 3.1)
and both require virus-induced phosphorylation in order to translocate to the
nucleus (Levy et al. 2002; Sato et al. 1998), ensuring only cells that have
encountered virus or viral products produce IFNβ. Furthermore IRF-7 is
dispensable for IFNβ induction in response to West Nile virus (WMV)
infection in the murine CNS although it is relevant to IFNα expression (Daffis
et al. 2008). Several other additional mechanisms ensure IFNβ expression is
a tightly limited event, including the short half-life of the IFNβ message (~45
minutes) (Peppel and Baglioni 1991), the short half-life of IRF-7 protein
(Prakash and Levy 2006), and the expression of a soluble IFNαβ-receptor 2
chain that also exhibits binding of extracellular IFNβ (Hardy et al. 2001) as
well as immediate upregulation of several negative regulators including
suppressors of cytokine signaling (SOCS) molecules (Yoshimura et al.
2004).
68
The so called “priming” effect of interferons is primarily a feature of the
IFNα family in pDC biology (Fitzgerald-Bocarsly 2002). Several IFNαs can
promote their own expression especially in pDCs including IFNα1 (Izaguirre
et al. 2003). However IFNα1 is only weakly anti-viral and appears to play
other roles in modulating pDC activity including maturation and migration
(Asselin-Paturel et al. 2005). Other aspects of interferon “priming” maybe
misconstrued given PAMP-receptors are also strongly interferon inducible,
which was also demonstrated during JHMV infection (Fig. 3.5 & 3.6)
(McKimmie et al. 2005; Miettinen et al. 2001). This feature of the interferon
response allows infected and neighboring cells to be more sensitive to
PAMPs in order to more readily produce IFNβ but this does not negate their
requirement for PAMP-receptor signaling to drive IFNβ expression.
The striking finding that oligodendroglia did not induce IFNαβ despite
their increasing viral burden contradicts the hypothesis suggesting IFNαβ
production by oligodendroglia is driving auto-reactive responses against
them (Lipton et al. 2007). It is also unclear why oligodendroglia fail to induce
IFNαβ in this setting. Their expression of a limited repertoire of PAMP-
receptors suggests oligodendroglia may not possess the appropriate
machinery to recognize JHMV infection while other cells, most notably
microglia, are capable of doing so. This is also supported by in vitro studies
suggesting vRNA is sequestered and TLR3, Mda5, and RIG-I pathways are
insufficient for detecting MHV infection (Versteeg et al. 2007; Zhou and
69
Perlman 2007). Alternatively IFNαβ expression may be actively antagonized
by virus (Ye et al. 2007), although the expression of IFNβ by other cell types
including CD45
-
, O4
-
resident glia suggests such antagonism can be
overcome. Furthermore the failure of oligodendroglia to induce IKKε, that
acts downstream of PAMP-receptors, also suggests these pathways are not
activated.

Oligodendroglia exhibit limited ISG expression characterized by the lack of
IKKε.
Nevertheless oligodendroglia responded to exogenous IFNαβ as
indicated by the upregulation of Mda5 and RIG-I transcripts that was
abolished in oligodendroglia lacking the IFNαβ receptor (Fig. 3.6). The recent
identification of IKKε involvement in JAK/STAT mediated IFNαβ signaling
offers an intriguing mechanism behind the limited expression of ISGs by
mature oligodendroglia resulting in a potentially inadequate anti-viral state.
While influenza is cleared from wild type mice, IKKε knock-out mice are
unable to clear influenza infection despite similar expression of IL-2, IL-6, IL-
12, IFNγ and RANTES and antibody responses (Tenoever et al. 2007).
Unlike STAT1
-/-
mice that are completely incapable of inducing ISGs, IKKε
-/-

mice only lack the induction of ~30% of ISGs (Durbin et al. 1996; Tenoever
et al. 2007).
70
Evaluation of ISGs expressed by mature oligodendroglia supports an
IKKε-independent IFNαβ response (summarized in Table 7.1). This was
characterized by the induction of IKKε-independent ISGs including Ifit2 as
well as Mda5 (Fig. 3.5 & 3.6) while dependent ISGs were not upregulated by
oligodendroglia during this infection, namely ADAR1 (Fig. 3.7) and TLR3
(Fig. 3.5). Retrospective evaluation of ISGs described as specifically
expressed by oligodendroglia during this viral infection include STAT1
(Gonzalez et al. 2005) and Tap1 (Malone et al. 2008) are also identified as
IKKε-independent ISGs (Tenoever et al. 2007). This suggests
oligodendroglia may not achieve an adequate anti-viral state and implies this
is an underlying cause of persistent infection in these cells. However more
extensive profiling of ISG expression by oligodendroglia during JHMV
infection and experiments involving restoration of this pathway in
oligodendroglia are required to support this hypothesis.
71
Chapter 3 References
Asselin-Paturel C, Brizard G, Chemin K, Boonstra A, O'Garra A, Vicari A,
Trinchieri G. 2005. Type I interferon dependence of plasmacytoid
dendritic cell activation and migration. J Exp Med 201(7):1157-67.
Baudoux P, Carrat C, Besnardeau L, Charley B, Laude H. 1998. Coronavirus
pseudoparticles formed with recombinant M and E proteins induce
alpha interferon synthesis by leukocytes. J Virol 72(11):8636-43.
Bergmann CC, Ramakrishna C, Kornacki M, Stohlman SA. 2001. Impaired T
cell immunity in B cell-deficient mice following viral central nervous
system infection. J Immunol 167(3):1575-83.
Bsibsi M, Ravid R, Gveric D, van Noort JM. 2002. Broad expression of Toll-
like receptors in the human central nervous system. J Neuropathol
Exp Neurol 61(11):1013-21.
Cervantes-Barragan L, Zust R, Weber F, Spiegel M, Lang KS, Akira S, Thiel
V, Ludewig B. 2007. Control of coronavirus infection through
plasmacytoid dendritic-cell-derived type I interferon. Blood
109(3):1131-7.
Dai J, Megjugorac NJ, Amrute SB, Fitzgerald-Bocarsly P. 2004. Regulation
of IFN regulatory factor-7 and IFN-alpha production by enveloped
virus and lipopolysaccharide in human plasmacytoid dendritic cells. J
Immunol 173(3):1535-48.
de Lang A, Baas T, Teal T, Leijten LM, Rain B, Osterhaus AD, Haagmans
BL, Katze MG. 2007. Functional genomics highlights differential
induction of antiviral pathways in the lungs of SARS-CoV-infected
macaques. PLoS Pathog 3(8):e112.
Durbin JE, Hackenmiller R, Simon MC, Levy DE. 1996. Targeted disruption
of the mouse Stat1 gene results in compromised innate immunity to
viral disease. Cell 84(3):443-50.
Fitzgerald-Bocarsly P. 2002. Natural interferon-alpha producing cells: the
plasmacytoid dendritic cells. Biotechniques Suppl:16-20, 22, 24-9.
Garlinghouse LE, Jr., Smith AL, Holford T. 1984. The biological relationship
of mouse hepatitis virus (MHV) strains and interferon: in vitro induction
and sensitivities. Arch Virol 82(1-2):19-29.
72
Gonzalez JM, Bergmann CC, Fuss B, Hinton DR, Kangas C, Macklin WB,
Stohlman SA. 2005. Expression of a dominant negative IFN-
gammareceptor on mouse oligodendrocytes. Glia 51(1):22-34.
Hardy MP, Owczarek CM, Trajanovska S, Liu X, Kola I, Hertzog PJ. 2001.
The soluble murine type I interferon receptor Ifnar-2 is present in
serum, is independently regulated, and has both agonistic and
antagonistic properties. Blood 97(2):473-82.
Hemmi H, Kaisho T, Takeuchi O, Sato S, Sanjo H, Hoshino K, Horiuchi T,
Tomizawa H, Takeda K, Akira S. 2002. Small anti-viral compounds
activate immune cells via the TLR7 MyD88-dependent signaling
pathway. Nat Immunol 3(2):196-200.
Hoebe K, Du X, Georgel P, Janssen E, Tabeta K, Kim SO, Goode J, Lin P,
Mann N, Mudd S and others. 2003. Identification of Lps2 as a key
transducer of MyD88-independent TIR signalling. Nature
424(6950):743-8.
Ireland DD, Stohlman SA, Hinton DR, Atkinson R, Bergmann CC. 2008. Type
1 Interferons are Essential in Controlling Neurotropic Coronavirus
Infection Irrespective of Functional CD8 T Cells. J Virol 82(in press).
Isaacs A, Lindenmann J. 1957. Virus interference. I. The interferon. Proc R
Soc Lond B Biol Sci 147(927):258-67.
Izaguirre A, Barnes BJ, Amrute S, Yeow WS, Megjugorac N, Dai J, Feng D,
Chung E, Pitha PM, Fitzgerald-Bocarsly P. 2003. Comparative
analysis of IRF and IFN-alpha expression in human plasmacytoid and
monocyte-derived dendritic cells. J Leukoc Biol 74(6):1125-38.
Kato H, Sato S, Yoneyama M, Yamamoto M, Uematsu S, Matsui K,
Tsujimura T, Takeda K, Fujita T, Takeuchi O and others. 2005. Cell
type-specific involvement of RIG-I in antiviral response. Immunity
23(1):19-28.
Kumar H, Kawai T, Kato H, Sato S, Takahashi K, Coban C, Yamamoto M,
Uematsu S, Ishii KJ, Takeuchi O and others. 2006. Essential role of
IPS-1 in innate immune responses against RNA viruses. J Exp Med
203(7):1795-803.
Levy DE, Marie I, Smith E, Prakash A. 2002. Enhancement and
diversification of IFN induction by IRF-7-mediated positive feedback. J
Interferon Cytokine Res 22(1):87-93.
73
Lin MT, Hinton DR, Marten NW, Bergmann CC, Stohlman SA. 1999.
Antibody prevents virus reactivation within the central nervous system.
J Immunol 162(12):7358-68.
Lipton HL, Liang Z, Hertzler S, Son KN. 2007. A specific viral cause of
multiple sclerosis: one virus, one disease. Ann Neurol 61(6):514-23.
Malone KE, Stohlman SA, Ramakrishna C, Macklin W, Bergmann CC. 2008.
Induction of class I antigen processing components in oligodendroglia
and microglia during viral encephalomyelitis. Glia 56(4):426-35.
Matsumoto M, Funami K, Tanabe M, Oshiumi H, Shingai M, Seto Y,
Yamamoto A, Seya T. 2003. Subcellular localization of Toll-like
receptor 3 in human dendritic cells. J Immunol 171(6):3154-62.
McKimmie CS, Johnson N, Fooks AR, Fazakerley JK. 2005. Viruses
selectively upregulate Toll-like receptors in the central nervous
system. Biochem Biophys Res Commun 336(3):925-33.
Miettinen M, Sareneva T, Julkunen I, Matikainen S. 2001. IFNs activate toll-
like receptor gene expression in viral infections. Genes Immun
2(6):349-55.
Olson JK, Miller SD. 2004. Microglia initiate central nervous system innate
and adaptive immune responses through multiple TLRs. J Immunol
173(6):3916-24.
Panne D. 2008. The enhanceosome. Curr Opin Struct Biol 18(2):236-42.
Parra B, Hinton DR, Marten NW, Bergmann CC, Lin MT, Yang CS, Stohlman
SA. 1999. IFN-gamma is required for viral clearance from central
nervous system oligodendroglia. J Immunol 162(3):1641-7.
Peppel K, Baglioni C. 1991. Deadenylation and turnover of interferon-beta
mRNA. J Biol Chem 266(11):6663-6.
Platanias LC. 2005. Mechanisms of type-I- and type-II-interferon-mediated
signalling. Nat Rev Immunol 5(5):375-86.
Plumet S, Herschke F, Bourhis JM, Valentin H, Longhi S, Gerlier D. 2007.
Cytosolic 5'-triphosphate ended viral leader transcript of measles virus
as activator of the RIG I-mediated interferon response. PLoS ONE
2(3):e279.
Prakash A, Levy DE. 2006. Regulation of IRF7 through cell type-specific
protein stability. Biochem Biophys Res Commun 342(1):50-6.
74
Prehaud C, Megret F, Lafage M, Lafon M. 2005. Virus infection switches
TLR-3-positive human neurons to become strong producers of beta
interferon. J Virol 79(20):12893-904.
Randall RE, Goodbourn S. 2008. Interferons and viruses: an interplay
between induction, signalling, antiviral responses and virus
countermeasures. J Gen Virol 89(Pt 1):1-47.
Roth-Cross JK, Martinez-Sobrido L, Scott EP, Garcia-Sastre A, Weiss SR.
2007. Inhibition of the alpha/beta interferon response by mouse
hepatitis virus at multiple levels. J Virol 81(13):7189-99.
Sato M, Hata N, Asagiri M, Nakaya T, Taniguchi T, Tanaka N. 1998. Positive
feedback regulation of type I IFN genes by the IFN-inducible
transcription factor IRF-7. FEBS Lett 441(1):106-10.
Schindler C, Levy DE, Decker T. 2007. JAK-STAT signaling: from interferons
to cytokines. J Biol Chem 282(28):20059-63.
Schoenborn JR, Wilson CB. 2007. Regulation of interferon-gamma during
innate and adaptive immune responses. Adv Immunol 96:41-101.
Shif I, Bang FB. 1970. In vitro interaction of mouse hepatitis virus and
macrophages from genetically resistant mice. II. Biological
characterization of a variant virus MHV (C3H) isolated from stocks of
MHV(PRI). J Exp Med 131(4):851-62.
Smith AL, Barthold SW, Beck DS. 1987. Intranasally administered alpha/beta
interferon prevents extension of mouse hepatitis virus, strain JHM, into
the brains of BALB/cByJ mice. Antiviral Res 8(5-6):239-45.
Taguchi F, Siddell SG. 1985. Difference in sensitivity to interferon among
mouse hepatitis viruses with high and low virulence for mice. Virology
147(1):41-8.
Takeuchi O, Akira S. 2007. Recognition of viruses by innate immunity.
Immunol Rev 220:214-24.
Tenoever BR, Ng SL, Chua MA, McWhirter SM, Garcia-Sastre A, Maniatis T.
2007. Multiple functions of the IKK-related kinase IKKepsilon in
interferon-mediated antiviral immunity. Science 315(5816):1274-8.
Uematsu S, Akira S. 2007. Toll-like receptors and Type I interferons. J Biol
Chem 282(21):15319-23.

75
Versteeg GA, Bredenbeek PJ, van den Worm SH, Spaan WJ. 2007. Group 2
coronaviruses prevent immediate early interferon induction by
protection of viral RNA from host cell recognition. Virology 361(1):18-
26.
Virelizier JL, Gresser I. 1978. Role of interferon in the pathogenesis of viral
diseases of mice as demonstrated by the use of anti-interferon serum.
V. Protective role in mouse hepatitis virus type 3 infection of
susceptible and resistant strains of mice. J Immunol 120(5):1616-9.
Wang Q, Haluskey JA, Lavi E. 1998. Coronavirus MHV-A59 causes
upregulation of interferon-beta RNA in primary glial cell cultures. Adv
Exp Med Biol 440:451-4.
Yamamoto M, Sato S, Hemmi H, Hoshino K, Kaisho T, Sanjo H, Takeuchi O,
Sugiyama M, Okabe M, Takeda K and others. 2003. Role of adaptor
TRIF in the MyD88-independent toll-like receptor signaling pathway.
Science 301(5633):640-3.
Ye Y, Hauns K, Langland JO, Jacobs BL, Hogue BG. 2007. Mouse hepatitis
coronavirus A59 nucleocapsid protein is a type I interferon antagonist.
J Virol 81(6):2554-63.
Yoneyama M, Kikuchi M, Matsumoto K, Imaizumi T, Miyagishi M, Taira K,
Foy E, Loo YM, Gale M, Jr., Akira S and others. 2005. Shared and
unique functions of the DExD/H-box helicases RIG-I, MDA5, and
LGP2 in antiviral innate immunity. J Immunol 175(5):2851-8.
Yoneyama M, Kikuchi M, Natsukawa T, Shinobu N, Imaizumi T, Miyagishi M,
Taira K, Akira S, Fujita T. 2004. The RNA helicase RIG-I has an
essential function in double-stranded RNA-induced innate antiviral
responses. Nat Immunol 5(7):730-7.
Yoshimura A, Ohishi HM, Aki D, Hanada T. 2004. Regulation of TLR
signaling and inflammation by SOCS family proteins. J Leukoc Biol
75(3):422-7.
Zhou H, Perlman S. 2007. Mouse hepatitis virus does not induce Beta
interferon synthesis and does not inhibit its induction by double-
stranded RNA. J Virol 81(2):568-74.
Zuo J, Stohlman SA, Hoskin JB, Hinton DR, Atkinson R, Bergmann CC.
2006. Mouse hepatitis virus pathogenesis in the central nervous
system is independent of IL-15 and natural killer cells. Virology
350(1):206-15.

76
Chapter 4: Induction of MHC class I antigen processing components in
oligodendroglia and microglia during JHMV infection of the CNS

Chapter 4 Abstract
Glia exhibit differences in susceptibility to CD8 T-cell mediated
effector mechanisms during neurotropic coronavirus infection. In contrast to
microglia, oligodendroglia are resistant to CD8 T cell perforin-mediated viral
control in the absence of IFNγ. The kinetics of MHC class I expression by
microglia and oligodendroglia in vivo were analyzed to assess responses to
distinct inflammatory signals. Flow cytometry demonstrated delayed MHC
class I surface expression by oligodendroglia compared to microglia. Distinct
kinetics of MHC class I protein upregulation correlated with cell type specific
transcription patterns of genes encoding MHC class I heavy chains and
antigen processing components. Microglia isolated from naïve mice
expressed high levels of these mRNAs, while they were near detection limits
in oligodendroglia; nevertheless, MHC class I protein was undetectable on
both cell types. Infection induced modest mRNA increases in microglia, but
dramatic transcriptional upregulation in oligodendroglia coincided with IFNγ
mRNA increases in infected tissue. Ultimately mRNAs reached similar levels
in both cell types at their respective time points of maximal MHC class I
expression. Expression of MHC class I on microglia, but not oligodendroglia,
in infected IFNγ deficient mice supported distinct IFN requirements for MHC
class I presentation. These data suggest microglia possess an innate
77
immune preparedness in presenting antigen to engage CD8 T-cells early
following infection. The delayed, yet robust, IFNγ-dependent capacity of
oligodendroglia to express class I suggests strict control of immune
interactions to avoid CD8 T-cell recognition and potential presentation of
autoantigen, in order to preserve myelin maintenance.

Introduction
In the quiescent central nervous system (CNS), glia express little, if
any, detectable major histocompatibility complex (MHC) molecules on their
surface until exposed to inflammatory stimuli (Dorries 2001; Hickey 2001;
Wong et al. 1984). MHC class I antigen presentation is critical for CD8 T-cell
mediated control of viral infections, as secretion of anti-viral cytokines and
perforin mediated cytolysis require T cell receptor: MHC molecule
interactions (Slifka et al. 1999). T-cell effector functions are also associated
with pathologies and neurological abnormalities (Dorries 2001; Huseby et al.
2001; Ip et al. 2006). Consequently, T cell interactions with CNS glial cells
require stringent regulation to balance the positive aspects of antiviral activity
with the potential for detrimental immunopathological damage.
MHC class I surface expression is regulated at multiple levels
including proteolysis, peptide transport, and chaperone-aided complex
assembly. The majority of peptides presented by MHC class I molecules are
derived from proteasomal degradation of ubiquitin-tagged proteins in the
cytoplasm. Proteasomal specificities are conferred by three β-subunits
78
Figure 4.1 Schematic of peptide processing for class I presentation.
2
1
4
3
5
CD8
T cell
virus
immunoproteasome
Transporter/
chaperones
β2-microglobulin
MHC I heavy chain
Key steps in peptide
processing for class I
presentation.
1. Immunoproteasome-mediated
protein degradation.
2. Peptide transport to the ER
3. Chaperone-aided peptide
loading and complex formation
4. Class I & β2M complex
transport to the cell surface.
5. Stable peptide presentation on
the cell surface.

localized in the catalytic 20S core complex (Strehl et al. 2005). The
constitutive proteolytic subunits involved in homeostatic protein turnover can
be replaced by interferon (IFN) inducible proteosomal subunits type 8, 9 and
10 (PSMB8, PSMB9, PSMB10; also known as LMP7, LMP2, and MECL-10,
respectively) to form the immunoproteasome. Immunoproteosomes release
peptides with increased MHC class I binding affinities (Strehl et al. 2005).
Peptides are selectively shuttled from the cytoplasm into the endoplasmic
reticulum (ER) by the heterodimeric transporter associated with antigen
processing (TAP), formed by the TAP1 and TAP2 subunits (Garbi et al.
2005). In the ER, chaperones aid in assembly of MHC class I heavy chains,
peptides and β2-microglobulin (β2M) to form a stable complex capable of
trafficking to the cell surface (Garbi et al. 2005). Several antigen processing
components, immunoproteosomes and TAP are encoded in the MHC class I
79
locus and are inducible by both IFNα/β and IFNγ (Jamaluddin et al. 2001;
Paulsson 2004).
Consistent with sparse MHC class I expression, the CNS expresses
minimal antigen processing associated proteins compared to peripheral
organs and lymphoid tissues (Fruh et al. 1992; Stohwasser et al. 1997).
However, inflammatory stimuli rapidly induce class I expression on microglia
in vitro and in vivo, coincident with upregulation of antigen processing
components (Bailey et al. 2006; Stohwasser et al. 2000). Similar to microglia,
IFNγ stimulates MHC class I expression on oligodendroglia in vitro and in
vivo (Popko and Baerwald 1999; Sedgwick and Hickey 1997). By contrast,
oligodendroglia specific transgenic expression of MHC class I heavy chains
leads to ER accumulation and severe myelination defects (Baerwald et al.
2000; Power et al. 1996; Turnley et al. 1991). This suggests basal levels of
the antigen processing machinery in oligodendroglia are insufficient to deliver
peptides for MHC class I assembly and egress from the ER. The regulation
of MHC class I antigen processing components by oligodendroglia is not only
of interest in elucidating their role as targets of anti-microbial CD8 T cells, but
also of self reactive CD8 T cells in autoimmune diseases, such as multiple
sclerosis (Huseby et al. 2001; Sun et al. 2001). Stringently regulated MHC
class I expression is also important in prolonging survival of oligodendroglia
grafts for therapeutic remyelination approaches (Tepavcevic and Blakemore
2006).
80
The present study investigated the regulation of MHC class I antigen
presentation components in oligodendroglia and microglia in a model of
neurotropic coronavirus induced encephalomyelitis (Bergmann et al. 2006).
Acute viral replication in the CNS is controlled by CD8 T-cells, consistent with
MHC class I expression on all glia (Bergmann et al. 2003; Hamo et al. 2007;
Ramakrishna et al. 2006; Redwine et al. 2001). Microglia and astrocytes, but
not oligodendroglia are susceptible to perforin-mediated CD8 T-cell viral
control in the absence of IFNγ. By contrast, IFNγ is required to control virus in
oligodendroglia (Gonzalez et al. 2006; Lin et al. 1997; Parra et al. 1999).
Whether IFNγ has a direct antiviral effect or enhances MHC class I antigen
presentation by oligodendroglia is unclear. Delayed MHC class I upregulation
on astrocytes compared to microglia in this viral model presents a
precedence for differential regulation of MHC class I antigen presentation
(Hamo et al. 2007).
MHC class I antigen presentation by oligodendroglia and microglia
was compared using flow cytometry and gene expression analysis of cells
isolated from the CNS of infected mice. Despite undetectable MHC class I
protein, naïve microglia expressed significantly higher basal levels of mRNAs
encoding MHC class I antigen presentation components compared to
oligodendroglia. Following infection, delayed MHC class I expression by
oligodendroglia compared to microglia correlated with a requirement for IFNγ
and de novo transcription of MHC genes required for antigen presentation.
81
By contrast, microglia only moderately upregulated mRNAs encoding antigen
presentation machinery, yet expressed MHC class I protein earlier and
independent of IFNγ. These results demonstrate more stringent regulation of
the class I antigen presentation pathway by oligodendroglia compared to
microglia during CNS inflammation.

Results
Oligodendroglia exhibit delayed MHC class I expression compared to
microglia.
Brain and spinal cords of uninfected and MHV-JHM infected PLP-GFP
mice were analyzed by flow cytometry to compare expression of MHC class I
molecules by oligodendroglia and microglia over the course of acute viral
infection. No MHC class I expression was detected on naïve microglia or
oligodendroglia from the brain or spinal cord (Fig. 4.2A). By day 5 post
infection (p.i.), 89% or more of microglia expressed MHC class I in the CNS
(Fig. 4.2A). By stark contrast, only 53% and 29% of oligodendroglia
expressed MHC class I in the brain and spinal cord, respectively. However,
MHC class I expression on oligodendroglia increased rapidly thereafter
reaching 96 % by day 7 p.i. in the CNS. The populations of MHC class I
expressing microglia and oligodendroglia declined by day 10 yet remained
elevated throughout day 14 p.i. This pattern of earlier MHC class I
expression on microglia than oligodendroglia was similar between the brain
and spinal cord and consistent in multiple experiments (Figure 4.2B). These
82
Figure 4.2. Delayed MHC class I expression on oligodendroglia
compared to microglia during infection. Glial cells from brains and spinal
cords of naive or infected PLP-GFP mice analyzed for CD45 and MHC class
I (clone 28-14-8) expression by flow cytometry at the indicated days p.i. (A)
Kinetics of class I expression on microglia (left panels) and oligodendroglia
(right panels) shown in density plots in the brain (left column) compared to
the spinal cord (right column). Numbers in the upper quadrant represent
percentages of glia expressing class I. (B) Mean percentages of class I
expressing cells with standard deviations derived from two to three separate
experiments.
83
0%
20%
40%
60%
80%
100%
3 5 7 10 14
% Class I +
Microglia Oligodendroglia
A
H2-D
b

Naive
D 14 D 10 D 7 D 5
61%
55% 48%
Brain Spinal Cord
H2-D
b

B
<2%
Microglia Oligodendroglia
68% 62%
Microglia Oligodendroglia
98%
66% 67%
89% 53%
97%
<2%
99% 29%
97% 96%
55%
0%
20%
40%
60%
80%
100%
3 5 7 10 14
% Class I +
Microglia Oligodendroglia
Days post infection Days post infection
Figure 4.2
84
data implicated microglia as primary glial targets for CD8 T cells early during
infection.

Naïve glia express disparate levels of mRNA encoding class I and antigen
processing components

Delayed MHC class I surface expression by oligodendroglia during
viral encephalomyelitis could be due to an initial absence or low abundance
of antigen processing components relative to microglia. To assess basal
transcript levels of genes required for MHC class I peptide presentation,
oligodendroglia and microglia were FACS purified from spinal cords of naïve
mice. Both glial populations expressed similar levels of Gapdh transcripts
per cell when compared to J774A.1 macrophages (Fig. 4.3A). Furthermore,
the ratio of Gapdh mRNA levels per number of purified cells was consistent
throughout infection (data not shown). These data confirmed Gapdh as a
stable reference gene, whose mRNA levels were not affected by alterations
in the CNS environment due to inflammation. Although microglia from naïve
mice did not express detectable MHC class I protein, MHC class I heavy
chain transcripts were expressed at levels similar to J774A.1 macrophages
(Fig. 4.3B), which constitutively express surface MHC class I molecules. By
contrast, oligodendroglia within the naïve CNS expressed ten times lower
levels of these transcripts compared to microglia or J774A.1 cells.
85
0.01
0.1
1
10
100
Psmb9
0
20
40
60
80
100
120
140
Psmb5
**
** *
*
Transcript ratio
compared to J774.1
cells
0
0.2
0.4
0.6
0.8
1
1.2
Gapdh
A
0
50
100
150
200
250
H2-D/L
0.01
0.1
1
10
Tap1
**
**
*
***
B
Transcripts relative to Gapdh
J774.1 Microglia Oligodendroglia
Similarly, naïve microglia expressed comparable levels of Tap2 and
Psmb8 encoding mRNA as J774A.1 cells, whereas these transcripts were
barely detectable in naïve oligodendroglia. The relative levels of β2M, Tap1,
and Psmb9 mRNAs were similar to MHC class I heavy chain, Tap2, and
Psmb8 mRNAs in each glial cell type, respectively (data not shown).

Figure 4.3. Disparate basal
levels of MHC class I
antigen presentation
associated transcripts in
microglia and
oligodendroglia derived
from naïve mice. Microglia
and oligodendroglia were
purified by FACS from spinal
cords of naïve mice and
mRNA analyzed by real time
RT-PCR. (A) Comparative
analysis of transcript levels
encoding the housekeeping
gene Gapdh. Data are
standardized to Gapdh mRNA
levels obtained from J774 A.1
cells. (B) Transcript levels
encoding MHC class I (H2-
D/L), antigen processing
components (Tap2 and
Psmb8) and the constitutive
proteasomal subunit Psmb5
in microglia and
oligodendroglia compared to
J774A.1 cells relative to
Gapdh. Values are the
average of three independent
experiments with standard
deviation. Asterisks denote p
values; ***, **, and * indicate
p<0.001, p<0.005, p<0.05,
respectively.
86
Transcripts encoding the constitutive proteasomal subunit Psmb5, not
encoded at the MHC locus, were analyzed to evaluate the overall
proteasomal degradation capacities in the glial subsets. Basal levels of
Psmb5 transcripts were present at similar levels in naïve microglia and
oligodendroglia, though both were lower than Psmb5 transcript levels in
J774.1 cells (Fig. 4.3B).
Figure 4.4. Absence of
intracellular MHC class I
expression by naïve
microglia. Microglia were
analyzed for intracellular
accumulation of MHC class I
molecules following monesin
treatment for 6 hours. MHC
class I expressing J774 A.1
cells and antigen processing
defective T2-L
d
cells were
included as positive
controls. Left column:
Histograms depicting
surface class I (anti-H2-
L
d
/D
b
, clone 28-14-8)
expression (shaded lines)
compared to isotype control
staining (anti-H2-K
k
, clone
36-7-5) following monesin
treatment. Anti-H2-L
d
/D
b

antibody blocks MHC class I
detection (solid gray line).
Right column: Histograms
depicting intracellular MHC
class I (anti-H2-L
d
/D
b
)
expression (shaded lines)
compared to isotype control
(anti-H2-K
k
, dashed line) in permeabilized cells. Unconjugated anti-H2-L
d
/D
b

antibody was used to block cell surface detection prior to permeabilization
(solid gray line).

Intracellular Surface
Naïve Microglia
MHC Class I (H2-L
d
/D
b
)
T2-L
d
J774A.1
87
Naïve microglia do not express intracellular MHC class I protein.
MHC class I and antigen processing proteins are barely detectable in
naïve brains by flow cytometry, western blot (Fruh et al. 1992) or
immunohistochemistry (Fuss et al. 2001). The relative abundance of these
transcripts in microglia suggests post-transcriptional repression of MHC class
I antigen presentation. To confirm a block in translation rather than ER
retention of MHC class I in naïve microglia, intracellular retention of H2- D
b

was examined using a D
b
and L
d
cross-reactive monoclonal antibody (Fig.
4.4). Antigen processing deficient T2-L
d
cells were used as a control for
intracellular accumulation of unassembled MHC class I in the ER and
negligible surface staining. J774A.1 cells were used as a positive control for
both surface and intracellular MHC class I expression. Surface staining
confirmed undetectable expression of MHC class I on microglia, sparse
expression on T2-L
d
cells and prominent expression on J774A.1 cells (Fig.
4.4). Accumulation of intracellular MHC class I was analyzed following
monensin treatment to block the secretory pathway. Detection of surface
expression was blocked by pre-incubation with unlabeled mAb to maintain
similar conditions (Fig. 4.4). Under these conditions, intracellular MHC class I
remained undetectable in naïve microglia. By contrast T2-L
d
cells exhibited
robust intracellular accumulation of MHC class I molecules. J774A.1 cells
also accumulated intracellular MHC class I, albeit at lower levels compared
to T2-L
d
cells. Similar results were obtained in two additional independent
experiments in the absence of monensin treatment. These data suggest that
88
the inability of naïve microglia to express MHC class I complexes (Fig. 4.2),
despite abundant transcripts encoding all the necessary components (Fig.
4.3), is the result of translational repression rather than a post-translational
block.
MHC class I surface expression correlates with upregulation of mRNAs
encoding MHC class I antigen presentation components.
To assess a correlation between MHC class I surface expression and
transcriptional upregulation of genes required for MHC class I assembly and
transport, microglia and oligodendroglia were purified from brains and spinal
cords over the course of infection. Microglia exhibited a clear increase in
mRNAs encoding class I, β2M, Tap1 and inducible proteasomal subunits
Psmb8 and Psmb9 at day 5 p.i. (Fig. 4.5 & 4.6). The respective mRNA
levels dropped thereafter, but remained elevated through day 10 p.i. Tap2
transcripts did not change more than 2-fold in microglia throughout infection
(Fig. 4.5 & 4.6). Although levels of mRNAs encoding MHC class I heavy
chains and the antigen processing components were only increased by 5-10
fold at their peak relative to naïve microglia, peak mRNA accumulation at day
5 p.i. coincided with maximal MHC class I surface expression (Fig. 4.2).
These data suggest rapid MHC class I expression by microglia is due to both
a release from translational repression and transcriptional activation.

89
0%
20%
40%
60%
80%
100%
0 3 5 7 10
0%
20%
40%
60%
80%
100%
0%
20%
40%
60%
80%
100%
0%
20%
40%
60%
80%
100%
Naïv e 3 5 7 10
0%
20%
40%
60%
80%
100%
Days post infection
Brain Spinal Cord
Oligodendroglia Microglia
β β β β2M
H2-D
H2-D
0%
20%
40%
60%
80%
100%
Tap1 Tap1 Tap2
0%
20%
40%
60%
80%
100%
Tap2
Psmb8
Psmb8
Psmb9
Naïve 3 5 7 10 Naïve 3 5 7 10 Naïve 3 5 7 10
Psmb9
Naïve 3 5 7 10
Relative to Peak Induction
β β β β2M
Figure 4.5. Cell-type specific regulation of MHC class I antigen processing genes. Microglia and oligodendroglia were purified by
FACS from naïve or infected murine brains and spinal cords at different days p.i. and the levels of mRNA encoding MHC class I (H2-D),
β2-microglobulin (β2M), peptide transporter units (Tap1 and Tap2) and inducible proteasomal subunits (Psmb8 and Psmb9) were
calculated relative to Gapdh. Peak transcript levels were set to 100% for each cell type in two independent timecourse studies. Bars
represent the average percentage of peak expression for each cell type with standard deviation.

90
Figure 4.6 Transcript levels for MHC class I pathway genes in microglia
and oligodendroglia from the spinal cord during infection. Data from
figure 4.5 is depicted as respective transcript levels relative to Gapdh for
purified oligodendroglia or microglia from the spinal cord. Data is
representative of two independent experiments.

Oligodendroglia exhibited drastically different patterns of mRNA
upregulation over the course of infection (Fig. 4.5 & 4.6). Transcripts
encoding β2M, MHC class I heavy chain, Tap1/2 and Psmb8/9 in
oligodendroglia were notably increased in the brain and not the spinal cord at
day 5 p.i, with all peaking at day 7 p.i. Individual transcripts encoding MHC
0
200
400
600
800
1000
1200
1400
0 3 5 7 10
H2-D
0
1000
2000
3000
4000
0 3 5 7 10
β2M
0
5
10
15
20
25
0 3 5 7 10
0
10
20
30
40
50
60
0 3 5 7 10
Tap1 Tap2
0
50
100
150
200
250
300
0 3 5 7 10
Psmb9
0
5
10
15
20
25
0 3 5 7 10
Psmb8
Transcripts relative to Gapdh
days post infection
Microglia Oligodendroglia

91
class I processing components reached comparable maximal levels in both
cell types, with the exception of Tap2 mRNA (Fig. 4.6). In two independent
experiments peak expression of the respective mRNAs relative to Gapdh
differed less than 3-fold between the two cell types (Fig. 4.6). After day 7 p.i.,
all mRNAs declined in oligodendroglia, but remained elevated relative to
basal levels through day 10 p.i. (Fig. 4.5 & 4.6). Relative to basal levels,
virus-triggered inflammation induced at least 200 -1000 fold overall increases
in the mRNA populations in oligodendroglia compared to modest 5-10 fold
increases in microglia. The most potent increase was observed for MHC
class I mRNA, reaching 1300 and 5000-fold values relative to baseline levels
in two separate experiments. This dramatic increase in RNA accumulation
coincided with expression of MHC class I molecules on the surface of
oligodendroglia in both the brain and spinal cord (Fig. 4.2) and suggests de
novo transcriptional activation of genes encoding MHC class I presentation
components.

Transcriptional control of the MHC class I pathway is coordinated by shared
promoter elements related to IFN signaling.

The murine MHC locus is located on chromosome 17 and includes
genes encoding classical and non-classical MHC class I heavy chains as
well as several proteasomal subunits, transporters and chaperones (Fig.
4.7A). These genes are arranged in a tight neighborhood; Tap1 & Psmb9

92
even share their promoter region that operates bi-directionally (Fig 4.7A).
However, nearly half of the known genes involved in the MHC class I
pathway are not located at this locus, but scattered across the genome (Fig.
4.7B). These genes include additional proteasomal subunits (Psmb10),
proteasomal activators, interferon-inducible di-ubiquitin, and the ER
aminopeptidase (Arts1). Despite the dispersal of these genes they share
transcription factor binding sites for interferon signaling and can be clustered
according to their function (Fig. 4.7C). For example, genes involved in the
formation of the immunoproteasome contain multiple signal transduction and
transcription (STAT) sites, with the exception of Psmb10.
Promoters for the MHC class I heavy chains (H2-K & H2-L) contain
repeated NfκB sites followed by an interferon-stimulated response element
(ISRE). This arrangement is termed the “MHC enhanceasome” and is
conserved among the murine and human heavy chain promoters (Howcroft
and Singer 2003). Surprisingly, the murine β2M promoter appears divergent
from its human orthologue (Fig. 4.7E). While the human β2M promoter also
contains the MHC enhanceasome sequence, the murine β2M promoter lacks
both ISRE and IRF elements. Interestingly its upregulation also appears
earlier in oligodendroglia, particularly in the spinal cord (Fig. 4.5 & 4.6),
suggesting it is less tightly regulated by interferons than other MHC class I
related genes.

93
Figure 4.7 Transcription of MHC class I-related genes is coordinated
via shared promoter elements. (A) MHC locus depicted in an ideogram of
murine chromosome 17 with magnification of the Psmb/Tap neighborhood.
(B) Table summarizing genomic locale of known genes involved in MHC
class I processing and presentation. (C) In silico analysis of transcription
factor-binding sites located in the promoter regions of MHC class I-related
genes. (D) Consensus sequence logo for conserved IRF-1/2 element found
in APM genes. (E) Divergence between the murine and human β2-
microglobulin promoter regions.

94
Figure.4.7
B A
C
MHC Locus
Other class I related genes are located outside the MHC locus
Conserved arrangement of IFN-related promoter
elements in class I gene promoters
D
E
Gene Name ID Description Locus Reference
Ubiquitin D Ubd Ubiquitin-mediated
proteolysis
17 B3 Fan et al 1996
PA28α Psme1 Proteosomal
Activator
14 C2-
D1
Jiang et al 1997
PA28β Psme2 Proteosomal
Activator
14 C2-
D1
Jiang et al 1997
Psmb8 Psmb8 Inducible proteosomal
subunit
17 B1 Kelly et al 1991
Psmb9 Psmb9 Inducible proteosomal
subunit
17 B1 Glynn et al 1991
Psmb10 Psmb10 Inducible proteosomal
subunit
8 D3 Nandi et al 1996
Tap1 Tap1 Transport subunit 17 B1 Deverson et al 1990
Tap2 Tap2 Transport subunit 17 B1 Deverson et al 1990
Tapasin Tapbp Chaperone 17 B1 Sadasivan et al 1996
ER
aminopeptidase
Arts1 Peptide trimming 13 C1 Serwold et al 2001
β2-microglobulin B2m Surface complex
subunit
2 F1-F3 Peterson et al 1974,
Poulik et al 1973
H2-D H2-D1 MHC heavy chain 17 B1
H2-L H2-L MHC heavy chain 17 B1
H2-K H2-K1 MHC heavy chain 17 B1

95
Distinct from the heavy chain promoters, all other genes involved in
peptide processing contain a highly conserved interferon regulatory factor
(IRF) site (Fig. 4.7C & D) (Brucet et al. 2004). The critical role of IRF-1 in
controlling the MHC class I presentation pathway was demonstrated by low
levels of MHC class I expression in IRF-1
-/-
mice (Hobart et al. 1997). IFNαβ
and IFNγ directly activate MHC class I transcription via JAK/STATs or
indirectly via IRF-1 induction.

Figure 4.8. Kinetics of IRF-
1/2 mRNA upregulation
following infection. (A & B)
Interferon regulatory factor 1
(IRF-1) and interferon
regulatory factor 2 (IRF-2)
transcript levels relative to
Gapdh in purified microglia and
oligodendroglia at the indicated
time p.i. for one of two
experiments. (C) Average and
standard deviation of IRF-
1:IRF-2 ratios in microglia and
oligodendroglia from two
independent experiments.
To consider upstream
0
100
200
300
400
0 3 5 7 10 14
0
1
2
3
4
5
0 3 5 7 10 14
Microglia Oligodendroglia
0
200
400
600
800
1000
1200
0 3 5 7 10 14
Days post infection
A
Transcript
relative to Gapdh
C
IRF-1:IRF-2
transcript ratio
Microglia
IRF-1
Transcript
relative to Gapdh
Days post infection
IRF-2
Oligodendroglia
B

96
events in MHC gene transcription initiation, transcripts encoding IFN
regulatory factor 1 (IRF-1) and its antagonist, IFN regulatory factor 2 (IRF-2)
were measured in purified glia populations (Kroger et al. 2002). IRF-1 mRNA
was detectable in microglia from naïve mice, but near detection limits in
oligodendroglia, whereas both naïve glia expressed relatively higher levels of
IRF-2 transcripts (Fig. 4.8A & B). Following infection, IRF-1 transcripts
increased to peak levels at days 5 and 7 p.i. in microglia and oligodendroglia,
respectively. Whereas the IRF-1 mRNA increases were ~10-fold in microglia
and greater than 1000-fold in oligodendroglia relative to basal levels, IRF-2
levels in both cell types only changed 2-3 fold (Fig. 4.8A & B). As a result,
IRF-1 mRNA increased 3-4 fold over IRF-2 levels in both cell types (Fig.
4.8C). Peak increases in IRF-1mRNA levels coincided with peak levels of
transcripts encoding antigen processing components. These data suggest
oligodendroglia preferentially amplify IFNγ mediated signals via the IRF-1
pathway.

Cell-specific induction of MHC class I is associated with different IFNs.
The strikingly different patterns of MHC class I related gene
expression in microglia compared to oligodendroglia suggests distinct
responsiveness to inflammatory events. Given the importance of interferon
signaling in regulating the MHC class I pathway, and the kinetics of IFNα/β
and IFNγ induction in this model of viral infection, interferon responses were
investigated as prime candidates promoting expression of MHC genes.

97
First, the parallel kinetics of MHC class I expression on
oligodendroglia and induction of IFNγ during infection suggested a direct
relationship. To assess if IFNγ is required for MHC class I expression by
oligodendroglia, IFNγ
-/-
mice were infected with MHV-JHM. In the absence
of IFNγ, oligodendroglia did not express MHC class I on their surface during
the acute infection (Fig. 4.9). By contrast, microglia of both the brain and
spinal cord, were still capable of expressing MHC class I as early as day 5
p.i. in mice deficient for IFNγ and reached levels comparable to wild type by
day 7p.i. (Fig. 4.2 & 4.9). These data demonstrate that oligodendroglia
require IFNγ for MHC class I expression and support an IFNγ-independent
signal in regulating MHC class I antigen presentation by microglia (Bergmann
et al. 2003).
While microglia were still capable of expressing MHC class I in the
absence of IFNγ, consideration as to the role of Type I IFNs in inducing early
class I expression on microglia was evaluated in IFNαβR
-/-
mice. Microglia
from these mice exhibited only a slight delay in MHC class I expression as
compared to wild type (Fig. 4.2 & 4.9) demonstrating IFNαβ signaling is not
required for microglial expression of MHC class I, similar to previous findings
(Ireland et al. 2008a). The delay in early MHC class I expression at day 5 p.i.
suggests IFNαβ is an early cue for microglia, however the compensatory
augmentation of IFNγ in these mice masks any subtle contribution of IFNαβ
in this regard. Still the lack of either type of interferon is not sufficient to

98
Figure 4.9 IFNγ γ γ γ dependent MHC class I expression on oligodendroglia.
Glial cells derived from brains or spinal cords of infected IFNαβR-/- and
IFNγ-/- (H-2
b
)

mice (pooled from n=3 per time point, per group) were
analyzed for MHC class I (clone 28-14-8) expression by flow cytometry at the
indicated days p.i. Cells were gated on CD45
lo
microglia and CD45
-
O4
+

oligodendroglia. Contour plots depict microglia and oligodendroglia
expressing MHC class I as gated on Ms IgG2a isotype control. Numbers
represent the percentage of glia expressing MHC class I. Day 7 p.i. for IFNγ-
/- mice was repeated in three independent experiments, with average and
standard deviation noted. Otherwise data are from a single experiment. N/A
denotes not available.

99

MHC Class I (H2-D
b
)
D 10 D 5
18%
Brain Spinal Cord
Microglia
28% 4%
Microglia Oligodendroglia
4%
75% 6% 71% 3%
1%
±13% ±4% ±8% ±3%
IFNγ -/- IFNαβR-/-
Microglia
86%
Oligodendroglia
IFNγ -/- IFNαβR-/-
91%
60%
Microglia
N/A
93%
N/A
D 7
2% 42% 3%
Figure 4.9

100
diminish expression of MHC class I by microglia, suggesting Type I or II IFN
signalling is capable of overcoming the loss of the other in this regard for
microglia. However this data cannot dismiss the potential role of other early
inflammatory mediators such as TNFα in inducing MHC class I expression by
microglia (Milner and Campbell 2003).

Discussion
The response of glia to infection, specifically their interaction with
infiltrating T cells, determines how T cell effector functions contribute to
microbial control and pathogenesis. The present data demonstrate more
stringent regulation of class I expression by oligodendroglia compared to
microglia during viral induced inflammation. Rapid class I expression by
microglia suggests they are the initial infected cells that interact with early
infiltrating virus specific CD8 T cells to trigger IFNγ secretion. This local IFNγ
in turn induces class I expression by oligodendroglia, which peaks coincident
with maximal IFNγ transcript levels and prominent T-cell infiltration into the
CNS (Marten et al. 2000b). The timing of these interactions is critical in
establishing a balance between viral spread and CD8 T cell mediated
control, as cytolysis is downregulated during the transition to viral persistence
(Bergmann et al., 2006) and IFNγ is crucial in controlling MHV-JHM
replication specifically in oligodendroglia (Bergmann et al. 2004; Gonzalez et
al. 2006; Parra et al. 1999).

101
The cell type specific MHC class I expression patterns were
associated with distinct levels of basal transcription of MHC genes, as well as
differences in the timing and magnitude of transcriptional upregulation. The
high basal levels of MHC class I transcripts in purified microglia, suggest they
are a source of MHC class I transcripts previously detected at low levels in
the naïve adult brain (Fahrner et al. 1987). MHC class I expression is
regulated at the transcriptional level with conserved promoter elements
determining both tissue specific expression as well as responsiveness to
cytokines and hormones (Howcroft and Singer 2003). Coordinated
transcriptional upregulation of MHC genes in both oligodendroglia and
microglia is consistent with similarities in their core promoter elements (Arons
et al. 2001; Brucet et al. 2004). Following MHV-JHM infection, increased
IRF-1 to IRF-2 mRNA ratios support IRF-1 as a primary candidate in
enhancing transcription of these genes. Upregulation of IRF-1 mRNA
coincided with early MHC class I expression by microglia, whereas IFNγ
mRNA expression correlated with accumulation of mRNAs encoding IRF-1
and antigen presentation components in oligodendroglia. IFNγ-dependent
MHC class I expression by oligodendroglia, but not microglia, was confirmed
by MHC class I expression patterns in infected IFNγ
-/-
mice.
The MHV-JHM model suggests the more rapid MHC class I
upregulation by microglia resides in an inherently increased responsiveness
to early inflammatory mediators and earlier transcriptional activation

102
compared to oligodendroglia. Delayed MHC class I expression by microglia
in MHV-JHM infected mice deficient in IFNαβ receptor signaling confirm
IFNαβ contributes to early MHC class I presentation by microglia (Ireland et
al. 2008a). In addition, the modest increases in mRNAs encoding antigen
presentation components in microglia support a stong contribution of
translational regulation. Post-transcriptional repression of MHC genes has
been observed in a variety of cancers, yet the mechanisms are unclear (Luo
et al. 1995; Ponzoni et al. 1993). Analysis of proteasomes from primary
microglia cultures derived from neonatal mice revealed low, yet detectable
protein levels of the immunoproteasome subunits PSMB9 and PSMB8
(Stohwasser et al. 2000), which were significantly increased following IFNγ
treatment. Although IFNαβ stimulation was not analyzed in the
aforementioned studies, the data support constitutive transcription of MHC
class I related genes in naïve microglia. Our data suggest that translational
repression of MHC associated transcripts, potentially released by IFNαβ
signaling, may constitute a provocative new mechanism regulating MHC
class I expression by microglia.
The modest overall increase of MHC encoded mRNAs in microglia
relative to oligodendroglia may reflect cell type specific integration of both
IFNαβ and IFNγ signals, or additional responses to other inflammatory
mediators in the CNS environment. The fact that microglia strongly
upregulate MHC class II expression in an IFNγ dependent manner (Ch 6)

103
(Bergmann et al. 2003), even in the absence of IFNαβ signals (Ireland et al.
2008a), suggests that IFNγ responsiveness is not impaired by IFNαβ pre-
conditioning. The apparent lack of additional IFNγ mediated transcription of
genes encoding MHC class I antigen presentation components may be due
to saturation at the promoter sites in microglia.
MHC class I expression by oligodendroglia required IFNγ stimulated
de novo transcription. The negligible levels of MHC class I related transcripts
in oligodendroglia derived from the naïve CNS are consistent with active
repression of MHC class I gene transcription by oligodendroglia-specific DNA
binding factors (Mavria et al. 1998). Low mRNA levels and undetectable
protein expression were also observed in unstimulated neonatal
oligodendroglia cultures (Massa et al. 1993). Although IFNαβ does not
appear to play a role in regulating class I antigen presentation by
oligodendroglia, other effects on oligodendroglia biology including induction
of antiviral pathways are also indicated (Ch.2). The delayed, yet prominent
increase in MHC class I related genes may result from synergistic stimulation
by IFNγ and TNFα (Agresti et al. 1998). This strict regulation suggests
deviation of cellular resources from myelin maintenance to host defense, a
notion consistent with IFNγ mediated induction of ER stress in
oligodendroglia and perturbation of remyelination (Lin et al. 2006).
Overall the stringent induction of MHC genes by oligodendroglia
implies a tendency to avoid CD8 T cell cytolysis and preserve myelin

104
maintenance and neuronal function. Nevertheless, as oligodendroglia are
myelin factories, it is feasible to assume they present myelin derived epitopes
during inflammation associated with IFNγ secretion. Indeed, MBP specific
CD8 T cells can recognize and lyse oligodendroglia in the absence of
exogenous peptide in vitro (Huseby et al. 2001). Similarly, CD8 T cell
inflammation induced by overexpression of PLP by oligodendroglia is
associated with class I expression on oligodendroglia and CNS damage (Ip
et al. 2006). Activation and clonal expansion of CD8 T cells in brain biopsy
samples and CSF of multiple sclerosis patients supports a role of local CNS
autoantigen presentation (Babbe et al. 2000; Jacobsen et al. 2002; Skulina et
al. 2004). Furthermore, although MHC class I and IRF-1 was prominently
expressed by activated microglia/macrophages in multiple sclerosis lesions,
both proteins were also localized to oligodendroglia (Gobin et al. 2001). In
vivo interactions between CD8 T cells and class I peptide complexes
presented by oligodendroglia have not been formally proven. However, the
potent transcriptional upregulation of MHC class I antigen presentation
components by oligodendroglia presented in this report clearly demonstrates
a potential for oligodendroglia to present myelin antigens. Still, the broad
sensitivity of microglia to early inflammatory cytokines implicates these cells
as targets for initial CD8 T-cell interactions.

105
Chapter 4 References
Agresti C, Bernardo A, Del Russo N, Marziali G, Battistini A, Aloisi F, Levi G,
Coccia EM. 1998. Synergistic stimulation of MHC class I and IRF-1
gene expression by IFN-gamma and TNF-alpha in oligodendrocytes.
Eur J Neurosci 10(9):2975-83.

Arons E, Kunin V, Schechter C, Ehrlich R. 2001. Organization and functional
analysis of the mouse transporter associated with antigen processing
2 promoter. J Immunol 166(6):3942-51.

Babbe H, Roers A, Waisman A, Lassmann H, Goebels N, Hohlfeld R, Friese
M, Schroder R, Deckert M, Schmidt S and others. 2000. Clonal
expansions of CD8(+) T cells dominate the T cell infiltrate in active
multiple sclerosis lesions as shown by micromanipulation and single
cell polymerase chain reaction. J Exp Med 192(3):393-404.

Baerwald KD, Corbin JG, Popko B. 2000. Major histocompatibility complex
heavy chain accumulation in the endoplasmic reticulum of
oligodendrocytes results in myelin abnormalities. J Neurosci Res
59(2):160-9.
Bailey SL, Carpentier PA, McMahon EJ, Begolka WS, Miller SD. 2006.
Innate and adaptive immune responses of the central nervous system.
Crit Rev Immunol 26(2):149-88.

Bergmann CC, Lane TE, Stohlman SA. 2006. Coronavirus infection of the
central nervous system: host-virus stand-off. Nat Rev Microbiol
4(2):121-32.

Bergmann CC, Parra B, Hinton DR, Chandran R, Morrison M, Stohlman SA.
2003. Perforin-mediated effector function within the central nervous
system requires IFN-gamma-mediated MHC up-regulation. J Immunol
170(6):3204-13.

Bergmann CC, Parra B, Hinton DR, Ramakrishna C, Dowdell KC, Stohlman
SA. 2004. Perforin and gamma interferon-mediated control of
coronavirus central nervous system infection by CD8 T cells in the
absence of CD4 T cells. J Virol 78(4):1739-50.

Brucet M, Marques L, Sebastian C, Lloberas J, Celada A. 2004. Regulation
of murine Tap1 and Lmp2 genes in macrophages by interferon
gamma is mediated by STAT1 and IRF-1. Genes Immun 5(1):26-35.

Dorries R. 2001. The role of T-cell-mediated mechanisms in virus infections
of the nervous system. Curr Top Microbiol Immunol 253:219-45.

106
Fahrner K, Hogan BL, Flavell RA. 1987. Transcription of H-2 and Qa genes
in embryonic and adult mice. Embo J 6(5):1265-71.

Fruh K, Yang Y, Arnold D, Chambers J, Wu L, Waters JB, Spies T, Peterson
PA. 1992. Alternative exon usage and processing of the major
histocompatibility complex-encoded proteasome subunits. J Biol
Chem 267(31):22131-40.

Fuss B, Afshari FS, Colello RJ, Macklin WB. 2001. Normal CNS myelination
in transgenic mice overexpressing MHC class I H-2L(d) in
oligodendrocytes. Mol Cell Neurosci 18(2):221-34.

Garbi N, Tanaka S, van den Broek M, Momburg F, Hammerling GJ. 2005.
Accessory molecules in the assembly of major histocompatibility
complex class I/peptide complexes: how essential are they for CD8(+)
T-cell immune responses? Immunol Rev 207:77-88.

Gobin SJ, Montagne L, Van Zutphen M, Van Der Valk P, Van Den Elsen PJ,
De Groot CJ. 2001. Upregulation of transcription factors controlling
MHC expression in multiple sclerosis lesions. Glia 36(1):68-77.

Gonzalez JM, Bergmann CC, Ramakrishna C, Hinton DR, Atkinson R,
Hoskin J, Macklin WB, Stohlman SA. 2006. Inhibition of interferon-
gamma signaling in oligodendroglia delays coronavirus clearance
without altering demyelination. Am J Pathol 168(3):796-804.

Hamo L, Stohlman SA, Otto-Duessel M, Bergmann CC. 2007. Distinct
regulation of MHC molecule expression on astrocytes and microglia
during viral encephalomyelitis. Glia 55(11):1169-77.

Hickey WF. 2001. Basic principles of immunological surveillance of the
normal central nervous system. Glia 36(2):118-24.

Hobart M, Ramassar V, Goes N, Urmson J, Halloran PF. 1997. IFN
regulatory factor-1 plays a central role in the regulation of the
expression of class I and II MHC genes in vivo. J Immunol
158(9):4260-9.

Howcroft TK, Singer DS. 2003. Expression of nonclassical MHC class Ib
genes: comparison of regulatory elements. Immunol Res 27(1):1-30.

Huseby ES, Liggitt D, Brabb T, Schnabel B, Ohlen C, Goverman J. 2001. A
pathogenic role for myelin-specific CD8(+) T cells in a model for
multiple sclerosis. J Exp Med 194(5):669-76.

107
Ip CW, Kroner A, Bendszus M, Leder C, Kobsar I, Fischer S, Wiendl H, Nave
KA, Martini R. 2006. Immune cells contribute to myelin degeneration
and axonopathic changes in mice overexpressing proteolipid protein in
oligodendrocytes. J Neurosci 26(31):8206-16.

Ireland DD, Stohlman SA, Hinton DR, Atkinson R, Bergmann CC. 2008. Type
1 Interferons are Essential in Controlling Neurotropic Coronavirus
Infection Irrespective of Functional CD8 T Cells. J Virol 82(1):300-10.

Jacobsen M, Cepok S, Quak E, Happel M, Gaber R, Ziegler A, Schock S,
Oertel WH, Sommer N, Hemmer B. 2002. Oligoclonal expansion of
memory CD8+ T cells in cerebrospinal fluid from multiple sclerosis
patients. Brain 125(Pt 3):538-50.

Jamaluddin M, Wang S, Garofalo RP, Elliott T, Casola A, Baron S, Brasier
AR. 2001. IFN-beta mediates coordinate expression of antigen-
processing genes in RSV-infected pulmonary epithelial cells. Am J
Physiol Lung Cell Mol Physiol 280(2):L248-57.

Kroger A, Koster M, Schroeder K, Hauser H, Mueller PP. 2002. Activities of
IRF-1. J Interferon Cytokine Res 22(1):5-14.

Lin MT, Stohlman SA, Hinton DR. 1997. Mouse hepatitis virus is cleared from
the central nervous systems of mice lacking perforin-mediated
cytolysis. J Virol 71(1):383-91.

Lin W, Kemper A, Dupree JL, Harding HP, Ron D, Popko B. 2006. Interferon-
gamma inhibits central nervous system remyelination through a
process modulated by endoplasmic reticulum stress. Brain 129(Pt
5):1306-18.

Luo H, Sopchak L, Lerman SP, King SR. 1995. Selective loss of H-2Ds
antigen on a murine B lymphoma due to a post-transcriptional block in
expression. Mol Immunol 32(14-15):1011-20.

Marten NW, Stohlman SA, Bergmann CC. 2000. Role of viral persistence in
retaining CD8(+) T cells within the central nervous system. J Virol
74(17):7903-10.

Massa PT, Ozato K, McFarlin DE. 1993. Cell type-specific regulation of major
histocompatibility complex (MHC) class I gene expression in
astrocytes, oligodendrocytes, and neurons. Glia 8(3):201-7.

108
Mavria G, Hall KT, Jones RA, Blair GE. 1998. Transcriptional regulation of
MHC class I gene expression in rat oligodendrocytes. Biochem J 330
( Pt 1):155-61.

Milner R, Campbell IL. 2003. The extracellular matrix and cytokines regulate
microglial integrin expression and activation. J Immunol 170(7):3850-
8.

Parra B, Hinton DR, Marten NW, Bergmann CC, Lin MT, Yang CS, Stohlman
SA. 1999. IFN-gamma is required for viral clearance from central
nervous system oligodendroglia. J Immunol 162(3):1641-7.

Paulsson KM. 2004. Evolutionary and functional perspectives of the major
histocompatibility complex class I antigen-processing machinery. Cell
Mol Life Sci 61(19-20):2446-60.

Ponzoni M, Guarnaccia F, Corrias MV, Cornaglia-Ferraris P. 1993.
Uncoordinate induction and differential regulation of HLA class-I and
class-II expression by gamma-interferon in differentiating human
neuroblastoma cells. Int J Cancer 55(5):817-23.
Popko B, Baerwald KD. 1999. Oligodendroglial response to the immune
cytokine interferon gamma. Neurochem Res 24(2):331-8.

Power C, Kong PA, Trapp BD. 1996. Major histocompatibility complex class I
expression in oligodendrocytes induces hypomyelination in transgenic
mice. J Neurosci Res 44(2):165-73.

Ramakrishna C, Atkinson RA, Stohlman SA, Bergmann CC. 2006. Vaccine-
induced memory CD8+ T cells cannot prevent central nervous system
virus reactivation. J Immunol 176(5):3062-9.

Redwine JM, Buchmeier MJ, Evans CF. 2001. In vivo expression of major
histocompatibility complex molecules on oligodendrocytes and
neurons during viral infection. Am J Pathol 159(4):1219-24.

Sedgwick J, Hickey W. 1997. Antigen presentation in the central nervous
system. In: Keane RW HW, editor. Immunology of the Central
Nervous System. Oxford: Oxford University Press. p 394-398.

Skulina C, Schmidt S, Dornmair K, Babbe H, Roers A, Rajewsky K, Wekerle
H, Hohlfeld R, Goebels N. 2004. Multiple sclerosis: brain-infiltrating
CD8+ T cells persist as clonal expansions in the cerebrospinal fluid
and blood. Proc Natl Acad Sci U S A 101(8):2428-33.

109
Slifka MK, Rodriguez F, Whitton JL. 1999. Rapid on/off cycling of cytokine
production by virus-specific CD8+ T cells. Nature 401(6748):76-9.

Stohwasser R, Giesebrecht J, Kraft R, Muller EC, Hausler KG, Kettenmann
H, Hanisch UK, Kloetzel PM. 2000. Biochemical analysis of
proteasomes from mouse microglia: induction of immunoproteasomes
by interferon-gamma and lipopolysaccharide. Glia 29(4):355-65.

Stohwasser R, Standera S, Peters I, Kloetzel PM, Groettrup M. 1997.
Molecular cloning of the mouse proteasome subunits MC14 and
MECL-1: reciprocally regulated tissue expression of interferon-
gamma-modulated proteasome subunits. Eur J Immunol 27(5):1182-7.

Strehl B, Seifert U, Kruger E, Heink S, Kuckelkorn U, Kloetzel PM. 2005.
Interferon-gamma, the functional plasticity of the ubiquitin-proteasome
system, and MHC class I antigen processing. Immunol Rev 207:19-
30.

Sun D, Whitaker JN, Huang Z, Liu D, Coleclough C, Wekerle H, Raine CS.
2001. Myelin antigen-specific CD8+ T cells are encephalitogenic and
produce severe disease in C57BL/6 mice. J Immunol 166(12):7579-
87.

Tepavcevic V, Blakemore WF. 2006. Haplotype matching is not an essential
requirement to achieve remyelination of demyelinating CNS lesions.
Glia 54(8):880-90.

Turnley AM, Morahan G, Okano H, Bernard O, Mikoshiba K, Allison J,
Bartlett PF, Miller JF. 1991. Dysmyelination in transgenic mice
resulting from expression of class I histocompatibility molecules in
oligodendrocytes. Nature 353(6344):566-9.

Wang FI, Hinton DR, Gilmore W, Trousdale MD, Fleming JO. 1992.
Sequential infection of glial cells by the murine hepatitis virus JHM
strain (MHV-4) leads to a characteristic distribution of demyelination.
Lab Invest 66(6):744-54.

Wong GHW, Bartlett PF, Clark-Lewis I, Battye F, Schrader JW. 1984.
Inducible expression of H-2 and Ia antigens on brain cells. Nature
310(5979):688-691.

110
Chapter 5: Regulation of PD-L1 inhibitory ligand transcription by
oligodendroglia during JHMV infection.

Chapter 5 Abstract
Expression of MHC class I accessory molecules can alter CD8 T-cell
activity towards target cells. Viral infection of oligodendroglia cannot be
controlled by cytolytic mechanisms and they become the predominant cell
type infected by JHMV. In support of earlier work, oligodendroglia were
assessed for expression of PD-L1 by transcript analysis. Oligodendroglia
upregulated PD-L1 transcription in coordination with MHC class I expression
during infection; a process primarily mediated by IFNγ-driven transcription.
PD-L1 expression was maintained by oligodendroglia proceeding into the
persistent stage of infection and may represent a means by which CD8 T-
cells expressing PD-1 are impaired in clearing virus from these cells.

111
Introduction
T cells infiltrate the CNS as early as day 5p.i. (Bergmann et al. 2001).
They also exhibit characteristic markers of activation indicated by CD44
hi
,
CD62
-
, CD11a
hi
and CD49d
+
expression (Bergmann et al. 2001). While the
expression of MHC class I by oligodendroglia at that time is presumably
sufficient to coordinate their interaction with activated antigen specific CD8 T
cells, expression of additional accessory molecules may further modulate the
effector functions of CD8 T cells towards target cells in the CNS. Formation
of the “immunological synapse” hinges on MHC:TCR interactions. It is
associated with co-stimulatory and/or negative regulatory molecules
surrounded by concentric rings of adhesion molecules, providing a pocket for
the delivery of granzyme/perforin granules and cytokines. Interactions
between adhesion molecules (CD54) and integrins facilitate T-cell adhesion
at the MHC:TCR synapse as well as aiding transmigration. CD54 binds to the
leukocyte function antigen 1 complex (LFA-1) composed of CD11a and
CD18 integrins (Dustin 2007). It is constitutively expressed at low levels on
endothelial cells and leukocytes (Roebuck and Finnegan 1999). CD54/LFA-1
interactions are also a potent regulator of inflammatory cell migration through
the blood brain barrier (Dietrich 2002). CD54 upregulation is associated with
microglia and astrocyte activation (Aloisi et al. 2000; Olschowka et al. 1997),
however it is unknown if oligodendroglia participate in such interactions.
More recently programmed cell death 1 (PD-1)/ PD-L1 interactions
have been identified in governing the outcome of infection by different strains

112
of LCMV. PD-L1 is one of two ligands for PD-1 and is expressed at low levels
by many cell types and can be further upregulated by various stimuli, most
notably interferons (Liang et al. 2003). Whereas the second ligand, PD-L2,
exhibits more restricted expression, it can be induced on macrophages and
DCs by IL-4, IFNγ and GM-CSF (Liang et al. 2003). Interactions between
PD1 expressing T cells and PD-L1/2 expressing cells can down-modulate T
cell effector activity (Latchman et al. 2004). In PD1 or PD-L1 knock-out mice,
viral infections that were otherwise chronic can now be cleared but they are
associated with high mortality due to uncontrolled T cell activity (Barber et al.
2006; Iwai et al. 2003).
Oligodendroglia were assessed for CD54 expression by flow
cytometry and for transcription of PD-L1 during JHMV infection. Transcription
of PD-L1 was upregulated with similar kinetics as class I pathway genes.
Induction of PD-L1 by IFNγ in oligodendroglia was confirmed in IFNγ-deficient
mice. Prolonged expression of PD-L1 in concert with MHC class I suggests a
mechanism by which CD8 T cells are prevented from effectively clearing
virus from oligodendroglia.

Results
CD54 is not strongly expressed by resident glia during JHMV infection.
The expression of adhesion molecule CD54 (ICAM-1) in the CNS was
assessed by flow cytometry. During JHMV infection infiltrating leukocytes
and resident microglia clearly expressed CD54 in the spinal cord at day 7

113
Spinal Cord (d7)
CD45
CD54
Oligodendroglia
GFP
Figure 5.1 CD54 is predominantly expressed
by microglia and infiltrating leukocytes. Flow
cytometry detection of CD54 surface expression
at day 7 p.i. in PLP-GFP/B6 mice (upper panel is
gated on live cells, lower panel is gated on
CD45-, GFP+ oligodendroglia).
p.i., while the remaining resident glia express
little or none (Fig. 5.1). Specific analysis of GFP+
oligodendroglia also indicated CD54 expression
remained very low at that time (Fig. 5.1, lower
panel). This suggests resident glia and
particularly oligodendroglia may not form
conventional interactions with CD8 T cells during
JHMV infection.
Oligodendroglia robustly upregulate PD-L1 expression in parallel with MHC
class I.
PD-L1 transcription by oligodendroglia was also evaluated during
infection of PLP-GFP/B6 mice. PD-L1 transcripts were upregulated in purified
oligodendroglia during infection in a manner parallel with their surface
expression of PD-L1 protein (unpublished data from Ramakrishna Chandran
and Timothy Phares). Comparison of PD-L1 transcript levels in
oligodendroglia with their respective upregulation of MHC class I-related
genes indicated strong parallels. PD-L1 transcripts were not detectable in
naïve oligodendroglia however they were significantly upregulated during the
acute infection consistently peaking at day 7 in both the brain and

114
Figure 5.2 Oligodendroglia
upregulate PD-L1 transcripts
in parallel with MHC class I
expression. PD-L1 transcript
levels detected in sorted GFP+
oligodendroglia from the brains
and spinal cords of PLP-GFP/B6
mice during acute infection.

spinal cord. (Fig. 5.2). The tight parallels in expression of MHC class I
genes with PD-L1 by oligodendroglia suggests all MHC class I+
oligodendroglia are also PD-L1+ during JHMV infection.
Interferon-γ strongly regulates PD-L1 expression in O4+ glia.
The finding that mature oligodendroglia upregulate PD-L1 expression
in parallel with class I, suggests PD-L1 expression is also regulated by IFNγ
in mature oligodendroglia. O4+ glia, which includes mature oligodendroglia
as well as oligodendroglia precursors, were evaluated for surface expression
of PD-L1 during infection of IFNγ
-/-
mice by flow cytometry. By day 7 and 10
p.i., less than 10% of O4+ glia expressed PD-L1 during infection in the
absence of IFNγ (Fig. 5.3A), Furthermore PD-L1 mRNA levels in O4+ glia
0
50
100
150
200
250
Naïve 3 5 7 10 14
Days post infection
0
40
80
120
160
200
Brain
Spinal Cord
PD-L1 transcript levels in
oligodendroglia during infection
Transcript relative to Gapdh

115
Figure 5.3 IFN-γ γ γ γ strongly regulates PD-L1 expression by O4+ glia. (A)
Analysis of CD45-,O4+ glia from the brains of IFNγ
-/-
mice were evaluated for
PD-L1 expression (clone MIH5, dark histograms) during acute infection by
flow cytometry as gated against Rat IgG2a isotype control (solid line). (B)
PD-L1 transcript levels detected in O4+ glia sorted from the brains of wild
type B6 mice as compared to O4+ glia from IFNγ
-/-
(GKO) mice during acute
infection. Data is from a single experiment.
also revealed decreased transcription in the absence of IFNγ (Fig.
5.3B).Naïve O4+ glia from both IFNγ
-/-
and wild type B6 mice did not express
detectable levels of PD-L1 transcripts (Fig.5.3B). During acute infection PD-
L1 transcripts were expressed in O4+ glia from both strains of mice (Fig.
5.3B). However levels in O4+ glia from IFNγ-deficient mice remained 3-5
times lower those from wild type that were robustly upregulated (Fig. 5.3B).
This data indicates PD-L1 is also regulated in response to IFNγ in
oligodendroglia similar to their regulation of MHC class I expression (Malone
et al. 2008).

O4+ glia (IFNγ γ γ γ-/- )
A
d7 d10
6%
10%
PD-L1
0
50
100
150
naïve 5 7
days post infection
transcript relative to Gapdh
B6
GKO
B
PD-L1 transcript
levels in O4+ glia
ND/ND
% Max

116

Figure 5.4 Oligodendroglia exhibit
prolonged expression of PD-L1 in
association with class I following
acute infection. (A) PD-L1 (clone
MIH5) is readily detected by flow
cytometry on oligodendroglia (CD45-
, GFP+) but not microglia (CD45lo)
from both the brain and spinal of
PLP-GFP/B6 mice at day 21 p.i. as
gated against Rat IgG2a isotype
control. Values in bold indicate
proportion of PD-L1+ cells and
values in parentheses indicate
proportion of cells that were MHC class I+ in the same experiment.
Expression of PD1 (clone RMP1-30, FITC conjugate) by CD8
+
T-cells
(CD45
hi
, CD8
+
) also isolated from the brain and spinal cord of PLP-GFP/B6
mice at day 21 p.i. as gated against Rat IgG2b isotype control. (B) Transcript
levels for PD-L1 detected in sorted microglia and oligodendroglia from the
brain and spinal cord of PLP-GFP/B6 mice at day 21 post infection. Floating
bars indicate the spread of values for each population for two independent
experiments.
B
64%
(75%)
9%
(68%)
Microglia
CD45
Oligodendroglia
day 21
GFP+
5%
(51%)
53%
(56%)
CD8+ T cells
A
PD1
Brain
Spinal
Cord
PD-L1
39%
67%

117

Oligodendroglia exhibit prolonged expression of PD-L1 with MHC class I.
To further consider how PD1/L1 interactions may contribute to the
establishment of persistent infection by continuing to block T cell activity, PD-
L1 expression by oligodendroglia and microglia was evaluated at day 21 p.i.,
as well as CD8 T-cell expression of PD1 at the same time. By day 21 p.i.,
infectious virus is no longer detectable in wild type mice by plaque assay
(Gonzalez et al. 2006; Parra et al. 1999) and oligodendroglia are the
predominant cell-type infected (Chapter 2).
At this time more than half of the microglia and oligodendroglia remain
class I positive in both the brain and spinal cord of PLP-GFP/B6 mice (Fig.
5.4A). However less than 10% of microglia were PD-L1+ while an equal
proportion of oligodendroglia were PD-L1+ as MHC class I+ (Fig. 5.4A).
Additionally, PD-L1 transcript levels measured in oligodendroglia from the
brain at day 21 p.i. remained 5-10 fold higher than that detected in the
corresponding microglia population, with similar findings in the spinal cord
(Fig. 5.4B). This suggests oligodendroglia are PD-L1, class I double positive,
even leading into the persistent phase of JHMV infection. Also at day 21 p.i.,
CD8
+
T-cells in the brain and spinal cord were 39% and 67% PD1+,
respectively (Fig. 5.4A), implying PD1/PD-L1 interactions between
oligodendroglia and CD8+ T-cells may continue following the acute infection.

118
Discussion

MHC:TCR interactions between oligodendroglia and T cells are not
supported by conventional immunologic synapse formation during JHMV
infection.
The lack of CD54 expression by oligodendroglia during JHMV
infection suggests CD8 T cells are unable to form conventional
immunological synapses with MHC class I positive oligodendroglia. This
does not necessarily prevent or diminish CD8 T cell activity towards target
cells as astrocytes that are infected with adenovirus can still direct virus
specific T cell polarization of IFNγ in the absence of CD54 interactions
(Barcia et al. 2008). Conversely, microglia expressed high levels of CD54
during JHMV infection suggesting they can interact with T cells to form
conventional immunological synapses and supports their role as an important
professional antigen presenting cell type in the CNS.
PD-L1 expression may spare oligodendroglia from CD8 T cell activity at the
cost of viral clearance.
PD-L1 expression in the central nervous system is not found under
normal conditions in murine and human brains (Liang et al. 2003; Wintterle et
al. 2003). During JHMV infection PD-L1 expression by oligodendroglia
corresponds to their expression of class I in response to IFNγ. Similarly other
non-professional APCs, tubular epithelial cells, express PD-L1 following IFNβ

119
or IFNγ exposure with limited expression of other co-stimulatory molecules
(Waeckerle-Men et al. 2007). PD-L1 expression by oligodendroglia supports
a mechanism whereby CD8 T cells may be impaired in clearing virus from
this cell type, even leading into the persistent phase of infection.
While direct evidence of such activity remains to be confirmed,
previous work supports CD8 T cells may be driven to exhaustion. In the
model of JHMV recrudescence, infectious virus reemerges in the absence of
a neutralizing antibody response (Lin et al. 1999; Ramakrishna et al. 2003). T
cells are capable of controlling the acute infection, yet during viral
reemergence, they fail to control viral spread, ultimately resulting in death
(Lin et al. 1999; Ramakrishna et al. 2006; Ramakrishna et al. 2003). Further
evidence suggests T cells lose their cytolytic activity following acute JHMV
infection, while retaining their ability to secrete IFNγ (Lin et al. 1999;
Ramakrishna et al. 2006). In the persistent LCMV model PD-L1 expression is
maintained specifically on virus infected cells (Barber et al. 2006). This is
does not appear to be the case in JHMV where the majority of
oligodendroglia express PD-L1 with MHC class I while only a proportion are
likely to be infected. Rather expression of PD-L1 in conjunction with MHC
class I by oligodendroglia appears to be a protective response, given their
critical role in maintaining myelin.

120
Chapter 5 References

Aloisi F, De Simone R, Columba-Cabezas S, Penna G, Adorini L. 2000.
Functional maturation of adult mouse resting microglia into an APC is
promoted by granulocyte-macrophage colony-stimulating factor and
interaction with Th1 cells. J Immunol 164(4):1705-12.
Barber DL, Wherry EJ, Masopust D, Zhu B, Allison JP, Sharpe AH, Freeman
GJ, Ahmed R. 2006. Restoring function in exhausted CD8 T cells
during chronic viral infection. Nature 439(7077):682-7.
Barcia C, Wawrowsky K, Barrett RJ, Liu C, Castro MG, Lowenstein PR.
2008. In vivo polarization of IFN-gamma at Kupfer and non-Kupfer
immunological synapses during the clearance of virally infected brain
cells. J Immunol 180(3):1344-52.
Bergmann CC, Ramakrishna C, Kornacki M, Stohlman SA. 2001. Impaired T
cell immunity in B cell-deficient mice following viral central nervous
system infection. J Immunol 167(3):1575-83.
Dietrich JB. 2002. The adhesion molecule ICAM-1 and its regulation in
relation with the blood-brain barrier. J Neuroimmunol 128(1-2):58-68.
Dustin ML. 2007. Cell adhesion molecules and actin cytoskeleton at immune
synapses and kinapses. Curr Opin Cell Biol 19(5):529-33.
Gonzalez JM, Bergmann CC, Ramakrishna C, Hinton DR, Atkinson R,
Hoskin J, Macklin WB, Stohlman SA. 2006. Inhibition of interferon-
gamma signaling in oligodendroglia delays coronavirus clearance
without altering demyelination. Am J Pathol 168(3):796-804.
Iwai Y, Terawaki S, Ikegawa M, Okazaki T, Honjo T. 2003. PD-1 inhibits
antiviral immunity at the effector phase in the liver. J Exp Med
198(1):39-50.
Latchman YE, Liang SC, Wu Y, Chernova T, Sobel RA, Klemm M, Kuchroo
VK, Freeman GJ, Sharpe AH. 2004. PD-L1-deficient mice show that
PD-L1 on T cells, antigen-presenting cells, and host tissues negatively
regulates T cells. Proc Natl Acad Sci U S A 101(29):10691-6.
Liang SC, Latchman YE, Buhlmann JE, Tomczak MF, Horwitz BH, Freeman
GJ, Sharpe AH. 2003. Regulation of PD-1, PD-L1, and PD-L2
expression during normal and autoimmune responses. Eur J Immunol
33(10):2706-16.

121
Lin MT, Hinton DR, Marten NW, Bergmann CC, Stohlman SA. 1999.
Antibody prevents virus reactivation within the central nervous system.
J Immunol 162(12):7358-68.
Malone KE, Stohlman SA, Ramakrishna C, Macklin W, Bergmann CC. 2008.
Induction of class I antigen processing components in oligodendroglia
and microglia during viral encephalomyelitis. Glia 56(4):426-35.
Olschowka JA, Kyrkanides S, Harvey BK, O'Banion MK, Williams JP, Rubin
P, Hansen JT. 1997. ICAM-1 induction in the mouse CNS following
irradiation. Brain Behav Immun 11(4):273-85.
Parra B, Hinton DR, Marten NW, Bergmann CC, Lin MT, Yang CS, Stohlman
SA. 1999. IFN-gamma is required for viral clearance from central
nervous system oligodendroglia. J Immunol 162(3):1641-7.
Ramakrishna C, Atkinson RA, Stohlman SA, Bergmann CC. 2006. Vaccine-
induced memory CD8+ T cells cannot prevent central nervous system
virus reactivation. J Immunol 176(5):3062-9.
Ramakrishna C, Bergmann CC, Atkinson R, Stohlman SA. 2003. Control of
central nervous system viral persistence by neutralizing antibody. J
Virol 77(8):4670-8.
Roebuck KA, Finnegan A. 1999. Regulation of intercellular adhesion
molecule-1 (CD54) gene expression. J Leukoc Biol 66(6):876-88.
Waeckerle-Men Y, Starke A, Wahl PR, Wuthrich RP. 2007. Limited
costimulatory molecule expression on renal tubular epithelial cells
impairs T cell activation. Kidney Blood Press Res 30(6):421-9.
Wintterle S, Schreiner B, Mitsdoerffer M, Schneider D, Chen L, Meyermann
R, Weller M, Wiendl H. 2003. Expression of the B7-related molecule
B7-H1 by glioma cells: a potential mechanism of immune paralysis.
Cancer Res 63(21):7462-7.

122
Chapter 6: MHC class II expressing antigen presenting cells in the CNS
and the mystical dendritic cell

Chapter 6 Abstract

During JHMV infection of the CNS, the adaptive immune response is
critical for controlling viral spread while it is also responsible for the ensuing
demyelination. To evaluate interactions between CD4 T cells and
oligodendroglia MHC class II, FAS (CD95) and Trail-R expression were
measured in comparison to microglia. Limited or no expression of MHC class
II molecules or FAS and TRAIL receptor transcripts by oligodendroglia during
infection indicates they are unlikely in interact directly with CD4 T cells in a
MHC restricted or unrestricted manner. Furthermore, control of MHC class II
expression by microglia in vivo is regulated by IFNγ at the transcriptional
level. Microglia expressed both PI and PIV isoforms of the MHC class II
transactivator (CIITA) and MHC class II genes in coordination with IFNγ
exposure. Similar regulation of MHC class II expression by infiltrating F4/80
+

cells was also noted, however in the absence of IFNγ a subpopulation of
MHC class II expressing F4/80
+
cells was identified. These cells most closely
resemble myeloid dendritic cells and represent the first antigen-presenting
cell available to interact with CD4 T cells in the CNS, particularly in the
absence of IFNγ.

123
Introduction

During JHMV infection of the CNS, CD4 T cells aid anti-viral immune
responses by the secretion of cytokines and providing help to the humoral
response. Secretion of IFNγ and TNFα by CD4 T cells can directly contribute
to viral control. However, CD4 T cells are also strongly implicated in
immune-mediated pathologies during CNS inflammation. Virus specific CD4
T cells transferred into JHMV infected SCID or RAG
-/-
mice induced
demyelination (Stohlman et al. 2008; Wu et al. 2000). Conversely, CD4
-/-

mice experience less severe demyelination during JHMV infection as
compared to CD8
-/-
mice (Lane et al. 2000). In experimental autoimmune
encephalomyelitis (EAE), TCR transgenic CD4 T cells recognizing myelin
basic protein peptides can also induce disease (Bettelli 2007).
CD4 T cells respond to peptide presented in the context of MHC class
II. Once primed by professional antigen presenting cells CD4 T cells may
also induce apoptosis in target cells through FAS/FASL and the related
Trail/Trail-R pathway in an MHC unrestricted manner. To evaluate the
potential for direct CD4 T cell interactions with oligodendroglia, expression of
MHC class II, Fas (CD95) and Trail-R were measured during JHMV infection.
MHC class II expression has been detected on oligodendroglia progenitor
cells in vitro (Calder et al. 1988), but there are few indications for MHC class
II expression by mature oligodendroglia during CNS inflammation (Horwitz et
al. 1999; Matsumoto and Fujiwara 1986; Redwine et al. 2001). Whereas both

124
FAS and Trail-R have been detected on oligodendroglia and their expression
can be upregulated upon inflammatory stimuli (Dorr et al. 2002; Hovelmeyer
et al. 2005). During EAE, Trail-R expression by neurons is strongly
implicated in neuronal death (Aktas et al. 2005). Currently it is unknown what
role these receptors may play in directing CD4 T cell interactions with glia
during JHMV infection.
Phagocytic cell types present within the inflamed CNS are
predominantly of myeloid lineage, including microglia, infiltrating
macrophages and dendritic cells (DCs) (Bailey et al. 2006; Kadiu et al. 2005).
Both macrophages and DCs are capable of presenting MHC class II upon
maturation as antigen presenting cells (APCs). The regulation of MHC class
II expression by these closely related cells types in the CNS has not been
evaluated in vivo. Microglia respond to IFNγ by expressing MHC class II on
their surface (Bergmann et al. 2003; O'Keefe et al. 2001; Wong et al. 1984).
Infiltrating monocytic cells also respond to IFNγ by upregulating MHC class II
(Bergmann et al. 2004). However there is a subpopulation of infiltrating
myeloid cells that consistently express MHC class II even in the absence of
IFNγ (Bergmann et al. 2004; Stohlman et al. 2008), indicating heterogeneity
within this population.
To characterize differences in MHC class II regulation between these
populations we evaluated the transcriptional regulation of MHC class II genes
and class II transactivator (CIITA) isoforms, particularly in the absence of

125
Exon 1 Exon 1 Exon 1
Exons 2-19
AUG AUG AUG
Type I (132KD)
(Constitutive) DCs
Macrophage +IFN-γ γ γ γ
Type III (124KD)
B-cells
Type IV (121KD)
Macrophage +IFN-γ γ γ γ
Non-hematopoietic
cells + IFN-γ
pI pIII pIV
Class II Transactivator (Ciita)
IFNγ. MHC class II transcriptional regulation by CIITA is very well defined. In
the absence of CIITA, MHC class II expression is limited primarily to DCs
and is expressed at substantially lower levels (Williams et al. 1998). Finer,
promoter-specific knock-out mice have identified three cell-specific promoters
governing the expression of CIITA isoforms, which is outlined in the following
schematic:

Figure 6.1 Promoter organization of the class II transactivator (Ciita)
gene. CIITA isoforms are encoded by three different promoters utilized by
specific cell-types to drive different exon 1 expression. This allows the
evaluation of CIITA isoform expression at the transcriptional level. Schematic
adapted from Pai et al 2002.

Constitutive expression of CIITA from the PI promoter is largely
contributed to DCs (LeibundGut-Landmann et al. 2004). However, upon IFNγ
stimulation resident and infiltrating macrophages can express the PI-driven
isoform (Waldburger et al. 2001). Cultured microglia can also be induced to
express PI- as well as PIV-isoforms in response to IFNγ (Waldburger et al.
2001). Expression of CIITA from the PIV promoter clearly requires IFNγ
stimulation and is mediated by STAT1 and IRF-1 transcription factors

126
(Muhlethaler-Mottet et al. 1998). PIV is absolutely required for MHC class II
expression in non-hematopoeitic cells (Waldburger et al. 2001). However it is
not clear how IFNγ mediates expression from the PI promoter in
macrophages or microglia, as this promoter does not contain any known IFN
responsive elements. Lastly, the PIII-driven isoform is exclusively expressed
by B cells; a process regulated by their maturation program independent of
IFNγ (Piskurich et al. 2000).
The findings presented here indicate oligodendroglia are not likely to
interact with CD4 T cells in a MHC restricted or unrestricted manner.
Additionally, MHC class II expression by microglia and infiltrating F4/80+
cells in vivo involves transcriptional upregulation of CIITA and MHC class II
genes. This process requires IFNγ to promote expression of both PI and PIV
isoforms, indicating microglia and CNS infiltrating macrophages share similar
pathways for class II regulation in vivo. However microglia appeared to utilize
PIV-driven isoforms more so than PI, opposite of proportions detected in
infiltrating F4/80+ cells indicating the specialized nature of microglia
compared to other macrophages. In the absence of IFNγ a third, distinct
population of MHC class II+ myelomonocytic cells can be identified. These
cells functionally resemble myeloid dendritic cells (mDCs) in their regulation
of MHC class II expression and represent a strong candidate for presenting
viral and potentially auto-antigen to CD4 T cells, particularly in the absence
of IFNγ early during infection.

127
Results
Lack of MHC class II expression by mature oligodendroglia during JHMV
infection is impaired at the level of the class II transactivator.
By utilizing PLP-GFP/B6 reporter mice, GFP+ oligodendroglia can be
distinguished from earlier precursors. They are both a target of viral infection
and the myelin expressing cell type. MHC class II expression was evaluated
on fully differentiated, myelinating oligodendroglia during JHMV infection at
two levels: surface expression of MHC class II protein and transcriptional
induction of class II transactivator mRNA (Ciita). Microglia were compared as
a positive control. 90% of microglia found in the spinal cords of these mice at
day 7 p.i. were class II positive corresponding to peak IFNγ exposure,
however class II was undetectable on oligodendroglia (Fig. 6.2A). By day 14
p.i., spinal cords of B6 mice exhibit severe demyelination (Wang et al. 1992).
At this time microglia have down regulated expression of class II, but 38%
are still positive in PLP-GFP/B6 spinal cords, whereas oligodendroglia
remained class II negative (Fig. 6.2A).
Ciita message was induced by over 300-fold in microglia relative to
naïve microglia, in a pattern related to their class II surface expression (Fig.
6.2B). Oligodendroglia failed to express substantial amounts of Ciita
message relative to microglia (Fig. 6.2B), despite responding to IFNγ
(Malone et al. 2008), indicating their lack of class II expression lies
predominantly in repression of the class II transactivator.

128
Figure 6.2 Class II is not
expressed by GFP
+

oligodendroglia. (A) Percentage
of CD45
lo
microglia (upper panels)
expressing class II during acute
viral infection (d7p.i.) and during
the onset of demyelination (d14p.i.)
in the spinal cord of PLP-GFP/B6
mice. GFP+ oligodendroglia (lower
panels) from the spinal cord do not
express class II at these times.
Filled histograms depict class II
(M5) positive glia as gated against
Ms IgG1 isotype control (gray line).
(B) Transcript levels for Class II
transactivator (Ciita) in purified
microglia and oligodendroglia from
the spinal cord of infected mice.
Data are from single contiguous
experiments.

Fas (CD95) and TRAIL-R transcripts remain at very low levels in both
oligodendroglia and microglia during JHMV infection.

While oligodendroglia do not express MHC class II during JHMV
infection, they may interact with CD4 or CD8 T cells in a MHC unrestricted
manner through the expression of FAS and/or Trail-R. Apoptosis can be
A
Spinal Cord (PLP-GFP/B6)
d7
90%
Microglia
Oligodendroglia
<1%
d14
38%
<1%
MHC Class II (M5)
Class II Transactivator
0
10
20
30
40
50
naïve 3 5 7 10 14
days post infection
Microglia
Oligodendroglia
B
Transcripts relative to Gapdh

129
induced in oligodendroglia in vitro through engagement of exogenous FASL
or TRAIL (Wosik et al. 2003). Resting microglia express low levels of Fas
and TRAIL-R mRNA according to microarray analysis(Aravalli et al. 2006).
Basal levels for Fas and Trail-R transcripts were ~10,000 lower than Gapdh
levels in naïve microglia and these levels did not change in comparison to
microglia at day 7 p.i (Table 6.1). Oligodendroglia also expressed very low
levels of these transcripts and this appeared to increase with inflammation
(Table 6.1). However Fas and Trail-R transcript levels in oligodendroglia did
not exceed that expressed by microglia, even during peak inflammation
(Table 6.1).
Table 6.1. Fas and Trail-R transcript levels in microglia and
oligodendroglia. Glia were sorted from spinal cords of naïve and day 7 p.i.
PLP-GFP/B6 mice. Transcript values are relative to Gapdh, 10
3
.

Contribution of IFNγ to MHC class II expression by myeloid cells in the CNS
during viral infection.
In the naïve CNS microglia are the predominant myeloid cell, acting in
many ways the role of tissue-resident macrophage representing a prime
candidate for CD4 T cells interactions. However they do not express MHC
class II until exposed to IFNγ. To quantify differences in IFNγ mediated MHC
class II expression, CD45
lo
, F4/80
+
microglia were compared to the infiltrating
Fas (CD95) Trail-R
Naïve d7p.i. Naïve d7p.i.
Microglia 0.52 0.44 0.22 0.12
Oligodendroglia 0.01 0.31 0.02 0.09

130
d5
B6 (wt)
Resident
Microglia
18.5%
±4%
33%
15%
F4/80 (APC)
CD45 (PerCp)
4.5%
±2%
Infiltrating
F4/80+ cells
± ± ± ±7%
±2%
26%
±7%

8%
78.9%
±7%
79.9%
±8%
MHC class II (M5)-PE
d7
±1%
A
19%
±2%
12%
±7%
d5
IFNγ
-/-
d7
CD45 (PerCp)
30%
22%
23.9%
±1%
4.0%
±1%
1%
12%
Resident
Microglia
Infiltrating
F4/80+ cells MHC class II (M5)-PE
F4/80 (APC)
B
Figure 6.3. MHC class II
expression in vivo by resident
microglia and infiltrating F4/80+
cells in the presence or absence
IFNγ γ γ γ during viral infection.
Distribution of microglia (CD45
lo
,
F4/80
+
) and infiltrating CD45
hi
,
F4/80
+
cells recovered from the
brains of wild type (A) or IFNγ
-/-

mice by trypsin digestion as
described in Ch. 8 (B) at the
indicated times post infection.
Percentages indicate average
proportion of total mononuclear
cells with standard deviations from
two or three independent
experiments (n=3 mice pooled per
time point). MHC class II
expression (filled histogram) as
gated against Ms IgG1 isotype
control (gray line) for each
population. Percentages indicate
average of MHC class II
+
cells with
standard deviations from two (B6)
or three (IFNγ
-/-
) independent
experiments at day 7p.i.

131
myelomonocytic cells designated by CD45
hi
, F4/80
+
in the brains of wild type
B6 and IFNγ
-/-
(B6) mice (Fig. 6.3). Flow cytometry analysis of MHC class II
surface expression on these populations revealed many similarities between
these closely related cell types as well as some subtle, yet distinct
differences. In wild type mice, microglia and infiltrating F4/80
+
cells
demonstrated strong upregulation of MHC class II expression with both
peaking at day 7p.i., although a small proportion of infiltrating cells
consistently expressed MHC class II earlier than microglia at day 5 (Fig.
6.3A). As expected, microglia from IFNγ
-/-
mice did not induce MHC class II,
although a similar proportion of infiltrating F4/80
+
cells were MHC class II+ at
day 5 p.i. as compared to wild type (Fig. 6.3). By day 7 nearly a quarter of
infiltrating F4/80
+
cells consistently expressed MHC class II in IFNγ
-/-
mice,
representing a distinct population composing approximately 5% of the
infiltrating leukocytes (Fig. 6.3B). Less than 10% of the remaining infiltrates
(CD45
hi
, F4/80
-
) were MHC class II positive at this time (data not shown).

Transcriptional regulation of MHC class II genes.
To gain further insight as to how MHC class II expression is regulated
between infiltrating F4/80
+
cells and microglia, transcripts encoding MHC
class II genes as well as the class II transactivator were evaluated in purified
populations from the brains of both wild type and IFNγ-deficient mice during

132

Figure 6.4. Class II transcript levels correspond with class II surface
expression in microglia and infiltrating F4/80+ cells. H2-Aβ1 transcript
levels in purified brain populations of resident microglia or infiltrating F4/80+
cells from wild type (B6) or IFNγ
-/-
(GKO) mice at the indicated times post
infection. Data represents a single experiment at day 3 p.i. or the average
and standard deviation for days 5 and 7 p.i. from two independent
experiments.

infection. First, the levels of transcripts in these populations encoding H2-Aβ,
the β chain component of the I-A complex, reflected the overall surface
expression of MHC class II demonstrated by flow cytometry in the
corresponding experiments. Microglia from wild type mice exhibited the most

133
dramatic upregulation of H2-Aβ1 transcripts, increasing 10-15 fold between
days 3 and 7 p.i. (Fig. 6.4). Additionally in wild type mice, infiltrating F4/80
+

cells already expressed approximately 10 times higher levels of H2-Aβ1 at
day 3 p.i. as compared to microglia (Fig. 6.4) and this was reflected in their
relatively earlier MHC class II expression on their surface (Fig. 6.3).
Infiltrating F4/80
+
cells further increased these transcripts to levels
comparable with microglia at day 7 (Fig. 6.4). In IFNγ
-/-
mice induction of H2-
Aβ1 transcripts was abrogated in both cell types, however infiltrating F4/80
+

cells consistently expressed approximately 10 times higher levels than
microglia from the same mice (Fig. 6.4).
The class II transactivator is largely responsible for transcriptional
regulation of MHC class II genes. Expression of specific Ciita isoforms
yielded further clues as to differences between these myeloid populations in
their regulation of class II expression. Discrimination of each isoform by PCR
utilizes a unique forward primer corresponding to each exon 1 paired with a
common reverse primer complimentary to exon 2 (Takeuchi et al. 2003). PIII
was not induced in any myeloid cell types analyzed during the acute
infection. All samples remained more than 30-fold lower than that detected in
naïve splenocytes, of which more than half are B cells (Fig. 6.5). In wild type
microglia, PI and PIV isoforms were detected with PIV expression being most
prominent. PIV regulated transcripts were not detectable at day 3 p.i. but
composed the major isoform expressed by wild type microglia at day 7p.i

134
(Fig. 6.5). In microglia from IFNγ
-/-
mice neither PI or PIV isoforms were
expressed (Fig. 6.5). Infiltrating F4/80
+
cells from wild type mice
predominantly expressed PI as early as day 3 p.i. and levels increased ~5-
fold by day 7 p.i. (Fig. 6.5). Lower levels of PIV-driven transcripts were also
detected in infiltrating F4/80
+
cells from wild type mice, though it did not

Figure 6.5. Cell-
specific expression of
Ciita-isoforms. PI, PIII
and PIV transcript
isoforms expressed in
naïve splenocytes,
microglia or infiltrating
F4/80
+
cells in wild type
(B6) or IFNγ
-/-
(GKO)
mice at the indicated
times post infection.
Data represents a single
experiment at day 3 p.i.
or the average and
standard deviation for
days 5 and 7 p.i. from
two independent
experiments.

0
5
10
15
20
25
30
35
splenocytes
resident
F4/80+
infiltrating
F4/80+
resident
F4/80+
infiltrating
F4/80+
resident
F4/80+
infiltrating
F4/80+
naïve d3 d5 d7
0
5
10
15
20
25
30
35
splenocytes
resident
F4/80+
infiltrating
F4/80+
resident
F4/80+
infiltrating
F4/80+
resident
F4/80+
infiltrating
F4/80+
naïve d3 d5 d7
Ciita isoform-specific transcripts
PI
B6 microglia GKO microglia
B6 infiltrating F4/80+ GKO infiltrating F4/80+

Transcripts relative to Gapdh
PIII
0
5
10
15
20
25
30
35
40
45
splenocytes
Microglia
infiltrating
F4/80+
Microglia
infiltrating
F4/80+
Microglia
infiltrating
F4/80+
naïve d3 d5 d7
PIV
ND/ND
ND

135

Figure 6.6. MHC class II and Ciita transcripts are similarly induced in
populations purified from infected Balb/c mice. H2-Aα and total Ciita
transcript levels in microglia or infiltrating F4/80+ cells at days 3 and 7 p.i.
Data is from a single experiment.
increase more than 3-fold during the acute infection (Fig. 6.5). In infiltrating
F4/80
+
cells from IFNγ
-/-
mice, PIV expression was completely abrogated
whereas PI was the only isoform consistently expressed during infection in
this population (Fig. 6.5).
In humans the MHC locus consistently exhibits high linkage
disequalibrium with multiple sclerosis (McElroy and Oksenberg 2008). A
recent study has also identified a CIITA polymorphism associated with
human herpes virus 6 (HHV-6a) replication in a portion of multiple sclerosis
(MS) patients, suggestive of the gene-environment interactions that are
involved in MS (Martinez et al. 2007). BALB/c mice differ at their MHC locus
In comparison to B6 mice, involving numerous single nucleotide
polymorphisms (SNPs);with genetic backgrounds of H2
d
versus H2
b

haplotypes, respectively. In a related experiment of infected BALB/c mice,
0
100
200
300
400
500
600
F4/80+
d3pi d7pi
0
10
20
30
40
Microglia Infiltrating
F4/80+
H2-Aα1 Ciita
H2-Aα1 mRNA expression
relative to Gapdh
Class II & Ciita transcripts in
populations purified from BALB/c
Microglia Infiltrating
F4/80+
Ciita mRNA expression
relative to Gapdh

136
microglia and infiltrating F4/80
+
cells exhibited similar patterns of MHC class
II gene expression during infection as compared to wild type B6 mice. Both
populations increased H2-Aα1 transcripts substantially between day 3 and 7
p.i. as well as total Ciita transcript levels (Fig. 6.6). This data indicates
myeloid cell-specific regulation of class II related genes is largely unaffected
between two genetically diverse strains of mice at this locus.

Regulation of MHC class II expression by macrophage J774.1 cells in
response to IFNγ.
J774.1 cells generally exhibit an archetypical macrophage phenotype
in their ability to present antigens. To consider if the phenotypes of infiltrating
F4/80+ cells and microglia seen in vivo could be recapitulated in vitro the
regulation of MHC class II in J774.1 cells was evaluated. Unstimulated
J774.1 cells express very low levels of MHC class II. Following IFNγ
stimulation for 24hrs, the proportion of MHC class II+ cells increased from
7%to 74% (Fig. 6.7A). MHC class II transcripts encoding H2-Aα and H2-Aβ
were increased over 2000-fold compared to unstimulated J774.1 cells (Fig.
6.7B), indicating J774.1 cells require transcriptional upregulation. In contrast
to microglia and the typical phenotype of macrophages, J774.1 cells induced
expression of all three Ciita isoforms in response to IFNγ. Most notably PIII
and PIV-regulated transcripts levels were increased 240 and 125 fold,
respectively, in IFNγ treated as compared to untreated cells (Fig. 6.7B). This

137
Figure 6.7. MHC class II
expression by J774.1
macrophage cells is
upregulated in response to
IFNγ γ γ γ. J774.1 cells were
stimulated with IFNγ [10ng/mL]
for 24 hours and evaluated for
MHC class II expression in
comparison to unstimulated
cultures. (A) Surface
expression of MHC class II by
IFNγ stimulated cells (dark
histogram), untreated cells
(solid line), as gated on Ms
IgG2a isotype controls
(dashed lines). (B) Transcript
levels for H2-Aa, H2-Ab, and
Ciita isoforms: PI, PIII, and
PIV expressed by IFNγ
stimulated and unstimulated
J774.1 cells. ND denotes not
detected.

feature is shared with a similar macrophage cell line, Raw 264.7, that also
utilize PIII and PIV promoters in response to IFNγ (Nikcevich et al. 1999),
suggesting induction from the PIII promoter in response to IFNγ may be a
consequence of transformation. However these cells retain the phenotype of
minimal MHC class II expression exhibited by unstimulated microglia and
macrophages.

Class II, I-A
d
(39-10-8) FITC
J774.1 cells
Untreated
IFNγ treated
Class II-related genes
0.0001
0.001
0.01
0.1
1
10
100
H2-
Aa
H2-
Ab
PI PIII PIV transcripts relative to Gapdh
untreated
IFNg treated
ND
A
B

138
A
CD11c (PE)
CD45 (PerCp)
B
Class II (2G9) FITC
0
10
20
30
40
Microglia
Microglia
Infiltrating
F4/80+
CD3+ T
cells
Naïve d7
transcript relative to Gapdh
ND
C
Itgax (CD11c)
Figure 6.8. CD11c expression by
infiltrating F4/80+ cells is associated
with increased MHC class II
expression, but CD11c is not
exclusively expressed by this
population. (A) Mononuclear cells from
B6 brains at day 7p.i. are gated on
CD45
+
, F4/80
+
and depicted in relation to
CD11c expression. (B) MHC class II
expression by CD45
hi
, F4/80
+
, CD11c
+

cells (shaded histogram) as compared to
CD45
hi
, F4/80
+
, CD11c
-
cells (empty
histogram). Raw data for panels A & B
was provided by John-Mario Gonzales.
Brain cells were disrupted by dounce
homogenizers and purified by percol
gradients as previously described
(Bergmann et al. 2004). (C) Itgax
(CD11c) transcript levels in sorted
populations from B6 mice. ND denotes
not detected.
CD11c is expressed by a variety of cells
during JHMV infection.
The expression of MHC class II by
a subpopulation of infiltrating F4/80
+
cells
in the absence of IFNγ suggests
heterogeneity within this population. To
assess the proportion of F4/80
+
DCs that
may be present in the infiltrating population we evaluated the expression of
CD11c by different cells during JHMV infection. At day 7 p.i., approximately
25% of the infiltrating F4/80
+
cells were CD11c
+
Fig. 6.8A). Furthermore
CD11c expression was associated with greater MHC class II expression in

139
these populations.Of the CD45
hi
, F4/80
+
, CD11c+ cells, 92% were MHC
class II
+
, as compared to 74% MHC class II
+
in the CD45
hi
, F4/80
+
, CD11c-
population (Fig. 6.8B) (Templeton et al. 2008). However microglia also
appeared to express intermediate levels of CD11c (Fig. 6.8A). CD11c
upregulation by microglia has been documented by flow cytometry in JHMV
infection (Templeton et al. 2008) as well as during the preclinical stages of
EAE (Ponomarev et al. 2005).
Additionally CD11c expression has been described for effector T cells
during respiratory syncytial virus infection (Beyer et al. 2005). Similarly
CD11c+ antigen primed T cells in EAE are associated with increased
pathology (Bullard et al. 2007). To confirm CD11c expression is not unique to
DCs in the CNS, transcripts levels for integrin alpha x (Itgax), the gene
encoding CD11c, was measured by real-time PCR in FACS purified
populations from the brains of B6 mice. Itgax transcripts were not detectable
in naïve microglia (Fig. 6.8C). By day 7 p.i., microglia expressed slightly
higher levels of Itgax in comparison to infiltrating F4/80
+
cells (Fig. 6.8C). The
relatively lower Itgax transcript levels expressed by infiltrating F4/80
+
cells
likely reflects the small proportion of CD11c
+
cells within this population at
large. Notably CD3+ T cells also expressed similar levels of Itgax transcripts
(Fig. 6.8C). While CD11c expression may distinguish mDCs from
macrophages that are also CD45
hi
, F4/80
+
, these data indicate CD11c
expression is not a unique feature of DCs in the CNS.

140
Discussion

To directly address the potential for mature myelinating
oligodendroglia to interact with CD4 T cells in a model of immune-mediated
demyelination during viral infection MHC class II expression by PLP-GFP/B6
mice was examined. The finding that oligodendroglia lack MHC class II
expression indicates they are not a primary target for CD4 T cell interactions
during acute infection or the onset of demyelination. Conversely these data
underscore the limited role CD4 T cells play in viral control in oligodendroglia
(Bergmann et al. 2004; Stohlman et al. 2008). Further evaluation indicated
repression of MHC class II in oligodendroglia occured at the level of the
CIITA. Expression of MHC class II in non-haematopoietic originating cells,
requires IFNγ signaling and IRF-1 expression to drive transcription from the
PIV promoter of C2ta (Muhlethaler-Mottet et al. 1998; Waldburger et al.
2001). Both events have been demonstrated to occur in oligodendroglia
during this infection (Malone et al. 2008), however Ciita transcripts remained
substantially lower in these cells as compared to microglia. Ciita expression
may be epigenetically repressed in mature oligodendroglia in the course of
their differentiation (Wright and Ting 2006); a process that may have evolved
to limit myelin peptide presentation to CD4 T cells. In addition,
oligodendroglia did not express high levels of FAS or Trail-R indicating they
are also unlikely to interact with CD4 T cells in a MHC unrestricted fashion. In
MS, apoptosis induced via these receptors in oligodendroglia in MS lesions

141
has recently been discounted as a major pathological mechanism (Cannella
et al. 2007).
These and previous findings (Bergmann et al. 2003; Liu and Lane
2001) demonstrated instead that microglia and infiltrating F4/80
+
cells are the
primary source of MHC class II expression early during JHMV infection. This
also parallels MS, where MHC class II expression has been examined in
lesions and normal appearing white matter. In MS lesions the predominant
MHC class II expressing cell was of microglia or macrophage phenotype with
gradation as to lesion type while there was no detection of MHC class II on
oligodendroglia or astrocytes (Hoftberger et al. 2004).
In microglia, IFNγ is required to induce MHC class II expression.
Analysis of transcript levels demonstrated expression of MHC class II by
microglia in vivo requires transcriptional upregulation of Ciita and MHC class
II genes in response to IFNγ. Furthermore this pattern of transcriptional
upregulation of MHC class II related genes in microglia is reminiscent of
IFNγ-dependent MHC class I gene expression demonstrated in
oligodendroglia at the same time (Malone et al. 2008), establishing a clear
pattern for the expression of IFNγ initiated transcription in different cell types
during this JHMV infection. Several studies have noted IFNγ increases PIV
and PI-driven transcripts in neonatal microglia cultures or cell lines (O'Keefe
et al. 2001; Youssef et al. 2002). In vivo, we also found microglia expressed

142
predominantly PIV as well as PI-regulated isoforms of CIITA and expression
of both was dependent on IFNγ.

Infiltrating F4/80+ cells are a conglomerate of macrophages and mDCs.
Analysis of MHC class II expression by infiltrating F4/80
+
cells in wild
type mice demonstrated several similarities with resident microglia as well as
some important distinctions. Both populations increased expression of MHC
class II in concordance with IFNγ at the transcriptional level for MHC class II
genes, including Ciita, and cell surface expression of protein. Further
analysis of MHC class II regulation by infiltrating F4/80
+
cells did not
completely fit the known responses of macrophages suggesting an additional
cell type is present. mDCs are also F4/80
+
yet exhibit unique characteristics
with regards to MHC class II expression, the main points of which are
outlined in table 6.2. Analysis of Ciita transcript isoforms expressed in the
CD45
hi
, F/80
+
population demonstrated PI driven expression was earlier and
predominated over PIV-associated isoforms, a feature associated with DCs.
This however cannot entirely account for the presence of DCs as the data
presented here and work by Waldburger et al. 2001, clearly demonstrate
macrophages as well as microglia can contribute to PI-controlled isoform
expression during CNS inflammation in response to IFNγ.
Cells expressing myeloid DC markers (CD11c+, CD11b+, CD8α-,
DEC 205-) have been identified in the CNS and cervical draining lymph

143
nodes (CLNs) during JHMV infection (Trifilo and Lane 2004). These cells are
associated with IL-12p70, and low IL-10 expression, suggesting they can
drive Th1-type responses (Trifilo and Lane 2004). Additional evidence for the
presence of mDCs in the CNS of JHMV infected mice is seen in IFNγ
deficient mice. A subset of CD45
hi
, F4/80
+
cells express MHC class II without
IFNγ induction, a finding consistent with previous, related experiments
(Bergmann et al. 2004; Stohlman et al. 2008) further indicating heterogeneity
within this population. Additionally, only the PI associated Ciita isoform was
readily detectable in this population in the absence of IFNγ. Furthermore H2-
Aα1 and PI-associated transcript levels did not alter significantly during
infection of IFNγ
-/-
mice, indicating post-transcriptional mechanisms for class
II surface expression. All together these features strongly suggest mDCs are
present within the infiltrating F4/80
+
population during JHMV infection of the
CNS.
To distinguish F4/80
+
,CD11b
+
mDCs from macrophages and microglia
in the inflamed CNS, CD11c has been used as the primary marker
(Pashenkov et al. 2003). However this has proved less useful as more cell
Table 6.2. Unique features of myeloid dendritic cell regulation of class II
Constitutive expression of PI Ciita isoform (LeibundGut-Landmann et
al. 2004)
CIITA independent expression of class II (Williams et al. 1998)
IFNγ independent expression of class II (Waldburger et al. 2001)
Post-transcriptional upregulation of class II
surface expression
(Watts et al. 2007)

144
types have been demonstrated to express CD11c in a variety of inflammatory
conditions. While we found CD11c expression in the context of CD45
hi
,
F4/80
+
cells was also associated with greater MHC class II expression,
CD11c expression alone does not distinguish mDCs from other cell types.
Furthermore, since CD11c is an integrin expressed by several diverse cell
types there is no indication that expression of CD11c confers a unique trait in
DC function.
Although the infiltrating F4/80
+
, MHC class II
+
population presumably
composed of mDCs in the IFNγ-/- mice are limited in number and their
expression of MHC class II is low, they may potentiate CD4 T cell functions.
In myelin oligodendrocytic glycoprotein (MOG) induced EAE, mDCs
compose ~10% of the infiltrating population and are found in the vicinity of
CD4 T cells (Bailey et al. 2007). More importantly mDCs isolated from the
CNS of EAE mice can present endogenous myelin peptide to TCR-
transgenic T cells, driving Th17 responses that are found to be detrimental
during EAE (Bailey et al. 2007; Miller et al. 2007).
JHMV infection of IFNγ
-/-
mice offers an opportunity for phenotypic
characterization of a functionally identified population resembling dendritic
cells present in the CNS during immune-mediated demyelination. Their
potential contribution to pathogenesis during JHMV infection may prove
relevant as IFNγ
-/-
mice exhibit similar demyelination as wild type mice (Parra
et al. 1999) and transfer of IFNγ
-/-
CD4 T cells into infected RAG
-/-
mice suffer

145
even worse demyelination than recipients of wild type CD4 T cells (Pewe et
al. 2002). mDCs may be the initial presenters of MHC class II complexes to
CD4 T cells especially early during infection prior to, or in the absence of,
IFNγ stimulation.

146
Chapter 6 References

Aktas O, Smorodchenko A, Brocke S, Infante-Duarte C, Schulze Topphoff U,
Vogt J, Prozorovski T, Meier S, Osmanova V, Pohl E and others.
2005. Neuronal damage in autoimmune neuroinflammation mediated
by the death ligand TRAIL. Neuron 46(3):421-32.

Aravalli RN, Hu S, Rowen TN, Gekker G, Lokensgard JR. 2006. Differential
apoptotic signaling in primary glial cells infected with herpes simplex
virus 1. J Neurovirol 12(6):501-10.

Bailey SL, Carpentier PA, McMahon EJ, Begolka WS, Miller SD. 2006.
Innate and adaptive immune responses of the central nervous system.
Crit Rev Immunol 26(2):149-88.

Bailey SL, Schreiner B, McMahon EJ, Miller SD. 2007. CNS myeloid DCs
presenting endogenous myelin peptides 'preferentially' polarize CD4+
T(H)-17 cells in relapsing EAE. Nat Immunol 8(2):172-80.

Bergmann CC, Parra B, Hinton DR, Chandran R, Morrison M, Stohlman SA.
2003. Perforin-mediated effector function within the central nervous
system requires IFN-gamma-mediated MHC up-regulation. J Immunol
170(6):3204-13.

Bergmann CC, Parra B, Hinton DR, Ramakrishna C, Dowdell KC, Stohlman
SA. 2004. Perforin and gamma interferon-mediated control of
coronavirus central nervous system infection by CD8 T cells in the
absence of CD4 T cells. J Virol 78(4):1739-50.

Bettelli E. 2007. Building different mouse models for human MS. Ann N Y
Acad Sci 1103:11-8.

Beyer M, Wang H, Peters N, Doths S, Koerner-Rettberg C, Openshaw PJ,
Schwarze J. 2005. The beta2 integrin CD11c distinguishes a subset of
cytotoxic pulmonary T cells with potent antiviral effects in vitro and in
vivo. Respir Res 6:70.

Bullard DC, Hu X, Adams JE, Schoeb TR, Barnum SR. 2007. p150/95
(CD11c/CD18) expression is required for the development of
experimental autoimmune encephalomyelitis. Am J Pathol
170(6):2001-8.

Calder VL, Wolswijk G, Noble M. 1988. The differentiation of O-2A progenitor
cells into oligodendrocytes is associated with a loss of inducibility of Ia
antigens. Eur J Immunol 18(8):1195-201.

147
Cannella B, Gaupp S, Omari KM, Raine CS. 2007. Multiple sclerosis: death
receptor expression and oligodendrocyte apoptosis in established
lesions. J Neuroimmunol 188(1-2):128-37.

Dorr J, Bechmann I, Waiczies S, Aktas O, Walczak H, Krammer PH, Nitsch
R, Zipp F. 2002. Lack of tumor necrosis factor-related apoptosis-
inducing ligand but presence of its receptors in the human brain. J
Neurosci 22(4):RC209.

Hoftberger R, Aboul-Enein F, Brueck W, Lucchinetti C, Rodriguez M,
Schmidbauer M, Jellinger K, Lassmann H. 2004. Expression of major
histocompatibility complex class I molecules on the different cell types
in multiple sclerosis lesions. Brain Pathol 14(1):43-50.

Horwitz MS, Evans CF, Klier FG, Oldstone MB. 1999. Detailed in vivo
analysis of interferon-gamma induced major histocompatibility
complex expression in the the central nervous system: astrocytes fail
to express major histocompatibility complex class I and II molecules.
Lab Invest 79(2):235-42.

Hovelmeyer N, Hao Z, Kranidioti K, Kassiotis G, Buch T, Frommer F, von
Hoch L, Kramer D, Minichiello L, Kollias G and others. 2005.
Apoptosis of oligodendrocytes via Fas and TNF-R1 is a key event in
the induction of experimental autoimmune encephalomyelitis. J
Immunol 175(9):5875-84.

Kadiu I, Glanzer JG, Kipnis J, Gendelman HE, Thomas MP. 2005.
Mononuclear phagocytes in the pathogenesis of neurodegenerative
diseases. Neurotox Res 8(1-2):25-50.

Lane TE, Liu MT, Chen BP, Asensio VC, Samawi RM, Paoletti AD, Campbell
IL, Kunkel SL, Fox HS, Buchmeier MJ. 2000. A central role for CD4(+)
T cells and RANTES in virus-induced central nervous system
inflammation and demyelination. J Virol 74(3):1415-24.

LeibundGut-Landmann S, Waldburger JM, Reis e Sousa C, Acha-Orbea H,
Reith W. 2004. MHC class II expression is differentially regulated in
plasmacytoid and conventional dendritic cells. Nat Immunol 5(9):899-
908.

Liu MT, Lane TE. 2001. Chemokine expression and viral infection of the
central nervous system: regulation of host defense and
neuropathology. Immunol Res 24(2):111-9.

148
Malone KE, Stohlman SA, Ramakrishna C, Macklin W, Bergmann CC. 2008.
Induction of class I antigen processing components in oligodendroglia
and microglia during viral encephalomyelitis. Glia 56(4):426-35.

Martinez A, Alvarez-Lafuente R, Mas A, Bartolome M, Garcia-Montojo M, de
Las Heras V, de la Concha EG, Arroyo R, Urcelay E. 2007.
Environment-gene interaction in multiple sclerosis: human herpesvirus
6 and MHC2TA. Hum Immunol 68(8):685-9.

Matsumoto Y, Fujiwara M. 1986. In situ detection of class I and II major
histocompatibility complex antigens in the rat central nervous system
during experimental allergic encephalomyelitis. An
immunohistochemical study. J Neuroimmunol 12(4):265-77.

McElroy JP, Oksenberg JR. 2008. Multiple sclerosis genetics. Curr Top
Microbiol Immunol 318:45-72.

Miller SD, McMahon EJ, Schreiner B, Bailey SL. 2007. Antigen presentation
in the CNS by myeloid dendritic cells drives progression of relapsing
experimental autoimmune encephalomyelitis. Ann N Y Acad Sci
1103:179-91.

Muhlethaler-Mottet A, Di Berardino W, Otten LA, Mach B. 1998. Activation of
the MHC class II transactivator CIITA by interferon-gamma requires
cooperative interaction between Stat1 and USF-1. Immunity 8(2):157-
66.

Nikcevich KM, Piskurich JF, Hellendall RP, Wang Y, Ting JP. 1999.
Differential selectivity of CIITA promoter activation by IFN-gamma and
IRF-1 in astrocytes and macrophages: CIITA promoter activation is
not affected by TNF-alpha. J Neuroimmunol 99(2):195-204.

O'Keefe GM, Nguyen VT, Ping Tang LL, Benveniste EN. 2001. IFN-gamma
regulation of class II transactivator promoter IV in macrophages and
microglia: involvement of the suppressors of cytokine signaling-1
protein. J Immunol 166(4):2260-9.

Parra B, Hinton DR, Marten NW, Bergmann CC, Lin MT, Yang CS, Stohlman
SA. 1999. IFN-gamma is required for viral clearance from central
nervous system oligodendroglia. J Immunol 162(3):1641-7.

Pashenkov M, Teleshova N, Link H. 2003. Inflammation in the central
nervous system: the role for dendritic cells. Brain Pathol 13(1):23-33.

149
Pewe L, Haring J, Perlman S. 2002. CD4 T-cell-mediated demyelination is
increased in the absence of gamma interferon in mice infected with
mouse hepatitis virus. J Virol 76(14):7329-33.

Piskurich JF, Lin KI, Lin Y, Wang Y, Ting JP, Calame K. 2000. BLIMP-I
mediates extinction of major histocompatibility class II transactivator
expression in plasma cells. Nat Immunol 1(6):526-32.

Ponomarev ED, Shriver LP, Maresz K, Dittel BN. 2005. Microglial cell
activation and proliferation precedes the onset of CNS autoimmunity.
J Neurosci Res 81(3):374-89.

Redwine JM, Buchmeier MJ, Evans CF. 2001. In vivo expression of major
histocompatibility complex molecules on oligodendrocytes and
neurons during viral infection. Am J Pathol 159(4):1219-24.

Stohlman SA, Hinton DR, Parra B, Atkinson R, Bergmann CC. 2008. CD4 T
cells contribute to virus control and pathology following central
nervous system infection with neurotropic mouse hepatitis virus. J
Virol 82(5):2130-9.

Takeuchi O, Sims TN, Takei Y, Ramassar V, Famulski KS, Halloran PF.
2003. Differential usage of class II transactivator promoters PI and PIV
during inflammation and injury in kidney. J Am Soc Nephrol
14(11):2823-32.

Templeton SP, Kim TS, O'Malley K, Perlman S. 2008. Maturation and
localization of macrophages and microglia during infection with a
neurotropic murine coronavirus. Brain Pathol 18(1):40-51.

Trifilo MJ, Lane TE. 2004. The CC chemokine ligand 3 regulates
CD11c+CD11b+CD8alpha- dendritic cell maturation and activation
following viral infection of the central nervous system: implications for
a role in T cell activation. Virology 327(1):8-15.

Waldburger JM, Suter T, Fontana A, Acha-Orbea H, Reith W. 2001.
Selective abrogation of major histocompatibility complex class II
expression on extrahematopoietic cells in mice lacking promoter IV of
the class II transactivator gene. J Exp Med 194(4):393-406.

Wang FI, Hinton DR, Gilmore W, Trousdale MD, Fleming JO. 1992.
Sequential infection of glial cells by the murine hepatitis virus JHM
strain (MHV-4) leads to a characteristic distribution of demyelination.
Lab Invest 66(6):744-54.

150
Watts C, Zaru R, Prescott AR, Wallin RP, West MA. 2007. Proximal effects of
Toll-like receptor activation in dendritic cells. Curr Opin Immunol
19(1):73-8.

Williams GS, Malin M, Vremec D, Chang CH, Boyd R, Benoist C, Mathis D.
1998. Mice lacking the transcription factor CIITA--a second look. Int
Immunol 10(12):1957-67.

Wong GHW, Bartlett PF, Clark-Lewis I, Battye F, Schrader JW. 1984.
Inducible expression of H-2 and Ia antigens on brain cells. Nature
310(5979):688-691.

Wosik K, Antel J, Kuhlmann T, Bruck W, Massie B, Nalbantoglu J. 2003.
Oligodendrocyte injury in multiple sclerosis: a role for p53. J
Neurochem 85(3):635-44.

Wright KL, Ting JP. 2006. Epigenetic regulation of MHC-II and CIITA genes.
Trends Immunol 27(9):405-12.

Wu GF, Dandekar AA, Pewe L, Perlman S. 2000. CD4 and CD8 T cells have
redundant but not identical roles in virus-induced demyelination. J
Immunol 165(4):2278-86.

Youssef S, Stuve O, Patarroyo JC, Ruiz PJ, Radosevich JL, Hur EM, Bravo
M, Mitchell DJ, Sobel RA, Steinman L and others. 2002. The HMG-
CoA reductase inhibitor, atorvastatin, promotes a Th2 bias and
reverses paralysis in central nervous system autoimmune disease.
Nature 420(6911):78-84.

151
Chapter 7: Early events in JHMV infection and the role of interferons.

A model of early events in JHMV infection in vivo.
Based on the data presented in this thesis and the previous work done
in this model of viral infection in the CNS, I endeavor to expand on the model
of early events taking place during JHMV infection. Following intracranial
inoculation JHMV spreads rapidly from the ependymal cell layers of the
ventricles to the glia within the parenchyma and the majority of glia cell types,
including microglia and oligodendroglia, appear susceptible to initial viral
infection (Fig. 2.2) (Wang et al. 1992). Common to other viral infections,
direct interaction of cells with virus triggers early, local IFNαβ responses
(Randall and Goodbourn 2008). Similarly, the IFNβ response was also
observed to be a local event during SARS-CoV infection of the respiratory
system of macaques (de Lang et al. 2007). During JHMV infection, glia
upregulate IFNβ in correlation with genomic-length vRNA levels, with the
notable exception of oligodendroglia (Fig. 2.2 & 3.3). Microglia are the most
prominent producer of IFNβ identified in the CNS during JHMV infection (Fig.
3.3B). Although several cell types do not appear to induce IFNαβ in response
to MHV infection, including fibroblasts and bone marrow derived DCs (Zhou
and Perlman 2007) this data does not rule out the potential contributions by
other cells including astrocytes, pDCs, endothelial cells and even neurons
(Cervantes-Barragan et al. 2007; Delhaye et al. 2006; Wang et al. 1998).
Although pDCs are characterized as high IFNα producers, in vivo

152
experiments with IFNα6-GFP reporter mice have demonstrated pDC
involvement in viral infection is likely organ specific and tissue-resident
macrophages are the primary source of IFNα in localized infection in the lung
but not systemic infection (Kumagai et al. 2007). We currently find no
evidence for strong pDC involvement during JHMV infection in the CNS
(unpublished data from Derek Ireland). Similarly microglia appeared to
account for the majority of IFNαβ induced during JHMV infection in the CNS
(Chapter 3).
Microglia also express a broad repertoire of PAMP-receptors (Bsibsi
et al. 2002; Olson and Miller 2004). They constitutively expressed high levels
of transcripts encoding PAMP-receptors that may recognize vRNA, including
TLR7 (Fig. 3.5) which is implicated in pDC recognition of MHV infection
(Cervantes-Barragan et al. 2007). Microglia further upregulated their
expression of PAMP-receptors during acute infection (Fig.3.5), suggesting
they increase their sensitivity to potential danger signals associated with viral
infection. In contrast, the limited repertoire of PAMP-receptors expressed by
oligodendroglia during JHMV infection (Fig. 3.5) may not support their
recognition of MHV and subsequently they do not contribute to the IFNβ
response during this infection (Fig. 3.3). It does not appear oligodendroglia
are incapable of inducing an IFNαβ response at all, but rather suggests they
do not receive the appropriate signals during this particular infection. For
example oligodendroglia expressed the common cytosolic pathway for

153
detecting vRNA products (RIG-I & Mda5) (Fig. 3.5). While these pathways
are not triggered by MHV (Zhou and Perlman 2007) oligodendroglia could be
capable of recognizing exposed dsRNA or uncapped RNA from different
viruses and inducing IFNαβ. Furthermore this indicates microglia, as
opposed to other glia, are best suited for detecting pathogens and supports a
strong protective role for microglia in preventing widespread infection prior to
engagement with adaptive immune responses.
Although oligodendroglia did not participate in the autocrine IFNαβ
response during JHMV infection, they did respond to exogenous IFNαβ in
vivo. This was shown by their early upregulation of ISGs (Mda5 and RIG-I,
that also serve as PAMP-receptors for vRNA) that was abrogated in
oligodendroglia lacking a functional IFNαβ-receptor (Fig. 3.6). However ISG
induction in oligodendroglia appears limited to a subset of genes (Fig. 3.7). A
similar profile of limited ISG expression is also exhibited by IKKε
-/-
cells in
response to IFNβ due to alterations in STAT1 phosphorylation (Tenoever et
al. 2007). Also during influenza infection IKKε
-/-
mice are unable to clear virus
despite mounting a proinflammatory immune response (Tenoever et al.
2007). Although IKKε is induced in response to inflammatory signals,
including TNFα and IL-6 that are also expressed during JHMV infection
(Parra et al. 1997; Wang et al. 2005), mature oligodendroglia did not induce
IKKε transcripts during JHMV infection (Fig. 3.7). Based on the lack of IKKε
in oligodendroglia, their ISG profile in response to IFNαβ signaling during

154
Table 7.1. ISGs induced by mature oligodendroglia during JHMV
infection in vivo. ISGs expressed by oligodendroglia are segregated
according to requirements for IKKε activity as identified in TenOever et al.
2007.
IKKε ε ε ε-independent ISGs
Expression by oligodendroglia?
STAT1 Yes, Gonzalez et al Glia 2005
Tap1 Yes, Malone et al Glia 2008
Mda5 Yes (Fig. 3.5)
Ifit2 (ISG54) Yes (Fig. 3.7)
IKKε ε ε ε-dependent ISGs
Adar1 No (Fig. 3.7)
TLR3 No (Fig. 3.5)
JHMV infection was also predicted to limited. Further examination of the
ISGs expressed by oligodendroglia during viral infection also supports an
IKKε-independent interferon response (Table 7.1).
This also suggests oligodendroglia are only capable of establishing a
partial anti-viral state, leaving them particularly susceptible to viral infection.
However extensive profiling of mature oligodendroglia during JHMV infection
is required to determine if oligodendroglia indeed fit an IKKε-independent
pattern of ISG expression. This also suggests the potential for viral
antagonism of this pathway. Members of rubulavirus can interfere with the
TBK1/IKKε pathway. They encode proteins that can act as targets for
TBK1/IKKε phosphorylation potentially behaving as decoys and inhibiting
downstream signaling (Lu et al. 2008). However IKKε does not appear to be
induced at all in mature oligodendroglia suggesting a different mechanism for
its suppression. Further investigation into the role of IFNαβ signaling and its
potential modulation by IKKε in contributing to control of JHMV infection is

155
also important as it remains unknown exactly which ISGs are responsible for
impairing coronavirus infections.

Enter T cells
In addition to inducing IFNαβ responses, viral infection also stimulates
the production of other inflammatory cytokines and chemokines from infected
and uninfected cells, promoting disruption of the blood brain barrier and the
recruitment of leukocytes into the CNS (Lane et al. 1998; Lane et al. 2000).
Naïve T cells are believed to be primed in the cervical lymph nodes prior to
CNS infiltration (Marten et al. 2003). By day 5 p.i., T cells begin entering the
brain first and then into the spinal cord following the spread of virus (Fig. 1.3)
(Bergmann et al. 2001). The initial interactions between virus-specific CD8+
T cells and infected glia are mediated through microglia, as they are the first
glial cells to express MHC class I on their surface (Hamo et al. 2007;
Hindinger et al. 2005; Malone et al. 2008), further supporting their critical role
in guiding the emerging adaptive immune response. Early expression of
MHC class I by microglia appears mediated by IFNαβ responses in these
cells (Ch. 4) (Ireland et al. 2008b; Malone et al. 2008) similar to TMEV
infection (Njenga et al. 1997).
This interaction triggers a cascade of important events. 1)
MHC:peptide presentation facilitates TCR engagement to initiate CD8 T cell
effector mechanisms including the secretion of IFNγ (Parra et al. 2001). (2)

156
IFNγ drives the expression of MHC, both of class I and class II in specific cell
types. Oligodendroglia express MHC class I in response to IFNγ (Malone et
al. 2008), and microglia express MHC class II as well as further upregulate
expression of class I (Bergmann et al. 2003; Malone et al. 2008). (3) CD8 T
cells effectively clear viral infection from microglia and astrocytes by perforin-
mediated cytolytic mechanisms (Bergmann et al. 2004; Lin et al. 1997). This
coincides with the decline of vRNA (Fig. 2.2) and detection of viral
nucleocapsid protein in these populations (Gonzalez et al. 2006; Parra et al.
1999). However oligodendroglia appear refractory to cytolytic activity
(Bergmann et al. 2004; Gonzalez et al. 2006; Parra et al. 1999) possibly due
to their upregulation of the inhibitory ligand, PD-L1, in concert with MHC
class I (Ch. 5 and unpublished data by Ramakrishna Chandran and Timothy
Phares). This is associated with the continued presence of vRNA (Ch. 2) and
the prolonged detection of nucleocapsid protein in oligodendroglia (Gonzalez
et al. 2006; Wang et al. 1992) (4) T-cell mediated clearance of virus from
IFNαβ producing cells, most notably microglia, results in the decline of IFNαβ
responses (Ch. 3). (5) The decline in IFNαβ responses coincides with the
dramatic increase of genomic-length vRNA in mature oligodendroglia
suggesting increased susceptibility to infection (Fig. 2.2). (6) The culmination
of T cell effector activities, humoral responses and potentially further innate
immunity control infectious virus and virion levels decline to below detection
but oligodendroglia remain a reservoir for viral infection.

157
Interferon responses by glia during JHMV infection
Figure 7.1 A model of interferon responses by glia during the acute phase of JHMV infection. The cartoon strip above
depicts the three major classes of glia (microglia, astrocytes and oligodendroglia) during the initial stages of viral spread. Early
encounter with virus induces interferon-αβ expression by cells other than oligodendroglia, impairing viral spread in all cell types
and induces MHC class I presentation by microglia (left panel). Virus-specific CD8 T cells engage microglia triggering secretion of
interferon-γ that drives the expression of MHC class I on other cells and MHC class II expression by microglia (center panel). T
cells clear virus from microglia and astrocytes but expression of PD-L1 by oligodendroglia protects them from cytolytic activity
while interferon-γ impairs the production of infectious virus (right panel).
αβ
αβ
αβ
CD8
αβ
γ γ γ γ
γ γ γ γ
γ γ γ γ
γ γ γ γ
γ γ γ γ
γ γ γ γ
γ γ γ γ
γ γ γ γ
γ γ γ γ
γ γ γ γ
γ γ γ γ
γ γ γ γ
αβ
αβ
αβ
αβ αβ αβ αβ
αβ αβ αβ αβ
αβ αβ αβ αβ
CD8
γ γ γ γ
γ γ γ γ
γ γ γ γ γ γ γ γ
γ γ γ γ
γ γ γ γ
γ γ γ γ
γ γ γ γ
γ γ γ γ
CD8
CD8
γ γ γ γ
Microglia
Astrocyte
Oligodendroglia
class I
class II
PD-L1

158
Steps four and five, proposed above were previously unexplored
aspects of JHMV infection and indicate an indirect effect of adaptive immune
responses in modulating innate IFNαβ pathways. These considerations
prompt several questions. What is the role of IFNγ versus IFNαβ duringJHMV
infection of the CNS and how do these new considerations advance our
understanding of immune responses in the CNS?

Complimentary and distinct roles of IFNα α α αβ β β β and IFNγ γ γ γ in the CNS
While it has proven difficult to dissect the direct anti-viral effects of
IFNγ from its role in upregulating MHC thereby facilitating T cell interactions
with antigen presenting cells, several lines of experimentation have
demonstrated IFNγ also controls viral replication, particularly during the latter
acute phase when oligodendroglia become the predominant cell type
infected (Bergmann et al. 2006). More recently IFNαβ has been identified as
an important mediator of innate anti-viral responses during JHMV infection,
as IFNαβR
-/-
mice succumb to infection sooner than SCID mice lacking both
T and B cells, as well as IFNγ-deficient (GKO) mice (Fig. 7.2) (Bergmann et
al. 2004; Houtman and Fleming 1996; Ireland et al. 2008; Parra et al. 1999).
Without IFNαβ responses JHMV spreads rapidly uncontrolled into different
cell types in the CNS despite mounting a robust T cell response (Ireland et
al. 2008b). Even though SCID mice also suffer widespread infection and
viral titers are never controlled they have upregulated IFNβ mRNA levels

159
Figure 7.2 Effects of
immunodeficiency on viral infection.
Survival curves for different knock-out
or transgenic mice following intracranial
infection of JHMV. Note PLP-dnIFNgR
mice exhibit similar survival as wild type
mice. Data is compiled from the following references, (Bergmann et al. 2004;
Gonzalez et al. 2006; Houtman and Fleming 1996; Ireland et al. 2008; Parra
et al. 1999).

(Houtman and Fleming 1996; Ramakrishna et al. 2004), indicating continued
innate responses attempt to slow the spread of viral infection.
To specifically address the role of IFNγ signaling in oligodendroglia
transgenic mice expressing a dominant negative IFNγ receptor specifically in
oligodendroglia were developed (Gonzalez et al. 2005). These PLP-
dnIFNγR1 mice exhibited impaired IFNγ signaling specifically in
oligodendroglia without affecting other cell types (Gonzalez et al. 2005).

160
JHMV infection of PLP-dnIFNγR1 mice resulted in prolonged detection of
infectious virus and increased detection of nucleocapsid protein specifically
in oligodendroglia with impaired IFNγ signaling following acute infection
(Gonzalez et al. 2006). However viral infection was eventually controlled in
these mice as indicated by undetectable viral titers and few nucleocapsid
positive cells evident by day 30 p.i., also supporting a strong role for the
humoral response during persistence (Gonzalez et al. 2006). The remaining
nucleocapsid positive cells were identified as oligodendroglia by double
labeling, suggesting virus was cleared from other cell types similarly as in
wild type mice (Gonzalez et al. 2006). There were no differences in the
recruitment of virus-specific CD8 T cells to the CNS nor extent of
demyelination in these mice as compared to wild type (Fig. 7.2) (Gonzalez et
al. 2006). These experiments in PLP-dnIFNγR1 mice point to a direct anti-
viral role for IFNγ limiting viral replication in oligodendroglia during the latter
stage of acute infection, however MHC class I expression by oligodendroglia
was not evaluated and is expected to be depressed relative to wild type
(Malone et al. 2008).

Inverse expression of IFNβ versus IFNγ during JHMV infection.
The data presented in this thesis has brought to light an inverse
relationship between the expression of IFNβ and IFNγ during JHMV infection
(Fig. 3.2 & 7.3) that was not extensively considered in the above

161
IFNβ β β β versus IFNγ γ γ γ expression
days post infection
naive 3 5 7 10 14
Microglia expression of IFNb
transcripts relative to Gapdh
0
1
2
3
4
IFNg transcripts relative to Gapdh
in the whole brain
0
2
4
6
8
10
12
IFNb (Microglia)
IFNg (Brain)

Figure 7.3 Downregulation of IFNβ β β β expression coincides with
upregulation of IFNγ γ γ γ expression. Pink boxes indicate IFNβ mRNA levels
detected in microglia from infected PLP-GFP/B6 and B6 mice. For days 3-10
the floating boxes indicate the range of values for 3-5 experiments for which
statistical analysis could be performed showing significant upregulation of
IFNβ transcripts in microglia relative to naïve microglia. ** and * equals
p<0.005 and p<0.01 respectively. NS denotes not significant. Values for day
14 are from two experiments. IFNγ mRNA levels (gray boxes) detected in
whole brain RNA from three individuals per timepoint. ND denotes not
detected and NA is not available.
experiments. Microglia were identified as the prominent source of IFNβ and
their expression strongly correlates with detection of vRNA associated with
them (Ch. 3). This suggests that microglia produce IFNαβ in direct response
to viral infection. So when anti-viral T cell responses effectively control
ND NA
**
*
*
NS

162
infection in microglia the IFNβ response is down regulated, leading to the
inverse relationship with IFNγ (Fig. 7.1 & 7.3). The consequences of this
relationship are potentially wide reaching with respect to anti-viral activity.

Oligodendroglia also benefit from early IFNβ responses.
Although both interferons exhibit direct anti-viral activity, IFNβ is
consistently more potent compared to IFNγ and the two are not entirely
interchangeable (Muller et al. 1994). This is implied from in vivo infections of
various transgenic or knock-out mice summarized earlier (Fig. 7.2) but direct
in vitro studies also demonstrate on a per unit basis pretreatment of cells with
IFNβ or IFNγ consistently results in stronger inhibition of MHV by IFNβ than
IFNγ (Sainz et al. 2004). This is likely due to the different spectrum of ISGs
and the magnitude of their induction by IFNβ compared to IFNγ in different
cell types (de Veer et al. 2001; Der et al. 1998). Profiling of cells treated with
either IFNβ or IFNγ demonstrated ISGs involved in intracellular anti-viral
pathways such as PKR and 2’-5’OAS are more readily induced by IFNβ
signaling than IFNγ (Der et al. 1998). In vivo, IFNαβR
-/-
mice infected with
JHMV also fail to upregulate these ISGs to levels achieved in wild type mice,
despite enhanced expression of IFNγ (Ireland et al. 2008). Conversely,
antigen processing and presentation pathway genes as well as IRF-1 are
induced to higher levels in IFNγ treated cells as compared to IFNβ treated

163
cells (Der et al. 1998). Given IFNγ is predominantly expressed by T cells it
follows that a major function of IFNγ is to promote the interaction between T
cells and antigen presenting cells or target cells through the upregulation of
MHC. Even though IFNαβ has overlapping features with IFNγ their distinct
signaling pathways indicate the two classes of interferons are not completely
interchangeable.
Interestingly oligodendroglia also exhibited distinct patterns of ISG
induction in response to the opposing kinetics of IFNβ and IFNγ during viral
infection. Early expression of intracellular anti-viral pathways Mda5 and RIG-I
in oligodendroglia was in response to IFNαβ (Ch. 3), whereas their delayed
MHC class I pathway genes were distinctly induced in relation to IFNγ
signaling (Ch. 4) (Malone et al. 2008).
However the most striking effect on oligodendroglia is their dramatic
increase in infection occurring at this junction of IFNβ and IFNγ expression
(Fig. 7.4). This supports a strong role for IFNβ in reducing viral spread, not
only in other cell types but also for oligodendroglia. Exogenous IFNβ may be
even more crucial for oligodendroglia as they did not participate in autocrine
IFNαβ responses during JHMV infection and their incoming IFNαβ signal
appears somewhat limited (Ch.3). This also implies IFNγ cannot completely
substitute for IFNβ anti-viral activity as JHMV still exhibits a propensity
towards oligodendroglia even in wild type, IFNγ competent mice (Ch.2)

164

Figure 7.4 Overview of
interferon kinetics in
relation to infection of
oligodendroglia and
control of infectious
virus. The schematic to
the left depicts the
patterns IFNβ and IFNγ
responses highlighting the
transition period
associated with increased
vRNA in mature
oligodendroglia.

(Gonzalez et al. 2006). Additionally, IFNαβR
-/-
mice express far higher levels
of IFNγ during infection yet are unable to control viral spread (Ireland et al.
2008). This limitation of IFNγ anti-viral activity is indicated in vitro as
pretreatment of cells with IFNγ prior to infection with MHV-A59 or JHMV is
required to limit their degree of susceptibility, otherwise IFNγ is only weakly
anti-viral during ongoing infection (Zhang et al. 1997).
In addition to altering intracellular anti-viral responses, IFNβ alters viral gene
expression directly. IFNβ treatment in vitro reduces overall viral replication
and vRNA expression but differentially reduces the expression of viral
proteins for both MHV-A59 and parental JHMV strains of virus (Taguchi and
Siddell 1985). IFNβ activity reduces spike (S) and membrane (M) protein

3 14 10 7 5
days post infection
vRNA oligodendroglia
IFNβ (microglia)
IFNγ (T cells)
Viral titers
arbitrary units

165
expression by 70- 95%, while only reducing nucleocapsid (N) expression by
30-50% (Taguchi and Siddell 1985). It remains unclear how IFNγ may affect
JHMV replication directly but it may alter viral gene expression differently that
IFNβ.
Investigations in other viral infections of the CNS also point to an anti-
inflammatory role for IFNβ. TMEV infection in the murine CNS also leads to
immune-mediated demyelination and chronic viral infection. Administration of
IFNβ (i.v.) for five weeks during chronic TMEV disease promotes
remyelination (Njenga et al. 2000). Although they did not evaluate the effect
of IFNβ on viral replication directly it did not alter the number of cells infected,
but it was associated with decreased lymphocyte infiltration (Njenga et al.
2000).
These findings highlight the cooperative network between different
glial cell types, type I verus type II interferons and the adaptive immune
response in controlling viral infection in the CNS. Furthermore it underscores
the requirement for an intact innate immune response by resident cells in
finally attaining a successful adaptive immune response, particularly within
the central nervous system.

166
Chapter 7 References

Bergmann CC, Altman JD, Hinton D, Stohlman SA. 1999. Inverted
immunodominance and impaired cytolytic function of CD8+ T cells
during viral persistence in the central nervous system. J Immunol
163(6):3379-87.
Bergmann CC, Lane TE, Stohlman SA. 2006. Coronavirus infection of the
central nervous system: host-virus stand-off. Nat Rev Microbiol
4(2):121-32.
Bergmann CC, Parra B, Hinton DR, Chandran R, Morrison M, Stohlman SA.
2003. Perforin-mediated effector function within the central nervous
system requires IFN-gamma-mediated MHC up-regulation. J Immunol
170(6):3204-13.
Bergmann CC, Parra B, Hinton DR, Ramakrishna C, Dowdell KC, Stohlman
SA. 2004. Perforin and gamma interferon-mediated control of
coronavirus central nervous system infection by CD8 T cells in the
absence of CD4 T cells. J Virol 78(4):1739-50.
Bergmann CC, Ramakrishna C, Kornacki M, Stohlman SA. 2001. Impaired T
cell immunity in B cell-deficient mice following viral central nervous
system infection. J Immunol 167(3):1575-83.
Bsibsi M, Ravid R, Gveric D, van Noort JM. 2002. Broad expression of Toll-
like receptors in the human central nervous system. J Neuropathol
Exp Neurol 61(11):1013-21.
Cervantes-Barragan L, Zust R, Weber F, Spiegel M, Lang KS, Akira S, Thiel
V, Ludewig B. 2007. Control of coronavirus infection through
plasmacytoid dendritic-cell-derived type I interferon. Blood
109(3):1131-7.
de Lang A, Baas T, Teal T, Leijten LM, Rain B, Osterhaus AD, Haagmans
BL, Katze MG. 2007. Functional genomics highlights differential
induction of antiviral pathways in the lungs of SARS-CoV-infected
macaques. PLoS Pathog 3(8):e112.
de Veer MJ, Holko M, Frevel M, Walker E, Der S, Paranjape JM, Silverman
RH, Williams BR. 2001. Functional classification of interferon-
stimulated genes identified using microarrays. J Leukoc Biol
69(6):912-20.

167
Delhaye S, Paul S, Blakqori G, Minet M, Weber F, Staeheli P, Michiels T.
2006. Neurons produce type I interferon during viral encephalitis. Proc
Natl Acad Sci U S A 103(20):7835-40.
Der SD, Zhou A, Williams BR, Silverman RH. 1998. Identification of genes
differentially regulated by interferon alpha, beta, or gamma using
oligonucleotide arrays. Proc Natl Acad Sci U S A 95(26):15623-8.
Gonzalez JM, Bergmann CC, Fuss B, Hinton DR, Kangas C, Macklin WB,
Stohlman SA. 2005. Expression of a dominant negative IFN-
gammareceptor on mouse oligodendrocytes. Glia 51(1):22-34.
Gonzalez JM, Bergmann CC, Ramakrishna C, Hinton DR, Atkinson R,
Hoskin J, Macklin WB, Stohlman SA. 2006. Inhibition of interferon-
gamma signaling in oligodendroglia delays coronavirus clearance
without altering demyelination. Am J Pathol 168(3):796-804.
Hamo L, Stohlman SA, Otto-Duessel M, Bergmann CC. 2007. Distinct
regulation of MHC molecule expression on astrocytes and microglia
during viral encephalomyelitis. Glia 55(11):1169-77.
Hindinger C, Gonzalez JM, Bergmann CC, Fuss B, Hinton DR, Atkinson RD,
Macklin WB, Stohlman SA. 2005. Astrocyte expression of a dominant-
negative interferon-gamma receptor. J Neurosci Res 82(1):20-31.
Houtman JJ, Fleming JO. 1996. Dissociation of demyelination and viral
clearance in congenitally immunodeficient mice infected with murine
coronavirus JHM. J Neurovirol 2(2):101-10.
Ireland DD, Stohlman SA, Hinton DR, Atkinson R, Bergmann CC. 2008. Type
I interferons are essential in controlling neurotropic coronavirus
infection irrespective of functional CD8 T cells. J Virol 82(1):300-10.
Kumagai Y, Takeuchi O, Kato H, Kumar H, Matsui K, Morii E, Aozasa K,
Kawai T, Akira S. 2007. Alveolar macrophages are the primary
interferon-alpha producer in pulmonary infection with RNA viruses.
Immunity 27(2):240-52.
Lane TE, Asensio VC, Yu N, Paoletti AD, Campbell IL, Buchmeier MJ. 1998.
Dynamic regulation of alpha- and beta-chemokine expression in the
central nervous system during mouse hepatitis virus-induced
demyelinating disease. J Immunol 160(2):970-8.

168
Lane TE, Liu MT, Chen BP, Asensio VC, Samawi RM, Paoletti AD, Campbell
IL, Kunkel SL, Fox HS, Buchmeier MJ. 2000. A central role for CD4(+)
T cells and RANTES in virus-induced central nervous system
inflammation and demyelination. J Virol 74(3):1415-24.
Lin MT, Stohlman SA, Hinton DR. 1997. Mouse hepatitis virus is cleared from
the central nervous systems of mice lacking perforin-mediated
cytolysis. J Virol 71(1):383-91.
Lu LL, Puri M, Horvath CM, Sen GC. 2008. Select paramyxoviral V proteins
inhibit IRF3 activation by acting as alternative substrates for
IKKE/TBK1. J Biol Chem.
Malone KE, Stohlman SA, Ramakrishna C, Macklin W, Bergmann CC. 2008.
Induction of class I antigen processing components in oligodendroglia
and microglia during viral encephalomyelitis. Glia 56(4):426-35.
Marten NW, Stohlman SA, Zhou J, Bergmann CC. 2003. Kinetics of virus-
specific CD8+ -T-cell expansion and trafficking following central
nervous system infection. J Virol 77(4):2775-8.
Muller U, Steinhoff U, Reis LF, Hemmi S, Pavlovic J, Zinkernagel RM, Aguet
M. 1994. Functional role of type I and type II interferons in antiviral
defense. Science 264(5167):1918-21.
Njenga MK, Coenen MJ, DeCuir N, Yeh HY, Rodriguez M. 2000. Short-term
treatment with interferon-alpha/beta promotes remyelination, whereas
long-term treatment aggravates demyelination in a murine model of
multiple sclerosis. J Neurosci Res 59(5):661-70.
Njenga MK, Pease LR, Wettstein P, Mak T, Rodriguez M. 1997. Interferon
alpha/beta mediates early virus-induced expression of H-2D and H-2K
in the central nervous system. Lab Invest 77(1):71-84.
Olson JK, Miller SD. 2004. Microglia initiate central nervous system innate
and adaptive immune responses through multiple TLRs. J Immunol
173(6):3916-24.
Parra B, Bergmann CC, Hinton DR, Atkinson R, Stohlman SA. 2001. IFN-
gamma secreted by virus-specific CD8+ T cells contribute to CNS viral
clearance. Adv Exp Med Biol 494:335-40.
Parra B, Hinton DR, Lin MT, Cua DJ, Stohlman SA. 1997. Kinetics of
cytokine mRNA expression in the central nervous system following
lethal and nonlethal coronavirus-induced acute encephalomyelitis.
Virology 233(2):260-70.

169
Parra B, Hinton DR, Marten NW, Bergmann CC, Lin MT, Yang CS, Stohlman
SA. 1999. IFN-gamma is required for viral clearance from central
nervous system oligodendroglia. J Immunol 162(3):1641-7.
Ramakrishna C, Bergmann CC, Holmes KV, Stohlman SA. 2004. Expression
of the mouse hepatitis virus receptor by central nervous system
microglia. J Virol 78(14):7828-32.
Randall RE, Goodbourn S. 2008. Interferons and viruses: an interplay
between induction, signalling, antiviral responses and virus
countermeasures. J Gen Virol 89(Pt 1):1-47.
Sainz B, Jr., Mossel EC, Peters CJ, Garry RF. 2004. Interferon-beta and
interferon-gamma synergistically inhibit the replication of severe acute
respiratory syndrome-associated coronavirus (SARS-CoV). Virology
329(1):11-7.
Taguchi F, Siddell SG. 1985. Difference in sensitivity to interferon among
mouse hepatitis viruses with high and low virulence for mice. Virology
147(1):41-8.
Tenoever BR, Ng SL, Chua MA, McWhirter SM, Garcia-Sastre A, Maniatis T.
2007. Multiple functions of the IKK-related kinase IKKepsilon in
interferon-mediated antiviral immunity. Science 315(5816):1274-8.
Wang FI, Hinton DR, Gilmore W, Trousdale MD, Fleming JO. 1992.
Sequential infection of glial cells by the murine hepatitis virus JHM
strain (MHV-4) leads to a characteristic distribution of demyelination.
Lab Invest 66(6):744-54.
Wang N, Ahmed S, Haqqi TM. 2005. Genomic structure and functional
characterization of the promoter region of human IkappaB kinase-
related kinase IKKi/IKKvarepsilon gene. Gene 353(1):118-33.
Zhang X, Hinton DR, Cua DJ, Stohlman SA, Lai MM. 1997. Expression of
interferon-gamma by a coronavirus defective-interfering RNA vector
and its effect on viral replication, spread, and pathogenicity. Virology
233(2):327-38.
Zhou H, Perlman S. 2007. Mouse hepatitis virus does not induce Beta
interferon synthesis and does not inhibit its induction by double-
stranded RNA. J Virol 81(2):568-74.
Zhou J, Marten NW, Bergmann CC, Macklin WB, Hinton DR, Stohlman SA.
2005. Expression of matrix metalloproteinases and their tissue
inhibitor during viral encephalitis. J Virol 79(8):4764-73.

170
Zhou J, Stohlman SA, Hinton DR, Marten NW. 2003. Neutrophils promote
mononuclear cell infiltration during viral-induced encephalitis. J
Immunol 170(6):3331-6.

171
Chapter 8: Experimental methods and design for the investigation of
glial responses to JHMV infection

Chapter 8 Summary
The following is a description of the experimental techniques
employed throughout the investigations described in the preceding chapters.
A systems biology approach has been applied to this complex model of viral
infection in the murine central nervous system. This involved immunological,
genetic, in vivo, in vitro and in silico based analysis. Most notably the
employment of flow cytometry activated cell sorting (FACS) coupled with
transgenic reporter mice was used to purify specific cell populations to
ascertain the responses by resident glia during viral infection in vivo.
Transcript analysis provided evaluation of specific responses but combined
with in silico gene modeling also provides a framework for predicting entire
pathways governing anti-viral responses. By applying these methods a more
detailed model of the cell-specific biology contributing to viral control at the
innate immunity level and interactions with the ongoing adaptive immune
response can be obtained.

172
Materials and Methods
Virus.
MHV-JHMV variant J.2.2v-1 selected by mAb as previously described
(Fleming et al. 1986) was used in all mouse infections. A parental strain of
MHV-JHM of medium plaque size (DM) was used for infections of cells in
vitro.

Mice.
Wild type C57BL/6 mice were purchased from the National Cancer
Institute (Frederick, MD). Mice expressing green fluorescent protein (GFP)
under control of the proteolipid protein (PLP) promoter (PLP-GFP)(Fuss et al.
2000) were backcrossed 6 times with C57BL/6 mice prior to use. Mice
deficient in IFNγ (IFNγ
-/-
) on the C57BL/6 background were previously
described (Dalton et al. 1993; Parra et al. 1999). Mice lacking the R1
component of the IFNαβ receptor complex on the C57BL/6 background were
provided by K. Murali Krishna and previously described (Kolumam et al.
2005; Muller et al. 1994). All mice were housed and bred at accredited
animal facilities at the Keck School of Medicine, University of Southern
California, Los Angeles, CA, or the Cleveland Clinic, Cleveland, OH. All
procedures were carried out in compliance with Institutional Animal Care and
Use Committee approved protocols.

173
Cell lines.
The antigen presentation sufficient human B lymphoblastic cell line
C1R-L
d
and the antigen processing deficient cell line T2-L
d
stably transfected
with the murine H2-L
d
gene were kindly provided by Peter Creswell, Yale
University Medical Center (Anderson et al. 1993). The T2-L
d
and C1R-L
d

cells and the H-2
d
J774A.1 macrophage cell line (American Type Culture
Collection) were all maintained in Dulbeccos’ modified MEM containing 10%
FCS. Delayed brain tumor (DBT) astrocytoma cells were cultured in MEM
containing 10% newborn calf serum and 7% tryptone phosphate broth.

Viral inoculation.
Adult mice, 6-8 weeks of age, were injected intracranially (i.c.) with
30μL of endotoxin-free PBS containing 250 plaque forming units of the MHV-
JHM (v2.2-1). Mice were monitored for signs of disease and scored
according to a 4-tiered scale: 4- moribund/dead, 3- hind limb paralysis, 2-
uneven gait and difficulty to right themselves, 1- hunched back, roughed coat
and limp tail.

Isolation of cells from the central nervous system.
Mice were sacrificed and perfused with 10mL cold PBS before brains
and spinal cords were excised. Brains and spinal cords were minced and
digested in 0.25% trypsin solution in PBS (4mL per brain or 2 spinal cords)
for approximately 30 minutes at 37
o
C. Trypsin was quenched with a final

174
concentration of chilled 10% fetal bovine serum or newborn calf serum. Cells
were enriched by centrifugation (800g for 30 minutes at 4
o
C) using 30%/70%
Percoll (Pharmacia, Sweden) gradients. Cells from 2 brains or 4 spinal cords
were combined per gradient. This method allowed the efficient recovery of
live resident glia and infiltrating leukocytes. Approximately 75-85% of cells
were alive following this isolation as indicated by limited trypan blue uptake.

Phenotypic analysis of surface molecules and the identification of cell types
by flow cytometry.
Cells were isolated as described above and pooled from a minimum of
3 mice per timepoint for phenotypic analysis. Cells were stained with a
combination of antibodies to discern the cell type and particular expression of
surface molecules as described previously (Gonzalez et al. 2005;
Ramakrishna et al. 2006). Cells were fixed in 2% paraformaldehyde prior to
analysis on a FACSCalibur flow cytometer (Becton Dickinson) using Flowjo
7.1 software (Tree Star, Inc.). The gating strategies for the identification of
cell types is summarized in table 8.1. A detailed list of antibodies employed
can be found in table 8.2.

175
Table 8.1 Classification of cell types for identification by flow
cytometry.

Cell Type Phenotypic classification
Oligodendroglia (mature) CD45-, GFP+
O4+ glia CD45-, O4+
Microglia CD45
lo
(also F4/80+)
Macrophages (Infiltrating F4/80+) CD45
hi
, F4/80+
T cells (all T cells) CD45
hi
, CD3+
CD8 T cells CD45
hi
, CD8+

Table 8.2 Antibodies utilized in flow cytometry.
Antibody Clone Flurochromes Vendor
CD3 17A2 FITC BDpharmingen
CD8 53-6.7 PE BDpharmingen
CD45 30-F11 APC, PerCp BDpharmingen
CD54 3E2 Bio+ Av-PE BDpharmingen
F4/80 C1:A3-1 APC Serotec
O4 O4 na* in house
MHC class I 28-14-8 PE eBioscience
MHC class II M5 PE BDpharmingen
PD-L1 M1H5 PE eBioscience
PD-1 RMP1-30 FITC eBioscience
*O4 antibody from hybridoma supernatant was obtained from Dr. Stephen
Stohlman or Dr. Bruce Trapp's lab. It was titrated for use against cells
isolated from PLP-GFP mice and detected with secondary anti-mus IgM
(PE). Total protein concentration ranged from 0,1-0.5mg/mL.

Figure 8.1 GFP positive cells identify mature
oligodendroglia in PLP-GFP/B6 mice by flow
cytometry. Mononuclear cells were isolated
from the spinal cords of naïve PLP-GFP/B6
mice at 6 weeks of age and stained for CD45
and O4. Cells are gated on total CD45-
population.

GFP
O4+
Total CD45- cells
(naïve PLP-GFP/B6)

176
Figure 8.1 demonstrates the relationship between O4 expression and
PLP-driven transgenic GFP expression in naïve PLP-GFP/B6 mice. All
GFP+ cells are also O4+, however approximately 30% of O4+ cells are not
GFP+ in the naïve PLP-GFP/B6 mouse (Fig. 8.1). These cells likely
represent less differentiated oligodendroglia lineage cells, and possibly adult
progenitor cells (Fuss et al. 2000). Furthermore the proportion of mature
oligodendroglia in relation to progenitor or precursor cells is not expected to
remain stable over the course of infection, however this was not specifically
evaluated.

Purification of cells by flow activated cell sorting (FACS).
CNS mononuclear cells were isolated as described above. They were
stained for cell surface markers while suspended in RPMI 1%FCS
(supplemented with 10mM HEPES to maintain pH 7.2). They were
maintained in media [3-6 x 10
6
cells/mL] on ice for sorting. Following FACS
purification cells were pelleted by centrifugation (400g for 7 minutes at 4
o
C)
to remove sheath fluid prior to subsequent analysis. The typical yields of cell
populations per organ are listed in table 8.3. The number of resident cells
retrieved was less variable the total number of cells isolated. As expected the
least amount of total cells harvested was from naïve organs and the greatest
amount of total cells harvested occurred during peak inflammation at day
7p.i. (Table 8.3). Mononuclear cells were pooled from a minimum of 6 mice
per time point.

177

Table 8.3 Number of cells isolated per organ by FACS.

Brain Number of cells retrieved per organ
Total cells before FACS (naïve) 4x10
5
- (peak) 1.8-2.5x10
6

Microglia 75,000-150,000
Oligodendroglia (GFP+) 5,000-10,000

Spinal Cord
Total cells before FACS (naïve) 0.5-1x10
5
-(peak) 5-8x10
5

Microglia 15,000-30,000
Oligodendroglia (GFP+) 10,000-20,000

Intracellular Staining for class I molecules.
To detect intracellular class I heavy chains, brain cells isolated from
uninfected PLP-GFP mice or continuous cell lines were incubated with Golgi-
plug (1μL/mL media; BD Biosciences) in DMEM 10% FCS for 6 hrs at 37°C.
Nonspecific antibody adsorption was blocked by incubation with anti-FcIII/IIR
(2.G42) and 5% serum mixture consisting of equal parts; mouse, human, rat,
and rabbit serum. Cells were then incubated with 10 g anti-class I mAb
(clone 28-14-8) for 30 minutes at 4
o
C to block subsequent surface class I
detection. Brain derived cells were stained with anti-CD45 (APC) to identify
microglia. Cells were fixed and permeabilized with Cytofix/Cytoperm
reagents (BD Biosciences). Permeabilized cells were treated with anti-
FcIII/IIR and serum to prevent nonspecific antibody binding as described
above, prior to incubation with anti-MHC class I-PE (clone 28-14-8) or anti-
MHC class I-PE (H2-K
k
, clone 36-7-5) (BD Biosciences) as an isotype

178
control. Cells were analyzed on a FACSCalibur flow cytometer as described
above.

Gene Expression analysis
RNA isolation.
For isolation of total RNA from (1/2) brains or spinal cords, organs
were ground directly in Trizol (Invitrogen) using Tenbroeck tissue
homogenizers. Lysates were passaged through a 26-gauge needle and RNA
extracted according to manufacturer’s instructions. 5μg of RNA was
visualized by electrophoresis on formaldehyde agarose gels (1.2%) to
confirm integrity. Although gene expression evaluation by real-time PCR can
be performed when samples have undergone some degree of degradation
because amplicons typically range from 60-150 bases in length, samples
displaying smeared ribosomal RNA bands were not utilized.
For RNA isolation of FACS purified cells, cells were lysed directly in
250-500μL of Trizol (depending on the number of cells obtained.) RNA was
purified and precipitated in the presence of 5μg glycogen (Ambion), then
resuspended in 8μL of DEPC-treated H
2
O. Purified RNA samples were kept
at –80
o
C for long-term storage.

179
Reverse transcription for first strand synthesis.
1μg of total RNA from organs or 4μL of RNA from sorted cell samples
was digested with DNase I (2.5 units of enzyme per reaction, Roche Applied
Science) for 20 minutes, followed by heat inactivation. RNA was reversed
transcribed using 30 units of AMV Reverse Transcriptase (Promega) with
1μg oligo-dT primers or 1.5μg of random oligonucleotide primers (Promega)
in a total volume of 20μl with 5X RT buffer provided with the enzyme. cDNA
samples were diluted 10-fold in Tris-EDTA (pH 8.0) and stored at –20
o
C. All
reactions were carried out in the presence of 40 units RNasin (Promega).

Primer design and Real-time PCR.
Real-time PCR primers were obtained from the literature as
referenced, but the majority were designed using PerlPrimer v1.1.9 (Marshall
2004). This program interfaces with the Esembl mouse genome database
and the National Center for Biotechnology Information (NCBI) basic local
alignment and search tool (BLAST) server. Sequences are based on the
C57BL/6 reference genome (Gregory et al. 2002), current build 37.1. The
following criteria outlines the basis for primer design:
• Primers should be complimentary to all known transcript isoforms for a
given gene.

180
• At least one primer should span an exon/exon junction or reside in
neighboring exons. If a transcript does not have any splice junctions
oligo-dT primed cDNA is exclusively used for evaluation.
• Primers targets should reside between 1-2 Kb from the 3’-prime end of
transcripts.
• Primer-dimers should not form potentially extensible conformations by
more than two base pairs. No primer-dimers should exhibit more than
4 consecutive base pairs and no more than 8 total.
• Primer sequences should match the intended gene as determined by
BLAST analysis of the mouse transcriptome.
Utilizing the above criteria minimizes non-specific or genomic
amplification and ensures a high degree of quantification for full-length
messenger RNA that has undergone at least some degree of splicing. A list
of all primer sequences designed for mouse genes is provided in the
appendix.
Quantitative real time PCR reactions were carried out using 5μL of
cDNA and 2X SYBER Green PCR Master Mix (ABI) in a total reaction
volume of 25μL in duplicate on an MJ DNA Engine Opticon (Biorad,
Hercules, CA). The thermocyling program was ran for all genes evaluated as
follows with the exception for reaction for virus specific genes: initial
incubation at 95
o
C for 10 minutes to activate Taq polymerase, followed by 38
cycles of 94
o
C for 10 seconds, 60
o
C for 20 seconds and 72
o
C for 10

181
seconds. For virus specific gene reactions the 60
o
C step was extended to 60
seconds. Specificity for each gene was confirmed by examining melting
curves and control reactions lacking a template. Transcript levels are
calculated relative to Gapdh using the formula: 2^
(Ct Gapdh - CtTarget Gene)
*1000.

Using Gapdh for relative gene quantification.
Glyceraldehyde-3-phosphate dehydrogenase, Gapdh, is involved in
cellular metabolism. It is useful for relative gene quantification because is it
expressed by all cell types, its message undergoes splicing and its level of
expression does not appear substantially altered directly by viral infection
(Fig. 8.2A). Furthermore it is used as a quality check for RNA isolation from a
limited number of cells as the Gapdh level directly reflects the number of
cells from which the cDNA was obtained (Fig. 8.2B). Lastly detection limits
were determined relative to Gapdh. By using a minimum of 30,000 cells per
sample detection of transcripts equivalent to 10,000 times less abundant
than Gapdh could be reliably measured, or according to the formula
employed, transcripts with a value greater than 0.1. For detection of rare
transcripts between 10,000 and 100,000 times less than Gapdh a minimum
of 50-80,000 cells were used.

182
Statistics
To determine statistically significant differences between different
samples, values from a minimum of three experiments were used per group.
Significant differences between groups were determined by a two-tailed
distribution analysis of the unpaired student’s t-test. P values less than 0.05
were considered statistically significant.

Computational tools for In silico analysis.
Genomic sequences upstream known transcriptional start sites for
genes of interest were retrieved from the transcriptional regulatory element
database (TRED) maintained by the Michael Zhang lab at Cold Spring
Harbor Laboratory. Sequences were uploaded to the TFSearch engine
(Akiyama 1998) for evaluation of transcription factor binding sites based on
matrix algorithims compiled from the public TRANSFAC database
(Heinemeyer et al. 1998). Consensus sites conserved among genes are
depicted as sequence logos based on nucleotide frequency (Crooks et al.
2004).

183

Figure 8.2 Gapdh is a suitable housekeeping gene for relative gene
quantification of small numbers of cells during JHMV infection. (A)
Cultures of DBT cells or J774.1 cells were infected with DM-JHMV and
monitored for changes in Gapdh transcripts levels during a one-step viral
infection. (B) J774.1 cells were serially diluted prior to RNA isolation and
reverse transcription. Average and standard deviation of Ct values for real-
time PCR reactions conducted in triplicate for Gapdh are depicted relative to
the standard log of the input number of cells. R
2
statistic denotes degree of fit
to the trendline.
Gapdh relative to cell number
R2 = 0.9878
14
16
18
20
22
3.5 4.5 5.5 6.5
Log(cell #)
Gapdh (Ct)
Effect of viral infection on Gapdh expression
15
17
19
21
23
mock 2 4 6 8
hours post infection
Gadph (Ct)
J774.1
DBT
A
B
R
2
= 0.988

184
Chapter 8 Referenes

Akiyama Y. 1998. TFSEARCH: Searching Transcription Factor Binding Sites
[Web based]. Version 1.3.
Anderson KS, Alexander J, Wei M, Cresswell P. 1993. Intracellular transport
of class I MHC molecules in antigen processing mutant cell lines. J
Immunol 151(7):3407-19.
Crooks GE, Hon G, Chandonia JM, Brenner SE. 2004. WebLogo: a
sequence logo generator. Genome Res 14(6):1188-90.
Dalton DK, Pitts-Meek S, Keshav S, Figari IS, Bradley A, Stewart TA. 1993.
Multiple defects of immune cell function in mice with disrupted
interferon-gamma genes. Science 259(5102):1739-42.
Fleming JO, Trousdale MD, el-Zaatari FA, Stohlman SA, Weiner LP. 1986.
Pathogenicity of antigenic variants of murine coronavirus JHM
selected with monoclonal antibodies. J Virol 58(3):869-75.
Fuss B, Mallon B, Phan T, Ohlemeyer C, Kirchhoff F, Nishiyama A, Macklin
WB. 2000. Purification and analysis of in vivo-differentiated
oligodendrocytes expressing the green fluorescent protein. Dev Biol
218(2):259-74.
Gonzalez JM, Bergmann CC, Fuss B, Hinton DR, Kangas C, Macklin WB,
Stohlman SA. 2005. Expression of a dominant negative IFN-
gammareceptor on mouse oligodendrocytes. Glia 51(1):22-34.
Gregory SG, Sekhon M, Schein J, Zhao S, Osoegawa K, Scott CE, Evans
RS, Burridge PW, Cox TV, Fox CA and others. 2002. A physical map
of the mouse genome. Nature 418(6899):743-50.
Heinemeyer T, Wingender E, Reuter I, Hermjakob H, Kel AE, Kel OV,
Ignatieva EV, Ananko EA, Podkolodnaya OA, Kolpakov FA and
others. 1998. Databases on transcriptional regulation: TRANSFAC,
TRRD and COMPEL. Nucleic Acids Res 26(1):362-7.
Kolumam GA, Thomas S, Thompson LJ, Sprent J, Murali-Krishna K. 2005.
Type I interferons act directly on CD8 T cells to allow clonal expansion
and memory formation in response to viral infection. J Exp Med
202(5):637-50.

185
Marshall OJ. 2004. PerlPrimer: cross-platform, graphical primer design for
standard, bisulphite and real-time PCR. Bioinformatics 20(15):2471-2.
Muller U, Steinhoff U, Reis LF, Hemmi S, Pavlovic J, Zinkernagel RM, Aguet
M. 1994. Functional role of type I and type II interferons in antiviral
defense. Science 264(5167):1918-21.
Parra B, Hinton DR, Marten NW, Bergmann CC, Lin MT, Yang CS, Stohlman
SA. 1999. IFN-gamma is required for viral clearance from central
nervous system oligodendroglia. J Immunol 162(3):1641-7.
Ramakrishna C, Atkinson RA, Stohlman SA, Bergmann CC. 2006. Vaccine-
induced memory CD8+ T cells cannot prevent central nervous system
virus reactivation. J Immunol 176(5):3062-9.

186
Bibliography

Adami C, Pooley J, Glomb J, Stecker E, Fazal F, Fleming JO, Baker SC.
1995. Evolution of mouse hepatitis virus (MHV) during chronic
infection: quasispecies nature of the persisting MHV RNA. Virology
209(2):337-46.
Agresti C, Bernardo A, Del Russo N, Marziali G, Battistini A, Aloisi F, Levi G,
Coccia EM. 1998. Synergistic stimulation of MHC class I and IRF-1
gene expression by IFN-gamma and TNF-alpha in oligodendrocytes.
Eur J Neurosci 10(9):2975-83.
Akiyama Y. 1998. TFSEARCH: Searching Transcription Factor Binding Sites
[Web based]. Version 1.3.
Aktas O, Smorodchenko A, Brocke S, Infante-Duarte C, Schulze Topphoff U,
Vogt J, Prozorovski T, Meier S, Osmanova V, Pohl E and others.
2005. Neuronal damage in autoimmune neuroinflammation mediated
by the death ligand TRAIL. Neuron 46(3):421-32.
Aloisi F, De Simone R, Columba-Cabezas S, Penna G, Adorini L. 2000.
Functional maturation of adult mouse resting microglia into an APC is
promoted by granulocyte-macrophage colony-stimulating factor and
interaction with Th1 cells. J Immunol 164(4):1705-12.
Anderson KS, Alexander J, Wei M, Cresswell P. 1993. Intracellular transport
of class I MHC molecules in antigen processing mutant cell lines. J
Immunol 151(7):3407-19.
Aravalli RN, Hu S, Rowen TN, Gekker G, Lokensgard JR. 2006. Differential
apoptotic signaling in primary glial cells infected with herpes simplex
virus 1. J Neurovirol 12(6):501-10.
Arbour N, Day R, Newcombe J, Talbot PJ. 2000. Neuroinvasion by human
respiratory coronaviruses. J Virol 74(19):8913-21.
Arons E, Kunin V, Schechter C, Ehrlich R. 2001. Organization and functional
analysis of the mouse transporter associated with antigen processing
2 promoter. J Immunol 166(6):3942-51.
Asselin-Paturel C, Brizard G, Chemin K, Boonstra A, O'Garra A, Vicari A,
Trinchieri G. 2005. Type I interferon dependence of plasmacytoid
dendritic cell activation and migration. J Exp Med 201(7):1157-67.

187
Axtell RC, Steinman L. 2008. Type 1 interferons cool the inflamed brain.
Immunity 28(5):600-2.
Babbe H, Roers A, Waisman A, Lassmann H, Goebels N, Hohlfeld R, Friese
M, Schroder R, Deckert M, Schmidt S and others. 2000. Clonal
expansions of CD8(+) T cells dominate the T cell infiltrate in active
multiple sclerosis lesions as shown by micromanipulation and single
cell polymerase chain reaction. J Exp Med 192(3):393-404.
Baerwald KD, Corbin JG, Popko B. 2000. Major histocompatibility complex
heavy chain accumulation in the endoplasmic reticulum of
oligodendrocytes results in myelin abnormalities. J Neurosci Res
59(2):160-9.
Bagnato F, Evangelou IE, Gallo A, Gaindh D, Yao K. 2007. The effect of
interferon-beta on black holes in patients with multiple sclerosis.
Expert Opin Biol Ther 7(7):1079-91.
Bailey SL, Carpentier PA, McMahon EJ, Begolka WS, Miller SD. 2006.
Innate and adaptive immune responses of the central nervous system.
Crit Rev Immunol 26(2):149-88.
Bailey SL, Schreiner B, McMahon EJ, Miller SD. 2007. CNS myeloid DCs
presenting endogenous myelin peptides 'preferentially' polarize CD4+
T(H)-17 cells in relapsing EAE. Nat Immunol 8(2):172-80.
Bang FB. 1981. The use of a genetically incompatible combination of host
and virus (MHV) for the study of mechanisms of host resistance. Adv
Exp Med Biol 142:359-73.
Barber DL, Wherry EJ, Masopust D, Zhu B, Allison JP, Sharpe AH, Freeman
GJ, Ahmed R. 2006. Restoring function in exhausted CD8 T cells
during chronic viral infection. Nature 439(7077):682-7.
Barcia C, Wawrowsky K, Barrett RJ, Liu C, Castro MG, Lowenstein PR.
2008. In vivo polarization of IFN-gamma at Kupfer and non-Kupfer
immunological synapses during the clearance of virally infected brain
cells. J Immunol 180(3):1344-52.
Baric RS, Yount B. 2000. Subgenomic negative-strand RNA function during
mouse hepatitis virus infection. J Virol 74(9):4039-46.
Baudoux P, Carrat C, Besnardeau L, Charley B, Laude H. 1998. Coronavirus
pseudoparticles formed with recombinant M and E proteins induce
alpha interferon synthesis by leukocytes. J Virol 72(11):8636-43.

188
Bergmann CC, Altman JD, Hinton D, Stohlman SA. 1999. Inverted
immunodominance and impaired cytolytic function of CD8+ T cells
during viral persistence in the central nervous system. J Immunol
163(6):3379-87.
Bergmann CC, Dimacali E, Stohl S, Marten N, Lai MM, Stohlman SA. 1998.
Viral evolution and CTL epitope stability during JHMV infection in the
central nervous system. Adv Exp Med Biol 440:751-7.
Bergmann CC, Lane TE, Stohlman SA. 2006. Coronavirus infection of the
central nervous system: host-virus stand-off. Nat Rev Microbiol
4(2):121-32.
Bergmann CC, Parra B, Hinton DR, Chandran R, Morrison M, Stohlman SA.
2003. Perforin-mediated effector function within the central nervous
system requires IFN-gamma-mediated MHC up-regulation. J Immunol
170(6):3204-13.
Bergmann CC, Parra B, Hinton DR, Ramakrishna C, Dowdell KC, Stohlman
SA. 2004. Perforin and gamma interferon-mediated control of
coronavirus central nervous system infection by CD8 T cells in the
absence of CD4 T cells. J Virol 78(4):1739-50.
Bergmann CC, Ramakrishna C, Kornacki M, Stohlman SA. 2001. Impaired T
cell immunity in B cell-deficient mice following viral central nervous
system infection. J Immunol 167(3):1575-83.
Bermel RA, Rudick RA. 2007. Interferon-beta treatment for multiple sclerosis.
Neurotherapeutics 4(4):633-46.
Bettelli E. 2007. Building different mouse models for human MS. Ann N Y
Acad Sci 1103:11-8.
Beyer M, Wang H, Peters N, Doths S, Koerner-Rettberg C, Openshaw PJ,
Schwarze J. 2005. The beta2 integrin CD11c distinguishes a subset of
cytotoxic pulmonary T cells with potent antiviral effects in vitro and in
vivo. Respir Res 6:70.
Bos EC, Heijnen L, Luytjes W, Spaan WJ. 1995. Mutational analysis of the
murine coronavirus spike protein: effect on cell-to-cell fusion. Virology
214(2):453-63.
Brian DA, Baric RS. 2005. Coronavirus genome structure and replication.
Curr Top Microbiol Immunol 287:1-30.

189
Brucet M, Marques L, Sebastian C, Lloberas J, Celada A. 2004. Regulation
of murine Tap1 and Lmp2 genes in macrophages by interferon
gamma is mediated by STAT1 and IRF-1. Genes Immun 5(1):26-35.
Bsibsi M, Ravid R, Gveric D, van Noort JM. 2002. Broad expression of Toll-
like receptors in the human central nervous system. J Neuropathol
Exp Neurol 61(11):1013-21.
Bullard DC, Hu X, Adams JE, Schoeb TR, Barnum SR. 2007. p150/95
(CD11c/CD18) expression is required for the development of
experimental autoimmune encephalomyelitis. Am J Pathol
170(6):2001-8.
Buttmann M, Rieckmann P. 2008. Treating multiple sclerosis with
monoclonal antibodies. Expert Rev Neurother 8(3):433-55.
Caldarelli-Stefano R, Vago L, Omodeo-Zorini E, Mediati M, Losciale L,
Nebuloni M, Costanzi G, Ferrante P. 1999. Detection and typing of JC
virus in autopsy brains and extraneural organs of AIDS patients and
non-immunocompromised individuals. J Neurovirol 5(2):125-33.
Calder VL, Wolswijk G, Noble M. 1988. The differentiation of O-2A progenitor
cells into oligodendrocytes is associated with a loss of inducibility of Ia
antigens. Eur J Immunol 18(8):1195-201.
Cannella B, Gaupp S, Omari KM, Raine CS. 2007. Multiple sclerosis: death
receptor expression and oligodendrocyte apoptosis in established
lesions. J Neuroimmunol 188(1-2):128-37.
Cervantes-Barragan L, Zust R, Weber F, Spiegel M, Lang KS, Akira S, Thiel
V, Ludewig B. 2007. Control of coronavirus infection through
plasmacytoid dendritic-cell-derived type I interferon. Blood
109(3):1131-7.
Cheever FS, Daniels JB, et al. 1949. A murine virus (JHM) causing
disseminated encephalomyelitis with extensive destruction of myelin. J
Exp Med 90(3):181-210.
Choi KS, Huang P, Lai MM. 2002. Polypyrimidine-tract-binding protein affects
transcription but not translation of mouse hepatitis virus RNA. Virology
303(1):58-68.
Crooks GE, Hon G, Chandonia JM, Brenner SE. 2004. WebLogo: a
sequence logo generator. Genome Res 14(6):1188-90.

190
Daffis S, Samuel MA, Suthar MS, Keller BC, Gale M, Jr., Diamond MS. 2008.
Interferon regulatory factor (IRF)-7 induces the antiviral interferon
(IFN)-{alpha} response and protects against lethal West Nile virus
infection. J Virol.
Dai J, Megjugorac NJ, Amrute SB, Fitzgerald-Bocarsly P. 2004. Regulation
of IFN regulatory factor-7 and IFN-alpha production by enveloped
virus and lipopolysaccharide in human plasmacytoid dendritic cells. J
Immunol 173(3):1535-48.
Dalton DK, Pitts-Meek S, Keshav S, Figari IS, Bradley A, Stewart TA. 1993.
Multiple defects of immune cell function in mice with disrupted
interferon-gamma genes. Science 259(5102):1739-42.
de Haan CA, Kuo L, Masters PS, Vennema H, Rottier PJ. 1998. Coronavirus
particle assembly: primary structure requirements of the membrane
protein. J Virol 72(8):6838-50.
de Lang A, Baas T, Teal T, Leijten LM, Rain B, Osterhaus AD, Haagmans
BL, Katze MG. 2007. Functional genomics highlights differential
induction of antiviral pathways in the lungs of SARS-CoV-infected
macaques. PLoS Pathog 3(8):e112.
de Veer MJ, Holko M, Frevel M, Walker E, Der S, Paranjape JM, Silverman
RH, Williams BR. 2001. Functional classification of interferon-
stimulated genes identified using microarrays. J Leukoc Biol
69(6):912-20.
Delhaye S, Paul S, Blakqori G, Minet M, Weber F, Staeheli P, Michiels T.
2006. Neurons produce type I interferon during viral encephalitis. Proc
Natl Acad Sci U S A 103(20):7835-40.
Der SD, Zhou A, Williams BR, Silverman RH. 1998. Identification of genes
differentially regulated by interferon alpha, beta, or gamma using
oligonucleotide arrays. Proc Natl Acad Sci U S A 95(26):15623-8.
Dessau RB, Lisby G, Frederiksen JL. 2001. Coronaviruses in brain tissue
from patients with multiple sclerosis. Acta Neuropathol 101(6):601-4.
Dietrich JB. 2002. The adhesion molecule ICAM-1 and its regulation in
relation with the blood-brain barrier. J Neuroimmunol 128(1-2):58-68.
Dorr J, Bechmann I, Waiczies S, Aktas O, Walczak H, Krammer PH, Nitsch
R, Zipp F. 2002. Lack of tumor necrosis factor-related apoptosis-
inducing ligand but presence of its receptors in the human brain. J
Neurosci 22(4):RC209.

191
Dorries R. 2001. The role of T-cell-mediated mechanisms in virus infections
of the nervous system. Curr Top Microbiol Immunol 253:219-45.
Durbin JE, Hackenmiller R, Simon MC, Levy DE. 1996. Targeted disruption
of the mouse Stat1 gene results in compromised innate immunity to
viral disease. Cell 84(3):443-50.
Dustin ML. 2007. Cell adhesion molecules and actin cytoskeleton at immune
synapses and kinapses. Curr Opin Cell Biol 19(5):529-33.
Dutta R, Trapp BD. 2007. Pathogenesis of axonal and neuronal damage in
multiple sclerosis. Neurology 68(22 Suppl 3):S22-31; discussion S43-
54.
Fahrner K, Hogan BL, Flavell RA. 1987. Transcription of H-2 and Qa genes
in embryonic and adult mice. Embo J 6(5):1265-71.
Fitzgerald-Bocarsly P. 2002. Natural interferon-alpha producing cells: the
plasmacytoid dendritic cells. Biotechniques Suppl:16-20, 22, 24-9.
Fleming JO, Houtman JJ, Alaca H, Hinze HC, McKenzie D, Aiken J,
Bleasdale T, Baker S. 1993. Persistence of viral RNA in the central
nervous system of mice inoculated with MHV-4. Adv Exp Med Biol
342:327-32.
Fleming JO, Trousdale MD, el-Zaatari FA, Stohlman SA, Weiner LP. 1986.
Pathogenicity of antigenic variants of murine coronavirus JHM
selected with monoclonal antibodies. J Virol 58(3):869-75.
Fleury HJ, Sheppard RD, Bornstein MB, Raine CS. 1980. Further
ultrastructural observations of virus morphogenesis and myelin
pathology in JHM virus encephalomyelitis. Neuropathol Appl Neurobiol
6(3):165-79.
Ford AL, Goodsall AL, Hickey WF, Sedgwick JD. 1995. Normal adult ramified
microglia separated from other central nervous system macrophages
by flow cytometric sorting. Phenotypic differences defined and direct
ex vivo antigen presentation to myelin basic protein-reactive CD4+ T
cells compared. J Immunol 154(9):4309-21.
Fruh K, Yang Y, Arnold D, Chambers J, Wu L, Waters JB, Spies T, Peterson
PA. 1992. Alternative exon usage and processing of the major
histocompatibility complex-encoded proteasome subunits. J Biol
Chem 267(31):22131-40.

192
Furuta Y, Takasu T, Suzuki S, Fukuda S, Inuyama Y, Nagashima K. 1997.
Detection of latent varicella-zoster virus infection in human vestibular
and spiral ganglia. J Med Virol 51(3):214-6.
Fuss B, Afshari FS, Colello RJ, Macklin WB. 2001. Normal CNS myelination
in transgenic mice overexpressing MHC class I H-2L(d) in
oligodendrocytes. Mol Cell Neurosci 18(2):221-34.
Fuss B, Mallon B, Phan T, Ohlemeyer C, Kirchhoff F, Nishiyama A, Macklin
WB. 2000. Purification and analysis of in vivo-differentiated
oligodendrocytes expressing the green fluorescent protein. Dev Biol
218(2):259-74.
Garbi N, Tanaka S, van den Broek M, Momburg F, Hammerling GJ. 2005.
Accessory molecules in the assembly of major histocompatibility
complex class I/peptide complexes: how essential are they for CD8(+)
T-cell immune responses? Immunol Rev 207:77-88.
Garlinghouse LE, Jr., Smith AL, Holford T. 1984. The biological relationship
of mouse hepatitis virus (MHV) strains and interferon: in vitro induction
and sensitivities. Arch Virol 82(1-2):19-29.
Gobin SJ, Montagne L, Van Zutphen M, Van Der Valk P, Van Den Elsen PJ,
De Groot CJ. 2001. Upregulation of transcription factors controlling
MHC expression in multiple sclerosis lesions. Glia 36(1):68-77.
Gombold JL, Weiss SR. 1992. Mouse hepatitis virus A59 increases steady-
state levels of MHC mRNAs in primary glial cell cultures and in the
murine central nervous system. Microb Pathog 13(6):493-505.
Gonzalez JM, Bergmann CC, Fuss B, Hinton DR, Kangas C, Macklin WB,
Stohlman SA. 2005. Expression of a dominant negative IFN-
gammareceptor on mouse oligodendrocytes. Glia 51(1):22-34.
Gonzalez JM, Bergmann CC, Ramakrishna C, Hinton DR, Atkinson R,
Hoskin J, Macklin WB, Stohlman SA. 2006. Inhibition of interferon-
gamma signaling in oligodendroglia delays coronavirus clearance
without altering demyelination. Am J Pathol 168(3):796-804.
Gregory SG, Sekhon M, Schein J, Zhao S, Osoegawa K, Scott CE, Evans
RS, Burridge PW, Cox TV, Fox CA and others. 2002. A physical map
of the mouse genome. Nature 418(6899):743-50.
Hamo L, Stohlman SA, Otto-Duessel M, Bergmann CC. 2007. Distinct
regulation of MHC molecule expression on astrocytes and microglia
during viral encephalomyelitis. Glia 55(11):1169-77.

193
Hardy MP, Owczarek CM, Trajanovska S, Liu X, Kola I, Hertzog PJ. 2001.
The soluble murine type I interferon receptor Ifnar-2 is present in
serum, is independently regulated, and has both agonistic and
antagonistic properties. Blood 97(2):473-82.
Heinemeyer T, Wingender E, Reuter I, Hermjakob H, Kel AE, Kel OV,
Ignatieva EV, Ananko EA, Podkolodnaya OA, Kolpakov FA and
others. 1998. Databases on transcriptional regulation: TRANSFAC,
TRRD and COMPEL. Nucleic Acids Res 26(1):362-7.
Hemmi H, Kaisho T, Takeuchi O, Sato S, Sanjo H, Hoshino K, Horiuchi T,
Tomizawa H, Takeda K, Akira S. 2002. Small anti-viral compounds
activate immune cells via the TLR7 MyD88-dependent signaling
pathway. Nat Immunol 3(2):196-200.
Hickey WF. 2001. Basic principles of immunological surveillance of the
normal central nervous system. Glia 36(2):118-24.
Hindinger C, Gonzalez JM, Bergmann CC, Fuss B, Hinton DR, Atkinson RD,
Macklin WB, Stohlman SA. 2005. Astrocyte expression of a dominant-
negative interferon-gamma receptor. J Neurosci Res 82(1):20-31.
Hobart M, Ramassar V, Goes N, Urmson J, Halloran PF. 1997. IFN
regulatory factor-1 plays a central role in the regulation of the
expression of class I and II MHC genes in vivo. J Immunol
158(9):4260-9.
Hoebe K, Du X, Georgel P, Janssen E, Tabeta K, Kim SO, Goode J, Lin P,
Mann N, Mudd S and others. 2003. Identification of Lps2 as a key
transducer of MyD88-independent TIR signalling. Nature
424(6950):743-8.
Hoebe K, Janssen E, Beutler B. 2004. The interface between innate and
adaptive immunity. Nat Immunol 5(10):971-4.
Hoftberger R, Aboul-Enein F, Brueck W, Lucchinetti C, Rodriguez M,
Schmidbauer M, Jellinger K, Lassmann H. 2004. Expression of major
histocompatibility complex class I molecules on the different cell types
in multiple sclerosis lesions. Brain Pathol 14(1):43-50.
Horwitz MS, Evans CF, Klier FG, Oldstone MB. 1999. Detailed in vivo
analysis of interferon-gamma induced major histocompatibility
complex expression in the the central nervous system: astrocytes fail
to express major histocompatibility complex class I and II molecules.
Lab Invest 79(2):235-42.

194
Houtman JJ, Fleming JO. 1996. Dissociation of demyelination and viral
clearance in congenitally immunodeficient mice infected with murine
coronavirus JHM. J Neurovirol 2(2):101-10.
Hovelmeyer N, Hao Z, Kranidioti K, Kassiotis G, Buch T, Frommer F, von
Hoch L, Kramer D, Minichiello L, Kollias G and others. 2005.
Apoptosis of oligodendrocytes via Fas and TNF-R1 is a key event in
the induction of experimental autoimmune encephalomyelitis. J
Immunol 175(9):5875-84.
Howcroft TK, Singer DS. 2003. Expression of nonclassical MHC class Ib
genes: comparison of regulatory elements. Immunol Res 27(1):1-30.
Huseby ES, Liggitt D, Brabb T, Schnabel B, Ohlen C, Goverman J. 2001. A
pathogenic role for myelin-specific CD8(+) T cells in a model for
multiple sclerosis. J Exp Med 194(5):669-76.
Ip CW, Kroner A, Bendszus M, Leder C, Kobsar I, Fischer S, Wiendl H, Nave
KA, Martini R. 2006. Immune cells contribute to myelin degeneration
and axonopathic changes in mice overexpressing proteolipid protein in
oligodendrocytes. J Neurosci 26(31):8206-16.
Ireland DD, Stohlman SA, Hinton DR, Atkinson R, Bergmann CC. 2008a.
Type 1 Interferons are Essential in Controlling Neurotropic
Coronavirus Infection Irrespective of Functional CD8 T Cells. J Virol
82(in press).
Ireland DD, Stohlman SA, Hinton DR, Atkinson R, Bergmann CC. 2008b.
Type I interferons are essential in controlling neurotropic coronavirus
infection irrespective of functional CD8 T cells. J Virol 82(1):300-10.
Isaacs A, Lindenmann J. 1957. Virus interference. I. The interferon. Proc R
Soc Lond B Biol Sci 147(927):258-67.
Iwai Y, Terawaki S, Ikegawa M, Okazaki T, Honjo T. 2003. PD-1 inhibits
antiviral immunity at the effector phase in the liver. J Exp Med
198(1):39-50.
Izaguirre A, Barnes BJ, Amrute S, Yeow WS, Megjugorac N, Dai J, Feng D,
Chung E, Pitha PM, Fitzgerald-Bocarsly P. 2003. Comparative
analysis of IRF and IFN-alpha expression in human plasmacytoid and
monocyte-derived dendritic cells. J Leukoc Biol 74(6):1125-38.

195
Jacobsen M, Cepok S, Quak E, Happel M, Gaber R, Ziegler A, Schock S,
Oertel WH, Sommer N, Hemmer B. 2002. Oligoclonal expansion of
memory CD8+ T cells in cerebrospinal fluid from multiple sclerosis
patients. Brain 125(Pt 3):538-50.
Jamaluddin M, Wang S, Garofalo RP, Elliott T, Casola A, Baron S, Brasier
AR. 2001. IFN-beta mediates coordinate expression of antigen-
processing genes in RSV-infected pulmonary epithelial cells. Am J
Physiol Lung Cell Mol Physiol 280(2):L248-57.
Jeong YS, Repass JF, Kim YN, Hwang SM, Makino S. 1996. Coronavirus
transcription mediated by sequences flanking the transcription
consensus sequence. Virology 217(1):311-22.
Jordan CA, Friedrich VL, Jr., Godfraind C, Cardellechio CB, Holmes KV,
Dubois-Dalcq M. 1989. Expression of viral and myelin gene transcripts
in a murine CNS demyelinating disease caused by a coronavirus. Glia
2(5):318-29.
Kadiu I, Glanzer JG, Kipnis J, Gendelman HE, Thomas MP. 2005.
Mononuclear phagocytes in the pathogenesis of neurodegenerative
diseases. Neurotox Res 8(1-2):25-50.
Kahn JS. 2006. The widening scope of coronaviruses. Curr Opin Pediatr
18(1):42-7.
Kato H, Sato S, Yoneyama M, Yamamoto M, Uematsu S, Matsui K,
Tsujimura T, Takeda K, Fujita T, Takeuchi O and others. 2005. Cell
type-specific involvement of RIG-I in antiviral response. Immunity
23(1):19-28.
Klein RS, Diamond MS. 2008. Immunological headgear: antiviral immune
responses protect against neuroinvasive West Nile virus. Trends Mol
Med.
Knobler RL, Dubois-Dalcq M, Haspel MV, Claysmith AP, Lampert PW,
Oldstone MB. 1981. Selective localization of wild type and mutant
mouse hepatitis virus (JHM strain) antigens in CNS tissue by
fluorescence, light and electron microscopy. J Neuroimmunol 1(1):81-
92.
Knobler RL, Lampert PW, Oldstone MB. 1982. Virus persistence and
recurring demyelination produced by a temperature-sensitive mutant
of MHV-4. Nature 298(5871):279-80.

196
Kolumam GA, Thomas S, Thompson LJ, Sprent J, Murali-Krishna K. 2005.
Type I interferons act directly on CD8 T cells to allow clonal expansion
and memory formation in response to viral infection. J Exp Med
202(5):637-50.
Komurasaki Y, Nagineni CN, Wang Y, Hooks JJ. 1996. Virus RNA persists
within the retina in coronavirus-induced retinopathy. Virology
222(2):446-50.
Kooi C, Mizzen L, Alderson C, Daya M, Anderson R. 1988. Early events of
importance in determining host cell permissiveness to mouse hepatitis
virus infection. J Gen Virol 69 ( Pt 6):1125-35.
Krijnse-Locker J, Ericsson M, Rottier PJ, Griffiths G. 1994. Characterization
of the budding compartment of mouse hepatitis virus: evidence that
transport from the RER to the Golgi complex requires only one
vesicular transport step. J Cell Biol 124(1-2):55-70.
Kristensson K, Holmes KV, Duchala CS, Zeller NK, Lazzarini RA, Dubois-
Dalcq M. 1986. Increased levels of myelin basic protein transcripts in
virus-induced demyelination. Nature 322(6079):544-7.
Kroger A, Koster M, Schroeder K, Hauser H, Mueller PP. 2002. Activities of
IRF-1. J Interferon Cytokine Res 22(1):5-14.
Kumagai Y, Takeuchi O, Kato H, Kumar H, Matsui K, Morii E, Aozasa K,
Kawai T, Akira S. 2007. Alveolar macrophages are the primary
interferon-alpha producer in pulmonary infection with RNA viruses.
Immunity 27(2):240-52.
Kumar H, Kawai T, Kato H, Sato S, Takahashi K, Coban C, Yamamoto M,
Uematsu S, Ishii KJ, Takeuchi O and others. 2006. Essential role of
IPS-1 in innate immune responses against RNA viruses. J Exp Med
203(7):1795-803.
Kurtzke JF. 2000. Epidemiology of multiple sclerosis. Does this really point
toward an etiology? Lectio Doctoralis. Neurol Sci 21(6):383-403.
Lai MM, Cavanagh D. 1997. The molecular biology of coronaviruses. Adv
Virus Res 48:1-100.
Lane TE, Asensio VC, Yu N, Paoletti AD, Campbell IL, Buchmeier MJ. 1998.
Dynamic regulation of alpha- and beta-chemokine expression in the
central nervous system during mouse hepatitis virus-induced
demyelinating disease. J Immunol 160(2):970-8.

197
Lane TE, Liu MT, Chen BP, Asensio VC, Samawi RM, Paoletti AD, Campbell
IL, Kunkel SL, Fox HS, Buchmeier MJ. 2000. A central role for CD4(+)
T cells and RANTES in virus-induced central nervous system
inflammation and demyelination. J Virol 74(3):1415-24.
Latchman YE, Liang SC, Wu Y, Chernova T, Sobel RA, Klemm M, Kuchroo
VK, Freeman GJ, Sharpe AH. 2004. PD-L1-deficient mice show that
PD-L1 on T cells, antigen-presenting cells, and host tissues negatively
regulates T cells. Proc Natl Acad Sci U S A 101(29):10691-6.
Lavi E, Gilden DH, Highkin MK, Weiss SR. 1984a. Detection of MHV-A59
RNA by in situ hybridization. Adv Exp Med Biol 173:247-57.
Lavi E, Gilden DH, Highkin MK, Weiss SR. 1984b. Persistence of mouse
hepatitis virus A59 RNA in a slow virus demyelinating infection in mice
as detected by in situ hybridization. J Virol 51(2):563-6.
Lavi E, Suzumura A, Hirayama M, Highkin MK, Dambach DM, Silberberg
DH, Weiss SR. 1987. Coronavirus mouse hepatitis virus (MHV)-A59
causes a persistent, productive infection in primary glial cell cultures.
Microb Pathog 3(2):79-86.
LeibundGut-Landmann S, Waldburger JM, Reis e Sousa C, Acha-Orbea H,
Reith W. 2004. MHC class II expression is differentially regulated in
plasmacytoid and conventional dendritic cells. Nat Immunol 5(9):899-
908.
Levy DE, Marie I, Smith E, Prakash A. 2002. Enhancement and
diversification of IFN induction by IRF-7-mediated positive feedback. J
Interferon Cytokine Res 22(1):87-93.
Liang SC, Latchman YE, Buhlmann JE, Tomczak MF, Horwitz BH, Freeman
GJ, Sharpe AH. 2003. Regulation of PD-1, PD-L1, and PD-L2
expression during normal and autoimmune responses. Eur J Immunol
33(10):2706-16.
Lin MT, Hinton DR, Marten NW, Bergmann CC, Stohlman SA. 1999.
Antibody prevents virus reactivation within the central nervous system.
J Immunol 162(12):7358-68.
Lin MT, Stohlman SA, Hinton DR. 1997. Mouse hepatitis virus is cleared from
the central nervous systems of mice lacking perforin-mediated
cytolysis. J Virol 71(1):383-91.

198
Lin W, Bailey SL, Ho H, Harding HP, Ron D, Miller SD, Popko B. 2007. The
integrated stress response prevents demyelination by protecting
oligodendrocytes against immune-mediated damage. J Clin Invest
117(2):448-56.
Lin W, Kemper A, Dupree JL, Harding HP, Ron D, Popko B. 2006. Interferon-
gamma inhibits central nervous system remyelination through a
process modulated by endoplasmic reticulum stress. Brain 129(Pt
5):1306-18.
Lipton HL, Liang Z, Hertzler S, Son KN. 2007. A specific viral cause of
multiple sclerosis: one virus, one disease. Ann Neurol 61(6):514-23.
Liu MT, Lane TE. 2001. Chemokine expression and viral infection of the
central nervous system: regulation of host defense and
neuropathology. Immunol Res 24(2):111-9.
Lu LL, Puri M, Horvath CM, Sen GC. 2008. Select paramyxoviral V proteins
inhibit IRF3 activation by acting as alternative substrates for
IKKE/TBK1. J Biol Chem.
Luo H, Sopchak L, Lerman SP, King SR. 1995. Selective loss of H-2Ds
antigen on a murine B lymphoma due to a post-transcriptional block in
expression. Mol Immunol 32(14-15):1011-20.
Maeda A, Hayashi M, Ishida K, Mizutani T, Watanabe T, Namioka S. 1995.
Characterization of DBT cell clones derived from cells persistently
infected with the JHM strain of mouse hepatitis virus. J Vet Med Sci
57(5):813-7.
Malone KE, Stohlman SA, Ramakrishna C, Macklin W, Bergmann CC. 2008.
Induction of class I antigen processing components in oligodendroglia
and microglia during viral encephalomyelitis. Glia 56(4):426-35.
Marshall OJ. 2004. PerlPrimer: cross-platform, graphical primer design for
standard, bisulphite and real-time PCR. Bioinformatics 20(15):2471-2.
Marten NW, Stohlman SA, Atkinson RD, Hinton DR, Fleming JO, Bergmann
CC. 2000a. Contributions of CD8+ T cells and viral spread to
demyelinating disease. J Immunol 164(8):4080-8.
Marten NW, Stohlman SA, Bergmann CC. 2000b. Role of viral persistence in
retaining CD8(+) T cells within the central nervous system. J Virol
74(17):7903-10.

199
Marten NW, Stohlman SA, Zhou J, Bergmann CC. 2003. Kinetics of virus-
specific CD8+ -T-cell expansion and trafficking following central
nervous system infection. J Virol 77(4):2775-8.
Martinez A, Alvarez-Lafuente R, Mas A, Bartolome M, Garcia-Montojo M, de
Las Heras V, de la Concha EG, Arroyo R, Urcelay E. 2007.
Environment-gene interaction in multiple sclerosis: human herpesvirus
6 and MHC2TA. Hum Immunol 68(8):685-9.
Massa PT, Ozato K, McFarlin DE. 1993. Cell type-specific regulation of major
histocompatibility complex (MHC) class I gene expression in
astrocytes, oligodendrocytes, and neurons. Glia 8(3):201-7.
Masters PS. 2006. The molecular biology of coronaviruses. Adv Virus Res
66:193-292.
Matsumoto M, Funami K, Tanabe M, Oshiumi H, Shingai M, Seto Y,
Yamamoto A, Seya T. 2003. Subcellular localization of Toll-like
receptor 3 in human dendritic cells. J Immunol 171(6):3154-62.
Matsumoto Y, Fujiwara M. 1986. In situ detection of class I and II major
histocompatibility complex antigens in the rat central nervous system
during experimental allergic encephalomyelitis. An
immunohistochemical study. J Neuroimmunol 12(4):265-77.
Mavria G, Hall KT, Jones RA, Blair GE. 1998. Transcriptional regulation of
MHC class I gene expression in rat oligodendrocytes. Biochem J 330 (
Pt 1):155-61.
McElroy JP, Oksenberg JR. 2008. Multiple sclerosis genetics. Curr Top
Microbiol Immunol 318:45-72.
McFarland HF, Martin R. 2007. Multiple sclerosis: a complicated picture of
autoimmunity. Nat Immunol 8(9):913-9.
McKimmie CS, Johnson N, Fooks AR, Fazakerley JK. 2005. Viruses
selectively upregulate Toll-like receptors in the central nervous
system. Biochem Biophys Res Commun 336(3):925-33.
Merkler D, Ernsting T, Kerschensteiner M, Bruck W, Stadelmann C. 2006. A
new focal EAE model of cortical demyelination: multiple sclerosis-like
lesions with rapid resolution of inflammation and extensive
remyelination. Brain 129(Pt 8):1972-83.

200
Miettinen M, Sareneva T, Julkunen I, Matikainen S. 2001. IFNs activate toll-
like receptor gene expression in viral infections. Genes Immun
2(6):349-55.
Miller DH, Leary SM. 2007. Primary-progressive multiple sclerosis. Lancet
Neurol 6(10):903-12.
Miller SD, McMahon EJ, Schreiner B, Bailey SL. 2007. Antigen presentation
in the CNS by myeloid dendritic cells drives progression of relapsing
experimental autoimmune encephalomyelitis. Ann N Y Acad Sci
1103:179-91.
Milner R, Campbell IL. 2003. The extracellular matrix and cytokines regulate
microglial integrin expression and activation. J Immunol 170(7):3850-
8.
Muhlethaler-Mottet A, Di Berardino W, Otten LA, Mach B. 1998. Activation of
the MHC class II transactivator CIITA by interferon-gamma requires
cooperative interaction between Stat1 and USF-1. Immunity 8(2):157-
66.
Muller U, Steinhoff U, Reis LF, Hemmi S, Pavlovic J, Zinkernagel RM, Aguet
M. 1994. Functional role of type I and type II interferons in antiviral
defense. Science 264(5167):1918-21.
Muzio L, Martino G, Furlan R. 2007. Multifaceted aspects of inflammation in
multiple sclerosis: the role of microglia. J Neuroimmunol 191(1-2):39-
44.
Nikcevich KM, Piskurich JF, Hellendall RP, Wang Y, Ting JP. 1999.
Differential selectivity of CIITA promoter activation by IFN-gamma and
IRF-1 in astrocytes and macrophages: CIITA promoter activation is
not affected by TNF-alpha. J Neuroimmunol 99(2):195-204.
Njenga MK, Coenen MJ, DeCuir N, Yeh HY, Rodriguez M. 2000. Short-term
treatment with interferon-alpha/beta promotes remyelination, whereas
long-term treatment aggravates demyelination in a murine model of
multiple sclerosis. J Neurosci Res 59(5):661-70.
Njenga MK, Pease LR, Wettstein P, Mak T, Rodriguez M. 1997. Interferon
alpha/beta mediates early virus-induced expression of H-2D and H-2K
in the central nervous system. Lab Invest 77(1):71-84.

201
O'Keefe GM, Nguyen VT, Ping Tang LL, Benveniste EN. 2001. IFN-gamma
regulation of class II transactivator promoter IV in macrophages and
microglia: involvement of the suppressors of cytokine signaling-1
protein. J Immunol 166(4):2260-9.
Olschowka JA, Kyrkanides S, Harvey BK, O'Banion MK, Williams JP, Rubin
P, Hansen JT. 1997. ICAM-1 induction in the mouse CNS following
irradiation. Brain Behav Immun 11(4):273-85.
Olson JK, Miller SD. 2004. Microglia initiate central nervous system innate
and adaptive immune responses through multiple TLRs. J Immunol
173(6):3916-24.
Ontiveros E, Kuo L, Masters PS, Perlman S. 2001. Inactivation of expression
of gene 4 of mouse hepatitis virus strain JHM does not affect virulence
in the murine CNS. Virology 289(2):230-8.
Panne D. 2008. The enhanceosome. Curr Opin Struct Biol 18(2):236-42.
Parra B, Bergmann CC, Hinton DR, Atkinson R, Stohlman SA. 2001. IFN-
gamma secreted by virus-specific CD8+ T cells contribute to CNS viral
clearance. Adv Exp Med Biol 494:335-40.
Parra B, Hinton DR, Lin MT, Cua DJ, Stohlman SA. 1997. Kinetics of
cytokine mRNA expression in the central nervous system following
lethal and nonlethal coronavirus-induced acute encephalomyelitis.
Virology 233(2):260-70.
Parra B, Hinton DR, Marten NW, Bergmann CC, Lin MT, Yang CS, Stohlman
SA. 1999. IFN-gamma is required for viral clearance from central
nervous system oligodendroglia. J Immunol 162(3):1641-7.
Pashenkov M, Teleshova N, Link H. 2003. Inflammation in the central
nervous system: the role for dendritic cells. Brain Pathol 13(1):23-33.
Paulsson KM. 2004. Evolutionary and functional perspectives of the major
histocompatibility complex class I antigen-processing machinery. Cell
Mol Life Sci 61(19-20):2446-60.
Peppel K, Baglioni C. 1991. Deadenylation and turnover of interferon-beta
mRNA. J Biol Chem 266(11):6663-6.
Perlman S, Jacobsen G, Moore S. 1988. Regional localization of virus in the
central nervous system of mice persistently infected with murine
coronavirus JHM. Virology 166(2):328-38.

202
Perlman S, Jacobsen G, Olson AL, Afifi A. 1990. Identification of the spinal
cord as a major site of persistence during chronic infection with a
murine coronavirus. Virology 175(2):418-26.
Perlman S, Ries D. 1987. The astrocyte is a target cell in mice persistently
infected with mouse hepatitis virus, strain JHM. Microb Pathog
3(4):309-14.
Pewe L, Haring J, Perlman S. 2002. CD4 T-cell-mediated demyelination is
increased in the absence of gamma interferon in mice infected with
mouse hepatitis virus. J Virol 76(14):7329-33.
Piskurich JF, Lin KI, Lin Y, Wang Y, Ting JP, Calame K. 2000. BLIMP-I
mediates extinction of major histocompatibility class II transactivator
expression in plasma cells. Nat Immunol 1(6):526-32.
Platanias LC. 2005. Mechanisms of type-I- and type-II-interferon-mediated
signalling. Nat Rev Immunol 5(5):375-86.
Plumet S, Herschke F, Bourhis JM, Valentin H, Longhi S, Gerlier D. 2007.
Cytosolic 5'-triphosphate ended viral leader transcript of measles virus
as activator of the RIG I-mediated interferon response. PLoS ONE
2(3):e279.
Ponomarev ED, Shriver LP, Maresz K, Dittel BN. 2005. Microglial cell
activation and proliferation precedes the onset of CNS autoimmunity.
J Neurosci Res 81(3):374-89.
Ponzoni M, Guarnaccia F, Corrias MV, Cornaglia-Ferraris P. 1993.
Uncoordinate induction and differential regulation of HLA class-I and
class-II expression by gamma-interferon in differentiating human
neuroblastoma cells. Int J Cancer 55(5):817-23.
Popko B, Baerwald KD. 1999. Oligodendroglial response to the immune
cytokine interferon gamma. Neurochem Res 24(2):331-8.
Power C, Kong PA, Trapp BD. 1996. Major histocompatibility complex class I
expression in oligodendrocytes induces hypomyelination in transgenic
mice. J Neurosci Res 44(2):165-73.
Prakash A, Levy DE. 2006. Regulation of IRF7 through cell type-specific
protein stability. Biochem Biophys Res Commun 342(1):50-6.
Prehaud C, Megret F, Lafage M, Lafon M. 2005. Virus infection switches
TLR-3-positive human neurons to become strong producers of beta
interferon. J Virol 79(20):12893-904.

203
Raamsman MJ, Locker JK, de Hooge A, de Vries AA, Griffiths G, Vennema
H, Rottier PJ. 2000. Characterization of the coronavirus mouse
hepatitis virus strain A59 small membrane protein E. J Virol
74(5):2333-42.
Ramakrishna C, Atkinson RA, Stohlman SA, Bergmann CC. 2006. Vaccine-
induced memory CD8+ T cells cannot prevent central nervous system
virus reactivation. J Immunol 176(5):3062-9.
Ramakrishna C, Bergmann CC, Atkinson R, Stohlman SA. 2003. Control of
central nervous system viral persistence by neutralizing antibody. J
Virol 77(8):4670-8.
Ramakrishna C, Bergmann CC, Holmes KV, Stohlman SA. 2004. Expression
of the mouse hepatitis virus receptor by central nervous system
microglia. J Virol 78(14):7828-32.
Randall RE, Goodbourn S. 2008. Interferons and viruses: an interplay
between induction, signalling, antiviral responses and virus
countermeasures. J Gen Virol 89(Pt 1):1-47.
Redwine JM, Buchmeier MJ, Evans CF. 2001. In vivo expression of major
histocompatibility complex molecules on oligodendrocytes and
neurons during viral infection. Am J Pathol 159(4):1219-24.
Rima BK, Duprex WP. 2005. Molecular mechanisms of measles virus
persistence. Virus Res 111(2):132-47.
Roebuck KA, Finnegan A. 1999. Regulation of intercellular adhesion
molecule-1 (CD54) gene expression. J Leukoc Biol 66(6):876-88.
Roth-Cross JK, Martinez-Sobrido L, Scott EP, Garcia-Sastre A, Weiss SR.
2007. Inhibition of the alpha/beta interferon response by mouse
hepatitis virus at multiple levels. J Virol 81(13):7189-99.
Rowe CL, Baker SC, Nathan MJ, Fleming JO. 1997. Evolution of mouse
hepatitis virus: detection and characterization of spike deletion
variants during persistent infection. J Virol 71(4):2959-69.
Sainz B, Jr., Mossel EC, Peters CJ, Garry RF. 2004. Interferon-beta and
interferon-gamma synergistically inhibit the replication of severe acute
respiratory syndrome-associated coronavirus (SARS-CoV). Virology
329(1):11-7.

204
Sato M, Hata N, Asagiri M, Nakaya T, Taniguchi T, Tanaka N. 1998. Positive
feedback regulation of type I IFN genes by the IFN-inducible
transcription factor IRF-7. FEBS Lett 441(1):106-10.
Sawicki SG, Sawicki DL. 2005. Coronavirus transcription: a perspective. Curr
Top Microbiol Immunol 287:31-55.
Schindler C, Levy DE, Decker T. 2007. JAK-STAT signaling: from interferons
to cytokines. J Biol Chem 282(28):20059-63.
Schoenborn JR, Wilson CB. 2007. Regulation of interferon-gamma during
innate and adaptive immune responses. Adv Immunol 96:41-101.
Schwendimann RN, Alekseeva N. 2007. Gender issues in multiple sclerosis.
Int Rev Neurobiol 79:377-92.
Sedgwick J, Hickey W. 1997. Antigen presentation in the central nervous
system. In: Keane RW HW, editor. Immunology of the Central
Nervous System. Oxford: Oxford University Press. p 394-398.
Sejvar JJ, Haddad MB, Tierney BC, Campbell GL, Marfin AA, Van Gerpen
JA, Fleischauer A, Leis AA, Stokic DS, Petersen LR. 2003. Neurologic
manifestations and outcome of West Nile virus infection. Jama
290(4):511-5.
Shif I, Bang FB. 1970. In vitro interaction of mouse hepatitis virus and
macrophages from genetically resistant mice. II. Biological
characterization of a variant virus MHV (C3H) isolated from stocks of
MHV(PRI). J Exp Med 131(4):851-62.
Singer BB, Scheffrahn I, Heymann R, Sigmundsson K, Kammerer R, Obrink
B. 2002. Carcinoembryonic antigen-related cell adhesion molecule 1
expression and signaling in human, mouse, and rat leukocytes:
evidence for replacement of the short cytoplasmic domain isoform by
glycosylphosphatidylinositol-linked proteins in human leukocytes. J
Immunol 168(10):5139-46.
Skulina C, Schmidt S, Dornmair K, Babbe H, Roers A, Rajewsky K, Wekerle
H, Hohlfeld R, Goebels N. 2004. Multiple sclerosis: brain-infiltrating
CD8+ T cells persist as clonal expansions in the cerebrospinal fluid
and blood. Proc Natl Acad Sci U S A 101(8):2428-33.
Slifka MK, Rodriguez F, Whitton JL. 1999. Rapid on/off cycling of cytokine
production by virus-specific CD8+ T cells. Nature 401(6748):76-9.

205
Smith AL, Barthold SW, Beck DS. 1987. Intranasally administered alpha/beta
interferon prevents extension of mouse hepatitis virus, strain JHM, into
the brains of BALB/cByJ mice. Antiviral Res 8(5-6):239-45.
Smith-Jensen T, Burgoon MP, Anthony J, Kraus H, Gilden DH, Owens GP.
2000. Comparison of immunoglobulin G heavy-chain sequences in
MS and SSPE brains reveals an antigen-driven response. Neurology
54(6):1227-32.
Sorensen O, Dales S. 1985. In vivo and in vitro models of demyelinating
disease: JHM virus in the rat central nervous system localized by in
situ cDNA hybridization and immunofluorescent microscopy. J Virol
56(2):434-8.
Sospedra M, Martin R. 2005. Immunology of multiple sclerosis. Annu Rev
Immunol 23:683-747.
Steiner I, Kennedy PG, Pachner AR. 2007. The neurotropic herpes viruses:
herpes simplex and varicella-zoster. Lancet Neurol 6(11):1015-28.
Stohlman SA, Hinton DR, Parra B, Atkinson R, Bergmann CC. 2008. CD4 T
cells contribute to virus control and pathology following central
nervous system infection with neurotropic mouse hepatitis virus. J
Virol 82(5):2130-9.
Stohwasser R, Giesebrecht J, Kraft R, Muller EC, Hausler KG, Kettenmann
H, Hanisch UK, Kloetzel PM. 2000. Biochemical analysis of
proteasomes from mouse microglia: induction of immunoproteasomes
by interferon-gamma and lipopolysaccharide. Glia 29(4):355-65.
Stohwasser R, Standera S, Peters I, Kloetzel PM, Groettrup M. 1997.
Molecular cloning of the mouse proteasome subunits MC14 and
MECL-1: reciprocally regulated tissue expression of interferon-
gamma-modulated proteasome subunits. Eur J Immunol 27(5):1182-7.
Strehl B, Seifert U, Kruger E, Heink S, Kuckelkorn U, Kloetzel PM. 2005.
Interferon-gamma, the functional plasticity of the ubiquitin-proteasome
system, and MHC class I antigen processing. Immunol Rev 207:19-
30.
Sun D, Whitaker JN, Huang Z, Liu D, Coleclough C, Wekerle H, Raine CS.
2001. Myelin antigen-specific CD8+ T cells are encephalitogenic and
produce severe disease in C57BL/6 mice. J Immunol 166(12):7579-
87.

206
Taguchi F, Siddell SG. 1985. Difference in sensitivity to interferon among
mouse hepatitis viruses with high and low virulence for mice. Virology
147(1):41-8.
Takeuchi O, Akira S. 2007. Recognition of viruses by innate immunity.
Immunol Rev 220:214-24.
Takeuchi O, Sims TN, Takei Y, Ramassar V, Famulski KS, Halloran PF.
2003. Differential usage of class II transactivator promoters PI and PIV
during inflammation and injury in kidney. J Am Soc Nephrol
14(11):2823-32.
Talbot PJ, Knobler RL, Buchmeier MJ. 1984. Western and dot
immunoblotting analysis of viral antigens and antibodies: application to
murine hepatitis virus. J Immunol Methods 73(1):177-88.
Templeton SP, Kim TS, O'Malley K, Perlman S. 2008. Maturation and
localization of macrophages and microglia during infection with a
neurotropic murine coronavirus. Brain Pathol 18(1):40-51.
Tenoever BR, Ng SL, Chua MA, McWhirter SM, Garcia-Sastre A, Maniatis T.
2007. Multiple functions of the IKK-related kinase IKKepsilon in
interferon-mediated antiviral immunity. Science 315(5816):1274-8.
Tepavcevic V, Blakemore WF. 2006. Haplotype matching is not an essential
requirement to achieve remyelination of demyelinating CNS lesions.
Glia 54(8):880-90.
Tooze J, Tooze S, Warren G. 1984. Replication of coronavirus MHV-A59 in
sac- cells: determination of the first site of budding of progeny virions.
Eur J Cell Biol 33(2):281-93.
Trifilo MJ, Lane TE. 2004. The CC chemokine ligand 3 regulates
CD11c+CD11b+CD8alpha- dendritic cell maturation and activation
following viral infection of the central nervous system: implications for
a role in T cell activation. Virology 327(1):8-15.
Turnley AM, Morahan G, Okano H, Bernard O, Mikoshiba K, Allison J,
Bartlett PF, Miller JF. 1991. Dysmyelination in transgenic mice
resulting from expression of class I histocompatibility molecules in
oligodendrocytes. Nature 353(6344):566-9.
Uematsu S, Akira S. 2007. Toll-like receptors and Type I interferons. J Biol
Chem 282(21):15319-23.

207
Verbeek R, van Dongen H, Wawrousek EF, Amor S, van Noort JM. 2007.
Induction of EAE by T cells specific for alpha B-crystallin depends on
prior viral infection in the CNS. Int Immunol 19(3):277-85.
Versteeg GA, Bredenbeek PJ, van den Worm SH, Spaan WJ. 2007. Group 2
coronaviruses prevent immediate early interferon induction by
protection of viral RNA from host cell recognition. Virology 361(1):18-
26.
Virelizier JL, Gresser I. 1978. Role of interferon in the pathogenesis of viral
diseases of mice as demonstrated by the use of anti-interferon serum.
V. Protective role in mouse hepatitis virus type 3 infection of
susceptible and resistant strains of mice. J Immunol 120(5):1616-9.
Waeckerle-Men Y, Starke A, Wahl PR, Wuthrich RP. 2007. Limited
costimulatory molecule expression on renal tubular epithelial cells
impairs T cell activation. Kidney Blood Press Res 30(6):421-9.
Waldburger JM, Suter T, Fontana A, Acha-Orbea H, Reith W. 2001.
Selective abrogation of major histocompatibility complex class II
expression on extrahematopoietic cells in mice lacking promoter IV of
the class II transactivator gene. J Exp Med 194(4):393-406.
Wang FI, Hinton DR, Gilmore W, Trousdale MD, Fleming JO. 1992.
Sequential infection of glial cells by the murine hepatitis virus JHM
strain (MHV-4) leads to a characteristic distribution of demyelination.
Lab Invest 66(6):744-54.
Wang FI, Stohlman SA, Fleming JO. 1990. Demyelination induced by murine
hepatitis virus JHM strain (MHV-4) is immunologically mediated. J
Neuroimmunol 30(1):31-41.
Wang N, Ahmed S, Haqqi TM. 2005. Genomic structure and functional
characterization of the promoter region of human IkappaB kinase-
related kinase IKKi/IKKvarepsilon gene. Gene 353(1):118-33.
Wang Q, Haluskey JA, Lavi E. 1998. Coronavirus MHV-A59 causes
upregulation of interferon-beta RNA in primary glial cell cultures. Adv
Exp Med Biol 440:451-4.
Watts C, Zaru R, Prescott AR, Wallin RP, West MA. 2007. Proximal effects of
Toll-like receptor activation in dendritic cells. Curr Opin Immunol
19(1):73-8.

208
White FA, 3rd, Ishaq M, Stoner GL, Frisque RJ. 1992. JC virus DNA is
present in many human brain samples from patients without
progressive multifocal leukoencephalopathy. J Virol 66(10):5726-34.
Wiesemann E, Deb M, Trebst C, Hemmer B, Stangel M, Windhagen A. 2008.
Effects of interferon-{beta} on co-signaling molecules: upregulation of
CD40, CD86 and PD-L2 on monocytes in relation to clinical response
to interferon-{beta} treatment in patients with multiple sclerosis. Mult
Scler 14(2):166-76.
Williams GS, Malin M, Vremec D, Chang CH, Boyd R, Benoist C, Mathis D.
1998. Mice lacking the transcription factor CIITA--a second look. Int
Immunol 10(12):1957-67.
Wintterle S, Schreiner B, Mitsdoerffer M, Schneider D, Chen L, Meyermann
R, Weller M, Wiendl H. 2003. Expression of the B7-related molecule
B7-H1 by glioma cells: a potential mechanism of immune paralysis.
Cancer Res 63(21):7462-7.
Wong GHW, Bartlett PF, Clark-Lewis I, Battye F, Schrader JW. 1984.
Inducible expression of H-2 and Ia antigens on brain cells. Nature
310(5979):688-691.
Wosik K, Antel J, Kuhlmann T, Bruck W, Massie B, Nalbantoglu J. 2003.
Oligodendrocyte injury in multiple sclerosis: a role for p53. J
Neurochem 85(3):635-44.
Wright KL, Ting JP. 2006. Epigenetic regulation of MHC-II and CIITA genes.
Trends Immunol 27(9):405-12.
Wu GF, Dandekar AA, Pewe L, Perlman S. 2000. CD4 and CD8 T cells have
redundant but not identical roles in virus-induced demyelination. J
Immunol 165(4):2278-86.
Yamamoto M, Sato S, Hemmi H, Hoshino K, Kaisho T, Sanjo H, Takeuchi O,
Sugiyama M, Okabe M, Takeda K and others. 2003. Role of adaptor
TRIF in the MyD88-independent toll-like receptor signaling pathway.
Science 301(5633):640-3.
Ye Y, Hauns K, Langland JO, Jacobs BL, Hogue BG. 2007. Mouse hepatitis
coronavirus A59 nucleocapsid protein is a type I interferon antagonist.
J Virol 81(6):2554-63.
Yokomori K, Banner LR, Lai MM. 1991. Heterogeneity of gene expression of
the hemagglutinin-esterase (HE) protein of murine coronaviruses.
Virology 183(2):647-57.

209
Yoneyama M, Kikuchi M, Matsumoto K, Imaizumi T, Miyagishi M, Taira K,
Foy E, Loo YM, Gale M, Jr., Akira S and others. 2005. Shared and
unique functions of the DExD/H-box helicases RIG-I, MDA5, and
LGP2 in antiviral innate immunity. J Immunol 175(5):2851-8.
Yoneyama M, Kikuchi M, Natsukawa T, Shinobu N, Imaizumi T, Miyagishi M,
Taira K, Akira S, Fujita T. 2004. The RNA helicase RIG-I has an
essential function in double-stranded RNA-induced innate antiviral
responses. Nat Immunol 5(7):730-7.
Yoshimura A, Ohishi HM, Aki D, Hanada T. 2004. Regulation of TLR
signaling and inflammation by SOCS family proteins. J Leukoc Biol
75(3):422-7.
Youssef S, Stuve O, Patarroyo JC, Ruiz PJ, Radosevich JL, Hur EM, Bravo
M, Mitchell DJ, Sobel RA, Steinman L and others. 2002. The HMG-
CoA reductase inhibitor, atorvastatin, promotes a Th2 bias and
reverses paralysis in central nervous system autoimmune disease.
Nature 420(6911):78-84.
Zhang X, Hinton DR, Cua DJ, Stohlman SA, Lai MM. 1997. Expression of
interferon-gamma by a coronavirus defective-interfering RNA vector
and its effect on viral replication, spread, and pathogenicity. Virology
233(2):327-38.
Zhou H, Perlman S. 2007. Mouse hepatitis virus does not induce Beta
interferon synthesis and does not inhibit its induction by double-
stranded RNA. J Virol 81(2):568-74.
Zhou J, Marten NW, Bergmann CC, Macklin WB, Hinton DR, Stohlman SA.
2005. Expression of matrix metalloproteinases and their tissue
inhibitor during viral encephalitis. J Virol 79(8):4764-73.
Zuo J, Stohlman SA, Hoskin JB, Hinton DR, Atkinson R, Bergmann CC.
2006. Mouse hepatitis virus pathogenesis in the central nervous
system is independent of IL-15 and natural killer cells. Virology
350(1):206-15.

210

Appendix. Real-time PCR primers for murine transcripts.

Gene Product ID Forward Primer Reverse Primer
Adar Adar GGGCTTCATCAGGTTTCTC TGGCAAGCTCAAATATGCTG
CD11c Itgax TTCCCAGACTTGAAGACC CTCCATCATTAGACACCGT
CIITA (all isoforms) Ciita AACTCAGCTCAGAGCCAGAC ACGTACTGATCCAGTTCCGC
Gapdh Gapdh CATGGCCTTCCGTGTTCCTA ATGCCTGCTTCACCACCTTCT
H2-Aβ (H2
b
) H2-Ab GCCTGAAGAGCCCCATCAC ATGCCGCTCAACATCTTGCT
H2-Aα (H2
d
) H2-Aa TCAACATCACATGGCTCAGAAATA AGACAGCTTGTGGAAGGAATGG
IFNα4 Ifna4 GAGCTACTACTGGTCAGCCT GGGAGTCTTCTCATTTCTTCCA
IFN β Infb
GCTCCTGGAGCAGCTGAATG

CGTCATCTCCATAGGGATCTTGA

IFN γ Ifng CCAAGTTTGAGGTCAACAACCC AACAGCTGGTGGACCACTC
IKKε Ikbke CCAGAAGATTCAGTGTTGTTTGG TCATTGTAGCTGAGCCCTG
ISG54 Ifit2 AGAGGAAGAGGTTGCCTGGA CTCGTTGTACTCATGACTGCTG
Mda5 Ifih1 GACACCAGAATTCAAGGGAC GCCACACTTGCAGATAATCTC
PD-L1 Cd274 GCTACGGGCGTTTACTATCAC TTCTACAGGGAATCTGCACTC
RIG-I Ddx58 GTCAGCACAAACCACAACC GTCTCAACCACTCGAATGTC
TLR3 Tlr3 GGACTGAATAACTTAAACAAACTTGAACC AGCGCATATCTAAACTGTTCAGG
TLR7 Tlr7 GCTCTTAGTTTCTAGAGTCTTTGG AGTCCACGATCACATGGG

211
Appendix (con.) Real-time PCR primers for the detection of specific viral
subgenomic RNAs.

Anti-leader TAAGAGTGATTGGCGTCCG
Genomic length (ORF1a/b) ATCTTTGCCATTATGCAACCT
SgRNA2 (NS2) CCATTTCCACAAGTTGAGACTG
SgRNA3 (Spike) CTGTAAGCGCGAGATTCC
SgRNA4 (NS4) GCTACTAGAAATGGACCAATAAAGAC
SgRNA5 (Envelope) CTGCGCTGCAAATTTACC
SgRNA6 (Membrane) ATTTAGCGCATACACGCA
SgRNA7 (Nucleocapsid) ATTGGGTTGAGTAGTTGCAG

Note: The primer for a specific subgenomic RNA is paired with the anti-
leader primer. cDNA templates must be random primed in order to amplify
these products.

Abstract (if available)

Abstract The data presented in this thesis is incorporated into the model of early events of coronavirus infection and focuses on the innate responses by glia and their potential interactions with the mounting adaptive immune response. By utilizing transgenic mice to purify distinct populations of glia at different times during coronavirus infection of the central nervous system, the unique cell-specific responses can be evaluated in vivo to provide a fuller picture of the events leading to persistent viral infection. These new findings emphasize the protective role of microglia in providing early IFNalphabeta expression and the indirect modulation of this response by T cell activity. Microglia express a broad repertoire of pathogen associated pattern receptors (i.e. TLRs and RIG-I family helicases) and thereby trigger IFNalphabeta expression in direct response to viral infection. IFNalphabeta expression declines in correlation with effective clearance of virus from microglia by T cell activity. Oligodendroglia upregulated their expression of cytosolic receptors for viral RNA products, RIG-I and Mda5, during infection. However oligodendroglia were incapable of recognizing coronavirus infection and did not induce IFNalphabeta expression.

Linked assets

University of Southern California Dissertations and Theses

Conceptually similar

PDF

Rationalized immunotherapy by immune signature characterization

PDF

Kaposi's sarcoma associated herpes-virus induces cellular proxi expression to modulate host gene expression that benefits viral infection and oncogenesis

PDF

Maternal inflammation disrupts fetal blood-brain barrier formation via cyclooxygenase activation

PDF

The effects of hepatitis C virus infection on host immune response and signaling pathways

PDF

Human papillomavirus type 16 entry via the annexin A2 heterotetramer leads to infection and immune evasion

PDF

Characterization of three novel variants of the MAVS adaptor

PDF

Study of dendritic cell targeting by engineered lentivectors

PDF

Mediating the homeostatic response during light & cytotoxic induced retinal damage

Asset Metadata

Creator Malone, Karen Emmerette (author)

Core Title Immune responses by glia during neurotropic coronavirus induced encephalomyelitis

School Keck School of Medicine

Degree Doctor of Philosophy

Degree Program Pathobiology

Publication Date 10/22/2008

Defense Date 06/16/2008

Publisher University of Southern California (original), University of Southern California. Libraries (digital)

Tag anti-viral response,glia,immunity,interferon,major histocompatibility complex,murine coronavirus,neurosciences,OAI-PMH Harvest,T-cell response

Language English

Contributor Electronically uploaded by the author (provenance)

Advisor Hofman, Florence M. (committee chair), Gardner, Judy (committee member), Hinton, David R. (committee member)

Creator Email flutedevil@yahoo.com,kmalone@usc.edu

Permanent Link (DOI) https://doi.org/10.25549/usctheses-m1693

Unique identifier UC1301801

Identifier etd-Malone-2110 (filename),usctheses-m40 (legacy collection record id),usctheses-c127-124776 (legacy record id),usctheses-m1693 (legacy record id)

Legacy Identifier etd-Malone-2110.pdf

Dmrecord 124776

Document Type Dissertation

Rights Malone, Karen Emmerette

Type texts

Source University of Southern California (contributing entity), University of Southern California Dissertations and Theses (collection)

Repository Name Libraries, University of Southern California

Repository Location Los Angeles, California

Repository Email cisadmin@lib.usc.edu