University of Southern California Dissertations and Theses

Evaluating the therapeutic potential of targeting CBX8 in MLLr leukemia

(USC Thesis Other)

Evaluating the therapeutic potential of targeting CBX8 in MLLr leukemia

PDF

Download a page range

Download transcript

Copy asset link

Request this asset

Transcript (if available)

Content

Evaluating the therapeutic potential of targeting CBX8 in MLLr leukemia

By

Jiaxuan Bian

A Dissertation Presented to the
FACULTY OF THE USC KECK SCHOOL OF MEDICINE
In Partial Fulfillment of the
Requirements for the Degree
MASTER OF SCIENCE
(BIOCHEMISTRY AND MOLECULAR MEDICINE)

December 2022

Copyright 2022 Jiaxuan Bian

ii

Acknowledgments
I would like to thank my committee members: Dr. Oliver Bell, Dr. Yali Dou,
and Dr. Yong-Mi Kim, for supporting my experiments and thesis. Special thanks
to my mentor, Dr. Oliver Bell, for every one-on-one communication, every
suggestion from the lab meeting, for giving me detailed guidance when I did
experiments, and for troubleshooting with me when my experiments showed
abnormal results. These moments helped me become better acquainted with
laboratory life and helped me keep moving forward in my scientific research.
I would also like to thank all the members of the Bell lab who have helped me
with research during this time. Alexandria Sorensen, Baily Richardson, Dr.
Daniel Bsteh, Eda Atmaca, and Jasmine Martinez provided me with a lot of
experimental experience and guidance. I would also like to give a special
thanks to Bo Chen, who helped me a lot with my ChIP-seq data analysis. I
enjoyed the time in the lab with you guys.
Finally, thanks to two postdocs from Dr. Yali Dou's lab: Dr. Liang Sha and
Dr. Xueqing Wang. They generously provided MOLM-13 cells and suggestions
for Western blot and cell culture. I would like to thank Ph.D. student Heather
Ogana from Dr. Yong-Mi Kim‘s lab. The cells, cell proliferation data, and advice
she provided were valuable to my thesis. Finally, I would like to thank Benjamin
Weekley, Dingqi Xu, Guanlin Liu, Huikang Ye, Jingqi yu, Tianyang Bai, Yao Liu,
and Zi Yang, who also provided meaningful suggestions and help for my
experiments.

iii

Table of Contents
Acknowledgements .......................................................................................... ii
List of figures ................................................................................................. iv
Abstract .......................................................................................................... v
Chapter 1: Introduction .................................................................................... 1
1.1 Polycomb Repressive Complexes (PRCs) .......................................... 2
1.1.1 Polycomb Repressive Complexes 2 (PRC2) .............................. 2
1.1.2 Polycomb Repressive Complexes 2 (PRC1) .............................. 2
1.1.3 Chromobox (CBX) Proteins ...................................................... 3
1.2 Leukemia ........................................................................................... 4
1.2.1 Chromosomal translocations involving the mixed lineage
leukemia (MLL) ..................................................................................... 6
1.2.2 Interaction of CBX8 with MLL-AF9 in the MLLr cell line ............ 6
1.3 UNC7040 and Tazemetostat ............................................................. 7
Chapter 2: Result ......................................................................................... 10
2.1 UNC7040 has a stronger effect on the MLL-AF9 cell line, and the
difference in treatment effect is independent of the expression level of
CBX4,7,8 .................................................................................................... 10
2.1.1 CBX8 antagonist UNC7040 inhibits MLLr cell line proliferation 10
2.1.2 UNC7040 had a stronger inhibition than other inhibitors for MLL-
AF9 cell line ............................................................................................. 11
2.1.3 CBX8 dependence is not attributed to expression levels of CBX
paralogs .................................................................................................. 14
2.2 UNC7040 treatment efficiently displaces CBX protein and RING1B
from Polycomb target genes ....................................................................... 17
2.3 Analysis of ShCBX8 knockdown efficiency ........................................ 23
Chapter 3: Discussion .................................................................................. 30
Chapter 4: Methods and materials ............................................................... 37
References ................................................................................................... 43

iv

List of figures
Figure 1 ............................................................................................................ 8
Figure 2 ............................................................................................................ 9
Figure 3 .......................................................................................................... 13
Figure 4 .......................................................................................................... 15
Figure 5 .......................................................................................................... 18
Figure 6 .......................................................................................................... 20
Figure 7 .......................................................................................................... 25
Figure 8 .......................................................................................................... 29

v

Abstract
Chromosomal rearrangements of the Mixed-Lineage Leukemia (MLL) gene
encoding a histone H3 lysine 4 specific methyltransferases can lead to the
development of acute leukemias. M L L rearrangements (MLLr) result in
oncogenic fusion proteins, such as MLL-AF9 and MLL-AF4, which exploit the
chromatin regulatory machinery to enforce oncogenic gene expression and
promote leukemogenesis. One of the major interacting partners is CBX8, a
Polycomb group protein commonly associated with transcriptional repression.
Surprisingly, CBX8 binding to MLL fusions promotes aberrant gene activation
but the underlying mechanisms are poorly understood. We previously
developed UNC7040, a chemical probe specifically targeting CBX8 interaction
with the repressive histone modification H3K27me3. Using UNC7040, we
sought to investigate the therapeutic potential of targeting CBX8 in MLLr cell
lines and study its role in MLLr-dependent and H3K27me3-dependent gene
regulation. We show that in MLL-AF9 cells, UNC7040 displaces CBX8-
containing PRC1 complexes from Polycomb target sites and strongly impairs
proliferation. A comparatively milder effect of EZH2 inhibition on proliferation
suggests that UNC7040 targets H3K27me3-dependent and independent CBX8
functions. In conclusion, our data support the therapeutic potential of targeting
CBX8 for the treatment of MLL-AF9 driven leukemia.

1

Chapter 1: Introduction
Differentiation of cells into functionally distinct tissues and organs results from
the selective expression of genes. Fundamentally, differential gene expression
is controlled at the level of binding of transcription factors to DNA. However, in
mammals DNA is present in form of chromatin, a nucleo-protein complex, which
inherently interferes with transcription factor interactions. The fundamental
subunit of chromatin is the nucleosome which is composed of an octamer of
four core histones: H3, H4, H2A, and H2B [1]. To modulate DNA accessibility,
transcription factors cooperate with chromatin regulatory proteins which
facilitate increased or decreased binding through histone modifications
including posttranslational modifications and ATP-dependent nucleosome
remodeling. The Polycomb Repressive complexes 1 and 2 play an important
role in transcriptional silencing through the formation of repressive chromatin
[2]. Polycomb genes were originally identified in a fly genetic screen as
transcriptional repressors of Hox genes which encode transcription factors
driving pattern formation [3]. Later research discovered that Polycomb genes
are also highly conserved in mammals and play an important regulatory role
during development [4]. Moreover, dysregulation of Polycomb group proteins
has been implicated in the development of many cancers [5,6], but how this
process occurs is still unclear.
Based on a series of studies, scientists found that the Polycomb protein mainly
consists of two complexes, PRC1 and PRC2 [7].

2

1.1 Polycomb Repressive Complexes (PRCs)
1.1.1Polycomb Repressive Complex (PRC2)
PRC2 is a complex with methyltransferase activity, and one of its main functions
is to catalyze mono-, di- and trimethylation of H3K27 (H3K27me1, 2, 3) [8]. The
PRC2 complex forms a tetrameric core complex, including the enhancer of
Zeste 2 (EZH2) or its paralog EZH1, Suppressor of Zeste 12 (SUZ12), and
retinoblastoma-binding protein 4 (RBBP4) or RBBP7. Its methyltransferase
activity is mainly derived from EZH2 [9, 10]. Cryo-electron microscopy studies
revealed that its catalytically active site is derived from the CXC and SET
domains, which bind to nucleosomal DNA, and SUZ12 is required for binding
to chromatin in vivo [11].
Based on the combination of PRC2 with different subunits, PRC2 can be
classified into PRC2.1 and PRC2.2: PRC2.1 is formed with PCL1/2/3 and
EPOP or PALI1/2, and PRC2. 2 requires the co-assembly of AEBP2 and
JARID2. It remains unknown whether there is a functional difference between
PRC2.1 and PRC2.2, and ChIP-seq studies have shown that they highly
overlap with core PRC2 and thus are not responsible for different targets [12].
Dysregulation of EZH2 is thought to be associated with cancer invasion, and its
overexpression exists in various cancer cells including lung, liver, and ovarian
cancer [13-15].
1.1.2 Polycomb Repressive Complex (PRC1)
PRC1 possesses E3 ubiquitin ligase activity and can catalytic

3

monoubiquitination of H2AK119 (H2AK119ub1) [16]. The catalytic core of PRC1
includes one of six PCGF proteins (PCGF1-6) bound to RING1A/B [17]. During
histone ubiquitination, RING1B and PCGF dimerization are required to facilitate
interaction with E2-binding enzymes [18]. According to the different subunits,
PRC1 can be classified as Canonical PRC1 and Variant PRC1. Canonical
PRC1 consists of PCGF2/4, Chromobox (CBX) protein, RING1 (A/B) and PHC1
or PHC2. Variant PRC1 includes one of PCGF proteins (1/2/3/4/5/6), RING1
(A/B), and YY1-binding protein (RYBP) or YY1-associated factor 2 (YAF2) [17,
19]. There is a feedback and communication mechanism between canonical
PRC1 and PRC2 (Figure 1). PRC1 can ubiquitinate H2AK119, which is
recognized by AEBP2 and JARID2 of the PCR2.2 subunit, which leads to
increasing in PRC2 occupancy and stimulates H3K27me3. [20, 21] H3K27me3
can be recognized by the Chromobox proteins and recruit canonical PRC1
(Figure1).
1.1.3 Chromobox (CBX) Proteins
The binding of PRC1 to nucleosomes requires the mediation of CBX (2/4/6/7/8),
which can specifically recognize H3K27me3 and recruit another PRC1 subunit.
Chromobox domain protein 8 (CBX8) is a member of CBX proteins. In
beginning, scientists thought that CBX8 is a transcriptional repressor, it can bind
to RING1B and correlates with BMI1. Further research has shown that CBX7
and CBX8 can affect INK4a/ARF through PRC1 inhibition of tumor suppressor
sites [22].

4

1.2 Leukemia
Leukemia is a blood cancer. Leukemia cells can grow rapidly in the bone marrow and
are released into the blood. Unlike normal blood cells, they are similar to
immature blood cells and have no corresponding biological function, but they
occupy the space of the bone marrow and the blood leads to interference with
the development of red blood cells and white blood cells [23]. According to the
rate of leukemia progression, it can be classified into acute leukemia and
chronic leukemia. Acute leukemia can be further subdivided into Acute
lymphocytic leukemia (ALL) and Acute myelogenous leukemia (AML).
AML accounts for about 25% of adult leukemia [24]. There are multiple AML
pathogenic mechanisms, including mutations in signaling and kinase pathways,
mutations in epigenetic modifications, and mutations in transcription factors.
The mutations in the FLT3 gene, one of the most common mutations in AML,
present in one-third of AML cases, activate downstream signaling through the
RAS/RAF/MEK proliferation pathway [25]. DNMT3A is one of the other common
mutations in AML, associated with epigenetic modifications. DNMT3A
mutations can inhibit the activity of methyltransferase, resulting in limited HSC
function, increased self-renewal, and differentiation block [26].
ALL arises from the malignant transformation and proliferation of lymphoid
progenitor cells [27]. ALL occurs mostly in children and is one of the most
common childhood malignancies, about 25% of childhood cancers are ALL [28].
ALL is associated with genetic diseases such as Bloom's syndrome and Down's

5

syndrome [29,30]. Typical translocations include BCR-ABL1 rearrangements
and mixed lineage leukemia (MLL) rearrangements [31]. There are 70–80% of
infant acute leukemias associated with rearrangement of MLL, but the
mechanism is still unclear.

6

1.2.1 Chromosomal translocations involving the mixed lineage leukemia (MLL)
Lysine [K]-MethylTransferase 2A gene (Also known as MLL) is a histone H3K4-
specific methyltransferase involved in transcriptional activation [32]. The MLL
gene is a common chromosomal translocation or rearrangement site in Acute
lymphoblastic leukemia (ALL), which is one of the most common childhood
hematologic diseases and some adult acute leukemias. This type of leukemia
often has a poor prognosis because of the survival advantage of leukemia cells
caused by the rearrangement of MLL. The chromosomal translocation leads to
the formation of a variety of fusion proteins in MLL. It is reported that MLL has
more than 60 known fusion partners, the most common partners are AF9, AF4,
and ENL [33,34]. Targeting epigenetic regulators and chromatin modifiers is a
popular therapeutic option for MLL rearrangements, and a lot of research have
discovered that MLL fusion proteins are involved in the deregulation of
transcriptional elongation [35]. Wild type MLL is essential for embryonic
development and HOX gene regulation [36]. In MLLr, MLL loss its function and
the MLL fusion protein interferes with the downregulation of HOXA9 and MESI1
during hematopoietic differentiation, resulting in the upregulation of HOXA9 and
MESI1, which in turn promotes leukemia progression [37].
1.2.2 Interaction of CBX8 with MLL-AF9 in the MLLr cell line
As a CBX protein, previous studies suggested that CBX8 can recognize
H3K27me3 and recruit PRC1. On the other hand, CBX8 can affect MLL-AF9-
induced leukemia cell proliferation and participate in MLL-AF9 transcriptional

7

activation, which is independent of PRC1 [38]. There is also research
discovering that PRC1-independent CBX8 acts as transcriptional repression via
binding to the MLL-AF9 fusion protein, which will be competitively replaced by
transcriptional activator DOLT1 and AF4, then cause the gene activation [39].
Based on existing studies, CBX8 may have dual roles in MLLr cell lines,
H3K27me3-dependent and H3K27me3-independent, but the functions are still
unclear.
1.3 UNC7040 and Tazemetostat
We previously developed a series of chemical probes to study the function of
CBX8 and UNC7040 is one of the most potent compounds. UNC7040, an
antagonist of CBX8, can block the interaction of CBX8 with H3K27me3 (Figure2
A, B). It can displace the PRC1 from H3K27me3 without affecting PRC1-
independent CBX8 [40]. UNC7040 is an important probe for exploring the
H3K27me3 dependent CBX8 and H3K27me3 independent CBX8.
Tazemetostat, an inhibitor of EZH2, was approved for the treatment of
epithelioid sarcoma. It can inhibit the growth of various cancer cells by inhibiting
the catalytic activity of EZH2 of PRC2 and reducing H3K27me3 (Figure2 C) [41].
Since more and more studies have demonstrated the importance of MLL fusion
proteins in the progression of leukemia, therapeutic targeting of MLL fusion
proteins has become promising. The interaction of CBX8 with the MLL fusion
protein is crucial for the survival of leukemia cells, which leads us to believe
that CBX8 is an interesting therapeutic target for MLLr leukemia. Our antagonist

8

UNC7040 can specifically inhibit the function of PRC1-dependent CBX8, which
will become one of the important means for my study to explore the function of
CBX8 in leukemia.

Figure 1: Feedback and communication between PRC1 and PRC2
a. PRC2 subunit EZH2 catalyzes the H3K27 to H3K27me3
b. CBX recognizes H3K27me3 and recruits PRC1
c. PRC1 catalyzes H2AK119 to H2AK119ub1

9

Figure 2: UNC7040 and Tazemetostat
A. Chemical structure of UNC7040
B. The binding profile of UNC7040, UNC7042, UNC7263, and UNC7045 for
CBXs, CDYL2, and MPP8 chromodomains. (Figure from Suh, J. L., D Bsteh,
Si, Y., Hart, B., & Bell, O. . (2021). REPROGRAMMING CBX8-PRC1
FUNCTION WITH A POSITIVE ALLOSTERIC MODULATOR.)
C. Chemical structure of Tazemetostat
D. Function of Tazemetostat and UNC7040.Tazemetostat inhibits EZH2, and
UNC7040 inhibits CBX8

10

Chapter 2: Result
2.1 CBX8 antagonist UNC7040 has a stronger effect on the MLL-
AF9 cell line, and the difference in treatment effect is independent
of the expression level of CBX4,7,8
2.1.1 UNC7040 inhibits MLLr cell line proliferation
To investigate the therapeutic potential of CBX8 targeting with small molecules,
we sought to compare the impact of UNC7040 treatment on cell proliferation of
two MLLr (MOLM-13, RS4;11) and one non-MLLr (K562) cell line. MOLM-13 is
an AML cell line expressing the MLL-AF9 fusion protein, RS4; 11 is an ALL cell
line expressing the MLL-AF4 fusion protein, and K562 is an AML cell line driven
by the fusion of BCR-ABL. Treatment of leukemia cell lines with H2O served as
a negative control. In addition, we used UNC7263, a structural analog of
UNC7040 with lower potency against CBX8 [39]. Changes in cell proliferation
were initially determined by my colleague Heather Ogana (Dr. Yong-mi Kim’s
lab, CHLA). Cells were treated in triplicate and Heather used flow cytometry to
measure cell concentration after 2, 5, and 7 of treatment in case of MOLM-13
cells, or 2 and 4 days of treatment in case of RS4;11, and K562 cells. Changes
were computed as ratios relative to H2O control (Figure 3A). This initial
experiment by Heather showed a pronounced reduction in cell proliferation
upon treatment with 20uM and 40uM of UNC7040 in MOLM-13 and RS4;11
cells but not in K562 cells. UNC7263 also reduced the proliferation of MOLM-
13 cells but did not affect the proliferation of RS4;11 and K562 cells within the

11

period of treatment.
2.1.2 UNC7040 had a stronger inhibition than other inhibitors for the MLL-AF9
cell line
Next, we sought to evaluate if the antiproliferative effect was specific to CBX8
antagonism or reflected a general dependence on canonical Polycomb
repression involving PRC2 and CBX-containing PRC1 complexes. Therefore,
we compared the consequences of antagonizing CBX8 with other CBX protein
paralogs, as well as with inhibition of H3K27me3 by PRC2. In collaboration with
the Frye lab at UNC in Chapel Hill, our lab had previously developed and
characterized UNC4976, a potent and specific antagonist for CBX4/7 [42]. We
used the commercially available EZH2 inhibitor Tazemetostat to inhibit
H3K27me3. 0.4% of DMSO solvent was used as a negative control. MOLM-13,
RS4;11, and K562 were seeded in triplicate in 24 well-plates and cell
proliferation was measured on day 2, day 5, day 7, and day 10 CellTiter Glo by
Cell titer Glo Assay using a plate reader. Cell titer Glo quantifies ATP levels
which are proportional to live cells. Similar to cell counts, the Cell titer Glo assay
showed that cell proliferation was strongly reduced upon 40uM UNC7040
treatment in MOLM-13 and RS4;11 but not in response to DMSO. After 10 days
of UNC7040 treatment, the number of cells decreased by 89% compared to the
DMSO control. RS4;11 live cell number was reduced by 50% within 4 days. In
contrast, cell proliferation of K562 was less affected. (Figure 3B). Cell
proliferation of the three leukemia cell lines was also reduced by approximately

12

50% upon treatments with UNC4976 and Tazemetostat. This suggests a
general dependency of leukemia cells on H3K27me3-dependent targeting of
cPRC1 and transcriptional silencing. However, the substantially stronger
antiproliferative effect of CBX8 antagonism in MOLM-13 cells suggests that
AML cells driven by MLL-AF9 may also depend on H3K27me3-independent
functions of CBX8. To test this scenario, we treated MOLM-13 cells with a
combination of UNC7040 and Tazemetostat. We reasoned that if CBX8 acted
only downstream of H3K27me3, proliferation should not be reduced upon
combination treatment compared to Tazemetostat treatment alone. While
combination treatment had a minor additive effect on proliferation of RS4;11
and K562 cells, we observed that proliferation was further strongly impaired in
MOLM-13 cells. Together, we conclude that MOLM-13 cells are dependent on
CBX8 which likely functions dependent and independent of H3K27me3.

13

Figure 3: Effects of drug therapy on the proliferation of leukemia cells
A. Cell proliferation assays of MOLM-13, RS4; 11, K562 treated with 20uM,
40uM of UNC7263 and UNC7040, 7 days for MOLM-13, 4 days for RS4;11 and
K562, the results are from Dr. Yong-Mi Kim’s lab Ph.D. student Heather Ogana.
The results were derived from the count of live cells with trypan blue.
B. Cell proliferation assays of MOLM-13, RS4; 11, K562 treated with 40uM of
UNC4976 and UNC7040 2uM of Tazemetostat, 10 days for MOLM-13, RS4;11
and K562. The results were derived from the luciferase assays with CellTiter
Glo.

14

2.1.3 CBX8 dependence is not linked to expression levels of CBX paralogs
Because UNC7040, UNC4976, and Tazemetostat had different inhibitory
effects on MOLM-13, RS4;11, and K562, we hypothesized that differences
could be linked to expression levels of CBX4, CBX7, and CBX8 in the three cell
lines. We used immunoblotting to determine the expression levels of specific
CBX protein paralogs. Ponceau staining was used to control for equal loading
(Figure 4). Immunoblotting revealed that CBX7 and CBX8 expression was
comparable between the three cell lines. Moreover, compared to MOLM-13 and
RS4;11, CBX4 levels were lower in K562. Together, these results suggest that
CBX8 dependency is not directly associated with differential expression.

15

16

Figure 4: Western blot of MOLM-13, RS4;11 and K562
The expression levels of CBX4, CBX7, CBX8, and MLL1 proteins in MOLM-13,
RS4;11, and K562 were detected by western blotting, and Ponceau staining
was used as a loading control.

17

2.2 UNC7040 treatment efficiently displaces CBX protein and
RING1B from Polycomb target genes
We used ChIP-qPCR to evaluate the consequences of UNC7040 treatment on
CBX8 and PRC1 occupancy in MOLM-13 cells. MOLM-13 cells were treated
with 40uM of UNC7040 or H2O for 48 hours in duplicates. 20 million cells were
crosslinked with formaldehyde, and I performed ChIP according to a protocol
established in the Bell lab. Solubilized chromatin fragments were enriched with
antibodies specific against CBX4, CBX7, CBX8, RING1B, and H3K27me3. We
used qPCR to quantify the effect of UNC7040 on the occupancy of PRC1 at
selected target genes relative to GAPDH (Figure 5). The results of ChIP-qPCR
showed that the enrichment of CBX4, CBX7, CBX8, and RING1B were reduced
at HOXA9, EYA4, and CCND2 after 48h UNC7040 treatment. Next, we ask if
the reduction in CBX protein binding and Ring1B binding is related to a
decrease in H3K27me3. Unlike PRC1 subunits, UNC7040 treatment did not
affect H3K27me3 enrichment levels at selected Polycomb target genes. This
indicates that UNC7040 can interfere with the interaction between PRC1 and
the target genes by inhibition of PRC1 recruitment via UNC7040 displacing
CBXs from chromatin marked with H3K27me3 in the MOLM-13 cell line.

18

Figure 5: UNC7040 treatment causes displacement of CBX-PRC1 from
target genes.
ChIP-qPCR analysis for UNC7040-treated MOLM-13 cells on CCND2, EYA4,
and HOXA9. Normalization with GAPDH. For each compound, we performed
two independent replicates, except CBX8.

19

To gain insight into the genome-wide impact of UNC7040 treatment on PRC1
binding, we performed RING1B ChIP in untreated and UNC7040-treated
MOLM-13 cells coupled to high-throughput sequencing (ChIP-seq).
Unfortunately, the ChIP-seq libraries had high levels of adapter contamination
resulting in limited unique reads of our RING1B ChIP. However, despite the
limited sequencing read depth, we were still able to detect RING1B peaks to
allow the identification of PRC1 binding sites in untreated MOLM-13 cells. With
the help of my colleague Bo Cheng, we identified 13,056 RING1B peaks, which
are mostly located in promoter-distal intergenic regions (Figure 6 A). The GO
(Gene Ontology) analysis showed that RING1B peaks are overlap with the
genes related to skeletal development, embryonic organ development, and
morphology, which is consistent with Polycomb's function of maintaining cell
identity and organ development (Figure6 B). In addition, we compared
untreated and UNC7040 treated RING1B binding. Notably, in agreement with
our ChIP-qPCR results, we observed a global decrease in the binding of
RING1B (Figure 6 C). The Genome-browser showed reduced binding of
RING1B to the promoter regions of HOXA9 and CCND2 upon UNC7040
treatment, which confirmed our previous ChIP-qPCR results (Figure 6 D).

20

21

22

Figure 6: UNC7040 efficiently displaces RING1B from chromatin in MOLM-
13 cells
A. Genomic feature associated with RING1B peaks in MOLM13 cell.
B. GO enrichment analysis of RING1B.
C. Heatmap displayed ChIP-seq enrichment of RING1B in MOLM-13 cells
untreated and treated with 40uM UNC7040 for 24h.
D. Genome-browser snapshot of Hox cluster and CCND2 from ChIP-seq
enrichment of RING1B in MOLM-13 cells untreated and UNC7040 treated.

23

2.3 Analysis of shCBX8 knockdown efficiency
To validate that the antiproliferative effects of UNC7040 are specifically linked
to disruption of CBX8 function, we sought to use an orthogonal approach to
study the impact of CBX8 depletion by RNAi knockdown in MOLM-13 cells.
With the help of Heather Ogana in the lab of Dr. Yong-Mi Kim at CHLA, we
developed MOLM-13 cell lines harboring Doxycycline-inducible shRNAs
targeting CBX8 (shCBX8) or Renilla, as control (shCtrl). Stable, inducible cell
lines were generated by lentiviral infections of LT3GEPIR. (Figure 7A). Tet-
operator exists in LT3GEPIR. When doxycycline is treated, the target gene and
the tandem EGFP are expressed, and the signal generated by the expressed
GFP will be detected by flow cytometry, so we can use FACS to verify whether
the target gene is expressed. The plasmid has a puromycin resistance gene
fragment, so we can use puromycin to kill cells that do not contain the interested
gene, thereby increasing the proportion of cells containing shRNA.
After puromycin selection, the cells were induced with DOX for 48 hours and
verified by flow cytometry to detect a positive level of GFP. (Figure7 B) Flow
cytometry results revealed that under 48 hours of DOX treatment, the GFP-
positive level of shCtrl was 83.6%, while that of shCBX8 was 95.0%. It shows
that shRNA can be expressed normally in this cell line.
Next, used western blot to determine the level of CBX8 depletion upon Dox
treatment. Detection of PARP expression was used as a loading control.
MOLM-13 cells were harvested after 48 h of DOX treatment and proteins were

24

extracted for western blot. Compared to no DOX treatment, 48h of DOX
induction resulted in 71% of CBX8 depletion (Figure 7 C). No change in CBX8
expression was observed upon DOX treatment of shCtrl expressing MOLM-13
cells.

25

26

27

Figure 7: CBX8 knockdown efficiency in shCBX8 cell lines
A. Map of LT3GEPIR plasmid.
B. Analysis of GFP signals of shCtrl and shCBX8 after Dox treatment for 48h
by flow cytometry. X-axis is GFP signal, Y-axis is m-cherry signal.
C. The expression levels of CBX8 in shCtrl and shCBX8 that were treated by
DOX for 48h were detected by western blotting, and Ponceau staining was used
as a loading control.

28

Knockdown of CBX8 has limited effect on cell proliferation of MOLM-13
After verifying the knockdown efficiency of shCBX8, we wanted to understand
whether knockdown of CBX8 would lead to inhibition of cell proliferation on the
MLL-AF9 cell line. We hypothesized that RNAi knockdown would disrupt both
H3K27me3-dependent and independent CBX8 function and ultimately reduce
cell proliferation. In a previous report by Tan et al.,[23], shCBX8 can reduce the
50% rate of cell proliferation compared with the number of cells in the shCtrl
group in 5 days. We seeded the same number of cells and analyzed them with
Cell titer Glo after 48 h of DOX treatment of shCtrl and shCBX8. The results
showed that there was no significant difference between shCBX8 and shCtrl in
the first 8 days. But on day10, shCBX8 was about 84% of the control group,
and the inhibition of cell proliferation was not obvious (Figure8). This indicates
that on MOLM-13, knockdown of CBX8 can slightly reduce the level of cell
proliferation, but it is limited.

29

Figure 8: Effects of CBX8 knockdown on cell proliferation
Inhibitory Response of Cell Proliferation in shCBX8 Cells After DOX treatment.
Using shCtrl plus DOX as a negative control, the result is displayed as the total
number of cells

30

Chapter 3: Discussion
3.1 UNC7040 has a stronger effect on the MLL-AF9 cell line, and
the difference in treatment effect is independent of the expression
level of CBX4,7,8
Our cell proliferation assay results showed that UNC7040 inhibited MLL-AF9
more significantly than other Polycomb-targeted compounds. Our initial
hypothesis was that UNC7040 was able to displace CBX8 from H3K27me3,
thereby inhibiting PRC1-dependent gene regulation. PRC1-dependent CBX8
was unable to participate in recruitment and it would transfer to free CBX8,
increasing the ratio of binding to MLL-AF9. Tan's paper suggests that PRC1-
independent CBX8 binds to MLL-AF9 promoting some abnormal gene
activation. Kuntimaddi’s paper indicates that the binding of CBX8 to MLL-AF9
inhibits MLL-AF9 from participating in transcriptional activation, and the PRC1-
dependent CBX8 plays its function as a transcriptional repressor. Our cell
proliferation assays on RS4;11 showed that UNC7040 did not have a significant
inhibitory effect on its proliferation, which was inconsistent with Heather's
results. One of the possible reasons is that our detection method is different,
we use CellTiter Glo, which is an ATP assay for the detection of viable cells.
And Heather's results came from cell counting. Cell counting with trypan blue
can distinguish live cells but does not reflect whether cells are actively growing
or dividing, which may have affected the results of the experiment. The cell
proliferation results of RS4;11 need to be repeated, and we can also use

31

MV4;11, another MLL-AF4 leukemia cell line, to verify whether UNC7040 has a
strong inhibitory effect on other MLLr cell lines.
We hypothesized that UNC7040 has more targets than PRC1-dependent CBX8,
and before experimenting, we thought that the combination of UNC7040 and
Tazemetostat would not significantly affect the inhibition rate. Because we
believe that Tazemetostat is targeting EZH2, by inhibiting EZH2, it can reduce
the catalytic activity of PRC2, which causes H3K27me3 reduced. And PRC1 as
a downstream of PRC2 could also be affected by Tazemetostat. The therapeutic
mechanism of UNC7040 is to antagonize the binding of CBX8 and H3K27me3.
When H3K27me3 is absent, the therapeutic efficiency of UNC7040 should be
partially reduced. We compared the effect of UNC7040, Tazemetostat alone
and the effect of the combination of two compounds in the treatment, although
in these three cell lines, all the results showed that the two drugs in combination
were better than either drug alone in the inhibition rate, the effects of the three
cell lines were not the same. On RS4;11 and K562, the combined effect of the
two drugs was weaker than that same treatment on MOLM-13. For RS4;11 and
K562, the therapeutic effect of drug combination was close to the product of the
inhibition rates of treating with two drugs alone. The combined effect of the two
drugs was more obvious for MOLM-13. After 7 days, treated MOLM-13 almost
stopped growing. This result demonstrates the high dependence of MOLM-13
on CBX8.
Although a good synergy between UNC7040 and Tazemetostat was observed

32

in MOLM-13, further experimental results are still needed to explain the
possible reasons.
We hypothesized that there may be other PRC1-independent therapeutic
targets for UNC7040. In addition, we did not have the concentration curve of
Tazemetostat for these three cell lines, but we chose to keep the same
concentration as other cell lines for Tazemetostat. This may lead to incomplete
inhibition of EZH2 on these three cell lines, thus affecting our conclusions.
To explore whether there is a synergistic effect between UNC7040 and
Tazemetostat, we may need to determine the ED50 value of the two drugs at
MOLM-13 and use the method of isoboles to determine whether there is a
synergistic effect between the two compounds [43]. On the other hand, we co-
treated MOLM-13 with UNC7040 and Tazemetostat, collected cells and
extracted RNA for sequencing, and compared it with UNC7040, Tazemetostat
alone treatment group, which also helps us understand whether the
combination of UNC7040 and Tazemetostat have therapeutic value.
3.2 UNC7040 treatment efficiently displaces CBX protein and
RING1B from Polycomb target genes and causes a global
decrease in binding of RING1B
ChIP-qPCR results showed that UNC7040 interfered with the binding of CBX4,
CBX7, and CBX8 to the target genes of H3K27me3. We initially thought that
UNC7040 can only displace CBX8. We speculated that the structural similarity
between CBX4, CBX7, and CBX8 might lead to UNC7040 being able to partially

33

displace other CBXs. But these may not be the main targets of CBX4 and CBX7,
so the corresponding enrichment levels are not significant. For the ChIP-seq
results of CBX8, we performed ChIP-qPCR two times, each with two replicates.
However, the signal of GAPDH may be lost from a set of data in the first ChIP
due to loading errors or other reasons, and the levels of CCND2 and EYA4
cannot be calculated by GAPDH normalization. And the second time, the
enrichment effect of the CBX8 antibody on DNA fragments was not good.
Therefore, there is only one set of results for CBX8 at the result of ChIP-qPCR,
and an error bar cannot be generated, so it is necessary to repeat the qPCR of
CBX8 in the next ChIP experiment.
We originally hoped to obtain more information through ChIP-seq, but the
quality of ChIP-seq libraries was poor. QC showed that all samples had a high
level of contamination. One of the reasons is that too many adapter dimers were
introduced during the preparation of libraries. Failure to clear it during the
cleanup steps resulted in few valid ChIP-seq reads and poor data quality.
Among them, the data of CBX8 is seriously affected and cannot be used for
analysis. Therefore, we chose to use RING1B, which has relatively better data
quality and interacts with CBX8, for analysis.
We used the results of CCND2 and Hoxa9 of RING1B ChIP enrichment to verify
the effect of UNC7040. ChIP-seq results showed that UNC7040 effectively
reduced the binding of RING1B and CBX8 complexes to corresponding genes.
Our results showed that the global binding of RING1B was decreased after

34

UNC7040 treatment, with nearly all loci affected. The possible reason is that
there is more contamination in the UNC7040 treated group, and to confirm our
results, the experiment needs to be repeated in the future. We also found some
decrease in RING1B interacting with other genes after UNC7040 treatment
including Foxd4, Hey2, and SP9, but these target genes need to be further
confirmed by RT-PCR.

35

3.3 Validation of knockdown efficiency of CBX8 on MOLM-13, and
knockdown of CBX8 on MOLM-13 partially inhibited cell proliferation
The knockdown assay of CBX8 showed that the construction of shCBX8 was
successful. The cell line could express shCBX8 normally after DOX inducing,
and its protein expression was about 29% compared to the control cell line. We
then compared the cell proliferation change on this cell line and the shCtrl cell
line, and the results showed that the cell proliferation level of shCBX8
decreased slightly after 10 days, but not as good as the results in Tan's paper.
Initially, we hoped to reproduce the result of inhibition of cell proliferation in
Tan's CBX8 knockdown cell line, but we did not observe a similar level of
inhibition of cell proliferation on MOLM-13. One of the possible reasons is that
our CBX8 knockdown efficiency is lower than the knockdown level in Tan’s
paper, resulting in the normal function of even a small amount of CBX8
remaining. On the other hand, in Tan's paper, a CBX8 knockdown cell line for
THP-1 was used, whereas we used MOLM-13 cells. Although both are MLL-
AF9 cell lines, differences in cells may also lead to inconsistent results in cell
proliferation experiments. Unfortunately, I chose the wrong control in my cell
proliferation assays, I used the shCtrl cell line plus DOX and shCBX8 plus DOX
for comparison. However, the proliferation rates of the shCtrl and shCBX8 cell
lines themselves may not be consistent and are not suitable for direct
comparison. My initial thought was to avoid the effects of DOX, but a more
reasonable approach would be to use shCtrlDOX+/- and shCBX8+/-

36

simultaneously for cell proliferation analysis.
To improve the knockdown efficiency, we used puromycin for two rounds of
screening before, but the actual effect of this cell section method on cell
proliferation inhibition was limited.
To further improve the knockdown efficiency, we plan to use FACS to select
cells with higher GFP content for culture to ensure that the selected cells can
have a higher expression level of shCBX8. On the other hand, we can also
construct other shCBX8 with a stronger knockdown ability for cell proliferation
experiments.

37

Chapter 4: Methods and materials
4.1 Cell culture
MOLM-13, RS4;11, K562 cells were maintained in RPMI-1640 (Corning)
supplemented with 10% FBS. Cells were split every 3-4 days.
For shCBX8 and shCtrl cells, cells were collected for flow cytometry or Western
blot after 48h treatment with 1ug/ml DOX.
The cell incubator was set to 37°C, with 5% CO2.
4.2 Cell proliferation assay
For cell proliferation assay, 5e4 cells were added into 500ul medium and
seeded on 24-well plates, the control group was added with 0.4% DMSO, and
the treatment group was added with 0.4% DMSO plus 40uM UNC7040, 40uM
UNC4976, 0.4% DMSO plus 2uM Tazemetostat, 0.4 %DMSO plus 40uM
UNC7040 and 2uM Tazemetostat. Each treatment group has three replicates.
On day 3, day 5, and day 8 cells were diluted 1:5 in a medium containing the
corresponding compound and transferred to new 24-well plates. On days 2, 5,
7, and 10 after mixing the cells, transfer 100 ul of cells to a 96-well plate, add
the same volume of CellTiter-Glo® 2.0 (Promega), mix on the shaker for 2 min,
let stand for 10 min, and the result was read by CLARIOstar Plus Microplate
reader.
4.3 Western blot
1.5e6 MOLM-13, RS4;11, K562 cells were collected for nuclear proteins
extraction. Cells were washed with 10mL PBS and then resuspended in 5mL

38

Buffer A (25 mM HEPES pH7.6, 5 mM MgCl, 25 mM KCl, 0.05 mM EDTA, 10 %
Glycerol, 0.1 % NP40), DTT 1:1000 (100 mM) and PMSF 1x (100x)), which
were incubated on ice for 10 min. Cells were centrifuged and washed with 5ml
buffer A, then centrifuged again, lysed with 200 ul RIPA buffer (150 mM NaCl,
5 mM EDTA pH8.0, 50 mM Tris pH8.0, 1 % NP40, 0.5 % Sodium Deoxycholate,
0.1 % SDS, Proteinase Inhibitor 1x), and incubated on ice for 20 minutes. DNA
was sheared and removed via 3 cycles of sonication (30s on, 30s off) (Bioruptor
Pico, Diagenode) and then incubated with 1 ul Benzonase Nuclease at 4 °C for
1h. Centrifuge for 15 min and then measured protein concentration with a
Bradford Assay. 20ug protein lysate was mixed with 4x Loading Buffer and
boiled for 10 min at 95 °C. Samples were resolved on a NuPAGE 4% -12%
gradient Bis-Tris gel (Thermo Fisher Scientific) in MES buffer (20X MES buffer
diluted with MQ water to 1X MES buffer). After a run of 90 min at 110 Volt, the
gel was transferred onto a Polyvinylidene difluoride (PVDF) membrane (Sigma-
Aldrich) in Transfer Buffer ((100 ml 10 x transfer buffer (28.125g of Trizma base
and 131.25g of Glycine dissolved in MQ water), 700 ml MQ water and 200ml
pure Methanol)) for overnight at 30mA. The membrane was stained with 20ml
of Ponceau on the shaker for 2 min and washed three times with MQ water
after scanning until the red mark disappeared completely. The membrane was
then blocked in 5% non-fat milk in PBST (1x PBS supplemented with 0.1 %
Tween 20 (Sigma Aldrich) for 1 hour at room temperature. Then the primary
antibody was added to a 5% milk solution, overnight incubation at 4°C. The next

39

day the membrane was washed three times for 10 min with PBST before adding
the secondary antibody (1:2500 in 5% milk Goat anti-Rabbit IgG (H+L)
Secondary Antibody, DyLight 800, Thermo Fisher Scientific) for 1 hour at room
temperature and another three wash steps with PBST. Then the blot was
scanned by the ODYSSEY CLx system (LI-COR). Quantitative analysis with
ImageJ.
4.4 Chromatin Immunoprecipitation
11% formaldehyde solution was prepared fresh from 16% formaldehyde (VWR).
For treatment groups, treated with 40uM UNC7040 for 48h before collecting
cells.2e6 MOLM-13 cells were collected and washed and resuspended with
10mL PBS 2 times. 1mL 11% formaldehyde was added into cell suspension,
and cells were incubated for 7 min at room temperature for crosslinking. Then,
0.5mL 2.5M glycine was added, and cells were incubated on the ice for 5 min
to stop crosslinking. Nuclei were prepared by washes with NP-Rinse buffer 1
(10 mM Tris pH 8.0, 10 mM EDTA pH 8.0, 0.5mMEGTA, 0.25% Triton X-100)
followed by NP-Rinse buffer 2(10mMTris pH 8.0, 1mM EDTA, 0.5mM EGTA,
200mM NaCl). Afterward, the cells were prepared for shearing by sonication by
two washes with Covaris shearing buffer (1mMEDTA pH 8.0, 10mMTris-HCl pH
8.0, 0.1% SDS) and resuspension of the nuclei in 0.9 mL Covaris shearing
buffer (with protease inhibitors mini (VWR)). The nuclei were sonicated with
0.44g Biorupter for 8 cycles (30 seconds on/30 seconds off). Lysates were
incubated in 1x IP buffer (final: 50 mM HEPES/KOH pH 7.5, 300 mM NaCl,

40

1mM EDTA, 1% Triton X-100, 0.1% DOC, 0.1% SDS), with 2uL antibodies at
4°C overnight. The next day, samples were incubated with Protein G magnetic
Dynal beads (Thermo) for 3 hours at 4°C. Collected Beads were washed 5
times with 1x IP buffer (50 mM HEPES/KOH pH 7.5, 300mM NaCl, 1mM
EDTA,1%Triton-X100, 0.1% DOC, 0.1% SDS), followed by three times with
DOC buffer (10mM Tris pH 8, 0.25mM LiCl, 1mM EDTA, 0.5% NP40, 0.5% DOC)
and 1x with 1ml TE (with 50mM NaCl). Resuspend the beads 2 times in 150 ul
elution buffer (0.1% SDS, 0.1M NaHCO3), incubated for 20 min at 65°C. To
Reverse crosslink for IP, add 0.2 mg/ml RNase A and 50 ug/ml Proteinase K to
chromatin then incubate at 55°C for at least 2.5 h, then overnight incubation at
65°C. Extracted DNA with 500 ul Phenol/chloroform/IA and spun. Then add 1.5
ul glycogen, 33ul 3M NaOAc, and 300 ul isopropanol to the top layer.
Centrifuged for 1h at 4°C and resuspended with 500 ul 70% ethanol. After
centrifugation, waited for the ethanol to evaporate, and dissolved the
transparent pellet in 20ul TE buffer.
4.5 qPCR Analysis
The PCIA extracted IP DNA was precipitated and quantified using a homemade
EvaGreen-based qPCR mix on a CFX Connect Real-Time PCR Detection
System (BioRad).
4.6 ChIP-seq library preparation
Libraries were prepared using the NEXTflex ChIP-Seq kit (Bio Scientific)
following the “No size-selection cleanup” protocol. ChIP library prepared

41

through the process of endpoint repairing, beads (Agencourt AMPure XP
(Beckman Coulter)) cleaning up, barcoded adaptors ligation, beads cleaning up,
PCR amplification, and beads cleaning up. All samples were pooled together in
the end.
4.7 Flow Cytometry
shCtrl and shCBX8 cells were centrifuged at 80 g for 5 min and resuspended
in medium. Cells were analyzed for GFP ratio using Attune NxT Flow after
filtering with a round bottom test tube.
4.8 Supplementary Materials
Western blot antibodies
Protein name Antibody Concentration
CBX8 Bethyl Rabbit anti-CBX8 Antibody 1:2000
CBX7 Abcam Anti-cbx7 antibody (ab21873) 1:2000
CBX4 Cell Signaling CBX4 Antibody #44268 1:2000
RING1B Abcam Recombinant Anti-RING2 /
RING1B / RNF2 antibody [EPR12245]
(ab181140)
1:2000
PARP Cell Signaling PARP (46D11) Rabbit mAb
#9532
1:2000
ChIP-qPCR and ChIP-seq antibodies
Protein name Antibody Concentration
CBX8 Bethyl Rabbit anti-CBX8 Antibody 1:100
CBX7 Abcam Anti-cbx7 antibody (ab21873) 1:100
CBX4 Cell Signaling CBX4 Antibody #44268 1:100
H3K27me3 Cell Signaling Tri-Methyl-Histone H3
(Lys27) (C36B11) Rabbit mAb #9733
1:100
RING1B Abcam Recombinant Anti-RING2 /
RING1B / RNF2 antibody [EPR12245]
(ab181140)
1:100
Primers for ChIP-qPCR
Name Sequence
GAPDH-Forward TCTCCCCACACACATGCACTT
GAPDH-Reverse CCTAGTCCCAGGGCTTTGATT
CCND2-Forward ACTGTCTGAAATGAAGGTGAAGC

42

CCND2-Reverse GATTTGATGGACACTTGGTTTGT
HOXA9-Forward CAGTGTAAGTTCAGTCTGATGG
HOXA9-Reverse GAACAGTGAGGAAATTCGGAGC
shRNA
Name 97-mer
CBX8 TGCTGTTGACAGTGAGCGCAGAGTTATATTTTCTATTAGATA
GTGAAGCCACAGATGTATCTAATAGAAAATATAACTCTATGC
CTACTGCCTCGGA
Plasmid
Name Source
LT3GEPIR Johannes Zuber Lab

43

References
[1] Luger, K., et al. "Crystal structure of the nucleosome core particle at 2.8 A
resolution. " Nature 389.6648(1997):251-260.\

[2] Allfrey, V. G. , and R. F. E. Mirsky . "ACETYLATION AND METHYLATION
OF HISTONES AND THEIR POSSIBLE ROLE IN THE REGULATION OF RNA
SYNTHESIS." Proceedings of the National Academy of Sciences of the United
States of America 51.5(1964):786-794.

[3] Bracken, and P. A. . "Genome-wide mapping of Polycomb target genes
unravels their roles in cell fate transitions." Genes, Development, 20.9(2006).

[4] Martinez, Anne Marie , and G. Cavalli . "The role of Polycomb Group
Proteins in Cell Cycle Regulation During Development.".

[5] Jacobs, J. J., et al. "The oncogene and Polycomb-group gene bmi-1
regulates cell proliferation and senescence through the ink4a locus. " Nature
397.6715(1999):164.

[6] Varambally, S., et al. "The polycomb group protein EZH2 is involved in
progression of prostate cancer." Nature 419.6907(2002):624-629.

44

[7] Ru, C. , et al. "Role of Histone H3 Lysine 27 Methylation in Polycomb-Group
Silencing." Science 300.5595(2002):131.

[8] Buchwald, G. , et al. "Structure and E3 ‐ligase activity of the Ring–Ring
complex of Polycomb proteins Bmi1 and Ring1b." The EMBO Journal 25(2006).

[9] Bentley, M. L. , et al. "Recognition of UbcH5c and the nucleosome by the
Bmi1/Ring1b ubiquitin ligase complex." The EMBO Journal (2011).

[10] Whitcomb, S. J. , et al. "Polycomb Group proteins: an evolutionary
perspective. " Trends in Genetics 23.10(2007):494-502.

[11] Poepsel, S. , V. Kasinath , and E. Nogales . "Cryo-EM structures of
PRC2 simultaneously engaged with two functionally distinct nucleosomes."
Nature Structural & Molecular Biology (2018).

[12] Choi, J. , et al. "DNA binding by PHF1 prolongs PRC2 residence time on
chromatin and thereby promotes H3K27 methylation." Nature Structural &
Molecular Biology (2017).

[13] Hua, L. , et al. "Enhancer of Zeste Homolog 2 Promotes the Proliferation
and Invasion of Epithelial Ovarian Cancer Cells." Molecular Medicine Reports

45

16.3(2017):3600.

[14] Lu, C. , et al. "Gene Alterations Identified by Expression Profiling in Tumor-
Associated Endothelial Cells from Invasive Ovarian Carcinoma." Cancer
Research 67.4(2007):1757-68.

[15] Zhou, Jun , et al. "Overexpression of enhancer of zeste homolog 2 (EZH2)
and focal adhesion kinase (FAK) in high grade endometrial carcinoma."
Gynecologic Oncology 125.2(2012):S164-S165.

[16] Li, Z. , et al. "Structure of a Bmi-1-Ring1B Polycomb Group Ubiquitin Ligase
Complex." Journal of Biological Chemistry 281.29(2006):20643-20649.

[17] Gao, Z. , et al. "PCGF homologs, CBX proteins, and RYBP define
functionally distinct PRC1 family complexes. " Molecular Cell 45.3(2012):344-
356.

[18] Buchwald, G. , et al. "Structure and E3 ‐ligase activity of the Ring–Ring
complex of Polycomb proteins Bmi1 and Ring1b." The EMBO Journal 25(2006).

[19] Hauri, S. , et al. "A High Density Map for Navigating the Human Polycomb
Complexome." Cold Spring Harbor Laboratory2(2016).

46

[20] Cooper, S. , et al. "Jarid2 binds mono-ubiquitylated H2A lysine 119 to
mediate crosstalk between Polycomb complexes PRC1 and PRC2." Nature
Communications 7(2016):13661.

[21] Boyer, L. A. , et al. "Polycomb complexes repress developmental regulators
in murine embryonic stem cells. " Nature 441.7091(2006):349-353.

[22] Bracken, A. P. , et al. "The Polycomb group proteins bind throughout the
INK4A-ARF locus and are disassociated in senescent cells." Genes Dev
21.5(2007):525-30.

[23] Nemkov, T. , A. D'Alessandro , and J. A. Reisz . "Metabolic
underpinnings of leukemia pathology and treatment." Cancer Reports 2(2019).

[24] Dores, G. M. , et al. "Acute leukemia incidence and patient survival among
children and adults in the United States, 2001-2007." Blood 119.1(2012):34.

[25] Ravandi, F. , et al. "Outcome of patients with FLT3-mutated acute myeloid
leukemia in first relapse. " Leuk Res 34.6(2010):752-756.

[26] Challen, G. A. , et al. "Dnmt3a is essential for hematopoietic stem cell
differentiation." Nature Genetics 44.1(2012):23-31.

47

[27] Mayle, A. , et al. "Dnmt3a loss predisposes murine hematopoietic stem
cells to malignant transformation." Blood 125.4(2015):629-38.

[28] Terwilliger, T. , and M. Abdul-Hay . "Acute lymphoblastic leukemia: a
comprehensive review and 2017 update." Blood Cancer Journal
7.6(2017):e577.

[29] German, J. . "Bloom's syndrome. XX. The first 100 cancers." Cancer
Genetics & Cytogenetics 93.1(1997):100-106.

[30] Chessells, J. M. , et al. "Down's syndrome and acute lymphoblastic
leukaemia: clinical features and response to treatment." Archives of Disease in
Childhood 85.4(2001):321-5.

[31] Mullighan, C. G. , et al. "Rearrangement of CRLF2 in B-progenitor- and
Down syndrome-associated acute lymphoblastic leukemia. " Nature Genetics
41.11(2009):1243-1246.

[32] Shilatifard, A. . "Molecular Implementation and Physiological Roles for
Histone H3 Lysine 4 (H3K4) Methylation." Current Opinion in Cell Biology
20.3(2008):341-348.

48

[33] Yokoyama, A. , et al. "A Higher-Order Complex Containing AF4 and ENL
Family Proteins with P-TEFb Facilitates Oncogenic and Physiologic MLL-
Dependent Transcription." Cancer Cell 17.2(2010):198-212.

[34] "The MLL recombinome of acute leukemias in 2013. " Leukemia (08876924)
(2013).

[35] Lin, C. , et al. "AFF4, a component of the ELL/P-TEFb elongation complex
and a shared subunit of MLL chimeras, can link transcription elongation to
leukemia. " Molecular Cell 37.3(2010):429-437.

[36] Yu, B. D. , et al. "Altered Hox expression and segmental identity in Mll-
mutant mice." Nature 378.6556(1995):505-508.

[37] Dou, Y. , and J. L. Hess . "Dou, Y. & Hess, J. L. Mechanisms of
transcriptional regulation by MLL and its disruption in acute leukaemia. Int. J.
Haematol. 87, 10-18." International Journal of Hematology 87.1(2008):10-18.

[38] Tan, Jiaying , et al. "CBX8, a polycomb group protein, is essential for MLL-
AF9-induced leukemogenesis. " Cancer Cell 20.5(2011):563-575.

[39] Kuntimaddi, Aravinda , et al. "Degree of Recruitment of DOT1L to MLL-AF9

49

Defines Level of H3K79 Di- and Tri-methylation on Target Genes and
Transformation Potential." Cell Reports 11.5(2015).

[40] Suh J L , Bsteh D , Si Y , et al. REPROGRAMMING CBX8-PRC1
FUNCTION WITH A POSITIVE ALLOSTERIC MODULATOR. Cold Spring
Harbor Laboratory, 2021.

[41] Italiano A , Soria J C , Toulmonde M , et al. Tazemetostat, an EZH2
inhibitor, in relapsed or refractory B-cell non-Hodgkin lymphoma and advanced
solid tumours: a first-in-human, open-label, phase 1 study[J]. Lancet Oncology,
2018:S1470204518301451.5

[42] Lamb, K. N. , et al. "Discovery and Characterization of a Cellular Potent
Positive Allosteric Modulator of the Polycomb Repressive Complex 1
Chromodomain, CBX7." Cell Chemical Biology (2019).

[43] Tallarida, and J. R. . "Revisiting the Isobole and Related Quantitative
Methods for Assessing Drug Synergism." Journal of Pharmacology &
Experimental Therapeutics 342.1(2012):2-8.

Abstract (if available)

Abstract Chromosomal rearrangements of the Mixed-Lineage Leukemia (MLL) gene encoding a histone H3 lysine 4 specific methyltransferases can lead to the development of acute leukemias. MLL rearrangements (MLLr) result in oncogenic fusion proteins, such as MLL-AF9 and MLL-AF4, which exploit the chromatin regulatory machinery to enforce oncogenic gene expression and promote leukemogenesis. One of the major interacting partners is CBX8, a Polycomb group protein commonly associated with transcriptional repression. Surprisingly, CBX8 binding to MLL fusions promotes aberrant gene activation but the underlying mechanisms are poorly understood. We previously developed UNC7040, a chemical probe specifically targeting CBX8 interaction with the repressive histone modification H3K27me3. Using UNC7040, we sought to investigate the therapeutic potential of targeting CBX8 in MLLr cell lines and study its role in MLLr-dependent and H3K27me3-dependent gene regulation. We show that in MLL-AF9 cells, UNC7040 displaces CBX8-containing PRC1 complexes from Polycomb target sites and strongly impairs proliferation. A comparatively milder effect of EZH2 inhibition on proliferation suggests that UNC7040 targets H3K27me3-dependent and independent CBX8 functions. In conclusion, our data support the therapeutic potential of targeting CBX8 for the treatment of MLL-AF9 driven leukemia.

Linked assets

University of Southern California Dissertations and Theses

Conceptually similar

PDF

Characterization of a new chromobox protein 8 (CBX8) antagonist in a model of human colon cancer

PDF

Developing MLL1 degraders as therapeutics for leukemia

PDF

Epigenetic dysregulation in acute myeloid leukemia (AML) with MLL1 aberrations

PDF

A novel screening approach to identify regulators of polycomb-dependent gene silencing

PDF

Determinination of the causal potential of histone modifications on transcription and chromatin structure

PDF

Mixed lineage leukemia proteins (MLLs), their effect as coregulators on target gene expression and global histone methylation

PDF

The role of survivin in drug resistant pediatric acute lymphoblastic leukemia

PDF

Cancer-recurrent missense mutations in SET domain alter KMT2A methyltransferase activity

PDF

Identification of target genes and protein partners of ZNF711 in glioblastoma cells

PDF

The role of histone H4 lysine 20 monomethylation in gene expression and differentiation

PDF

Mapping transcription factor networks linked to glioblastoma multiform: identifying target genes of the oncogenic transcription factor ZFX in glioblastoma multiforme

PDF

Using epigenetic toggle switches to repress tumor-promoting gene expression

PDF

Regulation of Aurora kinase B and its effect on phosphorylation of G9a/GLP

PDF

Therapeutic resistance in acute lymphoblastic leukemia: cIAP2 inhibition sensitizes B cell acute lymphoblastic leukemia to anti-CD19 chimeric antigen receptor T cell

PDF

Collecting epigenetic information with DNA methylation footprinting

PDF

Induction of hypersignaling as a therapeutic approach for treatment of BCR-ABL1 positive Acute Lymphoblastic Leukemia (ALL) cells

PDF

Multiple functions of the PR-Set7 histone methyltransferase: from transcription to the cell cycle

PDF

Characterization of zebrafish phf6 CRISPR mutant phenotypes

PDF

Mechanism of a new CK2 inhibitor triggering senescence in breast cancer cells

PDF

Identification and characterization of post-translational modifications on histones: an on-line top-down mass spectrometry workflow for analysis using ProSight PTM

Asset Metadata

Creator Bian, Jiaxuan (author)

Core Title Evaluating the therapeutic potential of targeting CBX8 in MLLr leukemia

School Keck School of Medicine

Degree Master of Science

Degree Program Biochemistry and Molecular Medicine

Degree Conferral Date 2022-12

Publication Date 09/07/2022

Defense Date 06/02/2022

Publisher University of Southern California (original), University of Southern California. Libraries (digital)

Tag CBX8,leukemia,MLLr,OAI-PMH Harvest

Format application/pdf (imt)

Language English

Contributor Electronically uploaded by the author (provenance)

Advisor Bell, Oliver (committee chair), Dou, Yali (committee member), Kim, Yong-Mi (committee member)

Creator Email jiaxuanb@usc.edu,roybian0901@163.com

Permanent Link (DOI) https://doi.org/10.25549/usctheses-oUC111833789

Unique identifier UC111833789

Legacy Identifier etd-BianJiaxua-11181

Document Type Thesis

Format application/pdf (imt)

Rights Bian, Jiaxuan

Type texts

Source 20220908-usctheses-batch-978 (batch), University of Southern California (contributing entity), University of Southern California Dissertations and Theses (collection)

Access Conditions The author retains rights to his/her dissertation, thesis or other graduate work according to U.S. copyright law. Electronic access is being provided by the USC Libraries in agreement with the author, as the original true and official version of the work, but does not grant the reader permission to use the work if the desired use is covered by copyright. It is the author, as rights holder, who must provide use permission if such use is covered by copyright. The original signature page accompanying the original submission of the work to the USC Libraries is retained by the USC Libraries and a copy of it may be obtained by authorized requesters contacting the repository e-mail address given.

Repository Name University of Southern California Digital Library

Repository Location USC Digital Library, University of Southern California, University Park Campus MC 2810, 3434 South Grand Avenue, 2nd Floor, Los Angeles, California 90089-2810, USA

Repository Email cisadmin@lib.usc.edu