University of Southern California Dissertations and Theses

Genome manipulation of filamentous fungi for upregulating the production and illustrating the biosynthesis of valuable secondary metabolites using CRISPR-Cas9

(USC Thesis Other)

Genome manipulation of filamentous fungi for upregulating the production and illustrating the biosynthesis of valuable secondary metabolites using CRISPR-Cas9

PDF

Download

Open document

Flip pages

Download a page range

Download transcript

Copy asset link

Request this asset

Transcript (if available)

Content

Genome manipulation of filamentous fungi for upregulating the production and illustrating the
biosynthesis of valuable secondary metabolites using CRISPR-Cas9

by
Bo Yuan

A Dissertation Presented to the
FACULTY OF THE USC SCHOOL OF PHARMACY
UNIVERSITY OF SOUTHERN CALIFORNIA
In Partial Fulfillment of the
Requirements for the Degree
DOCTOR OF PHILOSOPHY
(PHARMACEUTICAL SCIENCES)

December 2022

Copyright 2022 Bo Yuan

- ii -

To my family for the never-ending support
they provided me.
To my friends for helping me to shape my life
with positivity and passion.

Without you, I would never be the person I am today.

- iii -

Acknowledgements

Professor Clay C. C. Wang is more to me than just a supervisor, but a mentor, motivator,
and life coach. His passion and scientific vision continue to inspire me throughout my PhD. His
encouragement and guidance have made my work far more impactful than I could have imagined.
I also would like to thank our collaborators who have been incredibly generous with their
support and expertise. Professor Berl R. Oakley from the University of Kansas has always been
highly supportive of my work. I appreciate his kindness and patience in dedicating his time to me
when I struggled with my projects. I am fortunate to have Professor Jason E. Stajich from the
University of California, Riverside as my mentor in genome editing. He has taught me many
valuable techniques beyond bench work, and has trained me to become capable of
understanding the secrets of fungal genetics. It has been my great honor to work with them.
I would like to thank my committee members—Professor Curtis Okamoto and Professor
Berl Oakley. I have received constructive feedback and suggestions from them to direct my career
path and to better shape my work.
I truly appreciate the help provided by Dr. Yi-Ming Chiang and Dr. Ming-Shian Lee during
my studies. They have never failed to contribute their time to help and train me. They opened
my mind about how a person can be so skillful in their areas of expertise.

- iv -
I would like to thank my former lab members—Dr. Johannes van Dijk, Dr. Michelle Grau,
Dr. Adriana Blachowicz, Dr. Jillian Romsdahl, Dr. Tzu-Shyang Lin, Dr. Swati Bijlani, Yien Liao, Gujie
Xu, Sujeung Lim, Jingyi Wang, Ngan Pham. I thank Dr. van Dijk for training me when I started in
the lab. He was a valuable teacher, and I learned many techniques from him. Dr. Michelle Grau
and Dr. Adriana Blachowicz have also been my good friends and they continue to help and
support me even after graduation.
I am thankful to my current lab members—Chris Rabot, Shu-Yi Lin, Jennifer Shyong, and
Michael De Guzman. I am lucky to have Chris Rabot as not only my colleague but my close friend
who always provides support and help with no hesitation. When I was struggling with things not
going well, he was always on my side. I also extend my special thanks to Shu-Yi Lin for his
assistance, and I look forward to following his academic work as a professor in the future.
Besides those mentioned, I also received support outside the lab. I am grateful for Gujie
Xu who has been an amazing source of help and support for me. He showed me a bigger picture
of life and taught me to visualize things from different angles. He helped me to become the
person that I always wanted to be. For the person that I love and appreciate the most, my mother,
Jie Liang, who traveled across half of the Earth constantly to see me, I express my sincerest
gratitude to her. If I have any accomplishments in my life, she shares the credit with me.
In the end, I want to thank the USC School of Pharmacy for allowing me to pursue my
dream in science. I have been put into an excellent working environment with the support of
fellowships that facilitated me to earn a PhD. No matter how far I go, I will always be a part of
the Trojan family.

- v -

TABLE OF CONTENTS

Dedication ................................................................................................................ii
Acknowledgements .............................................................................................................iii
List of Tables ....................................................................................................................... viii
List of Figures ...................................................................................................................... ix
Abstract ............................................................................................................................... xii
Chapter 1: Introduction ....................................................................................................... 1
1.1 Natural product drug discovery ............................................................................... 1
1.2 Fungal secondary metabolism: from chemistry to genetics .................................... 3
1.3 Application of CRISPR-Cas: a game-changing technology ........................................ 5
1.4 Delivering CRISPR in filamentous fungi .................................................................... 8
Chapter 2: Manipulation of the global regulator mcrA upregulates secondary metabolite
production in Aspergillus wentii using CRISPR-Cas9 with in vitro-assembled
ribonucleoproteins ............................................................................................................... 14
2.1 Abstract ................................................................................................................... 14
2.2 Introduction ............................................................................................................ 15
2.3 Results and Discussion ............................................................................................ 19
2.3.1 Establishment of an in-vitro CRISPR-Cas9 system in A. wentii by targeting
the pksP melanin gene ......................................................................................... 19
2.3.2 McrA deletion results in upregulation of secondary metabolite production ....... 22
2.3.3 McrA/gedC homolog double-knockout reveals additional upregulated SMs ....... 24
2.4 Conclusion .............................................................................................................. 26
2.5 Methods ................................................................................................................. 28
2.5.1 Genome Assembly and Annotation ...................................................................... 28
2.5.2 Molecular Genetic Procedures ............................................................................. 29
2.5.3 Transformation of A. wentii .................................................................................. 30
2.5.4 Culturing and HPLC-DAD-MS Analysis .................................................................. 31
2.5.5 Compound Purification and Characterization ...................................................... 32
2.6 Supporting Information .......................................................................................... 34
Chapter 3: Identification of the neoaspergillic acid biosynthesis gene cluster by establishing
an in vitro CRISPR-ribonucleoprotein genetic system in Aspergillus melleus ……………………. 58
3.1 Abstract ................................................................................................................... 58
3.2 Introduction ............................................................................................................ 59
3.3 Results and Discussion ............................................................................................ 61
3.3.1 A. melleus produces neoaspergillic acid on solid YEPD medium. The gene

- vi -
cluster was located through genome annotation ................................................ 61
3.3.2 Deletion of neaC using in vitro CRISPR-Cas9 confirms the gene cluster of
neoaspergillic acid in A. melleus ........................................................................... 63
3.3.3 Deletion of additional cluster genes to reveal the biosynthetic pathway of
neoaspergillic acid ................................................................................................ 65
3.3.4 Deletion of the negative transcriptional factor, mcrA, upregulates the
production of neoaspergillic acid and the related compounds ............................ 67
3.4 Conclusion ............................................................................................................. 68
3.5 Methods ................................................................................................................ 70
3.5.1 Genome Assembly and Annotation ...................................................................... 70
3.5.2 Molecular Genetic Procedures ............................................................................. 70
3.5.3 Transformation of A. melleus ............................................................................... 71
3.5.4 Culturing and HPLC-DAD-MS Analysis .................................................................. 73
3.5.5 Compound Purification and Characterization ...................................................... 74
3.6 Supporting Information ......................................................................................... 75
Chapter 4: Genome mining of the biosynthetic gene cluster of citrinalin in
Penicillium citrinum using CRISPR-Cas9................................................................................. 88
4.1 Abstract ................................................................................................................. 88
4.2 Introduction .......................................................................................................... 88
4.3 Results and Discussion .......................................................................................... 90
4.3.1 Establishment of a plasmid-facilitated CRISPR system by targeting the
putative NRPS in the citrinalin gene cluster ......................................................... 90
4.3.2 Deletion of additional genes within the citrinalin cluster illustrate the critical
enzyme involved in the formation of nitro group ……………………………………….…... 95
4.4 Conclusion ............................................................................................................ 96
4.5 Methods ............................................................................................................... 97
4.5.1 Transformation procedure for Penicillium citrinum ............................................. 97
4.5.2 Strain cultivation and scale up ............................................................................. 99
4.5.3 Genome sequencing and analyzing .................................................................... 100
4.6 Supporting Information ........................................................................................ 101
Chapter 5: Extend the application of in vitro CRISPR-RNP system in Penicillium rubens
and Scopulariopsis candida ................................................................................................ 122
5.1 Introduction ........................................................................................................ 122
5.2 Results and Discussion ........................................................................................ 123
5.2.1 Genome sequencing and establishment of an in vitro CRISPR-RNP system
for P. rubens ....................................................................................................... 123
5.2.2 Upregulation of secondary metabolite production in P. rubens through
mcrA deletion ..................................................................................................... 125
5.2.3 Deletion of a backbone enzyme in hymeglusin PKS cluster in Scopulariopsis
candida IMV00968 using in vitro CRISPR strategy .............................................. 127
5.3 Conclusion ......................................................................................................... 129
5.4 Methods ............................................................................................................ 130
5.4.1 Molecular Genetic Procedures ........................................................................... 130
5.4.2 Transformation protocol .................................................................................... 130

- vii -
5.5 Supporting Information ..................................................................................... 132
Chapter 6: Conclusions and perspectives ....................................................................... 138
Bibliography ..................................................................................................................... 141

- viii -

LIST OF TABLES

2.1 Genome assembly characteristics of Aspergillus wentii IMI 49129 ................................................... 34
2.2 Secondary metabolite clusters predicted by antismash v4.1.0 ......................................................... 35
2.3 Cluster comparison of geodin between A. terreus and A. wentii ...................................................... 36
2.4 Cluster comparisons of scytalidin in Scytalidium album, zopfiellin in Diffractella curvata,
and homolog in A. wentii .................................................................................................................... 37
2.5 Primers used in this study .................................................................................................................. 38
3.1 Genome assembly characteristics of Aspergillus melleus .................................................................. 75
3.2 Secondary metabolite clusters predicted by antismash v4.1.0 ......................................................... 76
3.3 Cluster comparison of aspergillic acid in Aspergillus flavus and neoaspergillic acid in A. melleus .... 77
3.4 Primers used in this study .................................................................................................................. 78
4.1 Predicted citrinalin biosynthesis genes in Penicillium citrinum and gene function predictions ......... 92
4.2 Primers used in this study ………………………………………………………………………………………………….…………. 101
4.3 Chemical shifts comparison between citG mutant intermediate and citrinalin A and B ................... 103
5.1 Secondary metabolite clusters predicted by antismash v5.2.0 …………………………………………….……. 124
5.2 Primers used in this study .................................................................................................................. 132

- ix -

LIST OF FIGURES

1.1 Genome mining in fungi yields valuable secondary metabolites .......................................................... 2
1.2 An illustrative overview of a biosynthetic gene cluster and the typical building blocks of
secondary metabolites ......................................................................................................................... 4
1.3 An illustration of the type II CRISPR-Cas9 system ................................................................................. 7
1.4 Delivering CRISPR in filamentous fungi ................................................................................................ 9
2.1 Overview of gene replacement coupled with in vitro assembled RNP cleavage ................................. 21
2.2 Paired HPLC profiles of A. wentii (wild type, mcrAΔ, and mcrAΔ gedCΔ dual knockout strains)
extracts when grown on a solid PDA medium .................................................................................... 23
2.3 Chemical structures of the upregulated compounds in the A. wentii mcrAΔ strain .......................... 24
2.4 Chemical structures of compound 16 (Aspergillus acid B) and compound 17 (Aspergillus acid E)
as determined by NMR ...................................................................................................................... 26
2.5 Antibiotic sensitivity test of A. wentii against phleomycin ................................................................. 39
2.6 Antibiotic sensitivity test of A. wentii against hygromycin B .............................................................. 40
2.7 Results of the diagnostic PCR of pksP coding region in wild type and pksPΔ strains of A. wentii ...... 41
2.8 Results of the diagnostic PCR amplification of mcrA coding region in wild type and mcrAΔ
strains of A. wentii .............................................................................................................................. 42
2.9 Results of the PCR amplification of physcion/emodin gedC coding region in wild type, mcrAΔ
strains, and mcrAΔ gedCΔ strains of A. wentii .................................................................................... 43
2.10
1
H NMR spectrum of emodin (1) in acetone-d 6 (400 MHz) .............................................................. 44
2.11
1
H NMR spectrum of physcion (2) in acetone-d 6 (400 MHz) ............................................................ 45
2.12
1
H NMR spectrum of sulochrin (3) in DMSO-d 6 (400 MHz) ............................................................... 46
2.13
1
H NMR spectrum of physcion bianthrone (4) in chloroform-d (400 MHz) ...................................... 47
2.14
1
H NMR spectrum of 14-O-demethylsulochrin (5) in DMSO-d 6 (400 MHz) .................................... 48
2.15
1
H NMR spectrum of (trans)-emodin bianthrone (6) in acetone-d 6 (400 MHz) ................................ 49
2.16
1
H NMR spectrum of (cis)-emodin bianthrone (7) in DMSO-d 6 (400 MHz) ....................................... 50
2.17
1
H NMR spectrum of (trans)-emodin physcion bianthrone (8) in acetone-d 6 (400 MHz) ................. 51
2.18
1
H NMR spectrum of (cis)-emodin physcion bianthrone (9) in acetone-d 6 (400 MHz) ..................... 52
2.19
1
H NMR spectrum of Aspergillus acid B (16) in chloroform-d (400 MHz) ......................................... 53
2.20
13
C NMR spectrum of Aspergillus acid B (16) in chloroform-d (400 MHz) ........................................ 54
2.21
1
H NMR spectrum of Aspergillus acid E (17) in chloroform-d (400 MHz) ......................................... 55
2.22
13
C NMR spectrum of Aspergillus acid E (17) in chloroform-d (400 MHz) ........................................ 56
2.23 UV-Vis and ESIMS spectra (positive or negative mode) of gedC-related and new compound
identified in this study ...................................................................................................................... 57
3.1 Replacement of the native NRPS-like gene (neaC) with a hygromycin resistance (HygR) marker ... 62
3.2 Paired HPLC profiles of A. melleus (wild type, neaCD, neaDD, neaBD, mcrAD strains) extracts
when grown on a solid YEPD medium ................................................................................................ 63
3.3 NeaD oxidizes neodeoxyaspergillic acid forming neoaspergillic acid ............................................. 66

- x -
3.4 Proposed biosynthesis pathway of neoaspergillic acid in A. melleus ............................................. 67
3.5 Increased production of compound 1 and 2 in mcrAD strain ........................................................ 68
3.6 Anti-candida test of A. melleus against wild-type C. albicans and fluconazole-resistant
C. albicans ……………………………………………………………………………………………………………………………………... 79
3.7 Antibiotic sensitivity test of A. melleus against hygromycin B ........................................................... 80
3.8 Results of the diagnostic PCR amplification of neaC coding region in wild type and neaCD
strains of A. melleus ........................................................................................................................... 81
3.9 Results of the diagnostic PCR amplification of neaD coding region in wild type and neaDD
strains of A. melleus ............................................................................................................................ 82
3.10 Results of the diagnostic PCR amplification of neaB coding region in wild type and neaBD
strains of A. melleus .......................................................................................................................... 83
3.11 Results of the diagnostic PCR amplification of mcrA coding region in wild type and mcrAD
strains of A. melleus .......................................................................................................................... 84
3.12
1
H NMR spectrum of neoaspergillic acid (1) in methanol-d 4 (400 MHz) .......................................... 85
3.13
13
C NMR spectrum of neoaspergillic acid (1) in methanol-d 4 (400 MHz) ......................................... 86
3.14
1
H NMR spectrum of neohydroxyaspergillic acid (2) in methanol-d 4 (400 MHz) ............................. 87
4.1 Chemical structure of paraherquamide A and chemical structures of stereoisomers of
citrinalin A and B ................................................................................................................................. 90
4.2 Predicted gene cluster of citrinalin in Penicillium citrinum and Total Ion Current (TIC) of
positive ions traces for P. citrinum wild type and citA mutant ........................................................ 91
4.3 Total Ion Current (TIC) of positive ions traces for P. citrinum wild type and citB-citL mutant …....... 94
4.4 Chemical shifts of intermediate produced by citG mutant compared to citrinalin A ....................... 96
4.5 Effective concentration (0.1mg/mL) of phleomycin for P. citrinum protoplast
growth inhibition .............................................................................................................................. 104
4.6 Sequencing data of wild type and citA mutant of P. citrinum ..................................................... 105
4.7 Sequencing data of wild type and citB mutant of P. citrinum ..................................................... 106
4.8 Sequencing data of wild type and citC mutant of P. citrinum ..................................................... 107
4.9 Sequencing data of wild type and citD mutant of P. citrinum ..................................................... 108
4.10 Sequencing data of wild type and citE mutant of P. citrinum ..................................................... 109
4.11 Sequencing data of wild type and citF mutant of P. citrinum ..................................................... 110
4.12 Sequencing data of wild type and citG mutant of P. citrinum .................................................... 111
4.13 Sequencing data of wild type and citH mutant of P. citrinum .................................................... 112
4.14 Sequencing data of wild type and citI mutant of P. citrinum ....................................................... 113
4.15 Sequencing data of wild type and citJ mutant of P. citrinum …………………………………………………… 114
4.16 Sequencing data of wild type and citK mutant of P. citrinum ..................................................... 115
4.17 Sequencing data of wild type and citL mutant of P. citrinum …………………………………………………… 116
4.18
1
H NMR spectrum of citrinalin amine in DMSOd 6 (400 MHz) ...................................................... 117
4.19
13
C NMR spectrum of citrinalin amine in DMSOd 6 (400 MHz) …………………………………………………. 118
4.20 COSY spectrum of citrinalin amine in DMSOd 6 (400 MHz) .......................................................... 119
4.21 HMBC spectrum of citrinalin amine in DMSOd 6 (400 MHz) ......................................................... 120
4.22 HMQC spectrum of citrinalin amine in DMSOd 6 (400 MHz) ……………………………………………………... 121
5.1 Antibiotic sensitivity tests of P. rubens against hygromycin B (i) and phleomycin (ii) .................. 124
5.2 Paired HPLC profiles of P. rubens (wild type and mcrAD strains) extracts when grown on
different solid media …………………………………………………………………………………………………………….….... 126
5.3 Paired HPLC profiles of S. candida (wild type, PKSD strain) extracts when grown on
a solid SDA medium ......................................................................................................................... 128
5.4 Transformation plates for pksP∆ and controls of P. rubens ……………………………………………….….……. 133

- xi -
5.5 Results of the diagnostic PCR amplification of pksP coding region in wild type and pksPD
strains of P. rubens ……………………………………………………………………………………………………………………… 134
5.6 Transformation plates for mcrA∆ and controls of P. rubens ……………………….………………………………. 135
5.7 Results of the diagnostic PCR amplification of mcrA coding region in wild type and mcrAD
strains of P. rubens ……………………………….…………………………………………………………………………………… 136
5.8 Results of the diagnostic PCR amplification of PKS coding region in PKSD strains of S. candida …….137

- xii -

Abstract

Natural products have proven to be an essential source of bioactive compounds
throughout society. Natural products and their derivatives have been widely applied in the food,
agriculture, cosmetic, and pharmaceutical industries. Secondary metabolites are low-molecular-
weight natural products derived from central metabolic pathways. In contrast to primary
metabolites, which are required for survival, secondary metabolites generally confer survival
advantages to the host during competition with other organisms. The bioactivities of the
produced secondary metabolites can be both beneficial and detrimental to humans. Antibiotic
and antitumor effects of some secondary metabolites, such as penicillin and paclitaxel, can be
used in medical treatments. At the same time, the toxicity of mycotoxins frequently leads to
significant food contamination and subsequent crop loss. Thus, developing a considerable
understanding of secondary metabolite biosynthesis is of critical importance.
Filamentous fungi are known to be prolific producers of secondary metabolites. Genome
mining in fungal species has revealed a substantial potential for the discovery of novel bioactive
natural products. However, the accessibility of genome manipulation in different wild-type fungal
strains is often limited. Even though whole genome sequencing has revealed a large number of
biosynthetic gene clusters responsible for secondary metabolite biosynthesis, the activation of

- xiii -
those gene clusters is constrained by limited genetic tools. Fortunately, the development of
CRISPR-Cas9-based genetic engineering strategies has vastly expanded our molecular genetic
toolbox. As an efficient genetic technique that has been applied in plants, fish, and mammalian
cells, CRISPR-Cas9 has recently been applied in fungal models toward the discovery of novel
secondary metabolites.
The work described in this thesis details CRISPR-based approaches we have taken both to
upregulate the production of secondary metabolites and to solve the biosynthetic pathways of
secondary metabolites produced in non-model fungal species. Chapter 1 is an introduction to
natural products with an emphasis on fungal secondary metabolism, and the application of
different CRISPR-Cas9 engineering systems. In Chapter 2, we genetically engineered Aspergillus
wentii to upregulate the production of several secondary metabolites by manipulating a negative
transcriptional regulator, mcrA, using CRISPR-Cas9 with in vitro-assembled ribonucleoproteins. A
novel compound bearing a maleic anhydride moiety, aspergillus acid E, was discovered in this
work. In Chapter 3, we elucidated the biosynthetic pathway of neoaspergillic acid, a compound
with antibacterial, antifungal, and antitumor activities in Aspergillus melleus using CRISPR-Cas9.
In Chapter 4, we developed a genetic system for Penicillium citrinum using plasmid-facilitated
CRISPR-Cas9. As the unknown biosynthetic pathway of organic nitro compounds has not yet been
elucidated, we identified the first enzyme responsible for the critical conversion of an amine
functional group to a nitro functional group. In Chapter 5, we expanded the application of our in
vitro CRISPR-ribonucleoprotein system into Penicillium rubens and Scopulariopsis candida species.
The successful establishment of in vitro-CRISPR systems in both strains indicates the widely
applicable potential of this genetic system. In Chapter 6, I summarize all the findings,

- xiv -
demonstrate their significance, and discuss the future directions of novel compound discovery in
filamentous fungi using CRISPR-Cas9.

- 1 -

Chapter 1 _____________________________________________

Introduction

1.1 Natural product drug discovery

In all living organisms, natural products play crucial roles in physical development, cellular
function, and cell-cell interaction. As low-molecular-weight natural products, secondary
metabolites (SMs) derived from primary metabolite pools often possess unique bioactivities.
1

Melanin is a natural pigment produced in fungi which confers photoprotective properties to the
host. The application of melanin in cosmetics as ultraviolet protectants was later established.
2,3

On the other hand, aflatoxins produced by some filamentous fungi are serious food contaminants,
even though the initial purpose of producing this compound by fungi was to poison insects.
4
One
study showed that more than half of 1500 compounds that have been isolated from fungi
displayed antifungal, antibacterial, or antitumor effects.
5
In fact, fungal metabolites received
widespread attention starting in the 20
th
century. Large-scale efforts have focused on the
investigation of valuable fungal secondary metabolites such as penicillin, cyclosporin, and
lovastatin to extend human life. In recent years, technological advances have dramatically
improved natural product-based drug discovery prospects (Figure 1.1).
1,6,7

- 2 -

Thus far, thousands of natural compounds have been discovered that inhibit the growth of
bacteria, fungi, viruses, and tumor cells. Previous studies have detailed natural product (NP) or
natural product-derived drugs approved from 2000 to 2013. Among 317 of the new drugs
approved from New Chemical Entities (NCE), 54 of them were NP-derived.
8,9
As we continue to
discover more natural products, these bioactive compounds represent important chemical
entities in drug discovery.
Figure 1.1: Genome mining in fungi yields valuable secondary metabolites. Biosynthetic gene
clusters in filamentous fungi can be activated through regulator manipulation and environmental
stimuli. Bioactive secondary metabolites (SMs) are produced upon activation of BGCs. Figure
adapted from REF
1
, Nature Reviews.

- 3 -

1.2 Fungal secondary metabolism: from chemistry to genetics

Even with enormous chemical diversity and complexity, secondary metabolites originate
from a limited number of building blocks and precursors. Genes that encode enzymes that direct
SM biosynthesis are generally clustered together as a biosynthetic gene cluster (BGC) in fungal
genomes.
10,11
Those BGCs are classified by the chemical products of the core enzymes. For the
synthesis of polyketides, polyketide synthases (PKSs) generally use acyl CoA or malonyl CoA
substrates as building blocks. Non-ribosomal peptide synthases (NRPSs), on the other hand, use
proteinogenic or non-proteinogenic amino acid building blocks for peptide generation. Some less
common BGCs, such as terpenes and indole alkaloids, also have their unique building blocks.
Terpenes are composed of isoprene units with further modifications, while indole alkaloids are
usually derived from tryptophan and dimethylallyl pyrophosphate.
12-14
In a BGC, a synthase or
synthetase is responsible for generating carbon backbones from primary precursors. The
intermediate products are then modified by tailoring enzymes within the gene cluster. About half
of the fungal BGCs contain a cluster-specific transcription factor that typically positively regulates
genes within the BGCs. Protective genes encoding proteins that alleviate the toxicity of the
produced metabolite are sometimes also present in the gene clusters together with other
hypothetical genes (Figure 1.2).
1,11

As a result of whole genome sequencing projects, the number of sequenced fungal genomes
continues to increase. The 1000 Fungal Genomics Projects, Fungal Genomic Initiative, and

- 4 -
hundreds of projects conducted in individual laboratories expand genomic resources for genome
mining in fungal species.
15,16
As more BGCs have been discovered in various fungal strains, the
accessibility of genetic manipulation and activation of BGCs presents two essential problems.
Current algorithms allow us to predict the type of BGCs that encode conserved synthases or
synthetases. However, the chemical structures of the final product and the true association with
a cluster can only be confirmed through targeted gene knockouts. Further, the activation of a
given BGC can be challenging, as most BGCs are silent under normal laboratory growth conditions.
Figure 1.2: An illustrative overview of a biosynthetic gene cluster and the typical building blocks of
secondary metabolites. Most secondary metabolites can be classified based on their chemical
identities. Synthases or synthetases are responsible for forming backbone precursors of final SM
products. Genes encoding the core and tailoring enzymes are generally clustered in a canonical BGCs.

- 5 -
Environmental stimuli such as temperature, pH, radiation exposure, and nutritional input have
been applied, which is known as the one strain-many compounds (OSMAC) approach for
metabolite mining.
17-19
Another common way to activate BGCs is to regulate the expression of
transcriptional factors. A cluster-specific transcription factor, which is responsible for regulating
all genes within a cluster, can occasionally be located.
20
The global or “broad-domain”
transcription factors, on the other hand, contribute to the regulation of multiple BGCs
concurrently. Deletion of these global regulators leads to positive or negative regulation of some
BGCs depending on the chemical identities of the regulators. LaeA was found to be a positive
global regulator of BGCs. Deletion of laeA in A. nidulans led to a downregulation of the
sterigmatocystin BGCs and some other gene clusters. McrA was discovered as a negative global
regulator of BGCs, as deletion of mcrA in A. nidulans resulted in upregulation of over one
thousand genes, including those contained in ten different BGCs.
21,22
The regulatory nature of
the mcrA gene product makes manipulation of mcrA an attractive approach toward BGC
activation.

1.3 Application of CRISPR-Cas: a game-changing technology

With the rapid progress of genome sequencing technologies, we have begun to have a better
understanding of ourselves and other living organisms. Meanwhile, more genetic-associated
diseases have been discovered. A study showed that more than 3000 genes have been found to
be associated with disease-causing mutations in humans. Since then, large-scale efforts have
focused on implementing gene therapy.
23,24
One of the most well-known trials was conducted in
France for treating children with X-linked combined immunodeficiency. After performing gene

- 6 -
therapy, 17 out of 20 patients were cured. Unfortunately, 5 children developed T-cell leukemia
and one child died because of it.
25
Later studies showed that correcting genes were inserted into
the genome, which caused transcriptional activation of tumor-promoting genes among patients
with developed leukemia.
26
The occurring tragedies and failures from other gene therapy trials
made people realize the importance of site-specific targeting. After that, great progress in gene
editing has been generated by discovering site-specific nucleases such as zinc finger nucleases
(ZFNs), transcription activator-like effector nucleases (TALENs), and clustered regularly
interspaced short palindromic repeats (CRISPR)-Cas9.
27-29
CRISPR-Cas9 was first discovered by the identification of unusual repeat sequences in E. coli.
Bacteria carrying a viral DNA sequence were found to be resistant to infections from the specific
phage, indicating that CRISPR-Cas is an adaptive phage immunity system in prokaryotes.
30,31

Further studies classified the different CRISPR-Cas systems into two classes and six types. Most
studies focused on type I-III while the I system uses Cas3 and the type III system uses Cas10. The
most well-known type II CRISPR system uses the Cas9 protein which possesses multiple functions,
such as scanning, binding, and cleaving DNA sequences. The three components in a genomic
CRISPR locus are the CRISPR spacer sequence, trans-activating CRISPR RNA (tracrRNA) gene, and
the Cas gene. The spacer sequence is later transcribed and modified into crRNA and forms a single
guide RNA (sgRNA) complex combined with tracrRNA. By searching for an appropriate
protospacer adjacent motif (PAM), the protein-RNA complex binds to the target site and unwinds
DNA. The target sequence is then cleaved by the Cas9 nuclease (Figure 1.3).
32,33
Besides genome editing, CRISPR has also been applied to the manipulation of gene expression.
CRISPR systems with a catalytically dead Cas9 enzyme (dCas9) were designed for gene repression,

- 7 -
termed CRISPR interference (CRISPRi). The dCas9 protein was able to bind to the same target site
as Cas9 without causing cleavage. By continually binding to the target gene, RNA polymerase or
transcription factors were not able to interact with the target gene, and therefore resulted in
gene repression.
34
On the other hand, a gene activation CRISPR system was also developed by
fusing dCas9 with a repeating peptide array transcription factor, termed CRISPRa.
35
Further
studies showed that CRIPSR can also be used as a powerful tool in epigenetic studies, and
inducible CRISPR systems were later developed. Unlike the ZFNs and TALENs, which require
Figure 1.3: An illustration of the type II CRISPR-Cas9 system.

- 8 -
complex protein engineering, the CRISPR system displays its unique advantages in simplicity and
efficiency for gene editing.
23

Nowadays, CRISPR-Cas9 has been widely applied in many areas including the elucidation of
mechanisms of genetic diseases, engineering plants for food production, developing animal
disease models, and diagnosis of infectious diseases like COVID-19. Successful experiments
validated the great therapeutic potential of CRISPR-Cas9. Two genes were disrupted in
cynomolgus monkeys from a single microinjection of CRISPR components into one-cell-stage
embryos. The coat color of mice was disrupted by delivering CRISPR ribonucleoprotein (RNP)
targeting the color gene into zygotes followed by transferring them to pseudopregnant mothers.
Injection of plasmid-coding sgRNA and Cas9 into mice induced indel mutations of two tumor
suppressor genes.
36-38
As we can see, with continually developed delivering methods such as lipid
nanoparticles and adeno-associated virus (AAVs) vehicles, effective CRISPR delivery will make a
meaningful impact on the medical field.
23

1.4 Delivering CRISPR in filamentous fungi

As an essential source of novel bioactive secondary metabolites, filamentous fungi have been
heavily studied in recent years. With an increased number of fungal genome sequencing efforts,
genetic tools for fungal genome mining are still relatively scarce. Even though traditional
strategies of gene manipulation have been well-established in model fungi such as Aspergillus
nidulans and Penicillium chrysogenum, the genetic accessibility of non-model wild-type fungi is
rather limited. Selectable markers used in model fungi might not be adapted in other fungal
species. Unlike model strains with mutations of marker genes such as pyrG, encoding orotidine-

- 9 -
5’-phosphate decarboxylase, non-model strains are mostly wild-type with an intact pyrG and Ku,
a dimeric protein complex that facilitates non-homologous end-joining (NHEJ) DNA repair.
39-41

Fortunately, CRISPR may represent a valuable tool to add to our current molecular genetic
arsenal.
A plasmid-facilitated CRISPR-Cas9 system was first established in filamentous fungi by the
Mortensen group.
42
The designed plasmid contains a self-splicing guide RNA (gRNA) construct, a
Figure 1.4: Delivering CRISPR in filamentous fungi. DNA cleavage can be generated through sgRNA
and Cas9 transcribed from a designed plasmid or ribonucleoproteins assembled using crRNA, tracrRNA,
and Cas9. The DNA double stranded break (DSB) is repaired through either non-homologous end-
joining (NHEJ) or homology-directed repair (HDR) DNA-repair pathways. Nucleotides insertion or
deletion (Indels) will be introduced to the target site by NHEJ, while a homologous gene cassette will
be incorporated into the fungal genome through HDR.

- 10 -
Cas9 cassette, an AMA1 sequence supporting autonomous replication, a resistance marker for E.
coli cloning, and a selectable marker for fungal transformation. A 20 bp protospacer was designed
complementary to the target gene followed by a PAM sequence (NGG), and therefore sgRNA
guides Cas9 to the target site and introduces double strand breaks (DSBs). After DNA cleavage,
the genome will be repaired through either the NHEJ or homology-directed repair (HDR) DNA-
repair pathways. In a wild-type fungal genome with intact Ku genes, the NHEJ pathway usually
results in insertions or deletions of nucleotides (indels). Previous studies showed that Ku-deleting
strains favor the HDR pathway when a homologous repair template is provided during
transformation. In a plasmid-facilitated CRISPR-Cas9 system, mutations are introduced to the
target gene through NHEJ, which leads to a loss of function of the enzyme (Figure 1.4).
42
Another recently developed CRISPR system using ribonucleoproteins (RNPs) has been highly
successful in fungi, plant, and mammalian cells.
42-46
The commercially available crRNA, tracrRNA,
and Cas9 are assembled together in vitro to form an RNP complex which is then delivered into
fungal protoplasts during transformation. Implementing a gene knockout is significantly
simplified by the RNP assembly compared to the plasmid construction, and it also creates the
opportunity to target two sites simultaneously. A recent study showed that a complete gene
deletion in filamentous fungi can be achieved by targeting both ends of the gene and supplying
a homologous repair template during transformation. The repair template contains a selectable
marker for selecting correct mutant strains.
42

Some other CRISPR approaches have also been developed for genome manipulation in fungi.
CRISPRi was developed by replacing Cas9 with a nuclease deactivated Cas protein (dCas). The
dCas protein binds to the target site without making a cleavage and therefore prevents the gene

- 11 -
from being transcribed.
23,35
CRISPRa was also developed by fusing dCas protein with a synthetic
tripartite activator VP64-p65-Rta (VPR). The target gene will then be continually activated upon
binding of the dCas.
46,47
We have described many CRISPR approaches that have been applied to filamentous fungi for
genome mining. In the work that follows, I present the CRISPR systems that we established in our
fungal strains with the goal of activating SM biosynthesis or illustrating the biosynthetic pathway
of bioactive compounds. In Chapter 2, we manipulate the negative global regulator, mcrA, in
Aspergillus wentii by establishing a CRISPR-Cas9 system with in vitro-assembled
ribonucleoproteins. A new compound, aspergillus acid E, was first discovered in this work. In
Chapter 3, we identified the gene cluster of neoaspergillic acid, a compound with antibacterial,
antifungal, and antitumor activity. The biosynthetic pathway of neoaspergillic acid in Aspergillus
melleus was first elucidated using CRISPR-Cas9 in this work. In Chapter 4, we developed a genetic
system for Penicillium citrinum using plasmid-facilitated CRISPR-Cas9. The critical conversion of
an amine functional group to a nitro functional group was discovered. In Chapter 5, we illustrate
techniques that we used to retrieve genomic data from wild-type fungal species and we expand
the application of our in vitro CRISPR-RNP system into Penicillium rubens and Scopulariopsis
Candida. The CRISPR-RNP system was well-established in both of the strains indicating this
technique can be widely applied to other non-model filamentous fungi for discovery of novel
bioactive compounds. In Chapter 6, I summarize our main findings and discuss the future
directions of related work.

- 12 -
Chapter 2 is incorporated from Yuan, B., Keller, N. P., Oakley, B. R., Stajich, J. E., and Wang, C. C.
C. Manipulation of the Global Regulator mcrA Upregulates Secondary Metabolite Production in
Aspergillus wentii using CRISPR-Cas9 with in vitro-Assembled Ribonucleoproteins, ACS Chemical
Biology 2022, DOI:10.1021/acschembio.2c00456.
The author is the only graduate student in this study. The original strain was provided by Dr.
Keller. Dr J. E. Stajich assisted in genome annotation and analysis.

Chapter 3 is incorporated from Yuan, B, Grau, M. F., Torok, T., Venkateswaran, K., Stajich, J. E.,
and Wang, C. C. C. Identification of the neoaspergillic acid biosynthesis gene cluster by
establishing an in vitro CRISPR-ribonucleoprotein genetic system in Aspergillus melleus, which is
currently in preparation.
The author engineered all the mutant strains, identified and purified compounds, located the
gene cluster, and established the biosynthetic pathway in this study. Dr. M. Grau performed the
anti-Candida screening and assisted in compound identification. The original strain was provided
by Dr. Torok. Dr J. E. Stajich assisted in genome annotation and analysis.

Chapter 4 is incorporated from Yuan, B., van Dijk, J. W. A., Yu, F.-G., Sherman, D. H., and Wang,
C. C. C. Genome Mining of the Biosynthetic Gene Cluster of Citrinalin in Penicillium citrinum using
CRISPR-Cas9, which is currently in preparation.
The author has made the most contributions to this study. Dr. J. W. van Dijk engineered citA –
citF mutant strains. Dr. F.-G Yu conducted genome annotation. The strain was provided by Dr.
Sherman.

- 13 -

Chapter 5 is incorporated from Yuan, B., Grau, M. F., Stajich J.E., Torok, T., Wang, C. C. C. Extend
the application of in vitro CRISPR-RNP system in Penicillium rubens and Scopulariopsis candida,
which is currently in preparation.
The author has made the most contributions to this study. Genome annotation and analysis was
conducted by J. E. Stajich. Strains were provided by Dr. T. Torok.

- 14 -

Chapter 2 _____________________________________________

Manipulation of the global regulator mcrA upregulates secondary
metabolite production in Aspergillus wentii using CRISPR-Cas9 with in
vitro-assembled ribonucleoproteins

2.1 Abstract

Genome sequencing of filamentous fungi has demonstrated that most secondary metabolite
biosynthetic gene clusters (BGCs) are silent under standard laboratory conditions. In this work,
we have established an in vitro CRISPR-Cas9 system in Aspergillus wentii. To activate otherwise
silent BGCs, we deleted the negative transcriptional regulator, mcrA. Deletion of mcrA (mcrAD)
resulted in differential production of 17 SMs in total when the strain was cultivated on potato
dextrose media (PDA). Nine out of 15 of these SMs were fully characterized, including emodin
(1), physcion (2), sulochrin (3), physcion bianthrone (4), 14-O-demethylsulochrin (5), (trans/cis)-
emodin bianthrone (6 and 7), and (trans/cis)-emodin physcion bianthrone (8 and 9). These
compounds were all found to be produced by the same polyketide synthase (PKS) BGC. We then
performed a secondary knockout targeting this PKS cluster in the mcrAD background. The
metabolite profile of the dual-knockout strain revealed new metabolites that were not previously
detected in the mcrAD parent strain. Two additional SMs were purified from the dual-knockout

- 15 -
strain and were characterized as aspergillus acid B (16) and a structurally related but previously
unidentified compound (17). For the first time, this work presents a facile genetic system capable
of targeted gene editing in A. wentii. This work also illustrates the utility of performing a dual
knockout to eliminate major metabolic products, enabling additional SM discovery.

2.2 Introduction

Secondary metabolites (SMs) produced by filamentous fungi often exhibit interesting and
potent bioactivities valuable to the pharmaceutical and food industries. Fungal SMs, for example,
exhibit antibiotic, anticancer, and immunosuppressive properties.
48,49
Initial efforts toward the
identification of novel fungal SMs relied on methods such as the one strain-many compounds
(OSMAC) approach.
18,19
However, the majority of SM biosynthetic gene clusters (BGCs) are silent
under normal laboratory growth conditions, which makes OSMAC only partially successful in
identifying new SMs. New techniques are needed to activate otherwise silent BGCs and express
and characterize their corresponding SMs. Several genomic approaches to activate SM BGCs have
been developed, including heterologous expression, promotor substitution, and overexpression
of transcription factors. Despite these advances, the activation of many SM BGCs and
identification of downstream products remains elusive, particularly for species without well-
developed molecular genetic systems.
1,50

The number of sequenced fungal genomes continues to increase, enabling genomic and
comparative genomics projects. The growth of these genomic resources is supported by efforts
such as the Fungal Genome Initiative
15
, 1000 Fungal Genomes Project,
16
the Y1000 project along
with hundreds of projects from individual labs and consortia. The genus Aspergillus has been

- 16 -
heavily studied and encompasses a diverse collection of globally distributed species that occupy
broad ecological niches.
51,52
Many genus-sequencing efforts have been devoted to studying
different Aspergillus species and the SMs they produce. Aspergilli were found to produce
valuable extracellular enzymes, pharmaceuticals (A. fumigatus and A. terreus), and toxic fungal
compounds such as aflatoxins (A. flavus and A. parasiticus).
53-55
However, genome sequencing
efforts have revealed that the number of predicted BGCs greatly exceeds the number of known
SMs, especially in some less well-studied species, such as Aspergillus wentii and Aspergillus
steynii.
56,57

Recently, molecular genetic tools have rapidly progressed to enable rapid and highly
programmable genome editing.
42,43
CRISPR (clustered regularly interspaced short palindromic
repeat)-Cas9 is one technique that has been successfully utilized in bacteria, fungi, and
mammalian cells to edit DNA sequences.
58
Cas9 is a DNA nuclease that cleaves target DNA
sequence by combining with a guide RNA (gRNA) to form a ribonucleoprotein (RNP) complex. The
gRNA consists of two parts: the CRISPR RNA (crRNA) and trans-activating CRISPR RNA (tracrRNA).
While tracrRNA remains unchanged, the crRNA contains a 20-base pair protospacer that can be
modified to complement a target gene. Prior to transformation, commercially available Cas9,
crRNA, and tracrRNA were rapidly assembled in vitro, which makes the transformation process
more efficient. The speed and efficiency of this CRISPR-RNP system has also been used to
engineer several fungal species such as Penicillium chrysogenum and Aspergillus niger.
59-61,65
To
ensure DNA cleavage, the protospacer is followed by a PAM (protospacer-adjacent motif)
sequence, which is typically NGG, where N is any nucleotide.
33,62
Following DNA cleavage, the
genome can be repaired through either the non-homologous end-joining (NHEJ) or homology-

- 17 -
directed repair (HDR) DNA-repair pathways. While NHEJ usually introduces short deletions or
insertions of genes to the target site, HDR integrates a repair template that is largely homologous
to the target gene. It has recently been demonstrated that the genome can also be repaired by
providing a microhomology template flanking the double-stranded break (DSB) site through
microhomology-mediated end joining (MMEJ).
43,63

In recent years, many regulators of secondary metabolism have been characterized in
Aspergillus species. Among them, global regulators such as laeA and mcrA have been noted for
their abilities to activate multiple SM BGCs simultaneously. McrA was found to encode a zinc-
finger transcription factor which was able to regulate multiple BGCs at once in previous
studies.
22,64
Deletion of mcrA in Aspergillus nidulans was found to upregulate over one thousand
genes, including those contained within ten BGCs. Given the highly conserved nature of mcrA and
its ability to regulate multiple BGCs simultaneously, the manipulation of the mcrA gene
represents an attractive method to activate BGCs in other filamentous fungi.
22

Although the genomes of thousands of fungal species have been sequenced, only a small
fraction have genetic tools developed to fully exploit their secondary metabolism potential. Some
wild-type fungal species have high resistance to indels (insertion or deletions of nucleotide bases)
introduced by NHEJ, and some strains require species-specific promoters for expressing Cas9.
65

Previous studies have illustrated that higher gene targeting efficiency was observed in Ku-
knockout strains, where Ku is a dimeric protein complex required for NHEJ.
41,66,67
Unfortunately,
deletion of Ku genes in a wild-type strain with low transformation efficiency sometimes can be
very difficult to achieve and requires laborious work for selecting correct transformants. As
genetic manipulation of wild-type fungal strains remains difficult, new methods are needed to

- 18 -
make programmable editing feasible and easy. As recent studies indicate that one can target
specific genes directly in wild-type fungal strains using in vitro-assembled Cas9-guide RNA
ribonucleoproteins coupled with microhomology repair templates,
33,43
we decided to apply this
new technique to Aspergillus wentii, which previously exhibited low transformation efficiency in
our laboratory using plasmid-facilitated CRISPR-Cas9.
In this work, we sequenced and annotated an A. wentii strain, established an in vitro CRISPR-
Cas9 system, deleted mcrA, and observed increased production of several metabolites produced
by this mutant strain. Nine of the 15 upregulated metabolites that were produced in sufficient
quantities for purification and characterization by NMR were found to be part of the
physcion/emodin pathway.
68,69
To isolate the other BGC products activated in the mcrA deletion
strain, we needed to divert the starter unit pool away from the physcion/emodin pathways by
eliminating physcion/emodin genes. We performed a second knockout targeting the PKS gene
involved in emodin biosynthesis in the mcrAΔ background using the same in vitro CRISPR
technique. By creating a dual-knockout A. wentii strain (mcrAD gedCD), six LCMS-detectable
metabolites found to have increased in the mcrAΔ strain disappeared, suggesting these are also
involved in the physcion/emodin pathway. Satisfyingly, two metabolites (Aspergillus acid B
(16)
70,71
and a structurally related new metabolite, designated Aspergillus acid E) could be
isolated and characterized from the dual-knockout strain. Our data show that compounds that
were upregulated by deletion of mcrA but were previously hidden due to overlap with the major
SMs upregulated, could be detected in the dual-knockout strain.
Our results indicate that this in vitro CRISPR-Cas9 system can be employed to generate dual
knockout mutants and enable direct hypothesis testing of genes involved in production of specific

- 19 -
SMs. This technique facilitated the upregulation, purification, and characterization of new
metabolites that have previously eluded identification. Finally, we show that wild-type fungal
species can be genetically accessed using the in vitro CRISPR-Cas9 system described in this study.

2.3 Results and Discussion

2.3.1 Establishment of an in-vitro CRISPR-Cas9 system in A. wentii by targeting the pksP
melanin gene

To assess the transformation efficiency for A. wentii using our in vitro CRISPR-Cas9 system,
we targeted the homolog of a pigment-associated gene, pksP, that was first discovered in A.
fumigatus (Afu2g17600). Since the gene is involved in dihydroxy naphthalene (DHN)-melanin
biosynthesis, targeting pksP allows us to evaluate CRISPR-Cas9 efficiency by selecting
transformants that are antibiotic resistant and determining the fraction of transformants that are
white. The melanin metabolite imparts a grey-greenish color to A. fumigatus conidia, while it may
also account for a yellow-brownish color in other species.
72,73
The homolog of pksP was identified
in the A. wentii genome by searching the annotated proteins with the Afu2g17600 protein
sequence using BLASTp (RRID:SCR_001010). Each domain within this gene was carefully analyzed
to confirm its identity.
Different from plasmid-facilitated CRISPR-Cas9, which usually results in deletions or insertion
of a few nucleotides through NHEJ, the in vitro CRISPR-Cas9 system we utilized is predicted to
delete the entire coding region of the gene through MMEJ. We designed two crRNAs targeting
the 5¢ untranslated region (UTR) and 3¢ UTR of pksP separately. Both targeting sites were followed
by functional PAM (NGG) sequences to permit Cas9 cleavage. To minimize off-target effects, we
performed a BLAST analysis for the protospacer sequences within the A. wentii genome. The

- 20 -
chosen protospacers adjacent to the PAMs were close (within the first three nucleotides) to the
start and stop codons, with no obvious off-targets being identified.
Wild-type fungal strains with intact Ku genes favor NHEJ repair over homologous
recombination (HR) following DNA double-strand breaks.
41,67
However, the efficiency of gene
replacement in wild-type strains can be improved by simultaneous two-site CRISPR cuts (at the
5¢ and 3¢ UTRs) with a repair template containing a proper selection marker.
43,74
Phleomycin and
hygromycin B were chosen as selection markers for A. wentii based on the sensitivity of the strain
to these chemicals. Antibiotic resistance tests were performed in order to determine the
effective concentrations of each antibiotic. 1.0 ´ 10
6
wild-type A. wentii protoplasts were
inoculated onto agar plates containing various phleomycin or hygromycin concentrations (0, 0.01,
0.05, 0.1, 0.2, 0.3 mg/mL). The minimum effective concentration that inhibits growth was found
to be 0.1 mg/mL for phleomycin and 0.3 mg/mL for hygromycin B (Supplemental Figure 2.5 and
2.6). As the wild-type A. wentii is more resistant to Hygromycin B, we decided to use a phleomycin
cassette as a selection marker for the first transformation targeting pksP. The repair template
containing a phleomycin resistance gene (blue) and 50 bp homologous flanking sequences were
amplified via PCR (Figure 2.1).
The transformation was performed according to a slightly modified protocol for Aspergillus
fumigatus.
43
All transformants that appeared after four days on agar plates containing
phleomycin were white and these were re-streaked on the day after. All the restreaked
transformants produced white colonies after a five-day incubation. Nested primers were
designed to amplify the pksP sequence in both wild type and mutants. PksP amplicons were 6.8
kb and 1.6 kb for the wild-type and mutant strains, respectively. We determined that 1.6 kb is

- 21 -
the combined length of bleR and the homologous flanking regions. The gene replacement
efficiency was 100% among the six chosen colonies (Supplemental Figure 2.7). These results
indicate that CRISPR-Cas9 with in vitro-assembled RNPs can be applied to wild-type A. wentii
resulting in exceptionally high gene targeting efficiency.

Figure 2.1: Overview of gene replacement coupled with in vitro-assembled RNP cleavage. (A)
Replacement of pksP with an antibiotic resistance gene by in vitro CRISPR coupled with dual Cas9 RNP
cleavage. Dual crRNAs targeting the beginning and the end of pksP were assembled separately with
tracrRNAs to become sgRNAs. Two sgRNAs were then assembled with Cas9 to form the RNP. The repair
template, consisting of a phleomycin resistance gene (1477 bp), was amplified from plasmid pFC333.
Wild-type A. wentii protoplasts were transformed with the RNPs together with the repair template.
(B) The pksP gene in A. wentii was replaced by the phleomycin selection marker through DNA cleavages
induced by the Cas9 RNP. The resulting white transformants, with the phleomycin resistance marker,
were able to grow on media containing phleomycin.

- 22 -

2.3.2 McrA deletion results in upregulation of secondary metabolite production

To activate silent BGCs in A. wentii, we deleted the entire coding region of the master
negative regulator, mcrA. We used the A. nidulans mcrA (AN8694) protein sequence to locate the
gene within the A. wentii genome via BLASTp. Because the in vitro CRISPR-Cas9 system had been
verified as described above, we performed the same process for designing crRNAs targeting mcrA
and the homologous repair template containing bleR with modification in the flanking tails.
Following A. wentii inoculation and transformation, colonies that appeared after six days
were restreaked to new agar plates and allowed to grow for five more days. A new set of nested
primers was designed for verifying the deletion of mcrA. Because the total length of mcrA and
bleR amplicons are similar (2.3 kb and 2.4 kb, respectively), we designed the forward primer to
bind to a sequence within the mcrA coding region, and the reverse primer to bind within the
repair template. Therefore, only the mutant strains with correct gene replacement would
generate amplicons using the designed primers.
Following PCR amplification, no band was observed in wild-type A. wentii, as expected. Three
out of eight restreaked transformants also did not generate any amplicons. The remaining
transformants generated amplicons of the expected size (Supplemental Figure 2.8). Therefore,
the gene replacement efficiency targeting mcrA is approximately 62.5%. The discrepancy in the
knockout efficiency between targeting pksP and mcrA may have been caused by the retarded
growth of the mcrAD strain. The mcrA mutant colonies appeared on phleomycin-containing
plates one day later than the pksP mutants, which allowed an extra day for wild-type colonies to
grow. However, the gene targeting efficiency remains high, especially when considering that the
strain is not NHEJ-deficient.

- 23 -

To examine the effect that an mcrA deletion has on the secondary metabolite profile of A.
wentii, we cultivated the wild-type and mcrAD strains separately in potato dextrose agar (PDA).
We extracted SMs of both the wild-type and mcrAD strains from solid PDA plates and analyzed
the extracts through HPLC-DAD-MS. Comparative metabolic analysis revealed an increase in the
production of several metabolites (Figure 2.2). To identify these upregulated metabolites, the
mcrAD strain was scaled up in 100 plates with 20 mL solid PDA per plate. Subsequent solid-liquid
extraction, column chromatography, and HPLC permitted isolation of each upregulated
compound. Nuclear magnetic resonance (NMR) analysis led to the identification of nine
metabolites, all related to the physcion/emodin biosynthetic pathway,
68
including emodin (1),
physcion (2), sulochrin (3), physcion bianthrone (4), 14-O-demethylsulochrin (5), (trans/cis)-
Figure 2.2: Paired HPLC profiles of A. wentii (wild type, mcrAD, and mcrAD gedCD dual knockout
strains) extracts when grown on a solid PDA medium. (i) wild type, (ii) mcrAD, and (iii) mcrAD gedCD
dual knockout strains. Compounds 1 – 15 are gedC related, while compounds 16 and 17 are additional
metabolites revealed in the dual knockout strain.

- 24 -
emodin bianthrone (6 and 7), (trans/cis)-emodin physcion bianthrone (8 and 9) (Figure 2.3,
supplemental Figure 2.10-2.18). The results confirm that mcrA is capable of modulating SM
production in A. wentii. Manipulation of mcrA opens opportunities for more fungal SMs discovery.

2.3.3 McrA/gedC homolog double-knockout reveals additional upregulated SMs

Several compounds that appeared to be unrelated to the physcion/emodin pathway were
also detected by HPLC-DAD-MS analysis of the mcrAD strain. Because the amount of these
Figure 2.3: Chemical structures of the upregulated compounds in the A. wentii mcrAΔ strain. Emodin
(1), physcion (2), sulochrin (3), physcion bianthrone (4), 14-O-demethylsulochrin (5), (trans)-emodin
bianthrone (6), (cis)-emodin bianthrone (7), (trans)-emodin physcion bianthrone (8), (cis)-emodin
physcion bianthrone (9).

- 25 -
metabolites was relatively low compared to physcion/emodin-related compounds, we decided
to perform a secondary knockout, targeting the physcion/emodin gene cluster in the mcrAD
strain parent. We used gedC (ATEG_08451), a gene encoding the polyketide synthase (PKS) that
synthesizes a backbone precursor of geodin in A. terreus as a probe, to locate the
physcion/emodin gene cluster in A. wentii.
69
The proposed biosynthetic pathway of geodin
involves intermediates such as emodin and sulochrin that were previously detected in the mcrAD
strain. Geodin itself was not detected among the upregulated SMs and the biosynthetic genes
that directly form geodin such as gedL and gedJ were also missing in the A. wentii genome,
suggesting that different final compounds might be produced (Supplemental Table 2.3). We
designed crRNAs targeting the gedC homolog and amplified the repair template for hygromycin
B (hygR) as a second selection marker. Transformed colonies appeared after six days, which were
restreaked on plates containing 0.3 mg/mL hygromycin B. Successful gene replacement in
transformants was confirmed by PCR amplification using nested primers (Supplemental Figure
2.9). Seven out of nine restreaked colonies generated amplicons of the expected size (2.9kb) (a
78% gene replacement efficiency). The dual-knockout transformants carrying deletions of both
mcrA and gedC were able to grow on plates containing both phleomycin and hygromycin B.
We then cultured the wild type, mcrAD, and mcrAD gedCD double knockout strains on solid
PDA plates and extracted SM from the agar plates. As anticipated, the gedC-related compounds
were not detected, and several additional metabolites were revealed (Figure 2.2). We then
performed a scale-up of the mcrAD gedCD strain. Two major compounds that were upregulated
were purified and identified as aspergillus acid B (16)
70,71
(Figure 4) and a structurally related new
compound that we designate aspergillus acid E (17) (Figure 2.4, Supplemental Figure 2.19-2.22).

- 26 -
These two compounds were originally produced in low quantities and co-eluted with physcion
bianthrone (4), which allowed them to evade detection in the mcrAD mutant. Aspergillus acids B
and E are found to be structurally related to the monomers that produce scytalidin and zopfiellin,
which belong to an important class of natural products containing maleic anhydride moieties
(Supplemental Table 2.4).
75,76

With an additional selection marker, one can perform a second knockout targeting a different
gene on a previously manipulated strain without sacrificing the transformation efficiency rate. As
deletion of mcrA usually upregulates different BGCs, a dual-knockout CRISPR opens the
opportunities of characterizing more SMs that have previously eluded identification due to
overlapping with major compounds. Previous work has revealed that different compounds are
upregulated on different carbon sources in an A. nidulans mcrA-deletion strain.
22
Experiments
focusing on purifying and identifying additional SMs produced by A. wentii mutant strains under
different growth media conditions are ongoing and will be reported in due course.

2.4 Conclusion

We successfully applied an in vitro CRISPR-Cas9 technique to genetically engineer a wild-type
A. wentii strain that previously exhibited low gene targeting efficiency via plasmid-facilitated
Figure 2.4: Chemical structures of compound 16 (Aspergillus acid B) and compound 17 (Aspergillus
acid E) as determined by NMR.

- 27 -
CRISPR-Cas9. We deleted mcrA through MMEJ and examined its effect on secondary metabolism
through metabolic profiling. Nine of 15 upregulated SMs were characterized through NMR,
including emodin (1), physcion (2), sulochrin (3), physcion bianthrone (4), 14-O-
demethylsulochrin (5), (trans/cis)-emodin bianthrone (6 and 7), (trans/cis)-emodin physcion
bianthrone (8 and 9). The six additional metabolites were also revealed to be related to the
physcion/emodin pathway by performing a second knockout targeting the physcion/emodin
gene cluster. As production of the 15 upregulated SMs was abated in the dual-knockout strain,
additional metabolites that were previously undetectable were revealed. By analyzing the dual-
knockout strain, two more SMs were purified and identified as aspergillus acid B (16), and a new,
structurally-related compound designated aspergillus acid E (17). Overall, our results indicate
that in vitro CRISPR-Cas9 systems can be highly successful in wild-type Aspergilli. This method
allows the wild-type fungal species to be genetically accessed, bypassing the disruption of Ku
genes, which makes gene edits easier and faster to achieve. Once the in vitro CRISPR-Cas9 system
is established in a wild-type species, the strain might be adapted to multi-gene knockouts, and
therefore synergetic effects of two or multiple genes can be examined straightforwardly. It might
be critical to generate transformation protocols using recycled markers, so the in vitro CRISPR
system established would not be limited by the number of selection markers that can be applied
to the target strains. Based on our results, generating a dual-knockout strain and eliminating the
major compounds produced is beneficial for detection and isolation of new compounds in
filamentous fungi.

- 28 -
2.5 Methods

2.5.1 Genome Assembly and Annotation.

For five days, wild-type Aspergillus wentii (IMI 49129) was cultured on potato dextrose agar
(PDA). The spore suspension was harvested using ST buffer (8.5 g L
–1
NaCl, 1mL L
–1
Tween 80).
DNA extraction of fresh spores was performed using Qiagen DNeasy PowerLyzer Microbial Kit
through the standard protocol. The quality of the extracted DNA and the final concentration were
tested using Nanodrop (Thermo Scientifics NanoDrop 2000c Spectrophometer). Approximately
50 μL of DNA sample (50.9 ng/μL) was sent to Novogene for Illumina NovaSeq sequencing.
After retrieving the raw sequencing results from Novogene, downstream genome analysis
was performed at the High-Performance Computing Center (HPCC) at UC Riverside
(https://hpcc.ucr.edu). The fungal genome was assembled through AAFTF (v0.2.0), which relies
on trimmomatic v0.36 to trim reads and bowtie v 2.3.4.1 to filter against a databases of
contaminants, assemble reads with SPAdes (v 3.12.0), remove vector sequences by BLASTN
against a vector sequence databases, filter bacteria contamination with sourmash (v3.5.0), and
polish the assembly with the short reads using pilon.
77-79
The final assembly was masked with
RepeatMasker (v. open-1.0.11) and annotated with the Funannotate pipeline (v1.5.0).
80,81
This
approach uses HISAT2 (v2.2.1), Trinity (v2.11.0) and PASA (v2.4.1) to predict genes and identify
homology for functional annotation.
82-84
The annotated genome was analyzed with antiSMASH
(v4.1.0) to search for SM gene clusters.
85
The sequence reads, assembly, and annotation of the
strain were deposited at NCBI GenBank under Bioproject PRJNA826222. The genome
characteristics and predicted clusters were summarized in the Supplemental Table 1 and 2.

- 29 -

2.5.2 Molecular Genetic Procedures.

Phleomycin and hygromycin B resistance cassettes were used as selection markers in this
work. A 1,477-bp BleR microhomology repair template spanning 320 bp of the trpC promoter,
375 bp of the phleomycin resistance cassette, and 782 bp of the trpC terminator was amplified
from pFc333 through PCR using primers containing 50 bp flanking regions (Supplemental Table
2.5). A 1,375-bp HygR microhomology repair template, which spans 320 bp of the trpC promoter
and 1,020 bp of the hygromycin B resistance cassette, was amplified from pFc332. The PCR
products were purified by gel extraction and eluted with Elution Buffer (Qiagen, Cat. No. 19086).
The Cas9-gRNA ribonucleoprotein complexes were assembled with Alt-R-CRISPR-Cas9
components from Integrated DNA Technologies (IDT). The designed crRNA and universal
tracrRNA were prepared as 100 µM stock solutions and stored at -20°C until use. The Cas9
nuclease was diluted to 1 µg/µL using nuclease-free Cas9 working buffer (20 mM HEPES, 150 mM
KCl, pH 7.5) and stored at -20°C. The guide RNA duplex was assembled by mixing crRNA and
tracrRNA in equal molar concentrations to reach a final concentration of 33 µM (Figure 2.1). The
mixtures were heated at 95°C for 5 min and cooled to room temperature. The final duplex was
stored at -20°C until use. The Cas9 RNP complexes were generated by combining 1.5 μL of each
gRNA duplex separately with 0.75 μL of Cas9 and 11 μL of nuclease-free Cas9 working buffer. The
mixtures were incubated at room temperature for 5 min to form the RNP complexes. Two RNP
complexes were combined to form a final volume of 26.5 μL before they were added to A. wentii
protoplasts during transformation.

- 30 -
2.5.3 Transformation of A. wentii.

Fresh spores of wild-type A. wentii were harvested from PDA plates. 1 × 10
8
spores of A. wentii
were inoculated into 50 mL of Potato Dextrose Broth (PDB) in a 250 mL flask and incubated
overnight at 30°C with shaking at 135 rpm. Mycelia were harvested through filtration and
resuspended in protoplasting buffer. The protoplasting buffer was prepared by adding 1.2 g of
VinoTaste Pro (VTP) in 20 mL of 1.1M KCl, 0.39M citric acid monohydrate buffer (pH 5.8, adjusted
with 1.1M KOH). After vortexing for 15 minutes, the protoplasting buffer was centrifuged for 15
minutes at 1800 g. The supernatant was filter-sterilized into a 50 mL flask together with the
filtered mycelia. The flask was incubated at 30°C with shaking at 100 rpm for 4 hours. 5 mL of the
protoplast suspension was transferred into a 15 mL tube and gently overlaid with 5 mL 0.4 M ST
(0.4 M D-sorbitol, 100 mM Tris-HCl, pH 8). Protoplasts were separated from the mycelial debris
by centrifuging for 15 min at 4 °C and 800 g. The protoplast layer at the interface was collected
and transferred into a new tube. After gently adding 15 mL ST (1.0 M D-sorbitol, 50 mM Tris-HCl,
pH 8), the solution was centrifuged at room temperature at 800 g for 10 min. The pellet was
washed with 10 mL ST and centrifuged at room temperature at 800 g for 10 min. The protoplast
pellet was resuspended in STC buffer (1.0 M D-sorbitol, 50 mM CaCl 2, 50 mM Tris-HCl, pH 8), and
100 μL (approximately 1.0 ´ 10
6
) of protoplasts were transferred to the tube containing Cas9 RNP
mixture (26.5 µL). 3 µg of the purified repair template and 25 µL of polyethylene glycol (PEG)-
CaCl 2 buffer (40% [wt/vol] PEG 3350, 50 mM CaCl 2, 50 mM Tris-HCl, pH 8) was added immediately
after transferring protoplasts. The mixture was incubated on ice for 50 min. After adding 1.25 mL
PEG-CaCl 2, the mixture was then incubated at room temperature for 20 min. By adding STC buffer,
the mixture was brought to 2 mL, and 500 μL of suspension was spread on SMM agar plates

- 31 -
(GMM supplemented with 1.2 M sorbitol, 1.5% [wt/vol] agar). The agar plates were incubated at
room temperature overnight, and the second layer of SMM top agar (GMM supplemented with
1.2 M sorbitol, 0.7% [wt/vol] agar) containing the selected antibiotic was overlaid. The plates
were incubated at 30°C for 4 days for spore generation.

2.5.4 Culturing and HPLC-DAD-MS Analysis.

A. wentii strains were incubated at 30°C on PDA (Difco™ Potato Dextrose Agar) plates. 1.0 ´
10
7
spores were inoculated on each plate, and 5 plugs (7 mm diameter) were cut out for
compound extraction after 5 days of culturing. The agar plugs were extracted with 5 mL of
methanol with 1 h of sonication. The extract was collected, and the agar plugs were extracted
with 5 mL of dichloromethane: methanol (1:1) followed by another 1 h of sonication. The extract
was collected into the same clean vial, and the solvent was evaporated through TurboVap LV
(Caliper LifeSciences). The solid residues were dissolved in equal amounts (10 mL) of EtOAc and
water. The EtOAc layer was collected and evaporated with a TurboVap LV. The final extract was
redissolved in 400 μL of DMSO:MeOH (1:4), and 10 μL was injected into LC-DAD-MS for analysis.
To obtain LC/MS spectra, we used a ThermoFinnigan LCQ Advantage ion trap mass spectrometer
with a reversed phase C 18 column (Alltech Prevail C 18; column, 2.1 by 100 mm; particle size, 3 μm;
flow rate 125 μL min
-1
). The solvent A was 5% MeCN−H 2O, and the solvent B was 95% MeCN−H 2O.
Both solvents contained 0.05% formic acid. The solvent gradient was as follows: 100% solvent A
from 0 to 5 min, 0 to 25% solvent B from 5 to 6 min, 25 to 100% solvent B from 6 to 35 min, 100%
solvent B from 35 to 40 min, 100 to 0% solvent B from 40 to 45 min, and re-equilibration with
100% solvent A from 45 to 50 min. The MS included a 5.0 kV capillary voltage, 60-arbitrary units

- 32 -
flow rate of the sheath gas, 10-arbitrary units of the auxiliary gas, and 350°C of the ion transfer
capillary temperature.

2.5.5 Compound Purification and Characterization.

A. wentii strains were cultured in 40 ´ 150mm diameter Petri dishes with a total volume of
2L of PDA medium at 30°C for 5 days. The agar was chopped into pieces and extracted with
methanol and dichloromethane: methanol (1:1) followed by 1 h of sonication as described above.
The residue was extracted three times with EtOAc, and the combined EtOAc layers were
evaporated in vacuo to yield a crude extract. Silica gel column chromatography was performed
using dichloromethane and methanol as eluent (starting with 100% dichloromethane). Each
fraction was further separated through preparative HPLC [Phenomenex Luna 5 μm C 18 (2), 250
´ 21.2; flow rate of 5.0 mL min
−1
; UV detector at 280 nm]. Nuclear Magnetic Resonance (NMR)
spectral analysis was performed using a Varian Mercury Plus 400 spectrometer. High-resolution
electrospray ionization mass spectra (HRESIMS) were obtained on a Thermo Scientific Q Exactive
Hybrid Quadrupole-Orbitrap mass spectrometer at a flow rate of 5 μL min
−1
. MS conditions
included a spray voltage of 5 kV, sheath gas flow rate at 15 au, auxiliary gas flow rate at 5 au,
capillary temperature at 320 °C, s-lens RF level 60, scan range of 100.0−500.0 m/z, resolution 140,
000, AGC target 5 × 10
5
, and maximum injection time of 50 ms.

2-Tetradec-(17-acetoxy) yl-3-methylmaleic Anhydride (Aspergillus acid E) (17). White Powder; UV
λ max
MeOH
nm: 239, 250;
1
H NMR (CDCl 3): δ 1.25 (br s, 20H), 1.53−1.63 (m, 4H), 2.04 (s, 3H), 2.07
(s, 3H), 2.45 (t, J = 6 Hz, 2H), 4.05 (t, J=6 Hz, 2H);
13
C NMR (CDCl 3): δ 9.5, 21.0, 24.4, 25.8, 27.5,
28.6, 29.2-29.5 (9 ´ CH 2), 64.6, 140.4, 144.7,165.8, 166.2, 171.2. See Supplemental Figure 19 for

- 33 -
UV and ESIMS spectrum; HRESIMS obtained m/z [M + H]
+
= 367.2487 (calcd 367.2485 for
C 21H 35O 5).

- 34 -
2.6 Supporting Information

Supplemental Table 2.1: Genome assembly characteristics of Aspergillus wentii IMI 49129.

- 35 -
Supplemental Table 2.2: Secondary metabolite clusters predicted by antismash v4.1.0.

- 36 -
Supplemental Table 2.3: Cluster comparison of geodin between A. terreus and A. wentii.

*Per. Ident (Percent Identity): A number that describes the extent to which two aligned
sequences have the same exact nucleotides or amino acids in the same positions.

- 37 -
Supplemental Table 2.4: Cluster comparisons of scytalidin in Scytalidium album, zopfiellin in
Diffractella curvata, and homolog in A. wentii.

- 38 -
Supplemental Table 2.5: Primers used in this study.

Primer Sequence (5' → 3')
Primers used for amplifying sgRNA fragments
PksP_FW

AAGGTTCAAATTTCTGCGACAGTTGACTGACGAACGGCCTTCCCCCTAAG
GCTAGTGGAGGTCAACACAT
PksP_REV

AAACTCCAATAAGAAAGAAGAGTGAAAGAGTGAGAAACGAGGAACAGC
CTATGCGGTAGTGGGGATTTAC

McrA_FW

AATTATACACGCACTACTACATCCACTACTGACTTTCCCCCCCTGCCTGTG
CTAGTGGAGGTCAACACAT

McrA_REV

TCGTCCAATGACATCATTCGCTCCAAAGCCATCTCTCAGCCTCTAATCCAA
TGCGGTAGTGGGGATTTAC

GedC_FW

CAGCAATGGTAGCATCTTCAACCTCTTCCTTATCCTCGCCTTCTTTCGACGC
TAGTGGAGGTCAACACAT

GedC_REV

AAAAACAAAATACCCCAACATGAAAACAATCTAGCTGTAGTACTCCTCCA
CTTAATGCGGTAGTGGGGAT
Primers used for sequencing mutant strains

PksP_seq_FW

GAAGAGTGAAAGAGTGAG

PksP_seq_REV GGCAAGGATGTATTGTTC

McrA_seq_FW1 CGACCTCAATTTGCTTCG

McrA_seq_REV1 TATCCTCACGTCATACCC

McrA_seq_FW2 CGACCTCAATTTGCTTCGAG

McrA_seq_REV2 CCTGTGCTAGTGGAGGTCAA

GedC_seq_FW GTTCTGGCCTCATCACACAT

GedC_seq_REV AACCAACTAGCTGACTAGGC

- 39 -

Supplemental Figure 2.5: Antibiotic sensitivity test of A. wentii against phleomycin. The minimum
inhibitory concentration was determined to be 0.1 mg/mL of phleomycin.

0 0.01 0.05
0.1 0.2 0.3

- 40 -

Supplemental Figure 2.6: Antibiotic sensitivity test of A. wentii against hygromycin B. The
minimum inhibitory concentration was determined to be 0.3 mg/mL of hygromycin B.

0 0.01 0.05
0.1 0.2 0.3

- 41 -

Supplemental Figure 2.7: Results of diagnostic PCR of the pksP coding region in wild type and
pksPD strains of A. wentii.

- 42 -

Supplemental Figure 2.8: Results of diagnostic PCR amplification of the mcrA coding region in
wild type and mcrAD strains of A. wentii. (i) Both nested primers were located within the A. wentii
genome. The total lengths of the amplified regions were similar between WT and mcrAD (2.3kb
and 2.4kb, respectively). (ii) (iii) New forward primer (McrA_seq_FW2) bound to the sequence
within the mcrA coding region, while the new reverse primer (McrA_seq_REV2) bound to the
sequence within the repair template. Only the mcrAD mutant with the correct gene replacement
could generate a band around 2kb.

(ii) (i)
(iii)

- 43 -

Supplemental Figure 2.9: Results of the PCR amplification of physcion/emodin gedC coding
region in wild type, mcrAD strains, and mcrAD gedCD strains of A. wentii. Both wild type and
mcrAD have an intact gedC band around 7kb, while the dual-knockout strains have a band around
2.9kb.

- 44 -

Supplemental Figure 2.10:
1
H NMR spectrum of emodin (1) in acetone-d 6 (400 MHz).

1 . 0 1 . 5 2 . 0 2 . 5 3 . 0 3 . 5 4 . 0 4 . 5 5 . 0 5 . 5 6 . 0 6 . 5 7 . 0 7 . 5 8 . 0 8 . 5 9 . 0 9 . 5 1 0 . 0 1 0 . 5 1 1 . 0
f 1 ( p p m )
3 . 1 2
0 . 9 1
0 . 9 3
0 . 9 9
1 . 0 0
2 . 0 4 a c e t o n e
2 . 0 5 a c e t o n e
2 . 0 5 a c e t o n e
2 . 0 6 a c e t o n e
2 . 0 6 a c e t o n e
2 . 0 7 a c e t o n e
2 . 0 7 a c e t o n e
2 . 4 6
6 . 7 1
6 . 7 1
7 . 1 3
7 . 2 7
7 . 2 8
7 . 5 6

- 45 -

Supplemental Figure 2.11:
1
H NMR spectrum of physcion (2) in acetone-d 6 (400 MHz).

1 . 0 1 . 5 2 . 0 2 . 5 3 . 0 3 . 5 4 . 0 4 . 5 5 . 0 5 . 5 6 . 0 6 . 5 7 . 0 7 . 5 8 . 0 8 . 5 9 . 0 9 . 5 1 0 . 0
f 1 ( p p m )
3 . 9 2
3 . 8 0
0 . 8 9
1 . 0 5
0 . 9 7
1 . 1 0
2 . 0 4 a c e t o n e
2 . 0 5 a c e t o n e
2 . 0 5 a c e t o n e
2 . 0 6 a c e t o n e
2 . 0 6 a c e t o n e
2 . 0 7 a c e t o n e
2 . 0 7 a c e t o n e
2 . 4 8
2 . 8 6 H 2 O
4 . 0 2
6 . 8 1
6 . 8 2
7 . 1 8
7 . 2 9
7 . 3 0
7 . 6 1

- 46 -

Supplemental Figure 2.12:
1
H NMR spectrum of sulochrin (3) in DMSO-d 6 (400 MHz).

1 . 0 1 . 5 2 . 0 2 . 5 3 . 0 3 . 5 4 . 0 4 . 5 5 . 0 5 . 5 6 . 0 6 . 5 7 . 0 7 . 5 8 . 0 8 . 5 9 . 0 9 . 5 1 0 . 0 1 0 . 5 1 1 . 0 1 1 . 5 1 2 . 0 1 2 . 5
f 1 ( p p m )
2 . 9 9
3 . 1 6
3 . 1 4
1 . 9 8
0 . 9 8
0 . 9 8
0 . 8 1
1 . 7 8
2 . 1 3
2 . 4 7 d m s o
2 . 4 8 d m s o
2 . 4 8 d m s o
2 . 4 9 d m s o
2 . 4 9 d m s o
3 . 6 2
3 . 6 3 H 2 O
3 . 7 5
6 . 0 7
6 . 6 0
6 . 6 1
6 . 8 5
6 . 8 6
9 . 9 4
1 1 . 4 1

- 47 -

Supplemental Figure 2.13:
1
H NMR spectrum of physcion bianthrone (4) in chloroform-d (400
MHz).

1 . 0 1 . 5 2 . 0 2 . 5 3 . 0 3 . 5 4 . 0 4 . 5 5 . 0 5 . 5 6 . 0 6 . 5 7 . 0 7 . 5 8 . 0 8 . 5 9 . 0 9 . 5 1 0 . 0 1 0 . 5 1 1 . 0 1 1 . 5 1 2 . 0 1 2 . 5 1 3 . 0 1 3 . 5
f 1 ( p p m )
6 . 9 3
7 . 0 6
2 . 2 5
2 . 0 5
2 . 1 1
2 . 0 9
2 . 0 9
0 . 9 1
0 . 8 0
0 . 8 3
0 . 8 8
1 . 5 6 H 2 O
2 . 2 9
2 . 3 1
3 . 8 2
3 . 8 4
4 . 3 4
4 . 3 5
5 . 9 7
5 . 9 7
6 . 0 0
6 . 0 1
6 . 1 0
6 . 1 2
6 . 3 5
6 . 3 6
6 . 3 8
6 . 3 8
6 . 6 8
6 . 7 0
7 . 2 6 c d c l 3
1 1 . 8 2
1 1 . 8 8
1 2 . 1 3
1 2 . 1 8

- 48 -

Supplemental Figure 2.14:
1
H NMR spectrum of 14-O-demethylsulochrin (5) in DMSO-d 6 (400
MHz).

2 . 0 2 . 5 3 . 0 3 . 5 4 . 0 4 . 5 5 . 0 5 . 5 6 . 0 6 . 5 7 . 0 7 . 5 8 . 0 8 . 5 9 . 0 9 . 5 1 0 . 0 1 0 . 5 1 1 . 0 1 1 . 5 1 2 . 0 1 2 . 5 1 3 . 0
f 1 ( p p m )
7 . 3 0
5 . 1 8
5 . 8 2
2 . 7 7
2 . 0 4
0 . 8 4
3 . 8 0
1 . 0 5
2 . 1 3
2 . 4 7 d m s o
2 . 4 8 d m s o
2 . 4 8 d m s o
2 . 4 9 d m s o
2 . 4 9 d m s o
3 . 8 5
6 . 0 6
6 . 4 8
6 . 4 9
6 . 7 3
6 . 7 4
9 . 7 1
1 1 . 4 0
1 2 . 2 7

- 49 -

Supplemental Figure 2.15:
1
H NMR spectrum of (trans)-emodin bianthrone (6) in acetone-d 6
(400 MHz).

1 . 0 1 . 5 2 . 0 2 . 5 3 . 0 3 . 5 4 . 0 4 . 5 5 . 0 5 . 5 6 . 0 6 . 5 7 . 0 7 . 5 8 . 0 8 . 5 9 . 0 9 . 5 1 0 . 0 1 0 . 5 1 1 . 0 1 1 . 5 1 2 . 0 1 2 . 5
f 1 ( p p m )
1 0 . 9 7
3 . 1 0
2 . 8 5
3 . 1 3
2 . 8 9
3 . 0 7
0 . 9 1
1 . 0 5
2 . 0 4
2 . 0 5
2 . 0 5
2 . 0 6
2 . 0 6
2 . 0 9
2 . 2 0
4 . 5 4
5 . 9 1
6 . 3 6
6 . 3 7
6 . 5 8
6 . 7 0
1 1 . 8 0
1 2 . 0 9

- 50 -

Supplemental Figure 2.16:
1
H NMR spectrum of (cis)-emodin bianthrone (7) in acetone-d 6 (400
MHz).

1 . 0 1 . 5 2 . 0 2 . 5 3 . 0 3 . 5 4 . 0 4 . 5 5 . 0 5 . 5 6 . 0 6 . 5 7 . 0 7 . 5 8 . 0 8 . 5 9 . 0 9 . 5 1 0 . 0 1 0 . 5 1 1 . 0 1 1 . 5 1 2 . 0 1 2 . 5
f 1 ( p p m )
1 0 . 6 4
3 . 0 8
9 . 0 4
2 . 9 5
1 . 0 1
0 . 9 2
2 . 0 4
2 . 0 5
2 . 0 5
2 . 0 6
2 . 0 6
2 . 0 7
2 . 3 0
4 . 5 2
6 . 2 3
6 . 2 7
6 . 2 7
6 . 3 1
6 . 6 7
1 1 . 9 1
1 1 . 9 9

- 51 -

Supplemental Figure 2.17:
1
H NMR spectrum of (trans)-emodin physcion bianthrone (8) in
acetone-d 6 (400 MHz).

1 . 0 1 . 5 2 . 0 2 . 5 3 . 0 3 . 5 4 . 0 4 . 5 5 . 0 5 . 5 6 . 0 6 . 5 7 . 0 7 . 5 8 . 0 8 . 5 9 . 0 9 . 5 1 0 . 0 1 0 . 5 1 1 . 0 1 1 . 5 1 2 . 0 1 2 . 5
f 1 ( p p m )
7 . 8 0
3 . 7 1
0 . 9 6
1 . 0 5
0 . 8 5
0 . 9 8
0 . 8 6
0 . 9 5
3 . 2 1
1 . 3 4
2 . 0 4
2 . 0 5
2 . 0 5
2 . 0 6
2 . 0 6
2 . 0 7
2 . 2 1
2 . 2 3
3 . 9 5
4 . 5 6
4 . 5 7
4 . 6 1
4 . 6 2
5 . 9 5
6 . 0 3
6 . 3 7
6 . 3 7
6 . 4 3
6 . 4 4
6 . 6 0
6 . 6 1
6 . 6 3
6 . 6 8
1 1 . 7 3
1 1 . 8 2
1 2 . 0 4
1 2 . 0 5

- 52 -

Supplemental Figure 2.18:
1
H NMR spectrum of (cis)-emodin physcion bianthrone (9) in acetone-
d 6 (400 MHz).

1 . 0 1 . 5 2 . 0 2 . 5 3 . 0 3 . 5 4 . 0 4 . 5 5 . 0 5 . 5 6 . 0 6 . 5 7 . 0 7 . 5 8 . 0 8 . 5 9 . 0 9 . 5 1 0 . 0 1 0 . 5 1 1 . 0 1 1 . 5 1 2 . 0 1 2 . 5
f 1 ( p p m )
4 . 1 3
3 . 7 4
3 . 7 1
0 . 8 4
1 . 0 2
1 . 8 8
2 . 1 5
0 . 9 7
0 . 9 7
1 . 1 8
1 . 1 3
2 . 0 4
2 . 0 5
2 . 0 5
2 . 0 6
2 . 0 6
2 . 0 7
2 . 2 4
2 . 3 5
3 . 8 2
3 . 8 9
4 . 5 3
4 . 5 4
4 . 6 0
4 . 6 1
6 . 0 6
6 . 0 9
6 . 3 1
6 . 3 2
6 . 3 3
6 . 3 3
6 . 4 3
6 . 5 7
6 . 6 4
6 . 7 3
1 1 . 8 4
1 1 . 8 6
1 2 . 0 0

- 53 -

Supplemental Figure 2.19:
1
H NMR spectrum of Aspergillus acid B (16) in chloroform-d (400 MHz).

0 . 0 0 . 5 1 . 0 1 . 5 2 . 0 2 . 5 3 . 0 3 . 5 4 . 0 4 . 5 5 . 0 5 . 5 6 . 0 6 . 5 7 . 0 7 . 5 8 . 0
f 1 ( p p m )
6 . 9 7
1 . 8 5
1 . 1 1
0 . 8 2
1 . 2 4
1 . 2 5
1 . 2 6
1 . 2 7
1 . 3 0
1 . 3 1
1 . 5 4
1 . 5 5
1 . 5 6
1 . 5 7
1 . 5 8
1 . 5 9 H 2 O
2 . 0 7
2 . 0 7
2 . 0 7
2 . 1 3
2 . 1 3
2 . 1 3
2 . 3 9
2 . 4 1
2 . 4 2
2 . 4 3
2 . 4 3
2 . 4 3
2 . 4 4
2 . 4 4
2 . 4 5
2 . 4 5
2 . 4 5
2 . 4 6
2 . 4 7
2 . 4 7
7 . 2 6 c d c l 3

- 54 -

Supplemental Figure 2.20:
13
C NMR spectrum of Aspergillus acid B (16) in chloroform-d (400
MHz).

0 1 0 2 0 3 0 4 0 5 0 6 0 7 0 8 0 9 0 1 0 0 1 1 0 1 2 0 1 3 0 1 4 0 1 5 0 1 6 0 1 7 0 1 8 0 1 9 0 2 0 0 2 1 0 2 2 0
f 1 ( p p m )
9 . 5 1
2 3 . 8 5
2 4 . 4 4
2 7 . 5 9
2 9 . 1 7
2 9 . 3 9
2 9 . 4 1
2 9 . 4 2
2 9 . 4 4
2 9 . 5 4
2 9 . 5 7
2 9 . 5 8
2 9 . 8 6
4 3 . 8 2
7 6 . 6 9 c d c l 3
7 7 . 0 0 c d c l 3
7 7 . 3 2 c d c l 3
1 4 0 . 4 3
1 4 4 . 7 8
1 6 5 . 8 8
1 6 6 . 2 8
2 0 9 . 4 6

- 55 -

Supplemental Figure 2.21:
1
H NMR spectrum of Aspergillus acid E (17) in chloroform-d (400 MHz).

0 . 0 0 . 5 1 . 0 1 . 5 2 . 0 2 . 5 3 . 0 3 . 5 4 . 0 4 . 5 5 . 0 5 . 5 6 . 0 6 . 5 7 . 0 7 . 5 8 . 0
f 1 ( p p m )
1 2 . 0 5
4 . 0 2
1 . 5 4
1 . 5 5
1 . 0 3
1 . 0 2
1 . 2 5
1 . 3 0
1 . 5 3
1 . 5 5
1 . 5 7
1 . 5 8
1 . 5 9 H 2 O
1 . 6 1
1 . 6 3
2 . 0 4
2 . 0 7
2 . 0 7
2 . 0 7
2 . 4 3
2 . 4 3
2 . 4 4
2 . 4 4
2 . 4 5
2 . 4 5
2 . 4 5
2 . 4 7
2 . 4 7
4 . 0 3
4 . 0 5
4 . 0 6
7 . 2 6 c d c l 3

- 56 -

Supplemental Figure 2.22:
13
C NMR spectrum of Aspergillus acid E (17) in chloroform-d (400
MHz).

0 1 0 2 0 3 0 4 0 5 0 6 0 7 0 8 0 9 0 1 0 0 1 1 0 1 2 0 1 3 0 1 4 0 1 5 0 1 6 0 1 7 0 1 8 0 1 9 0 2 0 0 2 1 0 2 2 0
f 1 ( p p m )
9 . 5 1
2 1 . 0 3
2 4 . 4 4
2 5 . 8 9
2 7 . 5 9
2 8 . 5 8
2 9 . 1 8
2 9 . 2 4
2 9 . 4 1
2 9 . 5 0
2 9 . 5 4
2 9 . 5 8
6 4 . 6 6
7 6 . 6 9 c d c l 3
7 7 . 0 0 c d c l 3
7 7 . 3 2 c d c l 3
1 4 0 . 4 3
1 4 4 . 7 7
1 6 5 . 8 8
1 6 6 . 2 8
1 7 1 . 2 8

- 57 -

Supplemental Figure 2.23: UV-Vis and ESIMS spectra (positive or negative mode) of gedC-
related and new compounds identified in this study.

- 58 -

Chapter 3 _____________________________________________

Identification of the neoaspergillic acid biosynthesis gene cluster by
establishing an in vitro CRISPR-ribonucleoprotein genetic system in
Aspergillus melleus

3.1 Abstract

Filamentous fungi are an important source of bioactive mycotoxins. Recent efforts have
focused on developing antifungal agents that are effective against invasive yeasts such as
Candida albicans. By screening fungal strains isolated from regions surrounding the Chernobyl
nuclear power plant disaster for antifungal activity against Candida albicans, we found that
Aspergillus melleus IMV 01140 produced compounds that inhibited the growth of the yeast. The
active compound produced by A. melleus was isolated and found to be neoaspergillic acid, a
compound that is closely related to aspergillic acid. While aspergillic acid and its derivatives have
been well-characterized and were found to have antibiotic and antifungal properties,
neoaspergillic acid has been much less studied. Even though neoaspergillic acid and related
compounds were found to have antibacterial and antitumoral effects, further investigation into
this group of compounds is limited by challenges associated with large-scale production, isolation,
and purification. The production of neoaspergillic acid has been shown to require co-cultivation

- 59 -
methods or special growth conditions. In this work, neoaspergillic acid and related compounds
were found to be produced by A. melleus under laboratory growth conditions. The biosynthetic
gene cluster of neoaspergillic acid was predicted using the aspergillic acid gene cluster as a model.
The biosynthetic pathway for neoaspergillic acid was then confirmed by establishing an in vitro
CRISPR-ribonucleoprotein system to individually delete each gene within the cluster. A negative
transcriptional factor, mcrA, was also eliminated to further improve the production of
neoaspergillic acid and the related compounds for future studies.

3.2 Introduction

Candida yeasts, such as Candida albicans, are invasive species that can be deadly in
immunocompromised patients.
86
With the limited number of drugs that are available in
antifungal therapies, it is crucial to discover more antifungals with anti-Candida activity.
87,88
The
investigation of fungal secondary metabolites (SMs) has progressed rapidly with the recent
development of molecular genetic tools. SMs have been used extensively in the agricultural, food,
cosmetic, and pharmaceutical industries.
1,50,51
As the number of sequenced fungal genomes has
rapidly increased, efficient techniques have been developed that make fungal strains genetically
more accessible.
15,49
Among various gene manipulation methods, CRISPR (clustered regularly
interspaced short palindromic repeat)-Cas9 has been shown to achieve extremely accurate and
efficient edits. Adaptation of the CRISPR gene editing technology has revealed unknown SM
biosynthetic pathways in several filamentous fungi.
42,43,59

In our screen of over 150 fungal strains for the production of compounds with anti-Candida
activity, Aspergillus melleus was found to produce a compound that exhibits growth inhibition of

- 60 -
C. albicans. Compound isolation, followed by NMR structural determination, identified the
antifungal activities as neoaspergillic acid. Aspergillic acid and related compounds have been
widely studied as mycotoxins, with many of them displaying antibacterial and antifungal
activities.
89,90
While the gene cluster and biosynthetic pathway of aspergillic acid have been
reported, there are limited studies about a closely related compound, neoaspergillic acid.
89

Previous investigations have shown that neoaspergillic acid possesses antibacterial, antifungal,
and antitumoral effects.
91,92
With relatively strong toxicity, the lethal dose (LD50) of
neoaspergillic acid in mice was reported to be 125 mg/kg.
93
The complex derivatives of this
compound such as ferrineoaspergillin, aluminiumneoaspergillin, and zirconiumneoaspergillin
also acquire different levels of toxic activities.
90,94,95
A dimeric zinc complex,
dizinchydroxyneoaspergillin was also found to have significant bactericidal effects toward
methicillin-resistant bacteria strains.
96
In our optimized laboratory conditions, the highest titer
we could obtain is 4 mg/liter of neoaspergillic acid from liquid culture. To enable the production
of sufficient quantities of this antifungal compound for derivatization and further development
as an anti-candida agent, we set out to identify the genes involved in the biosynthesis of
neoaspergillic acid. We confirmed the gene cluster that is responsible for producing
neoaspergillic acid by establishing an in vitro CRISPR-Cas9 system in A. melleus with assembled
ribonucleoprotein (RNP). The non-ribosomal peptide synthetase (NRPS)-like core gene and
tailoring enzymes such as the P450 oxidase and hydrolase have been deleted individually to
validate the biosynthetic pathway of this compound. In our initial attempt to increase the titer of
neoaspergillic acid, we deleted a negative transcriptional factor, mcrA, in A. melleus using the
same in vitro CRISPR-Cas9 system. Upregulation of both neoaspergillic acid (1) and

- 61 -
neohydroxyaspergillic acid (2) in the mcrAD strain was observed indicating that this gene cluster
was negatively regulated by mcrA in A. melleus.

3.3 Results and discussion

3.3.1 A. melleus produces neoaspergillic acid on a solid YEPD medium. The gene cluster was
located through genome annotation.

Over 150 fungal strains collected from the Chernobyl nuclear power plant and surrounding
areas were screened for antifungal activity against C. albicans ATCC 90028 and fluconazole-
resistant C. albicans ATCC 321182. The selected strains were designated by IMV (Institute of
Microbiology and Virology, Kiyv, Ukraine) strain numbers. Among the fungal species with
antifungal activity against C. albicans, A. melleus IMV 01140 was found to produce two
compounds on solid Yeast Extract Peptone Dextrose (YEPD) medium as analyzed by liquid
chromatography mass spectrometry (LC-MS) (Supplemental Figure 3.6). To identify the
compounds, A. melleus was cultivated on 15-cm diameter Petri dishes in multiple replicates (n=40)
of YEPD medium, and the compounds were purified by a solid-liquid extraction, column
chromatography, and high-performance liquid chromatography (HPLC). The two major
compounds produced were confirmed to be neoaspergillic acid (1) and neohydroxyaspergillic
acid (2) by nuclear magnetic resonance (NMR) analysis (Figure 3.2, supplemental Figures 3.12-
3.14). Compound 3, a substance related to neoaspergillic acid, was also detected in lower
amounts and was predicted to be neodehydroxyaspergillic acid as it shares the same mass with
deoxyaspergillic acid in the aspergillic acid pathway.

- 62 -

After confirming that neoaspergillic acid was the major compound produced by A. melleus on
YEPD, we wanted to locate the neoaspergillic acid gene cluster to reveal the biosynthetic pathway.
The genome of A. melleus was sequenced and annotated. Due to the similarity between
neoaspergillic and aspergillic acid, we used asaC, a non-ribosomal peptide synthetase-like (NRPS-
like) core gene in the aspergillic acid gene cluster (Aspergillus flavus NRRL3357) as a probe to
search for the gene cluster of neoaspergillic acid in A. melleus. The homolog of asaC protein was
identified in the A. melleus genome using BLASTp (RRID:SCR_001010). The gene cluster of
neoaspergillic acid in A. melleus had a strong similarity to the gene cluster of aspergillic acid in A.
flavus, except for the homologs of asaD and asaR, which were initially predicted together in A.

Figure 3.1: Replacement of the native NRPS-like gene (neaC) with a hygromycin resistance (HygR)
marker. (A) Predicted neoaspergillic acid gene cluster in Aspergillus melleus. (B) The repair template,
consisting of a hygromycin resistance gene (1375 bp), was amplified from plasmid pFC332 with 50 bp
flanking regions at both ends. The replacement of the NRPS-like gene (neaC) by the HygR marker was
induced by DNA cleavages during transformation.

- 63 -
melleus (Figure 3.1, supplemental Table 3.3). We designated the homolog of asaC in A. melleus
to be neaC and used this name in the following work.

3.3.2 Deletion of neaC using in vitro CRISPR-Cas9 confirms the gene cluster of neoaspergillic
acid in A. melleus

We established an in vitro CRISPR-Cas9 system in A. melleus to verify that the gene cluster
found through BLASTp was responsible for producing neoaspergillic acid. DNA repair normally
occurs through non-homologous end-joining (NHEJ) when Cas9 introduces a double-strand break
Figure 3.2: Paired HPLC profiles of A. melleus (wild type, neaCD, neaDD, neaBD, mcrAD strains)
extracts when grown on a solid YEPD medium. (i) wild type, (ii) neaCD, (iii) neaDD, (iv) neaBD, and (v)
mcrAD strains.

- 64 -
in DNA. As NHEJ requires a dimeric protein complex, Ku, to facilitate the repair, genetic
manipulations involving entire gene deletions are typically performed in fungal strains with a Ku-
background. However, by targeting both ends of a gene simultaneously with a microhomologous
repair template, it increases the efficiency of gene replacement through microhomology-
mediated end joining (MMEJ) (Figure 3.1). Thus, we can successfully manipulate wild-type fungal
genomes using the CRISPR-RNP system that has previously been reported in other Aspergillus
spp.
We performed an antibiotic resistance test to determine the effective concentration of
hygromycin B. 1.0 ´ 10
6
wild-type A. melleus protoplasts were inoculated into each well with
different hygromycin concentrations (0, 0.05, 0.1, 0.2, 0.4, 0.6 mg/mL). The wild-type A. melleus
was found to be resistant to hygromycin at 0.4 mg/mL (Supplemental Figure 3.7). The repair
template, amplified from pFc332, contains a hygromycin resistance gene and 50 bp homologous
flanking regions at either end. We designed two crRNAs targeting the 5’ untranslated region (UTR)
and 3’ UTR of the NRPS-like gene, neaC, respectively, to form RNPs by assembling with tracrRNA
and Cas9. The targeting regions were followed by PAM (NGG) sequences for efficient Cas9
cleavage. Protospacer sequences were selected by performing a BLAST search within the A.
melleus genome to minimize off-target effects.
We delivered assembled RNPs into wild-type A. melleus protoplasts along with the repair
template during transformation. Transformants appeared on hygromycin-selective plates on day
4 and were restreaked onto non-selective potato dextrose agar (PDA) for conidium harvesting.
DNA was extracted from the fungal biomass of each transformant after incubating for five days.
To confirm the deletions were correct, we designed primers to amplify the neaC sequence using

- 65 -
both wild-type and transformant DNA. The neaC amplicon was approximately 5 kb for the wild-
type, and 2.7 kb for correct transformants with the gene deleted. The PCR results indicate that
neaC was successfully deleted in mutant A. melleus strains (Supplemental Figure 3.8). Wild-type
and neaCD strains were cultivated on YEPD for six days, and plates were extracted for
metabolomics analysis. As predicted, the production of neoaspergillic acid and related
compounds is eliminated in neaCD strains, confirming that this is the cluster responsible for the
production of neoaspergillic acid (Figure 3.2).

3.3.3 Deletion of additional cluster genes to reveal the biosynthetic pathway of neoaspergillic
acid

To establish the biosynthetic pathway, we targeted aspergillic acid homologs of the p450
oxidase (asaD) and hydrolase (asaB) in the neoaspergillic acid gene cluster. The corresponding
genes were located through a BLASTp search and were designated as neaD and neaB,
respectively. Following the same procedure as described in above, we designed crRNAs targeting
these two genes and assembled them separately with tracrRNA and Cas9. The assembled RNPs
were then delivered to wild-type A. melleus protoplasts with repair templates during
transformation. After four days of incubation, transformants were streaked on non-selective PDA
plates for conidium collection and DNA extraction. Deletions of neaD and neaB were confirmed
by PCR (Supplemental Figures 3.9 and 3.10).
The neaDD and neaBD strains were cultivated on YEPD for six days and plates were extracted
for metabolomics analysis. Neoaspergillic acid (1) is still produced by neaBD strains, however, the
presence of neohydroxyaspergillic acid (2) is absent, suggesting that neaB is responsible for the
hydrolysis step following neoaspergillic acid formation (Figure 2[iv]). Deletion of neaD completely

- 66 -
abolished the production of both neoaspergillic acid (1) and neohydroxyaspergillic acid (2) (Figure
3.2[iii]). Extracted ion chromatograms (EIC) showed the presence of compound 3 ([M+H]
+
=209
m/z) in wild-type, neaDD, and neaBD strains, but not in neaCD strains. This indicates the
formation of compound 3 occurs before the oxidation and hydrolysis steps (Figure 3.3). An earlier
study of the aspergillic acid biosynthetic pathway reports that a compound with the same mass
as compound 3 was found by deletion of asaD, and identified to be deoxyaspergillic acid.
9

Therefore, compound 3 was predicted to be neodeoxyaspergillic acid, and the proposed
biosynthetic pathway is illustrated in Figure 3.4.

Figure 3.3: NeaD oxidizes neodeoxyaspergillic acid forming neoaspergillic acid. Extracted
ion chromatograms ([M+H]
+
=209) show neodeoxyaspergillic acid (3) is present in wild type,
neaDD, neaBD, and mcrAD strains) extracts when grown on a solid YEPD medium. (i) wild
type, (ii) neaCD, (iii) neaDD, (iv) neaBD, and (v) mcrAD strains.

- 67 -

3.3.4 Deletion of the negative transcriptional factor, mcrA, upregulates the production of
neoaspergillic acid and the related compounds.

To upregulate neoaspergillic acid production, we decided to target mcrA, a negative global
regulator of SM production in filamentous fungi. We located the mcrA in A. melleus by using the
A. nidulans mcrA (AN8694) protein sequence as a probe. The homolog of AN8694 was found in
the A. melleus genome using BLASTp. We designed crRNAs targeting both ends of the gene and
performed RNP assembly and fungal transformation as described before. Transformants were
restreaked on PDA plates for conidium harvesting and DNA extraction. Correct transformants
were confirmed using PCR that assessed the presence of the hygB marker and the absence of the
mcrA gene (Supplemental Figure 3.11).
Upregulation of both neoaspergillic acid (1) and neohydroxyaspergillic acid (2) was observed
in the HPLC profiles of metabolite extracts from the mcrAD strain compared to the wild-type
strain (Figure 3.2). We observed a 1.7-fold and 1.6-fold increase in the production of
neoaspergillic acid (1) and neohydroxyaspergillic acid (2), respectively, in mcrAD strain (Figure
3.5). Upregulation of neoaspergillic and neohydroxyaspergillic acid in the mcrA deletion strains
Figure 3.4: Proposed biosynthesis pathway of neoaspergillic acid in A. melleus.

- 68 -
suggests that mcrA acts as a negative regulator of the neoaspergillic acid gene cluster. The mcrAD
strain can be utilized to enhance the production of compound 1 for future studies focused on
characterizing the biological properties of neoaspergillic acid.

3.4 Conclusion

The production of neoaspergillic acid has been shown to require co-cultivation of Aspergillus
species or monoculture in high salt stress conditions in previous studies.
95-97
Cultivation of some
other Aspergillus species for neoaspergillic acid extraction was as long as 60 days and purified
compounds were mainly isolated through alkali hydrolysis of ferrineoaspergillin,
aluminiumneoaspergillin, and zirconiumneoaspergillin in previous work.
90,96
The accessibility of
neoaspergillic acid limits further studies of its bioactivities and biosynthesis. In this study,
Figure 3.5: Increased production of compounds 1 and 2 in mcrAD strain. Neoaspergillic acid (1)
production increased by 1.7-fold and neohydroxyaspergillic acid (2) production increased by 1.6-fold
compared to the ones in the wild type.

- 69 -
neoaspergillic acid and its derivatives were first reported to be produced by A. melleus under
laboratory growth conditions on Day 6 without co-cultivation or the addition of salts. The gene
cluster of neoaspergillic acid was predicted using the aspergillic acid cluster core gene, asaC, as
a probe. We established an in vitro CRISPR-Cas9 system in A. melleus by deleting the NRPS-like
core gene (neaC). The function of the predicted P450 oxidase (neaD) and hydrolase (neaB) within
the gene cluster was also confirmed by deleting each gene individually. The biosynthetic pathway
of neoaspergillic acid was first proposed in this study (Figure 3.4). To optimize the production,
we deleted mcrA, a negative transcriptional regulator in A. melleus, resulting in enhanced
production of neoaspergillic acid (1) and neohydroxyaspergillic acid (2). By establishing the
biosynthetic pathway and optimizing the production of neoaspergillic acid, future studies can
focus on the biological characteristics of this compound and its chelation with different metals.

- 70 -
3.5 Methods

3.5.1 Genome Assembly and Annotation.

Wild-type Aspergillus melleus was cultivated on potato dextrose agar (PDA) for six days. The
PDA plate with A. melleus growth on top was sent to Novogene for DNA extraction and Illumina
NovaSeq sequencing.
The raw sequencing results were collected from Novogene, and genome analysis was
performed at the High-Performance Computing Center (HPCC) at UC Riverside
(https://hpcc.ucr.edu). The genome was assembled through AAFTF, which relies on trimmomatic
v0.36 to trim reads and bowtie v 2.3.4.1 to filter against databases of contaminants, assemble
reads using SPAdes, remove vector sequences by BLASTN against a vector sequence database,
filter bacteria contamination using sourmash v3.5.0, and polish the assembly with the short reads
using pilon.
77-79
The final assembly was masked by RepeatMasker and annotated using the
Funannotate pipeline.
80,81
This procedure uses HISAT2, Trinity and PASA to predict genes and
identify homology for functional annotation.
82-84
The SM gene clusters were revealed by
analyzing the annotated genome with antiSMASH.
85
The sequence reads, assembly, and
annotation of the strain were deposited at NCBI GenBank under Bioproject PRJNA883727. The
predicted gene clusters and genome characteristics were summarized in the Supplemental Table
1 and 2.

3.5.2 Molecular Genetic Procedures.

Hygromycin B was used as a selectable marker in this work based on the results of the
antibiotic resistance test (Supplemental Figure 3.7). A 1,375-bp HygR microhomology repair
template, which spans 320 bp of the trpC promoter and 1,020 bp of the hygromycin B resistance

- 71 -
cassette, was amplified from pFc332 using primers with 50 bp homologous flanking
(Supplemental Table 3.4). The amplified PCR products were purified by gel extraction and the
final DNA repair templates were eluted with an Elution Buffer (Qiagen, Cat. No. 19086).
The Alt-R-CRISPR-Cas9 components were ordered from Integrated DNA Technologies (IDT).
The universal tracrRNA and the crRNA with the designed 20 bp protospacer were prepared as
100 µM stock solutions and stored at -20°C before use. The Cas9 nuclease was diluted to a final
concentration of 1 µg/µL with nuclease-free Cas9 working buffer (20 mM HEPES, 150 mM KCl,
pH 7.5) and stored at -20°C until use. The crRNA and tracrRNA in equal molar concentrations
were first assembled to become the guide RNA duplex at a final concentration of 33 µM. The
duplex mixture was heated for 5 min at 95°C and cooled to room temperature before use or
stored at -20°C for long-term use. The Cas9-gRNA ribonucleoprotein complexes were then
generated by combining 1.5 μL of each gRNA duplex separately with 11 μL of nuclease-free Cas9
working buffer and 0.75 μL of Cas9. The RNP complexes were formed by incubating the mixtures
for 5 min at room temperature. Two RNP complexes targeting both ends of the gene were
combined to form a final volume of 26.5 μL before the transformation.

3.5.3 Transformation of A. melleus.

Fresh conidia of wild-type A. melleus were collected from PDA plates after 6 days of
incubation at 30°C. 1 × 10
8
conidia of A. melleus were inoculated into 50 mL of Potato Dextrose
Broth (PDB) in a 250 mL flask and incubated at 30°C overnight with shaking at 135 rpm. Mycelia
were collected by filtration and resuspended in protoplasting buffer, which was prepared by
adding 1.2 g of VinoTaste Pro (VTP) in 20 mL of 1.1M KCl, 0.39M citric acid monohydrate buffer

- 72 -
(pH 5.8, adjusted with 1.1M KOH). The protoplasting buffer was vortexed for 15 min and
centrifuged for 15 min at 1800 x g. Together with the filtered mycelia, the supernatant of the
protoplasting buffer was filter-sterilized into a 50 mL flask and were incubated at 30°C for 4 h
with shaking at 100 rpm. Five milliliters of the protoplast suspension was transferred and gently
overlaid with 5 mL 0.4 M ST (0.4 M D-sorbitol, 100 mM Tris-HCl, pH 8) into a 15 mL tube. The
tube was centrifuged for 15 min at 4 °C and 800 x g to separate protoplasts from the mycelial
debris. The protoplast layer was collected at the interface and transferred into a new tube. After
adding 15 mL ST (1.0 M D-sorbitol, 50 mM Tris-HCl, pH 8), the suspension was centrifuged at
room temperature for 10 min at 800 x g. The protoplast pellet was washed with ST and
centrifuged at room temperature at 800 x g for 10 min. The pellet was then resuspended in STC
buffer (1.0 M D-sorbitol, 50 mM CaCl 2, 50 mM Tris-HCl, pH 8). 100 μL (approximately 1.0 ´ 10
6
)
of protoplasts were added to the Cas9 RNP mixture (26.5 µL). Approximately 3 µg of the purified
repair template and 25 µL of polyethylene glycol (PEG)-CaCl 2 buffer (40% [wt/vol] PEG 3350, 50
mM CaCl 2, 50 mM Tris-HCl, pH 8) was added immediately after adding protoplasts. The mixture
of protoplast, Cas9 RNP, and the repair templates was incubated for 50 min on ice. A 1.25 mL
PEG-CaCl 2 was added to the protoplast mixture and the suspension was incubated for 20 min at
room temperature. The suspension was brought to 2 mL by adding STC buffer, and 500 μL of
suspension was spread on SMM agar plates (GMM supplemented with 1.2 M sorbitol, 1.5%
[wt/vol] agar). The SMM plates were incubated at room temperature overnight, and the second
layer of top agar (GMM supplemented with 1.2 M sorbitol, 0.7% [wt/vol] agar) with the selected
antibiotic was overlaid. The transformed SMM plates were incubated for 4 days at 30°C for
conidium generation.

- 73 -

3.5.4 Culturing and HPLC-DAD-MS Analysis.

A. melleus strains were incubated at 30°C on Yeast Extract Peptone Dextrose (YEPD) agar
plates. For each strain, 1.0 ´ 10
7
conidia were inoculated on a YEPD plate, and 5 plugs (7 mm
diameter) were cut out for compound extraction after 6 days of cultivation. The agar plugs were
extracted with 5 mL of methanol. After 1 h of sonication, the extract was collected into a clean
glass vial, and the agar plugs were extracted again with 5 mL of dichloromethane: methanol (1:1)
followed by another 1 h of sonication. The extract was collected into the same glass vial for
evaporation with a TurboVap LV (Caliper LifeSciences). The dried residues were dissolved in equal
amounts (7 mL) of ethyl acetate (EtOAc) and water. The EtOAc layer was collected into a new
glass vial and evaporated using a TurboVap LV. The dried extract was redissolved in 400 μL of
dimethyl sulfoxide (DMSO): methanol (MeOH) (1:4), and 10 μL was injected into LC-DAD-MS for
analysis. We used a ThermoFinnigan LCQ Advantage ion trap mass spectrometer with a reversed-
phase C 18 column (Alltech Prevail C 18; column, 2.1 by 100 mm; particle size, 3 μm; flow rate 125
μL min
-1
) to retrieve LC/MS spectra. Solvent A was 5% acetonitrile (MeCN)−H 2O, and the solvent
B was 95% MeCN−H 2O. Both solvents contained 0.05% formic acid, and the solvent gradient was
as follows: 100% solvent A from 0 to 5 min, 0 to 25% solvent B from 5 to 6 min, 25 to 100% solvent
B from 6 to 35 min, 100% solvent B from 35 to 40 min, 100 to 0% solvent B from 40 to 45 min,
and re-equilibration with 100% solvent A from 45 to 50 min. The MS included a 5.0 kV capillary
voltage, 60-arbitrary units flow rate of the sheath gas, 10-arbitrary units of the auxiliary gas, and
350°C of the ion transfer capillary temperature.

- 74 -
3.5.5 Compound Purification and Characterization.

Wild type A. melleus strains were cultivated in 40 of 15-cm diameter Petri dishes with a total
volume of 2.5 L of YEPD medium for 5 days at 30°C. After incubation, the agar was chopped into
pieces and extracted with methanol and dichloromethane: methanol (1:1) followed by 1 h of
sonication as described above. The liquid residue was evaporated in vacuo to lower the total
volume and extracted three times with EtOAc. The combined EtOAc layers were evaporated in
vacuo to generate a crude extract. Silica gel column chromatography was performed using
dichloromethane and methanol as eluent, starting with 1% methanol. Neoaspergillic acid (1) and
neohydroxyaspergillic acid (3) were eluted at 3% methanol. Fractions with desired compounds
were combined and further separated through preparative HPLC [Phenomenex Luna 5 μm C 18 (2),
250 ´ 21.2; flow rate of 5.0 mL min
−1
; UV detector at 280 nm]. The purified compounds were
characterized by Nuclear Magnetic Resonance (NMR) spectral analysis using a Varian Mercury
Plus 400 spectrometer.

- 75 -
3.6 Supporting Information

Supplemental Table 3.1: Genome assembly characteristics of Aspergillus melleus.

- 76 -
Supplemental Table 3.2: Secondary metabolite clusters predicted by antismash v4.1.0.

- 77 -
Supplemental Table 3.3: Cluster comparison of aspergillic acid in Aspergillus flavus and
neoaspergillic acid in A. melleus.

*Per. Ident (Percent Identity): A number that describes the extent to which two aligned
sequences have the same amino acids in the same positions.

- 78 -
Supplemental Table 3.4: Primers used in this study.

Primer Sequence (5' → 3')
Primers used for amplifying sgRNA fragments
NeaC_FW

GGTAGACTGTGGGTATATATAGACTGGGAGGGACTTGGAATGTCAGTAACGCTAGT
GGAGGTCAACACAT
NeaC_REV

CTACAAATATGCGAACAAATTTCCAGTCTAACAAATATTAACTTCAACCTCTTAATGC
GGTAGTGGGGAT

NeaD_FW

TGGTATAGCGCCACCAGTAGCTCGCTCGCAATTCGTCATGTCACGACCTTGCTAGTG
GAGGTCAACACAT

NeaD_REV

CGTTCCGCAGATTCAGTCCCCAGCTGTCAACCACGTAATTCGTGCCTCCACTTAATGC
GGTAGTGGGGAT

NeaB_FW

GATCGTATTCGCTGAAACTTGGCAAATCTTCGCGATTCCGCTTCTCTACTGCTAGTGG
AGGTCAACACAT

NeaB_REV

mcrA_FW

mcrA_REV

ATGGACACTAATTAGCCCAGATCGTTAGGCGACTAACAAAGCTCACACCTCTTAATG
CGGTAGTGGGGAT

ATACACGGACACACCCCTGCTCCTGCTCCTGCTCCTTGGCCGTCGACCCGGCTAGTG
GAGGTCAACACAT

TCTGGTCTCTTTCCCCTCAGAAACCGCCCCTCCAAGGATAATTCAGACCGCTTAATGC
GGTAGTGGGGAT

Primers used for sequencing mutant strains

NeaC_seq_FW

TGACTAGCTGGACTTCGTGA

NeaC_seq_REV GCTTGTCGTGATCAAGCCTT

NeaD_seq_FW GTGATGGACTGGTCCTCTTC

NeaD_seq_REV CGCCTCTGACACATAGTCAA

NeaB_seq_FW TGGCGTTACATTTCAACGGG

NeaB_seq_REV TGTCCAAGTCGCTGTTCAAC

McrA_seq_FW GAACTCCGCATTGCAATCCT

McrA_seq_REV GACCGCTTAATGCGGTAGTG

- 79 -

Supplemental Figure 3.6: Anti-candida test of A. melleus against wild-type C. albicans and
fluconazole-resistant C. albicans. (i) wild-type C. albicans (ATCC 90028) (ii) fluconazole-resistant
C. albicans (ATCC 321182).

- 80 -

Supplemental Figure 3.7: Antibiotic sensitivity test of A. melleus against hygromycin B. The
minimum inhibitory concentration was determined to be 0.4 mg/mL of hygromycin B.

0 0.05 0.1
0.2 0.4 0.6

- 81 -

Supplemental Figure 3.8: Results of the diagnostic PCR amplification of neaC coding region in
wild type and neaCD strains of A. melleus. The neaC amplicon was around 5 kb for the wild-type,
and 2.7 kb for the neaCD strains.

- 82 -

Supplemental Figure 3.9: Results of the diagnostic PCR amplification of neaD coding region in
wild type and neaDD strains of A. melleus. The neaD amplicon was around 2.5 kb for the wild-
type, and 2.2 kb for the neaDD strains.

- 83 -

Supplemental Figure 3.10: Results of the diagnostic PCR amplification of neaB coding region in
wild type and neaBD strains of A. melleus. The neaB amplicon was around 1.7 kb for the wild-
type, and 2.0 kb for the neaBD strains.

- 84 -

Supplemental Figure 3.11: Results of the diagnostic PCR amplification of mcrA coding region in
wild type and mcrAD strains of A. melleus. (i) (ii) The lengths of the mcrA and HygB marker are
similar to each other (1.6kb and 1.4kb, respectively). A special set of nested primers were
designed. Forward primer (McrA_seq_FW) bound to the sequence within the mcrA coding region,
while the reverse primer (McrA_seq_REV) bound to the sequence within the HygB repair
template. Only the mcrAD strain with the correct gene replacement could generate a band
around 1.8kb.

(ii)
(i)

- 85 -

Supplemental Figure 3.12:
1
H NMR spectrum of neoaspergillic acid (1) in methanol-d 4 (400
MHz).

0 . 0 0 . 5 1 . 0 1 . 5 2 . 0 2 . 5 3 . 0 3 . 5 4 . 0 4 . 5 5 . 0 5 . 5 6 . 0 6 . 5 7 . 0 7 . 5 8 . 0
f 1 ( p p m )
1 2 . 1 1
0 . 9 5
0 . 8 6
4 . 1 1
0 . 9 4
0 . 8 7
0 . 8 8
0 . 8 9
0 . 9 1
2 . 0 7
2 . 0 8
2 . 1 0
2 . 1 2
2 . 1 3
2 . 1 5
2 . 1 8
2 . 1 9
2 . 2 1
2 . 2 3
2 . 2 5
2 . 6 0
2 . 6 2
2 . 6 3
2 . 6 5
3 . 3 0 c d 3 o d
3 . 3 1 c d 3 o d
3 . 3 1 c d 3 o d
3 . 3 1 c d 3 o d
3 . 3 2 c d 3 o d
4 . 8 6 H D O
7 . 2 9

- 86 -

Supplemental Figure 3.13:
13
C NMR spectrum of neoaspergillic acid (1) in methanol-d 4 (400
MHz).

0 1 0 2 0 3 0 4 0 5 0 6 0 7 0 8 0 9 0 1 0 0 1 1 0 1 2 0 1 3 0 1 4 0 1 5 0 1 6 0 1 7 0
f 1 ( p p m )
2 2 . 8 8
2 2 . 9 3
2 6 . 7 8
2 8 . 5 3
3 8 . 0 7
4 2 . 5 1
4 8 . 3 6 c d 3 o d
4 8 . 5 7 c d 3 o d
4 8 . 7 9 c d 3 o d
4 9 . 0 0 c d 3 o d
4 9 . 2 1 c d 3 o d
4 9 . 4 3 c d 3 o d
4 9 . 6 4 c d 3 o d
1 2 7 . 1 5
1 4 2 . 2 9
1 4 8 . 3 4
1 5 8 . 7 3

- 87 -

Supplemental Figure 3.14:
1
H NMR spectrum of neohydroxyaspergillic acid (2) in methanol-d 4
(400 MHz).

0 . 0 0 . 5 1 . 0 1 . 5 2 . 0 2 . 5 3 . 0 3 . 5 4 . 0 4 . 5 5 . 0 5 . 5 6 . 0 6 . 5 7 . 0 7 . 5 8 . 0
f 1 ( p p m )
1 5 . 5 0
1 . 2 1
0 . 8 2
3 . 0 8
0 . 8 8
1 . 0 1
0 . 8 7
0 . 8 9
0 . 9 0
0 . 9 1
2 . 0 9
2 . 1 1
2 . 1 3
2 . 1 5
2 . 1 6
2 . 2 8
2 . 3 0
2 . 3 1
2 . 3 3
2 . 6 0
2 . 6 2
2 . 6 4
2 . 6 6
2 . 6 8
3 . 3 0 c d 3 o d
3 . 3 1 c d 3 o d
3 . 3 1 c d 3 o d
3 . 3 1 c d 3 o d
3 . 3 2 c d 3 o d
4 . 7 2
4 . 7 3
4 . 8 5 H D O
7 . 4 8

- 88 -

Chapter 4 _____________________________________________

Genome Mining of the Biosynthetic Gene Cluster of Citrinalin in
Penicillium citrinum using CRISPR-Cas9

4.1 Abstract

Two new nitro compounds, citrinalin A and B, were recently found to be produced by a
marine-derived fungal strain, Penicillium citrinum. Using a known biosynthetic gene cluster that
produces a structurally similar compound as a probe, we discovered the gene cluster responsible
for citrinalin production. To elucidate the citrinalin biosynthetic pathway, we developed a genetic
system for Penicillium citrinum using CRISPR-Cas9. Genes within the citrinalin gene cluster were
knocked out individually, and the resulted mutant strains were cultivated under citrinalin-
producing conditions. Analysis of the citrinalin-related intermediates produced by each mutant,
allow us to determine the gene responsible for the critical conversion of an amine functional
group to a nitro functional group during citrinalin biosynthesis.

4.2 Introduction

Organic nitro compounds (-NO 2 group) are abundant in nature with a wide range of biological
activities. The most well-known nitro compounds, trinitrotoluene (TNT) and nitroglycerine are
used as explosives in military and mining applications.
98
Nitroglycerine was used as an active

- 89 -
ingredient in the production of explosives but is currently used as a potent vasodilator
administered in oral capsules.
99

The abundance of genome sequencing data available for many different fungi allows the
elucidation of the natural compounds' biosynthetic gene clusters.
100,101
Nitro functional group
containing natural products have been isolated in filamentous fungi and exhibit great structural
diversity.
102
Aspergillus wentii reportedly produces 1-amino-2-nitrocyclopentanecarboxylic acid
when grown on pea plants where the compound inhibits plant growth.
103
More recently, two new nitro compounds, Citrinalin A and B (Figure 4.1) were discovered
in Penicillium citrinum.
104,105
These two stereoisomers are produced as a form of stress response
when nutrient and saline concentrations are reduced while incubation time is
increased.
106
Despite the continuous discovery of new nitro containing natural products, the
genes encoding the enzyme necessary for the transformation are still unknown. In this study we
have identified the gene of the nitro group producing enzyme in citrinalin biosynthesis. We took
advantage of the fact that genes necessary for the biosynthesis of a natural product in
filamentous fungi are clustered within the genome. Therefore, in citrinalin biosynthesis, the
nitro-producing gene should be located in a cluster containing an NRPS gene.
107,108
We developed
a genetic system for the citrinalin producing organism using CRISPR-Cas9 technology first
adopted in Aspergillus to accomplish our goal. Using the CRISPR-Cas9 system, we deleted ten
genes surrounding the citrinalin NRPS gene. We identified one mutant no longer capable of
producing citrinalin A with the nitro functional group. Instead, this mutant produces citrinalin
amine suggesting that we have identified the gene responsible for converting an amine functional
group to a nitro group.

- 90 -

4.3 Results and Discussion

4.3.1 Establishment of a plasmid-facilitated CRISPR system by targeting the putative NRPS in
the citrinalin gene cluster

We used the fact that paraherquamide and citrinalin share a similar dipeptide core to locate
the citrinalin NRPS in the P. citrinum producing strain. The NRPS (phqB) of the paraherquamide
pathway was used as a probe to search for the citrinalin gene cluster in P. citrinum, and a hit was
found on contig Node_754 (67,287 bp).
109,110
Homology analysis revealed that the gene cluster
for citrinalin biosynthesis contains one NRPS and ten additional genes, of which one is a gene
likely responsible for the conversion from an amine to an amino group (Figure 4.2, Table 4.1). To
delete all ten possible gene candidates, we needed to develop a genetic system for the producing
organism. The Mortensen group recently developed a plasmid-facilitated CRISPR-Cas9 system for
Aspergillus species. We adopted the system for Penicillium citrinum. The plasmids contain a self-
splicing guide RNA (gRNA) construct, a Cas9 cassette, an AMA1 sequence supporting autonomous
Figure 4.1: Chemical structure of paraherquamide A and chemical structures of stereoisomers of
citrinalin A and B.

- 91 -
replication, an ampicillin resistance marker for E. coli cloning, and a phleomycin resistance gene
as a fungal selection marker for protoplast transformation.
42,59,111

Since there is no literature precedence for genetically manipulating P. citrinum, we developed
a protoplasting system for this organism. We tested and showed that protoplasts could be
generated by the enzymatic digestion of the cell wall by incubation with the VinoTaste Pro
solution. The protoplasts took up plasmids during transformation, and the ones expressing the
phleomycin resistance gene underwent selective growth on media containing phleomycin. Each
Figure 4.2: (a) Predicted gene cluster of citrinalin in Penicillium citrinum. (b) Total Ion Current (TIC) of
positive ions traces for P. citrinum wild type and citA mutant.

- 92 -
filamentous fungus has a different tolerance to antibiotics under different conditions. Thus, we
determined the effective concentration of phleomycin on the reconstituted growth of P.
citrinum protoplasts on GMM with 0.6M KCl as an osmotic stabilizer. About 5 ´ 10
5
protoplasts
were plated on plates with varying phleomycin concentrations (0, 0.001, 0.01, 0.1, 1.0 mg/mL),
and sufficient growth inhibition was observed at a concentration of 0.1 mg/mL. The effective
antibiotic concentration was used in all protoplast transformations that followed. To perform
gene knockouts using the CRISPR-Cas9 strategy, we designed gRNA constructs targeting each
gene in the putative citrinalin biosynthetic cluster and then assembled these constructs with the

- 93 -
Cas9 containing plasmids. This allowed Cas9 to cut within in targeted genes to create enzyme-
disrupting mutations that impacted citrinalin production. gRNA for Cas9 consists of a folded
domain that interacts with the enzyme and a 20-nucleotide protospacer found in the target gene
preceding a PAM sequence (NGG), where N can be any nucleotide.
We first designed a 20 bp protospacer that targeted the putative NRPS, citA, that is
responsible for the initial step of citrinalin biosynthesis. A successfully disruptive mutant should
ablate citrinalin production completely, which can be confirmed with liquid chromatography-
mass spectrometry (LC-MS) analysis of the extracts of the mutant strains. We amplified the self-
splicing gRNA constructs from pFC334, changing the gRNA part as designed using two long
primers, producing two gRNA fragments. We fused these two fragments with a linearized pFC333
(the bleR containing plasmid) through Gibson assembly.
112
The assembled plasmid contained a
complete gRNA construct with a designed protospacer that we amplified through E.
coli transformation. Four out of five transformed E. coli colonies undergoing selective growth on
media that contained ampicillin had the correctly assembled plasmid. A 5 mL miniprep provided
30-50 μg plasmid, and 10 μg was linearized for transformation using PvuI digestion.
Then we used the same transformation procedure as described to transform the plasmid
into P. citrinum protoplasts, which generated about a dozen colonies on phleomycin selective
plates after four days of incubation. Five colonies were streaked on phleomycin selective plates
and incubated for four days. They were then re-streaked again and incubated for an additional
four days to ensure the Cas9 enzyme had specifically and repeatedly cut the target site until DNA
repair errors occurred. We then plated the mutant strains on non-selective PDA plates to obtain
healthy spores and allow plasmids to be lost without selective pressure. DNA extraction and

- 94 -
sequencing of the target region for each mutant strain showed various mutations. Two of the
five citA mutant strains showed no change at the targeted site, while one strain showed a 58 bp
insertion, and two other strains showed 14 and 9 bp deletions, respectively. Even though each
mutation is significantly different from the other, they all occurred at the targeted site with no
off-target mutations elsewhere in the sequenced section. Though larger insertions or deletions
are not uncommon, previously reported CRISPR-Cas9 mutations normally generate single or a
few nucleotide deletions. Culturing of each citA mutant strain under described conditions
showed the disappearance of the peaks corresponding to citrinalin A and B, which confirmed that
gene disruption was successful (Figure 4.2).

Figure 4.3: Total Ion Current (TIC) of positive ions traces for P. citrinum wild type and citB-citL
mutant. CitB-citE, citG, citH, citJ and citK mutants show ablation of citrinalin production, while citF,
citI, and citL mutant show reduced production of citrinalin. Clear intermediates can be observed in
mutant strains.

- 95 -

4.3.2 Deletion of additional genes within the citrinalin cluster Illustrate the critical enzyme
involved in the formation of nitro group

We then targeted six putative CYP450 or FAD-oxygenases (citB-citG) based on blast homology
to determine if one encodes the enzyme that will catalyze the nitro group. We designed six
protospacers and constructed plasmids using Gibson assembly as described. A dozen of colonies
were generated from the transformation of P. citrinum with each plasmid. Sequencing at the
targeted sites showed mutations by either insertion or deletion. Culturing each mutant strain
under citrinalin producing conditions showed no or lower citrinalin production, indicating
that citB-citG were involved in the biosynthesis of citrinalin. The remaining genes (citH-citL)
within the gene cluster were also disrupted individually using the same procedure. Among
them, citH, citJ, and citK showed complete ablation of citrinalin production, while citI,
and citL showed reduced production of citrinalin (Figure 4.3). Of the intermediates detected in
each mutant strain, the intermediate of citGD corresponds to the m/z value of citrinalin with an
amine instead of the nitro functional group (-30 Da). Next, we performed a 600 mL scale-up of
the citGD strain and extracted and purified the putative citrinalin amine compound using reverse
phase C18 flash chromatography and subsequent high-performance liquid chromatography
(HPLC) purification. Approximately 5 mg of the pure compound was obtained and dissolved in 1
mL of DMSO-d 6 for nuclear magnetic resonance (NMR) analysis. 2D NMR confirmed the structure
of the intermediate, which had very similar chemical shifts to citrinalin A, with shift changes
around the modified nitrogen (Figure 4.4, Supplemental Table 4.3, Supplemental Figure
4.18-4.22).

- 96 -

4.4 Conclusion

To summarize, we discovered the gene cluster responsible for citrinalin production using a
structurally similar compound where the biosynthetic pathway is already known. We developed
a genetic system for Penicillium citrinum using CRISPR-Cas9 technology. This work shows the first
known genetic system for Penicillium citrinum that generated new and critical information on
enzymes involved in introducing a nitro group in secondary metabolites. The first intermediate
structure of citrinalin was discovered and purified in this work. Most importantly, the cDNA
sequence of citG can be used as a probe to discover nitro-compound-producing gene clusters in
other fungal species. Additional investigations involving the biosynthesis of other nitro containing
fungal natural products are currently underway and will be reported in due course.

Figure 4. Chemical shifts of intermediate produced by citG mutant compared to citrinalin A.

- 97 -

4.5 Methods

4.5.1 Transformation procedure for Penicillium citrinum

For protoplast generation, fresh spores of Penicillium citrinum wildtype strain were harvested
from PDA plates. 1 × 10
8
spores of Penicillium citrinum was inoculated into 20 mL of PDB in a 50
mL flask that was incubated overnight at 30°C with shaking at 135 rpm. To prepare the digestion
buffer, 1.2 g of VinoTaste Pro (VTP) was dissolved in 20 mL of 1.2 M MgSO 4, 50 mM phosphate
buffer (pH 5.0). After vortexing for 15 minutes, the digestion buffer was centrifuged for 15
minutes at 1800 g. The supernatant was then filter-sterilized (0.22 μm) into a sterile 50 mL flask.
Note that the digestion buffer must be freshly prepared (within 30 minutes) before use.
Overnight-cultured mycelia were filtered with sterile miracloth and washed with sterile ddH 2O.
Filtered mycelia were transferred into 20 mL freshly-prepared VTP digestion buffer, which was
incubated at 30°C with shaking at 100 rpm for 3 - 4 hours. The status of protoplast formation was
monitored microscopically during the incubation. Once a substantial number of protoplasts was
observed, the protoplast suspension was filtered through sterile miracloth and washed with 5 mL
1.2 M MgSO 4, 50 mM phosphate buffer (pH 5.0). 5 × 5 mL protoplast filtrate was transferred into
15 mL tubes and gently overlaid with 5 mL 0.4 M ST (0.4 M D-sorbitol in 100 mM Tris pH 8). The
ST buffer with overlaid protoplast filtrate was centrifuged at 4 °C at 800 g for 15 min with the
brake off. The white layer (protoplast layer) at the interface was collected (~ 5 mL) and gently
added to 15 mL ST (1.0 M D-sorbitol in 50 mM Tris pH 8). The solution was then centrifuged at
room temperature at 800 g for 10 min, which yielded a white/green pellet. The pellet was
resuspended in 10 mL ST and centrifuged at room temperature at 800 g for 10 min. After

- 98 -
removing the supernatant, the pellet was resuspended in STC buffer (ST + 50 mM CaCl 2) and the
concentration of protoplasts were counted under microscope. For long term storage, STC was
added to make 8 mL, and 2 mL of 40% PEG in STC (freshly filtered) was added and mixed gently
by pipetting up and down. Finally, 700 μL DMSO was added and mixed in. The protoplast aliquots
(200 μL) can be stored at -80°C for future transformations.
Approximately 10 μg of Gibson assembly plasmid were added to 100 μl of protoplasts thawed
on ice. The mixture was vortexed once and allowed to rest on ice for 30 min. 1 mL of 40 % PEG in
STC (freshly filtered) was added, and the mixture was incubated at RT for 30 min. 10 mL GMM +
0.6 M KCl was added in a 50 mL tube together with the protoplast mixture. The tube was
incubated at 30 °C with shaking at 80 rpm for 1 hour to recover protoplasts. Protoplasts were
then centrifuged down at 800 g for 5 min. Since the pellet was not visible, approximately 1 mL
was left after removing supernatant. Protoplasts were resuspended in 12 mL of GMM + 0.6M KCl
+ 0.8 % agar (liquid agar was kept at 50 °C in a water bath). 60 μL phleomycin (0.1 mg/mL) was
added immediately before resuspension. The agar solution was mixed by pipetting up and down
twice and plated in the middle of 10 cm plates. After 1 hour, media was solid enough for a second
layer of 16 mL GMM + 0.6M KCl + 0.8 % agar with 80 μL phleomycin. After an additional hour of
cooling, plates were incubated at 30 °C with the protoplasts at the bottom (plate was right-side
up). Transformant colonies usually appeared after 4 - 5 days of incubation. Three colonies of each
transformation were picked and restreaked twice on GMM + phleomycin (1.5% agar, 0.1 mg/mL
phleomycin) plates. Emergent colonies were then restreaked on PDA for ample spore formation
and subsequent DNA extraction for sequencing of Cas9-targeted regions.

- 99 -

4.5.2 Strain cultivation and scale up

Wild type and mutant strains were cultured in citrinalin-producing media, which consisted of
60% MF nutrients and 20% Artificial Seawater (ASW) for 21 days at 30 °C. MF nutrients: glucose
20 g/L, soluble starch 10 g/L, soytone 20 g/L, peptone 5 g/L, beef extract 0.3 g/L and yeast extract
5 g/L dissolved in ddH 2O. ASW: CaCl 2 1.36 g/L, MgCl 2 9.68 g/L, KCl 0.61 g/L, NaCl 30.00 g/L,
Na 2HPO 4 0.14 mg/L, Na 2SO 4 3.47 g/L, NaHCO 3 0.17 g/L, H 3BO 3 30 mg/L dissolved in ddH 2O.
For scaling up to isolate the intermediate produced from the citG mutant, 12 ´ 50 mL of MF
media with 60% nutrients and 20% salts was inoculated with 1´ 10
5
spores/mL. After 8 days of
stationary culture at 30 °C, mycelia were removed using filter paper, and media was extracted
with an equal volume of ethyl acetate. Extracts were dried under reduced pressure. Filtered
mycelia were soaked in methanol overnight and filtered once again. Filtrate was again dried
under reduced pressure. Both dried extracts contained citrinalin-amine and were combined
(crude weight = 0.5 g). C-18 reverse phase flash chromatography with 10, 30, 50, 70 and 100%
methanol in ddH 2O were performed. Yielded fractions (50% and 70%) contained citrinalin-amine
and impurities. These fractions were lyophilized and further purified using semi-preparative HPLC.
The gradient system used to purify the fractions was 5% MeCN / H 2O (solvent A) and MeCN
(solvent B) both containing 0.05% TFA. The gradient was 0 - 5 min 0% B, 5-5.1 min 0 - 25% B, 5.1
- 15 min 25 - 35% B, 15 - 15.1 min 35 - 100% B, 15.1 - 17.5 min 100% B, 17.5 - 18 min 100 - 0% B,
18 - 20 min 0% B with citrinalin-amine eluting at 9 min. Roughly 5 mg of pure compound was
obtained and dissolved in 1 mL of DMSO-d 6 for NMR analysis.

- 100 -

4.5.3 Genome sequencing and analyzing

Since paraherquamide and citrinalins share a similar dipeptide core, the NRPS (phqB) of the
paraherquamide pathway was used as a probe to mine the genomic assembly of P. citrinum and
a hit was found on contig Node_754 (67,287 bp). Further analysis indicated that the contig
contains the gene cluster of citrinalin biosynthesis. The gene cluster is laden with modifying
enzymes (P450 monooxygenases or FAD monooxygenase, one oxidoreductase and one short-
chain dehydrogenase).

- 101 -

4.6 Supporting Information

Supplemental Table 4.2: Primers used in this study.

Primer Sequence (5' → 3')
Primers used for amplifying sgRNA fragments
333_diagnostic_FW GAT GTA GGT AAG CCC GCC
333_diagnostic_Rev GGG CTC AAA CCC TTG GCT
CitA_FW1 TCA TAG CTG TTT CCG CTG A
CitA_Rev1
TCT CAC GTA GGG CAA TTG CAG ACG AGC TTA CTC GTT TCG TCC
TCA CGG ACT CAT CAG TGC AAT CGG TGA TGT CTG CTC AAG
CitA_FW2
TCG TCT GCA ATT GCC CTA CGT GAG AGT TTT AGA GCT AGA AAT
AGC AAG TTA AA
CitA_Rev2 ATT CTG CTG TCT CGG CTG
CitB_Rev1 TGC CTT GAC TGG AAT GAA AG…
CitB_FW2 …CTT TCA TTC CAG TCA AGG CA…
CitC_Rev1 GAG TAT TGA GGA TGG TGC AG…
CitC_FW2 …CTG CAC CAT CCT CAA TAC TC…
CitD_Rev1 GGA GGA GTA AGT TTA TAG AA…
CitD_FW2 …TTC TAT AAA CTT ACT CCT CC…
CitE_Rev1 AGG GCT CTT GAT ACA TGA AG…
CitE_FW2 …CTT CAT GTA TCA AGA GCC CT…
CitF_Rev1 TAC CTC ATC ATC CGA ATT AG…
CitF_FW2 …CTA ATT CGG ATG ATG AGG TA…
CitG_Rev1 GTA CGG ATT TGG AAT GCG TA…
CitG_FW2 …TAC GCA TTC CAA ATC CGT AC…
CitH_Rev1 AGC TCA CGA AGA GCA CTG GC…
CitH_FW2 …GCC AGT GCT CTT CGT CAG CT…
CitI_Rev1 CCA ACC ACA GTA TAT CCT GA…
CitI_FW2 …TCA GGA TAT ACT GTG GTT GG…
CitJ_Rev1 TTA AAT GTT ACT TGT TTC CA…
CitJ_FW2 …TGG AAA CAA GTA ACA TTT AA…
CitK_Rev1 CAA TAA GAG AGA TTT CGG GG…
CitK_FW2 …CCC CGA AAT CTC TCT TAT TG…
CitL_Rev1 TTA CCC TGA CGA GTG GTG CT…
CitL_FW2 …AGC ACC ACT CGT CAG GGT AA…
Primers used for sequencing mutant strains
CitA_seq_FW GGG CAG CGA ATC TTG CAT C
CitA_seq_Rev AGC ATT GGC CCA TAC TGC G
CitB_seq_FW CGA GAA ACT CCT CTG CAC C
CitB_seq_Rev CCG TCC TCC TTG TTC TTG AG
CitC_seq_FW CCG GCA GAG CAC CAT GAG
CitC_seq_Rev CAC TGG AGA TAC CAG ACC AC
CitD_seq_FW CCA GCG ATT CTT TAC AAC CC
CitD_seq_Rev CGC AGT TCT GTG ACG ATC G

- 102 -
CitE_seq_FW GAC ACT TGG AGC ACT TGT GT
CitE_seq_Rev GCC ACG TTG TGC GAA TCA T
CitF_seq_FW GAT GTA GGT AAG CCC GCC
CitF_seq_Rev GGG CTC AAA CCC TTG GCT
CitG_seq_FW TCA GGC CGG TAG AGC TCC
CitG_seq_Rev GGA GGA ATG TCA AGC TCA GC
CitH_seq_FW GTA TCT GTG GTT GGA GCT AC
CitH_seq_Rev CCT CGC ACA AAG GTA TCG A
CitI_seq_FW GCA ATA CCA CAT GGC GTG
CitI_seq_Rev CCA CTG ATA AAC CGC GCT
CitJ_seq_FW TCG CTT GCG CAT TCT CCA
CitJ_seq_Rev TGA AGT CCT TCG CCA TCC
CitK_seq_FW GGC ACA TGA ATT CGG CCA
CitK_seq_Rev GAC GTG CTG AGT CGA TAC
CitL_seq_FW GAC ACA CGG TCT CCA ATG
CitL_seq_Rev GAT GAC TGG TCA AGC AGG

- 103 -

Supplemental Table 4.3: Chemical shifts comparison between citG mutant intermediate and
citrinalin A and B.

- 104 -

Supplemental Figure 4.5: Effective concentration (0.1 mg/mL) of phleomycin for P. citrinum
protoplast growth inhibition.

- 105 -

Supplemental Figure 4.6: Sequencing data of wild type and citA mutant of P. citrinum in the
targeted region. A deletion of nucleotides was observed near the protospacer (green bar).

- 106 -

Supplemental Figure 4.7: Sequencing data of wild type and citB mutant of P. citrinum in the
targeted region. A deletion of nucleotides was observed near the protospacer (green bar).

- 107 -

Supplemental Figure 4.8: Sequencing data of wild type and citC mutant of P. citrinum in the
targeted region. A deletion of nucleotides was observed near the protospacer (green bar).

- 108 -

Supplemental Figure 4.9: Sequencing data of wild type and citD mutant of P. citrinum in the
targeted region. A deletion of one nucleotide was observed near the protospacer (green bar).

- 109 -

Supplemental Figure 4.10: Sequencing data of wild type and citE mutant of P. citrinum in the
targeted region. A deletion of one nucleotide was observed near the protospacer (green bar).

- 110 -

Supplemental Figure 4.11: Sequencing data of wild type and citF mutant of P. citrinum in the
targeted region. A deletion of nucleotides was observed near the protospacer (green bar).

- 111 -

Supplemental Figure 4.12: Sequencing data of wild type and citG mutant of P. citrinum in the
targeted region. A large deletion of nucleotides was observed near the protospacer (green bar).

- 112 -

Supplemental Figure 4.13: Sequencing data of wild type and citH mutant of P. citrinum in the
targeted region. A deletion of nucleotides was observed near the protospacer (green bar).

- 113 -

Supplemental Figure 4.14: Sequencing data of wild type and citI mutant of P. citrinum in the
targeted region. A deletion of nucleotides was observed near the protospacer (green bar).

- 114 -

Supplemental Figure 4.15: Sequencing data of wild type and citJ mutant of P. citrinum in the
targeted region. A deletion of nucleotides was observed near the protospacer (green bar).

- 115 -

Supplemental Figure 4.16: Sequencing data of wild type and citK mutant of P. citrinum in the
targeted region. A deletion of nucleotides was observed near the protospacer (green bar).

- 116 -

Supplemental Figure 4.17: Sequencing data of wild type and citL mutant of P. citrinum in the
targeted region. A deletion of nucleotides was observed near the protospacer (green bar).

- 117 -

Supplemental Figure 4.18:
1
H NMR spectrum of citrinalin amine in DMSO-d 6 (400 MHz).

1.5 2.0 2.5 3.0 3.5 4.0 4.5 5.0 5.5 6.0 6.5 7.0 7.5 8.0 8.5 9.0 9.5 10.0 10.5
f1 (ppm)
-200
-100
0
100
200
300
400
500
600
700
800
900
1000
1100
1200
1300
1400
1500
1600
1700
1800
1900
2000
2100
2200
PROTON_01
Pcit10B_peak2
0.87
0.93
3.00
1.32
2.04
1.01
17.67
1.06
1.00
0.77
1.7196
1.7548
1.8452
1.8589
1.8736
1.8894
1.9231
2.0248
2.0638
2.0727
2.0832
2.0912
2.0985
2.1222
2.1485
2.1845
2.2446
2.2823
2.7195
2.7610
2.8199
2.8616
3.0314
3.0625
3.2436
3.4210
3.5057
3.6073
3.8631
6.5775
6.5984
7.7153
7.7362
10.1710

- 118 -

Supplemental Figure 4.19:
13
C NMR spectrum of citrinalin amine in DMSO-d 6 (400 MHz).

10 20 30 40 50 60 70 80 90 100 110 120 130 140 150 160 170 180 190 200 210
f1 (ppm)
-1000
0
1000
2000
3000
4000
5000
6000
7000
8000
9000
10000
11000
CARBON_01
Eva
19.2495
20.3599
21.1663
22.7418
25.7639
26.0236
26.5375
42.6037
44.0634
46.1292
48.0084
54.8833
58.3309
58.8515
59.7814
61.3506
79.3061
105.0828
109.2735
120.5463
132.9933
142.6079
158.8615
183.2371
192.6780

- 119 -

Supplemental Figure 4.20: COSY spectrum of citrinalin amine in DMSO-d 6 (400 MHz).

-1.0 -0.5 0.0 0.5 1.0 1.5 2.0 2.5 3.0 3.5 4.0 4.5 5.0 5.5 6.0 6.5 7.0 7.5 8.0 8.5 9.0 9.5 10.0 10.5 11.0
f2 (ppm)
-1
0
1
2
3
4
5
6
7
8
9
10
11
f1 (ppm)
gCOSY_01
Pcit10B_peak2

- 120 -

Supplemental Figure 4.21: HMBC spectrum of citrinalin amine in DMSO-d 6 (400 MHz).

-1 0 1 2 3 4 5 6 7 8 9 10 11 12 13 14
f2 (ppm)
0
20
40
60
80
100
120
140
160
180
200
220
f1 (ppm)
gHMBC_01
Pcit10B_peak2

- 121 -

Supplemental Figure 4.22: HMQC spectrum of citrinalin amine in DMSO-d 6 (400 MHz).

-1 0 1 2 3 4 5 6 7 8 9 10 11 12 13 14
f2 (ppm)
0
10
20
30
40
50
60
70
80
90
100
110
120
130
140
150
f1 (ppm)
gHMQC_01
Pcit10B_peak2

- 122 -

Chapter 5 _____________________________________________

Extend the application of in vitro CRISPR-RNP system in Penicillium
rubens and Scopulariopsis candida

5.1 Introduction

In Chapters 2 and 3, we successfully established in vitro CRISPR-RNP systems in wild-type
Aspergillus wentii and Aspergillus melleus. We achieved high transformation efficiencies in both
strains. We then decided to extend the application of the in vitro CRISPR system to other wild-
type fungal species to further explore the efficacy of this system. As the first known species to
produce the antibiotic penicillin, Penicillium rubens was also found to produce many important
compounds with interesting bioactivities such as andrastin and roquefortine.
113,114
By
establishing an in vitro CRISPR system, wild-type P. rubens can be easily genetically manipulated
to promote SM biosynthesis. Therefore, Penicillium rubens IMV00188 was chosen as a target
strain in this study.
We also applied the same in vitro CRISPR-RNP system to a Scopulariopsis candida strain that
was previously sequenced and annotated in our laboratory. Anti-candida activities were
observed in this strain, and production of hymeglusin (1) and fusaridioic acid (2) was detected
when S. candida was cultivated on YES plates (20 g L
-1
yeast extract, 100 g L
-1
sucrose, 15 g L
-1

- 123 -
agar, and 1 ml L
-1
Hutner’s trace element solution). The hymeglusin cluster in S. candida was
previously predicted by comparing it with the hymeglusin cluster in Fusarium solani strain FSSC
5 v1.0.
115,116
To confirm the identity of the predicted cluster, a plasmid-facilitated CRISPR system
was established in S. candida using hymeglusin as a selectable marker (minimum effective
concentration at 0.4 mg/mL). Unfortunately, we had a problem confirming the knockout through
gene amplification of the target site. Unexpected large insertions or deletions of nucleotides
were introduced through the non-homologous end-joining (NHEJ) pathway. We then decided to
adopt the in vitro CRISPR-RNP system for gene manipulation in S. candida.

5.2 Results and Discussion

5.2.1 Genome sequencing and establishment of an in vitro CRISPR-RNP system for P. rubens

Wild-type P. rubens was cultivated on PDA plates for 6 days at 30°C followed by spore
harvesting and DNA extraction. DNA samples were sent to Novogene for Illumina NovaSeq
sequencing. The raw data retrieved from Novogene was assembled and annotated for genetic
analysis. The annotated genome was then analyzed with antiSMASH for gene cluster
identification. The predicted clusters in P. rubens are summarized in Table 5.1.
In order to identify a selectable marker and to determine an effective antibiotic concentration
to facilitate subsequent selection, we performed antibiotic resistance tests for both phleomycin
and hygromycin B. 1.0 × 10
6
of wild-type P. rubens protoplasts were inoculated onto GMM 6-well
plates with different concentrations of phleomycin (0, 0.01, 0.05, 0.1, 0.15, 0.2 mg/ml) or
hygromycin B (0, 0.01, 0.05, 0.1, 0.2, 0.3 mg/ml). P. rubens showed high resistance to hygromycin

- 124 -
B, while it was very sensitive to phleomycin. The minimum effective concentration of phleomycin
was found to be 0.05 mg/ml (Figure 5.1).

Table 5.1: Secondary metabolite clusters predicted by antismash v5.2.0.
(i) (ii)
Figure 5.1: Antibiotic sensitivity tests of P. rubens against hygromycin B (i) and phleomycin (ii). P.
rubens is highly resistant to hygromycin B. The minimum inhibitory concentration was determined
to be 0.05 mg/mL of phleomycin.

- 125 -
To have a better understanding of the transformation efficiency for P. rubens using the in
vitro CRISPR-Cas9 system, we decided to first target the pigment-associated gene, pksP. Using
the pksP in A. fumigatus (Afu2g17600) as a probe, we successfully located the pksP homolog in
P. rubens (010364). CrRNAs were designed to target 5’ UTR and 3’ UTR of pksP separately, and
both target sites were followed by functional PAM sequences. To form a ribonucleoprotein (RNP)
complex, crRNAs were assembled in vitro with tracrRNA and Cas9. The RNP complex was then
delivered to wild-type P. rubens protoplasts together with phleomycin repair templates during
transformation. White transformants appeared on Day 4 and were restreaked to non-selective
PDA plates one day after. Fresh spores were harvested after 5 days of incubation of the
restreaked PDA plates. DNA extraction was performed, and a set of nested primers were
designed to amplify the pksP region in P. rubens. The wild-type PksP amplicon was approximately
7.5 kb, while the amplicon of mutant strains was around 2.5 kb. The PCR amplification results
indicate that the in vitro CRISPR-RNP system can work well in a wild-type P. rubens strain.

5.2.2 Upregulation of secondary metabolite production in P. rubens through mcrA deletion

Similar to the mcrA-deletion project of A. wentii, we decided to locate and delete the mcrA
homolog in P. rubens to upregulate SM production. Using the A. nidulans mcrA (AN8694) protein
sequence as a probe, we located the mcrA homolog (004635) in P. rubens. The crRNAs targeting
mcrA were designed and the phleomycin repair templates were amplified with 50 bp homologous
regions at both ends of the template. After transformation, small transformants appeared on Day
4 and were restreaked onto PDA plates the following day. As the lengths of mcrA and BleR are
very similar (around 1.5kb), a special set of nested primers were designed with the forward

- 126 -
primer bound within the mcrA coding region, while the reverse primer bound within the
phleomycin repair template. A 2.2 kb amplicon was generated in the mcrAΔ strain, while the wild
type yielded no amplicon. These PCR results showed that mcrA was successfully deleted in the P.
rubens strain.

Figure 5.2: Paired HPLC profiles of P. rubens (wild type and mcrAD strains) extracts when grown on
different solid media. (A) YAG, (B) PDA, and (C) YEPD plates. (i) wild-type strain, and (ii) mcrAD strain.

- 127 -
The wild-type P. rubens and mcrAΔ strains were cultivated on different solid media to assay
secondary metabolite profiles. Compounds were extracted from solid yeast extract glucose agar
(YAG), potato dextrose agar (PDA), and yeast extract peptone dextrose agar (YEPD). The
extracted samples were then analyzed through HPLC-DAD-MS. Comparative metabolite analysis
showed increased production of compounds in mcrAΔ strains (Figure 5.2). The results indicated
that deletion of mcrA upregulates gene clusters and creates opportunities for natural product
discovery in P. rubens. Identification and characterization of the upregulated SMs will be
performed in future studies.

5.2.3 Deletion of a backbone enzyme in the hymeglusin PKS cluster in Scopulariopsis candida
IMV00968 using an in vitro CRISPR strategy

The putative HR-PKS gene (008082) in the hymeglusin biosynthetic gene cluster was targeted
for cluster identification in S. candida. RNPs targeting both ends of the gene were assembled by
the designed crRNAs, tracrRNA, and Cas9 separately. The hymeglusin repair templates with 50
bp homologous flanking were generated through PCR amplification followed by gel extraction.
The RNPs and the repair templates were then delivered into wild-type S. candida protoplasts
through transformation. Because of the slow growth of S. candida, transformants appeared on
Day 8 and were available to be restreaked by Day 10. The restreaked mutant strains were
cultivated on non-selective PDA plates for spore harvesting followed by DNA extractions. The
amplified region of wild-type HR-PKS was expected to be around 13 kb, while the PCR
amplification showed the mutant strains have an amplicon around 2.8 kb. The result indicated
that the deletion of HR-PKS in S. candida was successful and therefore the in vitro CRISPR-RNP
system is applicable to genetically modify S. candida.

- 128 -
By culturing wild-type S. candida in different growth conditions, we found compounds 1 and
2 had an improved production on Sabouraud Dextrose Agar (SDA) compared to YES. Wild-type S.
candida and the PKSΔ strains were cultivated on SDA plates for 6 days at 30 °C. Compound
extractions were performed with methanol and dichloromethane. The HPLC profiles of the
extracted samples showed hymeglusin (1) and fusaridioic acid (2) were absent in the PKSΔ strain,
which confirmed the identity of the hymeglusin gene cluster that we located before (Figure 5.3).

Figure 5.3: Paired HPLC profiles of S. candida (wild type, PKSD strain) extracts when grown on a
solid SDA medium. (i) wild type and (ii) PKSD strain. Hymeglusin (1) and fusaridioic acid (2) detected
in wild-type S. candida was absence in PKSD strain.

- 129 -

5.3 Conclusion

In this study, we successfully applied an in vitro CRISPR-Cas9 system in P. rubens and S.
candida. The pigment-associated gene, pksP, was first deleted in P. rubens and the gene
replacement efficiency was shown to be high. A negative global regulator, mcrA, was then
identified using BLASTp and deleted in P. rubens to upregulate the production of SMs. By
cultivating the wild-type and mcrAΔ strains under different growth conditions, upregulation of
existing compounds and the appearance of new compounds were detected, indicating the
successful deletion of mcrA. We also successfully established the in vitro CRISPR system in S.
candida, a strain that previously had problems regarding plasmid-facilitated CRISPR. The PKS in
the hymeglusin cluster was targeted and deleted with a slightly modified transformation protocol.
The PKSΔ strains cultivated under hymeglusin-producing conditions showed abolished
production of hymeglusin and related compounds, indicating a successful establishment of the
CRISPR-RNP system in S. candida. Overall, this work shows that the in vitro CRISPR system can be
well-established in fungal species other than Aspergilli. For strains with limited genetic
tractability, in vitro CRISPR techniques represent a promising genetic engineering method to
facilitate future drug discovery efforts.

- 130 -
5.4 Methods

5.4.1 Molecular Genetic Procedures.

Phelomycin and hygromycin B were used as selectable markers for P. rubens and S. candida
respectively in this work based on the results of the antibiotic resistance tests (Figure 5.1).
Phleomycin and hygromycin B resistance cassettes were amplified from pFc333 and pFc332
respectively using primers with 50 bp homologous flanking. The amplified PCR products were
purified by gel extraction and the final DNA repair templates were eluted with Elution Buffer
(Qiagen, Cat. No. 19086).
The in vitro CRISPR-RNP components were ordered from Integrated DNA Technologies (IDT).
The crRNAs with designed 20 bp protospacers complementary to the target regions were
prepared as 100 µM stock solutions and stored at -20°C before use. The Cas9 nuclease was
diluted to a final concentration of 1 µg/µL with nuclease-free Cas9 working buffer (20 mM HEPES,
150 mM KCl, pH 7.5) and stored at -20°C. The crRNA and tracrRNA were assembled in equal molar
concentrations to become the guide RNA duplex (33 µM). The gRNA duplex was heated for 5 min
at 95°C and cooled to room temperature. 1.5 μL of each gRNA duplex was combined with 11 μL
of nuclease-free Cas9 working buffer and 0.75 μL of Cas9 to form the Cas9-gRNA
ribonucleoprotein complexes. The mixture was incubated for 5 min at room temperature. Two
RNP complexes targeting target 5’ UTR and 3’ UTR of the gene were combined to form a final
volume of 26.5 μL.

5.4.2 Transformation protocol.

Wild-type spores were collected from PDA plates after 5 days of incubation at 30°C. 1 × 10
8

spores were inoculated into 50 mL of Potato Dextrose Broth (PDB) in a 250 mL flask. The culture

- 131 -
was incubated at 30°C overnight with shaking at 135 rpm. Mycelia were filtered and resuspended
in a protoplasting buffer which was prepared by adding 1.2 g of VinoTaste Pro (VTP) in 20 mL of
1.1M KCl, 0.39M citric acid monohydrate buffer (pH 5.8, adjusted with 1.1M KOH). The
protoplasting buffer was vortexed for 15 min and centrifuged for 15 min at 1800 g. Supernatant
of the protoplasting buffer was filter-sterilized and incubated at 30°C for 4 hours with shaking at
100 rpm in a 50 mL flask. 5 mL of the protoplast suspension was transferred and overlaid with 5
mL 0.4 M ST (0.4 M D-sorbitol, 100 mM Tris-HCl, pH 8) into a 15 mL tube. The tube was
centrifuged for 15 min at 800g and 4 °C. The protoplasts were collected at the interface and
transferred into a new tube. Adding 15 mL ST (1.0 M D-sorbitol, 50 mM Tris-HCl, pH 8), the
solution was centrifuged at room temperature for 10 min at 800 g. The protoplasts were washed
with ST and centrifuged at room temperature at 800 g for 10 min. The pellet was resuspended in
STC buffer (1.0 M D-sorbitol, 50 mM CaCl 2, 50 mM Tris-HCl, pH 8). 100 μL (approximately 1.0 ´
10
6
) of protoplasts were added to the RNP mixture (26.5 µL) during transformation. The purified
repair template (around 3 µg) and 25 µL of polyethylene glycol (PEG)-CaCl 2 buffer (40% [wt/vol]
PEG 3350, 50 mM CaCl 2, 50 mM Tris-HCl, pH 8) was added immediately after transferring
protoplasts. The final mixture was incubated for 50 min on ice. A 1.25 mL PEG-CaCl 2 was added
to the mixture and the solution was incubated for 20 min at room temperature. The mixture was
brought to 2mL by adding STC buffer. 500 μL of suspension was spread on SMM agar plates (GMM
supplemented with 1.2 M sorbitol, 1.5% [wt/vol] agar) and the SMM plates were incubated at
room temperature overnight. A second layer of top agar (GMM supplemented with 1.2 M sorbitol,
0.7% [wt/vol] agar) containing phleomycin (0.05 mg/mL) or hygromycin B (0.4 mg/ml) was
overlaid. The transformed SMM plates were incubated for 5 days at 30°C.

- 132 -
5.5 Supporting Information

Supplemental Table 5.2: Primers used in this study.

Primer Sequence (5' → 3')
Primers used for amplifying sgRNA fragments
PksP_FW

CTTCTTTCTCCATATACGCCTGAAACCAATAATTCGCCACTGGGGAGA
CTGCTAGTGGAGGTCAACACAT
PksP_REV

AGAAAAGGACCCATATACAAATGTCCTGGAAGTAGGCACGCGCAGCC
CCAATGCGGTAGTGGGGATTTAC

McrA_FW

CCTGCATCCTTGACTCACCTCGTCTTATTCTTACCCCAGCAACACAAAT
GGCTAGTGGAGGTCAACACAT

McrA_REV

PKS_FW

PKS_REV

TTGATCCCCATTCCTCACCGGTCCCGCGTCGCATTCTTCGTGCGTTTCC
TATGCGGTAGTGGGGATTTAC

GTCCTGTCATACATGGTACTTGGCATACATATCACTTGGCATATCCAAG
CGCTAGTGGAGGTCAACACAT

CACTAGGAACCTACAATCAGTGCGCCTCCCCGTTCGCCGTCGCACCGC
CTCTTAATGCGGTAGTGGGGAT

Primers used for sequencing mutant strains

PksP_seq_FW

CTGGCGTTTCATCCTTCATC

PksP_seq_REV TCCACTTAGGCTCTGTAAGG

McrA_seq_FW TTCTCGGCTTCATAGCAACG

McrA_seq_REV GTTTCCTATGCGGTAGTGGG

PKS_seq_FW

PKS_seq_REV

GTTAAGTTCGTAGCGTCCAG

GCACTCTTGGCCAATCAAAG

- 133 -

Supplemental Figure 5.4: Transformation plates for pksP∆ and controls of P. rubens.
(A) P. rubens protoplasts grown without phleomycin showing regeneration. (B) P. rubens
protoplasts grown with phleomycin showing effective growth inhibition. (C) Transformed
colonies grown with phleomycin after transformation with RNPs and repair templates targeting
pksP. (D) – (F) Restreaked transformants lost pigmentation.

- 134 -

Supplemental Figure 5.5: Results of the diagnostic PCR amplification of pksP coding region in
wild type (7.5 kb) and pksPD strains (2.4 kb) of P. rubens.

- 135 -

Supplemental Figure 5.6: Transformation plates for mcrA∆ and controls of P. rubens. (A) P.
rubens protoplasts grown without phleomycin showing regeneration. (B) P. rubens protoplasts
grown with phleomycin showing effective growth inhibition. (C) Transformed colonies grown
with phleomycin after transformation with RNPs and repair templates targeting mcrA.

- 136 -

Supplemental Figure 5.7: Results of the diagnostic PCR amplification of mcrA coding region in
wild type (no band) and mcrAD strains (2.2 kb) of P. rubens.

- 137 -

Supplemental Figure 5.8: Results of the diagnostic PCR amplification of PKS coding region in PKSD
strains (2.8 kb) of S. Candida. The amplicon in wild type is expected to be around 13 kb (data not
shown) which exceeds the limit of long PCR amplification.

- 138 -

Chapter 6 _____________________________________________

Conclusions and perspectives

The development of genetic tools such as CRISPR-Cas9 have significantly improved the
process of novel compound discovery in filamentous fungi. As genome sequencing technologies
continue to grow, more wild-type fungal species become genetically accessible. The work
described in this dissertation details the CRISPR approaches that were established in non-model
fungal strains for studying bioactive metabolites. We also contributed our knowledge to the field
and proposed new approaches to manipulating fungal genomes for novel compound discovery.
Genome manipulation in wild-type fungal species is limited by the availability of efficient
selectable markers and the existence of the intact non-homologous end-joining DNA repair
system. In Chapter 2, we adopted an in vitro CRISPR-Cas9 technique to genetically engineer the
wild-type A. wentii strain. We deleted the negative transcriptional regulator, mcrA, by targeting
both ends of the gene through MMEJ and investigated its effect on secondary metabolism by
metabolic profiling. 15 upregulated SMs were detected in mcrAΔ strain and were found to be
related to the physcion/emodin pathway. To reveal SMs that were hidden due to an overlap with
the major compounds, we performed a second knockout targeting the physcion/emodin gene
cluster. Two additional SMs, aspergillic acid B and a new structurally-related compound

- 139 -
designated aspergillic acid E, were detected in the dual-knockout strain. Our results indicate that
in vitro CRISPR-Cas9 can be well-established in Aspergilli for novel SMs discovery.
In chapter 3, we applied the same in vitro CRISPR-RNP system in A. melleus to illustrate the
biosynthetic pathway of neoaspergillic acid, a compound previously proven to demonstrate
antibiotic, antifungal, and antitumor activities. We established normal laboratory growth
conditions for neoaspergillic acid production. Additionally, we found the gene cluster responsible
for producing neoaspergillic acid by using the cluster of aspergillic acid as a probe. The NRPS-like
core gene was deleted through in vitro CRISPR, and the resulting mutant strain stopped producing
the target compounds. Additional genes within the gene cluster have also been deleted for
elucidating the biosynthetic pathway of neoaspergillic acid. McrA was also deleted to enhance
the production of the compound and intermediates. The results showed that the biosynthesis of
SMs can be solved by establishing an in vitro CRISPR-RNP system in non-model fungi such as A.
melleus. As the strain with enhanced production of neoaspergillic acid has been generated, future
studies will focus on establishing the biological characteristics of this compound and its chelation
with different metals.
In Chapter 4, we investigated the biosynthesis of nitro compounds, citrinalin A and B,
produced by Penicillium citrinum using plasmid-facilitated CRISPR-Cas9. Using a structurally-
related compound, paraherquamide, as a probe, we found the gene cluster of citrinalin and
knocked out each gene individually within the gene cluster. An intermediate compound, citrinalin
amine, was detected and characterized in one of the mutant strains, citGΔ. This work
demonstrates the first known molecular genetic system for Penicillium rubens and the discovery
of a critical enzyme involved in introducing a nitro group in secondary metabolites. The cDNA of

- 140 -
citG will be further used as a probe in other fungal species for discovering novel gene clusters
that produce different nitro compounds.
In Chapter 5, we expanded the application of the in vitro CRISPR-RNP system in fungal species
other than Aspergilli. P. rubens and S. candida were selected as target strains and we successfully
established the in vitro CRISPR system in both strains through successful gene deletions. In P.
rubens, the genes PksP and mcrA were deleted separately which resulted in the lack of melanin
production and an upregulated production of SMs, respectively. In S. Candida, the core enzyme
of the hymeglusin gene cluster was targeted and the resulting mutant strain lost the ability to
produce hymeglusin. Both results indicate that in vitro CRISPR can be widespread in different
wild-type fungal species for genome manipulation. Discovery of novel bioactive compounds can
be further improved by this simplified and efficient genetic tool.
While the adaptations of CRISPR-Cas9 techniques in filamentous fungi are successful, one
should realize that we are still scratching the surface of CRISPR application. Techniques such as
CRISPRi and CRISPRa will be further developed and applied in more fungal models in future
studies. Additionally, more genetic tools will be created and optimized for cluster mining and
drug discovery. The work described in this dissertation has built a foundation for CRISPR
application in fungi and contributed to the future development of genetic manipulation.

- 141 -

Bibliography

(1) Keller NP. Fungal secondary metabolism: regulation, function and drug discovery. Nat
Rev Microbiol. 2019;17(3):167-180.

(2) Shukla, S. et al. Total phenolic content, antioxidant, tyrosinase and α- glucosidase
inhibitory activities of water soluble extracts of noble starter culture Doenjang, a
Korean fermented soybean sauce variety. Food Control, 2016;59, 854–861.

(3) Zhao L, Kim JC, Paik MJ, Lee W, Hur JS. A Multifunctional and Possible Skin UV
Protectant, (3R)-5-Hydroxymellein, Produced by an Endolichenic Fungus Isolated from
Parmotrema austrosinense. Molecules. 2016;22(1):26.

(4) Drott MT, Lazzaro BP, Brown DL, Carbone I, Milgroom MG. Balancing selection for
aflatoxin in Aspergillus flavus is maintained through interference competition with,
and fungivory by insects. Proc Biol Sci. 2017;284(1869):20172408.

(5) Pelaez, F. in Handbook of Industrial Mycology (ed. Zhiqiang, A.) (Marcel Dekker, New
York, NY, 2005).

(6) Schueffler A, Anke T. Fungal natural products in research and development. Nat Prod
Rep. 2014;31(10):1425-1448.

(7) Kück U, Bloemendal S, Teichert I. Putting fungi to work: harvesting a cornucopia of
drugs, toxins, and antibiotics. PLoS Pathog. 2014;10(3):e1003950.

(8) Butler MS, Robertson AA, Cooper MA. Natural product and natural product derived
drugs in clinical trials. Nat Prod Rep. 2014;31(11):1612-1661.

(9) Newman DJ, Cragg GM. Natural Products as Sources of New Drugs over the Nearly
Four Decades from 01/1981 to 09/2019. J Nat Prod. 2020;83(3):770-803.

(10) Trail F, Mahanti N, Rarick M, et al. Physical and transcriptional map of an aflatoxin
gene cluster in Aspergillus parasiticus and functional disruption of a gene involved
early in the aflatoxin pathway. Appl Environ Microbiol. 1995;61(7):2665-2673.

- 142 -

(11) Yu J, Chang PK, Ehrlich KC, et al. Clustered pathway genes in aflatoxin
biosynthesis. Appl Environ Microbiol. 2004;70(3):1253-1262.

(12) Chiang YM, Oakley BR, Keller NP, Wang CC. Unraveling polyketide synthesis in
members of the genus Aspergillus. Appl Microbiol Biotechnol. 2010;86(6):1719-1736.

(13) Hur GH, Vickery CR, Burkart MD. Explorations of catalytic domains in non-ribosomal
peptide synthetase enzymology. Nat Prod Rep. 2012;29(10):1074-1098.

(14) Schmidt-Dannert C. Biosynthesis of terpenoid natural products in fungi. Adv Biochem
Eng Biotechnol. 2015;148:19-61.

(15) Galagan JE, Henn MR, Ma LJ, Cuomo CA, Birren B. Genomics of the fungal kingdom:
insights into eukaryotic biology. Genome Res. 2005;15(12):1620-1631.

(16) Grigoriev IV, Nordberg H, Shabalov I, et al. The genome portal of the Department of
Energy Joint Genome Institute. Nucleic Acids Res. 2012;40(Database issue):D26-D32.

(17) Hewage RT, Aree T, Mahidol C, Ruchirawat S, Kittakoop P. One strain-many
compounds (OSMAC) method for production of polyketides, azaphilones, and an
isochromanone using the endophytic fungus Dothideomycete sp. Phytochemistry.
2014;108:87-94.

(18) Bode HB, Bethe B, Höfs R, Zeeck A. Big effects from small changes: possible ways to
explore nature's chemical diversity. Chembiochem. 2002;3(7):619-627.

(19) Hu Z, Ye Y, Zhang Y. Large-scale culture as a complementary and practical method for
discovering natural products with novel skeletons. Nat Prod Rep. 2021;38(10):1775-
1793.

(20) Brown DW, Lee SH, Kim LH, et al. Identification of a 12-gene Fusaric Acid Biosynthetic
Gene Cluster in Fusarium Species Through Comparative and Functional Genomics. Mol
Plant Microbe Interact. 2015;28(3):319-332.

(21) Chettri P, Bradshaw RE. LaeA negatively regulates dothistromin production in the pine
needle pathogen Dothistroma septosporum. Fungal Genet Biol. 2016;97:24-32.

(22) Oakley CE, Ahuja M, Sun WW, et al. Discovery of McrA, a master regulator of
Aspergillus secondary metabolism. Mol Microbiol. 2017;103(2):347-365.

(23) Lino CA, Harper JC, Carney JP, Timlin JA. Delivering CRISPR: a review of the challenges
and approaches. Drug Deliv. 2018;25(1):1234-1257.

- 143 -
(24) Cox DB, Platt RJ, Zhang F. Therapeutic genome editing: prospects and challenges. Nat
Med. 2015;21(2):121-131.

(25) Hacein-Bey-Abina S, Le Deist F, Carlier F, et al. Sustained correction of X-linked severe
combined immunodeficiency by ex vivo gene therapy. N Engl J Med.
2002;346(16):1185-1193.

(26) Kaiser J. Gene therapy. Seeking the cause of induced leukemias in X-SCID trial. Science.
2003;299(5606):495.

(27) Bibikova M, Golic M, Golic KG, Carroll D. Targeted chromosomal cleavage and
mutagenesis in Drosophila using zinc-finger nucleases. Genetics. 2002;161(3):1169-
1175.

(28) Christian M, Cermak T, Doyle EL, et al. Targeting DNA double-strand breaks with TAL
effector nucleases. Genetics. 2010;186(2):757-761.

(29) Ishino Y, Shinagawa H, Makino K, Amemura M, Nakata A. Nucleotide sequence of the
iap gene, responsible for alkaline phosphatase isozyme conversion in Escherichia coli,
and identification of the gene product. J Bacteriol. 1987;169(12):5429-5433.

(30) Jansen R, Embden JD, Gaastra W, Schouls LM. Identification of genes that are
associated with DNA repeats in prokaryotes. Mol Microbiol. 2002;43(6):1565-1575.

(31) Wiedenheft B, Lander GC, Zhou K, et al. Structures of the RNA-guided surveillance
complex from a bacterial immune system. Nature. 2011;477(7365):486-489.

(32) Chylinski K, Makarova KS, Charpentier E, Koonin EV. Classification and evolution of
type II CRISPR-Cas systems. Nucleic Acids Res. 2014;42(10):6091-6105.

(33) Jinek M, Chylinski K, Fonfara I, Hauer M, Doudna JA, Charpentier E. A programmable
dual-RNA-guided DNA endonuclease in adaptive bacterial immunity. Science.
2012;337(6096):816-821.

(34) Qi LS, Larson MH, Gilbert LA, et al. Repurposing CRISPR as an RNA-guided platform for
sequence-specific control of gene expression Cell. 2013;152(5):1173-1183.

(35) Tanenbaum ME, Gilbert LA, Qi LS, Weissman JS, Vale RD. A protein-tagging system for
signal amplification in gene expression and fluorescence imaging. Cell.
2014;159(3):635-646.

(36) Niu Y, Shen B, Cui Y, et al. Generation of gene-modified cynomolgus monkey via
Cas9/RNA-mediated gene targeting in one-cell embryos. Cell. 2014;156(4):836-843.

- 144 -

(37) Wu Y, Liang D, Wang Y, et al. Correction of a genetic disease in mouse via use of
CRISPR-Cas9. Cell Stem Cell. 2013;13(6):659-662.

(38) Long C, McAnally JR, Shelton JM, Mireault AA, Bassel-Duby R, Olson EN. Prevention of
muscular dystrophy in mice by CRISPR/Cas9-mediated editing of germline
DNA. Science. 2014;345(6201):1184-1188.

(39) Ballance DJ, Buxton FP, Turner G. Transformation of Aspergillus nidulans by the
orotidine-5'-phosphate decarboxylase gene of Neurospora crassa. Biochem Biophys
Res Commun. 1983;112(1):284-289.

(40) Boeke JD, LaCroute F, Fink GR. A positive selection for mutants lacking orotidine-5'-
phosphate decarboxylase activity in yeast: 5-fluoro-orotic acid resistance. Mol Gen
Genet. 1984;197(2):345-346.

(41) Abbasi S, Parmar G, Kelly RD, Balasuriya N, Schild-Poulter C. The Ku complex: recent
advances and emerging roles outside of non-homologous end-joining. Cell Mol Life Sci.
2021;78(10):4589-4613.

(42) Nødvig CS, Nielsen JB, Kogle ME, Mortensen UH. A CRISPR-Cas9 System for Genetic
Engineering of Filamentous Fungi. PLoS One. 2015;10(7):e0133085.

(43) Al Abdallah Q, Ge W, Fortwendel JR. A Simple and Universal System for Gene
Manipulation in Aspergillus fumigatus: In Vitro-Assembled Cas9-Guide RNA
Ribonucleoproteins Coupled with Microhomology Repair Templates. mSphere.
2017;2(6):e00446-17.

(44) Findlay GM, Boyle EA, Hause RJ, Klein JC, Shendure J. Saturation editing of genomic
regions by multiplex homology-directed repair. Nature. 2014;513(7516):120-123.

(45) Zhu H, Li C, Gao C. Applications of CRISPR-Cas in agriculture and plant
biotechnology. Nat Rev Mol Cell Biol. 2020;21(11):661-677.

(46) Roux I, Woodcraft C, Hu J, Wolters R, Gilchrist CLM, Chooi YH. CRISPR-Mediated
Activation of Biosynthetic Gene Clusters for Bioactive Molecule Discovery in
Filamentous Fungi. ACS Synth Biol. 2020;9(7):1843-1854.

(47) Mali P, Aach J, Stranges PB, et al. CAS9 transcriptional activators for target specificity
screening and paired nickases for cooperative genome engineering. Nat Biotechnol.
2013;31(9):833-838.

(48) Chavali AK, Rhee SY. Bioinformatics tools for the identification of gene clusters that
biosynthesize specialized metabolites. Brief Bioinform. 2018;19(5):1022-1034.

- 145 -

(49) Keller NP, Turner G, Bennett JW. Fungal secondary metabolism - from biochemistry to
genomics. Nat Rev Microbiol. 2005;3(12):937-947.

(50) Chiang YM, Wang CCC, Oakley BR. Analyzing Fungal Secondary Metabolite Genes and
Gene Clusters. In Natural Products; John Wiley & Sons, Ltd, 2014; pp 171–193.

(51) de Vries RP, Riley R, Wiebenga A, et al. Comparative genomics reveals high biological
diversity and specific adaptations in the industrially and medically important fungal
genus Aspergillus. Genome Biol. 2017;18(1):28.

(52) Kjærbølling I, Vesth TC, Frisvad JC, et al. Linking secondary metabolites to gene clusters
through genome sequencing of six diverse Aspergillus species. Proc Natl Acad Sci U S A.
2018;115(4):E753-E761.

(53) Kjærbølling I, Vesth T, Frisvad JC, et al. A comparative genomics study of 23 Aspergillus
species from section Flavi. Nat Commun. 2020;11(1):1106.

(54) Vesth TC, Nybo JL, Theobald S, et al. Investigation of inter- and intraspecies variation
through genome sequencing of Aspergillus section Nigri. Nat Genet. 2018;50(12):1688-
1695.

(55) Kjærbølling I, Vesth T, Andersen MR. Resistance Gene-Directed Genome Mining of
50 Aspergillus Species. mSystems. 2019;4(4):e00085-19.

(56) Selva A, Traldi P, Camarda L, Nasini G. New secondary metabolites of Aspergillus wentii
Wehmer. The positive and negative ion mass spectra produced by electron
impact. Biomed Mass Spectrom. 1980;7(4):148-152.

(57) Miao FP, Liang XR, Liu XH, Ji NY. Aspewentins A-C, norditerpenes from a cryptic
pathway in an algicolous strain of Aspergillus wentii. J Nat Prod. 2014;77(2):429-432.

(58) Ramakrishna S, Kwaku Dad AB, Beloor J, Gopalappa R, Lee SK, Kim H. Gene disruption
by cell-penetrating peptide-mediated delivery of Cas9 protein and guide RNA. Genome
Res. 2014;24(6):1020-1027.

(59) Pohl C, Kiel JA, Driessen AJ, Bovenberg RA, Nygård Y. CRISPR/Cas9 Based Genome
Editing of Penicillium chrysogenum. ACS Synth Biol. 2016;5(7):754-764.

(60) Kuivanen J, Korja V, Holmström S, Richard P. Development of microtiter plate scale
CRISPR/Cas9 transformation method for Aspergillus niger based on in vitro assembled
ribonucleoprotein complexes. Fungal Biol Biotechnol. 2019;6:3.

- 146 -
(61) Nagy G, Szebenyi C, Csernetics Á, et al. Development of a plasmid free CRISPR-Cas9
system for the genetic modification of Mucor circinelloides. Sci Rep. 2017;7(1):16800.

(62) Ran FA, Hsu PD, Wright J, Agarwala V, Scott DA, Zhang F. Genome engineering using
the CRISPR-Cas9 system. Nat. Protoc. 2013, 8, 2281−2308.

(63) Sakuma T, Nakade S, Sakane Y, Suzuki KT, Yamamoto T. MMEJ-assisted gene knock-in
using TALENs and CRISPR-Cas9 with the PITCh systems. Nat Protoc. 2016;11(1):118-
133.

(64) Bok JW, Keller NP. LaeA, a regulator of secondary metabolism in Aspergillus
spp. Eukaryot Cell. 2004;3(2):527-535.

(65) Grahl N, Demers EG, Crocker AW, Hogan DA. Use of RNA-Protein Complexes for
Genome Editing in Non-albicans Candida Species. mSphere. 2017;2(3):e00218-17.

(66) Shrivastav M, De Haro LP, Nickoloff JA. Regulation of DNA double-strand break repair
pathway choice. Cell Res. 2008;18(1):134-147.

(67) Choquer M, Robin G, Le Pêcheur P, Giraud C, Levis C, Viaud M. Ku70 or Ku80
deficiencies in the fungus Botrytis cinerea facilitate targeting of genes that are hard to
knock out in a wild-type context. FEMS Microbiol Lett. 2008;289(2):225-232.

(68) Du L, Zhu T, Liu H, Fang Y, Zhu W, Gu Q. Cytotoxic polyketides from a marine-derived
fungus Aspergillus glaucus. J Nat Prod. 2008;71(11):1837-1842.

(69) Nielsen MT, Nielsen JB, Anyaogu DC, et al. Heterologous reconstitution of the intact
geodin gene cluster in Aspergillus nidulans through a simple and versatile PCR based
approach. PLoS One. 2013;8(8):e72871.

(70) Secondary metabolites, 3D structure: Trivial name – Citraconic anhydride metabolite 1.
The Aspergillus Website. http://www.aspergillus.org.uk. March 2022 accessed.

(71) Argade NP, Easwar S. A facile synthesis and enzymatic resolution of naturally occurring
remotely functionalized alkylmethylmaleic anhydrides from Aspergillus wentii:
Aspergillus acids A-D. Synthesis 2006; 2006, 831−838.

(72) Tsai HF, Wheeler MH, Chang YC, Kwon-Chung KJ. A developmentally regulated gene
cluster involved in conidial pigment biosynthesis in Aspergillus fumigatus. J Bacteriol.
1999;181(20):6469-6477.

(73) Sugareva V, Härtl A, Brock M, et al. Characterisation of the laccase-encoding gene abr2
of the dihydroxynaphthalene-like melanin gene cluster of Aspergillus fumigatus. Arch
Microbiol. 2006;186(5):345-355.

- 147 -

(74) Krappmann S, Sasse C, Braus GH. Gene targeting in Aspergillus fumigatus by
homologous recombination is facilitated in a nonhomologous end- joining-deficient
genetic background. Eukaryot Cell. 2006;5(1):212-215.

(75) Shiina T, Ozaki T, Matsu Y, et al. Oxidative Ring Contraction by a Multifunctional
Dioxygenase Generates the Core Cycloocatadiene in the Biosynthesis of Fungal Dimeric
Anhydride Zopfiellin. Org Lett. 2020;22(5):1997-2001.

(76) de Mattos-Shipley KMJ, Spencer CE, Greco C, et al. Uncovering biosynthetic
relationships between antifungal nonadrides and octadrides. Chem Sci.
2020;11(42):11570-11578.

(77) Stajich J, Palmer J. AAFTF-v0.2, 2018. https://zenodo.org/record/1620527 (accessed
April 2022).

(78) Prjibelski A, Antipov D, Meleshko D, Lapidus A, Korobeynikov A. Using SPAdes De Novo
Assembler. Curr Protoc Bioinformatics. 2020;70(1):e102.

(79) Brown CT, Irber L. Sourmash: a library for MinHash sketching of DNA. JOSS 2016; 1 (5),
27.

(80) Smit AFA, Hubley R. RepeatModeler-v1.0, (2008−2015). http://www.repeatmasker.org
(accessed April 2022).

(81) Love J, Palmer J, Stajich J, Esser T, Kastman E, Winter D. Funannotate-v1.5.0, 2018.
https://zenodo.org/record/1342272 (accessed April 2022).

(82) Kim D, Paggi JM, Park C, Bennett C, Salzberg SL. Graph-based genome alignment and
genotyping with HISAT2 and HISAT-genotype. Nat Biotechnol. 2019;37(8):907-915.

(83) Grabherr MG, Haas BJ, Yassour M, et al. Full-length transcriptome assembly from RNA-
Seq data without a reference genome. Nat Biotechnol. 2011;29(7):644-652.

(84) Haas BJ, Salzberg SL, Zhu W, et al. Automated eukaryotic gene structure annotation
using EVidenceModeler and the Program to Assemble Spliced Alignments. Genome
Biol. 2008;9(1):R7.

(85) Blin K, Wolf T, Chevrette MG, et al. antiSMASH 4.0-improvements in chemistry
prediction and gene cluster boundary identification. Nucleic Acids Res.
2017;45(W1):W36-W41.

(86) Nathens AB, Rotstein OD, Marshall JC. Tertiary peritonitis: clinical features of a
complex nosocomial infection. World J Surg. 1998;22(2):158-163.

- 148 -

(87) Pianalto KM, Alspaugh JA. New Horizons in Antifungal Therapy. J Fungi (Basel).
2016;2(4):26.

(88) Roemer T, Xu D, Singh SB, et al. Confronting the challenges of natural product-based
antifungal discovery. Chem Biol. 2011;18(2):148-164.

(89) Lebar MD, Cary JW, Majumdar R, et al. Identification and functional analysis of the
aspergillic acid gene cluster in Aspergillus flavus. Fungal Genet Biol. 2018;116:14-23.

(90) Xu X, He F, Zhang X, Bao J, Qi S. New mycotoxins from marine-derived fungus
Aspergillus sp. SCSGAF0093. Food Chem Toxicol. 2013;53:46-51.

(91) Morales-Sánchez V, Díaz CE, Trujillo E, et al. Bioactive Metabolites from the Endophytic
Fungus Aspergillus sp. SPH2. J Fungi (Basel). 2021;7(2):109.

(92) Zhu F, Chen G, Chen X, et al. Aspergicin, a new antibacterial alkaloid produced by
mixed fermentation of two marine-derived mangrove epiphytic fungi. Chem Nat
Compd. 2011; 47, 767–769.

(93) MacDonald JC. Toxicity, analysis, and production of aspergillic acid and its
analogues. Can J Biochem. 1973;51(9):1311-1315.

(94) Lebar MD, Mack BM, Carter-Wientjes CH, Gilbert MK. The aspergillic acid biosynthetic
gene cluster predicts neoaspergillic acid production in Aspergillus section Circumdati.
World Mycotoxin Journal, 2019;12, 213–222.

(95) Bao J, Wang J, Zhang XY, Nong XH, Qi SH. New Furanone Derivatives and Alkaloids from
the Co-Culture of Marine-Derived Fungi Aspergillus sclerotiorum and Penicillium
citrinum. Chem Biodivers. 2017;14(3):10.1002/cbdv.201600327.

(96) Guo C, Wang P, Pang X, et al. Discovery of a Dimeric Zinc Complex and Five
Cyclopentenone Derivatives from the Sponge-Associated Fungus Aspergillus
ochraceopetaliformis. ACS Omega. 2021;6(13):8942-8949.

(97) Zheng J, Wang Y, Wang J, Liu P, Li J, Zhu W. Antimicrobial ergosteroids and pyrrole
derivatives from halotolerant Aspergillus flocculosus PT05-1 cultured in a hypersaline
medium. Extremophiles. 2013;17(6):963-971.

(98) Parry R, Nishino S, Spain J. Naturally-occurring nitro compounds. Nat Prod Rep.
2011;28(1):152-167.

(99) Olender D, Żwawiak J, Zaprutko L. Multidirectional Efficacy of Biologically Active Nitro
Compounds Included in Medicines. Pharmaceuticals (Basel). 2018;11(2):54.

- 149 -

(100) Winkler R, Hertweck C. Biosynthesis of nitro compounds. Chembiochem.
2007;8(9):973-977.

(101) Romsdahl J, Wang CCC. Recent advances in the genome mining
of Aspergillus secondary metabolites (covering 2012-2018). Medchemcomm.
2019;10(6):840-866.

(102) Ju KS, Parales RE. Nitroaromatic compounds, from synthesis to
biodegradation. Microbiol Mol Biol Rev. 2010;74(2):250-272.

(103) Burrows BF, Turner WB. 1-Amino-2-nitrocyclopentanecarboxylic acid. A New
Naturally-occurring Nitro-compound. J Chem Soc C. 1966, (3), 255- &.

(104) Pimenta EF, Vita-Marques AM, Tininis A, et al. Use of experimental design for the
optimization of the production of new secondary metabolites by two Penicillium
species. J Nat Prod. 2010;73(11):1821-1832.

(105) Mercado-Marin EV, Garcia-Reynaga P, Romminger S, et al. Total synthesis and
isolation of citrinalin and cyclopiamine congeners. Nature. 2014;509(7500):318-324.

(106) Blunt JW, Copp BR, Keyzers RA, Munro MH, Prinsep MR. Marine natural products. Nat
Prod Rep. 2016;33(3):382-431.

(107) Yaegashi J, Romsdahl J, Chiang YM, Wang CCC. Genome mining and molecular
characterization of the biosynthetic gene cluster of a diterpenic meroterpenoid, 15-
deoxyoxalicine B, in Penicillium canescens. Chem Sci. 2016;7(3):2440.

(108) Wiemann P, Keller NP. Strategies for mining fungal natural products. J Ind Microbiol
Biotechnol. 2014;41(2):301-313.

(109) Yamazaki M, Okuyama E, Kobayashi M, Inoue H. The structure of paraherquamide, a
toxic metabolite from Penicillium paraherquei. Tetrahedron Lett. 1981, 22(2), 135-
136.

(110) Fraley AE, Caddell Haatveit K, Ye Y, et al. Molecular Basis for Spirocycle Formation in
the Paraherquamide Biosynthetic Pathway. J Am Chem Soc. 2020;142(5):2244-2252.

(111) Nielsen ML, Isbrandt T, Rasmussen KB, et al. Genes Linked to Production of Secondary
Metabolites in Talaromyces atroroseus Revealed Using CRISPR-Cas9. PLoS One.
2017;12(1):e0169712.

- 150 -
(112) Gibson DG, Young L, Chuang RY, Venter JC, Hutchison CA 3rd, Smith HO. Enzymatic
assembly of DNA molecules up to several hundred kilobases. Nat Methods.
2009;6(5):343-345.

(113) Houbraken J, Frisvad JC, Seifert KA, et al. New penicillin-producing Penicillium species
and an overview of section Chrysogena. Persoonia. 2012;29:78-100.

(114) Nielsen JC, Grijseels S, Prigent S, et al. Global analysis of biosynthetic gene clusters
reveals vast potential of secondary metabolite production in Penicillium species. Nat
Microbiol. 2017;2:17044.

(115) Liu SZ, Yan X, Tang XX, Lin JG, Qiu YK. New Bis-Alkenoic Acid Derivatives from a
Marine-Derived Fungus Fusarium solani H915. Mar Drugs. 2018;16(12):483.

(116) Šišić A, Baćanović-Šišić J, Al-Hatmi AMS, et al. The 'forma specialis' issue in Fusarium:
A case study in Fusarium solani f. sp. pisi. Sci Rep. 2018;8(1):1252.

Abstract (if available)

Abstract Natural products have proven to be an essential source of bioactive compounds throughout society. Natural products and their derivatives have been widely applied in the food, agriculture, cosmetic, and pharmaceutical industries. Secondary metabolites are low-molecular-weight natural products derived from central metabolic pathways. In contrast to primary metabolites, which are required for survival, secondary metabolites generally confer survival advantages to the host during competition with other organisms. The bioactivities of the produced secondary metabolites can be both beneficial and detrimental to humans. Antibiotic and antitumor effects of some secondary metabolites, such as penicillin and paclitaxel, can be used in medical treatments. At the same time, the toxicity of mycotoxins frequently leads to significant food contamination and subsequent crop loss. Thus, developing a considerable understanding of secondary metabolite biosynthesis is of critical importance.
Filamentous fungi are known to be prolific producers of secondary metabolites. Genome mining in fungal species has revealed a substantial potential for the discovery of novel bioactive natural products. However, the accessibility of genome manipulation in different wild-type fungal strains is often limited. Even though whole genome sequencing has revealed a large number of biosynthetic gene clusters responsible for secondary metabolite biosynthesis, the activation of those gene clusters is constrained by limited genetic tools. Fortunately, the development of CRISPR-Cas9-based genetic engineering strategies has vastly expanded our molecular genetic toolbox. As an efficient genetic technique that has been applied in plants, fish, and mammalian cells, CRISPR-Cas9 has recently been applied in fungal models toward the discovery of novel secondary metabolites.
The work described in this thesis details CRISPR-based approaches we have taken both to upregulate the production of secondary metabolites and to solve the biosynthetic pathways of secondary metabolites produced in non-model fungal species. Chapter 1 is an introduction to natural products with an emphasis on fungal secondary metabolism, and the application of different CRISPR-Cas9 engineering systems. In Chapter 2, we genetically engineered Aspergillus wentii to upregulate the production of several secondary metabolites by manipulating a negative transcriptional regulator, mcrA, using CRISPR-Cas9 with in vitro-assembled ribonucleoproteins. A novel compound bearing a maleic anhydride moiety, aspergillus acid E, was discovered in this work. In Chapter 3, we elucidated the biosynthetic pathway of neoaspergillic acid, a compound with antibacterial, antifungal, and antitumor activities in Aspergillus melleus using CRISPR-Cas9. In Chapter 4, we developed a genetic system for Penicillium citrinum using plasmid-facilitated CRISPR-Cas9. As the unknown biosynthetic pathway of organic nitro compounds has not yet been elucidated, we identified the first enzyme responsible for the critical conversion of an amine functional group to a nitro functional group. In Chapter 5, we expanded the application of our in vitro CRISPR-ribonucleoprotein system into Penicillium rubens and Scopulariopsis candida species. The successful establishment of in vitro-CRISPR systems in both strains indicates the widely applicable potential of this genetic system. In Chapter 6, I summarize all the findings, demonstrate their significance, and discuss the future directions of novel compound discovery in filamentous fungi using CRISPR-Cas9.

Linked assets

University of Southern California Dissertations and Theses

Conceptually similar

PDF

Genetic engineering of fungi to enhance the production and elucidate the biosynthesis of bioactive secondary metabolites

PDF

Genome mining of natural product biosynthesis pathways in filamentous fungi for novel drug discovery and production

PDF

Genome mining of secondary metabolites in Scedosporium apiospermum and Paecilomyces variotii using CRISPR-Cas9 technology

PDF

Application of genome-wide strategies for the mining of secondary metabolite biosynthesis pathways in filamentous fungi

PDF

Genome mining of secondary metabolites in Aspergillus terreus isolated from the Chernobyl Collection

PDF

Secondary metabolites biosynthesis in Aspergillus species revealed by fungal genome mining

PDF

Application of biological and chemical approaches to generate new and diverse fungal natural products

PDF

Secondary metabolites of Aspergillus nidulans

PDF

Uncovering the mechanism of the radiation tolerance of a Chernobyl isolated Cladosporium cladosporioides using genetic engineering

PDF

Molecular genetic mining of the secondary metabolome in Aspergillus nidulans

PDF

Examinations of secondary metabolites and their production in fungi and bacteria

PDF

Harnessing environmental and culture conditions to alter fungal ‘omics’

PDF

Genome engineering of filamentous fungi for efficient novel molecule production

PDF

Characterization of secondary metabolite compounds produced by Cladosporium sphaerospermum, an isolate from the Chernobyl site

PDF

Multi-omic data mining to elucidate molecular adaptation mechanisms of filamentous fungi exposed to space environment

PDF

Genome-scale screening in mammalian cells using CRISPR-Cas9 system

PDF

Mining the felinone A biosynthetic pathway

PDF

Semi-synthesis of sclerotiorin derivatives for tau aggregate inhibition and antifungal activity

PDF

Genetic and chemical characterization of two highly-reducing polyketide synthase clusters from Aspergillus species

PDF

Genetic engineering of non-reducing polyketide synthases by domain swap strategy in Aspergillus nidulans

Asset Metadata

Creator Yuan, Bo (author)

Core Title Genome manipulation of filamentous fungi for upregulating the production and illustrating the biosynthesis of valuable secondary metabolites using CRISPR-Cas9

School School of Pharmacy

Degree Doctor of Philosophy

Degree Program Pharmaceutical Sciences

Degree Conferral Date 2022-12

Publication Date 11/29/2024

Defense Date 10/26/2022

Publisher University of Southern California (original), University of Southern California. Libraries (digital)

Tag CRISPR-Cas9,filamentous fungi,genome mining,global transcriptional regulator,natural product,OAI-PMH Harvest,secondary metabolite

Format theses (aat)

Language English

Contributor Electronically uploaded by the author (provenance)

Advisor Wang, Clay (committee chair), Oakley, Berl (committee member), Okamoto, Curtis (committee member)

Creator Email evabboyuan@gmail.com,yuan984@usc.edu

Unique identifier UC112542522

Identifier etd-YuanBo-11336.pdf (filename)

Legacy Identifier etd-YuanBo-11336

Document Type Dissertation

Format theses (aat)

Rights Yuan, Bo

Internet Media Type application/pdf

Type texts

Source 20221201-usctheses-batch-993 (batch), University of Southern California (contributing entity), University of Southern California Dissertations and Theses (collection)

Access Conditions The author retains rights to his/her dissertation, thesis or other graduate work according to U.S. copyright law. Electronic access is being provided by the USC Libraries in agreement with the author, as the original true and official version of the work, but does not grant the reader permission to use the work if the desired use is covered by copyright. It is the author, as rights holder, who must provide use permission if such use is covered by copyright. The original signature page accompanying the original submission of the work to the USC Libraries is retained by the USC Libraries and a copy of it may be obtained by authorized requesters contacting the repository e-mail address given.

Repository Name University of Southern California Digital Library

Repository Location USC Digital Library, University of Southern California, University Park Campus MC 2810, 3434 South Grand Avenue, 2nd Floor, Los Angeles, California 90089-2810, USA

Repository Email cisadmin@lib.usc.edu