University of Southern California Dissertations and Theses

Expression of recombinant hepatitis B virus e antigen and analysis of its effect on macrophages

(USC Thesis Other)

Expression of recombinant hepatitis B virus e antigen and analysis of its effect on macrophages

PDF

Download a page range

Download transcript

Copy asset link

Request this asset

Transcript (if available)

Content

EXPRESSION OF RECOMBINANT HEPATITIS B VIRUS E
ANTIGEN AND ANALYSIS OF ITS EFFECT ON MACROPHAGES

by

Yanwen Zhu

A Thesis Presented to the
FACULTY OF THE USC KECK SCHOOL OF MEDICINE
UNIVERSITY OF SOUTHERN CALIFORNIA
In Partial Fulfillment of the
Requirements for the Degree
MASTER OF SCIENCE
(MOLECULAR MICROBIOLOGY AND IMMUNOLOGY)

August 2020

Copyright 2020 Yanwen Zhu
ii

ACKNOWLEDGEMENTS
This dissertation would not be realized without the generous support of many individuals.
I would like to thank all of them.
I would like to give thanks first and foremost to my supervisor Dr. Jing-Hsiung James Ou.
I am truly appreciative of his guidance and patience. His encouragement gave me more confidence
in my topic, and he always went over my experiment step-by-step to help me find a better strategy
once I encountered difficulties or failures on the experiment. I would also like to sincerely thank
my other committee members: Dr. Weiming Yuan and Dr. Keigo Machida for the valuable
comments and suggestions to my topic during the class presentation. I would like to thank Dr.
Chengyu Liang who provided me many valuable suggestions on experiments in my first semester.
Her strong passion and positive attitude toward science guided me to the correct direction of doing
research.
I would like to thank my mentor Kenneth Tsai, who provided lots of guidance and help on
my experiments and explained every new concept very patiently. I am also fortunate to have
worked with all my lab mates. The thesis cannot be completed without their generous assistance.
Finally, I would like to thank my family and my friends. Their support accompanied me all
the time in the past few years and they always encouraged me to try my best. Especially I would
like to thank my dog Rich, who is my only family member in this foreign country and her constant
company provided me lots of energy to overcome the difficulties.

iii

TABLE OF CONTENTS

ACKNOWLEDGEMENTS ............................................................................................................ ii

LIST OF FIGURES ....................................................................................................................... iv

ABBREVIATIONS ......................................................................................................................... v

ABSTRACT .................................................................................................................................. vii

CHAPTER 1: INTRODUCTION ................................................................................................... 1
1.1. HBV Life Cycle ............................................................................................................. 1
1.2. HBV Infection ............................................................................................................... 2
1.3. HBV Persistence ............................................................................................................ 3
1.4. Efficacy of Current Therapies ....................................................................................... 4
1.5. HBeAg and Macrophages in HBV Persistence ............................................................. 5

CHAPTER 2: MATERIALS AND METHODS ............................................................................. 8
2.1. Plasmids ............................................................................................................................ 8
2.2. Expression of rHBeAg in Epicurian coli BL21-codonplus
TM
(DE3)-RIL ........................ 8
2.3. Purification of rHBeAg ..................................................................................................... 9
2.4. RNA extraction ............................................................................................................... 10
2.5. Reverse Transcription-PCR and Quantitative Real-Time PCR Analysis........................ 10
2.6. Cell culture and treatment ............................................................................................... 10
2.7. Pulldown assay.................................................................................................................11
2.8. SDS-PAGE and Silver Staining ...................................................................................... 12
2.9. Immunofluorescence ....................................................................................................... 12

CHAPTER 3: RESULTS .............................................................................................................. 13
3.1. Construction of plasmid encoding the His-tagged HBeAg protein (rHBeAg) ............... 13
3.2. Expression of recombinant HBeAg (rHBeAg) ............................................................... 13
3.3. Purification of rHBeAg by affinity chromatography ...................................................... 14
3.4. The rHBeAg is biologically active ................................................................................. 15
3.5. The rHBeAg can be internalized into macrophages ....................................................... 16
3.6. Optimization of the amount of rHBeAg interacting with macrophages ......................... 17
3.7. Attempt to purify HBeAg receptor on macrophages ...................................................... 19

CHAPTER 4: DISCUSSION ........................................................................................................ 21

BIBLIOGRAPHY ......................................................................................................................... 27

iv

LIST OF FIGURES

Figure 1 Diagram of pET-HBeAg plasmid -----------------------------------------------------13
Figure 2 Overexpression of rHBeAg in Epicurian coli BL21-codonplus
TM
(DE3)-RIL --14
Figure 3 Analysis of proteins from pET-HBeAg-transformed Epicurian coli BL21-
codonplus
TM
(DE3)-RIL after affinity chromatography ----------------------------15
Figure 4 Quantification of mRNA levels of cytokines after rHBeAg treatment ----------16
Figure 5 Immunofluorescence staining of THP-1 cells treated with rHBeAg -------------17
Figure 6 Immunofluorescence staining of different rHBeAg titrations ---------------------18
Figure 7 Finding rHBeAg-interacting proteins in macrophages -----------------------------20

v

ABBREVIATIONS

cccDNA Covalently Closed Circular DNA
CHB Chronic Hepatitis B
CTL Cytotoxic CD8+ T cell
CTL Cytotoxic T Lymphocytes
FBS Fetal Bovine Serum
HBcAg Hepatitis B core antigen
HBeAg Hepatitis B e antigen
HBsAg Hepatitis B surface antigen
HBV Hepatitis B Virus
HBx Hepatitis B x antigen
HCC Hepatocellular Carcinoma
IFN Interferon
IPTG Isopropyl-b-D-Thiogalactopyranoside
LB Luria Broth
MS Mass Spectrometry
NK cells Natural killer cells
PBMC Peripheral Blood Mononuclear Cells
PBS Phosphate Buffered Saline

vi

PCR Polymerase Chain Reaction
pgRNA pregenomic RNA
PMA Phorbol 12-myristate 13-acetate
rcDNA Relaxed Circular DNA
rHBeAg Recombinant HBV e antigen
SDS-PAGE Sodium Dodecyl Sulphate Polyacrylamide Gel Electrophoresis

vii

ABSTRACT
Hepatitis B Virus (HBV) is a hepatotropic virus that can cause acute and chronic infections in
humans and is also one of the leading causes of hepatocellular carcinoma (HCC). Approximately
300 million people in the world are infected by HBV , resulting in approximately 1.1 million deaths
annually. Although HBV vaccines are available, effective therapies are still lacking for the large
number of chronically infected patients. HBV e antigen (HBeAg) is thought to be involved in
establishing viral persistence, which is tightly correlated with chronicity. Based on the finding that
maternal HBV e antigen (HBeAg) can alter the polarization phenotypes of macrophages of the
offspring and trigger anti-inflammatory responses (Tian et al., 2016), the interaction between
HBeAg and macrophages is critical in immune regulation and may be a novel therapeutic target
for chronically infected patients. In this report, we expressed and purified recombinant HBeAg
(rHBeAg) and demonstrated that rHBeAg could stimulate THP-1 human macrophages to produce
proinflammatory cytokines IL-6 and TNF-. This stimulation of THP-1 macrophages was specific,
as it could be blocked by the anti-HBeAg antibody. To understand how rHBeAg stimulated THP-
1 macrophages, we investigated the interaction between rHBeAg and THP-1 by
immunofluorescence staining and found that HBeAg could be internalized into macrophages
probably through receptor-mediated endocytosis. By performing His-tag pulldown experiment, we
attempted to isolate HBeAg-associating proteins from the macrophage to identify the putative
HBeAg receptor. The identification of the HBeAg receptor will allow us to further understand the
relationship between HBeAg and macrophages and develop therapeutic approaches for the
treatment of chronic HBV patients.
1

CHAPTER 1: INTRODUCTION
Hepatitis B Virus (HBV) is a partially double-stranded hepatotropic DNA virus and belongs to the
hepadnavirus family. It can establish acute and chronic infections of the liver and is one of the
leading causes of chronic hepatitis, cirrhosis, and hepatocellular carcinoma (HCC). Although
HBV vaccines have been available to prevent HBV infection for approximately 40 years, they
cannot be used to treat chronic HBV patients (Seeger and Mason, 2000). Approximately 3.5% of
global population is chronically infected with HBV . Current therapies can suppress viral
replication but generate sustained response in only a small fraction of patients. As such, patients
often require long-term treatment, leading to several side effects and the emergence of drug-
resistant mutants. Thus, it is essential to develop a more efficient antiviral therapy for chronic
patients (Yuen et al., 2018).

1.1. HBV Life Cycle
HBV has a small DNA genome (3.2 Kb), encoding seven proteins. Surface antigen (HBsAg),
which provides the basis for the current HBV vaccine, has three different forms (large, middle,
and major proteins) and are the viral envelope proteins. Hepatitis B core antigen (HBcAg)
forms nucleocapsid that encloses viral DNA. Hepatitis B e antigen (HBeAg) is a circulating
protein that is believed to have an immunomodulatory activity. DNA polymerase of HBV
contains a domain with reverse transcriptase activity and can reverse transcribe the viral
pregenomic RNA (pgRNA) and convert it into the relaxed circular DNA (rcDNA) genome. X

2

antigen (HBx) is a regulatory protein that promotes viral replication (Lee, 1997). Once the
virus enters the liver cell through the cell surface receptor, the nucleocapsid enters the host
nucleus and the rcDNA is released into the nucleoplasm and repaired to form the covalently
closed circular DNA (cccDNA). This cccDNA is transcribed into pregenomic RNA (pgRNA),
which serves as the template for reverse transcription to form the rcDNA genome. The
nucleocapsid containing rcDNA can either be re-imported to the nucleus and form cccDNA or
be enveloped to form progeny virus particles and released from the cell (Grimm et al., 2011).

1.2. HBV Infection
HBV can establish acute and chronic infections in humans. The only confirmed site of HBV
replication is hepatocytes (Seeger and Mason, 2000). Progression from acute to chronic
infection is strongly influenced by the age of acquiring the virus. Infection later in life usually
leads to acute, self-clearance of the virus and the patient will maintain life-long protective
immunity. If infection occurs early in life, which is the case in high HBV prevalence countries,
it is more often to develop chronic hepatitis following with liver fibrosis and cirrhosis (Yuen
et al., 2018). In HBV endemic areas such as East Asia and sub-Saharan Africa, where most
infections are acquired perinatally through vertical transmission, the host immune system is
often not able to distinguish the difference between the virus and host cells, leading to a high
possibility of developing life-long chronic infection. One potential mechanism of the
establishment of chronic infection by vertical transmission is that the immune system of

3

neonates has not yet fully developed and the immunomodulatory effects might be carried out
by HBeAg, which is not required for viral infection, replication and assembly. The other
possibility is the development of viral escape mutations, which helps virus escape from
vaccine-induced immune responses (Rehermann and Nascimbeni, 2005). In the West, most
infections are acute and acquired during adolescence and early adulthood by sexual activity,
injection drug use, and occupational exposure (Dienstag, 2008). Although the vaccine is
available nowadays, globally there are still 350-500 million people infected with HBV .
Furthermore, chronic HBV infection is a leading cause of the development of hepatocellular
carcinoma (HCC), liver failure and cirrhosis, which account for approximately 1 million deaths
worldwide annually (Lamontagne et al., 2016). HBV is not cytopathic and thus does not
directly kill host cells. Instead, the virus is recognized by host immune system and the infected
liver cells will then be attacked by self-immune response. If the immune system is over
activated, it can cause severe liver injury (Tang et al., 2018).

1.3. HBV Persistence
In chronic HBV infections, virus can persist in the host without being attacked by the host
immunity. Therefore, chronic infections become a public health problem and a therapeutic
challenge for clinicians. HBV has developed multiple strategies to evade host immune system
and establish viral persistence, including suppressing NK cells and cytotoxic T lymphocytes
(CTL) and educating fetal immunity (Tsai and Kuo, 2017). The largest challenge of eradicating

4

the virus is the stability of viral covalently closed circular DNA (cccDNA) (Rajbhandari and
Chung, 2016). After HBV infects the hepatocyte, the viral genome will either be integrated
into host DNA or enter the nucleus and be repaired to form cccDNA, which serves as the
template for viral RNA transcription (Tang et al., 2018). Therefore, the infected hepatocyte
becomes the reservoir of HBV viral replication, leading to the recurrence of the virus after
cessation the treatment (Tsai and Kuo, 2018). In addition, error-prone replication of HBV
genome that allows mutations in precore region is another factor that results in viral persistence.
Moreover, some viral components are involved in directly targeting host immune cells in order
to escape from recognition and attack of immune system (Rajbhandari and Chung, 2016).

1.4. Efficacy of Current Therapies
Currently there are two available therapies for the patients with chronic HBV infection:
interferon therapy and nucleos(t)ide analogues. Interferons (alpha, beta, and gamma) are
natural cytokines produced by the immune system in response to viral infections. They have
antiviral and immunomodulatory functions. Although the mechanism of the antiviral effect of
interferons is not well known, it is believed to play a role in the degradation of cccDNA and
viral messenger RNA and inhibition of viral DNA. Furthermore, interferon treatment may
boost the host immune response to facilitate viral clearance. Nucleos(t)ide analogues is another
commonly used treatment for HBV infection. They work by inhibiting the reverse transcriptase
activity of viral DNA polymerase. However, none of the therapies is optimal due to the failure

5

to eradicate the virus. The ideal outcome of the therapy is the loss of HBsAg, which indicates
viral DNA suppression. Unfortunately, only 3-11% of patients treated with interferons and 1-
12% of patients treated with nucleos(t)ide analogues achieves this result. Patients need a life-
long treatment, which may cause some toxic effects (Tang et al., 2019). Therefore, novel
antiviral therapies aiming to completely clear the virus need to be developed for chronic HBV
patients.

1.5. HBeAg and Macrophages in HBV Persistence
Hepatitis B e antigen (HBeAg) is an alternative gene product of HBV core gene. It is not a
structural component of HBV and not required for viral replication, but growing evidence
suggests that it plays an important role in maintaining viral persistence (Yang et al., 2019).
HBeAg is derived from the precore protein, which is encoded by the C gene. The precore
protein contains a hydrophobic leader peptide that directs the precore protein to the
endoplasmic reticulum. This is followed by the cleavage at its C-terminus to result in the
secretion of HBeAg (17 Kd). HBeAg is not essential for HBV replication because the mutation
that blocked HBeAg expression did not affect viral replication (Chen et al., 1992). It is often
used in clinic to indicate viral infectivity, severity of disease, and response to treatment.
Because HBeAg is highly conserved among all hepadnaviruses, it is believed to play an
important role in theHBV life cycle. It is known that vertical transmission is very common
throughout the world and is responsible for most chronic infections. A previous study

6

demonstrates that children born to mothers who are wildtype HBV carriers usually develop
chronic infection, but children born to mothers who are HBeAg-negative carriers often develop
self-limited acute infection, suggesting the importance of HBeAg in establishing viral
persistence in neonatal infection (Milich and Liang, 2003).

Many studies have confirmed that liver is the only target for HBV infection, liver cells become
the most suitable model to study the interaction between HBV and the host. Liver is composed
of many types of cells, but hepatocytes, ductule epithelium, and liver macrophages play the
most important functional roles (Seeger and Mason, 2000). Resident liver macrophages,
known as Kupffer cells, account for approximately 15% of total liver cells and are critical
components of the innate immune system. Kupffer cells are derived from the differentiation of
peripheral circulating monocytes which migrate into the liver. In the case of HBV infection,
viral particles and proteins are released from hepatocytes and can alter the function of Kupffer
cells through intracellular and surface receptors. In other words, HBV can regulate the host
immune response by interacting with Kupffer cells (Heydtmann, 2008). In chronic HBV
infection, Kupffer cells are involved in apoptosis of infected hepatocytes and liver
inflammation (Rehermann and Nascimbeni, 2005). One study found that after HBV injection
to the offspring born to an HBV-carrier mother, Kupffer cells (i.e., hepatic macrophages)
impaired CD8
+
cytotoxic T lymphocytes (CTL) responses by upregulating PD-L1 expression.
CTL activity of clearing virus was restored by depleting Kupffer cells, indicating that Kupffer
cells are essential for HBV persistence. It is previously mentioned that HBeAg may have some

7

important functions related to viral persistence during vertical transmission. The same study
concludes that the presence of maternal HBeAg is required for HBV to establish persistent
replication in the offspring. The following observation demonstrates that HBeAg can promote
viral persistence by triggering M2 polarization of Kupffer cells after the offspring was born to
a HBeAg-negative carrier mother, leading to an anti-inflammatory response (Tian et al., 2016).
The correlation between maternal HBeAg and the development of chronic hepatitis in the
offspring emphasizes that HBeAg plays a critical role in establishing chronicity. Furthermore,
the study of Kupffer cells and HBeAg provides us an insight that macrophages might be an
important target for HBeAg to regulate host immune responses. The purpose of this report is
to use recombinant HBeAg to examine the effect of HBeAg on macrophages.

8

CHAPTER 2: MATERIALS AND METHODS
2.1. Plasmids
Plasmid expressing HBeAg with a 6xHis-tag was generated by amplifying the HBeAg sequence
from the plasmid of HBV precore protein by the polymerase chain reaction (PCR). Primers
(HBeAgF: GGAAAGCTTATGTCCAAGCTGTGCCTTGGGTGG and HBeAgR:
GGACTCGAGAACAACAGTAGTTTCCGGAAGTGT) were used for the amplification. The
PCR was carried out in a thermal cycler, for 33 cycles, each consisting of 1 min at 95°C, 45 s at
55°C and 1.5 min at 72°C. At the end, an extra cycle of 5 min at 72°C was performed. The
amplified product was digested by appropriate enzymes and then inserted between Ndel and Xhol
sites of pET20b.

2.2. Expression of rHBeAg in Epicurian coli BL21-codonplus
TM
(DE3)-RIL
Plasmid pET-HBeAg was used to transform Epicurian coli BL21-codonplus
TM
(DE3)-RIL
competent cells. Bacteria were grown at 37°C in 500 ml of Luria Broth (LB) medium
supplemented with 10ug/ml ampicillin, until an absorbance A600 = 0.6 were reached. At this time,
isopropyl-b-D-thiogalactopyranoside (IPTG) was added to the culture to a final concentration of
1mM to induce HBeAg expression. Two hours after induction at 37°C, bacteria were centrifuged
at 5000 × g for 20 min and resuspended in 50 ml of the Bug Buster Protein Extraction reagent
(Novagen) to lyse the bacterial cell wall. Bacterial nucleic acids were digested by a non-specific
endonuclease (Benzonase from Novagen). Inclusion bodies containing insoluble proteins were

9

collected by centrifugation at 16,000 × g for 20 min at 4°C, and after complete dispersion of the
pellet in the BugBuster reagent, lysozyme was added to a final concentration of 200 ug/ml. After
5 min incubation at room temperature, the suspension was centrifuged at 16,000 × g for 15 min at
4°C to collect the inclusion bodies, which were then resuspended in 50 ml of 1:10 diluted
BugBuster reagent. The inclusion bodies were then collected by centrifugation for 15 min at 16,000
× g and resuspended in 10 ml of loading buffer (50 mM Na2HPO4/NaH2PO4, pH 7.7, 300 mM
NaCl, 8 M urea). The remaining insoluble debris was eliminated by centrifugation for 30 min at
10,000 × g.
2.3. Purification of rHBeAg
The supernatant obtained from previous step was loaded, at a flow rate of 100 ul/min, onto the
chromatography column containing Nickel-chelated His-bind resin. The column was washed with
the wash buffer (50 mM Na2HPO4/NaH2PO4, 300 mM NaCl, 8 M urea, 20 mM imidazole).
Proteins were then eluted with the elution buffer (50 mM Na2HPO4/NaH2PO4, 300 mM NaCl, 8
M urea, 500 mM imidazole). Urea was removed from the purified protein fractions by dialysis for
16 h at 4°C against buffer 1 (50 mM Na2HPO4/NaH2PO4, 300 mM NaCl, 3 M urea, 5 mM
dithiothreitol) followed by dialysis against buffer 2 (50 mM Na2HPO4/NaH2PO4, 300 mM NaCl,
0 M urea, 20 mM imidazole) for 8 h at 4°C and buffer 3 (same as buffer 2) for 16 h at 4°C. the
purified protein was stored at -20°C in buffer 2.

10

2.4. RNA extraction
The THP-1 cells incubated with rHBeAg for 16 h at 37°C were lysed using 1ml of Trizol reagent
per 35 mm dish for 5 min at room temperature. 200 ul chloroform was added to the dish, following
by 15 s vortex and 2-3 min incubation. Then the cells were centrifuged at 13,000 rpm for 15 min
at 4°C and the RNA-containing top layer was collected and incubated with 500 ul isopropanol for
10 min. After centrifugation at 13,000 rpm for 10 min at 4°C, the RNA is pelleted and washed by
1 ml 75% ethanol. A centrifugation at 13,000 rpm for 5 min at 4°C was used to wash the RNA
pellet. The pellet was dried in air and the RNA is eluted by 20 ul RNase-free water.
2.5. Reverse Transcription-PCR and Quantitative Real-Time PCR Analysis
Total RNA was reversely transcribed using SuperScript™ III Reverse Transcriptase
(Invitrogen) with 3 ug of input RNA and 1 ul Oligo(dT)12-18 primers (Invitrogen). Quantitative
real-time PCR reactions were performed in 96-well plates with Power SYBR Green PCR Master
Mix using 4 ul of the 1:20 cDNA dilutions (in DEPC water) in a volume of 20 ul with the specific
primers. The qPCR was run with the following parameters: denaturation at 95°C for 10 min,
followed by 40 cycles of denaturation at 95°C for 1 min, and annealing at 60°C for 1 min. Each
reaction was performed in duplicate. All results were normalized to GAPDH mRNA level and
calculated using the ddCt method.

2.6. Cell culture and treatment
The human monocytic cell line THP-1 was obtained from American Type Culture Collection was

11

maintained at a density of 10
6
/ml in the RPMI 1640 medium supplemented with 10% fetal bovine
serum (FBS), 10mM HEPES, 0.1mM non-essential amino acid, 1mM sodium pyruvate, and
100nM penicillin/streptomycin and placed in a 5% CO2 incubator at 37°C. THP-1 cells were kept
at a minimum density of 3 × 10
5
cells/ml and were passaged every 48 h. THP-1 cells were
differentiated to macrophages using 100nM phorbol 12-myristate 13-acetate (PMA) for 48h.
To test the biologic function of rHBeAg, the differentiated THP-1 cells were treated with both
rHBeAg and anti-HBeAg antibody (made by our lab) for 16 h and lysed for the following qRT-
PCR analysis. Recombinant BSA (MyBioSource) was used as the negative control.

2.7. Pulldown assay
For isolation of the HBeAg receptor on macrophages, a His-tag pulldown assay was performed.
The differentiated THP-1 cells were incubated with 40 ug/ml rHBeAg in serum-free RPMI 1640
medium at 37°C for 0.5 h to allow rHBeAg to bind to its associated proteins on the cell surface.
Then the cells were lysed by a mild lysis buffer (50 mM Na2HPO4/NaH2PO4, 30 0mM NaCl2, 5
mM imidazole, 0.1% Tween 20). The cell debris were eliminated by centrifugation at 13,000 rpm
for 5 min at 4°C. The supernatant collected from cell lysate was incubated with Nickel magnetic
beads (EMD) for 1h at 4°C with rotation. The mixture was washed by the wash buffer (50 mM
Na2HPO4/NaH2PO4, 300 mM NaCl2, 10 mM imidazole, 0.1% Tween 20) for six times and the
rHBeAg-associated complexes were eluted by the elution buffer (50 mM Na2HPO4/NaH2PO4,
300 mM NaCl2, 300 mM imidazole) following the manufacturer’s instruction.

12

2.8. SDS-PAGE and Silver Staining
The purified rHBeAg-associated complexes from pulldown assay were denatured in sodium
dodecyl sulfate (SDS) buffer and boiled for 5 min. Samples were electrophoresed on 8% and 12%
polyacrylamide gels followed by silver staining according to manufacturer’s instruction.

2.9. Immunofluorescence
1x10
6
THP-1 cells were seeded to coverslip and triggered to differentiate by cultured with PMA
for 48 h. To compare the effect of incubation period and temperature on binding efficiency, the
cells were incubated with rHBeAg in serum-free RPMI 1640 medium for different time interval
(0.5 h and 1 h) at different temperature (4°C and 37°C). Then the cells were washed with PBS and
fixed using 4% paraformaldehyde for 10 min at room temperature. The fixed cells were washed
using the wash buffer (PBS with 1% BSA, 0.02% saponin, 0.05% sodium azide) for three times.
The cells were then incubated with mouse anti-His-tagged antibody (1:200; GeneTex; GTX628914)
overnight at 4°C. After overnight incubation, the cells were washed three times with the wash
buffer and incubated with 1:50 dilutions of rhodamine goat anti-mouse IgG secondary antibody
(Invitrogen; #31660) in absence of light. Then the cells were washed three times with the wash
buffer and mounted with DAPI Fluoromount-G (SouthernBiotech; 0100-20). The images were
acquired using the fluorescence microscope.

13

CHAPTER 3: RESULTS
3.1. Construction of plasmid encoding the His-tagged HBeAg protein (rHBeAg)
The pET-20b(+) vector was used for the construction of plasmid pET-20b(+)-HBsAg-His. This
vector contains an IPTG-inducible T7 promoter, an ampicillin resistance gene and a His-tag (six
histidine residues). T7 promoter allows the expression of the recombinant protein in bacteria. The
His-tag provides the convenience of purification of the recombinant protein after overexpression.
The gene encoding HBeAg was inserted upstream of His-tag (Fig. 1). Different from the natural
process that HBeAg comes from the cleavage of the precore protein, the recombinant HBeAg
(rHBeAg) that we directly expressed in E. coli resembled the mature HBeAg without the need of
undergoing proteolytic cleavage.

Figure 1. Diagram of pET-HBeAg plasmid. A DNA fragment
encoding HBeAg was inserted into pET-20b(+) vector downstream
of a T7 promoter and upstream of a His-tag.

3.2. Expression of recombinant HBeAg (rHBeAg)
As the first step, the best IPTG induction time was determined to be two hours at 37 °C by a study
which expressed HBeAg precursor P22 (Laine et al., 2002). Therefore, Epicurian coli BL21-
codonplus
TM
(DE3)-RIL cells were transformed with plasmid pET-HBeAg-His and induced by
IPTG for 2 h. After IPTG induction, the cells were lysed with RIPA buffer and analyzed by SDS-
PAGE and Coomassie blue staining (Fig. 2a). A band at expected molecular mass of rHBeAg (17
kD) was observed (Fig. 2a, lane 4). It was observed only in pET-HBeAg-His transformed bacteria

14

and most likely corresponded to rHBeAg. This assumption was confirmed by a Western blot
analysis of transformed bacteria lysate using anti-His and anti-HBeAg antibodies (Fig. 2B). As a
previous study confirming that P22r, HBeAg precursor, was found predominantly in the insoluble
proteins, inclusion bodies from pET-HBeAg were used in further purification experiments (Laine
et al., 2002).

Figure 2. Overexpression of rHBeAg in Epicurian coli BL21-codonplus
TM
(DE3)-RIL. Non-transformed cells (ctrl) and rHBeAg
transformed cells were treated with 1mM IPTG for 2 h. (A) The cell lysates were analyzed on 15% SDS-PAGE stained with
Coomassie blue. (B) The presence of rHBeAg was confirmed by Western blot using anti-HBeAg and anti-His tag antibodies.

3.3. Purification of rHBeAg by affinity chromatography
Purified inclusion bodies were loaded at flow rate of 100 ul/min onto the chromatography column
charged with Histidine-binding Ni-NTA resin. Proteins that were not retained on the column (flow-
through fractions) and proteins that bound non-specifically to the column (wash fractions) were
collected. Specifically bound proteins were eluted into eight fractions using high concentration of
imidazole to compete with His-tag for the binding of nickel. An SDS-PAGE analysis followed by
Coomassie blue staining of these fractions was performed. The elution fractions contain substantial

15

amount of purified rHBeAg (Fig. 3, lane 5-8), and the amount decreases as the eluates become
more diluted (Fig. 3, lane 9-12). A dialysis was performed after affinity chromatography in order
to get rid of high concentration of urea. After three rounds of dialysis against reducing
concentrations of urea, all of the urea was eventually removed and the proteins were refolded to
the natural conformation.

Figure 3. Analysis of proteins from pET-HBeAg-transformed Epicurian coli BL21-codonplus
TM
(DE3)-RIL after affinity
chromatography. Insoluble proteins from transformed cells were loaded on a His-Bind resin. The soluble proteins (S), the proteins
that were not retained on the column (FT), nonspecifically bound proteins (W) and specifically bound proteins (Eluate 1-8) were
analyzed on 15% SDS-PAGE stained with Coomassie blue.

3.4. The rHBeAg is biologically active
To confirm whether the purified rHBeAg has biologic function in vitro, THP-1 monocytic cell-line
was incubated with rHBeAg and the mRNA level of multiple cytokines was quantified by qRT-
PCR. Comparing to the controls, recombinant BSA and recombinant HBV core protein, rHBeAg
significantly upregulated IL-6 and TNF- and has no significant effect on IL-1 and MRC-1 (Fig.
4A). To confirm whether this effect is specifically mediated by rHBeAg, anti-HBeAg antibody
was used to deplete rHBeAg by blocking its activity. After treating the cells with both rHBeAg
and anti-HBeAg antibody, the mRNA levels of IL-6 and TNF- decreased to the same level as the
control, indicating that the increased mRNA levels are specifically due to rHBeAg (Fig. 4B).

16

Figure 4. Quantification of mRNA levels of cytokines after rHBeAg treatment. (A) Histograms representing the fold-changes (2^-
ddCt) in the quantitation of cytokines in the macrophages incubated with rHBeAg compared to the negative controls (macrophages
incubated with rBSA and rCore). (B) Histograms representing the fold-changes (2^-ddCt) in the quantitation of cytokines in the
macrophages incubated with anti-HBeAg to deplete the activity of rHBeAg.

3.5. The rHBeAg can be internalized into macrophages
After confirming the biologic activity of rHBeAg, an immunofluorescence test was performed to
investigate the physical interaction between rHBeAg and macrophages. Differentiated THP-1
macrophages were incubated with rHBeAg for different time intervals (0 min, 10 min, 30 min and
1 h) at different temperatures (4°C and 37°C) with or without permeabilization by 0.02% saponin.
The cells incubated with rHBeAg for 30 min at 37°C with permeabilization yielded most puncta
and the strongest signals. Comparing to the sample without permeabilization, the sample with
permeabilization provides a much stronger signal, indicating that a large amount of rHBeAg was
internalized into the macrophages by endocytosis. Comparing to the sample incubated for 1 h, the
one incubated for 30 min has stronger signal. One possibility is that during long time incubation,
the internalized proteins might start to be degraded by the cell, resulting in the smaller signal

17

puncta (Fig. 5). Therefore, an incubation for 30 min at 37°C was chosen as the experimental
condition for the following experiments.

Figure 5. Immunofluorescence staining of THP-1 cells treated with rHBeAg. After THP-1 cells were treated with purified rHBeAg
for different time periods at different temperatures, rHBeAg was stained with anti-His mouse antibody and rhodamine anti-mouse
secondary antibody.

3.6. Optimization of the amount of rHBeAg interacting with macrophages
To determine which concentration of rHBeAg can provide the highest binding efficiency with the
macrophages, a titration of different rHBeAg concentrations from 3 ug/ml to 60 ug/ml was tested
using immunofluorescence staining (Fig. 6A). After THP-1 cells were treated with different
concentrations of rHBeAg, the rHBeAg-positive cells were counted and a logistic curve was

18

generated based on the correlation of rHBeAg concentration and percentage of rHBeAg-positive
cells (Fig. 6B). According to the results, the saturable binding is observed at addition of 40ug/ml
rHBeAg by showing that 65% to 70% cells contains internalized rHBeAg. Therefore, rHBeAg
concentration of 40 ug/ml is determined to be the optimal amount added to the cells and is
supposed to yield the highest interaction efficiency with macrophages.

19

Figure 6. Immunofluorescence staining of different rHBeAg titrations. (A) Different concentrations (3-60 ug/ml) of rHBeAg were
used to treat THP-1 cells for 30 min at 37C, and rHBeAg was stained with anti-His mouse antibody and rhodamine anti-mouse
secondary antibody. (B) A titration curve was generated by counting the percentage of rHBeAg-positive cells.

3.7. Attempt to purify HBeAg receptor on macrophages
As the immunofluorescence staining clearly showing an interaction between rHBeAg and THP-1
cells, it is reasonable to predict that rHBeAg is internalized into the cell with the assistance of
some proteins on the surface of the cell. To isolate such receptor, a His-tag pulldown assay was
performed using Nickel magnetic beads and the complex of rHBeAg and its interacting proteins
were purified with high concentration of imidazole. Then the mixture was analyzed by 15% and
8% SDS-PAGE followed by a silver staining. Comparing with the control (the sample without
incubation with rHBeAg), multiple unique bands were isolated and analyzed by Mass spectrometry
(Fig. 7). Unfortunately, none of the results from Mass spec can be a potential candidate for the
receptor protein. Also, for the results to be reliable, at least the signal of rHBeAg from the sample
that was incubated with rHBeAg should be visible, but it can be barely seen in the silver staining.
Based on the current results, some further optimization is required.

20

Figure 7. Finding rHBeAg-interacting proteins in macrophages. A His-tag pulldown assay was performed to purify the proteins
interacting with rHBeAg in THP-1 cells. 15% (left) and 8% (right). SDS-PAGE and silver staining were used to analyze the purified
mixture.

21

CHAPTER 4: DISCUSSION
Although HBeAg has been discovered for more than 40 years, the mechanism by which HBeAg
maintains HBV persistence remains elusive. In this study, we aimed to produce the highly purified
recombinant HBeAg (rHBeAg) and then use it for the subsequent study focusing on its interaction
with macrophages (Fig. 1-3). We confirmed that the purified rHBeAg is biologically active and
found that the transcription level of two pro-inflammatory cytokines IL-6 and TNF- is
upregulated in THP-1 macrophages by treating them with rHBeAg. This effect can be blocked by
anti-HBeAg antibody, indicating it is specifically mediated by rHBeAg (Fig. 4). We further
demonstrate that rHBeAg can be internalized into macrophages most likely through receptor-
mediated endocytosis (Fig. 5). Currently we are attempting to isolate the HBeAg receptor from
macrophages by His-tag pulldown assay and APEX2 proximity labeling.

Studies of infants born to HBeAg-negative and HBeAg-positive mothers during neonatal infection
suggest that HBeAg might play a role in viral persistence in order to promote further vertical and
horizontal transmission after perinatal infection (Milich et al., 1990). However, the underlining
mechanism still remains unclear after several decades of this finding. A previous report, which is
the foundation of this study, demonstrates that maternal HBeAg can trigger Kupffer cells (i.e.,
hepatic macrophages) of the offspring to display the M2 anti-inflammatory phenotype if the
mother is a HBeAg-positive carrier and enhance the ability of HBV to persist for further
transmission among the population (Tian et al., 2016). Once the mechanism by which HBeAg
interacts with Kupffer cells and establishes the immune tolerance is defined, it can probably be a

22

novel therapeutic drug target for chronic infections due to its relevance to viral persistence. In
order to study protein-protein interaction, we produced recombinant HBeAg (rHBeAg) and used
it for subsequent receptor identification. rHBeAg was successfully expressed in Epicurian coli
BL21-codonplus™ (DE3)-RIL strain using the parameters of Laine’s paper about producing
recombinant P22, the precursor of HBeAg (Laine et al., 2002). Because the rHBeAg has a poly-
histidine tag (His-tag) on its C-terminus, it is relatively simple to purify it on a Ni
2+
-chelated His-
Bind resin. The rHBeAg is expressed in an insoluble form and accumulates as inclusion bodies.
One disadvantage of isolating proteins from inclusion bodies is that the overall recoveries may
only be 5% to 20% of identical proteins expressed in the soluble form. Also, the proteins extracted
from inclusion bodies need to be refolded into its nature state, which increases the risk of
misfolding. Inclusion bodies can be avoided by changing the promoter, host strain or temperature
of induction (Wingfield, 2015). Since our overall yield was sufficient for the following
experiments, we decided not to further optimize the experimental condition. The total yield was
optimized from 0.2 mg to 0.72 mg by decreasing the flow rate to enhance the binding efficiency
of the protein and the resin and by eluting the protein by gravity. In addition, the single band in
the Coomassie blue staining result indicates a high purity of the rHBeAg after affinity
chromatography and thus it is suitable for the subsequent experiments.

The biological activity of the purified proteins was confirmed in THP-1 human monocytic cell line.
It has been demonstrated that treating THP-1 cells with PMA can drive the cells toward a
differentiated macrophage phenotype that closely resembles monocyte-derived macrophages.

23

Since primary tissue macrophages are difficult to obtain, differentiated monocytic cell lines
become a common model to study macrophage function (Daigneault et al., 2010). Our RT-qPCR
results show that the transcription level of two pro-inflammatory cytokines, IL-6 and TNF-, was
upregulated after treating the cells with rHBeAg, implying that rHBeAg may be able to trigger an
inflammatory response of macrophages. This effect disappeared after the addition of anti-HBeAg
antibody, indicating that the increase of cytokine expression is specifically mediated by rHBeAg.
Our result is consistent with Tian’s ex vivo study that HBeAg can induce inflammatory cytokines
in the Kupffer cells isolated from healthy mice whose mothers are not HBV carriers (Tian et al.,
2016). Another study reports that treating primary human macrophages with high dose of HBV
can substantially induce various cytokines, including IL-6 and TNF-, and the same effect was
observed in THP-1 cells as well. Based on our results, there is a possibility that the expression of
these inflammatory cytokines is regulated by the secreted HBeAg to modulate downstream
immune responses of the host. The same study demonstrates that HBV does not trigger any
interferon (IFN) response in hepatocytes, indicating that immune responses against HBV is
probably mediated by macrophages activated by high-titer HBV mainly through the expression of
inflammatory cytokines such as IL-6 and TNF- (Cheng et al., 2017). However, it is still difficult
to determine whether HBeAg mainly triggers pro-inflammatory or anti-inflammatory responses
because the opposite effect was observed in cases of neonatal infection. Interestingly, Kupffer cells
of normal mice transfected with HBeAg-expressing plasmid showed a pro-inflammatory
phenotype, but Kupffer cells of TGD mice, born from HBeAg-positive HBV-carrier mothers,
expressed an anti-inflammatory phenotype (Tian et al., 2016). This dichotomous observation

24

indicates that HBeAg may not always simply trigger inflammatory responses. Instead, it can
possibly tolerize the Kupffer cells of the offspring in uterus and is responsible for the
immunosuppressive response once the offspring is infected after birth. In addition, the
establishment of immunotolerance in fetal Kupffer cells educated by maternal HBeAg implies that
the effect of HBeAg on macrophages may also be influenced by the maturity of the host immune
system. Due to the limitations of models available to study HBV , the cell model we used may not
perfectly resemble the hepatic macrophage activity in vivo, especially the lack of interaction with
other immune cells. To solidify our results, further ex vivo and in vivo confirmation in Kupffer
cells is necessary. According to our data showing that rHBeAg can be internalized into
macrophages to upregulate the expression of several inflammatory cytokines, we concluded that
HBeAg may be one of the viral components involved in macrophage activation. However, it is
premature to conclude that such effect is mediated by only one viral component. The correlation
between the immune response of macrophages and other viral proteins need to be further
investigated.

Based on the previous finding that HBeAg can induce the expression of several pro-inflammatory
cytokines in the macrophages, it is reasonable to believe that HBeAg elicits such effect by
interacting with some membrane proteins in macrophages. From immunofluorescence staining, it
is clearly shown that rHBeAg can be internalized into THP-1 cells in a dose-dependent manner
until reaching the saturation point, indicating that it may undergo endocytosis under the guidance
of some receptor proteins. After optimizing the incubation conditions of rHBeAg and THP-1

25

macrophages, a His-tag pulldown assay was performed in order to purify the receptor protein
directly associated with rHBeAg. Unfortunately, this strategy did not work optimally due to the
high background of silver staining results. Also, the band at 17 kD indicating rHBeAg is not shown
on the gel, implying that a large portion of initially added rHBeAg might be lost throughout the
procedure. Comparing to the control, the cells not treated with rHBeAg, the difference is too
minimal to determine whether it is a real difference or it is due to the high background. Based on
the mass spectrometry (MS) results, none of the proteins is a conceivable candidate for the receptor
of HBeAg because they are neither membrane proteins nor immune-related proteins. In order to
further optimize the experimental procedures, a stronger lysis buffer will be used to lyse the cells
more completely. In addition, salt concentration in the wash buffer will be increased to reduce the
background for silver staining. However, a report from Frei et al. mentions that affinity-based
strategies such as immunoprecipitation and pulldown assay are limited to the protein-protein
interaction with a high affinity, and it often fails when involving plasma membrane proteins that
are relatively hydrophobic and expressed in low abundance (Frei et al., 2013). We have repeated
the His-tag pulldown experiment multiple times with continuous optimization, including
increasing the amount of rHBeAg added, testing the lysis/wash buffer with different salt
concentration and increasing number of times of washing. Because none of the results clearly show
a distinct difference between the control and the treatment, we propose that the binding affinity of
HBeAg and its receptor may be relatively weak and transient. Frei’s report also mentions that yeast
two-hybrid and protein array-based technologies are also not suitable for detecting weak and
transient extracellular interaction (Frei et al., 2013). An alternative method, proximal biotin

26

labeling by APEX2, can probably be an optimal strategy in our case. APEX2 is a modified soybean
peroxidase that can effectively biotinylate proteins in living cells. Similar to the classic BioID,
APEX2 can label neighboring proteins in cells with biotin but with a faster labeling rate than BioID.
This method allows the isolation of the associated proteins that have weak or transient interactions,
and the high binding affinity of biotin and streptavidin helps minimize background contamination
(Mulcahy, 2019). In our study, APEX2-rHBeAg fusion proteins will first be generated and APEX2
will use biotin-phenol and H2O2 to biotinylate the proteins in close proximity to rHBeAg.
Biotinylated proteins will then be purified by streptavidin and identified by MS (Zhen et al., 2018).
If the receptor protein is successfully isolated, the future direction will be to further confirm it by
the knockout experiment in THP-1 cell line, following by ex vivo experiments using Kupffer cells
extracted from mice.

27

BIBLIOGRAPHY

Chen, H. S., Kew, M. C., Hornbuckle, W. E., Tennant, B. C., Cote, P. J., Gerin, J. L., Purcell, R.
H., and Miller, R. H. (1992). The precore gene of the woodchuck hepatitis virus genome is not
essential for viral replication in the natural host. Journal of Virology 66, 5682–5684.

Cheng, X., Xia, Y ., Serti, E., Block, P.D., Chung, M., Chayama, K., Rehermann, B., and Liang, T.
J. (2017). Hepatitis B virus evades innate immunity of hepatocytes but activates cytokine
production by macrophages. Hepatology 66, 1779–1793.

Daigneault, M., Preston, J. A., Marriott, H. M., Whyte, M. K. B. and Dockrell, D. H. (2010). The
Identification of Markers of Macrophage Differentiation in PMA-Stimulated THP-1 Cells and
Monocyte-Derived Macrophages. PLoS ONE 5.

Dienstag, J. L. (2008). Hepatitis B Virus Infection. New England Journal of Medicine 359, 1486–
1500.

Frei, A. P., Moest, H., Novy, K., and Wollscheid, B. (2013). Ligand-based receptor identification
on living cells and tissues using TRICEPS. Nature Protocols 8, 1321–1336.

Grimm, D., Thimme, R., and Blum, H. E. (2011). HBV life cycle and novel drug
targets. Hepatology International 5, 644–653.

Heydtmann, M. (2008). Macrophages in Hepatitis B and Hepatitis C Virus Infections. Journal of
Virology 83, 2796–2802.

Lainé, S., Salhi, S., and Rossignol, J.-M. (2002). Overexpression and purification of the hepatitis
B e antigen precursor. Journal of Virological Methods 103, 67–74.

Lamontagne, R. J., Bagga, S., and Bouchard, M. J. (2016). Hepatitis B virus molecular biology
and pathogenesis. Hepatoma Research 2, 163.

Lee, W. M. (1997). Hepatitis B Virus Infection. N Engl J Med 337, 1733-1745.

Milich, D. (2003). Exploring the biological basis of hepatitis B e antigen in hepatitis B virus
infection. Hepatology 38, 1075–1086.

Milich, D. R., Jones, J. E., Hughes, J. L., Price, J., Raney, A. K., and McLachlan, A. (1990). Is a
function of the secreted hepatitis B e antigen to induce immunologic tolerance in
utero? Proceedings of the National Academy of Sciences 87, 6599–6603.

28

Rajbhandari, R., and Chung, R. T. (2016). Treatment of Hepatitis B: A Concise Review. Clinical
and Translational Gastroenterology 7.

Rehermann, B. and Nascimbeni, M. (2005). Immunology of hepatitis B virus and hepatitis C virus
infection. Nature Reviews Immunology 5, 215–229.

Seeger, C. and Mason, W. S. (2000). Hepatitis B Virus Biology. Microbiology and Molecular
Biology Reviews 64, 51–68.

Seeger, C., and Mason, W. S. (2015). Molecular Biology of Hepatitis B Virus Infection. Virology
0, 672-686.

Tang, L. S. Y ., Covert, E., Wilson, E. and Kottilil, S. (2018). Chronic Hepatitis B
Infection. Jama 319, 1802.

Tian, Y ., Kuo, C., Akabari, O., and Ou, J.-H. J. (2016). Maternal-Derived Hepatitis B Virus e
Antigen Alters Macrophage Function in Offspring to Drive Viral Persistence after Vertical
Transmission. Immunity 44, 1204-1214.

Trinkle-Mulcahy, L. (2019). Recent advances in proximity-based labeling methods for interactome
mapping. F1000Research 8, 135.

Tsai, K.-N., Kuo, C.-F., and Ou, J.-H. J. (2018). Mechanisms of Hepatitis B Virus
Persistence. Trends in Microbiology 26, 33–42.

Wingfield, P. T. (2015). Overview of the Purification of Recombinant Proteins. Current Protocols
in Protein Science 80.

Yang, F., Yu, X., Zhou, C., Mao, R., Zhu, M., Zhu, H., Ma, Z., Mitra, B., Zhao, G., Huang, Y ., Guo,
H., Wang, B., and Zhang, J. (2019). Hepatitis B e antigen induces the expansion of monocytic
myeloid-derived suppressor cells to dampen T-cell function in chronic hepatitis B virus
infection. PLOS Pathogens 15.

Yuen, M. F., Chen, D. S., Dusheiko, G. M., Janssen, H. L. A., Lau, D. T. Y ., Locarinini, S. A.,
Peters, M. G., and Lai, C. L. (2018). Hepatitis B virus infection. Nat Rev Dis Primers 4, 18035.

Zhen, Y ., Haugsten, E. M., Singh, S. K., and Wesche, J. (2018). Proximity Labeling by a
Recombinant APEX2–FGF1 Fusion Protein Reveals Interaction of FGF1 with the Proteoglycans
CD44 and CSPG4. Biochemistry 57, 3807–3816.

Abstract (if available)

Abstract Hepatitis B Virus (HBV) is a hepatotropic virus that can cause acute and chronic infections in humans and is also one of the leading causes of hepatocellular carcinoma (HCC). Approximately 300 million people in the world are infected by HBV, resulting in approximately 1.1 million deaths annually. Although HBV vaccines are available, effective therapies are still lacking for the large number of chronically infected patients. HBV e antigen (HBeAg) is thought to be involved in establishing viral persistence, which is tightly correlated with chronicity. Based on the finding that maternal HBV e antigen (HBeAg) can alter the polarization phenotypes of macrophages of the offspring and trigger anti-inflammatory responses (Tian et al., 2016), the interaction between HBeAg and macrophages is critical in immune regulation and may be a novel therapeutic target for chronically infected patients. In this report, we expressed and purified recombinant HBeAg (rHBeAg) and demonstrated that rHBeAg could stimulate THP-1 human macrophages to produce proinflammatory cytokines IL-6 and TNF-α. This stimulation of THP-1 macrophages was specific, as it could be blocked by the anti-HBeAg antibody. To understand how rHBeAg stimulated THP-1 macrophages, we investigated the interaction between rHBeAg and THP-1 by immunofluorescence staining and found that HBeAg could be internalized into macrophages probably through receptor-mediated endocytosis. By performing His-tag pulldown experiment, we attempted to isolate HBeAg-associating proteins from the macrophage to identify the putative HBeAg receptor. The identification of the HBeAg receptor will allow us to further understand the relationship between HBeAg and macrophages and develop therapeutic approaches for the treatment of chronic HBV patients.

Linked assets

University of Southern California Dissertations and Theses

Conceptually similar

PDF

The role of amphisomes and Rab11 protein in release of mature hepatitis B viral particles and analysis of the arginine-rich C-terminal domain of HBV precore protein

PDF

The analysis and modeling of signaling pathways induced by the interactions of the SARS-CoV-2 spike protein with cellular receptors

PDF

Autophagy and Hepatitis C and Hepatitis B viruses

PDF

The effects of SRPK1 and SRPK2 on HBV precore protein

PDF

Modulation of host antigen presentation by herpes simplex virus 1

PDF

Characterization of invariant natural killer T cells in a novel humanized HBV-transgenic model

PDF

Mechanism of ethanol-mediated increase of SARS-COV-2 entry through GRP78 induction

PDF

Tri-specific T cell engager immunotherapy targeting tumor initiating cells

PDF

The effect of cofilin on HCV core protein association with lipid droplet and on lipid droplet redistribution

PDF

Role of TLR4 and AID in lymphomagenesis induced by obesity and hepatitis C virus

PDF

Synergism between TLR4-c-JUN axis and surface receptor stimulation translocate c-MYC into Ig loci, through AID leading to lymphomagenesis

PDF

Self-secretion of checkpoint blockade enhances antitumor immunity by murine chimeric antigen receptor-engineered T cells

PDF

Mechanisms of nuclear translocation of pyruvate dehydrogenase and its effects on tumorigenesis of hepatocellular carcinoma…

PDF

Beclin 2-mediated autophagic degradation of the pathogenic proteins in neurodegenerative diseases

PDF

Comparative analysis of scFv and non-scFv based chimeric antigen receptors (CARs) against B cell maturation antigen (BCMA)

PDF

Design and characterization of multiplex anti-HIV single domain antibodies for genome editing of the immunoglobulin locus

PDF

The effects of autophagy on hepatitis C virus

PDF

Effect of hepatitis C virus infection on signal transduction adaptor protein: TRAF6

PDF

Hepatic c-Jun overexpression metabolically reprograms cancer cells through mTORC2/AKT pathway

PDF

The effects of hepatitis C virus infection on host immune response and signaling pathways

Asset Metadata

Creator Zhu, Yanwen (author)

Core Title Expression of recombinant hepatitis B virus e antigen and analysis of its effect on macrophages

School Keck School of Medicine

Degree Master of Science

Degree Program Molecular Microbiology and Immunology

Publication Date 06/30/2020

Defense Date 03/04/2020

Publisher University of Southern California (original), University of Southern California. Libraries (digital)

Tag HBV,macrophages,OAI-PMH Harvest,protein purification

Format application/pdf (imt)

Language English

Contributor Electronically uploaded by the author (provenance)

Advisor Ou, Jing-Hsiung James (committee chair), Machida, Keigo (committee member), Yuan, Weiming (committee member)

Creator Email 951379837@qq.com,yanwenzh@usc.edu

Permanent Link (DOI) https://doi.org/10.25549/usctheses-c89-323209

Unique identifier UC11673342

Identifier etd-ZhuYanwen-8628.pdf (filename),usctheses-c89-323209 (legacy record id)

Legacy Identifier etd-ZhuYanwen-8628.pdf

Dmrecord 323209

Document Type Thesis

Format application/pdf (imt)

Rights Zhu, Yanwen

Type texts

Source University of Southern California (contributing entity), University of Southern California Dissertations and Theses (collection)

Access Conditions The author retains rights to his/her dissertation, thesis or other graduate work according to U.S. copyright law. Electronic access is being provided by the USC Libraries in agreement with the a...

Repository Name University of Southern California Digital Library

Repository Location USC Digital Library, University of Southern California, University Park Campus MC 2810, 3434 South Grand Avenue, 2nd Floor, Los Angeles, California 90089-2810, USA