University of Southern California Dissertations and Theses

Characterization of genetic and physiological responses to environmental stress in Caenorhabditis elegans across the lifespan

(USC Thesis Other)

Characterization of genetic and physiological responses to environmental stress in Caenorhabditis elegans across the lifespan

PDF

Download a page range

Download transcript

Copy asset link

Request this asset

Transcript (if available)

Content Characterization of genetic and physiological responses to environmental stress in Caenorhabditis elegans across the lifespan by Hans M. Dalton A Dissertation Presented to the Faculty of the USC Graduate School In Partial Fulfillment of the Requirements for the Degree Doctor of Philosophy Molecular Biology Department of Biological Sciences - Molecular and Computational Biology December 2018 2 This work is dedicated to my beloved wife Lauren, whose voice can calm my nerves a thousand times over (and through six years of graduate school is getting close to that number). 3 4 Table of Contents Page No. Chapter 1 - Introduction 5 Chapter 2 - Hypodermal responses to protein synthesis inhibition induce systemic developmental arrest and AMPK-dependent survival in Caenorhabditis elegans 12 Chapter 3 - Developmental arrest in response to reduced protein synthesis causes altered lipid homeostasis in Caenorhabditis elegans and is mediated by TGF-β signaling 63 Chapter 4 - Air pollution alters Caenorhabditis elegans development and lifespan: responses to traffic-related nanoparticulate matter (nPM) 90 References 118 Acknowledgements 139 5 Chapter 1 Introduction An important lesson for scientists seeking genes that increase longevity is that these genes most likely were not selected to exclusively promote longevity; and if they are lucky enough to find a gene that is exclusive, it will likely have some of the weakest selection of any gene in its genome 1–4 . This simple idea, straightforward to some, is crucial for the way that scientists must think of ways to manipulate longevity in any organism. This is because the understanding that longevity is not selected for alone dictates that we must either have great care in thinking about the functions of a gene affecting longevity over the whole lifespan (as it could also affect reproduction, development, or otherwise) or that we should pursue artificial selection of rare or newly introduced genes that only impact longevity - completely separate from other biological processes (especially those that might negatively impact organismal health). Ultimately, most genes affecting longevity are linked to other processes, with some of the strongest increases in longevity have to do with growth, reproduction, or stress (Table 1) 5– 7 . Table 1. List of genes where loss-of-function confers a conserved strong lifespan increase. ND = not determined. Gene pathway C. elegans % lifespan increase D. Melanogaster % lifespan increase M. musculus % lifespan increase H. sapien Insulin signaling daf-2 ~200-300% 8 InR ~85% 9 Igf1r ~30% 10,11 IGF1R Protein synthesis rsks-1 ~20% 12 S6k ~30% 13 Rps6kb1 ~20% 14 RPS6KB1 ife-2 ~20% 15 eIF4E1 ND Eif4e ND EIF4E Mitochondria, timing clk-1 ~40% 16 coq7 ND Coq7 ~20% 17,18 COQ7 coq-2 ~10% 16 coq2 ~10-30% 19 Coq2 ND COQ2 mTOR growth complex let-363 ~150% 20 Tor ~30% 13 Mtor ~20% 21 MTOR 6 Why is it that genetic pathways linked to increasing longevity are tied to other biological processes? The evolutionary theory of aging suggests that natural selection decreases with age, and its impact typically plummets after reproductive senescence 1–4 . Once reproduction ceases, the ability for the parent to positively affect the survival of its downstream lineage, and therefore its fitness, rapidly decreases (though this decrease has a varying trajectory concordant with amount of care for young) 5,22 . Because of this, genes important for pre- reproductive life, especially pertaining to growth and development, have much stronger selection acting on them. This has led to the developmental theory of aging that posits that developmental-based genes have more of an effect on post-reproductive longevity than any gene that may be specifically selected for said longevity 7 . This is not to say that longevity cannot be selected for. Animals may live longer or shorter based on many reasons such as developmental timing, size, or reproductive strategies 23,24 . Experimentally, it is also possible to select for older animals from a genetically homogenous population and end up with a longer-lived population, such as in crickets 25 and flies 26 . Generally speaking, these are trade-offs, where developmental time or reproductive capacity often act against longevity 27 . Furthermore, in a resource-limited environment, over time it may actually be disadvantageous to have a long post-reproductive lifespan as resources might be taken away from one's progeny - eventually even favoring negative selection toward long lifespans as a form of altruism 28,29 . If the developmental theory of aging is true, it suggests that selecting for longevity is useful to a genome only to the extent that it improves fitness; any increase in lifespan outside of the scope of increasing fitness would then be random, as it would be an off-target effect of fitness promotion (note that defining the "scope of increasing fitness" is not trivial). On its face, this appears to be true, as laboratory manipulation of some genes increases lifespan while others decrease it. However, this also brings with it an interesting premise - if a non-fitness related lifespan increase is selected for randomly, it follows that the quality (or "time spent 7 healthy") of that increased lifespan would also be random. When scientists research aging, one goal is to find pathways that increase lifespan, but we are only really interested in longevity accompanied by general good health 30,31 . For humanity, a good "longevity" gene would also maintain good health, else the long life would be spent decrepit. Scientists have found many single genetic mutations capable of increasing lifespan across multiple organisms (Table 1 has some examples). It follows that if current longevity-promoting mutations are truly randomly evolved, their associated quality of life should also be random - some good, some bad. Indeed, research on C. elegans has found not all longevity-promoting mutations come with good health; for example, while both increase lifespan, mutations in the daf-2 insulin/IGF- 1 signaling pathway appear to maintain good health, while mutations in the mitochondrial gene clk-1 have overall worse health 32,33 . One way to help us understand why some longevity-promoting genes are health- promoting or not could be to look at their evolutionary origin. Understanding how a gene pathway acts over a whole life span may be useful in predicting if a future gene is a good candidate for researching healthy aging 7 . To focus in on a specific evolutionary response, we will primarily examine C. elegans, but it should be relevant to most animals given the large amount of homology in multiple longevity-promoting pathways (Table 1). If we take insulin signaling for an example (daf-2/IGF-1R and related pathway mutants), why is it that reducing a major growth signaling pathway should have benefits later in life, evolutionarily speaking? For example, in C. elegans, mutations in insulin signaling can reduce protein aggregation 34 , increase pathogen resistance 35 , and delay age-related neuronal defects 36 . In the context of the developmental theory of aging, it would suggest that these benefits were not selected for the benefits of the worm's late life health (as downregulation of insulin signaling can promote post-reproductive health and longevity, yet post-reproductive benefits should have little to no positive impact on overall fitness); instead, it is more likely that these positive phenotypes were selected for during development. As it turns out, downregulation of insulin signaling leads to a 8 developmental arrest state called dauer; starvation, overpopulation, and high temperatures trigger this dauer arrest, which is reversible, and causes gene transcriptional changes, as well as morphological alteration, to increase survival 8,37–39 . In the context of starvation or stress, the ability for a worm to reduce insulin signaling in order to increase stress resistance by entering dauer arrest would directly help its fitness by increasing survival. The important point is that even if this pathway is not utilized in young worms, it still exists in adult animals due to it being selected for survival earlier in life (and specifically in earlier generations of life). In a way, adult animals with reduced insulin signaling reap the benefits of a pathway that may have evolved to increase survival at a completely different life stage. Similar to insulin signaling, while reducing protein synthesis increases lifespan, and has a neutral-to-positive increase in overall animal health 15,32,33,40 , it is not immediately clear of the benefits of reducing protein synthesis in older age. For example, it is important to synthesize new proteins in old age, where having functional detoxification enzymes or protein chaperones may be essential to combat increased amounts of oxidized or misfolded proteins 41–44 . Some hypotheses mention the idea that by reducing protein synthesis, it shifts energy away from translation and into survival-promoting pathways 45 , as reducing protein synthesis in adult worms increases oxidative, thermal, and heavy metal stress 15,33,40,46 . Just as in daf-2/IGF-1R mutants, reduction of protein synthesis is another example of a longevity-promoting pathway that is tied to an arrest state 15,40,47,48 , though typically this was thought to be a lethal endpoint. Recent studies show that reducing protein synthesis during worm development results in a transient arrest stage with similar stress resistance as in adult animals with reduced protein synthesis 46 . As with insulin signaling, it may be that this survival arrest pathway was selected for early in life to aid the worm against pathogens, or otherwise, that reduce protein synthesis in the wild - allowing the animal enough time to escape to more favorable environments (thereby increasing fitness vs. animals lacking such a pathway). Once again, thinking on the developmental theory of aging, adult animals may still have this survival pathway that can 9 activate during adulthood and increase stress resistance and longevity, yet was evolved to aid the animal earlier in life. While long-term arrest states in development, as in C. elegans, are generally not conserved in vertebrates, the concept of an organism utilizing a pathway during adulthood that was selected to increase survival during development can still make sense (especially as many of these longevity-promoting genes are conserved, Table 1). Both insulin signaling and protein synthesis serve as positive examples of the developmental theory of aging - where pathways that may have been selected for during development serve to affect aging later in life. Why then is it useful to look at this from a developmental standpoint? One reason is that it helps to contextualize the reason behind longevity-promoting pathways in the first place 7 . It helps explain why treatments can be given even late in life to promote longevity 49,50 , such as treatment of rapamycin, an inhibitor of the growth complex mTOR (Table 1), which increases lifespan even in middle-aged mice 51 . Reduction of mTOR signaling early in life could indicate times of starvation or poisoning from a food source or environment, and having a pathway in place to increase survival during such times would positively increase that animal's overall fitness (as survival can allow them to make it to reproduction). In the context of the developmental theory of aging, middle-aged mice would still be using that same survival pathway under mTOR inhibition in order to increase survival late in life. Another reason to look at longevity from a developmental standpoint is that it may allow researchers to more rapidly determine if a longevity-promoting mutation will also have positive effects on health. In both reduced insulin signaling dauers and reduced protein synthesis arrested animals, the arrested animals share many of the same stress resistance phenotypes as their long-lived counterparts 15,40,46,52 . Rather than having to wait for populations to mature to old age before testing for positive health phenotypes like stress resistance, it may be useful to test these effects in young, arrested populations first as a sort of screen for useful longevity mutants. If arrested and long-lived mutants of the same gene truly share a survival-promoting pathway, positive 10 effects seen in arrested animals may be predictive for positive health effects in long-lived adults. However, even in the context of genetic pathways that increase longevity as well as overall health, such as negative regulation of the insulin signaling pathway, there are still trade- offs. Weak mutations in insulin signaling can increase lifespan, but they come with reduced brood sizes in worms 53 , and full knockouts are embryonically lethal in worms, flies, and mice 53–55 . For mTOR, rapamycin treatment increases lifespan in mice 56 , but it comes with issues with aberrant immune responses and glucose intolerance in mammals 57–59 . Reducing protein synthesis can increase lifespan, but it can also reduce brood sizes and full knockouts are typically lethal 15,48,60 . Ultimately, these pathways are based on our genomes that have been selected primarily for reproduction 7,61 . Indeed, even searching for any one gene that can positively affect longevity, much less one that also promotes a healthy, post-reproductive longevity, will be from a limited pool of genes. It is hard to change one part of our genome without affecting tens of hundreds of others. Millions of years of evolution, acting on organisms from our distant evolutionary past, have been honed and intertwined into our current genomes, and manipulating these highly connected networks means careful untangling and re-designing may be inevitable. There may be no way to truly stop aging in our pursuit for longevity, as it is inherently linked with the way that our biology functions 28,62,63 . Perhaps one solution is to try to think of systems or mechanisms that exist disconnected from the highly developed and complex biology that currently exists. It is easy to be stuck in the idea that there must be trade-offs in longevity. If you look at current genomes, that appears to be the case 7,61,64 . However, it is not impossible that in the future, we may be able to use biological interventions that are separated from our current biology, and thereby separate from the current trade-off dogma. At this time, there is no known gene that has been selected to only increase lifespan beyond the point where fitness is being positively affected (i.e. past a stage where progeny have any positive benefit from a parent); by the definition of selection 11 and fitness, this makes sense - selection of such a gene would typically be detrimental to the preservation of a genome (by wasting energy, taking resources from progeny, or otherwise). But hypothetically, what would such a gene look like? Eschewing evolution for a moment, what qualities would make up a gene whose sole purpose was to maintain an organism indefinitely, irrespective of impact on fitness? It is likely it would need a way to repair damaged proteins, DNA, or other cellular components as well as a way to sense that damage in the first place. Perhaps it could help clear protein aggregates or alter the chromatin state of DNA. But most importantly, for such a gene to be desired by humans, it would have to exist in its own domain, away from the current developmental and reproductive processes important to life - so that it could have a positive effect on humans late in life without sacrificing these early processes. The insights we gain from developmental pathways utilized by adult organisms to increase health and lifespan can give us a base of understanding of how to best approach a health- promoting longevity in the long term. Maybe this will be from continued manipulation of growth, reproduction, and developmental pathways as is currently pursued, but perhaps it could be from the introduction of new genes, via systems like CRISPR/Cas9, completely separate from the complex interactions already in place in our genomes. Understanding what gives rise to longevity in our genome is crucial to contextualizing the evolution of longevity and developing new ideas of how to increase lifespan in humans. New evidence continues to suggest that developmental selection is a primary driving force behind aging. Promotion of lifespans free of ailment and disease will always be the core goal of aging research 30,31 and should be pursued by any and all methodology currently available to us. 12 Chapter 2 Hypodermal responses to protein synthesis inhibition induces systemic developmental arrest and AMPK-dependent survival in Caenorhabditis elegans Hans M. Dalton 1,2 and Sean P. Curran 1,2,3 1. Leonard Davis School of Gerontology, University of Southern California, Los Angeles, CA 90089 2. Dornsife College of Letters, Arts, and Sciences, University of Southern California, Los Angeles, CA 90089 3. Norris Comprehensive Cancer Center, Keck School of Medicine, University of Southern California, Los Angeles, CA 90089 13 Abstract Across organisms, manipulation of biosynthetic capacity arrests development early in life, but can increase health- and lifespan post-developmentally. Here we demonstrate that this developmental arrest is not sickness but rather a regulated survival program responding to reduced cellular performance. We inhibited protein synthesis by reducing ribosome biogenesis (rps-11/RPS11 RNAi), translation initiation (ifg-1/EIF3G mutation and egl-45/EIF3A RNAi), or ribosome progression (cycloheximide treatment), all of which result in a specific arrest at larval stage 2 of C. elegans development. This quiescent state can last for weeks – beyond the normal C. elegans adult lifespan – and is reversible, as animals can resume reproduction and live a normal lifespan once released from the source of protein synthesis inhibition. The arrest state affords resistance to thermal, oxidative, and heavy metal stress exposure. In addition to cell-autonomous responses, reducing biosynthetic capacity only in the hypodermis was sufficient to drive organism-level developmental arrest and stress resistance phenotypes. Among the cell non-autonomous responses to protein synthesis inhibition is reduced pharyngeal pumping that is dependent upon AMPK-mediated signaling. The reduced pharyngeal pumping in response to protein synthesis inhibition is recapitulated by exposure to microbes that generate protein synthesis-inhibiting xenobiotics, which may mechanistically reduce ingestion of pathogen and toxin. These data define the existence of a transient arrest- survival state in response to protein synthesis inhibition and provide an evolutionary foundation for the conserved enhancement of healthy aging observed in post-developmental animals with reduced biosynthetic capacity. 14 Introduction The differing phenotypes stemming from the loss of essential cellular functions, such as protein synthesis, are specific to the time in life (development or adulthood) when the deficit occurs. Under such deficits, arresting development is an established strategy at the disposal of animals to ensure future reproductive success. During its four larval stages, the nematode C. elegans has several possible arrested states that trigger in response to different stressors, including dauer 65,66 , starvation-induced arrest 67 , and adult reproductive diapause 68,69 , among others. Dauer diapause occurs under lack of food, high temperature, or high population density, inducing an alternative larval stage 3 66 ; this dauer state carries both metabolic and behavioral changes, including increased stress resistance 70,71 . This stress resistant and pre-reproductive arrest state is thought to have evolved to allow the worm to conserve its resources, and it affords protection from the environment until a more favorable environment is encountered. Starvation-induced arrest can occur at larval stage 1 (L1), induced from starvation occurring immediately after hatching, and this state similarly results in stress resistance 72 . Two other arrest states are adult reproductive diapause, which is induced by L4 starvation and results in an early-adult arrest state capable of surviving long periods of nutrient deprivation with the ability to later resume reproduction, and impaired mitochondria arrest, induced by deficiency in mitochondrial respiration and resulting in L3 arrest 68,73 ; however, these two states have not yet been directly shown to have stress resistance phenotypes. These examples suggest the existence of cellular programs that function as checkpoints throughout development that stall reproduction to promote fitness 74 . Intriguingly, the same triggers that induce these genetically regulated arrest states during development, when initiated post-developmentally, lead to increased life and healthspan (e.g. daf-2/Insulin IGFI signaling mutants 8,38,39 , mitochondrial deficiency 75,76 . Moreover, the loss of essential cellular functions was shown to alter animal behavior 77 , 15 presumably to avoid further exposure to the environment causal for the perceived loss of cellular homeostasis 47,78,79 . Protein synthesis inhibition is another trigger of developmental arrest early in life and increased lifespan in adults 12,15,47,80 , although the underlying mechanisms are not well understood. Similar to inhibiting the insulin-signaling pathway in adults, inhibiting protein synthesis provides several resistances from stress - starvation, thermal, and oxidative 12,15 . Activation of the energy sensor AMP-activated protein kinase (AMPK) is linked to a reduction in protein synthesis 81–83 , and AMPK can be activated by reducing growth via starvation in C. elegans 84 or via inhibiting S6 kinase in isolated mouse cells 14,85 ; this activation includes increased lifespan that is dependent on activation of AMPK in C. elegans 14 . Here we provide new characterization of a C. elegans survival arrest state brought on by reducing protein synthesis, which confers stress resistance and is reversible. Enacting protein synthesis inhibition in the hypodermis alone was partially sufficient for both the arrest and stress resistance phenotypes. Arrested animals had very high expression of a metallothionein and were found to have higher levels of calcium, which may be linked to an observed reduction in pharyngeal pumping. All of these survival phenotypes, save the arrest, were dependent on functional AMPK. Finally, these phenotypes could be recapitulated from exposure to xenobiotics, implying a potential evolutionary context for this fitness-promoting arrest state. 16 Results Protein synthesis inhibition induces a stress resistant developmental arrest state To elucidate the possible connection between the developmental arrest and longevity- promoting effects of protein synthesis inhibition 12,15,47,80,86 , we first defined the nature of the developmental arrest in C. elegans. We analyzed the effects of protein synthesis inhibition by targeting distinct and conserved aspects of the protein biosynthesis machinery (S1A Fig). We measured the synthesis of two GFP reporters; a heat shock inducible promoter (S1B Fig) and a mlt-10p driven construct (S1C Fig) that is only expressed between developmental molts as a surrogate assessment for general protein biosynthesis 87 . Because GFP from these reporters is limited to temporally distinct periods, we can robustly measure differences in GFP levels between protein synthesis inhibition conditions. We targeted the translation initiation factor, egl-45/EIF3A, or the small ribosomal protein, rps-11/RPS11, by RNA interference (RNAi), so that we could control the strength and duration of inhibition, thereby avoiding the constitutive arrest that can occur when protein synthesis is inhibited by genetic mutation 48 . While there are many genes involved in protein synthesis that can induce arrest when inhibited 12,15,47 , egl-45 and rps-11 were selected as RNAi of these genes results in a fully penetrant larval arrest phenotype (S1D Fig). There is a threshold effect to this arrest, as diluting the RNAi to 10% of total food allowed more escaping animals (S1E Fig), while still impairing development. In all RNAi conditions tested at 100% of total food, we observed a potent developmental arrest that could persist beyond 10 days (S1D Fig). To define the developmental arrest state more precisely, we made use of the molting reporter (mlt-10p::gfp-pest) that marks each of the four developmental molts in C. elegans 88 . This revealed a potent arrest after the first molt at larval stage 2 (L2) (Figs 1A-1C). In addition, these animals are morphologically different than other arrest states like dauer and L1 arrested animals (S1F Fig) and are smaller in length than wild type L2s unlike arrested L2d animals (S1G Fig). Together, these data support the existence of a potent developmental arrest point in response to diminished biosynthetic capacity. 17 To address the hypothesis that the induced developmental arrest in response to protein synthesis inhibition is beneficial, we challenged L2 arrested animals and non-arrested L2 control animals to oxidative (20mM H 2 O 2 , Fig 1D and S2A Fig) or thermal (36 o C, Fig 1E and S2B Fig) stress and found the arrested animals were more resistant to all tested environmental insults. Animals that remained in the arrested state for longer periods of time (2 or 10 days) were markedly more protected against oxidative stress and extended exposures to thermal stress (S2C-S2F Figs). Thus, the durability of the response and the capacity to further enhance resistance to perceived deficiencies is enhanced so long as it is needed. Collectively, these data show that loss of protein biosynthetic capacity during development does not induce a decrepit state, but rather a beneficial health-promoting state of impeded development. The amplification of stress resistance that correlated with time in the arrested state predicted that arrested animals could persist in the L2 stage for much longer than wild type animals. Given this, we examined the lifespan of animals in the arrested state and discovered that egl-45 RNAi and rps-11 RNAi animals had a mean survival in the arrested state of 24 and 12 days, respectively (Fig 1F), compared to a normal eight hour L2 stage (Fig 1A). As such, the developmental arrest resulting from reduction of protein biosynthetic capacity results in health-promoting state of extended diapause. One hypothesis is that pausing development in the L2 stage alone confers survival benefits. To test this, we screened all annotated RNAi clones that induce early and fully penetrant L2 arrest (S2G and S2H Figs) and measured their ability to resist the same exposure to stress. Despite sharing an L2 arrest phenotype, none of these RNAi treatments resulted in the same decrease in protein synthesis (S2I Fig) or afforded increased survival during stress (S2J and S2K Figs). As such, arrest at the L2 stage does not require a loss in biosynthetic capacity and is not inherently stress resistance-promoting. In addition, the phenotypes observed are not tied to RNAi responses, as ifg-1 (ok1211) mutant animals that arrest at the L2 state 48 are more resistant to oxidative stress as compared to wild type controls 18 (S2L Fig). We also tested the long-term survival of acn-1, let-767, and pan-1; while only acn-1 maintained long-term L2 arrest (S2H Fig), the survival of acn-1 RNAi treated animals was significantly shorter than rps-11 and egl-45 RNAi treated animals (S2M Fig). Finally, we tested the necessity of FOXO/daf-16, a transcription factor that is required for dauer arrest 74 , in these survival phenotypes. Reducing protein synthesis in daf-16 mutants still causes developmental arrest (S3A Fig) and results in increased resistance to oxidative (S3B Fig) and thermal (S3C Fig) stress. We further note that these animals are not dauers, morphologically (S1F Fig) and are not resistant to treatment with 1% SDS – a phenotype of animals that successfully enter dauer diapause. Moreover, reducing protein synthesis in daf-2 mutants, which form constitutive dauers at the restrictive temperature of 25C, enter this L2 arrest stage instead of developing into dauers. These findings support the protein synthesis inhibition arrest state at the L2 larval stage and prior to dauer formation, which is an alternative L3 stage (S3D Fig). The hypodermis can mediate systemic responses during protein synthesis inhibition Considering the need for every cell to sense and respond to changes in biosynthetic capacity, but also the benefit of coordinating a systemic physiological response to a perceived organism-level deficit in any tissue, we hypothesized that the response to protein synthesis inhibition would be both cell autonomous and non-autonomous. The germline is a facile model for cell division in early larval development in C. elegans 89 . Similar to the developmental arrest observed at the organism level, tissue-general protein synthesis inhibition resulted in the clear arrest of the reproductive tissue at a stage typical for L2 animal development (Fig 2A). We next sought to determine which tissues were capable of initiating the L2 arrest. Using tissue- specific RNAi, we systematically reduced the expression of egl-45/EIF3 or rps-11/RPS11 in the intestine, germline, or hypodermis (S4A Fig). Similar to tissue-general RNAi, hypodermal- specific protein synthesis inhibition induced potent developmental arrest (Figs 2B-2D) and halted germline proliferation (Fig 2E). In contrast, while still slowing development, intestinal or 19 germline-specific RNAi was unable to induce developmental arrest (S4B-S4J Figs). Germline- specific protein synthesis inhibition results in sterility (S4H-S4K Figs), which differentiates the cell autonomous effects of protein synthesis inhibition from the cell non-autonomous impact on the entire organism when diminished biosynthetic capacity is restricted to the hypodermis. Hypodermal-specific protein synthesis inhibition was the most effective at enhancing resistance to oxidative (Fig 2F) and thermal (Fig 2G) stress, as compared to germline- and intestine-specific RNAi (S4M-S4P Figs), which had modest or no effect on stress resistance. Moreover, hypodermal-specific protein synthesis inhibition initiated post-developmentally was capable of increasing lifespan and, in the case of egl-45 RNAi, was at least equally potent as tissue-general protein synthesis inhibition (S4Q Fig). As predicted by their essential roles in protein synthesis, egl-45/EIF3 and rps-11/RPS11 expression is detectable in several tissues (S4R-S4U Figs), but the differences in the expression level and location could explain the variance in the strengths of phenotypes observed in egl-45 RNAi versus rps-11 RNAi. Nevertheless, these data identify the hypodermis as an important mediator of organismal regulation of growth and development in response to diminished biosynthetic capacity. Protein synthesis inhibition increases organismal Ca 2+ levels and induces mtl-1 expression We examined the transcript levels of a panel of genes with established roles in stress adaptation (see Methods) under both 24 hours and 120 hours exposure to protein synthesis inhibition (collected after 24 and 120 hour exposure to RNAi) 90 . Despite the enhanced stress resistance observed in protein synthesis inhibition-induced L2 arrested animals, the expression of most genes tested – including several heat shock proteins, redox homeostasis pathway components, and isoforms of superoxide dismutase – was significantly repressed (S5A-S5J Figs). The notable exception in this panel was the expression of mtl-1, a metallothionine involved in metal homeostasis, which after 24 hours of either egl-45/EIF3 or rps-11/RPS11 20 RNAi was increased >10-fold (Fig 3A and S5E Fig); in animals arrested for 5 days, mtl-1 was increased >100-fold (Fig 3B and S5F Fig). This temporal enhancement was not observed for other genes involved in stress adaptation (S5G-S5J Figs). Moreover, hypodermal-specific protein synthesis inhibition also induced mtl-1 expression (Fig 3A and S5E Fig), consistent with the notion that the hypodermis is a potent sensor for organismal biosynthetic capacity. As mtl-1 is activated in response to heavy metals, we challenged protein synthesis inhibition-arrested animals to toxic levels of Cd 2+ (50mM) and discovered this arrest state also enhanced resistance to heavy metal stress (Fig 3C). Because heavy metal resistance was not previously annotated in adults with protein synthesis inhibition 12,15,80 , we initiated protein synthesis inhibition post-developmentally by egl-45/EIF3A or rps-11/RPS11 RNAi, which also resulted in resistance to Cd 2+ exposure (S5K Fig). Similar to oxidative and thermal stress, hypodermal- specific RNAi of egl-45/EIF3 or rps-11/RPS11 could recapitulate the whole animal RNAi phenotype (S5L Fig). We next tested whether the increase in mtl-1 was causative for the resistance, so we created a double mutant of mtl-1 (tm1770) and mtl-2 (gk125) (mtl-2 is a related metallothionine also activated in response to heavy metals), which greatly attenuated the ability to survive Cd 2+ exposure when protein synthesis is inhibited (S5M Fig). Based on these heavy metal responses, we wanted to further test if hypodermal RNAi could increase mtl-1 to the same degree as observed in wild type animals exposed to protein synthesis inhibition for extended periods. Correlating with the rate of developmental arrest, mtl-1 levels increase out to 48 and 120hrs of exposure to hypodermal specific RNAi of egl-45 or rps-11 (S5N Fig). However, animals with longer exposure to rps-11 RNAi have mtl-1 transcript levels that return to near wild type levels, which correlates with the escape from developmental arrest under hypodermal specific rps-11 RNAi (Fig 2D). Although heavy metals are not abundant in standard growth media, these findings led us to examine the total metal content of animals in protein synthesis inhibition arrest by inductively coupled plasma-atomic emission spectroscopy (ICP-AES). The metal profiles 21 revealed a significant reduction in Mg 2+ and Mn 2+ and a marked increase in Ca 2+ (Fig 3D and S6A Fig). These steady-state concentrations of metals were maintained in animals trapped in the arrested state for 5 days (Fig 3D and S6A Fig). mtl-1;mtl-2 double mutant animals reduced multiple metal species by 10-20%, but did not affect Ca 2+ levels (S6B-S6D Figs); protein synthesis inhibition treatment in this mutant was still able to induce many of the same Mg 2+ , Mn 2+ , and Ca 2+ changes as seen in wild type, consistent with the transcriptional induction of mtl-1 acting as a stress response rather than as the upstream effector. Moreover, animals acutely exposed to CaCl 2 treatment as larvae have an mtl-1 transcriptional profile that mirrors animals with protein synthesis inhibition (Fig 3E), suggesting that the increase in Ca 2+ could be physiologically significant and promote the increased mtl-1 expression. Protein synthesis inhibition reduces pharyngeal pumping in developmentally arrested and adult C. elegans Animals have adopted several strategies, ranging from molecular adaptation to changes in behavior, in order to cope with less than ideal growth conditions 91 , and calcium plays several critical functions in these physiological responses. As such, we examined the behaviors of animals arrested from protein synthesis inhibition and noted a marked decrease in pharyngeal pumping (Fig 4A and S7A Fig), a rhythmic behavior influenced by calcium transients 92,93 . The reduction in pharyngeal pumping was significant after 24-hours of protein synthesis inhibition and was more pronounced the more time animals were in the arrested state (S7B Fig); despite this reduction, a basal level of pumping continues even after 15 days in the arrested state (S7B Fig). Similar to the developmental arrest and enhanced stress resistance observed in daf-16 (mgDf47) animals, daf-16 is not required for the reduction in pharyngeal pumping rates when protein synthesis is inhibited (S7C Fig). In line with previous cell non-autonomous effects, hypodermal-specific protein synthesis inhibition effectively reduced pharyngeal pumping (Fig 4B), while protein synthesis inhibition in other somatic tissues could not evoke the same magnitude of responses (S7D and S7E Figs). This reduction 22 of pharyngeal pumping is intriguing as this behavior is correlated with food intake 94 , and caloric-restriction (CR) is an established means of enhancing organismal health- and lifespan 95,96 . With this in mind, we measured pharyngeal pumping in adult worms fed egl-45 or rps-11 RNAi to induce protein synthesis inhibition, which are long-lived 47 , and also discovered a significant reduction in pharyngeal pumping (S7F Fig). Taken together, these data define reduced pharyngeal pumping as a physiological response of protein synthesis inhibition during development and adulthood. AMPK signaling mediates the survival benefits of developmental protein synthesis inhibition Protein synthesis is energetically expensive, and it is possible that protein synthesis inhibition leads to a state of excess ATP, which could be redirected to other cytoprotective pathways that drive stress resistance 97 . However, we found that animals exposed to protein synthesis inhibition during development have 50% less cellular ATP (Fig 4C). AAK-2/AMPK is a conserved sensor of energy homeostasis that responds to changes in cellular AMP/ATP levels 98 . Indeed, animals with protein synthesis inhibition have significantly higher AMP/ATP and ADP/ATP ratios (Fig 4D). As such, we tested aak-2 mutants for the protein synthesis inhibition survival and arrest phenotypes. aak-2 mutants exposed to protein synthesis inhibition were still arrested as L2 animals with reduced germ cell counts (S8A-S8C Figs), but failed to dampen pharyngeal pumping rates (Fig 4E and S8D Fig), which importantly uncouples these two protein synthesis inhibition responses and suggests that the developmental phenotypes are not a result of diminished food intake. Additionally, aak-2 mutant animals failed to evoke protein synthesis inhibition responses observed in wild type animals (Fig 4F). Specifically, aak- 2 mutants have minimal, often undetectable, changes in the expression of mtl-1 during protein synthesis inhibition (S8F Fig) - a phenotype similar to daf-16 mutant animals (S8G Fig), which is a known regulator of the mtl-1 locus (S8H Fig). aak-2 mutants are also as sensitive to Cd 2+ as wild type animals (S8I Fig), which further supports the connection between mtl-1 expression 23 with resistance to environmental metal exposure. Furthermore, aak-2 mutants with protein synthesis inhibition are as sensitive to oxidative and thermal stress as wild type animals (S8J and S8K Figs, S8M and S8N Figs), indicating the essentiality of AMPK signaling in protein synthesis inhibition-induced stress resistance. We then tested mutant animals harboring a truncated and constitutively active (CA) form of AAK-2 99 , which slowed development and afforded resistance to oxidative stress while restoring thermal stress resistance under reduced protein synthesis, relative to aak-2 mutants (S8A, S8C, S8J, S8L, S8M, and S8O Figs). Intriguingly, expression of a constitutively activated version of AMPK (CA-AMPK 99 ) restored the reduction of pharyngeal pumping phenotype when protein synthesis was reduced (S8D and S8E Figs). Taken together with the AMP/ATP and ADP/ATP levels (Fig 4G), these data define an AAK-2/AMPK molecular pathway that initiates organismal-level physiological responses to cellular deficiencies in protein synthesis. Importantly, our studies reveal a clear role for AMPK signaling in mediating the survival responses to protein synthesis inhibition beyond developmental arrest. Developmental exposure to microorganisms producing protein synthesis inhibition- inducing xenobiotics recapitulate the arrest-survival state In the context of a worm’s natural environment, we postulated that the ability to pause development in response to a perceived cellular deficiency would be advantageous - and perhaps evolved - as a response mechanism to deal with environmental hazards. In the wild, C. elegans consume diets that are far more complex than the simple and homogenous E.coli lawn provided to them in the laboratory 65 . These wild diets include heterogeneous populations of microorganisms, some of which can produce xenobiotic compounds that can target and disable essential biological pathways. Recently, the soil and intestinal microbiome of C. elegans has been characterized 100–102 . While only appearing at rates ranging from 0.001- 0.1% in soil samples found in these studies, we chose to focus on the genus Streptomyces, as it is soil-dwelling, readily accessible with the lowest biosafety level, and has several members 24 that produce commonly utilized molecules that can potently inhibit eukaryotic protein synthesis 103 . If wild C. elegans came upon a microcosm of Streptomyces species, or any other organism capable of producing xenobiotics that reduce protein synthesis, it would be important to have defenses available against these molecules. We exposed worms to S. griseus, S. griseolus, or S. alboniger, that produce cycloheximide (CHX), anisomycin, and puromycin, respectively (S9A Fig). Exposure to these Streptomyces species grown under stationary conditions for five days, in order to initiate secondary metabolism and the creation of these protein synthesis inhibition molecules 104 , resulted in delayed reproduction (S9B Fig) and significant reduction of their pharyngeal pumping in two species (Fig 5A). This is in contrast to exposure with microbes in exponential phase growth which attenuates secondary metabolism 104 (Fig 5A). Exposure to pathogens can alter several physiological parameters in the host, and of all the pathogens tested, exposure to S. griseus exerted the strongest influence on pharyngeal pumping. The remarkably similar impact that exposure to S. griseus had on C. elegans development and physiology, as compared to RNAi-induced protein synthesis inhibition, drove a further examination of how exposure to cycloheximide (CHX), the bioactive secondary metabolite produced by S. griseus, affected C. elegans survival during development. CHX is a potent inhibitor of ribosome processivity and has recently been shown to exert health- promoting effects in adult C. elegans by an unknown mechanism 105 . Satisfyingly, CHX exposure upon hatching, which inhibits new protein synthesis (S9C Fig), also resulted in arrested animal development (S9D Fig and Fig 5B), and can arrest in a dose-dependent manner (S9D Fig). Although animals arrested by RNAi-mediated protein synthesis inhibition can continue development upon removal from the RNAi state, not all animals in the population mature into fertile adults (S9E-S9G Figs) - likely a result of the persistence of RNAi 106–108 . However, initiating protein synthesis inhibition via exposure to 0.05mg/ml CHX rather than RNAi of essential protein synthesis factors (S1A Fig) enabled studies of recovery from the arrest state without the complications of RNAi. Once removed 25 from the xenobiotic, developmentally arrested animals resume development - indicating the arrest state is truly transient (Fig 5B, Table S2). The CHX-induced arrest state caused reduced pharyngeal pumping (Fig 5C), arrested germ cell proliferation (Fig 5D), increased organismal [AMP]/[ATP] ratio (Fig 5E). Importantly, this arrest state phenocopied all RNAi-based protein synthesis inhibition survival responses (Fig 5F) including: enhanced resistance to oxidative (S9H Fig) and thermal stress (S9I Fig), induced the expression of mtl-1 (S9J Fig) decreased cellular ATP (S9K Fig), and resulted in metal profiles similar to animals fed RNAi targeting egl- 45/EIF3 and rps-11/RPS11 (S9L and S9M Figs). 0.05mg/ml CHX exposure may not fully arrest all animals, as some daf-2 animals at the restrictive temperature did become dauers (S2Q Fig). Animals that are released from CHX arrest have minimal (if any) changes in reproductive output (S9N Fig), have a small but significant increase in resistance of oxidative stress (S9O Fig), are delayed ~16-20hrs to reproduction (S9P Fig), and have normal pumping rates at physiological day 3 of adulthood (S9Q Fig). Thus, this transient arrest state is survival promoting when the deficiency in protein synthesis is present and is not afforded once homeostasis is reestablished, similar to animals released from dauer 91 . Intriguingly, the ability of Streptomyces griseus to reduce pharyngeal muscle pumping required the presence of live bacteria co-culture (S9R Fig). In addition, increasing doses of CHX, similar to the threshold effects seen with RNAi targeting genes involved in protein synthesis (S1E Fig), could further reduce the pumping rate of the arrested animal (S9S Fig). Thus, the complexity of the environment and drug dosage are important for balancing the induction of this survival state. 26 Discussion In response to impaired organismal protein synthesis, animals are capable of entering an arrest state, reaping survival benefits, and exiting to become reproductive adults (Fig 5B). In our studies, we are forcing continual exposure of animals to protein synthesis inhibiting RNAi or xenobiotics, which is likely "unnatural", as previous studies of lethal RNAi treatment and xenobiotic treatments leads to aversion behaviors 77,78 . With this in mind, we predict that in the wild the perceived loss of translation would evoke a similar aversion response - allowing animals to escape to new pathogen-free environments. This model is supported by our studies with cycloheximide exposure, which drives a rapid induction of arrest and stress resistance, from which animals can quickly recover. In this regard, we believe that the use of cycloheximide as a transient inducer of protein synthesis inhibition in the worm will be of great use in studying protein synthesis inhibition going forward in order to circumvent the complications of RNAi expansion over the worm lifespan and subsequent generations. Given that there is a dose response to CHX exposure, higher doses can be utilized to prolong the arrest state and enhance arrest phenotypes although prolonged exposure to higher concentration reduces the rate of escape (Table S2). The lack of necessity of DAF-16 for the developmental arrest in response to protein synthesis inhibition indicates that the reduced protein synthesis pathway functions independently from the dauer development pathway. Yet, while most dauer constitutive daf-2 mutants that are arrested from CHX do not form dauers, intriguingly ~20-25% will develop into dauers instead of undergoing protein synthesis arrest (S3D Fig). This finding suggests that animals can either alternatively arrest in the L2d stage 109–111 , or that the CHX dose requires a higher threshold for complete arrest of animals (especially given the 100% non-dauer RNAi- treated animals). Of note, reduced protein synthesis arrested animals are distinct from the L2d stage as they are of smaller length than wild type L2s (S1G Fig) (unlike 50% longer L2d animals 109 , functional AMPK is not necessary for the reduction of germ cell numbers (S8B Fig) 27 as it is in L2d/dauer animals 112 , and we have never observed them becoming dauers after exiting the arrest state. Future characterization of any phenotypic parallels between L2d and reduced protein synthesis arrest, especially in the context of the differing role of AMPK in controlling germ cell proliferation, will be of interest for future studies. A persistent question in biology asks how cellular status is communicated across the organism and, more importantly, how an appropriate homeostatic response is engaged. Protein synthesis inhibition in the hypodermis alone was sufficient for all arrest and healthspan phenotypes. In addition to its important role in the molting process during larval development, the hypodermis has recently been implicated as being important in dietary checkpoints in larval arrest 74,113 . Although it is known that C. elegans tissues have differential capacity for RNAi, our work bolsters the hypodermis as a key tissue in larval development, and identifies a new cell non-autonomous communication pathway to initiate systemic responses. Given that the hypodermis is the first barrier to its external environment that covers the entire organism, it is reasonable that C. elegans might evolve sensing mechanisms for hypodermal cellular changes to influence whole-body cellular signaling. It is also possible that the high demand for protein synthesis during growth of the developing hypodermis amplifies the tissue-general effects of protein synthesis inhibition in this tissue, with or without specifically evolved signaling pathways. However, proliferation alone is not the only factor that influences responses to protein synthesis inhibition. The germline is a highly proliferative tissue in C. elegans, and while protein synthesis inhibition in the germline did not result in the same L2 arrest state as tissue-general or hypodermis-specific reduction, it did result in pre-reproductive adult animals with mild stress resistance (S4 Fig). It remains to be seen if this germline arrest is also reversible, similar to starvation-induced adult reproductive diapause 68 . It is important to note the differences in stress resistance when protein synthesis is reduced in specific tissues. While hypodermis-specific RNAi of protein synthesis components results in increased stress resistance that is consistent when RNAi is initiated in all tissues, 28 intestine-specific RNAi resulted in no change to stress resistance capacity except for a few instances of increased resistance only observed for rps-11 RNAi. The more tissue-general expression of rps-11/RPS11 (S4 Fig), may explain these minor phenotypic differences as compared to egl-45/EIF3 RNAi. Taken together, these data support the idea that the systemic stress responses that stem from the loss of rps-11 are mediated by effects across multiple tissues. In contrast to the hypodermis and intestine, germline-specific loss of protein synthesis resulted in modest or no changes in oxidative stress resistance and surprisingly lead to reduced thermal tolerance. This suggests that the oxidative and thermal stress resistance responses, at least in the germline, may be uncoupled or, alternatively, that reducing protein synthesis in the germline activates a separate pathway that negatively affects thermal stress resistance. Finally, it is also worth noting that there is considerable variation in stress resistance among these tissue-specific RNAi strains. We attribute much of this both to the use of RNAi variance, as well as the ever-present "leakiness" of these tissue specific strains that can sometimes spread RNAi effects to other tissues 114,115 . The metallothionein, mtl-1, is highly (>100-fold) upregulated under reduced protein synthesis. The increased expression of mtl-1 was required for heavy metal resistance in animals with protein synthesis inhibition, which is notable since hypersensitivity to cadmium has not been reported in adult C. elegans lacking MTL-1 or MTL-2 116 . This finding further advocates for the importance of uncoupling developmental and adult specific responses. Transcription of MT-1, the mammalian homolog of mtl-1, is also upregulated by oxidative stress agents in cell lines and mice 117,118 , so it is possible that protein synthesis inhibition causes an increase in ROS that triggers mtl-1 transcription; however, then we would also expect to see increased transcription of SKN-1 target genes (e.g. gst-4), which we do not observe. Moreover, mtl-1 expression was not necessary for the arrest, oxidative or thermal stress resistance, or reduced pumping, as daf-16 mutants (which lack mtl-1 expression, S8 Fig) still display both phenotypes. Thus, given the very specific transcription of mtl-1, the 29 changes in expression are likely due to the presence of its most well-defined binding partners, metal cations. Traditional targets of MTL-1 are Zn 2+ , Cd 2+ , and Cu 2+ , but mammalian homologs can bind to Mg 2+ , Mn 2+ , and Ca 2+ 119–121 . The increase in Ca 2+ ions could be the cause of this high transcriptional response, especially given that Ca 2+ treatment could induce mtl-1 in worms (Fig 3E). However, it is also possible that higher levels of other heavy metals, such as Cd 2+ , which never reached our detection limits, are responsible. Given that mtl-1 expression was disposable for the arrest, stress resistance, and reduced pumping rate, the increased expression change is a "biomarker" for the reduction of protein synthesis, rather than a central player in this developmental state. Given the ability for calcium to upregulate this mtl-1 response (Fig 3), we expect the protein synthesis loss triggers calcium abundance and daf-16 activation 47 , that both go on to increase mtl-1 levels. It is possible that the reduction of cellular ATP we observe reflects the use of ATP to “power” survival processes 97 . However, a ~50% reduction in ATP after 24hrs of protein synthesis inhibition is a remarkable loss, and it would not explain how this energy usage would be sustained to continue stress resistance over extended time periods, especially when accompanied by a reduction in pharyngeal pumping (thereby reducing food/energy intake even further). Our data support an alternative model where increases in the [AMP]/[ATP] and [ADP]/[ATP] ratios activate AMPK pathways that signal for downstream survival pathways (Figs 4C and 4F). The underlying mechanism driving the imbalance to cellular adenylate pools will be of future interest. We found that AMPK was necessary for all of our protein synthesis inhibition survival phenotypes, except for arrest. AMPK activation has been implicated in survival phenotypes before, including glucose restriction pathways 122 and oxidative stress resistance 123 in C. elegans. Juxtaposed to our work, activating AMPK (such as via AICA ribonucleotide) causes a decrease in protein synthesis 81–83 . While our work focuses directly on protein synthesis alone, AMPK is also increased in rsks-1/S6K mutants 14,85 and under starvation conditions 84 . This 30 suggests that AMPK and protein synthesis may work together in a circular pathway or that they affect each other by cell non-autonomous signaling. In addition, an upstream activator of AMPK, ARGK-1, is both important for rsks-1/S6K mutant longevity, and its overexpression caused reduced pumping rates in worms 124 ; further study into the role of ARGK-1 in this protein synthesis inhibition survival state will be of interest in future studies. As a final note, C. elegans lacking the elongation factor efk-1, which is activated by AMPK, fare worse under nutrient starvation conditions 125 ; thus, there are multiple connections between starvation, protein synthesis, and energy homeostasis, and understanding them in context of survival states is important to consider. Previous studies suggest that the effects of protein synthesis inhibition on adult lifespan are distinct from caloric restriction (CR) 12 and that the CR state can drive a reduction in protein synthesis 15 . Our data suggest that during development the opposite is also true: that protein synthesis inhibition can reduce pharyngeal pumping leading to a CR-like state. CR across most organisms has both life- and healthspan promoting effects; however, the evolutionary basis of the CR response is unknown. One hypothesis generated from this study is that the physiological response to CR might stem from an ancient program to promote stress resistance when the presence of diminished biosynthetic capacity is perceived. Microorganisms such as Streptomyces provide a potential evolutionary explanation to a mechanism of a pathogen-derived CR pathway by engaging behavioral avoidance phenotypes toward toxin-producing pathogens 77 . It is important to note that Streptomyces was found at very low levels in recent studies looking at C. elegans soil samples 100–102 . Our xenobiotic experiments are not meant to emulate the wild environment, but to capture the interaction between the worm and a harmful species in the environment. It is altogether possible that there are areas (or times in history) where Streptomyces, or other species capable of inhibiting host protein synthesis, are a more common occurrence, demanding the need for such an arrest survival response documented here. 31 There are connections between immune function and the regulation of protein synthesis - both to exposure to protein synthesis-impairing xenobiotics (ExoA, Hygromycin) as well as potential surveillance mechanisms for reduced protein translation as a surrogate for infection 126–128 . Pathogen response pathways can also be closely linked to promoting proteostasis 129 . In addition, a recent study found that C. elegans can enter a diapause to avoid pathogens (unlike our study, this is reliant on the formation of dauers 130 ). Nevertheless, our findings support the idea that the loss of protein synthesis might be perceived as "an attack" by a pathogen, which initiates a reduction in pharyngeal pumping, that could minimize ingestion of toxin-producing microbes. Given the remarkable overlap in phenotypes resulting from protein synthesis inhibition by pathogen-derived xenobiotics and our genetic and RNAi-mediated protein synthesis inhibition, it is suggestive that this survival-arrest state could have evolved as a stress response to the presence of pathogens (Fig 6). This idea parallels models of adult longevity pathways, which may have connections to xenobiotics targeting other essential pathways besides protein synthesis 90 . Unlike previous models that suggest the developmental arrest resulting from early loss of protein synthesis is a detrimental state 97 , these studies provide an alternative way of thinking about these developmental responses. The induction of protective responses to reduced protein synthesis is survival-promoting, and we predict that the capacity to engage these pathways would enable future opportunities for reproduction once the inhibition is alleviated. Lastly, our results provide an example of how the evolution and selection of developmental pro-fitness pathways may be utilized effectively later in life under the right conditions. Just as dauer diapause from reduced insulin/IGF-1 signaling (IIS) has mechanistic similarities with adult longevity responses when IIS is reduced post-developmentally, our studies establish a similar fitness-driven developmental program as the underlying mechanism of the enhanced healthy aging observed in adults with compromised protein biosynthetic capacity. The exceptional degree of conservation of these cellular pathways across organisms 32 is suggestive that the pre- and post-developmental responses to protein synthesis inhibition observed in C. elegans could be similarly shared, even among humans. 33 Methods C. elegans strains and culture Worm strains were grown at 20 o C for all experiments except dauer studies that were conducted at 25C. All strains were unstarved for at least 3 generations (except for L1 synchronization) before being used in any experiments. List of strains used: N2 Bristol (wild type), DR1572 daf-2 (e1368), GR1329 daf-16 (mgDf47), MGH171 (sid-1(qt9); Is[vha-6::sid-1::SL2::gfp], JM43 (rde-1(ne219); Is[wrt- 2p::rde-1], myo-2p::rfp]), NL2098 (rrf-1(pk1417)), GR1395 (mgIs49[mlt-10p::gfp-pest, ttx-3::gfp]IV]), SPC365 mtl-1(tm1770); mtl-2 (gk125),, RB754 (aak-2 (ok524)), SPC366 (aak-2 (ok524); uthIs248[aak- 2p::aak-2(genomic aa1-321)::GFP::unc-54 3'UTR (gain of function allele); myo-2p::tdTOMATO]), SPC363 (Ex[egl-45p::rfp; rol-6(su1006)]), SPC364 (Ex[rps-11p::gfp; rol-6(su1006)]), CL2070 (dvIs70[hsp-16.2p::GFP; rol-6(su1006)]), KX38 (ifg-1 (ok1211)/mIn1 [mIs14 dpy-10(e128)]). Some strains were provided by the CGC, which is funded by NIH Office of Research Infrastructure Programs (P40 OD010440). Protein synthesis inhibition treatment by RNAi or xenobiotic E. coli strain HT115 (DE3) containing empty vector L4440 (hereafter referred to as Control RNAi), or plasmid against a gene of interest, was grown overnight (16-18hrs) at 37 o C and seeded on NGM plates containing 5mM isopropyl-β-D-thiogalactoside (IPTG) and 50ug/ml carbenicillin. The bacteria were allowed to generated dsRNA overnight before being used within the next 1-3 days (stored at 20 o C for this period if not used immediately). Dose response curves were established by feeding HT115 bacteria expressing the indicated RNAi clone diluted with HT115 bacteria harboring the control RNAi plasmid L4440. 0.05mg/ml Cycloheximide (CHX) or water (vehicle control) was added on top of bacteria and allowed to dry and rest for at least 1 hour before placing worms on treated bacterial lawns; this was the concentration of CHX throughout this paper, unless otherwise noted. Loss of protein synthesis was determined via measurements of de novo synthesis of GFP through both an internal (via natural development) and external (via high temperature) induction method. External: plated animals expressing hsp-16.2p::GFP were maintained at 20 o C and fed RNAi since hatching. After 24hrs, one set of worms was shifted to 36 o C for 3hr, while the other was 34 mounted for the baseline 0hr time point. The baseline plate was also checked after 3 hours at room temperature as a control for any room temperature-induced GFP expression. Internal: plated animals expressing mlt-10p::gfp-pest, treated with RNAi or drug since hatching, were imaged via the same methods for GFP expression at 12, 14, and 16 hours post-feeding. Worms were imaged at 20x zoom with bright field and GFP filter (Zeiss Axio Imager). Protein synthesis arrest recovery Plated animals, treated with drug or RNAi since hatching, were counted in 24 hours intervals via a compound microscope as larval stage 1-3 (size), larval stage 4 (vulval invagination), adult (size), or reproductive (presence of internal eggs). In food switching assays, worms were moved to rde-1 RNAi after 24hrs on the listed RNAi. rde-1 RNAi was used to inhibit the RNAi machinery because RNAi effects can persist even after moving animals off of food containing double stranded RNA for multiple generations. Thermotolerance Plated animals, treated for 24 or 48 hours on drug or RNAi since hatching, were placed at 36 o C for up to 12 hours. Every 3 hours, one set of plates was removed to room temperature. Worms were allowed to recover for at least 10 minutes, and then counted for survival immediately by checking for touch response to prodding with a platinum wire. Oxidative stress Plated animals, treated for 24 or 48 hours on drug or RNAi since hatching, were washed with M9 buffer twice in microcentrifuge tubes, then treated with 20mM H 2 O 2 for up to 1 hour while rocking at room temperature. Every 20 minutes, one set of worms was removed from rocking, washed 3 times in M9 buffer, and plated back onto new plates containing their previous treatment (drug or RNAi). Worms were checked 1 hour after plating to count any acute deaths ("straight line" bodies or ruptured vulvas) only by eye, and 24 hours after plating to count final survival as done in thermotolerance assay. Heavy metal stress Plated animals, treated for 24 hours on RNAi since hatching or at L4/YA stage, were washed with K-medium (32mM KCl, 51mM NaCl in dH2O) twice in microcentrifuge tubes, then treated with 5 or 35 50mM CdCl 2 in K-medium (hatched or YAs, respectively) for 30 minutes while rocking at room temperature. After 30 minutes, worms were washed 3 times in K-medium, and plated back onto new plates containing their previous treatment (RNAi). Worms were checked 1 hour after plating to count any acute deaths ("straight line" bodies or ruptured vulvas) only by eye, and 24 hours after plating to count final survival as done in thermotolerance assay. Dauer development assay Wild type and daf-2(e1368) were placed as synchronized L1s onto the listed RNAi clone or drug at 25 o C for 48hrs. Worms were then washed in M9, pelleted, and treated with 1% for 30min while rocked at room temperature. Treated animals were then plated onto plates with HT115 bacteria and counted for survival. qRT-PCR measurements Drug- or RNAi-treated animals were washed with M9 buffer twice in microcentrifuge tubes, then frozen at -80 o C in TRI-Reagent® (Zymo Research, R2050-1-200). After at least 24 hours at -80 o C, RNA was extracted from samples using the Direct-zol™ RNA MiniPrep kit (R2052). Quantitative reverse transcription PCR (qRT-PCR) was performed on the RNA samples with gene specific primers (Table 1). For evaluation of mtl-1 induced by calcium, wild type animals, grown for 24 hours on Control RNAi, were washed with K-medium twice in microcentrifuge tubes and then treated with 500mM CaCl 2 (in K-medium) for 30 minutes at room temperature. Animals were then washed three times with K- medium, frozen at -80 o C in TRI-Reagent® as above, and the same protocol as above was utilized. Developmental timing by mlt-10p::gfp Two 24-well plates, each containing a single GR1395 worm on RNAi or Control RNAi, were visualized by fluorescence microscopy every hour for 72 hours. Worms were marked as green or non- green to indicate molting or non-molting, respectively. Worms that crawled off the side of the plate or burst were censored. Germline development Plated animals, treated for 24 hours on RNAi or drug since hatching, were imaged at 20x magnification (Zeiss Axio Imager), and individual germ cells were counted with the Cell Counter plugin on Fiji software 131 . 36 Pharyngeal pumping analysis Plated animals, treated for the indicated time on drug or RNAi since hatching, were imaged via the Movie Recorder at 8ms exposure using the ZEN 2 software at 10x magnification (Zeiss Axio Imager). Animals with zero pumping were excluded. ATP, ADP, AMP measurements 1000 or 500 plated animals, treated for 24 or 48 hours on drug or RNAi since hatching respectively, were washed 3 times in M9 buffer (keeping ~100µl of supernatant at final wash), snap frozen in a dry ice/ethanol bath, and placed at -80 o C until use. Frozen pellets were boiled for 15 minutes and spun down at 14,800g at 4 o C. The supernatant was then diluted in dH 2 O (1/10) (Adapted from 132 ). Samples were tested for protein content via Bradford analysis (Amresco M173-KIT), and ATP was assessed via the ENLITEN® ATP Assay System (Promega). To determine relative levels of ATP/ADP/AMP, we followed the same method as above, but did not dilute the supernatant. Protein supernatant was directly assayed via the ATP/ADP/AMP Assay Kit (University at Buffalo, Cat. # A-125) to determine total ATP/ADP/AMP in each sample; these values were then directly compared to determine relative ratios. Inductively-coupled plasma atomic emission spectroscopy analysis 8,000-10,000 (L4 stage) or 20,000-25,000 (L2 stage) animals, treated for the listed time on the listed RNAi clone, were collected into microcentrifuge tubes (tubes weighed beforehand) using isotonic buffer (150mM Choline Chloride, 1mM HEPES, pH 7.4 with NaOH, filter sterilized). Worms were washed 3 times over 30 minutes (pelleting at 1,000g/30s each time) to clear gut content and then finally pelleted at 12,000g/2min. Worm pellets were then dried at 60 o C for 48 hours using a heat block. Worm pellets were weighed after drying, and ICP analysis of the samples was conducted by Dr. David Kililea, Children's Hospital Oakland Research Institute. Before ICP analysis, dried pellets were acid digested with Omnitrace 70% HNO 3 at 60°C overnight. Samples were diluted with Omnitrace water for a final concentration of 5% HNO 3 . Derived metal content was normalized to dried worm pellet weights. Each animal is compared back to 24hr Control RNAi treated animals. 48hr Control RNAi animals are given as a reference for what the metal content of a chronologically matched animal would be; albeit animals that are L4-YA stage and thus 2-3 larger with higher food intake. 37 Streptomyces co-culture Streptomyces Alboniger (ATCC 12461), Griseus (ATCC 23345), or Griseolus (ATCC 3325) were grown at 26 o C, shaking, in Tryptone-Yeast Extract Broth (5g Tryptone, 3g Yeast Extract in 1L dH 2 O, pH 7; taken from ATCC® Medium 1877: ISP Medium 1) for 5 days before plating unless otherwise noted. Strains were plated on Yeast Malt Agar plates (HiMedia Laboratories, M424), and mixed 1 part to 3 parts 25x HT115 when used with worms. For the egg laying comparisons, 100ul Saccharomyces cerevisiae was also added to induce competition; to compare total number of eggs, worms were mounted at ~52hrs after dropping to food source, and imaged at 20x zoom with DIC (Zeiss Axio Imager). For testing dead HT115, 75ml/L of 2.5% Streptomycin was added to 25x HT115 and the mix was rocked for 24hrs at room temperature. This mixture was then used in place of the 25x HT115 above. Survival assay For survival in the arrested state, worms were dropped on the listed RNAi and counted each day (for the majority) for survival. Survival was assessed by touch response to prodding with a platinum wire. The Control RNAi wild type control strain used in this experiment was moved each day starting at adult day 1 as necessary until reproduction ceased. For tissue-specific lifespan analysis, worms were grown on Control RNAi until L4/young adult age, and then transferred to the listed RNAi plates treated with 50µM FUdR. Survival was assessed every other day as above. For all assays, animals were only censored (bursting, vulval protrusion, etc.) prior to the first counted death. Worm imaging Worm morphological comparisons were imaged at 20x zoom with DIC filter (Zeiss Axio Imager). Worm length comparisons were made in ImageJ using the segmented line tool down the midline of each animal from head to tail. For GFP and RFP reporter strains, worms were mounted in M9 with 10mM Sodium Azide, and imaged at 40x zoom with DIC and GFP/RFP filters (Zeiss Axio Imager). Fluorescence is 38 measured via corrected total cell fluorescence (CTCF) via ImageJ and Microsoft Excel. CTCF = Integrated Density – (Area of selected cell X Mean fluorescence of background readings). For imaging of heat-induced GFP expression via strain CL2070, plated animals were maintained at 20 o C and fed RNAi since hatching. After 24hrs, one set of worms was shifted to 36 o C for 3hr, while the other was mounted (as above) for the baseline 0hr time point. The baseline plate was also checked after 3 hours at room temperature as a control for any room temperature- induced GFP expression. Worms were imaged at 20x zoom with bright field and GFP filter (Zeiss Axio Imager). Statistical analyses Thermotolerance, oxidative stress, and heavy metal stress were all compared using Fisher's Exact Test using the statistical software R 133 ; specifically, the bars in each graph represent a unique set of biological replicates (2-6 independent biological replicates) relative to its own independent control cohort (and the significance level relative to this control is indicated by the # of stars above each bar); this test is employed as we are comparing the categorical variables of Alive vs Dead, and data is presented as changes in survival. Comparison of all RNAi clones and CHX for protein synthesis rates under the mlt-10p::GFP promoter was performed using one-way ANOVA. Lifespan curves were compared and analyzed via Log-Rank using JMP Pro 12. qPCR, worm fluorescence, metal content, ATP/ADP/AMP levels, and pharyngeal pumping comparisons were made with Student's t test using Microsoft Excel. When comparing groups of three or more, Bonferroni multiple comparison post- correction was employed on Fisher's test, ANOVA, and t tests. 39 snb-1 F CCGGATAAGACCATCTTGACG snb-1 R GACGACTTCATCAACCTGAGC mtl-1 F GCTTGCAAGTGTGACTGCAA mtl-1 R TTTTTCTCACTGGCCTCCTC mtl-2 F TCTGCAAGTGTGACTGCAAA mtl-2 R CAGCAGTATTGCTCACAGCAC cdr-1 F TCTTCTCTCAATTGGCAACTG cdr-1 R TTTGGGTAAACTTCATGACGA gst-4 F GATGCTCGTGCTCTTGCTG gst-4 R CCGAATTGTTCTCCATCGAC hsp-4 F CTAAGATCGAGATCGAGTCACTC hsp-4 R GCTTCAATGTAGCACGGAAC hsp-6 F TTAGAAACCCCCAACGTGTC hsp-6 R CGGCACAAAGAACAGAACAA hsp-60 F TCCAACTAAGGTGGTTCGC hsp-60 R TGACTACGCATTCGGTTGTG hsp-70 F TGAAAGAGAAGACGCAGCAC hsp-70 R GCCTGCTTAACTTGGAATGC hsf-1 F TTGACGACGACAAGCTTCCAGT hsf-1 R AAAGCTTGCACCAGAATCATCCC daf-16 F CTTCAAGCCAATGCCACTACC daf-16 R GGAGATGAGTTGGATGTTGATAGC sod-2 F TTTGGAAGATCGCCAACTG sod-2 R TTGTGATTCAGCTCATTTATTGC ugt-11 F CCGATTTCTGGGACTCTCAA ugt-11 R GGACTCCCAGGAAGTGTGAC gcs-1 F CCAATCGATTCCTTTGGAGA gcs-1 R TCGACAATGTTGAAGCAAGC icl-1 F TCTCCGTGGTATCCATGCC icl-1 R TGATCGAAAACTCTCTTAGCC gpdh-1 F GGAGCACTAAAGAACATTGTCG gpdh-1 R GGATGATAGCGGATTTCACG sod-3 F GCAATCTACTGCTCGCACTG sod-3 R GCATGATGCTTTTGATGATGA sod-1 F TTTTCCGCAGGTCGAAGC sod-1 R CCTGGTCATTTTCGGACTTC sod-2 F TTTGGAAGATCGCCAACTG sod-2 R TTGTGATTCAGCTCATTTATTGC sod-4 F TGGCCGAAGTGTGGTTATTC sod-4 R TCAGACGGTACCGATAGTTCC sod-5 F CTTCCACAGGACGTTGTTTCC sod-5 R TGGGTAAGCCAAACAGTTCC Table 1. List of genes tested for expression and their qPCR primers. Acknowledgements We thank J. Dietrich, S. Hassan, and L. Thomas for technical support; A. Frand for the mlt- 10p::GFP reporter strain GR1395; J. Lo for critical reading and comments on the manuscript; the Caenorhabditis Genetics Center (CGC) for some strains used in this study, and WormBase. 40 Figures Fig 1. Protein synthesis inhibition promotes a developmental arrest and survival state. A-C. C. elegans normally transit temporally through four larval stages; each is stage separated by a molt (A), while protein synthesis inhibition induced by egl-45 RNAi (B) or rps-11 RNAi (C) results in arrest at larval stage 2 (L2); each black line represents a single worm (darker shades indicating more animals) and the red line represents % molting worms in the population. Note that starting from synchronized L1s, Control RNAi animals go through four molts (represented by each "peak" of red) to become Adults, while egl-45 and rps-11 RNAi treated animals cease development after the first molt as L2 stage larva (N=33-46 from 2 biological replicates). D-E. Protein synthesis inhibition-induced arrested L2 larvae are resistant to oxidative (D) and thermal (E) stress as compared to control RNAi treated L2 stage animals (the bars in each graph represent a unique set of biological replicates relative to its own independent control cohort, N=126-251 from 2-3 biological replicates). (F). Wild type L2 stage lasts ~8hrs (panel A), 41 while arrested animals survive weeks in the L2 stage; WT animals exit L2 stage by proceeding to L3 stage and normal development, while arrested animals "exit" L2 stage via death (N=180-227 from 2-3 biological replicates). * p< 0.025, ** p<0.005, *** p<0.0005, **** p<0.00005 (D-E: Fisher's exact test). Fig 2. Cell autonomous and cell non-autonomous pathways contribute to organismal responses to protein synthesis inhibition. A. Germ cell proliferation is restricted in response to protein synthesis inhibition (N=9-20). B-D. As compared to control RNAi (B), hypodermal-specific RNAi targeting egl-45 (C) or rps-11 (D) is sufficient to drive developmental arrest; pre-L4 (blue) to L4 (red), to adult (green), and reproductive adult (purple). Note that "pre-L4" is almost exclusively L2 stage past 24hrs, based on germline and molting data (see Methods for details) (N=279-335 from 2 biological replicates). E-G. Hypodermal-specific protein synthesis inhibition arrests germ cell proliferation (E) (N=21-22 from 2 biological replicates), organism level resistance to oxidative (F) and thermal (G) stress as compared to control RNAi-treated L2 stage animals (the bars in each stress resistance graph represent a unique set of biological replicates relative to its own independent control cohort, N=178-403 from 2-3 biological replicates). * p<0.025, ** p<0.005, **** p<0.00005 (A, E: One-way ANOVA; F-G: Fisher's exact test). 42 Fig 3. Protein synthesis inhibition induces mtl-1 expression in response to deregulated Ca 2+ homeostasis. (A-B) Organismal expression of mtl-1 is increased while mtl-2 is decreased in response to protein synthesis inhibition generated by RNAi in all cells (solid bars), hypodermal-specific RNAi (Hyp), or the germline-specific RNAi (Ger), but not the intestine-specific RNAi (Int) (A); this expression is more pronounced after 5 days (120hr) in the arrested state (B) (3 biological replicates). C. Protein synthesis inhibition-induced arrested L2 larvae are resistant to toxic levels of Cd 2+ (50mM) (N=188-251 from 2 biological replicates). D. Quantification of ICP-AES analysis of steady state metal levels in protein synthesis inhibition treated wild type animals. Samples are compared to 24-hour old, L2 stage, animals fed Control RNAi (from 4-7 biological replicates). E. Wild type animals exposed to 500mM CaCl 2 induce the expression of mtl-1 similar to protein synthesis inhibition treated animals (3 biological replicates). * p<0.05, ** p<0.01, *** p<0.001, **** p<0.0001 (A-B, E: Student's t test). * p< 0.025, ** p<0.005, *** p<0.0005, **** p<0.00005 (D-E: Student's t test; C: Fisher's exact test). 43 Fig 4. Protein synthesis inhibition drives a reduction in pharyngeal pumping and stress resistance through AMPK signaling. A. Protein synthesis inhibition decreases pharyngeal pumping rates in wildtype animals in a time-dependent manner (N=9-23 from 2-3 biological replicates). B. Reducing protein synthesis in the hypodermis is sufficient to reduce pharyngeal pumping rate (N=9-10 from 2 biological replicates). C-D. Protein synthesis inhibition arrested larvae have reduced levels of cellular ATP, and their ratio of AMP and ADP to ATP is higher (3 biological replicates). E-F. aak- 2/AMPK mutant animals fail to reduce pharyngeal pumping in response to protein synthesis inhibition (E) and although arrested, are not resistant to environmental stress (F) (N=16-24 from 2-3 biological replicates; intensity of red and blue coloring indicates increased and decreased responses, 44 respectively, as compared to control RNAi treated animals). G. Schematic diagram of the cell autonomous and cell non-autonomous pathways that mediate organism-level responses to protein synthesis inhibition – red colors identify findings of this study. Additional mediators (?) are likely to exist, including the genetic regulators of the developmental arrest (left). * p<0.025, ** p<0.005, *** p<0.0005, **** p<0.00005 (A-B, E: One-way ANOVA, C-D: Student's t test). Fig 5. Exposure to the xenobiotic cycloheximide mimics the survival responses to transcriptional and genetic reduction of protein synthesis. A. C. elegans exposed to Streptomyces species, that generate xenobiotics targeting eukaryotic protein synthesis, reduce pharyngeal pumping, but not when secondary metabolism is repressed (N=9-18 from 2 biological replicates). B. Animals exposed to 0.05mg/ml CHX for 24hrs, then removed to vehicle, can fully recover to reproduction (N=93 from 2 biological replicates). C-E. Treatment of C. elegans with cycloheximide (CHX) reduces pharyngeal pumping (C) (N=31-64 from 3 biological replicates), arrests germ cell proliferation (D) (N=10-20), increases the ratio of AMP and ADP to ATP (E) (3 biological replicates), and induces protein synthesis inhibition developmental arrest and stress resistance phenotypes; intensity of red coloring indicates increased responses as compared to control RNAi (F). * p<0.0166, **** p<0.000033 (A: One-way ANOVA); * p<0.05, ** p<0.01, **** p<0.0001 (C-E: Student's t test). 45 Fig 6. Schematic model of fitness-driven responses to toxin producing microbes. The ability of a worm to respond to toxins via stress responses, such as increasing stress resistance or decreasing pharyngeal pumping, is imperative to survive in a pathogen-rich environment. 46 Supplemental figures 47 S1 Fig. Protein synthesis inhibition promotes a sustained developmental arrest state. A. Schematic placement of RPS-11 (green), EGL-45/EIF3A (red), IFG-1/EIF4G (light blue), and cycloheximide (purple) in ribosome biogenesis and processivity B-C. As compared to control RNAi treated animals (blue), protein synthesis inhibition by egl-45 (red) or rps-11 (green) RNAi impairs GFP biosynthesis in response to heat shock in animals expressing hsp-16.2p::GFP (B) (N=14-17) or in response to reporter of developmental molting by mlt-10p::GFP (C) (N=40-48 from 2 biological replicates). hsp-16.2p::GFP worms are 24hrs on RNAi at time of heat shock (the 0hr); mtl-10p::GFP worms are the same age as the listed hour post-feeding. Both fluorophores are measured via corrected total cell fluorescence (CTCF). D. egl-45 or rps-11 RNAi results in a sustained, greater than 10 days, developmental arrest at the L2 larval stage. E. Decreasing the total percentage of RNAi in the food (via mixing with Control RNAi) results in a dose-dependent response for developmental arrest. F. DIC comparisons of wild type, egl-45 and rps-11-arrested animals, daf-2(e1368) dauers, and arrested starved L1 larvae grown at 25C (scale bar is 100um). The gross developmental size of egl-45 and rps- 11 RNAi arrested animals are between dauers and starved L1 larvae. G. Worms with reduced protein synthesis grown at 20C or 25C for 24hrs are smaller than Control RNAi-fed animals. * p< 0.025, ** p<0.005, *** p<0.0005, **** p<0.00005 (B, G: Student's t test); ** p<0.0017, **** p<0.000017 (C: One- way ANOVA). 48 S2 Fig. Organismal stress resistance is a specific response to protein synthesis inhibition- induced L2 arrest. A-F. Absolute survival of protein synthesis inhibition-induced arrested L2 larvae by 49 RNAi to egl-45 (red) or rps-11 (green) as compared to control RNAi (blue) when exposed to oxidative (A,C,D) or thermal (B,E,F) stress following 24 (A,B), 48 (C,E), or 240 (D,F) hours of arrest (N=23-423 from 2-3 biological replicates). G-H. Flow chart (G) of RNAi clones screened that induce larval stage 2 arrest and the timeline of maintained arrest (H) (N=15-35 from 3 biological replicates). I. acn-1 (brown), let-767 (purple), and pan-1 (yellow) RNAi do not reduce protein synthesis to the same degree as egl-45 or rps-11 RNAi as compared via mlt-10p::GFP analysis (N=40-48 from 2 biological replicates). J-K. L2 arrest induced without protein synthesis inhibition through acn-1, let-767, or pan-1 RNAi does not result in the same stress resistance phenotypes (N=151-312 from 2-3 biological replicates). L. Arrested L2 ifg-1 mutants (light blue) have oxidative stress resistance (N=82-388 from 2 biological replicates). M. Survival of acn-1, let-767, and pan-1 dropped as synchronized L1s onto RNAi (N=101-132 from 4 biological replicates) (acn-1 vs egl-45 or rps-11 p<0.0001, Log-Rank test). * p<0.0083 (I: One-way ANOVA); * p< 0.01667, ** p<0.0033, *** p<0.00033, **** p<0.000033, (J-K, Fisher's exact test), * p<0.05, ** p<0.01, **** p<0.0001 (L, Fisher's exact test) 50 S3 Fig. Organismal stress resistance is independent of the DAF-16 dauer pathway. A-C. daf- 16(mgDf47) mutant animals still arrest under reduced protein synthesis (A) (N=22-32 from 2 biological replicates) and still have oxidative (B) and thermal (C) stress resistance (N=40-397 from 2-3 biological replicates). D. Arrest from reduced protein synthesis does not protect against 1% SDS, and the protein synthesis arrest at L2 occurs instead of dauer diapause as - daf-2(e1368) animals become susceptible to SDS rather than develop into SDS-resistant dauers. * p< 0.025, ** p<0.005, *** p<0.0005, **** p<0.00005 (B-C: Fisher's exact test). *** p<0.0001 (Q, Two-way ANOVA). 51 S4 Fig. Tissue-specific protein synthesis inhibition responses. A. Model of C. elegans tissues. B- P. As compared to hypodermal specific RNAi (as shown in Fig 2) and relative to control RNAi (B, E, H, 52 K, I), intestinal-specific (E-G, L, M-N) and germline-specific (H-J, K, O-P) RNAi targeting egl-45 or rps- 11 have attenuated or undetectable responses to protein synthesis inhibition (arrest N=225-311, pumping N=22-26, oxidative/thermal N=79-364 from 2-3 biological replicates). Q. RNAi of egl-45 (red, p<0.001, Log-rank test) or rps-11 (green, p<0.01, Log-rank test) only in the hypodermis (left) in post- developmental wild type animals is sufficient to induce lifespan extension as compared to control RNAi treated animals (blue); this is compared to wild type (right) increases in lifespan under RNAi of egl-45 (red, p<0.0001, Log-rank test) or rps-11 (green, p<0.05, Log-rank test) (N=50-221 from 2 biological replicates). R-U. An rps-11p::gfp (R,S) and egl-45p::mCherry (T,U) reporter is detectable in multiple tissues at 24 hours (R,T) and 48 hours (S,U) of development. **** p<0.0001 (K-L, One-way ANOVA); * p< 0.025, ** p<0.005, *** p<0.0005, **** p<0.00005 (M-P, Fisher's exact test). 53 S5 Fig. Transcriptional profiling of tissue general and tissue specific protein synthesis inhibition responses. A-E. Relative to tissue general RNAi (solid), hypodermal specific (Hyp) RNAi 54 induces similar transcriptional responses to reduced expression of egl-45 (A, C, G, H) or rps-11 (B, D, E, F, I, J), while germline specific (Ger) and intestinal specific (Int) RNAi responses are attenuated (3 biological replicates). K. Post-developmental RNAi of egl-45 (red) or rps-11 (green) is sufficient to induce resistance to toxic levels of cadmium (5mM) (N=126-198). L-M. 24-hour hypodermal reduction of protein synthesis is sufficient to provide similar resistance as whole-body (L), and whole-body resistance is largely lost in mtl-1 and mtl-2 double mutants (M) (N=97-257 from 2 biological replicates). N. 48 and 120hr hypodermal reduction of protein synthesis increases mtl-1 expression further (3 biological replicates). * p<0.05, ** p<0.01, *** p<0.001 (A-J, N-P, N: Student's t test); * p< 0.025, ** p<0.005, *** p<0.0005, **** p<0.00005 (K-M: Fisher's exact test). 55 S6 Fig. Steady state levels of metals in response to protein synthesis inhibition. A-C. Quantification of ICP-AES analysis of steady state metal levels in protein synthesis inhibition treated 56 wild type (A) or mtl-1; mtl-2 mutant (B, C) animals. D. Comparison of mtl-1; mtl-2 mutant animal total metal levels compared to wild type (4-7 biological replicates). * p< 0.025, ** p<0.005, *** p<0.0005, **** p<0.00005 (A-D: Student's t test). 57 S7 Fig. Changes in pharyngeal pumping in response to protein synthesis inhibition. A. ifg-1 mutant animals (light blue) have reduced pharyngeal pumping compared to wild type animals (N=12-22 58 from 2 biological replicates). B. RNAi of egl-45 (red) or rps-11 (green) reduces pharyngeal pumping rate over 15 days of L2 arrest (no control is given for 240/360 hours as all control animals are post- developmental) (N=7-14 from 2 biological replicates). C. The pharyngeal pumping decrease is not dependent on daf-16 (N=15-18 from 2 biological replicates). D-E. RNAi of egl-45 (red) or rps-11 (green) only in the germline does not decrease pumping to the same degree (D) and increases pumping when RNAi is restricted in the intestine (E) (N=9-21 from 2 biological replicates). F. 24 hours of RNAi of egl-45 (red) or rps-11 (green) in post-developmental wild type animals is sufficient to reduce pharyngeal pumping as compared to control RNAi treated animals (blue) (N=11-18 from 2 biological replicates). * p<0.05, ** p<0.01, *** p<0.001, **** p<0.0001 (A: Student's t test); * p<0.025, ** p<0.005, *** p<0.0005, **** p<0.00005 (B-F: One-way ANOVA). 59 S8 Fig. Organismal responses to protein synthesis inhibition are mediated by AMPK signaling. A. Protein synthesis inhibition induces L2 arrest independent of AMPK signaling. B-O. aak-2/AMPK 60 mutation (B, D, F, I, J, K, M, N) abolishes protein synthesis inhibition responses, that are restored by ectopic expression of AAK-2(aa1-321) (uthIs248; CA-AMPK) (C, D, E, J, L, M, O) (48hr timepoint shown; pumping N=12-27 from 1-2 biological replicates, cadmium/oxidative/thermal N=79-351 from 2-3 biological replicates). F-I. The increased expression of mtl-1, but not the reduced expression of mtl-2, in response to egl-45 (red) or rps-11 (green) RNAi, is dependent on daf-16 (G), which is a known transcriptional regulator the mtl-1 locus (H) (3 biological replicates). * p<0.05, ** p<0.01, *** p<0.001, **** p<0.0001 (F-H: Student's t test) * p<0.025, ** p<0.005, *** p<0.0005, **** p<0.00005 (B-E: One-way ANOVA; I-O: Fisher's exact test). 61 S9 Fig. Organismal responses to protein synthesis inhibition may have evolved from interactions with microbes that generate protein synthesis inhibition xenobiotics. A. Table of 62 Streptomyces species that produce xenobiotics that target eukaryotic protein synthesis. B. Exposure to Streptomyces species grown at stationary phase delays reproduction (N=21-47 from 2 biological replicates). C. CHX strongly inhibits protein synthesis when assayed through the mlt-10p::GFP reporter (N=16-48from 2 biological replicates). D. Relative to vehicle (water) treatment, animals exposed to cycloheximide (CHX) delay development in a dose-dependent manner (D). E-G. Development resumes from L2 (blue) to L4 (red), to adult (green), and reproductive adult (purple) when animals are moved from either control RNAi (E), egl-45 RNAi (F) or rps-11 RNAi (G) onto rde-1 RNAi to impede RNA interference (N=95-114 from 2 biological replicates). H-M. Developmentally arrested animals, exposed for 24hrs to CHX, are resistant to oxidative (H) and thermal (I) stress (N=48-301 from 2 biological replicates), increase mtl-1 expression (J) (3 biological replicates), have reduced ATP levels (K) (3 biological replicates), and have similar metal profiles as RNAi-mediated protein synthesis inhibition animals (L-M) (7 biological replicates). N-Q. Animals released and allowed to develop after 24hr exposure to CHX at hatching have a small but non-significant decrease in brood size (N) (N=12-13), have a small increase in oxidative stress resistance (O) (N=84-219 from 2 biological replicates), are delayed 16-20hrs in reproduction timing (P) (N=241-418 from 2 biological replicates), and have normal pumping rates by physiological day 3 of adulthood (Q) (N=15-16 from 2 biological replicates). R-S. The effects of S. griseus on pumping are dependent on living HT115 (R) (N=21-30 from 2 biological replicates), and CHX has a dose-dependent effect on pumping rate (S) (N=7-16). * p<0.0166 (B: Student's t test); * p<0.05, ** p<0.01, *** p<0.001, **** p<0.0001 (C, J-M, P-R: Student's t test; H-I, O: Fisher's exact test) * p<0.01, ** p<0.002, *** p<0.0002, **** p<0.00002 (S: One-way ANOVA). 63 Chapter 3 Developmental arrest in response to reduced protein synthesis causes altered lipid homeostasis in Caenorhabditis elegans and is mediated by TGF-β signaling Hans M. Dalton 1,2 and Sean P. Curran 1,2,3 1. Leonard Davis School of Gerontology, University of Southern California, Los Angeles, CA 90089 2. Dornsife College of Letters, Arts, and Sciences, University of Southern California, Los Angeles, CA 90089 3. Norris Comprehensive Cancer Center, Keck School of Medicine, University of Southern California, Los Angeles, CA 90089 64 Introduction Genetic pathways linked to growth are often intimately tied to longevity phenotypes. For example, inhibiting the major growth complex mTOR, genetically or pharmacologically, increases longevity in worms 20,134 , flies 13,135 , and mice 14,21,56 . Genetically disrupting the insulin signaling (IIS) growth pathway can also increase longevity in worms 8,38,39 , flies 9 , and mice 10 . And reducing protein synthesis, essential for growth and development, can decrease senescence features in human cell lines 105 , increase healthspan and lifespan in C. elegans 15,47,105 , and increase replicative lifespan in yeast 136 . All of these cases - mTOR, IIS signaling, protein synthesis - must be only partial inhibitions of signal, or must be initiated post- developmentally, to reap the benefits of health- or lifespan extension; inhibiting growth too early results in lethality - for example, deletion of insulin receptors in mice causes postnatal lethality 54,137,138 , and mTOR deficiency in C. elegans causes developmental arrest 139 . However, some of these "lethal" endpoints can actually be transient stages, where animals may arrest development only to later escape or overcome the growth loss if the inhibition is reduced or removed. Understanding the underlying mechanisms of these developmental phenotypes may provide insight into the greater role of these genetic pathways over whole lifespans. Reducing protein synthesis induces a transient developmental arrest at larval stage 2, prior to dauer arrest 46 . Yet similar to dauer arrest 8,38,39 , this arrest is reversible with little or no late-life consequences from being arrested 46 . During this arrest, the worm has increased stress resistance (oxidative, thermal, and heavy metal) and a reduced feeding rate, both of which rely on functional AMP kinase (AMPK), an energy sensor. In addition, reducing protein synthesis in the hypodermis alone was sufficient for these phenotypes, indicating a cell non-autonomous effect on pumping rate. Despite the importance of AMPK for the enhanced survival phenotypes, AMPK mutant animals remain arrested as larval stage 2 (L2) animals under reduced protein synthesis. It is still unclear what pathway(s) control the transition into or 65 out of this L2 arrest and how independent this arrest pathway is from the AMPK-dependent survival phenotypes. Energy storage has important roles in growth and longevity pathways in C. elegans. The dauerlarvae, induced by factors such as high population, temperature, or starvation, maintains high levels of lipids despite being unable to physically eat 38,140 . In addition, long-lived IIS mutants or germline-less mutants have higher lipid levels than wild type 141 , and alterations to lipid synthesis can affect stress resistance and longevity in the worm 142 . One pathway controlling dauer formation is the DAF-7 branch of the Transforming Growth Factor beta (TGF- beta) pathway, where early daf-7 inactivation causes constitutive dauer animals 143–145 . Adult worms with downregulated daf-7 ligand have a reduced feeding rate, yet they still accumulate lipids - similar to dauer and reduced IIS animals 146 . Recently, the other TGF-beta branch, which signals through the ligand DBL-1, has been implicated in lipid homeostasis. Worms with either increased or decreased DBL-1 signaling have a decrease in lipid levels 147 ; intriguingly, in animals with reduced DBL-1 signaling, rescuing this pathway in the hypodermis alone could restore lipids to wild type levels. Given the reduced pumping rate and increased energy usage in worms with reduced protein synthesis, both their lipid content and how their lipid content may affect their increased arrest survival are important to elucidate. Here we found that reducing protein synthesis causes ongoing accumulation of lipids in arrested animals. We performed RNA-seq on arrested animals and found that these arrested worms have reduced expression of lipid catabolism genes; in addition, a significant fraction of upregulated genes are associated with the DBL-1 TGF-beta signaling pathway. Finally, we found that overexpression of DBL-1 can release animals from some forms of reduced protein synthesis arrest. 66 Methods Strain information and maintenance Worms were kept at 20 o C for all experiments unless otherwise indicated. List of strains: N2 Bristol (wild type), BW1940 (ctIs40 [dbl-1(+) + sur-5::GFP]), LT186 (sma-6(wk7) II), SPC407 (ctIs40 [dbl-1(+) + sur-5::GFP]; sma-6(wk7)). Some strains were provided by the CGC, which is funded by NIH Office of Research Infrastructure Programs (P40 OD010440). Worms were maintained on E. coli strain HT115 (DE3) harboring the empty vector L4440 (Control RNAi). RNA Interference (RNAi) HT115 bearing double stranded RNA against a gene of interest was grown for 16-18hrs overnight. Bacteria was then seeded onto NGM plates that contained 5mM isopropyl-β-D- thiogalactoside (IPTG) and 50ug/ml carbenicillin. Plates were used within 24-72hrs to allow generation of dsRNA and were stored at 20 o C during this time. Fixed Nile Red staining Worms, treated for the listed time with RNAi, were washed with PBST and rocked for 3 minutes in 40% isopropyl alcohol. The worms were then pelleted and treated with Nile red in 40% isopropyl alcohol for 2 hrs 141,148 . Worms were pelleted again and PBST was added for an additional 30 minutes. The worms were pelleted one final time and then imaged at 10x zoom with DIC and GFP filter (Zeiss Axio Imager). RNA-seq sample preparation, quality control, and Novogene work Worms treated for 48 or 120hrs on RNAi against egl-45 or rps-11, or 24hrs on Control RNAi, were collected in TRI-Reagent® (Zymo Research, R2050-1-200) and frozen at -80 o C. The Direct-zol™ RNA MiniPrep kit (R2052) was used to extract RNA from samples. The Qubit™ RNA BR Assay Kit was used to determine RNA concentration. Samples were sent to Novogene Corporation for paired-end 150bp sequencing of RNA using the NovaSeq 6000 platform. Novogene performed analysis on the data using the DESeq R package 151 , and adjusted the attained p-values using the Benjamini and Hochberg method to control the false discovery rate (comparing 48/120hr RNAi to Control RNAi). We then took these lists and set a cut off of 67 p<0.01 significance level and required every RNAi treatment to hit that significance level for any particular gene, creating our list of differentially expressed genes (DEGs). Our DEGs were then analyzed for GO terms using the Enrichment Analysis tool at Wormbase 152 and for transcription factor over-representation analysis using RegulatorTrail 1.1 149 (using +/-1kb RTI Database V2 ENCODE data 150 ). Data will be deposited in the NCBI Gene Expression Omnibus (GEO) repository 153 . Worm sizing To measure worm size, animals were imaged at 10x zoom at the listed day. Each worm was outlined using the segmented line tool in FIJI to determine the area of the animal, and comparisons were made using the average of these areas. 68 Results Total fat levels increase in arrested animals with reduced protein synthesis We previously found that arrested animals with reduced protein synthesis had reduced pharyngeal pumping and lower AMP/ATP levels, suggesting lower energy intake and increased energy expenditure respectively 46 . To reduce protein synthesis, we used RNAi against the translation initiation factor egl-45/EIF3A or the small ribosomal protein rps- 11/RPS11 46 . To elucidate the metabolic state of these animals, we examined the total lipid content of arrested animals via fixed Nile red staining. Reducing protein synthesis increased total lipid levels in arrested animals compared to wild type non-arrested larval stage 2 (L2) controls after 48hrs, and lipid levels continued to increase out to 120hrs in the arrested state (Fig. 1A). Gene expression changes in reduced protein synthesis arrested animals In order to better understand the gene expression underpinning these metabolic changes, we performed RNA-seq on developmentally arrested animals treated for either 48hrs or 120hrs on egl-45 or rps-11 RNAi (Table 1, Methods). Because we previously found that the majority of phenotypes (stress resistance, pumping rate, gene expression, AMPK dependence) were shared between animals treated with egl-45 or rps-11 RNAi 46 , we decided to focus on gene expression changes that were significant across all RNAi treatments and time points to increase the stringency of our results. Compared to wild type non-arrested L2 animals, shared across all four conditions, we found upregulation of 1073 genes and downregulation of 1487 genes (≥2-fold change, p-value ≤0.01, ≤0.05 FDR; Table 1, Methods). Gene ontology (GO) analysis of the downregulated genes revealed 24 categories were enriched at 1.5-fold change, with the top hits being Mitochondrion (GO:0005739) and Organelle inner membrane (GO:0019866) (Table 2, Supp. Table 1). In upregulated genes, 16 categories were enriched at 1.5-fold change, with the top hits being Response to biotic stimulus (GO:0009607) and Immune system process (GO:0002376) (Table 2, Supp. Table 1). 69 We next looked at over-representation analysis (ORA) of transcription factor binding sites (taken from ENCODE 150 ) directly (1kb) up- or downstream of all differentially expressed genes (Table 3, Supp Table 2) 149 . The top hits in both down- and upregulated genes were Smad proteins, involved in the transforming growth factor beta (TGF-beta) superfamily, and nuclear hormone receptors (NHRs), which are ligand-activated and involved in a diverse set of biological processes. To indicate efficacy of RNAi in the RNA-seq, both egl-45 and rps-11 were downregulated 2.5-fold and 3.9-fold, respectively (Supp Table 3). In addition, two previous targets consistent with the reduced protein synthesis arrest response, mtl-1 and mtl-2, were upregulated (81-fold) and downregulated (3-fold), respectively, as previously found 46 (Supp Table 3). Reduced protein synthesis arrest causes alterations in lipid homeostasis gene expression and some forms can be rescued by increased TGF-beta signaling Lipid synthesis and storage have highly altered expression in arrested animals. The top two downregulated genes from the RNA-seq analysis are involved in lipid breakdown; lips-6 and acdh-1 mRNA are reduced 793-fold and 651-fold, respectively (Table 1). LIPS-6 is a lipase that is upregulated by starvation-induced octopamine production and thought to promote energy balance via lipid hydrolysis 154 ; ACDH-1 is a short-chain acyl-CoA dehydrogenase involved in mitochondrial beta-oxidation that is downregulated in response to fasting 155 or cholesterol starvation 156 as well as being a dietary sensor for different bacterial diets in the worm 157 . In addition, relating to lipid mobilization, vit-2 had the fourth-most increase in gene expression at an 816-fold increase. VIT-2 is a vitellogenin protein, typically synthesized in reproductively-active adult worms to shuttle fats from the intestine to developing oocytes 158– 160 . Given that germline development arrests in animals with reduced protein synthesis 46 , it is unclear what function VIT-2 may have in the arrested animal. Taken together, in conjunction 70 with the lipid storage increase in arrested animals (Fig. 1), it suggests that reduced protein synthesis arrest initiates a genetic program to prevent further breakdown of lipids. The TGF-beta Smad proteins SMA-3 and SMA-9 were consistently ranked highly in the ORA analysis of transcription factors (Table 3, Supp Table 2), with SMA-9 being the fourth most over-represented in both down- and upregulated genes. DBL-1 TGF-beta signaling is typically associated with both increases and decreases in gene expression 161–163 , and we see genes associated with increased DBL-1 TGF-beta signaling are changed in our data; for example, expression of the negative growth regulator lon-1 162,163 is reduced 1.6-fold, and expression of the antimicrobial peptide gene cnc-2 161 and the DBL-1 co-receptor sma-6 are increased 28-fold and 1.6-fold, respectively 164 (Table 1). As mentioned, DBL-1 TGF-beta signaling has been linked to lipid signaling, and the hypodermis appears to be a key tissue in mediating these lipid phenotypes 147 - similar to the importance of the hypodermis in reduced protein synthesis arrest 46 . Given this, as well as the connections with the DAF-7 TGF-beta pathway and dauer arrest, we wondered if DBL-1 TGF-beta signaling is important in the reduced protein synthesis arrest phenotype. With this in mind, we treated worms overexpressing dbl-1 (dbl-1(o/e)) with egl-45 and rps-11 RNAi. Remarkably, animals treated with rps-11 RNAi, but not egl-45 RNAi, were capable of escaping L2 arrest after 7 days of RNAi (Fig. 2). Of note, dbl-1(o/e) animals were not RNAi deficient, as they succumbed to a series of lethal RNAi tests and were able to rapidly diminish fluorescence from their GFP co-expression marker via GFP RNAi (Supp. Fig. 1). To further verify the DBL-1 TGF-beta pathway in controlling the reduced protein synthesis arrest, we crossed dbl-1(o/e) with worms harboring a mutation in the DBL-1 downstream co-receptor sma-6 (producing dbl-1(o/e); sma-6 (wk7)). dbl-1(o/e); sma-6 (wk7) transgenic worms arrested as L2s regardless of time spent on RNAi, indicating that the sma- 6(wk7) mutation rescued the arrest recovery phenotype of dbl-1(o/e) animals (Fig. 2). Taken 71 together, these data indicate that increased TGF-beta signaling at least partially controls the recovery from reduced protein synthesis arrest (Fig. 3). 72 Discussion The developmental arrest from reduced protein synthesis induces a high amount of gene expression changes (Methods). During this arrest, worms become fatter and also upregulate TGF-beta signaling. As the DBL-1 TGF-beta pathway is primarily growth-promoting 164,165 , we did not anticipate that its upregulation would actually cause worms to enter the observed developmental arrest. We previously found that the arrest state from reducing protein synthesis is reversible 46 . Since enhanced DBL-1 signaling facilitates animals to escape arrest, we hypothesize that perhaps DBL-1 signaling might be increased under reduced protein synthesis as a "failsafe" prior to undergoing developmental arrest. It is yet unclear if DBL-1 TGF-beta signaling can also affect other reduced protein synthesis phenotypes such as stress resistance, feeding rate, or fat levels. Future work in determining if the developmental arrest and these stress adaptations can be uncoupled will be important to determine. The DBL-1 TGF-beta pathway has several similarities to phenotypes we observed when reducing protein synthesis, including with the aforementioned lipid metabolism 46 . For example, DBL-1 signaling in the hypodermis is important for learning aversive olfactory responses as well as for antimicrobial peptide expression 161,166 ; in addition, DBL-1 signaling is also involved in pharyngeal neuron morphology 167 . Given that reducing protein synthesis in the hypodermis is sufficient to drive organism-level survival-related phenotypes, including a cell non- autonomous decrease in pharyngeal pumping, it is possible that there is a connection between TGF-beta and monitoring of protein synthesis. There is an increasingly complex relationship between lipids, aging, and longevity 168,169 ; for example, many long-lived C. elegans models have increased lipid stores and particular lipid classes may be important in signaling for survival responses 142,169 . In addition, while an obese BMI still carries socioeconomic and comorbidity consequences 170,171 , studies in humans show that having an overweight BMI may increase survival in old age 172,173 . While DBL-1 TGF-beta signaling has been implicated in lipid metabolism in the worm 147 , there are also parallels with 73 its orthologous pathway in humans, the bone morphogenetic protein (BMP) TGF-beta pathway. Genetic variants in BMP signaling are associated with obesity 174 and higher body fat or BMI was associated with release of TGF-beta1 by adipose tissue 175 . Originally, it was observed that reducing protein synthesis in adult animals decreased lipid content 47 ; however, this methodology used Nile red staining in the plate (rather than fixed staining), which has since been found to stain lysosome-related organelles rather than major fats 141 . As we have found increased lipids in our arrested animals, it will be of interest to see if long-lived reduced protein synthesis adults have increased lipids as well. The strong downregulation of both acdh-1 and lips-6 (Table 1) is strongly associated with starvation 155,176 . Previously, we found that reducing protein synthesis caused a reduction in pharyngeal pumping; while worms continue to eat food even 10 days into reduced protein synthesis arrest 46 , it indicates that they have reduced food intake. In addition to potential health benefits 15,177,178 , this caloric restriction will likely also serve to decrease protein synthesis further through downregulation of mTOR signaling 179 . Interestingly, studies in C. elegans show that, similar to avoidance phenotypes induced by harmful fungi or bacteria 180 , RNAi against genes encoding essential processes (such as protein synthesis) can induce food avoidance and reduce pharyngeal pumping rate 77 . It is possible that reducing protein synthesis causes a starvation response, potentially for stress resistance purposes and/or as an evolved response to discontinue eating perceived harmful food sources. Given that reducing protein synthesis in adult worms also reduces pharyngeal pumping rate 46 , it suggests that adult animals may utilize the same pathway as arrested animals. It will be of interest to see if reducing protein synthesis in adult worms induces a similar starvation response. There are some limitations to the RNA-seq analysis presented here. The current database utilized by the transcription factor analysis tool RegulatorTrail 149 only has binding information for 115 of the estimated ~900 transcription factors in the C. elegans genome (Table 3, see Methods). In addition, the GO analysis (Table 2) could only analyze genes with 74 actual annotated functionality, meaning that sometimes up to half of the genes examined could not be characterized here. Thus, it is possible that additional, uncharacterized pathways play important roles in the response to reduced protein synthesis. As additional data on transcription factor binding sites and/or genes come to light, re-analysis of this RNA-seq data may prove insightful. Previously, reducing protein synthesis via either egl-45 or rps-11 RNAi caused similar stress resistance, gene expression changes, and pharyngeal pumping reduction 46 , and they caused similar changes in fat levels here (Fig. 1). However, there were differences in survival, with worms fed rps-11 RNAi dying earlier 46 . Here we find that increased DBL-1 TGF-beta signaling could rescue rps-11 RNAi-fed animals from arrest, but not egl-45 RNAi-fed animals. Despite egl-45 and rps-11 sharing the majority of survival adaptations, it suggests that the arrest pathway may act independently depending on what part of ribosome biosynthesis is being inhibited. rps-11/RPS-11 encodes for a small ribosomal protein that is part of the structure of the ribosome, while egl-45/EIF3A encodes for an initiation factor that aids in the assembly of said structure 181,182 . It is possible that there are differences in biological responses, such as a pathway dedicated to monitoring excess ribosomal proteins, when either is reduced in expression. This may also explain how there are differences in increasing lifespan in the adult worm can vary by 10-50% based on what part of translation is affected 12,15,47 . Elucidation of any specific signaling pathways associated with the distinct aspects of the protein synthesis machinery/complexes will be important in understanding the variability of these phenotypes. Why is it important to look at developmental phenotypes associated with longevity? If long-lived adults utilize similar pro-survival responses as developmentally arrested animals, as seems to be the case here with protein synthesis as well as with the daf-2/IGF-1R insulin signaling pathway 8,37–39 , it may provide a better avenue for testing survival phenotypes. As not all longevity-promoting mutants are associated with good health 32,33 , looking for stress 75 resistance phenotypes in arrested animals of the same pathways may act as a screen before investing time into aging animals for a stress assay. In addition, examining developmental phenotypes can better titrate the perfect age to begin altering a pathway for maximizing longevity; while reducing protein synthesis arrests animals when fed directly after hatching, perhaps treatment halfway during development might not arrest them, providing a longer-term exposure to reduced protein synthesis and potentially increasing overall health or longevity benefits. In a broader sense, it also gives us insight into how these pathways came about in the first place. DBL-1 TGF-beta signaling is associated with antimicrobial peptide production 161 , and we previously found that xenobiotics could induce similar phenotypes as RNAi against protein synthesis 46 . If long-lived adults with reduced protein synthesis are utilizing the same survival pathway as young animals, it suggests that the evolutionary origin for such a pathway may be to aid against negative environmental or pathogen exposure. We believe insights into the origin of such pathways will be useful going forward in an age where manipulation of the genome may become more common, and understanding these genetic interactions may help in determining what genes to alter - and when. 76 Figures Figure 1 - Lipid levels increase with time spent in reduced protein synthesis arrest. A. Fixed Nile red staining increases rapidly after just 48hrs of arrest. One-way ANOVA with Bonferroni multiple comparison correction, p-values: **=0.01, ****=0.0001. 77 Downregulated log 2 fold change Gene name 48hr egl- 45/ EIF3A 120hr egl-45/ EIF3A 48hr rps-11/ RPS11 120hr rps-11/ RPS11 Average lips-6 -10.22 -11.317 -7.6829 -9.3096 -9.632375 acdh-1 -8.7157 -9.0992 -9.4282 -10.15 -9.348275 K01D12.9 -11.193 -12.378 -5.7614 -6.3402 -8.91815 F40E10.5 -9.6449 -11.594 -6.8037 -5.8467 -8.472325 K02E11.10 -9.2858 -13.024 -4.4685 -5.2494 -8.006925 R02F11.1 -8.6415 -13.028 -4.9179 -4.9344 -7.88045 F18C5.5 -10.967 -10.978 -4.7674 -4.3644 -7.7692 D1054.9 -8.7565 -11.02 -5.2685 -5.2783 -7.580825 cyn-17 -8.6267 -10.055 -6.062 -5.4474 -7.547775 ZC84.1 -8.6723 -10.83 -5.3083 -5.2628 -7.51835 F49E10.2 -9.04 -11.162 -5.3086 -4.5528 -7.51585 Y48G8AL.12 -9.7817 -11.23 -5.0817 -3.4906 -7.396 ZK1025.3 -9.2733 -10.257 -5.2266 -4.7469 -7.37595 F45B8.3 -8.1919 -9.2996 -5.3308 -6.329 -7.287825 wrt-4 -9.4928 -10.077 -5.0674 -4.3292 -7.2416 Upregulated log 2 fold change Gene name 48hr egl- 45/ EIF3A 120hr egl-45/ EIF3A 48hr rps-11/ RPS11 120hr rps-11/ RPS11 Average B0563.9* 11.136 11.918 11.747 12.232 11.75825 B0563.10* 9.4823 11.339 11.254 11.431 10.876575 col-96 10.164 10.429 8.906 9.6781 9.794275 vit-2 8.0846 9.9973 7.3963 13.212 9.67255 ilys-3 8.7767 10.637 7.8378 9.5416 9.198275 K03D3.2 9.0229 8.375 8.5016 8.6158 8.628825 Y68A4A.13 9.1429 8.2587 8.4367 7.7382 8.394125 fipr-23 7.6186 7.5551 9.735 8.4406 8.337325 Y75B8A.39 6.6139 8.1455 7.701 9.1224 7.8957 F49H6.5 7.3641 6.6748 8.4679 8.6324 7.7848 Y110A2AL.3 8.4296 8.0205 7.481 6.8188 7.687475 ssp-35 8.3485 8.7043 6.3634 7.2892 7.67635 srg-31 7.6882 8.3391 6.8868 7.6686 7.645675 col-140 7.4615 7.1892 5.4081 10.229 7.57195 ZK354.2 4.3811 8.4412 6.9259 10.429 7.5443 Table 1. Top 15 up- and downregulated genes under reduced protein synthesis. *While related closely by name, B0563.9 and B0563.10 are ~1kb apart and not on an operon. 78 From downregulated gene list, 1487 (1012 valid, 474 no data) Term Accession number Enrichment Fold Change P value Q value mitochondrion GO:0005739 4.1 6.80E-63 8.00E-61 organelle inner membrane GO:0019866 4.5 2.20E-28 1.30E-26 envelope GO:0031975 3.1 5.40E-22 2.10E-20 cytoplasm GO:0005737 1.5 5.20E-20 1.50E-18 contractile fiber GO:0043292 3.8 2.00E-16 4.70E-15 organic acid metabolic process GO:0006082 2.7 3.10E-16 6.10E-15 nucleoside phosphate metabolic process GO:0006753 2.8 1.50E-13 2.50E-12 ribose phosphate metabolic process GO:0019693 3 2.40E-13 3.50E-12 purine nucleotide metabolic process GO:0006163 3 2.50E-12 3.30E-11 structural constituent of ribosome GO:0003735 3 2.00E-09 2.30E-08 From upregulated gene list, 1073 (446 valid, 627 no data) Term Accession number Enrichment Fold Change P value Q value response to biotic stimulus GO:0009607 5 4.20E-18 5.00E-16 immune system process GO:0002376 3.8 2.90E-17 1.70E-15 extracellular region GO:0005576 2.9 3.10E-15 1.20E-13 extracellular space GO:0005615 3.5 4.50E-11 1.30E-09 tetrapyrrole binding GO:0046906 3.3 5.30E-07 1.30E-05 transmembrane transport GO:0055085 1.6 0.0001 0.002 peptidyl-tyrosine modification GO:0018212 2.7 0.00053 0.0089 dephosphorylation GO:0016311 2 0.00081 0.012 peptidase activity GO:0008233 1.7 0.00085 0.012 protein catabolic process GO:0030163 1.8 0.0016 0.017 Table 2. Gene Ontology analysis of the top 10 DEGs. GO terms were attained using the Enrichment Analysis tool at Wormbase 152 . Note that to be "valid", genes had to have annotation assigned to them. 79 Table 3 - Transcription factor over-representation analysis of the top 10 DEGs. Over-represented transcription factor binding sites were attained using RegulatorTrail 1.1 149 , using Fisher's Exact test to compute enrichments and Benjamini-Yekutieli method for adjusting the False Discovery Rate. Downregulated NHR-48 1089 875.82 1.60e-26 NHR-102 967 759.21 1.19e-23 NHR-43 1137 968.13 2.95e-18 SMA-9 1090 916.54 2.95e-18 SPR-1 1104 937.49 3.24e-17 ETS-4 941 782.10 4.96e-14 RBR-2 1058 908.11 1.54e-13 CEH-2 938 791.19 4.41e-12 TBX-2 1294 1183.40 7.79e-12 SYD-9 898 753.32 1.10e-11 NHR-48 1089 875.82 1.60e-26 Upregulated Regulator #Targets Expected #targets Adjusted p-value SMA-3 1068 876.30 1.87e-23 NHR-20 1105 926.27 8.22e-22 NHR-80 926 759.91 4.46e-16 SMA-9 1014 871.27 8.32e-13 NHR-90 1231 1127.71 1.07e-10 SNU-23 834 707.82 4.10e-9 LIN-40 689 586.75 5.58e-6 NHR-71 807 710.65 2.82e-5 DAO-5 994 904.09 3.49e-5 MADF-10 947 855.89 3.91e-5 80 Figure. 2 - Overexpression of dbl-1 promotes escape from reduced protein synthesis arrest. After 7 days of rps-11 RNAi exposure, animals overexpressing dbl-1 break out of the developmental arrest. Mutation of the downstream target receptor sma-6 rescues the arrest back to wild type levels. Two-way ANOVA, corrected with Sidak's multiple comparison test, p values: **=0.01, ****=0.0001. Figure. 3 - Proposed model of TGF-beta signaling under protein synthesis loss. Reduced protein synthesis drives expression of TGF-beta signaling, that when upregulated further can inhibit the arrest state. It remains to be seen what effects TGF-beta signaling has on other reduced protein synthesis survival phenotypes. Red lines indicate findings from this work. Wild type dbl-1 (o/e) dbl-1 (o/e); sma-6 (wk-7) Wild type dbl-1 (o/e) dbl-1 (o/e); sma-6 (wk-7) Wild type dbl-1 (o/e) dbl-1 (o/e); sma-6 (wk-7) 0.00 0.02 0.04 0.06 0.08 Worm Area (mm^2) 48hrs **** Wild type dbl-1 (o/e) dbl-1 (o/e); sma-6 (wk-7) Wild type dbl-1 (o/e) dbl-1 (o/e); sma-6 (wk-7) 0.00 0.02 0.04 0.06 0.08 Worm Area (mm^2) 168hrs egl-45 RNAI rps-11 RNAi ** **** 81 Supplemental Figures Downregulated GO terms Term Expected Observed Enrichment Fold Change P value Q value mitochondrion GO:0005739 43 177 4.1 6.80E-63 8.00E-61 organelle inner membrane GO:0019866 15 68 4.5 2.20E-28 1.30E-26 envelope GO:0031975 27 84 3.1 5.40E-22 2.10E-20 cytoplasm GO:0005737 280 429 1.5 5.20E-20 1.50E-18 contractile fiber GO:0043292 12 46 3.8 2.00E-16 4.70E-15 organic acid metabolic process GO:0006082 30 79 2.7 3.10E-16 6.10E-15 nucleoside phosphate metabolic process GO:0006753 21 58 2.8 1.50E-13 2.50E-12 ribose phosphate metabolic process GO:0019693 16 50 3 2.40E-13 3.50E-12 purine nucleotide metabolic process GO:0006163 15 46 3 2.50E-12 3.30E-11 structural constituent of ribosome GO:0003735 11 34 3 2.00E-09 2.30E-08 molting cycle GO:0042303 8.5 28 3.3 3.00E-09 3.20E-08 peptidase activity GO:0008233 37 74 2 7.60E-09 7.40E-08 supramolecular complex GO:0099080 23 51 2.2 2.20E-08 2.00E-07 transmembrane transport GO:0055085 76 123 1.6 5.60E-08 4.70E-07 collagen trimer GO:0005581 14 34 2.5 2.80E-07 2.20E-06 structural GO:0042302 14 33 2.4 6.40E-07 4.70E-06 82 constituent of cuticle metalloendopeptida se activity GO:0004222 8.1 21 2.6 1.40E-05 9.70E-05 calcium ion binding GO:0005509 13 29 2.2 2.90E-05 0.00019 extracellular region GO:0005576 43 68 1.6 7.20E-05 0.00044 serine hydrolase activity GO:0017171 9 21 2.3 7.50E-05 0.00044 amide transport GO:0042886 28 48 1.7 0.00012 0.00069 primary active transmembrane transporter activity GO:0015399 8.3 17 2 0.0015 0.0079 peptide biosynthetic process GO:0043043 28 43 1.5 0.0022 0.011 actin filament- based process GO:0030029 12 21 1.8 0.0026 0.012 Upregulated GO terms Term Expected Observed Enrichment Fold Change P value Q value response to biotic stimulus GO:0009607 8 40 5 4.20E- 18 5.00E-16 immune system process GO:0002376 14 53 3.8 2.90E- 17 1.70E-15 extracellular region GO:0005576 23 66 2.9 3.10E- 15 1.20E-13 extracellular space GO:0005615 9.6 34 3.5 4.50E- 11 1.30E-09 83 tetrapyrrole binding GO:0046906 6.4 21 3.3 5.30E- 07 1.30E-05 transmembrane transport GO:0055085 40 64 1.6 0.0001 0.002 peptidyl-tyrosine modification GO:0018212 4.5 12 2.7 0.00053 0.0089 dephosphorylation GO:0016311 10 21 2 0.00081 0.012 peptidase activity GO:0008233 20 34 1.7 0.00085 0.012 protein catabolic process GO:0030163 13 24 1.8 0.0016 0.017 regulation of protein metabolic process GO:0051246 18 30 1.6 0.0035 0.031 metalloendopeptida se activity GO:0004222 4.3 10 2.3 0.0036 0.031 primary active transmembrane transporter activity GO:0015399 4.4 10 2.3 0.0045 0.035 zinc ion binding GO:0008270 23 35 1.5 0.0049 0.036 serine hydrolase activity GO:0017171 4.7 10 2.1 0.0078 0.054 regulation of cell shape GO:0008360 4.2 9 2.1 0.0096 0.063 Supplemental Table 1 - Full GO-term analysis of DEGs. GO terms reaching 1.5 enrichment were included here. 84 Transcription factor analysis of upregulated genes Rank Regulator #Targets Expected #targets Adjusted p-value 1 SMA-3 1068 876.30 1.87e-23 2 NHR-20 1105 926.27 8.22e-22 3 NHR-80 926 759.91 4.46e-16 4 SMA-9 1014 871.27 8.32e-13 5 NHR-90 1231 1127.71 1.07e-10 6 SNU-23 834 707.82 4.10e-9 7 LIN-40 689 586.75 5.58e-6 8 NHR-71 807 710.65 2.82e-5 9 DAO-5 994 904.09 3.49e-5 10 MADF-10 947 855.89 3.91e-5 11 NHR-43 1005 920.32 9.85e-5 12 NHR-48 912 832.57 7.60e-4 13 NHR-85 1027 952.43 7.79e-4 14 NHR-102 802 721.71 8.19e-4 15 LET-607 965 889.20 9.49e-4 16 XBP-1 1005 934.85 0.002 17 SWSN-7 968 898.56 0.003 18 IRX-1 997 931.80 0.006 19 ELT-2 1137 1081.22 0.009 20 B0261.1 927 862.19 0.009 21 ZK185.1 977 914.29 0.010 22 TBX-2 1174 1124.95 0.019 23 CHD-7 948 889.48 0.023 24 LSY-12 938 882.40 0.039 25 CEH-90 996 944.63 0.059 26 F22D6.2 977 926.13 0.068 27 NHR-179 749 697.61 0.099 28 DUXL-1 1037 992.05 0.117 29 C04F5.9 1012 966.32 0.117 30 MES-2 793 743.61 0.117 31 NHR-47 786 739.57 0.171 32 MEL-28 849 803.15 0.171 33 B0035.1 977 936.19 0.247 34 DAF-16 1143 1110.49 0.364 35 RBR-2 899 863.26 0.536 36 zfp-2 822 788.90 0.767 37 T07F8.4 846 814.92 0.910 38 REC-8 1137 1113.40 1 39 ZTF-18 942 919.75 1 40 DIE-1 965 943.99 1 41 HIF-1 697 678.33 1 42 F52B5.7 838 819.81 1 43 SPR-1 908 891.18 1 44 TBX-9 736 720.15 1 45 UNC-130 1073 1060.09 1 85 46 FKH-4 1033 1020.61 1 47 Y116A8C.19 991 979.50 1 48 F55B11.4 857 844.90 1 49 MXL-1 926 914.36 1 50 FKH-3 1026 1015.94 1 51 LIR-3 1252 1248.07 1 52 SDZ-38 753 747.37 1 53 HLH-12 937 936.69 1 54 PQM-1 986 986.17 1 55 T26A5.8 783 784.86 1 56 HRDE-1 908 911.67 1 57 NPAX-4 836 839.94 1 58 HMG-11 628 636.72 1 59 REF-2 942 950.58 1 60 UNC-86 1137 1145.15 1 61 COG-1 855 868.43 1 62 RNT-1 1114 1127.36 1 63 ELT-4 1015 1030.11 1 64 HLH-4 1087 1101.63 1 65 Sox-4 990 1006.65 1 66 CEH-9 955 973.12 1 67 UNC-3 849 868.50 1 68 HIM-1 1047 1064.42 1 69 CEH-32 667 689.03 1 70 CEH-18 832 857.16 1 71 HLH-6 934 959.87 1 72 CEH-24 921 949.17 1 73 F10B5.3 886 915.21 1 74 CEH-14 805 836.39 1 75 TTX-3 964 993.18 1 76 Y22D7AL.16 883 913.58 1 77 LIM-6 914 944.27 1 78 NHR-232 822 853.55 1 79 XND-1 842 873.61 1 80 POP-1 967 999.14 1 81 F49E8.2 891 924.64 1 82 ZTF-11 1050 1080.22 1 83 MES-4 705 740.85 1 84 CEH-2 715 752.12 1 85 ETS-4 706 743.47 1 86 ETS-7 700 737.59 1 87 C08G9.2 915 950.72 1 88 HND-1 899 935.77 1 89 Ahr-1 897 937.61 1 90 DMD-4 936 975.75 1 91 SDC-2 867 909.12 1 92 FAX-1 741 785.78 1 93 HLH-15 967 1010.34 1 86 94 CHE-1 901 946.54 1 95 DSC-1 730 778.27 1 96 HLH-8 918 964.55 1 97 TBX-7 625 675.71 1 98 fkh-6 863 912.80 1 99 CEH-34 837 888.21 1 100 MEC-3 932 981.20 1 101 EGL-13 1009 1056.12 1 102 PAG-3 873 924.50 1 103 FKH-8 708 761.97 1 104 B0310.2 918 969.08 1 105 CEH-31 740 795.35 1 106 EYG-1 953 1004.67 1 107 GMEB-2 959 1014.38 1 108 HMBX-1 843 902.10 1 109 SYD-9 651 716.11 1 110 CEH-36 855 920.60 1 111 ALY-1 892 956.47 1 112 Mls-2 762 833.77 1 113 CEH-48 921 988.36 1 114 ZIP-5 320 397.50 1 115 UNC-42 672 767.64 1 Transcription factor analysis of downregulated genes Rank Regulator #Targets Expected #targets Adjusted p-value 1 NHR-48 1089 875.82 1.60e-26 2 NHR-102 967 759.21 1.19e-23 3 NHR-43 1137 968.13 2.95e-18 4 SMA-9 1090 916.54 2.95e-18 5 SPR-1 1104 937.49 3.24e-17 6 ETS-4 941 782.10 4.96e-14 7 RBR-2 1058 908.11 1.54e-13 8 CEH-2 938 791.19 4.41e-12 9 TBX-2 1294 1183.40 7.79e-12 10 SYD-9 898 753.32 1.10e-11 11 CEH-18 1039 901.70 2.08e-11 12 fkh-6 1091 960.23 5.67e-11 13 REF-2 1127 999.97 6.80e-11 14 CEH-31 973 836.68 7.57e-11 15 MES-2 920 782.25 7.65e-11 16 SMA-3 1052 921.83 1.38e-10 17 NHR-20 1101 974.40 1.38e-10 18 HLH-8 1136 1014.66 2.94e-10 19 Mls-2 1005 877.09 6.45e-10 20 ELT-2 1243 1137.39 9.26e-10 21 CEH-34 1058 934.36 9.26e-10 22 NHR-80 925 799.40 3.09e-9 23 FAX-1 950 826.61 4.77e-9 87 24 CEH-32 850 724.83 4.77e-9 25 RNT-1 1281 1185.93 4.77e-9 26 HMG-11 792 669.80 1.15e-8 27 LSY-12 1040 928.24 4.84e-8 28 DAF-16 1258 1168.19 1.04e-7 29 EYG-1 1157 1056.86 1.30e-7 30 SNU-23 857 744.59 1.86e-7 31 COG-1 1021 913.55 2.06e-7 32 PQM-1 1137 1037.40 2.37e-7 33 B0310.2 1120 1019.43 2.55e-7 34 CHE-1 1097 995.72 3.27e-7 35 POP-1 1148 1051.05 3.71e-7 36 F22D6.2 1074 974.25 7.37e-7 37 F10B5.3 1063 962.77 7.49e-7 38 LIN-40 722 617.24 1.10e-6 39 HND-1 1082 984.39 1.10e-6 40 UNC-3 1011 913.63 3.08e-6 41 Y22D7AL.16 1056 961.05 3.28e-6 42 CEH-14 978 879.85 3.32e-6 43 ZK185.1 1056 961.80 3.83e-6 44 MEC-3 1119 1032.18 9.99e-6 45 DSC-1 914 818.71 9.99e-6 46 HMBX-1 1040 948.97 9.99e-6 47 LET-607 1027 935.40 9.99e-6 48 LIM-6 1081 993.34 1.36e-5 49 ALY-1 1093 1006.16 1.38e-5 50 ETS-7 870 775.91 1.46e-5 51 DIE-1 1078 993.04 2.67e-5 52 C08G9.2 1084 1000.12 3.10e-5 53 GMEB-2 1147 1067.08 3.10e-5 54 HLH-6 1093 1009.74 3.10e-5 55 XBP-1 1068 983.42 3.10e-5 56 CHD-7 1022 935.70 3.33e-5 57 DMD-4 1108 1026.44 3.67e-5 58 CEH-48 1120 1039.72 4.14e-5 59 HIF-1 803 713.57 4.20e-5 60 DUXL-1 1123 1043.59 4.76e-5 61 SDZ-38 871 786.20 1.06e-4 62 MADF-10 982 900.36 1.25e-4 63 CEH-36 1047 968.43 1.44e-4 64 NHR-71 831 747.57 1.48e-4 65 REC-8 1237 1171.25 1.53e-4 66 ZTF-18 1045 967.54 1.80e-4 67 SDC-2 1034 956.35 1.88e-4 68 UNC-42 889 807.52 1.88e-4 69 CEH-24 1074 998.48 1.99e-4 70 F52B5.7 942 862.40 2.20e-4 71 NHR-232 976 897.90 2.48e-4 88 Supplemental Table 2 - Full transcription factor over-representation analysis. From the transcription factor analysis tool RegulatorTrail 149 . 72 MES-4 859 779.34 2.83e-4 73 C04F5.9 1089 1016.53 3.18e-4 74 CEH-9 1094 1023.68 4.79e-4 75 SWSN-7 1016 945.24 8.49e-4 76 NHR-47 852 778.00 8.63e-4 77 TBX-7 785 710.81 8.68e-4 78 B0035.1 1053 984.84 0.001 79 PAG-3 1041 972.53 0.001 80 zfp-2 899 829.89 0.002 81 ZIP-5 481 418.15 0.002 82 TBX-9 826 757.57 0.002 83 DAO-5 1015 951.06 0.003 84 MEL-28 911 844.88 0.003 85 ELT-4 1141 1083.63 0.004 86 NHR-90 1235 1186.31 0.007 87 LIR-3 1351 1312.92 0.007 88 T07F8.4 918 857.26 0.007 89 NHR-179 795 733.86 0.008 90 B0261.1 965 906.99 0.010 91 FKH-3 1118 1068.72 0.019 92 UNC-130 1161 1115.17 0.025 93 NPAX-4 936 883.58 0.025 94 UNC-86 1245 1204.65 0.028 95 EGL-13 1156 1111.00 0.029 96 Sox-4 1105 1058.95 0.033 97 FKH-4 1119 1073.64 0.034 98 ZTF-11 1179 1136.35 0.034 99 HRDE-1 1007 959.04 0.037 100 Y116A8C.19 1076 1030.39 0.040 101 T26A5.8 875 825.64 0.041 102 IRX-1 1024 980.21 0.062 103 HLH-15 1101 1062.83 0.101 104 MXL-1 1002 961.87 0.106 105 TTX-3 1083 1044.79 0.106 106 F55B11.4 927 888.80 0.153 107 Ahr-1 1022 986.33 0.172 108 NHR-85 1037 1001.91 0.176 109 F49E8.2 1007 972.68 0.204 110 HLH-12 1019 985.36 0.213 111 HIM-1 1144 1119.72 0.448 112 HLH-4 1177 1158.87 0.772 113 CEH-90 1014 993.71 0.787 114 XND-1 934 919.00 1 115 FKH-8 799 801.56 1 89 Re-verification log 2 fold change Gene name 48hr egl-45/ EIF3A 120hr egl-45/ EIF3A 48hr rps-11/ RPS11 120hr rps-11/ RPS11 Average mtl-1 6.1874 7.6207 5.8319 5.7687 6.352 mtl-2 -0.80428 -1.23 -2.5997 -1.9961 -1.65752 egl-45 -1.5511 -1.1674 - - -1.35925 rps-11 - - -2.1371 -1.8166 -1.97685 Supplemental Table 3 - Confirmation of previous targets and RNAi. Supplemental Figure 1. No RNAi deficiency in dbl-1(o/e) animals. The strain BW1940 has both an integrated dbl-1(o/e) transgene as well as a GFP co-marker. Using GFP RNAi, we can successfully reduce the GFP fluorescence down to near zero, indicating that animals do not appear to have RNAi deficiency. One-way ANOVA, using Bonferroni multiple comparison correction, p-values: ****=0.0001. 24hrs 0 2×10 4 4×10 4 6×10 4 8×10 4 Worm Florescence CTCF (Arbitrary Units) **** **** **** 48hrs 0 1×10 5 2×10 5 3×10 5 4×10 5 Worm Florescence CTCF (Arbitrary Units) N2 Control RNAi dbl-1 (o/e) L4440 RNAi dbl-1 (o/e) GFP RNAi **** ns **** 90 Chapter 4 Air pollution alters Caenorhabditis elegans development and lifespan: responses to traffic-related nanoparticulate matter (nPM) Amin Haghani 1# , Hans M Dalton 1# , Nikoo Safi 2 , Farimah Shirmohammadi 3 , Constantinos Sioutas 3 , Todd E Morgan 1 , Caleb E Finch 1 , Sean P Curran 1* 1. Leonard Davis School of Gerontology, University of Southern California, Los Angeles, CA. 2. Center for Cancer Prevention and Translational Genomics at the Samuel Oschin Comprehensive Cancer Institute, Cedars-Sinai Medical Center, Los Angeles, CA. 3. Viterbi School of Engineering, University of Southern California, Los Angeles, CA. # Co-first/equal authorship 91 Abstract Air pollution is a heterogeneous environmental toxicant that impacts humans throughout their life. We introduce Caenorhabditis elegans as a valuable air pollution model with its short life span, high-throughput capabilities, and highly conserved biological pathways that impact healthspan. We exposed developmental and adult life stages of C. elegans to airborne nano- sized particulate matter (nPM) produced by traffic emissions and measured biological and molecular endpoints that changed in response. C. elegans was resistant to acute nPM lethality, but short-term exposure during larval stage 1 caused delayed development. Gene expression responses to nPM exposure overlapped with responses of mouse and cell culture models of nPM exposure in previous studies. We showed further that the skn-1/Nrf2 antioxidant response mediated development and hormetic effects of nPM but was not critical for survival. This study introduces the worm as a new resource and complementary model for mouse and cultured cell systems to study air pollution toxicity across the lifespan. Keywords: Caenorhabditis elegans, air pollution, nPM, skn-1, development 92 Introduction Epidemiological studies show that air pollution is associated with multiple chronic health hazards of older age including Alzheimer’s disease, ischemic heart disease and stroke, lung cancer, and chronic obstructive pulmonary diseases - all of which decrease life expectancy 183– 191 . Understanding the underlying mechanisms between air pollution and these diseases requires modeling both air pollution and the resulting biological responses. Traffic related air pollution (TRAP) particles are a complex environmental toxicant consisting of a variety of inflammogens and toxicants derived from vast heterogeneous sources. The nanosized subfraction of TRAP (nPM) has consistent toxic effects in rodent and cell models 192 . Biochemical and cell assays of air pollution toxicity, while widely used, are not good predictors of in vivo responses for multicellular organisms (e.g. Dithiothreitol [DTT], ascorbic acid [AA]-glutathione [GSH], and MTT 193 . Exposure of mouse models to reaerosolized nPM results diverse systemic and organ-specific localized effects that involve different biological networks such as oxidative stress and antioxidant responses, innate immunity, and the nervous system 194–197 . These responses were dependent on the dosage of PM samples and the developmental stage of the exposure. Mouse models are a valuable tool to study air pollution toxicity, but they are limited as a biological model; low reproduction yield, long life span, expense, and ethical considerations in these animals can reduce the feasibility of this model and also the statistical power of any experiments. Caenorhabditis elegans is a valuable model for TRAP toxicology with a potential for much higher throughput than rodents 198 . Humans and worms share several basic physiological and stress response processes with homologues in most human genes (60- 80%), including multiple signal transduction pathways 199,200 . Easy maintenance, large scale production, small size, body transparency, full genomic characterization, complete cell lineage map, and mutant libraries make the worm an ideal model for gene network and environment interactions 201 . C. elegans allows high-throughput whole organism-level assays with multiple 93 end points (e.g. development, reproduction, feeding, life span, locomotion) 200 . Worms have been used to assess the toxicity of terrestrial environmental samples (e.g. soils, sludge, river sediments, 202,203 , pesticides (e.g. Glyphosate, Paraquat, Endosulfan and Dichlorvos for neurotoxicity, DNA damage, sterility and embryonic lethality) 204 , metal toxicity (e.g. Ag, Cd, Pb, Fe), lifespan, fertility, growth 205 , nanoparticles 206 , drugs 207 , toxins (e.g. nicotine) 208–210 , as well as other bioreactive molecules including NaAsO 2 , NaF, caffeine and DMSO 211 . While airborne bacteria have been tested in C. elegans 202 , its responses to TRAP have not been studied. Considering the usefulness of C. elegans in diverse toxicology models, this study introduces C. elegans as a multicellular model organism for air pollution toxicity. Here we examined different nPM dosages, as well as developmental and lifespan effects in C. elegans based on our prior in vitro and in vivo findings 191,194–197 . In examining the genetic response to nPM, including several cell survival pathways and Alzheimer Aβ-related genes, we investigated the cytoprotective transcription factor skn-1/Nrf2 in C. elegans and show its importance for a developmental delay phenotype as well as a hormetic increase in lifespan. 94 Method C. elegans strain maintenance C. elegans were maintained at 20°C unless otherwise noted. Strains used were N2 Bristol (wild type), LG335 (skn-1(zu135); nT1 (qIs51[myo-2::GFP; pes-10::GFP; F22B7.9::GFP])), and CL2166 (dvIs19 [(pAF15)gst-4p::GFP::NLS] III). Some strains were provided by the CGC, funded by NIH Office of Research Infrastructure Programs (P40 OD010440). E. coli strain OP50 was used for all non-RNAi experiments and for general C. elegans maintenance. For synchronization prior to plating, eggs were harvested from gravid adults by hypochlorite treatment. Airborne nano-sized particle collection Ambient nano-sized particles (diameter<0.18 µm) were collected on 8x10 inch commercially available Zeflour PTFE filters (Pall Life Sciences, Ann Arbor, MI) using a High-Volume Ultrafine Particle (HVUP) Sampler 212 operating at a sampling flow rate of 400 liters/min flow rate at the Particle Instrumentation Unit (PIU) of University of Southern California located within 150m downwind of a major freeway (I-110). Gravimetric mass (nPM mass concentration) was determined from pre- and post-weighing the filters under controlled temperature (22–24 ºC) and relative humidity (40–50%) conditions. The filter-deposited nPM was eluted by sonication into ultrapure deionized (milli-Q) water 195 providing the concentrated slurry suspension used for these exposures. A portion of the aqueous suspension was chemically characterized. After acid digestion, samples were analyzed by high resolution inductively coupled plasma sector field mass spectrometry (SF-ICPMS). Another portion was analyzed using a Sievers 900 Total Organic Carbon Analyzer to determine total organic carbon (TOC) content. RNA interference The E. coli strain HT115 (DE3), harboring either the empty L4440 plasmid ("Control RNAi") or the skn-1 RNAi plasmid (dsRNA production of skn-1 sequence - Ahringer Library), was grown 16-18hrs at 37 o C overnight. Cultures were seeded onto RNAi plates (normal NGM plates with 5mM isopropyl-β- D-thiogalactoside (IPTG) and 50 µg/ml carbenicillin) and left overnight to generate dsRNA for experiments (maintained at 20 o C during and after dsRNA generation). To optimize RNAi of skn-1 in 95 offspring, P0 worms were plated on bacteria expressing skn-1 RNAi for 12, 18, 24, or 48 hrs (Fig. S2); this was done to further reduce maternally-deposited skn-1 mRNA transcripts as well as to deposit skn- 1 RNAi in the F1 generation prior to hatching. To control developmental and RNAi timing, these adults were placed in 15°C for the duration of skn-1 RNAi exposure. Adult exposure for 24 or 48 hr caused 90- 100% of dead F1 eggs. 18 hrs was chosen as an acceptable 20-50% egg death while decreasing skn-1 transcripts in living animals to ~50-70% (Fig. S6). Optimization of air pollution exposure model Two routes of nPM exposure (liquid or chronic exposure on growth medium plates) and duration (1, 2, 4, 8, 24 hours) were tested in larval stage 1 or 4 (L1 or L4) C. elegans, as well as solvents (M9 buffer or K medium). 1 hr exposure in diluted nPM at different dosages (1-200 µg nPM/ml) with M9 was chosen for further experiments as it was the fastest exposure in inducing phenotypes without compromising developmental timing. For treatments, worms were washed into an Eppendorf tube, brought to a known volume, and nPM was added to each tube to achieve the listed concentration. Worms were incubated at 20°C for all experiments, unless otherwise indicated. Worms were gently rocked 1 hr for even distribution of nPM. After exposure, worms were washed once before plating at time 0 in post exposure time. Worms treated as "L1s" were treated immediately at the synchronized developmental stage (prior to feeding). Size analysis Following exposure of L1 stage for 1 hr to nPM and re-plating, worms were incubated at 20 °C for 72 hrs. Body size was analyzed by area using ImageJ (average of width × length). Pharyngeal Pumping Worms were treated with 200 µg/ml nPM for 1 hr at L1 stage, then allowed to recover for 24hrs. Plated worms were then recorded using the Movie Recorder in the ZEN 2 software at 6-8ms exposure and 10x magnification (Zeiss Axio Imager) for 10-15 seconds. Worms without pharyngeal pumping (dead, lethargus) during recording were excluded. Immunofluorescent analysis of gst-4p::GFP labeled C. elegans 96 gst-4p::GFP animals were treated with the listed nPM concentration (0-200 µg/ml) for 1 hr and then imaged 4 or 24 hrs after exposure. To image, animals were mounted on slides in M9 solution with 10mM sodium azide. Images were taken at 40x zoom with DIC and GFP filters (Zeiss Axio Imager). Fluorescence is measured via corrected total cell fluorescence (CTCF) via ImageJ and Microsoft Excel. CTCF = Integrated Density – (Area of selected cell X Mean fluorescence of background readings). Lifespan C. elegans were treated with 50 µg/ml nPM at either L1 stage or at L1 and Day 2 adult (~96 hrs). Synchonized L1 animals (after nPM exposure) were plated on control RNAi or skn-1 RNAi. Worms were re-plated each day of reproduction (Day 1-5) to avoid overcrowding from progeny. Individuals were checked for survival by prodding with a platinum wire to verify touch responsivity. Individual worms were censored from survival analysis for gross morbidity (bursting, vulval protrusion, crawling off plate, etc.). Statistics Size and gst-4p::GFP analysis results were compared using ANOVA followed by Tukey post hoc with calculating multiplicity adjusted P values by Graphpad Prism 7. In qPCR time points and the experiments with only two groups, pairwise comparison was done with both T distribution and F distribution tests in Graphpad Prism 7. Lifespan was analyzed by logrank test in JMP software. Heatmap and dendrogram analysis was done in R by the CompexHeatmap package of Bioconductor using Euclidean distance matrix and complete linkage for clustering of the genes. Quantitative real-time PCR L1 or L4 worms were exposed to 50 µg/ml nPM for 1 hr, and then worms were collected and washed in M9 solution at 0 (immediately after 1hr exposure), 1, 2, 4, or 8 hrs after exposure. Worms were pelleted at collection, 500 µl of TriZol reagent (Zymo) was added. RNA was extracted using TriZol method 195 with an additional step of treatment with DNase, lysis by T&C lysis and protein precipitation by MPC reagent (Epicenter, USA) for purification. RNA concentration and purity were assessed by O.D. 230, 260, and 280 by spectrophotometry before qRT-PCR with gene specific primers in Table S1. The 97 data was normalized to ama-1 as housekeeping gene. For Figure 2, skn-1 RNAi was administered to P0 adults, and F1 progeny were analyzed (as "RNA interference" above). 98 Results Acute nPM exposure drives developmental defects in C. elegans Different exposure methods were tested to determine the acute lethal dosage 50 (LD50) of nPM samples. Larval stage 1 and 4 (L1 and L4) wild type N2-Bristol worms (~100 per replicate; at least 3 replicates/group) were exposed to a range of nPM concentrations (0.5-200 µg/ml) for 1, 4, or 24 hrs in liquid culture or on growth medium plates. C. elegans did not show any acute mortality at the highest dose in any of tested conditions during 3 days after exposure. However, nPM exposure did affect development in a dose-dependent manner (Fig. 1A). Exposure of L1 stage animals to nPM in M9 buffer (10, 50 and 200 µg/ml) for only 1 hr showed dose dependent size reduction (13-26% of the worm’s area) in day 1. This size difference was not due to lack of food intake because pharyngeal pumping rates were not impaired (Fig. 1B). Since nPM at 50 µg/ml caused the same size reduction as 200 µg/ml, the lower dose was used for further experiments. skn-1 is activated in response to nPM exposure Because nPM caused size reduction without mortality, we hypothesized that the worm initiates biological defenses in response to nPM. TRAP nPM is a heterogeneous environmental toxicant consisting of multiple elements and water-soluble organic carbons with high oxidant activity (Fig. S1). We chose to examine skn-1/Nrf2, a cytoprotective transcription factor, due to its established anti-oxidant defense response 213 and role in development 214 ; specifically, we used the used the skn-1 reporter gst-4p::GFP (GFP linked to Glutathione S-transferase) to examine activation of SKN-1 in animals treated with nPM. In the gst-4p::GFP strain, both L1 and L4 had dose dependent increases in response as early as 4 hr post-exposure to nPM. By 18 hr post-exposure of L1 stage and 24 hr post-exposure of L4 stage, we observed reduction 99 of GFP signal in most of the nPM exposed animals (all groups except for 10 µg/ml nPM exposed L1s) (Fig. 2A) suggesting a rapid return of homeostasis post-SKN-1 activation. To determine the role of SKN-1 activation in survival to nPM stress, we down-regulated SKN-1 by RNAi before exposure to nPM. Worms were examined after a single L1 exposure to 50 µg/ml nPM, or after a double nPM exposure to 50 µg/ml nPM (at L1 and day 2 of adulthood). Contrary to the negative survival effects observed in cell lines 193 , the dual exposure to nPM caused a modest increase in mean life span (1.1-day, p=0.015 Log rank test, analysis in 90% of total lifespan); reducing skn-1 expression by RNAi ablated this increase. Single developmental L1 exposure to nPM did not affect lifespan (Fig 2B, Table S2). We investigated skn-1 knockout (skn-1(zu135)) for its response to nPM. While L1 exposure of wild type worms to 50 µg/ml nPM reduced day 1 adult size by 20%, skn-1(zu135) worms did not show this decrease in size (Fig. 2C). In both conditions, skn-1(zu135) worms were smaller overall compared to wild type. Gene expression changes induced by nPM exposure To understand molecular responses to nPM, selected mRNAs were measured by qPCR to analyze a panel of genes involved in C. elegans stress responses, development, vitellogenesis, innate immunity, amyloid processing, and TGF-β signaling pathway in L1 or L4 (Fig. 3, S3-S7). In general, animals exposed at L1 had larger nPM mediated mRNA changes, particularly in the first hours of exposure compared to L4 animals; moreover, the genes with largest nPM responses in L1 stage did not change in L4 stage exposed animals (e.g. gst-4, daf-2, apl-1, sel-12). In L1 stage animals, 1 hr exposure to nPM immediately (0 hr post-exposure) changed the expression of several genes (Fig. 3, S4-7). Some of the observed changes at this time included heat shock responses (e.g. hsp-4 [expression/control=0.5 fold], hsf-1 [0.6]), innate immune responses (e.g. tol-1 [0.62]), hormone receptor and development (e.g. daf-2 [0.58], 100 daf-12 [0.61]), vitellogenin (e.g. vit-6 [0.64]) and Alzheimer amyloid processing genes (e.g. apl- 1 [0.64], lrp-1 [0.68] and sel-12 [0.55]) and TGF-β signaling pathway (e.g. daf-7 [0.53]). At 1 hr post-exposure, the expression of most genes returned to baseline (pre-exposure) levels (exceptions were hsf-1 [0.6], hsp-4 [0.47] and daf-2 [0.82]). This shift continued and lead to upregulation of several genes at 2 hr post-exposure of L1s in response to nPM. These responses consisted of skn-1 antioxidant target genes (e.g. gst-4 [3.5]), metal response genes (e.g. cdr-1 [5.7]), innate immune response (e.g. abf-2 [2.8]) and amyloid processing genes (e.g. sel-12 [2.9]). At 8 hr post-exposure, these changes returned to base line or were decreased compared to controls. Metal-sensing genes (e.g. aip-1 [0.54], cdr-1 [0.42]), heat shock responses (e.g. hsf-1 [0.46]) and innate immune responses (e.g. tol-1 [0.84]) were among the genes with lower mRNA levels compared to controls at 8 hr post-exposure (Fig. 3). In L4 stage animals, nPM exposure did not significantly alter the expression of most genes examined. However, several followed the trend observed in L1 exposed animals with increased expression at 1 hr post-exposure and return to baseline at 4 hr post-exposure (Fig. 3). nPM caused decrease of tol-1 mRNA [-0.86] at this time. In contrast to other genes, daf-7 expression followed a distinct pattern compared to L1 exposed animals. At 0 hr post-exposure of L4, nPM increased daf-7 mRNA [2.6], which was in contrast with L1 response [0.55]. daf-7 mRNA eventually returned to normal at later times of exposure in both developmental stages. These data suggest that transcriptional responses to nPM exposure are dependent on developmental stage. The role of skn-1 transcriptional activity in response to nPM exposure. Given the responsiveness of gst-4 to nPM, we further studied the role of SKN-1 activity in nPM mediated toxicity. The expression of skn-1 and its downstream genes was targeted by skn-1 RNAi at L1, which blocked gst-4 response in first 2 hours after nPM exposure (Fig. 4A). At 0 hr post-exposure, all SKN-1 targets were lower (skn-1 [0.7], gst-4 [0.58], gcs-1 [0.47] and ugt-11 [0.25]) vs negative control RNAi. Control animals had significant gst-4 [1.56] mRNA 101 increase at 0 hr post-exposure to nPM, which was not observed for skn-1 RNAi. Contrary to skn-1-related genes after RNAi, nPM still induced some innate immune responses, e.g. abf-2 [0.7 nPM/control at 0 hr post-exposure]. Moreover skn-1 RNAi slightly increased abf-2 response (+30%) at 2 hr post-exposure regardless of nPM. For the amyloid processing genes, skn-1 RNAi decreased sel-12 (-40%) with no further response to nPM at 0 hr post-exposure. At 2 hr post-exposure, nPM still decreased sel-12 mRNA in worms fed Control RNAi (-20%), but not when fed skn-1 RNAi. These data reveal that SKN-1 plays a central role in mediating the transcriptional responses to nPM exposure. Discussion This study introduces C. elegans as a valuable short-lived model with potential for high throughput for genetic and toxicological studies of air pollution toxicity in humans. Most notable are the genomic responses to nPM, a toxic subfraction of the ultrafine air pollution particulate matter. We identified several genomic pathways shared with humans and mice that show developmental sensitivity to nPM. While nPM does not cause lethality in adult C. elegans up to 200 µg/ml, developmental exposure to nPM does reduce worm size and alter mRNA levels, dependent on SKN-1. Responsive genes include skn-1, the C. elegans homologue of the mammalian Nrf2, which has fundamental roles in air pollution toxicity 193 . In addition, 50 µg/ml of nPM given twice early in the C. elegans life cycle caused a mild increase in lifespan [1.2 days in mean life span], again dependent on SKN-1. Although C. elegans lacks a respiratory system, exposing animals to cigarette smoke in smoking chambers for 3hrs impaired intestinal bacterial clearance and gene expression changes 215 ; we observe similar gene expression changes following nPM exposure (e.g. tir-1: - 3.24, and hso-16.2: 2.14 fold change). In the insect Drosophila, chronic exposure to air pollution decreased life span by 50% 216 , and a similar exposure chamber was also used for exposing C. elegans to cigarette smoke 215 . Future studies using this methodology will allow 102 comparisons between liquid and aerosolized delivery of nPM. It is possible that suspended particles could limit the toxic effects of nPM, and exposure to aerosolized particles should be considered for future experiments. Using lifelong liquid cultures to maintain worms could also be used to increase exposure of nPM. While most collected nPM has a cell cytotoxicity 50 (CC50) of 10-20 µg/ml 193 , our data show that there is no acute lethality to nPM even at concentrations as high as 200 µg/ml, which have no obvious counterpart in human exposure. This lack of toxicity at high levels of nPM suggests that C. elegans may be highly adapted to ambient toxicity from various sources. Our study examined the role of skn-1/Nrf2 in the observed physiological and molecular changes of nPM. skn-1/Nrf2 is a transcription factor well-known for affecting both development 214 and cytoprotection/detoxification 213 , among other genes. Exposure of young adult mice (3 mo), but not older adult mice (18 mo), to nPM induced Nrf2-dependent phase II detoxifying enzymes such as GCLC and GCLM in lung, liver and brain samples 217 . These age differences further show the different susceptibility of life stages to air pollution toxicity. Down-regulation of skn-1/Nrf2 in C. elegans did not affect short term survival of this animal in response to nPM, implicating other antioxidant responses independent of skn-1 against air pollution. skn-1 knockout animals no longer had a reduction in size under nPM exposure (albeit were smaller overall). It is possible this developmental effect may involve sel-12, as sel-12 mRNA was decreased by skn-1 RNAi; similar to size reduction in these animals. In view of skn-1 targets, nPM specifically activated gst-4 with minimal change in gcs-1 expression. Genome wide screening of the genes associated with skn-1-mediated detoxifying responses showed involvement of alternative pathways (e.g. apb-2 and csn-2) in activation of gcs-1, regardless of skn-1 activation 218 . Thus gcs-1 may be regulated independently of other phase 2 genes. We must consider if C. elegans is an appropriate model for human air pollution toxicity, because humans have more complex circulatory and immune systems and 100-fold longer 103 lifespans. Our previous studies of air pollution toxicity in mouse and cell culture models nonetheless show extensive overlap with these C. elegans findings 191 . This study investigates our previous findings of air pollution toxicity based on prior mouse and cell culture models. Specifically, we used TRAP ultrafine particulate matter (<0.2 µm dia.) in this study. UltrafinePM may be more toxic compared to PM2.5 219,220 , but is not currently regulated or monitored by the EPA. Air pollution and oxidative stress are strongly associated 221–223 . Previously, we showed only 5 hr exposure to air pollution sufficed for oxidative damage of membrane lipids in olfactory epithelium of exposed mice, assayed as 4-HNE 197 . Oxidative stress (e.g. gst-4) was a prominent response to nPM. The other consistent air pollution response in cell cultures, mice, and humans is inflammation. Microarray analysis of the primary mixed glial culture responses to nPM showed MyD88 dependent activation of TLR4, suggesting this pathway as an important upstream sensors of air pollution leading to inflammation 224 . Exposed mice had higher levels of brain TNFα depending on the duration of nPM exposure 192,195 . Humans exposed to diesel exhaust also show rapid systemic inflammatory responses 225 . Notably, TLR associated gene homologues (tol-1: TLR4, tir-1: MyD88, abf-2: downstream of tol-1) were among the earliest responses of C. elegans to nPM. Air pollution is recently recognized as an environmental risk factor for Alzheimer’s disease (AD) and accelerated cognitive decline 191,226 . In mouse and cell models, exposure to nPM increased production of the Aβ peptide 191 . C. elegans also shows similar effects of air pollution in the responsiveness of its homologous amyloid processing genes to nPM. Several amyloid-related genes are associated with C. elegans development; for example, inactivation of apl-1/APP results in penetrant lethality during the L1 to L2 transition due to molting defects 227 . On the other hand, overexpression of apl-1/APP results in penetrant L1 lethality, shortened body length and morphological, locomotive, and reproductive effects 227,228 . sel-12/PSEN is 104 one of the genes regulating apl-1/APP cleavage and trafficking 227 . The expression of both apl- 1/APP [0 hr: 0.64] and sel-12/PSEN [0 hr: 0.55, 2 hrs: 2.88] is significantly changed in L1 stage following nPM exposure, suggesting the importance of apl-1 and sel-12 expression for the developmental responses to nPM. In addition, air pollution is linked with developmental changes in humans; for example, childhood obesity is associated with maternal exposure to ambient air polycyclic aromatic hydrocarbons during pregnancy 229 . Moreover, we showed that prenatal exposure of mice to nPM alters neuronal differentiation and depression-like responses 196 . Lack of sel-12 lead to elevated endoplasmic reticulum (ER) mitochondrial Ca 2+ signaling and oxidative stress due to mitochondrial superoxide production 230 . Thus, sel-12/PSEN might be a part of antioxidant response to nPM. We initially hypothesized exposure to nPM might be fatal for C. elegans, especially during development. Instead, we found that early exposure to air pollution with a second adult exposure caused a hormetic increase in their lifespan. Hormesis, wherein small doses of a toxin or stress can induce increases in health and lifespan, is well established in eukaryotes 231 , including C. elegans 232 . Interestingly, the hormetic effect of air pollution is dependent on a functional skn-1 response, indicating its importance on later lifespan in addition to its importance in physical development. If exposure to nPM is administered more chronically, perhaps by air exposure chambers, longer or more constant doses may eventually cause decreases in lifespan. Future studies will further identify signaling pathways in responses to air pollution and hopefully help to identify drug and/or diet intervention strategies to counteract these ambient toxins. Systematic study of the life stages of C. elegans will identify critical periods of vulnerability to acute and chronic air pollution exposure. C. elegans could productively complement rodent models for studies of air pollution toxicity throughout the life cycle. 105 Acknowledgements We thank the CGC, funded by NIH Office of Research Infrastructure Programs (P40 OD010440) for some strains, and WormBase. This work was supported by NIH grants T32AG052374 (A.H.); R01AG051521 (C.E.F.); R21AG05020 (C.E.F.); Cure Alzheimer’s Fund, (C.E.F.); R01GM109028 (S.P.C.), F31AG051382 (H.M.D.) and T32AG000037 (H.M.D). Author contributions Conceptualization, S.P.C., C.E.F., T.E.M.; Methodology, A.H., H.M.D. and S.P.C.; nPM collection and characterization: F.S., C.S.; Investigation, A.H., H.M.D., N.S. and S.P.C.; Writing, A.H., H.M.D. and S.P.C.; Supervision, Project Administration, and Funding Acquisition, S.P.C. and C.E.F. 106 Figures Figure 1. Acute nPM exposure of L1 worms results in adult worm size reduction. A) Dose dependent size changes (mean±SEM) of Day 1 adult animal body area following 1 hr exposure to nPM in L1 stage. B) Pharyngeal pumping rate of animals analyzed at 24 hrs post-exposure of the L1 stage wildtype animals to 200 µg/ml nPM. Statistical tests include ANOVA followed by Tukey post hoc with correction for multiple statistical hypothesis testing for size and t test for pharyngeal pumping. Adjusted p-values: <0.05 (*), <0.01(**), <0.001(***), <0.0001(****). 0 200 0 100 200 300 Pharyngeal pumping rate / min Pharyngeal pumping nPM concentration µg/ml N2 24 hours post exposure 60 70 80 90 100 110 %Area Size of the Day 1 adult N2 worms nPM concentration µg/ml * *** ** **** **** 0 10 50 200 A B 107 B Figure 2. nPM mediated SKN-1 response underlies developmental and lifespan effects of TRAP particulate matter. A) Dose response gst-4 protein responses to nPM in L1 and L4 gst-4p::GFP strain (n=9-22/group). B) Role of skn-1 response in hormesis effects of short term air pollution (50 µg/ml) exposure until 90% of worms are dead (n=92-146). C) Analysis of adult skn-1(zu135) mutants and wild type worms exposed to nPM during development (n>50/group). Statistical tests: Survival data was analyzed by Log-Rank test. ANOVA followed by Tukey post hoc with correction for multiple statistical hypothesis testing was used for size. ANOVA followed by Tukey post hoc with correction for multiple 0 10 50 200 0 10 50 200 0 1 2 3 Relative gst-4::gfp levels/control L1 exposure nPM concentration µg/ml * * * * 4 18 Hours post exposure: 0 50 0 50 0 50 100 150 200 %Area **** ** **** N2 skn-1 -/- nPM concentration µg/ml Size of Day 1 adult 0 10 50 200 0 10 50 200 0 1 2 3 Relative gst-4::gfp levels/control L4 exposure nPM concentration µg/ml *** * * *** **** ** ** * 4 24 gst-4::gfp strain A C 0.0 0.2 0.4 0.6 0.8 1.0 Surviving 5 10 15 20 Day *P=0.015 L1 exposure L1 and Day 2 adult exposure Control RNAi skn-1 RNAi skn-1 RNAi Control RNAi Control nPM 0.0 0.2 0.4 0.6 0.8 1.0 Surviving 5 10 15 20 Day 0.0 0.2 0.4 0.6 0.8 1.0 Surviving 5 10 15 20 Day 0.0 0.2 0.4 0.6 0.8 1.0 Surviving 5 10 15 20 Day 108 statistical hypothesis for gst-4p::GFP results. Adjusted p-values: <0.05 (*), <0.01(**), <0.001(***), <0.0001(****). Figure 3. mRNA response to nPM varies with developmental stage. Heatmap showing the mRNA changes of the selected genes in L1 and L4 stage animals exposed to 50 µg/ml nPM for 1 hr (n=4 population/group). RNA levels were followed for 8 hr post-exposure in L1 stage animals and 4 hr post- exposure in L4 stage animals. Responses are clustered based on Euclidian distance using complete linkage method. The heatmap is annotated with the time point, treatment, life stage, average of mRNA changes and the function of target genes. Significant changes are shown in the heatmap. The t-test or F-test was used to compare nPM and controls at each time. p-values: <0.05 (*), <0.01(**), <0.001(***), <0.0001(****). Note: F: F-test P value with F distribution assumption. 109 Figure 4. SKN-1 mediates transcriptional responses of nPM. A) RNA responses to 1 hr nPM (50 µg/ml nPM) after skn-1 RNAi (n=3-5 worms/group). Pairwise t-test or F test to compare Control RNAi vehicle controls with skn-1 RNAi or nPM vs controls at each time. p-values: <0.05 (*), <0.01(**), <0.001(***), <0.0001(****). 0 2 0 2 0.5 1 2 Hours after 1 hr exposure (time of dropping) Expression relative to control skn-1 Control RNAi skn-1 RNAi ** 0 2 0 2 0.25 0.5 1 2 Hours after 1 hr exposure (time of dropping) Expression relative to control gcs-1 skn-1 RNAi **** *** Control RNAi 0 2 0 2 0.25 0.5 1 2 Hours after 1 hr exposure (time of dropping) Expression relative to control tol-1 skn-1 RNAi * Control RNAi 0 2 0 2 0.25 0.5 1 2 Hours after 1 hr exposure (time of dropping) Expression relative to control sel-12 skn-1 RNAi *** ** Control RNAi 0 2 0 2 0.5 1 2 4 8 Hours after 1 hr exposure (time of dropping) Expression relative to control gst-4 skn-1 RNAi *** ** **** Control RNAi 0 2 0 2 0.0625 0.125 0.25 0.5 1 2 Hours after 1 hr exposure (time of dropping) Expression relative to control ugt-11 skn-1 RNAi ** Control RNAi 0 2 0 2 0.25 0.5 1 2 Hours after 1 hr exposure (time of dropping) Expression relative to control abf-2 skn-1 RNAi * F test * Control RNAi SKN-1 targeted genes Innate immune genes Amyloid processing genes Control nPM 110 Supplemental figures Table S1. List of qPCR primers used. snb-1 F CCGGATAAGACCATCTTGACG snb-1 R GACGACTTCATCAACCTGAGC ama-1 F CGGAGGAGATTAAACGCATG ama-1 R CCAACTTTGGCTTTCCGTTC hsf-1 F TTGACGACGACAAGCTTCCAGT hsf-1 R AAAGCTTGCACCAGAATCATCCC aip-1 F AAGCAAGAACAGAGGGAGATG aip-1 R CACTAAATTGGATGCTATGAGAC hsp-4 F CTAAGATCGAGATCGAGTCACTC hsp-4 R GCTTCAATGTAGCACGGAAC gcs-1 F CCAATCGATTCCTTTGGAGA gcs-1 R TCGACAATGTTGAAGCAAGC tir-1 F GGACAACTTCTTGATGGGAT tir-1 R GGTTTCAAATGCTTGTGTCA lrp-1 F CACCAAACAGACCATCAACG lrp-1 R CTTCGAGATTTCCGCTTTTG tol-1 F CCAAAGGTTCTCATTCAGGA tol-1 R CCGTATTGACAGCAGATACA apl-1 F TGGTGGAAACATCAGTACAA apl-1 R ACTTCTGGTGATTGGATGAG daf-2 F GCCCGAATGTTGTGAAAACT daf-2 R CCAGTGCTTCTGAATCGTCA cdr-1 F TCTTCTCTCAATTGGCAACTG cdr-1 R TTTGGGTAAACTTCATGACGA gst-4 F GATGCTCGTGCTCTTGCTG gst-4 R CCGAATTGTTCTCCATCGAC daf-7 F AAAGAGGCACCAAAGGGATT daf-7 R TCAAACTTGGCAACAAGCTG daf-12 F GAGGCAATGATTCCAAAGGA daf-12 R CTTTAAGCTCAGCGGCATTC abf-2 F TCGACTTTAGTACTTGTGCC abf-2 R AGTGGAATATCTCCTCCTCC vit-6 F CAATCAATGTTGAACCACGC vit-6 R CTCCTCCATTTGTGGTTGGT sel-12 F TCTGGAGTAAGGGTGGAACG sel-12 R TGGCCACATAACAAGCGATA skn-1 F CCACTTCAATCCCCACAAAG skn-1 R CCGGGCTCAAATGAAAAAC gcs-1 F CCAATCGATTCCTTTGGAGA gcs-1 R TCGACAATGTTGAAGCAAGC ugt-11 F CCGATTTCTGGGACTCTCAA ugt-11 R GGACTCCCAGGAAGTGTGAC 111 Figure S1. Chemical composition of the nPM0.2 sample used in this study. Figure S2. Optimization of the duration of skn-1 RNAi exposure prior to nPM exposure experiment. 18 hrs treatment was selected for the experiments. During optimization only 2-3 population per group were tested. S Na Ca Mg K Zn Ba P Al Cu B Mn Ni Sb Fe Mo Se V Cr Li As Sn Co Ti Rb 0.001 0.01 0.1 1 10 100 1000 Elements >0.005 ng/ug nPM Pb W Cd Tl Ce Cs Y Pd U La Nd Ag Eu Sc Hf Pt Nb Th Dy Rh Sm Yb Pr Ho Lu 0.000001 0.00001 0.0001 0.001 0.01 Elements <0.005 ng/ug nPM 0.001 0.01 0.1 1 10 100 1000 mass fraction (ng/µg PM) Total Organic carbon 0.5 1.0 1.5 RNAi treatment duration (hrs) Expression relative to control skn-1 mRNA 12 18 24 * 0.0 0.5 1.0 1.5 RNAi treatment duration (hrs) Expression relative to control gst-4 mRNA 12 18 24 Control RNAi skn-1 RNAi ** *** * 112 Table S2. Raw data of the control or skn-1 RNAi treated C. elegans survival in response to nPM Control RNAi SKN-1 RNAI Veh L1 nPM L1 Veh L1D2 nPM L1D2 Veh L1 nPM L1 Veh L1D2 nPM L1D2 DAY Death Censor Death Censor Death Censor Death Censor Death Censor Death Censor Death Censor Death Censor 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 2 0 5 0 6 0 0 0 0 0 5 0 5 0 0 0 0 3 1 13 1 17 0 8 0 9 0 9 0 55 0 2 0 2 4 0 9 0 7 0 7 0 6 0 2 0 6 0 9 0 7 5 0 2 0 1 1 6 0 2 0 3 0 2 0 3 0 2 6 0 4 0 2 0 0 0 2 0 5 0 2 0 7 0 3 7 1 0 1 1 0 2 0 2 0 0 0 0 0 0 0 4 8 2 1 9 0 5 6 5 5 4 0 3 5 2 2 1 9 9 6 3 14 9 4 0 2 1 8 0 3 0 9 0 3 0 10 13 4 10 43 10 1 10 4 12 0 8 0 7 0 10 1 11 17 2 13 1 9 0 10 0 9 0 7 0 9 0 14 0 12 15 0 8 1 19 0 9 4 20 0 4 1 11 1 14 0 13 9 1 9 2 7 0 14 11 9 0 7 0 8 0 6 0 14 8 0 5 0 11 3 7 0 11 0 8 0 10 0 6 0 15 4 4 3 1 8 0 4 0 14 0 12 3 12 0 15 1 16 6 1 8 0 9 0 5 0 13 0 9 1 11 0 11 0 17 2 0 3 1 10 0 7 0 17 0 12 0 10 0 19 0 18 5 0 4 0 4 0 3 9 12 0 10 0 11 0 14 0 19 6 0 2 0 3 0 5 0 10 0 5 0 10 0 8 0 20 5 0 2 0 7 0 8 0 2 0 3 0 5 0 8 0 21 6 0 4 0 5 0 7 0 5 0 1 0 2 0 3 0 22 1 0 3 0 4 0 2 0 0 0 0 0 0 0 0 0 23 0 0 2 0 4 0 3 0 0 0 0 0 0 0 0 0 24 1 0 1 0 1 0 3 0 0 0 0 0 0 0 0 0 25 3 0 0 0 3 0 0 0 0 0 0 0 0 0 0 0 26 1 0 2 0 0 0 1 0 0 0 0 0 0 0 0 0 27 0 0 0 0 1 0 1 0 0 0 0 0 0 0 0 0 28 0 0 0 0 2 0 0 0 0 0 0 0 0 0 0 0 113 Figure S3. Changes in SKN-1 pathway targets following nPM exposure at L1 or L4 stage of C. elegans development. Expression data was normalized to ama-1 Ct values as a housekeeping gene. Statistics: Pairwise t-test or F test was performed to compare vehicle controls with nPM at each time point. p-values: <0.05 (*), <0.01(**), <0.001(***), <0.0001(****). 0 1 2 4 8 0 1 2 4 8 0.0625 0.125 0.25 0.5 1 2 4 8 16 Hours after 1 hr exposure (time of dropping) Expression relative to control gst-4 * L1 L4 0 1 2 8 0.0625 0.125 0.25 0.5 1 2 Hours after 1 hr exposure (time of dropping) Expression relative to control gcs-1 L1 Control nPM SKN-1 targeted genes 114 Figure S4. Changes in amyloid processing pathway following exposure to 50 µg/ml nPM at L1 or L4 stage of C. elegans development. Expression data was normalized to ama-1 Ct values as a housekeeping gene. Statistics: Pairwise t-test or F test was performed to compare vehicle controls with nPM at each time point. p-values: <0.05 (*), <0.01(**), <0.001(***), <0.0001(****). 0 1 2 4 8 0 1 2 4 8 0.125 0.25 0.5 1 2 Hours after 1 hr exposure (time of dropping) Expression relative to control apl-1 * L1 L4 0 1 2 8 0.125 0.25 0.5 1 2 Hours after 1 hr exposure (time of dropping) Expression relative to control lrp-1 L1 * 0 1 2 4 8 0 1 2 4 8 0.25 0.5 1 2 4 Hours after 1 hr exposure (time of dropping) Expression relative to control sel-12 * * L1 L4 Control nPM Alzheimer homologue genes 115 Figure S5. Changes in genes associated with innate immune responses following exposure to 50 µg/ml nPM at L1 or L4 stage of C. elegans development. Expression data was normalized to ama-1 Ct values as a housekeeping gene. Statistics: Pairwise t-test or F test was performed to compare vehicle controls with nPM at each time point. p-values: <0.05 (*), <0.01(**), <0.001(***), <0.0001(****). 0 1 2 4 8 0 1 2 4 8 0.25 0.5 1 2 Hours after 1 hr exposure (time of dropping) Expression relative to control tol-1 ** F test ** Ftest ** L1 L4 0 1 2 8 0.0625 0.125 0.25 0.5 1 2 Hours after 1 hr exposure (time of dropping) Expression relative to control tir-1 L1 0 1 2 8 0.25 0.5 1 2 4 Hours after 1 hr exposure (time of dropping) Expression relative to control abf-2 L1 * Control nPM Innate immune response genes 116 Figure S6. Additional analysis of gene expression in response to air pollution after nPM exposure at L1 or L4 stage of C. elegans development. Expression data was normalized to ama-1 Ct values as a housekeeping gene. Statistics: Pairwise t-test or F test was performed to compare vehicle controls with nPM at each time point. p-values: <0.05 (*), <0.01(**), <0.001(***), <0.0001(****). 0 1 2 8 0.0625 0.125 0.25 0.5 1 2 Hours after 1 hr exposure (time of dropping) Expression relative to control hsf-1 L1 * Ftest * * 0 1 2 8 0.0625 0.125 0.25 0.5 1 2 Hours after 1 hr exposure (time of dropping) Expression relative to control hsp-4 L1 * * Heat shock genes 0 1 2 8 0.03125 0.0625 0.125 0.25 0.5 1 2 Hours after 1 hr exposure (time of dropping) Expression relative to control aip-1 L1 * 0 1 2 8 0.0625 0.125 0.25 0.5 1 2 4 8 Hours after 1 hr exposure (time of dropping) Expression relative to control cdr-1 L1 ** *** Ftest Metal and alcohol response genes Control nPM 0 1 2 8 0.015625 0.03125 0.0625 0.125 0.25 0.5 1 2 Hours after 1 hr exposure (time of dropping) Expression relative to control asr-1 L1 * 117 Figure S7. Analysis of the genes from hormone receptor, vitellogenin, and TGFβ pathways in response to air pollution exposure at L1 or L4 stage of C. elegans development. Expression data was normalized to ama-1 Ct values as a housekeeping gene. Statistics: Pairwise t-test or F test was performed to compare vehicle controls with nPM at each time point. p-values: <0.05 (*), <0.01(**), <0.001(***), <0.0001(****). 0 1 2 8 0.5 1 2 Hours after 1 hr exposure (time of dropping) Expression relative to control daf-12 L1 * 0 1 2 4 8 0 1 2 4 8 0.25 0.5 1 2 4 8 16 Hours after 1 hr exposure (time of dropping) Expression relative to control daf-7 * ** Ftest L1 L4 0 1 2 8 0.25 0.5 1 2 4 8 Hours after 1 hr exposure (time of dropping) Expression relative to control vit-6 L1 ** * Ftest 0 1 2 4 8 0 1 2 4 8 0.25 0.5 1 2 Hours after 1 hr exposure (time of dropping) Expression relative to control daf-2 * *Ftest L1 L4 Hormone receptor, development or vitellogenin TGFβ pathway 118 References 1. Medawar, P. B. An Unsolved Problem of Biology. (1952). 2. Rose, M. R. Evolutionary Biology of Aging. (Oxford University Press, 1991). 3. Hamilton, W. D. The moulding of senescence by natural selection. J. Theor. Biol. 12, 12– 45 (1966). 4. Charlesworth, B. Fisher, Medawar, Hamilton and the evolution of aging. Genetics 156, 927–31 (2000). 5. Croft, D. P., Brent, L. J. N., Franks, D. W. & Cant, M. A. The evolution of prolonged life after reproduction. Trends Ecol. Evol. 30, 407–16 (2015). 6. Kenyon, C. J. The genetics of ageing. Nature 464, 504–12 (2010). 7. de Magalhães, J. P. & Church, G. M. Genomes optimize reproduction: aging as a consequence of the developmental program. Physiology (Bethesda). 20, 252–9 (2005). 8. Kenyon, C., Chang, J., Gensch, E., Rudner, A. & Tabtiang, R. A C. elegans mutant that lives twice as long as wild type. Nature 366, 461–4 (1993). 9. Tatar, M. et al. A mutant Drosophila insulin receptor homolog that extends life-span and impairs neuroendocrine function. Science (80-. ). 292, 107–10 (2001). 10. Holzenberger, M. et al. IGF-1 receptor regulates lifespan and resistance to oxidative stress in mice. Nature 421, 182–7 (2003). 11. Xu, J. et al. Longevity effect of IGF-1R(+/-) mutation depends on genetic background- specific receptor activation. Aging Cell 13, 19–28 (2014). 12. Pan, K. Z. et al. Inhibition of mRNA translation extends lifespan in Caenorhabditis elegans. Aging Cell 6, 111–119 (2007). 13. Kapahi, P. et al. Regulation of lifespan in Drosophila by modulation of genes in the TOR signaling pathway. Curr. Biol. 14, 885–90 (2004). 14. Selman, C. et al. Ribosomal Protein S6 Kinase 1 Signaling Regulates Mammalian Life Span. Science (80-. ). 326, 140–144 (2009). 119 15. Hansen, M. et al. Lifespan extension by conditions that inhibit translation in Caenorhabditis elegans. Aging Cell 6, 95–110 (2007). 16. Asencio, C., Rodríguez-Aguilera, J. C., Ruiz-Ferrer, M., Vela, J. & Navas, P. Silencing of ubiquinone biosynthesis genes extends life span in Caenorhabditis elegans. FASEB J. 17, 1135–7 (2003). 17. Takahashi, K., Noda, Y., Ohsawa, I., Shirasawa, T. & Takahashi, M. Extended lifespan, reduced body size and leg skeletal muscle mass, and decreased mitochondrial function in clk-1 transgenic mice. Exp. Gerontol. 58, 146–53 (2014). 18. Liu, X. et al. Evolutionary conservation of the clk-1-dependent mechanism of longevity: loss of mclk1 increases cellular fitness and lifespan in mice. Genes Dev. 19, 2424–34 (2005). 19. Liu, J. et al. Drosophila sbo regulates lifespan through its function in the synthesis of coenzyme Q in vivo. J. Genet. Genomics 38, 225–34 (2011). 20. Vellai, T. et al. Genetics: Influence of TOR kinase on lifespan in C. elegans. Nature 426, 620 (2003). 21. Wu, J. J. et al. Increased Mammalian Lifespan and a Segmental and Tissue-Specific Slowing of Aging after Genetic Reduction of mTOR Expression. Cell Rep. 4, 913–920 (2013). 22. Ellis, S. et al. Postreproductive lifespans are rare in mammals. Ecol. Evol. 8, 2482–2494 (2018). 23. MacArthur, R. H. & Wilson, E. O. The Theory of Island Biogeography. (Princeton University Press, 1967). 24. Stearns, S. C. Life-history tactics: a review of the ideas. Q. Rev. Biol. 51, 3–47 (1976). 25. Hunt, J., Jennions, M. D., Spyrou, N. & Brooks, R. Artificial selection on male longevity influences age-dependent reproductive effort in the black field cricket Teleogryllus commodus. Am. Nat. 168, E72-86 (2006). 120 26. Rose, M. R. LABORATORY EVOLUTION OF POSTPONED SENESCENCE IN DROSOPHILA MELANOGASTER. Evolution 38, 1004–1010 (1984). 27. Buck, S., Vettraino, J., Force, A. G. & Arking, R. Extended longevity in Drosophila is consistently associated with a decrease in developmental viability. J. Gerontol. A. Biol. Sci. Med. Sci. 55, B292-301 (2000). 28. Werfel, J., Ingber, D. E. & Bar-Yam, Y. Programed Death is Favored by Natural Selection in Spatial Systems. Phys. Rev. Lett. 114, 238103 (2015). 29. Mitteldorf, J. & Wilson, D. S. Population viscosity and the evolution of altruism. J. Theor. Biol. 204, 481–96 (2000). 30. Kaeberlein, M., Rabinovitch, P. S. & Martin, G. M. Healthy aging: The ultimate preventative medicine. Science 350, 1191–3 (2015). 31. Sierra, F. & Kohanski, R. Geroscience and the trans-NIH Geroscience Interest Group, GSIG. GeroScience 39, 1–5 (2017). 32. Bansal, A., Zhu, L. J., Yen, K. & Tissenbaum, H. A. Uncoupling lifespan and healthspan in Caenorhabditis elegans longevity mutants. Proc. Natl. Acad. Sci. U. S. A. 112, E277- 86 (2015). 33. Hahm, J.-H. et al. C. elegans maximum velocity correlates with healthspan and is maintained in worms with an insulin receptor mutation. Nat. Commun. 6, 8919 (2015). 34. Cohen, E., Bieschke, J., Perciavalle, R. M., Kelly, J. W. & Dillin, A. Opposing activities protect against age-onset proteotoxicity. Science 313, 1604–10 (2006). 35. Evans, E. A., Kawli, T. & Tan, M.-W. Pseudomonas aeruginosa suppresses host immunity by activating the DAF-2 insulin-like signaling pathway in Caenorhabditis elegans. PLoS Pathog. 4, e1000175 (2008). 36. Pan, C.-L., Peng, C.-Y., Chen, C.-H. & McIntire, S. Genetic analysis of age-dependent defects of the Caenorhabditis elegans touch receptor neurons. Proc. Natl. Acad. Sci. U. S. A. 108, 9274–9 (2011). 121 37. Murphy, C. T. The search for DAF-16/FOXO transcriptional targets: approaches and discoveries. Exp. Gerontol. 41, 910–21 (2006). 38. Ogg, S. et al. The Fork head transcription factor DAF-16 transduces insulin-like metabolic and longevity signals in C. elegans. Nature 389, 994–999 (1997). 39. Morris, J. Z., Tissenbaum, H. A. & Ruvkun, G. A phosphatidylinositol-3-OH kinase family member regulating longevity and diapause in Caenorhabditis elegans. Nature 382, 536– 9 (1996). 40. Pan, K. Z. et al. Inhibition of mRNA translation extends lifespan in Caenorhabditis elegans. Aging Cell 6, (2007). 41. McElwee, J. J., Schuster, E., Blanc, E., Thomas, J. H. & Gems, D. Shared transcriptional signature in Caenorhabditis elegans Dauer larvae and long-lived daf-2 mutants implicates detoxification system in longevity assurance. J. Biol. Chem. 279, 44533–43 (2004). 42. Lindblom, T. H. & Dodd, A. K. Xenobiotic detoxification in the nematode Caenorhabditis elegans. J. Exp. Zool. A. Comp. Exp. Biol. 305, 720–30 (2006). 43. Soti, C. & Csermely, P. Chaperones come of age. Cell Stress Chaperones 7, 186–90 (2002). 44. Manière, X. et al. High transcript levels of heat-shock genes are associated with shorter lifespan of Caenorhabditis elegans. Exp. Gerontol. 60, 12–7 (2014). 45. Hipkiss, A. R. On why decreasing protein synthesis can increase lifespan. Mech. Ageing Dev. 128, 412–4 (2007). 46. Dalton, H. M. & Curran, S. P. Hypodermal responses to protein synthesis inhibition induce systemic developmental arrest and AMPK-dependent survival in Caenorhabditis elegans. PLoS Genet. 14, e1007520 (2018). 47. Curran, S. P. & Ruvkun, G. Lifespan Regulation by Evolutionarily Conserved Genes Essential for Viability. PLoS Genet. 3, e56 (2007). 122 48. Contreras, V., Richardson, M. A., Hao, E. & Keiper, B. D. Depletion of the cap- associated isoform of translation factor eIF4G induces germline apoptosis in C. elegans. Cell Death Differ. 15, 1232–42 (2008). 49. Blagosklonny, M. V. Revisiting the antagonistic pleiotropy theory of aging: TOR-driven program and quasi-program. Cell Cycle 9, 3151–6 (2010). 50. Gems, D. The aging-disease false dichotomy: understanding senescence as pathology. Front. Genet. 6, 212 (2015). 51. Bitto, A. et al. Transient rapamycin treatment can increase lifespan and healthspan in middle-aged mice. Elife 5, (2016). 52. Ruzanov, P., Riddle, D. L., Marra, M. A., McKay, S. J. & Jones, S. M. Genes that may modulate longevity in C. elegans in both dauer larvae and long-lived daf-2 adults. Exp. Gerontol. 42, 825–39 (2007). 53. Gems, D. et al. Two pleiotropic classes of daf-2 mutation affect larval arrest, adult behavior, reproduction and longevity in Caenorhabditis elegans. Genetics 150, 129–55 (1998). 54. Joshi, R. L. et al. Targeted disruption of the insulin receptor gene in the mouse results in neonatal lethality. EMBO J. 15, 1542–7 (1996). 55. Chen, C., Jack, J. & Garofalo, R. S. The Drosophila insulin receptor is required for normal growth. Endocrinology 137, 846–56 (1996). 56. Harrison, D. E. et al. Rapamycin fed late in life extends lifespan in genetically heterogeneous mice. Nature 460, 392–5 (2009). 57. Thomson, A. W., Turnquist, H. R. & Raimondi, G. Immunoregulatory functions of mTOR inhibition. Nat. Rev. Immunol. 9, 324–37 (2009). 58. Yang, S.-B. et al. Rapamycin induces glucose intolerance in mice by reducing islet mass, insulin content, and insulin sensitivity. J. Mol. Med. (Berl). 90, 575–85 (2012). 59. Lamming, D. W., Ye, L., Sabatini, D. M. & Baur, J. A. Rapalogs and mTOR inhibitors as 123 anti-aging therapeutics. J. Clin. Invest. 123, 980–9 (2013). 60. Pende, M. et al. S6K1(-/-)/S6K2(-/-) mice exhibit perinatal lethality and rapamycin- sensitive 5’-terminal oligopyrimidine mRNA translation and reveal a mitogen-activated protein kinase-dependent S6 kinase pathway. Mol. Cell. Biol. 24, 3112–24 (2004). 61. Williams, G. C. Pleiotropy, Natural Selection, and the Evolution of Senescence. Evolution (N. Y). 11, 398–411 (1957). 62. Holliday, R. Aging is no longer an unsolved problem in biology. Ann. N. Y. Acad. Sci. 1067, 1–9 (2006). 63. Partridge, L. & Gems, D. The evolution of longevity. Curr. Biol. 12, R544-6 (2002). 64. Lemaître, J.-F. et al. Early-late life trade-offs and the evolution of ageing in the wild. Proceedings. Biol. Sci. 282, 20150209 (2015). 65. Frézal, L. & Félix, M.-A. C. elegans outside the Petri dish. Elife 4, (2015). 66. Cassada, R. C. & Russell, R. L. The dauerlarva, a post-embryonic developmental variant of the nematode Caenorhabditis elegans. Dev. Biol. 46, 326–42 (1975). 67. Baugh, L. R. & Sternberg, P. W. DAF-16/FOXO Regulates Transcription of cki-1/Cip/Kip and Repression of lin-4 during C. elegans L1 Arrest. Curr. Biol. 16, 780–785 (2006). 68. Angelo, G. & Van Gilst, M. R. Starvation protects germline stem cells and extends reproductive longevity in C. elegans. Science 326, 954–8 (2009). 69. Seidel, H. S. & Kimble, J. The oogenic germline starvation response in C. elegans. PLoS One 6, e28074 (2011). 70. Honda, Y. & Honda, S. The daf-2 gene network for longevity regulates oxidative stress resistance and Mn-superoxide dismutase gene expression in Caenorhabditis elegans. FASEB J. 13, 1385–93 (1999). 71. Barsyte, D., Lovejoy, D. A. & Lithgow, G. J. Longevity and heavy metal resistance in daf- 2 and age-1 long-lived mutants of Caenorhabditis elegans. FASEB J. 15, 627–34 (2001). 72. Baugh, L. R. To grow or not to grow: nutritional control of development during 124 Caenorhabditis elegans L1 arrest. Genetics 194, 539–55 (2013). 73. Tsang, W. Y., Sayles, L. C., Grad, L. I., Pilgrim, D. B. & Lemire, B. D. Mitochondrial respiratory chain deficiency in Caenorhabditis elegans results in developmental arrest and increased life span. J. Biol. Chem. 276, 32240–32246 (2001). 74. Schindler, A. J., Baugh, L. R. & Sherwood, D. R. Identification of Late Larval Stage Developmental Checkpoints in Caenorhabditis elegans Regulated by Insulin/IGF and Steroid Hormone Signaling Pathways. PLoS Genet. 10, e1004426 (2014). 75. Artal-Sanz, M. & Tavernarakis, N. Prohibitin couples diapause signalling to mitochondrial metabolism during ageing in C. elegans. Nature 461, 793–7 (2009). 76. Rea, S. L., Ventura, N. & Johnson, T. E. Relationship between mitochondrial electron transport chain dysfunction, development, and life extension in Caenorhabditis elegans. PLoS Biol. 5, e259 (2007). 77. Melo, J. A. & Ruvkun, G. Inactivation of conserved C. elegans genes engages pathogen- and xenobiotic-associated defenses. Cell 149, 452–66 (2012). 78. Liu, Y., Samuel, B. S., Breen, P. C. & Ruvkun, G. Caenorhabditis elegans pathways that surveil and defend mitochondria. Nature 508, 406–10 (2014). 79. Shore, D. E. & Ruvkun, G. A cytoprotective perspective on longevity regulation. Trends Cell Biol. 23, 409–20 (2013). 80. Syntichaki, P., Troulinaki, K. & Tavernarakis, N. eIF4E function in somatic cells modulates ageing in Caenorhabditis elegans. Nature 445, 922–926 (2007). 81. Bolster, D. R., Crozier, S. J., Kimball, S. R. & Jefferson, L. S. AMP-activated protein kinase suppresses protein synthesis in rat skeletal muscle through down-regulated mammalian target of rapamycin (mTOR) signaling. J. Biol. Chem. 277, 23977–80 (2002). 82. Chan, A. Y. M., Soltys, C.-L. M., Young, M. E., Proud, C. G. & Dyck, J. R. B. Activation of AMP-activated Protein Kinase Inhibits Protein Synthesis Associated with Hypertrophy in the Cardiac Myocyte. J. Biol. Chem. 279, 32771–32779 (2004). 125 83. Saha, A. K. et al. Downregulation of AMPK accompanies leucine- and glucose-induced increases in protein synthesis and insulin resistance in rat skeletal muscle. Diabetes 59, 2426–34 (2010). 84. Webster, C. M. et al. Genome-wide RNAi Screen for Fat Regulatory Genes in C. elegans Identifies a Proteostasis-AMPK Axis Critical for Starvation Survival. Cell Rep. 20, 627– 640 (2017). 85. Aguilar, V. et al. S6 kinase deletion suppresses muscle growth adaptations to nutrient availability by activating AMP kinase. Cell Metab. 5, 476–87 (2007). 86. SYNTICHAKI, P., TROULINAKI, K. & TAVERNARAKIS, N. Protein Synthesis Is a Novel Determinant of Aging in Caenorhabditis elegans. Ann. N. Y. Acad. Sci. 1119, 289–295 (2007). 87. Kourtis, N. & Tavernarakis, N. Cell-Specific Monitoring of Protein Synthesis In Vivo. PLoS One 4, e4547 (2009). 88. Frand, A. R., Russel, S. & Ruvkun, G. Functional Genomic Analysis of C. elegans Molting. PLoS Biol. 3, e312 (2005). 89. Lesch, B. J. & Page, D. C. Genetics of germ cell development. Nat. Rev. Genet. 13, 781–794 (2012). 90. Shore, D. E., Carr, C. E. & Ruvkun, G. Induction of cytoprotective pathways is central to the extension of lifespan conferred by multiple longevity pathways. PLoS Genet. 8, e1002792 (2012). 91. Fielenbach, N. & Antebi, A. C. elegans dauer formation and the molecular basis of plasticity. Genes Dev. 22, 2149–2165 (2008). 92. Shimozono, S. et al. Slow Ca2+ dynamics in pharyngeal muscles in Caenorhabditis elegans during fast pumping. EMBO Rep. 5, 521–6 (2004). 93. Kerr, R. et al. Optical imaging of calcium transients in neurons and pharyngeal muscle of C. elegans. Neuron 26, 583–94 (2000). 126 94. Lakowski, B. & Hekimi, S. The genetics of caloric restriction in Caenorhabditis elegans. Proc. Natl. Acad. Sci. U. S. A. 95, 13091–6 (1998). 95. Finch, C. E. & Ruvkun, G. T HE G ENETICS OF A GING. Annu. Rev. Genomics Hum. Genet. 2, 435–462 (2001). 96. Lee, C. & Longo, V. Dietary restriction with and without caloric restriction for healthy aging. F1000Research 5, (2016). 97. Tavernarakis, N. Ageing and the regulation of protein synthesis: a balancing act? Trends Cell Biol. 18, 228–235 (2008). 98. Mair, W. Tipping the energy balance toward longevity. Cell Metab. 17, 5–6 (2013). 99. Burkewitz, K. et al. Neuronal CRTC-1 governs systemic mitochondrial metabolism and lifespan via a catecholamine signal. Cell 160, 842–855 (2015). 100. Berg, M. et al. Assembly of the Caenorhabditis elegans gut microbiota from diverse soil microbial environments. ISME J. 10, 1998–2009 (2016). 101. Samuel, B. S., Rowedder, H., Braendle, C., Félix, M.-A. & Ruvkun, G. Caenorhabditis elegans responses to bacteria from its natural habitats. Proc. Natl. Acad. Sci. 113, E3941–E3949 (2016). 102. Dirksen, P. et al. The native microbiome of the nematode Caenorhabditis elegans: gateway to a new host-microbiome model. BMC Biol. 14, 38 (2016). 103. Obrig, T. G., Culp, W. J., McKeehan, W. L. & Hardesty, B. The mechanism by which cycloheximide and related glutarimide antibiotics inhibit peptide synthesis on reticulocyte ribosomes. J. Biol. Chem. 246, 174–81 (1971). 104. van Wezel, G. P. & McDowall, K. J. The regulation of the secondary metabolism of Streptomyces: new links and experimental advances. Nat. Prod. Rep. 28, 1311–33 (2011). 105. Takauji, Y. et al. Restriction of protein synthesis abolishes senescence features at cellular and organismal levels. Sci. Rep. 6, 18722 (2016). 127 106. Alder, M. N., Dames, S., Gaudet, J. & Mango, S. E. Gene silencing in Caenorhabditis elegans by transitive RNA interference. RNA 9, 25–32 (2003). 107. Sijen, T. et al. On the role of RNA amplification in dsRNA-triggered gene silencing. Cell 107, 465–76 (2001). 108. Alcazar, R. M., Lin, R. & Fire, A. Z. Transmission dynamics of heritable silencing induced by double-stranded RNA in Caenorhabditis elegans. Genetics 180, 1275–88 (2008). 109. Golden, J. W. & Riddle, D. L. The Caenorhabditis elegans dauer larva: developmental effects of pheromone, food, and temperature. Dev. Biol. 102, 368–78 (1984). 110. Hammell, C. M., Karp, X. & Ambros, V. A feedback circuit involving let-7-family miRNAs and DAF-12 integrates environmental signals and developmental timing in Caenorhabditis elegans. Proc. Natl. Acad. Sci. U. S. A. 106, 18668–73 (2009). 111. Abbott, A. L. et al. The let-7 MicroRNA family members mir-48, mir-84, and mir-241 function together to regulate developmental timing in Caenorhabditis elegans. Dev. Cell 9, 403–14 (2005). 112. Narbonne, P. & Roy, R. Inhibition of germline proliferation during C. elegans dauer development requires PTEN, LKB1 and AMPK signalling. Development 133, 611–9 (2006). 113. Fukuyama, M., Kontani, K., Katada, T. & Rougvie, A. E. The C. elegans Hypodermis Couples Progenitor Cell Quiescence to the Dietary State. Curr. Biol. 25, 1241–8 (2015). 114. Kumsta, C. & Hansen, M. C. elegans rrf-1 mutations maintain RNAi efficiency in the soma in addition to the germline. PLoS One 7, e35428 (2012). 115. Winston, W. M., Molodowitch, C. & Hunter, C. P. Systemic RNAi in C. elegans requires the putative transmembrane protein SID-1. Science 295, 2456–9 (2002). 116. Hall, J., Haas, K. L. & Freedman, J. H. Role of MTL-1, MTL-2, and CDR-1 in mediating cadmium sensitivity in Caenorhabditis elegans. Toxicol. Sci. 128, 418–26 (2012). 117. Bauman, J. W., Liu, J., Liu, Y. P. & Klaassen, C. D. Increase in metallothionein produced 128 by chemicals that induce oxidative stress. Toxicol. Appl. Pharmacol. 110, 347–54 (1991). 118. Dalton, T., Palmiter, R. D. & Andrews, G. K. Transcriptional induction of the mouse metallothionein-I gene in hydrogen peroxide-treated Hepa cells involves a composite major late transcription factor/antioxidant response element and metal response promoter elements. Nucleic Acids Res. 22, 5016–23 (1994). 119. Kobayashi, K. et al. Induction of metallothionein by manganese is completely dependent on interleukin-6 production. J. Pharmacol. Exp. Ther. 320, 721–7 (2007). 120. Meloni, G., Polanski, T., Braun, O. & Vasák, M. Effects of Zn(2+), Ca(2+), and Mg(2+) on the structure of Zn(7)metallothionein-3: evidence for an additional zinc binding site. Biochemistry 48, 5700–7 (2009). 121. Xiong, X., Arizono, K., Garrett, S. H. & Brady, F. O. Induction of zinc metallothionein by calcium ionophore in vivo and in vitro. FEBS Lett. 299, 192–6 (1992). 122. Schulz, T. J. et al. Glucose Restriction Extends Caenorhabditis elegans Life Span by Inducing Mitochondrial Respiration and Increasing Oxidative Stress. Cell Metab. 6, 280– 293 (2007). 123. Greer, E. L. et al. An AMPK-FOXO pathway mediates longevity induced by a novel method of dietary restriction in C. elegans. Curr. Biol. 17, 1646–56 (2007). 124. McQuary, P. R. et al. C. elegans S6K Mutants Require a Creatine-Kinase-like Effector for Lifespan Extension. Cell Rep. 14, 2059–2067 (2016). 125. Leprivier, G. et al. The eEF2 kinase confers resistance to nutrient deprivation by blocking translation elongation. Cell 153, 1064–79 (2013). 126. McEwan, D. L., Kirienko, N. V. & Ausubel, F. M. Host Translational Inhibition by Pseudomonas aeruginosa Exotoxin A Triggers an Immune Response in Caenorhabditis elegans. Cell Host Microbe 11, 364–374 (2012). 127. Dunbar, T. L., Yan, Z., Balla, K. M., Smelkinson, M. G. & Troemel, E. R. C. elegans detects pathogen-induced translational inhibition to activate immune signaling. Cell Host 129 Microbe 11, 375–86 (2012). 128. Argüello, R. J., Rodriguez Rodrigues, C., Gatti, E. & Pierre, P. Protein synthesis regulation, a pillar of strength for innate immunity? Curr. Opin. Immunol. 32, 28–35 (2015). 129. Reddy, K. C. et al. An Intracellular Pathogen Response Pathway Promotes Proteostasis in C. elegans. Curr. Biol. 27, 3544–3553.e5 (2017). 130. Palominos, M. F. et al. Transgenerational Diapause as an Avoidance Strategy against Bacterial Pathogens in Caenorhabditis elegans. MBio 8, (2017). 131. Schindelin, J. et al. Fiji: an open-source platform for biological-image analysis. Nat. Methods 9, 676–82 (2012). 132. Palikaras, K. & Tavernarakis, N. Intracellular Assessment of ATP Levels in Caenorhabditis elegans. BIO-PROTOCOL 6, (2016). 133. R Core Team. R: A language and environment for statistical computing. (2013). at <http://www.r-project.org/> 134. Robida-Stubbs, S. et al. TOR signaling and rapamycin influence longevity by regulating SKN-1/Nrf and DAF-16/FoxO. Cell Metab. 15, 713–24 (2012). 135. Bjedov, I. et al. Mechanisms of Life Span Extension by Rapamycin in the Fruit Fly Drosophila melanogaster. Cell Metab. 11, 35–46 (2010). 136. Kaeberlein, M. et al. Regulation of yeast replicative life span by TOR and Sch9 in response to nutrients. Science (80-. ). 310, 1193–6 (2005). 137. Accili, D. et al. Early neonatal death in mice homozygous for a null allele of the insulin receptor gene. Nat. Genet. 12, 106–9 (1996). 138. Liu, J. P., Baker, J., Perkins, A. S., Robertson, E. J. & Efstratiadis, A. Mice carrying null mutations of the genes encoding insulin-like growth factor I (Igf-1) and type 1 IGF receptor (Igf1r). Cell 75, 59–72 (1993). 139. Long, X. et al. TOR deficiency in C. elegans causes developmental arrest and intestinal 130 atrophy by inhibition of mRNA translation. Curr. Biol. 12, 1448–61 (2002). 140. Kimura, K., Tissenbaum, H., Liu, Y. & Ruvkun, G. daf-2, an insulin receptor-like gene that regulates longevity and diapause in Caenorhabditis elegans. Science (80-. ). 277, 942–946 (1997). 141. O’Rourke, E. J., Soukas, A. A., Carr, C. E. & Ruvkun, G. C. elegans major fats are stored in vesicles distinct from lysosome-related organelles. Cell Metab. 10, 430–5 (2009). 142. Shmookler Reis, R. J. et al. Modulation of lipid biosynthesis contributes to stress resistance and longevity of C. elegans mutants. Aging (Albany. NY). 3, 125–47 (2011). 143. Malone, E. A. & Thomas, J. H. A screen for nonconditional dauer-constitutive mutations in Caenorhabditis elegans. Genetics 136, 879–86 (1994). 144. Larsen, P. L., Albert, P. S. & Riddle, D. L. Genes that regulate both development and longevity in Caenorhabditis elegans. Genetics 139, 1567–83 (1995). 145. Ren, P. et al. Control of C. elegans larval development by neuronal expression of a TGF- beta homolog. Science 274, 1389–91 (1996). 146. Greer, E. R., Pérez, C. L., Van Gilst, M. R., Lee, B. H. & Ashrafi, K. Neural and molecular dissection of a C. elegans sensory circuit that regulates fat and feeding. Cell Metab. 8, 118–31 (2008). 147. Clark, J. F., Meade, M., Ranepura, G., Hall, D. H. & Savage-Dunn, C. Caenorhabditis elegans DBL-1/BMP Regulates Lipid Accumulation via Interaction with Insulin Signaling. G3 (Bethesda). 8, 343–351 (2018). 148. Escorcia, W., Ruter, D. L., Nhan, J. & Curran, S. P. Quantification of Lipid Abundance and Evaluation of Lipid Distribution in Caenorhabditis elegans by Nile Red and Oil Red O Staining. J. Vis. Exp. (2018). doi:10.3791/57352 149. Kehl, T. et al. RegulatorTrail: a web service for the identification of key transcriptional regulators. Nucleic Acids Res. 45, W146–W153 (2017). 131 150. Sloan, C. A. et al. ENCODE data at the ENCODE portal. Nucleic Acids Res. 44, D726– D732 (2016). 151. Anders, S. & Huber, W. Differential expression analysis for sequence count data. Genome Biol. 11, R106 (2010). 152. Angeles-Albores, D; Lee, RYN; Chan, J; Sternberg, P. Two new functions in the WormBase Enrichment Suite. Micropublication Biol. Dataset.ht, (2018). 153. Clough, E. & Barrett, T. in Methods in molecular biology (Clifton, N.J.) 1418, 93–110 (2016). 154. Tao, J., Ma, Y.-C., Yang, Z.-S., Zou, C.-G. & Zhang, K.-Q. Octopamine connects nutrient cues to lipid metabolism upon nutrient deprivation. Sci. Adv. 2, e1501372 (2016). 155. Van Gilst, M. R., Hadjivassiliou, H. & Yamamoto, K. R. A Caenorhabditis elegans nutrient response system partially dependent on nuclear receptor NHR-49. Proc. Natl. Acad. Sci. U. S. A. 102, 13496–501 (2005). 156. Kawasaki, I., Jeong, M.-H., Yun, Y.-J., Shin, Y.-K. & Shim, Y.-H. Cholesterol-responsive metabolic proteins are required for larval development in Caenorhabditis elegans. Mol. Cells 36, 410–6 (2013). 157. MacNeil, L. T., Watson, E., Arda, H. E., Zhu, L. J. & Walhout, A. J. M. Diet-induced developmental acceleration independent of TOR and insulin in C. elegans. Cell 153, 240–252 (2013). 158. Kimble, J. & Sharrock, W. J. Tissue-specific synthesis of yolk proteins in Caenorhabditis elegans. Dev. Biol. 96, 189–96 (1983). 159. Schneider, W. J. Vitellogenin receptors: oocyte-specific members of the low-density lipoprotein receptor supergene family. Int. Rev. Cytol. 166, 103–37 (1996). 160. Lynn, D. A. et al. Omega-3 and -6 fatty acids allocate somatic and germline lipids to ensure fitness during nutrient and oxidative stress in Caenorhabditis elegans. Proc. Natl. Acad. Sci. 112, 201514012 (2015). 132 161. Zugasti, O. & Ewbank, J. J. Neuroimmune regulation of antimicrobial peptide expression by a noncanonical TGF-beta signaling pathway in Caenorhabditis elegans epidermis. Nat. Immunol. 10, 249–56 (2009). 162. Morita, K. et al. A Caenorhabditis elegans TGF-beta, DBL-1, controls the expression of LON-1, a PR-related protein, that regulates polyploidization and body length. EMBO J. 21, 1063–73 (2002). 163. Maduzia, L. L. et al. lon-1 regulates Caenorhabditis elegans body size downstream of the dbl-1 TGF beta signaling pathway. Dev. Biol. 246, 418–28 (2002). 164. Suzuki, Y. et al. A BMP homolog acts as a dose-dependent regulator of body size and male tail patterning in Caenorhabditis elegans. Development 126, 241–50 (1999). 165. Savage-Dunn, C. & Padgett, R. W. The TGF-β Family in Caenorhabditis elegans. Cold Spring Harb. Perspect. Biol. 9, a022178 (2017). 166. Zhang, X. & Zhang, Y. DBL-1, a TGF-β, is essential for Caenorhabditis elegans aversive olfactory learning. Proc. Natl. Acad. Sci. U. S. A. 109, 17081–6 (2012). 167. Ramakrishnan, K., Ray, P. & Okkema, P. G. CEH-28 activates dbl-1 expression and TGF-β signaling in the C. elegans M4 neuron. Dev. Biol. 390, 149–59 (2014). 168. Schroeder, E. A. & Brunet, A. Lipid Profiles and Signals for Long Life. Trends Endocrinol. Metab. 26, 589–592 (2015). 169. Bustos, V. & Partridge, L. Good Ol’ Fat: Links between Lipid Signaling and Longevity. Trends Biochem. Sci. 42, 812–823 (2017). 170. Khaodhiar, L., McCowen, K. C. & Blackburn, G. L. Obesity and its comorbid conditions. Clin. Cornerstone 2, 17–31 (1999). 171. Apovian, C. M. Obesity: definition, comorbidities, causes, and burden. Am. J. Manag. Care 22, s176-85 (2016). 172. Cheng, F. W. et al. Body mass index and all-cause mortality among older adults. Obesity (Silver Spring). 24, 2232–9 (2016). 133 173. Winter, J. E., MacInnis, R. J., Wattanapenpaiboon, N. & Nowson, C. A. BMI and all- cause mortality in older adults: a meta-analysis. Am. J. Clin. Nutr. 99, 875–90 (2014). 174. Böttcher, Y. et al. Adipose tissue expression and genetic variants of the bone morphogenetic protein receptor 1A gene (BMPR1A) are associated with human obesity. Diabetes 58, 2119–28 (2009). 175. Fain, J. N., Tichansky, D. S. & Madan, A. K. Transforming growth factor beta1 release by human adipose tissue is enhanced in obesity. Metabolism. 54, 1546–51 (2005). 176. Jo, H., Shim, J., Lee, J. H., Lee, J. & Kim, J. B. IRE-1 and HSP-4 contribute to energy homeostasis via fasting-induced lipases in C. elegans. Cell Metab. 9, 440–8 (2009). 177. Heilbronn, L. K. & Ravussin, E. Calorie restriction and aging: review of the literature and implications for studies in humans. Am. J. Clin. Nutr. 78, 361–9 (2003). 178. Redman, L. M. et al. Metabolic Slowing and Reduced Oxidative Damage with Sustained Caloric Restriction Support the Rate of Living and Oxidative Damage Theories of Aging. Cell Metab. 27, 805–815.e4 (2018). 179. Raught, B., Gingras, A. C. & Sonenberg, N. The target of rapamycin (TOR) proteins. Proc. Natl. Acad. Sci. U. S. A. 98, 7037–44 (2001). 180. Schulenburg, H. & Ewbank, J. J. The genetics of pathogen avoidance in Caenorhabditis elegans. Mol. Microbiol. 66, 563–70 (2007). 181. Neueder, A. et al. A local role for the small ribosomal subunit primary binder rpS5 in final 18S rRNA processing in yeast. PLoS One 5, e10194 (2010). 182. Valášek, L. S. et al. Embraced by eIF3: structural and functional insights into the roles of eIF3 across the translation cycle. Nucleic Acids Res. 45, 10948–10968 (2017). 183. Scheers, H., Jacobs, L., Casas, L., Nemery, B. & Nawrot, T. S. Long-Term Exposure to Particulate Matter Air Pollution Is a Risk Factor for Stroke: Meta-Analytical Evidence. Stroke 46, 3058–66 (2015). 184. Casanova, R. et al. A Voxel-Based Morphometry Study Reveals Local Brain Structural 134 Alterations Associated with Ambient Fine Particles in Older Women. Front. Hum. Neurosci. 10, 495 (2016). 185. Chen, T., Jia, G., Wei, Y. & Li, J. Beijing ambient particle exposure accelerates atherosclerosis in ApoE knockout mice. Toxicol. Lett. 223, 146–153 (2013). 186. McConnell, R. et al. A Longitudinal Cohort Study of Body Mass Index and Childhood Exposure to Secondhand Tobacco Smoke and Air Pollution: The Southern California Children’s Health Study. Environ. Health Perspect. 123, 360–366 (2015). 187. Wolf, K. et al. Association Between Long-term Exposure to Air Pollution and Biomarkers Related to Insulin Resistance, Subclinical Inflammation, and Adipokines. Diabetes 65, 3314–3326 (2016). 188. Hamra, G. B. et al. Outdoor Particulate Matter Exposure and Lung Cancer: A Systematic Review and Meta-Analysis. Environ. Health Perspect. 122, 906–911 (2014). 189. Liu, X. et al. Association of Exposure to particular matter and Carotid Intima-Media Thickness: A Systematic Review and Meta-Analysis. Int. J. Environ. Res. Public Health 12, 12924–40 (2015). 190. Aguilera, I. et al. Particulate Matter and Subclinical Atherosclerosis: Associations between Different Particle Sizes and Sources with Carotid Intima-Media Thickness in the SAPALDIA Study. Environ. Health Perspect. 124, 1700–1706 (2016). 191. Cacciottolo, M. et al. Particulate air pollutants, APOE alleles and their contributions to cognitive impairment in older women and to amyloidogenesis in experimental models. Transl. Psychiatry 7, e1022 (2017). 192. Cheng, H. et al. Urban traffic-derived nanoparticulate matter reduces neurite outgrowth via TNFα in vitro. J. Neuroinflammation 13, 19 (2016). 193. Forman, H. J. & Finch, C. E. A critical review of assays for hazardous components of air pollution. Free Radic. Biol. Med. 117, 202–217 (2018). 194. Woodward, N. C. et al. Traffic-related air pollution impact on mouse brain accelerates 135 myelin and neuritic aging changes with specificity for CA1 neurons. Neurobiol. Aging 53, 48–58 (2017). 195. Morgan, T. E. et al. Glutamatergic neurons in rodent models respond to nanoscale particulate urban air pollutants in vivo and in vitro. Environ. Health Perspect. 119, 1003– 9 (2011). 196. Davis, D. A. et al. Prenatal exposure to urban air nanoparticles in mice causes altered neuronal differentiation and depression-like responses. PLoS One 8, e64128 (2013). 197. Cheng, H. et al. Nanoscale Particulate Matter from Urban Traffic Rapidly Induces Oxidative Stress and Inflammation in Olfactory Epithelium with Concomitant Effects on Brain. Environ. Health Perspect. 124, 1537–1546 (2016). 198. Leung, M. C. K. et al. Caenorhabditis elegans: An Emerging Model in Biomedical and Environmental Toxicology. Toxicol. Sci. 106, 5–28 (2008). 199. Scientific Frontiers in Developmental Toxicology and Risk Assessment. (National Academies Press, 2000). doi:10.17226/9871 200. Kaletta, T. & Hengartner, M. O. Finding function in novel targets: C. elegans as a model organism. Nat. Rev. Drug Discov. 5, 387–98 (2006). 201. Antoshechkin, I. & Sternberg, P. W. The versatile worm: genetic and genomic resources for Caenorhabditis elegans research. Nat. Rev. Genet. 8, 518–32 (2007). 202. Duclairoir Poc, C. et al. Caenorhabditis elegans: a model to monitor bacterial air quality. BMC Res. Notes 4, 503 (2011). 203. Anbalagan, C. et al. Transgenic nematodes as biosensors for metal stress in soil pore water samples. Ecotoxicology 21, 439–55 (2012). 204. Anbalagan, C. et al. Use of transgenic GFP reporter strains of the nematode Caenorhabditis elegans to investigate the patterns of stress responses induced by pesticides and by organic extracts from agricultural soils. Ecotoxicology 22, 72–85 (2013). 136 205. Hunt, P. R., Olejnik, N. & Sprando, R. L. Toxicity ranking of heavy metals with screening method using adult Caenorhabditis elegans and propidium iodide replicates toxicity ranking in rat. Food Chem. Toxicol. 50, 3280–90 (2012). 206. Zhao, Y., Wu, Q., Tang, M. & Wang, D. The in vivo underlying mechanism for recovery response formation in nano-titanium dioxide exposed Caenorhabditis elegans after transfer to the normal condition. Nanomedicine 10, 89–98 (2014). 207. Liu, S., Saul, N., Pan, B., Menzel, R. & Steinberg, C. E. W. The non-target organism Caenorhabditis elegans withstands the impact of sulfamethoxazole. Chemosphere 93, 2373–80 (2013). 208. Saul, N., Chakrabarti, S., Stürzenbaum, S. R., Menzel, R. & Steinberg, C. E. W. Neurotoxic action of microcystin-LR is reflected in the transcriptional stress response of Caenorhabditis elegans. Chem. Biol. Interact. 223, 51–7 (2014). 209. Smith, M. A. et al. Impacts of chronic low-level nicotine exposure on Caenorhabditis elegans reproduction: identification of novel gene targets. Reprod. Toxicol. 40, 69–75 (2013). 210. Moore, C. E., Lein, P. J. & Puschner, B. Microcystins alter chemotactic behavior in Caenorhabditis elegans by selectively targeting the AWA sensory neuron. Toxins (Basel). 6, 1813–36 (2014). 211. Sprando, R. L., Olejnik, N., Cinar, H. N. & Ferguson, M. A method to rank order water soluble compounds according to their toxicity using Caenorhabditis elegans, a Complex Object Parametric Analyzer and Sorter, and axenic liquid media. Food Chem. Toxicol. 47, 722–8 (2009). 212. Misra C, Kim S, Shen S, S. C. Design and evaluation of a high-flow rate, very low pressure drop impactor for separation and collection of fine from ultrafine particles. J Aerosol Sci. 33, 736–752 (2002). 213. An, J. H. & Blackwell, T. K. SKN-1 links C. elegans mesendodermal specification to a 137 conserved oxidative stress response. Genes Dev. 17, 1882–93 (2003). 214. Bowerman, B., Eaton, B. A. & Priess, J. R. skn-1, a maternally expressed gene required to specify the fate of ventral blastomeres in the early C. elegans embryo. Cell 68, 1061– 75 (1992). 215. Green, R. M. et al. Impact of cigarette smoke exposure on innate immunity: a Caenorhabditis elegans model. PLoS One 4, e6860 (2009). 216. Wang, X. et al. Exposure to Concentrated Ambient PM2.5 Shortens Lifespan and Induces Inflammation-Associated Signaling and Oxidative Stress in Drosophila. Toxicol. Sci. 156, 199–207 (2017). 217. Zhang, H. et al. Nrf2-regulated phase II enzymes are induced by chronic ambient nanoparticle exposure in young mice with age-related impairments. Free Radic. Biol. Med. 52, 2038–46 (2012). 218. Crook-McMahon, H. M., Oláhová, M., Button, E. L., Winter, J. J. & Veal, E. A. Genome- wide screening identifies new genes required for stress-induced phase 2 detoxification gene expression in animals. BMC Biol. 12, 64 (2014). 219. Zhang, X. et al. Associations of oxidative stress and inflammatory biomarkers with chemically-characterized air pollutant exposures in an elderly cohort. Environ. Res. 150, 306–19 (2016). 220. Stone, V. et al. Nanomaterials Versus Ambient Ultrafine Particles: An Opportunity to Exchange Toxicology Knowledge. Environ. Health Perspect. 125, 106002 (2017). 221. Brown, D. M. et al. Calcium and ROS-mediated activation of transcription factors and TNF-α cytokine gene expression in macrophages exposed to ultrafine particles. Am. J. Physiol. Cell. Mol. Physiol. 286, L344–L353 (2004). 222. Baulig, A. et al. Role of Paris PM(2.5) components in the pro-inflammatory response induced in airway epithelial cells. Toxicology 261, 126–35 (2009). 223. Gilmour, P. S. et al. Adverse health effects of PM10 particles: involvement of iron in 138 generation of hydroxyl radical. Occup. Environ. Med. 53, 817–22 (1996). 224. Woodward, N. C. et al. Toll-like receptor 4 in glial inflammatory responses to air pollution in vitro and in vivo. J. Neuroinflammation 14, 84 (2017). 225. SALVI, S. et al. Acute Inflammatory Responses in the Airways and Peripheral Blood After Short-Term Exposure to Diesel Exhaust in Healthy Human Volunteers. Am. J. Respir. Crit. Care Med. 159, 702–709 (1999). 226. Zhang, X., Chen, X. & Zhang, X. The impact of exposure to air pollution on cognitive performance. Proc. Natl. Acad. Sci. 115, 9193–9197 (2018). 227. Hornsten, A. et al. APL-1, a Caenorhabditis elegans protein related to the human beta- amyloid precursor protein, is essential for viability. Proc. Natl. Acad. Sci. 104, 1971–1976 (2007). 228. Ewald, C. Y., Raps, D. A. & Li, C. APL-1, the Alzheimer’s Amyloid precursor protein in Caenorhabditis elegans, modulates multiple metabolic pathways throughout development. Genetics 191, 493–507 (2012). 229. Rundle, A. et al. Association of childhood obesity with maternal exposure to ambient air polycyclic aromatic hydrocarbons during pregnancy. Am. J. Epidemiol. 175, 1163–72 (2012). 230. Sarasija, S. et al. Presenilin mutations deregulate mitochondrial Ca2+ homeostasis and metabolic activity causing neurodegeneration in Caenorhabditis elegans. Elife 7, (2018). 231. Gems, D. & Partridge, L. Stress-Response Hormesis and Aging: “That which Does Not Kill Us Makes Us Stronger”. Cell Metab. 7, 200–203 (2008). 232. Cypser, J. R. & Johnson, T. E. Multiple stressors in Caenorhabditis elegans induce stress hormesis and extended longevity. J. Gerontol. A. Biol. Sci. Med. Sci. 57, B109-14 (2002). 139 Acknowledgements Thank you to: My wife, Lauren Heath, for enduring through years of long distance. Her patience and love were truly invaluable through my graduate studies. I am fortunate to have a partner with whom I can discuss genetic pathways as well as theories on Game of Thrones endings. My P.I., mentor, colleague, and friend Sean Curran. He is an inspiration to me, and many others, for his constant positive attitude despite working in academia. The Curran lab past - Jackie, Dana, and Akshat - and present - Chia-An, Brett, Amy, Wilbur, Christian, James, and Nicole. It would be hard to ask for a better group of friends and colleagues. And to An especially, for sometimes being the only joy in coming to lab at all. My committee members Drs. John Tower, Carolyn Phillips, and Christian Pike. My parents Julie and Jan Dalton, my grandmother Lucile Lickteig, and my brother Joseph Dalton. And to those we've lost - my uncle Marty Lickteig and my grandparents William and Tobina Dalton. I consider myself extremely lucky to have a family with whom I can share my life, good and bad, and be loved all the same. My best friend Jason Steimel and his significant other Jenny Jirschefske. I hope I will always have such amazing friends as kind and reliable as these two. My previous undergraduate mentee, and current friend and Dungeon Master Jeremy Dietrich. I thank him for encouraging me to try new podcasts, books, and games and for reminding me that we're always capable of making new friends. Steve and Annette Gerus, who without their scholarship I may never have succeeded through my undergraduate studies. My undergraduate lab, Dr. Richard Neubig and my graduate mentor, Dr. Jason Kehrl, for their patience in turning me into a semi-competent scientist as well as for the excellent advice to apply to graduate school immediately. João Pedro de Magalhães. His article "How to Become a Biogerontologist" 140 (http://senescence.info/) was indispensable to me as an ignorant high school and undergraduate student. My graduate school friends and RPG buddies Ellen Quarles and Zuzana Kocsis. And finally to my high school chemistry teacher Dave Capron, who made me truly love science for the first time (by fighting off the exam dragons with periodic table shields, of course).

Abstract (if available)

Abstract Across organisms, manipulation of biosynthetic capacity arrests development early in life, but can increase health- and lifespan post-developmentally. Here we demonstrate that this developmental arrest is not sickness but rather a regulated survival program responding to reduced cellular performance. We inhibited protein synthesis by reducing ribosome biogenesis (rps-11/RPS11 RNAi), translation initiation (ifg-1/EIF3G mutation and egl-45/EIF3A RNAi), or ribosome progression (cycloheximide treatment), all of which result in a specific arrest at larval stage 2 of C. elegans development. This quiescent state can last for weeks—beyond the normal C. elegans adult lifespan—and is reversible, as animals can resume reproduction and live a normal lifespan once released from the source of protein synthesis inhibition. The arrest state affords resistance to thermal, oxidative, and heavy metal stress exposure. In addition to cell-autonomous responses, reducing biosynthetic capacity only in the hypodermis was sufficient to drive organism-level developmental arrest and stress resistance phenotypes. Among the cell non-autonomous responses to protein synthesis inhibition is reduced pharyngeal pumping that is dependent upon AMPK-mediated signaling. The reduced pharyngeal pumping in response to protein synthesis inhibition is recapitulated by exposure to microbes that generate protein synthesis-inhibiting xenobiotics, which may mechanistically reduce ingestion of pathogen and toxin. These data define the existence of a transient arrest-survival state in response to protein synthesis inhibition and provide an evolutionary foundation for the conserved enhancement of healthy aging observed in post-developmental animals with reduced biosynthetic capacity.

Linked assets

University of Southern California Dissertations and Theses

Conceptually similar

PDF

Genetic basis of diet-dependent responses across the lifespan in Caenorhabditis elegans

PDF

The role of mitochondria in the male reproductive capacity of Caenorhabditis elegans

PDF

Regulation of Caenorhabditis elegans small RNA pathways: an examination of Argonaute protein RNA binding and post-translational modifications in C. elegans germline

PDF

SKN-1 coordination of stress adaptation, metabolism, and resource allocation in Caenorhabditis elegans

PDF

WDR23-mediated regulation of the DNA damage response, oxidative stress resistance, and glucose metabolism

PDF

Dissecting novel roles for MAFR-1 in reproduction and metabolic homeostasis

PDF

Phenotypic and multi-omic characterization of novel C. elegans models of Alzheimer's disease

PDF

Defining novel molecular mechanisms to restore balance of a stress response homeostat across spatial and temporal boundaries

PDF

Alpha-ketoglutarate, an endogenous metabolite, extends lifespan and compresses morbidity in aging mice

PDF

SIMR-1 facilitates robust silencing of piRNA target loci in the C. elegans germline

PDF

Genetic and molecular analysis of a rhythmic behavior in C. elegans: how neuropeptide signaling conveys temporal information

PDF

Characterizing the physiological roles and regulatory mechanisms of Maf1

PDF

C. elegans topoisomerase II regulates chromatin architecture and DNA damage for germline genome activation

PDF

The role of the proteasome & its regulators in adaptation to oxidative stress

PDF

Physiological strategies of resilience to environmental change in larval stages of marine invertebrates

PDF

To adapt or not to adapt: the age-specific and sex-dependent differences in the adaptive stress response

PDF

The role of translocator protein (TSPO) in mediating the effects of mitotane in human adrenocortical carcinoma cells

PDF

Medicinal chemistry and chemical biology approaches to improve the selectivity and potency of kinase inhibitors

PDF

Using chemical biology approaches to investigate the consequences of protein concentration and activity in cancer cells

Asset Metadata

Creator Dalton, Hans Martin (author)

Core Title Characterization of genetic and physiological responses to environmental stress in Caenorhabditis elegans across the lifespan

School College of Letters, Arts and Sciences

Degree Doctor of Philosophy

Degree Program Molecular Biology

Publication Date 11/12/2018

Defense Date 10/24/2018

Publisher University of Southern California (original), University of Southern California. Libraries (digital)

Tag aging,Caenorhabditis elegans,Evolution,OAI-PMH Harvest,protein synthesis,ribosome

Format application/pdf (imt)

Language English

Contributor Electronically uploaded by the author (provenance)

Advisor Curran, Sean (committee chair), Phillips, Carolyn (committee member), Pike, Christian (committee member), Tower, John (committee member)

Creator Email hansmdalton@gmail.com,hdalton@usc.edu

Permanent Link (DOI) https://doi.org/10.25549/usctheses-c89-106370

Unique identifier UC11675554

Identifier etd-DaltonHans-6964.pdf (filename),usctheses-c89-106370 (legacy record id)

Legacy Identifier etd-DaltonHans-6964.pdf

Dmrecord 106370

Document Type Dissertation

Format application/pdf (imt)

Rights Dalton, Hans Martin

Type texts

Source University of Southern California (contributing entity), University of Southern California Dissertations and Theses (collection)

Access Conditions The author retains rights to his/her dissertation, thesis or other graduate work according to U.S. copyright law. Electronic access is being provided by the USC Libraries in agreement with the a...

Repository Name University of Southern California Digital Library

Repository Location USC Digital Library, University of Southern California, University Park Campus MC 2810, 3434 South Grand Avenue, 2nd Floor, Los Angeles, California 90089-2810, USA