University of Southern California Dissertations and Theses

Renin-angiotensin system modulation for the prevention and treatment of metabolic dysfunction

(USC Thesis Other)

Renin-angiotensin system modulation for the prevention and treatment of metabolic dysfunction

PDF

Download a page range

Download transcript

Copy asset link

Request this asset

Transcript (if available)

Content 1

RENIN-ANGIOTENSIN SYSTEM MODULATION FOR THE PREVENTION AND
TREATMENT OF METABOLIC DYSFUNCTION

A Thesis Presented to the
FACULTY OF THE USC SCHOOL OF PHARMACY
UNIVERSITY OF SOUTHERN CALIFORNIA
In Partial Fulfillment of the Requirements for the Degree
MASTER OF SCIENCE
(CLINICAL AND EXPERIMENTAL THERAPEUTICS)

By Tamar Amzaleg
University of Southern California
December 2018

Thesis Committee:
Dr. Kathleen Rodgers
Dr. Stan Louie
Dr. Christina Dieli-Conwright

Copyright 2018 Tamar Amzaleg
2

Dedication
I dedicate this thesis to my beloved grandparents and role models,
RAOUL AND DENISE LOKIEC

3

Acknowledgements
I would like to thank my advisor, Dr. Kathleen Rodgers, for giving me the opportunity to learn and
develop as a scientist in her laboratory. Thank you to all my lab mates and colleagues for your friendships
and help along the way. Thank you to all my committee members and advisors, Dr. Daryl Davies, Dr.
Stan Louie, and Dr. Christina Dieli-Conwright, for your mentorship throughout my time at USC and for
all your time and suggestions for this thesis. A special thanks to Dr. Isaac Asante for his tremendous
helpfulness and advice throughout the years.
I would also like to thank my entire family who always stood by me, and especially my parents for their
unconditional love and support, and for teaching me by example to work hard for what I aspire to achieve.
To my children and husband, thank you for being the light in my life. Yonatan, thank you for being my
rock and for your unwavering love and support throughout the challenges of graduate school and life.

4

Table of Contents
Dedication…………………………………………………………………………………………………2
Acknowledgements…………………………………………………………………………………… ….3
Table of Contents………………………………………………………………………………………….4
List of Figures…………………………………………………………………………………………......5
List of Tables……………………………………………………………………………………………...7
List of Abbreviations……………………………………………………………………………………...8
Abstract…………………………………………………………………………………………………..10
Chapter 1: Angiotensin-(1-7) ameliorates metabolic disease in the db/db mouse model of
T2D………………………………………………………………………………………………………11
Introduction…………………………………………………………………………………...…11
Materials and Methods………………………………………………….……………………....20
Results………………………………………………………………………….…………….....23
Discussion………………………………………………………………………….…………...32
Chapter 2: RAS inhibitors may improve metabolic outcomes in obese, hypertensive breast cancer
survivors at risk for T2D………………................................................................................................38
Introduction…………………………………………………………………………………......38
Materials and Methods……………………………………………………………………...…..43
Results………………………………………………………………………………….…..…...48
Discussion……………………………………………………………………………................62
References………………………………………………………………………………………………66

5

List of Figures
Figure 1.1. Global diabetes epidemic is projected to increase………………………………………11
Figure 1.2. Infiltration of macrophages and their contribution to a proinflammatory state in WAT
induces insulin resistance............................................................................................…..13
Figure 1.3. Inhibition of insulin signaling via activation of inflammatory pathways…………..……14
Figure 1.4. The Renin-Angiotensin System (RAS)…………………………………………………..16
Figure 1.5. Activation of TLR4 in addition to cytokine receptors results in activation of NF-κB......17
Figure 1.6 Fasting blood glucose levels (FBG) were measured from the saphenous vein................23
Figure 1.7. Insulin plasma levels and insulin positive area in the pancreas were not affected by
A(1-7)……………………………………………………………………………..…......24
Figure 1.8. Body weights and adipocyte area were increased in the diabetic animals compared
to Htz controls………..……………………………..…………………………………..25
Figure 1.9. Monocyte chemoattractant protein (MCP-1) expression was attenuated in WAT of
db/db mice treated with A(1-7)…………………………………………………....…...26
Figure 1.10. Markers of macrophage infiltration into WAT of db/db mice were quantified using
gene expression studies…………………………………………...………………..…..27
Figure 1.11. Expression levels of pro- and anti-inflammatory cytokines in WAT were not
significantly affected by A(1-7) treatment in db/db mice………………………..……28
Figure 1.12. Triglyceride levels were measured in the plasma, in the liver, and in the skeletal muscle
to determine the effects of A(1-7) treatment on ectopic lipid accumulation in db/db
mice……………………………………………………………..………………….…..29
Figure 1.13. Markers of oxidative stress in WAT were attenuated by A(1-7) treatment in db/db
mice……………………………………..……………………………………….…......30
Figure 1.14. TLR4 and NFκB expression were slightly decreased by A(1-7) in WAT of db/db
mice………………………………………………………………………….…………31
Figure 2.1. RAS Modifying Drugs Mechanism of Action…………………………………………40
Figure 2.2. Systemic cytokine levels measured in plasma baseline samples were lower in patients
taking RAS modifying BP medications compared to those taking calcium channel
blockers………………………………………………..………………………….……48
Figure 2.3. Body composition assessments and grading for the metabolic syndrome were
significantly improved by 16 week exercise intervention……………………………..50
Figure 2.4. Systemic and adipose tissue markers of inflammation were significantly reduced
by 16 week exercise intervention………………………………………...……..……..51
6

Figure 2.5. Markers of metabolic health were significantly altered by 16 week exercise
intervention………………………………………………………………………...…53
Figure 2.6. Body composition assessments and grading for the metabolic syndrome were improved
by RAS modifying BP medications………………………………………………..…55
Figure 2.7. Systemic and adipose tissue markers of inflammation were altered by RAS modifying
BP medications……………………………………………………………….…........57
Figure 2.8. Markers of metabolic health were improved by RAS modifying BP medications......60

7

List of Tables
Table 1.1. Primer sequences for qRT-PCR………………………………………………………22
Table 2.1. Significance in ANCOVA Tests in Between Subject Effects for Body Composition
Assessments and Grading for the Metabolic Syndrome……………………………...56
Table 2.2. Significance in ANCOVA Tests in Between Subject Effects for Systemic and Adipose
Tissue Inflammatory Markers………………………………………………………..59
Table 2.3. Significance in ANCOVA Tests in Between Subject Effects for Markers of Metabolic
Health………………………………………………………………………………...61

8

List of Abbreviations
AAMs alternatively activated macrophages
ACE angiotensin converting enzyme
ACE2 angiotensin converting enzyme 2
Ang II angiotensin II
A(1-7) angiotensin-(1-7)
AP-1 activator protein-1
ARBs angiotensin II receptor blockers
AT1 receptor angiotensin II type I receptor
AT2 receptor angiotensin II type II receptor
ATMs adipose tissue macrophages
BC breast cancer
BP blood pressure
BMI body mass index
CaB calcium channel blockers
CAMs classically activated macrophages
CBL change from baseline
CDC Centers for Disease Control and Prevention
CLS crown like structures
ER endoplasmic reticulum
FFAs free fatty acids
FBG fasting blood glucose
GSK glycogen synthase kinase
HFD high fat diet
HOMA-IR Homeostatic Model Assessment of Insulin Resistance
Htz heterozygous
9

HSC-RP1 C-reactive protein
IFN interferon
IKK inhibitor of nuclear factor (NF)-κB (IκB) kinase
IL Interleukin
JNK c-Jun N-terminal kinases
IRS insulin receptor substrate
LPS lipopolysaccharide
MetS metabolic syndrome
MCP-1 monocyte chemoattractant protein-1
NADPH nicotinamide adenine dinucleotide phosphate
NF-κB Nuclear factor kappa B
NOX NADPH oxidase
OS oxidative stress
PI3K phosphatidylinositol-3-kinase
PA-1 plasminogen activator inhibitor-1
RAS Renin Angiotensin System
ROS reactive oxygen species
SEM standard error of the mean
SOD superoxide dismutase
T2D type 2 diabetes mellitus
TARE traditional aerobic and resistance exercise
TLRs toll-like receptors
TNF tumor necrosis factor
WC waist circumference
WAT white adipose tissue
WHEL Women’s Health and Exercise Laboratory
10

Abstract
The prevalence of the metabolic syndrome (MetS), a cluster of health conditions which include obesity,
hypertension, glucose intolerance, insulin sensitivity, and a poor lipid profile, is increasing at an alarming
rate. It contributes to the development of type 2 diabetes (T2D), cardiovascular disease, and death, and is
known to affect certain vulnerable populations, such as breast cancer (BC) survivors, increasing their risk
for cancer recurrence. While exercise has been proven to be an effective strategy for the prevention and
treatment of these conditions, some individuals are not compliant with this intervention, and current
medications have proven insufficient. Although the etiology of the MetS and T2D are complex and
remain poorly understood, pathologies associated with obesity, including oxidative stress (OS) and
inflammation of adipose tissue resulting from infiltration of proinflammatory macrophages, have been
shown to be involved in the pathogenesis of these conditions. Studies have shown that the renin
angiotensin system (RAS) plays a key role in metabolic regulation. Chronic activation of the pathological
arm of the RAS, of which the key peptide hormone is angiotensin II (Ang II), has been associated with
OS and inflammation leading to impairment of glucose and lipid metabolism in rodent models of MetS
and T2D. Hence, the development of new therapeutic targets which modulate the RAS might be a viable
strategy for the prevention and treatment of the MetS and metabolic diseases. In this thesis, we
investigated the potential of RAS modifying therapies, which oppose the action of Ang II, to ameliorate
severe metabolic disease in a rodent model of T2D, and to improve metabolic health in a clinical
population of BC survivors. As described in the first chapter of this thesis, we used a mouse model of
severe diabetes, (db/db) mice, to analyze the role of Angiotensin-(1-7)[A(1-7)], a counter-regulatory
hormone to Ang II, in ameliorating the metabolic disturbances associated with T2D. As described in the
second chapter of this thesis, we assessed in a population of hypertensive, obese BC survivors the effects
of taking RAS modifying blood pressure (BP) medications, including ACE inhibitors and angiotensin II
receptor blockers (ARBs), on inflammation and metabolic outcomes, comparing these to the effects of a
non-RAS modifying BP drug. In the animals, A(1-7) treatment significantly reduced fasting blood
glucose (FBG) levels and reduced markers of proinflammatory macrophage infiltration in adipose tissue.
This phenomenon may be associated with a reduction in OS also observed in these animals treated with
A(1-7). In the clinical population, RAS inhibition via the BP control medications showed promise in
decreasing inflammation and improving metabolic health, especially when combined with an exercise
regimen. Altogether, these data suggest that modulation of the RAS may be a beneficial therapeutic
strategy in the treatment of severe diabetes and metabolic disorders, and for the prevention of the
development of metabolic disease in certain vulnerable populations, such as BC survivors. Further
research into the RAS can yield future novel therapies that can be used alongside lifestyle interventions,
such as exercise, to dramatically enhance the health of those at risk for serious metabolic disease and its
consequences.
.

.

11

Chapter 1: Angiotensin-(1-7) ameliorates metabolic disease in the db/db mice model of T2D

Introduction
Type 2 Diabetes, Insulin Resistance, and Obesity
Type 2 Diabetes Mellitus (T2D), a metabolic disease resulting from the body’s inability to respond
normally to insulin, has become an illness with staggering costs. In the United States (US), about 30
million people, or 1 in 11 Americans, are currently affected by diabetes (Centers for Disease Control and
Prevention (CDC), 2015), while the global prevalence was estimated in 2014 to be 422 million,
representing almost 10% of the world’s population. In addition, the number of cases of diabetes is
projected to increase by 55% by 2035 (International Diabetes Federation, 2013) (Table 1.1). The disease
poses a major financial burden; it was estimated in 2017 that $327 billion, or 1 in 4 US healthcare dollars,
are annually spent treating T2D and its complications (American Diabetes Association, 2018). Yet while
T2D signifies a major public health problem, it lacks sufficient treatment options. Despite currently
available medications, many diabetic patients still struggle to regulate their blood glucose levels. Chronic,
uncontrolled hyperglycemia is a major cause of severe and life-threatening complications in working age
adults in the US, including blindness, end-stage kidney failure, lower limb amputations, strokes, and

Figure 1.1. Global diabetes epidemic is projected to increase. Report from the International Diabetes
Federation indicates that about 382 million people are living with diabetes, and predicts that this number
will increase by 55% by 2035. Downloaded from the International Diabetes Federation (www.idf.com)
on June 7, 2018.

12

cardiovascular disease. Causing more than 200,000 deaths per year, T2D is one of the leading causes of
mortality in the U.S. (CDC National Diabetes Statistics Report, 2017).
The main pathogenic mediator of T2D is insulin resistance, a state in which insulin sensitive tissues
(including adipose tissue, liver, and skeletal muscle) fail to respond to normal circulating levels of insulin.
The consequence of both genetic and environmental factors, insulin resistance leads to an increased
demand for insulin by insulin resistant tissues, which results in the expansion of pancreatic beta cells and
the hypersecretion of insulin. In certain genetically predisposed individuals, this expansion and
hypersecretion of insulin takes a toll on the β cells, rendering them unable to meet the increased demand
for insulin. This can result in β cell failure and death, the outcome of which is glucose intolerance that can
quickly progresses to T2D (Cusi et al., 2010).
One of the major risk factors for the development of insulin resistance and T2D is obesity resulting from
chronic overeating and physical inactivity. In fact, about 90% of people currently living with T2D are
obese or overweight (World Health Organization, 2013). The dramatic increase in the occurrence of T2D
in the US has been attributed to the rapid rise in prevalence of obesity. The National Center for Health
Statistics reported in 2014 that 70.7% of adults in the US are overweight or obese and that 47.4% of
children and adolescents in the US are obese (CDC, 2016). Various studies have confirmed the long-term
detrimental health impacts of childhood obesity, which include premature death in adulthood, due to the
development of T2D and heart disease (Cusi et al., 2010). It’s been widely accepted that excess visceral
fat, the type found around the organs and in the omentum, as opposed to excess subcutaneous fat which is
largely located under the skin and muscles, is the type of fat which poses the significant health risks in
obesity (Qiang et al., 2016). Dysfunction of adipocytes resulting from excess visceral fat plays a center
role in the pathophysiology of T2D, and amelioration of these abnormalities may be a promising target in
the treatment and prevention of T2D.
Adipose Tissue Macrophages (ATMs)
Once believed to be a passive depot for energy storage, white adipose tissue (WAT) is now recognized as
a dynamic and complex organ comprising of various cells types with diverse metabolic, endocrine, and
immune functions. Signaling products secreted by WAT are known as adipokines and cover a broad
spectrum of effects. Of the diverse cell types in WAT are macrophage subpopulations, whose survival
and differentiation are controlled by local signals produced within WAT. These macrophages are a
heterogeneous population that can alter their phenotypes from pro- to anti-inflammatory in response
stimuli in the local environment (Dalmas et al., 2011). In lean mice, the predominant macrophage
population is the anti-inflammatory type, known as M2-like or alternatively activated macrophages
13

(AAMs). These tissue resident immune cells contribute to WAT homeostasis, for instance, by promoting
local insulin sensitivity through the production of anti- inflammatory cytokines, including Arginase I (Arg
I) and interleukin (IL)-10 (Olefsky & Glass et al., 2010).
In contrast, obesity is considered a chronic, low grade inflammatory state, associated with the recruitment
and infiltration of proinflammatory M1-like macrophages, or classically activated macrophages (CAMs),
into WAT. These are functionally distinct from their M2 counterparts and are typically found in a ring-
like configuration surrounding large dying adipocytes, known as crown like structures(CLS)(Lumeng et
al., 2008). M1-like macrophages have been identified in fluorescent-activated cell sorting (FACS)
analysis to be triply positive for cell surface markers F4/80, CD11b, and CD11c, while M2 macrophages
have been found to express F4/80 and CD11b, but not CD11c (Nguyen et al., 2007). These
proinflammatory CD11c+ macrophages secrete inflammatory factors including tumor--necrosis-factor-α
(TNFα), IL-1β, IL-6, leukotriene B4 (LTB4), and nitric oxide (Lumengl et al., 2007), which interfere with
normal metabolic processes and which are implicated in the development of insulin resistance and T2D
(Tateya et al., 2013) (Fig 1.2.).

Figure 1.2. Infiltration of macrophages and their contribution to a proinflammatory state in WAT
induces insulin resistance. (A) In the lean state, M2-like resident macrophages contribute to WAT tissue
homeostasis by secreting IL-10. (B) Adipocyte hypertrophy caused by chronic overeating and lack of
exercise triggers MCP-1 secretion from WAT, resulting in macrophage infiltration and their differentiation
into M1-like macrophages, which secrete proinflammatory cytokines that can leak out of WAT and cause
insulin resistance in the liver and skeletal muscle. Reproduced with permission from Tateya et al. 2013.
14

Figure 1.3. Inhibition of insulin signaling via activation of
inflammatory pathways. Proinflammatory cytokine
production by invading macrophages in WAT activates kinases
JNK and IKKβ, which can trigger serine phosphorylation of
IRS-1, leading to ubiquitination and degradation of IRS-1 and
to the inhibition of the insulin signaling pathway. These kinases
can also further exacerbate the inflammatory state through the
activation of transcription factors AP-1 and NF-κB, resulting in
a positive feedback loop of inflammation. Reproduced with
permission from Carter-Kent et al., 2008.

The link between ATM recruitment and Insulin Resistance
It is widely believed that WAT inflammation resulting from macrophage infiltration plays a major role in
the development of obesity related complications, including systemic and WAT insulin resistance. In
animal models, elevated macrophage numbers in WAT correlated with an impairment of glucose
homeostasis (Dalmas et al., 2011). Similarly, clinical trials have shown a positive association between
systemic insulin resistance and a CD11c positive cell population in WAT (Wentworthert al., 2010). It
appears as though the key link between infiltration and insulin resistance is the overproduction of
proinflammatory cytokines in obese WAT, mainly by the infiltrating macrophages and also by
adipocytes. Xu et al reported that the expression of macrophage specific proinflammatory genes in WAT
of obese mice preceded a striking increase in insulin production, and that treatment in these mice with
rosiglitazone, an insulin-sensitizing agent, decreased the expression of these genes (Xu et al., 2003). The
appearance of these inflammatory cytokines right before the development of insulin resistance suggests
that they may play a role in promoting insulin resistance and other obesity related
complications(Greenberg & Obin et al., 2006).
Many studies have shown that the disproportionately large production of proinflammatory cytokines by
macrophages in obese WAT results in the attenuation of insulin signaling, starting locally in WAT, and
following that, also in other insulin sensitive tissues, such as the liver and skeletal muscle. TNF-α is one
of the proinflammatory cytokines secreted
by ATMs which plays a major role in the
pathogenesis of insulin resistance and
impaired glucose uptake (Kohlgruber &
Lynch et al., 2015). Its effects on insulin
resistance have led to the discovery of a
major intracellular pathway involved in
the inhibition of insulin signaling, the
IKKβ–NF-κB (inhibitor of nuclear factor
(NF)-κB (IκB) kinase-β) and the JNK–
AP1 (Jun N-terminal kinase– activator
protein-1) signaling pathways. In response
to inflammatory signals, the kinases JNK
and IKKβ are activated and can trigger
serine phosphorylation of IRS-1 (Insulin
Receptor Substrate-1) by the insulin
15

receptor, which blocks the insulin signaling cascade and impairs glucose homeostasis (ibid). These
inflammatory kinases not only inhibit the insulin cascade, but they also activate the downstream
transcription factors AP-1 and NF-κB, which leads to the continued production of proinflammatory
cytokines, further propagating the inflammatory state that potentiates insulin resistance (Carter-Kent et
al., 2008) (Figure 1.3.)
In addition, these large quantities of proinflammatory cytokines can leak out of WAT and act in an
endocrine fashion to induce insulin resistance in peripheral insulin sensitive tissues, such as the skeletal
muscle and liver, also by serine/threonine phosphorylation of IRS-1(Osborn & Olefsky et al., 2012).
Agreeing with this theory, studies have shown that elevated circulating level of inflammatory markers are
indicative of T2D risk (McNelis & Olefsky et al., 2014). Macrophage infiltration into WAT also promotes
excess release of free fatty acids (FFAs) and ectopic lipid accumulation, which can also lead to
interference with insulin signaling and insulin resistance (Guilherme et al., 2008) . Hence, although
macrophage subpopulations in lean adipose tissue are contributors to metabolic health, it is widely
recognized that in obesity, WAT macrophage are major contributors to insulin resistance and T2D. Thus,
therapeutic interventions that target WAT macrophage infiltration may be a potential target for the
treatment and prevention of inflammation induced metabolic dysfunction in obesity and T2D.
Factors Contributing to Recruitment of ATMs: Dysregulation of the Renin Angiotensin System
Since insulin resistance is largely the consequence of the immune cell induced inflammatory state in
WAT that inhibits insulin signaling and other adipocyte functions, understanding the mechanisms
involved in ATM recruitment is critical. The secretion of potent chemoattractants by WAT in obesity
promotes the recruitment of monocytes to WAT and their differentiation into M1 macrophages (Dalmas
et al., 2011). Once recruited, these macrophages themselves secrete additional inflammatory mediators,
setting off a feed-forward loop that propagates the inflammatory state and further attracts more
macrophages (McNelis & Olefsky et al., 2014). To date, MCP-1 (monocyte chemoattractant protein) and
its receptor CCR2 have been the best chemokine ligand and receptor studied for the role they play in
obesity associated recruitment of macrophages into WAT. Yu et al. demonstrated that the expression of
MCP-1 is increased in WAT of LepR
db/db
, Lep
ob/ob
and diet induced obese mice, and that it correlates with
an increased expression of macrophage markers F4/80 and CD68 (Yu et al., 2006). This suggests that this
chemokine may play a role in macrophage recruitment. Other chemoattractants that recruit macrophages
to WAT include LTB4, MIP-1α, RANTES, interferon-g (IFN-ƴ), and CXCL14(McNelis & Olefsky,
2014)(Cusi, 2010). The mechanisms that lead to the secretion of these chemoattractants during obesity
and T2D have not been fully elucidated, although there are various theories as to which factors may play
a role. Upstream investigation of inflammatory cytokines revealed that the kinases JNK and IKK are
16

major contributors to the stimulation of inflammation in metabolic tissues. Activation of these kinases and
their downstream signaling cascades are markedly elevated in obese WAT compared to lean controls
(Kohlgruber & Lynch et al., 2015). Similarly, toll-like receptors (TLRs) of the innate immune system are
also activated in obese adipose tissue compared with lean controls (Mantell et al., 2011).
What triggers the activation of these inflammatory mediators? Various factors have been proposed to play
a role in ATM recruitment to hypertrophied adipocytes, including fatty acid flux, hypoxia, adipocyte cell
death, and endoplasmic reticulum (ER) stress (Surmi & Hasty et al., 2008). Recent studies have
delineated a potential role for the pathological arm of the Renin-Angiotensin System (RAS) in immune
mediated disturbances of WAT implicated in the development of insulin resistance and T2D.
Traditionally known as a major regulator of body fluid and cardiovascular homeostasis, the classical RAS
consists of various enzymatic cascades leading to the synthesis of angiotensin II (Ang II), a key effector
of the RAS. This occurs through cleavage of angiotensinogen by renin to angiotensin I and its subsequent
cleavage by the angiotensin converting enzyme (ACE) to Ang II (Dominici et al., 2014) (Figure 1.4). Ang
II is likely the main player of the pathological arm of the RAS; it mediates its effects mainly by binding to
the Ang II type 1 (AT1) receptor, which include vasoconstriction as well as pro-inflammatory, pro-
oxidative, proliferative and hypertrophic effects. Recent studies have shown that Ang II, AT1 receptor,
and other components of the RAS are fully expressed in insulin sensitive tissues, including visceral WAT,
and that alterations within the local WAT RAS are implicated in metabolic dysregulation (Passos-Silva et
al., 2013).

Figure 1.4. The Renin-Angiotensin System (RAS): pathways leading to the synthesis of the two key
peptide hormones of the RAS, Angiotensin II (Ang II) and Angiotensin (1-7) [A(1-7)], and their
respective receptors. A(1-7) has been shown to counteract the AT1 receptor mediated deleterious effects
of Ang II by binding the MAS receptor. Reproduced with permission from Dominici et al., 2014.
17

Figure 1.5. Activation of TLR4 in addition to
cytokine receptors results in activation of NF-κB.
This results in the transcription of a host of inflammatory
factors, the interference of insulin signaling, and the
secretion of chemokines, such as MCP-1, which are
responsible for macrophage recruitment into WAT.
Reproduced with permission from Lê et al., 2011.

The Pathological Role of Ang II in WAT Inflammation
One of these alterations, a hallmark of T2D, is an increased secretion of Ang II by adipocytes (Cassis et
al., 2008). It is widely known that angiotensin peptides are prominent among adipokines and that Ang II
in particular plays a role in regulating adipocyte differentiation, lipid metabolism, and the secretion of
chemokines that promote inflammation of WAT. Infusion of Ang II into rats increased gene expression
and protein levels of WAT MCP-1 (ibid). Others have shown that AT1 receptor activation induces the
expression of MCP-1 and CCR2, promoting inflammation of WAT (Ghigliotti et al., 2014). Moreover,
inhibition of Ang II with an AT1 receptor antagonist in an obese, diabetic mouse model resulted in a
decreased expression of proinflammatory cytokines, concurrent with a decrease in glucose levels and an
improvement in insulin sensitivity (Iwai et al., 2007). One way by which Ang II modulates the
inflammatory process in WAT and the infiltration of macrophages is through the activation of NF-κB, a
major initiator of the inflammatory response. Activation of NF-κB occurs through AT1 receptor
stimulation, resulting in the production of various proinflammatory cytokines, including TNF-α, IL-6, IL-
8, MCP-1, and plasminogen activator inhibitor-1 (PA-1) (Ferder et al., 2006). TLR4 is another activator
of the NF-κB pathway resulting in macrophage recruitment and the downregulation of insulin signaling
(Lê et al., 2011) (Figure 1.5).
It has also been confirmed that Ang II may have
an indirect effect on NF-κB activity that involves
the production of reactive oxygen species
(ROS)(Ferder et al., 2006). Oxidative stress (OS)
has been implicated in the development of the
insulin resistant state by various studies which
showed that treatments reducing ROS can
enhance insulin sensitivity (Han et al., 2016).
Evidence suggests that adipocyte hypertrophy,
which results from nutrient overload, is
associated with increased ROS production,
promoting WAT dysfunction and metabolic
complications. One important source of ROS
production in hypertrophied adipocytes is
nicotinamide adenine dinucleotide phosphate
(NADPH) oxidase enzymes, of which NADPH
18

oxidase (NOX) 4 is the primary isoform in WAT. Numerous studies have implicated Ang II in the
increased production of NADPH oxidase in obese and diabetic WAT (Dominici et al., 2014). OS resulting
from abnormally elevated ROS production, is strongly implicated in the propagation of the inflammatory
state by causing dysregulated secretion of adipokines (Han, 2016). Studies show that exposure of
adipocytes to ROS leads to altered adipokine levels, such as the upregulation of proinflammatory
cytokines and chemokines, including PA-1 and IL-6, and MCP-1 and a decrease in the secretion of
adiponectin, an anti-inflammatory adipokine. This can occur through the activation by ROS of NF-κB
(Ferder et al 2006). Significantly, studies in rodent models of metabolic disease have shown that
treatment with antioxidants regulates adipokine secretion and improves diabetes (Hurrle et al., 2017).
Collectively, it can be concluded that locally derived Ang II is an important instigator of insulin resistance
and T2D via its pro-oxidative and pro-inflammatory effects. A plethora of evidence points to the peptide
as the key link in the development and propagation of insulin resistance. Clinical trials have accordingly
shown that inhibition of ACE or blockade of AT1 receptor improves glycaemic control in diabetic
patients and reduces the risk of developing diabetes (Abuissa et al., 2005).
The ACE2/A(1-7)/MAS Receptor Protective Arm of the RAS
Another peptide of the RAS with biological activity, which can be produced through cleavage of Ang II
by the action of the ACE2 enzyme, is Angiotensin-(1-7) [A(1-7)]. A key member in the protective arm of
the RAS, A(1-7) binds the MAS receptor, a G-protein-coupled receptor (GPCR), to mediate its effects,
which broadly oppose Ang II actions in pathological conditions. These effects include vasodilation and
reducing OS and inflammation as well as anti-hypertrophic and anti-proliferative effects. Interestingly,
studies show that the MAS receptor is highly expressed in metabolic tissues, and particularly in WAT,
with A(1-7) treatment (Muñoz et al., 2012). In addition, studies have demonstrated that ACE2 is
expressed in WAT (Cassis et al., 2008). This suggests that both Ang II and A(1-7) can be found in WAT,
and that the balance between them may influence local WAT function. Since, in metabolic disease, the
balance appears to be tilted towards increased levels of Ang II, which plays a major role in the
pathogenesis of disease, pharmacological administration of A(1-7) may have highly beneficial effects in
treatment of metabolic disease.
Indeed, recent studies have shown the therapeutic role of A(1–7) in treating and preventing metabolic
diseases. Increased circulating levels of A(1-7) in a transgenic rat model enhanced glucose tolerance and
insulin sensitivity (Bilman et al., 2012; Santos et al., 2010). Oral administration of A(1-7) in a rat model
of T2D improved glycemic control and prevented hyperinsulinemia (Santos et al., 2014). The
improvement in glucose tolerance and insulin sensitivity in many of these cases occurred in conjunction
with an improvement in obesity related WAT disturbances. In fructose fed rats, A(1-7) treatment reduced
19

immune cell infiltration into WAT and decreased NADPH oxidase activity (Marcus et al., 2013). A recent
study has shown that Ang-(1–7) stimulated glucose transport and decreased OS in 3T3-L1 adipocytes
(Liu et al., 2012). Moreover, A(1-7) decreased the expression of the proinflammatory markers COX-2 and
IL-1β in WAT of transgenic rats on a high fat diet (HFD)(Santos et al., 2012). In animal models of insulin
resistance, A(1-7) counteracted Ang II mediated inhibition of insulin signaling and enhancing insulin
signaling in insulin sensitive tissues (Dominici et al., 2014). This was associated with a reduction of JNK
activity and decreased serine phosphorylation of IRS-1.
Evidence suggests that the mechanisms involved in A (1-7)’s protective actions may involve inhibition of
Ang II mediated OS and inflammation in WAT. However, these mechanisms have not been fully
elucidated and require further investigation. Furthermore, a majority of these studies have used mice
models of MetS and have not assessed the effects of A(1-7) on advanced diabetic disease. A(1-7) is
currently in clinical development for the treatment of cytopenias, a side-effect of myelosuppressive cancer
treatment. It has already been shown to be safe in safety studies, in which even high doses elicited no
severe adverse effects (Rodgers, Oliver, & DiZerega et al., 2006). It has been administered to
heterozygous mice without any effects on the studied markers. Since WAT is the source of the
pathologies associated with the development of insulin resistance and T2D, the goal of this study was to
investigate the protective effects of 8 weeks of administration of A(17) on obesity and diabetic related
metabolic disturbances in WAT . Using db/db mice, a severely diabetic mouse model, we studied the
effects of the peptide on inflammation and OS in this tissue in order to assess the role it may play in the
amelioration of insulin resistance, the primary pathogenic mediator of T2D.

20

Materials and Methods
Animals
Eight week old male BKS.Cg-Dock7m+/+ Leprdb/J (db/db) mice and their age-matched heterozygous
controls (Htz) were purchased from Jackson Laboratories (Bar Harbor, ME). Mice were kept on a 12h
light/dark cycle with food and water available ad libitum. The diabetic (db/db) mice were randomized into
two treatment groups, either vehicle (saline) or A(1-7) (500 ug per kg of animal) and the heterozygous
control mice were used as a healthy control and were treated with vehicle (saline). Pharmaceutical grade
A(1-7) was purchased from Bachem (Torrance, CA, USA) and formulated with sterile water for injection.
Treatments were administered daily via subcutaneous injection for 8 weeks, after which the mice were
sacrificed for tissue collection.

Measurements of Body Weight and Fasting Blood Glucose (FBG) Concentration
Three days prior to necropsy, following an overnight fast (~12 hours), FBG levels were measured in mice
using a hand-held blood glucometer (FreeStyle Lite) from a drop of blood obtained from the saphenous
vein. Body weights were monitored before treatments began and at necropsy.

Tissue Collection
At necropsy, mice were overdosed with ketamine/xylazine and sacrificed with cervical dislocation. Blood
was collected by cardiac puncture using a 23-gauge needle into EDTA coated tubes. Insulin sensitive
tissues including visceral adipose tissue, skeletal muscle (gastrocnemius), pancreas, and liver were
quickly excised. Half of each of the tissues was either fixed in formalin for embedding and the other half
was flash frozen in liquid nitrogen and stored at −80 °C for mRNA and protein analysis.

Reverse transcription and qRT-PCR
Relative mRNA expression was measured using Reverse-Transcriptase quantitative polymerase chain
reaction (RT-qPCR). Total RNA was extracted from 150-200 mg of adipose tissue using RNAzol
®
RT
reagent (Sigma-Aldrich, St. Louis, MO) according to manufacturer’s protocol. RNA was treated with
DNase using the TURBO DNA-free Kit (Life Technologies, Carlsbad, CA) to remove contaminating
DNA. cDNA was synthesized from the RNA template unit the Revert-Aid Reverse Transcription Kit
(Thermo Fischer, Waltham, MA). RT-qPCR was performed using the Applied Biosystems 7300 Real
Time PCR System and Maxima SYBR Green/ROX qPCR Master Mix reagents (Thermo Fischer,
Waltham, MA) using the manufacturer’s protocol. The primers used for qPCR are listed in Table 1.1.
Data were normalized with the mRNA levels of RPS29 which themselves did not significantly change in
response to treatment.
21

Protein Quantification of MCP-1 and Proinflammatory Cytokines in Adipose Tissue
Protein quantification in adipose tissue was measured using a multi-array technology from MesoScale
Diagnostics (Rockville, MD, USA), which uses an electrochemiluminescence detection method. For
adipose tissue preparation, ~100 mg of tissue was weighed and homogenized using a bullet blender (Next
Advance Inc., Troy, NY) in a 0.1% Triton X-100 solution supplemented with Halt™ Protease Inhibitor
Cocktail (100X) and 1x EDTA (Thermo Fisher Scientific, Grand Island, NY). Samples were incubated on
ice for 30 minutes and then centrifuged for 5 min at 20,000 x g at 4°C. A sterile toothpick was utilized to
pierce the fat layer and remove the supernatant. The total protein concentration in the sample was
measured using the Pierce™ BCA Protein Assay Kit (Thermo Fisher Scientific, Grand Island, NY).
MCP-1 and proinflammatory cytokines protein concentrations were measured using a Mouse U-
PLEX MCP-1 assay and a V-PLEX Proinflammatory Panel 1 Mouse Kit (Rockville, MD, USA),
respectively. 100 µg of sample was added/well in duplicates. Assays were performed in accordance to
manufacturer’s protocol. Plates were read and analyzed using a Sector S 600 analyzer (Meso Scale
Diagnostics, Rockville, MD, USA).
Circulating and Tissue Triglycerides and Insulin Levels
Following blood collection, plasma was immediately isolated by centrifugation and stored at −80°C for
downstream analysis. Plasma insulin was measured using a mouse Ultra Sensitive ELISA assay
(ChrystalChem, Elk Grove Village, IL) and plasma, liver, and skeletal muscle triglycerides were
measured using a Triglyceride Colorimetric Assay Kit (ChrystalChem, Elk Grove Village, IL), according
to the manufacturers’ protocols.

H&E Staining and Immunohistocehmistry
Adipose tissue specimen were fixed overnight in 10% neutral buffered formalin, embedded in paraffin,
and sectioned at 4 µm. Pancreas specimens were fixed overnight in 10% neutral buffered formalin,
embedded in paraffin, and sectioned at 5 µm. Adipose tissue sections were stained with hematoxylin and
eosin (H&E) for evaluation of adipocyte diameter. Ten random fields were acquired from each section at
40× magnification. Cross-area of 10-15 adipocytes was measured using freehand selection in ImageJ
(1.47v, NIH, USA). For immunohistochemical analyses of the pancreas, monoclonal antibody against
insulin was used (Santa Cruz Biotechnology, USA). Following de-paraffinization in xylene and hydration
in graded alcohols, a standard heat-induced antigen retrieval procedure was carried out. Briefly, sections
were incubated in citrate solution, pH 6.0 (Biogenex, USA) inside a pressure cooker and were pressurized
in a microwave. Following a 1 hr incubation in blocking buffer (2.5% goat serum in PBS), sections were
22

incubated with primary antibody (1:100) overnight at 4°C. Secondary antibody incubation was performed
using appropriate secondary antibody (biotinylated goat anti-rabbit IgG; Vector Laboratories, USA) and
an avidin-biotin complex method was used for detection (VECTASTAIN Elite ABC HRP Kit, Vector
Laboratories, USA). Hematoxylin was used as a counter-stain. Images were acquired using a Zeiss Axio
Scope.A1 microscope (Carl Zeiss Microscopy, Jena, Germany) equipped with a Nikon Zeiss Axiocam
503 color digital camera and visualization software, Zeiss Zen Blue (Carl Zeiss Microscopy). 15-20
pictures of each pancreas section were taken at 10x magnification and were analyzed using ImageJ
software (1.47v, NIH, USA), which was used to measure the insulin positive area of the pancreas
relative to the total pancreas.
Statistical analysis
Statistical analyses were performed using GraphPad Prism Version 6, and data was expressed as mean
value ± standard error of the mean (SEM). One Way Analysis of Variance (ANOVA) followed by
Dunnett’s multiple comparisons test was used to compare groups to selected control. P values less than
0.05 were considered significant (*p<0.05).

Table1.1 Primer Sequences for qRT-PCR
Primer Forward Sequence Reverse Sequence
RPS29 GAAGCCTATGTCCTTCGCGT TCTGATCCGCAAATACGGGC
IL-6 CTGGTCTTCTGGAGTACCATAGC CTCTGAAGGACTCTGGCTTTGT
IL-10 GGGTTGCCAAGCCTTATCGG AGGGTCTTCAGCTTCTCACC
TNFα GTGGGTGAGGAGCACGTAG CAACCAACTAGTGGTGCCAG
TLR4 ACTCAGCAAAGTCCCTGATGAC CTTCAAGGGGTTGAAGCTCAG
NF-κB p150 GGTCCTTCCTGCCCATAACC CATCCTTCCGCAAACTCAGC
NOX4 TCATTTGGCTGTCCCTAAACG AGTAGTATTCTGGCCCTTGGT
CD68 CTTCCCACAGGCAGCACAG AATGATGAGAGGCAGCAAGAGG-
CD11b GGGAGGACAAAAACTGCCTCA ACAACTAGGATCTTCGCAGCAT
CD11c ATGTTGGAGGAAGCAAATGG CCTGGGAATCCTATTGCAGA
F4/80 TGACTCACCTTGTGGTCCTAA CTTCCCAGAATCCAGTCTTTCC
MCP-1 CCACTCACCTGCTGCTACTCAT TGGTGATCCTCTTGTAGCTCTCC
gp91
phox
TTGGGTCAGCACTGGCTCTG TGGCGGTGTGCAGTGCTATC
p22
phox
GTCCACCATGGAGCGATGTG CAATGGCCAAGCAGACGGTC
p40
phox
GCCGCTATCGCCAGTTCTAC GCAGGCTCAGGAGGTTCTTC
23

Results
A (1-7) treatment in db/db mice significantly reduced fasting blood glucose levels (FBG). Hyperglycemia
is a hallmark of T2D, caused by insulin resistance, the inability to properly use insulin to regulate blood
glucose levels. As expected, FBG measured from the saphenous vein of db/db mice treated with saline
was significantly higher compared to their heterozygous, age-matched controls (Figure 1.6). Remarkably,
db/db mice that were treated with A(1-7) had significantly lower FBG levels compared to diabetic mice
treated only with saline. Although A(1-7) treated mice did not restore FBG levels to normal, as the FBG
levels of A(1-7) treated mice was still significantly higher than those of the heterozygous, healthy
controls, nevertheless, these data suggest that A(1-7) treatment may have a positive effect on
hyperglycemia via a mechanism that may involve improvement of insulin resistance. This is in agreement
with others who have shown that A(1-7) enhances glucose tolerance and improves insulin sensitivity in
rodent models of the MetS and T2D (Munoz, et al., 2012; Marcus, et al., 2013; Santos, et al., 2014).
However, this is the first time that such a dramatic decrease in FBG was observed with A(1-7) treatment
in this severe db/db diabetic model.

Insulin Secretion and β Cell Area was not significantly altered by A(1-7) treatment in non-fasting db/db
mice treated with A(1-7). Although the interplay between insulin secretion, insulin resistance, and blood
glucose levels is complex and depends on a variety of factors, it has been established in both animal and
human studies that the inability of the pancreatic β cells to compensate for the increased need for insulin

Figure 1.6 Fasting blood glucose (FBG) levels were measured from the saphenous vein. FBG levels in
diabetic animals treated with saline were significantly elevated competed to heterozygous controls. A(1-7)
significantly reduced FBG levels in db/db mice compared to saline treated mice. *p<0.05, **p<0.01,
***p<0.001, ****p<0.0001, calculated using one-way ANOVA; plotted as mean ± SEM.
24

Figure 1.7. Insulin plasma levels and insulin positive area in the pancreas were not affected by A(1-7).
Secreted insulin in the plasma measured via an ELISA assay (A) and insulin positive area measured via
immunohistochemistry (B) were not affected by A(1-7) treatment. *p<0.05, **p<0.01, ***p<0.001,
****p<0.0001 calculated using one-way ANOVA; plotted as mean ± SEM.
in insulin resistant individuals is a crucial step in the development of T2D (Cavaghan et al., 2000). To
assess the effects of A(1-7) treatment on insulin production and secretion in db/db mice, circulating
insulin levels were measured in the plasma of the animals using an ELISA assay, and pancreatic beta cell
area was quantified by measuring insulin positive area in pancreas sections stained with an insulin
monoclonal antibody (Figure 1.7). As expected, both circulating insulin levels and β cell area were
significantly higher in diabetic mice compared to the heterozygous controls, which can be explained by
the increased demand for insulin in insulin resistant animals that causes an expansion of beta cell mass
and a hypersecretion of insulin (ibid). Our data show that A(1-7) treatment in the diabetic animals did not
significantly affect neither secretion of insulin nor β cell area, indicating that the peptide likely did not
cause a reduction in FBG in the db/db mice by enhancing the capacity of the β cell to produce and secrete
insulin in order to compensate for the increased demand for insulin caused by insulin resistance in
diabetic animals. It may suggest that rather, A(1-7)’s effects on blood glucose levels may be the result of
its enhancement of insulin sensitivity or amelioration of insulin resistance in insulin target tissues,
although this requires further investigation.
25

A(1-7) had no effect on body mass and adipocyte diameter in db/db mice. db/db mice have a
deficiency in their leptin receptor, which is important for signaling satiety upon leptin binding. As a
result, these mice become obese between 4-8 weeks of age due to chronic overeating. Measurement of
body weights at necropsy show the significant differences in body weights of db/db animals compared to
their heterozygous controls (Figure 1.8A). A(1-7) treatment did not decrease body mass of the treated
db/db mice. The metabolic stress of obesity causes hypertrophy of adipocytes in adipose tissue, which
plays a major role in the development of obesity associated complications, mainly, the development of
insulin resistance. Evidently, the adipocyte diameter of the obese, diabetic animals was significantly
higher than those of their age matched heterozygous controls, but A(1-7) treatment had no effect on this
parameter (Figure 1.8B). This implies that A(1-7)’s mechanism of its amelioration of elevated FBG in
db/db mice did not involve a reduction in weight accumulation or a decrease in adipocyte hypertrophy.
Figure 1.8. Body weights and adipocyte area were increased in the diabetic animals compared to Htz
controls. There were no significant changes in body weights (A) or in adipocyte area (B) with A(1-7)
treatment compared to saline treatment in the db/db animals. *p<0.05, **p<0.01, ***p<0.001,
****p<0.0001 calculated using one-way ANOVA; plotted as mean ± SEM.

26

A(1-7) significantly reduced MCP-1 levels in the adipose tissue of db/db mice. One of the consequences
of adipocyte hypertrophy in obesity and diabetes is the secretion of MCP-1 by adipocytes, which plays a
key role in the infiltration of macrophages into adipose tissue (Tateya et al., 2013). Both gene expression
(A) and protein levels (B) of MCP-1 in adipose tissue were elevated in db/db mice treated only with
saline compared to the heterozygous controls (Figure 1.9). Interestingly, A(1-7) significantly decreased
MCP-1 protein levels in db/db mice compared to db/db mice treated only with saline. In a similar fashion,
gene expression of MCP-1 was also reduced, and while this reduction is not considered significant, it
comes very close to being so (p=0.0556). Infiltration of macrophages into adipose tissue in obesity and
diabetes is one of the primary drivers of insulin resistance. It results in the development of a
proinflammatory state in adipose tissue that is associated with interference of the insulin signaling
cascade via the inhibition of IRS-1(Gregor et al., 2011).

Figure 1.9. Monocyte chemoattractant protein (MCP-1) expression was attenuated in WAT of db/db mice
treated with A(1-7). Gene expression levels of MCP-1 (A) in WAT were elevated in db/db saline treated animals
compared to Htz controls and were decreased with A(1-7) treatment. The same pattern was observed in protein
expression of MCP-1 (B), although with protein, the changes were significant. p<0.05, **p<0.01, ***p<0.001,
calculated using one-way ANOVA; plotted as mean ± SEM.

27

Markers of Pan and M1 (Proinflammatory) Macrophages were significantly decreased by A(1-7)
treatment in the db/db mice. Gene expression studies in adipose tissue revealed a significant reduction in
pan macrophage markers in AT from the db/db mice treated with A(1-7) compared to saline treated db/db
mice, including F4/80, CD68, and CD11b (Figure 1.10A,B,C). More significantly, CD11c, a cell surface
marker of the M1 type, or proinflammatory macrophages, was also significantly reduced in A(1-7) treated
diabetic mice (Figure 1.5D). All of these markers were significantly elevated in db/db mice treated with
saline compared to the heterozygous controls, and were normalized by A(1-7) treatment, suggesting the
peptide has a positive effect on macrophage infiltration into adipose tissue in these mice.
There were no significant changes in pro- and anti-inflammatory cytokines in WAT of db/db mice treated
with A(1-7). Despite the significant decreases in macrophage markers in the db/db adipose tissue of the

Figure 1.10. Markers of macrophage infiltration into WAT of db/db mice were quantified
using gene expression studies. Widely used markers of murine macrophage populations, F4/80,
CD68, and CD11b (1.5A,B,C), were significantly elevated in diabetic animals treated with saline
compared to Htz controls. A(1-7) reduced the expression of these pan macrophage markers, and
although only F4/80 showed a significant decrease, the other two markers were close to being
significantly decreased as well. CD11c, a marker of proinflammatory macrophages, found in
WAT during the development of insulin resistance, was significantly decreased by A(1-7) in the
db/db animals. p<0.05, **p<0.01, ***p<0.001, calculated using one-way ANOVA; plotted
as mean ± SEM.

28

A(1-7) treated animals, there were no significant changes in gene expression (Figure 1.11A) or protein
levels (Figure 1.11B) of adipose tissue proinflammatory (TNFα, IL12p70, IL-1β) or anti-inflammatory
cytokines (IL-10) between the A(1-7) and saline treated diabetic animals.

Figure 1.11. Expression levels of pro- and anti-inflammatory cytokines in WAT were not significantly
affected by A(1-7) treatment in db/db mice. Gene expression (A) of proinflammatory cytokines TNF-α and IL-6
and anti-inflammatory cytokine IL-10, were elevated in the diabetic mice compared to Htz controls, yet A(1-7)
treatment did not affect these cytokines. In a similar fashion, protein expression (B) of cytokines are increase
overall in the diabetic saline treated mice compared to Htz controls, and although there were some trends with A(1-
7) to decrease some inflammatory cytokines, mainly IL-12 and IFN-ƴ, there were no significant changes notes with
treatment. p<0.05, **p<0.01, ***p<0.001, calculated using one-way ANOVA; plotted as mean ± SEM.

29

A(1-7) did not prevent ectopic lipid accumulation in db/db mice. A consequence of adipose tissue
inflammation is elevated levels of circulating free fatty acids, which cause a buildup of ectopic lipids in
insulin sensitive tissues, such as the liver and skeletal muscle, which interfere with insulin stimulated
glucose transport, leading to insulin resistance in those tissues (Guilherme et al., 2008). Triglyceride
levels in the skeletal muscle, in the liver, and in the circulation were quantified in an ELISA assay, and
although there was a significant increase, as expected, in triglyceride levels in the diabetic mice treated
with saline compared to the healthy controls, A(1-7) did not significantly decrease levels in any of these
tissues, suggesting blood glucose lowering effects were not the result of a decrease in ectopic lipid
accumulation that results from WAT inflammation in this model (Figure 1.12).

Fig 1.12. Triglyceride levels were measured in the plasma, in the liver, and in the skeletal muscle to determine the
effects of A(1-7) treatment on ectopic lipid accumulation in db/db mice. No significant differences were observed
between the three groups in the plasma. In the liver and skeletal muscle, triglyceride levels were significantly higher in the
diabetic groups compared to the Htz control, but A(1-7) did not reduce this parameter. *p<0.05, ****p<0.0001, calculated
using one-way ANOVA; plotted as mean ± SEM.

30

A(1-7) treatment in db/db mice produced decreased trends in gene expression of OS markers. OS plays a
major role in obesity and diabetic related complications associated with insulin resistance, and it is
intrinsically associated with the development of an inflammatory state in adipose tissue. ROS are a
product of Ang II mediated activation of NADPH Oxidase, which is involved in the activation of
inflammatory pathways responsible for macrophage recruitment, most notably, the NF-κB pathway
(Ferder et al., 2006). NOX4 is the isoform of the enzyme that plays a major role in the development of
adipose tissue inflammation and insulin resistance(Hartigh et al., 2016). A(1-7) treatment in db/db mice
decreased the expression of NOX4 in adipose tissue (Figure 1.13A). Similar trends were observed in the
expression of the NADPH oxidase subunits p40
phox
, p22
phox
, and gp91
phox
(Figure 1.13B-D), suggesting
that attenuation OS may play a role in A(1-7)’s mechanism of improving adipocyte associated metabolic
disturbances.

Figure 1.13. Markers of OS in WAT were attenuated by A(1-7) treatment in db/db mice. Gene expression of NOX4,
the NADPH isoform most associated with WAT dysfunction leading to insulin resistance (A), and of the NADPH oxidase
subunits (B-D) were significantly higher in the db/db saline treated mice than the Htz mice. A(1-7) treatment in the db/db
mice resulted in decreased trends in these markers, and although not significant, followed a similar pattern.
*p<0.05, **p<0.01, calculated using one-way ANOVA; plotted as mean ± SEM.

31

A(1-7) restored to normal levels the expression of toll-like receptor4 (TLR4) and NF-κB, initiators of
inflammatory response leading to macrophage recruitment in db/db mice. The NF-κB pathway has been
implicated in the recruitment of macrophages into obese adipose tissue and has been shown to be
upregulated in individuals positive for crown like structures (CLS), a ring of macrophages surrounding
dead adipocytes (Le et al. 2011). One way the pathway is activated is through the activation of TLR4;
recent studies have linked Ang II to activation of NF-κB via a TLR4 dependent mechanism (Kalupahana
et al., 2012). The consequences of TLR4 and NF-κB activation are the transcription and secretion of
MCP-1, leading to the recruitment of macrophages into adipose tissue and the downregulation of insulin
signaling (Le et al. 2011). Gene expression analysis in adipose tissue shows the A(1-7) reduced the
expression of NF-κB and TLR4 close to heterozygous levels. db/db saline treated animals expression
levels were higher than both groups(Figure 1.14.). Although these changes were close to but not
significant, these trends in expression suggests that attenuation of this pathway may be part of A(1-7)’s
mechanism in reducing macrophage infiltration into WAT and that higher doses may potentially achieve a
more powerful effect.

Figure 1.14. TLR4 and NFκB expression were slightly decreased by A(1-7) in WAT of db/db mice. These
key initiators of the inflammatory response leading to macrophage infiltration into WAT were elevated in the
db/db mice treated with saline while A(1-7) attenuated their expression in WAT, although this reduction did
not reach significance. p<0.05 **p<0.01, ***p<0.001, calculated using one-way ANOVA; plotted as
mean ± SEM.

32

Discussion
In the past decade there has been a tremendous evolution in the understanding of the role obesity and
WAT play in the development of insulin resistance and T2D. WAT is more than simply an energy depot
but rather a dynamic endocrine organ that plays a major role in regulating metabolic homeostasis. Excess
energy intake which occurs in obesity is associated with adipocyte hypertrophy which is accompanied by
severe abnormalities and a massive infiltration of macrophages into WAT. This leads to a chronic, low
grade inflammatory state, marked by the dysfunctional secretion of proinflammatory cytokines and
adipokines (McNelis et al. 2014). These inflammatory mediators contribute to the development of insulin
resistance via the activation of inflammatory kinases that interfere with the insulin signaling pathways
(Gregor & Hotamisligil et al., 2011). Recently, it has been demonstrated that all the components of the
RAS, including the classical ACE/Ang II/AT1receptor arm as well as the alternative ACE 2/A(1-7)/MAS
receptor arm, are all expressed in rodent and human WAT (Slamkova, Zorad, & Krskova et al., 2016).
Ang II, the main effector of the classical RAS, has been implicated in the induction of the inflammatory
state in WAT that occurs in metabolic disease. In contrast, A(1-7), a peptide of the alternative RAS, with
counter-regulatory effects to Ang II, has shown great promise in the amelioration of the pathologies
causing insulin resistance and T2D, including the attenuation of Ang II mediated OS and inflammation.
Various studies have looked at the effects of A(1-7) on models of metabolic disease and have shown its
potential to improve metabolic health and ameliorate WAT related disturbances via binding to the MAS
receptor. However, most of these studies have been performed in models of the MetS, including rodents
on high fructose or high fat diets, and have not examined the effects of A(1-7) on the pathologies leading
to insulin resistance and T2D, mainly inflammation of WAT, in advanced diabetic disease. In addition,
the mechanisms of these newly discovered components of the RAS are complex and are not completely
understood, and hence require further investigation. In this study, we have examined the preliminary
effects of pharmacological, intravenous administration of A(1-7) for 8 weeks, on metabolic health and
WAT biology of BKS.Cg-Dock7m +/+ Leprdb/J mice, which are characterized by severe obesity,
hyperglycemia, and dyslipidemia. Even in this severe T2D model, which develops more serious
pathologies than a similar B6 db strain (B6.BKS(D)-Leprdb/J), and only survive up to 24
weeks, A(1-7) had a profound effect on metabolic health. FBG measured before necropsy showed
significant reductions in the A(1-7) treated diabetic group compared to the saline treated diabetic group.
These results demonstrated that A(1-7) may contribute to glucose homeostasis in this severe T2D model
and prompted us towards further investigation into the mechanisms that may be involved in this
regulation.
33

Evaluation of plasma collected at necropsy showed no significant changes in insulin levels between
treatment groups in diabetic animals. In addition, pancreatic beta cell area was not affected by A(1-7) in
the diabetic mice, indicating that A(1-7)’s mechanism of improving blood glucose levels may not involve
acting on the pancreas to enhance insulin production and release, but rather may be through amelioration
of pathologies implicated in insulin resistance. In any case, we concluded that enhancing insulin
sensitivity, rather than increasing insulin levels, is likely the best way to improve metabolic function in a
model of severe diabetes such as the db/db mouse, which has a diminished capability to respond to insulin
due to deficiencies in intracellular signaling mechanisms.
Although other studies have shown that A(1-7) may be involved in fat mass control, as in the case of
transgenic rats with increased circulating A(1-7) who exhibited a decrease in body weight while on a high
fat diet (Santos et al., 2012), in this model, body mass was not altered in the diabetic mice by A(1-7),
which could be due in part to the greater severity of the db/db model. Studies have suggested a role for
Ang II in the regulation of adipocyte formation, showing that increased levels of Ang II may lead to a
high proportion of large, dysfunctional adipocytes (Thatcher et al., 2009). Nevertheless, there was no
change in adipocyte area in the db/db mice on A(1-7) treatment, suggesting the blood glucose lowering
effects of the peptide in this model were not the result of less adipocyte hypertrophy. Rather, it might
target the downstream effects of hypertrophy, the abnormalities that might result from the dysregulated
expansion adipocytes. The effect of A(1-7) on this parameter in different models of metabolic disease has
been controversial, with some groups reporting a change with treatment (Marcus et al., 2013), while
others, in agreement with this study, observing no change (Santos et al., 2012). These disparities might be
attributed to differences in rodent models, pharmacological dosages, method and length of treatment.
One of the major consequences of obesity and adipocyte hypertrophy is the infiltration of macrophages
into WAT and their polarization into “M1-like,” or proinflammatory cells, overwhelming the tissue
resident “M2-like”, or anti-inflammatory macrophages, which contribute to tissue homeostasis in the lean
state. These M1 macrophages are responsible for propagating the chronic, low grade inflammatory state
of WAT and negatively influencing insulin sensitivity (Gregor & Hotamisligil et al., 2011). In this study,
we observed a significant change in protein and gene expression levels of MCP-1 in WAT with A(1-7)
treatment in the db/db mice, a chemokine that plays a key role in the recruitment of macrophages to
hypertrophied adipocytes. In addition, the gene expression of cell surface markers of macrophages F4/80,
CD11b, and M1 specific macrophage marker CD11c, were also significantly reduced by A(1-7) treatment
in the db/db mice.
34

Macrophages contribute to the inflammatory state in WAT by being a relentless source of
proinflammatory factors. These include proinflammatory cytokines such as TNF-α, IL-6, IL-1β, and
IFN-ƴ, which can activate inflammatory pathways, mainly the IKKβ–NF-κB and the JNK–AP1 signaling
pathways that lead to interference with insulin stimulated glucose transport via inhibitory phosphorylation
of IRS-1(Guilherme et al., 2008). Interestingly, there were no observed significant changes in the
expression of pro- and anti-inflammatory cytokines with A(1-7) treatment in the db/db animals, as would
be expected to result from a decrease in macrophage infiltration into fat. This is one of the weaknesses of
the present study; however it has been recently shown that administration of anti-TNFα antibody to
humans, or treatment with a TNFα antagonist, had little or no effect on insulin resistance (ibid), indicating
that perhaps these cytokines do not play such a defined role in the pathogenesis of this disease and that
attenuation of macrophage infiltration may improve metabolic health via an alternative mechanism rather
than through a reduction of these cytokines.
In addition to activation of inflammatory pathways that interfere with insulin signaling, one of the ways
by which infiltrating WAT macrophages can lead to insulin resistance is by causing elevated levels of
circulating FFAs. Studies have demonstrated a consistent association between high circulating FFAs and
peripheral insulin resistance in both humans and animals (Wills et al., 1963). Triglyceride overload during
chronic overeating leads to hypertrophied adipocytes with adverse adipokine and chemokine secretion
and the recruitment of macrophages, which contribute to the propagation of the inflammatory state. These
cytokines disrupt normal adipocyte metabolic functions, such as triglyceride deposition into adipocytes,
and enhance lipolysis, causing an excess of triglycerides and FFAs to leak out into the circulation and to
be taken up by peripheral insulin sensitive tissues such as the skeletal muscle. The ectopic lipids in insulin
sensitive tissues can interfere with insulin stimulated glucose transport and cause insulin resistance via
mechanisms involving several protein kinases, including JNK, IKKβ, protein kinase Cθ (PKCθ),
(mTORC1) and p70 ribosomal S6 kinase (p70S6K), which negatively regulate insulin signaling via
phosphorylation of IRS-1 at the serine residue. Intracellular lipid metabolites, such as fatty acyl-CoA and
diacylglycerol, activate PKC, can also inhibit insulin signaling via the same IRS-1 mediated mechanism
(Guilherme et al., 2008). To determine whether A(1-7) ameliorated ectopic lipid accumulation that may
be involved in propagating insulin resistance, we measured ectopic lipid accumulation by quantifying
triglyceride levels in the liver, the skeletal muscle, and in the circulation of the db/db mice. Although
there was a significant increase in all instances in the diabetic animals compared to the healthy htz
controls, A(1-7) had no effect on this parameter.
Since it does not appear as though A(1-7) ameliorated hyperglycemia in this model via a decrease in the
detrimentally high levels of FFAs, which are characteristic of this disease, another mechanisms to
35

consider is a direct modulation of A(1-7) on insulin signaling. Santos et al. showed a that an oral nano-
formulation of A(1-7) in a rat model of insulin resistance increased activation of the insulin receptor
signaling pathway in conjunction with a decrease in glucose and an improved insulin sensitivity (Santos
et al., 2014), a mechanism that involves inhibition of JNK, mTOR, and, potentially, ERK1(Dominici, et
al., 2014). Rats on a high fructose diet treated with 2 weeks of A(1-7) treatment had insulin stimulated
increases in the phosphorylation of Akt and AS160, two important components of the insulin signaling
cascade leading to glucose uptake in skeletal muscle and AT (Munoz et al., 2012). Due to the limited
scope of this study, the phosphorylation levels of the key molecules of the insulin signaling cascade,
including the insulin receptor, IRS-1, P13K (phosphatidylinositol-3-kinase), AKT, AS160 in myocytes
and adipocytes, and of the insulin receptor, IRS-1, P13K, AKT and glycogen synthase kinase (GSK)-3β
in the liver, were not measured in the db/db mice treated with A(1-7), and this warrants further studies.
Another mechanism by which A(1-7) may have improved high blood sugar is through attenuation of OS.
Various studies have suggested what is known as a negative crosstalk between Ang II and insulin
signaling, which occurs through serine phosphorylation of IRS-1 and results in a decrease in insulin
sensitivity and a reduction in glucose transport, with insulin resistance as a consequence. It has been
corroborated that this mechanism involves the generation of ROS, by which activation of NADPH
oxidase plays a pivotal role (Dominici et al., 2014). NADPH oxidases (NOX) are a family of membrane
bound enzymes which generate superoxide by transferring electrons from NADPH to oxygen (superoxide
is converted to a more stable ROS, hydrogen peroxide, by the enzyme superoxide dismutase
(SOD)(Bedard & Krause et al., 2007). Of the seven NOX isoforms, NOX4 has been found to be the major
one expressed in cultured murine and human adipocytes, its activity shown to increase in WAT during the
development of insulin resistance. Thus, in addition to potentially directly improving the phosphorylation
of insulin-related intracellular proteins, A(1-7)’s protective effects of insulin signaling may also occur
indirectly through a suppression of OS. The peptide’s ability to ameliorate OS has been confirmed in vitro
by Liu et al., whose group demonstrated a decrease in ROS production in 3T3-L1 adipocytes with
exogenous A(1-7) administration via a reduction in NADPH oxidase activity (Liu et al., 2012), and in
vivo by Marcus et al. who also showed a decrease in NADPH activity in rats on a high-fructose diet
treated with A(1-7)(Marcus et al., 2013). In this study we observed decreased trends in expression levels
of NADPH subunits gp91
phox
, p22
phox
, and p40
phox
in db/db mice treated with A(1-7) treatment.
Expression levels of these subunits were significantly elevated in db/db saline mice compared to htz
controls, indicating that OS is present in these animals and may be a contributor to the pathologies
involved in insulin resistance. We observed a reduction of NOX4 expression as well. Although the
changes with A(1-7) treatment in the db/db animals were not significant and this matter requires further
36

confirmatory studies in this model, nevertheless, a repeated trend in multiple subunits may be indicative
of an effect which may be enhanced with a higher dose of treatment or with a longer treatment period.
In addition to interfering with insulin stimulated glucose transport, OS plays a role in WAT associated
macrophage recruitment during obesity and the development of T2D by contributing to the dysregulated
secretion by WAT of proinflammatory cytokines and chemokines, including MCP-1(Han et al. 2016).
Although various factors have been implicated in causing WAT associated macrophage recruitment in
obesity, including ER stress, hypoxia, and adipocyte apoptosis, ROS generation occurs upstream of ER
stress and adipocyte death (Strissel et al., 2007). Studies have shown that silencing of NOX4 results in a
decrease in ROS generation and an inhibition of MCP-1 in vitro (Han et al., 2016).The effect of ROS and
macrophage recruitment is associated with the activation by ROS of NF-κB and the resultant
inflammatory gene expression (Freder et al., 2006). In support of this, antioxidant treatment has been
shown to inhibit ROS generation and NF-κB translocation(Han et al., 2016). Thus, attenuation of OS may
be one of the mechanisms by which A(1-7) reduced macrophage infiltration in the db/db mice. In this
study, we showed that A(1-7) treatment reduced gene expression of NF-κB in WAT of db/db mice, and
although this was only a trend, the expression level of the A(1-7) treated mice was closer to heterozygous
mice than the saline treated diabetics. The mechanism may involve classical activation of IkappaB kinase
(IKK) by hydrogen peroxide (Gloire et al., 2006), although this requires further investigation, as other
ROS have as well as reactive nitrogen species have been found to activate NF-κB as well (ibid).
An alternative mechanism by which NFκB is activated to provoke WAT inflammation is via activation of
toll-like receptor (TLR)4, which is expressed on adipocytes and is a ligand for lipopolysaccharide (LPS)
or fatty acids that are released from hypertrophied adipocytes (Dalmas et al., 2011). Activation of NF-κB
by TLR4 results in the increased expression of MCP-1 amongst other proinflammatory factors which
promote macrophage recruitment into WAT (Lê et al., 2011). Recent reports have indicated that resistin,
an inflammatory adipokine elevated in obesity and T2D which plays an important role in linking obesity,
insulin resistance and T2D, can compete with LPS for TLR4 (Kushiyama et al., 2005). Via this
mechanism, resistin modulates the secretion of proinflammatory cytokines through an NF-κB dependent
pathway and therefore contributes to the pathogenesis of obesity and T2D (Santos et al., 2013).
Interestingly, another study revealed that Ang II treatment increases adipocytes secretion of resistin
(Kalupahana et al., 2012), linking the RAS peptide to the activation of NF-κB. In this study, there was a
decrease in expression levels of TLR4 as well as NF-κB in the fat, and although these were trends that did
not reach statistical significance, both markers were closer to the htz levels than to the saline treated db/db
mice. In addition, there is data in the literature demonstrating the potential of A(1-7) to decrease hepatic
inflammation via suppression of this pathway (resistin/TLR4/MAPK/NF-kB) in rats on a high fat diet
37

(Feltenberger et al., 2013), and hence it is likely that A(1-7)’s protective effects on WAT macrophage
infiltration during metabolic disease may involve attenuation of this pathway as well.
Recent progress has delineated a role for the components of the RAS in the modulation of critical WAT
functions. Although the complexity of this regulation requires further investigation, and there are various
other components of the RAS that have yet to be studied, it is clear that Ang II contributes to obesity
associated pathologies, mainly the development of insulin resistance, a crucial feature of T2D. This most
likely occurs via an enhancement of inflammatory pathways and increases in OS in WAT. In this study,
A(1-7) showed promise in its ability to ameliorate these Ang II associated pathologies in WAT, mainly
macrophage infiltration, and caused a dramatic improvement in hyperglycemia in a severe T2D mouse
model. Previous studies from our laboratory have also demonstrated A(1-7)’s ability to improve overall
health of these mice by ameliorating their diabetic complications, including heart and lung dysfunction
(Papinska et al. 2016). It is worthwhile to investigate in upcoming studies whether A(1-7) in the treatment
of advanced diabetic disease can yield even greater improvements in metabolic health via a larger dose in
addition to a longer treatment period, and when used in conjunction with other blood glucose lowering
agents. In addition, since it has been shown that the protective effects of A(1-7) in WAT occur via the
MAS receptor (Santos et al., 2012), the development of MAS agonists, small compounds that are orally
available, may prove beneficial for the treatment of metabolic disease as they may manifest similar effects
as A(1-7) in countering the deleterious actions of Ang II on WAT in metabolic diseases.

38

Chapter 2: RAS inhibitors may improve metabolic outcomes in obese, hypertensive breast
cancer survivors at risk for T2D
Introduction
Breast Cancer and the Metabolic Syndrome
Recent advances in cancer treatments have made breast cancer (BC) one of the most highly curable forms
of cancer, especially when detected in the earlier stages, with the five year survival rate for stages I and II
at 99% and 86%, respectively (National Breast Cancer Foundation, 2016). Nevertheless, BC patients are
subject to an increased risk of mortality from other factors: comorbidities of BC which are detrimental to
overall health and survivorship. In particular, these comorbidities, which are often the result of cancer
related treatments, alter metabolic function in these patients, and can include the development of the so
called MetS, a cluster of conditions which increase the risk for T2D, stroke, and heart disease (Holmes et
al., 2005). Amongst the components of the MetS are hypertension, high blood sugar, insulin resistance,
excess abdominal fat, and abnormal levels of cholesterol and triglyceride levels (dyslipidemia), and BC
survivors having more than one of these conditions simultaneously are at an increased risk of mortality
from metabolic and cardiovascular diseases. In addition, evidence suggests that these metabolic
disturbances dramatically increase the risk of cancer recurrence and are associated with a poorer
prognosis and a more aggressive tumor phenotype (Gezgen et al., 2012). The development of the MetS in
BC patients can be a consequence of cancer treatments such as chemotherapy, which is associated with
excessive weight gain, fatigue, and physical inactivity, all which can lead to alterations in the components
of the MetS (Irwin et al., 2009). A recent study showed that of 86 women diagnosed with stage I to stage
III BC who had not been previously diagnosed with MetS and were undergoing chemotherapy treatment
with the drugs Doxil, Cytoxan, and Taxol, 72.5% were diagnosed with MetS one week after the
completion of their treatments (Dieli-Conwright et al., 2016).
Obesity, one particular component of MetS resulting from excess weight gain, dramatically affects overall
health and survivorship of BC patients. Both pre- and post-menopausal women receiving adjuvant
hormone therapy and chemotherapy are subject to side effects which include increased body mass index
(BMI) and central obesity, which can result in earlier development of cardiovascular disease or type 2
diabetes in those already predisposed to these diseases and increases the risk among those not already
predisposed (de Haas et al., 2010). It has been estimated that of current BC survivors with a high 5-year
survival rate, 64% are either overweight (BMI 25-30 kg/m
2
) or obese (BMI >30 kg/m
2
)(American Cancer
Society, 2011). Moreover, studies have shown that patients with obesity have double the death rate from
cancer compared to non-obese patients (Canfield et al., 2003). This suggests that adipose tissue may play
39

a central role in the recurrence of BC and in the overall prognosis of the disease. Studies have shown that
excess central and visceral adiposity may contribute to negative outcomes in BC patients by increasing
adipose tissue inflammation and promoting abnormal growth of tissue and tumor progression (Iyengar et
al., 2014). The expansion of adipose tissue during obesity causes a phenotypic switch in adipose tissue
macrophage activation from the "alternatively activated" or M2 adipose tissue macrophages (ATMs)
which are anti-inflammatory and contribute to tissue homeostasis, to the "classically" activated or M1
ATMs, which are pro-inflammatory. These M1 macrophages are associated with a dysregulated secretion
of pro-inflammatory cytokines such as TNF-α and IL-6 (Kershaw & Flier et al., 2004), and the resultant
activation of the NF-kB pathway, which promotes insulin resistance as well as contributes to tumor
growth and metastasis (Mason et al., 2009). Hence, maintaining a healthy body weight is of utmost
importance for BC survivors.
Lifestyle Interventions: Combined Exercise Program for Early BC Survivors Study
These negative alterations in metabolic health that are often a side effect of BC treatment can be offset by
lifestyle interventions, such as exercise. While various studies have emphasized the beneficial effects of
exercise on overall health and cancer recurrence in and long-term survivors, less is known about early (0-
3 month post-treatment) survivors. A clinical study conducted by the Women’s Health and Exercise
Laboratory (WHEL) in the Division of Biokinisiology and Physical Therapy at the University of Southern
California (USC), led by Dr. Christina Dieli-Conwright, set out to determine the effects of a combined
exercise program on metabolic outcomes in overweight BC survivors that recently completed cancer
related treatment. In the Combined Exercise Program for Early BC Survivors Study, one hundred
post-menopausal obese (BMI ≥ 30 kg/m2) women with stage I–III BC who had recently completed
radiation and/or chemotherapy treatment were recruited and randomized into control or exercise arm. The
control arm continued with their normal activities while those assigned to the exercise group underwent a
supervised, 16 week exercise intervention based on the guideline delineated by the American Cancer
Society and the American College of Sports Medicine. The intervention consisted of a traditional aerobic
and resistance exercise (TARE) program, with one hour workout sessions given three times a week with a
physical trainer; two days were spent on a combination of aerobic and resistance exercises and one was
dedicated only to aerobic activity. Participants provided fasting blood for the measurement of
cardiometabolic parameters and dual-energy X-ray absorptiometry (DEXA), for body composition
measurements. These were taken once at baseline and once post intervention, after the 16 weeks of
exercise. In addition, a subset of these patients (n=20) were willing to undergo a superficial subcutaneous
abdominal adipose tissue biopsy and a pilot study with these participants was used to characterize the
effects of exercise on adipose tissue inflammation and macrophage phenotype in obese BC survivors.
40

Figure 2.1. RAS Modifying Drugs Mechanism
of Action. This class of drugs blocks the action of
Ang II either by inhibiting the ACE enzyme,
which catalyses conversion of Angiotensin I to
Ang II, as in the case of ACE inhibitors, or by
preventing Ang II binding to its receptors (highly
selective for AT1 receptor), as in the case of ARB
(Adapted from www.basicmedicalkey.com/ace-
inhibitors-and-angiotensin-receptor-blockers).
As a result of the 16-week exercise intervention, the study participants experienced significant
improvements in physical fitness and in the components of MetS (body composition, waist circumference
(WC), BP, and serum levels of insulin, glucose, lipids, C-reactive protein, and HbA1c). Participants in the
exercise arm of the adipose tissue pilot study had significant decreases in M1 type ATMs and an increase
in M2 ATMs, an increased secretion of anti-inflammatory cytokines such as adiponectin, and a decreased
secretion of pro-inflammatory cytokines, such as TNF-α and IL-6. These findings were published in the
Journal of Clinical Oncology (Dieli-Conwright et al., 2018) and present early BC survivors with a
lifestyle intervention that can dramatically enhance their health and survivorship. Future large randomized
studies will further investigate the effects of exercise induced reductions in adipose tissue inflammation
on overall health and cancer recurrence in obese BC patients.
A Role for RAS Modulation in the Amelioration of Metabolic Disease in Obese BC Survivors
Obesity is a chronic inflammatory state that contributes to
metabolic disease and is a major risk factor for the development of
hypertension (Praso et al., 2012). Given that the inclusion criteria
of the Combined Exercise Program for Early BC Survivors Study
was a BMI > 25 kg/m
2
or body fat > 30%, and that hypertension is
a common side effect of some cancer treatment (Mouhayar &
Salahudeen et al., 2011), it was likely that a subset of the patient
population of this study were taking blood pressure (BP) lowering
medications. This afforded us, through collaboration with the
WHEL, the opportunity to examine the effects of RAS modulation
on metabolic dysfunction in these obese cancer survivors who are
at an increased risk of metabolic disease and cancer recurrence.
RAS modifying medications, or RAS Blockers, comprise of
inhibitors of the RAS, mainly ACE inhibitors and Ang II
receptor blockers (ARBs). These two drugs are traditionally used
for the treatment of hypertension via either decreasing the
production of Ang II (ACE inhibitors), a potent vasoconstrictor
and major effector of the RAS, or by inhibiting the action of Ang
II on its pathological receptor, the AT1 receptor (ARBs) (Figure
2.1).
Recent studies have delineated a role for the RAS in the
41

modulation of various other systems in addition to BP regulation and cardiovascular homeostasis.
Activation of the pathological arm of the RAS via Ang II has been implicated in chronic inflammation,
OS, and the development of metabolic disease (Ferder et al., 2006). Hence it is no surprise that recent
clinical findings point at RAS modifying BP medications as potential treatments for the amelioration of
the pathologies associated with MetS, such as excess body fat and insulin resistance. Clinical trials have
accordingly shown that inhibition of ACE or blockade of the AT1 receptor improves glycemic control in
diabetic patients and reduces the risk of developing diabetes (Abuissa et al., 2005). In addition, animal
models of insulin resistance and T2D have shown enhanced glucose tolerance and insulin sensitivity as a
result of Ang II inhibition (Ferder et al., 2006). Various mechanisms have been proposed for the
implication of the RAS in the etiology of obesity and metabolic disease and for the insulin sensitizing
capabilities of ACE inhibitors and ARBs, yet these mechanisms have not been fully elucidated and
require further investigation.
Therefore, we set out to study the effects of RAS modifying BP medications on systemic and adipose
tissue inflammation and their effects on metabolic health in these study participants, who are at an
increased risk for metabolic diseases (MetS, T2D) and of cancer recurrence as a consequence of these
diseases. Using a subset of the study population that had been taking BP medications for at least six
months, we separated the study participants into three groups: patients taking RAS modifying BP drugs
(n=23), patients taking other BP drugs, Calcium channel blockers (CaB) (n=12) as a comparator, and
patients not clinically diagnosed with hypertension, or Normotensives (n=31), who were used as
controls. We used the baseline plasma samples obtained before the exercise intervention to compare
markers of inflammation and metabolic health between the three groups in order to determine an effect
independent of exercise. We also compared the effects of exercise versus control on various
cardiometabolic parameters, and finally, we assessed the combined effects of taking RAS modifying BP
drugs and exercising on markers of inflammation and metabolic health. The markers of inflammation we
assessed consisted of a panel of cytokines including IFN-γ, IL-1β, IL-2, IL-4, IL-6, IL-8, IL-12p70, IL-
13, and TNF-α, which we measured in the baseline plasma samples using a multiplex ELISA assay.
Outcome measures provided for our analysis by WHEL for these patients included WC (inches) and
HOMA-IR (Homeostatic Model Assessment of Insulin Resistance), and information regarding age,
ethnicity (Hispanic or non-Hispanic white), height and weight for each participant was also provided.
Using the patients samples from adipose tissue pilot study (n=20), we were able to compared the effects
of RAS modification on the percentage of M1 vs. M2 macrophages in the adipose biopsy samples as
markers of adipose tissue inflammation. Additional outcome measures were provided to us by WHEL for
these participants which allowed us to assess the effects of RAS modifying drugs on more markers of
42

metabolic health, including body composition assessments such as body weight, WC, lean mass, fat mass,
and grading for the MetS in addition to serum levels of insulin, glucose, lipids, C-reactive protein, leptin,
and adiponectin. Our hypothesis was that hypertensive patients on RAS modifying BP medications have
decreased systemic inflammation and an improved metabolic profile compared to patients on CaB as a
result of Ang II inhibition.

43

Materials and Methods
Study Design for Combined Exercise Program for Early BC Survivors Study
Recruitment and Eligibility
Recruitment efforts included posting flyers at the USC Health Sciences Campus, Huntington Memorial
Hospital, and institutions in the San Gabriel Valley, informing BC patients of the study prior and during
chemotherapy and/or radiation therapy, and announcements in the Clinical Trials webpage for USC.
Approval from subjects’ primary physician was obtained prior to recruitment. Participants were recruited
by Dr. Christina Dieli-Cornwright at the Lee Breast Clinic at Norris Comprehensive Cancer Center and at
LAC+USC County Medical Center, under the medical guidance of Dr. Darcy Spicer.
Inclusion Criteria:
• Women ≥ 18 years of age newly diagnosed (0-III) with a first primary invasive BC
• Have undergone a lumpectomy or mastectomy
• Have completed surgery, neoadjuvant/adjuvant cytotoxic chemotherapy and/or radiation therapy and
able to initiate Exercise program (if randomized to that arm) within 24 weeks of therapy (i.e. surgery,
chemotherapy, radiation) completion
• BMI > 25 kg/m
2
or body fat > 30% (determined by Dr. Dieli-Conwright at baseline visit)
• Currently participate in less than 60 minutes of physical activity per week; the Control group may
increase activity participation up to 120 minutes of total exercise per week during the duration of the
study
• May use adjuvant trastuzumab or endocrine therapy if use will be continued for duration of study
period
• Nonsmokers (i.e., not smoking during previous 12 months)
• Willing to travel to the exercise facility and USC
• Able to provide physician clearance to participate in exercise program
• Women of all racial and ethnic backgrounds will be included in the study enrollment process

Exclusion Criteria:
• History of chronic disease including uncontrolled diabetes, uncontrolled hypertension or uncontrolled
thyroid disease
• Weight reduction ≥ 10% within past 6 months
• Metastatic disease
44

• Planned reconstructive surgery with flap repair during trial and follow-up period
• Cardiovascular, respiratory or musculoskeletal disease or joint problems that preclude moderate
physical activity.

Patient Consent
During patient registration, signed and dated copies of the informed consent forms with the Human
Rights and the HIPAA authorization were given to the patients and were sent to the USC Health Research
Association (HRA). The original forms were kept by the data manager.

Exercise Intervention
Once deemed eligible, 100 obese, postmenopausal BC survivors were recruited and randomized to either
the exercise or control groups. One week prior to start of intervention, participants and underwent a series
of tests to measure the outcome measures at baseline (see description below). The exercise group was
required to visit the Clinical Exercise Research Center (CERC) at USC where the study was conducted
three times per week for 16 weeks to complete the exercise protocol. All sessions were supervised by Dr
Dieli-Conwright, an American College of Sports Medicine (ACSM) Cancer Exercise Trainer (CET). The
exercise group was encouraged to participate in 1 additional 30-45 minute exercise session at home
consisting of comprised of moderate-intensity aerobic exercise. The control group was asked not to
change their normal exercise level, which could not exceed more than 120 minutes of total exercise per
week during the study and were offered the same intervention at the conclusion of the 16-week trial
period. The exercise protocol consisted of 30 minutes of aerobic exercise sessions three times per week
for 16 weeks. Twice a week the aerobic exercise sessions were followed by resistance exercise sessions.
Aerobic exercise consisted of treadmill walking or stationary cycling. The resistance exercise sessions
included leg presses, leg flexion, leg extension, chest presses, seated row, biceps curls, and triceps pull
down. This exercise regimen is based on current recommendations for BC survivors following treatment
(Hayes et al., 2009)(Newton & Galva et al., 2008). Over the course of the trial, the exercises were altered
and resistance was increased as participants gained muscular strength and endurance.
Outcome Measures
The following measures of MetS were performed at the pre-intervention visit (week 0) and following the
16-week study period (week 17) for participants in the exercise and control groups:
• Blood Draw: Fasting blood was drawn from the antecubital vein (~30 cc) by a trained
phlebotomist at the CERC
45

• Serum Assays: The Diabetes and Obesity Research Institute (DORI) at USC performed standard
assays to measure in serum the following biomarkers: lipids (cholesterol, triglycerides), insulin,
glucose, and C-reactive protein (CRP), adiponectin, and leptin.
• Body Composition Assessments: Body weights were measured using a medical scale (Detecto
®

437, Webb City, MO). Body composition (total lean and fat mass) was measured from a whole
body scan using Dual-Energy X-ray Absorptiometry (DEXA, Lunar DPX-IQ). A tape measure
was used to obtain WC defined as the distance around the waist using the navel as the reference
point.
Adipose Tissue Biopsies
All participants were provided with the option to undergo dSAT biopsies at the pre-intervention visit and
post-testing. This testing was part of a pilot study meant to collect preliminary data for a larger trial and
so within the 100 participants, 20 were recruited (10 controls and 10 exercise) to undergo the biopsy
procedure. Following a 12-hour fast, participants underwent a deep abdominal subcutaneous fat biopsy by
punch biopsy under local anesthesia using 6 mm biopsy attachment with a 1-cm scalpel incision . Adipose
tissue samples were analyzed using fluorescence-activated cell sorting (FACS) to characterize ATMs (M1
vs. M2). Samples were gated for M1 proinflammatory macrophages (CD45+/CD14+/CD40+) or M2 anti-
inflammatory macrophages (CD45+/CD14+/CD206+).The percentage of each macrophage subtype (M1
vs. M2) was determined by the difference between the percent of CD40+ or CD206+ cells and that of the
isotype control cells.
Analysis of RAS Modulation in the Amelioration of Metabolic Disease in Obese BC Survivors
Group Assignment and Variables
Through a collaboration with the WHEL at USC, we obtained baseline and post-intervention plasma
samples from the study participants in addition to data with respect to their ethnicity (Hispanic or non-
Hispanic white), age, body weights, WC, HOMA-IR measurements, and BP medication they were taking
(n=66). We separated the study participants into three groups: patients taking RAS-modifying BP drugs,
including ACE inhibitors and ARBs (n=23), patients taking another class of BP drugs, CaB (n=12), and
patients not clinically diagnosed with hypertension, or Normotensives (n=31). Subjects who have been
assessed had been taking their BP control medications for at least 6 months. Additional metabolic data
and body composition assessments were provided to us for the participants who underwent the adipose
tissue biopsy (n=20), which included, aside from the % of M1 or M2 macrophages in adipose tissue, the
following parameters: insulin, glucose, cholesterol, triglycerides, C-reactive protein, adiponectin, leptin,
46

grading for the MetS, IL-6, IL-8, lean mass, and fat mass. Using the provided data, our goal was to
compare the effects of these three groups on inflammation metabolic health in this patient population.
Measurement of Systemic Pro- and Anti-inflammatory Profile
We measured the systemic proinflammatory profile in the provided plasma samples of the study
participants using a V-PLEX Proinflammatory Panel 1 Human Kit (MSD, Rockville, MD) to detect a
panel of pro-inflammatory cytokines including IFN-γ, IL-1β, IL-2, IL-4, IL-6, IL-8, IL-12p70, IL-13, and
TNF-α.
Analysis
IBM SPSS Software, version 24, was used to perform the analyses.
• ANCOVA (analysis of covariance) was used to detect differences in the means of the systemic
inflammatory markers between the three BP groups (RAS modifying, CaCh blockers, and
Normotensives), controlling for confounders (ethnicity, age, and WC). This was performed using
baseline (pre-intervention) plasma samples. Adjusted means of each group were transferred to
Graphpad Prism for graphing and a one-way ANOVA was used to detect statistical differences
between the three BP groups, with *p<0.05 **p<0.01, ***p<0.001 (Figure 2.2).
• The percentage change from baseline (% CBL) following the exercise intervention was calculated
((post-intervention value minus baseline value/baseline value)*100) for each of the metabolic and
inflammatory markers (body weights, WC, MetS grading, lean mass, fat mass, serum IL-6, IL-8, C-
reactive protein, % of M1 or M2 macrophages in adipose tissue, HOMA-IR measurements, serum
insulin, glucose, cholesterol, triglycerides, adiponectin, and leptin) and compared in an ANCOVA
analysis in SPSS between the control and exercise groups (controlling for ethnicity, age, and WC).
Adjusted means of each group were transferred to Graphpad Prism for graphing and a student t-test
was used to compare the exercise vs. control groups, with *p<0.05 **p<0.01, ***p<0.001 (Figures
2.3-2.4)
• % CBL values were used to compare the effects of the three BP groups on the metabolic and
inflammatory markers (body weights, WC, MetS grading, lean mass, fat mass, serum IL-6, IL-8, C-
reactive protein, % of M1 or M2 macrophages in adipose tissue, HOMA-IR measurements, serum
insulin, glucose, cholesterol, triglycerides, adiponectin, and leptin), using ANCOVA analysis to
control for the effects of confounders, including ethnicity, age, WC and exercise (Tables 2.1-2.3).
Adjusted means of each group were transferred to Graphpad Prism for graphing and a one-way
47

ANOVA was used to detect statistical differences between the three BP groups, with *p<0.05
**p<0.01, ***p<0.001 (Figures 2.6-2.8).

48

Results
Systemic levels of pro- and anti-inflammatory cytokines measaured in baseline plasma samples in the
RAS modifying group differed from the CaB group and resembled the normotensive group.Cytokine

Figure 2.2. Systemic cytokine levels measured in plasma baseline samples were lower in patients taking RAS
modifying BP medications compared to those taking calcium channel blockers. We compared the effects on
systemic inflammation of RAS modifying BP medication and calcium channel blockers, with the normotensive group
as the control. The pro-inflammatory cytokines IFN-ƴ, TNF-α, and IL-12p70 (A-C) trended more towards
normotensive levels than calcium channel blockers. Cytokines IL-6, IL-8, IL-4 and IL-10(D-G) were also decreased in
the RAS modifying group compared to calcium channel blocker group, with IL-8(E) significantly so (p<0.05). IL-1β,
IL-13, and IL-2 (H-J) had the highest variation between the two BP medication groups and it was difficult to identify a
trend. ANCOVA analysis was used to control for confounders, including WC, ethnicity, and age. Adjusted mean
values generated in SPSS software were used for graphing in Graphpad software. Values were platted as mean ± SEM,
with *p<0.05, **p<0.01, ***p<0.001.

49

levels measured in a multiplex ELISA assay in the baseline plasma samples of all the study participants
were compared across the three groups (Figure 2.2). Using the baseline samples enabled us to increase
our sample size to use both the exercise and control groups, as this was before the exercise intervention
and therefore exercise did not play a role in the possible effects of the RAS modifying drugs we were
assessing. The cytokine levels in the RAS modifying group tended to be lower than those in the CaB for
the majority of the cytokines, following a pattern similar to the normotensives. Pro-inflammatory
cytokines IFN-ƴ, TNF-α, IL-12p70, IL-6, and IL-8 (Figure 2.2 A-E) were lower in the RAS modifying
BP group compared to the CaB group; these decreases were all trends following a similar patten, and only
IL-8 was significantly reduced in the RAS modifying group. Interestingly, the Th2 cytokines IL-4 and IL-
10 were also decreased by the RAS modifying drugs (Figures 2.2 F-G), and although these cytokines
typically have anti-inflammatory properties, studies show that in the presence of hypertension, they may
play a pro-inflammatory, pro-fibrotic roles (Singh, Castillo, Islam, & Majid, 2017). IL-1β, IL-2, and IL-
13 levels varied more across the three groups (Figure 2.2 H-J) and it was difficult to isolate any trends.
Body Composition and MetS Grading were significantly improved by the 16-week exercise
intervention.We assessed the effects of exercise in obsese , post-menopausal BC survivors on body
compostion and MetS scores. Values were expressed as a percenage change from baseline following the
intervention (Figure 2.3). When comparing the exercise group with the controls, who maintained their
normal actiivites and did not increase their activity levels to more than 120 min a week, we found that the
TARE intervention significantly reduced body weight and waist circumfrence in the exercise group
compared to the controls (Figure 2.3A). Lean mas and fat mass were not as affected by exercise (Figure
2.3B). Howerver, grading for the MetS was significantly reduced by the exercise intervention, indicating
that exercise may be powerful intervention in the amelioration of metabolic alterations that are a risk
factor for type 2 diabetes and heart disease.

50

Figure 2.3. Body composition assessments and grading for MetS were significantly improved by 16
week exercise intervention. Percentage change from baseline (%CBL) in body weight and WC
following the exercise intervention were very significantly reduced by exercise (A), while the %CBL in
lean and fat mass exhibited more variation between the two groups (B). All these variables were
measured in the study population and provided to us for this analysis by the WHEL. %CBL values were
computed in excel and were transferred to SPSS. ANCOVA analysis in SPSS was used to control for
confounders, including waist circumference, ethnicity, and age. Adjusted mean values generated in
SPSS software were used for graphing in Graphpad software. Values were platted as mean ± SEM, and a
student t-test was used to compare the exercise vs. control groups, with *p<0.05 **p<0.01, ***p<0.001.

Exercise significantly reduced systemic inflammation and shifted macrophage phenotype from
proinflammatory to anti-inflammatory in adipose tissue. C-reactive protein, one of most widely used
diagnostic markers of inflammation, and proinflammatory cytokines IL-6 and IL-8, were significantly
decreased from baseline in the systemic circulation following the 16-week exercise intervention (Figure
2.4A). Adipose tissue macrophage phenotype has been shown to play a central role in influencing the
inflammatory state in this tissue, which is important for the regulation of metabolic health. While a pro-
inflammatory phenotype may contribute to the develoment of insulin resistance, an anti-inflammatroy
phenotype supports normal tissue functions necessary for the maintainance of homeostasis. In adipose
tissue of the study participants, the % of M1 (pro-inflammatory) macrophages was also quite significanty
reduced compared to baseline in the exercise group versus the control group, while the % of M2 (anti-
A
B
51

Figure 2.4. Systemic and adipose tissue markers of inflammation were significantly reduced by 16 week
exercise intervention. The %CBL of systemic markers of inflammation including C-reactive protein, IL-6 and IL-
8 measured in the study participants were significantly lower in the exercise vs. control group (A). %CBL of the
%M1 macrophages in adipose tissue was also significantly lower in the exercise group, while the %CBL of the %
of M2 macrophages was significantly higher(B), indicating a phenotypic switch in adipose tissue of the obese
subjects from pro-inflammatory to anti-inflammatory. All these variables were measured in the study population
and provided to us for this analysis by the WHEL. %CBL values were computed in excel and were transferred to
SPSS. ANCOVA analysis in SPSS was used to control for confounders, including waist circumference, ethnicity,
and age. Adjusted mean values generated in SPSS software were used for graphing in Graphpad software. Values
were platted as mean ± SEM, and a student t-test was used to compare the exercise vs. control groups, with
*p<0.05 **p<0.01, ***p<0.001.

inflammatory) macrophages was increased from baseline after exercise and was significantly higher than
the control group (Figure 2.4B). The percentasge of M1 or M2 macrophages in adipose tissue of the study
participants were measured by WHEL in FACS analysis, in which M1 macropahges were identified as
(CD45+/CD14+/CD40+) while M2 macrophages were identified as (CD45+/CD14+/CD206+).
Serum levels of insulin, glucose, lipids, and adipokines and a measure of insulin resistance were
significantly improved by the exercise intervention. Homeostatic Model Assessment of Insulin Resistance
(HOMA-IR), a calculation used to determine the presence and extent of any insulin resistance, had a
52

%CBL significantly lower in the exercise group compared to the control group. Accordingly, %CBL of
serum insulin levels were also decreased by exercise compared to control, which makes sense due to the
reduction in insulin resistance. In a similar fashion, the %CBL of blood glucose levels was also lower in
the exercise group compared to the control, indicating an improvement in glucose uptake (Figure 2.5A).
Dyslipidemia, an abnormal amount of lipids such as cholesterol and triglycerides, also appeared to be
significantly improved by exercise compared to the control following the intervention (Figure 2.5B). This
condition is a major risk factor for heart attacks, strokes, and peripheral arterial disease. Adipokines are
signaling molecules secreted by adipose tissue which function as signal communicators and which play a
role in regulation of metabolism; their dysregulation has been implicated in obesity T2D. Adiponectin, an
adipokine known for its anti-inflammatory effects, which has been found to be reduced in T2D and
obesity, had a %CBL that was significantly higher in the exercise group compared to the control (Figure
2.5C). In contrast, the %CBL of leptin, an adipokine responsible for appetite suppression, was
significantly lower in the exercise group, indicating there is less of a need for this regulator of appetite
following an exercise regimen.
53

The RAS modifying BP group showed trends towards an improvement of body composition assessments
and MetS grading. When the %CBL of RAS modifying drugs was compared to the that of CaB for the
various body composition assessments, having controlled for exercise, WC, age, and ethnicity, 16 weeks
of RAS modifying drugs appeared to cause greater decreased trends in WC, body weight, and MetS
grading (2.5A). In addition the %CBL of fat mass showed a greater decreased trend in the RAS grouped
compared to CaB, while there was a slightly greater increased trend in lean mass (Figure 2.5B). Since
ANCOVA analysis was used to control for confounders such as exercise, and the adjusted means of the
BP groups were used for plotting, these observed effects indicate that RAS modifying drugs act in a
similar fashion to exercise towards improvement of metabolic alterations in body composition, although
exercise elicited more significant effects. Table 2.1 delineates the significance of the covariates that were

Figure 2.5. Markers of metabolic health are significantly altered by 16 week exercise intervention. Insulin resistance
measured using HOMA-IR, serum insulin, and serum glucose levels had decreased %CBL in the exercise groups, which
differed significantly from the control group (A). Similarly, the %CBL of cholesterol and triglycerides was also significantly
lower in the exercise group than in the controls (B). Adiponectin, an anti-inflammatory adipokine was increased in the exercise
group and had a %CBL significantly higher than the control group. In contrast, leptin levels appeared to be reduced with
exercise and the %CBL of this adipokine was actually significantly lower than that of the control. All these variables were
measured in the study population and provided to us for this analysis by the WHEL. %CBL values were computed in excel and
were transferred to SPSS. ANCOVA analysis in SPSS was used to control for confounders, including waist circumference,
ethnicity, and age. Adjusted mean values generated in SPSS software were used for graphing in Graphpad software. Values
were platted as mean ± SEM, and a student t-test was used to compare the exercise vs control groups, with *p<0.05 **p<0.01,
***p<0.001.

54

computed in the ANCOVA analysis for these body composition measurements. Exercise as a covariate
was found to be significant for the MetS grading, for WC, and for fat mass, suggesting that a combination
of exercise and RAS modifying BP drugs may have great benefit for the amelioration of these parameters.

55

Figure 2.6. Body composition assessments and grading for MetS were improved by RAS modifying BP
medications. RAS modifying BP group showed greater improvements in the %CBL of body composition assessments
and MetS grading compared to CaB (A), and although these alterations were no significant, the consistent pattern
indicates that an effect is present on these parameters by this BP class of drugs. In addition, there was also a greater trend
for the improvement of %CBL of fat mass and lean mass in the RAS group compared to CaB group (B) which was not
observed for exercise. %CBL values were computed in excel and were transferred to SPSS. ANCOVA analysis in SPSS
was used to control for confounders, including waist circumference, ethnicity, and age. Adjusted mean values generated
in SPSS software were used for graphing in Graphpad software. Values were platted as mean ± SEM, and ANOVA
analysis was used to compare the three BP groups, with *p<0.05 **p<0.01, ***p<0.001.

A
B
56

Dependent Variable Covariates p-value
MetS % CBL ETHNICITY 0.738
AGE 0.906
WAIST CIRCUMFRENCE (WC) 0.814
EXERCISE 0.006
BP GROUP 0.482
Waist Circumference % CBL ETHNICITY 0.786
AGE 0.730
EXERCISE 0.000
BP GROUP 0.136
Body Weight% CBL ETHNICITY 0.586
AGE 0.189
WAIST CIRCUMFRENCE (WC) 0.000
EXERCISE 0.123
BP GROUP 0.252
Fat Mass % CBL ETHNICITY 0.854
AGE 0.368
WAIST CIRCUMFRENCE (WC) 0.428
EXERCISE 0.008
BP GROUP 0.216
Lean Mass % CBL ETHNICITY 0.888
AGE 0.742
WAIST CIRCUMFRENCE (WC) 0.097
EXERCISE 0.410
BP GROUP 0.199

Table 2.1. Significance in ANCOVA Tests in Between Subject Effects for Body
Composition Assessments and Grading for MetS. The effects of these covariates
(ethnicity, age, WC, exercise, and BP group) on the listed dependent variables (left
column) was analyzed using an ANVCOVA analysis. Significance in the Tests in
Between Subject Effects was defined as p<0.05

57

RAS modifying BP drugs reduced systemic markers of inflammation but had no effect on ATM phenotype
changes. When comparing the %CBL of RAS modifying drugs to that of CaB for markers of systemic
inflammation, it is evident that the RAS modifying group elicited a greater decrease in %CBL of reactive
protein, a major marker of inflammation, and this difference was very close to significant. The effects on
IL-6 and IL-8 were not as pronounced, although there was a slight decreasing trend for IL-6 in the RAS
group (2.7A). However, RAS modifying drugs did not appear to have much of an effect on ATM
phenotype like exercise (2.7B), indicating that the mechanism of these drugs may not involve

Figure 2.7. Systemic and adipose tissue markers of inflammation were altered by RAS modifying BP drugs. %CBL of
systemic C-reactive protein was more reduced in the RAS modifying group compared to the CaB group. There was a trend
for a greater decrease than the CaB group for the %CBL of IL-6 in the RAS modifying group, but no identifiable trend for IL-
8 (A). There were no decreases in the %CBL of M1 macrophages or an increase in %CBL of M2 macrophages in the RAS
group compared to the CaB group (B). %CBL values were computed in excel and were transferred to SPSS. ANCOVA
analysis in SPSS was used to control for confounders, including waist circumference, ethnicity, and age. Adjusted mean
values generated in SPSS software were used for graphing in Graphpad software. Values were plotted as mean ± SEM, and
ANOVA analysis was used to compare the three BP groups, with *p<0.05 **p<0.01, ***p<0.001.

A
B
58

amelioration of adipose tissue inflammation for its improvement of systemic inflammation and metabolic
health. When assessing the effects of exercise as a covariate in the ANCOVA for the %CBL of all these
inflammatory markers (Table 2.2), exercise has a significant effect for each and every one, indicating that
a combined effect of exercising and taking RAS modifying BP drugs for the case of the systemic
inflammatory markers may prove beneficial for the amelioration of inflammation in this study population.
Ethnicity was another covariate, which, after adjusting for age, WC, and the other covariates, was
significantly associated with HSC-RP1 levels. Indeed, the literature indicates that Hispanics tend to have
more systemic inflammation than non-Hispanic whites. While more studies are necessary to assess the
effects of ethnic differences on inflammatory markers, these results illustrate that modifiable risk factors
such as WC and exercise may not solely account for differences in systemic inflammation in different
ethnic groups.
59

Dependent Variable Covariates p-value
C-reactive protein (HSC-RP1) % CBL ETHNICITY 0.021

AGE 0.706

WAIST CIRCUMFRENCE (WC) 0.388

EXERCISE 0.003

BP GROUP 0.118
IL-8 % CBL ETHNICITY 0.261

AGE 0.930

WAIST CIRCUMFRENCE (WC) 0.569

EXERCISE 0.002

BP GROUP 0.969
IL-6 % CBL ETHNICITY 0.102

AGE 0.977

WAIST CIRCUMFRENCE (WC) 0.820

EXERCISE 0.000

BP GROUP 0.115
%M1 Mac % CBL ETHNICITY 0.722

AGE 0.621

WAIST CIRCUMFRENCE (WC) 0.929

EXERCISE 0.003

BP GROUP 0.898
%M2 Mac % CBL ETHNICITY 0.561

AGE 0.585

WAIST CIRCUMFRENCE (WC) 0.586

EXERCISE 0.001

BP GROUP 0.743

Table 2.2. Significance in ANCOVA Tests in Between Subject Effects for Systemic and
Adipose Tissue Inflammatory Markers. The effects of these covariates (ethnicity, age, WC,
exercise, and BP group) on the listed dependent variables (left column)was analyzed using an
ANVCOVA analysis. Significance in the Tests in Between Subject Effects was defined as p<0.05

Participants taking RAS modifying BP drugs showed greater improvements in the %CBL of markers of
metabolic health compared to those taking CaBs. One of the more significant findings of this study was
the effect of RAS modifying drugs on these markers of metabolic health: the reduction in the %CBL in
HOMA-IR, insulin, blood glucose, cholesterol, triglycerides, leptin, and the increase in the %CBL of
adiponectin. These trends are a reflection of the effects observed with exercise. Table 2.3 shows that in
60

ANCOVA analysis, exercise as a covariate significantly affects all of these dependent variables, thereby
suggesting that a combination of exercise and of taking RAS modifying BP medications can greatly
improve these parameters of metabolic health in these study participants.

Figure 2.8. Markers of metabolic health were improved by RAS modifying BP medications. %CBL of HOMA-IR,
insulin, and blood glucose was more reduced in the RAS modifying group compared to the CaB group (A). Lipid levels
(cholesterol and triglycerides) also trended towards a greater reduction in %CBL in the RAS group compared to the other two
groups. In a similar fashion to exercise, the %CBL of adiponectin was greater in the RAS modifying group and of leptin was
lower in the RAS modifying group compared to the other groups. %CBL values were computed in excel and were transferred
to SPSS. ANCOVA analysis in SPSS was used to control for confounders, including WC, ethnicity, and age. Adjusted mean
values generated in SPSS software were used for graphing in Graphpad software. Values were platted as mean ± SEM, and
ANOVA analysis was used to compare the three BP groups, with *p<0.05 **p<0.01, ***p<0.001.

61

Dependent Variable Covariates p-value
HOMA-IR % CBL ETHNICITY 0.417
AGE 0.947
WAIST CIRCUMFRENCE (WC) 0.498
EXERCISE 0.001
BP GROUP 0.650
Insulin % CBL ETHNICITY 0.381
AGE 0.992
WAIST CIRCUMFRENCE (WC) 0.498
EXERCISE 0.001
BP GROUP 0.478
Blood Glucose % CBL ETHNICITY 0.876
AGE 0.727
WAIST CIRCUMFRENCE (WC) 0.128
EXERCISE 0.013
BP GROUP 0.338
Cholesterol % CBL ETHNICITY 0.468
AGE 0.731
WAIST CIRCUMFRENCE (WC) 0.733
EXERCISE 0.003
BP GROUP 0.852
Triglycerides % CBL ETHNICITY 0.252
AGE 0.777
WAIST CIRCUMFRENCE (WC) 0.512
EXERCISE 0.000
BP GROUP 0.411
Adiponectin % CBL ETHNICITY 0.931
AGE 0.453
WAIST CIRCUMFRENCE (WC) 0.798
EXERCISE 0.001
BP GROUP 0.598
Leptin % CBL ETHNICITY 0.742
AGE 0.347
WAIST CIRCUMFRENCE (WC) 0.765
EXERCISE 0.012
BP GROUP 0.837

Table 2.3. Significance in ANCOVA Tests in Between Subject Effects for Markers of
Metabolic Health. The effects of these covariates (ethnicity, age, WC, exercise, and BP
group) on the listed dependent variables (left column)was analyzed using an ANVCOVA
analysis. Significance in the Tests in Between Subject Effects was defined as p<0.05

62

Discussion
The negative ramifications that obesity and the MetS may have on overall health in the general population
are widely recognized, but less known is the fact that these conditions are quite common and may be even
more detrimental in vulnerable populations, such as BC survivors. Common comorbidities of BC include
alterations in metabolic health and excess weight gain, which have been shown to increase the risk in
survivors of mortality due to the increased chance of diabetes, heart disease, and cancer recurrence
(Holmes et al., 2005). This may be due to adipose tissue inflammation which leads to the activation of
inflammatory pathways in obesity. Fortunately, obesity and MetS can be treated and prevented by
lifestyle interventions before they progress into full blown disease. In a recent study, a 16-week aerobic
and resistance exercise intervention improved physical fitness, adipose tissue inflammation, and the
cardio metabolic profile of obese, postmenopausal BC survivors (Dieli-Conwright et al., 2016).
Another common comorbidity of BC is hypertension, and hence it is typical to find that in a
population of BC survivors many are on prescribed BP control medications. We took advantage of
this information to assess the effects of RAS modifying BP medications on metabolic health and on
systemic and adipose tissue inflammation in short term (0-3 month post-treatment) BC survivors in
order to determine if this class of drugs shows the potential to be developed as a standalone therapy
or as a combination therapy with exercise for the treatment of the MetS in this study population. RAS
inhibitors, which mainly include ACE inhibitors and ARBs, have recently shown promise in animal
and clinical studies for their ability to ameliorate various aspects of the MetS such as insulin
resistance and excess weight gain, independently from their anti-hypertensive effects (Kloet et al.,
2011). They have also been shown to suppress inflammation and OS by virtue of Ang II inhibition
(Suzuki & Eguchi et al., 2006). Other studies have also shown that RAS inhibitors may have anti-
tumor effects and improve cancer survival (Marín-ramos et al., 2018). However, the mechanisms for
these effects remain to be elucidated. Thus far, this is the first instance in which the effects of RAS
inhibition on metabolic health and systemic inflammation, which plays a central role in the
development of metabolic disease, were assessed in early term, obese BC survivors.
In the first part of our analysis, we measured a panel of pro- and anti-inflammatory cytokines in
baseline plasma samples of the study participants and, using the available BP medication data,
compared their levels between patients on RAS modifying medications, patients on calcium CaB, and
63

normotensives, using ANCOVA analysis to control for confounders such as ethnicity, age, and WC.
We observed trends indicating a decrease in pro-inflammatory cytokines (TNF- α, IFN- ƴ, IL-6, and
IL-12p70) and in a proinflammatory chemokine (IL-8) in the RAS modifying group compared to the
CaB group. The normotensive group was decreased in a similar fashion as the RAS modifying group.
Expecting an increasing trend in the typical anti-inflammatory cytokines, we were surprised to find that
the Th2 type cytokines, IL-10, IL-4, and IL-13, which are produced by Type 2 T helper cells, were
decreased in the RAS modifying group compared to the CaB group. It is known that while Th1-type
cytokines, such as IFN-ƴ, tend to produce a proinflammatory response responsible for attacking
intracellular pathogens, Th2-type cytokines, which include IL- 4, IL-5, and IL-13, promote IgE and
eosinophilic responses in allergic reactions; IL-10 typically has an anti-inflammatory response (Berger et
al., 2000). Further investigation revealed that in the presence of increased levels of Ang II and
hypertension, these cytokines may actually have pro-inflammatory, profibrotic effects (Singh et al., 2017)
(Peng et al., 2015) and that hence a reduction in the level of these cytokines may be beneficial in
hypertensives. We concluded that in this patient population, RAS inhibiting drugs may prove beneficial in
ameliorating systemic inflammation, which is indicative of a dysregulated secretion of cytokines by
adipose tissue and is a major contributor to the development of insulin resistance and T2D. Interestingly,
the literature shows that CaB may also have anti-inflammatory effects (Batmanabane & Vasigar et al.,
2013), though clearly more modest than those of the RAS inhibitors, and hence, since we do not have an
untreated hypertensive group to compare the anti-inflammatory effects of the RAS to and can only use the
CaB group as a reference, it could be that a more drastic decrease in inflammation would be observed
when comparing patients on RAS modifying drugs to untreated hypertensives or to those on anti-
hypertensives other than CaBs.
In order to confirm the validity of our data, we wanted to show that exercise as a lifestyle intervention can
improve alterations in metabolic health in these study participants, which has already been established by
various studies. Using the metabolic and inflammatory markers provided to us by WHEL for the 20 study
participants that underwent adipose tissue biopsies, we assessed the percentage change from baseline
(%CBL) in these markers following the 16-week exercise intervention and compared the control and
exercise arms. As predicted, exercise caused a significant reduction in body weight and WC. Lean mass
and fat mass were not affected. However, since WC is a measure of central adiposity, which is a more
pathological form of obesity than subcutaneous fat, the reduction in WC is more significant for the
ramifications it may have on metabolic heath. In agreement with this, % CBL of the MetS grading was
significantly lower in the exercise group compared to the control, as were HOMA-IR, insulin, blood
glucose and lipid serum levels, all of which are indicative of improved metabolic health . It is also not
64

surprising that markers of inflammation such as C - reactive protein, IL-6, and IL-8 had a change from
baseline that was significantly reduced in the exercise arm compared to the control arm. Inflammation of
adipose tissue, which is a consequence of obesity, plays a major role in the pathogenesis of metabolic
disease. Characterization of macrophages in adipose tissue is an important measure indicative of the
inflammatory state in the tissue. We found that exercising in this study resulted in a significantly lower %
CBL in the proinflammatory M1 type macrophages compared to controls. The opposite was observed for
the anti-inflammatory M2 type macrophages. In addition, the anti-inflammatory adipokine, adiponectin,
had a %CBL significantly higher in the exercise group compared to the control. The reduction we
observed in leptin following exercise is consistent with other reports describing a decrease in this
adipokine following long term aerobic and resistance exercise, and has been attributed to changes in
energy balance, improved insulin sensitivity, and other unknown factors (Bouassida et al., 2006).
Following this analysis, we compared the same parameters between the three BP medication groups,
controlling for exercise amongst other confounders in an ANCOVA analysis and plotting the adjusted
means, so that any observed effects could be attributed to the 16 weeks of taking the BP medication (or
not taking anything in the case of the normotensives), rather than to exercise. Remarkably, we found
similar trends to exercise in the RAS modifying group for the majority of the parameters, and although
these effects were not significant, a pattern of trends across many of the parameters indicated some sort of
positive regulation by the RAS modifying group. The RAS modifying group had greater decreasing
trends in the %CBL compared to the CaB group in all the body composition assessment parameters,
which included body weight, WC, fat mass, and an increasing trend for lean mass. This is in agreement
with various studies which have established a substantial role for the RAS in the regulation of body
weight. In rodent models of obesity, administration of RAS inhibitors resulted in a leaner phenotype
(Kloet et al., 2011). Although our understanding of this regulation is far from clear, some proposed
mechanisms include elevations by RAS inhibition of energy expenditure, a decrease in adipocyte
hypertrophy, and reduced food intake (ibid). It has also been found that inhibiting the activity of the
counter-regulatory ACE2/A(1–7)/MAS axis results in the opposite effect on weight regulation, mainly
increased abdominal fat mass in addition to augmented dyslipidemia, insulin insensitivity, and glucose
intolerance (Santos et al., 2008).
The main difference when comparing the trends in the %CBL of the RAS modifying group to the effects
of exercise was in the adipose tissue characterization, where the RAS modifying group did not appear to
have the same beneficial effects as was the case in the exercise group in terms of reducing the
proinflammatory M1 macrophages and increasing the M2 anti-inflammatory ones after 16 weeks.
However, with a reduction in C-reactive protein that was almost significant in the RAS modifying group
65

compared to the CaB group, it is clear that 16-weeks of RAS modifying BP medications had an effect on
reducing inflammation. It could be that after the 16 weeks, the macrophage pro- and anti- inflammatory
balance normalized in the RAS group and hence there was no need to alter the macrophage phenotype.
Alternatively, this suggests that other mechanisms may be associated with the RAS inhibitors’
amelioration of metabolic disturbances in obese cancer survivors, and that these mechanisms do not
involve an alteration of macrophage phenotype in adipose tissue. In fact, various mechanisms have been
proposed to explain how Ang II might cause metabolic disturbances, which include decreasing
adiponectin, interfering with adipogenesis, increasing ectopic fat, inhibiting GLUT4 translocation by
direct inhibition of insulin signaling, and enhancing OS, in addition to its role in mediating adipose tissue
inflammation (Kloet et al., 2011). Hence, the inhibition of the RAS in this study, which resulted in greater
improvements in insulin resistance (HOMA-IR), in MetS grading, and in blood glucose, insulin, lipid, and
adiponectin levels compared to CaB after 16 weeks, might’ve come about through an attenuation of any
of these mechanisms by virtue of Ang II inhibition.
Although these alterations of the metabolic markers by the RAS inhibitors in this study were not
significant, even small improvements in metabolic health as a result of RAS inhibition validates this
system as a potential target for developing a novel therapy for this distinct population of survivors. In
addition, given the small sample size (n=20) of this study, it is remarkable that we were able to discern a
pattern of trends in a certain direction, and perhaps if this analysis is repeated with a larger sample size,
the involvement of the RAS in the metabolic regulation of this population would be even more apparent.
This analysis suggests that further study of these drugs can be promising for the treatment of
comorbidities in BC survivors. In addition, since we observed in the ANCOVA tests in between subject
effects that exercise had a significant effect on altering all the studied variables (with the exception of
lean mass, which is not as important in the amelioration of the MetS), a combination therapy consisting of
both RAS inhibitors and exercise could be a much more potent treatment for MetS in obese, hypertensive
BC survivors than each of these interventions on their own. Although more studies need to be performed
in order to determine whether RAS inhibitors can be used safely in normotensive BC patients to
ameliorate the MetS , the results of this study definitely highlight the benefits of prescribing a RAS
modifying BP medication over another form of anti-hypertensive in obese, short term BC survivors with
elevated BP. In conclusion, developing RAS modifying drugs for this indication could be a novel
therapeutic approach for this vulnerable population whose survival is compromised as a result of the
harmful metabolic side effects of BC treatment.

66

References
Abuissa, H., Jones, P. G., Marso, S. P., & O’Keefe, J. H. (2005). Angiotensin-converting enzyme
inhibitors or angiotensin receptor blockers for prevention of type 2 diabetes: A meta-analysis of
randomized clinical trials. Journal of the American College of Cardiology, 46(5), 821–826.
https://doi.org/10.1016/j.jacc.2005.05.051
Batmanabane, M., & Vasigar, P. (2013). Anti-inflammatory activity of calcium channel blocker
lercanidipine hydrochloride. Journal of Pharmacology and Pharmacotherapeutics, 4(4), 238.
https://doi.org/10.4103/0976-500X.119707
Bedard, K., & Krause, K.-H. (2007). The NOX Family of ROS-Generating NADPH Oxidases:
Physiology and Pathophysiology. Physiological Reviews, 87(1), 245–313.
https://doi.org/10.1152/physrev.00044.2005
Berger, A. (2000). Science commentary: Th1 and Th2 responses: what are they? Bmj, 321(7258), 424–
424. https://doi.org/10.1136/bmj.321.7258.424
Bilman, V., Mares-Guia, L., Nadu, A. P., Bader, M., Campagnole-Santos, M. J., Santos, R. A. S., &
Santos, S. H. S. (2012). Decreased hepatic gluconeogenesis in transgenic rats with increased
circulating angiotensin-(1-7). Peptides, 37(2), 247–251.
https://doi.org/10.1016/j.peptides.2012.08.002
Bouassida, A., Zalleg, D., Bouassida, S., Zaouali, M., Feki, Y., Zbidi, A., & Tabka, Z. (2006). Leptin, Its
Implication in Physical Exercise and Training: a Short Review. Journal of Sports Science and
Medicine, 5, 172–181.
Canfield, R. L., Henderson, C. R. J., Cory-Slechta, D. A., Cox, C., Jusko, T. A., & Lanphear, B. P.
(2003). New England Journal. The New England Journal of Medicine, 348(16), 1517–1526.
https://doi.org/10.1056/NEJMoa1603827
Carter-Kent, C., Zein, N. N., & Feldstein, A. E. (2008). Cytokines in the pathogenesis of fatty liver and
disease progression to steatohepatitis: Implications for treatment. American Journal of
Gastroenterology, 103(4), 1036–1042. https://doi.org/10.1111/j.1572-0241.2007.01709.x
Cassis, L. A., Police, S. B., Yiannikouris, F., & Thatcher, S. E. (2008). Local adipose tissue renin-
angiotensin system. Current Hypertension Reports, 10(2), 93–98. https://doi.org/10.1007/s11906-
008-0019-9
Cavaghan, M. K., Ehrmann, D. A., & Polonsky, K. S. (2000). Interactions between insulin resistance and
insulin secretion in the development of glucose intolerance. Journal of Clinical Investigation,
106(3), 329–333. https://doi.org/10.1172/JCI10761
Cusi, K. (2010). The role of adipose tissue and lipotoxicity in the pathogenesis of type 2 diabetes. Current
Diabetes Reports, 10(4), 306–315. https://doi.org/10.1007/s11892-010-0122-6
Dalmas, E., Clément, K., & Guerre-Millo, M. (2011). Defining macrophage phenotype and function in
67

adipose tissue. Trends in Immunology, 32(7), 307–314. https://doi.org/10.1016/j.it.2011.04.008
de Haas, E. C., Oosting, S. F., Lefrandt, J. D., Wolffenbuttel, B. H., Sleijfer, D. T., & Gietema, J. A.
(2010). The metabolic syndrome in cancer survivors. The Lancet Oncology, 11(2), 193–203.
https://doi.org/10.1016/S1470-2045(09)70287-6
Dieli-Conwright, C. M., Courneya, K. S., Demark-Wahnefried, W., Sami, N., Lee, K., Buchanan, T. A.,
… Mortimer, J. E. (2018). Effects of aerobic and resistance exercise on metabolic syndrome,
sarcopenic obesity, and circulating biomarkers in overweight or obese survivors of breast cancer: A
randomized controlled trial. Journal of Clinical Oncology, 36(9), 875–883.
https://doi.org/10.1200/JCO.2017.75.7526
Dieli-Conwright, C. M., Wong, L., Waliany, S., Bernstein, L., Salehian, B., & Mortimer, J. E. (2016). An
observational study to examine changes in metabolic syndrome components in patients with breast
cancer receiving neoadjuvant or adjuvant chemotherapy. Cancer, 122(17), 2646–2653.
https://doi.org/10.1002/cncr.30104
Dominici, F. P., Burghi, V., Muñoz, M. C., & Giani, J. F. (2014). Modulation of the action of insulin by
angiotensin-(1-7). Clinical Science (London, England : 1979), 126(9), 613–30.
https://doi.org/10.1042/CS20130333
Feltenberger, J. D., Andrade, J. M. O., Paraíso, A., Barros, L. O., Filho, A. B. M., Sinisterra, R. D. M., …
Santos, S. H. S. (2013). Oral formulation of angiotensin-(1-7) improves lipid metabolism and
prevents high-fat diet-induced hepatic steatosis and inflammation in mice. Hypertension, 62(2),
324–30. https://doi.org/10.1161/HYPERTENSIONAHA.111.00919
Ferder, L., Inserra, F., & Martínez-Maldonado, M. (2006). Inflammation and the metabolic syndrome:
Role of angiotensin II and oxidative stress. Current Hypertension Reports, 8(3), 191–198.
https://doi.org/10.1007/s11906-006-0050-7
Gezgen, G., Roach, E. C., Kizilarslanoglu, M. C., Petekkaya, I., & Altundag, K. (2012). Metabolic
syndrome and breast cancer: an overview. Journal of B.U.ON. : Official Journal of the Balkan
Union of Oncology, 17(2), 223–9. Retrieved from http://www.ncbi.nlm.nih.gov/pubmed/22740197
Ghigliotti, G., Barisione, C., Garibaldi, S., Fabbi, P., Brunelli, C., Spallarossa, P., … Arsenescu, V.
(2014). Adipose tissue immune response: Novel triggers and consequences for chronic
inflammatory conditions. Inflammation, 37(4), 1337–1353. https://doi.org/10.1007/s10753-014-
9914-1
Gloire, G., Legrand-Poels, S., & Piette, J. (2006). NF-κB activation by reactive oxygen species: Fifteen
years later. Biochemical Pharmacology, 72(11), 1493–1505.
https://doi.org/10.1016/j.bcp.2006.04.011
Greenberg, A. S., & Obin, M. S. (2006). Obesity and the role of adipose tissue in inflammation and
metabolism. The American Journal of Clinical Nutrition, 83(2), 461–465.
https://doi.org/10.1093/ajcn/83.2.461S
Gregor, M. F., & Hotamisligil, G. S. (2011). Inflammatory Mechanisms in Obesity. Annual Review of
Immunology, 29(1), 415–445. https://doi.org/10.1146/annurev-immunol-031210-101322
Guilherme, A., Virbasius, J. V., Puri, V., & Czech, M. P. (2008). Adipocyte dysfunctions linking obesity
to insulin resistance and type 2 diabetes. Nature Reviews Molecular Cell Biology, 9(5), 367–377.
https://doi.org/10.1038/nrm2391
68

Han, C. Y. (2016). Roles of Reactive Oxygen Species on Insulin Resistance in Adipose Tissue. Diabetes
Metab J, 40, 272–279. https://doi.org/10.4093/dmj.2016.40.4.272
Hartigh, L. J. Den, Omer, M., Goodspeed, L., Wang, S., Wietecha, T., Brien, K. D. O., & Han, C. Y.
(2016). the Onset of Insulin Resistance and Attenuates Adipose Tissue Inflammation in Obesity.
https://doi.org/10.1161/ATVBAHA.116.308749
Hayes, S. C., Spence, R. R., Galvão, D. A., & Newton, R. U. (2009). Australian Association for Exercise
and Sport Science position stand : Optimising cancer outcomes through exercise, 12, 428–434.
https://doi.org/10.1016/j.jsams.2009.03.002
Holmes, M. D., Chen, W. Y., Feskanich, D., Kroenke, C. H., & Colditz, G. A. (2005). Physical activity
and survival after breast cancer diagnosis. Jama, 293(20), 2479–86.
https://doi.org/10.1001/jama.293.20.2479
Hurrle, S., & Hsu, W. H. (2017). The etiology of oxidative stress in insulin resistance. Biomedical
Journal, 40(5), 257–262. https://doi.org/10.1016/j.bj.2017.06.007
irwin.PDF. (n.d.).
Iwai, M., Chen, R., Imura, Y., & Horiuchi, M. (2007). TAK-536, a New AT1 Receptor Blocker,
Improves Glucose Intolerance and Adipocyte Differentiation. American Journal of Hypertension,
20(5), 579–586. https://doi.org/10.1016/j.amjhyper.2006.12.010
Kalupahana, N. S., Massiera, F., Quignard-Boulange, A., Ailhaud, G., Voy, B. H., Wasserman, D. H., &
Moustaid-Moussa, N. (2012). Overproduction of angiotensinogen from adipose tissue induces
adipose inflammation, glucose intolerance, and insulin resistance. Obesity, 20(1), 48–56.
https://doi.org/10.1038/oby.2011.299
Kaphingst, K. A., Persky, S., & Lachance, C. (2010). NIH Public Access, 14(4), 384–399.
https://doi.org/10.1080/10810730902873927.Testing
Kershaw, E. E., & Flier, J. S. (2004). Adipose tissue as an endocrine organ. Journal of Clinical
Endocrinology and Metabolism, 89(6), 2548–2556. https://doi.org/10.1210/jc.2004-0395
Kloet, A. D. De, Krause, E. G., & Woods, S. C. (2011). The Renin Angiotensin System and the Metabolic
Syndrome. Physiol Behav, 100(5), 525–534. https://doi.org/10.1016/j.physbeh.2010.03.018.The
Kohlgruber, A., & Lynch, L. (2015). Adipose Tissue Inflammation in the Pathogenesis of Type 2
Diabetes. Current Diabetes Reports, 15(11). https://doi.org/10.1007/s11892-015-0670-x
Kushiyama, A., Shojima, N., Ogihara, T., Inukai, K., Sakoda, H., Fujishiro, M., … Asano, T. (2005).
Resistin-like molecule β activates MAPKs, suppresses insulin signaling in hepatocytes, and induces
diabetes, hyperlipidemia, and fatty liver in transgenic mice on a high fat diet. Journal of Biological
Chemistry, 280(51), 42016–42025. https://doi.org/10.1074/jbc.M503065200
Lê, K., Mahurkar, S., Alderete, T. L., Hasson, R. E., Adam, T. C., Kim, J. S., … Goran, M. I. (2011).
Subcutaneous Adipose Tissue Macrophage Infiltration Is Associated With Hepatic and Visceral Fat
Deposition, Hyperinsulinemia, and Stimulation of NF-kB Stress Pathway. Diabetes, 60(11), 2802–9.
https://doi.org/10.2337/db10-1263.
Liu, C., Lv, X. H., Li, H. X., Cao, X., Zhang, F., Wang, L., and Yang, J. K. (2012). Angiotensin-(1-7)
suppresses oxidative stress and improves glucose uptake via Mas receptor in adipocytes. Acta
Diabetologica, 49(4), 291–299. https://doi.org/10.1007/s00592-011-0348-z
69

Lumeng, C. N., Bodzin, J. L., & Saltiel, A. R. (2007). Obesity induces a phenotipic switch in adipose
tissue macrophage polarization. J Clin Invest, 117(1), 175–184.
https://doi.org/10.1172/JCI29881.The
Lumeng, C. N., Delproposto, J. B., Westcott, D. J., & Saltiel, A. R. (2008). Phenotypic switching of
adipose tissue macrophages with obesity is generated by spatiotemporal differences in macrophage
subtypes. Diabetes, 57(12), 3239–3246. https://doi.org/10.2337/db08-0872
M.D, H. C. L. (2014). NIH Public Access. National Institutes of Health, 302–306.
https://doi.org/10.1200/EdBook
Mantell, B. S., Stefanovic-Racic, M., Yang, X., Dedousis, N., Sipula, I. J., & O’Doherty, R. M. (2011).
mice lacking NKT cells but with a complete complement of CD8+ T-Cells are not protected against
the metabolic abnormalities of diet-induced obesity. PLoS ONE, 6(6), 1–8.
https://doi.org/10.1371/journal.pone.0019831
Marcus, Y., Shefer, G., Sasson, K., Kohen, F., Limor, R., Pappo, O., … Stern, N. (2013). Angiotensin 1-7
as means to prevent the metabolic syndrome: lessons from the fructose-fed rat model. Diabetes,
62(4), 1121–30. https://doi.org/10.2337/db12-0792
Marín-ramos, N. I., Ortega-gutiérrez, S., & López-rodríguez, M. L. (2018). Seminars in Cancer Biology
Blocking Ras inhibition as an antitumor strategy. Seminars in Cancer Biology, (December 2017), 0–
1. https://doi.org/10.1016/j.semcancer.2018.01.017
Mason, A. (2009). NIH Public Access, 19(9), 389–399.
https://doi.org/10.1016/j.asieco.2008.09.006.EAST
McNelis, J. C., & Olefsky, J. M. (2014). Macrophages, Immunity, and Metabolic Disease. Immunity,
41(1), 36–48. https://doi.org/10.1016/j.immuni.2014.05.010
Mouhayar, E., & Salahudeen, A. (2011). Hypertension in cancer patients. Texas Heart Institute Journal /
from the Texas Heart Institute of St. Luke’s Episcopal Hospital, Texas Children’s Hospital, 38(3),
263–265.
Muñoz, M. C., Giani, J. F., Burghi, V., Mayer, M. A., Carranza, A., Taira, C. A., & Dominici, F. P.
(2012). Regulatory Peptides The Mas receptor mediates modulation of insulin signaling by
angiotensin- ( 1 – 7 ). Regulatory Peptides, 177(1–3), 1–11.
https://doi.org/10.1016/j.regpep.2012.04.001
Newton, R. U., & Galva, D. A. (2008). Exercise in Prevention and Management of Cancer, 135–146.
https://doi.org/10.1007/s11864-008-0065-1
Nguyen, M. T. A., Favelyukis, S., Nguyen, A. K., Reichart, D., Scott, P. A., Jenn, A., … Olefsky, J. M.
(2007). A subpopulation of macrophages infiltrates hypertrophic adipose tissue and is activated by
free fatty acids via toll-like receptors 2 and 4 and JNK-dependent pathways. Journal of Biological
Chemistry, 282(48), 35279–35292. https://doi.org/10.1074/jbc.M706762200
Olefsky, J. M., & Glass, C. K. (2010). Macrophages, Inflammation, and Insulin Resistance. Annual
Review of Physiology (Vol. 72). https://doi.org/10.1146/annurev-physiol-021909-135846
Osborn, O., & Olefsky, J. M. (2012). The cellular and signaling networks linking the immune system and
metabolism in disease. Nature Medicine, 18(3), 363–374. https://doi.org/10.1038/nm.2627
Papinska, A. M., Soto, M., Meeks, C. J., & Rodgers, K. E. (2016). Long-term administration of
70

angiotensin (1-7) prevents heart and lung dysfunction in a mouse model of type 2 diabetes (db/db)
by reducing oxidative stress, inflammation and pathological remodeling. Pharmacological
Research, 107, 372–380. https://doi.org/10.1016/j.phrs.2016.02.026
Passos-Silva, D. G., Verano-Braga, T., & Santos, R. a S. (2013). Angiotensin-(1-7): beyond the cardio-
renal actions. Clinical Science (London, England : 1979), 124(7), 443–56.
https://doi.org/10.1042/CS20120461
Peng, H., Sarwar, Z., Yang, X. P., Peterson, E. L., Xu, J., Janic, B., … Rhaleb, N. E. (2015). Profibrotic
Role for Interleukin-4 in Cardiac Remodeling and Dysfunction. Hypertension, 66(3), 582–589.
https://doi.org/10.1161/HYPERTENSIONAHA.115.05627
Praso, S., Jusupovic, F., Ramic, E., Gledo, I., Ferkovic, V., Novakovic, B., & Hadzovic, E. (2012).
Obesity as a risk factor for artherial hypertension. Materia Socio-Medica, 24(2), 87–90.
https://doi.org/10.5455/msm.2012.24.87-90
Qiang, G., Kong, H. W., Fang, D., McCann, M., Yang, X., Du, G., … Liew, C. W. (2016). The obesity-
induced transcriptional regulator TRIP-Br2 mediates visceral fat endoplasmic reticulum stress-
induced inflammation. Nature Communications, 7, 1–14. https://doi.org/10.1038/ncomms11378
Rodgers, K. E., Oliver, J., & DiZerega, G. S. (2006). Phase I/II dose escalation study of angiotensin 1-7
[A(1-7)] administered before and after chemotherapy in patients with newly diagnosed breast
cancer. Cancer Chemotherapy and Pharmacology, 57(5), 559–568. https://doi.org/10.1007/s00280-
005-0078-4
Santos, R. A. S., Ferreira, A. J., & Sim, A. C. (2008). Recent advances in the angiotensin-converting
enzyme 2 – angiotensin ( 1 – 7 )– Mas axis, 519–527.
https://doi.org/10.1113/expphysiol.2008.042002
Santos, S. H. S., Andrade, J. M. O., Fernandes, L. R., Sinisterra, R. D. M., Sousa, F. B., Feltenberger, J.
D., … Santos, R. A. S. (2013). Oral Angiotensin-(1-7) prevented obesity and hepatic inflammation
by inhibition of resistin/TLR4/MAPK/NF-κB in rats fed with high-fat diet. Peptides, 46, 47–52.
https://doi.org/10.1016/j.peptides.2013.05.010
Santos, S. H. S., Braga, J. F., Mario, E. G., Prto, L. C. J., Rodrigues-Machado, M. D. G., Murari, A., …
Santos, R. A. S. (2010). Improved Lipid and Glucose Metabolism in Transgenic Rats with Increased
Circulating Angiotensin-(1-7). Arteriosclerosis, Thrombosis, and Vascular Biology, 30(5), 953–961.
https://doi.org/10.1161/ATVBAHA.109.200493
Santos, S. H. S., Fernandes, L. R., Pereira, C. S., Guimares, A. L. S., de Paula, A. M. B., Campagnole-
Santos, M. J., … Santos, R. A. S. (2012). Increased circulating angiotensin-(1-7) protects white
adipose tissue against development of a proinflammatory state stimulated by a high-fat diet.
Regulatory Peptides, 178(1–3), 64–70. https://doi.org/10.1016/j.regpep.2012.06.009
Santos, S. H. S., Giani, J. F., Burghi, V., Miquet, J. G., Qadri, F., Braga, J. F., … Bader, M. (2014). Oral
administration of angiotensin-(1-7) ameliorates type 2 diabetes in rats. Journal of Molecular
Medicine, 92(3), 255–265. https://doi.org/10.1007/s00109-013-1087-0
Singh, P., Castillo, A., Islam, M. T., & Majid, D. S. A. (2017). Evidence for Prohypertensive,
Proinflammatory Effect of Interleukin-10 During Chronic High Salt Intake in the Condition of
Elevated Angiotensin II Level. Hypertension (Dallas, Tex. : 1979), 70(4), 839–845.
https://doi.org/10.1161/HYPERTENSIONAHA.117.09401
71

Slamkova, M., Zorad, S., & Krskova, K. (2016). Alternative renin-angiotensin system pathways in
adipose tissue and their role in the pathogenesis of obesity. Endocrine Regulations, 50(4), 229–240.
https://doi.org/10.1515/enr-2016-0025
Strissel, K. J., Stancheva, Z., Miyoshi, H., James, W., Defuria, J., Jick, Z., & Greenberg, A. S. (2007).
Adipocyte Death , Adipose Tissue Remodeling and Obesity Complications and Martin S . Obin ,
PhD . From the Obesity & Metabolism Laboratory , JM-USDA Human Nutrition Research Center
on Aging at Tufts University , Boston , MA 02111 Running title : adipocyte, (August).
Surmi, B. K., & Hasty, A. H. (2008). Macrophage infiltration into adipose tissue: Initiation, propagation
and remodeling. Future Lipidology, 3(5), 545–556. https://doi.org/10.2217/17460875.3.5.545
Suzuki, H., & Eguchi, S. (2006). Adiponectin versus angiotensin II: Key pathological role of their
misbalance. Kidney International, 70(10), 1678–1679. https://doi.org/10.1038/sj.ki.5001936
Tateya, S., Kim, F., & Tamori, Y. (2013). Recent advances in obesity-induced inflammation and insulin
resistance. Frontiers in Endocrinology, 4(AUG), 1–14. https://doi.org/10.3389/fendo.2013.00093
Wentworth, J. M., Naselli, G., Brown, W. A., & Doyle, L. (2010). Pro-inflammatory CD11c+ CD206+
adipose tissue macrophages are associated with insulin resistance in human obesity. Diabetes,
59(July), 1648–1656. https://doi.org/10.2337/db09-0287.
Wills, E. (1963). Role of fatty acid in the pathogenesis of insulin resistance and NIDDM. Biological
Chemistry Journal, 113, 315.
Xu, H., GT, B., Q, Y., G, T., D, Y., C, C., … H, C. (2003). Chronic inflammation in fat plays a crucial
role in the development of obesity-related insulin resistance. Journal of Clinical Investigation,
112(12), 1821–1830. https://doi.org/10.1172/JCI19451
Yu, R., Kim, C. S., Kwon, B. S., & Kawada, T. (2006). Mesenteric adipose tissue-derived monocyte
chemoattractant protein-1 plays a crucial role in adipose tissue macrophage migration and activation
in obese mice 1599. Obesity.(Silver.Spring), 14(1930–7381 (Print)), 1353–1362.
https://doi.org/10.1038/oby.2006.153

Abstract (if available)

Abstract The prevalence of the metabolic syndrome (MetS), a cluster of health conditions which include obesity, hypertension, glucose intolerance, insulin sensitivity, and a poor lipid profile, is increasing at an alarming rate. It contributes to the development of type 2 diabetes (T2D), cardiovascular disease, and death, and is known to affect certain vulnerable populations, such as breast cancer (BC) survivors, increasing their risk for cancer recurrence. While exercise has been proven to be an effective strategy for the prevention and treatment of these conditions, some individuals are not compliant with this intervention, and current medications have proven insufficient. Although the etiology of the MetS and T2D are complex and remain poorly understood, pathologies associated with obesity, including oxidative stress (OS) and inflammation of adipose tissue resulting from infiltration of proinflammatory macrophages, have been shown to be involved in the pathogenesis of these conditions. Studies have shown that the renin angiotensin system (RAS) plays a key role in metabolic regulation. Chronic activation of the pathological arm of the RAS, of which the key peptide hormone is angiotensin II (Ang II), has been associated with OS and inflammation leading to impairment of glucose and lipid metabolism in rodent models of MetS and T2D. Hence, the development of new therapeutic targets which modulate the RAS might be a viable strategy for the prevention and treatment of the MetS and metabolic diseases. In this thesis, we investigated the potential of RAS modifying therapies, which oppose the action of Ang II, to ameliorate severe metabolic disease in a rodent model of T2D, and to improve metabolic health in a clinical population of BC survivors. As described in the first chapter of this thesis, we used a mouse model of severe diabetes, (db/db) mice, to analyze the role of Angiotensin-(1-7)[A(1-7)], a counter-regulatory hormone to Ang II, in ameliorating the metabolic disturbances associated with T2D. As described in the second chapter of this thesis, we assessed in a population of hypertensive, obese BC survivors the effects of taking RAS modifying blood pressure (BP) medications, including ACE inhibitors and angiotensin II receptor blockers (ARBs), on inflammation and metabolic outcomes, comparing these to the effects of a non-RAS modifying BP drug. In the animals, A(1-7) treatment significantly reduced fasting blood glucose (FBG) levels and reduced markers of proinflammatory macrophage infiltration in adipose tissue. This phenomenon may be associated with a reduction in OS also observed in these animals treated with A(1-7). In the clinical population, RAS inhibition via the BP control medications showed promise in decreasing inflammation and improving metabolic health, especially when combined with an exercise regimen. Altogether, these data suggest that modulation of the RAS may be a beneficial therapeutic strategy in the treatment of severe diabetes and metabolic disorders, and for the prevention of the development of metabolic disease in certain vulnerable populations, such as BC survivors. Further research into the RAS can yield future novel therapies that can be used alongside lifestyle interventions, such as exercise, to dramatically enhance the health of those at risk for serious metabolic disease and its consequences.

Linked assets

University of Southern California Dissertations and Theses

Conceptually similar

PDF

Modulation of the renin-angiotensin system (RAS) for the treatment of COVID-19

PDF

Angiotensin (1-7): a novel treatment for diabetes-induced kidney and heart dysfunction

PDF

Averting dementia: renin-angiotensin system and angiogenic cells in cognitive decline

PDF

Alterations in renin-angiotensin system signaling in SARS-CoV2 infection

PDF

The peptide angiotensin-(1-7) as a novel treatment for complications induced by type 2 diabetes mellitus

PDF

Laser induced modulation of ocular renin-angiotensin system for treatment of dry age-related macular degeneration

PDF

Effects of combined thermal and radiation injury on the renin-angiotensin system

PDF

Factors that may impact drug disposition and metabolism

PDF

From risk mitochondrial and metabolic phenotype towards a precision medicine approach for Alzheimer's disease

PDF

Exploration and expansion of novel therapeutic strategies targeting brain metabolism in neurodegenerative diseases

PDF

Elastin like polypeptide tagged angiotensin (1-7) is a potential effective treatment for retinitis pigmentosa

PDF

Small molecule lipoxin analogue for prevention of retinal degeneration

PDF

Therapeutic potential of host defense peptides for the treatment of cystic fibrosis lung disease

PDF

Modulation of immune response in Systemic Lupus Erythematosus by synthetic lipoxin analogue, NAP1051

PDF

RPE secretome for the treatment of retinal degeneration in the RCS rat

PDF

Retinal pigment epithelium regeneration using ND: YAG laser on mouse model

PDF

Methicillin-resistant Staphylococcus aureus: molecular epidemiology, virulence in disease, and antibiotic modulation of virulence

PDF

Neuroinflammation and ApoE4 genotype in at-risk female aging: implications for Alzheimer's disease

PDF

Investigating sodium butyrate as a potential treatment for alcohol liver disease through the gut-liver axis

PDF

Therapeutic potential of Rhesus theta defensin-1 for the treatment of COVID-19 pneumonia

Asset Metadata

Creator Amzaleg, Tamar (author)

Core Title Renin-angiotensin system modulation for the prevention and treatment of metabolic dysfunction

School School of Pharmacy

Degree Master of Science

Degree Program Clinical and Experimental Therapeutics

Publication Date 12/12/2018

Defense Date 12/11/2018

Publisher University of Southern California (original), University of Southern California. Libraries (digital)

Tag angiotensin,Breast,cancer,Diabetes,Exercise,metabolic,OAI-PMH Harvest,obesity,renin,syndrome,type 2

Format application/pdf (imt)

Language English

Contributor Electronically uploaded by the author (provenance)

Advisor Louie, Stan (committee chair), Dieli-Conwright, Christina (committee member), Rodgers, Kathleen (committee member)

Creator Email tamar.e.amzaleg@gmail.com,tamar.e.cohen@gmail.com

Permanent Link (DOI) https://doi.org/10.25549/usctheses-c89-112024

Unique identifier UC11676702

Identifier etd-AmzalegTam-7011.pdf (filename),usctheses-c89-112024 (legacy record id)

Legacy Identifier etd-AmzalegTam-7011.pdf

Dmrecord 112024

Document Type Thesis

Format application/pdf (imt)

Rights Amzaleg, Tamar

Type texts

Source University of Southern California (contributing entity), University of Southern California Dissertations and Theses (collection)

Access Conditions The author retains rights to his/her dissertation, thesis or other graduate work according to U.S. copyright law. Electronic access is being provided by the USC Libraries in agreement with the a...

Repository Name University of Southern California Digital Library

Repository Location USC Digital Library, University of Southern California, University Park Campus MC 2810, 3434 South Grand Avenue, 2nd Floor, Los Angeles, California 90089-2810, USA