University of Southern California Dissertations and Theses

Cell surface translocation and therapeutic targeting of GRP78

(USC Thesis Other)

Cell surface translocation and therapeutic targeting of GRP78

PDF

Download a page range

Download transcript

Copy asset link

Request this asset

Transcript (if available)

Content

CELL SURFACE TRANSLOCATION AND THERAPEUTIC
TARGETING OF GRP78
by
Pu Zhang

A Thesis Presented to the
FACULTY OF THE USC GRADUATE SCHOOL
UNIVERSITY OF SOUTHERN CALIFORNIA
In Partial Fulfillment of the
Requirements for the Degree
MASTER OF SCIENCE
(MOLECULAR MICROBIOLOGY & IMMUNOLOGY)

May 2019

Copyright 2019 Pu Zhang
2
Table of contents

Table of Contents 2
List of Figures 3
Abstract 4
Introduction 5
Materials and Methods 10
Results 17
Discussion 24
Acknowledgements 27
References 29

3
List of Figures
Figure 1. The C-terminal proline-rich region is critical for the complex formation of GRP78 and
CD44v
Figure 2. The C-terminal proline-rich region is critical for GRP78 cell surface translocation in
breast cancer cell lines
Figure 3. The C-terminal proline-rich region of GRP78 is a novel modulator of STAT3 signaling
Figure 4. The secretory small peptide encoding the C-terminal proline-rich region of GRP78
reduces CD44v and Cyclin D1 levels
Figure 5. The C-terminal proline-rich region is critical for GRP78 cell surface translocation in
HCT116 colon cancer cells

4
Abstract
Atypical translocation of the 78 kDa glucose-regulated protein (GRP78) to the plasma
membrane allows GRP78 to exert novel signaling functions independent of its chaperone activity
in the endoplasmic reticulum (ER). Cell surface GRP78 (csGRP78) is up-regulated in a diverse
range of cancer cells and minimally in the normal cells. However, csGRP78 largely exists as a
peripheral protein outside the plasma membrane. How it can translocate from the intracellular
location to the cell surface remains largely unknown. The understanding of the underlying
mechanisms of this translocation of GRP78 should facilitate the development of new therapeutic
strategies to specifically target cancer cells. Previously our lab uncovered a variant isoform of
CD44, a transmembrane protein and an important marker of breast cancer stem cells, as a novel
binding partner of csGRP78. In this study, we discovered that the proline-rich region at the C-
terminus of GRP78 is critical for the formation of a complex of GRP78 and CD44v. We further
showed that this proline-rich region plays an important role in GRP78 cell surface translocation
using cell surface biotinylation followed by avidin pull-down. We then developed a small peptide
encoding the sequence spanning the proline-rich region of GRP78. We showed that overexpression
of the secretory version of this peptide or application of conditional medium containing the
secretory peptide reduced CD44v and Cyclin D1 levels. Taken together, our study uncovered a
novel mechanism underlying GRP78 cell surface translocation. Our results suggest that targeting
the interaction between GRP78 and its partner proteins may have therapeutic implications against
cancer.

5
Introduction
The glucose-regulated proteins (GRPs) are a group of stress inducible molecular chaperones
that are mainly found in the endoplasmic reticulum (ER) and in the mitochondria(Lee 2014).
GRPs, including GRP78, GRP94, GRP170, and GRP75 belong to heat shock protein (HSP)
family, and they facilitate protein folding and protein quality control. They maintain the
homeostasis of the ER and mitochondria by regulating protein quality control and binding
calcium ions(Lee 2014).
The 78 kilo Dalton glucose-regulated protein (GRP78), also known as immunoglobulin
heavy-chain binding protein (BiP), is a member of the heat shock protein 70 (HSP70)
superfamily(Ni and Lee 2007). GRP78 is one of the major molecular chaperones residing in the
ER. Its highly-conserved structure includes an ATP binding domain, a substrate binding domain,
and a KDEL-motif at the C-terminus (Lee 2005). With its ATPase activity, GRP78 forms a
complex with nascent polypeptides and facilitates their folding and maturation in the ER lumen.
In addition, GRP78 also prevents intermediates from aggregating, targets misfolded proteins for
proteasomal degradation, and serves as an important regulator of the unfolded protein response
(UPR) (Lee 2014). Under non-stressed conditions, GRP78 binds to three transmembrane ER
stress sensors, including IRE1, PERK and ATF6, and maintains them in their inactive forms.
Upon ER stress, misfolded proteins accumulate in the ER lumen and titrate GRP78 away from
the ER stress sensors, leading to their activation followed by UPR, thus impacting cell survival
and apoptosis (Bertolotti et al. 2000).
Beyond its functions in the ER, GRP78 also exists in other cellular locations such as the
mitochondria, cell surface, cytosol and secreted vesicles and plays critical roles in cell
proliferation, apoptosis, invasion and immunity. For instance, GRP78 co-localizes with RAF1 on
6
the outer surface of mitochondria and maintains mitochondrial permeability, thus preventing cell
apoptosis (Shu et al. 2008). GRP78 is also found in the cytoplasm and helps assembly of viral
proteins and regulation of UPR signaling (Ni, Zhang, and Lee 2011). In addition, secreted
GRP78 is detected in the extracellular space and regulates signaling pathways critical for cell
proliferation and survival (Kern et al. 2009).
In particular, GRP78 can translocate to the cell surface of specific cell types, such as cancer
cells, and this process is enhanced by ER stress. Cell surface GRP78 exerts novel signaling
functions independent of its chaperone activity in the ER. For examples, csGRP78 forms a
complex with the protease inhibitor, α2-macroglubulin (α2M*), and promotes cell proliferation,
motility and metastasis through downstream extracellular-signal-regulated kinase 1/2 (ERK1/2),
Protein kinase B (Akt), nuclear factor κB (NF-κB) and p21 activated kinase 2 (PAK-2) signaling
pathways in 1-LN prostate cancer cells (Misra, Deedwania, and Pizzo 2005, 2006). Cell surface
GRP78 also forms a complex with Cripto protein, a multifunctional glycosylphosphatidylinositol
(GPI) -anchored protein which plays critical roles in embryogenesis and tumor progression by
inhibiting transforming growth factor-β (TGF-β) signaling (Shani et al. 2008, Spike et al. 2014).
Importantly, the antibody against N-terminus of GRP78 can inhibit the oncogenic effect of
Cripto signaling (Kelber et al. 2009). GRP78 also binds to and acts in concert with a GPI-
anchored protein, CD109, on the cell surface of cancer cell, thus inhibiting TGF-β signaling
through promoting degradation of TGF-β receptors (Tsai et al. 2018). GRP78 is also expressed
on the proliferating endothelial cell surface and promotes cell survival via association with a
GPI-anchored protein, T-cadherin (Philippova et al. 2008). Cell surface GRP78 also mediates
viral entry into host cells. For instance, GRP78 acts as a receptor for dengue virus serotype 2 and
7
aids its entry into liver cancers. This effect can be neutralized by treatment with antibody against
N- or C-terminus of GRP78 (Jindadamrongwech, Thepparit, and Smith 2004).
GRP78 is preferentially expressed on the cell surface of cancer cells or other cell types under
stress conditions, which suggests an opportunity for specific tumor targeting with minimal side
effects (Lee 2014, Ni, Zhang, and Lee 2011). Previous studies have demonstrated promise with
targeted therapy against GRP78. Synthetic peptides containing the GRP78-binding motif,
together with a programmed-cell-death-inducing sequence or cytotoxic drugs, can promote
cancer cell apoptosis both in vitro and in vivo. For examples, the taxol-conjugated cyclic peptide,
Pep42, can specifically bind to csGRP78 in melanoma cells and induce cell death (Kim et al.
2006). A mung bean trypsin inhibitor-fusion protein containing the GRP78 binding peptide,
WIFPWIQL, induces apoptosis and inhibits tumor growth in colorectal cancer (Li et al. 2014).
Furthermore, monoclonal antibody targeting csGRP78 has shown great promise as a potential
strategy for anti-cancer therapy. PAT-SM6 is a human monoclonal IgM antibody isolated from a
gastric cancer patient, and it can promote the apoptosis and lipid accumulation in human multiple
myeloma cells through binding to csGRP78 and low-density lipoproteins on the cell surface
(Rasche et al. 2013). MAb159, a GRP78-specific mouse monoclonal immunoglobulin G (IgG)
antibody, has been found to suppress the growth of breast, colon and lung xenografts in part
through inhibition of the PI3K signaling pathway (Liu et al. 2013). Another mouse monoclonal
IgG antibody, C107, targets the C-terminal of GRP78, and it inhibits the growth of melanoma
xenografts (de Ridder, Ray, and Pizzo 2012).
GRP78 primarily exists as a peripheral protein on the cell surface, and the mechanism
underlying GRP78 cell surface translocation has just been emerging (Tsai et al. 2015). GRP78
interacting partner proteins, such as MTJ1 or Par-4, may facilitate its translocation, but these
8
processes are thought to be cell type specific and may work in combination (Misra et al. 2005,
Burikhanov et al. 2009). Considering the great potential of targeting cell surface GRP78 in
cancer therapy, it is of vital importance to further understand how GRP78 is tranlocated from the
ER to the cell surface, which may have a profound impact in developing novel cancer therapeutic
agents.
CD44 is a type I transmembrane protein and has been widely used as a cancer stem cell
marker in breast cancer (Liu et al. 2010, Yan, Zuo, and Wei 2015). It is known to plays critical
roles in facilitating cancer cell survival, migration and multi-drug resistance (Hiraga, Ito, and
Nakamura 2013, Ishimoto et al. 2011). CD44 is alternatively spliced to produce variable
isoforms by incorporating extra exons into the extracellular juxtamembrane region (Zoller 2011).
In addition to its role as a receptor for a variety of extracellular matrix components, CD44
variant isoforms act as a co-receptor which binds VEGF, FGF2 and osteopontin and then present
them to their receptors (Zoller 2011). It has been reported that the expression of CD44v3-10,
instead of CD44v8-10 and CD44 standard isoform (CD44s), correlates with a poor prognosis of
breast cancer patients (Hu et al. 2017).
Our previous study has uncovered that CD44v3-10 (CD44 containing variable exon 3 to 10)
is a novel partner protein of cell surface GRP78. Considering the potential importance of partner
proteins in facilitating GRP78 cell surface translocation, we further characterized the binding
region of GRP78 to CD44v3-10 using a GST pull-down assay. We found that the proline-rich
region at the C-terminal of GRP78 is critical for its interaction with CD44v3-10. Reduced
surface expression was observed after mutation was introduced into the C-terminal proline-rich
region, suggesting the proline-rich region is important for the cell surface translocation of
GRP78. We further showed that overexpression of GRP78 with a mutated proline-rich region
9
failed to rescue STAT3 signaling after GRP78 knockdown, indicating that the C-terminal
proline-rich region of GRP78 is a novel modulator of STAT3 signaling. The C-terminal proline-
rich region of GRP78 is critical for GRP78 to form a complex with its partner proteins and to
translocate to cell surface. Therefore, we developed a small peptide the sequence spanning the
proline-rich region of GRP78 and found that cells treated with this peptide exhibited reduced
CD44v and Cyclin D1 levels, suggesting that targeting the interaction between GRP78 and its
partner proteins may have therapeutic implications for cancer treatment.
10
Materials and Methods
Cell culture
The tamoxifen-resistant MCF7 human breast cancer cell line (MCF7-LR) was a gift from Dr.
Rachel Schiff (Baylor College of Medicine, TX). MCF7-LR cells were cultured in phenol-red
free RPMI 1640 medium containing the following components: 5% charcoal-stripped fetal
bovine serum, 100 nM 4-hydroxy-tamoxifen, 200 nM glutamine, 10 IU/mL penicillin, 10 µg/mL
streptomycin, and 2.5 µg/mL fungizone. The human breast cancer cell line, MDA-MB-231, was
a gift from Dr. Shyamala Maheswaran (Harvard Medical School, MA). MDA-MB-231 cells
were cultured in Dulbecco’s modified Eagle’s medium (DMEM) containing the following
components: 10% fetal bovine serum, 4.5 g/L glucose and 4 mM glutamine. The human colon
cancer cell line, HCT116, was cultured in McCoy’s 5A medium containing the following
components: 10% fetal bovine serum, 4.5 g/L glucose, 4 mM glutamine, 100 IU/mL penicillin
and 100 µg/mL streptomycin. The large T antigen transformed human embryonic kidney cell
line, 293T, was cultured in DMEM medium described above.
Plasmids and cloning
A FLAG-tagged GRP78 expression plasmid was constructed in previous study (Zhang et al.
2013). A Glutathione S-transferase (GST) bacterial expression plasmid pGEX-4T-1 was
obtained from GE Healthcare (Chicago, IL). The full-length (FL, a.a. 19-654) and truncated
human GRP78, including the N-terminal half (NT, a.a. 19-407), the C-terminal half (CT, a.a.
413-654), ∆KDEL (a.a. 19-650), ∆C11 (a.a. 19-643), ∆C17 (a.a. 19-637) and ∆C73 (a.a. 19-
581), were generated by PCR amplification, and the template was the GRP78 coding sequence
from the FLAG-tagged GRP78 expression plasmid. Then GST-tagged GRP78 expression
plasmids were constructed through inserting full-length and truncated human GRP78 in-frame
11
into a pGEX -4T-1 bacterial expression plasmid (GE Healthcare,Chicago, IL) at the BamHI and
XhoI sites. The constructs were illustrated in Figure 1b. The pcDNA3 expression vector was
obtained from Thermo Scientific (Waltham, MA). The HA-tagged CD44 containing v3-v10
(CD44v-HA) was generated by PCR amplification using a primer containing the HA tag
sequence, and the template was from the cDNA library of MCF7-LR cells. Then, a CD44v-HA
expression plasmid was constructed through inserting CD44v-HA into the pcDNA3 expression
vector at KpnI and EcoRI sites. The full-length GRP78 bearing the PPP to AAA mutation (F78-
AAA, a.a. 640-642) was generated by PCR amplification, and the template was the GRP78
coding sequence from the FLAG-tagged GRP78 expression plasmid. Then the F78-AAA
expression plasmid was constructed by inserting F78-AAA into the pcDNA3 expression vector
at the BamHI and XhoI sites. The small peptide expression vectors were constructed by inserting
the annealed sequence shown below into the pcDNA3 expression vector at BamHI and EcoRI
sites.
Secretion signal-sorting sequence-partial GRP78-Forward:
GATCCATGCCGAGATCGTGCTGCAGCCGCTCGGGGGCCCTGTTGCTGGCCTTGCTGC
TTCAGGCCTCCATGGAAGTGCGTGGCTGGTGCCTGGAGAGCAGCCAGTGTCAGGAC
CTCACCACGGAAAGCAACCTGCTGGAGTGCATCCGGGCCTGCAAGCCCCGCGAGGG
CAAGCGCTAAG
Secretion signal-sorting sequence-partial GRP78-Reverse:
AATTCTTAGCGCTTGCCCTCGCGGGGCTTGCAGGCCCGGATGCACTCCAGCAGGTTG
CTTTCCGTGGTGAGGTCCTGACACTGGCTGCTCTCCAGGCACCAGCCACGCACTTCC
12
ATGGAGGCCTGAAGCAGCAAGGCCAGCAACAGGGCCCCCGAGCGGCTGCAGCACG
ATCTCGGCATG
We used the following primers synthesized by Integrated DNA Technologies (Integrated
Device Technology, San Jose, CA):
GST-FL
Forward 5’-CGCGGATCCATGGAGGAGGAGGACAAGAAGGAGGA-3’
Reverse 5’-CCGCTCGAGCTACAACTCATCTTTTTCTGCT-3’
GST-NT
Forward 5’-CGCGGATCCATGGAGGAGGAGGACAAGAAGGAGGA-3’
Reverse 5’-CCGCTCGAGCTAACCAGAGAGCACACCAGC-3’
GST-CT
Forward 5’-CGCGGATCCATGGACCTGGTACTGCTTGATGTA-3’
Reverse 5’-CCGCTCGAGCTACAACTCATCTTTTTCTGCT-3’
GST-
∆KDEL
Forward 5’-CGCGGATCCGAGGAGGAGGACAAGAAGGAGGA-3’
Reverse 5’-CCGCTCGAGctaTTCTGCTGTATCCTCTTCACCAG-3’
GST-
∆C11
Forward 5’-CGCGGATCCGAGGAGGAGGACAAGAAGGAGGA-3’
Reverse 5’-CCGCTCGAGCTAAGTTGGGGGAGGGCCTGCA-3’
GST-
∆C17
Forward 5’-CGCGGATCCGAGGAGGAGGACAAGAAGGAGGA-3’
Reverse
5’-CCGCTCGAGCTAACTTCCATAGAGTTTGCTGATAATT
GG-3’
GST-
∆C73
Forward 5’-CGCGGATCCGAGGAGGAGGACAAGAAGGAGGA-3’
Reverse 5’-CCGCTCGAGCTACTTTTCTTTATCTCCAATCTGATTC-3’
CD44v3-
10-HA
Forward 5’-CGGGGTACCATGGACAAGTTTTGGTGGCACGCAGCCT-3’
Reverse
5’-CCGGAATTCTTAAGCGTAATCTGGAACATCGTATGGGT
ACACCCCAATCTTCATGTCCACATTCT-3’
13
F78-
AAA
Forward 5’-CGCGGATCCATGAAGCTCTCCCTGGTGGC-3’
Reverse
5’-CCGCTCGAGCTACAACTCATCTTTTTCTGCTGTATCCTCTT
CACCAGTTGCGGCAGCGCCTGCACTTCCATAGAGTTTGCTGA-
3’

Plasmid transfection
MCF7-LR, MDA-MB-231, HCT116 and 293T cells were transfected with the BioT
transfection reagent (Bioland Scientific, Paramount, CA) following the manufacturer’s
instruction. At 5 h post-transfection, medium was replaced by fresh medium. The cells were then
collected 48 h post-transfection for recombinant protein purification or further analysis. Trypsin
(0.05%)-EDTA (0.02%) (Thermo Fisher Scientific, Waltham, MA) was used to dissociate cells,
and the cells from the flask or plate were harvested by gentle scraping.
Gene knockdown
The following short interfering RNAs (siRNA) were used:
siGrp78-3’-UTR Sense: 5’-CUUAAGUCUCGAAUGUAAUdTdT-3'
siCtrl Sense: 5’-GAGAUCGUAUAGCAACGGUdTdT-3’
MCF7-LR cells were transfected with the Lipofectmine RNAiMAX reagent (Thermo Fisher
Scientific, Waltham, MA) according to the manufacturer’s instruction for siRNA knockdown.
The final concentration of the siRNA was 60 pM.
GST-tagged recombinant protein purification
14
GST-tagged GRP78 expression plasmids were transformed into E. coli (BL21). Bacteria were
cultured in Luria-Bertani (LB) medium until optimal optical density (OD
600
= 0.5) was reached.
The expression of GST-fusion GRP78 proteins was induced by 4 mM isopropyl-β-D-
thiogalactoside (IPTG) at 37 ℃ for 4 h. Tris-buffered saline (TBS) containing 50 mM Tris-Cl,
150 mM NaCl, 1% Triton X-100 and 1 mg/mL lysozyme and protease and phosphatase inhibitor
cocktails (Thermo Scientific, Waltham, MA) was used to lyse bacteria for 30 min on ice. Then,
bacteria were sonicated for 4 min (20 sec on, 20 sec off) and centrifuged at 11,500 rpm, 4 ℃ for
1 h. The supernatant was incubated with Glutathione Sepharose 4 B beads (GE Healthcare,
Chicago, IL) at 4 ℃ for 12 h, and the GST-fusion GRP78 proteins were eluted by 10 mM
reduced glutathione (Sigma-Aldrich, St. Louis, MO) in TBS at 4 ℃ for 12 h. The buffer was
then exchanged to TBS, and 15% glycerol was added to the recombinant proteins in TBS before
snap-frozen in liquid nitrogen and stored at -80 ℃.
GST pull-down assay
GST tag and GST-fusion GRP78 (FL, NT, CT, ∆KDEL, ∆C11, ∆C17 and ∆C73) recombinant
proteins were conjugated to Glutathione Sepharose 4 B beads (GE Healthcare, Chicago, IL) at
4 ℃ for 4 h. Then, the CD44v-HA expression plasmid was transfected into 293T cells, and the
lysate was harvested 48 h post-transfection. The conjugated recombinant proteins were incubated
with 1 mg whole cell lysate containing CD44v-HA at 4 ℃ for 12 h in IP lysis buffer (Thermo
Fisher Scientific, Waltham, MA). Then the beads were washed 6 times with IP lysis buffer and
the proteins were eluted by 2X SDS sample buffer.
Western blot analysis
15
Cells were lysed with radioimmunoprecipitation (RIPA) buffer containing 50 mM Tris-HCl
pH 7.5, 150 mM NaCl, 1% NP-40, 0.5% sodium deoxycholate, 0.1% SDS, and a protease and
phosphatase inhibitor cocktail (Roche, Basel, Switzerland). After 30 min incubation on ice, cells
were centrifuged at 13,000 rpm at 4 ℃ for 15 min. The cleared supernatant containing 20-30 µg
of protein was analyzed by 10% SDS-PAGE and transferred to nitrocellulose membrane at 4 ℃
overnight. Membranes were blocked by Tris-buffered saline (TBS) containing 0.05% Tween-20
(TBST) and 5% non-fat dry milk at room temperature for 1h and then incubated with primary
antibody diluted in TBST with 5% Bovine serum albumin (BSA) at 4 ℃ overnight. After 3
washes with TBST, membranes were incubated with horseradish peroxidase (HRP)-conjugated
secondary antibodies or fluorescent IRDye-labeled secondary antibodies (LI-COR Biosciences,
Lincoln, NE). Proteins levels were detected by ChemiDoc
TM
XRS+ Imager (HRP signals, Bio-
Rad Laboratories, Hercules, CA) or Odyssey (LI-COR Bioscience, Lincoln, NE).
Antibodies
The primary antibodies used in this study are described as follows: anti-HA tag antibody (sc-
805, Santa Cruz Biotechnology, Dallas, TX), anti-GST tag antibody (sc-138, Santa Cruz
Biotechnology, Dallas, TX), anti-FLAG M2 antibody (F1804, Sigma-Aldrich, St. Louis, MO),
anti-Annexin II antibody (610068, BD Biosciences, Franklin Lakes, NJ), anti-β-actin antibody
(A5316, Sigma-Aldrich, St. Louis, MO), anti-phospho-STAT3 (Y705) antibody (9145, Cell
Signaling Technology, Danvers, MA), anti-STAT3 antibody (610190, BD Biosciences, Franklin
Lakes, NJ), anti-GRP78 antibody (Dr. Parkash S. Gill at USC), anti-CD44v3 antibody (BMS144,
Thermo Fisher Scientific, Waltham, MA) and anti-CyclinD1 antibody (sc-753, Santa Cruz
Biotechnology, Dallas, TX)
16
The secondary antibodies used in this study were purchased from Santa Cruz Biotechnology
(Dallas, TX), Enzo Life Sciences (Farmingdale, NY), and LI-COR Biosciences (Lincoln, NE).
Cell surface protein biotinylation and avidin pull-down
Forty-eight hours post-transfection, the medium was removed and cells were wash twice with
ice-cold Dulbecco's phosphate-buffered saline (DPBS) with MgCl
2
and CaCl
2
(Sigma-Aldrich,
St. Louis, MO). Cells were then biotinylated with 0.5 mg/mL EZ-Link Sulfo-NHS-SS-Biotin
(Thermo Fisher Scientific, Dallas, TX) in DPBS at 4 ℃ for 30 min. The plates with cells were
gently shaken and mixed by hand every 10 min. Excessive biotin was quenched by washing with
100 mM glycine in cold PBS for four times. Cells were lysed using RIPA buffer, and the protein
concentrations were measured by Bradford assay (Bio-Rad Laboratories, Hercules, CA). Lysates
were then divided into two parts: 20-30 µg of proteins were saved as whole cell lysate for
detecting the total protein levels and 500-1000 µg of proteins were used to purify cell surface
proteins. High Capacity NeutrAvidin Agarose Resin (Thermo Fisher Scientific, Dallas, TX) was
washed with RIPA lysis buffer three times and then incubated with 500-1000 µg of protein lysate
at room temperature for 1 h. The NeutrAvidin Agarose Resin was then washed 10 times with
RIPA buffer, and the bound proteins were eluted by 2X SDS sample buffer and heated at 95 ℃
for 5 min.
17
Results
C-terminal proline-rich region is critical for GRP78 forming complex with CD44v
Previously, we have observed that GRP78 and CD44v formed a complex on the breast cancer
cell surface (Tseng et al., submitted). To study whether the interaction with CD44v is important
for GRP78 cell surface translocation, we first mapped the regions of GRP78 for CD44v binding
using the in vitro GST pull-down assay. We constructed GST-fused GRP78 mutant expression
vectors according to the simulated human GRP78 structure using the I-TASSER server (Yang et
al. 2015) and purified GST and GST-tagged GRP78 wildtype or mutant recombinant proteins
from E. Coli (BL21) cells (Fig 1a, b). Then, we constructed a HA-tagged CD44 containing
variable exons 3-10 (CD44v3-10) and overexpressed this construct in 293T cells. We then
performed the GST pull-down assay and found that HA-tagged CD44v3-10 expressed in 293T
cells mainly formed a complex with the full length and the carboxyl half of GRP78. Deletion of
the last 17 amino acids, including the proline-rich amino acid sequence “AGPPPT” of GRP78,
reduced the binding of CD44v3-10 to around forty percent. Interestingly, while GRP78 mutants
generally exhibited reduced capability to form a complex with CD44v3-10, deletion of the last
11 amino acids resulted in increased binding, likely due to the exposure of the proline-rich region
(Fig 1c). Taken together, these results suggest that GRP78 forms a complex with CD44 through
the C-terminal proline-rich region.
18

19

Figure 1. The C-terminal proline-rich region is critical for the interaction between GRP78
and CD44v. (a) Ribbon diagram of simulated human GRP78 structure. The ATPase domain is in
blue. The substrate binding domain is in pink. The proline-rich region is in red (as shown in right
panel) (b) Schematic representation of GRP78 protein and GST-fusion GRP78 (wild-type and
mutants). (c) Western blot analysis of an in vitro GST pull-down assay. Recombinant GRP78
(wild-type and mutants) proteins were purified from E. coli (BL21) and incubated with 293T
whole cell lysate containing overexpressed HA-tagged CD44v3-10. Lower panel: input GST and
GST-fusion GRP78. Numbers below HA band: relative levels of HA-tagged CD44v3-10 bound
to GST and GST-fused GRP78. Experiments were repeated three times with similar results.
The proline-rich region at the C-terminus of GRP78 is important for its cell surface
translocation
Next, we investigated the function of the proline-rich region in the translocation of GRP78 to
the cell surface. We first modified the pcDNA3 based FLAG-tagged GRP78 expression vector
and created the PPP to AAA (a.a. 640-642) mutant (Fig 2a). Then, we overexpressed wild-type
and mutant FLAG-tagged GRP78 in MCF7-LR and MDA-MB-231 cells, and then used cell
surface biotinylation followed by avidin pull-down to label and detect cell surface proteins.
While the mutant protein had a similar expression level compared to wild-type GRP78 in the
whole cell lysate, we observed a 70-80% of reduction of mutant GRP78 on the cell surface in
both cell lines (Fig 2b-c). Our results suggest that the proline-rich region at the C-terminus of
GRP78 is critical in making it translocate to the cell surface.
20

Figure 2. C-terminal proline-rich region is critical for GRP78 cell surface translocation in
MCF7-LR and MDA-MB-231 cells (a) Schematic representation of FLAG-tagged GRP78
(WT) and FLAG-tagged GRP78 bearing PPP to AAA mutantion (AAA). (b-c) Western blot
analysis of the cell surface proteins of MCF7-LR (b) and MDA-MB-231 (c) cells transfected
with pcDNA3 (v), WT and AAA expression vectors. Annexin II and β-actin are loading controls
for the cell surface fraction and the whole cell lysate (WCL), respectively. Experiments were
repeated three times with similar results.
C-terminal proline-rich region of GRP78 is a novel modulator of STAT3 signaling
In order to study the signaling function of the proline-rich region, we then explored the
impact of PPP to AAA mutation on the known downstream STAT3 signaling of CD44 and
GRP78 (Wang et al. 2012, Yao et al. 2015, Xu et al. 2015). Knockdown of endogenous GRP78
by siRNA targeting the 3’ untranslated region (UTR) led to approximately a 30% decrease of
21
STAT3 activation as demonstrated by STAT3 phosphorylation at tyrosine 705 in MCF7-LR
cells. Simultaneous knockdown of endogenous GRP78 and overexpression of FLAG-tagged
wild-type GRP78 promoted STAT3 phosphorylation at tyrosine 705. However, overexpression
of vectors bearing PPP to AAA mutant failed to rescue STAT3 activation (Fig 3). These results
suggest that the C-terminal proline-rich region of GRP78 is a novel modulator of STAT3
signaling.

Figure 3. C-terminal proline-rich region of GRP78 is a novel modulator of STAT3
signaling. Left: Western blot analysis of MCF7-LR cells co-transfected with overexpression
vectors (v, WT, AAA) and siRNA targeting the 3’ UTR of Grp78 or scrambled control (siCtrl).
Right: Relative levels of pSTAT3/STAT3. Three independent biological repeats showed similar
results.
The small peptide encoding the C-terminal proline-rich region of GRP78 reduces CD44v and
CyclinD1 levels
Furthermore, we investigated the therapeutic potential of small peptide designed based on the
proline-rich region we discovered that is critical for GRP78 cell surface translocation as well as
22
its signaling function. We constructed pcDNA3 based expression vectors containing GRP78
sequences (a.a. 631-650) spanning 20 a.a. region centered with PPP or AAA mutant sequence.
The partial GRP78 sequence was led by the secretion signal and sorting sequence of a
neuropeptide, α-melanocyte-stimulating hormone (Fig 4a). MCF7-LR cells expressing the small
peptide including PPP showed approximately 70% reduction of CD44v levels and 20% reduction
of Cyclin D1 levels compared to the AAA control (Fig 4b). We then applied the conditional
media containing the overexpressed small peptides to MCF7-LR cells and observed
approximately 40% reduction of CD44v and Cyclin D1 levels (Fig 4c). Our results indicate that
targeting the interaction between GRP78 and its partner proteins, including CD44v may impair
cell proliferation and have therapeutic implications.

Figure 4. The small peptide encoding the C-terminal proline-rich region of GRP78 reduces
CD44v and CyclinD1 levels (a) Schematic representation of signal sequence (SSP)-guided
23
small peptide expressing vectors. (b) Left: Western blot analysis of MCF7-LR cells transfected
with pcDNA3 vector or small peptide expression vectors for 48 h. Right: Relative levels of
CD44v3. Three independent biological repeats showed similar results. (c) Left: Western blot
analysis of MCF7-LR cells treated with conditional media for 48 h. The conditional media were
collected from MCF7-LR cells transfected with pcDNA3 vector or small peptide expression
vectors for 48 h. Right: Relative levels of CD44v3. Three independent biological repeats showed
similar results.

24
Discussion
The discovery of the expression of the ER chaperone protein, GRP78, on the cancer cell
surface represents a paradigm shift in its functions under pathological conditions (Luo and Lee
2013). A large number of recent studies have provided convincing evidence that cell surface
GRP78 plays critical roles in regulating cellular signaling pathways such as PI3K/AKT signaling
and TGF-β signaling pathways and impacts cell proliferation, migration, survival and apoptosis
in cancer cells (Kelber et al. 2009, Gonzalez-Gronow et al. 2009, Zoni et al. 2017). Therefore,
understanding the mechanism underlying the translocation of GRP78 to the cell surface can
provide valuable insights in basic ER chaperone biology as well as developing novel therapeutic
approaches.
The nitrogen atom of proline is covalently locked within a ring, which makes it an anomalous
amino acid. Sequences of three consecutive prolines can fold into a triproline helice, which plays
critical roles in protein-protein interaction (Morgan and Rubenstein 2013). Here, we reported that
mutation at the C-terminal proline-rich region inhibited GRP78 cell surface translocation and
signaling functions. Together with the discovery that the proline-rich region was important for
GRP78 binding to CD44v, our results suggested that the interaction of GRP78 with partner
proteins is critical for its cell surface translocation. However, the importance of the C-terminal
proline-rich region for GRP78 binding to CD44v is based on an in vitro GST pull-down assay
and further investigation is required to elucidate the role of the C-terminal proline-rich region of
GRP78 in its binding to partner proteins/substrates in the context of endogenous protein
interaction. To address this issue, we will overexpress FLAG-tagged GRP78 wild-type and
mutants together with HA-tagged CD44v and then perform co-immunoprecipitation using
25
antibody against FLAG epitope, followed by Western blot analysis to explore the capacity of
each form of GRP78 to bind to CD44v.
In this study, we found that cells treated with conditional medium containing the 20 amino
acid-long small peptide encoding the proline-rich region of GRP78 resulted in reduction of
CD44v and Cyclin D1 levels compared to the controls. This indicated that targeting the
interaction between GRP78 and its partner proteins has therapeutic potential. For future studies,
we have designed synthetic peptides according to the 20 amino acid-long region described above
and will use them to investigate whether they will perturb the interaction of GRP78 and its
binding partners and if they can have effects on cellular functions. While the detailed mechanism
remains to be elucidated, our study uncovered the previously unappreciated functions of the C-
terminal proline rich region of GRP78.
Previously, our lab discovered that the substrate binding capacity of GRP78 is required for its
translocation to the cell surface. The mutant GRP78 bearing the T453D mutation located within
the substrate binding domain led to a 75% reduction of GRP78 cell surface translocation, while
the mutation located within the ATPase domain or at the MTJ1 binding site did not affect the
expression level of cell surface GRP78 (Tsai et al. 2015). This raised an interesting question
regarding the potential interdependence of the substrate binding domain and the proline-rich
region in regulating the translocation of GRP78 to the cell surface. Investigating whether the PPP
to AAA mutation affects the substrate binding capacity of GRP78 will be required to answer this
question. Therefore, to address this question in the future, we will modify the pcDNA3 based
FLAG-tagged GRP78 expression vector and create the T453D plus PPP to AAA (a.a. 640-642)
double mutant. We will then use cell surface biotinylation assay to study how double mutations
will affect the translocation of GRP78 to the cell surface compared to the T453D and PPP to
26
AAA mutants. Furthermore, we will use luciferase refolding assay to investigate the influence, if
any, of mutations in GRP78 (T453D, PPP to AAA and double mutant) on its chaperone function.
Additionally, we will overexpress FLAG-tagged GRP78 wild-type and mutants and then perform
co-immunoprecipitation using antibody against the FLAG epitope, followed by SDS-PAGE and
colloidal blue staining or silver staining to explore the substrate binding capacity of each form of
GRP78.
Interestingly, we found that the proline-rich region is also important for the translocation of
GRP78 to the cell surface in HCT116 cells (Figure 5). Previous data from our lab has suggested
that HCT116 cells utilize alternative routing mechanism independent of ER to Golgi
transportation for the cell surface translocation of GRP78 (Tsai et al. 2015). In this study, we
observed that mutation in the proline-rich region led to a 40% reduction of cell surface GRP78,
indicating the cell surface translocation of GRP78 in HCT116 cell, at least partially, depends on
the proline-rich region of GRP78.

Figure 5. C-terminal proline-rich region is critical for GRP78 cell surface translocation in
HCT116 cells. Western blot analysis of HCT116 cells transfected with pcDNA3 (v), WT and
AAA expression vector. Annexin II and β-actin are loading controls for cell surface fraction and
whole cell lysate (WCL), respectively.
27
Acknowledgements
I would like to express my deep gratitude to my research advisor, Dr. Amy S. Lee. During the
past two years, Dr. Lee has provided me great opportunities to work in a stimulating and
collaborative laboratory environment. Her guidance has prepared me very well toward my dream
to become a thoughtful and creative scientist. Being mentored by Dr. Lee has been an amazing
and memorable scientific journey in my life.
I sincerely thank my committee members, Dr. Jing-Hsiung James Ou and Joseph R.
Landolph, Jr., for their valuable advice. Additionally, their lectures in INTD 522 (Infection and
Host Responses) and INTD 504 (Molecular Biology of Cancer) have greatly stimulated my
interest in Immunology and Cancer Biology. My appreciation also goes to Dr. Axel H. Schönthal
and Dr. Jie Li for their guidance all the way along my graduate study in the Department of
Molecular Microbiology and Immunology.
I am particularly grateful for the help and support from the Lee laboratory members: Chun-
Chih Tseng, Dat Ha, Daisy Flores Rangel, Anthony J. Carlos, Richard Van Krieken, and John
Johnson. I will always remember the good time that we spent together, especially the thought-
provoking scientific discussions. My special thanks go to Chun-Chih Tseng, who mentored my
scientific knowledge and techniques critical for my projects and conveyed the right attitude to
face challenging moments in scientific research. The advice I obtained from Chun-Chih Tseng,
Dat Ha, Daisy Flores Rangel, Anthony J. Carlos and Richard Van Krieken greatly helped me
move forward to the next phase of my scientific career.
28
I am eternally grateful to my mother, Jinpu Jia, and my father, Shishan Zhang. I am grateful
to have had them accompany with me during every difficult and joyful moment. They have
taught me love, responsibility and respect.
29
References
Bertolotti, A., Y. Zhang, L. M. Hendershot, H. P. Harding, and D. Ron. 2000. "Dynamic
interaction of BiP and ER stress transducers in the unfolded-protein response." Nat Cell
Biol 2 (6):326-32. doi: 10.1038/35014014.
Burikhanov, R., Y. Zhao, A. Goswami, S. Qiu, S. R. Schwarze, and V. M. Rangnekar. 2009.
"The tumor suppressor Par-4 activates an extrinsic pathway for apoptosis." Cell 138
(2):377-88. doi: 10.1016/j.cell.2009.05.022.
de Ridder, G. G., R. Ray, and S. V. Pizzo. 2012. "A murine monoclonal antibody directed
against the carboxyl-terminal domain of GRP78 suppresses melanoma growth in mice."
Melanoma Res 22 (3):225-35. doi: 10.1097/CMR.0b013e32835312fd.
Gonzalez-Gronow, M., M. A. Selim, J. Papalas, and S. V. Pizzo. 2009. "GRP78: a
multifunctional receptor on the cell surface." Antioxid Redox Signal 11 (9):2299-306.
doi: 10.1089/ARS.2009.2568.
Hiraga, T., S. Ito, and H. Nakamura. 2013. "Cancer stem-like cell marker CD44 promotes bone
metastases by enhancing tumorigenicity, cell motility, and hyaluronan production."
Cancer Res 73 (13):4112-22. doi: 10.1158/0008-5472.can-12-3801.
Hu, J., G. Li, P. Zhang, X. Zhuang, and G. Hu. 2017. "A CD44v(+) subpopulation of breast
cancer stem-like cells with enhanced lung metastasis capacity." Cell Death Dis 8
(3):e2679. doi: 10.1038/cddis.2017.72.
Ishimoto, T., O. Nagano, T. Yae, M. Tamada, T. Motohara, H. Oshima, M. Oshima, T. Ikeda, R.
Asaba, H. Yagi, T. Masuko, T. Shimizu, T. Ishikawa, K. Kai, E. Takahashi, Y. Imamura,
Y. Baba, M. Ohmura, M. Suematsu, H. Baba, and H. Saya. 2011. "CD44 variant
regulates redox status in cancer cells by stabilizing the xCT subunit of system xc(-) and
30
thereby promotes tumor growth." Cancer Cell 19 (3):387-400. doi:
10.1016/j.ccr.2011.01.038.
Jindadamrongwech, S., C. Thepparit, and D. R. Smith. 2004. "Identification of GRP 78 (BiP) as
a liver cell expressed receptor element for dengue virus serotype 2." Arch Virol 149
(5):915-27. doi: 10.1007/s00705-003-0263-x.
Kelber, J. A., A. D. Panopoulos, G. Shani, E. C. Booker, J. C. Belmonte, W. W. Vale, and P. C.
Gray. 2009. "Blockade of Cripto binding to cell surface GRP78 inhibits oncogenic Cripto
signaling via MAPK/PI3K and Smad2/3 pathways." Oncogene 28 (24):2324-36. doi:
10.1038/onc.2009.97.
Kern, J., G. Untergasser, C. Zenzmaier, B. Sarg, G. Gastl, E. Gunsilius, and M. Steurer. 2009.
"GRP-78 secreted by tumor cells blocks the antiangiogenic activity of bortezomib."
Blood 114 (18):3960-7. doi: 10.1182/blood-2009-03-209668.
Kim, Y., A. M. Lillo, S. C. Steiniger, Y. Liu, C. Ballatore, A. Anichini, R. Mortarini, G. F.
Kaufmann, B. Zhou, B. Felding-Habermann, and K. D. Janda. 2006. "Targeting heat
shock proteins on cancer cells: selection, characterization, and cell-penetrating properties
of a peptidic GRP78 ligand." Biochemistry 45 (31):9434-44. doi: 10.1021/bi060264j.
Lee, A. S. 2005. "The ER chaperone and signaling regulator GRP78/BiP as a monitor of
endoplasmic reticulum stress." Methods 35 (4):373-81. doi:
10.1016/j.ymeth.2004.10.010.
Lee, A. S. 2014. "Glucose-regulated proteins in cancer: molecular mechanisms and therapeutic
potential." Nat Rev Cancer 14 (4):263-76. doi: 10.1038/nrc3701.
31
Li, Z., C. Zhao, Y. Zhao, S. Shan, T. Shi, and J. Li. 2014. "Reconstructed mung bean trypsin
inhibitor targeting cell surface GRP78 induces apoptosis and inhibits tumor growth in
colorectal cancer." Int J Biochem Cell Biol 47:68-75. doi: 10.1016/j.biocel.2013.11.022.
Liu, H., M. R. Patel, J. A. Prescher, A. Patsialou, D. Qian, J. Lin, S. Wen, Y. F. Chang, M. H.
Bachmann, Y. Shimono, P. Dalerba, M. Adorno, N. Lobo, J. Bueno, F. M. Dirbas, S.
Goswami, G. Somlo, J. Condeelis, C. H. Contag, S. S. Gambhir, and M. F. Clarke. 2010.
"Cancer stem cells from human breast tumors are involved in spontaneous metastases in
orthotopic mouse models." Proc Natl Acad Sci U S A 107 (42):18115-20. doi:
10.1073/pnas.1006732107.
Liu, R., X. Li, W. Gao, Y. Zhou, S. Wey, S. K. Mitra, V. Krasnoperov, D. Dong, S. Liu, D. Li,
G. Zhu, S. Louie, P. S. Conti, Z. Li, A. S. Lee, and P. S. Gill. 2013. "Monoclonal
antibody against cell surface GRP78 as a novel agent in suppressing PI3K/AKT
signaling, tumor growth, and metastasis." Clin Cancer Res 19 (24):6802-11. doi:
10.1158/1078-0432.CCR-13-1106.
Luo, B., and A. S. Lee. 2013. "The critical roles of endoplasmic reticulum chaperones and
unfolded protein response in tumorigenesis and anticancer therapies." Oncogene 32
(7):805-18. doi: 10.1038/onc.2012.130.
Misra, U. K., R. Deedwania, and S. V. Pizzo. 2005. "Binding of activated alpha2-macroglobulin
to its cell surface receptor GRP78 in 1-LN prostate cancer cells regulates PAK-2-
dependent activation of LIMK." J Biol Chem 280 (28):26278-86. doi:
10.1074/jbc.M414467200.
Misra, U. K., R. Deedwania, and S. V. Pizzo. 2006. "Activation and cross-talk between Akt, NF-
kappaB, and unfolded protein response signaling in 1-LN prostate cancer cells
32
consequent to ligation of cell surface-associated GRP78." J Biol Chem 281 (19):13694-
707. doi: 10.1074/jbc.M511694200.
Misra, U. K., M. Gonzalez-Gronow, G. Gawdi, and S. V. Pizzo. 2005. "The role of MTJ-1 in cell
surface translocation of GRP78, a receptor for alpha 2-macroglobulin-dependent
signaling." J Immunol 174 (4):2092-7.
Morgan, A. A., and E. Rubenstein. 2013. "Proline: the distribution, frequency, positioning, and
common functional roles of proline and polyproline sequences in the human proteome."
PLoS One 8 (1):e53785. doi: 10.1371/journal.pone.0053785.
Ni, M., and A. S. Lee. 2007. "ER chaperones in mammalian development and human diseases."
FEBS Lett 581 (19):3641-51. doi: 10.1016/j.febslet.2007.04.045.
Ni, M., Y. Zhang, and A. S. Lee. 2011. "Beyond the endoplasmic reticulum: atypical GRP78 in
cell viability, signalling and therapeutic targeting." Biochem J 434 (2):181-8. doi:
10.1042/BJ20101569.
Philippova, M., D. Ivanov, M. B. Joshi, E. Kyriakakis, K. Rupp, T. Afonyushkin, V. Bochkov, P.
Erne, and T. J. Resink. 2008. "Identification of proteins associating with
glycosylphosphatidylinositol- anchored T-cadherin on the surface of vascular endothelial
cells: role for Grp78/BiP in T-cadherin-dependent cell survival." Mol Cell Biol 28
(12):4004-17. doi: 10.1128/MCB.00157-08.
Rasche, L., J. Duell, C. Morgner, M. Chatterjee, F. Hensel, A. Rosenwald, H. Einsele, M. S.
Topp, and S. Brändlein. 2013. "The natural human IgM antibody PAT-SM6 induces
apoptosis in primary human multiple myeloma cells by targeting heat shock protein
GRP78." PLoS One 8 (5):e63414. doi: 10.1371/journal.pone.0063414.
33
Shani, G., W. H. Fischer, N. J. Justice, J. A. Kelber, W. Vale, and P. C. Gray. 2008. "GRP78 and
Cripto form a complex at the cell surface and collaborate to inhibit transforming growth
factor beta signaling and enhance cell growth." Mol Cell Biol 28 (2):666-77. doi:
10.1128/MCB.01716-07.
Shu, C. W., F. C. Sun, J. H. Cho, C. C. Lin, P. F. Liu, P. Y. Chen, M. D. Chang, H. W. Fu, and
Y. K. Lai. 2008. "GRP78 and Raf-1 cooperatively confer resistance to endoplasmic
reticulum stress-induced apoptosis." J Cell Physiol 215 (3):627-35. doi:
10.1002/jcp.21340.
Spike, B. T., J. A. Kelber, E. Booker, M. Kalathur, R. Rodewald, J. Lipianskaya, J. La, M. He, T.
Wright, R. Klemke, G. M. Wahl, and P. C. Gray. 2014. "CRIPTO/GRP78 signaling
maintains fetal and adult mammary stem cells ex vivo." Stem Cell Reports 2 (4):427-39.
doi: 10.1016/j.stemcr.2014.02.010.
Tsai, Y. L., D. P. Ha, H. Zhao, A. J. Carlos, S. Wei, T. K. Pun, K. Wu, E. Zandi, K. Kelly, and
A. S. Lee. 2018. "Endoplasmic reticulum stress activates SRC, relocating chaperones to
the cell surface where GRP78/CD109 blocks TGF-β signaling." Proc Natl Acad Sci U S
A 115 (18):E4245-E4254. doi: 10.1073/pnas.1714866115.
Tsai, Y. L., Y. Zhang, C. C. Tseng, R. Stanciauskas, F. Pinaud, and A. S. Lee. 2015.
"Characterization and mechanism of stress-induced translocation of 78-kilodalton
glucose-regulated protein (GRP78) to the cell surface." J Biol Chem 290 (13):8049-64.
doi: 10.1074/jbc.M114.618736.
Wang, X., G. Wang, Y. Zhao, X. Liu, Q. Ding, J. Shi, Y. Ding, and S. Wang. 2012. "STAT3
mediates resistance of CD44(+)CD24(-/low) breast cancer stem cells to tamoxifen in
vitro." J Biomed Res 26 (5):325-35. doi: 10.7555/JBR.26.20110050.
34
Xu, H., Y. Tian, X. Yuan, H. Wu, Q. Liu, R. G. Pestell, and K. Wu. 2015. "The role of CD44 in
epithelial-mesenchymal transition and cancer development." Onco Targets Ther 8:3783-
92. doi: 10.2147/OTT.S95470.
Yan, Y., X. Zuo, and D. Wei. 2015. "Concise Review: Emerging Role of CD44 in Cancer Stem
Cells: A Promising Biomarker and Therapeutic Target." Stem Cells Transl Med 4
(9):1033-43. doi: 10.5966/sctm.2015-0048.
Yang, J., R. Yan, A. Roy, D. Xu, J. Poisson, and Y. Zhang. 2015. "The I-TASSER Suite: protein
structure and function prediction." Nat Methods 12 (1):7-8. doi: 10.1038/nmeth.3213.
Yao, X., H. Liu, X. Zhang, L. Zhang, X. Li, C. Wang, and S. Sun. 2015. "Cell Surface GRP78
Accelerated Breast Cancer Cell Proliferation and Migration by Activating STAT3."
PLoS One 10 (5):e0125634. doi: 10.1371/journal.pone.0125634.
Zhang, Y., C. C. Tseng, Y. L. Tsai, X. Fu, R. Schiff, and A. S. Lee. 2013. "Cancer cells resistant
to therapy promote cell surface relocalization of GRP78 which complexes with PI3K and
enhances PI(3,4,5)P3 production." PLoS One 8 (11):e80071. doi:
10.1371/journal.pone.0080071.
Zoller, M. 2011. "CD44: can a cancer-initiating cell profit from an abundantly expressed
molecule?" Nat Rev Cancer 11 (4):254-67. doi: 10.1038/nrc3023.
Zoni, E., L. Chen, S. Karkampouna, Z. Granchi, E. I. Verhoef, F. La Manna, J. Kelber, R. C. M.
Pelger, M. D. Henry, E. Snaar-Jagalska, G. J. L.H van Leenders, L. Beimers, P. Kloen, P.
C. Gray, G. van der Pluijm, and M. Kruithof-de Julio. 2017. "CRIPTO and its signaling
partner GRP78 drive the metastatic phenotype in human osteotropic prostate cancer."
Oncogene 36 (33):4739-4749. doi: 10.1038/onc.2017.87.

Abstract (if available)

Abstract Atypical translocation of the 78 kDa glucose-regulated protein (GRP78) to the plasma membrane allows GRP78 to exert novel signaling functions independent of its chaperone activity in the endoplasmic reticulum (ER). Cell surface GRP78 (csGRP78) is up-regulated in a diverse range of cancer cells and minimally in the normal cells. However, csGRP78 largely exists as a peripheral protein outside the plasma membrane. How it can translocate from the intracellular location to the cell surface remains largely unknown. The understanding of the underlying mechanisms of this translocation of GRP78 should facilitate the development of new therapeutic strategies to specifically target cancer cells. Previously our lab uncovered a variant isoform of CD44, a transmembrane protein and an important marker of breast cancer stem cells, as a novel binding partner of csGRP78. In this study, we discovered that the proline-rich region at the C-terminus of GRP78 is critical for the formation of a complex of GRP78 and CD44v. We further showed that this proline-rich region plays an important role in GRP78 cell surface translocation using cell surface biotinylation followed by avidin pull-down. We then developed a small peptide encoding the sequence spanning the proline-rich region of GRP78. We showed that overexpression of the secretory version of this peptide or application of conditional medium containing the secretory peptide reduced CD44v and Cyclin D1 levels. Taken together, our study uncovered a novel mechanism underlying GRP78 cell surface translocation. Our results suggest that targeting the interaction between GRP78 and its partner proteins may have therapeutic implications against cancer.

Linked assets

University of Southern California Dissertations and Theses

Conceptually similar

PDF

The role of endoplasmic reticulum chaperone protein GRP78 in breast cancer

PDF

Cell surface translocation mechanism of stress-inducible GRP78 in human cancer

PDF

The molecular mechanism of GRP78 translocation from the endoplasmic reticulum to the cell surface

PDF

The role of GRP78 in the regulation of apoptosis and prostate cancer progression

PDF

Utilizing novel small molecules to modulate GRP78 expression and activity in cancer

PDF

The role of nuclear GRP78 in regulation of EGFR expression in lung cancer

PDF

The role of endoplasmic reticulum chaperone glucose-regulated 78-kilodalton (GRP78) in lung cancer

PDF

Mechanism of ethanol-mediated increase of SARS-COV-2 entry through GRP78 induction

PDF

The role of endoplasmic reticulum protein GRP78 in normal hematopoeises and PTEN-null leukemogenesis

PDF

Role of endoplasmic reticulum chaperones GRP78 and GRP94 in regulating unfolded protein response and cell survival

PDF

Molecular mechanisms of chemoresistance in breast cancer

PDF

The role of endoplasmic reticulum chaperones in adipogenesis, liver cancer and mammary gland development

PDF

The role of glucose-regulated proteins in endometrial and pancreatic cancers

PDF

Role of GRP78 and its novel cytosolic isoform GRP78va in regulating the unfolded protein response in cancer

PDF

The roles of endoplasmic reticulum chaperones in regulating liver homeostasis and tumorigenesis

PDF

Creating a multiple micrornia expression vector to target GRP78, an ER chaperone and signaling regulator in cancer

PDF

The role of endoplasmic reticulum proteins GRP78 and IP3R1 in regulation of glucose homeostasis and acute pancreatitis

PDF

Examination of the effect of oleandrin on head and neck cancer cells

PDF

Examination of the effect of the ecPlexin-B1 on MDA-MB-231 cells

PDF

Decreased levels of expression of transmembrane protein 56 (TMEM56) in breast cancer tissues

Asset Metadata

Creator Zhang, Pu (author)

Core Title Cell surface translocation and therapeutic targeting of GRP78

School Keck School of Medicine

Degree Master of Science

Degree Program Molecular Microbiology and Immunology

Publication Date 04/24/2020

Defense Date 03/19/2019

Publisher University of Southern California (original), University of Southern California. Libraries (digital)

Tag breast cancer,CD44,GRP78,OAI-PMH Harvest,proline,proline-rich region

Format application/pdf (imt)

Language English

Contributor Electronically uploaded by the author (provenance)

Advisor Ou, Jing-Hsiung James (committee chair), Landolph, Joseph R., Jr. (committee member), Lee, Amy Shiu (committee member)

Creator Email 820874946@qq.com,puzhang@usc.edu

Permanent Link (DOI) https://doi.org/10.25549/usctheses-c89-142962

Unique identifier UC11675728

Identifier etd-ZhangPu-7238.pdf (filename),usctheses-c89-142962 (legacy record id)

Legacy Identifier etd-ZhangPu-7238.pdf

Dmrecord 142962

Document Type Thesis

Format application/pdf (imt)

Rights Zhang, Pu

Type texts

Source University of Southern California (contributing entity), University of Southern California Dissertations and Theses (collection)

Access Conditions The author retains rights to his/her dissertation, thesis or other graduate work according to U.S. copyright law. Electronic access is being provided by the USC Libraries in agreement with the a...

Repository Name University of Southern California Digital Library

Repository Location USC Digital Library, University of Southern California, University Park Campus MC 2810, 3434 South Grand Avenue, 2nd Floor, Los Angeles, California 90089-2810, USA