Protein ADP-ribosylation: from biochemical characterization to therapeutic applications

PDF

Download

Open document

Flip pages

Summarize

Download a page range

Download transcript

Copy asset link

Request this asset

Transcript (if available)

Content i Protein ADP-Ribosylation: From Biochemical Characterization to Therapeutic Applications by Jingwen (Julianna) Chen Degree Conferral May 2019 A Dissertation Presented to the FACULTY OF THE USC GRADUATE SCHOOL UNIVERISTY OF SOUTHERN CALIFORNIA In Partial Fulfillment of the Requirement of the Degree DOCTOR OF PHILOSOPHY (PHARMACEUTICAL SCIENCES) ii Copyright by Jingwen Chen, 2019 All Rights Reserved iii Dedicated to my family for their unconditional love, support and encouragement iv Acknowledgement I would like to express my sincere gratitude to my advisor Dr. Yong Zhang for his support and mentorship. Under his guidance, I learned to ask questions, think critically and develop solutions to move my projects forward. I have advanced significantly in my path to becoming a scientist thanks to his help and teaching. I would also like to thank the other members of my thesis committee: Dr. Curtis T. Okamoto and Dr. Wei-Chiang Shen for their constructive comments and suggestions. My projects would not have been successful without my fellow Zhang lab members, both former and present: Dr. Xiao-Nan Zhang, Dr. Qinqin Cheng, Xiaojing Shi, Zhefu Dai, Albert Lam, Menglu Han, and Yanran Lu. Many thanks go out to Dr. Xiao-Nan Zhang, Dr. Qinqin Cheng and Xiaojing Shi for teaching me about the technical details about experiments and helping me research solutions when I encounter difficulties in my projects. Special thanks to Xiaojing Shi and Dr. Xiao-Nan Zhang as Xiaojing conducted the majority of the cell experiments in Chapter 4 and kindly provided me with the data and Dr. Xiao-Nan Zhang synthesized and purified the compounds for conjugation. Last but not least, I am extremely grateful for my family and friends for their company along this incredible journey in completing my degree. I would like to thank my undergraduate mentor Philip M. Potter for his mentorship and inspirations. Many special thanks to my sister, Katherine Chen, and my boyfriend, Luis Caceres Flores, for their tremendous support and belief in me that gave me strength every day for fighting obstacles in my career. v Abstract The research projects primary focus on developing new methods and tools for the characterization and functional studies of ADP-ribosyltransferases (ARTs) involved in both mono and poly ADP-ribosylation (MARylation and PARylation) and the development of poly ADP-ribose (ADPr)-based therapeutics. ARTs catalyze reversible additions of mono and poly ADPr onto diverse types of proteins, using nicotinamide adenine dinucleotide (NAD + ) as a co- substrate. Both mono and poly ARTs have significant impact on the regulation of various cellular processes, including apoptosis, DNA repair and transcription. In Chapter 2, we developed a macrodomain-linked immunosorbent assay (MLISA) for characterizing mono ARTs’ activity. Recombinant macrodomain 2 from poly ADP-ribose polymerase 14 (PARP14) was generated with a C-terminus human influenza hemagglutinin (HA) tag for detecting mono ADP-ribosylated proteins. Coupled with an anti-HA secondary antibody, the generated HA-tagged macrodomain 2 revealed high specificity for MARylation catalyzed by distinct mono ARTs. MLISA provides a new and convenient method for the quantitative characterization of mono ART enzymes and may allow identification of potent mono ART inhibitors in a high-throughput-compatible manner. Identification of new modulators of mono ARTs can thus potentially lead to discovery of novel chemical probes and therapeutics. Chapter 3 describes the efforts to identify bioorthogonal pairs of PARP1/NAD + analogues. Site- directed mutagenesis was conducted on selected residues on PARP1’s catalytic domain, intended for the accommodation of the clickable functional groups attached to NAD + analogues. Two novel NAD + analogues with strong to moderate activities for PARP1-catalyzed PARylation were identified, serving as unique and important tools for probing and investigating cellular PARylation. vi We then explored the potential therapeutic use of automodified PARP1 as a novel drug carrier in Chapter 4. Thanks to its robust automodification activity, human PARP1 can catalyze the transfer of multiple ADPr units with clickable moieties onto itself, resulting in clickable ADPr polymers. The generated automodified PARP1 with clickable polymers allows for conjugation with monoclonal antibodies and cytotoxic agents, forming novel antibody drug conjugates (ADCs). The generated ADCs display significant specificity and potency towards targeted cell lines. This versatile conjugation method offers a platform with promising potentials for the development new classes of ADCs with enhanced efficacy. vii TABLE OF CONTENTS Acknowledgement ....................................................................................................................................... iv Abstract ......................................................................................................................................................... v Table of Contents ........................................................................................................................................ vii List of Figures .............................................................................................................................................. ix List of Tables ............................................................................................................................................... xi Abbreviations .................................................................................................................................. xii 1 Introduction ........................................................................................................................................... 1 1.1 Overview of ADP-ribosylation ..................................................................................................... 1 1.2 NAD + Biosynthesis Pathways ....................................................................................................... 2 1.3 Writers: ADP-ribosyltransferases (ARTs) .................................................................................... 2 1.4 Poly ADP-ribosylation (PARylation) and PARP1 ........................................................................ 4 1.5 Mono ADP-ribosylation (MARylation) and Mono PARPs .......................................................... 6 1.6 Motifs Recognizing ADP-ribosylation ......................................................................................... 8 1.7 Poly (ADP-ribose) Glycohydrolase (PARG), ADP-ribosyl-acceptor Hydrolase (ARH), and Macrodomains........................................................................................................................................... 9 2 Macrodomain-linked Immunosorbent Assay (MLISA) (Chen et al., 2018) ....................................... 13 2.1 Introduction ................................................................................................................................. 13 2.2 Experimental Methods ................................................................................................................ 15 2.2.1 Molecular Cloning and Protein Expression and Purification .............................................. 15 2.2.2 MLISA Assay ..................................................................................................................... 17 2.3 Results ......................................................................................................................................... 21 2.3.1 Overall Assay Design.......................................................................................................... 21 2.3.2 Validation ............................................................................................................................ 23 2.3.3 Time and Concentration Dependence ................................................................................. 24 2.3.4 Kinetics Parameters Characterization ................................................................................. 25 2.3.5 Inhibitor Screening .............................................................................................................. 26 2.4 Discussion ................................................................................................................................... 27 3 Developing Bioorthogonal Pairs of NAD + Analogue and PARP1 Mutant for Direct Substrate Identification ............................................................................................................................................... 48 3.1 Introduction ................................................................................................................................. 48 viii 3.2 Experimental Methods ................................................................................................................ 50 3.2.1 Materials and Reagents ....................................................................................................... 50 3.2.2 Molecular Cloning and Protein Expression and Purification .............................................. 50 3.2.3 Construction of a Model of PARP1 in Complexed with NAD + .......................................... 52 3.2.4 Automodification and Immunoblotting Activity Analysis.................................................. 52 3.2.5 High-performance Liquid Chromatography (HPLC)-based Kinetic Assays ...................... 53 3.3 Results ......................................................................................................................................... 54 3.3.1 Overall Design of Bioorthogonal PARP1 Mutant/NAD + Analogue Pairs .......................... 54 3.3.2 Immunoblot-based Screening of NAD + Analogues and PARP1 Enzymes ......................... 55 3.3.3 Kinetics Parameters............................................................................................................. 56 3.4 Discussion ................................................................................................................................... 57 4 Developing Antibody Drug Conjugates (ADCs) using Automodified PARP1 as a Novel Drug Carrier ......................................................................................................................................................... 67 4.1 Introduction ................................................................................................................................. 67 4.2 Experimental Methods ................................................................................................................ 69 4.2.1 Materials and Cell Lines ..................................................................................................... 69 4.2.2 Molecular Cloning and Protein Expression and Purification. ............................................. 69 4.2.3 Conjugations and Purifications of ADCs ............................................................................ 70 4.2.4 Nanoparticle Tracking Analysis (NTA) .............................................................................. 72 4.2.5 Flow Cytometry Binding Analysis ..................................................................................... 72 4.2.6 Confocal Imaging of Cellular Uptake of Conjugates .......................................................... 73 4.2.7 In vitro Cytotoxicity Assay ................................................................................................. 73 4.3 Results ......................................................................................................................................... 74 4.3.1 Overall Design of ADCs ..................................................................................................... 74 4.3.2 Chemical Conjugation and Purification of Various ADC Constructs ................................. 75 4.3.3 Binding and Cellular Uptake of ADCs ............................................................................... 76 4.3.4 In vitro Cytotoxicity of ADCs ............................................................................................ 77 4.4 Discussion and Future Experiments ............................................................................................ 77 5 Conclusion .......................................................................................................................................... 93 6 References ........................................................................................................................................... 95 ix LIST OF FIGURES Figure 1.1 General scheme of ADP-ribosylation ........................................................................................ 11 Figure 1.2 General scheme of for biosynthesis of NAD + ........................................................................... 12 Figure 2.1 Protein ADP-ribosylation by mono ARTs ................................................................................. 31 Figure 2.2 SDS-PAGE gel of purified macrodomain 2 and PARP enzymes stained with Coomassie blue .................................................................................................................................................................... 32 Figure 2.3 General scheme of MLISA ........................................................................................................ 33 Figure 2.4 Macrodomain 2 (M2) is specific for mono ADP-ribosylation by (A) PARP15 and (B) PARP14 .................................................................................................................................................................... 34 Figure 2.5 Percentages of the background fluorescence intensities (control reactions without NAD + ) relative to those of 2-hour PARP14-catalyzed ([E]=3, 6, and 9 µM) automodifications ........................... 35 Figure 2.6 Frequency distribution of the maximal (2-hour reaction) and minimal (no reaction) fluorescence intensities for (A) PARP15 ([E]=500 nM), (B) PARP14 ([E]=3 µM), and (C) PARP14 ([E]=6 µM) .................................................................................................................................................. 36 Figure 2.7 Time-dependent PARP15-catalyzed mono ADP-ribosylations as measured by MLISA .......... 37 Figure 2.8 Time-dependent PARP14-catalyzed mono ADP-ribosylations as measured by MLISA .......... 38 Figure 2.9 Concentration-dependent PARP-catalyzed mono ADP-ribosylations as measured by MLISA .................................................................................................................................................................... 39 Figure 2.10 Enzyme kinetic parameters of PARP15-catalyzed automodification ...................................... 40 Figure 2.11 Inhibition of PARP15 by individual compounds at varied concentrations.............................. 41 Figure 2.12 Inhibition of PARP14 by individual compounds at varied concentrations.............................. 42 Figure 3.1 Chemical structures of NAD + analogues 1-7 ............................................................................. 59 Figure 3.2 Model of PARP1 (green) in complex with NAD + and selected residues of PARP1 for mutagenesis in NAD + -binding pocket ........................................................................................................ 60 Figure 3.3 SDS-PAGE gel of wild type PARP1 and mutant enzymes stained with Coomassie blue ........ 61 Figure 3.4 Substrate activities of NAD + analogues with wild type PARP1 on click chemistry based automodification activity immunoblotting .................................................................................................. 62 Figure 3.5 Substrate activities of selected NAD + analogues with selected PARP1 mutants based automodification activity through immunoblotting .................................................................................... 63 Figure 4.1 PARP1 catalyzes PARylation with NAD + as a co-substrate ..................................................... 82 Figure 4.2 Schematic representation of the proposed ADC assembly platform. ........................................ 83 Figure 4.3 SDS-PAGE gel picture of trastuzumab Fab .............................................................................. 84 Figure 4.4 SDS-PAGE gel of Fab-PARP1 conjugates with different payloads .......................................... 85 Figure 4.5 Size distribution of Fab-PARP1-NAD6-DBCO-MMAF .......................................................... 86 Figure 4.6 Flow cytometric analysis of the binding of Fab-PARP1-NAD6-DBCO-488 and PARP1- NAD6-DBCO-488 control to A) HCC1954 cell line B) MDA-MB-468.................................................... 87 Figure 4.7 Confocal microscopic analysis of Fab-PARP1-NAD6-DBCO-488 (green) uptake in HCC1954 and MDA-MB-468 cells ............................................................................................................................. 88 Figure 4.8 In vitro cytotoxicity of controls in HCC1954 and MDA-MB-468 cells .................................... 89 Figure 4.9 In vitro cytotoxicity of MMAF ADCs in HCC1954 and MDA-MB-468 cells.. ....................... 90 Figure 4.10 In vitro cytotoxicity of Fab-PARP1-NAD6-DBCO-MMAF conjugates with various drug ratios in HCC1954 and MDA-MB-468 cells .............................................................................................. 91 x Figure 4.11 In vitro cytotoxicity of Fab-PARP1-NAD6-DBCO-MMAF (1:100) in HCC1954, MDA-MB- 231 and SK-BR-3 cells. .............................................................................................................................. 92 xi LIST OF TABLES Table 2.1 List of primer sequences used in molecular cloning ................................................................... 43 Table 2.2 Statistical parameters of optimized MLISA for PARP15 and PARP14 ..................................... 44 Table 2.3 Evaluation of % coefficient of variation of maximal and minimal signals using standard deviation criteria ......................................................................................................................................... 45 Table 2.4 List of compounds used for inhibition studies. ........................................................................... 46 Table 2.5 Inhibitory potency of eight compounds for PARP15 .................................................................. 47 Table 3.1 List of primer sequences used in molecular cloning ................................................................... 64 Table 3.2 Kinetic parameters of NAD + , 2, and 6 for purified human full-length PARP1. ......................... 66 xii Abbreviations Ab Antibody HA Human influenza hemagglutinin -OH Hydroxy group ADC Antibody drug conjugate HEPES 4-(2-hydroxyethyl)-1- piperazineethanesulfonic acid PARG Poly (ADP-ribose) glycohydrolase ADP Adenosine diphosphate HER2 Human epidermal growth factor receptor 2 PARP Poly (ADP-ribose) polymerase ADPr Adenosine diphosphate ribose HPLC High performance liquid chromatography PARylation Poly ADP- ribosylation ART ADP- ribosyltransferases HRP Horseradish peroxidase PBM PAR-binding motif ARTC Cholera toxin like ADP- ribosyltransferases IPTG Isopropyl β-D-1- thiogalactopyranoside PBS Phosphate buffered saline ARTD Diphtheria toxin like ADP- ribosyltransferases Kapβ1 Importinβ1/ karyopherin β1 PBST Phosphate buffered saline with Tween 20 ARH ADP-ribosyl- acceptor hydrolase k Rate constant PBZ PAR-binding zinc finger ATCC American Type Culture Collection M2 Macrodomain 2 PCR Polymerase chain reaction BCN Bicyclo[6.1.0]nony ne MAPK Mitogen-activated protein kinase 1 PDE Phosphodiesterase BSA Bovine serum albumin MARylation Mono ADP-ribosylation PEG Polyethylene glycol CaMKII Calcium-dependent protein kinase MLISA Macrodomain-linked immunosorbent assay PFA Paraformaldehyde CI Confidence interval MMAF Monomethyl auristatin F PMSF Phenylmethylsulfo nylfluoride CuAAC Copper(I)-catalyzed azide alkyne cycloaddition MTT 3-(4,5-Dimethylthiazol-2- yl)-2,5- diphenyltetrazolium bromide S/B Signal to background CuSO 4 Copper sulfate NaCl Sodium chloride SD Standard deviation xiii CV Coefficient of variation NAD + Nicotinamide adenine dinucleotide SDS- PAGE Sodium dodecyl sulphate- polyacrylamide gel electrophoresis DAPI 4’,6-diamidino-2- phenylindole NAMPT Nicotinamide phosphoribosyltransferase S/N Signal to noise DBCO Dibenzocyclooctyne ND Not determined TCA Trichloroacetic acid DMSO Dimethyl sulfoxide NHS N-Hydroxysuccinimide T-DM1 Trastuzumab emtansine DNA Deoxyribonucleic acid Ni-NTA Nickel-nitrilotriacetic acid THPTA Tris(3- hydroxypropyltriaz olylmethyl)amine DTT Dithiothreitol NLS Nuclear localization signal Tris Tris(hydroxymethy l)aminomethane [E] Enzyme concentration NMN Nicotinamide mononucleotide wt Wild type E.Coli Escherichia coli NMNAT Nicotinamide mononucleotide adenylyltransferase Z’ Z-factor EDTA Ethylenediaminetetr aacetic acid NR Nicotinamide riboside ZnSO 4 Zinc sulfate FI Fluorescence intensity NRK Nicotinamide riboside kinase GDH Glutamate dehydrogenase NTA Nanoparticle tracking analysis 1 1 Introduction 1 1.1 Overview of ADP-ribosylation Adenosine 5´-diphosphate (ADP)-ribosylation is a reversible post-translational modification that has important biological functions (Li and Chen, 2014; Liu and Yu, 2015; Luscher et al., 2018; Palazzo et al., 2017). The modification catalyzed by a group of enzymes named ADP- ribosyltransferases (ART) usually results in the addition of ADP ribose (ADPr) moieties on to their targets (Cohen and Chang, 2018). The acceptor sites typically are the asparagine, cysteine, arginine, aspartate, glutamate, lysine, and serine residues of the protein substrates (Hottiger et al., 2011; Liu and Yu, 2015; Quénet, 2018). Other targets may be modified include nucleotides, antibiotics and small molecules (Liu and Yu, 2015). ARTs use nicotinamide adenine dinucleotide (NAD + ) as a co-substrate during the catalysis, and as a product, nicotinamide is released (Luscher et al., 2018). ADP-ribosylation affects the protein substrates’ functions through various mechanisms, leading to changes in their activities, cellular stability, and interactions with partner proteins (Cohen and Chang, 2018). The process of ADP-ribosylation is highly reversible, with three types pf proteins involved: ARTs as writers for addition of ADPr units, several protein domains and motifs as readers for recognition and hydrolases as erasers for removal of the moieties (Figure 1.1) (Luscher et al., 2018). The unique system functions as a switch turning biological signals on and off through the attachment, recognition, removal, and recycle of ADPr groups along the process (Li and Chen, 2014). 1 Chapter 1 contains sections partially quoted verbatim from my first author publication: Chen, J., Lam, A.T., and Zhang, Y. (2018). A macrodomain-linked immunosorbent assay (MLISA) for mono-ADP-ribosyltransferases. Anal Biochem 543, 132-139. Permission to use is granted by Elsevier, ScienceDirect, for non-commercial purposes <https://www.elsevier.com/about/policies/copyright/permissions> 2 1.2 NAD + Biosynthesis Pathways As one of the most critical players in energy metabolism, NAD + is often seen as a coenzyme due to its unique chemical composition, which allows it to be both a donor and an acceptor for electrons in its reduced and oxidized forms (Hottiger et al., 2011). Recent studies have revealed two key NAD + intermediates and their associated enzymes: nicotinamide riboside (NR) and nicotinamide mononucleotide (NMN), and NR kinase (NRK) and NMN adenylyltransferases (NMNATs) (Hassa et al., 2006; Yoshino et al., 2018). Absorbed from everyday food sources, NR and NMN are both natural compounds serving as precursors of NAD + (Figure 1.2) (Yoshino et al., 2018). NR is converted to NMN through phosphorylation catalyzed by NRK. In mammals, an alternative pathway exists as nicotinamide phosphoribosyltransferase (NAMPT) can directly use nicotinamide for synthesis of NMN. Then NAD + can be synthesized through the catalysis of NMNAT using NMN as a substrate. 1.3 Writers: ADP-ribosyltransferases (ARTs) ARTs widely exist in conserved forms in the biological systems of diverse organisms in the evolutionary spectrum, including bacteria, viruses and mammals (Aravind et al., 2015). There are two major categories of ARTs based on their structural similarities to bacterial toxins: cholera toxin like ADP-ribosyltransferases (ARTC) and diphtheria toxin like ADP- ribosyltransferases (ARTD) (Karlberg et al., 2013). Structurally, the two classes of ARTs mainly differ in their binding motifs to NAD + . ARTCs generally contain an R-S-F-E motif while the binding motif for ARTDs is H-Y-Y/F-E. Four ARTCs in humans have been successfully expressed and studied: ARTC1, ARTC3, ARTC4, and ARTC5 (Liu and Yu, 2015; Luscher et al., 2018). Most of the human ARTCs are found on the cell membranes except for ARTC5, which is 3 secreted (Fabrizio et al., 2015). ARTC1, ARTC2, and ARTC5 have been found to have mono ART activities, allowing them to transfer a single ADPr moiety onto their target proteins. The ARTCs function in cell to cell communications and various signaling pathways through modifying protein substrates on the cell surfaces (Zolkiewska, 2005). The signal transductions likely result in immune responses and inflammation as studies have found ARTC activity on epithelial and immune cells (Palazzo et al., 2017). On the other hand, 17 mammalian ARTDs have been found so far (Luscher et al., 2018). Most of the ARTDs are widely expressed in the cell cytosol and are involved in intracellular signaling through different pathways. ARTDs have highly conserved catalytic domains that share structural similarities with the catalytic domain of diphtheria toxin (Liu and Yu, 2015). Four ARTDs (ARTD1, 2, 5 and 6) have been identified to have poly ADP-ribosylation activities. The poly ARTDs can attach ADPr polymers on to target substrates while the other ARTDs can either only transfer a single ADPr moiety or have no catalytic activity (Luscher et al., 2018; Palazzo et al., 2017). ARTDs can be further divided into several subgroups based on their domain compositions (Barkauskaite et al., 2015; Liu and Yu, 2015). The domain architectures usually determine ARTDs’ catalytic activities and functions. For example, the ARTDs with DNA-binding domains usually require interactions with DNA for activation of catalytic activities. The difference in ARTD domain compositions determines and contributes to the diverse cellular processes that the enzymes are involved in (Luscher et al., 2018). 4 1.4 Poly ADP-ribosylation (PARylation) and PARP1 ARTDs are also called poly ADP‐ribose polymerase (PARP) enzymes due to different nomenclatures (Kuny and Sullivan, 2016). PARPs/ARTDs that are capable of catalyzing PARylation have been found to mediate cellular processes in response to DNA damage and repair, transcription and chromatin regulation, apoptosis, and energy metabolism (Altmeyer et al., 2009; Beck et al., 2014; Jubin et al., 2016; Ko and Ren, 2012; Ray Chaudhuri and Nussenzweig, 2017; Tao et al., 2009a). Among all 17 enzymes of the PARP family, the founding member PARP1/ARTD1 is the first one discovered and identified (Fouquerel and Sobol, 2014). PARP1 is a 113 kDa enzyme widely expressed in the nucleus (Bouchard et al., 2003). Its ability to rapidly attach poly ADPr polymers on to its substrates has been extensively studied according to previous literature (Beck et al., 2014; Jubin et al., 2016; Ko and Ren, 2012). The majority of the formed PARylation in cells is attributed to PARP1 activities. While PARP1 has a multidomain structure, the main domains responsible for its PARylation activities are consist of a DNA-binding domain at the N-terminus, an automodification domain, and a highly conserved catalytic domain (Altmeyer et al., 2009). There are multiple zinc finger motifs found in the DNA-binding domain for stabilizing the enzyme’s interactions with DNA. A nuclear localization signal (NLS) is also embedded in the DNA-binding domain allowing for PARP1’s localization into the nucleus. The automodification domain in the middle of the PARP1's sequence is found to be one of the sites containing multiple acceptor amino acid residues for poly ADPr attachments. The automodification domain also plays an important role serving as the platform where PARP1 self-dimerizes for catalytic activity upon DNA activation. PARP1’s catalytic domain at the C-terminus contains a highly conserved H-Y-E motif (Pion et al., 2005; Vyas et al., 2014). The conserved residues bind to different functional groups on NAD + molecules for 5 initiating interactions required for catalysis (Steffen et al., 2013). Three functions have been identified and associated with PARP1's catalytic domain (Altmeyer et al., 2009). The enzyme attaches the initial ADPr unit onto the acceptor residue, elongates the linear ADPr chain, and adds ADPr units in a branched fashion. The DNA-binding and catalytic domains are the minimal domains required for PARP1 catalytic activity. PARP1 transfers ADPr units onto a wide range of cellular substrates (heteromodification) (Vyas et al., 2014). Histones are well-studied substrates for PARP1, especially H1 and H2B (Ko and Ren, 2012). But PARP1 mainly catalyzes the modification of attaching up to 200 units of linear or branched poly ADPr units to amino acid residues on itself, a unique characteristic called automodification (Krishnakumar and Kraus, 2010; Putt and Hergenrother, 2004). The poly ADPr chains synthesized through automodification serve as localization signals for the recruitment of scaffolding proteins, check point proteins, and transcription factors to form large protein complexes for repairing DNA when damages occur (Ko and Ren, 2012). A number of different stimuli can induce PARP1 catalysis, either in a DNA-dependent or a DNA-independent manner. The level of PARP1 activity is relatively low when cells are operating under normal conditions (McCluskey et al., 2011). However, PARP1 can be activated once its zinc fingers recognize and bind to damaged DNA such as single strand and double strand breakage, as well as a variety of other DNA structures like non-B-DNA (Lonskaya et al., 2005). Protein/enzyme components in other signaling pathways can also stimulate PARP1 activity. Several kinases including mitogen- activated protein kinase (MAPK) and Ca 2+ /calmodulin-dependent protein kinase II (CaMKII) are able to activate PARP1 for PARylation (Cohen-Armon et al., 2007; Ko and Ren, 2012). Enzymes involved in energy metabolism like NAD + synthesis can also have downstream effects leading to increased enzymatic activity of PARP1. 6 1.5 Mono ADP-ribosylation (MARylation) and Mono PARPs MARylation differs from PARylation in that it is the process where only one ADPr unit can be covalently attached to the substrate protein (Butepage et al., 2015). Like PARylation, MARylation is reversible and highly regulated. In the superfamily of human ARTs, 14 members are shown to display mono ART activity, exemplified by the commonly studied PARP10, PARP14, PARP15, and PARP16 from the PARP family (Scarpa et al., 2013; Vyas et al., 2014). Like the poly PARPs that are capable of PARylation, mono PARPs also have conserved catalytic domains for transferase activities. But instead of the H-Y-E motif seen in PARP1, mono PARPs lack the glutamate responsible for polymer elongation in the triad (Kleine et al., 2008). Mono PARPs are also multidomain enzymes that can be further characterized based on their unique domain structures. For example, some of the enzymes have ADPr recognition domains named macrodomains but the number of the domains in their sequence varies from each other. The domain arrangement may have an impact on the enzymes’ biological roles in cells. Mono ART- mediated post-translational modifications are found to be involved in major cellular processes such as DNA replication, cell proliferation, signal transduction, and apoptosis (Butepage et al., 2015; Chen et al., 2018; Feijs et al., 2013b; Hassa et al., 2006; Ryu et al., 2015). Cellular MARylation is also identified as mechanisms in response to genotoxic stresses and unfolded protein responses to modulate protein functions and cell physiology (Haag and Buck, 2015). In addition, some mono ARTs exhibit anti-viral activities upon infections, implicating a role in innate immunity (Butepage et al., 2015; Chen et al., 2018; Karlberg et al., 2015). PARP10 is the first member identified and characterized in the mono PARP subgroup (Luscher et al., 2018). Despite being a cytoplasmic enzyme widely expressed in all tissues, PARP10 can translocate to the nucleus to regulate cell proliferation. PARP10 interact with a variety of binding 7 partners and substrates, including nuclear antigens, oncoprotein c-Myc, core histones and many kinases involved in kinase cascades in various signaling pathways (Marton et al., 2018; Yu et al., 2005). Studies have also shown that PARP10 activity plays an important role in DNA-damage repair, making it a novel target in cancer biology studies (Megnin-Chanet et al., 2010; Schleicher et al., 2018). PARP14 shares structure and function homology with PARP10 and the two enzymes have several common substrates and roles in signaling pathways they are both involved in (Forst et al., 2013). PARP14 has been shown to activate Stat6 as a crucial step in transcription control (Mehrotra et al., 2011). Strong evidence has been found supporting the linkage in between PARP14 and cancers such as multiple myeloma and diffuse large B-cell lymphomas (Scarpa et al., 2013). Despite the structure similarities it shares with the other members in the PARP family, PARP16 is the only mono PARP with a transmembrane anchor, while the other PARPs remained cytoplasmic (Di Paola et al., 2012; Jwa and Chang, 2012). Recent studies have revealed that a novel substrate importinβ1/ karyopherin β1 (Kapβ1) of PARP16 (Fabrizio et al., 2015). In addition to its involvement in mitosis, Kapβ1 mediates the shuttling of cargo proteins from the cytosol to the nucleus. The MARylation of PARP16 may have potential indications in serving as the regulatory mechanism for nucleocytoplasmic transportation. To date, there has not been much comprehensive analysis completed on mono PARPs due to lack of specific tools for detecting MARylation, and only fragmented information is available for mono PARPs like PARP10 and PARP14-16. Further systematic characterizations of those enzymes and new development of new chemical tools such as selective inhibitors will gain valuable insights not only in their biological functions but also in therapeutic opportunities for treatment of diseases. 8 1.6 Motifs Recognizing ADP-ribosylation Detecting and recognizing ADPr tags are important steps in signaling pathways where ADP- ribosylation is involved (Verheugd et al., 2016). Hence, many cellular proteins have domains and motifs that are able to bind ADPr units incorporated into their sequences and structures (Teloni and Altmeyer, 2016). The PAR-binding motif (PBM), the macrodomain, the PAR-binding zinc finger (PBZ), the WWE domain, the BRCT domain, the FHA domain, the OB-fold domain and the RRM domain have been found to be ADPr binding modules (Wei and Yu, 2016). Within the eight modules, macrodomains, PBZ and WWE have been most extensively studied for their ADPr binding characteristics (Rack et al., 2016). These domains can either bind to mono ADPr or poly ADPr chains to attract proteins to PARP catalytic sites or tag the ADP-ribosylated enzyme substrates for ADPr moiety removal. It is not surprising to find that most of the ADPr binding modules are found on proteins involved in DNA-damage repair pathways, given the heavy involvement of PARP enzymes in the repair process (Wei and Yu, 2016). The PAR- binding zinc finger (PBZ) binds to tandem ADPr on poly ADPr chains. They have mostly been found in machineries such as DNA damage response protein APLF and CHFR ligase (Ahel et al., 2008). WWE domains are able to recognize the linkage in between two ADPr units (Wang et al., 2012). They are mainly found in both the PARPs such as PARP7 and PARP11-14, and the E3 ubiquitin protein ligases like RNF146/Iduna, which is also a ligase involved in DNA damage repair. Macrodomains are a family of evolutionarily conserved proteins characterized by tight binding affinity and high specificity to mono and poly ADPr (Feijs et al., 2013a; Han et al., 2011; Kalisch et al., 2012). By recognizing ADPr units covalently attached to target proteins, macrodomains act as readers of MARylation and PARylation in regulating ART-mediated signaling pathways (Egloff et al., 2006; Karras et al., 2005; Rack et al., 2016). Numerous human 9 macrodomain-containing proteins have been identified, including macroH2A and its variants, MacroD1-3, C6orf130, ALC1, PARP9, PARP14, and PARP15 (Aguiar et al., 2005; Feijs et al., 2013a; Han et al., 2011). Notably, a subset of macrodomain proteins display hydrolase activities and function as erasers of protein ADP-ribosylation, which include archaebacterial Af1521 and human MacroD1, MacroD2, and C6orf130 (Jankevicius et al., 2013; Leung et al., 2018; Rosenthal et al., 2013). Recent studies in macrodomain crystal structures revealed the structural aspect of how different macrodomains recognize and distinguish in between poly ADPr and mono ADPr to bind to the designated moiety (Karlberg et al., 2013). According to the co- crystallization study, both the poly ADPr binding- and mono ADPr binding-macrodomains form a structure with a cleft where the adenine ribose group of ADPr is deeply buried. However, the nicotinamide ribose groups of poly ADPr are aligned with positive charges along the cleft and are less exposed comparing to that of the mono ADPr, indicating that the structure alignment functions to accommodate the negative charges of the phosphate groups on poly ADPr chains. In light of their high affinity and specificity to ADPr, macrodomain proteins have been applied to proteomic and imaging studies to profile and visualize ADP-ribosylated proteomes (Aguilera- Gomez et al., 2016; Dani et al., 2009). 1.7 Poly (ADP-ribose) Glycohydrolase (PARG), ADP-ribosyl-acceptor Hydrolase (ARH), and Macrodomains Since ADP-ribosylation is a reversible modification, ADP-ribosyl hydrolases are pivotal in degrading poly ADPr chains and removing mono ADPr from substrate proteins (Meyer-Ficca et al., 2011; Mortusewicz et al., 2011; Sahaboglu et al., 2014). The timely turnover of ADPr moieties is essential for maintaining cellular homeostasis (Zaja et al., 2012). Studies have shown that the lack of ADP-ribosyl hydrolases in mice can lead to embryonic fatality as the animals are 10 unable to degrade poly ADPr accumulated in cells (Blenn et al., 2006; Koh et al., 2004). In nuclear poly (ADP-ribose) glycohydrolase (PARG) knockout mice, the buildup of poly ADPr impeded normal neuronal cells activities, causing further damages. Only a handful of ADP- ribosyl hydrolases have been identified and the two most studied types of enzymes are PARG and ADP-ribosyl hydrolases (ARH) (Mashimo and Moss, 2016). PARG breaks down the ribose- ribose bonds on poly ADPr chains, resulting in either mono ADPr units or free ADPr polymers. Three mammalian ARH enzymes have been found (ARH1-3) with only two members of the family having known hydrolase activity, ARH1 and 3 (Mashimo and Moss, 2016). ADPr attached on arginine residues can be cleaved off by ARH1 while ARH3 can only hydrolyze poly ADPr chains, potentially leading to the formation of mono ADP-ribosylated proteins due to incomplete hydrolysis. As mentioned in the previous section, certain macrodomains may exhibit hydrolase activities. Interestingly, a macrodomain core is found in the catalytic domain of PARG with an additional PARG conserved sequence (Kim et al., 2012). These findings provide the basis of understanding on the erasers involved in ADPr hydrolysis and recycling, as more studies on removal mechanisms are underway, since hydrolases that specifically recognize ADPr on amino acid acceptors like lysine or cysteine residues have yet to be found. 11 Figure 1.1 General scheme of ADP-ribosylation. Writers transfer ADPr moieties onto substrate proteins using NAD + as co-substrate. Erasers hydrolyzes the ADPr groups, removing them from substrate proteins. Reproduced and adapted from Luscher et al., 2018 (Luscher et al., 2018). 12 Figure 1.2 General scheme of for biosynthesis of NAD + . NRKs or NAMPT catalyze the reaction for NMN synthesis using NR or Nam. NAD + is then synthesized by NMNAT using NMN as the substrate. Reproduced and adapted from Yoshino et al., 2018 (Yoshino et al., 2018). 13 2 Macrodomain-linked Immunosorbent Assay (MLISA) 2 (Chen et al., 2018) 2.1 Introduction Accumulating evidence revealed that overexpressed mono ARTs are widely seen in many types of human diseases, including cancer, immune disorders, and metabolic diseases (Cho et al., 2009; Di Paola et al., 2012; Gariani et al., 2017; Iansante et al., 2015; Jwa and Chang, 2012; Mehrotra et al., 2013; Riffell et al., 2012; Ryu et al., 2016; Vyas and Chang, 2014; Welsby et al., 2012). In the human ART superfamily, 14 out of 20 members are shown to catalyze endogenous protein MARylation (Figure 2.1). Their expression levels and enzymatic activities often correlate with disease pathogenesis and progression (Bachmann et al., 2014; Barbarulo et al., 2012; Cho et al., 2011; Ossovskaya et al., 2010; Quiles-Perez et al., 2010; Vyas and Chang, 2014; Yanagawa et al., 2007). Given their potentially essential functions and roles in pathophysiology, human mono ARTs have been emerging as highly promising targets for development of new diagnostics and therapeutics (Ekblad et al., 2015; Gariani et al., 2017; Quiles-Perez et al., 2010; Scarpa et al., 2013; Vyas and Chang, 2014). However, potent inhibitors specifically targeting disease-related mono ARTs are yet to be developed for therapeutic applications as well as for better understanding of their mechanisms involved in pathogenesis. Thus, innovative assays suitable for high-throughput screening are desired for quantitative determination of mono ART activities and identification of novel inhibitors with high potency and specificity. 2 Chapter 2 contains sections partially quoted verbatim from my first author publication: Chen, J., Lam, A.T., and Zhang, Y. (2018). A macrodomain-linked immunosorbent assay (MLISA) for mono-ADP-ribosyltransferases. Anal Biochem 543, 132-139.Permission to use is granted by Elsevier, ScienceDirect, for non-commercial purposes <https://www.elsevier.com/about/policies/copyright/permissions> 14 Currently, several methods have been established for characterization of mono ARTs. Radioactive NAD + compounds are common and sensitive tools for examining ART activities (Vyas et al., 2014). Non-radioactive NAD + analogues with remote purine moieties modified by alkyne, biotin, and etheno groups have been generated for studying protein ADP-ribosylation catalyzed by both poly and mono ARTs (Carter-O'Connell et al., 2014; Ekblad et al., 2015; Gibson et al., 2016; Jiang et al., 2010; Laing et al., 2011; Oei et al., 1996; Venkannagari et al., 2016; Wallrodt et al., 2016). An enzyme-coupled spectrophotometric assay was also developed for quantitatively determining ADP-ribosylation activity by measuring decrease of UV absorbance at 340 nm for NADH consumed by glutamate dehydrogenase (GDH) in response to produced ammonia from nicotinamidase-catalyzed hydrolysis of nicotinamide (Smith et al., 2009). Similarly, ART activity could be measured on the basis of the decrease in fluorescence for a fluorophore chemically converted from unused NAD + (Putt and Hergenrother, 2004; Venkannagari et al., 2013). In contrast to commercially readily available antibodies against poly ADPr, few monoclonal antibodies specific for mono ADPr have been developed (Meyer and Hilz, 1986; Young and Santella, 1988). We hereby report the development of a macrodomain-linked immunosorbent assay (MLISA) as a generally applicable method for quantitative characterization of mono ART enzymes. By exploiting macrodomain 2 of PARP14 that binds tightly to mono ADPr both in vitro and in cells while lacking hydrolase activity, a recombinant agent for recognizing mono ADP-ribosylated proteins was generated (Forst et al., 2013; Rosenthal et al., 2013). In combination with an anti- hemagglutinin (HA) antibody, the macrodomain 2-based ADPr binding module was shown to detect protein MARylation with good selectivity. As a general approach, the developed MLISA allows rapid quantification of protein ADP-ribosylations catalyzed by distinct mono ARTs 15 exemplified by PARP15 and PARP14, as well as characterization of PARP15 enzyme kinetics. Furthermore, a panel of commonly used chemical tools for PARPs was examined for inhibitory activities against PARP15 and PARP14 by performing MLISA-based screening in 96-well plates. Our study shows that MLISA provides a convenient and quantitative approach for characterizing mono ARTs and potentially enables discovery of new mono ARTs inhibitors in a high-throughput compatible format. 2.2 Experimental Methods 2.2.1 Molecular Cloning and Protein Expression and Purification The catalytic domains of PARP15 (residue 481-678) and PARP14 (residue 1611-1801), with N- terminus His6 tags and Factor Xa cleavage sites were amplified through polymerase chain reaction (PCR) using primers P1-2 and P8-9 (Table 2.1), followed by additions of XhoI and XbaI restriction enzyme sites at 5'- and 3'-end, respectively, using primers listed in Table 2.1 (P5 and P6 for PARP14; P10 and P11 for PARP15). Macrodomain 2 (residue 999-1196) of PARP14 with an N-terminus His6 tag and a Factor Xa cleavage site was amplified by PCR using primers P3 and P4, followed by incorporation of XhoI and XbaI restriction enzyme sites and a C-terminus HA tag using primers P5 and P7 (Table 2.1). The amplified DNA fragments were digested by XhoI and XbaI restriction enzymes and then ligated into pET-28a (+) using T4 DNA ligase. All generated expression vectors were confirmed by DNA sequencing provided by Genewiz LLC (South Plainfield, NJ). PARP15 plasmid was cloned by Albert Lam. BL21 (DE3) cells were transformed with the generated constructs for bacterial protein expression in LB Broth supplemented with kanamycin (50 µg mL -1 ). The overnight bacterial culture (5 mL) was diluted into 1 liter LB Broth with kanamycin (50 µg mL -1 ) for growth at 37 ̊C 16 in an incubator shaker at a speed of 250 rpm (Series 25, New Brunswick Scientific, NJ). When OD600nm reached 0.6-0.8, protein expression was induced with 0.5 mM isopropyl β-D-1- thiogalactopyranoside (IPTG) for overnight at 22 ̊C. Cells were then harvested by centrifugation at 4,550 g (Beckman J6B Centrifuge, JS-4.2 rotor), resuspended in equilibrium buffer (20 mM Tris-HCl, pH 8.0, 200 mM NaCl, 20 mM imidazole), and lysed using a French Press (GlenMills, NJ) at 25,000 psi for three times. Cell debris was removed by centrifugation at 27,000 g for 1 hour (Beckman Coulter centrifuge, JA-17 rotor) and supernatant was filtered through a 0.45 µm membrane. The filtrate was loaded on a gravity flow column packed with 1 mL Ni-NTA agarose resin (Thermo Fisher Scientific, Waltham, MA), followed by washing with 15 column volumes of wash buffer (20 mM Tris-HCl, pH 8.0, 200 mM NaCl, 30 mM imidazole). Proteins were then eluted in 15 column volumes of elution buffer (20 mM Tris-HCl, pH 8.0, 200 mM NaCl, 400 mM imidazole), dialyzed in storage buffer (20 mM Tris-HCl, pH 8.0, 300 mM NaCl, 1 mM DTT, 10% glycerol) at 4 ̊C for overnight and another 6 hours in fresh storage buffer, and concentrated using an Amicon centrifugal concentrator (EMD Millipore, Temecula, CA) with a 10 kDa cutoff. Purified proteins were examined by SDS-PAGE and NanoDrop 2000C spectrophotometer (Thermo Fisher Scientific, Waltham, MA), and aliquoted and flash-frozen in liquid nitrogen for storage at -80 ̊C. Calculated molecular extinction coefficient values are 1.20 for PARP 14, 1.13 for PARP15, and 0.93 for macrodomain 2. 17 2.2.2 MLISA Assay 2.2.2.1 Overall Assay Design and Validation The general scheme of MLISA is shown in Figure 2.3. First, 200 µL of PARP-catalyzed automodifications using NAD + as co-substrate in reaction buffer (50 mM Tris-HCl, pH 7.4, 2 mM DTT) were performed in 96-wells plates together with the coating process for 2 hours at room temperature. Following five washes with 200 µL of PBST (0.1% v/v Tween-20 in PBS, pH 7.4) in each well, plates were blocked with 3% BSA dissolved in PBS, pH 7.4, for 2 hours under room temperature. Next, each well was washed five times using 200 µL of PBST and then incubated with 100 µL of purified macrodomain 2 (0.1 µM M2 for PARP15 and 0.3 µM M2 for PARP14) in PBS for 1 hour at room temperature. Subsequently, plates were washed five times with 200 µL of PBST and incubated with 100 µL of anti-HA-HRP conjugate (1: 5000 in PBS) for 1 hour at room temperature. After another five washes with 200 µL of PBST, 75 µL of QuantaBlu TM fluorogenic peroxidase substrate was added to each well and incubated for 10 minutes prior to reading. Fluorescence intensity in each well was then measured using Synergy H1 Multi-Mode Reader (BioTek, Winooski VT). All experiments were performed at least in triplicates. Control wells were established to evaluate background signal intensity due to non-specific binding in between assay components. Wells for 2-hour PARP enzymatic reactions with 500 µM of NAD + were set as the maximal signal wells while wells with only enzymes and no NAD + addition were set to be the minimal signal wells. Fluorescence signal intensities of wells containing 3% BSA only, 3% BSA with various concentrations of M2, NAD + plus various concentrations of M2, and enzymatic reactions without M2 addition were separately measured 18 after incubation with anti-HA-HRP conjugate and compared to those of the maximal signal wells. MLISA assays for both PARP15 and PARP14 were performed on five plates with two sets of triplicates of the maximal and minimal signal wells on each plate for assay validation and repeatability purposes, of which three plates were carried out on the same day and two plates on different days. Assay quality was assessed through analyzing commonly accepted statistical parameters including signal-to-noise ratio (S/N), signal-to-background ratio (S/B) and screening window coefficient (Z′) (Iversen et al., 2004; Venkannagari et al., 2013; Zhang et al., 1999). Coefficients of variations (CVs) are calculated by analyzing all data on the assay plates and the normality of both maximal and minimal signal intensities of PARP15 and PARP14 was evaluated through Kolmogorov-Smirnov and D’Agostino and Pearson omnibus tests using GraphPad Prism (La Jolla, CA). 2.2.2.2 Time- and Concentration-dependent PARP Catalytic Activities To perform activity assays with varied reaction time and concentrations, 96-well plates were coated with reaction mixtures in triplicates that consist of 500 µM of NAD + and purified PARP enzymes at varied concentrations (PARP15: 0.25 µM, 0.5 µM, 0.75 µM, 1 µM, 1.5 µM, 2 µM and 2.5 µM; PARP14: 1.5 µM, 3 µM, 4.5 µM, 6 µM, 7.5 µM and 9 µM) in reaction buffer (50 mM Tris-HCl, pH 7.4, 2 mM DTT) and incubated for different time points (PARP15: 0, 5, 10, 15, 20, 30, 40, 60, 80 90, 100 and 120 minutes; PARP14: 0, 30, 60, 90, 120, 150, 180, 210, 240, 270, 300, and 360 minutes) at room temperature. The reactions were quenched with 20% ice- cold TCA at those time points. For each enzyme concentration, the apparent rate constant (k) was calculated in GraphPad Prism using one phase exponential association equation Y=Ymax*(1- exp(-k*X)). The rates were then plotted against enzyme concentrations and fitted through the linear regression model for signal linearity analysis. 19 2.2.2.3 Inhibition of PARP Enzymatic Activities To carry out inhibition assays, 96-well plates were coated with reactions in triplicates that consist of 500 µM of NAD + , purified PARP enzymes (PARP15: 500 nM; PARP14: 3 µM), and various inhibitors at multiple concentrations (0, 0.5, 1, 2.5, 5, 7.5, 10, 12.5, and 15 µM for PARP15, 0.1% DMSO or water and 0, 1, 2.5, 5, 10, 25, 50, 75, and 100 µM for PARP14, 0.6% DMSO or water) in reaction buffer (50 mM Tris-HCl, pH 7.4, 2 mM DTT). Additional inhibitor concentrations (ranging from 1 nM to 1 mM for olaparib, 1,5-isoquinolinediol, 6(5H)- Phenanthridinone, and DR2313) were included for PARP15-catalyzed reactions for determination of IC50 values. DMSO-soluble inhibitors (olaparib, XAV939, 1,5-isoquinolinediol, minocin, 6(5H)-Phenanthridinone, and adenine) were initially dissolved in 100% DMSO and diluted in water to reduce DMSO content to either 0.1% (for PARP15) or 0.6% (for PARP14) in each well. In the presence of inhibitors at various concentrations, fluorescence intensities (FI') for PARP-catalyzed reactions were measured by MLISA. Inhibition activities were normalized on the basis of the measured fluorescence intensities (FI0) for the wells without inhibitors and with 0.1% DMSO or water for PARP15 and 0.6% DMSO or water for PARP14. IC50 and pIC50 values of individual inhibitors were calculated by fitting the dose-response curves with four parameters in GraphPad Prism for both PARP15 and PARP14 (Selvaraj et al., 2011). 20 2.2.2.4 Enzyme Kinetics of PARP15-catalyzed Automodification To characterize enzyme kinetics, 96-well plates were coated with reactions in triplicates that consist of 500 nM of PARP15 and NAD + at varied concentrations (5, 10, 20, 30, 40, 200, and 400 µM) in reaction buffer (50 mM Tris-HCl, pH 7.4, 2 mM DTT). The reactions were quenched with 20% ice-cold TCA at different time points (0, 2.5, 5, 7.5, 10, 12.5, 15, and 20 minutes). The plates were further incubated for up to 2 hours under room temperature followed by five washes with 200 µL of PBST. Kinetic parameters were calculated by fitting data to Michaelis-Menten model implemented in GraphPad Prism (La Jolla, CA). To determine reaction rates, standard curves were generated for each reaction plate. In brief, PARP15-catalyzed automodification reactions were incubated for 2 hours under room temperature in 1.5 mL microcentrifuge tubes that contained 50 µg mL -1 of purified PARP15 and 500 µM of NAD + in reaction buffer (50 mM Tris-HCl, pH 7.4, 2 mM DTT). Reaction mixtures were then serially diluted and plated simultaneously on both the 96-well ELISA plates and clear 96-well pureGrade plates. Upon additions of Coomassie Plus (Bradford) assay reagents to clear 96-well pureGrade plates, the absorbance at 595 nm of each well was measured by Synergy H1 Hybrid Multi-Mode Microplate Reader. The concentrations of automodified PARP15 were calculated through fitting to linear regression curves generated with BSA standards. Standard curves were constructed through linear correlation of the determined concentrations of automodified PARP15 with the fluorescence intensities of the corresponding wells measured on 96-well ELISA plates. 21 2.2.2.5 High-performance Liquid Chromatography (HPLC)-based Activity Assay PARP-catalyzed automodification reactions were performed at room temperature in 100 µL assay solutions containing 50 mM Tris-HCl, pH 7.4, 2 mM DTT, and varied concentrations of NAD + and purified PARP enzymes. The reaction mixtures after varied lengths of incubation were separated by reverse phase HPLC using a semipreparative C18 Kinetex ® column (5 µm, 100 Å, 150 x 10.0 mm, Phenomenex Inc, Torrance, CA) with a gradient of methanol (0-50% in 12 minutes) in water containing 0.1% formic acid. Reaction rates were determined on the basis of the assigned peaks of nicotinamide and NAD + . The experiment was performed by Albert Lam. 2.3 Results 2.3.1 Overall Assay Design Previous studies indicated that macrodomain proteins possess high affinity and specificity towards protein ADP-ribosylation and could be utilized to identify and visualize ADP- ribosylated proteins in the cells (Aguilera-Gomez et al., 2016; Dani et al., 2009; Forst et al., 2013). We thus envisioned that recombinant macrodomains can possibly act as powerful detection agents of MARylation for direct and quantitative characterization of mono ARTs through a novel immuno-like assay potentially adaptable for high-throughput screening. To test this notion, macrodomain 2 of PARP14 was chosen for developing the MLISA, since it shows high affinity to mono ADPr but displays no hydrolase activity seen in many other macrodomain proteins (Forst et al., 2013; Rosenthal et al., 2013). The bacterial expression construct for macrodomain 2 was designed with an N-terminus His6 tag followed by a Factor Xa cleavage site for purification and a C-terminus HA tag for recognition by a secondary antibody. Recombinant 22 macrodomain 2 was stably expressed in E. coli and purified by Ni-NTA affinity chromatography with a final yield of 1.4 mg per liter. SDS-PAGE analysis revealed that the generated macrodomain 2 migrated as a single band around 24 kDa (Figure 2.2). Next, to test the generality of the resulting macrodomain 2 in binding and reporting MARylation, two human mono ARTs PARP15 and PARP14 were recombinantly produced. Overexpression of these mono ARTs are frequently detected in many types of cancer, but little is known about the characteristics of these enzymes (Andersson et al., 2012). All PARPs were stably expressed in E. coli and purified using the same method as macrodomain 2 with final yields of 1-1.5 mg per liter. SDS-PAGE analysis showed single bands of 25 kDa for PARP15 and 23 kDa for PARP14 (Figure 2.2). The catalytic activities of the generated PARPs were verified through automodification reactions using HPLC-based activity assay. The MLISA was designed by utilizing the HA-tagged macrodomain 2 as a primary detection agent for recognition of mono ADP-ribosylated proteins that are immobilized on ELISA plates (Figure 2.3). An anti-HA antibody-HRP conjugate was included as a dual agent for detecting bound macrodomain 2 and reporting levels of activity through enzyme-mediated signal amplification. First, automodification reactions by mono ARTs were performed in the wells for direct coating of ADP-ribosylated proteins on 96-well plates. The reactions could be quenched by adding 20% TCA to each well. By dispensing libraries of compounds onto the plates, their effects on mono ART activities could be quantitatively measured for identification of new activators/inhibitors. Second, 3% BSA in PBS (pH 7.4) was utilized as blocking agent following the coating step, similar to conventional immunoassays. Then, HA-tagged macrodomain 2 and anti-HA antibody-HRP conjugate were added to each well in a sequential order for complex assembly. It should also be noted that each of these steps was incubated for 1-2 hours at room 23 temperature and thorough washes (5 ) with PBST were carried out prior to additions of any reagents for next step. Lastly, upon addition of fluorogenic substrates of HRP to each well, enzymatic activities were determined on the basis of recorded fluorescence intensities that closely correlate with the levels of immuno-complexes formed in the wells. 2.3.2 Validation By performing MLISA with auto-ADP-ribosylation catalyzed by different mono ARTs, the specificity of macrodomain 2 towards mono ADP-ribosylated proteins was examined. Reactions containing PARP enzymes with and without NAD + were incubated for two hours in the wells, followed by blocking with 3% BSA, detecting with macrodomain 2, and the reporting step as established for the MLISA. In comparison to the control wells where no reactions occur or no macrodomain 2 existed, the respective ones with NAD + -dependent auto-ADP-ribosylation showed dramatically increased fluorescence intensities for both PARPs (Figure 2.4). This indicated that the generated macrodomain 2 binds specifically to mono ADP-ribosylated proteins. Using macrodomain 2 as a detection agent of mono ADPr, MLISA allows quantitative measurements of MARylation on distinct proteins. It was found that relative to reaction wells, the control wells with PARP14 revealed higher background fluorescence intensities than those with PARP15, likely resulting from the nonspecific binding caused by high concentration of PARP14 (3 µM for PARP14 and 500 nM for PARP15). Importantly, by increasing the concentrations of PARP14 to 6 and 9 µM for enhanced MARylation, lower contributions of fluorescence signals from the background were observed (Figure 2.5), supporting high specificity of the generated macrodomain 2 for mono ADP-ribosylated proteins. Relative to PARP15, higher macrodomain 2 concentration (0.3 µM versus 0.1 µM) was used for PARP14 to improve signal-to-background ratio (> 2.5). Additions of anti-HA antibody-HRP conjugate with and 24 without macrodomain 2 to the wells with only 3% BSA resulted in minimal fluorescence intensity, showing that neither of these reagents binds nonspecifically to BSA. In the absence of macrodomain 2, incubation of anti-HA antibody-HRP conjugate with PARP-catalyzed reactions led to low fluorescence signals, indicating the lack of specific binding to ADP-ribosylated proteins for the anti-HA secondary antibody. Compared with reaction wells, the control wells without PARP enzymes gave minimal fluorescence signals, showing no affinity between macrodomain 2 and NAD + . Taken together, these results support the use of recombinant macrodomain 2 in MLISA as a specific detection agent for mono ADP-ribosylated proteins. The well-to-well, plate-to-plate, and day-to-day variations and frequency distribution of maximal and minimal signals were evaluated through analysis of five independent assay plates performed on different days (Table 2.2 and Table 2.3; Figure 2.6). The Z' factors for PARP15- and PARP14- catalyzed automodifications are 0.8 and 0.6, respectively, indicating that the developed MLISA assay is suitable for screening purposes. 2.3.3 Time and Concentration Dependence Next, catalytic activities of PARP15 and PARP14 were characterized by MLISA at varied lengths of reaction times and different enzyme concentrations. Automodification of PARP15 was incubated for 0 to 120 minutes in an enzyme concentration range of 0 to 2.5 µM. The reaction wells showed that the fluorescence intensities for PARP15-catalyzed automodification reactions increased in time-dependent manners (Figure 2.7). Moreover, the determined apparent rate constants show linear dependence on the concentrations of PARP15 enzyme from 0.25 µM to 2.5 µM (Figure 2.9A), allowing quantitative measurements of PARP15 activities by MLISA. Similarly, the time-dependent increases in fluorescence signals were seen for PARP14-catalyzed automodifications which were carried out at both higher enzyme concentrations and longer time 25 duration (Figure 2.8). The measured apparent rate constants also display a linear correlation with the concentrations of PARP14 enzyme in the range of 1.5 to 9 µM (Figure 2.9B). These data indicated that PARP14 enzymatic activity can also be quantitatively determined by MLISA. In addition, it was found that further decreased concentrations of PARP15 resulted in significantly reduced apparent rate constants, which were determined to be 0.003 min -1 for 0.1 µM and 0.001 min -1 for 0.05 µM. Due to low activity, no apparent rate constants could be determined at concentrations below 0.05 µM for PARP15 and 1.5 µM for PARP14. To more accurately determine the apparent rate constants, the fluorescence intensities at time 0 (y-intercept) in Figure 2.7 and Figure 2.8 could be included in the exponential association equation. Alternatively, the measured fluorescence intensities in the initial linear region could be fitted to a linear equation with the included y-intercept for determination of the reaction rates. In both cases, the measured rates are linearly dependent on the enzyme concentrations. Collectively, MLISA is shown as a general method for qualitative and quantitative characterization of mono ARTs. 2.3.4 Kinetics Parameters Characterization The developed MLISA was then utilized to characterize enzyme kinetics of mono ARTs. PARP15 was selected as a model enzyme since a published Km value for its automodification reaction was available (Karlberg et al., 2015). MLISA-based PARP15-catalyzed automodifications were performed with NAD + at varied concentrations. The enzymatic reactions were quenched with ice cold 20% TCA at various time points. As described in the experimental methods, standard curves were created on each plate for determining the concentrations of generated automodified PARP15 on the basis of measured fluorescence intensities. By fitting the kinetic data to Michaelis-Menten equation, the kcat and Km of PARP15 for automodification were 26 calculated to be 0.011 ± 0.001 min -1 and 4.5 ± 2.9 µM (Figure 2.10), respectively, which is consistent with the Km value of 5.8 ± 1.9 µM as reported previously (Karlberg et al., 2015). This supports the use of MLISA as a direct method for examining kinetics of mono ARTs. It was noted that the reaction rates for PARP15-catalyzed automodifications could be confidently measured by MLISA with a NAD + concentration of 5 µM or above. Reactions with lower NAD + concentrations resulted in little fluorescence signals over the background and relatively large variations. 2.3.5 Inhibitor Screening We next applied the MLISA for inhibitor screening of PARP15 and PARP14, given that both mono ART enzymes are involved in many human diseases including cancer. A panel of eight commonly used chemical tools for PARPs was examined in 96-well plates for their inhibitory effects on automodifcations of PARP15 and PARP14 at different concentrations (Table 2.4). Since some of those compounds were tested in 0.1% or 0.6% DMSO, control wells containing 0.1% or 0.6% DMSO only were used as no inhibitor controls to even out the inhibitory effect of DMSO on PARP enzymes. It was found that several inhibitors exhibit dose-dependent inhibition on catalytic activities of PARP15 with IC50 values in the range of 2-9 µM (Table 2.5 and Figure 2.11). Both olaparib and 6(5H)-Phenanthridinone display moderate inhibition activity for PARP15 with determined IC50 values of 4.6 ± 0.9 and 1.5 ± 0.5 µM, respectively, which are consistent with previous studies (Venkannagari et al., 2013; Wahlberg et al., 2012). Similarly, 1,5-isoquinolinediol and DR2313 were found to inhibit PARP15 activity with IC50 of 8.5 ± 2.7 and 8.6 ± 0.6 µM, respectively. The other four compounds including XAV939, minocin, nicotinamide, and adenine gave no significant inhibition effects on PARP15 activity at high inhibitor concentrations up to 15 µM. In contrast to PARP15, none of the eight tested compounds 27 revealed dose-dependent inhibition activity against PARP14 at concentrations up to 100 µM (Figure 2.12), suggesting large differences in the active sites and/or catalytic mechanisms of PARP15 and PARP14. It was shown that MLISA offers a direct and convenient approach for characterization of mono ART modulators, which is likely to be suitable for high-throughput screening. 2.4 Discussion We herein reported the development of an innovative MLISA assay for studying mono ARTs by exploiting the macrodomain protein as a binding module of mono ADPr. As a general approach, it may be applicable to investigation of various types of mono ART enzymes and qualitative and quantitative characterization of mono ART activities and their modulators. Similar to conventional ELISA, the developed MLISA can possibly be performed in different formats through uses of modified and/or new reagents, including direct, sandwich, and competitive manners. The versatility in assay style would further expand its applications in identifying readers and erasers of MARylation and examining enzyme-specific modifications. Through the use of a secondary antibody-HRP conjugate to amplify levels of modifications detected by the macrodomain protein, MLISA is characterized by a wide range of signal intensity, allowing measurements of rapid turnovers of NAD + by mono ARTs and identification of enzyme inhibitors. Additionally, MLISA requires no radioactive NAD + or specialized NAD + analogues and utilizes reagents which need no special handling and are readily accessible, providing a relatively low-cost and high-accessibility approach for evaluating mono ART enzymes. By directly measuring and reporting levels of enzyme activities, MLISA reduces complexity of the reaction systems and minimizes experimental variations. 28 In contrast to those established assays for protein MARylation, MLISA also has some potential limitations in the characterization of mono ARTs. The sensitivity of MLISA is dependent on the binding affinity of macrodomain to mono ADP-ribosylated proteins. Thus, a macrodomain protein with sub-micromolar binding affinity is unlikely to afford an ADP-ribosylation assay with sensitivity comparable to assays using radioactive NAD + or biotinylated NAD + . The reaction rates of PARP15-catalyzed automodification can be measured by MLISA with NAD + concentration as low as 5 µM. MLISA provides a direct endpoint assay for qualitative and quantitative evaluation of protein MARylation, whereas the enzyme-coupled assay allows continuously monitoring of mono ART-catalyzed reactions. In addition, despite tight affinity to both free and protein-linked ADPr, the specificity of macrodomain for modified peptide/protein needs further studies (Forst et al., 2013). To assess other mono ARTs with MLISA, assay conditions such as concentrations of macrodomain 2 and mono ARTs need be optimized. Significant levels of fluorescence intensity were observed in MLISA for the control wells with 3 µM PARP14 enzyme only, suggesting that in the absence of ADP-ribosylation the recombinant macrodomain 2 binds to the catalytic domain of PARP14. It is likely that the macrodomain 2 of PARP14, which is a multidomain protein with a molecular weight of approximately 203 kDa, can form interactions with the catalytic domain within the protein architecture to coordinate or regulate biological functions (Hakme et al., 2008). When recombinantly produced, these subdomains of PARP14 may still interact with each other, causing higher background signals as observed in the wells with PARP14 enzyme only. Olaparib, a potent inhibitor of poly ARTs, showed less inhibitory activity against mono ARTs comparing to PARP1 (IC50=5 nM), consistent with previous studies (Menear et al., 2008; Venkannagari et al., 2013; Wahlberg et al., 2012). The preferential binding of olaparib to poly 29 ARTs possibly resulted from differences in catalytic mechanisms, overall structural folds, catalytic elements, and active site interactions. Extensive mechanistic and structural studies have been performed with poly ARTs with diverse groups of inhibitors, which facilitate elucidation of principles underlying the catalysis and inhibition of poly ARTs. In comparison, limited information is available for selective inhibition of mono ARTs (Ekblad et al., 2015). In our study, several compounds including olaparib revealed differential inhibition effects on catalytic activities of PARP15 and PARP14. A relatively higher enzyme concentration was used for PARP14 in comparison to that of PARP15. Even though the inhibitor concentrations were increased accordingly, it is possible that such inhibitor concentrations may still not be sufficient enough for inhibition of PARP14 enzymatic activity. Despite the similar structures for mono ART catalytic domains, the mechanisms for catalysis may be different among individual enzymes. New inhibitors specific for individual mono ARTs could possibly be identified through mechanism and/or structure-based design or library-based screening. In fact, a potent PARP14 inhibitor was recently identified using a small molecule microarray, which exhibits more than 20-fold selectivity over PARP1 (Peng et al., 2017). Future structure-activity relationship studies will provide more details on how mono ARTs interact with their substrates and inhibitors as well as their catalytic mechanisms. In addition to macrodomain 2 of PARP14, other macrodomains in the superfamily can possibly be utilized as detection agents for the ADPr moiety, depending on their binding affinities, specificity, and capabilities in hydrolysis. For example, macrodomain 3 of PARP14 was also shown to bind tightly to mono ADPr in vitro (Feijs et al., 2013a; Forst et al., 2013). Similarly, PARP15 is a macrodomain-containing protein. In contrast to these mono ADPr binding modules, 30 macrodomain proteins recognizing poly ADPr units have been identified, such as PARP9 and Af1521, suggesting the possibility of characterizing poly ARTs with macrodomains (Karras et al., 2005). Indeed, macrodomains have been utilized to identify and visualize cellular ADP- ribosylated proteins (Aguilera-Gomez et al., 2016; Dani et al., 2009; Forst et al., 2013; Vivelo and Leung, 2015). It is of note that some of the macrodomain proteins were found to have ADP- ribosyl hydrolase activities including Af1521, human MacroD1, MacroD2, and C6orf130, preventing them from use in detecting protein ADP-ribosylation (Jankevicius et al., 2013; Rosenthal et al., 2013). Besides macrodomains, recent studies discovered that WWE domains can uniquely recognize poly ADPr units, representing a new class of protein tools for studying protein ADP-ribosylation. Moreover, the high specificity of macrodomains and WWE domains for ADPr possibly allow studies of extracellular ADP-ribosylation by distinct ART enzymes (Gibson and Kraus, 2012; Kang et al., 2011; Wang et al., 2012; Zhang et al., 2011). Guided by X-ray crystal structures of various macrodomains, protein engineering can be performed to create variants with improved affinity and specificity or orthogonal pairs of macrodomain and non-canonical ADPr. The resulting engineered macrodomains may provide important tools for investigating protein ADP-ribosylation and modulating signaling pathways and biological processes regulated by macrodomains. 31 Figure 2.1 Protein ADP-ribosylation by mono ARTs. Approximately 80% of mono ART enzymes (highlighted in red) are implicated in various human diseases. 32 Figure 2.2 SDS-PAGE gel of purified macrodomain 2 and PARP enzymes stained with Coomassie blue. Proteins loaded were normalized to 2 µg per well. Lanes 1-4: protein ladder, macrodomain 2, PARP14, and PARP15. 33 Figure 2.3 General scheme of MLISA. Five washes of PBST were conducted in between each step. 3% BSA, macrodomain 2 (M2), and anti-HA antibody-HRP conjugate were diluted in PBS, pH 7.4. 34 Figure 2.4 Macrodomain 2 (M2) is specific for mono ADP-ribosylation by (A) PARP15 and (B) PARP14. Lane 1: anti-HA antibody-HRP conjugate (Ab) has no binding to BSA. Lane 2: M2 has no binding to BSA as examined by Ab. Lane 3: M2 has low to moderate binding to non-ADP- ribosylated PARPs as examined by Ab. Lane 4: Ab has low binding to ADP-ribosylated PARPs in the absence of M2. Lane 5: M2 has no binding to NAD + in the assay system. Lane 6: M2 specifically binds to ADP-ribosylated PARPs from 2-hour reactions as measured by Ab. Values displayed were calculated as mean values of triplicates ± SD. 35 Figure 2.5 Percentages of the background fluorescence intensities (control reactions without NAD + ) relative to those of 2-hour PARP14-catalyzed ([E]=3, 6, and 9 µM) automodifications. 36 Figure 2.6 Frequency distribution of the maximal (2-hour reaction) and minimal (no reaction) fluorescence intensities for (A) PARP15 ([E]=500 nM), (B) PARP14 ([E]=3 µM), and (C) PARP14 ([E]=6 µM). The data were from five different plates performed on two different days. 37 Figure 2.7 Time-dependent PARP15-catalyzed mono ADP-ribosylations as measured by MLISA. (A-G) PARP15: 0.25 µM, 0.5 µM, 0.75 µM, 1 µM, 1.5 µM, 2 µM, and 2.5 µM. M2: 0.1 µM. Fluorescence intensities at various enzyme concentrations were measured at 0-, 5-, 10-, 15-, 20-, 30- 40-, 60-, 80-, 90-, 100-, and 120-minute time points. The values were calculated as mean values of triplicates ± SD. For each enzyme concentration, the apparent rate constant (k) was calculated in GraphPad Prism using one phase exponential association equation Y=Ymax*(1- exp(-k*X)). 38 Figure 2.8 Time-dependent PARP14-catalyzed mono ADP-ribosylations as measured by MLISA. (A-F) PARP14: 1.5 µM, 3 µM, 4.5 µM, 6 µM, 7.5 µM, and 9 µM. M2: 0.3 µM. Fluorescence intensities at various enzyme concentrations were measured at 0-, 30-, 60-, 90-, 120-, 150-, 180-, 210-, 240-, 270-, 300-, and 360-minute time points. The values were calculated as mean values of triplicates ± SD. For each enzyme concentration, the apparent rate constant (k) was calculated in GraphPad Prism using one phase exponential association equation Y=Ymax*(1- exp(-k*X)). 39 Figure 2.9 Concentration-dependent PARP-catalyzed mono ADP-ribosylations as measured by MLISA. At each enzyme concentration, the apparent rate constant (k) was calculated in GraphPad Prism using one phase exponential association equation Y=Ymax*(1-exp(-k*X)) on the basis of the measured fluorescence intensities by MLISA at different time points. The determined apparent rate constants were then plotted versus the concentrations of PARP enzymes. (A) PARP15: 0.25 µM, 0.5 µM, 0.75 µM, 1 µM, 1.5 µM, 2 µM, and 2.5 µM M2: 0.1 µM; (B) PARP14: 1.5 µM, 3 µM, 4.5 µM, 6 µM, 7.5 µM, and 9 µM. M2: 0.3 µM. The values were calculated as mean values of triplicates ± SD. 40 Figure 2.10 Enzyme kinetic parameters of PARP15-catalyzed automodification. Reaction rates measured by MLISA were plotted against varied NAD + concentrations used in the reactions. The values were calculated as mean values of triplicates ± SD. 41 Figure 2.11 Inhibition of PARP15 by individual compounds at varied concentrations. Normalized values were expressed as mean values of triplicates ± SD. (FI′: fluorescence intensity in the presence of inhibitors; FI0: fluorescence intensity in the absence of inhibitors). 42 Figure 2.12 Inhibition of PARP14 by individual compounds at varied concentrations. Normalized values were expressed as mean values of triplicates ± SD. (FI′: fluorescence intensity in the presence of inhibitors; FI0: fluorescence intensity in the absence of inhibitors). 43 Table 2.1 List of primer sequences used in molecular cloning. Name Application Sequence P1 PARP14 catalytic domain forward CACCATCATCATCATCATATTGAGG GTCGCGATATGAAGCAGCAGAATTT CTGTGTGG P2 PARP14 catalytic domain reverse AAGGGCATCGGTCGACTTATTATTTT CTAAACGTAATAAGGTACTCTGGGT ATGC P3 PARP 14 Macrodomain 2 forward TTTCTATTGCTACAAACGCATACGCT ATGCACCATCATCATCATCATATTG AGGG P4 PARP 14 Macrodomain 2 reverse CTCAAGGGCATCGGTCGACTTATTA ACTAACCAAATTGCCGTTTGCACG P5 pET28a reverse with Xba I site TCTAGAAATAATTTTGTTTAACTTTA AGAAGGAGATATACCATGCACCATC ATCATCATCATATTGAGGGTC P6 pET28a forward with Xho I site for PARP14 catalytic domain CTCGAGTTATTATTTTCTAAACGTAA TAAGGTACTCTGGG P7 pET28a forward with Xho I site for PARP14 Macrodomain 2 with a C-terminus HA tag GTGGTGCTCGAGTTATTAAGCGTAAT CTGGAACATCGTATGGGTAACTGAC GAGATTTCCATTAGCCCTTC P8 PARP15 catalytic domain forward CACCATCACCATCACATTGAAGGCC GTAATCTTCCTGAACACTGGACTGA CATG P9 PARP15 catalytic domain reverse CTCAAGGGCATCGGTCGACTTATTA AGCCGTGAAAGTTATGAGATATTCT GGG P10 pET28a reverse with Xba I site TCTAGAAATAATTTTGTTTAACTTTA AGAAGGAGATATACCATGGGCCATC ACCATCACCATCACATTG P11 pET28a forward with Xho I site for PARP15 catalytic domain GTGGTGGTGGTGGTGCTCGAGTTATT AAGCCGTGAAAGTTATGAGATATTC TGGG 44 Table 2.2 Statistical parameters of optimized MLISA for PARP15 and PARP14. PARP15 PARP14 S/B 3 19.9 ± 3.4 2.7 ± 0.7 S/N 4 12.4 ± 1.7 6.3 ± 0.2 Z’ 5 0.8 ± 0.1 0.6 ± 0.1 Day to day, CV 6 (max/min;%) 7.6 ± 1.0/37.1 ± 22.4 6.8 ± 0.7/18.8 ± 11.1 Well to well, CV (max/min;%) 8.5/35.7 8.7/31.0 Plate to plate, CV (max/min;%) 5.5 ± 0.9/11.4 ± 4.5 6.9 ± 1.1/2.8 ± 1.1 3 S/B: Signal to Background ratio 4 S/N: Signal to Noise ratio 5 Z’: Z factor 6 CV: Coefficient of variation 45 Table 2.3 Evaluation of % coefficient of variation of maximal and minimal signals using standard deviation criteria. PARP15 PARP14 SDmax/SDmin, day to day 3673/840 1699/1615 SDmax/SDmin, well to well 4031/902 2183/2940 SDmax/SDmin, plate to plate 2631/289 1730/270 46 Table 2.4 List of compounds used for inhibition studies. Number Name Structure 1 Olaparib 2 XAV939 3 1,5-Isoquinolinediol 4 Minocin 5 DR2313 6 6(5H)-Phenanthridinone 7 Nicotinamide 8 Adenine 47 Table 2.5 Inhibitory potency of eight compounds for PARP15. Compound PARP15 IC 50 (µM) CI 7 (µM) pIC 50 Olaparib 4.6 ± 0.9 3.7 to 5.5 5.3 XA V939 >15 µM N.D. 8 N.D. 1,5-Isoquinolinediol 8.5 ± 2.7 5.8 to 11.2 5.1 Minocin >15 µM N.D. N.D. DR2313 8.6 ± 0.6 8.0 to 89.2 5.1 6(5H)-Phenanthridinone 1.5 ± 0.5 1.0 to 2.0 5.8 Nicotinamide >15 µM N.D. N.D. Adenine >15 µM N.D. N.D. 7 CI: 95% Confidence intervals. 8 N.D.: Not determined 48 3 Developing Bioorthogonal Pairs of NAD + Analogue and PARP1 Mutant for Direct Substrate Identification 3.1 Introduction As the founding member of the PARP family, PARP1 functions to regulate a variety of cellular functions, including DNA damage, apoptosis and unfolded protein response (Vyas et al., 2013). Due to the importance of PARylation in cell physiology, PARP1 has been found to play a key role in many signaling pathways mediating chromatin structure during transcription (Kim et al., 2004). Some of PARP1's cellular substrates have been identified and well-studied, such as histone H1 and H2B and various transcription factors (Ko and Ren, 2012). A recent study in proteomics using high-accuracy quantitative mass spectrometry has identified the vast majority of cellular proteins that are substrates of poly PARPs in various stress signaling pathways (Jungmichel et al., 2013). However, due to the homology shared in between poly PARPs, it is difficult to distinguish and characterize PARP1-specific substrates. For example, PARP1 and PARP2 share structural and functional overlaps as PARP2 is able to substitute for PARP1 activity in case of deficiencies (Boehler et al., 2011; Morales et al., 2014). It is no surprise that the two poly PARPs share certain common protein substrates in DNA repair pathways (Carter- O'Connell et al., 2014; Gibson et al., 2016). Previous efforts to identify PARP1 targets both in vitro and in vivo include co-purification, co-immunoprecipitation, crosslinking and adopting yeast as an artificial model system for two-hybrid screening and proteome microarray screening (Tao et al., 2009b; Vivelo and Leung, 2015). However, those methods are not sufficient enough to isolate the direct substrates of PARP1 (Carter-O'Connell et al., 2014). A novel and emerging method involves the use of clickable NAD + analogues as PARP enzyme co-substrates for 49 PARP1 specific substrate profiling (Jiang et al., 2010). Modifications have been done to these analogues to substitute a terminal alkyne group on the adenine moiety of NAD + , which will allow for conjugation of a functional tag through copper(I)-catalyzed azide alkyne cycloaddition (CuAAC) (Pickens et al., 2018). To date, most of the modifications are focused on the adenine moiety of NAD + . A recent study reported an adenine-based analogue-sensitive approach through pairing specific NAD + analogues with their corresponding PARP1 and PARP2 with targeted mutations (Gibson et al., 2016). Although these NAD + analogues provide a sensitive method for target identification and distinguishing in between the poly PARP substrates, the analogues are unable to permeate through the cell membranes thus cannot be used for the imaging and labeling of PARP1 substrates in live cells. Therefore, we aimed to generate bioorthogonal pairs of PARP1/NAD + , which are featured by a novel class of NAD + analogues with modified ribose moieties. This effort led to the discovery of two new NAD + analogue with PARP1 substrate activity comparable to or slightly less than that of NAD + . The new NAD + analogues may provide new chemical tools for studying PARylation in living cells. 50 3.2 Experimental Methods 3.2.1 Materials and Reagents NAD + and a panel of 7 NAD + analogues synthesized by Dr Xiao-Nan Zhang were used for substrate activity evaluation. 3.2.2 Molecular Cloning and Protein Expression and Purification Full-length human PARP1 with a C-terminus His6 tag was amplified through PCR using primers P1 and P2 (Table 3.1). The amplified DNA fragment was digested by XhoI and XbaI restriction enzymes and then ligated into pET-28a (+) using T4 DNA ligase. Site-directed mutagenesis for PARP1 mutants M890A, F891A, Y889A, Y896A, K903A, E988D, Y907W, and H937G using primers P3-P20 (Integrated DNA Technologies, Coralville, IA) in Table 3.1. The DNA templates were digested by DpnI restriction enzyme. All generated expression vectors were confirmed by DNA sequencing provided by Genewiz LLC (South Plainfield, NJ). The bacterial expression and purification of both full-length PARP1 and mutants were carried out by following a previously published protocol with slight modifications (Langelier et al., 2011). BL21 (DE3) cells were transformed with the generated PARP1 and mutant constructs for bacterial protein expression in LB Broth supplemented with kanamycin (50 µg mL -1 ). The overnight bacterial culture (60 mL) was diluted into six 1 liter LB Broth with kanamycin (50 µg mL -1 ) for growth at 37 ̊C in an incubator shaker at a speed of 250 rpm (Series 25, New Brunswick Scientific, NJ). When OD600 nm reached 0.6–0.8, 100 mM ZnSO4 stock was added to each liter of culture to reach a final concentration of 0.1 mM. When OD reached 0.8-1.0, cultures were removed from incubator and chilled in 4 o C for 1 hour. Protein expression was then induced with 0.5 mM isopropyl ß-D-1-thiogalactopyranoside (IPTG) for overnight at 16 ̊C. Cells were 51 harvested by centrifugation at 4,550 g (Beckman J6B Centrifuge, JS-4.2 rotor), resuspended in equilibrium buffer (25 mM HEPES pH 8.0, 500 mM NaCl, 1 mM PMSF), and lysed using a French Press (GlenMills, NJ) at 25,000 psi for three cycles. Cell debris was removed by centrifugation at 27,000 g for 100 minutes (Beckman Coulter centrifuge, JA-17 rotor) and supernatants were filtered through 0.45 µm membranes. The filtrate was loaded on a gravity flow column packed with 5 mL Ni-NTA agarose resin (Thermo Fisher Scientific, Waltham, MA), followed by washing with 50 mL of low-salt wash buffer (25 mM HEPES pH 8.0, 500 mM NaCl, 20 mM imidazole), 50 mL of high-salt wash buffer (25 mM HEPES pH 8.0, 1 M NaCl, 20 mM imidazole) and 50 mL of low-salt wash buffer. Proteins were then eluted with 25 mL elution buffer (25 mM HEPES pH 8.0, 500 mM NaCl, 400 mM imidazole). 25 mL no-salt buffer (50 mM Tris pH 7.0, 1 mM EDTA, 0.1 mM DTT) was then added to the eluted proteins and the proteins were loaded onto a 5-mL HiTrap Heparin HP Column by a low-pressure peristaltic pump at a flow rate of at 3 mL min -1 (GE Healthcare, Princeton, NJ). Heparin column was placed on an ÄKTA Pure chromatography system to elute PARP1 using a gradient of 0-100% buffer B (50 mM Tris pH 7.0, 1 mM EDTA, 0.1 mM DTT, 1 M NaCl) in buffer A (50 mM Tris pH 7.0, 1 mM EDTA, 0.1 mM DTT, and 250 mM NaCl) at a flow rate of 1 mL min -1 . PARP1 was eluted starting at 40% buffer B and the collected fractions were combined and spun down to 500 µL using Amicon centrifugal filters with 30 kDa cutoff (EMD Millipore, Temecula, CA). The concentrated proteins were injected on to a size-exclusion chromatography column Superdex 200 Increase 10/300 GL (GE Healthcare, Princeton, NJ) and eluted using gel filtration buffer (25 mM HEPES, pH 8.0, 150 mM NaCl, 1 mM EDTA, 0.1 mM DTT). Purified PARP1 was examined by SDS-PAGE and a NanoDrop 2000C spectrophotometer (Thermo Fisher Scientific, Waltham, MA), then aliquoted and flash-frozen in 52 liquid nitrogen for storage at -80°C. Calculated molecular extinction coefficient value for human PARP1 with a C-terminus His6 tag is 1.052. 3.2.3 Construction of a Model of PARP1 in Complexed with NAD + The alignment of NAD + into PARP1 catalytic domain’s active site was constructed based on a previously published model (Gibson et al., 2016). Three co-crystal structures of Diphtheria toxin with NAD + (PDB:1TOX), Tankyrase 2 with EB-47 (PDB:4BJ9), and PARP1 with 3- methoxybenzamide (PDB:3PAX) were obtained from the RCSB Protein Data Bank. The catalytic domains of the three enzymes were superpositioned together using the matchmaker function of UCSF Chimera program (Pettersen et al., 2004). To model NAD + at the active site of PARP1 catalytic domain, the nicotinamide-ribose portion of NAD + from 1TOX and the nicotinamide-based inhibitor 3-MB were first aligned together, then the adenine-ribose portion of NAD + was aligned to the adenine-ribose group from the NAD + -like inhibitor EB47. 3.2.4 Automodification and Immunoblotting Activity Analysis The procedure of automodification reaction of PARP1 was also adopted from the previous study (Gibson et al., 2016). Auto-PARylation of purified PARP1 was performed at 30 ̊ C for 2 hours in 50 µL assay solutions containing 30 mM HEPES, pH 8.0, 5 mM MgCl2, 5 mM CaCl2, 1 mM DTT, 100 ng µL -1 activated DNA, 250 µM NAD + or NAD + analogues, and 5 μM purified PARP1 or PARP1 mutant enzyme. 20 μL of the reaction was taken out and saved for SDS- PAGE analysis. The remaining reaction mixtures were further labeled with azide-biotin (for 1-4) or phosphine-PEG3-Biotin (for 5-7) through copper(I)-catalyzed azide alkyne cycloaddition (CuAAC) and Staudinger reaction. The CuAAC reactions were performed for one hour at room temperature in 40 L volume, which contain 30 L PARP1 automodification mixtures, 2 mM 53 THPTA, 1 mM CuSO4, 100 μM azide-biotin, and 10 mM sodium ascorbate in PBS. The Staudinger reactions were performed for two hours at 30 ̊ C in 35 L volume, which contain 30 L PARP1 automodification mixtures and 35 M of phosphine-PEG3-biotin. The levels of auto- PARylation were evaluated by immunoblots using a streptavidin-HRP conjugate for detection of the biotinylated PARP1 via click chemistry and Staudinger reaction. 3.2.5 High-performance Liquid Chromatography (HPLC)-based Kinetic Assays Auto-PARylation of PARP1 was carried out in 80 µL assay solutions (30 mM HEPES, pH 8.0, 5 mM MgCl2, 5 mM CaCl2, 1 mM DTT, 100 ng µL -1 of activated DNA, 100 ng µL -1 BSA) containing varied concentrations of NAD + (50, 100, 250, 450, 600, and 750 µM) or NAD + analogues (2, 6) at 30 o C with purified PARP1 enzymes. The reactions were quenched at different time points (NAD + : 0, 2.5, 5, 10, 15, and 20 minutes; 2: 0, 60, 120, 180, 240, and 300 minutes; 6: 0, 5, 10, 15, 20 and 30 minutes) using 20% ice-cold TCA. After centrifugation, the reaction mixtures were analyzed by reverse phase HPLC using a semipreparative C18 Kinetex column (5 µm, 100 Å, 150×10.0 mm, from Phenomenex Inc, Torrance, CA) (mobile phase A: 0.1% formic acid (aq); mobile phase B: 0.1% formic acid in acetonitrile; flow rate = 2.0 mL min -1 ; 0-8 minutes: 0% B, 8-12 minutes: 0-50% B, 12-13 minutes: 50-2.5% B, 13-18 minutes: 2.5-40% B, 18-20 minutes: 40-0% B) with detection of UV absorbance at 260 nm. The retention times for NAD + , 2, 6 were 13.0, 13.6, and 13.6 minutes, while for ADPr, ADPr2, ADPr6, the retention times were 6.3, 12.9, and 9.0 minutes. Standard curves for NAD + and NAD + analogues together with ADPr and ADPr analogues were constructed by linear correlations of concentrations and corresponding integrated peak areas. NADase reaction rates were determined based on the increase in peak areas of the assigned peaks of ADPr and ADPr analogues, while reaction rates 54 for PARP activities were measured based on the decrease in peak areas of the assigned peaks of NAD + and NAD + analogues excluding NADase activity. Kinetic parameters were determined by fitting data to the Michaelis-Menten model implemented in GraphPad Prism (La Jolla, CA). 3.3 Results 3.3.1 Overall Design of Bioorthogonal PARP1 Mutant/NAD + Analogue Pairs Inspired by the previous published design of bioorthogonal NAD + analogues with modification on adenine ring and PARP1 mutants by Gibson and colleagues (Gibson et al., 2016), we sought to develop PARP1 mutants to recognize novel NAD + analogues from a panel of NAD + analogues synthesized in our laboratory where OH groups at the 2′ and 3′ positions on the ribose ring in the nicotinamide riboside (NR) moiety were modified (Figure 3.1). The identified mutants and the modified NAD + analogues were expected to be orthogonal, while wild type PARP1 would not be able to utilize the orthogonal analogues for PARylation. In order to construct a library of PARP1 mutants specifically designed for the NAD + analogues, we adopted a previously reported model of NAD + bound to the active site of wild type PARP1, since no crystal structure of PARP1 in complex with NAD + is available (Gibson et al., 2016). The cocrystal structures of PARP1 with a nicotinamide-like inhibitor was first superpositioned to the crystal structure of diphtheria toxin 1 in complex with NAD + , and then aligned with Tankyrase 2 in complex with a NAD + -like inhibitor based on structural similarities of both the molecules and catalytic domains. Several PARP1 active site residues in approximation with the 2′- and 3′-OH groups of NR moiety were identified both within a flexible loop region (Figure 3.2), including M890, F891, Y889, Y896, K903, E988, Y907 and H937. The model was then aligned to currently available PARP1 crystal structures for confirmation of the residue positions. 55 3.3.2 Immunoblot-based Screening of NAD + Analogues and PARP1 Enzymes Human wild type PARP1 was recombinantly produced and eight selected residues were mutated to generate the desired PARP1 mutants: M890A, F891A, Y889A, Y896A, K903A, E988D, Y907W and H937G. Most of the amino acid residues were mutated to an alanine or a glycine for accommodation of the modified ribose moiety, while Y907W was mutated to tryptophan aiming to maximize interactions in between the modified ribose group and the amino acid side chains. All PARPs were expressed in E. coli and purified according to a previously established protocol with final yields of 1-1.5 mg per six liters (Langelier et al., 2011). SDS-PAGE analysis of wild type PARP1 with three additional mutants showed wild type PARP1 (114 kDa) as three bands at the 100 kDa molecular marker (Figure 3.3). PARP1 is known for its ability to undergo rapid automodification in the presence of NAD + and DNA fragments (Beck et al., 2014; Fouquerel and Sobol, 2014; Gibson et al., 2016; Jiang et al., 2010). A panel of NAD + analogues with terminal alkyne or azide modifications was first screened with wild type PARP1 to test for PARylation activity through click-chemistry based immunoblots (Figure 3.4A). Wild type PARP1 reactions with NAD + were used as negative controls since ADPr without clickable moieties would be inactive for conjugation with clickable biotin thus would not be recognizable by the streptavidin antibody. It was shown that out of the initial compounds tested, PARP1 can use both NAD2 and NAD6 as co-substrates, resulting in strong signals as evidence for automodification. We next proceeded to examine whether this activity was truly originated from PARP1 catalysis and not due to NAD + analogue hydrolysis by incorporating two commercially available PARP1 inhibitors, olaparib and veliparib. The catalytic activity of PARP1 can be potently suppressed by the inhibitors and the automodification signal was significantly reduced comparing with the no-inhibitor controls, 56 confirming that NAD2 and NAD6 can actively be recognized by wild type PARP1 for use as a co-substrate (Figure 3.4B). Without the clickable moieties on NAD + molecules, no automodification signals were observed for NAD + -modified PARP1 on this biotinylation-based immunoblot. The compound library of NAD + analogues was then screened with both the wild type PARP1 and the mutants using the established biotinylation-based immunoblot method. However, none of the NAD + analogue was specifically active for any of the mutants. While conducting the mutant screening with NAD1 and NAD7, there were no apparent difference in the reactivity of NAD1 and NAD7 with either wild type PARP1 or mutants. The analogues have low reactivity with wild type PARP1 are found to have low activities with the mutants as well (Figure 3.5). For the active analogue NAD6, certain mutants demonstrated a higher reactivity comparing to the wild type PARP1, such as M890A, F891A and Y889A. However, NAD6 was not specific to a particular mutant nor was it specific for the wild type enzyme itself. 3.3.3 Kinetics Parameters After we confirmed that NAD2 and 6 can be efficiently used by PARP1 for automodification as co-substrates, we seek to characterize enzyme kinetics of wild type PARP1 with NAD2 and 6 in comparison with NAD + . We developed an HPLC-based method modified from previously published work to measure the catalysis activity as well as the NAD + hydrolysis activity that PARP1 processes (Jiang et al., 2010). PARP1-catalyzed automodifications were performed with NAD + , NAD2, and NAD6 at various concentrations. The enzymatic reactions were quenched with ice-cold TCA with a final concentration of 20% at various time points. Standard curves were created using a range of set concentrations of NAD + , NAD2 and NAD6 for determination 57 of NAD + and analogue concentrations in the quenched reactions. Likewise, standard curves for ADPr, ADPr 2 and ADPr 6 were constructed and used for ADPr and analogues concentration determination. By fitting the kinetics data to Michaelis-Menten equation, the kcat and Km of PARP1 with NAD + , NAD2 and NAD6 were calculated (Table 3.2). The calculated Km for NAD + with PARP1 is 145.4 ± 36.0 µM, consistent with the previously reported value of 97 ± 7 µM. The kcat of NAD6 is 4.1 ± 0.6 min -1 , slightly lower than that of NAD + (4.7 ± 0.4 min -1 ). The Km (370.5 ± 104.8 µM) of NAD6 is higher than that (145.4 ± 36 µM) of NAD + . In comparison, the kcat of NAD2 for PARP activity is significantly lower than those of NAD + and NAD6. Same as NAD + , NAD2 and NAD6 could undergo slow hydrolysis catalyzed by PARP1. Similar to their PARP activities, the NADase activity for NAD6 is comparable to that of NAD + . These results are consistent with immunoblot analyses and support 3′-azido and 3′-alkyne NAD + analogues as good substrates for PARP1-catalyzed ADP-ribosylation. 3.4 Discussion A PARP1 mutant library has been constructed for use in screening with a compound library of NAD + analogues, aiming to find bioorthogonal PARP1/NAD + pairs to label cellular targets of PARP1. However, both reactivity and specificity remained issues in the screening process. None of the mutants displayed activity better than wild type PARP1 for most of the analogues except for NAD6. Although some mutants were able to rapidly use NAD6 for automodification, the analogue has very high reactivity with wild type PARP1 as well. It is likely that the model we adopt to incorporate NAD + into PARP1’s active site was not accurate for amino acid residue identification around the ribose moiety on the NR ring of NAD + . Point mutations may not allow the binding pocket to fully accommodate the functional group modifications on NAD + analogues. Due to the lack of available cocrystallization structure of NAD + and PARP1 catalytic 58 domain, further optimization on the current model is required, such as adjusting the modeling parameters and incorporating additional docking analysis to find the low-energy state enzyme- substrate conformations through software simulations. We defined the kinetics parameters of two analogues NAD2 and NAD6 with wild type PARP1, in comparison to that of NAD + . NAD6 can be used as the co-substrate for PARP1 in PARylation as efficiently as NAD + . Meanwhile, the propargyl group modification done on the 3′-OH position of the NR ring (NAD2) seem to result in slower catalytic activity, whereas the 3′-azido group modification has very minor effect on automodification. The two NAD + analogues provide new chemical tools for the analysis of PARylation. The same bioorthogonal model can be applicable for use to study other components and pathways related to PARylation. For example, the same type of modifications can be done on cell-permeable NR molecules as well as NMN molecules for pairing with NRK and NMNAT mutants for cellular synthesis of NAD + analogues for use by PARP1, as a tool to image and label cellular protein PARylation in living cells. 59 Figure 3.1 Chemical structures of NAD + analogues 1-7. 60 Figure 3.2 Model of PARP1 (green) in complex with NAD + and selected residues of PARP1 for mutagenesis in NAD + -binding pocket. Selected residues are labeled in three-letter codes. (PDB: 3PAX). Model was constructed in UCSF Chimera software (Pettersen et al., 2004). 61 Figure 3.3 SDS-PAGE gel of wild type PARP1 and mutant enzymes stained with Coomassie blue. Proteins loaded were normalized to 4 µg per well. Lanes 1-5: protein ladder, wild type PARP1, M890A, F891A, Y889A. 62 Figure 3.4 Substrate activities of NAD + analogues with wild type PARP1 on click chemistry based automodification activity immunoblotting. A) Lane 1-8: Protein ladder, NAD1, NAD3, NAD2, NAD4, NAD + (alkyne control), NAD6, NAD + (azide control). B) Lane 1-7: Protein ladder, NAD2, NAD2 with inhibitor olaparib, NAD2 with inhibitor veliparib, NAD6, NAD6 with olaparib, NAD6 with veliparib. 63 Figure 3.5 Substrate activities of selected NAD + analogues with selected PARP1 mutants based automodification activity through immunoblotting. A) Lane 1-14: Protein ladder, wtPARP1- NAD1, wtPARP1-NAD + , wtPARP1-NAD2, M890A-NAD1, F891A-NAD1, Y889A-NAD1, Y896A-NAD1, K903A-NAD1, wtPARP1-NAD7, wtPARP1-NAD + , wtPARP1-NAD6, K903A- NAD7, and K903A-NAD6. B) Lane 1-11: Protein ladder, wtPARP1-NAD6, wtPARP1-NAD7, M890A-NAD6, F891A-NAD6, Y889A-NAD6, Y896A-NAD6, M890A-NAD7, F891A-NAD7, Y889A-NAD7, and Y896A-NAD7. 64 Table 3.1 List of primer sequences used in molecular cloning. Name Application Sequence P1 Wild type PARP1 forward TGGTGCTCGAGCCACAGGGAGGTCT TAAAATTGAATTTCAGT P2 Wild type PARP1 reverse CCCTCTAGAAATAATTTTGTTTAACT TTAAGAAGGAGATATACCATGGCGG AGTCTTCGGATAAGC P3 M890A Mutagenic primer 1 GTCAGCGAAATAGATCCCTTTACCA AAGGCGTAGCCTGTCACGGG P4 M890A Mutagenic primer 2 CCCGTGACAGGCTACGCCTTTGGTA AAGGGATCTATTTCGCTGAC P5 F891A Mutagenic primer 1 CGCCCGTGACAGGCTACATGGCCGG TAAAGGGATCTATTTCGC P6 F891A Mutagenic primer 2 GCGAAATAGATCCCTTTACCGGCCA TGTAGCCTGTCACGGGCG P7 Y889A Mutagenic primer 1 CGAAATAGATCCCTTTACCAAACAT GGCGCCTGTCACGGGC P8 Y889A Mutagenic primer 2 GCCCGTGACAGGCGCCATGTTTGGT AAAGGGATCTATTTCG P9 Y896A Mutagenic primer 1 CTACATGTTTGGTAAAGGGATCGCC TTCGCTGACATGGTCTCCAAGA P10 Y896A Mutagenic primer 2 TCTTGGAGACCATGTCAGCGAAGGC GATCCCTTTACCAAACATGTAG P11 K903A Mutagenic primer 1 TGACATGGTCTCCGCCAGTGCCAAC TACTGCCATACGTCTC P12 K903A Mutagenic primer 2 GAGACGTATGGCAGTAGTTGGCACT GGCGGAGACCATGTCA P13 E988D Mutagenic primer 1 GACACCTCTCTACTATATAACGACT ACATTGTCTATGATATTGCT P14 E988D Mutagenic primer 2 AGCAATATCATAGACAATGTAGTCG TTATATAGTAGAGAGGTGTC 65 P15 Y907W Mutagenic primer 1 CTCCAAGAGTGCCAACTGGTGCCAT ACGTCTCAGG P16 Y907W Mutagenic primer 2 CCTGAGACGTATGGCACCAGTTGGC ACTCTTGGAG P17 H937G Mutagenic primer 1 GAACTGAAGCACGCTTCAGGCATCA GCAAGTTACCCAAGGGCA P18 H937G Mutagenic primer 2 TGCCCTTGGGTAACTTGCTGATGCCT GAAGCGTGCTTCAGTTC 66 Table 3.2 Kinetic parameters of NAD + , 2, and 6 for purified human full-length PARP1. Substrate kcat (min -1 ) Km ( M) kcat/Km (min -1 M -1 ) PARP activity NAD + 4.7 ± 0.4 145.4 ± 36.0 3.2×10 4 2 0.06 ± 0.01 218.1 ± 81.7 2.8×10 2 6 4.1 ± 0.6 370.5 ± 104.8 1.1×10 4 NADase activity NAD + 0.39 ± 0.08 471.5 ± 187.4 8.3×10 2 2 0.02 ± 0.01 661.1 ± 489.0 0.3×10 2 6 0.46 ± 0.17 326.9 ± 278.8 1.4×10 3 67 4 Developing Antibody Drug Conjugates (ADCs) using Automodified PARP1 as a Novel Drug Carrier 4.1 Introduction In response to DNA damage, PARP1 is able to rapidly catalyze the transfer of ADPr units onto itself through a process called automodification, using NAD + as co-substrates (Altmeyer et al., 2009; Beck et al., 2014; Bouchard et al., 2003; Fouquerel and Sobol, 2014; Ko and Ren, 2012). More than 200 units of ADPr can be added onto each other forming either linear or branched polymer structures on just one amino acid acceptor site (Figure 4.1) (Krishnakumar and Kraus, 2010; Putt and Hergenrother, 2004). The unique characteristic of PARP1 inspired us to create novel methods using it as a drug carrier, especially in the case of developing novel ADCs, a class of fast-emerging and promising therapeutics. Cytotoxic agents are often covalently linked to tumor-specific monoclonal antibodies for targeted drug delivery (Lu et al., 2016; McCombs and Owen, 2015; Perez et al., 2014). Auristatin, calicheamicin and maytansine are three classes of cytotoxic drugs commonly used in ADCs (Jerjian et al., 2016). It is anticipated that the ADCs are able to efficiently release cytotoxic agents upon entering the targeted tumor cells to reduce the systemic exposure of the body to free drug molecules (Yao et al., 2016). The payload for current ADCs is often limited as they only carry up to 8-12 copies of cytotoxic agents (Beck, 2013). To rapidly reach therapeutically effective concentrations upon cellular delivery by the linked antibodies, it is required for high levels of expression of the tumor antigens, fast internalization rates for antibody carriers, and extremely high potency for the small-molecule chemotherapeutics (Diamantis and Banerji, 2016; Peters and Brown, 2015; Tsuchikama and An, 2018). Such requirements have made it challenging to develop ADCs with desired properties. Cases such that 68 patients develop resistance towards monoclonal antibody treatment due to various cell regulation mechanisms such as autophagy, receptor dimerization and gene mutation become undesirable hurdles impeding drug efficiency (Sahin et al., 2016). Innovative conjugation approach for attaching small molecule agents onto antibodies with increased drug-to-antibody ratio will enable generation of novel ADCs with significantly enhanced efficacy. The success in generation of such ADCs can lead to significant improvement in the therapeutic index of both the antibodies and the cytotoxic agents in use. As one of the most widely known and studied monoclonal antibodies, trastuzumab as well as its ADC trastuzumab-MCC-DM1 (T-DM1) are FDA approved treatments for HER2-positive metastatic breast cancer (Barok et al., 2014). Using trastuzumab and T-DM1 as a model, we hereby report the development of a novel ADC incorporating the auto-PARylation characteristics of PARP1 and click chemistry as conjugation method. Rapid automodification with NAD6 allows PARP1 to transfer multiple ADPr groups containing clickable azide onto itself. The azide groups on PARP1 can then serve as the linkage spots that are clickable for alkyne groups connected to both the targeting moiety trastuzumab fragment antigen binding (Fab) and the payload Monomethyl auristatin F (MMAF), an anti-tubulin cytotoxic agent inhibiting cell division. Our platform provides a new way of ADC assembly with potential therapeutic and diagnostic implications as the targeting groups and payloads can be tailored to target the specific receptors of particular types of cancers. 69 4.2 Experimental Methods 4.2.1 Materials and Cell Lines Trastuzumab Fab plasmid was a gift from Dr. Peter G. Schultz laboratory from The Scripps Research Institute. Large scale preparations of NAD6, MMAF-alkyne, MMAF-DBCO were synthesized and purified by Dr. Xiao-Nan Zhang. Breast cancer cell lines (HCC1954, MDA- MB-468, SK-BR-3 and MDA-MB-231) were obtained from the American Type Culture Collection (ATCC) (Manassas, VA) and maintained in RPMI 1640 medium supplemented with 10% FBS at 37 ̊C in 5% CO2. The cell lines were cultured by Xiaojing Shi. 4.2.2 Molecular Cloning and Protein Expression and Purification. Molecular cloning and protein expression of PARP1 were performed as described in the previous chapter. DH10B cells were transformed with the trastuzumab Fab plasmid for bacterial protein expression in LB Broth supplemented with ampicillin (100 µg mL -1 ). The overnight bacterial culture (5 mL) was diluted into 1 liter LB Broth with ampicillin (100 µg mL -1 ) for growth at 37 ̊C in an incubator shaker at speed of 250 rpm (Series 25, New Brunswick Scientific, NJ). When OD600nm reached 0.6-0.8, protein expression was induced with 20% arabinose for overnight at 22 ̊C. Cells were then harvested by centrifugation at 4,550 g (Beckman J6B Centrifuge, JS-4.2 rotor), resuspended in lysis buffer (25 mM Tris-HCl, pH 8.0, 1 mM EDTA, 1 mM PMSF, 20 mg mL -1 lysozyme and 20% (w/v) sucrose) for periplasmic extraction. Cells were stirred for 20 minutes and vigorously shaken for another 20 minutes. Cell debris was removed by centrifugation at 27,000 g for 1 hour (Beckman Coulter centrifuge, JA-17 rotor) and supernatant was filtered 70 through a 0.45 µm membrane. The filtrate was loaded on a gravity flow column packed with 1 mL Protein G resin (GenScript, China), followed by washing with 30 column volumes of PBS. Proteins were then eluted in 15 column volumes of elution buffer (100 mM Glycine-buffer HCl, pH 2.7), dialyzed in PBS buffer at 4 ̊C for overnight and another 6 hours in fresh PBS buffer, and concentrated using an Amicon centrifugal concentrator (EMD Millipore, Temecula, CA) with a 10 kDa cutoff. Purified proteins were examined by SDS-PAGE and NanoDrop 2000C spectrophotometer (Thermo Fisher Scientific, Waltham, MA), and aliquoted and flash-frozen in liquid nitrogen for storage at -80 ̊C. Calculated molecular extinction coefficient values 1.39 for trastuzumab Fab. 4.2.3 Conjugations and Purifications of ADCs 4.2.3.1 Design of Conjugates and Control Conjugates Three trastuzumab Fab-PARP1-NAD6-conjugates with different payloads were designed and prepared: Fab-PARP1-NAD6-DBCO-MMAF, Fab-PARP1-NAD6-Alkyne-MMAF, and Fab- PARP1-NAD6-DBCO-Alexa 488. Three more trastuzumab Fab-PARP1-NAD6-DBCO-MMAF conjugates with various drug ratios were designed and prepared accordingly: 1:20, 1:50 and 1:100. The corresponding NAD6 concentrations was also adjusted for each individual conjugate. Four control conjugates were also designed and prepared: Fab-PARP1-NAD6, BSA-PARP1- NAD6, PARP1-NAD6-DBCO-MMAF, and BSA-PARP1-NAD6-DBCO-MMAF. 71 4.2.3.2 Trastuzumab Fab NHS-BCN Linker Conjugation Endo-BCN-PEG4-NHS ester was dissolved in 100% DMSO as 100 mM stock. A 20-fold molar excess of endo-BCN-PEG4-NHS ester linker was added into trastuzumab Fab in PBS. The solution was mixed gently and allowed to react at room temperature for two hours. The removal of unreacted linker was performed through buffer exchange using Amicon centrifugal concentrator (EMD Millipore, Temecula, CA) with a 10 kDa cutoff in PBS buffer, with a dilution factor over 1,000,000. The antibody-linker conjugate was then aliquoted and flash- frozen in liquid nitrogen for storage at -80 ̊C. 4.2.3.3 PARP1 Automodification Large scale auto-PARylation of purified PARP1 was performed at 30 ̊ C for 12 hours in 48 individual 150 µL assay solutions containing 30 mM HEPES, pH 8.0, 5 mM MgCl2, 5 mM CaCl2, 1 mM DTT, 100 ng µL -1 activated DNA, various concentrations of NAD6 (100 µM for 1:20, 250 µM for 1:50, 500 µM for 1:100), and 5 μM purified PARP1 enzyme. The removal of reaction buffer components and unreacted NAD6 was performed through buffer exchange using Amicon centrifugal concentrator (EMD Millipore, Temecula, CA) with a 30 kDa cutoff in PBS buffer. Purified automodified PARP1 was aliquoted and flash-frozen in liquid nitrogen for storage at -80 ̊C. 4.2.3.4 Conjugation and Purification of ADCs Trastuzumab Fab-BCN was added into 100 µL of automodified PARP1 solution with a 1.5-fold molar excess. The conjugation was allowed to happen at room temperature for 72 hours. Chemically modified MMAF with terminal alkyne or DBCO moieties was dissolved in 100% 72 DMSO to reach a stock concentration of 10 mM. DBCO-MMAF was then slowly added to antibody and PARP1 mixture according to the different molar ratio of 1:20, 1:50 and 1:100. Alkyne-MMAF was slowly added to the mixture together with CuAAC reaction buffer (2 mM THPTA, 1 mM CuSO4, 100 μM azide-biotin, and 10 mM sodium ascorbate). DBCO-Alexa 488 was dissolved in 100% DMSO to reach a stock concentration of 5 mM and was slowly added to the reaction mixture using a molar ratio of 1:20. The solution was gently mixed and allowed to react at room temperature for an additional 72 hours. The precipitates were removed by passing the solutions through a 0.22 µm filter and the conjugates were injected on to a size-exclusion chromatography column Superdex 200 Increase 10/300 GL (GE Healthcare, Princeton, NJ) and eluted using PBS. Purified conjugates were examined by SDS-PAGE and the protein concentration determined using Coomassie Plus (Bradford) assay reagents, then aliquoted and flash-frozen in liquid nitrogen for storage at -80°C. 4.2.4 Nanoparticle Tracking Analysis (NTA) Nanoparticle tracking analysis was conducted to measure the particle concentration and size distribution of the purified Fab-PARP1-NAD6-DBCO-MMAF conjugates using Nanosight LM10 (Malvern Instruments, U.K.) according to the manufacturer’s instruction (Cheng et al., 2018). 4.2.5 Flow Cytometry Binding Analysis Flow cytometry analysis was performed to evaluate the binding of Fab-PARP1-NAD6-DBCO- 488 conjugates to HER2 positive cell line HCC1954 and HER2 negative cell line MDA-MB- 468. Cells were incubated with 0.1 µg µL -1 conjugates in PBS with 2% FBS for 30 minutes at 73 4°C and washed three times with PBS containing 2% FBS. Samples were analyzed using an LSR II Flow Cytometer (BD Biosciences, San Jose, CA). Data were processed by FlowJoV10 software (Tree Star Inc., Ashland, OR). The experiment was conducted by Xiaojing Shi. 4.2.6 Confocal Imaging of Cellular Uptake of Conjugates HCC1954 and MDA-MB-468 cells (3×10 4 ) were seeded into clear bottoms of 24-well plates one day prior to the experiment. 16 µg mL -1 of Fab-PARP1-NAD6-DBCO-488 conjugates were diluted with medium and then mixed with the cells for incubation at 37 ̊C for three hours. The cells were gently washed three times then fixed using 4% PFA under room temperature for 20 minutes. The cells were then washed three times with PBS and stained with DAPI under room temperature for 20 minutes. After three more PBS washes, cells were mounted on slides and imaged with a Leica SP8 confocal laser scanning microscope (Leica Microsystems Inc., Buffalo Grove, IL) equipped with a 40×, 1.3 NA PLAPO oil immersion objective lens using Alexa 488 filters. Images were processed using LAS X software (Leica Microsystems Inc., Buffalo Grove, IL). The experiment was conducted by Xiaojing Shi. 4.2.7 In vitro Cytotoxicity Assay HCC1954, MDA-MB-231, SK-BR-3 and MDA-MB-468 cells were seeded in 96-well plates the day prior to the experiment (5000 cells per well for HCC1954, MDA-MB-231, SK-BR-3 and 6000 cells per well for MDA-MB-468). The cells were incubated with various concentrations of conjugates for 96 hours. 10 µL of 3-(4,5- dimethylthiazol-2-yl)-2,5- diphenyltetrazolium bromide (MTT) solution was then added in the wells and incubated for 2 hours at 37 ̊C. Subsequently, 100 μL of lysis buffer (20% SDS in 50% dimethylformamide, pH 74 4.7) was added to the mixture, plates were incubated for 4 hours at 37 ̊C and measured for absorbance at 570 nm using a BioTek Synergy H1 Hybrid Multi-Mode Microplate reader (BioTek, Winooski, VT). Cell viability was calculated as the percentage of cell viability=[(absorbanceexperimental – absorbancespontaneous average)/(absorbancemaximal viability average– absorbancespontaneous average)]  100. The experiment was conducted, and data was analyzed by Xiaojing Shi. 4.3 Results 4.3.1 Overall Design of ADCs The general scheme of conjugation uses click chemistry as the main method for connecting both the targeting groups and payloads, whether it is an antibody, a dye or a cytotoxic agent (Figure 4.2). We have previously reported that PARP1 is able to actively attach clickable poly ADPr chains to itself, using NAD6 as co-substrate for automodification. The clickable azide groups from NAD6 can now be used for conjugation through simple click chemistry to form stable triazole linkages. Inspired by trastuzumab and T-DM1 as the ADC model, we chose the fragment antigen binding of trastuzumab as the targeting group for HER2 receptors with high binding affinity (Bostrom et al., 2011). Commercial endo-BCN-PEG4-NHS ester linkers can be used to conjugate the BCN moieties rapidly on to the primary amines of trastuzumab Fab. BCN groups are able to react with azide groups on automodified PARP1 through copper free click chemistry, bridging the targeting group Fab together with automodified PARP1 (Leunissen et al., 2014). Meanwhile, MMAF was chosen as the choice of cytotoxic agent as it is commonly used in ADC conjugation for inhibiting tubulin polymerization to disrupt cell division (Tsuchikama and An, 2018). MMAF was further chemically modified with either a dibenzocyclooctyne (DBCO) 75 group, another cyclooctyne moiety able to react with azide through copper free chemistry, or an alkyne group for copper(I)-catalyzed azide alkyne cycloaddition (CuAAC) (Pickens et al., 2018). The modified MMAF can then be readily conjugated onto the automodified PARP1, completing the assembly of the ADC. 4.3.2 Chemical Conjugation and Purification of Various ADC Constructs Fab was recombinantly produced in E. coli with high yields and purity. SDS-PAGE analysis revealed that the generated Fab migrated as a single band around 50 kDa and that the addition of DTT as a reducing agent was able to fully reduce the disulfide linkage in between the heavy chain and light chain (Figure 4.3). Fab was reacted with endo-BCN-PEG4-NHS ester to generate Fab-BCN targeting moiety with clickable functional group. PARP1 and NAD6 were produced and prepared as described in the previous chapter. After automodification, PARP1-NAD6 (automodified PARP1 with poly azide ADPr chains) were further purified for conjugation after removal of unreacted NAD6. Upon addition of Fab-BCN and reaction for three days, clickable MMAF or Alexa-488 dye was added into the Fab-BCN and PARP1-NAD6 mixture for payload conjugation. Three conjugates carrying either dye or cytotoxic drugs were generated and purified: Fab-PARP1-NAD6-DBCO-MMAF, Fab-PARP1-NAD6-Alkyne-MMAF, and Fab- PARP-NAD6-DBCO-488. Fab-PARP1-NAD6-DBCO-MMAF was chosen as the main conjugate for future conjugation and further analysis as it has relatively higher yield than Fab- PARP1-NAD6-Alkyne-MMAF. Fab-PARP1-NAD6-Alkyne-MMAF experienced significant precipitation during the CuAAC reaction process. Fab-PARP-NAD6-DBCO-488 was purified for analysis of further binding and cellular uptake analysis. 76 SDS-PAGE analysis suggested that all three conjugates have molecular weight higher than the largest molecular marker of 190 kDa of the protein ladder (Figure 4.4). When exposed with Alexa-488 filter, only the Fab-PARP-NAD6-DBCO-488 showed fluorescence signals, verifying the identity of the conjugates. Size distribution analysis was conducted on Fab-PARP1-NAD6- DBCO-MMAF for more accurate determination of size and diameter of the conjugate (Figure 4.5). It appeared that the conjugates mainly exist as two heterogenous species peaking at 64 nm and 95 nm, with a mean diameter of 85.8 ± 3.7 nm. 4.3.3 Binding and Cellular Uptake of ADCs In order to examine whether the resulted ADCs can bind specifically to HER2 receptors, flow cytometry analysis was conducted using Fab-PARP-NAD6-DBCO-488 and PARP-NAD6- DBCO-488 control without the Fab targeting group (Figure 4.6). Comparing to no shift in the HER2 negative cell line, a distinct shift observed in the HER2 positive cells suggests that Fab targeting group on the ADC is able to specifically bind to the HER2 receptors, retaining its target binding affinity after the conjugation and purification process. However, binding HER2 receptors are not directly indicative of internalization of ADCs. Uptake assay aiming to visualize whether Fab-PARP-NAD6-DBCO-488 can be internalized into HER2 positive cells was then conducted (Figure 4.7). Confocal imaging revealed that green fluorescence signals from Fab- PARP-NAD6-DBCO-488 can be observed inside of HER2 positive cells but not in HER2 negative cells. The overall results from binding and uptake demonstrate that the ADC generated can specifically recognize the HER2 positive cells, followed by internalization. 77 4.3.4 In vitro Cytotoxicity of ADCs The potency of the generated ADCs was then evaluated through multiple cytotoxicity assays, in comparison with several control conjugates. Some control conjugates exhibited inhibitory effect in both the HER2 positive and HER2 negative cell lines (Figure 4.8). Noticeably, Fab-PARP1- NAD6 conjugates inhibited cell growth with an IC50 value of 1,125 ± 136 ng mL -1 , while no obvious inhibition curve was observed for the other control conjugates. Both MMAF ADCs displayed cytotoxicity activity towards HER2 positive cells, with respectfully similar IC50 values, 892.5 ± 68.6 ng mL -1 for Fab-PARP1-NAD6-DBCO-MMAF and 757.3 ± 28.7 ng mL -1 for Fab-PARP1-NAD6-Alkyne-MMAF (Figure 4.9). The cytotoxicity result for Fab-PARP1- NAD6-DBCO-MMAF conjugates with various drug ratios of 1: 20, 1:50 and 1:100 suggested that cytotoxic activity of the conjugate is dependent on the drug ratio used for automodification and conjugation. The IC50 values for 1:20, 1:50, 1:100 decreased as drug ratio increased: 2137 ± 602.5 ng mL -1 (1:20), 368.4 ± 68.4 ng mL -1 (1:50), 220.9 ± 13.7 ng mL -1 (1:100) (Figure 4.10). However, the cytotoxic activity of Fab-PARP1-NAD6-DBCO-MMAF does not seem to be dependent on the amount of HER2 receptors on cell surfaces, as seen in cell lines with varying HER2 expression levels (Figure 4.11). 4.4 Discussion and Future Experiments We initially proposed to use poly ADPr chains instead of automodified-PARP1 as the drug carrier of interest for ADC development. However, the solid-phase chemical synthesis of PAR oligomers is a multi-step process with much lower yield comparing to enzymatic biosynthesis by PARPs (Drenichev and Mikhailov, 2016). A method was published on the large-scale preparation of biosynthesized poly ADPr through chemical cleavage from automodified PARP1 78 (Tan et al., 2012). But the overall yields were low, and the purification and characterization were challenging. Therefore, to achieve our goal of using functionalized poly ADPr chains for the development of new types of ADCs, we proposed to adopt automodified PARP1 as the drug carrier in our ADC design for simple preparation and higher yields. We then developed a novel platform for ADC construction, where targeting group, carrier and payloads can be conjugated through simple click chemistry-based reactions. Three main conjugates were synthesized and purified, two with MMAF and one with a fluorescence dye. The two species observed in the size distribution analysis for Fab-PARP1-NAD6-DBCO-MMAF suggested that there could be either one or two Fab groups conjugated to automodified PARP1. During the conjugation and purification processes, formation of aggregates was observed. Aggregation is known to be a major factor limiting the development of ADCs as the exact mechanism inducing aggregate formation varies depending on the characteristics of the conjugates (Frka-Petesic et al., 2016). A previous study on ADC aggregate analysis revealed that ADCs are more likely to form aggregates comparing with their monoclonal antibody counterparts due to the fact that most of the conjugated cytotoxic agents are hydrophobic (Neupane et al., 2018). Hydrophobic interactions in between drug molecules may further induce aggregate formation, especially in the case of increased hydrophobic payloads. The cytotoxic agent MMAF happens to be very hydrophobic and may contribute to aggregate formation (Johansson et al., 2017). Changing the payloads to hydrophilic cytotoxic agents may be a potential solution limiting hydrophobic interactions to minimize aggregate formation. Our ADCs demonstrated both selectivity and cytotoxicity towards cell lines expressing HER2 receptors. But high background was detected outside of the HER2 negative cells, possibility due to the hydrophobic DBCO-Alexa-488 dye attracted to the also hydrophobic cell membrane. 79 Inhibition of cell growth was observed when HER2 negative cells were incubated with ADCs at high concentrations. The overall stability of the ADCs may be of question. It appeared that the ADCs may be unstable at high concentrations during the long incubation period. It is also likely that the drug carrier PARP1 may undergo cleavages by proteases in the tissue culture media and eventually degraded, releasing MMAF during the process. Free MMAF may diffuse through cell membranes, resulting in cellular cytotoxicity. Another possibility may be attributed to the potential existence of ADPr hydrolases on the cell surface. A recent study found that extracellular poly ADPr can be recognized by macrophages, serving as pro-inflammatory signals (Krukenberg et al., 2015). Extracellular poly ADPr thus may play an important role in cell to cell communication and signaling, leading to the activation of immune system. In addition, several mammalian ecto-ARTs on cell surfaces have been identified to be mono ARTs (Seman et al., 2004). ARTs responsible for synthesizing poly ADPr chains are even found on T-cell surfaces (Morrison et al., 2006). Considering the reversible nature of ADP-ribosylation, there could potentially be a hydrolysis mechanism for the removal of these ADPr units on cell membranes for the maintenance of cellular homeostasis. However, so far there has not been any proof suggesting the existence of such “ecto-hydrolases” and further research is required for providing more evidence on the subject. So far, the preliminary analysis on selectivity of the conjugates focused on the comparisons in between the positive and negative cell lines. Due to the difference in units, the selectivity of conjugates comparing to free MMAF has not been analyzed yet. Our next step will focus on conducting in-depth drug to antibody ratio characterization. We are currently analyzing the drug to antibody ratio by using a DBCO-MMAF disulfide bond surrogate (DBCO-SS-MMAF) as the payload for conjugation. The resulting ADCs will be purified through size exclusion 80 chromatography. Excess DTT will be added to the sample to fully reduce the disulfide bond of DBCO-SS-MMAF, releasing MMAF-SH molecules. MMAF-SH can then be quantified on the HPLC through a standard curve. We will then be able to accurately covert the ADC protein concentration to MMAF molar concentration to re-analyze in vitro cytotoxicity and selectivity in comparison with that of the free MMAF. Conjugate stability analysis and release mechanism studies are also underway for further characterization. Since the antibody of choice is trastuzumab, it is expected that Fab-PARP1-NAD6-DBCO-MMAF will be internalized into breast cancer cells with HER2 overexpression in a similar manner as T-DM1 ADC. The antibody trastuzumab on T-DM1 first binds to HER2 receptors (Barok et al., 2014; Lambert and Chari, 2014). Then the receptor-ADC complex can be internalized through receptor-mediated endocytosis in early endosomes. When endosomes mature to lysosomes, proteolytic degradation of trastuzumab occurs, releasing cytotoxic DM1 molecules in the cells to inhibit microtubule assembly. We presume that Fab-PARP1-NAD6-DBCO-MMAF can bind to the HER2 receptors followed by internalization through the same mechanism. After internalization, both the trastuzumab Fab and automodified PARP1 are subject to lysosomal degradation. Although automodified PARP1 is known to involved in cellular transcriptional events (Muthurajan et al., 2014), it is unlikely that the automodified enzyme can retain such biological activities upon lysosomal proteolysis. The payload MMAF linked to poly ADPr chains may be released by enzymes such as phosphodiesterases (PDE), releasing free cytotoxic MMAF molecules inside of the cancer cells. We have broadened and redefined the multi-facet role PARP1 plays in PARylation. Although PARP1 as an enzyme has been widely-studied, most of the research focuses on functional studies and seldom have people investigated the therapeutic applications of PARylation. PARP1 81 displays promising capabilities as a drug carrier with potentially much higher payload than traditional ADCs, as over 200 units of ADPr can be attached on one acceptor amino acid residue (Krishnakumar and Kraus, 2010). Cytotoxic agents with enhanced clinical safety profiles and better tolerable side effects can be used for conjugation to reach the same efficacy instead of the highly cytotoxic agents that can cause serious adverse events in patients. Comparing to biopersistent synthetic polymers, the naturally occurring biodegradable poly ADPr may offer potential safety advantages in risk mitigation of lysosomal storage diseases and optimization of pharmacokinetics (Duncan, 2011). The ADC’s targeting group Fab has high affinity with HER2 receptors, allowing the ADCs to specifically bind to cancer cells with HER2 overexpression (Bostrom et al., 2011). In addition to specificity and potency, our ADCs provide a model for simple assembly of components of ADC through click chemistry, where the targeting groups and payloads can be changed to accommodate future experimental needs for both cancer diagnosis and therapeutics. 82 Figure 4.1 PARP1 catalyzes PARylation with NAD + as a co-substrate. Reproduced and adapted from Putt and Hergenrother,2004 (Putt and Hergenrother, 2004) 83 Figure 4.2 Schematic representation of the proposed ADC assembly platform. 84 Figure 4.3 SDS-PAGE gel picture of trastuzumab Fab. Lane 1-2: trastuzumab Fab, trastuzumab Fab with DTT as a reducing agent to separate the heavy and light chains. 4 µg of samples were loaded. 85 Figure 4.4 SDS-PAGE gel of Fab-PARP1 conjugates with different payloads. Left panel Lane 1- 3: Fab-PARP1-NAD6-DBCO-MMAF, Fab-PARP1-NAD6-Alkyne-MMAF, Fab-PARP1- NAD6-DBCO488. 4 µg of samples were loaded. 86 Figure 4.5 Size distribution of Fab-PARP1-NAD6-DBCO-MMAF. 87 Figure 4.6 Flow cytometric analysis of the binding of Fab-PARP1-NAD6-DBCO-488 and PARP1-NAD6-DBCO-488 control to A) HCC1954 cell line B) MDA-MB-468. 88 Figure 4.7 Confocal microscopic analysis of Fab-PARP1-NAD6-DBCO-488 (green) uptake in HCC1954 and MDA-MB-468 cells. The nucleus is stained with DAPI (blue). Scale bars: 20 µM. 89 Figure 4.8 In vitro cytotoxicity of controls in HCC1954 and MDA-MB-468 cells. A) Fab- PARP1-NAD6 conjugates. B) BSA-PARP1-NAD6 conjugates. C) PARP1-NAD6-DBCO- MMAF conjugates. D) BSA-PARP1-NAD6-DBCO-MMAF. 90 Figure 4.9 In vitro cytotoxicity of MMAF ADCs in HCC1954 and MDA-MB-468 cells. A) Fab- PARP1-NAD6-DBCO-MMAF. B) Fab-PARP1-NAD6-Alkyne-MMAF. 91 Figure 4.10 In vitro cytotoxicity of Fab-PARP1-NAD6-DBCO-MMAF conjugates with various drug ratios in HCC1954 and MDA-MB-468 cells. A) 1:20. B) 1:50. C) 1:100. 92 Figure 4.11 In vitro cytotoxicity of Fab-PARP1-NAD6-DBCO-MMAF (1:100) in HCC1954, MDA-MB-231 and SK-BR-3 cells. 93 5 Conclusion 9 In summary, a set of novel methods and tools have been developed to characterize protein ADP- ribosylation and apply it for therapeutic development. We have developed MLISA for characterization of mono ART enzymes by using the recombinant macrodomain 2 protein as a detection agent of mono ADPr (Chen et al., 2018). The method was demonstrated to be applicable for both PARP15 and PARP14. MLISA provides a novel approach for qualification and quantification of protein MARylation and identification of mono ART inhibitors in a potentially high-throughput compatible fashion. Future studies include extending this assay to characterize other mono ARTs with distinct cellular locations and examining alternative macrodomains for enhanced specificity. For the identification of the direct cellular substrates of PARP1, we constructed a library of PARP1 mutants for screening against a panel of NAD + analogues we have synthesized. Although a bioorthogonal pair of PARP1 NAD + was not identified due to the lack of specificity and activity, we found two NAD + analogues with clickable azide and alkyne groups that can be used as co-substrates by PARP1 during automodification. The NAD + analogues can be further modified to increase cell permeability for use in visualizing live cell PARylation. For the exploration of PARP1’s potential use as a drug carrier through its automodification characteristics, we developed a novel ADC assembly platform, connecting targeting moieties, automodified PARP1, and payloads through click chemistry-based reactions. Our ADCs exhibited high specificity and potency towards targeted receptor cell lines. The novel ADCs incorporating PARP1 as drug carrier have further 9 Chapter 5 contains sections partially quoted verbatim from my first author publication: Chen, J., Lam, A.T., and Zhang, Y. (2018). A macrodomain-linked immunosorbent assay (MLISA) for mono-ADP-ribosyltransferases. Anal Biochem 543, 132-139.Permission to use is granted by Elsevier, ScienceDirect, for non-commercial purposes <https://www.elsevier.com/about/policies/copyright/permissions> 94 implications in diagnosis and therapeutics, as both the targeting group and payload can be altered based on individual research needs. 95 6 References Aguiar, R.C., Takeyama, K., He, C., Kreinbrink, K., and Shipp, M.A. (2005). B-aggressive lymphoma family proteins have unique domains that modulate transcription and exhibit poly(ADP-ribose) polymerase activity. J Biol Chem 280, 33756-33765. Aguilera-Gomez, A., van Oorschot, M.M., Veenendaal, T., and Rabouille, C. (2016). In vivo vizualisation of mono-ADP-ribosylation by dPARP16 upon amino-acid starvation. Elife 5, e21475. Ahel, I., Ahel, D., Matsusaka, T., Clark, A.J., Pines, J., Boulton, S.J., and West, S.C. (2008). Poly(ADP- ribose)-binding zinc finger motifs in DNA repair/checkpoint proteins. Nature 451, 81-85. Altmeyer, M., Messner, S., Hassa, P.O., Fey, M., and Hottiger, M.O. (2009). Molecular mechanism of poly(ADP-ribosyl)ation by PARP1 and identification of lysine residues as ADP-ribose acceptor sites. Nucleic Acids Res 37, 3723-3738. Andersson, C.D., Karlberg, T., Ekblad, T., Lindgren, A.E., Thorsell, A.G., Spjut, S., Uciechowska, U., Niemiec, M.S., Wittung-Stafshede, P., Weigelt, J., et al. (2012). Discovery of ligands for ADP- ribosyltransferases via docking-based virtual screening. J Med Chem 55, 7706-7718. Aravind, L., Zhang, D., de Souza, R.F., Anand, S., and Iyer, L.M. (2015). The natural history of ADP- ribosyltransferases and the ADP-ribosylation system. Curr Top Microbiol Immunol 384, 3-32. Bachmann, S.B., Frommel, S.C., Camicia, R., Winkler, H.C., Santoro, R., and Hassa, P.O. (2014). DTX3L and ARTD9 inhibit IRF1 expression and mediate in cooperation with ARTD8 survival and proliferation of metastatic prostate cancer cells. Mol Cancer 13, 125. Barbarulo, A., Iansante, V., Chaidos, A., Naresh, K., Rahemtulla, A., Franzoso, G., Karadimitris, A., Haskard, D.O., Papa, S., and Bubici, C. (2012). Poly(ADP-ribose) polymerase family member 14 (PARP14) is a novel effector of the JNK2-dependent pro-survival signal in multiple myeloma. Oncogene 32, 4231. Barkauskaite, E., Jankevicius, G., and Ahel, I. (2015). Structures and Mechanisms of Enzymes Employed in the Synthesis and Degradation of PARP-Dependent Protein ADP-Ribosylation. Mol Cell 58, 935-946. Barok, M., Joensuu, H., and Isola, J. (2014). Trastuzumab emtansine: mechanisms of action and drug resistance. Breast Cancer Res 16, 209. Beck, A. (2013). Review of Antibody-Drug Conjugates, Methods in Molecular Biology series. MAbs 6, 30-33. Beck, C., Robert, I., Reina-San-Martin, B., Schreiber, V., and Dantzer, F. (2014). Poly(ADP-ribose) polymerases in double-strand break repair: focus on PARP1, PARP2 and PARP3. Exp Cell Res 329, 18- 25. Blenn, C., Althaus, F.R., and Malanga, M. (2006). Poly(ADP-ribose) glycohydrolase silencing protects against H2O2-induced cell death. Biochem J 396, 419-429. Boehler, C., Gauthier, L., Yelamos, J., Noll, A., Schreiber, V., and Dantzer, F. (2011). Phenotypic characterization of Parp-1 and Parp-2 deficient mice and cells. Methods Mol Biol 780, 313-336. Bostrom, J., Haber, L., Koenig, P., Kelley, R.F., and Fuh, G. (2011). High affinity antigen recognition of the dual specific variants of herceptin is entropy-driven in spite of structural plasticity. PLoS One 6, e17887. Bouchard, V.J., Rouleau, M., and Poirier, G.G. (2003). PARP-1, a determinant of cell survival in response to DNA damage. Exp Hematol 31, 446-454. Butepage, M., Eckei, L., Verheugd, P., and Luscher, B. (2015). Intracellular Mono-ADP-Ribosylation in Signaling and Disease. Cells 4, 569-595. Carter-O'Connell, I., Jin, H., Morgan, R.K., David, L.L., and Cohen, M.S. (2014). Engineering the substrate specificity of ADP-ribosyltransferases for identifying direct protein targets. J Am Chem Soc 136, 5201-5204. 96 Chen, J., Lam, A.T., and Zhang, Y. (2018). A macrodomain-linked immunosorbent assay (MLISA) for mono-ADP-ribosyltransferases. Anal Biochem 543, 132-139. Cheng, Q., Shi, X., Han, M., Smbatyan, G., Lenz, H.J., and Zhang, Y. (2018). Reprogramming Exosomes as Nanoscale Controllers of Cellular Immunity. J Am Chem Soc 140, 16413-16417. Cho, S.H., Ahn, A.K., Bhargava, P., Lee, C.H., Eischen, C.M., McGuinness, O., and Boothby, M. (2011). Glycolytic rate and lymphomagenesis depend on PARP14, an ADP ribosyltransferase of the B aggressive lymphoma (BAL) family. Proc Natl Acad Sci U S A 108, 15972-15977. Cho, S.H., Goenka, S., Henttinen, T., Gudapati, P., Reinikainen, A., Eischen, C.M., Lahesmaa, R., and Boothby, M. (2009). PARP-14, a member of the B aggressive lymphoma family, transduces survival signals in primary B cells. Blood 113, 2416-2425. Cohen-Armon, M., Visochek, L., Rozensal, D., Kalal, A., Geistrikh, I., Klein, R., Bendetz-Nezer, S., Yao, Z., and Seger, R. (2007). DNA-independent PARP-1 activation by phosphorylated ERK2 increases Elk1 activity: a link to histone acetylation. Mol Cell 25, 297-308. Cohen, M.S., and Chang, P. (2018). Insights into the biogenesis, function, and regulation of ADP- ribosylation. Nat Chem Biol 14, 236-243. Dani, N., Stilla, A., Marchegiani, A., Tamburro, A., Till, S., Ladurner, A.G., Corda, D., and Di Girolamo, M. (2009). Combining affinity purification by ADP-ribose-binding macro domains with mass spectrometry to define the mammalian ADP-ribosyl proteome. Proc Natl Acad Sci U S A 106, 4243- 4248. Di Paola, S., Micaroni, M., Di Tullio, G., Buccione, R., and Di Girolamo, M. (2012). PARP16/ARTD15 is a novel endoplasmic-reticulum-associated mono-ADP-ribosyltransferase that interacts with, and modifies karyopherin-ss1. PLoS One 7, e37352. Diamantis, N., and Banerji, U. (2016). Antibody-drug conjugates--an emerging class of cancer treatment. Br J Cancer 114, 362-367. Drenichev, M.S., and Mikhailov, S.N. (2016). Poly(ADP-ribose): From chemical synthesis to drug design. Bioorg Med Chem Lett 26, 3395-3403. Duncan, R. (2011). Polymer therapeutics as nanomedicines: new perspectives. Curr Opin Biotechnol 22, 492-501. Egloff, M.P., Malet, H., Putics, A., Heinonen, M., Dutartre, H., Frangeul, A., Gruez, A., Campanacci, V., Cambillau, C., Ziebuhr, J., et al. (2006). Structural and functional basis for ADP-ribose and poly(ADP- ribose) binding by viral macro domains. J Virol 80, 8493-8502. Ekblad, T., Lindgren, A.E., Andersson, C.D., Caraballo, R., Thorsell, A.G., Karlberg, T., Spjut, S., Linusson, A., Schuler, H., and Elofsson, M. (2015). Towards small molecule inhibitors of mono-ADP- ribosyltransferases. Eur J Med Chem 95, 546-551. Fabrizio, G., Scarpa, E.S., and Di Girolamo, M. (2015). State of the art of protein mono-ADP- ribosylation: biological role and therapeutic potential. Front Biosci (Landmark Ed) 20, 405-430. Feijs, K.L., Forst, A.H., Verheugd, P., and Luscher, B. (2013a). Macrodomain-containing proteins: regulating new intracellular functions of mono(ADP-ribosyl)ation. Nat Rev Mol Cell Biol 14, 443-451. Feijs, K.L., Verheugd, P., and Luscher, B. (2013b). Expanding functions of intracellular resident mono- ADP-ribosylation in cell physiology. FEBS J 280, 3519-3529. Forst, A.H., Karlberg, T., Herzog, N., Thorsell, A.G., Gross, A., Feijs, K.L., Verheugd, P., Kursula, P., Nijmeijer, B., Kremmer, E., et al. (2013). Recognition of mono-ADP-ribosylated ARTD10 substrates by ARTD8 macrodomains. Structure 21, 462-475. Fouquerel, E., and Sobol, R.W. (2014). ARTD1 (PARP1) activation and NAD(+) in DNA repair and cell death. DNA Repair (Amst) 23, 27-32. Frka-Petesic, B., Zanchi, D., Martin, N., Carayon, S., Huille, S., and Tribet, C. (2016). Aggregation of Antibody Drug Conjugates at Room Temperature: SAXS and Light Scattering Evidence for Colloidal Instability of a Specific Subpopulation. Langmuir 32, 4848-4861. Gariani, K., Ryu, D., Menzies, K.J., Yi, H.S., Stein, S., Zhang, H., Perino, A., Lemos, V., Katsyuba, E., Jha, P., et al. (2017). Inhibiting poly ADP-ribosylation increases fatty acid oxidation and protects against fatty liver disease. J Hepatol 66, 132-141. 97 Gibson, B.A., and Kraus, W.L. (2012). New insights into the molecular and cellular functions of poly(ADP-ribose) and PARPs. Nat Rev Mol Cell Biol 13, 411-424. Gibson, B.A., Zhang, Y., Jiang, H., Hussey, K.M., Shrimp, J.H., Lin, H., Schwede, F., Yu, Y., and Kraus, W.L. (2016). Chemical genetic discovery of PARP targets reveals a role for PARP-1 in transcription elongation. Science 353, 45-50. Haag, F., and Buck, F. (2015). Identification and analysis of ADP-ribosylated proteins. Curr Top Microbiol Immunol 384, 33-50. Hakme, A., Huber, A., Dolle, P., and Schreiber, V. (2008). The macroPARP genes Parp-9 and Parp-14 are developmentally and differentially regulated in mouse tissues. Dev Dyn 237, 209-215. Han, W., Li, X., and Fu, X. (2011). The macro domain protein family: structure, functions, and their potential therapeutic implications. Mutat Res 727, 86-103. Hassa, P.O., Haenni, S.S., Elser, M., and Hottiger, M.O. (2006). Nuclear ADP-ribosylation reactions in mammalian cells: where are we today and where are we going? Microbiol Mol Biol Rev 70, 789-829. Hottiger, M.O., Boothby, M., Koch-Nolte, F., Luscher, B., Martin, N.M., Plummer, R., Wang, Z.Q., and Ziegler, M. (2011). Progress in the function and regulation of ADP-Ribosylation. Sci Signal 4, mr5. Iansante, V., Choy, P.M., Fung, S.W., Liu, Y., Chai, J.G., Dyson, J., Del Rio, A., D'Santos, C., Williams, R., Chokshi, S., et al. (2015). PARP14 promotes the Warburg effect in hepatocellular carcinoma by inhibiting JNK1-dependent PKM2 phosphorylation and activation. Nat Commun 6, 7882. Iversen, P.W., Beck, B., Chen, Y.F., Dere, W., Devanarayan, V., Eastwood, B.J., Farmen, M.W., Iturria, S.J., Montrose, C., Moore, R.A., et al. (2004). HTS Assay Validation. In Assay Guidance Manual, G.S. Sittampalam, N.P. Coussens, K. Brimacombe, A. Grossman, M. Arkin, D. Auld, C. Austin, J. Baell, B. Bejcek, J.M.M. Caaveiro, et al., eds. (Bethesda (MD): Eli Lilly & Company and the National Center for Advancing Translational Sciences). Jankevicius, G., Hassler, M., Golia, B., Rybin, V., Zacharias, M., Timinszky, G., and Ladurner, A.G. (2013). A family of macrodomain proteins reverses cellular mono-ADP-ribosylation. Nat Struct Mol Biol 20, 508-514. Jerjian, T.V., Glode, A.E., Thompson, L.A., and O'Bryant, C.L. (2016). Antibody-Drug Conjugates: A Clinical Pharmacy Perspective on an Emerging Cancer Therapy. Pharmacotherapy 36, 99-116. Jiang, H., Kim, J.H., Frizzell, K.M., Kraus, W.L., and Lin, H. (2010). Clickable NAD analogues for labeling substrate proteins of poly(ADP-ribose) polymerases. J Am Chem Soc 132, 9363-9372. Johansson, M.P., Maaheimo, H., and Ekholm, F.S. (2017). New insight on the structural features of the cytotoxic auristatins MMAE and MMAF revealed by combined NMR spectroscopy and quantum chemical modelling. Sci Rep 7, 15920. Jubin, T., Kadam, A., Jariwala, M., Bhatt, S., Sutariya, S., Gani, A.R., Gautam, S., and Begum, R. (2016). The PARP family: insights into functional aspects of poly (ADP-ribose) polymerase-1 in cell growth and survival. Cell Prolif 49, 421-437. Jungmichel, S., Rosenthal, F., Altmeyer, M., Lukas, J., Hottiger, M.O., and Nielsen, M.L. (2013). Proteome-wide identification of poly(ADP-Ribosyl)ation targets in different genotoxic stress responses. Mol Cell 52, 272-285. Jwa, M., and Chang, P. (2012). PARP16 is a tail-anchored endoplasmic reticulum protein required for the PERK- and IRE1alpha-mediated unfolded protein response. Nat Cell Biol 14, 1223-1230. Kalisch, T., Ame, J.C., Dantzer, F., and Schreiber, V. (2012). New readers and interpretations of poly(ADP-ribosyl)ation. Trends Biochem Sci 37, 381-390. Kang, H.C., Lee, Y.I., Shin, J.H., Andrabi, S.A., Chi, Z., Gagne, J.P., Lee, Y., Ko, H.S., Lee, B.D., Poirier, G.G., et al. (2011). Iduna is a poly(ADP-ribose) (PAR)-dependent E3 ubiquitin ligase that regulates DNA damage. Proc Natl Acad Sci U S A 108, 14103-14108. Karlberg, T., Klepsch, M., Thorsell, A.G., Andersson, C.D., Linusson, A., and Schuler, H. (2015). Structural basis for lack of ADP-ribosyltransferase activity in poly(ADP-ribose) polymerase-13/zinc finger antiviral protein. J Biol Chem 290, 7336-7344. 98 Karlberg, T., Langelier, M.F., Pascal, J.M., and Schuler, H. (2013). Structural biology of the writers, readers, and erasers in mono- and poly(ADP-ribose) mediated signaling. Mol Aspects Med 34, 1088- 1108. Karras, G.I., Kustatscher, G., Buhecha, H.R., Allen, M.D., Pugieux, C., Sait, F., Bycroft, M., and Ladurner, A.G. (2005). The macro domain is an ADP-ribose binding module. EMBO J 24, 1911-1920. Kim, I.K., Kiefer, J.R., Ho, C.M., Stegeman, R.A., Classen, S., Tainer, J.A., and Ellenberger, T. (2012). Structure of mammalian poly(ADP-ribose) glycohydrolase reveals a flexible tyrosine clasp as a substrate- binding element. Nat Struct Mol Biol 19, 653-656. Kim, M.Y., Mauro, S., Gevry, N., Lis, J.T., and Kraus, W.L. (2004). NAD + -dependent modulation of chromatin structure and transcription by nucleosome binding properties of PARP-1. Cell 119, 803-814. Kleine, H., Poreba, E., Lesniewicz, K., Hassa, P.O., Hottiger, M.O., Litchfield, D.W., Shilton, B.H., and Luscher, B. (2008). Substrate-assisted catalysis by PARP10 limits its activity to mono-ADP-ribosylation. Mol Cell 32, 57-69. Ko, H.L., and Ren, E.C. (2012). Functional Aspects of PARP1 in DNA Repair and Transcription. Biomolecules 2, 524-548. Koh, D.W., Lawler, A.M., Poitras, M.F., Sasaki, M., Wattler, S., Nehls, M.C., Stoger, T., Poirier, G.G., Dawson, V.L., and Dawson, T.M. (2004). Failure to degrade poly(ADP-ribose) causes increased sensitivity to cytotoxicity and early embryonic lethality. Proc Natl Acad Sci U S A 101, 17699-17704. Krishnakumar, R., and Kraus, W.L. (2010). The PARP side of the nucleus: molecular actions, physiological outcomes, and clinical targets. Mol Cell 39, 8-24. Krukenberg, K.A., Kim, S., Tan, E.S., Maliga, Z., and Mitchison, T.J. (2015). Extracellular poly(ADP- ribose) is a pro-inflammatory signal for macrophages. Chem Biol 22, 446-452. Kuny, C.V., and Sullivan, C.S. (2016). Virus-Host Interactions and the ARTD/PARP Family of Enzymes. PLoS Pathog 12, e1005453. Laing, S., Unger, M., Koch-Nolte, F., and Haag, F. (2011). ADP-ribosylation of arginine. Amino Acids 41, 257-269. Lambert, J.M., and Chari, R.V. (2014). Ado-trastuzumab Emtansine (T-DM1): an antibody-drug conjugate (ADC) for HER2-positive breast cancer. J Med Chem 57, 6949-6964. Langelier, M.F., Planck, J.L., Servent, K.M., and Pascal, J.M. (2011). Purification of human PARP-1 and PARP-1 domains from Escherichia coli for structural and biochemical analysis. Methods Mol Biol 780, 209-226. Leung, A.K.L., McPherson, R.L., and Griffin, D.E. (2018). Macrodomain ADP-ribosylhydrolase and the pathogenesis of infectious diseases. PLoS Pathog 14, e1006864. Leunissen, E.H., Meuleners, M.H., Verkade, J.M., Dommerholt, J., Hoenderop, J.G., and van Delft, F.L. (2014). Copper-free click reactions with polar bicyclononyne derivatives for modulation of cellular imaging. ChemBioChem 15, 1446-1451. Li, N., and Chen, J. (2014). ADP-ribosylation: activation, recognition, and removal. Mol Cells 37, 9-16. Liu, C., and Yu, X. (2015). ADP-ribosyltransferases and poly ADP-ribosylation. Curr Protein Pept Sci 16, 491-501. Lonskaya, I., Potaman, V.N., Shlyakhtenko, L.S., Oussatcheva, E.A., Lyubchenko, Y.L., and Soldatenkov, V.A. (2005). Regulation of poly(ADP-ribose) polymerase-1 by DNA structure-specific binding. J Biol Chem 280, 17076-17083. Lu, J., Jiang, F., Lu, A., and Zhang, G. (2016). Linkers Having a Crucial Role in Antibody-Drug Conjugates. Int J Mol Sci 17, 561. Luscher, B., Butepage, M., Eckei, L., Krieg, S., Verheugd, P., and Shilton, B.H. (2018). ADP- Ribosylation, a Multifaceted Posttranslational Modification Involved in the Control of Cell Physiology in Health and Disease. Chem Rev 118, 1092-1136. Marton, J., Fodor, T., Nagy, L., Vida, A., Kis, G., Brunyanszki, A., Antal, M., Luscher, B., and Bai, P. (2018). PARP10 (ARTD10) modulates mitochondrial function. PLoS One 13, e0187789. Mashimo, M., and Moss, J. (2016). Functional Role of ADP-Ribosyl-Acceptor Hydrolase 3 in poly(ADP- Ribose) Polymerase-1 Response to Oxidative Stress. Curr Protein Pept Sci 17, 633-640. 99 McCluskey, J.D., Sava, D., Harbison, S.C., Muro-Cacho, C.A., Giffe, J.T., Ping, X., and Harbison, R.D. (2011). Hepatoprotective effects of select water-soluble PARP inhibitors in a carbon tetrachloride model. Int J Crit Illn Inj Sci 1, 97-103. McCombs, J.R., and Owen, S.C. (2015). Antibody drug conjugates: design and selection of linker, payload and conjugation chemistry. AAPS J 17, 339-351. Megnin-Chanet, F., Bollet, M.A., and Hall, J. (2010). Targeting poly(ADP-ribose) polymerase activity for cancer therapy. Cell Mol Life Sci 67, 3649-3662. Mehrotra, P., Hollenbeck, A., Riley, J.P., Li, F., Patel, R.J., Akhtar, N., and Goenka, S. (2013). Poly (ADP-ribose) polymerase 14 and its enzyme activity regulates T(H)2 differentiation and allergic airway disease. J Allergy Clin Immunol 131, 521-531 e521-512. Mehrotra, P., Riley, J.P., Patel, R., Li, F., Voss, L., and Goenka, S. (2011). PARP-14 functions as a transcriptional switch for Stat6-dependent gene activation. J Biol Chem 286, 1767-1776. Menear, K.A., Adcock, C., Boulter, R., Cockcroft, X.L., Copsey, L., Cranston, A., Dillon, K.J., Drzewiecki, J., Garman, S., Gomez, S., et al. (2008). 4-[3-(4-cyclopropanecarbonylpiperazine-1- carbonyl)-4-fluorobenzyl]-2H-phthalazin- 1-one: a novel bioavailable inhibitor of poly(ADP-ribose) polymerase-1. J Med Chem 51, 6581-6591. Meyer-Ficca, M.L., Lonchar, J.D., Ihara, M., Meistrich, M.L., Austin, C.A., and Meyer, R.G. (2011). Poly(ADP-ribose) polymerases PARP1 and PARP2 modulate topoisomerase II beta (TOP2B) function during chromatin condensation in mouse spermiogenesis. Biol Reprod 84, 900-909. Meyer, T., and Hilz, H. (1986). Production of anti-(ADP-ribose) antibodies with the aid of a dinucleotide- pyrophosphatase-resistant hapten and their application for the detection of mono(ADP-ribosyl)ated polypeptides. Eur J Biochem 155, 157-165. Morales, J., Li, L., Fattah, F.J., Dong, Y., Bey, E.A., Patel, M., Gao, J., and Boothman, D.A. (2014). Review of poly (ADP-ribose) polymerase (PARP) mechanisms of action and rationale for targeting in cancer and other diseases. Crit Rev Eukaryot Gene Expr 24, 15-28. Morrison, A.R., Moss, J., Stevens, L.A., Evans, J.E., Farrell, C., Merithew, E., Lambright, D.G., Greiner, D.L., Mordes, J.P., Rossini, A.A., et al. (2006). ART2, a T cell surface mono-ADP-ribosyltransferase, generates extracellular poly(ADP-ribose). J Biol Chem 281, 33363-33372. Mortusewicz, O., Fouquerel, E., Ame, J.C., Leonhardt, H., and Schreiber, V. (2011). PARG is recruited to DNA damage sites through poly(ADP-ribose)- and PCNA-dependent mechanisms. Nucleic Acids Res 39, 5045-5056. Muthurajan, U.M., Hepler, M.R., Hieb, A.R., Clark, N.J., Kramer, M., Yao, T., and Luger, K. (2014). Automodification switches PARP-1 function from chromatin architectural protein to histone chaperone. Proc Natl Acad Sci U S A 111, 12752-12757. Neupane, R., Kallsten, M., Lehmann, F., and Bergquist, J. (2018). Effect of mobile phase composition on the analysis of aggregates of antibody drug conjugates (ADCs) using size exclusion chromatography. Anal Methods 10, 938-941. Oei, S.L., Griesenbeck, J., Buchlow, G., Jorcke, D., Mayer-Kuckuk, P., Wons, T., and Ziegler, M. (1996). NAD + analogs substituted in the purine base as substrates for poly(ADP-ribosyl) transferase. FEBS Lett 397, 17-21. Ossovskaya, V., Koo, I.C., Kaldjian, E.P., Alvares, C., and Sherman, B.M. (2010). Upregulation of Poly (ADP-Ribose) Polymerase-1 (PARP1) in Triple-Negative Breast Cancer and Other Primary Human Tumor Types. Genes Cancer 1, 812-821. Palazzo, L., Mikoc, A., and Ahel, I. (2017). ADP-ribosylation: new facets of an ancient modification. FEBS J 284, 2932-2946. Peng, B., Thorsell, A.G., Karlberg, T., Schuler, H., and Yao, S.Q. (2017). Small Molecule Microarray Based Discovery of PARP14 Inhibitors. Angew Chem Int Ed Engl 56, 248-253. Perez, H.L., Cardarelli, P.M., Deshpande, S., Gangwar, S., Schroeder, G.M., Vite, G.D., and Borzilleri, R.M. (2014). Antibody-drug conjugates: current status and future directions. Drug Discov Today 19, 869- 881. 100 Peters, C., and Brown, S. (2015). Antibody-drug conjugates as novel anti-cancer chemotherapeutics. Biosci Rep 35, e00225. Pettersen, E.F., Goddard, T.D., Huang, C.C., Couch, G.S., Greenblatt, D.M., Meng, E.C., and Ferrin, T.E. (2004). UCSF Chimera--a visualization system for exploratory research and analysis. J Comput Chem 25, 1605-1612. Pickens, C.J., Johnson, S.N., Pressnall, M.M., Leon, M.A., and Berkland, C.J. (2018). Practical Considerations, Challenges, and Limitations of Bioconjugation via Azide-Alkyne Cycloaddition. Bioconjug Chem 29, 686-701. Pion, E., Ullmann, G.M., Ame, J.C., Gerard, D., de Murcia, G., and Bombarda, E. (2005). DNA-induced dimerization of poly(ADP-ribose) polymerase-1 triggers its activation. Biochemistry 44, 14670-14681. Putt, K.S., and Hergenrother, P.J. (2004). An enzymatic assay for poly(ADP-ribose) polymerase-1 (PARP-1) via the chemical quantitation of NAD(+): application to the high-throughput screening of small molecules as potential inhibitors. Anal Biochem 326, 78-86. Quénet, D. (2018). Chapter One - Histone Variants and Disease. In International Review of Cell and Molecular Biology, F. Loos, ed. (Academic Press), pp. 1-39. Quiles-Perez, R., Munoz-Gamez, J.A., Ruiz-Extremera, A., O'Valle, F., Sanjuan-Nunez, L., Martin- Alvarez, A.B., Martin-Oliva, D., Caballero, T., Munoz de Rueda, P., Leon, J., et al. (2010). Inhibition of poly adenosine diphosphate-ribose polymerase decreases hepatocellular carcinoma growth by modulation of tumor-related gene expression. Hepatology 51, 255-266. Rack, J.G., Perina, D., and Ahel, I. (2016). Macrodomains: Structure, Function, Evolution, and Catalytic Activities. Annu Rev Biochem 85, 431-454. Ray Chaudhuri, A., and Nussenzweig, A. (2017). The multifaceted roles of PARP1 in DNA repair and chromatin remodelling. Nat Rev Mol Cell Biol 18, 610-621. Riffell, J.L., Lord, C.J., and Ashworth, A. (2012). Tankyrase-targeted therapeutics: expanding opportunities in the PARP family. Nat Rev Drug Discov 11, 923-936. Rosenthal, F., Feijs, K.L., Frugier, E., Bonalli, M., Forst, A.H., Imhof, R., Winkler, H.C., Fischer, D., Caflisch, A., Hassa, P.O., et al. (2013). Macrodomain-containing proteins are new mono-ADP- ribosylhydrolases. Nat Struct Mol Biol 20, 502-507. Ryu, D., Zhang, H., Ropelle, E.R., Sorrentino, V., Mazala, D.A., Mouchiroud, L., Marshall, P.L., Campbell, M.D., Ali, A.S., Knowels, G.M., et al. (2016). NAD + repletion improves muscle function in muscular dystrophy and counters global PARylation. Sci Transl Med 8, 361ra139. Ryu, K.W., Kim, D.S., and Kraus, W.L. (2015). New facets in the regulation of gene expression by ADP- ribosylation and poly(ADP-ribose) polymerases. Chem Rev 115, 2453-2481. Sahaboglu, A., Bolz, S., Lowenheim, H., and Paquet-Durand, F. (2014). Expression of poly(ADP-ribose) glycohydrolase in wild-type and PARG-110 knock-out retina. Adv Exp Med Biol 801, 463-469. Sahin, O., Saatci, O., Durmus, S., Eyupoglu, E., and Wiemann, S. (2016). Systems level analysis of T- DM1 resistance in in vitro and in vivo models of HER-2 overexpressing breast cancer. Eur J Cancer 61, S121-S121. Scarpa, E.S., Fabrizio, G., and Di Girolamo, M. (2013). A role of intracellular mono-ADP-ribosylation in cancer biology. FEBS J 280, 3551-3562. Schleicher, E.M., Galvan, A.M., Imamura-Kawasawa, Y., Moldovan, G.L., and Nicolae, C.M. (2018). PARP10 promotes cellular proliferation and tumorigenesis by alleviating replication stress. Nucleic Acids Res 46, 8908-8916. Selvaraj, C., Tripathi, S.K., Reddy, K.K., and Singh, S.K. (2011). Tool development for Prediction of pIC 50 values from the IC 50 values-A pIC 50 value calculator. Curr Trends Biotechnol Pharm 5. Seman, M., Adriouch, S., Haag, F., and Koch-Nolte, F. (2004). Ecto-ADP-ribosyltransferases (ARTs): emerging actors in cell communication and signaling. Curr Med Chem 11, 857-872. Smith, B.C., Hallows, W.C., and Denu, J.M. (2009). A continuous microplate assay for sirtuins and nicotinamide-producing enzymes. Anal Biochem 394, 101-109. Steffen, J.D., Brody, J.R., Armen, R.S., and Pascal, J.M. (2013). Structural Implications for Selective Targeting of PARPs. Front Oncol 3, 301. 101 Tan, E.S., Krukenberg, K.A., and Mitchison, T.J. (2012). Large-scale preparation and characterization of poly(ADP-ribose) and defined length polymers. Anal Biochem 428, 126-136. Tao, Z., Gao, P., and Liu, H.W. (2009a). Identification of the ADP-ribosylation sites in the PARP-1 automodification domain: analysis and implications. J Am Chem Soc 131, 14258-14260. Tao, Z., Gao, P., and Liu, H.W. (2009b). Studies of the expression of human poly(ADP-ribose) polymerase-1 in Saccharomyces cerevisiae and identification of PARP-1 substrates by yeast proteome microarray screening. Biochemistry 48, 11745-11754. Teloni, F., and Altmeyer, M. (2016). Readers of poly(ADP-ribose): designed to be fit for purpose. Nucleic Acids Res 44, 993-1006. Tsuchikama, K., and An, Z. (2018). Antibody-drug conjugates: recent advances in conjugation and linker chemistries. Protein Cell 9, 33-46. Venkannagari, H., Fallarero, A., Feijs, K.L., Luscher, B., and Lehtio, L. (2013). Activity-based assay for human mono-ADP-ribosyltransferases ARTD7/PARP15 and ARTD10/PARP10 aimed at screening and profiling inhibitors. Eur J Pharm Sci 49, 148-156. Venkannagari, H., Verheugd, P., Koivunen, J., Haikarainen, T., Obaji, E., Ashok, Y., Narwal, M., Pihlajaniemi, T., Luscher, B., and Lehtio, L. (2016). Small-Molecule Chemical Probe Rescues Cells from Mono-ADP-Ribosyltransferase ARTD10/PARP10-Induced Apoptosis and Sensitizes Cancer Cells to DNA Damage. Cell Chem Biol 23, 1251-1260. Verheugd, P., Butepage, M., Eckei, L., and Luscher, B. (2016). Players in ADP-ribosylation: Readers and Erasers. Curr Protein Pept Sci 17, 654-667. Vivelo, C.A., and Leung, A.K. (2015). Proteomics approaches to identify mono-(ADP-ribosyl)ated and poly(ADP-ribosyl)ated proteins. Proteomics 15, 203-217. Vyas, S., and Chang, P. (2014). New PARP targets for cancer therapy. Nat Rev Cancer 14, 502-509. Vyas, S., Chesarone-Cataldo, M., Todorova, T., Huang, Y.H., and Chang, P. (2013). A systematic analysis of the PARP protein family identifies new functions critical for cell physiology. Nat Commun 4, 2240. Vyas, S., Matic, I., Uchima, L., Rood, J., Zaja, R., Hay, R.T., Ahel, I., and Chang, P. (2014). Family-wide analysis of poly(ADP-ribose) polymerase activity. Nat Commun 5, 4426. Wahlberg, E., Karlberg, T., Kouznetsova, E., Markova, N., Macchiarulo, A., Thorsell, A.G., Pol, E., Frostell, A., Ekblad, T., Oncu, D., et al. (2012). Family-wide chemical profiling and structural analysis of PARP and tankyrase inhibitors. Nat Biotechnol 30, 283-288. Wallrodt, S., Buntz, A., Wang, Y., Zumbusch, A., and Marx, A. (2016). Bioorthogonally Functionalized NAD(+) Analogues for In-Cell Visualization of Poly(ADP-Ribose) Formation. Angew Chem Int Ed Engl 55, 7660-7664. Wang, Z., Michaud, G.A., Cheng, Z., Zhang, Y., Hinds, T.R., Fan, E., Cong, F., and Xu, W. (2012). Recognition of the iso-ADP-ribose moiety in poly(ADP-ribose) by WWE domains suggests a general mechanism for poly(ADP-ribosyl)ation-dependent ubiquitination. Genes Dev 26, 235-240. Wei, H., and Yu, X. (2016). Functions of PARylation in DNA Damage Repair Pathways. Genomics Proteomics Bioinformatics 14, 131-139. Welsby, I., Hutin, D., and Leo, O. (2012). Complex roles of members of the ADP-ribosyl transferase super family in immune defences: looking beyond PARP1. Biochem Pharmacol 84, 11-20. Yanagawa, T., Funasaka, T., Tsutsumi, S., Hu, H., Watanabe, H., and Raz, A. (2007). Regulation of phosphoglucose isomerase/autocrine motility factor activities by the poly(ADP-ribose) polymerase family-14. Cancer Res 67, 8682-8689. Yao, H., Jiang, F., Lu, A., and Zhang, G. (2016). Methods to Design and Synthesize Antibody-Drug Conjugates (ADCs). Int J Mol Sci 17. Yoshino, J., Baur, J.A., and Imai, S.I. (2018). NAD(+) Intermediates: The Biology and Therapeutic Potential of NMN and NR. Cell Metab 27, 513-528. Young, T.L., and Santella, R.M. (1988). Development of techniques to monitor for exposure to vinyl chloride: monoclonal antibodies to ethenoadenosine and ethenocytidine. Carcinogenesis 9, 589-592. 102 Yu, M., Schreek, S., Cerni, C., Schamberger, C., Lesniewicz, K., Poreba, E., Vervoorts, J., Walsemann, G., Grotzinger, J., Kremmer, E., et al. (2005). PARP-10, a novel Myc-interacting protein with poly(ADP- ribose) polymerase activity, inhibits transformation. Oncogene 24, 1982-1993. Zaja, R., Mikoc, A., Barkauskaite, E., and Ahel, I. (2012). Molecular Insights into Poly(ADP-ribose) Recognition and Processing. Biomolecules 3, 1-17. Zhang, J.H., Chung, T.D., and Oldenburg, K.R. (1999). A Simple Statistical Parameter for Use in Evaluation and Validation of High Throughput Screening Assays. J Biomol Screen 4, 67-73. Zhang, Y., Liu, S., Mickanin, C., Feng, Y., Charlat, O., Michaud, G.A., Schirle, M., Shi, X., Hild, M., Bauer, A., et al. (2011). RNF146 is a poly(ADP-ribose)-directed E3 ligase that regulates axin degradation and Wnt signalling. Nat Cell Biol 13, 623-629. Zolkiewska, A. (2005). Ecto-ADP-ribose transferases: cell-surface response to local tissue injury. Physiology (Bethesda) 20, 374-381.

Abstract (if available)

Abstract The research projects primary focus on developing new methods and tools for the characterization and functional studies of ADP-ribosyltransferases (ARTs) involved in both mono and poly ADP-ribosylation (MARylation and PARylation) and the development of poly ADP-ribose (ADPr)-based therapeutics. ARTs catalyze reversible additions of mono and poly ADPr onto diverse types of proteins, using nicotinamide adenine dinucleotide (NAD⁺) as a co-substrate. Both mono and poly ARTs have significant impact on the regulation of various cellular processes, including apoptosis, DNA repair and transcription. ❧ In Chapter 2, we developed a macrodomain-linked immunosorbent assay (MLISA) for characterizing mono ARTs’ activity. Recombinant macrodomain 2 from poly ADP-ribose polymerase 14 (PARP14) was generated with a C-terminus human inﬂuenza hemagglutinin (HA) tag for detecting mono ADP-ribosylated proteins. Coupled with an anti-HA secondary antibody, the generated HA-tagged macrodomain 2 revealed high speciﬁcity for MARylation catalyzed by distinct mono ARTs. MLISA provides a new and convenient method for the quantitative characterization of mono ART enzymes and may allow identiﬁcation of potent mono ART inhibitors in a high-throughput-compatible manner. Identiﬁcation of new modulators of mono ARTs can thus potentially lead to discovery of novel chemical probes and therapeutics. ❧ Chapter 3 describes the efforts to identify bioorthogonal pairs of PARP1/NAD⁺ analogues. Site-directed mutagenesis was conducted on selected residues on PARP1’s catalytic domain, intended for the accommodation of the clickable functional groups attached to NAD⁺ analogues. Two novel NAD⁺ analogues with strong to moderate activities for PARP1-catalyzed PARylation were identified, serving as unique and important tools for probing and investigating cellular PARylation. ❧ We then explored the potential therapeutic use of automodified PARP1 as a novel drug carrier in Chapter 4. Thanks to its robust automodification activity, human PARP1 can catalyze the transfer of multiple ADPr units with clickable moieties onto itself, resulting in clickable ADPr polymers. The generated automodified PARP1 with clickable polymers allows for conjugation with monoclonal antibodies and cytotoxic agents, forming novel antibody drug conjugates (ADCs). The generated ADCs display significant specificity and potency towards targeted cell lines. This versatile conjugation method offers a platform with promising potentials for the development new classes of ADCs with enhanced efficacy.

Linked assets

University of Southern California Dissertations and Theses

Conceptually similar

PDF

Development of new approaches for antibody modification

PDF

Biochemical development and analysis of NAD⁺-related biomolecules

Asset Metadata

Creator Chen, Jingwen (Julianna) (author)

Core Title Protein ADP-ribosylation: from biochemical characterization to therapeutic applications

School School of Pharmacy

Degree Doctor of Philosophy

Degree Program Pharmaceutical Sciences

Publication Date 04/24/2021

Defense Date 03/18/2019

Publisher University of Southern California (original), University of Southern California. Libraries (digital)

Tag ADP-ribosyltransferases,antibody drug conjugates,bioorthogonal,characterization methods and tools,click chemistry,drug carrier,enhanced efficacy,high-throughput,macrodomain-linked immunosorbent assay (MLISA),mono and poly ADP-ribosylation (MARylation and PARylation),OAI-PMH Harvest,poly ADP-ribose,therapeutics

Format application/pdf (imt)

Language English

Contributor Electronically uploaded by the author (provenance)

Advisor Zhang, Yong (committee chair), Okamoto, Curtis (committee member), Shen, Wei-chiang (committee member)

Creator Email jingwenc@usc.edu,jingwenjuliannachen@gmail.com

Permanent Link (DOI) https://doi.org/10.25549/usctheses-c89-144149

Unique identifier UC11676748

Identifier etd-ChenJingwe-7247.pdf (filename),usctheses-c89-144149 (legacy record id)

Legacy Identifier etd-ChenJingwe-7247.pdf

Dmrecord 144149

Document Type Dissertation

Format application/pdf (imt)

Rights Chen, Jingwen (Julianna)

Type texts

Source University of Southern California (contributing entity), University of Southern California Dissertations and Theses (collection)

Access Conditions The author retains rights to his/her dissertation, thesis or other graduate work according to U.S. copyright law. Electronic access is being provided by the USC Libraries in agreement with the a...

Repository Name University of Southern California Digital Library

Repository Location USC Digital Library, University of Southern California, University Park Campus MC 2810, 3434 South Grand Avenue, 2nd Floor, Los Angeles, California 90089-2810, USA