University of Southern California Dissertations and Theses

Chorion gene amplification in Drosophila melanogaster

(USC Thesis Other)

Chorion gene amplification in Drosophila melanogaster

PDF

Download

Open document

Flip pages

Download a page range

Download transcript

Copy asset link

Request this asset

Transcript (if available)

Content

CHORION GENE AMPLIFICATION IN DROSOPHILA MELANOGASTER

by
Nan Chen
—————————————————————————————

A Dissertation Presented to the
FACULTY OF THE GRADUATE SCHOOL
UNIVERSITY OF SOUTHERN CALIFORNIA
In Partial Fulfillment of the Requirements for the Degree
DOCTOR OF PHILOSOPHY
(MOLECULAR BIOLOGY)

August 2010

Copyright 2010 Nan Chen
ii
Acknowledgements
It is my honor to thank all the people who ever cared for me, even if just for a split of
second, and helped to make this thesis dissertation possible. I am so grateful to have such
wonderful people like you in my life. I love you with all my heart.
iii
Table of Contents
Acknowledgements ii
List of Tables iv
List of Figures v
Abstract vi
Chapter 1: Introduction 1
Chapter 2: Conditional switches for extracellular matrix patterning in Drosophila
melanogaster
24
Chapter 3: Ecdysone receptor and chorion gene transcription regulate chorion gene
amplification
65
Conclusion 109
Bibliography 117

iv
List of Tables

1.1 Trans-regulators of chorion gene amplification 12
2.1 New PdL mutations with pattern defects 54
3.1 qPCR results of EcR transgenic lines 96

v
List of Figures

1.1 Onion skin structure of chorion gene amplification 7
1.2 3rd chromosome chorion gene cluster 17
1.3 A model for chorion gene amplification 20
2.1 Outline of signaling pathways affecting tubulogenesis. 29
2.2 DOX dependent gene over-expression in ovarian follicle cells 32
2.3 Identification of conditional, dominant mutations affecting the eggshell 34
2.4 Molecular characterization of select mutations 43
3.1 Conditional transgene expression in follicle cells using the Tet-on system 84
3.2 Conditional transgene expression in follicle cells using the Geneswitch
system
86
3.3 Effect of EcR transgene expression on eggshell structure 92
3.4 Effect of EcR transgene expression on chorion gene locus copy number 94
3.5 Clustered point mutations of chorion locus sequences and effects on
transcription and amplification.
97
3.6 Effect of PdL-mediated gene over-expression mutations on chorion gene
amplification
101

vi
Abstract
Drosophila chorion genes are amplified in the ovarian follicle cells during oogenesis in
order to satisfy the high demand for eggshell protein synthesis. Amplification occurs
through repeated firing of origin(s) and is strictly regulated both temporally and spatially.
The third chromosome chorion gene s18 requires upstream replicator Amplification
Element on the 3rd Chromosome (ACE3) and downstream sequence-specific origin ori-
beta for efficient amplification. Using constructs carrying ACE3, s18 and ori-beta, we
were able to study the sequence and transcription requirement for s18 amplification. We
found that experimentally reducing transcription of s18 inhibits amplification. Using
conditional overexpression of Green Fluorescence Protein (GFP), we found that active
transcription alone is not sufficient to initiate amplification without the presence of ACE3
and ori-beta. Point mutations in the s18 TATA box reduced s18 amplification. We
therefore conclude that transcription, although not sufficient for amplification initiation,
is essential for efficient s18 amplification. Point mutation of ecdysone receptor binding
motifs found in the s18 promoter and in ori-beta reduced both chorion gene transcription
and amplification. Reduced amplification was also observed with conditional inhibition
of ecdysone receptor gene expression and upon overexpression of dominant-negative
forms of the ecdysone receptor. Ecdysone receptor therefore mediates both
developmental regulation of chorion gene transcription and amplification. Additionally,
we identified several novel positive and negative trans-regulators of chorion gene
amplification, via a gene over-expression screen. Taken together, the results demonstrate
vii
that chorion gene amplification is the combined result of sequence specific regulatory
elements, active transcription and precise developmental control.
1
Chapter 1. Introduction
DNA amplification is a unique phenomenon that arose from the normal cell cycle and
DNA replication. Unlike typical replication, DNA amplification escapes the once-a-cell-
cycle control and when it occurs, the rest of the genome-wide replication ceases. Due to
its precise developmental control and discrete loci, DNA amplification provides a
convenient tool and an excellent model for understanding metazoan replication
regulation. In humans, abnormal DNA replication is tightly related to cancer. Gene
amplification itself has been widely recognized as an important indication for human
cancer progression. Better understanding of DNA amplification using model organisms
such as Drosophila enriches our knowledge of eukaryotic DNA replication.
There are 3 well-studied gene amplification examples in model organisms: Drosophila
chorion gene amplification, Tetrahymena rDNA amplification and the Sciara salivary
gland DNA puff.

Tetrahymena thermophila is a free-living ciliate protozoa that carries nuclear
dimorphism. It has two types of nuclei: a small, diploid germline micronucleus,
transcriptionally silent during vegetative growth; and a large, polyploidy somatic
2
macronucleus, which is highly transcriptionally active. In the macronucleus, a
minichromosome of 21-kb palindromic DNA structure forms through programmed
chromosome fragmentation and micronuclear ribosomal DNA (rDNA) rearrangement.
The minichromosome encodes ribosomal RNA and amplifies 9,000 fold during
macronuclear development (Zhang et al. 1997; Collins and Gorovsky 2005).
Tetrahymena is an attractive model for amplification studies because amplification occurs
during normal cell cycles.

Sciara coprophila is also called fungus fly. Like Drosophila, it belongs to the order of
Diptera. The Sciara salivary gland cells form two DNA puffs (II/2B and II/9A) at loci
containing putative pupal case genes. Those loci are amplified up to 20 fold followed by
high level transcription beginning 19 days after hatching (Liang and Gerbi 1994). The
II/9A origin initiation site is adjacent to an ORC-binding site (Gerbi et al. 2002). The
size of the initiation zone contracts when DNA puff amplification occurs (Lunyak et al.
2002) (Wu et al. 1993). The change of the initiation zone might be a result of chromatin
structure change and transcription machinery loading. The formation of the DNA puffs is
regulated by the steroid hormone ecdysone (Wu et al. 1993; Liang and Gerbi 1994;
3
Lunyak et al. 2002; Foulk et al. 2006). Three ecdysone response elements (EcRE) were
found in the II/9A promoter region and one was found in the 1-kb origin of amplification
region, located 2.5 kb away from II/9A.

Drosophila is a dipteran insect. It has just established an amazing 100-year history in
genetics and now has expanded its beneficial usage into almost all fields of biological
studies.

Drosophila chorion gene amplification is precisely regulated by the developmental
program in a temporal and spatial manner. Chorion gene amplification takes place in the
ovarian follicle cells, which form an epithelium surrounding the developing oocyte and
nurse cells, to create a structure called the “egg chamber”. About 1000 follicle cells are
found in this epithelium. These ovarian follicle cells are responsible for the synthesis and
secretion of the chorion proteins, which form the chorion, or eggshell. The chorion can
be further divided into 3 layers: inner chorion, endochorion and exochorion (Cavaliere et
al. 2008). Between the oocyte and the chorion, there is also a vitelline membrane and a
4
wax layer. Other specialized structures on a mature egg chamber include the dorsal
appendages, used for gas exchange, and the micropyle, which is the site for sperm entry.
Drosophila produce eggs and eggshells at a rapid rate. In order to satisfy the high
demand for eggshell gene expression, the chorion genes in the follicle cells undergo
amplification at the later stage of oogenesis. The chorion proteins are encoded by two
chorion gene clusters in the genome, at cytological location 7F on the X chromosome,
and at 66D on the 3rd. At the Drosophila amplicon in follicle cells (DAFC) 7X, chorion
genes are amplified up to 15 fold. The chorion genes at DAFC 66D can be amplified up
to 60 fold. There are two other amplification loci identified at 62D and 30B on the 3rd
chromosome (Claycomb et al. 2004). They are amplified 6 and 4 fold, respectively
(Claycomb et al. 2004). However, DAFC-30B and DAFC-62D do not encode chorion
proteins. But at least one of their products is essential for eggshell integrity (Claycomb et
al. 2004). These four DAFCs can be visualized by BrdU staining in stage 10 egg
chambers (Calvi 1999; Zhang and Tower 2004).

The mechanism of chorion gene amplification is by repeated firing of the origins in the
gene clusters. The overlapping replication forks result in an “onionskin” structure
5
(Figure 1). The replication forks move 40 – 50 kb in each direction during amplification
and there are no detectable termination sites or fork barriers (Claycomb et al. 2004;
Tower 2004). This onionskin structure maximizes the efficiency of increasing DNA
copies and therefore gene expression within a short amount of time. Chorion gene
amplification therefore provides a rare opportunity for understanding repeated origin
initiation and provides insights into metazoan DNA replication regulation.

Chorion gene amplification occurs in at least 4 distantly related species in the genus
Drosophila, with highly conserved sequences in the chorion gene region. Two clones
homologous to Drosophila X chromosome chorion genes s36 and s38 were identified in
Ceratitis capitata, known as the medfly (Tolias et al. 1990), and were found to amplify in
ovarian follicle cells. DNA puffs were also found in Rynchosciara americana. The
genes in the puffs encode a protein necessary for cocoon synthesis (Tolias et al. 1990).
A mature fly ovary consists of 16-20 ovarioles, each of which contains a string of
developing egg chambers. The posterior end of the ovariole is called the vitellarium and
the anterior end is called the germarium. The germarium contains germline and somatic
stem cell populations, where young egg chambers are generated. As the egg chambers
6
mature, they move into to the vitellarium and the mature egg eventually enters the
oviduct (Horne-Badovinac and Bilder 2005). The germline stem cells (GSCs) divide
asymmetrically to produce a cytoblast, which then undergoes 4 rounds of mitotic division
with incomplete cytokinesis and forms a germline cyst of 16 cystocytes. One of the
original two cells after the first mitotic division becomes the oocyte. The other 15 cells
develop into nurse cells, which deposit maternal mRNAs, organelles, proteins and
cytoplasm into the oocyte as it matures. The somatic stem cells (SSCs) produce the
follicle cell precursors, which encapsulate the 16-cell germline cyst as they pass through
the germarium.

Oogenesis can be divided into 14 stages based on the developing egg chamber
morphology. Up to stage 6, the follicle cells carry out normal mitotic cycles following
the size increase of the oocyte. Starting at stage 7, the whole follicle cell genome
replicates without exiting and reentering the s-phase, this process is known as the
endocycle. After four rounds of endocycle, the follicle cells become polyploid (16X).
7

Figure 1. Onion skin structure of chorion gene amplification (Tower 2004).

8
The chorion gene amplification begins at stage 10 following the last endocycle (Calvi
1999). DAFC-7F reaches its maximal amplification at stage 12. At stage 13, DAFC-66D
chorion gene amplification reaches its maximal level. At stage 14, shortly before the
eggs are laid, the follicle cells are degraded.

In order to understand chorion gene amplification regulation, scientists have taken
approaches including identifying cis- and trans-regulators, hormonal control and
signaling pathways. Mutations of genes required for chorion gene amplification result in
thin, fragile egg shells, and non-viable eggs. These phenotypes can be readily identified
under the dissecting microscopes. The chorion gene amplification level can be measured
by Southern blot or real-time PCR analysis of DNA isolated from egg chambers.
The identified trans-regulators of chorion amplification are summarized in Table 1.

Specifically, k43 is the homolog of yeast origin recognition complex (ORC) subunit orc2.
Hypomorphic k43 mutants showed defective chorion gene amplification phenotype,
whereas k43 null mutations are lethal (Landis et al. 1997). The discovery of k43
indicates the engagement of ORC in chorion gene amplification.
9
Cyclin E forms an active complex with the cyclin-dependent kinase cdk2. It was shown
that the oscillation of Cyclin E controls the S phase during endocycles (Lilly and
Spradling 1996). Persistent Cyclin E level at the end of the endocycle might contribute to
the repression of replication of the rest of the genome during chorion gene amplification
(Calvi et al. 1998). The cyclin E inhibitor decapo inhibits chorion gene amplification
when overexpressed, suggesting that Cyclin E/CDK is also required for amplification
(Calvi and Spradling 2001).

Orc1 is regulated by E2F, a transcription factor also identified as a trans-regulator of
chorion gene amplification. Overexpression of Orc1 increases replication activities in the
rest of the genome while chorion gene amplification is inhibited (Asano and Wharton
1999). Orc1 antibody staining has shown that Orc1 travels from throughout the genome
to only chorion gene loci at the endocycle-amplification transition at a striking rate
(Asano and Wharton 1999).

10
Hypomorphic chiffon mutants cause thin and fragile eggshells and were found to
eliminate chorion gene amplification (Landis and Tower 1999). The predicted chiffon
protein contains two domains related to the S.cerevisiae Dbf4 protein, which participates
in DNA replication origin firing and cell cycle progression (Landis and Tower 1999).
The chiffon gene is required for ORC2 localization to the chorion gene loci, which further
reveals its role in amplification initiation.

double-parked is required for chorion gene amplification (Underwood et al. 1990) and
encodes a protein related to the yeast Cdt regulator of DNA replication.

Drosophila Cdt localizes to chorion gene amplification loci (Claycomb et al. 2002), and
after the loading of ORC Cdt travels along with the replication fork (Claycomb et al.
2002).

11
geminin mutants showed an overamplification phenotype and ectopic amplification loci.
Geminin forms a complex with double-parked product Cdt and acts as a negative
regulator of DNA replication by preventing Mcm loading (Quinn et al. 2001; Mihaylov et
al. 2002).

Hypomorphic mcm6 mutants showed thin eggshell phenotype. Null mcm6 alleles are
lethal (Schwed et al. 2002).

E2F is a transcription factor family that regulates the G1 to S phase transition (Asano and
Wharton 1999). Drosophila contains two E2F members: E2f1 and E2f2, which forms a
functional unit with subunit Dp. E2f1 is required for cell cycle transition from G1 to S
phase by regulating multiple genes including orc1. Both E2f1 and E2f mutants showed
ectopic replication of the genome during amplification (Cayirlioglu et al. 2001; Royzman
et al. 2002). Recently, E2F was found to be the target of ecdysone and EcR:USP
complex during a genome-wide EcR:USP target mapping (Gauhar et al. 2009),
suggesting that it might be a mediator of hormonal regulation of amplification.
12
Table 1. Trans-regulators of chorion gene amplification.
Gene Gene product Proposed or known function
k43 ORC2 Binds origin DNA
cyclin E Cyclin E Activates cdk2 kinase
orc1 ORC1 Binds origin DNA
chiffon Dbf4-like Activates cdc7 kinase
double-parked Cdt
Replication initiation and
elongation
geminin Geminin Negative regulator
mcm6 Mcm6 Replication
E2f1, E2f2, dp and rb E2F S-phase transcription factor
Myb oncogene-like Myb complex
Recruit chromatin-modifying
complexes
humpty-dumpty Hd Replication

13
Drosophila Myb (Myeloblastosis) is a homologue of the human Myb oncoprotein.
Tightly associated with four additional proteins, Myb complex binds to two regulatory
elements of 3
rd
chromosome chorion gene s18: Amplification Control Element 3
rd

chromosome (ACE3) and ori-beta (Figure 3), and is required for chorion gene
amplification (Beall et al. 2002). Myb was found to be able to associate with ORC in
vivo. Myb mutants are lethal, suggesting its essential role in DNA replication.

humpty-dumpty mutants result in thin eggshells and reduced chorion gene amplification
(Bandura et al. 2005). The Hd protein peaks at late G1 and S phase and it responds to the
E2F1/Dp complex. Antibody staining showed that Hd often overlaps with ORC2,
implicating its role in origin licensing and initiation.

As shown above, many of the trans-regulators identified are components of the general
DNA replication machinery, indicating the resemblance of chorion gene amplification
and general DNA replication.
14
By using a modified P-element (PdL) mediated transformation, we performed a genetic
screen in order to identify more trans-regulatory proteins (Chapter 1). Several PdL
mutants showing increased or reduced amplification of the 3rd chromosome chorion gene
locus were found and analyzed.

The cis-regulatory sequences for the 3rd chromosome chorion gene locus have been
studied in greatest detail (Lu et al. 2001; Zhang and Tower 2004). By employing
germline P-element transformation, constructs carrying various deletion and mutations
were introduced back into Drosophila. The amplification level of those constructs
provided insights into the sequence requirements for 3rd chromosome chorion gene
amplification. Position effects were reduced or eliminated in those constructs by the
flanking transcriptional insulator SHWBS (suppressor of Hairy-wing protein binding
site).

A 320-bp region identified as amplification control element, 3rd chromosome (ACE3)
was found to be required for high level amplification and is sufficient for very low level
amplification (Delidakis and Kafatos 1989). Four amplification-enhancing regions
15
(AER) – A, B, C and D have stimulatory functions (Figure 5).
ACE3 has several subregions. Deletion of each subregion does not eliminate
amplification as completely as deleting the whole of ACE3, suggesting redundancy
among subregions (Orr-Weaver et al. 1989). Highly conserved sequences were found in
ACE3 that are shared in four Drosophila species: D.melanogaster, D. subobscura, D.
virilis, and D. grimshawi.

ori-β is the major replication origin during amplification, as confirmed by 2-D gel
analysis (Heck and Spradling 1990). There are two additional minor origins, ori-α and
ori-γ, where low frequency initiation occurs. Deletion analysis revealed that there are
two subregions in ori-β: a 5’ 140-bp region and the 226-bp A/T-rich β region (Zhang and
Tower 2004). A fragment containing only these two regions was sufficient for most of
the ori-β activities. The β-region of the ori-β contains some sequences homologous to
those of the ACE3 α-region. ORC binds to both ACE3 and ori-β (Austin et al. 1999).

Two constructs were generated to characterize the sequence requirement of ACE3 and
ori-β for amplification. The construct called Small Parent (SP) contains only the 320-bp
16
ACE3 and 840-bp ori-β, flanked adjacently by SHWBSs. SP was able to amplify, though
at a moderate level of ~8 fold, demonstrating that ACE3 and ori-β are sufficient for low-
level amplification (Lu et al. 2001). The Big Parent (BP) construct contains the 320-bp
ACE3, 1.2-kb s18 chorion gene and the 840-bp ori-β. The BP supported more efficient
amplification at 20 fold with minimal position effects (Zhang and Tower 2004) and was
chosen for the studies discussed below in Chapter 2. Additionally, the 140 bp from the 3’
of the 840-bp ori-β may have stimulatory function (Tower 2004), which is consistent
with the half-EcRE site found at 756-761 bp from 5’ of ori-β.

As discussed previously, multiple trans-regulatory factors for amplification (Table 1) are
subunits of ORC or ORC loading machinery. The cis-regulatory elements of s18 ACE3
and ori-β bind to ORC in vivo and in vitro (Austin et al. 1999). The evidence suggested
that ORC binding is essential for chorion gene amplification.

It was observed in Drosophila that ORC localizes to open chromatin (MacAlpine et al.
2010). Additionally, the affinity of ORC for negatively supercoiled DNA is 30-fold
higher (Remus et al. 2004). Three major DNA bent sites were identified in DAFC-66D,
17
Figure 2. 3rd chromosome chorion gene cluster.

18
one in the center of ACE3 and two in ori-β, respectively (Gimenes et al. 2009).
Therefore, DNA topology might play an important role in the amplification, possibly
through providing a platform for ORC and/or other replication machinery binding.
Extensive studies have suggested that negative DNA supercoils can be a result of
interaction of site-specific DNA-binding protein and a DNA template during transcription
(Leng and McMacken 2002).

During the late oogenesis, DAFCs are the only loci with active transcription while the
rest of genome remains silent. It is reasonable to argue that active transcription assists in
maintaining the open chromatin structure required for amplification.

Taking all the evidence together, our model for chorion gene amplification is the
combination of specific cis-regulatory origin sequences with nearby active transcription
as shown in Figure 3.

To characterize the role of transcription during amplification, we first used two
conditional overexpression systems to drive expression of Green Fluorescent Protein
19
(GFP) transgenes during oogenesis, and measured the transgene copy number. No
changes were observed, indicating that transcription alone is not sufficient for DNA
amplification. To test whether transcription is necessary for amplification, we made
point mutations in the TATA box of the s18 gene on BP construct to diminish its
transcription. Reduced amplification of constructs carrying TATA box point mutations
was observed, indicating that active transcription assists amplification.

Ecdysone (20-hydroxy-ecdysone) is a steroid hormone that fluctuates through fly
development and is known to directly regulate metamorphosis and to regulate many
additional aspects of the development. The hormone functions through the ecdysone
receptor (EcR) with its heterodimer partner Ultraspiracle (Usp, homolog of vertebrate
RXR). The EcR:USP complex mediates ecdysone signaling by binding to ecdysone
response elements (EcRE) in the DNA, usually a psudo-palindromic sequence. There are
three EcR isoforms, EcR-A, EcR-B1 and EcR-B2. They share a conserved C-terminus
and differ in their N-termini. EcR-A and EcR-B are under the control of different
promoters, whereas EcR-B1 and EcR-B2 result from alternative splicing
20
Figure 3. A model for chorion gene amplification.

21
(Riddiford et al. 2000). Extensive genetic studies have suggested that EcR-B isoforms
act as potent ligand-regulated transcriptional activators and EcR-A is a poor
transcriptional activator due to its lack of the activation function domain (Gauhar et al.
2009). One model of EcR:USP function is that they may function as repressor in the
absence of ecdysone by using co-repressor complexes. Upon hormone binding, they
recruit co-activator and eject co-repressor, therefore activating target genes (Gauhar et al.
2009).

During mid-oogenesis, ecdysone regulates developmental progression and the migration
and patterning of dorsal follicle cells, possibly through its downstream target genes such
as E74, E75 and BR-C (Buszczak et al. 1999; Tzolovsky et al. 1999; Kozlova and
Thummel 2000). It was also found that EcR activities are required for the endocycle-
amplification transition (Sun et al. 2008). Reduced chorion protein expression was
observed in EcR-B1 dominant-negative (DN) strains (Hackney et al. 2007).

Additionally, ecdysone induces transcription and amplification in Sciara salivary gland
(Foulk et al. 2006) as mentioned above. We have found two half EcRE sites (TCACGT)
22
65 bp upstream of s18 and near the 3’ of ori-β, respectively. All the evidence suggests
that ecdysone and EcR are highly related with chorion gene amplification.

To characterize whether EcR regulates chorion gene amplification by direct binding,
clustered point mutations were made on the BP construct at individual EcRE sites. The
mutated constructs showed reduced amplification level compared to BP, indicating that
the two EcRE sites are critical for supporting full-extent amplification, possibly as
mediators of EcR.

A network of pathways seemed to be involved in the regulation of EcR activities. The
Ras pathway has shown to limit EcR distribution in follicle cells (Hackney et al. 2007).
PI3K in the Insulin/IGF pathway promotes ecdysone signaling (Colombani et al. 2005).
Extended notch activities inhibit EcR during endocycle (Sun et al. 2008). Therefore,
several mutants from the Ras and Insulin/IGF pathways were tested for their effects on
chorion gene amplification.

23
In this thesis dissertation, I will discuss my attempts to better understand chorion gene
amplification, including screening for novel trans- regulators, exploring the relation
between amplification and transcription, and examining the hormonal control of
amplification.
24
Chapter 2. Conditional switches for extracellular matrix
patterning in Drosophila melanogaster

Co-authored by
1
: Arvinder Khokhar, Nan Chen, Ji-Ping Yuan, Yishi Li, Gary N. Landis,
Gregory Beaulieu, Harminder Kaur and John Tower
Molecular and Computational Biology Program, Department of Biological Sciences,
University of Southern California, Los Angeles, CA 90089-2910

1
My contribution to this paper includes the results shown in Figure 2; Figure 3‐
G, H and I; Figure 4‐A, B, C and D; and Table 1.
25
Chapter 2 Abstract
An F1 mutagenesis strategy was developed to identify conditional mutations affecting
extra-cellular matrix (ECM) patterning. Tubulogenesis requires coordinated movement of
epithelial cells and deposition of a multi-layered extra-cellular matrix (ECM). In the
Drosophila ovary, an epithelium of follicle cells creates the eggshells, including the
paired tubular dorsal appendages (DAs) that act as breathing tubes for the embryo. A P
element mutagenesis strategy allowed for conditional over-expression of hundreds of
genes in follicle cells. Conditional phenotypes were scored at the level of individual
mutant (F1) female flies. ECM pattern regulators were readily identified including
MAPK signaling gene ets domain lacking (fused DAs), Wnt pathway genes frizzled 3 and
osa (long DAs), Hh pathway gene debra (branched DAs), and transcription factor genes
sima/HIF-1a, ush, lilli, Tfb1, broad and foxo. In moving cells the [Ca++]/Calcineurin
pathway can regulate adhesion to ECM while adherens junctions link cells together.
Accordingly, thin eggshell and DA phenotypes were identified for the Calcineurin
regulator Calreticulin and the adherens junction component arc. Finally a tubulogenesis
defect phenotype was identified for the gene pterodactyl – homologous to the mammalian
Serine/Threonine Receptor Associated Protein (STRAP) that integrates the TGF-b and
26
PI3K/AKT signaling pathways. Because phenotypes can be scored in each mutant fly
before and after gene induction, this F1 conditional mutagenesis strategy should allow for
increased scale in screens for mutations affecting repeated (reiterated) events in adult
animals, including gametogenesis, movement, behavior and learning.
Chapter 2 Introduction
One of the most basic and astonishing features of human development is the
transformation of flat sheets of epithelial cells into tubes of various sizes, cell number and
branch structure – often in the absence of cell division or cell death. In response to
growth factors and/or inductive interactions with other cells, the epithelial sheet
undergoes oriented growth, cell movement, changes in the number of cell/cell contacts
(cell intercalation) and changes in contacts with the ECM. The resulting tubulogenesis
and branching morphogenesis creates the substructure of numerous tissues and organs,
including the neural tube, kidney, lung, breast, and circulatory system. In adults the
growth of new blood vessels (angiogenesis) is critical to wound healing as well as to
tumor progression. Tumor metastasis and tubulogenesis share the common basic features
of cell growth, cell movement and altered contacts with ECM. Consequently the same
growth factor and signaling pathways important in tubulogenesis are also implicated in
27
tumor progression (Glesne et al. 2006; Reya and Clevers 2005; van de Wetering et al.
2002). As such the genes and pathways controlling tubulogenesis are of intense interest
as possible targets for disease interventions in vivo and for controlling tissue and organ
culture in vitro (Meyer et al. 2004; Soriano et al. 2004).

Mammalian in vitro systems implicate several specific growth factors (GF) and signaling
pathways in tubulogenesis (summarized in Figure 1) (Han et al. 2004). For example,
when Hepatocyte Growth Factor is applied to primary cultured hepatocytes it binds the
Met Receptor Tyrosine Kinase and activates a signal cascade including MAPK
components and ETS-family transcription factors, and ultimately results in branching
morphogenesis (Rosario and Birchmeier 2003). Similarly, angiogenesis can be induced
in cultured cells by Vascular Endothelial Growth Factor acting through the PI3K/AKT
pathway and transcription factor ETS-1 (Lavenburg et al. 2003).

Drosophila is an excellent model for the study of genes affecting tubulogenesis
(Cabernard et al. 2004; Jung et al. 2005). The tracheae are the respiratory organ of
28
Drosophila and genes have been identified that are required for each step of tracheole
branching morphogenesis (Neumann and Affolter 2006; Petit et al. 2002; Samakovlis et
al. 1996). These studies identify several signaling pathways conserved in humans,
including the GF, TGF-b, Wnt and Hh pathways. The pattern of tubules of the Drosophila
wing vasculature (see Figure 3I) arises from another well-studied sequential gene action
(Crozatier et al. 2004; De Celis 2003). The Hh and TGF-b signaling pathways set up
positional information in the wing primordium and define the geometry of vein
placement. Homeodomain transcription factors are involved in specifying cells
competent for expression of Rhomboid, while Notch signaling pathway is involved in
further refining the boundaries of Rhomboid expression. The resulting pattern of
Rhomboid expression predicts the ultimate vein pattern. Rhomboid is a potent stimulator
of signaling through the EGFR pathway - which in turn promotes vein development.
Additional patterning steps include intervein differentiation and cross-vein development.
Intervein structure has been demonstrated to be dependent upon the Integrins - a family
of trans-membrane receptor proteins that link the ECM to the cytoskeleton, and that are
also involved in tracheole morphogenesis (Araujo et al. 2003; Levi et al. 2006).
29
Figure 1. Outline of signaling pathways affecting tubulogenesis.
Canonical pathway components are indicated in black. Details of Drosophila homologs
are indicated in blue. Genes identified in this study are indicated in red. The ETS domain
is

a DNA-binding domain that specifically interacts with sequences containing

the
common core trinucleotide GGA and is involved in

protein-protein interactions with co-
factors that help determine its

biological activity. RBPs, receptor binding proteins; ROS,
reactive oxygen species.

30
Figure 1, Continued.

31
The construction of the eggshell (chorion) by the Drosophila ovarian follicle cells is
emerging as a powerful model system in which to study tubulogenesis and ECM
patterning (Berg 2005; Kleve et al. 2006; Papadia et al. 2005; Tzolovsky et al. 1999).
The follicle cell epithelium surrounds the developing oocyte (see Figure 2C, D) and in
the absence of cell division synthesizes a multilayer ECM with a number of specialized
features (see Figure 3B, F). A subset of the dorsal/anterior columnar follicle cells detach
from the underlying oocyte and embark on a dramatic anterior migration to synthesize the
Dorsal Appendages (DAs). The DAs are the pair of large and elaborate gas-exchange
tubes that project out from the anterior of the eggshell. Another subset of follicle cells
synthesizes the tiny, tubular micropyle through which some intrepid sperm might pass.
Formation of these structures requires coincident signaling through the EGFR and TGF-
b. The migrating cells that generate Drosophila tracheoles and micropyles coordinate
their movement through reciprocal signaling events sometimes called “social
interactions” (Ghabrial and Krasnow 2006; Montell 2006). During tracheole branch
formation the epithelial cells compete for the lead-cell position in a process involving GF
and Notch pathway signals. The dynamic nature of tubulogenesis suggests that
32
Figure 2. DOX dependent gene over-expression in ovarian follicle cells.
Ovaries and stage-10 egg chambers were photographed under visible light source and
fluorescent light source and merged pictures are shown. The scale is indicated in the
lower left corner. (A) Ovaries dissected from female containing the GFP-reporter
insertion and rtTA(3)E2 insertion cultured in absence of DOX. (B) Ovaries dissected
from female containing the GFP-reporter and rtTA(3)E2 cultured in presence of DOX.
(C) Stage-10 egg chamber dissected from female containing the GFP-reporter and
rtTA(3)E2 cultured in absence of DOX. (D) Stage-10 egg chamber dissected from female
containing the GFP-reporter and rtTA(3)E2 cultured in presence of DOX. Results are
typical of multiple flies and experiments.

33
Figure 2, Continued.

34
Figure 3. Identification of conditional, dominant mutations affecting the eggshell.
(A) Scheme to identify conditional eggshell mutants. Crosses 1 and 2 were done en
masse in bottles. F1 females bearing new PdL insertions obtained from the same bottle in
Cross 2 could contain unique events or the same event and were named to reflect that
information. The mini-white+ gene in the rtTA(3)E2 insertion yields only an orange eye
color, and so new white+ PdL insertions could be identified in this background by a more
red or wild-type eye color. (B-H) Eggshell phenotypes. The indicated PdL mutant
strains were crossed to rtTA(3)E2 driver strain, and female progeny were cultured in the
presence and absence of DOX. The –DOX control eggs (B, F) are from strain edl
4M127

(as in C), however they are characteristic of the normal morphology of control eggs for
the other two lines shown (D and E), as well as most other PdL conditional eggshell
mutations. (I) Recessive wing phenotype of pterodactyl
2-4
insertion and excision
derivatives. Representative wings are presented from wild-type flies, and from flies
homozygous for the starting pterodactyl
2-4
insertion and homozygous for the indicated
excision (exc) derivatives. The class of pterodactyl

wing phenotype (mild, intermediate,
severe) is indicated.

35
Figure 3, Continued.

36
Figure 3, Continued.

37
Figure 3, Continued.

38
conditional mutations might be particularly useful for future genetic analyses, in that they
might allow for more fine-scale dissection of individual steps.

A number of important questions remain to be answered for each of the tubulogenesis
model systems, including how signals through the multiple pathways are integrated, and
how specific pathways activate specific tubulogenesis events at the level of the individual
cell. A remarkably small number of cell-intrinsic surface remodeling events can account
for the movements required for tubulogenesis and cell intercalation (Lecuit and Pilot
2003; Neumann and Affolter 2006; Pilot and Lecuit 2005). “Focal adhesions” are
specific contacts between the epithelial cell and the ECM involving Integrins and the
Actin cytoskeleton. Cell movement over an ECM involves membrane protrusions and
formation of new focal adhesions at the leading edge coordinated with disassembly of
adhesions at the rear. Within the moving cell there are directional changes in
Actin/Myosin polymerization, and endocytic shuttling of membrane components to the
leading edge. Cell intercalation additionally requires changes in the number and location
of “adherens junctions”, which are specialized connections between epithelial cells
involving Catenins, Cadherins, and the Actin cytoskeleton(Neumann and Affolter 2006).
39
GTPases such as Rho and nucleoside kinases including nm23 (awd) act downstream of
Wnt and other pathways to directly regulate cytoskeleton organization and membrane
dynamics in the moving cell (Dammai et al. 2003; Palacios et al. 2002).

Transposable elements with outwardly directed promoters are powerful tools for creating
mutations by over-expression and/or mis-expression of gene(s) near the insertion site, and
have been a rich source for mutations affecting development (Pena-Rangel et al. 2002;
Rorth et al. 1998; Tseng and Hariharan 2002). A Drosophila P type transposable element
called PdL contains a doxycycline (DOX)-inducible promoter directed outward from its
3’ end (Landis et al. 2001). New PdL insertions cause the DOX-dependent over-
expression of genes downstream of the insertion site, often hundreds of base-pairs away.
It is estimated that up to 1/3 of PdL insertions cause the over-expression of a downstream
gene. The gene over-expression often, but not always, results in a conditional mutant
phenotype. For example seven percent of PdL insertions are conditional larval lethal.
Because PdL mutations are both dominant and conditional they lend themselves to
efficient strategies for functional gene discovery. In these studies the conditional and
dominant nature of the PdL mutations was used to allow identification of interesting
40
phenotypes at the level of the individual F1 fly, thereby facilitating the screening of
larger numbers of events.
Chapter 2 Materials and Methods
General. Drosophila stocks and culture conditions are as previously described (Landis
et al. 2001; LANDIS et al. 2003). All experiments were performed using the rtTA(3)E2
driver strain.

Isolation of genomic DNA from PdL lines. DNA was isolated from PdL lines (50
female flies each) as previously described (Landis et al. 2001). It was further treated
with RNaseA for 15 min. at 37°C, followed by phenol/chloroform extraction. The DNA
was then precipitated, washed in 70% ethanol and dissolved in 50 µl of distilled water
and stored at -20°C.

Inverse PCR amplification of PdL flanking sequences. DNA equivalent to four flies
was restriction digested with Taq1 at 65°C for five hours. The DNA was extracted with
41
phenol/chloroform, precipitated with ethanol, dissolved in 100 µl of distilled water and
10 µl of this was treated with T4 DNA ligase overnight at 16°C. PCR amplification was
performed using primers Pry1 and IR as described (Landis et al. 2001). PCR protocol
was as follows: step 1, 94°C for 5 min; step 2, 96°C for 30 sec; step 3, 51°C for 1 min;
step 4, 72°C for 2 min; step 5, steps 2-4, repeat 39 times; step 6, 72°C for 10 min. PCR
product was sub-cloned into the PCR2.1-TOPO cloning vector (Invitrogen, San Diego).
Sequencing was carried out at University of Southern California Microchemical Core
Facility.

DNA sequence analyses. PdL flanking DNA sequences were used to query Genbank
databases using BLASTN program with default settings as provided at the NCBI web site
(http://www.ncbi.nlm.nih.gov/).

Northern analyses. Total RNA was isolated from adult female Drosophila using the
TRIZOL Reagent (Life Technologies) using standard protocol. RNA was fractionated on
1% formaldehyde gels and transferred to Gene Screen membranes (NEN, Boston, MA).
42
The DNA probe A for the edl gene (Figure 4A) was generated by PCR amplification
from Drosophila genomic DNA using primers “EDL38381F” (cctagtccttagttctgctc) and
“EDL39059R” (ccgttcgcaacgtttgagtt)). The DNA probe B for the 89 Amino Acid ORF
region (Figure 4A) was generated by PCR amplification from Drosophila genomic DNA
using primers “89ORF44621F” (ctgttggctcaataagcagg) and “89ORF45410R”
(tactgtaggtcagccatgtg).

The DNA probe C for the debra gene (Figure 4B) was generated by PCR amplification
from Drosophila genomic DNA using primers “dbrF” (gttccagcaacccaaatcccacaccg) and
“dbrR” (cctgctttaaatccacgattgagcag). The DNA probe D for the galacten gene was
generated by PCR amplification from Drosophila genomic DNA using primers
“galectinF” (caatgactctcgagatgtgg) and “galectinR” (acggattctgatagactcgc)).

The DNA probe E for the ush gene (Figure 4C) was obtained from a full-length cDNA
LD12631 (STAPLETON et al. 2002). The DNA probe F for the lwr gene was generated by
PCR amplification from Drosophila genomic DNA using primers “lwrF”
(tgctcgactgcacatttgc) and “lwrR” (cagtagagaagcgagcaag).
43
Figure 4. Molecular characterization of select mutations.
(A-D) Intron and exon boundaries of the mutated genes are indicated, with numbering
according to DNA sequences obtained from NCBI web site
(http://www.ncbi.nlm.nih.gov/). Locations for transcriptional initiation are indicated by
arrows. PdL inserts are indicated by triangles and each is oriented 5’ to 3’, as indicated
by internal arrows. DNA fragments used as probes in Northern analyses are indicated
above each diagram. (A) edl (genomic scaffold sequence AE003798.3). (B) dbr
(genomic scaffold sequence AE003590.3). (C) ush (genomic scaffold sequence
AE003589.3; SD5608 cDNA sequence is from accession #AI541608 in the NCBI
database. (D) foxo. (E-G) Northern analysis of selected lines. Oregon R wild-type strain
and the indicated PdL mutant strains were crossed to rtTA(3)E2 driver strain. Total RNA
was isolated from adult progeny cultured one week +/- DOX, transferred to Northerns
blots, and hybridized with the gene-specific probes indicated. Ribosomal protein 49 gene
Rp49 was used as control for loading. Two amounts of RNA were loaded for each
sample (1x and 2x, as indicated), and signals were visualized by phosphoimager. (E)
edl
4M127
mutant strains and controls. (F) dbr
3M1753
mutant strain and controls. (G) ush
3-

44
Figure 4, Continued.
38
mutant strains and controls. Galectin probe D downstream of gene dbr and lwr probe F
downstream of gene ush did not yield any altered signal +/- DOX, indicating that
transcription did not go beyond genes dbr and ush. The predicted sizes of the edl
4M127
,
dbr
3M1753
and ush
3-38
PdL transcripts (A-C) matched the measured sizes of the
corresponding +DOX transcripts (E-G).
45
Figure 4, Continued.

46
Figure 4, Continued.

47
Figure 4, Continued.

48
The loading control was ribosomal protein gene Rp49 (O'CONNELL and ROSBASH 1984).
DNA probes were
32
P-labelled using the Prime-It II DNA labeling kit (Stratagene).
Hybridization signals were scanned using the Phosphoimager (Molecular Dynamics) and
visualized using Imagequant program. Transcript size was determined by comparison
with 1 Kb RNA ladder (Gibco-BRL) according to the manufacturers instructions.

Electron microscopy. Scanning electron microscopy (SEM) was carried out at the
University of Southern California Center for Electron Microscopy and Microanalysis,
using a Cambridge 360 SEM. Samples were prepared using standard methods: Briefly,
young F1 female flies were cultured on food in the presence and absence of DOX for 10
days. The females were mated and fed yeast paste prepared with and without added
DOX for the last two days to boost egg production. The females were allowed to lay
eggs directly onto the SEM grid, and these were then sputter-coated with platinum and
examined in the SEM.

Expression of GFP in follicle cells. A transgenic reporter strain was generated in which
expression of eGFP is driven by the “tet-on” promoter in USC 1.0 vector (Allikian et al.
49
2002). The creation and characterization of the construct and strains will be described in
detail elsewhere (Nicholas Hoe and J.T., manuscript in preparation). Males from the
eGFP strain were crossed with rtTA(3)E2 females and progenies (F1) were collected that
contained both constructs. F1 female flies were cultured on food in the presence and
absence of DOX for 10 days before dissection and microscopy. The females were mated
and fed yeast paste prepared with and without added DOX for 2 days before dissection to
boost egg production. Ovaries and stage 10 egg chambers were dissected in 1X PBS
buffer at room temperature and GFP images were generated using the Leica MZ FLIII
fluorescence stereomicroscope and SPOT image capture system and software according
to the manufacturers instructions.

Mobilization of P element insertion in the pterodactyl mutant line.
Females homozygous for the PeterodactlylPdL2-4 insertion, genotype y-ac-w;PdL2-4
were crossed to males from a line containing a source of P element transposase
(Robertson et al. 1988), genotype Sp/Cyo;delta2-3 Sb/TM2 Ubx. The first generation
male flies containing both PdL and the delta2-3 transposase were collected and crossed to
50
second chromosome balancer females, genotype y-ac-w;Sp/CyO. From the offspring,
twelve single males with PdL excision (loss of white+ marker) were identified, each from
a different vial and therefore representing independent events. These twelve excision
chromosomes were made homozygous by crossing to second chromosome balancer
stock.

Chapter 2 Results and Discussion
In the rtTA(3)E2 transgenic strain, the artificial transcription factor rtTA is expressed in
all somatic cells using the powerful Actin 5C gene promoter (Bieschke et al. 1998). The
rtTA protein will bind to its target site (tetO) and activate transcription only in the
presence of DOX. To confirm efficient induction of target gene transcription in the
ovary, a tetO-GFP reporter construct was assayed in adult females that had been cultured
+/-DOX in the food for 10 days. Fluorescence microscopy of dissected ovaries
confirmed DOX-dependent expression of GFP in the follicle cells at all stages of
oogenesis (Figure 2). Particularly abundant expression was present at stage 10 of
oogenesis in the columnar follicle cell epithelium surrounding the oocyte (Figure 2D).
51
GFP could also be readily detected in the squamous follicle cells stretched over the nurse
cells, and in the migrating border follicle cells. As expected, little-to-no GFP expression
could be detected in the nurse cells or oocyte. Transgenic constructs are not efficiently
expressed in Drosophila germ-line cells unless they contain specific germ-line
transcription and RNA processing elements (Rorth 1998). As a consequence, the tetO
promoters are not efficiently expressed in the germ line cells, and any PdL mutant
phenotypes should result from gene over-expression in the somatic follicle cells.

A PdL insertion on the second chromosome was mobilized to approximately 3,000 new
chromosomal insertion sites by crossing to a strain that expresses the P element
transposase (Figure 3A). The strains and crossing strategy are designed to minimize time
and effort and allow for simultaneous mutagenesis of each of the five Drosophila
chromosomes (X, Y, 2, 3, 4) using only two crosses performed en masse. Progeny are
generated in Cross 2 that contain a new PdL insertion as well as the rtTA(3)E2
transactivator, and these flies are referred to as F1. A single Drosophila female is capable
of laying hundreds of eggs throughout her lifetime. Each of 3,000 F1 females bearing a
new PdL insertion was cultured individually in the absence of DOX for several days so
52
that normal, viable eggs were laid, and the event could be recovered later if desired. The
female was then serially transferred to culture vials containing DOX over several days,
and the last two vials were inspected for the presence of eggs with abnormal shells using
the dissecting microscope. DOX treatment and any subsequent gene over-expression was
for a minimum of 10 days before scoring of eggshells (Figure 3A), and therefore based
on typical times for progression through stages of oogenesis, the follicle cells have
potentially been over-expressing the gene from the time of stem-cell division through
completion of eggshell synthesis (Margolis and Spradling 1995). Out of 3,000 females
scored, 190 failed to lay eggs, or produced eggs that were abnormal in the presence of
DOX. Stable PdL insert lines were successfully established from the early-laid, normal
eggs for 170 of the females. Conditional eggshell phenotypes were confirmed for 140
strains by testing cohorts of females from each strain in parallel, in the presence and
absence of DOX. The gene downstream of the PdL insertion site was identified for
patterning-defect lines by inverse PCR and sequencing (Table 1). For selected genes
DOX-dependent over-expression was confirmed by Northern blot (Figure 4). It was
previously observed that PdL-directed transcription and over-expression does not extend
beyond the terminator of the first gene downstream (3’) of the PdL insertion site (i.e., no
53
detectable “read-through”) (Landis et al. 2001; Landis et al. 2003), and that result was
confirmed here for genes dbr and ush using Northern analysis and downstream probes.
Numerous mutations were recovered that altered ECM patterning, some with quite
specific effects on tubulogenesis (Figure 3, Table 1). A PdL insertion was mapped 69 bp
upstream of edl gene and DOX-dependent over-expression of the gene was confirmed by
Northern blot (Figure 4A, E). Probe A located in the edl coding region hybridized to
RNA species of approximate sizes 1.2kb, 2.4kb and 4.4kb, while probe B located
upstream of the PdL insertion did not hybridize to any detectable RNA species in the
presence or absence of DOX (data not shown). Over-expression of edl caused a dramatic
fusion of the DAs (Figure 3C). The edl gene encodes a negative transcription factor that
antagonizes Pointed, and over-expression of edl has previously been shown to yield fused
DAs (Yamada et al. 2003). At least nine genes are known to give rise to the same
phenotype when they are mutated to loss-of-function (Berg 2005): The products of the
toucan, egghead, brainiac and fringe genes all modify the Notch receptor, while the
products of the Spitz, argos and vein genes each encode EGFR ligands. Finally, pointed
encodes an ETS-domain transcription factor activated by EGFR signaling (summarized in
Figure 1). The data are consistent with a model in which Notch signaling and EGFR
54
Table 1. New PdL mutations with pattern defects
Gene ID number Alleles Functions Egg phenotype
bad egg (beg) CG7842 18 Fatty acid synthesis Thin shell
cracked (ckd) CG14959 12 ? Thin shell, short DA
debra (dbr) CG11371 9 MVB, Hh signaling Thin shell, branched
DAs and micropyle
ets domain
lacking (edl) CG15085 2 GF signaling Fused DAs
foxo CG3143 1 Txn factor, AKT pway Thin shell, short DAs
ushaped (ush) CG2762 1 Txn factor Thin shell, short DAs
Tfb1 CG8151 1 Txn factor Thin shell, long DAs
arc (a) CG13505 1 Adherens junction DAs folded
lilliputian
(lilli) CG8817 1 Txn factor Thin shell, long DAs
55
Table 1, Continued.
Calreticulin
(Crc) CG9429 1 ER, protein folding Thin shell, short DAs
peg CG8583 1 SRP, protein folding Thin shell, short DAs
pterodactyl
(pter) CG3957 1 TGF-b signaling Long DAs
veil CG4827 1 5'-nucleotidase Thin shell, short DAs
frizzled 3
(fz3) CG16785 1 Wnt signaling Long DAs
osa CG7467 1 Txn factor, Wnt signaling Abnormal DAs
broad (br) CG11491 1 Txn factor Thin shell
similar (sima) CG7951 1 Txn factor, HIF-1a homolog Abnormal DAs
Spargel CG9809 1 PEP-dependent sugar phosphotransferase system,
PPAR-gammaC1A homolog Long DAs

56

Table 1, Continued.
eIF3-S10 CG9805 1 Translation initiation Short DAs
- CG3563 1 ? Long DAs
- CG13012 1 ? Long DAs
- CG2127 1 ? Long DAs
- CG2909 1 ? Long DAs
- CG4815 1 Chymotrypsin-like Thin shell, short DA
- CG31246 1 ? Thin shell, long DAs
l(3)neo26 CG6874 1 ? Long DAs
- CG33188 1 ? Long DAs
- CG15160 1 ? Long DAs

57
signaling through Pointed cooperate to specify the midline branch that results in two
distinct DAs (Ward et al. 2006).

Over-expression of debra (dbr) yielded a novel phenotype characterized by multi-
branched DAs and multi-branched micropyle (Figure 3D). PdL was mapped 98 bp
upstream of debra gene and over-expression was confirmed by Northern blot (Figure 4B,
F). Debra is a component of the multivesicular body (MVB) - a type of late endosome in
which regions of the limiting endosomal membrane invaginate to form internal vesicles.
Membrane proteins are targeted to the vesicles by ubiquitination and are sequestered
from the cytoplasm. The MVB functions in down-regulation of membrane receptor
signaling. Debra has been shown to mediate the ubiquitination and lysosomal destruction
of the Hh pathway target transcription factor Ci during wing development (Dai et al.
2003). The phenotype observed here in the ovary suggests that Hh pathway signaling
and Ci factor activity might favor branching.

The TGF-b and AKT pathways are critically implicated in tubulogenesis, but it is not
known how these signals are integrated at the level of the individual epithelial cell. In
58
mammals a WD-40 repeat-containing protein called STRAP has been identified that
bridges these pathways (Datta et al. 1998; Datta and Moses 2000; Seong et al. 2005).
STRAP interacts physically with both Type I and II receptors and SMAD7 and inhibits
TGF-b signaling, while in turn it physically interacts with PI3K and stimulates the AKT
pathway (summarized in Figure 1). A PdL insertion was mapped at 3bp upstream of the
Drosophila homolog of STRAP, here designated pterodactyl (pter).

Over-expression

of
pterodactyl in the follicle cells caused overly-long DAs (Figure 3G), while a homozygous
pterodactyl insertion (pter
2-4
) showed a loss-of-function phenotype of mild wing vein
defects (Figure 3I). The fact that pterodactyl over-expression and loss-of-function both
affect branching morphogenesis supports the conclusion that the mutagenesis strategy is
identifying true tubulogenesis regulators and not merely creating neomorphic effects via
unrelated genes. The pter
2-4
insertion PdL insertion was mobilized using P element
transposase, and twelve lines were generated where the mini-white+ marker gene in PdL
had been lost, indicating partial or complete loss of the pter
2-4
insertion. Each excision
derivative was homozygous viable, and had wing vasculature defects that were more
severe than the starting pter
2-4
insertion: Specifically there was increased presence of
ectopic wing vasculature. Relative to the mild phenotype of the starting pter
2-4
mutation,
59
seven of the new excision mutations (lines 1, 2, 6, 8, 9, 10 and 12) had an intermediate
phenotype, while five lines (3, 4, 5, 7, 11) had a severe phenotype (Figure 3I). Mutations
from both the intermediate and severe class had the same wing phenotype when
heterozygous to the starting pter
2-4
mutation. The data support the conclusion that the
starting pter
2-4
mutation is indeed caused by an insertion of the PdL element marked with
mini-white+. Moreover the lack of excision events with wild-type wing phenotype
suggests that the starting pter
2-4
insertion might have a complex structure that precludes
reversion to wild type, such as an associated deletion, and it may be useful to further
characterize this mutation in the future.

Over-expression of several transcription factor genes resulted in thin eggshells, including
ush, foxo, lilli and Tfb1 (Table 1; Figure 3E, H). Ush is a Zinc-finger transcription
factor that acts downstream of TGF-b signaling during embryogenesis, and cooperates
with another transcription factor, Pnr, to regulate Wnt expression (Fossett et al. 2001).
Over-expression of ush caused thin eggshells and small, short DAs, while positioning of
the DAs appeared relatively normal (Figure 3E). The presence of an upstream promoter
and alternative transcript for the ush gene is suggested by the location of the PdL
60
insertion and the location of the 5’ end of the SD5608 cDNA sequence found in Genbank
database (Figure 4). The ush coding region probe (probe E) hybridized to both a 4.4KB
and 7.5KB transcript induced by DOX, suggesting that the large intervening sequence
(30KB) was spliced out and that the transcript from the upstream promoter is being over-
expressed along with possible alternative splicing. The transcription factor Foxo acts
downstream of insulin-like signaling, AKT/PI3K signaling, and JNK signaling pathways
to regulate metabolic activity and growth in Drosophila and other species (Vogt et al.
2005), and over-expression of Foxo caused short DAs and thin eggshell (Figure 3H).
Lilli is the only member of the Fragile X/Burkitt’s lymphoma family of transcription
factors found in Drosophila. The lilli gene is required for normal cytoskeleton
organization, cell size and embryo segmentation and interacts genetically with each of
the Wnt, AKT and EGFR pathways (Gu and Nelson 2003; Su et al. 2001; Tang et al.
2001; Wittwer et al. 2001).

Wnt signaling is critical for tubulogenesis and has several direct cytoskeletal targets
relevant to moving cells (summarized in Figure 1). Overexpression of the antagonistic
Wnt receptor gene fz3 (Chen et al. 2004) caused overly-long DAs (Table 1). Wnt
61
signaling through GSK3 is known to directly modify b-Catenin, which in turn acts both
as a transcription factor and a component of the adherens junction. DA structure was
disrupted by over-expression of arc which encodes a component of the adherens junction,
and osa which is a Wnt pathway trancription factor target. GTPases such as Rho and
nucleoside kinases including nm23 (awd) act downstream of Wnt and other pathways to
directly regulate cytoskeleton organization and membrane dynamics. In Drosophila
nm23 has been shown to regulate tracheal cell motility and FGFR recycling (Dammai et
al. 2003). Over-expression of a gene designated veil caused thin eggshells and short
DAs. The veil gene is predicted to encode a 5’-nucleotidase and over-expression of veil
can affect growth of mutant cells in the wing (Raisin et al. 2003). Taken together the
data suggest a possible role for veil in the [GTP] signaling pathway (summarized in
Figure 1).

The [Ca++]/Calcineurin pathway regulates Integrin gene expression, as well as focal
adhesion assembly/disassembly and recycling of Integrin proteins to the leading edge of
many types of moving cells (summarized in Figure 1). Calreticulin is a Ca++ binding
protein thought to function as a molecular chaperone component of the endoplasmic
62
reticulum (ER) quality control machinery and in exocytosis. In mice Calreticulin has
been found to be a critical regulator of Calcineurin activity, particularly important in
development of the heart (Lynch et al. 2005). Here over-expression of Drosophila
Calreticulin gene was found to cause both thin eggshells and short DAs, consistent with a
role in ECM patterning. A similar thin eggshell and short DA phenotype was observed
for over-expression of a gene designated peg. The peg gene encodes a homolog of a
signal recognition particle (SRP) factor involved in protein folding at the ER, and it is
tempting to speculate that peg might also act in the Calcineurin pathway.

One common aspect of Drosophila DAs, Drosophila tracheoles, human lungs, and human
vasculature is they all serve as tubular conduits for oxygen supply to various tissues. It is
then perhaps no surprise that cellular oxygen-sensing pathways are found to affect the
development of these structures. Mammalian HIF-1a regulates cellular metabolism and
transcription in response to oxygen concentration and functions in angiogenesis (Kim et
al. 2006; Papandreou et al. 2006). The Drosophila homolog of HIF-1a (Sima) (Nambu
et al. 1996; Reiling and Hafen 2004) regulates tracheole branch extension and
termination. Here over-expression of HIF-1a (Sima) was found to affect DA length and
63
structure (Table 1). Intriguingly, the Foxo transcripton factor implicated here as a
regulator of DA length is also involved in oxygen-stress sensing pathways in various
organisms (Lehtinen et al. 2006; Wolff et al. 2006).

In summary, while it is possible that one or more of the genes identified in this study
represent a non-specific background, many of the mutations were found to affect
pathways critical for ECM patterning and should be useful reagents for further genetic
analyses (summarized in Figure 1). Mutations were identified in genes known to be
essential for DA formation such as broad (Chen and Schupbach 2006; Deng and Bownes
1997; Tzolovsky et al. 1999), as well as new genes. Both over-expression and loss-of-
function tubulogenesis phenotypes were identified for the potentially important signaling
gene pterodactyl (related to mammalian STRAP) - for which no mutant phenotype had
previously been available. In addition, phenotypes could be observed for genes that have
no detectable loss-of-function phenotype such as fz3. The set of ECM patterning genes
identified here overlaps and complements those identified for trachea development.
Finally, since many interesting genes were hit only once, it is likely that this screen
(3,000 insertions) has only scratched the surface of potential ECM regulatory
64
switches.The P element has allowed numerous types of genomic alterations and
engineering, such as germ-line transformation, targeted deletions, local transposition and
enhancer-trapping (Bellen et al. 2004). In the past the low frequency of mutation has
limited the feasibility of large-scale P element screens. As shown here the dominant and
conditional nature of PdL mutations allows for increased scale through the scoring and
recovery of conditional mutations at the level of the individual (F1) mutant fly.
Saturation-type P element screens (50-100,000 events) should be possible in the future
for groups interested in identifying Drosophila mutations affecting ECM patterning and
other reiterated events in the adult such as gametogenesis, movement, behavior and
learning.

Chapter 2 Acknowledgements
We thank Andy Dillin for suggesting the name pterodactyl. This research was supported
by grants from the Department of Health and Human Services to JT (GM48449,
AG11833). The manuscript is dedicated to the memory of Harminder Kaur.
65

Chapter 3. Ecdysone receptor and chorion gene transcription
regulate chorion gene amplification
Nan Chen and John Tower, Molecular and Computational Biology Program, Department
of Biological Sciences, University of Southern California, Los Angeles, CA 90089-2910.

Chapter 3 Abstract
Developmentally regulated amplification of the 3
rd
chromosome chorion gene locus
occurs in the somatic follicle cells of the ovary, and proceeds through repeated firing of
bidirectional chromosomal DNA replication origin(s). Transgenic constructs containing
appropriate chorion gene locus sequences will amplify normally in the follicle cells,
allowing for mapping of cis-regulatory elements. Efficient amplification requires the
“ACE3” replicator element located immediately 5’ to the S18 chorion gene, as well as the
sequence-specific origin “ori-beta” located immediately 3’ of S18, and amplification
levels are stimulated by the presence of S18. Experiments were conducted to investigate
the possible role of S18 gene transcription in the process of amplification. Activated
66
expression of a heterologous transgene (GFP) in the follicle cells did not result in GFP
sequence amplification, consistent with the conclusion that active transcription is not
sufficient to direct amplification in the absence of ACE3 and ori-beta. However, in
constructs containing ACE3, S18 and ori-beta, mutation of the S18 gene’s TATA box
reduced both transcription and amplification levels, as did mutation of binding motifs for
the ecdysone receptor transcription factor located in the S18 promoter and in ori-beta.
Moreover, amplification was reduced by conditional inactivation of ecdysone receptor
expression using RNAi, and by conditional over-expression of specific ecdysone receptor
isoforms and dominant negative mutants. Taken together, the data suggest that
developmentally regulated activation of S18 chorion gene transcription by the ecdysone
receptor acts in concert with ACE3 to stimulate the firing of the downstream origin ori-
beta. Finally, a gene over-expression screen identified several novel positive and
negative regulators of amplification.

Chapter 3 Introduction
Several lines of evidence indicate an intimate connection between the regulation of gene
transcription and the regulation of eukaryotic chromosomal DNA replication origins
67
(Hamlin et al., 2008; Kohzaki and Murakami, 2005; Tower, 2004). Eukaryotic DNA
replication origins were first characterized in DNA tumor viruses, where the same trans-
acting factors can regulate both processes, for example the SV40 virus T antigen. In
yeast, Drosophila and mammalian cells, the timing of DNA replication in S phase
correlates with transcriptional activity, in that transcriptionally active regions of the
chromosome tend to replicate early in S phase, while transcriptionally inactive regions
tend to replicate towards the end of S phase (MacAlpine and Bell, 2005). In the highly-
studied mammalian DHFR locus origin region, the promoter of the DHFR gene appears
to act as a replicator element, in that it stimulates the firing of origins located 3’ to the
DHFR gene (Saha et al., 2004).

Developmentally regulated gene amplification provides an ideal model system to study
the regulation of chromosomal DNA replication origins, and the potential role of
transcription in regulating the origins (Cavaliere et al., 2008; Tower, 2004).
Developmental gene amplification produces an increased number of templates for
transcription, allowing for increased expression of genes at the amplified loci.
Amplification is generally observed with genes that are highly transcribed and where the
68
developmental program requires a large amount of those gene products within a small
interval of time. Amplification proceeds through repeated firing of one or more origins
located near the genes, while the rest of the genome replicates to a lesser extent, or not at
all. In this way amplification is an exception to the once-and-only-once rule of DNA
replication. In Drosophila the eggshell (chorion) genes undergo amplification in the
follicle cells of the ovary to allow for rapid eggshell synthesis. In Sciara genes in larval
salivary gland cells undergo amplification to meet the demand for pupal case proteins,
whereas Tetrahymena amplifies its rRNA genes several thousand fold during the creation
of the macronucleus. Comparisons of these systems suggest a conservation of trans-
regulators and sequence-specific cis-regulatory replicator and origin elements, and a
regulatory role for gene transcription and chromatin structure at the origins. During
Tetrahymena rDNA amplification the genes of the macronucleus are first endoreplicated
about 45-fold, and then the highly transcribed rDNA locus is specifically amplified
several hundred more-fold while replication of the rest of the genome ceases (Kapler,
1993; Mohammad et al., 2003). Similarly, in Drosophila and Sciara, cells exit the
mitotic cell cycle and enter a specialized cell cycle of alternating S and G phases called
the endocycle. During the endocycle genomic replication occurs without cell division,
69
resulting in polyploid cells (Edgar and Orr-Weaver, 2001; Smith and Orr-Weaver, 1991).
Subsequently, genome-wide replication ceases and initiations become limited to origins
at the loci undergoing amplification. Notably, in Drosophila, down-regulation of Notch
pathway signaling and up-regulation of the ecdysone receptor (EcR) transcription factor
are required for the developmentally regulated transition from endocycle replication to
amplification in the follicle cells (Sun et al., 2008). Additionally, the transcription factors
Myb, E2F1 and Rb have been found to regulate chorion gene amplification (Beall et al.,
2002; Bosco et al., 2001).

Drosophila chorion gene amplification regulatory sequences have been studied in detail
for the 3
rd
chromosome chorion gene cluster (Cavaliere et al., 2008; Orr-Weaver, 1991;
Tower, 2004). The cis-regulatory sequences were mapped by introducing mutated
constructs into Drosophila chromomes via P element mediated transformation, and
assaying for amplification of such constructs in the follicle cells. Amplification is subject
to severe chromosomal position effects, and only ~1/3 of insertion sites permitted
amplification of transgenic constructs to proceed. To allow for mapping of cis-regulatory
sequences, previous studies involved the assay and statistical analysis of large numbers of
70
transgenic lines for control and mutant constructs (Orr-Weaver et al., 1989), and/or
creation of a series of deletions of one large transgenic construct by imprecise
transposase-induced excision events (Delidakis and Kafatos, 1987). Efficient
amplification was found to require a 320 bp element called ACE3 (for Amplification
Control Element, 3rd Chromosome), as well as several stimulatory regions (or
“Amplification Enhancing Regions”) AER-A, AER-B, AER-C and AER-D (see Figure
5A). Using 2D gel analysis of DNA replication intermediates (Brewer and Fangman,
1987) AER-D was found to coincide with the location of the major origin of replication
that is active during amplification, called ori-beta (Delidakis and Kafatos, 1989; Heck
and Spradling, 1990; Lu et al., 2001; Zhang and Tower, 2004), while a smaller number of
replication forks was observed to initiate more distally, likely from the AER-A, AER-B
and AER-C stimulatory regions. Therefore, amplification of the endogenous 3
rd

chromosome chorion gene locus proceeds through the firing of several origins
interspersed among the chorion genes, with the majority of the initiations occurring at
ori-beta.

71
The sequences regulating chorion gene amplification are not required for chorion gene
transcription, for example, ACE3 was not essential for S18 gene transcription (Orr-
Weaver et al., 1989). In contrast, several lines of evidence suggest the possibility that
chorion gene transcriptional regulatory sequences might stimulate amplification. We have
found that placing transcriptional insulator elements flanking the chorion locus sequences
in transgenic constructs greatly reduces chromosomal position effects (Lu and Tower,
1997), allowing for more detailed analysis of cis-sequence requirements (Lu et al., 2001;
Zhang and Tower, 2004), and thereby implicating chromatin structure in the regulation of
the origin. A construct containing ACE3, S18 and ori-beta flanked by insulators (called
“Big Parent” construct, or “BP”) will amplify at relatively high level (~20 fold) at
virtually all insertion sites, and in this construct all of the detectable initiation events
occur at ori-beta (Lu et al., 2001). Deletion of the S18 sequences from BP caused reduced
amplification (to ~8 fold), and the construct was now subject to negative chromosomal
position effects, despite the presence of the flanking insulators (Zhang and Tower, 2004).
One possibility is that active transcription of S18 plays a stimulatory role in
amplification, and consequently several experiments were undertaken to investigate the
possible role of S18 gene transcription in regulating chorion gene amplification.
72
The steroid hormone ecdysone is required for the normal progression of oogenesis, and
acts through the ecdysone receptor (EcR), which is a member of the nuclear receptor
superfamily (Koelle et al., 1991). EcR becomes functional by forming a heterodimer
with Ultraspiracle, which is another member of the nuclear receptor superfamily, and a
homolog of the vertebrate retinoid X receptor (RXR) (Oro et al., 1990; Yao et al., 1992).
There are three EcR protein isoforms in Drosophila: EcR-A, EcR-B1 and EcR–B2, that
originate from a single gene (Koelle et al., 1991; Talbot et al., 1993). EcR-A and EcR-B
arise from different promoters, whereas EcR-B1 and EcR–B2 result from alternative
splicing. The three EcR protein isoforms share a conserved C- terminus and DNA-
binding domain (DBD), but vary in their N-termini. The EcR-B isoforms may be more
potent transcriptional activators than EcR-A. The EcR:USP heterodimer binds to DNA at
EcR response elements (EcREs), which are imperfect palindromes (spacing 1) of the
half-site motif AGGTCA. This motif is related to the hexameric motif TCACGT that is
present in the promoters of all the chorion genes, and that has been shown to bind to USP
and be required for normal expression of chorion gene S15 (Mariani et al., 1996). In the
absence of ligand, EcR:USP acts as a transcription repressor and silences target genes
73
(Hu et al., 2003; King-Jones and Thummel, 2005). Upon binding to ecdysone, the
EcR:USP complex becomes a transcriptional activator of target gene transcription.
EcR is found in both Drosophila germ line cells and somatic follicle cells throughout
oogenesis (Riddiford et al., 2000; Tzolovsky et al., 1999). EcR-A and USP are present in
follicle cells throughout oogenesis, EcR-B2 is preferentially expressed in the basal
follicle cells that develop into the basal stalk, and EcR-B1 was not observed during
oogenesis. Because EcR is implicated in normal chorion gene expression, alteration of
EcR activity provides a potential means to investigate the role of chorion gene
transcription in the process of chorion gene amplification.

Chapter 3 Materials and methods
Drosophila melanogaster strains
The generation of PdL mutant strains was described previously (Khokhar et al., 2008).
UAS-EcR transgenic lines for protein over-expression and RNAi were obtained from
Bloomington Drosophila stock center. The strains w[*]; P{w[+mC]=UAS-
EcR.A.W650A}TP5, w[*]; P{w[+mC]=UAS-EcR.A.F645A}TP2, w[1118];
74
P{w[+mC]=UAS-EcR.B1-DeltaC655.F645A}TP1, w[1118]; P{w[+mC]=UAS-EcR.B1-
DeltaC655.W650A}TP1-9, w[*]; P{w[+mC]=UAS-EcR.B2.W650A}TP5, and w[*];
P{w[+mC]=UAS-EcR.B2.F645A}TP1 are as previously described (Cherbas et al., 2003).
The strains w[*]; P{w[+mC]=UAS-EcR.A}3a, w[*]; P{w[+mC]=UAS-EcR.B1}3b,
w[*]; P{w[+mC]=UAS-EcR.B2}3a, w[1118]; P{w[+mC]=UAS-EcR-RNAi}97,
w[1118]; P{w[+mC]=UAS-EcR.B1.dsRNA}168, and w[1118]; P{w[+mC]=UAS-
EcR.A.dsRNA}91 are as previously described (Roignant et al., 2003). The “Ultra-GFP”
strain contains multiple copies of a UAS-2xEGFP construct on both the second and third
chromosomes, and its construction and characterization have been previously described
(Yang and Tower, 2009). The tissue-general drivers for the Geneswitch system w[1118];
Act-GS-255B and for the Tet-on system w[11118]; rtTA(3)E2/TM3 are as previously
described (Ford et al., 2007).

DNA constructs and generation of transgenic lines
All point mutations were generated using the “Big Parent” (BP) construct (Lu et al.,
2001; Zhang and Tower, 2004). Clustered point mutations were made using the
Stratagene QuikChange Lightning Site-Directed Mutagenesis Kit. All numbering
75
describing mutation positions is relative to the start site (+1) for s18 gene transcription.
The mutagenesis primers are as follows, with the point mutations indicated in bold with
underline:
TATA box: 5'-cctctgcctggatctggtacgaaaacaaaacattgcgcca-3'
TATA box-antisense: 5'-tggcgcaatgttttgttttcgtaccagatccaggcagagg-3'
EcRE 1: 5'-gaaacttgcatcatattcggcccgtaagagttgggcctctg-3'
EcRE 1-antisense: 5'-cagaggcccaactcttacgggccgaatatgatgcaagtttc-3'
EcRE 2: 5'-aacagaacaattagtgtatatagggcccgtaaatgtccaggctaaaatttg-3'
EcRE 2-antisense: 5'-caaattttagcctggacatttacgggccctatatacactaattgttctgtt-3'
All mutagenesis primers were HPLC-purified. The final constructs were named BP-
EcRE1, BP-EcRE2, BP-EcRE1+2 and BP-TATA. The mutation-carrying plasmids were
restriction mapped to confirm the presence of all chorion locus sequences and the
presence of the point mutations was confirmed by sequencing. The “BP-pt1” primers
were used for sequencing the mutated region in BP-EcRE1 and BP-TATA, and the “BP-
pt2” primers were used for sequencing the mutated region in BP-EcRE2:
76
BP-pt1-F: 5’ GAGGCGAGGCCTGGAACTGC 3’
BP-pt1-R: 5’ GGACGCAGTTGAGGTGTTGAGGT 3’
BP-pt2-F: 5’ TCACCACCCAACACCCGGTA 3’
BP-pt2-R: 5’ TGATTTACCGACCAGAAACGCTCG 3’
Transgenic lines were generated using P-element-mediated germline transformation. All
transposons were injected into embryos of yw;delta2-3 Ki recipient strain (GenetiVision,
Houston, Texas, 77054). For each construct three independent transgenic lines were
generated. BP: w[1118]; P{w[+mC]=BP}6A, w[1118]; P{w[+mC]=BP}27B, and
w[1118]; P{w[+mC]=BP}35A. BP-EcRE1: w[1118]; P{w[+mC]=BP-EcRE1}31B,
w[1118]; P{w[+mC]=BP-EcRE1}50A, and w[1118]; P{w[+mC]=BP-EcRE1}80A.
BP-EcRE2: w[1118]; P{w[+mC]=BP-EcRE2}16B, w[1118]; P{w[+mC]=BP-
EcRE2}31D, and w[1118]; P{w[+mC]=BP-EcRE2}33A. BP-EcRE1+2: w[1118];
P{w[+mC]=BP-EcRE1+2}1A, P{w[+mC]=BP-EcRE1+2}24A, and w[1118];
P{w[+mC]=BP-EcRE1+2}24B. BP-TATA: w[1118]; P{w[+mC]=BP-TA}19A,
w[1118]; P{w[+mC]=BP-TA}42A, and w[1118]; P{w[+mC]=BP-TA}50A.
77
RNA purification and quantitative real-time PCR (qPCR)
Real-time PCR reactions were performed using the MyiQ thermal cycler and the iQ5
software (BioRad, Hercules, CA 94547). The fluorescent dye is SYBR Green.
Three technical triplicates were performed for each reaction using the same template. At
least three biological replicates of ~100 ECs each were used for each sample. DNA was
isolated from egg chambers, and DNA equivalent to 5-6 egg chambers was used as
template for each PCR reaction. Reverse transcription was performed using QuantiTect
Rev. Transcription Kit (Sigma, Valencia, CA 91355). The absolute quantitative method
was used. Standard curves were generated for each target sequence using serial dilutions
(10
8
, 10
7
, 10
6
, 10
5
, 10
4
, 10
3
molecules) of purified PCR product of that sequence. The
molecule numbers for each target were then calculated according to the standard curves,
and ribosomal protein 49 gene (rp49) was used as an internal control. Equal amount of
total RNA from all samples was used for reverse transcription prior to real-time PCR.
GFP and s18 expression from stage 10 egg chambers were quantified as transcripts per ng
total RNA.
78
Primers for real-time PCR
ACE3 -1: 5’ CTGAGCCTGGCCAACATCTAA 3’
ACE3 -4: 5’ GGATCCGCATAGTTTCGATCA 3’
s18-1F: 5’ GTGCCTGTGCCCGTGTCCTC 3’
s18-1R: 5’ GCGGGGAGCCTCCTTCCAGA 3’
Rp49 F: 5’ AGCCCAAGGGTATCGACAA 3’
Rp49 R: 5’ ACCGTTGGGGTTGGTGAG 3’
GFP F: 5’ TATATCATGGCCGACAAGCA 3’
GFP R: 5’ GAACTCCAGCAGGACCATGT 3’
white F: 5’ AGCTCCAAGCGGTTTACGCC 3’
white R: 5’ AAAACCAATCACCACCCCAATCACT 3’
All primers for real-time PCR were tested prior to use using melting curve analysis of the
products, and only primer pairs that produced product with a sharp single peak were used.

79
DNA isolation and quantification of gene amplification
Female flies were fed fresh yeast paste for 48 hours prior to dissection to stimulate egg
chamber production. Egg chambers were dissected in 1X PBS at room temperature for
DNA extraction. Egg chambers prior to RNA extraction were dissected in 1X PBS on ice
and were immediately stored in -80oC upon collection. 100 stage 13 and 50 stage 10 egg
chambers were collected for each DNA/RNA extraction. For each sample, at least 3
independent extractions were performed as biological replicates. Stage 13 egg chamber
DNA was extracted using the chloroform/phenol method (Lu and Tower, 1997). Egg
chamber RNA was extracted using TRIZOL Reagent (Invitrogen, Carlsbad, California
92008), according to the manufacturer’s instruction. For isolation of genomic DNA 20
flies were used for each genomic DNA extraction. Whole fly genomic DNA was
extracted using ZR Quick-gDNA MiniPrep (Zymo Research, Orange, CA) according to
the manufacturer’s instruction. Primers specific to the 1st exon of the white gene were
used to measure the amplification level of the transgenic construct in DNA isolated from
egg chambers (ECs); these sequences are deleted in the endogenous white gene in the
w[1118] genetic background employed here. Male transgenic fly genomic DNA was
used as a non-amplified control. white sequence copy number was first normalized to
80
rp49 copy number. Then the white/rp49 ratio for egg chambers (EC) was normalized by
the white/rp49 ratio from the male genomic DNA control. Therefore, fold amplification
= (white
EC
/rp49
EC
) / (white
male
/rp49
male
).

GFP imaging
GFP fluorescence images were taken using a Leica MZ FLIII fluorescence
stereomicroscope and image capture system (Leica Microsystems, Inc, Bannockburn, IL)
and SPOT software (Diagnostic Instruments, Sterling Hgts, MI), according to the
manufacturers instructions.

Scanning Electron microscopy (SEM)
Scanning electron microscopy was performed at the University of Southern California
Center for Electron Microscopy and Microanalysis, using the JSM 6610 Low-Vacuum
Scanning Electron Microscope (Company, city). Flies were allowed to lay eggs
overnight on double-coated carbon tape affixed to a metal specimen disc placed on top of
an apple juice agar plate. Eggs laid on the tape were directly imaged using low vacuum
setting, 10Kv.
81
Statistical analyses
The Grubbs’ test was performed using R statistical environment to identify and exclude
outliers from the qPCR data. Grubbs' test (Grubbs, 1969; Stefansky, 1972)(also known as
the maximum normed residual test) is a univariate statistical test used to detect outliers in
normally distributed populations. The test was performed using the grubbs.test function
in the package outliers (Komsta, 2007) in R (RDevelopmentCoreTeam, 2009), and has
previously been applied to standardizing data analysis in qPCR (Burns et al., 2005).
Statistical significance of differences in RNA levels and DNA copy number between
samples was determined using unpaired, two-sided t-tests in Excel.

Chapter 3 Results
Conditional activation of transgene expression in the follicle cells
Two conditional systems were used to manipulate gene expression in the ovarian follicle
cells. With the Tet-on system transgene expression is triggered by feeding flies the drug
doxycycline (DOX), and with the Geneswitch system transgene expression is triggered
by feeding flies the drug RU486/Mifepristone. Both the Tet-on system (Figure 1) and the
82
Geneswitch system (Figure 2) produced abundant drug-dependent expression of GFP
transgenes in the follicle cells, as revealed by GFP fluorescence. With the Tet-on system,
GFP expression could be detected beginning at stage 9, with strong expression in the
squamous follicle cells that cover the nurse cells, and lower expression in the columnar
follicle cells that cover the oocyte (Figure 1B). At stage 10 strong GFP expression was
observed throughout the follicle cells (Figure 1C), and GFP expression continued in the
follicle cells until stage 13 (Figure 1D). With the Geneswitch system, GFP transgene
expression could be also detected beginning at stage 9, with relatively stronger
expression in the columnar follicle cells (Figure 2C); this expression continued through
stage 12, and began to be reduced by stage 13 (Figure 2D). A qPCR assay confirmed the
drug-dependent induction of GFP RNA with both systems, to levels similar to that of the
endogenous S18 gene (Supplemental Figure 1). The copy number of GFP transgene
sequences was quantified in DNA isolated from stage 13 egg chambers dissected from
flies where GFP transcription was induced by drug, and from non-drug controls. No
change in GFP copy number was observed with either the Tet-on or Geneswitch systems
(Supplemental Figure 2). These results therefore support the conclusion that transgene
83
transcription is not sufficient to cause gene amplification in the absence of specific
regulatory sequences such as ACE3 and ori-beta (Orr-Weaver et al., 1989; Tower, 2004).

84
Figure 1. Conditional transgene expression in follicle cells using the Tet-on system.
Young adult females containing the tissue-general rtTA(3)E2 driver and the TetO-GFP
reporter were cultured for one week in the presence or absence of drug DOX. Ovaries and
egg chambers were dissected and the samples were photographed using visible light and
GFP fluorescence, and the merged images are presented. A. Whole ovaries. B. Stage 9
egg chambers. C. Stage 10 egg chambers. D. Stage 13 egg chambers.
85
Figure 1, Continued.

86
Figure 2. Conditional transgene expression in follicle cells using the Geneswitch system.
Young adult females containing the tissue-general Actin-GS-255B driver and the UAS-
GFP reporter were cultured for one week in the presence or absence of drug RU486.
Ovaries and egg chambers were dissected and the samples were photographed using
visible light and GFP fluorescence, and the merged images are presented. A. Whole
ovaries. B. Stage 9 egg chambers. C. Stage 10 egg chambers. D. Stage 13 egg
chambers.
87
Figure 2, Continued.
88
Inhibition of EcR function disrupts chorion gene amplification and eggshell
structure
Expression of dominant negative forms of the EcR in the follicle cells caused reduced
expression of chorion gene RNA and protein, consistent with a requirement for EcR for
normal chorion gene transcription (Hackney et al., 2007). Here the Geneswitch
conditional system was used to drive expression of two the EcR-A isoform dominant
negative (DN) mutants, two EcR-B1 isoform DN mutants, and two EcR-B2 dominant
negative mutants. The EcR dominant mutant transgenes were each found to cause severe
disruption of eggshell structure, including thin and fragile eggshells with greatly
shortened or missing dorsal appendages (Figure 3B, and additional data not shown). In
addition, the DN transgenes caused reductions in chorion gene amplification ranging
from ~-25% to ~-50% in repeated assays (Figure 4A, B; Table 1) (with the exception of
EcR-B2 mutant line W650A, which did not cause a statistically significant change).
These results indicate that the EcR normally plays a positive role in regulating chorion
gene amplification. Consistent with this observation, conditional expression of RNAi
transgenes specific for the common region of the EcR isoform transcripts, and RNAi
transgenes specific for the EcR-B1 isoform transcript each caused a similar reduction in
89
eggshell structures (Figure 3C, D), and a reduction in amplification levels of ~-35%
(Figure 4C, D; Table 1). Interestingly, over-expression of the wild-type EcR-A isoform
and the wild-type EcR-B1 isoform also caused a disruption of eggshell morphogenesis,
characterized by shortened and branched dorsal appendages and displacement of the
dorsal appendages to a more posterior position on the eggshell (Figure 3E, F, H), and
these disruptions also correlated with decreased levels of chorion gene amplification
ranging from ~-35% to ~-50% (Figure 4E, F; Table 1). Assay of the Geneswitch driver
crossed to control strain w[1118] demonstrates that the RU486 drug itself does not affect
amplification (Figure 4E). The observation that both decreased and increased EcR
function disrupted chorion gene amplification suggests that correctly regulated EcR
activity is critical for this process, perhaps related to the fact that EcR functions in a
complex.

Effect of S18 gene transcription on amplification of transgenic constructs
The chorion gene promoters contain conserved motifs (TCACGT) that are required for
their normal expression and that have been identified as binding sites for the EcR
90
complex (Cavaliere et al., 2008). The BP construct contains two such sites, one located
in the S18 gene promoter and one located in the 3’ region of ori-beta (Figure 5B). To
investigate the possible role of S18 gene transcription in regulating chorion gene
amplification, clustered point mutations were created in the BP construct that disrupt one
or both of these sites, and the effect of these mutations were compared to the effect of
disruption of the S18 promoter TATA box. Three independent transgenic lines were
assayed for the BP construct, the BP-EcR1 mutant, the BP-EcR2 mutant, the BP-
EcRE1+2 mutant and the BP-TATA mutant. To allow for analysis of effects of the
mutations on S18 expression in the transgenic construct, the S18 RNA from the construct
must be distinguished from the endogenous S18 RNA. Sequence analysis revealed two
base substitutions that distinguish the BP S18 sequence from the endogenous S18
sequence (Supplemental Figure S3A). Oligonucleotide primers for qPCR were generated
with their 3’ base homologous to the S18 sequence contained in BP, and these oligos
were confirmed to preferentially amplify the S18 sequences from BP, as expected
(Supplemental Figure S3B). Using this assay the mutations in BP TATA box were found
to reduce S18 RNA levels significantly (Figure 5C; Supplemental Table S1), as did the
EcRE2 mutation, whereas the reductions caused by mutations EcRE1 and EcRE1+2 did
91
not reach significance with this assay. These results were confirmed using primers that
recognize both the BP S18 sequences and the endogenous S18 sequences. In this assay
the S18 transcripts from the BP construct can be distinguished from the endogenous S18
transcripts because they are more abundant, perhaps due to the presence of the flanking
transcriptional insulator elements in BP, and/or the possible absence of negative
regulators of chorion gene transcription located in the third chromosome locus (Mariani
et al., 1996). Using this assay, disruption of the TATA box as well as both EcRE1 and
EcRE2 mutations were found to reduce S18 RNA levels (Supplemental Figure S4;
Supplemental Table S2). Each of the mutations in BP was found to cause a
corresponding reduction in chorion gene amplification (Figure 5D; Supplemental Table
S3), consistent with the conclusion that S18 gene transcription plays a stimulatory in
amplification, and suggesting that part of the requirement for EcR function in chorion
gene amplification may be through its role in regulating chorion gene transcription.

92
Figure 3. Effect of EcR transgene expression on eggshell structure.
Young adult female flies containing the Actin-GS-255B driver and the indicated UAS-
EcR transgenes were cultured for one week in presence and absence of drug RU486.
Dissected stage 13 egg chambers were photographed using light microscopy (A-F), and
laid eggs were imaged using SEM (G, H). A. Control stage 13 egg chamber. B.
Dominant negative EcR-A mutation W650A. C. EcR RNAi specific for common region.
D. EcR RNAi specific for isoform B1. E. EcR-A isoform. F. EcR-B1 isoform. G.
Control egg. H. EcR-A isoform.

93
Figure 3, Continued.

94
Figure 4. Effect of EcR transgene expression on chorion gene locus copy number.
Young adult females flies containing the Actin-GS-255B driver and the indicated UAS-
EcR transgenes were cultured for one week in presence and absence of drug RU486.
DNA was isolated from stage 13 egg chambers and chorion locus copy number was
determined. “-” indicates minus drug, “+” indicates plus drug. A. Dominant negative
EcR-A mutation W650A. B. Dominant negative EcR-B1 mutation F645A. C. EcR
RNAi specific for common region. D. EcR RNAi specific for isoform A. E. EcR-A
isoform. F. EcR-B1 isoform. The significance of the difference between plus and minus
drug samples was determined using unpaired, two-sided t-tests, and p values are indicated
above the graphs.

95
Figure 4, Continued.

96
Table 1. qPCR results of EcR transgenic lines.
Lines ACE3/rp49 Ratio % Change P-value
RU486- RU486+
EcR-A-F645A 62.9±4.3 48.4±6.6 -23% 0.04
EcR-A-W650A 80.9±0.7 42.7±12.9 -47% 0.02
EcR-B1-F645A 43.4±4.2 18.9±3.1 -56% 0.0001
EcR-B1-W650A 72.0±3.6 56.9±8.3 -22% 0.0003
EcR-B2-F654A 84.5±4.6 62.9±4.4 -26% 0.008
EcR-B2-W650A 79.5±5.3 103.2±26.1 - 0.1
EcR-RNAi (104) 35.7±3.0 23.5±1.6 -34% 0.0003
EcR-RNAi (97) 77.4±4.5 16.32±1.0 -79% *
EcR-RNAi-A 38.6±1.0 25.8±4.0 -33% 0.03
EcR-RNAi-B1 65.3±20.7 42.2±6.4 -35% 0.02
EcR-A 21.8±0.5 10.6±0.7 -51% 3.6E-6
39.9±3.4 19.6±1.8 -51% 0.0002
EcR-B1 93.4±23.1 32.7±3.2 -65% 0.0005
EcR-B2 60.1±2.3 43.5±5.5 -28% 0.002
46.8±7.5 34.1±3.6 -28% 0.01
* Only two biological replicates were assayed for EcR-RNAi[97] due to severely
weakened oogenesis and paucity of stage 13 egg chambers.
97
Figure 5. Clustered point mutations of chorion locus sequences and effects on
transcription and amplification. A. Diagram of third chromosome chorion gene locus.
The required ACE3 and ori-beta elements are indicated by black boxes, and chorion
genes are indicated by arrows. B. Diagram of the chorion locus sequences contained in
the “Big Parent” (BP) transgenic construct. The clustered point mutations created in the
constructs BP-EcRE1, BP-EcRE2, BP-EcRE1+2, and BP-TATA are indicated, with
numbering relative to the start site (+1) for S18 transcription. C. Total RNA was isolated
from stage 13 egg chambers from three independent transgenic lines for each of the
constructs BP (lines 6A, 27B, 35A), BP-EcRE1 (lines 31A, 50A, 80A), BP-EcRE2 (lines
16B, 31D, 33A), BP-EcRE1+2 (lines 1A, 24A, 24B), and BP-TATA (lines 19A, 42A,
50A), and the S18 transgene RNA levels were quantified using allele-specific qPCR.
The mean and SD for each line is presented as bar graph. Statistical significance of the
change between BP and the mutants was determined by averaging the values for the three
independent lines for BP, and comparing that to the average for the three independent
transgenic lines of the mutants, using unpaired, two-sided t-tests. BP-EcRE1, p = 0.12;
BP-EcRE2, p = 0.03; BP-EcRE1+2, p = 0.07; BP-TATA, p = 0.03. D. The amplification
98
Figure 5, Continued.
level of the transgenic construct in each of the three independent transgenic lines was
measured using qPCR. Statistical significance of the change between BP and the mutants
was determined by averaging the values for the three independent lines for BP, and
comparing that to the average for each of the constructs using unpaired, two-sided t-tests.
BP-EcRE1, p = 0.02; BP-EcRE2, p = 0.02; BP-EcRE1+2, p < 0.001; BP-TATA, p <
0.001.
99
Figure 5, Continued.
100
Novel gene over-expression mutations that affect chorion gene amplification
PdL is an engineered version of the P transposable element containing the Tet-on
doxycycline-regulated promoter directed out through the 3’ end of the element. PdL
insertions cause doxycycline dependent over-expression of downstream genes, thereby
creating conditional (DOX-dependent) mutations at high frequency (Landis et al., 2001).
In an attempt to identify additional regulators of chorion gene amplification we assayed a
group of 21 PdL insertion mutations that had previously been found to cause DOX-
dependent disruptions of eggshell morphology (Supplemental Table S4) (Khokhar et al.,
2008). Two PdL mutations caused decreased amplification (Figure 6A,B; Supplemental
Table S4), and three mutations caused increased amplification (Figure 6C-E;
Supplemental Table S4), and each of these mutations was in a gene not previously
implicated in chorion gene amplification regulation. Analysis of the predicted protein
sequences of these genes revealed no significant homologies or known protein motifs,
with the exception of PdL[4510] (CG33188), which contains a Zinc-finger motif.

101
Figure 6. Effect of PdL-mediated gene over-expression mutations on chorion gene
amplification. Young adult female flies containing the rtTA(3)E2 driver and the indicated
PdL insertions were cultured for one week +/- DOX, as indicated. Stage 13 egg chamber
DNA was isolated and chorion gene locus copy number was assayed using qPCR. A.
PdL[2111]. B. PdL[5M1132]. C. PdL[1254]. D. PdL[4821]. E. PdL[251O]. The CG
numbers for the (over-expressed) genes located immediately downstream of the PdL
DOX-dependent promoter are indicated. The significance of the difference between plus
and minus drug samples was determined using unpaired, two-sided t-tests, and the
percent change in copy number and p values are indicated above the graphs.
102
Figure 6, Continued.

103
Chapter 3 Discussion
Transgenic constructs containing the ACE3 replicator element, the S18 chorion gene and
the sequence-specific origin element ori-beta will amplify when inserted at ectopic
chromosomal positions. Amplification of such transgenic constructs is highly sensitive to
inhibitory chromosomal position effects, however, flanking these chorion locus
sequences with transcriptional insulator elements allows amplification to proceed at
virtually every chromosomal insertion site (Lu and Tower, 1997; Lu et al., 2001).
Previous studies demonstrated that deletion of the S18 chorion gene from such transgenic
constructs reduces levels of amplification, and makes amplification of the constructs
more susceptible to inhibitory chromosomal position effects, even in the presence of the
flanking insulators (Zhang and Tower, 2004), thereby indicating a stimulatory role for
S18. Here experiments were conducted to investigate the potential role of S18 chorion
gene transcription in the process of chorion gene amplification. Conditional expression
of GFP transgenes in the ovarian follicle cells confirmed that high-level gene
transcription is not sufficient to cause gene amplification in the absence of the
amplification regulatory elements ACE3 and ori-beta. However, the present results
support the conclusion that transcription of the S18 chorion gene plays a stimulatory role
in amplification. First, inhibition of the normal function of the chorion gene transcription
104
factor ecdysone receptor reduces S18 gene transcription (Hackney et al., 2007) and
reduced the amplification of transgenic constructs containing S18, in addition to causing
defects in chorion structure and patterning. Second, inhibition of S18 gene transcription
by mutation of the TATA box or by mutation of ecdysone receptor binding motifs in the
S18 promoter and in ori-beta was also found to reduce amplification. The ecdysone
receptor binding motifs (EcREs) in the S18 promoter and in ori-beta (TCACGT)
correspond to a half-site of the canonical ecdysone receptor binding motif, and it is
common for the other half of such sites to be degenerate in sequence. The EcRE half-site
motif is shared by all chorion gene promoters, and has been previously been
demonstrated to be required for efficient expression of the S15 chorion gene in follicle
cells (Mariani et al., 1996).

The EcRE motif in ori-beta (EcRE2) is located near the 3’ end of ori-beta, within a 140
bp region that was previously shown by deletion analysis to be stimulatory for
amplification in the context of the BP construct: Deletion of the entire 3’ 140 bp of ori-
beta reduced BP amplification from ~20 fold to ~12 fold (Zhang and Tower, 2004),
which is similar to the reduction in amplification observed here upon point mutation of
105
EcRE2. The present results suggest that the stimulatory effect of the 3’ 140 bp of ori-
beta is due to EcRE2 and it’s stimulatory effect on S18 transcription, and is consistent
with previous mapping of the essential ori-beta sequences to the 5’ 366 bp of the ori-beta
region (Zhang and Tower, 2004).

Analysis of another locus that amplifies in the Drosophila follicle cells is consistent with
a role for active gene transcription in amplification. The y2g gene locus undergoes two
rounds of low-level amplification in the follicle cells (Claycomb et al., 2004). The
second round of y2g amplification occurs at stage 13 of oogenesis and is preceeded by
transcription across the locus at stage 12. Notably, amplification of the y2g locus at stage
13 was reduced by the transcriptional inhibitory drug alpha-amanitin, consistent with the
conclusion that transcription of y2g stimulates its amplification (Xie and Orr-Weaver,
2008). Alpha-amanitin was not found to inhibit the amplification of the chorion gene loci
or y2g transgenic constructs containing flanking insulator elements, leading to the
suggestion that transcriptional regulation of follicle cell gene amplification might be
limited to the endogenous y2g locus at stage 13 (Xie and Orr-Weaver, 2008). However,
another possibility is that the alpha-amanitin treatment was not as effective when
106
transcription was favored by the presence of flanking insulator elements in y2g
transposons, or by the normal chromosomal location and flanking sequences present at
the endogenous chorion gene loci, and this possibility would be consistent with the
present results indicating a role for S18 gene transcription in stimulating amplification.
Activation of EcR activity was found to be required for the normal transition of the
Drosophila follicle cells from the endocycle to locus specific amplification (Sun et al.,
2008). Consistent with a role for EcR in normal chorion synthesis, Hackney et al have
recently reported that expression of EcR DN transgenes using a follicle cell-specific
driver (slobo-GAL4) reduced the expression of the chorion genes, and disrupted normal
eggshell synthesis, resulting in cup-shaped eggs with shortened and branched dorsal
appendages (Hackney et al., 2007). Those phenotypes were somewhat less severe than
observed here with conditional expression of the EcR DN transgenes, and were similar to
what was observed with over-expression of EcR isoforms. Hackney et al also found that
the EcR DN transgenes caused reductions in Orc2 foci in the nuclei of the follicle cells.
Those results suggested possible effects on chorion gene amplification, however chorion
gene locus copy number was not assayed. Here we have directly measured chorion gene
amplification levels and demonstrate that inhibition of EcR function inhibits
107
amplification. Moreover, our results suggest that the function of EcR in amplification
may be through a stimulatory role of chorion gene transcription on amplification.
Ecdysone has been shown to induce developmentally regulated gene transcription and
gene amplification in another dipteran fly, Sciara coprophila (Foulk et al., 2006; Gerbi et
al., 2002). Several genes encoding putative pupal case proteins are amplified in Sciara
larval salivary gland cells, and addition of exogenous ecdysone will cause these genes to
undergo premature amplification and expression. For one of these genes, called II/9-1, a
1-kb initiation zone has been mapped ~2.5 kb upstream of the gene, using methods that
identify DNA replication initiation events and ORC binding (Bielinsky et al., 2001;
Lunyak et al., 2002). Three ecdysone response elements are located in the II/9-1
promoter and one is located within the 1-kb origin region, and this site has been shown to
bind to the EcR complex (Foulk et al., 2006). Those results directly implicate the EcR in
regulating II/9-1 locus amplification, however the lack of a genetic assay for Sciara
amplification precludes mutational analysis of the EcREs. Binding of RNA polymerase
II marks the right boundary of the II/9-1 initiation zone, consistent with a role for
transcription and/or transcription-dependent chromatin changes in defining the Sciara
origin region (Lunyak et al., 2002).
108
Taken together, the present results with Drosophila support a model wherein activated
S18 chorion gene transcription stimulates the activity of the downstream origin ori-beta.
One likely possibility is that activated S18 transcription creates an altered or more open
chromatin structure that facilitates the binding of the Orc complex and other DNA
replication machinery to the nearby ACE3 and ori-beta elements (Tower, 2004).
Consistent with this idea, chorion gene amplification correlates with specific alterations
in chromatin structure, including histone H3 and H4 hyperacetylation (Aggarwal and
Calvi, 2004; Hartl et al., 2007). Finally, the location of the minimal and essential
sequences of ori-beta coincides with the expected termination site(s) for the S18
transcription unit (Zhang and Tower, 2004), suggesting a possible mechanistic
connection between transcriptional termination and origin firing, and this will be a
particularly interesting area for future study.

Chapter 3 Acknowledgements
This work was supported by a grant from the Department of Health and Human Services
to JT (GM048449 and AG011833).
109
Conclusion
Drosophila chorion gene amplification and transcription provide a convenient tool for
understanding DNA replication regulation and developmental control of transcription.
The third chromosome chorion gene s18 and its cis-regulatory elements were studied in
detail previously (Lu et al., 2001; Zhang and Tower, 2004) and were chosen for more
explicit studies of the sequence and transcription requirement of amplification.

ACE3 replicator and ori-β origin element were previously found to be necessary for
efficient amplification (Lu et al., 2001). The BP construct contains ACE3, s18 and ori-β
in their natural context flanked by transcription insulators SHWBS (suppressor of hairy-
wing protein binding site). BP is sufficient for amplification at a moderate level (~20
fold) (Zhang and Tower, 2004). The Small Parent (SP) construct, which carries only the
320 bp ACE3 and 840 bp ori-β was also sufficient to amplify, but at a lower level
compared to BP (average 8 fold). The amplification difference between SP and BP could
be due to inefficient spacing between ACE3 and ori-β, or the lack of s18 transcription
activities.
110
Chorion genes transcription is regulated precisely. The third chromosome chorion genes
reach their transcription peak at stage 13 and 14 (Orr-Weaver, 1991). Previously, each
chorion gene was isolated and their transcription regulation was studied separately. It
was discovered that, albeit in a cluster, the transcription of each chorion gene is regulated
independently with their own cis-regulatory elements (Wakimoto et al., 1986).

Conditional overexpression of GFP in follicle cells resulted in significant increase of GFP
expression in stage-13 egg chambers. At stage-10, GFP signal was seen in egg chambers.
Although GFP expression reached or even excelled the s18 level in stage-13 egg
chambers, we did not see increase in GFP gene copies. Therefore, we concluded that
transcription alone is not enough to initiate amplification without the appropriate cis-
regulatory sequences.

To explore whether transcription is necessary for amplification, we made two point
mutations in the s18 TATA box on BP. This mutation abolished the BP-s18 transcription
and reduced the construct amplification from ~20 fold to ~8 fold. This data is consistent
111
with the previous discovery that SP amplifies ~8 fold. Therefore, our data strongly
suggests that active transcription is required for efficient amplification.

Ecdysone is essential for almost every aspect of the fly development, including
oogenesis. Ecdysone receptor (EcR) was found in both germline and somatic cells during
all stages of the oogenesis, from germarium to mature eggs (Buszczak et al., 1999).
Several studies have suggested that ecdysone receptors (EcR) might be essential for
chorion gene amplification regulation including endocycle-amplification transition (Sun
et al., 2008) and chorion gene expression (Hackney et al., 2007).

By measuring chorion gene amplification in multiple conditional EcR isoform-inhibition
mutants, we found that inhibited EcR reduced amplification. Similar results were also
seen in the conditional EcR isoform overexpression strains. The reduction of chorion
gene amplification was observed in all isoform-specific strains and EcR common region
mutants. There was no obvious evidence that if any particular EcR isoform causes more
amplification than others, or the EcR common region mutants cause more reduction than
112
isoform-specific mutants. Therefore, there might be certain functional redundancy
existing between each isoform. Our data suggests that EcR is required for normal
chorion gene amplification. However, the temporal and spatial distribution of EcR is also
essential for amplification.

EcR has appeared in a network of multiple pathways, including the genes Ras and foxo.
Our attempts to explore whether Ras and foxo mutants alter chorion gene amplification
showed that Ras-DN reduced amplification whereas Ras-overexpression, foxo-
overexpression and foxo-null did not change amplification. Our data confirmed the
complex nature of ecdysone cascade and its regulation network.

To explore whether EcR regulate chorion gene amplification through direct binding, we
searched for its potential binding sites. Two half-EcRE sites (TCACGT) were fond in the
s18 promoter (EcRE1) and 3’ of ori-β (EcRE2), respectively. Interestingly, the same site
is also present at approximately -60 bp from the transcription starting sites of all the other
major Drosophila chorion genes (Orr-Weaver, 1991). This hexamer is also present in the
113
chorion genes in all other species in the genus Drosophila (Y C Wong, 1985) as well as
the silkmoth (Spoerel et al., 1989).

Our clustered point mutations at the two EcRE sites on BP have reduced the
amplification by 37% (EcRE1), 35% (EcRE2) and 72% (EcRE1+2) compared to BP.
This result suggested that the EcRE sites on s18 promoter and ori-β are both essential for
amplification, and the full-extent amplification results from a combined contribution
from both sites.

To further explore the mechanism how the EcRE sites assist amplification, we measured
the transcription of s18 on the BP. The clustered point mutations on EcRE1 and EcRE2
diminished the s18 transcription. This result correlates with the data that destructed
transcription in BP-TA inhibited amplification. When the EcRE sites were mutated
individually, the negative impact on amplification was not as much as that in the BP-TA
mutants. However, when both mutants were present, the combined effect was similar to
BP-TA. It is possible that separate mutations on either EcRE site did not destruct the
114
transcription completely and the remaining transcription activities supported
amplification at certain extend. This data also proved the important role of ori-β in
stimulating transcription.

Therefore, we concluded that EcR acts in cis by binding to the TCACGT sequences to
activate s18 transcription.

Taken together, all the data supports our hypothesis that amplification is the result of
specific cis-regulatory origin sequences combined with nearby active transcription.

To look for the next trans- regulator(s) of chorion gene amplification, we conducted a
conditional gene overexpression screening by using a modified P-element (PdL)
mutagenesis. The doxycycline-regulated promoter on PdL conditionally drives
downstream genes overexpression essentially at random loci throughout the genome. By
screening for abnormal egg chamber phenotypes including thin/thick egg shells and
115
short/long dorsal appendages, we narrowed down the strains that could potentially have
chorion gene trans- regulators downstream of PdL. Several rounds of amplification
assay including Southern blots and real-time PCR were performed to quantify the
endogenous third chromosome chorion gene loci amplification level. Several positive
and negative regulators were identified. However, their detailed molecular function is yet
to be further characterized.

Overall, chorion gene amplification follows the basic DNA replication rules by sharing
similar components of the replication machinery. Yet, it is excluded from the typical cell
cycle control, possibly a combined result of unique sequence-specific cis-regulators and
transcription activities controlled by development.

For future research, it would be interesting to study in details the regulators identified
from the PdL screening and further characterize the signaling pathway network that
regulates the EcR and its function during oogenesis.
116
Chorion gene amplification provides a convenient tool for metazoan DNA replication
studies. Additionally, oncogenesis studies may also benefit from understanding gene
amplification and its regulation, as abnormal DNA replication and amplification are
important indicators for human cancer diagnosis.
117
Bibliography
Allikian, M. J., D. Deckert-Cruz, M. R. Rose, G. N. Landis and J. Tower, 2002
Doxycycline-induced expression of sense and inverted-repeat constructs modulates
phosphogluconate mutase (Pgm) gene expression in adult Drosophila melanogaster.
Genome Biol 3: research0021.
Araujo, H., E. Negreiros and E. Bier, 2003 Integrins modulate Sog activity in the
Drosophila wing. Development 130: 3851-3864.
Asano, M. and R. P. Wharton 1999 "E2F mediates developmental and cell cycle
regulation of ORC1 in Drosophila." EMBO J 18(9): 2435-2448.
Austin, R. J., T. L. Orr-Weaver, et al. 1999 "Drosophila ORC specifically binds to ACE3,
an origin of DNA replication control element." Genes Dev 13(20): 2639-2649.
Bandura, J. L., E. L. Beall, et al. 2005 "humpty dumpty is required for developmental
DNA amplification and cell proliferation in Drosophila." Curr Biol 15(8): 755-759.
Beall, E. L., J. R. Manak, et al. 2002 "Role for a Drosophila Myb-containing protein
complex in site-specific DNA replication." Nature 420(6917): 833-837.
Bellen, H. J., R. W. Levis, G. Liao, Y. He, J. W. Carlson et al., 2004 The BDGP gene
disruption project: single transposon insertions associated with 40% of Drosophila genes.
Genetics 167: 761-781.
Berg, C. A., 2005 The Drosophila shell game: patterning genes and morphological
change. Trends Genet 21: 346-355.
Bieschke, E. T., J. C. Wheeler and J. Tower, 1998 Doxycycline-induced transgene
expression during Drosophila development and aging. Mol Gen Genet 258: 571-579.
Brewer, B.J., and Fangman, W.L. 1987 The localization of replication origins on ARS
plasmids in S. cerevisiae. Cell 51, 463-471.
Burns, M.J., Nixon, G.J., Foy, C.A., and Harris, N. 2005 Standardisation of data from
real-time quantitative PCR methods - evaluation of outliers and comparison of calibration
curves. BMC Biotechnol 5, 31.
118
Buszczak, M., M. R. Freeman, et al. 1999 "Ecdysone response genes govern egg chamber
development during mid-oogenesis in Drosophila." Development 126(20): 4581-4589.
Cabernard, C., M. Neumann and M. Affolter, 2004 Cellular and molecular mechanisms
involved in branching morphogenesis of the Drosophila tracheal system. J Appl Physiol
97: 2347-2353.
Calvi, B. R., et al. 1999 "Chorion Gene Amplification in Drosophila: A Model for
Metazoan Origins of DNA Replication and S-Phase Control."
Calvi, B. R., M. A. Lilly, et al. 1998 "Cell cycle control of chorion gene amplification."
Genes Dev 12(5): 734-744.
Calvi, B. R. and A. C. Spradling 2001 "The nuclear location and chromatin organization
of active chorion amplification origins." Chromosoma 110(3): 159-172.
Cavaliere, V., F. Bernardi, et al. 2008 "Building up the Drosophila eggshell: first of all
the eggshell genes must be transcribed." Dev Dyn 237(8): 2061-2072.
Cayirlioglu, P., P. C. Bonnette, et al. 2001 "Drosophila E2f2 promotes the conversion
from genomic DNA replication to gene amplification in ovarian follicle cells."
Development 128(24): 5085-5098.
Chen, C. M., W. Strapps, A. Tomlinson and G. Struhl, 2004 Evidence that the cysteine-
rich domain of Drosophila Frizzled family receptors is dispensable for transducing
Wingless. Proc Natl Acad Sci U S A 101: 15961-15966.
Chen, Y., and T. Schupbach, 2006 The role of brinker in eggshell patterning. Mech Dev
123: 395-406.
Crozatier, M., B. Glise and A. Vincent, 2004 Patterns in evolution: veins of the
Drosophila wing. Trends Genet 20: 498-505.
Claycomb, J. M., M. Benasutti, et al. 2004 "Gene amplification as a developmental
strategy: isolation of two developmental amplicons in Drosophila." Dev Cell 6(1): 145-
155.
Claycomb, J. M., D. M. MacAlpine, et al. 2002 "Visualization of replication initiation
and elongation in Drosophila." J Cell Biol 159(2): 225-236.
119
Collins, K. and M. A. Gorovsky 2005 "Tetrahymena thermophila." Curr Biol 15(9):
R317-318.
Colombani, J., L. Bianchini, et al. 2005 "Antagonistic actions of ecdysone and insulins
determine final size in Drosophila." Science 310(5748): 667-670.
Dai, P., H. Akimaru and S. Ishii, 2003 A hedgehog-responsive region in the Drosophila
wing disc is defined by debra-mediated ubiquitination and lysosomal degradation of Ci.
Dev Cell 4: 917-928.
Dammai, V., B. Adryan, K. R. Lavenburg and T. Hsu, 2003 Drosophila awd, the
homolog of human nm23, regulates FGF receptor levels and functions synergistically
with shi/dynamin during tracheal development. Genes Dev 17: 2812-2824.
Datta, P. K., A. Chytil, A. E. Gorska and H. L. Moses, 1998 Identification of STRAP, a
novel WD domain protein in transforming growth factor-beta signaling. J Biol Chem
273: 34671-34674.
Datta, P. K., and H. L. Moses, 2000 STRAP and Smad7 synergize in the inhibition of
transforming growth factor beta signaling. Mol Cell Biol 20: 3157-3167.
De Celis, J. F., 2003 Pattern formation in the Drosophila wing: The development of the
veins. Bioessays 25: 443-451.
Delidakis, C., and Kafatos, F.C. 1987 Amplification of a chorion gene cluster in
Drosophila is subject to multiple cis-regulatory elements and to long range position
effects. Journal of Molecular Biology 197, 11-26.
Delidakis, C. and F. C. Kafatos 1989 "Amplification enhancers and replication origins in
the autosomal chorion gene cluster of Drosophila." EMBO J 8(3): 891-901.
Deng, W. M., and M. Bownes, 1997 Two signalling pathways specify localised
expression of the Broad-Complex in Drosophila eggshell patterning and morphogenesis.
Development 124: 4639-4647.
Dorman, J. B., K. E. James, S. E. Fraser, D. P. Kiehart and C. A. Berg, 2004 bullwinkle
is required for epithelial morphogenesis during Drosophila oogenesis. Dev Biol 267: 320-
341.
120
Edgar, B.A., and Orr-Weaver, T.L. 2001 Endoreplication cell cycles: more for less. Cell
105, 297-306.
Fossett, N., S. G. Tevosian, K. Gajewski, Q. Zhang, S. H. Orkin et al., 2001 The Friend
of GATA proteins U-shaped, FOG-1, and FOG-2 function as negative regulators of
blood, heart, and eye development in Drosophila. Proc Natl Acad Sci U S A 98: 7342-
7347.
Foulk, M. S., C. Liang, et al. 2006 "Ecdysone induces transcription and amplification in
Sciara coprophila DNA puff II/9A." Dev Biol 299(1): 151-163.
Gauhar, Z., L. V. Sun, et al. 2009 "Genomic mapping of binding regions for the
Ecdysone receptor protein complex." Genome Res 19(6): 1006-1013.
Gerbi, S. A., Z. Strezoska, et al. 2002 "Initiation of DNA replication in multicellular
eukaryotes." J Struct Biol 140(1-3): 17-30.
Ghabrial, A. S., and M. A. Krasnow, 2006 Social interactions among epithelial cells
during tracheal branching morphogenesis. Nature 441: 746-749.
Gimenes, F., M. Assis, et al. 2009 "Intrinsically bent DNA sites in the Drosophila
melanogaster third chromosome amplified domain." Mol Genet Genomics.
Glesne, D. A., W. Zhang, S. Mandava, L. Ursos, M. E. Buell et al., 2006 Subtractive
transcriptomics: establishing polarity drives in vitro human endothelial morphogenesis.
Cancer Res 66: 4030-4040.
Grubbs, F. 1969 Procedures for Detecting OutlyingObservations in Samples.
Technometrics 11, 1-21.
Gu, Y., and D. L. Nelson, 2003 FMR2 function: insight from a mouse knockout model.
Cytogenet Genome Res 100: 129-139.
Hackney, J. F., C. Pucci, et al. 2007 "Ras signaling modulates activity of the ecdysone
receptor EcR during cell migration in the Drosophila ovary." Dev Dyn 236(5): 1213-
1226.
121
Hamlin, J.L., Mesner, L.D., Lar, O., Torres, R., Chodaparambil, S.V., and Wang, L. 2008
A revisionist replicon model for higher eukaryotic genomes. J Cell Biochem 105, 321-
329.
Han, H. J., W. J. Sigurdson, P. A. Nickerson and M. Taub, 2004 Both mitogen activated
protein kinase and the mammalian target of rapamycin modulate the development of
functional renal proximal tubules in matrigel. J Cell Sci 117: 1821-1833.
Heck, M. M. and A. C. Spradling 1990 "Multiple replication origins are used during
Drosophila chorion gene amplification." J Cell Biol 110(4): 903-914.
Horne-Badovinac, S. and D. Bilder 2005 "Mass transit: epithelial morphogenesis in the
Drosophila egg chamber." Dev Dyn 232(3): 559-574.
Jung, A. C., B. Denholm, H. Skaer and M. Affolter, 2005 Renal tubule development in
Drosophila: a closer look at the cellular level. J Am Soc Nephrol 16: 322-328.
Kapler, G.M. 1993 Developmentally regulated processing and replication of the
Tetrahymena rDNA minichromosome. Curr Opin Genet Dev 3, 730-735.
Khokhar, A., Chen, N., Yuan, J., Li, Y., Landis, G.N., Beaulieu, G., Kaur, H., and Tower,
J. 2008 Conditional switches for extracellular matrix patterning in Drosophila
melanogaster. Genetics.
Kim, J. W., I. Tchernyshyov, G. L. Semenza and C. V. Dang, 2006 HIF-1-mediated
expression of pyruvate dehydrogenase kinase: a metabolic switch required for cellular
adaptation to hypoxia. Cell Metab 3: 177-185.
Kleve, C. D., D. A. Siler, S. K. Syed and E. D. Eldon, 2006 Expression of 18-wheeler in
the follicle cell epithelium affects cell migration and egg morphology in Drosophila. Dev
Dyn.
Komsta, L. 2007 outliers: Tests for outliers. R package version 0.13-2 (r-project.org).
Kozlova, T. and C. S. Thummel 2000 "Steroid regulation of postembryonic development
and reproduction in Drosophila." Trends Endocrinol Metab 11(7): 276-280.

122
Landis, G., R. Kelley, et al. 1997 "The k43 gene, required for chorion gene amplification
and diploid cell chromosome replication, encodes the Drosophila homolog of yeast origin
recognition complex subunit 2." Proc Natl Acad Sci USA 94(8): 3888-3892.
Landis, G. and J. Tower 1999 "The Drosophila chiffon gene is required for chorion gene
amplification, and is related to the yeast Dbf4 regulator of DNA replication and cell
cycle." Development 126(19): 4281-4293.
Landis, G., D. Bhole, L. Lu and J. Tower, 2001 High-frequency generation of conditional
mutations affecting Drosophila melanogaster development and life span. Genetics 158:
1167-1176.
Landis, G. N., D. Bhole and J. Tower, 2003 A search for doxycycline-dependent
mutations that increase Drosophila melanogaster life span identifies the VhaSFD, Sugar
baby, filamin, fwd and Cctl genes. Genome Biol 4: R8.
Lavenburg, K. R., J. Ivey, T. Hsu and R. C. Muise-Helmericks, 2003 Coordinated
functions of Akt/PKB and ETS1 in tubule formation. Faseb J 17: 2278-2280.
Lecuit, T., and F. Pilot, 2003 Developmental control of cell morphogenesis: a focus on
membrane growth. Nat Cell Biol 5: 103-108.
Lehtinen, M. K., Z. Yuan, P. R. Boag, Y. Yang, J. Villen et al., 2006 A conserved MST-
FOXO signaling pathway mediates oxidative-stress responses and extends life span. Cell
125: 987-1001.
Leng, F. and R. McMacken 2002 "Potent stimulation of transcription-coupled DNA
supercoiling by sequence-specific DNA-binding proteins." Proc Natl Acad Sci USA
99(14): 9139-9144.
Levi, B. P., A. S. Ghabrial and M. A. Krasnow, 2006 Drosophila talin and integrin genes
are required for maintenance of tracheal terminal branches and luminal organization.
Development 133: 2383-2393.
Liang, C. and S. A. Gerbi 1994 "Analysis of an origin of DNA amplification in Sciara
coprophila by a novel three-dimensional gel method." Mol Cell Biol 14(2): 1520-1529.
123
Lilly, M. A. and A. C. Spradling 1996 "The Drosophila endocycle is controlled by
Cyclin E and lacks a checkpoint ensuring S-phase completion." Genes Dev 10(19): 2514-
2526.
Lu, L., and Tower, J. 1997 A transcriptional insulator element, the su(Hw) binding site,
protects a chromosomal DNA replication origin from position effects. Mol Cell Biol 17,
2202-2206.
Lu, L., H. Zhang, et al. 2001 "Functionally distinct, sequence-specific replicator and
origin elements are required for Drosophila chorion gene amplification." Genes Dev
15(2): 134-146.
Lunyak, V. V., M. Ezrokhi, et al. 2002 "Developmental changes in the Sciara II/9A
initiation zone for DNA replication." Mol Cell Biol 22(24): 8426-8437.
Lynch, J., L. Guo, P. Gelebart, K. Chilibeck, J. Xu et al., 2005 Calreticulin signals
upstream of calcineurin and MEF2C in a critical Ca(2+)-dependent signaling cascade. J
Cell Biol 170: 37-47.
MacAlpine, H. K., R. Gordân, et al. 2010 "Drosophila ORC localizes to open chromatin
and marks sites of cohesin complex loading." Genome Res 20(2): 201-211.
Margolis, J., and A. C. Spradling, 1995 Identification and behavior of epithelial stem
cells in the Drosophila ovary. Development 121: 3797-3807.
Meyer, T. N., C. Schwesinger, K. T. Bush, R. O. Stuart, D. W. Rose et al., 2004
Spatiotemporal regulation of morphogenetic molecules during in vitro branching of the
isolated ureteric bud: toward a model of branching through budding in the developing
kidney. Dev Biol 275: 44-67.
Mihaylov, I. S., T. Kondo, et al. 2002 "Control of DNA replication and chromosome
ploidy by geminin and cyclin A." Mol Cell Biol 22(6): 1868-1880.
Mohammad, M., York, R.D., Hommel, J., and Kapler, G.M. 2003 Characterization of a
novel origin recognition complex-like complex: implications for DNA recognition, cell
cycle control, and locus-specific gene amplification. Mol Cell Biol 23, 5005-5017.
Montell, D. J., 2006 The social lives of migrating cells in Drosophila. Curr Opin Genet
Dev 16: 374-383.
124
Nambu, J. R., W. Chen, S. Hu and S. T. Crews, 1996 The Drosophila melanogaster
similar bHLH-PAS gene encodes a protein related to human hypoxia-inducible factor 1
alpha and Drosophila single-minded. Gene 172: 249-254.
Neumann, M., and M. Affolter, 2006 Remodeling epithelial tubes through cell
rearrangements: from cells to molecules. EMBO reports 7: 36-40.
O'Connell, P., and M. Rosbash, 1984 Sequence, structure, and codon preference of the
Drosophila ribosomal protein 49 gene. Nucleic Acids Research 12: 5495-5513.
Orr-Weaver, T. 1991 Drosophila chorion genes: cracking the eggshell's secrets.
BioEssays 13, 97-105.
Orr-Weaver, T. L., C. G. Johnston, et al. 1989 "The role of ACE3 in Drosophila chorion
gene amplification." EMBO J 8(13): 4153-4162.
Palacios, F., J. K. Schweitzer, R. L. Boshans and C. D'Souza-Schorey, 2002 ARF6-GTP
recruits Nm23-H1 to facilitate dynamin-mediated endocytosis during adherens junctions
disassembly. Nat Cell Biol 4: 929-936.
Papadia, S., G. Tzolovsky, D. Zhao, K. Leaper, D. Clyde et al., 2005 emc has a role in
dorsal appendage fate formation in Drosophila oogenesis. Mech Dev 122: 961-974.
Papandreou, I., R. A. Cairns, L. Fontana, A. L. Lim and N. C. Denko, 2006 HIF-1
mediates adaptation to hypoxia by actively downregulating mitochondrial oxygen
consumption. Cell Metab 3: 187-197.
Pena-Rangel, M. T., I. Rodriguez and J. R. Riesgo-Escovar, 2002 A misexpression study
examining dorsal thorax formation in Drosophila melanogaster. Genetics 160: 1035-
1050.
Petit, V., C. Ribeiro, A. Ebner and M. Affolter, 2002 Regulation of cell migration during
tracheal development in Drosophila melanogaster. Int J Dev Biol 46: 125-132.
Pilot, F., and T. Lecuit, 2005 Compartmentalized morphogenesis in epithelia: from cell to
tissue shape. Dev Dyn 232: 685-694.
125
Quinn, L. M., A. Herr, et al. 2001 "The Drosophila Geminin homolog: roles for
Geminin in limiting DNA replication, in anaphase and in neurogenesis." Genes Dev
15(20): 2741-2754.
Raisin, S., S. Pantalacci, J. P. Breittmayer and P. Leopold, 2003 A new genetic locus
controlling growth and proliferation in Drosophila melanogaster. Genetics 164: 1015-
1025.
RDevelopmentCoreTeam 2009 R: A language and environment for statistical
computing. (R Foundation for Statistical Computing, Vienna, Austria.).
Reiling, J. H., and E. Hafen, 2004 The hypoxia-induced paralogs Scylla and Charybdis
inhibit growth by down-regulating S6K activity upstream of TSC in Drosophila. Genes
Dev 18: 2879-2892.
Remus, D., E. L. Beall, et al. 2004 "DNA topology, not DNA sequence, is a critical
determinant for Drosophila ORC-DNA binding." EMBO J 23(4): 897-907.
Reya, T., and H. Clevers, 2005 Wnt signalling in stem cells and cancer. Nature 434: 843-
850.
Riddiford, L. M., P. Cherbas, et al. 2000 "Ecdysone receptors and their biological
actions." Vitam Horm 60: 1-73.
Robertson, H. M., C. R. Preston, R. W. Phillis, D. M. Johnson-Schlitz, W. K. Benz et al.,
1988 A stable genomic source of P element transposase in Drosophila melanogaster.
Genetics 118: 461-470.
Rorth, P., 1998 Gal4 in the Drosophila female germline. Mech Dev 78: 113-118.
Rorth, P., K. Szabo, A. Bailey, T. Laverty, J. Rehm et al., 1998 Systematic gain-of-
function genetics in Drosophila. Development 125: 1049-1057.
Rosario, M., and W. Birchmeier, 2003 How to make tubes: signaling by the Met receptor
tyrosine kinase. Trends Cell Biol 13: 328-335.
Royzman, I., A. Hayashi-Hagihara, et al. 2002 "The E2F cell cycle regulator is required
for Drosophila nurse cell DNA replication and apoptosis." Mech Dev 119(2): 225-237.
126
Ryder, E., Ashburner, M., Bautista-Llacer, R., Drummond, J., Webster, J., Johnson, G.,
Morley, T., Chan, Y.S., Blows, F., Coulson, D., et al. 2007 The DrosDel deletion
collection: a Drosophila genomewide chromosomal deficiency resource. Genetics 177,
615-629.
Saha, S., Shan, Y., Mesner, L.D., and Hamlin, J.L. 2004 The promoter of the Chinese
hamster ovary dihydrofolate reductase gene regulates the activity of the local origin and
helps define its boundaries. Genes Dev 18, 397-410.
Samakovlis, C., N. Hacohen, G. Manning, D. C. Sutherland, K. Guillemin et al., 1996
Development of the Drosophila tracheal system occurs by a series of morphologically
distinct but genetically coupled branching events. Development 122: 1395-1407.
Schwed, G., N. May, et al. 2002 "Drosophila minichromosome maintenance 6 is
required for chorion gene amplification and genomic replication." Molecular Biology of
the Cell 13(2): 607-620.
Seong, H. A., H. Jung, H. S. Choi, K. T. Kim and H. Ha, 2005 Regulation of
transforming growth factor-beta signaling and PDK1 kinase activity by physical
interaction between PDK1 and serine-threonine kinase receptor-associated protein. J Biol
Chem 280: 42897-42908.
Smith, A.V., and Orr-Weaver, T.L. 1991. The regulation of the cell cycle during
Drosophila embryogenesis: the transition to polyteny. Development 112, 997-1008.
Soriano, J. V., N. Liu, Y. Gao, Z. J. Yao, T. Ishibashi et al., 2004 Inhibition of
angiogenesis by growth factor receptor bound protein 2-Src homology 2 domain bound
antagonists. Mol Cancer Ther 3: 1289-1299.
Spoerel, N. A., Nguyen, H. T., Eickbush, T. H. and Kafatos, F. C. 1989. Gene evolution
and regulation in the chorion complex of Bombyx mori. Hybridization and sequence
analysis of multiple developmentally middle A/B chorion gene pairs. J Mol Biol 209, 1-
19.
Stapleton, M., J. Carlson, P. Brokstein, C. Yu, M. Champe et al., 2002 A Drosophila full-
length cDNA resource. Genome Biol 3: RESEARCH0080.
Stefansky, W. 1972 Rejecting Ouliers in Factorial Designs. Technometrics 14, 469-479.
127
Su, M. A., R. G. Wisotzkey and S. J. Newfeld, 2001 A screen for modifiers of
decapentaplegic mutant phenotypes identifies lilliputian, the only member of the Fragile-
X/Burkitt's Lymphoma family of transcription factors in Drosophila melanogaster.
Genetics 157: 717-725.
Sun, J., L. Smith, et al. 2008 "Regulation of the endocycle/gene amplification switch by
Notch and ecdysone signaling." J Cell Biol 182(5): 885-896.
Tang, A. H., T. P. Neufeld, G. M. Rubin and H. A. Muller, 2001 Transcriptional
regulation of cytoskeletal functions and segmentation by a novel maternal pair-rule gene,
lilliputian. Development 128: 801-813.
Tolias, P. P., M. Konsolaki, et al. 1990 "The chorion genes of the medfly, Ceratitis
capitata. II. Characterization of three novel cDNA clones obtained by differential
screening of an ovarian library." Dev Biol 140(1): 105-112.
Tower, J. 2004). "Developmental gene amplification and origin regulation." Annu Rev
Genet 38: 273-304.
Tseng, A. S., and I. K. Hariharan, 2002 An overexpression screen in Drosophila for genes
that restrict growth or cell-cycle progression in the developing eye. Genetics 162: 229-
243.
Tzolovsky, G., W. M. Deng, T. Schlitt and M. Bownes, 1999 The function of the broad-
complex during Drosophila melanogaster oogenesis. Genetics 153: 1371-1383.
Underwood, E. M., A. S. Briot, et al. 1990 "Genetics of 51D-52A, a region containing
several maternal-effect genes and two maternal-specific transcripts in Drosophila."
Genetics 126(3): 639-650.
van de Wetering, M., E. Sancho, C. Verweij, W. de Lau, I. Oving et al., 2002 The beta-
catenin/TCF-4 complex imposes a crypt progenitor phenotype on colorectal cancer cells.
Cell 111: 241-250.
Vogt, P. K., H. Jiang and M. Aoki, 2005 Triple Layer Control: Phosphorylation,
Acetylation and Ubiquitination of FOXO Proteins. Cell Cycle 4.
128
Wakimoto, B. T., Kalfayan, L. J. and Spradling, A. C. 1986 Developmentally regulated
expression of Drosophila chorion genes introduced at diverse chromosomal positions. J
Mol Biol 187, 33-45.
Ward, E. J., X. Zhou, L. M. Riddiford, C. A. Berg and H. Ruohola-Baker, 2006 Border of
Notch activity establishes a boundary between the two dorsal appendage tube cell types.
Dev Biol.
Wittwer, F., A. van der Straten, K. Keleman, B. J. Dickson and E. Hafen, 2001
Lilliputian: an AF4/FMR2-related protein that controls cell identity and cell growth.
Development 128: 791-800.
Wolff, S., H. Ma, D. Burch, G. A. Maciel, T. Hunter et al., 2006 SMK-1, an essential
regulator of DAF-16-mediated longevity. Cell 124: 1039-1053.
Y C Wong, J. P., N Spoerel, F C Kafatos. 1985 Coding and potential regulatory
sequences of a cluster of chorion genes in Drosophila melanogaster. Chromosoma 92,
124-35.
Wu, N., C. Liang, et al. 1993 "Developmental progression of DNA puffs in Sciara
coprophila: amplification and transcription." Dev Biol 160(1): 73-84.
Xie, F., and Orr-Weaver, T.L. 2008 Isolation of a Drosophila amplification origin
developmentally activated by transcription. Proc Natl Acad Sci U S A.
Yamada, T., M. Okabe and Y. Hiromi, 2003 EDL/MAE regulates EGF-mediated
induction by antagonizing Ets transcription factor Pointed. Development 130: 4085-4096.
Zhang, H. and J. Tower 2004 "Sequence requirements for function of the Drosophila
chorion gene locus ACE3 replicator and ori-beta origin elements." Development 131(9):
2089-2099.
Zhang, Z., D. M. Macalpine, et al. 1997 "Developmental regulation of DNA replication:
replication fork barriers and programmed gene amplification in Tetrahymena
thermophila." Mol Cell Biol 17(10): 6147-6156.

Abstract (if available)

Abstract Drosophila chorion genes are amplified in the ovarian follicle cells during oogenesis in order to satisfy the high demand for eggshell protein synthesis. Amplification occurs through repeated firing of origin(s) and is strictly regulated both temporally and spatially. The third chromosome chorion gene s18 requires upstream replicator Amplification Element on the 3rd Chromosome (ACE3) and downstream sequence-specific origin ori-beta for efficient amplification. Using constructs carrying ACE3, s18 and ori-beta, we were able to study the sequence and transcription requirement for s18 amplification. We found that experimentally reducing transcription of s18 inhibits amplification. Using conditional overexpression of Green Fluorescence Protein (GFP), we found that active transcription alone is not sufficient to initiate amplification without the presence of ACE3 and ori-beta. Point mutations in the s18 TATA box reduced s18 amplification. We therefore conclude that transcription, although not sufficient for amplification initiation, is essential for efficient s18 amplification. Point mutation of ecdysone receptor binding motifs found in the s18 promoter and in ori-beta reduced both chorion gene transcription and amplification. Reduced amplification was also observed with conditional inhibition of ecdysone receptor gene expression and upon overexpression of dominant-negative forms of the ecdysone receptor. Ecdysone receptor therefore mediates both developmental regulation of chorion gene transcription and amplification. Additionally, we identified several novel positive and negative trans-regulators of chorion gene amplification, via a gene over-expression screen. Taken together, the results demonstrate that chorion gene amplification is the combined result of sequence specific regulatory elements, active transcription and precise developmental control.

Linked assets

University of Southern California Dissertations and Theses

Conceptually similar

PDF

Molecular and genomic studies of sex determination in Drosophila

PDF

Molecular misreading in Drosophila melanogaster

PDF

Over-expression of superoxide dismutase in Drosophila melanogaster

PDF

Transgenic biomarkers of aging in drosophila melanogaster

PDF

Characterization of Drosophila longevity and fecundity regulating genes

PDF

Differential role of two coactivators, CCAR1 and CARM1, for dysregulated beta-catenin activity in colorectal cancer cell growth and gene expression

PDF

Innovative sequencing techniques elucidate gene regulatory evolution in Drosophila

PDF

Sex-specific effects of drosophila p53 on adult life span

PDF

Computational and experimental approaches for the identification of genes and gene networks in the Drosophila sex-determination hierarchy

PDF

Behavioral choice assays and alcohol preference in Drosophila melanogaster

PDF

Real-time tracking and analysis of Drosophila behavior and gene expression

PDF

The effect of microbial load and autophagy on drosophila immunity and life span

PDF

Investigating the role of SASH1 gene located on chromosome 6 in ovarian cancer

PDF

Robustness and stochasticity in Drosophila development

PDF

Structure and regulation of lymphoid tyrosine phosphatase (LYP) in autoimmune response

PDF

Biological interactions on the behavioral, genomic, and ecological scale: investigating patterns in Drosophila melanogaster of the southeast United States and Caribbean islands

PDF

The mechanism of recruitment of Tip60 to ER target genes

PDF

Unraveling the molecular mechanisms of heterochromatic double strand break repair in Drosophila cells

PDF

Epigenetic regulation of non CPG island gene promoters

PDF

Functional characterization of colon cancer risk-associated enhancers: connecting risk loci to risk genes

Asset Metadata

Creator Chen, Nan (author)

Core Title Chorion gene amplification in Drosophila melanogaster

School College of Letters, Arts and Sciences

Degree Doctor of Philosophy

Degree Program Molecular Biology

Publication Date 06/24/2010

Defense Date 04/23/2010

Publisher University of Southern California (original), University of Southern California. Libraries (digital)

Tag chorion amplification,Drosophila,OAI-PMH Harvest

Language English

Contributor Electronically uploaded by the author (provenance)

Advisor Tower, John (committee chair), Finch, Caleb E. (committee member), Turcotte, Lorraine (committee member)

Creator Email nanchen@gmail.com,nanchen@usc.edu

Permanent Link (DOI) https://doi.org/10.25549/usctheses-m3153

Unique identifier UC186316

Identifier etd-Chen-3720 (filename),usctheses-m40 (legacy collection record id),usctheses-c127-351860 (legacy record id),usctheses-m3153 (legacy record id)

Legacy Identifier etd-Chen-3720.pdf

Dmrecord 351860

Document Type Dissertation

Rights Chen, Nan

Type texts

Source University of Southern California (contributing entity), University of Southern California Dissertations and Theses (collection)

Repository Name Libraries, University of Southern California

Repository Location Los Angeles, California

Repository Email cisadmin@lib.usc.edu