University of Southern California Dissertations and Theses

Sex-specific effects of drosophila p53 on adult life span

(USC Thesis Other)

Sex-specific effects of drosophila p53 on adult life span

PDF

Download a page range

Download transcript

Copy asset link

Request this asset

Transcript (if available)

Content SEX-SPECIFIC EFFECTS OF DROSOPHILA p53 ON ADULT LIFE SPAN

by

Jie Shen

A Dissertation Presented to the
FACULTY OF THE GRADUATE SCHOOL
UNIVERSITY OF SOUTHERN CALIFORNIA
In Partial Fulfillment of the
Requirements for the Degree
DOCTOR OF PHILOSOPHY
(MOLECULAR BIOLOGY)

August 2009

Copyright 2009 Jie Shen

ii

Acknowledgements
I would like to thank John Tower for his guidance and encouragements throughout the
course of this work at USC. I’ve been fortunate to have John as my mentor. John is a
patient and motivating mentor. He gave me the courage and confidence to solve problems
and finish my work. Especially, I would like to thank John for the extraordinary support
during my last year of graduate study, under the Final Year Dissertation Fellowship. I
made great progress on my project during this period. This would not have happened
without John’s kind support and encouragements!

I would like to thank the entire Tower lab, past and present, for making the lab a great
place to spend five years. Their helpful suggestions, discussions, and reagents, for my
qualifying exam and for my projects, are greatly appreciated.

Great Thanks to my dissertation committee – Susan Forsburg, Valter Longo, and Chi
Mak, for their time and helpful suggestions. Also thanks to my previous committee
members – Lei Li, Amy Barrios, and the late Robert Bau, for their kind suggestions
during my qualifying exam and committee meetings afterwards.

Thanks to the lab of Oscar Aparicio, Michelle Arbeitman, Norm Arnhein, and Myron
Goodman for the use of equipment. Special thanks to Oscar Aparicio lab and Michelle
iii

Arbeitman lab, not only for the use of equipment, but also for the delight and the feeling
of family. Thanks to my friends throughout the Department, as well as those outside the
department.

iv

Table of Contents
Acknowledgements ii

List of Figures v

List of Tables vii

Abstract viii

Chapter 1: Introduction 1

Chapter 2: A screen of apoptosis and senescence regulatory genes for
life span effects when over-expressed in Drosophila
17

Chapter 3 Tissue-specific, sexually antagonistic effects of p53 on
Drosophila life span and Akt phosphorylation depend
upon foxo and Sir2
52

Chapter 4: Identifying sexual differentiation genes that affect
Drosophila life span
78

Final Summary 103

References 107

v

List of Figures
Figure 1: The structure of human p53 protein 4

Figure 2: Insulin/IGF-1 like signaling pathway in Drosophila 8

Figure 3: Drosophila sex determination hierarchy. 13

Figure 4: The GeneSwitch/RU486 system 14

Figure 5: Expression pattern produced by GeneSwitch drivers and UAS-
GFP reporter in adult flies
23

Figure 6: Expression pattern produced by GeneSwitch drivers and UAS-
GFP reporter in larvae
25

Figure 7: Effect of transgene over-expression on survival of adult flies 29

Figure 8: Effect of Baculovirus p35 over-expression on survival of adult
flies
32

Figure 9: Mortality rate analysis of female larvae with and without
Baculovirus p35 transgene expression
35

Figure 10: Effect of ubiquitous p53 over-expression on survival of adult flies 56

Figure 11: Effect of neural-specific p53 over-expression on survival of adult
flies
58

Figure 12: Effect of p53 over-expression in Sir2-/- background on survival of
adult flies
61

vi

Figure 13: Effect of neural-specific p53 over-expression in on Akt
phosphorylation
63

Figure 14: Effect of p53 over-expression in on 4E-BP expression 66

Figure 15: Chapter 3 Summary of results and possible models 67

Figure 16: Drosophila sex determination hierarchy and the tudor mutation 82

Figure 17: Life span assays and mortality rate analysis for germline-ablated
Drosophila
85

Figure 18: Effect of tra over-expression during development on sexual
differentiation of adults
87

Figure 19: Effect of sex differentiation pathway gene mis-expression on
survival of male and female adult flies
88

vii

List of Tables
Table 1: p53 effect on aging in different organisms. 6

Table 2: Chatper 2 Starting stocks 36

Table 3: Chatper 2 Life span data of apoptosis-related gene experiments,
with means, standard deviations, medians, percent change in
mean and median, and log rank p value
37

Table 4: Chatper 2 Life span data for baculovirus p35 experiments, with
means, standard deviations, medians, percent change in mean and
median, and log rank p value
41

Table 5: Chatper 2 Parameters for Gompertz-Makeham model and
likelihood ratio test results
44

Table 6: Chatper 3 Starting stocks 68

Table 7: Chatper 3 Life span data with means, standard deviations,
medians, percent change in mean and median, and log rank p
value.
68

Table 8: Chatper 4 Starting stocks 91

Table 9: Chatper 4 Statistical analysis of tudor life span assays 91

Table 10: Chatper 4 Parameters for Gompertz-Makeham model and
likelihood ratio test results
92

Table 11: Chatper 4 Life span data with means, standard deviations,
medians, percent change in mean and median, and log rank p
value
93

viii

Abstract
Aging is a process of gradual decline of normal function and increase of chance of
mortality in an organism over time. Recent aging research has shown that conserved
pathways are shared between Drosophila and other model organisms. One of the main
evolutionary theories of aging is the antagonistic pleiotropy theory, that predicts that
there are antagonistically pleiotropic genes (AP genes) that can be both beneficial and
harmful at different stages of the life cycle. To test this, the effects of p53 on Drosophila
life span were examined, using a system for experimentally controlling gene expression
called “GeneSwitch”. p53 was found to be an AP gene, with sex-specific and tissue-
specific effects on fly life span. Nervous-system-specific over-expression of p53 in adult
flies gave a life span extension to females, but a decrease of life span in males. Tissue-
general over-expression of p53 in adult flies gave the opposite pattern: a life span
extension to males, but a decrease of life span in females. These results suggest that p53
has both tissue-specific and sexually antagonistic effects on fly life span. Over-expression
of other apoptosis-regulatory genes did not increase life span, suggesting that p53
regulation of apoptosis may not be the mechanism by which p53 affects fly life span. The
IIS pathway was found to be involved in determining the sex-specific effects of p53. In a
foxo null background, the effect of p53 in males was converted to the female-like pattern.
In addition, over-expression of p53 was found to alter signaling through the IIS pathway
in a sex-specific way, as indicated by AKT phosphorylation levels. The effects of p53
ix

over-expression on life span were reduced in a Sir2 null mutant background, indicating
that the Sir2 pathway regulates the magnitude of p53 effects. Finally, the effects of sex-
differentiation genes on life span were explored. The data suggest that genes in the sex-
determination and differentiation pathway interact with IIS and Sir2 to produce the sex-
specific effects of p53.

1

CHAPTER 1
Introduction
Aging is a process involving gradual decline of normal function and increased chance of
mortality in an organism over time. Drosophila melanogaster is a one of the most
commonly used model organisms in molecular biology and genetics, including studies of
development and physiology. Drosophila melanogaster is also a powerful tool for the
study of aging. Recent research on aging has shown that Drosophila and other model
organisms share conserved pathways that modulate life span and aging phenotypes, for
example, the insulin/IGF1-like signaling (IIS) pathway (Longo and Finch, 2003).
Drosophila has a tissue structure more similar to mammals than does C.elegans or yeast,
yet Drosophila has a much shorter life span than mice. Therefore, aging research in
Drosophila is both rapid and highly informative. In this thesis, Drosophila melanogaster
was used with a system for experimentally controlling gene expression called
“GeneSwitch” to examine the sex-specific effects of p53 on adult life span. The
relationship of p53 effects on aging to IIS and Sir2 pathway was also explored. The
effects of apoptosis-regulatory genes and sex-differentiation genes on life span were also
addressed.

2

Aging theory: antagonistic pleiotropy theory
There are two main theories of aging from the evolutionary perspective: mutation
accumulation and antagonistic pleiotropy (AP) (Medawar, 1952; Williams, 1957). The
mutation accumulation theory is based on the idea that the force of natural selection
decreases with age. Mutations happen at random and most are deleterious and are
removed from the population by the force of natural selection. However, occasionally a
mutation will arise that does not have a deleterious effect until late ages. Such a mutation
can escape the force of natural selection, because by the time the negative effect of the
mutation is expressed in the animal, that gene has most likely already been passed onto
the next generation. Accumulation of these mutations with late-acting deleterious effects
is therefore thought to be one reason for aging.

The antagonistic pleiotropy theory is very similar to the mutation accumulation theory,
with the exception that the genes harmful to later life could actually be actively
maintained in the genome by positive selection because they also have beneficial effects
early in life. These genes are called antagonistic pleiotropic genes (AP genes). Similarly,
there could also be sexually AP genes that favor one sex but are harmful to the other sex,
since males and females face different selection pressures.

A related evolutionary theory of aging is the disposable soma theory. The allocation of
resources or disposable soma theory was developed by Kirkwood (Kirkwood, 2005). The
3

idea is that limited biological resources are allocated to reproduction, growth and short
term survival at the expense of somatic maintenance pathways required for optimal life
span.

Here p53 found to be an example of an antagonistic pleiotropic gene, that shows sex-
specific and tissue-specific effects on aging.

p53 function and structure in human and Drosophila
p53 is an important tumor suppressor in humans. In about half of human cancers, there is
loss of function of p53 caused by inactivating mutations or deletions (Levine, 1997). p53
helps maintain genomic integrity and therefore is called "the guardian of the
genome"(Lane, 1992). In response to cellular damage and stress, p53 can either induce
cell cycle arrest, to allow DNA repair, or induce apoptosis when the damage is severe.
p53 is also involved in the regulation of metabolism, autophagy, and cellular senescence
(Bensaad et al., 2006; Crighton et al., 2006).

Human p53 is a 393 amino acids protein. There are three main functional domains
(Figure 1): an amino-terminal transactivation domain, a DNA-binding domain, and a
carboxy-terminal tetramerization domain (Ollmann et al., 2000). The N-terminal domain
is composed of three parts: residues 1-42 is the the N-terminal transcription-activation
domain (AD1) which activates transcription factors, residues 43-63 is the activation
4

domain 2 which is important for apoptotic activity, residues 64-91 is the proline-rich
domain (Harms and Chen, 2005). The central DNA-binding domain is within residues
100 to 300, and contains the highly conserved domains II to V. It is the main target of
mutations in human cancers. The C-terminal domain has three main parts: residues 316 to
325 is the nuclear localization signal domain, residues 334 to 356 is the tetramerization
domain that is essential for the p53 activity, and residues 364 to 393 is the C-terminal
basic domain that is involved in downregulation of DNA binding (Harms and Chen,
2005).

Figure 1. The structure of human p53 protein. The three main domains are: an amino-terminal
transactivation domain, a DNA-binding domain, and a carboxy-terminal tetramerization domain.

Drosophila p53 (Dmp53) sequence shows significant similarity to the DNA binding
domain of human p53, including the DNA sequence recognition residues and residues
for coordination of a zinc ion(Cho et al., 1994). The N-terminal region does not have the
Mdm2-binding motif as does human p53 (Kussie et al., 1996), or the proline rich domain
(Walker and Levine, 1996). This is consistent with the fact that Drosophila does not have
a homolog of Mdm2. However, Dmp53 does have a high proportion of acidic residues in
the N-terminus, similar to human p53 (Brodsky et al., 2000). Therefore, the
transactivation function is likely to be conserved in Dmp53. The C-terminal region has
low sequence similarity to human p53; however, the C-terminus is enriched in basic
5

residues and has a tetremerization domain for Dmp53 oligomerization similar to human
p53 (Brodsky et al., 2000).

Although short lived invertebrates such as C. elegans and Drosophila melanogaster do
not develop cancer (Lu and Abrams, 2006), p53 is found to regulate apoptosis in flies
(Brodsky et al., 2000; Jin et al., 2000; Ollmann et al., 2000) during development and in
response to DNA damage (Sogame et al., 2003). Two-hybrid analysis revealed that
Drosophila p53 interacts with partners involved in a variety of processes, such as DNA
repair and metabolism (Giot et al., 2003; Stanyon et al., 2004). Recently, p53 was found
to be a regulator of longevity in C.elegans, mice, and Drosophila.

p53 and aging
p53 has been found to be an important regulator of aging and longevity (Table 1). In
mice, the effect of p53 on aging is complicated and condition-dependent. In transgenic
mice expressing a truncated p53 with deletion of the first six exons, wild-type p53
stability was increased and the nuclear localization was facilitated (Moore et al., 2007).
p53 wild-type activity was augmented, and there was enhanced tumor resistance, but
shortened life span together with premature aging phenotypes, including organ atrophy,
osteoporosis, and a reduced stress tolerance (Tyner et al., 2002).

6

Another transgenic mouse model contains p44, the natural short form of p53 that lacks
the first transactivation domain, and these mice exhibit premature aging and growth
suppression (Maier et al., 2004). The overexpression of p44 leads to abnormal IGF
signaling in mouse (Maier et al., 2004). Therefore, aberrantly enhanced p53 activity
might be harmful to longevity due to altered signaling through the IIS pathway.

However, when an additional copy of intact wild-type p53 allele was co-over-expressed
with an additional copy of p19ARF, which is a tumor suppressor that activates p53, the
transgenic mice showed enhanced cancer resistance and delayed aging (Matheu et al.,
2007). Interestingly, transgenic mice with only one or two additional copies of wild-type
p53 alleles showed only cancer resistance but no alteration in longevity (Garcia-Cao et
al., 2002). Thus, the effect of p53 on aging could be condition-dependent. Normally
augmented p53 function may be beneficial to longevity.
Table 1. p53 effect on aging in different organisms.
Organism Genetic manipulation Effects on aging
mouse over-expression of truncated p53 premature aging

over-expression of natural short form p53 premature aging
over-expression of wild type p53 allele w/p19ARF delayed aging

C.elegans RNAi or knockout of cep-1 increased life span

RNAi or knockout of cep-1 in foxo null background no increase in life span

RNAi or knockout of cep-1 in Sir2 over-expression
background no increase in life span

Drosophila Neuronal expression of p53 dominant mutation allele increased life span

Neuronal expression of p53 dominant mutation allele
under DR condition no increase in life span

Expression of p53 dominant mutation allele in
insulin-like peptide producing cells increased life span

7

In C. elegans, RNA interference (RNAi) or

genetic knockout of p53 homolog, cep-1,
resulted in increased life span. In daf-16 null background, or in sir2.1 over-expressing
background, p53 knockdown did not increase life span(Arum and Johnson, 2007). daf-16
and sir2.1 in C. elegans are homologous to foxo and Sir2 in Drosophila, respectively.
FOXO, the forkhead transcription factor, is an important mediator of IIS that regulates
longevity. Sir2, the NAD-dependent histone deacetylase, has shown to be a primary
mediator of Dietary restriction (DR)-induced life span extension. Overall, these data
show that the effect of p53 on longevity might be IIS and DR pathway-related.

p53 was also found to be a regulator of aging in Drosophila. Neuronal expression of p53
dominant mutation allele in adults gave a significant life span increase in both males and
females (Bauer et al., 2005). Under calorie restriction or dSir2 over-expression condition,
life span extension by the neuronal expression of the p53 dominant mutation allele was
not observed (Bauer et al., 2005; Johannes H. Bauer, 2009). Moreover, expression of the
dominant mutant form of p53 only in the 14 insulin-like peptide-producing cells in the
brain gave a life span increase similar to the pan-neuronal expression, by reducing the
insulin signaling (Bauer et al., 2007). Therefore, p53 and calorie restriction may be in the
same pathway, or affect the same pathway. Because of inherent limitations in the
transgenic system employed in Drosophila (called the “GAL4/UAS” system) some of the
life span increases observed could have been affected by genetic background differences
between the experimental and control groups. However, that said, the data suggest that
p53 may alter life span by affecting IIS.
8

Pathways related with aging
IIS and dietary restriction (DR) are two well studied pathways that can extend life span in
worms, flies and mammals (Masoro, 2003; Osborne et al., 1917; Tatar et al., 2003).

Figure 2. Insulin/IGF-1 like signaling pathway in Drosophila. Activation of insulin receptor (InR) by
insulin-like peptides (ILP) leads the retention of FOXO in the cytoplasm, and therefore inhibits life span
extension.

In Drosophila IIS, the binding of insulin-like peptides (ILP) to the insulin receptor (InR)
causes the activation of InR substrate CHICO. Subsequent activation of the downstream
phosphoinositide-3-kinase (PI3K) leads to the phosphorylation of protein kinase B/Akt
9

(Goberdhan and Wilson, 2003). Activation of Akt results in the phosphorylation of the
forkhead transcription factor FOXO, and retention of FOXO in the cytoplasm (Obsil et
al., 2003; Wang et al., 2006). The protein phosphatase PTEN is a negative regulator of
IIS. PTEN antagonizes PI3K activity and leads to FOXO accumulation in nucleus (Van
Der Heide et al., 2004).

Hypomorphic mutation of InR in Drosophila yielded dwarf adults, extended female life
span up to 85%, and reduced male late-stage mortality (Tatar et al., 2001). Null mutation
of InR substrate chico also gave a life span increase to both males and females, but with a
bigger increase in females (Clancy et al., 2001). Over-expression of FOXO in fly head
fat-body extended both male and female life span, by reducing the expression of ILP2
expression and therefore repressing IIS signaling in the peripheral fat body (Hwangbo et
al., 2004b). However, another study showed that over-expression of FOXO in the
peripheral fat body could extend female but not male fly life span, and caused reduced
female fecundity (Giannakou et al., 2004). Over-expression of PTEN in head fat body
also extended Drosophila lifespan (Hwangbo et al., 2004b). Therefore, InR and CHICO
are negative regulators of longevity, whereas FOXO and PTEN are both positive
regulators of longevity. In summary, IIS is an important pathway that regulates aging in
Drosophila. Manipulation of IIS might have sex-specific effects on Drosophila life span
for reasons that are not yet clear.

10

Dietary restriction (DR) is another important intervention that extends life span. First
found in rodents, the life span extending effect is conserved across species, from yeast to
mammals. The underlying mechanism is not entirely clear. There is evidence showing
that Sir2, the NAD-dependent histone deacetylase, may be a primary mediator of DR-
induced life span extension.

An increase in Sir2 in yeast extends mother cell life span, which is linked to DR (Jiang et
al., 2002; Kaeberlein et al., 1999; Lin et al., 2002). Similarly, increased expression of
Sir2 extends life span in C.elegans (Tissenbaum and Guarente, 2001). In Drosophila, DR
was found to increase Sir2 mRNA level (Rogina et al., 2002). Pan-neuronal over-
expression of Sir2 extends female fly life span in a DR-related manner (Rogina and
Helfand, 2004). Most importantly, DR could not extend life span in Sir2 null background
(Rogina and Helfand, 2004). The SIR2 activator, resveratrol, has been reported to extend
life span in yeast, worms, and flies in a Sir2- and DR-dependent manner (Howitz et al.,
2003; Wood et al., 2004). Resveratrol was also found to enhance survival of mice on
high-calorie diet (Baur et al., 2006). However, in another study, no significant effect of
resveratrol on Drosophila or C. elegans life span was seen, after several independent
trials (Bass et al., 2007). Another histone deacetylase, Rpd3, might also be a mediator of
DR: Null mutation of Rpd3 in Drosophila was reported to extend life span, in a DR-
related way (Rogina et al., 2002). Rpd3 could be upstream of Sir2 in the DR pathway
(Rogina and Helfand, 2004). In summary, Sir2 might be an important mediator of DR-
11

dependent life span extension pathway, although the mechanism of DR pathway is not
clear yet. Rpd3 could also be a mediator of DR pathway that is upstream of Sir2.

Overlapping mechanisms might be shared between IIS pathway and DR pathway in
Drosophila, as study shows that the life span increased by chico mutation cannot be
further extended by DR (Clancy et al., 2002). However, there is also evidence showing
that the IIS pathway and DR pathways have independent mechanisms: For example, DR
was found to still be effective in life span extension in a foxo null background (Min et al.,
2008). Over-expression of FOXO in fly head fat-body extends life span and decreases
ILP2 mRNA abundance, whereas DR only changed ILP5 mRNA abundance (Min et al.,
2008).. In summary, IIS and DR may modulate life span through both shared and
independent mechanisms.

Apoptosis could be another pathway that affects aging. In Drosophila, apoptotic-like
events occur within muscle cells and fat cells and increase with physical age (Zheng et
al., 2005). The level of apoptotic markers was found to increase with age, in normal mice,
and in POLG mice. PLOG mice express a proofreading-deficient

mitochondrial DNA
polymerase g and show symptoms of accelerated aging. Accumulation

of mtDNA
mutations was found correlated with apoptotic markers (Kujoth et al., 2005). However,
there is no evidence yet in Drosophila that inhibition of apoptosis in adults can increase
longevity.

12

As discussed above, manipulation of genes in IIS pathway or DR pathway may have
different effects on males and females. For example, mutations in InR or chico in
Drosophila gave a bigger increase in female life span than male life span (Clancy et al.,
2001; Tatar et al., 2001). Similarly, pan-neuronal over-expression of Sir2 extended life
span of female flies more than males (Rogina and Helfand, 2004). There is additional
evidence that the IIS pathway is related with sexual dimorphism. Mutation of InR or
ablation of insulin-producing cells feminizes the locomotor activity of male flies, by
increasing the number of start/stops, or the number of activity and inactivity phases, to a
comparable level to that of female flies (Belgacem and Martin, 2006).Ames dwarf mice
are mutant for Prop1, the gene that encodes a transcription factor required for the
development of the anterior pituitary gland, and therefore lack the GH/IGF-1 axis
(Amador-Noguez et al., 2005). The Ames dwarf mice are long-lived, and notably, 117
out of 123 genes lost their sex-specific expression pattern in the liver. Therefore, one
possibility is that the IIS pathway and DR pathway may affect aging by altering the
expression or function of sex-specific genes.

In Drosophila, the sex determination hierarchy consists of SXL, TRA, and TRA-2 pre-
mRNA splicing factors (Figure 3) (Goldman and Arbeitman, 2007). In males, absence of
SXL, and therefore lack of TRA activity, leads to the male-specific splicing to produce
the male isoform of the transcription factors FRU and DSX. In females, the activation of
SXL results in the pre-mRNA splicing of tra. TRA and TRA-2 together direct the
splicing of dsx and fru pre-mRNA in females, and lead to the production of DSX female
13

isoform, and fru transcripts that are not translated in females (Goldman and Arbeitman,
2007). Although there is no evidence yet that Drosophila sex differentiation genes could
affect lifespan, genes in the sex determination hierarchy could be possible candidates that
interact with IIS or DR pathway, to give sex-specific effect on aging, and that possibility
is explored in this thesis.

Figure 3. Drosophila sex determination hierarchy. In females, the existence of SXL leads to the pre-
mRNA splicing of tra. TRA and TRA-2 together direct the splicing of dsx and fru pre-mRNA in females,
and lead to the production of DSX
F
. In males, lack of SXL and TRA activity leads to expression of FRU
M
and DSX
M
.

GeneSwitch system to over-express genes in Drosophila

GeneSwitch system is a powerful conditional gene expression system in Drosophila.
GeneSwitch is a modified version of the yeast GAL4 protein. It contains the GAL4
DNA-binding domain and transcriptional activation domain, fused to the human
progesterone-receptor regulatory domain (Osterwalder et al., 2001). In the presence of the
drug RU486 (an artificial progesterone analog), GeneSwitch can bind to the upstream
14

activating sequence (UAS), and drive the expression of the downstream gene.
GeneSwitch system allows both spatial and temporal control of gene expression. One
advantage of the Geneswitch system relative to the GAL4/UAS system is that with
Geneswitch the control and gene-over-expressing groups have identical genetic
backgrounds, and differ only in the presence or absence of drug.

Figure 4. The GeneSwitch/RU486 System. This system uses two transgenic constructs – a “Driver”
construct in which the Geneswitch cDNA is downstream of a tissue-specific promoter, and a UAS-
transgene “Target” construct. GeneSwitch is a modified GAL4 protein that contains the human
progesterone-receptor regulatory domain. In the presence of the drug RU486, GeneSwitch can bind to the
upstream activating sequence (UAS) and drive the expression of the target gene.

In this thesis several Geneswitch “driver lines” were used to examine the effect on gene
over-expression on longevity. “Drivers lines” are transgenic strains in which the
regulatory sequences for a particular gene are used to drive the expression of the artificial
transcription factor Geneswitch;using the regulatory sequences from a tissue-specific
gene, results in tissue-specific expression of Geneswitch. For example, use of the
regulatory sequences of the nervous-tissue specific gene Elav results in nervous tissue-
15

specific expression of Geneswitch. The drivers used here include the tissue-general
GeneSwitch driver lines Act-GS-255B and Act-GS-255A, which contains multiple inserts
of a GeneSwitch construct under the promoter of the cytoplasmic actin5C promoter (Ford
et al., 2007), the nervous-system-specific Elav-GS driver, which contains GeneSwitch
under control of the Elav gene promoter (Osterwalder et al., 2001), the whole-body fat-
body GeneSwitch driver strain (“WB-FB-GS”), which contains both a head fat-body
driver (S
1
-32) plus a body-fat-body driver (S
1
-106) (Giannakou et al., 2007; Hwangbo et
al., 2004a; Roman et al., 2001), and the muscle-specific MHC-GS driver (Osterwalder et
al., 2001; Roman et al., 2001).

In chapter 2, I describe the characterization of GeneSwitch drivers in adult flies and in
larvae using the UAS-GFP reporter. After characterizing these drivers, I used them to
test a number of different genes for effects on life span when over-expressed either
during larval development or in adult flies. For example, I examined the effect of
apoptosis-regulatory gene over-expression on life span: I assayed the effects of fourteen
genes on adult fly life span when they were over-expressed in adult flies or during larval
development, and found that baculovirus p35 and the wingless and Ras genes can have
sex-specific and developmental stage-specific effects on adult Drosophila life span.

In chapter 3, I describe the sex-specific and tissue-specific effects of Drosophila p53
over-expression on adult fly life span. The interaction between p53, IIS pathway, and DR
pathway, is also explored, by looking at the effect of p53 on life span in a foxo null
16

background and in a Sir2 null background. Further, the phosphorylation level of the
FOXO upstream regulator Akt, and the expression level two downstream targets of
FOXO (4E-BP and l(2)efl) were measured to examine effects on signaling through IIS.

Finally, in chapter 4, I screened through several UAS-type P element mutations in genes
that regulate sexual differentiation to test the hypothesis that altered expression of sex-
differentiation genes might give sex-specific effects on life span. Indeed, specific
manipulations of sexual differentiation pathway genes were found to have sex-specific
effects on adult life span.

17

Chapter 2
A screen of apoptosis and senescence regulatory genes for life
span effects when over-expressed in Drosophila
Abstract
Conditional expression of transgenes in Drosophila was produced using the Geneswitch
system, wherein feeding the drug RU486/Mifepristone activates the artificial
transcription factor Geneswitch. Geneswitch was expressed using the Actin5C promoter
and this was found to yield conditional, tissue-general expression of a target transgene
(UAS-GFP) in both larvae and adult flies. Nervous system-specific (Elav-GS) and fat
body-specific Geneswitch drivers were also characterized using UAS-GFP. Fourteen
genes implicated in growth, apoptosis and senescence regulatory pathways were over-
expressed in adult flies or during larval development, and assayed for effects on adult fly
life span. Over-expression of a dominant p53 allele (p53-259H) in adult flies using the
ubiquitous driver produced increased life span in females but not males, consistent with
previous studies. Both wingless and Ras activated form transgenes were lethal when
expressed in larvae, and reduced life span when expressed in adults, consistent with
results from other model systems indicating that the wingless and Ras pathways can
promote senescence. Over-expression of the caspase inhibitor baculovirus p35 during
larval development reduced the mean life span of male and female adults, and also
18

produced a subset of females with increased life span. These experiments suggest that
baculovirus p35 and the wingless and Ras pathways can have sex-specific and
developmental stage-specific effects on adult Drosophila life span, and these reagents
should be useful for the further analysis of the role of these conserved pathways in aging.

Introduction
A number of stresses can cause cells to enter a non-dividing state called cellular
senescence (Campisi, 2005). These stresses include repeated cell division, expression of
activated oncogenes, oxidative stress, and irradiation. The cellular senescence pathway
functions as an anti-tumor mechanism in mammals, and is regulated by the tumor-
suppressor proteins p53 and Rb. Senescence of cells during aging may contribute to
mammalian aging phenotypes by limiting the ability of stem cell populations to replenish
tissues. Several Drosophila tissues are maintained by dividing stem cell populations,
including the gonads (Nystul and Spradling, 2006), the gut (Micchelli and Perrimon,
2006; Ohlstein and Spradling, 2006) and the malpighian tubule (equivalent to mammalian
kidney) (Singh et al., 2007), however it is currently unknown whether alterations in these
stem cell populations during aging has an effect on Drosophila life span.

Apoptosis (programmed cell death) is also implicated in mammalian and Drosophila
aging phenotypes. Regulated apoptosis is required for normal homeostasis in dividing
tissues such as the gut and hematopoetic system, and abnormal apoptotic events have
19

been observed in muscle and other tissues during mammalian aging (Marzetti et al.,
2008). In addition, apoptosis is implicated in several human aging-related diseases, for
example neurodegenerative diseases such as Alzheimer’s disease and Parkinson’s disease
(Bredesen, 2008). In aging Drosophila, abnormal apoptotic events have been observed in
muscle and fat tissue (Zheng et al., 2005), but the extent to which apoptosis (or cellular
senescence) might modulate Drosophila life span remains largely unknown. Several
genes that can affect apoptosis (and senescence) have been found to affect Drosophila
life span, including DPOSH, MnSOD and p53 (Aigaki et al., 2002; Bauer et al., 2005;
Curtis et al., 2007; Tower, 2006). In mammals hyperactive p53 can produce an
accelerated-aging-like phenotype (Ungewitter and Scrable, 2009), and in Drosophila a
dominant-mutant p53 transgene can inhibit insulin-like signaling and cause increased life
span (Bauer et al., 2007). However the extent to which these effects on life span might
be mediated by alterations in apoptosis and/or cellular senescence pathways is largely
unknown. The potential importance of the cellular senescence and apoptosis pathways in
modulating life span prompted a screen of additional genes implicated in these pathways
for life span effects in the fly.

Conditional gene expression systems have several advantages for studies of aging: for
example with the Tet-on system the expression of transgenes is triggered by feeding the
flies the drug doxycycline, and with the Geneswitch system transgene expression is
triggered using the drug RU486/Mifepristone (Ford et al., 2007; Nicholson et al., 2008;
Poirier et al., 2008). These conditional systems allow for transgene expression to be
20

limited to specific life cycle stages such as development or adulthood. Moreover, these
systems provide powerful controls for genetic background effects on life span, since the
control and gene-over-expressing animals have identical genetic backgrounds and differ
only in the presence or absence of the drug. It is often desirable to over-express a gene in
all the tissues of the fly, for example when screening genes for possible life span effects.
We have recently reported the generation of a Geneswitch system driver (called “Act-GS-
255B”), which contains multiple inserts of a construct in which the promoter of the
cytoplasmic actin gene Actin5C is used to drive expression of the Geneswitch
transcription factor (Ford et al., 2007). Here the Act-GS-255B driver is further
characterized using a UAS-GFP reporter, and we report that it is truly tissue-general in
both the larval and adult stages. The tissue general driver facilitated the screening of
senescence and apoptosis regulatory genes for life span effects.
Results
Characterization of Geneswitch drivers in adult flies using the UAS-GFP reporter.
To facilitate the screen of apoptosis and senescence-regulatory genes for life span effects,
several Geneswitch system drivers were characterized for their tissue-specificity of
transgene activation using a UAS-GFP reporter, both in adult flies and during larval
development. The UAS-GFP reporter employed was “UAS-ultraGFP” which contains
multiple copies of a UAS-eGFP construct, and yields particularly high levels of GFP
expression (Yang and Tower, 2009). Three Geneswitch system drivers were
characterized: The Act-GS-255B driver strain contains multiple inserts of a construct in
21

which the promoter from the cytoplasmic actin gene Actin 5C drives Geneswitch, and is
expected to yield tissue-general expression (Ford et al., 2007). The Elav-GS driver
contains Geneswitch under control of the Elav gene promoter and produces nervous-
system-specific expression (Osterwalder et al., 2001). Finally the whole-body fat-body
Geneswitch driver strain (“WB-FB-GS”) contains both a head fat-body driver (S
1
-32) and
a body-fat-body driver (S
1
-106) (Giannakou et al., 2007; Hwangbo et al., 2004a; Roman
et al., 2001), and is expected to yield expression in the fat-body tissue throughout the
animal. The three driver strains were crossed to the UAS-ultraGFP reporter strain to
produce adult progeny containing both the driver and reporter constructs, and the flies
were cultured in the presence and absence of drug for two weeks. GFP expression was
scored in live adult flies as well as in several dissected tissues (Figure 5). The Act-GS-
255B driver was found to yield tissue-general expression of the UAS-ultraGFP reporter
in adult flies. In whole adults, GFP expression was observed throughout the body of both
males and females, with greater expression levels observed in females relative to males.
Similarly with heads dissected in half and bodies dissected in half, expression was
observed in all tissues, including abundant expression in nervous system, muscle
(including flight muscle), and fat-body tissue. Note that flight muscle in male has lower
expression than flight muscle in female, however inspection of the GFP-only image for
male flight muscle (inset) reveals expression throughout this tissue. Abundant expression
was also observed throughout dissected gut tissue, ovary and testes. The expression level
was greater in some regions of the gut than others, however all regions of the gut
exhibited staining, as revealed by inspection of the GFP-only images (inset). All tissues
22

observed showed significant GFP expression, and therefore we conclude that Act-GS-
255B yields truly tissue-general expression in adult flies. The WB-FB-GS driver
produced GFP expression in the head-fat-body and body-fat-body tissues, as expected, as
well as in the gut and testes, and very faint expression in ovary; there was no detectable
expression in nervous, muscle, or other tissues. Notably, the expression in adult male
head fat body was much reduced relative to female head fat body, consistent with recent
characterization of the fat body drivers using a LacZ reporter (Poirier et al., 2008).
Finally, the Elav-GS driver produced abundant expression in the brain and ventral nerve
cord, as expected, and there was no detectable expression in any other tissues; for
example, the muscle, gut and gonads were clearly negative. Note the GFP-only image for
the gut (inset) shows a lack of expression. The Elav-GS driver was found to produce
similar levels of UAS-GFP reporter expression in male versus female in our experiments.

23

Figure 5. Expression pattern produced by GeneSwitch drivers and UAS-GFP reporter in adult flies.
The indicated GeneSwitch drivers Act-GS-255B (“255B”), Elav-GS (“Elav”) and WB-FB-GS (“FB”) were
crossed to the UAS-ultraGFP reporter and adult progeny containing both constructs were scored for GFP
expression in various tissues. Control flies were generated by crossing UAS-ultraGFP to white
1118
strain
flies to produce progeny containing only UAS-ultraGFP. Age-synchronized flies were cultured in the
presence and absence of the drug RU486 for two weeks prior to assay, and GFP expression was scored in
whole adult flies and dissected tissues, as indicated. Each image is the overlay of the visible light and GFP
images. Insets show details of the regions boxed in white, GFP image only. M = male, F = female.
Pictures were taken at the magnification of 20X, 50X, 32X, 20X, 50X, and 80X, for whole fly, head in half,
body in half, gut, ovary, and testes, respectively. The white arrow indicates a region of 255B Female flight
muscle that is obscured by a fragment of cuticle.
24

Characterization of Geneswitch drivers in larvae using the UAS-GFP reporter.
The Geneswitch driver strains were also scored for expression patterns in 3
rd
instar larvae
and dissected tissues (Figure 6). The Act-GS-255B driver was found to yield tissue-
general expression, including abundant expression throughout the body of whole 3
rd

instar larvae, as well as in dissected brain, gut, salivary gland, imaginal discs and fat-
body tissues; all tissues observed showed abundant GFP expression (Figure 6A). The
inset for the Act-GS-255B 3
rd
instar larval brain shows detail of the GFP-only image, and
indicates that expression was present throughout the brain, with higher-level expression
in a subset of cells. The WB-FB-GS driver was found to drive abundant expression in
salivary gland and anterior midgut, but notably no expression in any other larval tissues
including larval fat-body. Finally the Elav-GS driver produced abundant expression in
larval nervous system and no detectable expression in any other larval tissues. The inset
for the Elav-GS 3
rd
instar larval brain shows detail of the GFP-only image, and shows
that expression was present throughout the brain, with higher-level expression in a subset
of cells. Notably this subset of cells was different from that observed above with Act-
GS-255B. Each of the three drivers was found to produce similar patterns of expression
in 1
st
and 2
nd
instar larvae as well (Figure 6B). When the Act-GS-255B driver was
induced using dilutions of RU486 drug in the culture media, it produced a dose-response
of GFP expression in 3
rd
instar larvae (Figure 6D), as well as in adult flies (data not
shown).
25

Figure 6. Expression pattern produced by GeneSwitch drivers and UAS-GFP reporter in larvae. The
crosses are the same as Figure 5, but larvae were cultured in the presence and absence of drug in the food,
from hatching to the indicated developmental stage. A. Expression patterns in 3
rd
instar larvae and dissected
tissues. For the Elav-GS driver (“Elav”) a 1:10 dilution of drug was used because of the toxic effects of
drug observed in larvae with this driver. Pictures were taken at the magnification of 25X, 100X, 20X, 50X,
100X, 80X, for whole larvae, brain, gut, salivary gland, imaginal discs, and fat body, respectively.
26

Figure 6, continued. Expression pattern produced by GeneSwitch drivers and UAS-GFP reporter in
larvae. B. Expression patterns in the three larval stages. For Elav-GS a 1:10 dilution of drug was used to
avoid toxic effects. GFP pictures were taken at the magnification of 100X, 50X, 25X, for 1
st
instar, 2
nd

instar, and 3
rd
instar, respectively. C. Expression in 3
rd
instar larvae using Act-GS-255B and titrations of
drug. ETOH indicates the ethanol solvent for the drug alone. Pictures were taken at the magnification of
25X.

27

Effect of apoptosis and senescence-regulatory gene over-expression on life span.
Fourteen apoptosis and senescence regulatory genes were chosen for analysis based on
their relevance to human apoptosis and senescence pathways and the availability of
reagents for Drosophila. Ras85D is a Drosophila homolog of the human oncogene Ras
that encodes a GTPase involved in signal transduction. Ras85D activated form contains
an amino acid substitution that causes Ras to be constitutively active (Lee et al., 1996),
and Ras85D dominant negative (DN) form contains an amino acid substitution that
causes it to inhibit the endogenous Ras protein (Farnsworth and Feig, 1991; Lee et al., 1996).
Wingless is a Drosophila homolog of the human Wnt signaling protein involved in
development and tumorigenesis (Clevers, 2006). Pk61C is a serine/threonine protein
kinase related to human PDK-1 and involved in growth signaling (Osaki et al., 2004).
DIAP1 is a Drosophila member of the inhibitor of apoptosis protein (IAP) family
(Srinivasula and Ashwell, 2008). Baculovirus p35 is a caspase inhibitor protein also
related to the IAPs. Nemo (nmo) is the Drosophila homolog of a human protein kinase
regulatory subunit involved in NF-kappaB signaling pathway (Cordier et al., 2008). Egfr
is the Drosophila homolog of the human epidermal growth factor receptor (Shilo, 2005).
The Drosophila pointed (pnt) gene encodes a transcription factor homologous to human
Ets1 that is involved in the Ras signaling pathway. The Drosophila Matrix
metalloproteinase 2 gene (Mmp2) is involved in tissue remodeling and tumor
progression and is related to a family of human matrix metalloproteinases (Page-McCaw,
2008). The Drosophila Stat92E gene encodes a homolog of the human Stat transcription
factor, which is a target of the Jak-Stat growth-regulatory pathway (Li, 2008). The
28

Drosophila puckered (puc) gene encodes a phosphatase homologous to the human VH-1
family that antagonizes JNK signaling, and heterozygous puc mutant flies have been
reported to have increased stress resistance and life span (McEwen and Peifer, 2005;
Wang et al., 2003). The Drosophila Sphingosine kinase 2 (Sk2) gene encodes a lipid
kinase involved in activation of protein kinase C-family signaling, and the human
homolog Sphk2 is implicated in regulation of apoptosis (Don et al., 2007). Finally the
CG14544 gene encodes a predicted methyltransferase, and the Drosophila bantam (ban)
gene encodes a micro-RNA that inhibits expression of pro-apoptotic genes (Nolo et al.,
2006). Each of these genes of interest was over-expressed in adult flies or during larval
development, and assayed for effects on adult fly life span.

29

Figure 7. Effect of transgene over-expression on survival of adult flies. Apoptosis and senescence-
related genes wingless, Ras85D, and Ras85D activated form were over-expressed during larval
development or in adults, and assayed for effects on adult life span in male and female flies, as indicated.
The life span assays were performed at 29 C. Open circles represent the no-drug control (“-”). Solid
squares represent adults treated with drug (“A”). Grey triangles represent larvae on drug (“L”). Survival
curves are plotted as a function of adult age in days. Median life span of each cohort is presented along
with p value for log rank test (in parentheses). (A, C, E, G) male flies. (B, D, F, H) female flies. (A, B)
Control flies containing the driver and no target transgene. (C, D) Ras85D activated form. (E, F) Ras85D
wild-type. (G, H) wingless.
30

To control for any possible effects of the Geneswitch system and the RU486 drug itself,
life span was assayed in flies that were the progeny of Act-GS-2555B driver crossed to
either Oregon-R (Or-R) wild-type strain or to the w
1118
control strain, to produce progeny
containing only the driver. In these control flies, treatment with drug produced small, but
statistically significant reductions in life span in both male and female adults: treatment
during adulthood reduced mean life span by -4% to -10%, while treatment in larval stages
reduced adult life span by –8% to -16% (Figure 7A, B; Figure 8A, B; Tables 2, 3). There
were no significant increases in life span in control flies treated with RU486 in any of the
replicate experiments. These data indicate that in these experiments, when the Act-GS-
255B driver is present, the RU486 can cause small but significant reductions in adult life
span, and this effect must be taken into account when interpreting the effects of transgene
over-expression. Other studies (Hwangbo et al., 2004a), including ones from our own
laboratory using the Act-GS-255B driver (Ren et al., 2009), found no negative effects of
RU486 on adult fly life span. We conclude that the small negative effects observed here
result from differences in the lot of RU486 drug, and/or small differences in effective
concentrations due to specifics of media preparation. To confirm that the Act-GS-255B
driver can produce increased life span, it was used to drive over-expression of the
dominant p53 allele (p53-259H). Over-expression of p53-259H in adult flies using the
ubiquitous Act-GS-255B driver produced increased median life span in females (+8%)
but not males (-2.8%), and no life span increase when expressed in larvae (Table 4).
These results are consistent with previous studies showing that expression of p53-259H
in the adult nervous system with the Elav-GS driver can cause increased life span in
31

females (Bauer et al., 2007), and confirms that the Act-GS-255B driver can indeed
produce increased life span when combined with an appropriate target gene.

Most of the genes tested by over-expression with the ubiquitous Act-GS-255B driver did
not affect life span to an extent greater than the small changes observed with the control
flies. However, Ras activated form transgene was lethal when expressed in larvae, and
reduced both male and female life span by –80% when expressed in adults (Figure 7C, D;
Table 3). Over-expression of wild-type Ras or a Ras dominant-negative allele was not
lethal to larvae, and produced only small decreases (-4 to –12%) in both male and female
adult life span (Figure 7 E, F; Table 3), thereby in the range of negative effects observed
with control flies. Over-expression of the wingless gene was found to be lethal to male
and female larvae, using two independent wingless transgenes (Table 3). Over-
expression of wingless in adult flies produced significant reductions in both male and
female life span: ~-42% with one wingless transgene (Figure 7 G, H) and ~-10% with the
other transgene (Table 3).
32

Figure 8. Effect of Baculovirus p35 over-expression on survival of adult flies. Baculovirus p35
transgenes inserted on the X chromosome, chromosome 2, and chromosome 3 were over-expressed during
larval development or adult stage, as indicated. The life span assays were performed at 25 C. Open circles
represent the no-drug control (“-”). Solid squares represent adults treated with drug (“A”). Grey triangles
represent larvae on drug (“L”). Survival curves are plotted as a function of adult age in days. Median life
span of each cohort is presented along with p value for log rank tests (in parentheses). (A, C, E, G) male
flies. (B, D, F, H) female flies. (A,B) Control flies containing the driver and no target transgene. (C, D)
Baculovirus p35 transgene on X chromosome. (E, F) Baculovirus p35 transgene on second chromosome.
(G, H) Baculovirus p35 transgene on third chromosome.
33

Finally, the tissue-general Act-GS-255B driver was used to over-express three different
transgenes encoding the caspase inhibitor Baculovirus p35, during larval development
and in adult flies (Figure 8; Table 4). Over-expression of Baculovirus p35 in adult flies
using the tissue-general Act-GS-255B driver produced only small decreases in life span
that were within the range observed with control flies, suggesting there were no
significant effects in adults. In contrast, when Baculovirus p35 was over-expressed
during larval development using the tissue-general driver, it reduced the mean life span of
male and female adults by –20% to –50%. Interestingly, over-expression of each of the
three independent Baculovirus p35 transgenes during larval development produced an
unusual biphasic-shaped survival curve in adult females (Figure 8 D, F, H), suggesting
the presence of a subset of adult female flies with unchanged or even increased life span.
A Gompertz-Makeham model was found to give the best fit to the life span data for
females in which Baculovirus p35 was over-expressed during larval development (Figure
9; Table 5). This analysis revealed that the decrease in mean life span was due to
increased age-independent mortality. When the age-independent mortality was removed
and the data re-plotted, it revealed a subset of female flies with unchanged (Figure 9 B, F)
or increased life span (Figure 9D).

Two independent Baculovirus p35 transgenes were also over-expressed in adult flies
using the head-fat-body driver S
1
-32, and the whole-body fat-body driver (S
1
-32 plus S
1
-
106), and during larval development using the whole-body fat-body driver, however no
consistent effects on life span were observed (Table 4).
34

The nervous system-specific Elav-GS driver was also used to over-express two
baculovirus p35 transgenes. In adults the Elav-GS driver itself had little to no effect on
life span, and over-expression of baculovirus p35 in adults using Elav-GS had no
consistent effects on life span (Table 4). In contrast, when drug was administered to
larvae, the Elav-GS driver itself was associated with significant decreases in life span in
both males (~-30% to –40%) and females (~-25%), and significantly reduced the number
of male adults, and no effects of the baculovirus p35 transgenes on life span could be
identified in this background (Table 4). In an attempt to reduce this background toxicity
and allow assay of baculovirus p35 transgenes with the Elav-GS driver in larvae, a 1:10
dilution of drug was used. Under these conditions the life span reductions caused by drug
in males and females were smaller (~-2% to –12%), and the number of males obtained
was approximately normal, however no increases in life span were observed upon over-
expression of baculovirus p35 (Table 4).
35

Figure 9. Mortality rate analysis of female larvae with and without Baculovirus p35 transgene
expression. Open circles represent the no-drug control (“-”). Solid squares represent larvae cultured with
drug (“L”). (A, B) Baculovirus p35 transgene on X chromosome. (C, D) Baculovirus p35 transgene on
second chromosome. (E,F) Baculovirus p35 transgene on third chromosome. (A, C, E) Plots of natural-log
mortality rate vs. age in days. (B, D, F) The data were fitted to the Gompertz-Makeham model, which best
described the mortality rate. The age-independent mortality was removed and the survival curves were re-
drawn using only the Gompertz components. Mortality rate analysis showed that age-independent mortality
was significantly higher for female larvae on drug versus control for all three Baculovirus p35 lines (Table
5).
36

The muscle-specific MHC-GS driver was used to drive over-expression of several
transgenes in adult flies, however the MHC-GS driver itself was found to cause a
significant RU486-dependent decrease in life span in both males and females (~-20% to –
30%), and none of the target transgenes tested produced a significant life span increase in
this background (Table 4).

Table 2 Starting Stocks.
St# Genotype Notes Abbreviation
1 w; GS-Actin255-B:+ Ubiquitous GeneSwitch 255B Driver 255B
2 w; GS-Actin255-A;+ Ubiquitous GeneSwitch 255A Driver 255A
3 w; P{Switch}bun[Switch 1-32];+ GeneSwitch Head Fat Body Driver S32
4 w; P{Switch}S1-106 P{Switch}bun[Switch 1-32];+ GeneSwitch Head & Thorax-
Abdomen Fat Body Driver
S106 S32
5 yw; +; GS-Elav GeneSwitch Elav Driver Elav
6 yw; Sp/CyO,FLP.lacZ; MHC:GS GeneSwitch Muscle Driver Sp/CyO,MHC
7 Oregon R ( +; +; +) wild type
8 w1118; +; + wild type
9 P{UAS.p35.H}BH3,w*;+;+ UAS-p35 on chromosome 1 p35
10 w*; P{UAS.p35.H}BH1;+ UAS-p35 on chromosome 2 p35
11 w*; +; P{UAS.p35.H}BH2 UAS-p35 on chromosome 3 p35
12 w1118; +; P{UAS-Ras85D.V12}TL1 UAS-Ras85D activated form Ras act
13 w*; P{UAS-Ras85D.K}5-1;+ UAS-Ras85D WT form Ras WT
14 P{UAS-Ras85D.N17}TL1, w1118; +; + UAS-Ras85D DN form Ras DN
15 w*; P{UAS-wg.H.T:HA1}3C;+ UAS-wg on chromosome 2 wg
a

16 w*; +; P{UAS-wg.H.T:HA1}6C UAS-wg on chromosome 3 wg
b

17 y1 w67c23; +;P{EPgy2}EY04093 EP-Pk61C Pk61C
a

18 w; +; P{EP}Pk61CEP3644/TM6,Tb EP-Pk61C Pk61C
b

19 w*; +; P{UAS-DIAP1.H}3 UAS-DIAP1 DIAP1
20 y1 w67c23; P{EPgy2}EY00935 EP-nmo nmo
21 y1 w*; +; P{UAS-Egfr.B}32-26-1 UAS-Egfr Egfr
22 y1 w67c23; +; P{EPgy2}pntEY03254 EP-pnt pnt
23 y1 w67c23; P{EPgy2}Mmp2EY08942/CyO; + EP-Mmp2 Mmp2
24 y1 w67c23; +; P{EPgy2}Stat92EEY14209/TM3,Sb1
Ser1
EP-Stat92E Stat
25 w*; +; P{EPgy2}pucEY09772/TM6C EP-puc puc
26 y1 w67c23; +; P{EPgy2}scramb2EY01180 EP-Sk2 Sk2
27 y1 w67c23; +; P{EPgy2}EY06207 EP-ban ban
28 w1118; +; PBac{WH}CG14544f01091/TM6B, Tb1 XP-CG14544 CG14544
29 w1118; +; P{GUS-p53.259H}3.1 UAS-p53 point mutation p53.259H

37

Table 3. Life span data of apoptosis-related gene experiments, with means, standard
deviations, medians, percent change in mean and median, and log rank p value.
Cross
MxF RU486 Genotype Sex N Mean
a
Median
%Change
in Median
Log Rank
p Value

Exp1 Life span assay using GS255B driver at 29C

8-1 - w/Y; 255B/+; + M 115 51.53±8.66 53 --------- ---------
A w/Y; 255B/+; + M 120 47.29±11.06 50 -5.66 0.001
L w/Y; 255B/+; + M 40 47.28±12.15 51 -3.77 0.002
- w/w; 255B/+; + F 128 54.18±8.26 56 --------- ---------
A w/w; 255B/+; + F 120 51.74±3.89 52 -7.14 4.38E-09
L w/w; 255B/+; + F 120 48.18±8.38 50 -10.71 6.30E-11
12-1 - w/Y; 255B/+; Ras act/+ M 122 51.11±11.58 55.5 --------- ---------
A w/Y; 255B/+; Ras act/+ M 128 9.45±3.42 10 -81.98 0
L w/Y; 255B/+; Ras act/+ M 0 NA NA --------- ---------
- w/w*; 255B/+; Ras act/+ F 123 54.19±13.26 59 --------- ---------
A w/w*; 255B/+; Ras act/+ F 123 12.11±2.8 12 -79.66 0
L w/w*; 255B/+; Ras act/+ F 0 NA NA --------- ---------
13-1 - w/Y; 255B/Ras WT;+ M 124 46.65±9.01 47 --------- ---------
A w/Y; 255B/Ras WT;+ M 122 42.3±9.13 42 -10.64 1.43E-04
L w/Y; 255B/Ras WT;+ M 47 42.06±10.37 43 -8.51 0.004
- w/w*; 255B/Ras WT;+ F 126 51.31±8.64 52 --------- ---------
A w/w*; 255B/Ras WT;+ F 126 46.84±5.17 46 -11.54 8.15E-12
L w/w*; 255B/Ras WT;+ F 118 43.66±8.85 46 -11.54 0
1-14 - Ras DN, w/Y; 255B/+; + M 127 47.89±9.88 50 --------- ---------
A Ras DN, w/Y; 255B/+; + M 123 43.64±6.87 44 -12 5.78E-08
L Ras DN, w/Y; 255B/+; + M 79 44.76±12.49 48 -4 0.14
- Ras DN, w/w; 255B/+; + F 121 51.65±14.25 57 --------- ---------
A Ras DN, w/w; 255B/+; + F 125 51.82±8.3 53 -7.02 5.09E-04
L Ras DN, w/w; 255B/+; + F 125 45.39±13.16 49 -14.04 1.98E-09
15-1 - w/Y; 255B/wg
a
; + M 130 52.56±8.37 55 --------- ---------
A w/Y; 255B/wg
a
; + M 122 29.83±9.32 32 -41.82 0
L w/Y; 255B/wg
a
; + M 0 NA NA --------- ---------
- w/w*; 255B/wg
a
; + F 122 55.78±12.01 60 --------- ---------
A w/w*; 255B/wg
a
; + F 125 33.61±10.55 34 -43.33 0
L w/w*; 255B/wg
a
; + F 0 NA NA --------- ---------
16-1 - w/Y; 255B/+;wg
b
/+ M 124 52.31±8.81 56 --------- ---------
A w/Y; 255B/+;wg
b
/+ M 131 45.02±8.04 47 -16.07 0
L w/Y; 255B/+;wg
b
/+ M 0 NA NA --------- ---------
- w/w*; 255B/+;wg
b
/+ F 120 51.29±10.38 53 --------- ---------
A w/w*; 255B/+;wg
b
/+ F 123 47.55±7.23 49 -7.55 3.24E-10
L w/w*; 255B/+;wg
b
/+ F 0 NA NA --------- ---------
17-1 - w/Y; 255B/+; Pk61C
a
/+ M 122 47.9±9.67 47 --------- ---------
L w/Y; 255B/+; Pk61C
a
/+ M 21 42.81±13.89 47 0 0.224
- w/yw; 255B/+; Pk61C
a
/+ F 127 49.82±16.97 56 --------- ---------
L w/yw; 255B/+; Pk61C
a
/+ F 121 50.24±11.55 52 -7.14 8.57E-04
18-1 - w/Y; 255B/+; Pk61C
b
/+ M 126 57.29±8.23 59 --------- ---------
L w/Y; 255B/+; Pk61C
b
/+ M 24 48.08±10.99 51 -13.56 4.11E-12
- w; 255B/+; Pk61C
b
/+ F 124 54.51±9.89 56.5 --------- ---------
L w; 255B/+; Pk61C
b
/+ F 121 45.28±13.38 51 -9.73 1.79E-14

38

Table 3, continued.
Cross
MxF RU486 Genotype Sex N Mean
a
Median
%Change
in Median
Log Rank
p Value

19-1 - w/Y; 255B/+; DIAP1/+ M 120 56.23±8.68 59 --------- ---------
L w/Y; 255B/+; DIAP1/+ M 93 47.68±17.07 53 -10.17 0.002
- w/w*; 255B/+; DIAP1/+ F 120 54.64±11.2 57.5 --------- ---------
L w/w*; 255B/+; DIAP1/+ F 117 46.74±14.76 51 -11.3 1.97E-07

7-1 - w/Y; 255B/+; + M 124 52.97±7.68 56 --------- ---------
A w/Y; 255B/+; + M 124 49.73±4.6 50 -10.71 6.19E-13
L w/Y; 255B/+; + M 22 44.5±16.86 52 -7.14 2.94E-05
- w/+; 255B/+; + F 118 58.39±5.25 59 --------- ---------
A w/+; 255B/+; + F 122 52.66±4.09 52 -11.86 0
L w/+; 255B/+; + F 122 50.45±9.78 53.5 -9.32 1.18E-13

Ex 2 Life span assay using GS255B driver at 25C

7-1 - w/Y; 255B/+; + M 94 73.17±15.64 78 --------- ---------
A w/Y; 255B/+; + M 93 69.97±12.33 72 -7.69 5.22E-04
- w/+; 255B/+; + F 92 87.2±18.44 92 --------- ---------
A w/+; 255B/+; + F 91 91.93±7.76 94 2.17 0.940
20-1 - w/Y; 255B/+; nmo/+ M 95 66.74±16.11 68 --------- ---------
A w/Y; 255B/+; nmo/+ M 90 64.66±14.3 66 -2.94 0.102
- w/yw; 255B/+; nmo/+ F 97 67.59±28.66 74 --------- ---------
A w/yw; 255B/+; nmo/+ F 95 68.79±30.17 80 8.11 0.878
15-1 - w/Y; 255B/wg
a
; + M 96 72.88±10.31 74 --------- ---------
A w/Y; 255B/wg
a
; + M 92 53.14±18.01 56 -24.32 0
- w/w*; 255B/wg
a
; + F 97 78.89±19.38 84 --------- ---------
A w/w*; 255B/wg
a
; + F 97 53.72±22.13 52 -38.1 0
17-1 - w/Y; 255B/+; Pk61C
a
/+ M 91 64.11±13.4 64 --------- ---------
A w/Y; 255B/+; Pk61C
a
/+ M 94 62.85±13.08 66 3.13 0.555
- w/yw; 255B/+; Pk61C
a
/+ F 98 70.73±26.23 78 --------- ---------
A w/yw; 255B/+; Pk61C
a
/+ F 94 79.81±23.77 90 15.38 0.149
21-1 - w/Y; 255B/+; Egfr/+ M 89 62.38±11.19 66 --------- ---------
A w/Y; 255B/+; Egfr/+ M 97 62.06±9.18 64 -3.03 0.166
- w/y w*; 255B/+; Egfr/+ F 95 65.71±21.16 68 --------- ---------
A w/y w*; 255B/+; Egfr/+ F 100 63.52±17.9 65 -4.41 0.076
19-1 - w/Y; 255B/+; DIAP1/+ M 102 76.57±13.04 78 --------- ---------
A w/Y; 255B/+; DIAP1/+ M 94 73.4±9.53 74 -5.13 0.002
- w/w*; 255B/+; DIAP1/+ F 98 78.9±18.26 84 --------- ---------
A w/w*; 255B/+; DIAP1/+ F 95 81.39±19.17 88 4.76 0.011
22-1 - w/Y; 255B/+; pnt/+ M 96 62.6±9.74 64 --------- ---------
A w/Y; 255B/+; pnt/+ M 94 59.15±10.7 60 -6.25 0.077
- w/yw; 255B/+; pnt/+ F 92 74.32±27.19 85 --------- ---------
A w/yw; 255B/+; pnt/+ F 95 79.77±20.03 88 3.53 0.402

Exp3 Life span assay using GS255B driver at 25 C

7-1 - w/Y; 255B/+; + M 100 81.01±15.38 86 --------- ---------
A w/Y; 255B/+; + M 92 80.46±10.42 82 -4.65 0.039
- w/+; 255B/+; + F 85 92.49±11.86 94 --------- ---------
A w/+; 255B/+; + F 99 92.05±13.07 94 0 0.571

39

Table 3, continued.
Cross
MxF RU486 Genotype Sex N Mean
a
Median
%Change
in Median
Log Rank
p Value

13-1 - w/Y; 255B/Ras WT;+ M 95 75.87±12.26 78 --------- ---------
A w/Y; 255B/Ras WT;+ M 98 67.92±14.13 70 -10.26 1.62E-06
- w/w*; 255B/Ras WT;+ F 96 83.43±12.26 86 --------- ---------
A w/w*; 255B/Ras WT;+ F 98 79.59±10.58 82 -4.65 0.001
23-1 - w/Y; 255B/Mmp2; + M 96 69.77±13.03 70 --------- ---------
A w/Y; 255B/Mmp2; + M 96 68.81±10.06 70 0 0.117
- w/yw; 255B/Mmp2; + F 98 85.94±18.45 91 --------- ---------
A w/yw; 255B/Mmp2; + F 101 84.85±18.67 90 -1.1 0.109
24-1 - w/Y; 255B/+; Stat/+ M 96 64.31±10.06 65 --------- ---------
A w/Y; 255B/+; Stat/+ M 99 65.08±13.33 68 4.62 0.325
- w/yw; 255B/+; Stat/+ F 99 70.48±21.48 78 --------- ---------
A w/yw; 255B/+; Stat/+ F 96 62.29±24.99 74 -5.13 0.076
25-1 - w/Y; 255B/+; puc/+ M 97 70.78±14.98 70 --------- ---------
A w/Y; 255B/+; puc/+ M 96 68.96±13.62 68 -2.86 0.269
- w/w*; 255B/+; puc/+ F 84 94.07±15.00 98 --------- ---------
A w/w*; 255B/+; puc/+ F 97 98.1±7.86 100 2.04 0.135

Exp4 Life span assay using GS255B driver at 25 C

7-1 - w/Y; 255B/+; + M 92 73.76±18.31 78 --------- ---------
A w/Y; 255B/+; + M 86 71.84±10.87 74 -5.13 1.43E-04
- w/+; 255B/+; + F 86 86.28±15.46 90 --------- ---------
A w/+; 255B/+; + F 101 86.18±10.02 88 -2.22 0.035
26-1 - w/Y; 255B/+; Sk2/+ M 90 67.22±16.97 72 --------- ---------
A w/Y; 255B/+; Sk2/+ M 95 69.85±12.26 72 0 0.953
- w/yw; 255B/+; Sk2/+ F 101 73.29±24.6 84 --------- ---------
A w/yw; 255B/+; Sk2/+ F 106 78.08±19.61 86 2.38 0.84
27-1 - w/Y; 255B/+; ban/+ M 98 66.59±21.91 70 --------- ---------
A w/Y; 255B/+; ban/+ M 95 61.56±18.15 62 -11.43 0.003
- w/yw; 255B/+; ban/+ F 94 76.36±28.78 88 --------- ---------
A w/yw; 255B/+; ban/+ F 96 81.56±18.03 88 0 0.023
28-1 - w/Y; 255B/+;CG14544/+ M 91 75.03±12.8 76 --------- ---------
A w/Y; 255B/+;CG14544/+ M 97 77.01±9.82 78 2.63 0.844
- w/w; 255B/+;CG14544/+ F 101 70.99±26.75 82 --------- ---------
A w/w; 255B/+;CG14544/+ F 96 69.33±20.57 79 -3.66 2.28E-05

Exp5 Life span assay using GS255B driver, and MHC GS driver at 25 C

7-1 - w/Y; 255B/+; + M 98 75.06±11.65 79 --------- ---------
A w/Y; 255B/+; + M 97 73.96±12.27 78 -1.27 0.161
- w/+; 255B/+; + F 100 87.88±7.74 88 --------- ---------
A w/+; 255B/+; + F 101 85.33±12.78 88 0 0.014
8-1 - w/Y; 255B/+; + M 99 66.55±11.82 68 --------- ---------
A w/Y; 255B/+; + M 97 69.84±10.57 72 5.88 0.14
- w/w; 255B/+; + F 100 79.6±14.08 84 --------- ---------
A w/w; 255B/+; + F 97 81.69±3.82 82 -2.38 0.005
17-1 - w/Y; 255B/+; Pk61C
a
/+ M 99 64.87±12.41 64 --------- ---------
A w/Y; 255B/+; Pk61C
a
/+ M 98 62.16±12.33 64 0 0.113
- w/yw; 255B/+; Pk61C
a
/+ F 98 81.96±13.91 86 --------- ---------
A w/yw; 255B/+; Pk61C
a
/+ F 99 80.46±11.15 82 -4.65 0.001
40

Table 3, continued.
Cross
MxF RU486 Genotype Sex N Mean
a
Median
%Change
in Median
Log Rank
p Value

18-1 - w/Y; 255B/+; Pk61C
b
/+ M 100 71.2±9.32 74 --------- ---------
A w/Y; 255B/+; Pk61C
b
/+ M 101 73.33±8.19 74 0 0.135
- w; 255B/+; Pk61C
b
/+ F 98 80.27±12.63 82 --------- ---------
A w; 255B/+; Pk61C
b
/+ F 100 82.02±4.89 82 0 0.399
19-1 - w/Y; 255B/+; DIAP1/+ M 101 72.97±11.13 76 --------- ---------
A w/Y; 255B/+; DIAP1/+ M 101 71.15±11.37 74 -2.63 0.425
- w/w*; 255B/+; DIAP1/+ F 98 83.02±7.52 84 --------- ---------
A w/w*; 255B/+; DIAP1/+ F 106 79.47±12.78 82 -2.38 0.011
7-6 - yw/Y;+/CyO; MHC/+ M 96 71.31±13.18 76 --------- ---------
A yw/Y;+/CyO; MHC/+ M 98 58.92±12.84 60 -21.05 0
- yw/+;+/CyO; MHC/+ F 96 78.04±15.76 84 --------- ---------
A yw/+;+/CyO; MHC/+ F 114 52.84±13.75 58 -30.95 0
8-6 - yw/Y;+/CyO; MHC/+ M 99 56.42±16.69 60 --------- ---------
A yw/Y;+/CyO; MHC/+ M 92 43.26±15 48 -20 1.61E-12
- yw/w;+/CyO; MHC/+ F 93 60.73±18.82 68 --------- ---------
A yw/w;+/CyO; MHC/+ F 99 45.21±13.63 50 -26.47 2.22E-16
17-6 - yw/Y;+/CyO; MHC/Pk61C
a
M 100 54.32±14.66 58 --------- ---------
A yw/Y;+/CyO; MHC/Pk61C
a
M 101 52.46±12.42 56 -3.45 0.004
- yw;+/CyO; MHC/Pk61C
a
F 100 61.3±19.84 65 --------- ---------
A yw;+/CyO; MHC/Pk61C
a
F 99 39.37±14.22 36 -44.62 0
18-6 - yw/Y;+/CyO; MHC/Pk61C
b
M 96 56.44±18.89 62 --------- ---------
A yw/Y;+/CyO; MHC/Pk61C
b
M 108 53.56±10.21 56 -9.68 1.75E-07
- yw/w;+/CyO; MHC/Pk61C
b
F 96 55.25±21.21 56 --------- ---------
A yw/w;+/CyO; MHC/Pk61C
b
F 90 39.42±12.45 38 -32.14 1.40E-11
19-6 - yw/Y;+/CyO; MHC/DIAP1 M 98 66.71±12.27 68 --------- ---------
A yw/Y;+/CyO; MHC/DIAP1 M 98 54.92±10.4 56 -17.65 6.66E-15
- yw/w*;+/CyO;MHC/DIAP1 F 108 64.89±18.19 71 --------- ---------
A yw/w*;+/CyO;MHC/DIAP1 F 104 57.04±14.85 58 -18.31 6.72E-08
7-6 - yw/Y;+/Sp; MHC/+ M 99 68.67±13.38 74 --------- ---------
A yw/Y;+/Sp; MHC/+ M 98 61.76±12.62 64 -13.51 5.34E-08
- yw/+;+/Sp; MHC/+ F 94 73.66±13.99 78 --------- ---------
A yw/+;+/Sp; MHC/+ F 102 59.98±8.45 62 -20.51 0
8-6 - yw/Y;+/Sp; MHC/+ M 96 61.6±14.81 66 --------- ---------
A yw/Y;+/Sp; MHC/+ M 94 54.55±15.5 56 -15.15 2.47E-06
- yw/w;+/Sp; MHC/+ F 93 58.41±17.34 62 --------- ---------
A yw/w;+/Sp; MHC/+ F 102 47.59±12.97 52 -16.13 2.70E-14
17-6 - yw/Y;+/Sp; MHC/Pk61C
a
M 95 49.31±12.75 54 --------- ---------
A yw/Y;+/Sp; MHC/Pk61C
a
M 100 45.14±11.03 48 -11.11 1.95E-04
- yw;+/Sp; MHC/Pk61C
a
F 99 42.99±20.17 40 --------- ---------
A yw;+/Sp; MHC/Pk61C
a
F 100 35.78±16.13 30 -25 0.003
18-6 - yw/Y;+/Sp; MHC/Pk61C
b
M 100 56.36±12.56 60 --------- ---------
A yw/Y;+/Sp; MHC/Pk61C
b
M 98 51.06±9.77 52 -13.33 2.13E-06
- yw/w;+/Sp; MHC/Pk61C
b
F 97 56.6±16.25 60 --------- ---------
A yw/w;+/Sp; MHC/Pk61C
b
F 94 41.79±11.81 42 -30 1.67E-15
19-6 - yw/Y;+/Sp; MHC/DIAP1 M 99 61.21±10.04 62 --------- ---------
A yw/Y;+/Sp; MHC/DIAP1 M 97 55.51±9.17 58 -6.45 5.02E-08
- yw/w*;+/Sp; MHC/DIAP1 F 103 71.13±17.02 78 --------- ---------
A yw/w*;+/Sp; MHC/DIAP1 F 101 62.3±13.23 66 -15.38 6.66E-16
a
Mean life span, days +/- SD.
41

Table 4. Life span data for baculovirus p35 experiments, with means, standard
deviations, medians, percent change in mean and median, and log rank p value.
Cross
MxF RU486 Genotype Sex N Mean
a
Median
%Change
in Median
Log Rank
p Value

Exp1 Life span assay of three UAS-p35 lines and UAS-p53.259H with GS255B driver at 25 C

7-1 - w/Y; 255B/+; + M 120 84.6±14.25 90 --------- ---------
A w/Y; 255B/+; + M 119 83.08±10.94 86 -4.44 0.014
L w/Y; 255B/+; + M 123 78.44±22.48 86 -4.44 0.244
- w/+; 255B/+; + F 116 92.02±9.64 94 --------- ---------
A w/+; 255B/+; + F 121 94.69±8.61 94 0 0.009
L w/+; 255B/+; + F 124 91.97±15.74 94 0 0.047
1-9 - p35,w*/Y; 255B/+; + M 120 68.93±12.49 70 --------- ---------
A p35,w*/Y; 255B/+; + M 123 68.62±11.76 70 0 0.681
L p35,w*/Y; 255B/+; + M 98 33.1±22.91 26 -62.86 0
- p35,w*/+; 255B/+; + F 122 83.28±15.13 86 --------- ---------
A p35,w*/+; 255B/+; + F 130 77.15±20.92 82 -4.65 0.11
L p35,w*/+; 255B/+; + F 125 57.52±35.8 70 -18.6 0.001
10-1 - w/Y; 255B/p35; + M 117 54.48±13 54 --------- ---------
A w/Y; 255B/p35; + M 121 57.26±8.45 58 7.41 0.583
L w/Y; 255B/p35; + M 110 34.25±19.5 34 -37.04 5.60E-10
- w/w*; 255B/p35; + F 120 64.05±14.63 66 --------- ---------
A w/w*; 255B/p35; + F 126 60.79±16.68 66 0 0.188
L w/w*; 255B/p35; + F 123 49.37±32.2 54 -18.18 0.436
11-1 - w/Y; 255B/+; p35/+ M 133 86.03±12.51 90 --------- ---------
A w/Y; 255B/+; p35/+ M 122 81.31±13.87 84 -6.67 8.92E-06
L w/Y; 255B/+; p35/+ M 56 46.18±24.21 44 -51.11 0
- w/w*; 255B/+; p35/+ F 126 87.54±10.04 90 --------- ---------
A w/w*; 255B/+; p35/+ F 127 82.19±9.91 82 -8.89 8.60E-05
L w/w*; 255B/+; p35/+ F 126 64.63±29.62 75 -16.67 4.67E-07
29-1 - w/Y; 255B/+;p53.259H/+ M 118 71.54±13.86 72 --------- ---------
A w/Y; 255B/+;p53.259H/+ M 125 68.90±10.41 70 -2.78 0.002
L w/Y; 255B/+;p53.259H/+ M 119 67.73±16.92 70 -2.78 0.069
- w; 255B/+; p53.259H/+ F 119 75.40±8.50 76 --------- ---------
A w; 255B/+; p53.259H/+ F 119 80.66±10.98 82 7.89 4.05E-08
L w; 255B/+; p53.259H/+ F 125 70.24±22.02 76 0 0.202

Exp2 Life span assay of three UAS-p35 lines with head FB driver, whole body FB driver and GS255A driver at 25 C

3-7 - +/Y; S32/+; + M 75 59.23±14.11 64 --------- ---------
A +/Y; S32/+; + M 63 55.21±15.74 60 -6.25 0.013
- w/+; S32/+; + F 111 59.91±18.96 60 --------- ---------
A w/+; S32/+; + F 115 63.77±17.71 66 10 0.263
3-9 - p35,w*/Y; S32/+; + M 122 62.69±10.62 64 --------- ---------
A p35,w*/Y; S32/+; + M 105 58.3±13.45 60 -6.25 0.022
- p35,w*/w; S32/+; + F 112 59.95±25 72 --------- ---------
A p35,w*/w; S32/+; + F 108 59±24.86 68 -5.56 0.974
3-10 - w*/Y; S32/p35; + M 123 45.19±7.61 46 --------- ---------
A w*/Y; S32/p35; + M 120 41.52±6.84 42 -8.7 1.96E-04
- w*/w; S32/p35; + F 121 61.62±8.71 62 --------- ---------
A w*/w; S32/p35; + F 105 63.28±10.6 66 6.45 0.036

42

Table 4, continued.
Cross
MxF RU486 Genotype Sex N Mean
a
Median
%Change
in Median
Log Rank
p Value

3-11 - w*/Y; S32/+; p35/+ M 125 62.67±12.41 64 --------- ---------
A w*/Y; S32/+; p35/+ M 125 60.78±14.07 62 -3.13 0.174
- w*/w; S32/+; p35/+ F 109 68.44±17.09 74 --------- ---------
A w*/w; S32/+; p35/+ F 113 70.52±18.12 76 2.7 0.043
4-7 - +/Y; S106 S32/+; + M 116 54.12±9.89 56 --------- ---------
A +/Y; S106 S32/+; + M 118 52.68±9.77 52 -7.14 0.208
- w/+; S106 S32/+; + F 110 58.82±14.95 62 --------- ---------
A w/+; S106 S32/+; + F 120 58.07±16.45 63 1.61 0.569
4-9 - p35,w*/Y; S106 S32/+; + M 121 47.21±8.48 46 --------- ---------
A p35,w*/Y; S106 S32/+; + M 110 47.67±10.28 48 4.35 0.263
- p35,w*/w; S106 S32/+; + F 119 55.18±22.95 66 --------- ---------
A p35,w*/w; S106 S32/+; + F 126 47.79±24.9 62 -6.06 0.01
4-10 - w*/Y; S106 S32/p35; + M 125 33.39±4.44 34 --------- ---------
A w*/Y; S106 S32/p35; + M 125 32.3±6.16 32 -5.88 0.475
- w*/w; S106 S32/p35; + F 121 49.55±8.14 50 --------- ---------
A w*/w; S106 S32/p35; + F 121 50.84±8.85 50 0 0.107
4-11 - w*/Y; S106 S32/+; p35/+ M 125 47.15±6.81 48 --------- ---------
A w*/Y; S106 S32/+; p35/+ M 117 48.6±8.42 48 0 0.072
- w*/w; S106 S32/+; p35/+ F 125 56.81±13.02 60 --------- ---------
A w*/w; S106 S32/+; p35/+ F 116 60.69±11.7 64 6.67 0.004
2-7 - +/Y; 255A/+; + M 114 66.04±8.95 67 --------- ---------
A +/Y; 255A/+; + M 117 58.97±15.36 62 -7.46 1.48E-05
- w/+; 255A/+; + F 114 72.65±13.95 78 --------- ---------
A w/+; 255A/+; + F 116 75.02±13.19 78 0 0.064
2-9 - p35,w*/Y; 255A/+; + M 111 65.98±14.65 66 --------- ---------
A p35,w*/Y; 255A/+; + M 115 59.82±13.31 60 -9.09 3.78E-05
- p35,w*/w; 255A/+; + F 113 58.95±20.26 64 --------- ---------
A p35,w*/w; 255A/+; + F 117 69.21±17.4 72 12.5 1.32E-06
2-10 - w*/Y;255A/p35; + M 113 48.98±9.74 48 --------- ---------
A w*/Y;255A/p35; + M 125 47.66±7.19 48 0 0.03
- w*/w; 255A/p35; + F 115 60.57±16.71 66 --------- ---------
A w*/w; 255A/p35; + F 118 62±17.79 70 6.06 0.052
2-11 - w*/Y; 255A/+; p35/+ M 115 63.66±11.4 64 --------- ---------
A w*/Y; 255A/+; p35/+ M 114 64.92±9.41 64 0 0.776
- w*/w; 255A/+; p35/+ F 120 67.05±11.58 70 --------- ---------
A w*/w; 255A/+; p35/+ F 120 68.75±9.08 70 0 0.41

Exp3 Life span assay of two UAS-p35 lines with whole body FB driver at 29 C

7-4 - w/Y; S106 S32/+; + M 124 49.15±12.5 54 --------- ---------
L w/Y; S106 S32/+; + M 121 49.11±10.75 52 -3.7 0.655
- w/+; S106 S32/+; + F 121 51.95±10.82 54 --------- ---------
L w/+; S106 S32/+; + F 118 55.29±10.06 60 11.11 0.029
8-4 - w/Y; S106 S32/+; + M 121 47.16±10.27 48 --------- ---------
L w/Y; S106 S32/+; + M 118 42.85±12.89 44 -8.33 0.002
- w/w; S106 S32/+; + F 124 50.48±11.91 56 --------- ---------
L w/w; S106 S32/+; + F 125 51.63±8.47 54 -3.57 0.196

43

Table 4, continued.
Cross
MxF RU486 Genotype Sex N Mean
a
Median
%Change
in Median
Log Rank
p Value

10-4 - w/Y; S106 S32/p35; + M 121 50.43±6.73 52 --------- ---------
L w/Y; S106 S32/p35; + M 121 46.5±8.28 48 -7.69 4.23E-05
- w*/w; S106 S32/p35; + F 120 50.4±12.84 56 --------- ---------
L w*/w; S106 S32/p35; + F 129 48.57±8.9 50 -10.71 1.45E-05
11-4 - w/Y; S106 S32/+; p35/+ M 126 44.03±6.5 46 --------- ---------
L w/Y; S106 S32/+; p35/+ M 122 41.92±10.42 46 0 0.208
- w*/w; S106 S32/+; p35/+ F 122 58.03±6.59 60 --------- ---------
L w*/w; S106 S32/+; p35/+ F 124 54.81±8.05 56 -6.67 8.84E-07

Exp4 Life span assay of two UAS-p35 lines with Elav driver at 29 C

7-5 - yw/Y; +/+; Elav/+ M 131 53.92±7.15 54 --------- ---------
A yw/Y; +/+; Elav/+ M 129 52.33±8.14 53 -1.85 0.083
L yw/Y; +/+; Elav/+ M 59 35.85±10.58 38 -29.63 0
- yw/+; +/+; Elav/+ F 127 58.15±7.22 60 --------- ---------
A yw/+; +/+; Elav/+ F 129 57.11±5.19 58 -3.33 0.013
L yw/+; +/+; Elav/+ F 120 43.46±7.94 44 -26.67 0
8-5 - yw/Y; +/+; Elav/+ M 126 44.08±8.36 44.5 --------- ---------
A yw/Y; +/+; Elav/+ M 120 43.32±8.76 45 1.12 0.186
L yw/Y; +/+; Elav/+ M 102 26.24±8.51 26 -41.57 0
- yw/w; +/+; Elav/+ F 124 46.88±9.92 50 --------- ---------
A yw/w; +/+; Elav/+ F 124 48.13±7.5 49.5 -1 0.406
L yw/w; +/+; Elav/+ F 114 34.82±10.34 36 -28 0
10-5 - yw/Y; p35/+; Elav/+ M 125 42.34±6.38 44 --------- ---------
A yw/Y; p35/+; Elav/+ M 122 43.34±10.34 46 4.55 0.007
L yw/Y; p35/+; Elav/+ M 9 20.89±10.3 26 -40.91 0
- yw/w*; p35/+; Elav/+ F 121 49±10.63 52 --------- ---------
A yw/w*; p35/+; Elav/+ F 126 50.16±6.4 51 -1.92 0.014
L yw/w*; p35/+; Elav/+ F 9 28.22±10.27 32 -38.46 1.60E-14
11-5 - yw/Y; +; Elav/p35 M 120 51.24±10.46 54 --------- ---------
A yw/Y; +; Elav/p35 M 121 48.62±10.1 52 -3.7 1.22E-06
L yw/Y; +; Elav/p35 M 1 10±NA 10 -81.48 5.60E-10
- yw/w*; +; Elav/p35 F 118 56.77±3.89 58 --------- ---------
A yw/w*; +; Elav/p35 F 131 52.67±5.08 54 -6.9 3.51E-13
L yw/w*; +; Elav/p35 F 0 NA NA --------- ---------

Exp5 Life span assay of two UAS-p35 lines with GS255B driver at 25 C

8-1 - w/Y; 255B/+; + M 121 62.33±18.12 68 --------- ---------
L w/Y; 255B/+; + M 119 62.57±16.22 68 0 0.478
L1-10 w/Y; 255B/+; + M 120 66.02±19.38 72 5.88 7.82E-04
- w/w; 255B/+; + F 123 75.95±9.37 78 --------- ---------
L w/w; 255B/+; + F 124 69.02±12.88 74 -5.13 7.69E-07
L1-10 w/w; 255B/+; + F 124 78.18±9.17 80 2.56 7.84E-04
10-1 - w/Y; 255B/p35; + M 111 56.32±25.51 66 --------- ---------
L w/Y; 255B/p35; + M 4 16±21.6 7 -89.39 6.47E-05
L1-10 w/Y; 255B/p35; + M 117 58.56±17.95 62 -6.06 0.528
- w/w*; 255B/p35; + F 119 68.47±13.26 72 --------- ---------
L w/w*; 255B/p35; + F 30 27.47±16.58 24 -66.67 0
L1-10 w/w*; 255B/p35; + F 124 64.5±16.45 70 -2.78 0.757
44

Table 4, continued.
Cross
MxF RU486 Genotype Sex N Mean
a
Median
%Change
in Median
Log Rank
p Value

11-1 - w/Y; 255B/+; p35/+ M 117 66.15±9.97 68 --------- ---------
L w/Y; 255B/+; p35/+ M 1 14±NA 14 -79.41 3.38E-14
L1-10 w/Y; 255B/+; p35/+ M 123 64.98±15.73 70 2.94 0.099
- w/w*; 255B/+; p35/+ F 123 74.41±5.98 76 --------- ---------
L w/w*; 255B/+; p35/+ F 0 NA NA --------- ---------
L1-10 w/w*; 255B/+; p35/+ F 123 74.37±11.95 78 2.63 0.003

Exp6 Life span assay of two UAS-p35 lines with Elav driver at 25C

8-5 - yw/Y; +/+; Elav/+ M 108 61.69±17.95 67 --------- ---------
L1-10 yw/Y; +/+; Elav/+ M 115 54.17±15.55 58 -13.43 1.80E-08
- yw/w; +/+; Elav/+ F 120 57.42±14.79 64 --------- ---------
L1-10 yw/w; +/+; Elav/+ F 117 56.41±10.82 58 -9.38 0.004
10-5 - yw/Y; p35/+; Elav/+ M 121 46.6±7.2 46 --------- ---------
L1-10 yw/Y; p35/+; Elav/+ M 115 37.81±9.05 38 -17.39 7.06E-14
- yw/w*; p35/+; Elav/+ F 123 50.63±15.32 54 --------- ---------
L1-10 yw/w*; p35/+; Elav/+ F 121 49.19±12.16 50 -7.41 0.035
11-5 - yw/Y; +; Elav/p35 M 120 54.32±13.04 56 --------- ---------
L1-10 yw/Y; +; Elav/p35 M 111 52.31±10.98 52 -7.14 0.037
- yw/w*; +; Elav/p35 F 123 52.7±13.97 54 --------- ---------
L1-10 yw/w*; +; Elav/p35 F 118 56.63±10.73 58 7.41 0.091
a
Mean life span, days +/- SD.

Table 5. Parameters for Gompertz-Makeham model and likelihood ratio test results.
Parameters L - chi^2 df p Value chi^2 df p Value
Females
one parameter compared at each time
p35 (X)
Both a and b are
constrained
a 5.39 x 10
-9
3.96 x 10
-7
1.789 1 0.181
b 3.89 x 10
-1
3.00 x 10
-1
1.516 1 0.218
c 2.08 x 10
-2
1.63 x 10
-3
59.967 1 <0.001 57.983 1 <0.001

p35 (2) b is constrained
a 7.71 x 10
-6
2.10 x 10
-4
5.234 1 0.022 50.203 1 <0.001
b 2.41 x 10
-1
1.92 x 10
-1
1.700 1 0.192
c 2.52 x 10
-2
1.37 x 10
-3
50.610 1 <0.001 50.154 1 <0.001

p35 (3)
Both a and b are
constrained
a 3.31 x 10
-6
3.00 x 10
-6
0.003 1 0.958
b 2.50 x 10
-1
2.46 x 10
-1
0.009 1 0.923
c 1.36 x 10
-2
1.80 x 10
-4
46.090 1 <0.001 66.787 <0.001

45

Discussion
The tissue and temporal specificity of transgene expression can have significant effects
on Drosophila life span, and therefore the ability meaningfully to interpret results
depends upon careful characterization of the expression patterns produced by the system
chosen to drive transgene expression (Poirier et al., 2008; Tower, 2000). Here the
Geneswitch system driver Act-GS-255B was found to yield tissue-general expression of
target transgenes in both larvae and adults, including modulation of expression by
titrating the concentration of drug in the food. Some sex-dependent effects on expression
were observed with the Geneswitch drivers. For example, Act-GS-255B produced tissue-
general expression in both males and females, however females consistently exhibited
higher levels of expression than males. Poirier et al have recently reported that the
Geneswitch driver S
1
-106 (head fat body) is active in adult females but not males (Poirier
et al., 2008), and we found a similar result. Poirier et al also reported that the Elav-GS
(nervous system) driver had a female bias, but in our experiments the Elav-GS driver
supported similar levels of UAS-GFP expression in males and females. It was
particularly striking that while the S
1
-106 and S
1
-32 drivers produced abundant target
gene expression in adult fat body, they did not support expression in the larval fat body.

For the Elav-GS driver, previous studies have reported pan-neuronal expression in larvae
using a UAS-eGFP reporter (Osterwalder et al., 2001), nervous system-specific
expression in adults using a UAS-eGFP reporter (Ford et al., 2007), and expression in a
46

subset of neurons in brain and ventral nerve cord in adults using a UAS-LacZ reporter
(Poirier et al., 2008). Here, using the UAS-ultraGFP reporter, Elav-GS was found to
produce pan-neuronal staining (i.e., expression in all nervous tissue), plus higher-level
expression in a subset of neurons, in both larvae and adults, whereas no expression was
observed in any tissues other than nervous system in either larvae or adults. In contrast,
Poirier et al reported that the Elav-GS driver produced staining in the digestive system
(gut) when it was tested with the UAS-LacZ reporter, and that this signal in gut was not
induced by drug (Poirier et al., 2008). One possible explanation for this difference in
results is that the endogenous Drosophila β-galactosidase is expressed in sub-regions of
the gut (Schnetzer and Tyler, 1996), and this could have resulted in a background signal
when staining for transgenic LacZ activity. Alternatively, the expression pattern
produced by the Elav-GS driver might be affected by culture conditions or genetic
background differences.

When the Act-GS-255B ubiquitous driver was used to drive expression of the p53-259H
transgene in adult flies, it produced life span extension in females, consistent with
previous results using the Elav-GS driver (Bauer et al., 2005), and therefore
demonstrating that the Act-GS-255B driver can produce increased life span when
combined with an appropriate target gene. Of the fourteen candidate genes tested by
over-expression, only a subset caused significant and reproducible effects on life span:
wingless and Ras activated form caused negative effects, while baculovirus p35 produced
both positive and negative effects depending upon sex and developmental stage for over-
47

expression. Care must be taken when interpreting negative effects on life span, since life
span might be decreased due to a novel pathology unrelated to the normal mechanisms
modulating life span. However, that said, it is interesting that these particular
genes/pathways were identified from among the set of genes tested.

Over-expression of wingless using the tissue-general Act-GS-255B driver was lethal to
male and female larvae, and when expressed in adult flies wingless dramatically
decreased both male and female life span. In Drosophila, wingless signaling promotes
maintenance of the gut stem cells (Lin et al., 2008; Takashima et al., 2008) and somatic
stem cells in the ovary (Song and Xie, 2003). Interestingly, the wingless homolog Wnt
and the Wnt signaling pathway have been implicated in modulating aging-related cellular
phenotypes in mammals (DeCarolis et al., 2008): Wnt signaling is implicated in tissue
homeostasis and the maintenance of adult stem cell populations in younger mammals,
while conversely Wnt signaling is implicated in promoting senescence of muscle stem
cells in aging mammals (Brack and Rando, 2007). Moreover, the Klotho gene appears to
function by inhibiting Wnt signaling, and Klotho mutation produces an accelerated aging-
like phenotype in mice (Liu et al., 2007), consistent with a pro-aging effect of the Wnt
pathway. Drosophila stem cell populations show defects in replicative homeostasis
during aging in the gut (Biteau et al., 2008; Choi et al., 2008) and gonads (Boyle et al.,
2007; Pan et al., 2007; Wallenfang et al., 2006; Zhao et al., 2008), however it is currently
unknown to what extent alterations in stem cell function might limit adult Drosophila life
span. It will be of interest to determine if wingless over-expression reduces adult fly life
48

span by disrupting the function of one or more stem cell populations, and to further
explore the role of wingless signaling in the maintenance of stem cell populations during
Drosophila aging.

Over-expression of Ras activated form during Drosophila larval development was lethal
to males and females, and when expressed in adult flies it dramatically decreased both
male and female life span. Ras signaling has been found to shorten life span and promote
cellular senescence in yeast and mammals (Bihani et al., 2007; Courtois-Cox et al., 2006;
Di Micco et al., 2006; Fabrizio et al., 2005; Hlavata et al., 2008; Longo, 2004), whereas
in contrast Ras signaling is reported to promote longevity in long-lived C. elegans Daf-2
insulin-like receptor mutants (Nanji et al., 2005). It will be of interest in the future to test
in what tissue Ras activated form acts to decrease adult fly life span and to determine if
this might result from an induction of cellular senescence.

Over-expression of the caspase inhibitor baculovirus p35 in adult flies using the tissue-
general Act-GS-255B driver had little to no effect on life span, using three independent
baculovirus p35 transgenes. In addition, over-expression of the caspase inhibitor DIAP1
in adults had no consistent effects on life span. While caution must be exercised in
interpreting a negative result, it would tend to suggest that adult fly life span is not
limited by a canonical caspase-dependent apoptotic pathway. Relevant to this idea, the
apoptotic events in aging rat skeletal muscle are reported to be relatively caspase-
independent (Marzetti et al., 2008). When baculovirus p35 was expressed during larval
49

development using the tissue-general Act-GS-255B driver, it caused reduced mean life
span in the resultant male and female adult flies, consistent with the requirement for
regulated apoptosis in normal fly development. However, the female adults that resulted
from tissue-general baculovirus p35 over-expression during development exhibited an
unusual bi-phasic survival curve that included a subset of adult females with increased
life span. This bi-phasic curve and subset of long-lived females was not observed with
nervous-system expression of baculovirus p35 in larvae using the Elav-GS driver,
suggesting that nervous-tissue may not be the critical tissue; however, these experiments
were confounded by toxic effect of the Elav-GS driver itself in drug-treated larvae. It will
be of interest in the future to determine what might be the mechanism by which
baculovirus p35 over-expression in larvae produces a subset of females with increased
life span, and if it might result from the inhibition of apoptosis in some critical tissue
during female development.

Methods
Drosophila Strains. All the target transgenes for over-expression (Table 2) were
obtained from Bloomington Drosophila Stock Center. The ubiquitous Geneswitch driver
lines Act-GS-255B and Act-GS-255A contain multiple copies of a P element construct in
which expression of the Geneswitch cDNA is under the control of the tissue-general
Actin5C promoter (Ford et al., 2007). The UAS-ultraGFP strain contain multiple copies
of a UAS-eGFP construct, and its construction and characterization have been recently
50

described (Yang and Tower, 2009). The Geneswitch system drivers Elav-GS, MHC-GS,
S
1
-32 and S
1
-106 were generously provided by T. Osterwalder and R. Davis (Osterwalder
et al., 2001; Roman et al., 2001).

Drosophila Culture. Drosophila culture and life span assays were performed as
described previously (Ford et al., 2007). GeneSwitch virgins were used in the crosses
with males of other lines, with the exception of strains in which the target transgene for
over-expression was on the X chromosome. Life span assays consisted of ~25 flies per
vial, and a total 5 vials for each cohort. For survival assays performed at 25
o
C, flies were
transferred to new vials ever other day. For survival assays preformed at 29
o
C flies were
transferred to new vials every other day during the first 30-40 days, and then every day
for the remainder of the life span. RU486 (Mifepristone, Sigma) was dissolved in ethanol
(100%) to make a stock solution of 3.2mg/ml. For adult feeding, 50ul RU486 stock
solution was added to the surface of each vial to produce a final concentration of
~160ug/ml; 50ul ethanol was added to the control vials. For larval feeding, 0.5ml of
3.2mg/ml RU486 stock solution (or the indicated diluted concentration) was added to the
surface of each bottle to produce a final concentration of ~160ug/ml (or indicated diluted
concentration); 0.5ml ethanol was added to control bottles.

GeneSwitch Driver Characterization. Adult flies were cultured in vials in the presence
and absence of drug for two weeks prior to dissection. Adult male and female flies, head
in half, body in half, midgut and hindgut, ovary and testes, were photographed. Larvae at
51

1
st
instar, 2
nd
instar and 3
rd
instar, as well as 3
rd
instar dissected tissues (brain, midgut and
hindgut, salivary gland, imaginal discs, and fat body) were also photographed. The Leica
MZ FLIII fluorescence stereomicroscope together with the SPOT software were used for
photographs: The GFP pictures were taken under the fluorescent light with exposure time
4 sec and a gain of 2.

Statistical Analysis. Mean, standard deviation, median, percent change in mean, percent
change in median, and log rank p value were calculated using R 2.6.2
(RDevelopmentCoreTeam, 2006). Analysis of mortality rate was performed with the
WinModest statistical package (Pletcher, 1999). In the Gompertz-Makeham model, the
increase

of mortality (µ
x
) with age (x) is expressed as: µ
x

= ae
bx
+c, where the constant a is
the initial mortality

rate, b is the rate of exponential increase in mortality, and c is the age-
independent mortality. The age specific mortality rate (µ
x
) was calculated using
WinModest by binning the days over which deaths were counted (since fly deaths were
recorded every other day) such that µ
x
= (-ln(N
x + x
/ N
x
)) / 
x
(or P
x
= N
x + x
/ N
x
and µ
x

= -1/ 
x
ln(P
x
)), where N
x
is the number of flies alive at day x and 
x
is the bin size (2).
Parameters (a, b, c) were also calculated based on a likelihood ratio test. The full model
(ae
bx
+c) was plotted, and the Gompertz-only component (ae
bx
) was used to build the
decomposed survival curves, using µ
x
: µ
x

= ae
bx
, P
x

= e
-µ x
. For the decomposed survival
curves, any value below 0.5% survival was considered to be the final data point.

52

Chapter 3
Tissue-specific, sexually antagonistic effects of p53 on
Drosophila life span and Akt phosphorylation depend upon
foxo and Sir2

Abstract
We have previously demonstrated that tissue-general over-expression of wild-type p53 in
adult Drosophila increases life span in males, but decreases life span in females. Here we
report that nervous system-specific over-expression of p53 yields the opposite pattern:
increased life span in females and decreased life span in males. In a foxo null
background, p53 life span effects in males were reversed, becoming similar to the effects
in females, whereas in a Sir2 null background the magnitude of p53 effects in males and
females was reduced. foxo was required for normal levels of Akt phosphorylation in
adult flies, suggesting that foxo acts both downstream and upstream of Akt
phosphorylation. Nervous system-specific over-expression of p53 also had sexually
antagonistic effects on Akt phosphorylation levels. The data suggest that the sexual
differentiation pathway interacts with foxo and Sir2 to enable sexually-antagonistic
effects of p53 on adult fly insulin-like signaling and life span.

53

Introduction
The p53 gene encodes a tumor suppressor, and is mutated in the majority of human
cancers (Levine, 1997). The p53 gene product is a transcription factor, and in response to
DNA damage and other stresses p53 can activate expression of cell cycle arrest genes to
allow time for repair, or can activate apoptosis genes to facilitate elimination of abnormal
cells. The p53 protein can also interact directly with mitochondria to induce apoptosis,
and appears to function in normal cells to regulate cellular metabolism and ROS levels.

Several lines of evidence implicate p53 in aging. In humans, p53 activity declines with
age (Feng et al., 2007), while paradoxically, the gene expression pattern observed in old
mice is similar to that produced by activated p53 (Edwards et al., 2007). Truncated forms
of p53 protein in mice can cause a premature aging-like phenotype, apparently by causing
a state of p53 hyperactivation, whereas co-over-expression of an additional copy of intact
wild-type p53 allele with an additional copy of p19ARF, which is a tumor suppressor that
activates p53,can enhance cancer resistance and delayed aging in mice (Matheu et al.,
2007). Taken together, the data from mammals suggest that increased levels of “normal”
p53 can reduce cancer incidence and promote longevity, whereas hyper-activated p53
forms can promote aging.

Mutations in the p53 DNA binding domain can result in dominant negative forms of the
protein, that antagonize normal p53 function. Previously, nervous system-specific
54

expression of a dominant negative form of p53 in adult flies has been shown to increase
life span, with correlated effects of decreased insulin/IGF1-like signaling (IIS) (Bauer et
al., 2007), but not under dietary restriction or dSir2 over-expression condition (Bauer et
al., 2005; Johannes H. Bauer, 2009). Similarly, in C. elegans, RNA interference (RNAi)
or

genetic knockout of p53 homolog, cep-1, resulted in the increase of life span, which
was dependent on foxo and correlated with Sir2 expression (Arum and Johnson, 2007).
We have previously shown that wild-type p53 can cause increased life span when over-
expressed during development, and that in adults wild-type p53 has sex specific effects.
Over-expression of wild type p53 in a tissue-general pattern in adult flies produced
increased life span in females, and decreased life span in males, consistent with a sexual
antagonistic pleiotropy property for p53 (Waskar et al., 2009). Here we determine that
the sexually antagonistic effects of p53 are tissue-specific, and that they are dependent
upon the foxo and Sir2 genes, which are the main regulators of insulin/IGF1-like
signaling (IIS) pathway and dietary restriction pathway, respectively.

Results
To produce over-expression of p53 in adult flies, the Geneswitch system was utilized,
where transgene expression is induced by feeding the flies the drug RU486
(Mifepristone). To control for any effects of the drug itself, the Act-GS-255B driver line
was crossed to w1118 control strain, to produce progeny containing only the Act-GS-
255B driver and no target transgene. In these control flies the drug was found to cause a
55

slight increase in life span <4% (Figure 10 A, B). In other control experiments a slight
decrease was observed (Table 7 Exp3 and Exp4), indicating a small range of changes
produced by the drug that we interpret as the background of the assay.

Three independent transgenes encoding wild type p53 were over-expressed in adult flies
(indicated as p53 WT 1, 2, 3 in Figure 10), and a consistent pattern of changes was
observed across all three transgenes. In males life span was increased from 10 to 18
percent, whereas in females life span was decreased from 4 to 6 percent. This is
consistent with a previous assay of p53 WT 3 where male life span was increased 8
percent and female life span was decreased 15 percent (Waskar et al., 2009). These
results demonstrate that tissue-general over-expression of wild-type p53 produces
opposite effects on life span in males versus females, consistent with an antagonistic
pleiotropy model for p53 (results summarized in Figure 15A).

Strikingly, an opposite pattern of effects in males and females was observed when p53
was over-expressed specifically in nervous tissue using the Elav-GS driver (Figure 11 C-
F). When over-expressed in adult fly nervous system, p53 decreased life span in males
and increased life span in females. Because tissue-general over-expression includes
nervous-system expression, the difference in effects between tissue-general and nervous-
system-specific p53 over-expression suggests that signaling between tissues is involved
in producing the effects on adult life span.

56

Figure 10. Effect of ubiquitous p53 over-expression on survival of adult flies. p53 were over-expressed
ubiquitously in wildtype background or in foxo-/- background in adults, and assayed for effects on adult
life span in male and female flies, as indicated. The life span assays were performed at 29 ̊ C. Open circles
represent the no-drug control (“-“). Solid squares represent adults treated with drug (“+”).Survival curves
are plotted as a function of adult age in days. Mean life span of each cohort is presented along with p value
for log rank test (in parentheses). (A, C, E, G, I, K) male flies. (B, D, F, H, J, L) female flies. (A, B)
Control flies containing the driver and no target transgene. (C, D) p53WT trangene line 1. (E, F) p53WT
trangene line 2. (G, H) p53WT trangene line 3.

57

Figure 10, continued. Effect of ubiquitous p53 over-expression on survival of adult flies. p53 were
over-expressed ubiquitously in wildtype background or in foxo-/- background in adults, and assayed for
effects on adult life span in male and female flies , as indicated. The life span assays were performed at
29 ̊ C. Open circles represent the no-drug control (“-“). Solid squares represent adults treated with drug
(“+”).Survival curves are plotted as a function of adult age in days. Mean life span of each cohort is
presented along with p value for log rank test (in parentheses). (A, C, E, G, I, K) male flies. (B, D, F, H,
J, L) female flies. (I, J) p53WT trangene line 1 in foxo-/- background. (K, L) p53WT trangene line 2 in
foxo-/- background.

58

Figure 11. Effect of neural-specific p53 over-expression on survival of adult flies. p53 were over-
expressed in nerous systmem in wildtype background or in foxo-/- background in adults, and assayed for
effects on adult life span in male and female flies , as indicated. The life span assays were performed at
29 ̊ C. Open circles represent the no-drug control (“-“). Solid squares represent adults treated with drug
(“+”). Survival curves are plotted as a function of adult age in days. Mean life span of each cohort is
presented along with p value for log rank test (in parentheses). (A, C, E, G, I) male flies. (B, D, F, H, J)
female flies. (A, B) Control flies containing the driver and no target transgene. (C, D) p53WT trangene
line 1. (E, F) p53WT trangene line 2.

59

Figure 11, continued. Effect of neural-specific p53 over-expression on survival of adult flies. p53 were
over-expressed in nerous systmem in wildtype background or in foxo-/- background in adults, and assayed
for effects on adult life span in male and female flies , as indicated. The life span assays were performed at
29 ̊ C. Open circles represent the no-drug control (“-“). Solid squares represent adults treated with drug
(“+”). Survival curves are plotted as a function of adult age in days. Mean life span of each cohort is
presented along with p value for log rank test (in parentheses). (A, C, E, G, I) male flies. (B, D, F, H, J)
female flies. (G, H) p53WT trangene line 1 in foxo-/- background. (I, J) p53WT trangene line 2 in foxo-/-
background.

60

The foxo gene was found to be required for the sexual dimorphism in p53 life span
effects. When p53 was over-expressed in a foxo null background, the pattern of effects in
females remained the same, i.e., decreased life span with tissue-general over-expression
(Figure 10 J, L), and increased life span with nervous system-specific expression (Figure
11 H, J; results summarized in Figure 15A). However, the foxo null background caused a
reversal of the pattern in males, so that p53 effects in males now had the same pattern as
in females, i.e., decreased life span with tissue general over-expression (Figure 10 I, K)
and increased life span with nervous system expression (Figure 11 G, H). Therefore foxo
was required for sexual dimorphism in the tissue-specific effects of p53 on adult life span
(results summarized in Figure 15A).

The effects of p53 over-expression on life span were also assayed in a Sir2 null mutant
background. In a Sir2 null background, the effect of tissue-general over-expression of
p53 was reduced in both males and females, whereas the effect of nervous system-
specific over-expression was intact in males and reduced in females (Figure 12;
summarized in Figure 15A). Therefore we conclude that the Sir2 gene is required for the
magnitude of most of the observed effects of p53 over-expression on life span.

61

Figure 12. Effect of p53 over-expression in Sir2-/- background on survival of adult flies. p53 were
over-expressed ubiquitously or neural-specifically in Sir2-/- background in adults, and assayed for effects
on adult life span in male and female flies , as indicated. The life span assays were performed at 29 ̊ C.
Open circles represent the no-drug control (“-“). Solid squares represent adults treated with drug (“+”).
Survival curves are plotted as a function of adult age in days. Mean life span of each cohort is presented
along with p value for log rank test (in parentheses). (A, C, E) male flies. (B, D, F) female flies. The
controls are the same as Figure 10 and Figure 11. (A, B) Ubiquitous p53WT trangene line 3 over-
expression in Sir2-/- background. (C, D) Neural-specific p53WT trangene line 1 over-expression in Sir2-/-
background. (E, F) Neural-specific p53WT trangene line 2 over-expression in Sir2-/- background.

62

The activity of the Foxo transcription factor is regulated by IIS, in which the
phosphorylated and activated form of the protein kinase Akt acts to phosphorylate and
inactivate Foxo (Figure 15). Akt phosphorylation levels therefore provide a read-out of
signaling through IIS pathway. Akt phosphorylation levels were assayed by Western blot
for control flies, and flies in which p53 had been over-expressed, in the wild type
background as well as foxo null and Sir2 null backgrounds. One striking result was that
foxo null mutation greatly reduced Akt phosphorylation levels in both males and females
(Figure 13), indicating that foxo acts both upstream and downstream of Akt (diagrammed
in Figure 15 B). There are no previous observations of negative feedback loop between
foxo and IIS, although study from C. elegans indicated a positive feedback loop between
foxo and IIS (Murphy et al., 2007). Over-expression of p53 in the wild type background
produced decreased Akt phosphorylation in males, and increased Akt phosphorylation in
females, indicating that p53 has sexually antagonistic effects on IIS. These effects were
opposite in sign to the effects on life span, again consistent with a negative feedback loop
between foxo and IIS (Figure 15 B). The effect of p53 on Akt phosphorylation levels was
reduced in the foxo null background, consistent with the conclusion that foxo is required
for sexual dimorphism of p53 effects on both IIS and life span. In the Sir2 null
background the effect of p53 over-expression on Akt phosphorylation was similar to that
observed in wild type background (Figure 13), indicating that Sir2 acts exclusively
downstream of Akt and/or in a parallel pathway (diagrammed in Figure 15 B).

63

Figure 13. Effect of neural-specific p53 over-expression in on Akt phosphorylation. Neural-specific
p53 over-expression in wildtype background decreased pAkt level in males, but increased pAkt level in
females. pAkt level was greatly reduced in foxo-/- background, in both males and females. Neural-specific
p53 over-expression in foxo-/- background or in Sir2-/- background did not cause change of pAkt level.
RU486 did not induce difference in pAkt level in control flies containing the driver and no target transgene
(western blotting image not shown here). (A, B) Western blotting results. Neural-specific p53WT trangene
line 2 over-expression in wildtype background, in foxo-/- background, or in Sir2-/- background. 2X and
1X volume from the same sample were loaded next to each other. “-” represent the no-drug control. “+”
represents the drug treated group. pAkt is 65kD and -actin is 45kD.
64

Figure 13, continued. Effect of neural-specific p53 over-expression in on Akt phosphorylation. Neural-
specific p53 over-expression in wildtype background decreased pAkt level in males, but increased pAkt
level in females. pAkt level was greatly reduced in foxo-/- background, in both males and females. Neural-
specific p53 over-expression in foxo-/- background or in Sir2-/- background did not cause change of pAkt
level. RU486 did not induce difference in pAkt level in control flies containing the driver and no target
transgene (western blotting image not shown here). (C, D) Quantification of pAkt amount. The amount of
pAkt in each band was normalized to the amount of β-actin.

65

Foxo is a transcription factor, and several Foxo target genes have been reported for
Drosophila, including translation initiation factor gene 4E-BP and the small hsp gene
l(2)efl. Quantitiative real-time RT-PCR was used to assay 4E-BP and l(2)efl transcript
levels upon p53 over-expression in wild type, foxo null and Sir2 null mutant
backgrounds (Figure 14). Expression of 4E-BP and l(2)efl was reduced in the foxo null
background, consistent with the known regulation of these genes by foxo. In addition,
expression of the foxo target genes was significantly reduced in females relative to males.
Conditional over-expression of p53 in either the tissue-general or nervous system-specific
manner had little effect on 4E-BP and l(2)efl expression levels, indicating that p53 may
affect only a subset of foxo targets, or that the assay is not sensitive to possible changes in
expression of 4E-BP and l(2)efl.

66

Figure 14. Effect of p53 over-expression in on 4E-BP expression. Neural-specific or ubiquitous p53
over-expression in males in foxo-/- background decreased 4E-BP expression 28% and 33%, respectively,
but not in females. Neural-specific or ubiquitous p53 over-expression in wildtype background or in Sir2-/-
background did not change male or female 4E-BP expression significantly. Mean ± SD of triplicate assays
was plotted as bar graph. Statistically significant difference (p<0.05) was indicated by asterisks along with
the percent change in mean. (A, B) Ubiquitous p53WT trangene line 2 over-expression in wildtype
background, in foxo-/- background, or in Sir2-/- background. (C, D) Neural-specific p53WT trangene line
2 over-expression in wildtype background, in foxo-/- background, or in Sir2-/- background.
67

Figure 15. Summary of results and the possible model. (A) Summary of life span data. The results for
nervous-system-specific expression of p53 using the Elav-GS driver (“NS”) and tissue-general expression
of p53 using the Act-GS-255B driver (“General”) are summarized for each sex. Numbers indicate the
median life span change for each experiment for each sex. (B) One possible model for the feedback loop of
foxo activating Akt phosphorylation levels, and the sex-specific inputs of p53.

68

Table 6. Starting Stocks.
St# Geneotype Notes Abbreviation
1 w; GS-Actin255-B:+ Ubiquitous GeneSwitch 255B driver 255B
2 yw; +; GS-Elav GeneSwitch Elav Driver Elav
3 Oregon R ( +; +; +) wild type
4 w1118; +; + wild type
5 w1118; P{GUS-p53}2.1; + wild type p53 p53WT1
6 w1118; P{UAS-p53.Ex}2; + wild type p53 p53WT2
7 y1w1118; +; P{UAS-p53.Ex}3 wild type p53 p53WT3
8 w; GS-Actin255-B; Df(3R)Exel8159/TM3,Sb

255B; foxo -
9 yw; P{GUS-p53}2.1; foxo21 rec7A/TM3,Sb

p53WT1; foxo -
10 w1118; P{UAS-p53.Ex}2; foxo21 rec7A/TM3,Sb p53WT2; foxo -
11 w1118; GS-Actin255-B Df(2L)BSC344/CyO; + 255B Sir2 -
12 yw; Sir2 4.5/CyO; P{UAS-p53.Ex}3

Sir2 -; p53WT3
13 w1118; +; Elav-GS Df(3R)Exel8159/TM6C,Sb

Elav foxo -
14 w1118; P{GUS-p53}2.1 Df(2L)BSC344/CyO; + p53WT1 Sir2 -
15 w1118; P{UAS-p53.Ex}2 Df(2L)BSC344/CyO; + p53WT2 Sir2 -
16 yw; Sir2 4.5/CyO; GS-Elav

Sir2 -; Elav
17 w; P{Switch}S1-106 P{Switch}bun[Switch 1-32];+ GeneSwitch Head & Thorax-
Abdomen Fat Body Driver
FB

Table 7. Life span data with means, standard deviations, medians, percent change in
mean and median, and log rank p value.
Cross
MxF RU486 Genotype Sex N Mean
a
Median ∆ Median
Log Rank
p Value

Exp1 Life span assay with GS255B driver at 29 C

3-1 - w/Y; 255B/+; + M 126 52.52±10.68 56 --------- ---------
3-1 + w/Y; 255B/+; + M 132 56.02±7.79 57 1.79 1.30E-05
3-1 - w/+ ;255B/+; + F 126 57.96±10.65 61 --------- ---------
3-1 + w/+ ;255B/+; + F 124 60.33±9.89 62 1.64 5.92E-05
4-1 - w/Y; 255B/+; + M 130 48.11±8.56 48 --------- ---------
4-1 + w/Y; 255B/+; + M 131 50.52±9.15 50 4.17 0.008
4-1 - w1118/+ ;255B/+; + F 131 52.82±5.31 53 --------- ---------
4-1 + w1118/+ ;255B/+; + F 136 54.9±5.02 55.5 4.72 0.001
5-1 - w/Y; 255B/p53WT1; + M 128 47.01±4.97 46 --------- ---------
5-1 + w/Y; 255B/p53WT1; + M 130 51.85±7.44 53 15.22 1.02E-12
5-1 - w; 255B/p53WT1; + F 134 49.95±5.15 49 --------- ---------
5-1 + w; 255B/p53WT1; + F 134 46.61±5.53 47 -4.08 1.22E-08
6-1 - w/Y; 255B/p53WT2; + M 125 43.59±8.45 44 --------- ---------
6-1 + w/Y; 255B/p53WT2; + M 137 49.58±8.39 52 18.18 3.43E-09
6-1 - w; 255B/p53WT2; + F 129 49.32±6 50 --------- ---------
6-1 + w; 255B/p53WT2; + F 129 46.29±7.86 47 -6.00 9.42E-05
7-1 - w/Y; 255B/+; p53WT3/+ M 134 46.84±9 48 --------- ---------
7-1 + w/Y; 255B/+; p53WT3/+ M 125 51.61±9.04 53 10.42 6.99E-07
7-1 - w/yw; 255B/+; p53WT3/+ F 130 51.72±9.32 54 --------- ---------
7-1 + w/yw; 255B/+; p53WT3/+ F 136 50.43±6.06 52 -3.70 5.64E-08

69

Table 7, continued.
Cross
MxF RU486 Genotype Sex N Mean
a
Median
%Change
in Median
Log Rank
p Value

9-8 - w/Y;255B/p53WT1; foxo -/- M 118 35.7±11.26 36 --------- ---------
9-8 + w/Y;255B/p53WT1; foxo -/- M 115 33.65±8.07 33 -8.33 0.003
9-8 - w/yw;255B/p53WT1; foxo -/- F 129 42.02±8.3 43 --------- ---------
9-8 + w/yw;255B/p53WT1; foxo -/- F 123 40.3±5.45 40 -6.98 3.48E-04
10-8 - w/Y; 255B/p53WT2; foxo -/- M 104 30.05±12.47 33 --------- ---------
10-8 + w/Y; 255B/p53WT2; foxo -/- M 104 16.59±6.55 18 -45.45 0
10-8 - w; 255B/p53WT2; foxo -/- F 128 36.98±7.6 37 --------- ---------
10-8 + w; 255B/p53WT2; foxo -/- F 128 33.83±10.91 36 -2.70 0.579
12-11 - w/Y;255B Sir2 -/-;p53WT3/+ M 131 43.02±7.16 45 --------- ---------
12-11 + w/Y;255B Sir2 -/-;p53WT3/+ M 122 43.37±10.12 45 0.00 0.003
12-11 - w/yw;255B Sir2 -/-;p53WT3/+ F 127 47.25±12.11 50 --------- ---------
12-11 + w/yw;255B Sir2 -/-;p53WT3/+ F 131 47.86±12.45 52 4.00 0.064

Exp2 Life span assay with Elav-GS driver at 29 C

3-2 - yw/Y; +; Elav/+ M 126 48.59±5.02 50 --------- ---------
3-2 + yw/Y; +; Elav/+ M 127 49.61±7.56 50 0.00 0.004
3-2 - yw/+; +; Elav/+ F 118 58.2±5.28 58 --------- ---------
3-2 + yw/+; +; Elav/+ F 125 60.82±4.8 62 6.90 5.94E-05
4-2 - yw/Y; +; Elav/+ M 124 42.07±7.61 44 --------- ---------
4-2 + yw/Y; +; Elav/+ M 127 43.29±8.52 46 4.55 0.002
4-2 - yw/w1118; +; Elav/+ F 127 43.99±10.55 47 --------- ---------
4-2 + yw/w1118; +; Elav/+ F 129 46.58±8.29 48 2.13 0.076
5-2 - yw/Y; p53WT1/+; Elav/+ M 122 43.94±5.46 45 --------- ---------
5-2 + yw/Y; p53WT1/+; Elav/+ M 123 39.56±8.4 41 -8.89 0.036
5-2 - yw/w; p53WT1/+; Elav/+ F 125 50.78±9.47 55 --------- ---------
5-2 + yw/w; p53WT1/+; Elav/+ F 120 60.21±6.33 61 10.91 0
6-2 - yw/Y; p53WT2/+; Elav/+ M 122 43.27±5.86 43.5 --------- ---------
6-2 + yw/Y; p53WT2/+; Elav/+ M 129 39.37±8.01 38 -12.64 0.016
6-2 - yw/w; p53WT2/+; Elav/+ F 125 44.34±13.5 49 --------- ---------
6-2 + yw/w; p53WT2/+; Elav/+ F 122 53.89±10.37 55 12.24 1.49E-13
9-13 - w/Y;p53WT1/+; Elav foxo -/- M 127 33.46±12.42 35 --------- ---------
9-13 + w/Y;p53WT1/+; Elav foxo -/- M 124 44.91±12.96 47 34.29 6.84E-14
9-13 - w/yw;p53WT1/+;Elav foxo -/- F 125 46.17±7.55 48 --------- ---------
9-13 + w/yw;p53WT1/+;Elav foxo -/- F 127 52.94±8.82 55 14.58 0
10-13 - w/Y;p53WT2/+; Elav foxo -/- M 123 41.8±9.99 45 --------- ---------
10-13 + w/Y;p53WT2/+; Elav foxo -/- M 123 45.56±13.58 48 6.67 7.21E-08
10-13 - w; p53WT2/+; Elav foxo -/- F 120 40.49±8.19 42 --------- ---------
10-13 + w; p53WT2/+; Elav foxo -/- F 130 43.71±11.14 46 9.52 1.10E-05
16-14 - w/Y; p53WT1 Sir2 -/-;Elav/+ M 132 40.83±9.21 44 --------- ---------
16-14 + w/Y; p53WT1 Sir2 -/-;Elav/+ M 133 34.8±9 34 -22.73 5.20E-07
16-14 - w/yw; p53WT1 Sir2 -/-;Elav/+ F 126 45.83±7.43 47.5 --------- ---------
16-14 + w/yw; p53WT1 Sir2 -/-;Elav/+ F 125 50.35±7.13 51 7.37 9.96E-10
16-15 - w/Y; p53WT2 Sir2 -/-; Elav/+ M 121 35.26±7.3 36 --------- ---------
16-15 + w/Y; p53WT2 Sir2 -/-; Elav/+ M 131 31.99±8.08 32 -11.11 0.017
16-15 - w/yw;p53WT2 Sir2 -/-; Elav/+ F 126 46.19±7.97 47 --------- ---------
16-15 + w/yw;p53WT2 Sir2 -/-; Elav/+ F 132 47.61±8.86 49 4.26 0.084

70

Table 7, continued.
Cross
MxF RU486 Genotype Sex N Mean
a
Median
%Change
in Median
Log Rank
p Value

Exp3 Life span assay with Elav-GS driver at 29 C

3-2 - yw/Y; +; Elav/+ M 131 53.92±7.15 54 --------- ---------
3-2 + yw/Y; +; Elav/+ M 129 52.33±8.14 53 -1.85 0.083
3-2 L 1-1 yw/Y; +; Elav/+ M 59 35.85±10.58 38 -29.63 0
3-2 - yw/+; +; Elav/+ F 127 58.15±7.22 60 --------- ---------
3-2 + yw/+; +; Elav/+ F 129 57.11±5.19 58 -3.33 0.013
3-2 L 1-1 yw/+; +; Elav/+ F 120 43.46±7.94 44 -26.67 0
4-2 - yw/Y; +; Elav/+ M 126 44.08±8.36 44.5 --------- ---------
4-2 + yw/Y; +; Elav/+ M 120 43.32±8.76 45 1.12 0.186
4-2 L 1-1 yw/Y; +; Elav/+ M 102 26.24±8.51 26 -41.57 0
4-2 - yw/w1118; +; Elav/+ F 124 46.88±9.92 50 --------- ---------
4-2 + yw/w1118; +; Elav/+ F 124 48.13±7.5 49.5 -1.00 0.406
4-2 L 1-1 yw/w1118; +; Elav/+ F 114 34.82±10.34 36 -28.00 0
5-2 - yw/Y; p53WT1/+; Elav/+ M 130 44.53±8.45 46 --------- ---------
5-2 + yw/Y; p53WT1/+; Elav/+ M 135 36.31±8.62 36 -21.74 1.1E-13
5-2 L 1-1 yw/Y; p53WT1/+; Elav/+ M 82 31.77±11.05 32 -30.43 0
5-2 - yw/w; p53WT1/+; Elav/+ F 128 46.2±11.1 49 --------- ---------
5-2 + yw/w; p53WT1/+; Elav/+ F 103 50.88±9.28 54 10.20 0.018
5-2 L 1-1 yw/w; p53WT1/+; Elav/+ F 119 35.47±8.57 34 -30.61 0

Exp4 Life span assay with Elav-GS driver at 25 C

4-2 - yw/Y; +; Elav/+ M 108 61.69±17.95 67 --------- ---------
4-2 + yw/Y; +; Elav/+ M 119 64.67±13.19 66 -1.49 0.765
4-2 L 1-10 yw/Y; +; Elav/+ M 115 54.17±15.55 58 -13.43 1.80E-08
4-2 L 1-100 yw/Y; +; Elav/+ M 114 63.96±18.78 70 4.48 0.841
4-2 - yw/w1118; +; Elav/+ F 120 57.42±14.79 64 --------- ---------
4-2 + yw/w1118; +; Elav/+ F 120 56.15±12.99 60 -6.25 0.004
4-2 L 1-10 yw/w1118; +; Elav/+ F 117 56.41±10.82 58 -9.38 0.004
4-2 L 1-100 yw/w1118; +; Elav/+ F 123 57.17±13.69 60 -6.25 0.248
5-2 - yw/Y; p53WT1/+; Elav/+ M 127 63.94±11.93 66 --------- ---------
5-2 + yw/Y; p53WT1/+; Elav/+ M 123 53.43±9.2 54 -18.18 0
5-2 L 1-10 yw/Y; p53WT1/+; Elav/+ M 112 53.29±12.55 54 -18.18 7.89E-10
5-2 L 1-100 yw/Y; p53WT1/+; Elav/+ M 119 61.71±11.08 62 -6.06 0.092
5-2 - yw/w; p53WT1/+; Elav/+ F 124 58.37±15.4 61 --------- ---------
5-2 + yw/w; p53WT1/+; Elav/+ F 120 60.97±14.08 64 4.92 0.384
5-2 L 1-10 yw/w; p53WT1/+; Elav/+ F 120 62.67±9.15 66 8.20 0.954
5-2 L 1-100 yw/w; p53WT1/+; Elav/+ F 109 53.69±17.66 58 -4.92 0.062
6-2 - yw/Y; p53WT2/+; Elav/+ M 123 63.41±8.34 64 --------- ---------
6-2 + yw/Y; p53WT2/+; Elav/+ M 122 57.08±8.62 56 -12.50 5.84E-07
6-2 L 1-10 yw/Y; p53WT2/+; Elav/+ M 176 46.81±13.83 46 -28.13 0
6-2 L 1-100 yw/Y; p53WT2/+; Elav/+ M 113 62.12±8.88 64 0.00 0.464
6-2 - yw/w; p53WT2/+; Elav/+ F 113 51.45±23.66 50 --------- ---------
6-2 + yw/w; p53WT2/+; Elav/+ F 117 64.1±22.95 76 52.00 3.13E-04
6-2 L 1-10 yw/w; p53WT2/+; Elav/+ F 202 52.16±15.83 54 8.00 0.001
6-2 L 1-100 yw/w; p53WT2/+; Elav/+ F 120 47.28±21.1 49 -2.00 0.008

71

Table 7, continued.
Cross
MxF RU486 Genotype Sex N Mean
a
Median
%Change
in Median
Log Rank
p Value

Exp5 Life span assay with whole body FB-GS at 29 C

3-17 - yw/Y; FB/+; + M 124 49.15±12.5 54 --------- ---------
3-17 + yw/Y; FB/+; + M 122 48.13±7.16 50 -7.41 1.30E-05
3-17 L 1-1 yw/Y; FB/+; + M 121 49.11±10.75 52 -3.70 0.655
3-17 - yw/+; FB/+; + F 121 51.95±10.82 54 --------- ---------
3-17 + yw/+; FB/+; + F 127 45.59±9.24 48 -11.11 5.22E-12
3-17 L 1-1 yw/+; FB/+; + F 118 55.29±10.06 60 11.11 0.029
4-17 - yw/Y; FB/+; + M 121 47.16±10.27 48 --------- ---------
4-17 + yw/Y; FB/+; + M 113 44.23±10.08 46 -4.17 0.001
4-17 L 1-1 yw/Y; FB/+; + M 118 42.85±12.89 44 -8.33 0.002
4-17 - yw/w1118; FB/+; + F 124 50.48±11.91 56 --------- ---------
4-17 + yw/w1118; FB/+; + F 121 47.44±9.37 50 -10.71 2.74E-09
4-17 L 1-1 yw/w1118; FB/+; + F 125 51.63±8.47 54 -3.57 0.196
5-17 - yw/Y; FB/p53WT1; + M 123 45.69±8.3 48 --------- ---------
5-17 + yw/Y; FB/p53WT1; + M 124 42.02±8.84 44 -8.33 1.17E-09
5-17 L 1-1 yw/Y; FB/p53WT1; + M 118 44.97±8.78 46 -4.17 0.359
5-17 - yw/w; FB/p53WT1; + F 127 48.03±11.67 52 --------- ---------
5-17 + yw/w; FB/p53WT1; + F 128 44.61±7.97 46 -11.54 7.54E-13
5-17 L 1-1 yw/w; FB/p53WT1; + F 125 47.57±10.69 50 -3.85 0.087
a
Mean life span, days +/- SD.

Conclusions
The data presented here demonstrate that tissue-general over-expression of wild-type p53
in adult Drosophila increases life span in males, but decreases life span in females,
consistent with our previous observations using only a single p53 transgene (Waskar et
al., 2009). Strikingly, nervous system-specific over-expression of p53 produced the
opposite pattern: increased life span in females and decreased life span in males. In a
foxo null background, p53 life span effects in males were reversed, becoming similar to
the effects in females, whereas in a Sir2 null background the magnitude of p53 effects in
males and females was reduced. foxo was required for normal levels of Akt
72

phosphorylation in adult flies, suggesting that foxo acts both downstream and upstream of
Akt phosphorylation (diagrammed in Figure 15 B). Nervous system-specific over-
expression of p53 had sexually antagonistic effects on Akt phosphorylation levels. The
data suggest that the sexual differentiation pathway interacts with foxo and Sir2 to enable
sexually-antagonistic effects of p53 on adult fly insulin-like signaling and life span
(diagrammed in Figure 15 B). These data are consistent with the conclusion that p53 is
an antagonistically pleiotropic gene, with tissue-specific effects on life span that are
opposite in males and females. Moreover, foxo was required for the sexual-dimorphism
of p53 effects on both life span and IIS, as indicated by Akt phosphorylation levels.
These results are consistent with previous observations that the conserved foxo gene is
required for sexual dimorphism in phenotypes such as gene expression levels in mouse
(Amador-Noguez et al., 2005), and daily locomotor activity patterns in flies (Belgacem
and Martin, 2006). These data are consistent with a model in which sex-specific
selection pressures maintain sexually-antagonistic genes such as p53 in the genome,
thereby contributing to the aging phenotype in each sex.

Methods
Drosophila Strains. UAS-p53 lines and deficiency lines of foxo and Sir2 (Table 6) were
obtained from Bloomington Drosophila Stock Center. The foxo
21
rec7A null line and the
Sir2
4.5
null line were generously provided by M. Tatar (Min et al., 2008) and SL.
Helfand (Rogina and Helfand, 2004). The ubiquitous Geneswitch driver line Act-GS-
73

255B contains multiple copies of a P element construct in which expression of the
Geneswitch cDNA is under the control of the tissue-general Actin5C promoter (Ford et
al., 2007). The UAS-ultraGFP strain contain multiple copies of a UAS-eGFP construct,
and its construction and characterization has been recently described (Yang and Tower,
2009). The Geneswitch system drivers Elav-GS, MHC-GS, S
1
-32 and S
1
-106 were
generously provided by T. Osterwalder and R. Davis (Osterwalder et al., 2001; Roman et
al., 2001).

Generation of Recombination Lines. Stock #11, #13, #14, #15 (Table 6) were generated
by recombination. Stock #8, #9, #10, #12, #16 (Table 6) were generated after multiple
steps of crossings by using double balancers. After generation of these lines, the Elav-GS
or GS-Actin255-B component were confirmed by induction of GFP expression in the
offspring (larvae stage) when these lines were crossed to UAS-ultraGFP (18); the foxo
deficiency Df(3R)Exel8159 in the newly generated lines was confirmed by the lethality
test when these lines were crossed to two other foxo deficiency lines Df(3R)ED5634 and
Df(3R)ED5644 and a mutant line that contains a recessive lethal mutation
RpII140[wimp] in the deficiency region; the Sir2 deficiency Df(2L)BSC344 in the newly
generated lines was confirmed by the lethality test when these lines were crossed to two
other Sir2 deficiency lines Df(2L)BSC245and Df(2L)ED784. DNA was extracted from
15 male offspring of the final crosses for the life span assays with ZR Genomic DNA II
kit (ZYMO RESEARCH). Genotype of Df foxo/foxo
21
rec7A was confirmed by
sequencing. The primers are: foxo-F, CACCGACGAGTTGGACAGTA; foxo-R,
74

GCTCTGCGAATTGTGAATGA. In foxo
21
null mutant, the codon for W95 was mutated
to stop codon (Junger et al., 2003) . Indeed, the DNA sequencing result showed that the
Df foxo/foxo
21
rec7A flies have the stop codon TGA, but the wildtype flies have the
codon TGG. Genotype of Df Sir2/Sir2
4.5
was confirmed by PCR product electrophoresis
followed by sequencing. The primers are: Sir-F, GGCACTTTCCATGCAGAAAC; Sir-
R, AATAGTCCCACAGCACGGAG. The Sir2
4.5
deletion includes nucleotides -16 to
+759 (Newman et al., 2002). Primers were designed to cover this region and amplify
1070bp in wildtype fly DNA but only produce 295bp amplified fragment in Df
Sir2/Sir2
4.5
fly DNA. The PCR gel electrophoresis showed that the PCR product
amplified from Df Sir2/Sir2
4.5
fly DNA is about 800bp. Sequencing results showed that
indeed there is deletion of expected size in Df Sir2/Sir2
4.5
fly DNA, and there is some
remaining sequence of P-element transposon vector by NCBI blast search.

Drosophila Culture. Drosophila culture and life span assays were performed as
described previously (Ford et al., 2007). GeneSwitch virgins were used in the crosses
with males of other lines. Life span assays consisted of ~25 flies per vial, and a total 5
vials for each cohort. For survival assays performed at 25̊ C, flies were transferred to
new vials ever other day . For survival assays preformed at 29̊ C flies were transferred to
new vials every other day in the first 30 days, and then every day for the remainder of the
life span. RU486 (Mifepristone, Sigma) was dissolved in ethanol (100%) to make a stock
solution of 3.2mg/ml. For adult feeding, 50ul RU486 stock solution was added to the
surface of each vial to produce a final concentration of ~160ug/ml; 50ul ethanol was
75

added to the control vials. For larval feeding, 0.5ml of 3.2mg/ml RU486 stock solution
(or the indicated diluted concentration) was added to the surface of each bottle to produce
a final concentration of ~160ug/ml (or indicated diluted concentration); 0.5ml ethanol
was added to control bottles.

Real-time RT-PCR. Total RNA was isolated using TRIzol reagent (Invitrogen), from 15
male or female flies that are 10 days on RU 486 or on ethanol food at 29̊ C, after they
were collected within three days of eclosion. RNA concentration was measured using a
spectrophotometer (NanoDrop). RNA was reverse-transcribed to cDNA using the
QuantiTect Reverse Transcription kit (Qiagen) according to the manufacturer’s protocol.

The primers used to amplify the Sir2 and l(2)efl genes were as previously described
((Rogina and Helfand, 2004) and (Flatt et al., 2008)). The following primers were used:
Sir2-F, GGCGGCAGCTGTGCTGCGATGAG;
Sir2-R, GCTCTCCACCGTTGTCTGAGGGCC;
l(2)efl-F, AGGGACGATGTGACCGTGTC;
l(2)efl-R, CGAAGCAGACGCGTTTATCC;
4E-BP-F,CATGAAGAATCTCCGTGGCT;
4E-BP-R, AGCGACTTGGTCTGCTTGAT;
rp49-F, AGCCCAAGGGTATCGACAA;
rp49-R, ACCGTTGGGGTTGGTGAG.

76

Real-time PCR was performed using the Bio-RAD DNA Engine Opticon 2 Real-time
PCR detector, and SYBR green dye. Pfaffl’s method (Pfaffl, 2001)was used for
quantification. Serial dilutions of w1118 control line cDNA were amplified in triplicates
and the threshold cycle (Ct) was plotted as the function of the log10 value of cDNA
amount. The real-time PCR efficiencies for each pair of primers were calculated
according to the equation: E=10
[-1/slope]
. Three biological replicates were used in the real-
time PCR. For each biological replicate, real-time PCR was performed on three technical
replicates at the same time. rp49 was used as the internal control and amplified in parallel
with target genes. Message levels were normalized to the rp49 control. Values are plotted
as mean ± SD.

Western Blotting. Protein from male and female whole fly was isolated by homogenizing
the flies in laemmli sample buffer (Bio-Rad). Protein extracts were separated on 7.5%
Tris-HCl polyacrylamide gles (Bio-Rad) and transferred onto nitrocellulose membranes
(Bio-Rad). Phospho-Akt was detected with anti-pAkt (1:1000) (#4050 and #9271; Cell
Signaling Technology). -actin (1:5000) (#4967; Cell Signaling Technology) primary
antibodies was used to detect the level of -actin as the internal control. Horseradish-
peroxidase-conjugated anti-rabbit IgG (1:10,000) (#7074; Cell Signaling Technology)
was used as the secondary antibody. Chemiluminescence detection was performed by
using Amersham EDL Advance Western Blotting Detection Kit (GE Healthcare). The
intensity of each band was analyzed by using Quantity One software (Bio-Rad). For
intensity analysis, the amount of pAkt was normalized to the amount of -actin.
77

Statistical Analysis. For life span assays, mean, standard deviation, median, percent
change in mean, percent change in median, and log rank p value were calculated using R
2.6.2 (RDevelopmentCoreTeam, 2006). Unpaired, two sided t-test was used to determine
the difference of mRNA level between the RU486-treated and control groups;
statistically significant difference (p<0.05) was indicated by asterisks along with the
percent change in mean in the bar graphs.

78

Chapter 4
Identifying sexual differentiation genes that affect Drosophila
life span
In this chapter, I performed Wolbachia Test, the mortality rate analysis and other
statistical analysis for tudor life span assays (Figure 16 C, Figure 17, and Table 9, Table
10). I characterized the phenotypes of adult flies that had tra over-expression during
development (Figure 18), examined the effects of sex differentiation pathway gene mis-
expression on survival of adults flies (Figure 19, and Table 11 Exp 1, Exp 2), and
performed the statistical analysis for all the life span assays (Table 11 Exp 1, Exp 2, and
Exp 3). The tudor life span assays (Figure 17) were performed by Daniel Ford. The life
span assays of sex differentiation pathway genes on Table 11 Exp 3 were conducted by
Gary Landies.

Abstract
Experiments were conducted to determine how alterations in sexual differentiation gene
activity might affect the life span of Drosophila melanogaster. Drosophila females
heterozygous for the tudor
1
mutation produce normal offspring, while their homozygous
sisters produce offspring that lack a germ line. In this study such germ-line ablation was
found to increase life span in males but not in females, consistent with previous reports.
79

Fitting the data to a Gompertz-Makeham model indicated that the maternal tudor
1

mutation increases the life span of male progeny by decreasing age-independent
mortality. The Geneswitch system was used to screen through several UAS-type and EP-
type P element mutations in genes that regulate sexual differentiation, to determine if
additional sex-specific effects on life span would be obtained. Over-expression of
fruitless male isoform A (fru-MA) during development was lethal, whereas over-
expression of fru-MA in adults greatly reduced both male and female life span. Over-
expression of doublesex female isoform (dsxF) during development was lethal to males,
and produced a limited number of female escapers, whereas over-expression of dsxF
specifically in adults greatly reduced both male and female life span. Conditional over-
expression of transformer female isoform (traF) during development produced male
adults with inhibited sexual differentiation, however this caused no significant change in
life span. The data demonstrate that manipulation of sexual differentiation pathway genes
either during development or in adults can have sex-specific effects on adult life span.

Introduction
The disposable soma theory states that aging occurs because there is a selection pressure
to assign limited biological resources to short-term survival, growth, and reproduction,
rather than long-term survival (Kirkwood, 2005; Kirkwood, 1990). This suggests that a
decrease in reproduction might cause a shift in resources, resulting in the alteration of life
span. Consistent with this idea, several studies have suggested that there may exist a
80

trade-off between reproduction and life span. For example, in humans, longer life span
has been correlated with a smaller number of offspring (Westendorp and Kirkwood,
1998), but see also (Gavrilova et al., 2004; Ligtenberg and Brand, 1999). In C.elegans,
elimination of reproduction by ablation of the germ line extended life span by up to 60%
(Hsin and Kenyon, 1999). This effect was attributed to increased activity of the
insulin/IGF1-like signaling (IIS) pathway target transcription factor DAF-16 in the
gastrointestinal tract, caused by hormonal signaling from the gonad to the intestine
(Berman and Kenyon, 2006). A trade-off between life span and reproduction does not
appear to be obligatory, because it is possible in certain instances to increase life span in
C.elegans and Drosophila without causing a decrease in reproduction (Flatt and
Kawecki, 2007; Toivonen and Partridge, 2008).

In Drosophila, elimination of germ cells (GCs) by forced expression of the differentiation
gene bam in late development or adulthood was found to increase median life span by 14-
78% in males, and 23-100% in females (Flatt et al., 2008). The elimination of Drosophila
GCs was found to modulate insulin signaling, by increasing nuclear localization of the
Drosophila homolog of DAF-16 (called dFOXO), and by increasing the levels of
Drosophila insulin-like peptides (dilps) (Flatt et al., 2008). The Drosophila maternal
effect genes germ cell-less and tudor are necessary for the formation of the germ line in
offspring (Thomson and Lasko, 2005). Interestingly, in another recent study, it was
concluded that elimination of Drosophila GCs using germ cell-less and tudor mutations
might not extend life span (Barnes et al., 2006), and the reason for the difference in
81

results in these previous studies may be differences in the timing of germ cell ablation
relative to fly development. Here the maternal tudor
1
mutation was tested in a particularly
long-lived genetic background, and was found to increase the life span of male offspring,
but to have neutral or negative effects on female life span.

To test if additional alterations in sexual differentiation might affect fly life span, the
Geneswitch system was used to screen through several UAS-type and EP-type P element
mutations in genes that regulate sexual differentiation; this allows genes to be over-
expressed either during Drosophila larval development, or specifically in the adult stages.
The Drosophila sex determination hierarchy consists of pre-mRNA splicing factors
encoded by the genes sex-lethal (sxl), transformer (tra), and transformer-2 (tra-2)
(Goldman and Arbeitman, 2007) (Figure 16A). In females (sex chromosome composition
X/X), the ratio of X chromosomes to autosomes causes expression of SXL protein, which
directs the pre-mRNA splicing of tra transcripts. The TRA and TRA-2 proteins together
direct the splicing of pre-mRNAs for the transcription factor genes doublesex (dsx) and
fruitless (fru), such that females express the female form of the doublesex protein
(DSX
F
), and no fruitless protein. In males (sex chromosome composition X/Y), the sxl
and tra genes are not activated, which results in expression of the male form of doublesex
(DSX
M
), and the male form of fruitless (FRU
M
). The DSX and FRU transcription factors
then direct sex-specific differentiation of tissues and behaviors. The data presented here
demonstrate that the Drosophila sexual differentiation pathway can act during
development and in adults to affect longevity.
82

Figure 16. Drosophila sex determination hierarchy and the tudor mutation. A) The Drosophila sex
determination hierarchy. In males, lack of SXL and TRA activity leads to expression of FRU
M
and DSX
M
.
In females, TRA and TRA2 together direct splicing of downstream targets to produce DSX
F
, and fru P1
transcripts that are not translated in females. B) Crossing scheme to produce germ line-ablated flies using
tudor1. For the experimental group, tudor homozygote females were crossed to wild type Oregon-R males
to generate progeny lacking a germline. For the control group, tudor heterozygote females were crossed to
Oregon-R males to generate progeny containing a normal germline. Both experimental and control groups
have the same chromosomal composition. C) Test for Wolbachia. The Wolbachia 16S rDNA sequences
were amplified by PCR from the indicated Drosophila lines and controls, and the presence or absence of
Wolbachia-specific PCR products was determined by gel electrophoresis and ethidium bromide staining.

83

Results
Female flies heterozygous or homozygous for the tudor
1
mutation were crossed to
Oregon-R wild-type male flies to produce control offspring and offspring lacking the
germline, respectively (Figure 16B). In the first experiment the life span of control and
germline-ablated flies was measured using cohorts of ~125 flies each. For the germ line-
ablated male flies the mean and median life span was increased by 19.91% and 12.90%,
respectively, relative to controls, while in contrast female life span was significantly
decreased (Table 9). To determine if these results were reproducible, the experiment was
repeated with cohorts sizes of ~240 flies. Male mean and median life span was again
found to be increased by 19.97% and 12.20%, respectively, while female life span was
not altered. Plots of percent survival versus time indicated that there was also significant
early mortality in several of the cohorts (Figure 17A, D, G, J). Consequently, the
Winmodest statistical package was used to control for early mortality and to analyze the
survival data in greater detail. The data was fitted to a Gompertz-Makeham model where
the constant a is the initial mortality

rate, b is the rate of exponential increase in mortality,
and c is the age-independent mortality (Figure 17B, E, H, K). The values of a, b and c
were calculated based on a likelihood ratio test (Table 10). Re-plotting of the fitted data
using only the Gompertz term yields a decomposed survival curve consisting of only the
age-dependent mortality (Figure 17C, F, I, L). The data indicate that the increase in
mean life span of germ line-ablated males relative to controls can be attributed to a
decrease in age-independent mortality (rate constant c), while the initial mortality rate
84

(rate constant a) and mortality rate increase with time (rate constant b) were not
significantly affected (Table 10). While the initial experiment indicated a decrease in the
life span of germ line-ablated females relative to controls, this result was not reproduced
in the larger cohorts, where there was no significant difference in any of the mortality rate
parameters.

Wolbachia are gram-positive bacteria that are transmitted through inheritance (McGraw
and O'Neill, 2004). These bacteria are capable of altering life span, and can potentially
result in a false positive for life span extension (Fry et al., 2004; Toivonen et al., 2007).
Therefore, the presence of Wolbachia was assayed by PCR using primers specific for the
Wolbacbia 16S RNA genes, and the lines used in this experiment were found not to be
infected (Figure 16C).
85

Figure 17. Life span assays and mortality rate analysis for germline-ablated Drosophila. A) Males
lacking the germ line. The assay consisted of 125 flies for the experimental group and 122 flies for the
control group. B) Mortality rate (Gompertz-Makeham model) of the germ line-ablated and control male
groups. C) Redrawn survival curve for males with age-independent mortality removed. D) Females
lacking the germ line. The assay consisted of 118 flies for the experimental group, and 124 flies for the
control group. E) Mortality rate (Gompertz-Makeham model) of the germ line-ablated and control female
groups. F) Redrawn survival curve for females with age-independent mortality removed. G) Males lacking
the germ line, repeat assay. The assay consisted of 238 flies for the experimental group and 139 flies for the
control group. H) Mortality rate (Gompertz-Makeham model) of the germ line-ablated and control male
groups. I) Redrawn survival curve for males with age-independent mortality removed. J) Females lacking
the germline, repeat assay. The assay consisted of 233 flies for the experimental group and 175 flies for the
control group. K) Mortality rate (Gompertz-Makeham model) of the germ line-ablated and control female
groups. L) Redrawn survival curve with age-independent mortality removed.
86

To begin to ask if other alterations in sexual differentiation could affect life span, the
Geneswitch system was used to cause over-expression or inhibition of several genes
involved in the sex-determination pathway. Expression of the Geneswitch transcription
factor was driven with the cytoplasmic Actin5C promoter, using transgenic line Act-GS-
255B. Feeding animals the drug RU486/Mifepristone either during larval development or
as adults causes activation of the Geneswitch factor, which then binds to UAS sites in
target promoters and activates expression of the gene of interest or the RNAi construct.
To control for any effects of the drug itself, the Act-GS-255B line was crossed to Oregon
R wild type strain to generate progeny containing Act-GS-255B but no target construct.
In these control flies, the drug treatment generally had no effect on life span, with the
exception of two experiments where life span of adult females was reduced by 2-5%
(Figure 19A,B; Table 11). However, because these changes in controls were were small
in magnitude and not always observed, we interpret these changes as being within the
background of the assay. The drug treatment during development caused no change in
sexual differentiation in control flies (data not shown).

Conditional over-expression of the pre-mRNA splicing factor tra during development
significantly inhibited sexual differentiation in males, resulting in a lack of much of the
external genitalia and a reduction in the size of the sex combs (Figure 18E, G), however
these flies did not exhibit a significant change in life span (Figure 19I; Table 11). In
contrast, in females, over-expression of tra during development did not detectably affect
87

sexual differentiation (Figure 18B, C), and did not alter life span (Figure 19J; Table 11).
Repeats of the life span assay produced similar results (Table 11, Exp3).

Figure 18. Effect of tra over-expression during development on sexual differentiation of adults. UAS-
tra males were crossed to GS255B virgins, cultured on food with drug (+RU486) to drive the over-
expression of tra during development, or cultured on food with ethanol as the control, as indicated. Pictures
were taken at the magnification of 100X. (A, B) Female genitalia. (C, D) Male genitalia. (E, F) Male sex
comb.
88

Figure 19. Effect of sex differentiation pathway gene mis-expression on survival of male and female
adult flies. Sexual differentiation pathway genes or RNAi constructs were over-expressed either during
larval development (“L” ; gray triangles) or in adults (“A” ; solid squares). Open circles represent the no-
drug control (“-“). Survival curves are plotted as a function of adult age in days. Median life span and p
value for log rank test are indicated in parentheses for each cohort. (A, B) Control flies (progeny of driver
crossed to Or-R wild type). (C, D) dsxF. (E, F) fruMA. (G, H) fru-IR.
89

Figure 19, continued. Effect of sex differentiation pathway gene mis-expression on survival of male
and female adult flies. Sexual differentiation pathway genes or RNAi constructs were over-expressed
either during larval development (“L” ; gray triangles) or in adults (“A” ; solid squares). Open circles
represent the no-drug control (“-“). Survival curves are plotted as a function of adult age in days. Median
life span and p value for log rank test are indicated in parentheses for each cohort. (I, J) tra. (K, L) dsxM.
(M, N) tra2 IR.

90

Over-expression of dsxF during development was lethal to males and produced a limited
number of females, while over-expression of dsxF in adults significantly reduced male
and female median life span, by 61.33% and 45.78%, respectively (Figure 19C, D; Table
11, Exp1); and these results were confirmed by repeated experiment (Table 11, Exp3).
Similarly, over-expression of the fru male isoform A (fru MA) during development was
lethal, and over-expression of fru MA in adults greatly reduced both male and female
mean life span, by 61.97% and 64.52%, respectively (Figure 19E, F; Table 11, Exp1).

Developmental or adult-specific expression of one or two inserts of an RNAi construct
designed to target the male-specific isoform of FRU (Manoli and Baker, 2004) did not
affect male life span (Figure 19G), but surprisingly, decreased female lifespan
significantly (Figure 19H; Table 11). Over-expression of dsxM during development was
toxic to males and females and produced only a limited number of adult escapers, while
over-expression of dsxM in adults caused a small but significant reduction in male and
female life span, by 5.5% and 7.8%, respectively (Figure 19K, L and Table 11 Exp1).
Conditional expression of the tra2 RNAi construct in female adults resulted in a small but
significant decrease in life span of –12% (Figure 19N), however expression of the tra2
RNAi construct during male and female development or in male adults did not affect life
span (Figure 19 M, N; Table 11). Finally, EP-sxl, XP-dsx, and XP-tra2 gene-over-
expression lines were also tested, but did not give a consistent or significant change in
life span (<3% change), when expressed during development or in adults (Table 11,
Exp3).
91

Table 8. Starting stocks.
St# Genotype Notes Abbreviation
1 w[1118]; Act-GS-255B;+ Tissue-general Geneswitch driver 255B
2 yw; P{UAS-fruMA}[7];+ UAS-fru male A isoform fruMA
3 w; P{UAS-fru-IR}/CyO; P{UAS-fru-IR} UAS-fru RNAi fruIR
4 w; P{UAS-dsxM}/CyO,GFP; + UAS-dsx male isoform dsxM
5 w P{UAS-tra2-IR}[61A]; +; P{UAS-tra2-IR}[82A] UAS-tra2 RNAi tra2IR
6 w[1118]; +; + Injection strain control
7 Oregon R ( +; +; +) wild type control
9 w; +; P{UAS-dsxF}/TM3, Sb UAS-dsx female isoform dsx
10 w; P{UAS-tra}[20J7]; + UAS-tra tra
11 y[1] w[67c23] P{EPgy2}Sxl[EY06108]/FM6B EP-sxl sxl
14 w; +; P{dsx-XP}[d09625] XP-dsx dsx
15 w; P{tra2-XP}[d10032]; + XP-tra2 tra2
16 +; tud[1], bw, sp/SM1; + tudor[1] mutant

Table 9. Statistical analysis of tudor life span assays.

Group N Mean
a
Median
% Change
in Mean
%Change
in Median
Log Rank
p Value
Exp 1
Mutant Males 125 68.45±11.37 70 19.91 12.90 4.25E-05
Control Males 122 57.08±20.28 62
Mutant Females 118 47.36±24.50 56 -20.99 -23.29 5.33E-10
Control Females 124 59.94±28.03 73
Exp 2
Mutant Males 238 87.41±18.03 92 19.97 12.20 1.00E-10
Control Males 139 72.86±25.01 82
Mutant Females 233 74.33±22.01 80 -2.04 0.00 0.121
Control Females 175 75.87±21.78 80
a
Mean life span, days +/- SD.
92

Table 10. Parameters for Gompertz-Makeham model and likelihood ratio test
results.
Parameters Mutant Control χ2 df p Value χ2 df p Value
Tudor Exp 1 one parameter compared at each time
Males Both a and b are constrained
a 1.00 x 10
-4
7.00 x 10
-5
0.13 1 0.724
b 2.07 x 10
-1
2.29 x 10
-1
0.73 1 0.392
c 2.06 x 10
-9
7.52 x 10
-3
17.65 1 <0.001 23.76 1 <0.001

Females c is constrained
a 3.20 x 10
-4
1.04 x 10
-6
13.23 1 <0.001 13.34 1 <0.001
b 1.93 x 10
-1
2.91 x 10
-1
5.84 1 0.016 5.47 1 0.019
c 1.43 x 10
-2
1.66 x 10
-2
0.37 1 0.541
Tudor Exp 2
Males Both a and b are constrained
a 8.38 x 10
-8
6.03 x 10
-7
2.60 1 0.107
b 3.19 x 10
-1
3.06 x 10
-1
0.23 1 0.633
c 1.67 x 10
-3
4.67 x 10
-3
7.98 1 0.005 18.46 1 <0.001

Females
a 6.40 x 10
-7
3.46 x 10
-7
0.33 1 0.565

b 3.07 x 10
-1
3.17 x 10
-1
0.15 1 0.694
c 3.76 x 10
-3
3.69 x 10
-3
0.00 1 0.949

93

Table 11. Life span data with means, standard deviations, medians, percent change
in mean and median, and log rank p value.
Cross
MxF RU486 Genotype Sex N Mean
a
Median ∆ Median
Log Rank
p Value

Exp 1

7-1 - w/Y; 255B/+; + M 122 68.85±14.18 71 --------- ---------
7-1 A w/Y; 255B/+; + M 112 70.64±13.48 73 2.82 0.646
7-1 L w/Y; 255B/+; + M 145 69.63±12.16 73 2.82 0.265
7-1 - w/+; 255B/+; + F 121 87.78±8.83 89 --------- ---------
7-1 A w/+; 255B/+; + F 117 88.56±6.85 89 0 0.615
7-1 L w/+; 255B/+; + F 120 85.96±11.95 89 0 0.192
9-1 - w/Y; 255B/+; dsxF/+ M 115 72.23±10.20 75 --------- ---------
9-1 A w/Y; 255B/+; dsxF/+ M 108 29.78±7.60 29 -61.33 0
9-1 L w/Y; 255B/+; dsxF/+ M 0 --------- --------- --------- ---------
9-1 - w; 255B/+; dsxF/+ F 117 77.05±19.31 83 --------- ---------
9-1 A w; 255B/+; dsxF/+ F 99 44.06±13.39 45 -45.78 0
9-1 L w; 255B/+; dsxF/+ F 23 71.57±21.55 73 -12.05 0.191
2-1 - w/Y; 255B/fruMA; + M 118 69.27±12.50 71 --------- ---------
2-1 A w/Y; 255B/fruMA; + M 126 27.83±4.03 27 -61.97 0
2-1 L w/Y; 255B/fruMA; + M 0 --------- --------- --------- ---------
2-1 - w/yw; 255B/fruMA; + F 113 90.34±10.49 93 --------- ---------
2-1 A w/yw; 255B/fruMA; + F 123 32.83±7.76 33 -64.52 0
2-1 L w/yw; 255B/fruMA; + F 0 --------- --------- --------- ---------
3-1 - w/Y; 255B/fruIR; fruIR/+ M 114 68.63±12.39 71 --------- ---------
3-1 A w/Y; 255B/fruIR; fruIR/+ M 121 68.02±12.20 69 -2.82 0.77
3-1 L w/Y; 255B/fruIR; fruIR/+ M 124 66.23±13.69 67 -5.63 0.475
3-1 - w; 255B/fruIR; fruIR/+ F 116 76.37±16.00 79 --------- ---------
3-1 A w; 255B/fruIR; fruIR/+ F 120 72.94±11.19 75 -5.06 3.26E-07
3-1 L w; 255B/fruIR; fruIR/+ F 124 63.72±21.87 65 -17.72 0.002
10-1 - w/Y; 255B/tra; + M 122 68.60±15.83 71 --------- ---------
10-1 A w/Y; 255B/tra; + M 118 73.10±13.38 73 2.82 0.024
10-1 L w/Y; 255B/tra; + M 123 67.54±14.05 69 -2.82 0.406
10-1 - w; 255B/tra; + F 122 68.75±18.34 75 --------- ---------
10-1 A w; 255B/tra; + F 122 66.51±15.22 71 -5.33 4.91E-05
10-1 L w; 255B/tra; + F 127 73.03±13.07 77 2.67 0.15
4-1 - w/Y; 255B/dsxM; + M 120 72.39±12.77 73 --------- ---------
4-1 A w/Y; 255B/dsxM; + M 118 66.14±13.80 69 -5.48 2.07E-04
4-1 L w/Y; 255B/dsxM; + M 1 67.00±NA 67 -8.22 0.343
4-1 - w;255B/dsxM; + F 118 77.20±10.40 77 --------- ---------
4-1 A w;255B/dsxM; + F 121 71.91±6.83 71 -7.79 6.60E-08
4-1 L w; 255B/dsxM; + F 10 69.60±18.21 70 -9.09 0.765
1-5 - w tra2IR/Y;255B/+;tra2IR/+ M 119 74.82±13.69 77 --------- ---------
1-5 A w tra2IR/Y;255B/+;tra2IR/+ M 120 75.33±12.55 75 -2.6 0.905
1-5 L w tra2IR/Y;255B/+;tra2IR/+ M 122 76.28±13.32 81 5.19 0.628
1-5 - w tra2IR/w;255B/+;tra2IR/+ F 119 80.43±22.10 91 --------- ---------
1-5 A w tra2IR/w;255B/+;tra2IR/+ F 128 74.20±19.64 80 -12.09 4.02E-07
1-5 L w tra2IR/w;255B/+;tra2IR/+ F 127 82.20±20.76 89 -2.2 0.218

94

Table 11, continued.
Cross
MxF RU486 Genotype Sex N Mean
a
Median
%Change
in Median
Log Rank
p Value

6-1 - w/Y; 255B/+; + M 116 77.52±13.06 78 --------- ---------
6-1 A w/Y; 255B/+; + M 118 77.46±15.82 79 1.28 0.125
6-1 L w/Y; 255B/+; + M 115 76.37±14.50 79 1.28 0.361
6-1 - w/w1118; 255B/+; + F 124 78.97±13.48 79 --------- ---------
6-1 A w/w1118; 255B/+; + F 121 76.71±13.57 81 2.53 0.008
6-1 L w/w1118; 255B/+; + F 123 81.28±14.17 83 5.06 0.118

Exp 2

3-1 - w/Y; 255B/fruIR; fruIR/+ M 88 48.77±26.56 58 --------- ---------
3-1 A w/Y; 255B/fruIR; fruIR/+ M 109 61.43±16.27 64 10.34 0.024
3-1 L w/Y; 255B/fruIR; fruIR/+ M 120 53.65±19.56 56 -3.45 0.895
3-1 - w; 255B/fruIR; fruIR/+ F 76 68.45±17.05 73 --------- ---------
3-1 A w; 255B/fruIR; fruIR/+ F 95 58.04±14.35 62 -15.07 1.55E-15
3-1 L w; 255B/fruIR; fruIR/+ F 129 53.77±18.60 60 -17.81 1.14E-13
3-1 - w/Y; 255B/CyO; fruIR/+ M 55 42.18±18.86 46 --------- ---------
3-1 A w/Y; 255B/CyO; fruIR/+ M 66 41.52±12.24 44 -4.35 0.066
3-1 L w/Y; 255B/CyO; fruIR/+ M 78 42.38±15.69 44 -4.35 0.536
3-1 - w;255B/CyO; fruIR/+ F 79 73.75±13.13 76 --------- ---------
3-1 A w; 255B/CyO; fruIR/+ F 86 57.88±14.28 62 -18.42 0
3-1 L w; 255B/CyO; fruIR/+ F 101 59.07±13.13 62 -18.42 0
6-1 - w/Y; 255B/+; +/+ M 121 62.33±18.12 68 --------- ---------
6-1 A w/Y; 255B/+; +/+ M 117 57.09±22.64 66 -2.94 0.165
6-1 L w/Y; 255B/+; +/+ M 119 62.57±16.22 68 0 0.478
6-1 - w/w1118; 255B/+; +/+ F 123 75.95±9.37 78 --------- ---------
6-1 A w/w1118; 255B/+; +/+ F 122 71.05±13.36 74 -5.13 7.97E-06
6-1 L w/w1118; 255B/+; +/+ F 124 69.02±12.88 74 -5.13 7.69E-07

Exp 3

7-1 - w/Y; 255B/+; + M 124 72.03±18.30 75 --------- ---------
7-1 A w/Y; 255B/+; + M 123 74.18±20.23 80 6.67 0.151
7-1 L w/Y; 255B/+; + M 123 71.69±23.51 80 6.67 0.171
7-1 - w/+ ;255B/+; + F 124 85.39±25.75 92 --------- ---------
7-1 A w/+ ;255B/+; + F 118 83.03±25.60 90 -2.17 0.043
7-1 L w/+ ;255B/+; + F 119 91.78±19.02 96 4.35 0.213
9-1 - w/Y; 255B/+; dsxF/+ M 74 83.35±22.08 88 --------- ---------
9-1 A w/Y; 255B/+; dsxF/+ M 100 34.20±9.96 32 -63.64 0
9-1 L w/Y; 255B/+; dsxF/+ M 0 --------- --------- --------- ---------
9-1 - w; 255B/+; dsxF/+ F 73 87.53±19.27 90 --------- ---------
9-1 A w; 255B/+; dsxF/+ F 98 52.00±13.51 52 -42.22 0
9-1 L w; 255B/+; dsxF/+ F 24 67.33±26.60 78 -13.33 1.87E-04
10-1 - w/Y; 255B/tra; + M 124 81.47±14.12 82 --------- ---------
10-1 A w/Y; 255B/tra; + M 122 74.48±13.90 76 -7.32 2.26E-04
10-1 L w/Y; 255B/tra; + M 124 79.71±16.97 84 2.44 0.293
10-1 - w; 255B/tra; + F 127 93.40±15.91 96 --------- ---------
10-1 A w; 255B/tra; + F 123 91.38±18.93 98 2.08 0.81
10-1 L w; 255B/tra; + F 126 90.24±22.04 96 0 0.732

95

Table 11, continued.
Cross
MxF RU486 Genotype Sex N Mean
a
Median
%Change
in Median
Log Rank
p Value

1-11 R1 - yw sxl/Y ;255B/+; + M 25 85.12±14.30 88 --------- ---------
1-11 R1 A yw sxl/Y ;255B/+; + M 45 85.51±19.71 94 6.82 0.314
1-11 R1 L yw sxl/Y ;255B/+; + M 76 85.13±13.94 84 -4.55 0.635
1-11 R1 - yw sxl/w; 255B/+; + F 49 70.45±31.82 82 --------- ---------
1-11 R1 A yw sxl/w; 255B/+; + F 72 57.39±35.23 76 -7.32 0.011
1-11 R1 L yw sxl/w; 255B/+; + F 122 83.31±23.54 86 4.88 0.005
1-11 R2 - yw sxl/Y ;255B/+; + M 67 91.22±21.02 98 --------- ---------
1-11 R2 A yw sxl/Y ;255B/+; + M 75 75.55±22.66 80 -18.37 2.30E-09
1-11 R2 L yw sxl/Y ;255B/+; + M 96 86.31±27.48 98 0 0.965
1-11 R2 - yw sxl/w; 255B/+; + F 69 89.45±25.26 92 --------- ---------
1-11 R2 A yw sxl/w; 255B/+; + F 74 87.32±18.37 88 -4.35 0.064
1-11 R2 L yw sxl/w; 255B/+; + F 121 92.58±17.93 96 4.35 0.593
11-7 - yw sxl/Y ; + ; + M 119 92.76±15.18 98 --------- ---------
11-7 - yw sxl/+ ; + ; + F 120 94.48±18.26 98 --------- ---------
14-1 - w/Y; 255B/+;dsx/+ M 124 68.73±21.07 72 --------- ---------
14-1 A w/Y; 255B/+;dsx/+ M 124 70.53±17.57 72 0 0.88
14-1 L w/Y; 255B/+;dsx/+ M 5 46.00±35.30 50 -30.56 0.27
14-1 - w; 255B/+;dsx/+ F 123 65.37±28.78 76 --------- ---------
14-1 A w; 255B/+;dsx/+ F 123 65.56±30.01 76 0 0.763
14-1 L w; 255B/+;dsx/+ F 123 73.06±17.51 74 -2.63 0.735
15-1 - w/Y; 255B/tra2 ; + M 125 73.44±16.92 76 --------- ---------
15-1 A w/Y; 255B/tra2 ; + M 124 75.61±15.06 76 0 0.469
15-1 L w/Y; 255B/tra2 ; + M 125 74.64±21.79 78 2.63 0.039
15-1 - w; 255B/tra2 ; + F 124 78.58±25.27 85 --------- ---------
15-1 A w;255B/tra2 ; + F 125 77.47±27.00 86 1.18 0.789
15-1 L w;255B/tra2 ; + F 125 79.81±17.45 82 -3.53 0.144
a
Mean life span, days +/- SD.

96

Discussion
In these experiments germline ablation using the tudor
1
mutation caused increased mean
and median life span in males, +19% and +12%, respectively, whereas female life span
was not affected. In a previous report, germline ablation using the tudor
1
mutation
increased the median life span of male flies by 8.6% (Barnes et al., 2006). However,
germ line ablation was considered not to have increased life span in that report.
Presumably, this was due to a decrease in female life span, and the fact that germline
ablation with a germ cell-less mutant failed to extend life span in either males or females.
However, germ cell-less was reported to have only ~75% penetrance in that study, which
conceivably could have masked any life span extension. Here the tudor mutation was
found to show a greater increase in life span, and overall longer life spans were observed
for both control and experimental groups. This may be due to differences in the genetic
background used: here the relatively long-lived Oregon-R strain was used for crosses to
tudor1, while in the previous study the relatively shorter-lived Dahomey strain was
utilized for crosses. In another recent report, elimination of GCs was found to extend
median life span by +14-78% in males, and by +23-100% in females (Flatt et al., 2008).
In those experiments germ line ablation was produced by mi-expression of the bag of
marbles (bam) gene in adult flies, which caused full sterility by day 7 post-eclosion in
females, and GC depopulation in the 3
rd
instar larval (L3) stage or later in males. The
presence of a complete germ line in the earlier stages of development followed by GC
loss at a later stage could affect life span in a different way, compared with the lack of a
97

germ line from the beginning of embryogenesis, such as is produced by the tudor
mutation. For example, the tudor mutation also causes a lack of formation of the somatic
gonad, while ablation of GCs using bam mis-expression at later developmental stages
allows for differentiation of the somatic gonad. Consistent with this idea, in C. elegans,
extension of life span by ablation of the germ line requires the presence of the somatic
gonad (Yamawaki et al., 2008).

The Winmodest program was used to fit the tudor
1
mutant data to a Gompertz-Makeham
model, which allowed us to separate early mortality from the age-dependent and age-
independent mortality. The analysis indicated that germline ablation in male Drosophila
extended life span by decreasing the age-independent mortality. That implies that
germline ablation provides a benefit for survival in male flies, and this beneficial effect is
constant over the adult life span. This might occur through altered IIS as reported for C.
elegans hermaphrodites (Yamawaki et al., 2008).

The other manipulations of the sexual differentiation pathway tested produced either
neutral or negative effects on adult fly life span. Over-expression of dsxF during
development was lethal to males and produced a limited number of females, while over-
expression of dsxF in adults reduced both male and female life span. Over-expression of
dsxM during development was toxic to males and females, whereas over-expression of
dsxM in adults produced small but significant reductions in male and female life span.
This indicates that in adults, where sexual differentiation is already complete, changes in
98

expression of sex-determination pathway genes are still able to have significant effects on
life span.

Interestingly, over-expression of fru male isoform A (fruMA) during development was
lethal, and over-expression of fruMA in adults greatly reduced bth male and female
median life span. However, expression of an RNAi construct specific for fruMA during
development or in adults significantly decreased female life span, but did not give a
consistent change in male life span. The reason for this effect of fruMA-RNAi in females
is not yet clear. In females, fru P1 transcripts are produced, but not translated (Song et
al., 2002). Possibly the fruMA-RNAi could still function through fru P1 transcripts to
affect female life span, or could function through targets other than fru.

Conditional over-expression of tra during development significantly inhibited sexual
differentiation in males, yet produced no significant change in adult life span. This
demonstrates that it is possible to alter sexual differentiation, at least in males, without
necessarily having effects on adult life span. Overall, the data indicate that it should be
possible to further study the effect on life span of altering the sexual differentiation
pathway either during development or in the adult.

99

Materials and Methods
Drosophila Strains. The UAS-transgene strains were generously provided by Michelle
Arbeitman at USC: The strain yw; P{UAS-fruMA}[7];+ is described in (Song et al.,
2002). The strain w; P{UAS-fru-IR}/CyO; P{UAS-fru-IR} is described in (Manoli and
Baker, 2004). The strain w; P{UAS-dsxM}/CyO,GFP; + is described in (Lee et al.,
2002). The strain w; +; P{UAS-dsxF}/TM3, Sb was generated by Ken Burtis and is
described in (Sanchez et al., 2001). The strain w; P{UAS-tra}[20J7]; + is described in
(Ferveur and Greenspan, 1998). The strains w; +; P{dsx-XP}[d09625] and w; P{tra2-
XP}[d10032]; + are described in (Thibault et al., 2004). The strain y[1] w[67c23]
P{EPgy2}Sxl[EY06108]/FM6B was obtained from Bloomington Drosophila stock
center. The tudor
1
mutant strain (Schupbach and Wieschaus, 1986) was also obtained
from Bloomington Drosophila stock center. For experiments involving tudor
1
, he
experimental group consisted of the progeny of tudor
1
homozygous females crossed to
Oregon R wild-types males, while the control group consisted of the offspring of tudor
1

heterozygotes crossed to Oregon R males. This resulted in control and experimental
groups with the same chromosomal composition, however the experimental group lacks a
germline due to the maternal effect of homozygous tudor
1
(Figure 16B). The tissue-
general Geneswitch driver line Act-GS-255B contains multiple copies of a construct in
which the tissue-general actin5C promoter drives expression of the Geneswitch protein,
and has previously been described and characterized (Ford et al., 2007; Shen et al., 2009).
Act-GS-255B virgins were used in the crosses with males of other lines, unless the UAS
100

insertion of the sex differentiation gene or the EP (XP) insertion was on the X
chromosome, the cross direction was reversed.

Fly Culture. Drosophila culture and life span assays were performed essentially as
previously described (Ford et al., 2007). Briefly, Drosophila were cultured on dextrose,
agar, yeast, cornmeal medium (Ren et al., 2007) at twenty-five flies per vial. Survival
assays were performed at 25oC. Every two days, flies were transferred to new vials, and
the number of deaths was recorded. The drug RU486 (Mifepristone, Sigma) was
dissolved in ethanol (100%) to make a stock solution at 3.2mg/ml. For adult feeding, 50ul
RU486 stock solution was added to each vial to produce a final concentration of
~160ug/ml. 50ul ethanol was added to the control vials. For larval feeding, 0.5ml RU486
of 3.2mg/ml was added to each bottle, whereas 0.5ml ethanol was added to controls.
Vials and bottles were covered with cheesecloth and allowed to dry overnight to allow
the ethanol to evaporate.

Wolbachia Test. Total DNA was extracted from ten male and ten female flies of each
line using the ZR Genomic DNA Kit II (Zymo Research). The Drosophila DNA was
then used as template for PCR amplification with Wolbachia-specific primers, and the
products were fractionated on an agarose gel and stained with ethidium bromide (O'Neill
et al., 1992).

101

Phenotype Characterization. UAS-tra males were crossed to Act-GS-255B virgins, and
the progeny were cultured on food with drug (+RU486) to drive the over expression of
tra during development, or cultured on food with ethanol as the control. Male and female
external genitalia, abdomenal pigmentation patterns, and male sex combs were
photographed using a Leica MZ FLIII fluorescence stereomicroscope. Or-R and w[1118]
males were also crossed to Act-GS-255B virgins, and the progeny were cultured on food
supplemented with drug (+RU486) or with ethanol only, as the controls.

Statistical Analysis. Mean, standard deviation, median, percent change in mean, percent
change in median, and log rank p value were calculated using R 2.6.2. Analysis of
mortality rate was performed using the WinModest statistical package (Pletcher, 1999). In
the Gompertz-Makeham model, the increase

of mortality (µ
x
) with age (x) is expressed as:
µ
x

= ae
bx
+c, where the constant a is the initial mortality

rate, b is the rate of exponential
increase in mortality, and c is the age-independent mortality. Fly deaths were recorded
every other day. Therefore, age was divided by two before being input into WinModest.
The output age was then multiplied by two to compensate for the initial division. The
natural logarithm of mortality (Ln (µ
x
)) for each time point was calculated by the
WinModest statistical software, based on: P
x

= N
x+1

/ N
x

, µ
x

= -Ln(P
x
). Parameters (a, b,
c) were also calculated by the WinModest statistical package, based on a likelihood ratio
test. The full model (ae
bx
+c) was plotted, and the Gompertz-only component (ae
bx
) was
used to build the decomposed survival curves, from the reverse calculation of µ
x
: µ
x

=
102

ae
bx
, P
x

= e
-

µ
x
. For the decomposed survival curves, any value below 0.5% survival was
considered to be the final data point.

103

Final Summary
The antagonistic pleiotropy theory of aging predicts that there are pleiotropic genes (AP
genes) that can be both beneficial and harmful, and this prediction is supported by the
effects of p53 on life span. When over-expressed in the nervous system specifically in
adult flies, p53 gave a life span extension to females, but a decrease of life span in males.
When over-expressed tissue-generally in adult flies, p53 gave a life span extension to
males, but a slight decrease of life span in females. Therefore, p53 had beneficial effects
on life span in one sex, but detrimental effects in the other sex. The pattern of p53 effects
was switched to the opposite when the over-expression was expanded from the nervous
system to the whole body, demonstrating that the effects on life span are tissue specific.
Therefore, p53 is an AP gene, and has sex-specific and tissue-specific effects on fly
aging.

P53 is a multi-functional protein, and there are several possible ways that p53 might
affect Drosophila life span. P53 is a potent tumor-suppressor gene in humans, and
therefore one conceivable way p53 might affect Drosophila life span is by preventing
cancer. Traditionally it has been thought that Drosophila do not develop cancer (Lu and
Abrams, 2006), however there have been recent reports of tumor-like masses and
intestinal over-growths. In Drosophila eye imaginal disc epithelium cells, loss of
epithelial polarity genes, such as scribble (scrib), lethal giant larvae (lgl), or discs large
104

(dlg), leaded to over-proliferation of the tissue (Bilder, 2004). Tumors were found to
develop in male fly testis and gut with age (Salomon and Jackson, 2008). Excessive
proliferation of intestinal stem cells (ISC) in the fly posterior midgut and aberrant
differentiation of ISC were also found to increase in old flies, or under stressed condition
(Biteau et al., 2008). One interesting question to address in the future is whether these
over-growths can limit fly survival, and if these growths are affected by p53. p53 is
involved in additional processes that might affect life span, including regulation of
metabolism and apoptosis. The level of apoptotic markers was found to increase with
age in Drosophila (Zheng et al., 2005), and nervous system specific over-expression of
pro-apoptotic genes, grim, reaper, or the caspase DRONC, shortened adult fly life span
(Bauer et al., 2005), which has led to suggestions that fly life span might be limited by
apoptosis-like processes. However, our results indicate that p53 regulation of apoptotic-
like events may not be the mechanism by which p53 effects fly aging. Here fourteen
apoptosis-regulatory genes were over-expressed tissue generally, in adult flies or during
larval development, and assayed for effects on adult fly life span. Over-expression of the
two powerful apoptosis inhibitors, the Drosophila inhibitor of apoptosis protein DIAP1,
and the caspase inhibitor baculovirus p35, did not produce significant change in either
male or female life span. This suggests that Drosophila life span is not limited by a
canonical caspase-dependent apoptotic process, or at least not one that can be prevented
by over-expression of caspase inhibitors.

105

The IIS pathway appears to be one of the mechanisms behind p53 effects on Drosophila
life span. In a foxo null background, the effect of p53 in males was converted to the
female-like pattern: nervous system specific expression of p53 increased life span in both
males and femalesand tissue general over-expression of p53 decreased life span in both
males and females. Therefore, in a foxo null background, the sexual-dimorphism of p53
effects was eliminated. Over-expression of p53 was found to alter the IIS pathway in a
sex-specific way as well. Nervous system specific over-expression of p53 decreased
phosphorylated Akt levels in males, but increased phosophorylated Akt levels in females.
This supports our conclusion that that the IIS pathway in involved in the sex specific
effects of p53 on life span.

The Sir2 pathway is known to mediate the effects of DR on life span, and is likely to be
another mechanism involved in p53 effects on Drosophila life span. In a Sir2 null
background, the magnitude of p53 effects on life span was reduced: tissue-general over-
expression of p53 produced almost no change of life span in either males or females.
Similarly, in a Sir2 null background, nervous-system specific over-expression of p53
gave only a small change in female life span, although it still produced a decrease in male
life span comparable level to p53 over-expression in wild type background. In summary,
the Sir2 pathway may regulate the magnitude of p53 effects on life span.

As discussed above, p53 has sex-specific effects on life span. This indicates that the sex-
determination and differentiation pathway plays an important role in p53 effects on life
106

span. Over-expression or knockdown of genes in the Drosophila sex determination
hierarchy, sxl, tra, tra-2, fru, dsx, either during development or in adults, had sex-specific
effects on adult life span. Although the effects on life span observed so far are all
negative, genes in the sex determination hierarchy could interact with the IIS and Sir2
pathways to produce the sex-specific effects of p53, since both the IIS and DR pathways
are known to have sex-specific effects on life span. There could also be other sex-
regulatory genes that control the effect of p53 on life span, and this will be an important
area for future research. For example, it would be interesting to see how p53 might affect
life span in a sex-determination pathway mutant background. Mutations that disrupt the
sexual dimorphism between male and female flies might be predicted to also eliminate
the sex-specific effects of p53 on life span. The IIS pathway has been shown to be
involved in sexual dimorphism. Therefore, it will be interesting in the future to ask how
the IIS pathway regulates sexual-differentiation in a way that produces sex-specific
effects of p53 on life span.

107

References
Aigaki, T., Seong, K.H., and Matsuo, T. (2002). Longevity determination genes in
Drosophila melanogaster. Mech Ageing Dev 123, 1531-1541.
Amador-Noguez, D., Zimmerman, J., Venable, S., and Darlington, G. (2005). Gender-
specific alterations in gene expression and loss of liver sexual dimorphism in the long-
lived Ames dwarf mice. Biochem Biophys Res Commun 332, 1086-1100.
Arum, O., and Johnson, T.E. (2007). Reduced expression of the Caenorhabditis elegans
p53 ortholog cep-1 results in increased longevity. J Gerontol A Biol Sci Med Sci 62, 951-
959.
Barnes, A.I., Boone, J.M., Jacobson, J., Partridge, L., and Chapman, T. (2006). No
extension of lifespan by ablation of germ line in Drosophila. Proc Biol Sci 273, 939-947.
Bass, T.M., Weinkove, D., Houthoofd, K., Gems, D., and Partridge, L. (2007). Effects of
resveratrol on lifespan in Drosophila melanogaster and Caenorhabditis elegans. Mech
Ageing Dev 128, 546-552.
Bauer, J.H., Chang, C., Morris, S.N., Hozier, S., Andersen, S., Waitzman, J.S., and
Helfand, S.L. (2007). Expression of dominant-negative Dmp53 in the adult fly brain
inhibits insulin signaling. Proc Natl Acad Sci U S A 104, 13355-13360.
Bauer, J.H., Poon, P.C., Glatt-Deeley, H., Abrams, J.M., and Helfand, S.L. (2005).
Neuronal expression of p53 dominant-negative proteins in adult Drosophila melanogaster
extends life span. Curr Biol 15, 2063-2068.
Baur, J.A., Pearson, K.J., Price, N.L., Jamieson, H.A., Lerin, C., Kalra, A., Prabhu, V.V.,
Allard, J.S., Lopez-Lluch, G., Lewis, K., et al. (2006). Resveratrol improves health and
survival of mice on a high-calorie diet. Nature 444, 337-342.
Belgacem, Y.H., and Martin, J.R. (2006). Disruption of insulin pathways alters trehalose
level and abolishes sexual dimorphism in locomotor activity in Drosophila. J Neurobiol
66, 19-32.
Bensaad, K., Tsuruta, A., Selak, M.A., Vidal, M.N., Nakano, K., Bartrons, R., Gottlieb,
E., and Vousden, K.H. (2006). TIGAR, a p53-inducible regulator of glycolysis and
apoptosis. Cell 126, 107-120.
108

Berman, J.R., and Kenyon, C. (2006). Germ-cell loss extends C. elegans life span
through regulation of DAF-16 by kri-1 and lipophilic-hormone signaling. Cell 124, 1055-
1068.
Bihani, T., Chicas, A., Lo, C.P., and Lin, A.W. (2007). Dissecting the senescence-like
program in tumor cells activated by Ras signaling. J Biol Chem 282, 2666-2675.
Bilder, D. (2004). Epithelial polarity and proliferation control: links from the Drosophila
neoplastic tumor suppressors. Genes Dev 18, 1909-1925.
Biteau, B., Hochmuth, C.E., and Jasper, H. (2008). JNK activity in somatic stem cells
causes loss of tissue homeostasis in the aging Drosophila gut. Cell Stem Cell 3, 442-455.
Boyle, M., Wong, C., Rocha, M., and Jones, D.L. (2007). Decline in self-renewal factors
contributes to aging of the stem cell niche in the Drosophila testis. Cell Stem Cell 1, 470-
478.
Brack, A.S., and Rando, T.A. (2007). Intrinsic changes and extrinsic influences of
myogenic stem cell function during aging. Stem Cell Rev 3, 226-237.
Bredesen, D.E. (2008). Programmed cell death mechanisms in neurological disease. Curr
Mol Med 8, 173-186.
Brodsky, M.H., Nordstrom, W., Tsang, G., Kwan, E., Rubin, G.M., and Abrams, J.M.
(2000). Drosophila p53 binds a damage response element at the reaper locus. Cell 101,
103-113.
Campisi, J. (2005). Senescent cells, tumor suppression, and organismal aging: good
citizens, bad neighbors. Cell 120, 513-522.
Cho, Y., Gorina, S., Jeffrey, P.D., and Pavletich, N.P. (1994). Crystal structure of a p53
tumor suppressor-DNA complex: understanding tumorigenic mutations. Science 265,
346-355.
Choi, N.H., Kim, J.G., Yang, D.J., Kim, Y.S., and Yoo, M.A. (2008). Age-related
changes in Drosophila midgut are associated with PVF2, a PDGF/VEGF-like growth
factor. Aging Cell 7, 318-334.
Clancy, D.J., Gems, D., Hafen, E., Leevers, S.J., and Partridge, L. (2002). Dietary
restriction in long-lived dwarf flies. Science 296, 319.
109

Clancy, D.J., Gems, D., Harshman, L.G., Oldham, S., Stocker, H., Hafen, E., Leevers,
S.J., and Partridge, L. (2001). Extension of life-span by loss of CHICO, a Drosophila
insulin receptor substrate protein. Science 292, 104-106.
Clevers, H. (2006). Wnt/beta-catenin signaling in development and disease. Cell 127,
469-480.
Cordier, F., Grubisha, O., Traincard, F., Veron, M., Delepierre, M., and Agou, F. (2008).
The zinc finger of NEMO is a functional ubiquitin-binding domain. J Biol Chem.
Courtois-Cox, S., Genther Williams, S.M., Reczek, E.E., Johnson, B.W., McGillicuddy,
L.T., Johannessen, C.M., Hollstein, P.E., MacCollin, M., and Cichowski, K. (2006). A
negative feedback signaling network underlies oncogene-induced senescence. Cancer
Cell 10, 459-472.
Crighton, D., Wilkinson, S., O'Prey, J., Syed, N., Smith, P., Harrison, P.R., Gasco, M.,
Garrone, O., Crook, T., and Ryan, K.M. (2006). DRAM, a p53-induced modulator of
autophagy, is critical for apoptosis. Cell 126, 121-134.
Curtis, C., Landis, G.N., Folk, D., Wehr, N.B., Hoe, N., Waskar, M., Abdueva, D.,
Skvortsov, D., Ford, D., Luu, A., et al. (2007). Transcriptional profiling of MnSOD-
mediated lifespan extension in Drosophila reveals a species-general network of aging and
metabolic genes. Genome Biol 8, R262.
DeCarolis, N.A., Wharton, K.A., Jr., and Eisch, A.J. (2008). Which way does the Wnt
blow? Exploring the duality of canonical Wnt signaling on cellular aging. Bioessays 30,
102-106.
Di Micco, R., Fumagalli, M., Cicalese, A., Piccinin, S., Gasparini, P., Luise, C., Schurra,
C., Garre, M., Nuciforo, P.G., Bensimon, A., et al. (2006). Oncogene-induced senescence
is a DNA damage response triggered by DNA hyper-replication. Nature 444, 638-642.
Don, A.S., Martinez-Lamenca, C., Webb, W.R., Proia, R.L., Roberts, E., and Rosen, H.
(2007). Essential requirement for sphingosine kinase 2 in a sphingolipid apoptosis
pathway activated by FTY720 analogues. J Biol Chem 282, 15833-15842.
Edwards, M.G., Anderson, R.M., Yuan, M., Kendziorski, C.M., Weindruch, R., and
Prolla, T.A. (2007). Gene expression profiling of aging reveals activation of a p53-
mediated transcriptional program. BMC Genomics 8, 80.
Fabrizio, P., Gattazzo, C., Battistella, L., Wei, M., Cheng, C., McGrew, K., and Longo,
V.D. (2005). Sir2 blocks extreme life-span extension. Cell 123, 655-667.
110

Farnsworth, C.L., and Feig, L.A. (1991). Dominant inhibitory mutations in the Mg(2+)-
binding site of RasH prevent its activation by GTP. Mol Cell Biol 11, 4822-4829.
Feng, Z., Hu, W., Teresky, A.K., Hernando, E., Cordon-Cardo, C., and Levine, A.J.
(2007). Declining p53 function in the aging process: a possible mechanism for the
increased tumor incidence in older populations. Proc Natl Acad Sci U S A 104, 16633-
16638.
Ferveur, J.F., and Greenspan, R.J. (1998). Courtship behavior of brain mosaics in
Drosophila. J Neurogenet 12, 205-226.
Flatt, T., and Kawecki, T.J. (2007). Juvenile hormone as a regulator of the trade-off
between reproduction and life span in Drosophila melanogaster. Evolution 61, 1980-
1991.
Flatt, T., Min, K.J., D'Alterio, C., Villa-Cuesta, E., Cumbers, J., Lehmann, R., Jones,
D.L., and Tatar, M. (2008). Drosophila germ-line modulation of insulin signaling and
lifespan. Proc Natl Acad Sci U S A 105, 6368-6373.
Ford, D., Hoe, N., Landis, G.N., Tozer, K., Luu, A., Bhole, D., Badrinath, A., and Tower,
J. (2007). Alteration of Drosophila life span using conditional, tissue-specific expression
of transgenes triggered by doxycyline or RU486/Mifepristone. Exp Gerontol 42, 483-
497.
Fry, A.J., Palmer, M.R., and Rand, D.M. (2004). Variable fitness effects of Wolbachia
infection in Drosophila melanogaster. Heredity 93, 379-389.
Garcia-Cao, I., Garcia-Cao, M., Martin-Caballero, J., Criado, L.M., Klatt, P., Flores,
J.M., Weill, J.C., Blasco, M.A., and Serrano, M. (2002). "Super p53" mice exhibit
enhanced DNA damage response, are tumor resistant and age normally. EMBO J 21,
6225-6235.
Gavrilova, N.S., Gavrilov, L.A., Semyonova, V.G., and Evdokushkina, G.N. (2004).
Does exceptional human longevity come with a high cost of infertility? Testing the
evolutionary theories of aging. Ann N Y Acad Sci 1019, 513-517.
Giannakou, M.E., Goss, M., Jacobson, J., Vinti, G., Leevers, S.J., and Partridge, L.
(2007). Dynamics of the action of dFOXO on adult mortality in Drosophila. Aging Cell
6, 429-438.
111

Giannakou, M.E., Goss, M., Junger, M.A., Hafen, E., Leevers, S.J., and Partridge, L.
(2004). Long-lived Drosophila with overexpressed dFOXO in adult fat body. Science
305, 361.
Giot, L., Bader, J.S., Brouwer, C., Chaudhuri, A., Kuang, B., Li, Y., Hao, Y.L., Ooi,
C.E., Godwin, B., Vitols, E., et al. (2003). A protein interaction map of Drosophila
melanogaster. Science 302, 1727-1736.
Goberdhan, D.C., and Wilson, C. (2003). The functions of insulin signaling: size isn't
everything, even in Drosophila. Differentiation 71, 375-397.
Goldman, T.D., and Arbeitman, M.N. (2007). Genomic and functional studies of
Drosophila sex hierarchy regulated gene expression in adult head and nervous system
tissues. PLoS Genet 3, e216.
Harms, K.L., and Chen, X. (2005). The C terminus of p53 family proteins is a cell fate
determinant. Mol Cell Biol 25, 2014-2030.
Hlavata, L., Nachin, L., Jezek, P., and Nystrom, T. (2008). Elevated Ras/protein kinase A
activity in Saccharomyces cerevisiae reduces proliferation rate and lifespan by two
different reactive oxygen species-dependent routes. Aging Cell 7, 148-157.
Howitz, K.T., Bitterman, K.J., Cohen, H.Y., Lamming, D.W., Lavu, S., Wood, J.G.,
Zipkin, R.E., Chung, P., Kisielewski, A., Zhang, L.L., et al. (2003). Small molecule
activators of sirtuins extend Saccharomyces cerevisiae lifespan. Nature 425, 191-196.
Hsin, H., and Kenyon, C. (1999). Signals from the reproductive system regulate the
lifespan of C. elegans. Nature 399, 362-366.
Hwangbo, D.S., Gersham, B., Tu, M.P., Palmer, M., and Tatar, M. (2004a). Drosophila
dFOXO controls lifespan and regulates insulin signalling in brain and fat body. Nature
429, 562-566.
Hwangbo, D.S., Gershman, B., Tu, M.P., Palmer, M., and Tatar, M. (2004b). Drosophila
dFOXO controls lifespan and regulates insulin signalling in brain and fat body. Nature
429, 562-566.
Jiang, J.C., Wawryn, J., Shantha Kumara, H.M., and Jazwinski, S.M. (2002). Distinct
roles of processes modulated by histone deacetylases Rpd3p, Hda1p, and Sir2p in life
extension by caloric restriction in yeast. Exp Gerontol 37, 1023-1030.
112

Jin, S., Martinek, S., Joo, W.S., Wortman, J.R., Mirkovic, N., Sali, A., Yandell, M.D.,
Pavletich, N.P., Young, M.W., and Levine, A.J. (2000). Identification and
characterization of a p53 homologue in Drosophila melanogaster. Proc Natl Acad Sci U S
A 97, 7301-7306.
Johannes H. Bauer, S.N.S.M., Chengyi Chang, Thomas Flatt, Jason G. Wood and
Stephen L. Helfand (2009). dSir2 and Dmp53 interact to mediate aspects of CR-
dependent life span extension in D. melanogaster. AGING 1, 38-38.
Junger, M.A., Rintelen, F., Stocker, H., Wasserman, J.D., Vegh, M., Radimerski, T.,
Greenberg, M.E., and Hafen, E. (2003). The Drosophila forkhead transcription factor
FOXO mediates the reduction in cell number associated with reduced insulin signaling. J
Biol 2, 20.
Kaeberlein, M., McVey, M., and Guarente, L. (1999). The SIR2/3/4 complex and SIR2
alone promote longevity in Saccharomyces cerevisiae by two different mechanisms.
Genes Dev 13, 2570-2580.
Kirkwood, T.B. (2005). Understanding the odd science of aging. Cell 120, 437-447.
Kirkwood, T.B.L. (1990). The disposable soma theory of aging. In Genetic effects on
aging II, D.E. Harrison, ed. (Caldwell, NJ, Telford press.).
Kujoth, G.C., Hiona, A., Pugh, T.D., Someya, S., Panzer, K., Wohlgemuth, S.E., Hofer,
T., Seo, A.Y., Sullivan, R., Jobling, W.A., et al. (2005). Mitochondrial DNA mutations,
oxidative stress, and apoptosis in mammalian aging. Science 309, 481-484.
Kussie, P.H., Gorina, S., Marechal, V., Elenbaas, B., Moreau, J., Levine, A.J., and
Pavletich, N.P. (1996). Structure of the MDM2 oncoprotein bound to the p53 tumor
suppressor transactivation domain. Science 274, 948-953.
Lane, D.P. (1992). Cancer. p53, guardian of the genome. Nature 358, 15-16.
Lee, G., Hall, J.C., and Park, J.H. (2002). Doublesex gene expression in the central
nervous system of Drosophila melanogaster. J Neurogenet 16, 229-248.
Lee, T., Feig, L., and Montell, D.J. (1996). Two distinct roles for Ras in a
developmentally regulated cell migration. Development 122, 409-418.
Levine, A.J. (1997). p53, the cellular gatekeeper for growth and division. Cell 88, 323-
331.
113

Li, W.X. (2008). Canonical and non-canonical JAK-STAT signaling. Trends Cell Biol
18, 545-551.
Ligtenberg, T., and Brand, H. (1999). Longevity--does family size matter? Nature 399,
522.
Lin, G., Xu, N., and Xi, R. (2008). Paracrine Wingless signalling controls self-renewal of
Drosophila intestinal stem cells. Nature 455, 1119-1123.
Lin, S.J., Kaeberlein, M., Andalis, A.A., Sturtz, L.A., Defossez, P.A., Culotta, V.C., Fink,
G.R., and Guarente, L. (2002). Calorie restriction extends Saccharomyces cerevisiae
lifespan by increasing respiration. Nature 418, 344-348.
Liu, H., Fergusson, M.M., Castilho, R.M., Liu, J., Cao, L., Chen, J., Malide, D., Rovira,
II, Schimel, D., Kuo, C.J., et al. (2007). Augmented Wnt signaling in a mammalian
model of accelerated aging. Science 317, 803-806.
Longo, V.D. (2004). Ras: the other pro-aging pathway. Sci Aging Knowledge Environ
2004, pe36.
Longo, V.D., and Finch, C.E. (2003). Evolutionary medicine: from dwarf model systems
to healthy centenarians? Science 299, 1342-1346.
Lu, W.J., and Abrams, J.M. (2006). Lessons from p53 in non-mammalian models. Cell
Death Differ 13, 909-912.
Maier, B., Gluba, W., Bernier, B., Turner, T., Mohammad, K., Guise, T., Sutherland, A.,
Thorner, M., and Scrable, H. (2004). Modulation of mammalian life span by the short
isoform of p53. Genes Dev 18, 306-319.
Manoli, D.S., and Baker, B.S. (2004). Median bundle neurons coordinate behaviours
during Drosophila male courtship. Nature 430, 564-569.
Marzetti, E., Wohlgemuth, S.E., Lees, H.A., Chung, H.Y., Giovannini, S., and
Leeuwenburgh, C. (2008). Age-related activation of mitochondrial caspase-independent
apoptotic signaling in rat gastrocnemius muscle. Mech Ageing Dev 129, 542-549.
Masoro, E.J. (2003). Subfield history: caloric restriction, slowing aging, and extending
life. Sci Aging Knowledge Environ 2003, RE2.
114

Matheu, A., Maraver, A., Klatt, P., Flores, I., Garcia-Cao, I., Borras, C., Flores, J.M.,
Vina, J., Blasco, M.A., and Serrano, M. (2007). Delayed ageing through damage
protection by the Arf/p53 pathway. Nature 448, 375-379.
McEwen, D.G., and Peifer, M. (2005). Puckered, a Drosophila MAPK phosphatase,
ensures cell viability by antagonizing JNK-induced apoptosis. Development 132, 3935-
3946.
McGraw, E.A., and O'Neill, S.L. (2004). Wolbachia pipientis: intracellular infection and
pathogenesis in Drosophila. Curr Opin Microbiol 7, 67-70.
Medawar, P.B., ed. (1952). An unsolved problem in biology (London: HK Lewis).
Micchelli, C.A., and Perrimon, N. (2006). Evidence that stem cells reside in the adult
Drosophila midgut epithelium. Nature 439, 475-479.
Min, K.J., Yamamoto, R., Buch, S., Pankratz, M., and Tatar, M. (2008). Drosophila
lifespan control by dietary restriction independent of insulin-like signaling. Aging Cell 7,
199-206.
Moore, L., Lu, X., Ghebranious, N., Tyner, S., and Donehower, L.A. (2007). Aging-
associated truncated form of p53 interacts with wild-type p53 and alters p53 stability,
localization, and activity. Mech Ageing Dev 128, 717-730.
Murphy, C.T., Lee, S.J., and Kenyon, C. (2007). Tissue entrainment by feedback
regulation of insulin gene expression in the endoderm of Caenorhabditis elegans. Proc
Natl Acad Sci U S A 104, 19046-19050.
Nanji, M., Hopper, N.A., and Gems, D. (2005). LET-60 RAS modulates effects of
insulin/IGF-1 signaling on development and aging in Caenorhabditis elegans. Aging Cell
4, 235-245.
Newman, B.L., Lundblad, J.R., Chen, Y., and Smolik, S.M. (2002). A Drosophila
homologue of Sir2 modifies position-effect variegation but does not affect life span.
Genetics 162, 1675-1685.
Nicholson, L., Singh, G.K., Osterwalder, T., Roman, G.W., Davis, R.L., and Keshishian,
H. (2008). Spatial and temporal control of gene expression in Drosophila using the
inducible GeneSwitch GAL4 system. I. Screen for larval nervous system drivers.
Genetics 178, 215-234.
115

Nolo, R., Morrison, C.M., Tao, C., Zhang, X., and Halder, G. (2006). The bantam
microRNA is a target of the hippo tumor-suppressor pathway. Curr Biol 16, 1895-1904.
Nystul, T.G., and Spradling, A.C. (2006). Breaking out of the mold: diversity within
adult stem cells and their niches. Curr Opin Genet Dev 16, 463-468.
O'Neill, S.L., Giordano, R., Colbert, A.M., Karr, T.L., and Robertson, H.M. (1992). 16S
rRNA phylogenetic analysis of the bacterial endosymbionts associated with cytoplasmic
incompatibility in insects. Proc Natl Acad Sci U S A 89, 2699-2702.
Obsil, T., Ghirlando, R., Anderson, D.E., Hickman, A.B., and Dyda, F. (2003). Two 14-
3-3 binding motifs are required for stable association of Forkhead transcription factor
FOXO4 with 14-3-3 proteins and inhibition of DNA binding. Biochemistry 42, 15264-
15272.
Ohlstein, B., and Spradling, A. (2006). The adult Drosophila posterior midgut is
maintained by pluripotent stem cells. Nature 439, 470-474.
Ollmann, M., Young, L.M., Di Como, C.J., Karim, F., Belvin, M., Robertson, S.,
Whittaker, K., Demsky, M., Fisher, W.W., Buchman, A., et al. (2000). Drosophila p53 is
a structural and functional homolog of the tumor suppressor p53. Cell 101, 91-101.
Osaki, M., Oshimura, M., and Ito, H. (2004). PI3K-Akt pathway: its functions and
alterations in human cancer. Apoptosis 9, 667-676.
Osborne, T.B., Mendel, L.B., and Ferry, E.L. (1917). The Effect of Retardation of
Growth Upon the Breeding Period and Duration of Life of Rats. Science 45, 294-295.
Osterwalder, T., Yoon, K.S., White, B.H., and Keshishian, H. (2001). A conditional
tissue-specific transgene expression system using inducible GAL4. Proc Natl Acad Sci U
S A 98, 12596-12601.
Page-McCaw, A. (2008). Remodeling the model organism: matrix metalloproteinase
functions in invertebrates. Semin Cell Dev Biol 19, 14-23.
Pan, L., Chen, S., Weng, C., Call, G., Zhu, D., Tang, H., Zhang, N., and Xie, T. (2007).
Stem cell aging is controlled both intrinsically and extrinsically in the Drosophila ovary.
Cell Stem Cell 1, 458-469.
Pfaffl, M.W. (2001). A new mathematical model for relative quantification in real-time
RT-PCR. Nucleic Acids Res 29, e45.
116

Pletcher, S.D. (1999). Model fitting and hypothesis testing for age-specific mortality data.
J Evol Biol 12, 430-439.
Poirier, L., Shane, A., Zheng, J., and Seroude, L. (2008). Characterization of the
Drosophila gene-switch system in aging studies: a cautionary tale. Aging Cell 7, 758-770.
RDevelopmentCoreTeam (2006). R: A language and environment for statistical
computing. (R Foundation for Statistical Computing, Vienna, Austria).
Ren, C., Finkel, S.E., and Tower, J. (2009). Conditional inhibition of autophagy genes in
adult Drosophila impairs immunity without compromising longevity. Exp Gerontol, In
press.
Ren, C., Webster, P., Finkel, S.E., and Tower, J. (2007). Increased internal and external
bacterial load during Drosophila aging without life-span trade-off. Cell Metab 6, 144-
152.
Rogina, B., and Helfand, S.L. (2004). Sir2 mediates longevity in the fly through a
pathway related to calorie restriction. Proc Natl Acad Sci U S A 101, 15998-16003.
Rogina, B., Helfand, S.L., and Frankel, S. (2002). Longevity regulation by Drosophila
Rpd3 deacetylase and caloric restriction. Science 298, 1745.
Roman, G., Endo, K., Zong, L., and Davis, R.L. (2001). P[Switch], a system for spatial
and temporal control of gene expression in Drosophila melanogaster. Proc Natl Acad Sci
U S A 98, 12602-12607.
Salomon, R.N., and Jackson, F.R. (2008). Tumors of testis and midgut in aging flies. Fly
(Austin) 2, 265-268.
Sanchez, L., Gorfinkiel, N., and Guerrero, I. (2001). Sex determination genes control the
development of the Drosophila genital disc, modulating the response to Hedgehog,
Wingless and Decapentaplegic signals. Development 128, 1033-1043.
Schnetzer, J.W., and Tyler, M.S. (1996). Endogenous beta-galactosidase activity in the
larval, pupal, and adult stages of the fruit fly, Drosophila melanogaster, indicates need for
caution in lacZ fusion-gene studies. Biol Bull 190, 173-187.
Schupbach, T., and Wieschaus, E. (1986). Maternal-effect mutations altering the anterior-
posterior pattern of the Drosophila embryo. Rouxs Arch Dev Biol 195, 302-317.
117

Shen, J., Curtis, C., Tavaré, S., and Tower, J. (2009). A screen of apoptosis and
senescence regulatory genes for life span effects when over-expressed in Drosophila.
Impact Aging 1, 191-211.
Shilo, B.Z. (2005). Regulating the dynamics of EGF receptor signaling in space and time.
Development 132, 4017-4027.
Singh, S.R., Liu, W., and Hou, S.X. (2007). The adult Drosophila malpighian tubules are
maintained by multipotent stem cells. Cell Stem Cell 1, 191-203.
Sogame, N., Kim, M., and Abrams, J.M. (2003). Drosophila p53 preserves genomic
stability by regulating cell death. Proc Natl Acad Sci U S A 100, 4696-4701.
Song, H.J., Billeter, J.C., Reynaud, E., Carlo, T., Spana, E.P., Perrimon, N., Goodwin,
S.F., Baker, B.S., and Taylor, B.J. (2002). The fruitless gene is required for the proper
formation of axonal tracts in the embryonic central nervous system of Drosophila.
Genetics 162, 1703-1724.
Song, X., and Xie, T. (2003). Wingless signaling regulates the maintenance of ovarian
somatic stem cells in Drosophila. Development 130, 3259-3268.
Srinivasula, S.M., and Ashwell, J.D. (2008). IAPs: what's in a name? Mol Cell 30, 123-
135.
Stanyon, C.A., Liu, G., Mangiola, B.A., Patel, N., Giot, L., Kuang, B., Zhang, H., Zhong,
J., and Finley, R.L., Jr. (2004). A Drosophila protein-interaction map centered on cell-
cycle regulators. Genome Biol 5, R96.
Takashima, S., Mkrtchyan, M., Younossi-Hartenstein, A., Merriam, J.R., and
Hartenstein, V. (2008). The behaviour of Drosophila adult hindgut stem cells is
controlled by Wnt and Hh signalling. Nature 454, 651-655.
Tatar, M., Bartke, A., and Antebi, A. (2003). The endocrine regulation of aging by
insulin-like signals. Science 299, 1346-1351.
Tatar, M., Kopelman, A., Epstein, D., Tu, M.P., Yin, C.M., and Garofalo, R.S. (2001). A
mutant Drosophila insulin receptor homolog that extends life-span and impairs
neuroendocrine function. Science 292, 107-110.
Thibault, S.T., Singer, M.A., Miyazaki, W.Y., Milash, B., Dompe, N.A., Singh, C.M.,
Buchholz, R., Demsky, M., Fawcett, R., Francis-Lang, H.L., et al. (2004). A
118

complementary transposon tool kit for Drosophila melanogaster using P and piggyBac.
Nat Genet 36, 283-287.
Thomson, T., and Lasko, P. (2005). Tudor and its domains: germ cell formation from a
Tudor perspective. Cell Res 15, 281-291.
Tissenbaum, H.A., and Guarente, L. (2001). Increased dosage of a sir-2 gene extends
lifespan in Caenorhabditis elegans. Nature 410, 227-230.
Toivonen, J.M., and Partridge, L. (2008). Endocrine regulation of ageing and
reproduction in Drosophila. Mol Cell Endocrinol.
Toivonen, J.M., Walker, G.A., Martinez-Diaz, P., Bjedov, I., Driege, Y., Jacobs, H.T.,
Gems, D., and Partridge, L. (2007). No influence of Indy on lifespan in Drosophila after
correction for genetic and cytoplasmic background effects. PLoS Genet 3, e95.
Tower, J. (2000). Transgenic methods for increasing Drosophila life span. Mech Ageing
Dev 118, 1-14.
Tower, J. (2006). Sex-specific regulation of aging and apoptosis. Mech Ageing Dev 127,
705-718.
Tyner, S.D., Venkatachalam, S., Choi, J., Jones, S., Ghebranious, N., Igelmann, H., Lu,
X., Soron, G., Cooper, B., Brayton, C., et al. (2002). p53 mutant mice that display early
ageing-associated phenotypes. Nature 415, 45-53.
Ungewitter, E., and Scrable, H. (2009). Antagonistic pleiotropy and p53. Mech Ageing
Dev 130, 10-17.
Van Der Heide, L.P., Hoekman, M.F., and Smidt, M.P. (2004). The ins and outs of FoxO
shuttling: mechanisms of FoxO translocation and transcriptional regulation. Biochem J
380, 297-309.
Walker, K.K., and Levine, A.J. (1996). Identification of a novel p53 functional domain
that is necessary for efficient growth suppression. Proc Natl Acad Sci U S A 93, 15335-
15340.
Wallenfang, M.R., Nayak, R., and DiNardo, S. (2006). Dynamics of the male germline
stem cell population during aging of Drosophila melanogaster. Aging Cell 5, 297-304.
Wang, M.C., Bohmann, D., and Jasper, H. (2003). JNK Signaling Confers Tolerance to
Oxidative Stress and Extends Lifespan in Drosophila. Dev Cell 5, 811-816.
119

Wang, Y., Oh, S.W., Deplancke, B., Luo, J., Walhout, A.J., and Tissenbaum, H.A.
(2006). C. elegans 14-3-3 proteins regulate life span and interact with SIR-2.1 and DAF-
16/FOXO. Mech Ageing Dev 127, 741-747.
Waskar, M., Landis, G.N., Shen, J., Curtis, C., Tozer, K., Abdueva, D., Skvortsov, D.,
Tavaré, S., and Tower, J. (2009). submitted.
Westendorp, R.G., and Kirkwood, T.B. (1998). Human longevity at the cost of
reproductive success. Nature 396, 743-746.
Williams, G.C. (1957). Pleiotropy, Natural Selection, and the Evolution of Senescence.
Evolution 11, 398-411.
Wood, J.G., Rogina, B., Lavu, S., Howitz, K., Helfand, S.L., Tatar, M., and Sinclair, D.
(2004). Sirtuin activators mimic caloric restriction and delay ageing in metazoans. Nature
430, 686-689.
Yamawaki, T.M., Arantes-Oliveira, N., Berman, J.R., Zhang, P., and Kenyon, C. (2008).
Distinct activities of the germline and somatic reproductive tissues in the regulation of
Caenorhabditis elegans' longevity. Genetics 178, 513-526.
Yang, J., and Tower, J. (2009). Expression of hsp22 and hsp70 transgenes is partially
predictive of Drosophila survival under normal and stress conditions. J Gerontol: Biol Sci
In press.
Zhao, R., Xuan, Y., Li, X., and Xi, R. (2008). Age-related changes of germline stem cell
activity, niche signaling activity and egg production in Drosophila. Aging Cell 7, 344-
354.
Zheng, J., Edelman, S.W., Tharmarajah, G., Walker, D.W., Pletcher, S.D., and Seroude,
L. (2005). Differential patterns of apoptosis in response to aging in Drosophila. Proc Natl
Acad Sci U S A 102, 12083-12088.

Abstract (if available)

Abstract Aging is a process of gradual decline of normal function and increase of chance of mortality in an organism over time. Recent aging research has shown that conserved pathways are shared between Drosophila and other model organisms. One of the main evolutionary theories of aging is the antagonistic pleiotropy theory, that predicts that there are antagonistically pleiotropic genes (AP genes) that can be both beneficial and harmful at different stages of the life cycle. To test this, the effects of p53 on Drosophila life span were examined, using a system for experimentally controlling gene expression called “GeneSwitch”. p53 was found to be an AP gene, with sex-specific and tissue-specific effects on fly life span. Nervous-system-specific over-expression of p53 in adult flies gave a life span extension to females, but a decrease of life span in males. Tissue-general over-expression of p53 in adult flies gave the opposite pattern: a life span extension to males, but a decrease of life span in females. These results suggest that p53 has both tissue-specific and sexually antagonistic effects on fly life span. Over-expression of other apoptosis-regulatory genes did not increase life span, suggesting that p53 regulation of apoptosis may not be the mechanism by which p53 affects fly life span. The IIS pathway was found to be involved in determining the sex-specific effects of p53. In a foxo null background, the effect of p53 in males was converted to the female-like pattern. In addition, over-expression of p53 was found to alter signaling through the IIS pathway in a sex-specific way, as indicated by AKT phosphorylation levels. The effects of p53 over-expression on life span were reduced in a Sir2 null mutant background, indicating that the Sir2 pathway regulates the magnitude of p53 effects. Finally, the effects of sex-differentiation genes on life span were explored.

Linked assets

University of Southern California Dissertations and Theses

Conceptually similar

PDF

The effect of microbial load and autophagy on drosophila immunity and life span

PDF

Transgenic biomarkers of aging in drosophila melanogaster

PDF

Differential effects of starvation in normal and cancer cells: from EGR1-dependent protection to p53-mediated apoptosis

PDF

Characterization of Drosophila longevity and fecundity regulating genes

PDF

Molecular misreading in Drosophila melanogaster

PDF

Fluorescent protein turnover in free-moving Drosophila melanogaster

PDF

Studies of Sir2 and caloric restriction mimetic pathways in aging

PDF

To adapt or not to adapt: the age-specific and sex-dependent differences in the adaptive stress response

PDF

Biological interactions on the behavioral, genomic, and ecological scale: investigating patterns in Drosophila melanogaster of the southeast United States and Caribbean islands

Asset Metadata

Creator Shen, Jie (author)

Core Title Sex-specific effects of drosophila p53 on adult life span

School College of Letters, Arts and Sciences

Degree Doctor of Philosophy

Degree Program Molecular Biology

Publication Date 07/07/2009

Defense Date 04/29/2009

Publisher University of Southern California (original), University of Southern California. Libraries (digital)

Tag aging,apoptosis,Drosophila,OAI-PMH Harvest,p53,sex-differentiation

Language English

Contributor Electronically uploaded by the author (provenance)

Advisor Tower, John (committee chair), Forsburg, Susan (committee member), Longo, Valter D. (committee member), Mak, Chi Ho (committee member)

Creator Email jies@usc.edu,jieshen007@gmail.com

Permanent Link (DOI) https://doi.org/10.25549/usctheses-m2329

Unique identifier UC160005

Identifier etd-shen-2907 (filename),usctheses-m40 (legacy collection record id),usctheses-c127-561816 (legacy record id),usctheses-m2329 (legacy record id)

Legacy Identifier etd-shen-2907.pdf

Dmrecord 561816

Document Type Dissertation

Rights Shen, Jie

Type texts

Source University of Southern California (contributing entity), University of Southern California Dissertations and Theses (collection)

Repository Name Libraries, University of Southern California

Repository Location Los Angeles, California

Repository Email cisadmin@lib.usc.edu