University of Southern California Dissertations and Theses

Inclusion body purification of elastin-like-polypeptide fusion proteins with a low transition temperature

(USC Thesis Other)

Inclusion body purification of elastin-like-polypeptide fusion proteins with a low transition temperature

PDF

Download a page range

Download transcript

Copy asset link

Request this asset

Transcript (if available)

Content Inclusion Body PurificaƟon of ElasƟn-Like-PolypepƟde Fusion Proteins with A Low TransiƟon
Temperature
By
Haozhong Luo
A Thesis Presented to the
FACULTY OF THE USC ALFRED E. MANN SCHOOL OF PHARMACY AND PHARMACEUTICAL
SCIENCE
UNIVERSITY OF SOUTHERN CALIFORNIA
In ParƟal Fulfillment of the
Requirements for the Degree
(MASTER OF SCIENCE)
(PHARMARCEUTICAL SCIENCE)
DECEMBER 2023
Copyright 2025 Haozhong Luo

ii
Acknowledgements
J. Andrew Mackay, Shin-Jae Lee, Marinella Markanovic, Sara Aƫa, Alvin Phan, Ian S. Haworth,
CurƟs T. Okamoto
I would like to acknowledge and give my warmest thanks to Dr. J. Andrew MacKay who made
this work possible. His guidance and advice carried me through all the stages of wriƟng my
project. I would also like to thank my commiƩee members, Dr. Haworth, and Dr. Okamoto, for
the valuable comments.
I would also like to give thanks to Shin-Jae Lee for the collaboraƟons and instrucƟons
throughout the whole project. The images that he and Marinella Markanovic provided made
this thesis complete.
Finally, I would like to thank lab members, Sara Aƫa, and Alvin Phan, for giving support and
advice.

iii
TABLE OF CONTENTS
ACKNOWLEDGEMENTS ................................................................................................................................................. ii
LIST OF TABLES ............................................................................................................................................................. v
LIST OF FIGURES .......................................................................................................................................................... vi
ABBREVIATIONS .......................................................................................................................................................... vii
ABSTRACT .................................................................................................................................................................. viii
CHAPTER 1: INTRODUCTION ...................................................................................................................................... 1
1.1 ELP ....................................................................................................................................................................... 4
1.2 MOLECULAR CLONING ............................................................................................................................................... 6
1.3 INCLUSION BODIES .................................................................................................................................................... 8
1.4 PURIFICATION ........................................................................................................................................................ 12
1.5 SOLUBILIZATION ..................................................................................................................................................... 14
1.6 REFOLDING ........................................................................................................................................................... 17
CHAPTER 2: MATERIALS AND METHODS .................................................................................................................... 20
2.1 IL17R-V96 LIGATION .............................................................................................................................................. 20
2.2 NON-DENATURANT ................................................................................................................................................. 21
2.3 PULSATILE DILUTION ................................................................................................................................................ 22
2.4 STEPWISE AND ONE-STEP DIALYSIS FINAL YIELD COMPARISON .......................................................................................... 28
2.5 PROTEIN SOLUBILITY DURING STEPWISE AND ONE-STEP DIALYSIS ....................................................................................... 29
2.6 DIFFERENT DETERGENTS WASH COMPARISONS .............................................................................................................. 30
2.7 WESTERN BLOT ...................................................................................................................................................... 34
2.8 TRITON X-100 INTERFERENCE WITH COACERVATION OF V96 ........................................................................................... 35
2.9 PROTEIN CONCENTRATIONS ...................................................................................................................................... 35
CHAPTER 3: RESULTS ................................................................................................................................................. 36
3.1 IL17R-V96 LIGATION .............................................................................................................................................. 36
3.2 NON-DENATURANT ................................................................................................................................................. 40
3.3 MANUAL PULSATILE DILUTION ................................................................................................................................... 42
3.4 PULSATILE DILUTION UNDER DIFFERENT CONDITIONS ...................................................................................................... 44
3.5 PROTEIN SOLUBILITY DURING STEPWISE AND ONE-STEP DIALYSIS ....................................................................................... 50
3.6 DIFFERENT DETERGENTS WASH COMPARISONS. ............................................................................................................. 53
3.7 TRITON X-100 INTERFERENCE WITH COACERVATION OF V96 ........................................................................................... 60

iv
CHAPTER 4: DISCUSSION ............................................................................................................................................. 63
CHAPTER 5: CONCLUSION ........................................................................................................................................... 66
REFERENCES ............................................................................................................................................................... 67

v
LIST OF TABLES
Table 1 SolubilizaƟon Buffers condiƟons ..................................................................................................................... 25
Table 2 PulsaƟle diluƟons condiƟons with a syringe pump ......................................................................................... 26
Table 3 Dialysis condiƟons in pulsaƟle diluƟons with a syringe pump ........................................................................ 27
Table 4 Stepwise dialysis protocol for solubilized IB sample ....................................................................................... 28
Table 5 One-step dialysis protocol for solubilized IB sample ....................................................................................... 28
Table 6 Culture, wash and solubilizaƟon protocols for Protein solubility test during stepwise and one-step
dialysis ................................................................................................................................................................. 29
Table 7 PurificaƟon condiƟons using 1% triton and 1% triton+2M urea. .................................................................... 30
Table 8 PurificaƟon condiƟons using CHAPS from Sigma-Aldrich (1% and 0.5%) ........................................................ 31
Table 9 purificaƟon process using Sarkosyl from Thermo Fisher ScienƟfic (1% and 0.5%) ......................................... 32
Table 10 solubilizaƟon and refolding protocols for different detergents wash condiƟons. ......................................... 33

vi
LIST OF FIGURES
Figure 1 IL17R-V96 DNA plasmid map. ........................................................................................................................ 36
Figure 2 AnƟ-IL17A western blot showing cold spin supernatant and pellet comparison aŌer cell lysis. ................... 39
Figure 3 AnƟ-IL17RA western blot showing that non-denaturant methods were used to extract naƟve-like
proteins from E. coli under low-temperature culture. ....................................................................................... 40
Figure 4 anƟ-IL17RA western blot showing manual pulsaƟle diluƟon. ....................................................................... 42
Figure 5 AnƟ-IL17RA western blot showing that more concentrated chaotrope 8M Urea at pH=8 was able
to efficiently solubilize the intact protein. ......................................................................................................... 44
Figure 6 AnƟ-IL17RA western blot showing comparisons of supernatant and pellet in different raƟo
condiƟons aŌer diluƟon and dialysis. ................................................................................................................. 46
Figure 7 AnƟ-IL17RA western blot showing comparisons among the supernatant of pre-diluƟon soluƟon
and refolded supernatants aŌer diluƟons and dialysis. ...................................................................................... 47
Figure 8 AnƟ-IL17RA western blot showing solubilized IBs were dialyzed by one-step or stepwise methods. ........... 48
Figure 9 AnƟ-IL17RA western blot showing supernatant and pellets comparisons in each stage during
one-step dialysis.................................................................................................................................................. 50
Figure 10 AnƟ-IL17RA western blot showing supernatant and pellets comparisons in each stage during
stepwise dialysis. ................................................................................................................................................ 51
Figure 11 SDS-PAGE showing the supernatants and pellets during each triton wash and aŌer solubilizaƟon. .......... 53
Figure 12 SDS-PAGE showing the comparisons between supernatants and pellets aŌer the 1st wash
with different detergents. ................................................................................................................................... 55
Figure 13 AnƟ-IL17RA western blot showing comparisons between the supernatants and pellets aŌer
dialysis in different detergents wash condiƟons. ............................................................................................... 56
Figure 14 AnƟ-IL17RA western blot showing that one round of ELP-mediated phase separaƟon was
performed on the supernatants aŌer dialysis in different detergents wash condiƟons. .................................... 57
Figure 15 SDS-PAGE showing that one round of ELP-mediated phase separaƟon was performed on
the supernatants aŌer dialysis in different detergents wash condiƟons. ........................................................... 58
Figure 16 ODs of 0.05Mm V96 with 0.01%, 0.003%, 0.001% and no triton at different temperatures. ..................... 60
Figure 17 ODs of 0.05Mm V96 with 0.3%, 0.1%, 0.03% and no triton at different temperatures. ............................. 61

vii
AbbreviaƟons
BME, β-mercaptoethanol; DTT, dithiothreitol, PMSF, phenylmethylsulfonyl fluoride; CHAPS, 3-
((3-cholamidopropyl) dimethylammonio)-1-propanesulfonate; ELP, elasƟn-like polypepƟde; IB,
inclusion body. PBS, Phosphate-buffered saline; IPTG, Isopropyl ß-D-1-thiogalactopyranoside;
GdnHCl, guanidine hydrochloride; ECM, extracellular matrix.

viii
Abstract
The IL17 receptor (IL17RA) was fused with elasƟn-like polypepƟdes (ELP) to produce the
recombinant protein IL17R-V96 in E. Coli. However, inclusion bodies (IBs) were observed during
the producƟon and yields in the soluble fracƟon were very low. General IB purificaƟon includes
four major stages: culture, wash, solubilizaƟon, and refolding. Several strategies of IB
purificaƟon that focus on different stages were evaluated. For example, a mild, nondenaturaƟon method aƩempted to resolubilize the naƟve protein without reducing reagents or
significant chaotropic salts. It was clear this method also produced limited naƟve protein;
therefore, more aggressive denaturants were used to focus on solubilizaƟon before refolding.
Different washing detergents, solubilizaƟon buffers, and refolding buffers were then tested
using SDS-PAGE and western bloƫng. Efficient solubilizaƟon required longer incubaƟon with 8M
urea at pH 8. PulsaƟle diluƟon prevented protein reaggregaƟon during refolding and resulted in
a pure band in the soluble fracƟon aŌer refolding. One-step dialysis also prevented precipitaƟon
of the fusion protein. Moreso than CHAPS and sarkosyl, Triton-X 100 was the best washing
detergent among three tested and did not interfere with the ELP transiƟon temperature.
Despite this, ELP-mediated phase separaƟon was unable to achieve a high final yield and purity.
Future studies should aƩempt alternaƟve methods to enrich the IL17R-ELP in soluƟon at higher
yield.

1
Chapter 1: Introduction
In the realm of medicine, nanotechnology is an innovaƟon that only thrived in recent years,
though its potenƟal has always seemed a step ahead of its real-world applicaƟons. It plays an
indispensable role in reimagining drug delivery systems. This concept[1] is built upon the
principle of enhancing drug efficacy by modulaƟng their physical characterisƟcs, fine-tuning
their delivery mechanisms, and minimizing adverse effects[2]. This opƟmizaƟon between safety
and efficacy becomes more paramount when we consider potent medicaƟons, such as cancer
treatments, which can become detrimental in high doses. Nanomedicine offers an alternaƟve in
this regard by promising enhanced drug effecƟveness without escalaƟng dosages.
The essence of nanomedicine lies in its inherent adaptability. It facilitates the craŌing of
designed materials to shuƩle drugs directly to affected areas, ensuring a controlled release. By
tweaking the design of nanoparƟcles, we can potenƟally extend the residence Ɵme of drugs
within the body, giving them an edge over convenƟonal drug delivery methods. In the baƩle
against cancer, nanotechnology has already proven its effect with several USFDA-approved
treatments, such as liposomal doxorubicin [3, 4]. These treatments are precisely engineered to
leverage specific tumor aƩributes. AddiƟonally, they present a promising countermeasure to
the resistance issues that undermined many cancer drugs[5].

2
The applicaƟons of nanoparƟcles are not without challenges. IniƟal iteraƟons were prone to
rapid eliminaƟon from the bloodstream, which undercut their effecƟveness. This hurdle was
later overcome by forƟfying these parƟcles with specialized polymer coaƟngs[6], a
breakthrough that paved the way for their clinical endorsement approximately twenty years
ago. The external characterisƟcs of these delivery vehicles demand meƟculous adjustments to
avoid quick removal and ensure efficacy[7]. Hence, the strides made in nanomedicine are
intrinsically linked to advancements in craŌing biocompaƟble polymers.
Large-chain polymers have emerged as a soluƟon to solubilize specific drugs[8, 9]. By linking
these drugs to hydrophilic chains, their stay within the body can be substanƟally prolonged[10].
The domain of drug carriers has witnessed exploraƟon spanning from organic polymers to
syntheƟc ones. The diversity in polymer lengths requires stringent oversight given its profound
implicaƟons for drug acƟon. PotenƟal immunogenic reacƟons, degradaƟon rates, encapsulaƟon
efficiency, drug release mechanisms, and stability are some of the mulƟfaceted concerns
associated with these materials[11].
While tradiƟonal polymers such as PEG and PCL have gained tracƟon due to their
biocompaƟbility, their shortcomings in terms of polydispersity and target-binding capabiliƟes
have prompted the search for alternaƟves[10, 12]. These efforts combined diverse polymer
types into novel structures like micelles and polymerases, which depend on their hydrophilic
and hydrophobic aƩributes[2].

3
InteresƟngly, when compared with convenƟonal polymers, those derived from recombinant
proteins seem to emerge as contenders. These protein polymers, conceived in the mid-1980s,
owe their origins to either naturally occurring paƩerns or those engineered in labs[13, 14].
Created through geneƟc engineering, they promise precision and uniformity in design. Given
their lineage tracing back to natural proteins, they have the capability to be non-immunogenic,
degrading into biocompaƟble by-products[15].
GeneƟc engineering provides unparalleled control over biopolymer aƩributes such as
morphology, affinity sites, and areas for drug aƩachment. This capacity has inspired the
meƟculous creaƟon of extensive libraries, each differing in individual protein components.
Merging other proteins with these chains oŌen results in hybrid proteins that uphold the
funcƟonaliƟes of the original ones[16]. Furthermore, the feasibility of mass-producing these
protein polymers without incurring high costs has the potenƟal to enable their applicaƟons in
medicine[17].

4
1.1 ELP
ElasƟn in ECM:
ElasƟn is a polymeric ECM protein found in various Ɵssues such as skin, lungs, blood vessels, and
carƟlage[18-20]. Its funcƟon is to give Ɵssues the ability to stretch and recoil. Though elasƟn
originates from a single gene encoding the precursor tropoelasƟn, it has diverse structures. The
protein has repeƟƟve hydrophobic moƟfs, primarily valine and alanine, indicaƟng elasƟc
domains. Other amino acids, namely glycine and proline, prevent specific structural formaƟons
like alpha-helixes and beta-sheets. Specific pepƟdes in elasƟn are involved in crosslinking with
other tropoelasƟn molecules, aided by lysyl oxidase acƟng on lysine residues. This process
ulƟmately forms insoluble elasƟn fibrils[21]. Pioneering studies idenƟfied that hydrolyzed αelasƟn has a temperature-dependent solubility. At temperatures below 25°C, it remains soluble.
However, at 37°C, it forms a separate phase, known as a coacervate[22, 23]. This phase
transiƟon is reversible.
ElasƟn-Like PolypepƟdes (ELPs):
ELPs are syntheƟc, biomimeƟc protein polymers inspired by elasƟn's repeaƟng hydrophobic
paƩerns[23]. ELPs have a wide range of applicaƟons, such as drug delivery and Ɵssue
engineering, making them an important focus in scienƟfic research[24-26]. The typical ELP unit
consists of a five-amino-acid sequence(Val-Pro-Gly-Xaa-Gly)n. VariaƟons are possible in the
sequence, and some, like tyrosine and lysine, are added for specific purposes like
spectrophotometric analysis[27] and crosslinking[28, 29]. Like elasƟn, ELPs have a criƟcal

5
transiƟon temperature (Tt) where they undergo phase changes. Thermodynamically, this is
expressed in terms of Gibbs free energy. An essenƟal property of ELPs is their ability to
reversibly form coacervates in response to temperature fluctuaƟons[30]. Dr. Urry's studies on
the protein sequence (GVGVP)n illuminated the profound ways in which protein sequences and
their interacƟons with water can dictate their physical state. At cooler temperatures, this
protein sequence remains dispersed as soluble form in water[31]. However, as the temperature
approaches that of the human body, the sequence undergoes a transformaƟon, driven by
hydrophobic or water-avoiding interacƟons. The once-soluble sequence aggregates into a more
ordered state that retains a proporƟon of water. Intriguingly, this structured phase can be
further disrupted into a disordered state at temperatures that are even higher[32].
One of the most crucial insights is the relaƟonship between the hydrophobicity, or waterrepellence, of an ELP and the temperature at which it undergoes its transformaƟon. It is
proposed that any alteraƟon, whether it's in the polymer's structure, surroundings, or even
chemical modificaƟons, can be discerned through its impact on this transiƟon temperature[33].
EssenƟally, the transiƟon temperature serves as a fingerprint of the polymer's intrinsic
properƟes and interacƟons. Polymers with a higher propensity to repel water or with a bulkier
structure require less energy, or heat, to induce the water molecules around them to disperse.
This dispersal acts as a precursor to the formaƟon of the structured phase. In pracƟcal terms,
this means that ELPs that are more hydrophobic or have a higher molecular weight tend to
undergo their phase transiƟon at lower temperatures. In contrast, those that are less
hydrophobic or smaller in size do so at higher temperatures[34].

6
This reversible phase transiƟon, which behaves almost like a biological thermostat, is what
makes ELPs incredibly versaƟle and aƩracƟve in the realm of biomedicine[33]. It can be pictured
as a molecular switch that responds to temperature changes. The implicaƟons for medical
applicaƟons are vast. For instance, an ELP-based soluƟon that remains in a liquid state at room
temperature allows for easy injecƟons. Once this soluƟon enters the body, and the temperature
rises to around 37°C, it could transform into a semi-solid depot, potenƟally acƟng as a drug
reservoir or a scaffold for Ɵssue regeneraƟon[35]. What makes this system even more
impressive is the precision with which this phase transiƟon can be engineered. By fine-tuning
factors like the hydrophobicity of the ELP, its molecular weight, and concentraƟon, one can
predictably control the temperature at which the ELP undergoes its transformaƟon[36].
1.2 Molecular cloning
ConcatemerizaƟon is one of the first techniques uƟlized for the creaƟon of recombinant
libraries of ELPs[37]. This innovaƟve approach hinges on the natural propensity of repeƟƟve
geneƟc sequences to self-assemble, resulƟng in the combinaƟon of these sequences to produce
oligomers of different lengths through a singular synthesis step. While it is efficient, this method
comes with a significant drawback. One cannot exercise absolute control over the specific
length of the resultant oligomer. Thus, genes constructed via concatemerizaƟon present a
spectrum of DNA oligomers, each possessing varying chain lengths, which makes them

7
somewhat unpredictable. It's noteworthy that while each bacterial colony that's formed is
derived from a unique ELP gene length, targeƟng, and achieving a gene of a predetermined,
specific molecular weight using this method is a cumbersome task. Another limitaƟon to be
noted is the heightened challenge of using concatemerizaƟon to form genes encoding very large
ELPs, especially those exceeding 100 kDa.
Seeking improvements over concatemerizaƟon, a method termed recursive direcƟonal ligaƟon
by plasmid reconstrucƟon (PRe-RDL) was developed[17]. This advanced technique has its
foundaƟon in the use of a specialized group of enzymes known as Type II restricƟon enzymes.
These enzymes have the unique ability to make cuts to the DNA strand a liƩle distance away
from their recogniƟon site, parƟcularly in the 3’ direcƟon. By carefully posiƟoning these
recogniƟon sites adjacent to the iniƟaƟon and terminaƟon sequences of the gene, these
enzymes can create complementary overhanging sequences, commonly referred to as "sƟcky
ends", located within the ELP gene itself. By following a structured procedure involving double
digesƟon using the unique Type II enzyme and another strategically located enzyme, it's
possible to separate two disƟnct segments of the plasmid, both containing the full ELP gene.
These separated segments, once purified, can be seamlessly ligated or joined together. A key
point of this process is twofold. Firstly, it reconstructs the whole plasmid, maintaining the
necessary funcƟonal sites like the origin of replicaƟon and anƟbioƟc resistance. Secondly, the
resultant gene is an in-frame combinaƟon of both the original plasmids, which can serve to
either double an ELP gene's length or to combine varying genes, essenƟally forming block
copolymers. This process, due to its iteraƟve nature, can be systemaƟcally repeated to produce

8
increasingly larger plasmids and, in turn, provide a pathway to the expression of comprehensive
ELP libraries with pinpointed molecular weights. Another notable advantage is the absence of
extraneous amino acids in the final protein product, thanks to the specific acƟon of the Type II
restricƟon enzymes[38]. This specificity makes PRe-RDL versaƟle, allowing it to be adapted
beyond just ELP gene construcƟon and making it suitable for creaƟng any protein polymer
derived from repeaƟng DNA sequences. Apart from PRe-RDL, there's a suite of other innovaƟve
techniques for ELP synthesis that researchers have tapped into, including the widely recognized
polymerase chain reacƟon (PCR)[39], the meƟculous seamless cloning technique[40], and the
advanced overlap extension rolling circle amplificaƟon (OERCA)[41, 42].
1.3 Inclusion bodies
In Escherichia coli, the producƟon of recombinant proteins oŌen confronts an obstacle: proteins
tend to aggregate into formaƟons referred to as inclusion bodies (IBs) [43-45]. This aggregaƟon
can be intensified by several factors: increased temperatures during protein expression,
amplified inducer amounts, and the implementaƟon of robust promoter systems. These
elements, which accelerate protein synthesis, someƟmes surpass the bacterial mechanism's
ability to maintain protein integrity, causing a buildup of parƟally or misfolded proteins that
amass into IBs[46]. To Compound this problem, the oxidaƟve environment of the bacterial

9
cytosol, the absence of specific eukaryoƟc chaperones and refined post-translaƟonal apparatus
also play roles in this aggregaƟon process[47].
UƟlizing E. coli for the extracƟon and purificaƟon of recombinant proteins becomes more
complex due to the formaƟon of IBs [48-50]. To derive the protein from these clumps, a laborintensive procedure is required: isolaƟng them from cells, solubilizing, iniƟaƟng protein
refolding, and subsequent purificaƟon. The solubilizing and refolding phases are oŌen
experimental, resulƟng in less-than-ideal recovery of the intended acƟve protein. However,
there's a silver lining: due to the aggregaƟon specificity in E. coli, these clumps are
predominantly composed of the target recombinant protein. Should an efficient methodology
be devised for the seamless extracƟon of correctly folded protein molecules from these
conglomerates, it might eliminate the need for extended purificaƟon stages, like
chromatography. Remarkably, some IBs include proteins that maintain structures akin to their
naƟve forms, displaying even biological acƟvity. However, the uƟlizaƟon of potent chaotropic
agents, such as urea and guanidine hydrochloride (GdnHCl) can be used to dismantle these
structures. The challenge is that aŌer solubilizaƟon, protein refolding commonly leads to the
precipitaƟon of protein aggregates, which are lost to producƟon[51].
IB purificaƟon was used to solve the low-yield challenges that many proteins faced.
Cephalopods can change the color of their skin due to the dynamic self-assembly of structural
proteins called reflecƟns. To harness the potenƟal of these proteins for engineering bio-based
materials, they need to be produced biotechnologically. One of the main challenges lies in

10
opƟmizing the purificaƟon process for reflecƟns. The study examined purificaƟon methods for
two different reflecƟn sequences that were produced in a bacterial host on a lab scale[52].
When evaluaƟng these methods in terms of purity, yield, producƟvity, cost, and sustainability,
the non-chromatographic method, which involves washing IBs, yielded the best results with a
protein purity of over 90% and purificaƟon yields up to 88%.
A therapeuƟc tetrameric protein, L-asparaginase-II from Escherichia coli, was generated as IBs.
These IBs underwent solubilizaƟon with low-concentraƟon urea and were then reacƟvated into
their tetrameric state using the pulsaƟle diluƟon technique. A dual-step purificaƟon process
involving ion-exchange and gel-based methods was employed. From the IBs, about 50% of the
acƟve asparaginase was retrieved. The determined melƟng point for the purified enzyme was
64°C. It had a funcƟonal potency of 190 IU/mg. Moreover, this enzyme exhibited robust acƟvity
in a four-molar urea environment where all IB clumps dissolved.[53].
The process of purifying aminoacylase IBs was examined with four osmolytes:
dimethylsulphoxide, glycerol, proline, and sucrose. Each agent showed concentraƟon-related
success in both reducing aggregaƟon and reviving enzyme funcƟonality. Notably, using 40%
glycerol or 1.5 mol/L sucrose nearly stopped the aggregaƟon enƟrely[54]. All four osmolytes
successfully reduced hydrophobic surface exposure. This finding indicates that the addiƟon of
osmolytes facilitate protein hydrophobic collapse. Osmolytes can exert protecƟve effects on
protein acƟvity and structure. Even though these effects are equal for different kinds of

11
osmolytes, osmolytes’ abiliƟes to facilitate the refolding of different proteins vary case by case.
However, in all cases, glycerol was found to be the best stabilizer and folding aid.

12
1.4 PurificaƟon
IBs present a unique challenge as they contain protein molecules in a clustered form, making it
a difficult endeavor to dissolve these structures and then revert the solubilized proteins back to
their biologically acƟve state[55]. TradiƟonal methodologies to extract proteins from IBs consist
of four pivotal stages: first, separaƟng and purifying IBs; second, dissolving these compacted
structures; third, refolding the solubilized proteins to their original shape; and finally, purifying
the refolded proteins uƟlizing diverse chromatographic methods[56]. The most criƟcal junctures
in the process of retrieving funcƟonal proteins from IBs are the dissoluƟon of the aggregated
formaƟons and the subsequent refolding of the protein molecules to their naƟve structure.
Culture and isolaƟon
IBs are disƟncƟve aggregates that predominantly contain the desired recombinant protein.
Therefore, it's essenƟal to separate and refine these aggregates to achieve a homogeneous
state before proceeding with dissoluƟon and reformaƟon. ExtracƟng proteins from such bodies
diminishes the need for molecular tags and mulƟple purificaƟon stages. As highlighted earlier,
the condiƟons under which proteins are expressed influence the quality of IBs. Employing lower
expression temperatures aids in the creaƟon of malleable, non-tradiƟonal IBs, which can be
dissolved using non-destrucƟve solvents[57, 58]. Moreover, maintaining a certain pH, for
example, 8, during expression has been found to modify the quality of the IBs [59].
Several techniques are employed to separate IBs from bacterial cells, ranging from mechanical
disrupƟon methods like sonicaƟon or using a French press to chemical procedures that uƟlize

13
agents such as lysozyme for cell lysis. InteresƟngly, the method chosen for cell breakdown
significantly impacts the IBs' quality[60]. Chemical disrupƟon techniques are typically preferred
over mechanical methods like sonicaƟon or homogenizaƟon, as the laƩer can compromise the
IBs' integrity, leading to unwanted protein aggregaƟons, some of which were iniƟally
soluble[60]. Using a strategic blend of both mechanical and chemical disrupƟon processes has
shown promise as well[61]. Due to their denser nature compared to other cell components, IBs
can be conveniently separated from the total cell mixture through centrifugaƟon[61]. Another
technique, crossflow membrane microfiltraƟon, has been deployed to segregate IBs from host
cell proteins[62].
Despite the separaƟon, the isolated IBs sƟll contain contaminants such as naƟve proteins, RNA,
and cellular membrane fragments[63]. To purify further, mulƟple washing cycles are employed.
UƟlizing low-concentraƟon detergents like deoxycholic acid and Triton X-100[55] assists in both
achieving purer IBs and in eliminaƟng membrane residues. It's worth noƟng that non-tradiƟonal
IBs are excepƟonally pH-sensiƟve during purificaƟon, as elevated pH levels might inadvertently
dissolve protein molecules[64]. Techniques like sucrose density gradient ultracentrifugaƟon
have also been employed for purificaƟon[61]. Ensuring the purity of IBs is crucial, as it
minimizes potenƟal obstacles during the refolding phase and reduces the need for
comprehensive purificaƟon stages.

14
1.5 SolubilizaƟon
In the past, IBs were typically dissolved using high levels of denaturing agents and chaotropic
agents such as urea and GdnHCl [[49, 65]]. When dealing with proteins that possess mulƟple
cysteine residues, agents like β-mercaptoethanol or dithiothreitol are incorporated to break
down incorrect disulfide links. ResorƟng to high chaotropic agent concentraƟons for IBs
solubilizaƟon leads to total breakdown of the protein's structure. Frequently, this causes
proteins to reaggregate during the refolding phase[66]. Given that some IB aggregates maintain
structures akin to their naƟve counterparts and can exhibit acƟvity, opƟng for a mild dissoluƟon
method that doesn't enƟrely disrupt these configuraƟons can be beneficial[67].
As previously indicated, IBs are not staƟc but are constantly changing. There's an ongoing
balance between properly folded and clumped protein molecules. This characterisƟc can be
uƟlized to dissolve IBs in non-destrucƟve buffers, saving the need for solubilizaƟon agents. For
instance, the IBs of N-acetyl-d-glucosamine 2-epimerase have been successfully dissolved using
a Tris–HCl buffer with a pH level of 7, resulƟng in acƟve proteins[68]. By employing mild
solubilizaƟon condiƟons, biologically acƟve proteins can be extracted from non-tradiƟonal IBs.
This approach conserves the naƟve-like configuraƟons found in the IBs, circumvenƟng the need
for a refolding stage. Mild solvents such as 5% n-propanol and DMSO, as well as 0.2% N-lauroyl
sarcosine detergent, have been employed for dissolving non-tradiƟonal IBs [57]. Even low urea
concentraƟons have someƟmes been used for dissolving these aggregates [57, 69]. Notably,
these solubilizaƟon agents allow for the extracƟon of acƟve recombinant proteins without

15
necessitaƟng a refolding stage. However, the primary limitaƟon of these methods is that they're
not effecƟve for tradiƟonal IBs.
In the quest for beƩer dissoluƟon of IBs, several mild methods have been used. These ensure
that the protein remains parƟally folded during the solubilizaƟon process. When these methods
are employed, the refolding of dissolved protein molecules begins in a semi-folded state, which
prevents them from reaggregaƟng during the refolding process. Mild methods, including those
uƟlizing alkaline pH[67], elevated pressure[69], detergents[70, 71], organic solvents[66], and
low chaotrope concentraƟons[53, 57], have been employed to reclaim bioacƟve proteins from
IBs. In many scenarios, enhancements in the IB extracƟon process, combined with cuƫng-edge
refolding techniques and milder solubilizaƟon, have boosted the overall retrieval rate of
biologically acƟve proteins.
Buffers with very high pH have shown promise as mild solubilizaƟon agents. Pairing high pH
buffers (>12) with 2 M urea has yielded effecƟve dissoluƟon of IBs, preserving some naƟve
structural elements during solubilizaƟon[51, 67]. Enhancing the recovery of bioacƟve proteins,
mild urea soluƟons[53] and detergents like N-Lauroylsarcosine and Lauroyl-L-glutamate have
been recognized as beneficial[70, 71].

16
InteresƟngly, combining reducing reagents such as βME[55] and n-propanol with minimal urea
concentraƟons has emerged as a novel approach for beƩer protein recovery[66]. For example,
the dissoluƟon of human growth hormone IBs benefits from n-propanol buffers over tradiƟonal
urea or GdnHCl ones, securing inherent secondary structures[72]. Given that alcohols can
interact with and someƟmes stabilize proteins, their integraƟon offers a viable shiŌ from
established urea/GdnHCl techniques. Notably, the combinaƟon of n-propanol and 2 M urea has
dissolved mulƟple proteins, highlighƟng the potenƟal of organic solvents in protein recovery
from bacterial IBs [66].
A one-size-fits-all IB solubilizaƟon strategy remains elusive. It necessitates tailored screening for
each protein. Streamlining this process, Hahn and his team introduced a quick turbidity-centric
assay for effecƟve agent screening[73]. Grasping the primary factors driving protein aggregaƟon
and mildly dissolving IB clusters is pivotal for the opƟmized protein refolding process, especially
with E. coli IBs.

17
1.6 Refolding
IB proteins, once solubilized, are returned to their funcƟonal states by eliminaƟng the
solubilizaƟon agents. Standard pracƟces like infusing solubilized proteins into refolding buffers
or subjecƟng them to dialysis alongside these buffers dominate in restoring acƟve proteins[65,
74]. Challenges such as demand for large volumes of buffer, especially for producƟon-scale
bioprocessing, and low-level refolding outputs due to protein clumping persist. To circumvent
these, maintaining low protein concentraƟons and limiƟng protein-to-protein interacƟons
during the refolding are crucial. InnovaƟons like pulsaƟle diluƟon have emerged, reducing buffer
use, and enhancing protein refolding outcomes.[55]
For superior refolded protein quality and scalability suited for industrial contexts,
chromatographic column-based refolding has been developed. Various chromatographic
techniques, including size exclusion[75], ion exchange[76], and affinity chromatography[77, 78],
dominate this domain. However, hydrophobic interacƟon chromatography may also be suitable.
This "on-column refolding" has mulƟple merits: it offers a spaƟal distancing of refolding enƟƟes,
facilitates high-concentraƟon refolding, integrates denaturant eliminaƟon with protein
purificaƟon, and automates the process[79, 80]. Unique techniques involve immobilizing
chaperonins on the chromatographic substrates to simulate natural folding processes. Though
such strategies can ensure refolding outcomes, their cost-intensive nature hinders widespread
industrial adaptaƟon. Ongoing research in this area primarily targets enhancing refolding rates
and fine-tuning condiƟons to boost protein quality[81].

18
Modern refolding strategies use microfluidic chips, where denaturant levels are modulated
using controlled diffusion via laminar flow in micro-channels[82]. Such strategies have shown
promise with tradiƟonally challenging proteins like citrate synthase. Another emerging
technique employs the urease enzyme to methodically eliminate urea from solubilized protein
mixtures, focusing on urease-catalyzed reacƟons[83]. One standout advantage of this system is
that it achieves efficient protein refolding in extremely small volumes, avoiding the need for
refolding buffers and thereby potenƟally reducing producƟon costs.
The refolding process is complex and mulƟfaceted, parƟcularly given the diversity of proteins
and the specific condiƟons they each require folding correctly. Here are some key points. The
primary challenge during refolding is the prevenƟon of protein aggregaƟon. AddiƟves are crucial
for miƟgaƟng aggregaƟon and enhancing refolding. Examples include chaotropic agents (e.g.,
urea, GdnHCl) which help in solubilizing and denaturing proteins. Amino acids (e.g., glycine,
arginine, proline)[84-87] can stabilize proteins and prevent aggregaƟon. Polyhydric alcohols and
sugars (e.g., polyethylene glycol, glycerol, sorbitol, sucrose)[54, 88-90] act as osmolytes, helping
in stabilizing proteins. Non-detergent zwiƩerions: These unique compounds, like sulfo-betaines
and subsƟtuted pyridines, can act as stabilizing agents during refolding[91-93].
Chaperones act as molecular helpers that assist proteins in folding by capturing and releasing
intermediates, prevenƟng unwanted interacƟons that could lead to misfolding[94]. Folding
Catalysts include enzymes like pepƟdylprolyl cis-trans isomerase and protein-disulfide
isomerase that hasten certain slower steps in the folding process, ensuring beƩer folding and

19
higher yields. By interacƟng with protein folding intermediates, detergent molecules can
encapsulate and protect these intermediates, forming mixed micelles. Cyclodextrins can then be
used to strip away these detergents and iniƟate proper folding[95]. By binding proteins and
then precipitaƟng under specific condiƟons, innovaƟve smart polymers allow for a controlled
refolding environment. By simply reversing the condiƟons, proteins can be released from these
polymers, aiding in the refolding process[96, 97]. Given the diversity of proteins, there isn't a
one-size-fits-all soluƟon for refolding. The composiƟon of the refolding buffer must be
individually tailored and screened for each protein to ensure opƟmal results[98, 99].
In conclusion, achieving successful refolding of denatured proteins requires a mulƟ-pronged
approach. By understanding the nature of the protein and leveraging a combinaƟon of natural
and syntheƟc aids, researchers can increase their chances of obtaining funcƟonal, correctly
folded proteins.

20
Chapter 2: Materials and Methods
2.1 IL17R-V96 ligaƟon
An IL17RA-containing plasmid was purchased and expanded in TOP10 E. coli. Similarly, an ELPencoding plasmid for V96 was purified from TOP10 E. coli separately in LB medium overnight at
37 °C. Plasmid minipreps were used to extract DNA. DNA was mixed with ultrapure water to
make 16μl sample that contained around 0.5μg DNA. 1μl BserI, 1ul BSSH2 restricƟon enzymes,
and 2ul cut smart buffer were added to the 16μl IL17RA plasmid and 16μl V96 plasmid
separately. Ran on agarose gel to separate DNA fragments. DNA bands containing IL17RA and
V96 were cut from gel and dissolved with agarose dissolving buffer. IL17RA and V96 DNA
fragments were mixed to make 16μl DNA fragment samples. 2μl T4 ligase buffer first, and, then
1μl T4 ligase were added to the sample and incubated at room temperature for 30 min. 250μl
TOP10 E. coli from -80 °C freezer was thawed on ice for 10 min. Then, a 19μl plasmid sample
was added to the TOP10 E. coli and incubated for another 15 minutes on ice. The sample was
heat-shocked at 42 °C for 30 seconds to transform the IL17R-V96 plasmid into TOP10 E. coli. E.
coli was plated on a LB agar plate containing carbenicillin and incubated at 37 °C for 24 to 36
hours. We picked the selected colonies and cultured them in LB medium at 37 °C overnight.
Plasmids were miniprepped and run on an agarose gel with NdeI and BamHI restricƟon enzymes
to check molecular structure and weight. IL17R-V96 plasmid was sent for DNA sequencing.
25μl BLR E. coli from a -80 °C freezer was thawed on ice for 10 min. 2μl IL17R-V96 plasmid was
mixed with BLR and incubated on ice for 15 min. sample was heat-shocked at 42°C for 30
seconds to transform IL17R-V96 into BLR. Then sample was plated on a TB medium plate with

21
carbenicillin and incubated at 37 °C for 24 to 36 hours. The selected colonies were picked and
cultured in TB medium at 37 °C overnight. The sample was stored in an -80 a °C freezer.
2.2 Non-denaturant
Frozen IL17R-V96 in BLR cells were taken from a -80°C freezer. Cells were cultured in 50ml of TB
medium with 50μl 10% carbenicillin soluƟon overnight at 37°C on a New Brunswick Series 25
incubator shaker. Then, 40ml cells were transferred to a 2L TB medium with a 2ml 10%
carbenicillin soluƟon overnight at 27°C on an incubator shaker. SoluƟons were transferred to
two 1L boƩles and centrifuged at 4000 RPM for 20 min. The supernatant was poured, and cell
pellets were resuspended with a 60 ml 4°C PBS soluƟon. Cells were sonicated with an amplitude
of 11, process Ɵme of 3 minutes, a pulse-on Ɵme of 10 seconds, and a pulse-off Ɵme of 20
seconds. Tubes were kept in an ice bucket while sonicaƟng.
A 2% PMSF protease inhibitor was added in all the following steps. Resuspensions were done
with pipets. Cold spin was performed (10K RPM, 2°C) for 15 minutes. Pellets were collected and
washed with 20 ml 1% triton in PBS. This step was repeated twice.
Cold spin was performed for 15 minutes. Pellets were collected and washed with 20ml of PBS.
This step was repeated twice. The sample was split in half for two condiƟons and cold spined.
CondiƟon 1: IBs were resuspended in 10ML 1M urea, 0.2% sarcosine, 50mM Tris-HCL, pH=8.

22
Solubilized IBs were dialyzed with SnakeSkin 10K Dialysis Tubing in 1L 50mM Tris-HCL, pH=8
buffer for 4 hours at 4°C. Then clean buffer was changed. The steps were repeated for 3 Ɵmes.
The sample was cold spined, and supernatant was collected. Then the tube was put in a 37°C
warm water bath.
CondiƟon 2: IBs were resuspended in 10ML 1M urea, 0.2% sarcosine, 5%DMSO, 50mM Tris-HCL,
pH=8.
Solubilized IBs were dialyzed with SnakeSkin 10K Dialysis Tubing in 1L 50mM Tris-HCL, pH=8
buffer for 4 hours at 4°C. Then clean buffer was changed. The steps were repeated for 3 Ɵmes.
The sample was cold spined, and supernatant was collected. Then the tube was put in a 37°C
warm water bath.
2.3 PulsaƟle diluƟon
Manual diluƟon: frozen IL17R-V96 in BLR cells were taken from a -80°C freezer. Cells were
cultured in 50ml of TB medium with 50μl 10% carbenicillin soluƟon overnight at 37°C on a New
Brunswick Series 25 incubator shaker. Then 20ml cells were transferred to 1L of TB medium with
1ml of 10% carbenicillin soluƟon overnight at 27°C on an incubator shaker. SoluƟons were

23
transferred to 1L boƩles and centrifuged at 4000 RPM for 20 min. The supernatant was poured,
and cell pellets were resuspended in a 30 ml 4°C PBS soluƟon. Cells were sonicated with an
amplitude of 11, process Ɵme of 3 minutes, a pulse-on Ɵme of 10 seconds, and a pulse-off Ɵme
of 20 seconds. The tubes were kept in an ice bucket while sonicaƟng.
A 2% PMSF protease inhibitor was added in all the following steps. Resuspensions were done
with pipets. Cold spin (10K RPM, 2°C) was performed for 15 min. Pellets were collected and
washed with 10 ml 1% triton in PBS. This step was repeated twice.
Cold spin was performed for 15 minutes. Pellets were collected and washed with 10ml PBS.
This step was repeated twice. Then IBs were cold spined.
IBs were resuspended in 10ml of 4M Urea, 1mM DTT, and 0.2% sarcosine. SoluƟons were kept
on ice, and manually transferred with a pipet to 90ml of 0.5M Urea, 50mM Tris-HCL, 0.1m
arginine, that were also kept on ice. The transfer speed was 100 μl/min.
The samples were dialyzed with tubing in 2L of 50mM Tris-HCL, 0.5M Urea, pH=8 for 4 hours.
Then, samples were transferred into 2L of 50mM Tris-HCL, pH=8 for 4 hours twice.
Then the sample was cold spined, and the supernatant was kept. The sample was put in a 37°C
warm water bath.
DiluƟon with a syringe pump and dialysis with different condiƟons: frozen IL17R-V96 in BLR cells
were taken from a -80°C freezer. Cells were cultured in 100ml TB medium with 100μl 10%
carbenicillin soluƟon overnight at 37°C on a New Brunswick Series 25 incubator shaker. Then,
80ml was transferred to 4L of TB medium with 4ml of 10% carbenicillin soluƟon overnight at

24
37°C on an incubator shaker. AŌer OD was higher than 0.6, 0.5mM IPTG was added. The
inducƟon was kept for 3 hours at 27°C. SoluƟons were transferred to 1L boƩles and centrifuged
at 4000 RPM for 20 min. The supernatant was poured, and cell pellets were resuspended with
120 ml OF 4°C PBS soluƟon. Cells were sonicated with an amplitude of 11, a process Ɵme of 3
min, a pulse-on Ɵme of 10 seconds, and a pulse-off Ɵme of 20 seconds. The tubes were kept in
an ice bucket while sonicaƟng.
2% PMSF protease inhibitor was added in all following steps. Resuspensions were done with
syringes. Cold spin was performed (10K RPM, 2°C) for 15 minutes. Pellets were collected and
washed with 10 ml of 1% triton in PBS. This step was repeated twice. Then hot spin was
performed (10K RPM, 37°C) for 15 minutes (cloudy soluƟon). Pellets were collected and washed
with 10 ml 1% triton in PBS.
Cold spin was performed for 15 minutes. Pellets were collected and washed with 10ml PBS. This
step was repeated twice. Then sample was resuspended with 10ml of PBS and separated into 4
tubes. Cold spined was performed again to collect IBs pellets.
Each sample was denatured separately in a 10ml of denaturing buffer.

25
CondiƟon Unique AddiƟves Treatment
C1 8M Urea, pH=8 Syringe and sƟr overnight at 4°C
C2 8M Urea, pH=8 Syringe, sƟr overnight at 4°C, sonicaƟon (6x10s)
C3 8M Urea, pH=4.5 Syringe and sƟr overnight at 4°C
C4 8M Urea, pH=4.5 Syringe, sƟr overnight at 4°C, sonicaƟon
C5 6M G-HCL, pH=8 Syringe and sƟr overnight at 4°C
C6 6M G-HCL, pH=8 Syringe, sƟr overnight at 4°C, sonicaƟon
C7 6M G-HCL, pH=4.5 Syringe and sƟr overnight at 4°C
C8 6M G-HCL, pH=4.5 Syringe, sƟr overnight at 4°C, sonicaƟon
Table 1 SolubilizaƟon Buffers condiƟons
Common AddiƟves: 500mM Arginine, 50mM Tris-HCL, 200mM Nacl, 2mM PMSF, 2mM DTT.
Denatured samples were cold spined for 30 min and collected supernatant(key)
The samples from 8M Urea, pH=8 condiƟon were used and separated into 1ml samples for
pulsaƟle diluƟon with a Harvard Apparatus Holliston syringe pump. A 1ml sample was pumped
by 100μl/min into refolding buffer that was placed on ice.

26
Condition
Solubilized
Protein
Volume
Addition
Rate
Refolding
Buffer
Volume
Dilution
Ratio Procedure
Refolding Buffer
Composition
C1 1ml 0.1ml/min 10ml 1:10
Added by
syringe pump,
stir, on ice
1M urea, 50mM Tris-HCL,
pH=7.75, 500mM arginine,
200mM NaCl, 10% Glycerol,
0.7M sucrose
C2 1ml 0.1ml/min 50ml 1:50
Added by
syringe pump,
stir, on ice
1M urea, 50mM Tris-HCL,
pH=7.75, 500mM arginine,
200mM NaCl, 10% Glycerol,
0.7M sucrose
C3 1ml 0.1ml/min 100ml 1:100
Added by
syringe pump,
stir, on ice
1M urea, 50mM Tris-HCL,
pH=7.75, 500mM arginine,
200mM NaCl, 10% Glycerol,
0.7M sucrose
Table 2 PulsaƟle diluƟons condiƟons with a syringe pump
All diluted samples were incubated at 4°C overnight, cold spined for 30 min. Supernatant was
transferred into dialysis tubing.

27
Sample(s) Buffer ComposiƟon Volume DuraƟon
DiluƟon
Sequence
C1, C2
0M Urea, 50mM Tris-HCl pH 8.0, 50mM Arginine,
200mM NaCl 1L 24 hours 1st
C3
0M Urea, 50mM Tris-HCl pH 8.0, 50mM Arginine,
200mM NaCl 2L 24 hours 1st
C1, C2 1x PBS 1.5L 24 hours 2nd
C3 1x PBS 3L 24 hours 2nd
C1, C2 1x PBS 1.5L 24 hours 3rd
C3 1x PBS 3L 24 hours 3rd
Table 3 Dialysis condiƟons in pulsaƟle diluƟons with a syringe pump
The refolded samples were cold spined for 30 min. The supernatant was kept for each
condiƟon. Pellets were resuspended for western blot.

28
2.4 Stepwise and One-step dialysis final yield comparison
2ml pH=8, 8M Urea solubilized samples were added in two dialysis tubing
Step Buffer ComposiƟon
DuraƟon &
CondiƟons
1
1L: 3M Urea, 50mM Tris-HCl, 200mM NaCl, 500mM Arginine, 2mM GSH,
0.2mM GSSG Overnight at 4°C
2
1L: 1M Urea, 50mM Tris-HCl, 200mM NaCl, 500mM Arginine, 2mM GSH,
0.2mM GSSG Overnight at 4°C
3 1L: 0.5M Urea, 50mM Tris-HCl, 200mM NaCl, 250mM Arginine Overnight at 4°C
4 1L: 0M Urea, 50mM Tris-HCl pH 8, 200mM NaCl, 50mM Arginine Overnight at 4°C
5 Changed to 1L 50mM Tris-HCl twice Overnight at 4°C
Table 4 Stepwise dialysis protocol for solubilized IB sample
Step Buffer ComposiƟon DuraƟon & CondiƟons
1 1L: 0M Urea, 50mM Tris-HCl pH 8, 200mM NaCl, 50mM Arginine Overnight at 4°C
2 Changed to 1L 50mM Tris-HCl twice Overnight at 4°C
Table 5 One-step dialysis protocol for solubilized IB sample

29
2.5 Protein solubility during stepwise and one-step dialysis
Steps Parameters Details
Culture
- Medium
– Temperature
– DuraƟon
- InducƟon
- 3L TB medium with carbenicillin
- 37°C
Overnight
- Overnight IPTG inducƟon at 27°C aŌer OD600 >1
Wash (PreLysis) - AddiƟves - None
Post-Lysis
- Cold
CentrifugaƟon
- Pellet
Resuspension
- Further
CentrifugaƟon
- Wash
- Final
CentrifugaƟon
- Result
- 15 minutes at 10,000 rpm, 2°C
- In 15ml PBS containing 1% triton
- 15 minutes at 10,000 rpm, 2°C
- With detergent (2 Ɵmes) followed by 15ml PBS (3 Ɵmes)
- 15 minutes at 10,000 rpm, 2°C
- 7 ml of pellets
SolubilizaƟon
- Solvent
PreparaƟon
- DissoluƟon
- Cold
CentrifugaƟon
- 70 ml buffer (pH=8, 8M urea, 500mM Arginine, 50mM TrisHCL, 200mM NaCl, 20mM DTT) + 7 ml pellet (10:1 raƟo)
- Syringe followed by sƟrring overnight at 4°C
- 30 minutes at 10,000 rpm, 2°C, collected supernatant, divided
into 2 samples for one-step and step-wise dialysis
Table 6 Culture, wash and solubilizaƟon protocols for Protein solubility test during stepwise and
one-step dialysis
Separated samples were treated with the stepwise dialysis protocol (Table 4) and with the onestep dialysis protocol (Table 5)

30
2.6 Different detergents wash comparisons
Step AcƟon/CondiƟon DescripƟon
Culture
- Medium: 2L TB with
carbenicillin - Temperature: 37°C
- DuraƟon: Overnight - 3hr 0.5mM IPTG inducƟon at 27°C
Before Lysis
AddiƟon of protease inhibitors
(protease inhibitor Cocktail
powder P8465)
Added 1 ml protease inhibitors cocktail for
every L of medium
Post Lysis Cold Spin 15 min, 10k rpm, 2°C
CondiƟon 1 (1%
Triton) Resuspend with detergent
Resuspended pellets with PBS containing 1%
Triton using a syringe. Followed with cold spin
(15 min, 10k rpm, 2°C).
Wash Steps
Washed with 1% Triton 3 Ɵmes, then washed
with PBS 3 Ɵmes. AŌer final wash, performed a
cold spin (15 min, 10k rpm, 2°C).
CondiƟon 2 (1%
Triton + 2M
Urea) Resuspended with detergent
Resuspended pellets with PBS containing 1%
Triton+2M Urea using a syringe. Followed with
a cold spin (15 min, 10k rpm, 2°C).
Wash Steps
Washed with 1% Triton+2M Urea 3 Ɵmes, then
washed with PBS 3 Ɵmes. AŌer final wash,
performed a cold spin (15 min, 10k rpm, 2°C).
Table 7 PurificaƟon condiƟons using 1% triton and 1% triton+2M urea.

31
Step AcƟon/CondiƟon DescripƟon
Culture
- Medium: 2L TB with carbenicillin
- Temperature: 37°C - DuraƟon
Overnight
- 0.5mM IPTG inducƟon overnight at 27°C
aŌer OD>1
Before Lysis No addiƟons -
Post Lysis Cold Spin 15 min, 10k rpm, 2°C
CondiƟon 1
(1% CHAPS) Resuspended with detergent
Resuspended pellets with PBS containing 1%
CHAPS using a syringe. Followed with cold spin
(15 min, 10k rpm, 2°C).
Wash Steps
Washed with 1% CHAPS 2 Ɵmes, then wash
with PBS 3 Ɵmes. AŌer final wash, performed
a cold spin (15 min, 10k rpm, 2°C).
CondiƟon 2
(0.5% CHAPS) Resuspended with detergent
Resuspended pellets with PBS containing 0.5%
CHAPS using a syringe. Followed with a cold
spin (15 min, 10k rpm, 2°C).
Wash Steps
Washed with 0.5% CHAPS 2 Ɵmes, then
washed with PBS 3 Ɵmes. AŌer final wash,
performed a cold spin (15 min, 10k rpm, 2°C).
Table 8 PurificaƟon condiƟons using CHAPS from Sigma-Aldrich (1% and 0.5%)

32
Step AcƟon/CondiƟon DescripƟon
Culture
- Medium: 2L TB with carbenicillin
- Temperature: 37°C - DuraƟon:
Overnight
- 0.5Mm IPTG inducƟon overnight at 27°C aŌer
OD>1
Before Lysis No addiƟons -
Post Lysis Cold Spin 15 min, 10k rpm, 2°C
CondiƟon 3
(1% Sarkosyl) Resuspended with detergent
Resuspended pellets with PBS containing 1%
Sarkosyl using a syringe. Followed with a cold
spin (15 min, 10k rpm, 2°C).
Wash Steps
Washed with 1% Sarkosyl 2 Ɵmes, then washed
with PBS 3 Ɵmes. AŌer final wash, performed a
cold spin (15 min, 10k rpm, 2°C).
CondiƟon 4
(0.5%
Sarkosyl) Resuspended with detergent
Resuspended pellets with PBS containing 0.5%
Sarkosyl using a syringe. Followed with a cold
spin (15 min, 10k rpm, 2°C).
Wash Steps
Washed with 0.5% Sarkosyl 2 Ɵmes, then
washed with PBS 3 Ɵmes. AŌer final wash,
performed a cold spin (15 min, 10k rpm, 2°C).
Table 9 purificaƟon process using Sarkosyl from Thermo Fisher ScienƟfic (1% and 0.5%)

33
Step AcƟon/CondiƟon DescripƟon
DuraƟon &
Temperature
SolubilizaƟon
1
SolubilizaƟon
Buffer
Added samples to 10ml buffer containing:
pH=8, 8M urea, 500mM Arginine, 50mM TrisHCL, 200mM NaCl, 20mM DTT. -
2 Mixing
Used a syringe to ensure proper mixing, then
let it sƟr to dissolve. Overnight at 4°C
3
Cold
CentrifugaƟon
Spined samples to separate any undissolved
parƟcles.
30 min, 10k rpm,
2°C
4 CollecƟon Collected the solubilized supernatant. -
Refolding
5 One-Step Dialysis
Dialyzed with 2L of a buffer containing: pH=8,
0M Urea, 50 mM Tris-Hcl, 200 mM NaCl,
50mM arginine. Overnight at 4°C
6 PBS Dialysis Dialyzed with 2L PBS.
Overnight at 4°C
(Repeat twice)
7
Cold
CentrifugaƟon Spined samples to separate solid parƟcles.
30 min, 10k rpm,
2°C
8 CollecƟon Collected the clear supernatant. -
Table 10 solubilizaƟon and refolding protocols for different detergents wash condiƟons.
For all condiƟons, the solubilizaƟon steps and refolding steps were the same.
PurificaƟon with ELP-mediated phase separaƟon:
AŌer the dialysis, the samples were subjected to cold centrifugaƟon for 30 minutes at 10,000
rpm and 2°C. The clear supernatant was collected aŌer this process. Then, the collected
supernatant was transferred to a 37°C warm water bath to gently elevate its temperature to at

34
least 37°C. For the samples treated with 1% Triton and 1% Triton + 2M Urea, 2M NaCl was
added. This salt addiƟon induced coacervaƟon in all samples, causing proteins to aggregate.
AŌer coacervaƟon was observed, the samples were centrifuged at 10,000 rpm and 2°C for 15
minutes. This gathered the coacervated proteins into pellets. Carefully the obtained protein
pellets were resuspended in 1 ml of Phosphate Buffered Saline (PBS). Lastly, The resuspended
samples were centrifuged one more Ɵme at 2°C to separate any remaining impuriƟes. The
resulƟng supernatant was collected, which should primarily contain the desired proteins.
2.7 Western blot
Samples of different IBs concentraƟons were normalized with adequate ultra-pure water to
make 15μl samples. 5μl SDS reagent (BME: 4X Laemmli Sample Buffer= 1:9) was added to each
sample to make a total of 20μl and mixed. Proteins were heated at 98°C for 5 minutes. SDSPAGE was conducted in 1x SDS buffer with the BIO-Rad mini-protein tetra system at 200Volts for
32 minutes. The sample was transferred from SDS-PAGE gel from Invitrogen to the western blot
membrane with the Invitrogen iBlot 2 gel Transfer Device. The device was run at 20V for 3
minutes. Unspecific protein binding was blocked with 5% milk in 1x TBST soluƟon for 1 hour at
room temperature and washed with 1x TBST soluƟon. Sample was incubated with a 7ml of
primary anƟbody milk TBST soluƟon (IL17RA polyclonal AnƟbody from Invitrogen: 5% milk
TBST=1:1000) overnight at 4°C. sample was washed with TBST soluƟon for 10 mins. The washing
steps were repeated for 3 Ɵmes. Sample was Incubated with secondary AnƟbody milk TBST
soluƟon (AnƟ-rabbit IgG: 5%milk TBST=1:1000) for 1 hour at room temperature. Sample was

35
washed with TBST soluƟon for 10 mins. The washing steps were repeated for 3 Ɵmes. 1 ml of
Thermo ScienƟfic Western Blot signal enhancer reagent 1 and 1 ml of reagent 2 were mixed and
added to the sample. Sample was later imaged with the iBright FL1000 Gel Imager.
2.8 Triton X-100 interference with coacervaƟon of V96
0.05Mm V96 was mixed with different concentraƟons of triton X-100. Visible light was used to
heat samples from 15°C to 65°C at a speed of 1°C/min. The change of OD280 was used to
observe if different concentraƟons of triton affected the coacervaƟon of V96.
2.9 Protein concentraƟons
2μl protein sample was mixed with 10μl 6M GdnHCl. Nanodrop 2000 was used to detect OD at
280 nm and at 350nm. The Bradford formula was used to calculate the protein concentraƟon.

36
Chapter 3: Results
3.1 IL17R-V96 ligaƟon
Figure 1 IL17R-V96 DNA plasmid map.
The IL17R-V96 DNA plasmid contains a T7 promoter and a T7 terminator to transcript IL17RV96 as RNA copies. The AmpR sequence and promoter is inserted to screen E. coli for anƟbioƟc
(carbenicillin) resistance. The LacI sequence and promoter and lac operator in front of the
IL17R-V96 sequence are inserted to control the producƟon of proteins. With IPTG inducƟon, the
target gene transcripƟon rate can increase. The HSV tag is also included but not used so far. The
molecular weight of IL17R-V96 is 73 kDa (BioinformaƟcs.org). V96 is 39 kDa and IL17RA is 34
kDa Thank you to Shin-Jae Lee for performing this study.

37
The IL17R-V96 plasmid (figure 1) encodes an open reading frame (capital leƩers represent the
soluble, extracellular domain of the IL17RA, and lower-case leƩers represent V96):
ATGAGCCCGCGCCTGCTGGATTTTCCGGCGCCGGTGTGCGCCCAGGAAGGCCTGAGCTGCCGCGTGAAA
AACAGCACCTGCCTGGATGATAGCTGGATTCATCCGAAAAACCTGACCCCGAGCAGCCCGAAAAACATTTA
TATTAACCTGAGCGTGAGCAGCACCCAGCATGGCGAACTGGTGCCGGTGCTGCATGTGGAATGGACCCTG
CAGACCGATGCGAGCATTCTGTATCTGGAAGGCGCGGAACTGAGCGTGCTGCAGCTGAACACCAACGAA
CGCCTGTGCGTGAAATTTCAGTTTCTGAGCATGCTGCAGCATCATCGCAAACGCTGGCGCTTTAGCTTTAG
CCATTTTGTGGTGGACCCGGGCCAGGAATATGAAGTGACCGTGCATCATCTGCCGAAACCGATTCCGGATG
GCGATCCGAACCATAAAAGCAAAATTATTTTTGTGCCGGATTGCGAAGATAGCAAAATGAAAATGACCACC
AGCTGCGTGAGCAGCGGCAGCCTGTGGGACCCGAACATTACCGTGGAAACCCTGGATACCCAGCATCTGC
GCGTGGATTTTACCCTGTGGAACGAAAGCACCCCGTATCAGGTGCTGCTGGAAAGCTTTAGCGATAGCGA
AAACCATAGCTGCTTTGATGTGGTGAAACAGATTTTTGCGCCGCGCCAGGAAGAATTTCATCAGCGTGCG
AACGTGACCTTTACCCTGAGCAAATTTCATTGGTGCTGCCATCATCATGTGCAGGTGCAGCCGTTTTTTAGC
AGCTGCCTGAACGATTGCCTGCGCCATGCGGTGACCGTGCCGTGCCCGGTGATTAGCAACACCACCGTGC
CGAAACCGGTGGCGGATTATATTCCGCTGTGGggtgƩccgggcgtgggtgtaccaggtgtcggtgtaccgggtgtcggcgt
acctggcgtcggtgtcccgggtgƩggtgƩccgggtgtaggtgƩccgggcgtgggtgtaccaggtgtcggtgtaccgggtgtcggcgtac
ctggcgtcggtgtcccgggtgƩggtgƩccgggtgtaggtgƩccgggcgtgggtgtaccaggtgtcggtgtaccgggtgtcggcgtacctg
gcgtcggtgtcccgggtgƩggtgƩccgggtgtaggtgƩccgggcgtgggtgtaccaggtgtcggtgtaccgggtgtcggcgtacctggc
gtcggtgtcccgggtgƩggtgƩccgggtgtaggtgƩccgggcgtgggtgtaccaggtgtcggtgtaccgggtgtcggcgtacctggcgtc
ggtgtcccgggtgƩggtgƩccgggtgtaggtgƩccgggcgtgggtgtaccaggtgtcggtgtaccgggtgtcggcgtacctggcgtcggt
gtcccgggtgƩggtgƩccgggtgtaggtgƩccgggcgtgggtgtaccaggtgtcggtgtaccgggtgtcggcgtacctggcgtcggtgtc
ccgggtgƩggtgƩccgggtgtaggtgƩccgggcgtgggtgtaccaggtgtcggtgtaccgggtgtcggcgtacctggcgtcggtgtccc

38
gggtgƩggtgƩccgggtgtaggtgƩccgggcgtgggtgtaccaggtgtcggtgtaccgggtgtcggcgtacctggcgtcggtgtcccgg
gtgƩggtgƩccgggtgtaggtgƩccgggcgtgggtgtaccaggtgtcggtgtaccgggtgtcggcgtacctggcgtcggtgtcccgggtg
ƩggtgƩccgggtgtaggtgƩccgggcgtgggtgtaccaggtgtcggtgtaccgggtgtcggcgtacctggcgtcggtgtcccgggtgƩg
gtgƩccgggtgtaggtgƩccgggcgtgggtgtaccaggtgtcggtgtaccgggtgtcggcgtacctggcgtcggtgtcccgggtgƩggtg
ƩccgggtgtaggtgƩccgggcgtgggtgtaccaggtgtcggtgtaccgggtgtcggcgtacctggcgtcggtgtcccgggtgƩggtgƩc
cgggtgtaggtgƩccgggcgtgggtgtaccaggtgtcggtgtaccgggtgtcggcgtacctggcgtcggtgtcccgggtgƩggtgƩccg
ggtgtaggtgƩccgggcgtgggtgtaccaggtgtcggtgtaccgggtgtcggcgtacctggcgtcggtgtcccgggtgƩggtgƩccgggt
gtaggtgƩccgggcgtgggtgtaccaggtgtcggtgtaccgggtgtcggcgtacctggcgtcggtgtcccgggtgƩggtgƩccgggtgta
ggƩac

39
Cleavage product
Figure 2 AnƟ-IL17A western blot showing cold spin supernatant and pellet comparison aŌer cell
lysis.
LiƩle soluble IL17R-V96 was observed in the supernatant, and clear cleavage product was
found.
AŌer cell lysis, a cold spin was performed. For naƟve-like ELP proteins, they should stay in the
supernatant aŌer a cold spin due to the transiƟon temperature. However, no intact IL17R-V96
was observed in the cell lysis supernatant aŌer cold spin (figure2). This proves the existence of
IBs during cell culture. post-lysis pellet post-lysis supernatant
IL17R-V96

40
3.2 Non-denaturant
Figure 3 AnƟ-IL17RA western blot showing that non-denaturant methods were used to extract
naƟve-like proteins from E. coli under low-temperature culture.
Two solubilizaƟon buffers were applied. They were different with the addiƟon of 5% DMSO as a
surfactant. No intact naƟve-like proteins were observed in the supernatant aŌer dialysis.
Instead, they were in the pellets. (Read only this figure from right to leŌ)
An unspecific protease inhibitor, PMSF, was added to all soluƟons following cell lysis. Under
both condiƟons, E. coli was cultured at 27°C and no IPTG inducƟon was performed. It was
intended that less misfolded polypepƟdes and more naƟve-like proteins would be produced.
Thus, funcƟonal proteins might be extracted without denaturing and refolding steps. CondiƟon
1 and condiƟon 2 were different in that an extra surfactant of 5% DMSO was added to the
solubilizaƟon buffer in condiƟon 2 to break the IBs (figure 3). No cold spin was performed aŌer DMSO post-dialysis pellet DMSO post-dialysis supernatant DMSO post-dialysis solu
Ɵon DMSO pre-dialysis solu
Ɵon
-DMSO post-dialysis pellet
-DMSO post-dialysis supernatant
-DMSO post-dialysis solu
Ɵon
-DMSO pre-dialysis solu
Ɵon post-PBS wash pellet
IL17R-V96
Cleavage product

41
solubilizaƟon and before dialysis. But cold spin was performed aŌer dialysis to separate
funcƟonal proteins from polypepƟdes that remained misfolded.
Unfortunately, no funcƟonal proteins were retrieved aŌer dialysis for either condiƟon. Band
intensiƟes were similar before the cold spin and aŌer dialysis under both condiƟon 1 and
condiƟon 2. 5% DMSO did not make a difference between condiƟons. No signs of proteins were
observed in the supernatant at the right molecular weight, where the funcƟonal, intact proteins
should be found.
PotenƟal reasons could be that there was no naƟve-like protein produced during culture, even
under low-temperature culture condiƟon. Or the solubilizaƟon buffers were not strong enough
to break the IBs with resuspensions by pipet. AlternaƟvely, PMSF may not have prevented all
protease acƟviƟes.

42
3.3 Manual pulsaƟle diluƟon
Figure 4 anƟ-IL17RA western blot showing manual pulsaƟle diluƟon.
Ussing pipeƩe, the unfolded polypepƟdes were added manually to a large volume of refolding
buffer at ice-temperature, which was intended to achieve fast refolding by exposing drops of the
unfolded sample to a significantly larger volume of refolding buffer. The sample was frozen at -
20°C for 3 days prior to dialysis. Most samples included low-molecular-weight cleavage products
and liƩle intact protein at the expected molecular weight (arrow).
In pulsaƟle diluƟon, 4 M Urea as a denaturant and 1 mM DTT as reducing agent were added to
the 10 ml solubilizaƟon buffer to unfold all polypepƟdes (figure 4). Then, the sample was added
manually with a pipeƩe dropwise into 90 ml diluƟon buffer with 0.5 M urea on ice. This quickly
removed addiƟves from unfolded polypepƟdes in small drops of samples, like small-scale onestep dialysis. The speed of diluƟon was 0.1mL/min. AŌer diluƟon, the sample was kept at -20 °C
for three days. Then dialysis was performed to remove the remaining addiƟves. post-solubiliza
Ɵon post-dilu
Ɵon post-dialysis post-cold spin supernatant post-cold spin pellet post-dilu
Ɵon (3 days later)
IL17R-V96
Cleavage product

43
The post-diluƟon sample did not seem to degrade significantly aŌer three days at -20°C. In the
post-dialysis soluƟon before cold spin, a pale band at the right molecular weight of around 73
kDa was sƟll visible. But aŌer a cold spin, It disappeared in both supernatant and pellets. The
most reasonable explanaƟon is that aŌer diluƟon to 100 ml soluƟon, the concentraƟon of the
target protein was too low that the protein was lost so much and could not be detected.
There was only one band of target protein around the correct molecular weight. However, this
band could not be enriched in the soluble fracƟon, even through the addiƟon of PMSF.

44
3.4 PulsaƟle diluƟon under different condiƟons
Figure 5 AnƟ-IL17RA western blot showing that more concentrated chaotrope 8M Urea at pH=8
was able to efficiently solubilize the intact protein.
AŌer solubilizaƟon, A cold spin step was applied to separate unfolded proteins from pellets. The
supernatants were compared for solubilizaƟon under different condiƟons. At pH=8 condiƟon,
the protein bands were present. LiƩle cleavage product was observed, while a relaƟvely larger
amount of intact protein was observed.
Having failed to idenƟfy intact protein in the supernatant, 8M urea and 6M GdnHCl were used
separately as denaturants. A syringe was used during resuspension, ensuring full contact
between polypepƟdes and addiƟves. AŌer solubilizaƟon, a cold centrifuge spin was applied to
Cleavage product urea, pH=8 urea, pH=8, sonicate urea, pH=4.5 urea, pH=4.5, sonicate
IL17R-V96

45
separate unfolded polypepƟdes in the supernatant from aggregated polypepƟdes in the pellet.
Unfortunately, GdnHCl distorted SDS-PAGE. Therefore, there is no data from GdnHCl condiƟons.
pH is an important parameter in the resolubilizing of proteins. The pH of the buffer is supposed
to be at least 1 unit different from the PI of the sample protein. Therefore, pH above and below
the PI were evaluated. The difference in pH allows proteins to stay in overall charged form, not
in zwiƩerion form. Thus, much higher sample solubility in buffer can occur. The PI of IL17R-V96
is 6.55 (BioinformaƟcs.org). In buffer with pH=8, a clear band was observed (figure 5), while in
buffer with pH=4.5, no band was observed. It could be under the influence that pH =4.5 is out of
the Tris-HCL buffer range.
SonicaƟng the supernatant aŌer fully syringe mixing between the IBs and solubilizaƟon buffer
did not seem to have a significant effect on the extent of IBs unfolding.

46
Figure 6 AnƟ-IL17RA western blot showing comparisons of supernatant and pellet in different
raƟo condiƟons aŌer diluƟon and dialysis.
The supernatants and pellets within the same diluƟon raƟo condiƟons were normalized. The
raƟo of sample loss aŌer pulsaƟle diluƟon can be compared with the raƟo between pellet and
supernatant. A 1:10 raƟon between the sample volume and the final volume showed clear
intact protein in the supernatant, while no aggregaƟons were observed in pellets in any
condiƟons.
1:10 supernatant 1:10 pellet 1:50 supernatant 1:50 pellet 1:100 supernatant 1:100 pellet
IL17R-V96

47
Figure 7 AnƟ-IL17RA western blot showing comparisons among the supernatant of pre-diluƟon
soluƟon and refolded supernatants aŌer diluƟons and dialysis.
Pre-diluƟon soluƟon and refolded supernatants aŌer diluƟons can be compared to see the
amount of sample loss. There was a huge loss aŌer diluƟon, or simply because the
concentraƟons of refolded supernatants aŌer diluƟons were too low to be detected.
A syringe pump with a flow rate of 0.1 ml was used for more accurate and easy-controlled
diluƟons. Three raƟos (figure 6) between the unfolded sample and diluƟon buffer were tested
(1:10, 1: 50 and 1:100). The final volumes aŌer dialysis were 15 ml from the 1:10 condiƟon, 75
ml from 1:50 and 150 ml from 1: 100. There was about a 50% volume increase before dialysis
compared to aŌer dialysis. The reason could be the glycerol in the dialysis tubing that created
the great osmoƟc pressure difference.
The supernatant and pellet within the same diluƟon raƟo condiƟons were normalized. There
was a clear band under the lane of 1:10 raƟo supernatant and a pale band under the lane of
1:50 raƟo supernatant. No bands under the lanes of pellets suggested liƩle misfolded protein in
the final sample and high refolding efficiency from unfolded polypepƟdes with pulsaƟle diluƟon
by syringe pump. pre-dilu
Ɵon 1:10 1:50 1:100
IL17R-V96

48
However, the pale band in the 1:50 lane and no band in the 1:100 also showed the potenƟal
problem of pulsaƟle diluƟon. The concertaƟon of the target protein was too low in the final
sample. It also created difficulty in the following test. The OD at 280nm for supernatant samples
under three raƟo condiƟons were all lower than 0.010.
The direct comparison among pre-diluƟon sample and three supernatant samples (figure 7)
could give a rather clear view of how much protein was lost during refolding. Although different
samples were normalized, much smaller amounts of diluted samples were used in western blot.

Figure 8 AnƟ-IL17RA western blot showing solubilized IBs were dialyzed by one-step or stepwise
methods.
While bands from stepwise methods were slightly heavier, the difference in final yield between
the two methods was not huge.
IBs samples solubilized under 8M urea, pH=8 condiƟon were dialyzed with one-step dialysis
with just Tris-HCl or stepwise dialysis with gradually removed addiƟves (figure 8). No huge
difference was observed from just western blot images. However, there were sƟll no one-step stepwise
IL17R-V96

49
coacervaƟons formed in the sample aŌer heaƟng in a 37 °C water bath. The reason could be the
relaƟvely low concentraƟon of target protein in the final sample, or triton’s potenƟal interacƟon
interfered with the ELP transiƟon temperature property. Other detergent could be used to
replace triton and compare.

50
3.5 Protein solubility during stepwise and one-step dialysis
Figure 9 AnƟ-IL17RA western blot showing supernatant and pellets comparisons in each stage
during one-step dialysis.
No apparent loss of intact target protein was observed in the pellets during different stages of
one-step dialysis. Thank you to Marinella Markanovic for performing this study.
0M urea supernatant 0M urea pellet 1st PBS supernatant 1st PBS pellet 2nd PBS supernatant 2nd PBS pellet
IL17R-V96
Cleavage product

51
Figure 10 AnƟ-IL17RA western blot showing supernatant and pellets comparisons in each stage
during stepwise dialysis.
A liƩle loss of intact target protein was observed in the pellets of each stage in stepwise
dialysis. Thank you to Marinella Markanovic for performing this study.
In one-step dialysis (figure 9), the supernatant that contains refolded IL17R-V96 shows that the
target protein was not greatly lost during each stage of one-step dialysis. However, in pellets,
there are misfolded polypepƟdes containing IL17R. Since the molecular weight of the misfolded
polypepƟdes is around 35 kDa, they could be pure IL17R without V96. It is possible that the
pure IL17R is unfolded during solubilizaƟon and misfolded again during dialysis.
On the other hand, during stepwise dialysis (figure 10), there are more target proteins lost
during each stage as the bands in pellets are heavier than those during one-step dialysis. The
was no band at the target protein molecular weight in the 1M urea supernatant. The band later
reappeared in the 0.5M urea supernatant. One plausible reason could be that the intermediate 3M urea supernatant 3M urea pellet 1M urea supernatant 1M urea pellet 0.5M urea supernatant 0.5M urea pellet ladder 0M urea supernatant 0M urea pellet PBS supernatant PBS pellet
IL17R-V96
Cleavage product

52
form of IL17R-V96 in 1M urea condiƟon blocked the binding of anƟ-IL17RA anƟbody binding to
the specific site on the polypepƟdes.

53
3.6 Different detergents wash comparisons.

Figure 11 SDS-PAGE showing the supernatants and pellets during each triton wash and aŌer
solubilizaƟon.
The supernatants and pellets are compared to see the amount of protein that was washed
away or solubilized. There were much fewer proteins washed away in the 3rd wash with triton
than those in the 1st wash. Nearly all target proteins were dissolved in the solubilizaƟon buffer,
as they were observed in the solubilizaƟon supernatant but not in the pellets aŌer cold spin.
The triton wash removed a large amount of cell proteins as well as some target proteins (Figure
11). AŌer every wash, the amount of protein washed away decreased, and aŌer 3rd Ɵme wash,
the amount of cell protein that could be washed away was relaƟvely small. To preserve the
target protein, triton washing for 3 Ɵmes should be enough. ladder 1st wash supernatant 1st wash pellet 2nd wash supernatant 2nd wash pellet 3rd wash supernatant 3rd wash pellet solubiliza
Ɵon solu
Ɵon solubiliza
Ɵon supernatant solubiliza
Ɵon pellet
250
150
100
75
50
37
25
20

54
AŌer the solubilized sample was centrifuged, there was almost no band at the weight of the
target protein, which means the IL17R-V96 solubilizaƟon with the solubilizaƟon buffer was
almost complete. However, other proteins were also refolded, along with IL17R-V96, and went
into the supernatant.

55

Figure 12 SDS-PAGE showing the comparisons between supernatants and pellets aŌer the 1st
wash with different detergents.
Sarkosyl as a detergent washed away more proteins and leŌ a purer sample than CHAPS aŌer
the wash.
Both CHAPS and sarkosyl were used as detergent to remove some cell proteins (figure 12). A
higher percentage of detergent seems to be able to remove more proteins. At the same
percentage, sarkosyl can remove more proteins overall than CHAPS. The IBs pellets leŌ aŌer
being washed with sarkosyl are also clearer than those washed with CHAPS. 1% Chaps supernatant 1% Chaps pellet 0.5% Chaps supernatant 0.5% Chaps pellet 1% Sarkosyl supernatant 1% Sarkosyl pellet 0.5% Sarkosyl supernatant 0.5% Sarkosyl pellet
250
150
100
75
50
37
25

56

Figure 13 AnƟ-IL17RA western blot showing comparisons between the supernatants and pellets
aŌer dialysis in different detergents wash condiƟons.
Triton and urea wash with protease inhibitors produced target proteins with liƩle cleavage
products, while sarkosyl leŌ liƩle or no misfolded protein in the pellets.
AŌer separaƟon with cold spin following dialysis, the supernatants and pellets are compared
among different wash condiƟons (figure 13). Samples washed with sarkosyl seem to leave the
least misfolded protein in the pellets aŌer dialysis. Specifically, IBs washed with 1% sarkosyl
show no misfolded protein band in the pellets.
On the other hand, samples washed with 1% tritona and 2M urea also had protease inhibitor
cocktail treatment right aŌer cell lysis with sonicaƟon. The protease inhibitor cocktail seems to
show effect because there is only one band at the right molecular weight in other supernatant
and pellet lanes. 1% triton+2M urea supernatant 1% triton+2M urea pellet 1% CHAPS supernatant 1& CHAPS pellet 0.5% CHAPS supernatant 0.5% CHAPS pellet 1% sarkosyl supernatant 1% sarkosyl pellet 0.5% sarkosyl supernatant 0.5% sarkosyl pellet
IL17R-V96

57
Figure 14 AnƟ-IL17RA western blot showing that one round of ELP-mediated phase separaƟon
was performed on the supernatants aŌer dialysis in different detergents wash condiƟons.
The supernatants aŌer one complete round of ELP-mediated phase separaƟon are compared.
Triton-washed samples showed clear bands while CHAPS-washed samples showed liƩle bands,
and sarkosyl-washed samples showed no bands.
1% triton+2M Urea 1% triton 1% CHAPS 0.5% CHAPS 1% sarkosyl 0.5% sarkosyl
IL17R-V96

58
Figure 15 SDS-PAGE showing that one round of ELP-mediated phase separaƟon was performed
on the supernatants aŌer dialysis in different detergents wash condiƟons.
The supernatants aŌer one complete round of ELP-mediated phase separaƟon are compared.
The sarkosyl and CHAPS washed samples showed less cleavage product and impuriƟes and
seemingly heavier bands at the target protein.
The supernatants aŌer dialysis were heated in a 37°C water bath. The supernatant from 1%
CHAPS, 0.5% CHAPS, 1% sarkosyl, and 0.5% sarkosyl condiƟons showed coacervaƟons without
the addiƟon of NaCl. 2M NaCl, while supernatants from 1% triton and 1% triton+2M urea
condiƟons showed coacervaƟons aŌer addiƟon of 2M NaCl.
One round of ELP-mediated phase separaƟon (hot spin+ cold spin) was performed aŌer dialysis.
AŌer ELP-mediated phase separaƟon, the supernatants were collected and heated in a 37°C ladder 1% triton+2M urea 1% triton 1% CHAPS 0.5% CHAPS 1% sarkosyl 0.5% sarkosyl
IL17R-V96

59
water bath again. No coacervaƟons were observed in all condiƟons aŌer the addiƟon of 5 M
NaCl.
The SDS-PAGE image (figure 15) of the supernatants aŌer ELP-mediated phase separaƟon
showed that in 1% triton and 1%+2M urea condiƟons, there were sƟll some unwanted proteins
remaining in the sample, while in the other condiƟons, there were much fewer proteins overall.
The western blot image (figure 14) showed that aŌer ELP-mediated phase separaƟon, in the 1%
triton condiƟon and the 1%+2M urea condiƟon, most target proteins remained with minor
degradaƟons. In 1% and 0.5% CHAPS condiƟons, the pale bands indicated that fewer target
proteins remained, while in 1% and 0.5% sarkosyl condiƟons, there were no indicaƟons of
IL17R-V96. However, when compared with the SDS-PAGE using the same samples, it seemed like
there were heavier bands at 73 KDa of the target protein in the SDS-PAGE than in the western
blot. So, it is possible that the remaining CHAPS and sarkosyl blocked the target protein
signaling in the western blot.

60
3.7 Triton x-100 interference with coacervaƟon of V96
Figure 16 ODs of 0.05Mm V96 with 0.01%, 0.003%, 0.001% and no triton at different
temperatures.
There was no apparent difference in the transiƟon temperature for all condiƟons. The blue line
indicates blank.
blank

61
Figure 17 ODs of 0.05Mm V96 with 0.3%, 0.1%, 0.03% and no triton at different temperatures.
The line with two rises is V96 with 0.3% triton. While the 1st rise is related to the cloud point,
the 2nd rise should indicate transiƟon temperature itself. The blue line indicates blank.
0.05 mM V96 with different concentraƟons of triton was tested for a possible transiƟon
temperature. In the range from 0.1% to 0.01% (figure 16, 17). Triton did not seem to interfere
with the coacervaƟon of v96 since their ODs all start to rise at around 31 °C and reached around
1.6 at their peaks. However, when triton concentraƟon increased to 0.1%, there was a 1st rise in
the OD at around 18 °C and it reached 1.5. later, at 31 °C. OD rose again and reached 1.8.
2
nd rise started at the same temperature at which pure 0.05mM V96 started to form
coacervaƟon. But the 1st rise was more likely related to the cloud point effect of triton. When
hot spin was used at 37 °C to separate IL17R-V96 samples aŌer triton washes, a white cloud-like
V96+0.3% triton
blank

62
substance was also observed. The cloud-like structure seemed to start forming at around 18 °C
and completed it at 24 °C. However, it seems that the triton did not interfere with the V96
transiƟon temperature.

63
Chapter 4: Discussion
The recombinant protein IL17R-V96 is an ELP recombinant protein that shows IBs and A low
yield problem. In other ELP recombinant proteins, for example, hIFN-γ with the V50 ELP
recombinant protein demonstrated a much higher yield compared to the hIFN-γ protein itself
when expressed in E. coli[100]. Thus, it is an interesƟng aƩempt to discover the purificaƟon
methods for the IL17R-V96. We aƩempted to solve the purificaƟon problem from many
different aspects, like protease acƟvity, culture condiƟons, washing detergents, solubilizing
agents, and addiƟves and length during dialysis. The data can provide valuable informaƟon for
ELP recombinant protein purificaƟon in many aspects.
There was protease acƟvity observed that cuts the target protein IL17R-V96. Unspecific
protease inhibitor 2% PMSF did not stop the acƟviƟes, while adding in cell lysis a E. coli protease
inhibitor cocktail containing AEBSF at 23 mM, EDTA at 100 mM, BestaƟn at 2 mM, PepstaƟn A at
0.3 mM, and E-64 at 0.3 mM for protein purificaƟon with his-tag seemed to prevent the cut
from happening. However, this E. coli protease inhibitor cocktail is very expensive for a small
amount. To massively produce the target protein, IL17R-V96, we can test all the protease
inhibitors within the cocktail one by one to find out which one or combinaƟon of protease
inhibitors can best prevent the protease from cuƫng IL17R-V96 so that less cost is needed.
During the non-denaturant method. the low-temperature culture method did not generate
naƟve-like target proteins during culture. New culture condiƟons, instead of solubilizaƟon

64
condiƟons, are more necessary to be tested if non-denaturant methods should be considered in
the future.
In a pulsaƟle diluƟon test, the syringe pump worked beƩer than manual diluƟon. If the whole
process can be done in the refrigerator at a low-temperature, the effect should be beƩer than
using an ice bucket to keep soluƟons at low-temperature. AŌer diluƟon with a large volume of
buffer and the absorbance of water during dialysis due to the osmoƟc pressure of glycerol, the
concentraƟon in the sample will significantly reduce. This creates problems in the following
protein quanƟficaƟon. While glycerol almost completely stopped the aggregaƟon of IBs [54], it
sƟll created the volume expansion and concentraƟon problems in our study. If pulsaƟle diluƟon
is to be used in the future, a higher concentraƟon of target protein should be solubilized first
before pulsaƟle diluƟon into a large amount of buffer. PulsaƟle diluƟon seems to produce
successfully refolded IL17R-V96 and generate liƩle to no misfolded polypepƟde during refolds.
In the solubilizaƟon process, DTT as a reducing agent is necessary. 8M urea as a denaturant can
unfold IL17R-V96. 8M urea proved to be a very promising denaturant for unfolding, as in many
other cases[49]. While 6M GdnHCl is also tested, because of the interacƟon between SDSbuffer and GdnHCl, the SDS-PAGE failed to run. To conƟnue the test, the solubilized sample by
GdnHCl can be diluted before running on SDS-PAGE gel. To ensure full effect, the IBs pellet and
solubilizaƟon buffer raƟo should also be maintain at least 1:5, 1:10 if best. Buffer with pH=8,
successfully solubilized protein because it was at least 1 higher than the PI of IL17R-V96, 6.55.
To test buffer with pH that is 1 lower than 6.55, buffer other than Tris-HCL should be used
because it is out of the buffer range 7.0 -9.2.

65
Syringes worked beƩer than pipets during the resuspension process. AŌer solubilizaƟon, it is
necessary that the supernatant and pellet are separated by centrifugaƟon before the refold
aƩempt because the misfolded polypepƟde could conƟnue to affect the unfolded proteins and
induce them to become misfolded again during refold.
The western blot image shows that the IL17R-V96 refolding rates between using one-step and
stepwise dialysis methods do not have a huge difference. To simply try different condiƟons, it is
not necessary to use the more expensive and Ɵme-consuming stepwise dialysis method.
While CHAPS and sarkosyl as washing detergents could solubilize more cell proteins than triton
and triton + urea as washing detergents, and sarkosyl could leave almost no misfolded protein
aŌer dialysis, they greatly consumed IL17R-V96 as well. For massive producƟon, triton is a
beƩer choice than CHAPS and sarkosyl. Triton washing for three Ɵmes should remove the
majority of cell proteins while keeping considerable IL17R-V96. In the study of recovering
glutathione S-transferase (GST)- and His6-tagged maltose binding protein (MBP) fusion proteins
from IBs, sarkosyl was used only as a reagent to solubilize the IBs and results in more than 90%
solubility of IBs [101]. While triton forms large micelle that cannot be dialyzed through 10 k
MW dialysis tubing, it does not seem to interfere with the ELP transiƟon temperature. However,
when heated above the cloud point, triton will appear as a white cloud. So, it is beƩer to use a
cold spin rather than a hot spin aŌer triton wash.

66
Chapter 5: Conclusion
The detergent washing comparisons showed that triton is, so far, the best among the 3 washing
detergents. The solubilizaƟon buffer with 8M urea and other reagents at pH=8 fully dissolves
IL17R-V96 IBs. And pulsaƟle diluƟon successfully refolds the protein with a high efficiency and
recovery rate. For the following studies of IL17R-V96, studies should focus on finding out
whether protease acƟvity takes place before or aŌer lysis. It is also important to find an
adequate concentraƟon of IBs before solubilizaƟon and dialysis so that IBs can be well
solubilized and refolded, while keeping enough acƟve protein for further purificaƟon. More
purificaƟon strategies like ion-exchange and his-tag can be tried in the future to preserve more
target protein.

67
References
1. Strebhardt, K. and A. Ullrich, Paul Ehrlich's magic bullet concept: 100 years of progress. Nat Rev
Cancer, 2008. 8(6): p. 473-80.
2. Hoffman, A.S., The origins and evoluƟon of "controlled" drug delivery systems. J Control Release,
2008. 132(3): p. 153-63.
3. Cho, K., et al., TherapeuƟc nanoparƟcles for drug delivery in cancer. Clin Cancer Res, 2008. 14(5):
p. 1310-6.
4. Greish, K., Enhanced permeability and retenƟon of macromolecular drugs in solid tumors: a royal
gate for targeted anƟcancer nanomedicines. J Drug Target, 2007. 15(7-8): p. 457-64.
5. Sharom, F.J., The P-glycoprotein efflux pump: how does it transport drugs? J Membr Biol, 1997.
160(3): p. 161-75.
6. Malam, Y., M. Loizidou, and A.M. Seifalian, Liposomes and nanoparƟcles: nanosized vehicles for
drug delivery in cancer. Trends Pharmacol Sci, 2009. 30(11): p. 592-9.
7. Barenholz, Y., Doxil®--the first FDA-approved nano-drug: lessons learned. J Control Release, 2012.
160(2): p. 117-34.
8. Duncan, R., The dawning era of polymer therapeuƟcs. Nat Rev Drug Discov, 2003. 2(5): p. 347-60.
9. Mitragotri, S., et al., AcceleraƟng the TranslaƟon of Nanomaterials in Biomedicine. ACS Nano,
2015. 9(7): p. 6644-54.
10. Vicent, M.J. and R. Duncan, Polymer conjugates: nanosized medicines for treaƟng cancer. Trends
Biotechnol, 2006. 24(1): p. 39-47.
11. Yamaoka, T., Y. Tabata, and Y. Ikada, Fate of water-soluble polymers administered via different
routes. J Pharm Sci, 1995. 84(3): p. 349-54.
12. Veronese, F.M., PepƟde and protein PEGylaƟon: a review of problems and soluƟons.
Biomaterials, 2001. 22(5): p. 405-17.

68
13. Srinivasan, N. and S. Kumar, Ordered and disordered proteins as nanomaterial building blocks.
Wiley Interdiscip Rev Nanomed Nanobiotechnol, 2012. 4(2): p. 204-18.
14. Ferrari FA, R.C., Chambers J, Causey SC, Pollock TJ, Capello J, Crissman JW, ConstrucƟon of
syntheƟc DNA and its use in large polypepƟde synthesis. Google Patents, 1993.
15. Frandsen, J.L. and H. Ghandehari, Recombinant protein-based polymers for advanced drug
delivery. Chem Soc Rev, 2012. 41(7): p. 2696-706.
16. Floss, D.M., et al., ElasƟn-like polypepƟdes revoluƟonize recombinant protein expression and
their biomedical applicaƟon. Trends Biotechnol, 2010. 28(1): p. 37-45.
17. Hassouneh, W., S.R. MacEwan, and A. ChilkoƟ, Fusions of elasƟn-like polypepƟdes to
pharmaceuƟcal proteins. Methods Enzymol, 2012. 502: p. 215-37.
18. Baldock, C., et al., Shape of tropoelasƟn, the highly extensible protein that controls human Ɵssue
elasƟcity. Proc Natl Acad Sci U S A, 2011. 108(11): p. 4322-7.
19. Urry, D.W., C.H. Luan, and S.Q. Peng, Molecular biophysics of elasƟn structure, funcƟon and
pathology. Ciba Found Symp, 1995. 192: p. 4-22; discussion 22-30.
20. Partridge, S.M., H.F. Davis, and G.S. Adair, The chemistry of connecƟve Ɵssues. 2. Soluble proteins
derived from parƟal hydrolysis of elasƟn. Biochem J, 1955. 61(1): p. 11-21.
21. Ciofani, G., et al., Recombinant human elasƟn-like magneƟc microparƟcles for drug delivery and
targeƟng. Macromol Biosci, 2014. 14(5): p. 632-42.
22. Urry, D.W., B. Starcher, and S.M. Partridge, CoacervaƟon of solubilized elasƟn effects a notable
conformaƟonal change. Nature, 1969. 222(5195): p. 795-6.
23. Cox, B.A., B.C. Starcher, and D.W. Urry, CommunicaƟon: CoacervaƟon of tropoelasƟn results in
fiber formaƟon. J Biol Chem, 1974. 249(3): p. 997-8.
24. Meyer, D.E. and A. ChilkoƟ, GeneƟcally encoded synthesis of protein-based polymers with
precisely specified molecular weight and sequence by recursive direcƟonal ligaƟon: examples
from the elasƟn-like polypepƟde system. Biomacromolecules, 2002. 3(2): p. 357-67.

69
25. ChilkoƟ, A., M.R. Dreher, and D.E. Meyer, Design of thermally responsive, recombinant
polypepƟde carriers for targeted drug delivery. Adv Drug Deliv Rev, 2002. 54(8): p. 1093-111.
26. Mackay, J.A. and A. ChilkoƟ, Temperature sensiƟve pepƟdes: engineering hyperthermia-directed
therapeuƟcs. Int J Hyperthermia, 2008. 24(6): p. 483-95.
27. Pastuszka, M.K., et al., A tunable and reversible plaƞorm for the intracellular formaƟon of
geneƟcally engineered protein microdomains. Biomacromolecules, 2012. 13(11): p. 3439-44.
28. Lim, D.W., et al., Rapid cross-linking of elasƟn-like polypepƟdes with (hydroxymethyl)phosphines
in aqueous soluƟon. Biomacromolecules, 2007. 8(5): p. 1463-70.
29. Reichheld, S.E., et al., ConformaƟonal transiƟons of the cross-linking domains of elasƟn during
self-assembly. J Biol Chem, 2014. 289(14): p. 10057-68.
30. Roberts, S., M. Dzuricky, and A. ChilkoƟ, ElasƟn-like polypepƟdes as models of intrinsically
disordered proteins. FEBS LeƩ, 2015. 589(19 Pt A): p. 2477-86.
31. Urry, D.W., T.L. Trapane, and K.U. Prasad, Phase-structure transiƟons of the elasƟn
polypentapepƟde-water system within the framework of composiƟon-temperature studies.
Biopolymers, 1985. 24(12): p. 2345-56.
32. Urry, D.W., et al., ElasƟc-contracƟle model proteins: Physical chemistry, protein funcƟon and drug
design and delivery. Adv Drug Deliv Rev, 2010. 62(15): p. 1404-55.
33. Pastuszka, M.K., et al., Flipping the Switch on Clathrin-Mediated Endocytosis using Thermally
Responsive Protein Microdomains. Adv Funct Mater, 2014. 24(34): p. 5340-5347.
34. Despanie J, D.J., Hamm-Alvarez SF, MacKay JA., ElasƟn-like polypepƟdes: TherapeuƟc
applicaƟons for an emerging class of nanomedicines. J Control Release, 2016 Oct 28(240:93-
108.).
35. McDaniel, J.R., D.J. Callahan, and A. ChilkoƟ, Drug delivery to solid tumors by elasƟn-like
polypepƟdes. Adv Drug Deliv Rev, 2010. 62(15): p. 1456-67.
36. Valiaev, A., et al., HydraƟon and conformaƟonal mechanics of single, end-tethered elasƟn-like
polypepƟdes. J Am Chem Soc, 2008. 130(33): p. 10939-46.

70
37. Haider, M., et al., Molecular engineering of silk-elasƟnlike polymers for matrix-mediated gene
delivery: biosynthesis and characterizaƟon. Mol Pharm, 2005. 2(2): p. 139-50.
38. Janib, S.M., et al., A quanƟtaƟve recipe for engineering protein polymer nanoparƟcles. Polym
Chem, 2014. 5(5): p. 1614-1625.
39. Kurihara, H., et al., Recombinant extracellular matrix-like proteins with repeƟƟve elasƟn or
collagen-like funcƟonal moƟfs. Biotechnol LeƩ, 2005. 27(9): p. 665-70.
40. McMillan RA, L.T., ConƟcello VP., Rapid Assembly of SyntheƟc Genes Encoding Protein Polymers.
Macromolecules, 1999(32:3643–3648).
41. Amiram, M., et al., A highly parallel method for synthesizing DNA repeats enables the discovery
of 'smart' protein polymers. Nat Mater, 2011. 10(2): p. 141-8.
42. Amiram, M., et al., Injectable protease-operated depots of glucagon-like pepƟde-1 provide
extended and tunable glucose control. Proc Natl Acad Sci U S A, 2013. 110(8): p. 2792-7.
43. Williams, D.C., et al., Cytoplasmic inclusion bodies in Escherichia coli producing biosyntheƟc
human insulin proteins. Science, 1982. 215(4533): p. 687-9.
44. Freedman, R.B. and R. Wetzel, Protein engineering. Curr Opin Biotechnol, 1992. 3(4): p. 323-5.
45. Chrunyk, B.A., et al., Inclusion body formaƟon and protein stability in sequence variants of
interleukin-1 beta. J Biol Chem, 1993. 268(24): p. 18053-61.
46. Carrió, M.M. and A. Villaverde, LocalizaƟon of chaperones DnaK and GroEL in bacterial inclusion
bodies. J Bacteriol, 2005. 187(10): p. 3599-601.
47. Carrió, M.M., R. Cubarsi, and A. Villaverde, Fine architecture of bacterial inclusion bodies. FEBS
LeƩ, 2000. 471(1): p. 7-11.
48. Marston, F.A., The purificaƟon of eukaryoƟc polypepƟdes synthesized in Escherichia coli. Biochem
J, 1986. 240(1): p. 1-12.
49. Rudolph, R. and H. Lilie, In vitro folding of inclusion body proteins. Faseb j, 1996. 10(1): p. 49-56.

71
50. Burgess, R.R., Refolding solubilized inclusion body proteins. Methods Enzymol, 2009. 463: p. 259-
82.
51. Singh, A., Upadhyay, V., Upadhyay, A.K. et al, Protein recovery from inclusion bodies of
Escherichia coli using mild solubilizaƟon process. Microb Cell Fact, 2015. 14, 41.
52. Iana Lychko, C.L.S., Ana Margarida Gonçalves Carvalho Dias, Ana Cecília Afonso Roque A scalable
method to purify reflecƟns from inclusion bodies. SeparaƟon and PurificaƟon Technology, 2023.
315.
53. Upadhyay, A.K., et al., Refolding and purificaƟon of recombinant L-asparaginase from inclusion
bodies of E. coli into acƟve tetrameric protein. Front Microbiol, 2014. 5: p. 486.
54. Kim, S.H., Y.B. Yan, and H.M. Zhou, Role of osmolytes as chemical chaperones during the
refolding of aminoacylase. Biochem Cell Biol, 2006. 84(1): p. 30-8.
55. Patra, A.K., et al., OpƟmizaƟon of inclusion body solubilizaƟon and renaturaƟon of recombinant
human growth hormone from Escherichia coli. Protein Expr Purif, 2000. 18(2): p. 182-92.
56. Clark, E.D., Protein refolding for industrial processes. Curr Opin Biotechnol, 2001. 12(2): p. 202-7.
57. Jevsevar, S., et al., ProducƟon of nonclassical inclusion bodies from which correctly folded protein
can be extracted. Biotechnol Prog, 2005. 21(2): p. 632-9.
58. Peternel, S., et al., Engineering inclusion bodies for non denaturing extracƟon of funcƟonal
proteins. Microb Cell Fact, 2008. 7: p. 34.
59. Castellanos-Mendoza, A., et al., Influence of pH control in the formaƟon of inclusion bodies
during producƟon of recombinant sphingomyelinase-D in Escherichia coli. Microb Cell Fact, 2014.
13: p. 137.
60. Peternel, S. and R. Komel, IsolaƟon of biologically acƟve nanomaterial (inclusion bodies) from
bacterial cells. Microb Cell Fact, 2010. 9: p. 66.
61. Upadhyay, A.K., et al., KineƟcs of inclusion body formaƟon and its correlaƟon with the
characterisƟcs of protein aggregates in Escherichia coli. PLoS One, 2012. 7(3): p. e33951.

72
62. Venkiteshwaran, A., et al., OpƟmized removal of soluble host cell proteins for the recovery of
met-human growth hormone inclusion bodies from Escherichia coli cell lysate using crossflow
microfiltraƟon. Biotechnol Prog, 2007. 23(3): p. 667-72.
63. Wang, L., Towards revealing the structure of bacterial inclusion bodies. Prion, 2009. 3(3): p. 139-
45.
64. Ami, D., et al., KineƟcs of inclusion body formaƟon studied in intact cells by FT-IR spectroscopy.
FEBS LeƩ, 2005. 579(16): p. 3433-6.
65. Fischer, B., et al., A novel sequenƟal procedure to enhance the renaturaƟon of recombinant
protein from Escherichia coli inclusion bodies. Protein Eng, 1992. 5(6): p. 593-6.
66. Singh, S.M., et al., SolubilizaƟon of inclusion body proteins using n-propanol and its refolding into
bioacƟve form. Protein Expr Purif, 2012. 81(1): p. 75-82.
67. Khan, R.H., et al., SolubilizaƟon of recombinant ovine growth hormone with retenƟon of naƟvelike secondary structure and its refolding from the inclusion bodies of Escherichia coli. Biotechnol
Prog, 1998. 14(5): p. 722-8.
68. Lu, S.C. and S.C. Lin, Recovery of acƟve N-acetyl-D-glucosamine 2-epimerase from inclusion
bodies by solubilizaƟon with non-denaturing buffers. Enzyme Microb Technol, 2012. 50(1): p. 65-
70.
69. St John, R.J., J.F. Carpenter, and T.W. Randolph, High pressure fosters protein refolding from
aggregates at high concentraƟons. Proc Natl Acad Sci U S A, 1999. 96(23): p. 13029-33.
70. Burgess, R.R., PurificaƟon of overproduced Escherichia coli RNA polymerase sigma factors by
solubilizing inclusion bodies and refolding from Sarkosyl. Methods Enzymol, 1996. 273: p. 145-9.
71. Kudou, M., et al., Refolding single-chain anƟbody (scFv) using lauroyl-L-glutamate as a
solubilizaƟon detergent and arginine as a refolding addiƟve. Protein Expr Purif, 2011. 77(1): p.
68-74.
72. Perham, M., J. Liao, and P. WiƩung-Stafshede, DifferenƟal effects of alcohols on conformaƟonal
switchovers in alpha-helical and beta-sheet protein models. Biochemistry, 2006. 45(25): p. 7740-
9.

73
73. Dürauer, A., et al., High-throughput system for determining dissoluƟon kineƟcs of inclusion
bodies. Biotechnol J, 2009. 4(5): p. 722-9.
74. Tsumoto, K., et al., PracƟcal consideraƟons in refolding proteins from inclusion bodies. Protein
Expr Purif, 2003. 28(1): p. 1-8.
75. Werner, M.H., et al., Refolding proteins by gel filtraƟon chromatography. FEBS LeƩ, 1994. 345(2-
3): p. 125-30.
76. SuƩnar, J., et al., Procedure for refolding and purificaƟon of recombinant proteins from
Escherichia coli inclusion bodies using a strong anion exchanger. J Chromatogr B Biomed Appl,
1994. 656(1): p. 123-6.
77. Glynou, K., P.C. Ioannou, and T.K. Christopoulos, One-step purificaƟon and refolding of
recombinant photoprotein aequorin by immobilized metal-ion affinity chromatography. Protein
Expr Purif, 2003. 27(2): p. 384-90.
78. Yin, S.M., Y. Zheng, and P. Tien, On-column purificaƟon and refolding of recombinant bovine prion
protein: using its octarepeat sequences as a natural affinity tag. Protein Expr Purif, 2003. 32(1):
p. 104-9.
79. Jungbauer, A., W. Kaar, and R. Schlegl, Folding and refolding of proteins in chromatographic beds.
Curr Opin Biotechnol, 2004. 15(5): p. 487-94.
80. Li, M., Z.G. Su, and J.C. Janson, In vitro protein refolding by chromatographic procedures. Protein
Expr Purif, 2004. 33(1): p. 1-10.
81. Chen, Y. and S.S. Leong, AdsorpƟve refolding of a highly disulfide-bonded inclusion body protein
using anion-exchange chromatography. J Chromatogr A, 2009. 1216(24): p. 4877-86.
82. Yamaguchi, H., et al., Refolding of difficult-to-fold proteins by a gradual decrease of denaturant
using microfluidic chips. J Biochem, 2010. 147(6): p. 895-903.
83. Okada, J., et al., Enzyme-mediated protein refolding. Chem Commun (Camb), 2009(46): p. 7197-
9.
84. Ou, W.B., Y.D. Park, and H.M. Zhou, Effect of osmolytes as folding aids on creaƟne kinase
refolding pathway. Int J Biochem Cell Biol, 2002. 34(2): p. 136-47.

74
85. Buchner, J. and R. Rudolph, RenaturaƟon, purificaƟon and characterizaƟon of recombinant Fabfragments produced in Escherichia coli. Biotechnology (N Y), 1991. 9(2): p. 157-62.
86. Xia, Y., et al., The protecƟve effects of osmolytes on arginine kinase unfolding and aggregaƟon.
Int J Biol Macromol, 2007. 40(5): p. 437-43.
87. Samuel, D., et al., Proline inhibits aggregaƟon during protein refolding. Protein Sci, 2000. 9(2): p.
344-52.
88. Cleland, J.L. and D.I. Wang, Cosolvent assisted protein refolding. Biotechnology (N Y), 1990.
8(12): p. 1274-8.
89. Cleland, J.L., et al., Polyethylene glycol enhanced protein refolding. Biotechnology (N Y), 1992.
10(9): p. 1013-9.
90. Majumder, A., et al., Effect of osmolytes and chaperone-like acƟon of P-protein on folding of
nucleocapsid protein of Chandipura virus. J Biol Chem, 2001. 276(33): p. 30948-55.
91. Vallejo, L.F. and U. Rinas, OpƟmized procedure for renaturaƟon of recombinant human bone
morphogeneƟc protein-2 at high protein concentraƟon. Biotechnol Bioeng, 2004. 85(6): p. 601-9.
92. Goldberg, M.E., et al., Non-detergent sulphobetaines: a new class of molecules that facilitate in
vitro protein renaturaƟon. Fold Des, 1995. 1(1): p. 21-7.
93. Vallejo, L.F., et al., RenaturaƟon and purificaƟon of bone morphogeneƟc protein-2 produced as
inclusion bodies in high-cell-density cultures of recombinant Escherichia coli. J Biotechnol, 2002.
94(2): p. 185-94.
94. Tsumoto, K., et al., Immobilized oxidoreductase as an addiƟve for refolding inclusion bodies:
applicaƟon to anƟbody fragments. Protein Eng, 2003. 16(7): p. 535-41.
95. Nath, D. and M. Rao, ArƟficial chaperone mediated refolding of xylanase from an alkalophilic
thermophilic Bacillus sp. ImplicaƟons for in vitro protein renaturaƟon via a folding intermediate.
Eur J Biochem, 2001. 268(20): p. 5471-8.
96. Kuboi, R., et al., Protein refolding using sƟmuli-responsive polymer-modified aqueous two-phase
systems. J Chromatogr B Biomed Sci Appl, 2000. 743(1-2): p. 215-23.

75
97. Mondal, K., et al., Alginate-chaperoned facile refolding of Chromobacterium viscosum lipase.
Biochim Biophys Acta, 2006. 1764(5): p. 877-86.
98. Middelberg, A.P., PreparaƟve protein refolding. Trends Biotechnol, 2002. 20(10): p. 437-43.
99. Vallejo, L.F. and U. Rinas, Strategies for the recovery of acƟve proteins through refolding of
bacterial inclusion body proteins. Microb Cell Fact, 2004. 3(1): p. 11.
100. Reza Heidari-Japelaghi, R.H., Mostafa Valizadeh, Ebrahim Dorani-Uliaie, Mokhtar Jalali-Javaran
ElasƟn-like polypepƟde fusions for high-level expression and purificaƟon of human IFN-γ in
Escherichia coli. AnalyƟcal Biochemistry, 2019. 585.
101. Tao, H., et al., Purifying naƟvely folded proteins from inclusion bodies using sarkosyl, Triton X100, and CHAPS. Biotechniques, 2010. 48(1): p. 61-4.

Abstract (if available)

Abstract The IL17 receptor (IL17RA) was fused with elastin-like polypeptides (ELP) to produce the recombinant protein IL17R-V96 in E. Coli. However, inclusion bodies (IBs) were observed during the production and yields in the soluble fraction were very low. General IB purification includes four major stages: culture, wash, solubilization, and refolding. Several strategies of IB purification that focus on different stages were evaluated. For example, a mild, non-denaturation method attempted to resolubilize the native protein without reducing reagents or significant chaotropic salts. It was clear this method also produced limited native protein; therefore, more aggressive denaturants were used to focus on solubilization before refolding. Different washing detergents, solubilization buffers, and refolding buffers were then tested using SDS-PAGE and western blotting. Efficient solubilization required longer incubation with 8M urea at pH 8. Pulsatile dilution prevented protein reaggregation during refolding and resulted in a pure band in the soluble fraction after refolding. One-step dialysis also prevented precipitation of the fusion protein. Moreso than CHAPS and sarkosyl, Triton-X 100 was the best washing detergent among three tested and did not interfere with the ELP transition temperature. Despite this, ELP-mediated phase separation was unable to achieve a high final yield and purity. Future studies should attempt alternative methods to enrich the IL17R-ELP in solution at higher yield.

Linked assets

University of Southern California Dissertations and Theses

Conceptually similar

PDF

Sustained and targeted delivery of rapamycin using FKBP-elastin like polypeptide fusion proteins

PDF

Methods and protocols for detecting the intracellular assembly of elastin-like polypeptides

PDF

Cellular uptake mechanism of elastin-like polypeptide fusion proteins

PDF

Characterization of actin based motility in mammalian cells through LIM and SH3 domain protein 1 (LASP1) and elastin like polypeptide (ELP) fusion protein

PDF

Tubulin-based fusion proteins as multifunctional tools

PDF

Stable cell lines expressing elastin-like polypeptide fusions with epidermal growth factor receptor modulate gene expression in a heat dependent manner

PDF

Temperature-mediated induction of caveolin-mediated endocytosis via elastin-like polypeptides

PDF

The modulation of dynamin and receptor endocytosis machinery using elastin-like polypeptides

PDF

Comparing drug release kinetics of rapamycin bound FKBP-ELP fusion proteins

PDF

Physical chemistry and polymeric modification of elastin-like polypeptides

PDF

Elastin like polypeptide tagged angiotensin (1-7) is a potential effective treatment for retinitis pigmentosa

PDF

Expression and purification of different elastin like polypeptides (ELPs) constructs for therapeutic applications

PDF

Multivalent smart elastin-like polypeptide therapeutics with drug delivery and biosensing applications.

PDF

Characterization of IL-1β secretion by fusing elastin-like polypeptides to pro-caspase-1

PDF

Flipping the switch on protein activity activity: elastin-like polypeptides assemble into cell switches and vesicles

PDF

Application of elastin-like polypeptides to therapeutics in leukemia

PDF

Effects of particle architecture on in-vivo pharmacokinetics and bio-distribution of therapeutic nanostructures

PDF

Targeting LFA-1/ICAM-1 interaction using ICAM-1 binding elastin-like polypeptide

PDF

Development of protein polymer therapeutics for the eye

PDF

Development of novel immunosuppressant-based therapies to treat dacryoadenitis in a Sjögren’s syndrome mouse model

Asset Metadata

Creator Luo, Haozhong (filename)

Core Title Inclusion body purification of elastin-like-polypeptide fusion proteins with a low transition temperature

School School of Pharmacy

Degree Master of Science

Degree Program Pharmaceutical Sciences

Degree Conferral Date 2023-12

Publication Date 12/08/2024

Defense Date 12/04/2023

Publisher Los Angeles, California (original), University of Southern California (original), University of Southern California. Libraries (digital)

Tag detergent,dialysis,elastin-like-polypeptide,inclusion body,OAI-PMH Harvest,pulsatile dilution,purification,recombinant protein,transition temperature

Format theses (aat)

Language English

Contributor Electronically uploaded by the author (provenance)

Advisor MacKay, J. Andrew (committee chair), Haworth, Ian S. (committee member), Okamoto, Curtis T. (committee member)

Creator Email 779339407@qq.com,haozhong@usc.edu

Permanent Link (DOI) https://doi.org/10.25549/usctheses-oUC113783858

Unique identifier UC113783858

Identifier etd-LuoHaozhon-12538.pdf (filename)

Legacy Identifier etd-LuoHaozhon-12538

Document Type Thesis

Format theses (aat)

Rights Luo, Haozhong

Internet Media Type application/pdf

Type texts

Source 20231211-usctheses-batch-1113 (batch), University of Southern California (contributing entity), University of Southern California Dissertations and Theses (collection)

Access Conditions The author retains rights to his/her dissertation, thesis or other graduate work according to U.S. copyright law. Electronic access is being provided by the USC Libraries in agreement with the author, as the original true and official version of the work, but does not grant the reader permission to use the work if the desired use is covered by copyright. It is the author, as rights holder, who must provide use permission if such use is covered by copyright.

Repository Name University of Southern California Digital Library

Repository Location USC Digital Library, University of Southern California, University Park Campus MC 2810, 3434 South Grand Avenue, 2nd Floor, Los Angeles, California 90089-2810, USA

Repository Email cisadmin@lib.usc.edu