University of Southern California Dissertations and Theses

Role of GH/IGF-1 signaling in oxidative stress, DNA damage and cancer

(USC Thesis Other)

Role of GH/IGF-1 signaling in oxidative stress, DNA damage and cancer

PDF

Download a page range

Download transcript

Copy asset link

Request this asset

Transcript (if available)

Content ROLE OF GH/IGF-1 SIGNALING IN OXIDATIVE STRESS, DNA DAMAGE AND
CANCER

by

Priya Balasubramanian

A Dissertation Presented to the
FACULTY OF THE USC GRADUATE SCHOOL
UNIVERSITY OF SOUTHERN CALIFORNIA
In Partial Fulfillment of the
Requirements for the Degree
DOCTOR OF PHILOSOPHY
(MOLECULAR BIOLOGY)

August 2010

Copyright 2010 Priya Balasubramanian

ii
DEDICATION

To my mother Vathsala, and my father Balasubramanian for their unconditional
love and support.

iii

ACKNOWLEDGEMENTS

I would like to thank my mentor, Valter Longo, for giving me the wonderful
opportunity to be his student. As an excellent scientist and advisor Valter has
kept me motivated throughout and provided me with much needed
encouragement. I appreciate very much that Valter is always available and willing
to discuss research ideas or problems no matter how busy he might be. I have
learned a lot from him and I am very happy and proud to have been a member of
the Longo lab.
I am very lucky that I had Steven Goodman to turn to for support and
reassurance. He is the kind of committee member every graduate student needs
and I thank him very much for always having had my best interests in mind.
Thanks to Steven Finkel for being very patient and helpful. I have approached
him with questions several times and he has always tried to find the best possible
solution to any problem I have had. I also thank Christian Pike and Michelle
Arbeitman for their helpful inputs.
I would like to acknowledge past and current Longo lab members who
have contributed to this work in one way or another. Thanks to Min Wei for help
with experiments, lively discussions and help with data analysis. I appreciate
help from Federica Madia who performed yeast experiments that have directly
benefitted my research and Chia-Wei Cheng for spending several weekends in
lab running comet assays with me. Paola Fabrizio was very helpful with her funny
bits of advice that meant a lot.
iv
Thanks also to Mario Mirisola for helping me troubleshoot molecular
experiments. I would like to thank Edoardo Parrella for being a good friend and
for helping me find humor in every situation, Fernando Safdie and Changhan Lee
for being entertaining officemates, Stavros Gonidakis for asking a lot of questions
and Jia Hu, Ying Li, Sangeeta Bardhan Cook and Abu Galbani for being great
labmates. I would like to acknowledge Zhengyi Zhou, who along with Min Wei
generated cells lines and plasmids that I was able to subsequently use in my
projects.
I would like to express my gratitude to collaborators from other institutions;
Jaime Guevara-Aguirre, Rafael de Cabo, Pinchas Cohen and members of their
respective groups who have contributed to my research.
Thanks to past and current members of the Davies lab and the Finch lab
especially Jenny Ngo who, as a good friend, has given me helpful tips all along,
Gennady Ermak who I had the opportunity to work with and Jason Arimoto who
always let me borrow material for experiments.
I’d like to also acknowledge help from Linda Bazilian and the Molecular
Biology staff who have helped me stay on track over the years.
Finally, I am very grateful to my family and friends without whose support this
would not have been possible.

v
TABLE OF CONTENTS

Dedication ii

Acknowledgements iii

List of Tables vi

List of Figures vii

Abstract x

Chapter 1: Introduction
Growth Hormone (GH) function 1
GH production and secretion 1
Growth Hormone signaling 3
Metabolic effects of GH signaling 4
Growth and Aging effects of GH
Signaling 4

Chapter 2: Growth Hormone Receptor Deficiency
is Associated with Inactivation of
Conserved Pro-Aging Pathways and
Very Low Cancer and Diabetes
Incidence in Humans
Chapter 2 Abstract 12
Chapter 2 Introduction 13
Chapter 2 Materials and Methods 19
Chapter 2 Results 25
Chapter 2 Discussion 60

Chapter 3: Regulation of FOXO transcription
factors by Ras and p38
Chapter 3 Abstract 65
Chapter 3 Introduction 66
Chapter 3 Materials and Methods 74
Chapter 3 Results 78
Chapter 3 Discussion 99
Chapter 4: Conclusions 104
Bibliography 113

vi
LIST OF TABLES

Table 2.1 Genotype of the GHRD cohort 28

Table 2.2 Cancer Mortality in GHRD and controls 30

Table 2.3 List of genes with significantly altered expression
in GHRD and Control serum grown HMECs 47

Table 2.4 Genes in the significantly altered functional
pathways identified by microarray analysis 52

vii
LIST OF FIGURES

Figure 1.1 Conserved regulation of growth factor
signaling 5

Figure 2.1 Age distribution of alive GHRD subjects 26

Figure 2.2 E180 mutation in the GHR gene 27

Figure 2.3 Characterization of serum IGF-I, IGF-II and
IGFBP-1 in GHRD and control subjects 29

Figure 2.4 Types of Cancers that cause mortality in
the Control subjects 31

Figure 2.5 Leading causes of Mortality in Control and
GHRD subjects 32

Figure 2.6 Cancer and Diabetes in the GHRD population 34

Figure 2.7 DNA damage in Human Mammary Epithelial Cells
(HMEC) 1 hour after treatment with H
2
O
2
36

Figure 2.8 DNA damage in Human Mammary Epithelial Cells
(HMEC) 24 hours after treatment with H
2
O
2
37

Figure 2.9 IGF-1 prevents death in damaged cells 39

Figure 2.10 Induction of Apoptosis in Human Mammary
Epithelial Cells (HMEC) treated with H
2
O
2
41

Figure 2.11 Analysis of IGF-I signaling in IGF-1R KO (R-)
and IGF-1R overexpressing (R+) Mouse
Embryonic Fibroblast (MEF) cells 44

Figure 2.12 Ingenuity Pathway Analysis of microarray data
shows the down regulation of Ras, PKA and Tor
in HMEC cells grown in GHRD serum 49

Figure 2.13 RT-PCR analysis reveals reduced expression
of major growth factor signaling genes in HMEC
cells grown in GHRD serum 50

Figure 2.14 No effect of GHRD or Control serum on
H
2
O
2
mediated cytotoxicity in HepG2 cells 51
viii

Figure 2.15 Functional clustering of gene expression
changes analyzed by Ingenuity Pathways
Analysis 54

Figure 2.16 Conserved nutrient responsive signaling
pathways in yeast and mammals 56

Figure 2.17 Homologous nutrient sensitive pathways
in yeast and mammals mediate lifespan and
DNA damage 58

Figure 2.18 Survival and mutation frequency of H
2
O
2

treated WT and ras2 ∆tor1 ∆sch9 ∆ triple mutants 59

Figure 3.1 FoxO regulated genes and their functions 69

Figure 3.2 Tet inducible expression of CA and DN Ras
in PC12 cells 79

Figure 3.3 Reduced Ras activity protects against
oxidative stress 80

Figure 3.4 Ras regulates FOXO promoter activity 82

Figure 3.5 Regulation of FOXO by Ras in HepG2 cells 84

Figure 3.6 Regulation of FOXO1 by p38 86

Figure 3.7 p38 regulates nuclear-cytoplasmic translocation
of FOXO1 88

Figure 3.8 Regulation of FOXO1 by p38 is independent of Akt 90

Figure 3.9 p38 regulates total FOXO1 protein levels in vitro
and in vivo 91

Figure 3.10 p38 inhibition protects against menadione induced
oxidative stress 92

Figure 3.11 p38 inhibition requires FOXO1 to protect
against Menadione induced oxidative stress 93

Figure 3.12 p38 regulates MnSOD protein levels 95

ix
Figure 3.13 MnSOD mediates the p38-FOXO1 regulated
oxidative stress response 96

Figure 3.14 p38 regulates IGFBP-1 98

Figure 3.15 Model for p38 mediated oxidative stress
protection in mammalian cells via FOXO
and IGFBP-1 103

x
ABSTRACT

Reduced signaling of the Insulin like Growth Factor 1 (IGF-1) pathway in
mammals or that of its orthologs in lower organisms is known to increase lifespan
and protect against oxidative stress and age-related pathologies. IGF-1 is mainly
synthesized in the liver in response to Growth Hormone (GH). Mice with reduced
GH signaling, for example the Ames dwarf, Snell dwarf or the Growth Hormone
Receptor Knock Out (GHRKO) mice are smaller in size, have longer lifespans,
increased insulin sensitivity and are protected against cancer.
In humans, mutations in the Growth Hormone Receptor (GHR) lead to
Growth Hormone Receptor Deficiency (GHRD) also known as Laron Syndrome
which is characterized by extremely low levels of IGF-1 and dwarfism. Only one
case of non-lethal cancer and no cases of diabetes have been observed in a
population of about one-hundred GHRD individuals from southern Ecuador in the
last twenty two years. This indicates that reduced GH signaling can protect
against age-related diseases in humans as well.
Primary, non-cancerous, Human Mammary Epithelial Cells (HMEC) were
incubated with serum from GHRD individuals or their unaffected control relatives.
GHRD serum protected these cells against oxidative DNA damage and also
promoted apoptosis in damaged cells by a mechanism that was reversed by
IGF-1. Microarray analysis of genes expression changes between HMEC
incubated with GHRD or control serum indicates the upregulation of stress
xi
protective genes such as the mitochondrial SOD (SOD2) and downregulation of
growth factor signaling pathways such as Ras, PKA and Tor.
Yeast lacking TOR1, RAS2, and SCH9 (S6K), 3 orthologs of central IGF-1
signaling genes displayed a major decrease in age-dependent mutations. This
indicates that the mechanisms responsible for protection against DNA damage
and cancer are highly conserved in lower organisms and humans.
Analysis of Ras signaling in mammalian cells shows that it can
downregulate FoxO transcription factor activity. FoxO is already known to be
downregulated by IGF-1 signaling via Akt and increased FoxO activity can not
only enhance expression of stress protective genes, for example, SOD2, but also
participate in regulating apoptosis. Upregulation of FoxO by inhibition of the p38
MAP kinase increases SOD2 protein levels and protects HepG2 cells against
oxidative stress. It is possible that p38 is a mediator of Ras signaling to FoxO.
The studies described in this dissertation reveal mechanisms by which a
reduction in GH/IGF-1 signaling could protect against DNA damage and cancer
in humans.
1
CHAPTER 1
INTRODUCTION

Growth Hormone (GH) function
Growth Hormone is the main mediator of somatic growth and proliferation
in the body. Also known as the somatotropic axis, the components of the GH
signaling pathway are involved in the regulation of puberty and adult body size.
GH levels are high during childhood and adolescence and decline with age
leading to loss in muscle mass and increased adiposity (Bartke 2005). GH
signaling also promotes substrate metabolism. When nutrients are available, GH
promotes breakdown of carbohydrate and proteins. It can enhance amino acid
uptake and nitrogen retention in muscle. Under conditions of nutrient scarcity, it
alters metabolism in favor of lipid breakdown. This switch from carbohydrate
metabolism to lipolysis allows storage of protein sources and is vital to survival of
the organism under conditions of starvation. Therefore, GH also plays a role in
decreasing body fat by promoting lipolysis and release of free fatty acids (Okada
and Kopchick 2001; Moller and Jorgensen 2009).
GH production and secretion
Human Growth Hormone is a 191 amino acid peptide hormone that is
synthesized and secreted by the anterior pituitary gland (Press 1988). In
humans, GH is secreted in a pulsatile manner from the pituitary gland all day with
spikes in secretion occurring every 3-5 hours (Hartman, Faria et al. 1991).
Surges in secretion are seen following the onset of slow-wave sleep and lower
2
secretion is seen after consumption of food (Moller and Jorgensen 2009). GH
levels are usually low between peak secretions and wide ranges in peak
concentrations are observed. Maximal GH secretion occurs during late puberty
where individuals can secrete 1-1.8mg/day (Giustina and Veldhuis 1998).
Healthy young adults secrete about 0.4-0.5mg of GH /day (Hartman, Faria et al.
1991). Stress and fasting can increase GH secretion whereas high levels of
glucose and lipids can inhibit it (Moller and Jorgensen 2009).
Synthesis and secretion of GH is governed mostly by Growth Hormone
Releasing Hormone (GHRH), Somatostatin and IGF-1. In addition, Ghrelin, which
is produced mainly in the stomach induces secretion of GH and regulates
appetite, insulin secretion and fat oxidation (Kojima, Hosoda et al. 1999). GHRH
is synthesized by the hypothalamus and can stimulate both the synthesis and
release of GH when it binds to its specific receptor on the membranes of
somatotropes (Giustina and Veldhuis 1998). GH secretion is stimulated in a Ca
2+

ion and cAMP dependent mechanism. The importance of GHRH on GH
production is highlighted by the fact that point mutations in the extracellular
binding domain of the GHRH receptor lead to GH deficiencies and dwarfism in
the “little” lit/lit mouse model and also in humans (Godfrey, Rahal et al. 1993).
Somatostatin, which is also hypothalamic in origin, on the other hand, acts as an
antagonist of GHRH and by binding to its specific receptors inhibits the release
but not the biosynthesis of GH. IGF-1 which will be discussed in further detail
acts as a feedback regulator of GH (Giustina and Veldhuis 1998). Finally, GH is
also positively regulated by several endocrine hormones such as glucorticoids,
3
the sex hormones and the thyroid hormone. In fact, concentrations of
testosterone in young males and estradiol in young females correlate positively
with GH levels (Ho, Evans et al. 1987; Giustina, Scalvini et al. 1997). However,
despite the presence of sex hormones, GH levels begin to decline during
adulthood and drop down to less than a quarter or half of the values seen during
puberty (Giustina and Veldhuis 1998). This decrease is also accompanied by a
gradual decline in levels of IGF-1. Finally, GH production is also influenced by
metabolic substrates. Hypoglycemia stimulates GH secretion while
hyperglycemia can suppress GH secretion (Casanueva 1992). Type-2 diabetics
exhibit impaired GH secretion in response to administered GHRH, which is also
true in the case of obese non-diabetics (Casanueva 1992; Okada and Kopchick
2001). It is hypothesized that chronic hyperglycemia can suppress the GH
response to GHRH stimulation in these patients by increasing somatostatin
release (Giustina and Veldhuis 1998).
Growth Hormone signaling
The Growth Hormone Receptor (GHR) is a single transmembrane protein
620 amino acids in length. The Growth Hormone Binding Protein (GHBP), also
encoded by the same gene, corresponds to the extracellular domain of the GHR.
Binding of GH to the GHR initiates several intracellular signal transducers. The
JAK-STAT pathway regulates transcription of several genes including IGF-1.

4
The MAPK pathway is also activated by GH signaling and involves SHC,
GRB2 and SOS upstream of the Ras-Erk cascade (Yamauchi, Kaburagi et al.
1998). GH can also phosphorylate IRS1 and stimulate glucose uptake due to
membrane localization of the glucose transporter GLUT4 (Okada and Kopchick
2001).
Metabolic effects of GH signaling
As mentioned before, GH stimulates lipolysis and the most significant
metabolic effect of GH is a marked and prolonged increase in free fatty acids and
ketone bodies due to lipolysis in femoral and abdominal adipose tissue (Moller,
Jorgensen et al. 1990; Moller, Jorgensen et al. 1991; Gravholt, Schmitz et al.
1999). GH does not affect total glucose turnover, but it suppresses oxidative
utilization of glucose with a proportionate increase in non-oxidative glucose
utilization (Moller, Jorgensen et al. 1991). In general, Growth Hormone
antagonizes the effects of Insulin on lipid and glucose metabolism. In the case of
protein metabolism GH exhibits anabolic actions and it has been observed to
increase protein synthesis at the whole-body level without affecting muscle
breakdown (Norrelund 2005). Local infusion of GH and Insulin revealed an
increase in protein synthesis but no muscle degradation implying that GH can
inhibit the action of Insulin on muscle breakdown (Fryburg, Gelfand et al. 1991).
Growth and Aging effects of GH signaling
IGF-1 is the main mediator of GH effects on somatic growth and
intracellular signaling. The effect of GH/IGF-1 signaling on growth and
proliferation has led to interest in its role in aging and cancer. The major part of
5
IGF-1 is generated by the liver. IGF-1, IGF-II and Insulin are part of the IGF-1
family of growth factors (Chan, Cao et al. 1990). The liver is also the site for
production of the IGF Binding Proteins (IGFBPs). There are six IGFBPs that can
bind with high affinity to IGF-1 and limit the availability of free IGF-1 to the IGF-1
receptor (Monzavi and Cohen 2002). Orthologs of IGF-1 signaling elements are
conserved across species and stimulate growth and proliferation (Fig.1.1).

Figure 1.1 Conserved regulation of growth factor signaling.
From: Longo VD and Finch CE Science 2003.

In mammals, the IGF-1 signaling pathway includes the IGF-1 receptor,
phosphatidylinositol 3-kinase (PI3K), Akt/PKB kinase and the Forkhead
transcription factor O (FOXO) family which regulate expression of several
genes(Burgering and Medema 2003). Binding of IGF-1 to its receptor results in
6
recruitment of PI3K which when activated generate 3’-phosphorylated inositol
lipids (PtdIns3P). As secondary messengers, these lipids activate downstream
kinases, in particular the Ser/Thr kinase Akt/PKB. Activation of Akt/PKB occurs
when it is phosphorylated at Thr308 and Ser473. PI3K is tightly regulated by
several phosphatases particularly the tumor suppressor PTEN which is a 3’
phosphatase and can significantly reduce PI3K signaling. Activation of Akt/PKB
results in phosphorylation of several downstream substrates that share a
common consensus sequence. These include GSK-3, mTOR, the Bcl2 family
member BAD, caspase 9 etc and the FOXO family of transcription factors
(FOXO1, FOXO3a, FOXO4 and FOXO6) which are important downstream
components of PI3K-Akt/PKB signaling (Burgering and Coffer 1995).
Phosphorylation of BAD and Caspase9 results in inactivation and suppression of
their proapoptotic functions (Datta, Dudek et al. 1997; del Peso, Gonzalez-Garcia
et al. 1997; Cardone, Roy et al. 1998). Similarly, phosphorylation by Akt/PKB
inactivates the FOXO proteins which have multiple intracellular functions
including protection against oxidative stress, apoptosis, DNA damage repair, cell
cycle arrest and muscle atrophy (Brunet, Bonni et al. 1999; Kops, Dansen et al.
2002; Greer and Brunet 2005). It was recently demonstrated that somatic
deletion of all FoxOs resulted in development of a cancer phenotype in mice
implying that FoxOs act as bonafide tumor suppressors (Paik, Kollipara et al.
2007). The role of FOXO regulated SOD2 in prevention of oxidative DNA
damage and possibly cancer will be discussed in Chapter 2 of this thesis.
7
The FOXO factors appear to be convergence points for multiple signals
and are regulated not only by IGF-1 signaling but also by stress, ubiquitination,
acetylation etc. (Brunet, Sweeney et al. 2004; Essers, Weijzen et al. 2004). The
regulation of FOXO by p38 and its effects on stress resistance will be discussed
in chapter 3 of this thesis.
As an essential promoter of growth and cellular proliferation the relevance
of GH/IGF-1, signaling in aging and cancer has been examined. Early evidence
for a role of this pathway in aging was the finding that mutations in daf-2, the
C.elegans homolog of the IGF-1 receptor led to a 2 fold increase in lifespan
(Kenyon, Chang et al. 1993). daf-2 mutations cause activation of the Forkhead
transcription factor daf-16 (homolog of mammalian FOXO) which regulates
formation of the dauer larvae and is a key regulator of resistance to oxidative
stress. In yeast, mutations in Sch9 and Ras2, homologs of the two main signaling
molecules that function downstream of IGF-1 in mammals extend lifespan in a
SOD2 dependent manner (Fabrizio, Pozza et al. 2001; Fabrizio, Liou et al. 2003)
IGF-1 receptor (InR) and Insulin Receptor Substrate (chico) mutations can also
increase the lifespan of Drosophila by 80% and 40% respectively (Clancy, Gems
et al. 2001; Tatar, Kopelman et al. 2001). Robust increases in longevity are
observed in mice carrying mutations in growth signaling pathways. For example,
IGF-1 receptor heterozygotes live 30% longer than WT mice (Holzenberger,
Dupont et al. 2003) and mice having pituitary defects, such as the Ames and
Snell dwarf mice, have low levels of IGF-1, Thyroid hormone, and Prolactin and
are long lived (Brown-Borg, Borg et al. 1996; Flurkey, Papaconstantinou et al.
8
2002). Similarly, mutations in the Growth Hormone Receptor gene in GHR/BP
knockout mice reduce circulating IGF-1 levels and increase lifespan by 26-55%
depending on background (Coschigano, Holland et al. 2003; Bartke 2005).
Downregulation of IGF-1 signaling is also seen with the lifespan extending
Calorie Restriction (CR) strategy. This intervention, which involves a reduction in
food intake without leading to malnutrition, has been shown to enhance longevity
in yeast, worms, flies, mice and monkeys. In S. cerevisiae, switching cells from a
nutrient rich medium to water doubles their chronological lifespan and this effect
is dependent upon the Ser/Thr kinase Rim15 and the stress resistance
transcription factors, Gis1 and Msn2/4 (Wei, Fabrizio et al. 2008). The
mechanism involved is dependent upon the use of ethanol and acetic acid
produced by these non-dividing yeast cells as carbon sources resulting in an
accumulation of glycerol in the medium.
This mechanism of CR overlaps with a genetic deletion of TOR1 or SCH9,
which reduces respiration and prolongs chronological lifespan in yeast. However,
TOR, Sch9 and Ras–PKA can also extend the lifespan of yeast in media
deficient in ethanol and acetic acid, therefore indicating additional mechanisms of
lifespan extension that are independent of carbon source substation (Fabrizio, Li
et al. 2005; Wei, Fabrizio et al. 2009).
In worms, DAF-16 (FoxO) which is a major protein involved in lifespan
extension by reduced IGF-1 signaling and AMPK (aak-2) are required only for
some forms of CR while the transcription factors Pha-4 and SKN-1 are required
for others (Mair and Dillin 2008; Greer and Brunet 2009). CR in Drosophila can
9
also extend lifespan by a reduction in IGF-1 signaling but does not require the
activity of dFoxO (Giannakou, Goss et al. 2008). In mice, CR can increase
lifespan by 60% and involves a reduction in Insulin/IGF-1 signaling (Weindruch,
Naylor et al. 1988). Adult-onset CR in rodents increases both mean and maximal
lifespan (Weindruch and Walford 1982). CR mice have been shown to be
protected against age-related diseases such as cancer, diabetes, cardiovascular
disease and obesity (Weindruch, Naylor et al. 1988). This protection has also
been reported in a recent 20-year longitudinal study of adult onset CR in rhesus
monkeys where a 30% reduction in calorie intake resulted in a significant
reduction in death due to age-related pathologies and reduced incidence of
diabetes, cancer, cardiovascular disease and brain atrophy (Colman, Anderson
et al. 2009). While the effects of CR are difficult to determine in humans due to
practical and ethical reasons, some data has been collected from human studies.
CR appears to reduce markers for atherosclerosis and diabetes in humans.
However unlike rodents, CR does not reduce levels of IGF-1 in humans or alter
IGF-1: IGFBP-3 ratios (Fontana, Weiss et al. 2008). On the other hand, moderate
protein restriction in humans significantly reduces free and total IGF-1 levels
(Fontana, Weiss et al. 2008; Fontana, Weiss et al. 2009).
As cancer is a major age-related disease and, as explained in detail
earlier, inhibition of GH/IGF-1 signaling increases lifespan and reduces age-
related pathologies in a number of organisms, the relevance of this pathway in
cancer incidence and progression is of great interest. Infact, mutations that cause
constitutive activation of these pathways are commonly found in many cancers.
10
For example, inactivation of the tumor suppressor gene PTEN commonly occurs
in several human cancers (Chalhoub and Baker 2009). PTEN, which functions as
an antagonist of PI3K, when inactivated, allows unrestrained signaling through
PI3K which results in dysregulation of apoptosis (Di Cristofano, Kotsi et al. 1999;
Di Cristofano and Pandolfi 2000). Similarly mutations in the Ras isoforms: K, N
And Ha Ras are frequently found in a variety of human cancers (Bos 1989). In
fact, K Ras mutations are frequently found in malignant neoplasms: 90% of
adenocarcinomas

of the pancreas; 50% of colon, 30% of lung, and 50% of
thyroid

tumors; and 30% of myeloid leukemia cases (Bos 1989). Studies in yeast
have revealed a lower frequency of age-dependent base substitutions, small
DNA insertions/deletions, and gross chromosomal rearrangements (GCRs) in the
long-lived Sch9 deletion mutants (Madia, Wei et al. 2009). The mutants also
exhibit higher SOD2 expression and lower Rev1 expression indicating that sch9,
which is a homolog of mammalian Akt/S6K, promotes superoxide dependent
DNA damage and mutagenesis via an error-prone DNA repair mechanism
(Madia, Wei et al. 2009).
In C.elegans, Daf-16, a major mediator of lifespan extension in IGF-1
pathway mutants, also regulates several genes that are involved in tumor
progression and p53 dependent apoptosis suggesting that the same pathways
that regulate aging are involved in regulation of cancer (Pinkston-Gosse and
Kenyon 2007). Similarly, the Ames dwarf mice and the GHR/BP KO mice, both of
which are long-lived exhibit delayed occurrence of cancers (Ikeno, Bronson et al.
2003; Ikeno, Hubbard et al. 2009). Rhesus monkeys on DR also exhibit reduced
11
neoplastic disease (Colman, Anderson et al. 2009). In humans, high levels of
IGF-1 in acromegalics have been associated with an increased risk of cancer
(Renehan, Zwahlen et al. 2004). Population studies in humans demonstrate a
modest association between high IGF-1 levels and cancer (Pollak 2004).
This dissertation will focus on GH/IGF-1 signaling in mammalian systems
as it relates to cancer, aging and stress resistance. Chapter 2 is my report on the
role of GH/IGF-1 signaling in cancer in a human population of Growth Hormone
Receptor Deficient (Laron Syndrome) individuals from Ecuador. In Chapter 3, I
report molecular details of regulation of FOXO transcription factor signaling by
Ras and the p38 MAPK.

12
CHAPTER 2
GROWTH HORMONE RECEPTOR DEFICIENCY IS ASSOCIATED WITH
INACTIVATION OF CONSERVED PRO-AGING PATHWAYS AND VERY LOW
CANCER AND DIABETES INCIDENCE IN HUMANS

Chapter 2 Abstract

Growth Hormone Receptor Deficiency (GHRD) in mice causes life span
extension and a major increase in the portion of animals that die without
detectable pathologies including cancer and insulin resistance. In a 22-year
monitoring of approximately one- hundred Ecuadorian GHRD subjects with
severe IGF-I deficiency we observed only a single case of non-lethal malignancy
and no cases of diabetes compared to the expected incidence for these diseases
in first to fourth degree relatives. To understand the mechanisms responsible for
low disease incidence we incubated Human Mammary Epithelial Cells (HMEC)
with serum from either GHRD or control subjects. GHRD serum not only
protected mammary cells against hydrogen peroxide-dependent DNA damage
but also promoted the apoptosis of severely damaged cells by a mechanism
blocked by IGF-I. The gene expression profile in epithelial cells exposed to
GHRD serum pointed to the down-regulation of Ras, PKA, and TOR, and up-
regulation of FOXO-regulated genes including SOD2, all changes implicated in
cellular protection and life span regulation in yeast and mice. These results
provide evidence for a role of reduced expression of conserved pro-aging genes
regulated by GH and IGF-I in promoting healthy aging in humans.
13
Chapter 2 Introduction

Growth Hormone (GH) signaling proceeds mainly via IGF-1 and is
important for somatic growth and tissue development early in life (Bartke 2005).
While it is known that natural age-related declines in GH secretion can cause a
decrease in lean body mass, increased adiposity and thinning of skin in humans
(Rudman, Feller et al. 1990), mutations in genes involved in this pathway have,
on the other hand, also been associated with extended lifespan, stress
resistance and protection from diseases in several organisms (Kenyon, Chang et
al. 1993; Brown-Borg, Borg et al. 1996; Clancy, Gems et al. 2001; Tatar,
Kopelman et al. 2001; Coschigano, Holland et al. 2003; Longo 2003). We and
others have extensively characterized Sch9 and Ras2, the yeast homologs of
mammalian Akt/S6K and Ras respectively. We have demonstrated that
inactivation of the Ras/cAMP/PKA pathway in S. cerevisiae increases longevity
as well as resistance to oxidative and thermal stress in part by activating
transcription factors Msn2 and Msn4 which can then induce the expression of
several stress response genes such as catalase, heat shock proteins and DDR2
(Fabrizio, Pozza et al. 2001; Fabrizio, Liou et al. 2003). Yeast Sch9 mutants also
require Rim15 and Gis1 for lifespan extension and stress resistance (Wei,
Fabrizio et al. 2009). Lifespan extension in worms with reduced Insulin IGF-1
signaling (IIS) requires daf-16, the homolog of mammalian FOXO (Kenyon,
Chang et al. 1993). Daf-16 in worms regulates stress response, antimicrobial
activity and protection from free radicals (Cohen, Paulsson et al. 2009).
14
A deficiency in juvenile hormone because of InR mutations in Drosophila
generates dwarf flies with up to 85% increase in longevity and mutations in the
InR substrate, chico, also result in extended lifespan (Clancy, Gems et al. 2001;
Tatar, Kopelman et al. 2001). Similarly, mutant mice that have reduced GH and
IGF-1 signaling such as the Snell dwarf, the Ames dwarf mice and the GHR/BP
KO mice have a reduced body size and extended lifespan (Brown-Borg, Borg et
al. 1996; Flurkey, Papaconstantinou et al. 2002; Coschigano, Holland et al.
2003). It is well documented that genome alterations increase with age and can
contribute to tumorigenesis (Hasty, Campisi et al. 2003; Vijg and Dolle 2007).
Therefore, given the pro-growth and anti-apoptotic role of the GH/IGF-1 axis and
the fact that cancer is a major age-related disease, this suggests that the same
genes that promote aging might be involved in increasing genomic instability and
carcinogenesis. Infact, activating mutations in the two main downstream
signaling genes Ras and Akt, or in the IGF-1 receptor are frequently detected in
many human cancers (Rodriguez-Viciana, Tetsu et al. 2005; Toker and Yoeli-
Lerner 2006). It has also been shown that the long lived Ames dwarf mice which
have reduced IGF-1 signaling and recently, the GHR/BP KO mice, exhibit a
delayed occurrence of neoplastic disease compared to their wild type littermates
(Ikeno, Bronson et al. 2003; Ikeno, Hubbard et al. 2009).
There are several possible mechanisms by which IGF-1 pathway signaling could
contribute to cancer in humans. This could be due to a direct increase in
oxidative damage to DNA by downregulation of SODs and stress resistance
15
transcription factors such as the FOXOs. We have observed that yeast lacking
SODs have a high frequency of mutations and increased DNA damage
(Longo, Liou et al. 1999; Fabrizio, Battistella et al. 2004). In addition, neoplasias
are observed in mice with reduced SODs (Van Remmen, Ikeno et al. 2003;
Busuttil, Garcia et al. 2005). Secondly, the anti-apoptotic role of this pathway can
promote cancer by allowing cells that have heavily damaged genomes to survive
(Pollak 2004). Hepatocytes derived from Ames dwarf mice when treated with
hydrogen peroxide, undergo apoptosis more readily than those derived from
controls. This highlights the important role played by apoptosis in eliminating
damaged cells and delaying the occurrence of cancer in these mice (Kennedy,
Rakoczy et al. 2003). The GH/IGF-1 pathway may also contribute to genomic
instability and cancer by promoting error prone DNA repair. In yeast, error prone
repair mediates age dependent genomic instability in multiple genetic
backgrounds and a recent study suggests that, in mammals, OGG-1 can cause
CAG trinucleotide expansion in somatic cells (Kovtun, Liu et al. 2007; Madia,
Gattazzo et al. 2008; Madia, Wei et al. 2009).
There have been some studies indicating an association between
GH/IGF-1 signaling and aging and cancer in humans. A study by Suh Y et al has
shown that heterozygous mutations in the IGF-1 receptor are overrepresented in
centenarians and conversely high IGF-1 levels have been associated with an
increased risk of cancer over 40 (Suh, Atzmon et al. 2008). High cancer
incidence is observed in acromegalics who have high levels of IGF-1 (Colao,
Ferone et al. 2004; Renehan, Zwahlen et al. 2004). A preliminary report by Laron
16
et al indicates that patients with primary IGF-1 deficiencies could be protected
against cancer (Shevah and Laron 2007). Severe IGF-1 deficiency is seen in
GHRD Laron Syndrome individuals. Laron Syndrome is a rare human autosomal
recessive disorder caused by point mutations in the Growth Hormone Receptor
(GHR) gene. It was first described by Laron et al as a growth disorder with
clinical features characteristic of isolated Growth Hormone (GH) deficiency,
however, patients exhibit high levels of circulating GH (Laron, Pertzelan et al.
1966). Guevara-Aguirre et al have previously described a large population of
these patients (about 1/3 of total known patients) initially in the Loja province and
subsequently in the neighboring El-Oro province in southern Ecuador
(Rosenbloom, Guevara Aguirre et al. 1990; Guevara-Aguirre, Rosenbloom et al.
1993).
Striking clinical features in the GHRD subjects include severe short
stature, overweight and obesity starting in childhood. Although GHRD may be
apparent at birth based on characteristic clinical features such as frontal
prominence, depressed nasal bridge, sparse hair growth and small hands and
feet most newborns are within the normal birth weight and length range.
However, growth retardation begins soon after birth with absence of the pubertal
growth spurt in either sex and delayed puberty in 50% of affected individuals
(Bachrach, Marcus et al. 1998). Additionally, GHRD subjects exhibit upper to
lower body segment disproportion where adults have childlike body proportions
and reduced arm span (Rosenfeld, Rosenbloom et al. 1994). This feature is an
17
important consideration when analyzing overweight versus obesity in these
subjects and will be discussed later.
Although, patients exhibit unresponsiveness to administered GH, a high
level of structurally and functionally normal GH is present in the serum (Najjar,
Khachadurian et al. 1971; Eshet, Peleg et al. 1985; Spadoni, Cianfarani et al.
1988). In fact, children with GHRD from the Ecuadorian cohort can have random
GH levels that may be as high as 200ug/L and both children and adults
demonstrate hyper-responsiveness to GH stimulation with agents such as
clonidine or arginine; however, maintain intact the IGF1 mediated feedback
mechanisms on the hypothalamus and the pituitary gland (Vaccarello, Diamond
et al. 1993).
The GH binding protein (GHBP) is a cleavage product of the Growth
Hormone receptor and exhibits decreased activity in most cases as majority of
the mutations are found in the extracellular region of the GHR gene, which
corresponds to the amino acid sequence of the GHBP. Serum IGF-1
concentrations are profoundly reduced in GHRD subjects and are much lower in
prepubertal patients (less than 10ng/ml) compared with adults (less than
100ng/ml) possibly due to sex steroid mediated IGF-1 production in adults
(Rosenbloom, Guevara-Aguirre et al. 1999). IGFBP-3, the major IGF-1 binding
protein whose production is regulated by GH and ALS (acid Labile Subunit)
which forms a ternary complex with IGF-1 and IGFBP-3 and whose synthesis is
also GH dependent are also markedly reduced in the serum of GHRD subjects
(Fielder, Guevara-Aguirre et al. 1992; Gargosky, Wilson et al. 1993).
18
The GHR consists of an extracellular domain that binds GH, a single
transmembrane domain and a cytoplasmic domain (Leung, Spencer et al. 1987).
Like other tyrosine kinase receptors, dimerization of the GHR is required in order
for it to be fully functional (de Vos, Ultsch et al. 1992).
Several mutations in the GHR have been described in different
populations (Berg, Argente et al. 1993; Rosenbloom and Guevara-Aguirre 1998).
Of these, the Ecuadorian GHRD cohort is genetically homogenous in
predominantly having an A to G splice site mutation resulting in a truncated
protein missing eight amino acids in the extracellular domain. Designated the
E180 splice mutation it has been found in all but one Ecuadorian GHRD subjects
(Berg, Guevara-Aguirre et al. 1992).
In this study, we have tested the hypothesis that reduced GH/IGF-1
signaling in a Growth Hormone Receptor Deficient population can protect against
cancer and other diseases. Our studies suggest that inhibition of GH/IGF-I
signaling in adults can extend the healthy life span in humans as has been
demonstrated in mice and lower eukaryotes.

19
Chapter 2 Materials and Methods

Subject Recruitment and Sample Collection
GHRD and Control subjects were recruited for the study under protocols
approved by the IEMYR. GHRD subjects were identified based on clinical
observations. All subjects signed informed consent forms indicating their
agreement to participate in the study. Data on deceased GHRD subjects was
collected by interviewing family member using a detailed questionnaire. Atleast
two family members were required to be present at the time of the interview.
Genotyping
Saliva samples were collected using the Oragene OG-250 DNA collection
kit (DNA Genotek Inc., Ontario, Canada). DNA extraction from saliva was
performed according to the manufacturer’s protocol. DNA samples were
genotyped for the E180 mutation using the following primers.
cattgccctcaactggactt Forward
cattttccatttagtttcatttact Reverse (WT)
cattttccatttagtttcatttac Reverse (mutant)
Serum Analysis
IGF-I, IGF-II and IGFBP-I levels in serum from GHRD/Control subjects
was measured using an in-house ELISA based assay developed at UCLA.
Cell Culture
Primary Human Mammalian Epithelial Cells (HMECs) were purchased
from ScienCell Research Laboratories (Carlsbad, CA). Cells were cultured in
20
HMEC medium (ScienCell) at 37
o
C and 5% CO
2
in Poly-L-Lysine coated culture
dishes (Sigma). Primary MEF’s (ATCC) were cultured in DMEM/ F12 + 15% FBS
at 37
o
C and 5% CO
2.
R+ and R- cells were obtained from Dr. Baserga and
cultured in DMEM/F12 + 10% FBS.
Comet Assay
Comet assay was performed according to the method described by Olive
et al (Olive and Banath 2006). 40,000 HMECs R cells were seeded per well in
24 plates in HMEC medium. 48 hours later, cells were treated with 15% GHRD/
Control serum for 6 hours in HMEC basal medium followed by treatment with
Hydrogen Peroxide for 1 or 24 hours and collected for the comet assay. Briefly,
cells were washed with ice cold PBS and mixed with LMA agarose and allowed
to gel on glass slides (Trevigen Inc, Gaithersburg, MD). The slides were
sequentially immersed in pre-chilled lysis solution (Trevigen, 40min, 4°C),
alkaline solution (30min, room temperature) and TBE buffer (5min, twice) and
then electrophoresed in TBE buffer (1 volt/cm, for 10 minutes). Slides were
allowed to dry overnight, stained with 1X SYBR
®
and imaged using flourescence
microscopy. DNA damage was quantified/ cell using the Comet Score TM
software. 100-200 cells were counted per sample.
LDH assay
8,000 HMECs/MEF’s were seeded/well in 96 well plates for 48 hours. LDH
activity was assayed in culture supernatant using the Cytotox non-radioactive
assay kit from Promega.
21
Untreated 100% lysis and spontaneous LDH release controls were included in
each experiment. Where possible medium used for LDH assays was devoid of
phenol red or medium only controls were included in the experiment to normalize
for medium background absorbance.
MTT Assay
8,000 HMECs/MEF’s were seeded/well in 96 well plates for 48 hours.
MTT reduction was assayed using MTT obtained from Sigma. 5mg/ml MTT was
diluted 1:10 in low serum medium and added to cells at the end of each
treatment. Cells were incubated in this medium for 2-4 hours until MTT crystals
were visible under the microscope. Cells were lysed using buffer containing DMF
and Acetic acid overnight and MTT reduction was quantified.
Apoptosis Assay
40,000 cells were seeded/well in 24 well plates for 48 hours. Cells were
treated with GHRD/Control serum followed by Hydrogen Peroxide treatment for 1
hour. Cells were collected and processed for plate reader apoptosis assay using
the Fluorescein CaspaTag
TM
Pan-Caspase Assay Kit (Chemicon). For
microscopic analysis cells were directly grown on 8 chamber slides and treated
as above before staining for activated caspases.

22
FoxO Luciferase Activity Assay
50,000 cells/well were transfected with 0.2ug of plasmid DNA containing
the consensus Foxo binding sequence driving firefly luciferase gene expression
and co-transfected with 0.02ug plasmid DNA encoding Renilla luciferase. 24
hours after transfection, dual luciferase assays were performed using the Dual-
Luciferase
®
Reporter Assay System from Promega according to instructions.
Western Blot Analysis
Cells were lysed in RIPA buffer and total protein was assayed using BCA
(Pierce). 15 µg of protein was loaded on denaturing 10% SDS-PAGE gels.
Primary antibodies against phospho and total Akt as well as phospho and total
FoxO1 were obtained from Cell Signaling Technologies (Boston, MA). β tubulin
was obtained from Santa Cruz Biotechnology Inc. (Santa Cruz, CA). Secondary
rabbit antibody was obtained from Jackson Immunoresearch Laboratories, Inc.
(West Grove, PA).
Microarray Analysis
RNA was extracted using TRI Reagent® (Ambion) according to protocol
and hybridized to BD-103-0603 chips from Illumina Beadchips. Raw data were
subjected to Z normalization as described previously (Cheadle, Cho-Chung et al.
2003) and are available at
http://www.ncbi.nlm.nih.gov/geo/query/acc.cgi?acc=GSE21980.

23
Gene set enrichment was tested using the PAGE method as previously
described (Kim and Volsky 2005). Figures were selected based on the names
and descriptions provided by Ingenuity Pathways Analysis (Ingenuity Systems;
Redwood City, CA) and/or Ariadne Pathway Studio 7 (Ariadne Genomics).
Yeast Strains and Assays
Wild type DBY746 (MAT,leu2-3,112,his31,trp1-289,ura3-52,GAL
+
) and
its derivative ras2::LEU2tor1::HIS3sch9::URA3, originated by one-step gene
replacement according to Brachmann et al. (Brachmann, Davies et al. 1998),
were grown in SDC containing 2% glucose and supplemented with amino acids,
adenine and uracil as described (Kaiser, S. et al. 1994) as well as a 4-fold
excess of the supplements tryptophan, leucine, uracil, and histidine.
Chronological life span in SDC medium was monitored by measuring colony
forming-units (CFUs), on YPD plates, every two to four days. The number of
CFUs on day 1 was considered to be the initial survival (100%) and was used to
determine the age-dependent mortality (Fabrizio and Longo 2003). Spontaneous
mutation frequency was evaluated by measuring the frequency of mutations of
the CAN1 (YEL063) gene. The Can
r
mutator phenotype can be conferred by any
mutations that block the expression of the CAN1 gene. Cells were plated onto
selective SDC-Arginine plates in the presence of L-canavanine sulfate [60ng/mL];
mutation frequency was expressed as the ratio of Can
r
colonies over total viable
cells (Madia, Gattazzo et al. 2007).
24
Resistance to oxidative stress was also evaluated in yeast cultures chronically
treated with 1 mM H
2
O
2
on days 1 and 3. Percent of survival and induced- Can1
mutation frequency were measured as described above.
Statistical Analysis
Comet data, LDH and Apoptosis data were analyzed using a 2 way
ANOVA while FOXO luciferase activity data and R-/R+ Comet data was analyzed
using a two-tailed student’s t test.

25
Chapter 2 Results

Based on the life span extension and protective effects of mutations in
GH/IGF-I signaling or analogous pathways in simple organisms, we hypothesized
that the severely reduced IGF-I levels in GHRD individuals could protect them
against disease by a mechanism that involves increased stress resistance and
delayed or reduced DNA damage (Fabrizio, Pozza et al. 2001; Longo and Finch
2003; Bartke 2005; Garcia, Busuttil et al. 2008).
Description of the Study Group
The Ecuadorian cohort in our study includes 99 GHRD subjects ranging in
age from 9 months-86 years that have been followed since 1988 (Fig. 2.1). Of
these, 9 subjects have died during the course of this study. In addition, data on
deceased GHRD subjects that died before 1988 was collected based on
interviews and questionnaires with their families. Using this approach we
obtained information on an additional 62-deceased GHRD subjects, 35 of who
are under the age of twenty. The control population consists of more than 1500
first, second, third and fourth degree unaffected and age-matched relatives of
GHRD subjects.

26
<10 10-20 20-30 30-40 40-50 50-60 60-70 70-80 80-90
0
5
10
15
20
Age (years)
Alive GHRD subjects

Figure 2.1 Age distribution of alive GHRD subjects.

Genotype of the GHRD subjects
In addition to their short stature and family history, GHRD subjects
participating in the study were identified based on genotype and
clinical/biochemical phenotype. The GHR gene consists of an extracellular
domain that binds GH, a single transmembrane domain and a cytoplasmic
domain (Leung, Spencer et al. 1987). Several mutations in the GHR, leading to
GHRD have been described in different populations, most of which lie in the
extracellular region (Berg, Argente et al. 1993; Rosenbloom and Guevara-Aguirre
1998). The great majority of Ecuadorian GHRD subjects (87%) in our study are
homozygous for an A to G transition at position 180 in exon 6 of the GHR gene
(Fig. 2.2). Termed the E180 mutation, this transition creates a splice site variant
of the transcribed gene without a change in the amino acid encoded.
27
The splice site appears to be preferentially used and is located 24 amino acids
upstream of the regular splice site. Consequently, the mutant protein lacks 8
amino acids in its extracellular domain, is possibly misfolded and degraded and
leads to GHR deficiency (Berg, Guevara-Aguirre et al. 1992).

C AATA C AAAG AGGT A AATGA AAC TAA AT GGAA AAT Ggtaa ga- -- -Intron
( Siteof A to G S ubstitution a t codon 180 of t he GHR ge ne )
E V N E T K W K M (G H R)
180 184 188
C AATA C AAAG AGGT A AATGA AAC TAA AT GGAA AAT Ggtaa ga- -- -Intron
( Siteof A to G S ubstitution a t codon 180 of t he GHR ge ne )
E V N E T K W K M (G H R)
180 184 188

Figure 2.2 E180 mutation in the GHR gene.

The only other mutation that has been found in this population is termed
R43X. This mutation leads to substitution of Arginine (CGA) with a stop codon
(TGA) at codon 43 in Exon 4 (Amselem, Sobrier et al. 1991). Two GHRD
subjects in this cohort are heterozygous for the E180/R43X mutation while two
subjects are homozygous for the R43X mutation.
Table 2.1 represents the current genotype data of the 99 GHRDs in our
study group. Individuals whose genotype has not been confirmed are listed as
being identified based on clinical/biochemical phenotype only.
The genotype of the additional 62 deceased GHRD subjects was inferred based
on clinical phenotype and pedigree information provided by their relatives and is
not included in table 2.1.
28
As mentioned earlier, the Ecuadorian GHRD cohort is the largest GHRD
cohort in the world. It is obvious from genotype data that this population is also
highly homogenous with respect to the mutation. This is possibly the because of
a “founder effect” as a result of the mutation being introduced in this population
by Spanish settlers. The same mutation has also been found in an Israeli subject
of Moroccan heritage (Berg, Peoples et al. 1994).

Genotype E180/E180 E180/R43X E180/? R43X/R43X Undetermined
Number 81 2 1 2 13

Table 2.1 Genotype of the GHRD cohort.
The E180 splice site mutation is the predominant genotype in this population,
seen in 87% of affected individuals.

Biochemical Characterization of GHRD serum
GHRD subjects exhibit clinical features that are typical of isolated GH
deficiency but are biochemically different in that they usually have normal or, in
the case of prepubertal children, elevated GH levels which can be as high as
200 ηg/ml. Normal diurnal variation in levels as well as hyper-responsiveness to
stimulation with glucose is also observed in these individuals (Fielder, Guevara-
Aguirre et al. 1992; Gargosky, Wilson et al. 1993; Rosenfeld, Rosenbloom et al.
1994). However, patients typically have extremely low levels of serum IGF-I and
IGF-II (Guevara-Aguirre, Rosenbloom et al. 1993).
We used an ELISA based assay to measure the levels of IGF-I, IGF-II and
IGFBP-1 in 16 GHRD and 13 control subjects (Fig. 2.3). Serum IGF-I were
29
< 20ng/ml in GHRD subjects compared to controls. Significantly lower levels of
IGF-II were also observed in the GHRD subjects. We did not however observe
any difference in IGFBP-1 levels from GHRD subjects and controls despite
reports that IGFBP-1 levels are usually elevated in patients with growth hormone
deficiencies (Rosenbloom, Guevara-Aguirre et al. 1999).

0
200
400
600
800
IGF-I IGF-II IGFBP-1
CONTROL
GHRD
ηg/ml

Figure 2.3 Characterization of serum IGF-I, IGF-II and IGFBP-1 in GHRD and
control subjects.
Serum concentrations of IGF-I, IGF-II and IGFBP-1 were measured using and
ELISA based assay. Data represent mean from 13 control serum samples and
16 GHRD serum samples.

Diseases in the GHRD and Controls
We compared cancer mortality between the GHRD and Control relatives.
This table includes deceased GHRD subjects from the original study population
and also incorporates data on 21 deceased GHRD subjects from the same age
30
group that died before our study began in 1988. This additional mortality data
was collected by interviews with family and/or village members using a
questionnaire. As evident from table 2.2, we observed a completed lack of
cancer related mortality in any age group in the GHRD population.

Total Cancer (%) Total Cancer
10‐30 yr 25 5 (20) 5 0
30‐50 yr 89 19 (21.3) 12 0
50‐70 yr 168 43 (25.6) 12 0
70‐100 yr 288 47 (16.3) 1 0
Relatives GHRD subjects

Table 2.2 Cancer Mortality in Control and GHRD subjects.
Numbers in bracket represent number of deaths due to cancer in that age group.

A preliminary report on the development of malignancies in IGF-I
deficient subjects was previously published by Shevah and Laron (Shevah and
Laron 2007). However, in this report the mean age of the IGF-I deficient subjects
described was 20.1 compared to a mean age of 52 for control relatives.
As cancer prevalence is very low in young individuals, these results represented
a very preliminary investigation of the effect of IGF-I deficiency in cancer. Our
data from age-matched GHRD and unaffected relative controls is in agreement
with that of Shevah and Laron and suggests that GHRD causes a major
reduction in cancer and diabetes incidence.
31
The types of cancers that accounted for mortality in the control population
are shown in Fig 2.4. Stomach cancer, which is know to be highly prevalent in
the Ecuador population, was the most prevalent type of cancer that we observed.
0 10 20 30
Bladder
Gall bladder
Spinal
Duodenal
Hodgkins
Mouth
Esophagus
Pancreatic
Bone
Skin
Breast
Leukemia
Cerebral
Colon
Liver
Throat
Lung
Prostate
Uterine
Stomach
%

Figure 2.4 Types of Cancers that cause mortality in the Control subjects.

Major causes of death in the Control and GHRD population age 10 and
above are shown in Fig. 2.5 A and B. While cancer represents a major cause of
mortality (20%) in the controls, both cancer and diabetes related mortality is
strikingly absent from the GHRD population.

32
While the percentage of cardiac disease related death may be somewhat higher
in the GHRDs compared to controls, the mortality due to vascular diseases
(combining cardiac + stroke) appears to be the same or slightly higher in the
controls, implying that GHRD may increase susceptibility to cardiac diseases
while reducing that to stroke.
On the other hand, accident, convulsive disorder and alcohol-related deaths are
much more frequent in the GHRDs.
A
B

Figure 2.5 Leading causes of Mortality in Control and GHRD subjects
(A) Control (B) GHRD
33
Fig. 2.6 A represents cancer and diabetes in GHRD and controls as a
percentage of all diseases. To date, only one GHRD subject has been diagnosed
with cancer. Following the diagnosis of papillary serous cancer, an epithelial
tumor of the ovary, she was treated with surgery and chemotherapy with
Carboplatinum + Paclitaxel in 2006. She is currently alive and cancer free. In
contrast, cancer represented approximately 17% of all diseases in the control
subjects aged 10 and above (Fig. 2.6 A). Additionally, no case of diabetes has
been diagnosed in the GHRD population aged 20-80 years whereas diabetes
represents about 6% of all diseases in the controls (Fig.2.6A).
We observed a 21% prevalence of obesity in the GHRD cohort (Age 15-
100 years) based on WHO standards of BMI> 30 kg/m
2
compared with 13.4%
prevalence for the Ecuadorian population (source-WHO, age 15-100 years). It is
intriguing that despite the high level of obesity not a single case of type 2
diabetes has been diagnosed in the GHRD population compared with a
prevalence of 5.5% in Ecuador (Fig 2.6 A, B).

34
Cancer Diabetes
0
10
20
30
Control
GHRD
# ^
% of diseases
Obesity Diabetes
0
10
20
30
Ecuador
GHRD
# Prevalence (%)
AB

Figure 2.6 Cancer and Diabetes in the GHRD population.
(A) Cancer and Diabetes as a percentage of diseases in control and GHRD
subjects (B) Obesity and Diabetes prevalence in GHRD compared with obesity
and diabetes in the Ecuadorian population (based on WHO data)
^ only 1 case diagnosed, # 0 cases diagnosed.

The obesity reported is based on WHO standards for obesity
determination. Based on WHO standard for overweight, we observed about 21%
overweight in the GHRD population (BMI between 25-30kg/M
2
). However, it is
important to note that Ecuadorian GHRD subjects, especially adults have
disproportionate body ratios and it is likely that applying WHO standards would
underestimate obesity in this population. Nevertheless, considering the strong
link between obesity and diabetes, it is interesting to note the complete absence
of the disease in this population.

Effect of GHRD/control serum on DNA damage
The role of IGF-I in tumor development and progression has been
attributed to increased cell growth and decreased apoptosis in damaged and pre-
35
cancerous cells (Pollak 2004). Our studies in S. cerevisiae indicate that
homologs of IGF-I signaling genes including S6K, promote age-dependent DNA
mutations analogous to those detected in cancer cells by increasing superoxide
production and promoting DNA damage independently of cell growth (Longo,
Lieber et al. 2008; Madia, Gattazzo et al. 2008; Madia, Wei et al. 2009). Also, in
GHRD mice, the frequency of age-dependent mutations is reduced, raising the
possibility that IGF-I promotes cancer not only by preventing apoptosis of
damaged cells but also by increasing mutations in both dividing and non-dividing
cells (Garcia, Busuttil et al. 2008).
To test the hypothesis that the low IGF-1 levels in GHRD serum can
protect against oxidative DNA damage, we grew primary non-cancerous Human
Mammary Epithelial Cells (HMEC) in medium supplemented with serum from
GHRD or control subjects and treated them with 700 μM hydrogen peroxide for 1
hour or for 24 hours. 6 serum samples were independently tested for each group.
Following treatment, cells were lysed and subjected to the Single Cell
Electrophoresis / Comet Assay which measures DNA damage in individual cells.
Fig. 2.7 (A) represents the olive tail moment of cells grown either in GHRD serum
or Control serum and untreated / treated with hydrogen peroxide for 1 hour. Olive
tail moment is a product of tail length and fraction of DNA in the tail and is the
most accurate parameter of DNA damage using this assay (Olive and Banath
2006). Under alkaline lysis conditions, this assay detects both single and double
strand breaks in the DNA. Cells incubated in GHRD serum were significantly
protected against DNA damage when treated with 700 μM as opposed to cells
36
grown in control serum (Fig 2.7 A). This is also obvious in the representative
pictures shown in fig 2.7B and C. Only cell treated with 700 μM H
2
O
2
are shown
in the pictures. Significantly longer tails with much of the DNA migrating into the
tail were seen in the cells grown in control serum (fig 2.7B). On the other hand
cells grown in GHRD serum had shorter tails with less DNA in the tail (Fig. 2.7
C).
0 100 700
0
20
40
60
80
100
GHRD
Control
***
hydrogen peroxide(uM)
Tail Olive Moment
A.
B. C.
0 100 700
0
20
40
60
80
100
GHRD
Control
***
hydrogen peroxide(uM)
Tail Olive Moment
A.
B. C.

Figure 2.7 DNA damage in Human Mammary Epithelial Cells (HMEC) 1 hour
after treatment with H
2
O
2
.
(A) DNA damage represented as tail olive moment. (B, C) Representative
pictures of GHRD serum (B) or Control serum (C) grown cells treated with 700 μM
H
2
O
2.
Data represent mean ± SEM. ***p < 0.0001

37
GHRD cells were protected even after a 24 hour 700 μM H
2
O
2
treatment
compared with control cells (Fig 2.8A). As seen in the representative pictures,
several damaged cells were seen in the Control serum group (Fig. 2.8B) versus
the GHRD serum group (Fig. 2.8C).
The difference in DNA damage levels at 24 hours between GHRD and
Control serum treated cells could be due to repair of DNA damage in these cells
by 24 hours or due to apoptosis of heavily damaged cells by 24 hours.
0 100 700
0
20
40
60
80
100
GHRD
Control
*
hydrogen peroxide (uM)
Tail Olive Moment
A.
B.
C.
0 100 700
0
20
40
60
80
100
GHRD
Control
*
hydrogen peroxide (uM)
Tail Olive Moment
A.
B.
C.

Figure 2.8 DNA damage in Human Mammary Epithelial Cells (HMEC) 24
hours after treatment with H
2
O
2
.
(A) DNA damage represented as tail olive moment. (B, C) Representative
pictures of GHRD serum (B) or Control serum (C) grown cells treated with 700 μM
H
2
O
2.
Data represent mean ± SEM. * p< 0.05

38
Effect of GHRD/control serum on apoptosis
Cellular apoptosis in response to DNA damage is an important means of
protection against the accumulation of mutations and possibly cancer (Pollak
2004).
In order to test if GHRD serum could sensitize cells to apoptosis in
response to oxidative stress and if this effect is dependent on reduced IGF-1
signaling, we performed LDH assays on HMEC grown in medium supplemented
with Control serum, GHRD serum or GHRD serum+ 200ng/ml IGF-I and treated
with a low (100 μM) or high (700 μM) concentration of H
2
O
2
for 24 hours. Normal
IGF-I levels in Ecuadorian human adults vary between 96-270 ηg/ml with no
significant difference between males and females (Guevara-Aguirre,
Rosenbloom et al. 1993) (Fig 2.3). Fig. 2.9 represents LDH activity in culture
medium after 24 hours of treatment. Cells incubated with GHRD serum appeared
to be slightly better protected when treated with 100 μM H
2
O
2
compared with
GHRD+IGF-1 or Control serum. However, at 700 μM H
2
O
2
, the GHRD serum
cells, exhibited higher LDH activity implying higher cytotoxicity compared with
control serum. A complete reversal of cytotoxicity was seen when cells were
instead grown in medium supplemented with GHRD serum + 200ng/ml IGF-I
prior to 700 μM H
2
O
2
treatments (Fig. 2.9A). Similar results were obtained when
we measured survival rather than cytotoxicity using the MTT assay (Fig. 2.9B)
We also tested our hypothesis in primary MEF cells. LDH activity in MEFs
was higher than what we observed in HMECs. This may be due to differences in
cell type. However, in this case as well, H
2
O
2
treatment resulted in higher
39
cytotoxicity in cells that were incubated in GHRD serum rather than control
serum (Fig. 2.9C). These data imply that the IGF-1 in control serum inhibits the
death of highly damaged cells that have accumulated DNA damage.
100 700
0
20
40
60
80
100
120
GHRD
GHRD+IGF-I
CONTROL
**
*
hydrogen peroxide(μM)
Survival (% of Control)
100 700
0
2
4
6
8
10
12
GHRD
Control
GHRD+IGF-1
**
*
hydrogen peroxide (μM)
Cytotoxicity (% of control)
700 1000
0
20
40
60
80
GHRD
Control
***
**
hydrogen peroxide(μM)
Cytotoxicity (% of control)
A.
B.
C.

Figure 2.9 IGF-1 prevents death in damaged cells.
(A) LDH release in response to H
2
O
2
treatment was used to assess cytotoxicity
under conditions of growth in medium containing control serum, GHRD serum or
GHRD serum+IGF-1 in HMECs. (B) MTT reduction in response to H
2
O
2
treatment was used to assess cell survival under conditions of growth in medium
containing control serum, GHRD serum or GHRD serum+IGF-1 in HMECs. (C)
LDH release in response to H
2
O
2
treatment was used to assess cytotoxicity
under conditions of growth in medium containing control serum or GHRD serum
in Mouse Embryonic Fibroblast cells. Data represent mean ± SEM. * p< 0.05, **
p<0.001

40
We hypothesized that this protection offered by IGF-1 in control serum
was due to its known role in promoting growth rather than apoptosis. In order to
test for apoptosis induction we treated HMECs as before with 100 μM or 700 μM
H
2
O
2
for 1 hour following pre-incubation with GHRD/control serum and measured
caspase activation in these cells. The IGF-1 pathway can inhibit apoptosis by
downregulation of caspase activity (Cardone, Roy et al. 1998; Panka, Mano et al.
2001). We used a cell permeable, irreversible general caspase inhibitor, Z-VAD-
FMK which can bind to activated caspase dimers and prevent their further action.
As the Z-VAD- FMK molecule is also conjugated to a flourophore, it allowed
visualization of caspase activation by microscopy. Pre-incubation with GHRD
serum efficiently induced apoptosis in cells treated with H
2
O
2
at both 100 μM and
700 μM and results are shown in Fig 2.10. This effect was only in response to
H
2
O
2
treatment as basal caspase activation in the cells was very low and not
different between GHRD and control serum incubated, untreated cells.
Taken together these data indicate that the low IGF-1 level in GHRD
serum plays a remarkable dual anti-cancer role by protecting cells against DNA
damage but also by promoting the clearance of highly damaged and possibly
pre-cancerous cells by apoptosis. In fact, DNA breaks were greatly reduced in
H
2
O
2
stressed GHRD-pre-incubated cells at 24 hours vs. 1 hour, indicating that
either the damage was repaired or, more likely, that the damaged cells
underwent apoptosis.

41

CONTROL CONTROL GHRD GHRD
100µm 700µm
A.
B.
100 700
0
20
40
60
80
GHRD
Control
*
hydrogen peroxide (μM)
% Caspase positive cells

Figure 2.10 Induction of Apoptosis in Human Mammary Epithelial Cells
(HMEC) treated with H
2
O
2.

Caspase activation was measured in HMECs treated with H
2
O
2
using a
fluorescein conjugated Z-VAD-FMK cell permeable pan-caspase inhibitor. (A)
Activated pan- caspases were measured by increase in fluorescence of Z-VAD-
FMK. Data are represented as % of control. * p< 0.05 (B) Representative pictures
of caspase activation in HMECs after H
2
O
2
treatment.

42
Role of IGF-1 signaling

To further elucidate IGF-I involvement in DNA damage we used MEFs
derived from IGF-I receptor knockout mice (R-) or MEFs engineered to express
overexpress IGF-1 receptors (R+) as models to test DNA damage under
conditions of very low or very high IGF-1 signaling respectively (Sell, Rubini et al.
1993; Romano, Prisco et al. 1999). These cells were kindly provided to us by Dr.
Baserga (Thomas Jefferson University). A higher level of DNA damage was
seen in R+ cells versus R- cells (Fig. 2.11 A).
Akt is a major mediator of IGF-1 signaling in cells and is phosphorylated in
response to IGF-1R activation. Akt can phosphorylate and inactivate FOXO
transcription factors by excluding them from the nucleus. The FOXO transcription
factors are known to mediate stress resistance and extended lifespan under
conditions of attenuated IGF-1 signaling (Kenyon, Chang et al. 1993; Brunet,
Bonni et al. 1999; Kops, Dansen et al. 2002). When in the nucleus, the FOXO
factors can activate transcription of antioxidant genes such as MnSOD and
Catalase, genes involved in DNA repair such as GADD45 as well as genes that
promote apoptosis such as the Fas ligand and the bcl-2 family members Bim and
Bcl-XL (Greer and Brunet 2005). Based on our observation that reduced IGF-1
signaling protected cells from DNA damage and induced apoptosis both in
human mammary epithelial cells and in mouse embryonic fibroblasts we were
interested to know if FOXO factors were regulated differently in R- and R+ cells.
Western blot analysis revealed that both Akt and FOXO1 are highly
phosphorylated in the R+ cells (Fig. 2.11 B). Phosphorylation by Akt, renders
43
FOXO inactive, therefore, this implies that, FOXO1 is activated in the R- cells
and inactivated in R+ cells. Activated FOXO could potentially upregulate genes
involved in protection from oxidative stress, DNA repair genes and pro-apoptotic
genes such as the BcL-2 family member Bim (Greer and Brunet 2005). The very
low levels of total FOXO1 protein in R+ cells are likely because Akt mediated
phosphorylation of FOXO1 targets it to the cytoplasm for ubiquitination and
proteasomal degradation (Huang, Regan et al. 2005).
In order to test if FOXO promoter activity was also differentially regulated
in the R- and R+ cells, we transfected them with a plasmid construct that
contains the consensus FOXO binding site and drives the expression of Firefly
luciferase . Cells were co-transfected with a Renilla luciferase construct driven by
a CMV promoter in order to normalize for transfection efficiency. As expected, we
observed higher FOXO promoter activity in the R+ cells (Fig. 2.11 C).
These results highlight the role of IGF-1 signaling in response to oxidative
stress. As the FOXO factors can mediate both protection from oxidative stress
and apoptosis, it is possible that activation of these transcription factors in cells
under conditions of low IGF-1 signaling can protect them against low-grade
oxidative stress by upregulation of SOD2, catalase etc. At the same time, when
cells are challenged with higher levels of stress and accumulate a lot of damage,
FOXO activation can lead to apoptosis.

44
pAkt
tAkt
pFOXO1
tFOXO1
ß tubulin
R- R+ R+
0
1
2
3
4
5
R-
R+
Tail Olive Moment
0
100
200
300
R-
R+
***
FOXO Promoter Activity (A.U.)
A.
B.
C.

Figure 2.11 Analysis of IGF-I signaling in IGF-1R KO (R-) and IGF-1R
overexpressing (R+) Mouse Embryonic Fibroblast (MEF) cells.
(A) Basal DNA damage measured by comet analysis (B) Representative western
blot shows higher Akt and FOXO1 phosphorylation in R+ versus R- cells implying
that Akt is highly activated and FOXO1 is inactivated in these cells. (C) FOXO
promoter activity measured by firefly luciferase reporter activity. Renilla luciferase
activity was used to normalize for transfection efficiency. Data are represented as
% of control ± SEM. *** p<0.0001

45
Microarray analysis of HMEC incubated in GHRD/control serum
To test further the mechanisms responsible for the protective effect of
GHRD serum we performed microarray analysis on HMECs grown in medium
with GHRD serum or control serum. Parametric analysis of gene set enrichment
(PAGE) to identify specific functional pathways within the microarray data was
performed according to the method described by Kim and Volsky(Kim and Volsky
2005) (Kim and Volsky 2005) followed by Ingenuity Pathways Analysis of the
data.
We observed significant gene expression changes in 66 genes between
GHRD and control serum HMEC. Of these, genes involved in stress resistance,
DNA repair and apoptosis were upregulated in HMEC incubated with GHRD
serum. Consistent with FOXO activation under conditions of low IGF-1 that we
observed in R- cells, microarray analysis of HMECs grown in GHRD or control
serum revealed upregulation of three known FOXO targets, SOD2, FBXO32 and
DDB1. In yeast, we have shown that SOD2 functions downstream of growth
signaling pathways such as Sch9 and Ras2 and is responsible for protection the
increased lifespan, protection against oxidative stress and DNA damage
(Fabrizio, Liou et al. 2003; Madia, Gattazzo et al. 2008; Madia, Wei et al. 2009).
FBXO32 is a muscle atrophy related ubiquitin ligase that is a critical regulator of
skeletal muscle size (Stitt, Drujan et al. 2004). DDB1 can interact with Cul4 to
form a complex that can regulate DNA repair, proliferation and genomic integrity
(Groisman, Polanowska et al. 2003).
46
We observed a 1.3 higher fold expression of the mitochondrial MnSOD in
GHRD serum incubated cells. MnSOD or SOD2 is directly regulated by FOXO
and functions in detoxification of superoxide radicals (Kops, Dansen et al. 2002).
We have previously shown that yeast cells lacking sch9 the homolog of
mammalian Sch9/S6K are protected against DNA damage in a SOD2 dependent
mechanism. This higher expression of SOD2 could, therefore, account for the
protective effects of attenuated IGF-1 signaling seen in R- cells and GHRD
serum HMEC. We also observed increased expression of genes involved in cell
cycle regulation and checkpoint activation such as Wee1 and ZAK in GHRD
serum treated cells. Activation of the cell cycle checkpoint and arrest allows cells
to repair damaged DNA and also prevents the replication of damaged cells. It is
therefore an important means for protection from unregulated cell division and
cancer (Campisi and d'Adda di Fagagna 2007). Upregulation of DNA damage
repair and pro-apoptotic genes such as DDB1 and RAD21 indicates that cell
cycle arrest in the GHRD serum treated cells is coupled with an attempt to repair
DNA or promote apoptosis of damaged cells.
A complete list of genes with significant expression changes is provided in
Table 2.3.

47

TARGET ID (fold change) GHRD-Control (zratio) GHRD-Control
PDK4 2.1 8.0
PIK3IP1 2.0 7.4
RAD21 1.6 6.0
UGCG 1.5 5.3
FBXO32 1.5 4.8
LOC387763 1.5 4.7
DAB2 1.4 4.4
LBH 1.4 4.1
DAB2 1.4 4.2
PTK2 1.4 4.3
MAFF 1.4 4.0
MMP10 1.4 3.8
NFKBIZ 1.4 4.1
SERINC3 1.4 4.2
WEE1 1.4 3.8
PPTC7 1.4 3.6
MMP7 1.4 3.9
MMP7 1.3 3.6
SDCBP2 1.3 3.9
SOX9 1.3 3.7
SOD2 1.3 3.6
PFKFB3 1.3 3.5
ATP2B4 1.3 3.3
DKK1 1.3 3.7
ITSN1 1.3 3.1
CTDSP2 1.3 3.0
TSC22D1 1.3 2.9
ULK1 1.3 3.1
C4ORF34 1.3 3.1
PLEKHA1 1.3 3.1
SNF1LK 1.3 2.9
RAB9A 1.3 3.0

Table 2.3 List of genes with significantly altered expression in GHRD and
Control serum grown HMECs.
Microarray analysis was performed on RNA extracted from HMEC cells
incubated with serum from either control or GHRD subjects for 6 hours. For
detailed methods see Materials and Methods section page 19.

48
Table 2.3 List of genes with significantly altered expression in GHRD and
Control serum grown HMECs (continued)

TARGET ID (fold change) GHRD-Control (zratio) GHRD-Control
ZAK 1.3 2.7
TAX1BP1 1.2 2.8
CDK6 1.2 2.6
ATP2B4 1.2 2.5
C16ORF72 1.2 2.3
AVPI1 1.2 2.3
ELF2 1.2 2.1
ATG2B 1.2 1.9
KIAA0174 1.2 2.0
IRF6 1.1 2.0
DDB1 1.1 1.9
SH3GLB1 1.1 1.8
MOCS1 -1.1 -1.6
RUNDC1 -1.1 -2.0
FOXK1 -1.1 -1.8
TUBB -1.2 -1.7
C21ORF57 -1.2 -2.2
FST -1.2 -2.2
DKC1 -1.2 -2.3
COMMD4 -1.2 -2.4
LOC728734 -1.2 -2.4
RRP12 -1.2 -2.5
PLEKHG3 -1.2 -2.2
C12ORF31 -1.2 -2.3
LLGL1 -1.2 -2.7
EXOSC6 -1.2 -2.4
FAHD1 -1.2 -2.5
VPS72 -1.2 -2.6
UBE2G2 -1.2 -2.6
ZNF562 -1.2 -2.8
KIAA0020 -1.2 -2.9
CSNK1G2 -1.2 -2.7
LOC654121 -1.3 -3.0
SH3RF2 -1.3 -3.0
HDDC2 -1.3 -2.9
LZTR1 -1.3 -3.2
HSPC159 -1.6 -5.5

49
Ingenuity Pathways Analysis (IPA) of HMECs also pointed towards
downregulation of Ras, PKA and TOR in GHRD serum treated cells (Fig. 2.12)

Figure 2.12 Ingenuity Pathway Analysis of microarray data shows the down
regulation of Ras, PKA and Tor in HMEC cells grown in GHRD serum.
Red = upregulation, blue = Downregulation
50
Based on microarray data and pathway information obtained from IPA we
performed RT-PCR analysis to analyze expression levels of Tor/S6K, Ras and
PKA. PCR analysis confirmed the 1.3 fold higher expression of mitochondrial
MnSOD (SOD2) in the GHRD group compared with the control group. Further,
we saw an approximately 70% reduction in N-Ras expression, 50% reduction in
PKA and 20% reduction in the expression of Tor (Fig. 2.13).

SOD2 N Ras PKA TOR
0.0
0.5
1.0
1.5
CONTROL
GHRD
Fold Change (relative to control)

Figure 2.13 RT-PCR analysis reveals reduced expression of major growth
factor signaling genes in HMEC cells grown in GHRD serum.
RT-PCR analysis was performed on RNA extracted from HMEC incubated with
serum from control or GHRD subjects. Amplification of SOD2, N-Ras , PKA and
TOR was done to confirm microarray data.

These results are particularly interesting because Tor/S6K, and Ras-PKA
are perhaps the most important pro-aging genes and SOD2 one of the most
important anti-aging genes that we and others identified in S. cerevisiae
(Fabrizio, Liou et al. 2003; Hlavata and Nystrom 2003; Urban, Soulard et al.
2007; Madia, Gattazzo et al. 2008; Madia, Wei et al. 2009).
51
Interestingly, when we performed LDH assays on human hepatocellular
carcinoma HepG2 cells pre-incubated with control serum or GHRD serum and
treated with H
2
O
2
we observed no difference in cytotoxicity between the two
serum groups (Fig 2.14). This is likely because these cells have a dominant
acting mutation in the N-ras gene and are unresponsive to downregulation of Ras
by GHRD serum (Richards, Short et al. 1990).
700 1000
0
20
40
60
GHRD
CONTROL
hydrogen peroxide(μM)
Cytotoxicity (% of control)

Figure 2.14 No effect of GHRD or Control serum on H
2
O
2
mediated
cytotoxicity in HepG2 cells.
N-Ras mutated HepG2 cells were incubated with serum from control or GHRD
subjects for 6 hours and treated with H
2
O
2
for 24 hours. LDH activity was
measured in culture supernatant as an indicator of cytoxicity. Data represent
mean ± SEM.

Pathway analysis also pointed to significant differences in pathways
involved in cell cycle regulation, gene expression, cell movement and cell death
among others between HMEC incubated with GHRD/control serum. The genes
picked out by pathway analysis as being involved in these four major significant
functional pathways are listed in Table 2.4.
52

Gene Name ID
Fold
Change
p
value
DDB1
damage-specific DNA binding
protein 1 1642 1.18 0.0005
LATS2
large tumor suppressor, homolog 2
(Drosophila) 26524 1.2 0.0008
NRG1 neuregulin 1 3084 -1.31 0.0001
WEE1 WEE1 homolog (S. pombe) 7465 1.29 0.0019
SOX9
SRY (sex determining region Y)-box
9 6662 1.3 0.0033
CREBBP CREB binding protein 1387 1.17 0.0032
RAN RAN, member RAS oncogene family 5901 -1.24 0.0023
IRF1 interferon regulatory factor 1 3659 1.31 0.0014
NFKBIA
nuclear factor kappa B-cells
inhibitor, alpha 4792 1.26 0.0013
NFKBIZ
nuclear factor kappa in B-cells
inhibitor, zeta 64332 1.32 0.0005
PRKAR2A
protein kinase, cAMP-dependent,
regulatory, type II, alpha 5576 -1.13 0.0003
TIAM1
T-cell lymphoma invasion and
metastasis 1 7074 1.22 0
DAB2
disabled homolog 2, mitogen-
responsive phosphoprotein 1601 1.47 0
GRB7
growth factor receptor-bound
protein 7 2886 1.29 0.0003
UGCG
UDP-glucose ceramide
glucosyltransferase 7357 1.53 0
TAX1BP1
Tax1 (human T-cell leukemia virus
type I) binding protein 1 8887 1.22 0.0005
HSPA9
heat shock 70kDa protein 9
(mortalin) 3313 -1.18 0.0014
TXNDC5
thioredoxin domain containing 5
(endoplasmic reticulum) 81567 -1.21 0.0018

Table 2.4 Genes in the significantly altered functional pathways identified
by microarray analysis
Genes in the top four significantly altered functional pathways identified from
microarray analysis in GHRD/Control serum grown HMECs. Fold change is
presented as GHRD:Control.

53
Of the genes shown in the table above are those involved in the G2/M cell
cycle arrest for example DDB1, LATS2, NRG1 and Wee1. The G2/M cell cycle
checkpoint is essential for preventing the replication of damaged cells and to
allow cells a chance to repair DNA damage (DiPaola 2002). Infact, DDB1 which
is a FOXO1 regulated gene and alongwith DDB2 is involved in DNA repair (Li,
Wang et al. 2006).
This analysis also revealed differences in expression in genes involved in
cell death and apoptosis for example Sox9, NRG1, IRF1 and NF κB.
A complete list of functional pathways that are significantly altered is shown in
Fig. 2.15

54

Figure 2.15 Functional clustering of gene expression changes analyzed by
Ingenuity Pathways Analysis.
55
Figure 2.15 Functional clustering of gene expression changes analyzed by
Ingenuity Pathways Analysis (continued).

56
Conserved growth factor signaling pathways in yeast and mammals
Signaling components of the IGF-1 pathway are highly conserved in yeast
and mammals as shown in Fig. 2.16.

MAMMALS
PKA
SOD2, Catalase,
fat accumulation
autophagy
IGF-I
IGF-IR
PI3K
FOXO
AKT
RAS
Aging
GH
?
TOR
S6K
AC
?
Glucose/
Amino acids
?
Glucose/
Amino acids
RAS
AC
PKA
RIM15
MSN2/4
SOD2, Catalase, HSPs,
glycogen and glycerol
accumulation,
autophagy
TOR
SCH9
Gpr1
GIS1
Aging
YEAST

Figure 2.16 Conserved nutrient responsive signaling pathways in mammals
and yeast.

In yeast, downregulation of Ras or Sch9 extends lifespan and protects
cells from oxidative damage (Fabrizio, Pozza et al. 2001). In addition, sch9 ∆
mutants exhibit lower age-dependent genomic alterations than WT yeast and this
57
is due, in part, to reduced error prone repair of damaged DNA in these cells
(Madia, Gattazzo et al. 2008; Madia, Wei et al. 2009)
In order to establish the role of homologs of IGF-I signaling proteins in
DNA damage we used the simple yeast model to generate triple mutants lacking
Ras, Tor and Sch9, the yeast homologs of mammalian Ras, Akt/PKB and S6K,
respectively (Fig 2.16). Our previous studies have shown that yeast sch9 ∆
mutants exhibit lower age-dependent genomic alterations than wild type cells
(Madia, Gattazzo et al. 2008; Madia, Wei et al. 2009) caused, in part, by reduced
error prone Pol ∆-dependent DNA repair. We observed a major life span increase
in non-dividing triple mutant cells compared to wild type cells (Fig. 2.17 A).
Moreover, the frequency of age-dependent mutations in the CAN1 gene, which
are mostly point mutations including a high frequency of G to T (transversion)

or
C to T (transition) base substitutions were higher in wild type cells compared to
the triple mutants (Fig 2.17 B). This increase was also evident when we analyzed
cumulative mutation frequency at day 7 (Fig 2.17 C).

58
5 10 15 20 25 30
0
20
40
60
80
100
120
140
ras2Δtor1Δsch9Δ
WT
days
Survival (%)
1 3 5 7 9 11 13 15 17 19 21 2325 27 29 31
0
2
4
6
8
10 WT (DBY746)
ras2Δtor1Δsch9Δ
days
Mutation Freq (10
-6
)
WT ras2Δtor1Δsch9Δ
0.0
0.5
1.0
1.5
2.0
2.5
Day 7
Mutation Freq (10
-6
)
A.
B.
C.

Figure 2.17 Homologous nutrient sensitive pathways in yeast and
mammals mediate lifespan and DNA damage.
(A) Chronological survival in yeast triple mutants lacking ras2, sch9 and tor1 (B)
Mutation frequency over time in the CAN1 gene (measured as Can
r
mutants/10
6

cells) (C) Cumulative mutation frequency, measured as Can
r
mutants/10
6
cells,
calculated from day 1 to day 7 in the wild type (DBY746) and ras2 ∆tor1 ∆sch9 ∆
mutants. Data represent the mean ± SEM (error bars), n= 5

In parallel with our studies with Human Mammary Epithelial Cells
(HMECs) we also tested the resistance of the triple yeast mutants,
ras2 ∆tor1 ∆sch9 ∆ to oxidative stress. H
2
O
2
treatment further decreased the
survival of WT cells whereas the triple mutants were almost unaffected (Fig 2.18
A). This was accompanied by a major H
2
O
2
and age-dependent increase in
mutations in WT cells but not in the triple mutants (Fig. 2.18 B).
59
2 4 6 8 10
0
20
40
60
80
100
120
WT
WT + H
2
O
2
ras2Δ tor1Δ sch9Δ
ras2Δ tor1Δsch9Δ + Η
2
Ο
2
Days
Survival (%)
1 3 5 7 9
0
5
10
15
20
25
**
*
**
*

WT (DBY746)
WT + H
2
O
2
ras2Δ tor1Δ sch9Δ
ras2Δ tor1Δ sch9Δ + H
2
O
2
Day s
Mutation Freq (10
-6
)
A. B.

Figure 2.18 Survival and mutation frequency of H
2
O
2
treated WT and
ras2 ∆tor1 ∆sch9 ∆ triple mutants.
(A) Chronological survival in yeast triple mutants lacking ras2, sch9 and tor1 after
treatment with H
2
O
2
(B) Mutation frequency over time in the CAN1 gene following
H
2
O
2
treatment (measured as Can
r
mutants/10
6
cells). Data represent the mean
± SEM (error bars), n= 5.
Experiments in Fig. 2.17 and Fig. 2.18 were performed by Federica Madia.

60
Chapter 2 Discussion

In this study we report on the very low cancer and diabetes incidence in a
human population deficient in GHR and IGF-1. Moreover, surveys of relatives
and the monitoring of death for 22 years support the absence of cancer related
mortality in 20 – 80 year old deceased GHRD individuals. In fact, we have
learned of only one case of cancer in a 60 year old GHRD woman who was
treated and is currently alive and cancer free. Our results are in agreement with a
previous preliminary study by Shevah and Laron who reported no history of
cancer in a group of 222 patients with congenital IGF-1 deficiencies (Shevah and
Laron 2007). In their study, the authors surveyed not only GHRD subjects but
also subjects with isolated Growth Hormone Deficiency, Growth Hormone
Releasing Hormone Receptor defect and IGF-1 insensitivity syndromes but
compared young IGF-I deficient subjects with much older controls. Our study, is
however, based on a more stringent analysis of a homogenous and genotyped
population of GHRD individuals and age-matched controls. The very low
incidence of cancer and diabetes in GHR and IGF-I deficient subjects may
provide a partial explanation for the overrepresentation of heterozygote
mutations in the IGF-1 receptor found among Ashkenazi Jewish centenarians
(Suh, Atzmon et al. 2008).
It is also worth we have not observed a single case of type 2 Diabetes
Mellitus in this cohort of GHRD subjects while their relatives and community
controls in the same geographical are largely susceptible. This is particularly
61
interesting considering that the clinical phenotype of subjects with GHRD
includes obesity with altered bone and body composition with low content of lean
and high of fat mass (Guevara-Aguirre J 1991). GHR/BP KO mice which are
considered a model for GHRD/Laron syndrome are insulin sensitive
(Coschigano, Holland et al. 2003; Liu, Coschigano et al. 2004). Moreover, GH
treatment has been reported to increase insulin resistance in GH deficient
subjects. Liver IGF-1 Deficient mice (LID) have a 75% reduction in IGF-1 levels
and high GH levels. When these mice were crossed with GH antagonist mice
they exhibited enhanced insulin sensitivity and better glucose uptake (Yakar,
Setser et al. 2004) Thus, the absence of diabetes in GHRD subjects could be
explained by chronic high insulin sensitivity and needs further investigation.
Mice with GHRD and GH deficient mice can live 40% longer but,
remarkably, almost half of them die without obvious evidence of lethal
pathological lesions, compared to only about 10% of their normal siblings (Bartke
2005; Ikeno, Hubbard et al. 2009). GHRD mice display a lower incidence (-49%)
and delayed occurrence of fatal neoplasms, increased insulin sensitivity, and a
reduction in age-dependent cognitive impairment (Bartke 2005).
Similar phenotypes are generally also observed in GH deficient mice
(Ikeno, Hubbard et al. 2009). In agreement with the human subjects results
presented in this study, the reduced cancer incidence in GHRD mice is
associated with a lower mutation frequency in various tissues (Garcia, Busuttil et
al. 2008). Also the down-regulation of PKA in human cells exposed to GHRD
serum together with the decreased age-dependent tumors and insulin resistance
62
in PKA deficient mice raise the possibility that the anti-cancer and diabetes
effects observed in GHRD subjects depends in part on AC/PKA inhibition
(Fabrizio, Pozza et al. 2001). Notably, reduced bone fractures and
cardiomyopathies are observed in the long-lived adenylate cyclase 5 deficient
mice (Yan, Vatner et al. 2007). It will be important to investigate further these
diseases in GHRDs and controls.
IGF-I expression has been frequently associated with a variety of cancers
although its role in tumorigenesis remains controversial (Pollak, Schernhammer
et al. 2004; Renehan, Zwahlen et al. 2004) IGF-I is believed to contribute to
cancer by promoting growth and inhibiting apoptosis. In fact, treatment of PC-12
cells with IGF-I has been shown to increase levels of the anti-apoptotic protein
Bcl-XL while IGF-I deficient hepatocytes from Ames dwarf mice which are
deficient in IGF-1 readily undergo apoptosis when exposed to hydrogen peroxide
(Parrizas and LeRoith 1997; Kennedy, Rakoczy et al. 2003). Our results support
the role of IGF-I in promoting cancer by preventing apoptosis but also indicate
that reduced GHR and IGF-I signaling protects from cancer by causing the
activation of stress resistance and anti-aging pathways. In fact, 10% of the genes
up-regulated in human epithelial cells exposed to GHRD serum, including SOD2,
are known targets of the conserved anti-aging FOXO transcription factor and Tor,
Ras, and PKA, which are orthologs of central yeast pro-growth and pro-aging
genes, are all down-regulated in GHRD serum-incubated cells. This anti-aging
mode apparently entered by GHRD serum pre-incubated cells was associated
with much lower DNA damage after treatment with hydrogen peroxide.
63
Together with the effect of this IGF-I deficient serum in causing the clearance of
highly damaged cells, its stress resistance effect could be responsible for the
very low cancer incidence in this GHRD cohort. Our yeast and mammalian
studies indicate that reduced IGF-I signaling, and particularly reduction of
Tor/S6K and of Ras/PKA signaling, makes cells resistant to aging- and oxidative
stress-dependent mutagenesis. This effect appears to depend, in part, on
increased activity of FOXO transcription factor and of its target SOD2. In fact, in
has been shown that Mice lacking Cu/Zn SOD or MnSOD are susceptible to
increased DNA damage and cancer (Busuttil, Garcia et al. 2005). Furthermore,
microarray pathway analysis shows a general trend towards upregulation of cell
cycle arrest and apoptosis in this group.
The role of IGF-1 signaling in cancer is not limited to propagation of initial
oncogenic mutations in normal cells but is also responsible for growth and
metastasis of established cancers. LNCaP prostate cancer cells undergo
apoptosis when treated with serum from men on a low fat diet and undergoing
exercise intervention and this effect is reversed by the addition of IGF-1 to the
serum. On the other hand, addition of IGFBP-1 to pre diet and exercise serum
induced apoptosis in these cells (Ngo, Barnard et al. 2003).
In summary, we show that very low levels of IGF-1 and reduced GHR and IGF-I
signaling associated with longevity extension and reduced age-dependent
damage and/or diseases in organisms ranging from yeast to mice, are
associated with a very low incidience of cancer and diabetes in a human
population. These results provide the foundation for further investigation aimed at
64
understanding the role of these mutations on different diseases including
neurodegenerative diseases and osteporosis and also at understanding whether
disease prevention also occurs in individuals that are heterozygous for this
mutation and that do not display severe growth deficiencies.

65
CHAPTER 3
REGULATION OF FOXO TRANSCRIPTION FACTORS BY RAS AND p38

Chapter 3 Abstract

Downregulation of IGF-1 signaling homologs has been shown to extend
lifespan, increase resistance to stress and delay or reduce the occurrence of
age-related pathologies in organisms ranging from yeast and worms to mice and
monkeys. Mammalian Ras is an important downstream mediator of IGF-1
signaling. In yeast, mutations in Ras2 can double life span and increase
resistance to oxidative stress by activating SOD2 via stress responsive kinases
and transcription factors. In mammals the Ras pathway has not been associated
with lifespan, however, inhibition of Ras signaling can protect against oxidative
stress. Here we show that similar to yeast, Ras can regulate the activity of the
stress transcription factor, FOXO in mammalian cells. Further, we demonstrate
that p38, a target of Ras, downregulates FOXO1 and MnSOD (SOD2). Reduced
FOXO1-MnSOD activity sensitizes the cells to superoxide induced oxidative
stress. We propose that Ras can sensitize cells to oxidative stress possibly
through p38 and FOXO.

66
Chapter 3 Introduction

Reduction in IGF-1 signaling is known to protect against oxidative stress
and extend lifespan in many model systems (Kenyon, Chang et al. 1993; Brown-
Borg, Borg et al. 1996; Fabrizio, Pozza et al. 2001; Tatar, Kopelman et al. 2001;
Coschigano, Holland et al. 2003; Longo 2003). In worms, mutations in the insulin
like receptor, daf-2, makes them live twice as long as wild type and this extension
in lifespan is dependent on daf-16, a forkhead like transcription factor and
homolog of mammalian FOXO (Kenyon 2001). In addition to the role it plays in
lifespan extension, daf-16 is also an essential regulator of oxidative stress
resistance, dauer formation, fat storage and metabolism (Larsen, Albert et al.
1995). In Drosophila, mutations in the Insulin like Receptor, InR or its substrate
chico also extend lifespan (Clancy, Gems et al. 2001; Tatar, Kopelman et al.
2001). Overexpression of dFOXO in the adult fat body extends lifespan
(Hwangbo, Gershman et al. 2004; Giannakou and Partridge 2007). In
mammalian cells, FOXO transcription factors are also regulated by IGF-1
signaling and regulate a diverse array of genes that function in metabolism, cell-
cycle inhibition, stress protection and apoptosis (Fig. 3.1) (Greer and Brunet
2005). There is a remarkable conservation of the signaling components that lead
to suppression of FOXO factors in worms, flies and mammals. When simplified
these consist of a Insulin like receptor, a phosphoinositide kinase and a serine
threonine kinase (Paradis and Ruvkun 1998; Vanfleteren and Braeckman 1999;
Scanga, Ruel et al. 2000; Kops, Dansen et al. 2002). In mammals, Insulin/IGF-1
67
binding to its receptor activates PI3K which generates the 3’ phosphorylated
inositol lipids (PtdIns3P). These can bind to pleckstrin homology containing
domains and act as secondary messengers. Of these, the PH domain containing
serine/threonine kinase, Akt/PKB, is activated by PtdIns3P binding by
phosphorylation at Thr 308 and Ser 473 (Alessi, James et al. 1997). Among the
substrates for phosphorylation by Akt are GSK-3, mTOR, BAD, ASK, Caspase-9
and the FOXO transcription factors (Alessi, Caudwell et al. 1996; Coffer, Jin et al.
1998).
The FoxO family of transcription factors in mammals consists of FoxO1
(FKHR), FoxO3a (FKHRL1), FoxO4 (AFX) and FoxO6. In standard
nomenclature, human FOXO proteins are abbreviated with all uppercase letters,
in mouse only the first letter is capitalized and first and subclass letters are in
uppercase for all other chordates. Like other Forkhead transcription factors, the
FoxO factors share a DNA binding domain with the core consensus sequence 5’
TTGTTTAC 3’ (Furuyama, Nakazawa et al. 2000). The Forkhead domain itself is
approximately 110 amino acids long, is made up of three α helices and two large
β strand loops/wings, and is therefore referred to as a winged helix domain
(Weigel, Jurgens et al. 1989). The expression of FoxOs can vary between
organs. FoxO1 is highly expressed in adipose tissue, FoxO3a in the liver, FoxO4
in the muscle and FoxO6 in the brain (Furuyama, Nakazawa et al. 2000). All
FoxO members are regulated by Akt/PKB phosphorylation at three conserved
threonine and serine residues one each at the N and C termini and one in the
forkhead domain (Brunet, Bonni et al. 1999; Kops, de Ruiter et al. 1999).
68
Phosphorylation by Akt/PKB results in nuclear exclusion and inactivation of
FoxOs in a 14-3-3 dependent manner (Brunet, Kanai et al. 2002).
Phosphorylation by Akt in the forkhead domain masks its Nuclear Localization
Sequence (NLS) and affects the DNA binding activity of FoxO. In addition to Akt,
Serum and Glucocorticoid kinase (SGK), Casein Kinase (CK1) and DYRK1 can
phosphorylate FoxOs (Brunet, Park et al. 2001; Garcia-Martinez and Alessi
2008).
FoxOs are also regulated by cellular stress signals. The stress activated
MAPK, c-Jun N terminal kinase (JNK), when activated by low levels of oxidative
stress by the small GTPase Ral can phosphorylate FOXO4 which results in
nuclear import and activation of FOXO (Essers, Weijzen et al. 2004). This stress-
induced nuclear translocation results in acetylation of FOXO and recruitment of
SIRT1 to a complex consisting of FOXO p300/CBP and p300/CBP associated
factor. Recruitment of SIRT1 is also dependent on oxidative stress and increases
FOXOs ability to induce cell cycle arrest and protect from oxidative damage but
inhibits apoptosis (Brunet, Sweeney et al. 2004). FoxOs can also be regulated by
ubiquitination and proteasomal degradation once they are translocated to the
cytoplasm. Akt phosphorylation creates a binding site for the ubiquitin ligase
Skp2 and this has been shown to result in the proteasomal degradation of FoxO
(Huang, Regan et al. 2005).
FoxO proteins function in a vast array of cellular processes, primarily in
response to stress (Fig.3.1). Overexpression of FoxO in dividing cells can cause
them to arrest at the G1/S boundary by activation of p21/p27 or by inhibition of
69
cyclin D1 and D2 (Medema, Kops et al. 2000; Ramaswamy, Nakamura et al.
2002). FoxO can also cause cells to arrest at the G2/M boundary by upregulation
of GADD45. GADD45 and DDB1, another FoxO target gene can also function in
the repair of damaged DNA (Tran, Brunet et al. 2002). Phosphorylation of BIM by
FoxO can trigger apoptosis. FoxO4 has been shown to downregulate the pro-
survival protein BcL-xL. Finally, FoxO can mediate apoptosis by upregulation of
the death cytokines Fas ligand and TRAIL (Brunet, Bonni et al. 1999; Tang,
Nunez et al. 1999; Dijkers, Medema et al. 2000). FoxO can also upregulate
SOD2 and Catalase and protect cells against oxidative stress (Kops, Dansen et
al. 2002).

Figure 3.1 FoxO regulated genes and their functions.
From: Greer, E. L. and A. Brunet (2005)

70
Superoxide Dismutases (SODs) are ubiquitously expressed, conserved
proteins that catalyze the dismutation of Superoxide into Hydrogen Peroxide and
water. They constitute important defense mechanisms against high levels of
oxidative stress. Three forms of SODs have been identified in mammals – SOD1
also known as CuZn SOD is localized in the cytoplasm while SOD2 also known
as MnSOD localizes to the mitochondria. Extracellular SOD, SOD3, also has
CuZn in its catalytic center (Zelko, Mariani et al. 2002). Of these, SOD2 has been
recognized as an important mediator of the stress response seen under
conditions of reduced IGF-1 pathway signaling in yeast and mammals (Brown-
Borg, Borg et al. 1996; Fabrizio, Pozza et al. 2001; Garcia, Busuttil et al. 2008;
Madia, Gattazzo et al. 2008; Madia, Wei et al. 2009). SOD2 is also regulated by
the FOXO transcription factors thus explaining its important role in the IGF-1
pathway (Kops, Dansen et al. 2002).
As a nutrient sensing molecule, Ras plays an important role in IGF-1
signaling by activating signal transduction pathways such as RAF/MEK/ERK,
JNK, p38 and other pathways which promote cell division and growth. Ras acts
as a transducer of extracellular signals by being anchored at the plasma
membrane and hydrolyzing GTP. Mammalian Ras exists in three cellular
isoforms – H-Ras, K-Ras and N-Ras. Despite high sequence homology and
interactions with many common effectors, the Ras isoforms have been shown to
differ in signal outputs (Hancock 2003). These differences have been attributed
to the hypervariable 25 amino acid C-terminus. Post-translational modification of
the C-terminus is essential for Ras to associate with the cell membrane and this
71
involves a sequential series of protein modifications. The first of these is
farnesylation of the C-terminal CAAX motif by a farnesyl transferase. Inhibitors of
Farnesyl transferases, FTIs, have gained importance as clinical agents for anti-
cancer therapy (Reuter, Morgan et al. 2000).
Deletion of Ras2 in yeast results in a two-fold increase in lifespan and a
corresponding protection from paraquat induced oxidative stress (Fabrizio, Pozza
et al. 2001). In yeast Ras acts upstream of Cyr1 and PKA and therefore
inactivation of either of these components also results in an increase in survival
(Fabrizio, Pozza et al. 2001). In mammals, Ras has not been associated with
increased lifespan; however, several studies have shown an association of
increased Ras activity with decreased stress resistance. AC5 knockout mice
exhibit about a 30% increase in lifespan and are protected against oxidative
stress (Yan, Vatner et al. 2007). AC5 is the mammalian homolog of yeast Cyr1
and catalyses the conversion of cAMP from ATP which is required for PKA
activity. In PC12 cells downregulation of Ras increases resistance to oxidative
stress (Spear, Estevez et al. 1998). Our lab has recently demonstrated that
downregulation of Ras- Erk activity protects neurons from oxidative injury (Li, Xu
et al. 2008).
p38 Map Kinase is the homolog of yeast Hog1 and is activated both
downstream of growth signaling pathway such as Ras and by stress signals.
Mammalian p38 is activated in response to various extracellular stimuli such as
UV light, heat, osmotic shock, cytokines and growth factors (Freshney,
Rawlinson et al. 1994; Rouse, Cohen et al. 1994; Foltz and Schrader 1997).
72
p38 plays a role in a broad range of physiological processes which include
inflammation, apoptosis, embryonic development, cell cycle and cancer (Xia,
Dickens et al. 1995; Juo, Kuo et al. 1997; Guan, Buckman et al. 1998; Guan,
Buckman et al. 1998; Takenaka, Moriguchi et al. 1998; Johnson and Bailey 2003;
Hollenbach, Neumann et al. 2004; Dolado, Swat et al. 2007). As with the other
MAPKs, p38 is activated by a series of phosphorylation steps. The two main
MAP kinase kinases that activate p38 are MKK3 and MKK6 (Zarubin and Han
2005). A MKK independent activation pathway is mediated by the TAK-1 binding
protein, TAB-1, and involves autophosphorylation of p38 (Ge, Gram et al. 2002).
There are four mammalian p38 isoforms p38 α, p38 β, p38 γ and p38 δ of which
p38 α and p38 β are ubiquitously expressed. All p38 kinases are characterized by
a Thr- Gly- Tyr (TGY) dual phosphorylation motif. Substrates of p38 α include
MAP kinase-activated protein kinase 2 (MAPKAP-2/MK2), hsp27,cAMP response
element binding protein (CREB), tau and several transcription factors such as
Activating Transcription Factor (ATF-1/2/6), SRF accessory protein (Sap1),
GADD153, p53, ELK1, NFAT etc (Janknecht and Hunter 1997; Reynolds,
Nebreda et al. 1997; Gomez del Arco, Martinez-Martinez et al. 2000).
FoxO4 has been shown to be regulated in response to oxidative stress by
JNK, which, like p38, is a stress-activated member of the MAPK family (Essers,
Weijzen et al. 2004). However, in contrast to Akt regulation, phosphorylation of
FoxO4 by JNK leads to its activation and nuclear localization (Essers, Weijzen et
al. 2004). As p38 is also activated by stress, and because a large majority of p38
targets are transcription factors we hypothesized that it could regulate FoxO
73
transcription factors in response to mitogenic or stress signals. In addition a
recent report by Asada et al demonstrated the phosphorylation of FoxO1 by Erk
and p38 in vitro (Asada, Daitoku et al. 2007). In this study we demonstrate that
p38 can downregulate FoxO1 in an Akt independent manner and sensitize
HepG2 cells to oxidative stress as a result of reduced MnSOD expression.
Further, our results demonstrate that p38 also negatively regulates IGFBP-1,
which could result in a feed-forward signaling of the IGF-1 axis.

74
Chapter 3 Materials and Methods
Cell Culture
PC12 cells were cultured in DMEM F-12 medium containing 15% Horse
serum and 2.5% FBS at 37
0
C and 5% CO
2
on poly-L-Lysine coated culture
dishes. In order to induce expression of CA or DN K-Ras, cells were treated with
1 μg/ μl Doxycycline for 48 hours. Induction of Ras was measured using a Ras
activation assay kit from Upstate and/or by fluorescence microscopy of EGFP
tagged Ras. HepG2 and HEK293 cells were cultured in DMEM F-12 medium
containing 10% FBS at 37
0
C and 5% CO
2.
R-/R+ cells were a kind gift from Dr.
Baserga (Thomas Jefferson University, Philadelphia, PA). Cells were cultured in
DMEM F-12 medium containing 10% FBS at 37
0
C and 5% CO
2.

Treatments
(a) Inhibitors – FTI-277 (Sigma) was used to inhibit Ras processing at
concentrations of 300 ηM – 1 μM. SB203580 (Alexis) was used to inhibit p38
activity at 1.5-3 μM concentrations. (b) Oxidative stress – Hydrogen Peroxide
was used to induce oxidative stress in PC 12 and HepG2 cells. Menadione was
used to induce superoxide and hydrogen peroxide mediated stress in HepG2
cells.
Transfection
Transfection studies were performed in PC-12, HEK293, HepG2 and R-
and R+ cells using Fugene HD to transfect cells (Roche). siRNA transfections
were performed at 3:1 (Fugene:DNA) ratios for FOXO1 and p38 α and 3:2 ratios
for MnSOD. 3:1 transfection ratios were also used for FOXO-luc, IGFBP-1 luc
75
and FOXO-SEAP transfections. When co-transfections were performed with
Renilla luciferase or β-galactosidase, Fugene and DNA amounts were increased
proportionally. Transfection mixtures were prepared in serum free DMEM and
incubated for 30-45 minutes at RT according to manufacturers protocol.
Luciferase Assays
Dual luciferase assays were performed using the dual luciferase assay kit
(Promega) according to manufacturer’s instructions.
SEAP Assay
SEAP activity was assayed in culture supernatant, 24 -48 hours after
transfection, using a SEAP assay kit from Invivogen according to manufacturer’s
protocol.
LDH Assay
LDH activity was assayed in culture supernatant using the Cytotox non-
radioactive assay kit from Promega. Untreated 100% lysis and spontaneous LDH
release controls were included in each experiment.
MTT Assay
MTT reduction was assayed using MTT obtained from Sigma. 5mg/ml
MTT was diluted 1:10 in low serum medium and added to cells at the end of each
treatment. Cells were incubated in this medium for 2–4 hours until MTT crystals
were visible under the microscope. Cells were lysed using buffer containing DMF
and Acetic acid overnight and MTT reduction was quantified.

76
Fluorescence Microscopy
Flourescence microscopy was used to analyze EGFP and GFP tagged
Ras and FOXO1 respectively. For FOXO1–GFP analysis, cells were grown and
treated directly on 8 chamber slides.
Ras Activity Assay
Ras activation was analyzed using Immunoprecipitation to pull down GTP
bound Ras followed by western blotting to detect active Ras using the Ras
activation assay kit from Millipore. Detailed protocol is as per manufacturers
instructions.
Western Blots
Western blot analysis was performed according to commonly used
protocols. Briefly, cells were lysed in RIPA buffer and protein estimations were
done using the BCA assay. 15-20 μg protein was loaded onto 10% SDS
polyacrylamide gels. Following blotting onto PVDF membranes, blocking of blots
was done in 5% milk. Primary antibodies and dilutions used are as follows – anti
phospho FOXO1 (Ser253) and total FOXO1 dilution 1:1500, Anti phospho Akt
(Thr 308) dilution 1:1500 and anti total Akt dilution 1:2000 were from Cell
Signaling Technologies (Beverly, MA). Anti MnSOD dilution 1:2000 was from
Assay Designs/Stressgen (Ann Arbor, Michigan) and anti GAPDH dilution 1:3000
was from Abcam (Cambridge, MA). All antibodies from Cell Signaling were
diluted in 5% BSA while all others were diluted in 5% milk. Primary antibody
incubations were carried out at 4
o
C overnight. Secondary antibodies were
obtained from Jackson Immunoresearch (West Grove, PA).
77
Statistical Analysis
Data were analyzed using 2-way ANOVA and unpaired students t-test to
determine significant differences between treatment and control groups. Data
were considered significant if the p value was less than 0.05.

78
Chapter 3 Results

Ras regulates FOXO
Previous studies from our laboratory have shown the negative effect of
Ras pathway signaling on lifespan and stress protection in yeast (Fabrizio, Pozza
et al. 2001). The deletion of Ras2 in yeast, can double lifespan and increase
stress resistance by upregulation of SOD2. This increase in lifespan requires the
activity of msn2 and msn4, two stress resistance transcription factors that
mediate transcription of genes that have a Stress Response Element (STRE) in
their promoters. In mammals, Ras functions downstream of growth factors
including the pro-aging IGF-1 pathway and we have previously demonstrated
that downregulation of Ras signaling in mouse neuronal cells protects them
against oxidative stress (Li, Xu et al. 2008). Based on these studies, we asked if
Ras could regulate the stress resistance FOXO factors in mammalian cells in a
manner similar to yeast.
We generated Tet-On PC12 cells stably transfected with a Tetracycline
inducible, constitutively active (CA) mutant of K-Ras: Ras
leu61
. The mutant protein
was tagged with EGFP. As active Ras must localize to the membrane in order to
participate in signal transduction, tagging the mutant Ras gene with EGFP
facilitated easy microscopic observation of induction. Treatment with 1 μg/ μl
Doxycycline induced strong expression of the protein within 48 hours as seen in
Fig. 3.2 A and B.

79
-Dox +Dox (1µg/µl) -Dox +Dox (1µg/µl)
B.
C.
-+
Doxycycline (1ug/ml)
Active Ras
A.

Figure 3.2 Tet inducible expression of CA and DN Ras in PC12 cells.
(A) Induction of CA-Ras was measured by measuring activity of GTP bound Ras
(B, C) Fluorescence microscopy demonstrates induction of CA-Ras (B) or DN-
Ras (C) 48 hours after treatment with Doxycycline.

We also generated Tet-On PC12 stably transfected cells expressing a
Tetracycline inducible K-Ras
Asn17
mutant that is inactive and acts as dominant
negative mutant (DN) when overexpressed (Fig. 3.2C). Mock transfected PC12
cells were used as a control for the CA and DN cells.
80
We first tested if CA Ras and DN Ras cells responded differently to
oxidative stress. Control, CA Ras or DN Ras cells were treated with hydrogen
peroxide and assayed for cytotoxicity by LDH release. As seen, CA Ras cells
were more susceptible to H
2
O
2
induced cytotoxicity at 100 μM concentrations
(Fig. 3.3). On the other hand, cells overexpressing DN Ras were significantly
protected from H
2
O
2
induced cytotoxicity

at both 100 μM and 200 μM compared
with control cells (Fig. 3.3).
100 200
0
50
100
150
CA Ras
Control
DN Ras
*
*
*
hydrogen peroxide(μM)
Cytotoxicity (% of control)

Figure 3.3 Reduced Ras activity protects against oxidative stress.
H
2
O
2
induced cytotoxicity

was assayed by measuring LDH activity in control, CA
Ras or DN Ras expressing PC-12 cells. Data represent mean ± SEM. * p< 0.05.

Next, we were interested to know if Ras could regulate the FoxO
transcription factors in a manner similar to the regulation of msn2 and msn4 in
yeast (Fabrizio, Pozza et al. 2001). To do this, we first analyzed FoxO promoter
activity in these cells by transfecting them with a reporter construct containing six
conserved FoxO binding elements that drive expression of a secreted form of the
Alkaline Phospatase reporter (SEAP). Co-transfection with a β-galactosidase
81
expression vector was used to normalize for transfection efficiency. 24 hours
after transfection, cells were treated with 1 μg/ μl Doxycycline for 48 hours to
induce expression of the transgenes. As seen, cells expressing CA Ras exhibited
significantly lower FOXO activity compared to controls while cells expressing DN
Ras had higher FOXO activity compared with both Control and CA Ras
expressing cells (Fig. 3.4 A). The reporter vector used in the experiment is shown
in Fig. 3.4 B.
We also analyzed FOXO1 protein levels by western blot in induced CA
Ras and DN Ras cells. Higher levels of FOXO1 were seen in the DN Ras cells
compared with CA Ras (Fig 3.4 C). Together, these results suggest that high
levels of Ras can sensitize cells to oxidative stress possibly by downregulation of
FOXO transcription factors.

82
FOXO
FOXO binding element
Control CA Ras DN Ras
0
50
100
150
200
*
FOXO promoter activity
(A.U.)
A. B.
Total FOXO1
GAPDH
d1 d2
d1 d2
SEAP
C.
CA Ras DN Ras

Figure 3.4 Ras regulates FOXO promoter activity.
(A) PC-12 cells transfected with the FOXO-SEAP reporter vector were assayed
for SEAP activity after induction of CA K-Ras or DN K-Ras. (B) Diagrammatic
representation of the FOXO reporter vector. (C) Western blot showing total
protein levels of FOXO1 at day1 and day 2 after induction with 1 μg/ μl
Doxycycline.

Akt and Ras are the two major pathways that act downstream of the IGF-
1 receptor. It has been shown that IGF-1 signaling via Akt can downregulate
FOXO factors (Brunet, Bonni et al. 1999). We hypothesized that IGF-1 signaling
via downstream effectors of Ras could also downregulate FOXO factors and
sensitize cells to oxidative damage. We used HepG2 human hepatocellular
carcinoma cells to test our hypothesis. These cells harbor an activating mutation
in codon 61 in N-Ras (Richards, Short et al. 1990). As the liver is the major site
for IGF-I and IGFBP synthesis in the body, these cells are also a good model for
investigation of the IGF-1 pathway.
83
To test regulation of FOXO by Ras in HepG2 cells, we transfected the
cells with a FOXO reporter plasmid and treated them with the farnesylation
inhibitor, FTI-277 to inhibit Ras activity. The reporter vector contains 3 canonical
ForkHead Response Elements (FHRE) that drive expression of firefly luciferase
downstream of a basal promoter element (Brunet, Bonni et al. 1999). Ras
proteins cycle between GDP and GTP bound states at the cell membrane in
order to transduce extracellular signals. Anchoring of Ras to the plasma
membrane is essential for these functions and is achieved by a series of post-
translational modifications. The first step of this process is catalyzed by Farnesyl
Transferase and involves the addition of a Farnesyl group to the C-terminal
CAAX peptide of nascent Ras where C is Cysteine, A is isoleucine or Valine and
X is Serine or Methionine. Competitive inhibitors known as Farnesyl Transferase
Inhibitors (FTI) that can prevent this modification have been developed as
potential anti-cancer drugs (Lerner, Qian et al. 1995). We treated transfected
cells with FTI-277, a cell permeable inhibitor of Ras farnesylation in order to
inhibit its activity. Treatment with this inhibitor results in accumulation of Ras in
the cytoplasm where it can bind to and sequester its downstream effector Raf
resulting in an inhibition of signaling (Lerner EC JBC 1995). FTI-277 treatment
resulted in increased FOXO promoter activity in the cells compared with control
untreated cells (Fig 3.5A).
We also analyzed total FOXO1 protein levels in cells untreated or treated
with the inhibitor by western blot. As seen, FTI-277 was able to increase FOXO
protein levels in a concentration dependent manner (Fig. 3.5B).
84
These data suggest that Ras downregulates FOXO activity and protein
levels in HepG2 cells.
Control FTI-277
0
20
40
60
80
*
FOXO Promoter Activity (A.U.)
FTI-277
-+ ++
total FOXO1
GAPDH
A.
B.

Figure 3.5 Regulation of FOXO by Ras in HepG2 cells
(A) FOXO activity was assayed in cells transfected with a FOXO-luc reporter and
treated with FTI-277 to inhibit Ras activity. Data are calculated as Firefly
luciferase/Renilla luciferase.* p=0.02. (B) Western blot showing increase in
FOXO protein levels after treatment with FTI-277.

p38 regulates FOXO1
To look for targets of Ras that could mediate downregulation of FOXO we
turned to the stress activated MAPK, p38. As a downstream effector of Ras, p38
has been shown to be an essential component of Ras mediated invasion of
cancer cells(Marshall 1996). Infact, Ras can activate all three MAPK - ERK, JNK
and p38. Of these ERK is activated mostly by growth factors and mitogenic
signals whereas p38 and JNK are also activated by stress (Denhardt 1996). As
FOXOs are also regulated by stress and it has already been shown that FOXO4
is regulated by JNK (Essers, Weijzen et al. 2004) we considered the possibility
85
that p38 could regulate FOXO. Infact, p38 was recently shown to be able to
phosphorylate FOXO1 in vitro (Asada, Daitoku et al. 2007).
In order to test if p38 can regulate FOXO intracellularly, we first analyzed
the effect of p38 inhibition on FOXO transcriptional activity. HepG2 cells were
transfected with a FHRE-firefly luciferase reporter plasmid as described above.
Co-transfection with a renilla luciferase reporter was used to normalize for
transfection efficiency. Downregulation of p38 activity by using a synthetic
inhibitor of p38 α and p38 β SB203580 (SB), by co-transfecting cells with a DN
p38 α construct or by co-transfecting cells with siRNA against p38 α resulted in a
2-fold increase in luciferase activity (Fig. 3.6 A) implying that p38 negatively
regulates FOXO transcription.
Based on a report by Asada et al, that p38 can phosphorylate and
regulate FOXO1 in vitro (Asada, Daitoku et al. 2007); we were interested to see if
p38 could specifically regulate FOXO1 transcriptional activity in these cells. As all
FOXO factors can bind to the canonical FHRE elements and initiate luciferase
expression we used siRNA against FOXO1 to analyze its effect on luciferase
reporter expression. As seen, FOXO1 knockdown resulted in reduced luciferase
expression compared to mock-transfected controls (Fig. 3.6 B). Moreover,
knockdown of FOXO1 reversed the effect of p38 inhibition on FOXO promoter
activity (Fig. 3.6 B). Knockdown of FOXO1 is shown in Fig. 3.6C
86
Control SB p38 α siRNA DN p38 α
0
100
200
300
400
***
*** ***
FOXO promoter activity (A.U.)
Untreated SB
0
100
200
300
400
Control siRNA
FOXO1 siRNA
***
***
FOXO Promoter Activity (A.U.)
A.
B.
d1 d2 d3 d1 d2 d3
Control siFOXO1
FOXO1
GAPDH
C.

Figure 3.6 Regulation of FOXO1 by p38.
(A) Inhibition of p38 by SB203580 (SB), a specific inhibitor of p38 α and p38 β or
using a dominant negative (DN) p38 α vector or by siRNA mediated
downregulation of p38 α results in enhanced FOXO promoter activity represented
as firefly/renilla luciferase A.U. Data represent the mean ± SEM (B)
Downregulation of FOXO1 by siRNA reverses the effect of p38 inhibition on
FOXO promoter activity represented as firefly/renilla luciferase (A.U.) Data
represent the mean ± SEM *** p < 0.0001(C) Western blot shows reduction in
total FOXO1 levels by FOXO1 siRNA.

p38 regulates nuclear-cytoplasmic translocation of FOXO1
Akt/PKB mediated phosphorylation promotes nuclear export and prevents
DNA binding and subsequent transcriptional activity of the FoxO factors (Brunet,
Bonni et al. 1999; Brownawell, Kops et al. 2001). Phosphorylation by Akt/PKB
results in the efficient binding of 14-3-3 proteins that are responsible for transport
in and out of the nucleus. Binding of 14-3-3 disrupts the Nuclear Localization
87
Sequence (NLS) and results in FoxO being transported out of the nucleus
(Brunet, Bonni et al. 1999).
We were interested to know if the p38 mediated inhibition of FoxO1
transcriptional activity that we observed was also due to nuclear exclusion of
FoxO1 by p38 similar to Akt/PKB. In order to do this we transfected cells with a
FoxO1-GFP construct. Serum starvation of the cells for 24 hours resulted in
predominantly nuclear localization of FOXO1 (Fig 3.7 A). Addition of 10% FBS to
serum starved cells resulted in nuclear export of FOXO1 within 15 min (Fig 3.7B).
When the cells were treated with Wortmannin, an inhibitor of PI3K for 30 min
prior to addition of 10% serum, FOXO1, as expected was retained in the nucleus
despite the presence of growth factors (Fig. 3.7 C). Finally, when we pretreated
the cells with SB203580 for 30 min before addition of 10% FBS, we observed
nuclear retention of FOXO1 similar to that seen with Wortmannin (Fig 3.7 D).
These results imply that p38 can regulate FOXO1 activity by promoting nuclear
export similar to the mechanism observed with Akt regulation of FOXO.
These data are different from the regulation of FOXO by JNK which was shown
to results in nuclear translocation of FOXO4 (Kops, Dansen et al. 2002). This
implies that multiple mechanisms of FOXO regulation exist in the cell.

88

Figure 3.7 p38 regulates nuclear-cytoplasmic translocation of FOXO1.
Cells were transfected with a FoxO1-GFP plasmid. Cells were serum starved for
24 hours. Following this, cells were (A) starved for an additional 45 min (B)
starved for 30 min and switched to 10% FBS for 15 min (C) treated with
wortmannin for 30 min before switching to 10% FBS for 15 min or (D) treated
with SB203580 for 30 min before switching to 10% FBS for 15 min.

p38 regulates FOXO1 independently of Akt.
It has been previously reported that p38 along with its downstream
signaling proteins MAPKAP-2 (MK2) and Hsp27 functions in a signaling complex
that activates Akt. This study proposed that p38 can phosphorylate Akt via MK2
in neutrophils (Rane, Coxon et al. 2001). To determine if regulation of FOXO1 by
p38 was dependent on Akt signaling we first examined if Akt phosphorylation
itself and subsequent FOXO1 phosphorylation by Akt is altered by p38 inhibition
89
in HepG2 cells. SB treatment did not affect phosphorylation of Akt nor did it affect
phosphorylation of FOXO1 by Akt (Fig.3.8A). We also tested FoxO promoter
activity in R- and R+ fibroblasts. R- cells are derived from IGF-1 receptor
knockout mice and R+ cells overexpress IGF-1 receptors (Sell, Rubini et al.
1993; Romano, Prisco et al. 1999). As seen in chapter 2, R+ cells exhibit higher
Akt phosphorylation than R- cells implying that Akt is highly active in these cells.
Despite this difference, SB treatment was able to increase FoxO activity by about
1.3 fold in both cell types. This implies that p38 can regulate FoxO activity
regardless of Akt activation status (Fig. 3.8B).
We also observed higher levels of total FOXO1 protein in HepG2 cells
treated with SB. As mentioned earlier, FOXO proteins are also regulated by
ubiquitination and proteasomal degradation. It has been shown that activation of
Akt results in a decrease in FOXO1 and FOXO3a protein levels which can be
inhibited by proteasome inhibitors (Plas DR, JBC 2003, Matsuzaki H, PNAS
2003).
Akt mediated phosphorylation and cytosolic translocation are required for
this event (Matsuzaki H PNAS 2003). It is therefore interesting that p38 inhibition
appeared to increased total protein levels of FOXO1 (Fig. 3.8A).

90
Total FOXO1
DMSO
pAkt
Total Akt
pFOXO1 (Akt site)
GAPDH
SB
A. B.
DMSO SB DMSO SB
0
50
100
150
200
250
R- R+
**
**
FOXO Promoter Activity (A.U.)

Figure 3.8 Regulation of FOXO1 by p38 is independent of Akt.
(A) Effect of p38 inhibition on Akt and FOXO1 was measured by analyzed by
western blotting of phospho Akt (Ser 473) and phospho FOXO1 (Ser256) after
treatment of the cells with SB. (B) FoxO-luciferase activity was measured in R-
and R+ cells after treatment with SB. Data are normalized to renilla luciferase
internal controls and represent mean ± SEM. p<0.005

We treated cells with SB and used western blotting to analyze total
FOXO1 protein levels in the cells. As seen before, SB treatment resulted in
increased total FOXO1 levels (Fig. 3.9A). Cells transfected with the DN p38 α
vector also showed an increase in FOXO1 protein levels at day1 and day 2
following transfection (Fig.3.9 B). To test if p38 also regulates FOXO1 protein in
vivo we obtained mice with a liver specific deletion of p38 α. Higher FOXO1
levels were also seen in the liver of these compared with the liver of control mice
(Fig. 3.9 C). Taken together our data suggests that p38 regulates FOXO1 protein
levels both in vitro and in vivo and this effect is independent of Akt.
91
total FOXO1
Control DNp38 Control DNp38
Day 1 Day2
(days post transfection)
GAPDH
total FOXO1
Control
liver
p38-/-
liver
GAPDH
A.
C.
total FOXO1
C
SB
(1.5uM)
GAPDH
B.
total FOXO1
Control DNp38 Control DNp38
Day 1 Day2
(days post transfection)
GAPDH
total FOXO1
Control DNp38 Control DNp38
Day 1 Day2
(days post transfection)
GAPDH
total FOXO1
Control
liver
p38-/-
liver
GAPDH
Control
liver
p38-/-
liver
GAPDH
A.
C.
total FOXO1
C
SB
(1.5uM)
GAPDH
C
SB
(1.5uM)
GAPDH
B.

Figure 3.9 p38 regulates total FOXO1 protein levels in vitro and in vivo.
(A) Total FOXO1 protein levels in cells treated with vehicle or SB 203580. (B).
Total FOXO1 protein levels in HepG2 cells transfected with a dominant negative
p38 α mutant. (C). Total FOXO1 protein levels in mouse liver from floxed controls
or mice carrying a liver specific p38 α deletion. Data are representative of 5
control and 8 p38-/- mouse livers.

p38 mediated downregulation of FOXO1 sensitizes HepG2 cells to oxidative
stress.
Of their various intracellular functions, the FOXO proteins have been
shown to play a role in oxidative stress protection. In C.elegans, daf-16, the
worm homolog of FOXO is required for dauer formation which is a
developmentally arrested, long-lived larval form characterized by resistance to
thermal and oxidative stress (Kenyon, Chang et al. 1993; Kenyon 2001). In
mammalian cells FOXOs have been shown to directly upregulate the expression
92
of MnSOD (SOD2) and Catalase, two enzymes essential for protection against
oxidative radicals (Kops, Dansen et al. 2002).
In order to investigate if inhibition of p38 could protect cells against
oxidative stress we treated cells with H
2
O
2
after a 24 hour pre-incubation with
either vehicle or SB (Fig. 3.10 A and B). No difference in LDH release between
cells pre-treated either with DMSO (vehicle control) or 1.5 μM SB was observed
at either H
2
O
2
concentration (Fig. 3.10 A). Treatment with Menadione on the
other hand resulted in significant protection in the SB pre-treated cells compared
with vehicle pre-treated cells (Fig 3.10 B). As Menadione is a generator of
hydrogen peroxide as well as superoxide, our data suggests that the protective
effects of p38 inhibition are due to protection against the superoxide radical
rather than hydrogen peroxide.
A. B.
300 500
0
20
40
60
80
DMSO (vehicle control)
SB
Hydrogen peroxide(μM)
LDH release (% of control)
20 50
0
20
40
60
DMSO (control)
SB
***
***
Menadione(μM)
LDH release (% of control)

Figure 3.10 p38 inhibition protects against menadione induced oxidative
stress
(A) Cells were treated with the indicated concentrations of H
2
O
2
for 24 hours prior
to LDH assays (B) Cells were treated with the indicated concentrations of
Menadione for 24 hours prior to LDH assays. Data represent the mean ± SEM
*** p< 0.0001.

93
We were interested to see if the protective effect of p38 inhibition was due
to the upregulation of FOXO1 in the cells. HepG2 cells were transfected with
either a control siRNA vector or with a FOXO1 specific siRNA vector.
Downregulation of FOXO1 enhanced LDH release implying that cells are more
susceptible to oxidative damage in the absence of FOXO1. SB pre-treatment
however, could only protect the mock-transfected cells and not cells in which
FOXO1 was downregulated (Fig 3.11). Taken together, these data demonstrate
that p38 mediated downregulation of FOXO1 sensitizes cells to oxidative stress.

DMSO SB DMSO SB
0
20
40
60
Control siRNA
FOXO1 siRN A
***
Menadione(50μM)
LDH release (% of control)

Figure 3.11 p38 inhibition requires FOXO1 to protect against Menadione
induced oxidative stress
LDH activity was measured after menadione treatment in control cells or cells in
which FOXO1 was downregulated. Data represent the mean ± SEM
***p< 0.0001

94
p38 regulates MnSOD via FOXO1
MnSOD (SOD2) is a major detoxifying enzyme found in the mitochondria
that catalyzes the dismutation of superoxide into oxygen and hydrogen peroxide.
The FOXO factors can directly upregulate MnSOD levels in cells (Kops, Dansen
et al. 2002). We hypothesized that p38 inhibition protected cells against
menadione induced stress due to upregulation of MnSOD via FOXO1. To test
our hypothesis, we first looked at MnSOD levels in response to p38 inhibition by
transfecting cells with a DN p38 α plasmid. Inhibition of p38 resulted in
significantly increased MnSOD levels (Fig 3.12A). Next, in order to test if this
effect was dependent on FOXO1, we downregulated FOXO1 and treated the
cells with SB. Control cells treated with SB showed 30% increase in MnSOD
proteins levels compared with vehicle treated controls. However, downregulation
of FOXO1 not only prevented but also reduced MnSOD levels in response to SB
treatment (Fig. 3.12 B and C).
These results demonstrate that p38 can regulate MnSOD in a FOXO1
dependent manner.
95
Control DNp38a Control DNp38a
day1 day 2
MnSOD
GAPDH
(Days post transfection)
Control DNp38a Control DNp38a
day1 day 2
MnSOD
GAPDH
(Days post transfection)
A.
B.
Unt. SB Unt. SB
Control siRNA FOXO1 siRNA
MnSOD
GAPDH
-20
-10
0
10
20
30
40
Control siRN A
FOXO1 siRNA
p38 inhibition induced
% change in MnSOD
C.

Figure 3.12 p38 regulates MnSOD protein levels.
(A) MnSOD protein levels in HepG2 cells following downregulation of p38 with a
DN p38 α plasmid (B) Increase in MnSOD upon p38 inhibition is dependent on
FOXO1. (C) Percent increase in MnSOD protein levels in control and FOXO1
siRNA transfected cells by quantification of band intensity using ImageJ.

In order to establish the role of p38-FOXO1-MnSOD signaling in the stress
response of HepG2 cells, we used siRNA to downregulate MnSOD in these cells
and treated them with 50 μM Menadione. As expected, downregulation of MnSOD
resulted in increased LDH activity.

96
While cells treated with SB were better protected as seen previously, SB
treatment did not protect cells that were transfected with siRNA against MnSOD
(Fig. 3.13 A and B).
These observations suggest that p38 sensitizes cells to oxidative stress by
downregulation of FOXO1–MnSOD.
MnSOD
GAPDH
Unt. SB Unt. SB
0
20
40
60
80
Control siRNA
MnSOD siRNA
*
LDH release (% of control)
A.
B.
siMnSOD Control

Figure 3.13 MnSOD mediates the p38-FOXO1 regulated oxidative stress
response.
(A) Cells transfected with either control siRNA or siRNA against MnSOD were
treated with 50 μM menadione. LDH activity was assayed after 24 hours of
treatment. (B) Western blot demonstrating knockdown of MnSOD.

97
p38 regulates IGFBP-1
IGFBP-1 is one of six IGF-1 binding proteins that can bind to and regulate
the bioavailability and thus activity of IGF-1. The FOXO factors can regulate
IGFBP-1 transcription (Cichy, Uddin et al. 1998; Durham, Suwanichkul et al.
1999; Tomizawa, Kumar et al. 2000; Guo, Cichy et al. 2001). Based on our
finding that p38 can regulate FOXO1 we wanted to know if p38 could also
regulate IGFBP-1 through FOXO1. We transfected HepG2 cells with a IGFBP-1
reporter plasmid containing part of the IGFBP-1 promoter gene. Co-transfection
with a CMV promoter driven Renilla luciferase plasmid was used to control for
transfection efficiency. We observed a significant increase in IGFBP-1 promoter
activity when cells were treated with SB for 24 hours following transfection (Fig.
3.14 A).
To test if, like, MnSOD, IGFBP-1 activity was regulated by p38 via
FOXO1, we used siRNA to downregulate FOXO1 in the cells. However, as seen,
downregulation of FOXO1 activity had no effect on regulation of IGFBP-1 by p38
(Fig. 3.14 B). This indicates that p38 regulates IGFBP-1 in a FOXO1 independent
manner.

98
DMSO SB DMSO SB
0
500
1000
1500
2000
**
Control siRNA FOXO1 siRN A
IGFBP-1 promoter activity (A.U.)
1 2 3 4 5 6 7 8
A. B.
IGFBP-1

Figure 3.14 p38 regulates IGFBP-1.
(A) Western blot of secreted IGFBP-1 levels from conditioned medium.
Lanes 1-8: 1-Control, 2-Control, 3-Wortmannin (100nm), 4-SB (1.5uM), 5-SB
(10uM), 6-SB (20uM), 7-Insulin, 8-Dexamethasone (B) IGFBP-1 promoter activity
in HepG2 cells transfected with Control or FOXO1 siRNA and treated with
vehicle (DMSO) or SB203580. * p<0.05

99
Chapter 3 Discussion

In this study we demonstrate a mammalian p38 dependent pathway that
can regulate oxidative stress via FOXO and MnSOD (SOD2). Further,
consistent with our findings in yeast, we have observed that Ras also regulates
FOXO activity in mammalian cells. We propose that p38 kinase is possibly a
downstream mediator of Ras signaling to FOXO in mammals. Downregulation of
Ras signaling in yeast not only increases lifespan but also protects cells against
oxidative damage, in part, by activating the stress response transcription factors
Msn2/Msn4 and Gis1. Similarly, in mammals, the FOXO transcription factors
function as essential mediators of stress response by enhancing transcription of
several genes related to DNA damage repair such as DDB1 and GADD45 and
oxidative stress response such as SOD2 and Catalase (Greer and Brunet 2005).
Therefore, our finding that the FOXO factors are regulated by Ras highlights an
essential conserved signaling mechanism between yeast and mammals. It is
important to note that although, in this study, we have examined the role of Ras-
FOXO signaling with regard to oxidative stress response it is very likely that this
pathway also functions in transformation and cancer. The FOXO factors are
known to both prevent apoptosis as well as promote it. Chronic downregulation
of FOXO by activated Ras in a cancer cell for example could prevent apoptosis
and promote growth and replication instead.
The p38 kinase is activated by growth and stress signals. Our findings
reveal the role of this kinase in integrating these signals to converge onto FOXO.
100
The other stress activated map kinase, JNK has been shown to regulate FOXO4
(Kops, Dansen et al. 2002). In response to JNK phosphorylation, FOXO4
translocates to the nucleus. This is in contrast with Akt mediated regulation of
FOXO factors where phosphorylation by Akt results in their nuclear exclusion
(Brunet, Bonni et al. 1999). Our findings reveal that the regulation of FOXO by
p38 is similar to Akt rather than JNK in that p38 inhibition results in nuclear
accumulation of FOXO1. We also provide evidence that this is independent of
Akt. It has already been reported that p38 can phosphorylate FOXO1 at five
residues and none of these sites are phosphorylated by Akt (Asada 2007). We
found that Akt phosphorylation levels remained unchanged following treatment
with the p38 inhibitor nor did this treatment affect Akt mediated phosphorylation
of FOXO1 at Ser 256. Therefore we consider it unlikely that p38 acts upstream
of Akt. We have seen, however, that p38 inhibition leads to an accumulation of
total FOXO1 levels. When phosphorylated by Akt, FOXO is targeted to the
cytoplasm and undergoes ubiquitination and proteasomal degradation (Huang,
Regan et al. 2005). It is possible that phosphorylation by p38 decreases protein
half life of FOXO1 in a similar manner by targeting it to the proteasome. We
observed an increase in total FOXO1 protein levels in livers from p38 α knockout
mice compared with controls implying that p38 regulates FOXO1 in vivo as well.
We have seen that the increase in FOXO1 protein level and activity by p38
inhibition can protect against oxidative stress. This protection appears to be
specific to superoxide because treatment with hydrogen peroxide did not reveal
any significant difference in LDH activity in cells treated or untreated with SB.
101
However, when SB treated cells were treated with Menadione, which generates
both hydrogen peroxide and superoxide they were better protected than control
cells. This observation led us to test if the protective effect was mediated by
MnSOD which is a known FOXO target gene. We observed a FOXO dependent
upregulation of MnSOD following p38 inhibition. Knockdown of MnSOD using
siRNA also reversed the protective effect of p38 inhibition. Again, our results are
in line with data from yeast where downregulation of Sch9 or Ras2 results in an
increase in SOD2 and protection against DNA and oxidative damage(Fabrizio,
Liou et al. 2003; Madia, Gattazzo et al. 2008; Madia, Wei et al. 2009). To gain
insight into the mechanisms of IGF-I pathway regulation by p38 we also
examined if p38 could affect the activity of IGFBP-1 an important FOXO target
gene. As an IGF-I binding protein IGFBP-1 can affect the bioavailability of
FOXO1. While inhibition of p38 resulted in accumulation of secreted IGFBP-1 in
cell culture medium and also enhanced transcriptional activity of the IGFBP-1
promoter, this effect was not dependent on FOXO1. Knockdown of FOXO1
using siRNA did not affect p38 mediated regulation of IGFBP-1. At the present
time it is not know if p38 can affect any of the other FOXO transcription factors
but it will be interesting to see if regulation of IGFBP-1 by p38 is mediated by any
FOXO other than FOXO1(Frost, Nystrom et al. 2000). Our findings are in
contrast to studies that have demonstrated that p38 can induced IGFBP-1
expression (Frost, Nystrom et al. 2000; Nagashima, Maeda-Nakamura et al.
2007). It is possible that stress (Toxins, Cytokines, inflammation) versus growth
signals (IGF-1, Ras etc) could affect p38 signaling in different ways.
102
Collectively, our data imply that p38 regulates stress resistance in mammalian
cells in two ways – firstly, p38 can downregulate FOXO transcription factors and
prevent the upregulation of MnSOD when cells experience oxidative damage.
Secondly, p38 can enhance IGF-1 pathway activity by preventing the activation
of IGFBP-1. IGFBP-1 binds to and reduces the bioavailability of IGF-1. In its
absence, IGF-1 signaling can result in a feed forward signaling loop that
activates Akt and Ras activity leading to increase in p38 activity and a reduction
in FOXO1- MnSOD. This would lead to decreased cellular protection against
oxidative insults. Based on these results we propose a p38 signaling model
which is shown in Fig. 3.15.

103
MnSOD
Ras
p38
FOXO1
OXIDATIVE STRESS PROTECTION
Akt
IGF-I
IGFBP-1

Fig. 3.15 Model for p38 mediated oxidative stress protection in mammalian
cells via FOXO and IGFBP-1.
IGF-1 initiates signaling through its two main downstream components Akt and
Ras. These signals converge on FOXO and inactivate it. We propose that p38
plays a role in this signaling process by regulating FOXO1 possibly downstream
of Ras. Inactivation of FOXO1 by p38 inhibits upregulation of MnSOD and
sensitizes cells to oxidative stress. p38 can also independently regulate IGFBP-1
and possibly initiate a feed-forward signaling loop through IGF-1.

104
CHAPTER 4
CONCLUSIONS

The pro-aging role of the GH/IGF-I pathway is already well established not
only in mammals but also in lower organisms that have orthologs of mammalian
IGF-1 pathway proteins (Kenyon, Chang et al. 1993; Clancy, Gems et al. 2001;
Fabrizio, Pozza et al. 2001; Tatar, Kopelman et al. 2001). It was recently shown
that Rhesus macaque monkeys on a CR diet have delayed mortality
accompanied by delayed onset of cancer, cardiovascular disease and other age-
related pathologies (Colman, Anderson et al. 2009). Heterozygous mutations that
reduce activity of the IGF-1 receptor a overrepresented in centenarians
compared with controls indicating that reduced activity of the IGF-I receptor is
associated with extended lifespan in humans as well (Suh, Atzmon et al. 2008).
In Chapter 2 of this dissertation, I have presented results from the study of
a human population with reduced IGF-1 signaling due to a Growth Hormone
Receptor Deficiency (GHRD). Our analysis reveals that these individuals are
highly protected against cancer and diabetes – two major age-related
pathologies. Analysis of mechanisms that are responsible for this observation
point towards a general reduction in growth factor signaling pathways (Ras, PKA,
TOR) that converge on stress transcription factors (possibly FOXO) and stress
protective genes (SOD2). These highly conserved signal transduction proteins
that are part of the IGF-1 pathway have been shown to also be involved in stress
protection and longevity in lower organisms. Of these, the FOXO homolog Daf16
105
was one of the first proteins described in lifespan regulation of C. elegans
(Kenyon, Chang et al. 1993). Its mammalian homolog, FoxO, has been shown to
be an important regulator of transcription of many stress protective genes
including SOD2, catalase, DDB1 etc. Chapter 3 of this dissertation describes my
study of the regulation of FOXO1 and oxidative stress by Ras and the stress
activated MAPK, p38 in mammalian cells. I conclude, on the basis of these
studies that reduced GH/IGF-1 signaling can promote healthy aging in humans
by a switch from pro-growth to protective signaling. This signaling appears to
require the downregulation of proteins such as Ras, TOR etc. and upregulation of
oxidative stress and DNA damage protective genes via FOXO.
The studies described in the preceding chapters highlight that the very
same mechanisms that exist to promote stress protection and lifespan extension
in lower organisms also function in humans. Reduced growth factor signaling in
particular through the IGF-1 pathway implies higher expression of stress
protective genes, reduced neoplastic disease and extended lifespan. Conversely,
increased signaling through this pathway can lead to unregulated growth, DNA
damage and cancer. Infact, activating mutations in Ras and Akt signaling are
frequently detected in human cancers (Rodriguez-Viciana, Tetsu et al. 2005;
Toker and Yoeli-Lerner 2006). Our laboratory has recently exploited this trade-off
between growth and maintenance in a “Differential Stress Resistance” (DSR)
based strategy to protect normal but not cancer cells from the toxic effects of
chemotherapy (Lee, Safdie et al.; Raffaghello, Lee et al. 2008). This technique,
which is dependent in part on IGF-1 signaling, utilizes the concept that normal
106
cells can upregulate their stress protection systems when deprived of growth
factors whereas cancer cells are in a permanently ‘on’ state due to mutations and
cannot upregulate their defense mechanisms under similar conditions. As a
result normal cells are protected while cancer cells succumb to oxidative stress /
chemotherapy (Lee, Safdie et al.; Raffaghello, Lee et al. 2008). We now
demonstrate that a lifelong reduction in IGF-1 levels as a result of Growth
Hormone Receptor Deficiency in humans protects against cancer as well as
diabetes.
As described in chapter 2, the Ecuadorian GHRD cohort consists of
individuals ranging in age from 9 months to 86 years. Since both cancer and
diabetes are age-related diseases, we would expect the incidence of both
diseases to increase as a function of age. We have observed only one case of
cancer and no cases of diabetes in this GHRD population. No cancer or diabetes
related mortality has been recorded in this population. It is important to continue
to monitor for cancer and diabetes as this population ages.
It has been proposed that higher IGF-1 levels are associated with
carcinogenesis and progression of early established tumors due to the survival
rather than apoptosis of damaged cells (Pollak 2004). In agreement with this, we
have shown that reduced IGF-1 levels promote apoptosis in damaged cells.
Additionally, we show that low IGF-1 levels can protect cells from DNA damage.
This observation is very similar to our yeast studies where we have seen that
sch9 ∆ mutant yeast cells accumulate less DNA damage than their WT
counterparts (Madia, Wei et al. 2009). Thus, we show evidence for a new
107
mechanism of protection from cancer in human cells which relies on lower DNA
damage. In yeast we have observed that this protection is dependent upon
reduced activity of the error prone repair enzyme Rev1 and it will be very
interesting to study if a similar situation exists in mammalian cells (Madia, Wei et
al. 2009).
The absence of Type 2 diabetes in the Ecuadorian GHRD subjects is very
interesting considering the high (21%) incidence of obesity in this cohort. Obesity
is intimately linked with diabetes due to the fact that obesity can cause Insulin
resistance. Several subjects in this population are overweight with BMI > 25
kg/m
2
. Considering unequal body proportions, when height-age corrections are
applied, most subjects considered overweight are actually obese. The already
high obesity level (21%) that we have seen in this population is quite possibly an
underestimation because of the reported distorted body proportions (Rosenfeld,
Rosenbloom et al. 1994). Nevertheless, the fact remains that unlike their
unaffected relatives or compared with the 5% diabetes incidence in Ecuador, the
GHRD subjects that we have studied did not develop diabetes at any age. In this
context, it is interesting to note that the GHRKO mice, a model for GHRD are
known to be highly insulin sensitive (Coschigano, Clemmons et al. 2000;
Coschigano, Holland et al. 2003; Liu, Coschigano et al. 2004). It has been
proposed, in CR mice, GH resistant or GHRKO mice that increased insulin
sensitivity and low circulating levels of insulin are responsible, in part, for the
extended lifespan seen in these mice (Dominici, Hauck et al. 2002; Masternak,
108
Panici et al. 2009). It is also interesting to note that while normal insulin levels
decline with age, a high level of insulin sensitivity is observed in centenarians.
Liver IGF-1 Deficient mice (LID) have a 75% reduction in IGF-1 levels and high
GH levels. As GH is an inhibitor of Insulin action, it is seen that the LID mice are
insulin resistant. When these mice were crossed with GH antagonist mice, to
inhibit the activity of GH, they exhibited enhanced insulin sensitivity and better
glucose uptake (Yakar, Setser et al. 2004). High insulin sensitivity in GHRD
subjects could explain the absence of diabetes in these subjects due to
essentially the same physiological phenomena of low IGF-1 levels and high but
unusable GH levels. It will be important to test the insulin sensitivity of GHRD
subjects via glucose tolerance tests (GTT) to analyze if GHRD subjects exhibit
enhanced insulin sensitivity compared with controls.
The FOXO transcription factors play a very central role in IGF-1 pathway
signaling in many model organisms. They are involved in a vast array of cellular
functions such as oxidative stress protection, DNA damage protection, anti
apoptotic as well as apoptotic functions, cell turnover, metabolic function and
also tumorigenesis (Greer and Brunet 2005). The data presented in this
dissertation suggests that FOXO factors and the genes that they regulate are
mediators of not only stress protection but also cancer and may be essential
molecular links between aging and age-related diseases. Of the 44 genes that
were upregulated in human mammary epithelial cells (HMEC) treated with serum
from GHRD subjects (described in chapter 2), four genes are known FOXO
targets. While we did not see a significant upregulation of FOXO mRNA itself,
109
this might be because of the fact that FOXO is regulated mostly by post-
transcriptional modification; low IGF-1 signaling can upregulate FOXO by
dephosphorylation and nuclear retention. When in the cytoplasm, under
conditions of high IGF-1 signaling, FOXO factors are ubiquitinated and targeted
for proteasomal degradation (Brunet, Bonni et al. 1999; Huang, Regan et al.
2005). Infact, it appears that expression and/or protein stability is altered of
FOXO1 is altered by Ras and p38 described in chapter 3, where we observed
higher total FOXO1 protein levels following inhibition of Ras or p38. Interestingly,
Al-Regaiey et al have demonstrated increased mRNA levels of both FOXO1 and
SOD2 in GHRKO mice compared with WT controls (Al-Regaiey, Masternak et al.
2005). In their study, the authors also observed higher levels of active p38 in the
GHRKO mice. In contrast, our studies imply that high p38 activity would
downregulate FOXO1 and SOD2 in N-Ras activated HepG2 human liver cancer
cells. We attribute this difference to the fact that p38 can be activated by both
stress and growth factors and may have different functions under these different
conditions (Freshney, Rawlinson et al. 1994; Rouse, Cohen et al. 1994; Foltz and
Schrader 1997).
Consistent with findings in HepG2 cells, we observed reduced expression
of N-Ras and increased expression of SOD2 in human mammary epithelial cells
(HMEC) incubated with GHRD serum. Although the Ras/PKA pathway has been
shown by us to be important in lifespan and stress regulation of yeast cells no
studies have demonstrated the existence of this in mammalian cells (Fabrizio,
Pozza et al. 2001). The regulation of FOXO by Ras coupled with the finding that
110
both N-Ras and PKA mRNA is downregulated and FOXO regulated genes are
upregulated in HMEC points in the direction of the existence of a similar Ras
mediated signaling pathway in mammals. Our data suggests that p38 could be a
mediator of Ras signaling to FOXO although it remains to be seen if PKA or other
kinases acting downstream of Ras are also involved. Further studies are required
to establish the existence of this signaling mechanism in mammalian cells.
It is very likely that SOD2 also plays an important role in DNA damage
protection as seen in HMEC treated with GHRD serum compared with controls.
This idea stems from studies in yeast where increased SOD2 levels protect
sch9 ∆ cells against oxidative damage to DNA (Madia, Wei et al. 2009). Further,
sch9 ∆ can protect against point mutations, base substitutions and Gross
Chromosomal Rearrangements (GCR) in part, through donwregulation of the
error prone repair enzyme Rev1. We used the comet assay to analyze DNA
damage in mammary epithelial cells. The comet assay performed under alkaline
conditions predominantly measures single and double strand DNA breaks. The
presence of double strand breaks in the DNA can lead to mutations or sensitize
cells to apoptotic death (Jackson 2002). Future studies aimed at understanding if
and what types of mutations accumulate in these cells under treatment
conditions described us are important. Also, considering the remarkable
conservation of signaling that we have observed in yeast and humans, it will be
interesting to see if, like yeast cells the accumulation of mutations is dependent
on Rev1 expression. Our laboratory is currently developing a PCR based assay
to detect random genomic mutations in the p53 gene in epithelial cells. This
111
method has previously been shown to be sensitive enough to detect mutations at
a frequency of 1 in 10
8
base pairs in Human Dermal Fibroblast cells (Bielas and
Loeb 2005). As our model cells, HMEC are human breast cells, the analysis of
mutation accumulation in these cells is particularly interesting because mutations
in p53 play an important role in breast cancer tumorigenesis (Coles, Condie et al.
1992).
It is important to bear in mind that GH/IGF-1 signaling is the main hormone
system in the body that ensures adequate growth and development in
mammalian models as well as humans (Kopchick and Andry 2000). In humans,
reduced GH signaling is accompanied by dwarfism and underdevelopment while
an excess is associated with gigantism and acromegaly. There is a natural and
inevitable decline in GH levels with age in all mammalian species (Crew, Spindler
et al. 1987). This decline in GH levels also results in a reduction in IGF-1 levels
and in humans, is associated with a loss in skeletal muscle mass, increased
body fat and decreased physical, mental and immune fitness (Veldhuis,
Iranmanesh et al. 1997). Termed somatopause, this reduction in GH levels in the
elderly reaches levels as low as that seen in GH deficient younger individuals
(Zadik, Chalew et al. 1985). Some positive effects of administering GH to adults
with adult onset or childhood onset GH deficiency have been noted. These
include improved levels of LDL and HDL cholesterol and decrease in body mass
(Boguszewski, Meister et al. 2005). The biggest beneficial aspect of this therapy
lies in the ability of GH to stimulate muscle protein synthesis and prevent muscle
breakdown (Salomon, Cuneo et al. 1989). The studies raise the question of
112
whether it is beneficial to administer GH to the general aging population in order
to restore youthfulness. The data presented in this dissertation imply that the
potential for GH signaling to promote cancer and diabetes may outweigh the
benefits associated with GH treatments. Infact, other studies involving GH
therapy in aged adults have not resulted in beneficial effects except for one study
where GH was administered in combination with testosterone (Blackman, Sorkin
et al. 2002). The observed side effects of GH therapy include impaired glucose
regulation and diabetes (Nass and Thorner 2002). These studies suggest that
GH therapy in non GH-deficient adults could have the unwanted side effects of
increased cancer and diabetes incidence in these individuals.
In conclusion, despite the expected trade-off in terms of growth and
development, our studies suggest that reduced GH/IGF-1 signaling in humans
can be beneficial in terms of protection from oxidative stress, DNA damage,
cancer and diabetes. The mechanisms involved in this protection include
signaling proteins that act downstream of growth factor pathways such as Ras,
TOR, FOXO and SOD2.

113
Bibliography
Al-Regaiey, K. A., M. M. Masternak, et al. (2005). "Long-lived growth hormone
receptor knockout mice: interaction of reduced insulin-like growth factor i/insulin
signaling and caloric restriction." Endocrinology 146(2): 851-60.
Alessi, D. R., F. B. Caudwell, et al. (1996). "Molecular basis for the substrate
specificity of protein kinase B; comparison with MAPKAP kinase-1 and p70 S6
kinase." FEBS Lett 399(3): 333-8.
Alessi, D. R., S. R. James, et al. (1997). "Characterization of a 3-
phosphoinositide-dependent protein kinase which phosphorylates and activates
protein kinase Balpha." Curr Biol 7(4): 261-9.
Amselem, S., M. L. Sobrier, et al. (1991). "Recurrent nonsense mutations in the
growth hormone receptor from patients with Laron dwarfism." J Clin Invest 87(3):
1098-102.
Asada, S., H. Daitoku, et al. (2007). "Mitogen-activated protein kinases, Erk and
p38, phosphorylate and regulate Foxo1." Cell Signal 19(3): 519-27.
Bachrach, L. K., R. Marcus, et al. (1998). "Bone mineral, histomorphometry, and
body composition in adults with growth hormone receptor deficiency." J Bone
Miner Res 13(3): 415-21.
Bartke, A. (2005). "Insulin resistance and cognitive aging in long-lived and short-
lived mice." J Gerontol A Biol Sci Med Sci 60(1): 133-4.
Bartke, A. (2005). "Minireview: role of the growth hormone/insulin-like growth
factor system in mammalian aging." Endocrinology 146(9): 3718-23.
Berg, M. A., J. Argente, et al. (1993). "Diverse growth hormone receptor gene
mutations in Laron syndrome." Am J Hum Genet 52(5): 998-1005.
Berg, M. A., J. Guevara-Aguirre, et al. (1992). "Mutation creating a new splice
site in the growth hormone receptor genes of 37 Ecuadorean patients with Laron
syndrome." Hum Mutat 1(1): 24-32.
Berg, M. A., R. Peoples, et al. (1994). "Receptor mutations and haplotypes in
growth hormone receptor deficiency: a global survey and identification of the
Ecuadorean E180splice mutation in an oriental Jewish patient." Acta Paediatr
Suppl 399: 112-4.
114
Bielas, J. H. and L. A. Loeb (2005). "Quantification of random genomic
mutations." Nat Methods 2(4): 285-90.
Blackman, M. R., J. D. Sorkin, et al. (2002). "Growth hormone and sex steroid
administration in healthy aged women and men: a randomized controlled trial."
JAMA 288(18): 2282-92.
Boguszewski, C. L., L. H. Meister, et al. (2005). "One year of GH replacement
therapy with a fixed low-dose regimen improves body composition, bone mineral
density and lipid profile of GH-deficient adults." Eur J Endocrinol 152(1): 67-75.
Bos, J. L. (1989). "ras oncogenes in human cancer: a review." Cancer Res
49(17): 4682-9.
Brachmann, C. B., A. Davies, et al. (1998). "Designer deletion strains derived
from Saccharomyces cerevisiae S288C: a useful set of strains and plasmids for
PCR-mediated gene disruption and other applications." Yeast 14(2): 115-32.
Brown-Borg, H. M., K. E. Borg, et al. (1996). "Dwarf mice and the ageing
process." Nature 384(6604): 33.
Brownawell, A. M., G. J. Kops, et al. (2001). "Inhibition of nuclear import by
protein kinase B (Akt) regulates the subcellular distribution and activity of the
forkhead transcription factor AFX." Mol Cell Biol 21(10): 3534-46.
Brunet, A., A. Bonni, et al. (1999). "Akt promotes cell survival by phosphorylating
and inhibiting a Forkhead transcription factor." Cell 96(6): 857-68.
Brunet, A., F. Kanai, et al. (2002). "14-3-3 transits to the nucleus and participates
in dynamic nucleocytoplasmic transport." J Cell Biol 156(5): 817-28.
Brunet, A., J. Park, et al. (2001). "Protein kinase SGK mediates survival signals
by phosphorylating the forkhead transcription factor FKHRL1 (FOXO3a)." Mol
Cell Biol 21(3): 952-65.
Brunet, A., L. B. Sweeney, et al. (2004). "Stress-dependent regulation of FOXO
transcription factors by the SIRT1 deacetylase." Science 303(5666): 2011-5.
Burgering, B. M. and P. J. Coffer (1995). "Protein kinase B (c-Akt) in
phosphatidylinositol-3-OH kinase signal transduction." Nature 376(6541): 599-
602.
Burgering, B. M. and R. H. Medema (2003). "Decisions on life and death: FOXO
Forkhead transcription factors are in command when PKB/Akt is off duty." J
Leukoc Biol 73(6): 689-701.
115
Busuttil, R. A., A. M. Garcia, et al. (2005). "Organ-specific increase in mutation
accumulation and apoptosis rate in CuZn-superoxide dismutase-deficient mice."
Cancer Res 65(24): 11271-5.
Campisi, J. and F. d'Adda di Fagagna (2007). "Cellular senescence: when bad
things happen to good cells." Nat Rev Mol Cell Biol 8(9): 729-40.
Cardone, M. H., N. Roy, et al. (1998). "Regulation of cell death protease
caspase-9 by phosphorylation." Science 282(5392): 1318-21.
Casanueva, F. F. (1992). "Physiology of growth hormone secretion and action."
Endocrinol Metab Clin North Am 21(3): 483-517.
Chalhoub, N. and S. J. Baker (2009). "PTEN and the PI3-kinase pathway in
cancer." Annu Rev Pathol 4: 127-50.
Chan, S. J., Q. P. Cao, et al. (1990). "Evolution of the insulin superfamily: cloning
of a hybrid insulin/insulin-like growth factor cDNA from amphioxus." Proc Natl
Acad Sci U S A 87(23): 9319-23.
Cheadle, C., Y. S. Cho-Chung, et al. (2003). "Application of z-score
transformation to Affymetrix data." Appl Bioinformatics 2(4): 209-17.
Cichy, S. B., S. Uddin, et al. (1998). "Protein kinase B/Akt mediates effects of
insulin on hepatic insulin-like growth factor-binding protein-1 gene expression
through a conserved insulin response sequence." J Biol Chem 273(11): 6482-7.
Clancy, D. J., D. Gems, et al. (2001). "Extension of life-span by loss of CHICO, a
Drosophila insulin receptor substrate protein." Science 292(5514): 104-6.
Coffer, P. J., J. Jin, et al. (1998). "Protein kinase B (c-Akt): a multifunctional
mediator of phosphatidylinositol 3-kinase activation." Biochem J 335 ( Pt 1): 1-13.
Cohen, E., J. F. Paulsson, et al. (2009). "Reduced IGF-1 signaling delays age-
associated proteotoxicity in mice." Cell 139(6): 1157-69.
Colao, A., D. Ferone, et al. (2004). "Systemic complications of acromegaly:
epidemiology, pathogenesis, and management." Endocr Rev 25(1): 102-52.
Coles, C., A. Condie, et al. (1992). "p53 mutations in breast cancer." Cancer Res
52(19): 5291-8.
Colman, R. J., R. M. Anderson, et al. (2009). "Caloric restriction delays disease
onset and mortality in rhesus monkeys." Science 325(5937): 201-4.
116
Coschigano, K. T., D. Clemmons, et al. (2000). "Assessment of growth
parameters and life span of GHR/BP gene-disrupted mice." Endocrinology
141(7): 2608-13.
Coschigano, K. T., A. N. Holland, et al. (2003). "Deletion, but not antagonism, of
the mouse growth hormone receptor results in severely decreased body weights,
insulin, and insulin-like growth factor I levels and increased life span."
Endocrinology 144(9): 3799-810.
Crew, M. D., S. R. Spindler, et al. (1987). "Age-related decrease of growth
hormone and prolactin gene expression in the mouse pituitary." Endocrinology
121(4): 1251-5.
Datta, S. R., H. Dudek, et al. (1997). "Akt phosphorylation of BAD couples
survival signals to the cell-intrinsic death machinery." Cell 91(2): 231-41.
de Vos, A. M., M. Ultsch, et al. (1992). "Human growth hormone and extracellular
domain of its receptor: crystal structure of the complex." Science 255(5042): 306-
12.
del Peso, L., M. Gonzalez-Garcia, et al. (1997). "Interleukin-3-induced
phosphorylation of BAD through the protein kinase Akt." Science 278(5338): 687-
9.
Denhardt, D. T. (1996). "Signal-transducing protein phosphorylation cascades
mediated by Ras/Rho proteins in the mammalian cell: the potential for multiplex
signalling." Biochem J 318 ( Pt 3): 729-47.
Di Cristofano, A., P. Kotsi, et al. (1999). "Impaired Fas response and
autoimmunity in Pten+/- mice." Science 285(5436): 2122-5.
Di Cristofano, A. and P. P. Pandolfi (2000). "The multiple roles of PTEN in tumor
suppression." Cell 100(4): 387-90.
Dijkers, P. F., R. H. Medema, et al. (2000). "Expression of the pro-apoptotic Bcl-2
family member Bim is regulated by the forkhead transcription factor FKHR-L1."
Curr Biol 10(19): 1201-4.
DiPaola, R. S. (2002). "To arrest or not to G(2)-M Cell-cycle arrest : commentary
re: A. K. Tyagi et al., Silibinin strongly synergizes human prostate carcinoma
DU145 cells to doxorubicin-induced growth inhibition, G(2)-M arrest, and
apoptosis. Clin. cancer res., 8: 3512-3519, 2002." Clin Cancer Res 8(11): 3311-
4.
117
Dolado, I., A. Swat, et al. (2007). "p38alpha MAP kinase as a sensor of reactive
oxygen species in tumorigenesis." Cancer Cell 11(2): 191-205.
Dominici, F. P., S. Hauck, et al. (2002). "Increased insulin sensitivity and
upregulation of insulin receptor, insulin receptor substrate (IRS)-1 and IRS-2 in
liver of Ames dwarf mice." J Endocrinol 173(1): 81-94.
Durham, S. K., A. Suwanichkul, et al. (1999). "FKHR binds the insulin response
element in the insulin-like growth factor binding protein-1 promoter."
Endocrinology 140(7): 3140-6.
Eshet, R., S. Peleg, et al. (1985). "Some properties of the plasma hGH activity in
patients with Laron-type dwarfism determined by a radioreceptor assay using
human liver tissue." Horm Res 22(4): 276-83.
Essers, M. A., S. Weijzen, et al. (2004). "FOXO transcription factor activation by
oxidative stress mediated by the small GTPase Ral and JNK." EMBO J 23(24):
4802-12.
Fabrizio, P., L. Battistella, et al. (2004). "Superoxide is a mediator of an altruistic
aging program in Saccharomyces cerevisiae." J Cell Biol 166(7): 1055-67.
Fabrizio, P., L. Li, et al. (2005). "Analysis of gene expression profile in yeast
aging chronologically." Mech Ageing Dev 126(1): 11-6.
Fabrizio, P., L. L. Liou, et al. (2003). "SOD2 functions downstream of Sch9 to
extend longevity in yeast." Genetics 163(1): 35-46.
Fabrizio, P. and V. D. Longo (2003). "The chronological life span of
Saccharomyces cerevisiae." Aging Cell 2(2): 73-81.
Fabrizio, P., F. Pozza, et al. (2001). "Regulation of longevity and stress
resistance by Sch9 in yeast." Science 292(5515): 288-90.
Fielder, P. J., J. Guevara-Aguirre, et al. (1992). "Expression of serum insulin-like
growth factors, insulin-like growth factor-binding proteins, and the growth
hormone-binding protein in heterozygote relatives of Ecuadorian growth hormone
receptor deficient patients." J Clin Endocrinol Metab 74(4): 743-50.
Flurkey, K., J. Papaconstantinou, et al. (2002). "The Snell dwarf mutation
Pit1(dw) can increase life span in mice." Mech Ageing Dev 123(2-3): 121-30.
Foltz, I. N. and J. W. Schrader (1997). "Activation of the stress-activated protein
kinases by multiple hematopoietic growth factors with the exception of
interleukin-4." Blood 89(9): 3092-6.
118
Fontana, L., E. P. Weiss, et al. (2008). "Long-term effects of calorie or protein
restriction on serum IGF-1 and IGFBP-3 concentration in humans." Aging Cell
7(5): 681-7.
Fontana, L., E. P. Weiss, et al. (2009). "IGF-1, nutrition and aging: the big
picture." Aging Cell.
Freshney, N. W., L. Rawlinson, et al. (1994). "Interleukin-1 activates a novel
protein kinase cascade that results in the phosphorylation of Hsp27." Cell 78(6):
1039-49.
Frost, R. A., G. J. Nystrom, et al. (2000). "Stimulation of insulin-like growth factor
binding protein-1 synthesis by interleukin-1beta: requirement of the mitogen-
activated protein kinase pathway." Endocrinology 141(9): 3156-64.
Fryburg, D. A., R. A. Gelfand, et al. (1991). "Growth hormone acutely stimulates
forearm muscle protein synthesis in normal humans." Am J Physiol 260(3 Pt 1):
E499-504.
Furuyama, T., T. Nakazawa, et al. (2000). "Identification of the differential
distribution patterns of mRNAs and consensus binding sequences for mouse
DAF-16 homologues." Biochem J 349(Pt 2): 629-34.
Garcia-Martinez, J. M. and D. R. Alessi (2008). "mTOR complex 2 (mTORC2)
controls hydrophobic motif phosphorylation and activation of serum- and
glucocorticoid-induced protein kinase 1 (SGK1)." Biochem J 416(3): 375-85.
Garcia, A. M., R. A. Busuttil, et al. (2008). "Effect of Ames dwarfism and caloric
restriction on spontaneous DNA mutation frequency in different mouse tissues."
Mech Ageing Dev 129(9): 528-33.
Gargosky, S. E., K. F. Wilson, et al. (1993). "The composition and distribution of
insulin-like growth factors (IGFs) and IGF-binding proteins (IGFBPs) in the serum
of growth hormone receptor-deficient patients: effects of IGF-I therapy on IGFBP-
3." J Clin Endocrinol Metab 77(6): 1683-9.
Ge, B., H. Gram, et al. (2002). "MAPKK-independent activation of p38alpha
mediated by TAB1-dependent autophosphorylation of p38alpha." Science
295(5558): 1291-4.
Giannakou, M. E., M. Goss, et al. (2008). "Role of dFOXO in lifespan extension
by dietary restriction in Drosophila melanogaster: not required, but its activity
modulates the response." Aging Cell 7(2): 187-98.
119
Giannakou, M. E. and L. Partridge (2007). "Role of insulin-like signalling in
Drosophila lifespan." Trends Biochem Sci 32(4): 180-8.
Giustina, A., T. Scalvini, et al. (1997). "Maturation of the regulation of growth
hormone secretion in young males with hypogonadotropic hypogonadism
pharmacologically exposed to progressive increments in serum testosterone." J
Clin Endocrinol Metab 82(4): 1210-9.
Giustina, A. and J. D. Veldhuis (1998). "Pathophysiology of the neuroregulation
of growth hormone secretion in experimental animals and the human." Endocr
Rev 19(6): 717-97.
Godfrey, P., J. O. Rahal, et al. (1993). "GHRH receptor of little mice contains a
missense mutation in the extracellular domain that disrupts receptor function."
Nat Genet 4(3): 227-32.
Gomez del Arco, P., S. Martinez-Martinez, et al. (2000). "A role for the p38 MAP
kinase pathway in the nuclear shuttling of NFATp." J Biol Chem 275(18): 13872-
8.
Gravholt, C. H., O. Schmitz, et al. (1999). "Effects of a physiological GH pulse on
interstitial glycerol in abdominal and femoral adipose tissue." Am J Physiol 277(5
Pt 1): E848-54.
Greer, E. L. and A. Brunet (2005). "FOXO transcription factors at the interface
between longevity and tumor suppression." Oncogene 24(50): 7410-25.
Greer, E. L. and A. Brunet (2009). "Different dietary restriction regimens extend
lifespan by both independent and overlapping genetic pathways in C. elegans."
Aging Cell 8(2): 113-27.
Groisman, R., J. Polanowska, et al. (2003). "The ubiquitin ligase activity in the
DDB2 and CSA complexes is differentially regulated by the COP9 signalosome
in response to DNA damage." Cell 113(3): 357-67.
Guan, Z., S. Y. Buckman, et al. (1998). "Interleukin-1beta-induced
cyclooxygenase-2 expression requires activation of both c-Jun NH2-terminal
kinase and p38 MAPK signal pathways in rat renal mesangial cells." J Biol Chem
273(44): 28670-6.
Guan, Z., S. Y. Buckman, et al. (1998). "Induction of cyclooxygenase-2 by the
activated MEKK1 --> SEK1/MKK4 --> p38 mitogen-activated protein kinase
pathway." J Biol Chem 273(21): 12901-8.

120
Guevara-Aguirre J, D. l. T. W., Rosenbloom AL, Acosta M, Rosenfeld RG (1991).
Osteopenia in menstruating women with low IGF-I levels due growth hormone
receptor deficiency. 73rd Annual Meeting of the Endocrine Society. Washington,
DC, Bethesda, MD, Endocrine Society 385.
Guevara-Aguirre, J., A. L. Rosenbloom, et al. (1993). "Growth hormone receptor
deficiency in Ecuador: clinical and biochemical phenotype in two populations." J
Clin Endocrinol Metab 76(2): 417-23.
Guo, S., S. B. Cichy, et al. (2001). "Insulin suppresses transactivation by
CAAT/enhancer-binding proteins beta (C/EBPbeta). Signaling to p300/CREB-
binding protein by protein kinase B disrupts interaction with the major activation
domain of C/EBPbeta." J Biol Chem 276(11): 8516-23.
Hancock, J. F. (2003). "Ras proteins: different signals from different locations."
Nat Rev Mol Cell Biol 4(5): 373-84.
Hartman, M. L., A. C. Faria, et al. (1991). "Temporal structure of in vivo growth
hormone secretory events in humans." Am J Physiol 260(1 Pt 1): E101-10.
Hasty, P., J. Campisi, et al. (2003). "Aging and genome maintenance: lessons
from the mouse?" Science 299(5611): 1355-9.
Hlavata, L. and T. Nystrom (2003). "Ras proteins control mitochondrial
biogenesis and function in Saccharomyces cerevisiae." Folia Microbiol (Praha)
48(6): 725-30.
Ho, K. Y., W. S. Evans, et al. (1987). "Effects of sex and age on the 24-hour
profile of growth hormone secretion in man: importance of endogenous estradiol
concentrations." J Clin Endocrinol Metab 64(1): 51-8.
Hollenbach, E., M. Neumann, et al. (2004). "Inhibition of p38 MAP kinase- and
RICK/NF-kappaB-signaling suppresses inflammatory bowel disease." FASEB J
18(13): 1550-2.
Holzenberger, M., J. Dupont, et al. (2003). "IGF-1 receptor regulates lifespan and
resistance to oxidative stress in mice." Nature 421(6919): 182-7.
Huang, H., K. M. Regan, et al. (2005). "Skp2 inhibits FOXO1 in tumor
suppression through ubiquitin-mediated degradation." Proc Natl Acad Sci U S A
102(5): 1649-54.
Hwangbo, D. S., B. Gershman, et al. (2004). "Drosophila dFOXO controls
lifespan and regulates insulin signalling in brain and fat body." Nature 429(6991):
562-6.
121
Ikeno, Y., R. T. Bronson, et al. (2003). "Delayed occurrence of fatal neoplastic
diseases in ames dwarf mice: correlation to extended longevity." J Gerontol A
Biol Sci Med Sci 58(4): 291-6.
Ikeno, Y., G. B. Hubbard, et al. (2009). "Reduced incidence and delayed
occurrence of fatal neoplastic diseases in growth hormone receptor/binding
protein knockout mice." J Gerontol A Biol Sci Med Sci 64(5): 522-9.
Jackson, S. P. (2002). "Sensing and repairing DNA double-strand breaks."
Carcinogenesis 23(5): 687-96.
Janknecht, R. and T. Hunter (1997). "Convergence of MAP kinase pathways on
the ternary complex factor Sap-1a." EMBO J 16(7): 1620-7.
Johnson, G. V. and C. D. Bailey (2003). "The p38 MAP kinase signaling pathway
in Alzheimer's disease." Exp Neurol 183(2): 263-8.
Juo, P., C. J. Kuo, et al. (1997). "Fas activation of the p38 mitogen-activated
protein kinase signalling pathway requires ICE/CED-3 family proteases." Mol Cell
Biol 17(1): 24-35.
Kaiser, C., M. S., et al. (1994). Methods in yeast genetics. New York, Cold Spring
Harbor Laboratory Press.
Kennedy, M. A., S. G. Rakoczy, et al. (2003). "Long-living Ames dwarf mouse
hepatocytes readily undergo apoptosis." Exp Gerontol 38(9): 997-1008.
Kenyon, C. (2001). "A conserved regulatory system for aging." Cell 105(2): 165-
8.
Kenyon, C., J. Chang, et al. (1993). "A C. elegans mutant that lives twice as long
as wild type." Nature 366(6454): 461-4.
Kim, S. Y. and D. J. Volsky (2005). "PAGE: parametric analysis of gene set
enrichment." BMC Bioinformatics 6: 144.
Kojima, M., H. Hosoda, et al. (1999). "Ghrelin is a growth-hormone-releasing
acylated peptide from stomach." Nature 402(6762): 656-60.
Kopchick, J. J. and J. M. Andry (2000). "Growth hormone (GH), GH receptor, and
signal transduction." Mol Genet Metab 71(1-2): 293-314.
Kops, G. J., T. B. Dansen, et al. (2002). "Forkhead transcription factor FOXO3a
protects quiescent cells from oxidative stress." Nature 419(6904): 316-21.
122
Kops, G. J., N. D. de Ruiter, et al. (1999). "Direct control of the Forkhead
transcription factor AFX by protein kinase B." Nature 398(6728): 630-4.
Kovtun, I. V., Y. Liu, et al. (2007). "OGG1 initiates age-dependent CAG
trinucleotide expansion in somatic cells." Nature 447(7143): 447-52.
Laron, Z., A. Pertzelan, et al. (1966). "Genetic pituitary dwarfism with high serum
concentation of growth hormone--a new inborn error of metabolism?" Isr J Med
Sci 2(2): 152-5.
Larsen, P. L., P. S. Albert, et al. (1995). "Genes that regulate both development
and longevity in Caenorhabditis elegans." Genetics 139(4): 1567-83.
Lee, C., F. M. Safdie, et al. "Reduced levels of IGF-I mediate differential
protection of normal and cancer cells in response to fasting and improve
chemotherapeutic index." Cancer Res 70(4): 1564-72.
Lerner, E. C., Y. Qian, et al. (1995). "Ras CAAX peptidomimetic FTI-277
selectively blocks oncogenic Ras signaling by inducing cytoplasmic accumulation
of inactive Ras-Raf complexes." J Biol Chem 270(45): 26802-6.
Leung, D. W., S. A. Spencer, et al. (1987). "Growth hormone receptor and serum
binding protein: purification, cloning and expression." Nature 330(6148): 537-43.
Li, J., Q. E. Wang, et al. (2006). "DNA damage binding protein component DDB1
participates in nucleotide excision repair through DDB2 DNA-binding and cullin
4A ubiquitin ligase activity." Cancer Res 66(17): 8590-7.
Li, Y., W. Xu, et al. (2008). "SirT1 inhibition reduces IGF-I/IRS-2/Ras/ERK1/2
signaling and protects neurons." Cell Metab 8(1): 38-48.
Liu, J. L., K. T. Coschigano, et al. (2004). "Disruption of growth hormone receptor
gene causes diminished pancreatic islet size and increased insulin sensitivity in
mice." Am J Physiol Endocrinol Metab 287(3): E405-13.
Longo, V. D. (2003). "The Ras and Sch9 pathways regulate stress resistance
and longevity." Exp Gerontol 38(7): 807-11.
Longo, V. D. and C. E. Finch (2003). "Evolutionary medicine: from dwarf model
systems to healthy centenarians?" Science 299(5611): 1342-6.
Longo, V. D., M. R. Lieber, et al. (2008). "Turning anti-ageing genes against
cancer." Nat Rev Mol Cell Biol 9(11): 903-10.
123
Longo, V. D., L. L. Liou, et al. (1999). "Mitochondrial superoxide decreases yeast
survival in stationary phase." Arch Biochem Biophys 365(1): 131-42.
Madia, F., C. Gattazzo, et al. (2007). "A simple model system for age-dependent
DNA damage and cancer." Mech Ageing Dev 128(1): 45-9.
Madia, F., C. Gattazzo, et al. (2008). "Longevity mutation in SCH9 prevents
recombination errors and premature genomic instability in a Werner/Bloom model
system." J Cell Biol 180(1): 67-81.
Madia, F., M. Wei, et al. (2009). "Oncogene homologue Sch9 promotes age-
dependent mutations by a superoxide and Rev1/Polzeta-dependent mechanism."
J Cell Biol 186(4): 509-23.
Mair, W. and A. Dillin (2008). "Aging and survival: the genetics of life span
extension by dietary restriction." Annu Rev Biochem 77: 727-54.
Marshall, C. J. (1996). "Ras effectors." Curr Opin Cell Biol 8(2): 197-204.
Masternak, M. M., J. A. Panici, et al. (2009). "Insulin sensitivity as a key mediator
of growth hormone actions on longevity." J Gerontol A Biol Sci Med Sci 64(5):
516-21.
Medema, R. H., G. J. Kops, et al. (2000). "AFX-like Forkhead transcription
factors mediate cell-cycle regulation by Ras and PKB through p27kip1." Nature
404(6779): 782-7.
Moller, N. and J. O. Jorgensen (2009). "Effects of growth hormone on glucose,
lipid, and protein metabolism in human subjects." Endocr Rev 30(2): 152-77.
Moller, N., J. O. Jorgensen, et al. (1991). "Effects of growth hormone on glucose
metabolism." Horm Res 36 Suppl 1: 32-5.
Moller, N., J. O. Jorgensen, et al. (1990). "Short-term effects of growth hormone
on fuel oxidation and regional substrate metabolism in normal man." J Clin
Endocrinol Metab 70(4): 1179-86.
Monzavi, R. and P. Cohen (2002). "IGFs and IGFBPs: role in health and
disease." Best Pract Res Clin Endocrinol Metab 16(3): 433-47.
Nagashima, H., K. Maeda-Nakamura, et al. (2007). "Induced secretion of insulin-
like growth factor binding protein-1 (IGFBP-1) in human hepatoma cell HepG2 by
rubratoxin B." Arch Toxicol 81(5): 347-51.
124
Najjar, S. S., A. K. Khachadurian, et al. (1971). "Dwarfism with elevated levels of
plasma growth hormone." N Engl J Med 284(15): 809-12.
Nass, R. and M. O. Thorner (2002). "Impact of the GH-cortisol ratio on the age-
dependent changes in body composition." Growth Horm IGF Res 12(3): 147-61.
Ngo, T. H., R. J. Barnard, et al. (2003). "Insulin-like growth factor I (IGF-I) and
IGF binding protein-1 modulate prostate cancer cell growth and apoptosis:
possible mediators for the effects of diet and exercise on cancer cell survival."
Endocrinology 144(6): 2319-24.
Norrelund, H. (2005). "The metabolic role of growth hormone in humans with
particular reference to fasting." Growth Horm IGF Res 15(2): 95-122.
Okada, S. and J. J. Kopchick (2001). "Biological effects of growth hormone and
its antagonist." Trends Mol Med 7(3): 126-32.
Olive, P. L. and J. P. Banath (2006). "The comet assay: a method to measure
DNA damage in individual cells." Nat Protoc 1(1): 23-9.
Paik, J. H., R. Kollipara, et al. (2007). "FoxOs are lineage-restricted redundant
tumor suppressors and regulate endothelial cell homeostasis." Cell 128(2): 309-
23.
Panka, D. J., T. Mano, et al. (2001). "Phosphatidylinositol 3-kinase/Akt activity
regulates c-FLIP expression in tumor cells." J Biol Chem 276(10): 6893-6.
Paradis, S. and G. Ruvkun (1998). "Caenorhabditis elegans Akt/PKB transduces
insulin receptor-like signals from AGE-1 PI3 kinase to the DAF-16 transcription
factor." Genes Dev 12(16): 2488-98.
Parrizas, M. and D. LeRoith (1997). "Insulin-like growth factor-1 inhibition of
apoptosis is associated with increased expression of the bcl-xL gene product."
Endocrinology 138(3): 1355-8.
Pinkston-Gosse, J. and C. Kenyon (2007). "DAF-16/FOXO targets genes that
regulate tumor growth in Caenorhabditis elegans." Nat Genet 39(11): 1403-9.
Pollak, M. N. (2004). "Insulin-like growth factors and neoplasia." Novartis Found
Symp 262: 84-98; discussion 98-107, 265-8.
Pollak, M. N., E. S. Schernhammer, et al. (2004). "Insulin-like growth factors and
neoplasia." Nat Rev Cancer 4(7): 505-18.
125
Press, M. (1988). "Growth hormone and metabolism." Diabetes Metab Rev 4(4):
391-414.
Raffaghello, L., C. Lee, et al. (2008). "Starvation-dependent differential stress
resistance protects normal but not cancer cells against high-dose
chemotherapy." Proc Natl Acad Sci U S A 105(24): 8215-20.
Ramaswamy, S., N. Nakamura, et al. (2002). "A novel mechanism of gene
regulation and tumor suppression by the transcription factor FKHR." Cancer Cell
2(1): 81-91.
Rane, M. J., P. Y. Coxon, et al. (2001). "p38 Kinase-dependent MAPKAPK-2
activation functions as 3-phosphoinositide-dependent kinase-2 for Akt in human
neutrophils." J Biol Chem 276(5): 3517-23.
Renehan, A. G., M. Zwahlen, et al. (2004). "Insulin-like growth factor (IGF)-I, IGF
binding protein-3, and cancer risk: systematic review and meta-regression
analysis." Lancet 363(9418): 1346-53.
Reuter, C. W., M. A. Morgan, et al. (2000). "Targeting the Ras signaling pathway:
a rational, mechanism-based treatment for hematologic malignancies?" Blood
96(5): 1655-69.
Reynolds, C. H., A. R. Nebreda, et al. (1997). "Reactivating kinase/p38
phosphorylates tau protein in vitro." J Neurochem 69(1): 191-8.
Richards, C. A., S. A. Short, et al. (1990). "Characterization of a transforming N-
ras gene in the human hepatoma cell line Hep G2: additional evidence for the
importance of c-myc and ras cooperation in hepatocarcinogenesis." Cancer Res
50(5): 1521-7.
Rodriguez-Viciana, P., O. Tetsu, et al. (2005). "Cancer targets in the Ras
pathway." Cold Spring Harb Symp Quant Biol 70: 461-7.
Romano, G., M. Prisco, et al. (1999). "Dissociation between resistance to
apoptosis and the transformed phenotype in IGF-I receptor signaling." J Cell
Biochem 72(2): 294-310.
Rosenbloom, A. L. and J. Guevara-Aguirre (1998). "Lessons from the genetics of
laron syndrome." Trends Endocrinol Metab 9(7): 276-83.
Rosenbloom, A. L., J. Guevara-Aguirre, et al. (1999). "Growth hormone receptor
deficiency in Ecuador." J Clin Endocrinol Metab 84(12): 4436-43.
126
Rosenbloom, A. L., J. Guevara Aguirre, et al. (1990). "The little women of Loja--
growth hormone-receptor deficiency in an inbred population of southern
Ecuador." N Engl J Med 323(20): 1367-74.
Rosenfeld, R. G., A. L. Rosenbloom, et al. (1994). "Growth hormone (GH)
insensitivity due to primary GH receptor deficiency." Endocr Rev 15(3): 369-90.
Rouse, J., P. Cohen, et al. (1994). "A novel kinase cascade triggered by stress
and heat shock that stimulates MAPKAP kinase-2 and phosphorylation of the
small heat shock proteins." Cell 78(6): 1027-37.
Rudman, D., A. G. Feller, et al. (1990). "Effects of human growth hormone in
men over 60 years old." N Engl J Med 323(1): 1-6.
Salomon, F., R. C. Cuneo, et al. (1989). "The effects of treatment with
recombinant human growth hormone on body composition and metabolism in
adults with growth hormone deficiency." N Engl J Med 321(26): 1797-803.
Scanga, S. E., L. Ruel, et al. (2000). "The conserved PI3'K/PTEN/Akt signaling
pathway regulates both cell size and survival in Drosophila." Oncogene 19(35):
3971-7.
Sell, C., M. Rubini, et al. (1993). "Simian virus 40 large tumor antigen is unable to
transform mouse embryonic fibroblasts lacking type 1 insulin-like growth factor
receptor." Proc Natl Acad Sci U S A 90(23): 11217-21.
Shevah, O. and Z. Laron (2007). "Patients with congenital deficiency of IGF-I
seem protected from the development of malignancies: a preliminary report."
Growth Horm IGF Res 17(1): 54-7.
Spadoni, G. L., S. Cianfarani, et al. (1988). "Laron dwarfism: cellular
unresponsiveness to GH demonstrated on cultured lymphocytes by a
cytochemical method." Horm Metab Res 20(7): 450-2.
Spear, N., A. G. Estevez, et al. (1998). "Enhancement of peroxynitrite-induced
apoptosis in PC12 cells by fibroblast growth factor-1 and nerve growth factor
requires p21Ras activation and is suppressed by Bcl-2." Arch Biochem Biophys
356(1): 41-5.
Stitt, T. N., D. Drujan, et al. (2004). "The IGF-1/PI3K/Akt pathway prevents
expression of muscle atrophy-induced ubiquitin ligases by inhibiting FOXO
transcription factors." Mol Cell 14(3): 395-403.
127
Suh, Y., G. Atzmon, et al. (2008). "Functionally significant insulin-like growth
factor I receptor mutations in centenarians." Proc Natl Acad Sci U S A 105(9):
3438-42.
Takenaka, K., T. Moriguchi, et al. (1998). "Activation of the protein kinase p38 in
the spindle assembly checkpoint and mitotic arrest." Science 280(5363): 599-
602.
Tang, E. D., G. Nunez, et al. (1999). "Negative regulation of the forkhead
transcription factor FKHR by Akt." J Biol Chem 274(24): 16741-6.
Tatar, M., A. Kopelman, et al. (2001). "A mutant Drosophila insulin receptor
homolog that extends life-span and impairs neuroendocrine function." Science
292(5514): 107-10.
Toker, A. and M. Yoeli-Lerner (2006). "Akt signaling and cancer: surviving but not
moving on." Cancer Res 66(8): 3963-6.
Tomizawa, M., A. Kumar, et al. (2000). "Insulin inhibits the activation of
transcription by a C-terminal fragment of the forkhead transcription factor FKHR.
A mechanism for insulin inhibition of insulin-like growth factor-binding protein-1
transcription." J Biol Chem 275(10): 7289-95.
Tran, H., A. Brunet, et al. (2002). "DNA repair pathway stimulated by the
forkhead transcription factor FOXO3a through the Gadd45 protein." Science
296(5567): 530-4.
Urban, J., A. Soulard, et al. (2007). "Sch9 is a major target of TORC1 in
Saccharomyces cerevisiae." Mol Cell 26(5): 663-74.
Vaccarello, M. A., F. B. Diamond, Jr., et al. (1993). "Hormonal and metabolic
effects and pharmacokinetics of recombinant insulin-like growth factor-I in growth
hormone receptor deficiency/Laron syndrome." J Clin Endocrinol Metab 77(1):
273-80.
Van Remmen, H., Y. Ikeno, et al. (2003). "Life-long reduction in MnSOD activity
results in increased DNA damage and higher incidence of cancer but does not
accelerate aging." Physiol Genomics 16(1): 29-37.
Vanfleteren, J. R. and B. P. Braeckman (1999). "Mechanisms of life span
determination in Caenorhabditis elegans." Neurobiol Aging 20(5): 487-502.
Veldhuis, J. D., A. Iranmanesh, et al. (1997). "Elements in the pathophysiology of
diminished growth hormone (GH) secretion in aging humans." Endocrine 7(1):
41-8.
128
Vijg, J. and M. E. Dolle (2007). "Genome instability: cancer or aging?" Mech
Ageing Dev 128(7-8): 466-8.
Wei, M., P. Fabrizio, et al. (2008). "Life span extension by calorie restriction
depends on Rim15 and transcription factors downstream of Ras/PKA, Tor, and
Sch9." PLoS Genet 4(1): e13.
Wei, M., P. Fabrizio, et al. (2009). "Tor1/Sch9-regulated carbon source
substitution is as effective as calorie restriction in life span extension." PLoS
Genet 5(5): e1000467.
Weigel, D., G. Jurgens, et al. (1989). "The homeotic gene fork head encodes a
nuclear protein and is expressed in the terminal regions of the Drosophila
embryo." Cell 57(4): 645-58.
Weindruch, R., P. H. Naylor, et al. (1988). "Influences of aging and dietary
restriction on serum thymosin alpha 1 levels in mice." J Gerontol 43(2): B40-2.
Weindruch, R. and R. L. Walford (1982). "Dietary restriction in mice beginning at
1 year of age: effect on life-span and spontaneous cancer incidence." Science
215(4538): 1415-8.
Xia, Z., M. Dickens, et al. (1995). "Opposing effects of ERK and JNK-p38 MAP
kinases on apoptosis." Science 270(5240): 1326-31.
Yakar, S., J. Setser, et al. (2004). "Inhibition of growth hormone action improves
insulin sensitivity in liver IGF-1-deficient mice." J Clin Invest 113(1): 96-105.
Yamauchi, T., Y. Kaburagi, et al. (1998). "Growth hormone and prolactin
stimulate tyrosine phosphorylation of insulin receptor substrate-1, -2, and -3, their
association with p85 phosphatidylinositol 3-kinase (PI3-kinase), and
concomitantly PI3-kinase activation via JAK2 kinase." J Biol Chem 273(25):
15719-26.
Yan, L., D. E. Vatner, et al. (2007). "Type 5 adenylyl cyclase disruption increases
longevity and protects against stress." Cell 130(2): 247-58.
Zadik, Z., S. A. Chalew, et al. (1985). "The influence of age on the 24-hour
integrated concentration of growth hormone in normal individuals." J Clin
Endocrinol Metab 60(3): 513-6.

129
Zarubin, T. and J. Han (2005). "Activation and signaling of the p38 MAP kinase
pathway." Cell Res 15(1): 11-8.
Zelko, I. N., T. J. Mariani, et al. (2002). "Superoxide dismutase multigene family:
a comparison of the CuZn-SOD (SOD1), Mn-SOD (SOD2), and EC-SOD (SOD3)
gene structures, evolution, and expression." Free Radic Biol Med 33(3): 337-49.

Abstract (if available)

Abstract Reduced signaling of the Insulin like Growth Factor 1 (IGF-1) pathway in mammals or that of its orthologs in lower organisms is known to increase lifespan and protect against oxidative stress and age-related pathologies. IGF-1 is mainly synthesized in the liver in response to Growth Hormone (GH). Mice with reduced GH signaling, for example the Ames dwarf, Snell dwarf or the Growth Hormone Receptor Knock Out (GHRKO) mice are smaller in size, have longer lifespans, increased insulin sensitivity and are protected against cancer.

Linked assets

University of Southern California Dissertations and Theses

Conceptually similar

PDF

Fasting-based differential stress resistance to enhance cancer treatment: a novel strategy to protect normal cells and sensitize cancer cells to chemotherapy

PDF

Roles of SIRT1 in neuronal oxidative damage and brain function

PDF

Studies of Sir2 and caloric restriction mimetic pathways in aging

PDF

The effects of prolonged fasting/ fasting mimicking diet (FMD) on CNS protection, regeneration, and treatment

PDF

The role of the proteasome & its regulators in adaptation to oxidative stress

PDF

Tight junction protein CLDN18.1 attenuates malignant properties and related signaling pathways of human lung adenocarcinoma in vivo and in vitro

PDF

Development of novel small molecules targeting mitochondrial and oxidative stress signaling pathways for pancreatic cancer therapy

PDF

The role of endoplasmic reticulum protein GRP78 in normal hematopoeises and PTEN-null leukemogenesis

PDF

The role of endoplasmic reticulum chaperones in adipogenesis, liver cancer and mammary gland development

Asset Metadata

Creator Balasubramanian, Priya (author)

Core Title Role of GH/IGF-1 signaling in oxidative stress, DNA damage and cancer

School College of Letters, Arts and Sciences

Degree Doctor of Philosophy

Degree Program Molecular Biology

Publication Date 07/30/2010

Defense Date 05/11/2010

Publisher University of Southern California (original), University of Southern California. Libraries (digital)

Tag cancer,Diabetes,FoxO,Growth Hormone,growth hormone receptor deficiency,insulin like growth factor-1,OAI-PMH Harvest,oxidative stress,p38,RAS

Language English

Contributor Electronically uploaded by the author (provenance)

Advisor Longo, Valter D. (committee chair), Goodman, Steven (committee member), Pike, Christian J. (committee member)

Creator Email bpriyaiyer@gmail.com,priyabal@usc.edu

Permanent Link (DOI) https://doi.org/10.25549/usctheses-m3223

Unique identifier UC1352539

Identifier etd-balasubramanian-3845 (filename),usctheses-m40 (legacy collection record id),usctheses-c127-352980 (legacy record id),usctheses-m3223 (legacy record id)

Legacy Identifier etd-balasubramanian-3845.pdf

Dmrecord 352980

Document Type Dissertation

Rights Balasubramanian, Priya

Type texts

Source University of Southern California (contributing entity), University of Southern California Dissertations and Theses (collection)

Repository Name Libraries, University of Southern California

Repository Location Los Angeles, California

Repository Email cisadmin@lib.usc.edu