University of Southern California Dissertations and Theses

Ecophysiology of important understudied bacterioplankton through an integrated research and education approach

(USC Thesis Other)

Ecophysiology of important understudied bacterioplankton through an integrated research and education approach

PDF

Download a page range

Download transcript

Copy asset link

Request this asset

Transcript (if available)

Content

Ecophysiology of important understudied bacterioplankton through an integrated research and
education approach
by
V. Celeste Lanclos

A Dissertation Presented to the
FACULTY OF THE GRADUATE SCHOOL
UNIVERSITY OF SOUTHERN CALIFORNIA
In Partial Fulfillment of the
Requirement for the Degree
DOCTOR OF PHILOSOPHY
(MARINE BIOLOGY AND BIOLOGICAL OCEANOGRAPHY)
August 2023

Copyright 2023 V. Celeste Lanclos
ii
DEDICATION
This dissertation is dedicated to those who suffer Vertigo-

“Anyone whose goal is 'something higher' must expect someday to suffer vertigo. What is
vertigo? Fear of falling? No, Vertigo is something other than fear of falling. It is the voice of the
emptiness below us which tempts and lures us, it is the desire to fall, against which, terrified, we
defend ourselves.”

-Milan Kundera, The Unbearable Lightness of Being

iii
ACKNOWLEDGEMENTS

I fundamentally believe that success can never be due purely to one’s own hard work.
While I do credit myself for my achievement of this Ph.D., my success throughout this journey
could not have been possible without those who supported me along the way and sheer dumb
luck to be in the right place at the right time. There are far too many people who have made an
impact on my career and overall life throughout my dissertation, but I’d like to highlight some of
the individuals who stand out.
I first would like to thank my advisor. Dr. J. Cameron Thrash, I’m not sure how the
enormous impact you made on my career as well as my own personal growth through life can be
summed up in a few sentences. My personal background is one of extreme poverty and hardships
in my upbringing that make it statistically highly unlikely for me to be successful through an
undergraduate degree much less a doctoral degree. We met when I was on the brink of
embracing the statistics and leaving college for a life that was more in line with my preordained
trajectory. You took a risk on me, gave me a position in your lab, and you have guided me
through the challenges of the academic system since. Throughout this journey, you have
advocated tirelessly for me, supported me through grad-school crises, and showed great
understanding towards me through personal difficulties that made work-life balance hard at
times. From you, I have learned how to challenge myself, how to recover gracefully from falls,
how to balance humanity with work pressures, how to celebrate a win no matter how small, and
definitely how to appreciate a good amaro. I owe my career and so much of my personal growth
to you. You prove again and again to be not only a graduate advisor, but a true mentor to me and
all those who have had the benefit of working with you. Thank you.
I’d also like to thank my dissertation committee members and lab mates. To Dr. Jan
Amend and Dr. Doug LaRowe, thank you for welcoming our group with open arms when we
moved the lab to the University of Southern California. The group lab meetings and lab retreat
made our introduction to USC incredibly educational and fun, and you opened my eyes to the
type of science that I want to embrace in my postdoctoral work. Thank you. To Dr. Eric Webb,
thank you for always being excited to talk research with me. You have provided immense help in
the way that I think about genomics, ecology, and writing. To my lab mates, past and present,
thank you for always being there to talk about work and life and for celebrating as many wins as
possible along the ride. I’d especially like to thank a few lab mates who stand out. To Emily
Savoie, thank you for your closeness growing up and being my introduction to the Thrash Lab.
To Chuankai Cheng, thank you for always having a positive attitude and our deep conversations
about work and the world. To Anna Lucchesi, thank you for the years of snapchat ugly faces,
marg days, and for being a great friend. To Shelby Barnes, thank you for our happy hours and
conversations in hard times. To Cole Hider, thank you for keeping me in check with
organization, always being there to lean on with experiments, and for showing us old-timers how
to win party games.
I’d like to thank those who have showed immense friendship through this journey. To Dr.
Michael Henson, I could write a book about what I could thank you for. You have become an
integral part of my life as my work spouse and best friend. The laughs, tears, sampling trips,
happy hours, pup hangouts, sleepovers, and dance parties have gotten me through some of the
toughest times of my life. You are always there when I need you and I cherish your friendship
endlessly. Thank you. To Jordan Coelho, you are forever my chosen family. You have been my
iv
lab mate, roommate, and sister who has changed my life for the better. Our early morning
excitement screaming with the pups, kitchen floor life conversations, and adventures around the
city will forever hold a cherished place in my heart. Thank you for being you and for loving me
in my worst times.
Lastly, I’d like to thank those outside of work who have made an impact on me. To
Donna Hebert and Theresa Stewart, thank you so much for the support you have shown me.
Donna, you have always been the one in my family that I looked up to and the one who has
always been there for me. You have shown me how to break cycles, stay focused, aim high, help
those who need, and not put up with any crap from anybody. You remind me every time we talk
that I can be whoever I’d like to be regardless of the conditions of who I was or where I came
from. I thought you were clinically insane when you told me to go for the Ph.D., but you were
right as always-education is the way out and the only thing that no one can ever take from me.
To Dawn Roberie, thank you for being my bonus mom. You showed me how to work hard, love
hard, and put a foot down when it’s called for. Your love and support for the past decade means
the world to me. To Billie, Dustin, Nick, Cameron, Aiden, and River Lanclos, thank you for
being my family and encouraging me to aim high. I love you all. To my partner, Julian Aichholz,
thank you for being you. You have supported me through these incredibly stressful final steps of
my dissertation, and you show me how to trust, love, go with the flow, and embrace changing
chapters head on. You are the best travel companion, t-shirt maker, dog dad, and partner I could
ask for. Finally, thank you to Jesse, my furry son. You have been the best pup I could have ever
asked for, and your unwilling emotional support through these last ten years is worth every hair
in my mouth and on my clothes in the mornings.

v

TABLE OF CONTENTS

DEDICATION ......................................................................................................... ii
ACKNOWLEDGEMENTS .................................................................................... iii
LIST OF TABLES ................................................................................................. vii
LIST OF FIGURES ............................................................................................... viii
ABSTRACT ............................................................................................................ ix
INTRODUCTION .....................................................................................................1
References-Introduction ............................................................................................................ 16
CHAPTER 1: Ecophysiology and Genomics of the Brackish Water
Adapted SAR11 Subclade IIIa ................................................................................24
CHAPTER 2: Isolation and Ecophysiology of the Roseobacter
CHAB-I-5 Lineage ..................................................................................................35
Introduction ............................................................................................................................... 36
Methods..................................................................................................................................... 38
Results ....................................................................................................................................... 44
Discussion ................................................................................................................................. 49
References-Chapter 2 ................................................................................................................ 55
Main Figures and Tables ........................................................................................................... 60
CHAPTER 3: A CURE for the Physiological Characterization of
Bacterioplankton in Liquid Culture .........................................................................68
CONCLUDING REMARKS ..................................................................................78
References-Concluding Remarks .............................................................................................. 83
BIBLIOGRAPHY ...................................................................................................84
APPENDICIES ......................................................................................................101
Chapter 1 Supplemental Materials .......................................................................................... 101
Chapter 2 Supplemental Materials .......................................................................................... 117
vi
Chapter 3 Supplemental Materials .......................................................................................... 123

vii

LIST OF TABLES
Table 1-1: Genome statistics of new IIIa isolates compared to other SAR11 genomes………...27
Table 3-1: Course schedule without break weeks.………………………………………………71
Table 3-2: Student learning outcomes and their respective assessments.……………………….73
Table 3-3: Example student writings……………………………………………………………78

viii
LIST OF FIGURES
Figure 1-1: Subclade structure and genome similarity………………………………………….27

Figure 1-2: Distribution of subclade IIIa and LD12 in metagenomic datasets………………….28

Figure 1-3: Highlighted comparative gene content in SAR11.……………………….…………29

Figure 1-4: Growth rates and doubling times of LSUCC0664 (IIIa.1) in orange
and LSUCC0723 (IIIa.3) in blue in media of varying salinities. …………………..……………30

Figure 1-5: Electron microscopy..……………………………………………………………….31

Figure 2-1. Phylogenetic tree of 16S sequences from Alphaproteobacteria with
US3C007 and other CHAB-I-5 sequences added in.………………………………………….…61

Figure 2-2: Phylogenomics and average nucleotide identity (ANI) of CHAB-I-5……………...62

Figure 2-3: Ecological recruitment of CHAB-I-5..……………………………………………...63

Figure 2-4: Metabolic pathway presence in CHAB-I-5 inferred with KEGG
Decoder and Expand.…………………………………………………………………………….64

Figure 2-5: Growth rates for US3C007 across A) salinities and B) temperatures
calculated with sparse-growth-curve-analysis. ……………………………………………..…...65

Figure 2-6: Growth curves for US3C007 across carbon concentrations over three
growth curves..………………………………………………………………………………..…66

Figure 2-7: Scanning electron microscopy of US3C007 indicating pleiomorphism
in the culture..…………………………………………………………………………………...67

Figure 3-1. Growth data for strain LSUCC0135 at different temperatures..……………………74

Figure 3-2. Grade distributions for major assignments and overall course scores……………...75

ix
ABSTRACT
Heterotrophic bacteria in global oceans are central components of the microbial loop, playing
important roles in the cycling of dissolved and particulate organic matter. To understand the way
in which these heterotrophs interact with global biogeochemical cycles, we must study how
individual lineages are distributed and characterize their different metabolic capacities.
Critically, the vast majority of known genera, including some of the most abundant taxa in global
oceans, have no cultivated representatives. Though cultivation-independent studies such as the
variety of multi-‘omics techniques have provided a wealth of information about the predicted
metabolism of uncultured taxa, these approaches are limited in their ability to validate
hypotheses about microbial physiology and interactions compared with cultivation-based
experimentation. Thus, the combination of cultivation-independent and cultivation-dependent
study is optimal to understand the interplay of ecological distribution, metabolism, and
physiological responses to dynamic environments for marine microorganisms. This dissertation
combines cultivation-independent and cultivation-dependent methods to investigate two poorly
understood but abundant groups, the SAR11 subclade IIIa and the Roseobacter lineage CHAB-I-
5, leveraging new cultures. This work provides the first physiological data from these organisms
to quantify oceanographically-relevant factors such as growth responses to salinity and
temperature changes, cell size and volume estimates, and growth dependence on key carbon and
nitrogen compounds. Using new isolates, complete, circularized genomes, and publicly available
data, this dissertation has also generated the most comprehensive ecological and genomic
analysis to date for both groups. Furthermore, it provides a framework to integrate undergraduate
research experiences into a classroom setting so that they can gain valuable research experience
in microbial ecology and physiology.
1
INTRODUCTION

The importance of heterotrophic bacterioplankton
Bacterioplankton are the free-living or particle-associated fraction of aquatic bacteria
whose motility potential cannot exceed that of the movement of the water around them. These
organisms perform diverse metabolic functions with their environment and other organisms
around them. It is estimated that there are about 3.6 x 10^28 prokaryotic cells (bacteria and
archaea) in the upper 200m of global oceans, with the majority of these numbers being
heterotrophic, meaning that they require carbon for energy and biomass from external sources (1,
2). These heterotrophs are reliant on interactions with autotrophs (organisms that fix inorganic
carbon into biomass and dissolved carbon forms), or the products of autotrophic metabolism, to
perform their metabolic functions and grow.
Because of their vast numbers, heterotrophic bacterioplankton are central components of
nutrient cycling (2). The particulate and dissolved organic matter (POM and DOM) from
autotrophs is consumed by heterotrophic bacteria with multiple fates: movement up the food
chain through grazing (a.k.a. the “microbial loop”), remineralization of inorganic nutrients, or
transformation into recalcitrant DOM, each of which is reviewed in Buchan et al. 2014 (2). The
dynamics of how each of these processes occur are complex, and there is an abundance of
metabolic flexibility for nutrient transformations in bacteria (3). While many oceanographers use
lump sum values to understand the total microbial contribution to these nutrient dynamics, it is
important to note that individual lineages of bacterioplankton do not contribute to nutrient
transformations in the same way and are not in equal abundance in their environment (4, 5). For
example, one historical method of measuring bacterial activity in oceans was done by adding
2
labeled 3H-thymidine into a sample and measuring its incorporation into the DNA of the
community (6). This technique measures the percent of the community that is actively replicating
their DNA. The Order Pelagibacterales (hereby referred to as SAR11) is the most abundant
group of bacterial heterotrophs in global oceans and usually comprise 20-40% of cells in the
surface oceans (7, 8). Though SAR11 is the most dominant bacterial heterotroph in its
community, physiological analysis later confirmed that SAR11 members cannot incorporate 3H-
thymidine, thus indicating the absence of the most dominant group in the community’s activity
measurements (9). This is one example of how the understanding of individual lineages of
bacteria must be accounted for when trying to understand the total microbial fraction of a system.
The purpose of my dissertation is to use isolated representatives of globally abundant
heterotrophic bacterial taxa that were historically considered “unculturable” or infrequently
cultivated combined with large-scale publicly-available data to define their ecophysiology in a
collaborative manner with an emphasis on undergraduate research experiences. To fulfil this
purpose, I focus on the Alphaproteobacteria SAR11 IIIa and Roseobacter CHAB-I-5, two groups
that have little to no published physiology information though they are both dominant members
of global aquatic heterotrophic bacteria.

General overview of studying microorganisms
In microbial ecology, we aim to identify the diversity of the microbial fraction of the tree
of life and understand the mechanisms by which microorganisms interact with their environment
and each other. Ecophysiology is “the science of the interrelationships between the physiology of
organisms and their environment” as defined by Mirriam-Webster. Because microorganisms
cannot be tracked and visualized in the way that macroscopic organisms can, a major challenge
3
in understanding their ecophysiology is developing the best methods by which to identify,
quantify, and measure the activities of microorganisms. These can broadly be broken down into
two categories- cultivation-independent, and cultivation-dependent. These methods that rely on
having microorganisms available in the laboratory for experimentation are termed “cultivation-
dependent”. However, most microorganisms have not been grown successfully in the laboratory
(10, 11), and thus an ever-growing pantheon of cultivation-independent methodology has been
developed.

Studying bacterioplankton: cultivation-independent approaches
Cultivation-independent methods include molecular techniques that can be used to study
what kinds of microbes are present in an environmental system and how they might be
interacting with their environment. We can use genomics of an organism to define the features of
a bacterial genome such as its size, ratio of nucleotides, and predicted coding density. Then we
can annotate (assign a predicted function) the predicted amino acid/protein sequences through
identity to sequences in curated databases of known functional bacterial proteins. These
proteomes can be organized into metabolic pathways to predict the genetic potential of an
organism to perform various metabolisms. Each of these genomic analyses can also be done on a
whole community basis, instead of on a single organism, but I will focus on the application of
metagenomics for relevance to this dissertation.
Two major types of analyses that are currently used to identify members of a community
and their ecology are the 16S rRNA gene amplicon and whole genome shotgun metagenomics
analyses, both of which are reviewed thoroughly in Gasol and Kirchman’s Microbial Ecology of
the Oceans (5). In bacterial 16S rRNA amplicon analysis, a single gene from the community
4
members is targeted with primers that attach to a conserved region in bacteria and polymerase
chain reaction is used to amplify the hypervariable region of the 16S rRNA gene (5, 12). This
results in copies of the entire 16S rRNA gene pool of the community that can then be grouped
into operational taxonomic units (OTUs clustered at ~97% identity aka “species”) and identified
through a database of known bacterial 16S rRNA genes such as the SILVA Ribosomal RNA
Gene Database Project (13). These OTUs can be used to understand which taxa are abundant in a
sample and how they correlate to environmental nutrients, abiotic data, or to other
microorganisms. Conversely, whole genome shotgun metagenomics aims to sequence all DNA
gathered from microorganisms in a sample rather than focusing on a single conserved gene (14).
Genomes can be assembled into metagenome assembled genomes (MAGs) from community
DNA and can be used to assess the microbial diversity of a sample as well as provide genomic
data to hypothesize what kind of metabolism an organism might exhibit (14). Metagenomics can
also be used to understand an organism’s ecological distribution through metagenomic read
recruitment. In this technique, the sequences are not binned and assembled into genomes, rather
they are mapped to existing genomes and normalized to RPKMs (Reads Per Kilobase of
sequences per Million reads mapped) (15). These RPKMs are used as a proxy for an organism’s
abundance and can be calculated from global public datasets to understand the ecological
distribution of a microorganism beyond the environment the genome was gathered from.
Although we can glean much information from cultivation-independent approaches, there
are fundamental aspects of microbiology that we cannot learn from these methods. Phenotypes
such as growth rates, temperature and salinity growth ranges, or gene regulation dynamics are
difficult, if not impossible, to attach to genotypes without a culture present in a laboratory. For
5
these types of characterization, an organism must be present in culture for cultivation-dependent
analysis.

Studying bacterioplankton: cultivation-dependent approaches
Nature journals defines bacterial physiology specifically as “a scientific discipline that
concerns the life-supporting functions and processes of bacteria, which allow bacterial cells to
grow and reproduce”. Traditionally, bacterial physiology data is gathered from pure cultures that
are grown in a laboratory and subjected to various external conditions while changes in growth is
observed (3). Some practical physiology experiments include, but are not limited to, the growth
response across temperatures, salinities, pH, nutrient concentrations, and nutrient sources. The
changes in growth rates of a culture in a certain condition can then be applied to make inferences
about how they might fare in their native environments and which conditions might constrain
their natural abundances. Bacterial physiology, therefore, necessitates the ability to study an
organism in a laboratory setting to subject it to varying conditions with proper controls.
One major challenge to the goal of measuring bacterial physiology for marine microbes is
the fact that most known bacterial diversity is uncultivated and cannot be studied in the
laboratory. This concept has been deemed the Great Plate Count Anomaly (GPCA) (16). The
GPCA notes that approximately 0.1-1% of bacteria known to exist from microscopic counts can
be cultivated in a laboratory on agar plates due to either a nonviability of the organism or a
failure to create artificial conditions conducive to growth (16). While the reported percentage of
uncultivated organisms is debated and varies depending on biome (10, 11, 17, 18), the current
best estimate is that 81% of known genera and 25% of known phyla do not exist in pure culture
6
for study (17). This is especially true for marine oligotrophic bacteria which exist in high
abundance in extremely nutrient-poor areas of the oceans.
While many known taxa are currently still uncultured, there have been great advances in
culturing methods that have improved the isolation of previously “unculturable” oligotrophic
marine bacterioplankton to allow for cultivation-dependent experiments. These methods have
been reviewed extensively previously (19–21), so I will highlight those that are of particular use
for this dissertation. One design is the shift from agar plates to liquid artificial medium that is
complex and defined and mimics the nutrient content of the source of inoculum (22, 23).
Dilution to extinction (DTE) is a method in which cells are diluted and separated to eliminate
competition for resources (24). High throughput experiments using 96-well culturing vessels,
flow cytometry, and small volumes help the increased numbers of isolation attempts needed to
successfully cultivate rarer members of the community (25–27). These techniques, and others in
the review articles above, have been instrumental in the cultivation and characterization of
important marine oligotrophs. For example, the first representative of the illusive yet abundant
SAR11 clade, HTCC1062, was isolated in 2002 using the methods above (25, 26). Additionally,
the combination of the above methods allowed for the isolation of other important marine
lineages such as OM43 (25), SAR92 (25), SAR116 (28, 29).
The approach to use isolation and physiological characterization of microorganisms alone
without an inclusion of cultivation-independent methods is nearing obsolescence in today’s
scientific world. Physiology alone cannot be extrapolated to know whether an organism will be
dominant or even present in the specific environments that mimic the laboratory conditions in
which they were tested in, nor is there sufficient isolated representatives to study that captures
the microbial diversity that is known to exist. Therefore, a combination of cultivation-
7
independent and cultivation-dependent approaches is necessary to contextualize environmental
data with physiological data and vice-versa.

Advantages of combining cultivation-independent and -dependent approaches:
The combination of cultivation independent and cultivation dependent methodologies are
vital to truly understand ecophysiology of an organism. One example of how these two
approaches inform our understanding of microbiology is that of marine heterotrophic bacteria’s
use of proteorhodopsin. Proteorhodopsin is a transmembrane protein pump using light that can
create energy in heterotrophs (30–33). Proteorhodopsin in marine bacteria was discovered
through cultivation-independent methods (32) and was found to be widespread in marine
heterotrophic bacteria (30, 31) though no cultured marine heterotroph at the time contained this
protein for experimental study. SAR11 was an “unculturable” organism for years, though
researchers knew it made up to 50% of the microbial community in surface waters (34). When
the first representative was isolated in 2002 (25, 26), proteorhodopsin was found in its genome
and experimental data was able to show that proteorhodopsin in SAR11 did not increase the
growth rate of the culture in light vs. dark conditions (35), rather its function provided means for
survival during carbon starvation (36). Conversely, a cultivation-dependent study in marine
Dokdonia sp. strain MED134 showed a higher growth rate in the light than in the dark due to the
presence of proteorhodopsin (37). These two organisms and their use of proteorhodopsin is one
example of many that validates the necessity of testing cultivation-independent hypotheses
across a range of isolates to elucidate potential differential functional potential for similar
genomic protein predictions.
8
This combination of cultivation-independent and cultivation-dependent methodologies
frames my dissertation work. Our group specializes in the isolation of bacterial heterotrophs
from a variety of aquatic systems (20, 23, 27) and exploring aspects of ecophysiology of some of
those isolates (38–41). This dissertation focuses on two groups within the Alphaproteobacteria,
specifically the SAR11 IIIa clade and the Roseobacter CHAB-I-5 cluster.

SAR11 IIIa
SAR11 was first established as an abundant, phylogenetically distinct lineage through
early 16S rRNA gene analyses of the Sargasso Sea (34) and was studied without isolates until the
first representatives belonging to subclade Ia were cultivated in 2002 (25, 26). SAR11 spans an
entire Order within the Pelagibacterales whose ecological distribution spans from marine to
freshwater depending on phylogenetic groupings (8, 42–44). These organisms, though diverse,
generally have very small genomes with a high level of conservation for gene content and
genome structure (45–48). The isolation of cultivated representatives within subclade I
demonstrated that SAR11 possesses a series of specific nutritional features due to multiple
auxotrophies that include an inability to synthesize serine (49), a requirement for reduced sulfur
compounds (50), and a dependency on hydroxymethyl pyrimidine (HMP) rather than thiamin as
a cofactor (51). They are excellent nutrient scavengers who produce glycolipids during
phosphorous starvation (52) and release methane into aerobic surface waters during the cleavage
of methylphosphonates (53). Despite all that has been learned about SAR11 genomics,
physiology, ecology, and evolution, the vast majority of research has focused on the subclade Ia
members because of their abundance and historical availability of isolates from this group.
However, the unique distributions of other subclades suggest important evolutionary
9
differentiation that could help us understand the ecological success of SAR11 (20, 54–58).
While the well-studied subclade I organisms are the most abundant heterotrophic bacteria
in large marine datasets, the subclade IIIa has a differential distribution and metabolic repertoire
that challenges how we might think about the functionality of SAR11 in global waters (55, 59). It
also shares a most recent common ancestor with the only freshwater lineage of SAR11,
IIIb/LD12, indicating its transitionary position within the clade’s evolutionary history through
multiple niches. The first reported discovery of subclade III was in 1997 with the OM155 16S
rRNA sequence, followed by two more sequences from the Artic in 2002 (44, 60). These three
sequences were first defined as belonging to subclade III on two phylogenetic branches in a
study characterizing the SAR11 diversity at the Bermuda Atlantic Time series Station (BATS)
(42). In this study, subclade III was defined as brackish and separate from the marine subclades
typical of surface waters at BATS (42). The breakdown of the clade at the time contained two
branches with the Artic sequences on one branch with the OM155 sequence on the other (42).
Though the first SAR11 isolates were cultured in 2002, subclade III did not have isolated
representatives until IMCC9063 was cultured in 2011 from Artic waters and HIMB114 in 2012
from coastal Hawaii (47, 61). In 2013, the currently accepted, and most comprehensive subclade
structure of SAR11 to date, was adapted to redesignate subclade III to IIIa with three branches:
IMCC9063 and OM155 on one branch, HIMB114 on one branch, and a third branch containing
uncultured environmental sequences at BATS (8). Community 16S rRNA gene data from BATS
found members of IIIa to be much lower in abundance than the other SAR11 subclades at the site
with differential ecology corresponding to the two branches of the tree: sequences belonging to
the HIMB114 branch of the tree appeared in Fall surface waters at the beginning of a deep
mixing event while the IMCC9063/OM155 branch was not represented at BATS in any
10
significance (8). Outside of BATS, IIIa ecology has been documented to fluctuate both with
temperature and salinity. Global ecological data of the SAR11 clade showed patterns of
abundance in which the HIMB114 branch of the clade was only present in waters above about
20˚C and the IMCC9065 branch was found in waters below 18˚C with a preference for polar
waters (62). This branched separation of distribution was also apparent in the Baltic Sea where
the IMCC9063 branch of subclade IIIa was the primary SAR11 type in brackish (salinity < 10)
waters while HIMB114 distribution extended more into the coastal and higher salinity waters
(63, 64). Since then, data from Louisiana estuaries show subclade IIIa having at least two distinct
subtypes whose ecological distributions are separated by salinity preferences with the
IMCC9063 type abundance peaking at low-brackish salinities and HIMB114 type peaking at
salinities of high brackish to marine (27, 65). A similar trend is also seen in the San Francisco
Bay in which two distinct IIIa OTUs share high abundances in mid-brackish salinities (65).
Previous work from our group resulted in multiple new IIIa isolates in artificial seawater
that is easily modified for physiological study (23, 27). In Chapter 1 below, I focus on the
ecophysiology of SAR11 IIIa and use the combination of genomics, metagenomics, and
physiology to characterize the group. I define three subgroups of IIIa, highlight the differences in
growth capability across salinities in two isolates from two subgroups, compare ecological
distribution across salinity regimes globally, and test temperature range as well as aspects of
their carbon and nitrogen usage.
CHAB-I-5 Roseobacter
The term “Roseobacter” is used in the literature to describe the Family
Rhodobacteraceae. This taxonomic nomenclature is somewhat confusing- though Roseobacter is
a genus within the Rhodobacteraceae, the first representatives of the Family belong to the genus
11
Roseobacter and became the identifying name for over 50 genera. Roseobacter overall is
monophyletic while the genera within Roseobacter are frequently paraphyletic (2, 66, 67).
Roseobacter, like SAR11, is frequently one of the most abundant types of bacteria in marine
waters. Roseobacter can make up to more than 30% of the bacterial community in coastal waters
(66) and exist as free-living, particle associated, or in symbiosis with other aquatic groups in
marine systems, particularly phytoplankton (2, 66). Roseobacter can be found in a broad variety
of ecosystems such a variety of depths throughout the water column, in open oceans, coastal
waters, within sea ice, and in sediments of coasts and the deep-sea (66, 68) . Unlike SAR11,
representatives from Roseobacter historically are well-represented in culture collections and
have been used as a model marine generalist in generalist (flexible modes of survival) in
comparisons with specialist (specialized modes of survival) life strategies (69–72).
One type of Roseobacter classification that is important in marine systems is the Pelagic
Roseobacter Cluster (PRC). The PRC comprises the most abundant Roseobacters in the open
ocean, is paraphyletic when phylogeny is inferred with orthologous protein alignments, but is
monophyletic when inferring phylogeny using shared gene content information (68, 73, 74). This
is due to the PRC being composed of multiple lineages that have adapted to the oligotrophic
conditions of the pelagic ocean by gaining gene content that confers an advantage to these
systems and losing some of their metabolic flexibility that does not aid in survival in the pelagic
oceans (68, 74). While some lineages of the PRC do exhibit features of genome streamlining
(low GC content, low non-coding DNA percentage, and small genome size) in addition to the
metabolic adaptations towards an oligotrophic lifestyle, not all lineages are considered genome
streamlined organisms (74–77). The predicted metabolic features of the most abundant PRC
clusters (CHAB-I-5, SAG-O19, and DC5-80-3 make up to 72% of Roseobacter in oceans)
12
generally include aerobic anoxygenic photosynthesis, sulfur oxidation, one-carbon metabolism,
and carbon monoxide oxidation (74). The PRC, unlike other Roseobacter, have very few
cultivated representatives (68). One abundant and largely uncultivated lineage of the PRC is
CHAB-I-5.
The CHAB-I-5 cluster was first discovered in a study of bottle-effects on water collected
from the Mediterranean as part of the Changes in Bacterial Diversity and Activity in
Mediterranean Coastal Waters as Affected by Eutrophication (CHABADA) project (78). It was
quickly established that the CHAB-I-5 cluster is found throughout global waters in high
abundance. CHAB-I-5 contributed 10-20% of the sequences found in coastal waters and the
Sargasso Sea (79–82) and is present in waters at all latitudes from polar to tropical (73, 74).
CHAB-I-5 reached up to 20% of the active bacterial cells in the microbial community in the
North Sea (73), showing that members of the cluster are actively transcribing genes and are not
only present in the environment. Some of the most transcribed pathways included aerobic
anoxygenic photosynthesis, carbon monoxide oxidation, transporters, and flagellum (73).
Outside of these features, other genomic studies show CHAB-I-5 to contain pathways for
inorganic sulfur oxidation, reduced sulfur acquisition, Entner-Doudoroff glycolysis, reduced
nitrogen uptake, nitrite/nitrate uptake, auxotrophy for thiamin and biotin, phosphonate
metabolism, and transport of metals such as iron (III), iron (II), and manganese. Though CHAB-
I-5 is abundant, active, and contains metabolic pathways important for nutrient cycling in global
waters, the cluster is relatively understudied as only four genomes (one isolate and three single-
cell amplified genomes) (73, 74) in total have been analyzed.
To date, all information about how CHAB-I-5 interacts with its environment is based on
genomic and ecological study as no physiology data for the clade has been published.
13
Representative isolates have been cultured previously, though none were maintained long
enough to gather any physiology data. One study reported >100 CHAB-I-5 isolates, though none
were able to be revived for future study (73, 83). Another isolate, SB2, was enriched and then
isolated long enough to gather the first isolate genome before the culture was contaminated (73).
A recent publication described another cultured representative, strain FZCC0083, and isolated
the first viruses for the cluster, but no physiology data on the CHAB-I-5 representative was
released (84). Fundamental questions about the clade’s growth rates, morphology, or temperature
and salinity tolerance remain unanswered, though these facets of physiological study are vital to
contextualize the ecology and nutrient cycling capabilities of the cluster.
In Chapter 2, I use a new isolate, its genome, as well as 51 other CHAB-I-5 genomes to
provide the largest survey of CHAB-I-5 to date. I describe the first physiology of CHAB-I-5
using a recently isolated representative, US3C007, and provide the first circularized CHAB-I-5
genome. Additionally, I define two clusters of CHAB-I-5 representing two species within the
same genus.

Integrating research and education
The maintenance and physiological study of environmental microorganisms is frequently
a daunting task, partially due to their adaptation to oligotrophic environments. They frequently
have very slow growth rates and are fastidious nutrient requirements (85), two features that make
experimentation tedious for any individual researcher. A solution for this scenario is to employ a
larger number of researchers, and this can be done in combination with serving education goals
in college and university undergraduate laboratory courses.
14
Undergraduate research benefits both the primary lead of a project as well as the
undergraduate researcher. The research lead gains assistance in executing the objectives of their
projects, while the undergraduate researchers gain hands-on training while contributing
meaningfully to scientific research. Some difficulties associated with traditional undergraduate
research opportunities include the limited amount of research positions available in research labs
and the time commitment away from work on their degree requirements (86). Frequently,
students who did not attend effective college preparatory high schools are at a disadvantage
when compared to those who did. They might not assimilate into college standards as easily and
do not know how to navigate the sometimes-confusing steps required to secure a position. As
these undergraduate research positions are frequently competitive, traditional modes of gaining
undergraduate research experience is often biased against less privileged students (86–88).
Recent data from the Department of Education notes that college students entering STEM majors
change their major at a 6% higher rate than non-STEM majors, with up to 40% of natural
sciences majors opting to not continue the major they began in (89).
One way for undergraduates to get involved in research that aids in connection to their
majors without the added burden of tradition research experiences is through their curricula with
Course-based Undergraduate Research Experiences (CUREs) (90). CUREs replace the
traditional college laboratory sections in which students use a lab manual to reproduce
previously known experimental outcomes. In a CURE curriculum, students work towards
gathering and analyzing brand new scientific data, in other words, perform real research, that
will ideally assist a graduate teaching assistant or faculty towards a peer reviewed publication.
These CUREs are an attractive solution to the limitations of traditional undergraduate research
15
experiences (86). CUREs have been shown to increase engagement and retention STEM majors,
especially those from underrepresented minority groups (86–88, 91).
In Chapter 3 of this dissertation, I display a CURE curriculum employed at two
universities that allows students to contribute to gathering physiology data on environmentally-
relevant bacterial isolates including the CHAB-I-5 isolate, US3C007. This curriculum reached a
total of 147 students and integrated up-to-date techniques such as flow cytometry and R data
visualization with classroom instruction.

16

References-Introduction
1. Whitman WB, Coleman DC, Wiebe WJ. 1998. Prokaryotes: the unseen majority. Proc
Natl Acad Sci U S A 95:6578–6583.
2. Buchan A, LeCleir GR, Gulvik CA, González JM. 2014. Master recyclers: features and
functions of bacteria associated with phytoplankton blooms. Nat Rev Microbiol 12:686–
698.
3. Fuqua DWJD. 2011. The Physiology and Biochemistry of Prokaryotes. Oxford
University Press.
4. Teel EN. 8/2017. Multi-Dataset Analysis of Bacterial Heterotrophic Variability at the San
Pedro Ocean Time Series (SPOT): An Investigation into the Necessity and Feasibility of
Incorporating a Dynamic Bacterial Component into Global Ecosystem NPZD Models.
Phd. Univeristy of Southern California, Los Angeles, CA.
5. David J. Kirchman JMG. 2018. Microbial Ecology of the Oceans, 3rd edition. John
Wiley & Sons, Inc, Hoboken, NJ.
6. Riemann B, Fuhrman J, Azam F. 1982. Bacterial secondary production in freshwater
measured by(3)H-thymidine incorporation method. Microb Ecol 8:101–113.
7. Morris RM, Rappé MS, Connon SA, Vergin KL, Siebold WA, Carlson CA, Giovannoni
SJ. 2002. SAR11 clade dominates ocean surface bacterioplankton communities. Nature
420:806–810.
8. Vergin KL, Beszteri B, Monier A, Thrash JC, Temperton B, Treusch AH, Kilpert F,
Worden AZ, Giovannoni SJ. 2013. High-resolution SAR11 ecotype dynamics at the
Bermuda Atlantic Time-series Study site by phylogenetic placement of pyrosequences.
ISME J 7:1322–1332.
9. White AE, Giovannoni SJ, Zhao Y, Vergin K, Carlson CA. 2019. Elemental content and
stoichiometry of SAR11 chemoheterotrophic marine bacteria: SAR11 composition.
Limnol Oceanogr 4:44–51.
10. Lloyd KG, Steen AD, Ladau J, Yin J, Crosby L. 2018. Phylogenetically Novel
Uncultured Microbial Cells Dominate Earth Microbiomes. mSystems 3:1–12.
11. Steen AD, Crits-Christoph A, Carini P, DeAngelis KM, Fierer N, Lloyd KG, Thrash JC.
2019. High proportions of bacteria and archaea across most biomes remain uncultured.
ISME J 13:3126–3130.
17
12. Sogin ML, Morrison HG, Huber JA, Welch DM, Huse SM, Neal PR, Arrieta JM, Herndl
GJ. 2006. Microbial diversity in the deep sea and the underexplored “rare biosphere.”
Proceedings of the National Academy of Sciences 103:12115–12120.
13. Quast C, Pruesse E, Yilmaz P, Gerken J, Schweer T, Yarza P, Peplies J, Glöckner FO.
2013. The SILVA ribosomal RNA gene database project: improved data processing and
web-based tools. Nucleic Acids Res 41:D590-6.
14. Mortazavi A, Williams BA, McCue K, Schaeffer L, Wold B. 2008. Mapping and
quantifying mammalian transcriptomes by RNA-Seq. Nat Methods 5:621–628.
15. Staley JT, Konopka A. 1985. Measurement of in situ activities of nonphotosynthetic
microorganisms in aquatic and terrestrial habitats. Annu Rev Microbiol 39:321–346.
16. Hug LA. 2018. Sizing Up the Uncultured Microbial Majority. mSystems 3.
17. Martiny AC. 2019. High proportions of bacteria are culturable across major biomes.
ISME J 3–6.
18. Giovannoni S, Stingl U. 2007. The importance of culturing bacterioplankton in the
“omics” age. Nat Rev Microbiol 5:820–826.
19. Henson MW. 2019. High-Throughput Cultivation of Bacterioplankton from the Gulf of
Mexico and Genomics of the First Cultured LD12 Representative. Ph.D. Louisiana State
University and Agricultural and Mechanical College, Baton Rouge, LA.
20. Lewis WH, Tahon G, Geesink P, Sousa DZ, Ettema TJG. 2020. Innovations to culturing
the uncultured microbial majority. Nat Rev Microbiol https://doi.org/10.1038/s41579-
020-00458-8.
21. Carini P, Steindler L, Beszteri S, Giovannoni SJ. 2013. Nutrient requirements for growth
of the extreme oligotroph ‘Candidatus Pelagibacter ubique’ HTCC1062 on a defined
medium. ISME J 7:592–602.
22. Henson MW, Pitre DM, Weckhorst JL, Lanclos VC, Webber AT, Thrash JC. 2016.
Artificial Seawater Media Facilitate Cultivating Members of the Microbial Majority from
the Gulf of Mexico. mSphere 1:1–10.
23. Button DK, Schut F, Quang P, Martin R, Robertson BR. 1993. Viability and Isolation of
Marine Bacteria by Dilution Culture : Theory , Procedures , and Initial Results Viability
and Isolation of Marine Bacteria by Dilution Culture : Theory , Procedures , and Initial
Results 59:881–891.
24. Connon SA, Giovannoni SJ. 2002. High-Throughput Methods for Culturing
Microorganisms in Very-Low-Nutrient Media Yield Diverse New Marine Isolates. Appl
Environ Microbiol 68:3878–3885.
18
25. Rappé MS, Connon S a., Vergin KL, Giovannoni SJ. 2002. Cultivation of the ubiquitous
SAR11 marine bacterioplankton clade. Nature 418:630–633.
26. Henson MW, Lanclos VC, Pitre DM, Weckhorst JL, Lucchesi AM, Cheng C, Temperton
B, Thrash JC. 2020. Expanding the diversity of bacterioplankton isolates and modeling
isolation efficacy with large-scale dilution-to-extinction cultivation. Appl Environ
Microbiol 86.
27. Oh H-M, Kwon KK, Kang I, Kang SG, Lee J-H, Kim S-J, Cho J-C. 2010. Complete
genome sequence of “Candidatus Puniceispirillum marinum” IMCC1322, a
representative of the SAR116 clade in the Alphaproteobacteria. J Bacteriol 192:3240–
3241.
28. Grote J, Bayindirli C, Bergauer K, Carpintero de Moraes P, Chen H, D’Ambrosio L,
Edwards B, Fernández-Gómez B, Hamisi M, Logares R, Nguyen D, Rii YM, Saeck E,
Schutte C, Widner B, Church MJ, Steward GF, Karl DM, Delong EF, Eppley JM,
Schuster SC, Kyrpides NC, Rappé MS. 2011. Draft genome sequence of strain
HIMB100, a cultured representative of the SAR116 clade of marine Alphaproteobacteria.
Stand Genomic Sci 5:269–278.
29. Fuhrman JA, Schwalbach MS, Stingl U. 2008. Proteorhodopsins: an array of
physiological roles? Nat Rev Microbiol 6:488–494.
30. Bamann C, Bamberg E, Wachtveitl J, Glaubitz C. 2014. Proteorhodopsin. Biochim
Biophys Acta 1837:614–625.
31. Béjà O, Aravind L, Koonin EV, Suzuki MT, Hadd A, Nguyen LP, Jovanovich SB, Gates
CM, Feldman RA, Spudich JL, Spudich EN, DeLong EF. 2000. Bacterial rhodopsin:
evidence for a new type of phototrophy in the sea. Science 289:1902–1906.
32. Martinez A, Bradley AS, Waldbauer JR, Summons RE, DeLong EF. 2007.
Proteorhodopsin photosystem gene expression enables photophosphorylation in a
heterologous host. Proc Natl Acad Sci U S A 104:5590–5595.
33. Giovannoni SJ, Britschgi TB, Moyer CL, Field KG. 1990. Genetic diversity in Sargasso
Sea bacterioplankton. Nature 345:60–63.
34. Giovannoni SJ, Bibbs L, Cho J-C, Stapels MD, Desiderio R, Vergin KL, Rappé MS,
Laney S, Wilhelm LJ, Tripp HJ, Mathur EJ, Barofsky DF. 2005. Proteorhodopsin in the
ubiquitous marine bacterium SAR11. Nature 438:82–85.
35. Steindler L, Schwalbach MS, Smith DP, Chan F, Giovannoni SJ. 2011. Energy Starved
Candidatus Pelagibacter Ubique Substitutes Light-Mediated ATP Production for
Endogenous Carbon Respiration 6:1–10.
36. Gómez-Consarnau L, González JM, Coll-Lladó M, Gourdon P, Pascher T, Neutze R,
Pedrós-Alió C, Pinhassi J. 2007. Light stimulates growth of proteorhodopsin-containing
marine Flavobacteria. Nature 445:210–213.
19
37. Henson MW, Lanclos VC, Faircloth BC, Thrash JC. 2018. Cultivation and genomics of
the first freshwater SAR11 (LD12) isolate. ISME J 12:1846–1860.
38. Savoie ER, Lanclos VC, Henson MW, Cheng C, Getz EW, Barnes SJ, LaRowe DE,
Rappé MS, Thrash JC. 2021. Ecophysiology of the Cosmopolitan OM252
Bacterioplankton (Gammaproteobacteria). mSystems e0027621.
39. Lanclos VC, Rasmussen AN, Kojima CY, Cheng C, Henson MW, Faircloth BC, Francis
CA, Thrash JC. 2023. Ecophysiology and genomics of the brackish water adapted SAR11
subclade IIIa. ISME J https://doi.org/10.1038/s41396-023-01376-2.
40. Getz, Eric W., V. Celeste Lanclos, Conner Y. Kojima, Chuankai Cheng, Michael W.
Henson, Max Emil Schön, Thijs J. G. Ettema, Brant C. Faircloth, and J. Cameron Thrash.
2023. The Aegean-169 clade of bacterioplankton is synonymous with SAR11 subclade V
(HIMB59) and metabolically distinct. mSystems.
41. Morris RM, Vergin KL, Cho J-C, Rappé MS, Carlson CA, Giovannoni SJ. 2005.
Temporal and spatial response of bacterioplankton lineages to annual convective overturn
at the Bermuda Atlantic Time-series Study site. Limnol Oceanogr 50:1687–1696.
42. Kan J, Evans SE, Chen F, Suzuki MT. 2008. Novel estuarine bacterioplankton in rRNA
operon libraries from the Chesapeake Bay. Aquat Microb Ecol 51:55–66.
43. Rappé MS, Kemp PF, Giovannoni SJ. 1997. Phylogenetic diversity of marine coastal
picoplankton 16S rRNA genes cloned from the continental shelf off Cape Hatteras, North
Carolina. Limnology and Oceanography https://doi.org/10.4319/lo.1997.42.5.0811.
44. Giovannoni SJ, Tripp HJ, Givan S, Podar M, Vergin KL, Baptista D, Bibbs L, Eads J,
Richardson TH, Noordewier M, Rappé MS, Short JM, Carrington JC, Mathur EJ. 2005.
Genome streamlining in a cosmopolitan oceanic bacterium. Science 309:1242–1245.
45. Giovannoni SJ, Cameron Thrash J, Temperton B. 2014. Implications of streamlining
theory for microbial ecology. ISME J 8:1553–1565.
46. Grote J, Cameron Thrash J, Huggett MJ, Landry ZC, Carini P, Giovannoni SJ, Rappé
MS. 2012. Streamlining and core genome conservation among highly divergent members
of the SAR11 clade. MBio 3:1–13.
47. Wilhelm LJ, Tripp HJ, Givan SA, Smith DP, Giovannoni SJ. 2007. Natural variation in
SAR11 marine bacterioplankton genomes inferred from metagenomic data. Biol Direct
2:27.
48. Tripp HJ, Schwalbach MS, Meyer MM, Kitner JB, Breaker RR, Giovannoni SJ. 2009.
Unique glycine-activated riboswitch linked to glycine--serine auxotrophy in SAR11.
Environ Microbiol 11:230–238.
20
49. Tripp HJ, Kitner JB, Schwalbach MS, Dacey JWH, Wilhelm LJ, Giovannoni SJ. 2008.
SAR11 marine bacteria require exogenous reduced sulphur for growth. Nature 452:741–
744.
50. Carini P, Campbell EO, Morré J, Sañudo-Wilhelmy SA, Cameron Thrash J, Bennett SE,
Temperton B, Begley T, Giovannoni SJ. 2014. Discovery of a SAR11 growth
requirement for thiamin’s pyrimidine precursor and its distribution in the Sargasso Sea.
ISME J 8:1727–1738.
51. Carini P, Van Mooy BAS, Thrash JC, White A, Zhao Y, Campbell EO, Fredricks HF,
Giovannoni SJ. 2015. SAR11 lipid renovation in response to phosphate starvation. Proc
Natl Acad Sci U S A 112:7767–7772.
52. Carini P, White AE, Campbell EO, Giovannoni SJ. 2014. Methane production by
phosphate-starved SAR11 chemoheterotrophic marine bacteria. Nat Commun 5:4346.
53. Ruiz-Perez CA, Bertagnolli AD, Tsementzi D, Woyke T, Stewart FJ, Konstantinidis KT.
2021. Description of Candidatus Mesopelagibacter carboxydoxydans and Candidatus
Anoxipelagibacter denitrificans: Nitrate-reducing SAR11 genera that dominate
mesopelagic and anoxic marine zones. Syst Appl Microbiol 44:126185.
54. Thrash JC, Temperton B, Swan BK, Landry ZC, Woyke T, DeLong EF, Stepanauskas R,
Giovannoni SJ. 2014. Single-cell enabled comparative genomics of a deep ocean SAR11
bathytype. ISME J 8:1440–1451.
55. Delmont TO, Kiefl E, Kilinc O, Esen OC, Uysal I, Rappé MS, Giovannoni S, Murat Eren
A. 2019. Single-amino acid variants reveal evolutionary processes that shape the
biogeography of a global SAR11 subclade https://doi.org/10.7554/eLife.46497.001.
56. Tsementzi D, Rodriguez-R LM, Ruiz-Perez CA, Meziti A, Hatt JK, Konstantinidis KT.
2019. Ecogenomic characterization of widespread, closely-related SAR11 clades of the
freshwater genus “Candidatus Fonsibacter” and proposal of Ca. Fonsibacter lacus sp.
nov. Syst Appl Microbiol 42:495–505.
57. Jimenez-Infante F, Ngugi DK, Vinu M, Blom J, Alam I, Bajic VB, Stingl U. 2017.
Genomic characterization of two novel SAR11 isolates from the Red Sea, including the
first strain of the SAR11 Ib clade. FEMS Microbiology Ecology
https://doi.org/10.1093/femsec/fix083.
58. Eiler A, Mondav R, Sinclair L, Fernandez-Vidal L, Scofield D, Scwientek P, Martinez-
Garcia M, Torrents D, McMahon KD, Andersson SGE, Stepanauskas R, Woyke T,
Bertilsson S. 2015. Tuning fresh: radiation through rewiring of central metabolism in
streamlined bacteria. ISME J 10:1–13.
59. Bano N, Hollibaugh JT. 2002. Phylogenetic composition of bacterioplankton
assemblages from the Arctic Ocean. Appl Environ Microbiol 68:505–518.
21
60. Oh HM, Kang I, Lee K, Jang Y, Lim SI, Cho JC. 2011. Complete genome sequence of
strain IMCC9063, belonging to SAR11 subgroup 3, isolated from the Arctic Ocean. J
Bacteriol 193:3379–3380.
61. Brown MV, Lauro FM, DeMaere MZ, Muir L, Wilkins D, Thomas T, Riddle MJ,
Fuhrman JA, Andrews-Pfannkoch C, Hoffman JM, McQuaid JB, Allen A, Rintoul SR,
Cavicchioli R. 2012. Global biogeography of SAR11 marine bacteria. Mol Syst Biol
8:595.
62. Herlemann DPR, Woelk J, Labrenz M, Jürgens K. 2014. Diversity and abundance of
“Pelagibacterales” (SAR11) in the Baltic Sea salinity gradient. Syst Appl Microbiol
37:601–604.
63. Dupont CL, Larsson J, Yooseph S, Ininbergs K, Goll J, Asplund-Samuelsson J, McCrow
JP, Celepli N, Allen LZ, Ekman M, Lucas AJ, Hagström Å, Thiagarajan M, Brindefalk B,
Richter AR, Andersson AF, Tenney A, Lundin D, Tovchigrechko A, Nylander JAA,
Brami D, Badger JH, Allen AE, Rusch DB, Hoffman J, Norrby E, Friedman R, Pinhassi
J, Venter JC, Bergman B. 2014. Functional tradeoffs underpin salinity-driven divergence
in microbial community composition. PLoS One 9.
64. Rasmussen AN, Damashek J, Eloe-Fadrosh EA, Francis CA. 2020. In-depth
Spatiotemporal Characterization of Planktonic Archaeal and Bacterial Communities in
North and South San Francisco Bay. Microb Ecol https://doi.org/10.1007/s00248-020-
01621-7.
65. Buchan A, González JM, Moran MA. 2005. Overview of the marine roseobacter lineage.
Appl Environ Microbiol 71:5665–5677.
66. Buchan A, Hadden M, Suzuki MT. 2009. Development and application of quantitative-
PCR tools for subgroups of the Roseobacter clade. Appl Environ Microbiol 75:7542–
7547.
67. Luo H, Moran MA. 2014. Evolutionary ecology of the marine Roseobacter clade.
Microbiol Mol Biol Rev 78:573–587.
68. Newton RJ, Griffin LE, Bowles KM, Meile C, Gifford S, Givens CE, Howard EC, King
E, Oakley CA, Reisch CR, Rinta-Kanto JM, Sharma S, Sun S, Varaljay V, Vila-Costa M,
Westrich JR, Moran MA. 2010. Genome characteristics of a generalist marine bacterial
lineage. ISME J 4:784–798.
69. Polz MF, Hunt DE, Preheim SP, Weinreich DM. 2006. Patterns and mechanisms of
genetic and phenotypic differentiation in marine microbes. Philos Trans R Soc Lond B
Biol Sci 361:2009–2021.
70. Futuyma DJ, Moreno G. 1988. THE EVOLUTION OF ECOLOGICAL
SPECIALIZATION. Annu Rev Ecol Syst 19:207–233.
22
71. Van Tienderen PH. 1991. EVOLUTION OF GENERALISTS AND SPECIALISTS IN
SPATIALLY HETEROGENEOUS ENVIRONMENTS. Evolution 45:1317–1331.
72. Billerbeck S, Wemheuer B, Voget S, Poehlein A, Giebel H-A, Brinkhoff T, Gram L,
Jeffrey WH, Daniel R, Simon M. 2016. Biogeography and environmental genomics of
the Roseobacter-affiliated pelagic CHAB-I-5 lineage. Nat Microbiol 1:16063.
73. Zhang Y, Sun Y, Jiao N, Stepanauskas R, Luo H. 2016. Ecological Genomics of the
Uncultivated Marine Roseobacter Lineage CHAB-I-5. Appl Environ Microbiol 82:2100–
2111.
74. Luo H, Swan BK, Stepanauskas R, Hughes AL, Moran MA. 2014. Evolutionary analysis
of a streamlined lineage of surface ocean Roseobacters. ISME J 8:1428–1439.
75. Luo H, Csuros M, Hughes AL, Moran MA. 2013. Evolution of divergent life history
strategies in marine alphaproteobacteria. MBio 4.
76. Voget S, Wemheuer B, Brinkhoff T, Vollmers J, Dietrich S, Giebel H-A, Beardsley C,
Sardemann C, Bakenhus I, Billerbeck S, Daniel R, Simon M. 2015. Adaptation of an
abundant Roseobacter RCA organism to pelagic systems revealed by genomic and
transcriptomic analyses. ISME J 9:371–384.
77. Schäfer H, Servais P, Muyzer G. 2000. Successional changes in the genetic diversity of a
marine bacterial assemblage during confinement. Arch Microbiol 173:138–145.
78. Suzuki MT, Preston CM, Béjà O, de la Torre JR, Steward GF, DeLong EF. 2004.
Phylogenetic screening of ribosomal RNA gene-containing clones in Bacterial Artificial
Chromosome (BAC) libraries from different depths in Monterey Bay. Microb Ecol
48:473–488.
79. Alonso-Gutiérrez J, Lekunberri I, Teira E, Gasol JM, Figueras A, Novoa B. 2009.
Bacterioplankton composition of the coastal upwelling system of “Ría de Vigo”, NW
Spain. FEMS Microbiol Ecol 70:493–505.
80. Moran MA, Buchan A, González JM, Heidelberg JF, Whitman WB, Kiene RP,
Henriksen JR, King GM, Belas R, Fuqua C, Brinkac L, Lewis M, Johri S, Weaver B, Pai
G, Eisen JA, Rahe E, Sheldon WM, Ye W, Miller TR, Carlton J, Rasko DA, Paulsen IT,
Ren Q, Daugherty SC, Deboy RT, Dodson RJ, Durkin AS, Madupu R, Nelson WC,
Sullivan SA, Rosovitz MJ, Haft DH, Selengut J, Ward N. 2004. Genome sequence of
Silicibacter pomeroyi reveals adaptations to the marine environment. Nature 432:910–
913.
81. Venter JC, Remington K, Heidelberg JF, Halpern AL, Rusch D, Eisen JA, Wu D, Paulsen
I, Nelson KE, Nelson W, Fouts DE, Levy S, Knap AH, Lomas MW, Nealson K, White
O, Peterson J, Hoffman J, Parsons R, Baden-Tillson H, Pfannkoch C, Rogers Y-H, Smith
HO. 2004. Environmental genome shotgun sequencing of the Sargasso Sea. Science
304:66–74.
23
82. Yang S-J, Kang I, Cho J-C. 2016. Expansion of Cultured Bacterial Diversity by Large-
Scale Dilution-to-Extinction Culturing from a Single Seawater Sample. Microb Ecol
71:29–43.
83. Zhang Z, Wu Z, Liu H, Yang M, Wang R, Zhao Y. Genomic analysis and
characterization of phages infecting the marine Roseobacter CHAB-I-5 lineage reveal a
globally distributed and abundant phage …. Front Microbiol.
84. Kirchman DL. 2016. Growth Rates of Microbes in the Oceans. Ann Rev Mar Sci 8:285–
309.
85. Linn MC, Palmer E, Baranger A, Gerard E, Stone E. 2015. Education. Undergraduate
research experiences: impacts and opportunities. Science 347:1261757.
86. Shapiro C, Moberg-Parker J, Toma S, Ayon C, Zimmerman H, Roth-Johnson EA,
Hancock SP, Levis-Fitzgerald M, Sanders ER. 2015. Comparing the Impact of Course-
Based and Apprentice-Based Research Experiences in a Life Science Laboratory
Curriculum. J Microbiol Biol Educ 16:186–197.
87. Bangera G, Brownell SE. 2014. Course-based undergraduate research experiences can
make scientific research more inclusive. CBE Life Sci Educ 13:602–606.
88. Auchincloss LC, Laursen SL, Branchaw JL, Eagan K, Graham M, Hanauer DI, Lawrie G,
McLinn CM, Pelaez N, Rowland S, Towns M, Trautmann NM, Varma-Nelson P, Weston
TJ, Dolan EL. 2014. Assessment of course-based undergraduate research experiences: a
meeting report. CBE Life Sci Educ 13:29–40.
89. Thompson SK, Neill CJ, Wiederhoeft E, Cotner S. 2016. A Model for a Course-Based
Undergraduate Research Experience (CURE) in a Field Setting. J Microbiol Biol Educ
17:469–471.

24
CHAPTER 1: Ecophysiology and Genomics of the Brackish Water
Adapted SAR11 Subclade IIIa
Chapter 1 was previously published in the ISME journal February 4
th
, 2023
(https://doi.org/10.1038/s41396-023-01376-2). Below is the main text as was originally
published. Supplemental information as was originally published can be found on page 84 and at
https://figshare.com/projects/Ecophysiology_and_genomics_of_the_brackish_water_adapted_S
AR11_subclade_IIIa/144939.

25

ARTICLE OPEN
Ecophysiology and genomics of the brackish water adapted
SAR11 subclade IIIa
V. Celeste Lanclos
1
, Anna N. Rasmussen
2
, Conner Y. Kojima
1
, Chuankai Cheng
1
, Michael W. Henson
3
, Brant C. Faircloth
4
,
Christopher A. Francis
2
and J. Cameron Thrash
1✉
© The Author(s) 2023
The Order Pelagibacterales (SAR11) is the most abundant group of heterotrophic bacterioplankton in global oceans and comprises
multiplesubcladeswithuniquespatiotemporaldistributions. SubcladeIIIaistheprimarySAR11groupinbrackishwatersandshares
a common ancestor with the dominant freshwater IIIb (LD12) subclade. Despite its dominance in brackish environments, subclade
IIIa lacks systematic genomic or ecological studies. Here, we combine closed genomes from new IIIa isolates, new IIIa MAGS from
San Francisco Bay (SFB), and 460 highly complete publicly available SAR11 genomes for the most comprehensive pangenomic
study of subclade IIIa to date. Subclade IIIa represents a taxonomic family containing three genera (denoted as subgroups IIIa.1,
IIIa.2, and IIIa.3) that had distinct ecological distributions related to salinity. The expansion of taxon selection within subclade IIIa
also established previously noted metabolic differentiation in subclade IIIa compared to other SAR11 subclades such as glycine/
serine prototrophy, mosaic glyoxylate shunt presence, and polyhydroxyalkanoate synthesis potential. Our analysis further shows
metabolicflexibilityamongsubgroupswithinIIIa.Additionally,wefindthatsubcladeIIIa.3bridgesthemarineandfreshwaterclades
based on its potential for compatible solute transport, iron utilization, and bicarbonate management potential. Pure culture
experimentation validated differential salinity ranges in IIIa.1 and IIIa.3 and provided detailed IIIa cell size and volume data. This
study is an important step forward for understanding the genomic, ecological, and physiological differentiation of subclade IIIa and
the overall evolutionary history of SAR11.
The ISME Journal; https://doi.org/10.1038/s41396-023-01376-2
INTRODUCTION
The SAR11 clade (Pelagibacterales) is a diverse order of
bacterioplankton that constitutes up to 40% of heterotrophic
bacteria in surface global oceans [1, 2]. The clade encompasses
multiple subclades that exhibit unique spatiotemporal distribu-
tions in global waters corresponding to the group’s phylogenetic
structure [1, 3]. Much of what is known about SAR11 comes from
subclade Ia, including the well-characterized strains HTCC1062
and HTCC7211 [4–6]. Studies focused on these organisms and
other genomes within Ia defined SAR11 as canonical genome-
streamlined oligotrophic marine heterotrophs [7–9] with specific
nutrient requirements [10], simple regulatory systems [7, 11, 12],
auxotrophies for key amino acids and vitamins [13, 14], partition-
ing of carbon flow for assimilation or energy based on external
nutrient concentrations [15], and sensitivity to purifying selection
within closely related populations [16]. Studies of non-Ia
SAR11 subclades have provided evidence of additional
subclade-specific genomic adaptations and biogeography. For
example, subclade Ic contains subtle genomic changes such as
amino acid composition, increased intergenic spacer size, and
genes encoding for cell wall components as likely adaptations to
thebathypelagic[17].SomesubcladeIIandIcmemberspossessed
genes for nitrate reduction in oxygen minimum zones, providing
the first evidence of facultative anaerobic metabolism in SAR11
[18]. The freshwater LD12/IIIb subclade was recently cultivated
and its growth in low brackish salinities and loss of osmoregula-
tion genes provides a hypothesis for SAR11 adaptation into
freshwater ecosystems [19, 20].
Another important SAR11 subclade, IIIa, which shares a most
recent common ancestor with the freshwater LD12/IIIb group
[3, 19] (hereafter LD12), has received comparatively little attention
despite being a key group to study the evolutionary transition of
SAR11 from marine to fresh water. To date, there are only two
reported isolates, HIMB114 (isolated from the Oahu, HI coast [8])
and IMCC9063 (isolated from the Svalbard, Norway coast [21]), but
this lack of systematic study is not indicative of IIIa’s relevance in
global aquatic systems. IIIa is the most abundant SAR11 subclade
in brackish waters and its distribution varies based on salinity and
phylogenetic position, with two primary branches represented by
the two isolates and their genomes [22, 23]. In a survey of the
Baltic Sea, the IMCC9063-type of SAR11 was the more abundant
representative in brackish waters (salinity < 10) while the
HIMB114-type peaked in high-brackish to marine salinities [22].
A similar trend has also been seen across northern Gulf of Mexico
estuaries in which multiple operational taxonomic units (OTUs) of
SAR11 IIIa were separated ecologically by salinities above and
Received: 2 August 2022 Revised: 6 January 2023 Accepted: 20 January 2023
1
Department of BiologicalSciences, University of Southern California, Los Angeles, CA 90089,USA.
2
Department of Earth System Science, Stanford University, Stanford, CA 94305,
USA.
3
Department of Geophysical Sciences, University of Chicago, Chicago, IL 60637, USA.
4
Department of Biological Sciences and Museum of Natural Science, Louisiana State
University, Baton Rouge, LA 70803, USA.
✉
email: thrash@usc.edu
www.nature.com/ismej
1234567890();,:
26

below ~10 [23]. In the San Francisco Bay (SFB), a 16S rRNA gene
ampliconOTU-based study alsofoundsubcladeIIIatodominateat
mesohaline salinities [24]. Additionally, the two established
branches of IIIa were separated by temperature and latitude in
polar versus temperate waters [25]. Despite evidence of niche
separation based on their environmental distributions, the
temperature and salinity tolerances of these organisms have not
been tested experimentally.
There is a comparative paucity of information about subclade
IIIa relative to other SAR11, and only limited information has been
gleaned from studies using comparative genomics thus far.
Neither IIIa representative contains a complete glycolytic pathway,
though the neighboring subclade LD12 contains a typical EMP
pathway [19] and some subclade I representatives have a variant
of the ED pathway [26]. While all SAR11 members are reliant on
exogenous reduced sulfur, neither HIMB114 nor IMCC9063 have
the genomic potential to use DMSO or DMSP like other
SAR11 strains [15, 27–29]. The extensive C1 metabolism found in
other SAR11 strains is also lacking in IIIa genomes [17]. Contrary to
other well-studied SAR11 members, HIMB114 and IMCC9063 have
been reported to contain serABC for glycine/serine prototrophy
and IMCC9063 also contains a tenA homolog not found in
subclade I that may allow for AmMP rather than HMP to serve as a
thiamin source [14]. Together, these genomic predictions suggest
that IIIa is fundamentally different from other well-studied SAR11
clades in some aspects of metabolic potential which aligns with
the general SAR11 trend of phylogeny reflecting the unique
ecology and genomic novelty of particular clades. Furthermore,
16S rRNA gene and phylogenomic trees indicate at least three
separate IIIa subgroups instead of only two, raising questions
about possible additional genomic and ecological diversification
within IIIa [3, 30].
To improve our understanding of the genomic, ecological, and
physiological variation present in SAR11 subclade IIIa, we
conducted a comprehensive study leveraging new isolates, three
closed genomes from these strains, and an additional 468 SAR11
genomes that included new and publicly available metagenome-
assembled genomes (MAGs), single-amplified genomes (SAGs),
and1059metagenomicsamplesfromavarietyofaquatichabitats.
We examined the pangenomics and global ecology of the group
as well as pure culture physiology from two of our isolates. Our
results provide strong evidence for three genera within IIIa (IIIa.1,
IIIa.2, and IIIa.3) whose ecological distribution is defined at least
partially by salinity. We define the genomic adaptations that
separate IIIa from the rest of defined clades of SAR11, the three
subgroups within IIIa from each other, and partially characterize
the physiology and morphology of two isolates from the IIIa
branches with cultured representatives. Our SAR11 IIIa strains
grown in defined and complex artificial seawater medium, as well
as their genomes, provide new opportunities for detailed study of
this group.
MATERIALS AND METHODS
Isolation, genome sequencing, and assembly
All strains were isolated using high throughput dilution-to-extinction
methods and identified through 16S rRNA gene sequences as previously
reported [25, 31]. DNA for strain LSUCC0261 was sequenced using HiSeq
(Illumina) after library preparation as previously reported [19] at the
Oklahoma Medical Research Facility. DNA for strains LSUCC0664 and
LSUCC0723 was sent to the Argonne National Laboratory Environmental
Sample Preparation and Sequencing Facility for library preparation and
sequencing. We trimmed reads with Trimmomatic v0.36 and assembled
trimmed reads for all genomes with SPAdes v3.10.1 [32] using default
parameters with coverage cutoff set to “auto”. We verified closure of the
genomes using Pilon v1.22 [33] and checked the assemblies for
contamination using CheckM v1.0.5 [34] with “lineage_wf”. See Supple-
mentary Text for detailed methods on isolation, sequencing, assembly,
binning, and genome closure verification.
Comparative genomics and genome characteristics
To increase the number of IIIa genomes in our analysis, we assembled
MAGs from the San Francisco Bay (SFB) [35] and combed public datasets
forhighly-completeSAR11genomesfromallsubcladesusingGTDB-Tk[36]
as indicated in the Supplementary Methods. Subclades within SAR11 were
delineated using phylogenetic branching (Supplementary Text) [37–39],
16S rRNA gene BLAST identity, average nucleotide identity (ANI) [40], and
average amino acid identity (AAI) (https://github.com/dparks1134/
CompareM, default settings). Comparative genomics was completed using
Anvi’o version 7.1 [41, 42] with the pangenomics workflow (https://
merenlab.org/2016/11/08/pangenomics-v2) as previously reported [43]
using the following annotation sources from Interproscan [44] and anvi-
estimate-metabolism: SMART, PRINTS, MobiDBLite, KEGG_Class, KOfam,
Gene3D, ProSiteProfiles, SUPERFAMILY, Pfam, CDD, Coils, Hamap, ProSite-
Patterns, PANTHER, SFLD, KEGG_Module, PIRSF, and TIGRFAM. Pfam and
KOfam were primarily used for detailed gene searches. We searched for
bacteriophage in the assembled genomes of LSUCC0261, LSUCC0664, and
LSUCC0723 using the Virsorter ‘Virome’ and ‘RefSeq’ databases [45]. Lastly,
we used CheckM v1.0.5 [34] output values for genome characteristics
(coding density, GC%, predicted genes, and estimated genome size)
comparison. We estimated the genome size of non-closed genomes from
public databases that were at least 80% complete by multiplying the
number of base pairs in the genome assembly by the inverse of the
estimated completion percentage (Supplementary Table S1).
Competitive metagenomic read recruitment
To examine the distribution of genomes in aquatic systems, we selected
1,059 metagenomes for read recruitment from the following regions and
salinity categories: Baltic Sea (oligo-mesohaline) [46, 47], Chesapeake Bay
(USA) (fresh-euhaline) [48, 49], Columbia River (USA) (oligo-euhaline) [50],
Black Sea (polyhaline) [51], Gulf of Mexico (poly-euhaline) [52], Pearl River
(China) (fresh-polyhaline) [53], San Francisco Bay (USA) (fresh-euhaline)
[35], BioGeoTraces (euhaline) [54], Tara Oceans (poly-euhaline) [55], and
the North Pacific Subtropical Gyre (euhaline) [56] (accession numbers
available in Supplementary Table S1). We conducted read mapping and
calculation of normalized abundances via Reads Per Kilobase (of genome)
per Million (of recruited read base pairs) (RPKM) using RRAP [57].
Growth experiments
To test the salinity and temperature ranges of our isolates, we grew pure
cultures in their isolation medium across a range of ionic strengths and
temperatures in the dark without shaking. To test for various C, N, and S
substrates that could be used by LSUCC0261, we grew the culture in a
modified JW2 medium that contained a single carbon, nitrogen, and sulfur
source (Supplementary Table S1) in 96×2.1mL well PTFE plates (Radleys,
Essex, UK). Concentrations for the nutrient sources were added to mimic
those in the original minimal media as follows: carbon 500nM, nitrogen
5µM, sulfur 90nM for cysteine and methionine, and 500nM for taurine.
After three sequential transfers of the plates every 3–4 weeks, we
transferred anywellsthatshoweda cellsignatureontheflow cytometer to
flasks in triplicate with the corresponding C/N/S mixtures and a higher
concentration of the carbon substate (50µM). All cultures were re-checked
for purity after the experiment concluded via Sanger sequencing of the
16S rRNA gene as described [31]. Cell concentrations were enumerated
usingaGuavaEasyCyte5HTflowcytometer(Millipore,Massachusetts,USA)
with previously reported settings [19, 31]. Growth rates were calculated
using sparse-growth-curve [58].
Electron microscopy and cell size estimates
LSUCC0261 was grown to 10
6
cells mL
−1
and 50mL of culture was fixed
with 3% glutaraldehyde at 4°C overnight. Cells were filtered onto a 0.2µm
Isopore polycarbonate membrane filter (MilliporeSigma) and dehydrated
with 20minute washes at 30%, 40%, 50%, 75%, 80%, 90%, 95%, and 100%
ethanol. We used a Tousimis 815 critical point drying system with 100%
ethanol. The filters were then placed into a Cressington 108 sputtercoater
for 45s and imaged on the JSM-7001F-LV scanning electron microscope at
the University of Southern California Core Center of Excellence in
NanoImaging (https://cni.usc.edu). LSUCC0664 was grown to 10
6
cells
mL
−1
and 5µL of culture was loaded onto a glow discharged 300 mesh
carbon filmed grid (EMS:CF300-cu). We removed excess liquid with filter
paperafter2minandstainedwith2%uranylacetate(TEDPellaCat:19481)
for1min.ThesampleswereimagedwithaJEM-1400transmissionelectron
microscope at Louisiana State University Shared Instrumentation Facility
V.C. Lanclos et al.
2
The ISME Journal
27

(https://www.lsu.edu/sif/). We estimated cell volumes using Pappus’
centroid theorem (Supplementary Text).
RESULTS
New isolate genome and MAG characteristics
During the course of previous large-scale culturing experiments,
we isolated multiple strains of SAR11 IIIa from the northern Gulf of
Mexico [23, 31]. We chose three of these isolates (LSUCC0261,
LSUCC0664, and LSUCC0723) for further genomic investigation
based on their distribution across the 16S rRNA gene tree within
SAR11 IIIa [23]. Genome sequencing and assembly resulted in a
single circular contig for each isolate genome. We assembled
eight SAR11 genomes from the San Francisco Bay, two of which
were subclade IIIa.3 members (Fig. 1A). The two IIIa.3 MAGs
generated from SFB were SFB9D2025, which is 0.6Mb, 52.4%
completeness, 5.7% contamination, and was generated from
waters with a salinity of 23.6, and SFB3D203, which is 0.9Mb,
72.6% completeness, 6% contamination, and was generated from
waters with a salinity of 5.7. Characteristically of other SAR11
genomes, our isolate genomes and others from IIIa had low GC
content (29–30%) and high coding density (96%) (Table 1,
Supplementary Fig. S1). However, subclade IIIa joins subclades II
and LD12 as having smaller genomes than those in subclade I
(Supplementary Fig. S1).
Phylogenomics, taxonomy, and genome trends
Phylogenomics of 471 SAR11 genomes resolved our isolates as
novel members of subclade IIIa (Supplementary Fig. S2), and
reproduced the three previously observed IIIa subgroups,
delineated as IIIa.1, IIIa.2, and IIIa.3 (Fig. 1A). While a similar
nomenclature was recently proposed [30], we have re-classified
the subgroups using results from more genomes, amino acid
identity (AAI), and 16S rRNA gene identity (Fig. 1B). Both 16S rRNA
gene and AAI identities show that IIIa.1 is more similar to IIIa.2
than IIIa.3 (Fig. 1B). The lowest 16S rRNA gene identity within IIIa is
92.1% (Supplementary Table S1). Genomes within a subgroup
have values of at least 73% AAI to each other with a dropoff of at
least 10% AAI between subgroups, which also indicates each
subgroup represents genus level classification using AAI [59]
(Fig.1A,B,SupplementaryTableS1).Notallofthegenomeswithin
IIIa contained a 16S rRNA gene sequence, but those that did
shared >97% 16S rRNA sequence identity within a subgroup. This
is near the ~98% sequence identity metric for species [60]. We
therefore propose that IIIa represents a taxonomic family
consisting of three genera.
IIIa
IIIb/
LD12
IIIa.1
A
0.4
AM1bin0028
AG470E16
SFB9D2025
LSUCC0664
SCGCAAA028C07
SCGCAAA280B11
TMED146
CP15
WB86001
AG895L23
CP1
LSUCC0261
SCGCAAA280P20
AG359E06
CP2
SCGCAAA027J10
MED1116
MED817
AG894A09
QL1
SFB3D203
CP31
SCGCAAA487M09
LSUCC0530
IMCC9063
HIMB114
LSUCC0723
BaikaldeepG36
SCGCAAA028D10
SCGCAAA027C06
CP55
100
100
100
100
100
100
100
100
100
97
99
100
90
85
100
100
100
100
100
100
100
100
100
100
100
78
100
90
100
100
IIIa.2
IIIa.3
Other
SAR11s
50
60
70
80
90
100
%ID
Aminoacididentity
Averagenucleotideidentity
SCGCAAA280B11
SCGCAAA028D10
SCGCAAA280P20
WB86001
LSUCC0530
SCGCAAA487M09
BaikaldeepG36
AG 894A09
TMED146
CP1
AG359E06
SCGCAAA028C07
CP55
SCGCAAA027C06
CP2
HIMB114
MED1116
SFB3D203
AG470E16
MED817
CP 15
IMCC9063
LSUCC0664
LSUCC0261
LSUCC0723
AG 895L23
QL1
SCGCAAA027J10
CP 31
SFB9D2025
92
94
96
98
100
70 80 90 100
Aminoacididentity(%)
16SrRNAgeneBLASTidentity(%)
AAISpecies
16SrRNA
genegenus
AAIGenus
16SrRNA
genespecies
Subclade
IIIa.1_IIIa.1
IIIa.1_IIIa.2
IIIa.1_IIIa.3
IIIa.2_IIIa.2
IIIa.2_IIIa.3
IIIa.3_IIIa.3
B
AM1bin0028
Ge us
p
Fig. 1 Subcladestructure andgenomesimilarity. A Phylogeny and ANI/AAI pairwise comparison of SAR11 IIIa and IIIb/LD12. The phylogeny
is a subset of the phylogenomic tree found in Supplementary Fig. 2. Node valuesare indicators of bootstrap support (n=1000). Stars indicate
new isolates from this analysis. B 16S rRNA gene BLAST identity vs AAI. Gray bars indicate the species and genera definitions using AAI [97]
and 16S rRNA genes [60] where noted.
Table 1. Genome statistics of new IIIa isolates compared to other SAR11 genomes. Genome size estimates were calculated by multiplying the
assembly size by the inverse of the estimated completion from CheckM [34].
Genome Subclade Contigs
in
Assembly
Completion
(%)
a
Est.
Contamination (%)
GC (%) Genome
Size
(Mbp)
b
Coding
density (%)
Predicted genes
LSUCC0664 IIIa.1 1 100 0 30 1.17 96 1256
LSUCC0723 IIIa.1 1 100 0 29 1.2 96 1309
LSUCC0261 IIIa.3 1 100 0 30 1.27 96 1330
Other IIIa IIIa 1–122 52.38–99.78 0–5.95 28–32 0.89–1.52 80–97 658–1894
Other SAR11 I,II,LD12 1–288 50.94–100 0–4.67 28–36 0.94–1.75 92–97 654–1788
a
Completion criteria of >80% for subclade I/II genomes from GTDB-Tk.
b
Genome size was estimated for incomplete genomes.
V.C. Lanclos et al.
3
The ISME Journal
28

Ecological distribution
We recruited reads from 1059 aquatic metagenomes spanning
salinities of 0.07–40.2 to 469 SAR11 genomes to evaluate each
genome’s relative global distribution across marine and estuarine
systems (Supplementary Table S1). We categorized salinity
following the Venice system (<0.5 fresh, 0.5–4.9 oligohaline,
5–17.9 mesohaline, 18–29.9 polyhaline, 30–39.9 euhaline, > 40
hyperhaline) [61] and summed the RPKM values by subclade
within a salinity category for each metagenomic sample. Subclade
IIIa overall had a wide ecological distribution with habitat
specialization by subgroup (Fig. 2A, B). IIIa.1 was primarily a
polyhaline clade with limited recruitment to sites with salinities
<18. IIIa.2 was euhaline-adapted with the lowest relative
abundances of IIIa. IIIa.1 and IIIa.2 abundances were much lower
than that of IIIa.3 generally (Fig. 2B). IIIa.3 was the most abundant
IIIa subgroup in salinities <30 and appeared primarily adapted for
meso/oligohaline environments (Fig. 2B). Genomes CP31, CP15,
LSUCC0261, and QL1 dominated the read recruitment in mesoha-
line waters and LSUCC0261 was the most abundant isolate
genome (Fig. 2A), contrasting with the previous use of IMCC9063
and HIMB114 as representatives of the subclade in metagenomic
recruitment datasets [22].
Genomic content of SAR11 IIIa compared to other SAR11
We conducted a pangenomic analysis of all 471 SAR11 genomes
to define genome content similarities and differences within IIIa
and between IIIa and other SAR11 with the goals of 1) quantifying
differences in metabolic potential, and 2) linking genomic
variation to different ecological distributions. Our closed isolate
genomes and expanded taxon selection within IIIa allowed us to
define whether the previously reported genomic content from
IMCC9063 and HIMB114 constituted unique or defining traits of
their respective subclades. Although SAR11 potentially contains
ten subclades [3] or more [30], for our analysis we condensed
these into the broad subclades I, II, and LD12, and excluded
subcladesIVandVsincetheirphylogeneticinclusionwithinSAR11
is the source of conflicting reports [30, 62–66]. Figure 3
summarizes the genomic differences among SAR11 highlighted
below and the complete set of orthologous clusters is in
Supplementary Table S1.
Central carbon. IIIa had predicted genes for the pentose
phosphate pathway, TCA cycle, and glucose 6-phosphate
isomerase like subclades I, II, and LD12. IIIa was missing the EMP
glycolysismarkergene,phosphofructokinase,thatsubcladesIIand
LD12 possessed. Other than one member of IIIa.1, IIIa was also
missing the pyruvate kinase commonly found in LD12 and MAGs
and SAGs within subclades I and II. IIIa contained pyruvate
dehydrogenase (aceEF) like subclades I, II, and LD12. Six genomes
within IIIa contained at least two copies of aceE, with QL1
containing 5 copies. Isocitrate lyase is the first enzyme in the
glyoxylate shunt that cleaves isocitrate to glyoxylate and
succinate. The glyoxylate shunt was not conserved in IIIa (Fig. 3),
as only 2/8 genomes within IIIa.1 and 5/9 genomes in IIIa.3
contained isocitrate lyase, including LSUCC0664 (IIIa.1) and
LSUCC0261 (IIIa.3). However, the closed isolate genome of
LSUCC0723 (IIIa.1) did not contain a predicted isocitrate lyase,
making it the first reported isolate missing this pathway. The
second step of the glyoxylate shunt is carried out by malate
synthase, which was common in IIIa and all other subclades of
SAR11. Subgroup IIIa.3 and a single non-IIIa genome,
SCGCAAA240_E13, contained acyP that breaks an acyl phosphate
into a phosphate, carboxyl group, and a proton.
C1 metabolism. Most IIIa genomes were missing formate-
tetrahydrofolate (THF) ligase and formate dehydrogenase for the
production of formate and CO
2
from the THF-linked oxidation
pathway, except for CP31 (IIIa.3) which had both (Fig. 3). All IIIa
genomes lacked the methylamine oxidation genes that were
common in I/II SAR11 as previously reported for HIMB114 [8]. Two
IIIa.3 genomes, CP31 and LSUCC0261, and six LD12 genomes
(including the closed isolate genome LSUCC0530) contained a
sodium-dependent bicarbonate transport permease in the SBT
protein family. In freshwater and estuarine cyanobacteria, this
protein functions as a high affinity bicarbonate transporter that
concentrates inorganic carbon within the cell [67]. This probable
bicarbonate transporter was found only in CP31 and LSUCC0261
within IIIa.3, which were also two of the genomes that heavily
recruited estuary metagenomes (Fig. 2). Though SAR11 is not
known to be able to use inorganic carbon for growth, their
genomesdo contain carbonicanhydrase and anaplerotic enzymes
to use inorganic carbon as intermediates in segments of central
carbon metabolism [68].
Amino Acids. IIIa and LD12 had the D-alanine transaminase and
alanine racemase genes to convert alanine to pyruvate, while
other SAR11 did not. Fourteen of twenty genomes from IIIa,
0
10
20
30
40
RPKM
SalinityCategory
Fresh<0.5
Oligohaline0.5−4.9
Mesohaline5.0−17.9
Polyhaline18.0−29.9
Euhaline30.0−39.9
Hyperhaline40.0+
Salinitycategory
IIIa
IIIb/
LD12
IIIa.1
A
0.4
AM1bin0028
AG470E16
SFB9D2025
LSUCC0664
SCGCAAA028C07
SCGCAAA280B11
TMED146
CP15
WB86001
AG895L23
CP1
LSUCC0261
SCGCAAA280P20
AG359E06
CP2
SCGCAAA027J10
MED1116
MED817
AG894A09
QL1
SFB3D203
CP31
SCGCAAA487M09
LSUCC0530
IMCC9063
HIMB114
LSUCC0723
BaikaldeepG36
SCGCAAA028D10
SCGCAAA027C06
CP55
100
100
100
100
100
100
100
100
100
97
99
100
90
85
100
100
100
100
100
100
100
100
100
100
100
78
100
90
100
100
IIIa.2
IIIa.3
Other
SAR11s
IIIasubclade
1e−03
1e−01
1e+01
IIIa.1 IIIa.2 IIIa.3
SummedRPKM(log10)
0
50
100
150
Ia Ib Ic
SummedRPKM
II IIIa.1 IIIa.2 IIIa.3 LD12
Subclade
B
Fig. 2 Distribution of subclade IIIa and LD12 in metagenomic datasets. A Metagenomic recruitment to IIIa and IIIb/LD12 genomes at sites
with salinities≤32. Tiles represent a metagenomic sample that are arranged by increasing salinity on the x-axis. Colors on each tile represent
the Reads Per Kilobase (of genome) per Million (of recruited read base pairs) (RPKM) values at the site. Colors on the x-axis indicate the
category of salinity the sample belongs to classified by the Venice system [61]. B Boxplot of RPKM values summed by subclade for each
metagenomic sample grouped by subclade and colored by salinity category. The insert displays log transformed summed RPKM values for
subclade IIIa.
V.C. Lanclos et al.
4
The ISME Journal
29

including our three isolate genomes, contained serABC for the
production of serine and glycine from glycolysis. Isolates in
subclade I were notedly missing the complete gene suite and
were consequently reliant on external glycine and serine for their
cellular requirements [10, 13], but our analysis found this gene
suite present in some MAGs and SAGs within I/II and LD12 (Fig. 3).
IIIa and LD12 also had multiple copies of metE, a B12-independent
methionine synthase. Though this gene was present in I/II
genomes, members of IIIa.3 and LD12 had up to three copies
spanning multiple orthologous gene clusters (Supplementary
Table S2).
Sulfur. Like all SAR11, IIIa appear dependent on reduced sulfur
compounds and contained no complete assimilatory or dissim-
ilatory sulfate reduction pathways [17, 19]. I/II SAR11 were
predicted to use DMSO and DMSP, but all IIIa genomes, as well
as LD12, were missing dmdA for the use of DMSP through the
demethylation pathway, confirming the previous observation in
the isolate genomes IMCC9063 and HIMB114 [69].
Nitrogen and urease. All SAR11 were predicted to use ammonia
and synthesize glutamate and glutamine, though the pathways in
which glutamate was synthesized were variable. Almost half of IIIa
and most LD12 members had glnB, a part of the P-II nitrogen
response system frequently found in Proteobacteria that is
missing in other members of SAR11 [12] (Fig. 3). The P-II
associated glnD gene was not found in any genome, so it is
unclear what nitrogen response differences, if any, glnB can confer
for IIIa/LD12. We found a urease gene suite operon, ureABC, and
accessory proteins ureEFGHJ in the isolate LSUCC0261 (IIIa.3)
genomewiththenickel/peptideABCtransportercommonly found
in SAR11. Functional urease operons require a nickel cofactor [70],
so the presence of the urease and accessory proteins just
downstream of the ABC transporter indicated a likely functional
gene suite, which we confirmed with growth experiments (below).
Thirty-six MAGs from subclade I also contained the urease gene
suite(Supplementary Table S2). Ureasein SAR11 wasfirstreported
in the Eastern Tropical North Pacific oxygen deficient zone where
up to 10% of SAR11 were reported to contain the genes [71]. Ours
is the first reported SAR11 isolate to contain urease and the only
extant member of IIIa or LD12 with these genes.
Polyhydroxyalkanoates. We found 11/20 genomes within IIIa.1/
IIIa.3 and 8/11 genomes in LD12 contained phaABC and an
associated phasin protein for the predicted production and use of
polyhydroxybutyrate (or another polyhydroxyalkanoate) (Fig. 3). In
other organisms, phaABC and phasin proteins allow cells to store
carbon intracellularly when carbon is high but another essential
component of growth such as nitrogen, phosphorous, magne-
sium, or oxygen is limiting/unbalanced [72]. These granules also
have been noted to protect cells from stressors such as
temperature, reactive oxygen species, osmotic shock, oxidative
stress, or UV damage [73]. These genes have been reported in
limited IIIa.1 genomes previously [74, 75], but we extend this
observation to additional isolates and confirm storage granule
synthesis potential as a widespread phenomenon in the IIIa and
LD12 subclades. Furthermore, this potential phenotype contrasts
with the concept of oceanic SAR11 cells storing phosphate in an
extracellular buffer [76]. The selection pressure for this gene suite
requires further investigation given the broad range of functions
for these compounds and the generally high nutrient load of
coastal and brackish waters where IIIa and LD12 predominate.
Metals. The Fe
3+
ABC transporter common in subclade I/II
SAR11 was found throughout IIIa. Two IIIa.1, three IIIa.3, and seven
LD12 representatives as well as three subclade I/II genomes also
contained efeU, a high affinity ferrous iron (Fe
2+
) transporter, and
IIIa.3 and LD12 members contained a ferrous-iron (Fe
2+
) efflux
pump fieF for iron and zinc removal from cells [77] (Fig. 3).
Estuarine systems have been noted to contain significant amounts
of available Fe
2+
[78], so these genes indicate a potential iron
availability niche of which some these specialized SAR11 can take
advantage.
Compatible solutes. An ectoine permease was found in all
SAR11subcladesexceptforIIIa.2andLD12,butonlyIIIa.3members
LSUCC0261, CP15, and CP55 (and four SAGS from other subclades)
were predicted to synthesize hydroxyectoine from ectoine (Fig. 3).
Hydroxyectoine is a broad-spectrum osmoprotective molecule for
cells, can protect cells against desiccation, and its production was
increasedduringstationaryphasewhengrowninhighsaltstressin
a minimal media in halophile Virgibacillus halodenitrificans PDB-F2
[79, 80]. The glycine betaine/proline transporter was present
throughout IIIa, but IIIa.3 representatives LSUCC0261, CP15, and
QL1weretheonlymembersthatcontainallthesubunits,including
the ATP binding subunit. This transporter was missing completely
in LD12 [19]. IIIa.3 members LSUCC0261 and CP15 were the only
members of IIIa that could transport taurine like subclades I/II. IIIa
was also missing mannitol synthesis/transport, sorbitol transport,
sarcosine synthesis, and TMAO synthesis though these systems are
found in some other I/II SAR11. These findings show IIIa contained
intermediate numbers of compatible solute genes in between
those of I/II and LD12 (Fig. 3). IIIa.3 contained the most compatible
solute genes within IIIa.
Vitamins/cofactors and other genomic features. Six IIIa.3
genomes (including the isolates IMCC9063 and LSUCC0261), one
I/II IIIa.1 IIIa.2 IIIa.3 LD12
taurine transport
glycine betaine/proline transport-
hydroxyectoine
Compatible Solutes
4(440)
292(440)
334(440)
4(9)
3(9)
2(9)
Subclade
thiL
tenA
Thiamin
297(440)
6(9) 1(8)
fieF
efeU
afuABC
Metals
365(440)
3(440)
1(3)
3(440)
4(8)
2(8)
3(9)
3(9)
5(9)
7(11)
8(11)
phaABC and phasin
Polyhydroxybutyrates
6(9) 8(11) 5(8)
glnB-
ureABC
8(11)
Nitrogen
36(440)
2(8) 7(9)
1(9)
10(11)
dmdA
metE
serABC
D−alanine racemase
D−alanine transaminase
methylamine oxidation
Amino Acids
22(440)
250(440)
97(440)
3(3) 8(8)
2(3) 8(8)
2(3) 5(8)
4(8)
6(9) 9(11)
9(11)
7(9) 10(11)
9(9) 10(11)
7(9)
bicarbonate transport permease
formate dehydrogenase
formate tetrahydrofolate ligase
C1 Metabolism
355(440)
120(440)
2(440)
4(9) 8(11)
1(9)
2(9)
7(11)
6(11)
42(440)
acyP
malate synthase
isocitrate lyase
multiple aceE copies
pyruvate kinase
phosphofructokinase
Central Carbon
Presence
none
< half
>half
all
76(440)
33(440)
286(440)
416(440)
6(11)
5(11)
1(11)
1(8)
1(8)
2(8) 5(9)
5(9)
3(3)
1(440)
5(8) 9(9)
7(9)
9(11)
2(11)
Pathway/Gene
Sulfur
374(440)
Fig. 3 Highlighted comparative gene content in SAR11. Colors
and text within the boxes indicate the proportion of genomes in a
subclade in which the gene/pathway is present in. Gene suites for
ABC transporters or multiple steps in a process are only noted if all
components are present while notable pathways missing one
component are noted in the text.
V.C. Lanclos et al.
5
The ISME Journal
30

IIIa.1 genome, and three SAGs outside of IIIa contained tenA that
shouldallowthecellstouseAmMPratherthanHMPasasourceof
thiamin precursor unlike other SAR11 [14], This distinction is
interesting because we also verified that the previously reported
loss of the thiL gene [14] to phosphorylate thiamin monopho-
sphate to the biologically available thiamin diphosphate (TPP) was
conserved throughout subclade IIIa. Thus, although IIIa may
exhibit some niche differentiation from Ia via import of a different
thiamin precursor, how IIIa produces TPP for use in the cell is
unresolved (Supplementary Text). Like other SAR11, IIIa had
proteorhodopsin–IIIa.1 was a mixture of green and blue (amino
acid L/Q at position 105, respectively), IIIa.2 has blue, IIIa.3 has
green (Fig. S3, Supplementary Text). These spectral tunings
correspond to the ecological distribution and source of the
genomes with genomes originating from estuarine systems with
mesohaline/polyhaline distributions having green. HIMB114, CP1,
and AG_894_A09 contained two copies of proteorhodopsin
belonging to two orthologous clusters (Supplementary Table S2)–
the implications of which are currently unclear and require further
study. Isolates LSUCC0723, LSUCC0664, and LSUCC0261 contained
no identifiable bacteriophage signatures according to Virsorter
(Supplementary Table S1).
Salinity and temperature growth ranges
We tested the salinity tolerances of two isolates within IIIa,
LSUCC0664 (IIIa.1) and LSUCC0261 (IIIa.3), to contextualize the
ecological data reported above and understand whether the
distribution in ecological data represents the physiological
capabilities of the organisms. LSUCC0664 (IIIa.1) grew at salinities
of 5.8–34.8 and LSUCC0261 (IIIa.3) grew at salinities of 1.5–34.8,
both with an optimum of 11.6. Though the two isolates have an
overlapping salinity growth range, LSUCC0261 (IIIa.3) grew faster
than LSUCC0664 (IIIa.1) at all salinities except for 23.3 and 34.8,
andnotablycouldgrowatlowersalinitiesthanLSUCC0664(Fig.4).
These data indicate the IIIa subgroups are euryhaline (capable of
inhabiting a wide range of salinities) in distinct contrast with the
sister clade LD12 [19]. We also tested isolate LSUCC0261 (IIIa.3) for
its temperature range/optimum. It could grow at temperatures of
12–35°C with its optimum of 30°C indicating a preference for
warmer waters (Supplementary Fig. S4). While rates of growth
between 30–35°C were similar, LSUCC0261 grew to a higher cell
density in 30°C (Supplementary Fig. S4).
Minimal C, N, S requirements
We grew LSUCC0261 (IIIa.3) in minimal artificial seawater media to
test the isolate’s ability to utilize individual carbon, nitrogen, and
sulfur sources with a variety of substrate combinations (Supple-
mentary Figs. S5 and S6, Supplementary Table S1). We tested
pyruvate, citrate, ribose, acetate, succinate, and α-ketoglutaric acid
as C sources, urea and ammonia as N sources, and cysteine, and
methionine as S sources. Oxaloacetic acid, taurine, dextrose,
sulfate, DMSO, and DMSP did not support growth. These results
are in line with what was predicted by genomics except for
oxaloaceticacidwhichshouldhavebeenusableasacarbonsource
due to the presence of maeB and its use in isolate HTCC1062 [10].
Alsoincontrasttoourstudy,HTCC1062wasabletousetaurinebut
not acetate as replacements for pyruvate [10] indicating multiple
physiological differences between the two isolates.
Electron microscopy
Scanning electron microscopy for LSUCC0261 and transmission
electron microscopy for LSUCC0664 showed that both cells were
curved rods like that of other SAR11 and able to stick inside of the
pores of a 0.1μm laser etched filter (Fig. 5A, B). We estimated the
cells at 100–300nm thick for LSUCC0261 and 150–240nm thick
for LSUCC0664 (Supplementary Fig. S7K), 0.2–1μm long for
LSUCC0261 and 0.4–1.5μm long for LSUCC0664 (Supplementary
Fig. S7L), with volumes between 0.01–0.05μm
3
for LSUCC0261
and 0.015–0.04μm
3
for LSUCC0664 (Supplementary Fig. S7M).
These values are in line with other estimates of SAR11 [81], thus
confirming conserved morphology over large evolutionary dis-
tances in the Pelagibacterales. These sizes are also notable since
SAR11 diameters could allow some cells to pass through
traditionally used 0.2µm filters, while their lengths could result
in their collection on filters of 0.8–1µm, which are sometimes
used to separate “particle-attached” taxa. Thus, SAR11 may
actually be undersampled in 0.2–1µm size fraction metagenomes.
DISCUSSION
Thisstudyisthefirsttosystematically focusonSAR11 subcladeIIIa
and constitutes the most current pangenomic study of high-
quality publicly available SAR11 genomes and their phylogenetic
relationships. We have contributed multiple new pure cultures,
their complete genomes, and 2 IIIa MAGs. Previous reports of IIIa
genomic content have primarily focused on exceptions to the
metabolism of other SAR11 subclades. With our expanded
genome selection, we determined whether these findings were
conserved features across IIIa or unique to individual isolates. Our
study establishes glycine and serine prototrophy, loss of DMSO,
DMSP, and much of C1 metabolism, presences of phaABC genes,
loss of thiL, and a mosaic distribution of the glyoxylate shunt as
conserved genomic traits within IIIa.
Wefurthermoreconfirmedseveralofthesegenomicpredictions
via growth physiology. The isolation of LSUCC0261, LSUCC0664,
and LSUCC0723 taxa tested serine and glycine prototrophy
because LSUCC0261 was isolated in JW2 medium that does not
contain glycine or serine, and LSUCC0664 and LSUCC0723 were
isolated in an another medium, MWH2, that did not contain
glycine or serine either but did have glycine betaine. HTCC1062
couldoxidizeglycinebetaineasareplacementglycinesource[10],
but LSUCC0664 and LSUCC0723 do not have the genes to convert
glycine betaine to glycine. Thus, the cultivation and propagation
of these isolates in our media confirms glycine and serine
prototrophy in IIIa. Furthermore, LSUCC0261 did not require
glycine or serine in minimal medium experiments (Supplementary
Fig. S4) and could not use the reduced sulfur compounds DMSP
and DMSO like other SAR11 [28].
This study is the first reported growth of a SAR11 isolate using
urea as a sole nitrogen source. Uptake of labeled urea by SAR11
has been observed in situ and the urease can be common in OMZ
SAR11 [71]. While we only observed the urease gene suite in one
IIIa genome (LSUCC0261), these SAR11 urease genes were found
throughout San Francisco Bay water column metagenomes
(Supplementary Figs. S8 and S9), suggesting that this metabolism
is important for estuarine SAR11. Future work will be needed to
determine whether LSUCC0261 uses urea as a source of nitrogen,
carbon, or both, explore the frequency of urease in coastal
populations, and identify the circumstances by which urease
offers a competitive advantage in SAR11.
664 (IIIa.1)
261 (IIIa.3)
0.00
0.02
0.04
0.06
0.08
Doubling rate (doubling/h)
0.4
1.5
5.8
11.6
23.2
.8
Salinity
0.01
0.00
0.01
0.02
0.03
0.04
0.05
0.06
Specific growth rate (1/h)
Fig. 4 Isolate salinity tolerance. Growth rates and doubling times
of LSUCC0664 (IIIa.1) in orange and LSUCC0261 (IIIa.3) in blue in
media of varying salinities.
V.C. Lanclos et al.
6
The ISME Journal
31

Far from being a monolithic subclade with universal features,
we propose that subclade IIIa represents a family within the order
Pelagibacterales and that the subgroups are equivalent to genera
defined by both 16S rRNA gene identity and AAI (Fig. 1)[59, 60].
The genera had unique spatio-temporal distributions (Fig. 2B),
which aligns with our understanding of the historical delineation
of different SAR11 ecotypes [3, 6, 30, 82]. Previous studies defined
three phylogenetic branches represented by HIMB114 as a coastal
branch (IIIa.1), IMCC9063 (IIIa.3) as a mesohaline branch, and an
uncultured oceanic branch between them [3, 22]. Our expanded
taxon selection and comparison to more than a thousand
metagenomes refines our understanding of subclade distribution.
While IIIa.3 wasthemost abundantofthe subgroups overall,these
organisms preferred slightly lower salinities than IIIa.1, and IIIa.2
was primarily a marine group. Such fine-scale salinity differentia-
tion was supported by physiological data. The IIIa.1 isolate
LSUCC0664 could not grow at the lowest salinities possible for
LSUCC0261 (IIIa.3) (Fig. 4). LSUCC0261 was also best adapted to
intermediate salinities, whereas LSUCC0664 grew much better by
comparison in higher salinities (Fig. 4).
There is important metabolic diversity between the subgroups
within IIIa, with IIIa.3 being the most distinct. Several metabolic
traitswereuniquetoIIIa.3 orsharedonlywiththefreshwaterLD12
clade. In addition to the ability to transport Fe
3+
via ABC transport
as other SAR11, IIIa can use a high affinity ferrous iron (Fe
2+
)
transporterandIIIa.3/LD12canpumpFe
2+
andzincfromcells[77].
IIIa.3 contained acyP that cleaves acyl-phosphate into a phosphate
and carboxylate which may serve as a parallel evolutionary tactic
to scavenge phosphate similarly to the methyl phosphonate
cleavage in Ia genomes like HTCC7211 [83] or could act simply as
an additional way to recycle acetate for the cell’s central carbon
metabolism. IIIa.3 has the potential for AmMP to fulfill thiamin
requirements instead of being reliant on HMP like most other
SAR11 [14] due to the presence of tenA. In a recent survey of
thiamin-related compound concentrations in the North Atlantic,
AmMP was found in similar but higher concentrations than HMP
at multiple marine stations [84]. This represents a crucial niche-
differentiating step for IIIa.3 from other SAR11, including the sister
groups IIIa.1 and IIIa.2 that are likely reliant on HMP [14]. Subclade
IIIa’sconserved deletionof thiL, whichconverts thiaminmonopho-
sphate (TP) to the biologically usable thiamin diphosphate (TPP),
remains inexplicable as it appears that these organisms still
require thiamin diphosphate. For example, eight genomes
spanning the three subgroups within IIIa have multiple gene
copies of the aceE E1 component of pyruvate dehydrogenase and
QL1 has five copies. This is notable because gene duplications in
SAR11 are limited [8], and also because aceE needs thiamin
diphosphosphate as a cofactor to combine thiamin diphosphate
and pyruvate to make acetyl-CoA [85]. It is thus likely that a
currently unannotated gene can complete this final conversion.
One possible candidate is an adenylate kinase found in all SAR11
that can convert thiamin diphosphate to thiamin triphosphate
[86]. Combined, these notable metabolic shifts in IIIa.3 probably
allow for the subclade to exploit environmental resources that
other SAR11 are unable to use and contribute to the ecological
success of the group relative to the other groups in IIIa.
Authentic estuarine-adapted taxa are believed to be rare
compared to marine and freshwater versions [87]. Prior research
from river outlets debated whether estuarine-adapted lineages
could truly exist or whether the community members in estuarine
zones are simply a mixture of freshwater and marine communities
because the short residence times of estuarine water make an
established community unlikely [88]. However, a genuine brackish
community in the Baltic Sea between salinities of 5–8 was distinct
from fresh and salty community members [89]. The physiology,
ecological distribution, gene content, and sister position of IIIa to
LD12 all support the concept of an estuarine origin of the last
commonancestorforIIIa/LD12.Subsequently,onesubgroupofIIIa
remained estuarine-adapted (IIIa.3), whereas the other subgroups
diversified into increasingly higher salinity niches over time (IIIa.1
and IIIa.2). Such marine-freshwater transitions in bacterial lineage
evolution are rare [90], although we are finding more examples as
more data becomes available [91]. Bacteria such as the
Methylophilaceae have recently been documented to have
freshwater origins for marine relatives [92] and some diatoms
such as the Thalassiosirales have extensive marine to freshwater
transitions followed by subsequent marine transitions [93]. While
IIIa appears to be a transitionary clade diversifying from estuarine
Fig. 5 Electron microscopy. A Scanning electron microscopy image
of a single LSUCC0261 cell. B Scanning electron microscopy image
of many LSUCC0261 cells and cellular debris. A-B indicates a 1µm
scale bar. C Transmission electron microscopy image of a single
LSUCC0664 cell likely mid-division with a scale bar of 200nm.
V.C. Lanclos et al.
7
The ISME Journal
32
waters back to marine systems, more genomes and further
research into physiology and biogeography are needed to
improve our understanding of the evolutionary origins and
trajectory of this group.
More generally, subclade IIIa represents an intermediate group
in the SAR11 evolutionary transition from marine to fresh water.
These organisms inhabit a wide range of salinities but are brackish
water specialists and share a most recent common ancestor with
the exclusively fresh and low-brackish water subclade LD12. The
last common ancestor of all SAR11 is believed to be a streamlined
marine organism [94], and we currently hypothesize that a key
evolutionary step that allowed the colonization of fresh water
occurred through the loss of osmolyte transport genes (for
glycine-betaine, proline, ectoine, and hydroxyectoine) in the LD12
branch [19]. The tradeoff for this gene loss was that LD12 was
prevented from reinhabiting salty waters [19]. We can use the
knowledge of subclade IIIa gained from this study to speculate on
the driver of this evolutionary transition further. The two isolates,
LSUCC0261 and LSUCC0664, have a euryhaline growth range.
While this is noteworthy by itself, it is perhaps more important
that LSUCC0261 could not grow in the lowest salinity media
tested, i.e., fresh water. What prevents this growth at the freshest
salinitiesremainsanimportantquestion.KeyfeaturesofSAR11are
small streamlined genomes that have a comparative dearth of
regulatory capability [9] and a high number of constitutively
expressed genes [95]. A likely scenario is that IIIa constitutive
expression of osmolyte transporter genes prevents these taxa
from inhabiting fresh water such that their loss let LD12 lineages
complete the transition from low brackish to truly freshwater taxa.
We are currently investigating this hypothesis with isolates from
IIIa and LD12. While the evolutionary trajectory for LD12 may pass
through the common ancestor of IIIa and LD12 as outlined above,
there is accumulating evidence that the ostensibly exclusively
marine SAR11 groups may also colonize freshwater environments
either sporadically, at very low abundances, or both [91, 96].
Overall, this study represents the most complete analysis of
SAR11 IIIa thus far and is a necessary steppingstone in the
understanding of SAR11 IIIa, its role in estuarine systems, and its
intermediate place in the evolution of SAR11 from marine to
freshwater environments. Future work on IIIa is needed to
contextualize functions of noted gene losses and gains, the mode
in which IIIa interacts with thiamin derivatives, and the extent at
which IIIa members interact with nutrient dynamics in estuaries
including urea and production of polyhydroxyalkanoates.
DATA AVAILABILITY
New genomes added from this study are available on FigShare at (https://doi.org/
10.6084/m9.figshare.21350343). Assembled isolate genomes for LSUCC0261,
LSUCC0664, and LSUCC0723 are available on IMG under Genome IDs 2728369215,
2770939455, and 2739368061, respectively. Raw isolate genome reads are available
on NCBI under accession PRJNA864866. Metagenome assembled genomes from the
SanFrancisco Bayareavailable onNCBI underBioSampleaccessions SAMN30106608-
SAMN30106615. The accessory datasheets from this publication including the
pangenome summary are hosted through FigShare (https://figshare.com/projects/
Ecophysiology_and_genomics_of_the_brackish_water_adapted_SAR11_subcla-
de_IIIa/144939). Cryostocks of isolates used in this analysis are available upon
request.
REFERENCES
1. Schattenhofer M, Fuchs BM, Amann R, Zubkov MV, Tarran GA, Pernthaler J.
Latitudinal distribution of prokaryotic picoplankton populations in the Atlantic
Ocean. Environ Microbiol. 2009;11:2078–93.
2. Morris RM, Frazar CD, Carlson CA. Basin-scale patterns in the abundance of
SAR11 subclades, marine Actinobacteria (OM1), members of the Roseobacter
clade and OCS116 in the South Atlantic. Environ Microbiol. 2012;14:1133–44.
3. Vergin KL, Beszteri B, Monier A, Thrash JC, Temperton B, Treusch AH, et al. High-
resolution SAR11 ecotype dynamics at the Bermuda Atlantic Time-series study
site by phylogenetic placement of pyrosequences. ISME J. 2013;7:1322–32.
4. Stingl U, Tripp HJ, Giovannoni SJ. Improvements of high-throughput culturing
yielded novel SAR11 strains and other abundant marine bacteria from the
Oregon coast and the Bermuda Atlantic Time Series study site. ISME J.
2007;1:361–71.
5. Rappé MS, Connon SA, Vergin KL, Giovannoni SJ. Cultivation of the ubiquitous
SAR11 marine bacterioplankton clade. Nature. 2002;418:630–3.
6. Giovannoni SJ. SAR11 bacteria: the most abundant plankton in the oceans. Ann
Rev Mar Sci. 2017;9:231–55.
7. Giovannoni SJ, Tripp HJ, Givan S, Podar M, Vergin KL, Baptista D, et al. Genome
streamlining in a cosmopolitan oceanic bacterium. Science. 2005;309:1242–5.
8. Grote J, Thrash JC, Huggett MJ. Streamlining and Core Genome Conservation
among highly divergent members of the SAR11 clade. mBio. 2012;3:1–13.
9. Giovannoni SJ, Cameron Thrash J, Temperton B. Implications of streamlining
theory for microbial ecology. ISME J. 2014;8:1553–65.
10. Carini P, Steindler L, Beszteri S, Giovannoni SJ. Nutrient requirements for growth
of the extreme oligotroph ‘Candidatus Pelagibacter ubique’ HTCC1062 on a
defined medium. ISME J. 2013;7:592–602.
11. Smith DP, Kitner JB, Norbeck AD, Clauss TR, Lipton MS, Michael S, et al. Tran-
scriptional and translational regulatory responses to iron limitation in the globally
distributed marine bacterium Candidatus Pelagibacter ubique. PLoS One.
2010;5:e10487.
12. Smith DP, Thrash JC, Nicora CD, Lipton MS, Burnum-Johnson KE, Carini P, et al.
Proteomic and transcriptomic analysis of “Candidatus Pelagibacter ubique”
describe the first P II-independent response to nitrogen limitation in a free-living
Alphaproteobacterium. MBio. 2013;4:1–11.
13. Tripp HJ, Schwalbach MS, Meyer MM, Kitner JB, Breaker RR, Giovannoni SJ.
Unique glycine-activated riboswitch linked to glycine-serine auxotrophy in
SAR11. Environ Microbiol. 2009;11:230–8.
14. Carini P, Campbell EO, Morré J, Sañudo-Wilhelmy SA, Cameron Thrash J, Bennett
SE, et al. Discovery of a SAR11 growth requirement for thiamin’s pyrimidine
precursor and its distribution in the Sargasso Sea. ISME J. 2014;8:1727–38.
15. Sun J, Steindler L, Thrash JC, Halsey KH, Smith DP, Carter AE, et al. One carbon
metabolism in SAR11 pelagic marine bacteria. PLoS One. 2011;6:e23973.
16. Delmont TO, Kiefl E, Kilinc O, Esen OC, Uysal I, Rappé MS, et al. Single-amino acid
variants reveal evolutionary processes that shape the biogeography of a global
SAR11 subclade. eLIFE. 2019;8:e46497.
17. Thrash JC, Temperton B, Swan BK, Landry ZC, Woyke T, DeLong EF, et al. Single-
cell enabled comparative genomics of a deep ocean SAR11 bathytype. ISME J.
2014;8:1440–51.
18. Tsementzi D, Wu J, Deutsch S, Nath S, Rodriguez-R LM, Burns AS, et al. SAR11
bacteria linked to ocean anoxia and nitrogen loss. Nature. 2016;536:179–83.
19. Henson MW, Lanclos VC, Faircloth BC, Thrash JC. Cultivation and genomics of the
first freshwater SAR11 (LD12) isolate. ISME J. 2018;12:1846–60.
20. Tsementzi D, Rodriguez-R LM, Ruiz-Perez CA, Meziti A, Hatt JK, Konstantinidis KT.
Ecogenomic characterization of widespread, closely-related SAR11 clades of the
freshwater genus “Candidatus Fonsibacter” and proposal of Ca. Fonsibacter lacus
sp. nov. Syst Appl Microbiol. 2019;42:495–505.
21. Oh HM, Kang I, Lee K, Jang Y, Lim SI, Cho JC. Complete genome sequence of
strain IMCC9063, belonging to SAR11 subgroup 3, isolated from the Arctic Ocean.
J Bacteriol. 2011;193:3379–80.
22. Herlemann DPR, Woelk J, Labrenz M, Jürgens K. Diversity and abundance of
“Pelagibacterales” (SAR11) in the Baltic Sea salinity gradient. Syst Appl Microbiol.
2014;37:601–4.
23. Henson MW, Lanclos VC, Pitre DM, Weckhorst JL, Lucchesi AM, Cheng C, et al.
Expanding the diversity of bacterioplankton isolates and modeling isolation
efficacy with large-scale dilution-to-extinction cultivation. Appl Environ Microbiol.
2020;86:e00943–20.
24. Rasmussen AN, Damashek J, Eloe-Fadrosh EA, Francis CA. In-depth spatio-
temporal characterization of planktonic archaeal and bacterial communities in
North and South San Francisco Bay. Microb Ecol. 2020. https://doi.org/10.1007/
s00248-020-01621-7.
25. Brown MV, Fuhrman JA. Marine bacterial microdiversity as revealed by internal
transcribed spacer analysis. Aquat Microb Ecol. 2005;41:15–23.
26. Schwalbach MS, Tripp HJ, Steindler L, Smith DP, Giovannoni SJ. The presence of
the glycolysis operon in SAR11 genomes is positively correlated with ocean
productivity. Environ Microbiol. 2010;12:490–500.
27. Malmstrom RR, Kiene RP, Cottrell MT, Kirchman DL. Contribution of SAR11 bac-
teria to dissolved dimethylsulfoniopropionate and amino acid uptake in the
North Atlantic ocean. Appl Environ Microbiol. 2004;70:4129–35.
28. Tripp HJ, KitnerJB,Schwalbach MS, DaceyJWH, Wilhelm LJ,Giovannoni SJ.SAR11
marine bacteria require exogenous reduced sulphur for growth. Nature.
2008;452:741–4.
29. Smith DP, Nicora CD, Carini P, Lipton MS, Norbeck AD, Smith RD, et al. Proteome
remodeling in response to sulfur limitation in “Candidatus Pelagibacter ubique.”.
mSystems. 2016;1:e00068–16.
V.C. Lanclos et al.
8
The ISME Journal
33

30. Haro-Moreno JM, Rodriguez-Valera F, Rosselli R, Martinez-Hernandez F, Roda-
Garcia JJ, Gomez ML, et al. Ecogenomics of the SAR11 clade. Environ Microbiol.
2019;22:1748–63.
31. Henson MW, Pitre DM, Weckhorst JL, Lanclos VC, Webber AT, Thrash JC. Artificial
seawater media facilitate cultivating members of the microbial majority from the
Gulf of Mexico. mSphere. 2016;1:1–10.
32. Bankevich A, Nurk S, Antipov D, Gurevich AA, Dvorkin M, Kulikov AS, et al.
SPAdes: a new genome assembly algorithm and its applications to single-cell
sequencing. J Comput Biol. 2012;19:455–77.
33. Walker BJ, Abeel T, Shea T, Priest M, Abouelliel A, Sakthikumar S, et al. Pilon: an
integrated tool for comprehensive microbial variant detection and genome
assembly improvement. PLoS One. 2014;9:e112963.
34. ParksDH,ImelfortM,SkennertonCT,HugenholtzP,TysonGW.CheckM:assessing
the quality of microbial genomes recovered from isolates, single cells, and
metagenomes. Genome Res. 2015;25:1043–55.
35. Rasmussen AN, Francis CA. Genome-resolved metagenomic insights into massive
seasonal ammonia-oxidizing archaea blooms in San Francisco Bay. mSystems.
2022;7:e0127021.
36. Chaumeil P-A, Mussig AJ, Hugenholtz P, Parks DH. GTDB-Tk: a toolkit to classify
genomes with the Genome Taxonomy Database. Bioinformatics. 2019;36:1925–7.
37. Edgar RC. MUSCLE: Multiple sequence alignment with high accuracy and high
throughput. Nucleic Acids Res. 2004;32:1792–7.
38. Capella-Gutierrez S, Silla-Martinez JM, Gabaldon T. trimAl: a tool for automated
alignment trimming in large-scale phylogenetic analyses. Bioinformatics.
2009;25:1972–3.
39. Nguyen L-T, Schmidt HA, von Haeseler A, Minh BQ. IQ-TREE: a fast and effective
stochastic algorithm for estimating maximum-likelihood phylogenies. Mol Biol
Evol. 2015;32:268–74.
40. Jain C, Rodriguez-R LM, Phillippy AM, Konstantinidis KT, Aluru S. High throughput
ANI analysis of 90K prokaryotic genomes reveals clear species boundaries. Nat
Commun. 2018;9:5114.
41. Eren AM, Esen ÖC, Quince C, Vineis JH, Morrison HG, Sogin ML, et al. Anvi’o: an
advanced analysis and visualization platform for’omics data. PeerJ. 2015;3:e1319.
42. Eren AM, Kiefl E, Shaiber A, Veseli I, Miller SE, Schechter MS, et al. Community-led,
integrated, reproducible multi-omics with anvi’o. Nat Microbiol. 2021;6:3–6.
43. Savoie ER, Lanclos VC, Henson MW, Cheng C, Getz EW, Barnes SJ, et al. Eco-
physiology of the Cosmopolitan OM252 Bacterioplankton (Gammaproteo-
bacteria). mSystems. 2021;6:e0027621.
44. Jones P, Binns D, Chang H-Y, Fraser M, Li W, McAnulla C, et al. InterProScan 5:
genome-scale protein function classification. Bioinformatics. 2014;30:1236–40.
45. Roux S, Enault F, Hurwitz BL, Sullivan MB. VirSorter: mining viral signal from
microbial genomic data. PeerJ. 2015;3:e985.
46. Alneberg J, Bennke C, Beier S, Bunse C, Quince C, Ininbergs K, et al. Ecosystem-
wide metagenomic binning enables prediction of ecological niches from gen-
omes. Commun Biol. 2020;3:119.
47. Alneberg J, Sundh J, Bennke C, Beier S, Lundin D, Hugerth LW, et al. BARM and
BalticMicrobeDB, a reference metagenome and interface to meta-omic data for
the Baltic Sea. Sci Data. 2018;5:180146.
48. Ahmed MA, Lim SJ, Campbell BJ. Metagenomes, metatranscriptomes, and
metagenome-assembled genomes from Chesapeake and Delaware Bay (USA)
water samples. Microbiol Resour Announc. 2021;10:e0026221.
49. Sakowski EG, Arora-Williams K, Tian F, Zayed AA, Zablocki O, Sullivan MB, et al.
Interaction dynamics and virus-host range for estuarine actinophages captured
by epicPCR. Nat Microbiol. 2021;6:630–42.
50. Fortunato CS, Crump BC. Microbial gene abundance and expression patterns
across a river to ocean salinity gradient. PLoS One. 2015;10:e0140578.
51. Di Cesare A, Dzhembekova N, Cabello-Yeves PJ, Eckert EM, Slabakova V, Slaba-
kova N, et al. Genomic comparison and spatial distribution of different Syne-
chococcus phylotypes in the Black Sea. Front Microbiol. 2020;11:1979.
52. Thrash JC, Seitz KW, Baker BJ, Temperton B, Gillies LE, Rabalais NN, et al. Meta-
bolic roles of uncultivated bacterioplankton lineages in the northern Gulf of
Mexico “Dead Zone.” MBio. 2017;8:e01017-17.
53. Xu B, Li F, Cai L, Zhang R, Fan L, Zhang C. A holistic genome dataset of bacteria,
archaea and viruses of the Pearl River estuary. Sci Data. 2022;9:49.
54. Biller SJ, Berube PM, Dooley K, Williams M, Satinsky BM, Hackl T, et al. Marine
microbialmetagenomessampled across spaceandtime. SciData. 2018;5:180176.
55. Sunagawa S, Coelho LP, Chaffron S, Kultima JR, Labadie K, Salazar G, et al.
Structure and function of the global ocean microbiome. Science.
2015;348:1261359.
56. Mende DR, Bryant JA, Aylward FO, Eppley JM, Nielsen T, Karl DM, et al. Envir-
onmental drivers of a microbial genomic transition zone in the ocean’s interior.
Nat Microbiol. 2017;2:1367–73.
57. Conner Y. Kojima, Eric W. Getz, and J. Cameron Thrash. RRAP: RPKM recruitment
analysis pipeline. Microbiol Resour Announc. 2022; 11.
58. Cheng C, Thrash JC. sparse-growth-curve: A Computational Pipeline For Parsing
Cellular Growth Curves With Low Temporal Resolution. Microbiol Resour
Announc. 2021;10:e00296-21.
59. Konstantinidis KT, Tiedje JM. Towards a genome-based taxonomy for prokar-
yotes. J Bacteriol. 2005;187:6258–64.
60. Yarza P, Yilmaz P, Pruesse E, Glöckner FO, Ludwig W, Schleifer K-H, et al. Uniting
theclassificationofculturedandunculturedbacteriaandarchaeausing16SrRNA
gene sequences. Nat Rev Microbiol. 2014;12:635–45.
61. Battaglia B. Final resolution of the symposium on the classification of brackish
waters. Archo Oceanogr Limnol. 1959;11:243–8.
62. Thrash JC, Boyd A, Huggett MJ, Grote J, Carini P, Yoder RJ, et al. Phylogenomic
evidence for a common ancestor of mitochondria and the SAR11 clade. Sci Rep.
2011;1:13.
63. Ferla MP, Thrash JC, Giovannoni SJ, Patrick WM. New rRNA gene-based phylo-
genies of the Alphaproteobacteria provide perspective on major groups, mito-
chondrial ancestry and phylogenetic instability. PLoS One. 2013;8:e83383.
64. Viklund J, Martijn J, Ettema TJG, Andersson SGE. Comparative and phylogenomic
evidence that the alphaproteobacterium HIMB59 is not a member of the oceanic
SAR11 clade. PLoS One. 2013;8:e78858.
65. Martijn J, Vosseberg J, Guy L, Offre P, Ettema TJG. Deep mitochondrial origin
outside the sampled alphaproteobacteria. Nature. 2018;557:101–5.
66. Muñoz-Gómez SA, Susko E, Williamson K, Eme L, Slamovits CH, Moreira D, et al.
Site-and-branch-heterogeneous analyses of an expanded dataset favour
mitochondria as sister to known Alphaproteobacteria. Nat Ecol Evol.
2022;6:253–62.
67. Kaczmarski JA, Hong N-S, Mukherjee B, Wey LT, Rourke L, Förster B, et al.
Structural basis for the allosteric regulation of the SbtA bicarbonate transporter
by the PII-like protein, SbtB, from cyanobium sp. PCC7001. Biochemistry.
2019;58:5030–9.
68. Alonso-Sáez L, Galand PE, Casamayor EO, Pedrós-Alió C, Bertilsson S. High
bicarbonate assimilation in the dark by Arctic bacteria. ISME J. 2010;4:1581–90.
69. Sun J, Todd JD, Thrash JC, Qian Y, Qian MC, Temperton B, et al. The abundant
marine bacterium Pelagibacter simultaneously catabolizes dimethylsulfoniopro-
pionate to the gases dimethyl sulfide and methanethiol. Nat Microbiol.
2016;1:16065.
70. Veaudor T, Cassier-Chauvat C, Chauvat F. Genomics of urea transport and cata-
bolism in cyanobacteria: biotechnological implications. Front Microbiol.
2019;10:2052.
71. Widner B, Fuchsman CA, Chang BX, Rocap G, Mulholland MR. Utilization of urea
and cyanate in waters overlying and within the eastern tropical north Pacific
oxygen deficient zone. FEMS Microbiol Ecol. 2018;94:1–15.
72. Sudesh K, Abe H, Doi Y. Synthesis, structure and properties of polyhydroxyalk-
anoates: biological polyesters. Prog Polym Sci. 2000;25:1503–55.
73. Obruca S, Sedlacek P, Koller M, Kucera D, Pernicova I. Involvement of poly-
hydroxyalkanoates in stress resistance of microbial cells: Biotechnological con-
sequences and applications. Biotechnol Adv. 2018;36:856–70.
74. Oh S, Zhang R, Wu QL, Liu WT. Evolution and adaptation of SAR11 and Cyano-
bium in a saline Tibetan lake. Environ Microbiol Rep. 2016;8:595–604.
75. Campbell BJ, Lim SJ, Kirchman DL. Controls of SAR11 subclade abundance,
diversity, and growth in two Mid-Atlantic estuaries. bioRxiv. 2022, https://
www.biorxiv.org/content/10.1101/2022.05.04.490708v2.
76. Zubkov MV, Martin AP, Hartmann M, Grob C, Scanlan DJ. Dominant oceanic
bacteria secure phosphate using a large extracellular buffer. Nat Commun.
2015;6:1–8.
77. Huang K, Wang D, Frederiksen RF, Rensing C, Olsen JE, Fresno AH. Investigation
of the role of genes encoding zinc exporters zntA, zitB, and fieF during salmo-
nella typhimurium infection. Front Microbiol. 2017;8:1–11.
78. Hopwood MJ, Statham PJ, Skrabal SA, Willey JD. Dissolved iron(II) ligands in river
and estuarine water. Mar Chem. 2015;173:173–82.
79. Czech L, Hermann L, Stöveken N, Richter A, Höppner A, Smits S, et al. Role of the
extremolytes ectoine and hydroxyectoine as stress protectants and nutrients:
genetics, phylogenomics, biochemistry, and structural analysis. Genes.
2018;9:177.
80. Tao P, Li H, Yu Y, Gu J, Liu Y. Ectoine and 5-hydroxyectoine accumulation in the
halophile Virgibacillus halodenitrificans PDB-F2 in response to salt stress. Appl
Microbiol Biotechnol. 2016;100:6779–89.
81. Zhao X, Schwartz CL, Pierson J, Giovannoni SJ, McIntosh JR, Nicastro D. Three-
dimensional structure of the ultraoligotrophic marine bacterium “Candidatus
Pelagibacter ubique.” Appl Environ Microbiol. 2017;83.
82. Giovannoni S, Stingl U. The importance of culturing bacterioplankton in the
“omics” age. Nat Rev Microbiol. 2007;5:820–6.
83. Carini P, White AE, Campbell EO, Giovannoni SJ. Methane production by
phosphate-starved SAR11 chemoheterotrophic marine bacteria. Nat Commun.
2014;5:1–7.
V.C. Lanclos et al.
9
The ISME Journal
34

84. Suffridge CP, Bolaños LM, Bergauer K, Worden AZ, Morré J, Behrenfeld MJ, et al.
Exploring vitamin B1 cycling and its connections to the microbial community in
the north atlantic ocean. Front Marine Sci. 2020;7:1–16.
85. Patel MS, Nemeria NS, Furey W, Jordan F. The pyruvate dehydrogenase com-
plexes: structure-based function and regulation. J Biol Chem. 2014;289:
16615–23.
86. Shikata H, Koyama S, Egi Y, Yamada K, Kawasaki T. Cytosolic adenylate kinase
catalyzes the synthesis of thiamin triphosphate from thiamin diphosphate. Bio-
chem Int. 1989;18:933–41.
87. DayJWJr,MichaelKempW,Yáñez-ArancibiaA,CrumpBC.Estuarineecology.2nd
ed. Hoboken NJ: John Wiley & Sons; 2012.
88. Crump BC, Hopkinson CS, Sogin ML, Hobbie JE. Microbial biogeography along an
estuarine salinity gradient: combined influences of bacterial growth and resi-
dence time. Appl Environ Microbiol. 2004;70:1494–505.
89. Herlemann DP, Labrenz M, Jürgens K, Bertilsson S, Waniek JJ, Andersson AF.
Transitions in bacterial communities along the 2000 km salinity gradient of the
Baltic Sea. ISME J. 2011;5:1571–9.
90. Logares R, Bråte J, Bertilsson S, Clasen JL, Shalchian-Tabrizi K, Rengefors K.
Infrequent marine-freshwatertransitions inthemicrobial world. Trends Microbiol.
2009;17:414–22.
91. Paver SF, Muratore D, Newton RJ, Coleman ML. Reevaluating the salty divide:
phylogenetic specificity of transitions between marine and freshwater systems.
mSystems. 2018;3:1–15.
92. Ramachandran A, McLatchie S, Walsh DA. A novel freshwater to marine evolu-
tionary transition revealed within Methylophilaceae bacteria from the Arctic
Ocean. MBio. 2021;12:e0130621.
93. Alverson AJ, Jansen RK, Theriot EC. Bridging the Rubicon: phylogenetic analysis
reveals repeated colonizations of marine and fresh waters by thalassiosiroid
diatoms. Mol Phylogenet Evol. 2007;45:193–210.
94. Luo H. Evolutionary origin of a streamlined marine bacterioplankton lineage.
ISME J. 2015;9:1423–33.
95. Cottrell MT, Kirchman DL. Transcriptional control in marine copiotrophic and
oligotrophic bacteria with streamlined genomes. Appl Environ Microbiol.
2016;82:6010–8.
96. Cabello-Yeves PJ, Picazo A, Camacho A, Callieri C, Rosselli R, Roda-Garcia JJ, et al.
Ecological and genomic features of two widespread freshwater picocyano-
bacteria. Environ Microbiol. 2018;20:3757–71.
97. Konstantinidis KT, Tiedje JM. Prokaryotic taxonomy and phylogeny in the
genomic era: advancements and challenges ahead. Curr Opin Microbiol.
2007;10:504–9.
ACKNOWLEDGEMENTS
We would like to thank the Louisiana State University Shared Instrumentation Facility
(SIF) and the University of Southern California Center for Electron Microscopy and
Microanalysis (CEMMA) for training and availability of electron microscopes to image
our isolates. We would also like to thank Dr. Casey Barr for his training on the
scanning electron microscope and Dr. Ying for her operation of the transmission
electron microscope. The authors acknowledge the Center for Advanced Research
Computing (CARC) at the University of Southern California (https://carc.usc.edu), as
well as high-performance computing resources provided by Louisiana State
University (http://www.hpc.lsu.edu), and the Stanford Research Computing Center
for providing computing resources that have contributed to the research results
reported within this publication. This work was supported by a Simons Early Career
Investigator in Marine Microbial Ecology and Evolution Award and NSF Biological
Oceanography Program grants (OCE-1747681 and OCE-1945279) to JCT.
AUTHOR CONTRIBUTIONS
VCL conducted data analysis, experimentation, generated the figures, and wrote the
paper. ANR, CYK, and CC conducted data analysis and contributed to figures. MWH,
BCF, and CAF contributed strains, data, and/or reagents. JCT devised the study,
obtained funding, conducted data analysis, and assisted with manuscript prepara-
tion. All authors contributed edits to the final manuscript.
FUNDING
Open access funding provided by SCELC, Statewide California Electronic Library
Consortium.
COMPETING INTERESTS
The authors declare no competing interests.
ADDITIONAL INFORMATION
Supplementary information The online version contains supplementary material
available at https://doi.org/10.1038/s41396-023-01376-2.
Correspondence and requests for materials should be addressed to J. Cameron
Thrash.
Reprints and permission information is available at http://www.nature.com/
reprints
Publisher’snote Springer Nature remains neutral with regard to jurisdictional claims
in published maps and institutional affiliations.
Open Access This article is licensed under a Creative Commons
Attribution 4.0 International License, which permits use, sharing,
adaptation,distributionandreproductioninanymediumorformat,aslongasyougive
appropriatecredittotheoriginalauthor(s)andthesource,providealinktotheCreative
Commonslicense,andindicateifchangesweremade.Theimagesorotherthirdparty
material in this article are included in the article’s Creative Commons license, unless
indicated otherwise in a credit line to the material. If material is not included in the
article’sCreativeCommonslicenseandyourintendeduseisnotpermittedbystatutory
regulation or exceeds the permitted use, you will need to obtain permission directly
from the copyright holder. To view a copy of this license, visit http://
creativecommons.org/licenses/by/4.0/.
© The Author(s) 2023
V.C. Lanclos et al.
10
The ISME Journal
35
CHAPTER 2: Isolation and Ecophysiology of the Roseobacter CHAB-I-
5 Lineage

36
Introduction

The Roseobacter clade is one of the most ecologically successful groups of bacteria
found across marine habitats and are often associated with phytoplankton blooms (1, 2).
Members of this clade exist as free-living, attached, and in symbiont forms (1) and can make up
to 20% of bacteria in coastal regimes (3). Though the Roseobacter clade overall is monophyletic,
the most abundant Roseobacters in the open ocean, the Pelagic Roseobacter Clade (PRC), is
paraphyletic when phylogeny is inferred from maximum likelihood methods and monophyletic
when inferred with genome content analysis (4, 5). This is due to multiple Roseobacter lineages
that have adapted gene content that skew towards a lifestyle that is helpful to live in the nutrient-
poor conditions of the pelagic waters such as aerobic anoxygenic photosynthesis (AAnP), C1
oxidation, anaplerotic CO2 usage, and DMSP degradation that distinguish them from other
species of Roseobacter (4, 6, 7). While many Roseobacter lineages have easily cultivated
representatives, the PRC contains multiple clusters without isolated lineages. One of the PRC
clusters that remains largely uncultivated is CHAB-I-5.
The CHAB-I-5 cluster comprises free-living marine bacteria distributed from tropical to
polar latitudes (5, 8) and is one of the most abundant types of Roseobacter in global oceans. It is
found in highest abundances near coastal North America and Europe (8) and constituted up to
20% of clones from early metagenomic work in the Sargasso Sea (1, 9). In a study of
Chesapeake Bay, CHAB-I-5 was the only Roseobacter that did not decrease in abundance along
a salinity gradient and was present in samples across salinities of 30.5-13.9 (10). While other
members of the Roseobacter clade have been found to correlate with phytoplankton blooms, this
pattern does not seem to hold for CHAB-I-5 (5). Numerous studies indicating the abundance and
ecology of CHAB-I-5 in global ocean waters also indicate a high activity level of the cluster (1,
37
5, 8, 10, 11). Furthermore, a recent study surveyed and isolated viruses that infect CHAB-I-5 and
found its phage to be abundant in global waters, particularly in the polar and estuarine systems
(12). This abundance, activity, and widespread phage distribution suggests this group is essential
to the overall global nutrient cycling, though the mechanisms of these dynamics are still greatly
elusive. Current predictions of CHAB-I-5 metabolism comes from only a handful of genomes
that have been analyzed. From genomic predictions, CHAB-I-5 appears to be motile with
metabolic pathways for aerobic anoxygenic photosynthesis, carbon monoxide oxidation,
inorganic sulfur oxidation, DMSP degradation, phosphonate metabolism, and evidence for
thiamin and biotin auxotrophy like other dominant microorganisms in oligotrophic waters,
particularly the PRC (5, 7). Due to missing genes from the analyzed genomes, it is unclear
whether CHAB-I-5 is able to use nitrate, nitrite, or reduce oxidized sulfur (5). To better resolve
the potential role of CHAB-I-5 in its environment, expanded analysis of genomics and
physiology is required. Representatives from the CHAB-I-5 cluster have been cultured multiple
times (5, 12, 13), but no isolate has been maintained in culture long enough for physiological
analysis except for the recent isolate FZCC0083 which remains uncharacterized except for use in
phage isolations (12).
Thus, although previous work has inferred CHAB-I-5’s metabolic potential, the small
number of genomes in published analyses limits our understanding of any intra-clade diversity of
this group. Furthermore, a lack of cultured representatives has prevented researchers from
acquiring much needed physiological data to contextualize their contributions to global
biogeochemical cycling. Here we present US3C007- an isolated member of the Roseobacter
CHAB-I-5 cluster that is readily propagated on artificial seawater medium and reliably revived
from frozen stocks. We present the first physiological characterization of a member of the
38
CHAB-I-5 lineage, and the largest genomic analysis of the CHAB-I-5 cluster to date using new,
complete genomes from both US3C007 and FZCC0083. We show the first morphology of a
CHAB-I-5 member and examine its growth dynamics across ranges of salinity, temperature, and
carbon concentrations. Additionally, we analyze ecological distribution of CHAB-I-5 from an
expanded set of global metagenomic samples that span a wide range of marine and estuarine
locations. Together, these data constitute the most in-depth investigation of the clade and provide
new insight on the contributions of these organisms to marine biogeochemistry.
Methods

US3C007 isolation
We obtained surface water (2m) from the San Pedro Ocean Time series (SPOTs) monthly cruise
on 09/16/2020 via CTD cast. The seawater was transported into the lab and filtered through a
2.7µm GF/D filter, stained with 1x Sybr green (Lonza) for 30 minutes in the dark, and cell
density was enumerated on a Guava Easy Cyte 5HT flow cytometer (Millipore, Massachusetts,
USA) with settings as described previously (14). We diluted cells to a final concentration of 1
cell/µL in 10mL of sterilized AMS1 artificial seawater medium (15) and inoculated 3 µL of the
diluted cell solution into each well of a 96 x 2.1mL well PTFE plate (Radleys, Essex, UK)
containing 1.5mL of AMS1 for a final theoretical concentration of 3 cells/well. Plates incubated
in the dark without shaking for 2.5 weeks and enumerated as described above. Positive wells
(>10
4
cells/mL) were transferred to Nalgene Oak Ridge PTFE centrifuge tubes (Thermo Fisher,
Massachusetts, USA) containing MWH1 medium (16) in an attempt to move the cultures to a
more frequently used medium for convenience. Subsequent transfers of isolates in MWH1 were
not successful, so we transferred the isolates from the Oak Ridge tubes containing MWH1 to
acid-washed 125 ml polycarbonate flasks containing the original isolation medium, AMS1. The
39
culture has been maintained in this manner over continual transfers. Cultures were cryopreserved
in both 10% DMSO and 10% glycerol diluted with AMS1. We grew US3C007 to late-log phase
and filtered the cells onto a 0.2µm polycarbonate filter (Millipore) and extracted its DNA using a
GenElute Bacterial Genomic DNA Kit (Sigma-Aldrich Co, Darmstadt, Germany). We amplified
and purified the DNA as previously reported (17) and sent samples for Sanger sequencing at
Genewiz (Azenta Life Sciences, New Jersey, USA). We inspected the resulting chromatograms
to verify purity through a lack of multiple peaks for a given base call, assembled a contiguous
sequence from the forward and reverse complement sequences using CAP3
(https://doua.prabi.fr/software/cap3), and used the web-based NCBI BLASTn with the nr/nt
database for sequence identification.

16S rRNA gene phylogeny to determine placement within CHAB-I-5
We created 16S rRNA gene phylogeny to verify placement of US3C007 within the CHAB-I-5
cluster using the alphaproteobacterial tree and methods from previous work (16, 17) with the
addition of known CHAB-I-5 relatives including SB2 (5), three CHAB-I-5 SAGs (8), the
original CHAB-I-5 clone (18), and US3C007. We aligned sequences with muscle v3.8.1551
(19), trimmed with trimal v1.4.1 (20), and inferred the phylogeny with iqtree2 v2.0.6 with flag -
B 1000 (21). The phylogeny was visualized with Figtree v1.4.4 and all nodes were collapsed
except for the branches containing CHAB-I-5 and PRC member HIMB11 to highlight
US3C007’s inclusion within the CHAB-I-5.

Genome sequencing and assembly
40
We revived US3C007 from cryostocks and grew the culture in multiple batches of 1L cultures to
gather DNA for genome sequencing. For all cultures, we filtered the cells onto 0.1µm
polycarbonate filters (Millipore) and extracted DNA with a phenol chloroform approach
(https://www.protocols.io/view/modified-phenol-chloroform-genomic-dna-extraction-
e6nvwkjzwvmk/v2). DNA was pooled together and sent for Illuminia Hi-Seq paired end
(2x151bp) sequencing at the Microbial Genome Sequencing Center (MiGS) (Pittsburgh,
Pennsylvania, USA) and sequenced in-house with Oxford Nanopore MinION with a R9v9.4.1
(FLOMIN106) flow cell (Oxford, UK). For MinION sequencing, DNA was sheared with a size
selection of 20,000bp or greater using Covaris g-tubes (D-Mark Biosystems, Woburn, USA).
Reads were base called with Guppy v4.4.1 (22). We assembled the long-read sequence data
using Flye v2.9.1 (23) with 4 rounds of polishing the assembly with minimap (24). We then used
short-reads from Illumina to further improve the assembly with Polypolish v0.5.0 (25). The
resulting assembly was visualized for completion with Bandage (26) and statistics evaluated with
CheckM v1.0.5 (27).

Taxon selection and phylogenomics
To expand the taxon selection for the CHAB-I-5 clade, we added the unpublished genome from a
recently published isolate, FZCC0083 (12), and combed public datasets for additional CHAB-I-5
related genomes. We downloaded Roseobacter genomes from the NCBI and IMG databases
(October, 2022), as well as large-scale metagenomic analyses including TARA Ocean (28, 29),
BioGoShip (30), and OceanDNA (31). Multiple iterations of phylogenomic trees were required
to create the final CHAB-I-5 phylogeny, and all phylogenies were, unless otherwise stated,
created using GTDB-tk v1.7.0 (32) to identify, align, and trim 120 conserved single copy marker
41
genes and phylogeny inferred with IQ-tree v2.2.0 (21) with parameter “-m LG+I+G”. First, we
built a phylogenetic tree of all Roseobacter genomes from the above databases to determine
which genomes belong to CHAB-I-5 and which is the closest sister clade to use for an outgroup
(data not shown). Once we established CHAB-I-5’s relationship to other Roseobacter and nearest
outgroup, FZCC0043, we then created a phylogeny of 259 CHAB-I-5 and FZCC0043 genomes
to determine the root position of the CHAB-I-5 cluster with its outgroup. Next, we built a
phylogeny of only CHAB-I-5 genomes and excluded the FZCC0043 genomes to determine the
phylogeny within the CHAB-I-5 cluster on a non-dereplicated set of 208 genomes. To exclude
redundant CHAB-I-5 genomes, genomes were dereplicated using dRep v3.2.0 (33) with option ‘-
pa 0.99’, which sets average nucleotide identity as 99%. Genomes with higher estimated quality,
which was defined as completeness minus five times of contamination (27), were selected as
representatives for the recruitment analysis with one exception in which we kept two SB2
genomes that were publicly available. The resulting set included 54 CHAB-I-5 genomes. We
removed two genomes, the redundant SB2 genome as well as one genome that had a particularly
long branch and did not group with either CHAB-I-5 cluster, and finally constructed the final
phylogenomic tree of these 52 genomes. This phylogenomic tree was rooted using mad v2.2
based on minimal ancestor deviation approach (34). This approach considers each branch as a
possible root position, evaluates the ancestor-descendant relationships of all possible ancestral
nodes in the tree, and chooses the branch with the minimal relative deviation as the root node
(34).

ANI and 16S rRNA comparisons:
42
We compared the pairwise average nucleotide identity (ANI) of the final 52 genomes with
fastANI v1.33 (35) and visualized in R. We used CheckM v1.1.3 ssu_finder (27) to identify the
bacterial 16S rRNA genes from the whole genomes and NCBI BLAST for comparison.

Genomic analysis
To examine the genomic content of the 52 genomes within the CHAB-I-5 cluster, we used
Anvio’ v7.1 (36) to generate predicted amino acid sequences from genome sequences and used
GhostKOALA (37) for annotation of the amino acid sequences using the KEGG orthology
database (38). The resulting annotations and the original amino acid sequences were used with
KEGG-Decoder and KEGG-Expander v.1.3 (39) to catalog the metabolic pathways present.

Metagenomic read recruitment
We recruited reads from 1,059 metagenomic samples to the CHAB-I-5 genomes using
competitive read recruitment via rrap (40) as previously reported (41). Briefly, rrap uses the
latest versions of Bowtie2 (42) and SAMtools (43) to concatenate genomes of interest, perform a
competitive read recruitment from metagenomic samples to the genomes, sort and index mapped
reads, and normalize the data into RPKM values (Reads Per Kilobase (of genome) per Million
(of recruited read base pairs)). We then analyzed the RPKM values in R.

Microscopy
We added 3% glutaraldehyde to 50 mL of US3C007 culture when it reached late-exponential
phase (~ 10
6
cells/mL) and stored it in the dark at 4˚C overnight. We filtered the cells onto a 0.2
µm Isopore polycarbonate filter (MilliporeSigma) and dehydrated the cells with ethanol for 20
43
minute washes with 30%, 40%, 50%, 75%, 80%, 90%, 95%, and 100% ethanol. We submerged
the filter in 100% ethanol and placed it into a Tousimis 815 critical point drying system. The
filters were sputtercoated for 45s with a Cressington 108 and imaged with the JSM-7001F-LV
scanning electron microscope at the University of Southern California Core Center of Excellence
in NanoImaging (https://cni.usc.edu). Resulting images were analyzed as described previously
(40).

Salinity and temperature growth range experiments
We used modified versions of the isolation medium, AMS1, (Table S1) to test the salinity range
of US3C007. We kept the concentration of all added nutrient stocks constant and changed
salinity by diluting or increasing the salt stocks while keeping the ratio of components constant.
The exception to this was for sodium bicarbonate, which we kept constant to maintain buffering
capacity. For temperature range experiments, we grew the cultures in AMS1 at 4˚C, 12˚C, 16˚C,
20˚C, 24˚C, 26˚C, 30˚C, and 37˚C. We counted cells daily or every other day. Growth rates were
calculated using the python package sparse-growth-curve (41).

Carbon concentration growth experiments
We modified AMS1 medium to adjust the carbon concentrations while keeping all other
components of the isolation medium the same. We tested the following concentrations of carbon:
0, 3.44 µM, 6.88 µM, 13.75 µM, 27.5 µM, 55 µM, 110 µM, and 220 µM. (Table S1). The
carbon stock includes a mixture of pyruvate, glycine, and methionine.

44
Results
US3C007 Isolation, Identification, and Genome Sequencing and Assembly
US3C007 was one of 4 isolates from our cultivation experiment inoculated with surface water
collected from the San Pedro Ocean Time series (SPOT) monthly cruise on 09/16/2020. Its top
16S rRNA gene BLAST hit was 100% identity to Roseobacter sp. SB2, accession KX467571.1
(5). The 16S rRNA gene phylogeny at the time of isolation indicated US3C007 was the nearest
phylogenetic neighbor to SB2 and the original clone library sequence of CHAB-I-5 (18) (Fig. 1).
A hybrid long and short read genome assembly resulted in 1 circularized contig with
3,622,411bp and an average coverage of 54x. CheckM indicated a completion score of 98.33%
though we did verify closure of the single contig via overlapping end with Flye v2.9.1 output
(23). CheckM reported 2 copies of the 16S rRNA gene, 0 ambiguous bases, contamination
estimate of 0.61%, 0% strain heterogeneity, a GC content of 50.6%, a coding density of 88.4%,
and 3,513 predicted genes (Table S1).

CHAB-I-5 phylogeny and intra-clade diversity
Multiple iterations of the phylogenomic tree were required to select the final CHAB-I-5 taxa to
be included. The final taxon selection includes 52 genomes (Table S1), and the phylogenomic
tree is shown in Fig. 2A. There are two clusters of the tree with US3C007 and SB2 on one
branch and isolate FZCC0083 on the second (Fig. 2A). We refer to these two branches as Cluster
1 and Cluster 2, respectively. Cluster 1 contained a minimum ANI identity of 95% to other
genomes in the cluster, while Cluster 2 minimum ANI identity was 94%. An ANI pairwise
percentage drop off between cluster boundaries was evident and matched the phylogenomic
branching pattern (Fig. 2B). Four genomes contained 16S rRNA sequences that were 1469bp
long- US3C007, FZCC0083, SB2, and AAA076-I17, with isolate US3C007 containing two
45
copies. SB2 and both copies of the US3C007 16S rRNA genes had 100% BLAST identities to
each other. FZCC0083 had 99.8% identity to the US3C007 and SB2 16S rRNA genes.

Ecology:
We mapped reads from metagenome samples across wide biogeographic distributions and
differing salinities as published previously (41) to CHAB-I-5 genomes to understand the
ecological distribution of each CHAB-I-5 genome and cluster. US3C007 was the most abundant
representative genome, followed by ERR559527_bin_47_MetaBAT_v2_12_1_MAG,
AA076_I17, FZCC0083, and SB2 (Fig. 3A). Comparison of genome abundance with salinity
demonstrated that all members of CHAB-I-5 are marine organisms, though some genomes do
recruit limited reads from samples with a salinity of 8 (Figs. 3B,S1). The most abundant
CHABI-I-5 representatives are cosmopolitan, being detected across the global oceans (Fig. 3C).
When total RPKMs are summed by phylogenetic cluster, the median recruited reads are smaller
for Cluster 1 than that of Cluster 2 (Fig. S2). Cluster 1, containing isolates US3C007 and SB2,
has a higher recruitment than Cluster 2, the FZCC0083 type, at sites such as the Western United
States coast, the South African Western tip, and the West and Southeast of South America.
Cluster 2 has a higher recruitment at locations such as the Mediterranean, Pearl River, and much
of the North Atlantic Gyre (Fig. S3).

Genomic content of CHAB-I-5
We analyzed the metabolic potential of CHAB-I-5 genomes to determine whether there were any
features that distinguished the two clusters from each other (Fig. 4).

46
Electron Transport, Central Carbon, and Amino Acids- All genomes contained a majority
pathway for glycolysis via the Enter-Doudoroff pathway and the TCA cycle. All genomes
contained a majority or complete pathways for NADH-quinone oxioreductase, F-type ATPase,
cytochrome c oxidase, and ubiquinol-cytochrome c reductase. One genome, CPC58, contains a
cbb3-type cytochrome c oxidase. Most genomes had the majority of a pathway for
polyhydroxybuterate synthesis. All genomes contain a partial formaldehyde assimilation
pathway. 12 genomes contain a di/tri methylamine dehydrogenase. All genomes have the
potential to convert ethanol to acetate and acetylaldehyde and some anaplerotic genes. 13
genomes have a carbon-phosphate lyase complex, operon, and cleavage potential. US3C007 is
the only isolate genome that does not contain this pathway.

Nitrogen, Phosphorus, Sulfur- Transporters for urea, ammonia, and phosphate were found in all
genomes, and most genomes contained a phosphonate transporter. CPC58 also is the sole
genome to contain a nitrite reduction pathway. All genomes except for CPC58 contained partial
or full pathway for thiosulfate oxidation. All genomes contain a gene encoding a sulfite
dehydrogenase quinone, and all genomes in cluster 1 and most in cluster 2 contain a sulfide
oxidation pathway. Most genomes contain a DMSP lyase, all contain a DMSP demethylation and
most genomes contain a DMSP synthase.

Vitamins and Metals- All genomes except for 4 contained Mg-Co transporter, 10 genomes
contained Mg-Zn transport potential, and 5 genomes in Cluster 1 contained a copper transporter.
US3C007 is the only isolate to contain the copper transporter. All genomes contain ferric iron,
Mn-Zn-Fe, zinc, tungstate transporters. All genomes except for 1 in Cluster 1 contain partial or
47
nearly complete pathways for molybdate transport while only 1 genome in Cluster 2 contained at
least a half pathway. No genome contained the full pathway for thiamin biosynthesis, though a
partial pathway was present in all genomes. Most genomes contained either a full or partial
pathway for riboflavin and cobalamin biosynthesis and thiamin transport.

Amino acids and compatible solutes- All genomes are prototrophic for lysine, serine, threonine,
glutamine, cysteine, glycine, valine, methionine, isoleucine, tryptophan, aspartate, and glutamate.
Only SB2 is prototrophic for asparagine. Prototrophy for histidine and arginine was found in all
but 5 and 3 genomes, respectively. All genomes could synthesize glycine betaine, and all
genomes except for one SAG could transport glycine-betaine/proline. 1 genome in Cluster 2
could not transport ectoine/hydroxyectoine. Most genomes in Cluster 1 could transport taurine,
with no genomes from Cluster 2 containing this pathway including FZCC0083. All genomes
except for 1 SAG contain the trk potassium transport system.

Photosynthesis and other features- All genomes except for 6 SAGs contain a complete
anoxygenic type-II reaction center and all genomes contain partial pathways for retinal
biosynthesis. Full or partial pathways for a flagellum were in all genomes. All genomes have
partial or full pathways for signal recognition Sec-SRP and twin arginine targeting.

Physiology
Temperature and Salinity: US3C007 was tested for temperature range at 4, 12, 16, 20, 24, 26, 30,
and 37˚C. It grew from 16˚C -26˚C with some limited growth in 30˚C (Fig.S4) and had an
optimum growth rate between 20˚C with 1.35 doublings/day (Fig.5A). Additionally, we tested
48
US3C007’s growth at salinities of 1.1, 2.1, 4.2, 8.4, 16.8, 16.9, 21.1, 28.11, 33.7, 33.73, and
40.48. It was able to grow at salinities of 28.11, 33.7, 33.73, and 40.48 with an optimum growth
rate at 33.7 with 1.3 doublings/day (Fig.5B, Fig.S5).

Carbon: We tested US3C007’s growth across a range of carbon concentrations to determine its
response to carbon flux. Carbon sources in the carbon mix include methionine, glycine, and
pyruvate. We tested 0 µM, 3.44, 6.88, 13.75, 27.5, 55, 100, and 220 µM carbon additions, with
110 µM being the concentration in AMS1 medium that US3C007 was isolated and is propagated
on. Over 3 growth cycles, growth dynamics indicate somewhat decreased cell growth over the
transfers in most conditions (Fig.6). This experiment will need further transfers to interpret the
data, as the negative control with no carbon has not yet carbon limited the culture.

Electron microscopy: Scanning electron microscopy images of US3C007 shown in Fig. 7A-F
indicate multiple morphologies within a single clonal culture. Single cells are coccobacillus Fig.
7A and multiple coccobacillus cells form chains Fig. 7B-C. Some chains exhibit irregular long
bacillus morphology that looks as if multiple coccobacillus chained with incomplete cell division
Fig. 7D. A morphology common in the culture is that of chained coccobacillus with incomplete
cell division that has a globulus feature in the middle of the chains Fig. 7E-F. These non-
standard morphologies are present on chains that visibly resemble multiple coccobacillus on
either side of the globulus structures. For a single cell, the radius was 0.20µm, length was
4.66µm, and volume was 0.09µm
3
(Fig7A, Table S1). The average dimensions of all cells
shown in Fig.7A-F are as follows: 0.22µm radius, 0.81µm length, and 0.21µm
3
volume. These
average values vary from that of the single cell because of the pleiomorphic nature of the cells
49
seen in the culture (Fig.7A-F). The distribution of calculations for cell radii, length, and volume
are shown in Fig. 7G-I, Fig. S6, Table S1.

Discussion
This study is the most comprehensive analysis of the CHAB-I-5 cluster within
Roseobacter to date. We have expanded the genomic and ecological characterization of 52
CHAB-I-5 genomes to determine two clusters within the clade supported with phylogenomics
and ANI. Additionally, we provide a new CHAB-I-5 isolate, US3C007, and the first circularized
CHAB-I-5 genome. US3C007 is reliably propagated in artificial seawater medium that is easily
modified, and we define the first physiology of the CHAB-I-5 including morphology, a
resistance to carbon limitation over 3 transfers, and temperature and salinity ranges with their
optima.
Our expanded analysis takes advantage of recent publicly-available CHAB-I-5 genomes
that provides the opportunity to understand intra-clade diversity using phylogenomics and
average nucleotide identity (ANI). ANI is a metric to designate species when comparing closely-
related organisms though their genomes (35, 44), and this type of whole genome comparison
within CHAB-I-5 has never before been possible due to a lack of publicly-available genomes. A
prior study established two subclusters within CHAB-I-5 using environmental 16S rRNA
sequence phylogeny (5), and we see the same division in our analysis. Both phylogenomics and
average nucleotide identity support at least two groupings of diversity within CHAB-I-5, denoted
Cluster 1 and Cluster 2 (Fig.2A-B). Each cluster belongs to its own branch on the phylogenomic
tree and are likely representative of two separate species within the clade as cluster contains a
minimum of 94% ANI within a cluster and with a drop-off in ANI between phylogenomic
50
clusters (Fig.2A-B). Isolate US3C007 belongs to Cluster 1 and isolate FZCC0083 belongs to
Cluster 2, indicating isolated representatives existing for each species within CHAB-I-5.
In a search for cluster-wide genomic content differences between Cluster 1 and Cluster 2
within CHAB-I-5, we found the predicted metabolism is largely consistent throughout the clade
with few differences between the two clusters save for a few exceptions (Fig. 4). 5 genomes in
Cluster 1 contained complete pathways for the copA copper transporter while no genome in
Cluster 2 contained this. Isolate US3C007 does possess the copper transporter while the recently
isolated FZCC0083 does not (Fig. 4). While copper is an important essential element for
bacteria, it is also highly toxic (45). In a survey of the effect of copper concentration shifts on
marine heterotrophic isolates, Dokdonia sp. strain Dokd-P16 had lowered growth rate and carbon
use in Dokdonia sp. strain Dokd-P16 while R. pomeroyi DSS-3 had no change in growth rate but
did have a raised carbon demand in response to lowered copper concentration (46). In
Escherichia coli, copA has been associated with copper toxicity resistance and the export of
copper from the cell (47, 48). The differential presence of this copper transporter in US3C007
and FZCC0083 may result in differential copper tolerance or requirements in the two isolates.
An additional pathway that is present in Cluster 1 and not Cluster 2 is the taurine transporter
(Fig. 4). Taurine is an important, multifunctional compound that serves as an osmoregulation
tool and as a source for carbon, nitrogen, and sulfur for marine bacteria (49). Isolate US3C007
should be able to transport taurine while FZCC0083 does not have the pathway (Fig. 4). This
differential ability to transport taurine may confer a growth advantage in US3C007, but future
analysis is needed to understand whether there is an advantage to transport taurine and what
specifically taurine is used for in US3C007. The last notable difference in metabolic content
within CHAB-I-5 is that of the CP-lyase genes. CP-lyase breaks apart carbon-phosphorous bonds
51
and is used in some marine organism as a phosphate scavenging strategy from
methylphosphonates and produces methane in aerobic waters (50). Cluster 2 is enriched in these
genes, while Cluster 1 only contains a few genomes with the pathway (Fig. 4). Isolate
FZCC0083 contains CP-lyase genes while US3C007 does not. Whether the two isolates use
differential CP-lyase as a phosphate scavenging mechanism and whether this results in CHAB-I-
5 significantly contributing to methane production in global oceans is unknown at this time.
These highlighted examples of cluster-wide and isolate-specific metabolic content could be
excellent starting points for future comparative physiological experimentation to determine what
kinds of growth advantages and ecological impacts these features might confer.
In a survey of CHAB-I-5 ecology, we found the cluster to be distributed across global
oceans similar to previous reports (5, 8). This study expands the known ecological distribution of
CHAB-I-5, showing its presence in sample sites such as the N. Atlantic gyre, S. Pacific, Gulf of
Mexico, and the Red Sea that were unavailable or had fewer sites surveyed in previous reports of
CHAB-I-5 ecology (Fig. 3) (5, 8). Though we did not include polar samples in our ecological
survey, other studies have found CHAB-I-5 to be present in polar waters (5, 8). The combination
of this work with previous study confirms CHAB-I-5 to be ubiquitous in global oceans. There is
no strong evidence of niche-differentiation within CHAB-I-5 based on cluster designation,
though some clusters within the PRC do tradeoff in abundance based on latitudinal location (8).
Cluster 1 recruited more overall reads than Cluster 2 (Fig.S2). One previous ecological survey
indicated the presence of CHAB-I-5 members did not decline along a salinity range of the
Chesapeake Bay (10), but no prior ecological study has focused on the distribution of CHAB-I-5
across salinities in global metagenomic data. This is partially due to the fact that the majority of
ecological data for CHAB-I-5 is focused on metagenomic datasets such as Tara Oceans that
52
largely only sampled marine environments, though at least some other Roseobacter relatives
have been isolated from brackish salinities (16, 17, 51). Therefore, this is the first study to
systematically examine CHAB-I-5’s distribution with an emphasis on salinity. There was no
evidence of fresh or brackish specialists within CHAB-I-5, and all members displayed a
distribution in RPKM values that favored marine samples though multiple genomes did recruit
low reads from brackish waters in salinities as low as 8 (Fig. S1). We summed the total RPKM
values across all sites for each genome and determined the top 5 most recruiting genomes were
US3C007, FZCC0083, SB2, AAA076I17, and ERR559527_bin47_MetaBATv2121MAG
(Fig.3A). Isolate US3C007 recruited the most reads of all across the samples (Fig.3A), providing
support that US3C007 is representative of an abundant type of CHAB-I-5 in global and poises
the isolate as an excellent candidate for physiology study of the clade.
We cultivated and propagated US3C007 using an artificial seawater medium that allowed
us to conduct the first physiology experiments for CHAB-I-5. Except for one failure to transfer
from its isolation medium, AMS1, into a medium that our group more frequently works with,
MWH1, US3C007 was largely easy to work with and could be reliably transferred when
temperature and salinity is kept constant. At room temperature (~24˚C) in the AMS1 medium,
CHAB-I-5 is relatively slow growing with an average growth rate of 1.32 doublings/day
(Fig.5B). Temperature experiments on US3C007 showed growth at temperatures between 16-
26˚C with an optimum at 20˚C (Fig.5B). While our ecological recruitment data did not include
the polar regions to examine CHAB-I-5 distribution in cold waters, other studies have found
CHAB-I-5 to be abundant and active in polar latitudes (5, 12). This contrasts with our data
showing US3C007 to not grow in the coldest temperatures tested. This contrast could be due to
US3C007’s actual inability to grow at 4 and 12˚C, but also could be due to perhaps not
53
continuing the experiment long enough to see growth at very slow rates expected for the cold
temperatures. Salinity experiments showed US3C007 grew at salinities between 28 and 40.5
(Fig.5A). This suggests that it is unlikely that the recruitment to the US3C007 genome from
samples with salinities much lower than 28 is due to actively growing populations and those
reads recruitment may be from dormant or non-growth states. The prior study from the
Chesapeake Bay that noted CHAB-I-5 remaining stable across salinities measured abundance
rather than activity, and activity studies of CHAB-I-5 have largely focused on marine samples (5,
10). Future work measuring activity of CHAB-I-5 across salinities could provide insight to
whether the cells might be active in salinities lower than 28. In a survey of US3C007’s growth
across carbon concentrations, our preliminary results suggest that US3C007 is tolerant of a large
range of carbon concentrations and is resistant to quick carbon limitation. Three growth cycles
were not enough to fully carbon limit the culture in carbonless media, indicating the potential for
the isolate to grow with small levels of carryover carbon concentrations (Fig.6). The
continuation of this experiment will be needed to characterize the carbon usage in US3C007
fully.
We generated the first scanning electron microscopy images and cell dimensions of
CHAB-I-5 using strain US3C007 and saw pleiomorphism in the culture (Fig.7A-F).
Pleiomorphism and irregular morphology has been recorded in other Roseobacter, including
HIMB11 which is closely-related to US3C007 (52). Both HIMB11 and US3C007 have cells that
are coccobacillus as well irregular rods with single and doublet features (52) (Fig.7A-F). At least
one scanning electron microscopy image of Roseobacter member, Phaeobacter caruleus, shows
cells with a rounded center like that seen in US3C007 (53) (Fig 7F), though the rounded center
in US3C007 is much more pronounced. It is currently unclear what to label this feature or the
54
cause of the unusual morphology in US3C007. Cell volume measurements were 0.09µm
3
for a
single cell and averaged of 0.21±0.25µm
3
across all morphologies seen in the US3C007 culture
(Table S1). In a study that measured the volume of 1276 heterotrophic cells across 23 coastal
ocean samples, the weighted average cell volume was 0.11±0.17µm
3
(54). US3C007’s average
cell volume is greater than that of the heterotrophic bacteria measured at coastal sites when the
bulbous morphology (Fig.7F) is included but is 0.16±0.23 µm
3
when excluding the atypical
morphology. This value is closer to that of the coastal heterotrophs, but is still larger than what is
observed in the natural populations. Future work to determine which morphology is typical of
CHAB-I-5 in natural populations would be important to understand in order to use cell volume in
the modeling of biogeochemical cycling in CHAB-I-5, though this range of volumes seen in
US3C007 is helpful to constrain estimates in current predictions.
Overall, this work provides the most comprehensive genomic and ecological
characterization of CHAB-I-5 and defines the first physiological data of the group. These recent
advances in the availability of public CHAB-I-5 genomes and a new isolate that is representative
of the CHAB-I-5 in global waters is a crucial component needed to characterize this abundant
and highly active fraction of the microbial community. Future work is needed on US3C007 and
the CHAB-I-5 cluster that could include comparative physiology between FZCC0083 and
US3C007 to highlight whether a growth advantage might be conferred in the environment based
on phosphorous, copper, or taurine availability and to quantify global estimates of CHAB-I-5’s
contribution to biogeochemical cycling in the oceans.

55

References-Chapter 2

1. Buchan A, González JM, Moran MA. 2005. Overview of the marine roseobacter lineage.
Appl Environ Microbiol 71:5665–5677.
2. Buchan A, LeCleir GR, Gulvik CA, González JM. 2014. Master recyclers: features and
functions of bacteria associated with phytoplankton blooms. Nat Rev Microbiol 12:686–
698.
3. Moran MA, Belas R, Schell MA, González JM, Sun F, Sun S, Binder BJ, Edmonds J, Ye
W, Orcutt B, Howard EC, Meile C, Palefsky W, Goesmann A, Ren Q, Paulsen I, Ulrich
LE, Thompson LS, Saunders E, Buchan A. 2007. Ecological Genomics of Marine
Roseobacters. Applied and Environmental Microbiology
https://doi.org/10.1128/aem.02580-06.
4. Luo H, Löytynoja A, Moran MA. 2012. Genome content of uncultivated marine
Roseobacters in the surface ocean. Environ Microbiol 14:41–51.
5. Billerbeck S, Wemheuer B, Voget S, Poehlein A, Giebel H-A, Brinkhoff T, Gram L,
Jeffrey WH, Daniel R, Simon M. 2016. Biogeography and environmental genomics of
the Roseobacter-affiliated pelagic CHAB-I-5 lineage. Nat Microbiol 1:16063.
6. Luo H, Moran MA. 2014. Evolutionary ecology of the marine Roseobacter clade.
Microbiol Mol Biol Rev 78:573–587.
7. Feng X, Chu X, Qian Y, Henson MW, Lanclos VC, Qin F, Barnes S, Zhao Y, Thrash JC,
Luo H. 2021. Mechanisms driving genome reduction of a novel Roseobacter lineage.
ISME J 15:3576–3586.
8. Zhang Y, Sun Y, Jiao N, Stepanauskas R, Luo H. 2016. Ecological Genomics of the
Uncultivated Marine Roseobacter Lineage CHAB-I-5. Appl Environ Microbiol 82:2100–
2111.
9. Venter JC, Remington K, Heidelberg JF, Halpern AL, Rusch D, Eisen JA, Wu D, Paulsen
I, Nelson KE, Nelson W, Fouts DE, Levy S, Knap AH, Lomas MW, Nealson K, White
O, Peterson J, Hoffman J, Parsons R, Baden-Tillson H, Pfannkoch C, Rogers Y-H, Smith
HO. 2004. Environmental genome shotgun sequencing of the Sargasso Sea. Science
304:66–74.
10. Buchan A, Hadden M, Suzuki MT. 2009. Development and application of quantitative-
PCR tools for subgroups of the Roseobacter clade. Appl Environ Microbiol 75:7542–
7547.
56
11. Henriques IS, Almeida A, Cunha A, Correia A. 2004. Molecular sequence analysis of
prokaryotic diversity in the middle and outer sections of the Portuguese estuary Ria de
Aveiro. FEMS Microbiol Ecol 49:269–279.
12. Zhang Z, Wu Z, Liu H, Yang M, Wang R, Zhao Y. Genomic analysis and
characterization of phages infecting the marine Roseobacter CHAB-I-5 lineage reveal a
globally distributed and abundant phage …. Front Microbiol.
13. Yang S-J, Kang I, Cho J-C. 2016. Expansion of Cultured Bacterial Diversity by Large-
Scale Dilution-to-Extinction Culturing from a Single Seawater Sample. Microb Ecol
71:29–43.
14. Thrash JC, Weckhorst JL, Pitre DM. 2017. Cultivating Fastidious Microbes, p. 57–78. In
McGenity, TJ, Timmis, KN, Nogales, B (eds.), Hydrocarbon and Lipid Microbiology
Protocols: Isolation and Cultivation. Springer Berlin Heidelberg, Berlin, Heidelberg.
15. Carini P, Steindler L, Beszteri S, Giovannoni SJ. 2013. Nutrient requirements for growth
of the extreme oligotroph ‘Candidatus Pelagibacter ubique’ HTCC1062 on a defined
medium. ISME J 7:592–602.
16. Henson MW, Lanclos VC, Pitre DM, Weckhorst JL, Lucchesi AM, Cheng C, Temperton
B, Thrash JC. 2020. Expanding the diversity of bacterioplankton isolates and modeling
isolation efficacy with large-scale dilution-to-extinction cultivation. Appl Environ
Microbiol 86.
17. Henson MW, Pitre DM, Weckhorst JL, Lanclos VC, Webber AT, Thrash JC. 2016.
Artificial Seawater Media Facilitate Cultivating Members of the Microbial Majority from
the Gulf of Mexico. mSphere 1:1–10.
18. Schäfer H, Servais P, Muyzer G. 2000. Successional changes in the genetic diversity of a
marine bacterial assemblage during confinement. Arch Microbiol 173:138–145.
19. Edgar RC. 2004. MUSCLE: Multiple sequence alignment with high accuracy and high
throughput. Nucleic Acids Res 32:1792–1797.
20. Capella-Gutierrez S, Silla-Martinez JM, Gabaldon T. 2009. trimAl: a tool for automated
alignment trimming in large-scale phylogenetic analyses. Bioinformatics
https://doi.org/10.1093/bioinformatics/btp348.
21. Nguyen L-T, Schmidt HA, von Haeseler A, Minh BQ. 2015. IQ-TREE: a fast and
effective stochastic algorithm for estimating maximum-likelihood phylogenies. Mol Biol
Evol 32:268–274.
22. Wick RR, Judd LM, Holt KE. 2019. Performance of neural network basecalling tools for
Oxford Nanopore sequencing. Genome Biol 20:129.
57
23. Kolmogorov M, Yuan J, Lin Y, Pevzner PA. 2019. Assembly of long, error-prone reads
using repeat graphs. Nat Biotechnol 37:540–546.
24. Li H. 2016. Minimap and miniasm: fast mapping and de novo assembly for noisy long
sequences. Bioinformatics 32:2103–2110.
25. Wick RR, Holt KE. 2022. Polypolish: Short-read polishing of long-read bacterial genome
assemblies. PLoS Comput Biol 18:e1009802.
26. Wick RR, Schultz MB, Zobel J, Holt KE. 2015. Bandage: interactive visualization of de
novo genome assemblies. Bioinformatics 31:3350–3352.
27. Parks DH, Imelfort M, Skennerton CT, Hugenholtz P, Tyson GW. 2015. CheckM:
assessing the quality of microbial genomes recovered from isolates, single cells, and
metagenomes. Genome Res 25:1043–1055.
28. Sunagawa S, Acinas SG, Bork P, Bowler C, Tara Oceans Coordinators, Eveillard D,
Gorsky G, Guidi L, Iudicone D, Karsenti E, Lombard F, Ogata H, Pesant S, Sullivan MB,
Wincker P, de Vargas C. 2020. Tara Oceans: towards global ocean ecosystems biology.
Nat Rev Microbiol 18:428–445.
29. Royo-Llonch M, Sánchez P, Ruiz-González C, Salazar G, Pedrós-Alió C, Sebastián M,
Labadie K, Paoli L, M Ibarbalz F, Zinger L, Churcheward B, Tara Oceans Coordinators,
Chaffron S, Eveillard D, Karsenti E, Sunagawa S, Wincker P, Karp-Boss L, Bowler C,
Acinas SG. 2021. Compendium of 530 metagenome-assembled bacterial and archaeal
genomes from the polar Arctic Ocean. Nat Microbiol 6:1561–1574.
30. Larkin AA, Garcia CA, Garcia N, Brock ML, Lee JA, Ustick LJ, Barbero L, Carter BR,
Sonnerup RE, Talley LD, Tarran GA, Volkov DL, Martiny AC. 2021. High spatial
resolution global ocean metagenomes from Bio-GO-SHIP repeat hydrography transects.
Sci Data 8:107.
31. Nishimura Y, Yoshizawa S. 2022. The OceanDNA MAG catalog contains over 50,000
prokaryotic genomes originated from various marine environments. Sci Data 9:305.
32. Chaumeil P-A, Mussig AJ, Hugenholtz P, Parks DH. 2019. GTDB-Tk: a toolkit to
classify genomes with the Genome Taxonomy Database. Bioinformatics
https://doi.org/10.1093/bioinformatics/btz848.
33. Olm MR, Brown CT, Brooks B, Banfield JF. 2017. dRep: a tool for fast and accurate
genomic comparisons that enables improved genome recovery from metagenomes
through de-replication. ISME J 11:2864–2868.
34. Tria FDK, Landan G, Dagan T. 2017. Phylogenetic rooting using minimal ancestor
deviation. Nat Ecol Evol 1:193.
58
35. Jain C, Rodriguez-R LM, Phillippy AM, Konstantinidis KT, Aluru S. 2018. High
throughput ANI analysis of 90K prokaryotic genomes reveals clear species boundaries.
Nat Commun 9:5114.
36. Eren AM, Esen ÖC, Quince C, Vineis JH, Morrison HG, Sogin ML, Delmont TO. 2015.
Anvi’o: an advanced analysis and visualization platform for ’omics data. PeerJ 3:e1319.
37. Kanehisa M, Sato Y, Morishima K. 2016. BlastKOALA and GhostKOALA: KEGG
Tools for Functional Characterization of Genome and Metagenome Sequences. J Mol
Biol 428:726–731.
38. Kanehisa M, Goto S. 2000. KEGG: kyoto encyclopedia of genes and genomes. Nucleic
Acids Res 28:27–30.
39. Graham ED, Heidelberg JF, Tully BJ. 2018. Potential for primary productivity in a
globally-distributed bacterial phototroph. ISME J 12:1861–1866.
40. Kojima CY, Getz EW, Thrash JC. 2022. RRAP: RPKM Recruitment Analysis Pipeline.
Microbiol Resour Announc 11:e0064422.
41. Lanclos VC, Rasmussen AN, Kojima CY, Cheng C, Henson MW, Faircloth BC, Francis
CA, Thrash JC. 2023. Ecophysiology and genomics of the brackish water adapted SAR11
subclade IIIa. ISME J https://doi.org/10.1038/s41396-023-01376-2.
42. Langmead B, Salzberg SL. 2012. Fast gapped-read alignment with Bowtie 2. Nat
Methods 9:357–359.
43. Danecek P, Bonfield JK, Liddle J, Marshall J, Ohan V, Pollard MO, Whitwham A, Keane
T, McCarthy SA, Davies RM, Li H. 2021. Twelve years of SAMtools and BCFtools.
Gigascience 10.
44. Konstantinidis KT, Ramette A, Tiedje JM. 2006. The bacterial species definition in the
genomic era. Philos Trans R Soc Lond B Biol Sci 361:1929–1940.
45. Argüello JM, Raimunda D, Padilla-Benavides T. 2013. Mechanisms of copper
homeostasis in bacteria. Front Cell Infect Microbiol 3:73.
46. Posacka AM, Semeniuk DM, Maldonado MT. 2019. Effects of Copper Availability on
the Physiology of Marine Heterotrophic Bacteria. Frontiers in Marine Science 5.
47. Rensing C, Fan B, Sharma R, Mitra B, Rosen BP. 2000. CopA: An Escherichia coli
Cu(I)-translocating P-type ATPase. Proc Natl Acad Sci U S A 97:652–656.
48. Ladomersky E, Petris MJ. 2015. Copper tolerance and virulence in bacteria. Metallomics
7:957–964.
59
49. Clifford EL, Varela MM, De Corte D, Bode A, Ortiz V, Herndl GJ, Sintes E. 2019.
Taurine Is a Major Carbon and Energy Source for Marine Prokaryotes in the North
Atlantic Ocean off the Iberian Peninsula. Microb Ecol 78:299–312.
50. Carini P, White AE, Campbell EO, Giovannoni SJ. 2014. Methane production by
phosphate-starved SAR11 chemoheterotrophic marine bacteria. Nat Commun 5:4346.
51. González JM, Kiene RP, Moran MA. 1999. Transformation of sulfur compounds by an
abundant lineage of marine bacteria in the alpha-subclass of the class Proteobacteria.
Appl Environ Microbiol 65:3810–3819.
52. Durham BP, Grote J, Whittaker KA, Bender SJ, Luo H, Grim SL, Brown JM, Casey JR,
Dron A, Florez-Leiva L, Krupke A, Luria CM, Mine AH, Nigro OD, Pather S, Talarmin
A, Wear EK, Weber TS, Wilson JM, Church MJ, DeLong EF, Karl DM, Steward GF,
Eppley JM, Kyrpides NC, Schuster S, Rappé MS. 2014. Draft genome sequence of
marine alphaproteobacterial strain HIMB11, the first cultivated representative of a unique
lineage within the Roseobacter clade possessing an unusually small genome. Stand
Genomic Sci 9:632–645.
53. Beyersmann PG, Chertkov O, Petersen J, Fiebig A, Chen A, Pati A, Ivanova N, Lapidus
A, Goodwin LA, Chain P, Detter JC, Rohde M, Gronow S, Kyrpides NC, Woyke T,
Simon M, Göker M, Klenk H-P, Brinkhoff T. 2013. Genome sequence of Phaeobacter
caeruleus type strain (DSM 24564T), a surface-associated member of the marine
Roseobacter clade. Stand Genomic Sci 8:403–419.
54. Malfatti F, Samo TJ, Azam F. 2010. High-resolution imaging of pelagic bacteria by Atomic
Force Microscopy and implications for carbon cycling. ISME J 4:427–439.

60
Main Figures and Tables

61

62

Figure 1. Phylogenetic tree of 16S sequences from Alphaproteobacteria with US3C007 and
other CHAB-I-5 sequences added in. Nodes outside of the CHAB-I-5 and Roseobacter HIMB11
clade have been collapsed to show US3C007’s inclusion with the CHAB-I-5 sequences. The
CHAB-I-5 cluster is boxed in red, and isolate US3C007 is starred.

Figure 2: Phylogenomics and average nucleotide identity (ANI) of CHAB-I-5. A) Phylogenomic
tree of 52 CHAB-I-5 genomes rooted with minimal ancestor deviation (MAD). CHAB-I-5 isolates
are highlighted in red and clusters are labeled. B) Pairwise ANI of the CHAB-I-5 clusters.

63

Figure 3: Ecological recruitment of CHAB-I-5. A) Boxplots of all RPKM values for each genome in
the analysis. Black lines within the boxes indicate median RPKM values. The top 5 recruiting
genomes are indicated by colored boxes. B) All RPKM values plotted across sample salinities for
the top 5 most recruiting genomes with a regression line featuring shading that represents a
95% confidence interval. C) All RPKM values plotted on a global map for the top 5 most
recruiting genomes. Increasing dot size represents increasing RPKM values at a sample site.

64

Figure 4: Metabolic pathway presence in CHAB-I-5 inferred with KEGG Decoder and Expand.
Genomes are arranged in order of phylogenetic relationship and colors indicate the pathway
completion. Pathways that were not present in any genome were removed from the
visualization.

65

Figure 5: Growth rates for US3C007 across A) salinities and B) temperatures calculated with
sparse-growth-curve-analysis.
66

Figure 6: Growth curves for US3C007 across carbon concentrations over three growth curves.
Replicates have been averaged at each sample point and deviation is indicated with vertical
lines.
110uM 220uM
13.75uM 27.5uM 55uM
0uM 3.44uM 6.88uM
0 5 10 0 5 10
0 5 10
1e+04
1e+05
1e+06
1e+07
1e+04
1e+05
1e+06
1e+07
1e+04
1e+05
1e+06
1e+07
Day
Ave
Transfer
0
1
2
67

Figure 7: Scanning electron microscopy of US3C007 indicating pleiomorphism in the culture.
Scale bars representing 1µm are indicated below each image. A) A single coccobacillus cell. B)
Two cells mid-division C) Four coccobacillus cells arranged in a chain D) Irregular cell potentially
composed of multiple incompletely divided cells. E-F) Zoomed out image of multiple cell
morphologies seen in the culture at varying stages of division completion. Distribution of cell G)
radii (um), H) length (um), and I) volume (um
3
).

68
CHAPTER 3: A CURE for the Physiological Characterization of
Bacterioplankton in Liquid Culture

Chapter 3 was previously published in the JMBE journal June 7
th
, 2022
(https://doi.org/10.1128/jmbe.00068-22). Below is the main text as it was published.
Supplemental information can be found on page 118.

69
A CURE for Physiological Characterization of Bacterioplankton
in Liquid Culture
V.CelesteLanclos,
a
JordanT.Coelho,
a
CatieS.Cleveland,
a
AlexJ.Hyer,
a
MindyC.McCallum,
b
EmilyR.Savoie,
c
ScottKosiba,
b
and J.CameronThrash
a
a
Department of Biological Sciences, University of Southern California, Los Angeles, California, USA
b
Department of Biological Sciences, Louisiana State University, Baton Rouge, Louisiana, USA
c
Department of Comparative Biomedical Sciences, Louisiana State University, Baton Rouge, Louisiana, USA
Bacterial characterization is an important aspect of microbiology that includes experimentally determin-
ing growth rates, environmental conditions conducive to growth, and the types of energy sources microor-
ganisms can use. Researchers use this information to help understand and predict an organism’s ecological
distribution and environmental functions. Microbiology students generally conduct bacterial characteriza-
tion experiments in their coursework; however, they are frequently restricted to model organisms without
ecological relevance and already well-studied physiologies. We present a course-based undergraduate
research experience (CURE) curriculum to involve students in characterization of previously untested,
ecologically relevant aquatic free-living bacteria (bacterioplankton) cultures to identify the usable nutrient
substrates, as well as the temperature and salinity ranges conducive to growth. Students use these results
to connect their organism’s physiology to the isolation environment. This curriculum also exposes students
to advanced microbiology methods such as flow cytometry for measuring cell concentrations, teaches
them to use the programming language R for data plotting, and emphasizes scientific communication
through writing, speaking, poster creation/presentation, and social media. This CURE is an attractive
introduction to scientific research and was successfully tested with 187 students in three semesters at two
different universities. Students generated reproducible growth data for multiple strains across these differ-
ent deployments, demonstrating the utility of the curriculum for research support.
KEYWORDS CURE,course-basedundergraduateresearchexperience,bacterialphysiology,bacterioplankton,undergraduateresearch
INTRODUCTION
Providing undergraduate students with real research
opportunities is a key component of enhancing undergradu-
ate STEM education (1–5). However, traditional research
positions at colleges and universities are limited in number,
are usually highly intensive and require considerable time
commitment, and therefore cannot be scaled to accommo-
date the majority of science majors (5). Course-based
Undergraduate Research Experiences (CUREs) provide the
opportunityforstudentstoparticipateinrealresearchunder
the aegis of the requisite coursework for attaining a degree
andcanthus reachconsiderablymorestudentsthanstandard
research positions (5). CUREs can be incorporated into any
lab-based course and have been shown to result in superior
learning outcomes for all students (5–7), as well as improved
retention in STEM for underrepresented minority students
(8) compared to traditional sections with previously known
outcomes, making them a valuable pedagogical option for
improving undergraduate STEM education. Here, we
describe a CURE curriculum for introductory biology stu-
dents that involves them in real research to characterize the
ubiquitous microbial denizens of aquatic systems, while also
teaching advanced data analysis techniques and scientific
communicationskills.
Aquatic systems host robust free-living bacterial com-
munities averaging cell densities of 10
6
cellsmL
!1
(9). Dueto
their vast numbers,thesebacterioplankton stronglyinfluence
their surrounding environments, making them important ele-
ments in a system’s ecology. The isolation of bacterioplank-
ton from their natural environment into pure culture allows
for physiological characterization of these organisms—an im-
portant experimental facet of environmental microbiology
that links physiology to ecology through growth characteris-
tics and metabolic capabilities (10, 11). Such experiments
EditorMassimilianoMarvasi,UniversityofFlorence
AddresscorrespondencetoDepartmentofBiologicalSciences,
UniversityofSouthernCalifornia,LosAngeles,California,USA.
E-mail:thrash@usc.edu.
Theauthorsdeclarenoconflictofinterest.
Received:10May2022,Accepted:18May2022,
Published:7June2022
Copyright©2022Lanclosetal.https://creativecommons.org/licenses/by-nc-nd/4.0/Thisisanopen-accessarticledistributedunderthetermsoftheCreativeCommonsAttribution-NonCommercial-NoDerivatives4.0International
license.
August 2022 Volume 23 Issue 2 10.1128/jmbe.00068-22 1
Curriculum
Downloaded from https://journals.asm.org/journal/jmbe on 13 February 2023 by 2603:8000:c100:c8b0:e0c2:5c4e:a418:ed38.
70
occur in other published curricula (12, 13) that frequently
use common model laboratory isolates such as Escherichia
coli, Pseudomonas fluorescens,or Beneckea natriegens (14–16).
These organisms are simple to work with due to their short
growth cycles,high celldensity,andwealth of datawithwhich
to compare results. However, their use in a classroom labo-
ratory setting does not provide students with the opportu-
nity to generate new results or interact with microorganisms
withwiderenvironmental relevance.
In this CURE curriculum, students work to characterize
growth ranges and optima for salinity and temperature, as
well as testing a range of possible growth compounds, for
bacterioplankton isolates that are not yet characterized.
The novelty of this curriculum is that, in addition to stu-
dents generating new results for undescribed bacterioplank-
ton in liquid culture, students are exposed to some of the
most up-to-date techniques in the field, such as flow cytom-
etry to track bacterial growth, data analysis using the pro-
gramming language R (and an Integrated Development
Environment [IDE]; RStudio) (http://www.R-project.org/;
http://www.rstudio.com/), and scientific communication via
oral, written, and social media. This CURE curriculum can
be adapted to match theflexible framework indicated in ref-
erence 17 and can also be utilized in series with other pub-
lished courses on high throughput dilution-based isolation
of bacteria (18) or the genomic characterization of bacterial
isolates (19).
Intendedaudience
The CURE curriculum teaches students the necessary
skills to use modern cultivation techniques for the charac-
terization of BSL1 aquatic bacterial isolates in liquid culture.
The intended audience for this course is first- or second-
yearcollege students majoring in a STEM field.
Learningtime
The curriculum is divided into 7 parts and can be com-
pleted in 12weeks with one 3-h lab period per week, but
this may vary depending on the growth rates of the organ-
isms being characterized. We recommend this project be
completed in an !15-week semester format to allow for
break weeks and flexibility in scheduling. Table 1 contains
the curriculum schedule without breaks.
Prerequisitestudentknowledge
All necessary training for students is included in the curricu-
lum, so no prerequisites are required. However, we recommend
thatstudentshavetakenhighschoolbiologyandchemistry.
Learningobjectives
Upon completion of this course, students will be able to:
1. Find, read, and interpret relevant primary scientific
literature.
2. Use sterile technique for proper handling of BSL1
bacterialisolatesinliquidmedia.
3. Determine physiological traits of aquatic
bacterioplankton.
4. Complete basic computer scripting with R to plot
growthdata.
5. Link research results to publicly available ecological
andenvironmentaldata.
6. Communicate research methods and results to sci-
entific and nonscientific audiences using posters,
writing,andsocialmedia.
PROCEDURE
Materials
Cryostocks or live cultures needed for this curriculum
can be obtained from a number of public culture collections,
such as the American Type Culture Collection (ATCC).
Pertinent cultures are also available from the Louisiana State
University Culture Collection (LSUCC) and University of
Southern California Culture Collection (US3C) housed in
the Thrash Lab at the University of Southern California. To
obtain cultures, please contact the corresponding author (JC
Thrash). The artificial seawater medium used throughout the
project has been previously published (20), and the recipe
is detailed in Appendix 1 in the supplemental material. An
order list for the course is found in Appendix 2, and many of
the items would stock the course for multiple semesters. All
media creation, experimental setup, and culture handling
should be done in a biosafety cabinet or laminar flow hood
to avoid contamination. Cell density is measured using flow
cytometry.
Studentinstructions
The major parts of the semester and their correspond-
ing week(s) and goal(s) are shown in Table 1. This schedule
and description of lab activities and assignments can be used
in conjunction with the detailed instructions for students
reported in the student lab manual (Appendix 3).
Facultyinstructions
A timeline for instructor lab preparation is found in
Appendix 25. Below, we highlight the general activities
according to their color-coded categories, as found in
Table 1. Note that some experiments overlap, and thus the
categories are interleaved in places. Please use Table 1 and
Appendix 25 as the primary guides. The instructor organ-
izes a poster symposium to highlight the students’ work to
take place at the end of the course. The planning includes
reserving a space, arranging printing services, setting up
BACTERIOPLANKTONCHARACTERIZATIONCURE JOURNALOFMICROBIOLOGYANDBIOLOGYEDUCATION
August2022 Volume23 Issue2 10.1128/jmbe.00068-22 2
Downloaded from https://journals.asm.org/journal/jmbe on 13 February 2023 by 2603:8000:c100:c8b0:e0c2:5c4e:a418:ed38.
71
TABLE1
Courseschedulewithoutbreakweeks
Week Topic Quiz Topic In-Class Activity Assignments Supporting Documents Due
1 Introduction Syllabus Pipette practice
Informal writing 1
Social media
assignment
Informal writing 1
Social media assignment
2
Nutrient
Stocks
Create nutrient stocks
used for minimal media
experiment
Nutrient
presentation
Media sheet
Nutrient presentation
Informal writing 1
3
Minimal
media
plate #1
Pipettes and
Nutrients
Set up and inoculate
minimal media plate #1,
science communication
example
Elevator Pitch
Writing 1
Media sheet,
Elevator pitch assignment
Writing1
4 Temperature Temperature inoculation Writing 2
Flow cytometry parameters,
media sheet
Nutrient
presentations
Writing 1
5
Minimal
media
plate #2
Temperature
Transfer minimal media
plate #1 to plate #2,
elevator pitch
Homework 1
Flow cytometry parameters,
Nutrient stock preparation
Homework 1
Elevator pitch
6
Growth
curves
Plot temperature growth
curves
Homework 2
R code,
Homework 2,
**Writing 2
Writing 2
Homework 1
7
Minimal
media
plate #3
Bacterial
Growth
Transfer minimal media
plate #2 to plate #3
Poster evaluation
Homework 3
Flow cytometry parameters,
Nutrient stock preparation,
Homework 3
Homework 2,
Writing 2
8 Growth rates
Plot temperature growth
rates
Homework 4
R code,
Homework 4
Homework 3
9 Salinity Growth rates Salinity inoculation
Poster,
Final writing
Media sheet,
Flow cytometry parameters,
poster assignment
WA#3 assignment
Homework 4
10
Data round-
up and
poster drafts
Salinity
Review data, poster
drafts,
Elevator speech assignment
11
Exam review
and posters
Poster presentation and
review
Informal writing 2 Informal writing 2 Final Writing
12 Final exam Final Exam Final Exam Example
BACTERIOPLANKTONCHARACTERIZATIONCURE JOURNALOFMICROBIOLOGYANDBIOLOGYEDUCATION
August2022 Volume23 Issue2 10.1128/jmbe.00068-22 3
Downloaded from https://journals.asm.org/journal/jmbe on 13 February 2023 by 2603:8000:c100:c8b0:e0c2:5c4e:a418:ed38.
72
tables and poster boards, and providing a participation
worksheet (such as Appendix 17) toguide students’interac-
tions as presenters and spectators. Instructors should begin
planning the poster symposium at the start of the semester.
Week 1: Introduction to the Course. In preparation for week
1(darkblue;Table1),theinstructorordersmaterials1–2
months before the course begins (Appendix 2) to ensure that
all materials arrive in time for the semester. A syllabus, assign-
ments, and readings for the semester are placed on the course
website prior to the first day of class if possible or at least
1week before the class period in which the materials will be
discussed. Approximately1–2weeksbeforeclassbegins,thein-
structor receives or reviews training with dishwashing
(Appendix 18), media creation (Appendix 1), sterile technique
in a biosafety cabinet, and operation of a flow cytometer
(Appendix 19) by growing the organism that will be used for
the course. To be better prepared for the social media assign-
ment (Appendix 5), the instructor familiarizes the students
with how social media is used for scientificpurposes.Inclass
on week 1, the instructor reviews the relevant institutional lab
safety rules with students and demonstrates proper pipetting
and sterile techniques. Lastly, the instructor assigns an informal
writing assignment to gauge student expectations/ideas of the
nontraditionalcourse(Appendix4)andassignsthesocialmedia
assignmentfor thecourse(Appendix5).
Week 2: Begin Minimal Media Experiment. Before class in
week 2 (yellow; Table 1), the instructor picks nutrient sources
to test. We recommend using primarily sources that will al-
ready be contained in the complete medium (Appendix 1). In
class on week 2, the instructor assigns nutrients to students
with a maximum of 96 total wells across all students so that
the counts can be done in a single 96-well plate for flow
cytometry. Instructors scale the number of wells and nutrient
sources per student based on the number of students in the
course. The instructor supervises students while they create
assigned nutrient stocks for their minimalmedia experiment in
class. The instructor also assigns the minimal media presenta-
tion in Appendix 6 to students.
Week 3: Continue Minimal Media Experiment. Before class
in week 3 (yellow; Table 1), artificial seawater medium (ASM;
Appendix 1) is prepared if the students did not complete that
task in class in week 2 (Appendix 3). The ASM is prepared
without any organic carbon, nitrogen, or sulfur sources other
than vitamins (Appendix 1; e.g., JW1, excluding amino acids,
miscellaneous carbon and nitrogen [C&N] mix, and fatty
acids). In class, to ensure sterile technique is practiced, the in-
structor supervises the students’ work in the biosafety cabinet
as they distribute ASM and nutrients into wells and inoculate
the minimal media experiment. Afterwards, the instructor
provides an example of scientificcommunication(suchasa
podcast or TED Talk) and guides the students in a discussion
about whether the communication was effective using part 1
of Appendix 7. The instructor then assigns part 2 of Appendix
7andthefirstwriting assignment(Appendix 8)tostudents.
Week 4: Temperature Experiment. Before class in week 4
(green; Table 1), the instructor creates additional growth
medium for the organism (containing all components) and
ensures that all flasks have gone through the dishwashing
protocol (Appendix 18) and are filled with 50mL medium in
preparation for the temperatureexperiment.Lastly,instruc-
tors set incubators at least 24h before class at various tem-
peratures for the upcoming temperature experiment. In week
4’sclassperiod,theinstructorevaluatesstudentminimalmedia
presentations. Afterwards, the instructor leads a discussion
about which temperatures would be ecologically relevant to
test based on the organism studied. Students are assigned to
temperature experiments so there is replication in the data.
The instructor supervises the students’ work in the biosafety
cabinet as they inoculate the experiments to ensure sterile
technique is being practiced. The instructor assigns the second
writing protocol (Appendix 9) then obtains a t0 cell count
sample from each flask and stores the flasks at discussed tem-
peratures. After class, the instructor then obtains cell counts
from the flasks at regular time points (e.g., once per day for
organisms with a 7–10-daygrowth curve).The instructorfixes
each sample in 3% glutaraldehyde and counts once at the end
of the growth curve. At the end of the growth period, the in-
structor gathers the data into a comma-separated file (.csv)
forstudentstoplotthe data inRstudio.
Week 5: Continue Minimal Media Experiment. Immediately
before class in week 5 (yellow; Table 1), the instructor per-
forms cell counts on the minimal media plate 1 and prepares
mediumwithoutaddednutrientsasnotedabove. In class,the
instructor supervises the students’ work inthe biosafety cab-
inet to ensure sterile technique is practiced as the students
transfercultures from minimal media plate 1 to plate 2. After
the transfers, the instructor arranges students into groups in
which they present their elevator pitches to each other
(Appendix 7). If possible, students are recorded so they can
better evaluate their own communication style. After class,
the instructor provides instructions on installing the pro-
gramming language R and Rstudio (Appendix 10). They also
provide the temperature growth cell count data and a basic
structure of the Growth Curve Graphing Code with annota-
tions of the functionality of each line such as that found in
Appendix21tousethefollowing week.
Week 6: Bacterial Growth. In class on week 6 (light blue;
Table 1), the instructor displays Rstudio with an example
code and plots the measured temperature data with stu-
dents. This should include a line-by-line explanation of what
the code does and real-time troubleshooting with students
as they follow along. They also assign the second homework
of plotting growth curves (Appendix 11).
Week 7: Continue Minimal Media Experiment. Immediately
before class on week 7 (yellow; Table 1), the instructor uses
flow cytometry to count the minimal media plate 2 and pre-
pares minimal media plate 3 as above. In class week 7, the in-
structor supervises the students’ work in the biosafety cabi-
net to ensure sterile technique is practiced as they transfer
from minimal media plate 2 to plate 3. The instructor leads a
discussion on physical or electronic examples of posters for
students to evaluate in preparation of their own poster
BACTERIOPLANKTONCHARACTERIZATIONCURE JOURNALOFMICROBIOLOGYANDBIOLOGYEDUCATION
August2022 Volume23 Issue2 10.1128/jmbe.00068-22 4
Downloaded from https://journals.asm.org/journal/jmbe on 13 February 2023 by 2603:8000:c100:c8b0:e0c2:5c4e:a418:ed38.
73
design and assign the third homework assignment of poster
critique(Appendix12).
Week 8: Bacterial Growth Continued. In class on week 8
(light blue; Table 1), the instructor guides students to calcu-
late growth rates from the temperature experiment and
review the basic structure of the Growth Rate Graphing
Code using annotations for each line of code in Appendix
22. The instructor displays Rstudio with an example code
and plots the provided data with students as previously
described under week 6. They also assign the fourth home-
work assignment of plotting growth rates (Appendix 13).
Week 9: Salinity experiment. Before class on week 9 (pur-
ple; Table 1), media of varying ecologically relevant salinities to
the organism being studied are created. The instructor assigns
students to salinity experiments so that there is replication in
the tested conditions. Our media is extremely adaptable—we
used salinities 34.8, 23.2, 11.6, and 5.8 corresponding to me-
dium recipes MWH 1–4(orJW1–4) (Appendix 1), respec-
tively, for isolates from the Gulf of Mexico. Ahead of class, the
125mL cleaned and autoclaved flasks should be filled with
50mL of the different media types to match the number of
replicates per condition. In class during week 9, the instructor
supervises the students’ work in the biosafety cabinet to
ensure sterile technique is being observed as the students in-
oculate the salinity experiment. Once the experiment has
been inoculated, the instructor immediately obtains a t0 cell
count, then again at regular time points matching that of the
corresponding temperature experiment in week 4. At the end
of the growth period, the instructor gathers the data into a
comma-separated file (.csv) for students to plot in RStudio.
The instructor assigns the final writing and poster assignments
(Appendices14and15)tostudents.
Weeks 10–12: Data Communication and Semester Wrap-Up.
Before class on week 10 (gray corresponding to weeks 10 to
12; Table 1), the instructor provides students the salinity
growth data and assigns them to plot growth and calculate
growth rates. The instructor also gathers a list of student
generated data that includes all tables, growth curves, and
growth rate plots. In class week 10, the instructor allows stu-
dents the class time to make and receive feedback on poster
outlines and figures. In week 11, the instructor evaluates stu-
dent poster presentations in class using a rubric such as the
one in Appendix 15. Note: Although a physical poster presen-
tation symposium would be ideal, in practice we did not print
studentpostersforin-classpresentationsandinsteaddisplayed
posters on a projector. Ideally, students focus their presenta-
tion on the discussion and future direction sections of their
posters since they generally have the same experimental data
with varying interpretations and connections to larger litera-
ture.After presentations, the instructor allows questions for a
final exam review and gives students time for informal writing
2(Appendix16).Beforeclassonweek12,theinstructorpre-
pares the final exam and optional practical stations (see exam-
plefinalin Appendix 24), then proctorsthefinalexam in week
12. The poster symposium should happen after the final exam
week and after students are given a chance to edit and print
their posters postfeedback from presentations. In our case,
multiple types of CURE courses joined together in a sympo-
sium in which 2–3postersfromeachsectionwerechosento
print and present while other students attended to give and
receive presentation feedback.
Suggestionsfordeterminingstudentlearning
Student learning can be determined through both tradi-
tional methods such as in-class quizzes (Appendix 23) and a
final exam (Appendix 24), but also through communication-
based assessments of learning that were highlighted and
included in informal and final writings (Appendices 4, 14,
16), presentations (Appendices 6, 7, 15), a final lab report
(Appendices 26–27), which can be used in conjunction with
or in place of a final exam, and a final poster (Appendix 15).
Relationships of assessments and course learning objectives
can be found in Table 2, and answer keys and rubrics are
TABLE2
Studentlearningoutcomesandtheirrespectiveassessments
Learningoutcome Assessments
1.Find,read,andinterpretrelevantprimaryscientificliterature Presentation1,Elevatorpitch,Finalwriting(Appendices6,7,14)
2.Usesteriletechniqueforproperhandlingofbacterialisolatesin
liquidmedia
Successfulcompletionoftheprotocols,Finalexam(Appendix24)
3.Determineanddisplayphysiologicaltraitsofaquatic
bacterioplankton
Successfulcompletionoftheprotocols,Homework#2,
Homework#4(Appendices11and13)
4.CompletebasiccomputerscriptingwithRtoplotgrowthdata
Successfulcompletionoftheprotocols,Homework#1,
Homework#2,Homework#4,Poster(Appendices10,11,13,15)
5.Linkresearchresultstopubliclyavailableecologicaland
environmentaldata
Finalwriting,Poster,LabReport(Appendices14,15,26,27)
6.Communicateresearchmethodsandresultstoscientificand
nonscientificaudiencesusingposters,writing,andsocialmedia
Poster,Elevatorpitch,Writingassignments,Presentations,Twitter
participation(Appendices15,7,8,9,14,6,5)
BACTERIOPLANKTONCHARACTERIZATIONCURE JOURNALOFMICROBIOLOGYANDBIOLOGYEDUCATION
August2022 Volume23 Issue2 10.1128/jmbe.00068-22 5
Downloaded from https://journals.asm.org/journal/jmbe on 13 February 2023 by 2603:8000:c100:c8b0:e0c2:5c4e:a418:ed38.
74
provided in the appendices. There are multiple sets of
quizzes, broken down by semester. There were five post-
lab quizzes in 2018 that tested students on material covered
in the previous lab section. In 2020 and 2021, there was a
mix of 10 pre- and postlab quizzes (Appendices 26–27).
Sampledata
Some combination of the following elements: (i) minimal
media table, (ii)temperaturegrowth curves/rates,and(iii) sa-
linity growth curves/rates were produced for five isolates:
LSUCC0112, LSUCC0117, LSUCC0135, LSUCC0713, and
US3C007 (Appendix 28). All isolates remained axenic except
LSUCC0112, which became contaminated sometime through-
out the semester (see Discussion). Although the students had
never worked with bacterial cultures prior to this course, the
growth curve data exhibited good reproducibility evidenced by
the overlapping growth data that was produced by different stu-
dents and different sections. Example results for each data type
can be found in Fig. 1 and Appendix 28. For instance,
LSUCC0135 had a growth temperature range of 12°C–40°C
with an optimum near 24°C. Its salinity range was 5.8–23.2, and
the optimum salinity was undetermined but somewhere
between 5.8 and 11.6. LSUCC0135 could grow on all carbon
sources after two transfers. LSUCC0117 had a temperature
range of 12°C–33°C with an optimum at 24°C.Its salinity range
was 5.8–34.8 and the optimum was 11.6. LSUCC0117 could use
the following carbon sources: leucine, lysine, methionine, gluta-
mate,succinate,sucrose,serine,andfolicacid(Appendix28).
Safetyissues
There are no biological safety issues in this laboratory if
BSL1 strains are selected for investigation. If completely
unknown strains are used, BSL2 protocols should be fol-
lowed according to the JMBE Biosafety Guidelines for
Handling Microorganisms in the Teaching Laboratory (21),
which would also require that students be proficient in han-
dling BSL1 strains first. Faculty should be careful with the
use of glass and diluted acid for dishwashing protocols and
glutaraldehyde if used forcell fixation.
DISCUSSION
Fieldtesting
We deployed this CURE during the fall 2018 semester at
Louisiana State University with three graduate teaching
instructors for six sections, totaling 147 students. The two
sections that characterized LSUCC0135 were in Biology
1207 Honors: Biology Laboratory for Science Majors and
had 46 students, while the other four sections working
with LSUCC0112 and LSUCC0117 were in 1208 Biology
Laboratory for Science Majors and had 101 students in total.
We also deployed this course at the University of Southern
California during spring 2020 and fall 2021 semesters of BISC
221 and 121 Advanced General Biology, in two sections each
that had 18 and 22 students enrolled total, respectively.
spring 2020 students characterized LSUCC0713 and fall
2021 students characterized US3C007. Thus, the curriculum
has been utilized with a total of 187 students across 10 sec-
tionsof two differentbiologycourses attwo universities.
Data produced by these deployments produced mixed
results. Example outcomes are detailed in Appendix 28, which
shows growth rate data for multiple strains across the differ-
ent deployments, and one of the minimal media experiments,
which in this deployment was restricted to testing carbon
sources only. In some cases, e.g., growth optima data for iso-
lates, minimal media experiment for LSUCC0117, results
were very reproducible across students and yielded publish-
able quality outcomes (Fig. 1, Appendix 28). Alternatively, the
sections culturing LSUCC0112 contaminated the culture
(detected via post course 16S rRNA gene PCR [20]), and the
minimal media experiments for US3C007 failed (no growth in
the positive control). Thus, as in all real research, some of the
experiments worked, whereas others did not and will need to
be repeated. Failed experiments offer just as much, if not
more, teaching opportunity since instructors can involve stu-
dents in determination of whether and how the experiment
failed, discuss the value of controls for evaluating experimental
success, and contextualize this more broadly in the utility of
the scientific method. More importantly, the field testing dem-
onstrated that the curriculum engages students to produce re-
producible, publishable data in multiple differentsettings.
Evidenceofstudentlearning
We provide evidence of student learning through multi-
ple means: grade distributions that reflect major assess-
ments and overall course progress (Fig. 2), experimental
results from the students showing successful completion of
the protocols and execution of R code (Fig. 1, Appendix
FIG 1. Growth data for strain LSUCC0135 at different temperatures,
indicated in the strip above each plot in °C. Cell concentration is
plotted against time and each replicate has a different color.
BACTERIOPLANKTONCHARACTERIZATIONCURE JOURNALOFMICROBIOLOGYANDBIOLOGYEDUCATION
August2022 Volume23 Issue2 10.1128/jmbe.00068-22 6
Downloaded from https://journals.asm.org/journal/jmbe on 13 February 2023 by 2603:8000:c100:c8b0:e0c2:5c4e:a418:ed38.
75
28), and examples of outcomes from student assignments
(Table 3, Appendices 28–30).
The grade distributions across the 10 sections reflect
the variations in success of students in multiple different
settings. Quizzes at LSU tested the major concepts covered
in a previous lab, whereas those at USC were either pre- or
postlab quizzes, testing either conceptual preparation for
the upcoming lab or knowledge gained in the previous lab,
respectively. Most students did very well on these quizzes;
most students in the majority of labs had aggregate scores
of As or Bs. Scores on the final exams, which were compre-
hensive tests of the skills learned during the semester,
including protocols, calculations, experimental design, fun-
damentals of microbiology, reading comprehension, and
data analysis, also reflected strong student performance in
most sections. Grades from the elevator pitch and poster
demonstrated that most students did very well learning to
communicate their science effectively in an oral or multime-
dia format. Similarly, students achieved success with written
communication of lab findings and contextualization of their
research, as evidenced by the strong grades in most sec-
tions for the Final Writing (LSU) or Lab Report (USC).
Excerpts of writing and associated scoring can be found in
Table 3, and a representative poster is provided in Appendix
30. We also provide qualitative examples of student reflec-
tions on their learning experience (resulting from informal
writing assignments; Appendices 4 and 16) that self-report
several skills gained from the course (Appendix 29).
The research outcomes also demonstrate student learn-
ing since the successful completion of the protocols yielded
reproducible experimental outcomes. In addition, the data vis-
ualization depicting the experimental results demonstrated
learning because the students had to develop skills in the pro-
gramming language R to manipulate and execute scripts using
real data as input. Examples of these research products, which
alsocontain theunderlyingresultsanddemonstratetherepro-
ducibilityofstudentwork,areinAppendix28.
Possiblemodifications
Since the course was deployed at different universities, it
has already been tested with a few modifications with regard
to activities and assessments (Appendices 26–27). For exam-
ple, a lab report was added for the USC deployments in
USC
13190
USC
13192
USC
13193
USC
13195
LSU
1
LSU
2
LSU
45
LSU
46
LSU
47
LSU
48
0 25 50 75 100 0 25 50 75 100 0 25 50 75 100 0 25 50 75 100
0 25 50 75 100 0 25 50 75 100
Overall
FinalExam
LabReport
Poster
FinalWriting
ElevatorPitch
Quizzes
Overall
FinalExam
LabReport
Poster
FinalWriting
ElevatorPitch
Quizzes
PercentageofStudents,bysection
Grade
A
B
C
D
F
FIG 2. Grade distributions for major assignments and overall course scores. Each section is plotted separately by university and is
denoted below the university designation. Grades according to an A, B, C, D, F scale are colored according to the key. The number of
students by section were as follows: 1, n=23; 2, n=23; 45, n=28; 46, n=26; 47, n=23; 48, n=24; 13190, n=10; 13192, n=8; 13193,
n=11; 13195, n=11.
BACTERIOPLANKTONCHARACTERIZATIONCURE JOURNALOFMICROBIOLOGYANDBIOLOGYEDUCATION
August2022 Volume23 Issue2 10.1128/jmbe.00068-22 7
Downloaded from https://journals.asm.org/journal/jmbe on 13 February 2023 by 2603:8000:c100:c8b0:e0c2:5c4e:a418:ed38.
76
exchange for the Final Writing assignment that was done at
LSU. The Lab Report was used in conjunction with a Final
Exam in spring 2020, but we have since dropped the Final
Exam in favor of only using the Lab Report beginning in fall
2021. Fall 2021 also saw implementation of a phytoplankton
microscopy lab (Appendix 27) that can add another perspec-
tive for students and potentially enrich their experience.
Details for all course modifications between the USC and LSU
deploymentsareavailableinAppendices26 and27.
We can envision several other modifications. We have so
faronlytestedthecourseonasemesterschedule,butthecur-
riculum could be adapted to a quarter or a trimester system
by combining the temperature and salinity growth experi-
ments into a single lab period, orcombining the data round-up
lab for the temperature experiment with the salinity inocula-
tion lab. In addition, the time for all experiments is dependent
onthedoublingtimeoftheculture,sousingastrainthatcom-
pletes a growth curve in<7–10days could shorten the incuba-
tion periods for theminimalmedia experiment.
Another attractive modification would be to teach stu-
dents how to use the flow cytometer for growth measure-
ments.This could only be donewith a smallerclass sizedueto
the setup and run times, the expense of the equipment, and
the close supervision required for undergraduates. If the
institution does not have access to a flow cytometer, cell
counts could be conducted with a plate reader, via direct cell
counts (microscopic counts), or via viable plate counts if the
cells will grow on agar plates. If the institution does not have
access to a full biosafety cabinet, a clean laminarflow worksta-
tionoraportablePCRhoodcouldworkforsterility.
Thiscoursecouldalsobemodifiedtoinvolvethestudents
inmoreofthepreparationsteps.Eachsection/instructorcould
take responsibility for one portion of the characterization
(minimal media, temperature, or salinity) so that students
could complete such tasks as making media, making stocks,
performing cell counts, providing input on experimental
design, dishwashing, etc. This would allow for more robust
data-sharing and collaboration between students. Lastly, stu-
dents could be exposed to the bioinformatic side of thework-
flow in a more comprehensive way by using techniques and
surveyshighlightedinrecentpublications(22).
SUPPLEMENTALMATERIAL
Supplemental material is available online only.
SUPPLEMENTALFILE1,PDFfile,5.1MB.
TABLE3
Examplesofstudentwritings
Excerptsabouttheculturedorganismsfromstudents’finalwriting
Excellent
"24°Cactedastheoptimumtempfortheorganismtosurvivein,asmultiplereplicatesof
[LSUCC0]117testedintheenvironmentshowedexponentialgrowthinashortperiodoftime,as
wellasashortlagphasepriortoexperiencingitslogphase.Thisismorethanlikelyduetothefact
that24°CisrelativelyclosetothetempoftheGulfofMexicothroughoutayr.40°Cwastoohot
fortheorganismtosurvivein,soitscellseitherdidnotreplicateordiedduetothetempcausing
themicrobe’senzymestodenature,eventuallykillingitsbodilyfunctionsanditintheprocess.”
Mentions features of graphed data; relates physiology to ecology; explains whyphysiological tolerances
have limits; student uses qualifying terms when data is not absolute.
Good
ThetempexptshowedthatLSUCC0117cangrowintemperaturesrangingfrom12°C,24°C,and
33°C.ThetempoftheGulfofMexicoisusuallyaround20°Cto23°CoffthecoastofLouisiana.It
isimportantthatLSUCC0117cangrowintemperaturesfarbelowandfarabovethenorm
becauseifthewatereversuddendlyhadaspikeordropintempthebacteriawouldstillbeableto
growandthrive.
ThesalinityexptshowedthatLSUCC0117cangrowinalargevarietyofsalinitiesandthisisan
importantcharacteristicofthisorganismbecauseitiswhatallowsittosurviverightoffthecoast
oflouisiana.ThesalinityofthewateriscontinouslychangingasitrainsandtheMississippiRiver
flowsintotheGulfofMexico.”
Briefly, but accurately, describes organism physiology; explicitly connects physiology to ecology; several
spelling errors; does not cite source for Gulf of Mexico temp.
NeedsImprovement
“Theoptimaltempwas24degreeswith33beingacceptableaswell.Thesalinitylevelsallproved
tobeacceptable,butJW3wasthebestoption.Therewereafewbacteriawellsthatdiedoff
regardless.Thiscanbeblamedonthechangeinlocationassomebacteriadeathcanbecausedby
significantintra-andinterannualchemicalfluxes,therebycreating ‘vintages’fromspecificsample
collectionsthatcanpreventreproduciblegrowthorrepeatedtransfers(Hensonetal.).The
results,nonetheless,supportedthehypothesisofthebacteriagrowingoptimallyintemperatures
andsalinitylevelsthatmimictheGulfofMexico.”
Relates physiology to ecology; accurately references collected data; does not utilizes correct unit symbols;
uses an incorrect reference to explain a phenomenon not relevant to the expt.
BACTERIOPLANKTONCHARACTERIZATIONCURE JOURNALOFMICROBIOLOGYANDBIOLOGYEDUCATION
August2022 Volume23 Issue2 10.1128/jmbe.00068-22 8
Downloaded from https://journals.asm.org/journal/jmbe on 13 February 2023 by 2603:8000:c100:c8b0:e0c2:5c4e:a418:ed38.
77

ACKNOWLEDGMENTS
We thank Louisiana State University College of Science
Dean Cynthia Peterson and our instructor of record, Chris
Gregg, for their support of this course and the CURE
program at LSU, and the staff with LSU’s Communication
Across the Curriculum (CxC) program and Becky
Carmichael for her presentations about effective posters
and scientific communication. LSU undergraduate teaching
assistants Joyti Prajapati, Olivia Drago, and Zoe Long
assisted with in-class activities. Brooke Trebona helped run
the poster symposium. We thank LUMCON and the crew
on board the R/V Pelican for facilitating an educational
research cruise. We thank University of Southern California
staff Linda Bazilian, Gorjana Bezmalinovic, Arunima Kolekar,
and Brett Spatola for their support of this course and the
CURE program at USC as well as Chuankai Cheng for
assistance with the fall 2021 course. Most of all, we thank
the LSU and USC students that participated in this course.
Their enthusiasm, drive, and feedback were instrumental in
thedevelopmentandsuccessofthiscourse.
Funding for this work was provided by a National
Academies of Science, Engineering, and Medicine Gulf
Research Program Early Career Fellowship and National
ScienceFoundationBiologicalOceanographyAwards(OCE-
1747681andOCE-1945279)toJ.C.T.
REFERENCES
1. Hathaway RS, Nagda BA, Gregerman SR. 2002. The relation-
ship of undergraduate research participation to graduate and
professional education pursuit: an empirical study. J Coll Stud
Dev43:614–631.
2. Seymour E, Hunter A-B, Laursen SL, DeAntoni T. 2004.
Establishing the benefits of research experiences for under-
graduatesinthesciences:firstfindingsfromathree-yearstudy.
SciEd88:493–534.https://doi.org/10.1002/sce.10131.
3. Russel GM.2008.Buildingbridgesbetweenresearchandprac-
tice:teachingqualitativeresearch.PsycEXTRADatasethttps://
doi.org/10.1037/e549322009-005.
4. Graham CR. 2013. Emerging practice and research in blended
learning.HandbookofDistanceEducation3:333–350.
5. Linn MC, Palmer E, Baranger A, Gerard E, Stone E. 2015.
Undergraduateresearchexperiences:impactsandopportunities.
Science347:1261757.https://doi.org/10.1126/science.1261757.
6. Shapiro C, Moberg-Parker J, Toma S, Ayon C, Zimmerman H,
Roth-Johnson EA, Hancock SP, Levis-Fitzgerald M, Sanders ER.
2015. Comparing the impact of course-based and apprentice-
based research experiences in a life science laboratory curricu-
lum. J Microbiol Biol Educ 16:186–197. https://doi.org/10.1128/
jmbe.v16i2.1045.
7. Thompson SK, Neill CJ, Wiederhoeft E, Cotner S. 2016. A
model for a course-based undergraduate research experience
(CURE) in a field setting. J Microbiol Biol Educ 17:469–471.
https://doi.org/10.1128/jmbe.v17i3.1142.
8. Bangera G, Brownell SE. 2014. Course-based undergraduate
research experiences can make scientific research more inclu-
sive. CBE Life Sci Educ 13:602–606. https://doi.org/10.1187/
cbe.14-06-0099.
9. Whitman WB, Coleman DC, Wiebe WJ. 1998. Prokaryotes:
the unseen majority. Proc Natl Acad Sci U S A 95:6578–6583.
https://doi.org/10.1073/pnas.95.12.6578.
10. Henson MW, Lanclos VC, Faircloth BC, Thrash JC. 2018.
Cultivation and genomics of the first freshwater SAR11
(LD12) isolate. ISME J 12:1846–1860. https://doi.org/10.1038/
s41396-018-0092-2.
11. Carini P, Steindler L, Beszteri S, Giovannoni SJ. 2013. Nutrient
requirements for growth of the extreme oligotroph “Candidatus
Pelagibacter ubique” HTCC1062 on a defined medium. ISME J
7:592–602.https://doi.org/10.1038/ismej.2012.122.
12. WagnerSC,StewartRS,Jr.2000.Microbialsafari:isolation&char-
acterization of unknowns in an introductory microbiology labora-
tory.AmBiolTeach62:588–592.https://doi.org/10.2307/4450983.
13. Finer KR, Fox L, Finer JJ. 2016. Isolation and characterization
of Agrobacterium strainsfromsoil: alaboratorycapstone expe-
rience. J Microbiol Biol Educ 17:444–450. https://doi.org/10
.1128/jmbe.v17i3.1124.
14. Woeste S, Demchick P. 1996. A slow bacterial growth curve
exercise for laboratory classrooms. J Biol Educ 30:91–92.
https://doi.org/10.1080/00219266.1996.9655484.
15. Paulton RJL. 1991. The bacterial growth curve. J Biol Educ
25:92–94.https://doi.org/10.1080/00219266.1991.9655183.
16. Saggers BA, Thomas M. 1980. The use of Beneckea natriegens for
practical exercises in microbiology and biochemistry. J Biol Educ
14:256–262.https://doi.org/10.1080/00219266.1980.9654305.
17. Bakshi A, Patrick LE, Wischusen EW. 2016. A framework for
implementing course-based undergraduate research experien-
ces (CUREs) in freshman biology labs. Am Biol Teach 78:448–
455.https://doi.org/10.1525/abt.2016.78.6.448.
18. BakshiA,WebberAT,PatrickLE,WischusenW,ThrashC.2019.
The CURE for cultivating fastidious microbes. J Microbiol Biol
Educ20:10.https://doi.org/10.1128/jmbe.v20i1.1635.
19. SchroederS,AmendJ.2018.Effectivestrategiesforengagingcom-
munity college students in research via cutting-edge technology.
MarTechnolSocj52:28–32.https://doi.org/10.4031/MTSJ.52.1.5.
20. Henson MW, Pitre DM, Weckhorst JL, Celeste Lanclos V,
Webber AT, Cameron Thrash J. 2016. Correction for Henson
etal.,artificialseawatermediafacilitatecultivatingmembersof
the microbial majority from the Gulf of Mexico. mSphere 1:
e00124-16.https://doi.org/10.1128/mSphere.00124-16.
21. Emmert EAB, ASM Task Committee on Laboratory Biosafety.
2013. Biosafety guidelines for handling microorganisms in the
teaching laboratory: development and rationale. J Microbiol
BiolEduc14:78–83.https://doi.org/10.1128/jmbe.v14i1.531.
22. Farrell KJ, Carey CC. 2018. Power, pitfalls, and potential for inte-
gratingcomputationalliteracyintoundergraduateecologycourses.
EcolEvol8:7744–7751.https://doi.org/10.1002/ece3.4363.
BACTERIOPLANKTONCHARACTERIZATIONCURE JOURNALOFMICROBIOLOGYANDBIOLOGYEDUCATION
August2022 Volume23 Issue2 10.1128/jmbe.00068-22 9
Downloaded from https://journals.asm.org/journal/jmbe on 13 February 2023 by 2603:8000:c100:c8b0:e0c2:5c4e:a418:ed38.
78

CONCLUDING REMARKS
This dissertation combines cultivation-independent and cultivation-dependent
methodologies to more clearly understand the SAR11 IIIa and CHAB-I-5 clades of the
Alphaproteobacteria, as well as provides a framework of a CURE curriculum for enhancing
undergraduate research experience in the classroom. We provide some of the first physiology of
the SAR11 IIIa and Roseobacter CHAB-I-5 groups to validate hypotheses generated from other
studies in the literature as well as provide new genomes and isolated representatives for others to
build upon this work.
The analysis of SAR11 IIIa in Chapter 1 represents the first systematic study of SAR11
IIIa that defines not only what separates IIIa from other SAR11, but also explores the diversity of
the members within IIIa. We demonstrated that genomic features such as the synthesis of storage
granules, glycine/serine prototrophy, and a gap in thiamine metabolism all are characteristic of
the clade while showing the first differential availability of features such as urease usage, a
bicarbonate transporter, and osmolytes within IIIa. We defined SAR11 subgroup IIIa.3 as a true
brackish group within SAR11 that is contradictory to a hypothesis suggesting brackish
communities are simply a mix of marine and freshwater taxa rather than obligate to brackish
waters. Interestingly, the ecological distribution of IIIa.1 and IIIa.3 is not simply due to a
physiological incapability of growth in nearly fresh or marine salinities. The growth rates for the
two isolates studied do reflect their ecology with IIIa.1 isolate having a higher growth rate in
marine salinities while IIIa.3 has a higher growth rate in brackish salinities. The difference in
growth capability and ecological distribution indicates that salinity is likely a factor in the
ecology, but is not likely the sole factor. Nutrient compounds, pH, respiration rates, or perhaps
79
cofactor availably likely play a role in IIIa ecology. Continued efforts to characterize the isolates
within IIIa is important to understand which environmental factors drives the shift in abundance
of different members of IIIa. We were able to verify with physiology that IIIa is not reliant on
external glycine or serine as other SAR11 members are, as well as that IIIa.3’s urease gene suite
is likely functional as the culture could grow with urea as a sole carbon source. During the course
of this project, I attempted to further characterize nutrient dynamics in IIIa isolates. I attempted
stoichiometry experiments to see if the changes in carbon and nitrogen concentrations or sources
could affect the max cell density and growth rate of IIIa isolate LSUCC0261 with the purpose of
quantifying the impact of this organism on nitrogen and carbon cycling in estuaries. These
experiments were interrupted with moving the lab across the country, then again with the
COVID-19 pandemic, and they could not be continued upon return to the laboratory due to the
timeline of my dissertation. Interestingly, the preliminary data collected between interruptions
was puzzling. I found that I could not reliably kill the culture through carbon starvation for a
negative control when carbon was the only nutrient changed from the isolation medium. After
multiple attempts from various lab members, we currently hypothesize that the genomic potential
of polyhydroxyalkanoate storage granules might be the cause for this. The conservation of these
storage granules in both LD12 and IIIa is puzzling. LD12 is dominant in freshwater and IIIa is
dominant in brackish systems that are oftentimes nutrient dense. Generally, these granules are
thought to be used as a reservoir for carbon that is stored when carbon is high but another
nutrient is low (1). This function doesn’t seem likely in the estuaries and brackish systems that
IIIa dominates. Future work to understand the conditions in which IIIa/LD12 produce storage
granules is ongoing in our group.
80
For Chapter 2, we were able to use our new circularized isolate genome as well as the
largest selection of public CHAB-I-5 genomes to define two species separated by phylogenomics
and average nucleotide identity. We identified US3C007 as the top recruiting genome of the
cluster, demonstrating it as the ideal candidate for physiological characterization in the cluster.
We provide microscopy showing pleiomorphism in US3C007 and tested its growth capabilities
across salinities, temperatures, and carbon concentrations. This study most importantly
contributes a highly sought-after component of data – a reliably propagated CHAB-I-5
representative isolate in artificial seawater medium. Multiple other studies have tried and failed
to successfully propagate a CHAB-I-5 representative (2, 3) to gain even the fundamental
physiology data that we report here such as growth rates, temperature and salinity tolerance, and
microscopy. US3C007 is currently the only isolated representative that is in a complex and
defined artificial seawater medium. The other existing isolate, FZCC0083, is in natural seawater
that is amended with nutrients (4). The existence of US3C007 in artificial seawater medium
allows future research to set US3C007 as the model representative isolate for CHAB-I-5
characterization. One important metabolic pathway that CHAB-I-5 is known to possess and is
noted in activity studies of the clade is aerobic anoxygenic photosynthesis (AAnP) (2, 5). This
metabolism allows bacteria to use a version of photosynthesis that does not produce oxygen and
uses an alternative electron donor such as thiosulfate (6). CHAB-I-5’s abundance in the global
oceans paired with high activity of its AAnP pathways makes it very important to understand the
conditions in which it switches from heterotrophic growth to light-supplemented growth as well
as the rates at which it grows under both conditions. While I did not have the time during my
dissertation to explore these dynamics, it is a crucial next topic of pursuit for future research as
81
these data would dramatically help in the quantification of nutrient dynamics and
biogeochemical cycling for the CHAB-I-5 cluster.
Lastly, we integrated our physiology experimentation with classroom education using a
CURE curriculum that reached 147 students. Through their coursework, students were able to
provide preliminary temperature, salinity, and carbon usage information for a range of
environmentally-relevant bacterial isolates as well as gain valuable skills in the collection and
analysis of never-before tested data. Additionally, we provide the framework for this curriculum,
a laboratory manual, as well as all supporting documents needed for implementation in an open-
source manner available for any educator to use. The benefits of this framework were
immediately apparent in its execution. Students who participated in the University of Southern
California’s (USC) curriculum were taught by another graduate student in our department who
was able to implement this curriculum while modifying aspects of it to their own interests. This
exposed students to multiple specializations within microbial ecology and directly allowed
collaborations between research groups in pursuit of the generation and interpretation of data that
is realistic in scientific research. These students directly aided in the physiological
experimentation of US3C007 presented in Chapter 2. Their temperature and salinity data
provided helpful boundary conditions for my later experimentation as well as additional
replication in the datapoints that overlapped. Though I was not the teaching assistant during the
USC implementation, multiple groups of students met with me throughout the semester to
collaborate in explaining the unusual cell morphology exhibited by US3C007. While we were
ultimately unsuccessful in finding an explanation for one morphology, the students’ eagerness to
comb the literature outside of course requirements displayed their attachment to the project. This
attachment and positive attitude towards undergraduate research within a university course is a
82
highly beneficial aspect of these CURE curriculums. Future implementation of the curriculum
could benefit in a shifting of scheduling for the course. Our iterations have been during three-
hour meetings once a week. While this is typical of laboratory sections on a semester schedule, it
does prevent the students from gathering the daily timepoints that are frequently needed for
bacterial physiology measurements and shifts the hands-on aspect of the course to be more
focused on setting up experiments and analyzing resulting data. This causes the teaching
assistant to be the primary daily collector of datapoints such as cell counts. A shift in the
curriculum to multiple shorter meetings during a week would aid in student ability to perform
more aspects of the research and interact more directly with the non-standard laboratory
instruments.
Overall, this dissertation is a combination of cultivation-independent, cultivation-
dependent, and curriculum-based undergraduate research experimentation that has aided in the
understanding of multiple important and understudied groups of bacterioplankton in global
oceans. It sets the framework for future characterization of these groups to create model
environmental organisms in brackish and pelagic systems that will aid in our understanding of
microbial contributions to global oceanic biogeochemistry.

83

References-Concluding Remarks
1. Obruca S, Sedlacek P, Koller M, Kucera D, Pernicova I. 2018. Involvement of
polyhydroxyalkanoates in stress resistance of microbial cells: Biotechnological
consequences and applications. Biotechnol Adv 36:856–870.
2. Billerbeck S, Wemheuer B, Voget S, Poehlein A, Giebel H-A, Brinkhoff T, Gram L,
Jeffrey WH, Daniel R, Simon M. 2016. Biogeography and environmental genomics of
the Roseobacter-affiliated pelagic CHAB-I-5 lineage. Nat Microbiol 1:16063.
3. Yang S-J, Kang I, Cho J-C. 2016. Expansion of Cultured Bacterial Diversity by Large-
Scale Dilution-to-Extinction Culturing from a Single Seawater Sample. Microb Ecol
71:29–43.
4. Zhang Z, Wu Z, Liu H, Yang M, Wang R, Zhao Y. Genomic analysis and
characterization of phages infecting the marine Roseobacter CHAB-I-5 lineage reveal a
globally distributed and abundant phage …. Front Microbiol.
5. Zhang Y, Sun Y, Jiao N, Stepanauskas R, Luo H. 2016. Ecological Genomics of the
Uncultivated Marine Roseobacter Lineage CHAB-I-5. Appl Environ Microbiol 82:2100–
2111.
6. Yurkov VV, Beatty JT. 1998. Aerobic anoxygenic phototrophic bacteria. Microbiol Mol
Biol Rev 62:695–724.

84
BIBLIOGRAPHY

Ahmed, M. A., Lim, S. J., & Campbell, B. J. (2021). Metagenomes, Metatranscriptomes, and
Metagenome-Assembled Genomes from Chesapeake and Delaware Bay (USA) Water
Samples. Microbiology Resource Announcements, 10(21), e0026221.
Alneberg, J., Bennke, C., Beier, S., Bunse, C., Quince, C., Ininbergs, K., Riemann, L., Ekman,
M., Jürgens, K., Labrenz, M., Pinhassi, J., & Andersson, A. F. (2020). Ecosystem-wide
metagenomic binning enables prediction of ecological niches from genomes.
Communications Biology, 3(1), 119.
Alneberg, J., Sundh, J., Bennke, C., Beier, S., Lundin, D., Hugerth, L. W., Pinhassi, J., Kisand,
V., Riemann, L., Jürgens, K., Labrenz, M., & Andersson, A. F. (2018). BARM and
BalticMicrobeDB, a reference metagenome and interface to meta-omic data for the Baltic
Sea. Scientific Data, 5, 180146.
Alonso-Gutiérrez, J., Lekunberri, I., Teira, E., Gasol, J. M., Figueras, A., & Novoa, B. (2009).
Bacterioplankton composition of the coastal upwelling system of “Ría de Vigo”, NW
Spain. FEMS Microbiology Ecology, 70(3), 493–505.
Alonso-Sáez, L., Galand, P. E., Casamayor, E. O., Pedrós-Alió, C., & Bertilsson, S. (2010). High
bicarbonate assimilation in the dark by Arctic bacteria. The ISME Journal, 4(12), 1581–
1590.
Alverson, A. J., Jansen, R. K., & Theriot, E. C. (2007). Bridging the Rubicon: phylogenetic
analysis reveals repeated colonizations of marine and fresh waters by thalassiosiroid
diatoms. Molecular Phylogenetics and Evolution, 45(1), 193–210.
Auchincloss, L. C., Laursen, S. L., Branchaw, J. L., Eagan, K., Graham, M., Hanauer, D. I.,
Lawrie, G., McLinn, C. M., Pelaez, N., Rowland, S., Towns, M., Trautmann, N. M.,
Varma-Nelson, P., Weston, T. J., & Dolan, E. L. (2014). Assessment of course-based
undergraduate research experiences: a meeting report. CBE Life Sciences Education,
13(1), 29–40.
Bakshi, A., Patrick, L. E., & Wischusen, E. W. (2016). A framework for implementing course-
based undergraduate research experiences (CUREs) in freshman biology labs. The
American Biology Teacher, 78(6), 448–455.
Bakshi, A., Webber, A. T., Patrick, L. E., Wischusen, W., & Thrash, C. (2019). The CURE for
Cultivating Fastidious Microbes †. In Journal of Microbiology & Biology Education
(Vol. 20, Issue 1). https://doi.org/10.1128/jmbe.v20i1.1635
Bamann, C., Bamberg, E., Wachtveitl, J., & Glaubitz, C. (2014). Proteorhodopsin. Biochimica et
Biophysica Acta, 1837(5), 614–625.
85
Bangera, G., & Brownell, S. E. (2014). Course-based undergraduate research experiences can
make scientific research more inclusive. CBE Life Sciences Education, 13(4), 602–606.
Bankevich, A., Nurk, S., Antipov, D., Gurevich, A. A., Dvorkin, M., Kulikov, A. S., Lesin, V.
M., Nikolenko, S. I., Pham, S. O. N., Prjibelski, A. D., Pyshkin, A. V., Sirotkin, A. V.,
Vyahhi, N., Tesler, G., Alekseyev, M. A. X. A., & Pevzner, P. A. (2012). and Its
Applications to Single-Cell Sequencing. 19(5), 455–477.
Bano, N., & Hollibaugh, J. T. (2002). Phylogenetic composition of bacterioplankton assemblages
from the Arctic Ocean. Applied and Environmental Microbiology, 68(2), 505–518.
Battaglia. (n.d.). Final resolution of the symposium on the classification of brackish waters.
Archo Oceanography Limnology.
Béjà, O., Aravind, L., Koonin, E. V., Suzuki, M. T., Hadd, A., Nguyen, L. P., Jovanovich, S. B.,
Gates, C. M., Feldman, R. A., Spudich, J. L., Spudich, E. N., & DeLong, E. F. (2000).
Bacterial rhodopsin: evidence for a new type of phototrophy in the sea. Science,
289(5486), 1902–1906.
Biller, S. J., Berube, P. M., Dooley, K., Williams, M., Satinsky, B. M., Hackl, T., Hogle, S. L.,
Coe, A., Bergauer, K., Bouman, H. A., Browning, T. J., De Corte, D., Hassler, C.,
Hulston, D., Jacquot, J. E., Maas, E. W., Reinthaler, T., Sintes, E., Yokokawa, T., &
Chisholm, S. W. (2018). Marine microbial metagenomes sampled across space and time.
Scientific Data, 5, 180176.
Billerbeck, S., Wemheuer, B., Voget, S., Poehlein, A., Giebel, H.-A., Brinkhoff, T., Gram, L.,
Jeffrey, W. H., Daniel, R., & Simon, M. (2016). Biogeography and environmental
genomics of the Roseobacter-affiliated pelagic CHAB-I-5 lineage. Nature Microbiology,
1(7), 16063.
Brown, M. V., & Fuhrman, J. A. (2005). Marine bacterial microdiversity as revealed by internal
transcribed spacer analysis. In Aquatic Microbial Ecology (Vol. 41, pp. 15–23).
https://doi.org/10.3354/ame041015
Brown, Mark V., Lauro, F. M., DeMaere, M. Z., Muir, L., Wilkins, D., Thomas, T., Riddle, M.
J., Fuhrman, J. A., Andrews-Pfannkoch, C., Hoffman, J. M., McQuaid, J. B., Allen, A.,
Rintoul, S. R., & Cavicchioli, R. (2012). Global biogeography of SAR11 marine bacteria.
Molecular Systems Biology, 8, 595.
Buchan, A., González, J. M., & Moran, M. A. (2005). Overview of the marine roseobacter
lineage. Applied and Environmental Microbiology, 71(10), 5665–5677.
Buchan, A., Hadden, M., & Suzuki, M. T. (2009). Development and application of quantitative-
PCR tools for subgroups of the Roseobacter clade. Applied and Environmental
Microbiology, 75(23), 7542–7547.
86
Buchan, A., LeCleir, G. R., Gulvik, C. A., & González, J. M. (2014). Master recyclers: features
and functions of bacteria associated with phytoplankton blooms. Nature Reviews.
Microbiology, 12(10), 686–698.
Button, D. K., Schut, F., Quang, P., Martin, R., & Robertson, B. R. (1993). Viability and
Isolation of Marine Bacteria by Dilution Culture : Theory , Procedures , and Initial
Results Viability and Isolation of Marine Bacteria by Dilution Culture : Theory ,
Procedures , and Initial Results. 59(3), 881–891.
Cabello-Yeves, P. J., Picazo, A., Camacho, A., Callieri, C., Rosselli, R., Roda-Garcia, J. J.,
Coutinho, F. H., & Rodriguez-Valera, F. (2018). Ecological and genomic features of two
widespread freshwater picocyanobacteria. Environmental Microbiology, 20(10), 3757–
3771.
Campbell, B. J., Lim, S. J., & Kirchman, D. L. (2022). Controls of SAR11 subclade abundance,
diversity, and growth in two Mid-Atlantic estuaries. In bioRxiv (p. 2022.05.04.490708).
https://doi.org/10.1101/2022.05.04.490708
Capella-Gutierrez, S., Silla-Martinez, J. M., & Gabaldon, T. (2009). trimAl: a tool for automated
alignment trimming in large-scale phylogenetic analyses. In Bioinformatics (Vol. 25,
Issue 15, pp. 1972–1973). https://doi.org/10.1093/bioinformatics/btp348
Carini, P., Campbell, E. O., Morré, J., Sañudo-Wilhelmy, S. A., Cameron Thrash, J., Bennett, S.
E., Temperton, B., Begley, T., & Giovannoni, S. J. (2014). Discovery of a SAR11 growth
requirement for thiamin’s pyrimidine precursor and its distribution in the Sargasso Sea.
The ISME Journal, 8(8), 1727–1738.
Carini, P., Steindler, L., Beszteri, S., & Giovannoni, S. J. (2013). Nutrient requirements for
growth of the extreme oligotroph ‘Candidatus Pelagibacter ubique’ HTCC1062 on a
defined medium. The ISME Journal, 7(3), 592–602.
Carini, P., Van Mooy, B. A. S., Thrash, J. C., White, A., Zhao, Y., Campbell, E. O., Fredricks,
H. F., & Giovannoni, S. J. (2015). SAR11 lipid renovation in response to phosphate
starvation. Proceedings of the National Academy of Sciences of the United States of
America, 112(25), 7767–7772.
Carini, P., White, A. E., Campbell, E. O., & Giovannoni, S. J. (2014). Methane production by
phosphate-starved SAR11 chemoheterotrophic marine bacteria. Nature Communications,
5, 4346.
Chaumeil, P.-A., Mussig, A. J., Hugenholtz, P., & Parks, D. H. (2019). GTDB-Tk: a toolkit to
classify genomes with the Genome Taxonomy Database. Bioinformatics .
https://doi.org/10.1093/bioinformatics/btz848
Conner Y. Kojima, Eric W. Getz, and J. Cameron Thrash. (2022). RPKM Recruitment Analysis
Pipeline. Submitted.
87
Connon, S. A., & Giovannoni, S. J. (2002). High-Throughput Methods for Culturing
Microorganisms in Very-Low-Nutrient Media Yield Diverse New Marine Isolates.
Applied and Environmental Microbiology, 68(8), 3878–3885.
Cottrell, M. T., & Kirchman, D. L. (2016). Transcriptional Control in Marine Copiotrophic and
Oligotrophic Bacteria with Streamlined Genomes. Applied and Environmental
Microbiology, 82(19), 6010–6018.
Crump, B. C., Hopkinson, C. S., Sogin, M. L., & Hobbie, J. E. (2004). Microbial biogeography
along an estuarine salinity gradient: combined influences of bacterial growth and
residence time. Applied and Environmental Microbiology, 70(3), 1494–1505.
Czech, L., Hermann, L., Stöveken, N., Richter, A., Höppner, A., Smits, S., Heider, J., & Bremer,
E. (2018). Role of the Extremolytes Ectoine and Hydroxyectoine as Stress Protectants
and Nutrients: Genetics, Phylogenomics, Biochemistry, and Structural Analysis. In Genes
(Vol. 9, Issue 4, p. 177). https://doi.org/10.3390/genes9040177
David J. Kirchman, J. M. G. (2018). Microbial Ecology of the Oceans, 3rd edition. John Wiley
& Sons, Inc.
Day, J. W., Jr, Michael Kemp, W., Yáñez-Arancibia, A., & Crump, B. C. (2012). Estuarine
Ecology. John Wiley & Sons.
Delmont, T. O., Kiefl, E., Kilinc, O., Esen, O. C., Uysal, I., Rappé, M. S., Giovannoni, S., &
Murat Eren, A. (2019). Single-amino acid variants reveal evolutionary processes that
shape the biogeography of a global SAR11 subclade.
https://doi.org/10.7554/eLife.46497.001
Di Cesare, A., Dzhembekova, N., Cabello-Yeves, P. J., Eckert, E. M., Slabakova, V., Slabakova,
N., Peneva, E., Bertoni, R., Corno, G., Salcher, M. M., Kamburska, L., Bertoni, F.,
Rodriguez-Valera, F., Moncheva, S., & Callieri, C. (2020). Genomic Comparison and
Spatial Distribution of Different Synechococcus Phylotypes in the Black Sea. Frontiers
in Microbiology, 11, 1979.
Dupont, C. L., Larsson, J., Yooseph, S., Ininbergs, K., Goll, J., Asplund-Samuelsson, J.,
McCrow, J. P., Celepli, N., Allen, L. Z., Ekman, M., Lucas, A. J., Hagström, Å.,
Thiagarajan, M., Brindefalk, B., Richter, A. R., Andersson, A. F., Tenney, A., Lundin,
D., Tovchigrechko, A., … Bergman, B. (2014). Functional tradeoffs underpin salinity-
driven divergence in microbial community composition. PloS One, 9(2).
https://doi.org/10.1371/journal.pone.0089549
Edgar, R. C. (2004). MUSCLE: Multiple sequence alignment with high accuracy and high
throughput. Nucleic Acids Research, 32(5), 1792–1797.
Eiler, A., Mondav, R., Sinclair, L., Fernandez-Vidal, L., Scofield, D., Scwientek, P., Martinez-
Garcia, M., Torrents, D., McMahon, K. D., Andersson, S. G. E., Stepanauskas, R.,
88
Woyke, T., & Bertilsson, S. (2015). Tuning fresh: radiation through rewiring of central
metabolism in streamlined bacteria. The ISME Journal, 10(January 2016), 1–13.
Emmert, E. A. B., & ASM Task Committee on Laboratory Biosafety. (2013). Biosafety
guidelines for handling microorganisms in the teaching laboratory: development and
rationale. Journal of Microbiology & Biology Education: JMBE, 14(1), 78–83.
Eren, A. M., Esen, Ö. C., Quince, C., Vineis, J. H., Morrison, H. G., Sogin, M. L., & Delmont, T.
O. (2015). Anvi’o: an advanced analysis and visualization platform for ’omics data.
PeerJ, 3, e1319.
Eren, A. M., Kiefl, E., Shaiber, A., Veseli, I., Miller, S. E., Schechter, M. S., Fink, I., Pan, J. N.,
Yousef, M., Fogarty, E. C., Trigodet, F., Watson, A. R., Esen, Ö. C., Moore, R. M.,
Clayssen, Q., Lee, M. D., Kivenson, V., Graham, E. D., Merrill, B. D., … Willis, A. D.
(2021). Community-led, integrated, reproducible multi-omics with anvi’o. Nature
Microbiology, 6(1), 3–6.
Farrell, K. J., & Carey, C. C. (2018). Power, pitfalls, and potential for integrating computational
literacy into undergraduate ecology courses. Ecology and Evolution, 8(16), 7744–7751.
Ferla, M. P., Thrash, J. C., Giovannoni, S. J., & Patrick, W. M. (2013). New rRNA gene-based
phylogenies of the Alphaproteobacteria provide perspective on major groups,
mitochondrial ancestry and phylogenetic instability. PloS One, 8(12), e83383.
Finer, K. R., Fox, L., & Finer, J. J. (2016). Isolation and Characterization of Agrobacterium
Strains from Soil: A Laboratory Capstone Experience. Journal of Microbiology &
Biology Education: JMBE, 17(3), 444–450.
Fortunato, C. S., & Crump, B. C. (2015). Microbial Gene Abundance and Expression Patterns
across a River to Ocean Salinity Gradient. PloS One, 10(11), e0140578.
Fuhrman, J. A., Schwalbach, M. S., & Stingl, U. (2008). Proteorhodopsins: an array of
physiological roles? Nature Reviews. Microbiology, 6(6), 488–494.
Fuqua, D. W. J. D. (2011). The Physiology and Biochemistry of Prokaryotes. Oxford University
Press.
Futuyma, D. J., & Moreno, G. (1988). THE EVOLUTION OF ECOLOGICAL
SPECIALIZATION. Annual Review of Ecology and Systematics, 19(1), 207–233.
Getz, Eric W., V. Celeste Lanclos, Conner Y. Kojima, Chuankai Cheng, Michael W. Henson,
Max Emil Schön, Thijs J. G. Ettema, Brant C. Faircloth, and J. Cameron Thrash. (2023).
The Aegean-169 clade of bacterioplankton is synonymous with SAR11 subclade V
(HIMB59) and metabolically distinct. MSystems.
89
Giovannoni, S. J., Britschgi, T. B., Moyer, C. L., & Field, K. G. (1990). Genetic diversity in
Sargasso Sea bacterioplankton. Nature, 345(6270), 60–63.
Giovannoni, S., & Stingl, U. (2007). The importance of culturing bacterioplankton in the
“omics” age. Nature Reviews. Microbiology, 5(10), 820–826.
Giovannoni, Stephen J. (2017). SAR11 Bacteria: The Most Abundant Plankton in the Oceans.
Annual Review of Marine Science, 9(1), 231–255.
Giovannoni, Stephen J., Bibbs, L., Cho, J.-C., Stapels, M. D., Desiderio, R., Vergin, K. L.,
Rappé, M. S., Laney, S., Wilhelm, L. J., Tripp, H. J., Mathur, E. J., & Barofsky, D. F.
(2005). Proteorhodopsin in the ubiquitous marine bacterium SAR11. Nature, 438(7064),
82–85.
Giovannoni, Stephen J., Cameron Thrash, J., & Temperton, B. (2014). Implications of
streamlining theory for microbial ecology. The ISME Journal, 8(8), 1553–1565.
Giovannoni, Stephen J., Tripp, H. J., Givan, S., Podar, M., Vergin, K. L., Baptista, D., Bibbs, L.,
Eads, J., Richardson, T. H., Noordewier, M., Rappé, M. S., Short, J. M., Carrington, J. C.,
& Mathur, E. J. (2005). Genome streamlining in a cosmopolitan oceanic bacterium.
Science, 309(5738), 1242–1245.
Gómez-Consarnau, L., González, J. M., Coll-Lladó, M., Gourdon, P., Pascher, T., Neutze, R.,
Pedrós-Alió, C., & Pinhassi, J. (2007). Light stimulates growth of proteorhodopsin-
containing marine Flavobacteria. Nature, 445(7124), 210–213.
Graham, C. R. (2013). Emerging practice and research in blended learning. Handbook of
Distance Education, 3, 333–350.
Grote, J., Bayindirli, C., Bergauer, K., Carpintero de Moraes, P., Chen, H., D’Ambrosio, L.,
Edwards, B., Fernández-Gómez, B., Hamisi, M., Logares, R., Nguyen, D., Rii, Y. M.,
Saeck, E., Schutte, C., Widner, B., Church, M. J., Steward, G. F., Karl, D. M., Delong, E.
F., … Rappé, M. S. (2011). Draft genome sequence of strain HIMB100, a cultured
representative of the SAR116 clade of marine Alphaproteobacteria. Standards in
Genomic Sciences, 5(3), 269–278.
Grote, J., Cameron Thrash, J., Huggett, M. J., Landry, Z. C., Carini, P., Giovannoni, S. J., &
Rappé, M. S. (2012). Streamlining and core genome conservation among highly
divergent members of the SAR11 clade. MBio, 3(5), 1–13.
Grote, J., Thrash, J. C., & Huggett, M. J. (2012). Streamlining and Core Genome Conservation
among Highly Divergent Members of the SAR11 Clade. 3(5), 1–13.
Haro-Moreno, J. M., Rodriguez-Valera, F., Rosselli, R., Martinez-Hernandez, F., Roda-Garcia, J.
J., Gomez, M. L., Fornas, O., Martinez-Garcia, M., & López-Pérez, M. (2019).
90
Ecogenomics of the SAR11 clade. Environmental Microbiology.
https://doi.org/10.1111/1462-2920.14896
Hathaway, R. S., Nagda, B. A., & Gregerman, S. R. (2002). The relationship of undergraduate
research participation to graduate and professional education pursuit: An empirical study.
Journal of College Student Development, 43(5), 614–631.
Henson, Michael W., Lanclos, V. C., Faircloth, B. C., & Thrash, J. C. (2018). Cultivation and
genomics of the first freshwater SAR11 (LD12) isolate. The ISME Journal, 12(7), 1846–
1860.
Henson, Michael W., Lanclos, V. C., Pitre, D. M., Weckhorst, J. L., Lucchesi, A. M., Cheng, C.,
Temperton, B., & Thrash, J. C. (2020). Expanding the diversity of bacterioplankton
isolates and modeling isolation efficacy with large-scale dilution-to-extinction
cultivation. Applied and Environmental Microbiology, 86(17).
https://doi.org/10.1128/AEM.00943-20
Henson, Michael W., Pitre, D. M., Weckhorst, J. L., Lanclos, V. C., Webber, A. T., & Thrash, J.
C. (2016). Artificial Seawater Media Facilitate Cultivating Members of the Microbial
Majority from the Gulf of Mexico. MSphere, 1(2), 1–10.
Henson, Michael Winslow. (2019). High-Throughput Cultivation of Bacterioplankton from the
Gulf of Mexico and Genomics of the First Cultured LD12 Representative [Ph.D].
Louisiana State University and Agricultural and Mechanical College.
Herlemann, D. P., Labrenz, M., Jürgens, K., Bertilsson, S., Waniek, J. J., & Andersson, A. F.
(2011). Transitions in bacterial communities along the 2000 km salinity gradient of the
Baltic Sea. The ISME Journal, 5(10), 1571–1579.
Herlemann, D. P. R., Woelk, J., Labrenz, M., & Jürgens, K. (2014). Diversity and abundance of
“Pelagibacterales” (SAR11) in the Baltic Sea salinity gradient. Systematic and Applied
Microbiology, 37(8), 601–604.
Hopwood, M. J., Statham, P. J., Skrabal, S. A., & Willey, J. D. (2015). Dissolved iron(II) ligands
in river and estuarine water. Marine Chemistry, 173, 173–182.
Huang, K., Wang, D., Frederiksen, R. F., Rensing, C., Olsen, J. E., & Fresno, A. H. (2017).
Investigation of the Role of Genes Encoding Zinc Exporters zntA, zitB, and fieF during
Salmonella Typhimurium Infection. Frontiers in Microbiology, 8, 2656.
Hug, L. A. (2018). Sizing Up the Uncultured Microbial Majority. MSystems, 3(5).
https://doi.org/10.1128/mSystems.00185-18
Jain, C., Rodriguez-R, L. M., Phillippy, A. M., Konstantinidis, K. T., & Aluru, S. (2018). High
throughput ANI analysis of 90K prokaryotic genomes reveals clear species boundaries.
Nature Communications, 9(1), 5114.
91
Jimenez-Infante, F., Ngugi, D. K., Vinu, M., Blom, J., Alam, I., Bajic, V. B., & Stingl, U.
(2017). Genomic characterization of two novel SAR11 isolates from the Red Sea,
including the first strain of the SAR11 Ib clade. In FEMS Microbiology Ecology (Vol. 93,
Issue 7). https://doi.org/10.1093/femsec/fix083
Jones, P., Binns, D., Chang, H.-Y., Fraser, M., Li, W., McAnulla, C., McWilliam, H., Maslen, J.,
Mitchell, A., Nuka, G., Pesseat, S., Quinn, A. F., Sangrador-Vegas, A., Scheremetjew,
M., Yong, S.-Y., Lopez, R., & Hunter, S. (2014). InterProScan 5: genome-scale protein
function classification. Bioinformatics , 30(9), 1236–1240.
Kaczmarski, J. A., Hong, N.-S., Mukherjee, B., Wey, L. T., Rourke, L., Förster, B., Peat, T. S.,
Price, G. D., & Jackson, C. J. (2019). Structural Basis for the Allosteric Regulation of the
SbtA Bicarbonate Transporter by the PII-like Protein, SbtB, from Cyanobium sp.
PCC7001. Biochemistry, 58(50), 5030–5039.
Kan, J., Evans, S. E., Chen, F., & Suzuki, M. T. (2008). Novel estuarine bacterioplankton in
rRNA operon libraries from the Chesapeake Bay. Aquatic Microbial Ecology:
International Journal, 51, 55–66.
Kirchman, D. L. (2016). Growth Rates of Microbes in the Oceans. Annual Review of Marine
Science, 8, 285–309.
Konstantinidis, K. T., & Tiedje, J. M. (2005). Towards a genome-based taxonomy for
prokaryotes. Journal of Bacteriology, 187(18), 6258–6264.
Lanclos, V. C., Rasmussen, A. N., Kojima, C. Y., Cheng, C., Henson, M. W., Faircloth, B. C.,
Francis, C. A., & Thrash, J. C. (2023). Ecophysiology and genomics of the brackish
water adapted SAR11 subclade IIIa. The ISME Journal. https://doi.org/10.1038/s41396-
023-01376-2
Lewis, W. H., Tahon, G., Geesink, P., Sousa, D. Z., & Ettema, T. J. G. (2020). Innovations to
culturing the uncultured microbial majority. Nature Reviews. Microbiology.
https://doi.org/10.1038/s41579-020-00458-8
Linn, M. C., Palmer, E., Baranger, A., Gerard, E., & Stone, E. (2015). Education. Undergraduate
research experiences: impacts and opportunities. Science, 347(6222), 1261757.
Lloyd, K. G., Steen, A. D., Ladau, J., Yin, J., & Crosby, L. (2018). Phylogenetically Novel
Uncultured Microbial Cells Dominate Earth Microbiomes. MSystems, 3(5), 1–12.
Logares, R., Bråte, J., Bertilsson, S., Clasen, J. L., Shalchian-Tabrizi, K., & Rengefors, K.
(2009). Infrequent marine-freshwater transitions in the microbial world. Trends in
Microbiology, 17(9), 414–422.
Luo, H. (2015). Evolutionary origin of a streamlined marine bacterioplankton lineage. The ISME
Journal, 9(6), 1423–1433.
92
Luo, H., Csuros, M., Hughes, A. L., & Moran, M. A. (2013). Evolution of divergent life history
strategies in marine alphaproteobacteria. MBio, 4(4).
https://doi.org/10.1128/mBio.00373-13
Luo, H., & Moran, M. A. (2014). Evolutionary ecology of the marine Roseobacter clade.
Microbiology and Molecular Biology Reviews: MMBR, 78(4), 573–587.
Luo, H., Swan, B. K., Stepanauskas, R., Hughes, A. L., & Moran, M. A. (2014). Evolutionary
analysis of a streamlined lineage of surface ocean Roseobacters. The ISME Journal, 8(7),
1428–1439.
Malfatti F, Samo TJ, Azam F. 2010. High-resolution imaging of pelagic bacteria by Atomic
Force Microscopy and implications for carbon cycling. ISME J 4:427–439
Malmstrom, R. R., Kiene, R. P., Cottrell, M. T., & Kirchman, D. L. (2004). Contribution of
SAR11 bacteria to dissolved dimethylsulfoniopropionate and amino acid uptake in the
North Atlantic ocean. Applied and Environmental Microbiology, 70(7), 4129–4135.
Martijn, J., Vosseberg, J., Guy, L., Offre, P., & Ettema, T. J. G. (2018). Deep mitochondrial
origin outside the sampled alphaproteobacteria. Nature, 557(7703), 101–105.
Martinez, A., Bradley, A. S., Waldbauer, J. R., Summons, R. E., & DeLong, E. F. (2007).
Proteorhodopsin photosystem gene expression enables photophosphorylation in a
heterologous host. Proceedings of the National Academy of Sciences of the United States
of America, 104(13), 5590–5595.
Martiny, A. C. (2019). High proportions of bacteria are culturable across major biomes. The
ISME Journal, 3–6.
Mende, D. R., Bryant, J. A., Aylward, F. O., Eppley, J. M., Nielsen, T., Karl, D. M., & DeLong,
E. F. (2017). Environmental drivers of a microbial genomic transition zone in the ocean’s
interior. Nature Microbiology, 2(10), 1367–1373.
Moran, M. A., Buchan, A., González, J. M., Heidelberg, J. F., Whitman, W. B., Kiene, R. P.,
Henriksen, J. R., King, G. M., Belas, R., Fuqua, C., Brinkac, L., Lewis, M., Johri, S.,
Weaver, B., Pai, G., Eisen, J. A., Rahe, E., Sheldon, W. M., Ye, W., … Ward, N. (2004).
Genome sequence of Silicibacter pomeroyi reveals adaptations to the marine
environment. Nature, 432(7019), 910–913.
Morris, R. M., Frazar, C. D., & Carlson, C. A. (2012). Basin-scale patterns in the abundance of
SAR11 subclades, marine Actinobacteria (OM1), members of the Roseobacter clade and
OCS116 in the South Atlantic. Environmental Microbiology, 14(5), 1133–1144.
Morris, R. M., Rappé, M. S., Connon, S. A., Vergin, K. L., Siebold, W. A., Carlson, C. A., &
Giovannoni, S. J. (2002). SAR11 clade dominates ocean surface bacterioplankton
communities. Nature, 420(6917), 806–810.
93
Morris, R. M., Vergin, K. L., Cho, J.-C., Rappé, M. S., Carlson, C. A., & Giovannoni, S. J.
(2005). Temporal and spatial response of bacterioplankton lineages to annual convective
overturn at the Bermuda Atlantic Time-series Study site. Limnology and Oceanography,
50(5), 1687–1696.
Mortazavi, A., Williams, B. A., McCue, K., Schaeffer, L., & Wold, B. (2008). Mapping and
quantifying mammalian transcriptomes by RNA-Seq. Nature Methods, 5(7), 621–628.
Muñoz-Gómez, S. A., Susko, E., Williamson, K., Eme, L., Slamovits, C. H., Moreira, D., López-
García, P., & Roger, A. J. (2022). Site-and-branch-heterogeneous analyses of an
expanded dataset favour mitochondria as sister to known Alphaproteobacteria. Nature
Ecology & Evolution, 6(3), 253–262.
Newton, R. J., Griffin, L. E., Bowles, K. M., Meile, C., Gifford, S., Givens, C. E., Howard, E. C.,
King, E., Oakley, C. A., Reisch, C. R., Rinta-Kanto, J. M., Sharma, S., Sun, S., Varaljay,
V., Vila-Costa, M., Westrich, J. R., & Moran, M. A. (2010). Genome characteristics of a
generalist marine bacterial lineage. The ISME Journal, 4(6), 784–798.
Nguyen, L.-T., Schmidt, H. A., von Haeseler, A., & Minh, B. Q. (2015). IQ-TREE: a fast and
effective stochastic algorithm for estimating maximum-likelihood phylogenies.
Molecular Biology and Evolution, 32(1), 268–274.
Obruca, S., Sedlacek, P., Koller, M., Kucera, D., & Pernicova, I. (2018). Involvement of
polyhydroxyalkanoates in stress resistance of microbial cells: Biotechnological
consequences and applications. Biotechnology Advances, 36(3), 856–870.
Oh, H. M., Kang, I., Lee, K., Jang, Y., Lim, S. I., & Cho, J. C. (2011). Complete genome
sequence of strain IMCC9063, belonging to SAR11 subgroup 3, isolated from the Arctic
Ocean. Journal of Bacteriology, 193(13), 3379–3380.
Oh, H.-M., Kwon, K. K., Kang, I., Kang, S. G., Lee, J.-H., Kim, S.-J., & Cho, J.-C. (2010).
Complete genome sequence of “Candidatus Puniceispirillum marinum” IMCC1322, a
representative of the SAR116 clade in the Alphaproteobacteria. Journal of Bacteriology,
192(12), 3240–3241.
Oh, S., Zhang, R., Wu, Q. L., & Liu, W. T. (2016). Evolution and adaptation of SAR11 and
Cyanobium in a saline Tibetan lake. Environmental Microbiology Reports, 8, 595–604.
Parks, D. H., Imelfort, M., Skennerton, C. T., Hugenholtz, P., & Tyson, G. W. (2015). CheckM:
assessing the quality of microbial genomes recovered from isolates, single cells, and
metagenomes. Genome Research, 25(7), 1043–1055.
Patel, M. S., Nemeria, N. S., Furey, W., & Jordan, F. (2014). The pyruvate dehydrogenase
complexes: structure-based function and regulation. The Journal of Biological Chemistry,
289(24), 16615–16623.
94
Paulton, R. J. L. (1991). The bacterial growth curve. Journal of Biological Education, 25(2), 92–
94.
Paver, S. F., Muratore, D., Newton, R. J., & Coleman, M. L. (2018). Reevaluating the Salty
Divide: Phylogenetic Specificity of Transitions between Marine and Freshwater Systems.
MSystems, 3(6). https://doi.org/10.1128/mSystems.00232-18
Polz, M. F., Hunt, D. E., Preheim, S. P., & Weinreich, D. M. (2006). Patterns and mechanisms of
genetic and phenotypic differentiation in marine microbes. Philosophical Transactions of
the Royal Society of London. Series B, Biological Sciences, 361(1475), 2009–2021.
Quast, C., Pruesse, E., Yilmaz, P., Gerken, J., Schweer, T., Yarza, P., Peplies, J., & Glöckner, F.
O. (2013). The SILVA ribosomal RNA gene database project: improved data processing
and web-based tools. Nucleic Acids Research, 41(Database issue), D590-6.
Ramachandran, A., McLatchie, S., & Walsh, D. A. (2021). A Novel Freshwater to Marine
Evolutionary Transition Revealed within Methylophilaceae Bacteria from the Arctic
Ocean. MBio, 12(3), e0130621.
Rappé, M. S., Connon, S. a., Vergin, K. L., & Giovannoni, S. J. (2002). Cultivation of the
ubiquitous SAR11 marine bacterioplankton clade. Nature, 418(6898), 630–633.
Rappé, M. S., Kemp, P. F., & Giovannoni, S. J. (1997). Phylogenetic diversity of marine coastal
picoplankton 16S rRNA genes cloned from the continental shelf off Cape Hatteras, North
Carolina. In Limnology and Oceanography (Vol. 42, Issue 5, pp. 811–826).
https://doi.org/10.4319/lo.1997.42.5.0811
Rasmussen, A. N., Damashek, J., Eloe-Fadrosh, E. A., & Francis, C. A. (2020). In-depth
Spatiotemporal Characterization of Planktonic Archaeal and Bacterial Communities in
North and South San Francisco Bay. Microbial Ecology. https://doi.org/10.1007/s00248-
020-01621-7
Rasmussen, A. N., & Francis, C. A. (2022). Genome-Resolved Metagenomic Insights into
Massive Seasonal Ammonia-Oxidizing Archaea Blooms in San Francisco Bay.
MSystems, 7(1), e0127021.
Riemann, B., Fuhrman, J., & Azam, F. (1982). Bacterial secondary production in freshwater
measured by(3)H-thymidine incorporation method. Microbial Ecology, 8(2), 101–113.
Roux, S., Enault, F., Hurwitz, B. L., & Sullivan, M. B. (2015). VirSorter: mining viral signal
from microbial genomic data. PeerJ, 3, e985.
Ruiz-Perez, C. A., Bertagnolli, A. D., Tsementzi, D., Woyke, T., Stewart, F. J., &
Konstantinidis, K. T. (2021). Description of Candidatus Mesopelagibacter
carboxydoxydans and Candidatus Anoxipelagibacter denitrificans: Nitrate-reducing
95
SAR11 genera that dominate mesopelagic and anoxic marine zones. Systematic and
Applied Microbiology, 44(2), 126185.
Russel, G. M. (2008). Building bridges between research and practice: Teaching qualitative
research. In PsycEXTRA Dataset. https://doi.org/10.1037/e549322009-005
Saggers, B. A., & Thomas, M. (1980). The use of Beneckea natriegens for practical exercises in
microbiology and biochemistry. Journal of Biological Education, 14(3), 256–262.
Sakowski, E. G., Arora-Williams, K., Tian, F., Zayed, A. A., Zablocki, O., Sullivan, M. B., &
Preheim, S. P. (2021). Interaction dynamics and virus-host range for estuarine
actinophages captured by epicPCR. Nature Microbiology, 6(5), 630–642.
Savoie, E. R., Lanclos, V. C., Henson, M. W., Cheng, C., Getz, E. W., Barnes, S. J., LaRowe, D.
E., Rappé, M. S., & Thrash, J. C. (2021). Ecophysiology of the Cosmopolitan OM252
Bacterioplankton (Gammaproteobacteria). MSystems, e0027621.
Schäfer, H., Servais, P., & Muyzer, G. (2000). Successional changes in the genetic diversity of a
marine bacterial assemblage during confinement. Archives of Microbiology, 173(2), 138–
145.
Schattenhofer, M., Fuchs, B. M., Amann, R., Zubkov, M. V., Tarran, G. A., & Pernthaler, J.
(2009). Latitudinal distribution of prokaryotic picoplankton populations in the Atlantic
Ocean. Environmental Microbiology, 11(8), 2078–2093.
Schroeder, S., & Amend, J. (2018). Effective Strategies for Engaging Community College
Students in Research via Cutting-Edge Technology. Marine Technology Society Journal,
52(1), 28–32.
Schwalbach, M. S., Tripp, H. J., Steindler, L., Smith, D. P., & Giovannoni, S. J. (2010). The
presence of the glycolysis operon in SAR11 genomes is positively correlated with ocean
productivity. Environmental Microbiology, 12(2), 490–500.
Seymour, E., Hunter, A.-B., Laursen, S. L., & DeAntoni, T. (2004). Establishing the benefits of
research experiences for undergraduates in the sciences: First findings from a three-year
study. Science Education, 88(4), 493–534.
Shapiro, C., Moberg-Parker, J., Toma, S., Ayon, C., Zimmerman, H., Roth-Johnson, E. A.,
Hancock, S. P., Levis-Fitzgerald, M., & Sanders, E. R. (2015). Comparing the Impact of
Course-Based and Apprentice-Based Research Experiences in a Life Science Laboratory
Curriculum. Journal of Microbiology & Biology Education: JMBE, 16(2), 186–197.
Shikata, H., Koyama, S., Egi, Y., Yamada, K., & Kawasaki, T. (1989). Cytosolic adenylate
kinase catalyzes the synthesis of thiamin triphosphate from thiamin diphosphate.
Biochemistry International, 18(5), 933–941.
96
Smith, D. P., Kitner, J. B., Norbeck, A. D., Clauss, T. R., Lipton, M. S., Michael, S., Steindler,
L., Nicora, C. D., Smith, R. D., & Giovannoni, S. J. (2010). Transcriptional and
Translational Regulatory Responses to Iron Limitation in the Globally Distributed
Marine Bacterium Candidatus Pelagibacter ubique. 5(5).
https://doi.org/10.1371/journal.pone.0010487
Smith, D. P., Nicora, C. D., Carini, P., Lipton, M. S., Norbeck, A. D., Smith, R. D., &
Giovannoni, S. J. (2016). Proteome Remodeling in Response to Sulfur Limitation in
“Candidatus Pelagibacter ubique.” MSystems, 1(4).
https://doi.org/10.1128/mSystems.00068-16
Smith, D. P., Thrash, J. C., Nicora, C. D., Lipton, M. S., Burnum-Johnson, K. E., Carini, P.,
Smith, R. D., & Giovannoni, S. J. (2013). Proteomic and Transcriptomic Analysis of
"Candidatus Pelagibacter ubique ” Describe the First P II -Independent Response to
Nitrogen Limitation in a Free-Living Alphaproteobacterium. MBio, 4(6), 1–11.
Sogin, M. L., Morrison, H. G., Huber, J. A., Welch, D. M., Huse, S. M., Neal, P. R., Arrieta, J.
M., & Herndl, G. J. (2006). Microbial diversity in the deep sea and the underexplored
“rare biosphere.” Proceedings of the National Academy of Sciences, 103(32), 12115–
12120.
Staley, J. T., & Konopka, A. (1985). Measurement of in situ activities of nonphotosynthetic
microorganisms in aquatic and terrestrial habitats. Annual Review of Microbiology, 39,
321–346.
Steen, A. D., Crits-Christoph, A., Carini, P., DeAngelis, K. M., Fierer, N., Lloyd, K. G., &
Thrash, J. C. (2019). High proportions of bacteria and archaea across most biomes remain
uncultured. The ISME Journal, 13(12), 3126–3130.
Steindler, L., Schwalbach, M. S., Smith, D. P., Chan, F., & Giovannoni, S. J. (2011). Energy
Starved Candidatus Pelagibacter Ubique Substitutes Light-Mediated ATP Production for
Endogenous Carbon Respiration. 6(5), 1–10.
Stingl, U., Tripp, H. J., & Giovannoni, S. J. (2007). Improvements of high-throughput culturing
yielded novel SAR11 strains and other abundant marine bacteria from the Oregon coast
and the Bermuda Atlantic Time Series study site. The ISME Journal, 361–371.
Sudesh, K., Abe, H., & Doi, Y. (2000). Synthesis, structure and properties of
polyhydroxyalkanoates: biological polyesters. Progress in Polymer Science, 25(10),
1503–1555.
Suffridge, C. P., Bolaños, L. M., Bergauer, K., Worden, A. Z., Morré, J., Behrenfeld, M. J., &
Giovannoni, S. J. (2020). Exploring Vitamin B1 Cycling and Its Connections to the
Microbial Community in the North Atlantic Ocean. Frontiers in Marine Science, 7.
https://doi.org/10.3389/fmars.2020.606342
97
Sun, J., Steindler, L., Thrash, J. C., Halsey, K. H., Smith, D. P., Carter, A. E., Landry, Z. C., &
Giovannoni, S. J. (2011). One carbon metabolism in SAR11 pelagic marine bacteria.
PloS One, 6(8). https://doi.org/10.1371/journal.pone.0023973
Sun, J., Todd, J. D., Thrash, J. C., Qian, Y., Qian, M. C., Temperton, B., Guo, J., Fowler, E. K.,
Aldrich, J. T., Nicora, C. D., Lipton, M. S., Smith, R. D., De Leenheer, P., Payne, S. H.,
Johnston, A. W. B., Davie-Martin, C. L., Halsey, K. H., & Giovannoni, S. J. (2016). The
abundant marine bacterium Pelagibacter simultaneously catabolizes
dimethylsulfoniopropionate to the gases dimethyl sulfide and methanethiol. Nature
Microbiology, 1(8), 16065.
Sunagawa, S., Coelho, L. P., Chaffron, S., Kultima, J. R., Labadie, K., Salazar, G., Djahanschiri,
B., Zeller, G., Mende, D. R., Alberti, A., Cornejo-Castillo, F. M., Costea, P. I., Cruaud,
C., d’Ovidio, F., Engelen, S., Ferrera, I., Gasol, J. M., Guidi, L., Hildebrand, F., …
Velayoudon, D. (2015). Structure and function of the global ocean microbiome. Science,
348(6237), 1261359.
Suzuki, M. T., Preston, C. M., Béjà, O., de la Torre, J. R., Steward, G. F., & DeLong, E. F.
(2004). Phylogenetic screening of ribosomal RNA gene-containing clones in Bacterial
Artificial Chromosome (BAC) libraries from different depths in Monterey Bay.
Microbial Ecology, 48(4), 473–488.
Tao, P., Li, H., Yu, Y., Gu, J., & Liu, Y. (2016). Ectoine and 5-hydroxyectoine accumulation in
the halophile Virgibacillus halodenitrificans PDB-F2 in response to salt stress. Applied
Microbiology and Biotechnology, 100(15), 6779–6789.
Teel, E. N. (8/2017). Multi-Dataset Analysis of Bacterial Heterotrophic Variability at the San
Pedro Ocean Time Series (SPOT): An Investigation into the Necessity and Feasibility of
Incorporating a Dynamic Bacterial Component into Global Ecosystem NPZD Models
[Phd]. Univeristy of Southern California.
The Venice system for the classification of marine waters according to salinity. (1958).
Limnology and Oceanography, 3(3), 346–347.
Thompson, S. K., Neill, C. J., Wiederhoeft, E., & Cotner, S. (2016). A Model for a Course-Based
Undergraduate Research Experience (CURE) in a Field Setting. Journal of Microbiology
& Biology Education: JMBE, 17(3), 469–471.
Thrash, J. C., Boyd, A., Huggett, M. J., Grote, J., Carini, P., Yoder, R. J., Robbertse, B.,
Spatafora, J. W., Rappé, M. S., & Giovannoni, S. J. (2011). Phylogenomic evidence for a
common ancestor of mitochondria and the SAR11 clade. Scientific Reports, 1, 13.
Thrash, J. C., Seitz, K. W., Baker, B. J., Temperton, B., Gillies, L. E., Rabalais, N. N., Henrissat,
B., & Mason, O. U. (2017). Metabolic Roles of Uncultivated Bacterioplankton Lineages
in the Northern Gulf of Mexico “Dead Zone.” MBio, 8(5).
https://doi.org/10.1128/mBio.01017-17
98
Thrash, J. C., Temperton, B., Swan, B. K., Landry, Z. C., Woyke, T., DeLong, E. F.,
Stepanauskas, R., & Giovannoni, S. J. (2014). Single-cell enabled comparative genomics
of a deep ocean SAR11 bathytype. The ISME Journal, 8(7), 1440–1451.
Tripp, H. J., Kitner, J. B., Schwalbach, M. S., Dacey, J. W. H., Wilhelm, L. J., & Giovannoni, S.
J. (2008). SAR11 marine bacteria require exogenous reduced sulphur for growth. Nature,
452(7188), 741–744.
Tripp, H. J., Schwalbach, M. S., Meyer, M. M., Kitner, J. B., Breaker, R. R., & Giovannoni, S. J.
(2009). Unique glycine-activated riboswitch linked to glycine--serine auxotrophy in
SAR11. Environmental Microbiology, 11(1), 230–238.
Tsementzi, D., Rodriguez-R, L. M., Ruiz-Perez, C. A., Meziti, A., Hatt, J. K., & Konstantinidis,
K. T. (2019). Ecogenomic characterization of widespread, closely-related SAR11 clades
of the freshwater genus “Candidatus Fonsibacter” and proposal of Ca. Fonsibacter lacus
sp. nov. Systematic and Applied Microbiology, 42(4), 495–505.
Tsementzi, D., Wu, J., Deutsch, S., Nath, S., Rodriguez-R, L. M., Burns, A. S., Ranjan, P.,
Sarode, N., Malmstrom, R. R., Padilla, C. C., Stone, B. K., Bristow, L. A., Larsen, M.,
Glass, J. B., Thamdrup, B., Woyke, T., Konstantinidis, K. T., & Stewart, F. J. (2016).
SAR11 bacteria linked to ocean anoxia and nitrogen loss. Nature, 536(7615), 179–183.
Van Tienderen, P. H. (1991). EVOLUTION OF GENERALISTS AND SPECIALISTS IN
SPATIALLY HETEROGENEOUS ENVIRONMENTS. Evolution; International
Journal of Organic Evolution, 45(6), 1317–1331.
Veaudor, T., Cassier-Chauvat, C., & Chauvat, F. (2019). Genomics of Urea Transport and
Catabolism in Cyanobacteria: Biotechnological Implications. Frontiers in Microbiology,
10, 2052.
Venter, J. C., Remington, K., Heidelberg, J. F., Halpern, A. L., Rusch, D., Eisen, J. A., Wu, D.,
Paulsen, I., Nelson, K. E., Nelson, W., Fouts, D. E., Levy, S., Knap, A. H., Lomas, M.
W., Nealson, K., White, O., Peterson, J., Hoffman, J., Parsons, R., … Smith, H. O.
(2004). Environmental genome shotgun sequencing of the Sargasso Sea. Science,
304(5667), 66–74.
Vergin, K. L., Beszteri, B., Monier, A., Thrash, J. C., Temperton, B., Treusch, A. H., Kilpert, F.,
Worden, A. Z., & Giovannoni, S. J. (2013). High-resolution SAR11 ecotype dynamics at
the Bermuda Atlantic Time-series Study site by phylogenetic placement of
pyrosequences. The ISME Journal, 7(7), 1322–1332.
Viklund, J., Martijn, J., Ettema, T. J. G., & Andersson, S. G. E. (2013). Comparative and
phylogenomic evidence that the alphaproteobacterium HIMB59 is not a member of the
oceanic SAR11 clade. PloS One, 8(11), e78858.
99
Voget, S., Wemheuer, B., Brinkhoff, T., Vollmers, J., Dietrich, S., Giebel, H.-A., Beardsley, C.,
Sardemann, C., Bakenhus, I., Billerbeck, S., Daniel, R., & Simon, M. (2015). Adaptation
of an abundant Roseobacter RCA organism to pelagic systems revealed by genomic and
transcriptomic analyses. The ISME Journal, 9(2), 371–384.
Wagner, S. C., & Jr, R. S. S. (2000). Microbial safari: isolation & characterization of unknowns
in an introductory microbiology laboratory. The American Biology Teacher, 62(8), 588–
592.
Walker, B. J., Abeel, T., Shea, T., Priest, M., Abouelliel, A., Sakthikumar, S., Cuomo, C. A.,
Zeng, Q., Wortman, J., Young, S. K., & Earl, A. M. (2014). Pilon: an integrated tool for
comprehensive microbial variant detection and genome assembly improvement. PloS
One, 9(11), e112963.
White, A. E., Giovannoni, S. J., Zhao, Y., Vergin, K., & Carlson, C. A. (2019). Elemental
content and stoichiometry of SAR11 chemoheterotrophic marine bacteria: SAR11
composition. Limnology and Oceanography, 4(2), 44–51.
Whitman, W. B., Coleman, D. C., & Wiebe, W. J. (1998). Prokaryotes: the unseen majority.
Proceedings of the National Academy of Sciences of the United States of America,
95(12), 6578–6583.
Widner, B., Fuchsman, C. A., Chang, B. X., Rocap, G., & Mulholland, M. R. (2018). Utilization
of urea and cyanate in waters overlying and within the eastern tropical north Pacific
oxygen deficient zone. FEMS Microbiology Ecology, 94(10).
https://doi.org/10.1093/femsec/fiy138
Wilhelm, L. J., Tripp, H. J., Givan, S. A., Smith, D. P., & Giovannoni, S. J. (2007). Natural
variation in SAR11 marine bacterioplankton genomes inferred from metagenomic data.
Biology Direct, 2(1), 27.
Woeste, S., & Demchick, P. (1996). A slow bacterial growth curve exercise for laboratory
classrooms. Journal of Biological Education, 30(2), 91–92.
Xu, B., Li, F., Cai, L., Zhang, R., Fan, L., & Zhang, C. (2022). A holistic genome dataset of
bacteria, archaea and viruses of the Pearl River estuary. Scientific Data, 9(1), 49.
Yang, S.-J., Kang, I., & Cho, J.-C. (2016). Expansion of Cultured Bacterial Diversity by Large-
Scale Dilution-to-Extinction Culturing from a Single Seawater Sample. Microbial
Ecology, 71(1), 29–43.
Yarza, P., Yilmaz, P., Pruesse, E., Glöckner, F. O., Ludwig, W., Schleifer, K.-H., Whitman, W.
B., Euzéby, J., Amann, R., & Rosselló-Móra, R. (2014). Uniting the classification of
cultured and uncultured bacteria and archaea using 16S rRNA gene sequences. Nature
Reviews. Microbiology, 12(9), 635–645.
100
Yurkov, V. V., & Beatty, J. T. (1998). Aerobic anoxygenic phototrophic bacteria. Microbiology
and Molecular Biology Reviews: MMBR, 62(3), 695–724.
Zhang, Y., Sun, Y., Jiao, N., Stepanauskas, R., & Luo, H. (2016). Ecological Genomics of the
Uncultivated Marine Roseobacter Lineage CHAB-I-5. Applied and Environmental
Microbiology, 82(7), 2100–2111.
Zhang, Z., Wu, Z., Liu, H., Yang, M., Wang, R., & Zhao, Y. (n.d.). Genomic analysis and
characterization of phages infecting the marine Roseobacter CHAB-I-5 lineage reveal a
globally distributed and abundant phage …. Frontiers in Microbiology.
Zhao, X., Schwartz, C. L., Pierson, J., Giovannoni, S. J., McIntosh, J. R., & Nicastro, D. (2017).
Three-Dimensional Structure of the Ultraoligotrophic Marine Bacterium “Candidatus
Pelagibacter ubique.” Applied and Environmental Microbiology, 83(3).
https://doi.org/10.1128/AEM.02807-16
Zubkov, M. V., Martin, A. P., Hartmann, M., Grob, C., & Scanlan, D. J. (2015). Dominant
oceanic bacteria secure phosphate using a large extracellular buffer. Nature
Communications, 6(May). https://doi.org/10.1038/ncomms8878

101
APPENDICIES
Chapter 1 Supplemental Materials

102

Supplemental text for Ecophysiology and genomics of the brackish water adapted SAR11 1
subclade IIIa 2
3
4
V. Celeste Lanclos, Anna N. Rasmussen, Conner Y. Kojima, Chuankai Cheng, Michael W. 5
Henson, Brant C. Faircloth, Christopher A. Francis, and J. Cameron Thrash 6
7
8
Supplemental Methods 9
10
Isolation, genome sequencing and assembly (continued) 11
LSUCC0261 was isolated using JW2 medium in September 2015 and LSUCC0664 and 12
LSUCC0723 were isolated using MWH2 medium in September 2016, from the Calcasieu Jetties 13
in Cameron, LA (29.760164 -93.340159)[1, 2]. We chose these strains for genome sequencing 14
because their location on the 16S rRNA gene phylogenetic tree indicated that they represented 15
two of the existing branches of IIIa [1, 2]. For genome sequencing, we grew LSUCC0664 and 16
LSUCC0723 in MWH2 and LSUCC0261 in JW2 media and filtered them through a 25 mm 0.22 17
μm polycarbonate filter (Millipore, Massachusetts, USA) when cultures reached roughly 10
6
18
cells mL
-1
. DNA was extracted with the MoBio PowerWater DNA kit (QIAGEN, Massachusetts, 19
USA) following the manufacturer’s protocol and eluted in 50uL of Mili-Q water. 20
21
DNA for strain LSUCC0261 was sequenced using an Illumina HiSeq after library preparation as 22
previously reported [3] at the Oklahoma Medical Research Facility. Sequencing produced 23
6,134,004 paired-end 151bp reads with a 400bp insert size. We selected a subset of 1,000,000 24
reads for assembly using seqtk as previously reported [3]. DNA for strains LSUCC0664 and 25
LSUCC0723 was sent to the Argonne National Laboratory Environmental Sample Preparation 26
and Sequencing Facility for library preparation and sequencing. These Illumina TruSeq libraries 27
were sequenced using and Illumina MiSeq and generating 1,609,453 and 2,314,532 paired-end 28
251bp reads with a 550bp insert size. We trimmed the resulting sequences with Trimmomatic 29
v0.36 using LEADING:20 TRAILING:20 SLIDINGWINDOW:13:20 MINLEN:40 for 30
LSUCC0261 and LSUCC0723 and LEADING:20 CROP:150 SLIDINGWINDOW:13:20 31
MINLEN:40 for LSUCC0664 and assembled trimmed reads for all genomes with SPAdes 32
v3.10.1 [4] with --cov-cutoff option set to “auto”. The final assembly coverages, calculated via 33
Pilon, were as follows: LSUCC0261- 1112x, LSUCC0664- 491x, LSUCC0723- 699x. Default 34
settings were used for all software during the genome assembly process unless otherwise noted. 35
36
Confirmation of closed genomes 37
The LSUCC0261 and LSUCC0723 assemblies resulted in single scaffolds with overlapping 38
ends. We evaluated the strain LSUCC0261 assembly using similar methods as previously 39
reported (1) involving two rounds of Reapr v1.0.18 (2) with one round of SSPACE v3.0 as 40
reported (3) using all HiSeq reads, as well as reapr/SSPACE runs on the rotated scaffold that was 41
103

manually joined at the ends and broken on the opposite side. This was followed by evaluation of 42
the rotated scaffold with Pilon v1.22 (4) with default settings using the indexed bam files from 43
reapr/SSPACE. Pilon made no corrections. We evaluated the LSUCC0723 assembly using Pilon 44
only, after mapping the reads to the scaffold using BWA (5), and repeated this process with the 45
rotated scaffold as for LSUCC0261, above. Pilon made no corrections on either run. 46
47
The LSUCC0664 assembly resulted in a single scaffold with overlapping ends, but while Pilon 48
(completed as described above) returned no corrections on the original scaffold, it found two 49
continuity breaks when we rotated the scaffold at the location where the ends overlapped in the 50
original scaffold (573,860-574,412 and 574,938-575,012). Thus, we designed primers to verify 51
the overlap with the NCBI Primer-BLAST website (https://www.ncbi.nlm.nih.gov/tools/primer- 52
blast/) using the following settings: Forward primer from 573800 to 573900; Reverse primer 53
from 574950 to 575050; PCR product size Min 900 / Max 1300; Tm Min 52 / Opt 54 / Max 55; 54
remainder default. We amplified DNA using the following primers: F- 55
ATAATGTCAAACTTGCACCTG, R-TCTAAGATTTACCCCTGTAGC, which were predicted 56
to set down at bases 573,834-573,854 and 575,003-575,023, respectively, outside of the region 57
of interest. PCR was conducted with the following annealing temperatures: 53, 52.5, 51.7, 50.4, 58
48.8, 47.6, 46.7, 46 (all ˚C). Multiple bands were observed at each temperature. We selected the 59
heaviest band, purified the gel, and Sanger sequencing of the resultant PCR product produced 60
overlapping reads from positions and 573,932-574,841 from the F primer and 574,018-575,034 61
from the R primer, confirming that this section of the scaffold was contiguous. 62
63
MAG assembly from the San Francisco Bay 64
We assembled MAGs from the San Francisco Bay estuary using methods targeting the recovery 65
of genomes from highly abundant organisms, such as SAR11, as previously described in [5]. 66
This effort yielded eight SAR11 MAGs, including two new IIIa MAGs from IIIa.3 (see “SFB” 67
designations in the text and figures). All eight SAR11 MAGs are deposited in BioProject no. 68
PRJNA819083. 69
70
Taxon selection for comparative genomics 71
We used known SAR11 isolate genomes listed in Table S1 as input for GTDB-Tk v1.5.0 – 72
classify_wf [6] to clearly define the SAR11 clade de novo and screened all genomes from the 73
SAR11 node of the GTDB output using the CheckM metadata. We did not include subclades IV 74
or V from this set except for the cultured genome of HIMB59 as an outgroup. We required 75
completeness of at least 50% and contamination of < 5% to define a starting set. We then culled 76
the genome selection using the following criteria: any IIIa genome that was > 50% complete and 77
< 5% contamination was kept to ensure the fullest possible sampling of available genomes, 78
whereas genomes within subclades I and II were maintained only if they had > 80% completion 79
and < 5% contamination because of an overrepresentation of genomes from these subclades in 80
GTDB. We supplemented the LD12 subclade with 5 additional genomes downloaded from IMG 81
104
(2018) to better match taxon selection in our previous work [3].We then dereplicated the 82
resulting genomes using fastANI [7] with default settings, defining duplicates as those with > 83
99% average nucleotide identity (ANI), and kept the genome from any matching pair with higher 84
completion and lower contamination as estimated using CheckM v1.0.5 [8]. This final genome 85
set was combined with MAGs assembled from the San Francisco Bay (SFB) (see above) that 86
were at least 50% complete with < 8% contamination as estimated with CheckM v1.0.5 [8] and 87
our isolate genomes for a total of 471 genomes used for phylogenomics and pangenomics. We 88
removed two non-IIIa MAGs from the San Francisco Bay that contained contamination > 5% 89
(highlighted in Table S1) before metagenomic recruitment analysis. 90
91
92
Phylogenomics 93
We processed all genomes through the Anvi’o version 6.2 pipeline [9] as referenced previously 94
[10] to gather single-copy marker genes present in at least half of the genomes. The 70 resulting 95
amino acid sequences were aligned with MUSCLE v3.8.1551 [11], trimmed with trimAl v1.2 96
[12], concatenated with genestitcher.py, and the final tree was inferred with IQ-TREE (version 97
1.6.12, default settings) [13]. We used FigTree v1.4.4 (http://tree.bio.ed.ac.uk/software/figtree/) 98
for visualization of the final tree. 99
100
Proteorhodopsin tuning identification 101
To investigate proteorhodopsin in SAR11 IIIa, we gathered amino acid sequences annotated as 102
rhodopsins from the pangenome summary (Table S2), aligned them with MUSCLE v3.8.1551 103
[11], and visualized the alignment with NCBI’s Multiple Sequence Alignment Viewer v.1.21.0 104
(Fig. S3). We compared amino acid position 105 (slightly different in our alignment because of 105
gaps) to identify the spectral tuning of each genome’s rhodopsin. 106
107
SFB urease gene tree: 108
To build a single-gene phylogeny of the SAR11 urease gene, we ran blastp on the LSUCC261 109
large subunit of the urease protein (UreC) to the nr database (accessed June 2018), collected the 110
200 best hits while excluding those labeled as “MULTISPECIES”, and added UreC amino acid 111
sequences from the San Francisco Bay metagenomic dataset [5] that were annotated as ureC in 112
IMG and identified using either a KO or pfam function search. The sequences were aligned with 113
MUSCLE v3.8.1551 [11], trimmed with trimAl v1.2 [12] using -automated1, and inferred with 114
IQ-TREE (version 1.6.12, default settings) [13]. 115
116
Cell size estimation 117
To calculate the volume of the cell, we first separated the cell image into two half spheres and a 118
curved cylinder. The cell volume, therefore, is the sum of the volumes of the curved cylinder and 119
the two half-spheres, where the radii of the half-spheres equal the section of the curved cylinder. 120
We estimated the length of the curved cylinder by drawing a curve connecting the center points 121
105
of all sections of the cylinder. The volume of the curved cylinder is the area of the section (πr
2
) x 122
length (Pappus’ centroid theorem). The volume of the two half-spheres was combined into one 123
as 4/3πr
3
. We summed the volumes of the sphere and the curved cylinder for the final estimate of 124
cell volume. The details of the calculations can be seen in Fig. S6 and Table S3. If a clear 125
septum is formed according to the image, we will do two separate annotations on the same 126
image, one for the parent cell (Fig. S7G), the other one for the two children cells (Fig.S6I). As 127
the result, the sizes of the children cells are the approximate minimum size of the strain and the 128
size of the mother cell is the approximate maximum. 129
130
131
Supplemental Results and Discussion 132
133
Additional genomic content not included in main text 134
Energetics. IIIa genomes contained oxidative phosphorylation genes encoding for an aerobic 135
chemoorganoheterotrophic lifestyle- as in other SAR11 genomes- with a predicted cytochrome c 136
oxidase, F-type ATP synthase, and a proton-pumping NADH dehydrogenase. Five members of 137
IIIa.1 and two members of IIIa.2 including isolates within IIIa.1(HIMB114, LSUCC0664, and 138
LSUCC0723) contained multiple copies of cytochrome c that belonged to two separate 139
orthologous gene clusters. 140
141
Membrane Transport. Like all other subclades of SAR11, IIIa contained polar amino acid ABC 142
transport, ntrXY genes for nitrogen sensing and assimilation, ammonium transport via amtB, the 143
regAB redox sensing two-component system, the envZ osmoregulation two-component system, 144
C4 dicarboxylate Tripartite ATP-Independent Periplasmic (TRAP) transporter, a phosphate ABC 145
transporter, and the sec-dependent pathway. 146
147
Minimal media verification of glycine/serine prototrophy. 148
We report the first verification of SAR11 IIIa glycine and serine prototrophy evidenced by 149
growth in JW2 and minimal media combinations found in Fig. S5. Minimal media combinations 150
that support growth included some TCA cycle intermediates that in theory could be used to form 151
glycine from glycolate via the glyoxylate shunt. It was hypothesized for HTCC1062 that the 152
presence of the glyoxylate shunt wouldn’t supply sufficient glycine for biomass because the 153
shunt directed the carbon compounds away from biosynthesis and towards energy production 154
due to low glycine concentrations in the cell [14]. If TCA cycle intermediates were to produce 155
glycine/serine via the glyoxylate bypass, the glycine concentration in the cell would already need 156
to be substantial through prototrophy. Additionally, LSUCC0723 does not contain the glyoxylate 157
shunt and grew in MWH2 medium, verifying the glycine/serine prototrophy is real rather than 158
supplied via TCA intermediates. 159
160
Supplemental Figure Captions 161
162
106
Supplemental Table 1: Accessory data used in this publication including: GTDB accessions, 163
CheckM statistics, and estimated genome size for all genomes, table of noted genomic features in 164
text, 16S blast hits of IIIa, ANI and AAI matrix of IIIa, AAI vs BLAST of IIIa, detailed gene 165
searches corresponding to previous publications, table of KO numbers that differ between 166
LSUCC isolate genomes, Anvi’o enriched pfam and KO, Virsorter outputs for isolates, input 167
table for sparse_growth_curve.py to calculate growth rates from salinity and temperature 168
experiments, growth data for minimal media experiment, minimal media setup, metagenomic 169
recruitment RPKM values, and collected metadata for the datasets used in recruitment. 170
Supplemental Table 1 is hosted at: https://doi.org/10.6084/m9.figshare.20415831. 171
172
Supplemental Table 2: Anvi’o pangenomic summary of 471 SAR11 genomes annotated with 173
the following sources from KEGG and Interproscan: Gene3D, SUPERFAMILY, TIGRFAM, 174
KEGG_Class, KOfam, ProSiteProfiles, Pfam, CDD, Hamap, PANTHER, KEGG_Module, 175
PIRSF, SMART, ProSitePatterns, Coils, MobiDBLite, PRINTS, SFLD. Supplemental Table 2 is 176
hosted at: https://doi.org/10.6084/m9.figshare.20415843. 177
178
Supplemental Table 3: Cell sizes measurements and estimations in Fig. S7. Supplemental Table 179
3 is hosted at: https://doi.org/10.6084/m9.figshare.20415852. 180
181
Figure S1: Boxplots of genome characteristics of IIIa compared to other SAR11. 182
183
Figure S2: Phylogenomic tree of 471 SAR11 genomes that are a combination of newly-added 184
genomes and publicly available. Node values are indicators of 1000 bootstrap support. 185
186
Figure S3: Multiple sequence alignment of IIIa proteorhodopsin with key spectral tuning 187
position boxed in red. 188
189
Figure S4: LSUCC0261 growth A) rates and B) curves at different temperatures. Points on B 190
indicate the average of three replicates and error bars indicate the standard deviation of cell 191
counts for three replicates measured. 192
193
Figure S5: LSUCC0261 growth in different minimal media. Points indicate the average of three 194
replicates and error bars indicate the standard deviation of cell counts for three replicates 195
measured. 196
197
Figure S6: Growth rates of LSUCC0261 grown in different minimal medium combinations. 198
199
Figure S7: Calculations of cell sizes. For example with the annotation in (G): we have the same 200
circles covering the entire cell shape. The radii (R = 45px = 88nm, half of the cell thickness) of 201
the identical circles includes the two half-spheres and the curved cylinder, from which we can 202
calculate the volume of the two half-spheres (in total, 4/3πR
3
= 0.0029 μm
3
). We then connect 203
the centers of the circles. The length of the connection line (l = 633.7 px = 1239 nm) is the length 204
of the curved cylinder. According to Pappus’ centroid theorem, the volume of the curved 205
cylinder is πlR
2
= 0.0301 μm
3
. We then get the total cell volume as 0.033 μm
3
. We applied this 206
method to all the cells in the images. (A) – (D) are the scanning electron microscopic images for 207
LSUCC0261. (E) and (F) are the transmission electron microscopic images for LSUCC0261. 208
107

(G) – (J) are the transmission electron microscopic images of LSUCC0664. (G) and (I) are two 209
identical images, where (G) is being annotated as a whole single cell while (I) is annotated as 210
two newborn cells since due to the presence of a likely septum. As the result, (K) — (M) are 211
showing the distributions of cell radius, lengths, and volumes. The data for making the violin 212
plots are in Table S3. 213
214
Figure S8: Phylogeny of the UreC sequences from the San Francisco Bay (SFB) with the 215
LSUCC0261 sequence highlighted. 216
217
Figure S9: Plot of BLAST hit percent identities between the SFB UreC sequences and the 218
LSUCC0261 UreC organized by samples with increasing salinities. 219
220
221
222
References 223
1. Henson MW, Lanclos VC, Pitre DM, Weckhorst JL, Lucchesi AM, Cheng C, et al. Expanding the 224
diversity of bacterioplankton isolates and modeling isolation efficacy with large-scale 225
dilution-to-extinction cultivation. Appl Environ Microbiol. 2020; 86. e00943-20. 226
2. Henson MW, Pitre DM, Weckhorst JL, Lanclos VC, Webber AT, Thrash JC. Artificial seawater 227
media facilitate cultivating members of the microbial majority from the Gulf of Mexico. 228
mSphere. 2016; 1: 1–10. 229
3. Henson MW, Lanclos VC, Faircloth BC, Thrash JC. Cultivation and genomics of the first 230
freshwater SAR11 (LD12) isolate. ISME J. 2018; 12: 1846–1860. 231
4. Bankevich A, Nurk S, Antipov D, Gurevich AA, Dvorkin M, Kulikov AS, et al. SPAdes: A new 232
genome assembly algorithm and its applications to single-cell sequencing. J Comput Biol. 233
2012; 19: 455–477. 234
5. Rasmussen AN, Francis CA. Genome-resolved metagenomic insights into massive seasonal 235
ammonia-oxidizing archaea blooms in San Francisco Bay. mSystems. 2022; 7: e0127021. 236
237
108

6. Chaumeil P-A, Mussig AJ, Hugenholtz P, Parks DH. GTDB-Tk: a toolkit to classify genomes with 238
the Genome Taxonomy Database. Bioinformatics. 2019;36: 1925–1927. 239
7. Jain C, Rodriguez-R LM, Phillippy AM, Konstantinidis KT, Aluru S. High throughput ANI analysis 240
of 90K prokaryotic genomes reveals clear species boundaries. Nat Commun. 2018; 9: 5114. 241
8. Parks DH, Imelfort M, Skennerton CT, Hugenholtz P, Tyson GW. CheckM: assessing the quality 242
of microbial genomes recovered from isolates, single cells, and metagenomes. Genome 243
Res. 2015; 25: 1043–1055. 244
9. Eren AM, Esen ÖC, Quince C, Vineis JH, Morrison HG, Sogin ML, et al. Anvi’o: an advanced 245
analysis and visualization platform for ’omics data. PeerJ. 2015; 3: e1319. 246
10. Savoie ER, Lanclos VC, Henson MW, Cheng C, Getz EW, Barnes SJ, et al. Ecophysiology of the 247
Cosmopolitan OM252 Bacterioplankton (Gammaproteobacteria). mSystems. 2021; 6: 248
e0027621. 249
11. Edgar RC. MUSCLE: Multiple sequence alignment with high accuracy and high throughput. 250
Nucleic Acids Res. 2004; 32: 1792–1797. 251
12. Capella-Gutierrez S, Silla-Martinez JM, Gabaldon T. trimAl: a tool for automated alignment 252
trimming in large-scale phylogenetic analyses. Bioinformatics. 2009; 25: 1972–1973. 253
13. Nguyen L-T, Schmidt HA, von Haeseler A, Minh BQ. IQ-TREE: a fast and effective stochastic 254
algorithm for estimating maximum-likelihood phylogenies. Mol Biol Evol. 2015; 32: 268– 255
274. 256
14. Carini P, Steindler L, Beszteri S, Giovannoni SJ. Nutrient requirements for growth of the 257
extreme oligotroph ‘Candidatus Pelagibacter ubique’ HTCC1062 on a defined medium. 258
ISME J. 2013; 7: 592–602. 259
109

110

111

112

113

114

115

116

117
Chapter 2 Supplemental Materials

Figure S1: RPKM values for each genome in the analysis plotted across salinity values. The
regression lines include shading that represents a 95% confidence interval

118

Figure S2: Boxplots of the total RPKM values for each CHAB-I-5 cluster with a log10
transformation. Black bars represent the median value of the data.
2
1
1e−05 1e−03 1e−01
RPKM
Cluster
CHABI | all data | with log
119

Figure S3: RPKM values summed by cluster for each sample plotted on a global map with
Cluster 1 in green and Cluster 2 in blue. The size of the dots increase as RPKM values increase.

2
1
−100 0 100 200
−50
0
50
−50
0
50
long
lat
alpha
0.1
Cluster
1
2
Sum_RPKM
0.0
2.5
5.0
7.5
120

Figure S4: Temperature experiment growth curves for US3C007 in AMS1 media. Colors indicate
replicate conditions.

121

Figure S5: Salinity experiment growth curves for US3C007 at ~24˚C. Colors indicate replicates
and the numbers above each curve represent the salinity value tested.

122

Figure S6: Scanning electron microscopy images with image analysis markings denoted for cell
dimension calculations.
Table S1: Supplementary tables for Chapter 2 are far too large to be formatted in text and can
be viewed at
https://docs.google.com/spreadsheets/d/1coyOxz5Sg00Ad_E4NPK7VqoAPXtjQx6b/edit?usp=sh
aring&ouid=117752608341839133228&rtpof=true&sd=true

123
Chapter 3 Supplemental Materials

124
Chapter 3 Appendix 1. Media Recipes (Modified from Bakshi et al. 2019)

Each artificial seawater medium is comprised of multiple components that are made separately and combined in the
final recipe. Below we detail how to make each mix/stock, and how these are combined in the final medium. For all
solutions we use acid-washed Pyrex screw-capped bottles. Note, besides the basic salts, which are made fresh for
each batch of medium, the stocks and mixes can be maintained at 4˚C for additional uses. We recommend remaking
the stocks and mixes every 2-3 months to avoid contamination.

Mg/Ca stock (20x)
In 100 mL deionized, MilliQ-filtered water, dissolve MgCl2x 6 H2O (21.2 g) and CaCl2x 2 H2O (3.04 g). Autoclave.

Iron stock (1,000x)
In 100 mL deionized, MilliQ-filtered water, dissolve FeSO4x 7 H2O (0.0028 g) and Nitrilotriacetic acid (NTA)
disodium salt (0.0081 g). Filter sterilize (0.2 µm).

AA mix (50,000x)
This can be purchased from Sigma Aldrich (Cat #M5550). Filter sterilize (0.2 µm).

FA mix (2,000,000x)
Combine the following: EtOH (54.86 mL), octanoic acid (15.84 mL), decanoic acid (17.26 g), isobutyric acid (9.27
mL), butyric acid (9.14 mL), and valeric acid (10.88 mL). Filter sterilize (0.2 µm).

Inorganic N mix (2,000x)
In 100 mL deionized, MilliQ-filtered water, dissolve sodium nitrate (0.646 g), sodium nitrite (0.028 g), and
ammonium chloride (0.053 g). Filter sterilize (0.2 µm).

Trace metals (100,000x)
In 100 mL deionized, MilliQ-filtered water, dissolve MnCl2x 4 H2O (0.018 g), ZnSO4x H2O (0.002 g), CoCl2(0.001
g), Na2MoO4(0.001 g), Na2SeO3(0.002 g), NiCl2(0.001 g). Filter sterilize (0.2 µm).

Vitamins (100,000x)
In 100 mL deionized, MilliQ-filtered water, dissolve thiamine (1.69 g), riboflavin (0.003 g), niacin (0.985 g),
pantothenate (1.013 g), pyridoxine (1.028 g), biotin (0.010 g), folic acid (0.018 g), B12 (0.010 g), myo-inositol
(0.901 g), and 4-aminobenzoic acid (0.823 g). Filter sterilize (0.2 µm). Wrap container in foil to avoid
photodegradation of vitamins.

P mix for MWH-type media (1,000x)
In 100 mL deionized, MilliQ-filtered water, dissolve orthophosphate (0.0022 mL) and KH2PO4(0.068 g). Filter
sterilize (0.2 µm).

Misc mix for MWH-type media (20,000x)
In 100 mL deionized, MilliQ-filtered water, dissolve L-glutamine (0.146 g), dextrose (0.180 g), D-ribose (0.150 g),
sodium pyruvate (0.110 g), sodium citrate (0.294 g), oxaloacetic acid (0.132 g), Sodium acetate (0.082 g), Sodium
succinate (0.162 g), alpha-ketoglutaric acid (0.168 g), urea (0.606 g), glycerol (0.074 mL), glycine betaine (0.154 g),
choline (0.140 g), sodium thiosulfate (0.158 g), cyanate (0.003 g), DMSO (0.056 mL), and DMSP (0.011 g). Filter
sterilize (0.2 µm).

Misc mix JW-type media (2,000x)
In 100 mL deionized, MilliQ-filtered water, dissolve L-glutamine (0.015 g), dextrose (0.018 g), D-ribose (0.015 g),
sodium pyruvate (0.011 g), sodium citrate (0.029 g), oxaloacetic acid (0.013 g), Sodium acetate (0.008 g), Sodium
succinate (0.016 g), alpha-ketoglutaric acid (0.017 g), urea (0.061 g)

125
Basic salts:

JW1 JW2 JW3 JW4 MWH1 MWH2 MWH3 MWH4
H2O (mL) 950 967 987.250 991.5 950 967 987.250 991.5
NaCl (g) 23.840 15.901 7.939 3.969 23.840 15.901 7.939 3.969
KCl (g) 0.746 0.498 0.248 0.124 0.746 0.498 0.248 0.124
NaHCO3 (g) 0.840 0.840 0.840 0.840 0.840 0.840 0.840 0.840
Na2SO4 (g) 4.270 2.848 1.422 0.711 4.270 2.848 1.422 0.711
NaBr (g) 0.082 0.055 0.027 0.014 0.082 0.055 0.027 0.014
H3BO3 (g) 0.026 0.017 0.009 0.004 0.026 0.017 0.009 0.004
SrCl2 (g) 0.014 0.009 0.005 0.002 0.014 0.009 0.004 0.002
NaF (g) 0.002 0.002 0.001 0.001 0.002 0.002 0.001 0.001
KH2PO4 (g) 0.007 0.007 0.007 0.004 X X X X

Final recipe- In a biosafety cabinet, add the following to the basic salts mix while stirring and filter sterilize (0.1
µm) the entire medium into a sterile container. Check medium pH, which should be ~8.2-8.3. Wrap with foil. Store
at room temperature prior to dispensing.

Mix JW1 JW2 JW3 JW4 MWH1 MWH2 MWH3 MWH4
Mg/Ca (mL) 50 33 17 8.5 50 33 17 8.5
Iron (mL) 1 1 1 1 1 1 1 1
AA Mix (µL) 20 20 20 20 20 20 20 20
FA Mix (µL) 0.5 0.5 0.5 0.5 0.5 0.5 0.5 0.5
Inorganic N (mL) 0.5 0.5 0.5 0.5 0.5 0.5 0.5 0.5
Trace Metals (µL) 10 10 10 10 10 10 10 10
Vitamins (µL) 10 10 10 10 10 10 10 10
Misc Mix JW (mL) 0.5 0.5 0.5 0.5 X X X X
Misc Mix MWH (µL) X X X X 50 50 50 50
P Mix (mL) X X X X 1 1 1 1

For additional media recipes that use modifications of the basic salts solution, see:

Henson, Michael W., V. Celeste Lanclos, Brant C. Faircloth, and J. Cameron Thrash. 2018. Cultivation and
genomics of the first freshwater SAR11 (LD12) isolate.The ISME Journal 12:1846-1860

126
Chapter 3 Appendix 2: Order List

Consumables (most will last >1 semester) Supplier Cat number Quantity Use
ICF instrument cleaning fluid (100ml)
Millipore
sigma
4200-0140 3
Guava flow cytometer
cleaning fluid
Serocluster,u-btm,n/s cs100 VWR 29442-396 1 Cell count plate
SYBR green I
Millipore
sigma
S9430-.5ML 1 Cell count DNA stain
Flow cell replacement
Millipore
sigma
0500-2260 1
Guava flow cytometer
part that is routinely
exchanged
Easy check kit
Millipore
sigma
4500-0025 1
Guava flow cytometer
callibration check
96-well, microwell microplates, round
wells,pack of 5
VWR 10036-122 2
Carbon experiment
vessel
VWR pipette sero 50ml pr cs100 VWR 89130-902 1 Media dispensing
VWR pipette sero 10ml pr cs200 VWR 89130-898 1 Media dispensing
50ml centrifuge tubes / bulk / cs500 VWR 10025-698 1 Stocks
2.0ml micro tubes / pk400 VWR 10025-738 1
Portioning of stocks,
culture, etc
Flasks polcarbonate 125ml VWR 89095-260 1 Culturing vessels
Nalgene™ rapid-flow™ sterile disposable
filter units with pes membrane
Thermofisher 567-0020 1
Media filtering and
storage
VWRsyringe filter .2um cs100 VWR 28145-499 1 Stock filtering
Syringe strl luerlok 60ml pk40. Cs160 VWR BD309653 1 Stock filtering
AA mix (5000x) Sigma M5550-100ML 1 Media component
L-Glutamine Sigma 56-85-9 1 Media component
Dextrose Sigma 50-99-7 1 Media component
D-Ribose Sigma 50-69-1 1 Media component
Sodium pyruvate Sigma 113-24-6 1 Media component
Sodium citrate Sigma 6132-04-3 1 Media component
Oxaloacetic acid Sigma 328-42-7 1 Media component
Sodium acetate Sigma 127-09-3 1 Media component
Sodium succinate Sigma 6106-21-4 1 Media component
a-ketoglutaric acid Sigma 22202-68-2 1 Media component
Urea Sigma 57-13-6 1 Media component
Octanoic Acid Sigma O3907-500ML 1 Media component
Decanoic Acid Sigma C1875-500G 1 Media component
Isobutyric Acid Sigma K1875-5G 1 Media component
Butyric Acid Sigma O3907-500ML 1 Media component
Valeric Acid Sigma C1875-500G 1 Media component
EtOH Sigma I1754-500ML 1 Media component
Sodium nitrate Sigma B103500-500ML 1 Media component
Sodium nitrite Sigma 240370-100ML 1 Media component
Ammonium chloride Sigma 12125-02-9 1 Media component
NaCl Sigma 7647-14-5 1 Media component
KCl Sigma 7447-40-7 1 Media component
NaHCO3 Sigma 144-55-8 1 Media component
Na2SO4 Sigma 7757-82-6 1 Media component
NaBr Sigma 7647-15-6 1 Media component
H3BO3 Sigma 10043-35-3 1 Media component
SrCl2 Sigma 10025-70-4 1 Media component
NaF Sigma 7681-49-4 1 Media component
KH2PO4 Sigma 7778-77-0 1 Media component
127
MgCl2 x 6H2O Sigma 7791-18-6 1 Media component
CaCl2 x 2H2O Sigma 10035-04-8 1 Media component
FeSO4 x 7H2O Sigma 15422-250G 1 Media component
NTA NA2 salt Sigma N0128-100G 1 Media component
MnCl2 x 4H2O Sigma M3634-100G 1 Media component
ZnSO4 X H2O Sigma 307491-100G 1 Media component
CoCl2 Sigma 232696-5G 1 Media component
Na2MoO4 Sigma 243655-5G 1 Media component
Na2SeO3 Sigma 214485-5G 1 Media component
NiCl2 Sigma 339350-50G 1 Media component
B1/Thiamine Sigma T4625-25G 1 Media component
B2/Riboflavin Sigma R4500-25G 1 Media component
B3/Niacin Sigma N4126-100G 1 Media component
B5/Pantothenate Sigma C8731-100G 1 Media component
B6/Pyridoxine Sigma P9755-25 1 Media component
B7/Biotin Sigma B4501-100MG 1 Media component
B9/Folic Acid Sigma F7876-1G 1 Media component
B12 Sigma V2876-250MG 1 Media component
Myo-inositol Sigma I5125-50G 1 Media component
4-Aminobenzoic Acid Sigma 127671-25G 1 Media component
Flow cytometer BD, Luminex Cell counts
Bisafety cabinet or laminar flow hood VWR/Fisher Sterility
Balances with 0.001gr sensitivity VWR/Fisher Media preparation
Weigh paper VWR/Fisher Media preparation
Filtered tips (1mL, 200uL, 10uL) VWR/Fisher Sterility
Pipettes (1mL, 200uL, 10uL) VWR/Fisher Culture handling
10% HCL bath VWR/Fisher Dishwashing
VWR markers VWR Labeling
Tape for labels VWR/Fisher Labeling
10% bleach VWR/Fisher Sterility
70% ethanol VWR/Fisher Sterility
Latex free gloves VWR/Fisher Sterility

128

Chapter 3 Appendix 3. Student Lab Manual (USC)-Contains student instructions

Chapter 1: Stocks and Carbon Plate Calculations
Learning Objectives:
-Define the Great Plate Count Anomaly and the role that medium composition might play in it.
-Be able to compare and contrast natural seawater medium and artificial seawater medium.
-Understand how Henson et al. 2016 is related to the GPCA and the overall importance of the paper to
environmental microbiology.
-Calculate volumes and weights needed to make a nutrient stock at a given concentration.
-Use a balance and sterile technique to create carbon stocks that will be used in the next lab.

Pre-lab reading
Bacterial cells rely on macromolecules (carbohydrates, proteins, lipids, and nucleic acids) to live. Many
bacterial cells are highly specialized in the types of macromolecules that can be used for life. In addition to the types
of macromolecules, many bacterial cells are sensitive to the concentration of nutrients in their surroundings.
Oligotrophic organisms need a relatively low-nutrient environment to thrive while copiotrophic organisms thrive on
high-nutrient eutrophic systems.

Historically, progress in microbiology has been hindered by the difficulty of obtaining pure bacterial
cultures. Most of the traditional knowledge about bacterial biochemistry, interactions, antibiotics, etc come from
easily cultivated model organisms like Escherichia coli, Bacillus subtilis, Pseudomonas fluorescens, or Azotobacter
vinelandii. These organisms have been tremendous in the amount of knowledge that we have gathered from them,
but they are not representative of environmental microbial diversity. The difficulty of cultivation of many
prokaryotes has been coined the Great Plate Count Anomaly (Staley and Konopka, 1985) in which there is a
discrepancy between number of cell types known to exist in a sample and the number of cell types that have been
cultured from a sample. This anomaly is due to many reasons, but some of the most important are competition for
nutrients, symbiotic interactions, and poor medium design.

Medium must contain all of the classes of molecules discussed earlier since they are vital for the bacteria to
survive. Often, a bacterial species that is successful or a key player in biogeochemical cycles is the result of
extensive evolution and natural selection acting upon populations. To successfully cultivate specialized types of
cells, researchers need to have a medium that mimics the environment closely enough so that the cells are capable of
making the habitat transition. Imagine humans needing to inhabit another planet. It is impossible for us to breath an
atmosphere that is too different than ours. If we try to colonize Mars as is, we will not survive the transition.

One way that researchers have been able to help solve the GPCA in aquatic systems is by using sterilized
natural seawater medium. To use natural seawater as a cultivation medium, researchers collect seawater from the
same location that they are trying to isolate bacteria from, filter out large organisms, and autoclave the seawater to
ensure it is sterile. Then, they use the water as-is or add in whatever nutrients they would like in the media. This type
of medium allows for certainty that factors such as nutrient content and salinity remain suitable for whatever
microbes are targeted for cultivation since they were already in the system. This method has been successful and is
still used, but natural seawater medium has a few key limitations. The first limitation of natural seawater medium is
the batch effect that happens with the seawater. Depending on the time of year and characteristics of the physical
movement of water, the nutrient content of water at a location will not be consistent over time. The second limitation
of natural seawater medium is the storage and transportation difficulty. If the researcher is not close to the water
body studied, they must determine how much seawater they will need to run all experiments and find a place to keep
it all without contaminating it.

Natural seawater is complex and undefined. This means that there is a complex suite of nutrients available
to the organism in culture, but researchers cannot always exactly quantify the ratio or sometimes the identity of each
type. The medium type that we are using in this lab is artificial seawater medium designed as part of Henson et al.
2016. This specific mixture of nutrients was created to mimic the coastal Gulf of Mexico in which our isolated
129
bacterial cells are from. This medium type is complex and defined, meaning there is still a complex suite of nutrients
available to the organism in culture, but we know exactly what type of molecule is there and in what concentration.
Additionally, we are able to modify the medium’s salinity to account for fluctuations in the estuarine environments
that coastal bacteria might encounter there.
This lab will result in the creation of various nutrient stocks that will aid to the cell’s production of
macromolecules essential to life. To do this, we will use the dilution equation. The dilution equation is as follows:
(initial concentration)(volume transferred)=(final concentration)(final volume)
Henson et al. discussion:
1. What was the motivation behind the paper?

2. What was the goal of the paper?

3. What did this paper contribute to the general scientific field?

4. What is the LSUCC?

5. Why is it important to be able to culture environmentally-relevant microbes?

Additional Notes/Questions:

Exercise #1: Calculations for stocks
Materials needed:
-Calculator
In this activity, we will perform the calculations needed to create the carbon sources that will be tested for our
bacterial isolate.

Gather some of these values from your instructor:

Assigned nutrient source(s):___________________________________________________

Final concentration of nutrient source needed in each well: _______________

Media volume in each well of plate:______________
130

Stock volume: __________________

Calculations:

1. Use the following equation to determine the mass of reagent needed to make a nutrient stock at _____________:

Mass = formula weight * Volume MilliQ Water (L) * concentration (M)

2. Use the following equation to determine the volume of nutrient stock needed for each well of the minimal media
plate:

Volume of stock to plate = (Final concentration desired in well * Final volume in well) /
Concentration of the stock

3. Use the following equation to determine the volume of culture needed to inoculate the plate:

Volume of culture = (Concentration of culture desired in well * Final volume in well)/
Concentration of culture

Do your calculations here and on the back of this page if needed for each stock:

131
Exercise #2: Creation of nutrient stocks
Materials needed:
-Biosafety cabinet
-Lab coat
-10% bleach
-70% ethanol
-Paper towels
-Gloves
-Pipettes and tips
-Milli-Q or other ultrafiltered water. DI acceptable.
-1-2 balance(s) per benchtop, weigh paper, clean scoops
-Stock of carbon, nitrogen, and sulfur sources to be tested
-1 50mL falcon tube/student
-Labeling equipment (markers and tape)
-1 0.2µm filter/student
-1 60mL syringe/student
Use the balance to measure your chemical out and mix it in a falcon tube containing _____________Mili-Q H2O.
Each student will be responsible for their own stocks, but should work in groups of two.
Usage of balance:
-Ensure the balance is clean and nothing is on top of it.
-Press “0” or “Zero” to calibrate the balance to no weight on it.
-Put your weigh boat or weigh paper on the scale.
-Press “tare” to reset the weight back to zero.
-Measure out the needed mass onto the boat or paper with a scoopula. If you spill, you must restart.
-Record your data in the chart below.
-Put your chemical into the falcon tube of water and ensure it dissolves completely
-Fully label everything.
Fill out the table below:
Chemical Goal Measurement Actual Measurement Notes

To filter your stock:
Before entering the biosafety cabinet, fully label a new falcon tube with the following information:
Name of chemical, stock concentration, 0.2um filtered, initials, date
In the biosafety cabinet, filter your stock through a 0.2um filter using sterile technique. Follow these steps:
-Tuck your lab coat into your gloves. There should be no skin showing ever.
-Use the squirt bottle and paper towels to wipe down your workspace with 10% bleach first, then 70%
ethanol
132
-Squirt ethanol onto your gloves and rub your hands together until dry.
-Unwrap a 60mL syringe and pull out the plunger. Make sure to stand the plunger upright with the black
rubber side up.
-Attach your filter to the end of the syringe.
-Pour your stock into the syringe over a container.
-Hold the syringe over a falcon tube and pop the plunger back into the syringe. Push the entire stock
through the filter and into the falcon tube. Be careful not to spill on the sides.
-Close the falcon tube tightly and store your stock with the instructor.
Exercise #3: Creation of other media types
The following tables show the composition of our medium types. What trends do you notice?
Basic salts:

JW1 JW2 JW3 JW4 MWH1 MWH2 MWH3 MWH4
H2O (mL) 950 967 987.250 991.5 950 967 987.250 991.5
NaCl (g) 23.840 15.901 7.939 3.969 23.840 15.901 7.939 3.969
KCl (g) 0.746 0.498 0.248 0.124 0.746 0.498 0.248 0.124
NaHCO3 (g) 0.840 0.840 0.840 0.840 0.840 0.840 0.840 0.840
Na2SO4 (g) 4.270 2.848 1.422 0.711 4.270 2.848 1.422 0.711
NaBr (g) 0.082 0.055 0.027 0.014 0.082 0.055 0.027 0.014
H3BO3 (g) 0.026 0.017 0.009 0.004 0.026 0.017 0.009 0.004
SrCl2 (g) 0.014 0.009 0.005 0.002 0.014 0.009 0.004 0.002
NaF (g) 0.002 0.002 0.001 0.001 0.002 0.002 0.001 0.001
KH2PO4 (g) 0.007 0.007 0.007 0.004 X X X X

Final recipe- In a biosafety cabinet, add the following to the basic salts mix while stirring and filter sterilize (0.1
µm) the entire medium into a sterile container.

Mix JW1 JW2 JW3 JW4 MWH1 MWH2 MWH3 MWH4
Mg/Ca (mL) 50 33 17 8.5 50 33 17 8.5
Iron (mL) 1 1 1 1 1 1 1 1
AA Mix (µL) 20 20 20 20 20 20 20 20
FA Mix (µL) 0.5 0.5 0.5 0.5 0.5 0.5 0.5 0.5
Inorganic N (mL) 0.5 0.5 0.5 0.5 0.5 0.5 0.5 0.5
Trace Metals (µL) 10 10 10 10 10 10 10 10
Vitamins (µL) 10 10 10 10 10 10 10 10
133
Misc Mix JW (mL) 0.5 0.5 0.5 0.5 X X X X
Misc Mix MWH (µL) X X X X 50 50 50 50
P Mix (mL) X X X X 1 1 1 1

Your instructor will give you a list of media types to make and divide up the responsibilities across groups and
sections.

Use the balance to measure your chemical out and mix in ________mL Mili-Q H2O.

Fill out the table below:
Chemical Goal Measurement Actual Measurement Notes

134
Chapter 2: Minimal Media Experiment
Learning Objectives:
-Define biogeochemistry.
-Be able to compare and contrast autotrophy and heterotrophy in bacteria.
-Understand where carbon is used in bacterial cells.
-Use Buchan et al. 2014 to understand where bacteria fit into a marine ecosystem
-Use sterile technique to inoculate the minimal media experiment for our organism.

Pre-lab reading:
Biogeochemistry is defined as “the study of microbially mediated chemical transformations of geochemical
interest”. Some important cycles that are microbially-mediated are the carbon, nitrogen, and sulfur cycles. Every
living thing needs carbon (as you will learn in-depth in organic chemistry). Autotrophic organisms can use inorganic
carbon for their life cycles while heterotrophic organisms require organic carbon. The carbon that a cell intakes is
used for either biomass production (incorporation into amino acids, lipids, DNA, etc) or respiration as CO2.
Nitrogen that is used for biomass production and is shunted into amino acids, proteins, and nucleic acids. Sulfur is
used by cells for energy generation and the production of vitamins and amino acids.

Classification Energy
Source
Carbon
Source
Examples
Chemotrophs
Chemoautotrophs Chemical Inorganic
Hydrogen-, sulfur-, iron-, nitrogen-, and carbon
monoxide-oxidizing bacteria
Chemoheterotrophs Chemical
Organic
compounds
All animals, most fungi, protozoa, and bacteria
Phototrophs
Photoautotrophs Light Inorganic
All plants, algae, cyanobacteria, and green and
purple sulfur bacteria
Photoheterotrophs Light
Organic
compounds
Green and purple nonsulfur bacteria, heliobacteria

In environmental microbiology, it is oftentimes a slow and difficult process to determine which organisms
are doing a specific piece of the biogeochemical cycle that you care about. Furthermore, it is important to remember
that no piece of any cycle is ever actually independent of others. Nothing exists in a vacuum and instead has many
factors that will enhance or decrease any portion of these reactions at any given time. That being said, it is still vital
to understand how environmentally-relevant organisms are possibly interacting with their environment in these
cycles. Culture-dependent work is important to ground-truth suggested genomic features and patterns seen in the
environment. Working with bacterial cultures allows researchers to quantify the capabilities of an organism over a
range of factors to try to link the microorganisms to their environmental role.

Table 2-1: Table of terminology to describe organisms based on their energy and carbon
sources. Table source:https://openstax.org/books/microbiology/pages/8-1-energy-matter-and-
enzymes#17019/.
135
Exercise #1: Literature reading
To gather an ecosystem-level overview of aquatic biogeochemical cycles and the way that microbes are playing
their part in it, use Figure 1 from the below reference to define the following terms:

Buchan, Alison, Gary R. LeCleir, Christopher A. Gulvik, and José M. González. 2014. “Master Recyclers: Features
and Functions of Bacteria Associated with Phytoplankton Blooms.” Nature Reviews. Microbiology 12 (10): 686–98

Plankton:

Phytoplankton:

Bacterioplankton:

DOM:

POM:

Microbial Loop:

Biological pump:

Microbial carbon pump:

Viral Shunt:

Remineralization:
Record at least two questions that you’d like to discuss in class:
1.

2.
136

Exercise #2: Minimal Media Plate #1 Inoculation
Materials needed:
-Biosafety cabinet
-Lab coat
-10% bleach
-70% ethanol
-Paper towels
-Gloves
-Pipettes and tips
-Mili-Q or other ultrafiltered water. DI acceptable.
-Healthy bacterial culture
-Nutrient stocks created last class
-Base media at each benchtop
-1 2mL microcentrifuge tube/student
Each student will test a minimal media combination to see whether it is sufficient to allow our isolate to grow.

Record the following:
My assigned source(s):
Well(s):

The chart below is representative of the 96-well plate that we will use for this experiment. Note the shaded gray
square will be A1. Label the rows A-H and the columns 1-12. Use this to keep track with where your experimental
condition will be in the plate and be sure not to accidently pipette into someone else’s well.

In the biosafety cabinet, set up the carbon experiment. Follow these steps:
-Tuck your lab coat into your gloves. There should be no skin showing ever.
-Use the squirt bottle and paper towels to wipe down your workspace with 10% bleach first, then 70%
ethanol
-Squirt ethanol onto your gloves and rub your hands together until dry.
-Using a new tip each time, use the following chart to guide you and pipette the following into a labeled
microcentrifuge tube:
137

Tube 1 Tube 2 (if applicable)
Base Media 1.5mL 1.5mL
Carbon
_______µL of
_______________
_______µL of
_______________
Nitrogen
_______µL of
_______________
_______µL of
_______________
Sulfur
_______µL of
_______________
_______µL of
_______________
Culture Added?
Placed in well?

-When you have all of your media combinations ready and the chart below filled, bring your tube into the
biosafety cabinet and pipette all of each tube into its corresponding assigned well.

Potential errors:

Exercise #3: Minimal Media Plate #1 Transfer into Plate #2
In the biosafety cabinet, set up the minimal media experiment plate #2. Follow these steps:
138
-Tuck your lab coat into your gloves. There should be no skin showing ever.
-Use the squirt bottle and paper towels to wipe down your workspace with 10% bleach first, then 70%
ethanol
-Squirt ethanol onto your gloves and rub your hands together until dry.
-Using a new tip each time, use the following chart to guide you and pipette the following into a labeled
microcentrifuge tube:

Tube 1 Tube 2 (if applicable)
Base Media 1.5mL 1.5mL
Carbon
_______µL of
_______________
_______µL of
_______________
Nitrogen
_______µL of
_______________
_______µL of
_______________
Sulfur
_______µL of
_______________
_______µL of
_______________
Placed in well?
Culture transferred?

-Then, transfer _________ µL of the well from plate #1 into the corresponding well of plate #2.

Potential error(s):

Exercise #4: Minimal Media Plate #2 Transfer into Plate #3
In the biosafety cabinet, set up the minimal media experiment plate #3. Follow these steps:
-Tuck your lab coat into your gloves. There should be no skin showing ever.
139
-Use the squirt bottle and paper towels to wipe down your workspace with 10% bleach first, then 70%
ethanol
-Squirt ethanol onto your gloves and rub your hands together until dry.
-Using a new tip each time, use the following chart to guide you and pipette the following into a labeled
microcentrifuge tube:

Tube 1 Tube 2 (if applicable)
Base Media 1.5mL 1.5mL
Carbon
_______µL of
_______________
_______µL of
_______________
Nitrogen
_______µL of
_______________
_______µL of
_______________
Sulfur
_______µL of
_______________
_______µL of
_______________
Placed in well?
Culture transferred?

-Then, transfer _________ of the well from plate #2 into the corresponding well of plate #3.

Potential error(s):

For each hypothetical media result below, record an interpretation of the data:

Plate 1 Plate 2 Plate 3 Interpretation
1 + + +
2 - - -
3 + - -
4 + - +
5 - - +

140
Chapter 3: Temperature

Learning Objectives:
-Compare and contrast the effect of high or low temperatures on a cell.
-Define classifications of microbes based on temperature.
-Use external resources to quickly connect our lab to the external pool of data online and design an experiment
-Use sterile technique to inoculate the salinity experiment for the semester.

Prelab reading
The cardinal temperatures refer to the minimum, maximum, and optimum temperature at which an
organism can grow. Plots of this data are generally displayed with growth rate on the y axis and temperature on the x
axis. At minimum temperature, the growth rate of the culture slows due to membrane gelling in which the cellular
membrane is not as fluid as it should be and is somewhat “frozen”. At the maximum temperature, proteins denature
and the membrane deteriorates causing cell lysis. At the optimum, the cell’s enzymes are functioning at peak ability
and the membrane is fluid and semi-permeable.
We know that bacteria are found in oceans, sediments, and our bodies, but they are also documented in the
Antarctic ice, hot springs, and in fracking shales. To be able to survive in extreme environments, bacterial cells often
have specialized enzymes that function optimally at really cold or really warm environments. Organisms that live in
the extremely hot or extremely cold environments can be classified as extremophiles. Bacteria can be classified by
the following temperature categories: psychrophiles, mesophiles, thermophiles, hyperthermophiles as seen below.

Figure 3-1. Temperature classifications of bacteria. Image source:
https://openstax.org/books/microbiology/pages/9-4-temperature-and-microbial-growth
141
Exercise 1: Experimental Design
We will inoculate the temperature experiment for our isolate. With your class, decide on an experimental design.
Remember that this organism was isolated from the coast of Louisiana. Spend 10-15 minutes researching
temperature conditions in this ecosystem if needed.
Include the following as part of your experimental design and discuss with your instructor as a class.
Media needed:
Temperatures tested:
Number of replicates per condition:
Controls:
Cell count frequency:
Predict patterns of growth with these temperatures and generate a hypothesis.

Exercise 2: Temperature inoculation and t0:
Materials needed:
-Biosafety cabinet
-Lab coat
-Safety goggles
-10% bleach
-70% ethanol
-Paper towels
-Gloves
-Pipettes and tips
-Mili-Q or other ultrafiltered water. DI acceptable.
-Healthy bacterial culture
-1-2 flasks/student
-Isolation media/benchtop

Before starting, review what you have learned about sterile technique when handling bacterial cultures in previous
chapters. To determine the volume of culture needed, use the cell count provided by your instructor and the dilution
equation to get a starting concentration of 10
4
cells/mL. show your work below.

C1V1=C2V2

142

Volume of culture to inoculate each flask: __

Instructions:
____________________.
-Use sterile technique to put 50mL of the appropriate media into the flask.
-Pipette the volume of culture needed from above into your flask.
-Prepare the cells to be counted by portioning 200µL into a labeled microcentrifuge tube. Your instructor
will fix them in 3% glutaraldehyde to perform cell counts later. Your instructor will review how
glutaraldehyde preserves cells in the cell count laboratory.

Exercise 2: Temperature diversity
Spend 20 minutes to create the following presentation about your assigned temperature category.

Category:

Bacteria that fits into this category:

Temperature range:

Culture dependent or independent work?

Has this organism ever been isolated? If so, from where?

Include image of environment that fits this criteria.

Sources:

143

Chapter 4: Microbial Growth
Learning Objectives:
-Label the parts of a bacterial growth curve
-Compare and contrast multiple methods of counting cells in a bacterial culture
-Discuss why oligotrophy vs copiotrophy could affect the mode of cell counting that is used

Pre lab reading:
When bacterial cells grow, they divide by binary fission and this results in a single cell becoming two
clonal cells. Depending on the generation time, cells can be classified as oligotrophic or copiotrophic. Oligotrophic
organisms are generally slow growing and only need small amount of nutrients to grow. Copiotrophic organisms,
however, are fast growers and have historically been the most easily studied type of organism.

The number of bacterial cells over time is plotted as a growth curve. There are several regions of a typical
bacterial culture’s growth curve. Lag phase occurs when a transfer into new medium happens and the population of
cells does not grow. This is potentially due to the cells needing an “adjustment period” to up or down regulate their
transcription of genes in response to the new environment. Exponential growth is the phase of growth in which cell
counts are growing the fastest. This stage is when cultures are the healthiest and rapidly using up the provided
nutrients. Stationary phase is when a limiting essential nutrient is completely used or when too many metabolic
byproducts accumulate in the culture. Cells can no longer continue with exponential growth and the growth will
slow to a halt. At this stage, cell growth and death are balanced. Death occurs after stationary phase when the
number of dividing cells is lower than the number of dead cells.

Figure 4-1: (a) The electron micrograph depicts two cells of Salmonella typhimurium after a binary
fission event. (b) Binary fission in bacteria starts with the replication of DNA as the cell elongates. A
division septum forms in the center of the cell. Two daughter cells of similar size form and separate, each
receiving a copy of the original chromosome. Figure and caption source:
https://openstax.org/books/microbiology/pages/9-1-how-microbes-grow.
144

When a culture exists in medium with multiple substrates available to use, sometimes growth curves will
show diauxic growth patterns. When the organism uses one substrate fully, there is an additional lag period in which
the cells shift their transcription to be able to swap to another substrate. When grown in the presence of two
substrates, E. coli uses the preferred substrate (in this case glucose) until it is depleted. Then, enzymes needed for
the metabolism of the second substrate are expressed and growth resumes, although at a slower rate.
Bacteria are too small to count with our eyes, so there are many different ways that we can count cells and
track their growth. Some of the common methods are:
1. Direct counts with light microscope: Fluorescence microscopy is one way that cells can be counted. Some cell
types can be seen with only a microscope, but oftentimes cells need to be stained to increase contrast and more
easily see the cells under a microscope. Some stain types that are frequently used are DAPI and SYBR Green.

2. Serial dilutions allow a mathematical way to determine cell count when organisms can be cultured on agar plates.
The dilution continues until there is a countable number of colonies on a plate. This is an estimate that can be done
with the naked eye.
Figure 4-2: Left: A standard bacterial growth curve with each phase indicated. Right: Growth curve
of E. coli exhibiting diuxic growth on glucose and lactose as substrates. Image and caption sources:
https://cnx.org/contents/kxd8RhSc@1.9:-_3GDcE6@2/How-Microbes-Grow and
https://cnx.org/contents/kxd8RhSc@1.9:0keuXsZD@1/Gene-Regulation-Operon-Theory.
Figure 4-3: Fluorescence staining (left) can be used to differentiate between viable and dead bacterial cells
in a sample for purposes of counting. Viable cells are stained green, whereas dead cells are stained red. This
diagram (right) is a Petroff-Hausser chamber in which grids of a certain area are used to count cells. Image
and caption sources modified from https://openstax.org/books/microbiology/pages/9-1-how-microbes-grow
145

3. Optical density: Spectrophotometers are used to indirectly count cell cultures by measuring the amount of light
that passes through the culture. Higher cell counts result in a higher turbidity of the culture and allow for less light to
pass through a cuvette.

4. Flow cytometry: This is an automated counting method and is the most sensitive method of counting cells. Cells
must be stained with a dye that incorporates into the DNA of the organism. Cells are sucked through a capillary in
single file and hit with a laser that causes the DNA stain to fluoresce. The fluorescence and scattering of light around
the cell is detected and used to quantify cell counts. The flow cytometry method allows for multiple stain types in a
single sample.
Figure 4-4 (left): Serial dilution involves
diluting a fixed volume of cells mixed with
dilution solution using the previous dilution
as an inoculum. The result is dilution of the
original culture by an exponentially growing
factor. Image and caption source:
https://openstax.org/books/microbiology/page
s/9-1-how-microbes-grow
Figure 4-5: (a) A spectrophotometer. (b) A spectrophotometer works by splitting white light from a source
into a spectrum. The spectrophotometer allows choice of the wavelength of light to use for the measurement.
The optical density (turbidity) of the sample will depend on the wavelength, so once one wavelength is
chosen, it must be used consistently. The filtered light passes through the sample (or a control with only
medium) and the light intensity is measured by a detector. The light passing into a suspension of bacteria is
scattered by the cells in such a way that some fraction of it never reaches the detector. This scattering happens
to a far lesser degree in the control tube with only the medium. Image and caption source:
https://openstax.org/books/microbiology/pages/9-1-how-microbes-grow.
146

Exercise 1: Plots
-Work with your instructor and classmates to plot a growth curve in R Studio.

Figure 4-6: In flow cytometry, a mixture of fluorescently labeled and unlabeled cells passes
through a narrow capillary. A laser excites the fluorogen, and the fluorescence intensity of
each cell is measured by a detector. Image and caption source:
https://openstax.org/books/microbiology/pages/20-5-fluorescent-antibody-techniques
147
Chapter 5: Growth Rates

Pre-lab reading:
When comparing bacterial growth across species or experimental conditions, we express the data as growth rates. It
is important to note that growth rates are never about a single cell, rather it is the rate at which an entire population
grows.

Copiotrophs generally have fast growth, and many copiotrophic organisms are able to grow faster when nutrients are
high and lower their rates when nutrients are low. Oligotrophic organisms, however, cannot do this and will not
usually flux their growth rate to accommodate a higher nutrient content. Oftentimes when culturing from
environmental samples, the copiotrophic organisms with faster growth rates will quickly outcompete the
oligotrophic organisms that grow more slowly. In the majority of ecosystems on Earth, however, the abundant and
environmentally relevant organisms are predicted to have slow growth rates since many of the natural environments
on Earth are oligotrophic. This is one of the fundamental reasons for the existence of the GPCA and why many lab-
strains and model organisms are fast-growing copiotrophs. To see a table comparing oligotrophs and copiotrophs,
see the following review article: Kirchman, David L. 2016. “Growth Rates of Microbes in the Oceans.” Annual
Review of Marine Science 8: 285–309.

Calculating Growth Rates of a culture

To find the growth rate of an organism, use the following:

Number of generations:
n = (log(Nt) - log(N0)) / log(2)
n= (log(#cells at end of log phase) - log(#cells at start of log phase)) / log(2)
0.301 = log(2)

Generation time:
g = n/t
g = number of generations / elapsed time

Growth rate (k):
k = 1/g
k = 1 / generation time
_____________________________________________________________________________________
148
If: N0= 1,000 cells ∙ mL
-1
Nt= 5,000 cells ∙ mL
-1
t = 120 hours

Then:
n = (log(5,000) - log(1,000)) / 0.301 = 2.322 generations

g = 2.322 / 120 = 0.01935 generations per hour
0.01935 generations per hour * 24 hours/day = 0.4644 generations/day

k = 1 / 0.4644 = 2.153 days per generation

Interpretation: This organism doubles every 2.153 days under the given conditions.

Exercise 1: Calculate the growth rates of the temperature experiment in excel
Use the growth plots that you made last week to calculate the growth rate of each replicate in each condition of
temperature growth. Optional- this exercise could be checked/done differently using sparse-growth-curve
(https://github.com/thrash-lab/sparse-growth-curve)

149
Chapter 6: Salinity
Learning Objectives:
-Define the ways that we classify bacteria based on salinity preferences
-Understand osmosis movements and what happens to a cell when placed in solutions outside of its optimum.
-Compare and contrast how limnic vs coastal vs ocean organisms might need to control their osmolarity.
-Connect lab information to the broader pool of knowledge to design an experiment to test salinity preferences in
our organisms.
Pre-lab reading:
Some of the ways that we classify bacteria cell’s relationship to salinity is nonhalotolerant, halotolerant, halophile,
extreme halophile. Water’s passive movement into and out of a cell is called osmosis and is affected by the tonicity
of the environment that the cell exists in. Water will flow from the low solute concentration to the high solute
concentration in an attempt to balance out the net concentration of solutes in and out of the cell. When water leaves
the cell and moves into a hypertonic solution, the cell will crenate. When water goes into the cell and moves from a
hypotonic solution, the cell will swell and lyse. If the solution is isotonic, the water moves in and out of a cell at
equal rates so that the cell remains healthy and intact.

Figure 3-1: Net movement of water. Image source: https://openstax.org/books/concepts-biology/pages/3-5-passive-
transport.
One of the ways that bacterial cells respond to osmotic stress is through incorporation of compatible solutes.
Compatible solutes are molecules in which the cell takes in to balance the ionic strength inside and outside of the
cell. Generally, these molecules are not used for biomass production or energy generation since they are not always
metabolized by the cell.
Marine bacteria don’t really have to worry about rapid salinity fluctuations since the salinity of the oceans stays
relatively constant. Bacterial cells that exist in coastal systems, however, must be able to respond to sudden changes
in ionic charge on the outside of the cells. Estuarine systems are areas in the land/water interface and are the point
that freshwater from rivers and lakes mix with the salt water from the oceans. For example, search usgs.gov for
estuary salinity data at a fixed location such as Barataria Bay in Louisiana to understand the types of salinity
changes organisms that live in estuaries face on short timescales. Organisms that live in places such as these must be
able to adjust their cellular machinery to account for the rapid ionic flux. Today we will set up an experiment that
will test the range of salinities that our cultures can grow in.
Exercise 1: Experimental design of a salinity experiment
Today we will inoculate our salinity experiment for our isolate. With your group, decide on an experimental design.
Remember that this organism was isolated from the coast of Louisiana. Spend 10-15 minutes to research salinity
fluctuations in the isolation environment and design your experiment. As a class, discuss your design with your
instructor.
Include the following:
Media needed:
150

Salinities tested:

Number of replicates per condition:

Controls:

Count frequency:

Predict patterns of growth with these temperatures and generate a hypothesis.

Exercise 2: Salinity experiment inoculation and t0
Materials needed:
-Biosafety cabinet
-Lab coat
-10% bleach
-70% ethanol
-Paper towels
-Gloves
-Pipettes and tips
-Mili-Q or other ultrafiltered water. DI acceptable.
-Healthy bacterial culture
-1-2 flasks/student
-Media that has a range of salinities/benchtop

Before starting, review what you have learned about sterile technique when handling bacterial cultures in previous
chapters.

To determine the volume of culture needed, use the cell count provided by your instructor and the dilution equation
to get a starting concentration of 10^4 cells/mL. show your work below.
C1V1=C2V2

Volume of culture to inoculate each flask:
______________________.
Use sterile technique to put 50mL of the appropriate media into the flask.

Pipette the volume of culture needed from above into your flask.

Prepare the cells to be counted by fixing them in 3% glutaraldehyde. Your instructor will review how glutaraldehyde
preserves cells in the cell count laboratory.

151
Chapter 3 Appendix 4. Informal Essay 1

In paragraph format, write an informal essay that highlights your initial impression about what it means to take part
in a Course-based Undergraduate Research Experience (CURE) lab. There is no strict word count on this
assignment, but your goal should be about half a page.
Here are some topics to cover:
-Background about yourself such as your major, goals you hope to achieve with your degree, interest (or lack of) in
research, previous exposure (or lack of) to research, and conceptions about who does research
-What you've heard about CURE labs (if anything), your worries about the course, excitement towards the course,
and what you hope to get out of this course
-Do you think that research experience applies to you and your goals? Why or why not?

152
Chapter 3 Appendix 5: Social Media Assignment

Purpose: The Social Media Assignment is designed to get you engaged with the scientific community on Twitter —
which many biologists have chosen as their preferred form of rapid scientific communication. By following
scientists on Twitter, you will be exposed to up-to-date research articles, current interests of the scientific
community, and ongoing scientific events such as conferences. Many biologists tweet articles they’ve recently read
or talks they’re currently attending and find interesting. Finally, you will need to perform some outreach of your
own.

Week 1: Sign up for a Twitter account at https://twitter.com and follow your TA. Each TAs Twitter handle can be
found in the syllabus. Complete the assignment on Moodle for Week 5 by telling your TA your Twitter handle so
they know who to actually accept and/or follow back.
o Feel free to make your Twitter account private, but you will have to follow a few people throughout the
semester.
o Your TA will not necessarily follow you back, you following them is a confirmation step. Class- relevant
communication will take place over Moodle, Email, or potentially Slack, but not Twitter.
o One exception: if your Twitter account is marked as "protected", your TA will have to follow you to add
you to their list. You must add them back to receive credit.
Week 2: Follow a scientist at your university and one from a different university on Twitter. Retweet a science-
related tweet from each that you like, with a comment about why you liked the tweet (you cannot simply retweet, it
must be a "Retweet with comment"). Submit the following for each scientist:
1. The name of each scientist you are following and the university or institution where they work.
2. A screenshot of your "Following" list showing that you are, in fact, following said scientists.
3. A link to, or screenshot of, your retweet (link preferred, links may not work if your account is protected).
Week 3: Follow a scientific organization on Twitter. Visit their website and tweet a sentence or two about the
organization and include their web page. Submit the following:
1. The name of the organization you’re following.
2. A screenshot of your "Following" list showing that you are, in fact, following said organization.
3. The link to the web page of the organization
4. A link to, or screenshot of, your retweet (link preferred).
Week 4: Follow a scientific government department, agency, etc. on Twitter. Retweet a science-related tweet from
them and comment on the tweet. Suggestions include NASA, the USGS, DoE, etc. Submit the following:
1. The name of the agency you’re following.
2. A screenshot of your "Following" list showing that you are, in fact, following said agency.
3. A link to, or screenshot of, your retweet (link preferred).
Week 5: Tweet about something you learned in any of your science classes this week that you found interesting or
surprising. Be sure to include the course name in your tweet. Submit the following:
1. The name of the course.
2. A link to, or screenshot of, your tweet (link preferred).
Week 6: Tweet a sentence or two about a scientific news story (not a research article). Please avoid clickbait stories
and stick to articles with primary sources as references. Submit the following:
1. The title of the story.
2. A link to the story.
3. A link to, or screenshot of, your tweet (link preferred).
153
Week 7: Tweet a sentence or two about a scientific video you watched and include the link to the video. It can be
from any source such as YouTube, a news site, a university website, etc. As with last week, avoid clickbait and stick
to videos about real science. This video needs to have taught you something new or easily described a concept
you’ve previously found difficult. Submit the following:

1. The title of the video.
2. A link to the video.
3. A link to, or screenshot of, your tweet (link preferred).

Week 8: Tweet a sentence or two about your lab work thus far. Focus on skills you’ve learned or anything
interesting that is happened. Submit the following:

1. A link to, or screenshot of, your tweet (link preferred).

Week 9: Choose a scientific paper tweeted byany scientist you’re following and read the abstract (you do not have to
read the whole article). Retweet the article and write one sentence about the abstract (you don’t need much detail).
This assignment can be turned in whenever you read the article. Submit the following:

1. The title of the scientific paper.
2. A link to the scientific paper.
3. A link to, or screenshot of, your retweet (link preferred).

Week 10: Tweet a sentence or two describing any scientific event—seminar, workshop, etc.—you have attended this
semester and not previously tweeted about. Include the name of the event, who hosted it, and a link to their site (if
applicable). This assignment can be turned in whenever you attend the event (you do not have to wait until Week
13). Examples include department seminars, etc. Feel free to use any scientific event, this is merely a suggestion.
Submit the following:
1. The name of the event.
2. Who hosted the event.
3. The date of the event.
4. The website of the event (if applicable).
5. A link to, or screenshot of, your tweet (link preferred).
Week 11: Tweet a sentence or two about your semester (not necessarily this class). You will be graded equally for a
positive or negative tweet as we are not trying to force good publicity for this lab. A tweet on your poster
presentation from Week 13 is also acceptable. Submit the following:

1. A link to, or screenshot of, your tweet (link preferred).

At the end of the semester, all of the above should be combined into a single PDF and submitted for grading. All
links/screenshot dates will be checked to ensure interaction throughout the semester rather than all posts occurring at
once.

154
Chapter 3 Appendix 6. Presentation: Minimal Media Assignment

Each person has been assigned a carbon, nitrogen, and sulfur source that we will test whether our organism can use
as the sole C/N/S substrates for growth. This presentation will give you practice obtaining relevant primary literature
online to answer the questions below and help you familiarize yourself with your substrates. Your instructor has
assigned you to groups, and each person per group will prepare one slide about their carbon source with the
following information:

1. The name of the C/N/S compounds
2. The chemical formula of the compounds
3. A picture of the compounds’ structure
4. A fact about where these compounds are naturally found
5. A fact about how these compounds are relevant to bacteria in the environment
6. Cite your source(s) in the footnote of your slide

You will each be given a maximum of two minutes to present your substrates. Be sure to practice this presentation to
ensure appropriate timing.

155

Chapter 3 Appendix 7. Elevator Pitch Assignment
Modified from Becky Carmichael, Kyle Sirovy, Scott Kosiba, Mindy Brooks, and Courtnie DiCapo.

Part 1: In class assignment

Scientists communicate their findings through a number of mediums to a wide variety of audiences that range from
fellow scientists within the same field of study to the general public. The composition of your audience should
always dictate how you discuss your science. If you were to present the findings of your research to a room of non-
scientists but your presentation was more appropriate for fellow scientists, the presentation would fall flat. What’s
the point of communicating if those receiving that communication don’t understand?
The goal of this assignment is to expose you to one of the many ways scientists communicate their research to
specific, well-defined audiences and highlight the broader impacts of their research in a way that is both relevant and
interesting to that audience. This exercise will help you identify your audience, cater your communications with that
audience, and aid in the development of an elevator pitch for your final posters.
Please read the following questions before listening to the science communication. Feel free to make notes
throughout and then provide detailed responses to these questions:

Title of science communication:

Presenter’s name, title, and affiliation:

Type of science communication (podcast, seminar talk, blog post, etc.):

1. Do you feel that the presenter has a strong grasp of the research they conduct? What gave you this
impression? What aspects could you model for your own pitch/what do you want to incorporate?

2. Who is the target audience for this communication? How can you tell?

3. Were they effective at communicating their research to this audience? What did you find specifically
effective or not? How did the presenter “hook” the listener and sustain attention?

4. List the main takeaways (broader impacts/results) of the research.

5. Was the importance of their research clear? What was it?

156
6. What did you like best about the presentation of the material?

7. What clarifying or engaging question would you want to ask the presenter? What was left unanswered?

8. After listening to the science communication, what aspects of the presenter’s delivery style will you
model for your own presentation?

9. List specific aspects from your CURE research that you will highlight including the big picture take-
away, and relatable example.

157
Part 2: Homework

An elevator pitch is a short talk used to introduce yourself and your research to others and includes the question
being addressed, the importance of the work, and major findings. You’ve already evaluated a science
communication piece (podcast episode, seminar talk, published paper, blog post, etc.) and analyzed that researcher’s
pitch. Now, you will use your previous evaluation to craft an elevator pitch on existing research. Use the instructor
suggestions to find a relevant piece of scientific work and create an elevator pitch on that work. Fill out the prompts
below:
Title of scientific research:

Presenter name(s), title(s), and affiliation:

Type of science communication (podcast, seminar talk, blog post, etc.):

When composing any sort of science communication, be it a poster or paper to be submitted to a peer-reviewed
journal, two components are essential: A well-defined target audience and a clear story.

Step 1. Identify your target audience
The reason many communications of science fail to resonate with those listening or reading is because the authors
did not adequately identify who they are communicating to. By zeroing in on a specific audience you can cater
components of your speech to their level of interest, understanding of complex relationships and methodologies, and
formulate broad impacts that will resonate.

1. What are some aspects of your target audience that you can define? Think: education level,
location/affiliations(s), occupation(s), age, familiarity with broad topics you’ll discuss. List as many
specifics as possible. Example: College educated, mostly PhD and MS degree seeking.

Your target audience:

2. Using your response above, create a single person that fits into this target audience. In a few sentences,
write a general description of this person—this is who you’ll be crafting your pitch for!

Step 2. Find your story
When communicating science in any form, it is crucial to have a clear idea of the story you want to tell. A clear
story makes communicating your results more interesting to your audience and helps to convey your desired
message effectively.

3. Write a two-sentence summary of the research question and the answer (main result/conclusion) to that
question. This two-sentence summary will form the backbone of your elevator pitch.

158

4. From the two-sentence summary you’ve created above, you should include a brief summary of the
approach used to obtain the main result. This does not need to be overly detailed but should be clear and
specific enough that your audience understands the general approach taken. Now, rewrite your two-
sentence summary to include a sentence (or two) about the general approach taken to obtain the main
result--this should be sandwiched between your research question and the main result/conclusion.

5. Consider why the main result is important from the perspective of your audience. It’s not enough to state
a result if nobody understands the point of it all. Rewrite your two-sentence summary on the back of this
sheet to include a sentence (or two) discussing why the results are important from an ecological or
biological perspective and also why this should be interesting/relevant to your audience.

6. Practice saying your elevator pitch and come to class ready to present it to your classmates in small
groups.

Elevator Pitch Rubric

3 min or less – 3 pts
Over 3 min – 0-2 pts

Introduction
Relevant/concise – 4 pts
Short/choppy or Too long/Rambling – 2 pts

Objectives of investigation
States objectives – 3 pts
Unclear objectives – 2 pts

Methods
Concise and relevant to results shared – 4 pts
Not relevant to results shared – 3 pts

Results
State main point that matches the objective – 3 pts
Main point doesn’t tie back to objective/unclear – 2 pt

Discussion
Communicate the importance of the result – 3pts
Weakly communicate importance of result – 2 pts

159
Chapter 3 Appendix 8. Writing Assignment 1: Nutrients

Use what you have learned about bacterial interactions with nutrients for writing assignment #1. Format your
writing as follows:

Introduction:
-Present information in a “funnel” that begins with the most general information and ends with the goal of
the project
-General statement about the importance of bacteria
-Relate bacteria to nutrients
-Why do we care about bacteria and nutrients together?
-Why are we doing this experiment?
-Hypotheses about the experiment and controls

Methods:
-What did we do? List volumes and concentrations -be specific.
-Avoid including information about labeling or type of pipette used.

Results:
-What should the result table look like for the entire class? Create the table but leave it empty until all
results are completed.

Discussion:
-What controls did we place?
-What kind of results could we see with the controls?
-What would each of these mean?

160

Rubric:

Section Category Points
Style 5 possible
Name, Section Number, Section Headings, Double-spaced 4

Title 1
Introduction 15 possible
General funnel of information 2
Define bacteria and their importance 2
Importance of carbon to life 3
Diversity of bacterial carbon usage and rationale for experiment 3
Hypothesis 3
Methods 10 possible
Sterile technique 2
Volume of media, carbon source, culture 5
Carbon substrate 3
Results 10 possible
Table of carbon substrates with appropriate caption 6
Written explanation of results 4
Discussion 10 possible
Discussion of possible controls and results 3
Support or reject hypothesis and why 4
Citations
Copy-and-paste information in text -6 per instance
Invalid sources -1 each instance
No in-line citations -3 each instance
No citations -5
Total

161
Chapter 3 Appendix 9. Writing Assignment 2: Temperature

Use what you have learned about the effect of temperature on bacterial growth for writing assignment #2. Format
your writing as follows:

Introduction
-Funnel of information:
-What is temperature, and why do we care about it in a bacterial sense?
-Scope/diversity of temperatures that bacteria are found to thrive in
-Why should we test temperature in our bacteria?
-Hypothesis. Expected temperature range of the bacteria and why?

Methods
-What did we do?
-Be sure to include things such as sterile technique, media, media modifications if needed, temperatures,
volumes, etc.

Results
-What is the temperature min, max, and optimum for your organism
-Graph – what we plotted in class.
-Figure caption

Discussion
-How does the data support or reject your hypothesis?
-Is this temperature range surprising given the isolation locations?
-What kind of data are our controls here?

162
Rubric

Section Category Points
Style 5 possible
Name, Section Number, Section Headings, Double-spaced, Title appropriate 5
Introduction 15 possible
General funnel of information 2
Define temperature and the relationship between bacteria and temperature 5
Diversity of temperature for bacteria and rationale for experiment 5
Hypothesis 3
Methods 10 possible
Sterile technique 1
Volume of media and culture 3
Temperature range and replicates 4
Description of how graphs were made 2
Results 10 possible
Cardinal temperatures 2
Temperature growth curve and figure caption 6
Paragraph explaining results of graph 2
Discussion 10 possible
Controls 3
Support or reject hypothesis and why 4
Temperature range in connection to the environment 3
Citations
Copy-and-paste information in text or no citations 0 on paper
Invalid sources or no in-line citations -3 each instance
Total 50

163
Chapter 3 Appendix 10. Homework 1: Downloading R and RStudio

Download R:
1. Go to the following address: https://cran.cnr.berkeley.edu
2. Select the download that is most appropriate for you (Linux, Mac, or Windows)
3. Follow any download instructions that appear

Download RStudio:
1. Go to the following address: https://www.rstudio.com/products/rstudio/download/
2. Choose the free RStudio Desktop Open Source License option
3. Follow any download instructions that appear

Show your instructor the downloaded programs at the start of class.

164
Chapter 3 Appendix 11. Homework 2: Growth Curves

Now that you are all professionals at plotting temperature data in RStudio, your homework is to do the following:
1. Download the two .csv files containing temperature data from the other sections’ organisms
2. Input the data into RStudio
3. Change the R code to match headings or regroup data if needed
4. Change the title to the strain number and your name
5. Plot the data and save a PDF to submit

Write a short paragraph of what you think about the data that you see. This should include the differences and
similarities of each organism’s min, max, and optimum. Your final product will be two growth curve plots and one
paragraph interpreting the data.

165
Chapter 3 Appendix 12. Homework 3: Poster critique

Find a scientific poster displayed somewhere on campus or use one provided by your instructor to answer the
following questions:

Based on the TITLE ONLY, what do you think the poster will be about?

What was the main research question and was the title an accurate description of it?

Was the main conclusion clearly stated? What was it?

Were the major ideas of each table/figure clearly stated in the table/figure legend? Were the tables/figures
themselves clear and easy to understand? Were they all necessary? Please comment.

Was the order of sections in the poster formatted in a logical/easy to read way?

What did you like best about this poster?

What did you think was the worst thing about this poster?

How long did it take you to understand this poster?

Please feel free to add pages in order to fully explain your responses

166
Chapter 3 Appendix 13: Homework 4: Growth Rates

After our in-class review of the new R code for plotting growth rates, plot growth rates for the temperature
experiment. Submit a brief interpretation of results and a PDF of the curve with appropriate title, labels, and figure
caption. In your results interpretation, include an outside primary source that contains some kind of temperature data
from any waters in coastal Louisiana and decide whether our organism might do well in that environment.

Your final product will be one plot of growth rates with a written interpretation and brief discussion of the data.
Most of this assignment will be complete before leaving class.

167

Chapter 3 Appendix 14. Final Writing

For this writing assignment, you should stop thinking of carbon substrate usage, temperature, and salinity as
unrelated experiments. Rather, remember that this entire course is actually a single project to characterize our
organisms. This writing assignment is meant to be a formal, comprehensive scientific report about the organism that
you have grown to know and love. This paper should be written so that an audience completely unrelated to our
class could understand it. This assignment will be broken into multiple parts:

Title: Should be an original descriptive title that includes key words of the project

Introduction:
-This section MUST include at least three outside references that you find on your own to support your
ideas
-Why are bacteria important to study?
-Explain why carbon usage, temperature, and salinity are important factors relating to bacteria and link that
information back to our isolation site.
-Introduce our organism. Include where it was isolated, how it was isolated, anything important about the
media, why this media is good/bad, where the isolate currently exists, anything that had been published
prior to this project, etc.
-Introduce our research questions, hypotheses, etc.

Methods:
-Be comprehensive, nonrepetitive, and concise.
-Use separate subheadings for:
-Sterile Technique
-Cell Counts
-Minimal media
-Temperature
-Salinity
-Growth rate calculations
-Graphing

Results: At this point, results should be comprehensive!
You should have the following figures with captions:
-Carbon Table
-Temperature Growth Curves
-Temperature Growth Rates
-Salinity Growth Curves
-Salinity Growth Rates
-Data in figures must be also typed out and reported in the text. Reference this in the text as relevant.
-EX: LSUCC0135 is a curved rod (Figure X).
-Break this category into relevant subsections as needed.
-There should be no interpretation of these results.

Discussion:
-Use this section to tie in our results to what we know from existing literature and things that we have
learned in class. This section is for the bigger picture connections from what we see in our data to existing
data and the world around us.
-There should be citations here

Future Directions:
-What would you like to see happen next in this series of experiments with our organism?

168
References:
-Follow APA style and list in order of appearance
-Use numerical in-text citations

169
Rubric:

Section Category Points
Peer Review
40
possible
Thoughtful comments and relevant feedback on peer’s paper
Style
10
possible

Name, section number, appropriate title, section headers, appropriate grammar, easy
to read and concise 7
Unit symbols where necessary 3
Introduction
40
possible
Importance of bacteria 5
Synthesis of bacterial relationship with carbon, temperature, and salinity 15
Introduce organism and any known information about it 7
Describe the rationale of this experiment and brief description of it 8
Hypothesis 5
Methods
30
possible
Sterile Technique 3
Counting: Instrument, stain, limit of detection 4
Carbon 4
Temperature 4
Salinity 7
Computation: R or RStudio 4
Computation: ggplot2 4
Results
30
possible
Carbon Table and caption 5
Temperature growth curves and caption 5
Temperature growth rates and caption 5
170
Salinity growth curves and caption 5
Salinity growth rates and caption 5
Written results in addition to the figures 5
Discussion
30
possible
Connection to ecology/ bigger idea 20
Well thought-out acceptance/rejection of hypothesis 10
Future
Directions
15
possible
Thoughtful idea of a follow-up experiment
References 5 possible
In-text citations and properly formatted citations 5
Total 200

171
Chapter 3 Appendix 15: Poster Assignment

Now that you’ve written your final paper, let’s practice another form of science communication. A poster is a great
way to discuss your research and present your data, while personally connecting with your audience. The general
construct of a scientific poster is similar to the scientific papers you have been writing; however, the poster is
concise and highlights the key points and findings. Essentially, condense your paper into poster format.

Like we discussed in class, your poster should be aesthetically pleasing and not cluttered.

Your poster needs to include:
1) Title
2) Your name and your lab partner’s name, and the department where the research was conducted
3) Introduction
a. Briefly highlight the relevant background, what makes this research important/what gap in the
knowledge we are filling with our work, and your research question/hypothesis.
4) Methods
a. Briefly discuss how we conducted our research and make sure to explain each experiment distinctly.
Feel free to be creative with figures, charts, diagrams, etc
5) Results
a. Provide the data produced from each experiment
b. Make sure that each figure/table has an informative caption
6) Discussion
a. Briefly discuss the main findings of our investigation and any conclusions we can draw from them
b. Briefly discuss the relevance of these conclusions to the broader scientific community
c. Bullet points are encouraged here
7) Acknowledgements
a. The purpose of this section is to thank anyone who made this research opportunity possible
b. Be sure to thank the department, the university CURE program and any staff that coordinate/direct the
program, the instructor of record, the Principle Investigator, and your Laboratory Teaching Assistant.
8) References
a. APA format and numerical in-text citations

Make sure your poster is sized for:
Width: 48 inches
Height: 36 inches

For the presentation, aim for 3-5 minutes.

Things to keep in mind:
-Your poster should be easy for your reader/audience to read and follow along
-No clutter, no distracting background
-Make sure the font is large enough/figures are readable
-Keep your poster spatially organized

172

Rubric

Section Category Points
Design and Layout
Organization 10 possible
Readable figures and text 10 possible
Heading

Names and Affiliation 5 possible
Clear and accurate title 5 possible
Content

Introduction 20 possible

Methods 10 possible

Results 10 possible

Figures, Tables, and Captions 20 possible

Discussion 20 possible

Acknowledgements and References 10 possible
Presentation
Time 10 possible
Professionalism and body language 20 possible
Total possible

150 possible

173
Chapter 3 Appendix 16. Informal Essay 2

In paragraph format, write an informal essay that highlights your experience now that you have taken part in a
Course-based Undergraduate Research Experience (CURE) lab. There is no strict word count on this assignment,
but your goal should be about half a page.
Here are some topics to cover:
-After revisiting your Blog Post #1, address your overall thoughts about your experience in the class. Was your
initial impression with the course consistent throughout the semester? Did your views on research and what it means
to be a researcher shift throughout the semester? Would you now consider yourself a researcher or at least capable of
being a researcher?
-Has your confidence in your lab abilities grown this semester? Do you feel that any skills you have learned are
relevant to you and your goals? Would you recommend a CURE lab to a friend?

174
Chapter 3 Appendix 17. Poster Symposium Worksheet

Criteria Poster #:________
1. Content: short, understandable 1 2 3 4 5 6 7 8 9 10
2. Organization/clarity: easy to follow and understand, flows well 1 2 3 4 5 6 7 8 9 10
3. Audience: detail appropriate; big picture catered to audience 1 2 3 4 5 6 7 8 9 10
4. Completeness: detail and depth is appropriate 1 2 3 4 5 6 7 8 9 10
5. Volume: Projects voice, appropriate for group size 1 2 3 4 5 6 7 8 9 10
6. Pace: Relaxed pace, easily understood given accent/vocal style 1 2 3 4 5 6 7 8 9 10
7. Diction: pronunciation is clear and deliberate 1 2 3 4 5 6 7 8 9 10
8. Enthusiasm/energy: shows interest through tone and energy 1 2 3 4 5 6 7 8 9 10
9. Body language/posture: does not fidget, upright posture 1 2 3 4 5 6 7 8 9 10
10. Eye contact: maintains eye contact, engages audience member 1 2 3 4 5 6 7 8 9 10
11. Audience questions: clear and thoughtful response 1 2 3 4 5 6 7 8 9 10
OVERALL POSTER SCORE

1. Based on your overall impression of the presentation, do you feel that they have a strong grasp of the experiment
they conducted and its relevance to the field? Were they able to effectively communicate this to their audience? Be
specific with your feedback.

2. What did you like best about the presentation of this poster?

3. What could have been improved or refined? Use the scores you provided to guide your response.

4. What clarifying or engaging question did you ask and what was the answer given? Did you feel that they
answered it thoroughly and with the audience in mind?

175
Chapter 3 Appendix 18. Dishwashing protocol

The following steps should be used to ensure clean dishware:
-Rinse with copious amounts of water
-Scrub using brushes or sponge with soap and hot water
-Rinse with hot water
-Rinse with cold water
-Rinse with DI water
-Allow to air dry on racks

If the dishware has an open top ro will be used for measurement, cover with foil and put away.

Flasks and glassware should be acid washed overnight in 10% HCl. After acid washing:
-Rinse 4x with DI water
-Rinse 4x with nanopure water
-Allow to air dry on racks
-Cap flasks and bottles before autoclaving

176
Chapter 3 Appendix 19. Flow cytometry parameters (Modified from Bakshi et al. 2019)

This protocol assumes that users have received the proper training in flow cytometry and understand how to use
their equipment. The following parameters are used with the Guava easyCyte 5HT (Millipore) flow cytometer for
enumeration:

Gain settings
Forward scatter 1
Side scatter 2.83
Green fluorescence 4.56
Yellow fluorescence 8
Red fluorescence 8

Counting
3,000 events or 90s.

Controls
Negative: unstained sterile medium
Negative: stained sterile medium
Positive: medium with a common marine bacterial heterotroph (e.g., E.coli).

Cell fixation
Cells can be fixed in 2-4% glutaraldehyde and stored at 4˚C if the instructor would like to complete cell counts all at
once rather than once per day. This would be ideal if the access to the flow cytometer is limited. Glutaraldehyde
should be used in a fume hood and fixed cells should be stored in a secondary container that is labeled according to
the institution’s EHS standards.

Additional details and gating examples can be found in:

Thrash, J. Cameron, Jessica Lee Weckhorst, and David M. Pitre. (2015) Cultivating Fastidious Microbes.In
Hydrocarbon and Lipid Microbiology Protocols, vol. 4 (Cultivation). Edited by Terry J. McGenity, Kenneth N.
Timmis and Balbina Nogales.

177
Chapter 3 Appendix 20. Example Setup of Carbon/Minimal Media Plate

Note that this implementation includes different organic and inorganic sulfur and nitrogen sources in addition to the
carbon sources on the left. This kind of approach can be used to find a defined minimal medium for the strain in
question, and thus, the alternative schedules in Chapter 3 Appendix 28 refer to the “minimal medium” experiment
instead of a “carbon plate” experiment.

178
Chapter 3 Appendix 21. Code for Growth Curves

Student Version
# File: Growth_Curves.R
# Source: Lanclos et al., 2018
# Authors: V. Celeste Lanclos, Alex Hyer, Jordan Coelho

# Useful reminders:
# 1. Any text after "#" is ignored by R. Use this feature to take notes.
# 2. You need to change any text in ALL CAPS to match your data file.
# 3. RStudio let's you export graphs from the Plots tab. NO SCREENSHOTS!

# This script takes a CSV with the following columns as input:
#
# Salinity (int) or Temperature (int): the salinity or temperature at which the culture was grown
# Day (int) or Hours (int): how long the culture has been growing
# Replicate (int): trial number at a given salinity
# Cell.Count (int): the concentration of cells counted on each day

# Purpose:

#
rm(list=ls())

#
install.packages("ggplot2")

#
library(ggplot2)

#
DATA_NAME <- read.csv("NAME_OF_CSV_FILE_HERE.csv", header = T)

#
DATA_NAME$Replicate <- factor(DATA_NAME$Replicate, levels = unique(DATA_NAME$Replicate))

#
ggplot(DATA_NAME, aes(x = COLUMN_FROM_CSV_FOR_X_AXIS, y =
COLUMN_FROM_CSV_FOR_Y_AXIS, color = COLUMN_FROM_CSV_FOR_SERIES, fill =
COLUMN_FROM_CSV_FOR_SERIES)) +
geom_line() +
facet_wrap(~COLUMN_FROM_CSV_FOR_INDEPENDENT_VARIABLE) +
labs(x = "X-AXIS_TITLE", y = "Y-AXIS_TITLE",
title = "FIGURE_TITLE") +
scale_y_log10() +
theme_bw()

179
Instructor Version

#' File: Growth_Curves_Instructor.R
#' Source: Lanclos et al., 2018
#' Authors: V. Celeste Lanclos, Alex Hyer, Jordan Coelho

#' This script graphs the growth curve of an organism at different salinities or temperatures.
#' The code below is in terms of salinity, but can easily be modified for temperature.

#' This is the Instructor Edition of this code and thus has the
#' "right answers" as well as useful tips. Please provide students with the
#' Student Edition and take time to note what information they need to
#' fill in for themselves.

#' This script takes a CSV with the following columns as input:
#'
#' Salinity (int) or Temperature (int): the salinity or temperature at which the culture was grown
#' Day (int) or Hours (int): how long the culture has been growing
#' Replicate (int): trial number at a given salinity
#' Cell.Count (int): the number of cells counted on each day
#'
#' You can, of course, edit the code and file to match your needs.

#' Removes any data from R's memory.
#' Note that this removes all environmental variables, please exercise caution.
#' In particular, don't execute this line after opening up an R Project file.
#' We strongly recommend that you execute this file in it's own R session.
#' This line is included to ensure a clean environment and prevents students
#' from unwittingly using previously stored data from their global environment
#' and getting perplexing results.
rm(list=ls())

#' Install the graphing software "ggplot2".
#' Comment this out/delete it if you've already installed it.
install.packages("ggplot2")

#' Load ggplot2 into R so that we can make our plot later.
#' This library will be removed by the `rm(list=ls())` which means students
#' can't proceed with plotting until they re-run this. It serves as a useful
#' check that they actually went through the whole file.
library(ggplot2)

#' Read your CSV file into R and saves the dataframe as "salinity" or "temperature".
#' Put the path to your file in between the quotation marks below.
#' You can use the tab key to more easily find your file in RStudio.
#' We found the GUI window was useful for students new to software.
salinity <- read.csv("salinity_growth_curve_example_data.csv", header = T)

#' Tells R to treat your replicates as categories instead of a number series.
#' We found that student's frequently skipped this line whenever they were
#' troubleshooting or trying to execute the code on their own for homework.
#' If this line is skipped, R will treat the replicates as a number series
#' which results in three obvious and incorrect features:
#' 1. There will only be a single series on their graph.
180
#' 2. The line is largely blue with black segments instead of a solid color.
#' 3. Each salinity on the x-axis will have a vertical spike.
#' If you notice these features on a student's graph, they have skipped this
#' critical line.
salinity$Replicate <- factor(salinity$Replicate, levels = unique(salinity$Replicate))

#' Render the graph using ggplot2.
#' Commenting out lines below and re-making the graph will help students
#' learn what each line does.
ggplot(salinity, aes(x = Day, y = Cell.Counts, color = Replicate, fill = Replicate)) + # aes = aesthetic
geom_line() + # Make this graph a line graph
facet_wrap(~Salinity) + # Make a new graph for each salinity
labs(x = "Time (Days)", y = "Cell Concentration (cells ∙ mL
-1
)", # Change the graph labels
title = "Test Organism Salinity Curve") + # Change the graph title
scale_y_log10() + # Scale the y-axis by log10
theme_bw() # Change the theme to a clean black and white theme

#' Students can now export the graph using the Export function in RStudio.
#' Don't let students submit screenshots.

181
Chapter 3 Appendix 22. R Code for Rates

Student Version

# File: Growth_Curves.R
# Source: Lanclos et al., 2018
# Authors: V. Celeste Lanclos, Alex Hyer, Jordan Coelho

# Useful reminders:
# 1. Any text after "#" is ignored by R. Use this feature to take notes.
# 2. You need to change any text in ALL CAPS to match your data file.
# 3. RStudio lets you export graphs from the Plots tab. NO SCREENSHOTS!

# This script takes a CSV with the following columns as input:
#
# Temperature (int) or Salinity (int): the temperature or salinity at which the culture was grown
# Replicate (int): trial number at a given temperature
# Rate (float): the rate at which a replicate grew

# Purpose:

#
rm(list=ls())

#
install.packages("ggplot2")

#
library(ggplot2)

#
DATA_NAME <- read.csv("NAME_OF_CSV_FILE_HERE.csv", header=T)

#
DATA_NAME$Replicate <- factor(DATA_NAME$Replicate, levels=unique(DATA_NAME$Replicate))

#
ggplot(DATA_NAME, aes(x = COLUMN_FROM_CSV_FOR_X_AXIS, y =
COLUMN_FROM_CSV_FOR_Y_AXIS)) +
geom_jitter(size = 5, width = 0.0, height = 0.0, alpha = I(0.5)) +
geom_smooth(method = "auto", formula = y ~ x, span = 0.85, se = FALSE) +
labs(x = "X-AXIS_TITLE", y = "Y-AXIS_TITLE",
title = "FIGURE_TITLE") +
scale_x_continuous(breaks = c(CONDITION1, CONDITION2, CONDITION3, ETC),
labels = c("CONDITION1", "CONDITION2", "CONDITION3", "ETC")) +
theme_bw()

182

Instructor Version

#' File: Growth_Rates_Instructor.R
#' Source: Lanclos et al., 2018
#' Authors: V. Celeste Lanclos, Alex Hyer, Jordan Coelho

#' This script graphs the growth rate of an organism at different salinities or temperatures.
#' Note: The code below is for salinity but can be easily modified for temperature.

#' This is the Instructor Edition of this code and thus has the
#' "right answers" as well as useful tips. Please provide students with the
#' Student Edition and take time to note what information they need to fill
#' fill in for themselves.

#' This script takes a CSV with the following columns as input:
#'
#' Salinity (int) or Temperature (int): the salinity or temperature at which the culture was grown
#' Replicate (int): trial number at a given salinity or temperature
#' Rate (float): the rate at which a replicate grew
#'
#' You can, of course, edit the code and file to match your needs.

#' Removes any data from R's memory.
#' Note that this removes all environmental variables, please exercise caution.
#' In particular, don't execute this line after opening up an R Project file.
#' We strongly recommend that you execute this file in it's own R session.
#' This line is included to ensure a clean environment and prevents students
#' from unwittingly using previously stored data from their global environment
#' and getting perplexing results.
rm(list=ls())

#' Install the graphing software "ggplot2".
#' Comment this out/delete it if you've already installed it.
install.packages("ggplot2")

#' Load ggplot2 into R so that we can make our plot later.
#' This library will be removed by the `rm(list=ls())` which means students
#' can't proceed with plotting until they re-run this. It serves as a useful
#' check that they actually went through the whole file.
library(ggplot2)

#' Read your CSV file into R and save it as "salinity" or "temperature".
#' Put the path to your file in between the quotation marks below.
#' You can use the tab key to more easily find your file in RStudio.
#' We found the GUI window was useful for students new to software.
salinity <- read.csv("salinity_growth_rate_example_data.csv", header=T)

#' Tells R to treat your replicates as categories instead of a number series.
#' We found that student's frequently skipped this line whenever they were
#' troubleshooting or trying to execute the code on their own for homework.
#' If this line is skipped, R will treat the replicates as a number series
#' which results in three obvious and incorrect features:
#' 1. There will only be a single series on their graph.
183
#' 2. The line is largely blue with black segments instead of a solid color.
#' 3. Each salinity on the x-axis will have a vertical spike.
#' If you notice these features on a student's graph, they have skipped this
#' critical line.
salinity$Replicate <- factor(salinity$Replicate, levels=unique(salinity$Replicate))

#' Render the graph using ggplot2.
#' Commenting out lines below and re-making the graph will help students
#' learn what each line does.
ggplot(salinity, aes(x = Salinity, y = Rates)) + # aes = aesthetic
geom_jitter(size = 5, width = 0.0, height = 0.0, alpha = I(0.5)) + # Graph data points
geom_smooth(method = "auto", formula = y ~ x, span = 0.85, se = FALSE) + # Draw average rate line
labs(x = "Salinity", y = "Growth Rate (k)", # Change the graph labels
title = "Test Organism Salinity Growth Rate") + # Change the graph title
scale_x_continuous(breaks = c(6, 12, 23, 35), # Manually set axis breaks to match salinity
labels = c("6", "12", "23", "35")) + # Manually label the breaks
theme_bw() # Change the theme to a clean black and white theme

#' Students can now export the graph using the Export function in RStudio.
#' Don't let students submit screenshots.

184
Chapter 3 Appendix 23. Quizzes

Fall 2018

Quiz- Pipettes and Carbon (post-lab)

1). You have three mechanical pipettes available for use: P10, P100, P1000.
A) Which is/are the pipette(s) that can hold 20 μL?

B) Which is/are the pipette(s) that can hold 100 μL?

C) Fill the boxes (right) to read as the volume readout should on the P10 pipette if you were to use it to
deliver 9.2 μL volume.

2) List 2 reasons that all organisms need carbon.

3) What are the two general forms of carbon?

4) Explain the difference between autotroph and heterotroph:

5) Why do we care to test Carbon use in our isolates?

6) Are all bacteria bad for you? Explain something beneficial that bacteria can do. Be as specific as possible and use
the back of the page if needed.

Pipettes and Carbon KEY

1. A. P10, P100
B. P100, P1000
C. 092
2. Carbon is used for structural components of a cell. Carbon is also used for energy within cells.
3. Inorganic and Organic
4.Autotrophs can use inorganic carbon while heterotrophs need organic carbon to live
5. Knowing the types of carbon molecules that an organism can use will help to predict its function in the
environmental nutrient cycling and maybe interactions between organisms.
6. No, not all bacteria are bad for you. The bacteria in your gut can help break down compounds that we cannot
process whole. This allows for a healthier gut.
185
Quiz - Temperature (post-lab)

1. The definition of temperature that we are using for this class is: “A measurement of the

_____________ _______________ of the molecules within a _____________.

2. Rapid movement of the molecules equates to (hot / cold) temperature.

3. List 2/3 effects temperature has on bacteria’s ability to survive:

1.

2.

4. T/F: Bacteria can regulate their own internal temperatures.

5. Why are temperature graphs shaped like a bell curve?:

6. Draw a diagram with the 3 Cardinal Temperatures. The y axis should be Growth Rate and the x axis should be
Temperature:

7. BONUS: Draw the graph from above with the bell curves and labels of the 4 temperature -phile types we saw in
class.

186
Temperature KEY
1. kinetic energy/system
2. hot
3. growth rate/enzyme function/
4. F
5. Organisms will have a min, max, and optimum temperature when plotting growth rates vs. termperature
6.The diagram should look like a bell curve. The y axis has Growth Rates and the x axis has temperatures from cold
to hot. The leftmost low in which the rate is non-zero is the minimum, the peak is the optimum, and the rightmost
low in which the rate is non-zero is the maximum.
7. See Figure 3-1 in Chapter 3 Appendix 11

Quiz- Salinity (post-lab)

1. Which is not a category to describe the salinity of water?
a. Brackish
b. Fresh
c. hyperbrackish
d. Briny
e. saline

2. Order the classifications from Q1 from most fresh to most salty:

3. Osmosis is the active/passive movement of water through cell membranes in response to solute concentrations
outside of the cell.

4. If solute concentration outside of the cell is higher than inside the cell, water:
a. Moves inside the cell
b. Moves outside the cell
c. Moves in and out at an equal rate
d. No movement

5. If solute concentration inside of the cell is higher than outside the cell, water:
a. Moves inside the cell
b. Moves outside the cell
c. Moves in and out at an equal rate
d. No movement

6. What is an osmolyte?

7. The following questions are in regard to our artificial seawater media that we use in class:

a. Which paper was the one to create this media?

b. What is the difference in medias that we are using for this salinity experiment? Your answer should go
beyond they are different salinities and explore what makes them different salinities.
187

Salinity KEY
1.C
2.Fresh, Brackish, Saline, Briny
3.Passive
4.B
5.A
6.An osmolyte is a charged molecule that the cell will store to balance the ionic charge inside and outside of the cell
7.a. Henson et al. 2016 / b. The media types that we use have the same types of salts at varying concentrations so
that the total ionic strength of each type is different. The nutrients are added to the media at equal concentrations
though.

Quiz- Bacterial Growth (post-lab)

1. Bacteria reproduce sexually/asexually.

2. Culture growth refers to what?

3. What is the technique we use to measure growth of our cultures?
a. Colony forming units
b. Flow cell cytometry
c. Hemacytometer
d. Optical density

4. Draw a standard bacterial growth curve, and include the phases of growth:

5. SYBR-green stains what part of the bacteria?
a. Cell wall
b. Mitochondria
c. Proteins
d. DNA

6. How do you add a comment in R Studio?

7. This is the code that we have been using. Circle the part of the code that allows you to change the axis labels. Put
a square around the part of the code that allows you to change the way the data is grouped.

ggplot(Temp, aes(x =Day, y = Cell.Count, color= Replicate, fill = Replicate)) +

188
geom_line() +

labs(x= "Time (Days)", y = "Cell Counts (cells ∙ mL
-1
)",

title = "LSUCC0117 Temperature Experiment") +

theme_bw()+

facet_wrap(~Temperature) +

scale_y_log10()

8. What was the motivation of Henson et al. 2016?

9. What was the goal of Henson et al. 2016?

10. What was the measurement of cultivation success/failure in Henson et al. 2016?

Bacterial Growth KEY
1.Asexually
2.When the total count of cells in the culture increases exponentially. Individual cells are living and dying, but the
total cell population size is increasing.
3.B
4.
5.D
6.Pound sign (#)
7.
8. The Great Plate Count Anomaly was the major motivation of Henson et al.2016. The GPCA is the phenomenon in
which <1% of cells that we know are in a sample are able to be cultured on an agar plate and grown in a lab.
9. The goal of Henson et al. 2016 was to use high throughput dilution to extinction culturing with artificial seawater
medium to isolate bacterioplankton from the Gulf of Mexico.
10. % viability was the metric used to evaluate success of the experiments.

Quiz 5- Growth Rates (post-lab)

1. Define what a “growth rate” is.

189

2. Where do we get data to calculate growth rates?

3. What is generation time?
a.Time it takes for cells to double in size
b.Time it takes for a single cell to divide
c.Growth of cells over a period of time
d. Time it takes for the population size to double

4.What do we NOT need to calculate generation time?
a. No
b. k
c. Nt
d. n

5.Fill in the equation
n= (log( )−log( )) / 0.301

6.Which is the line that assigns data for your x-axis and y-axis?
1.ggplot(nameyourdata, aes(x=XXXX, y=XXXX)) +
2. geom_jitter(size = 5, width = 0.0, height = 0.0, alpha = I(0.5)) +
3. geom_smooth(method = "auto", formula = y ~ x, span = 0.85, se = FALSE)
4. labs(x="Enter a label", y="Enter a label", title="Enter a label") +
5. scale_x_continuous(breaks=c(12,24,33,40),
6. labels=c("12","24","33","40")) +
7. theme_bw()

7. Is the code above for growth curves or rates?

8. What is the difference in axes for growth curves vs growth rates?

9. Draw what a growth curve graph looks like on the left and growth rate graph on right.

Growth Rates KEY
1. The rate at which a population of cells grow
2. The data comes from cell counts over time
3. D
4. B
190
5. n= (log( Nt)−log(N0 )) / 0.301
6. Line 1
7. Growth rates
8. Growth curves have time on the x axis and cell counts on the y axis. Growth rates have a variable on the x axis
and rates on the y axis.
9. See Figures 2-3 in the main text

191
Chapter 3 Appendix 24. Example Final Exam Fall 2018

Experimental Theory (150 points)
General:

1. What were 2 of the ways that we used sterile technique to minimize possible contamination in this lab? (2 points
each, 4 points total)
1)

2)

2. Describe a specific way that bacteria uniquely affect their environment. (4 points)

3. List 3 reasons that bacteria can be beneficial to humans. (2 points each, 6 points total)

1.

2.

3.

4. What are the two types of controls that we should have with experiments? (2 points each, 4 points total )

5. Define the predicted outcome of each of the controls from above and give an example of each: (2 points each, 4
points total)

1.

2.

6. Which of the following nutrient cycling do bacteria NOT help with: (2 points)
a. carbon
b. sulfur
c. nitrogen
d. phosphorous
e. bacteria help with all of the above
f. bacteria don’t participate in any of the above

Scientific literature:

7. What is the difference between a motivation and an objective? (2 points each, 4 points total)

Motivation:

192

Objective:

8. What are the 6 major sections of a scientific paper? (1 point each, 6 points total)

9. Fill in the section of a scientific paper that the following information would be found: (2 points each blank, 8
points total)

Excerpt from paper Section of
paper
Within the environment, chromium mainly persists in two forms: Cr(III) and Cr(VI) (Bartlett, 1991).
Cr(VI) is highly toxic, soluble, and can be easily transported across cell membranes of both
eukaryotic and prokaryotic organisms via sulfate and other active transporters (Ackerley et al., 2004b;
Cheng, Holman & Lin, 2012).

Though a “core” metabolic and genomic structure was seen among our isolates, our data suggests that
Cr(VI) reduction discrepancies within these isolates could be related to strain-level genetic and
metabolic variation. Further, chromate resistance may be intertwined with the ability of a bacterium
to reduce and transport chromate as well as the type of stress response the organism might have.

Each genome did contain genes with sequence homology to the chromate reductases, chrR and yieF,
of non-model organisms. The putative chrR-like genes found in the isolates are homologous to a chrR
gene (GenBank accession number AM902709) found in T. scotoductus. (Opperman, Piater & Van
Heerden, 2008).

Whole genome shotgun sequencing was performed by multiplexing the genomic DNA onto one lane
using the Illumina HiSeq 2000 platform with 100 bp paired end reads using V2 chemistry at
Cincinnati Children’s Hospital Medical Center’s Genetic Variation and Gene Discovery Core
Facility.

Carbon:

10. Autotrophs are associated with organic / inorganic carbon. (2 points)

11. Heterotrophs are associated with organic / inorganic carbon. (2 points)

12. Rocks, respiration, and sediment are sources of organic / inorganic carbon in aquatic ecosystems. (2 points)

13. In 3 sentences or less, why did we perform transfers when characterizing the carbon usage of your organism? (3
points)

193

Use the following result table to answer questions 14-17:

Well Carbon Source P1 P2 P3
A1. Sodium acetate + - -
A2. Sodium succinate + - -
A3. Sucrose + - -
A4. Urea + + +
A5. Glycine + + +
A6. Bacteria + media + + +
A7.
Bacteria + carbonless
media + + +
A8. Carbonless media only + + +

14. Which wells contain the carbon sources that this organism can use? (3 points)

15. Which wells contain the controls? Label them as positive or negative controls. (6 points)

16. Can we trust this data? (2 points)

17. Why or why not? (3 points)

18. Fill in the blank to go through the protocol for the carbon experiment: (3 points each blank, 15 points total)

We started the first carbon plate with 1.5mL of ____________________media already in the wells of Plate #1. We
then added our ____________________to give our organism food to grow. Then we inoculated Plate #1 with our
bacteria- ____________________._We waited for 2 weeks, then Plate #1 was counted using in the Lab. The source
of the bacteria for Plate #2 was _______________________ since this portion of the experiment was a transfer
rather than an inoculation.

194

19. What are the fates of carbon for a respiring bacterium? (3 points)
a. CO2
b. Waste
c. Biomass
d. All of the above
e. None of the above

20. T/F: All bacteria found in the same environment use the same types of carbon substrates. (1 point)

Temperature:

21. T/F: Bacteria can regulate their temperature. (1 point)

22. Rank from coldest to hottest: psychrophile, thermophile, hyperthermophile, hyper-psychrophile, mesophile (4
points)

23. Since temperature directly affects bacterial growth rate, if a bacterium is growing in a system that is outside its
optimum temperature range it will be more / less active. (2 point)

Use the following graph from XX to answer questions 24-27:
195

24. Which organism has the lowest range of possible temperatures? (3 points)
a. L. sansranciscensis I
b. L. sansranciscensis II
c. C. milleri

25. If all of these organisms were in a flask together, which do you think would dominate the culture? Hint: Which
would outgrow the others? (3 points)
a. L. sansranciscensis I
b. L. sansranciscensis II
c. C. milleri

26. What temperature range would you expect to see all of these organisms in the environment co-existing? (3
points)

27. Explain your answer for number 26 above. What about the graph tells us that this is the correct range? (4 points)

196

Salinity:

28. T/F: In the salinity experiment, we used media with different types of salts to figure out which salts the organism
liked best. (2 points)

29. T/F: If we adjust an organism’s media from a salinity value of 5 to a salinity value of 10, it will definitely be
okay because both of these values are in the brackish range. (2 points)

30. Osmosis is active/passive. (1 point)

31. Osmolyte transport is active/passive. (1 point)

32. T/F: Defining salinity tolerances helps in understanding bacterial distribution. (1 point)

33. If a cell is placed from a fresh habitat into a salty habitat, describe what happens to the water inside of the cell.
Draw an image if you’d like. (5 points)

34. Why are coastal areas commonly brackish? (5 points)

35. The saltiest type of water is: (2 points)
a) brackish
b) briny
c) fresh
d) saline
e) super saline

Microbial Growth and Growth Rates:

36. Fill in the blanks or circle the appropriate answer pertaining to microbial growth and growth rates. (3 points
each, 15 points total)

Bacteria reproduce through binary ___________________. This process is when one cell

becomes two through (sexual / asexual reproduction). Because of this type of reproduction,

cultures of bacteria experience ______________________ growth, which is indicated in the
197

growth curves as the part of the curve with the steepest slope. If we can find the number of

cells at the inflection points of a growth curve, we can calculate the ______________________

of the culture. This value allows researchers to easily compare microbial growth. Once rates are plotted,

they form a (sigmoidal / bell curve) shape in which we can see the minimum,

maximum, and optimum condition of a bacterial culture.

37. T/F: The way an organism will grow in a lab is the exact way that it will grow in the environment (2 points)

38. T/F: Generation time is the time it takes for one cell to become 2. (1 point)

39. The equation: n = (log(Nt) - log(N0)) / 0.301 is used to calculate what? (3 points)
a.The time at which lag phase ends
b.The time between Nt and N0
c. The cell count at the beginning of stationary
d. Generations between Nt and N0
e. Generations per time
f. Time per generation
g. Growth rate

40. The equation: g = n/t is used to calculate what? (3 points)
a.The time at which lag phase ends
b.The time between Nt and N0
c. The cell count at the beginning of stationary
d. Generations between Nt and N0
e. Generation time
f. Growth rate

41. The equation: k= 1/g is used to calculate what? (3 points)
a.The time at which lag phase ends
b.The time between Nt and N0
c. The cell count at the beginning of stationary
d. Generations between Nt and N0
e. Generations per time
f. Time per generation
g. Growth rate

Bonus: Explain in detail something that you learned this semester that was not on the exam. You can earn up to 5pts.

198
Final Exam Answer Key

1. Gloves/ Ethanol and Bleach our workstation/ Ethanol our gloves/ Use a biosafety cabinet
2. Answers can vary depending on in class discussion. Most answers with any nutrient cycling are acceptable and
some examples we used in lecture are:
-When bacteria degrade nutrients that flow into the Gulf of Mexico from the Mississippi River, they can use up all
the oxygen in the bottom waters and cause the seasonal hypoxic zone that we see in the summer.
-Bacteria often are the ones that can break down large complex carbon molecules into forms that are more usable for
other organisms to use. An example of this is aromatic hydrocarbons. The ring structures are difficult to break, but
some bacteria can sever the bonds and release the ring into chains that other organisms can use.
-Plant roots often have symbiotic bacteria that help with nitrogen fixation and turns nitrogen into a fom that is usable
for the plants.
3. Nutrient cycling, food microbiology (lactobacillus in yogurt), gut microbiome, etc
4. Positive and negative controls
5. Positive control results should respond to the tested stimuli in alignment with known results. EX: The carbon
experiment’s positive control was our isolate inoculated into its regular growth medium since we know that the
organism can grow in this medium.
A negative control should be designed so that there will be no response to the tested stimuli. EX: One of the carbon
experiment’s negative controls was the medium without our organism inoculated into it. If there is growth in that
well, it is likely that the experiment was contaminated and we should not trust the results.
6. e
7. Motivation is the reasoning for the study often presented as the problem or gap in knowledge. Objective is the
specific aims of what a study hopes to accomplish.
8. Abstract, Introduction, Methods, Results, Discussion, References
9. Introduction, Discussion, Results, Methods
10. Inorganic
11. Organic
12. Inorganic
13. We transferred the carbon plates multiple times to eliminate the carryover carbon that would exist from the
inoculum in the first plate. If the cells can grow after 3 transfers, we know mathematically that there wouldn’t be
enough carryover carbon to sustain life.
14. A4,A5,A6,A7,A8
15. A6 is the positive control and A8 is the negative control
16. The data seems untrustworthy at first since the negative control is positive.
17. Carbonless media only should not be positive since there is no bacteria inoculated into it. It is likely that this
experiment got contaminated with an autotroph.
18. carbonless media, carbon sources, LSUCC0135, Plate#1
19. d
20. F
21. F
22. hyper-psychrophile, psychrophile, mesophile, thermophile, hyperthermophile
23. less
24. c
25. b
26. around 10˚C to right under 35˚C
27. The organisms based on temperature alone in theory could overlap in the temperatures at which the growth rate
is not 0
28. F
29. F
30.passive
31.active
32.T
33.The water inside of the cell would rush outside of the cell to try to balance the ionic potential of each
34. Rivers often input large amounts of fresh water when they drain into salt water near coasts.
35. b
36. fission, exponential/logarithmic,growth rate, bell curve
199
37.F
38.F
39.D
40.E
41.G
Bonus: Can be anything that is correct and was covered in the course.

200

Chapter 3 Appendix 25: Instructor timeline

Week Topic Quiz In-Class Activity
Assign to
students
Instructor Prep for following
week
1-2 months
before class

Order all materials
(A2)
1 week
before class

Create and distribute syllabus,
instructor should get familiar
with cell counts (A3,19)
1 Introduction Syllabus Pipette practice
Informal Essay
1 (A5), Social
Media
Assignment
(A5)
Select nutrient sources
2 Nutrient Stocks
Create nutrient
stocks used for
minimal media
experiment
Presentation 1
(A6)
Make ASM-C (A1)
3
Minimal media
plate #1
Pipettes and
Nutrients
Set up and inoculate
minimal media
plate #1, science
communication
example
Elevator pitch
(A7), Writing 1
(A8)
Make temperature media (A1)
and set incubators
4 Temperature
Temperature
inoculation
Writing 2 (A9)
Daily cell counts on temperature
exp (A3, 19),
Make ASM-C (A1), Count
minimal media plate#1 (A3, 19)
5
Minimal media
plate #2
Temperature
Transfer minimal
media
plate #1 to plate
#2, elevator pitch
Homework 1
(A10)
Distribute temperature cell count
data to students,
Upload growth curve graphing
instructions and code (A21)
6 Growth curves
Plot temperature
growth curves
Homework 2
(A11)
Make ASM-C (A1) ,Count
minimal media plate #2 (A3, 19)
7
Minimal media
plate #3
Bacterial
Growth
Transfer minimal
media
plate #2 to plate #3
Poster evaluation
Homework 3
(A12)
Upload growth rate graphing
instructions and code (A22)
8 Growth rates
Plot temperature
growth rates
Homework 4
(A13)
Make salinity media (A1), Count
minimal media plate #3 (A3, 19)
9 Salinity Growth rates
Salinity
inoculation
Poster (A15),
Final writing
(A14)
Daily cell counts on salinity exp
(A3, 19), Distribute salinity cell
count data to students
10
Data round-up
and poster drafts
Salinity
Review data,
poster drafts,

11
Exam review and
posters

Poster
presentation and
review
Informal
Writing 2 (A16)
Create Final Exam (A24)
12 Final exam Final Exam

201
Chapter 3 Appendix 26: Alternative schedule and assignments/assessments/activities from Spring 2020

Week Topic Quiz
In-Class
Activity
Assign to
students
Instructor Prep for following
week
2 months
before
class

Order all materials
Create syllabus
2 weeks
before
class
Begin culturing strain for course
1 week
before
class

Transfer cultured strain into fresh
media
Distribute syllabus
1 No Class
Transfer cultured strain into fresh
media
Make SYBR-Green for course
experiments
2
Introduction +
Syllabus
Lab Safety
Transfer cultured strain into fresh
media
Calculate mass needed for each
chemical for each nutrient stock
Weigh and aliquot excess dry
chemical to bring into the lab
3
Macromolecules
and culture medium
Macromolec-
ules and
Minimal Media
Methods
Nutrient stocks
for minimal
media
experiment
Pre-lab
reading
assignment
(due week 4)
Transfer cultured strain into fresh
media
Make base MWH2 media (no C,
S, N sources)
Autoclave the 96-well plate cover
Aliquot 1.5mL Base MWH2 and
control media into wells of a
sterile 96-well plate
Aliquot MWH2 into controls
wells
Count cultured strain day of the
lab prior to class to calculate
inoculation volume of cultured
strain into plate
4
Minimal Media
Experimental
Design
Microbial
Physiology and
Minimal Media
Methods
Set-up and
inoculate
Minimal Media
Plate #1

Transfer cultured strain into fresh
media
Dishwash, acid wash, and
autoclave necessary number of
flasks for Temperature
Experiment
Make MWH2
Count cultured strain day of the
lab prior to class to calculate
inoculation volume
Aliquot 50mL of MWH2 into
each cleaned/autoclaved flask
Set desired temperature for
incubators
Daily time-points for 1 week for
the temperature experiment
5 Temperature Temperature
Temperature
Experiment
Inoculation
Elevator Pitch
(due week 7)

Transfer cultured strain into fresh
media
Autoclave the 96-well plate cover
Aliquot 1.5mL Base MWH2 and
control media into wells of a
sterile 96-well plate
Aliquot MWH2 into control wells
202
Continued daily time-points for
temperature experiment
6
Minimal Media
Experiment
Minimal Media
Experiment
Protocol
Journal Club
&
Minimal Media
Plate #2

Transfer cultured strain into fresh
media
Count Minimal Media Plate #1
Upload Plate #1 count data to
Blackboard
Dishwash, acid wash, and
autoclave necessary number of
flasks for Salinity Experiment
Make MWH1, MWH2, MWH3,
MWH4
Count cultured strain day of the
lab prior to class to calculate
inoculation volume
Aliquot 50mLs of each media
type into separate flasks for
Salinity Experiment
Daily time-points for 1 week for
the temperature experiment
7 Salinity Salinity
Salinity
Experiment
Inoculation
Introduction
and Methods
sections for
lab report
(due week 9)
Transfer cultured strain into fresh
media
Autoclave the 96-well plate cover
Aliquot 1.5mL Base MWH2 and
control media into wells of a
sterile 96-well plate
Aliquot MWH2 into control wells
Continued daily time-points for
salinity experiment
8
Minimal Media
Experiment
Scientific
Literature
Minimal Media
Plate #3
&
“Meet the
Micro-
biologist”
Podcast
Peer Edits &
Scientific
Reading
Assignment
(both due
week 11)
Count Minimal Media Plate #
Upload Plate #2 count data to
Blackboard
Clear space in Thrash Lab for
students to work
Day of class, set out pipette sets,
pipette tips, 96-well count plates,
and thaw SYBR-Green for
students
9 Flow Cytometry
Minimal Media
Experiment
Data
Interpretation
Optional
activity-
students
observe flow
cytometer cell
counts
Remind about
Peer Edits &
Scientific
Reading
Assignment

10
SPRING
BREAK NO
CLASS

Upload Temperature and Salinity
data to Blackboard
11 Bacterial Growth
Microbial
Growth
Data
Visualization
in R –
Temperature
and Salinity
Growth Curves
Temperature
and Salinity
Growth
Curves (due
week 12)
&
Final Lab
Report (Due
week 15)
Did not happen due to COVID
lab shutdown:
Count Minimal Media Plate #3
Upload Plate #3 count data to
Blackboard

12
Bacterial Growth
Rates

Calculate
Growth Rates
for
Temperature
and Salinity
Experiments
Final Exam
(Virtual
during Week
14)

Create poster template and upload
to Blackboard
203
&
Data
Visualization
in R –
Temperature
and Salinity
Growth Rate
Curves
Add extra
hour for
taking the
exam in case
of internet
shortages/lack
of quiet space
in home for
studying and
taking exam.
13
Poster Design and
Construction
R-Studio,
Salinity Growth
Rate Curve
Poster Drafts
Reminder
about Final
Exam and
Final Lab
Report

Poster
Presentation
(recorded
presentation
due Week 16)

14
Virtual Final
Exam

15 Study Period
Time for
questions and
help with
Posters and
Final Lab
Report

Spring 2020 Quizzes

Quiz 1 – Macromolecules and Minimal Media Methods (Pre-lab)

1. Natural seawater is:
a. Complex and undefined
b. Minimal and defined
c. Minimal and complex
d. Complex and defined
e. Minimal and undefined
2. _________ prompted scientists to create better growth media.
a. Artificial Seawater Media
b. The Great Plate Count Anomaly
c. Natural Seawater Media
3. It is ok for the nutrient solutions to be non-sterile because we will not be using them again.
a. True
b. False
4. Fill in the blank. We used a ________ to maintain a sterile environment _______ filter our nutrient stocks
using a __________ filter and ______________.
(laminar flow hood, filter sterilize, 0.2 micron, syringe)

Quiz 2 – Microbial Physiology and Minimal Media Methods (Pre-lab)

1. The carbon that heterotrophic microorganisms consume has two general gates, ____ and/or _________.
a. Incorporated into biomass/respired as CO2
b. Incorporated into biomass/remains unchanged from its original form
c. Remains unchanged from its original form/ respired as CO2
204
d. Never seen again/incorporated into biomass
2. Microorganisms are important in the carbon, sulfur, and nitrogen biogeochemical cycles.
a. True
b. False
3. An organism that uses light to consume and digest organic carbon is a _________.
a. Photoheterotroph
b. Photoautotroph
c. Chemoautotroph
d. Chemoheterotroph
e. None of the above
4. Short answer. How many carbon, nitrogen, and sulfur substrates will each student be testing in our minimal
media experiment?
(5 carbon, 2 nitrogen, 5 sulfur)

Quiz 3 – Enzyme Physiology (Pre-lab)

1. Enzymes are biological catalysts that increase the rate of chemical reactions by lowering the
____________ of the reaction.
a. Product concentration
b. Substrate availability
c. Activation energy
d. None of these
2. Cardinal temperatures refer to:
a. The minimum and maximum temperatures that an organism can grow
b. The minimum, maximum, and optimum temperatures that an organism can grow
c. The optimal temperature that an organism can grow
d. None of these
3. Temperature does not affect the activity of enzymes.
a. True
b. False
4. Extreme temperature disrupts the stability and structure of cell membranes.
a. True
b. False

Quiz 4 – Minimal Media Experiment Protocol (Pre-lab)

1. Prior to adding anything to the wells, what is the volume of media in each well?
a. 1.5 mL
b. 2 mL
c. 1.5 uL
d. 2 uL
2. What is the source of inoculum bacteria for Plate 2?
a. Plate 3
b. Plate 1
c. Culture flask
3. The volume of stock added to the well in the plate was ________ and to a final concentration of
_________.
a. 2 uL / 3.2 x 10^-5 M
b. 2 uL / 3.2 x 10^-2 M
c. 2 mL / 3.2 x 10^-2 M
d. 2 mL / 3.2 x 10^-5 M
205
4. The base media used in this experiment is unamended from it’s original form and contains all
macromolecules necessary for growth.
a. True
b. False

Quiz 5 – Salinity Quiz (Pre-lab)

1. Hydrophilic and large polar molecules can pass freely across the plasma membrane.
a. True
b. False
2. Water moves from ______ water / ______ solute concentration to ________ water / ________ solute
concentration.
a. High / low …. Low / High
b. High / high …. Low/ low
c. Low / high …. High / low
d. Low / low …. High/ high
3. Bacteria use compatible solutes as a way to fight osmotic stress during salinity changes in their surrounding
environment.
a. True
b. False
4. Compatible solutes are:
a. Can be used for biomass
b. Can be used for energy generation
c. Are used as a charge buffer to balance the ionic strength outside the cell
d. All of the above

Quiz 6 – Scientific Literature (Post-lab)

1. A textbook is an example of a ________:
a. Primary source
b. Secondary source
c. Tertiary source
2. A primary source is peer-reviewed from 2-3 experts in the field of research prior to the work being
published.
a. True
b. False
3. Where do these two components fit into the structural organization of a primary research paper: what is
already known about the topic, and the gaps?
a. Introduction
b. Methods
c. Results
d. Discussion
4. The results section is where you both describe the observed data and interpret it’s findings.
a. True
b. False

Quiz 7 – Minimal media Experiment interpretation (Post-lab)

1. Anything below ________ cells/mL we are not considering positive growth.
a. 1 x 10^6
206
b. 3 x 10^5
c. 1 x 10^4
d. 5 x 10^3
2. Short answer. How will we determine that LSUCC0713 is growing on the compounds supplied, and why?
(Positive growth on three consecutive plate transfers, to determine that LSUCC0713 is not consuming the
carryover nutrients from the initial inoculation.)

Quiz 8 – Microbial Growth (Pre-lab)

1. Compared to copiotrophic organisms, oligotrophic organisms typically grow ______ and need _______
nutrient concentrations to grow.
a. Quickly / high
b. Slowly / low
c. Quickly / low
d. Slowly / high
2. Regarding microbial growth, binary fission leads to exponential growth.
a. True
b. False
3. Which is NOT a phase in a microbial growth curve?
a. Lag Phase
b. Death Phase
c. Exponential phase
d. Saturation phase
e. Stationary phase
4. Diauxic growth patters in batch culture occur when the organism consumes and depletes a substrate during
growth, then transfers to another available substrate. During this process you see a lag phase while they
shift their gene expression to catabolize the new substrate.
a. True
b. False

Quiz 9 – RStudio, Salinity Growth Rate Curve (Post-lab)

x-axis = Salinity (PSU)
y-axis = Growth rate (divisions per day)
Title – “Growth Rate vs. Salinity, LSUCC0713”
Data points plotted along with interpolation curve

Quiz 10 – Poster draft (Post-lab)

Drawn schematic of how they envision their poster.
Spatial organizational flow of information determined, all figures to be included are specified, and flow
charts/visuals for methods are determined

207
Spring 2020 Alternative assignments/assessments/activities

Name: _____________________________

BISC 221 Lab – CURE
Spring 2020
Pre-Lab Assignment #2

Directions: Please read Carini et al. 2014 found on Blackboard, and answer the following questions regarding the
paper. Hand your completed assignment to your instructor at the beginning of class.

Due date: February 11
th

1. Fill in the blank:
“…relatively little is known about vitamin biogeochemistry or the affect of vitamins on

the _______________________ and __________________________ of planktonic

communities.

2. In Figure 1, what the reactions labeled in black mean? What do the reactions labeled in red mean?

3. What organism is this study working with? Is it a type of bacteria, archaea, or eukaryote? What Earth
system does it live in/isolated from (ex: soil, lakes, ocean, subsurface, etc.)?

4. Fill in the blank:

“Cells for counts were stained with ____________________________ and counted with

a Guava Technologies ______________________________________...”

5. What evidence lead these researchers to hypothesize that Ca. P. ubique is auxotrophic for HMP?

208

6. Figure 2c represents nucleotide sequences, each base represented by a different color. Above the aligned
sequences, is a sequence illustration with varying font sizes – what does this sequence represent.

7. The authors state that, “Thiamin and AmMP were ineffective at restoring thiamin-limited growth at pico-
or nanomolar concentrations.” Why? Hint – Figure 3.

8. In Figure 4, at what time of day and at what depth did the researchers find the highest concentration of
HMP? Approximately, what is the highest concentration they found?

9. True/False: Thiamin cycling in the oceans may follow complex patterns and involve multiple processes and
intermediates.

10. How was their thiamin stock solution contaminated with HMP?

Pre-lab Assignment #1 Answer Key

1. Structure, composition
209
2. Black = encoded in the genome. Red = missing from the genome
3. SAR11, bacteria, ocean
4. True
5. SYBR Green I, flow cytometer
6. Missing genes. No transporter, and also missing genes for biosynthesis
7. Consensus sequence
8. No ThiBPQ or TenA
9. 8pm, ~110 meters depth/DCM, ~ 35 pM
10. True
11. Background HMP concentrations from manufacturing

Meet the Microbiologist: SAR11 and Other Marine Microbes

1. Who provides the carbon for the marine ecosystems? What “zone” do they live in?

2. What is the “zone” referred to where “you might barely get to read a newspaper”? What are the
microorganisms that live there consuming? There did that source of food originate from?

3. Why are the microbes that live in the deep ocean biochemically different than those that live at the surface?

4. How does the distribution of cells change as you go deeper in the water column?

5. In regard to the carbon cycle, how much of global photosynthesis is occurring in the global oceans?

6. Why does the surface have so little nutrients?

7. How is the carbon cycle different in the ocean than it is on land?
210

8. Do the oceans act as a sink for atmospheric CO2?

9. What is the total census for SAR11 cells?

10. Where in the water column do SAR11 cells exist?

11. What percent range of photosynthetically fixed carbon are SAR11 cells consuming?

12. Are SAR11 cells vulnerable to infection? By what? Are these entities usually as abundant as SAR11?

13. What two gaseous compounds are SAR11 cells producing from DMSP? Are those compounds known to
volatize into the atmosphere from the ocean?

14. What technology did the Giovannoni lab use to isolate marine micobes 30 years ago? How does this work?
What medium did they use for isolating these organisms?

15. What is a characteristic of ocean gyres? What is the causing these regions to expans?

16. What analogy did Dr. Giovannoni use to describe the carbon source/”food” that SAR202 eats?
211
Final Lab Report Guidelines
This lab report is a synthesis of all the experiments done this semester. Augment your Introduction and
Methods sections, and make sure to implement any feedback that I have given you. You can access this feedback
on your turn-it-in assignments. You need to include the following sections:
Title:
The title should be descriptive of our objectives this semester
Introduction:
This section must include at least four outside references to support the message you are conveying in your
introduction. You will need to discuss why bacteria, particularly marine bacteria, are important. Incorporate ideas of
why nutrient usage, temperature, and salinity are important to bacteria, and marine and coastal environments.
Introduce LSUCC0713, and you MUST discuss where LSUCC0713 was isolated from and describe that system.
You need to include how it was isolated, the type of media used for isolation, where this isolate is stored.
That being said, you MUST cite Henson et al. 2016 as a reference – this citation is not counted in your 4-reference
minimum. Follow up with introducing the experiment, and what our objectives are.
Methods:
Your methods must be organized, accurate, comprehensive, and nonrepetitive. You should organize your
methods into different subheadings for each experiment, including sterile technique. Do not forget to discuss the
controls we implemented in each experiment, and to add Cell Counts and RStudio into your methods.
Results:
All figures must have the appropriate figure/table captions. The captions provide your reader with the
information needed to interpret the figure. Think of it like a map legend. The figures that you need to include
are:
-Minimal media experiment data
-Temperature Growth Curve
-Temperature Growth Rate Curve
-Salinity Growth Curve
-Salinity Growth Rate Curve
Remember, you are stating your results in this section, and will be interpreting them in the discussion.
Discussion:
Here is where you will interpret your data and address trends that you notice. I am not looking for a
specific answer, but I want you to form conclusions based on the data and to explain why you believe this to be
true.
I have provided you with the other section’s minimal media experiment data. You can use this as a point
of reference in interpreting your own data – under no circumstance should you include this in your results section.
Additionally, you can use this section to tie the results from our experiments into the bigger picture.
How does our experiment and results connect to existing data and to the marine environment. Use citations to
back up your claims if necessary.
Future Directions:
If you could continue, what experiments would you like to do? What direction would you take this
research?
References:
APA format

212
Introduction/Methods Rubric

This assignment is loosely graded. Essentially it is meant to get them thinking about how to write about
environmental microbiology, a way to provide them with feedback on the introduction), and to make sure that their
methods are correct. I told them to use the “Structural Organization of Primary Research Papers”, (page 7) in
Chapter 4 of their lab manual, to guide them in their writing.

Introduction – 10 points
Introduce the topic of environmental microbiology/marine microbial ecology (3 points)
They make no connection to marine microbial ecology (1 point)
Introduce the topic of the importance of cultivation (1 point)
*This is important, but at this point in their writing they might not have picked up
on it yet. This will be required and emphasized for the final lab report.*
No mention of it – 0 points
What type of organism is LSUCC0713? – A bacterium (1 point)
No mention – 0 points
Where was LSUCC0713 isolated? (1 point)
No mention – 0 points
Why is it unique/what type of system? (1 point)
Mention it is brackish – 0.5 points
No mention – 0 points
What is the motivation for this investigation? (3 points)
They provide a generic motivation without any context – 1 point
No mention of motivation – 0 points

Methods – 10 points
Carbon stocks – 2 points
Why did we make these/what experiment are they for? – 0.5 point
Concentration of stock/volume of water – 1 point
Filtered – 0.5 points
Minimal media – 2 points
Final concentration of stock in the plate – 0.5 points
The matrix format – 0.5 points
Repeated the plate 3 times – 0.5 points
The volumes of culture/stock/amended medium – 0.5 points
Temperature – 2 points
Type of media – 0.5 points
Volume of media/volume of culture inoculated – 0.5 points
Incubation length and conditions – 0.5 points
Cell fixing for counts – 0.5 points

Salinity – 2 points
Type of media – 0.5 points
Volume of media/volume of culture inoculated – 0.5 points
Incubation length and conditions – 0.5 points
Cell fixing for counts – 0.5 points
Sterile Technique – 2 points

213
Final Lab Report Rubric
50 points

Title: 2 points
Includes LSUCC0713 – 1 points
Includes the characterization aspect – 1 points

Introduction: 10 points
Introduce the topic of environmental microbiology/marine microbial ecology – 3 points
They make no connection to marine microbial ecology (1 point)
Introduce the topic of the importance of cultivation – 1 point
No mention of it – 0 points
What type of organism is LSUCC0713? – 1 point
No mention – 0 points
Where was LSUCC0713 isolated? – 1 point
No mention – 0 points
How was LSUCC0713 isolated? – 1 point
No mention – 0 points
Why is it unique/what type of system? – 1 point
Mention it is brackish – 0.5 points
No mention – 0 points
What is the motivation for this investigation? – 2 points
They provide a generic motivation without any context – 1 point
No mention of motivation – 0 points

Methods: 14 points
Carbon stocks – 2 points
Why did we make these/what experiment are they for? – 0.5 point
Concentration of stock/volume of water – 1 point
Filtered – 0.5 points
Minimal media – 2 points
Final concentration of stock in the plate – 0.5 points
The matrix format – 0.5 points
Repeated the plate 3 times – 0.5 points
The volumes of culture/stock/amended medium – 0.5 points
Temperature – 2 points
Type of media – 0.5 points
Volume of media/volume of culture inoculated – 0.5 points
Incubation length and conditions – 0.5 points
Cell fixing for counts – 0.5 points
Salinity – 2 points
Type of media – 0.5 points
Volume of media/volume of culture inoculated – 0.5 points
Incubation length and conditions – 0.5 points
Cell fixing for counts – 0.5 points
Sterile Technique – 2 points
Cell counts – 2 points
Method used – 0.5 points
Stain used – 0.5 points
Dilutions made to each sample – 1 point
RStudio – 1 points
Why did we use RStudio – 0.5 points
What packages did we use – 0.5 points

Results: 7 points
Minimal media data – 1 points
214
Temperature Growth Curve – 1 point
Temperature Growth Rate Curve – 1 point
Salinity Growth Curve – 1 point
Salinity Growth Rate Curve – 1 point
Informative figure and appropriate captions – 2 points

If figures are blurry, -0.25
Any mention of the other class’s data will get an automatic deduction of 5 points.

Discussion: 10 points
Interpret data and draw conclusions from them – 3 points
Explanation of why they think that conclusion to be true – 2 points
Extrapolating these conclusions out to the coastal Louisiana system – 3 points
Comparing these results with similar studies – 2 points

References: 2 points
Henson et al. 2016 – 1 points
At least 4 references – 1 point

Quality of writing: 6 points
Poor sentence structure, unclear ideas, poor grammar – 3 points

215

Chapter 3 Appendix 27: Alternative schedule and assignments/assessments/activities from Fall 2021

Dates Week Topic Quiz In-Class Activity Assign to students
Instructor Prep for day of
teaching
Order all materials
8/23-
8/29
1 No lab No lab
Instructor should create and
distribute the syllabus,
Instructor should get familiar
with cell counts
8/30-
9/5
2 Intro./safety Lab safety
Read lab manual
CH for next week
Instructor should familiarize
themselves with safety material
locations in the classroom
9/6-
9/12
3
Macromolecules
and Cultivation
Lab
Quiz
#1
Creation of
Nutrient Stocks
Pre-lab #1,
(Exercise #1 in CH
3 of lab manual),
Checked in lab
manual in week #4,
turned in (on 9/22),
Lab manual CH for
next week
Bring chemicals, falcon tubes,
filters, syringes, weigh paper,
and Milli-Q
9/13-
9/19
4
Minimal media
plate #1
Lab
quiz #2
Minimal media
plate #1
inoculation
Pre-lab assignment
#2 (A26) (Due
9/22), Lab manual
CH for next week
Fill 96-well plates with ~1.5 mL
of base media (AMS1-C/N/S),
Bring nutrient stocks to the lab,
Count during week 6.
09/20-
09/26
5 Temperature
Lab
quiz #3
Scientific paper,
Carini et al.
2014 discussion,
Temperature
inoculation
Pre-lab assignment
#3 (A27) due next
class (9/29)
Count inoculum cultures on
Accuri, fill flasks with ~50mL
of AMSW1, Bring flasks,
inoculum culture, and tubes to
the lab, Take daily time points
(~7 days) for temperature
experiment
9/27-
10/3
6
Minimal media
plate #2
Lab
quiz #4
Plate #1 transfer
to plate #2, Gene
editing journal
club w/ lecture
instructor (~1hr)
Podcast assignment
(A26) (Due 10/6),
Post-journal club
review paper (A27)
(Due 10/20), Lab
manual CH for next
week
Fill 96-well plates with ~1.5 mL
of base media (-C/N/S), Bring
nutrient stocks, pipettes, sterile
tips, and culture to the lab,
Count during week 9.
10/4-
10/10
7
Cell membranes
and salinity
Lab
quiz #5
Salinity lab
activity (non-
mCURE
activity/flex
week)
Intro. and methods
draft (Due 10/20)
Bring red onion, make
hypotonic, isotonic, and
hypertonic solutions, Set up
microscopes, Get sheep blood,
Show students how to use
microscopes, Show example
images of the cell wall effects
after all groups have completed
the lab activity (non-mCURE
activity/flex week) The
instructor can substitute in their
own lab activity to teach about
the topic of “Cell membranes
and salinity”
10/11-
10/17
8
No class, fall
break
No class, fall break
216
f 9
Minimal media
plate #3

Plate #2 transfer
to plate #3,
Climate change
journal club w/
lecture instructor
(~1 hr)
Post-journal club
review paper (A27)
(Due 11/10), Lab
manual CH for next
week
Count minimal media plate #2,
Fill 96-well plates with 1.5 mL
of base media (AMS1-C/N/S),
Bring nutrient stocks to the lab,
Count during week 12.
10/25-
10/31
10
Flow cytometry
and microbial
characterization
lab

Microscopy
characterization
lab and virtual
flow cytometry
activity (A27)
Bring laptops for
Next Classes, Lab
Manual CH for
Next Week
Bring Diatoms, Dinoflagellates,
Trichodesmium, and
Crocosphaera cultures/pasteur
pipettes/ ice water buckets for
Diatoms and Dinoflagellates,
Set up microscope stations,
Make video using flow
cytometer, keep the
Cyanobacteria in a window in
the classroom when not using
them during lab
11/1-
1/7
11
Bacterial growth
rates and data
visualization in R
Lab
quiz #6
and
Lab
quiz #7
Discuss
temperature
data, Final
paper, and
Posters
R-Markdown of
growth curve figure
draft (Due 11/10)
Bring laptop to demonstrate
plotting for students
11/8-
11/14
12
Bacterial growth
rates and data
visualization in R
Lab
quiz #8
Discuss data,
final paper, and
posters, Discuss
concepts from
CH 8 pt 2 and
how to do
growth rate
calculations
Growth rate
calculations due
next class
Count minimal media plate #3,
Bring data to class for students
to make tables with
11/15-
11/21
13
Final data round
up
Lab
quiz #9
Work on
posters/lab
Report
Posters (A27) (Due
12/1), Lab report
(A27) (Due 12/8)
Remind students of lab report
and poster due dates, but they
should have been working on
this for longer
11/22-
11/28
14 No class, Holiday
Lab
quiz
#10
No class,
Holiday

11/29-
12/5
15
Poster
presentations

Poster
presentations

Take notes during presentations
for grading later

Alternative Schedule Notes:
● Lab report turned in during finals week instead of a lab final exam being given
● The salinity experiment was omitted in this alternative schedule
● The social media assignment was omitted in this alternative schedule. Instead, two journal club review
writing exercises were implemented.
● The carbon utilization experiment was amended to be a minimal media experiment testing nitrogen and
sulfur utilization in addition to carbon.

217
Fall 2021 Quizzes

Quiz 1 (pre-lab)
1. Multiple Choice: Natural seawater is:
a. Complex and undefined
b. Minimal and undefined
c. Complex and defined
d. Minimal and defined
e. Minimal and complex

2. It is okay if our nutrient stocks are not totally sterile because it will not affect our minimal media
experiment in the future.
True False
Incorrect Feedback: Our nutrient stocks must be sterile because we need them to conduct our growth
experiments with our single bacterium. They are not useful to us if they get contaminated.

3. Pick the two correct answers. This week, we will be using a ____ attached to the end of a _______ inside of
a biosafety cabinet.
60mL syringe
0.2um filter
250mL flask
2um filter

4. The _____________ prompted scientists to create better growth media in modern times.
a. The Great Plate Count Anomaly
b. Natural Seawater Media
c. Artificial Seawater Media
d. Storage and Transportation Difficulty

5. Match the type of organism to the nutrient type it prefers.
a. a. Oligotrophic organisms a. low-nutrient environments
b. b. Copiotrophic organisms b. high-nutrient environments

6. True/False: The reaction that organisms use to catalyze the connection of monomers to form polymers is
called hydration synthesis.
True False
Incorrect Feedback: Go back to the lab manual and look over the reactions again. The reaction that
organisms use to form polymers is called 'dehydration' synthesis because a water molecule is lost from the
reaction.

Quiz 2 (pre-lab)
1. An organism that uses a chemical energy source to consume and digest organic carbon is a
______________.
a. Photoheterotroph
b. Photoautotroph
c. Chemautotroph
d. Chemoheterotroph
e. None of the above

218
2. Microorganisms are important in the carbon, sulfur, and nitrogen biogeochemical cycles.
True False

3. How many carbon, nitrogen, and sulfur substrates will each student be testing in our minimal media
experiment?
1 nitrogen, 1 sulfur, and 5 carbon sources.

4. The carbon that heterotrophic microorganisms consumes has two general fates, _________ and/or
_________.
a. incorporated into biomass/ respired as CO2
b. incorporated into biomass/remains unchanged from its original form
c. remains unchanged from its original form/respired as CO2
d. Never seen again/incorporated into biomass

5. Heliobacteria are an example of a photoautotroph that use organic carbon and light to survive.
True False
Incorrect Feedback
This is actually and example of a photoheterotroph from the lab manual. These organisms use light, but they use
organic carbon (hence the heterotrophic lifestyle).

6. Organisms commonly use both nitrogen and sulfur for amino acid formation in cells.
True False

Quiz 3 (pre-lab)
1. Enzymes are biological catalysts that increase the rate of chemical reactions by lowering the
________________ for that biochemical reaction.
activation energy
substrate availibility
product concentration
None of these

2. Cardinal temperatures refer to:
the minimum, maximum, and optimum temperatures that an organism can grow.
The minimum and maximum temperatures that an organism can grow.
The optimal temperature that an organism can grow.
None of these.

3. Temperature does not affect the activity of enzymes.
True False

4. Extreme temperatures disrupt the stability and structure of cell membranes.
True False

Quiz 4 (pre-lab)
1. A hypothesis needs to be _____ and _______ to be useful in the context of scientific investigation.
a. testable
b. provable
c. falsifiable
219
d. definitively correct

2. What is the trial group called in which the independent variable is kept at an established value or at zero?
a. control
b. dependent
c. prediction
d. independent

3. When trying to figure out how to write/format my lab report in a few weeks, what should I use to do this?
(one answer only)
a. Chapter 4 of my lab manual
b. Just copy the first suggestion that comes up on Google
c. Chapter 2 of my lab manual
d. Chapter 3 of my lab manual

4. When reading scientific papers, it is important to take notes, look at the figures, look up words that I don't
know, and make sure that I understand the conclusions that the paper is drawing.
True False

5. Which parameters need to be defined before the actual experimental methodology is put on paper? (select
all appropriate answers)
a. The variables
b. levels of treatment
c. replication
d. controls

6. Depending on the environment they live in, bacteria like to grow at different temperatures, so temperature
is important to test when studying an organism. This is why we did the temperature experiment for our
US3C007.
True False

Quiz 5 (pre-lab)

1. Hydrophilic and large polar molecules can pass freely across the plasma membrane.
True False

2. Water moves from ________ water / ________ solute concentration to, _________ water / ________
solute concentration.
high water / low solute ... low water / high solute
high water / high solute ... low water / low solute
low water / high solute ... high water / low solute
low water / low solute .... high water / high solute

3. Bacteria use compatible solutes as a way to fight osmotic stress during salinity changes in their surrounding
environment.
True False

220
4. Compatible solutes are:
not used for biomass
not used for energy generation
are used as a charge buffer to balance the ionic strength outside the cell
All of the above

Quiz 6 (post-lab)
1. Which organism that we observed last week was coccoid in shape and slightly green-colored under the
microscope?
a. Trichodesmium erythraeum
b. Crocosphaera watsonii
c. Pseudo-nitzschia
d. Alexandrium

2. What was the type of stain that the Thrash lab (and our experiments) use for flow cytometry?
a. Syber Green
b. DAPI
c. Ethidium Bromide
d. Acridine Orange

3. Which organisms that we observed last week had 'puff' and 'free trichome' morphologies?

a. Crocosphaera watsonii
b. Trichodesmium
c. Alexandrium
d. Pseudo-nitzschia

4. How would you descibe this morphology, based on your morphology guide sheet that you received last
week?
(insert image of a Streptobacillus bacterium)
a. Streptobacilli
b. Streptococci
c. Vibrio
d. Palisades

5. Which organism did we look at last week that was motile?
a. Alexandrium
b. Pseudo-nitzschia
c. Trichodesmium erythraeum
d. Trichodesmium thiebautii

6. How would you descibe this morphology, based on your morphology guide sheet that you received last
week?
(Insert image of a Spirochete bacteria)
a. spirochete
b. cocci
c. bacillus
221
d. filamentous

Quiz 7 (pre-lab)
1. What do you need to download before our lab on Wednesday this week?
a. Rstudio & R
b. Python
c. Matlab
d. JavaScript

2. What do I need to bring with me to lab this week?
a. My lab manual chapter 8 that I have thoroughly read all the way through
b. My laptop (not just a tablet/phone) because we are coding
c. Just my phone/tablet
d. Just a notebook

3. What is it called when there is a plateau in the number of living bacterial cells and the rate of cell division
and death are roughly equal?

a. Stationary phase
b. Log phase
c. Lag phase
d. Death phase

4. The homework following class today is to knit your RMarkdown file and submit the .html AND your
RCode files to Blackboard for grading.
True False

Quiz 8 (post-lab)
1. We should always use the library() command to re-load packages (like ggplot2) every time that we open R
so that the program knows what packages that we want to use.
True False

2. What did we use to format and output our .html file once we made our plot?
a. knit(knitr)
b. ggplot2
c. .html generator
d. ggridges

3. Why did we use RMarkdown and submit our figure as a .html file?
a. RMarkdown shows that your code is reproducible
b. RMarkdown is good for reports or other resources as it is easily formatted and easy to read.
c. We can only make an RMarkdown file in RStudio.
d. We did not use RMarkdown to output our plots to a .html file.

4. What kind of file with our data in it did we read into RStudio so that RStudio could 'understand it'
properly?
a. .csv
b. .html
222
c. .pdf
d. .xlsx

5. What package did we use to make our plots?
a. Knitr
b. ggplot2
c. ggridges
d. tidyverse

6. When we made our plots, we saw that our organism grew best at 37 degrees celcius.
True False

Quiz 9 (post-lab)
1. What are the most frequently used plot types?
a. line graphs
b. bar graphs
c. dotplots
d. density plots

2. What is Nt in the growth rate calculation?
a. The final cell density over the time period of observation.
b. The starting cell density over the time period of observation
c. The number of generations
d. The growth rate

3. Many natural environments are oligotrophic, so many organisms in oligotrophic regions have slow growth
rates.
True False

4. Most growth curves, like the main plot that we made in class, are ____ graphs/plots because it shows how
the cell density changes over time.
a. Line
b. Bar
c. Boxplot
d. Histogram

Quiz 10 (post-lab)
1. The positive control with our artificial seawater and inoculated US3C007 is not important when
considering the results of our minimal media experiment.
True False

2. Which temperature did our organism appear to grow best at in our temperature experiment?
a. 25 deg C
b. 12 deg C
c. 30 deg C
d. 4 deg C
e. 37 deg C
223

3. Ou temperature experiment and minimal media experiment were monitored and counted by use of the
______ ?
a. Flow cytometer and cells stained using Syber Green.
b. Hemocytometer and cells stained using Syber Green.
c. Flow cytometer and cells stained using Syber Yellow.
d. Hemocytometer and cells stained using Syber Blue.

4. Our temperature experiment was conducted over the course of 7 days by incubating our cultures at 5
different temperatures, and by taking daily cell counts on the flow cytometer.
True False

5. The stain that was used on our cells whenever a cell count was taken was a ___ stain.
a. DNA
b. Bacterial only
c. Mitochondrial
d. Golgi Aparatus

6. Please type the answers to both blanks with a comma in between them:
US3C007 is in the genus _____ and the class _______.
Evaluation Method Answer Case Sensitivity
Exact Match Roseobacter
Exact Match Alphaproteobacteria

224
Fall 2021 Alternative assignments/assessments/activities

Pre-Lab Assignment #3
Cavicchioli et al. 2019 (posted on Blackboard)

1. ______ organisms use the sun’s energy in the top _____ meters of the water column whereas
marine life in deeper zones uses ______ and _______ chemicals for energy.

2. Why specifically are phytoplankton important in terms of primary production and global oxygen
levels?

3. How does changing sea ice levels potentially impact primary production in the ocean?

4. Define any three of the terms listed in the MARINE (OCEAN) environment of figure 1
(excluding the terms light, heat, wind, and rain).

5. Describe the effects of aerosols on the environment that the paper discusses and how they are
related to microorganisms.

*For these next two questions, please do not copy the figure captions.
225

6. Write a brief (4-5 sentences) description on Figure 3 of the paper and describe how some of the
processes might link back to microbes.

7. Write a brief (4-5 sentences) description on Figure 2 of the paper and describe how some of the
processes might link back to microbes.

Pre-Lab Assignment #3
Read: Cavicchioli et al. 2019
(Answers in Quotes are taken directly from Cavicchioli et al. 2019)

1. ______ organisms use the sun’s energy in the top _____ meters of the water column whereas
marine life in deeper zones uses ______ and _______ chemicals for energy.
Answer: Phototrophic microorganisms use the sun’s energy in the top 200 m of the water
column,
whereas marine life in deeper zones uses organic and inorganic chemicals for energy.

2. Why specifically are phytoplankton important in terms of primary production and global oxygen
levels?
“Marine phyto-plankton perform half of the global photosynthetic CO2 fixation (net global
primary production of ~50PgC per year) and half of the oxygen production despite
amounting to only ~1% of global plant biomass30. In comparison with terrestrial plants,
marine phytoplankton are distributed over a larger surface area, are exposed to less
seasonal variation and have markedly faster turnover rates than trees (days versus
decades).”

3. How do sea ice levels potentially impact primary production in the ocean?
“The global sea ice (Sea Ice Index) is declining, leading to higher light penetration and
potentially more primary production; however, there are conflicting predictions for the
effects of variable mixing patterns and changes in nutrient supply and for productivity
trends in polar zones34.”

4. Define any three of the terms listed in the MARINE (OCEAN) environment of figure 1
(excluding the terms light, heat, wind, and rain).
226

5. Describe the effects of aerosols on the environment that the paper discusses and how they are
related to microorganisms.
“Aerosols affect cloud formation, thereby influencing sunlight irradiation and
precipitation, but the extent to which and the manner in which they influence climate
remains uncertain78. Marine aerosols consist of a complex mixture of sea salt, non-sea-salt
sulfate and organic molecules and can function as nuclei for cloud condensation,
influencing the radiation balance and, hence, climate79,80. For example, biogenic aerosols
in remote marine environments (for example, the Southern Ocean) can increase the
number and size of cloud droplets, having similar effects on climate as aerosols in highly
polluted regions80–83. Specifically, phytoplankton emit dimethylsulfide, and its derivate
sulfate promotes cloud condensation79,84. Understanding the ways in which marine
phytoplankton contribute to aerosols will allow better predictions of how changing ocean
conditions will affect clouds and feed back on climate84. In addition, the atmosphere itself
contains ~1022 microbial cells, and determining the ability of atmospheric micro-
organisms to grow and form aggregates will be valuable for assessing their influence on
climate”
*For these questions, please do not copy the figure captions.
6. Write a brief (4-5 sentences) description on Figure 3 of the paper and describe how some of the
processes might link back to microbes.

7. Write a brief (4-5 sentences) description on Figure 2 of the paper and describe how some of the
processes might link back to microbes.

Elevator Pitch Assignment
● 2–3-minute speech that summarizes the key findings from a scientific paper that you have
found
● Over 3 minutes will result in a zero on the assignment
● Sign-up for a time slot on Blackboard and paste in your paper’s title. IT CANNOT BE
THE SAME AS SOMEONE ELSE’S! So, please check what others have listed before
you choose a source.
● Must relate to the topic of this class (marine microbiology, bacterioplankton, microbial
ecology in the ocean, etc.)
● Must have a brief (1-2 sentences) of each section:
227
o Introduction (give title of you chosen paper)
o Objectives of investigation
o Methods
o Results
o Discussion
● Can bring speaker’s notes, but I would suggest memorizing what you want to say for the
sake of time

Elevator Pitch Rubric

3 min or less – 3 pts
Over 3 min – 2 pts

Introduction
Relevant/concise – 4 pts
Short/choppy or too long/Rambling – 3 pts

Objectives of investigation
States objectives – 3 pts
Unclear objectives – 2 pts

Methods
Concise and relevant to results shared – 4 pts
Not relevant to results shared – 3 pts

Results
State main point that matches the objective – 3 pts
Main point doesn’t tie back to objective/unclear – 2 pts

Discussion
Communicate the importance of the result – 3pts
Weakly communicate importance of result – 2 pts

228
Poster and Presentation Guidelines
Each poster presentation should be around 6-7 minutes in length, 3 minutes provided for
questions afterwards
• Poster should have all the sections listed in the example poster given, and they should be thoroughly
discussed and presented. Credit will be decided based on the level of concise yet thorough
completion of each section, attention to detail, providing all the necessary figures/tables (at least
one temperature plot and the Minimal Media Plate matrix), and the quality of the presentation of
each section to the class.
Introduction – 20 points
Research Objectives – 10 points
Methods (Methodology) – 15 points
Results – 20 points
Conclusions (Discussion) – 20 points
Future Directions – 10 points
References (Do not need to specifically list in the presentation, just need to be on the poster) – 5 points

Post-Journal Club Assignment
By: Catie S. Cleveland
Due 11/10/21 At the Beginning of Class
*****PLEASE PRINT OUT FOR CLASS*****
*****NOT EMAIL*****

1. Write a 1.5-2 page “review” paper of the second journal club papers that we discussed in
lab. Feel free to bring in ideas that we had in the discussion.

2. Remember that a review paper is a synthesis of sources and material.

229
3. Please make sure you are citing the references as you discuss them (ex: (Cleveland et al.
2020), (Cleveland and Cleveland 2020) for two authors, or (Cleveland 2020) for one
author).

4. Give it a title, write your name under the title

5. Use 12pt font

6. Reasonable font (Calibri, Times New Roman, Arial, etc.)

7. 1.5 line spacing (same spacing that this document has)

Microbial Morphology: Can you identify it?

Other microbial shapes:

Trichodesmium (Cyanobacteria)

Puff

230

Trichome

What are we looking at today?
Exercise 1:
1. Do some independent research on our organisms (listed on the board)
● What are their different morphologies?

● Are they autotrophs or heterotrophs? If they are autotrophs, what pigments
do they have?

● What type of organism are they (protist, bacteria, etc.)

● What size are they on average (individual cells, not colonies)?

Exercise 2:
Move around to the stations at the benches and either use the microscope or look at the
photos to characterize this organism based on your outside research and the given
information above.

231
FOR MOTILE ORGANISMS: If you see that an organism is moving, observe it for 30
seconds to 1 minute and write down 3 movements that it is doing (example: whipping
flagella, swimming straight, etc.) Please do not just use the example movements. Try to
make your own observations.
1. Which organism is this?

1. What is its morphology?

1. Is it motile or non-motile (N/A for photos)?

1. What color is it?

1. Give a 1-2 sentence description of it below.

232

Instructor Notes on this Lab Activity:
Materials:
● Compound microscopes
● Pasteur pipettes
● Cultures (amount and type of organism decided by instructor)
● Regular slides (and depression slides for motile organisms)
● Slide covers

1. Find images on showing and labeled with general microbial morphologies for students to
reference.
2. It is helpful to give a chalk talk on the board prior to this lab about the importance of
microbial morphology and why it is useful for studying bacterioplankton specifically
3. When this lab was deployed, the instructor had cultures of Trichodesmium,
Crocosphaera, Diatoms, and Dinoflagellates. So, the students referenced photos of these
organisms’ morphologies in class. Depending on what organisms are available for the
students to identify, reference photos of more complex morphologies can be included in
this activity at the instructor discretion under the “other microbial shapes” section. Photos
can be substituted for actual microorganisms at some stations if not enough live cultures
are available to the instructor.
4. If fluorescence microscopes are available, this can be helpful for seeing
small Cyanobacteria. This would also allow the instructor to talk about the importance
of pigment morphologies if desired.
5. Labeled stations should be set up with 1 microscope, 1 pasteur pipette, some slides,
some coverslips, and one culture flask (that does not need to be kept afterwards). The
students should make the wet mounts themselves unless the organism is particularly
difficult to handle.

233
Fall 2021 Final Lab Report Rubric and Guidelines
(Note, in this version of the course, the salinity experiment was not performed, and the minimal medium experiment
did not work- if those are added, this rubric will need modification)

Introduction – 20 points

Introduce the topic of environmental microbiology/marine microbial ecology (6 points)

Introduce the topic of the importance of cultivation (2 point)
This will be required and emphasized for the final lab report. *
No mention of it – 0 points

What type of organism is US3C007? – (2 point)
No mention – 0 points

Where was US3C007 isolated? (2 point)
No mention – 0 points

What is the type of system? (2 points)
Marine environment – (2 point)
No mention of environment type– 0 points

What is the motivation for this investigation? (6 points)
They provide a generic motivation without any context – 3 points
No mention of motivation – 0 points

Methods – 20 points

Sterile/aseptic technique mentioned? – 2 points

Carbon/Nutrient stocks – 6 points
Why did we make these/what experiment are they for? – 2 points
Concentration of stock/volume of water – 2 points
Filtering mentioned– 2 points

Minimal media – 6 points
Volume of stock to each well – 1 point
The matrix format written or in a table (recommended in a table)– 2 points
Repeated the plate 3 times - 1 point
The volumes of culture/base medium to each well– 2 points

Temperature – 6 points
Type of media (Artificial Seawater) used – 2 points
Volume of media/volume of culture inoculated – 2 points
Incubation conditions (temperatures)– 2 points

Results – 20 Points

*Note: All figures must have the appropriate figure captions. The captions provide your reader with the information
needed to interpret the figure. Think of it like a map legend.

● Temperature Growth Curve with growth rates on plot and thorough, appropriate figure caption – 4 points

● Section for Minimal Media Results: no tables necessary since this did not work. Just explain why all your
wells were negative in terms of cell density, provide your results from the experiment, and give the results
234
of your controls. Remember, you are stating and explaining how you got your results in this section and
will be interpreting them in the discussion. – 8 points

● Section for Temperature Results: Give the results of the temperature experiment. Provide the equations for
how you calculated the growth rates. What did we find? What are the growth rates? What are the cell
concentrations at the beginning and end of the experiment? Reference your figure(s) from R in this section.
Remember, you are stating and explaining how you got your results in this section and will be interpreting
them in the discussion. – 8 points

Discussion - 20 Points

Here is where you will interpret your data and address trends that you notice. I am not looking for a specific
answer, but I want you to form conclusions based on the data and to explain why you believe this to be true. You
should use this discussion section to tie the results from our experiments into the bigger picture. How do the results
from the temperature experiment connect to the ocean environment? What do these results mean in the context of
ecology? How does this relate to other Roseobacters? How do the results connect to biogeochemistry? Basically,
you should be connecting your temperature results back to the primary literature sources to make sense of the trends
that we see.
For our minimal media data, we cannot draw conclusions about the organism because there was an
experimental failure, but we can discuss things like: Why did this not work? What were some likely causes of the
organism not growing? What would we do differently next time? What is happening with the controls? Why are the
controls important in this case? ETC.

Future Directions – 10 points

If you could continue, what experiments would you like to do? What direction would you take this research?

References – 10 points
● APA format
● Listed in alphabetical order
● All information that is taken from a primary literature source is cited

235
Minimal Media Experiment:
Checklist for each day of the minimal media experiment:
o Artificial Seawater (~18 mL, ~1.5mL to each well, 6 wells per plate), verify that organisms will
actually grow in it before using
o Base Media (no nutrients) (~10 mL [account for a little extra], 1.5mL to each well, 3 wells per plate)
o 2 x 96 deep well u-bottom plates
o 2 x autoclaved plate lids wrapped in foil
o mL pipette and mL tips
o 20 uL pipette and tips
o 0.2-2 uL pipette and tips
o The culture (take a count of the seed culture before using it to make sure that it is healthy)
o PCR hood wheeled over to the undergraduate teaching lab (get someone to help you with this. It is
very heavy. I used a cart and slid it off the bench onto the cart, but it is very difficult to do alone.)
o Falcon tubes of prepared nutrient stocks for each class, check if allowed to store in the classroom
fridge.
o Remind students to bring their goggles, lab coat, and to wear long pants to lab

1) Make sure that you are checking the positive control as the experiment proceeds. After the 2 weeks have
passed for the first plate incubation, make sure that you see growth in the artificial seawater positive
control. If there is no growth (verify what growth should look like based on the growth rate of the organism
being used), the experiment should be started again with new media.
2) I suggest running this plate on the flow cytometer when someone will be around to watch it. It takes a long
time to run, but the instructor should make sure that someone will be there to ensure that it does not stop in
the middle of the run since it is a big plate.
3) Pipette ~1.5 mL of Base media to each necessary well (see plate matrix) BEFORE the beginning of the lab.
The students won’t have time to do this. Verify that this is an appropriate dilution for your given cell count.
4) Make sure your lecture is no longer than ~20-30 minutes. Otherwise, the students won’t have time to add
all the nutrient stocks and culture. Do a demonstration for them first on how to use the pipette, how to be
sterile in the hood, etc.
5) For the nutrient stocks, use tape on the lid of the falcon tube for the students to write on. This will make the
process of them gathering their assigned nutrients much easier on minimal media days.
6) Make sure to thoroughly explain what the controls are on the first day of the experiment.
7) You have one positive control, which is the artificial seawater inoculated with the culture to make sure that
culture is fine. The first negative control is the Base media with no nutrients added and the culture. The
second negative control is the artificial seawater with no culture added.
8) Use a tray (maybe an autoclave tray if available) to carry everything over
9) Assign students to the plate matrix prior to class
10) Change the order of students each week so that the same students are not going last for every minimal
media plate transfer.

Temperature Experiment:
Checklist on what to bring to lab:
o Culture (take a count before to make sure it is healthy)
o Small Erlenmeyer flasks filled with 50mL of sterile artificial seawater before the start of lab, use a tray
to carry them to the classroom
o 20 uL pipette and tips (for culture, calculate what cell concentration to dilute to)

1) Make sure that once the students inoculate the flasks, that the flasks remain upright and don’t fall over.
This can be difficult since there are so many. You will need a tray to carry them back to the Thrash lab.
2) Remind the students of the sterile and aseptic technique that they have learned
236
3) Explain the process of the experiment to the students since they don’t see what happens behind the scenes:
incubating for _____ days at ___ number of temperatures, replicates at each temperature, taking daily
counts on the flow cytometer, etc.
4) Check the daily counts for contamination/expected growth

Morphology and Microbial Characterization Lab (Made by Catie Cleveland, contact csclevel@usc.edu if you
have any questions):
Note: Organisms can be switched out depending on what is available to the instructor. The main goal of this
lab activity is to get the students to observe and think about microbial morphology

Checklist:
o Diatoms (Pseudo-nitzchia or other types)
o Dinoflagellates (Alexandrium)
o Croccosphaera species
o Trichodesmium erythraeum and thiebautii
o Bucket of ice to keep diatoms and dinoflagellates semi-cool
o Pasteur pipettes for each station
o Tube racks for the cultures in tubes
o Microscope slides (also need a few depression slides for the motile organisms)
o Cover slips
o Microscopes for each organism at stations (cabinet under benches)
o Morphology guide (post or print for students)

1) Have students follow the Morphology guide instructions
2) Let them work in groups of 2 to walk around to the labeled stations (station A, B, etc.) and identify the
organisms
3) Some can work on identification while some can work on the web search assignment portion
4) Each group needs to make their own slides
5) Help them spot the motile Dinoflagellates, they are fast! Dinoflagellates may concentrate at the bottom of
the bottle, so shake them up every now and then for the students.
6) Highlight the importance of morphology and microbial characterization. I drew a diagram on the board
with different types of morphology based on their guide, and asked them “What are some different cell
shapes? What are some colony shapes?” Etc.
7) Help them with using the microscopes.
8) Make sure the students know which organisms are bacteria and which are not.

237
Chapter 3 Appendix 28: Example Student Results

238

239
Example student carbon plate results for LSUCC0117.

Carbon Source Plate 1 Plate 2 Plate 3
Threonine NA + +
Tyrosine NA + +
Valine NA + -
Arginine - + +
Cysteine - - -
Histidine - - -
Isoleucine - - -
Leucine* + + +
Lysine* + + +
Methionine* + + +
Phenylalanine + - -
LSUCC0117 + ASM + + NA
LSUCC0117 + ASM + + NA
LSUCC0117 + ASM + + NA
LSUCC0117 + ASM + + NA
Glutamine + - -
Dextrose - - -
Ribose - - -
Pyruvate - - -
Citrate - - -
Glutamate* + + +
Acetate - - -
Succinate* + + +
a-ketoglutaric acid + + -
Urea + - -
Glycine - - -
Choline chloride salt - - -
Cyanate potassium salt - - +
Sucrose * + + +
240
Fructose + + -
Glucose + + -
Ornithine + + -
Serine* + + +
Folic Acid* + + +
L-Tryptophan - - -
LSUCC0117 + ASM-C + + -
LSUCC0117 + ASM-C + + -
LSUCC0117 + ASM-C* + + +
LSUCC0117 + ASM-C - + -
ASM-C - - -
ASM-C - - -
ASM-C - - -
ASM-C - - -
LSUCC0117 + ASM - + NA
LSUCC0117 + ASM - + NA
LSUCC0117 + ASM + + NA
LSUCC0117 + ASM + + NA
*Indicates sources that were positive for all three transfers. ASM is an abbreviation for Artificial Seawater Medium.

241
Chapter 3 Appendix 29: Example informal essay submissions

Student #1 Essay #1-“I am an animal science, pre-vet major. My goal is to eventually earn my DVM and a
PhD in either small animal soft tissue surgeries or exotics. I am very interested in research, particularly in studies
that better our understanding of animals…I haven’t heard much about CURE labs other than the fact that they are a
great way to get your feet wet in undergraduate research. My only worry for this course is that I won’t be able to
keep up. However, I know I will try my best to be as successful as possible. I am very excited to be a part of a real
research lab making new discoveries instead of doing “cookie cutter” labs and getting the same results as thousands
of students before me. I hope to obtain a better understanding of how research is conducted in real life as well as
establish connections that I can use one day whether it be for undergraduate research or for my honors college
thesis. I think that research experience applies to my goals because it will teach me to look at things from a scientific
standpoint. Having a better understanding of how scientific research works may allow me to conduct my own
research as a veterinarian.”
Student #1 Essay #2-“Overall, I fell that this class greatly enhanced my understanding of the scientific
world and how research is conducted. Although it was somewhat more difficult, I feel that this class was a better
opportunity than its regular lab counterpart. It was far more interesting to observe and record data that had not been
found before as opposed to doing a lab done by thousands of bored students before me. I enjoyed learning lab
techniques like the culture transfers as well as how to build presentations for the class. It was very interesting and
challenge to go in depth in such a niche area of research, and I feel that it better prepared me for both future lab
classes and any research I may do in the future. I struggled with the communication aspect, particularly presenting,
but I feel that I improved my public speaking abilities and built more confidence than I had before.”

Student #2 Essay #1- “I am currently majoring in Human Movement Science with a concentration in
Kinesiology Pre-med. As of now, I plan to minor in Biology as I hope to continue my education by attending
medical school. After medical school, my goal is to finish as a pediatric anesthesiologist. During my years at [high
school], my science classes were always based on the simple science experiments. I never had the chance to learn
about real research. When I think about the term “research,” the first thing that comes to mind is a lab rat spinning
on a wheel and a scientist with big, frizzy hair. As I was receiving emails about my classes before school started, I
learned that my … class was a “CURE” lab, and I never heard of “CURE” before. I am very excited to be a part of
current research that nobody has ever done before, which also makes me nervous at the same time. I have never
done lab research, so jumping straight into a current research project scares me because it may be a lot of hard work
for me to handle for my first time. After I attended my first lab, my nerves were gone. I learned that it is okay to
mess up because there is no certain outcome that should happen with current research. Once this semester is
finished, I hope to expand my excitement about research, and obtain a student job…for my undergraduate research
project. I am very confident that the research hours I will have under my belt going into medical school will help me
push through and finish with a high amplitude of experience as I earn my Doctorate.”
Student #2 Essay #2- “I was very intimidated about CURE research. Now that I am going into the last
week of this class, I am very honored to have been able to work with it. I have many friends who are enrolled in [the
regular section], and all they do is write charts down and work with results that have already been found. Knowing
that I could’ve been stuck with working in those labs makes me even more happy that I was a part of the CURE lab.
Working with a new bacterium was a great experience. I definitely believe that this CURE lab has prepared me for
all types of research that will come up for my future lab classes. Not only did I learn how to conduct the experiments
in the lab, I was able to learn how to create a well-organized and professional poster along with a lab report. I
learned the rights and wrongs of presenting in front of people and received feedback of my presentation by being
videoed. I would recommend to any biology student to take a CURE lab at least once. It has prepared me for the
future and developed my knowledge and skills in ongoing research. After completing every experiment and
characterizing LSUCC0135, I truly feel like a researcher, and I have been a part in helping define such a cool
bacterium that is very close to my home. I would love to thank CURE for giving me this great opportunity!”

242
Chapter 3 Appendix 30: Example student poster

Abstract (if available)

Abstract Heterotrophic bacteria in global oceans are central components of the microbial loop, playing important roles in the cycling of dissolved and particulate organic matter. To understand the way in which these heterotrophs interact with global biogeochemical cycles, we must study how individual lineages are distributed and characterize their different metabolic capacities. Critically, the vast majority of known genera, including some of the most abundant taxa in global oceans, have no cultivated representatives. Though cultivation-independent studies such as the variety of multi-‘omics techniques have provided a wealth of information about the predicted metabolism of uncultured taxa, these approaches are limited in their ability to validate hypotheses about microbial physiology and interactions compared with cultivation-based experimentation. Thus, the combination of cultivation-independent and cultivation-dependent study is optimal to understand the interplay of ecological distribution, metabolism, and physiological responses to dynamic environments for marine microorganisms. This dissertation combines cultivation-independent and cultivation-dependent methods to investigate two poorly understood but abundant groups, the SAR11 subclade IIIa and the Roseobacter lineage CHAB-I-5, leveraging new cultures. This work provides the first physiological data from these organisms to quantify oceanographically-relevant factors such as growth responses to salinity and temperature changes, cell size and volume estimates, and growth dependence on key carbon and nitrogen compounds. Using new isolates, complete, circularized genomes, and publicly available data, this dissertation has also generated the most comprehensive ecological and genomic analysis to date for both groups. Furthermore, it provides a framework to integrate undergraduate research experiences into a classroom setting so that they can gain valuable research experience in microbial ecology and physiology.

Linked assets

University of Southern California Dissertations and Theses

Conceptually similar

PDF

Identifying functional metabolic guilds: a computational approach to classifying heterotrophic diversity in the marine system

PDF

Thermodynamics-guided cultivation of microorganisms involved in novel and understudied sulfur catabolic reactions

PDF

Microbial ecology in the deep terrestrial biosphere: a geochemical, metagenomic and culture-based approach

PDF

Microbial metabolism in deep subsurface sediments of Guaymas Basin (Gulf of California): methanogenesis, methylotrophy, and asgardarchaeota

PDF

Enhancing recovery of understudied and uncultured lineages from metagenomes

PDF

Microbial metabolism in the deep subsurface: potential energy sources in subglacial and terrestrial environments

PDF

Genetic characterization of microbial eukaryotic diversity and metabolic potential

PDF

Unexplored microbial communities in marine sediment porewater

PDF

Spatial and temporal dynamics of marine microbial communities and their diazotrophs in the Southern California Bight

PDF

Patterns of molecular microbial activity across time and biomes

PDF

Changes in the community composition of marine microbial eukaryotes across multiple temporal scales of measurement

PDF

Microbe to microbe: monthly microbial community dynamics and interactions at the San Pedro Ocean Time-series

PDF

The impact of the concentration and distribution of dissolved and particulate B-vitamins and their congeners on marine microbial ecology

PDF

Disentangling the ecology of bacterial communities in cnidarian holobionts

PDF

Temporal variability of marine archaea across the water column at SPOT

PDF

Molecular ecology of marine cyanobacteria: microbial assemblages as units of natural selection

PDF

Geomicrobiology in the shallow-sea hydrothermal system at Milos Island, Greece

PDF

The molecular adaptation of Trichodesmium to long-term CO₂-selection under multiple nutrient limitation regimes

PDF

Marine protistan diversity, spatiotemporal dynamics, and physiological responses to environmental cues

PDF

Iron-dependent response mechanisms of the nitrogen-fixing cyanobacterium Crocosphaera to climate change

Asset Metadata

Creator Lanclos, V. Celeste (author)

Core Title Ecophysiology of important understudied bacterioplankton through an integrated research and education approach

School College of Letters, Arts and Sciences

Degree Doctor of Philosophy

Degree Program Biology (Marine Biology and Biological Oceanography)

Degree Conferral Date 2023-08

Publication Date 07/06/2024

Defense Date 07/06/2023

Publisher University of Southern California (original), University of Southern California. Libraries (digital)

Tag CHAB-I-5,Cure,ecophysiology,microbial ecology,OAI-PMH Harvest,SAR11

Format theses (aat)

Language English

Contributor Electronically uploaded by the author (provenance)

Advisor Thrash, J. Cameron (committee chair), Amend, Jan (committee member), LaRowe, Douglas (committee member), Webb, Eric (committee member)

Creator Email lanclos@usc.edu,lanclosvc@gmail.com

Permanent Link (DOI) https://doi.org/10.25549/usctheses-oUC113262963

Unique identifier UC113262963

Identifier etd-LanclosVCe-12037.pdf (filename)

Legacy Identifier etd-LanclosVCe-12037

Document Type Dissertation

Format theses (aat)

Rights Lanclos, V. Celeste

Internet Media Type application/pdf

Type texts

Source 20230710-usctheses-batch-1063 (batch), University of Southern California (contributing entity), University of Southern California Dissertations and Theses (collection)

Access Conditions The author retains rights to his/her dissertation, thesis or other graduate work according to U.S. copyright law. Electronic access is being provided by the USC Libraries in agreement with the author, as the original true and official version of the work, but does not grant the reader permission to use the work if the desired use is covered by copyright. It is the author, as rights holder, who must provide use permission if such use is covered by copyright.

Repository Name University of Southern California Digital Library

Repository Location USC Digital Library, University of Southern California, University Park Campus MC 2810, 3434 South Grand Avenue, 2nd Floor, Los Angeles, California 90089-2810, USA

Repository Email cisadmin@lib.usc.edu