University of Southern California Dissertations and Theses

Elastin like polypeptide tagged angiotensin (1-7) is a potential effective treatment for retinitis pigmentosa

(USC Thesis Other)

Elastin like polypeptide tagged angiotensin (1-7) is a potential effective treatment for retinitis pigmentosa

PDF

Download a page range

Download transcript

Copy asset link

Request this asset

Transcript (if available)

Content

Elastin like polypeptide tagged Angiotensin (1-7) is a potential effective
treatment for Retinitis Pigmentosa
by
Aditya Anil Naik

A Thesis Presented to the
FACULTY OF THE USC GRADUATE SCHOOL
UNIVERSITY OF SOUTHERN CALIFORNIA
In Partial Fulfillment of the
Requirements for the Degree
MASTER OF SCIENCE
(PHARMACEUTICAL SCIENCE)
August 2023
ii

Acknowledgements

I am sincerely grateful to my advisor, Dr. Stan Louie, for his unwavering support and guidance
throughout my master’s program. His expertise and patience have been priceless, playing a crucial
role in the success of this thesis.

I extend my gratitude to Dr. Andrew Mackay for giving me the opportunity to conduct my research
and for providing abundant resources and support.

Special thanks go to the members of the Louie lab, particularly Dr. Kabir Ahluwalia, Priyal Dave,
Prem Veera, Angela Lu, Dr. Rita Li, and Mackay lab member Shin Jae Lee, who went above and
beyond to assist me with my work.

I would also like to express my appreciation to Dr. Ian Haworth for serving on my thesis committee
and offering valuable feedback and suggestions. His insights and guidance were instrumental in
shaping my research and completing this thesis.

Finally, I am grateful to my parents for their unwavering emotional and financial support, believing
in me and my aspirations.

iii
Table of Contents:

Acknowledgements .......................................................................................................................... ii
List of Figures: ................................................................................................................................. vi
Abstract ............................................................................................................................................ viii
Chapter 1: Introduction to anatomy of the eye and retinal degenerative diseases ........................... 1
1.1. In vivo Animal Model of RP ..................................................................................................... 2
1.2 Anatomy of eye and Pathophysiology of Retinitis Pigmentosa ................................................. 3
1.2.1 Anatomy of eye ................................................................................................................... 3
1.2.1.1. Constituent of the Ocular Tears ................................................................................... 6
1.2.1.2. Retinal anatomy and Function ..................................................................................... 7
1.2.2 Retinitis Pigmentosa: ........................................................................................................... 7
1.2.3. Pathogenesis of Retinitis Pigmentosa: ................................................................................ 9
1.2.3.1. Molecular mechanism of Pathogenesis: ....................................................................... 10
1.2.3.2. Role of Retinal Reactive Oxygen Species ................................................................... 10
1.2.3.3. Apoptosis induced by ROS in Degenerative Disease: ................................................. 14
1.2.3.3. Effects of ROS: ............................................................................................................ 15
1.2.3.4. Overview of Inflammation: .......................................................................................... 16
1.3. In vivo Animal Model of RP ................................................................................................. 17
1.3.1. Increase in the MasR expression in relation to photoreceptor degeneration in RCS. ........ 20
1.3.2. Angiotensin/Mas in Retinitis Pigmentosa .......................................................................... 22
Shifting the balance of .................................................................................................................. 23
1.4. Elastin like polypeptide (ELP)-Angiotensin (1-7) as a long-acting Mas receptor
agonist. .......................................................................................................................................... 24
1.4.1. Characteristics of ELP peptides .......................................................................................... 24
Chapter 2: Development of ELP V192 Angiotensin (1-7) construct and validation ....................... 26
2.1. Development of ELP (V192-Angiontensin (1-7)) ................................................................. 26
2.2. Design of the ELP V192 Angiotensin (1-7) construct .......................................................... 28
2.2.1 Recursive directional ligation: ............................................................................................. 28

iv
2.2.2 Direct Ligation or Concatemerization ................................................................................. 31
2.3. Analysis of ELP Construct: ................................................................................................... 32
2.3.1 Sanger’s Sequencing: .......................................................................................................... 32
2.3.2 SDS PAGE Analysis of isolated protein: ............................................................................ 33
2.3.3 UV spectroscopy analysis in determining transitioning temperature: ................................. 34
2.3.4 MALDI: ............................................................................................................................... 35
2.3.5 Complications in development of V192-Angiontensin (1-7): ............................................. 36
2.4. Materials and Methods .......................................................................................................... 37
2.4.1. Isolation of DNA from Plasmid: ........................................................................................ 37
2.4.2. Transformation of E. coli cells ........................................................................................... 38
2.4.3. Gel Electrophoresis and Isolation of sequences for Recursive directional ligation ........... 39
2.4.4. Isolation & growth of the BLR cells transformed with V192-Angiotensin (1-7)
modified plasmid: ......................................................................................................................... 39
2.4.5. Sonication of the Cell lysate ............................................................................................... 40
2.4.6. Isolation of ELP from the cell lysate .................................................................................. 40
2.4.7. SDS PAGE gel analysis ...................................................................................................... 41
2.4.8. MALDI ............................................................................................................................... 42
2.4.9. UV Spectroscopy ................................................................................................................ 43
2.4.10. Molar extinction Coefficient & Protein concentration ..................................................... 43
2.4.11 DNA digestion ................................................................................................................... 44
2.4.12 DNA ligation ..................................................................................................................... 44
2.5. Advantages of ELP-conjugates ............................................................................................. 45
2.6. Escherichia coli in plasmid transformation and peptide production ..................................... 45
2.6.1. Potential problem of E. coli as production cell .................................................................. 45
2.6.2. Elimination of E. coli LPS ........................................................................................... 46
2.7. Result ..................................................................................................................................... 47
Chapter 3: In vitro validation of the construct ................................................................................. 49
3.1. CHO-K1 and Mas overexpressing CHO-K1 cells ................................................................. 49
3.1.1 Construction of the CHO-K1 cells vector ........................................................................... 50
3.1.2 Method of isolating the Mas-CHO-K1 ................................................................................ 51
3.1.2.1. Geneticin based selection. ............................................................................................ 51
3.1.2.2. FACS sorting ............................................................................................................... 52
3.1.3 Characterization of the Mas-CHO-K1: ELP-Ang (1-7) in comparisons with Ang (1-
7), NLE and Ang (1-7) ................................................................................................................. 53

v
3.1.3.1 Western blot .................................................................................................................. 53
3.2. Materials and Methods .......................................................................................................... 54
3.2.1. FACS: ................................................................................................................................. 54
3.2.2. Western blot: ....................................................................................................................... 55
3.3. Result: .................................................................................................................................... 56
Chapter 4: In vitro validation of Construct of THP-1 ...................................................................... 58
4.1 Role of THP-1 in immune response ....................................................................................... 58
4.2 Expression of Mas receptors and Activation of Mas receptors using Mas receptor
agonist on THP-1 cells ................................................................................................................. 60
4.2.1 Reverse transcriptase- Polymerase chain reaction ............................................................... 61
4.2.2 Flow Cytometry: .................................................................................................................. 64
4.3. Materials and Methods .......................................................................................................... 66
4.3.1. RT-PCR .............................................................................................................................. 66
4.3.1. Flow cytometry: .................................................................................................................. 67
4.4. Result: .................................................................................................................................... 68
Discussion ........................................................................................................................................ 70
Future Prospects ............................................................................................................................... 75
References: ....................................................................................................................................... 76

vi
List of Figures:

1. Figure 2.1. V192-Angiontensin (1-7) sequence in mpET 25b+ plasmid ........................... 27
2. Figure 2. 2. 1. Empty modified plasmid (mpET) digested with the endonucleases
BseR1 and Ecor1 and ligated with Angiotensin (1-7) peptide sequence forming
Angiotensin (1-7) sequence on mpET. Gene sequence map and agarose gel simulation
is generated using Snapgene. ............................................................................................. 28
3. Figure 2. 2. 2. Ang (1-7) on mpET is digested with the endonucleases BserRI and
BssHII to isolate the Ang (1-7) fragment using Gel electrophoresis. Gene sequence
map and agarose gel simulation is generated using Snapgene. ......................................... 29
4. Figure 2. 2. 3. V192 on mpET is digested using the endonucleases AcuI and BssHII to
isolate the V192 fragment on the plasmid. Gene sequence map and agarose gel
simulation is generated using Snapgene. ............................................................................ 29
5. Figure 2. 2. 4. The DNA is isolated using Miniprep kit by Qiagen and the DNA is
digested with BamH1 and NdeI to confirm the ligation of V192 & Ang (1-7) sequence.
Gene sequence map and agarose gel simulation is generated using Snapgene .................. 30
6. Figure 2. 2. 5. culmination of all the three steps in the process described above
involved information of V192 conjugated Angiotensin (1-7) peptide. Gene sequence
map is generated using Snapgene. ..................................................................................... 30
7. Figure 2. 2. 6. Concatemerization method for development V192-Angiotensin (1-7)
using Direct Ligation method. In the above figure 2.2.6, Even though there seems to
be presence of colonies, none of them tested positive for V192-Angiotensin (1-7). ......... 32
8. Figure 2. 3. 1. Sanger’s Sequencing of V192-Angiotensin (1-7) peptide sequence
............................................................................................................................................ 33
9. Figure 2. 3. 2. SDS-PAGE analysis of V192-Angiotensin (1-7) peptide. ......................... 34
10. Figure 2. 3. 3. The transition temperature gradation of V192- Ang (1-7) ELP predicted
using UV/Vis spectroscopy. ............................................................................................... 35
11. Figure 2. 3. 4. MALDI analysis of V180 conjugated peptide .......................................... 36
12. Figure 2. 3. 5. Comparison of unconjugated V192, conjugated V192-Angiontensin (1-
7) and conjugated V180 -Angiotensin (1-7) using SDS PAGE. ....................................... 37
13. Figure 3. 1. 1. Plasmid Encoding for Cytomegalovirus(CMV) as a promoter, EGFP
(Green Fluorescent Protein) and Mas Receptor (Mas1) transduced in CHO-K1 cells
............................................................................................................................................ 51
14. Figure 3. 1. 2. Estimating the concentration of Geneticin in effectively increasing the
concentration of Mas overexpressing CHO-K1 cells ........................................................ 52
15. Figure 3. 1. 3. FACS analysis of Mas overexpressing CHO-K1 cell and Confocal
microscope visualization of FACS sorted Mas overexpressing CHO-K1 cell .................. 53
16. Figure 3. 1. 4. Quantification of western blot Western Blot analysis of phosphorylation
eNOS on treating Mas overexpressing CHO-K1 cells with increasing concentration of
Mas receptor agonist and 5µM of A779. Analyzed using Image J. .................................. 54
17. Figure 4. 1. 1. The time course THP-1 PMA stimulation/Differentiation. The cells start
adhering over 72hours (about 3 days) time. ...................................................................... 60
18. Figure 4. 2. 1. RT-PCR data for Elastin like polypeptide on 6hours LPS stimulated
THP-1 (M0) macrophages for AKT and PTEN ................................................................. 62
19. Figure 4. 2. 2. Comparative RT-PCR data for Elastin like polypeptide and NorLeu on
6 hours LPS stimulated THP-1 (M0) macrophages for TNF-a ......................................... 62

vii
20. Figure 4. 2. 3. RT-PCR data for Elastin like polypeptide on 6 hours LPS stimulated
THP-1 (M0) macrophages for TGF-b and IL-1 ................................................................. 63
21. Figure 4. 2. 4.. RT-PCR data for Elastin like polypeptide on 6hours LPS stimulated
THP-1 (M0) macrophages for Mas receptor ...................................................................... 63
22. Figure 4. 2. 5. Gating strategy for isolation of Macrophages from the population ........... 65
23. Figure 4. 2. 6. Flow Cytometry analysis of dTHP-1 cells treated with ELP-Ang (1-7)
with LPS for 30mins .......................................................................................................... 66

viii
Abstract
Retinitis pigmentosa (RP) is a genetic linked retinal disease estimated to affect between 20-25 million
people worldwide. Currently, more than 60 distinct genes have been associated with RP. Despite
genetic variance, a common molecular underpinning of RP-related mutations is the presence of
oxidative stress and chronic inflammation. In Royal College of Surgeon’s (RCS) rats, retinal
degeneration corresponds increase Mas retinal expression, a component of the “Protective Arm” of
the renin angiotensin system (RAS). Angiotensin (1-7) (Ang (1-7)), is the natural ligand for Mas that
is able to promote nitric oxide synthase and superoxide dismutase (SOD) expression.
To exploit the increased in Mas expression, we developed an Elastin-like polypeptides (ELPs)-Ang
(1-7) conjugate, derived from human tropoelastin. ELP can phase separate into a depot at
physiological temperatures; furthermore, increases the intravitreal mean residence time by an order
of magnitude as compared to a free. Using recombinant technology and recursive directional ligation,
the protein sequence MG(VPGVG)192 was conjugated onto Ang(1-7) allowing for free carboxyl
terminus while retaining temperature-dependent phase separation after fusion. This fusion protein
was expressed at 50 mg/ L in bacterial culture that produced a single band at the expected MW (79899
Da). The biological activity of the modified ELP-Ang(1-7) was validated using Mas-CHO-K1 and
differentiated THP-1 (dTHP-1) monocytic leukemia cell lines to determine the relative
phosphorylation of downstream substrates such Akt, PTEN and down-regulation of TNF-a and
compared with Ang (1-7) and NorLeu3Ang (1-7). This approach is able to prolong release of Ang
(1-7) over a period of a month
1

Chapter 1: Introduction to anatomy of the eye and retinal degenerative
diseases

Retinitis pigmentosa (RP) is an inherited retinal disease where initial clinical presentation
may include night blindness and a decreased visual field. Progressive RP can lead to tunnel vision,
central visual acuity (VA) loss and ultimately blindness (1). Over 200 mutations across more than
60 distinct genes have been linked to the molecular pathogenesis of RP. (1). Despite these genetic
differences, there is a common molecular underpinning leaving to the loss of photoreceptors (PRs),
the sustained presence of persistent chronic inflammation. PR death is thought to be caused by
cellular debris accumulation which can activate and sustain persistent retinal inflammation (2-4)
Despite our advanced understanding of RP pathogenesis, only one gene therapy for a small
subset of RP (RPE65 for Leber’s congenital amaurosis) has been approved. Unfortunately, the
durability of this treatment is very short. Given the diversity of mutations found associated with
RP, corrective gene therapy approaches will require a myriad of specific gene strategies and
complementary delivery systems. These types of approaches may be cost-prohibitive to address
all the specific types of RP. Other drawbacks associated with gene therapy include the lack of
protein expression durability, where the host can produce inhibitors directed against the gene
products thus limiting sustainable efficacy (5-6). Alternative approaches, including retinal
progenitor cells and/or stem cell implantation, have also shown promising outcomes (7).
Unfortunately, these approaches do not address the root cause of Retinitis Pigmentosa. Newer
developments include oral N-acetylcysteine, which showed improved and corrected visual acuity
(VA) but has been associated with gastrointestinal intolerance (7).
Emerging data has suggested that RP patients have ocular inflammation where
inflammatory cytokine levels such as as IL-1b, IL-2, IL-4, IL-6, IL-8, GRO-a, and IFN-g induced

2
protein (CXCL-10) have correlated with the degree of cellular infiltration in the anterior vitreous
cavity (3,4). Moreover, vitreous cytokine levels were 6-fold higher in RP patients correlating with
cellular infiltration in the outer nuclear layer (ONL) and correspondingly affecting visual acuity
(VA) (2-4). Most recently, serum IL-8, a neutrophil chemokine, was found to inversely correlate
with disease severity in a study involving 54 RP patients (8). Despite the eyes are immune
privilege organs, cellular infiltration and microglial activation is observed in RP (46).
Additionally, these clinical findings in RP patients have been confirmed by new molecular
findings, where dysregulation of the innate immunity, in particular neutrophils, is an important
component in retinal diseases. Neutrophils have been found to be adhering onto the senescent
vascular endothelial cells promoting sterile inflammation found in both animals and patients with
retinal diseases (e.g., proliferative diabetic retinopathy [PDR], retinopathy of prematurity [ROP],
dry AMD) (9, 10). These discoveries show elevated levels of reactive microgliosis and innate
immune activation similar to what is seen in RP (11,12). These findings also suggest the presence
of damaged associated molecular patterns (DAMPs), that play an important role in the
pathogenesis and progression of RP.
1.1. In vivo Animal Model of RP

Royal College of Surgeon’s (RCS) rats have a MerTK mutation which affects that retinal
pigmented epithelial (RPE) cells’ ability to remove cellular debris and transport it across the retinal
barrier for elimination. In this model of retinitis pigmentosa (RP), the degeneration of
photoreceptors begins on post-natal day 21 (p21). By the time p60 is reached, near complete
degeneration of the outer nuclear layer (ONL), leading to a significant reduction in the total number
of photoreceptor nuclei.

3
Neutrophils normally have a limited lifespan of approximately 24 hours, but in the presence
of inflammatory cytokines their lifespan and associate inflammation can increase several-folds
(13). Tissue sequestered neutrophils can trigger NADPH oxidase (NOX) expression thus
increasing generation of reactive oxygen species (ROS), which in turn activates neutrophil elastase
(NE) translocation into the nucleus and promotes chromatin decondensation. ROS can activate
Mek/Erk phosphorylation which can evoke chromatin disassembly and expulsion of DNA, a
process referred to as neutrophil extracellular traps (NETosis) (14). Other hallmarks of NETosis
include increased peptidyl arginine deiminase-4 (PAD-4) expression mediating histone
citrullination which can also promote chromatin decondensation. These extracellular DNA-webs
are laced with myeloperoxidase (MPO) and NE capable of sustaining inflammation (14).
Both clinical and molecular dissection finding indicate the involvement of innate immunity
in RP, where increase in IL-8 promote the recruitment of neutrophils to the affected area. (3,4,8).
However, the role of neutrophils remains a subject of controversy, primarily due to the absence of
infiltrating cells in the retina. This was recently addressed where neutrophils localized in the retinal
perivascular space in disease animal models and was confirmed in patients with proliferative
diabetic retinopathy (PDR) and AMD (8,9).
1.2 Anatomy of eye and Pathophysiology of Retinitis Pigmentosa

1.2.1 Anatomy of eye

The eye is a fluid filled organ responsible for vision and the transduction of light energy
into chemical signals to improve visual sensory. To accomplish visual sensing abilities, the eye
must transform light, color and depth into an image that allows the brain to process. This means

4
that light must traverse across the cornea and is focused by the lens and images detected in the
retinal cells.
The lens separates the aqueous humor found in the front of the eye from the retina region.
In the retinal, light-sensitive cells are located along the back of the eye. There are specific retina
cells transducing light into neuronal signals which in the form of biochemical or ionic signals.
Light signals are transduced by photoreceptor (PR) cells found in the back of the retina.
Photoreceptors are further subclassified as either rods or cones. These PR cells can detect light
photons and convert them into neural impulses. These signals are transmitted by the optic nerve,
from the retina to central ganglia in the brain. Further, these signals in the lateral geniculate nucleus
then transmit the information to the visual cortex. Signals from the retina also travel directly from
the retina to the superior colliculus.
The eye is often divided into three segments, which are often referred to as outer, middle
and the inner segment of the eye. The outer segment consists of sclera and cornea. These cells are
thought to be derived from the para-ocular mesenchymal tissue (8). Sclera is the white opaque
fibrous shell mainly formed by type I collagen covering the ocular globe. In contrast, the cornea
is a continuous transparent curved layer that allows the light to enter that is further focused by the
lens and onto the macula. The cornea also serves as a structural barrier protecting the eye from
external foreign from penetrating the eye while allowing light to travel across all the layers of the
eye.
The corneal also protects the eye from environmental insults that may reduce visual acuity
(VA) and even lead to blindness. To achieve this, the corneal cells form a cellular barrier with a
refractive index of 1.376. This allows light to pass and focus through the ocular lens prior to
activating retinal cells. In addition to its protective properties, the cornea can also minimize light

5
scattering and is capable of focusing the image, which is achieved through its convex
conformation. To protect the visual barrier, the cornea is protected by tear film that is spread across
the entire corneal layer. In addition to their protective nature , ocular tears also contain lipids and
nutrients that not only lubricate the epithelial layer but also provide required nutrients to sustain
cellular proliferation.
A clear transparent structure, the cornea is made up of five separate cellular layers that is
classified as epithelium, fibrous Bowman’s Layer, stroma, central layer and the Descemet’s
membrane present on the posterior endothelial cell lining. Embryologically, the epithelial layer is
developed from the epidermal ectoderm followed by migration of cells of neural crest in between
the lens and the epithelial. Filled with water and collagen, the thickest layer, stroma, and
Descemet’s Membrane contributes to the structural integrity in maintaining the anterior curvature
of cornea owning to its thickness due to presence of collagen fibers and can regenerate in case of
a trauma. The transparency of this tissue is maintained by absence of blood vessels. Nutrients are
diffused through tear film covering the outermost layer.
The epithelium is comprised of three types of non-keratinized stratified squamous cells
namely, superficial cells, wing, and basal cells. The tight junction in between the epithelial cells
protects the inner layers of the eye from tear fluid infiltration. Desmosomes and Adheren’s
Junction present laterally helps with the intracellular adhesion. The cellular gap junction permits
small molecules permeation. In addition to this, Made of Type VII collagen anchoring fibrils are
found to be passing through the basement membrane forming anchoring plaques formed by Type
I collagen below the membrane. As described earlier the stroma is comprised of Collagen type IV
arranged in regular pattern giving it a transparency for passage of light. Primarily consists of non-
aqueous constituents like collagens, Proteoglycans, and cells, including Lamellae which may play

6
role in maintaining the structural integrity of the corneal and sclera. Proteoglycans serve as the
matrix gel by maintaining the transparency of the stroma by regulating the water content in the
layer. The innermost layer of the cornea, Descemet’s Membrane, a regenerative membrane made
from Type IV collagen serves as modified basement membrane for the endothelial layer. The
posterior most layer of the cornea, the endothelial lining the Descemet’s membrane, functions in
clarifying the stroma and reduce the swelling by a pumping action to maintain the fluid balance.
Each layer contributes to delivering a unified image in the eye. Any trauma and injury in these
layers may disrupt the light rays and vision. (1)(2)

1.2.1.1. Constituent of the Ocular Tears

Tear film is composed of proteins, enzymes, lipids, mucins, and salts which are actively
involved in nourishing and hydrating the cornea. Interestingly, tears also prevent corneal fluid
evaporation (4)(5). Tear film can function as a barrier capable of removing physical and chemical
irritants. There are three differentiated layers found in a normal tear that is classified as: 1) eye cell
bodies are in outer nuclear layer ganglion cell layer 2) inner nuclear layer while synapses and 3)
processes are present in the inner plexiform layer and outer plexiform layer. The synapses formed
by nuclei of photoceptor adjacent to the outer nuclear layer together with horizontal cells or bipolar
cells assists in neuronal transmission to the optic nerve. Lined by the Müller glia, they serve as
disposal sinks for removal of metabolic waste of the pigmented membranous outer segments of
the photoreceptors and excessive neurotransmitter (15)(14)

7
1.2.1.2. Retinal anatomy and Function

When the photoceptors are subjected to light in outer nuclear layer, the neurotransmitters
synapses in outer most outer plexiform layer continues through inner nuclear layer through bipolar
cells. The bipolar cells are in synaptic contact with the dendritic process of ganglionic cells in the
inner plexiform layer, the signal radiates through the retinal ganglionic ell layer into the optic nerve
followed to central nervous system (15)(14).
The melanin pigmented retinal pigmented epithelia (RPE) are responsible for absorption
of stray protons and phagocytosis of outer segments of photoreceptors. (15). The RPE is the barrier
that allows nutrients to be transported into the retina exchanging cellular debris and waste that is
transported into the circulation. This retinal layer is key in the pathogenesis of various retinal
diseases including aged related macular degeneration (AMD).
The Bruch's membrane, situated between the retina and choroid just beneath the RPE, plays
a vital role in eliminating waste from the outer segments of photoreceptors. If this waste removal
process fails, it can lead to the development of Age-related macular degeneration. This condition
arises from the buildup of waste materials, causing an escalation in oxidative stress, which
eventually results in the degeneration of retinal pigmented epithelium cells.

1.2.2 Retinitis Pigmentosa:

Retinitis pigmentosa (RP)is a group of retinal dystrophy diseases leading to gradual loss of
vision. It is the most common inherited retinal dystrophy diseases affecting 1 in 5000 subjects
worldwide. This condition can affect both the eyes simultaneously. Typically, the first sign of
disease progression is the loss of night vision in adolescence. This is followed by tunnel vision in

8
young adulthood, where ultimately complete blindness can occur depending on the severity of the
disease. (16)
The precise molecular pathogenesis of RP is complex and has various predispositions.
Pathogenic risk factors include genetic predisposition, ocular injury, light damage, and ciliary
transport dysfunction have been described as potentiators of disease initiation and causes for
disease progression. These factors will ultimately lead to degeneration of photoreceptors which is
the common converging event leading to visual decline and ultimately blindness. Rod
photoreceptor degeneration can occur during adolescence where night blindness may clinically
manifest, followed by tunnel vision as peripheral vision is reduced. As the retinal degeneration
progresses, the loss of rods is an additional burden on the RPE and retinal ganglionic cell (RGC)
layers. The inability to remove cellular debris and oxidative stress elements can exacerbate and
sustain retinal injury. The inability of reducing DAMPs can lead to reduction of cone
photoreceptors causing conditions like dyschromatopsia. (16,17).
On fundus examinations of RP patients reveal reduced photoreceptor response to
stimulation, Visual Field loss and vascular dysfunction. Vascular remodeling and disorganization
are also suggested to affect the stability of RPE and RGC layers as a result of attenuated vascular
supply (17).
Microglial cells normally found in inner plexiform layer are responsible for maintaining
the homeostasis of the retinal micro-environment. In case RP, infiltration of microglial cells in the
damaged RPE cells has been observed. This leads to exacerbation of photoreceptor degeneration
followed by release of inflammatory cytokines.

9
1.2.3. Pathogenesis of Retinitis Pigmentosa:

The disruption of the RPE microenvironment followed by photoreceptor degeneration
accounts for complete vision loss. The genetically triggered autophagic and necrotic signals,
dysregulated apoptosis seem to be the leading factors for progression of this condition. Light
exposure, mutation in metabolism, and increased amount of reactive oxygen species (ROS) in this
environment can accelerate retinal degeneration. Patients with RP exhibit the migration of melanin
pigment deposits due to reduced requirement because of photoreceptor degeneration, vascular
narrowing, optic nerve pallor and are at higher risk for development of keratoconus (16)(17).
Electroretinogram (ERG) suggests that patients with predisposition for RP have abnormalities
since early life and worsen as they age (18).
In early stage, the disease may not be recognizable as to the severity visual lost which is
often ignored by the patients. During this stage, the fundus examination cannot detect the migration
of pigments in peripheral region. The key for disease identification in the absence of genetic
predisposition is decline in b-wave amplitude during the ERG to evaluate scotopic vision. (19)
In mid stage, As the disease progresses the patients may become photophobic in diffused
lights causing difficulty in reading. Fundus examination shows the migration of pigments in the
peripheral region with ERG recording hypervolted cone cells.
In late stage, Patients show tunnel vision and peripheral loss of vision. The Fundus
examination show migration of pigments in peripheral region has reached the macular area and
ERG is unrecordable. The classic trial symptoms of bone spicule shaped pigments in the periphery,
optic pallor and vascular narrowing are visible. (19)

10
1.2.3.1. Molecular mechanism of Pathogenesis:

Probing in the molecular genetics associated with RP revealed overly complex and
overlapping genetic mutations between RP and Bardet Biedl syndrome, Stargardt disease,
congenital stationary night blindness, and Lebar congenital amaurosis (LCA). This overlap makes
the identification of a singular causative gene responsible for RP difficult. Amongst the unknown
reasons for disease onset the differential prevalence of RP between males versus females can be
contributed to the X-chromosomal linkage (20). Gene mutations in RPGR (Retinitis pigmentosa
GTPase regulator) and RP (Retinitis Pigmentosa), RHO(Rhodopsin), and USH2A((Usherin) out
of the currently identified genes seem to account for majority of cases of RP (21).

1.2.3.2. Role of Retinal Reactive Oxygen Species

One of the key factors associated with photoreceptor degeneration is increased in ROS
which is thought to promote inflammation. ROS are harmful reactive intermediates capable of
modulating the inflammatory signaling and cellular apoptosis pathways. Recent therapeutic
strategies suggest lowering ROS levels can normalize homeostatic physiological conditions.
ROS can be formed through two different pathways which are classified as 1) Endogenous
as a consequence of electron transport system in mitochondria and 2) Exogenous associated with
ultraviolet (UV) wave, xenobiotics, and ionizing radiation (22). Low levels of ROS are formed as
a consequence of normal cell cycle metabolism, maturation such as the activation of stem cells to
form various regulatory and effector cells. The metabolic changes can also generate additional
ROS that governs cellular regeneration, proliferation, and senescence/apoptosis of stem cells.

11
Immune response includes the modulation of T-cell based adaptive immunity which is
regulated by ROS. In case of pathogenic infiltration, the host is able to identify and quantify the
PAMPs to initiate response. The first signal is activation of NADPH oxidase (NOX) isoforms
(e.g., NOX2) which is able to generate additional ROS and assists in clearing the pathogenic
infiltration. This mechanism can also activate the adaptive immunity to establish an immunological
memory against the pathogen by recruiting T cells and B cells to the site of inflammation. ROS is
also involved in regulating the translocation of polymorphonuclear leukocytes such as neutrophils
to the site of pathogen and assists with its retention (23). In cancer, the proliferation of cancer cells
accounts for increased ROS production, which triggers cell apoptosis as an attempt to reduce
proliferation of genetically transformed cancer cells. Another such beneficial role of homeostatic
levels of ROS is assisting the proliferation of neuronal cells like astrocytes. NOX is the primary
source of ROS formation in central nervous system (CNS), involved in formation of ROS through
glycolytic conversation of glucose to lactate as a source for energy, especially in astrocytes. It has
been found that the metabolic ROS in can also govern proliferation and differentiation of neuronal
progenitor cells.
It is important to note that, the benefits of ROS as mentioned above are subjected to
normally at low levels which can be altered and managed by the counteracting antioxidant
molecules like superoxide dismutase (SOD), glutathione peroxidase (Gpx) and catalases (CAT).
Disruptions or irregularities in levels of antioxidant can cause imbalances and thus cause rampant
ROS production and subsequent detrimental effects on the cell viability (22)(23).
As mentioned earlier, ROS can be produced either through exogenous and/or endogenous
pathways. The endogenous pathways is associated with electron transport system in
mitochondrion, where the terminal electron acceptor is O2. The formation of .O2 can react with

12
water to form hydrogen peroxide (H2O2), singlet oxygen and hydroxyl radical formed because of
ATP producing complex I-III electron transport system in the inner membranes of mitochondria.
Some of the factors that may affect the production of ROS are factors promoting the respiratory
chain, the membrane potentiation in the mitochondria and oxygen load around in the surrounding
(28).
Oxygen plays a significant role in the ultimate step of ETS by accepting the final electron
to generate water (26). Superoxide and hydrogen peroxide are present in the subcellular
compartments of mitochondria. ROS products are reactive and react instantly with the molecules
in their vicinity. Amongst all, Hydrogen peroxide is more stable and can penetrate the cellular
membranes, while superoxides are in-diffusible and require ion channels to move across the cells
(27). As the ROS are generated, the antioxidants neutralize them before their accumulation. An
example of reactivity of H2O2 is iron catalyzed redox reaction of hydrogen peroxide in hydroxyl
ion. Iron is found to be involved in facilitating formation of ROS through Fenton reaction, in case
of patients with hemochromatosis shows early signs of age-related macular degeneration. (24)(25)
(26)
Additionally, superoxide can also serve are a source of H2O2 for catalytic conversion into
hydroxyl ion by SOD. This hydroxyl ion is converted into molecular water by the activity of CAT.
Apart from the molecular antioxidants, xenobiotics albumin, ferritin, lactoferrin, small molecules
like tocopherols, vitamin C and carotenoids are also involved in reduction of hydroxyl ions and
exhibiting ROS quenching activity. Owing to the amount of ROS being formed in ETS, there are
five major antioxidant enzymes present to neutralize them SOD1 (Cu/Zn-SOD), Mitochondrial
SOD2 (Mn-SOD), Extracellular SOD3 (EU-CuZn-SOD), CAT GPx, and glutathione reductase
(GR) (24) (25) (26). Alterations in redox balance activates nuclear factor-erythroid related factor

13
2 (Nrf2) which promotes transcription of antioxidants. The retinal has higher amounts of SOD
present. (26)
In some studies, Ca
2+
dependent ROS production has an interdependent relationship in
locations where calcium is abundantly present like cardiovascular system (CV). The influx of
calcium is dependent on the number of calcium channels present which are predominantly higher
in CV. Influx of calcium promotes the hyperactivation of mitochondria to suffice the energy
requirement in the form of ATP. As the metabolic rate increases, there is a rise in ROS. In contrast,
as there is higher production of ROS, that may interfere with membrane potential causing its
depolarization followed by higher influx of calcium ions. This interdependent relationship
culminates in mitochondrial apoptosis and cell death.
Other mechanisms such as independent of mitochondria, is NAPDH oxidase-based ROS
formation. Usually distributed in endoplasmic reticulum and nuclear membranes, NADPH oxidase
and Duox1-2 are seven known isoforms in the enzyme catalytic mechanism in formation of ROS
(33). Amongst these, NOX-2 is widely distributed in the retina of the eye. NOX 1, 4, and 5
isoenzymes are also found in the cornea and in particular, the stroma layer. (29)(30). Normally,
NOX expression is in responses to the presence of pathogen associate molecular patterns (PAMPs)
and DAMPs following binding onto pattern recognition receptors (PRRs). Usually, PAMPs and
DAMPs bind onto PRR receptors such as toll like receptors (TLRs) where the ligand binding can
trigger their activation. Derived from cellular necrosis, PAMPs and DAMPs are normally
byproducts that is detected by the innate immunity system and triggering and sustaining an
inflammatory response. Increased expression of NOX 2 has been associated with generation of
neutrophil extracellular traps (NETs) through the expulsion of decondensed chromatin and DNA,
which is the hallmark of pathogenic NETosis response. Studies have shown the prevalence of

14
NOX-2 expression in phagocytic cells like macrophages and neutrophils (29)(31). The
administration of H2O2 and hypochlorous acid can also trigger NETosis confirmed the interlinkage
of NOX and their presence in the phagocytic cells. (29)(30). Furthermore, activation of NOX-2
triggers the formation of ROS which leads to rapid conversion of nitric oxide to peroxynitrite
depleting the stores of NO as well as results in uncoupling of eNOS. eNOS (endothelial Nitric
oxide synthase) generally anchored in plasma membrane is responsible for production of NO in
presence of tetrahydrobiopterin, but its oxidation in presence of ROS leads to uncoupling of eNOS
and generation superoxides followed by reduction in NO stores (32)(33). NO is required for
maintaining the hemodynamics of the endothelial vasculature, restricting smooth muscle
proliferation (cardiac remodeling), inhibition of platelet and leukocytic adhesion (32). Moreover,
formation of peroxynitrite catalyzes the oxidation of tetrahydrobiopterin (32). Overall, increase in
NOX-2 leads to reduction in NO causing endothelial dysfunction and neovascularization (30)(32).
NOX-4 is responsible for production of hydrogen peroxide, which may be protective relaxing
smooth muscles as it does not oxidize the nitric oxide stores and tetrahydrobiopterin. (33)

1.2.3.3. Apoptosis induced by ROS in Degenerative Disease:
In degenerative diseases, the photoreceptor may undergo apoptosis in caspase dependent
or independent manner. In caspase dependent pathway, the trigger for the cascade is attachment of
Tumor necrosis factor (TNF) onto cell surface followed by recruitment of FADD. The cascade of
events leads to mitochondrial membrane permeabilization for transport of downstream activation
of apoptotic vesicles by Caspase -10. This pathway can also activate NF-kB to stimulate the
apoptotic response.

15
In contrast, caspase independent pathway - translocation of AIF in the nucleus indicates
the initiation of apoptosis. Autophagy can be activated through either RIPK1 mediated NF-k8,
cystatin depend on activation and RIPK dependent necrosis activation or RIPK3 mediated MLKL
phosphorylation and translocation to the cellular membrane. (35)

1.2.3.3. Effects of ROS:

In the presence of DAMPs and PAMPs, oxygen burst occurs where increased levels of
ROS is produced. This is triggered by mitochondrial ETS or NOX pathways which have damaging
effects on the morphology as well cell physiology. ROS can also interact with nitrogenous bases
found on the nucleic acids which can cause DNA strand breaks. ROS is known to affect structural
protein, protein aggregation, oxidation of polyunsaturated fatty acid (PUFA). Lipid peroxidation
of unsaturated fatty acids can form cross links, altering the metabolic pathways, accumulation of
oxygenated intermediates and oxidation of phospholipids (34). These reactive intermediates must
be eliminated and cleared to prevent further sustaining the oxidative stress. The inability of the
antioxidant system to mitigate the level of oxidative stress can promote the oxidative milieu
containing elevated levels of ROS promoting cellular autophagy, senescence, and programmed
cell death. This type of pathology is evident in neural degenerative diseases such as Alzheimer’s
(AD), Parkinson’s disease (PD), and AMD. So far, two main markers have been found that assist
with identification of oxidative damage, malondialdehyde (MDA), hydroxynonenal (4-HNE) lipid
peroxidation markers (24).

16
1.2.3.4. Overview of Inflammation:

Ocular inflammation and degeneration of photoreceptors can promote visual impairment
over a period. An example of chronic inflammation is RP where photoreceptor degeneration may
start as early as adolescence, where disease progression can advance as the patient ages. So far,
there are no standard treatments for prevention or impeding the progression of the disease.
Understanding the pathogenesis of inflammation is the key in figuring out early molecular markers
and developing potential treatments towards them.
The inflammation cascade in this disease condition begins with presentation of PAMPs,
DAMPs or inflammation causing products to the components of innate immune system like
microglial cells and macrophages lining the inner plexiform layer, below inner nuclear layer.
Microglial cells express multiple receptors like TLR’s, IL-1 receptor which assist them with
detection of changes in the microenvironment.
In the case of RP, persistent inflammation will result in debris and oxidative product
accumulation requiring excessive phagocytosis activities. In a state of inflammation, macrophages,
microglial cells, monocyte, and natural killer (NK) cells are found in the vitreous humor suggesting
their infiltrations and translocation. Microglial cells and monocytes can differentiate into M1 – pro
inflammatory and M2 – Anti-inflammatory subtypes in presence of stimuli. Once the inflammation
is reduced, M2 macrophages promote homeostasis restoration by release of anti-inflammatory
cytokines like IL-10, IL-4, IL-18, and IL-13. In this disease state, there is no switching off the
inflammatory stimuli as the gradual degeneration of photoreceptors serves as a stimulus for
persistent activation of microglial cells. They continue releasing inflammatory cytokines which
exacerbates photoreceptor loss and comprises the structural integrity of the retina. (37)(38)(39)

17
The inflammatory cytokines like IL1β, IL-2, IL-6, IL-8, monocyte chemotactic protein 1
and 2 (MCP-1 & 2), Platelet growth factor and TNF-a contribute to the maintenance and activation
of the downstream immune response. Interest, MCP-1 activates the translocation of microglial
cells and monocytic cells, memory cells and dendritic cells at the local site of inflammation. TNF-
a receptor is a transmembrane protein that is activated with a TNF converting enzyme known as
ADAM17 to release soluble TNF-a. Later, this cytokines stimulates nuclear translocation of NF-
Kb to induce necroptosis or apoptosis. (36-39)
This presentation brings about upregulation of predominant NAPDH oxidase, NOX-2 in
increasing the ROS load in the local microenvironment of inflammation while simultaneously
simulating release of pro-inflammatory cytokine, chemokines and iNOS.(36). In addition to this,
P2X7R, a purinergic receptor is found to be upregulated contributing to the release of
inflammatory components through activation of activation of protein kinase C, interestingly, a part
of MAPK pathway. Sometimes, mutations in genes can accelerate inflammation like Glyoxalase
(GLO1), which is responsible for clearance of Advanced glycosylated end products (AGE).

1.3. In vivo Animal Model of RP

Royal College of Surgeon (RCS) rats are the first known animal to exhibit retinal dystrophy
phenotype like that in Retinitis pigmentosa. This animal model is explored to serve as an excellent
candidate to study the progression of the diseases and testing of potential drug targets in decreasing
the progression of the disease state. The Royal College of Surgeon’s (RCS) rats possess a MerTK
mutation, which affects the retinal pigmented epithelial (RPE) cells’ ability to remove cellular
debris and transport it across the retinal barrier for elimination. In this model of RP, photoreceptor

18
degeneration is initiated on post-natal day 21 or p21, whereby p60, near total degeneration of outer
nuclear layer (ONL) where the nuclei of PR are almost eliminated.
As we have previously discussed, the photoreceptors undergo a continuous synthesis and
phagocytosis of circadian shedding of their outer segments by RPE. Moreover, RPE is involved in
providing supply of nutrients, ion, recycling of retinoids, secretion of basic fibroblast growth factor
(bFGF), vascular endothelial growth factor (VEGF), platelet-derived growth factor (PDGF) or
pigment epithelium derived factor (PEDF) and maintaining the ionic balance in the subretinal
space because of photoreceptor activity (43)(44) (46). The phagocytosis of the debris occurs by
recognition and binding on the tyrosine kinase receptor MERTK present on the cell membrane,
through which the debris is endocytosed and digested by the lysosomes. Mutations in MERTK
receptor interferes with recognition of the debris by the cells and leads to its accumulation in the
subretinal space (43) (46). It is found that there is an absence of this functional receptor in RCS
rats, which leads to the accumulation of the debris, highlighting similar cascading events in retinal
degeneration and exhibition of inflammatory response. Interestingly, as discussed earlier, there are
ion channels present on the surface of the retina like potassium, calcium, sodium, and hydrogen.
To date, we know of two existing pathways which cause accumulation of debris: receptor
dependent and receptor independent. (46)
In non-dystrophic rats, the debris binds to the MERTK receptor and subsequently activates
the downstream processes like activation phospholipase C and formation of inositol-1,4,5
triphosphate. Accumulation of inositol-1,4,5 triphosphate stimulates phagocytosis and influx of
extracellular calcium ions. Increased concentration of calcium ions activates the Protein kinases
and stops the phagocytosis. Previously, the role of protein kinase c is hypothesized and delineated
in increasing NAPDH oxidase resulting in increased production of Reactive oxygen species (49).

19
Based on this, we can correlate the accumulation of inositol-1,4,5 triphosphate with activation of
phagocytosis and final influx calcium ions to stimulate “off” signals. (46)
In dystrophic RCS rats, cell metabolism is impaired. The calcium ions influx produces a
much pronounced “off” signaling, inhibiting the phagocytosis. Possibly, due to the MERTK
mutation. (46) (47).
Additionally, as mentioned before, Microglial activation is the hallmark symptom of retinitis
pigmentosa. The infiltration of microglial cells and macrophages in the subretinal space indicates
the progression of retinitis pigmentosa. One of the studies, compared the presence of
immunological markers like CD36 and Mannose receptors (CD206) which are predominantly
found on the surface of macrophages. The study revealed that as the RCS rats age to day 14, there
is a progressive decline in CD36 expression required for phagocytosis of the photoceptors (46).
Additionally, a study conducted with SOD1-deficient mice provided evidence on
dependence of integrity of INL and ONL on the antioxidant activity of Sodium dismutase isoforms,
also, SOD 1 deficient mice exhibited senescing nuclei. These phenotypic results are synchronous
with retinal degeneration found in RCS rats, suggesting a decrease in SOD1 expression. (48)
Using the available research on gene profiling of RCS rats and upregulation of pro-
inflammatory cytokinin’s like Il1a, Tnf, C1qa, and Cd68(47), We can hypothesize that the
activation of immunological systems involving microglia and macrophages could be hallmark
evidence of NAPDH oxidase upregulation and simultaneous stimulation of immunological system
by DAMPs in form of accumulated debris in the subretinal space.
Neutrophils normally have a limited lifespan of approximately 24 hours, but in the presence
of inflammatory cytokines their lifespan, and associate inflammation, can increase several-fold
(13). Tissue sequestered neutrophils can trigger NAPDH oxidase (NOX) expression thus

20
increasing generation of reactive oxygen species (ROS), which in turn activates neutrophil elastase
(NE) translocation into the nucleus and promotes chromatin decondensation. ROS can activate
Mek/Erk phosphorylation which can evoke chromatin disassembly and expulsion of DNA, a
process referred to as neutrophil extracellular traps (NETosis) (14). Other hallmarks of NETosis
include increased peptidyl arginine deiminase-4 (PAD-4) expression mediating histone
citrullination which can also promote chromatin decondensation. These extracellular DNA-webs
are laced with myeloperoxidase (MPO), and NE capable of sustaining inflammation (14).
These clinical and molecular dissection findings point to the role of innate immunity in the
RP, where IL-8 recruit neutrophils to the affected site (3,4,8). However, there is controversy as to
the role of neutrophils, due in part to the lack of infiltrating cells in the retina. This was recently
addressed where neutrophils localized in the retinal perivascular space in disease animal models
and was confirmed in patients with proliferative diabetic retinopathy (PDR) and AMD (8,9).

1.3.1. Increase in the MasR expression in relation to photoreceptor degeneration in RCS.

The Renin Angiotensin system (RAS) has long been thought to be an important
modulator/regulator of fluid balance, and hemodynamics. Specifically, dysregulation of the RAS
has been linked to systemic hypertension. More recently, RAS has been shown to be an important
player in wound repair, where some components of the RAS are thought to pro-regenerative
activity.
Less is known is the pivotal role of RAS in wound healing and tissue repair. RAS has been
shown to regulate 1) stem and progenitor cell recruitment; 2) cellular proliferation; and 3) tissue
regeneration and revascularization.

21
The biosynthesis angiotensin peptides are mediated through the metabolism of penultimate
RAS precursor, angiotensinogen (Agt). The current understanding of angiotensin peptide
metabolism. Here Agt is produced in the liver where systemic Agt is metabolized by renin, which
is found predominantly in the kidneys to form Angiotensin (1-10) (Ang (1-10) or Angiotensin I
(AngI). Ang (1-10) is currently thought to be an inactive peptide which is a precursor substrate
for both angiotensin converting enzyme 1 (ACE1) and ACE2. AngI is metabolized by ACE1 to
form angiotensin II (AngII). AngII is a key RAS peptide that promotes its biological activity
through binding onto angiotensin type 1 receptor (AT1R) triggering inflammatory and pro-fibrotic
wound healing mechanisms. AngII/AT1R axis is a key member of the “classical or pathogenic
arm” of RAS.
AngII can be further metabolized by ACE2 to form Ang (1-7), an active metabolite formed
that binds onto MasR to non-fibrotic wound healing. These disparate and counter biological
activities have led to classifying Ang (1-7)/Mas and ACE2 as key components of the “protective
arm” of RAS. Another member of the protective arm of RAS includes Ang (1-9), a metabolite
formed through ACE2 metabolism of AngI. Like Ang (1-7)/Mas, Ang (1-9)/AT2R binding also
promote non-fibrotic wound healing.
The classical arm of renin starts when pro-renin transforms into renin through proteases in
the kidney's juxtaglomerular apparatus. This happens in response to changes in blood pressure
detected by renal baroreceptors, alpha adrenergic stimulation, and the detection of sodium chloride
influx by the macula densa. The aspartyl protease enzyme, Renin, cleaves first 10 amino acids
from N terminus of a biologically inactive a2 globulin, Angiotensinogen, to form Angiotensin I.
Predominantly, Angiotensinogen is produced by hepatocytes and later released in the plasma.
Angiotensin I is further cleaved by a non-specific proteolytic enzyme ACE into a highly active

22
octapeptide Angiotensin II. Angiotensin II formed by sequential cleavage peptides has its receptors
distributed in brain, heart, kidney, endothelial lining as well as immune cells. Angiotensin II is
short-lived with a half-life of 60 seconds; it is rapidly metabolized by proteases in Angiotensin III
and Angiotensin IV. (40)(41)
ACE is a non-specific proteolytic enzyme involved in cleavage of Angiotensin II and
formation for Bradykinin (Vasodilator). Present in the luminal wall of endothelial cells, it is
concentrated in lungs, kidney heart pulmonary circulation and smooth muscles. ACE has two
subtypes – ACE and ACE II. ACE II a membrane associated protein, hydrolyses Angiotensin I to
Angiotensin (1-9), cleaving two amino acids for the C terminus. Additionally, ACE 2 catalyzes
the conversion of Angiotensin II to Angiotensin (1-7), a Mas receptor agonist and a part of
protective arm of RAS system. Interestingly, Angiotensin (1-7) is formed by two pathways, hyd91-
7rolysis of Angiotensin II by ACE 2 and hydrolysis of Angiotensin (1-9) by ACE. Angiotensin (1-
7) can be further metabolized to Angiotensin (1-5). Recently, the cardioprotective role of
Angiotensin (1-7) has been explored, the role of Angiotensin (1-5) and Angiotensin (1-9) are still
unclear. Another pathway interconnected with RAS system is the Kinin system. A sequential
cleaving of a glycoprotein, Kininogen by tissue Kallikrein and aminopeptidases forms Bradykinin,
a vasodilatory peptide. This peptide is metabolized by Kininase II, an Identical peptide to ACE
(42)

1.3.2. Angiotensin/Mas in Retinitis Pigmentosa

Angiotensin (1-7)/Mas activates SOD expression while reduce Cyba (NADPH oxidase
P22 Phox) as revealed by Mordwinkin et al Endocrinology. These findings suggest that Ang (1-

23
7) can reduce oxidative stress through reducing the generation of ROS and increasing superoxide
dismutase (SOD) isoforms (49).
Shifting the balance of RAS can regulate the inflammatory response. In particular,
Angiotensin (1-7)/Mas receptor axis activation can alleviate inflammation. A study using db/db
diabetic mice show that the administration of Ang(1-7) was able to increase the levels of SOD
isoforms, in particular SOD 3, decrease levels of p22-phox (Cyb), which is accompanied by
increased eNOS expression. All of these effects were activated through Ang(1-7) activation of
Mas activation and blocked when the Mas antagonist, A779, was co-administered (49).
Additionally, A mice study using Mas deficient showed the dysregulation of the antioxidant
mechanisms, in particular decreased SOD and catalases activity and increased NOX 2
accompanied by increase blood pressure and higher levels of oxidative stress. When SOD mimetic
were used in these Mas deficient mice reduced levels of blood pressure was observed (50). These
studies show the relationship between Mas receptor/Angiotensin (1-7) axis with ROS and
stimulates the antioxidant system which directly inhibits NOX2 production.
Studies have also shown that Ang(1-7) activation of Mas found on macrophages can
increase phagocytosis which can eliminate both PAMPs and DAMPS. These activated
macrophages were able to eliminate cellular debris and reduce the TLR activation and potentially
reduce immune activation. Ocular humor may decrease the expression of NOX2, decrease in
immunological aggregation and infiltration of macrophages and microglial cells, decrease in
inflammatory cytokines and reducing the degradation of RPE layer. Since RP has been shown to
have persistent and unmitigated chronic inflammation increasing the presence of Mas receptor
upregulation with retinodegeneration, we hypothesize RP would be responsive toward Mas
agonist. Since Ang(1-7) has a short systemic half-life, ~20 minute, it would not be reasonable to

24
inject directly into the eye more than once a month. To mitigate this huddle, we strategize as how
to make a sustained release product that can retain the biological effects

1.4. Elastin like polypeptide (ELP)-Angiotensin (1-7) as a long-acting Mas receptor agonist.

The systemic half-life of Angiotensin (1-7) is approximately 20 minutes (56). Given the
beneficial role of Angiotensin (1-7)/Mas receptor cross talk, we wanted to develop a longer acting,
sustained release version of Angiotensin (1-7) that is compatible with ocular fluid.

1.4.1. Characteristics of ELP peptides

Over the decades, the applications and advancements in Nanotechnology have grown
tremendously. Newly developed and improved nanomaterials have found their way in healthcare,
food industry and cosmeceutical industry. We attempted incorporating the benefits of
nanotechnology in developing a sustained release Elastin like polypeptide tagged Angiotensin (1-
7) formulation. We expect the preparation to be site specific, non-immunogenic, potent, and
reduced frequency of dosing. Elastin Like polypeptide are genetically engineered derived from
human tropolelastin. Owing to human derivation, they are non-immunogenic, biodegradable, and
suited to drug delivery. The human derived water soluble tropoelastin is widely found in the
organelles of the living organisms like blood vessels, lungs etc. offering elasticity and resilience
to the tissues (51)(52). This biomolecule contains repeating hydrophilic and hydrophobic
sequences, these hydrophobic sequences assist in formation of coacervate. Classically, Elastin like
polypeptides are made of repetitive pentameric repeats Val–Pro–Gly–Xaa–Gly (VPGXG). X
amino acid – guest amino acid can alter the transitioning temperature by influencing the structural

25
and physiological chemistry of the peptide like hydrophobicity. One of the major characteristics
of ELP that makes it a suitable choice to achieve sustained drug release is the ability to phase
transition on increasing temperature. As hydrophobicity increases, the transitioning temperature
decreases as the process becomes easier. The transitioning temperature is highly influenced by the
guest amino acid, the length and molecular weight of the peptide. This property is also extended
to the peptide the ELP is tagged with making the ELP an ideal tag for peptides with lower
circulation time and high clearance. Phase transitioning is influenced by the external temperature
as at the lower temperature, the peptide is soluble and as the temperature increases it forms a
cloudy coacervate (51). Ionic concentration also plays a vital role in reducing the transitioning
temperature.

26
Chapter 2: Development of ELP V192 Angiotensin (1-7) construct and
validation
2.1. Development of ELP (V192-Angiontensin (1-7))

Elastin like polypeptide (ELP) can be genetically engineered using techniques like
Concatemerization (single step synthesis of oligomers) and Recursive directional ligation (multi-
step synthesis using restriction endonucleases). We used the recursive directional ligation method
for ligation of Angiotensin (1-7) sequence with ELP sequence. In this method, we used modified
pET-25b (+) expression vector with the site-specific endonuclease sequences. The vector was
modified by addition of 192 pentameric sequences with the valine as guest amino acid. As we
know, the catalytic site of Angiotensin (1-7) is the C terminus, we engineered the fusion of ELP
with N-terminus of Angiotensin (1-7) peptide. The basic structure of the ELP tagged Angiotensin
(1-7) sequence is as follows: Met-Gly-(Val-Pro-Gly-Val-Gly)192-Asp-Arg-Val-Tyr-Ile-His-Pro.
Once the vector was ready, the vector was transformed into Top-Ten E. coli bacteria as they are
beneficial in replication of genomes with repetitive units. The sequence was confirmed using
Sanger’s Sequencing, SDS-PAGE analysis and MALDI.
The translation of plasmid to protein was done in BLR E. coli cells. The protein was
isolated from the bacterial lysate using an Inverse transition technique which depends on the ability
of ELP to transition in alternate cold and hot centrifugation cycles. In this, The BLR E. coli.
bacteria are allowed to culture at 37˚C with continuous rotation for 16-18 hrs. Referring to the
bacterial growth phase, Culturing the bacteria beyond 18hrs may lead to bacteria entering
stationary to decline phase causing bacterial death and low yield. The next step is lysing of the
bacteria using sonication to assist the bacteria cell lysis and release of the translated protein. Post

27
lysis, the proteins are subjected to alternate cold and warm centrifugation to purify the peptide and
to reduce the level of E. coli derived lipopolysaccharides. The purity of the protein is measured
using UV-Vis Spectroscopy and Phase transitioning temperature in comparison to the
unconjugated ELP – V192.
Manipulating the proteins at the peptide is much easier than post translation as it avoids the chances
of degradation.

Figure 1.1 V192-Angiontensin (1-7) sequence in mpET 25b+ plasmid: The above figure is of the
modified plasmid pET25B+ with V192 (grey colored sequence) and Angiotensin (1-7) (pink
colored sequence).

28

2.2. Design of the ELP V192 Angiotensin (1-7) construct

2.2.1 Recursive directional ligation:

ELP V192 Angiotensin (1-7) construct was developed using Recursive directional ligation
method, a combination of stepwise digestion, isolation, and ligation of sequences. We used the
following sequences encoding Angiotensin (1-7) from IDT.
Sequence 1 /5Phos/TG ATC GCG TGT ATA TTC ATC CGT GAG
Sequence 2 /5Phos/AA TTC TCA CGG ATG AAT ATA CAC GCG ATC ACC

This method is divided into three steps:
1. Ligation of Angiotensin (1-7) sequence on mpET25+b plasmid and confirmation of
ligation.

Figure 2. 2. 1 Empty modified plasmid (mpET) digested with the endonucleases BseR1 and Ecor1
and ligated with Angiotensin (1-7) peptide sequence forming Angiotensin (1-7) sequence on mpET.
Gene sequence map and agarose gel simulation is generated using Snapgene.

29

Figure 2. 2. 2 Ang (1-7) on mpET is digested with the endonucleases BserRI and BssHII to isolate
the Ang (1-7) fragment using Gel electrophoresis. Gene sequence map and agarose gel simulation
is generated using Snapgene.
2. Digestion of V192 expressing mpET25+b plasmid and digestion of Angiotensin (1-7)
expressing plasmid to isolate the sequences

Figure 2. 2. 3. V192 on mpET is digested using the endonucleases AcuI and BssHII to isolate the
V192 fragment on the plasmid. Gene sequence map and agarose gel simulation is generated using
Snapgene.

30
3. Ligation of isolated sequences in step 1 and 2 to develop V192 Angiotensin (1-7) construct.

Figure 2. 2. 4. The DNA is isolated using Miniprep kit by Qiagen and the DNA is digested with
BamH1 and NdeI to confirm the ligation of V192 & Ang (1-7) sequence. Gene sequence map and
agarose gel simulation is generated using Snapgene.

Figure 2. 2. 5. Culmination of all the three steps in the process described above involved
information of V192 conjugated Angiotensin (1-7) peptide. Gene sequence map is generated using
Snapgene.

31
2.2.2 Direct Ligation or Concatemerization
Concatemerization is a single step fusion of Elastin-like polypeptide V192 and
Angiotensin (1-7) sequence. The process involves digestion of V192 sequence expressing plasmid
mpET25+b with endonuclease such that the C-terminus of V192 is available for ligation with
Angiotensin (1-7) peptide.
We attempted this method as it is a single step method and comparatively easier as
compared to recursive directional ligation method. In this process, firstly, V192 sequence
expressing plasmid mpET25+b was digested with endonucleases AcuI, BserR1 & EcoRI. Using
gel electrophoresis with a 10kb ladder, the digested plasmid split into respective sequences as
shown in the figure below. Out of the five isolated sequences, three sequences with bp 3477bp,
2880bp and 1012bp are isolated. These isolated sequences are cut in way that they are
complementary to angiotensin (1-7) sequence (add sequence). We attempted the ligation of the
isolated sequences with Angiotensin (1-7) sequence in 1:1 and 1:10 ratio. BamHI, an endonuclease
originally has its cut sites at C terminus of V192 sequence. BamH1 and NdeI endonucleases are
used to confirm the digestion of V192 mpET25+ plasmid and ligation of Angiontensin (1-7)
sequence. If there is a ligation, a single band will appear on gel electrophoresis, multiple in case
of no ligation. Finally, the ligation is confirmed using sanger’s sequencing, which did not confirm
the ligation of the bands. Hence, we proceeded ahead with the second approach, Recursive
directional ligation.

32

Figure 2. 2. 6. Concatemerization method for development V192-Angiotensin (1-7) using Direct
Ligation method. In the above figure 2.2.6, Even though there seems to be presence of colonies,
none of them tested positive for V192-Angiotensin (1-7).

2.3. Analysis of ELP Construct:

2.3.1 Sanger’s Sequencing:

Sanger sequencing is used to determine point mutations and accuracy the genetically engineered
plasmid encoding the V192-Angiotensin(1-7) polypeptide. Once the E. coli bacteria is transformed
and streaked on the plate, The colonies are picked followed by DNA isolation. This isolated DNA
is sequenced using sanger’s sequencing using T7 term primers. This begins with dsDNA
denaturation followed by elongation of ssDNA with dNTPs and fluorescence labeled ddNTPs. A
- green fluorescence, T - red, G - black, and C – blue, whenever a ddNTP is inserted in the
sequence, the elongation stops, and laser detects the intensity in form of Peak. (52)(53)

33

Figure 2. 3. 1. Sanger’s Sequencing of V192-Angiotensin (1-7) peptide sequence
The above figure 2.3.1 shows the ligation of Angiotensin (1-7) peptide (pink) on the C terminus
of V192 ELP (grey) visualized using Snapgene and sequenced using Genewiz.

2.3.2 SDS PAGE Analysis of isolated protein:

Sodium dodecyl sulfate–polyacrylamide gel electrophoresis, commonly known as SDS-PAGE, is
a technique used for the separation of proteins based on their molecular weight. In this case, SDS-
PAGE was employed as a confirmatory test to determine the presence of the V192-Ang (1-7)
polypeptide. The molecular weight of Angiotensin (1-7) is 899 Da, while V192 has a molecular
weight of 79 kDa. When combined, the V192-Ang (1-7) polypeptide has a total molecular weight
of 79899 Da. The disparity in molecular weight between the conjugated and unconjugated forms
is discernible through the presence of distinct bands on the gel, with the conjugated peptide running
slightly above the original V192 peptide.

34

Figure 2. 3. 2 SDS-PAGE analysis of V192-Angiotensin (1-7) peptide.In the above figure, V192-
Angiotensin (1-7) was characterized using SDS PAGE Gel Electrophoresis. The expected
molecular weight of the compound is approximately 79Kda. The SDS PAGE was run at 200V for
32mins. The wells 1 & 5 are the ladder. The sample in well 2 is the V192 (Unconjugated ELP)
peptide, in well 3,6, & 7 are V192 Angiotensin (1-7) ELP. We infer the slightly higher molecular
weight of the conjugated protein vs unconjugated protein is visible on the gel. Imaged using Ibright
Image viewer. We also, infer the presence of PMSF assists with reduction in protein degradation.

2.3.3 UV spectroscopy analysis in determining transitioning temperature:

As mentioned before, V192-Angiotensin (1-7) undergoes coacervation directly proportional to
increasing concentration and temperature. We used UV spectroscopy to determine the aggregation
of ELP at 350nM. Coacervation was induced using heat.

35

Figure 2. 3. 3. The transition temperature gradation of V192- Ang (1-7) ELP predicted using
UV/Vis spectroscopy. The transition temperature gradation of V192- Ang (1-7) ELP predicted
using UV/Vis spectroscopy (left) and Comparison of V192 conjugated and Unconjugated
polypeptide (right). On the right, the figure shows the transition temperature gradation across
increasing concentration of V192-AT (1-7) ELP. As the concentration increases from 0.4µM to
50µM, the transition temperature is expected to increase which can be observed. Comparing the
transition temperature of V192-AT (1-7) ELP with parent V192 ELP, there is not a lot of difference
in the transition temperatures.

2.3.4 MALDI:

Matrix-assisted laser desorption/ionization (MALDI) is used to accurately determine the molecular
weight of post-translation proteins and proteolytic fragments. In our study, we utilized MALDI to
assess the error in the molecular weight of the truncated V192 peptide, which we referred to as
V180 due to the absence of approximately 5 kDa of amino acids. Unfortunately, we were unable
to determine the molecular weight of the newly synthesized V192 peptide using MALDI as the
instrument was out of operation. Therefore, for confirmation, we relied on SDS-PAGE and
Sanger's sequencing methods. We used two concentration of V192-Ang (1-7) with MALDI matrix
as 1:5 and 1:10.

36

Figure 2. 3. 4. MALDI analysis of V180 conjugated peptide
The above figure represents the graph resulting from MALDI Analysis of the V180 conjugated
peptide, displaying the molecular weights listed above each peak. The blue portion of the graph
corresponds to the 1:5 construct, while the red portion represents the 1:10 construct of the Sample
protein with MALDI Matrix. The peak at a molecular weight of 74k corresponds to the sample
protein.

2.3.5 Complications in development of V192-Angiontensin (1-7):

Comparison of unconjugated V192, conjugated V192-Angiontensin (1-7) and conjugated V180 -
Angiotensin (1-7) which fits with the molecular weight suggested by MALDI analysis.

37

Figure 2. 3. 5. Comparison of unconjugated V192, conjugated V192-Angiontensin (1-7) and
conjugated V180 -Angiotensin (1-7) using SDS PAGE. The depicted figure highlights the
characterization of the peptide based on its molecular weight, which is expected to be
approximately 79 kDa. The SDS page was conducted for 32 minutes at a voltage of 200V. Ladder
samples were loaded into wells 1, 4, and 5. In well 2, the V192 peptide was placed, while in well
3, the Angiotensin (1-7) V192 ligated peptide was loaded. It is noticeable that the bands appear
slightly above the 75 kDa band on the ladder. Well 6 contains the previously isolated truncated
V192 peptide (referred as V180), which was used for comparison to observe any differences in
molecular weight. It can be observed that the truncated V192 peptide migrates slightly lower
compared to the 75 kDa band and the samples in wells 2 and 3.

2.4. Materials and Methods

2.4.1. Isolation of DNA from Plasmid:

The plasmid was isolated from the Top ten E.Coli bacteria using Qiagen DNA isolation
minprep protocol as per QIAprep Spin Miniprep Kit. The bacterial suspension is centrifuged at
4000 rpm for 8 minutes, and the supernatant is discarded. The pellet is then resuspended using P1
RNase free buffer (250 μl) and transferred to smaller tubes (2 ml). P2 buffer (250 μl), an alkaline
lysis buffer, is added to each sample, and gentle inversion is performed. The suspension is allowed
to stand for 2 minutes, causing cell lysis with the help of 1% SDS (a detergent) and 2 M NaOH

38
(denaturing the chromosomal DNA and plasmid DNA, but excessive lysis can result in fragmented
DNA unsuitable for genomic studies). N3 buffer (350 μl) is added, and gentle inversion is
performed. The samples are then centrifuged at RCF 16.1 (max speed) for 10 minutes. The pellet
is discarded, and 800 μl of supernatant, containing DNA, is extracted from the column. The column
is then spun down for 30 seconds at 16.1 rcf, discarding the collected liquid. Next, 750 μl of PE
buffer with added ethanol is added to the column and incubated for 2 minutes, followed by
centrifugation for 30 seconds. The collected liquid is discarded, and the dry column is transferred
to 2 ml tubes. Ultra-purified water or HPLC grade (40 μl) is added and incubated for 3 minutes,
ensuring the use of new pipette tips for each sample. A centrifuge is run again for 30 seconds, and
the collected solution contains the DNA.

2.4.2. Transformation of E. coli cells

The 50μl of E. coli cells were thawed on ice for 10 minutes after being removed from -80
degrees Celsius storage. Then, 2 μl of DNA was added to the cells and incubated on ice for 15
minutes. The cells were subjected to a heat shock at 42˚C for 35 seconds and immediately returned
to ice and incubated on ice for 20 minutes. Assuming successful transformation, the transformed
E. coli cells were plated on LB carbohydrate plates. After an incubation period of 16-18 hours, the
plates were stored at 2 degrees Celsius. Colonies were subsequently picked and grown in 6 ml of
LB broth without sodium chloride for 16-18 hours in culture tubes. Mini prep was performed to
isolate the DNA, and the DNA samples were sent for sequencing to Genewiz for further analysis.

39
2.4.3. Gel Electrophoresis and Isolation of sequences for Recursive directional ligation

To confirm the nicking using electrophoresis gel, agarose gel preparation and sample
loading were performed. For gel preparation, 1g of agarose powder was dissolved in 100ml of 1X
TAE buffer by microwaving for 2 mins and stirring. Sybr safe (SYBR™ Safe DNA Gel Stain,
Catalog number: S33102 Thermo Fisher Scientific) was added, and the solution was poured into a
mold and allowed to solidify. Samples were loaded by adding gel loading dye with SDS, and a
DNA ladder was included. Care was taken to avoid bubbles during sample loading. The gel was
run using electrophoresis at 140V for 1 hour. After separation, the samples were observed under
UV light or an iBright Image Visualizer.
For DNA purification from the agarose gel, the separated bands of interest were cut out
and transferred to 1.7ml Eppendorf tubes. The bands were digested with 1ml QG buffer, incubated
at 50°C for 10minutes, and vortexed intermittently every 5 minutes. The solution was transferred
to columns and centrifuged to remove liquid. PE buffer with ethanol was added and centrifuged
again. After discarding the collected liquid, the columns were transferred to 2ml tubes. Ultra-
purified water was added, followed by incubation to complete the DNA purification process.

2.4.4. Isolation & growth of the BLR cells transformed with V192-Angiotensin (1-7) modified
plasmid:

Initially, the isolated BLR E. coli bacterial cell colony and top ten E. coli bacterial cell
colony were introduced into 100 ml of terrific broth (CulGene, Catalogue no: C8153), which had
been prepared by dissolving 5.2 g of TB powder in 100 ml of distilled water and autoclaved prior
to use. The cells were then incubated at 37°C and 250 RPM for 16-18 hours. Following this initial

40
growth period, 20 ml aliquots were transferred to 1 liter of terrific broth, which had been prepared
by adding 52 g of terrific broth powder (CulGene, Catalogue no: C8153) to 1 liter of autoclaved
distilled water. Subsequently, the cells were further cultured for an additional 16 to 18 hours at
26°C and 250 RPM. The culture flasks were collected, and the cell solution was subsequently
transferred to 1-liter plastic flasks for centrifugation.

2.4.5. Sonication of the Cell lysate

The resuspended solution was sonicated using a Misonix S-4000 Sonicator with a cold
envelope maintained using ice. Sonication was performed for 3 minutes with an amplitude of 11,
a pulse-ON time of 10 seconds, and a pulse-OFF time of 20 seconds. Post-sonication, the solution
exhibited a deepened color.

2.4.6. Isolation of ELP from the cell lysate

After sonication, 200 μl of PEI (Polyethyleneimine) per 30ml of suspension was added to
the solution as it binds to the DNA groove or phosphate backbone, leading to DNA precipitation
as a pellet. The suspension was subjected to pre-cooled cold centrifuge for 17 min at 10000 RPM
in Beckman J2-Mi centrifuge. The cold centrifugation solubilizes the peptide and is present in the
supernatant phase. Keep the solution in 37˚C water bath to assist the aggregation of the peptide.
The aggregation was accelerated by addition of 5M Sodium Chloride in 5ml aliquots as the
addition of NaCl lowers the transition temperature of the peptide, hence enabling the peptide’s
precipitation. The maximum concentration of NaCl in the solution should not exceed more than
2M. The turbid solution is centrifuged at pre-warmed centrifuge at 38/40˚C at 4000RPM for

41
18mins. After centrifugation, the supernatant was discarded, and the pellet was resuspended in
PBS. The alternate warm and cold centrifugation cycles were repeated thrice, and the resultant
pellet post last warm centrifuge was resuspended in PBS using an 18-gauge syring to enhance
solubilization.

2.4.7. SDS PAGE gel analysis

To determine the approximate molecular weight of our recombinant ELP product, the
product was passed through a SDS PAGE. The samples are diluted to a concentration of 10 μg
with a total volume of 15 μl. Next, 5 μl of reducing dye, which consists of 900 μl Laemmli sample
buffer and 100 μl β-mercaptoethanol, is added to the samples. The samples are vortexed and
centrifuged at 2000rpm for 30seconds to ensure proper mixing. The samples are loaded onto a heat
block and incubated at 95°C for 5 minutes. Bio-Rad precast gels are used, ensuring that the well
plates and SDS PAGE reservoir are aligned correctly. Run the gel at 110 Volts for an hour or till
the samples reach the base of the reservoir. The gel is resuspended in distilled water. CooMassie
blue is added to sufficiently cover the gel and incubated for an hour on an orbital shaker at 60
revolutions per minute. The CooMassie blue (Bio-Safe CooMassie G-250 Stain1610786, Bio-
RAD) is then carefully emptied, and the gel is washed with distilled water to remove any excessive
staining. This washing step is repeated three times. Finally, the gel is imaged using a Chem Doc
imaging system.

42
2.4.8. MALDI

To further affirm the molecular weight of our recombinant products, we used MALDI-
TOF. The recombinant samples were prepared using matrix preparation for MALDI: 1.7 ml
Eppendorf tube was tared with 30 mg of DHAP (Dihydroacetone Phosphate, Catalogue no:
102783-56-2, SigmaAldrich). Then, 2 µl of formic acid, 498 µl of double-distilled water, and 500
µl of acetonitrile were added, and the mixture was vortexed until the DHAP was completely
dissolved.
Sample Preparation: 2.5 µl of the sample protein was added to 2.5 µl of B-mercaptoethanol
in a 1.7 ml Eppendorf tube. 5 µl of double-distilled water was added, and the mixture was mixed
using a pipette. The sample was heated to 95°C for 10 minutes on a heating block, followed by
cooling for 2 minutes. The tube was then centrifuged for 15-30 seconds at 14,000 RPM. The
prepared sample was diluted with matrix just before spotting it on the MTP AnchorChip 384(MTP
AnchorChip 384 BC Part No: 8280790 Bruker) for analysis.
Analysis using MALDI: For the analysis, two constructs were prepared with varying
concentrations of the MALDI matrix. The first construct consisted of 1 µl of the sample mixed
with 5 µl of the prepared matrix solution, while the second construct contained 1 µl of the sample
mixed with 10 µl of the matrix solution. A spot of 0.5 µl from each construct was carefully placed
on the MTP AnchorChip 384 BC, ensuring that the pipette tip did not touch the plate. The spots
were allowed to air dry. Using the Flex control software, analysis method was selected for intact
proteins detecting a range of peptide from 50 kDa to 100 kDa.

43
2.4.9. UV Spectroscopy

DU 800-spectrophotometer software is used for determination of transitioning temperature
and identifying the concentration/temperature for coacervation of the peptide. Using Tm
Microcell. The temperature controller is enabled, and the start temperature is set at 15˚C. The
method is edited to specify the number of cells to be used, which in this case is 5 cells. The cells
include a blank and four different concentrations of the peptide diluted in PBS: 0.4, 2.0, 10 and 50
μM. The analytical wavelength is set at 350 nm as the change in absorbance is dependent on the
turbidity resulting from the transitioning temperature rather than the protein concentration. The
ramp rate is set to 1˚C, and the read interval is set to 0.3˚C.

2.4.10. Molar extinction Coefficient & Protein concentration

To determine the molar extinction coefficient and protein concentration, certain steps were
followed. First, the protein was isolated using a protease inhibitor, specifically PMSF. The number
of cysteine, tryptophan, and tyrosine residues in the protein sequence were estimated using
SnapGene software, which allowed for the calculation of the molar extinction coefficient using a
specific formula. Based on the protein sequence analysis, the molar extinction coefficient was
determined to be 1285 liters/mol*cm in the absence of tryptophan and cysteine residues.
Calculation of Molar Extinction Coefficient of the fusion protein = 125* (Cysteine residues) +
5685* (Tryptophan residues) + 1285* (Tyrosine residues)
To determine the protein concentration, the absorption at 280nm was subtracted from the
absorption at 350nm. This value was then divided by the molar extinction coefficient multiplied
by the path length of the nanodrop (0.1cm).

44
Equation for Protein concentration determination: (Absorption at 280nm - Absorption at 350nm)
/ ((Molar extinction Coefficient) * Path length of nanodrop (0.1cm)

2.4.11 DNA digestion

For the preparation of DNA samples, we utilized 0.5 μg of DNA for digestion. It is crucial
to ensure that the amount of DNA to be digested remains below 16 μl. To facilitate digestion, the
DNA was diluted using Cut smart buffer, and 1 μl each of desired restriction endonucleases was
added to the mixture. The next step involved incubating the solution at 37°C for a duration of 30
minutes, allowing the restriction endonucleases to effectively digest the DNA. Once the incubation
period was completed, the sample was deemed ready for further analysis, such as electrophoresis,
which enables the separation and visualization of the digested DNA fragments. By adhering to
these steps, the DNA samples were appropriately prepared and made available for subsequent
experiments or analyses.

2.4.12 DNA ligation

Firstly, ensure that the volume of the mpET plasmid and the Ang (1-7) nucleotide adds up
to 10 μl. Then, add 2 μl of DNA Ligase Buffer to the mixture. Finally, add 1 μl of T4 DNA ligase
to the solution. This process will facilitate the joining of the plasmid and oligonucleotide through
the action of DNA ligase, enabling further downstream applications.

45
2.5. Advantages of ELP-conjugates

As discussed earlier, the major advantages of using ELP based conjugates are non-
immunogenic response, targeted drug delivery, assists with purification of the protein, genetically
manipulative, non-toxic, and easily cleared by elastases present widely in the systemic circulation,
cost effective, easily up scalable and can be lyophilized and stored for a long time.

2.6. Escherichia coli in plasmid transformation and peptide production

Escherichia coli (E. coli), with its well-understood genome and uncomplicated molecular
tools, has played a crucial role in the field of recombinant DNA technology over the past decade.
Since the introduction of insulin production using E. coli, this bacterium for protein production
has become increasingly popular. The advantages of utilizing E. coli include its bio-based nature,
ease of genetic manipulation, high replication density, simple maintenance, and cost-effectiveness.
E. coli provides a favorable platform for the efficient production and analysis of proteins, thanks
to its ability to accommodate coding sequences in vectors and its minor metabolic engineering
capabilities. Compared to post-translational products, proteins are easier to manipulate as
sequences due to the well-understood genome of E. coli and the simplified molecular tools
available.

2.6.1. Potential problem of E. coli as production cell

A universal characteristic of Gram-negative bacteria is the presence of an additional outer
membrane structure composed of phospholipids and Lipopolysaccharide (LPS). This outer

46
membrane consists of several components, including a conserved hydrophobic anchor called Lipid
A, which attaches the LPS molecule, a phosphorylated core, and a hydrophilic component (55)
LPS is a potent stimulator of toll-like receptor 4 (TLR4), which triggers the activation of
an immunogenic response and the release of pro-inflammatory cytokines such as interferon type-
1, resulting in inflammation. This activation is classified as Pathogen-Associated Molecular
Patterns (PAMPs). Normally, LPS is responsible for eliciting a pyrogenic response, which can
potentially lead to septic shock. (56)
During the production of recombinant proteins using E. coli as the host organism, the
bacterial cells are lysed to facilitate the release of the desired protein. However, this process also
leads to the release of LPS and other potential PAMPs into the environment, which can
significantly reduce the therapeutic value of the intended protein. Therefore, it is crucial to
effectively contain and eliminate this contaminant to prevent adverse effects in the mammalian
host.

2.6.2. Elimination of E. coli LPS

The Elastin-like polypeptide (ELP) tag is well known for its ability to transition between
warm and cold temperatures. This behavior has proven to be beneficial in reducing the
lipopolysaccharide (LPS) load from lysed cells and isolated proteins using inverse transitioning
centrifugation technology. During each cycle, the ELP is resuspended in a new aliquot of
Phosphate-buffered saline solution (PBS), indirectly reducing the ELP load in the final product.
Before introducing the isolated ELP, the cold protein solution is passed through a Mustang filter (
Acrodisc Unit with Mustang Membrane , Pall Corporation, Catalogue Number- MSTG25E3)

47
These filters are positively charged cation exchange filters that retain negatively charged LPS
when it is passed through them.

2.7. Result
The primary objective was to ensure the accuracy of the genetic construct and identify any
potential point mutations that could affect its functionality. To achieve this, we initiated the
experimental process by transforming E. coli bacteria with the plasmid. After successful
transformation, the bacteria were streaked onto plates, providing an environment conducive to
the growth of individual colonies. From these colonies, we selected isolated colonies for DNA
isolation, which served as the template for the subsequent Sanger sequencing process, As per the
figure 2.3.1, the peptide is constructed accurately.

To confirm that our construct is correct, we ascertain the first characterize the V192-Ang (1-7)
polypeptide using Sodium dodecyl sulfate–polyacrylamide gel electrophoresis (SDS-PAGE).
The separation confirmed the presence of our anticipated a total molecular weight of 79899 Da
for the V192-Ang (1-7) polypeptide when combined. As the conjugated peptide migrated
through the SDS-PAGE gel, we observed distinct bands slightly above those corresponding to
the original V192 peptide. This unequivocal evidence confirmed the successful formation of the
V192-Ang (1-7) conjugated polypeptide as suggested in the figure 2.3.2

We further characterize the physicochemical characteristics of the V192-Angiotensin(1-7) using
UV spectroscopy. This analysis allows us to determine the peptide's ability to coacervate at a
concentration of 350nM. We were able to induce peptide coacervation through heat showing that
the recombinant ELP construct has elastin-like polypeptide (ELP) segment Figure 2.3.3. This

48
information proved vital for understanding the potential biomedical applications of the V192-
Ang (1-7) polypeptide construct.

To ensure the stability and authenticity of the final product, we optimized the peptide synthesis
process with meticulous care. A critical factor we addressed was maintaining the synthesis
temperature below 20˚C, effectively minimizing the activation of proteases that could lead to
undesirable protein degradation. Following this, we re-synthesized the peptide and rigorously
characterized it using an array of analytical techniques.
To evaluate the impact of proteases on potential protein degradation, we employed two
recombinant constructs: one with the addition of PMSF (protease inhibitor) and one without. The
results obtained from SDS-PAGE demonstrated minimal protein degradation in both cases, A
critical factor we addressed was maintaining the synthesis temperature below 20˚C, This
unequivocally confirmed the structural integrity of the V192-Ang (1-7) polypeptide construct, as
per figure 2.3.5. Furthermore, using a UV/Vis spectrophotometer, we determined the transition
temperature of the peptide and compared it to the parent ELP, V192. This comparison revealed
similar behavior of transition temperature based on concentration, as expected from ELP, with
the transition temperature decreasing and the concentration increasing.
The molar extinction coefficient was determined which showed the protein concentration
was 282µM. These comprehensive analyses collectively validated the successful synthesis of the
V192-Angiotensin(1-7) conjugated polypeptide, reaffirming its structural integrity, stability, and
significant potential for biomedical research applications.

49
Chapter 3: In vitro validation of the construct

3.1. CHO-K1 and Mas overexpressing CHO-K1 cells

To test when the recombinant ELP construct can activated Mas mediated activity(ies), a
Chinese hamster ovary (CHO) Mas overexpressing cell line was developed. CHO cells are
extensively utilized in the field of recombinant DNA technology to express recombinant proteins
encoded by plasmids. In this regard, CHO-K1 cells were transduced lentiviral construct that
included human Mas gene. This cell line are similar human cells in terms of protein glycosylation
and assembling and protein folding (55). Additional these cells have a doubling rate of 12-14
hours, reducing the timeline of protein expression and experiments. On other hand, there Mas
receptors are inducible, and there are very few cell lines overexpressing Mas receptors which
makes estimating the downstream processes laborious. Hence, it our lab transduced the CHO-K1
cell line with human receptor to develop an overexpressing cell line to estimate the downstream
activation on treatment with its natural agonist Angiotensin (1-7).
Additionally, since CHO-K1 cells are derived from hamster ovaries, there may be
limitations in predicting the activation and behavior of molecules that interact with human-origin
receptors. The functional outcomes of molecules in CHO-K1 cells expressing human receptors
may not always directly correlate with their activity in human cells, making it difficult to accurately
predict the efficacy or response of the molecules being studied.
These limitations underscore the need for careful interpretation and validation of results
obtained using CHO-K1 cells, particularly when studying molecules with potential therapeutic
applications in humans.

50
3.1.1 Construction of the CHO-K1 cells vector

We transduce the Mas gene into CHO-K1 cells using a lentivirus vector containing plasmid that
contained the gene for the human Mas receptor tagged with a green fluorescent protein (GFP), as
well as a gene encoding for neomycin, which is a selection antibiotic. Lentiviral vector transfection
ascertains the safety of the cells and facilitates the delivery of cDNA in variety of diving cells.
Following transduction, the cells were cultured in 96-well plates, with each well containing only
one cell known as single cell sorting to avoid cell to cell heterogeneity genetically, which is
undesirable for molecule screening.
The wells containing single cells were carefully chosen and transferred to 48-well plates. These
individual cells are referred to as clones. Subsequently, the cells were cultured and expanded in
the presence of 500ng/ml geneticin (G418) to ensure the maintenance of selection. Through
examination using a confocal microscope, it was observed that the cells expressing the human Mas
receptor exhibited a distinct green fluorescence.

51

Figure 3. 1. 1. Plasmid Encoding for Cytomegalovirus(CMV) as a promoter, EGFP (Green
Fluorescent Protein) and Mas Receptor (Mas1) transduced in CHO-K1 cells

3.1.2 Method of isolating the Mas-CHO-K1

3.1.2.1. Geneticin based selection.

Transduced CHO-K1 containing the Mas plasmid also contain a sequence encoding for
neomycin resistant gene. G418, or geneticin is an aminoglycoside specifically for eukaryotic cells
with high proliferation rate like CHO-K1 cells. Geneticin inhibits the protein proliferation and
elongation in eukaryotes. It is also found to begin caspase -3- dependent apoptosis.

52
We tested out four concentrations of geneticin, 250µg/ml, 500µg/ml, 1000µg/ml in all
CHO-K1 transduced and Wild type cell line. We found that, all the concentration of geneticin had
a cell senescing and cell death effect while 500µg/ml of geneticin worked for selection of Mas
overexpressing cell line.

Figure 3. 1. 2. Estimating the concentration of Geneticin in effectively increasing the
concentration of Mas overexpressing CHO-K1 cells

3.1.2.2. FACS sorting

Fluorescence assisted cell sorting assists in isolation of GFP positive cells from a transduced cell
population and thereby increasing their concentration. As mentioned before, the plasmid we used
had GFP encoding gene attached to Mas receptor encoding gene, hence we attempted increasing
the population of Mas overexpressing cell lines using FACS.
We found that, The CHO-K1 cell line transfected with the Mas receptor as and GFP sequences is
considered a transient cell line, known for its tendency to lose the plasmid carrying these sequences
over time. To enrich the population of GFP-expressing cells, fluorescence-activated cell sorting
(FACS) was employed. However, the results did not reveal a significant difference between the
cell populations treated before and after FACS.

53

Figure 3. 1. 3. FACS analysis of Mas overexpressing CHO-K1 cell and Confocal microscope
visualization of FACS sorted Mas overexpressing CHO-K1 cell. The above figure shows the
expressing of GFP positive cells in the cell population of CHO-K1: Above 10
3
FITC, cells were
referred as GFP containing cells ~1% of total cells. The event P2 symbolizes the amount of GFP+
cells (Left) and Confocal microscope visualization of FACS sorted Mas overexpressing CHO-K1
cell (right).

3.1.3 Characterization of the Mas-CHO-K1: ELP-Ang (1-7) in comparisons with Ang (1-7), NLE
and Ang (1-7)

3.1.3.1 Western blot

We used Western blot for estimating the amount of translated phosphorylated eNOS at 30mins
with cell starvation of 2hrs prior to the treatment with increasing concentration of Mas receptor
agonist. We conducted this experiment in a 6 well plate. One of the wells was untreated, and rest
were treated in increasing concentration of Mas receptor agonist – 5 to 500 nM for 30mins. We
also pretreated one of wells with 5µM of A779 as a Mas receptor agonist for 1hr to inhibit the

54
activation of Mas receptors followed by 50nm of Mas receptor agonist for 30mins. The results
were visually interpreted using Ibright image analyzer and Image J to quantify the amount of
activation.

Figure 3. 1. 4. Quantification of western blot analysis of phosphorylation eNOS on treated Mas
overexpressing CHO-K1 cells revealing a concentration-dependent increased in eNOS-p after
Mas receptor activation. When these Mas agonist were co-administered with 5µM of A779, there
were some attenuation of Mas agonist effects. Analyzed using Image J.

3.2. Materials and Methods

3.2.1. FACS:

Cells were initially seeded at a density of 600,000 cells per 10 cm2 Petri dish. Once the cells
reached approximately 70% confluency, they were treated with concentrations of250 to 2000
μg/ml in RPMI media supplemented with 10% FBS. The cells were then monitored for GFP

55
expression throughout the week using a fluorescence microscope. Notably, the cells treated with
250 μg/ml and 500 μg/ml exhibited higher levels of GFP compared to the other concentrations.
Subsequently, these cells were subjected to fluorescence-activated cell sorting (FACS) and sorted
into wells containing 1 cell, 2 cells, and 5 cells per well, while the remaining cells were collected
into a 10 cm2 dish and allowed to grow in media supplemented with 20% FBS. Over the weekend,
the media in all the dishes was replaced with RPMI media supplemented with 10% FBS. The cells
were trypsinized and resuspended in 3ml of PBS and FACS for cellular GFP positive cells was
performed.

3.2.2. Western blot:

Sample Preparation and Gel Electrophoresis:

The level of protein was evaluated using Laemmli Loading Buffer based on the BCA assay. Protein
samples containing 20 μg of total protein, each cell lysate is then boiled in sample buffer at 95°C
for 5 minutes and centrifuged to clarify the samples. The clarified samples are then load into the
wells of an SDS-PAGE gel, along with 7 μL of molecular weight markers. The gel is then run at
125 V for 1.15 hours. The proteins were then transfer onto a PVDF membrane using a drive
transfer system:
Visualization of blots: On Day 1, block the membrane with 5% BSA for 1 hour at room
temperature. Prepare the primary antibody in 5% BSA and incubate the membrane with a 1:1000
dilution of the primary antibody in 5% milk overnight at 4°C. On Day 2, wash the membrane three
times with TBST for 5 minutes each. Then, incubate the membrane with a labeled secondary
antibody, diluted as recommended, in 5% BSA at room temperature for 1 hour. Following another

56
round of three 5-minute washes with TBST, proceed with signal development using an ECL-based
detection system. Mix the ECL peroxidase and substrate in a 1:1 ratio, drain excess TBST from
the membrane, and incubate it with the ECL reagent for 5 minutes at room temperature. After
draining the excess reagent, place the membrane between sheets of a sheet protector, remove any
bubbles, and detect the signal using a Chemidoc or iBright imager.
Antibodies used are eNOS, p-eNOS (), GAPDH mouse mcAb(ProteinTech 60004-1-Ig), Goat
Anti-Mouse IgG-HRP sc-2005(Santa Cruz Biotechnology IgG-HRP A2312), Goat pAB to Rb IgG
(HRP) (Abcam ab6721).

3.3. Result:
Confocal microscopy confirmed the distinct green fluorescence in cells expressing the human
Mas receptor, confirming the successful transduction and expression of the receptor in the CHO-
K1 cells. In the laboratory, we conducted lentiviral transduction of CHO-K1 cells using a
plasmid containing the human Mas receptor gene tagged with GFP and the neomycin gene for
selection. After transduction, the cells were cultured in 96-well plates, and single-cell sorting was
performed to ensure genetic homogeneity within each well. The selected single cells were
transferred to 48-well plates and expanded in the presence of 500ng/ml geneticin to maintain
selection.

The plasmid transduced into CHO-K1 cells carried the neomycin-resistant gene, allowing us to
use geneticin (G418) as a selection antibiotic (Figure 3.1.1). Clonal selection used geneticin
concentrations (250µg/ml, 500µg/ml, and 1000µg/ml) in both the transduced and compared to
wild-type untransduced CHO-K1 cells.(Figure 3.1.2). We found that 500µg/ml of geneticin

57
effectively selected the Mas overexpressing cell line, while all concentrations of geneticin
induced cell senescence and cell death.

GFP-expressing cells were further selected using fluorescence-assisted cell sorting (FACS) to
isolate only GFP positive cells from the transduced cell population. Despite the transient nature
of the CHO-K1 cell line transfected with the Mas receptor and GFP sequences, we attempted to
enrich the GFP-expressing cell population through FACS (Figure 3.1.3). Selected clones were
then expanded and stored in -80
o
C until used. When the clones were thawed, each clone was
subjected G418 selection.

In this study (Figure 3.1.4), we investigated the activation of Mas receptors in Mas-CHO-K1 cells
using various agonists, including Nor-Leu
3
Ang (1-7), ELP-conjugated Ang (1-7), and Ang (1-7),
at different concentrations for 30 minutes. Mas activation is thought to promote eNOS
phosphorylation. Western blot analysis was evaluate in comparison to GAPDH as a reference
control revealed that both ELP-Ang(1-7) and Ang (1-7) at 5nM concentration significantly
increased eNOS phosphorylation compared to the untreated group. Surprisingly, the activation of
Mas receptors could not be inhibited by A779, a Mas receptor antagonist, which might be due to
low GFP positive cell expression and A779's specificity for human Mas receptors rather than
CHO-K1 Mas receptors...

58
Chapter 4: In vitro validation of Construct of THP-1
4.1 Role of THP-1 in immune response
THP-1 cells are a monocytic cell line derived from a patient with acute monocytic leukemia. These
cells originate from the bone marrow and are an integral part of the innate immune response
system. Normally, they circulate in the blood and express receptors like TLR 4 on their cell
surfaces, which can be stimulated by Pathogen-Associated Molecular Patterns (PAMPs) or
Damage-Associated Molecular Patterns (DAMPs).

Monocytes have a short half-life of 1-2 days after production in the bone marrow and readily
differentiate into dendritic cells and macrophages when needed to mount an immune response.
They serve a dual role in maintaining homeostasis during cellular infiltration. Firstly, they initiate
a protective inflammatory response to phagocytose pathogens, generate Reactive Oxygen Species
(ROS) and Nitric Oxide (NO), and release inflammatory cytokines and interleukins. This helps in
clearing cellular debris and combating the invading pathogens (57)(58).

After the initial inflammatory response, monocytes also play a crucial role in tissue recovery,
remodeling, and repair through anti-inflammatory cytokines production. This allows for a balanced
immune response and helps in resolving inflammation while promoting tissue healing (57)(58).
Macrophages are a crucial part of the innate immune response system and can be found in various
tissues, such as microglial cells in the brain, Kupffer cells in the kidney, alveolar macrophages in
the lungs, and the lining of the retinal pigment epithelium (RPE) in the retina. Monocytes play a
role in providing extravascular spaces with macrophages as needed to initiate an immune response
(59). Macrophages possess Toll-like receptors on their surfaces, allowing them to "sample" the

59
external environment and respond accordingly with either an inflammatory or an anti-
inflammatory reaction. (61).

These macrophages exist in two major polarization states: M1 (inflammatory) and M2 (anti-
inflammatory), with an additional alternate state known as M0 or a switch-off state where
macrophages are in a homeostatic phase. The transition of THP-1 monocytes to M0 macrophage
was made using 5mM PMA (Phorbol-12-myristate-13-acetate), where the suspension cell line
becomes adherent within 48-72hours (about 3 days) of treatment.

M1 polarization occurs when macrophages are stimulated by bacterial lipopolysaccharides (LPS),
interferon-gamma (IFN-γ), or tumor necrosis factor-alpha (TNF-α). In this state, macrophages
actively release high levels of reactive oxygen species (ROS), nitric oxide (NO), and pro-
inflammatory cytokines like TNF-α and IL-6, which inhibit cell proliferation. On the other hand,
M2 polarization is triggered by substances like IL-4, IL-13, ornithine, and IL-10. In the M2 state,
macrophages secrete anti-inflammatory cytokines such as TGFβ, IL-10, CCL18, and CCL22, and
they play a role in phagocytosis and promoting angiogenesis and tissue repair. (59)(60)(61)During
inflammation, the first line of defense involves the proliferation of T cells and B cells to initiate
an immune response. Subsequently, macrophages locate themselves at the site of infection.
Interestingly, when pathogens stimulate an M1 response, there is an increase in Th1 (T helper
cells) response, further enhances the M1 response through inflammatory cytokines production.
Conversely, M2 macrophages promote the formation of Th2 cells and the secretion of IL-4, IL-10,
and TGFβ, which strengthen the M2 response. (60)(61)

60
Macrophages orchestrate the immune response with their polarization states determining whether
they mount an inflammatory or anti-inflammatory reaction.

Figure 4. 1. 1. The time course THP-1 PMA stimulation/Differentiation. The cells start adhering
over 72hours (about 3 days) time.

4.2 Expression of Mas receptors and Activation of Mas receptors using Mas receptor agonist on
THP-1 cells

Over the years, there has been exhausting evidence on the role of Mas receptors in eliciting anti-
inflammatory response and role of macrophages in eliciting an immune response. But there have
been very few studies which converge these ideas and talk about their interplay. One of the studies
explored the role of Mas receptor agonists on THP-1 cells in presence of LPS to emphasize the
anti-inflammatory activity of the Mas receptor agonists in reduction of IL-6 (inflammatory
interleukin) (59). We wanted to explore this newly established cross talk between Mas receptor
activation and macrophage polarization or shift from M1 to M0.
We expect to “switch off” the polarized macrophages and reduce the inflammatory cytokinin’s

61
like TNFa while increasing anti-inflammatory cytokinin like TGFb. Another Pathway that we
explored was AKT/PTEN.

4.2.1 Reverse transcriptase- Polymerase chain reaction
We used RT-PCR analysis to investigate changes in targeted genes of interest, such as PTEN,
AKT, and TNF-a. In a previous study using western blot, we observed an upregulation of Phospho-
AKT in CHO-K1 cells at the 30-minute timepoint.
To further elucidate the pathway by which the Mas receptor inhibits AKT and induces
upregulation, we designed an experiment with varying time points (5, 15, 30, and 60 minutes) and
increasing concentrations of ELP-Ang(1-7) (5nM, 50nM, 500nM) in the presence of 500ng/ml of
LPS.
Our findings revealed that at the 60-minute timepoint, the agonist downregulated PTEN while
concurrently upregulated AKT. Notably, the concentration of 500nM was particularly effective in
maintaining higher AKT levels at the 60-minute mark.
Additionally, in LPS-stimulated dTHP-1 cells, we observed no significant effect on TGF-b
expression across the evaluated time points. However, LPS did increase IL-10 expression, and the
addition of ELP-Ang(1-7) resulted in a marginal increase in IL-10 levels.

62

Figure 4. 2. 2. RT-PCR data for Elastin like polypeptide on 6 hours LPS stimulated THP-1 (M0)
macrophages for AKT and PTEN.

Figure 4. 2. 3. Comparative RT-PCR data for Elastin like polypeptide and NorLeu on 6 hours LPS
stimulated THP-1 (M0) macrophages for TNF-a

63

Figure 4. 2. 3. RT-PCR data for Elastin like polypeptide on 6 hours LPS stimulated THP-1 (M0)
macrophages for TGF-b and IL-10

Figure 4. 2. 4.. RT-PCR data for Elastin like polypeptide on 6hours LPS stimulated THP-1 (M0)
macrophages for Mas receptor.
Untreated
LPS
5
50
500
0
20
40
60
Concentration (nM)
Fold change compared
to Negative control
ELP 5mins Masr
Untreated
LPS
5
50
500
0
20
40
60
ELP 15mins Masr
Concentration (nM)
Fold change compared
to Negative control
Untreated
LPS
5
50
500
0
20
40
60
Concentration (nM)
Fold change compared
to Negative control
*30mins ELP Masr
Untreated
LPS
5
50
500
0
20
40
60
Concentration (nM)
Fold change compared
to Negative control
*60mins ELP Masr
Untreated
LPS
5
50
500
0
10
20
30
40
Concentration (nM)
Fold change compared
to Negative control
ELP 5mins IL10
Untreated
LPS
5
50
500
0
10
20
30
40
Concentration (nM)
Fold change compared
to Negative control
*30mins ELP IL10
Untreated
LPS
5
50
500
0
10
20
30
40
Concentration (nM)
Fold change compared
to Negative control
*60mins ELP IL10

64

4.2.2 Flow Cytometry:
We used differentiated macrophages stimulated with LPS through TLR4 which can induce
production of pro-inflammatory mediators. As a control, a group of macrophages remained
untreated and unstimulated with LPS. We investigated CD206, a mannose receptor known to be
expressed on activated macrophages, specifically termed as M2 macrophages. M2 macrophages
play a crucial role in the anti-inflammatory response, aiding in the resolution of excessive
inflammation. CD206 is responsible for essential functions such as endocytosis and phagocytosis,
and it contributes to immune homeostasis by acting as a scavenger for unwanted glycoproteins.
The exploration of CD206 in activated macrophages sheds light on its involvement in immune
regulatory processes and provides valuable insights into the anti-inflammatory mechanisms of M2
macrophages. In the figure below, we can see the transitioning of the ELP-Ang(1-7) attempting to
cross over from M1 to M0 macrophage.

4.2.2.1 Gating Strategy for Isolation of Macrophages:
Cells expressing different surface proteins can be identified and isolated using flow cytometry,
and this technique can be utilized to confidently analyze macrophages. To ensure the cells being
studied are indeed macrophages, a series of gating steps were employed. Initially, the cells were
gated based on the presence of CD45, a surface protein commonly found on leukocytes.
Subsequently, the gating was refined using CD11b, which is typically expressed on
Monocytes/Macrophages, Granulocytes, and Natural Killer cells. Finally, the analysis focused on
the presence of CD86 and CD206 (Mannose receptor), which are specific markers for M1 and M2
macrophages, respectively. M0 macrophages express both CD86 and CD206, hence cells found in
Quadrant 3 of the figure suggest a transition from M1 to M2 macrophages.

65

Figure 4. 2. 5. Gating strategy for isolation of Macrophages from the population. In the above
figure, A represents the population of live cells, B represents selection of Leukocytes from the
population, C represents isolation of Monocytes, Granulocytes and Natural killer cells and finally,
D represents the presence of cells in the second quadrant or Q2, suggesting the presence of
majority of cells in M0 phase.

A B
C D

66

4.2.2.2 Flow Cytometry based evaluation of M1 to M0 transition of Macrophages

Figure 4. 2. 6. Flow Cytometry analysis of dTHP-1 cells treated with ELP-Ang (1-7) with LPS for
30mins. The presence of mannose receptor or CD206, suggests the transitioning of cells from M1
to M0 macrophages. In the above figure, (Right) the LPS is suggested to drive the M1 phenotype
and Control is the M0 phenotype. The 500nM of ELP-Ang(1-7) suggests the transitioning of M1
macrophages to M0.

4.3. Materials and Methods

4.3.1. RT-PCR

On Day 1, the cells were cultured in RPMI media and subsequently differentiated using 100nM
phorbol 12-myristate 13-acetate (PMA) for 72 hours. On Day 2, the differentiated cells were
washed with PBS, and trypsin was added to detach the cells, followed by neutralization with cell
media (RPMI1640 + 10% FBS + 1% NEA). After centrifugation, the cells were resuspended in
media and seeded at 2 million cells per well of 6-well plates for 24 hours. At this point, the cells

67
reached approximately 70% confluency. The cells were serum-starved for 2 hours before being
stimulated with 500ng/ml of LPS for 6 hours. After LPS stimulation, the cells were treated with
Mas agonists for varying time intervals (0, 0.25, 0.5, and 1 hour). For cell harvesting, The cells
were treated with TRIzol for RNA isolation protocol and cDNA synthesis was performed using
the Revertaid kit protocol (Revertaid first strand cDNA synthesis kit, catalogue no: 2732124,
Thermo Scientific), resulting in the production of 3.5ug of cDNA. 30ng of cDNA was loaded with
6ul of Master mix included SYBR green Master mix (Powerup SYBR Green Master Mix,
catalogue no: 2741382, applied biosystems) and forward and reverse primer and RNAse free
water. The targets were confirmed using the following primers: 18S Forward
(AAACGGCTACCACATCCAAG, 18S Reverse (CAATTACAGGGCCTCGAAAG), Actin
Forward (CATGTACGTTGCTATCCAGGC), Actin Reverse
(CTCTTAATGTCACGCACGAT), Mas1 Forward (CTGCCGAAGCAGTCATCATCT), Mas1
Reverse (AGCTTGGAGGAATGGGAAGM), TGFB1 Forward
(TGGTGGAAACCCACAACGAA), TGFB1 Reverse (GAGCAACACGGGTTCAGGTA),
TNFa Forward (GCTGCACTTTGGAGTGATCG), and TNFa Reverse
(CTTGTCACTCGGGGTTCGAG)

4.3.1. Flow cytometry:

Cell Preparation: For cellular differentiation, cells were treated with 100nm PMA for 72 hours
(about 3 days). Prior to treatment, the cells were starved without FBS for 24 hours. Post-treatment,
the RPMI media was removed, and 500uL of trypsin was added per well, followed by swirling.
Cell detachment, if necessary, was achieved by gentle scraping and pipetting up and down to break
up clumps. Subsequently, the cells were transferred to flow cytometry tubes and diluted with 2ml

68
of staining buffer before centrifugation at 400×g for 5 minutes at 4˚C. After aspirating the
supernatant, the washing process was repeated. The cells were then fixed by adding 2ml of staining
buffer and centrifuging at 400×g for 5 minutes at 4˚C. Following the aspiration of the supernatant,
1 × 106 cells were resuspended in 100 µL of fixation buffer and incubated at room temperature for
15 minutes. An additional 2ml of staining buffer was added, and the cells were centrifiged once
more, finally, the cell concentration was adjusted to 1 x 106 cells per tube with 100µL pf PBS.
Anti-body staining: The samples were prepared as follows: unstained cells were pooled, and fully
stained cells were pooled for each sample. Prior to staining, the cell suspension was preincubated
with Human BD Fc Block™ purified anti-human CD16/CD32 monoclonal antibody (1 μg/million
cells in 100 μL) at 4°C for 5 minutes (2 mL). Compensation controls also received Fc block. The
antibody of interest was added directly to the preincubated cells along with Human BD Fc
Block™M (meaning that the Fc block did not need to be washed off before staining the cells). The
final antibody concentrations were set at 10 μg/mL, or 1 μg per 100 μL. The specific antibodies
used were CD45-PerCP/Cy5.5, CD-11b-PE, CD86-FITC, and CD206-APC, each at a
concentration of 0.2 mg/mL, with 5 μL used per sample. Next, the samples were incubated for 30
minutes at 4°C in the dark. Following incubation, the first wash was performed by adding 2 mL of
staining buffer, centrifuging the samples for 5 minutes at 400×g and 4°C, and then removing the
supernatant and vortexing the pellet. The pellet was subsequently resuspended in 2 mL of staining
buffer. A second wash was performed by repeating the centrifugation step. Finally, the cells were
resuspended in 400 μL of flow staining buffer and were ready for analysis on the flow cytometer.
4.4. Result:

In our study using dTHP-1 cells, we investigated the effects of ELP-Angiotensin (1-7) on various
cellular processes. We observed that the peptide had the ability to upregulate the Mas receptor

69
while simultaneously reducing the expression of the inflammatory cytokine TNF-a over a period
of 60 minutes. Additionally, we noticed a decrease in PTEN levels and a slight increase in AKT,
indicating an interaction between the peptide and its receptor (Figure 4.2.1)

Figure 4.2.1 and Figure 4.2.2 suggests the overexpression of the Mas receptor and an increase in
AKT and decrease in TNF-a expression led us to hypothesize that the ELP-Angiotensin (1-7)
peptide could promote an anti-inflammatory response, which was further supported by a slight
increase in TGF-B levels. To reinforce this hypothesis, in Figure 4.2.3 we utilized flow cytometry
data, which demonstrated that at 500nM and 30 minutes, in the presence of LPS
(lipopolysaccharide), the peptide could convert M1 macrophages to M0 macrophages.

Our study provides a preliminary understanding of the crosstalk between these pathways, leading
to a decrease in inflammation through the modulation of macrophages. We believe that this initial
investigation can serve as a foundation for further exploring the relationship between Mas receptor
upregulation, AKT increase, and their influence on macrophage transition. This research has the
potential to uncover novel insights into the regulation of inflammation and the potential therapeutic
applications of ELP-Angiotensin (1-7) in immune-related conditions.

70
Discussion
In this project, we aimed to understand the impact of Angiotensin (1-7) and the Mas
receptor axis in reducing inflammation caused by increased oxidative stress, like the rise in
inflammatory cytokines observed due to the domino effect of photoreceptor degradation in
Retinitis pigmentosa. To address the potential of Angiotensin (1-7) and the Mas receptor axis in
mitigating inflammation, we explored a novel formulation using Elastin Like Polypeptide (ELP)
tagged Angiotensin (1-7) as a sustained release peptide. We anticipated that this formulation could
slow down RPE degradation and the release of inflammatory cytokines. ELP, derived from human
tropoelastin, offers advantages of being non-immunogenic and biodegradable, making it suitable
for drug delivery. The ELP tagged Angiotensin (1-7) formulation is designed to be specific to the
site of action, potent, and capable of reducing the frequency of dosing. To create the ELP tagged
Angiotensin (1-7) sequence, we employed the recursive directional ligation method and confirmed
its physicochemical characteristics using various analytical techniques such as Sanger's sequence,
SDS PAGE, and MALDI. To explore the potency of ELP tagged angiotensin (1-7) we conducted
a study with treating CHO-K1 cells with increasing concentration of peptide.
In this study, a Chinese hamster ovary (CHO) cell line overexpressing the human Mas
receptor was developed to investigate the activation of Mas-mediated activities. The CHO-K1 cells
were transduced with a lentiviral construct containing the human Mas gene tagged with green
fluorescent protein (GFP) for visualization and a neomycin resistance gene for selection. Single-
cell sorting was employed to obtain individual clones of Mas-expressing cells to ensure genetic
homogeneity during experiments. Despite efforts to increase the population of Mas-
overexpressing cells using fluorescence-activated cell sorting (FACS), the CHO-K1 cell line was
found to be transient, with a tendency to lose the plasmid carrying the Mas receptor and GFP

71
sequences over time. Also, we tested the specificity of Angiotensin (1-7) for Mas receptors and
found to nonspecific leading to nonspecific binding of human Angiotensin (1-7) to hamster Mas
receptors.
Subsequently, the Mas-CHO-K1 cells were treated with various Mas receptor agonists,
including ELP-conjugated Angiotensin (1-7), Angiotensin (1-7), and Nor-Leu3, to assess their
effect on eNOS phosphorylation, indicative of Mas receptor activation. Interestingly, the activation
of Mas receptors could not be inhibited by A779, a Mas receptor antagonist, possibly due to the
low expression of GFP-positive cells and the specificity of A779 towards human Mas receptors
rather than Chinese hamster ovary Mas receptors. Although a significant increase in eNOS
phosphorylation was observed in response to ELP-conjugated Angiotensin (1-7) and Angiotensin
(1-7) treatment at a concentration of 500nM, there was no significant dose-dependent effect
observed in the treatment groups.
In our research, we aimed to investigate the role of Mas receptor agonists in dampening
inflammation by reducing macrophage aggregation and the release of inflammatory cytokines. As
we know, macrophages are an integral part of the innate immune system and become activated in
response to pathogen presentation. M1 macrophages promote aggregation, while M2 macrophages
facilitate healing and phagocytosis of pathogens.
In this study, we focused on understanding the interaction between Mas receptor activation
and macrophage polarization. To explore this, we transitioned THP-1 monocytes into M0
macrophages using 5mM PMA treatment, allowing us to examine the process of "switching off"
polarized macrophages to reduce the levels of inflammatory cytokines like TNF-a. Additionally,
we aimed to enhance the presence of the anti-inflammatory cytokine TGF-b by using Mas receptor
agonists such as ELP-conjugated Ang (1-7). Through this investigation, we sought to gain insights

72
into how Mas receptor activation influences macrophage behavior and its potential impact on
inflammatory responses.
THP-1 cells, derived from a patient with acute monocytic leukemia, play a vital role in the
innate immune response system. As monocytes, they express receptors like TLR 4, allowing them
to respond to various Pathogen-Associated Molecular Patterns (PAMPs) and Damage-Associated
Molecular Patterns (DAMPs). These cells have a short half-life and can differentiate into dendritic
cells and macrophages, adapting to the immune needs of the body. Monocytes initiate an
inflammatory response to combat pathogens by generating Reactive Oxygen Species (ROS), Nitric
Oxide (NO), and releasing inflammatory cytokines and interleukins. Once the initial inflammatory
phase is complete, they also contribute to tissue recovery and repair through the production of anti-
inflammatory cytokines, achieving a balanced immune response.
Macrophages, found in different tissues, can exist in various polarization states, including M1
(inflammatory), M2 (anti-inflammatory), and M0 (homeostatic). These polarization states
determine whether macrophages promote inflammation or facilitate tissue healing, making them
crucial orchestrators of the immune response. Additionally, the AKT/PTEN pathway was
investigated to downregulate AKT while upregulating PTEN, potentially impacting ROS and
oxidative stress levels.
RT-PCR analysis was conducted to examine specific genes of interest like PTEN, AKT,
and TNF-a, indicating that the agonist upregulated PTEN while downregulating AKT at the 30-
minute timepoint, with 500nM concentration particularly effective at maintaining lower AKT
levels than LPS at the 60-minute mark. In LPS-stimulated dTHP-1 cells, the study observed
increased IL-10 expression while no significant effect on TGF-b expression across evaluated time
points. The addition of ELP-Ang (1-7) resulted in a marginal increase in IL-10 levels.

73
Additionally, the peptide was found to upregulate Mas receptors at 15mins (reference Figure 4.2.1
and Figure 4.2.2)
Flow cytometric evaluation of dTHP-1 stimulated with LPS was able to transition to the
M1 phenotype via TLR4 binding. We showed that Mas agonism using either NLE or ELP-Ang(1-
7) was able to induce CD206, a mannose receptor, expression within 1 hour after treatment. This
suggest that Mas agonist can activated transition from M1 to M2 macrophages. In addition, the
cytokine profiles were consistent with those of M2 pro-resolving macrophages. In the Figure 4.2.6
this study show that ELP-Ang (1-7) can promote transitioning from M1 to M0 macrophage.
However, it is still not known whether with long observation time will these cells transition into
M2.
ELP-Ang (1-7) treatment can reduce Pten while increasing AKT expression 1 hr after
treatment, along with upregulating Mas receptors. No increase in TGF-b levels were seen over this
time horizon. Our focus is on exploring the relationship between Mas receptor upregulation and
the transition of M1 to M0 macrophages. To achieve this, we plan to conduct flow cytometry
analyses to identify the optimal concentration and time point for macrophage transitioning.
Our findings indicate that treating THP-1 cells with LPS increases oxidative stress and
leads to an elevation in Mas receptor expression. This suggests a potential need for an agonist to
activate the receptor, triggering the anti-inflammatory cascade and preventing cell apoptosis.
Interestingly, at 30 minutes, we observe a decrease in Mas receptor expression with an increase in
peptide concentration, suggesting a reverse agonist effect. This corresponds with a decrease in
TNF-a levels as the peptide concentration rises. Additionally, ELP-Ang (1-7) maintains steady
levels of TGF-b and IL-10 over 60 minutes, strengthening the case for the potency of the peptide.

74
Mas receptor activation plays a crucial role in reducing inflammation, leading to decreased
infiltration of macrophages and reduced release of anti-inflammatory cytokines. At 30 minutes,
the peptide demonstrates its ability to shift the cell population from M1 to M0 phenotype,
indicating its active and positive influence on this transition. These observations further support
the potential therapeutic value of ELP-Ang (1-7) in modulating inflammation and macrophage
behavior.
In conclusion, we were able to make an ELP-Ang(1-7) that was biologically similar to
NLE. In this manner, the ELP-Ang(1-7) has the ability to reduce inflammation. In addition, we
have preliminary suggesting that ELP-Ang(1-7) is able to promote macrophage polarization into
M2 phenotype. Future investigations will further elucidate its clinical implications and efficacy in
managing RP progression and preserving vision. Overall, these findings contribute to our
understanding of RP pathogenesis and pave the way for innovative approaches to address this
debilitating condition.
.

75
Future Prospects

1. Our immediate future direction involves validating the RTPCR results with the western
blot data. Additionally, we will replicate the RTPCR to draw statistical conclusions
regarding the timepoints and concentration of the peptide.
2. ELP-Ang (1-7) facilitates the transition from M1 to M0 macrophages. Considering the
classification of macrophages as M1 (inflammatory), M0 (Neutral), and M2 (anti-
inflammatory), our next step involves observing the transition from M1 to M0 or M2
over 60 minutes to 24 hours. This will help ascertain the sustained release activity of
ELP-Ang(1-7).
3. The downregulation of TLR 4 can be achieved using a mas receptor agonist. Previous
studies have shown that Ang(1-7) can downregulate the overexpression of TLR 4
receptor in the presence of LPS. In our future prospects, we aim to observe the
downregulation of TLR 4 receptors during incubation with ELP-Ang(1-7) across various
timepoints (60 mins to 24 hours) to validate the sustained release activity of ELP-Ang(1-
7) (62)
4. We will conduct intra-ocular pharmacokinetic studies to test ELP-Ang(1-7) peptide
coacervation by injecting it into the pigs' vitreous fluid incubated at 37˚C. This study will
help determine the release kinetics of the drug.
5. Determination of the soluble V192-A concentration in equilibrium with ELP
coacervates.
.

76
References:

1. Pradeep T, Mehra D, Le PH. Histology, Eye. [Updated 2023 May 1]. In: StatPearls
[Internet]. Treasure Island (FL): StatPearls Publishing; 2023 J an-. Available from:
https://www.ncbi.nlm.nih.gov/books/NBK544343/#

2. Sridhar, M. S. (2018, February). Anatomy of cornea and ocular surface. Indian journal of
ophthalmology.
https://www.ncbi.nlm.nih.gov/pmc/articles/PMC5819093/#:~:text=The%20corneal%20la
yers%20include%20epithelium,2%5D.

3. Pradeep T, Mehra D, Le PH. Histology, Eye. [Updated 2023 May 1]. In: StatPearls
[Internet]. Treasure Island (FL): StatPearls Publishing; 2023 Jan-. Available from:
https://www.ncbi.nlm.nih.gov/books/NBK544343/#

4. Gao, Y., Qi, Y., Huang, Y., Li, X., Zhou, L., & Zhao, S. (2021, September 24).
Lipidomics analysis of the tears in the patients receiving LASIK, FS-LASIK, or SBK
surgery. Frontiers. https://www.frontiersin.org/articles/10.3389/fmed.2021.731462/full

5. Kari B. Green-Church, Igor Butovich, Mark Willcox, Douglas Borchman, Friedrich
Paulsen, Stefano Barabino, Ben J. Glasgow; The International Workshop on Meibomian
Gland Dysfunction: Report of the Subcommittee on Tear Film Lipids and Lipid–Protein
Interactions in Health and Disease. Invest. Ophthalmol. Vis. Sci. 2011;52(4):1979-1993.
doi: https://doi.org/10.1167/iovs.10-6997d.

6. Fogt JS, Fogt N, King-Smith PE, Liu H, Barr JT. Changes in Tear Lipid Layer Thickness
and Symptoms Following the Use of Artificial Tears with and Without Omega-3 Fatty
Acids: A Randomized, Double-Masked, Crossover Study. Clin Ophthalmol.
2019;13:2553-2561https://doi.org/10.2147/OPTH.S228261

7. Butovich, Igor A., et al. “Human Tear Film and Meibum. Very Long Chain Wax Esters
and (O-Acyl)-Omega-Hydroxy Fatty Acids of Meibum.” Journal of Lipid Research, vol.
50, no. 12, Dec. 2009, pp. 2471–85. DOI.org (Crossref),
https://doi.org/10.1194/jlr.M900252-JLR200.

8. Pradeep T, Mehra D, Le PH. Histology, Eye. [Updated 2023 May 1]. In: StatPearls
[Internet]. Treasure Island (FL): StatPearls Publishing; 2023 Jan-. Available from:
https://www.ncbi.nlm.nih.gov/books/NBK544343/#

9. Bales TR, Lopez MJ, Clark J. Embryology, Eye. [Updated 2023 Mar 27]. In: StatPearls
[Internet]. Treasure Island (FL): StatPearls Publishing; 2023 Jan-. Available from:
https://www.ncbi.nlm.nih.gov/books/NBK538480/

10. Hejtmancik JF, Shiels A. Overview of the Lens. Prog Mol Biol Transl Sci. 2015;134:119-
27. doi: 10.1016/bs.pmbts.2015.04.006. Epub 2015 May 27. PMID: 26310153; PMCID:
PMC5656279.

77

11. Mahabadi N, Al Khalili Y. Neuroanatomy, Retina. [Updated 2022 Aug 8]. In: StatPearls
[Internet]. Treasure Island (FL): StatPearls Publishing; 2023 Jan-. Available from:
https://www.ncbi.nlm.nih.gov/books/NBK545310/

12. Cheng RW, Yusof F, Tsui E, Jong M, Duffin J, Flanagan JG, Fisher JA, Hudson C.
Relationship between retinal blood flow and arterial oxygen. J Physiol. 2016 Feb
1;594(3):625-40. doi: 10.1113/JP271182. Epub 2015 Dec 30. PMID: 26607393; PMCID:
PMC5341714.

13. Kiel JW. The Ocular Circulation. San Rafael (CA): Morgan & Claypool Life Sciences;
2010. Chapter 2, Anatomy. Available from:
https://www.ncbi.nlm.nih.gov/books/NBK53329/#

14. Purves D, Augustine GJ, Fitzpatrick D, et al., editors. Neuroscience. 2nd edition.
Sunderland (MA): Sinauer Associates; 2001. The Retina.Available from:
https://www.ncbi.nlm.nih.gov/books/NBK10885/

15. Hussey KA, Hadyniak SE, Johnston RJ Jr. Patterning and Development of Photoreceptors
in the Human Retina. Front Cell Dev Biol. 2022 Apr 14;10:878350. doi:
10.3389/fcell.2022.878350. PMID: 35493094; PMCID: PMC9049932.

16. O'Neal TB, Luther EE. Retinitis Pigmentosa. [Updated 2023 Feb 19]. In: StatPearls
[Internet]. Treasure Island (FL): StatPearls Publishing; 2023 Jan-. Available from:
https://www.ncbi.nlm.nih.gov/books/NBK519518/

17. Lu BW, Chao GJ, Wu GP, Xie LK. In depth understanding of retinitis pigmentosa
pathogenesis through optical coherence tomography angiography analysis: a narrative
review. Int J Ophthalmol. 2021 Dec 18;14(12):1979-1985. doi: 10.18240/ijo.2021.12.25.
PMID: 34926217; PMCID: PMC8640759.

18. Samuel G. Jacobson, Alejandro J. Roman, ToMas S. Aleman, Alexander
Sumaroka, Waldo Herrera, Elizabeth A. M. Windsor, Lori A. Atkinson, Sharon B.
Schwartz, Janet D. Steinberg, Artur V. Cideciyan; Normal Central Retinal Function and
Structure Preserved in Retinitis Pigmentosa. Invest. Ophthalmol. Vis.
Sci. 2010;51(2):1079-1085. doi: https://doi.org/10.1167/iovs.09-4372.

19. Hamel C. Retinitis pigmentosa. Orphanet J Rare Dis. 2006 Oct 11;1:40. doi: 10.1186/1750-
1172-1-40. PMID: 17032466; PMCID: PMC1621055.

20. Chivers M, Li N, Pan F, Wieffer H, Slowik R, Leartsakulpanitch J. The Burden of X-
Linked Retinitis Pigmentosa on Patients and Society: A Narrative Literature Review.
Clinicoecon Outcomes Res. 2021 Jun 23;13:565-572. doi: 10.2147/CEOR.S297287.
PMID: 34188501; PMCID: PMC8236258.

78
21. Marina França Dias, Kwangsic Joo, Jessica A. Kemp, Silvia Ligório Fialho, Armando da
Silva Cunha, Se Joon Woo, Young Jik Kwon, Molecular genetics and emerging therapies
for retinitis pigmentosa: Basic research and clinical perspectives, Progress in Retinal and
Eye Research, Volume 63, 2018, Pages 107-131, ISSN 1350-9462,
https://doi.org/10.1016/j.preteyeres.2017.10.004.

22. Milkovic L, Cipak Gasparovic A, Cindric M, Mouthuy PA, Zarkovic N. Short Overview
of ROS as Cell Function Regulators and Their Implications in Therapy Concepts. Cells.
2019 Jul 30;8(8):793. doi: 10.3390/cells8080793. PMID: 31366062; PMCID:
PMC6721558.

23. Bassoy EY, Walch M, Martinvalet D. Reactive Oxygen Species: Do They Play a Role in
Adaptive Immunity? Front Immunol. 2021 Nov 22;12:755856. doi:
10.3389/fimmu.2021.755856. PMID: 34899706; PMCID: PMC8653250.

24. Nita M, Grzybowski A. The Role of the Reactive Oxygen Species and Oxidative Stress in
the Pathomechanism of the Age-Related Ocular Diseases and Other Pathologies of the
Anterior and Posterior Eye Segments in Adults. Oxid Med Cell Longev.
2016;2016:3164734. doi: 10.1155/2016/3164734. Epub 2016 Jan 10. PMID: 26881021;
PMCID: PMC4736974.

25. Hebbar S, Knust E. Reactive oxygen species (ROS) constitute an additional player in
regulating epithelial development. BioEssays. 2021;43(8). doi:10.1002/bies.202100096

26. Shu DY, Chaudhary S, Cho K-S, Lennikov A, Miller WP, Thorn DC, Yang M, McKay
TB. Role of Oxidative Stress in Ocular Diseases: A Balancing Act. Metabolites. 2023;
13(2):187. https://doi.org/10.3390/metabo13020187

27. Görlach A, Bertram K, Hudecova S, Krizanova O. Calcium and ROS: A mutual interplay.
Redox Biol. 2015 Dec;6:260-271. doi: 10.1016/j.redox.2015.08.010. Epub 2015 Aug 11.
PMID: 26296072; PMCID: PMC4556774.

28. Görlach A, Bertram K, Hudecova S, Krizanova O. Calcium and ROS: A mutual interplay.
Redox Biol. 2015 Dec;6:260-271. doi: 10.1016/j.redox.2015.08.010. Epub 2015 Aug 11.
PMID: 26296072; PMCID: PMC4556774.

29. Bedard K, Krause KH. The NOX Family of ROS-Generating NADPH Oxidases:
Physiology and Pathophysiology. Physiological Reviews. 2007;87(1):245-313.
doi:10.1152/physrev.00044.2005

30. Santana-Garrido Á, Reyes-Goya C, Fernández-Bobadilla C, Blanca AJ, André H, Mate A,
Vázquez CM. NADPH oxidase-induced oxidative stress in the eyes of hypertensive rats.
Mol Vis. 2021 Apr 2;27:161-178. PMID: 33907371; PMCID: PMC8056463.
31. Singel KL, Segal BH. NOX2-dependent regulation of inflammation. Clin Sci (Lond). 2016
Apr 1;130(7):479-90. doi: 10.1042/CS20150660. PMID: 26888560; PMCID:
PMC5513728.

79

32. Landmesser U, Dikalov S, Price SR, et al. Oxidation of tetrahydrobiopterin leads to
uncoupling of endothelial cell nitric oxide synthase in hypertension. The Journal of clinical
investigation. 2003;111(8):1201-1209. doi:10.1172/JCI200314172

33. Drummond GR, Sobey CG. Endothelial NADPH oxidases: which NOX to target in
vascular disease? Trends in endocrinology and metabolism. 2014;25(9):452-463.
doi:10.1016/j.tem.2014.06.012

34. Babizhayev MA. Generation of reactive oxygen species in the anterior eye segment.
Synergistic codrugs of N-acetylcarnosine lubricant eye drops and mitochondria-targeted
antioxidant act as a powerful therapeutic platform for the treatment of cataracts and primary
open-angle glaucoma. BBA Clin. 2016 Apr 19;6:49-68. doi: 10.1016/j.bbacli.2016.04.004.
PMID: 27413694; PMCID: PMC4925929.

35. Liu W, Liu S, Li P, Yao K. Retinitis Pigmentosa: Progress in Molecular Pathology and
Biotherapeutical Strategies. Int J Mol Sci. 2022 Apr 28;23(9):4883. doi:
10.3390/ijms23094883. PMID: 35563274; PMCID: PMC9101511.

36. Kaur G, Singh NK. The Role of Inflammation in Retinal Neurodegeneration and
Degenerative Diseases. Int J Mol Sci. 2021 Dec 30;23(1):386. doi: 10.3390/ijms23010386.
PMID: 35008812; PMCID: PMC8745623.

37. Hayden MS, Ghosh S. Regulation of NF-κB by TNF family cytokines. Semin Immunol.
2014 Jun;26(3):253-66. doi: 10.1016/j.smim.2014.05.004. Epub 2014 Jun 21. PMID:
24958609; PMCID: PMC4156877.

38. Zhao L, Hou C, Yan N. Neuroinflammation in retinitis pigmentosa: Therapies targeting the
innate immune system. Front Immunol. 2022 Oct 27;13:1059947. doi:
10.3389/fimmu.2022.1059947. PMID: 36389729; PMCID: PMC9647059.

39. Olivares-González L, Velasco S, Campillo I, Rodrigo R. Retinal Inflammation, Cell Death
and Inherited Retinal Dystrophies. International Journal of Molecular Sciences. 2021;
22(4):2096. https://doi.org/10.3390/ijms22042096

40. Fountain JH, Kaur J, Lappin SL. Physiology, Renin Angiotensin System. [Updated 2023
Mar 12]. In: StatPearls [Internet]. Treasure Island (FL): StatPearls Publishing; 2023 Jan-.
Available from: https://www.ncbi.nlm.nih.gov/books/NBK470410/
41. Vargas Vargas RA, Varela Millán JM, Fajardo Bonilla E. Renin-angiotensin system: Basic
and clinical aspects-A general perspective. Endocrinol Diabetes Nutr. 2022 Jan;69(1):52-
62. doi: 10.1016/j.endinu.2021.05.012. Epub 2021 Oct 26. PMID: 34723133; PMCID:
PMC8547789.
42. Kaplan AP, Joseph K, Silverberg M. Pathways for bradykinin formation and inflammatory
disease. Journal of allergy and clinical immunology. 2002;109(2):195-209.
doi:10.1067/mai.2002.121316

80

43. Yang S, Zhou J, Li D. Functions and Diseases of the Retinal Pigment Epithelium. Front
Pharmacol. 2021 Jul 28;12:727870. doi: 10.3389/fphar.2021.727870. PMID: 34393803;
PMCID: PMC8355697.

44. Patricia M. D’Cruz and others, Mutation of the receptor tyrosine kinase gene Mertk in the
retinal dystrophic RCS rat, Human Molecular Genetics, Volume 9, Issue 4, 1 March 2000,
Pages 645–651, https://doi.org/10.1093/hmg/9.4.645

45. Vollrath, Douglas, Wei Feng, Jacque L. Duncan, Douglas Yasumura, Patricia M. D’Cruz,
Aimee Chappelow, Michael T. Matthes, Mark A. Kay, and Matthew M. LaVail.
“Correction of the Retinal Dystrophy Phenotype of the RCS Rat by Viral Gene Transfer of
Mertk.” Proceedings of the National Academy of Sciences 98, no. 22 (October 23, 2001):
12584–89. https://doi.org/10.1073/pnas.221364198.

46. Strauss, O., F. Stumpff, S. Mergler, M. Wienrich, and M. Wiederholt. “The Royal College
of Surgeons Rat: An Animal Model for Inherited Retinal Degeneration with a Still
Unknown Genetic Defect.” Cells Tissues Organs 162, no. 2–3 (1998): 101–11.
https://doi.org/10.1159/000046474.

47. Wang, Sean K., Yunlu Xue, Parimal Rana, Christin M. Hong, and Constance L. Cepko.
“Soluble CX3CL1 Gene Therapy Improves Cone Survival and Function in Mouse Models
of Retinitis Pigmentosa.” Proceedings of the National Academy of Sciences 116, no. 20
(May 14, 2019): 10140–49. https://doi.org/10.1073/pnas.1901787116.

48. Hashizume K, Hirasawa M, Imamura Y, Noda S, Shimizu T, Shinoda K, Kurihara T, Noda
K, Ozawa Y, Ishida S, Miyake Y, Shirasawa T, Tsubota K. Retinal dysfunction and
progressive retinal cell death in SOD1-deficient mice. Am J Pathol. 2008
May;172(5):1325-31. doi: 10.2353/ajpath.2008.070730. Epub 2008 Mar 27. PMID:
18372426; PMCID: PMC2329841.

49. Mordwinkin NM, Meeks CJ, Jadhav SS, Espinoza T, Roda N, diZerega GS, Louie SG,
Rodgers KE. Angiotensin-(1-7) administration reduces oxidative stress in diabetic bone
marrow. Endocrinology. 2012 May;153(5):2189-97. doi: 10.1210/en.2011-2031. Epub
2012 Mar 20. PMID: 22434085; PMCID: PMC3339643.

50. Rabelo, L., Alenina, N. & Bader, M. ACE2–angiotensin-(1–7)–Mas axis and oxidative
stress in cardiovascular disease. Hypertens Res 34, 154–160 (2011).
https://doi.org/10.1038/hr.2010.235

51. Despanie J, Dhandhukia JP, Hamm-Alvarez SF, MacKay JA. Elastin-like polypeptides:
Therapeutic applications for an emerging class of nanomedicines. J Control Release. 2016
Oct 28;240:93-108. doi: 10.1016/j.jconrel.2015.11.010. Epub 2015 Nov 11. PMID:
26578439; PMCID: PMC5767577.

81
52. Strien, Jolinde van, Oscar Escalona-Rayo, Wim Jiskoot, Bram Slütter, and Alexander Kros.
“Elastin-like Polypeptide-Based Micelles as a Promising Platform in Nanomedicine.”
Journal of Controlled Release 353 (January 1, 2023): 713–26.
https://doi.org/10.1016/j.jconrel.2022.12.033.

53. Gomes, Alicia, and Bruce Korf. “Chapter 5 - Genetic Testing Techniques.” In Pediatric
Cancer Genetics, edited by Nathaniel H. Robin and Meagan B. Farmer, 47–64. Elsevier,
2018. https://doi.org/10.1016/B978-0-323-48555-5.00005-3.

54. Vernet, G. “18 - Genomics of Infectious Diseases and Private Industry.” In Genetics and
Evolution of Infectious Diseases (Second Edition), edited by Michel Tibayrenc, 421–34.
London: Elsevier, 2017. https://doi.org/10.1016/B978-0-12-799942-5.00018-4.

55. Comprehensive biotechnology. ScienceDirect. (n.d.).
https://www.sciencedirect.com/referencework/9780080885049/comprehensive-
biotechnology

56. Kats, Jorge P. van, Larissa M. de Lannoy, A. H. Jan Danser, Jan R. van Meegen, Pieter D.
Verdouw, and Maarten A. D. H. Schalekamp. “Angiotensin II Type 1 (AT1) Receptor–
Mediated Accumulation of Angiotensin II in Tissues and Its Intracellular Half-Life In
Vivo.” Hypertension 30, no. 1 (July 1, 1997): 42–49.
https://doi.org/10.1161/01.HYP.30.1.42.

57. Yang J, Zhang L, Yu C, Yang XF, Wang H. Monocyte and macrophage differentiation:
circulation inflammatory monocyte as biomarker for inflammatory diseases. Biomark Res.
2014 Jan 7;2(1):1. doi: 10.1186/2050-7771-2-1. PMID: 24398220; PMCID:
PMC3892095.

58. Italiani, Paola, and Diana Boraschi. “From Monocytes to M1/M2 Macrophages:
Phenotypical vs. Functional Differentiation.” Frontiers in Immunology 5 (2014).
https://www.frontiersin.org/articles/10.3389/fimmu.2014.00514.

59. Cutolo, Maurizio, Rosanna Campitiello, Emanuele Gotelli, and Stefano Soldano. “The
Role of M1/M2 Macrophage Polarization in Rheumatoid Arthritis Synovitis.” Frontiers in
Immunology 13 (2022). https://www.frontiersin.org/articles/10.3389/fimmu.2022.867260.
60. Genin, M., Clement, F., Fattaccioli, A. et al. M1 and M2 macrophages derived from THP-
1 cells differentially modulate the response of cancer cells to etoposide. BMC Cancer 15,
577 (2015). https://doi.org/10.1186/s12885-015-1546-9

61. Mills CD. M1 and M2 Macrophages: Oracles of Health and Disease. Crit Rev Immunol.
2012;32(6):463-88. doi: 10.1615/critrevimmunol.v32.i6.10. PMID: 23428224.

62. Jiang M, Huang W, Wang Z, Ren F, Luo L, Zhou J, Yan R, Xia N, Tang L. Anti-
inflammatory effects of Ang-(1-7) via TLR4-mediated inhibition of the JNK/FoxO1
pathway in lipopolysaccharide-stimulated RAW264.7 cells. Dev Comp Immunol.

82
2019 Mar;92:291-298. doi: 10.1016/j.dci.2018.11.009. Epub 2018 Nov 17. PMID:
30458182.

Abstract (if available)

Abstract Retinitis pigmentosa (RP) is a genetic linked retinal disease estimated to affect between 20-25 million people worldwide. Currently, more than 60 distinct genes have been associated with RP. Despite genetic variance, a common molecular underpinning of RP-related mutations is the presence of oxidative stress and chronic inflammation. In Royal College of Surgeon’s (RCS) rats, retinal degeneration corresponds increase Mas retinal expression, a component of the “Protective Arm” of the renin angiotensin system (RAS). Angiotensin (1-7) (Ang (1-7)), is the natural ligand for Mas that is able to promote nitric oxide synthase and superoxide dismutase (SOD) expression.
To exploit the increased in Mas expression, we developed an Elastin-like polypeptides (ELPs)-Ang (1-7) conjugate, derived from human tropoelastin. ELP can phase separate into a depot at physiological temperatures; furthermore, increases the intravitreal mean residence time by an order of magnitude as compared to a free. Using recombinant technology and recursive directional ligation, the protein sequence MG(VPGVG)192 was conjugated onto Ang(1-7) allowing for free carboxyl terminus while retaining temperature-dependent phase separation after fusion. This fusion protein was expressed at 50 mg/ L in bacterial culture that produced a single band at the expected MW (79899 Da). The biological activity of the modified ELP-Ang(1-7) was validated using Mas-CHO-K1 and differentiated THP-1 (dTHP-1) monocytic leukemia cell lines to determine the relative phosphorylation of downstream substrates such Akt, PTEN and down-regulation of TNF-a and compared with Ang (1-7) and NorLeu3Ang (1-7). This approach is able to prolong release of Ang (1-7) over a period of a month

Linked assets

University of Southern California Dissertations and Theses

Conceptually similar

PDF

Methods and protocols for detecting the intracellular assembly of elastin-like polypeptides

PDF

Sustained and targeted delivery of rapamycin using FKBP-elastin like polypeptide fusion proteins

PDF

Inclusion body purification of elastin-like-polypeptide fusion proteins with a low transition temperature

PDF

Stable cell lines expressing elastin-like polypeptide fusions with epidermal growth factor receptor modulate gene expression in a heat dependent manner

PDF

Characterization of IL-1β secretion by fusing elastin-like polypeptides to pro-caspase-1

PDF

The peptide angiotensin-(1-7) as a novel treatment for complications induced by type 2 diabetes mellitus

PDF

Temperature-mediated induction of caveolin-mediated endocytosis via elastin-like polypeptides

PDF

Comparing drug release kinetics of rapamycin bound FKBP-ELP fusion proteins

PDF

The modulation of dynamin and receptor endocytosis machinery using elastin-like polypeptides

PDF

Flipping the switch on protein activity activity: elastin-like polypeptides assemble into cell switches and vesicles

PDF

Antibodies and elastin-like polypeptides: cellular and biophysical characterization of an anti-ELP monoclonal and an anti-CD3 single-chain-ELP fusion

PDF

Modulation of the renin-angiotensin system (RAS) for the treatment of COVID-19

PDF

Characterization of actin based motility in mammalian cells through LIM and SH3 domain protein 1 (LASP1) and elastin like polypeptide (ELP) fusion protein

PDF

RPE secretome for the treatment of retinal degeneration in the RCS rat

PDF

Laser induced modulation of ocular renin-angiotensin system for treatment of dry age-related macular degeneration

PDF

Project 1: Elastin-like polypeptide stabilizes recombinant cyclophilin into a nanoparticle; Project 2: Encapsulation of Rhesus theta defensin-1 (RTD-1) in PEG-PLGA nanoparticles for aerosol deliv...

Asset Metadata

Creator Naik, Aditya Anil (author)

Core Title Elastin like polypeptide tagged angiotensin (1-7) is a potential effective treatment for retinitis pigmentosa

School School of Pharmacy

Degree Master of Science

Degree Program Pharmaceutical Sciences

Degree Conferral Date 2023-08

Publication Date 08/08/2023

Defense Date 08/08/2023

Publisher University of Southern California. Libraries (digital)

Tag angiotensin,angiotensin (1-7),elastin like polypeptide,endothelial nitric oxide synthase,Inflammation,macrophages,OAI-PMH Harvest,oxidative stress,retinitis pigmentosa

Language English

Contributor Electronically uploaded by the author (provenance)

Advisor Louie, Stan (committee chair), Haworth, Ian (committee member), Mackay, Andrew (committee member)

Creator Email aanaik@usc.edu,naik.aditya96@gmail.com

Permanent Link (DOI) https://doi.org/10.25549/usctheses-oUC113296678

Unique identifier UC113296678

Identifier etd-NaikAditya-12212.pdf (filename)

Legacy Identifier etd-NaikAditya-12212

Document Type Thesis

Rights Naik, Aditya Anil

Internet Media Type application/pdf

Type texts

Source 20230808-usctheses-batch-1080 (batch), University of Southern California (contributing entity), University of Southern California Dissertations and Theses (collection)

Access Conditions The author retains rights to his/her dissertation, thesis or other graduate work according to U.S. copyright law. Electronic access is being provided by the USC Libraries in agreement with the author, as the original true and official version of the work, but does not grant the reader permission to use the work if the desired use is covered by copyright. It is the author, as rights holder, who must provide use permission if such use is covered by copyright. The original signature page accompanying the original submission of the work to the USC Libraries is retained by the USC Libraries and a copy of it may be obtained by authorized requesters contacting the repository e-mail address given.

Repository Name University of Southern California Digital Library

Repository Location USC Digital Library, University of Southern California, University Park Campus, Los Angeles, California 90089, USA

Repository Email cisadmin@lib.usc.edu