University of Southern California Dissertations and Theses

The interaction of SARS-CoV-2 with CD1d/NKT antigen presentation pathway

(USC Thesis Other)

The interaction of SARS-CoV-2 with CD1d/NKT antigen presentation pathway

PDF

Download

Open document

Flip pages

Download a page range

Download transcript

Copy asset link

Request this asset

Transcript (if available)

Content The Interaction of SARS-CoV-2 with CD1d/NKT Antigen Presentation Pathway

By
Xiangxue Deng
A Thesis Presented to the
FACULTY OF THE USC KECK SCHOOL OF MEDICINE
UNIVERSITY OF SOUTHERN CALIFORNIA

In Partial Fulfillment of the
Requirements for the Degree

MASTER OF SCIENCE

MOLECULAR MICROBIOLOGY AND IMMUNOLOGY
August 2023

i

Acknowledgments

I would like to take this opportunity to extend my deepest gratitude to all those who
have provided support and guidance throughout my two-year graduate study at the
University of Southern California.
Foremost, I am immensely grateful to Dr. Weiming Yuan, whose mentorship and
support have been invaluable to my Master’s study and research. His generosity,
patience, and enthusiasm have not only inspired me to excel as a researcher but
have also shaped my personal development.
I also extend my sincere thanks to my thesis committee members, Dr. Pinghui Feng
and Dr. Stanley Tahara, for their insightful feedback, encouragement, and guidance.
Their expertise has significantly contributed to the quality of this work.
I am also indebted to my colleagues in Dr. Weiming Yuan’s Lab; Siyang Chen,
Hongjia Lu, Zhewei Liu, Ramya Parandaman, Xiaoting Ren, Yi Wang and Lingxi Qiu,
whose assistance and support were crucial in various stages of this research.
Additionally, I am profoundly grateful to Changsheng Xing, Lei Tian, Qin Chao, and
Jill Henley from other labs. Their readiness to help and their backing were vital to the
successful completion of my project.
Moreover, I would like to express my appreciation to the Department of Molecular
Microbiology and Immunology for providing me with this remarkable opportunity and
program. In closing, my sincere thanks to all who contributed, either directly or
indirectly, to the successful completion of this thesis. Your support has been a beacon
of light guiding me through this academic endeavor.

ii

Table of Contents
Acknowledgments i
List of Figures iv
Abbreviations vi
Abstract vii
Chapter One: Introduction
1. COVID-19 pandemic and SARS-CoV-2
1
2. Structure proteins of SARS-CoV-2
1
3. The transmembrane domain of SARS-CoV-2 E proteins
3
4. NKT cells and CD1d presentation pathway
5

Chapter Two: Materials and Methods
1. Cell lines and plasmids
8
2. Antibodies and inhibitors
8
3. Transient Transfection
9
4. Cell Lysis and Immunoprecipitation Assay
10
5. Western Blotting
11
6. Flow Cytometry Analysis
12
7. Immunofluorescence Assay
13
8. Viruses
14
9. Mouse strains and in vivo SARS-CoV-2 infection
14
10. Primer Table
15

iii
11. Plasmid Sequences
17

Chapter Three: Results
1. The transmembrane domain of the SARS-CoV-2 envelope protein can lead to
the downregulation of CD1d in antigen-presenting
18
2. Relationship between the transmembrane domain of SARS-CoV-2 envelope.
protein and CD1d expression
20
3. Impact of the crucial amino acids at the C-terminal of the TM on CD1d.
expression.
21
4. Exploring mechanisms of SARS-CoV-2 E protein-induced CD1d
downregulation and the potential ameliorating Effects of Amantadine and HMA.
23
5. Impact of Proteasomal and Lysosomal Inhibition on SARS-CoV-2 E
Protein-Mediated CD1d Degradation
24
6. Activation of NKT can overcomes SARS-CoV-2 evasion of NKT cell function
and as a potential antiviral intervention against SARS-CoV-2 Infection
25
7. Stage-specific activation and inhibition of NKT cells at different stages of
SARS-CoV-2 infection cause altered disease progression
26
8. Role of NKT cells and potential therapeutic interventions in mouse-adapted
SARS-CoV-2 models
27

Chapter Four: Discussion 29

References 32

Figures 38

iv

List of Figures

Figure 1. Transmembrane domain in the envelope protein downregulates the
expression of CD1d on the surface of APC, while regions containing 21
amino acids in transmembrane regions restore the effect.
38
Figure 2. Specific amino acid sequences in the transmembrane domain effectively
counteract the downregulation effect of CD1d by the envelope protein.
39
Figure 3. SARS-CoV-2 envelope protein and mutation localization in the cells.
40
Figure 4. The downregulation effect of the transmembrane domain on CD1d is
diminished by the decreasing of crucial amino acids in the c terminals of
TM. 41
Figure 5. The downregulation of CD1d mediated by the envelope protein requires ion
channel activity. 42
Figure 6. Envelope protein instigates the degradation of the CD1d protein, utilizing a
process that is reliant on both proteasomes and lysosomes
43
Figure 7. Stimulating NKT cells reduces the inhibitory effects of SARS-CoV-2,
leading to less. severe illness and increased survival rates in mice.
44
Figure 8. Activation of NKT cells post-infection alleviated the severity of the disease
and enhanced the survival rate in mice.
45
Figure 9. Restricting NKT cells in the initial stage of infection in mice amplifies the
severity. 46
Figure 10. Restricting NKT cells in the advanced phase of infection lessens the
disease's severity.

v
47
Figure 11. iNKT cells are vital in producing optimal immune reactions to combat.
infection. 48

vi

Abbreviations

AA: Amino Acid
APC: Antigen-presenting Cell
ARDS: Acute Respiratory Distress Syndrome
β2m: Beta 2-Microglobulin
BSA: Bovine Serum Albumin
CD1d: Cluster of Differentiation 1 (Class D)
COVID: Coronavirus Disease
DMEM: Dulbecco's Modified Eagle Medium
FACS: Fluorescence-Activated Cell Sorting
GalCer: Galactosylceramide
HIV: Human Immunodeficiency Virus
HMA: Heavy Metal Associated
HSV: Herpes Simplex Virus
IgG: Immunoglobulin G
iNKT: Invariant Natural Killer T
MAPK: Mitogen-Activated Protein Kinase
MERS: Middle East Respiratory Syndrome
NK: Natural Killer
NKT: Natural Killer T
ORF: Open reading frame
PAGE: Polyacrylamide gel electrophoresis
PBS: Phosphate Buffer Saline
PEI: Polyethyleneimine
PS: Permeabilization solution
RBD: Receptor-binding domain
SARS: Severe Acute Respiratory Syndrome
SARS-CoV-2 E: SARS-CoV-2 Envelope protein
SARS-CoV-2 M: SARS-CoV-2 Membrane protein
SARS-CoV-2 N: SARS-CoV-2 Nucleocapsid protein
SARS-CoV-2 S: SARS-CoV-2 Spike protein
SDS: Sodium dodecyl sulfate
TGF: Transforming Growth Factor
TH2: T Helper 2 (usually referring to a type of cell in the immune
system)
TM: Transmembrane Domain

vii
Abstract

The worldwide pandemic of COVID-19, attributable to the SARS-CoV-2, has exacted
an immense and devastating impact on human lives. Elucidating the precise
pathogenic mechanisms of this virus is essential for the development of effective
antiviral strategies. A characteristic of SARS-CoV-2 is its potential to evade and
suppress the human innate immune response, leading to its pathogenicity.
CD1d-restricted NKT cells, an integral subset of innate T cells, play a pivotal role in
the initial stages of viral pathogenesis. Our research delves into the intricate
interactions between SARS-CoV-2 and the CD1d/NKT antigen presentation pathway
to gain deeper insights into this virus's pathogenesis and pinpoint potential
therapeutic interventions. We found that the transmembrane domain of the
SARS-CoV-2 envelope protein instigates CD1d downregulation, potentially facilitating
immune evasion. Further studies revealed that curtailing the ion channel function of
the SARS-CoV-2 E protein dramatically stymies CD1d downregulation, proposing a
potential counterstrategy against immune evasion.
Our investigation underscores the therapeutic role of NKT cells, demonstrating that
their activation may mitigate the deleterious effects of the virus. Moreover, our
findings suggested that adjusting NKT cell activity by disease progression may offer
therapeutic advantages, emphasizing the potential utility of NKT cell ligands as
therapeutic agents. This study sheds light on the intricate dynamics between
SARS-CoV-2 and the CD1d/NKT antigen presentation pathways, paving the way for
the development of optimal therapeutic strategies.

1

Chapter One: Introduction

1. The worldwide pandemic of COVID-19
An international outbreak of a new coronavirus started in 2019 and was officially
named SARS-CoV-2 [1]. SARS-CoV-2 is an enveloped virus with single-stranded
RNA, and it falls under the Beta coronavirus category [2]. When juxtaposing
SARS-CoV-2 with prior highly hazardous coronavirus outbreaks(SARS-CoV), it's
apparent that they both caused lower respiratory tract infections. As the disease
progresses, infected patients subsequently develop acute respiratory distress
syndrome (ARDS). The betacoronavirus also encompasses human coronaviruses
OC43, 229E, and HKU1 with SARS-CoV-2 sharing 79% similarity in nucleotide
sequences [3].

The spike protein of SARS-CoV, the important structural component of the virus,
encompasses RBD that engages explicitly with ACE2, its designated receptor [4].
This interaction paves the way for the virus to infiltrate the host organism. The viral
invasion instigates the formation of novel membrane structures with varying
dimensions and morphologies around the nucleus, termed "replicative organelles" [5,
6]. These structures are usually wrapped by a bilayer from the endoplasmic reticulum
(ER) that isolates the viral replication complex from the immune molecules of the host
cell [7]. The mechanism by which synthetic viral structural proteins and genomic RNA
are transported from the site of replication to the ER-Golgi intermediate compartment
(ERGIC), which is crucial for viral assembly and proliferation, remains to be
elucidated [8]. The virion incorporates merely four viral proteins: S, M, N, and E
protein.

2. Structure proteins of SARS-CoV-2

2
Spike proteins are important that protrude from the viral envelope. These proteins are
trimers made up of three segments. One of the central segments, the epicentral
region is further subdivided into two subregions, S1 and S2 [9]. The c-terminal domain
of the S1 subunit functions as the RBD.It can come into contact with receptors in the
body and facilitate the entry of the virus [10]. The S2 domain serves as the subunit
responsible for membrane fusion. The region in S protein that interacts with ACE2 is
highly preserved across different coronaviruses [11]. After the S1 structural domain is
attached to the host receptor, the S2 segment persistently aids the virus's fusion with
the host cell membrane, integrating it into the organism [12].

The membrane protein plays a crucial role in forming the viral envelope [13].
Comprised of 222 amino acids, it is comprised with an n-terminal and c-terminal
region and three transmembrane structural domains [14]. The c-terminal region of M
protein establish interaction with other structural proteins and have functions. These
protein-protein engagements, including the M protein's isotype interactions, are
intimately tied to membrane bending, budding, virus assembly, and internal
homeostasis maintenance [15]. As a principal protein constituent, the stable
attachment of the M protein to other structural proteins results in the creation of the
inner core of SARS-CoV-2 virus-like particles (VLPs). This aids in virus assembly and
is believed to regulate RNA replication and packaging into mature viral particles [16].

The N protein, which falls in the 43 to 50 kDa range, exhibits a binding affinity for
genomic RNA (gRNA) [17]. The functions of the N proteins are multifaceted, including
the promotion of viral RNA replication and transcription, as well as the formation and
maintenance of ribonucleoprotein (RNP) complexes. Additionally, N proteins are
involved in mediating interactions between the virus and the host, and have the
capacity to modulate the host cell cycle, including the induction of apoptosis, in order
to foster viral replication and dissemination [18].

3
The envelope proteins are the smallest of the major structural proteins and possess
two unique structural domains: a hydrophobic transmembrane domain and a ionized
cytoplasmic tail. The N-terminal part of the E proteins is transported across the
membrane, whereas the C-terminal portion remains exposed within the cytoplasm
[19]. E proteins maintain high conservation across various viral strains, and their
conserved structures display common attributes and functions, suggesting that
SARS-CoV E proteins share features such as ion channel activity with SARS-CoV-2
E proteins [20,21]. Additionally, CoV E proteins possess a unique function termed
"oligomerization," leading to the formation of viral spores [22]. These viral proteins
selectively facilitate the transport of calcium ions in the cytoplasm and participate in
the assembly and release of viral particles within the host cell [23, 24]. Additionally,
CoV E proteins play a role in the pathogenic mechanism by increasing the protein
folding burden of the endoplasmic reticulum (ER). This may ultimately induce
apoptosis [25].

Furthermore, E proteins form unique cation-selective channel can across ER-Golgi
intermediate compartments (ERGIC), which facilitate the release of mature viruses
[26]. Hence, a comprehensive investigation into the structural domain and functional
role of the E protein is imperative for a detailed analysis of viral virulence.

3. The transmembrane domain of E proteins

The E protein is composed of three essential structural domains: the Transmembrane
Domain (TMD), the intermediate helix structural domain, and the N-terminal and
C-terminal structural domains. The TMD is critical in the formation of E protein
homopolymers [27]. Although mutations in TMD, including alterations and deletions,
have been widely reported. Such mutations have been demonstrated to impair the
action of the virus in vivo, resulting in lower viral titers [28].

4
Viruses manipulate ion homeostasis in the human body in multiple ways to optimize
infection efficiency, and one key method involves the activity of viral viroporins.
Human viruses with high pathogenicity, including Human Immunodeficiency Virus 1,
and Coronaviruses typically encode one or more viroporins. These are small,
hydrophobic proteins encoded by viral RNA [29], and they play a pivotal role in various
stages of the viral life cycle. This includes facilitating virus entry, trafficking,
morphogenesis, maturation, and in some cases, enhancing virulence, by employing a
range of mechanisms [30]. Upon oligomerization in the ER/Golgi of the host cell, these
proteins establish a channel-like topology and perturb numerous physiological
properties of the cell. This disruption is brought about by a rise in membrane
permeability, alterations in membrane structure, and engagement with other resident
membrane proteins [31]. Thus, completing the infection cycle involves a multi-faceted
assault on host cell homeostasis.

It have been revealed that multiple viral proteins, including E, and ORF3a, have the
capacity to oligomerize and create ion channels (ICs) [32,33]. It's important to note
that the E protein demonstrates enhanced ion permeability, and inhibiting the E
protein channel greatly diminishes the virus's ability to cause disease. [34]. In
September 2020, sedimentation equilibrium data and gel electrophoresis results on
the E protein demonstrated that the E protein's transmembrane domain (TM) could
assemble into a homopentameric structure [35]. Further, NMR analysis of the TM
unveiled that residue 14-34 (TM21) are crucial for forming the E protein pentamer [36].
Moreover, the TM of the CoV E protein plays a vital role in forming viral viroporins.
Viroporin proteins significantly contribute to the functionalities of CoV. By establishing
hydrophilic conduits in the cell membrane, these viroporins modulate the
microenvironment in host cells, which includes ion concentrations and pH levels. The
channels facilitate the translocation of water and ions across the cell membrane,
causing disruptions in membrane potential, collapsing the ion gradient, and leading to

5
the egress of critical intracellular compounds. The function bolsters viral propagation
and sustains the production of virions [37].

4. NKT cells and CD1d presentation pathway
A particular subpopulation of lymphocytes, named "natural killer (NK) cells," is
equipped with molecular specificity to identify their target cells. Once activated, NK
cells can unleash their cytotoxic functionality and generate cytokines. These cells
target infected, transformed, and stressed cells, purging undesirable cells and
promoting cellular homeostasis. The importance of NK cells in controlling pathogen’s
infections and tumors is noteworthy. NK cells have been rigorously investigated as
potential treatments for human malignancies, and current scientific endeavors are
probing their potential application in treating viral diseases.

NKT cells are recognized for their potent immunomodulatory capabilities in immune
systems, especially in fighting pathogen infection and tumors. The major subset of
NKT cells is known as invariant natural killer T (iNKT) cells. iNKT cells form a distinct
lymphoid lineage that is separate from typical T cells, B cells, and NK cells. They
stand out due to their concurrent expression of both NK cell receptors and T cell
receptors [38].

CD1d is a glycoprotein, MHC class I-like molecule found on the surface of APC and
expressed in various hematopoietic cells as well as in non-hematopoietic tissues. In
contrast to MHC class I molecules, CD1d specializes in presenting lipid antigens to
iNKT. Upon activation, iNKT secrete a mix of pro-inflammatory and anti-inflammatory
cytokines, orchestrating both innate and adaptive immune responses within the
organism.

Various pathogens such as bacteria, parasites, and viruses use different pathways to
impair antigen presentation by CD1d to achieve immune escape. Studies have shown

6
that the p38 mitogen-activated protein kinase (MAPK) pathway, activated by the
vesicular stomatitis virus, impairs the presentation of CD1d antigen [39]. Additionally,
various pathogens utilize the TGF-β pathway to inhibit CD1d-mediated antigen
presentation, thereby impacting the function of NKT cells. Several viruses, such as
HIV, HSV-1, and KSHV, utilize various strategies to suppress CD1d and NKT cell
activity [40]. Viruses commonly downregulate antigen-presenting molecules as a
strategy to evade T-cell function. Downregulation of CD1d expression is a
widespread approach utilized by viruses to block NKT cell function.

iNKT cells can be triggered by glycolipids like α-galactosylceramide (GalCer) and are
known to release a broad spectrum of cytokines, encompassing Th1 and Th2
cytokines [41]. During some infections, iNKT cells experience direct and/or indirect
activation. In particular viral infection scenarios, iNKT cells get activated in the course
of the infection and participate in the eradication of these pathogens. The
participation of iNKT cells has been proposed in diverse animal disease models [42].
The progression and resolution of diseases, particularly the advancement of
symptoms caused by inflammatory responses, heavily rely on the cytokines produced
by iNKT cells and the cytokines that stimulate the production of cytokines in other cell
types. TH2 cytokines posses a dampening effect on several autoimmune models but
are crucial for the development of allergic diseases [43]. On the other hand, TH1
cytokines worsen autoimmune and inflammatory disease models but are necessary
for clearing infections and preventing tumor metastasis [44]. As a result, extensive
research has gradually focused on modulating the production of different cytokines by
activated NKT cells and delving deeper into this mechanism as a potential approach
to resolving diseases.

iNKT cells demonstrate IL-4 or IFNγ cytokine production in vivo shortly after
stimulation with the potent glycolipid antigen α-galactosyl ceramide (α-GalCer) [45].
This TH1 cytokine effectively activates the immune response, aiding in the

7
reinforcement of autoimmunity against viral infections. It has been observed that, in
addition to recruited immune cells, monocyte infection can trigger an excessive
inflammatory response in the later stages of the disease. These deregulated
hyperimmunity can lead to local and generalized tissue damage. Patients with severe
COVID-19 usually show a condition characterized by a reduced number of blood cells
(cytopenia) and lymphocytes (lymphopenia), along with a significant reduction in T
cell and NK cells frequency [46,47]. Most severe patients experience a cytokine storm
with the hallmark of elevated levels of pro-inflammatory cytokines. In contrast to
α-GalCer, OCH is a structural variants of α-GalCer can prompt iNKT cells to produce
convergent TH2 cytokines. OCH treatment has shown benefits in various
autoimmune models, including experimental autoimmune encephalomyelitis (EAE)
and type I diabetes [48]. OCH primarily activates Th2 cells and significantly mitigates
inflammation progression. Increasing evidence is associating SARS-CoV-2 with
extreme inflammation marked by the discharge of pro-inflammatory cytokines, and
acute respiratory distress syndrome (ARDS), which is a leading cause of mortality
among COVID-19 patients. OCH possesses anti-inflammatory properties, and it is
hypothesized that α-GalCer and OCH may have distinct functions at different stages
of the disease.

8
Chapter Two: Materials and Methods

1. Cell lines and plasmids

For the execution of our study, we utilized two robust cell lines: 293T.CD1d and
HeLa.CD1d, both provided by Dr. Weiming Yuan. These cell lines were explicitly
engineered to stably express CD1d molecules through the process of lentiviral
transduction. The 293T.CD1d cell line was cultivated in DMEM, procured from
Corning, supplemented with 5% FBS, acquired from HyClone, and a concentration of
0.05% puromycin. The addition of puromycin was crucial in selecting and maintaining
cells positive for CD1d. In parallel, the HeLa.CD1d cell line was cultured under similar
conditions and was nurtured in DMEM, fortified with 5% FBS and complemented with
Penicillin-Streptomycin antibiotics (100 µg/ml, sourced from Genesee Scientific).

The pTracer plasmid, provided by Dr. Weiming Yuan, was utilized in our study. This
plasmid facilitates the generation of Green Fluorescent Protein (GFP) within the cell,
serving as an indicator of successful transfection. Lastly, our research was
supplemented by the incorporation of a human codon-optimized SARS-CoV-2
envelope protein with a 2XStrep-tagged plasmid, a critical resource kindly provided
by the Krogan Lab at UCSF, as referenced in Gordon et al., 2020.

2. Antibodies and inhibitors

Our experimental procedures necessitated the utilization of a selection of primary and
secondary antibodies, in addition to specific inhibitors.

Primary Antibodies: The 51.1.3 Monoclonal antibody, provided by Dr. Steven Porcelli
of Albert Einstein College of Medicine, was instrumental in detecting the expression
of mature human CD1d and β2m complexes. We employed the D5 antibody to

9
identify the CD1d heavy chain (immature form). As a loading control, we utilized the
Grp94 antibody (rat monoclonal, Enzo) which binds to the GRP94 protein.
SARS-CoV-2 viral proteins carries 2XStrep tag, we utilized the anti-Strep tag mouse
monoclonal antibody procured from Biolegend.

Secondary Antibodies: We used donkey anti-mouse IgG (H+L) and donkey anti-rat
IgG antibodies from Jackson ImmunoResearch for western blot analysis. These were
utilized at a dilution of 1:5000 in the TBST buffer. For FACS analysis, we used PE
goat anti-mouse polyclonal antibody from Biolegend to stain cell surface CD1d at a
concentration of 1 μg/ml in PBS buffer. In the immunofluorescence assays, we
utilized Alexa Fluor 488 goat anti-mouse IgG2b, Alexa Fluor 568 goat anti-mouse
IgG1, and Alexa Fluor 647 goat anti-rabbit antibodies procured from Thermo Fisher
Scientific.

Inhibitors: To manipulate certain cellular processes, we employed specific inhibitors.
Chloroquine, obtained from Sigma-Aldrich, can inhibit the fusion of endosomes and
lysosomes, in addition to increasing the pH of lysosomes. MG132, also sourced from
Sigma-Aldrich, functions as a protease inhibitor. Additionally, Amantadine from
Sigma-Aldrich was utilized, given its ability to inhibit viroporin ion-channel activity
(Influenza M2).

3. Transient transfection

The cell lines used in this research, 293T.CD1d and HeLa.CD1d, was grown on 10
cm tissue culture dishes until they achieved confluency between 80-85%.
Subsequently, transfection was performed utilizing the Polyethyleneimine (PEI)
method as delineated by Kichler et al., 2001. For studies entailing inhibitor treatments,
the respective inhibitors were administered 24 hours post-initiation of transfection.
Following a 48-hour period post-transfection, the cells were subjected to harvest.

10
After rinsing and centrifugation at 290XRCF for 3 minutes, the supernatants were
removed. Cells were then washed with PBS buffer, and the subsequent supernatant
was similarly discarded. Cells were then primed for flow cytometry analysis or stored
at 4%PFA in -20°C conditions.

4. Cell Lysis and immunoprecipitation assay

The lysis buffer was prepared anew for every use, supplemented with various
protease inhibitors. The lysis buffer is composed of 1% Triton in Tris-buffered Saline
buffer (TBS) and various protease inhibitors were added into the lysis buffer, including
2 mM Indole-3-Acetic Acid (IAA), 0.1 mM PMSF, 1 mM NaVO3, Leupeptin, Pepstatin
A, 1 mM NaF, 0.1 µM Okadaic acid, 1 mM β-glycerophosphate and 5 mM NaPP. For
each 10 cm plate cell sample, 1 ml of cell lysis buffer was employed, and the cells
were resuspended and disrupted using the pipette. The resultant solution was
incubated on ice for 30 minutes, with periodic mixing every 10 minutes. Following this,
the cell suspension was subjected to centrifugation at 1000 RCF, 4°C, for a 10-minute
duration. Post-centrifugation, 200 µl of the supernatant was reserved as a
whole-cell-lysate sample, while the remaining 800 µl was used for the
immunoprecipitation assay. To the 200 µl aliquot of whole-cell lysate, 40 µl of 6X SDS
loading buffer was incorporated. The mixture was subsequently subjected to a
heating block set at 95°C for a duration of 2 minutes. After this process, the mixture
was preserved at a temperature of 4°C.

Immunoprecipitation was executed in two steps, commencing with pre-clearing and
followed by immunoprecipitation. For pre-clearing, a concoction of normal rabbit
serum or normal mouse serum (according to the different types of the antibody) along
with a 1:1 mixture of Sepharose 4B and protein G beads was added to the samples.
This mixture was subsequently left to rotate in a refrigerator at 4°C for 1 hour. After
this period, the supernatant was collected via centrifugation and mixed with the CD1d

11
51.1.3 or D5 antibody along with a 1:1 mixture of Sepharose 4B and protein G beads.
The mixture was then rotated at 4°C overnight. The subsequent day, the supernatant
was saved at -20°C freezer for later use, and the beads were washed with a 0.1%
Triton/TBS solution to remove the residual cell lysate. Lastly, the beads were
combined with 100ul 2X SDS loading buffer and subjected to heating at 95°C for 2
mins before storage at 4°C, or longer storage at -20°C.

5. Western blotting

Before electrophoresis, proteins go through a process of denaturation and
depolymerization. This involves the introduction of a reducing agent and SDS (an
anionic detergent) and treatment at high temperatures for 2 minutes. The effect is to
break the disulfide bonds in the protein structure, and the resulting interactions form
an apparently negatively charged complex, thus masking any original charge
differences between the proteins. As a result, the charge-to-mass ratio between the
different proteins becomes consistent, meaning that mobility during electrophoresis in
polyacrylamide gels is largely dependent on the molecular size of the protein.

The polyacrylamide gel utilized for electrophoresis is a composite of a stacking gel
and a separating gel. In our experiments, we employed a 4.5% polyacrylamide
stacking gel, the primary role of which is to minimize the variation in sample starting
heights, thus ensuring that all proteins commence electrophoresis from an equal
starting line.

For protein separation, the efficiency of a 10% polyacrylamide separating gel is
moderate for proteins within a 15-170 kDa range, while its performance significantly
diminishes for proteins below 15 kDa. The SARS-CoV-2 E proteins in our study fall
within the 8.4-12 kDa range, we used a 15% polyacrylamide gel to ensure adequate
resolution of these lower molecular weight proteins. Concurrently, for the other

12
proteins, namely CD1d D5 and 51.1.3, we utilized a 10% polyacrylamide separating
gel.

The gel was then transferred to a PVDF membrane that had been activated in
methanol. Successful protein transfers were confirmed by the presence of visible
protein markers on the PVDF membranes. Blocking of the PVDF membrane was
achieved by incubation in 5% non-fat milk prepared in TBST, followed by overnight
incubation with the primary antibody (1:1000) at 4°C. After washing the primary
antibody 3 times 5 minutes with TBST, the membranes were incubated with the
secondary antibody (1:5000) for an hour, followed by sequence washing. The final
visualization of the antibody was carried out with an HRP-based detection fluid and
imaged using the ChemiDoc Imaging System (Bio-rad) for detection of
chemiluminescence.

6. Flow cytometry analysis

Following 48 hours of transfection, cells were harvested from each 10 cm plate, and a
series of washes were conducted using PBS. Thereafter, cells were resuspended in 1
mL of PBS, and 200 µL of this suspension was allocated to a 96-well plate for flow
cytometry analysis. All steps involving intact cell staining were performed at
temperatures between 0 and 4°C. The cells were washed with FACS buffer (PBS 1X,
containing 0.5% BSA) prior to the addition of 150 µL of primary antibody 51.1.3 (5
µg/mL) for a 30-minute incubation. Subsequently, cells were washed thrice with
FACS buffer to remove excess primary antibody. The cells were then incubated with
150 µL of the secondary antibody, PE goat anti-mouse (1 µg/mL), in the dark for 30
minutes. Any excess secondary antibody was removed through a series of three
washes with FACS buffer. To fix the stained cells, 100 µL of 4% formaldehyde
solution was added for a duration of 10 minutes. This was followed by the addition of
300 µL of dPBS, yielding a final concentration of 1% formaldehyde. The cells were

13
then resuspended in this 1% formaldehyde/dPBS solution in preparation for FACS
analysis. The BD FACS Canto II flow cytometer was employed for the examination of
the cell samples. Ultimately, the FACS data were processed and interpreted utilizing
FlowJo software.

7. Immunofluorescence assay

The HeLa.CD1d cells were seeded in 24-well plates with microscope coverslips
placed in advance, and 25,000-30,000 cells were seeded per well. The transfected
cells expressed plasmid-encoded SARS-CoV-2 viral protein. After 48 h of transfection,
cells were incubated in fixative (4% formaldehyde in DMEM with 10 mM HEPES: 500
µl/well) for 20 min at room temperature. The coverslips were then washed twice with
the 500 ul serum-free media with 10mm Hepes (samples can be stored overnight at
this point.

Cells are permeable by the addition of 300-500 µl of permeabilization solution (PS)
per well, followed by a 20-minute incubation period at room temperature. Avoid the
utilization of PS solutions with a purple hue, indicative of pH values outside the
appropriate range, which may hamper antibody binding. Primary antibodies are
diluted in PS to a final concentration of 10 μg/ml. Cell staining is conducted within a
humidified container: aliquots of primary antibody (20 μl) are deposited onto parafilm,
followed by placement of a coverslip (cell side down) over the antibody solution. The
container is then enveloped and incubated for 30 minutes at room temperature,
ensuring a consistently moist incubation environment. Following incubation, the
coverslip is retrieved and repositioned within the 24-well plate and subjected to three
washes using 500 µl of PS. This incubation procedure is reiterated for the second
antibody.

14
Following this, the coverslips are mounted onto glass microscope slides. In
preparation for mounting, 20% Mowiol is pre-heated on a heating block set at 95°C.
Coverslips are washed via immersion in water, with surplus water subsequently
removed by aspiration. Drops of Mowiol (5 µl) are applied to the microscope slide,
upon which the coverslip (cell side down) is placed. To prevent light exposure,
samples are covered with aluminum foil and can be stored at 4°C until dry. Confocal
microscope (Nikon) is then employed to examine the samples, equipped with four
laser channels at 405 nm, 488 nm, 561 nm, and 640 nm.

The primary antibodies utilized in this study include anti-CD1d 51.1.3 mouse IgG2b
and anti-Strep-tagged mouse IgG1, while the secondary antibodies are Alexa Fluor
488 goat anti-mouse IgG2b and Alexa Fluor 568 goat anti-mouse IgG1.

8. Viruses

The SARS-CoV-2 virus (Isolate USA-WA1/2020), utilized in our study, was procured
from BEI resources. This virus strain was cultivated and titer quantification performed
in Vero-E6 cells, according to established methodologies [96]. We were also fortunate
to receive the mouse-adapted virus strain, CMAp20, as a generous contribution from
Dr. Pei-Yong Shi at the University of Texas Medical Branch, Galveston.

9. Mouse strains and in vivo SARS-CoV-2 infection

We obtained C57BL/6 and K18-hACE2-Tg mice from the Jackson Laboratory and set
up breeding colonies. Dr. Chyung-Ru Wang from Northwestern University, Chicago,
kindly supplied the CD1d knockout mice from a C57BL/6 lineage. K18-hACE2-Tg
mice were intranasally inoculated dose of 1X10^4 plaque-forming units (pfu) per
mouse of the wild-type SARS-CoV-2 strain (Isolate USA-WA1/2020). In the case of
C57BL/6 infection, mice were intranasally given 1X10^6 pfu per mouse of the

15
adapted CMAp20 strain. We monitored the infected mice daily for changes in body
weight and survival rates. To stimulate iNKT cells, mice were given an intraperitoneal
injection of either 3 µg of α-GalCer, sourced from Funakoshi Corporation, or 2 µg of
OCH, provided by the NIH Tetramer Facility.

10. Primer Table
Primer
name
Sequence Sour
ce
purpose
E-TM-
Lower
TCCATCCCCCGCCGCCTTCGAGCCTCAATG
CAGTCAGAATT GC
IDT Generate
TM only or
TM+N E
protein
mutants
E-TM-Upper GCAATTCTGACTGCATTGAGGCTCGAAGGC
GGCGGGGGAT GGA
IDT Generate
TM only or
TM+N E
protein
mutants
TM21-
Lower
CTC GTC ACA CTG GCA ATT CTG CTC GAA
GGC GGC GGG GGA TGG

IDT Generate
TM21
protein
mutant
TM21-
Upper
TCC ATC CCC CGC CGC CTT CGA GCA GAA
TTG CCA GTG TGA CGA

IDT Generate
TM21
protein
mutant
TM-N-DEL
Lower
TAC AGC TTC GTA TCA GAA GAA CTG ATC
GTA AAT TCT GTG CTC
IDT Generate
TM-N-DEL
mutant

16
TM-N-DEL
Upper
GAG CAC AGA ATT TAC GAT CAG TTC TTC
TGA TAC GAA GCT GTA
IDT Generate
TM-N-DEL
mutant
TM-N-TT-D
EL Lower
TAC AGC TTC GTA TCA GAA GAA GTA AAT
TCT GTG CTC TTG TTT CTG
IDT Generate
TM-N-TT-D
EL mutant
TM-N-TT-D
EL Upper
CAG AAA CAA GAG CAC AGA ATT TAC TTC
TTC TGA TAC GAA GCT GTA
IDT Generate
TM-N-TT-D
EL mutant
TM-C-DEL
Lower
GTC ACA CTG GCA ATT CTG CTC GAA GGC
GGC GGG GGA TGG A
IDT Generate
TM-C-DEL
mutant
TM-C-DEL
Upper
TCC ATC CCC CGC CGC CTT CGA GCA GAA
TTG CCA GTG TGA C
IDT Generate
TM-C-DEL
mutant
TM-C-Ronly-
DEL Lower
GCA ATT CTG ACT GCA TTG CTC GAA GGC
GGC GGG GGA TGG A
IDT Generate
TM-C-Ronly-
DEL mutant
TM-C-Ronly-
DEL Upper
TCC ATC CCC CGC CGC CTT CGA GCA ATG
CAG TCA GAA TTG C
IDT Generate
TM-C-Ronly-
DEL mutant
TM-C-LR-D
EL Lower
CTG GCA ATT CTG ACT GCA CTC GAA GGC
GGC GGG GGA TGG A
IDT Generate
TM-C-LR-D
EL mutant
TM-C-LR-D
EL Upper
TCC ATC CCC CGC CGC CTT CGA GTG CAG
TCA GAA TTG CCA G
IDT Generate
TM-C-LR-D
EL mutant
TM-C-ALR-
DEL Lower
CAC ACT GGC AAT TCT GAC TCT CGA AGG
CGG CGG GGG ATG GA
IDT Generate
TM-C-ALR-

17
DEL mutant
TM-C-ALR-
DEL Upper
TCC ATC CCC CGC CGC CTT CGA GAG TCA
GAA TTG CCA GTG TG
IDT Generate
TM-C-ALR-
DEL mutant

11. Plasmid sequences
SARS-Co
V-2
envelope
with
2Xstrep
tag
TGTACAGCTTCGTATCAGAAGAAACCGGGACACTGATCGTAAATTC
TGTGCTCTT
GTTTCTGGCATTCGTCGTATTTCTCCTCGTCACACTGGCAATTCTG
ACTGCATTG
AGGCTTTGCGCCTACTGTTGTAACATTGTCAATGTATCTCTCGTGA
AACCCTCAT
TCTACGTTTACAGCAGGGTGAAGAATCTCAATTCTAGCAGGGTGCC
GGATCTCC
TCGTTCTCGAAGGCGGCGGGGGATGGAGCCATCCACAATTCGAG
AAAGGCGGT
GGTTCAGGAGGAGGTAGCGGGGGTGGATCATGGTCACATCCGCA
GTTTGAAAA GTAAG
SARS-Co
V-2
TM with
2Xstrep
tag
ACCGGGACACTGATCGTAAATTCTGTGCTCTTGTTTCTGGCATTCG
TCGTATTTC
TCCTCGTCACACTGGCAATTCTGACTGCATTGAGGCTCGAAGGCG
GCGGGGGA
TGGAGCCATCCACAATTCGAGAAAGGCGGTGGTTCAGGAGGAGGT
AGCGGGGG
TGGATCATGGTCACATCCGCAGTTTGAAAAGTAAG

18
Chapter Three: Results

In anticipation of the COVID-19 pandemic, our lab has endeavored to discover novel
immune evasion mechanisms conducted by SARS-CoV-2, specifically focusing on its
structural protein-mediated evasion of NKT cells. Dr. Weiming Yuan performed a
systematic screening in an initial experiment to study the interaction between
SARS-CoV-2 proteins and CD1d expression. During this screening, we used 293T
cells expressing CD1d (293T.CD1d) and plasmids encoding distinct SARS-CoV-2
proteins.

For this experiment, co-transfection was conducted on the 293T.CD1d cells. We used
plasmids encoded with various SARS-CoV-2 proteins and pTracer. pTracer works as
a transfection marker. Post-transfection (48 hours), the cells were harvested, and
conducted surface staining for CD1d. This experiment was carried out by using
α-CD1d 51.1.3 (mouse IgG2b) antibody as the primary antibody and a PE- goat
anti-mouse antibody as the secondary antibody. Upon flow cytometry analysis, a
noticeable downregulation of CD1d expression was observed on transfected cells
(GFP positive) compared to their untransfected parts (GFP negative).

In subsequent experiments, the ability of SARS-CoV-2 E protein to downregulate
CD1d expression on cells was confirmed. This observation elucidates a crucial
mechanism by which the virus potentially impedes NKT cell activation, thereby
contributing to successful viral infection and immune evasion.

1. The transmembrane domain of the SARS-CoV-2 envelope protein can lead to
the downregulation of CD1d in antigen-presenting cells

As demonstrated in Figure 1, our study successfully reconfirmed the phenotypic
down-regulation of CD1d in response to the SARS-CoV-2 E protein, with a particular

19
emphasis on the influence of the transmembrane domain within the E protein.
Drawing from prior research, the ion channel activity of the E protein is realized
through the oligomerization of its transmembrane structural domain in host
membrane, which formulates an alpha-helical bundle. It is also noteworthy that the
amino acid sequences of the transmembrane domains of the SARS-CoV-2 and
SARS-CoV-1 in the coronavirus family are identical, and recent investigations have
revealed that the E protein in SARS-CoV-2 exhibits a similar ion channel function to
its SARS-CoV counterpart. Based on those findings, our research aimed to evaluate
the potential effects of the E protein transmembrane domain. We observed a
significant down-regulation of CD1d expression on the surface of APCs transfected
with the envelope protein and its transmembrane domain. Importantly, the extent of
CD1d down-regulation in the transmembrane domain was akin to that of the whole
envelope protein. Flow cytometric analysis indicated a notable shift in the CD1d
signal intensity of GFP-positive cells — those transfected with the envelope protein or
its transmembrane region — towards lower values, which provides evidence of
diminished CD1d expression. This observation aligns with the hypothesis that the
transmembrane domain predominantly contributes to the SARS-CoV-2 envelope
protein-induced down-regulation of CD1d.

We already know that TM is necessary for the downregulation of CD1d on the APC
surface. Based on the previous results, we wanted to further investigate which part of
the TM is responsible for the downregulation of CD1d, so we constructed 2 plasmids,
with only TM and only TM21 (figure 1). TM21 was predicted based on nuclear
magnetic resonance (NMR) spectroscopy structural studies of the a-helix [49]. The
results of flow cytometry showed that the peak changed greatly in TM-transfected
cells, but the down-regulation effect was not significant in TM21-transfected cells
(figure 1c).

20
Complementing our flow cytometric findings, Western blot analysis further affirmed
this down-regulation by illustrating a pronounced decrease in the CD1d protein level
in samples transfected with the SARS-CoV-2 envelope protein and TM (figure 1b).
But the CD1d protein level was not affected in the samples transfected with TM21.
The coherence of data derived from flow cytometry and Western blot analysis
substantiates our initial findings. Our findings revealed an intriguing dynamics of this
TM and accentuate the influential role of the TM in CD1d down-regulation.
Specifically, we found that sequences containing 21 amino acids within these regions
were instrumental in restoring the expression of CD1d to levels observed in the
control group.

2. Relationship between the transmembrane domain of SARS-CoV-2 envelope
protein and CD1d expression

Considering the difference in the nine additional amino acids in the transmembrane
structural domain (TM) over TM21, our previous results highlighted that TM was
critically essential for down-regulating the CD1d molecule, while TM21 failed to elicit a
similar down-regulation of CD1d. Consequently, we hypothesized that this
down-regulation effect could be diminished by removing these nine amino acids, and
we sought to identify the specific amino acid or section thereof, accountable for this
effect.

Subsequently, we analyzed the N- and C- terminals of TM, and designed primers for
the deletion of relatively crucial amino acids at both ends. We constructed four
plasmids based on our design, namely, TM-N-DEL, TM-C-DEL, TM-N-TT-DEL, and
TM-C-R-DEL (figure 2a). The amino acids R and TT are noteworthy due to their
probable connection to phosphorylation, and they were suspected to possess
significant function. Therefore, we carried out the deletion to assess their role within
the entire TM.

21

Our results showed a comparison between several mutations and TM. Through
unpaired Student’s t-test and one-way ANOVA test statistical analysis, we discerned
that among the mutations, TM-N-DEL, TM-N-TT-DEL, and TM-C-R-DEL each led to a
significant down-regulation of CD1d (p<0.0001). However, we also discovered that
the downregulation of CD1d by TM-C-DEL was markedly reduced. As TM-C-DEL is a
C-terminal deletion mutation of TM, we propose that the c-terminal portion of TM is an
key area facilitating the downregulation of CD1d by TM.

This observation is of notable significance, particularly considering our prior discovery
of CD1d downregulation by the SARS-CoV-2 envelope protein. This suggests that
specific amino acid sequences within TM can effectively counterbalance the initial
down-regulatory impact of the SARS-CoV-2 envelope protein on CD1d. This finding
underscores the complexity of virus-host immune system interplay and brings into
focus the role of specific amino acid sequences in the immune response. Our findings
provide insights for further exploration of these specific amino acid sequences, their
functional importance, and their potential therapeutic roles in thwarting CD1d
down-regulation caused by the viruses.

3. Impact of the crucial amino acids at the c-terminal of the TM on CD1d
expression

As our investigation progressed, we focused on understanding the c-terminal of the
TM. We attempted to uncover the relationship between the amino acids present
therein and the observed downregulation of CD1d expression. In contrast to the
full-length TM, TM-C-DEL deletes four amino acids from the c-terminus of TM,
namely Threonine, Alanine, Leucine, and Arginine (figure 4a). Our previous study
found that in the TM-C-Ronly-DEL transfection group, deletion of only Arginine for TM,

22
there is still significant downregulation of CD1d in transfected cells. So, we
constructed TM-C-LR-DEL and TM-C-ALR-DEL to continue investigating how the
reduction in amino acid affects the function of CD1d downregulation. The results
showed cells that are transfected with TM-C-Ronly-DEL and TM-C-LR-DEL still had a
significant down-regulatory effect on CD1d compared to the control group (p<0.001).
Furthermore, in the TM-C-ALR-DEL transfected group, the down-regulation of CD1d
was diminished compared to the control group (p<0.01) (figure 4b). In Figure 4c, we
subjected the TM-deleted mutant transfected group to flow cytometric data analysis
with the TM-transfected group to obtain more solid results. We obtained that deletion
of Arginine at the c-terminus of TM does affect the function of tm in downregulating
CD1d (**, p<0.01), considering that the involvement of Arginine in processes such as
phosphorylation would contribute to the downregulation effect. With the reduction of
the number of amino acids at the c-terminus, the difference between each mutant
transfected group and the tm transfected group increased.

A clear correlation is evident from our analysis. As we decrease the number of amino
acids at the c-terminus of the transmembrane domain, the downregulation of CD1d
becomes increasingly less significant. These results suggest that specific amino acids
within this region play a direct and influential role in regulating the expression level of
CD1d. This finding is particularly intriguing because it points to specific amino acids in
TM as crucial factors in our observed immunomodulatory effects. It implies that
specific amino acids can influence the interaction between SARS-CoV-2 and the host
immune response. These results also provide insights for further exploration,
including identifying these specific amino acids and understanding their exact role in
SARS-CoV-2-induced CD1d downregulation.

23

Based on the plasmids constructed before, we did the IF to check the localization of
each protein in cells. Our results reveal the specific localization of the SARS-CoV-2
envelope protein and its corresponding mutations within the cellular structure (figure
3). The E protein and its mutations are visualized in green, demonstrating their
presence and distribution within the cells. Additionally, mature CD1d staining,
indicated in red, provides a clear depiction of this cellular component's distribution.

Further inspection of these results provides compelling evidence of the interaction
between the SARS-CoV-2 envelope protein and CD1d expression.
Immuno-fluorescence (IF) analysis further reinforced this observation, demonstrating
that cells transfected with the full-length E protein and TM showed a downregulation
in surface CD1d expression. This was in stark contrast to the untransfected cells,
which maintained regular CD1d expression levels.

The implication of this result is profound as it points towards a potential mechanism
through which SARS-CoV-2 may be influencing the immune response. The
downregulation of CD1d in transfected cells could indicate a viral strategy to evade
the immune response, warranting further investigation.

4. Exploring mechanisms of E protein-induced CD1d downregulation and the
potential ameliorating Effects of Amantadine and HMA

Building upon our earlier discoveries, we next explored potential mechanisms by
which the E protein modulates CD1d expression. Particularly, we focus on the TM of
the E protein, which has been documented to create a cation-selective channel within
the ERGIC membrane. This channel plays a vital role in facilitating the release of
virus progeny and triggering host inflammasome activation. Based on these insights,
we aimed to assess if the downregulation of CD1d by the E protein could be mitigated

24
by impeding the ion channel activity of the E protein TM. Such ion channel activities
can be hindered by hexamethylene-amiloride (HMA) and amantadine, which are
established inhibitors of viroporins in the influenza A virus and HIV-1.

Our study used amantadine and HMA, two agents with known ion channel-interfering
effects. 293T.CD1d cells transfected with TM, then treated with increasing
concentrations of amantadine (100 uM, and 200 uM). Flow cytometry analysis was
conducted to quantify changes in surface CD1d expression. Interestingly, a
significant reduction in surface CD1d downregulation was observed in the group
treated with the highest concentration of amantadine (200 uM) relative to the
untreated group (Figure 5a).

In another set of experiments, 293T.CD1d cells transfected with TM, were exposed to
escalating concentrations of HMA (25 uM, 50 uM, and 75 uM) for 48 hours. Flow
cytometry data revealed a substantial decrease in the extent of surface CD1d
downregulation in cells treated with the highest concentration of HMA (75 uM)
compared to the untreated group (Figure 5b).

These findings substantiated that E protein-induced CD1d downregulation can be
attenuated by the application of amantadine and HMA, with both agents exerting a
dose-dependent alleviation of CD1d downregulation. These results underscored the
role of ion channel activity in the CD1d downregulation, contributing to our
understanding of SARS-CoV-2 pathogenesis.

5. Impact of Proteasomal and Lysosomal Inhibition on SARS-CoV-2 E
Protein-Mediated CD1d Degradation

Two agents were employed to decipher further the intricate mechanisms by which the
SARS-CoV-2 envelope protein influences CD1d expression. 293T.CD1d cells, after

25
being transfected with envelope plasmid, were subjected to treatment with MG132, a
proteasome inhibitor, in concentrations of 5 µM and 10 µM, or chloroquine, an
established antiviral agent that raises lysosomal pH, thus disrupting protein digestion
and viral release, at concentrations of 20 ug/ml and 50 μg/ml for 48 hours. The
efficacy of these treatments was demonstrated via the accumulation of p27 protein in
the MG132-treated samples and a significant increase of p62 protein in the
chloroquine-treated samples, as confirmed through Western blot analysis (Figure 6),
validating the inhibition of both proteasomal and lysosomal functions. Interestingly, in
the Western blot results, both MG132 and chloroquine restored the levels of CD1d in
cells transfected with envelope protein (Figure 6). These observations suggest that
the degradation of mature CD1d protein mediated by the E protein may encompass
both proteasomal and lysosomal degradation pathways.

6. Activation of NKT is a potential antiviral intervention against SARS-CoV-2
Infection

In our previous study, we confirmed the impact of the E protein on CD1d expression.
In the next phase of our investigation, we aimed to elucidate the functional regulation
of NKT cells in viral infections. To address the immune evasion of NKT cell induced
by viral infection, we employed α-galactosylceramide (α-GalCer) as a stimulator to
the activation of iNKT cells. For this experiment, K18-hACE2-Tg mice (n = 8, both
males and females) were administered a dose of 3 μg of α-GalCer via intraperitoneal
injection two days prior to infection.

Mice were then intranasally infected with viruses at a dose of 1X10^4 pfu per mouse.
(Figure 7a). The control mice succumbed to the virus with a weight loss rate of 20%,
and all were sacrificed the 8 days post-infection (Figure 7b and 7c). Conversely, in
the treated mice, the average body weight loss was not severe, with approximately 25%
of the treated mice survived (Figure 7b). The results indicate a significant diminution

26
in disease severity and an increased survival rate in the treated mice. This
intervention may reverse the immunosuppression observed in SARS-CoV-2 infection,
guiding future exploration to tackle viral immunosuppression. To extend our
investigation to the potential therapeutic effects of α-GalCer, we administered the
same dosage of α-GalCer via the same intraperitoneal injection procedure on mice. In
this experiment, mice were infected with viruses and treated with α-GalCer 1 and 2
days post-infection. The results illustrated a significantly enhanced survival rate
among all treated mice compared to the control group (Figure 8). These findings
demonstrated that the activation of iNKT has the ability to confer potent antiviral
capabilities, ameliorating the pathogenic consequences of the virus and enhancing
host survival.

7. Stage-specific activation and inhibition of NKT cells at different stages of
SARS-CoV-2 infection cause altered disease progression

We persistently explored the function of iNKT during SARS-CoV-2 infection and
found the impact of iNKT function inhibition at different stages of infection.
Interestingly, we discovered a striking correlation between the duration of inhibition
and the disease's severity. OCH is a structurally modified α-GalCer derivative. Unlike
αGC, OCH primarily activates Th2 cells and significantly retards inflammation
progression [50]. Given the escalating evidence of SARS-CoV-2 being associated
with excessive inflammation and a subsequent cytokine storm, we conjectured that
OCH's anti-inflammatory properties could be pivotal in disease remission during the
later stages.

For this experiment, K18-hACE2-Tg mice (15 in total, both males and females) were
intranasally infected with SARS-CoV-2 (Isolate USA-WA1/2020) at a dosage of
1x10^4 pfu per mouse. 2ug of OCH was administered intraperitoneally on 1 and 2
days post-infection. The infection led to a body weight loss rate of up to 15% in the

27
control mice, with all mice sacrificed on the eighth-day post-infection (Figures 9a and
9b). However, the OCH-treated mice showed a significant increase in disease
severity, dying earlier than the untreated group (p<0.05) (Figure 9a and 9c). These
results indicate that a Th2-type response by NKT cells during the early infection
stages enhances disease severity and significantly decreases survival.

In an independent study, a group of K18-hACE2-Tg mice (n = 15, both males and
females) were subjected to SARS-CoV-2 infection using the USA-WA1/2020 isolate,
with a viral inoculum of 1X10^4 pfu per mouse. Intraperitoneal injections of OCH were
administered during the later stage of infection, specifically on days 3 and 4
post-infection. In the control group, the infection resulted in a body weight loss rate of
up to 15%, and all mice succumbed to the infection by day seven post-infection (as
illustrated in Figures 10a and 10c). In the OCH-treated mice, although there is little
mitigation of the body weight loss (Figure 10b and Figure 10d), a significant decrease
in disease severity was observed by improved survival (P<0.05) (Figure 10a and
Figure 10c).

These findings suggested that properly activating NKT cell function in the right timing
can significantly reduce disease severity and enhance survival. Understanding this
temporal relevance of NKT cell function could guide targeted immunomodulatory
strategies, adjusting these cells' activity according to the disease stage, thereby
opening novel therapeutic possibilities.

8. Role of NKT cells and potential therapeutic interventions in mouse-adapted
SARS-CoV-2 models

Our study demonstrated that activation of NKT cells reduced the severity of viral
infection in hACE2-Tg mice. Nonetheless, the hACE2-Tg mouse model has
limitations and does not fully emulate the human infection process. To portray the

28
human viral pathogenesis more naturally, we adopted the recently developed
mouse-adapted viruses, better mimicing the infection in human.

Both wild-type C57BL/6 mice and CD1d knockout mice, which lack all NKT cells,
were infected intranasally with mouse-adapted (MA) viruses (CMAp20 strain) at a
dose of 1X10^6 pfu per mouse [51]. Interestingly, the MA virus triggered a less severe
disease and weight loss in wild-type C57BL/6 mice, while the viruses led to a weight
loss of up to 15% in CD1d knockout mice, with the peak at day 3 post-infection.
(Figure 11a).
After infecting Balb/c mice with the MA virus. We subsequently treated them with
α-GalCer and activated their iNKT cells. Remarkably, treated Balb/c mice
experienced minimal weight loss compared to the control mice (Figure 11B). These
results highlight the critical role of NKT cells in immune defense against viral
infections and elucidate the potential of cellular ligands for iNKT cells as promising
therapeutic tools.

29
Chapter Four: Discussion

In examining the SARS-CoV-2 and CD1d/NKT antigen presentation pathway
interface, we have unveiled vital insights that enrich our comprehension of
SARS-CoV-2 pathogenesis and illuminate potential avenues for therapeutic
intervention. Our work provides insight into the role between the transmembrane
domain of the SARS-CoV-2 envelope protein and the CD1d molecule on
antigen-presenting cells (APCs). Moreover, we explored the effects of these
interactions on the activation of invariant natural killer T (iNKT) cells and the impact
on the subsequent immune response. Accordingly, given their critical role in the
immune response, we have extended our exploration to the impacts of iNKT cell
activation and downregulation on viral infection progression.

Our research indicates that the SARS-CoV-2 envelope protein, specifically its
transmembrane domain, triggers the downregulation of CD1d, a cell surface
glycoprotein akin to MHC class I that presents lipid antigens to NKT cells. The impact
of CD1d downregulation on NKT cell function is significant, alluding to potential
mechanisms through which viruses might evade the immune system, especially
considering the involvement of viral envelope proteins and their transmembrane
domain. However, our observations reveal that specific amino acid sequences within
the transmembrane domain can mitigate the downregulatory effect of the
SARS-CoV-2 envelope protein on CD1d. As we reduce the number of amino acids at
the c-terminus of the transmembrane domain, CD1d downregulation becomes
increasingly less significant, signaling the pivotal role of specific amino acids in
immune modulation and outlining future directions for future research.

The ion channel function of the SARS-CoV-2 E protein has been previously identified
as a critical player in the propagation and release of viral progeny and a significant
determinant of host immune response. Our study shows that inhibiting this function

30
substantially curbs E protein-induced CD1d downregulation, suggesting that
impeding this ion channel function might be a promising counterstrategy against
immune evasion tactics. Moreover, we discovered that E protein-mediated CD1d
downregulation could be significantly reduced with the administration of MG132 and
chloroquine, implying that the degradation of CD1d orchestrated by the SARS-CoV-2
E proteins potentially involves host cell proteasome and lysosome degradation
pathways. Intriguingly, inhibiting these pathways restored CD1d levels, revealing
potential therapeutic interventions.

Of notable significance, our findings accentuate the therapeutic potential of NKT cells
in counteracting SARS-CoV-2-induced immunosuppression. Activating NKT cells
using α-galactosylceramide (α-GalCer) attenuates the virus's pathogenic effects and
boosts host survival. Meanwhile, our experiments unveiled the nuanced role of NKT
cells during infection. While inducing a Th2-type NKT cell response during the initial
infection stages exacerbates disease outcomes, activating these Th2-type responses
during later stages may help taming the hyperinflammation and bring about
improvements. This highlights the multifaceted, temporal role of NKT cells in
SARS-CoV-2 infection, suggesting that properly adjusting these cells' activity
according to disease progression could hold therapeutic promise.

In our final experiments, we performed experiments using mouse-adapted viruses,
and we aimed to better mimic the infection and treatment effects in humans. We
found that stimulating NKT cells lessened SARS-CoV-2 infection severity and that
therapeutically activating NKT cells offered promising outcomes in mitigating
SARS-CoV-2 pathogenesis. These findings underscore NKT cells' crucial role in
immune evasion from SARS-CoV-2 and emphasize the potential of NKT cell ligands
as therapeutic agents.

31
Our investigation illuminates the complex dynamics between SARS-CoV-2 and the
CD1d/NKT antigen presentation pathway. The knowledge gleaned from our study
forms a foundation for developing novel therapeutic approaches, underscoring the
urgency for continued research in this field.

32
References
[1] Guan WJ, Ni ZY, Hu Y, et al.. Clinical characteristics of coronavirus disease 2019
in China. N Engl J Med. 2020;382(18):1708–1720.
[2] Zhu N, Zhang D, Wang W, China Novel Coronavirus Investigating and Research
Team, et al.. A novel coronavirus from patients with pneumonia in China, 2019. N
Engl J Med. 2020;382(8):727–733.
[3] Fernandes Q, et al. Emerging COVID-19 variants and their impact on
SARS-CoV-2 diagnosis, therapeutics and vaccines. Ann Med. 2022
Dec;54(1):524-540.
[4] Lin, Cheng-Yao MD, MSa,b,c; Su, Shih-Bin MD, PhDd; Chen, Kow-Tong MD,
PhDe,f,*. An overview of gastrointestinal diseases in patients with COVID-19: A
narrative review. Medicine 101(36):p e30297, September 09, 2022.
[5] Hartenian E, et al. The molecular virology of coronaviruses. J Biol
Chem. 2020;295:12910–12934.
[6] Cortese M, et al. Integrative Imaging Reveals SARS-CoV-2-Induced Reshaping of
Subcellular Morphologies. Cell Host Microbe. 2020;28:853–866.:e5.
[7] Snijder EJ, et al. A unifying structural and functional model of the coronavirus
replication organelle: tracking down RNA synthesis. PLoS Biol. 2020;18:e3000715.
[8] Stertz S, et al. The intracellular sites of early replication and budding of
SARS-coronavirus. Virology. 2007;361:304–315.
[9] Neuman, B.W., et al(2011). A structural analysis of M protein in coronavirus
assembly and morphology. J Struct Biol 174, 11–22.
[10] Ke Z, Oton J, Qu K, Cortese M, Zila V, McKeane L, et al. Structures and
distributions of SARS-CoV-2 spike proteins on intact virions. Nature. 2020;588:1-7.

33
[11] Lan J, Ge J, Yu J, Shan S, Zhou H, Fan S, et al. Structure of the SARS-CoV-2
spike receptor-binding domain bound to the ACE2 receptor. Nature. 2020;581:215-20.
[12] Vandelli A, Monti M, Milanetti E, Armaos A, Rupert J, Zacco E, et al. Structural
analysis of SARS-CoV-2 genome and predictions of the human interactome. Nucleic
Acids Res. 2020;48:11270-83.
[13] Yan R., Zhang Y., Li Y., Xia L., Guo Y., Zhou Q. Structural basis for the
recognition of SARS-CoV-2 by full-length human ACE2. Science. 2020;367:1444–
1448. doi: 10.1126/science.abb2762.
[14] Neuman BW, Kiss G, Kunding AH, et al. A structural analysis of M protein in
coronavirus assembly and morphology. J Struct Biol. 2011;174:11–22.
[15] Tang T, Bidon M, Jaimes JA, Whittaker GR, Daniel S. Coronavirus membrane
fusion mechanism offers a potential target for antiviral development. Antiviral Res.
2020;178:104792.
[16] Lan J, Ge J, Yu J, Shan S, Zhou H, Fan S, et al. Structure of the SARS-CoV-2
spike receptor-binding domain bound to the ACE2 receptor. Nature. 2020;581:215-
20.
[17] Narayanan K, Chen CJ, Maeda J, Makino S. Nucleocapsid-independent specific
viral RNA packaging via viral envelope protein and viral RNA signal. J Virol.
2003;77:2922-7.
[18] Kadam SB, et al. SARS-CoV-2, the pandemic coronavirus: Molecular and
structural insights. J Basic Microbiol. 2021 Mar;61(3):180-202.
[19] McBride R, van Zyl M, Fielding BC. The coronavirus nucleocapsid is a
multifunctional protein. Viruses. 2014;6:2991-3018.
[20] Alam I, Kamau AA, Kulmanov M, Jaremko Ł, Arold ST, Pain A, et al. Functional
pangenome analysis suggests inhibition of the protein E as a readily available therapy
for COVID-2019. Front Cell Infect Microbiol. 2020;10:405.

34
[21] Wilson L, Mckinlay C, Gage P, Ewart G. SARS coronavirus E protein forms
cation-selective ion channels. Virology. 2004;330:322-31.
[22] Nieva JL, Madan V, Carrasco L. Viroporins: structure and biological
functions. Nat Rev Microbiol. 2012;10:563-74.
[23] Zhang R, Wang K, Lv W, Yu W, Xie S, Xu K, et al. The ORF4a protein of human
coronavirus 229E functions as a viroporin that regulates viral production. Biochim
Biophys Acta–Biomembr. 2014;1838:1088-95.
[24] Liao Y, Tam JP, Liu DX. Viroporin activity of SARS-CoV E protein. Adv Exp Med
Biol. 2006;581:199-202.
[25] Pham T, Perry JL, Dosey TL, Delcour AH, Hyser JM. The rotavirus NSP4
viroporin domain is a calcium-conducting ion channel. Sci Rep. 2017;7:43487.
[26] Wu Q, Zhang Y, Lü H, Wang J, He X, Liu Y, et al. The E protein is a
multifunctional membrane protein of SARS-CoV. J Genomics Proteomics.
2003;1:131-44.
[27] DeDiego ML, Nieto-Torres JL, Jiménez-Guardeño JM, Regla-Nava JA, Álvarez E,
Oliveros JC, et al. Severe acute respiratory syndrome coronavirus envelope protein
regulates cell stress response and apoptosis. PLOS Pathog. 2011;7(10):e1002315.
[28] Bordag N, Keller S. α-Helical transmembrane peptides: a “divide and conquer”
approach to membrane proteins. Chem Phys Lipids. 2010;163:1–26.
[29] Alam I, Kamau AA, Kulmanov M, et al. Functional pangenome analysis shows
key features of e protein are preserved in sars and sars-cov-2. Front Cell Infect
Microbiol. 2020;10:405.
[30] Nieva JL, Madan V, Carrasco L. Viroporins: Structure and biological
functions. Nat Rev Microbiol. 2012;10:563–574.

35
[31] Gonzalez ME, Carrasco L. Viroporins. FEBS Lett. 2003;552:28–34.
[32] Suzuki T, Orba Y, Makino Y, et al. Viroporin activity of the JC polyomavirus is
regulated by interactions with the adaptor protein complex 3. Proc Natl Acad Sci U S A.
2013;110:18668–18673.
[33] Kern DM, Sorum B, Hoel CM, et al. Cryo-EM structure of the SARS-CoV-2 3a ion
channel in lipid nanodiscs. BioRxiv. 2020;6(17):15644. 10.1101/2020.06.17.156554.
[34] Yue Y, Nabar NR, Shi C-S, et al. SARS-coronavirus open reading frame-3a
drives multimodal necrotic cell death. Cell Death Dis. 2018;9:1–15.
[35] Nieto-Torres JL, DeDiego ML, Verdiá-Báguena C, et al. Severe acute respiratory
syndrome coronavirus envelope protein ion channel activity promotes virus fitness
and pathogenesis. PLoS Pathog. 2014;10(5):e1004077.
[36] Mandala VS, McKay MJ, Shcherbakov AA, Dregni AJ, Kolocouris A, Hong
M. Structure and drug binding of the SARS-CoV-2 envelope protein transmembrane
domain in lipid bilayers. Nat Struct Mol Biol. 2020;27:1202–1208.
[37] Parthasarathy K, Lu H, Surya W, Vararattanavech A, Pervushin K, Torres
J. Expression and purification of coronavirus envelope proteins using a modified β-
barrel construct. Protein Expr Purif. 2012;85:133–141.
[38] Berterame NM, Porro D, Ami D, Branduardi P. Protein aggregation and
membrane lipid modifications under lactic acid stress in wild type and OPI1
deleted Saccharomyces cerevisiae strains. Microb Cell Fact. 2016;15:1–12.
[39] Cao Y, Yang R, Wang W, et al. Computational study of the ion and water
permeation and transport mechanisms of the SARS-CoV-2 pentameric E protein
channel. Front Mol Biosci. 2020;7:270.
[40] Hiroyasu Ito, et al. Role of Vα 14 NKT cells in the development of impaired liver
regeneration In Vivo,Hepatology, Volume 38, Issue 5, 2003, Pages 1116-1124, ISSN
0270-9139

36
[41] Bailey JC, et al. Inhibition of CD1d-mediated antigen presentation by the
transforming growth factor-β/Smad signalling pathway. Immunology. 2014
Dec;143(4):679-91.
[42] Taniguchi M, Seino K, Nakayama T. The NKT cell system: bridging innate and
acquired immunity. Nat. Immunol. 2003; 4,: 1164-1165
[43] Lu H, et al. (2023) Potent NKT cell ligands overcome SARS-CoV-2 immune
evasion to mitigate viral pathogenesis in mouse models. PLoS Pathog 19(3):
e1011240.
[44] Ho L. P., Denney L., Luhn K., Teoh D., Clelland C., McMichael A. J.. 2008.
Activation of invariant NKT cells enhances the innate immune response and improves
the disease course in influenza A virus infection. Eur. J. Immunol. 38: 1913–1922.
[45] Godfrey D. I., Stankovic S., Baxter A. G.. 2010. Raising the NKT cell family. Nat.
Immunol. 11: 197–206.
[46] Carnaud C., Lee D., Donnars O., Park S. H., Beavis A., Koezuka Y., Bendelac A..
1999. Cutting edge: cross-talk between cells of the innate immune system: NKT cells
rapidly activate NK cells. J. Immunol. 163: 4647–4650.
[47] Huang C, Wang Y, Li X, et al. Clinical features of patients infected with 2019
novel coronavirus in Wuhan, China. Lancet. 2020;395:497–506.
[48] Li S, Li X, et al. Clinical and pathological investigation of severe COVID-19
patients. JCI Insight. 2020;5:e138070.
[49] Mandala, V.S., McKay, M.J., Shcherbakov, A.A. et al. Structure and drug binding
of the SARS-CoV-2 envelope protein transmembrane domain in lipid bilayers. Nat
Struct Mol Biol 27, 1202–1208 (2020).
[50] Kenji Izuhara, Yamamoto, Periostin in Allergic Inflammation, Allergology
International, Volume 63, Issue 2, 2014, Pages 143-151, ISSN 1323-8930.

37
[51] Muruato A, et al. Mouse Adapted SARS-CoV-2 protects animals from lethal
SARS-CoV challenge. bioRxiv. 2021 May

38
Figures

Figure 1. Transmembrane domain in the envelope protein downregulate the
expression of CD1d on the surface of APC, while regions containing 21 amino
acids in transmembrane regions restore the effect. A. Indicative images of the
different deletion mutants generated in the study. B. Western blot results of
transfected samples. The SARS-CoV-2 E protein and TM transfected group showed
lower CD1d than the control group, while in TM21 transfected group showed no
reduction effect. The anti-Strep blot confirmed the expression of viral proteins in the
cells. C. Flow cytometry data analyzed. The yellow line represents isotype control, the
red line represents GFP-positive cells, and the blue line represents GFP-negative
cells. The shift of the peak to the left indicates a decrease in CD1d signal intensity,
which implies a decrease in cell surface CD1d levels. In this figure, the SARS-CoV-2
E group and TM transfected group showed lower CD1d levels compared to the control
group, while TM21 transfected group showed no downregulation of CD1d levels when
compared with the control group.

39

Figure 2. Specific amino acid sequences in the transmembrane region
effectively counteract the downregulation effect of CD1d by the envelope
protein. A. Indicative images of the different deletion mutants generated in the study.
B. Flow cytometry data analyzed. The SARS-CoV-2 E, TM, and TM-N-DEL
transfected groups showed greater levels of CD1d downregulation compared to the
control group. The TM21 and TM-C-DEL transfected groups showed no significant
downregulation of CD1d levels compared to the control group. C. Quantitative
analysis of FACS results. the E, TM, TM-N-DEL transfected groups showed
significantly lower CD1d levels than the control group (P<0.0001), while the
SARS-CoV-2 TM21 and TM-C-DEL transfected groups showed not significantly lower
CD1d levels than the control group. Statistical analyses were performed by unpaired
Student’s t-test and one-way ANOVA test. *, **, ***, ****: p<0.05, p<0.01, p<0.001,
p<0.0001. ns: not significant. D. Western blot results of transfected samples. The
anti-Strep blot confirmed the expression of viral proteins in the cells.

40

Figure 3. SARS-CoV-2 envelope protein and mutation localization in the cells.
Green corresponds to E protein and mutant staining. Red corresponds to mature
CD1d staining. For the CD1d expression change, the IF analysis showed cells that
were transfected with full-length E protein, TM, the surface expression of CD1d
was downregulated compared to untransfected cells.

41

Figure 4. The downregulation effect of the transmembrane domain on CD1d is
diminished by the decreasing of crucial amino acids in the c terminals of TM A.
Amino acid alignments of the different deletion mutants generated in this study. B.
Quantitative analysis of FACS results. CD1d levels were significantly lower in the TM,
TM-C-Ronly-DEL, and TM-C-LR-DEL transfected groups compared to the control
group (p<0.001), while the SARS-CoV-2 TM- C-ALR-DEL and TM-C-DEL transfected
groups did not have significantly lower CD1d compared with the control group. The
level of CD1d downregulation diminished with the increasing number of amino acids
removed from the C-terminus compared to the relative CD1d downregulation in the
TM group. C. Quantitative analysis of FACS results. The level of CD1d
downregulation diminished with the increasing number of amino acids removed from
the C-terminus compared to the relative CD1d downregulation in the TM group.

42

Figure 5. The downregulation of CD1d mediated by the envelope protein
requires ion channel activity. 293T.CD1d cells were transfected to express the TM
of the E protein and treated with a gradient elevated concentrations of ion channel
inhibitors, amantadine or hexamethylene-amiloride (HMA). Cell surface CD1d
expression was analyzed by flow cytometry 48 h after transfection. The relative
downregulation of CD1d after ion channel inhibitor treatment was calculated. The
downregulation of CD1d after 48 h post-transfection showed a significant
dose-dependent alleviation upon treatment with amantadine or HMA.

43

Figure 6 Envelope protein instigates the degradation of the CD1d protein,
utilizing a process that is reliant on both proteasomes and lysosomes. Western
blot analysis confirmed that the group transfected with E protein was able to restore
CD1d levels to those observed in untransfected cells after treatment with MG132 or
chloroquine, which showed inhibition of proteasome and lysosome function,
respectively.

44

Figure 7. Stimulating NKT cells reduces the inhibitory effects of SARS-CoV-2,
leading to less severe illness and increased survival rates in mice. Figure A
represents SARS-CoV-2 2 (Isolate USA-WA1/2020, 1X10e4 pfu per mouse) infected
mice. The experiment involved K18-hACE2-Tg mice, which express the human ACE2
receptor. Mice were divided into two groups, each consisting of four mice. One group
received a single dose of α-galactosylceramide (α-GalCer) treatment (2 μg per
mouse), while the other group served as a control. Figure B shows the survival rate of
the experimental group, which was significantly higher in the group receiving
α-galactosylceramide (α-GalCer) than in the control group. Figure C shows the
relative body weights of the experimental groups expressed as mean ± standard
deviation (s.d.). This measurement was used to monitor the overall health status of
the mice during the study.
0 2 4 6 8 10
0.8
0.9
1.0
1.1
1.2
POI
Relative body weight
α-GalCer treated weight(7/13/22)
Control (n=4)
a-GalCer (n=4)

45

Figure 8. Activation of NKT cells post infection alleviated the severity of the
disease and enhanced the survival rate in mice. Mice were divided into two groups,
each consisting of ten mice. Two groups received a single dose of
α-galactosylceramide (α-GalCer) treatment (2 μg per mouse) at 0- and 1-days
post-infection, and the two other groups served as a control. Figures A and C show
the survival rate of the experimental group was significantly higher compared to the
control group. Animal survival rates were compared using the Mantel-Cox log-rank
test, with a significance level of ** p<0.01. Figures B and D show the relative body
weights of the experimental groups expressed as mean ± standard deviation (s.d.).

46

Figure 9. Restricting NKT cells in the initial stage of infection in mice amplifies
the severity. The study involved two groups of five mice each. Two groups received
OCH treatment (3 μg per mouse) at DPI (Days post infection) 1 and 2, while the other
two groups served as controls. Figures A and C illustrate the decreased survival rate
in the experimental group compared to the control group (P<0.05). The Mantel-Cox
logarithm test was used to compare animal survival rates. Figures B and D present
the mean ± standard deviation (s.d.) of relative body weights for the experimental
groups, which served as an indicator of overall health status during the study.

47

Figure 10. Restricting NKT cells in the advanced phase of infection lessens the
disease's severity. The study involved two groups of five mice each. Two groups
received OCH treatment (3 μg per mouse) at DPI (Days post infection) 3 and 4, the
other two groups served as controls. Figure A represents the experimental group
treated with OCH at DPI-3, with increased survival compared to the control group.
Figure C represents the experimental group treated with OCH at DPI-4, with
increased survival compared to the control group. Figures B and D present the mean
± standard deviation (s.d.) of relative body weights for the experimental groups, which
served as an indicator of overall health status during the study. Statistical analysis
was performed using the Mantel-Cox logarithm test, with * indicating a significance
level of P<0.05 and ** indicating a significance level of P<0.001.

48

Figure 11. iNKT cells are vital in producing optimal immune reactions to combat
infection. A. Relative body weight of two groups, C57BL/6 mice and
mCD1d-knockout (CD1d-/-) mice. The study involved two groups of five mice each.
Both were infected with the mouse adapted CMAp20 strain of the virus (1X10e6
pfu/mouse). B. Relative body weights of Balb/c mice infected with the CMAp20 virus
strain (1X10e6 pfu/mouse). These mice were divided into two groups of five mice
each, and one group are treated with α-GalCer. The study monitored the daily body
weight of the mice to assess disease progression. Statistical analysis was performed
using two-way ANOVA followed by a Sidak post-hoc test, with ** indicating a
significance level of P<0.01 and *** indicating a significance level of P<0.001.

Abstract (if available)

Abstract The worldwide pandemic of COVID-19, attributable to the SARS-CoV-2, has exacted an immense and devastating impact on human lives. Elucidating the precise pathogenic mechanisms of this virus is essential for the development of effective antiviral strategies. A characteristic of SARS-CoV-2 is its potential to evade and suppress the human innate immune response, leading to its pathogenicity. CD1d-restricted NKT cells, an integral subset of innate T cells, play a pivotal role in the initial stages of viral pathogenesis. Our research delves into the intricate interactions between SARS-CoV-2 and the CD1d/NKT antigen presentation pathway to gain deeper insights into this virus's pathogenesis and pinpoint potential therapeutic interventions. We found that the transmembrane domain of the SARS-CoV-2 envelope protein instigates CD1d downregulation, potentially facilitating immune evasion. Further studies revealed that curtailing the ion channel function of the SARS-CoV-2 E protein dramatically stymies CD1d downregulation, proposing a potential counterstrategy against immune evasion.
Our investigation underscores the therapeutic role of NKT cells, demonstrating that their activation may mitigate the deleterious effects of the virus. Moreover, our findings suggested that adjusting NKT cell activity by disease progression may offer therapeutic advantages, emphasizing the potential utility of NKT cell ligands as therapeutic agents. This study sheds light on the intricate dynamics between SARS-CoV-2 and the CD1d/NKT antigen presentation pathways, paving the way for the development of optimal therapeutic strategies.

Linked assets

University of Southern California Dissertations and Theses

Conceptually similar

PDF

The role of envelope protein in SARS-CoV-2 evasion of CD1d antigen presentation pathway

PDF

SARS-CoV-2 suppression of CD1d expression and NKT cell function

PDF

Comparative studies of coronavirus interaction with CD1d-restricted iNKT cells

PDF

SARS-CoV-2 interaction with the CD1d/NKT cell antigen presentation system

PDF

Investigating the role of ion channel activity of coronaviruses envelope protein in CD1d regulation

PDF

Molecular mechanism for the immune evasion of CD1d antigen presentation by herpes simplex virus-1 UL56 protein

PDF

Mechanistic insights into HSV-1 UL56-mediated immune evasion through CD1d downregulation and NKT cell suppression

PDF

Herpes simplex virus-1 and immune evasion: the mechanistic role of UL56 and Nedd4 family ubiquitin ligases in CD1d downregulation

PDF

Herpes Simplex virus-1 UL56 collaborates with Nedd4 E3 ubiquitin ligase to downregulate surface CD1d and facilitate immune evasion of NKT cell function

PDF

HSV-1 UL56 serves as a potential Nedd4L E3 ligase adaptor for CD1d downregulation

PDF

The analysis and modeling of signaling pathways induced by the interactions of the SARS-CoV-2 spike protein with cellular receptors

PDF

A rigorous benchmarking of methods for SARS-CoV-2 lineage abundance estimation in wastewater

PDF

Mechanism of ethanol-mediated increase of SARS-COV-2 entry through GRP78 induction

PDF

Identification of molecular mechanism for cell-fate decision in liver; &, SARS-CoV replicon inhibitor high throughput drug screening

PDF

Pseudotyped viral vectors: HIV gene therapy applications and basic studies of SARS-COV-2

PDF

APOBEC RNA mutational signatures and the role of APOBEC3B in SARS-CoV-2 infection

Asset Metadata

Creator Deng, Xiangxue (author)

Core Title The interaction of SARS-CoV-2 with CD1d/NKT antigen presentation pathway

School Keck School of Medicine

Degree Master of Science

Degree Program Molecular Microbiology and Immunology

Degree Conferral Date 2023-08

Publication Date 07/26/2023

Defense Date 06/09/2023

Publisher University of Southern California. Libraries (digital)

Tag antiviral strategies,CD1d/NKT antigen presentation pathway,CD1d-restricted NKT cells,COVID-19,disease progression,downregulation of CD1d,immune evasion,immune system dynamics,innate immune response,ion channel function,NKT cell activation,NKT cell ligands,OAI-PMH Harvest,SARS-CoV-2,SARS-CoV-2 E protein,SARS-CoV-2 envelope protein,SARS-CoV-2 pathogenicity,therapeutic advantages,therapeutic interventions,therapeutic strategies,transmembrane domain,viral pathogenesis

Language English

Contributor Electronically uploaded by the author (provenance)

Advisor Yuan, Weiming (committee chair), Mullen, Peter (committee member), Schönthal, Axel (committee member)

Creator Email xiangxue@usc.edu,xiangxue0124@gmail.com

Permanent Link (DOI) https://doi.org/10.25549/usctheses-oUC113290644

Unique identifier UC113290644

Identifier etd-DengXiangx-12153.pdf (filename)

Legacy Identifier etd-DengXiangx-12153

Document Type Thesis

Rights Deng, Xiangxue

Internet Media Type application/pdf

Type texts

Source 20230728-usctheses-batch-1075 (batch), University of Southern California (contributing entity), University of Southern California Dissertations and Theses (collection)

Access Conditions The author retains rights to his/her dissertation, thesis or other graduate work according to U.S. copyright law. Electronic access is being provided by the USC Libraries in agreement with the author, as the original true and official version of the work, but does not grant the reader permission to use the work if the desired use is covered by copyright. It is the author, as rights holder, who must provide use permission if such use is covered by copyright.

Repository Name University of Southern California Digital Library

Repository Location USC Digital Library, University of Southern California, University Park Campus, Los Angeles, California 90089, USA

Repository Email cisadmin@lib.usc.edu