University of Southern California Dissertations and Theses

Targeting mitochondrion-nucleus PDH1 transfer to suppress self-renewal and epigenetic NANOG reprogramming of tumor-initiating cells

(USC Thesis Other)

Targeting mitochondrion-nucleus PDH1 transfer to suppress self-renewal and epigenetic NANOG reprogramming of tumor-initiating cells

PDF

Download a page range

Download transcript

Copy asset link

Request this asset

Transcript (if available)

Content
Targeting mitochondrion-nucleus PDH1 transfer to suppress self-renewal and
epigenetic NANOG reprogramming of tumor-initiating cells.

By

Simran Mehta

A Thesis Presented to the
FACULTY OF THE USC
KECK SCHOOL OF MEDICINE
In Partial Fulfillment of the
Requirements for the Degree
MASTER OF SCIENCE
(MOLECULAR MICROBIOLOGY AND IMMUNOLOGY)

August 2023

ii

Acknowledgments
I would like to express my sincere gratitude to the University of Southern California for
giving me the opportunity to fulfill my dream of one day being a student here. I would also like
to thank the Molecular Microbiology and Immunology department of the Keck School of
Medicine, USC for providing me with encouragement and guidance throughout my education
at USC. This thesis could not have been completed without the help of special mentors who
challenged, supported, and guided me along the way.
I would like to give special thanks to my committee chair and PI, Dr. Keigo Machida,
who has continually pushed me to achieve my full potential. It was a great honor to be part of
Dr . M a ch ida ’s lab oratory, and I am grateful for all the time he has taken to have individual
meetings with me. His encouragement and guidance made completing long days full of tedious
work feel very rewarding. I would also like to thank my committee members, Dr. Joseph
Landolph and Dr. Bangyan Stiles, who each deserve individual recognition.
I would like to give a big thank you to Dr. Bangyan Stiles for her support and willingness to help
me and provide any materials needed to complete my experiments. I am truly grateful to have
received your feedback on my presentations and writing. I would also like to give a big thanks
to Dr. Joseph R Landolph. It was a great privilege to have learned from you during a semester
of Cancer Biology. Your lectures have helped me obtain better experimental results and have
also made a positive impact on my future education. I would like to thank the post-doctoral
fellow Dr. Hye Yeon Choi in my lab for her guidance and supervision in performing complex
experiments, and a sincere thanks to Prof. Ram Murali at Cedars-Sinai Medical Institute for
providing the in-silico docking analysis data.

iii

TABLE OF CONTENTS

1. A ckn o wl e d g e m e n ts… ……………………………………………………………………….ii
2. List of T a b les………… ………………………………………………………………………iv
3. L ist o f Fi g u res……… …………………………………………………………………… …...v
4. Chapter One: A b stra ct ……………………………………………………………………….1
5. Chapter Two: I n tro d u ct ion …………………………………………………………………...2
6. Chapter Three: M a te ri a ls a n d Me th o d s…… . ………………………………………………9
7. Chapter Four: Res u lts ……………………………………………………………………….16
8. Chapter Five: Di scu ssi o n ……………………… …………………………………………...24
9. Chapter Six: Conclusions and Future Di rect io n s……………………………………… …27
10. Chapter Seven: T a b les …………………………………………………………………… …30
11. Chapter Eight: Fi g u res …………. ………………………………………………………… …36
12. Chapter Nine: Re fe ren ce s…….. ……………… ……………………………………………45

iv

List of Tables
Table 1: Plasmids used in the present study …………………………………………………….3 0
Table 2: shRNA oligonucleotides used for TBC1D15, NOTCH1 and PDH knockdown in
Huh7 cells …………………………………………………………………………………………….30
Table 3: Clinical pathological information of FFPE tissue …………… …………………………3 1
Table 4: Antibodies used in the present study ……………………………………………………3 1
Table 5: List of NCI drug candidates ………… ……………………………………………………3 2
Table 6: List of ChemBridge LLC shortlisted small molecule inhibitors ……………………….. 3 3

v

List of Figures
Figure 1: TBC1D15 and NOTCH1 levels are elevated in hepatocellular
carcinoma …………… ……………………………………………………………………………….36
Figure 2: TBC1D15 interacts with PEST domain of NOTCH1 to activate NOTCH1
pathway ……………………………………………………………………………………………….3 7
Figure 3: Tripartite complex formation of TBC1D15, NOTCH1 and FIS1 is dependent on
NICD and TBC1D15 … ………………………………………………………………………………3 8
Figure 4: TBC1D15-NICD interactions promote mitochondrial recruitment to perinuclear
regions, increase mitochondrial diameter, and regulate mitochondrial gene expression … ….3 9
Figure 5: In-silico docking analysis to screen drug inhibitory effect against TBC1D15 –
NOTCH1 interaction … …………………………………………………………………………….…4 0
Figure 6: Inhibitor B inhibits TIC self-renewal and tumor-initiation property ………………….. 4 2
Figure 7: Nuclear localization of PDHA1 in a manner dependent on TBC1D15 …………….. 4 3

1

Chapter One: Abstract
Hepatocellular carcinoma (HCC) is the fifth most frequent malignancy worldwide, with a
median survival time of 6 to 16 months post-diagnosis (Mak et al., 2018). Late-onset diagnosis,
underlying cirrhosis, and resistance to chemotherapy are all factors that contribute to the poor
prognosis; 40% of HCCs are clonal and so may emerge from progenitor/stem cells. A growing
body of evidence suggests that tumor initiating stem-like cells (TICs) drive HCC development.
We identified TBC1D15- mediated downstream pathways involved in promoting self-renewal
of tumor initiating stem-like cells and hence, stimulating tumorigenic environment. TBC1D15
interacts with NOTCH1 to stabilize and activate the NOTCH pathway in TICs. Co-IP analysis
using different NOTCH1 deletion mutants demonstrated that TBC1D15 interaction with
NOTCH1 is through the PEST domain at the C-terminal of NOTCH. We validated the activation
of the NOTCH pathway through the luciferase assay performed using a HEY1-luc construct.
Co-IP research revealed that NICD interacts with TBC1D15 and FIS1 at the mitochondrial outer
membrane in TICs. TBC1D15-NOTCH1-FIS1 complex formation enhanced mitochondrion-
nucleus spatial proximity and the development of this triple protein complex was dependent on
Notch intracellular domain (NICD) and was essential for PDH1 nuclear translocation. Extensive
small molecule inhibitor screening identified one inhibitor that blocks the interaction between
TBC1D15 and NOTCH1 and exhibited a potent TIC killing effect.

Key words: HCC, TBC1D15-NOTCH1 interaction, small molecule inhibitor, TICs.

2

Chapter Two: Introduction
Hepatocellular cancer (HCC) is the fourth greatest cause of cancer deaths worldwide,
and the leading cause of cancer death in low-income nations (Melendez-Torres and Singal,
2022). Its incidence rates vary broadly, with more than 80% of all cases occurring in poor and
middle-income nations, with notably high incidence rates in East Asia and Sub-Saharan Africa
(Yang and Heimbach, 2020). HCC is the fastest growing cause of cancer-related death in the
United States, with a 5-year survival rate of fewer than 12% (Mittal and El-Serag, 2013).
Between 1975 and 2007, the incidence of HCC increased three-fold in both sexes. The aging
group with chronic hepatitis C infection was responsible for over half of the rise in HCC cases.
Chronic hepatitis B and hepatitis C, alcohol addiction, metabolic liver disease (especially non-
alcoholic fatty liver disease), and exposure to food toxins, such as aflatoxins and aristolochic
acid, are all risk factors for induction of HCC (Yang et al., 2019).
Alcohol-related liver disease is the most common kind of chronic liver disease globally,
accounting for 30% of hepatocellular carcinoma (HCC) cases and HCC-specific fatalities
(Ganne-Carrié and Nahon, 2019). Ample epidemiological research demonstrates that there is
a strong link between hepatitis C virus (HCV) and alcoholic liver disease (ALD). For starters,
the frequency of HCV infection in alcoholics is much higher than in the overall population
(Heintges and Wands, 1997). Second, the presence of HCV infection correlates with the
severity of the disease in alcoholic subjects, HCV-infected ALD patients develop liver cirrhosis
and HCC at significantly faster rates than uninfected ALD patients, implying that alcohol and
HCV act synergistically to cause liver damage (Berchot et al., 2018). Co-morbidities such as
obesity/alcoholism with HCV infection increase the risk of developing HCC (Chen et al., 2014).
3

All these risk variables are potentially preventable, emphasizing the significant potential for risk
reduction in reducing the worldwide burden of HCC.
HCC is a disease that is both biologically complicated and very diverse. The bulk tumor
is made up of a heterogeneous collection of cells with varying molecular fingerprints and levels
of susceptibility to treatment. Heterogeneity fuels treatment resistance and has far-reaching
ramifications for cancer therapy and biomarker identification (Dagogo-Jack and Shaw, 2018).
Moreover, recent studies have suggested that tumor heterogeneity is a result of the hierarchical
organization of tumor cells by a subpopulation of cells with stem/progenitor cell features known
as tumor-initiating stem-like cells (TICs) (Yamashita and Wang, 2013). TICs, which were first
postulated over 40 years ago, have just lately been found in hematological cancers and solid
tumors such as the liver, colon, prostate, breast, and brain (Tang et al., 2008).
Stem cells are distinguished by their ability to self-renew themselves via asymmetrical
cell division, long-term tissue reconstitution, and serial transplantability. Through genetic
mutations, epigenetic disruption, signaling pathway dysregulation, or microenvironmental
changes, TICs play essential roles in controlling HCC stemness, self-renewal, recurrence,
metastasis, and treatment resistance (Liu et al., 2020). EpCAM, CD133, CD47, CD44,
CD24, CD13, CD90, and OV6 have all been identified as surface markers of HCC. Initially
derived from Huh7, a benign HCC cell line, the CD133+ subpopulation has been demonstrated
to have possible roles in proliferation and carcinogenesis (Suetsugu et al., 2006). Furthermore,
65% of human HCC cells are CD133+. CD133 knockout in HCC cells has been shown to
diminish tumorigenicity and cell cycle progression (Ma et al., 2007). Similar results were
reported in clinical HCC patients, where elevated CD133 expression was linked to a poor
outcome (Yu et al., 2018).
4

Obesity and alcoholism increase intestinal permeability, resulting in endotoxemia, which
activates Toll-like receptor 4 (TLR4) in the liver, leading to cytokine production and an
inflammatory response (Hritz et., al, 2008). It has been previously established that mice given
alcohol for 12 months develop liver tumors in a TLR4-dependent way by employing animals
with liver-specific expression of the HCV NS5A protein (Chen et al., 2013). TLR4 is ectopically
activated in hepatocytes/hepatoblasts by the HCV viral protein NS5A. TLR4 binds endotoxin,
activating hepatocytes and inducing NANOG, a stem cell marker. TLR4/ NANOG-dependent,
chemo-resistant tumor-initiating stem-like cells (TICs; CD133+) are generated throughout this
phase and can develop into HCC in mice (Chen et al., 2013).

Fig. 1: Schematic diagram depicting the influence of alcohol intake in the activation of
NANOG, a stem-cell related gene to promote liver cancer.

The Notch signaling system is an evolutionarily conserved mechanism that has been
shown to enhance TIC self-renewal, differentiation, survival, angiogenesis, proliferation, and
migration in a variety of cancers (Luo et al., 2015). It is one of the most extensively researched
possible therapeutic targets in TICs, and several NOTCH inhibitors are being developed.
Because NOTCH plays numerous key functions in the homeostasis of different organ tissues,
5

targeting and blocking NOTCH signaling in cancer is complicated (Moriyama et al., 2008, van
Es et al., 2005). The development of medicines to treat HCC based on NOTCH signaling is still
a long-term aim. Deregulation of the NOTCH pathway is critical for the survival and
maintenance of TICs, which is believed to provide an explanation for chemotherapy resistance
(Below and Opsipo, 2020).
Asymmetric divisions maintain the stem cell population by committing one daughter cell
to a specific fate while the other retains parental pluripotency. NUMB (homology of numb
protein), a p53 interacting partner protein, preserves this natural cellular asymmetry by blocking
p53 ubiquitin-mediated proteolysis catalyzed by the MDM2 E3 ubiquitin ligase (Fig. 2)
(Colaluca et al., 2008). As a result, NUMB acts as a significant barrier to pluripotency and the
unlimited proliferation of TICs9. NANOG-mediated induction of an upstream kinase for aPKC ζ,
Aurora A kinase, and repression of Lethal Giant Larva 2 (LGL2 or LLGL2), an aPKC ζ inhibitor,
leads to aPKC ζ overexpression and activation, as previously demonstrated. This causes
NUMB phosphorylation via aPKC ζ, NUMB separation from p53, and p53 degradation (Siddique
et al., 2015).

Fig. 2: Numb mediated blocking of p53 degradation.
We previously identified a Numb-associated protein through large-scale affinity
purification and tandem mass spectrometry, TBC1D15 (T re2 / B u b 2 /Cd c1 6 Domain Fa m il y
6

M e m b e r 1 5 ) a n d sh o wed t h a t its a m in o - te rm ina l d o m a in d isen g a g e s p 5 3 fro m Numb , ca u sing p 5 3 p rote o lysi s a n d e n co u rag in g se lf - ren e wal a n d p l u ri p o te n cy (F e ldman e t a l., 2 0 1 3 ). TBC1 D15 a c ts a s a R a b GTP a se a ctiva tin g p rote in (R a b GA P ) whi ch comprise a superfamily
of proteins that share a TBC (Tre-2/Bub2/Cdc16) domain and is responsible for inhibiting Rab7
binding to its effector protein Rab interacting lysosomal protein (RILP), fragmenting the
lysosome, and providing resistance to growth factor withdrawal-induced cell death (Peralta et
al., 2010). It has been established that TBC1D15 plays a role in mitophagy and is involved in
autophagosome fusion with lysosomes and endosomes (Han et al., 2021). Additionally,
TBC1D15 is linked to RhoA activity and the formation of membrane blebs (Takahara et al.,
2014). TBC1D15 has been demonstrated to interact with mitochondria via FIS1 and work to g e th e r t o m o d u la te a u to p h a g o so m e s h a p e d u ri n g P a rki n - m e d iat e d m ito p h a g y (Onoue et al.,
2013 and Yamano et al., 2014).
Fis1 is a C-terminally anchored protein in the mitochondrial outer membrane that has
been conserved from yeast to mammals (Mozdy et al., 2000). Perturbing the metabolic milieu
to target cancer has been an enticing tactic since the Warburg effect was discovered that some
cancer cells prefer glycolysis over oxidation (Warburg, 1956). A "reverse Warburg" effect,
involving reliance on OXPHOS for metabolism, has recently been documented in preclinical
models in multiple cancer stem cell subtypes (Lee et al., 2017 and Viale et al., 2014).
Additionally, the Notch signaling pathway, which is known to regulate cell fate decisions,
apoptosis, and proliferation has recently been linked to glycolysis regulation, which influences
tumor growth (Artavanis-Tsakonas et al., 1999 and Landor et al., 2011). A study revealed that
Notch signaling impacts the mitochondrial proteome, which in turn influenced the functioning
of major metabolic pathways, thereby linking an important signaling route to the regulation of
cellular metabolism (Basik et al., 2014).
7

Epigenetic modifications mediated by mitochondrial tricarboxylic acid (TCA) cycle
metabolites are required for transcriptional regulation. A previous study shows that several
enzymatically active mitochondrial enzymes linked to the TCA cycle, which is required for
epigenetic remodeling, are transiently and partially localized to the nucleus and that pyruvate
is required for nuclear localization (Nagaraj et al., 2017). Although there is a growing link
between enhanced mitochondrial metabolism and cancer development and progression, the
molecular mechanisms underlying this biological process remain unknown (Ahn and Metallo.,
2015). The pyruvate dehydrogenase complex (PDC) is a multi-protein complex that acts as a
gatekeeper, catalyzing the conversion of pyruvate to acetyl coenzyme A (acetyl CoA) and
thereby controlling mitochondrial function. A significant component of this complex is PDHA1
(Wieland, 1983). A prior study found that pharmacological and genetic inactivation of Pyruvate
Dehydrogenase A1 (PDHA1), a subunit of the pyruvate dehydrogenase complex (PDC),
reduces the development of prostate cancer in different mouse and human xenograft tumor
models by influencing lipid production (Chen et al., 2018). They demonstrate that in prostate
cancer, PDC is found in both the mitochondria and the nucleus.
NANOG, a master transcription factor required for cell stemness, was found to
play an important role in the self-renewal of tumor initiating-stem cells (TICs) in HCC (Sun et
la., 2013 and Shan et al., 2016). However, the functional role of NANOG in cancer etiology is
unknown. Toll-like receptor 4 (TLR4) signaling activates NANOG via phosphorylation of E2F1
and downregulation of NANOG reduces hepatocellular carcinoma (HCC) growth in mice
induced by alcohol/western diet and HCV protein (Chen et al., 2016). The study of epigenetic
control via transcription factors (TF) and chromatin interaction networks, and their relationship
to pluripotency, has resulted in the identification of extremely active cell-type specific cis-
regulatory elements (CREs), dubbed super-enhancers (SE) (Whyte et al., 2013). Furthermore,
8

super-enhancers have an important role in disease processes like as cancer, and targeting
them with small molecule inhibitors is an upcoming area of research (Lovén et al., 2013). SEs
bind to numerous tissue-specific TFs and master TFs including OCT4, SOX2, and Nanog in
embryonic stem cells (Jia et al., 2020). Furthermore, super-enhancers have very high levels of
the active enhancer epigenetic mark Histone 3 Lysine 27 Acetylation (H3K27Ac) (Pulakanti et
al., 2013).
In the present study, we demonstrated that TBC1D15 and NOTCH1 bind via PEST
d o m a in o f NOTC H1 to reg u lat e it’s sign a li n g p a th w a y in CD 1 3 3 (+ ) TICs a n d th a t TBC1D15,
NOTCH1 and FIS1 act in concert to control peri-nuclear localization of the mitochondria. We
also show that formation of this triple complex coordinates changes in mitochondrial
metabolism to induce nuclear translocation of PDH1 and acetylation of H3K27 thereby
providing insight into stem-cell and tumor initiating activities in HCC. Furthermore, we identified
small compounds that target the NOTCH1 domain, which binds TBC1D15. Our findings imply
that these small compounds could be used to treat CD133(+) TIC targets in cancer.

9

Chapter Three: Materials and Methods

Cell Culture.
Huh7, HepG2 (nontumorigenic cells with high proliferation rates and an epithelial-like
morphology), Hep3B (human hepatoma cell line isolated from liver tissue and exhibits epithelial
morphology) and HEK293T (human cell line that expresses a mutant version of the SV40 large
T antigen and commonly used to produce recombinant proteins) cells were maintained in
Dulb e cco ’s M o d ifi e d E a g le’s M e d iu m (D M E M , S igma -Aldrich., Milwaukee, WI, catalog #D9785)
supplemented with 10% heat-inactivated fetal bovine serum (CAT 100-106, Gemini), Non-
essential amino acids, L-glutamine, and antibiotic-antimycotic (Ref 11140-050, Ref 35050-061,
Ref 15240-062 Gibco). Cells were maintained at 37°C and 5% CO2 in a humidified incubator.
After reaching 80-90 % confluency, Cells were cultured in 25 cm
2
flasks with a medium change
every 2 days, and cells were passaged every 5 days. From Huh7, CD133-positive/negative
cells were isolated using magnetic-microbeads coated with CD133 (AC133, Cell isolation Kit,
Miltenyi Biotec., Waltham, MA). Magnetic separation was carried out twice. CD133-positive
cells were grown in growth medium as previously described.
Transfection
Huh7 cells (an immortal cell line composed of epithelial-like, tumorigenic cells isolated
from male hepatoma tissue) were grown to 60-75% confluency and transiently transfected
using Lipofectamine 2000 (Thermofischer., Waltham, MA, Catalog # 11668027). Following the
manufacture ’s protocol, mixtures of transfection complexes were prepared using a 2:1 ratio of
Lipofectamine 2000 (µl) to DNA (µg). Briefly, 3.12 µg of vector, 0.84 µg of pMD2.G (Addgene,
Watertown, MA catalog #12259), and 2.04 µg of psPAX2 (Addgene, Watertown, MA catalog
#12260) were added to 250 µl of Opti-MEM media and 12 µl of Lipofectamine 2000 was added
10

to a separate tube of 250 µl of Opti-MEM media. After 5 minutes incubation, both were mixed
and incubated at R.T for 20 mins. The entire mixture was then directly added to cells and plates
were returned to CO2 incubators. After sixteen to 24 hours, the medium was replaced with fresh
growth medium. Cells were harvested after 48 hours for analysis.
Lentiviral transduction of shRNA
Lentiviral transduction of short hairpin RNA (shRNA) was employed to create stable
TBC1D15 knock down in Huh7 cells. In T-75 cm
2
flasks, HEK293T cells (1 x 10
6
cells/well)
were plated and cultured to 50-70% confluency. Packaging plasmid (psPAX2), envelope
plasmid (pMD2.G), sh-TBC1D15 vector plasmid, transfection reagent, and Opti-MEM were
used to make the transfection mixture. After incubating the mixtures for 5-15 minutes at room
temperature, they were added to the cells. The medium was replaced 14-16 hours after
transfection, and the medium was harvested 48 and 72 hours later. The medium was
ce n tri fu g e d b e fo re b e ing filte red wi th a 0 .2 2 μ m syri n g e -driven filter. Lentivirus was
concentrated for 2 hours by ultracentrifugation at 20,000 rpm. The lentiviral pellet was
resuspended in the media before being kept at -80°C. Huh7 cells were infected with lentivirus
and tested for green fluorescent protein (GFP) expression. Knockdown cells were selected
u sing 6 μ g /m l p u ro m yc in.
Western blotting analysis
Cells were treated with radioimmunoprecipitation assay (RIPA) lysis buffer
(Thermofischer., Waltham, MA, catalog # 89900) supplemented with protease and
phosphatase inhibitors for protein extraction and incubated on ice for 5 minutes. After
centrifugation at 16,000 g for 20 minutes at 4°C , the protein concentration/sample was
measured using Bradford Protein Assay kits (Bio-Rad Protein Assay Kit, catalog # 5000201).
11

Proteins (20 μ g ) were l o a d e d o n 7 .5 % s o d iu m d o d e cyl su lfa te p o lyacryl a m ide e lect ro p h o r e sis gels (SDS-PAGE) and run at 80V for 5 mins followed by 135V for 1 hour. After separation,
proteins were blotted onto polyvinylidene fluoride membranes. Blocking of the membranes
used Tris-buffered saline with tween-20 (TBS-T) and 5% non-fat dry milk at room temperature
for 1 hour. The primary antibodies (1:1000) were diluted in blocking buffer and incubated
overnight at 4°C fo ll o wi n g t h e m a n u fa ct u rer’ s inst ruct ion s . Th e f o ll o wi n g d a y, m e m b ran e s w e re rinsed 3 –5 times for 5 min with TBS-T and incubated with horse-radish peroxidase (HRP)
conjugated secondary antibody (1:2000) for 1 h at room temperature. Washing was then
repeated. SuperSignal
TM
West Femto (Thermofischer., Waltham, MA, catalog #34096) was
used to visualize protein antibody complexes. Image J analysis software was used to read
b a n d in te n sity a g a ins t β -actin (housekeeping protein).
Co-Immunoprecipitation
For co-immunoprecipitation, cell lysates obtained were centrifuged (16,000 g at
4°C for 20 minutes), a n d 2 0 0 μ l o f su p e rn a ta n t was a d d e d t o p ri m a ry a n tib o d y a t co n ce n tra tio n s specified by the manufacturer and incubated at 4°C overnight. The immunocomplex was added
to pre-cleared protein A/G beads, and this complex was incubated at 4°C for 30 minutes with
gentle rocking. Samples were centrifuged at 16,000g for 30 seconds and the pellet was washed
with lysis buffer 5 times while keeping the mixture on ice. The pellet was then resuspended
with 3X SDS sample buffer and heated at 95°C for 5 minutes. The samples were loaded onto
SDS-PAGE gel and analyzed by western blot.
Immunofluorescence
Formalin-fixed paraffin embedded (FFPE) sections were employed to assess TBC1D15
and NOTCH1 expression in patient HCC tissue. The existence of a tumor and neighboring non-
12

tumor regions with HCV and/or alcoholic cirrhosis were used as selection criteria for patient
material. Only tissue sections with detectable TBC1D15 and NOTCH1 staining (n=3) were
included in the analysis. The clinical pathological information of the tissue sections used in this
study is summarized in Table 3.
Overnight, FFPE tissue slices were heated to 60°C. The slides were deparaffinized with
xylene and rehydrated with ethanol dilutions. The antigen was extracted using a Tender cooker
(Nordic Ware, Great Mall, CA #62104) and conventional microwave for 20 minutes on high in
Citrate ETDA buffer (10mM Citric Acid, 2mM EDTA, 0.05% Tween-20, pH 6.2). The slides were
blocked overnight in PBS with 5% goat serum and 10% BSA. Slides were treated with primary
antibodies (1:1000) overnight at 4°C. Following washing with PBS, slides were treated with
secondary antibodies for 2 hours (1:2000) at room temperature. Anti-fade mounting media with
DAPI (H-1200, Vector Laboratories, Newark, CA) was used to mount the slides and stain the
DNA. Confocal microscopy images were acquired using Leica software. Mean fluorescent
intensity was determined using Image J software.
Luciferase assay
Huh7 cells (7x10
4
cells/well) were seeded in 24-well plates and transfected with NANOG
luciferase constructs and appropriate control plasmids (500 ng total plasmid DNA). Forty-eight
hours after transfection, samples were harvested, and luciferase activity was measured using
a dual-luciferase reporter assay kit (Promega, Madison, WI, catalog# E1980). Lumat LB 9501
(Berthold) equipment was used to quantify luciferase activity. For each sample (n=3), firefly
luciferase activity was adjusted to Renilla luciferase activity.

13

Spheroid formation assay.
Huh7 CD133 (+) cells were seeded into 96 well ultra-low adhesion plates (2,000cells/96-
well, n = 3 ). Cells were g rown in low g luco s e Dulb e cco ’s M o d ified E a g le’s M e d i u m (G e n cl o n e .,
El Cajon, CA, catalog # 25-500). Cells were maintained at 37°C and 5% CO2 in a humidified
incubator. After 7 days of incubation, spheroids were counted.
XTT cell viability assay
Cryopreserved cells were thawed and grown in tissue culture T25 cm
2
flasks and
passaged once. The cells were then trypsinized using TrypLE ™ Express Enzyme (1X)
(Thermofischer., Waltham, MA, catalog # 12604021), and the cell count was determined using
an automated cell counter (Invitrogen
TM,
Carlsbad, CA, catalog # AMQAX2000). 5000
cells/well were seeded in a 96 well plate and incubate at 37°C and 5% CO2 for 16 hours. Drugs
were diluted in 0.5% dimethyl sulfoxide (DMSO) at a concentration of 10 µM to the wells and
incubated for 48 hours in 37°C. XTT reagents (Biotium., Fremont, CA, catalog #30007) were
p rep a re d a cc o rdin g to m a n u fa c tu rer’ s inst ruct ion s a n d 50 µL was added to each well. The plate
was incubated at 37°C for 4 hours and absorbance was measured at 475 nm using a FLUOstar
Omega microplate reader (BMG Labtech., Cary, NC).
Fluorescence polarization assay
Synthetic peptides (FITC-labeled PEST domain WT and PEST Y->A mutant) (Alan
Scientific Inc., Phoenix, AZ) was used. Peptides were received in powdered form and 1 mg
was weig h e d a n d d iss o lved in 7 5 0 μ l o f wat e r wi th 2 5 0 μ l o f a c e t o n itri le. Th e m ixtu re w a s sonicated for 30 seconds to aid in dissolution. Peptides were serially diluted in 2-fold dilutions
fro m 6 0 0 μ M to 0 n M in a 3 8 4 -well plate in triplicates, and the polarization was measured using
Biotek synergy H1 plate reader (Agilent., Pittsburgh, PA). The data obtained was analyzed
14

using GraphPad prism, and the concentration at which the milli polarization (mP) value that
was 10 times higher than buffer only control was selected for further analysis.
Patient-derived xenograft (PDX) mice
The NSG
TM
and NSG-SGM3 mice were surgically transplanted with a small piece (8
mm
3
) of patient HCC with known prior etiology of alcoholism and/or HCV infection.
Transplanted mice were monitored for 10-12 days, and sutures were then removed. These
xenografts form rapidly growing tumors after 7-10 weeks reaching an average size of 100 mm
3
.
Animals with tumor sizes of 1.5 cm before seven weeks were euthanized as per the IACUC
guidelines for tumor-bearing mice.
Genotyping
Mice tails were clipped (5 mm) and digested in DNA digestion buffer (50 mM Tris-HCl
pH 8.0, 100 mM EDTA pH 8.0, 100 mM NaCl, 1% SDS) containing proteinase K and incubated
at 50 °C overnight. The next day, the DNA was extracted using phenol chloroform extraction
(Green and Sambrook., 2017). After final ethanol extraction, tubes were air dried, and the pellet
was dissolved in T10 buffer (10 mM Tris) and DNA concentration was measured using
Nanodrop
TM
8000 spectrophotometer (Thermofischer., Waltham, CA, catalog # ND-8000-GL).
Approximately, 15- 3 0 n g /μ l o f DN A was c o n side red s u ff ici e n t. P CR rea ctio n (hot start) was
p e rfo rm e d u sing fin a l DN A co n c e n tra tio n o f 1 5 n g /μ l a n d using Advantage ® 2 PCR Kit
(Clontech., Mountain View, CA, catalog # NC9566392) according to m a n u fa ct u rer’ s
instructions. 1 0 μ l o f P CR p rod u ct wi th 5 μ l o f 5 x lo a d ing d y e was in t rod u ce d int o wells o f 2 % gels and run at 135V for 20 mins. The DNA bands were visualized under UV.

15

Statistical Analysis
All quantitative studies were carried out with at least three distinct biological replicates.
The unpaired Student's t-test was performed to compare two groups. All aggregated data are
displayed as mean ± SD. The two-tailed student t-test was used to acquire statistical
data comparisons between two groups. To analyze statistical significance, GraphPad Prism
Software (GraphPad Software, Inc.) was utilized.

16

Chapter Four: Results

TBC1D15 and NOTCH1 expression levels are increased in hepatocellular cancer.

We first determined whether the elevated levels of TBC1D15 in patient samples
correlated with higher incidence of cancer. After being subjected to Kaplan-Meier analysis, data
collected from breast cancer, liver cancer, lung cancer, and ovarian cancer tissues showed that
patients having higher levels of TBC1D15 had lower survival rates as time increases in
comparison to patients with lower levels of TBC1D15 (Fig. 1A). Furthermore, the cumulative
probability of surviving 5 years in patients with high TBC1D15 is lower than 0.4. This data
clearly highlights the parallel relationship between TBC1D15 expression and incidence of
cancer in patients. Next, a co-expression analysis of TBC1D15 protein was conducted using
the Oncomine database. The expression levels of the four NOTCH receptors, NOTCH1,
NOTCH2, NOTCH3, NOTCH4 and TBC1D15 were compared in 115 normal liver tissues and
95 HCC tissues (Fig. 1B). This analysis found a relationship between NOTCH gene expression
and TBC1D15. We performed immunoblots with TBC1D15 and NOTCH in alcohol associated
and non-alcohol associated (NASH) HCC against non-cancerous liver tissues to validate our
findings (Fig. 1C). This result showed a significant increase in NOTCH1 and TBC1D15 as
compared to non-existing expressions in NON-HCC. Immunohistochemistry (IHC) labeling of
TBC1D15 and NOTCH in HCC against matched non-cancerous liver tissues to further
elucidate this (clinicopathological factors are listed in Data Table 3) (Fig. 1D). TBC1D15 and
NOTCH1 considerably enhanced fluorescence to when compared to normal tissue (p <0.01)
(Fig. 1E).

17

TBC1D15 and NOTCH1 interaction domains.

Previous studies conducted in our laboratory have demonstrated that TBC1D15
interacts with all isoforms of NOTCH (full length and activated NICD forms) and TBC1D15
overexpression in non-transformed PH5CH cells led to increased NICD levels (Choi et al.,
2020). Furthermore, specificity of NOTCH1 activation by TBC1D15 was shown previously by
using the γ- s e cret a s e i n h ibito r D A P T on TBC1D15 overexpressed PH5CH cells and NOTCH1
level was found to be elevated (Choi et al., 2020 and Feng et al., 2019). To determine the
NOTCH1 interaction site of TBC1D15, we performed a protein domain mapping study by
creating deletion mutants of NOTCH and NICD in the PEST and STR domains, T2512A
substitution to remove the phosphorylation site and mutations of the STR phosphorylation
residues (3M and 4M) (Fig. 2A). The NOTCH STR domain contains four Ser/Thr-Pro
phosphorylation motifs. PIN1 binds to the NOTCH STR domain and promotes a conformational
shift in preparation for NOTCH1 cleavage by γ-secretase (Rustighi et al., 2009). The deletion
or absence of the NICD PEST and STR domains weakened the interaction with TBC1D15,
which was further reduced by alterations of the STR phosphorylation residues (3M and 4M)
(Fig. 2B).
TBC1D15 knockdown was confirmed by western blot in CD133(+) cells (TICs)
(Fig 2C, left). Immunoprecipitation of TBC1D15 with NICD deletion mutants in TBC1D15
knockdown cells revealed that NICD PEST deletion mutant expression reduced interactions
between TBC1D15 and NOTCH1 in TICs (Fig 2C, right). The interaction between TBC1D15
and the NICD PEST domain in shTBC1D15-CD133(+) TICs was restored by restoring
TBC1D15 expression in these cells (Fig. 2D). To determine whether TBC1D15 stimulates the
NOTCH1 pathway, we looked at the activity of the NOTCH1-targeted HEY-1 promoter in a
luciferase reporter assay. In CD133(+) TICs, we overexpressed wild type NOTCH1, as well as
18

NOTCH1 ΔE- FL, a derivative that is constitutively cleaved by 𝛾 -secretase, releasing active
NICD (Rustighi et al., 2009). TBC1D15 increased NOTCH1 ΔE-FL activity in CD133(+) TICs
expressing endogenous TBC1D15, according to the luciferase reporter test (Fig. 2E).
Furthermore, TBC1D15 knockdown drastically inhibited NOTCH1 ΔE-FL activation of the HEY-
1 promoter. TBC1D15 interacts with human NOTCH1 and modulates its route, according to
these findings.

TBC1D15 and NOTCH1 interaction in TICs stimulate perinuclear localization of
mitochondria and increase their diameter.

Previously we demonstrated that NANOG is the most up-regulated gene in alcohol/HCV
induced liver tumor models. To investigate the role of NANOG in TIC-mediated tumor
expansion, a genome-wide transcriptional profiling using ChIP-seq was conducted. This
analysis highlighted enrichment of NANOG gene in TICs as compared to CD133 (-) cells and
its role in reducing OXPHOS activity and induced fatty acid oxidation (FAO) pathways to
maintain TIC property (Chen et al., 2016). Results obtained from this study showed the
expression of genes involved in the mitochondria metabolic pathway, such as increased ATP
generation, mitochondria morphology and mitochondrial respiration. Since we have shown in
previous studies that TBC1D15-NOTCH1 interaction can activate NANOG, these results
further demonstrate that TBC1D15 and NOTCH1 can influence mitochondrial metabolism in
TICs.
To further investigate the role of TBC1D15-NOTCH1 interaction on mitochondria
movement, cells transfected with NOTCH1 mutants were subjected to immunoblot analysis for
TBC1D15, NICD and FIS1. The results showed that TBC1D15 and NICD-FL were present in
the mitochondrial fraction of CD133 (+) cells, but NICD-∆PEST was absent (Fig. 3A). Next, we
19

showed that co-localization of TBC1D15 and NOTCH1 reduced in the mitochondrial fraction in
cells transfected with PEST domain deletion mutant of NOTCH1 (Fig. 3B). This result
additionally proved that PEST domain of NOTCH1 is required for TBC1D15 binding and
localization at the mitochondrial membrane. Next, we tested the mitochondrial recruitment to
the peri-nucleus region via immunofluorescence staining with and without NICD PEST domain.
The staining revealed that the subcellular localization of mitochondria was noticeably altered
with its distribution closer to the nuclear membrane in CD133(+) cells expressing NICD-FL as
compared to NICD-∆PEST (Fig. 3C). The same cells and staining conditions (TOM20 to stain
mitochondria) were used to quantify the change in mitochondrial diameter and perinuclear
region. In CD133(+) TICs, both the mitochondrial diameter and their size increased along with
a pronounced localization near the nucleus in comparison with CD133(-) TICs (Fig. 3D).

TBC1D15-NOTCH1-FIS1 tripartite formation is dependent on NOTCH1 interaction.

We have already established that TBC1D15 and NOTCH1 bind and colocalize near the
mitochondria. Here, we hypothesize that TBC1D15-NOTCH1 interaction further supports
TBC1D15 binding to the mitochondrial fission protein (FIS1) and promotes intra-cytoplasmic
movement of the mitochondria. To elucidate this, we knocked down NOTCH1 in TICs and
observed the interaction between TBC1D15 and FIS1 with or without TBC1D15
overexpression. NOTCH1 knockdown reduced TBC1D15 expression but had no effect on FIS1
expression as shown in the whole cell lysate immunoblot (Fig. 4A, bottom). The Co-IP results
indicated that even with overexpression of TBC1D15 in sh-NOTCH1 TICs, FIS1 failed to
interact with TBC1D15 suggesting NOTCH1 requirement (Fig. 4A, top). To validate this
interaction, THLE2 non- tra n sfo r m e d ce ll s th a t d o n ’t e x p ress TBC 1 D15 a n d NOTC H1 w e re transfected with both TBC1D15 and NOTCH1 vectors.
20

Only when both vectors were co-expressed, FIS1 interaction with TBC1D15 is seen, but
not when only NOTCH1 is expressed (Fig. 4B). Furthermore, to show this interaction takes
place near the mitochondria, we knocked down TBC1D15 in TICs and conducted Co-IP with
anti-FIS1 antibody using the mitochondrial fraction. FIS1 and NOTCH1 interaction was
attenuated in sh-TBC1D15 cells as compared to sh-scrambled showing that TBC1D15 is
required for tripartite complex formation (Fig. 4C).

Screening of small molecule inhibitors to target TBC1D15-NOTCH1-FIS1 tripartite
interaction.

We performed in-silico docking analysis to show that upon binding of TBC1D15 to the
PEST domain of NOTCH1, TBC1D15 undergoes a structural change to bind to FIS1 stably and
form the tripartite complex at the mitochondria (Fig. 5a). Since we have previously shown that
NOTCH1-TBC1D15 interaction leads to stemness properties in liver cancer cells, we decided
to screen for antagonists that can inhibit this interaction and decrease tumor incidence in liver
cancer patients (Fig. 5B). A small molecule inhibitor library was screened to identify a lead
molecule. First, 500 drug candidates from the National Cancer Institute (NCI) diversity set VI
a n d m e ch a n istic s e t V I were te st e d a t th e c o n ce n tra tio n o f 1 0 μ M i n t h e ir a b il ity to kil l Hu h 7 cells from which 5 drug compounds (Table 5) showed significant reduction in cell viability but
had no killing effect on primary hepatocytes (Fig. 5C).
Additionally, we used in silico structure-based high-throughput screening to find
candidates for small molecule inhibitors that block the interaction between NOTCH1 and
TBC1D15 with the help of Prof. Ram Murali at Cedars-Sinai Medical Center. This discovered
255 inhibitors from millions of probable possibilities in Chembridge LLC's chemical libraries.
Based on X-ray structures of NOTCH1 and TBC1D15 (Fig. 5A), we investigated potential
interaction domains. Simulations were run to build structural models for screening. Standard
21

precision (SP) screening followed by extreme precision (XP) screening was applied to yield a
final group of 15 putative small molecule inhibitors of the NOTCH and TBC1D15 interaction
from the initial 255 hit ligand compounds (Table 6).
XTT assay conducted on Huh7 and Hep3B cells (both p53 mutant cell lines) narrowed
the drug list from 15 to 4 compounds (C3, C4, C5 and C10) that have a significant killing effect
as compared to the DMSO only control in vitro (Fig. 5D and Fig. 5F). Inhibitor C3 showed the
highest killing effect on both Huh7 and Hep3B cells. However, the same drugs test on HepG2
cells (p53 WT) resulted in only one drug (C4) to have a significant inhibition on cell growth (Fig.
5E). These tests resulted in the identification of a few leads small molecule inhibitors that show
significant inhibitory effect on liver cancer cell lines. We designed a fluorescence polarization
assay (FP assay) where FITC-tagged NOTCH1 PEST domain peptide and a Y to A mutant of
PEST domain peptide was synthesized (Fig. 5G). In this assay, the mutant peptides served
a s a n e g a tive co n tro l which d o e sn ’t b i n d t o TB C1D1 5 . To initi a te t h e assay, we first titrated the
FITC-tagged peptides to find the lowest concentration that has a fluorescence 10 times higher
than the buffer only control and 800 nM was identified as the optimal concentration for both
(Fig. 5H). To identify if the lead molecules inhibit the interaction between TBC1D15 and
NOTCH1, a competition FP assay needs to be conducted.

Identification of inhibitor B (C3) as a lead compound and it effectively inhibits TBC1D15-
NOTCH1 interaction.

The 4 hit compounds from the previous XTT assay (C3, C4, C5 and C10) were further
tested for their killing activity on primary hepatocytes. All four drugs showed no significant
reduction in the viability of primary hepatocytes but reduced the viability of Huh7 and Hep3B
cells (Fig. 6A and Fig. 6B). These results demonstrate that the selected small molecule
inhibitors are active against cancer cells and not normal cells. Compound C3 (N-{3-[(3R*,4R*)-
22

4-ethyl-3,4-dihydroxypiperidin-1-yl]-3-oxopropyl}-4-fluorobenzamide), also known as inhibitor
B, was found to be the best compound (Fig. 6 C). Inhibitor B effectively inhibited CD133(+)
Huh7 cell self-renewal at 100 nM concentration, as demonstrated by the spheroid assay (Fig.
6D). Next, we conduct an in-silico docking analysis of inhibitor B with the TBC1D15-NOTCH1-
FIS1 tripartite complex. Inhibitor B binds to the allosteric site of the binding pocket of TBC1D15
and FIS1 to block the interaction between TBC1D15 and NOTCH1 (Fig. 6E). To validate the
specificity of inhibitor B in targeting the interaction between TBC1D15 and NOTCH1, we
conducted a Co-IP western blot using anti-FLAG antibody against TBC1D15. Binding of
NOTCH1 to TBC1D15 was drastically reduced in the presence of inhibitor B (C3) as compared
to vector only control (Fig. 6F). To determine the lowest possible physiological drug
concentration, an IC50 study was conducted in Huh7 cells with drug concentrations ranging
fro m 2 0 μ M t o 1 nM. An IC50 va lu e o f 2 . 5 μ M was fo u n d a ft e r a n a lysi s in GraphPad Prism.
TBC1D15 induces PDHA1 localization in the nucleus in TICs and subsequent histone
acetylation.

Until now we have seen how TBC1D15 and NOTCH1 interaction induces and maintains
stem cell renewal ability of TICs. To further elucidate this mechanism, we identified a
downstream target of this interaction, PDHA1 that facilitates H3K27Ac of NANOG gene.
Immunofluorescence staining revealed that PDH localizes in the nucleus in CD133(+) TICs and
not in CD133(-) cells (Fig. 7A). PDH1 is made up of three catalytic enzyme subunits: pyruvate
dehydrogenase (PDHA1, PDH-E1), dihydrolipoamide transacetylase (DLAT, E2), and
dihydrolipoamide dehydrogenase (DLD, E3), as well as one tethering protein, E3-binding
protein (E3BP). All four subunits of PDH were found to be expressed in the nuclear fraction of
TICs but were not expressed in cells with TBC1D15 knockdown (Fig. 7B). This result depicted
that PDH nuclear localization is dependent on TBC1D15. We used co-IP analysis to determine
23

whether these subunits formed a complex in the nucleus that could be catalytically active. The
three subunits of PDH did interact with each other in the nucleus in a manner dependent on
TBC1D15 (Fig. 7C).
Next, we tested the epigenetic reprogramming ability of PDH1 by inducing histone
acetylation in TICs. Nuclear levels of PDHA1, Ac-H2B, Ac-H3, and H3K27Ac are much higher
in TICs compared to primary hepatocytes (lane 1 vs. lane 4 of Fig. 7D), indicating widespread
acetylation of histones in TICs. Furthermore, as shown earlier knockdown of TBC1D15 lowers
nuclear PDHA1, abolishes Ac-H2B, Ac-H3, and H3K27ac (lane 5), and knockdown of PDHA1
showed similar inhibitory effects, indicating that PDHA1 plays a major role in histone acetylation
in TICs (Fig. 7D). Additionally, treating TICs with PDH1 inhibitor, 6,8-bis(benzylthio)octanoic
acid (Zachar et al., 2011) abrogated Ac-H2B, Ac-H3, and H3K27Ac suggesting that PDH1 is
required to cause histone acetylation in TICs (Fig. 7E). Within the NANOG enhancer, we
discovered a potential RBPJ/NICD site as well as an E2F1 site (Fig. 7F, bottom). At -3200 bp
as per the reporter assay, the old NICD binding site is more functional than another
downstream RBPJ site (data not shown). To assess the functionality of the enhancer RBPJ
and E2F1 sites, we created enhancer-luciferase constructs with RBPJ or E2F1 site mutations
and evaluated them in pyruvate-stimulated TICs. Our findings demonstrate that each mutation
dramatically lowered reporter activity by 60-80% (Fig. 7F, right). Furthermore, PDHA1 KD
significantly reduced reporter activity with all designs and suppressed NANOG expression (Fig.
7F, left). NOTCH1 or E2F1 expression, on the other hand, increased reporter activity (Fig. 7G).
With this preliminary data we propose the continued hypothetical model of TBC1D15-NOTCH1
interaction leads to perinuclear localization of the mitochondria and the nuclear transfer of
PDHA1 to potentially acetylate H3K27 histone mark of NANOG in TICs (Fig. 7G).

24

Chapter Five: Discussion
To summarize, TBC1D15 was identified as a key player in promoting CD133(+)
tumorigenic activity with elevated levels found in HCC tissues. We highlighted a relationship
between TBC1D15 and the NOTCH pathway where binding to the constitutively active form of
NOTCH (NOTCH1/NICD) may lead to the observed mitochondrial recruitment to the nucleus
and the subsequent nuclear translocation of PDH1 to induce histone acetylation in TICs.
To further explain the stabilization of NOTCH by TBC1D15, additional experiments were
conducted (data not shown). In normal cells, the intracellular domain of NOTCH is directly
phosphorylated by CDK8 protein kinase between the TAD and PEST domains and facilitates
PEST-mediated degradation of NICD by FBW7, an E3 ubiquitin ligase (Fryer et al., 2004). Co-
IP and immunoblot analysis conducted revealed that CDK8 and TBC1D15 strongly interacted
with the PEST domain of NOTCH1 and overexpressing CDK8 suppressed TBC1D15 binding
to NOCTH1. Overall, these additional results further explain the essential role of TBC1D15 in
activation of NOTCH1 (Fig. 3)

Fig. 3: Hypothetical model of how TBC1D15 interacts with NOTCH to stabilize NOTCH1 in
CD133(+) TICs of how TBC1D15 inhibits NICD phosphorylation in CD133 (+) TICs.

25

The NOTCH signaling system is a highly conserved developmental network that
governs a wide range of cellular processes. As a result, aberrant Notch signaling activity and
overexpression of Notch target genes are implicated in several malignancies. We found that
mutant versions of the NOTCH1 PEST domain identified in CD133(+) TICs cannot bind to
TBC1D15 and the induce expression of NOTCH1 target genes like HEY1. A novel finding in
our study for the formation of TBC1D15-NOTCH1-FIS1 triple complex at the mitochondrial
membrane to promote mito-nucleus spatial colocalization. Even though this preliminary data
points towards a significant complex formation needed for TIC progression, additional variables
to consider are the disruption of the triple complex using FIS1-TBC1D15 binding site mutant.
More concrete evidence indicating that TBC1D15-NOTCH1-FIS1 interaction is absolutely
required for achieving mitochondria-nucleus spatial proximity and that disrupting this interaction
reduced TIC growth.
Elaborate drug screening performed aided in the identification of a potential inhibitor for
TBC1D15 and NOTCH1. Inhibitor B showed significant killing effect in CD133(+) rich HCC cell
lines. Western blot and in-silico analysis further confirmed its specificity towards binding to and
inhibiting TBC1D15-NOTCH1 interaction. To validate the specific binding and inhibitory ability
of inhibitor B, a fluorescence polarization assay (FP assay) was initiated where the goal is to
chemically show that FITC-tagged PEST domain peptide binds to purified TBC1D15 protein
leading to a high FP signal and then perform a competition binding assay where the binding of
inhibitor B displaces NOTCH1 from TBC1D15 and a decrease in FP value is observed. In this
study, the peptide only titration was completed as a starting point, however, further evaluations
need to be performed to prove the efficacy of inhibitor B. To determine the therapeutic efficacy
of inhibitor B, further analysis should be conducted solely on CD133(+) cells. We also need to
evaluate the modalities mentioned above in vitro in patient-derived xenograft (PDX) mice with
26

humanized immune systems. For this reason, PDX mice were established as mentioned in the
methods section. Inhibitor B's chemical and pharmacologic qualities in the setting of HCC are
mainly unknown, and it may have other negative effects beyond interfering with the TBC1D15-
NOTCH interaction.
We hypothesize that mitochondria pyruvate dehydrogenase (PDH1) translocates to the
nucleus to supply acetyl-CoA from pyruvate to stimulate H3K27 acetylation (H3K27Ac) in TICs.
Presently, we have shown that TBC1D15 expression stimulates PDH1 transfer to the nucleus
and acetylation of H3K27 in TICs. However, much more research needs to be conducted to
explain the exact mechanism behind the transfer of PDH and the additional supporting role of
HSP70 and O-GlcNAc (Guinez et al., 2004). Furthermore, we are focusing on H3K27Ac of
NANOG in TICs, but histone acetylation can be a global event and influence other genes. This
specific activation of NANOG needs to be validated further by ChIP-seq analysis. Having
shown that PDHA1 influences NANOG super-enhancer activity, we yet need to validate how
PDHA1 induces H3K27Ac of the identified super-enhancer.
Taken together, the findings detail the mechanisms underlying TBC1D15 binding and
activation of NOTCH1 to promote TIC self-renewal in HCC. This will lay the foundation for novel
therapeutic strategies aimed at reinstituting the normal function of these complexes and hold
important implications for cancer therapy.

27

Chapter Six: Conclusion and future directions

In conclusion, we succeeded in proving the novel finding that TBC1D15 stabilizes
NOTCH and interacts with NICD to initiate mitochondrial movement towards the nucleus and
the subsequent PDH1 nuclear transfer to induce H3K27Ac of NANOG to promote TICs
progression in HCC. Targeting TBC1D15-NOTCH1 binding can facilitate the disruption of this
mechanism and prevent TIC self-renewal in liver cancer. The Inhibitor B (N-{3-[(3R*,4R*)-4-
ethyl-3,4-dihydroxypiperidin-1-yl]-3-oxopropyl}-4-fluorobenzamide) was found to be the most
effective in inhibiting TBC1D15-NOTCH1 interaction, and a physiological IC50 o f 2 . 5 μ M was
determined.
To establish the specificity of inhibitor B disrupting this interaction, a competitive binding
fluorescence polarization assay will be performed using the peptide concentration determined
in this study. Ideally, we expect inhibitor B to dissociate TBC1D15 protein and FITC-tagged
PEST domain peptide in solution to give a low FP value that will solidify the notion that inhibitor
B is a strong drug candidate. Furthermore, additional in vitro experiments such as
overexpressing NICD to see if the action of inhibitor B is reduced and performing luciferase
assay to test the effect of inhibitor B on NANOG expression need to be performed. The type of
cell death mechanism that inhibitor B may induce is still unknown. To define the type of cell
death experiments such as: a) Apoptosis: measuring the accumulation of phosphatidylserine
on the plasma membrane by annexin V, b) Necrosis: measuring if the permeability of plasma
membrane to propidium iodide, and c) Autophagy: detecting LC3 marker by western blot.
Based on the optimistic therapeutic benefits of inhibitor B in the HCC cell lines and the
reasonable IC50 level of inhibitor B, we developed the in vivo PDX mouse by transplanting PDX
tissue with etiology of HCC with HCV infection (Fig. 4). We propose testing inhibitor B on PDX
28

model at doses ranging from 10mg/kg to 40mg/kg. However, if the PDX study data reveals
unexpected findings, we may need to alter the dose or add more animals to reach statistical
conclusions. To determine an optimum treatment regimen, detailed pharmacokinetic
investigations may be required.

Fig. 4: Schematic diagram depicting formation of PDX mouse model and action of Inhibitor B.
To dissect the molecular mechanism behind TBC1D15-NOTCH1-FIS1 interaction and
its role in promoting mitochondria-nucleus proximity, we will create deletion mutants of the key
binding sites, namely TBC1D15-∆canoe domain (binding site of NOTCH1) and FIS1 W40A
substitution and perform western blot and immunofluorescence staining and determine whether
these conditions challenge our hypothesis. Furthermore, electromagnetic imaging is currently
in progress to visualize the localization of the triple complex at the mitochondrial membrane
and the reduction in distance between the mitochondria and nucleus upon the complex
formation. For this, Huh7 cells seeded at 350,000 cells/well will be fixed with 4%
paraformaldehyde in an 8-chamber slide and stained with anti-NOTCH1, anti-TBC1D15
antibodies and Dapi. The cells will then be imaged using DeltaVision OMX (GE Healthcare).
Correlative light and electron microscopy (CLEM) will be performed where TBC1D15, NOTCH1
29

immunofluorescence low magnification images will be obtained and the correlative position of
successful staining is taken to perform transmission electron microscopy (TEM) at the Core
Centre for Excellence in Nano Imaging, USC (Fig. 5). For TEM, the slide will be soaked in
buffer to detach the coverslip, and the cells will be hard fixed with glutaraldehyde and fixed a
second time with osmium tetroxide. Cells will be dehydrated with ethanol and infiltrated with
epoxy resin blocks, polymerized for 18 hours, sectioned in 500 nm sections, and mounted on
TEM grids to visualize.

Fig. 5: Schematic diagram of Correlative light and electron microscopy.
Since we propose that nuclear translocation of PDH1 leads to TICs acquiring H3K27Ac
dependent overexpression of NANOG gene, we plan to use loss of function approach to
deplete TBC1D15, NOTCH1 and PDH1 in CD133(+) cells and test if these manipulations
reduce the expression of NANOG and self-renewal of TICs. Our initial studies have laid the
groundwork for defining the importance of TBC1D15-NOTCH1 in promoting TIC progression
and identified a promising inhibitor to target this mechanism. However, further experiments will
need to be conducted to determine whether this pathway really enhances NANOG
overexpression and accelerates HCC development. ChIP-qPCR will be performed to determine
super-enhancer activation of NANOG in the presence or absence of PDHA1.
30

Chapter Seven: Tables

Table 1: Plasmids used in the present study.
Sl. No Name
1. p3X-Flag-TBC1D15-full length
2. pcDNA3-NICD-myc
3. pcDNA3- ∆PE S T-myc
4. pcDNA3- ∆21 7 1-myc
5. pcDNA3-3M (S2122A/T2133A/S2137A)-myc
6. pcDNA3- ∆STR-myc
7. pcDNA3-4M (S2122A/T2133A/S2137A/S2142A)-myc
8. hNOTCH1-Full Length-myc
9. pcDNA3-PEST-T2512A-myc

Table 2: shRNA oligonucleotides used for TBC1D15, NOTCH1 and PDH knockdown in Huh7
cells.
Sl.
No
Name Sequence Source
1. sh-TBC1D15 1 . 5 ’ - GAGGTAATGTGGACCGAACTA- 3’
2 . 5 ’ – GCATTAGATTCCTCTAGTATT – 3’
Sigma Aldrich,
catalog #
TRCN0000154685,
TRCN0000231963
2. sh-NOTCH1 1 . 5 ’ – CGCTGCCTGGACAAGATCAAT- 3’
2 . 5 ’ – CCGGGACATCACGGATCATAT – 3’
Sigma Aldrich,
catalog #
TRCN0000350330,
TRCN0000350253

31

Table 3: Clinical pathological information of FFPE tissue.
ID # Tumor? Age Gender Primary Diagnosis
UMN 1326 Yes 53 M Hepatocellular carcinoma/Hepatitis C.
UMN 1368

Yes 55

F Hepatocellular Carcinoma/Hepatitis B

UMN 1308 Yes 66

M Hepatocellular Carcinoma /Hepatitis C +
Ethanol Cirrhosis

UMN 1264

Yes 46 M Hepatocellular Carcinoma /Hepatitis C +
Ethanol

UMN 1366

Yes 52 M Hepatocellular Carcinoma/Alcoholic
cirrhosis + Hepatitis C

Table 4: Antibodies used in the present study.
Sl. No Name Source
1. Monoclonal anti-Flag M2 Sigma Aldrich, catalog # F1804
2. Anti-TBC1D15 Abcam, catalog # ab121396
3. Anti-Myc-tag monoclonal Invitrogen, catalog # R951-25
4. Anti- β-Actin (AC-15) Santa Cruz, catalog # 69879
5. Anti-NOTCH1 (C-10) Santa Cruz, catalog # 373891
6. Goat anti-Rabbit IgG (H+L)
Highly Cross-Adsorbed
Secondary Antibody, Alexa Fluor
568
Thermofischer Scientific, catalog # A11011
7. Goat anti-Mouse IgG (H+L)
Highly Cross-Adsorbed
Secondary Antibody, Alexa Fluor
647
Thermofischer Scientific, catalog # A-21236

32

Table 5: List of NCI drug candidates.
Sl
no
Compound Name Structure
1. NSC 15571: 2-arsonobenzoic acid

Molecular Formula: C7H7AsO5

2. NSC 83715: 2-Pyridin-3-yl-2,3-dihydro-1H-
perimidine

Molecular Formula: C16H13N3

3. NSC 71795: 5,11-Dimethyl-6H-pyridol[4,3-
b]carbazole

Molecular Formula: C17H14N2

4. NSC 657598: (6Z)-3-(3-nitrophenyl)-6-[(4-
nitrophenyl)methylidene]-[1,3]thiazolo[2,3-
b][1,3]thiazol-4-ium-5-one;chloride

Molecular Formula: C18H10ClN3O5S2

5. NSC 635833: methyl 4-(2,3-dimethylanilino)-2,4-
dioxo-3-(3-oxo-4H-1,4-benzothiazin-2-yl)butanoate

Molecular Formula: C21H20N2O5S

33

Table 6: List of ChemBridge LLC shortlisted small molecule inhibitors.
Sl
No.
ID Compound Name Structure
1. C1 1-naphthyl hexopyranoside

2. C2 (2R,3S)-3-amino-4-[2-(2,4-difluorophenyl)-
1,4,6,7-
tetrahydro-5H-imidazo[4,5-c]pyridin-5-yl]-4-oxo-
2-
butanol dihydrochloride

3. C3 N-{3-[(3R*,4R*)-4-ethyl-3,4-dihydroxypiperidin-1-
yl]-
3-oxopropyl}-4-fluorobenzamide

4. C4 2-hydroxy-N-({1-[2-hydroxy-1-
(hydroxymethyl)ethyl]piperidin-3-yl}methyl)-5-
Methylbenzamide

5. C5 N-[2-(1-oxidoisonicotinoyl)-1,2,3,4-tetrahydro-7-
isoquinolinyl]tetrahydro-2-furancarboxamide

6. C6 N-[1-(1H-benzimidazol-2-yl)ethyl]-4-(3-hydroxy-
3-
methylbutyl) benzamide

34

7. C7 N-[3-(1H-tetrazol-5-yl)benzyl]-2,3-
dihydrothieno[3,4-
b][1,4]dioxine-5-carboxamide

Molecular Formula: C 15H 13N5O3S

8. C8 5-{[4-(2-furoyl)-1,4-diazepan-1-
yl]carbonyl}pyridin-3-ol

9. C9 3-{5-[(5-methyl-2H-1,2,3-triazol-4-yl)carbonyl]-
4,5,6,7-tetrahydro-1H-imidazo[4,5-c]pyridin-2-
yl}benzoic acid

10. C10 3-[5-(tetrahydrofuran-3-ylcarbonyl)-4,5,6,7-
tetrahydro-1H-imidazo[4,5-c]pyridin-2-yl]benzoic
acid

11. C11 N-[rel-(1R,2R,4S)-4-({[(1-ethyl-1H-imidazol-2-
yl)methyl]amino}carbonyl)-2-propoxycyclohexyl]-
1H-
1,2,3-triazole-5-carboxamide

12. C12 1-methyl-N-[3-(1H-tetrazol-5-yl)benzyl]-
1Himidazo[
1,2-b]pyrazole-7-carboxamide

13. C13 (2S)-2-({3-
[(methylsulfonyl)amino]propanoyl}amino)-3-
phenylpropanoic acid

35

14. C14 5-oxo-N-[3-(1H-tetrazol-5-yl)benzyl]-L-
prolinamide

15. C15 N-[1-(4-methoxyphenyl)-6,6-dimethyl-4,5,6,7-
tetrahydro-1H-indazol-4-yl]-5-oxo-2,5-dihydro-
1Hpyrazole-
3-carboxamide

36

Chapter Eight: Figures

Fig 1. TBC1D15 and NOTCH1 levels are elevated in hepatocellular carcinoma. A) Kaplan-
Meier analysis of liver, lung, breast, and ovary cancer patients with primary tumors expressing
high or low levels of TBC1D15. p-value from stratified Cox proportional hazards model. B) Co-
expression of the 4 different NOTCH receptors and TBC1D15 revealed by Oncomine database.
The color palette represents the range of mRNA expression values. Red denotes increased
mRNA expression, while the blue color reflects lower mRNA expression. C) Immunoblot
analyses confirmed that NOTCH1 and TBC1D15 are elevated in HCC tissues in comparison
to those in non-cancerous tissue regions. D) Representative immunohistochemistry images for
localized TBC1D15 and NOTCH1 in human normal liver vs. hepatocellular carcinoma tissues.
E) Mean fluorescent intensity relative to control is shown as mean ± SD (n = 3). Scale bars,
2 6 .3 μ M . I n se ts r e p res e n t 1 0 X ma g n ificat ion o f th e im a g e sh o wn a t 4 0 X .
37

Fig 2. TBC1D15 interacts with PEST domain of NOTCH1 to activate NOTCH1 pathway. A)
Image representing the deletion mutants of NOTCH1. B) Co-IP western blot analysis of PEST
interaction domain of NOTCH1 with TBC1D15. C) Immunoblot confirming knockdown of
TBC1D15 (left) in CD133(+) cells. Co-IP western blot analysis of diminished interaction
38

between NOTCH1 mutants and TBC1D15 in sh-TBC1D15 CD133 (+) cells (right). D) Co-IP
western blot analysis of recovered interaction between NOTCH1 and TBC1D15 in TBC1D15
overexpressed cells. E) NOTCH1 ΔE-FL transcriptional activity on HEY-1/Luc increased by
endogenous TBC1D15 in sh-TBC1D15 cells (top). Immunoblots shown below. Data
represented as mean ± SD.

Fig 3. TBC1D15-NICD interactions promote mitochondrial recruitment to perinuclear
regions, increase mitochondrial diameter, and regulate mitochondrial gene expression.
A) Immunoblot analysis of NICD-mutant transfected CD133(+) cells at the cytoplasm, nucleus,
and mitochondrion fractions. B) Co-IP immunoblot analysis of NICD-mutant transfected
CD133(+) cells at the cytoplasm, nucleus, and mitochondrion fractions. C)
Immunofluorescence images of DAPI (blue), TBC1D15 (green) and TOM20 (red) in NICD-FL
and NICD- ΔP E S T tra n sfe ct e d CD 1 3 3 (+ ) ce ll s. S ca le b a r= 7 .2 μ M D) Im m u n o flu o resce n c e images comparing TBC1D15 (green) and TOM20 (red) in NICD-FL and NICD- ΔP E S T transfected CD133(+) and CD133(-) cells (LEFT). Plots comparing mitochondria to nucleus
distance and mitochondria diameter in NICD-FL and NICD- ΔP E S T t ran sfe ct e d ce ll s (R IG H T) .
Data shown with mean ±SD 400. Statistical analysis conducted used unpaired T-test.

39

Fig 4. Tripartite complex formation of TBC1D15, NOTCH1 and FIS1 is dependent on NICD
and TBC1D15. A) In NOTCH1 knockdown CD133(+) TICs, TBC1D15 and FIS1 interaction is
prevented. Whole cell lysate shows that NOTCH1 knockdown reduces TBC1D15 but FIS1
expression is independent of it. B) NOTCH1 and TBC1D15 overexpression in THLE2 non-
transformed cells results in tripartite interaction between TBC1D15-NOTCH1-FIS1. C)
TBC1D15 silencing reduced FIS1-NICD interaction in heavy-membrane mitochondria fraction
in TIC nuclei in a TBC1D15-dependent way.

40

41

Fig 5. In-silico docking analysis to screen drug inhibitory effect against TBC1D15 –
NOTCH1 interaction. A) X-Crystallography imaging revealed that NICD-TBC1D15 complex
is critical to recruit FIS1. B) Hypothetical model showing that TBC1D15 interacts with NOTCH1
in TICs to enhance NOTCH1 activation and that the tripartite formation of TBC1D15-NOTCH1-
FIS1 facilitates perinuclear localization of the mitochondria. Small molecule inhibitors targeting
this interaction can prevent the action of stem-cell genes and expansion of TICs. C) Five lead
NCI drug candidates had significant killing effect on Huh7 cells. D) Huh7 cells versus DMSO
treated control. 48- h o u r d rug tre a tme n t a t 1 0 μ M co n c e n tra tio n ide n t ified f o u r d rug ca n d ida t e s that showed significant killing effect. E) HepG2 cells versus DMSO treated control. 48-hour
d rug tre a t m e n t a t 1 0 μ M co n ce n tra ti o n ide n tif ied o n e d ru g c a n d ida t e t h a t sh o wed sign ific a n t killing effect. F) Huh7 cells versus DMSO treated control. 48- h o u r d rug tre a tme n t a t 1 0 μ M concentration identified three drug candidates that showed significant killing effect. G) A
diagram depicting the screening scheme for selective inhibitors of TBC1D15-NOTCH
interaction using the wild type NOTCH1 PEST domain peptide and its mutant. Both were
labeled with FITC. H) Fluorescence polarization assay depicting the FP signal induced by FITC-
labeled wild type vs. mutant PEST (Y->A) domain peptide as a function of peptide
concentration. Peptide working concentration for both was found to be 800 nM. All data are
represented as mean +/- SD. Asterisk (*) indicates statistical significance. *: p<0.05 and **:
p<0.01.

42

Fig 6. Inhibitor B inhibits TIC self-renewal and tumor-initiation property. A) Inhibitor B
reduces cell viability of Huh7 cells but not of primary human hepatocytes. B) Inhibitor B reduces
cell viability of Hep3B cells but not of primary human hepatocytes. C) Structure of Inhibitor B
(C3 compound). D) Inhibitor B suppresses TIC self-renewal as determined by spheroid
formation. E) In silico docking screening identified inhibitor B to block the interactions between
NICD, TBC1D15 and FIS1. F) Huh7 cells transfected with NICD-myc, and TBC1D15-flag were
subjected to IP-Western blot analysis and the results showed that inhibitor B blocked
interactions between NOTCH1 and TBC1D15. G) IC50 analysis of inhibitor B (2-fold dilution
43

wi th co n c e n tr a tio n ran g ing f rom 2 0 μ M t o 1 n M ). IC 50 va lue = 2 . 5 μ M . A ll d a ta a re re presented
as mean +/- SD. Asterisk (*) indicates statistical significance. *: p<0.05 and **: p<0.01.

44

Fig 7. Nuclear localization of PDHA1 in a manner dependent on TBC1D15. A) Nuclear
localization of PDHA1 in TICs as shown by immunofluorescence staining. B) PDHA1 nuclear
levels diminished in TBC1D15 knockdown CD133(+) cells as compared to scrambled control.
C) PDH1 subunits form the complex in TIC nuclei in a TBC1D15-dependent manner, according
to co-IP studies. D)Western blot analysis of reduced expression of nuclear PDHA1 in sh-
TBC1D15 cells and loss of H3K27Ac in both TBC1D15 and PDHA1 knockdown cells. E)
PDHA1 inhibitor treatment leads to reduced histone acetylation including H3K27Ac in TICs.
F) Luciferase assay shows that mutation of the RBPJ or E2F1 site of the NANOG enhancer
decreases enhancer-reporter activity measured by Firefly/Renilla, and PDHA1 KD abolishes
activity in both wild type and mutant enhancers. G) NOTCH1 or E2F1 expression increases the
enhancer-reporter activity as measured by luciferase activity. H) Hypothetical model illustrating
the nuclear transfer of PDHA1 to the nucleus upon TBC1D15-NOTCH-FIS1 tripartite formation,
mitochondrial movement towards the nucleus and subsequent conversion of pyruvate to acetyl
CoA in the nucleus leading to activation of NANOG by induction of H3K27Ac.

45

Chapter Nine: References

1. Yang, J. D., and Heimbach, J. K. (2020). New advances in the diagnosis and
management of hepatocellular carcinoma. In The BMJ (Vol. 371).

2. Jonathan Melendez-Torres and Amit G. Singal (2022) Early detection of hepatocellular
carcinoma: roadmap for improvement, Expert Review of Anticancer Therapy, 22:6, 621-
632.

3. Mittal, Sahil, and Hashem B El- S e ra g . “Ep i d e m i o log y o f h e p a to c e ll u lar ca rci n o m a : co n side r t h e p o p u lat io n .” Journal of clinical gastroenterology vol. 47 Suppl,0 (2013).

4. Y a n g , Ju Don g e t a l. “A g lob a l view o f hepatocellular carcinoma: trends, risk, prevention
a n d m a n a g e m e n t. ” Nature reviews. Gastroenterology and hepatology vol. 16,10 (2019):
589-604.

5. Ganne-Carrié, N., and Nahon, P. “H e p a t o ce l lula r carcinoma in the setting of alcohol-
rela te d liver d isea s e .” Journal of Hepatology, vol 70, 2 (2019): 284 –293.

6. Heintges, T; Wands, J R. Hepatitis C virus: Epidemiology and transmission. Hepatology
26(3):p 521-526, September 1997.

7. Christian Brechot, Bertrand Nalpas, Mark A. Feitelson, Interactions Between Alcohol
and Hepatitis Viruses in the Liver, Clinics in Laboratory Medicine,Volume 16, Issue
2,1996,Pages 273-287.

8. Y a m a sh it a , Ta ro, a n d X in W e i W a n g . “C a n c e r ste m ce ll s in t h e d e ve lop m e n t o f li ve r
cance r.” The Journal of clinical investigation vol. 123,5 (2013).

9. Ta n g , Y i e t a l. “Prog e n ito r/ste m ce ll s g ive ri se to li ve r ca n c e r d u e to a b e rr a n t TGF -beta
and IL- 6 sig n a li n g .” Proceedings of the National Academy of Sciences of the United
States of America vol. 105,7 (2008): 2445-50.

10. Hritz, I., Mandrekar, P., Velayudham, A., Catalano, D., Dolganiuc, A., Kodys, K., Kurt-
Jones, E., and Szabo, G. (2008). The critical role of toll-like receptor (TLR) 4 in alcoholic
liver disease is independent of the common TLR adapter MyD88. Hepatology, 48(4),
1224 –1231.

11. Liu, Yu-Chin, Chau-Ting Yeh, and Kwang-Huei Lin. Cancer Stem Cell Functions in
Hepatocellular Carcinoma and Comprehensive Therapeutic Strategies. vol. 9, MDPI
AG, 2020.

12. Suetsugu, A., Nagaki, M., Aoki, H., Motohashi, T., Kunisada, T., and Moriwaki, H.
(2006). Characterization of CD133+ hepatocellular carcinoma cells as cancer
46

stem/progenitor cells. Biochemical and Biophysical Research Communications, 351(4),
820 –824.
13. Ma, Stephanie, et al. "Identification and Characterization of Tumorigenic Liver Cancer
Stem/Progenitor Cells." Gastroenterology (New York, N.Y. 1943), vol. 132, no. 7, 2007,
pp. 2542-2556.

14. Luo, Jing, et al. The Notch Pathway Promotes the Cancer Stem Cell Characteristics of
CD90+ Cells in Hepatocellular Carcinoma. vol. 7, Impact Journals, LLC, 2015,
doi:10.18632/oncotarget.6672.

15. Yu, Gui- Fa n g e t a l. “N u clea r CD 1 3 3 e xp ression p re d icts p o o r p ro gnosis for
h e p a to ce ll u l a r ca rci n o m a .” International journal of clinical and experimental
pathology vol. 11,4 2092-2099.

16. Dagogo- Ja ck, Ib iayi, a n d A li ce T S h a w. “T u m o u r heterogeneity and resistance to cancer
th e rap i e s.” Nature reviews. Clinical oncology vol. 15,2 (2018): 81-94.

17. Moriyama, Mariko, et al. "Multiple Roles of Notch Signaling in the Regulation of
Epidermal Development." Developmental Cell, vol. 14, no. 4, 2008, pp. 594-604.
MEDLINE.

18. Chen, CL., Tsukamoto, H. and Machida, K. Oncogenic signaling pathways and origins
of tumor-initiating stem-like cells of hepatocellular carcinomas induced by hepatitis C
virus, alcohol and/or obesity. Hepatol Int 8, 330 –338 (2014).

19. van Es, Johan H., et al. "Notch/[Gamma]-Secretase Inhibition Turns Proliferative Cells
in Intestinal Crypts and Adenomas into Goblet Cells." Nature (London), vol. 435, no.
7044, 2005, pp. 959.

20. Shan, Juanjuan e t a l. “N a n o g r e g u la te s s e lf -renewal of cancer stem cells through the
insulin- li ke g rowth f a c to r p a th way in h u m a n h e p a to ce ll u l a r ca rci n o m a .” Hepatology
(Baltimore, Md.) vol. 56,3 (2012): 1004-14.

21. S u n , C h u n , e t a l. “N A N OG P ro m o t e s L iver Ca n ce r Cell In v a sion b y I n d u cin g E p ith e li a l –
M e se n ch y m a l Tr a n siti o n th ro u g h No d a l/S m a d 3 S ign a li n g P a th way . ” The International
Journal of Biochemistry andamp; Cell Biology, vol. 45, no. 6, 2013, pp. 1099 –1108.

22. Pulakan ti, K ir th i e t a l. “En h a n ce r tra n scri b e d RN A s a ri se fro m h y p o m e th yl a te d , Te t -
o ccu p ie d g e n o m ic re g ion s.” Epigenetics vol. 8,12 (2013): 1303-20.

23. W h yt e , W a rr e n A e t a l. “M a ste r tra n scri p ti o n fa c to rs a n d m e d i a t o r e sta b li sh s u p e r -
enhancers at key cell identity g e n e s.” Cell vol. 153,2 (2013): 307-19.

47

24. L o vé n , Ja k o b e t a l. “ S e lect ive in h ibitio n o f tu m o r o n c o g e n e s b y d isr u p tio n o f su p e r -
e n h a n ce rs.” Cell vol. 153,2 (2013): 320-34.
25. Jia, Q., Chen, S., Tan, Y. et al. Oncogenic super-enhancer formation in tumorigenesis
and its molecular mechanisms. Exp Mol Med 52, 713 –723 (2020).

26. Below, Mckenna, and Clodia Osipo. Notch Signaling in Breast Cancer: A Role in Drug
Resistance. vol. 9, MDPI AG, 2020.

27. Siddique, Hifzur R., et al. NUMB Phosphorylation Destabilizes p53 and Promotes Self‐
renewal of Tumor‐initiating Cells by a NANOG‐dependent Mechanism in Liver
Cancer. vol. 62, Ovid Technologies (Wolters Kluwer Health), 2015.

28. Feldman DE, Chen C, Punj V, Machida K (2013) The TBC1D15 Oncoprotein Controls
Stem Cell Self-Renewal through Destabilization of the Numb-p53 Complex. PLOS ONE
8(2).

29. P e ralta , E ig e n R e t a l. “ Di ff e ren tia l e ff e cts o f T B C1D1 5 a n d m a m m a li a n V p s3 9 o n Ra b 7 activation state, lysosomal morphology, and growth f a cto r d e p e n d e n ce .” The Journal of
biological chemistry vol. 285,22 (2010): 16814-21.

30. Han, Z., Zhang, W., Ning, W. et al. Model-based analysis uncovers mutations altering
autophagy selectivity in human cancer. Nat Commun 12, 3258 (2021).

31. Takahara, Y., Maeda, M., Hasegawa, H. et al. Silencing of TBC1D15 promotes RhoA
activation and membrane blebbing. Mol Cell Biochem 389, 9 –16 (2014).

32. Yamano, K., Fogel, A., Wang, C., van der Bliek, A M, Youle, R J. Mitochondrial Rab
GAPs govern autophagosome biogenesis during mitophagy. eLife 2014.

33. Mozdy, A.D., McCaffery, J.M., Shaw, J.M. Dnm1p Gtpase-Mediated Mitochondrial
Fission Is a Multi-Step Process Requiring the Novel Integral Membrane Component
Fis1p. J Cell Biol 16 October 2000; 151 (2): 367 –380.
34.Warburg, O. On the Origin of Cancer Cells. Science 123, 309-314 (1956).
35.Lee KM, et al. MYC and MCL1 Cooperatively Promote Chemotherapy-Resistant
Breast Cancer Stem Cells via Regulation of Mitochondrial Oxidative
Phosphorylation. Cell metabolism 26, 633 –647 e637 (2017).
36.Viale A, et al. Oncogene ablation-resistant pancreatic cancer cells depend on
mitochondrial function. Nature 514, 628 –632 (2014).
37.Artavanis-Tsakonas S., Rand M. D., Lake R. J. (1999) Notch signaling. Cell fate
control and signal integration in development. Science 284, 770 –776.
38.Landor S. K., Mutvei A. P., Mamaeva V., Jin S., Busk M., Borra R., Grönroos T. J.,
Kronqvist P., Lendahl U., Sahlgren C. M. (2011) Hypo- and hyperactivated Notch
48

signaling induce a glycolytic switch through distinct mechanisms. Proc. Natl. Acad. Sci.
U.S.A. 108, 18814 –18819.
39. B a sa k, Nan d i n i P a l e t a l. “Alte ra tio n o f m ito ch o n d ri a l p rot e o m e d u e t o a c tiva tio n o f Not ch 1 sig n a li n g p a t h way. ” The Journal of biological chemistry vol. 289,11 (2014):
7320-34.
40. Na g a raj, Rag h a ve n d ra e t a l. “N u cle a r L o ca li za tio n o f M ito ch o n d ri a l TC A Cycl e Enzymes a s a Cr itical S te p in M a m m a li a n Zyg o tic G e n o m e A ctiva ti o n .” Cell vol.
168,1-2 (2017): 210-223.e11.
41.Ahn, C.S., Metallo, C.M. Mitochondria as biosynthetic factories for cancer
proliferation. Cancer Metab 3, 1 (2015).
42.Wieland OH. The mammalian pyruvate dehydrogenase complex: structure and
regulation. Rev Physiol Biochem Pharmacol. 1983; 96:123 –170.
43. Ch e n , Jin g ji n g e t a l. “C o m p a rtm e n ta li ze d a ctivities o f t h e p yruva t e d e h y d rog e n a s e co m p l e x su st a in li p o g e n e sis in p rost a t e ca n ce r.” Nature genetics vol. 50,2 (2018): 219-
228.
44. Fe n g , Jie e t a l. “D A P T, a γ -Secretase Inhibitor, Suppresses Tumorigenesis, and
Progression of Growth Hormone-Producing Adenomas by Targeting Notch Si
g n a li n g .” Frontiers in oncology vol. 9 809. 27 Aug. 2019.

45. Rust i g h i, A l e ssa n d ra e t a l. “Th e p rolyl -isomerase Pin1 is a Notch1 target that enhances
Not ch 1 a ctiva tio n in c a n ce r.” Nature cell biology vol. 11,2 (2009).

46.Chen, Chia- L in e t a l. “ NANOG Metabolically Reprograms Tumor-Initiating Stem-like
Cells through Tumorigenic Changes in Oxidative Phosphorylation and Fatty Acid
M e ta b o li s m .” Cell metabolism vol. 23,1 (2016): 206-19.

47. Za c h a r, Z u za n a e t a l. “N o n -redox-active lipoate derivates disrupt cancer cell
m ito ch o n d ri a l m e ta b o l ism a n d a re p o te n t a n tica n ce r a g e n ts i n vivo. ” Journal of
molecular medicine (Berlin, Germany) vol. 89,11 (2011): 1137-48.

48.Fryer, C., White, B J., Jones, K A. Mastermind Recruits CycC: CDK8 to Phosphorylate
the Notch ICD and Coordinate Activation with Turnover. Molecular Cell, vol 16. 4, (2004),
509-520.

49.Guinez, C., Morelle, W., Michalski, J.-C., and Lefebvre, T. (2005). O-GlcNAc
glycosylation: a signal for the nuclear transport of cytosolic proteins? The International
Journal of Biochemistry and Cell Biology, 37(4), 765 –774.

50.Green, M. R., and Sambrook, J. (2017). Isolation of High-Molecular-Weight DNA Using
Organic Solvents. Cold Spring Harbor Protocols, 2017(4), pdb.prot093450.

Abstract (if available)

Abstract Hepatocellular carcinoma (HCC) is the fifth most frequent malignancy worldwide, with a median survival time of 6 to 16 months post-diagnosis (Mak et al., 2018). Late-onset diagnosis, underlying cirrhosis, and resistance to chemotherapy are all factors that contribute to the poor prognosis; 40% of HCCs are clonal and so may emerge from progenitor/stem cells. A growing body of evidence suggests that tumor initiating stem-like cells (TICs) drive HCC development. We identified TBC1D15- mediated downstream pathways involved in promoting self-renewal of tumor initiating stem-like cells and hence, stimulating tumorigenic environment. TBC1D15 interacts with NOTCH1 to stabilize and activate the NOTCH pathway in TICs. Co-IP analysis using different NOTCH1 deletion mutants demonstrated that TBC1D15 interaction with NOTCH1 is through the PEST domain at the C-terminal of NOTCH. We validated the activation of the NOTCH pathway through the luciferase assay performed using a HEY1-luc construct. Co-IP research revealed that NICD interacts with TBC1D15 and FIS1 at the mitochondrial outer membrane in TICs. TBC1D15-NOTCH1-FIS1 complex formation enhanced mitochondrion-nucleus spatial proximity and the development of this triple protein complex was dependent on Notch intracellular domain (NICD) and was essential for PDH1 nuclear translocation. Extensive small molecule inhibitor screening identified one inhibitor that blocks the interaction between TBC1D15 and NOTCH1 and exhibited a potent TIC killing effect.

Linked assets

University of Southern California Dissertations and Theses

Conceptually similar

PDF

Identification of molecular mechanism for cell-fate decision in liver; &, SARS-CoV replicon inhibitor high throughput drug screening

PDF

Polycomb repressive complex 2 subunit stabilizes NANOG to maintain self-renewal in hepatocellular carcinoma tumor-initiating stem-like cells

PDF

Cell fate reprogramming of liver tumor-initiating stem-like cells via phosphorylated NUMB and TBC1D15

PDF

Roles of epithelial-mesenchymal transition and niche in tumorigenesis of tumor-initiating cells

PDF

Tri-specific T cell engager immunotherapy targeting tumor initiating cells

PDF

Hepatitis B virus X protein regulation of β-catenin and NANOG and co-regulatory role with YAP1 in HCC malignancy

PDF

Targeting tumor-initiating stem-like cells through metabolic and epigenetic regulations

PDF

Role of a novel transmembrane protein, MTTS1 in mitochondrial regulation and tumor suppression

PDF

Steatosis induces Wnt/β-catenin pathway to stimulate proliferation of hepatic tumor initiating cells and promote liver cancer development

PDF

Lnc-RNA and WNT signal synergistically promotes self-renewal of tumor initiating stem-like cells via epigenetic regulation

PDF

Treatment of HPV driven tumors with SH5-07, a small molecule inhibitor targeting STAT3

PDF

Mechanisms of nuclear translocation of pyruvate dehydrogenase and its effects on tumorigenesis of hepatocellular carcinoma…

PDF

SARS-CoV-2 suppression of CD1d expression and NKT cell function

PDF

WAVE1 is a novel mediator of HPV trafficking to the Golgi apparatus

PDF

Musashi-2 promotes c-MYC expression through IRES-dependent translation and self-renewal ability in hepatocellular carcinoma

PDF

MSI2 level alters histone transcription rate in HepG2 cells

PDF

Cell surface translocation and therapeutic targeting of GRP78

PDF

Methodology of exploring the role of SOX9 in the human HCC stem-like cells

PDF

Investigating the effects of polycomb repressive complex inhibitors on cancer cell phenotypic plasticity

PDF

The analysis and modeling of signaling pathways induced by the interactions of the SARS-CoV-2 spike protein with cellular receptors

Asset Metadata

Creator Mehta, Simran (author)

Core Title Targeting mitochondrion-nucleus PDH1 transfer to suppress self-renewal and epigenetic NANOG reprogramming of tumor-initiating cells

School Keck School of Medicine

Degree Master of Science

Degree Program Molecular Microbiology and Immunology

Degree Conferral Date 2023-08

Publication Date 06/27/2023

Defense Date 06/22/2023

Publisher University of Southern California (original), University of Southern California. Libraries (digital)

Tag HCC,OAI-PMH Harvest,small molecule inhibitor,TBC1D15-NOTCH1 interaction,TICs

Format theses (aat)

Language English

Contributor Electronically uploaded by the author (provenance)

Advisor Machida, Keigo (committee chair), Landolph, Joseph (committee member), Stiles, Bangyan (committee member)

Creator Email sim.mehta1798@gmail.com,simranme@usc.edu

Permanent Link (DOI) https://doi.org/10.25549/usctheses-oUC113260061

Unique identifier UC113260061

Identifier etd-MehtaSimra-11997.pdf (filename)

Legacy Identifier etd-MehtaSimra-11997

Document Type Thesis

Format theses (aat)

Rights Mehta, Simran

Internet Media Type application/pdf

Type texts

Source 20230630-usctheses-batch-1059 (batch), University of Southern California (contributing entity), University of Southern California Dissertations and Theses (collection)

Access Conditions The author retains rights to his/her dissertation, thesis or other graduate work according to U.S. copyright law. Electronic access is being provided by the USC Libraries in agreement with the author, as the original true and official version of the work, but does not grant the reader permission to use the work if the desired use is covered by copyright. It is the author, as rights holder, who must provide use permission if such use is covered by copyright.

Repository Name University of Southern California Digital Library

Repository Location USC Digital Library, University of Southern California, University Park Campus MC 2810, 3434 South Grand Avenue, 2nd Floor, Los Angeles, California 90089-2810, USA

Repository Email cisadmin@lib.usc.edu