University of Southern California Dissertations and Theses

Fibroblastic connective tissue cells: the blastema stem cells and source of large-scale chondrogenesis in the regenerating lizard tail

(USC Thesis Other)

Fibroblastic connective tissue cells: the blastema stem cells and source of large-scale chondrogenesis in the regenerating lizard tail

PDF

Download a page range

Download transcript

Copy asset link

Request this asset

Transcript (if available)

Content

FIBROBLASTIC CONNECTIVE TISSUE CELLS:
THE BLASTEMA STEM CELLS AND SOURCE OF LARGE-SCALE CHONDROGENESIS
IN THE REGENERATING LIZARD TAIL

by

Ariel C V onk

A Dissertation Presented to the
FACULTY OF THE USC GRADUATE SCHOOL
UNIVERSITY OF SOUTHERN CALIFORNIA
In Partial Fulfillment of the
Requirements for the Degree
DOCTOR OF PHILOSOPHY
(DEVELOPMENT, STEM CELLS, AND REGENERATIVE MEDICINE)

December 2023

Copyright 2023 Ariel C V onk

ii
ACKNOWLEDGEMENTS

Thank you to my mentor, Dr. Tom Lozito, for supporting me in ways I did not even know I needed.
For teaching me the ins and outs of lizards, academic research, how to cope with the endless
criticisms from reviewers, and for being living proof that there are PIs who know students are
people first, and scientists second. Thank you for giving me the confidence to believe in my skills
when I doubted myself. I would not have achieved this milestone without you and am forever
grateful for all that you have done.

Thank you to my committee members, Drs. Denis Evseenko and Francesca Mariani, for providing
scientific, professional, and personal support. Your kindness and encouragement have helped to
make me the scientist I am. Dr. Zhongwei Li, thank you for your mentorship and all you have
taught me. You helped me develop skills I will use for the rest of my life as a researcher.

To my lab members, especially Megan Hudnall and Darian Gamble, the lab would not and could
not run without you. I owe this achievement as much to you as I do to myself. Thank you for
always going the extra mile for me, feeding the lizards on my crazy days, and always having my
back when I needed it most. Know that I will always have yours!

To my family, especially my mother, who praised for me from afar every step of the way and for
helping me stick it out when I was at the end of my rope, questioning my choices. Thank you for
always letting me know I had a place to come back to regardless of those choices. To my brother

iii
for visiting when I was at my lowest, helping me to recharge and remind me of who I am and why
I began this journey in the first place. I am the first Dr. V onk because of you all.

To my amazing cohort, the friends I made on day one at USC when I knew and had no one on this
coast. Current and future Drs. Rosanna Calderon Campos, Ashley Del Dosso, and Han Vu, this
would not have happened without your constant love and support. Just show up!

And to Nash Arbuckle, my rock through this journey. I could not have asked for a better partner
and cheering section. You have made Los Angeles a special place in my heart by showing me all
the good it has to offer and helped me persevere when I thought I could not finish this marathon.
You have been proud of me from the start, even when I thought I did not deserve it. Thank you for
sticking it out with me, in this and in everything.

iv
TABLE OF CONTENTS

Acknowledgements ............................................................................................................ ii

List of Tables ...................................................................................................................... v

List of Figures .................................................................................................................... vi

Abstract .............................................................................................................................. ix

Introduction ........................................................................................................................ 1

Chapter 1: Single-Cell Analysis of Lizard Blastema Fibroblasts Reveals Phagocyte-
Dependent Activation of Hedgehog-Responsive Chondrogenesis ................. 4
Abstract ....................................................................................................... 5
Introduction ................................................................................................ 5
Results ........................................................................................................ 9
Discussion ................................................................................................. 27
Materials and Methods ............................................................................. 34
Supplementary Materials and Methods .................................................... 45
Figures ...................................................................................................... 51
Supplementary Figures ............................................................................. 66
Supplementary Tables ............................................................................... 95

Chapter 2: Lizard Blastema Organoid Model Recapitulates Regenerated Tail
Chondrogenesis .............................................................................................. 98
Abstract ..................................................................................................... 99
Introduction .............................................................................................. 99
Results .................................................................................................... 101
Discussion ............................................................................................... 105
Materials and Methods ........................................................................... 108
Figures .................................................................................................... 113
Supplementary Figures ............................................................................ 117

Chapter 3: Conclusion .................................................................................................... 118

References ...................................................................................................................... 124

v
LIST OF TABLES
Chapter 1
Supplementary Table 1. Relative fibroblast marker gene expression throughout tail
regeneration ...................................................................................................................... 95

Supplementary Table 2. Catalog information for commercial probes critical to in
situ hybridization (ISH) and fluorescent ISH experimental outcomes ............................. 96

Supplementary Table 3. RT-PCR primer sequences ...................................................... 97

vi
LIST OF FIGURES
Chapter 1

Figure 1. Single-cell RNA sequencing of regenerating lizard tails with pseudotime
trajectory analysis of fibroblastic connective tissue cells and chondrocytes throughout
tail regeneration ................................................................................................................ 51

Figure 2. Lizard tail fibroblasts exhibit spatiotemporal marker gene activation during
regeneration ...................................................................................................................... 53

Figure 3. Sulf1 expression in lizard tail blastema, but not limb, is regulated by
Hedgehog stimulation ....................................................................................................... 55

Figure 4. Comparing chondrogenic abilities of fibroblasts derived from original tail,
blastema and regenerated tails in vivo .............................................................................. 56

Figure 5. Comparing chondrogenic abilities of sulf1
+
tail blastema cells and sulf1
-

tail fibroblasts in vivo ....................................................................................................... 58

Figure 6. Spatiotemporal localizations of macrophage, osteoclast, and septoclast
populations during lizard tail regeneration and limb amputation ..................................... 60

Figure 7. Pre-exposure to phagocytic cells is required for activation of Hedgehog-
responsive chondrogenesis in lizard fibroblasts ............................................................... 62

Figure 8. Factors secreted by lizard macrophage and septoclast populations rescue
tail FCTC marker gene expression and chondrogenic potntial following endogenous
phagocyte depletion .......................................................................................................... 63

Figure 9. Lizard macrophage- and septoclast-secreted factors stimulate FCTCs and
promote chondrogenesis to amputated lizard limbs ......................................................... 64

Figure 10. Summary of proposed mechanism of FCTC gene expression acquisition
and chondrogenesis during lizard tail regeneration .......................................................... 65

Supplementary Figure 1. Single-cell RNA sequencing (scRNAseq) cluster gene
expression and validation ................................................................................................. 66

Supplementary Figure 2. Fluorescent ISH quantification of proportional area
contributions of respective cell types by scRNAseq cluster ............................................ 67

Supplementary Figure 3. FCTC/chondrocyte pseudotime trajectory analysis and
TSNE subclustering by tail stage ..................................................................................... 68

vii
Supplementary Figure 4. FCTC/chondrocyte subcluster gene expression and
pseudotime trajectory analysis of sall1 and pltp .............................................................. 70

Supplementary Figure 5. Additional fibroblast gene expression throughout lizard
tail regeneration ................................................................................................................ 71

Supplementary Figure 6. Hedgehog signaling regulates blastema cell
chondrogenesis ................................................................................................................. 73

Supplementary Figure 7. Lizard tail, but not limb, fibroblasts undergo Hedgehog-
regulated chondrogenesis ................................................................................................. 74

Supplementary Figure 8. Real time-polymerase chain reaction (RT-PCR) reveals
sulf1 expression is Hedgehog signaling-dependent in regenerating lizard tail ................ 76

Supplementary Figure 9. Validation of L. lugubris fibroblast cell isolation pools via
MACS
®
bead depletion .................................................................................................... 77

Supplementary Figure 10. Regenerating lizard tail skeletons exhibit proximodistal
gradients of sulf1 and sox9 ............................................................................................... 78

Supplementary Figure 11. Comparing chondrogenic abilities of tail and limb
fibroblasts in vivo ............................................................................................................. 79

Supplementary Figure 12. Comparing chondrogenic abilities of sulf1
+
tail blastema
cells and sulf1
-
tail fibroblasts in vivo, separately, in SAG- and vehicle control-treated
recipient lizards ................................................................................................................ 81

Supplementary Figure 13. Regenerated lizard tails exhibit distinct macrophage,
osteoclast, and septoclast-like cell populations ................................................................ 82

Supplementary Figure 14. Phagocytic macrophage and osteoclast populations peak
during inflammatory stage 7 DPA .................................................................................... 83

Supplementary Figure 15. Clodronate treatment depletes phagocyte populations,
prevents blastema formation, and inhibits blastema fibroblast gene expression
changes .............................................................................................................................. 84

Supplementary Figure 16. Sulf1 and spp1 expression co-localize in lizard blastema
fibroblasts ......................................................................................................................... 86

Supplementary Figure 17. Clodronate liposome treatments deplete phagocytes and
inhibits tail regeneration in both A. carolinensis and L. lugubris lizards ......................... 87

viii
Supplementary Figure 18. Comparing chondrogenic abilities of tail blastema
fibroblasts with and without phagocytic cell exposure in vivo, separately, in SAG-
and vehicle control-treated recipient lizards ..................................................................... 89

Supplementary Figure 19. Validation of bone marrow cell-derived macrophages
and tail vessel pericyte-derived septoclasts differentiated in culture ............................... 90

Supplementary Figure 20. Septoclast cell-conditioned media does not induce
amputated tail fibroblast sulf1 expression in the absence of endogenous phagocyte
populations and Hedgehog signaling ................................................................................ 91

Supplementary Figure 21. Unconditioned phagocyte media does not induce sulf1,
spp1 or sox9 expression in clodronate liposome-treated tails or untreated amputated
limbs ................................................................................................................................. 92

Supplementary Figure 22. Septoclast cell-conditioned media does not induce
amputated tail fibroblast sulf1 or sox9 expression in the absence of Hedgehog
signaling ........................................................................................................................... 93

Supplementary Figure 23. Gating strategy for flow cytometry analysis in
Supplementary Figure 19 ................................................................................................. 94

Chapter 2
Figure 1. CDH11
+
cells in original and regenerating lizard tails ................................... 113

Figure 2. CDH11 expression in micromass blastema organoid cultures ....................... 114

Figure 3. Sox9 expression in control and SAG-treated blastema tails .......................... 115

Figure 4. Micromass blastema organoid cultures mimic lizard tail regenerate
cartilage formation in optimized dissociation protocol and media ................................. 116

Supplementary Figure 1. RNAscope negative control in lizard blastema and cell
pellets .............................................................................................................................. 117

ix
ABSTRACT
Lizards cannot naturally regenerate limbs but are the closest known relatives of mammals
capable of epimorphic tail regrowth. However, the processes regulating the spatiotemporal
initiation of lizard tail blastema formation and chondrogenesis remain largely unknown, as well as
the cell types and signatures of cells involved. Fibroblastic connective tissue cells (FCTCs) have
been previously identified as the most abundant cell type found in the blastema of regenerating
axolotl limbs, thus, we propose activated FCTCs as the main blastema stem cell undergoing
chondrogenesis in lizard tail regeneration. Using green anole lizards (Anolis carolinensis), we
characterized the major cell types that make up the heterogenous blastema and regenerating tail
using single-cell RNA sequencing and evaluated the role and cellular mechanisms behind FCTCs
in lizard tail blastema formation and chondrogenesis. Tail blastema, but not limb, fibroblasts
express sulf1 and form cartilage under Hedgehog signaling regulation, while factors from lizard
phagocytic cells were shown to be critical for fibroblast-derived blastema and cartilage formation.
Our results indicate a hierarchy of phagocyte-induced fibroblast gene activations during lizard
blastema derivation, culminating in sulf1
+
pro-chondrogenic populations singularly responsive to
Hedgehog signaling. We also developed an in vitro model of the blastema, using a novel FCTC
blastema pellet culture system, modulated with Hedgehog signaling agonists, to recapitulate in
vivo lizard tail cartilage formation. These results and novel model system will allow for greater
understanding of appendage regeneration and may indicate actionable targets for inducing
regeneration in other species, including humans.

1
INTRODUCTION
The field of regenerative medicine aims to improve healing outcomes for patients with
damaged or lost tissues. However, appendage regeneration in mammals remains a distant
achievement in the field. Humans, like most mammals, suffer from minimal natural regenerative
capabilities. For example, there are nearly 2 million people living with limb loss in the United
States, and approximately 185,000 amputations occur each year[1]. The ability to improve the
regenerative capabilities of patients and functionally regenerate a complex structure, such as an
arm or spinal cord, is beyond the current limits of medical science. Remarkably, many non-
mammalian species are naturally capable of these exact feats of wound healing. The most widely
studied of these “hyper-regenerative” organisms are the salamanders. However, important
differences between mammalian and anamniote biology create barriers for translating amphibian
regenerative mechanisms to clinical relevancy. For example, salamanders exhibit amphibian
developmental stages, cell types, and genetics with amazing regenerative abilities but lack analogs
in mammals[2]. Lizards are an informative model organism to bridge this gap.
Evolutionarily, lizards are the closest amniote relative to mammals that maintain
appendage regeneration capacity. Lizards can spontaneously regenerate their tails following
amputation or loss throughout their lifespan[3–5], while mammals, like mice, form scars[6].
Regenerated tails contain a diversity of organized tissue types, including muscle bundles, fat,
epidermis, fibroblasts, blood vessels and a regenerated spinal cord, similar to their original tails,
but do not perfectly recapitulate the original structure. Notably, regenerates contain an unpatterned
cartilaginous tube as the main skeletal structure compared to the segmented and ossified vertebrae
of the original. Lizards regenerate large areas of cartilage in their tails[3,4,7–10], a tissue that
mammals are almost exclusively unable to repair or regrow[11]. Additionally, like mammals,

2
lizards are unable to regenerate limbs. Thus, limb amputation can conveniently be used as a control
within the same organism during regeneration fidelity experiments when utilizing lizard
models[5].
Tail regeneration follows reliable pattern of regrowth morphology, allowing it to be
characterized into stages based on phenotype and time post amputation[12–14]. During early
regeneration, approximately 3 days post amputation (DPA), an early robust immune response
occurs in which macrophages and osteoclasts infiltrate the tail stump, excreting proteases to break
down damaged bone and tissues with limited inflammation, while the epidermis proliferates to
seal the wound through a portion of the distal tail and the damaged distal vertebrae[4,15]. By 7
DPA, this excluded distal tissue is shed and the remaining tail stump epidermis proliferates,
forming the wound epidermis. A late immune response occurs with macrophages, microglia,
osteoclasts, and the wound epidermis secreting proteases and signals to break down and activate
fibroblastic connective tissue cells (FCTCs) at the tail stump[4,16,17], consistent with regenerating
salamander limb data[18–21]. Infiltrating immune cells also activate glial progenitor cells (GPC)
lining the central canal of tail spinal cord to invade the wound environment[15,22]. Activated
GPCs undergo gliogenesis including migration and proliferation, ultimately self-organizing into
an ependymal tube (ET). The ET invades and pushes closer to the wound epithelium, forming a
bulge of cells at the distal tail stump, a blastema, around 14 DPA. By 21 DPA, blastema cells
continue to proliferate pushing to elongate the tail and differentiating into the various tissue types
of the regenerated tail, while GPCs and the ET continue forming down the growing structure.
GPCs and glial cells within the ET secrete the morphogen sonic hedgehog (shh), which is required
for sox9 activation and chondrogenesis for the formation of the cartilage tube[3,4,7,9,13,23,24].
By 28 DPA, sox9-expressing cells surrounding the regenerated ependymal tube activate

3
chondrogenic programming, leading to cartilage differentiation and synthesis of cartilage matrix
rich in collagen type II (Col2a1). The ET goes on to form the regenerated tail spinal cord, a reduced
structure with neuron tracks[4,5,7,8,24–26].
The blastemas of regenerating axolotl limbs have been previously characterized, with vast
majority of cells being identified as FCTCs[18–21,27–29]. These fibroblasts are derived from
connective tissues of the limb stump and have been shown to differentiate into a variety of axolotl
limb tissues following appendage loss via lineage tracing experiments[18,21,28]. Blastema FCTCs
in axolotl contain cell expression patterns and signatures closely equivalent that of the developing
limb bud before redifferentiating into terminal limb tissue[18,28]. Comparatively, the cells and
signatures that make up the blastema in lizard tail regeneration and eventually lead to large-scale
chondrogenesis have not been described.
Here, I present the first single-cell RNA sequencing analysis in regenerating green anole
(Anolis carolinensis) tail. This dataset allowed for the characterization of cell types in the lizard
blastema, and identification of FCTCs as the blastema stem cell in lizards. Gene expression of
FCTCs were analyzed, allowing for marker identification for FCTCs, and were used for further
investigation into the chondrogenic potential of fibroblasts in the original, blastema or regenerating
tails when transplanted and traced in situ into cohort lizard tails. Single-cell analysis also led to
the identification of a phagocytic cell type specific to the regenerating lizard tail, uniquely
expressing both pericytic and phagocytic expression patterns, that is revealed to secrete factors
required for chondrogenesis and tail regrowth. Lastly, I modeled the blastema in vitro by
optimizing a culture system using primary FCTCs isolated from lizards, that allows for controlled
drug testing and chondrogenic potential assessment of lizard blastema in a small, reproducible
organoid model.

4
CHAPTER 1: Single-Cell Analysis of Lizard Blastema Fibroblasts Reveals Phagocyte-
Dependent Activation of Hedgehog-Responsive Chondrogenesis
1

Ariel C. V onk
2,3
, Xiaofan Zhao
4
, Zheyu Pan
2,3
, Megan L. Hudnall
3
, Conrad G. Oakes
3
, Gabriela
A. Lopez
2
, Sarah C. Hasel-Kolossa
2
, Alexander W. C. Kuncz
3
, Sasha B. Sengelmann
3
, Darian J.
Gamble
2,3
& Thomas P. Lozito
2,3

© 2023 This article is an open access article distributed under the terms and conditions of the
Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).

1
This manuscript was submitted to and published by Nature Communications[30] on 12/09/22 and 08/10/23,
respectively. https://doi.org/10.1038/s41467-023-40206-z
2
Affiliation: Department of Stem Cell Biology and Regenerative Medicine, Keck School of Medicine, University of
Southern California, 1425 San Pablo St, Los Angeles, CA, 90033, USA
3
Affiliation: Department of Orthopaedic Surgery, Keck School of Medicine, University of Southern California,
1540 Alcazar St, Los Angeles, CA, 90033, USA
4
Affiliation: Molecular Genomics Core, USC Norris Comprehensive Cancer Center, Keck School of Medicine,
University of Southern California, 1441 Eastlake Ave, Los Angeles, CA, 90033, USA

5
ABSTRACT
Lizards cannot naturally regenerate limbs but are the closest known relatives of mammals
capable of epimorphic tail regrowth. However, the mechanisms regulating lizard blastema
derivation and chondrogenesis remain unclear. Single-cell RNA sequencing analyses of
regenerating lizard tails identify fibroblast and phagocyte populations linked to cartilage
formation. Pseudotime trajectory analyses suggest spp1
+
-activated fibroblasts as blastema cell
sources, with subsets exhibiting sulf1 expression and chondrogenic potential. Tail blastema, but
not limb, fibroblasts express sulf1 and form cartilage under Hedgehog signaling regulation.
Depletion of phagocytes inhibits blastema formation, but treatments with media conditioned by
pericytic phagocytes rescue blastema chondrogenesis and cartilage formation in amputated limbs.
Here, results indicate a hierarchy of phagocyte-induced fibroblast gene activations during lizard
blastema derivation, culminating in sulf1
+
pro-chondrogenic populations singularly responsive to
Hedgehog signaling. These properties distinguish lizard blastema cells from homeostatic and
injury-stimulated fibroblasts and indicate potential actionable targets for inducing regeneration in
other species, including humans.

INTRODUCTION
Appendage regeneration remains a lofty goal in mammalian stem cell research, with few
examples of native large-scale tissue repair/replacement in humans and traditional mammalian
model organisms. With complex immune systems leading to extensive inflammatory responses to
tissue injury, mammal appendage loss, with few exceptions, tends to result in fibrosis and scar
formation rather than a regenerative response[6,31]. Research in non-mammalian vertebrates may

6
provide clues as to the molecular mechanisms and pathways responsible for a regenerative
outcome following limb and tail loss.
Regeneration research often highlights the axolotl salamander (Ambystoma mexicanum)
due to its remarkable ability to regenerate perfectly patterned copies of lost limbs or tails. However,
these amphibian organisms are distantly related to humans evolutionarily, do not undergo the same
life cycle stages as mammals, and exhibit neoteny, meaning they maintain juvenile features
through adulthood[2]. Evolutionarily closer related mouse digit tip studies involve a model system
more akin to humans and other mammals, but can only achieve limited regrowth, requiring nail
bed presence and restricting amputation to the most distal phalanges[32]. Further, mouse digit tip
healing is lineage-restricted, and blastema cells in adult mice are unable to differentiate into
cartilage[33,34]. Deer regenerate antlers, another example of mammalian regeneration, but do not
develop blastemas during the process of regeneration[35], highlighting a significant divergence
between their regrowth process and other blastema-based appendage regeneration models.
Lizards, amniotes that are more closely related evolutionarily to humans than amphibian
models, provide an intermediary for appendage regeneration research due to their natural
epimorphic tail regeneration capacity throughout their lifespan[3]. Additionally, lizards have more
complex and adaptive immune systems[15], more like that of mammals, contrasting more
rudimentary immune systems exhibited in amphibians, lacking sophisticated adaptive
immunity[36,37]. Thus, lizards emerge as an excellent model to investigate the role of the
inflammatory response in large-scale appendage replacement. Interestingly, lizards regenerate
distinctly different copies of their tails following loss, rather than recapitulating the original tail
tissues and patterning. Regenerated tails are fully functional and contain similar muscle, epithelial,
endothelial, adipose, and nervous tissues[5]. However, original tails are structured by an ossified

7
vertebrate skeleton, while the regenerated lizard tail skeleton consists of a single cartilage tube
surrounding the regenerated spinal cord. Additionally, regenerated tails appear to be innervated
only by the peripheral nervous system and lack true tendons[4,5,7,8,15,38–40]. Despite these
differences, lizards provide a promising model for appendage regeneration in amniotes, as well as
a model for large-scale chondrogenesis.
The immune response to appendage loss plays a massive role in the outcome of repair and
regeneration. Macrophages act in the early innate immune response to injury, traditionally referred
to as M1 macrophages, removing debris and necrotic tissue via phagocytosis, and secreting
chemokines, cytokines, and matrix-degrading enzymes, aiding in the coordination and recruitment
of other inflammatory response cells. Later in the immune response, M2 macrophages aid in tissue
growth and repair, secreting pro-angiogenic and proliferative factors to the regenerating tissue
environment[41–44].
The recruitment of macrophages and phagocytic cells to injury sites has been shown to be
crucial for appendage regeneration in several model organisms. For example, upon macrophage
depletion and amputation, mouse digit tip cells fail to accumulate at the wound site, the wound
does not re-epithelialize, and the digit does not regenerate[45]. Similar depletion treatments in
axolotls following limb amputation result in successful wound closure but lack subsequent limb
regeneration[46]. Ablation of macrophages during adult zebrafish caudal fin amputation resulted
in lack of blastema formation and fin regeneration[47], and macrophage loss prevents epimorphic
ear pinna regeneration in African spiny mice[48], underscoring the importance of macrophage
interaction during regrowth. Phagocytic osteoclasts have also been shown to play a critical role in
bone resorption and patterning in axolotl skeleton regrowth during limb regeneration[28,49,50].
Macrophages have been identified in amputated lizard tail and limbs injuries, including within

8
regenerating tail blastema[16,17,51], while systemic depletion of phagocytic cells in lizards has
been shown to prevent tail stump tissue ablation and subsequent tail regeneration[15].
Among the cells recruited by macrophages during the immune response, fibroblasts have
been shown to activate and migrate to areas of tissue loss in a coordinated manner[27]. Fibroblasts
localize to wounded tissue and respond to signals from the injured tissue environment in a similar
manner to innate immune cells, reacting to chemokines from damaged platelets and damage-
associated molecular patterns released by apoptotic cells[42]. In later stages of immune responses,
when inflammation is resolving, fibroblasts proliferate and deposit extracellular matrices and
collagens, which are critical for successful tissue remodeling and regeneration[27,44].
Reciprocally, fibroblasts have also been shown to recruit macrophages in some instances of tissue
repair through chemokine secretion[52]. Dysregulation of macrophage-fibroblast crosstalk in pro-
inflammatory stages can lead to fibrosis, scarring, and aberrant or incomplete tissue repair[6].
Fibroblastic connective tissue cells (FCTCs) have been previously identified as the most
abundant cell type found in blastemas of regenerating axolotl limbs[18–20,28,29]. Lineage tracing
of axolotl blastema FCTCs reveal derivation from connective tissues of remaining limb stump
skeleton, cartilage, tendons, dermis, pericytes, and interstitial fibroblasts, following limb loss.
These blastema FCTCs mimic embryonic limb bud signatures before redifferentiating into the
patterned limb skeleton and connective tissues[18,21]. The cell types and signatures that make up
lizard blastemas and lead to chondrogenesis are largely unknown.
Here, we present single-cell RNA sequencing performed in the green anole lizard, Anolis
carolinensis, characterizing regeneration of the tail and an investigation of the role of FCTCs and
phagocytes in regeneration and chondrogenesis.

9
RESULTS
Heterogenous fibroblasts contribute to lizard tail regrowth
To investigate the complexity and heterogeneity of each regeneration state during tail
regrowth, we performed single-cell RNA sequencing (scRNAseq) on staged tail samples of the
green anole lizard, Anolis carolinensis. Utilizing the 10x Genomics scRNAseq platform, tail
samples were divided into one of the four following sample groups: original tail (0 days post-
amputation, DPA), inflammatory stage (1, 3 & 7 DPA), blastema stage (14 & 21 DPA), or
regenerated homeostasis (28 DPA). Inflammatory and blastema stage samples included multiple
sample time points to ensure consistency among sample groups considering inherent variability in
tail regeneration between individuals[14]. In addition to tracking sample DPA, samples were
assessed for morphology and characteristic regeneration stage phenotypes[12], resulting in
multiple time points utilized in inflammatory and blastema stages (detailed
phenotypes/morphologies for each tail stage are described in Methods). Sequencing results were
analyzed using the 10x Genomics Cell Ranger[53] pipeline and R packages Seurat[54] and
Harmony[55].
Unsupervised UMAP clustering of the regeneration time course revealed 14 distinct cell
clusters (Figure 1a). Clusters were analyzed for top differentially expressed genes, and key cell
types were validated via in situ hybridization (ISH) and histology for corresponding tissue gene
expression in regenerating tail samples (Supplementary Figure 1). Several clusters of immune and
blood cells were identified including cathepsin B (ctsb
+
) macrophages[15], clusters delineated by
high levels of CD8 subunit A (cd8a
+
) and CD8 subunit B (cd8b
+
) expression and nucleated red
blood cells. Keratin type II cytoskeletal 5 (krt5
+
) epithelial cells, von Willebrand factor (vwf
+
)
endothelial cells, fatty acid binding protein 7 (fabp7
+
)

ependymal cells[56], cycling cells

10
characterized by high marker of proliferation Ki-67 (mki67) expression, creatine kinase M-type
(ckm
+
)

muscle-related cells[8], premelanosome protein (pmel
+
) melanocytes, SRY-box
transcription factor 9 (sox9
+
) chondrocytes[13], and collagen type I alpha 1 chain (col1a1
+
)
fibroblastic connective tissue cell (FCTC) clusters were also identified through differential gene
expression analysis and mammalian ortholog identification.
When analyzed by regeneration stage, proportional contributions of each cell type
compared to the total cells in the sample (Fig. 1b) revealed a large expansion in the FCTCs
population at the blastema stage, similar to previously mentioned axolotl scRNAseq analysis[18].
This FCTC cluster was closely associated with the chondrocyte cell cluster, the skeletal precursors
for regenerating lizard tail. Proportional cell type contributions were validated via FISH using
cluster defining marker genes (Supplementary Figure 2), depicting a significant increase in FCTCs
14 DPA compared to 0 and 7 DPA. Given the expansion of FCTCs in the blastema stage and their
close clustering with chondrocytes, the FCTC cluster and chondrocyte cluster were isolated,
computationally integrated, and subclustered (Fig. 1c, d) to determine if distinct fibroblast
populations existed within the FCTC cluster and to reveal any possible gene signatures leading to
FCTC chondrogenic potential.
Pseudotime trajectory analysis, a computational method used to infer biological transitions
or cell lineage relationships based on scRNAseq gene expression profiles[57], was performed on
the FCTC/chondrocyte subcluster (Fig. 1e, f) using R package Monocle2[58–60] and revealed one
minor and two major branch points of potential cell fate trajectory change over the course of
regeneration. When analyzing by regeneration time point (Fig. 1g, h, Supplementary Figure 3),
earlier pseudotime cell populations corresponded mostly with blastema stage cell populations,
while later pseudotime branch points were dominated by regenerated homeostasis and original tail

11
cells, suggesting the blastema stage and early pseudotime represent a less terminally differentiated,
more plastic cell type, while regenerated homeostatic cells in late pseudotime may have a more
restricted/defined cell fate.
Further analysis of differentially expressed genes (DEGs) in the FCTC/chondrocyte
subcluster revealed high levels of osteopontin, also referred to as secreted phosphoprotein 1 (spp1),
expression (Fig. 1i, j), particularly in subcluster 1 of the FCTC/chondrocyte dataset, within the
blastema stage sample and early pseudotime. Spp1 was first described for its role in bone
mineralization and extracellular matrix deposition[61], but more recent work suggests spp1 can
act as a cytokine and play a role in injury response[62–65]. For example, spp1 has been implicated
in Wnt and Hedgehog (Hh) pathway signaling modulation[66,67] and may help critical cell
populations survive wound environments due to anti-apoptotic activities[68].
Sulfatase 1 (sulf1) expression (Fig. 1k, l) spanned blastema and regenerated time points, as
well as most of pseudotime, with expression ranging early, middle, and late pseudotime. As a
heparin sulfate 6-O-endosulfatase that selectively removes 6-O-sulfate groups from heparin sulfate
proteoglycans (HSPGs), sulf1 enzymatic activity modulates the binding and downstream signaling
of many HSPG receptors for heparin-binding growth factors and cytokines[69,70]. Endosulfatases
have been shown to be necessary for activating Wnt and BMP signaling during mammalian and
avian skeletalgenesis and to dampen FGF signaling[70–72], while sulf1 specifically has also been
shown to modulate Hh signaling by enhancing local sonic hedgehog (shh) concentrations and
availability[73].
Chondrocyte markers sox9 (Fig. 1m, n) and collagen type II alpha 1 chain (col2a1)[8] (Fig.
1o, p) were heavily focused in subcluster 2, in regenerated homeostatic cells, and were specifically
expressed in the bottom branch of late pseudotime. Thus, the right branch of the early pseudotime

12
trajectory was dominated by spp1
+
blastema stage fibroblasts and the bottom branch of late
pseudotime represented more differentiated sox9
+
regenerating chondrocytes and terminally
differentiated col2a1
+
cartilage in regenerated homeostasis. DEGs phospholipid transfer protein
(pltp) and spalt like transcription factor 1 (sall1) were also analyzed via pseudotime trajectory
analysis (Supplementary Figure 4) but did not reveal distinct expression patterns correlating
pseudotime with specific regeneration stages.
Taken together, pseudotime trajectory analysis suggested fibroblasts gained FCTC marker
gene expression over the course of regeneration, eventually leading to potential chondrogenic
capacity and chondrocyte cell fate. Many blastema FCTCs express spp1. Some, but not all, of
those fibroblasts may go on to express sulf1 as they continue along the tail regeneration process,
and later, can become sox9
+
chondrocytes and form col2a1
+
cartilage. This scRNAseq study
represents critical time course analysis of lizard tail regeneration, and through pseudotime
trajectory, proposes a potential relationship between FCTC marker gene expression and blastema
FCTC chondrogenesis, investigated further below.

Lizard tail blastemas are made up of FCTCs
Using single-cell data analysis, several differentially upregulated fibroblast genes were
identified within the FCTCs cluster, many with implications in other organisms for condensing
mesenchyme, cartilage formation and bone remodeling and deposition functions[11,61,74]. These
FCTC marker genes were stained for expression throughout tail regeneration, revealing changes
in fibroblast gene expression patterns in a spatiotemporal manner (Figure 2, Supplementary Figure
5). In uninjured original tails, collagen type III alpha 1 chain (co13a1
+
) homeostatic FCTCs lined
periosteum, perichondrium, epidermis, and other connective tissues (Fig. 2a-f), with many FCTCs

13
also expressing low levels of cadherin 11 (cdh11), (Supplementary Fig. 5a-e), as previously
reported[75]. By 7 DPA, several additional fibroblast genes activated compared to 0 DPA and
relocalized from terminal vertebrae to distal wound sites. These injury-state FCTCs exhibited
elevated spp1 (Fig. 2k), as well as col3a1 (Fig. 2g), cdh11, collagen type XII alpha 1 chain
(col12a1), midkine (mdk), secreted protein acidic and cysteine rich (sparc), and tenascin-like (tnl)
expression (Supplementary Fig. 5f-j). Sulf1 began to localize to regions adjacent to amputated
spinal cords (Fig. 2l), while phospholipid transfer protein (pltp), spalt like transcription factor 1
(sall1), and sox9 (Fig. 2h-j) exhibited little-to-no expression 7 DPA.
During blastema formation 14 DPA, FCTCs aggregated at distal tail tips and increased
expression of several marker genes. Extensive sparc expression was observed throughout
blastemas, including regenerating muscle bundles (Supplementary Fig. 5n), while col3a1, spp1,
col12a1, mdk, and tnl labeled all newly formed blastemal tissue, but with markedly lower
expression in regenerating muscle bundles (Fig. 2m, q, Supplementary Fig. 5l, m, o). Several
FCTC markers exhibited more localized expression patterns within tail blastemas. Sox9
expression, the conserved marker gene of chondrogenic potential and cartilage regeneration in
lizards[13], labeled pro-chondrogenic mesenchyme condensing around central regenerated spinal
cords and exhibited high medial expression to low lateral expression and proximal (high) to distal
(low) organizations (Fig. 2p). Condensing chondrogenic mesenchyme was also labeled by pltp,
sall1, sulf1, and cdh11 expression (Fig. 2n, o, r, Supplementary Fig. 5k). Sulf1 also labeled FCTC
populations at distal blastema tips, exhibiting medial to lateral and proximodistal organizations,
inverse to those of sox9 (Fig. 2r).
At 28 DPA, regenerated connective tissue maintained high expression of spp1, cdh11, mdk,
and tnl, but these markers were largely excluded from differentiated muscle and cartilage elements

14
(Fig. 2w, Supplementary Fig. 5p, r, t). Col12a1 and sparc were highly expressed in connective
tissues and regenerated cartilage, but specifically excluded from regenerated muscle bundles
(Supplementary Fig. 5q, s). Only col3a1 maintained high expression in FCTC populations in every
stage of regeneration from 0-28 DPA in connective tissues within epidermis, muscle bundles,
cartilage elements and interstitium (Fig. 2s). Sox9 expression specifically labeled cartilage tubes
and decreased proximodistally (Fig. 2v). Pltp and sall1 were most highly expressed medially,
surrounding cartilage tubes, and distally at tail tips, but were largely lost in other connective tissues
(Fig. 2t, u). Sulf1 expression was notably absent 28 DPA, with only minimal expression remaining
in cartilage tubes (Fig. 2x). Overall, regenerated tails 14 and 28 DPA were dominated by FCTC
populations despite their relatively small and restricted niches within original tails (0 DPA), while
several FCTC genes were turned on during the injury-state of tail regeneration 7 DPA.

Sulf1
+
blastema FCTCs stimulated by Hh form cartilage
ScRNAseq results described above indicated distinct cartilage and blastema FCTC
clusters, and previous studies from our lab have identified ependyma-contributed Hh signaling as
the critical signal for inducing blastema cartilage formation[7]. Pharmacological agents were used
to test the effects of Hh inhibition and activation on blastema cell chondrogenesis (Supplementary
Figure 6). Lizards were treated with the Hh inhibitor cyclopamine, Hh smoothened agonist (SAG),
or vehicle control for 28 days. Tails were then collected and analyzed by gross morphology
(Supplementary Fig. 6a-c) and histology/fluorescent in situ hybridization (FISH) for expression of
col2a1, a marker of mature cartilage differentiation, shh, the predominant Hh signal within
regenerated tails, and fabp7, an ependymal cell marker (Supplementary Fig. 6d-l).

15
Lizards treated with vehicle control developed typical regenerated tails with cylindrical
col2a1
+
cartilage tubes surrounding shh
+
fabp7
+
ependymal tubes (Supplementary Fig. 6a, d, g,
h). Lizards treated with cyclopamine regrew tails of normal length, but completely lacked cartilage
despite maintenance of shh expression by ependymal tubes (Supplementary Fig. 6b, e, i, j).
Conversely, treatment with SAG resulted in stunted, bulbous tails filled with abundant col2a1
+
ectopic cartilage regions in addition to endogenous cartilage tubes (Supplementary Fig. 6c, f, k, l).
Neither Hh inhibition nor activation effected shh expression by fabp7
+
ependymal cells
(Supplementary Fig. 6h, j, l), indicating that changes in blastema FCTC chondrogenesis resulted
directly from drug treatments. SAG-induced cartilage was not observed anywhere else in the lizard
and was specific to blastema-derived tail regions. These results suggested that Hh signaling is
necessary and sufficient for inducing chondrogenesis in blastema FCTCs and that a large portion
of blastema cells are capable of cartilage differentiation. Exogenous Hh signals from SAG
treatment extend pro-chondrogenic areas beyond regions that typically form cartilage in response
to endogenous signaling.
Next, the effects of Hh activators/inhibitors on lizard limb and tail FCTCs gene expression
and chondrogenic potential were compared. Lizard tails and limbs were collected 28 DPA from
animals treated with cyclopamine, SAG, or vehicle control and analyzed by histology/ISH for
col2a1, spp1, and GLI family zinc finger 1 (gli1) expression (Supplementary Figure 7). As
described above, control tails developed col2a1
+
cartilage tubes. Cartilage tube development was
inhibited by cyclopamine treatment and expanded by SAG treatment, resulting in extensive ectopic
cartilage formation (Supplementary Fig. 7a, g, m). Tail FCTCs maintained spp1 expression 28
DPA, and expression was unaffected by cyclopamine or SAG treatment (Supplementary Fig. 7b,
h, n).

16
In direct contrast to tail blastema cells, limb fibroblasts did not express col2a1 or undergo
chondrogenesis in any of the conditions tested (Supplementary Fig. 7d-f, j-l, p-r). Specifically,
ectopic cartilage did not form in SAG-treated groups (Supplementary Fig. 7p). Furthermore, limb
FCTC spp1 expression was not maintained 28 DPA and was not sensitive to Hh signaling
(Supplementary Fig. 7e, k, q). Gli1, a downstream reporter of the Hh signaling pathway and an
established readout of Hh pathway activation[76], was expressed natively in control tails
(Supplementary Fig. 7c), while expression was absent in control limbs (Supplementary Fig. 7f)
and in both limb and tail Hh inhibitor cyclopamine treatment samples (Supplementary Fig. 7i, l).
SAG-treated tail and limb both exhibited high levels of gli1 activation (Supplementary Fig. 7o, r),
validating SAG treatment as a Hh pathway activator in both tail and limb. These results indicated
that, unlike tail blastemal FCTCs, amputated limb fibroblasts lacked Hh-responsive chondrogenic
potential, despite evidence of sufficient Hh pathway activation with SAG treatment.
Single-cell sequencing results described above identified sulf1, pltp, sall1, and spp1 as
lizard tail FCTC blastema markers. Sulf1 is reported to be regulated by Hh stimulation in other
systems[69,73,77], and here, we tested the effects of Hh inhibition and activation on tail blastema
marker expression (Figure 3). Amputated lizard limbs, which do not naturally form blastemas,
were included in analyses to distinguish blastema-specific markers from nonspecific healing
responses[3,9,78,79] (Fig. 3m-x). Tail blastema and limb samples were collected 14 DPA from the
same lizards treated with cyclopamine, SAG, or vehicle control and analyzed by histology/ISH for
sulf1, pltp, sall1, and spp1 to provide context for any Hh signaling dependencies observed among
marker expression patterns.
Control tail blastemas expressed sulf1, spp1, pltp, and sall1 (Fig. 3a-d). Spp1 was expressed
at high levels throughout blastemas, while pltp and sall1 were expressed at relatively lower levels

17
(Fig. 3b-d). Sulf1 exhibited the most defined expression pattern, being localized in areas
surrounding ependymal tubes, especially apical blastemas and pre-cartilage tube condensations
(Fig. 3a). Cyclopamine treatment significantly reduced tail blastema sulf1 expression (Fig. 3e) but
did not affect other markers tested (Fig. 3f-h). Conversely, SAG treatment resulted in increased
and expanded sulf1
+
blastema areas (Fig. 3i), especially in dorsal and proximal blastema areas, but
did not affect spp1, pltp, or sall1 expression (Fig. 3j-l).
Amputated limb FCTCs expressed high levels of spp1 (Fig. 3n), but sulf1, pltp, and sall1
were absent from limbs under control conditions (Fig 3m, o, p). Expression of gene markers
assayed was not affected by either cyclopamine or SAG treatments in limbs (Fig. 3q-x), and, unlike
tail blastema cells, amputated limb FCTCs did not increase sulf1 expression in response to SAG
treatment (Fig. 3u). These results were confirmed quantitatively via real-time polymerase chain
reaction (RT-PCR) analysis of tail samples 14 DPA for sulf1, spp1, pltp and sall1 (Supplementary
Figure 8). Taken together, these results identified sulf1, pltp, and sall1 as specific blastema
markers. Sulf1 was the only blastema marker tested that was particularly responsive to Hh
stimulation and inhibition. Spp1 was further confirmed as a general marker of injury-state FCTCs
stimulated by wound healing.

Sulf1 marks blastema FCTCs with chondrogenic potential
Next, we assessed chondrogenic capacity of FCTCs from specific tail regeneration stages,
to determine which FCTCs were competent to form cartilage, regardless of local tail environmental
signaling in vivo, using a transplantation model previously established to trace cell fates during
lizard tail regeneration[80].

Cells collected from the parthenogenetic lizard Lepidodactylus
lugubris reconstitute regenerated structures following transplantation into amputated tail stumps

18
of lizards belonging to the same clonal population without the need for immunosuppressant drug
treatments[81], previously shown to negatively impact regeneration[46,82,83]

(Figure 4).
Fibroblasts were isolated from donor L. lugubris original tails, blastema tails 14 DPA, and
regenerated tails 28 DPA, and resulting isolated cell pools were enriched for FCTC populations
using physical and enzymatic cell digestion, as well as MACS
®
bead treatments (Supplementary
Figure 9). Each FCTC pool was labeled with DiI and injected, separately, into SAG-treated
recipient blastema tails 14 DPA. 14 days post-transplant (14 DPT, recipient lizards 28 DPA)
recipient tails were analyzed for Col2 via immunofluorescence staining (IF) (Fig. 4a). Neither
original nor regenerated tail fibroblasts incorporated into Col2
+
cartilage by 28 DPA (Fig. 4b-d, h-
k), while the majority of transplanted blastema fibroblasts co-stained DiI label and Col2
expression, incorporating into cartilage elements at a significantly higher rate than original and
regenerated tail fibroblasts (Fig. 4e-g, k). This suggested that blastema fibroblasts were uniquely
competent to form cartilage in response to Hh stimulation, compared to homeostatic original and
regenerated tail fibroblasts.
Previous work has indicated Hh signaling as regulating lizard blastema chondrogenesis[7],
and sulf1 is reported to be expressed in pre-condensing mesenchyme during
chondrogenesis[84,85]. Here, we tested co-localization of sulf1 with sox9, the transcription factor
regulating chondrogenesis, within lizard tail blastemas 14 DPA in response to treatment with
cyclopamine, SAG, and vehicle control. (Supplementary Figure 10). Control tail blastemas
exhibited proximodistal gradients of sulf1 and sox9 expression in FCTCs surrounding ependymal
tubes (Supplementary Fig. 10a, b). Sulf1 expression localized in distal apical blastema regions and
reduced proximally as it was replaced by sox9. Sox9 exhibited its strongest expression in proximal
skeletal elements adjacent to original tail vertebrae at amputation planes. Cyclopamine treatment

19
reduced both sulf1 and sox9 expression and interrupted proximodistal marker localizations
(Supplementary Fig. 10c, d). In SAG-treated tails, both sulf1
+
and sox9
+
areas expanded
peripherally into regions removed from ependymal tubes, but proximodistal expression
relationships were maintained (Supplementary Fig. 10e, f).
The above results suggested a relationship between Hh signaling, sulf1 expression, and
chondrogenesis. Here, we tested this relationship by comparing the abilities of sulf1
+
and sulf1
-

lizard fibroblasts to undergo chondrogenesis in vivo using the L. lugubris transplantation model
(Supplementary Figure 11). First, donor original (0 DPA) tail and limb FCTCs were pre-labeled
with the fluorescent dyes DiI and DiO, respectively. Labeled tail and limb FCTCs were mixed, and
co-transplanted into recipient lizard tails at the time of recipient lizard tail amputation (0 DPA).
Recipient lizards were treated with SAG, and tails were collected 14 and 28 DPT for integration
assessment (Supplementary Fig. 11a). FISH and histological analysis of 14 DPT samples showed
DiI
+
tail and DiO
+
limb-derived fibroblasts expressed sulf1 (Supplementary Fig. 11b-e, j).
Similarly, both DiI
+
and DiO
+
fibroblasts formed Col2
+
cartilage in 28 DPT samples assessed by
IF (Supplementary Fig. 11f-i, k). These results suggested that both tail and limb fibroblasts possess
the capacity for sulf1 expression and chondrogenesis when exposed to the blastema formation
process and signaling niche.
Finally, we compared the above results with those observed when exogenous tail blastema
and limb FCTCs were transplanted into recipient tails that had already formed blastemas.
Fibroblasts isolated from donor L. lugubris tail blastemas and limbs 14 DPA, pre-labeled with the
DiI and DiO, respectively, were co-transplanted into SAG-treated recipient lizard tail blastemas
(Figure 5). Tails were collected 1 and 14 DPT and analyzed as described above to compare

20
percentages of exogenous tail blastema and limb fibroblasts that expressed sulf1 via FISH or Col2
via IF (Fig. 5a).
In 1 DPT samples, DiI
+
tail blastema-derived fibroblasts colocalized with sulf1 expression,
while DiO
+
limb-derived fibroblasts did not (Fig. 5b-e, n). 14 DPT samples analyzed via IF for
Col2 expression revealed significantly higher percentages of tail blastema FCTCs forming Col2
+

cartilage than limb fibroblasts (Fig. 5f-o). Tail and limb fibroblasts were also transplanted
separately into vehicle control- or SAG-treated recipient blastemas as controls (Supplementary
Figure 12). Only tail fibroblasts stimulated by SAG co-expressed DiI and Col2 (Supplementary
Fig. 12d-f, m), while tail and limb FCTCs transplanted into vehicle control recipients and limb
fibroblasts transplanted into SAG-treated recipient blastemas did not express Col2 or form
cartilage (Supplementary Fig. 12a-c, g-m). Taken together, these results confirmed the abilities of
sulf1
+
blastema FCTCs, but not sulf1
-
limb FCTCs, to undergo chondrogenesis in response to Hh
stimulation.

Tail regrowth involves distinct localizations of phagocytes
Further single-cell sequencing analyses of lizard tail regeneration investigated
macrophages and other phagocytic cells, revealing heterogeneity and distinct cell populations
delineated by differential marker gene expression and nearest-neighbor clustering (Supplementary
Figure 13a-c). Ctsb
+
cathepsin K-negative (ctsk
-
) macrophages and ctsb
+
ctsk
+
osteoclasts clustered
with other immune cells, as expected (Supplementary Fig. 13a, b). However, a distinct ctsb
-
ctsk
+

population clustered with collagen type IV alpha 1 chain (col4a1
+
) pericytes (Supplementary Fig.
13a-d). Septoclast populations, phagocytic cells derived from a pericytic rather than myeloid
lineage, have previously been shown to regulate skeletal development and healing in

21
mammals[86], and we hypothesized that ctsb
-
ctsk
+
col4a1
+
cells represented lizard septoclast-like
phagocytic cells (herein, referred to as septoclasts).
Single-cell sequencing results were validated via histology/FISH in lizard tails and limbs
collected 7, 14, and 21 DPA. (Figure 6). Ctsb
+
ctsk
-
col4a1
-
macrophage levels peaked in tails at 7
DPA (Fig. 6a-c, s) before diminishing by 21 DPA (Fig. 6g-i, s). Ctsb
+
ctsk
+
col4a1
-
osteoclast
population numbers were highest in tails at 7 and 14 DPA before decreasing by 21 DPA (Fig. 6a-i,
s). Tail osteoclasts were exclusively associated with vertebrae, occupying classic crypts along
periosteal surfaces (Fig. 6a-i). Ctsb
-
ctsk
+
col4a1
+
septoclast levels peaked in tails during blastema
formation at 14 DPA (Fig. 6a-i, s) and were detected among sulf1
+
blastema fibroblast populations
(Fig. 6a-i). Additionally, tails collected 0, 1, 3, 7, and 14 DPA confirmed ctsb
+
macrophage and
osteoclast populations peaked at 7 DPA within the span of immune cell-active inflammatory stage
time points 1-7 DPA (Supplementary Figure 14). Unlike tail macrophage and osteoclasts, however,
elevated septoclast numbers in tails persisted beyond blastema stages and, at 21 DPA, occupied
sulf1
+
apical regions at regenerating tail tips (Fig. 6g-i). Taken together, these results suggested a
relationship between septoclasts and blastema cell state.
Limbs exhibited macrophage and osteoclast populations that followed similar
spatiotemporal trends to time-matched tail cell populations (Fig. 6). Limb macrophages were
associated with wound epidermis and, along with bone-associated osteoclasts, peaked prior to 14
DPA before diminishing further at 21 DPA (Fig. 6j-r, t). However, limbs did not exhibit identifiable
septoclasts at any time points tested and did not express sulf1 (Fig. 6j-r, t). Given the lack of Hh-
responsive chondrogenesis exhibited by amputated lizard limbs described above, these results
further supported the links among lizard septoclasts, blastema formation, sulf1 expression, Hh
sensitivity, and cartilage formation, which are investigated further below.

22

Blastema formation and chondrogenesis depend on phagocytes
We previously validated clodronate liposome treatments as effective methods for depleting
lizard phagocyte/macrophage populations and inhibiting blastema formation in A.
carolinensis[15]. Here, we tested the effect of clodronate liposome treatment on macrophage,
osteoclast, and septoclast population levels and fibroblast marker expression during lizard tail
blastema formation (Supplementary Figure 15). Lizards were pre-treated with clodronate or
vehicle control phosphate buffered saline (PBS) liposomes 72 and 48 hours prior to tail
amputation, and tails were collected at the blastema stage 14 DPA for analysis.
Histology revealed clodronate liposome treatment inhibited blastema formation compared
to controls (Supplementary Fig. 15a, b, f, g) and resulted in depletion of ctsb
+
ctsk
-
macrophages,
ctsb
+
ctsk
+
osteoclasts and ctsb
-
ctsk
+
col4a1
+
septoclasts (Supplementary Fig. 15c-e, h-j), as
expected. Clodronate-treated tails also lost spp1 and sulf1 expression in FCTCs (Supplementary
Fig. 15a, b, f, g). Control blastema revealed macrophages and osteoclasts localized to sulf1
-
areas
of the blastema, while septoclasts were only detected distal to sulf1
+
areas of the tail
(Supplementary Fig. 15c-e). Co-staining of spp1 and sulf1 at 7 and 14 DPA in untreated blastema
revealed spp1 expression at both 7 and 14 DPA, while large areas of sulf1
+
blastema cells co-
expressed spp1, confirming both markers are active in a subpopulation of blastema FCTC
(Supplementary Figure 16). Taken together, these results established a link between lizard
phagocytic lineages and FCTC marker gene acquisition.
Next, we tested the effects of clodronate liposome pre-treatment on lizard FCTC
responsiveness to Hh signaling in L. lugubris blastema fibroblast transplantation studies (Figure
7). This model was found to be particularly applicable for testing exogenous FCTC chondrogenic

23
potential in situ when endogenous conditions are not conducive to blastema/cartilage formation.
L. lugubris lizards were pre-treated with clodronate liposomes (validated in Supplementary Figure
17), or control PBS liposomes prior to amputation, and fibroblasts were isolated from tails 14 DPA.
Fibroblasts collected from PBS and clodronate liposome-treated lizards were pre-labeled with DiI
or DiO, respectively, before co-transplanting into a separate cohort of SAG-treated recipient lizard
blastemas (Fig. 7a).
Tails were collected 14 DPT and analyzed for contribution of DiO
+
and DiI
+
cells to
cartilage formation (Fig. 7b-j). Significantly higher levels of DiI
+
control tail FCTCs underwent
chondrogenesis, incorporating into Col2
+
areas of condensing cartilage, compared to DiO
+
clodronate-treated FCTCs, suggesting that blastema fibroblasts contributed to cartilage regions
while fibroblasts derived from clodronate-treated tails, lacking blastemas, did not (Fig. 7b-j).
Clodronate and PBS liposome-treated fibroblasts transplanted separately into SAG- or vehicle
control-treated recipient blastemas revealed similar results (Supplementary Figure 18), with only
PBS liposome-treated fibroblasts incorporating into Col2
+
cartilage (Supplementary Fig. 18d-f,
m), while clodronate liposome fibroblasts in SAG-treated recipients and PBS or clodronate
liposome-treated fibroblasts transplanted into vehicle control blastema did not express Col2
(Supplementary Fig. 18a-c, g-m). Taken together, these results established a dependency of lizard
blastema cell Hh-responsive chondrogenesis on pre-conditioning by phagocyte populations.

Phagocyte-conditioned media rescue blastema formation
We have previously established protocols for isolating and differentiating phagocyte
populations from multiple lizard tissues[15]. Given the evidence described above linking
septoclasts with pericytes, we hypothesized that pericyte-rich tail blood vessels represented

24
effective sources of septoclasts. Caudal blood vessels were isolated from lizard tails and subjected
to phagocyte isolation protocols. Lizard bone marrow were utilized as a source of macrophages,
as previously validated[15]. Phagocytes differentiated from caudal blood vessels and bone marrow
cells were analyzed by phagocytosis assays, flow cytometry and by IF/FISH for Ctsk, ctsb, integrin
subunit alpha M (itgam/cd11b), and col4a1 expression (Supplementary Figure 19).
Both caudal vessel- and bone marrow-derived cells exhibited similarly high levels of
phagocytosis (Supplementary Fig. 19a-c, g) and expressed itgam/cd11b (Supplementary Fig. 19d,
h), validating their identities as phagocytes. However, blood vessel and bone marrow phagocytes
exhibited differential marker expressions that mirrored differences observed in vivo
(Supplementary Fig. 19d-f, h-j); bone marrow phagocytes expressed macrophage marker ctsb
(Supplementary Fig. 19d-f), while caudal vessel phagocytes expressed septoclast markers Ctsk
and col4a1 (Supplementary Fig. 19h-j). Flow cytometry confirmed the purity of respective
macrophage and septoclast populations, with an average of 94.5% of cells within the bone marrow
phagocyte pools expressing Ctsb
+
Ctsk
-
macrophage signatures and more than 98% of caudal
vessel phagocyte cells expressed Ctsb
-
Ctsk
+
septoclast signatures (Supplementary Fig. 19k-p).
Taken together, these results validated ctsb
-
ctsk
+
col4a1
+
caudal blood vessel-derived phagocyte
cultures as septoclasts and ctsb
+
ctsk
-
col4a1
-
bone marrow-derived phagocyte cultures as
macrophages.
Next, we tested the abilities of septoclast populations to rescue the lizard tail blastema cell
chondrogenic-potential state, defined by Hh-responsive sulf1 expression, following clodronate
liposome treatment (Figure 8, Supplementary Figure 20). Macrophage-conditioned media (M-
CM) and septoclast-conditioned media (S-CM) were collected from bone marrow- and caudal
vessel-derived phagocytes, respectively, and concentrated. Alginate beads soaked in concentrated

25
M-CM and/or S-CM were implanted into amputated tails of lizards co-treated with clodronate
liposomes and either SAG (Fig, 8a) or vehicle control (Supplementary Fig. 20a). Tails were
collected 14 days post-implantation and analyzed by histology/ISH/FISH for sulf1 and spp1
expression and phagocytic cell markers (Fig. 8b-q, Supplementary Fig. 20b-q).
Spp1 signal was detected in M-CM-treated tails regardless of SAG/vehicle control
treatment (Fig. 8g, o, Supplementary Fig. 20g, o), but was absent in S-CM-only treated conditions
(Fig. 8k, Supplementary Fig. 20k). Sulf1 expression was only detected in tails co-treated with SAG
and both M-CM and S-CM (Fig. 8n, Supplementary Fig. 20n). Spp1
+
and sulf1
+
tail regions
concentrated around implanted beads in M-CM and S-CM-treated samples (Fig. 8g, n, o).
Endogenous ctsb
+
ctsk
-
col4a1
-
macrophages, ctsb
+
ctsk
+
col4a1
-
osteoclasts, and ctsb
-
ctsk
+

col4a1
+
septoclasts were not detected in any of the conditions tested, as expected due to clodronate
liposome treatment (Fig. 8, Supplementary Fig. 20).
Unconditioned culture media-soaked beads were utilized as a control and implanted into
clodronate liposome-treated tails (Supplementary Figure 21), revealing no changes in spp1 or sulf1
expression in vehicle control or SAG-treated recipient tails (Supplementary Fig. 21a-d), signifying
phagocyte conditioned media treatments were responsible for changes in gene expression rather
than bead implantation or culture media alone. Taken together, these results suggested that
biomolecules secreted by lizard septoclasts were necessary for rescuing hallmarks of blastema
formation including sulf1 expression in response to Hh stimulation even when endogenous
septoclast populations had been depleted. While macrophage-secreted factors were sufficient for
inducing FCTC spp1 expression, sulf1 was only detected in tails treated with both macrophage-
and septoclast-conditioned media, indicating a sequential addition of FCTC marker gene
expression during blastema establishment.

26

Septoclast-CM induces cartilage formation in amputated limbs
Above comparisons of amputated lizard tail and limb healing suggested a link between
FCTC chondrogenesis and septoclast populations, and, here, the effects of S-CM on lizard limb
sulf1, spp1, and sox9 expression were tested (Figure 9, Supplementary Figure 22). Beads soaked
in S-CM and/or M-CM were implanted in lizard limbs 7 DPA. After 21 days of treatment with
SAG (Fig. 9) or vehicle control (Supplementary Fig. 22), limbs were collected and analyzed via
histology/ISH for FCTC and chondrogenesis marker expression and via FISH for phagocyte
markers (Fig. 9a, Supplementary Fig. 22a).
FCTCs in control limbs and limbs implanted with M-CM beads without S-CM did not
express sulf1, sox9, or spp1 regardless of SAG/vehicle control treatments (Fig. 9b-d, g-i,
Supplementary Fig. 22b-d, g-i). Implanted S-CM beads, with and without M-CM, induced FCTC
sulf1 and sox9 expression around bead implantation sites, but only in response to co-treatment with
SAG (Fig. 9l, m, q, r, Supplementary Fig. 22l, m, q, r). S-CM beads, again, regardless of M-CM
addition, induced spp1 expression in limbs of both SAG- and vehicle control-treated lizards (Fig.
9n, s, Supplementary Fig. 22n, s). Endogenous macrophages and osteoclasts, but not septoclasts,
were detected in all conditions tested and levels were unaffected by drug or bead treatment
regardless of conditioned media type (Fig. 9, Supplementary Fig. 22).
Unconditioned media treatment did not induce gene expression changes or chondrogenesis
in vehicle control or SAG-treated recipient limbs (Supplementary Fig. 21e-j). These results
suggested that exogenous septoclast-derived signals were necessary and sufficient for
supplementing the naturally septoclast-deficient amputated limb environment, introducing Hh-
responsive chondrogenesis to amputated lizard limbs. Lizard septoclast cell factors also

27
maintained spp1 expression in lizard limbs until at least 28 DPA. (Fig. 9n, s, Supplementary Fig.
22n, s). Since loss of spp1 expression by lizard limb FCTCs 28 DPA coincides with scar formation
by 28 DPA (Supplementary Fig. 7k), these results suggest a role for lizard septoclast populations
in the inhibition of fibrosis.
In summary, the results described above suggest the following mechanisms of sequential
fibroblast marker gene acquisition during lizard tail blastemal formation (Figure 10). Col3a1
+

resting fibroblasts in both tail and limb respond to amputation injury with expression of spp1,
along with other injury-state FCTC marker genes such as col12a1 and mdk. Injury-state FCTCs
migrate to amputation sites following infiltration of macrophage populations and signaling from
macrophage-secreted factors. Lizard tails, but not limbs, exhibit septoclast cell populations
following amputation injuries that induce increased FCTC Hh sensitivity. FCTCs exposed to
septoclast-secreted factors maintain spp1 and express sulf1 and sox9 following stimulation by shh,
produced by ependymal cells. This spatial patterning results in cartilage forming around blastema
ependymal tubes. Without septoclasts, amputated limb FCTCs do not maintain spp1 expression
and remain unresponsive to Hh signaling. Limb FCTCs do not express sulf1 or undergo
chondrogenesis, even when treated with exogenous Hh signals, ultimately forming scars instead
of cartilage.

DISCUSSION
As reptiles, lizards occupy a unique, intermediate position between amphibians and
mammals that is reflected in their regenerative biology, and this study identifies potential cellular
and molecular mechanisms underlying several of these distinctions. Amphibian urodeles exhibit
the most complete and drastic regenerative capabilities among tetrapods, with most species

28
retaining the ability to regrow near perfect copies of both limbs and tails following amputation[87–
89]. Conversely, lizards are the only known amniotes and the closest relatives of mammals capable
of multi-tissue, blastema-based appendage regeneration as adults. Some lizard species can regrow
amputated tails, but never limbs, and regenerated lizard tails are referred to as “imperfect
regenerates” due, in part, to a bias for forming cartilage over osseous skeletal tissues[3–5,7,15,38–
40]. The goal of this study was to determine the cell types and pathways involved in lizard blastema
formation and subsequent cartilage differentiation.
This study leveraged the power of single-cell sequencing methodologies and pseudotime
trajectory analysis to perform a comprehensive molecular interrogation into the heterogeneity of
lizard tail blastema cell populations. Our results, identifying FCTCs as the primary contributors to
lizard blastemas and regenerated tail cartilage, align with classical and modern single-cell studies
analyzing appendage regeneration in salamanders[18–21,28,29,90]. However, our lizard results
suggested a sequential addition of FCTC markers that diverge from the de-differentiation processes
reported in amphibian studies. Specifically, single-cell and ISH results confirmed that col3a1
+
fibroblasts increase expression of spp1, mdk, tnl, sparc, and col12a1 upon amputation injury,
regardless of ultimate regenerate outcome. Only FCTCs that subsequently contribute to tail
blastema formation add expression of sulf1, pltp, and sall1. Despite computational limitations of
pseudotime trajectory analysis without additional cell lineage information[91], the suggestive
pseudotime model of sequential addition of FCTC marker expression was tested experimentally
and supported with fibroblast transplantation studies.
As previously mentioned, sulf1 specifically marks blastema cells capable of entering the
cartilage differentiation and formation program. This hierarchical addition of mature connective
tissue markers throughout the injury, blastema, and chondrogenic processes is distinct from

29
salamander blastema formation, wherein FCTCs revert to embryonic mesenchymal states that are
transcriptionally distinct from resting populations, utilizing genes previously activated in tail
embryogenesis[18,92]. Previous studies have also identified structural differences in urodele and
lizard blastema cells that may reflect differences in de-differentiation and cell states, which could
influence plasticity during regeneration[93].
Furthermore, our results suggest that lizard tail regrowth is distinguished from amphibian
appendage regeneration by the retention of injury markers in mature regenerates. While blastema
cells undergoing chondrogenesis eventually lose injury markers spp1, mdk, tnl, sparc, and col12a1,
these markers are retained in non-cartilage connective tissue in mature regenerates. Conversely,
amphibian blastema FCTCs are reported to revert to cell states nearly transcriptionally identical to
uninjured conditions following differentiation into replacement connective tissues. These
differences between lizard and amphibian blastema FCTC populations may have repercussions for
the regenerative outcomes and fidelities of blastema-derived skeleton. Direct unbiased comparison
of regenerating lizard and axolotl tail scRNAseq datasets could provide more comprehensive
distinctions between respective blastema fibroblast transcriptional profiles and identify additional
differential gene expression changes between the two species’ cell populations.
Differences between lizard and salamander blastema cell states may account for the
inability of lizard blastema FCTCs to differentiate into bone. There is precedence for such a
hypothesis, as we have reported on similar potency deficiencies in lizard versus salamander neural
progenitor cells (NPCs)[22]. Adult lizard NPCs are unable to differentiate into roof plate identities
and undergo neurogenesis, resulting in a lack of dorsoventral patterning and new neurons in
regenerated lizard tails. Future work will be aimed at determining whether similar limitations in

30
lizard blastema FCTC differentiation capacities underlie the lack of osteogenesis in regenerated
lizard tails.
Lizards are one of the only adult vertebrates that combine regenerative appendages (i.e.,
tails), and non-regenerative appendages (i.e., limbs) in the same animal, affording the lizard model
with unique opportunities for study. For example, comparing tail blastema versus amputated limb
wound healing, similar to previous studies[94–96], allowed for the identification of blastema-
specific markers by eliminating limb transcripts associated with general healing mechanisms.
Here, we were able to leverage this strategy to classify several fibroblast injury markers, such as
spp1, mdk, col12a1, etc., as general markers of amputation wound healing. Conversely, we
identified a subset of injury markers, including sulf1, pltp, and sall1, as specific for blastema
formation.
Sulf1 was found to be particularly sensitive to Hh signaling and associated with blastema
fibroblasts possessing chondrogenic potential. However, this Hh responsiveness and chondrogenic
capacity appears to be highly specific for regenerated tissues derived from blastemal cells. FCTCs
in non-injured lizards; non-blastema FCTCs in lizards with amputated tails; FCTCs involved in
the healing of other, non-tail injuries such as skin biopsies and limb amputations; tail stump FCTCs
in clodronate treated lizards: None of these populations express sulf1 or undergo chondrogenesis
following stimulation with SAG. Taken together, these results show that, within adult lizards, only
blastema FCTCs respond to Hh stimulation with sulf1 expression and chondrogenesis.
Using the parthenogenetic lizard L. lugubris as a platform for cell transplantation
experiments, we took advantage of the differences in sulf1 expression between tail blastema and
limb FCTCs to specifically demonstrate the abilities of sulf1
+
, but not sulf1
-
, fibroblasts to undergo
Hh-responsive chondrogenesis in vivo. Furthermore, sulf1
-
limb FCTCs transplanted into tail

31
blastemas did not form cartilage in response to Hh stimulation despite the presence of endogenous
tail FCTC sulf1 expression, suggesting that sulf1 transcription is indicative of larger cell state
changes in FCTCs affecting Hh responsiveness and chondrogenesis. Indeed, exogenous sulfatase
produced by sulf1
+
-transplanted FCTCs failed to stimulate chondrogenesis in limb fibroblasts,
suggesting that sulf1 alone is not sufficient for cartilage formation in adult lizard fibroblasts, and
that concurrent epigenetic reprogramming may be required to transition adult fibroblasts to Hh-
responsive cell states.
Given the publication record showing sulf1 alters local signaling environments by
remodeling heparin sulfate proteoglycans and growth factor interactions[69–73], these results may
indicate sulf1 as a critical regulator of blastema formation that, through a positive feedback
scenario, modulates its own Hh-regulated transcription and transforms the blastema signaling
environment through varied effects on other critical signaling cascades. Additionally, as displayed
in pseudotime trajectory analysis, not all sulf1
+
fibroblasts activate chondrogenic programming in
the regenerating tail. Some sulf1-expressing FCTCs, particularly those distal to Hh signaling
sources, could be playing a role in regrowth and differentiation of other regenerating tissues via
signal/pathway modulation. Future work will be aimed at determining the specific roles of sulf1 in
modulating Hh, Wnt, BMP, and FGF signaling and resultant effects on blastema cell derivation
and behavior.
The divergent regenerative potentials of lizard tails and limbs within the same model
organism also facilitate identification and testing of pro-regenerative tail-specific molecules and
cells to enhance blastema formation in naturally non-regenerative limbs. Here, comparisons of
phagocyte populations between lizard tails and limbs lead to the observations that only tail
blastemas exhibited pro-regenerative septoclast populations, and that treatment with septoclast-

32
secreted factors enhanced sulf1 expression and cartilage formation in amputated limbs. Thus, this
study has led to the intriguing question: Why does the amputated lizard tail, but not limb, wound
healing environment support septoclast differentiation, survival, and/or persistence? Previous
reports in zebrafish identified vascularized hypertrophic regions of bone growth plate as sources
of septoclast-like cell populations[97]. Interestingly, adult lizard tail vertebrae, but not limb bones,
exhibit prominent growth plates associated with hypertrophic cartilaginous intervertebral
pads[10]. Perhaps blastema septoclasts originate from these tail-specific structures. Future work
will aim to identify the origins of blastema septoclasts and if other mechanisms account for
phagocyte population differences between amputated lizard tails and limbs.
Prior investigations into blastema formation and immune cell regulation of wound
environments have focused on cytokine stimulation of intracellular signaling cascades in resident
FCTCs[15,42,98,99]. However, we have focused on functional changes to FCTCs following
exposure to septoclasts and found that lizard blastema FCTCs are uniquely responsive to Hh
signaling. Another question considers how septoclasts alter lizard FCTC Hh-responsiveness.
Canonical Hh signaling is highly conserved across the animal kingdom and targets activation of
the Gli family of transcription factors[100]. Activated Gli transcription factors bind accessible Hh
response elements (HHREs) within promoters/enhancers containing the recognition sequence
GACCACCCA, resulting in expression of corresponding genes[101]. Many genes, including sulf1
and sox9, contain HHREs within their promoters/enhancers[77,102], but epigenetic regulation via
DNA methylation, histone binding, and other chromatin state changes can restrict accessibility to
Gli binding[103]. Future work will investigate possible roles of epigenetic reprogramming in
supporting septoclast-induced changes in FCTC Hh signaling sensitivities and responses.

33
Our studies demonstrated that lizard limbs, which do not naturally form blastemas, treated
with septoclast-secreted factors formed cartilage in response to Hh stimulation. While previous
studies have used other growth factors and treatments to produce cell proliferation and cartilage
development within amputated lizard limbs[104], our results are distinguished by several
important points. For example, treatment with FGF beads is reported to increase cartilage callus
formation along periosteum of amputated limb long bones. However, we have previously shown
that callus cartilage originates from periosteum of long bones[7], not from blastema fibroblasts.
Periosteum-derived calluses are also distinguished from blastema fibroblast-derived
cartilage in that callus cartilage undergoes hypertrophy and endochondral ossification. Blastema
FCTC-derived cartilage, as well as FCTC-derived cartilage formed in limb amputation
experiments co-treated with septoclast-conditioned media and SAG, do not undergo hypertrophy
or ossification. Taken together, these results suggest that lizard limbs do contain FCTC populations
with the potential to form blastemas and cartilage, but limbs lack the necessary environmental
signals required to enhance Hh-responsive FCTC chondrogenic potential. This study has
highlighted septoclast-like phagocyte populations as a critical source of signals regulating FCTC
blastema derivation. Single-cell subclustering and pseudotime trajectory analysis of immune and
phagocytic cells over the course of regeneration may provide interesting insight to evolving
transcriptional profiles and signaling roles of phagocytes in tail regrowth.
In summary, lizards represent an underused, but powerful model for studying the biology
of blastema formation and regeneration. While models of mammalian blastema-based regeneration
exist, such as rodent digit tip, the periosteal fibroblasts of adult mammalian blastemas exhibit very
limited differentiation potentials and can only form bone[32–34]. Lizards are the only known
amniotes, and closest relatives to mammals, that retain the regenerative abilities of amphibian

34
salamanders, forming blastema rich with fibroblasts possessing multi-lineage potential, including
cartilage, adipose, muscle tissues, etc. This study revealed that the unique evolutionary position
occupied by lizards affects their blastema cell identity, which takes the form of transcriptionally
distinct adult FCTCs rather than re-created embryonic populations. These cells demonstrate
unique, embryonic-like responses to Hh signaling that functionally distinguish lizard blastema
cells from other adult fibroblast populations. Thus, this study highlights interesting ways that a
fully developed, adult amniote can build on non-specific wound healing responses to create a
blastema, inhibit scar formation and promote appendage regeneration.

MATERIALS AND METHODS
Additional materials and methods can be found in Supplementary Methods. All
experiments complied with relevant ethical regulations for animal testing and research.

Lizard husbandry and species selection
Green anole lizards (Anolis carolinensis) were housed on a 12-hour light/12-hour dark
schedule with 50W spot basking heat lamps and UVB lamps during light hours. Anoles were
maintained at 65% humidity, at 24-26°C during light hours and 18.5-21°C during dark hours in
metal mesh cages. Cages were misted with water 5 times per week, and lizards were fed a diet of
an excess of ½-inch crickets dusted in calcium supplement 3 times per week. Male and female
anoles, ages 9-12 months old, were tested equally in all experiments.
Cell transplantation experiments were carried out using mourning geckos (Lepidodactylus
lugubris). This all-female lizard species is parthenogenic and reproduces asexually, yielding
clonally identical offspring[81]. Cells and tissues can be transplanted between colony members in

35
absence of immunosuppressants and anti-rejection therapeutics[22], which have been shown to
impact tail regeneration[46,82,83]. Mourning geckos were maintained at 24-26°C during light
hours and 18.5-21°C during dark hours in plastic cages, with 65% humidity, water misting 3 times
per week, and were fed a diet of fruit meal replacement powder 3 times per week. All mourning
geckos utilitzed in experiments were ages 9-12 months old. Husbandry and experimental use of
lizards was conducted per guidelines of the Institutional Animal Care and Use Committees at the
University of Pittsburgh (protocols 15114947, 16128889, and 18011476) and the University of
Southern California (protocol 20992).

Lizard amputations and staging
Lizard tails were anesthetized by exposing tails to a spray of ethyl chloride for 10 seconds
and amputated with a sterile scalpel blade to begin regeneration. Tail samples were collected in
Hank’s balanced salt solution (HBSS) supplemented with 100 units/mL penicillin and 100 µg/mL
streptomycin (HBSS with P/S). Samples were collected at 0, 1, 3, 7, 14, 15, 21, and 28 days after
initial amputation or days post-amputation (DPA) for histology or cell dissociation.
Although lizard tail regeneration follows a reliable pattern, inherent variability in tail
growth and regeneration rates between individual, field-collected lizards can lead to inconsistent
timelines for regeneration[14]. To ensure consistency among sample groups, in addition to tracking
sample DPA, tails were assessed for standardized morphological and phenotypical characteristics
for each regeneration stage[12]. Inflammatory stage tails ranged from the closing of the wound
epidermis to scab accumulation, blastema stage tails ranged from the loss of the amputation site
scab to tail cone shape formation, and homeostatic regeneration stage began after tail cone
formation through elongation and full regrowth. Original tail samples were isolated during initial

36
amputations and were consistently 0 DPA. 1, 3, and 7 DPA tails were classified as inflammatory
stage, and 14 and 21 DPA tails were classified as blastema stage samples for single cell RNA-
sequencing (scRNAseq) analysis.
Phagocytic macrophages and osteoclasts populations peaked at 7 DPA (Supplementary Fig.
14) and thus, were utilized as the inflammatory stage time point throughout the manuscript. 28
DPA samples were consistently utilized as regenerated homeostasis stage tails. Despite continued
tail growth and elongation after 28 DPA[38], this time point represents the earliest reliable point
at which terminally differentiated cartilage and regenerated muscle, blood vessels, peripheral
nerves, spinal cord, and mature connective tissues can be identified in A. carolinensis[5].

Histology and imaging
Lizard tail and limb samples were fixed overnight in 10% neutral-buffered formalin (NBF)
and then decalcified for 1 week in 14-20% ethylenediaminetetraacetic acid (EDTA) solution in
PBS, pH 7.2. Samples were then subjected to a sucrose gradient before snap freezing in Optimal
Cutting Temperature Compound (OCT) with 2-methylbutane and dry ice. Cryosamples were
sectioned at 16 µm via Leica CM1860 cryostat. All images of sagittal sections are presented in
figures with dorsal tail toward the top, ventral toward the bottom, distal toward the right, and
proximal toward the left, unless otherwise noted.
Processed samples were imaged with Keyence BZ-X810 Microscope with 2X, 10X, and
40X Nikon CFI Plan Apochromat Lambda D objective lenses. BZX DAPI, GFP, TRITC and Cy5
filter cubes (Keyence) were utilized for corresponding fluorescence staining. Z-stacks and stitched
images were processed using BZ-X800 Analyzer software (Keyence, v1.1.1.8), according to

37
manufacturer’s instructions. Adobe Photoshop 2021 (v22.5.3.561) and Illustrator 2022 (v26.0.1)
were used for preparing images and figures for publication.

Drug treatments
For Hedgehog pathway signaling modulation, lizards were weighed and treated with
cyclopamine (50 µg/g), or smoothened agonist (SAG, 40 µg/g) dosed per gram weight of the
animal and administered via intraperitoneal (IP) injections every 24 hours. Control animals were
treated with phosphate-buffered saline (PBS) in place of drug treatments.
For phagocyte depletion, lizards were weighed and received IP injections of L-α-
phosphatidylcholine/cholesterol liposomes containing clodronate (0.125 mg/g animal weight) 48
and 24 hours prior to amputation, dosed per gram weight of the animal. Control animals were
treated with liposomes containing PBS instead of clodronate.

Single-cell RNA sequencing cell dissociation
Three tail samples per time point (0, 1, 3, 7, 14, 21 and 28 DPA) were cut to 3-5 mm pieces
in length and each piece was cut into 1/8ths. Tail pieces were added to gentleMACS
™
C tubes
(Miltenyi Biotec, PN: 130-093-237) containing 2.5 mL Dulbecco’s modified Eagle media
(DMEM), 100 µL proprietary Enzyme D, 50 µL Enzyme R and 12.5 µL Enzyme A from Multi
Tissue Dissociation Kit 1 (Miltenyi Biotec, PN: 130-110-201). Tubes were inverted and placed
onto gentleMACS
™
OctoDissociator with sleeve (Miltenyi Biotec, PN: 130-096-427) and a
fibroblast dissociation protocol was run for 1 hour. Enzymatic activity was inactivated with
DMEM supplemented with 10% fetal bovine serum (FBS). Cells were gently resuspended via
pipetting and run through MACS
®
70 µm SmartStrainer (Miltenyi Biotec, PN: 130-098-462),

38
followed by filtration via Scienceware FlowMi
®
40 µM Cell Strainers for p1000 pipettes (Sigma
Aldrich, PN: H13680-0040). Cells were pelleted and washed with DMEM with 10% FBS. Cells
were resuspended in HBSS with 0.04% bovine serum albumin (BSA) prior to library preparation.

Single-cell RNA sequencing library preparation and next-generation sequencing
Isolated cells were counted on a hemocytometer and prepared using the 10x Genomics
Chromium Single-Cell Gene Expression kit (V2, PN: 120267) according to manufacturer’s
recommendations. Cells were encapsulated into droplets via gel bead-in emulsion (GEM) method
for barcoding using the 10x Genomics Chromium controller (PN: 1000202). GEMs were incubated
for cDNA synthesis, followed by amplification and library construction, according to
manufacturer’s instructions. Pooled libraries were sequenced on the MiSeq platform (Illumina).
Single-cell libraries were run with MiSeq Reagent Kit v3, 150 cycles (Illumina, PN: MS-102-
3001) and paired-end sequenced (2 x 150 base reads) at the USC Molecular Genomics Core.
10,000 cells per sample were sequenced to an estimated 50,000 reads per cell. Per-sample BCL
file outputs were converted to FASTQ files using the Cell Ranger mkfastq pipeline with the single-
cell RNA sequencing analysis software Cell Ranger[53] (v3.1.2, 10x Genomics).

Single-cell RNA sequencing data analysis
Green anole (A. carolinensis) genome FASTA and GTF files (Ensembl, v2.105) were used
to generate a reference genome for indexing by Cell Ranger mkref function (v3.1.2, 10x
Genomics). Sample read FASTQ files were aligned to the generated reference genome and counted
with Cell Ranger count pipeline to generate gene-barcode expression matrices. For all scRNAseq
sample datasets, Seurat[54] (v4.1.1) was used to perform standard quality control/pre-processing,

39
including normalization of libraries and removal of cells with greater than 5% mitochondrial
gene expression. To integrate the samples, RunHarmony() from R package Harmony[55] (v1.0)
was used to iteratively correct PCA embeddings.
The filtered, normalized, and integrated scRNAseq data from original tail (0 DPA samples),
inflammatory (1, 3, and 7 DPA samples), blastema (14 and 21 DPA samples), and regeneration
stage (28 DPA) tails were used for unsupervised clustering using FindClusters (resolution = 0.3),
then identification and terming metaclusters using Seurat. To investigate regeneration-related
metaclusters, we used multiple methodologies, including dimensional reduction and trajectories.
The first 20 dimensions from Harmony embedding were used for UMAP plots (min.dist = 0.6). R
package Monocle2[58–60] was used to build single-cell trajectories with which pseudotime was
introduced for analysis of fibroblastic connective tissue cell and chondrocyte clusters.

In situ hybridization
Chromogenic in situ hybridization (ISH) was accomplished using the RNAscope
™
2.5 HD
Detection Kit RED (Advanced Cell Diagnostics, PN: 322350) and custom proprietary ISH probes
(Advanced Cell Diagnostics, Supplementary Table 2). Samples were baked for 1-2 hours at 60°C,
rinsed in PBS, and post-fixed with 10% NBF at 4°C for 15 minutes. Slides were then dehydrated
in an ethanol gradient and treated with kit hydrogen peroxide solution for 10 minutes. Slides were
rinsed in distilled water and samples were outlined with ImmEdge
®
hydrophobic pen (Vector
Laboratories, PN: H-4000).
Slides were then incubated in RNAscope
™
protease III solution (Advanced Cell
Diagnostics, PN: 322337) at 40°C for 30 minutes and hybridized with custom ISH probes for 2
hours at 40°C. ISH signal was then amplified over 6 amplification steps with kit amplification

40
reagents, according to manufacturer’s instructions. Signal was detected with 1:50 kit Fast RED-A:
Fast RED-B solution for 10 minutes at room temperature. Sections were then counterstained with
50% Gill’s Hematoxylin I (StatLab, PN: HXGHE1LT) for 2.5 minutes and 0.02% ammonium
hydroxide for 1 minute at room temperature. Slides were washed with distilled water and then
dipped in xylene immediately before mounting in EcoMount mounting media (Biocare, PN:
EM897L) and a glass coverslip was placed. Slides were cured overnight at room temperature and
stored at room temperature before imaging.
Fluorescent ISH (FISH) was accomplished using the RNAscope
™
Multiplex Fluorescent
Reagent Kit v2 (Advanced Cell Diagnostics, PN: 323100) and custom proprietary ISH probes
(Advanced Cell Diagnostics, Supplementary Table 2). Samples were baked for 1-2 hours at 60°C,
rinsed in PBS, and post-fixed with 10% NBF at 4°C for 15 minutes. Slides were then dehydrated
in an ethanol gradient and treated with kit hydrogen peroxide solution for 10 minutes. Slides were
rinsed in distilled water and samples were outlined with ImmEdge
®
hydrophobic barrier pen
(Vector Laboratories, PN: H-4000). Slides were then incubated in RNAscope
™
protease III
solution (Advanced Cell Diagnostics, PN: 322337) at 40°C for 30 minutes and hybridized with up
to three custom ISH probes for 2 hours at 40°C. ISH signal was then amplified over three
amplification steps with kit amplification reagents, according to manufacturer’s instructions.
Kit HRP-C1, C2 or C3 solution, corresponding to channel (C) number 1, 2, or 3 of each
ISH probe, was added to slides and incubated at 40°C for 15 minutes. Signal was detected with
1:1500 Opal
™
520, 570 or 690 Reagent Packs for GFP, TRITC or Cy5 fluorescence, respectively
(Akoya Biosciences, PNs: FP1487001KT, FP1488001KT, FP1497001KT), diluted in RNAscope
™

kit TSA dilution buffer, incubated for 30 minutes at 40°C. HRP signal was blocked with kit HRP
blocker for 15 minutes at 40°C. For multiplexed samples, HRP-C# solution, fluorophore solution

41
and HRP blocker steps were repeated with respective probe channel numbers and fluorophores,
according to manufacturer’s instructions. Sections were then counterstained with kit DAPI for 30
seconds at room temperature and immediately mounted in ProLong
™
Gold Antifade Mountant
(ThermoFisher Scientific, PN: P36930), then a glass coverslip was placed. Slides were cured
overnight at room temperature in the dark, and were then sealed with clear nail polish, and stored
protected from light at 4°C before imaging. Positive FISH areas were quantified using Fiji (Image
J, NIH v2.9.0,), described in detail in Supplementary Methods.

Immunofluorescence staining
Lizard tissue samples were analyzed by Col2 immunofluorescence (IF) staining (primary
antibody: Abcam ab34712, dilution 1:1000) and by Ctsk IF (primary antibody: Abcam ab19027,
dilution 1:200) as previously described[7]. Detailed IF protocols and quantification methodology
are available in Supplementary Methods.

Lizard fibroblast isolation
Lizard (L. lugubris) tail and limb tissues were washed three times in 10% povidone-iodine
solution and washed once in HBSS supplemented with 100 units/mL penicillin, 100 µg/mL
streptomycin, and 250 ng/mL fungizone antimycotic. Washed tissues were incubated in 0.1%
EDTA in HBSS for 45 minutes at room temperature with agitation, and scales/epidermis were
peeled from each tissue piece with forceps and discarded. Prepared tissues were then washed
extensively in HBSS, minced, and digested in 1 mg/mL trypsin and 1 mg/mL collagenase II for 1
hour at 37°C. Immune, muscle-related, and endothelial cells were depleted by passing cell
suspensions through the following MACS
®
(Miltenyi Biotec) magnetic beads: CD144 (VE-

42
Cadherin) MicroBeads (PN: 130-097-857), Anti-Integrin α-7 MicroBeads (PN: 130-104-26),
CD45 MicroBeads (PN: 130-052-301), CD326 (EpCAM) MicroBeads (PN: 130-105-958),
according to the manufacturer’s instructions. Cell/bead suspensions were loaded onto LD columns
(Miltenyi Biotec, PN: 130-042-901) and placed on MidiMACS
™
Separator magnets (Miltenyi
Biotec, PN: 130-042-301). Enriched fibroblast suspensions were collected in lizard cell culture
medium (Dulbecco’s Modified Eagle Media (DMEM)/Ham’s F12, 2 mM Glutamax, 0.1 µM
dexamethasone, 40 µg/mL proline, 50 µg/mL ascorbate, and 10 µg/mL ITS+ supplement.)

Lizard cell labeling and transplantation
DiI and DiO labeling of fibroblast isolation pools were performed using CellTracker
™
dyes
(ThermoFisher Scientific, PNs: C7001, V22886) according to manufacturer’s instructions. Briefly,
cell suspensions were incubated with 1 µM CM-DiI/DiO labeling solutions for 5 min at 37°C
followed by an additional 15-minute incubation at 4°C. Cells were then washed with PBS and
resuspended at a density of 5,000 cells/μL. Labeled cell suspensions (2.5 million cells/animal)
were then injected into tail stumps or blastemas using an insulin syringe and a microinjector system
(Sutter Instrument).

Lizard macrophage and septoclast culture preparation and media conditioning
Bone marrow was isolated via extrusion by crushing femur bones with a mortar and pestle.
Bone marrow cells were passed through a 70 µm filter and treated with eBiosciences
™
1X red
blood cell lysis buffer (ThermoFisher Scientific, PN: 00-4333-57). To isolate blood vessel cells,
caudal arteries and veins were dissected from original lizard tails and digested in vessel
dissociation solution (Leibovitz’s L15 medium (ThermoFisher Scientific, PN: 11415064)

43
containing 30 units/mL papain, 0.5 mg/mL BSA, 0.24 mg/mL cysteine, 40 µg/mL DNase I type
IV , and 1.0 mg/mL trypsin inhibitor) for 90 minutes at room temperature. Digested vessels were
homogenized by repeatedly passing solutions gently through p1000 pipette tips. Digestion was
halted with ovomucoid inhibitor (1.0 mg trypsin inhibitor, 0.5 mg/mL BSA, and 40 µg/mL DNase
I type IV in Leibovitz’s L15 medium). Erythrocytes were depleted using the magnetic bead-based
MACSxpress
®
Erythrocyte Depletion Kit (Miltenyi Biotec, PN: 130-098-196) according to
manufacturer’s instructions. Endothelial cells were depleted using MACS
®
CD144 (VE-Cadherin)
MicroBeads (Miltenyi Biotec, PN: 130-097-857) magnetic beads and cell separation columns
according to the manufacturer’s instructions, as described above in fibroblast isolations.
For macrophage and septoclast differentiation, bone marrow cells and tail vessel cells,
respectively, were cultured for 1 week in phagocyte selection medium (DMEM, 10% fetal bovine
serum, 10% L929 supernatant, 0.1% beta-mercaptoethanol, 100 units/mL penicillin, 100 µg/mL
streptomycin, 10 mM non-essential amino acids, and 10 mM HEPES) at 30°C. Macrophage and
septoclast cultures were then used to generate conditioned media (CM); cultures were washed with
PBS, and selection medium was replaced with serum-free medium (DMEM, 10 µg/mL ITS+
supplement) for 24 hours. Macrophage- and septoclast-CM was collected and concentrated via 3
kD MWCO spin concentrators (Millipore Sigma, PN: UFC5003), and protein content was
determined using BCA protein assays (ThermoFisher Scientific, PN: 23227), according to
manufacturer’s instructions. Macrophage and septoclast cell pool purity validation is described in
Supplementary Methods.

Alginate bead preparation and implantation

44
1 mg/mL concentrated macrophage- and/or septoclast-CM was added to alginate solution
(1.5% w/v alginate, 25 mM HEPES, 118 mM NaCl, 5.6 mM KCl, 2.5 mM MgCl2). Alginate
droplets were injected directly into crosslinking solution (100 mM CaCl2, 10 mM HEPES) and
cured for 15 min with continuous stirring. Cured beads were extensively rinsed with wash buffer
(0.2 % CaCl2 in 0.9 % saline solution). Beads were immediately inserted into amputated lizard
limb and tail stumps.

Statistical analyses
Statistical analyses were performed using GraphPad Prism 9. Statistical tests utilized in
each figure are listed in respective figure legends with corresponding p-values or adjusted p-
values, when applicable. In figures, p-values or adjusted p-values are represented as follows, unless
otherwise noted: *, p < 0.05; **, p < 0.01; ***, p < 0.001; ****, p < 0.0001. All tests were
performed with 95% confidence intervals (a= 0.05) with p-value or adjusted p-value < 0.05
deemed to be statistically significant. All values and graphs/error bars are shown as mean +/-
standard deviation (SD). All experiments performed with A. carolinensis were completed with
equal numbers of male and female lizards. No significant differences were observed as a result of
sex for all reported results.

Author Contributions
A.C.V . contributed to conceptualization, methodology, software, validation, formal
analysis, investigation, resources, data curation, writing, including original draft preparation,
reviewing, and editing, visualization, supervision, and project administration. X.Z. contributed to
methodology, software, validation, formal analysis, investigation, data curation, and visualization.

45
Z.P. contributed to validation, investigation, resources, data curation, and reviewing and editing
writing. M.L.H. contributed to validation, investigation, resources, data curation, supervision, and
project administration. C.G.O., G.A.L., and S.C.H.-K. contributed to data curation. A.W.C.K.
contributed to data curation and reviewing and editing writing. S.B.S. contributed to validation
and data curation. D.J.G. contributed to resources and reviewing and editing writing. T.P.L.
contributed to conceptualization, methodology, software, validation, formal analysis,
investigation, resources, data curation, writing including original draft preparation, reviewing, and
editing, visualization, supervision, project administration, and funding acquisition.

SUPPLEMENTARY MATERIALS AND METHODS
Immunofluorescence (IF) staining detailed protocols
Col2 IF
Slides were rinsed in phosphate-buffered saline (PBS) three times to remove Optimal
Cutting Temperature compound (OCT) embedding medium, then equilibrated in 0.02% bovine
serum albumin (BSA) in PBS for 15 minutes at room temperature. Samples were then washed
once more with 0.02% BSA/PBS and incubated with Chondroitinase ABC (100 mU/mL, Sigma
Aldrich, PN: C3667) and Hyaluronidase (250 U/mL, Sigma Aldrich, PN: H3506) in 0.02%
BSA/PBS solution for antigen retrieval for 30 minutes at 37°C. Slides were washed twice in 1X
tris-buffered saline (TBS), permeabilized at room temperature in 0.01% Triton X-100/TBS for 10
minutes, then washed twice for 5 minutes each in 0.1% Tween
®
20/TBS. Samples were blocked
with filtered blocking buffer (1% BSA and 0.1% Tween
®
20 in TBS) for 2 hours at room
temperature.

46
Primary anti-Col2 antibody (Abcam, PN: ab34712) was diluted 1:1000 in blocking buffer
and samples were incubated overnight at 4°C. Slides were washed twice for 5 minutes each with
0.1% Tween
®
20/TBS, then anti-Mouse IgG (H+L) cross-adsorbed Alexa Fluor
™
647-tagged
secondary antibody (Invitrogen, PN: A-21235), 1:500 dilution in blocking buffer, was added for 1
hour at room temperature in the dark. Slides were again washed twice for 5 minutes each with
0.1% Tween
®
20/TBS and equilibrated in TBS for 5 minutes. Slides were counterstained with 300
nM DAPI for 10 minutes, washed twice with TBS and mounted in hard-set VectaMount
®
mounting
media (Vector Laboratories, PN: H-5000). Slides were stored at 4°C prior to imaging.

Ctsk IF
Slides were rinsed in PBS three times to remove OCT embedding medium, then
equilibrated in TBS for 15 minutes at room temperature. Samples were then permeabilized at room
temperature in 0.01% Triton X-100/TBS for 10 minutes and washed twice for 5 minutes each with
0.1% Tween
®
20/TBS. Samples were blocked with filtered blocking buffer (1% BSA and 0.1%
Tween
®
20 in TBS) for 2 hours at room temperature.
Primary anti-Ctsk antibody (Abcam, PN: ab19027) was diluted 1:200 in blocking buffer
and samples were incubated overnight at 4°C. Slides were washed twice for 5 minutes each with
0.1% Tween
®
20/TBS, then anti-rabbit-IgG (H+L) cross-adsorbed Alexa Fluor
™
647-tagged
secondary antibody (Invitrogen, PN: A-21244), 1:500 dilution in blocking buffer, was added for 1
hour at room temperature. Slides were again washed twice for 5 minutes each with 0.1% Tween
®

20/TBS and equilibrated in TBS for 5 minutes. Slides were counterstained with 300 nM DAPI for
10 minutes, washed twice with TBS and mounted in hard-set VectaMount
®
mounting media
(Vector Laboratories, PN:H-5000). Slides were stored at 4°C prior to imaging.

47

Real time-polymerase chain reaction (RT-PCR)
Total RNA of tails collected 14 days post-amputation (DPA) from lizards (Anolis
carolinensis) treated with vehicle control, Hedgehog (Hh) inhibitor cyclopamine, or Hh
smoothened agonist (SAG) were isolated using TRIzol
™
reagent (Invitrogen, PN: 15596026) and
purified using RNeasy
®
Plus Mini Kit (Qiagen, PN: 74134). Reverse transcription reactions were
performed using Superscript
®
VILO
™
cDNA Synthesis Kit (Invitrogen, PN: 11754250) according
to the manufacturer’s instructions. RT-PCR was performed for anole sulf1, spp1, pltp, and sall1
using Applied Biosystems
™
SYBR
™
Green PCR Master Mix (ThermoFisher Scientific, PN:
4309155) with a StepOnePlus
™
RT-PCR thermocycler (Applied Biosystems). All sample values
were normalized to gapdh using the 2–ΔΔCt method and relative gene expression levels were
generated by normalizing to corresponding vehicle control conditions for each gene. Forward and
reverse primer sequences are listed in Supplementary Table 3.

Phagocytosis assays
pHrodo
™
green bioparticles for phagocytosis
Lizard (A. carolinensis) phagocytes were incubated with 0, 1 or 100 µg/mL pHrodo
™
green
E. coli bioparticles (ThermoFisher Scientific, PN: P35366) for 2 hours at 30°C prior to analysis
via BD FACSAria
™
II flow cytometer. pHrodo
™
bioparticles exhibit pH-sensitive fluorescent
green signal that substantially increases with lower pH, such as upon ingestion into acidic
phagosomes[105], allowing for fluorescent detection of phagocytic cells. Forward scatter and side
scatter gating strategies depicted in Supplementary Figure 23.

48
Fluoroliposome
®
DiI
Green anole lizards (A. carolinensis) and mourning geckos (Lepidodactylus lugubris) with
regenerated tails 21 DPA were weighed and received 0.125 mg/g animal weight Fluoroliposome
®

DiI (Encapsula Nano Sciences, PN: CLD-8911) via intraperitoneal injections. Fluoroliposome
®

DiI is a dye, DiI, packaged in liposomes that fluorescence when phagocytosed and incorporated in
lipophilic membranes, allowing for quantification of phagocytic cells in vivo[106]. Tails were
collected 4-6 hours later for histology and analysis via fluorescence microscopy.

Flow cytometry
Primary antibodies anti-Ctsb (Abcam, PN: ab190077, 1:500 dilution) and anti-Ctsk
(Abcam, PN: ab19027, 1:500 dilution) were conjugated to Alexa Fluor
™
488 and 647 fluorophores,
respectively, prior to incubation using Zip Alexa Fluor
™
488 and 647 Rapid Antibody Labeling
Kits (Invitrogen, PNs: Z11233, Z11235), according to manufacturer’s instructions. Enriched
macrophage and septoclast cell pools were pelleted and resuspended in ice-cold PBS with 10%
fetal calf serum and 1% sodium azide.

Suspensions were then incubated, with prepared conjugated
primary antibodies anti-Ctsb-Alexa Fluor
™
488 and anti-Ctsk-Alexa Fluor
™
647 in ice-cold PBS
with 3% BSA for 30 minutes at 4°C. Cells were washed 3 times with ice-cold PBS via
centrifugation at 400 xg for 5 minutes each and resuspended in ice-cold PBS with 3% BSA and
1% sodium azide.
Cells were then analyzed with BD FACSAria
™
II flow cytometer. Cells were single-gated
from total events based on forward scatter and side scatter. Quadrants were then gated based on
control macrophage or septoclast sample cell pools incubated with polyclonal rabbit IgG isotype
(Abcam, PN: ab171870) with matching fluorophores. Data was analyzed using FlowJo software

49
(FlowJo LLC, version 9). Quadrant gating strategy depicted in Supplementary Figure 19. Forward
scatter and side scatter gating strategies depicted in Supplementary Figure 23.

FIJI (Image J) image quantification analysis
IF quantification
To quantify percentages of fluorescently labeled cells within Col2
+
regions, fluorescent
images were separated into DAPI, Col2, DiI, and/or DiO channels. Over/under thresholding was
used to identify positive staining in each channel. The lower-upper limit thresholds on a 0-255
scale were: DiI/DiO 25-85; Col2 45-85; DAPI 25-200. Next, DiI/DiO and DAPI channels were
overlaid, and cell nuclei associated with DiI/DiO signal were labeled with ascending numbers
counted. Finally, images of labeled nuclei were overlayed onto corresponding Col2 images and
labeled nuclei within Col2
+
regions were marked with ascending letters and counted. Percentages
of fluorescently labeled cells within Col2
+
regions were calculated from counts of labeled cells
within Col2
+
regions and counts of total cells labeled with DiI/DiO.

FISH quantification
To quantify cell densities of phagocytes based on ctsb, ctsk, and col4a1 expression,
fluorescent microscope images were divided into 1 mm
2
tail/limb regions and separated into DAPI,
ctsb, ctsk, and col4a1 channels. Over/under thresholding was used to identify positive staining in
each channel. The lower-upper limit thresholds on a 0-255 scale were: ctsb 50-255; ctsk 15-255;
col4a1; 50-255; DAPI 25-200. Next, DAPI channels were successively overlaid with ctsb, ctsk,
and col4a1 channels, and cell nuclei associated with each marker were labeled and counted.
Macrophage, osteoclast, and septoclast cell numbers were quantified from counts of ctsb
+
ctsk
-

50
col4a1
-
, ctsb
+
ctsk
+
col4a1
-
, ctsb
-
ctsk
+
col4a1
+
cells, respectively. Total sample areas were
calculated based on DAPI signal. Finally, cell densities were calculated based on cell counts and
sample areas.
To quantify contributions of select cell populations to regenerated tissues, 5 tails
phenotypically and morphologically representative of each of the four time points tested (Day 0,
Inflammatory Stage, Blastema Stage, Regenerated Homeostasis) were sagittally sectioned. Five
middle sections were analyzed by FISH in the Cy5 channel for fibroblastic connective tissue cells,
or FCTCs (col3a1), phagocytic macrophage and osteoclast (ctsb), immune cell (aoah), epithelial
(krt5), muscle-related (ckm), chondrocyte (col2a1), endothelial (vwf), and ependymal (fabp7)
markers. All sections were counterstained with DAPI. Over/under thresholding was used to
identify positive staining in each channel. The lower-upper limit thresholds on a 0-255 scale were:
Cell markers 50-255; DAPI 25-200. Total sample and marker signal areas were measured via
FIJI/ImageJ from DAPI and Cy5 channels, respectively. Amputation planes were identified by
distal most mature scale and tail vertebrae. Total sample areas included all DAPI
+
area distal to
boundaries 500 µm proximal to amputation planes. Percent areas for each marker were calculated
from marker signal areas and corresponding total sample areas.

Gross tail length quantification
To quantify regenerated tail length, the straight-line distance between the amputation plane
and distal tail tip was calculated using the FIJI/ImageJ measure tool. Amputation planes were
identified by distal most mature scale and tail vertebrae.

51
FIGURES

Figure 1. Single-cell RNA sequencing of regenerating lizard tails with pseudotime trajectory
analysis of fibroblastic connective tissue cells and chondrocytes throughout tail regeneration.

52
(a) UMAP of unsupervised clustering of single-cell RNA sequencing (scRNAseq) results for lizard
(Anolis carolinensis) tail regeneration time course comprised of uninjured day 0 lizard tail (0 days
post-amputation or DPA), inflammatory stage (1, 3 & 7 DPA), blastema stage (14 & 21 DPA) and
regenerated homeostasis (28 DPA) samples. (b) Quantification of relative cell type composition
proportions per tail sample stage, excluding red blood cells. (c) TSNE of fibroblastic connective
tissue cells (FCTCs) and chondrocytes isolated, integrated, and subclustered from scRNAseq
dataset in (a). (d) TSNE of unsupervised clustering of FCTCs and chondrocyte cell subset. (e)
Monocle2 pseudotime trajectory analysis for FCTCs and chondrocyte scRNAseq cell subset from
(c). (f) Pseudotime overlayed onto TSNE FCTC/chondrocyte cell subcluster. (g) Regeneration time
point overlayed on pseudotime trajectory for FCTC/chondrocyte subset. (h) FCTC/chondrocyte
TSNE analyzed by regeneration time point. (i, j) Spp1, (k, l) sulf1, (m, n) sox9, and (o, p) col2a1
gene expression in FCTC/chondrocyte TSNE subcluster and FCTC/chondrocyte subcluster
pseudotime trajectory, respectively. All panels generated by A.C.V . and X.Z.

53

Figure 2. Lizard tail fibroblasts exhibit spatiotemporal marker gene activation during
regeneration. Representative sagittal sections of original and regenerating lizard (A. carolinensis)

54
tail samples analyzed via RNAscope
™
in situ hybridization. (a-f) Original tails (0 DPA) with
magnified inset of homeostatic fibroblasts, (g-l) inflammatory stage tails 7 DPA, (m-r) blastema
stage tails 14 DPA, and (s-x) regenerated homeostasis stage tails 28 DPA analyzed for col3a1, pltp,
sall1, sox9, spp1, and sulf1. n = 5 animals/samples per time point. ct, cartilage tube; et, ependymal
tube; rm, regenerated muscle; sc, spinal cord; ve, vertebra. Bar = 500 µm. All panels generated by
A.C.V . with staining assistance by Z.P. and imaging assistance by G.A.L. and S.C.H.-K.

55

Figure 3. Sulf1 expression in lizard tail blastema, but not limb, is regulated by Hedgehog
stimulation. Representative sagittal sections of (a-l) tail and (m-x) limb samples collected from
lizards (A. carolinensis) 14 DPA treated with (a-d, m-p) vehicle control, (e-h, q-t) Hedgehog
inhibitor cyclopamine and (i-l, u-x) Hedgehog smoothened agonist, SAG, and analyzed by
histology/ISH for sulf1, spp1, pltp, and sall1. n = 5 lizards per treatment condition. et, ependymal
tube; sc, spinal cord; tb, tibia; ve, vertebra. Bar = 500 µm. Panels a-l generated by A.C.V . and
T.P.L. Panels m-x generated by T.P.L. Staining assistance for all panels by Z.P. and imaging
assistance from all panels by A.W.C.K. and S.B.S.

56

Figure 4. Comparing chondrogenic abilities of fibroblasts derived from original tail,
blastema and regenerated tails in vivo. (a) Experimental scheme for Lepidodactylus lugubris tail
fibroblast transplantations. (1) Donor lizard tails are amputated. FCTCs are isolated from original
tails (0 DPA), blastema tails (14 DPA), and regenerated tails (28 DPA). (2) Each tail FCTC pool is
labeled with fluorescent DiI, separately. (3) Labeled FCTC pools are transplanted into tail
blastemas (14 DPA) of SAG-treated recipient lizards, separately. (4) Following 14 days of SAG
treatment post-transplantation (14 DPT), regenerated tails are analyzed via Col2
immunofluorescence staining (IF) and fluorescence microscopy. (b-j) Representative histological
and fluorescent analysis of tails regenerated by SAG-treated lizards pre-injected with DiI-labeled
tail FCTCs derived from (b-d) original tail, (e-g) blastema tails, or (h-j) regenerated tails, analyzed
by Col2 IF 14 DPT/28 DPA. DiI and Col2 signals are presented separately and together to highlight

57
co-localization or lack thereof. Green arrowheads denote DiI
+
cells. Bar = 50 µm. (k)
Quantification of DiI-labeled cells incorporated within Col2
+
cartilage regions 14 DPT. n = 50 cell
counts measured from 5 images among 10 different animals/tail samples for each condition. Data
are presented as mean values +/- standard deviation. One-way Welch’s ANOV A for unequal
variances and Dunnett’s T3 multiple comparisons tests was used. ****, adjusted p < 0.0001
(Dunnett’s T3 multiple comparisons tests). Panel a generated by T.P.L. Panels b-k generated by
T.P.L. and M.L.H. Panel k statistics by A.C.V .

58

Figure 5. Comparing chondrogenic abilities of sulf1
+
tail blastema cells and sulf1
-
tail
fibroblasts in vivo. (a) Experimental scheme for L. lugubris tail blastema and amputated limb
fibroblast transplantations. (1) Donor lizard tails and left hind limbs are amputated. (2) FCTCs are
isolated from tail blastemas and limb stumps 14 DPA. (3) Tail FCTCs are labeled with DiI, while
limb FCTCs are labeled with DiO. (4) Labeled FCTCs are co-transplanted into tail blastemas (14
DPA) of SAG-treated recipient lizards. (5) Following 1 and 14 days of SAG treatment post-
transplantation, regenerated tails are analyzed via sulf1 FISH, Col2 IF, and fluorescence
microscopy. (b-m) Representative histological and fluorescent analysis of tails regenerated by
SAG-treated lizards pre-injected with DiI-labeled tail FCTCs and DiO-labeled limb FCTCs,
analyzed by (b-e) sulf1 FISH 1-day post-transplantation (DPT)/15 DPA and (f-m) Col2 IF 14
DPT/28 DPA. DiI, DiO, and sulf1 or Col2 signals are presented separately and together to highlight
co-localization or lack thereof. Red arrowheads mark DiI
+
cells, and green arrowheads denote

59
DiO
+
cells. Bar = 50 µm. (n, o) Quantification of DiI- and DiO-labeled cells (n) co-expressing
sulf1 1 DPT and (o) incorporated within Col2
+
cartilage regions 14 DPT. n = 50 cell counts
measured from 5 images among 10 different animals/tail samples for each condition. Data are
presented as mean values +/- standard deviation. Unpaired two-way t-tests with Welch’s correction
for unequal variances were used. ****, p < 0.0001. Panel a generated by T.P.L. Panels b-o
generated by T.P.L. and M.L.H. Statistics in panels n, o by A.C.V .

60

Figure 6. Spatiotemporal localizations of macrophage, osteoclast, and septoclast populations
during lizard tail regeneration and limb amputation. Representative sagittal sections of lizard
(A. carolinensis) (a-i) tails and (j-r) limbs collected (a-c, j-l) 7 DPA, (d-f, m-o) 14 DPA, and (g-i,
p-r) 21 DPA analyzed by histology/FISH for ctsb, ctsk, col4a1, and sulf1 expression. Higher
magnification views of corresponding regions in (a, d, g, j, m, p) highlighting ctsb
+
ctsk
-
col4a1
-

macrophages (m, arrowhead), ctsb
+
ctsk
+
col4a1
-
osteoclasts (o, arrowhead), and ctsb
-
ctsk
+

col4a1
+
septoclasts (s, arrowhead) in regions proximal to (b, e, h) vertebra, (k, n, q) tibia, (c, f, i)
distal tail and (l, o, r) distal limb. bm, bone marrow; bv, blood vessel; tb, tibia; ve, vertebra. Bar =
100 µm. (s, t) Quantification of macrophage, osteoclast, and septoclast densities measured in lizard
(s) tails and (t) limbs collected 7, 14, and 21 DPA. n = 50 cell densities measured from 5 images
among 10 different animals/samples for each time point. Data are presented as mean values +/-
standard deviation. One-way Welch’s ANOV A for unequal variances and Dunnett’s T3 multiple
comparisons tests were used. †, adjusted p = 0.0139; ††††, adjusted p < 0.0001; ns (†) , not
significant (adjusted p = 0.4663), compared to corresponding cell type 7 DPA (Dunnett’s T3
multiple comparisons tests). **, adjusted p = 0.0024; ***, adjusted p = 0.0005; ****, adjusted

61
p < 0.0001, compared to corresponding cell type 21 DPA (Dunnett’s T3 multiple comparisons
tests). Panels a-i by A.C.V . and T.P.L. Panels j-t by T.P.L. Staining assistance for a-r by Z.P. and
imaging assistance by A.W.C.K. Statistics for panels s, t by A.C.V .

62

Figure 7. Pre-exposure to phagocytic cells is required for activation of Hedgehog-responsive
chondrogenesis in lizard fibroblasts. (a) Experimental scheme for applying clodronate liposome
treatments and fibroblast transplantations in lizards (L. lugubris) toward investigating
dependencies of blastema cell chondrogenesis on phagocyte populations. (1) Tails of PBS
liposome- and clodronate liposome-treated donor lizards are amputated. (2) Tail fibroblasts are
isolated from PBS liposome- and clodronate liposome-treated lizard tails 14 DPA. (3) PBS lizard-
derived fibroblasts are labeled with DiI, while clodronate fibroblasts are labeled with DiO. (4)
Labeled cells are co-transplanted into 14 DPA tail blastema of recipient SAG-treated lizards. (5)
Following 14 days of SAG treatment post-transplantation, regenerated tails are analyzed via Col2
IF and fluorescence microscopy. (b-i) Representative histological analysis of tails regenerated by
SAG-treated lizards pre-injected with DiI-labeled PBS liposome-treated FCTCs and DiO-labeled
clodronate liposome-treated FCTCs and analyzed by histology, DiI and DiO fluorescence, and
Col2 IF 14 DPT/28 DPA. Bar = 50 µm. (j) Quantification of DiI- and DiO-labeled cells co-
expressing Col2 14 DPT. n = 50 cell counts measured from 5 images among 10 different
animals/tails for each condition. Data are presented as mean values +/- standard deviation.
Unpaired two-way t-test with Welch’s correction for unequal variances was used. ****, p < 0.0001.
Panel a generated by T.P.L. Panels b-j generated by T.P.L. and M.L.H. Statistics for panel j by
A.C.V .

63

Figure 8. Factors secreted by lizard macrophage and septoclast populations rescue tail FCTC
marker gene expression and chondrogenic potential following endogenous phagocyte
depletion. (a) Experimental scheme for testing effects of biomolecules secreted by macrophage
and septoclast populations on FCTC gene expression in clodronate liposome-treated lizard (A.
carolinensis) tails. (1) Bone marrow and tail blood vessel cells are isolated from donor lizards and
(2) differentiated into macrophages and septoclasts in vitro, respectively. (3) Macrophage- and
septoclast-conditioned media (M-CM and S-CM, respectively) are collected, concentrated, and
absorbed by alginate beads, both separately and together. (4) Alginate beads are implanted into
amputated tails of lizards (0 DPA) co-treated with clodronate liposomes and SAG. (b-q)
Representative sagittal sections of lizard tails 14 DPA co-treated with SAG and clodronate
liposomes, implanted with M-CM and/or S-CM beads, and analyzed via histology/ISH/FISH for
sulf1, spp1, ctsk, ctsb, and col4a1 expression. Higher magnification fluorescent views of (b, c, f,
g, j, k, n, o), respectively, depict indicated regions around (d, h, l, p) vertebra and (e, i, m, q)
implanted beads. n = 8 lizards/samples per treatment condition tested. *, location of implanted
bead; ve, vertebra. Bar = 50 µm. Panel a generated by T.P.L. Panels b-q generated by T.P.L. with
cell culture by M.L.H., staining assistance by Z.P. and imaging assistance by G.A.L., S.C.H.-K.,
A.W.C.K. and S.B.S. and revision by A.C.V .

64

Figure 9. Lizard macrophage- and septoclast-secreted factors stimulate FCTCs and promote
chondrogenesis to amputated lizard limbs. (a) Experimental scheme for testing effects of
macrophage- and septoclast-conditioned media on native fibroblasts in lizard (A. carolinensis)
limbs. (1) Bone marrow and tail blood vessel cells are isolated and (2) used to derive macrophages
and septoclasts in vitro, respectively. (3) Media conditioned by macrophages and septoclasts (M-
CM and S-CM) are collected, concentrated, and absorbed by alginate beads, both separately and
together. (4) Alginate beads are implanted into amputated limbs of SAG-treated lizards 7 DPA. (b-
u) Representative sagittal sections of lizard limbs 28 DPA treated with SAG, implanted with M-
CM and/or S-CM beads, and analyzed via histology/ISH/FISH for sulf1, sox9, spp1, ctsk, ctsb, and
col4a1 expression. Higher magnification fluorescent views of (b-d, g-i, l-n, q-s), respectively,
depict indicated regions around (e, j, o, t) implanted beads and (f, k, p, u) tibia. n = 8
lizards/samples per treatment condition tested. *, location of implanted bead; ec (arrowhead),
ectopic cartilage; m (arrowhead), macrophage; o (arrowhead), osteoclast; tb, tibia. Bar = 50 µm.
Panel a generated by T.P.L. Panels b-u generated by T.P.L. with cell culture by M.L.H., staining
help by Z.P. and imaging help by G.A.L., S.C.H.-K., A.W.C.K. and S.B.S. and revision by A.C.V .

65

Figure 10. Summary of proposed mechanism of FCTC gene expression acquisition and
chondrogenesis during lizard tail regeneration. Col3a1
+
homeostatic original tail FCTCs (0
DPA) are stimulated by macrophage paracrine signals and express spp1 in response to injury by 7
DPA. Factors secreted by tail septoclasts maintain spp1 expression in FCTCs and enhance FCTC
sensitivity to Hedgehog (Hh) signals contributed by blastema ependymal tubes. Hh stimulation
induces sulf1 expression in septoclast-stimulated blastema FCTCs by 14 DPA. Sulf1
+
FCTCs enter
a chondrogenic program in response to Hh signals and express sox9 and col2a1, differentiating
into chondrocytes by 28 DPA. Amputated lizard limbs provide context for tail blastema formation
and regrowth as non-regenerative appendages that exhibit FCTC mobilization and state changes,
but not chondrogenesis. Col3a1
+
homeostatic limb fibroblasts express spp1 at 7 DPA in response
to macrophage infiltration following amputation. However, spp1 expression is not maintained
without stimulation from septoclasts, which are absent in amputated lizard limbs. Without
exposure to septoclast-secreted factors, limb FCTCs lose spp1 expression by 14 DPA, remain
unresponsive to Hh signaling, and do not express sulf1 or undergo chondrogenesis. Instead,
amputated lizard limbs form scars. Figure generated by T.P.L. with revision by A.C.V .

66
SUPPLEMENTARY FIGURES

Supplementary Figure 1. Single-cell RNA sequencing (scRNAseq) cluster gene expression
and validation. (a) Percentage and average expression of top differentially expressed genes by
cluster of regenerating tail time course scRNAseq dataset presented in Figure 1a. (b-i) UMAP
feature plots of cluster-defining marker gene expression within regenerating tail scRNAseq
dataset. (j-q) Representative RNAscope
™
in situ hybridization (ISH) of cluster-defining marker
gene expression in lizard (Anolis carolinensis) tails with respective (r-y) magnified insets. n = 5
lizards per time point assayed. (j-q) Bar = 500 µm; (r-y) Bar = 50 µm. Panels a-g generated by
A.C.V . and X.Z. Panels j-y generated by A.C.V . with staining assistance from Z.P. and imaging
assistance from G.A.L. and S.C.H.-K.

67

Supplementary Figure 2. Fluorescent ISH quantification of proportional area contributions
of respective cell types by scRNAseq cluster. Quantification of positive RNAscope
™
fluorescent
ISH (FISH) percentage area stained of regenerating tail at day 0, inflammatory stage (7 days post-
amputation, or DPA), blastema stage (14 DPA), and regenerated homeostasis (28 DPA), for
respective scRNAseq clusters with indicated marker genes: FCTCs (col3a1), phagocytic
macrophages and osteoclasts (ctsb), immune cells (aoah), epithelial cells (krt5), muscle-related
cells (ckm), chondrocytes (col2a1), endothelial cells (vwf), and ependymal cells (fabp7). n = 5 tail
samples quantified per time point per cell type. One-way Welch’s ANOV A for unequal variances
with Dunnett’s T3 multiple comparisons tests were used per gene between respective tail stages.
*, adjusted p < 0.05; **, adjusted p < 0.01; ***, adjusted p < 0.001; ns, not significant. Adjusted p-
values represent Dunnett’s T3 multiple comparisons tests compared to Day 0 within cell types,
unless otherwise noted. Data are presented as mean values +/- standard deviation. Figure generated
by T.P.L. with statistics by A.C.V .

68

Supplementary Figure 3. FCTC/chondrocyte pseudotime trajectory analysis and TSNE
subclustering by tail stage. (a, b) Regeneration stages mapped on (a) pseudotime trajectory for

69
FCTC/chondrocyte subset and (b) FCTC/chondrocyte subset TSNE. (c-j) Pseudotime trajectory
and TSNE FCTC/chondrocyte subclustering for (c, d) Day 0, (e, f) Inflammatory Stage, (g, h)
Blastema Stage, or (i, j) Regenerated Homeostasis stage tail scRNAseq sample cells only. All
panels generated by A.C.V . with assistance from X.Z.

70

Supplementary Figure 4. FCTC/chondrocyte subcluster gene expression and pseudotime
trajectory analysis of sall1 and pltp. (a, b) Gene expression overlaid on TSNE subclustering of
FCTC/chondrocyte subset and (c, d) pseudotime trajectory analysis for fibroblast marker genes (a,
c) pltp and (b, d) sall1. All panels generated by A.C.V . and X.Z.

71

Supplementary Figure 5. Additional fibroblast gene expression throughout lizard tail
regeneration. Representative sagittal sections of original and regenerating lizard (A. carolinensis)
tail samples analyzed via ISH. (a-e) Original tails (0 DPA) with select magnified lower right corner
insets featuring homeostatic fibroblast expression, (f-j) inflammatory stage tails 7 DPA, (k-o)

72
blastema stage tails 14 DPA, and (p-t) regenerated homeostasis stage tails 28 DPA analyzed for
cdh11, col12a1, mdk, sparc, and tenascin-like (tnl) expression. n = 5 lizards/samples per time point
assayed. ct, cartilage tube; et, ependymal tube; rm, regenerated muscle; sc, spinal cord; ve,
vertebra. Bar = 500 µm. All panels generated by A.C.V . with staining assistance by Z.P. and
imaging assistance by G.A.L. and S.C.H.-K.

73

Supplementary Figure 6. Hedgehog signaling regulates blastema cell chondrogenesis.
Representative tail samples collected 28 DPA from lizards (Lepidodactylus lugubris) treated with
vehicle control (PBS), Hedgehog (Hh) pathway inhibitor cyclopamine, or Hh pathway smoothened
agonist, SAG, analyzed by (a-c) gross morphology and (d-l) histology/FISH for shh (Hh signal),
col2a1 (cartilage), and fabp7 (neural stem cells). (d-f) Sagittal representative tail sections and (g,
i, k) corresponding cross sections of regenerated tails. (h, j, l) Higher magnification views of
ependymal tube cross sections identified in (g, i, k), respectively. n = 5 lizards per treatment
condition. ct, cartilage tube; ec, ectopic cartilage; et, ependymal tube. (a-f) Bar = 2.5 mm. (g, i, k)
Bar = 500 µm. (h, j, l) Bar = 50 µm. All panels generated by T.P.L.

74

Supplementary Figure 7. Lizard tail, but not limb, fibroblasts undergo Hedgehog-regulated
chondrogenesis. Sagittal sections of representative (a-c, g-i, m-o) tails and (d-f, j-l, p-r) limb

75
samples collected from lizards (A. carolinensis) 28 DPA treated with (a-f) vehicle control, (g-l)
cyclopamine, or (m-r) SAG, and analyzed by histology/ISH for col2a1, spp1 and gli1. n = 5 lizards
per treatment condition. tb, tibia; ve, vertebra. Bar = 500 µm. Panels a-c, g-i, m-o generated by
A.C.V . and T.P.L. Panels d-f, j-l, p-r generated by T.P.L. Staining assistance for all panels by Z.P.
and imaging assistance by A.W.C.K. and S.B.S.

76

Supplementary Figure 8. Real time-polymerase chain reaction (RT-PCR) reveals sulf1
expression is Hedgehog signaling-dependent in regenerating lizard tail. RT-PCR analyses of
lizard sulf1, spp1, pltp, and sall1 expression in tails collected 14 DPA from lizards (A. carolinensis)
treated with vehicle control, cyclopamine, or SAG. All gene expression levels were first
normalized to corresponding gapdh expression levels to control for possible changes in total
mRNA amounts caused by drug treatments. Relative gene expression levels were then generating
by normalization to corresponding vehicle control conditions. n = 5 tails per drug treatment
condition assessed across 5 RT-PCR runs. Unpaired two-way t-tests with Welch’s correction for
unequal variances were used. *, p = 0.0366; ***, p = 0.0008; ****, p < 0.0001; ns, not significant,
compared to corresponding vehicle controls. Data are presented as mean values +/- standard
deviation. Figure generated by T.P.L. with statistics by A.C.V .

77

Supplementary Figure 9. Validation of L. lugubris fibroblast cell isolation pools via MACS
®

bead depletion. (a-f) Representative FISH of L. lugubris lizard tail fibroblast cell isolation pools
(a-c) before and (d-f) after treatment with MACS
®
beads, analyzed for FCTCs (col3a1),
endothelial cells (vwf), muscle-related cells (ckm) and immune cells (aoah). Bar = 25 µm. (g)
Quantification of FISH percentage area of respective cell types before and after MACS
®
bead
depletion treatment in fibroblast cultures. n = 10 fibroblast cell pools quantified each before and
after treatment. Paired two-way t-tests were used between respective cell populations. ****, p <
0.0001. Data are presented as mean values +/- standard deviation. Panels a-f generated by M.L.H.
Panel g generated by T.P.L. with statistics by A.C.V .

78

Supplementary Figure 10. Regenerating lizard tail skeletons exhibit proximodistal gradients
of sulf1 and sox9. Representative sagittal sections of tails collected 14 DPA from lizards (A.
carolinensis) treated with (a, b) vehicle control, (c, d) cyclopamine, or (e, f) SAG, and analyzed
by histology/ISH for sulf1 and sox9. n = 10 lizards per treatment condition. et, ependymal tube;
ve, vertebra. Bar = 500 µm. All panels generated by A.C.V . and T.P.L. Staining assistance by Z.P.
and imaging assistance by G.A.L. and S.C.H.-K.

79

Supplementary Figure 11. Comparing chondrogenic abilities of tail and limb fibroblasts in
vivo. (a) Experimental scheme for L. lugubris tail blastema and amputated limb fibroblast
transplantations. (1) FCTCs are isolated from amputated original (0 DPA) tails and left hind limbs
of donor lizards. (2) Tail FCTCs are labeled with DiI, while limb FCTCs are labeled with DiO. (3)
Labeled FCTCs are co-transplanted into freshly amputated tail stumps (0 DPA) of SAG-treated
recipient lizards. (4) Following 14 and 28 days of SAG treatment, regenerated tails are analyzed
via Col2 immunofluorescence staining (IF), sulf1 FISH, and fluorescence microscopy. (b-i)
Representative fluorescent and histological analysis of tails regenerated by lizards co-injected with
DiI-labeled tail FCTCs and DiO-labeled limb FCTCs, analyzed by (b-e) sulf1 FISH 14 days post-
transplantation (DPT)/14 DPA and (f-i) Col2 IF 28 DPT/28 DPA. DiI, DiO, and sulf1 or Col2
signals are presented separately and together to highlight co-localization or lack thereof. Green
arrowheads denote DiO
+
cells and red arrowheads mark DiI
+
cells. Bar = 50 µm. (j, k)
Quantification of DiI- and DiO-labeled cells (j) co-expressing sulf1 14 DPT and (k) incorporated
within Col2
+
cartilage regions 28 DPT. n = 50 cell counts measured from 5 images among 10
different animals/tails for each condition. Unpaired two-way t-tests with Welch’s correction for
unequal variances were used. ns, not significant. Data are presented as mean values +/- standard

80
deviation. Panel a generated by T.P.L. Panels b-k generated by T.P.L. and M.L.H. Statistics in
panels j, k by A.C.V .

81

Supplementary Figure 12. Comparing chondrogenic abilities of sulf1
+
tail blastema cells and
sulf1
-
tail fibroblasts in vivo, separately, in SAG- and vehicle control-treated recipient lizards.
(a-l) Representative histological analysis of tails regenerated by (a-c, g-i) PBS vehicle control- or
(d-f, j-l) SAG-treated recipient lizards pre-injected with (a-f) DiI-labeled blastema (14 DPA) tail-
derived FCTCs or (g-l) 14 DPA limb-derived FCTCs and analyzed by Col2 IF and fluorescence
microscopy 14 DPT/28 DPA. DiI and Col2 signals are presented separately and together to
highlight co-localization or lack thereof. Green arrowheads mark DiI
+
cells. Bar = 50 µm. (m)
Quantification of DiI-labeled cells incorporated within Col2
+
cartilage regions 14 DPT. n = 50 cell
counts measured from 5 images among 10 different animals/tails for each condition. Two-way
ANOV A with pairwise Tukey’s adjustment for multiple comparisons was used. ****, adjusted p <
0.0001; ns, not significant (adjusted p = 0.7939, Tukey’s). Data are presented as mean values +/-
standard deviation. All panels generated by T.P.L. and M.L.H. with statistics by A.C.V .

82

Supplementary Figure 13. Regenerated lizard tails exhibit distinct macrophage, osteoclast,
and septoclast-like cell populations. (a-c) SPRING[91] visualization of regenerating lizard (A.
carolinensis) tails highlighting distinct macrophage, osteoclast, and septoclast-like cell
populations (herein, septoclasts). Ctsb
+
ctsk
+
osteoclasts clustered with ctsb
+
ctsk
-
macrophages,
while ctsb
-
ctsk
+
septoclasts clustered with col4a1
+
pericytes. (d) Lizard tail blastema (14 DPA)
analyzed with col4a1 and vwf (endothelial cells) FISH toward validating col4a1 as a pericyte
marker in regenerating lizard tails. Col4a1
+
pericytes associate with vwf
+
blood vessels. n = 3
lizards for representative FISH. bv, blood vessel. Bar = 100 µm. Panels a-d generated by T.P.L.
Staining and imaging assistance in panel d by Z.P.

83

Supplementary Figure 14. Phagocytic macrophage and osteoclast populations peak during
inflammatory stage 7 DPA. (a-e) Representative histological and FISH analysis of phagocytic
macrophages and osteoclasts (ctsb) and immune cells (aoah) in lizard (A. carolinensis) tails from
0-14 DPA. Bar = 500 µm. (f) Quantification of positive FISH percentage area for each cell
population over total regenerated tail sample area per time point. Abundant immune cells and
phagocytic macrophages and osteoclasts are observed 1-7 DPA, characteristic of the inflammatory
stage of tail regeneration, with phagocytic cells peaking 7 DPA. n = 5 images quantified from 1
image each among 5 different animals/tails per time point. Data are presented as mean values +/-
standard deviation. Panels a-e by T.P.L. and A.C.V . with staining assistance by Z.P. and imaging
assistance by A.W.C.K. and S.B.S. Panel f generated by T.P.L.

84

Supplementary Figure 15. Clodronate treatment depletes phagocyte populations, prevents
blastema formation, and inhibits blastema fibroblast gene expression changes. Representative
sagittal sections of lizard (A. carolinensis) tails collected 14 DPA, pre-treated with (a-e) PBS

85
liposomes or (f-j) clodronate liposomes, and analyzed by (a, b, f, g) histology/ISH for sulf1 and
spp1 and by (c-e, h-j) FISH for ctsb, ctsk, and col4a1. (d, e, i, j) Higher magnification views of
corresponding regions identified in (c) and (h) highlighting ctsb
+
ctsk
-
col4a1
-
macrophages (m,
arrowhead), ctsb
+
ctsk
+
col4a1
-
osteoclasts (o, arrowhead), and ctsb
-
ctsk
+
col4a1
+
septoclasts (s,
arrowhead). n = 12 lizards per treatment. et, ependymal tube; sc, spinal cord; ve, vertebra. Bar =
50 µm. All panels generated by T.P.L. and A.C.V . with staining assistance from Z.P. and imaging
assistance from A.W.C.K.

86

Supplementary Figure 16. Sulf1 and spp1 expression co-localize in lizard blastema
fibroblasts. Representative sagittal sections of lizard (A. carolinensis) tails (a) 7 DPA in the
inflammatory stage and (b) 14 DPA in the blastema stage, analyzed via histology/FISH for sulf1
and spp1. (a) Spp1 expression, but not sulf1 expression, is observed in inflammatory stage
fibroblasts. (b) Sulf1 and spp1 are co-expressed in distal blastema stage fibroblasts. n = 3 tail
samples per time point. Bar = 500 µm. All panels generated by T.P.L. and A.C.V . with staining
assistance from Z.P. and imaging assistance from A.W.C.K.

87

Supplementary Figure 17. Clodronate liposome treatments deplete phagocytes and inhibits
tail regeneration in both A. carolinensis and L. lugubris lizards. (a-h) Gross morphology of (a,
b) green anole (A. carolinensis) and (e, f) mourning gecko (L. lugubris) treated with DiI and PBS
or clodronate liposomes, assessed for regenerated tail length 21 DPA. Dashed lines mark
amputation planes. (c, d, g, h) Fluorescence microscopy following Fluoroliposome
®
DiI injection,
a dye that fluoresces when engulfed by phagocytic cells[106], in 21 DPA tails from (c, d) A.
carolinensis and (g, h) L. lugubris. Bar = 1 mm. (i, j) Quantification of (i) regenerated tail length
and (j) phagocytic cell density in A. carolinensis and L. lugubris with PBS or clodronate liposome
treatment. n = 10 samples/images quantified per species and treatment for tail length and

88
phagocytic cell density. Unpaired two-way t-tests with Welch’s correction for unequal variances
were used. ****, p < 0.0001. Data are presented as mean values +/- standard deviation. All panels
generated by T.P.L. with statistics by A.C.V .

89

Supplementary Figure 18. Comparing chondrogenic abilities of tail blastema fibroblasts with
and without phagocytic cell exposure in vivo, separately, in SAG- and vehicle control-treated
recipient lizards. (a-l) Representative histological analysis of tails regenerated by (a-c, g-i) PBS
vehicle control- or (d-f, j-l) SAG-treated recipient lizards pre-injected with DiI-labeled blastema
(14 DPA) tail-derived fibroblasts from donor lizards treated with (a-f) PBS liposomes or (g-l)
clodronate liposomes and analyzed by Col2 IF and fluorescence microscopy 14 DPT/28 DPA. DiI
and Col2 signals are presented separately and together to highlight co-localization or lack thereof.
Green arrowheads mark DiI
+
cells. Bar = 50 µm. (m) Quantification of DiI-labeled cells
incorporated within Col2
+
cartilage regions 14 DPT. n = 50 cell counts measured from 5 images
among 10 different animals/tails for each condition. Two-way ANOV A with pairwise Tukey’s
adjustment for multiple comparisons was used. ****, adjusted p < 0.0001; ns, not significant
(adjusted p = 0.8478, Tukey’s). Data are presented as mean values +/- standard deviation. All
panels generated by T.P.L. and M.L.H. with statistics by A.C.V .

90

Supplementary Figure 19. Validation of bone marrow cell-derived macrophages and tail
vessel pericyte-derived septoclasts differentiated in culture. (a, b) Phagocytosis assays of (a)
bone marrow-derived macrophages and (b) tail blood vessel-derived septoclasts incubated with 0,
1 or 100 µg/mL pHrodo
™
green E. coli bioparticles. Percentages indicate quantity of phagocytic
cells. (c, g) Overlaid brightfield and green fluorescence micrographs indicating phagocytic cells
within both (c) macrophage and (g) septoclast cell cultures. (d-f, h-j) Representative fluorescence
microscopy of (d-f) macrophage and (h-j) septoclast cell cultures, analyzed by itgam/cd11b, ctsb,
and col4a1 FISH and Ctsk IF. Both macrophages and septoclasts expressed phagocyte marker
itgam/cd11b. Only macrophages expressed ctsb, while only septoclasts exhibited col4a1
expression and Ctsk
+
intracellular vesicles (arrowheads). Bar = 50 µm. n = 5 isolated macrophage
and septoclast cell pools stained each. (k, l, n, o) Flow cytometric analysis of cultures of (k, l)
macrophage and (n, o) septoclasts labeled with (l, o) anti-Ctsb and anti-Ctsk primary antibodies
with indicated fluorescent tags. (k, n) Control (k) macrophage and (n) septoclasts incubated with
isotype controls for primary antibodies with matching fluorescent tags to define quadrant gating.
Solid lines within plots denote gating boundaries. (m, p) Quantification of flow cytometry
quadrants in (l, n), respectively. n = 5 isolated macrophage and septoclast cell pools stained and
analyzed by separate flow cytometry experiments. Cell populations within quadrant are indicated
as percentages. One-way Welch’s ANOV A for unequal variances with Dunnett’s T3 multiple
comparisons tests were used. ****, adjusted p < 0.0001, compared to all other quadrants
(Dunnett’s T3). Data are presented as mean values +/- standard deviation. All panels generated by
M.L.H. and T.P.L. with statistics and revision by A.C.V .

91

Supplementary Figure 20. Septoclast cell-conditioned media does not induce amputated tail
fibroblast sulf1 expression in the absence of endogenous phagocyte populations and
Hedgehog signaling. (a) Experimental scheme for testing effects of biomolecules secreted by
macrophage and septoclast populations on FCTC marker gene expression in clodronate liposome-
treated lizard (A. carolinensis) tails. (1) Bone marrow and tail blood vessel cells are isolated and
(2) differentiated into macrophages and septoclasts in vitro, respectively. (3) Macrophage- and
septoclast-conditioned media (M-CM and S-CM) are collected, concentrated, and embedded in
alginate beads, together and separately. (4) Alginate beads are implanted into amputated tails (0
DPA) of lizards co-treated with clodronate liposomes and PBS (vehicle control for SAG
treatment). (b-q) Representative sagittal sections of lizard tails 14 DPA co-treated with PBS and
clodronate liposomes, implanted with M-CM and/or S-CM beads, and analyzed via
histology/ISH/FISH for sulf1, spp1, ctsk, ctsb, and col4a1 expression. Higher magnification
fluorescent views of indicated regions around (d, h, l, p) vertebra and (e, i, m, q) implanted bead
sites in (b, c, f, g, j, k, n, o). n = 8 lizards/samples per treatment condition. *, location of implanted
bead; ve, vertebra. Bar = 50 µm. Panel a generated by T.P.L. Panels b-q generated by T.P.L. with
cell culture by M.L.H., staining assistance by Z.P. and imaging assistance by G.A.L., S.C.H.-K,
A.W.C.K. and S.B.S and revision by A.C.V .

92

Supplementary Figure 21. Unconditioned phagocyte media does not induce sulf1, spp1 or
sox9 expression in clodronate liposome-treated tails or untreated amputated limbs. (a-d)
Representative sagittal sections of lizard (A. carolinensis) tails 14 DPA co-treated with clodronate
liposomes and (a, b) vehicle control (PBS) or (c, d) SAG, implanted with beads impregnated with
unconditioned macrophage/septoclast media, and analyzed via histology/ISH for sulf1 and spp1
expression. (e-j) Representative sagittal sections of lizard limbs 28 DPA treated with (e-g) vehicle
control or (h-j) SAG, implanted with unconditioned macrophage/septoclast media-soaked beads,
and analyzed via histology/ISH for sulf1, sox9, and spp1 expression. n = 8 lizards/samples per
treatment condition. *, location of implanted bead; tb, tibia; ve, vertebra. Bar = 50 µm. All panels
generated by T.P.L. and A.C.V . with staining assistance from Z.P. and imaging assistance from
S.B.S.

93

Supplementary Figure 22. Septoclast cell-conditioned media does not induce amputated tail
fibroblast sulf1 or sox9 expression in the absence of Hedgehog signaling. (a) Experimental
scheme for testing effects of macrophage- and septoclast-conditioned media on FCTC marker gene
expression in lizard (A. carolinensis) limbs. (1) Bone marrow and tail blood vessel cells are isolated
and (2) used to derive macrophages and septoclasts in vitro, respectively. (3) Media conditioned
by macrophages and septoclasts (M-CM and S-CM) are collected, concentrated, and embedded in
alginate beads, together and separately. (4) Alginate beads are implanted into amputated limbs of
PBS-treated (vehicle control of SAG treatment) lizards 7 DPA. (b-u) Representative sagittal
sections of lizard limbs 28 DPA treated with vehicle control, implanted with M-CM and/or S-CM
beads, and analyzed via histology/ISH/FISH for sulf1, sox9, spp1, ctsk, ctsb, and col4a1
expression. Higher magnification fluorescent views of indicated regions in (b-d, g-i, l-n, q-s)
depict indicated regions around (e, j, o, t) implanted bead and (f, k, p, u) tibia. n = 8 lizards/samples
per treatment condition. *, location of implanted bead; m (arrowhead), macrophage; o
(arrowhead), osteoclast; tb, tibia. Bar = 50 µm. Panel a generated by T.P.L. Panels b-u generated
by T.P.L. with cell culture by M.L.H., staining assistance by Z.P. and imaging assistance by G.A.L.,
S.C.H.-K., A.W.C.K., and S.B.S. and revision by A.C.V .

94

Supplementary Figure 23. Gating strategy for flow cytometry analysis in Supplementary
Figure 19. (a, b) Gating strategy for flow cytometry analysis of phagocytosis assays of (a) bone
marrow-derived macrophages (Supplementary Fig. 19a) and (b) tail blood vessel-derived
septoclasts (Supplementary Fig. 19b) incubated with pHrodo
™
green E. coli bioparticles. Cells
were single-gated from total events (black) based on forward scatter (FSC) and side scatter (SSC).
Double FSC and SSC gates (green) were used to select green-fluorescing positive cells for
analysis. (c, d) Gating strategy for flow cytometry analysis of (c) macrophage (Supplementary Fig.
19l) and (d) septoclasts (Supplementary Fig. 19o), incubated with fluorescent-conjugated primary
antibodies anti-Ctsb-Alexa Fluor
™
647 and anti-Ctsk-Alexa Fluor
™
488. Cells were single-gated
from total events (black) based on FSC and SSC. Double FSC and SSC gates (blue) were used to
select cells for analysis. Panels generated by M.L.H. and T.P.L. with revision by A.C.V .

95
SUPPLEMENTARY TABLES

Supplementary Table 1. Relative fibroblast marker gene expression throughout tail
regeneration. Relative gene expression levels of FCTC markers (assessed from ISH in Figure 2
& Supplementary Figure 5). -, no detectable expression; +, low expression; +++, high expression.
Table generated by A.C.V .

Marker
gene
Homeostatic
Fibroblasts
(0 DPA)
Injury
Fibroblasts
(7 DPA)
Blastema
Fibroblasts
(14 DPA)
Chondrocytes
(28 DPA)
cdh11 + + +++ -
col3a1 +++ +++ +++ +++
col12a1 - + +++ +++
mdk - + +++ +
pltp - - +++ +
sall1 - - +++ +
sox9 - - +++ +++
sparc - + +++ +++
spp1 - +++ +++ -
sulf1 - + +++ +
tnl - +++ +++ -

96

Supplementary Table 2. Catalog information for commercial probes critical to in situ
hybridization (ISH) and fluorescent ISH experimental outcomes. All probes were custom
designed by supplier Advanced Cell Diagnostics, Inc. to species-specific mRNA sequences for
respective genes. Table generated by A.C.V .

Reagent Catalog Number
RNAscope
™
Probe-Acar-aoah 896491
RNAscope
™
Probe-Acar-cdh11 896421
RNAscope
™
Probe-Acar-LOC100562721 (ckm) 882301
RNAscope
™
Probe-Acar-col1a1 1154551
RNAscope
™
Probe-Acar-col2a1 882331
RNAscope
™
Probe-Acar-col3a1 896371
RNAscope
™
Probe-Acar-col4a1 896381
RNAscope
™
Probe-Acar-col12a1 896401
RNAscope
™
Probe-Acar-ctsb 896341
RNAscope
™
Probe-Acar-LOC100561728 (ctsk) 882321
RNAscope
™
Probe-Acar-fabp7 896331
RNAscope
™
Probe-Acar-gli1 1181451
RNAscope
™
Probe-Acar-ifi30 896321
RNAscope
™
Probe-Acar-itgam 896501
RNAscope
™
Probe-Acar-LOC100566088 (krt5) 896481
RNAscope
™
Probe-Acar-mdk 896231
RNAscope
™
Probe-Acar-pltp 1058571
RNAscope
™
Probe-Acar-sall1 1058561
RNAscope
™
Probe-Acar-sox9 896451
RNAscope
™
Probe-Acar-sparc 896441
RNAscope
™
Probe-Acar-spp1 896251
RNAscope
™
Probe-Acar-sulf1 1058551
RNAscope
™
Probe-Acar-LOC100557189 (tenascin-like/tnl) 1058541
RNAscope
™
Probe-Acar-vwf 896201
RNAscope
™
Probe-Gj-sulf1 1123161

97

Supplementary Table 3. RT-PCR primer sequences. Forward and reverse primer sequences
utilized in RT-PCR experiments by gene. Table generated by T.P.L.

Gene Forward Primer Reverse Primer
gapdh CCATGTTTGTGATGGGTGTC CTATGGTGGTGAAGACGCCA
sulf1 GTTTGCCACGGGATTTCTGG AGCTTCCTCCATCTTTACTTCCTG
spp1 TGTGTCTTCTGACCATCGCC GGTGATGTGGGTGAGCATGA
pltp TGTTCTTCCCTTTGCGGGAG CCGAAGAACGAGGCTCTCAA
sall1 TGCATCGTCATCACCAGCTT AACTCAAGTCCTCTGCAGGC

98
CHAPTER 2: Lizard Blastema Organoid Model Recapitulates Regenerated Tail
Chondrogenesis
1

Ariel C. V onk,
2,3
Sarah C. Hasel-Kolossa,
2,†
Gabriela A. Lopez,
2,†
Megan L. Hudnall,
3
Darian J.
Gamble,
2,3
and Thomas P. Lozito
2,3

© 2022 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article
distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license
(https://creativecommons.org/licenses/by/4.0/).

1
This manuscript was submitted to and published by Journal of Developmental Biology[75] on 12/02/21 and
02/10/22, respectively. https://doi.org/10.3390/jdb10010012
2
Affiliation: Department of Stem Cell Biology and Regenerative Medicine, Keck School of Medicine, University of
Southern California, 1425 San Pablo St, Los Angeles, CA, 90033, USA
3
Affiliation: Department of Orthopaedic Surgery, Keck School of Medicine, University of Southern California,
1540 Alcazar St, Los Angeles, CA, 90033, USA
†
These authors contributed equally to this work.

99
ABSTRACT
(1) Background: Lizard tail regeneration provides a unique model of blastema-based tissue
regeneration for large-scale appendage replacement in amniotes. Green anole lizard (Anolis
carolinensis) blastemas contain fibroblastic connective tissue cells (FCTCs), which respond to
hedgehog signaling to create cartilage in vivo. However, an in vitro model of the blastema has not
previously been achieved in culture. (2) Methods: By testing two adapted tissue dissociation
protocols and two optimized media formulations, lizard tail FCTCs were pelleted in vitro and
grown in a micromass blastema organoid culture. Pellets were analyzed by histology and in situ
hybridization for FCTC and cartilage markers alongside staged original and regenerating lizard
tails. (3) Results: Using an optimized serum-free media and a trypsin- and collagenase II-based
dissociation protocol, micromass blastema organoids were formed. Organoid cultures expressed
FCTC marker CDH11 and produced cartilage in response to hedgehog signaling in vitro,
mimicking in vivo blastema and tail regeneration. (4) Conclusions: Lizard tail blastema
regeneration can be modeled in vitro using micromass organoid culture, recapitulating in vivo
FCTC marker expression patterns and chondrogenic potential.

INTRODUCTION
Lizards are the closest evolutionary relatives to mammals with the ability to perform large-
scale appendage regeneration[4,5]. As amniotes, lizards share many developmental milestones
with mammals, delineating them from traditional amphibian models of limb and tail regeneration,
such as the salamander[5,107,108]. Green anole lizards, Anolis carolinensis, share this capacity to
regenerate tails naturally through epimorphic or blastema-based regeneration[4,38,109].
Interestingly, lizards regenerate an “imperfect” copy of their tails, producing an unsegmented

100
cartilaginous tube rather than a patterned, ossified vertebra, providing a valuable model for large-
scale cartilage regeneration, an ability humans notably lack[4,5,7].
Upon amputation, anoles regenerate their tails over the course of 28 days, forming immune-
privileged blastemas, heterogenous collections of connective tissue and muscle progenitor cells in
various states of differentiation by day 14 (D14)[5,15,38,39]. Sonic hedgehog signaling (Shh)
produced by invading regenerating spinal cords activate a cartilage program in surrounding
blastema cells. Undifferentiated blastema cells begin to express Sox9 and differentiate into
chondrocytes. As regeneration continues, collagen type 2 alpha chain 1
+
(Col2a1
+
) cartilage tubes
form surrounding spinal cords as tails elongate. Meanwhile, other blastema cells differentiate into
muscle, fat, blood vessel, dermis, and other key tissue types in regenerated tails[4,8,10,38,110].
Treatment with exogenous Shh agonist (SAG) in vivo results in ectopic cartilage formation in
blastemas, demonstrating the capacity for most, if not all, blastema cells to take on a cartilage
program[7].
While lizard tail cartilage has been well studied in a number of species[8,109,111–113],
the specific cell populations that give rise to blastema cells with chondrogenic potential have yet
to be isolated. In the past, intervertebral disc, periosteum and other connective tissues have all been
studied as potential sources of regenerated lizard tail cartilage[7,8,10,109,111]. Furthermore, clues
from salamander studies may aid in identification of blastema cell populations responsible for
cartilage formation in regenerate lizard tails. Axolotl limb blastema cells express paired related
homeobox 1, PRRX1, a pan-fibroblastic connective tissue cell (FCTC) marker and exhibit
molecular funneling towards a common dedifferentiated state during blastema formation. Over the
course of regeneration, these cells then re-differentiate into cartilage, skeleton, periskeletal cells,
and regenerated fibroblastic connective tissues[18,28]. We hypothesize that similar cell types and

101
biological processes regulate lizard tail blastema formation and differentiation. To follow lizard
tissue tail differentiation, we have developed an in vitro system where growth conditions can be
controlled and monitored.
Micromass and organoid cultures allow for in vitro modeling of in vivo cellular processes.
Micromass culture, which involves high density cell seeding and aggregation, has been effectively
utilized with various species and cell types to explore chondrogenic potential and in vitro models
of cartilage development[114–119]. Here, we have developed a novel lizard blastema organoid
micromass culture system through the optimization of enzymatic digestion and culture conditions.
Lizard blastema stem cell isolation and growth were tested by using two combinations of
enzymatic digestion buffers and two culture media formulations previously reported as pro-
chondrogenic. Lizard blastema organoids were tested for their expression of FCTC markers and
for their chondrogenic potential in response to hedgehog stimulation.

RESULTS
Fibroblastic Connective Tissue Cells Express CDH11 in Lizard Blastema
We sought to identify fibroblastic connective tissue cells (FCTCs) in lizard tail blastemas,
similar to PRRX1
+
FCTCs in salamander limb[18]. Connective tissues in original tails (D0)
exhibited CDH11 expression via histology/RNAscope in situ hybridization in epidermis and
periosteum (Figure 1A–A’’) compared to bacterial gene DapB probe negative control (Figure S1A–
A’). During D14 blastema stages, CDH11 expression specifically marked blastema cells (Figure
1B, B’), while differentiated muscle bundles within blastemas exhibited markedly lower CDH11
expression (Figure 1B’’). Low residual CDH11 expression within regenerating muscle is expected
due to mesenchymal muscle stem cell signature within the regenerating bundles[120]. Upon tail

102
regrowth (D28), CDH11
+
FCTCs again localized to the epidermis and perichondrium of
regenerated tails (Figure 1C–C’’). Taken together, these results indicate that CDH11
+
cells exist in
original tail connective tissues and form the majority of blastema tissue during tail regrowth. After
regeneration is completed, CDH11 expression is again restricted to differentiated connective
tissues, mimicking original tail expression patterns.

CDH11
+
Blastema Cell Culture System Optimization
Next, we aimed to develop culture conditions for in vitro micromass blastema organoids.
Given the abundance of CDH11
+
cells detected in periosteum described above, we adapted a
protocol from embryonic mouse coronal suture cell dissociations[97] involving 4 units/mL
Dispase and 3 mg/mL collagenase II, herein the Dispase protocol. Additionally, we adapted a
protocol from chick limb bud cell dissociations, often comparable to the lizard tail bud in
developmental studies[116], containing 1 mg/mL trypsin and 1 mg/mL collagenase II, herein the
Trypsin protocol.
Original lizard tails were isolated and dissociated by utilizing either Dispase or Trypsin
protocols and pelleted via centrifugation in V-bottom plates. Culture media for traditional
mammalian serum-free chondrogenic media were tested[121], herein mammalian media,
containing 0.1 µM dexamethasone, 40 µg/mL proline, 10 µg/mL ITS+, 50 µg/mL ascorbic acid,
100 units/mL penicillin, 100 µg/mL streptomycin and 250 ng/mL fungizone antimycotic in
DMEM/Ham’s F12 with 1 mM Glutamax. Additionally, culture media for chick limb bud
micromass culture were tested[116], herein avian media, containing 10% FBS, 1% glucose, 1.1
mM CaCl2, 2.5 mM β-glycerophosphate, 50 µg/mL ascorbic acid, 100 units/mL penicillin and 100
µg/mL streptomycin in DMEM/Ham’s F12 with 1 mM Glutamax. Both culture media were

103
supplemented with 1 nM smoothened agonist (SAG) to mimic Shh signals received from
regenerating spinal cords in blastemas during in vivo lizard tail regeneration.
After 5 weeks in culture to mimic full tail regeneration, pellets were fixed, sectioned, and
analyzed via RNAscope in situ hybridization and histology. Cells isolated via the Dispase protocol
did not form one solid pellet in mammalian media culture, instead forming several smaller pellets
that lined plate wells (Figure 2A). All other conditions yielded single pellets (Figure 2B–D). Cells
isolated via the Dispase protocol and cultured in mammalian media also did not show uniform
expression of CDH11 (Figure 2A, A’) compared to bacterial gene DapB probe negative control
(Figure S1B, B’), in contrast to the other conditions that yielded pellets with more uniform CDH11
expression of cells not obscured by pigmented cells (Figure 2B–D’). Cells isolated via the Trypsin
protocol and cultured in mammalian media (Figure 2C, C’) showed the highest and most uniform
CDH11
+
cells in culture and, therefore, recapitulated in vivo blastema most accurately in terms
CDH11 expression patterns.

Sox9 Expression in Wild-Type and SAG-Treated Blastema
During natural lizard tail regeneration, regenerated spinal cords invade blastemas,
supplying Shh signals to blastema cells. Hedgehog stimulation primes surrounding blastema cells
to activate a Sox9
+
chondrogenic program, resulting in blastema cell differentiation into
chondrocytes. Original tail tissues (Figure 3A, A’) and blastema cells lateral to regenerating spinal
cords (Figure 3A’’’) do not receive and respond to endogenous Shh signaling due to their distance
from the spinal cord. In contrast, blastema cells medial to the regenerating spinal cord (Figure
3A’’) do receive Shh signals and express high levels of Sox9, signaling the activation of
chondrogenic programming.

104
Lizards were systemically treated with hedgehog agonist SAG (Figure 3B). When treated
with exogenous SAG in vivo, original tail FCTCs remained unaffected by Shh signaling and did
not show Sox9
+
activation (Figure 3B’). SAG treatment causes blastema cells both lateral (Figure
3B’’) and medial (Figure 3B’’’) to regenerating spinal cords to express high levels of Sox9. Thus,
exogenous Shh signaling can activate Sox9
+
chondrogenic programming in blastema FCTCs
regardless of location, while original FCTCs remain unaffected by additional signals. These results
indicate fundamental differences in chondrogenic potential between CDH11
+
blastema cells and
original tail FCTCs.

Micromass Blastema Organoid Cultures Mimic Regenerating Tail Cartilage Formation
Lizards treated with SAG-regenerate tails exhibit ectopic cartilage regions (Figure 4A)
made up of Col2a1
+
chondrocytes (Figure 4A’). In culture, cells isolated via Dispase and Trypsin
protocols recapitulated this phenomenon when cultured in mammalian media, forming Col2a1
+

cartilage in vitro (Figure 4B, C). The same cells exhibited low Col2a1 expression in avian media
and did not appear to form fully differentiated cartilage (Figure 4D, E).
Combined with observations of pellet morphology and CDH11 expression (Figure 2), these
results suggest that the Trypsin protocol combined with mammalian media produced the most
accurate recapitulation of regenerate lizard tail cartilage formation in vitro. Cells isolated via the
Dispase protocol cultured in mammalian media did not form a single pellet in culture and, thus,
do not mimic blastema cell masses in vitro, while Dispase cells cultured in avian media did not
display uniform CDH11 expression. Cells isolated via the Trypsin protocol and cultured in
mammalian media formed single cell pellets in vitro with uniform CDH11 expression, modeling

105
the D14 blastema, and formed fully differentiated Col2a1
+
cartilage over the same time period of
regeneration as in vivo lizard tails.

DISCUSSION
This study demonstrates the chondrogenic potential of lizard tail FCTCs using a novel
organoid model of lizard tail blastema development. Organoid models have emerged as important
techniques for reducing complicated biological processes to their most vital cell populations for
study in vitro [119]. In doing so, organoid models facilitate the interrogation of simulated tissue
homeostasis or pathologies with drug and genetic treatments that would be impossible in vivo.
However, new organoid models must first be validated to ensure they faithfully recreate known
biological process before they can be confidently used to interrogate new phenomena. Here, we
confirmed our micromass lizard blastema organoids form cartilage in response to the same signals
regulating regenerated tail chondrogenesis in vivo. We have previously defined the lizard blastema
cell state as one that undergoes chondrogenesis in response to hedgehog signaling[7,10,22,80].
Here, we validated that organoids formed from tail FCTC populations formed new cartilage in
response to hedgehog signaling.
Prior to this study, the cellular identities contributing to chondrogenic blastema cells were
unknown. Here, we identified CDH11 as an effective marker for lizard FCTC populations that
contribute to tail blastemas, and this study adds to the growing body of literature supporting FCTCs
as a (the) main contributor of appendage blastemas[18,19,28]. For example, PRRX1
+
salamander
limb FCTCs contribute to blastemas during salamander limb regrowth[18]. Cre-based lineage
tracing experiments suggested that PRRX1
+
FCTCs from multiple mesodermal tissues de-
differentiated into a common blastema cell state before re-differentiating into new limb tissues,

106
including cartilage. The lizard PRRX1 gene remains poorly annotated, but CDH11 was identified
as an acceptable substitute for identifying FCTC populations. The histology/ISH results presented
indicate that nearly all non-muscle blastema cells highly express CDH11, including those that
condense to form the regenerated tail cartilaginous skeleton. Taken together, these results
suggested that chondrogenic blastema cells are derived from CDH11
+
resident FCTC populations.
Ideally, transgenic tissue-specific reporter lines would be used to trace the differentiation
fates of CDH11
+
lizard FCTC cells though blastema formation and tail regeneration. However, the
realities of reptile reproduction, including late-developmental stage oviposition, make transgenic
lizard generation much more difficult than salamander genetic engineering, and the feasibility of
lizard gene reporter line establishment remains prohibitively difficult for basic research[122]. To
overcome these challenges, we employed selection by different enzymatic digestions and culture
system to select for CDH11
+
cells to demonstrate their chondrogenic capabilities in vitro.
Specifically, we found that digestion by trypsin and collagenase II enzymes and culture under
serum-free conditions selected for CDH11
+
FCTCs. These cells underwent chondrogenesis in
response to hedgehog stimulation, fulfilling our definition of lizard blastema cells. However,
further work is needed to determine the exact mechanisms by which hedgehog stimulations result
in cartilage formation. For example, does hedgehog stimulation result in increased cartilage
formation through differentiation of uncommitted FCTCs or proliferation of specific FCTC
populations pre-biased towards chondrogenesis? Additionally, further work is needed to confirm
if CDH11
+
FCTCs are the only cell populations responding to hedgehog signaling during
regeneration, given the known response of mesenchymal stem cells and lizard satellite cells to
activate chondrogenic programming in response to exogenous Shh[123,124].

107
This study also uncovered potential differences between lizard tail and salamander limb
blastema cell derivation. As previously mentioned, recent studies with salamander limb
regeneration show a cellular funneling of FCTCs to a more stem-like state during the salamander
limb blastema derivation process before differentiating into cartilage[18]. However, our results
suggest that lizard FCTCs do not have to proceed through the blastema cell process to form
cartilage. Instead, FCTCs isolated directly from original tails form cartilage in response to
hedgehog stimulation, bypassing the blastema cell stage. However, our results do suggest
differences in chondrogenic potential between FCTCs within original tail tissues and blastemas.
We show that, when lizards are systemically stimulated with hedgehog agonist SAG, only blastema
FCTCs undergo chondrogenesis. No cartilage formation is detected in FCTC populations within
original tail portions. Thus, instead of the reprogramming that takes place during salamander limb
blastema formation, we now hypothesize that mechanisms exist within original tail tissues that
suppress hedgehog-induced chondrogenesis in resident lizard FCTC populations. Given the
importance of hedgehog signaling in mammalian skeletal and limb development[125], repressive
molecular mechanisms may keep FCTCs in an adult state, where liberating these cells result in a
developmental signature that allows for response to hedgehog signals, resulting in the activation
chondrogenic programming. During blastema formation in vivo or micromass organoid culture in
vitro, FCTCs are freed from their niches and their inhibitors and allowed to condense and form
cartilage following hedgehog stimulation. Future studies will investigate these novel topics by
studying and comparing the epigenetic states of FCTCs within original tails and blastemas.
Furthermore, we will study the role of cell–cell contacts in FCTC condensation and
chondrogenesis in vivo and in vitro, allowing for better understanding of cartilaginous and skeletal
development in all organisms with developmental hedgehog signaling.

108
In summary, this manuscript has established an organoid model of regenerated lizard tail
blastema formation and chondrogenesis. The dependency of the model on different selection
method through different enzymatic digestions are presented, revealing different isolated cell
populations. Similarly, the effects on culture media conditions were tested. In the end, only
isolation and culture conditions that resulted in a high number of CDH11
+
FCTCs resulted in
organoid models capable of undergoing chondrogenesis in response to hedgehog stimulation.
These results point to the FCTC origin of lizard blastema cells and has laid the foundation for
future assessments of the effect of starting cell populations on cartilage phenotype outcomes. For
example, we have previously known that there are two distinct zones of regenerated lizard tail
cartilage, each with distinct cell sources and developmental trajectories. Proximal lizard tail
cartilage is directly derived from periosteal cells and undergoes hypertrophy and endochondral
ossification, similarly to mammalian cartilage fracture calluses. Distal regenerated lizard tail
cartilage forms from blastema cells and resist hypertrophy and ossification. Both proximal and
distal cartilage regions form in response to hedgehog signaling[7]. Since we have shown here that
periosteal cells, blastema cells, and organoid cells are CDH11-positive, it is currently unclear
whether the cartilage formed in organoid model is representative of distal or proximal cartilage or
both. Future work will be aimed at co-staining and testing under hypertrophy conditions [126] to
see if they can undergo cartilage hypertrophy and terminal differentiation.

MATERIALS AND METHODS
Lizard Maintenance and Handling
Wild adult green anole lizards (Anolis carolinensis, Carolina Biological Supply Company,
Burlington, NC, USA; LLL Reptile, Chandler, AZ, USA) were maintained 25.5 °C with 65%

109
humidity on a 12 h light: 12 h dark schedule with 12 h of 50 W basking heat lamp and UVB lamp
(Zoo Med, San Luis, Obispo, CA, USA) treatment during light hours. Care and experimental use
of animals was conducted in accordance with USC Institutional Animal Care and Use Committee
(IACUC) approved protocol #20992.

SAG Injections
Lizards were injected with 20 µg Smoothened Agonist HCl (SAG) (Selleck Chem,
Houston, TX, USA) per gram anole body weight every other day, beginning on the first day of
amputation day and continuing until tail collection.

Lizard Tail Amputations and Dissociation Protocols
Lizard tails were amputated to begin regeneration and collected in Hank’s balanced salt
solution (HBSS) (ThermoFisher, Waltham, MA, USA) supplemented with 100 units/mL penicillin
and 100 µg/mL streptomycin (Sigma, St. Louis, MO, USA) (HBSS with P/S) at day 0 (D0), day
14 (D14) or day 28 (D28) time points for histology and cell dissociation. Original D0 tails were
triple washed with Betadine (Henry Schein, Melville, NY , USA) followed by triple rinses of tap
water and HBSS with P/S. Tails were incubated for 45 min with agitation in HBSS with P/S and
0.1% ethylenediaminetetraacetic acid (EDTA) (ThermoFisher, Waltham, MA, USA). The
epidermis was removed with forceps and discarded. The remaining tissues were minced in HBSS
with P/S.
Two dissociation protocols were optimized. The first, herein the Trypsin protocol, was
adapted from the Mello and Tuan 1999 embryonic chick limb bud cell isolation protocol[116].
Trypsin protocol dissociation solution was formulated with 1 mg/mL collagenase II (Worthington

110
Biochemicals, Lakewood, NJ, USA) and 1 mg/mL Trypsin (Gibco ThermoFisher, Waltham, MA,
USA) in HBSS with P/S and filtered with a 0.22 µM Steriflip filter (MilliporeSigma, Burlington,
MA, USA). Minced tail pieces were added to solution and incubated at 37 °C for 45 min with
agitation and manual pipetting every 15 min. Dissociation was stopped with FBS (Gibco
ThermoFisher, Waltham, MA, USA).
The second dissociation protocol, herein the Dispase protocol, was adapted from Farmer
et al., 2021[97] coronal suture dissociations. Dispase protocol dissociation solution was formulated
with 3 mg/mL collagenase II and 4 units/mL Dispase (Corning, Corning, NY , USA) in HBSS with
P/S. Minced tail pieces were added to the solution and incubated at 37 °C for 45 min with agitation
and manual pipetting every 15 min. Dissociation was stopped with 30% FBS and 6 mM CaCl2
(Sigma, St. Louis, MO, USA) in 1× Phosphate-buffered saline (PBS) (Gibco ThermoFisher,
Waltham, MA, USA).
Following dissociation in both protocols, cells were filtered with 40 µM basket filters
(Corning, Corning, NY , USA) and plated in 96 well V-bottom plates (Corning, Corning, NY , USA)
with 1 million cells per well. Cells were pelleted via centrifugation at 500× g for 10 min.

Cell Culture
Cell pellets were maintained in either mammalian media or avian media for 5 weeks.
Mammalian media[121] were formulated with 0.1 µM dexamethasone (Sigma, St. Louis, MO,
USA), 40 µg/mL proline (Sigma, St. Louis, MO, USA), 10 µg/mL ITS+ (Life Technologies
ThermoFisher, Waltham, MA, USA), 50 µg/mL ascorbic acid (Sigma, St. Louis, MO, USA), 100
units/mL penicillin, 100 µg/mL streptomycin, and 250 ng/mL fungizone antimycotic (Life
Technologies ThermoFisher, Waltham, MA, USA) in Dulbecco’s Modified Eagle Media

111
(DMEM)/Ham’s F12 with 1× Glutamax (Gibco ThermoFisher, Waltham, MA, USA). Avian media
[20] were formulated with 10% FBS, 1% glucose (Sigma, St. Louis, MO, USA), 1.1 mM CaCl2,
2.5 mM beta-glycerophosphate (Sigma, St. Louis, MO, USA), 50 µg/mL ascorbic acid (Sigma, St.
Louis, MO, USA), 100 units/mL penicillin and 100 µg/ mL streptomycin (Life Technologies
ThermoFisher, Waltham, MA, USA) in DMEM/Ham’s F12 with 1× Glutamax. Both mammalian
and avian media conditions were supplemented with 1 nM SAG. Media were changed every other
day.

Histology
Lizard tails were collected, fixed overnight in 4% paraformaldehyde (PFA) (Electron
Microscopy Sciences, Hatfield, PA, USA) and then decalcified for 1 week in Osteosoft (Sigma,
St. Louis, MO, USA). Tails underwent a sucrose (Sigma, St. Louis, MO, USA) gradient and were
frozen in Optimal Cutting Temperature Compound (OCT) (Fisher Scientific, Hampton, NH, USA).
Tail cryoblocks were sectioned at 16 µM thickness.
Cell pellets were fixed in V-bottom plates for 30 min in 4% PFA. Pellets underwent a
sucrose gradient and were frozen in OCT. Pellet cryoblocks were sectioned at 10 µM thickness.

In Situ Hybridization (ISH)
ISH was performed using the RNAscope 2.5 HD Detection Kit (RED) and proprietary ISH
probes (Advanced Cell Diagnostics, Newark, CA, USA)[127]. Samples were baked for 1 h at 60
°C, rinsed in 1× PBS and post-fixed in 4% PFA at 4 °C for 15 min. Slides were dehydrated in an
ethanol (VWR, Visalia, CA, USA) gradient and allowed to dry for 5 min. Samples were incubated
in hydrogen peroxide for 10 min and then allowed to dry before outlining with PAP pen (Vector

112
Laboratories, Burlingame, CA, USA). Slides were incubated in protease solution at 40 °C for 30
min. Then, slides were hybridized with ISH CDH11 (fibroblastic connective tissue), Sox9
(cartilage program), Col2a1 (cartilage) or negative control bacteria DapB probes at 40 °C for 2 h.
The probe signal was amplified with 4 proprietary amplification reagents at 40 °C for 1.5 h and
another 2 amplification reagents at room temperature for 45 min. The signal was detected with
FAST RED solution (1:60 FAST RED B:FAST RED A solution) for 10 min at room temperature,
revealing puncta in red for analysis. Slides were counterstained with 50% Gill’s I hematoxylin
(StatLab, McKinney, TX, USA) and 0.02% Ammonium Hydroxide (Sigma, St. Louis, MO, USA).
Slides were mounted in xylene (VWR, Visalia, CA, USA) and EcoMount (Biocare, Pacheco, CA,
USA). Slides were imaged on a Keyence BX800 microscope (Keyence, Itasca, IL, USA) in
brightfield.

Author Contributions
Conceptualization, A.C.V . and T.P.L.; methodology, A.C.V . and T.P.L.; validation, A.C.V .,
S.C.H.-K., G.A.L., M.L.H. and D.J.G.; formal analysis, A.C.V . and T.P.L.; investigation, A.C.V .;
resources, A.C.V ., M.L.H. and D.J.G.; data curation, A.C.V ., S.C.H.-K. and G.A.L.; writing—
original draft preparation, A.C.V . and T.P.L.; writing—review and editing, A.C.V . and T.P.L.;
visualization, A.C.V . and T.P.L.; supervision, M.L.H. and T.P.L.; project administration, A.C.V .;
funding acquisition, T.P.L. All authors have read and agreed to the published version of the
manuscript.

113
FIGURES

Figure 1. CDH11
+
cells in original and regenerating lizard tails. (A) Original tail (D0), (B)
blastema (D14) and (C) regenerated tail (D28) analyzed by histology/in situ hybridization for
CDH11 expression. (A’, A’’) Higher magnification views of original tail regions identified in Panel
A highlighting CDH11 expression in (A’) epidermis (green arrowheads) and (A’’) periosteum
(green arrowheads). (B’, B’’) Higher magnification views of tail blastema regions identified in
Panel B contrasting (B’) high CDH11 expression in blastema connective tissue and (B’’) low
expression in blastema muscle bundles. (C’, C’’) Higher magnification views of regenerated tail
regions identified in Panel C including (C’) regenerated epidermis (green arrowheads) and (C’’)
perichondrium (green arrowheads). (A, B, C) Scale bar = 500 µM. (A’-C’’) Scale bar = 50 µM. bl
– blastema, ct – cartilage tube, om – original muscle, rm – regenerated muscle, rsc – regenerated
spinal cord, sc -spinal cord, v – vertebrae. All panels generated by A.C.V . with revision by T.P.L.

114

Figure 2. CDH11 expression in micromass blastema organoid cultures. Cell pellets derived
from Dispase dissociation protocol (A-B’) or Trypsin Dissociation protocol (C-D’) and cultured
in (A, A’, C, C’) Mammalian Media or (B, B’, D, D’) Avian Media were analyzed by histology/in
situ hybridization for CDH11 expression. (A’, B’, C’, D’) Higher magnification of pellet in Panels
A, B, C, and D, respectively. Cells with notable lack of CDH11 are highlighted (green arrowheads).
(A, B, C, D) Scale bar = 200 µM. (A’, B’, C’, D’) Scale bar = 50 µM. All panels by A.C.V .

115

Figure 3. Sox9 expression in control and SAG-treated blastema tails. (A) Control and (B)
SAG-treated blastemas (D14) analyzed by histology/in situ hybridization for Sox9 expression (A’-
A’’’) Higher magnification of regions identified in Panel A highlighting (A’) original tail FCTCs,
(A’’) blastema FCTCs medial to regenerated spinal cord and (A’’’) blastema FCTCs lateral to the
regenerating spinal cord. (B’-B’’’) Higher magnification of regions marked in Panel B showing
(B’) original tail FCTCs, (B’’) medial and (B’’’) lateral blastema FCTCs in respect to the
regenerating spinal cord. (A, B) Scale bar = 500 µM. (A’-A’’’, B’-B’’’) Scale bar = 50 µM. All
panels by A.C.V . with imaging assistance from G.A.L. and S.C.H.-K.

116

Figure 4. Micromass blastema organoid cultures mimic lizard tail regenerate cartilage
formation in optimized dissociation protocol and media. (A) SAG-treated regenerated lizard
tail (D28) analyzed via histology/in situ hybridization for Col2a1 expression. (A’) Higher
magnification of region identified in Panel A highlighting Col2a1
+
ectopic cartilage region. (B-E)
Col2a1 expression in cell pellets dissociated using (B, D) Dispase protocol or (C, E) Trypsin
protocol, cultured in (B, C) Mammalian Media or (D, E) Avian Media, and analyzed via
histology/in situ hybridization for Col2a1 expression. (A) Scale bar = 500 µM (A’, B-E) Scale bar
= 50 µM. All panels by A.C.V . with imaging assistance from G.A.L. and S.C.H.-K.

117
SUPPLEMENTARY FIGURES

Supplementary Figure 1. RNAscope negative control in lizard blastema and cell pellets. (A)
Control lizard tail blastema (D14) analyzed by in situ hybridization for bacterial DapB expression.
(A’) Higher magnification view of blastema cell region identified in Panel A demonstrating lack
of DapB expression in blastema cells. (B) Control cell pellet isolated via Trypsin protocol cultured
in mammalian media analyzed by in situ hybridization for bacterial DapB expression. (B’) Higher
magnification views of cell pellet identified in Panel B demonstrating lack of DapB expression in
cultured cells. (A) Scale bar = 500 μM. (B) Scale bar = 200 μM. (A’,B’) Scale bar = 50 μM. All
panels by A.C.V .

118
CONCLUSION
Lizards represent an important intermediate model organism between mammals and
amphibians for appendage regeneration. While hyper-regenerative salamanders can regrow
identical limbs and tails upon appendage loss, they lack developmental similarities to mammals
and remain in a juvenile state of neoteny throughout their life[2,88,89]. Lizards, as amniotes, are
the closest known relative of mammals capable of multi-tissue epimorphic appendage regeneration
as adults. Since they regrow tails, but not limbs, lizards can serve as their own experimental control
when testing treatments for appendage regeneration. They also regenerate large swaths of cartilage
in place of an ossified vertebrae when regrowing tails[3,4,23,25,38,89], a tissue that humans
struggle to repair or regenerate in any context. Thus, research into the prevention of ossification
of regenerated tail skeletal elements could reveal important clues for improving cartilage injury
outcomes in humans. The goal of this research was to determine what cell types and pathways
were responsible for lizard tail blastema formation and cartilage formation, as well as to create a
simplified model of this process in vitro.

Single-cell RNA sequencing analysis identifies FCTCs as lizard blastema stem cell and source
of cartilage skeleton
This study presented the first scRNAseq dataset in the regenerating lizard tail and
investigated and characterized the heterogeneity of the lizard blastema cell populations. The results
depict FCTCs as the main contributor to the blastema, aligning with classical and modern
sequencing analysis of axolotl limb blastema[18–21,28,29]. Characterization of FCTCs
throughout the course of tail regeneration via ISH and scRNAseq analysis, lizards FCTCs revealed
a sequential gain of signature marker genes. All FCTCs basally expressed col3a1 and cdh11, then

119
gained spp1, as well as mdk, sparc and col12a in response to amputation injury. Only tail blastema
FCTCs gained sulf1, pltp and sall1 expression during blastema formation and those marked with
sulf1 expression were specifically able to respond Hh signaling and activate chondrogenic
programming.
This hierarchal addition of signature FCTC markers in lizard deviates from axolotl studies,
where blastema FCTCs revert to a more embryonic and development-like cell signature before
redifferentiating into terminal limb tissues[18,28]. Lizard blastema FCTCs appear to undergo a
distinct cell signature, differing from that of original tail bud development. Considering the
regenerated lizard tail is not an exact copy of the original may account for how different genes can
be activated to create a functional, but distinctly different tail replacement. Further comparison of
transcriptome and epigenetic signatures of the regenerating lizard tail and embryonic tail bud cells,
side-by-side with axolotl analogs, could reveal the distinct transcription factors, pathways and
chromatin accessibility preventing regenerating lizard tails from forming patterned, ossified
vertebrae.

Sulf1-expressing FCTCs respond to Hh signals and form cartilage during tail regrowth
Comparing the nonregenerative limb and regenerating tail with SAG treatment for Hh
signaling, sulf1 was identified as a blastema specific marker for FCTCs capable of responding to
Hh stimulation. Using parthenogenetic L. lugubris FCTC cell transplantation experiments in lieu
of traditional lineage tracing[22,81], which is currently impossible in lizard models, sulf1 emerged
as a marker for FCTCs capable of forming cartilage in the regenerating tail. Sulf1
+
FCTCs derived
from the tail blastema were able to incorporate into Col2a1 cartilage elements in vivo, but sulf1
-
fibroblasts derived from lizard limb amputation sites could not, despite presence of Sulf1 signals

120
from the endogenous recipient blastema FCTCs. These results suggest sulf1 alone is not sufficient
for FCTCs to respond to Hh signaling and that inherent cell state changes, such as epigenetic
reprogramming, is first required to allow FCTCs to respond to Hh signals and initiate
chondrogenesis. Comparative single nuclear ATAC sequencing of FCTCs from limb and tail may
reveal changes in chromatin accessibility of Hh response elements and binding motifs required for
regeneration. Factors released by septoclasts appear to be sufficient to generate the required
changes in FCTC cell state to initiate sulf1-expression, rescue regeneration and initiate
chondrogenesis, even in the non-regenerative lizard limb.

Septoclasts provide critical signals for blastema derivation and chondrogenesis
Our results identified septoclasts, phagocytic cells sharing pericytic cell signatures[86], as
key cells in producing factors required for blastema formation, Hh responsiveness in FCTCs and
chondrogenesis. Considering conditioned media from septoclasts cultures were sufficient for
restoring regeneration and chondrogenesis in lizard limbs, septoclasts alone do not appear to be
responsible for this rescue, but rather the factors and signals secreted by septoclasts. ScRNAseq
data for septoclasts was compared to osteoclasts and macrophage clusters and analyzed for
pathway activation. Septoclasts specifically upregulated Gp6 and IL-4 signaling pathways related
to inflammatory response while macrophages and osteoclasts did not. Gp6 serves as a signaling
receptor for many collagen factors, which are highly expressed in the lizard septoclast cluster,
leading to platelet activation via downstream AKT/PI3K activation[128,129].
Platelets have been shown to play a role in inflammation through secretion of chemokines
and cytokines, as well as through the recruitment of leukocytes including neutrophils and
lymphocytes. Notably, when studied in atherosclerosis models, platelet accumulation was

121
associated with IL-1 signaling, resulting in anti-inflammatory effects[129,130], which may play a
role in prevention of scar formation and fibrosis in the blastema. Platelets have been shown to
express high levels of Cxcl4, which has been shown to interact with other heparin-binding proteins
[129]. Considering Sulf1 enzymatic activity modulates heparin-sulfate proteoglycans[70,72,84],
there could be direct interaction between platelet-activated Cxcl4 and Sulf1 activity in the
blastema.
IL-4 signaling has long been studied in the context of B and T cell activation for adaptive
immunity but has recently gained traction in literature for cytokine signaling capacity[131]. IL-4
as a cytokine activates the JAK/STAT signaling pathway, resulting in upregulated STAT6, a
transcription factor known for induction of T helper type II cell differentiation and B cell isotype
switching[132]. High levels of STAT6 have also been shown to induce M2 macrophage
differentiation, preventing inflammation and supporting a proliferative environment in cancer
niches with anti-apoptotic features[133]. Il-4 and Stat6 upregulation in the blastema could provide
the signals needed to prevent inflammation, apoptotic signals and fibrosis during the blastema
stage, as well as favor M2 macrophages[16], further supporting regeneration rather than scar
formation. Expansive proliferation of fibroblasts and lack of inflammation is critical for blastema
formation and tail regeneration, so septoclast-induced JAK/STAT activation via IL-4 signaling
may provide the factors to make support the unique niche required for epimorphic tail regrowth.
Future studies of immune response and cytokine signaling in the blastema via septoclasts will
focus on the direct molecular mechanisms responsible for creating this supportive environment.
Further, mass spectrometry analysis of septoclast- and macrophage-conditioned media
individually could identify specific signals responsible for each step of tail regeneration through
inflammatory and blastema stages.

122

FCTC characterization allowed for development of in vitro blastema model of chondrogensis
Identification of FCTC marker genes allowed for the generation of a novel in vitro model
of the blastema. Through isolation of primary original tail FCTCs, enzymatic and physical cell
dissociation protocols and recipe media were optimized to model blastema and tail
chondrogenesis, allowing for simplified assessment of drug treatments and signaling modulators
in vitro. Cdh11 was used to assess percent FCTC composition of pellet models, as well as
morphology and chondrogenic potential in response to Hh agonist SAG treatment, revealing
trypsin and collagenase II dissociation with serum-free culture media as the best conditions for
isolating and culturing blastema organoids.
Due to cell availability and high cell requirements for pellets, blastema organoids were
modeled using original tail FCTCs rather than those derived from blastema or regenerated tails.
Despite these cells never undergoing blastema formation, they still were able to respond to Hh
signals from SAG treatment and form cartilage over the same timeline as in vivo counterparts.
Epigenetic changes resulting in the liberation of original tail FCTCs from their niche could explain
their ability to enter chondrogenic programming. ATAC sequencing of original tail compared to
liberated single-cell suspensions of original tail FCTCs could determine the epigenetic effect of
dissociation on FCTC chromatin accessibility and subsequent chondrogenic potential through
exposure of gli Hh response elements in sulf1 and sox9[100,101].
Further assessment and characterization of this model would increase its robustness and
scientific rigor. Time course analysis of key FCTC markers, identified later in scRNAseq analysis,
such as col3a1, spp1, sulf1, pltp, etc., aligning with tail regeneration developmental stages, as well
as treatment conditions with and without Hh stimulation, could determine if the model mimics tail

123
regeneration gene expression profiles on a similar time scale as in vivo counterparts. Testing
blastema and regenerated tail FCTCs may also reveal differences in fibroblast state during and
following the regeneration process. Optimization of dissociation and pelleting protocols will be
required to reduce debris, preventing cell contact in culture, and decreasing required cell numbers
needed for forming blastema models and maintaining successful cultures.

In summary, lizards are an invaluable, but underutilized, model of regeneration, with
applicability in both cartilage and appendage regeneration. Despite mammalian models of
appendage regeneration, like rodent digit-tip[33,34], lizards demonstrate epimorphic regeneration
without lineage restriction and skeleton ossification. These studies reveal the major identity of
lizard tail blastema cells as fibroblastic connective tissue cells that are transcriptionally distinct
from tail bud cells in development, contrasting axolotl blastema FCTCs[18–21,28,29]. These
lizard fibroblasts respond to signals from phagocytic septoclasts and can respond to Hedgehog
signaling. These cells then can form cartilage during tail regeneration that does not undergo
hypertrophy or ossify. This process can be modeled using a fibroblast pellet blastema organoid in
vitro, for use in drug and signaling treatments and assessment of chondrogenic potential. Using
this knowledge translationally, improvements on patient wound healing, prevention of fibrosis and
improvement of cartilage regeneration could be applied.

124
REFERENCES
1. Ziegler-Graham, K.; MacKenzie, E.J.; Ephraim, P.L.; Travison, T.G.; Brookmeyer, R.
Estimating the Prevalence of Limb Loss in the United States: 2005 to 2050. Archives of
Physical Medicine and Rehabilitation 2008, 89, 422–429, doi:10.1016/j.apmr.2007.11.005.

2. Haas, B.J.; Whited, J.L. Advances in Decoding Axolotl Limb Regeneration. Trends Genet
2017, 33, 553–565, doi:10.1016/j.tig.2017.05.006.

3. Simpson, S.B. Studies on Regeneration of the Lizard’s Tail. Am Zool 1970, 10, 157–165,
doi:10.1093/icb/10.2.157.

4. Londono, R.; Sun, A.X.; Tuan, R.S.; Lozito, T.P. TISSUE REPAIR AND EPIMORPHIC
REGENERATION: AN OVERVIEW. Curr Pathobiol Rep 2018, 6, 61–69,
doi:10.1007/s40139-018-0161-2.

5. Lozito, T.P.; Tuan, R.S. Lizard Tail Regeneration As An Instructive Model of Enhanced
Healing Capabilities In An Adult Amniote. Connect Tissue Res 2017, 58, 145–154,
doi:10.1080/03008207.2016.1215444.

6. Wynn, T. Cellular and Molecular Mechanisms of Fibrosis. The Journal of Pathology 2008,
214, 199–210, doi:10.1002/path.2277.

7. Lozito, T.P.; Tuan, R.S. Lizard Tail Skeletal Regeneration Combines Aspects of Fracture
Healing and Blastema-Based Regeneration. Development 2016, 143, 2946–2957,
doi:10.1242/dev.129585.

8. Londono, R.; Wenzhong, W.; Wang, B.; Tuan, R.S.; Lozito, T.P. Cartilage and Muscle Cell
Fate and Origins during Lizard Tail Regeneration. Front. Bioeng. Biotechnol. 2017, 5,
doi:10.3389/fbioe.2017.00070.

9. Simpson Jr., S.B. Morphology of the Regenerated Spinal Cord in the Lizard, Anolis
Carolinensis. Journal of Comparative Neurology 1968, 134, 193–209,
doi:10.1002/cne.901340207.

10. Lozito, T.P.; Tuan, R.S. Lizard Tail Regeneration: Regulation of Two Distinct Cartilage
Regions by Indian Hedgehog. Developmental Biology 2015, 399, 249–262,
doi:10.1016/j.ydbio.2014.12.036.

11. Lindahl, A.; Brittberg, M.; Gibbs, D.; Dawson, J.I.; Kanczler, J.; Black, C.; Tare, R.;
Oreffo, R.OC. Chapter 16 - Cartilage and Bone Regeneration. In Tissue Engineering (Third
Edition); De Boer, J., Blitterswijk, C.A.V., Uquillas, J.A., Malik, N., Eds.; Academic Press,
2023; pp. 533–583 ISBN 978-0-12-824459-3.

125
12. McLean, K.E.; Vickaryous, M.K. A Novel Amniote Model of Epimorphic Regeneration:
The Leopard Gecko, Eublepharis Macularius. BMC Dev Biol 2011, 11, 1–25,
doi:10.1186/1471-213X-11-50.

13. Delorme, S.L.; Lungu, I.M.; Vickaryous, M.K. Scar-Free Wound Healing and
Regeneration Following Tail Loss in the Leopard Gecko, Eublepharis Macularius. The
Anatomical Record 2012, 295, 1575–1595, doi:10.1002/ar.22490.

14. Barr, J.I.; Boisvert, C.A.; Bateman, P.W. At What Cost? Trade-Offs and Influences on
Energetic Investment in Tail Regeneration in Lizards Following Autotomy. Journal of
Developmental Biology 2021, 9, 53, doi:10.3390/jdb9040053.

15. Londono, R.; Tighe, S.; Milnes, B.; DeMoya, C.; Quijano, L.M.; Hudnall, M.L.; Nguyen,
J.; Tran, E.; Badylak, S.; Lozito, T.P. Single Cell Sequencing Analysis of Lizard
Phagocytic Cell Populations and Their Role in Tail Regeneration. Journal of Immunology
and Regenerative Medicine 2020, 8, 100029, doi:10.1016/j.regen.2020.100029.

16. Alibardi, L. Autoradiography and Inmmunolabeling Suggests That Lizard Blastema
Contains Arginase-Positive M2-like Macrophages That May Support Tail Regeneration.
Annals of Anatomy - Anatomischer Anzeiger 2020, 231, 151549,
doi:10.1016/j.aanat.2020.151549.

17. Alibardi, L. Immunolocalization of 5BrdU Long Retaining Labeled Cells and Macrophage
Infiltration in the Scarring Limb of Lizard after Limb Amputation. Tissue and Cell 2016,
48, 197–207, doi:10.1016/j.tice.2016.03.007.

18. Gerber, T.; Murawala, P.; Knapp, D.; Masselink, W.; Schuez, M.; Hermann, S.; Gac-
Santel, M.; Nowoshilow, S.; Kageyama, J.; Khattak, S.; et al. Single-Cell Analysis
Uncovers Convergence of Cell Identities during Axolotl Limb Regeneration. Science 2018,
362, doi:10.1126/science.aaq0681.

19. Currie, J.D.; Kawaguchi, A.; Traspas, R.M.; Schuez, M.; Chara, O.; Tanaka, E.M. Live
Imaging of Axolotl Digit Regeneration Reveals Spatiotemporal Choreography of Diverse
Connective Tissue Progenitor Pools. Developmental Cell 2016, 39, 411–423,
doi:10.1016/j.devcel.2016.10.013.

20. Muneoka, K.; Fox, W.F.; Bryant, S.V. Cellular Contribution from Dermis and Cartilage to
the Regenerating Limb Blastema in Axolotls. Developmental Biology 1986, 116, 256–260,
doi:10.1016/0012-1606(86)90062-X.

21. McCusker, C.D.; Diaz-Castillo, C.; Sosnik, J.; Q. Phan, A.; Gardiner, D.M. Cartilage and
Bone Cells Do Not Participate in Skeletal Regeneration in Ambystoma Mexicanum Limbs.
Developmental Biology 2016, 416, 26–33, doi:10.1016/j.ydbio.2016.05.032.

126
22. Lozito, T.P.; Londono, R.; Sun, A.X.; Hudnall, M.L. Introducing Dorsoventral Patterning
in Adult Regenerating Lizard Tails with Gene-Edited Embryonic Neural Stem Cells. Nat
Commun 2021, 12, 6010, doi:10.1038/s41467-021-26321-9.

23. Egar, M.; Simpson, S.B.; Singer, M. The Growth and Differentiation of the Regenerating
Spinal Cord of the Lizard, Anolis Carolinensis. Journal of Morphology 1970, 131, 131–
151, doi:https://doi.org/10.1002/jmor.1051310202.

24. Hutchins, E.D.; Markov, G.J.; Eckalbar, W.L.; George, R.M.; King, J.M.; Tokuyama,
M.A.; Geiger, L.A.; Emmert, N.; Ammar, M.J.; Allen, A.N.; et al. Transcriptomic Analysis
of Tail Regeneration in the Lizard Anolis Carolinensis Reveals Activation of Conserved
Vertebrate Developmental and Repair Mechanisms. PLOS ONE 2014, 9, e105004,
doi:10.1371/journal.pone.0105004.

25. Gilbert, E.A.B.; Delorme, S.L.; Vickaryous, M.K. The Regeneration Blastema of Lizards:
An Amniote Model for the Study of Appendage Replacement. Regeneration (Oxf) 2015, 2,
45–53, doi:10.1002/reg2.31.

26. Gilbert, E.A.B.; Payne, S.L.; Vickaryous, M.K. The Anatomy and Histology of Caudal
Autotomy and Regeneration in Lizards. Physiological and Biochemical Zoology 2013, 86,
631–644, doi:10.1086/673889.

27. Gardiner, D.M.; Endo, T.; Bryant, S.V. The Molecular Basis of Amphibian Limb
Regeneration: Integrating the Old with the New. Seminars in Cell & Developmental
Biology 2002, 13, 345–352, doi:10.1016/S1084952102000903.

28. Leigh, N.D.; Dunlap, G.S.; Johnson, K.; Mariano, R.; Oshiro, R.; Wong, A.Y.; Bryant,
D.M.; Miller, B.M.; Ratner, A.; Chen, A.; et al. Transcriptomic Landscape of the Blastema
Niche in Regenerating Adult Axolotl Limbs at Single-Cell Resolution. Nat Commun 2018,
9, 5153, doi:10.1038/s41467-018-07604-0.

29. Dunis, D.A.; Namenwirth, M. The Role of Grafted Skin in the Regeneration of X-
Irradiated Axolotl Limbs. Developmental Biology 1977, 56, 97–109, doi:10.1016/0012-
1606(77)90157-9.

30. Vonk, A.C.; Zhao, X.; Pan, Z.; Hudnall, M.L.; Oakes, C.G.; Lopez, G.A.; Hasel-Kolossa,
S.C.; Kuncz, A.W.C.; Sengelmann, S.B.; Gamble, D.J.; et al. Single-Cell Analysis of
Lizard Blastema Fibroblasts Reveals Phagocyte-Dependent Activation of Hedgehog-
Responsive Chondrogenesis. Nat Commun 2023, 14, 4489, doi:10.1038/s41467-023-
40206-z.

31. Stramer, B.M.; Mori, R.; Martin, P. The Inflammation–Fibrosis Link? A Jekyll and Hyde
Role for Blood Cells during Wound Repair. Journal of Investigative Dermatology 2007,
127, 1009–1017, doi:10.1038/sj.jid.5700811.

127
32. Neufeld, D.A.; Zhao, W. Phalangeal Regrowth in Rodents: Postamputational Bone
Regrowth Depends upon the Level of Amputation. Prog Clin Biol Res 1993, 383A, 243–
252.

33. Rinkevich, Y.; Lindau, P.; Ueno, H.; Longaker, M.T.; Weissman, I.L. Germ-Layer and
Lineage-Restricted Stem/Progenitors Regenerate the Mouse Digit Tip. Nature 2011, 476,
409–413, doi:10.1038/nature10346.

34. Lehoczky, J.A.; Robert, B.; Tabin, C.J. Mouse Digit Tip Regeneration Is Mediated by Fate-
Restricted Progenitor Cells. Proceedings of the National Academy of Sciences 2011, 108,
20609–20614, doi:10.1073/pnas.1118017108.

35. Li, C.; Zhao, H.; Liu, Z.; McMahon, C. Deer Antler – A Novel Model for Studying Organ
Regeneration in Mammals. The International Journal of Biochemistry & Cell Biology
2014, 56, 111–122, doi:10.1016/j.biocel.2014.07.007.

36. Riera Romo, M.; Pérez‐Martínez, D.; Castillo Ferrer, C. Innate Immunity in Vertebrates:
An Overview. Immunology 2016, 148, 125–139, doi:10.1111/imm.12597.

37. Flajnik, M.F. A Cold-Blooded View of Adaptive Immunity. Nat Rev Immunol 2018, 18,
438–453, doi:10.1038/s41577-018-0003-9.

38. Fisher, R.E.; Geiger, L.A.; Stroik, L.K.; Hutchins, E.D.; George, R.M.; Denardo, D.F.;
Kusumi, K.; Rawls, J.A.; Wilson‐Rawls, J. A Histological Comparison of the Original and
Regenerated Tail in the Green Anole, Anolis Carolinensis. The Anatomical Record 2012,
295, 1609–1619, doi:https://doi.org/10.1002/ar.22537.

39. Alibardi, L. Histochemical, Biochemical and Cell Biological Aspects of Tail Regeneration
in Lizard, an Amniote Model for Studies on Tissue Regeneration. Prog Histochem
Cytochem 2014, 48, 143–244, doi:10.1016/j.proghi.2013.12.001.

40. Jacyniak, K.; McDonald, R.P.; Vickaryous, M.K. Tail Regeneration and Other Phenomena
of Wound Healing and Tissue Restoration in Lizards. Journal of Experimental Biology
2017, 220, 2858–2869, doi:10.1242/jeb.126862.

41. Chazaud, B. Macrophages: Supportive Cells for Tissue Repair and Regeneration.
Immunobiology 2014, 219, 172–178, doi:10.1016/j.imbio.2013.09.001.

42. Mescher, A.L. Macrophages and Fibroblasts during Inflammation and Tissue Repair in
Models of Organ Regeneration. Regeneration 2017, 4, 39–53, doi:10.1002/reg2.77.

43. Wynn, T.A.; Chawla, A.; Pollard, J.W. Macrophage Biology in Development, Homeostasis
and Disease. Nature 2013, 496, 445–455, doi:10.1038/nature12034.

44. Karin, M.; Clevers, H. Reparative Inflammation Takes Charge of Tissue Regeneration.
Nature 2016, 529, 307–315, doi:10.1038/nature17039.

128

45. Simkin, J.; Sammarco, M.C.; Marrero, L.; Dawson, L.A.; Yan, M.; Tucker, C.; Cammack,
A.; Muneoka, K. Macrophages Are Required to Coordinate Mouse Digit Tip Regeneration.
Development 2017, 144, 3907–3916, doi:10.1242/dev.150086.

46. Godwin, J.W.; Pinto, A.R.; Rosenthal, N.A. Macrophages Are Required for Adult
Salamander Limb Regeneration. Proc Natl Acad Sci U S A 2013, 110, 9415–9420,
doi:10.1073/pnas.1300290110.

47. Petrie, T.A.; Strand, N.S.; Tsung-Yang, C.; Rabinowitz, J.S.; Moon, R.T. Macrophages
Modulate Adult Zebrafish Tail Fin Regeneration. Development 2014, 141, 2581–2591,
doi:10.1242/dev.098459.

48. Simkin, J.; Gawriluk, T.R.; Gensel, J.C.; Seifert, A.W. Macrophages Are Necessary for
Epimorphic Regeneration in African Spiny Mice. eLife 2017, 6, e24623,
doi:10.7554/eLife.24623.

49. Riquelme-Guzmán, C.; Tsai, S.L.; Carreon Paz, K.; Nguyen, C.; Oriola, D.; Schuez, M.;
Brugués, J.; Currie, J.D.; Sandoval-Guzmán, T. Osteoclast-Mediated Resorption Primes the
Skeleton for Successful Integration during Axolotl Limb Regeneration. eLife 2022, 11,
e79966, doi:10.7554/eLife.79966.

50. DA Fischman; Hay, ED Origin of Osteoclasts from Mononuclear Leucocytes in
Regenerating Newt Limbs. The Anatomical Record 1962, 143, 329–337.

51. Alibardi, L. Immunoreactivity for Dab2 and Foxp3 Suggests That Immune-Suppressive
Cells Are Present in the Regenerating Tail Blastema of Lizard. Acta Zoologica 2022, 103,
389–401, doi:10.1111/azo.12380.

52. Bernardo, M.E.; Fibbe, W.E. Mesenchymal Stromal Cells: Sensors and Switchers of
Inflammation. Cell Stem Cell 2013, 13, 392–402, doi:10.1016/j.stem.2013.09.006.

53. Zheng, G.X.Y.; Terry, J.M.; Belgrader, P.; Ryvkin, P.; Bent, Z.W.; Wilson, R.; Ziraldo,
S.B.; Wheeler, T.D.; McDermott, G.P.; Zhu, J.; et al. Massively Parallel Digital
Transcriptional Profiling of Single Cells. Nat Commun 2017, 8, 14049,
doi:10.1038/ncomms14049.

54. Hao, Y.; Hao, S.; Andersen-Nissen, E.; Mauck, W.M.; Zheng, S.; Butler, A.; Lee, M.J.;
Wilk, A.J.; Darby, C.; Zager, M.; et al. Integrated Analysis of Multimodal Single-Cell
Data. Cell 2021, 184, 3573-3587.e29, doi:10.1016/j.cell.2021.04.048.

55. Korsunsky, I.; Millard, N.; Fan, J.; Slowikowski, K.; Zhang, F.; Wei, K.; Baglaenko, Y.;
Brenner, M.; Loh, P.; Raychaudhuri, S. Fast, Sensitive and Accurate Integration of Single-
Cell Data with Harmony. Nat Methods 2019, 16, 1289–1296, doi:10.1038/s41592-019-
0619-0.

129
56. Zhang, Y.; Zhang, J.; Ren, Y.; Lu, R.; Yang, L.; Nie, G. Tracing the Evolution of Fatty
Acid‐binding Proteins (FABPs) in Organisms with a Heterogeneous Fat Distribution. FEBS
Open Bio 2020, 10, 861–872, doi:10.1002/2211-5463.12840.

57. Cannoodt, R.; Saelens, W.; Saeys, Y. Computational Methods for Trajectory Inference
from Single-Cell Transcriptomics. European Journal of Immunology 2016, 46, 2496–2506,
doi:10.1002/eji.201646347.

58. Trapnell, C.; Cacchiarelli, D.; Grimsby, J.; Pokharel, P.; Li, S.; Morse, M.; Lennon, N.J.;
Livak, K.J.; Mikkelsen, T.S.; Rinn, J.L. The Dynamics and Regulators of Cell Fate
Decisions Are Revealed by Pseudotemporal Ordering of Single Cells. Nat Biotechnol 2014,
32, 381–386, doi:10.1038/nbt.2859.

59. Qiu, X.; Hill, A.; Packer, J.; Lin, D.; Ma, Y.-A.; Trapnell, C. Single-Cell MRNA
Quantification and Differential Analysis with Census. Nat Methods 2017, 14, 309–315,
doi:10.1038/nmeth.4150.

60. Qiu, X.; Mao, Q.; Tang, Y.; Wang, L.; Chawla, R.; Pliner, H.A.; Trapnell, C. Reversed
Graph Embedding Resolves Complex Single-Cell Trajectories. Nat Methods 2017, 14,
979–982, doi:10.1038/nmeth.4402.

61. Senger, D.R.; Wirth, D.F.; Hynes, R.O. Transformation-Specific Secreted Phosphoproteins.
Nature 1980, 286, 619–621, doi:10.1038/286619a0.

62. Liaw, L.; Birk, D.E.; Ballas, C.B.; Whitsitt, J.S.; Davidson, J.M.; Hogan, B.L. Altered
Wound Healing in Mice Lacking a Functional Osteopontin Gene (Spp1). J Clin Invest
1998, 101, 1468–1478, doi:10.1172/JCI2131.

63. Takahashi, F.; Takahashi, K.; Okazaki, T.; Maeda, K.; Ienaga, H.; Maeda, M.; Kon, S.;
Uede, T.; Fukuchi, Y. Role of Osteopontin in the Pathogenesis of Bleomycin-Induced
Pulmonary Fibrosis. Am J Respir Cell Mol Biol 2001, 24, 264–271,
doi:10.1165/ajrcmb.24.3.4293.

64. Petrow, P.K.; Hummel, K.M.; Schedel, J.; Franz, J.K.; Klein, C.L.; Müller-Ladner, U.;
Kriegsmann, J.; Chang, P.-L.; Prince, C.W.; Gay, R.E.; et al. Expression of Osteopontin
Messenger RNA and Protein in Rheumatoid Arthritis: Effects of Osteopontin on the
Release of Collagenase 1 from Articular Chondrocytes and Synovial Fibroblasts. Arthritis
& Rheumatism 2000, 43, 1597–1605, doi:10.1002/1529-0131(200007)43:7<1597::AID-
ANR25>3.0.CO;2-0.

65. Inoue, M.; Shinohara, M.L. Intracellular Osteopontin (IOPN) and Immunity. Immunol Res
2011, 49, 160–172, doi:10.1007/s12026-010-8179-5.

66. Das, S.; Harris, L.G.; Metge, B.J.; Liu, S.; Riker, A.I.; Samant, R.S.; Shevde, L.A. The
Hedgehog Pathway Transcription Factor GLI1 Promotes Malignant Behavior of Cancer

130
Cells by Up-Regulating Osteopontin*. Journal of Biological Chemistry 2009, 284, 22888–
22897, doi:10.1074/jbc.M109.021949.

67. Rohde, F.; Rimkus, C.; Friederichs, J.; Rosenberg, R.; Marthen, C.; Doll, D.; Holzmann,
B.; Siewert, J.-R.; Janssen, K.-P. Expression of Osteopontin, a Target Gene of de-
Regulated Wnt Signaling, Predicts Survival in Colon Cancer. International Journal of
Cancer 2007, 121, 1717–1723, doi:10.1002/ijc.22868.

68. Bawage, S.; Weeks, S.E.; Shevde, L.A.; Samant, R.S. Osteopontin (Spp1). In Encyclopedia
of Signaling Molecules; Choi, S., Ed.; Springer International Publishing: Cham, 2018; pp.
3677–3686 ISBN 978-3-319-67199-4.

69. Frese, M.-A.; Milz, F.; Dick, M.; Lamanna, W.C.; Dierks, T. Characterization of the
Human Sulfatase Sulf1 and Its High Affinity Heparin/Heparan Sulfate Interaction Domain
*. Journal of Biological Chemistry 2009, 284, 28033–28044,
doi:10.1074/jbc.M109.035808.

70. Ai, X.; Do, A.-T.; Lozynska, O.; Kusche-Gullberg, M.; Lindahl, U.; Emerson, C.P. QSulf1
Remodels the 6-O Sulfation States of Cell Surface Heparan Sulfate Proteoglycans to
Promote Wnt Signaling. J Cell Biol 2003, 162, 341–351, doi:10.1083/jcb.200212083.

71. Dhoot, G.K.; Gustafsson, M.K.; Ai, X.; Sun, W.; Standiford, D.M.; Emerson, C.P.
Regulation of Wnt Signaling and Embryo Patterning by an Extracellular Sulfatase. Science
2001, 293, 1663–1666, doi:10.1126/science.293.5535.1663.

72. Otsuki, S.; Hanson, S.R.; Miyaki, S.; Grogan, S.P.; Kinoshita, M.; Asahara, H.; Wong, C.-
H.; Lotz, M.K. Extracellular Sulfatases Support Cartilage Homeostasis by Regulating BMP
and FGF Signaling Pathways. Proc Natl Acad Sci U S A 2010, 107, 10202–10207,
doi:10.1073/pnas.0913897107.

73. Danesin, C.; Agius, E.; Escalas, N.; Ai, X.; Emerson, C.; Cochard, P.; Soula, C. Ventral
Neural Progenitors Switch toward an Oligodendroglial Fate in Response to Increased Sonic
Hedgehog (Shh) Activity: Involvement of Sulfatase 1 in Modulating Shh Signaling in the
Ventral Spinal Cord. J. Neurosci. 2006, 26, 5037–5048, doi:10.1523/JNEUROSCI.0715-
06.2006.

74. Siddiqui, J.A.; Partridge, N.C. Physiological Bone Remodeling: Systemic Regulation and
Growth Factor Involvement. Physiology 2016, 31, 233–245,
doi:10.1152/physiol.00061.2014.

75. Vonk, A.C.; Hasel-Kolossa, S.C.; Lopez, G.A.; Hudnall, M.L.; Gamble, D.J.; Lozito, T.P.
Lizard Blastema Organoid Model Recapitulates Regenerated Tail Chondrogenesis. Journal
of Developmental Biology 2022, 10, 12, doi:10.3390/jdb10010012.

76. Sasaki, H.; Nishizaki, Y.; Hui, C.; Nakafuku, M.; Kondoh, H. Regulation of Gli2 and Gli3
Activities by an Amino-Terminal Repression Domain: Implication of Gli2 and Gli3 as

131
Primary Mediators of Shh Signaling. Development 1999, 126, 3915–3924,
doi:10.1242/dev.126.17.3915.

77. Ramsbottom, S.A.; Maguire, R.J.; Fellgett, S.W.; Pownall, M.E. Sulf1 Influences the Shh
Morphogen Gradient during the Dorsal Ventral Patterning of the Neural Tube in Xenopus
Tropicalis. Developmental Biology 2014, 391, 207–218, doi:10.1016/j.ydbio.2014.04.010.

78. Whimster, I.W. Nerve Supply as a Stimulator of the Growth of Tissues Including Skin. II.
Animal Evidence. Clin Exp Dermatol 1978, 3, 389–410, doi:10.1111/j.1365-
2230.1978.tb01518.x.

79. Bryant, S.V.; Wozny, K.J. Stimulation of Limb Regeneration in the Lizard Xantusia Vigilis
by Means of Ependymal Implants. J Exp Zool 1974, 189, 339–352,
doi:10.1002/jez.1401890307.

80. Sun, A.X.; Londono, R.; Hudnall, M.L.; Tuan, R.S.; Lozito, T.P. Differences in Neural
Stem Cell Identity and Differentiation Capacity Drive Divergent Regenerative Outcomes in
Lizards and Salamanders. PNAS 2018, 115, E8256–E8265, doi:10.1073/pnas.1803780115.

81. Cuellar, O.; Kluge, A.G. Natural Parthenogenesis in the Gekkonid Lizard Lepidodactylus
Lugubris. J Genet 1972, 61, 14–26, doi:10.1007/BF02984098.

82. Wicke, C.; Halliday, B.; Allen, D.; Roche, N.S.; Scheuenstuhl, H.; Spencer, M.M.; Roberts,
A.B.; Hunt, T.K. Effects of Steroids and Retinoids on Wound Healing. Archives of Surgery
2000, 135, 1265–1270, doi:10.1001/archsurg.135.11.1265.

83. Fishel, R.; Barbul, A.; Wasserkrug, H.L.; Penberthy, L.T.; Rettura, G.; Efron, G.
Cyclosporine a Impairs Wound Healing in Rats. Journal of Surgical Research 1983, 34,
572–575, doi:10.1016/0022-4804(83)90112-9.

84. Zhao, W.; Sala-Newby, G.B.; Dhoot, G.K. Sulf1 Expression Pattern and Its Role in
Cartilage and Joint Development. Developmental Dynamics 2006, 235, 3327–3335,
doi:10.1002/dvdy.20987.

85. Holst, C.R.; Bou-Reslan, H.; Gore, B.B.; Wong, K.; Grant, D.; Chalasani, S.; Carano, R.A.;
Frantz, G.D.; Tessier-Lavigne, M.; Bolon, B.; et al. Secreted Sulfatases Sulf1 and Sulf2
Have Overlapping yet Essential Roles in Mouse Neonatal Survival. PLOS ONE 2007, 2,
e575, doi:10.1371/journal.pone.0000575.

86. Sivaraj, K.K.; Majev, P.-G.; Jeong, H.-W.; Dharmalingam, B.; Zeuschner, D.; Schröder, S.;
Bixel, M.G.; Timmen, M.; Stange, R.; Adams, R.H. Mesenchymal Stromal Cell-Derived
Septoclasts Resorb Cartilage during Developmental Ossification and Fracture Healing. Nat
Commun 2022, 13, 571, doi:10.1038/s41467-022-28142-w.

87. Daponte, V.; Tylzanowski, P.; Forlino, A. Appendage Regeneration in Vertebrates: What
Makes This Possible? Cells 2021, 10, 242, doi:10.3390/cells10020242.

132

88. Scadding, S.R. Limb Regeneration in Adult Amphibia. Can. J. Zool. 1981, 59, 34–46,
doi:10.1139/z81-007.

89. Scadding, S.R. Phylogenic Distribution of Limb Regeneration Capacity in Adult Amphibia.
Journal of Experimental Zoology 1977, 202, 57–67, doi:10.1002/jez.1402020108.

90. Tank, P.W.; Carlson, B.M.; Connelly, T.G. A Staging System for Forelimb Regeneration in
the Axolotl, Ambystoma Mexicanum. Journal of Morphology 1976, 150, 117–128,
doi:10.1002/jmor.1051500106.

91. Weinreb, C.; Rodriguez-Fraticelli, A.; Camargo, F.D.; Klein, A.M. Lineage Tracing on
Transcriptional Landscapes Links State to Fate during Differentiation. Science 2020, 367,
eaaw3381, doi:10.1126/science.aaw3381.

92. Alibardi, L. Appendage Regeneration in Anamniotes Utilizes Genes Active during Larval-
Metamorphic Stages That Have Been Lost or Altered in Amniotes: The Case for Studying
Lizard Tail Regeneration. Journal of Morphology 2020, 281, 1358–1381,
doi:10.1002/jmor.21251.

93. Alibardi, L. Ultrastructural Analysis of Early Regenerating Lizard Tail Suggests That a
Process of Dedifferentiation Is Involved in the Formation of the Regenerative Blastema.
Journal of Morphology 2018, 279, 1171–1184, doi:10.1002/jmor.20838.

94. Vitulo, N.; Dalla Valle, L.; Skobo, T.; Valle, G.; Alibardi, L. Transcriptome Analysis of the
Regenerating Tail vs. the Scarring Limb in Lizard Reveals Pathways Leading to Successful
vs. Unsuccessful Organ Regeneration in Amniotes. Developmental Dynamics 2017, 246,
116–134, doi:10.1002/dvdy.24474.

95. Vitulo, N.; Dalla Valle, L.; Skobo, T.; Valle, G.; Alibardi, L. Downregulation of Lizard
Immuno-Genes in the Regenerating Tail and Myogenes in the Scarring Limb Suggests That
Tail Regeneration Occurs in an Immuno-Privileged Organ. Protoplasma 2017, 254, 2127–
2141, doi:10.1007/s00709-017-1107-y.

96. Patel, S.; Ranadive, I.; Buch, P.; Khaire, K.; Balakrishnan, S. De Novo Transcriptome
Sequencing and Analysis of Differential Gene Expression among Various Stages of Tail
Regeneration in Hemidactylus Flaviviridis. Journal of Developmental Biology 2022, 10,
24, doi:10.3390/jdb10020024.

97. Farmer, D.T.; Mlcochova, H.; Zhou, Y.; Koelling, N.; Wang, G.; Ashley, N.; Bugacov, H.;
Chen, H.-J.; Parvez, R.; Tseng, K.-C.; et al. The Developing Mouse Coronal Suture at
Single-Cell Resolution. Nat Commun 2021, 12, 4797, doi:10.1038/s41467-021-24917-9.

98. Kendall, R.T.; Feghali-Bostwick, C.A. Fibroblasts in Fibrosis: Novel Roles and Mediators.
Front Pharmacol 2014, 5, 123, doi:10.3389/fphar.2014.00123.

133
99. Van Linthout, S.; Miteva, K.; Tschöpe, C. Crosstalk between Fibroblasts and Inflammatory
Cells. Cardiovascular Research 2014, 102, 258–269, doi:10.1093/cvr/cvu062.

100. Abbasi, A.A.; Goode, D.K.; Amir, S.; Grzeschik, K.-H. Evolution and Functional
Diversification of the GLI Family of Transcription Factors in Vertebrates. Evol Bioinform
Online 2009, 5, 5–13.

101. Lex, R.K.; Ji, Z.; Falkenstein, K.N.; Zhou, W.; Henry, J.L.; Ji, H.; Vokes, S.A. GLI
Transcriptional Repression Regulates Tissue-Specific Enhancer Activity in Response to
Hedgehog Signaling. eLife 2020, 9, e50670, doi:10.7554/eLife.50670.

102. Zehentner, B.K.; Dony, C.; Burtscher, H. The Transcription Factor Sox9 Is Involved in
BMP-2 Signaling. Journal of Bone and Mineral Research 1999, 14, 1734–1741,
doi:10.1359/jbmr.1999.14.10.1734.

103. Taylor, R.; Long, J.; Yoon, J.W.; Childs, R.; Sylvestersen, K.B.; Nielsen, M.L.; Leong, K.-
F.; Iannaccone, S.; Walterhouse, D.O.; Robbins, D.J.; et al. Regulation of GLI1 by Cis
DNA Elements and Epigenetic Marks. DNA Repair 2019, 79, 10–21,
doi:10.1016/j.dnarep.2019.04.011.

104. Alibardi, L. FGFs Treatment on Amputated Lizard Limbs Stimulate the Regeneration of
Long Bones, Opening New Avenues for Limb Regeneration in Amniotes: A Morphological
Study. Journal of Functional Morphology and Kinesiology 2017, 2, 25,
doi:10.3390/jfmk2030025.

105. ThermoFisher PHrodo
TM
Green E. Coli BioParticles
TM
Conjugate for Phagocytosis
Available online: https://www.thermofisher.com/order/catalog/product/P35366?SID=srch-
srp-P35366 (accessed on 8 December 2022).

106. ThermoFisher Scientific The Molecular Probes Handbook: A Guide to Fluorescent Probes
and Labeling Technologies - 16.1 Probes for Following Receptor Binding and
Phagocytosis; 11th ed.; 2010.

107. Stocum, D.L. Mechanisms of Urodele Limb Regeneration. Regeneration (Oxf) 2017, 4,
159–200, doi:10.1002/reg2.92.

108. Gross, M. Regeneration Lessons from the Axolotl. Current Biology 2018, 28, R187–R189,
doi:10.1016/j.cub.2018.02.033.

109. Alibardi, L. Regeneration in Reptiles and Its Position Among Vertebrates. In
Morphological and Cellular Aspects of Tail and Limb Regeneration in Lizards: A Model
System With Implications for Tissue Regeneration in Mammals; Alibardi, L., Ed.;
Advances in Anatomy, Embryology and Cell Biology; Springer: Berlin, Heidelberg, 2010;
pp. 1–49 ISBN 978-3-642-03733-7.

134
110. Lefebvre, V.; Dvir-Ginzberg, M. SOX9 and the Many Facets of Its Regulation in the
Chondrocyte Lineage. Connect Tissue Res 2017, 58, 2–14,
doi:10.1080/03008207.2016.1183667.

111. Alibardi, L. Stimulation of Regenerative Blastema Formation in Lizards as a Model to
Analyze Limb Regeneration in Amniotes. Histol Histopathol 2019, 34, 1111–1120,
doi:10.14670/HH-18-123.

112. Alibardi, L.; Meyer-Rochow, V.B. Comparative Fine Structure of the Axial Skeleton inside
the Regenerated Tail of Some Lizard Species and the Tuatara (Sphenodon Punctatus).
Gegenbaurs Morphol Jahrb 1989, 135, 705–716.

113. Pritchard, J.J.; Ruzicka, A.J. Comparison of Fracture Repair in the Frog, Lizard and Rat. J
Anat 1950, 84, 236–261.

114. Ahrens, P.B.; Solursh, M.; Reiter, R.S. Stage-Related Capacity for Limb Chondrogenesis in
Cell Culture. Developmental Biology 1977, 60, 69–82, doi:10.1016/0012-1606(77)90110-5.

115. Daniels, K.; Reiter, R.; Solursh, M. Chapter 12 Micromass Cultures of Limb and Other
Mesenchyme. In Methods in Cell Biology; Bronner-Fraser, M., Ed.; Methods in Avian
Embryology; Academic Press, 1996; Vol. 51, pp. 237–247.

116. Mello, M.A.; Tuan, R.S. High Density Micromass Cultures of Embryonic Limb Bud
Mesenchymal Cells: An in Vitro Model of Endochondral Skeletal Development. In Vitro
Cell.Dev.Biol.-Animal 1999, 35, 262–269, doi:10.1007/s11626-999-0070-0.

117. De Lise, A.M.; Stringa, E.; Woodward, W.A.; Mello, M.A.; Tuan, R.S. Embryonic Limb
Mesenchyme Micromass Culture as an In Vitro Model for Chondrogenesis and Cartilage
Maturation. In Developmental Biology Protocols; Tuan, R.S., Lo, C.W., Eds.; Methods in
Molecular Biology
TM
; Humana Press: Totowa, NJ, 2000; pp. 359–375 ISBN 978-1-59259-
066-7.

118. Handschel, J.G.K.; Depprich, R.A.; Kübler, N.R.; Wiesmann, H.-P.; Ommerborn, M.;
Meyer, U. Prospects of Micromass Culture Technology in Tissue Engineering. Head Face
Med 2007, 3, 4, doi:10.1186/1746-160X-3-4.

119. Kim, J.; Koo, B.-K.; Knoblich, J.A. Human Organoids: Model Systems for Human Biology
and Medicine. Nat Rev Mol Cell Biol 2020, 21, 571–584, doi:10.1038/s41580-020-0259-3.

120. Alimperti, S.; Andreadis, S.T. CDH2 and CDH11 Act as Regulators of Stem Cell Fate
Decisions. Stem Cell Research 2015, 14, 270–282, doi:10.1016/j.scr.2015.02.002.

121. Tuli, R.; Tuli, S.; Nandi, S.; Wang, M.L.; Alexander, P.G.; Haleem-Smith, H.; Hozack,
W.J.; Manner, P.A.; Danielson, K.G.; Tuan, R.S. Characterization of Multipotential
Mesenchymal Progenitor Cells Derived from Human Trabecular Bone. STEM CELLS
2003, 21, 681–693, doi:10.1634/stemcells.21-6-681.

135

122. Rasys, A.M.; Park, S.; Ball, R.E.; Alcala, A.J.; Lauderdale, J.D.; Menke, D.B. CRISPR-
Cas9 Gene Editing in Lizards through Microinjection of Unfertilized Oocytes. Cell Reports
2019, 28, 2288-2292.e3, doi:10.1016/j.celrep.2019.07.089.

123. Palade, J.; Djordjevic, D.; Hutchins, E.D.; George, R.M.; Cornelius, J.A.; Rawls, A.; Ho,
J.W.K.; Kusumi, K.; Wilson-Rawls, J. Identification of Satellite Cells from Anole Lizard
Skeletal Muscle and Demonstration of Expanded Musculoskeletal Potential. Dev Biol
2018, 433, 344–356, doi:10.1016/j.ydbio.2017.08.037.

124. Zuk, P. Adipose-Derived Stem Cells in Tissue Regeneration: A Review. ISRN Stem Cells
2013, 2013, 1–35, doi:10.1155/2013/713959.

125. Tickle, C.; Towers, M. Sonic Hedgehog Signaling in Limb Development. Frontiers in Cell
and Developmental Biology 2017, 5.

126. Mueller, M.B.; Fischer, M.; Zellner, J.; Berner, A.; Dienstknecht, T.; Kujat, R.; Prantl, L.;
Nerlich, M.; Tuan, R.S.; Angele, P. Effect of Parathyroid Hormone-Related Protein in an in
Vitro Hypertrophy Model for Mesenchymal Stem Cell Chondrogenesis. Int Orthop 2013,
37, 945–951, doi:10.1007/s00264-013-1800-1.

127. Wang, F.; Flanagan, J.; Su, N.; Wang, L.-C.; Bui, S.; Nielson, A.; Wu, X.; Vo, H.-T.; Ma,
X.-J.; Luo, Y. RNAscope. J Mol Diagn 2012, 14, 22–29,
doi:10.1016/j.jmoldx.2011.08.002.

128. Rayes, J.; Watson, S.P.; Nieswandt, B. Functional Significance of the Platelet Immune
Receptors GPVI and CLEC-2. J Clin Invest 129, 12–23, doi:10.1172/JCI122955.

129. von Hundelshausen, P.; Weber, C. Platelets as Immune Cells. Circulation Research 2007,
100, 27–40, doi:10.1161/01.RES.0000252802.25497.b7.

130. Yeung, J.; Li, W.; Holinstat, M. Platelet Signaling and Disease: Targeted Therapy for
Thrombosis and Other Related Diseases. Pharmacol Rev 2018, 70, 526–548,
doi:10.1124/pr.117.014530.

131. Keegan, A.D.; Leonard, W.J.; Zhu, J. Recent Advances in Understanding the Role of IL-4
Signaling. Fac Rev 2021, 10, 71, doi:10.12703/r/10-71.

132. Goenka, S.; Kaplan, M.H. Transcriptional Regulation by STAT6. Immunol Res 2011, 50,
87–96, doi:10.1007/s12026-011-8205-2.

133. Karpathiou, G.; Papoudou-Bai, A.; Ferrand, E.; Dumollard, J.M.; Peoc’h, M. STAT6: A
Review of a Signaling Pathway Implicated in Various Diseases with a Special Emphasis in
Its Usefulness in Pathology. Pathology - Research and Practice 2021, 223, 153477,
doi:10.1016/j.prp.2021.153477.

Abstract (if available)

Abstract Lizards cannot naturally regenerate limbs but are the closest known relatives of mammals capable of epimorphic tail regrowth. However, the processes regulating the spatiotemporal initiation of lizard tail blastema formation and chondrogenesis remain largely unknown, as well as the cell types and signatures of cells involved. Fibroblastic connective tissue cells (FCTCs) have been previously identified as the most abundant cell type found in the blastema of regenerating axolotl limbs, thus, we proposed activated FCTCs as the main blastema stem cell undergoing chondrogenesis in lizard tail regeneration. Using green anole lizards (Anolis carolinensis), we characterized the major cell types that make up the heterogenous blastema and regenerating tail using single-cell RNA sequencing and evaluated the role and cellular mechanisms behind FCTCs in lizard tail blastema formation and chondrogenesis. Tail blastema, but not limb, fibroblasts expressed sulf1 and formed cartilage under Hedgehog signaling regulation, while factors from lizard phagocytic cells were shown to be critical for fibroblast-derived blastema and cartilage formation. Our results indicate a hierarchy of phagocyte-induced fibroblast gene activations during lizard blastema derivation, culminating in sulf1+ pro-chondrogenic populations singularly responsive to Hedgehog signaling. We also developed an in vitro model of the blastema, using a novel FCTC blastema pellet culture system, modulated with Hedgehog signaling agonists, to recapitulate in vivo lizard tail cartilage formation. These results and novel model system will allow for greater understanding of appendage regeneration and may indicate actionable targets for inducing regeneration in other species, including humans.

Linked assets

University of Southern California Dissertations and Theses

Conceptually similar

PDF

Discovery of a novel role for Sonic Hedgehog during the early stages of large-scale murine rib regeneration

PDF

FGFR2 Regulates Connective Tissue Development in the Skull

PDF

Skeletal cell fate plasticity in zebrafish bone development and regeneration

PDF

The role of Hedgehog signaling in Sox9 expressing progenitors during large scale bone repair

PDF

Dissecting the heterogeneity of mouse hematopoietic stem cells in vivo

PDF

Nr5a2 balances lineage decisions to promote diverse connective tissue fates in the jaw

PDF

Dissecting metabolic changes in muscle stem cells during activation

PDF

The epigenetic landscapes underlying differentiation and plasticity in the developing organ of Corti

PDF

Transcriptomic maturation of developing human cone precursors in fetal and 3D hESC-derived tissues

PDF

Mechanisms that dictate beta cells’ response to stress in the context of genetic mutation, pregnancy, and infection

PDF

Exploring the function of distal nephron enhancers in zebrafish

PDF

DNA methylation in the mouse cochlea promotes maturation of supporting cells and contributes to the failure of hair cell regeneration

PDF

Dissecting the role of a non-canonical interleukin-6 cytokine signaling in systemic chronic inflammation and multimorbidity induced by a high-fat diet

PDF

Understanding human nephrogenesis and scaling synthesis of organoids facilitate modeling of kidney development and disease

PDF

Investigating molecular roadblocks to enhance direct cellular reprogramming

PDF

Transcriptional and epigenetic mechanisms underlying sensory hair cell differentiation and regeneration

PDF

Mechanisms of airway multiciliated cell differentiation

PDF

Transcriptional regulation in nephron progenitor cells

PDF

Regional localization and regulation of hematopoietic stem cells in the bone marrow stem cell niche

PDF

β-catenin couples self-renewal, induction and epithelial morphogenesis and patterning at the outset of mammalian nephrogenesis

Asset Metadata

Creator Vonk, Ariel Catherine (author)

Core Title Fibroblastic connective tissue cells: the blastema stem cells and source of large-scale chondrogenesis in the regenerating lizard tail

School Keck School of Medicine

Degree Doctor of Philosophy

Degree Program Development, Stem Cells and Regenerative Medicine

Degree Conferral Date 2023-12

Publication Date 09/11/2023

Defense Date 07/28/2023

Publisher Los Angeles, California (original), University of Southern California (original), University of Southern California. Libraries (digital)

Tag appendage regeneration,blastema formation,cartilage development,chondrogenesis,non-traditional model organisms,OAI-PMH Harvest,regenerative medicine,single-cell RNA sequencing

Format theses (aat)

Language English

Contributor Electronically uploaded by the author (provenance)

Advisor Evseenko, Denis (committee chair), Lozito, Thomas (committee member), Mariani, Francesca (committee member)

Creator Email a.vonk6@gmail.com,vonk@usc.edu

Permanent Link (DOI) https://doi.org/10.25549/usctheses-oUC113305043

Unique identifier UC113305043

Identifier etd-VonkArielC-12354.pdf (filename)

Legacy Identifier etd-VonkArielC-12354

Document Type Dissertation

Format theses (aat)

Rights Vonk, Ariel Catherine

Internet Media Type application/pdf

Type texts

Source 20230911-usctheses-batch-1095 (batch), University of Southern California (contributing entity), University of Southern California Dissertations and Theses (collection)

Access Conditions The author retains rights to his/her dissertation, thesis or other graduate work according to U.S. copyright law. Electronic access is being provided by the USC Libraries in agreement with the author, as the original true and official version of the work, but does not grant the reader permission to use the work if the desired use is covered by copyright. It is the author, as rights holder, who must provide use permission if such use is covered by copyright.

Repository Name University of Southern California Digital Library

Repository Location USC Digital Library, University of Southern California, University Park Campus MC 2810, 3434 South Grand Avenue, 2nd Floor, Los Angeles, California 90089-2810, USA

Repository Email cisadmin@lib.usc.edu