University of Southern California Dissertations and Theses

Effects of endocrine disrupting chemicals and pharmaceuticals on rodent immature Sertoli cell functions

(USC Thesis Other)

Effects of endocrine disrupting chemicals and pharmaceuticals on rodent immature Sertoli cell functions

PDF

Download a page range

Download transcript

Copy asset link

Request this asset

Transcript (if available)

Content Effects of endocrine disrupting chemicals and pharmaceuticals on rodent immature
Sertoli cell functions
by
Nicole Mohajer
A Thesis Presented to the
FACULTY OF THE USC ALFRED E. MANN SCHOOL OF PHARMACY
UNIVERSITY OF SOUTHERN CALIFORNIA
In Partial Fulfillment of the
Requirements for the Degree
MASTER OF SCIENCE
(PHARMACEUTICAL SCIENCES)
August 2024

ii
Acknowledgements:
First and foremost, I would like to thank my advisor Dr. Martine Culty, for
providing me a home in her lab and supporting my research endeavors. I would
like to thank members of the Culty lab who contributed to the work that is
presented here today including Dr. Maia Corpuz-Hilsabeck, Dr. Martine Culty,
Yousra Kawsar, and Runhan Luo. I would be remiss not to include members of the
Papadopoulos lab including Chantal Sottas, whose advice was always appreciated.
Lastly, I would like to thank the members of my thesis committee, Dr. Martine
Culty, Dr. Vassilios Papadopoulos, and Dr. Enrique Cadenas, for their help in
reviewing this work for submission.

iii
Table of Contents:
Acknowledgements..........................................................................................................................ii
Statement........................................................................................................................................iv
List of Tables...................................................................................................................................v
List of Figures.................................................................................................................................vi
Abbreviations.................................................................................................................................vii
Abstract.........................................................................................................................................viii
Chapter I: Introduction...................................................................................................................1
A. Sertoli cell development.........................................................................................2
B. EDC and Pharmaceutical Mixture Risk Assessment Strategies............................11
Chapter II: Materials & Methods...................................................................................................15
Chapter III: Effects of EDCs and pharmaceuticals on immature Sertoli cell
functions.............................................................................................................................20
Chapter IV: Mechanisms underlying the toxic effects of EDC/Pharmaceutical co-exposure to
immature Sertoli cell functions......................................................................................................27
References......................................................................................................................................40

iv
Statement:
I maintain that the work presented in this thesis is based on my own research,
unless otherwise acknowledged. Part of this thesis includes work that was
published in Cells (2023 Jul 7;12(13):1804. doi: 10.3390/cells12131804), titled
“Dysregulation of Immature Sertoli Cell Functions by Exposure to Acetaminophen
and Genistein in Rodent Cell Models,” in which I am listed as a second author.
I also wrote a peer-reviewed review article, designed with my supervisor, which
she edited and submitted to a special issue of the journal “Reproduction”. The
article is currently under revision.
Moreover, I presented my work at three conferences including:
Mohajer, N., Kawsar, Y., Corpuz-Hisabeck, M., Culty, M. (2024) Genistein
impacts immature murine Sertoli cell functions via multiple signaling pathways.
North American Testis Workshop, 3 May, Denver, CO, USA. Presented as a poster
and flash talk.
Mohajer, N., Luo, R., Kawsar, Y., Corpuz-Hisabeck, M., Culty, M. (2024) Effects
of Acetaminophen and Selective Cox Inhibitors on Murine Immature Sertoli Cells.
American Society of Andrology, 29 April, Denver, CO, USA. Presented as a poster
and flash talk.
Mohajer, N., Kawsar, Y., Corpuz-Hisabeck, M., Culty, M. (2023) Effects of
endocrine disrupting chemicals and pharmaceuticals on murine immature Sertoli
cell functions. Southern California Society of Toxicology Chapter Meeting, 11
October, Carlsbad, San Diego, CA, USA. Presented as a poster.
Sections containing this data have cited this work, and all collaborators have been
acknowledged.

v
List of Tables:
Table 1. Primer sets for q-PCR analysis.......................................................................................18
Table 2. Significantly up- and downregulated genes in TM4 Sertoli subjected to APAP, GEN
and their mixture............................................................................................................................30
Table 3. Functional pathways altered by APAP+GEN mixture in TM4 Sertoli cells..................31

vi
List of Figures:
Figure 1. Regulation, functions and cell types of the mature testis................................................2
Figure 2. Outline of the eicosanoid pathway................................................................................15
Figure 3. Chemical structures.......................................................................................................17
Figure 4. MTT assay detects changes in cell viability..................................................................20
Figure 5. APAP and GEN inhibit proliferation of TM4 SCs........................................................21
Figure 6. Transcriptomic analysis and relative gene expression..................................................22
Figure 7. Relative expression of SC maker Sox9.........................................................................23
Figure 8. Eicosanoid pathway gene and protein expression.........................................................25
Figure 9. Estrogen receptor expression is altered.........................................................................26
Figure 10. qPCR analysis of SC developmental markers.............................................................27
Figure 11. Prospective pathways and targets................................................................................28
Figure 12. Select differentially expressed genes (DEGs) in TM4 SCs.........................................29
Figure 13. Cell proliferation and viability assays.........................................................................32
Figure 14. Potential mechanisms related to downregulated Cox expression................................33
Figure 15. Mechanisms conferring APAP/GEN downregulation of Sox9 and cJun expression..34
Figure 16. Evaluation of protein expression by IF staining of TM4 SCs.....................................35

vii
Abbreviations:
SC = Sertoli cell(s)
EDC = Endocrine disrupting chemicals
APAP = Acetaminophen
GEN = Genistein
TM4 = transgenic mouse 4 Sertoli cell line
PND = postnatal day
(CS-) FBS = (Charcoal stripped-) Fetal bovine serum
GC = Germ cell(s)
ST = Seminiferous Tubule(s)
BTB = Blood-Testis Barrier
FSH = Follicle Stimulating Hormone
MAPK = Mitogen-Activated Protein Kinase
ERK = Extracellular Signal-Regulated Kinase
PI3K = Phosphoinositide 3-Kinase
AKT = AKT Serine/Threonine Kinase/Protein kinase B
PKA = Protein Kinase A
TGFB = Transforming Growth Factor Beta
ER = Estrogen receptor
PG = Prostaglandin
AMH = Anti-Müllerian Hormone
AR = Androgen receptor
SRY = Sex Determining Region Y
SOX9 = SRY Box Transcription Factor 9
COX = cyclooxygenase enzyme
cJun = Jun proto-oncogene
RA = Retinoic Acid

viii
Abstract:
Exposure to endocrine-disrupting chemicals (EDCs) and pharmaceuticals during
development has been linked to reproductive dysfunction and infertility. The aim of this project
was to expand understanding of the adverse effects associated with EDCs, pharmaceuticals, and
their mixtures which can pose a threat to male gonadal development. The current scientific
landscape lacks cell-by-cell analyses of mixture effects which could provide valuable insights into
molecular mechanisms that underlie the dysregulation of testicular function. Sertoli cells, which
provide support to every cell within the testis, are instrumental to the process of spermatogenesis,
and their dysregulation can contribute to disease and infertility. Thus, we probed two Sertoli cell
models and surveyed the impact of analgesic acetaminophen (APAP), phytoestrogen genistein
(GEN), and their mixture based on the likelihood of infant exposure and their association with
disrupting the testicular environment individually.
To address our aim, we hypothesized that APAP, GEN, and their mixture disrupt immature
Sertoli cell functions. Using primary rat Sertoli cells isolated at the immature stage of testicular
development and a mouse immature Sertoli cell line, we evaluated the adverse effects of these
compounds on cell viability, proliferation, the expression of Sertoli markers, the eicosanoid
pathway, and estrogen receptor signaling genes and proteins using multiple in vitro assays. Next,
we performed RNA sequencing analysis to discover other pathways and markers disrupted by
these compounds and their mixture. We found several altered pathways and genes that are related
to Sertoli cell and gonadal development. We used this data to probe the mechanisms by which
APAP, GEN, and their mixture altered SC functions, by comparing them to targets of their
prospective pathways. We found that APAP and GEN acted on immature SCs mainly via expected
signaling pathways but that there were also overlaps in some of their targets, suggesting additive
or synergistic effects of the mixtures.
This research supports the need for comprehensive risk assessment strategies that consider
the complex nature of chemical exposures in real-world scenarios. By advancing our
understanding of how EDC and pharmaceutical mixtures affect testicular cells, we aim to
contribute to the development of better regulatory policies and therapeutic interventions to mitigate
the impact of these compounds on male fertility.

1
Chapter I: Introduction
Global infertility rates are rising, with male-related causes contributing to up to 50% of
cases (Eisenberg et al., 2023). Human interaction with the environment leads to unintended
consequences such as usage of and exposure to endocrine disrupting chemicals (EDCs) and
pharmaceuticals, the latter of which is usually intentional. Registered manmade chemicals exceeds
150,000, not including many mixtures and unreported chemicals, many of which are likely to exert
endocrine disrupting effects (Wang et al., 2020, Gore et al., 2024). Dependency on manmade
chemicals in the production of industrial, agricultural, consumer products, and drugs in the modern
world has increased, possibly impacting human reproduction (Naidu et al., 2021). Humans are
seldom exposed to chemicals in isolation. Biomonitoring studies testing the prevalence of
chemicals on Earth have repeatedly shown that every human is exposed to EDCs and their
metabolites have been found in human fluids, such as blood, urine, and amniotic fluid, including
compounds known to cross the placental barrier (Brauner et al., 2022, Gore et al., 2024, Schug et
al., 2016). Therefore, it is crucial to assess the potency of EDC mixtures and determine the scope
of toxic mixtures that can significantly alter the male reproductive system and contribute to male
reproductive disorders and infertility.
Though the rise of infertility and reproductive conditions in males is a global problem,
there is a lack of unification on how to codify and limit the usage of EDCs. In fact, policymaking
regarding EDCs is mainly limited to the US, EU and Japan, while large EDC producers such as
China have not yet established policies on this issue (Xu et al., 2024). Moreover, there is a lack of
agreement on the definition of what an EDC is between countries and on how to regulate the
production and exposure levels of chemicals with possible EDC properties (Kassotis et al., 2020).
Scientists are working on expanding the breadth of EDC studies, as shown by increasing articles
assessing the impact of EDC mixtures on male reproduction. However, most studies about EDC
toxicity to the male reproductive system are still limited to single dose effects or few EDC
subgroups (Walker et al., 2021, Eustache et al., 2020, Walker et al., 2023). In addition, people,
including children, are exposed to various pharmaceuticals depending on their health status, and
through the release of medications into the environment where they can contaminate drinking
water (Kassotis et al., 2020). This raises questions about the risk pharmaceuticals pose alone and
in combination with well-documented EDCs. Many drugs, such as analgesics, also possess
endocrine-disrupting potential. However, there are limited studies concerning the role that they
play in mixtures impacting male reproductive development. In the past decade, research on EDC
and pharmaceutical mixtures and associated male reproductive toxicity has broadened the
definition of what constitutes an EDC and how EDCs can be grouped, expanding their scope by
using mixtures and a greater diversity of dosing strategies in reproductive risk assessment.
There are many cell types within the male gonad (Fig. 1), whose dysfunction can impair
fertility directly or indirectly. Among them are Sertoli cells (SCs), somatic cells that contribute to
the development of the male reproductive system, and subsequently the processes of
spermatogenesis (formation of sperm) and the formation of the blood-testis barrier (BTB) through
their cell-cell interactions, which is critical in their immunoprotective role (Ni et al., 2019). SCs
also coordinate other cell types within the testis, especially germ cells (Yao et al., 2015). Though
their dysfunction can have detrimental consequences on male reproduction, there are few studies
that examine the effects of SC impairment after exposure to EDCs and pharmaceuticals, with most
studies focusing on other testicular somatic cell types or germ cells, which are the precursors to
spermatozoa. It is critical, therefore, to assess the gaps in knowledge regarding the propensity of

2
EDC and pharmaceuticals to disrupt SC functions, especially at environmentally relevant doses of
such compounds and within the context of mixtures. Thus, the purpose of this project is to examine
the implications of EDC/pharmaceutical exposure on SCs, focusing on the consequences of
exposure to immature SCs, which drive testicular development, health, and fertility. First, it is
important to understand the functions of Sertoli cells to demonstrate the detriments that their
dysfunction can have on male reproductive health and fertility. In this chapter, I will cover SC
development and their role as the supporting cell of the testis followed by the recorded impact of
EDCs on their functions.
Fig. 1. Regulation, functions and cell types of the mature testis. Depicted on the left of the
figure is the hypothalamus-pituitary-gonad (HPG) axis. The hypothalamus and pituitary regulate
hormone production the hypothalamus releasing gonadotropin releasing hormone (GnRH),
which signals to the pituitary to produce luteinizing hormone (LH) when testosterone levels are
low. LH binds on its receptor on Leydig cells in the testis, inducing testosterone production.
Testosterone acts through a negative feedback loop on the hypothalamus and pituitary to regulate
its own levels and turns off LH and GnRH production (Robaire and Chan, 2023). Adjacent is a
cross-section of a seminiferous tubule within the testis, the interstitium surrounding the tubules,
and the basal lamina of the tubule separating the tubule and interstitium compartments. In the
interstitium are Leydig cells, where steroidogenesis occurs, and testosterone is produced. The
peritubular myoid cells border the tubule and with the Sertoli cells contribute to the formation of
the basal lamina. Sertoli and germ cells, shown at various stages of development, reside within
the tubule. Sertoli cells support the process of germ cell differentiation from gonocyte to
spermatozoa. Figure is adapted from Walker et al. (Walker et al., 2021).
Sertoli Cell Development:
As mentioned, the focus of this thesis work is on immature Sertoli cells, during a window
in which they are at a critical point in their development when they are most vulnerable to the
adverse effects of EDC exposure. However, it is important to describe the function of SCs
throughout development to fully understand the role that they play in proper testicular function

3
and fertility. There is less data on human SCs than rodents, even though there are underlying
differences in the genes and proteins expressed between them (Gao et al., 2015). However, data
shared in this section, unless otherwise outlined, is primarily restricted to studies in rodents, as this
applies to the discussed research project.
Fetal Sertoli Cells:
The somatic cell lineage begins to form in mice at around embryonic (E) days 10 or 11 as
the testis cords form and begin to surround and enclose the nescient germ cells, known as
gonocytes, in the gonad primordia (O’Donnell et al., 2022). Gonocytes form from primordial germ
cells, the embryonic stem cells committed to the germline lineage between E7.5 to E13.5, which
migrate to the genital ridge where the future gonads will form (Culty, 2009). The establishment of
a threshold number of Sertoli cells is crucial to sex determination and the fate of other cell types
as well as the fate of the fetal testis overall, directly contributing to the number of germ and Leydig
cells as seen in mice (Rebourcet et al., 2017). It is also crucial that this threshold is reached to
provide the testis with the proper level of hormones and proteins that drive spermatogenesis
(Meroni et al., 2019). When formed, SCs arrange in a basolateral manner, forming the seminiferous
cords, renamed seminiferous tubules (ST), of the testis after the neonatal period. Sertoli cell
proliferation and differentiation from the somatic cell lineage is supported by the coordinated
action of genes including the transcription factor Sex Determining Region Y (Sry), Wilms tumor
gene 1 (Wt1), SRY-Box Transcription Factor 9 (Sox9), Anti-Mullerian hormone (Amh), Vimentin,
Inhibin subunit alpha (Inha) and fibroblast growth factor 9 (Fgf9). The Sry gene, which appears at
E10.5 and prompts the formation of the testis cords, directly targets Sox9 which is then regulated
by Wt1 and Fgf9 (Gao et al., 2006, DiNapoli and Capel, 2008, Haverfield et al., 2015, Yao et al.,
2015). The SRY protein is crucial for directing SCs into their lineage and preventing differentiation
into the ovarian granulosa. Researchers also showed that downstream of SRY, Fgf9 acts as a key
regulator of Sox9 expression and overall SC proliferation during the sex determination period
(Schmahl et al., 2004). In fact, Fgf9-deficient mouse testes do not differentiate properly and revert
to the XX phenotype (Colvin et al., 2001). Sox9 can then activate a network of genes that are vital
for testis development including Prostaglandin D2 Synthase (Ptgds) and AMH. Prostaglandin D2
(PGD2), which is synthesized from PTGDS, helps establish the SC fate by coordinating the
translocation of Sox9 to the nucleus and, when the testis cords form, SCs secrete AMH which seals
the gonadal fate of the testes (Yao et al., 2015). In humans, AMH is a Sertoli-specific sex
differentiation marker that is consistently expressed from embryonic life until males are
approximately 5 years old (Franke et al., 2004). As summarized by Corpuz-Hilsabeck and Culty
(2023) through data from multiple studies, AMH concentration and expression can regulate the
fate of SCs: low concentrations are associated with increases in SC proliferation, while high
concentrations are associated with SC apoptosis. In addition, AMH clearly plays a role in defining
the testicular architecture as loss of AMH expression has been linked to loss of germ cells and
testis cord disruption (Corpuz-Hilsabeck and Culty, 2023). Crucially, because the precursors to
SCs are sex-indiscriminate, these factors are also required for sex determination.
The testicular architecture is established during the fetal period and must occur for proper
testis development and spermatogenesis to take place at puberty. The arrangement of cells into the
fetal testis must place SCs and GCs within the seminiferous cord while peritubular myoid cells
arrange around the cord, and other somatic cell types such as Leydig cells (LCs) and blood vessels
are positioned between seminiferous cords, forming the interstitium (Corpuz-Hilsabeck and Culty,
2023). Sry/Sox9 co-expression leads to Sertoli cells surrounding and protecting primordial germ

4
cells and forming the basis of the seminiferous cords (Yao et al., 2015). Eventually, Sertoli cells
will mature and support germ cells to progress throughout spermatogenesis later in their
development, including the necessary process of meiosis leading to the formation of haploid germ
cells differentiating into spermatozoa (O’Donnell et al., 2022). In the mouse testis, Sertoli cells
support the maturation of gonocytes to subsequent steps of spermatogonia, then spermatocytes,
followed by spermatids which further develop into spermatozoa, later released from SCs into the
lumen of the seminiferous tubules. In males, retinoic acid (RA), the body’s active form of Vitamin
A, regulates germ cell development, from the differentiation of gonocytes and several
spermatogonia steps and pre-leptotene spermatocyte formation (Schleif et al., 2022, França et al.,
2016, Meroni et al., 2019, Manku and Culty, 2015b). Fetal SCs produce the enzymes involved in
RA synthesis, as their counterparts do in fetal ovaries, where RA regulates the entry of oocytes
into meiosis. In fetal male germ cells, this process is prevented by the expression of cytochrome
P450 family 26 subfamily B member 1 (Cyp26b1), an enzyme that degrades RA, allowing fetal
testicular germ cells to remain diploid cells dividing by mitosis and preventing the disruption of
testis cord development (DiNapoli and Capel, 2008, O’Donnell et al., 2022). Although Cyp26b1
decreases with time, other factors block the premature entry of fetal male germ cells into meiosis.
While fetal SCs regulate the development of fetal LCs, LCs also regulate fetal SCs
proliferation and seminiferous cord elongation through signaling pathways involving the TGFB
superfamily of activins and inhibins, encoded by Inha, and several inhibin beta subunits, including
Inhba, Inhbb, or Inhbc (Barakat et al., 2008). Activin A, the homodimer of the Inhibin Beta
subunits, can signal to phosphorylate downstream Suppressor of Mothers Against Decapentaplegic
(SMAD) family of proteins, including Smad4 which coordinates the late-stage embryonic process
of testis cord elongation during the second wave of SC proliferation (Yao et al., 2015). After birth,
SCs secrete RA with a peak in stages VIII and IX of the spermatogenic cycle corresponding to
spermatogonial differentiation (Griswold, 2018). Because RA in part determines the fate of
spermatogonial differentiation, it is continuously modulated by SCs, especially during the first
wave of spermatogenesis, which occurs while SCs are still proliferating (O’Donnell et al., 2022).
Another factor produced by fetal and postnatal SCs that aids the growth and survival of
other somatic cell types is Desert Hedgehog (DHH), which is involved in initiating the formation
of androgen-producing fetal Leydig cells (Clark et al., 2000). In addition, DHH has been shown to
be critical in its regulation of early- and late-stage spermatogenesis in mice, as it persists within
the SCs throughout their development. In mice, Dhh produced by Sertoli cells regulates germ cell
meiosis and testis size. The same study also showed that in a Dhh-null phenotype, male mice were
infertile as the germline had failed to reach the threshold in the mutant strains (Bitgood et al.,
1996). Thus, fetal Sertoli cells are key players in establishing testis morphogenesis and provide
support to the testis.
Neonatal/Immature Sertoli Cells:
Immature Sertoli cells continue proliferating throughout their development, which is
crucial for the development of the testicular characteristics such as size. Importantly, humans differ
from rodents in that postnatal mice and rat SCs proliferate from birth to puberty, while human SCs
proliferate for a period after birth and again at the onset of puberty (O’Donnell et al., 2022, Barakat
et al., 2008). While the exact mechanisms of proliferation are species-dependent, in most species
SC proliferation is confined to the prepubertal stages of development and ends before SC
maturation begins.

5
During the neonatal period, Follicle Stimulating Hormone (FSH), produced by the
pituitary, largely governs SC proliferation, with SC-generated Inhibin-beta exerting a feedback
loop on the axis (O’Donnell et al., 2022, Shah et al., 2021). FSH receptor (FSHR) is heavily
expressed in Sertoli cells and FSH/FSHR G protein coupling sets off signaling cascades, such as
those of MAPK/ERK and PI3K/AKT, which support downstream SC functions in opposing ways
(Meroni et al., 2019, Shah et al., 2021). In rat Sertoli cells, it was found that FSH activates ERKdependent pathways which leads to the localization of ERK1/2 to the nucleus and later
upregulation of cyclin D1 (Ccnd1) allowing cell cycle progression and proliferation. FSH can then
inhibit ERK signaling during differentiation, showing that its role can also be related to bridging
the transition between the proliferation and differentiation stages and solidifying the maturation of
SCs (Crépieux et al., 2001, Shah et al., 2021). Meanwhile, the FSH-mediated activation of the
PI3K/AKT (PKB) pathway can then feedback to upregulate FSH. In rat Sertoli cells, researchers
found that FSH-mediated PI3K/PKB pathway is crucial to SC function, determining that PKB
activation is required to maintain FSH levels independent of PKA activation and downstream
signaling (Meroni et al., 2002). This shows that the function of FSH in activating various signaling
pathways to regulate SC proliferation is highly dynamic. FSH, along with other genes such as
Sox9, WT1, and members of the AP-1 transcription factor family also regulate AMH and Inhibin
B expression, which are crucial to testis development in the fetal to neonatal stage. In fact, not
expressing these hormones ultimately leads to Disorders of Sex Development (Lucas-Herald and
Mitchell, 2022).
Many pathways overlap in the context of SC proliferation. MAPKs including ERK1/2,
JNK/SAPK, and p38 are all expressed within immature SCs and, in some cases, with the help of
FSH, can both activate or be activated by other signaling molecules to induce proliferation
(Petersen et al., 2005). For example, the Insulin Growth Factor (IGF) family contributes to SC
proliferation during the immature period in rats by activating the MAPK and PI3K/AKT pathways
as well as regulating the role of FSH in proliferation and metabolic processes including the uptake
of calcium and transport of glucose which is an important function of SCs. Both IGF-1 and -2
communicate via their receptors and continue regulating processes such as spermatogenesis as SCs
mature (Corpuz-Hilsabeck and Culty, 2023, Meroni et al., 2019, Escott et al., 2013). Indeed, a
study in primary rat SCs found that BrdU did not incorporate as readily into DNA when the IGF1 receptor was not present in an IGF-1 knockout model, showing decreased SC viability with or
without FSH stimulation (Froment et al., 2007).
As mentioned, the TGFB superfamily of activins and inhibins can also regulate SC
proliferation via paracrine signaling (O’Donnell et al., 2022). During the proliferative stage, SCs
are responsive to both FSH and Activin A. Activin A is produced by Leydig cells and directed to
SCs, which binds its receptor and ultimately leads to the phosphorylation of the Smad2 or Smad3
family of signaling molecules, inducing the transcription of the adhesion protein Gap Junction
Alpha 1 (Gja1), also called Connexin-43, and the serine protease inhibitor, Serpina5, involved in
SC proliferation and maturation. Hence, the TGFB signaling pathway and subsequent activation
of Smad2/3 is required to transition from the proliferative to differentiating stages in Sertoli cells
(Archambeault and Yao, 2010, Ni et al., 2019). SCs produce Inhibin B, which regulates the
amounts of FSH produced by the pituitary via negative feedback, with FSH controlling immature
SC proliferation. Changes in the concentration of Inhibin B produced by SCs throughout the
neonatal period were shown using BrdU incorporation in replicating DNA, that when Inhibin B
levels rose improperly, this could lead to delay or failure to reach SC maturation. The finding that
Inhibin B plays a role in the transition between stages was critical because it seems to be species-

6
independent: the rise in Inhibin B occurs during the period in development where SCs are
proliferating in various species (Sharpe et al., 2003). With such a large role in SC proliferation,
the level of Inhibin B reflects the number of SCs produced once the proliferative stage ends. It is
then this threshold in SC number that determines the number of germ cells produced and the
spermatogenic capacity of the testis (Barakat et al., 2008).
Interestingly, although the cytokine family of interleukins (IL) is generally associated with
immune cells, Sertoli cells can produce IL-1 themselves (Loveland et al., 2017). As researched by
Petersen and colleagues, ILs contribute to SC development as growth factors in a coordinated
manner with the MAPK pathway and FSH. Their lab showed that constitutively active IL-alpha
and inducible IL-beta both stimulate SC proliferation in immature male rats by increasing DNA
and thus directly impacting the number of SCs produced, with IL-alpha playing a slightly larger
part (Petersen et al., 2002). They then set out to identify the molecular mechanism behind cytokine
contribution to SC proliferation. The lab found that antagonizing the IL-1 receptor with the
endogenous ligand IL-1 receptor antagonist led to a drop-off in phosphorylation of p38 and
JNK/SAPK pathways (Petersen et al., 2005). It has also been shown that IL-1 can activate activins
which, of course, also play a key part in SC proliferation (Loveland et al., 2017). This research is
pivotal, as cytokines are generally associated with the testis for their ability to maintain immune
privilege in the testis as a whole, rather than any direct impact they may possess in Sertoli cells
(Meroni et al., 2019).
The conclusion of the neonatal to juvenile proliferation stage is driven by signaling
involving retinoic acid, androgens, estrogens, and thyroid hormones (Shah et al., 2021, CorpuzHilsabeck and Culty, 2023). Sex hormones are especially relevant in their ability to directly
regulate the transition between developmental stages (Shah et al., 2021). In an in vivo study on
immature male rats [3H] thymidine uptake by Sertoli cell nuclei was measured over the course of
21 days after the 3-day old pups were hemicastrated, to track their proliferation post-treatment
with testosterone. They showed that hemicastration typically increases the rate of proliferation in
Sertoli cells, while testosterone treatment had a direct effect on the cessation of SC proliferation
in the hemicastrated rats. Additionally, this was mediated by FSH showing its possible role in
preventing premature cessation of proliferation by testosterone (Orth et al., 1984). The regulation
of estrogen signaling also plays a role in the transition from an immature to a mature Sertoli cell,
and it is heavily dependent on which estrogen receptor (ER) isoform is activated. Studies have
found a link between ER-a activation by receptor agonist 17B-estradiol (E2), and an increase in
proliferation in 5- to 15-day old rat SCs cultured in vitro observed via upregulation of Cyclin D1
(CCND1), whereas ER-b stimulation led to an increase in the Cyclin-dependent kinase inhibitor
1B (CDKN1B, p27Kip1, p27Cip1) in 20- to 30-day old rat SCs, a target that is associated with SC
maturation (Macheroni et al., 2020). Interestingly, nonspecific antagonization of ERs with receptor
antagonists such as ICI 182,780 can also activate SC proliferation in a period in which SCs are
proliferating in boars (Berger et al., 2013). More recently, SC proliferation has been observed
when estrogens bind to G-protein estrogen receptor (GPER), which begs what effect GPER
antagonists may have on SC proliferation (Meroni et al., 2019). Finally, at the maturation stage in
rats, Cytochrome P450 aromatase, or estrogen synthase (CYP19A1), is measurably downregulated
by thyroid hormone (Sharpe et al., 2003).
While sex hormones play a more overt role in suppressing proliferation and promoting the
transition to differentiation, RA and thyroid hormone triiodothyronine, or T3, can affect SC
proliferation. Several papers have summarized the ability of T3 to reduce the proliferation of SCs,
which is mediated by FSH. In one study, Sertoli cells were isolated from 5-day old rat testis and

7
treated with T3 and FSH simultaneously and showed increased levels of Inhibin B mRNA, which
is also a marker of SC differentiation. Clusterin, whose mRNA expression is also a demarcation
of SC differentiation, increased because of T3 + FSH co-treatment. Thus, hyperthyroidism can
affect the onset of SC differentiation and maturation (Cooke et al., 1994). Additionally, T3 binding
to the thyroid alpha 1 receptor can stimulate the next phase of SC development via actions such as
ST canalization (Holsberger et al., 2005). It has also been shown that retinoic acid, testosterone,
and T3 collectively reduce SC proliferation in vitro in rats, by inducible action of cell cycle
inhibitors in the Cdkn2b family (Buzzard et al., 2003). Consequently, both T3 and FSH can also
induce AR expression, likely through different mechanisms (Arambepola et al., 1998b). As it turns
out, RA can also suppress proliferation of immature rat SCs in its ability to directly antagonize
Activin A, a key component in SC proliferation. Nicholls et al. (2013) treated primary cultured rat
SCs with RA and recombinant Activin A and subsequently measured the rate of proliferation via
incorporation of EdU to show the role that RA played in suppressing the action of Activin A and
consequently promoting the cessation of the proliferative stage (Nicholls et al., 2013). In addition,
RA clearly bridges the transition between the neonatal and pubertal stage, as mice lacking RA
cannot form the proper structures indicative of a mature Sertoli cell (Chung et al., 2010). RA is
directly involved in increasing expression levels of proteins markers associated with a
differentiated SC that are required for the assembly of the tight junctions between adjacent SCs
(Haverfield et al., 2015).
Shutting off the pathways involved in SC proliferation is another way in which the bridge
between the neonatal and mature stages of SC development is built. For example, the PI3K/AKT
pathway promotes proliferation during neonatal development, but its regulator, phosphatase and
tensin homolog (PTEN), becomes active during the mature phase, shutting off FSH stimulation of
proliferation by this pathway (Tarulli et al., 2012). Additionally, the AMPK pathway has also been
shown to counteract the activity of the PI3K/AKT pathway during proliferation or similarly to T3,
by activation of cell cycle inhibitors and inhibition of global proteins involved in proliferation (Ni
et al., 2019). Many of the pathways that contribute to regulating SC growth and maintaining their
function in the neonatal/developmental period have also been shown to play a role in
spermatogenesis, as will be discussed in the following section.
Mature or Adult Sertoli Cells:
Adult Sertoli cells must exist in a manner that can support their biological functions,
controlling the subtypes of meiotic or post-meiotic germinal cells that can exist within their various
stages of development at the same time, and other somatic cell types (O’Donnell et al., 2022). The
hallmark of SC maturation stage in mice is SC terminal differentiation at around 7 to 11 days postpartum, when they cease proliferation, are no longer FSH hormone-responsive, and begin to form
tight junctions between each other. It is important to state that the concept of SC terminal
differentiation is contested since it may exist on species-by-species basis. For example, seasonal
breeders like Djungarian hamsters can potentially maintain their proliferative capacity in
adulthood, and human and mice models have shown an ability to regain proliferative capacity after
a quiescent period in various circumstances (Tarulli et al., 2012). As mentioned, however, there
are other clear indicators of SC maturation, such as differential gene and protein expression levels,
and the untimely alteration of such factors can potentially have negative consequences.
Around the onset of puberty, undifferentiated Sertoli cells are no longer mitotically active
and begin to express Androgen Receptor (AR) (Corpuz-Hilsabeck and Culty, 2023, Griswold,
2018). This AR expression promotes the process of spermatogenesis via AR stimulation by

8
testosterone in mature SCs, as GCs do not express AR themselves (Culty, 2009). Androgen
responsiveness is a highly regulated process within Sertoli cells. Researchers used a model to direct
premature AR expression in Sertoli cells, known as the transgenic SC-specific AR (TgSCAR)
model, into immature male mice and found that TgSCAR mice showed decreased testis size as
well as a discrepancy in proper lumen/ST formation and formation rate (Hazra et al., 2013). On
the other hand, SCAR knockout models further provided evidence that AR is crucial for SC
differentiation and function, as SCARKO mice could not maintain BTB integrity (Willems et al.,
2010). During puberty, Activin A levels drop drastically when SCs are considered mature (Meroni
et al., 2019). In contrast, T3 and FSH co-treatment which, as described, can signal to increase
levels of Inhibin B mRNA during the neonatal period, can also induce AR expression while
suppressing AMH expression after the neonatal stage, in preparation for the maturation stage
(Sharpe et al., 2003, Arambepola et al., 1998a).
The mature SC is marked by distinct changes in morphology. At terminal differentiation,
the adherens, gap, and tight ‘desmosome-like’ junctions between SCs form and create the BTB
and regulate the seminiferous tubule microenvironment and allow GC meiosis and post-meiotic
processing to take place (O’Donnell et al., 2022). This niche is dynamic, as the Sertoli cells can
adapt their morphology to accommodate the various stages of spermatogenesis, allowing GCs to
move as they differentiate and attach. The Sertoli-Sertoli tight junctions are unique in that they not
only facilitate interactions internally, but also at junctions with spermatids and can operate as a
recycling service within the seminiferous epithelium. The BTB and associated transport proteins
play a huge role in providing support to the GCs by producing and transporting elements crucial
for their survival and function, such as various micronutrients and iron (transferrin) (França et al.,
2016, Haverfield et al., 2015). Sertoli cells continuously express tight junction proteins, occludins
and claudins which, with the help of FSH and testosterone, regulate the formations of these
junctions and maintain BTB integrity (O’Donnell et al., 2022). In addition, many of the factors
that establish the integrity of these internal structures play a larger role in SC function and
development overall. Gap junction proteins, such as Connexin-43 (Gja1), and tight junction
proteins, such as Claudin-11, are expressed to regulate junction dynamics but play a role in
proliferation dynamics as well (Tarulli et al., 2012). For example, Connexin-43 knockout model
led to altered expression of targets that are relevant for the transition between the proliferation and
differentiation stages (Hilbold et al., 2020).
This period of SC development also marks alterations in the SCs cytoskeleton, nucleus,
nuclear envelope, and these changes are associated with their mature functions and their role in
supporting the meiotic and post-meiotic germ cells (França et al., 2016, Shah et al., 2021,
O’Donnell et al., 2022). Changes in morphology involve FSH, as it was shown in hypogonadal
(hpg) (with low testosterone levels) mice lacking gonadotropins, including FSH, that SC nuclei
did not have their normal tripartite structure indicative of a differentiated SC, overall SC numbers
were low, and the BTB failed to form (Haverfield et al., 2015). The same was observed in hpg
mice that were treated with testosterone, meaning that testosterone replacement was not sufficient
to recover proper morphological development. As expected, hpg mice that were treated with
androgen showed no background FSH activity (since negative feedback was enhanced by
exogenous testosterone), which helped elucidate FSH-independent actions by androgens,
including their role in GC late-stage meiosis, as the study suggests (Haywood et al., 2003). The
hpg mouse model has also shown that proper androgen signaling is required to maintain the
structure of SC-SC tight junctions. In hpg mice, it was observed that overall testis morphology
was impacted and the localization of connexin-43 and claudin-11 was altered. Overall expression

9
levels of claudins (claudin-3 and -11) were also drastically lowered. Treatment with
dihydroxytestosterone, a potent androgen, was able to recover some of the functions lost in hpg
mice, especially when co-treated with human transgenic FSH, although FSH alone cannot support
the formation of these tight junctions (McCabe et al., 2012).
Proteins that underpin SC differentiation, either during sex differentiation or whilst they
mature, include Doublesex- and Mab-3- Related Transcription Factor 1 (DMRT1), GATA Binding
Protein 4 (GATA4), WT1, all three of which are targets of SOX9 (Rahmoun et al., 2017).
Regulation of these factors is crucial for testis differentiation (Corpuz-Hilsabeck and Culty, 2023).
For example, DMRT1 actions have been linked to the decline in SC proliferation after the
immature period (Yang and Oatley, 2015). Signaling pathways that are relevant to the support and
function of adherens and tight junctions as well as the SC role in spermatogenesis during SC
differentiation include the AMPK, MAPK, and TGFB/SMAD pathways, best reviewed by Ni and
colleagues in 2019 examining these pathways in rodents. Briefly, as they summarize, the MAPK
pathway is heavily involved in regulating germ cell development and spermatogenesis, being the
primary signaling mechanism that regulates SC tight junctions. The AMPK pathway plays a role
in maintaining energy metabolism by regulating lactate secretion and can also activate the
expression of key junctional proteins. The TGFB family members can also regulate tight junction
dynamics through downstream signaling of Junctional adhesion molecule (JAM) proteins. Other
TGFB targets include Smad4, which plays a role during fetal life, but is also critical for
spermatogenesis, as deleting the gene leads to decreased testis size and sperm count. See (Ni et al.,
2019) for more information.
Key Functions of Sertoli Cells in Spermatogonial and Testicular Development:
Independent of their stage of maturation, functional SCs can always nourish germ cells,
dynamic in their ability to adapt their function throughout GC development based on their needs
(Sharpe et al., 2003). SCs regulate fetal to neonatal gonocytes, the undifferentiated precursors to
spermatogonial stem cells (SSCs), then spermatogonia and subsequent GC types, all the way to
spermatozoa. SSCs themselves form the spermatogonial niche, comprising SCs and myoid cells,
and while some SSCs proliferate to maintain the niche, others differentiate throughout
spermatogenesis starting at puberty to form spermatozoa (Culty, 2009, França et al., 2016).
Because Sertoli cells enclose and nurture germ cells, they are of the utmost importance for
maintaining the SSC niche and subsequent GCs, doing so primarily by producing and secreting
growth factors throughout the developmental scheme.
The fetal/neonatal testis is associated with several key events: SC proliferation and
gonocyte cell cycle arrest, when proteins that increase SC proliferation, such as Activin A, are
active, followed by resumption of gonocyte proliferation after birth. As SCs develop, they guide
gonocytes to proliferate, migrate to the basement membrane, and differentiate with the help of SCsecreted proteins fibroblast growth factor 2 (FGF2) and Leukemia inhibitory factor (LIF) (Yang
and Oatley, 2015). Glial cell line-derived neurotrophic factor (GDNF) production by SCs is crucial
for many processes related to SSCs. For example, GDNF maintains SSC niche through up and
downregulation of FSH via the Notch1 signaling pathway (O’Donnell et al., 2022, França et al.,
2016). Overall, Notch1 signaling is critical for SC-GC relations, as shown by a study conducted
in reporter mice designed to overexpress Notch1, which found that premature Notch1 signaling
led to aberrant GC behaviors, resulting from decreased Cyp26b1 and Gdnf expression in SCs, an
effect that was also observed in vitro in a Notch1 loss of function assay. Therefore, timely Notch1

10
signaling is required for proper germ cell maintenance by Sertoli cells (Garcia et al., 2013). GDNF
can also support SSC proliferation by activating the ERK pathway (Hai et al., 2014).
Several other paracrine- or autocrine-signaling proteins secreted by SCs are involved in
supporting the SSC niche. For example, chemokine factor C-X-C motif chemokine 12 (CXCL12),
SC differentiation marker DMRT1, and a cytokine known as the Kit ligand (Stem Cell Factor) aid
with SSC migration through the lumen during spermatogenesis. ER agonist E2, RA, and growth
factors including Platelet derived growth factors PDGFB and PDGFD, FGF2, epidermal growth
factor (EGF) family, and LIF all support either gonocyte proliferation, survival, or both and
ultimately, the expansion of the SSC population (Culty, 2009, França et al., 2016, O’Donnell et
al., 2022, Yang and Oatley, 2015). SSCs go through periods of proliferation, self-renewal, and
differentiation, which are maintained by several SC-secreted factors including GDNF, CXCL12,
EGF, LIF, and bone morphogenic proteins (Yang and Oatley, 2015).
Hormones mediated or secreted by SCs also play a large role in the process of GC
differentiation and spermatogenesis. Germ cells themselves do not have receptors for FSH or
androgens, so their effects must also be mediated by somatic cells including SCs. As well as aiding
in gonocyte proliferation, RA produced by SCs is also the driver of spermatogonial differentiation,
and without it, spermatogonia become arrested as A spermatogonia (Culty, 2009, Hai et al., 2014).
Additionally, factors produced by SCs during spermiation regulate the quality of sperm being
released from the lumen (O’Donnell et al., 2022). These findings collectively assert that Sertoli
cells are vital throughout the entire process of spermatogenesis. If these processes are not regulated
by SCs, it can lead to testicular tumors, infertility, disease (Hai et al., 2014, Yang and Oatley,
2015).
The testis is established as an organ with immune privilege. Sertoli cells contribute to testis
immune privilege inherently because of their unique ability to create the blood-testis barrier and
the secretion of proteins that have immunoprotective properties (Griswold, 2018). Cytokines
clearly play a role in regulating SC proliferation, but they are also responsible for maintaining
overall testis immune privilege by contributing to the functionality of the SC tight junctions
(França et al., 2016). Many cytokines, including IL6 and IL10 are secreted by Sertoli cells and can
protect germ cell integrity (Loveland et al., 2017). Androgen signaling also plays a role in
maintaining immune privilege, which is unsurprising given the role it plays in maintaining the
BTB. In mice, ablation of the androgen receptor leads to improper functioning of the BTB which,
in normal conditions, prevents immune cells from entering, causing inflammation, and launching
an autoimmune response which can damage developing testicular cells, including germ cells which
are already auto antigenic. Thus, androgen action in SCs may in fact regulate the permeability of
the BTB (Meng et al., 2011). As reviewed by Kaur and colleagues (2014), BTB integrity is not the
only factor involved in maintaining the immune privilege of the testis, as certain species do not
even form their BTB until later developmental stages. Moreover, some germ cells are located in
the basal compartment of the STs, including spermatogonia and preleptotene spermatocytes, and
thus they are not protected by the BTB, contrary to more mature germ cells located in the adluminal
compartment. These cells and the overall testis are also protected by other SC proteins
independently of the BTB, and by other testicular cells such as dendritic cells, macrophages and
Treg, which provide additional protection to germ cells (Kaur et al., 2014). Based on their signaling
and the variety of factors that they secrete, SCs play a clear immunomodulatory role and contribute
heavily to testis immune privilege.

11
Sertoli cells have an extended role via multiple functions which cannot all be summarized.
What is captured here is a mere glimpse into their immense capacity to direct testicular
development and lifelong functioning, as it relates to aspects that are relevant to the thesis project.
EDC and Pharmaceutical Mixture Risk Assessment Strategies:
Endocrine disrupting chemical is an all-encompassing term for any natural or synthetic
environmental pollutant that has the capacity to affect the endocrine system (Gao et al., 2015).
What’s more, even pharmaceuticals with proven health benefits have the potential to disrupt
endocrine functions (Sabir et al., 2019). Research into harmful chemicals building up in the
environment was spearheaded by scientists in the 1960s and 70s. However, the term “EDC” did
not appear until 1991 (Schug et al., 2016). Coincidentally, before the late 1990s in the United
States, the focus in male reproductive toxicology was studying the effects of individual chemical
compounds or EDC class subgroupings until 1996, when the EPA campaigned for an expansion
on risk assessment in mixtures (EPA, 1996). Still, the focus remained for quite some time on
individual chemicals and their effects on male reproductive health. However, studying individual
effects of an EDC may lead to gross underestimations of real-world exposures.
There are two resounding approaches when it comes to delineating the adverse effects
associated with EDC mixtures on male reproductive function. The “Typical Framework” approach
assesses the impact of co-exposure within one chemical class and its cumulative toxic effects. This
relies on concentration or dose addition models, also known as the hazard index (HI) approach,
which assumes that chemicals are more toxic when the summed effect is greater than the ratio of
exposure to the permitted dose (hazard quotient) of each chemical individually (Orton et al., 2014,
Price, 2023, Kortenkamp and Faust, 2010). Just as it is for examining chemicals individually,
studying EDC mixtures based on chemical similarity discourages the assessment of mixtures
containing compounds belonging to different EDC classes, which better mimics human exposure.
Kortenkamp and colleagues published a pivotal review ascertaining that mixtures composed of
chemicals acting dissimilarly have an effect below their no observed adverse effect levels
(NOAELs), while it was previously held that NOAELs are ‘zero effect’ level doses and that
chemicals at doses below their NOAELs with dissimilar modes of action cannot produce an effect
when combined (Kortenkamp et al., 2007). Their review focused mainly on ecotoxicity, which
prompted researchers to ask these questions in human-relevant models. Since then, Orton et al.
have shown that low doses of EDCs with dissimilar modes of action compound to produce a similar
adverse effect, such as AR antagonism (Orton et al., 2014). Increasingly, mixture studies in the
context of male reproductive toxicity have involved dose addition or HI approaches, including
chemicals with different proposed mechanisms or independent actions, which, when combined,
may lead to a common adverse outcome. Hence a second strategy, “Expanding Frameworks”.
To recapitulate, both frameworks have merit, however, assessing via the “Typical
framework” has similar limitations as assessing one chemical at a time: it is not fully representative
of realistic human exposure. Still, understanding mixture risk effects within chemical classes has
set the stage for more robust assessments by establishing the underlying adverse outcomes within
EDC classifications.
As the current literature expands on EDC mixture toxicity, mixture risk assessments and
experimental studies tend to inform each other on how to drive the field forward. Mixture risk
assessments take the existing body of evidence to make mathematically-derived inferences about
exposure levels and health impact (Kortenkamp, 2014). These assessments can provide valuable
information about a multitude of chemicals and their mixtures that pose a risk to male reproductive

12
health and development. A limiting factor is that these assessments rely on research data for EDC
mixtures that were deemed relevant by investigators, representing only a fraction of EDCs that
humans are exposed to, and on the experimental strategies used, which may not be representative
of human exposures (Dutta et al., 2023). In addition, these studies typically assess impact via in
vivo data or epidemiological evidence, which may limit specific understanding of harmful
exposure on a cell-to-cell basis. Crucially, in vivo analyses must complement in vitro studies to
assess the overall impact, given that both approaches can provide different sets of information
(Gao et al., 2015). Our previous research has characterized the effects that in vivo exposure to
EDCs, alone and mixed, can have on male reproductive functions with less of a compartmental
focus. There are still minimal studies addressing the effects of EDC and pharmaceuticals directly
on Sertoli cells, especially from a mechanistic perspective, despite ample evidence that human and
rodent SCs and SC-GC connections are vulnerable to these chemicals (Gao et al., 2015, CorpuzHilsabeck and Culty, 2023). Individual effects on Sertoli cells are reviewed in: (Corpuz-Hilsabeck
and Culty, 2023, Rey et al., 2009, Hai et al., 2014).
Much of the current literature highlighting the effects of EDC mixtures on testicular
function inherently focuses on the ways that these chemicals affect sex hormones. Typically, these
chemicals are categorized as exhibiting antiandrogenic or estrogenic/antiestrogenic capabilities,
and sometimes as altering both androgenic and estrogenic signaling modalities (Lazarevic et al.,
2019). Although much can be inferred upon, this type of approach should prioritize
compartmental, cell-specific analyses, especially considering that sex hormone-related signaling
varies on a cell-to-cell basis. For example, the only cells in the seminiferous tubules that express
androgen receptors are Sertoli cells (Wang et al., 2022). Thus, assessing the impact of
antiandrogenic chemicals on whole testis tissue may not tell the whole story, especially if the goal
is to assess what is occurring mechanistically. Similarly, when answering for EDCs that have
estrogenic or anti-estrogenic qualities, focusing on SCs is relevant considering that in the immature
testis, the SCs are the main source of estrogens (Carreau et al., 2011). Following the adverse
outcome approach accounts for the fact that EDC mixtures can alter several signaling pathways. It
has even been shown that one EDC within a mixture can exacerbate the effects of other EDCs
within that mixture, or just make cells more susceptible to adverse outcomes overall (Lazarevic et
al., 2019). Additionally, studies have reported that some of the antiandrogenic consequences that
lead to the disruption of spermatogenesis may occur as a result of the estrogenic activity of certain
EDCs in fetal Sertoli cells (Rey et al., 2009). Therefore, the most holistic approach is to observe
the effects of EDC mixtures exerting different mechanisms of toxicity within the animal, tissues,
or isolated cells.
Henceforth, the content of my thesis addresses the gap in understanding the effects of EDC
and pharmaceutical mixtures at environmentally relevant doses on immature rodent Sertoli cell
functions using an in vitro mechanistic approach.
Project Rationale:
As summarized above, Sertoli cells (SCs) are the backbone of the testicular ecosystem,
crucial for male fertility because not only are they the nurse cells to the germ cell, facilitating their
development into spermatozoa, but they also support the development of other somatic cell types
such as Leydig cells and peritubular myoid cells (França et al., 2016, Corpuz-Hilsabeck and Culty,
2023). The modern world is plagued by male reproductive health issues. There are higher rates of
testicular cancer, sperm quality is declining, and there is a greater incidence of disorders such as
hypospadias and cryptorchidism. Skakkebæk and colleagues have asserted that these disorders are

13
caused by what they have dubbed testicular dysgenesis syndrome (TDS) and that fetal and
perinatal exposures to EDCs, which can lead to TDS, typically stem from somatic cell injury
(Skakkebaek et al., 2001, Martinez-Arguelles et al., 2013). In reviewing the evidence linking TDS
and SC dysfunction, others have observed that TDS can also occur when SCs fail to properly
differentiate during puberty (Sharpe et al., 2003). Thus, Sertoli cell susceptibility to toxicant
exposure at any stage of development poses a serious threat to testicular health and fertility.
Phthalate esters are a long-standing area of interest in the study of EDCs and the scope of
their effects on male reproductive health. Phthalates are commonly used as polymer plasticizers in
industrial and commercial settings and are so pervasive that they are detected as contaminants in
water, soil, air, food, medical devices, and all humans. Of them, the most common is Di-(2-
ethylhexyl) phthalate (DEHP), which is metabolized in the body to its more potent form, mono(2-
ehtylhexyl) phthalate (MEHP) (Kavlock et al., 2006, Gao et al., 2017, Martinez-Arguelles et al.,
2013). Phthalates are prototypes of EDCs associated with TDS, proposing a common fetal origin
to the rising incidence of the disorders encompassed by TDS over the last decades (Skakkebaek et
al., 2001, Martinez-Arguelles et al., 2013).
Other common EDCs, including estrogenic compounds that differ from endogenous
estrogen species, are typically referred to as xenoestrogens. Xenoestrogens comprise mostly
manmade chemicals, but also natural substances such as phytoestrogens produced in plants. They
exert their effect by mimicking endogenous estrogen receptor ligands (Wang et al., 2021).
Genistein (GEN), an isoflavone found in soy, is a potent phytoestrogen shown to alter male
reproductive health in both in vivo and in vitro rodent studies (Lecante et al., 2022, CorpuzHilsabeck and Culty, 2023). There is growing concern about the level of genistein in soy-based
baby formula leading to unintended hormonal or nonhormonal effects in infants. Studies have
found that the level of soy flavonoids, particularly genistein, circulating in infants fed with soybased formula exceeds endogenous estrogen levels by up to 22,000 times and is 20 times greater
than what circulating levels in soy-reliant adults (Setchell et al., 1997, Suen et al., 2022). Taken
together, these data show that infants are vulnerable to the effects of dietary EDCs.
Our lab’s previous in vitro studies on isolated rat neonatal germ and the mouse MA-10
Leydig cell line, and in organ cultures of neonatal testes showed disruptive effects of MEHP and
GEN (Thuillier et al., 2010, Jones et al., 2015, Boisvert et al., 2016). Moreover, our in vivo studies
examining the effects of in utero exposure to DEHP and GEN on neonatal and adult testicular
function and fertility underscore the capacity of these chemicals to deteriorate testicular function.
In this model, we also assessed the impact of GEN exposure in combination DEHP at low doses
that mimic environmental and anthropogenic exposure levels. We found that in utero exposure to
GEN + DEHP at either 0.1 or 10 mg/kg/d altered a variety of endpoints in postnatal day 3 (PND3)
and adult (PND120) rat testes, such as the mRNA expression of gene representative of SC, Leydig
cell, and germ cell populations, as well as innate immune cells, increasing both pro- and antiinflammatory testicular macrophages (Jones et al., 2014, Walker et al., 2020). These studies
showed that fetal DEHP exposure disrupted antioxidant mechanisms in neonatal testes, which were
normalized when mixed with GEN (Jones et al., 2015). However, this apparent early protective
effect of GEN was not sufficient to prevent serious adverse effects of the mixtures in adult testes,
such as an increased incidence of rats with abnormal testes and infertility (Jones et al., 2014,
Walker et al., 2023, Walker et al., 2020). Moreover, the lower dose of the GEN-DEHP mixture
decreased circulating testosterone levels and increased Sertoli-only phenotypes both in F1 and F2
generations to a larger extend than either chemical alone. SC related markers such as androgen
binding protein (Abp) and Amh gene expression was downregulated by GEN + DEHP at PND6

14
and PND120 (Jones et al., 2014, Jones et al., 2015, Walker et al., 2023, Walker et al., 2020). Our
lab also delved into the in vitro effects of GEN + MEHP mixtures and observed that even at the
lowest tested dose (10 µM), the mixture altered the gene and protein expression of eicosanoid
pathway prostaglandin synthases and cyclooxygenase enzymes in murine SSCs, though the effects
on this pathway were considered to be GEN-driven (Tran-Guzman et al., 2022). This finding raises
questions about whether pharmaceuticals that act on this pathway, including analgesics, can also
lead to the disruption of Sertoli cell functions.
Non-steroidal anti-inflammatory drugs (NSAIDs), such as Ibuprofen (Ibu), and analgesic
Acetaminophen (APAP; paracetamol), which inhibit Cox enzymes (Fig. 2), also exhibit endocrine
disrupting properties in testicular tissue. Analgesic use for pain relief or fever is common in the
modern world and increased usage has raised concern, not only for human health, but for the
contamination of food and drinking water with these pharmaceuticals. Indeed, reports have shown
that analgesics are pervasive contaminants in drinking water (Philibert et al., 2023). In a
multinational study amongst pregnant women, approximately 50% of subjects reported using
analgesics during pregnancy, with approximately 47% of usage attributed to acetaminophen
(Lupattelli et al., 2014). Usage of mild analgesics, including Ibu and APAP, during pregnancy has
been associated with an increased incidence of TDS in rodent and human male offspring. The
endpoints tested matched those affected by antiandrogenic compounds, including decreased
anogenital distance and decreased testosterone levels (Kristensen et al., 2011, Kristensen et al.,
2012). It is also recognized that the eicosanoid pathway plays a role in the coordinated
development of the male gonad, and that eicosanoids and the enzymes leading to their synthesis
are involved in the regulation of spermatogenesis (Tran-Guzman and Culty, 2022). Rossitto et al.
observed that the offspring of pregnant mothers exposed to Ibu and APAP displayed a lowered
sperm count and delayed SC maturation (Rossitto et al., 2019). Importantly, APAP is of interest
because it is the most prescribed analgesic and antipyretic in infants (Kristensen et al., 2016, TranGuzman and Culty, 2022).
Our primary goal here is to assess the impact of EDCs and analgesics, both alone and
mixed, on immature Sertoli cell functions to best mimic real-world infant exposure. Given that
Sertoli cells are the gateway into the seminiferous tubules of the testis where the precursors to
sperm reside, we propose that by examining SC function after their exposure to EDCs and
pharmaceuticals we may answer questions about the mechanisms by which these chemicals can
lead to male reproductive toxicity. In support of this hypothesis, current literature comparing
antiandrogenic or estrogenic EDCs and APAP shows that their combined exposure is associated
with male infertility (Axelstad et al., 2018, Corpuz-Hilsabeck and Culty, 2023). We decided to
survey a broader range of EDC and drug mixtures to determine what combinations could disrupt
Sertoli cell functions in vitro using two rodent models. What we expected to find was that these
understudied combinations that infants are likely exposed to would impact SC function, and these
results could then be translatable to global dysregulation of testicular function. Initially, we looked
at four different compounds, including APAP, Ibu, GEN, and MEHP. In my thesis, I will only
present our data related to APAP and GEN because we focused most of them on my project and
are continuing to work on these two compounds and their mixture.

15
Fig. 2. Outline of the eicosanoid pathway. Phospholipase A2 (PLA2) is the enzyme that
cleaves phospholipids into lysophospholipids and arachidonic acid. Arachidonic acid is the
precursor to prostaglandins via the eicosanoid pathway, starting with COX-1 and -2 enzymes.
Prostaglandin H2 is the common precursor of other prostaglandins (PGs), such as PGD2, F2a, E2
and I2, and of thromboxane A2, via specific synthases (blue boxes). PGs then contact their
respective receptors (green boxes). Abbreviations: Phospholipase A2 (PLA2), Cyclooxygenase-1
(COX-1), Cyclooxygenase-2 (COX-2), Prostaglandin G2, H2 (PGG2, PGH2), Thromboxane-A
synthase (TBXAS1), Prostaglandin-D, F, E, I synthase (PGDS, PGFS, PGES, PGIS),
Thromboxane A2 (TXA2), Prostaglandin D2, F2α, E2, I2 (PGD2, PGF2α, PGF2, PGI2),
thromboxane receptor (TP), Prostaglandin D2 receptor 1, 2 (DP1, DP2), Prostaglandin F receptor
(FP), Prostaglandin E receptor 1 – 4 (EP1 – 4), Prostaglandin I receptor (IP).
Chapter II: Materials & Methods
Please note that elements of this method section were adapted or copied from (CorpuzHilsabeck et al., 2023), a study in which I was co-author, to keep consistent with the methods
employed.
TM4 Sertoli cell line culture:
Murine Sertoli cell line TM4 (Cat. no. CRL-1715, ATCC, Manassas, VA, USA) was
cultured in GibcoTM DMEM containing 4.5g/L d-Glucose, L-glutamine, and 110 mg/L of sodium
pyruvate (Thermo Fisher Scientific, Waltham, MA, USA) supplemented with either 10% heatinactivated FBS (Regular-FBS, REG-FBS) or charcoal-stripped FBS (CS-FBS) (Sigma Aldrich,
St. Louis, MO, USA) and 1% Penicillin-Streptomycin solution 100X (CorningTM).
Primary cell isolation:

16
Sertoli cells were isolated from PND8 rat testes as previously described (Manku and Culty,
2015a, Manku et al., 2012a, Manku et al., 2012b). Testes from 10 rat pups were decapsulated per
experiment, sequential enzymatic dissociation was performed, followed by differential plating
O/N of the trypsin supernatant containing Sertoli, myoid, and germ cells, in RPMI 1640 medium
(Invitrogen, Burlington, ON, CA) with 5% heat inactivated FBS (Sigma Aldrich, St. Louis, MO,
USA) at 37˚C, 3.5%CO2. The next day, floating germ cells were removed by aspirating media and
washes. Sertoli cells were lifted by short trypsin treatment and replated in 10% FBS, Regular (Reg)
or Charcoal-stripped (CS) (Sigma-Aldrich, St. Louis, MO, USA) followed by treatments the next
day. Sertoli cell purity was assessed based on IF staining with antibody against Vimentin (SCs),
α-SMA (peritubular myoid cells), and nuclear Vectashield® Antifade DAPI mounting medium for
total cell numbers (Vector Laboratories, Burlingame, CA, USA). Analysis with ImageJ (FIJI)
software of several samples gave a Sertoli cell purity of 68%.
Chemicals:
Genistein (4’,5,7-Trihydroxyisoflavone) (GEN, G), acetaminophen (APAP, A), ICI 182,
780 (ICI), NS-398 (NS), and FR122047 (FR) were purchased from SigmaAldrich (St. Louis, MO,
USA). G-15 (3aS*,4R*,9bR*)-4-(6-Bromo-1,3-benzodioxol-5-yl)-3a,4,5,9b-3Hcyclopenta[c]quinoline (G15) was purchased from Bio-Techne (Minneapolis, MN, USA). Stock
solutions of 10-1 M GEN were dissolved in ultra-pure grade dimethyl sulfoxide (DMSO from
VWR International, Radnor, PA, USA). APAP was dissolved in 100% ethanol (Commercial
Alcohols, USA). Stock solutions of 10-3 M ICI, 50 mM G15, 20 mM NS, and 10 mM FR were
dissolved in ultra-pure grade dimethyl sulfoxide (DMSO from VWR International, Radnor, PA,
USA). Stock solutions were stored at -20˚C.
Sertoli cell treatments:
TM4 or PND8 rat Sertoli cells were plated in 6, 12, 24, or 96-well Corning culture-treated
plates at 10,000 – 1,000,000 cells/well for assays including qPCR, cell viability (MTT), and cell
proliferation (EdU). TM4 cells were grown overnight to reach 70 – 80% confluency in media
containing either REG-FBS or CS-FBS, then treated accordingly. After replating in appropriate
culture dish, PND8 rat Sertoli cells were grown over three hours to adhere, then treatments were
added. All treatments were diluted in cell culture medium containing 10% of either REG-FBS or
CS-FBS. Treatments prepared in DMSO were filtered with 0.2 µm filters to ensure sterility,
whereas stocks made up in ethanol were directly diluted at the appropriate concentration in sterile
medium. Cells were treated with vehicle control (containing the same % DMSO and ethanol as
treatments) or 10, 50, 100 µM APAP, GEN, or their mixture for 24 – 72 hours (Fig. 3). Based on
their inferred mechanisms in Sertoli cells (see Chapter 4), APAP and GEN were compared to
pathway-specific antagonists and inhibitors at various concentrations including 1 µM ICI, 10 nM
and 100 nM G15, 10 or 100 µM NS, and 10 µM FR for 24 hours.

17
Fig. 3. Chemical structures of test chemicals acetaminophen (APAP, A) and Genistein (4’,5,7-
Trihydroxyisoflavone) (GEN, G) which cells were exposed to individually and mixed.
Cell viability:
TM4 cells were plated in 96-well CorningTM culture-treated microplates at 10,000 cells/
well and incubated overnight at 37˚C 5% CO2. MTT cell viability assay adhered to the
manufacturer’s protocol (Roche Cell proliferation kit I MTT, Sigma Aldrich, St. Louis, MO,
USA). TM4 cells were brought up in DMEM supplemented with 10% heat-inactivated FBS,
transferred to CS-FBS for treatment, and treated with APAP, GEN, their mixture, and their
prospective pathway-specific antagonists and inhibitors, over 24 – 72 hours. MTT reagent was
added at the end of a 24-hour treatment incubation. Cells were incubated for an additional 4 hours
at 37˚C, thereafter. This was followed by the addition of 100 µL of a solubilization buffer to each
treatment well. Cells incubated overnight at 37˚C with humidity. The spectrophotometric
absorbance (at 595 nm) of the solubilized formazan crystals was measured using the VICTOR™
X5 Multilabel Plate Reader (PerkinElmer, Inc., Waltham, MA, USA). Data are expressed as a fold
change compared to vehicle and calculated from at least three independent experiments done in
triplicate.
Cell proliferation:
TM4 cells were plated in 96-well CorningTM culture-treated microplates at 8,000 – 10,000
cells/well and incubated overnight at 37˚C 5% CO2. Cells were treated for 24 hours with Gen,
APAP, antagonists and inhibitors, alone or as mixtures diluted in 10% CS-FBS supplemented
medium. Incubation in 10 µM EdU (5’-ethynyl-2’-deoxyuridine) was performed over the last 6
hours of the 24-hour treatment according to the Click-iT™ EdU HCS assay (Invitrogen, Carlsbad,
CA, USA) manufacturer protocol. Cells were washed with 1X PBS and fixed to the culture plate
using 4% paraformaldehyde and permeabilized by 0.1% Triton X100 surfactant in 1X PBS. ClickIT reaction cocktail was added to each well and was incubated with the cells in the dark for 30
minutes at room temperature. Cells were washed and 100 µL of HCS NuclearMask was added at
a 1:2000 dilution per well. After a 30 min incubation at room temperature in the dark, cells were
washed twice with PBS. Cells were photographed by Biotek Cytation 5 imaging and EdU positive
cells were quantified with the GEN5 software (Biotek, Winooski, Vermont, USA) or counted
manually with Adobe Photoshop (version 25, Adobe™).
Gene expression measured by qRT-PCR:

18
TM4 Sertoli cells were plated at 100,000-150,000 cells/well and primary PND8 rat Sertoli
cells were plated 450,000-600,000 cells/well in a 24-well culture plate. The ZymoTM Quick-RNA
Miniprep plus kit (Zymo, Irvine, CA, USA) or the RNAqueous™ Total RNA Isolation Kit
(Invitrogen, Carlsbad, CA, USA) were used for total RNA extraction from cells. cDNA was
synthesized from RNA via PrimeScriptTM RT Master Mix (Takara Bio, Mountain View, CA,
USA). The qPCR thermal cycler used for gene expression analysis was the BioRad CFX384 Touch
Real-Time PCR System. Cycling conditions for qPCR were as follows: initial step at 95˚C
followed by 40 cycles at 95˚C for 15 s, 60˚C for 1 min and subsequent melting curves and cooling
cycles. The SYBR Green system was used for gene amplification and comparative threshold cycle
(Ct) method was used to analyze data, normalized to Gapdh for PND8 rat Sertoli and Rps29 for
TM4 cells. Primer sequences tested can be found in Table 1.
Table 1. Primer sets for q-PCR analysis:
Gene Forward Primer Reverse Primer
Rat
Gapdh CCATTCTTCCACCTTTGATGCT TGTTGCTGTAGCCATATTCATTGT
Sox9 TGCTGAACGAGAGCGAGAAG ATGTGAGTCTGTTCGGTGGC
Amh GTGGGTGGCAGCAGCACTAGG CGGGCTGTTTGGCTCTGATTCCCG
Ar CGGTCGAGTTGACATTAGTGAAGGACC ATTCCTGGATGGGACTGATGGT
Cox1 AGGTGTACCCACCTTCCGTA GGTTTCCCCTATAAGGATGAGGC
Cox2 ACGTGTTGACGTCCAGATCA CTTGGGGATCCGGGATGAAC
Esr1 GCCACTCGATCATTCGAGCA CCTGCTGGTTCAAAAGCGTC
Mouse
Rps29 TGAAGGCAAGATGGGTCAC GCACATGTTCAGCCCGTATT
Cox1 CCTCTTTCCAGGAGCTCACA TCGATGTCACCGTACAGCTC
Cox2 CAGGACTCTGCTCACGAAGG ATCCAGTCCGGGTACAGTCA
Amh GGGGAGACTGGAGAACAGC AGAGCTCGGGCTCCCATA
Amh TACTCGGGACACCCGCTATT CTCAGGGTGGCACCTTCTCT
Ar ACCAGATGGCGGTCATTCAG TGTGCATGCGGTACTCATTG
Sox9 TCGGACACGGAGAACACC GCACACGGGGAACTTATCTT
Esr1 TCTCCTCAAACACATCCCGTG GGCGAGTTACAGACTGGCTC
Gper CCTGGACGAGCAGTATTACGATATC TGCTGTACATGTTGATCTG
cJun GGGAGCATTTGGAGAGTCCC TTTGCAAAAGTTCGCTCCCG
PGD2 & PGE2 ELISA:
TM4 cells were plated at 250,000 cells/well in 12-well culture-treated plates and incubated
overnight at 37˚C 5% CO2. TM4 cells were treated with either APAP, GEN, or the mixture (50
µM) dissolved in culture medium containing 10% CS-FBS for 24h. Comparison of REG-FBS and
CS-FBS supplemented DMEM was performed (Fig. 4). Prostaglandin D2 and E2 ELISA assays
were purchased from Cayman Chemical (Ann Arbor, MI, USA). Aliquots of DMEM medium
supplemented with 10% CS-FBS without cells were used to establish the background level of PGs
(baseline level due to FBS), while conditioned media from control and treated TM4 Sertoli cells
were collected and stored in -80˚C for later use in ELISA assay. Measurement of %B/B0 was
performed using Cayman Chemical Excel spreadsheet for ELISA (Competitive) Analysis
available online. Each condition was performed in two separate experiments with duplicates (n =
4).

19
Immunofluorescent (IF) staining:
TM4 cells were plated at either 125,000 cells/well in 24-well culture-treated plate or 50,000
cells/well in 8-well chamber and grown overnight at 37˚C 5% CO2. Treatment for 24 hours
followed thereafter. Cells were washed with 1X PBS and fixed to culture plate or slide chamber
with 4% paraformaldehyde in 1X PBS. Cell were permeabilized by addition of 0.1% Triton-X 100
in 1X PBS solution for a 10-minute incubation at room temperature. Blocking for IF staining was
performed by adding 5% donkey serum in 0.5% BSA in 1X PBS solution to incubate for 30
minutes at room temperature. Primary antibodies were added on fixed cells at 1:100 - 1:300 diluted
in 5% donkey serum in a 0.5% BSA in 1X PBS solution overnight at 4˚C. Sox9 (anti-rabbit, catalog
no. Ab185966, Abcam, USA) COX1 (anti-rabbit, catalog no. 4841S, Cell Signaling, MA, USA),
COX2 (anti-rabbit, catalog no. ab52237, Abcam), ER-α (anti-rabbit, catalog no. MA1-310,
Thermo Fisher Scientific), PCNA (antimouse, catalog no. sc-56, Santa Cruz, TX, USA), α-Tubulin
(anti-mouse, catalog no. T9026, Thermo Fisher Scientific) and c-Jun (anti-mouse, catalog no. sc74543, Santa Cruz) were used for IF staining in TM4 cells. The next day, the slides/wells were
washed three times with 1X PBS. Secondary antibody was added at 1:400 dilution in 5% donkey
serum in 0.5% BSA in 1X PBS solution and slides/wells were incubated in dark for 30 minutes at
room temperature. Slides/wells were washed three times with 1X PBS to remove excess antibody
solution. The slide chamber walls were removed and DAPI was added to each well along with an
appropriate coverslip. Fluorescent-labeled cells were imaged, and fluorescence was quantified
using Biotek Cytation 5 imager and GEN5 software (Biotek, Winooski, Vermont, USA) or using
a BX40 Olympus microscope (Olympus, Center Valley, PA, USA) attached to a DP70 Olympus
digital camera. Fold change of immunofluorescent protein expression was compared between
treatment and vehicle conditions (n=4).
Whole transcriptome sequencing (Total RNA-seq):
Whole transcriptome sequencing or total RNA-seq was performed on an Illumina
Nextseq2000 platform by Keck Molecular Genomics Core (MGC) at University of Southern
California. Total RNA from both TM4 cells and SCs from 10 PND8 rat pups treated with A50,
G50, and AG50 was extracted as described above (n = 2-3 biological replicates per species and
condition). These RNA samples were submitted to the Keck Molecular Genomics Core for library
preparation and whole-transcriptome sequencing. Quality control of RNA samples was performed
using the Agilent Bioanalyzer 2100 and samples with RIN > 8 were approved for Total RNA-seq
analysis. cDNA libraries were prepared using Takara SMARTer® Stranded Total RNA-Seq Kit
v2 (Pico Input Mammalian) and sequenced at read length of 2x100 cycles. Raw sequencing data
was provided by Keck MGC and further analyzed using Partek® Flow® software, v10.0 for
analysis. Within Partek® Flow® software, the Database for Association, Visualization and
Integrated Discovery (DAVID) software (https://david.ncifcrf.gov/) linked to the Kyoto
Encyclopedia of Genes and Genomes (KEGG) database (https://www.genome.jp/kegg/) and
Ingenuity Pathway Analysis (IPA) were used for gene ontology and pathway enrichment analysis.
Statistical Analysis:
Statistical analysis was performed using one-way ANOVA with post-hoc Tukey’s or
Fisher’s LSD tests for multiple comparison or unpaired two-tailed Student’s t-test, for cell
viability, proliferation, qPCR, ELISA, and quantification of IF staining data analysis. Total RNAseq analysis was performed by normalization of differentially expressed gene (DEG) counts using

20
the DeSeq2 method within Partek® Flow® software. DEG counts were determined by setting an
FDR or p-value cut-off of 0.05 and fold-changes of -2 to +2.
Chapter III: Effects of EDCs and pharmaceuticals on immature Sertoli cell
functions
Sertoli cell proliferation and viability is negatively impacted by APAP, GEN, and their
mixture:
The MTT assay performed on TM4 Sertoli cells to measure cell viability after 24 –72h
exposure to APAP, GEN, and the mixture (APAP+GEN, AG) showed that APAP and mixture
treatments significantly decreased cell viability in a concentration-dependent manner over time.
Treatment with APAP had the most negative effect on SC viability compared to GEN and the
mixture, however the mixture effects followed a similar trend to APAP (Fig. 4). We also wanted
to compare viability in cells incubated in medium supplemented with either regular FBS or CSFBS. Charcoal stripping FBS was used to decrease the amount of prostaglandins present in regular
(untreated) serum, because we were using Cox inhibitor drugs that block prostaglandin synthesis,
and we wanted to decrease the baseline PG levels from serum to avoid confounding results (TranGuzman et al., 2022). Overall, we did not detect any discernable differences on the effects of
APAP and GEN between media types.
Fig. 4. MTT assay detects changes in cell viability after vehicle or 10, 50, 100 µM APAP,
GEN, and APAP+GEN exposure. TM4 SCs were treated from 24 – 72h in medium containing
untreated (Reg-FBS) or charcoal-stripped FBS (CS-FBS). Black circles = Veh and colored
symbols = treatment at various concentrations. Filled = reg-FBS and unfilled = CS-FBS. Data
shown is the mean fold change over control of three experiments performed in triplicate. Oneway ANOVA, multiple comparisons; * p≤0.05; ** p≤0.01; *** p≤0.001.
Using the Click-iT™ EdU HCS assay, we tracked cell proliferation after 24h treatment
with APAP, GEN, and the mixture. We observed a concentration-dependent decrease in cell
proliferation, greater than 50% at the highest concentration of 100 µM, after APAP and GEN
exposure, with about a 60 to 70 % reduction in EdU-positive cells compared to control.
Conversely, at 10 µM of APAP and APAP+GEN, cell proliferation was slightly increased (Fig.
5A). Interestingly, when we co-stained the cells with proliferating cell nuclear antigen (PCNA)
and SC marker SOX9 we observed a reduction in fluorescent signal in cells exposed to 50 µM
GEN and APAP+GEN but no obvious change after APAP alone (Fig. 5B). Therefore, both APAP

21
and GEN altered Sertoli cell proliferation capacity in some way, which could have an impact on
total SC numbers.
Fig. 5. APAP and GEN inhibit proliferation of TM4 SCs via EdU assay and IF staining. A)
Decrease in EdU positive cells in response to 100 µM APAP, GEN, and APAP+GEN. Data are
means ± SEM of three independent experiments performed in triplicates. One-way ANOVA,
multiple comparisons; * p≤0.05; ** p≤0.01; *** p≤0.001. B) Immunofluorescent co-staining
shows proliferation marker PCNA (red) and Sox9 (green) expression is decreased by 50 µM
treatments. Representative images are shown. DAPI (blue): nuclear signal. Scale bar: 50 µm.
Next, we wanted to verify our cell line data with primary cells. To do so, we isolated SCs
from rat pups on PND8, when the cells are still immature and not AR-responsive. We used wholetranscriptome sequencing (RNA-seq) to compare our two models, since the TM4 cell line is
isolated from PND11-13, when the animals are still immature but slightly older. To do so we tested
control samples from TM4 and PND8 rat cells and compared gene expression profiles of >15,000
orthologues found within mouse and rat sequencing libraries (Fig. 6A). Cross-species comparisons
of relative gene expression yielded a Pearson and Spearman’s correlation coefficient of 0.684 and
0.770 respectively. Log transforming the data resulted in a Spearman’s and Pearson’s test result of

22
0.774 and 0.757, respectively. Both tests indicate strongly that there is conserved expression
between the two species.
Fig. 6. Transcriptomic analysis and relative gene expression of murine TM4 and PND8 rat
Sertoli cells through RNA-seq analysis. A) Correlation plot showing the relationship between the
orthologues across both species. B) Estrogen receptor and C) Cox-related relative gene
expression across the two models. Data is displayed as the mean ± SEM of samples from three
experiments per cell type. Each cell preparation of rat Sertoli cells was obtained by pooling the
Sertoli cells from 10 PND8 rat pups.
We zoomed in to examine the relative expression of potential targets of APAP and GEN,
looking at eicosanoid pathway enzymes that APAP acts on and estrogen receptors to which Gen
may bind (Fig. 6B-C). The relative abundance of each ER subtype was conserved across both
models with Estrogen Receptor α (Esr1, Erα) and orphan Estrogen Related Receptor α (Esrra, Esrrα, Err-α) expression being highest. Relative expression of each receptor was up to 8-fold lower in
rat Sertoli compared to the murine cell line; interestingly, there were no hits for Estrogen Receptor
β (Esr2, Erβ) or the orphan Estrogen related receptor β Esrrβ (Esrrb, Err-β) (Fig 5B). Eicosanoid
pathway genes showed a somewhat similar expression profile in both species. In murine SCs, Cox1
and Cox2 (Ptgs1 and Ptgs2) were the most abundant in and expressed at similar levels. Meanwhile,
Pla2 and Carbonyl reductase 1 (Cbr1) were the highest in rat Sertoli cells, and Cox2 expression
was 15 times higher than Cox1 expression. Overall, both models had comparable expression
patterns, suggesting that the TM4 cell line is a good surrogate model for primary pre-pubescent rat
Sertoli cells, despite being from a different species and isolated slightly later.

23
Through qPCR analysis, we measured the relative gene expression levels of SC marker
Sox9 across treatments in both TM4 and PND8 SCs, to assess the functionality of the cells. Sox9
expression was reduced significantly in all treatment conditions except by APAP 10 µM. In TM4
SCs, APAP reduced expression by 39% and 35% at 50 and 100 µM while GEN decreased
expression by 40% and 50% at the respective concentrations. The mixture trended similarly to
GEN effects. Sox9 expression in PND8 rat Sertoli trended similarly to TM4 SCs, however to a
lesser extent. Overall, GEN and APAP+GEN at 50 µM decreased relative Sox9 expression the
most (Fig. 7A). TM4 SCs were co-stained with ɑ-Tubulin and Sox9 proteins to reveal similarly
decreased expression by GEN and APAP+GEN at 50 µM. Sox9 positive cells were also reduced
by APAP only in a similar pattern to expression at the mRNA transcript level (Fig. 7B). Observing
pictures of the cells in response to these treatments highlighted changes in morphology, namely,
nuclei of cells treated with GEN are visibly enlarged compared to treatments without GEN.
Fig. 7. Relative expression of SC maker Sox9 after exposure to APAP, GEN, and
APAP+GEN at 10, 50, and 100 µM concentrations in TM4 and PND8 Sertoli cells. A) Sox9
mRNA expression measured via qRT-PCR. Each condition was performed in triplicate in three
independent experiments and plotted as mean ± SEM. One-way ANOVA, multiple comparisons;
* p≤0.05; ** p≤0.01; *** p≤0.001. B) Immunofluorescent staining of TM4 cells reveals Sox9
(green) protein expression levels. Representative images are shown. Negative control photos
show 2° antibody signal. Cytoplasm was labeled using ɑ-Tubulin (red). Nuclei were stained with
DAPI (blue). Scale bar: 50 µm.
Changes in eicosanoid pathway expression in immature Sertoli cells by APAP, GEN, and
their mixture:

24
Acetaminophen inhibits Cox enzymes which leads to decreased prostaglandin synthesis
throughout the body, including the adult testis (Albert et al., 2013). Our previous studies have also
shown that Gen can alter the expression of eicosanoid pathway enzymes and levels of PG synthesis
in spermatogonia (Tran-Guzman et al., 2022). We examined if the same effect happened in SCs
after treatment with APAP, Gen, and their mixture. At 50 µM, the expression of PGD2 and PGE2
was reduced by all treatment conditions in TM4 Sertoli. The mixture led to the greatest change in
PG secretion, reducing PGD2 and PGE2 secretion by 63% and 89%, respectively (Fig. 8A). RNAsequencing analysis showed decreased Cox mRNA levels after all treatments at 50 µM (Fig. 8B).
Validating our results through qPCR analysis showed significant concentration-dependent
reductions in Cox1 expression by Gen and the mixture, matching our RNA-seq data, with Gen
having a slightly greater effect than the mixture. Alternatively, APAP increased expression in a
concentration-dependent manner. Although the trends were similar regarding Cox2 expression, we
observed a nonmonotonic effect in all treatments (Fig. 8C). We looked at protein expression of
Cox in TM4 cells treated with APAP, GEN, and APAP+GEN using immunofluorescent staining.
Co-staining revealed reductions in Cox protein expression by GEN and the mixture, whereas
APAP increased protein expression of both enzymes, similarly to what we observed at the gene
level (Fig. 8D-E). We suggest that discrepancies in our two methods investigating gene expression
could be due to varying sample sizes or the different abundance of these genes in the two cell
types. Uniquely, Cox1 expression was largely unaffected by treatments in PND8 rat Sertoli cells.
However, Cox2 was downregulated significantly at the higher concentrations of APAP (100 µM)
and GEN (50 and 100 µM), individually. Independent of the species, GEN has a larger effect on
Cox1 and Cox2 expression compared to APAP and the mixture (Fig. 8F). From these experiments
we may deduce that GEN acts on the eicosanoid pathway based on its ability to affect prostaglandin
production and Cox mRNA expression.

25
Fig. 8. Eicosanoid pathway gene and protein expression is altered by APAP, GEN, and their
mixture. A) ELISA assay reveals decreased the concentration of secreted prostaglandins in all
three treatments at 50 µM in TM4 cells. B) RNA-seq analysis dot plot relaying Cox expression is
decreased by 50 µM treatments in TM4 cells. C) qPCR data showing variation in Cox expression
levels due to APAP, GEN, and APAP+GEN at different concentrations. D) Co-staining cells
with antibodies against Cox1 and 2 (green) and cytoplasmic marker ɑ-tubulin (red).
Representative images are shown. DAPI (blue): nuclear signal. Scale bar: 50 µm. E)
Quantification of fluorescent signal at 488 nm shows Cox1 and 2 expression is increased by
APAP but decreased by GEN and the mixture at 50 µM. F) qPCR analysis shows PND8 SC
expression of Cox in response to treatments. For A, C, E and F Data are means ± SEM of three
independent experiments performed in triplicates. One-way ANOVA, multiple comparisons; *
p≤0.05; ** p≤0.01; *** p≤0.001.
Differential Estrogen receptor(s) expression following APAP, GEN, and mixture
treatment:
Appreciating the importance of estrogen signaling in SCs, we wanted to determine whether
APAP, GEN, and their mixture altered transcription of two ER subtypes, Esr1 and Gper in TM4
and PND8 SCs. There were no significant differences in Gper expression compared to control in
any treatment condition. What stands out, however, is that Esr1 expression was upregulated in all
treatments, almost 3-fold by Gen alone at the highest concentration, and 4-fold by APAP alone

26
(50 and 100 µM) in TM4 cells. However, with a 3-fold increase, mixture effects seem to mimic
GEN and cancel out any additional effect that acetaminophen had. However, APAP, GEN, and the
mixture had minimal effects on Esr1 expression in PND8 Sertoli, apart from a significant reduction
in transcript level at the high concentration of the mixture (Fig. 9A). To accompany what we found
at the gene level, we stained TM4 cells with an antibody against Esr1. Esr1 protein levels after
treatment with APAP, GEN, and APAP+GEN were decreased by all conditions compared to
vehicle, opposing the effect observed in the mRNA (Fig. 9B).
Fig. 9. Estrogen receptor expression is altered in TM4 and PND8 SCs by APAP, GEN, and
their mixture after 24h treatment. A) RTq-PCR analysis outlines gene expression of Gper and
Esr1 (Er-ɑ) in TM4 cells and B) in PND8 Sertoli. C) To concentrate on changes in Esr1
transcript levels, TM4 cells were stained with an antibody against Er-ɑ (green). DAPI (blue):
nuclear signal. Scale: 50 µm. Representative images are shown.
Dysregulation of immature SC development in response to APAP, GEN, and their mixture:
Employing RT-qPCR, we compared the expression of Amh, a marker of fetal/neonatal SC
cells, to Ar, a mature/pubertal SC marker, to determine how SC differentiation was impacted by
exposure to APAP and GEN in TM4 and PND8 Sertoli cells. In TM4 cells, Amh transcript levels
were increased by all treatment conditions. Concentration-dependent increases were observed in
APAP and mixture conditions, with approximately 2.5-fold increases at their highest
concentrations (Fig. 10A). By contrast, Amh expression trended down in each condition in PND8
rat SCs (Fig. 10B). In terms of Ar expression, APAP versus GEN and the mixture displayed
opposing trends, with expression increasing with the highest concentration of APAP but
decreasing as concentration of GEN/APAP+GEN increased. Here, a significant low-dose effect
was observed, as APAP+GEN at 10 µM increased Ar levels by 3-fold (Fig. 10A). Conversely, Ar

27
expression was decreased by all treatments in PND8 SCs, with some values as far as 40% below
control, and this time, APAP and the mixture trended similarly (Fig. 10B). These results indicate
that although the two models’ transcriptomes are comparable, there are clear differences in APAP
and GEN effects on SC marker expression, which could be due to the differences in developmental
age of the mouse cell line compared to the younger rat age model. It is also evident that while both
models are susceptible to dysregulation by APAP and GEN, they respond to these chemicals and
their mixture in different ways.
Fig. 10. qPCR analysis of SC developmental markers after treatment with APAP, GEN, and
the mixture in TM4 and PND8 SCs. A) Amh (fetal) and Ar (mature) expression in treated TM4
cells and B) in PND8 SCs. Data are expressed as means ± SEM of three experiments with each
condition performed as triplicate. One-Way ANOVA with multiple comparisons. * p≤0.05; **
p≤0.01; *** p≤0.001.
Chapter IV: Mechanisms underlying the toxic effects of EDC/Pharmaceutical
co-exposure to immature Sertoli cell functions
Project Rationale:
Our work elucidating the harmful effects of APAP, GEN, and their mixture on immature
Sertoli cell viability, proliferation, transcriptional regulation, and protein expression led us to
continue our project by uncovering the molecular mechanisms behind the observed effects. Altered
development of immature Sertoli cells may otherwise lead to unwanted consequences, including
male infertility. Male infertility is likely due in part to aberrant signaling in SCs during
development, though it is unclear which pathways are most heavily involved (Ni et al., 2019). It
is likely that APAP and Gen toxicity in SCs is related to their respective effects on the eicosanoid
pathway and estrogen receptor signaling. In Chapter 3, we selected established SC markers or

28
genes/proteins related to SC function or related to Eicosanoid pathway or to estrogen response to
test this hypothesis.
Studies attempting to understand aberrant spermatogenesis showed that injecting neonatal
rats with estrogen led to decreased Sertoli cell numbers (Atanassova et al., 1999). The ability of
APAP and Gen to alter gene expression of eicosanoid members in immature SCs also flags them
as potential disruptors of spermatogenesis. Operating under the assumption that APAP primarily
acts on Cox enzymes and Gen acts on Estrogen receptors to alter SC functions, we primarily
wanted to compare APAP and Gen, both alone and mixed, to other actors in these pathways (Fig.
11). Since APAP is a non-specific inhibitor of Coxs, we sought to examine its independent
interaction with each isoform in SCs using Cox-specific inhibitors NS-398 (NS) and FR122047
(FR) as comparisons. Similarly, based on the estrogen receptor subtypes native to SCs, we selected
antagonists of ERs including ICI 182,780 (ICI), which non-specifically binds to ER-ɑ and -β, and
the GPER antagonist G15. We believe that these receptor antagonists can block the binding of
GEN, which will illuminate the interactions between Gen and either ERs or GPER in SCs.
Concentrations of drugs used to treat cells were based on previous studies in our lab as well as the
literature. Despite previously testing several concentrations of APAP and GEN, here we focused
on effects observed at 50 µM, at a concentration within the levels detected in humans and one in
which we previously observed significant changes. We narrowed our focus to effects observed in
the TM4 Sertoli to assess changes in proliferation, viability, and gene/protein expression. In
chapter 4, we also probed targets and functional pathways discovered through RNA-seq which
may indicate the mechanism(s) by which APAP, GEN, and their mixture disrupt immature SC
functions.
Fig. 11. Prospective pathways and targets of APAP and GEN in immature SCs. A) APAP is a
non-selective COX enzyme inhibitor. To test its effects in SCs, we will compare it to FR122047
and NS-398 which are selective COX-1 and COX-2 inhibitors, respectively. B) Genistein exerts
its effects by mimicking endogenous estrogens. Presumptively, it could act on ER-ɑ, ER-β, and
GPER in immature SCs. To test this, we will compare the effect of GEN alone or mixed with
non-selective ER-ɑ/β antagonist ICI 182,780 and/or selective GPER antagonist G15.
Differentially expressed genes in the Sertoli cell transcriptome post-treatment with APAP
and GEN:

29
Total RNA-sequencing analysis revealed several differentially expressed genes (DEGs) in
TM4 SCs treated with 50 µM of APAP, GEN, and APAP+GEN, many of which are related to SC
survival and development (Fig. 12). In total, there were 704 genes altered, 94% of which were
treatments containing GEN. This implies that mixture effects are largely driven by GEN. Shared
DEGs between treatments reveal that there is some overlap in the pathways leading to APAP and
GEN effects in SCs.
Fig. 12. Select differentially expressed genes (DEGs) in TM4 SCs treated with 50 µM APAP,
GEN, and APAP+GEN. Whole transcriptome sequencing (RNA-seq) was used to map the
response within the SC transcriptome. Dot-plots show varying treatment effects on select genes
related to different functions in SCs. The accompanying Venn diagram displays statistically
significant DEG counts using false discovery rate or p-value ≤ 0.05 with a cutoff range of -2 to
+2 in Partek Flow.
Based on their assumed role in SCs, we highlighted a group of DEGs altered by each
treatment (Table 2). We found that SC-relevant DEGs were shared among treatments, including
thrombospondin 1 (Thbs1). Since, Thbs1 can activate TGFB, it is hypothesized to be a player in
the immunoprotective role of SCs in the testis, especially since it is highly expressed (Doyle et al.,
2012). Thbs1 expression was upregulated by all treatments, especially GEN. It is possible that
overexpression can be damaging to the cells, as Thbs1 overexpression in certain cancers leads to
‘poor prognosis’ (Jin et al., 2022). Epiregulin (Ereg), among the epidermal growth factors that are
secreted by SCs, was downregulated (up to 18-fold by the mixture) by all treatments (Chen et al.,
2016). Ereg is involved in the body’s immune response, which may allude to relationship to SC
immunoprotection (Shirasawa et al., 2004). The SC-secreted cytokine Lif, which is critical for SC
and SSC survival, was also significantly downregulated by all three treatments (Jenab and Morris,
1998, França et al., 2016). Lif can also mediate transcription of AP-1 transcription factor family
members, which play a crucial role in regulating junction dynamics in SC. Therefore, if they are
perturbed, it could be detrimental to overall cell function (Nguyen and Martin, 2023). Indeed,
expression of AP-1 transcription factors family members cJun (Jun), Junb, and Fosl1 were
affected by treatment. While Fosl1 was downregulated in all treatments, cJun was upregulated by
APAP and downregulated by GEN and their mixture effects may be driven by both compounds

30
(Fig. 12). The cell junction protein Gja1 was increased by GEN only, potentially disrupting cellcell dynamics. KEGG pathway analysis showed that in TM4 SCs, cJun is observed downstream
of the TNF signaling pathway (data not shown). Fosl1 is highly expressed in immature SCs, so its
downregulation by all treatments could lead to premature differentiation to adult type SCs
(Corpuz-Hilsabeck et al., 2023). The AP-1 TF family mediates phosphorylation of downstream
effectors such as signal transducer and activator of transcription 1 (Stat1), whose transcription is
also altered by GEN and APAP+GEN. Interestingly, data has shown that Stat1 is potentially at the
center of transcriptional regulation in SCs meaning its dysregulation could be costly (Zimmermann
et al., 2015). Here is merely a glimpse into the myriads of DEGs in TM4 SCS treated with APAP
and GEN.
Table 2. Significantly up- and downregulated genes in TM4 Sertoli subjected to APAP,
GEN and their mixture:
We also aimed to study functional pathways involving these DEGs, especially those
relevant to SC functions and development. Performing KEGG pathway enrichment highlighted

31
several pathways altered in TM4 SCs as a response to the APAP+GEN mixture (Table 3). Among
the most dramatically impacted, several pathways were related to cancer and inflammation
signaling including viral carcinogenesis, transcriptional misregulation in cancer, and microRNAs
in cancer. However, other pathways altered that involve important SC functional mediators include
TNF signaling pathway, viral protein interaction with cytokine and cytokine receptor, AMPK
signaling pathway, and TGF-beta signaling pathway. To further our analysis of pathways altered
by treatment, we mapped our data using Ingenuity Pathway Analysis (IPA). We found more genes
downregulated, primarily by GEN and the mixture, which are linked to estrogen and eicosanoid
pathway signaling. In turn, markers for inflammation were upregulated (data not shown).
Additional genes and pathways altered by A50, G50, and AG50 in RNA-seq can be found in our
publication on this data, along with our data on DEGs in PND8 rat Sertoli (Corpuz-Hilsabeck et
al., 2023).
Table 3. Functional pathways altered by APAP+GEN mixture in TM4 Sertoli cells:
TM4 SC proliferation and viability:
Analysis by MTT assay showed that none of the treatments were overtly toxic. Compared
to vehicle, there were no significant decreases in any of our treatments despite previously observed
decreases of 25% in viability at 50 µM of APAP and APAP+GEN. We surmise that this may be
due to the cell sensitivity changing as they were passaged. Slight increases in viability observed
after treatment with APAP were normalized by the mixture (Fig. 13A-B).
SC proliferation was significantly impacted by treatments. APAP slightly increased
proliferation while GEN and the mixture decreased proliferation by more than 50% of EdUpositive cells in controls. Co-treatment of APAP with Cox-specific inhibitors also did not
significantly change APAP effects. Conversely, while ER and GPER antagonists alone did not
alter cell proliferation, co-treating GEN with these antagonists, showed that both antagonists could
block GEN-induced decreases in proliferation. While they could not completely recover control
levels, co-treating cells with GEN and both antagonists increased the number of proliferating cells

32
by 50% compared to GEN alone, suggesting that GEN acts via both types of receptors (Fig. 13CD). In the future, however, more experiments are required to make conclusive remarks about the
exact mechanisms by which APAP, GEN, and the mixture alter proliferation in TM4 SCs.
Fig. 13. Cell proliferation and viability assays unearth potential causes of the adverse effects
of short-term exposure to APAP, GEN, and APAP+GEN in TM4 SCs. A) and B) MTT assay
data from 4 experiments done in triplicates show non-significant changes overall while C) and
D) Edu assay data from 2 experiments done in triplicates show that APAP significantly increased
SC proliferation (p = 0.0025), while Gen significantly decreases cell proliferation (p = 0.02).
Statistical significance was determined using one way ANOVA with Fisher’s LSD post-hoc
analysis. Statistical significance in comparison to each other are as follows: vs. Veh = *, vs.
APAP (A&C)/GEN (B&D) = #, vs. ICI = @, vs. G15(10) = ^, vs. G15(100) = $. * p<0.05; **
p<0.01; ***p<0.001.
TM4 SC gene/protein expression changes by APAP and GEN are related to eicosanoid and
ER signaling pathways:
Initially, we wanted to test the same markers that were previously altered TM4 SCs in
response to APAP, GEN, and APAP+GEN treatments to see if the associated changes were due to
eicosanoid or ER signaling. First, we looked at whether changes in the gene expression of Coxs
was related to APAP interactions with either or both Cox1 and Cox2. Here, we observed that
downregulation of Cox1 expression by APAP was similar to both Cox1 and 2 selective inhibitors
but mixing them with APAP did not exacerbate the responses (Fig. 14A). Meanwhile, Cox2
expression was significantly increased by 100 µM of NS, the Cox2 selective inhibitor, and its
mixture with APAP (Fig. 14B). Mechanisms behind GEN and APAP+GEN decreases in Cox
expression are yet to be studied. However, the mixture decreased Cox1 expression more
significantly than either APAP or GEN alone (Fig. 14).

33
Fig. 14. Potential mechanisms related to downregulated Cox expression in TM4 SCs treated
with APAP, GEN, and APAP+GEN. A) Cox1 expression is decreased in most treatment
conditions. B) Cox2 expression was decreased by GEN and APAP + GEN but upregulated by
NS (100 µM). Selected data are from at least 3 independent experiments done in triplicate.
Statistical significance was determined using one way ANOVA with Fisher’s LSD post-hoc
analysis. Statistical significance in comparison to each other are as follows: vs. Veh = *, vs.
APAP = #.
Next, we used qPCR analysis complemented by IF staining to explain changes in Sox9
gene and protein expression. Concurrently, we studied another SC-relevant transcription factor,
cJun, whose mRNA expression we showed was significant impacted by APAP, GEN, and
APAP+GEN (Fig. 12). Based on qPCR analysis, the expression of Sox9 and cJun were decreased
significantly by all treatments and showed a decreasing trend with APAP. Co-exposure to APAP
and either NS or FR downregulated both targets, suggesting that Cox enzymes play a role in the
expression of these genes. Meanwhile, Sox9 and cJun expression was significantly downregulated
by GEN and G15 (10 µM) relative to vehicle. Gen-driven reduction in Sox9 and cJun expression
was not recovered when co-treated with ICI. In most combination conditions, GEN and G15 (both
concentrations) had an additive effect on the downregulation of Sox9 and cJun expression.
However, ICI plus the higher concentration of G15 seemed to partially block the decrease of Sox9
expression by GEN (Fig. 15A-D).

34
Fig. 15. Mechanisms conferring APAP/GEN downregulation of Sox9 and cJun expression
in TM4 Sertoli cells may be related to eicosanoid and ER signaling as observed through qPCR
analysis. A) and B) Sox9 expression is downregulated significantly by most treatment conditions.
C) and D) cJun expression is downregulated significantly by most treatment conditions. Data are
from 1-3 experiments done in triplicates. Statistical significance was determined using one-way
ANOVA with Fisher’s LSD post-hoc analysis. Statistical significance between treatments are as
follows: vs. Veh = *, vs. APAP (A&C)/GEN (B&D) = #, vs. ICI = @, vs. G15(10) = ^, vs.
G15(100) = $. *p<0.05; **p<0.01; ***p<0.001.
Next, we co-stained cells with antibodies against Sox9 and cJun to confirm what we
observed at the mRNA level. Sox9 protein expression levels were decreased by all conditions but
most significantly by GEN and GEN+G15(10) which matches data at the mRNA level, albeit we
did not look at GEN+G15(100). Treatment with all three Cox inhibitors lead to increased protein
expression of cJun, despite downregulating its gene. By contrast to qPCR analysis, increased
protein expression of cJun after treatment with APAP matched what we observed in RNA-seq
expressional analysis (Fig. 12). Still, differences between qPCR and RNA-seq analysis may be
because there are far less data points where RNA-seq is concerned or because of the varying
sensitivities of each assay. cJun expression was enhanced by APAP+NS10 and decreased by
APAP+FR. Treatment with FR increased co-localization of the two proteins. Co-localization was
most apparent with APAP-NS10 mixture, while APAP-FR co-treatment decreased the expression
of both proteins (Fig. 16). This data suggests that eicosanoid pathway enzyme inhibitors influence
various functions in SCs. GEN alone almost entirely wiped cJun expression. Protein expression
after ICI and G15(10) treatments showed increased levels of expression of Sox9 and cJun,
opposing what we found at the mRNA level (Fig. 15A-D). ICI and G15(10) alone displayed
heightened colocalization (yellow) of the two proteins, unlike GEN alone. In co-exposure

35
conditions, cJun protein expression increased compared to vehicle and GEN alone (Fig. 16), which
also differed from what we saw at the mRNA level (Fig. 15A-D).
Fig. 16. Evaluation of protein expression by IF staining of TM4 SCs treated with APAP,
GEN, and pathway-specific antagonists/inhibitors. Cells were co-stained with Sox9 (green) and
cJun (red). Representative images are shown. Negative control photos show 2° antibody signal.
Cytoplasm was labeled using ɑ-Tubulin (red). Nuclei were stained with DAPI (blue). Scale bar:
50 µm.

36
Chapter V: Discussion and Conclusions
Dysregulation of Sertoli cell development by APAP, GEN, and their mixture:
The primary goal of this project was to assess the male reproductive risks associated with
an EDC and pharmaceutical mixture that infants are likely subjected to in the modern world
through diet and medical treatment. From there, we sought to determine the molecular mechanisms
contributing to the dysfunction sustained from this exposure. Given that SCs play a key role in the
process of spermatogenesis, their dysregulation by the APAP+GEN mixture could predict future
reproductive problems such as infertility. The effects of the APAP+GEN mixture were examined
in two juvenile rodent SC models, the TM4 cell line generated from the testes of PND11-13 mice
and primary immature SCs isolated from PDN8 rat pups. GEN and APAP were tested at
concentrations that mimicked levels measured in infant blood (Kavlock et al., 2006, Rozman et
al., 2006). What we found was that neither chemical was overtly cytotoxic at lower concentrations
in the short term. However, viability measurably decreased over time (Corpuz-Hilsabeck et al.,
2023). In addition, GEN alone exhibited cytostatic effects that were transferrable to the
APAP+GEN mixture. This is similar to its effect in other testicular cells at low concentrations
(Tran-Guzman et al., 2022).
Furthermore, this mixture disrupts functional pathways and expression of targets vital to
SC development. These compounds led to pathological over- or under-expression particularly in
Sertoli cell markers including Sox9 and Amh and eicosanoid pathway proteins. At the mRNA level
in both models, Sox9 expression was notably decreased by most treatments. Similarly, protein
expression was visibly decreased in TM4 cells. Decrease in expression suggests pathology in
immature SCs, given that Sox9 is vital at this stage of development for gene transcription to occur
properly. In TM4 cells, expression of Amh, a fetal SC marker that normally decrease as SCs
mature, was increased by APAP, GEN, and the mixture, while, in both models GEN and the
mixture exhibited opposing effect on Ar, a mature SC marker, suggesting disrupted SC
development. This imbalance in stage-specific expression after treatment coupled with the ability
of GEN to decrease proliferation could have consequences for the final SC population in mature
rodents. With respect to mRNA expression, individual and mixture effects were observed at
concentrations as low as 10 µM. This matches the typical level of APAP and Gen found infants
exposed to these compounds (Rozman et al., 2006, Brown et al., 1992). These results also show
that while APAP and GEN individually contribute to disruption of immature SCs, some of their
mechanisms do overlap, given that mixture effects can mimic each compound individually.
Sox9 downregulation by APAP/GEN could induce eicosanoid pathway dysregulation and
impact spermatogenesis. Sox9 plays a part in several processes in Sertoli, including regulation of
the L-PGDS/PGD2 pathway in fetal mouse SCs, as it is required for the expression of L-PGDS
and subsequent synthesis of PGD2, which then plays a role in GC differentiation (Rossitto et al.,
2015). Decreased Sox9 gene/protein expression by each treatment coupled with associated
decreases in PGD2 and E2 production in TM4 cells leads us to question how spermatogenesis can
be effective in tubules containing SCs that can’t maintain GC differentiation through these
interactions. This is further perpetuated by observed decreases in Cox expression, specifically by
GEN and the mixture at all concentrations. In TM4 cells, gene and protein expression of both Cox
enzymes is downregulated, as well as Cox2 expression in PND8 Sertoli. With Cox and Sox9
expression decreasing by treatment, PG synthesis is threatened.
Compatibility between murine TM4 and rat PND8 Sertoli cells:

37
We looked at two different species and compared our data between isolated rat SCs and an
established immortalized mouse cell line. Although the importance of observing results in primary
cell culture cannot be downplayed, we also intended to find a suitable model to facilitate our
research. In doing so, we compared their transcriptomic libraries and observed a high rate of
similarity. Both models were isolated at a period at which SCs are considered immature. Therefore,
it was encouraging that responsesto treatments with respect to the expression of Sox9, an immature
SC marker, were conserved between them. However, we did observe differences in the expression
of other developmental SC markers Amh and Ar. Expression in TM4 cells was upregulated,
especially at the higher concentrations of each treatment but downregulated in all treatments in
PND8 Sertoli cells. These results may arise from subtle differences between the developmental
ages at which the cells were isolated. However, it cannot be ignored that immortalized cell lines
forgo continuous and dynamic developmental changes that primary cells undergo.
We found that the abundance of estrogen receptors in each model varied drastically. It is
not surprising that Esr1 is more highly expressed than Esr2 in our models, given that studies in rat
Sertoli cells have shown that Esr1 is more abundant at the earlier stages of SCs (Lucas et al., 2014).
There are discrepancies between the models in terms of Esr1 mRNA levels in response to
treatment: treatments tended to upregulate Esr1 expression in TM4, while downregulating
expression in PND8 SCs. However, this could be due to the relatively lower abundance of Esr1 in
PND8 cells. Differences in abundance of the gene can contribute to the opposing effects observed.
Fewer copies of a transcript being made overall could increase the likelihood of further
downregulation after treatment, especially if the transcriptional milieu is not as robust and cannot
adapt to the changes imposed by APAP/GEN (Yang et al., 2019). In the end, both models display
clear disruption in response to treatment with APAP and GEN both alone and as a mixture, which
warrants further investigation.
Pathway-specific dysregulation of TM4 SC functions by APAP and GEN:
As we have shown, the thorough disruption of SC functions by APAP/GEN, specifically
to the eicosanoid pathway and ER signaling supports our hypothesis that these are among their
target genes or proteins. We dug into that further by comparing their effects to that of known actors
in both pathways to probe their individual and mixture effects (Fig. 11). We showed that Gen alone
inhibited immature SC proliferation by greater than half. By co-treating GEN with antagonists ICI
and G15, we observe that both compounds are capable of partially rescuing GEN effects,
suggesting that GEN alters proliferation through both ER and GPER-related signaling pathways,
especially since co-treating with both antagonists leads to the greatest recovery in the number of
proliferating cells. Data shows that estrogen signaling in SCs reduces their proliferation at the end
of the maturation stage, meaning that GEN signaling could lead to premature differentiation
(Meroni et al., 2019). This is further supported by an increase in Ar gene expression observed in
TM4 cells treated with 50 µM GEN. The same effect is observed in the mixture. While we
previously observed APAP’s ability to inhibit proliferation as well, more recent data shows that it
may slightly increase proliferation and that mixture-associated decreases are GEN-driven. APAPinduced increases in proliferation are likely via Cox2 inhibition and show additivity with Cox1
inhibition, suggesting the modulatory roles of both Cox enzymes on TM4 cell proliferation.
Looking at Gen alone, it is likely that estrogen receptor(s) and, especially GPER, mediate
GEN effects on gene and protein expression as well. We found that Sox9 and Amh (data not shown)
gene expression was most downregulated by GEN, G15(10), and their co-treatment, suggesting
that their expression relies heavily on GPER signaling. Similarly, our data suggests that GEN (or

38
the minimal estrogen content provided by CS-FBS which was the background in all our treatments)
exerted repressive effects on the protein expression of Sox9 and cJUN, which was blocked by both
antagonists. Co-exposure to APAP and either NS or FR downregulated Sox9 and cJun, suggesting
that Cox enzymes play a role in the expression of these genes. Especially at the protein level,
APAP and FR co-treatment wiped out the expression of Sox9, showing that inhibition of Cox1 is
detrimental at a certain threshold. APAP alone induced a non-significant decrease in Sox9 and
cJun that did not recapitulate the inhibitory effects induced by selective Cox1 and Cox2 inhibitors.
Despite previously observing significant downregulation of Sox9 expression by APAP alone, our
more recent data closely complements what we found at the protein level. It is likely that the impact
of the mixture on Sox9 expression is largely GEN-driven and occurs due to GEN-ER signaling.
APAP alone significantly decreased Cox1 gene expression, similar to the selective Cox
inhibitors, suggesting a possible contribution of both Cox types in APAP effects. However, APAP
and FR each did not change Cox2 expression, in contrast with the overexpression induced by NS,
suggesting that APAP does not affect Cox2 levels, contrary to the effect observed in Cox1. While
they each have their ‘canonical’ mechanisms or modes of action, studying the compounds both
individually and together, we observe that there is overlap in the way these chemicals exert their
toxicity in Sertoli cells. Aside from its estrogenic effects, Gen reduces prostaglandin production
and Cox expression similarly to APAP. This leads us to believe that Gen is altering the eicosanoid
pathway in some way. This is further supported by morphological changes observable in response
to GEN, a change that is also apparent via Cox-inhibitor additivity. Sertoli cell enlargement in
response to Gen and APAP+NS leads us to surmise that prostaglandins play a role in maintaining
the structure of Sertoli cells.
Dysregulation of SC-relevant genes and functional pathways by APAP and GEN:
RNA-sequencing discovery data identified other pathways altered by APAP and GEN
which could potentially lead to future reproductive issues. APAP, GEN, and their mixture alter
genes critical for SC survival, immune response and cell-cell junction dynamics. Several of these
genes are altered by the three conditions, but each individually produce changes in and of
themselves. In key targets, APAP and GEN alone produced effects individually that translated to
additive or synergistic effects in the mixture. In RNA-seq, apart from cJun, several targets with
roles in mediating SC functions had the most dramatic downregulation by the mixture. We began
to investigate the specific mechanism by which APAP and GEN altered SC function, starting with
cJun, considering that APAP and GEN had opposing effects on its expression at the mRNA level.
Validating what we observed using qPCR analysis, we instead found that APAP slightly reduced
expression of cJun, but not to the extent observed in GEN and the mixture. The decrease observed
in the cotreatment of APAP and NS may indicate that a threshold of Cox inhibition can initiate
changes in other pathways. Interestingly, the opposite is observed at the protein level at the lower
concentration. The dramatic effect that GEN has on cJun expression is exacerbated when it is cotreated with both ER antagonists, but the opposite is observed at the protein level.
KEGG pathway analysis revealed a plethora of SC-relevant functional pathways that were
altered by the mixture including AMPK and TGFB signaling, which are involved in immature SC
proliferation. The mixture also impacted TNF signaling pathways which are implicated in
maintaining the dynamics of tight junctions and cytokine pathways, which includes chemokines
such as CXCL12 involved in maintaining the SSC niche (Ni et al., 2019, Yang and Oatley, 2015).
Overall, the genes and pathways altered by APAP, GEN, and the mixture warrant further analysis.

39
Conclusions:
The data presented in this project highlights the effects of acetaminophen, genistein, and
their mixture on immature Sertoli cell functions and suggest that exercising caution in exposing
infants to these compounds is vital. In a modern environment that is riddled with highly
commercially available pharmaceuticals and endocrine-disrupting chemicals, it is critical to assess
the impact that these contaminants pose to male reproductive health, especially at key
developmental windows. Given that Sertoli cells are the foundational core of the testis, using them
as a model for discerning the cost of exposure to these compounds can provide meaningful
observations about overall reproductive health. Studying the mechanisms by which these
compounds and their mixture can interfere with testicular function is crucial for combatting the
rising rate of testicular disorders and male infertility.

40
References:
ALBERT, O., DESDOITS-LETHIMONIER, C., LESNé, L., LEGRAND, A., GUILLé, F.,
BENSALAH, K., DEJUCQ-RAINSFORD, N. & JéGOU, B. 2013. Paracetamol, aspirin
and indomethacin display endocrine disrupting properties in the adult human testis in
vitro. Human Reproduction, 28, 1890-1898.
ARAMBEPOLA, N. K., BUNICK, D. & COOKE, P. S. 1998a. Thyroid hormone and folliclestimulating hormone regulate Müllerian-inhibiting substance messenger ribonucleic acid
expression in cultured neonatal rat Sertoli cells. Endocrinology, 139, 4489-95.
ARAMBEPOLA, N. K., BUNICK, D. & COOKE, P. S. 1998b. Thyroid hormone effects on
androgen receptor messenger RNA expression in rat Sertoli and peritubular cells. J
Endocrinol, 156, 43-50.
ARCHAMBEAULT, D. R. & YAO, H. H. 2010. Activin A, a product of fetal Leydig cells, is a
unique paracrine regulator of Sertoli cell proliferation and fetal testis cord expansion.
Proc Natl Acad Sci U S A, 107, 10526-31.
ATANASSOVA, N., MCKINNELL, C., WALKER, M., TURNER, K. J., FISHER, J. S.,
MORLEY, M., MILLAR, M. R., GROOME, N. P. & SHARPE, R. M. 1999. Permanent
Effects of Neonatal Estrogen Exposure in Rats on Reproductive Hormone Levels, Sertoli
Cell Number, and the Efficiency of Spermatogenesis in Adulthood1. Endocrinology, 140,
5364-5373.
AXELSTAD, M., HASS, U., SCHOLZE, M., CHRISTIANSEN, S., KORTENKAMP, A. &
BOBERG, J. 2018. EDC IMPACT: Reduced sperm counts in rats exposed to human
relevant mixtures of endocrine disrupters. Endocr Connect, 7, 139-148.
BARAKAT, B., O'CONNOR, A. E., GOLD, E., DE KRETSER, D. M. & LOVELAND, K. L.
2008. Inhibin, activin, follistatin and FSH serum levels and testicular production are
highly modulated during the first spermatogenic wave in mice. Reproduction, 136, 345-
59.
BERGER, T., CONLEY, A. J., VAN KLOMPENBERG, M., ROSER, J. F. & HOVEY, R. C.
2013. Increased testicular Sertoli cell population induced by an estrogen receptor
antagonist. Molecular and Cellular Endocrinology, 366, 53-58.
BITGOOD, M. J., SHEN, L. & MCMAHON, A. P. 1996. Sertoli cell signaling by Desert
hedgehog regulates the male germline. Current Biology, 6, 298-304.
BOISVERT, A., JONES, S., ISSOP, L., ERYTHROPEL, H. C., PAPADOPOULOS, V. &
CULTY, M. 2016. In vitro functional screening as a means to identify new plasticizers
devoid of reproductive toxicity. Environ Res, 150, 496-512.
BRAUNER, E. V., ULDBJERG, C. S., LIM, Y. H., GREGERSEN, L. S., KRAUSE, M.,
FREDERIKSEN, H. & ANDERSSON, A. M. 2022. Presence of parabens, phenols and
phthalates in paired maternal serum, urine and amniotic fluid. Environ Int, 158, 106987.

41
BROWN, R. D., WILSON, J. T., KEARNS, G. L., EICHLER, V. F., JOHNSON, V. A. &
BERTRAND, K. M. 1992. Single-dose pharmacokinetics of ibuprofen and
acetaminophen in febrile children. J Clin Pharmacol, 32, 231-41.
BUZZARD, J. J., WREFORD, N. G. & MORRISON, J. R. 2003. Thyroid hormone, retinoic
acid, and testosterone suppress proliferation and induce markers of differentiation in
cultured rat sertoli cells. Endocrinology, 144, 3722-31.
CARREAU, S., BOURAIMA-LELONG, H. & DELALANDE, C. 2011. Estrogens in male germ
cells. Spermatogenesis, 1, 90-94.
CHEN, S. R., HAO, X. X., ZHANG, Y., DENG, S. L., WANG, Z. P., WANG, Y. Q., WANG,
X. X. & LIU, Y. X. 2016. Androgen receptor in Sertoli cells regulates DNA doublestrand break repair and chromosomal synapsis of spermatocytes partially through
intercellular EGF-EGFR signaling. Oncotarget, 7, 18722-35.
CHUNG, S. S., CHOI, C., WANG, X., HALLOCK, L. & WOLGEMUTH, D. J. 2010. Aberrant
distribution of junctional complex components in retinoic acid receptor alpha-deficient
mice. Microsc Res Tech, 73, 583-96.
CLARK, A. M., GARLAND, K. K. & RUSSELL, L. D. 2000. Desert hedgehog (Dhh) gene is
required in the mouse testis for formation of adult-type Leydig cells and normal
development of peritubular cells and seminiferous tubules. Biol Reprod, 63, 1825-38.
COLVIN, J. S., GREEN, R. P., SCHMAHL, J., CAPEL, B. & ORNITZ, D. M. 2001. Male-tofemale sex reversal in mice lacking fibroblast growth factor 9. Cell, 104, 875-89.
COOKE, P. S., ZHAO, Y. D. & BUNICK, D. 1994. Triiodothyronine inhibits proliferation and
stimulates differentiation of cultured neonatal Sertoli cells: possible mechanism for
increased adult testis weight and sperm production induced by neonatal goitrogen
treatment. Biol Reprod, 51, 1000-5.
CORPUZ-HILSABECK, M. & CULTY, M. 2023. Impact of endocrine disrupting chemicals and
pharmaceuticals on Sertoli cell development and functions. Front Endocrinol
(Lausanne), 14, 1095894.
CORPUZ-HILSABECK, M., MOHAJER, N. & CULTY, M. 2023. Dysregulation of Immature
Sertoli Cell Functions by Exposure to Acetaminophen and Genistein in Rodent Cell
Models. Cells, 12.
CRéPIEUX, P., MARION, S., MARTINAT, N., FAFEUR, V., VERN, Y. L., KERBOEUF, D.,
GUILLOU, F. & REITER, E. 2001. The ERK-dependent signalling is stage-specifically
modulated by FSH, during primary Sertoli cell maturation. Oncogene, 20, 4696-709.
CULTY, M. 2009. Gonocytes, the forgotten cells of the germ cell lineage. Birth Defects Res C
Embryo Today, 87, 1-26.

42
DINAPOLI, L. & CAPEL, B. 2008. SRY and the standoff in sex determination. Mol Endocrinol,
22, 1-9.
DOYLE, T. J., KAUR, G., PUTREVU, S. M., DYSON, E. L., DYSON, M., MCCUNNIFF, W.
T., PASHAM, M. R., KIM, K. H. & DUFOUR, J. M. 2012. Immunoprotective properties
of primary Sertoli cells in mice: potential functional pathways that confer immune
privilege. Biol Reprod, 86, 1-14.
DUTTA, S., SENGUPTA, P., BAGCHI, S., CHHIKARA, B. S., PAVLIK, A., SLAMA, P. &
ROYCHOUDHURY, S. 2023. Reproductive toxicity of combined effects of endocrine
disruptors on human reproduction. Front Cell Dev Biol, 11, 1162015.
EISENBERG, M. L., ESTEVES, S. C., LAMB, D. J., HOTALING, J. M., GIWERCMAN, A.,
HWANG, K. & CHENG, Y. S. 2023. Male infertility. Nat Rev Dis Primers, 9, 49.
EPA 1996. Guidelines for Reproductive Toxicity Risk Assessment. In: FORUM, R. A. (ed.).
Washington, DC: U.S. Environmental Protection Agency.
ESCOTT, G. M., JACOBUS, A. P. & LOSS, E. S. 2013. PI3K-dependent actions of insulin and
IGF-I on seminiferous tubules from immature rats. Pflugers Arch, 465, 1497-505.
EUSTACHE, F., BENNANI SMIRES, B., MOISON, D., BERGES, R., CANIVENC-LAVIER,
M. C., VAIMAN, D. & AUGER, J. 2020. Different exposure windows to low doses of
genistein and/or vinclozolin result in contrasted disorders of testis function and gene
expression of exposed rats and their unexposed progeny. Environ Res, 190, 109975.
FRANçA, L. R., HESS, R. A., DUFOUR, J. M., HOFMANN, M. C. & GRISWOLD, M. D.
2016. The Sertoli cell: one hundred fifty years of beauty and plasticity. Andrology, 4,
189-212.
FRANKE, F. E., PAULS, K., REY, R., MARKS, A., BERGMANN, M. & STEGER, K. 2004.
Differentiation markers of Sertoli cells and germ cells in fetal and early postnatal human
testis. Anatomy and Embryology, 209, 169-77.
FROMENT, P., VIGIER, M., NèGRE, D., FONTAINE, I., BEGHELLI, J., COSSET, F. L.,
HOLZENBERGER, M. & DURAND, P. 2007. Inactivation of the IGF-I receptor gene in
primary Sertoli cells highlights the autocrine effects of IGF-I. J Endocrinol, 194, 557-68.
GAO, F., MAITI, S., ALAM, N., ZHANG, Z., DENG, J. M., BEHRINGER, R. R.,
LéCUREUIL, C., GUILLOU, F. & HUFF, V. 2006. The Wilms tumor gene, Wt1, is
required for Sox9 expression and maintenance of tubular architecture in the developing
testis. Proc Natl Acad Sci U S A, 103, 11987-92.
GAO, H. T., XU, R., CAO, W. X., QIAN, L. L., WANG, M., LU, L., XU, Q. & YU, S. Q. 2017.
Effects of six priority controlled phthalate esters with long-term low-dose integrated
exposure on male reproductive toxicity in rats. Food Chem Toxicol, 101, 94-104.

43
GAO, Y., MRUK, D. D. & CHENG, C. Y. 2015. Sertoli cells are the target of environmental
toxicants in the testis – a mechanistic and therapeutic insight. Expert Opinion on
Therapeutic Targets, 19, 1073-1090.
GARCIA, T. X., DEFALCO, T., CAPEL, B. & HOFMANN, M.-C. 2013. Constitutive
activation of NOTCH1 signaling in Sertoli cells causes gonocyte exit from quiescence.
Developmental Biology, 377, 188-201.
GORE, A. C., LA MERRILL, M. A., PATISAUL, H. & SARGIS, R. M. 2024. Endocrine
Disrupting Chemicals: Threats to Human Health. IPEN.
GRISWOLD, M. D. 2018. 50 years of spermatogenesis: Sertoli cells and their interactions with
germ cells. Biol Reprod, 99, 87-100.
HAI, Y., HOU, J., LIU, Y., LIU, Y., YANG, H., LI, Z. & HE, Z. 2014. The roles and regulation
of Sertoli cells in fate determinations of spermatogonial stem cells and spermatogenesis.
Semin Cell Dev Biol, 29, 66-75.
HAVERFIELD, J. T., STANTON, P. G. & MEACHEM, S. J. 2015. 14 - Adult Sertoli cell
differentiation status in humans. In: GRISWOLD, M. D. (ed.) Sertoli Cell Biology
(Second Edition). Oxford: Academic Press.
HAYWOOD, M., SPALIVIERO, J., JIMEMEZ, M., KING, N. J. C., HANDELSMAN, D. J. &
ALLAN, C. M. 2003. Sertoli and Germ Cell Development in Hypogonadal (hpg) Mice
Expressing Transgenic Follicle-Stimulating Hormone Alone or in Combination with
Testosterone. Endocrinology, 144, 509-517.
HAZRA, R., CORCORAN, L., ROBSON, M., MCTAVISH, K. J., UPTON, D.,
HANDELSMAN, D. J. & ALLAN, C. M. 2013. Temporal Role of Sertoli Cell Androgen
Receptor Expression in Spermatogenic Development. Molecular Endocrinology, 27, 12-
24.
HILBOLD, E., DISTL, O., HOEDEMAKER, M., WILKENING, S., BEHR, R., RAJKOVIC, A.,
LANGEHEINE, M., RODE, K., JUNG, K., METZGER, J. & BREHM, R. H. J. 2020.
Loss of Cx43 in Murine Sertoli Cells Leads to Altered Prepubertal Sertoli Cell
Maturation and Impairment of the Mitosis-Meiosis Switch. Cells, 9.
HOLSBERGER, D. R., KIESEWETTER, S. E. & COOKE, P. S. 2005. Regulation of neonatal
Sertoli cell development by thyroid hormone receptor alpha1. Biol Reprod, 73, 396-403.
JENAB, S. & MORRIS, P. L. 1998. Testicular Leukemia Inhibitory Factor (LIF) and LIF
Receptor Mediate Phosphorylation of Signal Transducers and Activators of Transcription
(STAT)-3 and STAT-1 and Induce c-fos Transcription and Activator Protein-1 Activation
in Rat Sertoli But Not Germ Cells*. Endocrinology, 139, 1883-1890.
JIN, A., ZHOU, J., YU, P., ZHOU, S. & CHANG, C. 2022. High Expression of THBS1 Leads to
a Poor Prognosis in Papillary Thyroid Cancer and Suppresses the Anti-Tumor Immune
Microenvironment. Technol Cancer Res Treat, 21, 15330338221085360.

44
JONES, S., BOISVERT, A., DUONG, T. B., FRANCOIS, S., THRANE, P. & CULTY, M.
2014. Disruption of rat testis development following combined in utero exposure to the
phytoestrogen genistein and antiandrogenic plasticizer di-(2-ethylhexyl) phthalate. Biol
Reprod, 91, 64.
JONES, S., BOISVERT, A., FRANCOIS, S., ZHANG, L. & CULTY, M. 2015. In utero
exposure to di-(2-ethylhexyl) phthalate induces testicular effects in neonatal rats that are
antagonized by genistein cotreatment. Biol Reprod, 93, 92.
KASSOTIS, C. D., VANDENBERG, L. N., DEMENEIX, B. A., PORTA, M., SLAMA, R. &
TRASANDE, L. 2020. Endocrine-disrupting chemicals: economic, regulatory, and policy
implications. Lancet Diabetes Endocrinol, 8, 719-730.
KAUR, G., THOMPSON, L. A. & DUFOUR, J. M. 2014. Sertoli cells – Immunological
sentinels of spermatogenesis. Seminars in Cell & Developmental Biology, 30, 36-44.
KAVLOCK, R., BARR, D., BOEKELHEIDE, K., BRESLIN, W., BREYSSE, P., CHAPIN, R.,
GAIDO, K., HODGSON, E., MARCUS, M., SHEA, K. & WILLIAMS, P. 2006. NTPCERHR Expert Panel Update on the Reproductive and Developmental Toxicity of di(2-
ethylhexyl) phthalate. Reprod Toxicol, 22, 291-399.
KORTENKAMP, A. 2014. Low dose mixture effects of endocrine disrupters and their
implications for regulatory thresholds in chemical risk assessment. Curr Opin
Pharmacol, 19, 105-11.
KORTENKAMP, A. & FAUST, M. 2010. Combined exposures to anti-androgenic chemicals:
steps towards cumulative risk assessment. Int J Androl, 33, 463-74.
KORTENKAMP, A., FAUST, M., SCHOLZE, M. & BACKHAUS, T. 2007. Low-level
exposure to multiple chemicals: reason for human health concerns? Environ Health
Perspect, 115 Suppl 1, 106-14.
KRISTENSEN, D. M., HASS, U., LESNE, L., LOTTRUP, G., JACOBSEN, P. R., DESDOITSLETHIMONIER, C., BOBERG, J., PETERSEN, J. H., TOPPARI, J., JENSEN, T. K.,
BRUNAK, S., SKAKKEBAEK, N. E., NELLEMANN, C., MAIN, K. M., JEGOU, B. &
LEFFERS, H. 2011. Intrauterine exposure to mild analgesics is a risk factor for
development of male reproductive disorders in human and rat. Hum Reprod, 26, 235-44.
KRISTENSEN, D. M., LESNE, L., LE FOL, V., DESDOITS-LETHIMONIER, C., DEJUCQRAINSFORD, N., LEFFERS, H. & JEGOU, B. 2012. Paracetamol (acetaminophen),
aspirin (acetylsalicylic acid) and indomethacin are anti-androgenic in the rat foetal testis.
Int J Androl, 35, 377-84.
KRISTENSEN, D. M., MAZAUD-GUITTOT, S., GAUDRIAULT, P., LESNE, L., SERRANO,
T., MAIN, K. M. & JEGOU, B. 2016. Analgesic use - prevalence, biomonitoring and
endocrine and reproductive effects. Nat Rev Endocrinol, 12, 381-93.

45
LAZAREVIC, N., BARNETT, A. G., SLY, P. D. & KNIBBS, L. D. 2019. Statistical
Methodology in Studies of Prenatal Exposure to Mixtures of Endocrine-Disrupting
Chemicals: A Review of Existing Approaches and New Alternatives. Environ Health
Perspect, 127, 26001.
LECANTE, L. L., GAYE, B. & DELBES, G. 2022. Impact of in Utero Rat Exposure to
17Alpha-Ethinylestradiol or Genistein on Testicular Development and Germ Cell Gene
Expression. Front Toxicol, 4, 893050.
LOVELAND, K. L., KLEIN, B., PUESCHL, D., INDUMATHY, S., BERGMANN, M.,
LOVELAND, B. E., HEDGER, M. P. & SCHUPPE, H. C. 2017. Cytokines in Male
Fertility and Reproductive Pathologies: Immunoregulation and Beyond. Front
Endocrinol (Lausanne), 8, 307.
LUCAS, T. F. G., LAZARI, M. F. M. & PORTO, C. S. 2014. Differential role of the estrogen
receptors ESR1 and ESR2 on the regulation of proteins involved with proliferation and
differentiation of Sertoli cells from 15-day-old rats. Mol Cell Endocrinol, 382, 84-96.
LUCAS-HERALD, A. K. & MITCHELL, R. T. 2022. Testicular Sertoli Cell Hormones in
Differences in Sex Development. Front Endocrinol (Lausanne), 13, 919670.
LUPATTELLI, A., SPIGSET, O., TWIGG, M. J., ZAGORODNIKOVA, K., MåRDBY, A. C.,
MORETTI, M. E., DROZD, M., PANCHAUD, A., HäMEEN-ANTTILA, K.,
RIEUTORD, A., GJERGJA JURASKI, R., ODALOVIC, M., KENNEDY, D., RUDOLF,
G., JUCH, H., PASSIER, A., BJöRNSDóTTIR, I. & NORDENG, H. 2014. Medication
use in pregnancy: a cross-sectional, multinational web-based study. BMJ Open, 4,
e004365.
MACHERONI, C., LUCAS, T. F. G. & PORTO, C. S. 2020. The role of estrogen receptors in rat
Sertoli cells at different stages of development. Heliyon, 6, e05363.
MANKU, G. & CULTY, M. 2015a. Dynamic changes in the expression of apoptosis-related
genes in differentiating gonocytes and in seminomas. Asian J Androl, 17, 403-14.
MANKU, G. & CULTY, M. 2015b. Mammalian gonocyte and spermatogonia differentiation:
recent advances and remaining challenges. Reproduction, 149, R139-57.
MANKU, G., MAZER, M. & CULTY, M. 2012a. Neonatal testicular gonocytes isolation and
processing for immunocytochemical analysis. Methods Mol Biol, 825, 17-29.
MANKU, G., WING, S. S. & CULTY, M. 2012b. Expression of the Ubiquitin Proteasome
System in Neonatal Rat Gonocytes and Spermatogonia: Role in Gonocyte
Differentiation1. Biology of Reproduction, 87.
MARTINEZ-ARGUELLES, D. B., CAMPIOLI, E., CULTY, M., ZIRKIN, B. R. &
PAPADOPOULOS, V. 2013. Fetal origin of endocrine dysfunction in the adult: the
phthalate model. J Steroid Biochem Mol Biol, 137, 5-17.

46
MCCABE, M. J., ALLAN, C. M., FOO, C. F. H., NICHOLLS, P. K., MCTAVISH, K. J. &
STANTON, P. G. 2012. Androgen Initiates Sertoli Cell Tight Junction Formation in the
Hypogonadal (hpg) Mouse1. Biology of Reproduction, 87.
MENG, J., GREENLEE, A. R., TAUB, C. J. & BRAUN, R. E. 2011. Sertoli Cell-Specific
Deletion of the Androgen Receptor Compromises Testicular Immune Privilege in Mice1.
Biology of Reproduction, 85, 254-260.
MERONI, S. B., GALARDO, M. N., RINDONE, G., GORGA, A., RIERA, M. F. &
CIGORRAGA, S. B. 2019. Molecular Mechanisms and Signaling Pathways Involved in
Sertoli Cell Proliferation. Front Endocrinol (Lausanne), 10, 224.
MERONI, S. B., RIERA, M. F., PELLIZZARI, E. H. & CIGORRAGA, S. B. 2002. Regulation
of rat Sertoli cell function by FSH: possible role of phosphatidylinositol 3-kinase/protein
kinase B pathway. J Endocrinol, 174, 195-204.
NAIDU, R., BISWAS, B., WILLETT, I. R., CRIBB, J., KUMAR SINGH, B., PAUL
NATHANAIL, C., COULON, F., SEMPLE, K. T., JONES, K. C., BARCLAY, A. &
AITKEN, R. J. 2021. Chemical pollution: A growing peril and potential catastrophic risk
to humanity. Environ Int, 156, 106616.
NGUYEN, H. T. & MARTIN, L. J. 2023. Regulation of Cdh2 by the AP-1 family transcription
factor Junb in TM4 Sertoli cells. Biochem Biophys Res Commun, 663, 32-40.
NI, F. D., HAO, S. L. & YANG, W. X. 2019. Multiple signaling pathways in Sertoli cells: recent
findings in spermatogenesis. Cell Death Dis, 10, 541.
NICHOLLS, P. K., HARRISON, C. A., RAINCZUK, K. E., WAYNE VOGL, A. & STANTON,
P. G. 2013. Retinoic acid promotes Sertoli cell differentiation and antagonises activininduced proliferation. Molecular and Cellular Endocrinology, 377, 33-43.
O’DONNELL, L., SMITH, L. B. & REBOURCET, D. 2022. Sertoli cells as key drivers of testis
function. Seminars in Cell & Developmental Biology, 121, 2-9.
ORTH, J. M., HIGGINBOTHAM, C. A. & SALISBURY, R. L. 1984. Hemicastration causes
and testosterone prevents enhanced uptake of [3H] thymidine by Sertoli cells in testes of
immature rats. Biol Reprod, 30, 263-70.
ORTON, F., ERMLER, S., KUGATHAS, S., ROSIVATZ, E., SCHOLZE, M. &
KORTENKAMP, A. 2014. Mixture effects at very low doses with combinations of antiandrogenic pesticides, antioxidants, industrial pollutant and chemicals used in personal
care products. Toxicol Appl Pharmacol, 278, 201-8.
PETERSEN, C., BOITANI, C., FRöYSA, B. & SöDER, O. 2002. Interleukin-1 is a potent
growth factor for immature rat Sertoli cells. Molecular and Cellular Endocrinology, 186,
37-47.

47
PETERSEN, C., SVECHNIKOV, K., FRöYSA, B. & SöDER, O. 2005. The p38 MAPK
pathway mediates interleukin-1-induced Sertoli cell proliferation. Cytokine, 32, 51-9.
PHILIBERT, P., DEJARDIN, S., GIRARD, M., DURIX, Q., GONZALEZ, A. A., MIALHE, X.,
TARDAT, M., POULAT, F. & BOIZET-BONHOURE, B. 2023. Cocktails of NSAIDs
and 17alpha Ethinylestradiol at Environmentally Relevant Doses in Drinking Water Alter
Puberty Onset in Mice Intergenerationally. Int J Mol Sci, 24.
PRICE, P. S. 2023. The Hazard index at thirty-seven: New science new insights. Current
Opinion in Toxicology, 34, 100388.
RAHMOUN, M., LAVERY, R., LAURENT-CHABALLIER, S., BELLORA, N., PHILIP, G.
K., ROSSITTO, M., SYMON, A., PAILHOUX, E., CAMMAS, F., CHUNG, J.,
BAGHERI-FAM, S., MURPHY, M., BARDWELL, V., ZARKOWER, D., BOIZETBONHOURE, B., CLAIR, P., HARLEY, V. R. & POULAT, F. 2017. In mammalian
foetal testes, SOX9 regulates expression of its target genes by binding to genomic regions
with conserved signatures. Nucleic Acids Res, 45, 7191-7211.
REBOURCET, D., DARBEY, A., MONTEIRO, A., SOFFIENTINI, U., TSAI, Y. T., HANDEL,
I., PITETTI, J. L., NEF, S., SMITH, L. B. & O'SHAUGHNESSY, P. J. 2017. Sertoli Cell
Number Defines and Predicts Germ and Leydig Cell Population Sizes in the Adult Mouse
Testis. Endocrinology, 158, 2955-2969.
REY, R. A., MUSSE, M., VENARA, M. & CHEMES, H. E. 2009. Ontogeny of the androgen
receptor expression in the fetal and postnatal testis: its relevance on Sertoli cell
maturation and the onset of adult spermatogenesis. Microsc Res Tech, 72, 787-95.
ROBAIRE, B. & CHAN, P. 2023. The Handbook of Andrology, Third Edition, The American
Society of Andrology, The American Society of Andrology.
ROSSITTO, M., MARCHIVE, C., PRUVOST, A., SELLEM, E., GHETTAS, A., BADIOU, S.,
SUTRA, T., POULAT, F., PHILIBERT, P. & BOIZET-BONHOURE, B. 2019.
Intergenerational effects on mouse sperm quality after in utero exposure to
acetaminophen and ibuprofen. FASEB J, 33, 339-357.
ROSSITTO, M., UJJAN, S., POULAT, F. & BOIZET-BONHOURE, B. 2015. Multiple roles of
the prostaglandin D2 signaling pathway in reproduction. Reproduction, 149, R49-58.
ROZMAN, K. K., BHATIA, J., CALAFAT, A. M., CHAMBERS, C., CULTY, M., ETZEL, R.
A., FLAWS, J. A., HANSEN, D. K., HOYER, P. B., JEFFERY, E. H., KESNER, J. S.,
MARTY, S., THOMAS, J. A. & UMBACH, D. 2006. NTP-CERHR expert panel report
on the reproductive and developmental toxicity of genistein. Birth Defects Res B Dev
Reprod Toxicol, 77, 485-638.
SABIR, S., AKHTAR, M. F. & SALEEM, A. 2019. Endocrine disruption as an adverse effect of
non-endocrine targeting pharmaceuticals. Environ Sci Pollut Res Int, 26, 1277-1286.

48
SCHLEIF, M. C., HAVEL, S. L. & GRISWOLD, M. D. 2022. Function of Retinoic Acid in
Development of Male and Female Gametes. Nutrients, 14.
SCHMAHL, J., KIM, Y., COLVIN, J. S., ORNITZ, D. M. & CAPEL, B. 2004. Fgf9 induces
proliferation and nuclear localization of FGFR2 in Sertoli precursors during male sex
determination. Development, 131, 3627-36.
SCHUG, T. T., JOHNSON, A. F., BIRNBAUM, L. S., COLBORN, T., GUILLETTE, L. J., JR.,
CREWS, D. P., COLLINS, T., SOTO, A. M., VOM SAAL, F. S., MCLACHLAN, J. A.,
SONNENSCHEIN, C. & HEINDEL, J. J. 2016. Minireview: Endocrine Disruptors: Past
Lessons and Future Directions. Molecular Endocrinology, 30, 833-847.
SETCHELL, K. D., ZIMMER-NECHEMIAS, L., CAI, J. & HEUBI, J. E. 1997. Exposure of
infants to phyto-oestrogens from soy-based infant formula. Lancet, 350, 23-7.
SHAH, W., KHAN, R., SHAH, B., KHAN, A., DIL, S., LIU, W., WEN, J. & JIANG, X. 2021.
The Molecular Mechanism of Sex Hormones on Sertoli Cell Development and
Proliferation. Front Endocrinol (Lausanne), 12, 648141.
SHARPE, R. M., MCKINNELL, C., KIVLIN, C. & FISHER, J. S. 2003. Proliferation and
functional maturation of Sertoli cells, and their relevance to disorders of testis function in
adulthood. Reproduction, 125, 769-84.
SHIRASAWA, S., SUGIYAMA, S., BABA, I., INOKUCHI, J., SEKINE, S., OGINO, K.,
KAWAMURA, Y., DOHI, T., FUJIMOTO, M. & SASAZUKI, T. 2004. Dermatitis due
to epiregulin deficiency and a critical role of epiregulin in immune-related responses of
keratinocyte and macrophage. Proc Natl Acad Sci U S A, 101, 13921-6.
SKAKKEBAEK, N. E., RAJPERT-DE MEYTS, E. & MAIN, K. M. 2001. Testicular dysgenesis
syndrome: an increasingly common developmental disorder with environmental aspects.
Hum Reprod, 16, 972-8.
SUEN, A. A., KENAN, A. C. & WILLIAMS, C. J. 2022. Developmental exposure to
phytoestrogens found in soy: New findings and clinical implications. Biochemical
Pharmacology, 195, 114848.
TARULLI, G. A., STANTON, P. G. & MEACHEM, S. J. 2012. Is the adult Sertoli cell
terminally differentiated? Biol Reprod, 87, 13, 1-11.
THUILLIER, R., MAZER, M., MANKU, G., BOISVERT, A., WANG, Y. & CULTY, M. 2010.
Interdependence of platelet-derived growth factor and estrogen-signaling pathways in
inducing neonatal rat testicular gonocytes proliferation. Biol Reprod, 82, 825-36.
TRAN-GUZMAN, A. & CULTY, M. 2022. Eicosanoid Biosynthesis in Male Reproductive
Development: Effects of Perinatal Exposure to NSAIDs and Analgesic Drugs. Front
Toxicol, 4, 842565.

49
TRAN-GUZMAN, A., MORADIAN, R., CUI, H. & CULTY, M. 2022. In vitro impact of
genistein and mono(2-ethylhexyl) phthalate (MEHP) on the eicosanoid pathway in
spermatogonial stem cells. Reproductive Toxicology, 107, 150-165.
WALKER, C., BOISVERT, A., MALUSARE, P. & CULTY, M. 2023. Impact of Fetal Exposure
to Endocrine Disrupting Chemical Mixtures on FOXA3 Gene and Protein Expression in
Adult Rat Testes. Int J Mol Sci, 24.
WALKER, C., GARZA, S., PAPADOPOULOS, V. & CULTY, M. 2021. Impact of endocrinedisrupting chemicals on steroidogenesis and consequences on testicular function. Mol
Cell Endocrinol, 527, 111215.
WALKER, C., GHAZISAEIDI, S., COLLET, B., BOISVERT, A. & CULTY, M. 2020. In utero
exposure to low doses of genistein and di-(2-ethylhexyl) phthalate (DEHP) alters innate
immune cells in neonatal and adult rat testes. Andrology, 8, 943-964.
WANG, J. M., LI, Z. F. & YANG, W. X. 2022. What Does Androgen Receptor Signaling
Pathway in Sertoli Cells During Normal Spermatogenesis Tell Us? Front Endocrinol
(Lausanne), 13, 838858.
WANG, X., HA, D., YOSHITAKE, R., CHAN, Y. S., SADAVA, D. & CHEN, S. 2021.
Exploring the Biological Activity and Mechanism of Xenoestrogens and Phytoestrogens
in Cancers: Emerging Methods and Concepts. Int J Mol Sci, 22.
WANG, Z., WALKER, G. W., MUIR, D. C. G. & NAGATANI-YOSHIDA, K. 2020. Toward a
Global Understanding of Chemical Pollution: A First Comprehensive Analysis of
National and Regional Chemical Inventories. Environ Sci Technol, 54, 2575-2584.
WILLEMS, A., BATLOUNI, S. R., ESNAL, A., SWINNEN, J. V., SAUNDERS, P. T.,
SHARPE, R. M., FRANçA, L. R., DE GENDT, K. & VERHOEVEN, G. 2010. Selective
ablation of the androgen receptor in mouse sertoli cells affects sertoli cell maturation,
barrier formation and cytoskeletal development. PLoS One, 5, e14168.
XU, Y., WANG, T., YIN, J., HU, L. & LIAO, C. 2024. The silent threat and countermeasures:
Navigating the mixture risk of endocrine-disrupting chemicals on pregnancy loss in
China. Eco-Environment & Health.
YANG, Q.-E. & OATLEY, J. M. 2015. 3 - Early postnatal interactions between Sertoli and germ
cells. In: GRISWOLD, M. D. (ed.) Sertoli Cell Biology (Second Edition). Oxford:
Academic Press.
YANG, Y., WU, W. & WU, A. 2019. Toxicity Evaluation Using Animal and Cell Models. In:
WU, A. (ed.) Food Safety & Mycotoxins. Singapore: Springer Singapore.
YAO, H. H.-C., UNGEWITTER, E., FRANCO, H. & CAPEL, B. 2015. 2 - Establishment of
fetal Sertoli cells and their role in testis morphogenesis. In: GRISWOLD, M. D. (ed.)
Sertoli Cell Biology (Second Edition). Oxford: Academic Press.

50
ZIMMERMANN, C., STéVANT, I., BOREL, C., CONNE, B., PITETTI, J. L., CALVEL, P.,
KAESSMANN, H., JéGOU, B., CHALMEL, F. & NEF, S. 2015. Research resource: the
dynamic transcriptional profile of sertoli cells during the progression of spermatogenesis.
Mol Endocrinol, 29, 627-42.

Abstract (if available)

Abstract Exposure to endocrine-disrupting chemicals (EDCs) and pharmaceuticals during development has been linked to reproductive dysfunction and infertility. The aim of this project was to expand understanding of the adverse effects associated with EDCs, pharmaceuticals, and their mixtures which can pose a threat to male gonadal development. The current scientific landscape lacks cell-by-cell analyses of mixture effects which could provide valuable insights into molecular mechanisms that underlie the dysregulation of testicular function. Sertoli cells, which provide support to every cell within the testis, are instrumental to the process of spermatogenesis, and their dysregulation can contribute to disease and infertility. Thus, we probed two Sertoli cell models and surveyed the impact of analgesic acetaminophen (APAP), phytoestrogen genistein (GEN), and their mixture based on the likelihood of infant exposure and their association with disrupting the testicular environment individually.

To address our aim, we hypothesized that APAP, GEN, and their mixture disrupt immature Sertoli cell functions. Using primary rat Sertoli cells isolated at the immature stage of testicular development and a mouse immature Sertoli cell line, we evaluated the adverse effects of these compounds on cell viability, proliferation, the expression of Sertoli markers, the eicosanoid pathway, and estrogen receptor signaling genes and proteins using multiple in vitro assays. Next, we performed RNA sequencing analysis to discover other pathways and markers disrupted by these compounds and their mixture. We found several altered pathways and genes that are related to Sertoli cell and gonadal development. We used this data to probe the mechanisms by which APAP, GEN, and their mixture altered SC functions, by comparing them to targets of their prospective pathways. We found that APAP and GEN acted on immature SCs mainly via expected signaling pathways but that there were also overlaps in some of their targets, suggesting additive or synergistic effects of the mixtures.

This research supports the need for comprehensive risk assessment strategies that consider the complex nature of chemical exposures in real-world scenarios. By advancing our understanding of how EDC and pharmaceutical mixtures affect testicular cells, we aim to contribute to the development of better regulatory policies and therapeutic interventions to mitigate the impact of these compounds on male fertility.

Linked assets

University of Southern California Dissertations and Theses

Conceptually similar

PDF

Disruption of immature Sertoli cell functions by endocrine disruptors and analgesic drugs

PDF

Effect of acetaminophen and ibuprofen on spermatogenesis and cell signaling mechanisms

PDF

Identification of functional pathways altered in testis by in utero exposure to low doses of genistein and DEHP

PDF

Eicosanoid regulation of spermatogonial stem cell development

PDF

Fetal exposure to genistein and DEHP mixtures alters the expression of genes involved in critical testicular functions in adult rats

PDF

Endocrine disrupting chemicals: identifying reproductive toxic effects and disease of endocrine disrupting chemicals on male spermatogenesis

PDF

Mitochondrial dynamics regulate Leydig cell health and integrity

PDF

Effect of a mixture of two environmental chemicals on the interactions between macrophages and spermatogonia

PDF

The role of translocator protein (TSPO) in mediating the effects of mitotane in human adrenocortical carcinoma cells

PDF

Role of steroidogenic acute regulatory protein (STAR) and sterol carrier protein-x (SCPx) in the transport of cholesterol and other lipids

PDF

Reevaluation of the pregnenolone biosynthesis pathway in the human brain

PDF

The differential effects of genistein on cellular effects in T47D tumorigenic and MCF10A nontumorigenic breast epithelial cells: role of metabolism

PDF

Role of translocator protein (18 kDa) in cell function and metabolism

PDF

Role of the NF-κB-CXCL1 signaling pathway in the development of metabolic dysfunction-associated steatohepatitits

PDF

Effect of vicrostatin (an integrin based therapy) on canine osteosarcoma

PDF

Inhibition of NR3B1 attenuates the progression of NAFLD and NASH in liver-specific Pten knockout mice

PDF

Estradiol regulation of cerebral metabolism: implications for neuroprotection and mitochondrial bioenergetics

PDF

Steatosis induces Wnt/β-catenin pathway to stimulate proliferation of hepatic tumor initiating cells and promote liver cancer development

PDF

Regulation of mitochondrial bioenergetics via PTEN (phosphatase and tensin homolog deleted on chromosome 10)/estrogen-related receptor alpha (ERRα) signaling

PDF

Exploring the impact of elevated bile acids in metabolic dysfunction- associated steatotic liver disease in vitro

Asset Metadata

Creator Mohajer, Nicole (author)

Core Title Effects of endocrine disrupting chemicals and pharmaceuticals on rodent immature Sertoli cell functions

School School of Pharmacy

Degree Master of Science

Degree Program Molecular Pharmacology and Toxicology

Degree Conferral Date 2024-08

Publication Date 08/13/2024

Defense Date 08/09/2024

Publisher Los Angeles, California (original), University of Southern California (original), University of Southern California. Libraries (digital)

Tag acetaminophen,endocrine disrupting chemicals,genistein,infertility,Male,mixture,OAI-PMH Harvest,reproduction,rodent,Sertoli cells,Testis

Format theses (aat)

Language English

Contributor Electronically uploaded by the author (provenance)

Advisor Cadenas, Enrique (committee chair), Culty, Martine (committee chair), Papadopoulos, Vassilios (committee chair)

Creator Email nikimohajer822@gmail.com,nzmohaje@usc.edu

Permanent Link (DOI) https://doi.org/10.25549/usctheses-oUC113998TF1

Unique identifier UC113998TF1

Identifier etd-MohajerNic-13373.pdf (filename)

Legacy Identifier etd-MohajerNic-13373

Document Type Thesis

Format theses (aat)

Rights Mohajer, Nicole

Internet Media Type application/pdf

Type texts

Source 20240813-usctheses-batch-1196 (batch), University of Southern California (contributing entity), University of Southern California Dissertations and Theses (collection)

Access Conditions The author retains rights to his/her dissertation, thesis or other graduate work according to U.S. copyright law. Electronic access is being provided by the USC Libraries in agreement with the author, as the original true and official version of the work, but does not grant the reader permission to use the work if the desired use is covered by copyright. It is the author, as rights holder, who must provide use permission if such use is covered by copyright.

Repository Name University of Southern California Digital Library

Repository Location USC Digital Library, University of Southern California, University Park Campus MC 2810, 3434 South Grand Avenue, 2nd Floor, Los Angeles, California 90089-2810, USA

Repository Email cisadmin@lib.usc.edu