University of Southern California Dissertations and Theses

Cross-species comparison of non-canonical Wnt signaling in the developing retina

(USC Thesis Other)

Cross-species comparison of non-canonical Wnt signaling in the developing retina

PDF

Download a page range

Download transcript

Copy asset link

Request this asset

Transcript (if available)

Content Cross-Species Comparison of Non-Canonical Wnt Signaling in the Developing Retina
by
Rosanna Calderon Campos
A Dissertation Presented to the
FACULTY OF THE USC GRADUATE SCHOOL
UNIVERSITY OF SOUTHERN CALIFORNIA
In partial Fulfillment of the
Requirements for the Degree
DOCTOR OF PHILOSOPHY
(DEVELOPMENT, STEM CELLS AND REGENERATIVE MEDICINE)
August 2024
Copyright 2024 Rosanna Calderon Campos

ii
ACKNOWLEDGMENTS
First and foremost, I would like to thank my mentor, Dr. Aaron Nagiel, for the
opportunity to join his lab and his support throughout my graduate career. Thank you for
helping me learn how to work independently, encouraging me to become a better writer,
teaching me how to cope with the stresses of graduate school, and reassuring me as I
navigated balancing becoming a new parent while pursuing a doctoral degree.
I wish to express my gratitude to the members of my dissertation committee, Dr.
Giorgia Quadrato, Dr. Ellen Lien, and Dr. Kenia Gnedeva, for their guidance and support
over the past five years.
I want to thank my parents, Angel and Silvina Calderon, for all their love and
sacrifices that have allowed me to pursue such a long academic journey. I would not have
such incredible opportunities in life without all their support and dedication. I want to thank
my brothers, Angel and Rudy, for always providing kind words of encouragement. I want
to express my appreciation for my cohort friends Kate Millette, Ariel Vonk, and Ashley Del
Dosso. They are the most amazing group of friends I could ask for! I am so grateful to
have gone through this journey with you all. I sincerely thank Dr. Esteban Fernandez for
being an incredible mentor and a great friend. I want to thank my lab mates, especially
Kayla and Patty. I appreciate all your support, and I will miss you tremendously!
I want to thank my husband, Jesus Campos. I do not have the words to describe
how much I appreciate your support and hard work. You have been my rock through
these last six years, and I wouldn’t be here today without you. I am grateful to have you
as my life partner and to be able to share this amazing accomplishment with you. I love

iii
you. Finally, to my son, little Jesus Campos, I love you. You are my happiness and my
greatest motivation. Mommy loves you.

iv
TABLE OF CONTENTS
Acknowledgments ........................................................................................................... ii
List of Tables ................................................................................................................... vi
List of Figures ................................................................................................................. vii
List of Abbreviations ........................................................................................................ ix
Chapter 1: General Introduction
1.1 Anatomy of the Retina.................................................................................... 1
1.2 Retinal Neuronal Circuitry Relays Visual Information to the Brain ............... 3
1.3 Retinal Degenerative Diseases and Current Treatment Strategies ............. 5
1.4 Research Models for Mammalian Retina ...................................................... 7
1.5 State of Retinal Research and Human Retinal Organoids ........................... 9
1.6 Wnt Signaling ................................................................................................. 13
Chapter 2: Non-Canonical Wnt Pathway Expression in The Developing
Mouse and Human Retina
Abstract................................................................................................................. 16
2.1 Introduction..................................................................................................... 17
2.2 Results............................................................................................................ 19
2.3 Discussion ...................................................................................................... 23
2.4 Materials and Methods................................................................................... 27
2.5 Tables ............................................................................................................. 34
2.6 Figures............................................................................................................ 35
2.7 Supplementary Figures.................................................................................. 45
Chapter 3: Strategy for the Generation of an Inducible Human iPSC FZD3
Knockout Cell Line
Abstract................................................................................................................. 53
3.1 Introduction..................................................................................................... 54
3.2 Results............................................................................................................ 56
3.3 Discussion ...................................................................................................... 59

v
3.4 Materials and Methods................................................................................... 61
3.5 Tables ............................................................................................................. 64
3.6 Figures............................................................................................................ 66
Chapter 4: Concluding Remarks.................................................................................... 71
References ..................................................................................................................... 79
Appendix A: Manuscript Information
Manuscript adapted for Chapter 1 .................................................................................. 87
Manuscript adapted for Chapter 2 .................................................................................. 88

vi
LIST OF TABLES
Table 2.1 | List of single-cell RNA sequencing datasets used for analysis of
mouse, human, and human retinal organoid................................................................. 34
Table S2.1 | Components of human retinal organoid differentiation media ................. 51
Table S2.2 | List of fluorescents in situ hybridization probes used in the study........... 52
Table 3.1 | List of PCR primer sequences for amplification of target genes in the
cDNA library.................................................................................................................... 64
Table 3.2 | List of sgRNAs sequences .......................................................................... 65

vii
LIST OF FIGURES
Figure 1.1 | Histology of the adult mammalian retina ................................................... 2
Figure 1.2 | Schematic of retinal degenerative diseases.............................................. 5
Figure 1.3 | Time-course of human and mouse retinal development .......................... 8
Figure 1.4 | Human ROs recapitulate retinal development in vitro .............................. 12
Figure 1.5 | Wnt signal transduction pathways............................................................. 14
Figure 2.1 | UMAPs illustrate the three retinal scRNAseq datasets for mouse,
human, and human retinal organoid .............................................................................. 35
Figure 2.2 | Expression patterns of candidate non-canonical Wnt pathway genes
from mouse, human, and human retinal organoid scRNAseq datasets ....................... 36
Figure 2.3 |Gene expression pattern of Fzd3 in five major retinal cell types,
including rod, cone, bipolar, horizontal, and amacrine cells during development
in mouse, human, and human retinal organoid tissue .................................................. 37
Figure 2.4 | Fluorescence in situ hybridization for Fzd3 in mouse, human fetal
retina, and HRO.............................................................................................................. 38
Figure 2.5 | Gene expression pattern of Wnt2b, Wnt5a, and Wnt10a in five
major retinal cell types across various developmental time points for mouse,
human, and human retinal organoid tissue ................................................................... 39
Figure 2.6 | Fluorescence in situ hybridization for Wnt2b, Wnt5a, and Wnt10a
in mouse retina, human fetal retina, and HRO.............................................................. 40
Figure 2.7 | Gene expression pattern of Wnt mediators Vangl2, Celsr3,
Ryk, and Dvl1 in five major retinal cell types, including rod, cone, bipolar,
horizontal, and amacrine cells across development in mouse,
human, and human retinal organoid tissue ................................................................... 42

viii
Figure 2.8 | Fluorescence in situ hybridization for Vangl2, Dvl, Celsr3, and
Ryk in mouse retina, human fetal retina, and HRO....................................................... 43
Figure S2.1 | An overview of culture conditions for human retinal organoids
derived from iPSCs......................................................................................................... 45
Figure S2.2 |The number of puncta was quantified for a select set of genes
inthe retinal ganglion cell layer for mouse and human retina........................................ 46
Figure S2.3 | Fluorescent in situ hybridization of mouse retina at ages
P6, P8, P10, P12, and adult for Fzd3, Wnt2b, and Wnt5a............................................ 47
Figure S2.4 | Fluorescent in situ hybridization of mouse retina at ages
P6, P8, P10, P12, and adult for Vangl2, Celsr3, Dvl1, and Ryk ................................... 48
Figure S2.5 | Fluorescent in situ hybridization of the human fetal retina
(FW18.1) follows NRL staining pattern.......................................................................... 49
Figure 3.1 | PCR analysis of FZD3 expression in cDNA of iPSC and HROs .............. 66
Figure 3.2 | Schematic of the two-step strategy for generating an inducible
knockout (iKO) WTC11 cell line targeting FZD3 ........................................................... 67
Figure 3.3 | Schematic representation of the insertion of LoxP sites via HDR
repair............................................................................................................................... 68
Figure 3.4 | Generation of donor plasmid for AAVS1 locus ......................................... 69
Figure 3.5 | Schematic illustrating the iKO of FZD in cultured HROs .......................... 70

ix
LIST OF ABBREVIATIONS
AAVS1 – adeno-associated virus integration site 1
Cas9 – CRISPR- associated protein nuclease
CRISPR – clustered regularly interspaced short palindromic repeats
CELSR – Cadherin EGF LAG Seven-Pass G-Type Receptor
D – Days
DVL – Disheveled
ERT2 – Estrogen Receptor T2
ESCs – Embryonic stem cells
FISH – Fluorescent in situ Hybridization
FW – Fetal Week
FZD – Frizzled
GCL – Ganglion Cell Layer
HDR – Homology Directed Repair
HRO – Human Retinal Organoids
iKO – Inducible knockout
INDEL – Insertion/Deletion
INL – Inner Nuclear Layer
IRD – Inherited retinal dystrophies
iPSC – Induced pluripotent stem cells
NRL – Neural Retina Leucine Zipper
ONL – Outer Nuclear Layer
OPL – Outer Plexiform Layer

x
P – Postnatal Day
PCP – Planar Cell Polarity
PCR – Polymerase Chain Reaction
PPP1R12C – protein phosphatase 1, regulatory subunit 12C
RBC – Rod bipolar cell
RCVRN – Recoverin
RP – Retinitis Pigmentosa
PR – Photoreceptors
RPE – Retinal pigment epithelium
RYK – Receptor-Like Tyrosine Kinase
scRNAseq – Single-cell RNA sequencing
sgRNA – small guide RNA
ssODN – single-stranded oligodeoxynucleotide
VANGL – Vang-Like Protein
WNT – Wnt Family Member

CHAPTER 1
Introduction
1.1 Anatomy of the Retina
The retina is the layer of neural tissue lining the back of the eye that responds
to light and is adjacent to the retinal pigmented epithelium (RPE), which supports and
nourishes the neurosensory cells (S. Yang et al., 2021). In vertebrates, the neural retina
comprises six major neuronal cell types organized into five layers (Demb & Singer, 2015).
The outer nuclear layer (ONL) houses the photoreceptor cells' bodies, including rods and
cones (Zhang et al., 2011). Both rod and cone photoreceptors contain photopigments
with light-absorbing chromophores, which are coupled to rod- or cone-specific G-proteincoupled receptors known as opsins and can absorb specific light wavelengths. The
absorption of a photon by opsin induces a conformational change in the opsin protein,
which activates a G-protein biochemical signaling cascade. This cascade ultimately leads
to changes in membrane ion channels, resulting in a change in the cell’s membrane
potential and the generation of an electrical signal that is transmitted to the brain for visual
processing (Fain et al., 2010). The change in membrane permeability resulting from the
closure of the ion channels leads to a change in the photoreceptor membrane potential,
which then propagates the signal to the retinal bipolar neurons (Kolb, 2011). The
photoreceptor axons terminate and form synaptic connections within the outer plexiform
layer (OPL) with the dendrites of the intermediate neuronal cells, including bipolar cells,

2
horizontal cells, and amacrine cells (Fan et al., 2016; Shekhar et al., 2016). The inner
nuclear layer (INL) includes the cell body of all the intermediate neuron cells. Axons of
the bipolar and amacrine cells terminate in the inner plexiform layer, forming synaptic
connections with ganglion cells in the inner plexiform layer (IPL) (Nguyen-Ba-Charvet &
Chédotal, 2014). Ganglion cell bodies are located within the ganglion cell layer (GCL),
and their axons converge at the optic disc and transmit signals to the visual processing
centers of the brain via the optic nerve (Nguyen-Ba-Charvet & Rebsam, 2020).

3
Figure 1.1: Histology of the adult mammalian retina. Light passes through the cornea
and lens to reach the retina. The fundamental structure consists of six major neuronal cell
classes (rod, cones, bipolar cells, amacrine cells, horizontal cells, and ganglion cells),
organized into five layers: the outer nuclear layer (ONL), outer plexiform layer (OPL),
inner nuclear layer (INL), inner plexiform layer (IPL) and the ganglion cell layer (GCL).
Ganglion cells are closest to the lens, while photoreceptors are adjacent to the pigment
epithelium. Light travels through the retina and is detected by the rod and cone
photoreceptors. The signal is transduced across the neuronal network and to the brain
(Hoon et al., 2014). Schematic generated with BioRender.
1.2 Retinal Neuronal Circuitry Relays Visual Information to the Brain
Our eyes can transduce light energy into an electrical signal, which the brain can
propagate and process (Ptito et al., 2021). Light enters the eye through the cornea and
the pupil. The iris will dilate or constrict to regulate the light entering the eye, and the lens
will focus the light onto the retina's surface. In the retina, light is then absorbed by rod or
cone photoreceptors, which contain various opsin proteins within the outer segments
(Shichida & Matsuyama, 2009). With some overlap, rods are highly sensitive to dim
conditions, whereas cones can detect a spectrum of wavelengths, enabling our color
vision and the ability to perceive the visible light spectrum.
Photoreceptors transmit the visual information to bipolar cells, which then relay the
signal to retinal ganglion cells (RGC). RGCs converge to form the optic nerve (Burger et
al., 2021). Rods connect to rod bipolar cells (RBC) and All amacrine cells, which in turn
send the signal to both ON and OFF ganglion cells (Whitaker et al., 2021). The optic
nerves exit the back of each eye, cross over at the optic chiasm, and project to the lateral
geniculate nucleus of the thalamus before reaching the primary visual cortex (Erskine &
Herrera, 2014). Damage to the retina or optic nerve, whether from disease or injury, can

4
lead to irreversible vision loss. Currently, no effective treatments exist to restore lost
connections or replace damaged retina neurons (Crair & Mason, 2016).
Researchers have made significant advances in understanding the complex
process of establishing retinal and brain neuronal circuitry. Neurons of the primary visual
cortex receive input from both eyes, and neurons with the same eye preference are
organized into the same ocular dominance columns within the brain. The concept of
ocular dominance columns was introduced by a series of groundbreaking experiments
conducted by Wiesel and Hubel in the 1960s using cats. Their research involved depriving
vision in one eye via a monocular eyelid suture, which led to the shrinkage of ocular
dominance columns corresponding to the closed eye (Horton & Hocking, 1997; Hubel &
Wiesel, n.d.).
Ocular dominance columns are particularly susceptible to change during a window
of development known as the critical period (Wurtz, 2009). During this time, neurons are
actively forming new synapses and pruning existing ones, which fine-tunes the neural
connections. Hubel and Wiesel’s experiments highlighted how visual experiences during
early development are critical in shaping neuronal networks and demonstrated the impact
of visual deprivation on the shrinkage of ocular dominance columns (Horton & Hocking,
1997). Further studies considering the age of animals, and the duration of the experiment
highlighted the importance of this developmental window and emphasized the importance
of early intervention to address conditions that could lead to visual impairments.

5
1.3 Retinal Degenerative Disease and Current Treatment Strategies
The field of regenerative medicine is focused on understanding developmental
pathways and developing new methods to replace human cells and restore the normal
function of tissues and organs (Gomes et al., 2017). This area of medicine is crucial
because many tissues in the human body are lost due to disease and injury, with current
treatments often relying on donor organ transplantation (Coco-Martin et al., 2021).
Regenerative medicine has the potential to heal tissue damaged by age, disease, and
trauma and even normalize congenital defects.
Unlike birds and amphibians, which have notable regenerative capacities, the
mammalian retina has a limited ability for de novo neurogenesis (Xia & Ahmad, 2016).
Retinal degenerative conditions are progressive neurological disorders caused by genetic
mutations or pathological damage to the retinal neurons, leading to irreversible and
incurable vision loss (Figure 1.2) (Lee et al., 2021).

6
Figure1.2: Schematic of retinal degenerative diseases. Retinal degenerative diseases
are progressive neurological disorders resulting in irreversible apoptosis of retinal
neurons. Retinal degenerative diseases are multifactorial diseases caused by genetic and
environmental pathological damage, with minimal current treatment options available
(Hejtmancik & Daiger, 2020). Retinal cell replacement therapy is an emerging potential
therapeutic approach based on the differentiation of retinal neural cells and retinal
pigment epithelium cells in vitro and delivered subretinal, intravitreal, or suprachoroidal
(Coco-Martin et al., 2021). Image generated with BioRender.
Inherited retinal dystrophies (IRD) are a group of genetically inherited disorders
characterized by progressive retinal deterioration that leads to vision loss (Georgiou et
al., 2021). IRDs can manifest from birth or develop later in life, presenting symptoms such
as night blindness, color blindness, loss of peripheral vision, and progression to complete
blindness. Approximately 300 genes associated with IRDs have been identified, following
various inheritance patterns, including autosomal dominant, autosomal recessive, and Xlinked. Current treatment options to slow the progression and prevent blindness in IRDs
are limited. However, due to the accessibility of photoreceptors for surgical intervention
and the role of the blood-retinal barrier in ocular immune privilege, gene therapy and cell
therapy present promising treatment avenues. Gene therapy aims to deliver a functional
copy of the mutated gene to halt vision loss, while cell therapy, combined with gene
editing technologies, seeks to replace damaged retinal cells. Significant advancements
in gene therapy, such as the drug voretigene neparvovec-rzyl, which can deliver a healthy
copy of the gene RPE65, resulting in promising patient outcomes (Darrow, 2019).
Continued research into the molecular mechanisms of retinal development and
deterioration will facilitate the innovation of new therapies to address and repair damage
to retinal neural circuitry.

7
1.4 Research Models for Mammalian Retina
For years, mice have been the most widely used model for studying retinal
development and disease. Genetically engineered mice have been invaluable for basic
science research, testing gene therapy strategies, and identifying novel causative genes
for IRDs (Moshiri, 2021). Murine models have laid the groundwork for pinpointing
candidate genes in human retinal disease through genetic studies, including gene
knockout models.
Despite their many advantages, murine models have significant limitations. One
major limitation is that the architecture of the rodent eye differs from that of the human
eye (Brennenstuhl et al., 2015). Importantly, murine models lack a fovea. Additionally,
murine models have not always accurately recapitulated human retinal disease
phenotypes for various IRDs (Géléoc & El-Amraoui, 2020; Mata et al., 2001). The
absence of a macula and rodents' relatively short lifespans render them inadequate for
studying age-related macular degeneration, the leading cause of blindness in the United
States.
There are notable similarities and differences between the retinal neurogenesis in
humans and rodents. In both species, the six major neuronal cell types arise from a pool
of multipotent retinal progenitor cells (Figure 1.3) (Bassett & Wallace, 2012). The order in
which specific neuronal cell types appear is generally conserved across vertebrate
species (Livesey & Cepko, 2001). During rodent embryogenesis, ganglion cells arise first,
followed by cones, horizontal cells, and amacrine cells. A second wave of cellular
differentiation occurs postnatally, which gives rise to bipolar cells, amacrine cells, and
rods (Bassett & Wallace, 2012).

8
In contrast, human retinogenesis and retinal lamination occur between gestational
weeks 24 and 4 months postnatal (Quinn & Wijnholds, 2019). Humans and all other
primates form a fovea, a rod-free area of the retina responsible for high visual acuity, and
develops as early as the 11th week of gestation (Hendrickson, 2016). As the retina
develops in utero, a prominent foveal-to-peripheral gradient is established, with
neighboring areas across the same plane of the retina noticeably different developmental
stages. The OPL first appears in the foveal region around gestational week 13 and
progressively extends to the peripheral retina by gestational week 32 (Hendrickson,
2016).

9
Figure 1.3: Time-course of human and mouse retinal development. This schematic
illustrates the comparative neurogenesis between mice and humans. In humans, retinal
neurogenesis occurs during fetal development, with the fovea appearing at fetal week 25
and maturing by 15 months of age. The IPL emerges in the fovea at fetal week 8, reaches
the optic nerve by fetal week 12, and is present in both nasal and temporal peripheral
edges by fetal week 18–21. The OPL first appears in the fetal week 11 fovea and reaches
retinal edges by fetal week 30. In humans, eyelids open by fetal week 25, and
morphologically full retina development is completed only at 2 years of age. At birth, the
rodent retina is still poorly developed. OPL formation occurs postnatally, between P4 and
P10, but IPL formation takes place during embryogenesis. Rodents open their eyelids at
the age of P14 and reach morphologically full retinal development at P20–P21. The
schematic was adapted from (Telegina et al., 2021) and was generated using BioRender.
1.5 State of Retinal Research and Human Retinal Organoids
The inherent differences in retinal structure and function of animal models and the
limited availability of human early developmental and diseased retinal tissue significantly
restrict our understanding of retinal disease and developmental processes. To overcome
these limitations, new model systems are being developed to investigate the genetic
causes and cellular mechanisms underlying human retinal development and disease
(Hirami et al., 2009; Meyer et al., 2009). Recent advancements in embryonic stem cells
(ESCs) and the reprogramming of somatic cells into induced pluripotent stem cells
(iPSCs) have led to the creation of innovative models that enhance our understanding of
human biology (Foltz & Clegg, 2019; Mullin et al., 2021).
Human retinal organoids (HROs) are generated by differentiating stem cells into
self-organizing three-dimensional aggregates that express retinal cell type markers and
develop laminated structures similar to the native human retina (Eiraku et al., 2011).

10
Significant advances have been made to enhance the molecular characteristics and
morphological similarities of HROs to the native human retina, emphasizing the utility of
this emerging model in providing researchers access to early human retinogenesis.
Researchers have studied and staged the fetal human outer retina development based
on cell morphology, demonstrating how effectively HROs can recapitulate outer retina
development (Figure 1.4) (Mustafi et al., 2022; Prameela Bharathan et al., 2021).
Various retinal organoid differentiation protocols have been published, each
producing inconsistent organoids with variable cell proportions, shapes, and maturation
stages. As described by Zhong et al., 2014 protocol – iPSC aggregates are initially
attached to Matrigel-coated dishes, which differentiate into eye-field-like domains and
then into neural retina and RPE. The retinal cups are then mechanically detached and
continued to be cultured in suspension. This protocol results in rod-dense organoids,
which appear to have advanced stages of maturation and possible functional
photoreceptors (Zhong et al., 2014). In contrast, the Kuwahara et al., 2015 protocol is a
Matrigel-free protocol. It establishes neural differentiation by timed addition of BMP4
treatment and inhibition of GSK3 and FGFR, transitioning the neural retina to RPE. The
removal of inhibitors results in reversion back to neural retinal cells, which are then
maintained in culture for over 200 days. This protocol outlines what is referred to as the
induction-reversal method, and organoids produced display a central-to-periphery polarity
and RPE (Kuwahara et al., 2015). While currently established protocols are successful at
differentiating iPSCs into HROs, one main focus in the field is to standardize protocols to
increase efficiency and minimize the variability among the HROs produced (Harkin et al.,
2024).

11
While various protocols have proven efficient at differentiating stem cells into
neural retinas, morphological differences make comparisons across protocols
challenging. Organoids cultured as suspended aggregates encounter obstacles,
including the lack of blood vasculature, resulting in low nutrient and oxygen diffusion and
cell death. Additionally, the lack of connectivity to neurons of the visual cortex leads to
the progressive loss of RGCs throughout their long-term culture (Zhao & Yan, 2024).
While organoids are a promising model for human development and monogenic IRDs
leading to photoreceptor cell death, HROs often have abnormal cell morphology and
heterogeneity (Prameela Bharathan et al., 2021). This variability can lead to difficulties
interpreting the abnormalities caused by genetic mutations and complicate the
interpretation of the data. Finally, some protocols differentiate RPE-forming aggregates
rather than a monolayer, limiting their use as models to study dystrophies arising from
photoreceptor-RPE pathologies. New avenues addressing these limitations are currently
being explored, including innovative retina-on-a-chip technology and organoid-RPE coculture systems (Achberger et al., 2019).
Promising advancements in stem cell research and retinal development have been
made, including genetic manipulation of stem cell lines using CRISPR/Cas9 to genetically
engineer corrections to patient-specific mutations or generation of knockout models
further to investigate the role of essential genes of interest. Additionally, due to the nature
of iPSCs generated from patients, HRO models can serve as precise models to test
therapies and pharmacological screenings. Finally, in the future, the corrected HRO
neuronal and non-neuronal cells may open new avenues for replacement cell therapy in

12
patients with advanced retinal degenerative diseases with the potential of improving
vision and enhancing the patient’s quality of life.
Figure 1.4: Human retinal organoids recapitulate retinal development in vitro. A.
Representative light microscopic images of human iPSCs and ROs generated from iPSCs
at various ages in days. Maturing inner and outer segments of photoreceptors appear as
hair-like structures on the outer surface of the ROs (D130 onward). B and C.
Representative immunofluorescence images of human RO sections revealing the 3D
organization of major retinal cell types mimicking their native laminar architecture. Images
in (B) show low-magnification cross-sections and images in (C) show higher
magnification. DAPI-stained nuclei in the ONL and the INL, with OPL appearing as a gap
between the two nuclear layers. Cell-type specific markers were used to detect each cell
type (cones, ARR3; rods, NRL-GFP; bipolar cells, GNG13; horizontal cells, CALB; and
nuclei, DAPI). INL, inner nuclear layer; ONL, outer nuclear layer; OPL, outer plexiform
layer. Scale bars in panels (A–C) 100, 50, and 10 mm, respectively. Image taken from
review (Mustafi et al., 2022).

13
1.6 Wnt Signaling
Molecular signaling pathways, including hedgehog (Hh), bone morphogenic
protein (BMP), and Wnt, among many others, are known to be activated during
development. These key pathways are responsible for changes resulting in the formation
of the optic cup and the differentiation of the retinal progenitor cells into the six major
neuronal cell types (Livesey & Cepko, 2001). Wnt signaling is an essential pathway
activated during developmental processes such as cell fate determination, migration, and
organogenesis. However, accumulating evidence also suggests it is activated during
various cellular processes, including cancer, cardiac remodeling, and neurodegeneration
(Stylianidis et al., 2016).
Wnt signaling is activated by an extracellular Wnt ligand binding to a membrane
receptor and initiates a downstream intracellular signaling cascade. The Wnt signaling
pathway can be divided into three signal transduction cascades: the canonical/β-catenin
dependent pathway, the Wnt/Ca2+ pathway, and the non-canonical planar cell polarity
(PCP) pathway (Figure 1.5) (Komiya & Habas, 2008).

14
Figure 1.5: Wnt signal transduction pathways. A schematic illustrating the signaling
cascade activated by a Wnt ligand binding to receptor and co-receptor membrane
proteins. Left illustrates the activation of canonical Wnt signaling, including the
downstream cytoplasmic accumulation of β-catenin and its translocation to the nucleus
to induce transcription of target genes. Middle, illustrates the activation of the Fzd receptor
in response to Wnt ligand binding, followed by intracellular release of Ca2+ from the
endoplasmic reticulum, an essential pathway for early gastrulation and embryo
patterning. Right, illustrates the activation of the planar cell polarity (PCP) pathway
through Wnt ligand binding to the Fzd receptor and downstream signaling resulting in
actin cytoskeleton remodeling essential for polarization and migration. Figure adapted
from and Wnt signaling pathway review (Komiya & Habas, 2008) and generated the
image with BioRender.
The PCP Wnt signaling pathway regulates various cell functions, including cellular
orientation, organization of collective multicellular epithelial structures, and directional
movement of cells across developing vertebrate embryos (Davey & Moens, 2017). The
PCP processes function with multiple principles. First, there are both cell-autonomous

15
and non-cell-autonomous functions of the core components in the PCP pathway.
Secondly, the asymmetrical cellular localization of the core PCP genes and antagonistic
relationships directly affect their function. Finally, the PCP pathways regulated the
downstream cytoskeleton remodeling, directly affecting the cellular shape and migratory
capabilities (Y. Yang & Mlodzik, 2015). The core PCP components include membrane
proteins cadherin EGF LAG seven-pass G-type receptor/Flamingo (Celsr/Fmi), Vanglike/Strabismus (Vangl/Stbm), and Frizzled (Fzd). Diego (Dgo), Disheveled (Dsh/Dvl), and
Prickle (Pk) are cytoplasmic proteins that are recruited to the membrane during signaling
(Seifert & Mlodzik, 2007). The core components are functionally conserved and essential
during embryonic development, including limb and tail development, hair follicle
orientation, the orientation of the hair bundle within the inner ear, and central nervous
system organogenesis development (Cetera et al., 2017; May-Simera & Kelley, 2012;
Poobalasingam et al., 2017; Thakar et al., 2017; Tissir & Goffinet, 2013; Zou, 2020).
Additionally, there is evidence for the role of PCP signaling in murine OPL development
and retinal cell patterning (Sarin et al., 2018; Shen et al., 2016). There remains a need
for studies dissecting the expression pattern of PCP genes in the mouse and human
retina and further investigation of the roles of PCP genes in developing the highly
organized structure of the mammalian neural retina.

16
CHAPTER 2
Non-Canonical Wnt Pathway Expression in The Developing Mouse and Human Retina
ABSTRACT
The non-canonical Wnt pathway is an evolutionarily conserved pathway essential for
tissue patterning and development across species and tissues. In mammals, this pathway
plays a role in neuronal migration, dendritogenesis, axon growth, and synapse formation.
However, its role in the development and synaptogenesis of the human retina remains
less established. To address this knowledge gap, we analyzed publicly available singlecell RNA sequencing (scRNAseq) datasets for mouse retina, human retina, and human
retinal organoids over multiple developmental time points during outer retinal maturation.
We identified ligands, receptors, and mediator genes with a putative role in retinal
development, including those with novel or species-specific expression. We validated this
expression using fluorescent in situ hybridization (FISH). By quantifying outer nuclear
layer (ONL) versus inner nuclear layer (INL) expression, we provide evidence for the
differential expression of specific non-canonical Wnt signaling components in the
developing mouse and human retina during outer plexiform layer (OPL) development.
Importantly, we identified distinct expression patterns of mouse and human FZD3 and
WNT10A and previously undescribed expression, such as for mouse Wnt2b in Chat+
starburst amacrine cells. Human retinal organoids largely recapitulated the human noncanonical Wnt pathway expression. Together, this work provides the basis for further

17
study of non-canonical Wnt signaling in mouse and human retinal development and
synaptogenesis.
2.1 INTRODUCTION
The Wnt signaling pathway is an evolutionarily conserved pathway implicated in
regulating cell fate, neuronal patterning, cell polarity, cell migration, and organogenesis
during embryonic development (Komiya & Habas, 2008). Both canonical and noncanonical Wnt genes are functionally conserved in vertebrates and play an essential role
in central nervous system development and function, including axonal guidance, synapse
formation, and mammalian eye and retinal development (Liu et al., 2006; Van Raay &
Vetter, 2004; Zou, 2020).
To initiate signaling, one of 19 Wnt glycoproteins is secreted and binds to the
cystine-rich extracellular domain of the Frizzled receptors (X. He et al., 2004). After
binding, the signal is transduced in the cytoplasm through the phosphorylation of
Dishevelled(Dvl), at which point Wnt signaling branches off into three major cascades:
canonical, non-canonical/planar cell polarity (PCP), and Wnt/Ca2+ (Wallingford & Habas,
2005). Canonical Wnt signaling is associated with the accumulation and translocation of
β-catenin to the nucleus, where it serves as a transcriptional co-activator (Thompson et
al., 2002). The Wnt/Ca2+ pathway emerged from the discovery that some Wnt and Fzd
receptors can stimulate the intracellular release of Ca2+ from the endoplasmic reticulum
(Sheldahl et al., 2003).
The non-canonical PCP signaling pathway was originally found to be responsible
for the establishment of tissue-level cellular asymmetry (Shi, 2023). Mutations in PCP

18
components resulted in the randomized orientation of sensory bristles and cuticle hairs in
Drosophila (Seifert & Mlodzik, 2007). In vertebrates, the PCP pathway has been shown
to be crucial for axon guidance and the development of sensory organs (Davey & Moens,
2017). In the inner ear, for example, PCP signaling is critical for the proper orientation of
sensory hair cells (Stoller et al., 2018). These processes require the tight temporal and
spatial regulation of membrane protein expression in a cell-autonomous and non-cellautonomous fashion (Y. Yang & Mlodzik, 2015). Signal transduction and regulation
occurs through various mediators such as Vangl, Celsr, Ryk and the cytoplasmic proteins
Dvl and Diego (Mehta et al., 2021). A final outcome of the PCP pathway is the regulation
of the actin cytoskeleton for cellular structure and migration, functioning independently of
transcriptional changes (Komiya & Habas, 2008). Interestingly, these mediator proteins
can critically modulate the signaling output to result in opposing effects (Zou, 2020). For
example, during glutamatergic synapse development in the mouse hippocampus, loss of
Celsr3 causes a decrease in glutamatergic synapse formation, whereas loss of Vangl2
leads to an increase in synaptic density (Thakar et al., 2017).
Both canonical and non-canonical Wnt signaling are important for mammalian eye
development, including the retina (R. Shah et al., 2023). In one study by Sarin et al., bulk
RNAseq of the mouse retina identified multiple non-canonical Wnt signaling components
expressed in the developing mouse retina. Tissue-specific knockout of the non-canonical
ligands Wnt5a/b resulted in a duplicated OPL phenotype, suggesting this pathways role
in outer retinal development (Sarin et al., 2018). Another study found that loss of Fzd3 in
rod bipolar cells results in defects in rod-rod bipolar cell synapse formation, ectopic
synapses, and abnormal OPL patterning (Shen et al., 2016, p. 201).

19
To understand human retinal development, in vitro organoid models are being
utilized more frequently to generate three-dimensional versions of retinal tissue from stem
cells (Mustafi et al., 2022). After prolonged culture, human retinal organoids (HROs) can
resemble the structural organization of the retina and contain most retinal neuronal cell
types (Afanasyeva et al., 2021; Capowski et al., 2018; Cowan et al., 2020; Prameela
Bharathan et al., 2021; Zhong et al., 2014). Because non-canonical receptor-ligand
binding affinities can be species-specific (Agostino et al., 2017), there is a need for human
models to understand human-specific regulatory circuitry. In this work, we performed
gene expression analysis of the non-canonical Wnt pathway in mouse, human, and
human organoid retinae using single-cell RNAseq and fluorescent in situ hybridization
(FISH). We identified Wnt ligands, Frizzled receptors, and mediators that have been
conserved and species-specific expression. This study provides the basis for further work
elucidating the role of non-canonical Wnt signaling in outer retinal development.
2.2 RESULTS
In order to perform a cross-species comparison of non-canonical Wnt signaling in
retinal development, we mined publicly available scRNAseq datasets (Table 1) from
mouse (Clark et al., 2019), human (Lu et al., 2020), and HROs (Cowan et al., 2020).
Figure 1 demonstrates UMAP plots annotated by cell type (A, C, and E) and age (B, D,
and F) in human retina, mouse retina, and HROs, respectively. The plots demonstrate
integrated cell distributions by cell type and for select ages that correspond to the period
of outer retinal synapse development in mouse (P0-P14) and human (fetal week (FW)16-
22) retinae (Telegina et al., 2021). HRO data from Cowan et al. was only available at

20
weeks 30 and 38, and these time points were merged in all subsequent analyses due to
high similarity (Fig. 1F).
The relative expression of Frizzled receptors, Wnt ligands, and non-canonical Wnt
mediators in mouse retina, human retina, and HRO was charted on bubble plots to
illustrate mean expression and percent of cells (Fig. 2). Among the Frizzled receptor
family, mouse Fzd2 and Fzd3 were expressed early during outer retinal development but
tapered off during later time points (Fig. 2A). In contrast, human FZD3 was the only
receptor strongly expressed throughout development into adulthood (Fig. 2B), and this
was also observed in HROs (Fig. 2C). Analysis of Wnt ligand expression in mouse
revealed early expression of Wnt3, Wnt5a, and Wnt10a (Fig. 2D). In human retina,
WNT10A appeared to have the highest mean expression (Fig. 2E) — peaking at FW20.
WNT2B expression was detectable in both human retina and mature HROs (Fig. 2E-F).
Finally, downstream mediators of the non-canonical Wnt pathway appeared to be widely
expressed in mouse retina, human retina, and HROs (Fig. 2G-I).
To ascertain cell type-specific expression, we performed an analysis of specific
candidate genes by cell type and age with confirmation by fluorescence in situ
hybridization (FISH). HROs were staged according to Capowski et al. and Bharathan et
al. to identify HROs where the ONL and INL were separated by a nucleus-free OPL
(Capowski et al., 2018; Prameela Bharathan et al., 2021). Because retinal ganglion cells
in HROs are mostly lost by Day 70-100 (Prameela Bharathan et al., 2021), analysis of
ganglion cell layer (GCL) expression was limited to mouse and human fetal retina for a
select set of genes (Supplemental Figure 2).

21
Fzd3 receptor expression by age and cell type is summarized in Fig. 3. In mouse,
Fzd3 was predominantly expressed in bipolar, horizontal, and amacrine cells which reside
in the INL (Fig. 3A). In contrast, human FZD3 expression was detected in all cell types
analyzed including rods and cones, suggesting human-specific expression of FZD3 in
photoreceptors (Fig. 3B). FISH in mouse retina at multiple ages from P6-P12 and adult
confirmed expression exclusively in the INL (Fig. 4 and Supp. Fig. 3). Human FW16 and
HROs (Day 160) FISH for FZD3 mRNA confirmed expression in both the INL and ONL
(Fig. 4). FISH detected FZD3 transcripts expressed in mouse and human retinae GCL
(Supp. Fig 2). Across all three tissue types, there was greater detection of Fzd3 transcript
by ISH in INL than ONL, but the magnitude of the difference was largest in mouse with
near-zero puncta counts in the ONL (p<0.001).
We further analyzed the Wnt ligands Wnt2b, Wnt5a, and Wnt10a by scRNAseq
and FISH. scRNAseq showed low levels of Wnt2b expression in mouse horizontal cells
at P0 (Fig. 5A), but in contrast, human retina and HROs expressed WNT2B in all retinal
cell types analyzed (Fig. 5B and C). Ocular expression of Wnt2b has previously been
shown to be enriched in retinal pigment epithelium and retina of adult mice (Blomfield et
al., 2023). FISH in mouse retina for Wnt2b revealed expression within sparse cells
straddling the inner plexiform layer (Fig. 6A). Based on the spatial location, we
hypothesized that these Wnt2b+ cells could represent amacrine cells, and FISH for the
amacrine cell marker Chat (choline acetyltransferase) demonstrated co-expression of
Wnt2b and Chat (Fig. 6B). In contrast, human WNT2B was not observed via FISH in
either fetal retina or HROs (Fig. 6A).

22
scRNAseq analysis of Wnt5a in mouse showed early horizontal and amacrine cells
expression between P5 and P8 (Fig. 5D). In human retina, WNT5A expression appeared
to be mostly expressed in bipolar cells and expression was maintained from FW16
through postnatal day 8 (HPND8; Fig. 5E). Mature HROs also showed greatest mean
expression of WNT5A in bipolar cells (Fig. 5F). FISH for mouse and human Wnt5A
demonstrated preferential expression in the INL (Fig. 6C and Supp. Fig. 3), but HROs did
not have detectable WNT5A.
Finally, scRNAseq analysis of mouse Wnt10a found expression in amacrine cells
(Fig. 5G), and human retinal expression throughout all cells with an increased signal in
fetal rods (Fig. 5H-I). FISH for Wnt10a in mouse retina revealed both INL and ONL
expression whereas human fetal FISH demonstrated ONL-specific expression (Fig. 6D,
P<0.0001). In the human retina, puncta of WNT10A expression matches the pattern for
the rod progenitor marker neural-leucine zipper (NRL; Supp. Fig. 4), suggesting
expression by rod photoreceptors. WNT10A expression in HROs was undetectable,
however, which may reflect insufficient differentiation of rods as has been noted
previously (Prameela Bharathan et al., 2021).
Transcriptomic analysis of Wnt mediator genes showed robust expression across
all retinal cell types in mouse and human retina (Fig. 2G-I). We chose to further analyze
Vangl2 and Celsr3, since previous studies implicated these genes in glutamatergic
synapse development (Thakar et al., 2017). We also chose to analyze Dvl1 and Ryk,
which have been shown to play a role in mouse OPL development (Sarin et al., 2018).
Transcriptomic analysis by cell type and age for all four genes demonstrated relatively
uniform expression across photoreceptors, bipolar, horizontal, and amacrine cells during

23
mouse and human retinal development (Fig. 7). FISH detected stable transcript
expression in mouse retina from P6 through adult (Supp. Fig. 5). ISH for VANGL2 in
mouse, human, and HRO confirmed more robust expression in INL versus ONL (Fig. 8A,
all P<0.05), and expression in both mouse and human GCL (Supp. Fig. 2). In contrast,
CELSR3, DVL1, and RYK showed uniform nuclear layer expression across mouse,
human, and HRO retina (Figure 8B-D). CELSR3 also showed expression in mouse and
human retina GCL (Supp. Fig. 2).
2.3 DISCUSSION
Non-canonical Wnt signaling may play a key role in retinal patterning during mouse
and human retinal development. In this study, we analyzed previously published
scRNAseq datasets to compare transcript expression of non-canonical Wnt genes in
mouse retina, human fetal retina, and HROs (Fig. 2). Our in silico findings were validated
for select gene transcripts using FISH in these same tissues. To our knowledge, this is
the first report describing the transcript distribution of Fzd3, Wnt2b, Wnt5a, Wnt10a,
Vangl2, Celsr3, Ryk and Dvl1 in mouse retina, human fetal retina, and HROs. Findings
from this analysis include: 1) Human expression of FZD3 in the ONL unlike mouse; 2)
Mouse Wnt2b expression in Chat+ amacrine cells; 3) Human fetal WNT10A expression
in rods; 4) Wnt mediators Celsr3, Ryk, and Dvl1 appear to be distributed across all nuclear
layers in mouse and human retina, whereas mouse Vangl2 did not demonstrate ONL
expression. CELSR3 and VANGL2 were expressed in both mouse and human GCL
(Supp. Fig. 2).

24
A major impetus for this study was identifying the role of Fzd3 in mouse versus
human retina since prior work in mouse demonstrated its role in rod bipolar cell
orientation, soma shape, dendritic pruning, and synapse formation (Shen et al., 2016).
Interestingly, we found human FZD3 expression in all nuclear layers, including the ONL
(Fig. 3-4; Supp. Fig. 2). HROs recapitulate this ONL expression and suggest a possible
human-specific role for FZD3 expression in photoreceptors. Given that the human
photoreceptor synapse is glutamatergic and the non-canonical Wnt pathway plays a role
in glutamatergic synapses of hippocampal neurons in mice (Thakar et al., 2017), these
findings may warrant further study in the HRO system.
Examination of the non-canonical Wnt ligands revealed two intriguing findings,
both of which were species-specific. First, mouse Wnt2b expression was identified in
sparse cells along the inner plexiform layer (IPL). These were confirmed through
multiplex FISH to be choline acetyltransferase (ChAT)-expressing amacrine cells.
Starburst (ChAT+
) amacrine cells are radially symmetric GABAergic interneurons that
project to direction-selective retinal ganglion cells (Balasubramanian & Gan, 2014).
Because these cells are arguably among the best-studied amacrine cell subtypes and
have a critical role in detecting directional motion, Wnt2b could serve as a useful marker
for starburst amacrine cells and potentially play a role in cell specification. Second, human
WNT10A was found to have a rod-specific expression in the developing human retina
(Fig. 5-6). Given the expression of FZD3 in the human retina, it is possible that WNT10A
is a rod-specific ligand acting on FZD3-expressing cells to establish specific OPL
synapses.

25
Although mice remain the most utilized model for studying retinal biology, there
may be species-specific differences in expression patterns and knockout phenotypes
(Brennenstuhl et al., 2015). This was repeatedly observed in the current study (e.g.,
Fzd3, Wnt2b, and Wnt10a expression) and highlights the need for human-specific retinal
models (Mustafi et al., 2022). Here we included the HRO system to not only validate
human fetal retinal data but also to explore the potential for modeling non-canonical Wnt
signaling in the HRO system (Singh & Nasonkin, 2020). In many of our scRNAseq and
FISH results, the HRO system mirrored human fetal data, but there were notable
differences. For example, human WNT10A and VANGL2 were both expressed in the
developing human fetal ONL, but not in HRO ONL. It is well known that HRO
development reaches a plateau and can be internally dyssynchronous with certain cell
types developing faster or slower compared to the fetal retina (Prameela Bharathan et
al., 2021). The significance of these differences may limit the utility of the HRO system.
There were several limitations to the current study. One was the use of a single
scRNAseq dataset per species which could introduce bias or error. However, we utilized
the most recent and robust single-cell dataset available that also contained the
developmental time points we were interested in studying. Furthermore, the integration
of multiple datasets per species is not trivial due to differing underlying methodologies. A
second limitation to our scRNAseq analysis was that some genes were completely
missing or dramatically under-represented within the sequencing data (Pool et al., 2022).
These omitted genes in scRNAseq datasets may stem from sequencing loss reads,
including poor 3’ UTR annotations, intronic reads from pre-mRNA, or discarded reads
attributed to gene overlaps. As seen in this study, multiple genes identified by scRNAseq

26
were accurately validated with FISH, but there were some inconsistencies including
Wnt2b that could be explained by these limitations in methodology.
Another limitation of our study is the inability to compare precise analogous stages
among the three models. Animal models have been useful in understanding cellular
processes, but there are molecular and morphological differences compared to human
retina (Quinn & Wijnholds, 2019). In humans, the OPL begins to develop by fetal week
11 and reaches the peripheral retinal by fetal week 30 (Nguyen-Ba-Charvet & Chédotal,
2014). In rodents, neurogenesis proceeds in two waves: an early embryonic wave and
the second postnatal wave, where the OPL forms between postnatal days 4 and 10
(Telegina et al., 2021). HROs possess a well-defined, nucleus-free OPL by day 160 in
culture (Prameela Bharathan et al., 2021). We chose the sample time points based on
these corresponding developmental windows and the limited availability of human fetal
tissue.
Taken together, this work represents a comprehensive comparison of noncanonical Wnt pathway expression in the developing mouse and human retina. In
addition, this study establishes the potential of the HRO system to experimentally address
the role of this pathway in human development and identify any species-specific
differences. This could entail global and cell-type specific knockouts of critical noncanonical Wnt ligands, receptors, and mediators in HROs to dissect the role of this
pathway in human retinal development.

27
2.4 MATERIALS AND METHODS
2.1 Single-cell RNAseq data analysis
Single cell counts and annotations were downloaded from GEO or EGA (Table 1), and
analysis was performed on Partek Flow software 10.0 (Partek, Inc., Chesterfield, MO).
Genes with no expression in 99.99% cells were excluded from the analysis. Counts were
normalized by counts per million (CPM) and then log2 transformed with an offset of 1.
Normalized counts were used for plotting. Dimensionality reduction and visualization for
the data were performed using Uniform Manifold Approximation and Projection (UMAP)
using annotations from original publications. Differential expression analysis was done
with the ANOVA method in all three datasets. The bubble plots were generated using the
R studio version 4.2.1 (RStudio Core Team 2021) with packages ggplot2 version 3.3.6,
cowplot version 1.1.1, and gridExtra version 2.3. The color intensity of the red bubble
indicates mean expression of the gene of interest and the size of the bubble indicates
percentage of cells that expressed the gene of interest. The scales used for mean
expression and the percentage of cells were kept constant within each dataset.
2.2 Mouse tissue
Animal experiments were performed under research protocol (#79-17) approved by the
Animal Research Committee at Children’s Hospital Los Angeles and in strict accordance
with the recommendations in the Guide for the Care and Use of Laboratory animals of the
National Institutes of Health. Timed-pregnant female C57BL/6J mice were ordered from
The Jackson Laboratory. Collection of pup eyes occurred between post-natal day 6
through 12 and adult. To ensure RNase-free handling of the tissue, all lab equipment was

28
wiped down with ELIMINase and buffers were prepared with (diethyl-pyrocarbonate, 0.1%
v/v) DEPC treated water. Mouse eyes at postnatal timepoints were enucleated and
incubated in 1 mL 4% PFA following three washes with 1X PBS. The cornea was gently
cut and removed under a dissecting microscope and the lens was extracted using
forceps. The eye cup was then washed three times in 1X PBS. Adult mouse eyes were
then incubated in 4% PFA for an additional 15 minutes followed by three 1X PBS washes.
Eye cups were cryoprotected by equilibration in 15% sucrose solution overnight at 4˚C
and then 30% sucrose solution for 3 hours. Eyecups were embedded in OCT using 10 X
10 mm cryomolds, frozen on dry ice until solidified and stored at -80˚C. Eye cups were
sectioned maintaining a dorsoventral orientation and serial sections were cut at 20-30 µm
thickness. Microscope slides were stored in -80˚C until needed.
2.3 Human tissue
Human fetal samples were collected under Institutional Review Board approved protocols
(USCHS-13-0399 and CHLA-14-2211). Following the patient decision for pregnancy
termination, informed consent for donation of the products of conception for research
purposes was obtained and samples were collected without patient identifiers. The
person obtaining consent for tissue donation was different than the provider performing
the termination procedure. Participation in the tissue donation program did not alter the
method of pregnancy termination. Fetal age was determined according to the American
College of Obstetrics and Gynecology guidelines. To ensure RNase-free handling of the
tissue, all lab equipment was wiped down with ELIMINase and buffers were prepared with
DEPC-treated water. A 12-well plate was filled with one well of 70% EtOH and three wells

29
of 1X PBS. Tissue was placed in 70% EtOH for 5 seconds and washed 3 times in 1X
PBS. The eye was placed in a 10-cm dish with cold 1X PBS and extra tissue was removed
using forceps and dissecting scissors. The cornea was then punctured with a needle. A
fine Vannas scissor was used to remove the cornea. Once the cornea was removed the
lens was gently extracted. Eyes were then incubated in 4% PFA at room temperature for
1 hour on a rocker. The PFA was removed followed by three 5-minutes washes with 1X
PBS. Eye cups were cryoprotected by equilibrating in 15% sucrose solution overnight at
4˚C and transferred to a 30% sucrose solution for 3 hours. Eye cups were embedded in
OCT and frozen on dry ice until solidified and stored at -80˚C. Eye cups were sectioned
maintaining a dorsoventral orientation and serial cryosections were cut at 20 µm
thickness.
2.4 Human Retinal Organoid Culture and Processing
The WTC11 iPSC line (GM25256, Coriell Institute, Camden, NY) was maintained in
standard feeder-free culture conditions on hESC-qualified Matrigel-coated tissue culture
dishes in mTeSRPlus media. For HRO generation, WTC11 iPSCs were differentiated
using a method modified from previous publications (Aparicio et al., 2023; Kuwahara et
al., 2015; Zhong et al., 2014). Briefly, on Day 0 (D0), iPSCs were treated with 20µM ROCK
inhibitor Y27632 in pluripotent stem cell medium mTeSRPlus for 1 hr and dissociated into
single cell suspension using Accutase. To form aggregates, 12,000 cells were subjected
to centrifugation at 300g for 5 min in 100 µl Aggrewell Embryoid Body Formation Medium
supplemented with ISL cocktail (Wnt antagonist IWR1 (3 µM), SB431542 (10 µM),
LDN193189 (100 nM)) and 20 µM Y27632 in coated U-bottom 96 well plates (Aparicio et

30
al., 2023). On D1, the media were changed to gfCDM plus 10% Knockout Serum
Replacement (KSR) containing ISL cocktail (Wataya et al., 2008). From D6 to D19,
gfCDM plus 10% KSR medium was used, which was supplemented with BMP4 (1.5 nM)
on D6 and its concentration was diluted by half media change on D9 and D12 and threequarters media change on D15. On D19 and D21, RPE induction was performed by
changing to induction culture medium containing Wnt agonist CHIR09921 (3µM) and
FGFR inhibitor SU5402 (5µM). From D23 to D36, organoids were maintained in RDM3SKZ medium (“NR–differentiation medium” lacking retinoic acid and taurine), and
supplementation with taurine (0.1 mM) began on D30 (Kuwahara et al., 2015). Between
D37 and D42, the medium was gradually transitioned to long-term suspension culture
medium (Zhong et al., 2014). The medium were supplemented with 1 µM retinoic acid
from D72 and subsequently reduced to 0.5 µM from D100 until Day 160, when organoids
were collected. Additional details on culture media composition (Supplementary Table 1)
and timeline of steps (Supplementary Fig. 1) are found in the supplemental materials (Bai
et al., 2023; Prameela Bharathan et al., 2021). To ensure RNase-free handling of the
tissue all lab equipment was wiped down with ELIMINase and buffers were prepared with
DEPC-treated water. Organoids were collected under a dissecting microscope, placed
into Eppendorf tubes and washed with 1X PBS, treated with 4% PFA for 12 minutes and
washed 3X with 1X PBS. Organoids were cryoprotected by equilibrating in 30% sucrose
solution overnight at 4˚C. Organoids were embedded in OCT using 10 X 10 mm
cryomolds, frozen on dry ice until solidified and stored at -80˚C. Organoid serial sections
were cryosectioned at 10-20 µm thickness stored at -80˚C.

31
2.5 Hybridization Chain Reaction Fluorescent in situ Hybridization
Probes sets were designed and produced by Molecular Instruments (Los Angeles, CA)
by selecting the organism and providing the accession number for each target mRNA.
Molecular Instruments designs and generates HCR Probes that have maximum
hybridization efficiency and specificity while minimizing off-target complementarity. Each
probe set has a unique lot number used for identification, listed in Supp. Table 2. Probe
binding sequences may not be disclosed as they are the confidential and proprietary
information of Molecular Instruments. For sectioned mouse retina, human retina, and
human retinal organoids, we adapted the Multiplexed HCR RNA-FISH v3.0 protocol
provided by Molecular instruments. Briefly, slides were allowed to sit at room temperature
for 10 minutes, then sections were covered with 4% PFA at room temperature for 10
minutes and followed by three washes with PBS for five minutes. Slides were then added
to a coplin jar filled with cold 70% EtOH and stored overnight at -20˚C. The next day,
slides were allowed to air dry for 5 minutes at room temperature and sections were
outlined with a PAP pen. Sections were washed twice with 2X saline sodium citrate (SSC)
and then prehybridized for 30 minutes with probe hybridization buffer at 42˚C in a prewarmed humidified chamber. The probe solution was prepared by adding 0.4 pmol of
probe to 100 µL of probe hybridization buffer at 37˚C, then added to each section and
allowed to incubate overnight, placed in a 42˚C oven and then lowered to 37˚C. Unbound
probes were then washed off with four 5 minute washes in wash buffer at 37˚C and two
washes of 2X saline sodium citrate Tween (SSCT) for 5 minutes at room temperature.
Sections were incubated with amplification buffer for 30 minutes at room temperature.
Amplification hairpins were prepared by adding 6 pmol of each hairpin h1 and h2 into

32
separate tubes (heated to 95˚C for 90 seconds and then cooled to room temperature for
30 minutes). Once preamplification incubation was complete, solution was removed, and
hairpin solution was added and allowed to incubate overnight in a humidified chamber at
room temperature. Finally, solution was washed off with five 5 minutes washes of
2XSSCT at room temperature and a final wash of 2X SSCT with DAPI. Mounting media
and cover slip were added and sealed with nail polish in preparation for microscopy.
2.6 Confocal Fluorescence Microscopy
FISH tissue sections were imaged by confocal microscopy using a STELLARIS 5 system
mounted on a DMi8 inverted microscope with an HC PL APO CS2 63x/1.4 oil immersion
lens (Leica Microsystems, Buffalo Grove, IL). Fluorescence excitation lasers 405, 488,
555, and 639 nm was used to excite fluorescence of DAPI and Alexa Fluor 488, 546, and
647, respectively. The pinhole was set at 1 Airy unit and the voxel size was optimized for
Nyquist sampling at 0.1 × 0.1 × 0.34 μm. The system was controlled by LAS X software.
2.7 Quantification and Statistics
Puncta were counted with the Find Maxima function of ImageJ software (Schneider et al.,
2012). For each gene, puncta counts were compared among mouse, human, and retinal
organoid samples using Poisson regression. Within each model, multiple comparisons of
ONL vs. INL counts by species were adjusted using the Holm-Bonferroni method and are
reported as adjusted values. In figures, adjusted P values less than .05 are indicated with
(*), less than .01 with (**), less than .001 with (***), and less than .0001 with (****). All
analyses were conducted using Stata SE 14.2 (College Station, TX).

33
ETHICS APPROVAL
Animal work was performed under research protocol (#79-17) approved by the Animal
Research Committee at Children’s Hospital Los Angeles and in strict accordance with the
recommendations in the Guide for the Care and Use of Laboratory animals of the National
Institutes of Health.
ACKNOWLEDGMENTS
We acknowledge the CHLA Saban Research Institute Stem Cell Analytics Core and
Cellular Imaging Core for providing key instrumentation and personnel to support this
work. We also acknowledge Yibu Chen at the USC Libraries Bioinformatics Service for
assistance with Partek Flow data analysis. We thank Angela Ferrario and Patricia Galvan
for technical assistance. We thank Dr. David Cobrinik and lab members for significant
contributions during the review process. We would like to thank Melissa Wilson
(Department of Preventive Medicine, University of Southern California) and Family
Planning Associates for coordinating tissue collection.

34
2.5 TABLES
Table 1: List of single-cell RNA sequencing datasets used for analysis of mouse, human,
and human retinal organoids.

35
2.6 FIGURES
Figure 2.1: UMAPs illustrate the three retinal scRNAseq datasets for mouse, human, and
human retinal organoid. Individual cells are annotated by cell type (A-C) and age (D-F).

36
Figure 2.2: Expression patterns of candidate non-canonical Wnt pathway genes from
mouse (A, D, G), human (B, E, H), and human retinal organoid (C, F, I) scRNAseq
datasets. Bubble plots for Frizzled receptors (A-C), Wnt ligands (D-F), and mediators of
the Wnt pathway (G-I) at various developmental timepoints. Mean expression is illustrated
from gray (lowest) to red (highest), and the percentage of cells expressing each gene is
illustrated by the size of the bubble.

37
Figure 2.3: Gene expression pattern of Fzd3 in five major retinal cell types including rod,
cone, bipolar, horizontal, and amacrine cells during development in mouse (A), human
(B), and human retinal organoid (C) tissue. Mean expression is illustrated from gray
(lowest) to red (highest), and the percentage of cells expressing each gene is illustrated
by the size of the bubble. The absence of bipolar cells at early time points indicated by
(-) to differentiate from zero expression.

38
Figure 2.4: Fluorescence in situ hybridization for Fzd3 in mouse (P10), human fetal retina
(FW16), and HRO (D160). Retinal layers according to nuclear DAPI stain (blue) are
represented by the colored bars: outer nuclear layer (red), inner nuclear layer (white), and
ganglion cell layer (green). Number of puncta was quantified in the ONL and INL for each
species and illustrated via box-and-whisker plot. ****, P<0.0001; **, P<0.05. N=12 images
analyzed per species across at least 3 biological replicates. Scale bar, 10 µm.

39
Figure 2.5: Gene expression pattern of Wnt2b (A-C), Wnt5a (D-F), and Wnt10a (G-I) in
five major retinal cell types across various developmental time points for mouse (A, D,
G), human (B, E, H), and human retinal organoid (C, F, I) tissue. Mean expression is
illustrated from gray (lowest) to red (highest), and the percentage of cells expressing each
gene is illustrated by the size of the bubble. Absence of bipolar cells at early time points
indicated by (-) to differentiate from zero expression. Scales are kept consistent for each
species to allow for comparison of expression levels within each species/dataset.

40
Figure 2.6: Fluorescence in situ hybridization for Wnt2b (A-B), Wnt5a (C), and Wnt10a
(D) in mouse retina (P10), human fetal retina (FW16), and HRO (D160). In mouse P10
retina (B), multiplex FISH shows overlapping Chat (green) and Wnt2b (red) with nuclei
stained with DAPI (blue). Boxed areas B’ and B’’ on the left panel are magnified on the

41
right for INL and GCL. Retinal layers according to nuclear DAPI stain are represented by
the colored bars: outer nuclear layer (red), inner nuclear layer (white), and ganglion cell
layer (green). Number of puncta was quantified in the ONL and INL for each species and
illustrated via box-and-whisker plot. ****, P<0.0001; *, P<0.05; ns, not statistically
significant. N=12 images analyzed per species across at least 3 biological replicates.
Scale bar, 10 µm.

42
Figure 2.7: Gene expression pattern of Wnt mediators Vangl2 (A-C), Celsr3 (D-F), Ryk
(G-I), and Dvl1 (J-L) in five major retinal cell types including rod, cone, bipolar, horizontal,
and amacrine cells across development in mouse (A,D,G,J), human (B,E,H,K), and
human retinal organoid (C,F,I,L) tissue. Mean expression is illustrated from gray (lowest)
to red (highest), and the percentage of cells expressing each gene is illustrated by the
size of the bubble. Absence of bipolar cells at early time points indicated by (-) to
differentiate from zero expression. Scales are kept consistent for each species to allow
for comparison of expression levels within each species/dataset.

43

44
Figure 2.8: Retinal nuclear layers according to DAPI stain are represented by the colored
bars: outer nuclear layer (red), inner nuclear layer (white), and ganglion cell layer (green).
Number of puncta was quantified in the ONL and INL for each species and illustrated via
box-and-whisker plot. ****, P<0.0001; ns, not statistically significant. N=12 images
analyzed per species across at least 3 biological replicates. Scale bar, 10 µm.

45
2.7 SUPPLEMENTARY FIGURES
Supplemental Figure 2.1: An overview of culture conditions for human retinal organoids
derived from iPSCs. MM, maintenance medium; RA, retinoic acid; (Figure adapted from
Figure 2A Bai, J et al. (2023) Episodic live imaging of cone photoreceptor maturation in
GNAT2-EGFP retinal organoids. Disease Models and Mechanisms)

46
Supplemental Figure 2.2: The number of puncta was quantified for a select set of genes
in the retinal ganglion cell layer for mouse and human retina.

47
Supplementary Figure 2.3: Fluorescent in situ hybridization of mouse retina at ages
P6, P8, P10, P12, and adult for Fzd3 (A), Wnt2b (B), and Wnt5a (C) shown in red. DAPI
(blue) shows the multilayer structure of the retina. Colored bar indicate nuclear layers
outer nuclear layer (red), inner nuclear layer (white), and ganglion cell layer (green).
Scale bar: 10 µm.

48
Supplementary Figure 2.4: Fluorescent in situ hybridization of mouse retina at ages
P6, P8, P10, P12, and adult for Vangl2 (A), Celsr3 (B), Dvl1 (C), and Ryk (D). DAPI (blue)
shows the multilayer structure of the retina. Colored bar indicate nuclear layers outer
nuclear layer (red), inner nuclear layer (white), and ganglion cell layer (green). Scale bar:
10 µm.

49
Supplementary Figure 2.5: Fluorescent in situ hybridization of human fetal retina
(FW18.1) follows NRL staining pattern. (A) WNT10A (green) transcripts detected within
the ONL overlapping with NLR (red) transcript. (B) ARR3 transcripts detected apical of
WNT10A (green). DAPI (blue) shows the multilayer structure of the retina. Colored bar

50
indicate nuclear layers outer nuclear layer (red), inner nuclear layer (white), and ganglion
cell layer (green). Scale bar: 10 µm.

51
Supplemental Table 2.1: Components of human retinal organoid differentiation media,
listed by culture day, including medium, components, manufacture, catalog number, and
concentration.

52
Supplemental Table 2.2: List of fluorescent in situ hybridization probes used in the study.
All HCR probes were designed and manufactured by Molecular Instruments to have
maximum hybridization efficiency and specificity while minimizing off-target
complementarity. Each probe set has a unique lot number used for identification listed in
the table and the NCBI reference transcript sequence.

53
CHAPTER 3
Generation of an Inducible FZD3 Knockout Human iPSC Line
ABSTRACT
Frizzled3 (FZD3) is a member of the core non-canonical Wnt signaling pathway and is
implicated in the development of sensory organs and neuronal guidance. Studies have
shown Fzd3 to function in the maturation of the visual system, including guiding axon
projections of retinal ganglion cells and rod bipolar cell dendritic patterning in mice.
Previous work in our lab has shown the expression FZD3 transcripts in the outer nuclear
layer (ONL) human retina, which were absent in the mouse retina. This variation in
expression pattern raised the question of the species-specific role of FZD3 in human
retinal development. Due to the limitations in human fetal tissue and technical restrictions
of human experiments, human retinal organoids have become an ideal system for
studying embryonic human development. Using CRISPR/Cas9 gene editing tools, iPSC
lines can be genetically modified to generate an inducible knockout cell line using the
Cre/LoxP system. We present a two-step strategy: First, we will use Cas9-RNP and
ssODN for the biallelic insertion of LoxP sites flanking exon 3 of FZD3. Second, we will
insert the ERT2
-Cre-ERT2 cassette into the AAVS1 locus for global inducible expression
of Cre recombinase and induction with tamoxifen. This FZD3 inducible knockout iPSC
line will be differentiated into human retinal organoids, allowing us to examine the function
of FZD3 in synaptic development and cellular morphology in human outer retina
development.

54

3.1 INTRODUCTION
The development of retinal layers and the maturation of retinal neurons are
complex processes requiring spatiotemporal regulation of various signaling pathways
(Hoshino et al., 2017). The retina consists of more than 60 types of neurons, which are
categorized into six cell classes and arranged into five layers: three somatic (nuclear)
layers and two synaptic (plexiform) layers (Zhang et al., 2011). At present, very little is
known about the mechanisms that organize retinal neurons and their synaptic contacts.
During the synaptogenesis phase, neurites of retinal cells must identify their appropriate
partners and form synapses within two retinal zones, the outer plexiform layer (OPL) and
inner plexiform layer (IPL), for proper synaptic connectivity and visual function (Hoon et
al., 2014). The OPL is the first synaptic layer where the axon terminals of photoreceptors
synapse with dendritic tips of horizontal and bipolar cells (Nemitz et al., 2019). Bipolar
cells are interneurons synapse with rod and cone photoreceptors and relay the signals to
ganglion cells. There are about 11–13 subtypes of mammalian bipolar cells that receive
cone inputs, whereas only a single type of rod bipolar cell (RBC) has been identified (Pang
et al., 2018). The developmental pathways driving the establishment of appropriate
synaptic connections remain a fundamental question in developmental neurobiology.
The Wnt signaling pathway is one highly conserved signaling pathway necessary
for the development and maturation of sensory organs (Y. Yang & Mlodzik, 2015). Noncanonical Wnt genes play a role in neuronal migration and the stabilization of
glutamatergic synapses (C.-W. He et al., 2018). Non-canonical Wnt transmembrane
receptors Celsr3 and Vangl2 have been found to localize in developing glutamatergic

55
synapses and co-localize with pre- and post-synaptic proteins in hippocampal neurons
(Thakar et al., 2017). Additionally, RNA sequencing and CRISPR mutagenesis studies of
mouse retinal development have identified multiple non-canonical genes, including
Wnt5a/b, in regulating early OPL patterning (Sarin et al., 2018). Mouse models have been
used as the gold standard in studying the mammalian retina, but there are many
limitations due to the anatomical differences and variations in gene expression patterns.
Mouse models with homozygous mutations to specific non-canonical Wnt genes
have resulted in drastic developmental defects and perinatal lethality (Wang et al., 2016).
Additionally, limited availability of human fetal tissue restricts our understanding of
human-specific roles of signaling pathways involved in early development. Given the
embryonic lethal effect of mutations, conditional knockout models have been developed
to gain insight into the role of specific genes (Wang et al., 2016). Conditional knockout of
Fzd3, a non-canonical Wnt receptor, in mouse models, has been shown to contribute to
RBC development, and its inactivation resulted in abnormal RBC soma shape and
dendritic patterning (Shen et al., 2016). By postnatal day 10 (P10), RBC dendrites appear
to have reduced arborization and increased mistargeting, resulting in disorganized rodRBC synaptic connections by the time of OPL maturation. Further investigation of the
roles of FZD3 and other non-canonical Wnt genes during OPL development may provide
novel insight into the pathway’s role in synaptogenesis between rod and RBCs within the
retina.
Several labs have established successful protocols to differentiate human
inducible pluripotent stem cells (iPSCs) or embryonic stem cells (ESCs) into 3D organoids
capable of self-organizing into highly mature tissue structures expressing retina-specific

56
cell types and mimicking the structural organization of the native human retina, allowing
us to study the role of genes essential for proper development and function (Kuwahara et
al., 2015; O’Hara-Wright & Gonzalez-Cordero, 2020; Zhong et al., 2014). HROs can
successfully recapitulate many features of the OPL, including the expression of
photoreceptor and bipolar cell markers, expression of pre-synaptic and post-synaptic
proteins in later maturation states, and ribbon structures at axon terminals visualized with
electron microscopy (Prameela Bharathan et al., 2021).
Although published studies have suggested the role of non-canonical Wnt
signaling in mouse retinal development, the role of non-canonical Wnt in human retinal
development has yet to be examined. To further study the role of FZD3 in RBC dendritic
maturation, we aim to generate an inducible knockout iPSC line using the CRISPR/Cas9
and Cre/LoxP systems. First, ERT2
-Cre-ERT2 will be inserted into the AAVS1 locus for
global expression of Cre recombinase and induction with tamoxifen. Second, CRISPRassociated protein (Cas9) and small guide-RNA (sgRNA) ribonucleoprotein (RNP), along
with single-stranded oligodeoxynucleotide (ssODN), will be transfected into iPSCs to
generate the biallelic insertion of LoxP sites flanking exon 3 of FZD3.
3.2 RESULTS
We first determined the timeframe of FZD3 expression in the human iPSC line
(WTC11) and throughout the duration of the HRO differentiation period. To do this, we
designed forward and reverse primers targeting FZD3 exon 6/7 and exon 7/8 to amplify
the terminal region of FZD3 transcripts in the cDNA library of WTC11 cells and HROs at
multiple developmental time points (Table 3.1).

57
Our RT-PCR analysis suggests that FZD3 is not expressed in WTC11 iPSCs but
is detected as early as day 9 in HROs and is maintained throughout the 240 days in
culture, indicated by the last time point collected (Figure 3.1). To show the presence of
differentiated retinal neuronal cell types, we included primers for RCVRN as a
photoreceptor marker and mGluR6 and BHLHE23 as RBC markers. Once the expression
of FZD3 in HRO was confirmed, we designed a 2-step strategy for the inducible knockout
(iKO) system (Figure 3.2). Step 1 includes targeting of FZD3 by the biallelic insertion of
LoxP sites flanking exon 3, the exon coding for the functional ligand binding domain of
the FZD3 protein (Sala et al., 2000). For step 2, we aim to insert a tamoxifen-inducible
Cre cassette, ERT2
-Cre-ERT2
, into the adeno-associated virus integration site 1 (AAVS1)
locus within the protein phosphatase 1, regulatory subunit 12C (PPP1R12C) on human
chromosome 19. The AAVS1 locus is a safe harbor site for transgene insertion purposes
and guarantees the robust and maintained expression of the inserted gene even after in
vitro differentiation (Kotin et al., 1992). This 2-step strategy allows for the inducible FZD3
gene knockout at any time point of human retinal organoid development by adding
tamoxifen to the HRO culture medium.
As illustrated in Figure 3.3A, two LoxP sites will be inserted to flank the entirety of
exon 3 of FZD3, resulting in the excision of the cystine-rich ligand binding domain.
Conditional knockout mouse models have been successfully generated by targeting exon
3 of Fzd3 with the insertion of LoxP at the second and third introns (Hua et al., 2013). We
intend to use the ssODN-mediated homology-directed repair (HDR) combined with Cas9
nuclease to do this. ssODNs can be used as a donor template and a DNA nuclease to
efficiently target small insertions of DNA fragments (Yoshimi et al., 2016).

58
Two sgRNA were designed using the CRISPOR web tool (http://crispor.tefor.net/)
to target FZD3 intron 2 and 3 for the first and second LoxP site insertion, respectively.
We decided to use Cas9 and sgRNA as premixed RNP consisting of the Cas9
protein and sgRNA to achieve more precise delivery of Cas9 and minimize the risks of
off-target edits (Xu et al., 2021). For the first LoxP insertion into intron 3, we designed two
sgRNAs to find the best sgRNA with the highest insertion/deletion (INDEL) efficiency
(Table 3.2).
iPSCs were transfected by a premix of Cas9 protein and either of sgRNAs using
the Neon Transfection System (Invitrogen). The INDEL efficiency of sgRNA will be
analyzed using Sanger sequencing and the ICE web tool (https://ice.synthego.com/#/).
The same steps will be performed to identify the sgRNA with the highest INDEL efficiency
for intron 2. We aim to keep the distance between the two LoxP sites within the range of
2 kb, as Cre recombinase efficiency has been reported to decrease as genetic distance
increases (Zheng et al., 1999). Once an efficient sgRNA is selected for both sites, we can
design ssODN as illustrated in Figure 3.3B. ssOND can favor the HDR mechanism with
high efficiency, and 30-60 bp homology arm lengths have been reported to be sufficient
for short insertions (F. Chen et al., 2011; Davis & Maizels, 2014).
For the second step of our 2-step iKO strategy, we needed to generate a donor
plasmid to deliver the ERT2
-Cre-ERT2
fragment to the AAVS1 locus. To generate this
donor plasmid, we used the In-Fusion Cloning Kit (Takara), which applies a restriction
enzyme-free, PCR-based cloning strategy. Primers were designed following the
manufacturer's instructions for PCR amplification of the vector fragment from AddGene
plasmid # 80491 with AAVS1 homology arms and plasmid # 13777 for the amplification

59
of ERT2
-Cre-ERT2
fragment (Figure 3.4). The primer design ensures a 15-bp extension
of the fragment to complement the vector ends. The product of the In-Fusion cloning
reaction was then transformed into competent cells, which resulted in the generation of
the final plasmid (Figure 3.4).
For the insertion of the ERT2
-Cre-ERT2 cassette into the AAVS1 locus, we have
two potential strategies: 1) cell transfection by the donor plasmid and Cas9/AAVS1-
sgRNA RNP complex or 2) co-transfection of cells by the donor plasmid and
Cas9/AAVS1-sgRNA plasmid. Both strategies will be tested to determine the best method
for ERT2
-Cre-ERT2
fragment insertion into the WTC-11 cell genome.
3.3 DISCUSSION
Previous literature discussing the role of Fzd3 in mouse RBC patterning and
synaptic assembly in the ONL, along with our transcriptomic analysis and in situ data
suggesting its expression in both the ONL and INL of the human retina, encouraged us
to investigate its role in human retina development further (Shen et al., 2016). We
designed an inducible knockout system to allow for precise temporal control of FZD3 iKO
to ensure the survival of early-developing HROs. This work has outlined a concise twostep strategy for generating an iKO iPSC line.
First, the entirety of exon 3 of FZD3 was targeted for deletion by flanking both
intron 2 and intron 3 with LoxP sites (Wang et al., 2002). We designed a strategy that
takes advantage of both the efficiency of Cas9 RNP and ssODNs for the knock-in of LoxP
sites. Next, we aim to insert the ERT2
-Cre-ERT2
, a tightly regulated tamoxifen-inducible
Cre recombinase, into the AAVS1 locus (Y. Chen et al., 2015). We generated the donor

60
plasmid with the AAVS1 homology arms and the ERT2
-Cre-ERT2 cassette using the InFusion cloning protocol. Insertion to the safe-harbor site allows for the expression of
inducible Cre in all cell types without disrupting the expression of endogenous genes.
This two-step strategy will result in an inducible global FZD KO iPSC line, which
will be used to generate HROs. After 70 days in culture, once major retinal cell types have
differentiated, we will induce FZD3 KO by adding tamoxifen to the culture media (Figure
3.5). Morphological analysis using immunofluorescence staining, in situ hybridization, and
confocal microscopy will be performed to analyze the effects of FZD3 depletion on the
development of the outer retina.
If the global knockout of FZD3 affects the morphology of the retinal neurons, our
next avenue to pursue is to design cell-specific iKO lines to determine which specific cell
types are expressing FZD3. To do this, we will instead insert the ERT2
-Cre-ERT2
into the
promoter of cell-marker genes and repeat the HRO culture conditions and morphological
studies. Aside from FZD3, various other genes stood out in our analysis and warrant
further investigation. Mediators of the non-canonical Wnt pathway VANGL2 and CELSR3
were expressed in both the mouse and human retina. Given their role in establishing
glutamatergic synapses in the brain, both genes may be promising candidates for
investigating the potential role of establishing the rod-RBC glutamatergic synapse in the
retina (Thakar et al., 2017). Finally, Wnt ligands play a crucial role in a variety of
developmental pathways, and the loss or dysregulation of Wnt ligands leads to
developmental disorders and diseases (Davey & Moens, 2017; C.-W. He et al., 2018;
Mehta et al., 2021; Sarin et al., 2018). Our HROs model is an ideal system to further

61
investigate the role of WNT5A and WNT10A in retinal development, either by chemical
inhibitors or by generating iKO iPSC lines.
3.4 MATERIALS AND METHODS
3.1 Human iPSC Culture
WTC11 iPSC lines (GM25256, Cornell Institute) were maintained in standard feeder-free
conditions on Matrigel-coated (Stem Cell Technologies) tissue culture dishes with
mTeSR1 media (Stem Cell Technologies).
3.2 Human Retinal Organoid Differentiation
For HRO generation, WTC11 iPSCs were differentiated using a method modified from
previous publications (Aparicio et al., 2023; Kuwahara et al., 2015; Zhong et al., 2014).
Briefly, on Day 0 (D0), iPSCs were treated with 20µM ROCK inhibitor Y27632 in
pluripotent stem cell medium mTeSRPlus for 1 hr and dissociated into single-cell
suspension using Accutase. To form aggregates, 12,000 cells were subjected to
centrifugation at 300g for 5 min in 100 µl Aggrewell Embryoid Body Formation Medium
supplemented with ISL cocktail (Wnt antagonist IWR1 (3 µM), SB431542 (10 µM),
LDN193189 (100 nM)) and 20 µM Y27632 in coated U-bottom 96 well plates (Aparicio et
al., 2023). On D1, the media were changed to gfCDM plus 10% Knockout Serum
Replacement (KSR) containing ISL cocktail (Wataya et al., 2008). From D6 to D19,
gfCDM plus 10% KSR medium was used, which was supplemented with BMP4 (1.5 nM)
on D6 and its concentration was diluted by half media change on D9 and D12 and threequarters media change on D15. On D19 and D21, RPE induction was performed by

62
changing to induction culture medium containing Wnt agonist CHIR09921 (3µM) and
FGFR inhibitor SU5402 (5µM). From D23 to D36, organoids were maintained in RDM3SKZ medium (“NR–differentiation medium” lacking retinoic acid and taurine), and
supplementation with taurine (0.1 mM) began on D30 (Kuwahara et al., 2015). Between
D37 and D42, the medium was gradually transitioned to long-term suspension culture
medium (Zhong et al., 2014). The medium was supplemented with 1 µM retinoic acid from
D72 and subsequently reduced to 0.5 µM from D100 until the date collected.
3.3 Generation of cDNA Libraries
Analysis for FZD3 expression in HROs by reverse transcription of cDNA libraries. WTC11
and HROs were collected at multiple developmental time points. cDNA library was
synthesized using the High-Capacity cDNA Reverse Transcription Kit following the
manufacturer protocol (Cat# 4374966; Applied BioSystem).
3.4 PCR Conditions and Gel Electrophoresis
For PCR analysis, the Emerald master mix (EmeraldAmp GT PCR Master Mix, TaKaRa),
was used according to the manufacturer’s recommendation. A standard PCR reaction
was performed in a total volume of 10 µL containing 5µL of Emerald master mix, 0.25 µL
of each forward and reverse primer (0.25uM), 1µL of cDNA, and 3.5 µL of water. Primers
used are listed in Table 1. The PCR amplification was carried out with the following
thermal profile: an initial step of 98˚C for 30 sec followed by 28 cycles of 98˚C for 10 sec,
58˚C for 30 sec, and 72˚C for 1 min with a final step at 72˚C for 1 minute. The PCR
products were analyzed on a 1% agarose gel to determine the product size.

63
3.5 Plasmid Construction
Generation of the AAVS1-ERT2
-Cre-ERT2 donor plasmid followed the cloning and primer
design according to the In-Fusion HD Master Mix (Takara Cat # 638947) manufacturer’s
protocol, including the AAVS1-homology arms from the vector and the ERT2
-Cre-ERT2
fragment. The newly generated plasmid was transformed into competent cells and
isolated using Miniprep kit (Takara).
3.6 Design of gRNA
Potential off-target sites to the human genome were predicted using the CRISPOR
Design Tool website (http://crispor.gi.ucsc.edu). All potential gRNAs were ranked based
on potential off-targets in the genome and predicted on-target activity (Concordet &
Haeussler, 2018). sgRNAs were ordered as modified sgRNAs from Invitrogen TrueGuide.
AAVS1 sgRNA (Invitrogen Cat # A35522) was available to order from the CRISPR gRNA
controls.
3.7 Transfection of CRISPR RNP
Cells were then transfected with a 1:1 molar ratio of sgRNA to TrueCut Cas9 protein v2
and the Neon Transfection System (Invitrogen), following the manufacturer's protocol.
The optimal cell number used for electroporation of iPSCs is suggested to be 100,000 -
200,000 calls per electroporation.

64
3.5 TABLES

Table 3.1: List of PCR primer sequences for amplifying target genes in the cDNA library.
Primers were designed using Primer3. Each pair has a listed forward (For) and reverse
(Rev) primer sequence to yield a single amplification product.

65
sgRNA Name Sequence
gRNA_FZD3_In3_53rev CAUUCAUUAGAUUGGCUGAU
gRNA_FZD3_In3_91for GAAUGUGUUUGAUAAACAAC
gRNA_AAVS1 GCCAGUAGCCAGCCCCGUCC
Table 3.2: List of sgRNAs sequences. Two sgRNAs were designed, one in the forward
direction and the other in the reverse, targeting intron 3 of FZD3. All sgRNAs were ordered
from Invitrogen TrueGuide to maximize Cas9 genome editing activity.

66
3.6 FIGURES
Figure 3.1: PCR analysis of FZD3 expression in cDNA of iPSC and HROs. Analysis of
GAPDH expression was carried out as a control for cDNA quality. Samples were loaded
onto 1% agarose gel. Rod marker RCVRN and bipolar markers mGluR6 and BHLHE23
were included to indicate cell-type differentiation in HRO at each time point. FZD3 primers
targeted the terminal end of FZD3 transcript.

67
Figure 3.2: Schematic of the two-step strategy for generating an inducible knockout (iKO)
WTC11 cell line targeting FZD3. The first step is to generate a cell line with exon 3 flanked
by LoxP sites in both alleles using the Cas9-RNP and ssODN targeting strategy. The
second step is to insert the ERT2
-Cre-ERT2 expression cassette into the AAVS1 locus.
The completion of both steps will establish the iKO WTC-11 cell line.

68
Figure 3.3: Schematic representation of the insertion of LoxP sites via HDR repair. (A)
Schematic illustrating the intron for which each LoxP site will be targeted. (B) Schematic
representation of ssOND design including 50bp homology arm left and right of the LoxP
sequence.

69
Figure 3.4: Generation of donor plasmid for AAVS1 locus. (A) Plasmid pAAVS1-P-CAGGFP, containing the AAVS1 homology arms, was used to amplify the linearized vector.
Plasmid pCAG-ERT2
-Cre-ERT2 containing the ERT2
-Cre-ERT2 expression cassette was
amplified to generate the fragment. (B) After the In-Fusion reaction, the vector and
fragment were fused to generate the donor plasmid.

70
Figure 3.5: Schematic illustrating the iKO of FZD3 in cultured HROs. Once the FZD3 iKO
iPSC line has been established, we will culture following the HRO differentiation protocol.
After 70 days in culture, tamoxifen will be added to the media to induce the activity of Cre
recombinase, resulting in the full excision of FZD3 exon 3. HROs will continue to grow in
culture and be collected at multiple time points for downstream morphological analysis.

71
CHAPTER 4
Concluding Remarks
Our initial goal was to generate an FZD3 KO iPSC line to study the role of FZD3
in human retinal development. However, as we combed through the literature, we realized
a gap in our current knowledge of the gene expression profile of the non-canonical Wnt
genes in the human retina. We first described the pathway's expression pattern and
compared it across mouse retina, human retina, and human retinal organoids. For our
first aim, we used publicly available single-cell transcriptomic datasets to identify
candidate Wnt ligands, Frizzled receptors, and pathway mediators expressed in the
mouse retina, human fetal retina, and HROs (Clark et al., 2019; Cowan et al., 2020; Lu
et al., 2020). This analysis gave insight into what genes are expressed throughout retinal
development and provided information on cell-specific expression.
This analysis highlights four major findings. First, FZD3 transcripts were expressed
in the INL for both mouse and human retina. Still, the human retina also had a significant
amount of FZD3 transcripts detected in the ONL, indicating human photoreceptors may
be expressing FZD3. Second, Wnt2b expression in mice colocalizes with Chat+
expression, suggesting that amacrine cells may secrete Wnt2b ligand during mouse
retinal development. Third, WNT10A was expressed in human ONL, and its transcripts
co-localized with the early rod marker NRL. Finally, mediators of the non-canonical
signaling pathway are expressed ubiquitously in both mouse and human retina.

72
In hindsight, Seq-FISH technology may have been a more efficient methodology
for this study. Seq-FISH enables the identification of thousands of mRNA molecules
within single cells while preserving the tissue’s spatial context (S. Shah et al., 2017). This
ultra-resolution imaging of cells is achieved by targeting the single molecules with
fluorescent probes. Sequential rounds of fluorescent hybridization and imaging can be
used to map the cell’s spatial organization and molecule interactions at a singular cell
level.
In summary, our findings provide a comprehensive description of the novel
expression patterns of select non-canonical Wnt pathway genes. They also outline
human-specific expression patterns and their similarities to HROs, highlighting the utility
of HROs as potential models for understanding human developmental processes.
The second aim of this study was to develop a strategy to generate an inducible
FZD3 iPSC line. As discussed in Chapter 3, we have described a strategy to flank exon
3 of FZD3 with LoxP sites and knock out the expression of FZD3 with Cre recombinase.
The controlled expression of Cre recombinase activity with tamoxifen allows our models
to have precise temporal regulation of FZD3 expression. This methodology is ideal for
complex genes critical for early development and timing the knockout to identify a
timeframe range essential for function. Our strategy introduced the insertion of the four
LoxP sites to generate the biallelic flanked FZD3 first, allowing for the single-step insertion
of Cre to cell-specific promoters in future iPSC lines.
While this study aims to highlight the utility of HROs to model human development,
several aspects of the model system must be addressed. Current culture conditions are
inefficient at generating a homogenous population of organoids, resulting in variability of

73
developmental stages and cell type profiles at any given point in culture, making
experimental designs and comparisons difficult (Afanasyeva et al., 2021). HROs do not
truly recapitulate the complex process of human retinogenesis and remain limited by the
lack of vasculature to support internal cells, including RGCs, the absence of immune
cells, such as microglia, which are essential for neuronal cell survival, the lack of RPE
which provides nutrient support for photoreceptors and the absence of temporally
controlled diffusible factors (Singh & Nasonkin, 2020; Yuan & Jin, 2022).
Human retinogenesis initiates in the central retina and progresses through the
periphery, resulting in the formation of a cone-rich structure known as the macula
(Hendrickson, 2016). While other vertebrate models have been used to study retinal
neurogenesis, non-human primates are currently the only animal models with a structure
corresponding to the human fovea. While important to human research, the number of
non-human primates used in research remains small due to limitations in availability,
maintenance cost, and ethical concerns.
Currently, HRO protocols from various research groups yield organoids with
different cellular composition ratios (Berber et al., 2021; Capowski et al., 2018; Cowan et
al., 2020). Additionally, it is necessary to fine-tune the expression pattern of the induction
factors to determine the proper dosage and temporal window of treatment. There remains
a need to consolidate and standardize the protocols to facilitate comparability across
research groups, reduce batch and cell line variability, and streamline experimental
applications and reproducibility.
Finally, the lack of a synaptic partner leads to the progressive loss of RGCs in longterm culture. Efforts in generating “assembloids” by the co-culture of brain organoids to

74
retinal organoids could serve as a more precise ocular model to study the dynamic events
of human retinogenesis (O’Hara-Wright & Gonzalez-Cordero, 2020). While progress has
been made, organoid models are still in their infancy, and significant work must be done
to enhance their utility.
This work also highlights the similarities between human fetal tissue and HROs,
which are an improving and invaluable model for studying early human retinal
development and disease. Despite the use of other mammalian models, it is apparent
that the innovation of human-specific models is required to study the human-specific
anatomy of the retina. The evolving and streamlining of gene editing methodology is an
imperative tool that can be used not only for basic science research but combined with
the potential of stem cells, can be a promising avenue for cell therapy and treatments of
human retinal degenerative disease.
In summary, this dissertation describes my work in Dr. Nagiel’s lab on the
expression pattern of the non-canonical Wnt pathway in the developing outer retina of
mouse and human retinae. This analysis gave us insight into the fundamentals of the
non-canonical Wnt at different developmental stages that had not yet been analyzed.
Under Dr. Nagiel’s guidance, I have had the opportunity to learn a variety of lab
techniques, including ocular dissection and histological tissue preparation, transcriptomic
analysis, in situ hybridization, immunofluorescent staining, stem cell and organoid culture,
and confocal microscopy and my time in the lab allowed me to grow independently as a
scientist and to work in collaboration with others in the lab, including Kayla, Jay, Patty,
Leila, Sumitha, and Dominic. My experience in the lab provided me with multiple

75
opportunities to improve my critical thinking skills, presentation skills, and scientific
writing, including grant writing and manuscript preparations.

76
REFERENCES
Achberger, K., Probst, C., Haderspeck, J., Bolz, S., Rogal, J., Chuchuy, J., Nikolova,
M., Cora, V., Antkowiak, L., Haq, W., Shen, N., Schenke-Layland, K., Ueffing, M.,
Liebau, S., & Loskill, P. (2019). Merging organoid and organ-on-a-chip
technology to generate complex multi-layer tissue models in a human retina-ona-chip platform. eLife, 8, e46188. https://doi.org/10.7554/eLife.46188
Afanasyeva, T. A. V., Corral-Serrano, J. C., Garanto, A., Roepman, R., Cheetham, M.
E., & Collin, R. W. J. (2021). A look into retinal organoids: Methods, analytical
techniques, and applications. Cellular and Molecular Life Sciences, 78(19–20),
6505–6532. https://doi.org/10.1007/s00018-021-03917-4
Agostino, M., Pohl, S. Ö.-G., & Dharmarajan, A. (2017). Structure-based prediction of
Wnt binding affinities for Frizzled-type cysteine-rich domains. Journal of
Biological Chemistry, 292(27), 11218–11229.
https://doi.org/10.1074/jbc.M117.786269
Aparicio, J. G., Hopp, H., Harutyunyan, N., Stewart, C., Cobrinik, D., & Borchert, M.
(2023). Aberrant gene expression yet undiminished retinal ganglion cell genesis
in iPSC-derived models of optic nerve hypoplasia. Ophthalmic Genetics, 1–15.
https://doi.org/10.1080/13816810.2023.2253902
Bai, J., Koos, D. S., Stepanian, K., Fouladian, Z., Shayler, D. W. H., Aparicio, J. G.,
Fraser, S. E., Moats, R. A., & Cobrinik, D. (2023). Episodic live imaging of cone
photoreceptor maturation in GNAT2-EGFP retinal organoids. Disease Models &
Mechanisms, 16(11), dmm050193. https://doi.org/10.1242/dmm.050193
Balasubramanian, R., & Gan, L. (2014). Development of Retinal Amacrine Cells and
Their Dendritic Stratification. Current Ophthalmology Reports, 2(3), 100–106.
https://doi.org/10.1007/s40135-014-0048-2
Bassett, E. A., & Wallace, V. A. (2012). Cell fate determination in the vertebrate retina.
Trends in Neurosciences, 35(9), 565–573.
https://doi.org/10.1016/j.tins.2012.05.004
Berber, P., Milenkovic, A., Michaelis, L., & Weber, B. H. F. (2021). Retinal organoid
differentiation methods determine organoid cellular composition. Journal of
Translational Genetics and Genomics. https://doi.org/10.20517/jtgg.2021.35
Blomfield, A. K., Maurya, M., Bora, K., Pavlovich, M. C., Yemanyi, F., Huang, S., Fu, Z.,
O’Connell, A. E., & Chen, J. (2023). Ectopic Rod Photoreceptor Development in
Mice with Genetic Deficiency of WNT2B. Cells, 12(7), 1033.
https://doi.org/10.3390/cells12071033

77
Brennenstuhl, C., Tanimoto, N., Burkard, M., Wagner, R., Bolz, S., Trifunovic, D.,
Kabagema-Bilan, C., Paquet-Durand, F., Beck, S. C., Huber, G., Seeliger, M. W.,
Ruth, P., Wissinger, B., & Lukowski, R. (2015). Targeted Ablation of the Pde6h
Gene in Mice Reveals Cross-species Differences in Cone and Rod
Phototransduction Protein Isoform Inventory. Journal of Biological Chemistry,
290(16), 10242–10255. https://doi.org/10.1074/jbc.M114.611921
Burger, C. A., Jiang, D., Mackin, R. D., & Samuel, M. A. (2021). Development and
maintenance of vision’s first synapse. Developmental Biology, 476, 218–239.
https://doi.org/10.1016/j.ydbio.2021.04.001
Capowski, E. E., Samimi, K., Mayerl, S. J., Phillips, M. J., Pinilla, I., Howden, S. E.,
Saha, J., Jansen, A. D., Edwards, K. L., Jager, L. D., Barlow, K., Valiauga, R.,
Erlichman, Z., Hagstrom, A., Sinha, D., Sluch, V. M., Chamling, X., Zack, D. J.,
Skala, M. C., & Gamm, D. M. (2018). Reproducibility and staging of 3D human
retinal organoids across multiple pluripotent stem cell lines. Development,
dev.171686. https://doi.org/10.1242/dev.171686
Cetera, M., Leybova, L., Woo, F. W., Deans, M., & Devenport, D. (2017). Planar cell
polarity-dependent and independent functions in the emergence of tissue-scale
hair follicle patterns. Developmental Biology, 428(1), 188–203.
https://doi.org/10.1016/j.ydbio.2017.06.003
Chen, F., Pruett-Miller, S. M., Huang, Y., Gjoka, M., Duda, K., Taunton, J., Collingwood,
T. N., Frodin, M., & Davis, G. D. (2011). High-frequency genome editing using
ssDNA oligonucleotides with zinc-finger nucleases. Nature Methods, 8(9), 753–
755. https://doi.org/10.1038/nmeth.1653
Chen, Y., Cao, J., Xiong, M., Petersen, A. J., Dong, Y., Tao, Y., Huang, C. T.-L., Du, Z.,
& Zhang, S.-C. (2015). Engineering Human Stem Cell Lines with Inducible Gene
Knockout using CRISPR/Cas9. Cell Stem Cell, 17(2), 233–244.
https://doi.org/10.1016/j.stem.2015.06.001
Clark, B. S., Stein-O’Brien, G. L., Shiau, F., Cannon, G. H., Davis-Marcisak, E.,
Sherman, T., Santiago, C. P., Hoang, T. V., Rajaii, F., James-Esposito, R. E.,
Gronostajski, R. M., Fertig, E. J., Goff, L. A., & Blackshaw, S. (2019). Single-Cell
RNA-Seq Analysis of Retinal Development Identifies NFI Factors as Regulating
Mitotic Exit and Late-Born Cell Specification. Neuron, 102(6), 1111-1126.e5.
https://doi.org/10.1016/j.neuron.2019.04.010
Coco-Martin, R. M., Pastor-Idoate, S., & Pastor, J. C. (2021). Cell Replacement
Therapy for Retinal and Optic Nerve Diseases: Cell Sources, Clinical Trials and
Challenges. Pharmaceutics, 13(6), 865.
https://doi.org/10.3390/pharmaceutics13060865

78
Concordet, J.-P., & Haeussler, M. (2018). CRISPOR: Intuitive guide selection for
CRISPR/Cas9 genome editing experiments and screens. Nucleic Acids
Research, 46(W1), W242–W245. https://doi.org/10.1093/nar/gky354
Cowan, C. S., Renner, M., De Gennaro, M., Gross-Scherf, B., Goldblum, D., Hou, Y.,
Munz, M., Rodrigues, T. M., Krol, J., Szikra, T., Cuttat, R., Waldt, A., Papasaikas,
P., Diggelmann, R., Patino-Alvarez, C. P., Galliker, P., Spirig, S. E., Pavlinic, D.,
Gerber-Hollbach, N., … Roska, B. (2020). Cell Types of the Human Retina and
Its Organoids at Single-Cell Resolution. Cell, 182(6), 1623-1640.e34.
https://doi.org/10.1016/j.cell.2020.08.013
Crair, M. C., & Mason, C. A. (2016). Reconnecting Eye to Brain. The Journal of
Neuroscience, 36(42), 10707–10722. https://doi.org/10.1523/JNEUROSCI.1711-
16.2016
Darrow, J. J. (2019). Luxturna: FDA documents reveal the value of a costly gene
therapy. Drug Discovery Today, 24(4), 949–954.
https://doi.org/10.1016/j.drudis.2019.01.019
Davey, C. F., & Moens, C. B. (2017). Planar cell polarity in moving cells: Think globally,
act locally. Development, 144(2), 187–200. https://doi.org/10.1242/dev.122804
Davis, L., & Maizels, N. (2014). Homology-directed repair of DNA nicks via pathways
distinct from canonical double-strand break repair. Proceedings of the National
Academy of Sciences, 111(10). https://doi.org/10.1073/pnas.1400236111
Demb, J. B., & Singer, J. H. (2015). Functional Circuitry of the Retina. Annual Review of
Vision Science, 1(1), 263–289. https://doi.org/10.1146/annurev-vision-082114-
035334
Eiraku, M., Takata, N., Ishibashi, H., Kawada, M., Sakakura, E., Okuda, S., Sekiguchi,
K., Adachi, T., & Sasai, Y. (2011). Self-organizing optic-cup morphogenesis in
three-dimensional culture. Nature, 472(7341), 51–56.
https://doi.org/10.1038/nature09941
Erskine, L., & Herrera, E. (2014). Connecting the Retina to the Brain. ASN Neuro, 6(6),
175909141456210. https://doi.org/10.1177/1759091414562107
Fain, G. L., Hardie, R., & Laughlin, S. B. (2010). Phototransduction and the Evolution of
Photoreceptors. Current Biology, 20(3), R114–R124.
https://doi.org/10.1016/j.cub.2009.12.006
Fan, W., Li, X., Yao, H., Deng, J., Liu, H., Cui, Z., Wang, Q., Wu, P., & Deng, J. (2016).
Neural differentiation and synaptogenesis in retinal development. Neural
Regeneration Research, 11(2), 312. https://doi.org/10.4103/1673-5374.177743

79
Fleckenstein, M., Keenan, T. D. L., Guymer, R. H., Chakravarthy, U., SchmitzValckenberg, S., Klaver, C. C., Wong, W. T., & Chew, E. Y. (2021). Age-related
macular degeneration. Nature Reviews Disease Primers, 7(1), 31.
https://doi.org/10.1038/s41572-021-00265-2
Foltz, L. P., & Clegg, D. O. (2019). Patient-derived induced pluripotent stem cells for
modelling genetic retinal dystrophies. Progress in Retinal and Eye Research, 68,
54–66. https://doi.org/10.1016/j.preteyeres.2018.09.002
Géléoc, G. G. S., & El-Amraoui, A. (2020). Disease mechanisms and gene therapy for
Usher syndrome. Hearing Research, 394, 107932.
https://doi.org/10.1016/j.heares.2020.107932
Georgiou, M., Grewal, P. S., Narayan, A., Alser, M., Ali, N., Fujinami, K., Webster, A. R.,
& Michaelides, M. (2021). Sector Retinitis Pigmentosa: Extending the Molecular
Genetics Basis and Elucidating the Natural History. American Journal of
Ophthalmology, 221, 299–310. https://doi.org/10.1016/j.ajo.2020.08.004
Gomes, M. E., Rodrigues, M. T., Domingues, R. M. A., & Reis, R. L. (2017). Tissue
Engineering and Regenerative Medicine: New Trends and Directions—A Year in
Review. Tissue Engineering Part B: Reviews, 23(3), 211–224.
https://doi.org/10.1089/ten.teb.2017.0081
Hadziahmetovic, M., & Malek, G. (2021). Age-Related Macular Degeneration Revisited:
From Pathology and Cellular Stress to Potential Therapies. Frontiers in Cell and
Developmental Biology, 8, 612812. https://doi.org/10.3389/fcell.2020.612812
Harkin, J., Peña, K. H., Gomes, C., Hernandez, M., Lavekar, S. S., So, K., Lentsch, K.,
Feder, E. M., Morrow, S., Huang, K.-C., Tutrow, K. D., Morris, A., Zhang, C., &
Meyer, J. S. (2024). A highly reproducible and efficient method for retinal
organoid differentiation from human pluripotent stem cells. Proceedings of the
National Academy of Sciences, 121(25), e2317285121.
https://doi.org/10.1073/pnas.2317285121
He, C.-W., Liao, C.-P., & Pan, C.-L. (2018). Wnt signalling in the development of axon,
dendrites and synapses. Open Biology, 8(10), 180116.
https://doi.org/10.1098/rsob.180116
He, X., Semenov, M., Tamai, K., & Zeng, X. (2004). LDL receptor-related proteins 5 and
6 in Wnt/β-catenin signaling:Arrows point the way. Development, 131(8), 1663–
1677. https://doi.org/10.1242/dev.01117
Hejtmancik, J. F., & Daiger, S. P. (2020). Understanding the genetic architecture of
human retinal degenerations. Proceedings of the National Academy of Sciences,
117(8), 3904–3906. https://doi.org/10.1073/pnas.1922925117

80
Hendrickson, A. (2016). Development of Retinal Layers in Prenatal Human Retina.
American Journal of Ophthalmology, 161, 29-35.e1.
https://doi.org/10.1016/j.ajo.2015.09.023
Hirami, Y., Osakada, F., Takahashi, K., Okita, K., Yamanaka, S., Ikeda, H., Yoshimura,
N., & Takahashi, M. (2009). Generation of retinal cells from mouse and human
induced pluripotent stem cells. Neuroscience Letters, 458(3), 126–131.
https://doi.org/10.1016/j.neulet.2009.04.035
Hoon, M., Okawa, H., Della Santina, L., & Wong, R. O. L. (2014). Functional
architecture of the retina: Development and disease. Progress in Retinal and Eye
Research, 42, 44–84. https://doi.org/10.1016/j.preteyeres.2014.06.003
Horton, J. C., & Hocking, D. R. (1997). Timing of the Critical Period for Plasticity of
Ocular Dominance Columns in Macaque Striate Cortex. The Journal of
Neuroscience, 17(10), 3684–3709. https://doi.org/10.1523/JNEUROSCI.17-10-
03684.1997
Hoshino, A., Ratnapriya, R., Brooks, M. J., Chaitankar, V., Wilken, M. S., Zhang, C.,
Starostik, M. R., Gieser, L., La Torre, A., Nishio, M., Bates, O., Walton, A.,
Bermingham-McDonogh, O., Glass, I. A., Wong, R. O. L., Swaroop, A., & Reh, T.
A. (2017). Molecular Anatomy of the Developing Human Retina. Developmental
Cell, 43(6), 763-779.e4. https://doi.org/10.1016/j.devcel.2017.10.029
Hua, Z. L., Smallwood, P. M., & Nathans, J. (2013). Frizzled3 controls axonal
development in distinct populations of cranial and spinal motor neurons. eLife, 2,
e01482. https://doi.org/10.7554/eLife.01482
Hubel, D. H., & Wiesel, T. N. (n.d.). RECEPTIVE FIELDS OF SINGLE NEURONES IN
THE CAT’S STRIATE CORTEX.
Kolb, H. (2011, October 8). Simple Anatomy of the Retina by Helga Kolb – Webvision.
https://webvision.med.utah.edu/book/part-i-foundations/simple-anatomy-of-theretina/
Komiya, Y., & Habas, R. (2008). Wnt signal transduction pathways. Organogenesis,
4(2), 68–75. https://doi.org/10.4161/org.4.2.5851
Kotin, R. M., Linden, R. M., & Berns, K. I. (1992). Characterization of a preferred site on
human chromosome 19q for integration of adeno-associated virus DNA by nonhomologous recombination. The EMBO Journal, 11(13), 5071–5078.
https://doi.org/10.1002/j.1460-2075.1992.tb05614.x
Kuwahara, A., Ozone, C., Nakano, T., Saito, K., Eiraku, M., & Sasai, Y. (2015).
Generation of a ciliary margin-like stem cell niche from self-organizing human

81
retinal tissue. Nature Communications, 6(1), 6286.
https://doi.org/10.1038/ncomms7286
Lee, J. Y., Care, R. A., Della Santina, L., & Dunn, F. A. (2021). Impact of Photoreceptor
Loss on Retinal Circuitry. Annual Review of Vision Science, 7(1), 105–128.
https://doi.org/10.1146/annurev-vision-100119-124713
Liu, H., Thurig, S., Mohamed, O., Dufort, D., & Wallace, V. A. (2006). Mapping
Canonical Wnt Signaling in the Developing and Adult Retina. Investigative
Opthalmology & Visual Science, 47(11), 5088. https://doi.org/10.1167/iovs.06-
0403
Livesey, F. J., & Cepko, C. L. (2001). Vertebrate neural cell-fate determination: Lessons
from the retina. Nature Reviews Neuroscience, 2(2), 109–118.
https://doi.org/10.1038/35053522
Lu, Y., Shiau, F., Yi, W., Lu, S., Wu, Q., Pearson, J. D., Kallman, A., Zhong, S., Hoang,
T., Zuo, Z., Zhao, F., Zhang, M., Tsai, N., Zhuo, Y., He, S., Zhang, J., SteinO’Brien, G. L., Sherman, T. D., Duan, X., … Clark, B. S. (2020). Single-Cell
Analysis of Human Retina Identifies Evolutionarily Conserved and SpeciesSpecific Mechanisms Controlling Development. Developmental Cell, 53(4), 473-
491.e9. https://doi.org/10.1016/j.devcel.2020.04.009
Mata, N. L., Tzekov, R. T., Liu, X., Weng, J., Birch, D. G., & Travis, G. H. (2001).
Delayed Dark-Adaptation and Lipofuscin Accumulation in abcr؉/؉ Mice:
Implications for Involvement of ABCR in Age-Related Macular Degeneration.
42(8).
May-Simera, H., & Kelley, M. W. (2012). Planar Cell Polarity in the Inner Ear. In Current
Topics in Developmental Biology (Vol. 101, pp. 111–140). Elsevier.
https://doi.org/10.1016/B978-0-12-394592-1.00006-5
Mehta, S., Hingole, S., & Chaudhary, V. (2021). The Emerging Mechanisms of Wnt
Secretion and Signaling in Development. Frontiers in Cell and Developmental
Biology, 9, 714746. https://doi.org/10.3389/fcell.2021.714746
Meyer, J. S., Shearer, R. L., Capowski, E. E., Wright, L. S., Wallace, K. A., McMillan, E.
L., Zhang, S.-C., & Gamm, D. M. (2009). Modeling early retinal development with
human embryonic and induced pluripotent stem cells. Proceedings of the
National Academy of Sciences, 106(39), 16698–16703.
https://doi.org/10.1073/pnas.0905245106
Moshiri, A. (2021). Animals Models of Inherited Retinal Disease. International
Ophthalmology Clinics, 61(3), 113–130.
https://doi.org/10.1097/IIO.0000000000000368

82
Mullin, N. K., Voigt, A. P., Cooke, J. A., Bohrer, L. R., Burnight, E. R., Stone, E. M.,
Mullins, R. F., & Tucker, B. A. (2021). Patient derived stem cells for discovery
and validation of novel pathogenic variants in inherited retinal disease. Progress
in Retinal and Eye Research, 83, 100918.
https://doi.org/10.1016/j.preteyeres.2020.100918
Mustafi, D., Bharathan, S. P., Calderon, R., & Nagiel, A. (2022). HUMAN CELLULAR
MODELS FOR RETINAL DISEASE: From Induced Pluripotent Stem Cells to
Organoids. Retina, 42(10), 1829–1835.
https://doi.org/10.1097/IAE.0000000000003571
Nemitz, L., Dedek, K., & Janssen-Bienhold, U. (2019). Rod Bipolar Cells Require
Horizontal Cells for Invagination Into the Terminals of Rod Photoreceptors.
Frontiers in Cellular Neuroscience, 13, 423.
https://doi.org/10.3389/fncel.2019.00423
Nguyen-Ba-Charvet, K. T., & Chédotal, A. (2014). Development of retinal layers.
Comptes Rendus. Biologies, 337(3), 153–159.
https://doi.org/10.1016/j.crvi.2013.11.010
Nguyen-Ba-Charvet, K. T., & Rebsam, A. (2020). Neurogenesis and Specification of
Retinal Ganglion Cells. International Journal of Molecular Sciences, 21(2), 451.
https://doi.org/10.3390/ijms21020451
O’Hara-Wright, M., & Gonzalez-Cordero, A. (2020). Retinal organoids: A window into
human retinal development. Development, 147(24), dev189746.
https://doi.org/10.1242/dev.189746
Pang, J.-J., Yang, Z., Jacoby, R. A., & Wu, S. M. (2018). Cone synapses in mammalian
retinal rod bipolar cells. Journal of Comparative Neurology, 526(12), 1896–1909.
https://doi.org/10.1002/cne.24456
Poobalasingam, T., Yates, L. L., Walker, S. A., Pereira, M., Gross, N. Y., Ali, A., KolatsiJoannou, M., Jarvelin, M.-R., Pekkanen, J., Papakrivopoulou, E., Long, D. A.,
Griffiths, M., Wagner, D., Königshoff, M., Hind, M., Minelli, C., Lloyd, C. M., &
Dean, C. H. (2017). Heterozygous Vangl2 Looptail mice reveal novel roles for the
planar cell polarity pathway in adult lung homeostasis and repair. Disease
Models & Mechanisms, dmm.028175. https://doi.org/10.1242/dmm.028175
Pool, A.-H., Poldsam, H., Chen, S., Thomson, M., & Oka, Y. (2022). Enhanced recovery
of single-cell RNA-sequencing reads for missing gene expression data [Preprint].
Genomics. https://doi.org/10.1101/2022.04.26.489449
Prameela Bharathan, S., Ferrario, A., Stepanian, K., Fernandez, G. E., Reid, M. W.,
Kim, J. S., Hutchens, C., Harutyunyan, N., Marks, C., Thornton, M. E., Grubbs,
B. H., Cobrinik, D., Aparicio, J. G., & Nagiel, A. (2021). Characterization and

83
staging of outer plexiform layer development in human retina and retinal
organoids. Development, 148(23), dev199551.
https://doi.org/10.1242/dev.199551
Ptito, M., Bleau, M., & Bouskila, J. (2021). The Retina: A Window into the Brain. Cells,
10(12), 3269. https://doi.org/10.3390/cells10123269
Quinn, P. M. J., & Wijnholds, J. (2019). Retinogenesis of the Human Fetal Retina: An
Apical Polarity Perspective. Genes, 10(12), 987.
https://doi.org/10.3390/genes10120987
Sala, C. F., Formenti, E., Terstappen, G. C., & Caricasole, A. (2000). Identification,
Gene Structure, and Expression of Human Frizzled-3 (FZD3). BIOCHEMICAL
AND BIOPHYSICAL RESEARCH COMMUNICATIONS, 273(1).
Sarin, S., Zuniga-Sanchez, E., Kurmangaliyev, Y. Z., Cousins, H., Patel, M., Hernandez,
J., Zhang, K. X., Samuel, M. A., Morey, M., Sanes, J. R., & Zipursky, S. L.
(2018). Role for Wnt Signaling in Retinal Neuropil Development: Analysis via
RNA-Seq and In Vivo Somatic CRISPR Mutagenesis. Neuron, 98(1), 109-
126.e8. https://doi.org/10.1016/j.neuron.2018.03.004
Schneider, C. A., Rasband, W. S., & Eliceiri, K. W. (2012). NIH Image to ImageJ: 25
years of image analysis. Nature Methods, 9(7), 671–675.
https://doi.org/10.1038/nmeth.2089
Seifert, J. R. K., & Mlodzik, M. (2007). Frizzled/PCP signalling: A conserved mechanism
regulating cell polarity and directed motility. Nature Reviews Genetics, 8(2), 126–
138. https://doi.org/10.1038/nrg2042
Shah, R., Amador, C., Chun, S. T., Ghiam, S., Saghizadeh, M., Kramerov, A. A., &
Ljubimov, A. V. (2023). Non-canonical Wnt signaling in the eye. Progress in
Retinal and Eye Research, 95, 101149.
https://doi.org/10.1016/j.preteyeres.2022.101149
Shah, S., Lubeck, E., Zhou, W., & Cai, L. (2017). seqFISH Accurately Detects
Transcripts in Single Cells and Reveals Robust Spatial Organization in the
Hippocampus. Neuron, 94(4), 752-758.e1.
https://doi.org/10.1016/j.neuron.2017.05.008
Shekhar, K., Lapan, S. W., Whitney, I. E., Tran, N. M., Macosko, E. Z., Kowalczyk, M.,
Adiconis, X., Levin, J. Z., Nemesh, J., Goldman, M., McCarroll, S. A., Cepko, C.
L., Regev, A., & Sanes, J. R. (2016). Comprehensive Classification of Retinal
Bipolar Neurons by Single-Cell Transcriptomics. Cell, 166(5), 1308-1323.e30.
https://doi.org/10.1016/j.cell.2016.07.054

84
Sheldahl, L. C., Slusarski, D. C., Pandur, P., Miller, J. R., Kühl, M., & Moon, R. T.
(2003). Dishevelled activates Ca2+ flux, PKC, and CamKII in vertebrate
embryos. The Journal of Cell Biology, 161(4), 769–777.
https://doi.org/10.1083/jcb.200211094
Shen, N., Qu, Y., Yu, Y., So, K.-F., Goffinet, A. M., Vardi, N., Xu, Y., & Zhou, L. (2016).
Frizzled3 Shapes the Development of Retinal Rod Bipolar Cells. Investigative
Opthalmology & Visual Science, 57(6), 2788. https://doi.org/10.1167/iovs.16-
19281
Shi, D.-L. (2023). Planar cell polarity regulators in asymmetric organogenesis during
development and disease. Journal of Genetics and Genomics, 50(2), 63–76.
https://doi.org/10.1016/j.jgg.2022.06.007
Shichida, Y., & Matsuyama, T. (2009). Evolution of opsins and phototransduction.
Philosophical Transactions of the Royal Society B: Biological Sciences,
364(1531), 2881–2895. https://doi.org/10.1098/rstb.2009.0051
Singh, R. K., & Nasonkin, I. O. (2020). Limitations and Promise of Retinal Tissue From
Human Pluripotent Stem Cells for Developing Therapies of Blindness. Frontiers
in Cellular Neuroscience, 14, 179. https://doi.org/10.3389/fncel.2020.00179
Stoller, M. L., Roman, O., & Deans, M. R. (2018). Domineering non-autonomy in
Vangl1;Vangl2 double mutants demonstrates intercellular PCP signaling in the
vertebrate inner ear. Developmental Biology, 437(1), 17–26.
https://doi.org/10.1016/j.ydbio.2018.02.021
Stylianidis, V., Hermans, K. C. M., & Blankesteijn, W. M. (2016). Wnt Signaling in
Cardiac Remodeling and Heart Failure. In J. Bauersachs, J. Butler, & P. Sandner
(Eds.), Heart Failure (Vol. 243, pp. 371–393). Springer International Publishing.
https://doi.org/10.1007/164_2016_56
Telegina, D. V., Kozhevnikova, O. S., Antonenko, A. K., & Kolosova, N. G. (2021).
Features of Retinal Neurogenesis as a Key Factor of Age-Related
Neurodegeneration: Myth or Reality? International Journal of Molecular
Sciences, 22(14), 7373. https://doi.org/10.3390/ijms22147373
Thakar, S., Wang, L., Yu, T., Ye, M., Onishi, K., Scott, J., Qi, J., Fernandes, C., Han, X.,
Yates, J. R., Berg, D. K., & Zou, Y. (2017). Evidence for opposing roles of Celsr3
and Vangl2 in glutamatergic synapse formation. Proceedings of the National
Academy of Sciences, 114(4), E610–E618.
https://doi.org/10.1073/pnas.1612062114
Thompson, B., Townsley, F., Rosin-Arbesfeld, R., Musisi, H., & Bienz, M. (2002). A new
nuclear component of the Wnt signalling pathway. Nature Cell Biology, 4(5),
367–373. https://doi.org/10.1038/ncb786

85
Tissir, F., & Goffinet, A. M. (2013). Shaping the nervous system: Role of the core planar
cell polarity genes. Nature Reviews Neuroscience, 14(8), 525–535.
https://doi.org/10.1038/nrn3525
Van Raay, T. J., & Vetter, M. L. (2004). Wnt/Frizzled Signaling during Vertebrate Retinal
Development. Developmental Neuroscience, 26(5–6), 352–358.
https://doi.org/10.1159/000082277
Wallingford, J. B., & Habas, R. (2005). The developmental biology of Dishevelled: An
enigmatic protein governing cell fate and cell polarity. Development, 132(20),
4421–4436. https://doi.org/10.1242/dev.02068
Wang, Y., Chang, H., Rattner, A., & Nathans, J. (2016). Frizzled Receptors in
Development and Disease. In Current Topics in Developmental Biology (Vol.
117, pp. 113–139). Elsevier. https://doi.org/10.1016/bs.ctdb.2015.11.028
Wang, Y., Thekdi, N., Smallwood, P. M., Macke, J. P., & Nathans, J. (2002). Frizzled-3
Is Required for the Development of Major Fiber Tracts in the Rostral CNS. The
Journal of Neuroscience, 22(19), 8563–8573.
https://doi.org/10.1523/JNEUROSCI.22-19-08563.2002
Wataya, T., Ando, S., Muguruma, K., Ikeda, H., Watanabe, K., Eiraku, M., Kawada, M.,
Takahashi, J., Hashimoto, N., & Sasai, Y. (2008). Minimization of exogenous
signals in ES cell culture induces rostral hypothalamic differentiation.
Proceedings of the National Academy of Sciences, 105(33), 11796–11801.
https://doi.org/10.1073/pnas.0803078105
Whitaker, C. M., Nobles, G., Ishibashi, M., & Massey, S. C. (2021). Rod and Cone
Connections With Bipolar Cells in the Rabbit Retina. Frontiers in Cellular
Neuroscience, 15, 662329. https://doi.org/10.3389/fncel.2021.662329
Wurtz, R. H. (2009). Recounting the impact of Hubel and Wiesel. The Journal of
Physiology, 587(12), 2817–2823. https://doi.org/10.1113/jphysiol.2009.170209
Xia, X., & Ahmad, I. (2016). Unlocking the Neurogenic Potential of Mammalian Müller
Glia. International Journal of Stem Cells, 9(2), 169–175.
https://doi.org/10.15283/ijsc16020
Xu, H., Kita, Y., Bang, U., Gee, P., & Hotta, A. (2021). Optimized electroporation of
CRISPR-Cas9/gRNA ribonucleoprotein complex for selection-free homologous
recombination in human pluripotent stem cells. STAR Protocols, 2(4), 100965.
https://doi.org/10.1016/j.xpro.2021.100965

86
Yang, S., Zhou, J., & Li, D. (2021). Functions and Diseases of the Retinal Pigment
Epithelium. Frontiers in Pharmacology, 12, 727870.
https://doi.org/10.3389/fphar.2021.727870
Yang, Y., & Mlodzik, M. (2015). Wnt-Frizzled/Planar Cell Polarity Signaling: Cellular
Orientation by Facing the Wind (Wnt). Annual Review of Cell and Developmental
Biology, 31(1), 623–646. https://doi.org/10.1146/annurev-cellbio-100814-125315
Yoshimi, K., Kunihiro, Y., Kaneko, T., Nagahora, H., Voigt, B., & Mashimo, T. (2016).
ssODN-mediated knock-in with CRISPR-Cas for large genomic regions in
zygotes. Nature Communications, 7(1), 10431.
https://doi.org/10.1038/ncomms10431
Yuan, J., & Jin, Z.-B. (2022). Retinal Organoids over the Decade. In M. K. Paul (Ed.),
Biomedical Engineering (Vol. 13). IntechOpen.
https://doi.org/10.5772/intechopen.104258
Zhang, X., Serb, J. M., & Greenlee, M. H. W. (2011). Mouse Retinal Development: A
Dark Horse Model for Systems Biology Research. Bioinformatics and Biology
Insights, 5, BBI.S6930. https://doi.org/10.4137/BBI.S6930
Zhao, H., & Yan, F. (2024). Retinal Organoids: A Next-Generation Platform for HighThroughput Drug Discovery. Stem Cell Reviews and Reports, 20(2), 495–508.
https://doi.org/10.1007/s12015-023-10661-8
Zheng, B., Sage, M., Cai, W.-W., Thompson, D. M., Tavsanli, B. C., Cheah, Y.-C., &
Bradley, A. (1999). Engineering a mouse balancer chromosome. Nature
Genetics, 22(4), 375–378. https://doi.org/10.1038/11949
Zhong, X., Gutierrez, C., Xue, T., Hampton, C., Vergara, M. N., Cao, L.-H., Peters, A.,
Park, T. S., Zambidis, E. T., Meyer, J. S., Gamm, D. M., Yau, K.-W., & CantoSoler, M. V. (2014). Generation of three-dimensional retinal tissue with functional
photoreceptors from human iPSCs. Nature Communications, 5(1), 4047.
https://doi.org/10.1038/ncomms5047
Zou, Y. (2020). Breaking symmetry – cell polarity signaling pathways in growth cone
guidance and synapse formation. Current Opinion in Neurobiology, 63, 77–86.
https://doi.org/10.1016/j.conb.2020.03.010

87
APPENDIX A: MANUSCRIPT INFORMATION
Manuscript adapted for Chapter 1:
Human Cellular Models for Retinal Diseases: From Induced Pluripotent Stem Cell to
Organoids
Retina (2022) Oct 1;42(10):1829-1835.
doi: 10.1097/IAE.0000000000003571.
Mustafi, Debarshi MD, PhD1-3
; Bharathan, Sumitha P. PhD3,4; Calderon, Rosanna MS4-6
;
Nagiel, Aaron MD, PhD4-7
1Department of Ophthalmology, Karalis Johnson Retina Center, University of
Washington, Seattle, Washington;
2Department of Ophthalmology, Seattle Children's Hospital, Seattle, Washington;
3Brotman Baty Institute for Precision Medicine, Seattle, Washington;
4The Vision Center, Department of Surgery, Children's Hospital Los Angeles, Los
Angeles, California;
5The Saban Research Institute, Children's Hospital Los Angeles, Los Angeles, California;
6Department of Development, Stem Cells and Regenerative Medicine, Keck School of
Medicine, University of Southern California, Los Angeles, California; and
7Department of Ophthalmology, Roski Eye Institute, Keck School of Medicine, University
of Southern California, Los Angeles, California
ACKNOWLEDGMENTS: The authors acknowledge Yibu Chen and Meng Li of the USC
Libraries Bioinformatics Service for their assistance in creating the single-cell RNAseq
plot. The authors also acknowledge Kayla Stepanian, Andrew Salas, Jennifer Aparicio,
and the CHLA Stem Cell Analytics and Cellular Imaging Cores for organoid production
featured in Figure 2. The authors thank David Gamm from the University of Wisconsin for
the gift of the WA09 NRL+/eGFP human ESC line used for generating the retinal organoid
shown in Figure 2B.

88
Manuscript adapted for Chapter 2:
Non-Canonical Wnt Pathway Expression in the Developing Mouse and Human Retina.
Experimental Eye Research 244 (July 2024): 109947.
https://doi.org/10.1016/j.exer.2024.109947.
Rosanna C. Campos a,b, Kate Matsunaga c
, Mark W. Reid a
, G. Esteban Fernandez d
,
Kayla Stepanian a
, Sumitha P. Bharathan a,d, Meng Li e
, Matthew E. Thornton f
, Brendan
H. Grubbs f
, Aaron Nagiel a,d,g
a The Vision Center, Department of Surgery, Children’s Hospital Los Angeles, Los
Angeles, CA, USA
b Department of Development, Stem Cells and Regenerative Medicine, Keck School of
Medicine, University of Southern California, Los Angeles, CA, USA
c Keck School of Medicine, University of Southern California, Los Angeles, CA 90033,
USA
d The Saban Research Institute, Children’s Hospital Los Angeles, Los Angeles, CA, USA
e USC Libraries Bioinformatics Services, University of Southern California, Los Angeles,
CA, USA
f Maternal-Fetal Medicine Division, Department of Obstetrics and Gynecology, Keck
School of Medicine, University of Southern California, Los Angeles, CA, USA
g Roski Eye Institute, Department of Ophthalmology, Keck School of Medicine, University
of Southern California, Los Angeles, CA, USA
AUTHORS CONTRIBUTIONS: R.C.C. and A.N. designed research and wrote paper,
R.C.C performed research, K.M. data visualization, G.E.F imaging and analysis, M.W.R.
statistical analysis, K.S. and S.P.B. human retinal organoid culture, M.L. bioinformatics,
M.E.T. and B.H.G. provided human fetal tissue. A.N. project supervisor and funding
acquisition.

89
ACKNOWLEDGMENTS: We acknowledge the CHLA Saban Research Institute Stem
Cell Analytics Core and Cellular Imaging Core for providing key instrumentation and
personnel to support this work. We also acknowledge Yibu Chen at the USC Libraries
Bioinformatics Service for assistance with Partek Flow data analysis. We thank Angela
Ferrario and Patricia Galvan for their technical assistance. We thank Dr. David Cobrinik
and lab members for their significant contributions during the review process. We thank
Melissa Wilson (Department of Preventive Medicine, University of Southern California)
and Family Planning Associates for coordinating tissue collection.

Abstract (if available)

Abstract The non-canonical Wnt pathway is an evolutionarily conserved pathway essential for tissue patterning and development across species and tissues. In mammals, this pathway plays a role in neuronal migration, dendritogenesis, axon growth, and synapse formation. However, its role in the development and synaptogenesis of the human retina remains less established. To address this knowledge gap, we analyzed publicly available single-cell RNA sequencing (scRNAseq) datasets for mouse retina, human retina, and human retinal organoids over multiple developmental time points during outer retinal maturation. We identified ligands, receptors, and mediator genes with a putative role in retinal development, including those with novel or species-specific expression. We validated this expression using fluorescent in situ hybridization (FISH). By quantifying outer nuclear layer (ONL) versus inner nuclear layer (INL) expression, we provide evidence for the differential expression of specific non-canonical Wnt signaling components in the developing mouse and human retina during outer plexiform layer (OPL) development. Importantly, we identified distinct expression patterns of mouse and human FZD3 and WNT10A and previously undescribed expression, such as for mouse Wnt2b in Chat+ starburst amacrine cells. Human retinal organoids largely recapitulated the human non-canonical Wnt pathway expression. Together, this work provides the basis for further study of non-canonical Wnt signaling in mouse and human retinal development and synaptogenesis.

Linked assets

University of Southern California Dissertations and Theses

Conceptually similar

PDF

Generation and long-term culture of human cerebellar organoids to study development and disease.

PDF

The role of Wnt signaling in organogenesis: limb and lung

Asset Metadata

Creator Campos, Rosanna Calderon (author)

Core Title Cross-species comparison of non-canonical Wnt signaling in the developing retina

School Keck School of Medicine

Degree Doctor of Philosophy

Degree Program Development, Stem Cells and Regenerative Medicine

Degree Conferral Date 2024-08

Publication Date 08/29/2024

Defense Date 08/29/2024

Publisher Los Angeles, California (original), University of Southern California (original), University of Southern California. Libraries (digital)

Tag Cre,CRISPR,Fzd3,human retinal organoids,in situ hybridization,iPSC,LoxP,non-canonical Wnt,OAI-PMH Harvest,Vangl2,Wn2b,Wnt10a

Format theses (aat)

Language English

Contributor Electronically uploaded by the author (provenance)

Advisor Quadrato, Giorgia (committee chair), Gnedeva, Ksenia (committee member), Lien, Ching Ling (committee member), Nagiel, Aaron (committee member)

Creator Email cald942@usc.edu,rosannaccampos@gmail.com

Permanent Link (DOI) https://doi.org/10.25549/usctheses-oUC113999ZHI

Unique identifier UC113999ZHI

Identifier etd-CamposRosa-13450.pdf (filename)

Legacy Identifier etd-CamposRosa-13450

Document Type Dissertation

Format theses (aat)

Rights Campos, Rosanna Calderon

Internet Media Type application/pdf

Type texts

Source 20240830-usctheses-batch-1204 (batch), University of Southern California (contributing entity), University of Southern California Dissertations and Theses (collection)

Access Conditions The author retains rights to his/her dissertation, thesis or other graduate work according to U.S. copyright law. Electronic access is being provided by the USC Libraries in agreement with the author, as the original true and official version of the work, but does not grant the reader permission to use the work if the desired use is covered by copyright. It is the author, as rights holder, who must provide use permission if such use is covered by copyright.

Repository Name University of Southern California Digital Library

Repository Location USC Digital Library, University of Southern California, University Park Campus MC 2810, 3434 South Grand Avenue, 2nd Floor, Los Angeles, California 90089-2810, USA

Repository Email cisadmin@lib.usc.edu