University of Southern California Dissertations and Theses

Investigating sodium butyrate as a potential treatment for alcohol liver disease through the gut-liver axis

(USC Thesis Other)

Investigating sodium butyrate as a potential treatment for alcohol liver disease through the gut-liver axis

PDF

Download a page range

Download transcript

Copy asset link

Request this asset

Transcript (if available)

Content INVESTIGATING SODIUM BUTYRATE AS A POTENTIAL TREATMENT FOR ALCOHOL
LIVER DISEASE THROUGH THE GUT-LIVER AXIS
by
Alex Tzuchuan Tai
A Thesis Presented to the
FACULTY OF THE USC MANN SCHOOL OF PHARMACY
UNIVERSITY OF SOUTHERN CALIFORNIA
In Partial Fulfillment of the
Requirements for the Degree
MASTER OF SCIENCE
(CLINICAL AND EXPERIMENTAL THERAPEUTICS)
August 2024

ii
Acknowledgments
I would first like to thank my principal investigator for the past 18 months, Dr. Liana Asatryan,
for the continuous moral support, research advice, and academic guidance as I worked towards
completing the thesis. Throughout my time in the lab, I not only learned a lot about conducting
preclinical pharmacology research but also matured in my critical thinking, and I owe Dr.
Asatryan for that.
I would also like to express my gratitude to my master’s committee, which in addition to my
principal investigator includes Dr. Stan Louie and Dr. Daryl Davies. I am grateful for their words
of affirmation as well as constructive criticism.
Furthermore, I would like to acknowledge my lab mates, Greg Havton, Surabhi Vasisht, Nane
Kaymakamian, and Gwyneth Do for not only their assistance during bench work and animal
studies but also their guidance on concepts I was unfamiliar with.
I would also like to thank my parents, Dyson Tai and Amber Chen, as well as my brother Ian Tai
for their persistent faith in me to complete my master’s degree. Thank you for the supportive
messages and weekly checkups.
Last but not least, I would like to express my sincere gratitude to my girlfriend, Jessica Lei, for
the constant love and support you have given me throughout the years. It has not gone unnoticed
as it means so much to me.

iii
Table of Contents
Acknowledgments............................................................................................................................ i
List of Tables................................................................................................................................... v
List of Figures................................................................................................................................ vi
Abbreviations............................................................................................................................... viii
Abstract.......................................................................................................................................... ix
Chapter 1: Introduction....................................................................................................................1
Epidemiology of Alcohol Use Disorder.........................................................................1
Prevalence and Progression of Alcohol Liver Disease .................................................2
Mechanism of Alcohol Hepatitis: Leaky Gut and Macrophage Activation...................3
Current Treatment for Alcohol Hepatitis ......................................................................7
Novel Approaches to Alcohol Hepatitis Treatment: Modulation of Gut Bacteria
Composition to Reduce Gut Permeability and Inflammation........................................8
Short-Chain Fatty Acids (SCFAs): Production, Transport, and Absorption
Mechanisms in the Gut Microbiota ...............................................................................9
Butyrate: Anti-Inflammatory Properties and Intestinal Barrier Preservation .............11
Chapter 2: Hypothesis....................................................................................................................15
Chapter 3: Methods........................................................................................................................17
Animal Study ..............................................................................................................17
Sample Collections ......................................................................................................19
Protein Concentration Determination .........................................................................19
Blood Ethanol Concentration (BEC) ..........................................................................20
Triglyceride (TG) Level...............................................................................................21
Reverse Transcription-Quantitative Polymerase Chain Reaction (RT-qPCR).............22
Data Analyses...............................................................................................................24
Chapter 4: Results..........................................................................................................................27
Intake of Sodium Butyrate (SB) Solution Was Higher Compared to Water Intake.....27
SB Supplementation Did Not Reduce Ethanol Intake in Mice....................................28
Reduced Ethanol Preference seen in SB Supplementation..........................................30
SB Supplementation Yielded Slight Decreases in Blood Ethanol Concentration
Measured Upon Completion of Study .........................................................................32
Intermittent Two-Bottle Choice (2BC) Ethanol Consumption Did Not Modulate
Liver Weight and Triglyceride Levels as Prevention SB Group Only Had Slight
Reductions....................................................................................................................33
SB Supplementation Significantly Modulated M2 Macrophage Activation,
Highlighting a Shift Towards Anti-Inflammatory Macrophage Polarization ..............34
No Significant Change in M1 Macrophage-Stimulating TLR4 and
Pro-Inflammatory Factors with SB Supplementation..................................................35

iv
SB Supplementation Did Not Yield Significant Changes in Anti-Inflammatory
Cytokines Secreted from M2 Phenotype Macrophages...............................................37
Chapter 5: Discussion ...................................................................................................................39
Effect of SB Supplementation on Liquid Intake..........................................................39
Effect of SB Supplementation on Hepatosteatosis ......................................................40
Effect of SB Supplementation on mRNA Expression of M1 and M2 Macrophage
Phenotype Markers ......................................................................................................41
Effect of SB Supplementation on M1 Macrophage Stimulus TLR4, M1-Secreted
Pro-Inflammatory Factors, and M2-Secreted Anti-Inflammatory Cytokines..............44
Chapter 6: Conclusion....................................................................................................................47
References......................................................................................................................................49

v
List of Tables
Table 1: 2BC Study Design. Weekly study schedule indicating the two bottles in each group.....18
Table 2: The volumes of premix and water required for each of the four ethanol standards. .......21
Table 3: The volumes of standard and water required for each of the four TG standards. ...........21
Table 4: The forward and reverse mRNA sequences of the target primers used in this study.......24

vi
List of Figures
Figure 1: Size of standard drinks for different alcoholic beverages. The higher the alcohol
content, the lower the volume in a beverage’s standard drink.........................................................2
Figure 2: Spectrum of ALD progression from steatosis, prevalent among most heavy
drinkers to cirrhosis and carcinoma. ................................................................................................3
Figure 3: A damaged intestinal barrier allows LPS to seep through and reach the liver via
circulation before activating KCs to generate ROS and inflammatory response. ...........................5
Figure 4: Markers, secreted cytokines, and mechanisms of macrophage phenotypes.
Polarization of pro-inflammation and anti-inflammation phenotypes are between M1 and
M2a. .................................................................................................................................................6
Figure 5: Shifts in macrophage polarization in the context of ALD innate immune response
centered around inflammation. ........................................................................................................6
Figure 6: The molecular structures of the main SCFAs found in the gut. .....................................10
Figure 7: With the upregulation of butyrate, mucin production from goblet cells is increased,
helping limit intestinal permeability induced by dysbiosis............................................................12
Figure 8: Non-ethanol liquid intake throughout the study. (A) Both prevention and reversible
SB treatment groups registered higher weekly SB intake than water intake in the no SB
group. (B) Overall liquid intake combining all the weeks saw higher SB intake in SB1 and
SB2 groups compared to no SB’s water consumption...................................................................28
Figure 9: Ethanol intake throughout the study. (A) Prevention SB treatment saw more weekly
ethanol intake and reversible SB treatment did not yield statistically significant differences in
intake when compared to the control group. (B) When it came to overall EtOH intake, SB1’s
consumption was significantly more than both no SB and SB2, with SB2 only having
minimally lower intake than no SB. ..............................................................................................30
Figure 10: Ethanol preference throughout the study. (A) Both SB treatments were able to
present lower weekly ethanol preference compared to the control group. (B) As for overall
EtOH preference in 2BC, both SB groups also had significantly less EtOH preference, with
SB2 subjects having a larger decrease relative to no SB. ..............................................................31
Figure 11: BEC measured at the end of study. Although both SB groups had lower BEC than
the no SB group, the differences were not statistically significant................................................32
Figure 12: Liver weights and triglyceride concentrations measured at the end of the study.
(A) Although there was variation in liver weight among the four 2BC study groups, liver
weights were only significantly different between SB1 and SB2 groups. (B) There was no
significant variation found in liver TG concentration among the groups, but SB1 had visibly
reduced TG levels. .........................................................................................................................34

vii
Figure 13: Expression levels of macrophage biomarkers. (A) Despite slight decreases in
CD68 expression in both SB groups compared to no SB, no significant variation in
expression level was found. (B) SB1 had significantly higher CD206 expression than no SB,
with SB2 having a noticeably higher expression level as well. (C) The SB1 group also had a
significantly higher CD68 to CD206 ratio than the no SB group, indicating increased M2
polarization due to SB treatment....................................................................................................35
Figure 14: Expression levels of pro-inflammatory activator and factors pertaining to M1
macrophage polarization. (A) Both SB1 and SB2 groups saw a slight decrease in TLR4
expression compared to no SB, but the differences were not statistically significant. In
addition, there were no significant variations in expression levels of pro-inflammatory factors
(B) IL-1b, (C) IL-6, (D) MCP-1, and (E) CCR2 among the four 2BC study groups as SB
treatment did not seem to meaningfully downregulate any expression.........................................37
Figure 15: Expression levels of anti-inflammatory cytokines released through M2
macrophage polarization. Despite minimally higher expression of anti-inflammatory
cytokines (A) IL-10 and (B) TGF-b in SB1 and SB2 groups relative to no SB, there appeared
to be no significant variation in expression levels among the groups as SB treatment failed to
induce an anti-inflammatory response...........................................................................................38

viii
Abbreviations
ALD: Alcohol Liver Disease
AUD: Alcohol Use Disorder
BEC: Blood Ethanol Concentration
CBT: Cognitive Behavioral Therapy
CCR2: C-C Chemokine Receptor 2
CD68: Cluster of Differentiation 68
DiD: Drinking in the Dark
GI: Gastrointestinal
IL-1b: Interleukin-1b
iNOS: Inducible Nitric Oxide Synthase
MCP-1: Monocyte Chemoattractant Protein-1
NF-kB: Nuclear Factor-kB
LPS: Lipopolysaccharides
LT: Liver Transplantation
PAMPs: Pathogenic-Associated Molecular Patterns
SB: Sodium Butyrate
SCFA: Short-Chain Fatty Acid
TG: Triglyceride
TGF-b: Transforming Growth Factor-b
TLR4: Toll-Like Receptor 4
TNF-a: Tumor Necrosis Factor-a
2BC: Two-Bottle Choice

ix
Abstract
Alcohol use disorder (AUD), characterized by the inability to regulate alcohol intake, claims
millions of lives annually. The economic burden associated with AUD is estimated to be $249
billion, with healthcare costs alone comprising $28 billion. Among its many clinical
manifestations, alcohol liver disease (ALD) is one of the most prominent and inflicts the most
mortalities. The initial event in ALD is hepatic steatosis before progressing into alcohol hepatitis.
One factor leading to hepatic inflammation is the increased transfer of endotoxin across the
intestines due to alcohol-associated leaky gut. In addition, alcohol has anti-bacterial activity and
can alter gut microbiota, contributing to the metabolism of important metabolic precursors. The
scope of this work is to determine the potential of butyrate, a short-chain fatty acid (SCFA)
produced by gut microbiota with beneficial properties, to treat AUD and ALD. In this study, we
tested the effects of sodium butyrate (SB) on alcohol-induced changes in the liver (i.e. steatosis,
inflammatory response) with C57BL/6J adult male mice using an intermittent two-bottle choice
(2BC) ethanol exposure paradigm. SB was provided in bottles at 8 mg/ml from the beginning of
2BC (prevention group) and after 2 weeks of 2BC (reversible group). SB supplementation in
both groups reduced overall ethanol preference and increased non-ethanol liquid intake. The
ethanol paradigm did not induce hepatic steatosis, which SB supplementation did not further
modulate. There were no substantial changes in mRNA expression of pro- and anti-inflammatory
factors in the liver quantified by reverse transcriptase quantitative polymerase chain reaction
(RT-qPCR). However, SB’s effect on macrophage markers highlighted a shift towards antiinflammatory M2 polarization as determined through CD68/CD206 ratios. These findings
validated the beneficial effect of SB on AUD-associated drinking behavior, but ethanol exposure
preclinical models need to be optimized to further evaluate its therapeutic effect on liver health.

1
Chapter 1: Introduction
Epidemiology of Alcohol-Use Disorder
Alcohol Use Disorder (AUD) is an addictive condition characterized by consistent, strong
cravings for alcohol, leading to high levels of compulsive use over an extended period. Clinical
symptoms include anxiety, nausea, and delirium occurring during alcohol withdrawal. Long-term
effects of alcohol addiction include cognitive impairment and gut dysbiosis1
. In 2014 alone, the
World Health Organization (WHO) reported that 3.3 million people worldwide died from AUD,
which is 6% of all global deaths2
. Within the United States, there were 88,000 alcohol-associated
deaths between 2006 and 2010, accounting for nearly 1 in 10 nationwide mortalities over the
time span3
. The disorder also has negative consequences on the economy as well, as alcohol
overconsumption cost the US $249 billion in 2010, with a healthcare burden of $28 billion and
$179 billion in lost work productivity4
.
The driving factor in people with AUD is their alcohol consumption matching or surpassing
binge drinking levels. Binge drinking is classified by the National Institute of Alcoholism and
Alcohol Abuse (NIAAA) as four or more standard drinks (0.6 oz of ethanol) over two hours for
women and five or more for men, while five or more binge drinking days within a month
constitutes as heavy drinking2,3
. Examples of a standard drink volume in different alcoholic
beverages are shown in Figure 1. In the US, more than one in four adults reported at least one
binge drinking episode, and more than one in 20 adults reported heavy drinking habits3
. This has
led to the country having an annual AUD prevalence rate of 13.9% and a lifetime prevalence rate
of 29.1%5
.

2
Figure 1: Size of standard drinks for different alcoholic beverages. The higher the alcohol content, the
lower the volume in a beverage’s standard drink6
.
Prevalence and Progression of Alcohol Liver Disease
Within AUD, there is also a subset of over 60 notable conditions, with alcohol liver disease
(ALD) responsible for most AUD-associated mortalities7
. ALD comprises of a wide range of
issues from hepatosteatosis and progressing to more severe symptoms as summarized in Figure 2
like hepatitis, fibrosis, cirrhosis, and hepatocellular carcinoma (HCC) development that occur
because of heavy alcohol consumption6
. Steatosis, or fat accumulation in the form of
unprocessed lipid droplets, is very common among binge drinkers as it has a near-universal
clinical manifestation with a prevalence of more than 90%7
. Chronic alcohol intake not only
converts the liver from an organ that utilizes lipids to one that stores it through ethanol oxidation.
Paradoxically, ALD also accelerates the breakdown of fat stored in adipose tissue into free fatty
acids, which are absorbed by the liver and esterified into triglycerides, further worsening existing
steatosis6
. Steatosis can then further progress into steatohepatitis where bacteria-derived
endotoxins transiting from the gut lumen and crossing an increasingly permeable intestinal
lining. The endotoxins eventually reach the liver where they activate macrophages into secreting
pro-inflammatory cytokines10. Hepatic inflammation is less common but still significantly
prevalent with it being present in 30-40% of people chronically abusing alcohol, and it is much

3
more serious than steatosis as hepatitis has a high short-term mortality rate of up to 60% with no
treatment or other interventions6,7. Meanwhile, cirrhosis, the severe scarring of the liver, is
present in around 15% of ALD patients and is the stage where the structure of the tissue is
severely damaged with bridging fibrosis and regenerating nodules as ALD progression starts to
become irreversible even if the patient practices abstinence7
.
Figure 2: Spectrum of ALD progression from steatosis, prevalent among most heavy drinkers to cirrhosis
and carcinoma6
.
Mechanisms of Alcohol Hepatitis: Leaky Gut and Macrophage Activation
The second step of ALD progression is where patients begin presenting widespread inflammation
in the liver largely stemming from intestinal dysfunction and its consequences. In this stage,
hepatocytes begin to swell up and start to degenerate as patients begin to exhibit physical
symptoms such as weight loss, malnutrition, and jaundice7
. In the gastrointestinal (GI) tract,
heavy alcohol consumption can increase the abundance of pathogenic gram-negative bacteria
such as Enterobacteriaceae that produce endotoxin while lowering the abundance of short-chain
fatty acid (SCFA)-producing and anti-inflammatory bacteria such as Lachnospiraceae and
Faecalibacterium respectively to generate dysbiosis2,9. The high alcohol content level in the gut
increases secondary bile acid concentrations, which directly correlates with the severity of

4
intestinal permeability as tight junction proteins become impaired. As a result, increased levels of
gram-negative bacteria levels result in a large concentration of lipopolysaccharides (LPS) to
permeate the porous intestinal lining and seep into blood circulation10.
When endotoxins traverse across the intestinal barrier and make their way to the liver via the
lymphatic system and portal circulation, they can induce hepatic inflammation10. This
relationship between the gut and liver making it possible for gut dysbiosis to trigger significant
physiological changes in the liver is what is known as the gut-liver axis. Endotoxins are potent
pathogenic-associated molecular patterns (PAMPs) capable of activating toll-like receptors
(TLRs) and NOD-like receptors (NLRs) found on the resident liver macrophage Kupffer cells as
depicted in Figure 3, inducing an innate immune response8
. In addition to macrophages
endogenous to the liver like Kupffer cells that are the first to respond to PAMP activation of
pathogenic recognition receptors (PRRs), monocytes can be also recruited from the bone marrow
and differentiate into circulating macrophages8
. ALD-associated leaky gut enhances gramnegative bacteria-derived LPS, which can induce liver inflammation. LPS is one of the most
potent TLR-stimulators, binding to toll-like receptor 4 (TLR4) specifically and leading to
monocyte activation10. After LPS binds to TLR4, a signaling cascade is triggered where proinflammatory transcription factor nuclear factor-kB (NF-kB) is activated and initiates the
production of pro-inflammatory cytokines and other factors (i.e. interleukin-1β (IL-1β),
interleukin-6 (IL-6), tumor necrosis factor- � (TNF-�)
8,10.

5
Figure 3: A damaged intestinal barrier allows LPS to seep through and reach the liver via circulation
before activating KCs to generate ROS and inflammatory response10.
The mechanism of alcohol-induced inflammation is primarily driven by macrophage polarization
during activation. When its TLR4s are activated by LPS, Kupffer cells differentiate into either
M1 or M2 phenotypes depending on the hepatic microenvironment dictated by the specific
pathogen and disease state as depicted in Figure 511. In alcohol leaky gut-driven hepatitis, when
LPS as a PAMP is detected by TLR4, NF-κB is activated and pro-inflammatory gene
transcription is promoted to induce M1 polarization in which the macrophages are programmed
to produce pro-inflammatory cytokines listed in Figure 4 and chemokines (ie. C-C chemokine
ligand 2 (CCL2), CCL20, monocyte chemoattractant protein-1 (MCP-1))11,12. On the other hand,
if anti-inflammatory cytokines interleukin-4 and -13 (IL-4, IL-13) are upregulated and enough
dead cells are accumulated, macrophages may start shifting to the M2 phenotype and secrete
more anti-inflammatory factors like interleukin-10 (IL-10), transforming growth factor-β (TGFβ), and other factors listed in Figure 4 to resolve hepatic inflammation12,13.

6
Figure 4: Markers, secreted cytokines, and mechanisms of macrophage phenotypes. Polarization of proinflammation and anti-inflammation phenotypes are between M1 and M2a12.
Figure 5: Shifts in macrophage polarization in the context of ALD innate immune response centered
around inflammation11.

7
Current Treatments for Alcohol Hepatitis
The first line and most effective intervention for ALD is alcohol abstinence as it is emphasized in
all stages of ALD. The lack of alcohol exposure can potentially reverse alcohol-associated
hepatic changes7
. Although lower consumption of and reduced dependence on alcohol is not the
main endpoint desired in treatment, practicing abstinence can increase blood flow in the liver and
decrease the chances of rebleeding in the organ. Cessation of alcohol consumption can not only
reverse steatosis but also lower mortality among cirrhotic patients, whose five-year mortality rate
decreases to 10% compared to 30% in their counterparts who continue drinking6,7. More
importantly, in patients with alcohol hepatitis where the prognoses are the bleakest, the mortality
rate has been shown to decrease by up to 50% when patients cease alcohol consumption2
. To
effectively implement abstinence and lower the probability of relapsing, psychotherapies such as
cognitive behavioral therapy (CBT) are conducted where risk factors for drinking are identified
and self-control is promoted7
. Changes in lifestyle such as in diet and fitness can help as well,
especially when supervised by a medical professional6
. In addition, disulfiram, naltrexone, and
acamprosate are FDA-approved drugs that are also designed to treat alcohol dependence by
targeting alcohol metabolism or aspects of neurotransmission, but these therapeutics do not
alleviate existing liver inflammation of patients in any way.
Currently, no approved medication has ALD as its main indication, but among existing drug
treatments, the two well-established options are corticosteroids and pentoxifylline, as both are
used to target alcoholic hepatitis. Prednisolone is the corticosteroid extensively used for ALD as
it is intended to target the hepatic immune system to suppress pro-inflammatory responses7
.
However, studies evaluating the drug’s effectiveness in lowering mortality rates or even
improving short-term survival have yielded varied conclusions ranging from some improvement

8
to none at all, making it a controversial therapeutic. On the other hand, pentoxifylline is a
phosphodiesterase inhibitor that can inhibit TNF-�, which can help limit further hepatic
inflammation seen in ALD7
. Renal function of ALD patients in cirrhosis has been shown to
improve, but increased survival rates of ALD are not conclusions presented in all the studies
investigating this drug, with no consensus on its effectiveness.
Novel Approaches to Alcohol Hepatitis Treatment: Modulation of Gut Bacteria
Composition to Reduce Gut Permeability and Inflammation
Research into new pathways to target ALD is imperative as many of these patients will not be
eligible for liver transplantation (LT) if their hepatitis progresses further to cirrhosis, which
occurs in two-thirds of patients already presenting hepatic inflammation7
. This is due to the
perception that ALD is a self-inflicted condition as many medical professionals view the scarce
supply of donor organs better suited for other diseases like end-stage liver disease (ESLD).
Furthermore, rates of recidivism in resuming binge drinking post-transplantation is a concern as
12-46% of ALD patients who had LT continued consuming alcohol post-transplantation7
.
A key target for multiple studies is the origin of hepatitis, gut dysbiosis, to help preserve the
intestinal barrier and to prevent inducing leaky gut. In in vivo studies, preserving intestinal
barrier integrity has been shown to improve hepatic injuries associated with alcohol, highlighting
the potential of using probiotics to alleviate dysbiosis-induced hepatitis9
. The modulation of the
abundance of certain taxa in the gut microbiome can reduce both inflammation and GI barrier
permeability. In multiple mouse models, treatments administering Akkermansia muciniphilia and
Lactobacillus rhamnosus GG have been shown to alleviate alcohol-induced complications in
both the gut and liver2
. The abundance of A. muciniphilia decreases in the presence of alcohol
hepatitis. However, the introduction of L. rhamnosus GG appears to reverse alcohol-associated

9
intestinal permeability in previous rodent studies7
. However, this specific treatment involving
both bacteria and probiotic therapy in general remains to be tested extensively in a clinical
setting to treat dysbiosis, leaky gut, or hepatic inflammation. In one of the few clinical studies on
ALD treatment targeting the gut microbiota, the introduction of the probiotic strain Lactobacillus
casei Shirota was evaluated in an open-label study in patients with confirmed cirrhosis2
.
Treatment with Lactobacillus casei Shirota attenuated LPS- and TLR-activated immune
responses in the liver, indicating reduced hepatic inflammation. However, this study did not
investigate changes in the gut microbiota, so the therapeutic mechanism was not completely
characterized.
In addition to conventional probiotic treatments, Fecal microbiota transplantation (FMT) has
been tested as a reliable way to improve the biodiversity of the GI tract. This approach involves
having healthy donor stool administered to the gut microbiota of the ALD patient via intragastric
injection, and it has displayed the therapeutic effect in partially reversing dysbiosis by improving
SCFA production8
. In an open-label study with eight alcohol hepatitis patients, the treatment
group receiving FMT had a significantly higher 1-year survival rate of 87.5% compared to
33.5% in the control group2,10.
Short-Chain Fatty Acids (SCFAs): Production, Transport, and Absorption Mechanisms in
the Gut Microbiota
SCFAs are primary metabolites of dietary fiber and resistant starches that have undergone
bacterial fermentation in the colon14. Outside of fermentation of bacteria in the gut microbiota,
SCFAs can also be produced by fermentation of various amino acids and proteins as well as be
found in animal fat, plant oil, and even butter16. The chemical structure of SCFAs consists of

10
anywhere from one to six carbon atoms in an aliphatic tail along with a carboxylic acid
functional group17.
Acetate, propionate, and butyrate, whose molecular structures are provided in Figure 6, make up
90% of SCFAs produced in the GI tract at a 60:25:15 molar ratio of production, with other
SCFAs such as formate and valerate present at significantly lower abundances15,17. Acetate is
produced from pyruvate by most enteric bacteria such as A. municiphilia, Bacteroides spp., and
Bifidobacterium spp., utilizing both acetyl-CoA and Wood-Ljundahl pathways17. As for
propionate, phosphoenolpyruvate (PEP), amino acids, and carbohydrates are some originating
substrates, and the SCFA subtype is produced from bacteria in the Bacteroidetes and multiple
Firmicutes families through the succinate and acrylate pathways16,17. Meanwhile, butyrate can be
produced from acetate, lactate, and butyrate-phosphate with the phosphotransbutyrylase and
butyrate kinase pathways, and the bacteria involved in its production include Lachnospiraceae
and other families in the Clostridiales order16.17. The combined SCFA concentration in the colon
is in the range of 50-150 mM, but the concentration is higher in the distal end (70-140 mM) and
becomes progressively lower until it is the lowest in the distal end (20-70 mM)16.17. The source
of the bacterial substrate, location of substrate fermentation, gut microbiota composition, and
colonic pH are some of the factors impacting SCFA production15.
Figure 6: The molecular structures of the main SCFAs found in the gut15.

11
After being produced in the colon, over 90% of SCFAs are absorbed by colonocytes and the liver
where much of it is subsequently metabolized15. Because they are weak acids, much of the
SCFAs are in their ionized forms in the colon, which has a pH range of 5.5 to 6.716. As a result,
subtypes of H+- and sodium-dependent monocarboxylate transporters (MCTs and SMCTs) are
used to facilitate proper absorption of the metabolites14. MCT1, SMCT1, and SLC26A3 are nonspecific and have affinity for all three prominent SCFAs while SMCT2 is butyrate-specific16. All
of the listed transporters are present in both the colon and intestine except SLC26A3, which is
exclusive to the colon16.
When transporters carry SCFAs to the small intestine, three G protein-coupled receptors (GPRs)
are present for the metabolites to bind to: GPR41 (free fatty acid receptor 3, FFAR3), GPR43
(free fatty acid receptor 2, FFAR2), and GPR109a (hydrocarboxylic acid receptor 2, HCAR2)17.
GPR 41 and 43 have non-specific SCFA binding, while GPR109a only has an affinity for
butyrate16. When binding to GPRs, SCFAs will induce multiple signaling pathways such as
regulating cyclo-adenosine monophosphate (cAMP) production as well as inhibiting protein
kinase A and mitogen-activated protein kinases (ERK) activation to exert their influence on
various systemic functions16,17.
Butyrate: Anti-Inflammatory Properties and Intestinal Barrier Preservation
Butyrate or butyric acid is the third most prevalent SCFA present in the gut, consisting of four
carbons with a signature carboxylic acid functional group. As an SCFA it holds crucial functions
in the intestine including but not limited to anti-inflammatory effects and intestinal lining
protection15. Because of their prominent role in the gut microbiota, the bioactivities of butyrate
and other SCFAs have been the subject of much research to treat a multitude of diseases to
establish their mechanisms of action.

12
A key aspect of butyrate function is its ability to protect the intestinal barrier, resolving cases of
leaky gut. SCFAs play their part in keeping gut permeability low by maintaining proper
expression of tight junction proteins like occluding, claudin, and zonulin,17. Butyrate is the most
important tight junction regulator by upregulating relevant encoding genes such as claudin-1 and
zonal occludens-1 (ZO-1) as well as ensuring adequate distribution of occluding17. In addition,
butyrate facilitates the secretion of mucins that form the epithelial-mucosal barrier, a loose layer
surrounding the intestinal lining, that acts as another physical barricade against possible bacteria
and their components permeating in and out of the gut18. Mice who were administered with
2,4,6-trinitrobenzene sulfonic acid (TNBS) to replicate inflammatory bowel disease saw a partial
recovery of claudin-1, ZO-1, occludin, and mucin-2 (MUC2) when treated with SB as depicted
in Figure 7, indicating a restoration of intestinal permeability19. By maintaining intestinal barrier
integrity, less LPS will be able to seep into the portal vein, where it can eventually bind to
TLR4s, activating KCs and triggering pro-inflammatory M1 macrophage differentiation2,10.
Figure 7: With the upregulation of butyrate, mucin production from goblet cells is increased, helping
limit intestinal permeability induced by dysbiosis18.
In addition to inhibiting inflammation by treating leaky gut, butyrate can also directly influence
inflammatory responses. Butyrate is able to alleviate inflammation by upregulatimg of anti-

13
inflammatory cytokines and other mediators and the downregulating pro-inflammatory ones
through multiple pathways14. When binding to its receptor GPR41 on macrophages, butyrate can
inhibit the secretion of pro-inflammatory cytokines MCP-1, IL-6, and TNF-�17. In addition,
butyrate’s well-established inhibition of histone deacetylase (HDAC), which allows for DNA to
be bound tighter, suppresses the production of IL-6 and IL-12 by macrophages in the gut
microbiota18. As for anti-inflammatory mediators, butyrate facilitates the production of TGF- β in
intestinal epithelial cells (IEC) and upregulate anti-inflammatory T-cells (Treg)16. Within
macrophages, the mammalian target of rapamycin (mTOR) normally regulates cell proliferation
autophagy, and apoptosis, but when upregulated by certain bacteria it can increase the secretion
of IL-6, IL-12, and TNF-� while decreasing anti-inflammatory cytokine IL-1018. However, the
introduction of butyrate can inhibit mTOR activity and reverse the change in expression of both
pro- and anti-inflammatory cytokines mentioned18.
Although much of the mechanisms in which butyrate and other SCFAs affect macrophages
inducing anti-inflammatory responses is established in the gut, there have been studies that also
have determined the same induced responses in areas other than the gut microbiota. For example,
butyrate and propionate treatment on human mononuclear cells and neutrophils have been shown
to decrease NF-kB upregulation of pro-inflammatory mediator-encoded genes via HDAC
inhibition17. In addition, dendritic cells when treated with butyrate from human donors saw an
increase in IL-10 production as well as lower expression of antigens possibly inducing
inflammation16. Butyrate-treated dendritic cells have also been shown to stimulate macrophage
polarization towards M2 over M116. Supplementation of butyrate in its anionic form through SB
has also been concluded to have decreased multiple pro-inflammatory cytokines in the brain,

14
indicating it may have prevented neuroinflammatory responses induced by both antibiotic
treatment modeling dysbiosis and ethanol consumption20.
Because of their biological effects on the gut microbiota and potential to modulate key
mechanisms beyond the intestine, direct supplementation of SCFAs, namely butyrate, has been
touted as an approach to resolving ALD-associated leaky gut. With its ability to uphold the
integrity of the intestinal lining established, there is further potential for butyrate to directly
inhibit inflammation by reversing M1 macrophage polarization towards M2. This train of
thought is validated by butyrate’s success in driving down neuroinflammation by treating leaky
gut and preventing alcohol from further exploiting the gut-brain axis like it can with the gut-liver
axis.

15
Chapter 2: Hypothesis
Chronic consumption of alcohol has been shown to affect the gut microbiota by inducing
dysbiosis with LPS-elaborating bacterial overgrowth. This type of damage to the GI tract often
leads to an increase in intestinal barrier permeability, eventually causing the release of endotoxin
into the bloodstream21. LPS can then trigger an innate immune response as it makes its way from
circulation to critical organs like the liver, where the release of pro-inflammatory mediators
causes significant damage and compromises function. This inflammatory effect seen in the liver
is made possible by the gut-liver axis and is part of the larger response to alcohol known as ALD
consisting of other processes like steatosis and cirrhosis22.
LPS-induced inflammatory responses in the liver occur through the mechanism of macrophage
polarization. When PAMPs like LPS reach the liver via circulation, they activate Kupffer cells
via binding onto TLR4. Once activated, the main liver macrophage differentiates into the M1
phenotype, which triggers the production of various pro-inflammatory cytokines and other
factors12. Meanwhile, the M2 phenotype that secretes anti-inflammatory factors is neglected,
preventing the crucial increase in tissue repair, inflammation mitigation, and infection
prevention23.
The hepatitis stage of ALD is attributed to alcohol-mediated gut dysbiosis where there is a
change in the microbiota composition, including a shift in metabolite concentration. One
metabolite type of interest is SCFAs such as butyrate, acetate, and propionate derived from the
bacterial fermentation of dietary fibers in the colon21. Mice studies modeling dysbiosis exhibited
a decrease in butyrate-producing bacteria, indicating a reduction in butyrate concentration in a
compromised gut microbiome24. Furthermore, reduced butyrate concentration levels due to

16
ethanol consumption have been confirmed to upregulate neuroinflammation, further increasing
ethanol drinking behavior. The increased presence of neuroinflammation can be attributed to a
leaky gut taking advantage of the gut-brain axis like with the gut-liver axis by allowing more
LPS to permeate into circulation and reach the brain, activating pro-inflammatory cytokines and
chemokines20.
It is evident SCFAs play an essential role in upholding the integrity of the gut epithelial, and as a
result, there have been efforts to positively modulate their abundance in hopes of lowering
intestinal permeability by way of resolving dysbiosis18. Butyrate specifically has been the focus
of in vivo studies by the Asatryan lab investigating its ability to resolve dysbiosis and indirectly
alleviate ALD21,24,19. Recovering reduced butyrate levels can mitigate the consequences of
dysbiosis in the gut by recuperating the integrity of the intestinal barrier by way of accelerating
tight junction protein assembly25. Furthermore, butyrate could control inflammation induced by
leaky gut by indirectly stimulating M2 macrophages over its M1 counterparts by inhibiting the
TLR4/ NF-κB pathway, leading to the increased production of anti-inflammatory markers over
pro-inflammatory ones10. However, it is not clear whether the M1-M2 shift is a mechanism
behind the beneficial effect of butyrate on the liver during chronic alcohol exposure.
The working hypothesis is that leaky gut stemming from dysbiosis can result in liver
inflammation due to the gut-liver axis, and the supplementation of butyrate can help serve as a
potential ALD therapeutic through this pathway. The beneficial anti-inflammatory effect of
butyrate on the liver during chronic alcohol exposure involves inducing a shift from M1 to M2
macrophage phenotype, hence reducing ALD. We tested this hypothesis by supplementing mice
with sodium butyrate (SB), which contains butyrate in its anionic form, in an intermittent ethanol
exposure paradigm.

17
Chapter 3: Methods
Animal Study
Mice and Study Design:
6-8 week-old male C57BL/6J mice (n=45) were used for this study. The animals were singlehoused on a 12-hour light/dark cycle with temperature set at 70 °F and humidity at 37%. The
mice first went through a weeklong acclimation period where subjects were provided food and
water ad libitum from two bottles stimulating two-bottle choice (2BC) with the help of the
Department of Animal Research in the Mudd Memorial Research Building, University of
Southern California Health Sciences Campus.
After that, the 2BC portion of the study commenced in which the mice were initially split into
three different groups: 1) control (n=9), 2) no sodium butyrate (no SB, n=24), and 3) SB1
prevention treatment (n=12). Following the second week of 2BC, half of the ethanol group
switches to SB supplementation to form the 4) SB2 reversible treatment group (n=12). The 2BC
study was conducted for seven weeks in total before necropsy was conducted. The weekly 2BC
study timeline with the two bottles provided to each group is shown in Table 1. All animals in
the study were treated in accordance with the National Institutes of Health Guide for Care and
Use of Laboratory Animals and protocols approved by the USC Institutional Animal Care and
Use Committee.

18
2BC Treatment Schedule
Groups Wk. 1 Wk. 2 Wk. 3 Wk. 4 Wk. 5 Wk. 6 Wk. 7
Control Water
Water
No SB Water Water
5% EtOH 10% EtOH
SB1
(Prevention)
8 mg/mL SB 8 mg/mL SB
5% EtOH
with 8
mg/mL SB
10% EtOH with 8 mg/mL SB
SB2
(Reversible)
Water Water 8 mg/mL SB
5% EtOH 10% EtOH 10% EtOH with 8 mg/mL SB
Table 1: 2BC Study Design. Weekly study schedule indicating the two bottles in each group.
Intermittent Ethanol Consumption and SB Treatment in 2BC:
In each subject’s cages for the 2BC study, there were two bottles present for the mice to drink
from: one with their respective treatment (water or SB) and another with ethanol that may have
had SB or not based on their treatment. The control group had two bottles of water while the no
SB group had one water and one ethanol bottle. As for the two SB groups, they had a bottle with
SB solution, and one with ethanol with SB treatment. The reversible SB treatment group will
have their water and ethanol bottles switched out with SB solution and ethanol with SB bottles
after week 2 of the 2BC. The SB concentration was set at 8 mg/mL for the entire duration of the
study while the ethanol concentration was set at 5% for the first week and then increased to 10%
for the rest of the study.
On Mondays, Wednesdays, and Fridays, two bottles filled with up to 25 mL of their respective
liquids are inserted into each mice’s cage, where they have the choice to drink from either bottle.
Then, on Tuesdays, Thursdays, and Saturdays, the body weights as well as food and two-bottle

19
liquid consumption over the past 24 hours were measured in the mornings before taking out
ethanol bottles and replacing them with water until the next ethanol exposure period.
Sample Collections
Necropsy:
At the end of the seven-week treatment period of the study, the mice were euthanized with a CO2
gas chamber. Collection of blood samples occurred immediately after the mice was sacrificed
followed by the collection of liver samples.
Blood Collection:
Blood samples were taken from each mouse immediately after euthanasia via a cardiac puncture
with a 23-gauge needle attached to a syringe. After dispensing the blood into 1.5 mL tubes, the
samples were left sitting at room temperature for 1-2 hours before they were centrifuged at a
speed of 10,000 rpm for 10 minutes at 4°C. When finished, the top yellowish-clear fluid from the
sample was extracted to get serum and the cellular portion that was left was the plasma.
Liver Collection:
When livers were extracted from the mice post-euthanasia, their weights were first measured on
a scale. The tissue was then cut into five 1 cm pieces before being placed into 1.5 mL tubes/each,
fast frozen on dry ice, and stored at -70°C until further use.
Protein Concentration Determination
The protein concentrations of tissue samples were quantified with Bicinchronic Acid (BCA)
Protein Assay. 200 µL of a working reagent consisting of PierceTM BCA Protein Assay Reagents
A and B (Thermo Fisher Scientific, Rockford, IL) was loaded into each well of a 96-well plate.
Then, 25 µL of Bovine Serum Albumin (BSA) standards and diluted liver samples, which were

20
homogenized by RIPA buffer with protease inhibitor, were pipetted into their respective wells.
Each albumin standard and sample ran as duplicates. Once the reagents, standards, and assays
were loaded, the well plate was incubated at 37 °C for 30 minutes. The well plate was then had
absorbance read at 570 nm in a BioTek Synergy H1 plate reader (Agilent Technologies, Santa
Clara, CA). With the data output, the absorbances of the albumin standards were used to
construct a standard curve, which was used to quantify protein concentration of the liver samples
presented in mg/mL.
Blood Ethanol Concentration (BEC)
Blood ethanol concentration (BEC) measurements of collected serum samples were done
through the EnzyChromTM Ethanol Assay Kit with colorimetric detection (Bioassay Systems,
Hayward, CA). The standards were prepared through serial dilutions of the 1.0% EtOH Standard
according to Table 2. 10 µL of the standards and samples were pipetted into each well in a 96-
well plate where duplicates were run. A working reagent was then prepared for the assay with
Assay Buffer, Enzyme A, Enzyme B, nicotinamide adenine dinucleotide (NAD), and 3-(4,5-
dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide (MTT), with 100 µL of the solution
added into each well. Following a 30 minute incubation period at room temperature, the optical
density (OD) of the well plate was measured at 565 nm with a BioTek Synergy H1 plate reader
(Agilent Technologies, Santa Clara, CA). Ethanol concentration was able to be determined for
each sample by producing a standard curve from the ethanol standards and was presented in
percent ethanol.

21
Table 2: The volumes of premix and water required for each of the four ethanol standards.
Triglyceride (TG) Levels
Liver triglycerides (TG) of collected tissue samples were measured using the EnzyChromTM
Triglyceride Assay Kit (Bioassay Systems, Hayward, CA). Standards were diluted four different
ways with water based on the volumes listed in Table 3, which 10 µL were transferred into each
well of a 96-well plate. Meanwhile, samples were solubilized in 5% Triton X-10 with 10 µL was
loaded into each well also. Both standards and samples ran with duplicates in the assay. A
working reagent was prepared for the assay comprising of Assay Buffer, Enzyme Mix, Lipase,
ATP, and Dye Reagent with 100 µL added into each well. Following a 30 minute incubation at
room temperature, the well plate had its absorbance measured at 570 nm in a BioTek Synergy
H1 plate reader (Agilent Technologies, Santa Clara, CA). Triglyceride level was able to be
determined for each sample by producing a standard curve followed by normalizing over sample
protein concentration calculated from the BCA assay to obtain a concentration presented in
nM/mg protein.
Table 3: The volumes of standard and water required for each of the four TG standards.

22
Reverse Transcription-Quantitative Polymerase Chain Reaction (RT-qPCR)
RNA Extraction:
This RNeasy Mini Kit (QIAGEN, Germantown, MD) was used to homogenize the liver samples
and conduct RNA extraction. 700 µL of a mixture of Buffer RLT and β-mercaptoethanol (BME)
was loaded into each sample for homogenization with the help of the TissueLyser II instrument
(QIAGEN, Germantown, MD). The lysed sample was then centrifuged (10 RCF at 4 °C)
followed by removing the supernatant. An equal volume of 70% ethanol was added to the
supernatant before half of the mixture was loaded into a RNeasy spin column. The sample was
then centrifuged and flowthrough discarded before repeating the step again for the other half of
the mixture.
Then, the spin columns containing the samples’ RNA in their filters underwent wash cycles with
one round of Buffer RW1-ethanol solution (700 µL) and two rounds of Buffer RPE (500 µL
each). In each round of wash, the spin columns filled with their respective reagents were
centrifuged and had their flowthrough discarded. After an additional round of centrifuging with
no reagent to dry the spin columns’ filters, RNase-free water was added to the spin columns to
elute the sample RNA through centrifuging. This was done in two steps: 40 µL of RNase-free
water was eluted followed by 25 µL, producing two RNA samples per liver tissue.
RNA concentrations (ng/uL) were measured using the NanoDrop One instrument (Thermo
Fisher Scientific, Rockford, IL). 1.0 µL for each RNA sample was loaded to measure the
solution’s nucleic acid yield (ng/uL) as well as Absorbance ratios at 260/280 nm and 260/230 nm
were used to determine the RNA/DNA ratio and quantify any impurities respectively. Extracted
RNA samples were stored at -70 °C until cDNA synthesis.

23
cDNA Synthesis:
This reaction was conducted through the RevertAid First Strand cDNA Synthesis Kit (Thermo
Fisher Scientific, Rockford, IL). Utilizing the measured RNA concentrations of each liver
sample, the volumes (μL) needed to obtain 180 ng RNA were calculated. Then, the volumes of
sample RNA were added into a nuclease-free tube along with enough Oligo Primer and nucleasefree water to bring each sample volume to 12 μL.
Then, for each sample, 5x reaction buffer, RiboLock RNase inhibitor, 10 mM dNTP mix, and
RevertAid M-MulV RT (200 U/μL) were added to bring the total volume to 20 μL. Each tube
containing the sample mixture was spun down briefly before incubating in MiniAmp Plus
Thermal Cycler (Applied Biosystems, Waltham, MA) at 42 °C for 60 minutes and heated up to
70 °C for five minutes to terminate the reaction. When finished, the synthesized sample cDNA
was stored at -20 °C until qPCR.
RT-qPCR Analysis:
Multiple master mixes comprised of Fast SYBR Green Master Mix (Applied Biosystems,
Waltham, MA) and 3 μM primer solution (with both forward and reverse primers) were first
made for GAPDH and other primers. The forward and reverse genetic sequences for each target
primer shown in Table 4 were generated from National Center for Biotechnology Information
(NCBI) database, and all primer solutions were order from Integrated DNA Technologies.
Preparing for 15 liver cDNA samples, running duplicates, and including no cDNA template
wells, each master mix should have 185 μL of SYBR green and 37 μL of primer solution. After
that, 13 μL of master mixes and 2 μL of cDNA were pipetted into their respective 0.2 mL
microcentrifuge tubes. These tubes were specific to sample and target primer with the volume to
run duplicates. Then nuclease-free water was loaded into every tube to bring the volume to 22

24
μL. In tubes for the no template (NT) wells, only the master mix and water portions were added
with the sample cDNA omitted.
Solutions with master mix, sample cDNA, and nuclease-free water were pipetted into the
corresponding wells in a 368-well plate. For the no template (NT) wells, their corresponding
master mixes diluted with nuclease-free water were loaded in as well. When finished, the well
plate was covered with transparent and adhesive plastic before it was spun down. The well plate
was then put in the QuantStudio-12K Flex Real-Time PCR instrument (Thermo Fisher Scientific,
Rockford, IL) where the emission intensity (Rn) was measured for 40 reaction cycles to produce
a standard curve. The data readout also included Ct values indicate what reaction cycle did wells
with sample cDNA achieve enough target gene replication to pass the fluorescence threshold
(ΔRn).
Target Forward (5’ to 3’) Reverse (3’ to 5’)
GADPH AGGTCGGTGTGAACGGATTTG TGTAGACCATGTAGTTGAGGTCA
IL-1β TGGACCTTCCAGGATGAGGACA GTTCATCTCGGAGCCTGTAGTG
IL-6 ACAACCACGGCCTTCCCTACTT CACGATTTCCCAGAGAACATGTG
MCP-1 GCAGCAGGTGTCCCAAAGAA ATTTACGGGTCAACTTCACATTCA
TLR4 GAGCAAACAGCAGAGGAAGA CCAGGTGAGCTGTAGCATTTA
CCR2 GGTGGTATACTGAGACACCTTG CCCAAGGAAAGGTAGGTGATAG
IL-10 CCAAGACCAAGGTGTCTACAA GGAGTCCAGCAGACTCAATAC
TGF-β GGTGGTATACTGAGACACCTTG CCCAAGGAAAGGTAGGTGATAG
CD68 CCCACCTGTCTCTCTCATTTC GTATTCCACCGCCATGTAGT
CD206 TCATCCCTGTCTCTGTTCAGC ATGGCACTTAGAGCGTCCAC
Table 4: The forward and reverse mRNA sequences of the target primers used in this study.
Data Analyses
Liquid Intake and Preference:
With the liquid consumption in mL and mice weight in grams collected over the entirety of the
study period, the total liquid intake was calculated by dividing all the individual drinking values
by their respective mice’s body weights with the final unit of measurement being mL/g. The

25
same was done for SB vs. water intake. As for ethanol intake data, its consumption values were
multiplied by ethanol’s density (0.78 g/mL) and the percent ethanol concentration administered
before being divided by the body weight in kg. Ethanol preference was determined by taking the
percentage of ethanol consumption as part of total consumption, which could be done without
any unit conversion from the raw data.
Measurements of the three parameters were stratified by three groups: mice subjects with no SB
but were given ethanol (no SB), those administered with SB from the beginning of the 2BC
study (SB1) , and mice who switched from no SB to SB in the third week of the study (SB2, their
intake data for the first two weeks were placed in no SB). For the subjects that were part of the
SB2 group, their drinking data in the first two weeks were placed in the no SB group. The
averaged group metrics were compared week-to-week and presented as mean ± SEM. Variations
in total liquid intake, ethanol intake, SB vs. water intake, and ethanol preference among the
groups were assessed week-by-week through conducting unpaired t-test with equal variances
assumed for the first two weeks and one-way ANOVA for weeks 3-7.
BEC and TG Assay Data:
The BEC and normalized TG values calculated from each tested sample’s OD were stratified
based on the treatment group their respective mice concluded 2BC in (control, no SB, SB1, and
SB2). Presented in units of percent ethanol and nM/mg protein respective and in both assays as
mean ± SEM, one-way ANOVA tests were performed to determine any variations in the group
mean concentration among the four treatment groups.

26
qPCR:
The average of every sample’s Ct (within the same primer) was taken while wells exhibiting no
or inconclusive amplification were omitted. Then, the difference between every sample-primer
pair’s mean Ct and their respective sample’s GAPDH mean Ct was taken to calculate ∆Ct. Then,
for each primer outside of GAPDH, their ∆Ct from all the samples in the control group were
averaged to determine the delta control for the primers being run. Every ∆Ct was then subtracted
by their respective primer’s delta control to generate ∆∆Ct, which is then used to calculate the
relative gene quantity in 2-DDCt. The 2-DDCt values were stratified by the four 2BC treatment
groups where they were averaged and normalized to the control group before being presented as
mean ± SEM to compare relative gene expression of tested primers. Variation in 2-DDCt among the
treatment groups for every target primer were all analyzed with one-way ANOVA. However, if
sample sizes were too small, then unpaired t-test with equal variances assumed will be conducted
to determine differences between individual groups.
Statistical Analysis:
For any unpaired t-test and one-way ANOVA test conducted, significance level was set at p <
0.05. If the one-way ANOVA yielded a significant p-value, then Bonferroni post hoc tests with
multiple comparisons were conducted. For post hoc analysis, significance level was set at pAdj <
0.05 in which pAdj = p/number of possible comparisons.

27
Chapter 4: Results
Intake of Sodium Butyrate (SB) Solution Was Higher Compared to Water Intake
Weekly non-ethanol liquid intake was compared in between groups to determine if sodium
butyrate (SB) had the same effect on consumption as in previous studies21. In multiple weeks the
differences in non-ethanol consumption were significant among no SB (water), SB1 prevention
treatment group (administered SB from week 1 of the study), and SB2 reversible treatment group
(administered SB after 2 weeks of ethanol exposure) groups (one-way ANOVA: F(2, 105) =16.5,
p < 0.001; F(2, 104) = 3.7, p = 0.027; F(2, 104) = 8.6, p < 0.001; Fig. 8A). For weeks 1, 3, and 6
in particular, at least one of the SB groups had statistically significantly higher mean SB liquid
consumption than the no-SB group’s mean water intake (unpaired t-test: p = 0.012; unpaired ttest with Bonferroni correction: pAdj < 0.001, < 0.001, < 0.001, and < 0.001). When combining all
the non-ethanol liquid intake data for daily water vs. SB consumption, the disparity among the
three groups was significant like in weekly average intake (one-way ANOVA: F(2, 692) = 28.0, p
< 0.001; Fig. 8B). Looking into the multiple comparisons, it is evident both SB groups had much
higher liquid intake than no SB group’s water consumption (unpaired t-test with Bonferroni
correction: pAdj < 0.001 and < 0.001). When evaluating the data, the higher daily total liquid
intake seen in the SB groups was largely driven by higher consumption of 8 mg/mL SB over the
level of water intake seen in the no SB group.

28
(A)
(B)
Figure 8: Non-ethanol liquid intake throughout the study. (A) Both prevention and reversible SB
treatment groups registered higher weekly SB intake than water intake in the no SB group. (B) Overall
liquid intake combining all the weeks saw higher SB intake in SB1 and SB2 groups compared to no SB’s
water consumption. Data are presented as Mean ± SEM. Unpaired t-test, ^ p <0.05, ^^p <0.01, ^^^p
<0.001 and one-way ANOVA Bonferroni post hoc multiple comparisons, * pAdj < 0.05, ** pAdj < 0.01, ***
pAdj < 0.001.
SB Supplementation Did Not Reduce Ethanol Intake in Mice
In addition to non-ethanol intake, ethanol consumption was characterized to establish if alcohol
SB had a similar effect on alcohol drinking behavior as seen in previous studies using a bingelike drinking paradigm21. There was a significant variation in daily ethanol intake among the
three groups for multiple weeks (one-way ANOVA: F(2, 101) = 13.9, p < 0.001; F(2, 103) =

29
12.4, p < 0.001; F(2, 101) = 29.5, p < 0.001; Fig. 9A). However, the introduction of SB also led
to statistically significant increases in average weekly ethanol intake of the SB1 group compared
to the control group in weeks 2, 3, and 6 (unpaired t-test: p < 0.001; unpaired t-test with
Bonferroni correction: pAdj = 0.016 and < 0.001). The three groups also had significant
differences in average ethanol intake when combining data for the entire 2BC study (one-way
ANOVA: F(2, 675) = 16.4, p < 0.001; Fig. 9B). However, SB treatment led to higher EtOH
intake in SB1 subjects compared to no SB (unpaired t-test with Bonferroni correction: pAdj <
0.001). Meanwhile, mice in the SB2 group did consume less ethanol on average, but the
difference was negligible (unpaired t-test with Bonferroni correction: pAdj = 1). These results
suggested that SB supplementation did not protect from ethanol intake in the intermittent 2BC
alcohol procedure.
(A)

30
(B)
Figure 9: Ethanol intake throughout the study. (A) Prevention SB treatment saw more weekly ethanol
intake and reversible SB treatment did not yield statistically significant differences in intake when
compared to the control group. (B) When it came to overall EtOH intake, SB1’s consumption was
significantly more than both no SB and SB2, with SB2 only having minimally lower intake than no SB.
Data are presented as Mean ± SEM. Unpaired t-test, ^ p <0.05, ^^^p <0.001 and one-way ANOVA
Bonferroni post hoc multiple comparisons, * pAdj < 0.05, *** pAdj < 0.001.
Reduced Ethanol Preference seen in SB Supplementation
In addition to evaluating the consumption levels of water and ethanol, characterizing group
differences in ethanol preferences helped paint a clearer picture in how SB may impact the
alcohol cravings in mice. One-way ANOVA indicated there were significant variation in
preference among the three groups in more than one week (F(2, 102) = 8.7, p < 0.001; F(2, 99) =
5.4, p = 0.006; F(2, 103) = 3.1; p = 0.047; Fig. 10A) Although SB1 only had a statistically
significantly lower ethanol preference compared to no SB in week 3 (t-test with Bonferroni
correction: pAdj < 0.01), SB2 had mean ethanol preference statistically significantly lower than
the control group in weeks 3, 4, and 6 (t-test with Bonferroni correction: pAdj = 0.005, 0.006,
0.049). When consolidating all the data in the 2BC study, both SB groups had significant
difference in ethanol preference compared to no SB (one-way ANOVA: F(2, 680) = 26.4, p <
0.001; Fig. 10B), with both treatment groups able to lower their alcohol preference (unpaired ttest with Bonferroni correction: pAdj < 0.001 and < 0.001). SB treatment was clearly able to

31
downregulate interest in consuming more ethanol relative to total liquid intake. However, the
caveat was that the lower EtOH preference was largely driven by significantly higher SB liquid
intakes relative to water intake in the no SB group as ethanol intake did not see significant
decreases in SB treatment groups.
(A)
(B)
Figure 10: Ethanol preference throughout the study. (A) Both SB treatments were able to present
lower weekly ethanol preference compared to the control group. (B) As for overall EtOH preference in
2BC, both SB groups also had significantly less EtOH preference, with SB2 subjects having a larger
decrease relative to no SB. Data are presented as Mean ± SEM. One-way ANOVA with Bonferroni post
hoc multiple comparisons, * pAdj < 0.05, ** pAdj < 0.01.

32
SB Supplementation Yielded Slight Decreases in Blood Ethanol Concentration Measured
Upon Completion of Study
In addition to intake and preference, BECs between the study groups were determined from
blood serum samples collected at the end of 2BC study during necropsy. This was intended to not
only characterize the ethanol level in systemic circulation but also evaluate if the data reflected
overall ethanol intake and preference results. Although the BECs of both SB1 and SB2 were
lower than that of no SB, one-way ANOVA did not reveal any significant difference in ethanol
concentration among the four 2BC groups (p = 0.381; Fig. 11). The pattern seen in the BEC
results clearly did not reflect that of overall ethanol consumption, as the SB1 group saw
significantly higher intake and SB2 group saw minimally lower intake compared to the no SB
group. However, the data did corroborate with overall ethanol preference as both SB groups had
significantly lower preferences for alcohol compared to no SB.
Figure 11: BEC measured in serum samples collected at the end of study. Although both SB groups
had lower BEC than the no SB group, the differences were not statistically significant. Data are presented
as Mean ± SEM.

33
Intermittent Two-Bottle Choice (2BC) Ethanol Consumption Did Not Modulate Liver
Weight and Triglyceride Levels as Prevention SB Group Only Had Slight Reductions
Liver weights and TG levels were utilized to evaluate whether this alcohol consumption model
was able to induce steatosis and characterize the therapeutic effect of SB supplementation. The
intermittent 2BC study design with one bottle of water or SB solution and one with ethanol or
SB-ethanol solution was able to produce significant variance in mean liver weight among the
four groups (one-way ANOVA: F(3, 41) = 3.4, p = 0.026; Fig. 12A). It was important to
highlight 2BC induced a small but insignificant reduction in both liver weight and TG levels.
Livers were significant between the SB groups, with SB1 having the lower average weight
(unpaired t-test with Bonferroni correction: pAdj = 0.032). As for TG levels, it was determined
there was no variation among the four study groups (one-way ANOVA: F(3, 12) = 0.9, p = 0.471;
Fig. 12B) despite there being a slightly lower average concentration in the SB1 group compared
to no SB. Overall, results that intermittent 2BC was unable to induce steatosis and the
introduction of SB early in the beginning of the study could reduce liver TG level, but yielded no
significance.
(A)

34
(B)
Figure 12: Liver weights and triglyceride concentrations measured at the end of the study. (A)
Although there was variation in liver weight among the four 2BC study groups, liver weights were only
significantly different between SB1 and SB2 groups. (B) There was no significant variation found in liver
TG concentration among the groups, but SB1 had visibly reduced TG levels. Data are presented as Mean
± SEM. One-way ANOVA with Bonferroni post hoc multiple comparisons, * pAdj < 0.05.
SB Supplementation Significantly Modulated M2 Macrophage Activation, Highlighting a
Shift Towards Anti-Inflammatory Macrophage Polarization
We analyzed the expression levels of cluster of differentiation (CD) 68 and 206 to evaluate
macrophage activation and polarization in livers of mice at the end of intermittent 2BC exposure.
CD68, an oxidized low-density lipoprotein (LDL) scavenger receptor and is a pan-macrophage
marker26. However, it is more highly expressed in M1 than M2 macrophages, so it can still be
utilized to characterize M1 macrophage polarization27. There appeared to be no significant
difference in relative CD68 mRNA gene expression among the four groups (one-way ANOVA:
F(3, 11) = 2.1, p = 0.152; Fig. 13A). However, both SB groups seem to have slightly lower CD68
expression compared to no SB, indicating some degree of reduction in overall liver macrophage
activity. As for CD206, another scavenger receptor which binds to heme and is a prominent M2
macrophage marker, SB2 was determined to have significantly higher CD206 expression
compared to the no SB group (unpaired t-test: p = 0.019; Fig. 13B)12. Although the difference
was insignificant, the SB2 group also had increased CD206 expression compared to the no SB
group. To better characterize potential shifts from M1 to M2 macrophage phenotype, CD68 to

35
CD206 ratios were calculated for each study group. Both SB groups had smaller ratios than the
no SB group, and unpaired t-tests confirmed that SB2 had a significantly higher ratio than the no
SB group (p = 0.014; Fig. 13C). All in all, SB treatment was able to upregulate M2 macrophage
activation as indicated from its biomarkers, with the shift towards the anti-inflammatory
phenotype statistically significant in the SB1 prevention group.
Figure 13: Expression levels of macrophage biomarkers. (A) Despite slight decreases in CD68
expression in both SB groups compared to no SB, no significant variation in expression level was found.
(B) SB1 had significantly higher CD206 expression than no SB, with SB2 having a noticeably higher
expression level as well. (C) The SB1 group also had a significantly higher CD68 to CD206 ratio than the
no SB group, indicating increased M2 polarization due to SB treatment. Data are presented as Mean ±
SEM. Unpaired t-test, ^ p <0.05.
No Significant Change in M1 Macrophage-Stimulating TLR4 and Pro-Inflammatory
Factors with SB Supplementation
Gut-derived LPS binding onto TLR4 leads the activation of macrophages and release of proinflammation cytokines and chemokines10. The characterization of expression levels of the proinflammatory factors could determine any changes in M1 macrophage-activated inflammatory
responses from SB treatment. Although both SB1 and SB2 groups had reduced TLR4 expression
0
0.2
0.4
0.6
0.8
1
1.2
1.4
1.6
Relative Gene Expression
CD68
Control no SB SB1 SB2
0
0.5
1
1.5
2
2.5
3
3.5
4
4.5
Relative Gene Expression
CD206
Control no SB SB1 SB2
(A) (B)
^
0.000
0.200
0.400
0.600
0.800
1.000
1.200
1.400
1.600
Ratio
CD68 to CD206
Control no SB SB1 SB2
(C)
^
0
0.2
0.4
0.6
0.8
1
1.2
1.4
1.6
Relative Gene Expression
CD68
Control no SB SB1 SB2
0
0.5
1
1.5
2
2.5
3
3.5
4
4.5
Relative Gene Expression
CD206
Control no SB SB1 SB2
(A) (B)
^
0.000
0.200
0.400
0.600
0.800
1.000
1.200
1.400
1.600
Ratio
CD68 to CD206
Control no SB SB1 SB2
(C)
^

36
compared to the no SB group, the differences were not considered to be significant (one-way
ANOVA: F(3, 11) = 0.982, p = 0.436; Fig. 14A). SB groups, notably SB2, saw a slight decrease
in mRNA expression levels of pro-inflammation cytokines IL-1b and IL-6 compared to no SB,
but the difference in relative gene expression between the study groups was determined to be
insignificant (one-way ANOVA: F(3, 11) = 0.5, p = 0.689; F(3, 11) = 1.1, p = 0.408; Fig. 13B,
14C). In addition, no significant variations in the expression levels of pro-inflammatory
chemokine MCP-1 and chemokine receptor CCR2 were present (one-way ANOVA: F(3, 11) =
0.2, p = 0.925; F(3, 11) = 0.6, p = 0.613; Fig. 14D, 14E). Furthermore, expression of CCR2, a
receptor for MCP-1 or CCL2, was higher in the SB groups compared to no SB, implying an
increased expression in MCP-1 binding to the receptor26. In summary, the lack of changes in proinflammatory M1 markers suggested that the intermittent 2BC drinking procedure did not
modulate the activation of liver macrophages and therefore no mitigation by SB supplementation
could be observed.
0
0.2
0.4
0.6
0.8
1
1.2
Relative Gene Expression
TLR4
Control no SB SB1 SB2
0
0.5
1
1.5
2
2.5
Reletaive Gene Expression
IL-1β
Control no SB SB1 SB2
0
0.2
0.4
0.6
0.8
1
1.2
Relative Gene Expression
IL-6
Control no SB SB1 SB2
0
0.2
0.4
0.6
0.8
1
1.2
1.4
Relative Gene Expression
MCP-1
Control no SB SB1 SB2
0
0.2
0.4
0.6
0.8
1
1.2
1.4
1.6
Relative Gene Expression
CCR2
Control no SB SB1 SB2
(A)
(D) (E)
(B) (C)

37
Figure 14: Expression levels of pro-inflammatory activator and factors pertaining to M1
macrophage polarization. (A) Both SB1 and SB2 groups saw a slight decrease in TLR4 expression
compared to no SB, but the differences were not statistically significant. In addition, there were no
significant variations in expression levels of pro-inflammatory factors (B) IL-1b, (C) IL-6, (D) MCP-1,
and (E) CCR2 among the four 2BC study groups as SB treatment did not seem to meaningfully
downregulate any expression. Data are presented as Mean ± SEM.
SB Supplementation Did Not Yield Significant Changes in Anti-Inflammatory Cytokines
Secreted from M2 Phenotype Macrophages
Genetic expressions of anti-inflammatory factors were also characterized to determine if there
were anti-inflammatory responses driven by a shift to M2 polarization. Anti-inflammatory
cytokines secreted by macrophages with a M2 phenotype, IL-10, and TGF-b, had no significant
change in expression level across the four mice groups in the study (one-way ANOVA: F(3, 11)
= 1.2, p = 0.357; F(3, 11) = 0.9; p = 0.490; Fig. 15A, 15B). SB1 had slightly higher expression in
both IL-10 and TGF-b compared to no SB while SB2 only had increased expression in TGF-b.
Nevertheless, the patterns seen in anti-inflammatory cytokine expression although not
statistically significant, exhibited modest increases associated with M2 polarization in response
to SB treatment.
0
0.2
0.4
0.6
0.8
1
1.2
Relative Gene Expression
TLR4
Control no SB SB1 SB2
0
0.5
1
1.5
2
2.5
Reletaive Gene Expression
IL-1β
Control no SB SB1 SB2
0
0.2
0.4
0.6
0.8
1
1.2
Relative Gene Expression
IL-6
Control no SB SB1 SB2
0
0.2
0.4
0.6
0.8
1
1.2
1.4
Relative Gene Expression
MCP-1
Control no SB SB1 SB2
0
0.2
0.4
0.6
0.8
1
1.2
1.4
1.6
Relative Gene Expression
CCR2
Control no SB SB1 SB2
(A)
(D) (E)
(B) (C)

38
Figure 15: Expression levels of anti-inflammatory cytokines released through M2 macrophage
polarization. Despite minimally higher expression of anti-inflammatory cytokines (A) IL-10 and (B)
TGF-b in SB1 and SB2 groups relative to no SB, there appeared to be no significant variation in
expression levels among the groups as SB treatment failed to induce an anti-inflammatory response. Data
are presented as Mean ± SEM.
0
0.2
0.4
0.6
0.8
1
1.2
Relative Gene Expression
IL-10
Control no SB SB1 SB2
0
0.2
0.4
0.6
0.8
1
1.2
1.4
Relative Gene Expression
TGF-β
Control no SB SB1 SB2
(A) (B)

39
Chapter 5: Discussion
Effect of SB Supplementation on Liquid Intake
Intake data for both non-ethanol liquids and ethanol itself was collected throughout the study and
analyzed with the aim of corroborating the effect of both intermittent 2BC ethanol exposure and
SB treatment on drinking behavior of mice. SB was able to increase both weekly and overall
non-ethanol liquid intake in both SB groups when compared to the no SB group as observed in a
drinking in the dark (DiD) study within an earlier article researching SB supplementation’s effect
on antibiotic-induced increases in ethanol consumption21. However, SB also limited overall
ethanol intake in the 2BC study the paper also conducted, which was not the case in our study.
The prevention treatment group had significantly higher and reversible treatment group had
minimally lower ethanol consumption than the no SB group. A slight reduction in ethanol
preference was observed in SB groups, reflecting preference data in the past 2BC study. Despite
the decrease in preference induced by SB, difference in preference was mostly attributed to the
increase seen in SB liquid consumption instead of significant changes in ethanol intake.
To corroborate with overall ethanol intake and preference data, BECs of the four groups were
also measured. Although both SB groups had noticeable decreases in BEC compared to the no
SB group, especially the prevention SB group, there was not any significant difference between
the mice groups. This reflected data in the past 2BC study with SB mentioned above where there
was also no significant variation in BEC between the groups21. Although this result did not
reflect our study’s ethanol intake data, it did reflect overall ethanol preference as mice preference
for alcohol in a 2BC exposure model saw a slight decrease as well when SB was introduced. All
in all, despite no significant change SB supplementation still was able to lower the level of
ethanol in systemic circulation to some extent.

40
When comparing the differences between this study and past 2BC intermittent ethanol exposure
models with SB treatment, it was important to highlight that the previous 2BC study had an
antibiotic (ABX) cocktail administered in bottles while this study did not21. Comprised of
bacitracin, neomycin, and vancomycin, the ABX was utilized to replicate an altered microbiome
with reduced bacterial diversity. The ABX-induced dysbiosis promoted a porous intestinal lining
as seen in alcohol-mediated leaky gut and has shown to increase ethanol consumption28. This
exposure was included to ensure both heightened alcohol intake and leaky gut in ABX groups
rather than solely rely on ethanol exposure to trigger clinical manifestations of ALD. With ABX
upregulating chronic alcohol consumption, it did not have had a significant effect on SB’s ability
to reduce ethanol intake and preference in a 2BC model21. However, in a DiD model where the
mice could only drink ethanol from 3 to 5 pm daily, the SB group with ABX cocktail exhibited
significant decreases in ethanol consumption not seen in the non-ABX SB group. Meanwhile,
ABX eliminated SB’s effect on significantly increasing non-ethanol intake relative to the no SB
group, highlighting ABX’s potential role as a confounding variable as something that should be
taken into consideration when comparing data with past research that did administer the cocktail.
Furthermore, the ethanol concentration in our study was set at 5% for the first two weeks and
10% from the third week onwards, much lower than the 20% in the previous study21. The
disparity in concentration could explain differences in drinking behavior as the ethanol exposure
may not be severe enough to have the desired therapeutic effect from SB supplementation.
Effect of SB Supplementation on Hepatosteatosis
Steatosis in the groups of the 2BC study were characterized through average liver weight and TG
concentration. SB1 was the only group with SB supplementation with lower liver weight and
hepatic TG levels than the no SB group, but the differences were not significant. This result

41
could indicate that when introduced from the beginning as a preventative measure, SB treatment
could attenuate steatosis to some degree. However, it should be also noted that this model with
2BC intermittent ethanol exposure did not seem induce steatosis at all, as there were minimal
differences in both liver weight and TG level between the control and no SB groups. To better
initiate steatosis, mice should be put on a high-fat diet to stimulate fat buildup, as a diet with
45% of energy coming from fat led to hepatic TG concentration increasing by more than threefold in a 12-week study 29. Subsequently, when SB treatment was administered, steatosis induced
by a high-fat diet was diminished as indicated by the significant decrease in hepatic TG levels30.
Furthermore, inflammation enhanced by a high-fat diet was also attenuated by SB as proinflammatory cytokines TNF-a and IL-6 had significant drop-offs in mRNA expression when
mice were treated with the SCFA31. All in all, feeding mice with a diet comprised of a significant
level of fat paired with 2BC intermittent ethanol exposure could not only trigger steatosis and
inflammation in the liver but with SB supplementation these two stages of ALD could also be
alleviated.
Effect of SB Supplementation on mRNA Expression of M1 and M2 Macrophage Phenotype
Markers
The expression level of CD68, an oxidized low-density lipoprotein scavenger receptor, was
measured in liver samples of mice to help determine the extent of M1 macrophage polarization
between the study groups and assess SB treatment’s effect on M1 phenotype differentiation.
Although CD68 is classified as a pan-macrophage marker, it is more highly expressed in M1
macrophages, thereby making it an adequate M1 biomarker26. Both SB groups saw slight
decreases in CD68 expression relative to the no SB group, but the changes were insignificant.
This result indicated SB supplementation was able to inhibit further macrophage differentiation

42
into the pro-inflammatory M1 phenotype initiated by 2BC intermittent ethanol exposure.
Introduction of the SCFA had some effect in inhibiting gut-derived LPS activation of Kupffer
cells via the TLR4/ NF-κB pathway, which reduced M1 macrophage polarization in the liver to
an extent11. However, it was also important to highlight that because CD68 also has a significant
presence in M2 macrophages, there could be other cell surface markers with higher expression in
M1 relative to M2 phenotype such CD80, CD86, and inducible nitric oxide synthase (iNOS)23,27.
With these markers, the effect SB had on M1 macrophage polarization could be better evaluated.
In addition to M1 macrophage polarization, macrophage differentiation to the anti-inflammatory
M2 phenotype was also characterized with the aim of evaluating any potential effect SB
treatment has on modulating M2 polarization. The marker used was CD206, a heme scavenger
receptor featured prominently on M2-polarized macrophages12. Both SB groups had enhanced
expression levels of the M2 surface marker, with the SB1 prevention group exhibiting
significantly higher CD206 expression than the no SB group. To further characterize SB’s ability
to shift macrophage differentiation from M1 to M2, CD68 to CD206 mRNA expression levels
ratios were calculated for each group. Both SB groups had decreased ratios compared to the no
SB group, with SB1 group’s ratio also being statistically significantly lower. The data from both
CD206 mRNA expression and CD68 to CD206 ratio indicated supplementation of SB, especially
when administered from the beginning of the 2BC study as a preventative measure, had a
significant effect in changing hepatic macrophage polarization towards M2.
Although the results highlighted a shift to M2 polarization, more research needs to be done on
how SB directly modulates stimuli inducing M2 macrophage differentiation such as IL-4 and IL1312. Moreover, the M1/M2 dichotomy in macrophage polarization is considered an
oversimplified concept as the M2 phenotype further divides itself into four subtypes, who all

43
have their own unique set of stimuli and secreted cytokines11. As a result, these M2 subtypes
trigger a variety of responses beyond alleviating inflammation such as immunosuppression and
tissue remodeling. Because of the complexity in the differentiation of macrophage phenotypes,
more work needs to be done to discern between the different M2 subtypes. The aim of this study
was to investigate potential change in anti-inflammatory macrophage polarization induced by SB
treatment, so emphasis should be placed on assessing the activation of the M2a subtype. In
addition to CD206, specific surface markers of M2a macrophages whose expression levels
should be measured include MHCII, IL-1R, and Dectin-112.
To better characterize macrophage differentiation into M1 and M2 phenotypes in the future,
isolating macrophages can produce a more accurate sample than using entire liver homogenates.
For example, a study was investigating the shift in mTORC1-stimulated M1 polarization of liver
macrophages when mice were infected with Ehrlichia muris to induce mild ehrlichiosis32. To
characterize hepatic accumulation of M1 macrophages, researchers extracted splenic single-cell
suspensions from infected mice and isolated splenocytes. Then, the samples were blocked with
antibodies of M1 and M2 surface markers (i.e. CD16, CD32, CD11b, CD68, CD206) and flow
cytometry was conducted to determine the macrophage sample’s expression levels of these
markers, making it possible to evaluate the extent macrophage polarization in infected samples.
For future mice studies, sex-based and age-based differences in macrophage polarization and the
resulting secretions of pro- and anti-inflammatory factors in response to SB supplementation
could also be evaluated. This most recent study only had young male mice as subjects, limiting
the ability to observe variations between strata.

44
Effect of SB Supplementation on M1 Macrophage Stimulus TLR4, M1-Secreted ProInflammatory Factors, and M2-Secreted Anti-Inflammatory Cytokines
A leaky gut due to chronic alcohol consumption allows LPS to make its way to the blood before
reaching the liver where it is detected as a PAMP and becomes binded to TLR4, stimulating M1
macrophage polarization as a result10. Because of its crucial role as in regulating proinflammatory M1 macrophage activation, the mRNA expression of TLR4 was measured to
determine if SB treatment had any inhibitory effect on the inflammatory stimulus. Both groups
with SB supplementation displayed less TLR4 expression than the no SB group, with the SB2
group having the lower expression of the two. This result matched expectations of butyrate and
other SCFAs limiting the amount of LPS exploiting the gut-liver axis to induce hepatic
inflammation by minimizing intestinal permeability17. However, group differences in mRNA
expression were not statistically significant, indicating any SB’s inhibition of LPS-mediated
TLR4 activation was minimal.
In addition to evaluating SB’s effect on TLR4 activation, its modulation of the pro-inflammatory
factor secretion from M1 macrophages was also investigated. When LPS binds to TLR4 on
Kupffer cells, pro-inflammatory transcription factor NF-κB becomes upregulated, resulting in
macrophages differentiating into M1 and releasing pro-inflammatory cytokines8,11. The SB1
prevention group exhibited a slight decrease in the mRNA expression of inflammatory cytokines
IL-1b, but had increased expressions of IL-6 and chemokine MCP-1 compared to the no SB
group. As for the reversible group, it appeared this treatment design had more success in
inhibiting pro-inflammatory factor production, as IL-1b, IL-6, and MCP-1 all had decreased
expression levels. Moreover, both SB groups had higher expression of MCP1 receptor CCR2
than the no SB group.

45
When reviewing all the RT-qPCR data on pro-inflammatory factor expression, there seemed to
be conflicting evidence pertaining to SB supplementation’s impact on M1 macrophage secretion
of said factors. This ran contrary to a previous study on SB investigating its role in attenuating
neuroinflammation and its link to protecting against ABX-induced increasing ethanol intake20. In
this study utilizing a binge-like drinking paradigm in a DiD model, supplementation of the SCFA
significantly reduced mRNA expression of multiple pro-inflammatory cytokines. Butyrate’s
inhibition of cytokines such as TNF-a, IL-6, and MCP-1 that promote inflammation through the
receptor activation of GPR41 is well-established in literature17. Therefore, the lack of significant
SB-induced change in expression levels of inflammation-promoting factors was unexpected and
indicated the 2BC study with intermittent ethanol exposure was not appropriate in modeling SB
treatment’s potential inhibitory effect. It is evident additional research needs to be done on
optimizing future animal studies evaluating SB’s modulation of pro-inflammatory M1
macrophage responses. In addition, other secreted pro-inflammatory factors whose expressions
can help improve the characterization of M1 polarization include TNF-a and IL-1212.
It is also important to highlight that much of the significant decreases in expression level were in
groups treated with ABX to facilitate significant increase in ethanol intake. With ABX, chronic
alcohol consumption and its clinical manifestations were further aggravated, especially in DiD
studies. As a result, SB supplementation along with ABX treatment exhibited enhanced
therapeutic effect in inhibiting pro-inflammation factor production as with attenuating ethanol
intake20,21. As with drinking data, ABX’s impact on the M1 macrophage-mediated release of
inflammation-enhancing factors needs to be further studied.

46
Besides characterizing M1 macrophage production of pro-inflammation cytokines and other
relevant factors, mRNA expression of anti-inflammatory cytokines released by M2-polarized
macrophages was also quantified. SB1 group had slightly higher IL-10 and TGF-b expression
levels compared to the no SB group, SB2 only had minimal increase in expression with TGF-b.
The decreased expression in anti-inflammatory cytokines seen in the no SB group along with the
subsequent upregulation induced by SB point to a shift from M1 to M2 polarization in liver
macrophages. This result was similar to that of a study using a DiD ethanol drinking paradigm
which concluded binge drinking behavior upregulated IL-10 expression in the basolateral
amygdala section of mice brain33
. However, our data did not corroborate with a past DiD study
with SB where there was a downregulation of the anti-inflammatory factor with SB
supplementation with and without ABX20. It is also important to note both studies utilized the
DiD model instead of 2BC, and the difference in ethanol exposure may play a role in differing
results. The conflicting data underscores the need to further investigate SB supplementation’s
effect on a multitude of anti-inflammatory factors released by M2 macrophages. To paint a better
picture on changes in anti-inflammatory macrophage polarization, hepatic expression levels of
additional M2-secreted cytokines such as Arginase 1 (Arg1) as well as downstream cytokine
targets like signal transducer and activator of transcription 6 (STAT6)11,12.

47
Chapter 6: Conclusion
This most recent SB supplementation study with intermittent 2BC ethanol exposure revealed a
lot about not only SB’s therapeutic effect on ALD but also the ability of the model itself to
replicate ALD and treatment response. SB treatment appeared to increase non-ethanol intake in a
two-bottle setup but could not significantly decrease ethanol intake. Despite the reduction in
ethanol preference, the inability to lessen ethanol consumption compared to the no treatment
group indicated the study did not accurately model SB’s effect on liquid consumption as seen in
past research21.
When it came to characterizing hepatosteatosis, the same issue arose as intermittent ethanol
exposure on its own did not increase liver weight nor TG concentration, and SB treatment did
not significantly attenuate both metrics. A future study modeling steatosis and SB’s effect could
be optimized with the inclusion of a high-fat diet to stimulate steatosis29. mRNA expression
levels of M1 and M2 macrophage markers indicate a significant shift towards anti-inflammatory
polarization in response to SB supplementation. Future studies can improve on the evaluation of
M1/M2 macrophage polarization through splenic isolation32.
Despite a significant shift from M1 to M2 macrophage differentiation due to SB, the SCFA did
not seem to significantly attenuate LPS binding of TLR4 and downregulate pro-inflammatory
M1 macrophage activation in the liver. This was further confirmed by the lack of significant
change in expressions of both pro- and anti-inflammatory factors seen in SB groups despite SB
supplementation resulting in slight decreases in mRNA expression of pro-inflammatory factors
and slight increases in anti-inflammatory ones. The data did not reflect the significant decreases
seen in pro-inflammatory cytokines due to SB treatment in previous studies20. As for M2-

48
secreted anti-inflammatory cytokines, the lack of significant change in relative gene expression
between groups along with the conflicting conclusions drawn from previous data highlight that
more work needs to be done to reach a consensus on the effect of SB supplementation on said
factors released by M2 macrophages20,33
. Despite much of the data not reflecting past research, it
is also important to note that the 2BC model that was conducted for our study operated
differently compared to DiD studies conducted in previous papers with ABX to induce gut
dysbiosis20,21. Moving forward, it is imperative to evaluate the ABX’s influence on modulating
ethanol consumption, steatosis, and hepatic inflammation in past studies and take that into
consideration when comparing results with current animal models. More importantly, it is
evident that more research needs to be done to improve the animal model in simulating ALD’s
clinical manifestations with emphasis on hepatitis as well as characterizing SB’s therapeutic
effect through the gut-liver axis.

49
References
1. Li, X., Chen, L. M., Kumar, G., Zhang, S. J., Zhong, Q. H., Zhang, H. Y., Gui, G., Wu,
L. L., Fan, H. Z., & Sheng, J. W. (2022). Therapeutic Interventions of Gut-Brain Axis as
Novel Strategies for Treatment of Alcohol Use Disorder Associated Cognitive and Mood
Dysfunction. Frontiers in Neuroscience, 16, 820106.
https://doi.org/10.3389/fnins.2022.820106
2. Bajaj J. S. (2019). Alcohol, Liver Disease, and the Gut Microbiota. Nature Reviews.
Gastroenterology & Hepatology, 16(4), 235–246. https://doi.org/10.1038/s41575-018-
0099-1\
3. Kranzler, H. R., & Soyka, M. (2018). Diagnosis and Pharmacotherapy of Alcohol Use
Disorder: A Review. JAMA, 320(8), 815–824. https://doi.org/10.1001/jama.2018.11406
4. Sacks, J. J., Gonzales, K. R., Bouchery, E. E., Tomedi, L. E., & Brewer, R. D. (2015).
2010 National and State Costs of Excessive Alcohol Consumption. American Journal of
Preventive Medicine, 49(5), e73–e79. https://doi.org/10.1016/j.amepre.2015.05.031
5. Pandey, S. C., Kyzar, E. J., & Zhang, H. (2017). Epigenetic Basis of the Dark Side of
Alcohol Addiction. Neuropharmacology, 122, 74–84.
https://doi.org/10.1016/j.neuropharm.2017.02.002
6. Osna, N. A., Donohue, T. M., Jr, & Kharbanda, K. K. (2017). Alcoholic Liver Disease:
Pathogenesis and Current Management. Alcohol Research: Current Reviews, 38(2), 147–
161.
7. Jaurigue, M. M., & Cappell, M. S. (2014). Therapy for Alcoholic Liver Disease. World
Journal of Gastroenterology, 20(9), 2143–2158. https://doi.org/10.3748/wjg.v20.i9.2143
8. Pohl, K., Moodley, P., & Dhanda, A. D. (2021). Alcohol's Impact on the Gut and
Liver. Nutrients, 13(9), 3170. https://doi.org/10.3390/nu13093170
9. Wang, S. C., Chen, Y. C., Chen, S. J., Lee, C. H., & Cheng, C. M. (2020). Alcohol
Addiction, Gut Microbiota, and Alcoholism Treatment: A Review. International Journal
of Molecular Sciences, 21(17), 6413. https://doi.org/10.3390/ijms21176413
10. Dukić, M., Radonjić, T., Jovanović, I., Zdravković, M., Todorović, Z., Kraišnik, N.,
Aranđelović, B., Mandić, O., Popadić, V., Nikolić, N., Klašnja, S., Manojlović, A.,
Divac, A., Gačić, J., Brajković, M., Oprić, S., Popović, M., & Branković, M. (2023).
Alcohol, Inflammation, and Microbiota in Alcoholic Liver Disease. International Journal
of Molecular Sciences, 24(4), 3735. https://doi.org/10.3390/ijms24043735
11. Sun, J., Zhao, P., Shi, Y., & Li, Y. (2023). Recent Insight into the Role of Macrophage in
Alcohol-Associated Liver Disease: A Mini-Review. Frontiers in Cell and Developmental
Biology, 11, 1292016. https://doi.org/10.3389/fcell.2023.1292016

50
12. Wang, C., Ma, C., Gong, L., Guo, Y., Fu, K., Zhang, Y., Zhou, H., & Li, Y. (2021).
Macrophage Polarization and Its Role in Liver Disease. Frontiers in Immunology, 12,
803037. https://doi.org/10.3389/fimmu.2021.803037
13. Li, S., Tan, H. Y., Wang, N., Feng, Y., Wang, X., & Feng, Y. (2019). Recent Insights
into the Role of Immune Cells in Alcoholic Liver Disease. Frontiers in Immunology, 10,
1328. https://doi.org/10.3389/fimmu.2019.01328
14. Silva, Y. P., Bernardi, A., & Frozza, R. L. (2020). The Role of Short-Chain Fatty Acids
From Gut Microbiota in Gut-Brain Communication. Frontiers in Endocrinology, 11, 25.
https://doi.org/10.3389/fendo.2020.00025
15. Xiong, R. G., Zhou, D. D., Wu, S. X., Huang, S. Y., Saimaiti, A., Yang, Z. J., Shang, A.,
Zhao, C. N., Gan, R. Y., & Li, H. B. (2022). Health Benefits and Side Effects of ShortChain Fatty Acids. Foods (Basel, Switzerland), 11(18), 2863.
https://doi.org/10.3390/foods11182863
16. Martin-Gallausiaux, C., Marinelli, L., Blottière, H. M., Larraufie, P., & Lapaque, N.
(2021). SCFA: Mechanisms and Functional Importance in the Gut. The Proceedings of
the Nutrition Society, 80(1), 37–49. https://doi.org/10.1017/S0029665120006916
17. Liu, P., Wang, Y., Yang, G., Zhang, Q., Meng, L., Xin, Y., & Jiang, X. (2021). The Role
of Short-Chain Fatty Acids in Intestinal Barrier Function, Inflammation, Oxidative
Stress, and Colonic Carcinogenesis. Pharmacological Research, 165, 105420.
https://doi.org/10.1016/j.phrs.2021.105420
18. Chen, J., & Vitetta, L. (2020). The Role of Butyrate in Attenuating Pathobiont-Induced
Hyperinflammation. Immune Network, 20(2), e15. https://doi.org/10.4110/in.2020.20.e15
19. Chen, G., Ran, X., Li, B., Li, Y., He, D., Huang, B., Fu, S., Liu, J., & Wang, W. (2018).
Sodium Butyrate Inhibits Inflammation and Maintains Epithelium Barrier Integrity in a
TNBS-induced Inflammatory Bowel Disease Mice Model. EBioMedicine, 30, 317–325.
https://doi.org/10.1016/j.ebiom.2018.03.030
20. Gao, L., Davies, D. L., & Asatryan, L. (2022). Sodium Butyrate Supplementation
Modulates Neuroinflammatory Response Aggravated by Antibiotic Treatment in a
Mouse Model of Binge-like Ethanol Drinking. International Journal of Molecular
Sciences, 23(24), 15688. https://doi.org/10.3390/ijms232415688
21. Reyes, R. E., Gao, L., Zhang, Z., Davies, D. L., & Asatryan, L. (2022). Supplementation
with Sodium Butyrate Protects Against Antibiotic-Induced Increases in Ethanol
Consumption Behavior in Mice. Alcohol (Fayetteville, N.Y.), 100, 1–9.
https://doi.org/10.1016/j.alcohol.2021.12.003
22. Szabo G. (2015). Gut-Liver Axis in Alcoholic Liver Disease. Gastroenterology, 148(1),
30–36. https://doi.org/10.1053/j.gastro.2014.10.042

51
23. Yunna, C., Mengru, H., Lei, W., & Weidong, C. (2020). Macrophage M1/M2
Polarization. European Journal of Pharmacology, 877, 173090.
https://doi.org/10.1016/j.ejphar.2020.173090
24. Reyes, R. E. N., Al Omran, A. J., Davies, D. L., & Asatryan, L. (2020). AntibioticInduced Disruption of Commensal Microbiome Linked to Increases in Binge-Like
Ethanol Consumption Behavior. Brain Research, 1747, 147067.
https://doi.org/10.1016/j.brainres.2020.147067
25. Peng, L., Li, Z. R., Green, R. S., Holzman, I. R., & Lin, J. (2009). Butyrate Enhances the
Intestinal Barrier by Facilitating Tight Junction Assembly via Activation of AMPActivated Protein Kinase in Caco-2 Cell Monolayers. The Journal of Nutrition, 139(9),
1619–1625. https://doi.org/10.3945/jn.109.104638
26. Wei, Q., Deng, Y., Yang, Q., Zhan, A., & Wang, L. (2023). The Markers to Delineate
Different Phenotypes of Macrophages Related to Metabolic Disorders. Frontiers in
Immunology, 14, 1084636. https://doi.org/10.3389/fimmu.2023.1084636
27. M1 and M2 Macrophage Markers. Retrieved from OriGene website:
https://www.origene.com/research-areas/m1-and-m2-macrophagemarkers#:~:text=M2%20macrophages%20also%20express%20high,produce%20lower%
20levels%20of%20ROS
28. Reyes, R. E. N., Al Omran, A. J., Davies, D. L., & Asatryan, L. (2020). AntibioticInduced Disruption of Commensal Microbiome Linked to Increases in Binge-Like
Ethanol Consumption Behavior. Brain Research, 1747, 147067.
https://doi.org/10.1016/j.brainres.2020.147067
29. Fang, W., Xue, H., Chen, X., Chen, K., & Ling, W. (2019). Supplementation with
Sodium Butyrate Modulates the Composition of the Gut Microbiota and Ameliorates
High-Fat Diet-Induced Obesity in Mice. The Journal of Nutrition, 149(5), 747–754.
https://doi.org/10.1093/jn/nxy324
30. Zhao, Z. H., Wang, Z. X., Zhou, D., Han, Y., Ma, F., Hu, Z., Xin, F. Z., Liu, X. L., Ren,
T. Y., Zhang, F., Xue, Y., Cui, A., Liu, Z., Bai, J., Liu, Y., Cai, G., Su, W., Dai, X., Shen,
F., Pan, Q., Fan, J. G. (2021). Sodium Butyrate Supplementation Inhibits Hepatic
Steatosis by Stimulating Liver Kinase B1 and Insulin-Induced Gene. Cellular and
Molecular Gastroenterology and Hepatology, 12(3), 857–871.
https://doi.org/10.1016/j.jcmgh.2021.05.006
31. Zhu, W., Peng, K., Zhao, Y., Xu, C., Tao, X., Liu, Y., Huang, Y., & Yang, X. (2022).
Sodium Butyrate Attenuated Diet-Induced Obesity, Insulin Resistance and Inflammation
Partly by Promoting Fat Thermogenesis via Intro-Adipose Sympathetic
Innervation. Frontiers in Pharmacology, 13, 938760.
https://doi.org/10.3389/fphar.2022.938760

52
32. Haloul, M., Oliveira, E. R. A., Kader, M., Wells, J. Z., Tominello, T. R., El Andaloussi,
A., Yates, C. C., & Ismail, N. (2019). mTORC1-Mediated Polarization of M1
Macrophages and Their Accumulation in the Liver correlate with Immunopathology in
Fatal Ehrlichiosis. Scientific Reports, 9(1), 14050. https://doi.org/10.1038/s41598-019-
50320-y
33. Marshall, S. A., McKnight, K. H., Blose, A. K., Lysle, D. T., & Thiele, T. E. (2017).
Modulation of Binge-like Ethanol Consumption by IL-10 Signaling in the Basolateral
Amygdala. Journal of Neuroimmune Pharmacology: The Official Journal of the Society
on NeuroImmune Pharmacology, 12(2), 249–259. https://doi.org/10.1007/s11481-016-
9709-2

Abstract (if available)

Abstract AUD, characterized by the inability to regulate alcohol intake, claims millions of lives annually. The economic burden associated with AUD is estimated to be $249 billion, with healthcare costs alone comprising $28 billion. Among its many clinical manifestations, ALD is one of the most prominent and inflicts the most mortalities. The initial event in ALD is hepatic steatosis before progressing into alcohol hepatitis. One factor leading to hepatic inflammation is increased transfer of endotoxin due to alcohol-associated leaky gut. The scope of this work is to determine the potential of butyrate, a SCFA produced by gut microbiota, to treat ALD. In this study, we tested the effects of SB on alcohol-induced changes in the liver (i.e. steatosis, inflammatory response) with C57BL/6J adult male mice using an intermittent 2BC ethanol exposure paradigm. SB was provided in bottles at 8 mg/ml from the beginning of 2BC (prevention group) and after 2 weeks (reversible group). SB supplementation reduced overall ethanol preference and increased non-ethanol liquid intake. The ethanol paradigm did not induce hepatic steatosis, which SB supplementation did not further modulate. There were no substantial changes in mRNA expression of pro- and anti-inflammatory factors in the liver quantified by RT-qPCR. However, SB’s effect on macrophage markers highlighted a shift towards anti-inflammatory M2 polarization as determined through CD68/CD206 ratios. These findings validated the beneficial effect of SB on AUD-associated drinking behavior, but ethanol exposure preclinical models need to be optimized to further evaluate its therapeutic effect on liver health.

Linked assets

University of Southern California Dissertations and Theses

Conceptually similar

PDF

Polarization of microglia by sodium butyrate in Alcohol Use Disorder

PDF

Beneficial effect of antibiotic treatment on alcohol-related liver pathology in mice is not due to reduction in the butyrate-producing gut microbial phyla

PDF

Development of dihydromyricetin (DHM) as a novel therapy for alcoholic liver disease (ALD) and alcohol use disorder (AUD)

PDF

Investigating sodium butyrate effects on liver in a disrupted gut microbiome model of binge-like alcohol consumption in mice

PDF

The study of DHM effects on counteracting ethanol intoxications

PDF

Sodium butyrate prevents antibiotic-induced increase in ethanol drinking in C57BL/6J mice by modulating neuroinflammatory response

PDF

The preclinical evaluation of moxidectin as a platform for drug development for alcohol use disorder

PDF

Role of purinergic P2X7 receptors in inflammatory responses in the brain and liver: a study using a mouse model of chronic ethanol and high-fat diet exposure

PDF

Preclinical investigation of ivermectin as a novel therapeutic agent for treatment of alcohol use disorders

PDF

Development of ivermectin as a platform for the treatment and/or prevention of alcohol use disorders

PDF

Modulation of the renin-angiotensin system (RAS) for the treatment of COVID-19

PDF

Investigation of the anti-alcohol potential of avermectin drugs in in vitro studies of P2X4 and GABA(A) receptors

Asset Metadata

Creator Tai, Alex Tzuchuan (author)

Core Title Investigating sodium butyrate as a potential treatment for alcohol liver disease through the gut-liver axis

School School of Pharmacy

Degree Master of Science

Degree Program Clinical and Experimental Therapeutics

Degree Conferral Date 2024-08

Publication Date 07/30/2024

Defense Date 07/26/2024

Publisher Los Angeles, California (original), University of Southern California (original), University of Southern California. Libraries (digital)

Tag alcohol liver disease,alcohol use disorder,endotoxin,hepatitis,leaky gut,macrophage polarization,OAI-PMH Harvest,pro-inflammatory cytokines,steatosis

Format theses (aat)

Language English

Contributor Electronically uploaded by the author (provenance)

Advisor Asatryan, Liana (committee chair), Davies, Daryl (committee member), Louie, Stan (committee member)

Creator Email alextai@usc.edu,alextaius@gmail.com

Permanent Link (DOI) https://doi.org/10.25549/usctheses-oUC113998HJ3

Unique identifier UC113998HJ3

Identifier etd-TaiAlexTzu-13298.pdf (filename)

Legacy Identifier etd-TaiAlexTzu-13298

Document Type Thesis

Format theses (aat)

Rights Tai, Alex Tzuchuan

Internet Media Type application/pdf

Type texts

Source 20240730-usctheses-batch-1189 (batch), University of Southern California (contributing entity), University of Southern California Dissertations and Theses (collection)

Access Conditions The author retains rights to his/her dissertation, thesis or other graduate work according to U.S. copyright law. Electronic access is being provided by the USC Libraries in agreement with the author, as the original true and official version of the work, but does not grant the reader permission to use the work if the desired use is covered by copyright. It is the author, as rights holder, who must provide use permission if such use is covered by copyright.

Repository Name University of Southern California Digital Library

Repository Location USC Digital Library, University of Southern California, University Park Campus MC 2810, 3434 South Grand Avenue, 2nd Floor, Los Angeles, California 90089-2810, USA

Repository Email cisadmin@lib.usc.edu