University of Southern California Dissertations and Theses

β-catenin couples self-renewal, induction and epithelial morphogenesis and patterning at the outset of mammalian nephrogenesis

(USC Thesis Other)

β-catenin couples self-renewal, induction and epithelial morphogenesis and patterning at the outset of mammalian nephrogenesis

PDF

Download a page range

Download transcript

Copy asset link

Request this asset

Transcript (if available)

Content

β-CATENIN COUPLES SELF-RENEWAL, INDUCTION AND EPITHELIAL MORPHOGENESIS
AND PATTERNING AT THE OUTSET OF MAMMALIAN NEPHROGENESIS

by
Helena Bugacov

A Dissertation Presented to the
FACULTY OF THE USC GRADUATE SCHOOL
UNIVERSITY OF SOUTHERN CALIFORNIA
In Partial Fulfillment of the
Requirements for the Degree
DOCTOR OF PHILOSOPHY
(DEVELOPMENT STEM CELL AND REGENERATIVE MEDICINE)

May 2023

Copyright 2023 Helena Bugacov
ii

Dedication: I would like to dedicate my thesis work to my family,
friends and mentors that have been the village that has supported me
throughout the crusade of my thesis work.

iii

Acknowledgements:
I would like to acknowledge and thank my Ph.D. thesis advisor Dr. Andrew McMahon. This
dissertation work would not have been possible without his guidance, expertise, and support. I
am extremely grateful to have received such a robust scientific training by Dr. McMahon in the
research area of Wnt signaling in Kidney development, of which he is a major thought leader.
Dr. McMahon’s intense focus and relentless pursuit of performing “the right experiment” has
made all the difference. I would like to thank Jill McMahon for her support within the lab at the
beginning of my Ph.D..
I would like to thank Dr. Alex Guo passing off the nephron progenitor culture project to me and
for helping me get started. His mentorship at the beginning of my Ph.D. was essential. I would
also like to help Jinjin Guo for her sustained help and technical training throughout my thesis
work. I would like to thank Dr. Tracy Tran, Dr. Jack Song and Dr. Nils Lindstrom for your support
and intellectual as well as scientific engagement throughout my time as a doctoral student. Your
friendships have also made all the difference in keeping me sane and focused. It has been a
pleasure to develop friendships with scientists who I so fondly admire. I would also like to thank
my collaborator, Dr. Balint Der, for his imaging and quantifying nephron progenitor experiments.
I would like to thank Muskaan Singn for her exporting images as well as quantifying images. I
would like to thank Kari Koppitch for her support and for sharing the uplifting spirits of Teddy
and Laika.
My Ph.D. thesis committee, composed of Dr. Oliver Bell, Dr. Nuria Pastor-Soler, Dr. Scott
Fraser and Dr. Qilong Ying , has been essential in guiding my Ph.D. efforts as well as enabling
my career objectives. Their sustained mentorship, availability and guidance has helped me
tremendously.
Throughout my research career, I have been fortunate enough to have excellent, sustained
mentorship. I would like to thank Dr. Scott Fraser, Dr. Le Trinh, Dr. Masahiro Kitano for instilling
iv

a deep love for developmental biology within me throughout my formative years in high school. I
would like to thank Dr. Eduardo Marban, Dr. Eugenio Cingolani, Dr. Kamran Atabai and Dr.
Micheal Podalski for introducing me to the wonders of stem cell science and regenerative
medicine throughout my undergraduate years. I would like to thank Dr. Carlos Bustamante for
his support in my application of Ph.D. programs as an undergraduate at UC Berkeley.
I would like to thank Dr. Alana Grajewski, Dr. Damon Clark, Dr. Pastor-Soler and Dr. Maria
Ochoa for their support, encouragement and for exposing me to the power of medicine.
Shadowing physicians like you all have inspired my doctoral work and have propelled me
forward in wanting to make a difference.
I would like to thank Irene Alfaro, Dr. Michael Massa and Dr. Damon Clark for supporting the
Health Science Mentors and helping establish the Juvenile Hall Mentorship Program at East
Lake Juvenile Hall. The Health Science Mentors has been a critical component of my
experience as a doctoral student.
I would like to thank my Ph.D. cohort mates “The Pibblettes” for supporting me throughout my
dissertation work. Lunches with the “The Pibblettes” have been the highlight of my day for the
past 6 years. I would like to thank my mother Mariel Mulet, my step-father Andrew Bernstein, my
sister Mimi Bernstein and our dog Rosie for letting me live with them and supporting me through
my Ph.D..I would also like to thank my father, Dr. Alejandro Bugacov, for inspiring me and
instilling a love of science within me throughout my childhood. I also deeply appreciate his
support handling big data throughout my doctoral studies.
The pursuit of a Ph.D. within the high-powered academic environment of the McMahon lab has
been an absolute honor and I feel very fortunate to have had this experience.

v

TABLE OF CONTENTS
Dedication......................................................................................................................................ii
Acknowledgements.......................................................................................................................iii
List of Tables.................................................................................................................................vi
List of Figures..............................................................................................................................viii
Abstract .........................................................................................................................................x
Chapter 1: Introduction..................................................................................................................1
The Kidney: A Vital Organ.................................................................................................1
A Brief overview of Kidney Development..........................................................................2
Nephron Progenitor Positioning Within the Niche.............................................................5
Transcriptional Regulation of the Nephron Progenitor State.............................................9
A) Identity (transcriptional programs) of nephron progenitors...............................9
B) The expansion of nephron progenitors............................................................11
C) Nephron progenitor transcriptional induction…...............................................16
D) The mesenchymal to epithelial transition (MET) of nephron progenitors........24
A reductionist approach to dissect Wnt/β-catenin actions in nephron progenitors..........28
References......................................................................................................................29

Chapter 2: β-catenin couples self-renewal, induction and epithelial morphogenesis and
patterning at the outset of mammalian nephrogenesis…............................................................34
Acknowledgements..........................................................................................................34
Introduction .....................................................................................................................35
Results.............................................................................................................................37
Discussion.......................................................................................................................70
Methods...........................................................................................................................75
References......................................................................................................................87

Chapter 3: β-catenin operates concomitantly with α-catenin and cadherins to mediate the
mesenchymal to epithelial transition of nephron progenitors…………........................................98
Acknowledgements..........................................................................................................98
Introduction .....................................................................................................................99
Results...........................................................................................................................102
Discussion.....................................................................................................................126
Methods.........................................................................................................................128
References....................................................................................................................136

Chapter 4: Discussion...............................................................................................................140
The role of β-catenin in 1) self-renewal of NPCs...........................................................141
The role of β-catenin in 2) the transcriptional induction of NPCs...................................142
The role of β-catenin in 3) the cellular morphology changes resulting in the
mesenchymal to epithelial (MET) transition of NPCs....................................................143
Future experiments to mechanistically probe β-catenin’s multiple functions.................145
Comparison of Wnt/B-catenin actions in other mammalian stem/progenitor cell
systems..........................................................................................................................147
Concluding Remarks.....................................................................................................149
References....................................................................................................................151

vi

List of tables
All tables (.csv files) can be downloaded through the USC Digital Library
Chapter 2:
Table_1_low_CHIR_vs_highCHIR_DEseq2_log2fc_0.5_padj_0_05.csv
Table_2_low_CHIR_vs_No_CHIR_DEseq2_log2fc_0.5_padj_0_05.csv
Table_3_KO_1.25CHIR_Cre_log2fc_0.5_padj_0_05.csv
Table_4_KO_1.25CHIR_Cas9_log2fc_0.5_padj_0_05.csv
Table_5_KO_5CHIR_Cre_log2fc_0.5_padj_0_05.csv
Table_6_KO_5CHIR_Cas9_log2fc_0.5_padj_0_05.csv
Table_7_1_25_uMCHIR_down_Cas9_Cre_Intersection_12_17_22.csv
Table_8_1_25_uMCHIR_up_Cas9_Cre_Intersection_12_17_22.csv
Table_9_5uMCHIR_Down_Cas9_Cre_Intersection_12_17_22.csv
Table_10_5uMCHIR_up_Cas9_Cre_Intersection_12_17_22.csv
Table_11_1.25uMCHIR_KO_CRE_CAS9_GO_interesction_down_12_19_22.csv
Table_12_1.25uMCHIR_KO_CRE_CAS9_GO_interesction_UP_12_19_22.csv
Table_13_5uMCHIR_KO_CRE_CAS9_GO_interesction_down_12_19_22.csv
Table_14_5uMCHIR_KO_CRE_CAS9_GO_interesction_UP_12_19_22.csv
Table_15_12_16_22_GO_Down_LowCHIR_vsHigh_CHIR.csv
Table_16_12_16_22_GO_UP_LowCHIR_vsHigh_CHIR.csv
Table_17_12_16_22_GO_UP_LowCHIR_vsNo_CHIR.csv
Table_18_12_16_22_GO_Down_LowCHIR_vsNo_CHIR.csv
Table_19_Controls_1_25_vs_5_CHIR_Cas9_log2fc_0.5_padj_0_05.csv
Table_20_12_27_22_Tcf_KO_5CHIR_Cas9_log2fc_0.5_padj_0_05.csv
Table_21_12_27_22_Tcf_KO_1_25CHIR_Cas9_log2fc_0.5_padj_0_05.csv
Table_22_5uMCHIR_ctnnb1_down_OL_intersect_tcf_down_12_27_22.csv
Table_23_low_high_CHIR_Ctnnb1_Lef1_Tcf7_q_8_Cutt_of_combined.output.csv
Table_24_B-catenin_down_282_Chip_tcf7_Lef1_ctnnb1_intersection.csv
Table_25_gene_282_union_gene_intersection_updated_scRNA-seq.csv
Chapter 3:
Table_1_12_8_22_highchir_ctrlvs_CdhKO_log2fc_0.5_padj_0_05.csv
vii

Table_2_12_8_22_highchir_ctrlvs_CdhKO_log2fc_0.5_pvalue_0_05.csv
Table_3_12_8_22_highchir_ctrlvs_Ctnna1KO_log2fc_0.5_padj_0_05.csv
Table_4_12_8_22_highchir_ctrlvs_Ctnna1KO_log2fc_0.5_pval_0_05.csv
Table_5_12_8_22_lowchir_ctrlvs_cdhKO_log2fc_0.5_padj_0_05.csv
Table_6_12_8_22_lowchir_ctrlvs_acatKO_log2fc_0.5_padj_0_05.csv
Table_7_12_8_22_ctrl_lowchir_vs_highchir_log2fc_0.5_padj_0_05.csv

viii

Lists of figures:
Chapter 1: Introduction
Figure 1: Introduction to the urogenital system………………………………………………………1
Figure 2: Introduction to the initiation of kidney development………………………………………3
Figure 3: Introduction to the nephrogenic zone………………………………………………………6
Figure 4: Single cell RNA sequencing and mapping of kidney development……………………..8
Figure 5: Canonical Wnt Signaling…………………………………………………………………….11
Figure 6: Cell types in the nephrogenic zone………………………………………………………...16
Figure 7: Schematic representation of Tcf/Lef factor switching innephron progenitor cell
maintenance and induction…………………………………………………………………………….22
Figure 8: Introduction to the Mesenchymal to epithelial transition of nephron
progenitor cells…………………………………………………………………………………………..24

Figure 9: Schematic representation of β-catenin roles at the cell membrane…………………….26
Chapter 2: β-catenin couples self-renewal, induction and epithelial morphogenesis and
patterning at the outset of mammalian nephrogenesis.
Figure 1: NPEM culture provides a rapid and consistent method for studying
Wnt supported NPC maintenance and commitment……………………………………….……….42

Figure 2: mRNA transfection provides rapid Cre or Cas9 mediated removal of β-catenin in
primary mouse nephron progenitors…………………………………………………………………..47

Figure 3: β-catenin promotes NPC proliferation but is not a transcriptional regulator
of the self-renewal program…….……………………………………………………………………...51

Figure 4: Cell morphology/induction status changes resulting from β-catenin
removal in nephron progenitors in high CHIR.……………………………………………………….55

Figure 5: Transcriptional changes resulting from β-catenin removal in nephron progenitors…..59

Figure 6: Tcf/Lef transcription factor removal in nephron progenitors enables β-catenin
target validation……………………………………………………………….…………………………63

Figure 7: Integration of published ChIP seq data and scRNA-seq data with β-catenin target
genes reveals a suite of genes responsible for the early induction of NPCs and
patterning of the developing nephron…………………………………..……………………………..68

ix

Chapter 3: β-catenin operates concomitantly with α-catenin and cadherins to mediate the
mesenchymal to epithelial transition of nephron progenitors.
Figure 1: Increasing Wnt/β-catenin activity in nephron progenitor cell culture
stabilizes cell-cell contacts and models the first step of aggregation and cellular
induction…………………………………………………………………………...……………………105
Figure 2: In vivo and in vitro characterization of Cadherin expression reveals differential
cadherin expression within the self-renewing and patterning developing nephron…………….111
Figure 3: In vivo and in vitro characterization of α-catenin expression reveals
co-expression with β-catenin within the self-renewing and patterning developing
nephron…………………………………………………………………………………………………115
Figure 4: Individual cadherin removal does not affect jagged1 expression or cell
aggregation……………………………………………………………………………….…………….117
Figure 5: Compound cadherin removal maintains NPC transcriptional induction
status however ablates cell adhesion and phenocopies α-catenin
removal…………………………………………………………………………………………….……120

Figure 6: Nephron progenitors with compound cadherin removal and α-catenin
removal are not transcriptionally distinct from induced nephron
progenitors……………………………………………………………………………………………...124

Chapter 4: Discussion
Figure 1: Schematic representation of β-catenin-cadherin -catenin interactions
in mediating MET.……………………………………………………………………………………..145

Figure 2: Schematic representation of β-catenin point mutations affecting Tcf/Lef,
α-catenin, cadherin interactions…………….………………………………………………………..146

x

Abstract
Wnt/β-catenin signaling is a highly conserved molecular pathway that plays a crucial role in
stem/progenitor systems and cancer. β-catenin, the main Wnt pathway effector, has two pools
within a cell: one for cell-cell adhesion at the membrane and the other for transcriptional
functions in the nucleus. However, the mechanism by which β-catenin mediates both roles
remain unclear.
The tightly controlled, well characterized system of nephrogenesis is an ideal model to decouple
the roles of β-catenin at the membrane and in the nucleus. In kidney development, a delicate
balance of nephron progenitor cell self-renewal and differentiation is required for the
mesenchymal to epithelial transition (MET) in nephrogenesis and is driven by Wnt/β-catenin
signaling. Given an ability to isolate and manipulate large numbers of NPCs in tissue culture
(Brown 2015), we can dissect the dual nature of β-catenin as a transcriptional activator and
component of a cell membrane complex in adhesion.
I pioneered a method using CRISPR/Cas9 gene editing to rapidly remove β-catenin, Tcf/Lef
factors and simultaneous cadherin genes in primary NPCs. We have characterized the effects
of modulating β-catenin and integrated RNA-seq results from β-catenin’s removal with mouse
ChIP-seq and mouse single cell RNA -seq data. Functional analysis of β-catenin removal
provides strong evidence for β-catenin regulation of NPC proliferation, independent of a direct
Lef/Tcf associated transcriptional program. Together these data suggest β-catenin mediates
aggregation, the first step in MET, through catenin cadherin cell adhesion complexes, stabilizing
cell-cell contacts and transcriptional activation within these structures initiating the nephrogenic
program. The studies provide new insight into the direct transcriptional role of Lef/Tcf/β-catenin
complexes associated with the initiation of a nephron forming program. Overall, this study
enhances an understanding of the molecular mechanisms underlying kidney development and
stem/progenitor systems.
1

Chapter 1: Introduction
The Kidney: A Vital Organ
The kidneys are essential
organs that are responsible for
filtering and chemically
balancing blood. Each day, the
human kidney system filters
approximately 200 liters of fluid,
allowing toxins, metabolic waste
products, and excess ion to be
excreted while keeping
essential substances in the
blood (Ogobuiro and Tuma 2022). The nephron units of the kidney play a critical role in this
process by filtering blood and creating urine (Figure 1) (McMahon 2016).
Humans are born with 1 million nephrons in each kidney which are essential to cleaning a
lifetime of blood at birth (McMahon 2016). Aging, hypertension, kidney injury and diabetes lead
to nephron loss and lack of proper kidney function resulting in Chronic Kidney Disease (CKD)
(Pyram, Kansara et al. 2012, Denic, Glassock et al. 2016). Patients with CKD or End Stage
Renal Disease (ESRD) often have limited treatment options, including dialysis or kidney
transplantation. Although dialysis is an essential palliative solution, it is costly and associated
with high morbidity and mortality. Kidney transplantation is an often-preferred solution to dialysis
but there is a severe shortage of available kidneys for transplantation.
Therefore, new strategies to treat kidney disease are in demand and regenerative nephrology
holds great promise. Several groups have demonstrated directed differentiation of kidney-like
structures from mouse and human pluripotent stem cells (Little, Hale et al. 2019, Little, Kumar et
Figure 1: A) The Urogenital System consisting of kidneys,
ureter and bladder B) a nephron unit (1 million in one
human kidney). Image created using BioRender
2

al. 2019). These advances offer the prospect of modeling kidney diseases and functional kidney
substitutes (Morizane and Bonventre 2017). As the functional unit of the kidney is the nephron,
understanding how nephrons are generated is of fundamental importance to the field of
regenerative nephrology.
A precise spatiotemporal regulation of stem/progenitor cells is essential for proper kidney
development. In mammals, the development of nephrons, the functional units of the kidneys, is
balanced through a prolonged period of nephron progenitor cell (NPC) maintenance and
commitment, which determines the species-specific endowment of nephrons, with around
14,000 in mice and 1,000,000 in humans (McMahon 2016). NPCs give rise to at least 26 unique
cell types capable of distinct physiological functions that collectively are required to sustain life
(Ransick, Lindstrom et al. 2019). Nephron formation in mammals ends when the NPC pool is
depleted at late fetal or early postnatal stages in mice (Short, Combes et al. 2014).
Consequently, injury and disease can trigger repair of existing nephrons, but injury and aging
can also jeopardize nephron count and function. Considering that the humans lose the innate
ability to create new nephron tubules after birth, the ability to artificially create nephrons or
alternate filtration units to clean blood is of great importance (McMahon 2016).
Kidney Development: An Overview
In kidney development, paired nephric ducts emerge at rostral somite levels around E8.75. As
these ducts migrate posteriorly, they induce mesonephric tubule-like structures. The nephric
ducts continue to move laterally along the mesonephros until they reach the hindlimb level on
E10.5, where they approach a specified set of cells called the metanephric mesenchyme (MM).
Secretory factors produced by the MM attract the nephric ducts (McMahon 2016).
The entire urogenital tract, including the kidneys, develops from the intermediate mesoderm.
During embryonic development, at around E9.0, a lineage of Wt1-expressing progenitor cells
emanates from an Osr1(+) intermediate mesoderm (Larssen 1995). The Nephric ducts, which
3

arise from the dorsal portion of the intermediate mesoderm, specify the wolffian duct while the
ventral portion remains undifferentiated. The nephric duct signals lead to the formation of
primitive renal like structures that filter blood for a short period of time before the kidneys
develop. The passing of the adjacent nephric ducts in a rostral to caudal fashion first creates
pronephros and mesonephros. Finally, as the nephric ducts travel caudally towards the hindlimb
where signals from the MM hither the epithelial nephric duct towards a pool of specified
mesenchymal cells (Kopan, Chen et al. 2014) (McMahon 2016).
Here, the mesenchymal cells induce the formation of a single bi-lateral creating the UB, which
grows medially into the positioned (Wt1+/ Osr1+/Six2+) metanephric mesenchyme. Prior to this
invasion, the MM becomes specified by a series of transcription factors, with Six2 being
essential for the maintenance of the MM as a self-renewing, equipotent cell population capable
of giving rise
to all nephron
cell types,
including the
podocyte and
the most
distal portion
of the
nephron that
connects to
the
collecting duct (McMahon 2016).
Figure 2: The ureteric bud (UB) invades the metanephric mesenchyme (MM) at
e11.5.
4

The development of the kidney involves the convergence of two distinct tissue types: epithelial
and mesenchymal. This process is initiated by two independent developmental events that
specify the formation of these two tissues, which ultimately connect. The first event is the
formation and migration of the mesonephric duct, which gives rise to the collecting duct
progenitors, the cells that make up the urine drainage system of the body. This process occurs
prior to the formation of the epithelial tissue. The second event is the specification of a
metanephric mesenchyme that harbors progenitors for nephron and interstitial lineage. If this
specification is not in place (ie specified), at the hindlimb level, and if GDNF and FGFs are not
secreted when the mesonephric duct emerges, then the ureteric bud will not grow outwards and
invade the metanephric mesenchyme (Shakya, Watanabe T Fau - Costantini et al. , Pepicelli,
Kispert et al. 1997, Costantini 2012) (McMahon 2016). The inductive role of the Ureteric Bud
(UB) in directing nephrogenesis was first observed by Grobstein in the 1950’s (Grobstein 1953).
The first ingrowth of the bud is initiated from signals from the surrounding mesenchyme.
Branching morphogenesis after the initial ingrowth is driven by signals from the surrounding
mesenchyme caps which form around the tips of the branching buds, creating many
nephrogenic zones from which a species specific number of nephrons will emerge (Figure
2)(McMahon 2016).
The nephrogenic zone consists of the cap mesenchyme (CM), ureteric epithelium (UE)/(UB)
and the surrounding stromal progenitors (SPs) (Figure 2). Nephron progenitor cells lying in the
CM lie between the ureteric tips and SPs. SPs will later give rise to the interstitium of the kidney,
mesangial cells, pericytes and part of the kidney vasculature. All three major renal progenitor
cells lie next to each other and require paracrine signaling for their self-renewal and
differentiation. Nephron progenitors are instructed to either self-renew or differentiate by inputs
from their surrounding cells of the nephrogenic zone (NZ). Like many organ systems, stem
5

progenitors play a key role in their development. Proper balance of NPC self-renewal and
induction is vital for the proper orchestration of the reiterative process of nephrogenesis.
In the mouse, the proper regulation of self-renewal and commitment is essential in the
extraordinary production of 14,000 nephrons within 10-12 days (McMahon 2016). The same few
signaling pathways (Wnt, Fgf, BMP and Notch) are used time and again in different
developmental systems (Skin, Gut, Brain, Liver, ES cell etc.) and are crucial in the nephron
formation (Merrill, Gat et al. 2001, Ying, Wray et al. 2008, Nusse and Varmus 2012, Gehart and
Clevers 2019).
The coordinated morphological events that occur in the creation of the early nephron make
NPCs an ideal system to parse out key mechanisms governing self-renewal and differentiation
of stem/progenitors. Patterns observed from nephrogenesis can inform mechanisms governing
stem/progenitor systems and cancer at large.
Nephron Progenitor Positioning Within the Niche:
The specific organization of the niche suggests that the relative organization is important to the
expansion and maintenance of nephron progenitors is shown by various perturbation
experiments hindering NPC niche organization (Wellik, Hawkes et al. 2002, Kobayashi, Valerius
et al. 2008, Naiman, Fujioka et al. 2017, O'Brien, Combes et al. 2018).
A main characteristic of a progenitor stem niche is the proximity of signaling within a short range
of cells (Clevers, Loh et al. 2014). The NPC niche created by the outer lying stromal progenitors
(SPs) and inner ureteric bud (UB) create a unique environment for the highly mobile NPCs
(Lawlor, Zappia et al. 2019) (Figure 3).
NPCs swarm around the caps of the niche and around the UB tips (Combes, Lefevre et al.
2016). Nephron progenitor movement is stochastic. Imaging of NPCs within the CM has
demonstrated that NPCs can migrate to neighboring CM’s while maintaining NPC identity
6

(Combes, Lefevre et al. 2016). Light and electron microscopy from 1975 of the NPC niche and
the UB reveal loose extensions extending from the NPCs towards the UB (Lehtonen 1975)
swarm. NPCs detach and reattach to the UB and interpret both attractive and repulsive inputs to
either migrate downward or continue to swarm at the upper portion of the bud (Combes, Lefevre
et al. 2016).
Once committed, NPCs tightly cluster, upregulate induction genes such as Wnt4 and form the
pre-tubular aggregate (Stark, Vainio et al. 1994, Merrill, Gat et al.) and epithelize creating the
Renal Vesicle (RV). Upon epithelization and creation of a lumen, induced NPCs (iNPC) acquire
a proximal distal axis specifying their future cell types. However, it remains unclear when and
how induced NPCs become fully specified to any functional nephron cell type (Lindstrom, De
Sena Brandine et al. 2018).
Wnt4+ NPCs rarely move upstream and reintegrate into the niche, they can integrate into the
stromal compartments and vice versa; however, these events are micro-phenomenal. Although
these observations using explant imagining and genetic mice strains reveal the exceptions
Figure 3: A) The ureteric bud (grey) invading the metanephric mesenchyme and B)
branches many times throughout development creating many C) nephrogenic zones leading
to the formation of thousands of nephrons (14,000 mouse and 1,000,000 human).
7

rather than the rule of NPCs (Combes, Lefevre et al. 2016, Lawlor, Zappia et al. 2019), they
provide insight into the mechanisms governing the regulation and tight control of the
construction of well-organized compartments within the NZ.
Cell-cell interactions with the surrounding cell types such as SP’s and UE progenitors affects the
NPC state. For example, the UE maintains nephron progenitors within their niche through non-
canonical Wnt11 signaling (O'Brien, Combes et al. 2018). The organization of NPCs tightly
around the UB tips is characterized by a Wnt11-dependent interaction between the NPCs and
the UB. Here, NPCs attach to the UB through stable, yet flexible cytoplasmic extensions
maintained by noncanonical Wnt11 signaling from the UB. Loss of this attachment disrupts
NPCs, leading to premature induction as well as the creation of a disorganized NPC
compartment. Loss of Wnt11 in the niche results in the diminishment of the NPC pool and
smaller kidneys with fewer nephrons (O'Brien, Combes et al. 2018).
On the other side of the NPCs (NPCs are between the UB and SPs), SPs embrace the NPC
niche and create a compact environment that maintains and coordinates their growth. SPs give
rise to the interstitium of the kidney and holds vascular progenitors. In this, SPs regulate the
expansion of the nephron progenitor compartment (Naiman, Fujioka et al. 2017). An over
expanded NPC pool would disrupt the short range signaling required for the maintenance of the
nephron progenitor as well as disorganize the niche. Moreover, Pax2, a transcription factor
present in the uncommitted NPCs is known to repress the interstitial cell fate and creates an
interspatial/nephron progenitor boundary within the nephrogenic zone (Naiman, Fujioka et al.
2017). NPCs without Pax2 to differentiate and take on an interstitium-like cell identity (Naiman,
Fujioka et al. 2017).
At onset of the metanephric kidney, a subset of cells expresses both Six2 and Foxd1 in the MM.
In this, Foxd1 marks the self-renewing stromal compartment; however a rare Foxd1 linages
traced cell can end up in the NPC compartment (Kobayashi, Mugford et al. 2014). Loss of
8

Foxd1 leads to an expansion of uncommitted NPCs and a loss of committed NPCs suggesting
that Foxd1 in the stroma has an important role in the induction of NPCs (Fetting, Guay et al.
2014).
NPC specification is crucial for not only initiating the ingrowth of the UB allowing for
nephrogenesis to take place, but also for transcriptionally creating a district subset of cells within
the CM that proliferate to account for cells that have been induced through many rounds of
nephrogenesis, thereby renewing the progenitor pool. Moreover, size of the cap mesenchyme is
key to the establishment of a proper nephrogenic program. Size regulation of the NPCs is
carried out by cadherin interactions. Knock out studies of the atypical cadherin Fat4 reveals
that SP Fat4 signaling acts with its ligands Dachsous (Dhs1/2) to restrict the NPC pool
(Bagherie-Lachidan, Reginensi et al. 2015). SP-NPC mediated interactions by Fat4 regulate the
size of the niche, a tenant of Fat4 signaling often used to regulate organ size and planar cell
polarity. Therefore, the unique organization of the nephrogenic zone created by the progenitor
Figure 4: A) Schematic representation of the developing nephron with annotated clusters
according to domains of the developing kidney B) UMAP of clusters of the developing
nephron C) feature plots of gene expression of Six2 (self-renewal), Wnt4 (early induction
marker) and Jagged1 (induction and nephron patterning gene) in the developing
nephron.
9

cell types that surround NPCs enables both the expansion of a progenitor pool and coordinated
induction to create differentiated cell types of the nephron.
Transcriptional regulation of the nephron progenitor state and transcriptional regulation
subsequent nephron formation is a critical area of research in nephrology. Insights into the in
vivo regulation of nephrogenesis provides an invaluable framework for artificially creating higher
order kidney like structures using stem cells. Recent advances in Single Cell RNA sequencing
(Sc-RNA-Seq) have provided new insights into the expression of ligands and receptors within
different cell populations in nephrogenic zone (NZ) including the UB, NPC, SPCs. By analyzing
the ligand receptor cross talk between these three cell types, we can better understand the
pathways involved in NPC regulation (Combes, Phipson et al. 2019). Sc-RNA-Seq data is an
incredibly useful resource in hypothesis testing and experimental design. The McMahon Lab
has generated a robust P0 mouse sc-RNA-seq data set that has enables one to verify in vitro
observations and design targeted follow up experiments within an in vivo framework (Figure 4).
Resources made available to the public such as The Human Nephrogenesis Atlas (Lindstrom,
Sealfon et al. 2021) have made hypothesis testing easily accessible as no coding experience is
required to quickly access expression patterns of genes of interest and has also enabled us to
quickly cross reference species conservation between mouse and man.
Transcriptional Regulation of the Nephron Progenitor State:
A) Identity (transcriptional programs) of nephron progenitors:
A NPC is characterized as a cell that is capable of giving rise to all nephron cell types through
induction and can also self-renew to create more NPCs in the maintenance state (Kobayashi,
Valerius et al. 2008). The nephrogenic niche allows NPCs to both proliferate rapidly and
maintain their identity. NPCs are believed to be equipotent as all NPCs are equally capable of
making any mature nephron cell type (Kobayashi et al., 2008), (Schnell, Achieng et al. 2022) .
10

However, NPCs are not a homogenous cell population, as cells within the niche are in distinct
cell states based on their position, age within the niche and signals they receive from their
surroundings (Brown, Muthukrishnan et al. 2013, Chen, Brunskill et al. 2015).
The transcriptional regulation of NPC maintenance has been studied extensity involving the
relationships between several key genes such as Hox11, Six2, Sall1, Eya1, Myc, and Osr1.
These key genes not only act concomitantly in regulating their expression by creating unique
protein complexes at transcription sites but also can work to regulate their own expression.
During organogenesis, the “positional value” as well as “positional identity” is associated with
the Hox code of transcription factors. Hox11 paralogs are expressed in the correct position at
the right time to coordinate the anterior-posterior axis of the metanephric kidney. A key event in
the induction of nephrogenesis is the attraction of the UB to the MM. Hox11 specifies the MM.
Hox11 paralogs act redundantly as triple mutants of Hox11a,c,d have stark phenotypes of
kidney agenesis and are required for the expression of Gdnf, the main chemo-attractive signal
for the UB to invade the MM (Wellik, Hawkes et al. 2002). In this, the UB initiates reciprocal
signaling interactions where the UB expresses Ret and initiates a positive feedback loop
involving the expression of Gdnf from the NPC which, in turn, activates Ret and Wnt11 form the
UB (McMahon 2016).
Hox11 paralogs along with other transcription factors responsible for specifying MM regulate
Wnt11 expression. Drosophila studies have demonstrated that Six and Eya cooperate to
activate target genes and that Six factors are translocated to the nucleus via Eya (Ohto,
Kamada S Fau - Tago et al.). Eya1 lies upstream of Six2 as conditional inactivation of Eya1
leads to loss of Six2 expression subsequent premature induction of NPCs (Xu, Wong et al.
2014). The maintenance state and identity of NPCs are mediated by interactions between Eya1,
Six2, and Myc (Xu, Wong et al. 2014). Six2 maintains the NPC state and signifies NPC identity
as NPCs are induced prematurely without Six2 (Self, Lagutin et al. 2006) . NPCs emerge from
11

Osr1+ intermediate mesoderm; however, Six2 is required to maintain expression of Osr1.
Removal of Osr1 in the cap mesenchyme results in premature depletion of nephron progenitor
cells causing renal hypoplasia. Osr1 and Six2 have been shown to act synergistically to prevent
premature induction of NPCs and maintain an NPC progenitor state. Protein interaction and
mouse genetic studies have shown that Osr1 is critical maintaining in Six2-dependent
maintenance by stabilizing Tcf-Groucho transcriptional repression to antagonize Wnt mediated
NPC induction.
B) The expansion of nephron progenitors:
Canonical Wnt signaling
mediated by β-catenin
(Figure 5) and
specifically the Wnt9b
ligand has been thought
to regulate the
proliferation and self-
renewal aspect of the
NPC niche whereas the
repression of Wnt
responsiveness has also
been also associated
Figure 5: Schematic representation of the Wnt signaling pathway: wnt signaling is activated
as a Wnt ligand binds to its receptors. This sequesters a group of proteins in the cell called the
b-catenin destruction domain (Axin, Ck1, APC, GSK3β) to the membrane. β -catenin, a Wnt
pathway effector, is safe from destruction and levels of β-catenin accumulate in the cytoplasm
and can enter the nucleus. When β -catenin enters the nucleus, it interacts with Tcf/Lef family
transcription factors to activate Wnt target genes. CHIR 99021 is a commonly used GSK3β
inhibitor used as a Wnt agonist in culture (schematic courtesy of Alex Guo).
12

with the maintenance of NPC character as a means of repressing the induction program
(Karner, Das et al. 2011) (Xu, Wong et al. 2014).
Tcf/Lef factors bind to Wnt response elements and in the absence of a Wnt input are often
bound by co-repressors such ad Tle (Xu, Liu et al. 2014). When a Wnt ligand binds to its
receptors it leads to the stabilization of β-catenin; β-catenin can accumulate in the nucleus and
replace Tle binding on Tcf/Lef factors (Figure 5)(Cadigan and Waterman 2012).
Wnt9b is important for NPC proliferation and loss of Wnt9b leads to reduction in the NPC pool
which phenocopies the loss of β-catenin in NPCs. Similar phenotypes as a result of Wnt9b
mutations and β-catenin mutations in NPCs has indicated that Wnt9b via β-catenin mediates the
maintenance transcriptional program of NPCs (Karner, Das et al. 2011) (Carroll, Park et al.
2005). Because β-catenin has been shown to act canonically, through Tcf/Lef engagement, in
NPC induction (Park, Ma et al. 2012), it has been postulated that β-catenin also transcriptionally
regulates the maintenance signature in a canonical manner (Karner, Das et al. 2011).
This thesis provides an extension of work from the McMahon Laboratory presented in Guo
2021, has enabled a more refined understanding of the role of β-catenin in the maintenance
state of NPCs. Experimental evidence suggests that β-catenin is required for the proliferation of
NPCs but does not mediate transcription of the maintenance program.
Evidence of the role of Wnt/ β-catenin in mediating proliferation of NPCs is implicated
throughout many states of kidney development. Removal of Wnt9b between E15.5 and E17.5
resulted in significantly smaller kidneys compared to wildtype (Karner, Chirumamilla et al. 2009).
However, upon removal of Wnt9b at early stages such as E10.5, the MM still experiences the
first invasion and branching event from the UB suggesting that Wnt9b does not have a critical
role in initiating the ingrowth and earliest branching. These mutants also express Wnt11 and C-
ret in the UB and only have a minimal loss of Gdnf.
13

The drastically smaller kidneys resulting from Wnt9b mutants still express NPC maintenance
genes such as Itga8, Bmp7, Pax2, Six2 and Wt1, indicating that that canonically acting Wnt9b
may not regulate the NPC maintenance signature Therefore, the establishment of the MM is not
dependent on Wnt9b coming from the UB (Carroll, Park et al. 2005).
At E11.5 Six2/Wnt9b double mutants exhibit a mild decrease in Gdnf expression, indicating a
potential role for Six2 in regulating Gdnf expression. Interestingly, the loss of Gdnf in
Six2/Wnt9b double mutants is not lost due to a loss of NPCs as Eya1 remains expressed in the
mesenchyme of these cells. Tafa5, a marker of uncommitted NPCs according to Karner 2011
was lost in NPC mutants however, the loss of Wnt9b targets did not reflect a loss of the
progenitor domain as several Wnt9b independent progenitor markers, including Eya1 and Pax2,
were still present in both Wnt9b and Six2 mutants at this stage (Carroll, Park et al. 2005, Self,
Lagutin et al. 2006, Kobayashi, Valerius et al. 2008).
The role of β-catenin in mediating the transcriptional program of NPCs in the maintenance state
has been debated for decades. β-catenin ChIP-qPCR identified a suit of genes that were β-
catenin targets the mediated the self-renewal state (Karner, Das et al. 2011). Close examination
of the role of β-catenin in mediating self-renewal and induction using primary nephron progenitor
culture (Brown, Muthukrishnan et al. 2015) and Tcf/Lef/ β-catenin ChIP as well as Bulk-RNA seq
only corroborated a small subset of genes were differentially expressed and displayed
differential Tcf/Lef/β-catenin binding upon changing Wnt/β-catenin activation in culture (Guo,
Kim et al. 2021). Moreover, NPC maintenance identity genes such as Six2, Cited1, Eya1 were
not differentially expressed in NPC maintenance conditions where a low level of Wnt stimulus
was provided compared to absence of Wnt activity, suggesting that Wnt stimulus was not
required for the activation of the maintenance signature.
Wnt input has been shown to have a pro-proliferative effect on NPCs in the maintenance state
(Brown, Muthukrishnan et al. 2015). In Wnt9b mutants, NPCs have a higher rate of apoptosis as
14

measured by live-tracking and results in the premature exhaustion of NPCs. Pronounced cell
death was observed at E17.5 (could be the accumulation of earlier removals) but was not as
drastic at earlier stages such as 11.5. The importance of this proliferation reflects the size of the
niche where NPC niches are larger and house more cells at 11.5 compared to 17.5 (Rumballe,
Georgas et al. 2011). Loss of Six2 in NPCs also results in apoptosis and has been shown to
function cell autonomously in the maintenance of NPCs (Self, Lagutin et al. 2006, Kobayashi,
Valerius et al. 2008).
Wnt gradients are characteristically known to organize cell identity in embryo development
through the classical example of the midline Wnt gradient organizing the segmentation of the
developing central nervous system (Megason and McMahon). Recent in vitro work establishing
NPC culturing system using a Nephron Progenitor Expansion Media (NPEM) infers a potential
Wnt9b gradient establishing either self-renewal or induction conditions(Brown, Muthukrishnan et
al. 2015).
A key component of NPEM media is Gsk3B antagonist (ie Wnt agonist) CHIR (CHIR 99021)
(Figure 5) where a low level of CHIR is required to maintain the proliferative aspect of NPEM
culture allowing for expansion of NPCs while maintaining them in a uniform Cited1 positive
state. Increase of CHIR by 4-fold leads to the induction of these cells as marked by Wnt4 and
Jag1. In vitro observations inform an in vivo model suggesting a gradient in Wnt9b activity along
the UB/UE. Here, low levels of Wnt9b input lead to low β-catenin activity in the self-renewing
compartment of the niche and a higher level of Wnt9b along the stalk leads to high levels of β-
catenin activity acting to induce NPCs (Brown, Muthukrishnan et al. 2015, Guo, Kim et al. 2021).
Other Wnt effectors are crucial to maintaining the NPC state and can possibly attenuate the
level of Wnt input received. Frizzled Wnt receptors availability at the cell membrane is regulated
by receptor endocytosis and can negatively impact Wnt signaling. Their action is counteracted
by R-spondin a family of secreted molecules that bind to the Wnt frizzled co-receptors G-
15

protein-coupled receptors. R-spondin blocks endocytosis of the Wnt receptor complex and
promotes Wnt signaling. Nephron progenitors as well as stromal progenitors express R-spondin
transcripts and recent work highlights their importance in promoting maintenance and induction
of NPCs (Combes, Phipson et al. 2019, Vidal, Jian-Motamedi et al. 2020). Rspo1 and Rspo3
are both expressed in the CM (GUDMAP). Rspo1,3 is present in the NZ however Rspo1 is
limited to NPCs whereas Rspo3 is present in NPCs and SPCs and is important in regulating the
niche in both NPCs and SPs. Rspo3 is expressed in the stromal as well and fits with a
previously reported model where NPCs require stromal input to activate induction (Das,
Tanigawa et al. 2013). Here, Rspo3 expressed from the stromal compartment could enhance
the ability of cells in the ‘primed’ state to interpret more inductive Wnt9b input allowing by
stabilizing Wnt receptors at the membranes of NPCs (Vidal, Jian-Motamedi et al. 2020).
Wnt/β-catenin singling is not the only pathway that has dual roles in the maintenance and
commitment of NPCs. The BMP pathway has a role in maintaining NPCs as well as priming
them prior to induction. The BMP pathway has two working in arms in the NPCs: MAPK/JNK
and Smad. Bmp7 is made in the UB as well as the NPC and offers anti-apoptic support for
NPCs as Bmp7-/- leads to apoptosis. Bmp7 promotes proliferation of nephron progenitors by
directly activating the Jun-ATF2- Mapk-Jnk Axis through the activation of Bmp7 functions to
activate the JNK-Jun-ATF2 signaling axis directly in Six2+cap mesenchyme through the
upregulation of cyclin D3 (Blank, Brown et al. 2009, Brown, Muthukrishnan et al. 2013). Bmp7
also promotes the transition from G1 phase to S phase via Mapk effectors Tak1, JNK, Jun and
Myc and JNK has also been known to interact with non-canonical Wnt pathways (Yamanaka,
Moriguchi et al. 2002) (Muthukrishnan, Yang et al. 2015).
Edu chasing studies within the NPC niche revealed that there is positional heterogeneity within
the niche correlated with Six2 expression as well as its proliferative signature. Fast cycling cells
are in the inner compartment of the niche closest to the UB and have lower Six2 protein
16

signature. Cells with a lower proliferative signature are located on the periphery and have higher
Six2 protein expression. This model supports the notion that Wnt9b input could lead to the
proliferation of NPCs considering that the fast-cycling cells are closest to the UB. These cells
may be “primed” and moderately induced and on their way towards induction as Six2 levels are
diminishing. The slow cycling cells in this could be cells in the ground state, with a lower
exposure to Wnt9b signaling and are in the maintenance state (Brown, Muthukrishnan et al.
2013, Short, Combes et al. 2014). Deeper analysis into the compartmentalization of these
prospective cellular compartments along with markers such as Cited1 and pSMAD to mark the
ground vs primed niche as well as Wnt4 to delineate the primed vs induced niche would help
resolve cell states and proliferative signatures.
C) Nephron
progenitor
transcriptional
induction:
Induction of
NPCs requires
inputs from its
surround tissues:
SPCs and
UE/UB
progenitors. The
clustering of
NPCs into
aggregates
beneath ureteric
Figure 6: Markers of progenitor populations within the nephrogenic niche. Increased Wnt9b
signaling from the UB results in the MET of NPCs in the creation of the pretubular
aggregate and later the Renal Vesicle were NPCs first stream into distally.
17

branch tips (PTA’s) is the first sign of commitment (McMahon 2016). De novo activation of Fgf8,
Wnt4 and Pax8 as well as a partial loss of Six2 (Six2 remains active in the PTA and RV but is
lower) defines cells within the PTA.
NPCs housed within the niche are suggested to exist in 2 main compartments prior to induction
due to their ability to respond to a Wnt input (Brown, Muthukrishnan et al. 2013). These
compartments are characterized by the expression levels of Six2 and Cited1. Cited1+, Six2+
progenitors are considered “ground state” whereas Cited1-, Six2+ NPCs are denoted as
“primed’ for induction (Brown, Muthukrishnan et al. 2013). The Cited1+ state is considered
refractory to Wnt input whereas the Cited1- state is responsive to wnt signaling. A distinction
between cell states could be due to β-catenin localization within the cells in either the ‘ground’ or
‘primed’ state with Six2+/Cited1- cells having β-catenin in the nucleus.
Induced NPCs that are no longer in the Six2+/Cited1+ self-renewing can reintegrate themselves
into the self-renewing niche suggesting that induction is not a ‘point of no return’; however, such
observations may be an exception and observation of a microphenomenon rather than the rule
(Grieshammer, Cebrian et al. 2005, Perantoni, Timofeeva et al. 2005, McMahon 2016, Lawlor,
Zappia et al. 2019) (Stark 1994, Plachov 1990). Expression of NPC markers Six2 and Cited1
decrease in a proximal distal fashion suggesting a gradual decay of NPC self-renewal markers
through the induction process (Lindstrom, De Sena Brandine et al. 2018).
It is possible that β-catenin is differentially housed between the Cited1+ and Cited1-
compartments. Co-immunoprecipitation experiments of Six2 with β-catenin performed from
NPCs FACs sorted from either a Cited1+ compartment or a Six2+ compartment using genetic
reporter lines Six2-TGC and Cited1-RFP suggest differential binding of β-catenin to Six2 within
each compartment (Park, Ma et al. 2012). The Six2+ FACS sort includes the Cited1+Six2+ as
well as Cited1-Six2+ compartments whereas the Cited1 sort included only the Cited1+
compartment allowing for comparison between the cells negative for Cited1 and positive for
18

Cited1 within the Six2+ niche. Six2 remains present up to early induced NPCs and therefore
provides information about the differences in Six2 and β-catenin binding within compartments.
Six2 Co-immunoprecipitation of β-catenin in NPCs from the Cited1 sort are negative β-catenin
Six2 interactions while NPCs from the Six2 sort immunoprecipitated β-catenin along with Six2
(Park, Ma et al. 2012). This suggests that β-catenin may not be in the nucleus complexing with
Six2 in the Cited1 compartment as opposed to the Six2 compartment. In this one could
speculate that β-catenin may be in the nucleus associating to other factors or bound to other
proteins in the cytoplasm or membrane in the ground state NPCs. The movement of β-catenin
to the nucleus and/or change in binding partners in the Six2+ Cited1- compartment may also
allow for the ‘priming’ of NPCs prior to induction.
A main factor in the conversion from a ground to primed state is initiated by Bmp7 signaling
mediated via pSMAD. Bmp7 has also been previously reported as an induction target of
nephron progenitor cells as it has both Six2 and β-catenin bound at Cis-regulatory modules with
predicted Tcf/Lef motifs (Park, Ma et al. 2012). In this Smad response nephron progenitors
respond to Wnt signaling and appear more proliferative and then are receptive to induction.
NPCs that do not receive BMP7 input transduced via SMAD will not induce upon Wnt stimulus
(Brown, Muthukrishnan et al. 2013). Initially the maintenance of the MM is dependent on Bmp7
and Smad mediated BMP signaling as BMP signaling is crucial in the maintenance of the
metanephric mesenchyme prior to the UB invasion and maintains CM organization upon
invasion. Bmp4 has been shown to replace the role of Bmp7 upon its removal suggesting a
possible redundancy within the Bmp family (Oxburgh, Dudley et al. 2005). This redundancy has
proven key to the establishment of nephron progenitor culture systems which use both BMP
factors (Brown, Muthukrishnan et al. 2015).
Such ‘priming’ of nephron progenitors is also observed in comparing Topologically Associated
Domains (TADs) from Hi-C data comparing primary NPCs cultured in low levels of Wnt input
19

that model the self-renewal state and NPCS cultures in high Wnt input that model the induction
state. NPCs in both culures had very similar TAD domains at key induction genes such as
Wnt4,Bmp7,Lhx1,Emx2 with only new loops formed at Lef1 suggestive of a feedforward
mechanism that potentiates a canonical Wnt response (Guo, Kim et al. 2021).
Wnt4 was the first identified as an auto-inducer located in the PTA. Wnt4 -/- homozygous
animals die 24 hours after birth and are agentic with an abundance of undifferentiated
mesenchyme and a lack of early nephron epithelial structures such as comma and s-shaped
bodies. Here, Wnt4 was found unlikely important for cell proliferation as induction of the
mesenchyme lead to both the activation of Wnt4 and Wnt4 over expression experiments lead to
an increase in cell adhesion suggesting that Wnt4 here could possibly stimulate adhesion
through β-catenin and E-cadherin (Stark 1994).
Wnt4 signaling depends on cell-cell contact as explants cultured on filters with 0.05uM pores
show no induction when co-cultured with Wnt4 expressing NIH3T3s. Cytoplasmic extensions
can protrude 0.1uM pores and explants co-cultured with 0.1uM filters grew larger and
underwent tubulogenesis. This suggests that Wnt4 may act as an insoluble cell bound factor
(Kispert 1998). This is consistent with other findings showing the tight association of Wnts with
the ECM in spinal cord development (McMahon 1995). Wnt4 signaling requires sulfated
glycosaminoglycans (GAGs) and requires GAGs to act as cofactors for the binding of Wnt4 to
the recipient cell (Kispert 1996).
Wnt9b acts upstream of Wnt4 as Wnt9b mutants have a complete loss of Wnt9b signal. Wnt9
acts as a paracrine signal from the UB to the MM to leading to the induction of NPCs via
activation of Pax8, Fgf8 and Wnt4. Initial induction of these markers are independent of Wnt4
however, Wnt4 may play an important role in further upregulating their expression in the PTA
(Carroll, Park et al. 2005). Wnt9b and Wnt4 are believed to bind different receptors as they both
operate using different Wnt pathways (Park, Valerius et al. 2007, Tanigawa, Wang et al. 2011).
20

There are striking differences between Wnt4 and Wnt9b genetic models regarding UB
branching at the T-stage however, both models show a complete loss of RV induction by E13.5
(Carroll, Park et al. 2005).
Wnt9b signals canonically via the downstream Wnt effector β-catenin. Six2TGC: β-catenin
Flox/Flox (β-catenin LOF) phenocopy Wnt9b mutants as both mutants have remarkably smaller
NPC niches, rapid cessation of UB branching and complete loss of induced NPCs (iNPCs) and
the tubulogenic program (Carroll, Park et al. 2005, Park, Valerius et al. 2007). This suggests a
cell autonomous requirement for β-catenin activity in the NPCs and iNPCs into the RV for the
induction and creation of epithelial structures in nephrogenesis. Moreover, the similarities in
Wnt9b and β-catenin mutants suggests that Wnt9b acts canonically in the induction of NPCs via
β-catenin. Further, over stabilization of β-catenin in the NPCs using a Six2TGC β-catenin exon
3 Flox- flox (β-catenin GOF) induces NPCs via the expression of Pax8, Fgf8 and Wnt4 in the
absence of Wnt9b. However, β-catenin GOF mutants have large clusters of condensed
mesenchyme beneath the UB tips and ectopic condensates above the UB where Six2+ NPCs
would otherwise reside. Although Wnt4 and Fgf8 are dramatically increased in β-catenin GOF
mutants MET transition is blocked as there is no expression of E-cadherin and formation of
tubules suggesting that β-catenin needs to be transiently active in NPCs upon induction and
needs to be regulated in order to progress though the MET process (Park, Valerius et al. 2007).
Ectopic expression of β-catenin in NPCs creates a phenotype where NPCs fail to transition into
an epithelialized state marked by lack of expression of E-cadherin.
NPCs cultured from a Six2-GFP FACS sort revealed that cells cultured with Wnt agonist BIO
had no E-cadherin. However, when NPCs were first cultured BIO and then with media without
BIO, NPCs express a normal amount of E-cadherin. Thus, transient elevation of β-catenin levels
in NPCs cultured without other cell types is enough to initiate the induction of nephrogenesis
possibly modeling the normal action of Wnt9b in the induction of NPCs at the initial stages of
21

MET (Park, Ma et al. 2012). The importance of timing and duration of a Wnt9b input and its
effect allows for the tight control and highly regulated process of NPC induction. Given
subtleties in the regulation of the Wnt canonical pathway in the induction of NPCs in vitro
models should consider dosage duration and timing to recapitulate this process. The use of
CHIR (Gsk3 antagonist) is a method people use to model β-catenin input however next
generation Wnt agonists in the form of a bi-specific antibody as well as next generation Wnt3a
recombinants could create more biologically relative Wnt inputs in vitro models (Janda, Dang et
al. 2017) .
The Wnt activation of NPCs in induction upregulates members of the notch signaling pathway.
Notch signaling is required for the downregulation of Six2 in induced NPCs. Inducted NPCs
(iNPCs) that form an early PTA or RV express a tgHoxb7+/ Jag1 low /Wt1 low distal identity
whereas iNPCs arriving later express a TgHoxb7- Jag1 high/ Wt1/ high signature proximal
identity. Mechanistically, notch singling is required for induction of NPCs as well as the
acquisition of a proximal fate as Wt1 remains expressed in the late podocyte suggesting early
specification of proximal like fate in early RV recruitment (Chung, Deacon et al. 2016,
Lindstrom, De Sena Brandine et al. 2018, Tran, Lindstrom et al. 2019) (Chung, Deacon et al.
2017). Thus, NPCs adopt a proximal distal fate depending on their time of recruitment to the
RV.
Here, downregulation of Six2 coincides with upregulation of Jag1 and an active form of Notch1
ICD completely abolishes the expression of Six2 expression as Osr1+ NPCs were still present
in the niche suggesting that NPCs here were not depleted. Deletion of Rbpj domains of both
notch1 and notch2 did not lead to a downregulation of Six2 implying that notch has a role in
downregulating Six2 further potentiation the induction of NPCs through MET. In Six2 GOF
studies using a Tet-on system NPCs failed to induce, were restricted to the CM and did not
express Lhx1 or E-cadherin (Chung, Deacon et al. 2016). This implicates that persistent
22

expression of Six2 prevents NPCs from undergoing their induction further classifying Six2 as a
repressor of NPC induction. Moreover, notch involvement in the downregulation of Six2
suggests a possible role for notch in maintaining the NPC self-renewing gene program implying
that both β-catenin and notch both attenuate Six2 expression.
In vivo and in vitro results suggest
that Six2 and Tcf/Lef factors interact
and can possibly promote
maintenance and commitment
however, the mechanism of Six2’s
involvement with Wnt signaling
nuclear effectors is unclear (Figure
8) (Park, Ma et al. 2012) (Guo, Kim et
al. 2021). Possibly, Wnt mediated
activation and entrance of β-catenin into a Tcf/Lef/Six2 complex turns this complex from an OFF
to an on state initiating the differentiation NPC program (Figure 8). Prominent Cis-regulatory
modules (CRMs) such as the Six2 enhancer and Wnt4 enhancer are both bound by Six2 and β-
catenin suggesting that both opposing and collaborative interaction between Six2 and β-catenin:
Six2 is believed to repress the induction of NPCs and β-catenin has been speculated to
attenuate the NPC maintenance program (Self, Lagutin et al. 2006, Park, Ma et al. 2012). Chip-
Seq analysis revealed that β-catenin shared 23% of binding sites with Six2 at both self-renewing
and differentiating CRMs (Six2 enhancer and Wnt4 enhancer) suggesting possible dual roles for
this complex. Potential differences in the ability of this complex to drive either program may be
due to levels of β-catenin as well as ability to interact with Tcf/Lef factors.
Transgenes of 3 regulatory elements driving the expression of NPC induction genes Fgf8, Wnt4
and Bmp7 to drive the expression of Lacz in vivo showed similar gene expression as their
Figure 7: Schematic representation of Tcf/Lef factor
switch to turn on Wnt response genes in NPCs
23

relative in situ hybridization overlapping with the NPC induction gene Jag1 of the early RV
(Park, Valerius et al. 2007, Park, Ma et al. 2012). Moreover, when mutating Tcf/Lef binding
motifs in CRMs driving transgene expression, all signal from the transgene was lost suggesting
that Tcf/Lef interactions are crucial to drive gene expression at these CRMs (Park, Ma et al.
2012). Wnt4 distant enhancer homozygous mutants do not loose Wnt4 expression but
homozygous lose expression of Wnt4 in the RV and in the developing nephron however
expression is not lost in the medulla of the kidney. Wnt4 distal enhancer double mutants also
have a less severe phenotype than Wnt4-/- null protein mutants further supporting the notion
that Wnt4 has other unidentified regulatory elements (O'Brien, Guo et al. 2018).
β-catenin its self does not bind DNA therefore, the expression of these genes driven at their
CRMs is likely driven by Tcf/Lef- β -catenin interactions (Nelson and Nusse 2004, Arce,
Yokoyama et al. 2006, Park, Ma et al. 2012). Tcf’s are generally considered to be weak
activators and therefore complex with β -catenin to activate gene expression, however, Tcf7 and
Lef1 also preferentially bind to β-catenin potentially allowing them to be more efficient activators
once complexed with β-catenin as β-catenin recruits a suite of co-activating factors to activate
transcription. β-catenin itself does not bind DNA and requires binding to Tcf/Lef factors at DNA
through its armadillo domains. Tcf/Lef interactions with β-catenin are crucial to the transmission
of a canonical Wnt input as a transcriptional response. Tcf/Lef factor isoforms/mutants missing
their β-catenin binding domains while maintaining their DNA binding domains are dominant
negatives as their inability to bind β-catenin on DNA does not activate wnt target genes. The
Tcf/Lef factors bind similar DNA motifs however, Lef1 can bend DNA allowing it to have a
unique capacity to initiate transcription (Love 1995)(Cadigan and Waterman 2012, Valenta,
Hausmann et al. 2012).
Although there is evidence of Wnt4 initially acting canonically, data suggests that after its initial
activation, Wnt4 may operate via a non-canonical pathway. There are two major independent
24

Tcf/Lef independent Wnt pathways: Ca+ release pathway and the PCP pathway mediated by c-
Jun N-terminal kinase ((Kohn and Moon 2005)Yamanaka 2000 )). When culturing MM with a
Tcf/Lef dependent top flash reporter, only MMs cultured with recombinant Wnt3a (canonical
Wnt) compared to recombinant Wnt4 induced the reporter. Moreover, MMs cultured with Wnt4
did not increase levels of β-catenin or disheveled at 24 hours whereas Wnt3a increased levels
of β-catenin and disheveled within 5 min, suggesting that Wnt4 does not act via a canonical wnt
pathway in the induction of MMs. Using a Calcium sensing dye in MM cultures there was a
significant increase of Calcium in MMs cultured with Wnt4. This influx correlated with the
production of tubules in cultured MMs not observed in β -catenin GOF mutants suggesting that
Wnt4 may induce a calcium mediated wnt response required for the MET of NPCS (Tanigawa,
Wang et al. 2011)
D) The mesenchymal to epithelial transition (MET) of nephron progenitors.
The NPC to PTAs transition
leading to epithelization into
the creation of the RV has
been considered a coupled
process leading to a
spontaneous formation of
an RV in mice (Mugford, Yu
et al. 2009). Induction of
NPCs is marked by a concomitant decrease of a self-renewal signature and a rapid induction
Figure 8: E16.5 kidney section of Six2TGCx Tdt reporter mouse with fluorescent in situ
hybridization of Six2 and nephron linage tdTomato reporter. NPCs give rise to progeny and
induced nephron progenitors. Developing nephrons form a distal to proximal axis.
25

signature that coincides with changes in cellular shape, leading to the conversion to an epithelial
cell type (Figure 8).
Previously in the mouse, the developing nephron was considered a separate unit from the CM
because of the discrete borders in the morphology of the caps and had been compartmentalized
away from early tubular structures (Mugford, Yu et al. 2009). Deep analysis of human
nephrogenesis since has informed how we view murine nephrogenesis. In this, detailed 3D
imaging and rendering analysis of mice and human early nephron structures dismantled the
notion that RV production was a spontaneous and isolated event from the CM.
Throughout kidney formation each nephrogenic event reiteratively creates nephrons from a
mesenchymal cell population that undergo epithelization in the creation of a nephron tubule.
The epithelization process begins with the aggregation of NPCs into pretubular aggregates
(PTAs) and subsequent creation of lumenized renal vesicles (RV) (McMahon 2016). The NPC
occurs as NPCs are progressively recruited to the RV with the time of their recruitment directly
affecting their proximal-distal potential and place within the RV (Lindstrom, De Sena Brandine et
al. 2018).
Timing of NPC incorporation into the RV can distinguish their fate over time. In this, it is
presumed that a pulse of Wnt9 signaling leads to the formation of an aggregate and adherence
of NPCs to both each other leading to their recruitment into the vesicle. NPCs initiating PTA
formation abut under a branch tip where they aggregate to form the PTA and in the process of
MET generate polarized E-cadherin expressing (epithelization protein) cells. Induced NPCs in
the PTA that arrive first to the RV lie adjacent to the UB during the progression into an RV and
will give rise to the distally patterned portion of the RV. Later arriving cells are once a PTA or RV
is established are incorporated into the proximal end of the RV I. Thus, NPCs adopt a proximal
distal fate depending on their time of recruitment to the RV (Lindstrom, De Sena Brandine et al.
2018).
26

In the mesenchymal to epithelial transition (MET) of nephron progenitors requires two distinct,
yet, coupled events: the transcriptional induction of NPCs and morphological changes of NPCs.
MET involves several morphogenetic processes (e.g., cell aggregation, cell movement,
mesenchymal-epithelial conversion, cell sorting, and cell shape changes) that involve members
of the classic cadherin superfamily of cell adhesion molecules (Cho, Patterson et al. 1998,
Combes, Lefevre et al. 2016, Lawlor, Zappia et al. 2019).
The position of the distal portion of the RV is maintained by a direct stream of Wnt9b that
induces the epithelization strongest of these cells (Figure 8). In this, cells have exited a
mesenchymal state and are now epithelial cells that have adopted a basal to apical polarity as
well as acquired strong cell
junctions to each other. Wnt9 input
and the proximity of distally fated
cells in the RV links Wnt β-catenin
mediated signaling to the
epithelization of NPCs. Wnts are
powerful regulators of cell adhesion
therefore a strong pulse of Wnt9b,
potentially at the UE cleft, leads to
the upregulation of β-catenin
promoting aggregation and
upregulation of a committed NPC signature. β-catenin is central here acting as a transcriptional
regulator and as a structural adapting protein liking cadherins to the actin cytoskeleton (Weis
and Nelson) promoting cell adhesion and epithelization.
Cadherins, cell membrane adherent molecules, have been implicated in the development of the
nephron for decades. Cadherins contain a conserved cytoplasmic domain that interact with
Figure 9: Schematic representation of β-catenin roles
at the cell membrane (mediating cadherin-catenin-
actin) and within the nucleus (activating Wnt target
genes).
27

cytoplasmic proteins called catenins to link adhesion at the cell membrane with high order actin
based cell cytoskeletal rearrangements (Figure 9) (Nagafuchi and Takeichi 1988, Ozawa,
Baribault et al. 1989, Reynolds, Daniel et al. 1994, Shibamoto, Hayakawa et al. 1995). The
cadherin-catenin complex mediates cell adhesion and changes cytoskeletal rearrangements via
cytoplasmic cadherin binding to β-catenin which subsequently binds to α-catenin which directly
binds to the actin cytoskeleton (Hinck, Näthke et al. 1994) (Aberle, Butz et al. 1994, Butz and
Kemler 1994). Clusters of cadherins in cell-cell contact regions create adherents junctions which
create tight associations within cells leading to cell-cell signaling centers within cells (Gumbiner
1996).
Hence, a proposed modus operandi includes a canonical wnt initiated MET via β -catenin
activated transcription of the NPC induction program but then must be attenuated allowing for a
second non-canonical wnt pathway to progress through MET and undergo tubulogenisis. This
suggests that β-catenin signaling could bi-furcate first acting canonically to promote the
induction of NPCs and then act non-canonically to promote MET. This sets a model where β
catenin mediates the inductive capacity of Wnt9b whose target is Wnt4. However, Wnt9b
mediated β-catenin activity is a crucial regulatory event critical for the initiation of induction
whereas Wnt4 is required to progress through MET (Carroll, Park et al. 2005, Park, Valerius et
al. 2007)(Stark 1994). In order for proper nephrons to form, NPCS must divide and replenish the
NPC pool to provide cells for multiple rounds of nephrogenesis but also need to have induction
capacity. In other words, NPCs in their self-renewing state acquire a primed status such that a
permissive signal from the UB a canonical wnt (Wnt9b) quickly transitions them into an induced
state. This canonical Wnt9b input is tightly controlled however allows to the beginnings of the
MET process which is then carried out by a non-canonical Wnt4 NPC cell autonomous signal
and Notch-Jag1 interactions. The induction process is a transcriptional response to increased
level of signaling input. The direct link between the drastic transcriptional response to the
28

dramatic change in cell state moving from a mesenchymal, motile cell to an epithelial cell type
with apical and basal polarity is obviously connected however a direct mechanistic link between
the induction transcription signature and the complete cellular reorganization that occurs as a
result of MET.
A reductionist approach to dissect Wnt/β-catenin actions in nephron progenitors
The Wnt/β-catenin signaling pathway has critical roles the generation of a proper number of
nephrons during nephrogenesis. A delicate balance of Wnt mediated self-renewal and induction
is critical and can be further investigated using a fully defined NPC culture system using
nephron progenitor expansion medium (NPEM) to examine Wnt mediated actions and
regulatory interplay (Brown, Muthukrishnan et al. 2015). Low level Wnt pathway stimulation,
through addition of 1.25 μM of the GSK inhibitor and Wnt-pathway agonist CHIR99021 (CHIR;
Figure 5), is a critical component in NPEM’s NPC supporting role. Elevating β -catenin levels by
increasing CHIR concentrations to 5 μM (4 fold) leads to a rapid differentiation of NPCs. The
induction of NPCs leads to a β-catenin associated switch of Lef/Tcf factors, from repressive
(Tcf7l1/Tcf7l2) bound in self-renewal (low CHIR) conditions, to activator (Tcf7/Lef1) bound in
induction associations at differntiation targets (Guo et al. 2021). In this thesis, I combined the
NPC model with mRNA-directed modulation of β-catenin activity through various strategies to
provide new insight into the diverse roles and mechanistic actions of β-catenin in mammalian
NPC programs. This body of work will not only shed light into the transcriptional programming
and requirements of β-catenin for cellular rearrangements necessary at the outset of
nephrogenesis, but deepen our knowledge regarding the Wnt signaling pathway by providing a
deeper mechanistic understanding of the key Wnt signaling effector β-catenin (Clevers, Loh et
al. 2014), a protein critical to the maintenance of adult stem cell populations and repair of many
organ systems, and often mutated in cancer.

29

References
Bain, J., L. Plater, M. Elliott, N. Shpiro, C. J. Hastie, H. McLauchlan, I. Klevernic, J. S. Arthur, D.
R. Alessi and P. Cohen (2007). "The selectivity of protein kinase inhibitors: a further update."
Biochem J 408(3): 297-315.

Blank, U., A. Brown, D. C. Adams, M. J. Karolak and L. Oxburgh (2009). "BMP7 promotes
proliferation of nephron progenitor cells via a JNK-dependent mechanism." Development
136(21): 3557-3566.

Brault, V., R. Moore, S. Kutsch, M. Ishibashi, D. H. Rowitch, A. P. McMahon, L. Sommer, O.
Boussadia and R. Kemler (2001). "Inactivation of the beta-catenin gene by Wnt1-Cre-mediated
deletion results in dramatic brain malformation and failure of craniofacial development."
Development 128(8): 1253-1264.

Brembeck, F. H., M. Rosario and W. Birchmeier (2006). "Balancing cell adhesion and Wnt
signaling, the key role of beta-catenin." Curr Opin Genet Dev 16(1): 51-59.

Brown, A. C., S. D. Muthukrishnan, J. A. Guay, D. C. Adams, D. A. Schafer, J. L. Fetting and L.
Oxburgh (2013). "Role for compartmentalization in nephron progenitor differentiation." Proc Natl
Acad Sci U S A 110(12): 4640-4645.

Brown, A. C., S. D. Muthukrishnan and L. Oxburgh (2015). "A synthetic niche for nephron
progenitor cells." Dev Cell 34(2): 229-241.

Cadigan, K. M. and M. L. Waterman (2012). "TCF/LEFs and Wnt signaling in the nucleus." Cold
Spring Harb Perspect Biol 4(11).

Cantù, C., P. Pagella, T. D. Shajiei, D. Zimmerli, T. Valenta, G. Hausmann, K. Basler and T. A.
Mitsiadis (2017). "A cytoplasmic role of Wnt/β-catenin transcriptional cofactors Bcl9, Bcl9l, and
Pygopus in tooth enamel formation." Sci Signal 10(465).

Carroll, T. J., J. S. Park, S. Hayashi, A. Majumdar and A. P. McMahon (2005). "Wnt9b plays a
central role in the regulation of mesenchymal to epithelial transitions underlying organogenesis
of the mammalian urogenital system." Dev Cell 9(2): 283-292.

Cebrian, C., N. Asai, V. D'Agati and F. Costantini (2014). "The number of fetal nephron
progenitor cells limits ureteric branching and adult nephron endowment." Cell Rep 7(1): 127-
137.

Chen, S., E. W. Brunskill, S. S. Potter, P. J. Dexheimer, N. Salomonis, B. J. Aronow, C. I. Hong,
T. Zhang and R. Kopan (2015). "Intrinsic Age-Dependent Changes and Cell-Cell Contacts
Regulate Nephron Progenitor Lifespan." Dev Cell 35(1): 49-62.

Clevers, H., K. M. Loh and R. Nusse (2014). "Stem cell signaling. An integral program for tissue
renewal and regeneration: Wnt signaling and stem cell control." Science 346(6205): 1248012.

Clevers, H. and R. Nusse (2012). "Wnt/beta-catenin signaling and disease." Cell 149(6): 1192-
1205.
30

Costantini, F. (2012). "Genetic controls and cellular behaviors in branching morphogenesis of
the renal collecting system." Wiley Interdiscip Rev Dev Biol 1(5): 693-713.

Costantini, F. and R. Shakya (2006). "GDNF/Ret signaling and the development of the kidney."
Bioessays 28(2): 117-127.

Dickinson, K. K., L. C. Hammond, C. M. Karner, N. D. Hastie, T. J. Carroll and P. Goodyer
(2019). "Molecular determinants of WNT9b responsiveness in nephron progenitor cells." PLoS
One 14(4): e0215139.

Ding, Y., S. Su, W. Tang, X. Zhang, S. Chen, G. Zhu, J. Liang, W. Wei, Y. Guo, L. Liu, Y. G.
Chen and W. Wu (2014). "Enrichment of the beta-catenin-TCF complex at the S and G2 phases
ensures cell survival and cell cycle progression." J Cell Sci 127(Pt 22): 4833-4845.

Duttke, S. H., M. W. Chang, S. Heinz and C. Benner (2019). "Identification and dynamic
quantification of regulatory elements using total RNA." Genome Res 29(11): 1836-1846.

Gehart, H. and H. Clevers (2019). "Tales from the crypt: new insights into intestinal stem cells."
Nat Rev Gastroenterol Hepatol 16(1): 19-34.

Guo, Q., A. Kim, B. Li, A. Ransick, H. Bugacov, X. Chen, N. Lindström, A. Brown, L. Oxburgh,
B. Ren and A. P. McMahon (2021). "A β-catenin-driven switch in TCF/LEF transcription factor
binding to DNA target sites promotes commitment of mammalian nephron progenitor cells."
eLife 10: e64444.

Heinz, S., C. Benner, N. Spann, E. Bertolino, Y. C. Lin, P. Laslo, J. X. Cheng, C. Murre, H.
Singh and C. K. Glass (2010). "Simple combinations of lineage-determining transcription factors
prime cis-regulatory elements required for macrophage and B cell identities." Molecular cell
38(4): 576-589.

Hilliard, S., R. Song, H. Liu, C. H. Chen, Y. Li, M. Baddoo, E. Flemington, A. Wanek, J. Kolls, Z.
Saifudeen and S. S. El-Dahr (2019). "Defining the dynamic chromatin landscape of mouse
nephron progenitors." Biol Open 8(5).

Janda, C. Y., L. T. Dang, C. You, J. Chang, W. de Lau, Z. A. Zhong, K. S. Yan, O. Marecic, D.
Siepe, X. Li, J. D. Moody, B. O. Williams, H. Clevers, J. Piehler, D. Baker, C. J. Kuo and K. C.
Garcia (2017). "Surrogate Wnt agonists that phenocopy canonical Wnt and beta-catenin
signalling." Nature 545(7653): 234-237.

Karner, C. M., R. Chirumamilla, S. Aoki, P. Igarashi, J. B. Wallingford and T. J. Carroll (2009).
"Wnt9b signaling regulates planar cell polarity and kidney tubule morphogenesis." Nat Genet
41(7): 793-799.

Karner, C. M., A. Das, Z. Ma, M. Self, C. Chen, L. Lum, G. Oliver and T. J. Carroll (2011).
"Canonical Wnt9b signaling balances progenitor cell expansion and differentiation during kidney
development." Development 138(7): 1247-1257.

Kim, H., J. Wu, S. Ye, C. I. Tai, X. Zhou, H. Yan, P. Li, M. Pera and Q. L. Ying (2013).
"Modulation of beta-catenin function maintains mouse epiblast stem cell and human embryonic
stem cell self-renewal." Nat Commun 4: 2403.
31

Kobayashi, A., M. T. Valerius, J. W. Mugford, T. J. Carroll, M. Self, G. Oliver and A. P.
McMahon (2008). "Six2 defines and regulates a multipotent self-renewing nephron progenitor
population throughout mammalian kidney development." Cell Stem Cell 3(2): 169-181.

Langmead, B. and S. L. Salzberg (2012). "Fast gapped-read alignment with Bowtie 2." Nature
Methods 9(4): 357-359.

Lien, W. H., L. Polak, M. Lin, K. Lay, D. Zheng and E. Fuchs (2014). "In vivo transcriptional
governance of hair follicle stem cells by canonical Wnt regulators." Nat Cell Biol 16(2): 179-190.

Lindstrom, N. O., G. De Sena Brandine, T. Tran, A. Ransick, G. Suh, J. Guo, A. D. Kim, R. K.
Parvez, S. W. Ruffins, E. A. Rutledge, M. E. Thornton, B. Grubbs, J. A. McMahon, A. D. Smith
and A. P. McMahon (2018). "Progressive Recruitment of Mesenchymal Progenitors Reveals a
Time-Dependent Process of Cell Fate Acquisition in Mouse and Human Nephrogenesis." Dev
Cell 45(5): 651-660 e654.

Lindstrom, N. O., M. L. Lawrence, S. F. Burn, J. A. Johansson, E. R. Bakker, R. A. Ridgway, C.
H. Chang, M. J. Karolak, L. Oxburgh, D. J. Headon, O. J. Sansom, R. Smits, J. A. Davies and P.
Hohenstein (2015). "Integrated beta-catenin, BMP, PTEN, and Notch signalling patterns the
nephron." Elife 3: e04000.

Lindstrom, N. O., J. A. McMahon, J. Guo, T. Tran, Q. Guo, E. Rutledge, R. K. Parvez, G.
Saribekyan, R. E. Schuler, C. Liao, A. D. Kim, A. Abdelhalim, S. W. Ruffins, M. E. Thornton, L.
Baskin, B. Grubbs, C. Kesselman and A. P. McMahon (2018). "Conserved and Divergent
Features of Human and Mouse Kidney Organogenesis." J Am Soc Nephrol 29(3): 785-805.

Liu, H., S. Hilliard, E. Kelly, C. H. Chen, Z. Saifudeen and S. S. El-Dahr (2020). "The polycomb
proteins EZH1 and EZH2 co-regulate chromatin accessibility and nephron progenitor cell
lifespan in mice." J Biol Chem 295(33): 11542-11558.

Madisen, L., T. A. Zwingman, S. M. Sunkin, S. W. Oh, H. A. Zariwala, H. Gu, L. L. Ng, R. D.
Palmiter, M. J. Hawrylycz, A. R. Jones, E. S. Lein and H. Zeng (2010). "A robust and high-
throughput Cre reporting and characterization system for the whole mouse brain." Nat Neurosci
13(1): 133-140.

Mazzotta, S., C. Neves, R. J. Bonner, A. S. Bernardo, K. Docherty and S. Hoppler (2016).
"Distinctive Roles of Canonical and Noncanonical Wnt Signaling in Human Embryonic
Cardiomyocyte Development." Stem Cell Reports 7(4): 764-776.
McMahon, A. P. (2016). "Development of the Mammalian Kidney." Curr Top Dev Biol 117: 31-
64.

Miyamoto, N., M. Yoshida, S. Kuratani, I. Matsuo and S. Aizawa (1997). "Defects of urogenital
development in mice lacking Emx2." Development 124(9): 1653-1664.

Mori, K., H. Nakamura, H. Kurooka, H. Miyachi, K. Tamada, M. Sugai, T. Takumi and Y. Yokota
(2018). "Id2 Determines Intestinal Identity through Repression of the Foregut Transcription
Factor Irx5." Mol Cell Biol 38(9).

Morizane, R. and J. V. Bonventre (2017). "Kidney Organoids: A Translational Journey." Trends
Mol Med 23(3): 246-263.
32

Mukherjee, S., D. M. Luedeke, L. McCoy, M. Iwafuchi and A. M. Zorn (2022). "SOX transcription
factors direct TCF-independent WNT/beta-catenin responsive transcription to govern cell fate in
human pluripotent stem cells." Cell Rep 40(8): 111247.

Nelson, W. J. and R. Nusse (2004). "Convergence of Wnt, beta-catenin, and cadherin
pathways." Science 303(5663): 1483-1487.

O'Brien, L. L. (2019). "Nephron progenitor cell commitment: Striking the right balance." Semin
Cell Dev Biol 91: 94-103.

O'Brien, L. L., Q. Guo, E. Bahrami-Samani, J. S. Park, S. M. Hasso, Y. J. Lee, A. Fang, A. D.
Kim, J. Guo, T. M. Hong, K. A. Peterson, S. Lozanoff, R. Raviram, B. Ren, B. Fogelgren, A. D.
Smith, A. Valouev and A. P. McMahon (2018). "Transcriptional regulatory control of mammalian
nephron progenitors revealed by multi-factor cistromic analysis and genetic studies." PLoS
Genet 14(1): e1007181.

Park, J. S., W. Ma, L. L. O'Brien, E. Chung, J. J. Guo, J. G. Cheng, M. T. Valerius, J. A.
McMahon, W. H. Wong and A. P. McMahon (2012). "Six2 and Wnt regulate self-renewal and
commitment of nephron progenitors through shared gene regulatory networks." Dev Cell 23(3):
637-651.

Park, J. S., M. T. Valerius and A. P. McMahon (2007). "Wnt/beta-catenin signaling regulates
nephron induction during mouse kidney development." Development 134(13): 2533-2539.

Pei, D., X. Shu, A. Gassama-Diagne and J. P. Thiery (2019). "Mesenchymal-epithelial transition
in development and reprogramming." Nat Cell Biol 21(1): 44-53.

Platt, R. J., S. Chen, Y. Zhou, M. J. Yim, L. Swiech, H. R. Kempton, J. E. Dahlman, O. Parnas,
T. M. Eisenhaure, M. Jovanovic, D. B. Graham, S. Jhunjhunwala, M. Heidenreich, R. J. Xavier,
R. Langer, D. G. Anderson, N. Hacohen, A. Regev, G. Feng, P. A. Sharp and F. Zhang (2014).
"CRISPR-Cas9 knockin mice for genome editing and cancer modeling." Cell 159(2): 440-455.

Ramalingam, H., A. R. Fessler, A. Das, M. T. Valerius, J. Basta, L. Robbins, A. C. Brown, L.
Oxburgh, A. P. McMahon, M. Rauchman and T. J. Carroll (2018). "Disparate levels of beta-
catenin activity determine nephron progenitor cell fate." Dev Biol 440(1): 13-21.

Rieger, A., E. Kemter, S. Kumar, B. Popper, B. Aigner, E. Wolf, R. Wanke and A. Blutke (2016).
"Missense Mutation of POU Domain Class 3 Transcription Factor 3 in Pou3f3L423P Mice
Causes Reduced Nephron Number and Impaired Development of the Thick Ascending Limb of
the Loop of Henle." PloS one 11(7): e0158977-e0158977.

Schneider-Poetsch, T., J. Ju, D. E. Eyler, Y. Dang, S. Bhat, W. C. Merrick, R. Green, B. Shen
and J. O. Liu (2010). "Inhibition of eukaryotic translation elongation by cycloheximide and
lactimidomycin." Nat Chem Biol 6(3): 209-217.

Schnell, J., M. Achieng and N. O. Lindstrom (2022). "Principles of human and mouse nephron
development." Nat Rev Nephrol 18(10): 628-642.

Schuijers, J., M. Mokry, P. Hatzis, E. Cuppen and H. Clevers (2014). "Wnt-induced
transcriptional activation is exclusively mediated by TCF/LEF." EMBO J 33(2): 146-156.
33

Self, M., O. V. Lagutin, B. Bowling, J. Hendrix, Y. Cai, G. R. Dressler and G. Oliver (2006). "Six2
is required for suppression of nephrogenesis and progenitor renewal in the developing kidney."
EMBO J 25(21): 5214-5228.

Stuart, T., A. Butler, P. Hoffman, C. Hafemeister, E. Papalexi, W. M. Mauck, 3rd, Y. Hao, M.
Stoeckius, P. Smibert and R. Satija (2019). "Comprehensive Integration of Single-Cell Data."
Cell 177(7): 1888-1902 e1821.

Tanigawa, S., H. Naganuma, Y. Kaku, T. Era, T. Sakuma, T. Yamamoto, A. Taguchi and R.
Nishinakamura (2019). "Activin Is Superior to BMP7 for Efficient Maintenance of Human iPSC-
Derived Nephron Progenitors." Stem Cell Reports 13(2): 322-337.

Teng, A., M. Nair, J. Wells, J. A. Segre and X. Dai (2007). "Strain-dependent perinatal lethality
of Ovol1-deficient mice and identification of Ovol2 as a downstream target of Ovol1 in skin
epidermis." Biochim Biophys Acta 1772(1): 89-95.

Valenta, T., G. Hausmann and K. Basler (2012). "The many faces and functions of beta-
catenin." EMBO J 31(12): 2714-2736.

Ying, Q. L., J. Wray, J. Nichols, L. Batlle-Morera, B. Doble, J. Woodgett, P. Cohen and A. Smith
(2008). "The ground state of embryonic stem cell self-renewal." Nature 453(7194): 519-523.

Zhang, X., K. A. Peterson, X. S. Liu, A. P. McMahon and S. Ohba (2013). "Gene regulatory
networks mediating canonical Wnt signal-directed control of pluripotency and differentiation in
embryo stem cells." Stem Cells 31(12): 2667-2679.

34

Chapter 2: β-catenin couples self-renewal, induction and epithelial
morphogenesis and patterning at the outset of mammalian
nephrogenesis
Acknowledgements:
Chapter 2 was written by Helena Bugacov (Zhang, Peterson et al.) with edits and commentary
from Andrew McMahon (AM) and Balint Der (BD). Experimental design for experiments in this
chapter were designed by HB and AM with insight from other lab members at lab meetings and
meetings with collaborator Balint Der (BD). HB performed experiments to characterize the NPC
culture system and develop the mRNA based lipofectamine manipulation of NPCs and
performed experiments to remove β-catenin and Tcf/Lef factors. HB performed the
immunostaining, RT-qPCR and Bulk mRNA seq (sent to sequencing at ATGC at Washington
University in St. Louis). FAC sorting was assisted by members of the USC Stem Cell flow
cytometry core. Script for the analysis of mRNA-seq was developed by McMahon lab members
Louisa Gerhart (LG) and Sunghyun Kim (SK). Kari Koppitch performed scRNA-Seq experiments
and Riana Parvez (RP) and SK analyzed scRNA-seq data used to intersect Bulk mRNA
sequencing results. SK intersected scRNA-seq data with Bulk mRNA seq data and ChIP-seq
data published in Guo 2021. Imaging of NPCs and kidney sections was performed by BD, HB
and undergraduate Muskaan Singh (MS) with the majority of imaging and quantification
performed by BD. HB performed RNA-Scope and imaging of RNA scope of Tcf/Lef factors,
Ovol1 and Emx2. BD performed quantification of β-catenin removal and phenotypes associated
with its removal and MS performed quantification of Tcf/Lef factor removal. JinJin Guo (JG), HB
and BD assisted with guide optimization to remove Tcf/Lef factors.

35

Introduction:
Wnt signaling is required for the self-renewal and differentiation of many key progenitor and
stem cell types (Clevers, Loh et al. 2014). In canonical Wnt signaling, β-catenin (Ctnnb1)
transforms Wnt ligand binding to cell surface receptor complexes into a transcriptional output
(Schuijers, Mokry et al. 2014). Stabilization of β-catenin in response to canonical Wnt signaling
through Frizzled receptor complexes results in the translocation of β-catenin to the nucleus,
binding to Lef/Tcf DNA-binding partners and other transcriptional co-factors, and activation of
target gene transcription (Cadigan and Waterman 2012, Mazzotta, Neves et al. 2016).
Independently, β-catenin has a critical role in cadherin-mediated cell adhesion at adherent
junctions essential to epithelial organization (Brembeck, Rosario et al. 2006, Valenta,
Hausmann et al. 2012).
In the mammalian kidney, canonical or non-canonical Wnt-signaling pathways, have been
implicated in regulating distinct aspects of the nephrogenic program: expansion and induction of
mesenchymal nephron progenitor cells (NPCs), and the morphogenesis, differentiation and
patterning of NPCs within a developing epithelial nephron anlagen. Mesenchymal NPCs lie
within a nephrogenic niche, in close association with several other key kidney progenitor types:
epithelial ureteric progenitor cells (UPCs) which give rise to ductual network of the collecting
system, mesenchymal interstitial progenitor cells (IPCs) which generate diverse stromal cell
types, and vascular progenitor cells (VPCs) which generate a regionally diverse vascular
system (McMahon 2016). Reciprocal signaling types within the nephrogenic niche coordinate
interactions amongst progenitor cell types (McMahon 2016, O'Brien 2019). Wnt9b signaling
from underlying ureteric progenitor cells localized at the branch tips of the arborizing collecting
system network induces a subset of NPCs to undergo a mesenchymal-to-epithelial transition
(MET) in conjunction with UPC-driven division and branching of the ureteric branch tips
(Costantini and Shakya 2006, Costantini 2012, Cebrian, Asai et al. 2014). Importantly, the
36

generation of a species appropriate number of nephrons (Nelson and Nusse 2004, Brown,
Muthukrishnan et al. 2015, Lindstrom, McMahon et al. 2018, Pei, Shu et al. 2019) and normal
kidney function is critically dependent on balancing the self-renewal and induction of NPCs.
A foundational population of NPCs is expanded over a lengthy period of development
characteristic of the species (Lindstrom, De Sena Brandine et al.). Mesenchymal NPCs lie within
a nephrogenic niche, in close association with several other key progenitor types for functional
development of the kidney: epithelial ureteric progenitor cells (UPCs) which give rise to ductual
network of the collecting system, mesenchymal interstitial progenitor cells (IPCs) which
generate diverse stromal cell types, and vascular progenitor cells (VPCs) which generate a
regionally diverse vascular system (McMahon 2016). Interestingly, Wnt9b-directed canonical
Wnt signaling through Ctnnb1 is implicated in both the control of NPC regulatory programs
supporting an NPC state and the counter process of commitment of NPCs through a
mesenchymal to epithelial transition (MET) to a nephron forming program ((Park, Valerius et al.
2007, Karner, Das et al. 2011, Park, Ma et al. 2012, Lindstrom, Lawrence et al. 2015,
Ramalingam, Fessler et al. 2018, Tanigawa, Naganuma et al.).
Genetic and chromatin interaction studies have provided important insight into Wnt9b/β-catenin-
mediated regulation of NPCs (Self, Lagutin et al. 2006, Kobayashi, Valerius et al. 2008, O'Brien,
Guo et al. 2018, Dickinson, Hammond et al. 2019, Guo, Kim et al. 2021). In vivo, Wnt9b and β-
catenin are required for expanding the NPC pool (Carroll, Park et al. 2005, Karner, Chirumamilla
et al. 2009, Karner, Das et al. 2011). In vitro, the addition of low levels of small molecule
antagonists of glycogen synthase kinase-β (Miyamoto, Yoshida et al.) such as CHIR99021,
which mirror Wnt-ligand induced elevation of β-catenin levels by inhibiting a β-catenin
destruction complex (Bain, Plater et al. 2007), is essential for maintenance and expansion of
NPCs (Brown, Muthukrishnan et al. 2015, Ramalingam, Fessler et al. 2018, Hilliard, Song et al.
2019). These findings, together with evidence of the association of β-catenin around putative
37

NPC-restricted target genes, supports a direct transcriptional role for the canonical Wnt pathway
activity in maintenance and expansion of NPCs (Karner, Das et al. 2011, Park, Ma et al. 2012,
Ramalingam, Fessler et al. 2018). However, genomic scale analyzes of Lef/Tcf/Wnt chromatin
interactions did not observe a robust binding around proliferation associated genes requiring a
low level of CHIR for expansion of NPCs in vitro, arguing against a canonical Wnt transcriptional
response(Guo, Kim et al. 2021). In contrast, raising the concentration of GSK3β antagonists in
vitro, raises the level of β-catenin resulting in a switch of Lef/Tcf complexes at enhancers
controlling NPC differentiation, and the transcriptional activation of target genes (Guo, Kim et al.
2021)
Given an ability to isolate and manipulate large numbers of NPCs in tissue culture (Brown,
Muthukrishnan et al. 2015), and the interesting question of how opposing progenitor responses
are programmed through the same pathway (Karner, Das et al. 2011, Park, Ma et al. 2012,
Guo, Kim et al. 2021), the NPC culture model provides an excellent system for the mechanistic
dissection of Wnt pathway actions within NPCs. To gain a deeper understanding of β-catenin’s
action in NPC maintenance and renewal, we developed a system for rapid genetic modification
of NPCs in vitro and studied the effects of modulating β-catenin and Tcf/Lef factor activity on the
self-renewal and induction of primary mouse NPCs (Brown, Muthukrishnan et al. 2015). New
insight into Wnt actions in the kidney may have broader significance given the predominant role
for Wnt-regulation of stem/progenitor programs in metazoan (Ying, Wray et al. 2008, Lien, Polak
et al. 2014, Gehart and Clevers 2019).
Results:
NPEM culture provides a rapid and consistent method for studying Wnt supported NPC
maintenance and commitment
38

To model the self-renewal and induction of NPCs in vitro, mouse NPCs were isolated from
embryonic day (E) 16.5 kidneys by enzymatic digestion and MACS purification, then cultured in
Nephron Progenitor Expansion Media (NPEM), a defined medium formulated from insight into
signaling pathways implicated in maintaining NPCs in vivo (Brown, Muthukrishnan et al. 2015).
NPC expansion over multiple generations required low levels (1.25µM) of the GSK3β inhibitor
CHIR99021 (Figure 1A), supporting a role for canonical Wnt signaling in this process,
consistent with genetic studies removing Wnt9b signaling from the nephrogenic niche (Carroll,
Park et al. 2005, Karner, Das et al. 2011), or β-catenin (Park, Valerius et al. 2007) from NPCs.
In the nephrogenic niche in vivo, and low CHIR in vitro, high levels of Six2 highlight
uncommitted NPCs (Figure 1B, C). In short-term culture (24h), there is no requirement for Wnt
signaling to maintain an NPC state: both Cited1 and Six2 levels were elevated in the absence of
CHIR (Supplementary ext. Figure 1A). In the kidney, Six2 is downregulated in conjunction with
the up-regulation of the canonical Wnt target gene and transcriptional effector of Wnt signaling,
Lef1, and the Notch ligand Jag1, a critical regulator of early nephron patterning (Schnell,
Achieng et al. 2022), and the MET of NPCs to form the renal vesicle (Figure 1B) (Park, Valerius
et al. 2007, Park, Ma et al. 2012). Similarly, addition of high CHIR (5µM) for 24h to stabilized
NPC cultures (18-24h in low CHIR NPC) lead to an induction of Lef1 and Jag1 and the
formation of tightly packed aggregated NPC colonies, suggestive of early stages in the transition
of NPCs to renal vesicles (Figure 1C). (Figure 1C; Supplementary ext. Figure 1 A,B ).
Immunostaining showed β-catenin protein in the membranes NPCs in both low and high CHIR
with enhanced membrane accumulation within the tightly packed cell aggregates in high CHIR
(Supplementary ext. Figure 1B).
To examine the high CHIR-mediated inductive response, we performed a time course (0-12h)
and assayed key genes associated with uncommitted (Six2, Cited1, Eya1) and induced (Wnt4,
Lef1, Jag1, Fgf8 and Lhx1) NPC states by quantitative polymerase chain reaction (qPCR)
39

(Supplementary ext. Figure 1A). High CHIR resulted in a progressive downregulation in the
expression of uncommitted cell markers evident within the first 3 hours of culture
(Supplementary ext. Figure 1A). In contrast, all cell commitment associated genes showed
elevated expression within 3hrs of high CHIR addition which increased further to the 12h
timepoint (Supplementary ext. Figure 1A). Altering the seeding density (37,500 to 300,000
cells/well) did not appreciably alter the inductive response (Supplementary Figure 1B). To
verify CHIR acted directly on NPCs, we evaluated the purity of NPC isolation crossing Six2-
GFP:CRE mice (Kobayashi, Valerius et al. 2008) to the R26 loxp-stop-loxp -tdTomato reporter
strain (Madisen, Zwingman et al. 2010) to indelibly label NPCs. Over 92% of cultured cells
showed tdTomato activity indicating the transcriptional responses reflected bona-fide NPC
responses to high CHIR (Supplementary Figure 1C). Altering the seeding density (37,500 to
300,000 cells/well) did not appreciably alter the inductive response (Supplementary Figure
1B).
To determine that low and high CHIR modelled responses to Wnt-ligand signaling and not
secondary effects of blocking Gsk3 activity, NPCs were cultured with a bi-specific antibody that
binds both Frizzled and LRP components of the Wnt-receptor complex, mimicking Wnt ligand
signaling (Janda, Dang et al. 2017). NPCs cultured in 500pM of the bispecific antibody showed
significantly elevated cell proliferation as measured by EDU incorporation, but no evidence of an
inductive response (Supplementary Figure 1E), whereas supplementation at 4nM resulted in a
marked down-regulation of the NPC markers Cited1 and elevated expression of Jag1 and Wnt4
(Supplementary Figure 1D) as observed in the switch from low to high CHIR. Together, these
results indicate that low and high CHIR addition model key features of quantitative Wnt-receptor
activation in the expansion (low receptor activity) and induction (high receptor activity) of NPCs.
(Supplementary Figure 1D). However, high levels of the bispecific antibody did not result in the
pronounced down-regulation of Six2 expression observed on high CHIR induction potentially
40

reflecting differences in the mode of CHIR and antibody activation of canonical Wnt responses
in target cells (Supplementary Figure 1D).
To examine high CHIR-mediated induction in more detail, stabilized cultures were maintained
for 24h in either low or high CHIR, and gene expression analyzed by mRNA-seq. As expected,
the principal component of variability in the comparative analysis was CHIR treatment (71%
variance) (Supplemental Figure 1F) with no and low CHIR conditions displaying a similar
distribution, distinct from the high CHIR treatment (Supplemental Figure 1F). DE-SEQ2
analysis (log2FC cut off 0.5; p-adj cut off 0.050) comparing low CHIR with no CHIR conditions
showed fewer significant differences in transcript levels. In the absence of CHIR, transcript
levels for transcriptional determinants associated with the NPC state where elevated (eg. Osr1,
Meox1, Meox2, and Cited1), consistent with earlier qPCR analysis (Supplementary Figure 1C;
Supplementary Table 2). Thus, Wnt/β-catenin signaling attenuates NPC gene activity directly
or indirectly (for example, by stimulating cell proliferation) arguing against a transcriptional role
for β-catenin in maintaining an NPC state.
Comparing high CHIR to low CHIR showed a marked downregulation of genes encoding
regulatory factors and marker genes specific to the NPC state (including Six2, Eya1, Meox1,
Meox2, Osr1, Cited1, Tmem100) (Figure 1D; Supplementary Table 1), and the activation of
genes associated with NPC induction in vivo (including Fgf8, Wnt4, Jag1, Lef1, Emx2, Cux2
Ovol1) (Figure 1D; Supplementary Table 1). Similar trends are observed comparing low CHIR
to no CHIR NPCs with no CHIR having higher levels of Six2, Eya1, Cited1, Osr1, Meox1,
Meox2 suggesting that low levels of CHIR repress the self-renewal signature (Supplementary
Figure 1A) Consistent with biological processes at play, gene ontology terms highlight nephron
epithelium development and kidney epithelium development as significantly enriched terms for
genes down-regulated in high CHIR (Figure 1F; Supplementary Table 15) and urogenital
system development, renal system development, and epithelial tube morphogenesis amongst
41

the top 10 most significant terms for the up-regulated gene set (Figure 1E; Supplementary
Table 16).
To determine whether the primary inductive response requires new protein synthesis, we
treated NPCs with cycloheximide (CHX), an inhibitor of eukaryotic translation elongation
(Schneider-Poetsch, Ju et al. 2010), in high CHIR conditions. We observed an up-regulation of
induction associated genes such a Jag1, Wnt4, Lef1 and Lhx1 in the presence of CHX, though
not to normal levels (Supplemental Figure 3D-F). Thus, primary induction was independent of
new protein synthesis but the full response may require translation of new mRNA synthesis.
Interestingly, CHX treated NPCs failed to down-regulate Six2, Cited1 and Eya1 genes
associated with the self-renewing NPC state suggesting the engagement of a β-catenin
transcriptional program in suppressing the NPC state (Supplemental Figure 1A, 3E). Retention
of an NPC program may be an additional factor in the weak inductive response observed in
CHX.
42

43

44

45

mRNA transfection provides mediated removal of β-catenin in primary mouse nephron
progenitors
To develop a platform for rapid, genetic modification of NPCs in vitro, we developed a mRNA
lipofection approaches to modulate gene activity. Initially, we tested introduction of mRNA
reporters. Lipofectamine (OPTI-mem) transfection of NPCs with polyadenylated mRNA
encoding an mCherry reporter resulted in ~ 30% of cells exhibiting mCherry fluorescence within
3h of tranfection (Supplementary Figure 2A). Reporter mRNA transfected cells showed
expected response to varying levels of examining Six2, Cited1 and Wnt4 (Supplementary
Figure 2B). Co-transfection of GFP and mCherry mRNA and analysis of cells at 24h showed
that up to 80% of cells were reporter positive, with most cells producing both GFP and mCherry,
Figure 1: NPEM culture provides a rapid and consistent method for studying Wnt supported NPC
maintenance and commitment
A) Schematic representation of NPC isolation and culture in NPEM supplemented with no (0uM) CHIR, low
(1.25uM) CHIR and high (5uM) CHIR (for more details see (Brown, Muthukrishnan et al. 2015) B)
Immunofluorescence staining Six2, Lef1, Jag1, DAPI (green, red, cyan, blue) in E16.5 wild type kidney (scale bar
= 10um).C) Immunofluorescence staining Six2, Lef1, Jag1,DAPI (green, red, cyan, blue) on wild type nephron
progenitor cells culture in 0um, 1.25uM and 5uM CHIR)(scale bar = 10um).D) Bulk RNA-Seq data of DEGs using
log2fc = absolute value cut off 0.5 and p-adjusted value cut off = 0.05 comparing 1.25uM CHIR and 5uM CHIR
post 24 hour of culture represented as a volcano plot. E)Top 10 most significant gene ontology analysis of DEGs
that are upregulated in 1.25uM CHIR compared to 5uM CHIR F) Gene ontology analysis of DEGs that are
upregulated in 5uM CHIR compared to 1.25uM CHIR (the same as down in 1.25uM CHIR as 5uM CHIR)

Supplemental Figure 1:
A) Bulk RNA-Seq data of DEGs using log2fc = absolute value cut off 0.5 and p-djusted value cut off =
0.05comparing 0uM CHIR and 1.25uM CHIR post 24 hour of culture represented as a volcano plot. B) RT-qPCR
of self-renewal genes (Cited1, Six2) and induction genes (Jag1, Wnt4) of NPCs cultured with wnt surrogate bi-
specific antibody (BSAB) to validate activation of Wnt pathway using CHIR across 2 biological replicates Delta Ct
= (Gapdh – ct gene value) (n=2). C) Percent purity of NPCs derived from Six2TCGx Tdt mice. Purity measured
as expression of Six2 marked by presence of linage reporter activity Tdt expression. D) RT-qPCR results for
Six2, Cited1, Wnt4, Lef1, Lhx1, Jag1 (Gapdh-Ct value) of NPC cultured at 300K, 150K, 75K and 37.5K at 0uM,
1.25uM and 5uM CHIR. Further from x-axis denotes less expression across 3 biological replicates. E)
Quantification of Edu chasing (1 hour) of NPCs post 24-hour exposure to NPEM with various levels of Wnt input.
F) Principal component analysis of bulk RNA-Seq of wild-type NPCs cultured in 0uM, 1.25uM and 5uM CHIR.

Supplemental Figure 1 extension:
A) RT-qPCR of NPC cultured across a 3, 6 and 12 hour time course. Values are normalized to Gapdh, compared
to low CHIR conditions and Log2 transformed for plotting. Green genes are self-renewing and red genes are
inductive. Grey panel denotes genes in 0uM CHIR, light green in 1.25uM CHIR and darker green in 5uM CHIR.
B) Immunofluorescence staining β-catenin, Jag1, DAPI (green, magenta, blue) on wild type nephron progenitor
cells culture in (1.25uM and 5uM CHIR) (scale bar = 10um).

46

suggesting cells competent for infection take up multiple mRNAs (Supplementary Figure
2C,D). When NPCs were harvested from mice constitutively expressing a Cas9-GFP allele
(Platt, Chen et al. 2014) and transfected with a gRNA targeting GFP and mCherry reporter
ebcoding mRNA, fluorescence activated cell sorting FACS analysis identified a 75% reduction in
GFP signal 24h post-transfection localized to mCherry+ NPCs (Supplementary Figure 2E).
Thus, mRNA transfection provided a robust means of introducing exogenous gene activity and
modifying endogenous gene activity in the same NPC.
To gain a deeper understanding of Wnt/β-catenin signaling in NPC self-renewal and
commitment we used two different mRNA directed approaches to remove β-catenin activity:
knock out through transfection of β-catenin targeting gRNAs in Cas9-GFP+ NPCs and Cre
mRNA-mediated removal in NPCs homozygous for a conditional allele of β-catenin ((Brault,
Moore et al. 2001); Figure 2A). In all experiments, co-transfection with mCherry reporter mRNA
was used to distinguish co-transfected cells. NPCs from both mouse strains were isolated from
E16.5 kidneys, stabilized in 1.25uM CHIR overnight and transfected for 3h in OPTI-mem
(Figure 2A). After transfection, NPCs were cultured in 1.25µM CHIR for a 24h to enable the
genetic removal and turnover of mRNA and protein, before continuing culture for 24h in the
absence of CHIR, or adding CHIR under NPC maintenance (1.25µM CHIR) or induction
conditions (5.0µM CHIR). The effectiveness of β-catenin removal was assessed quantitatively
by immunostaining 24h post Cre or gRNA/Cas9 removal (Figure 2A). Immunostaining showed
β-catenin levels were reduced significantly in both mRNA transfection conditions (Cre ~70%
Cas9~65%) (Figure 2B,C,D,E).
47

48

Figure 2: mRNA transfection provides rapid Cre or Cas9 mediated removal of β-catenin in primary mouse
nephron progenitors
A) Schematic representation of Cre and Cas9 mediated transfection KO of NPCs from Cas9-GFP expressing and
β-catenin conditional allele mice. NPCs are isolated, stabilized in 1.25uM CHIR overnight (18-24hours),
transfected with either sgRNAs or Cre mRNA and mCherry mRNA and incubated in OPTI-MEM for 3 hours. Then
NPCs are cultured in 1.25uM CHIR for a 24-hour KO period prior to change in NPEM with differing CHIR levels.
NPCs are assayed for mRNA seq as well as immunostaining post 24 hours. B) Immunostaining of NPCs post 24-
hour Cas9 mediated KO prior to media change into NPEM with differing levels of CHIR. β-catenin in 488 channel
and mCherry (denoting transfected cells) in red (scale bar = 10um). C) Quantification of reduction in membrane
β-catenin protein signal post 24-hour Cas9 KO period in transfected (mCherry+) NPCs. (~65% KO after 24-hour
guide transfection). D) Immunostaining of NPCs post 24-hour Cre mediated KO prior to media change into NPEM
with differing levels of CHIR. B-catenin in 488 channel and mCherry (denoting transfected cells) in red (scale bar
= 10um). E) Quantification of reduction in membrane B-catenin protein signal post 24 hour Cre KO period in
transfected (mCherry+) NPCs (~70% KO after 24 hour of cre mRNA transfection).

Supplementary Figure 2:
A) Transfection rates of GFP-mRNA in NPCs measured by FACS sorting (2 biological replicates). B)RT-qPCR of
NPCs transfected with GFP and harvested 24 hours after changing media with altering CHIR conditions. Ct-
differences normalized to GAPDH and samples compared to 1.25uM CHIR conditions. Log2 transformed values
are plotted. 2 biological replicates. C) FACS sorting measuring co-transfection rates of mCherry and GFP mRNA
into NPCs. Data from 2 biological replicates D) Immunostaining of GFP and mCherry in NPCs demonstrating co-
localization of signal. E) GFP signal in GFPsgRNA/mCherry co- transfected samples and Ctnnb1sgRNA/mCherry
co-transfected samples

49

β-catenin promotes NPC proliferation but not the transcriptional program of self-
renewing NPCs.
Previous reports have suggested β-catenin’s transcriptional activity is required for expansion of
the nephron progenitor pool and NPC signature gene activity (Karner, Das et al. 2011,
Ramalingam, Fessler et al. 2018). Removal of β-catenin resulted in a reduction in Edu
incorporation, indicative of reduced cell proliferation, in both 1.25µM and 5µM conditions,
mirroring experimental removal of CHIR from NPEM, supporting the conclusion β-catenin
promotes the proliferation of NPCs (Figure 3 A,B,C).
To assess the transcriptional role of β-catenin in self-renewal conditions, we performed mRNA-
seq and DeSeq2 analysis (Log2FC cut off 0.5; p-adj cut off 0.5) to determine gene expression
changes shared on Cre or gRNA/Cas9 removal of β-catenin 48h post transfection. Cre
mediated removal yielded a larger number of differentially expressed genes, consistent with the
analysis of β-catenin levels (Figure 2D,E). Intersecting differentially expressed genes (DEGs)
shared between Cre and Cas9 removal, identified a small but significant group of genes up (n=
13; p-value = 2.007614e-70) or down (n=12; p-value = 1.534308e-69) regulated on β-catenin
removal in progenitor maintenance conditions (Figure 3D,E; Supplementary Table
T3,T4,T11,T12). GO term analysis identified kidney development amongst the enriched terms in
the up-regulated gene set consistent with elevated progenitor gene expression on CHIR
removal (Supplemental Figure 3A; Supplemental Table T12). In summary, β-catenin removal
did not result in a significant loss of either an NPC transcriptional or proliferative transcriptional
signature suggesting transcriptional Wnt pathwy activity is not required for maintenance of the
NPC state or cell replication.
Earlier reports suggested direct Wnt/β-catenin regulation of a number of an NPC self-renewal
target genes including Tafa5, Uncx, Pla2g7 and C1qtnf12 (Karner, Das et al. 2011). However,
expression of these genes was not altered on β-catenin removal. Examination of scRNA seq
50

data of p0 mouse kidneys showed variable expression of these genes in Six2+ NPCs while
most were co-expressed in Wnt4+ Jag1+, Lef1+ induced NPCs (Supplemental Figure 3G).
Thus, most are likely targets of induction. Examining ChiP-seq analysis of β-catenin/Tcf/Lef
interactions in primary NPCs (Guo, Kim et al. 2021) demonstrated Tafa5 undergoes a similar
Tcf/Lef transcriptional switch to elevated levels of β-catenin as Wnt4, Jag1, suggesting Tafa5 is
potentially a direct target of β-catenin-mediated transcriptional regulation in induced NPCs
(Supplementary Figure 3H). Further, intersection of the shared down regulated gene set with
the β-catenin/Tcf7/Lef1 Chip-seq data did not support direct regulation through β-catenin
transcriptional complexes (Supplementary Table 7). Additional evidence against a
transcriptional came from role assessing all β-catenin and activating Tcf/Lef factor (Tcf7/Lef1)
associations in low and high CHIR using MACS 2 (see Methods). Whereas high CHIR identified
5011 β-catenin/Tcf7 or Lef1 peaks-gene associations only 283 associations were detected in
low CHIR. None of the 12 genes whose expression was reduced on Cre and gRNA/Cas9
removal of β-catenin had β-catenin/Lef1 or Tcf7 association in the Guo et al (2021) dataset
(Supplementary Table 7, Supplementary Table 23).
51

52

53

β-catenin removal maintains nephron progenitors in a morphologically and
transcriptionally self-renewal like state in the presence of high Wnt input
Strikingly, β-catenin removal using both genetic approaches reduced NPCs ability to
differentiate, as marked by an absence of Jag1 upregulation (Figure 4 A,B,C), a failure of cell
aggregation (Figure 4 D,E) and an expansion of cell area, indicating a change in cell
morphology, in high Wnt input conditions (Figure 4G,H). Similar findings were obtained in
response to higher levels of the bispecific Wnt-receptor antibody (Figure 4A-F; Supplementary
Figure 4G-I). These data indicate β-catenin activity couples a transcriptional and morphological
response on induction of NPCs. This study focuses on the transcriptional response. The
morphological response is analyzed in a second manuscript (Der, Bugacov et al., 2023
submitted).
Figure 3: β-catenin promotes NPC proliferation but is not a transcriptional regulator of the self-renewal
program
A) Edu chasing f NPCs with Cas9 mediated B-catenin removal post 24-hour culture. B) Quantification of Edu+
(proliferating cells) per total number of NPCs in Cas9 Ctnnb1 KO samples. C)Quantification of Edu+ (proliferating
cells) per total number of NPCs in Cre Ctnnb1 KO samples. D) Intersection of DEGs upregulated (Cre up and
Cas9 up) or down regulated (Cre down and Cas9 down from NPCs with Ctnnb1 removed in 1.25uM (low) CHIR.
DEGs calculated with DESEQ2 using with p-adjusted cut offs = 0.05 and Log2FCcut off =0.5. E) Heatmap of
unbiased ranking based on significance of all upregulated genes compared to control low CHIR samples of the
intersection of both Cre and Cas9 mediated removal of B-catenin in low CHIR. F)Heatmap of unbiased ranking
based on significance of all downregulated genes compared to control low CHIR samples of the intersection of
both Cre and Cas9 mediated removal of β-catenin in low CHIR

Figure 3 Supplementary Figure:
A) Gene ontology (GO) terms associated with genes upregulated upon Ctnnb1 removal in low CHIR. B) Gene
ontology (GO) terms associated with genes downregulated upon Ctnnb1 removal in low CHIR. C) Expression of
DEGs upregulated from Ctnnb1 KO within the GO term kidney development in sc-RNA-Seq p0 mouse kidney. D)
immunofluorescence staining of NPCs treated with Cycloheximide (CHX) for 12 hours (Jag1 -green, DAPI-white).
E) RT-qCPR of NPCs treated with CHX for 12 hours. Log2FC graphed compared to low CHIR conditions. Values
normalized to Gapdh expression. F) Quantification od Jagged-1 expression in CHX treated NPCs vs vehicle
(DMSO) control. G) Expression of previously published Ctnnb1 NPC self-renewal targets (Karner, Das et al.
2011) in sc-RNA-Seq p0 mouse kidney. Co-expression with Self-renewal markers Six2 and Cited and induction
markers Wnt4 and Jag1 suggest the majority are co-expressed in an induced compartment.
H)Ctnnb1/Tcf7l1/Tcf7l2/Tcf7/Lef1 ChiP seq at Tafa5 (Fam19a5) cis-regulatory regions express induction marker
Tcf/Lef switch previously reported in induction target genes suggesting Tafa5 is an induction marker (Guo, Kim et
al. 2021).

54

NPCs lacking β-catenin retained features of the NPC state when switched to high CHIR
conditions including higher levels of Six2 and the repressive Lef/Tcf regulatory factor, Tcf7l1
(Supplementary Figure 4 A-F). Tcf7l1, is normally expressed at highest levels in the self-
renewing nephron progenitor compartment as evidenced by mouse p0 scRNA-seq analysis
(Supplementary figure 4F) and was transcriptionally upregulated in NPCs in low CHIR versus
high CHIR conditions (Figure 1D). Tcf7l1 protein levels were also elevated on removal of CHIR
(Guo, Kim et al. 2021) and altered Tcf7l1 levels on β-catenin removal suggest Tcf7l1 levels are
sensitive to Wnt input (Supplementary Figure 4D).
55

56

57

β-catenin transcriptional targets in the induction of Nephron progenitors
Bulk mRNA-sequencing was performed on biological replicates for both β-catenin removal
conditions in high CHIR culture following FACS isolation of genetically modified NPCs. Cre
mediated removal yielded a larger set of differentially expressed genes (Figure 5 A,B; DeSEq2
analysis log2 expression change cut off 0.5 and adjusted pValue 0.05; hypergeometric test p-
value up = 3.068098e-1664 and pvalue down 3.6675e-776). PCA analysis comparing control
and experimental samples in low and high CHIR conditions demonstrated co-clustering
amongst NPCs in all low CHIR conditions, and on β-catenin removal in high CHIR, consistent
with NPCs retaining an NPC state on removal of a canonical Wnt signaling capability
(Supplementary Figure 5A). Ranked intersections of Cre and Cas9 mediated KO identified
Cited1 as the most significant up regulated gene in KO NPCs, with other well known NPC
identifiers such as Tmem100, Meox2 and Osr1 in the top 30 ranked gene set (Figure 5C). NPC
self-renewal genes comprised much of the highly ranked GO term “urogenital system
Figure 4: Cell morphology/induction status changes resulting from β-catenin removal in nephron
progenitors in high CHIR
A) Jagged1 protein is lost in Cas9 mediated removal of β-catenin in NPCs in mCherry+ transfected cells in 5uM
CHIR. DAPI marks nuclei. B) Quantification of Jagged1 protein in mCherry + NPCs in Cas9 mediated removal of
β-catenin C) Quantification of Jagged1 protein in mCherry + NPCs in Cre mediated removal of β-catenin. D)
NPCs with β-catenin removed (transfected cells) do not form tight aggregates. mCherry marks transfected cells,
Jagged1 induction marker and DAPI (nuclei marker) white/grey. E) Percentage of mCherry+ transfected NPCs in
NPCs with β-catenin removed (Cas9 method) within aggregates. F) Percentage of mCherry+ transfected NPCs in
NPCs with β-catenin removed (Cre method) within aggregates. G) Total cell area in Cas9 mediated β-catenin KO
in low and high CHIR conditions. H) Total cell area in Cre mediated β-catenin KO in low and high CHIR
conditions

Supplemental Figure 4:
A) Immunostaining of NPCs with Cas9 mediated β-catenin KO in high CHIR (Six2 = green, mCherry = Red). B)
Quantification of increase in Six2 staining in Cas9 mediated β-catenin removal of NPCs cultured in high CHIR. C)
Quantification of increase in Tcf7l1 staining in Cre mediated β-catenin removal of NPCs. D)Immunostaining of
NPCs cultured in 1.25uM CHIR. Tcf7l1= green, mCherry = Red. E) Immunostaining of NPCs cultured in 5uM
CHIR. Tcf7l1= green, mCherry = Red. F) Feature plot of sc-RNA-Seq p0 mouse kidney expression of Co-
expression with self-renewal marker Six2 and induction marker Jag1 denoting Tcf7l1 co-expression in self
renewing NPCs and Lef1 co-expressing with induced NPCs. G) Immunostaining of NPCs with β-catenin removed
via Cas9 method across a 24 hour time course (red= mCherry transfected cells, white= DAPI). H) Quantification
of transfected (mCherry+) NPCs across a 24hr time course in various CHIR concentrations with and without β-
catenin removed using Cas9. I) Quantification of transfected (mCherry+) NPCs across time course in various
CHIR and Bi-specific antibody concentrations with and without β-catenin removed using Cas9.

58

development” recovered from gene ontology analysis of the entire gene set (Figure 5E). Other
terms such as “ameboidal cell movement”, “epithelium migration” and “tissue migration” likely
reflect altered cell behaviors observed on induction of NPCs following β-catenin removal
(Figure 5E; Supplementary Table T14).
The top 30 most significant down-regulated genes on Cre removal of β-catenin removal
included well characterized genes up-regulated in association with NPC induction in vivo
including Wnt4 and Jag1 (Figure 5D; Ma et al. 2012). As expected, top GO terms in this group
of genes were associated with kidney development programs: “embryonic organ
morphogenesis”, “renal system development” and “morphogenesis of an embryonic epithelium”;
and Wnt signaling, including “Wnt signaling pathway” and “cell-cell signaling by Wnt”, consistent
with a modified Wnt-signaling response (Supplementary Table T13). Several transcriptional
regulators were amongst the β-catenin dependent high CHIR gene set including Emx2 and
Ovol1.
Moreover, the term negative regulation of cell motility and negative regulation of cell adhesion
appears for sets of genes that are lost with the removal of β-catenin which is consistent with the
increase in motility that appears among the cells in culture upon β-catenin removal. This motility
may be lost due to numbers of genes coding for proteins that require β-catenin to stabilize cell-
cell contacts such as Cadherins (Valenta, Hausmann et al. 2012) as Cdh3, Cdh4, Cdh6 and
Cdh13 which are among the 282 genes lost upon β-catenin removal (Supplementary Table 9).
59

60

Tcf/Lef transcription factor removal in nephron progenitors enables β-catenin target
validation.
Tcf/Lef factors are the transcriptional mediators of Wnt signaling (REF review on transcription).
Of the four Tcf/Lef factors, fluorescent in situ hybridization and mouse p0 scRNA-seq suggests
that Tcf7l1 and Lef1 have elevated expression in self-renewing and induced nephron progenitor
Figure 5: Transcriptional changes resulting from β-catenin removal in nephron progenitors
A) Intersection of DEGs upregulated from Cre and Cas9 mediated β-catenin removal. B) Intersection of DEGs
downregulated from Cre and Cas9 mediated β-catenin removal. C) Heatmap of unbiased ranking of top 30
significant upregulated genes compared to control samples of the intersection of both Cre and Cas9 mediated
removal of β-catenin in high CHIR. D) Heatmap of unbiased ranking of top 30 significant downregulated genes
compared to control samples of the intersection of both Cre and Cas9 mediated removal of β-catenin in high
CHIR. E) Top 10 most significant Gene ontology terms (GO) associated with genes upregulated as a result of β-
catenin removal in high CHIR of intersected Cre and Cas9 meditated DEGs. F) Top 10 most significant Gene
ontology terms (GO) associated with genes downregulated as a result of β-catenin removal in high CHIR of
intersected Cre and Cas9 meditated DEGs

Supplemental Figure 5:
A)PCA plot of Bulk mRNA-SEQ B-catenin KO samples displaying Cre (light green) and Cas9 (Dark green) control
(circle) and KO (triangle) samples cultured in both Low and High CHIR

61

domains, respectively, while Tcf7 and Tcf7l2 have similar expression in both NPC states which
can account for some but not all aspects of altered binding of these factors in low and high
CHIR conditions (Figure 6 Supplementary A-D; Guo et al., 2021).
To assay the requirement for Tcf/Lef factors in modulating self-removal and induction we
optimized gRNAs for individual removal of each factor and extended the culture protocol for an
additional 24h following gRNA introduction into CAS9+ NPCs to ensure a strong knock-down of
Tcf/Lef factors before switching to high CHIR conditions (Figure 6A; Figure 6 Supplementary
extension A-H). Importantly, 24h of additional NPC culture did not alter gene expression trends
for Six2, Cited1, Wnt4 and Jag1, key anchor genes employed throughout the study
(Supplementary Table 19). Individual gRNAs led to a removal of greater than 80% of protein
for Tc7l1, Tc7l2 and Lef1 and 50% for Tcf7 (Supplementary Figure 6E) resulting in a ~50%
reduction of Jag1 protein compared to controls when all four gRNAs were combined in high
CHIR conditions (Figure 6B,C). Thus, knock-down of Lef/Tcf input appeared to attenuate the
CHIR-mediated inductive response.
To characterize this response further, bulk mRNA-sequencing was performed on biological
replicates of FACS sorted genetically modified NPCs from the quadruple KO population (QKO).
PCA analysis indicated QKO cells cluster separately from wild type NPCs under high CHIR
conditions, closer to NPCs maintained in low CHIR conditions (Supplementary Figure 6E). DE-
Seq2 DEG lists (absolute log2FC cut off 0.5; p-adj cut off 0.05) showed little difference in DEG
between wildtype and QKO samples in low CHIR conditions consistent with β-catenin removal
experiments (Figure 6F). PCA analysis of these samples also suggests very little variance and
none of the DEG’s in low CHIR QKO samples intersects with DEGs in low CHIR β-catenin
removal samples (Supplementary Table 21). This data supports the notion that the nephron
progenitor self-renewal program is not transcriptionally regulated by β-catenin/Tcf/Lef.
62

In contrast, DEG’s between wildtype and QKO NPCs in high CHIR identified a marked
response, with an overlapping set of 90 genes shared with β-catenin removal in high CHIR
conditions and similar GO terms (Figure 6D; Supplementary Table 22). Overall, QKO NPCs
showed a more NPC like state in high CHIR (eg. up-regulation of Wt1, Meox2, Osr2 and
“ameboid cell movement” and “nephron development GO terms) and a down-regulation of
expected inductive targets (eg Wnt4, Jag1, Lef1) (Figure 6 E,F; reference GO term table).
Notable differences between QKO and β-catenin removal in the segregation of NPCs and
induction of key patterning genes such as Pou3f3, an early distal nephron determinant (Rieger,
Kemter et al. 2016, Lindstrom, De Sena Brandine et al. 2018), likely reflects redundancy in the
activities of Lef/Tcf factors and the difficulty in experimentally removing all their activities.
Analysis of QKO DEGs yields GO terms urogenital system development and epithelial tube
morphogenesis. Well established induction targets Wnt4, Jag1 were downregulated because of
QKO. Mediators of cell adhesion Cdh3, Cdh4, Cdh13 also differentially expressed because of β-
catenin removal were lost upon QKO. Moreover, transcription factors Emx2, Bach2, Cux2 are
also lost upon QKO (Figure 6 E,G). The GO terms Wnt signaling pathway and cell-cell signaling
by wnt also appear upon GO enrichment from intersected lists of genes lost as a result of QKO
suggesting that expected β-catenin/Tcf/Lef targets are lost.

63

64

65

66

Integration of published ChIP seq data and scRNA-seq data with β-catenin target genes
reveals a suite of genes responsible for the early induction of NPCs and patterning of the
developing nephron
Given the accrued evidence for a direct β-catenin/Tcf/Lef-driven transcriptional response in the
invitro NPC induction assay, we intersected the 282 β-catenin dependent genes from the dual
genetic KO gene list with published ChiP-seq analysis of the chromatin association of β-catenin,
Tcf7and Lef1 in high CHIR conditions (Supplementary Table 23; Guo et al., 2021 and see
Methods). A significant overlap (p-value = 2.941503e-40) was observed with 161 genes using
HOMER to assign genes to peaks within 1 kilobase of the transcription start site (TSS) (defined
Figure 6: Tcf/Lef transcription factor removal in nephron progenitors enables β-catenin target validation.
A) Schematic representation of Cas9 mediated removal of Tcf7l1, Tcf7l2,Tcf7 & Lef1 in NPCs isolated from
Cas9-GFP expressing mice. NPCs were isolated, stabilized in 1.25uM CHIR overnight (18-24hours), transfected
with sgRNAs (targeting Tcf7l1, Tcf7l2,Tcf7 & Lef1 in experimental conditions or GFP in control conditions) along
with mCherry mRNA and incubated in OPTI-MEM for 3 hours. Then NPCs are cultured in 1.25uM CHIR for a 48-
hour KO period prior to change in NPEM with differing CHIR levels. NPCs are assayed for mRNA seq as well as
immunostaining 24 hours later.B) Immunofluorescence staining of NPCs with Tcf7l1,Tcf7l2,Tcf7 & Lef1 (QKO).
Induction marker Jag1 = cyan, mCherry = red, Golji = green, DAPI= white. 10um scale bar. C) Quantification of
induction marker Jag1 in QKO NPCs cultured in 5uM CHIR. D) Intersection of QKO target genes (genes lost in
QKO with log2fc cut off 0.5 and padj cut offs0.05) with Ctnnb1 KO target genes (genes lost in Ctnnb1 Cre and
Cas9 KO with log2fc cut off 0.5 and padj cut offs 0.05). E) Volcano plot of DEGs comparing QKO samples vs
control in high CHIR conditions. Decreased = genes lower in QKO samples; Increased= Genes higher in control
(GFP targeted) sample. F) Top 10 most significant Gene ontology analysis (GO) of DEGs upregulated in QKO
samples in high CHIR conditions. G) Top 10 most significant Gene ontology analysis (GO) of DEGs
downregulated in QKO samples in high CHIR conditions.

Supplementary Figure 6:
A) RNA scope of E16.5 Six2TGC x Tdt kidneys. Cyan = Tcf7l1, Lef1= Green, tdT antibody = red, DAPI= white. B)
RNA scope of E16.5 Six2TGC x Tdt kidneys. Cyan = Tcf7l2, DAPI= white, tdT antibody = red. C) RNA scope of
E16.5 Six2TGC x Tdt kidneys. Cyan = Tcf7, Lef1 antibody = Green, tdT antibody = red, DAPI= white. D) scRNA-
seq E16.5 kidneys – (Guo, Kim et al. 2021) dotplot showing Tcf7l1 and Lef1 expression in self-renewing and
induced NPCs respectively. E) principal component analysis (PCA) plot of control (GFP sgRNA) and QKO
(Tcf7l1, Tcf7l2, Tcf7, Lef1 sgRNA) in low and high CHIR. F) Volcano plot of all DEGs with absolute Log2FC cut
off 0.5; p-adj cut off 0.5 comparting low CHIR control and QKO samples. Increased are genes increased as a
result of QKO.

Supplementary Figure 6 extension:
A) Immunofluorescence staining of Tcf7l1= Cyan, mCherry (transfected cells) = red, DAPI= white denoting
Tcf7l1 protein removal. B) Quantification of Tcf7l1 protein removal. C) Immunofluorescence staining of Tcf7l2=
Cyan, mCherry (transfected cells) = red, DAPI= white denoting Tcf7l2 protein removal. D) Quantification of Tcf7l2
protein removal. E) Immunofluorescence staining of Tcf7= Cyan, mCherry (transfected cells) = red, DAPI= white
denoting Tcf7 protein removal. F) Quantification of Lef1 protein removal. G) Immunofluorescence staining of
Lef1= Cyan, mCherry (transfected cells) = red, DAPI= white denoting Lef1 protein removal. H) Quantification of
Lef1 protein removal
67

from -1kb to +100bp) or 1 kilobase (defined from -100 bp to +1kb) from the transcription
termination site (TTS) (Duttke, Chang et al. 2019) (Supplementary Table 24). Intersecting these
putative target genes with annotated single cell datasets of the P0 mouse kidney undergoing
early patterning from NPCs identified 137 of the 162 gene set shared with the in vivo
determined gene sets (see Methods; Supplementary Figure 7A,B,C; Supplementary Table 25).
These analyzes provide strong evidence that in vitro inductive responses in CHIR treated NPCs
reflect in vivo activity of β-catenin directed, Lef/Tcf driven, transcriptional programs in committed
NPC cell types. De novo induction of transcriptional regulators such as Ovol1 and Emx2, which
have β-catenin and Tcf/Lef factors associated with potential cis-regulatory modules in high
CHIR conditions (Supplementary Figure7D,E), may act as downstream transcriptional effectors
of nephron patterning initiated by canonical Wnt signaling. Consistent with this view, Ovol1 and
Emx2 are expressed in early in induced NPCs overlapping Wnt4. Ovol1 is then expressed
broadly within the renal vesicle (Figure 7C,D) while Emx2 refines to the distal nephron
(Lindstrom, De Sena Brandine et al. 2018)(Figure 7C,E).
68

69

70

Discussion:
This study has removed β-catenin in primary nephron progenitors and enabled the screening of
Wnt pathway targets in early nephron development using a system that models the self-renewal
and induction of NPCs in vitro. The use of mRNA and sgRNA transfection approaches create an
efficient and reliable KO platform for investigating genes of interest and minimize the bias of off
target effects while analyzing DEGs.
The removal of β-catenin in this study yields three novel points for discussion: 1) β-catenin does
not transcriptionally regulate NPC self-renewal however, β-catenin is involved in mediating the
proliferation of NPCs; 2) β-catenin couples a transcriptional response resulting from increased
levels of Wnt input and a cell morphology response by stabilizing cell-cell contacts that
promotes cell adhesion and enables the MET of NPCs in nephrogenesis; 3) the β-
catenin/Tcf/Lef transcriptional targets involved in the induction of nephron progenitor cells
mediate both cell adhesion and later cell induction by upregulating transcription factors involved
in the patterning of the developing nephron.
The role of β-catenin in self-renewal of nephron progenitors:
Figure 7: Integration of published ChIP seq data and scRNA-seq data with β-catenin target genes reveals
a suite of genes responsible for the early induction of NPCs and patterning of the developing nephron
A) Intersection of β-catenin target genes with β-catenin/ Tcf7/Lef1 ChIP seq binding and integration with scRNA-
seq data narrows down a significant list of 137 genes expressed in the developing nephron. B) Schematic
representation of the nephrogenic niche. C) Co-expression of β-catenin target genes Pax2, Id2, Uncx, Emx2,
Ovol1, Dach1 with known markers of self-renewing NPCs (Six2, Cited1), early induction gene (Wnt4), Distal
marker (Pou3f3), proximal tubule marker (Hnf4a), podocyte gene (Mafb) in mouse p0 scRNA-seq. D) RNA-scope
(fluorescent in situ hybridization) of Ovol1 on E16.5 Six2TGCx Tdt kidneys. Scale bar 10um. E) RNA-scope
(fluorescent in situ hybridization) of Emx2 on E16.5 Six2TGCx Tdt kidneys. Scale bar 10um

Supplementary Figure 7:
A) Schematic representation of nephrogenic niche and developing s-shape body. B) UMAP of all clusters of
nephrogenic linage of cells from p0 scRNA-seq data C) feature plots of β-catenin target genes Pax2, Id2, Uncx,
Emx2, Ovol1, Dach1, Sox11 with known markers of self-renewing NPCs (Six2, Cited1), early induction gene
(Wnt4), Distal marker (Pou3f3), proximal tubule marker (Hnf4a), podocyte gene (Mafb) in mouse p0 scRNA-seq
D) gene tracks of ChiP seq data at Ovol1 locus showing β-catenin/ Lef1 binding at annotated Cis regulatory
module of Ovol1 gene E) D) gene tracks of ChiP seq data at Emx2 locus showing β-catenin/ Lef1/Tcf7 binding at
annotated Cis regulatory module of Emx2 gene

71

Genetic evidence supports a direct role for β-catenin in regulating the maintenance and
expansion of NPCs. The in vitro observation that a low CHIR concentration is required to
maintain and expand primary NPCs while high levels induce them informs an in vivo speculation
that there exists a Wnt9b gradient along the UB and that a concentration of a Wnt9b pulse
differentiates the opposing cell fate outcomes of self-renewal and induction (Brown,
Muthukrishnan et al. 2015, Guo, Kim et al. 2021). Examining genes that display Wnt9b-
dependent expression in self-renewing NPCs (Karner, Das et al. 2011) have shown that seven
of the 16 genes showed elevated expression of at least one isoform in low CHIR versus no
CHIR in previous reports (Guo, Kim et al. 2021). However, none of those DEGs are lost upon β-
catenin removal and data suggests that previously identified Wnt9b self-renewal genes may be
early inductive targets due to the Tcf/Lef binding factor switch at regions regulating the
expression of Tafa5 (Fam19a5) and the co-expression of Wnt9b self-renewal genes with
induction genes Wnt4, Lef1, Jag1 (Figure 3G,H Supplementary extension).
The reduction of proliferation as measured by an EDU pulse raises the possibility that β-catenin
acts through an alternative transcriptional or cytoplasmic mechanism. Close examination of
Tcf7l1 binding in low CHIR provides strong evidence that Tcf7l1/ β-catenin binding is not
associative of the self-renewal gene program or mediates of cell-proliferation genes (Guo, Kim
et al. 2021). The changes in cell proliferation concomitant with lack of changes in self-renewal
gene expression suggests that β-catenin may play an essential, non-transcriptional role that
controls cell proliferation. Tcf/Lef/β-catenin nuclear complexes can oscillate with the cell cycle
suggesting other potential nuclear roles and may mediate NPC proliferation (Ding, Su et al.
2014). Moreover, β-catenin is reported to play an essential, non-transcriptional role in self-
renewal of mouse epiblast stem cells (Kim, Wu et al. 2013) and a cytoplasmic role in the
regulation of tooth development (Cantù, Pagella et al. 2017).
72

Moreover, the role of Wnt/ β-catenin signaling in the promotion of the self-renewal program
appears to be inhibitory rather than activating as self-renewal genes Six2, Cited1, Eya1
increase in no CHIR conditions compared to low CHIR conditions (Figure 1A Supplementary
Extension). Moreover, upon β-catenin removal Cited1 transcription is increased in Cre and
Cas9 mediated KO and Six2 and Tcf7l1 protein level also increases. This suggests that β-
catenin may have a secondarily effect of repressing the self-renewal program by directly
targeting a repressor that can negatively feedback and inhibit the renewal program. Additionally,
CHX studies suggest that blocking the new synthesis of proteins not only inhibits the induction
program but also fails to inhibit the self-renewal program upon NPC differentiation suggesting
that upon induction, newly synthesized proteins are needed to inhibit the self-renewal program.
To support this hypothesis Liu, Hilliard et al. have showed that repressors have been previously
implicated in the self-renewal program of NPCs as Ezh2 has been shown to repress Six2
activity and, in turn, aberrantly overexpress Wnt4 (Liu, Hilliard et al. 2020)
One such example and bona fide β-catenin target is Id2 which is lost upon both β-catenin Cre
and Cas9 removal and QKO (Figure 5, Figure 6). P0-scRNA-seq data suggests that Id2 is co-
expressed with Wnt4 and would therefore be an early β-catenin target. Id2 is a mediator of the
BMP pathway which has also been implicated as synergically regulating early stages of
nephrogenesis (Blank, Brown et al. 2009, Brown, Muthukrishnan et al. 2013). Additionally, Id2
has also been shown to be important in gut development and act alongside Six2 (Mori,
Nakamura et al. 2018). However, overexpression experiments of Id2 in NPCs in self-renewal
conditions would be required to test this hypothesis with the expectation that Id2 over
expression would result in decreased levels of Six2, Cited1 and Eya1 in low CHIR conditions.
β-catenin couples a transcriptional response and a cell morphology response enabling the MET
of NPCs
73

β-catenin is most often considered the main canonical Wnt pathway effector and is considerably
less known for its role at the cell surface mediating the interactions between cadherins and
alpha-catenin and actin (Valenta, Hausmann et al. 2012). The removal of β-catenin in this study
couples the phenomena of a transcriptional response resulting from Wnt signaling with a
morphological response that yields a MET and puts β-catenin as a key mediator of both
processes. β-catenin removal in high Wnt input conditions reduced NPCs ability to differentiate
and highlighted the role of β-catenin in cell adhesion as β-catenin KO cells were excluded from
aggregates. Lack of changes in cell size upon induction suggest that β-catenin couples a
transcriptional response as well as a cell morphology/ cell- adhesion/ cell reorganization
response in response to a high Wnt input and is mediated by β-catenin.
A MET driven cell morphology changes and partnered with wnt target genes alterations is not
unique to nephrogenesis and is also observed in formation of the first epithelia in the mouse
embryo through MET (Pei, Shu et al. 2019). A clear understanding of the role of β-catenin in
mediating the cellular morphology response resulting from a Wnt pulse is essential for the
creation nephron units (organoids) in vitro as we aim to manipulate cell rearrangements leading
to the formation of the nephron epithelia by mimicking and manipulating cellular signaling events
that occur during nephrogenesis (Morizane and Bonventre 2017).
β-catenin/Tcf/Lef transcriptional targets involved in the induction of nephron progenitor cells
mediate both cell adhesion and transcription factors that pattern the developing nephron
Transcriptional targets resulting from the removal of β-catenin can be validated by analyzing the
binding of β-catenin and Tcf/Lef factors using previously published ChIP-Seq data in primary
nephron progenitors (Guo, Kim et al. 2021). Loss of gene expression up β-catenin and Tcf/Lef
KO with corroborating β-catenin or Tcf/Lef binding at Cis regulatory modules grants such a gene
as a bona fide β-catenin/Tcf/Lef target.
74

Although only one third of β-catenin targets emerged in the Tcf/Lef QKO list, very similar GO
ontology terms emerged suggesting transcriptional regulation of similar gene sets. However,
differences may arise as β-catenin has been reported regulate expression of genes with Sox
family transcription factors in activating gene expression in response to a Wnt input (Mukherjee,
Luedeke et al. 2022). Moreover, Sox11 is a β-catenin target gene and is expressed in the
developing nephron (Supplementary Figure 7C; Supplemental Table 19) and could possibly
regulate other Wnt target genes in concert with β-catenin.
The presence of Uncx, Pax2 and Id2 within β-catenin/Tcf/Lef ChIP intersection reflects that
previously described β-catenin targets genes in self-renewal are indeed early inductive targets.
Uncx, Pax2 and Id2 are co-expressed with Six2 and Cited1 in mouse p0 Sc-RNA-Seq data
however, this may reflect the notion that self-renewing NPCs at p0 are in a more induced state
than their earlier counterparts (Chen, Brunskill et al. 2015).
Transcription factors Cux2, Bach2 and Emx2 are all bona fide β-catenin/Tcf/Lef targets and
Emx2 and Ovol1 have expression in the distal regions of the developing nephron (Figure 7) as
expressed in vivo validation of those gene genes using mouse p0 and week 14 human scRNA-
seq data supports cross species conservation. Ovol1 and Emx2 mutant mice have phenotypes
of embryonic cystic kidneys and urogenital defects respectively with Emx2 mutants failing to
upregulate Wnt4 in early nephrogenesis (Miyamoto, Yoshida et al. 1997, Teng, Nair et al. 2007).
Understanding the transcriptional outputs as a result of manipulating β-catenin has unexploited
therapeutic potential and is essential in improving kidney organoid cultures. Moreover, Wnt
signaling plays a key role directing stem cell/progenitor populations in many organ systems.
Deregulation of these interactions drives a number of cancers (Clevers and Nusse 2012). In
addition to obtaining important new insights into transcriptional programming of NPCs that can
facilitate regenerative approaches to kidney disease, our findings are likely to have broader
significance by gaining a deeper mechanistic understanding of Wnt signaling effectors (Clevers,
75

Loh et al. 2014), thus enhancing our knowledge of processes paramount in the maintenance
and repair of other organ systems, and to cancer.
Methods:
NPC isolation and culture
NPEM formulation and NPC isolation followed the published protocol (Brown et al., 2015).
Kidneys were harvested from E16.5 mice embryos and placed into PBS on ice. Each kidney
was expected to yield approximately 150,000 NPCs (100,000 NPCs for B6 background). After
dissection, kidneys were washed with 2mL HBSS (Thermo Fisher Scientific, 14175-095) twice
to remove blood and shaken on a Nutator platform for 2 min at 495rpm, then incubated in 2 mL
HBSS solution containing 2.5 mg/mL collagenase A (Roche, 11 088 793 001) and 10 mg/mL
pancreatin (Sigma, P1625) for 15 min at 37 ℃ while rocking on a Nutator platform at 495 rpm.
The enzymatic reaction was then terminated by the addition of 125ul of fetal bovine serum
(FBS). The resulting supernatant was pelleted then passed through a 40 μM filter, and then
washed with AutoMACS running buffer (Miltenyi, 130-091-221) before spinning down at 500 g
for 3 min. The cell pellet, predominantly cell of the cortical nephrogenic zone, was resuspended
in 76 μL of AutoMACS running buffer from 10 pairs of kidneys. NPC enrichment results from the
removal of other cell types in the cell suspension using a combination of PE-conjugated
antibodies as follows:
• Anti-CD105-PE (Miltenyi, 130-102-548), 9 μL
• Anti-CD140-PE (Miltenyi, 130-102-502), 9 μL
• Anti-Ter119-PE (Miltenyi, 130-102-893), 8 μL
• Anti-CD326-PE (Miltenyi, 130-118-075), 1.6 μL
76

The cells and antibodies were incubated at 4 ℃ for 30 min without agitation on ice, then washed
three times with 1 mL AutoMACS running buffer. To remove unwanted cells (non NPCs) , 20 μL
of anti-PE beads were added to the cell suspension for 30 min on ice. Cells were then washed
three times in 1 mL of running buffer, and finally cells resuspended in 1 mL of AutoMACS
running buffer and sent through the AutoMACS program as described in the published protocol
to remove non-NPC cell types enriching for NPCs (see Brown et al., 2015 for more information
on NPC isolation and NPEM).
NPCs were seeded at 300K cells/ well on a 24 well plate. 24-well NPC culture plates were
treated with Matrigel (Corning, 354277) 1:25 in APEL medium and incubated at room
temperature in cell culture hood for at least 1 hr. APEL was then aspirated off leaving behind
remaining Matrigel. For all culture experiments NPCs were seeded in low CHIR NPEM. Upon
seeding cells were shaken 3 times every ten minutes to evenly distribute cells throughout the
well.
In vitro mRNA synthesis
Cre mRNA was created using pCAG-Cre plasmid (Addgene Catalog number #13775), mCherry
mRNA was created using (Addgene pX330-U6-Chimeric_BB-CBh-hSpCas9 Cat# 42230) and
GFPmRNA was made using pCAG-GFP (Addgene Cat# 11150 ).
DNA template for RNA synthesis was created using the forward and reverse primers listed
below with GXL prime star PrimeSTAR® GXL DNA Polymerase (Takara Cat# R050A).
mMESSAGE mMACHINE™ T7 ULTRA Transcription Kit (ThermoFisher Cat# AM1345) was
used for in vitro mRNA synthesis from DNA template to create 5’CAP 3’Polyadenylated tailed
transcripts. Synthesized mRNA was Lithium chloride precipitation and ran on a 1.5% agarose
formaldehyde denaturing gel to validate proper size as well as tailing.
Primers for making DNA Templates:
77

Cre:
F: CGGTACCCGGGGATCTAATACGACTCACTATAGgccaccatggccaatttactgac
R: CGACTCTAGAGGATCtcacagatcttcttcagaaataagtttttgttcc
mCherry:
F:CGGTACCCGGGGATCTAATACGACTCACTATAGGATCGCCGCCACCATGGGTGAGCAAG
GGCGAGGAGGA
R: CAGGTCGACTCTAGAGGATCCTACTTGTACAGCTCGTCCATGCC
GFP:
F: TTTTGTAATACGACTCACTATAGGGCGG
R: GGCCGGCCGTTTAAACCTTATC
Cell transfection:
mRNAs as well as sgRNAs were transfected to NPCs using Lipofectamine™ MessengerMAX™
Transfection Reagent (Thermofisher, Cat # LMRNA015). Per 24 well, 500ng of total mRNA (per
transcript type) were added along with sgRNAs at 1uM concentration. NPCs were transfected
according to manual instructions in OPTI-MEM. NPCs were incubated with OPTI-MEM for 3
hours (See Figure 2A).
CRISPR mediated gene removal
sgRNA targeting GFP were purchased from ThermoFisher true guide gRNA sequence
(GGGCGAGGAGCTGTTCACCG) targeting exon 1 of GFP and designed using Invitrogen True
guide Tool. sgRNAs targeting Ctnnb1 were designed using indephi to maximize frameshift
potential (Shen, 2018 #410) and cross referenced with (Hodgkins, 2015 #411) to minimize off
target effects. We custom ordered Alt-R CRIPSR-Cas9 sgRNA,2nmol sgRNA’s from IDT. We
78

designed 4 guides, one targeting exon 2, 2 targeting exon3 and one targeting exon6 of B-
catenin. Their sequences are below:
Ctnnb1_sgRNA1-exon2 ATGAGCAGCGTCAAACTGCG
Ctnnb1_sgRNA3-exon3 AGCCAAGCGCTGGACATTAG
Ctnnb1_sgRNA5-exon3 AGCTACTTGCTCTTGCGTGA
Ctnnb1_sgRNA6-exon6 GAGATTATGCAGTGTCGTGA
Synthego
Tcf7l1 5' CUU AAA AAA AGC GCC AUC CU 3'
Tcf7l2 5' UUA GCG GCC AAG AGG CAA GA 3'
Tcf7 5' AGC UGG GGG ACG CCA UGU GG 3'
Lef1 5' CUC CCA GGA AAG CAU CCA GA 3'
Reverse transcription followed by qPCR (RT-qPCR)
RNA was isolated with RNeasy micro kit (Qiagen, #74004). RNA was reverse transcribed in
cDNA with SuperScript IV VILO Master Mix with ezDNase Enzyme (cat #: 11766050). qPCR
was performed with Luna Universal qPCR Master Mix Protocol (New England Biolab #M3003)
on a Vii7 Real-Time PCR 96 System. Primers used in RT-qPCR are listed as follows:
qPCR primers:
Six2:
F: CACCTCCACAAGAATGAAAGCG
R: CTCCGCCTCGATGTAGTGC
Cited1:
79

F: AACCTTGGAGTGAAGGATCGC
R: GTAGGAGAGCCTATTGGAGATGT
Eya1:
F: GACAGGCACCGTACAGCTAC
R: CGGAGGAGTTGGTGAGTGAATTA
Wnt4:
F: AGACGTGCGAGAAACTCAAAG
R: GGAACTGGTATTGGCACTCCT
Jag1:
F: CCTCGGGTCAGTTTGAGCTG
R: CCTTGAGGCACACTTTGAAGTA
Fgf8:
F: CCGAGGAGGGATCTAAGGAAC
R: CTTCCAAAAGTATCGGTCTCCAC
Lhx1:
F: CCCATCCTGGACCGTTTCC
R: CGCTTGGAGAGATGCCCTG
Lef1:
F: TGTTTATCCCATCACGGGTGG
R: CATGGAAGTGTCGCCTGACAG
80

FACS sorting mRNA isolation
Prior to FACS sorting NPCs were rinsed once with PBS, then incubated with trypsin for 5 min in
the incubator at 37 degrees Celsius. Reaction was quenched with 10% FBS in Automacs buffer.
NPCs were we pelleted and washed once with Automacs buffer before resuspending Automacs
with in DAPI (dead cell dye DAPI (4',6-Diamidino-2-Phenylindole, Dilactate, 422801, BioLegend
) and DRAQ5 ( DRAQ5™ Live cell dye, NBP2-81125-50ul, NOVUS). 60,000 to 150,000
mCherry+ NPCs were sorted on BD SORP FACS Aria IIu into RLT buffer with 1:100 beta-
mercaptoethanol prior to RNA isolation.
RNA-seq
Total RNA integrity was determined using Agilent Bioanalyzer or 4200 Tapestation. Library
preparation was performed with 10ng of total RNA with a Bioanalyzer RIN score greater than
8.0. ds-cDNA was prepared using the SMARTer Ultra Low RNA kit for Illumina Sequencing
(Takara-Clontech) per manufacturer's protocol. cDNA was fragmented using a Covaris E220
sonicator using peak incident power 18, duty factor 20%, cycles per burst 50 for 120 seconds.
cDNA was blunt ended, had an A base added to the 3' ends, and then had Illumina sequencing
adapters ligated to the ends. Ligated fragments were then amplified for 12-15 cycles using
primers incorporating unique dual index tags. Fragments were sequenced on an Illumina
NovaSeq-6000 using paired end reads extending 150 bases.
Basecalls and demultiplexing were performed with Illumina’s bcl2fastq2 software. RNA-seq
reads were then aligned to the combined mouse GRCm38 and human GRCh38 Ensembl
release 76 primary assemblies with STAR version 2.5.1a1. Gene counts were derived from the
number of uniquely aligned unambiguous reads by Subread:featureCount version 1.4.6-p52.
Isoform expression of known Ensembl transcripts were estimated with Salmon version 0.8.23.
Sequencing performance was assessed for the total number of aligned reads, total number of
81

uniquely aligned reads, and features detected. The ribosomal fraction, known junction
saturation, and read distribution over known gene models were quantified with RSeQC version
2.6.24.
Normalized counts tables were ran through DeSEQ2 (Love, 2014 #412) to create differential
gene expression tables with Log2Fc cut offs no less than 1 and p-adjusted values no greater
than 0.05. Significance of Cre and Cas9 intersected gene lists was calculated with
hypergeometric function in R. Differential expression tables were passed through Gene
Ontology package clusterProfiler (Yu, 2012 #413). Data was visualized using ggplot and
Complex heatmap functions in R (Gu, 2016 #414). Benjamini-Hochberg correction (False
Discovery Rate) applied as well as significance associated with intersections compared to all
genes expressed with gene normalized counts greater than or equal to 10 using hypergeometric
test.
Immunofluorescence staining
For immunofluorescence staining NPCs were cultured on coverslips (Thermanox plastic
coverslip Thermofisher Cat # 174969) , cell cultures were fixed with 4% PFA in PBS for 10 min,
then washed with PBS twice before blocking in 1.5% SEA block (Thermo Fisher Scientific,
107452659) in TBST (0.1% Tween-20 in TBS). After blocking room temperature for 1 hour,
coverslips were switched to primary antibody (diluted in blocking reagent) incubation in 4°
overnight. After washing three times with TBST, switched to secondary antibody (diluted in
blocking reagent) incubation 1 hour min in room temperature, shielded from light. This was
followed by three washes with TBST and a final rinse in PBS. Cover slips were then flipped onto
coverglass (VWR® Micro Cover Glasses, Rectangular no1.5 22x60, VWR Cat # 48393-221)
onto 15ul of mounting media (Fluoromount-G™ Mounting Medium (25mL) Themro Cat# 00-
4958-02). After drying overnight, coverglass with cover slips were taped with double sided tape
(Scotch® Permanent Double Sided Tape w/Refillable Dispenser, 1/2" x 6.94 yds., 1" Core, 1
82

Roll (136)) onto superfrost micro slides 25x75x1mm, cases (VWR Cat # 48311-703) Slides were
kept away from light at 4 degrees prior to confocal imaging.
Edu chasing
NPCs were chased with 10uM Edu diluted in DMSO for 1 hour prior to fixation with 4%PFA. To
visualize Edu incorporation we used Click-iT™ EdU Cell Proliferation Kit for Imaging, Alexa
Fluor™ 647 dye (Thermo Cat# C10340). NPCs were stained prior to Click-it reaction.
RNA-SCOPE
To perform in situ floursecent RNA analysis we used RNAscope Multiplex Fluorescent Reagent
Kit v2 (Advanced Cell Diagnostics, Inc.). We followed the commercially available RNA-Scope
protocol: the tissue on slides were treated with hydrogen peroxide and protease, then hybridized
with RNAscope probes for 2 hours at 40C using the HybEZ oven (Advanced Cell Diagnostics,
Inc.). Probes were then amplified and detected with tyramide signal amplification fluorescence.
The slides were incubated with 1 mg/ml Hoechst 33342 (Molecular Probes). The tissue was
imaged at 63X oil immersion lens using the Leica SP8 confocal microscope. The catalog
numbers of probes from Advanced Cell Diagnostics, Inc. used in this work are listed as follow:
Ovol1 (845271-C1), Emx2 (319001-C3).
Find antibodies used in the table below:
Primary
Antibody species company cat# concentration
Lef1 Rabbit Cell signaling 2230 1 to 100
B-catenin-Active non phosphorylated Rabbit Cell signaling 8814S 1 to 500
Six2 Rabbit Protein-Tech 11562-1-AP 1 to 500
83

Six2 Mouse Igg1 Novus H00010736- M01 1 to 1000
Jag1 Goat R&D AF599 1 to 250
Tcf7l1 Mouse Igg1 Santa Cruz sc-166411 1 to 250
Tcf7 Rabbit mAb #2203 Cell Signaling technology 1 to 100
Tcf7l2 Rabbit 2569 Cell Signaling Technology 1 to 100
mCherry Rabbit Abcam ab167453 1 to 1000
Td-Tomato Goat Sicgen Antibodies AB8181-200 1 to 4000
Secondary
Antibody species company cat# concentration
Donkey anti-goat 488 Molecular probes//Invitrogen A11055 1 to 500
Donkey anti-goat 555 Invitrogen A21432 1 to 500
Donkey anti-rabbit 488 Molecular probes A21206 1 to 500
Donkey anti-rabbit 594 Molecular probes A21207 1 to 500
Rat anti-mouse Igg1 647 Bio-Legend 406618 1 to 500
Image acquisition
Image acquisition was performed using Leica SP8-X confocal fluorescence imaging system
(Leica Microsystems, Germany) in 1024×1024 pixels with a 63X Leica oil immersion objective
(NA 1.6).
Image Quantification:
Edu quantification:
84

Cells were classified as mCherry+ or Edu+ based on manual cut-offs of their respective
fluorescent intensity histogram.
β-catenin KO quantification:
We quantified the membrane levels ß-catenin protein in the knockout (KO) experiments by
Imaris microscopy image analysis software (version 9.9, Oxford Instruments). Background noise
has been reduced by applying ‘Background Subtraction’ feature on the channel of examined
protein. We manually created five membrane masks by the ‘surfaces’ module per image,
measuring the fluorescent intensity of the shared membrane area between two adjacent
transfected (KO) cells of the protein of interest, and calculated an average of these values. We
chose to quantify membrane intensity only between two transfected cells to avoid the potential
overestimation of protein levels: the signal of a non-transfected cell could overlap with the
membrane of a KO cell. We also applied the same quantification method for adjacent non-
transfected cells (the average of five membrane intensities between non-transfected cells). We
calculated a ratio between the average fluorescent membrane intensity between two transfected
cells and the average membrane intensity of non-transfected cells. This ratio has been
multiplied by 100 and reported as the percentage KO of the protein. The latter normalization
step was required to correct the differences in immunostaining and image acquisition across
samples.

Jagged 1 loss from β-catenin KO quantification:
Images were masked and quantified with “surface”, “cell”, “spots” modules of Imaris software
9.7 (Oxford Instruments, United Kingdom). Fluorescent intensity histograms were created for
every masks in the field of view for each fluorescent channel. Cells were classified as mCherry+
or Edu+ based on manual cut-offs of their respective fluorescent intensity histogram.Six2 and
Tcf7l1 intensity was determined based on the nuclear intensities of cell module. Cells were
85

manually classified as Jagged-1+ if the nuclear masks had granular Jagged-1 signal in their
proximity and/or the signal was observed in membrane distribution. Cell size was determined by
“surface” module and nucleus size by “cell” module.”Spots” module was used to determine the
number of mCherry+ cells outside the aggregates. Visualization of quantification used dot plots
with columns and pie charts plotted by Graphpad Prizm 8.0 (GraphPad Software, USA). Cells
were manually classified as Jagged-1+ if the nuclear masks had granular Jagged-1 signal in
their proximity and/or the signal was observed in membrane distribution.
Jagged1 staining and inside outside quantification time course β-catenin KO quantification:
”Spots” module was used to determine the number of mCherry+ cells outside the aggregates.
Cells not in contact with Jag1+ aggregates were categorized as “outside the aggregate” cells.
Cell size changes from β-catenin KO quantification: Cell size was determined by surface module
and nucleus size by cell module.
Six2 protein/ Tcf7l1 protein quantification in β-catenin KO quantification: Six2 and Tcf7l1
intensity was determined based on the nuclear intensities of cell module.
Tcf/Lef KO and loss of Jagged1 protein with QKO quantification: We quantified the individual
and quadruple knockout (KO) experiments using Imaris microscopy image analysis software
(version 9.9, Oxford Instruments). The number of cells were automatically counted by the
software using the DAPI nuclear marker after setting the appropriate nuclear radius. The cells
were then classified as mCherry+ based on manual cut-offs of their respective fluorescent
intensity histogram. These mCherry+ cells were further classified as Lef1+ based on manual
cut-offs of their respective fluorescent intensity histogram. We calculated the decrease of
protein levels of Lef1 by finding the ratio between the Lef1+ mCherry+ cells and total mCherry+
cells. This ratio has been multiplied by 100 and reported as the percentage KO of the protein.
86

This quantification process was also applied to determine the decrease of protein levels of Tcf7,
Tcf7l1, Tcf7l2, and Jag1.
Statistics
Initially, the normal distribution of datasets was determined by D'Agostino-Pearson test. In case
of normal distribution, the p values were calculated by Student’s unpaired t-test. Mann-Whitney
test was applied for datasets with non-normal distribution.
Integration of scRNA-seq and ChIP seq data with bulk RNA seq Data
Previously published B-catenin and TCF/LEF transcription factor ChIP-seq data (Guo, Kim et al.
2021) was downloaded from publicly available data depository (GEO accession: GSE131117).
Raw sequencing reads of input, Ctnnb, Lef1, Tcf7 ChiP-seq from low/high-concentration
(1.25uM, 5uM) CHIR-treated NPCs were aligned by Bowtie2 (Langmead and Salzberg 2012) on
mm39 reference genome. Alignment files were sorted by samtools (Li et al., 2009) and filtered
to remove duplicate reads by picard ‘markduplicates’ tool (http://broadinstitute.github.io/picard/).
Peak calling was performed by MACS2 with a q-value cutoff threshold of 10-8, to ensure strong
transcription factor bindings in high-concentration CHIR treatment compared to low
concentration counterparts. Peak annotation was performed by annotatePeaks.pl from HOMER
suite (Heinz, Benner et al. 2010) with default parameter. To incorporate any B-catenin/TCF/LEF
downstream genes in high CHIR condition, the union set of annotated genes were used in the
following intersection analysis. Down-regulated DEGs in both Cas9- and Cre-mediated knockout
bulk RNA-seq data were intersected with ChIP-seq peak associated genes. Lastly, 161 genes in
the intersection list were visualized with Seurat (Stuart, Butler et al. 2019) FeaturePlot function
in mouse post-neonatal day0 (P0) nephrogenic-lineage cells from unpublished kidney single-cell
data (McMahon lab). Total number of expressed genes in nephrogenic cells were calculated
based on the threshold of more than 0.25% cells with normalized expression value of Gene X.
87

References:

Aberle, H., S. Butz, J. Stappert, H. Weissig, R. Kemler and H. Hoschuetzky (1994). "Assembly
of the cadherin-catenin complex in vitro with recombinant proteins." J Cell Sci 107 ( Pt 12):
3655-3663.

Arce, L., N. N. Yokoyama and M. L. Waterman (2006). "Diversity of LEF/TCF action in
development and disease." Oncogene 25(57): 7492-7504.

Bagherie-Lachidan, M., A. Reginensi, Q. Pan, H. P. Zaveri, D. A. Scott, B. J. Blencowe, F.
Helmbacher and H. McNeill (2015). "Stromal Fat4 acts non-autonomously with Dchs1/2 to
restrict the nephron progenitor pool." Development 142(15): 2564-2573.

Bain, J., L. Plater, M. Elliott, N. Shpiro, C. J. Hastie, H. McLauchlan, I. Klevernic, J. S. Arthur, D.
R. Alessi and P. Cohen (2007). "The selectivity of protein kinase inhibitors: a further update."
Biochem J 408(3): 297-315.

Blank, U., A. Brown, D. C. Adams, M. J. Karolak and L. Oxburgh (2009). "BMP7 promotes
proliferation of nephron progenitor cells via a JNK-dependent mechanism." Development
136(21): 3557-3566.

Brault, V., R. Moore, S. Kutsch, M. Ishibashi, D. H. Rowitch, A. P. McMahon, L. Sommer, O.
Boussadia and R. Kemler (2001). "Inactivation of the beta-catenin gene by Wnt1-Cre-mediated
deletion results in dramatic brain malformation and failure of craniofacial development."
Development 128(8): 1253-1264.

Brembeck, F. H., M. Rosario and W. Birchmeier (2006). "Balancing cell adhesion and Wnt
signaling, the key role of beta-catenin." Curr Opin Genet Dev 16(1): 51-59.

Brown, A. C., S. D. Muthukrishnan, J. A. Guay, D. C. Adams, D. A. Schafer, J. L. Fetting and L.
Oxburgh (2013). "Role for compartmentalization in nephron progenitor differentiation." Proc Natl
Acad Sci U S A 110(12): 4640-4645.

Brown, A. C., S. D. Muthukrishnan and L. Oxburgh (2015). "A synthetic niche for nephron
progenitor cells." Dev Cell 34(2): 229-241.

Butz, S. and R. Kemler (1994). "Distinct cadherin-catenin complexes in Ca(2+)-dependent cell-
cell adhesion." FEBS Lett 355(2): 195-200.

Cadigan, K. M. and M. L. Waterman (2012). "TCF/LEFs and Wnt signaling in the nucleus." Cold
Spring Harb Perspect Biol 4(11).

Cantù, C., P. Pagella, T. D. Shajiei, D. Zimmerli, T. Valenta, G. Hausmann, K. Basler and T. A.
Mitsiadis (2017). "A cytoplasmic role of Wnt/β-catenin transcriptional cofactors Bcl9, Bcl9l, and
Pygopus in tooth enamel formation." Sci Signal 10(465).

Carroll, T. J., J. S. Park, S. Hayashi, A. Majumdar and A. P. McMahon (2005). "Wnt9b plays a
central role in the regulation of mesenchymal to epithelial transitions underlying organogenesis
of the mammalian urogenital system." Dev Cell 9(2): 283-292.
88

Cebrian, C., N. Asai, V. D'Agati and F. Costantini (2014). "The number of fetal nephron
progenitor cells limits ureteric branching and adult nephron endowment." Cell Rep 7(1): 127-
137.

Chen, S., E. W. Brunskill, S. S. Potter, P. J. Dexheimer, N. Salomonis, B. J. Aronow, C. I. Hong,
T. Zhang and R. Kopan (2015). "Intrinsic Age-Dependent Changes and Cell-Cell Contacts
Regulate Nephron Progenitor Lifespan." Dev Cell 35(1): 49-62.

Chi, X., A. K. Hadjantonakis, Z. Wu, D. Hyink and F. Costantini (2009). "A transgenic mouse
that reveals cell shape and arrangement during ureteric bud branching." Genesis 47(2): 61-66.

Cho, E. A., L. T. Patterson, W. T. Brookhiser, S. Mah, C. Kintner and G. R. Dressler (1998).
"Differential expression and function of cadherin-6 during renal epithelium development."
Development 125(5): 803-812.

Chung, E., P. Deacon, S. Marable, J. Shin and J. S. Park (2016). "Notch signaling promotes
nephrogenesis by downregulating Six2." Development 143(21): 3907-3913.

Chung, E., P. Deacon and J. S. Park (2017). "Notch is required for the formation of all nephron
segments and primes nephron progenitors for differentiation." Development 144(24): 4530-
4539.

Clevers, H., K. M. Loh and R. Nusse (2014). "Stem cell signaling. An integral program for tissue
renewal and regeneration: Wnt signaling and stem cell control." Science 346(6205): 1248012.

Clevers, H. and R. Nusse (2012). "Wnt/beta-catenin signaling and disease." Cell 149(6): 1192-
1205.

Combes, A. N., J. G. Lefevre, S. Wilson, N. A. Hamilton and M. H. Little (2016). "Cap
mesenchyme cell swarming during kidney development is influenced by attraction, repulsion,
and adhesion to the ureteric tip." Dev Biol 418(2): 297-306.

Combes, A. N., B. Phipson, K. T. Lawlor, A. Dorison, R. Patrick, L. Zappia, R. P. Harvey, A.
Oshlack and M. H. Little (2019). "Correction: Single cell analysis of the developing mouse
kidney provides deeper insight into marker gene expression and ligand-receptor crosstalk
(doi:10.1242/dev.178673)." Development 146(13).

Costantini, F. (2012). "Genetic controls and cellular behaviors in branching morphogenesis of
the renal collecting system." Wiley Interdiscip Rev Dev Biol 1(5): 693-713.

Costantini, F. and R. Shakya (2006). "GDNF/Ret signaling and the development of the kidney."
Bioessays 28(2): 117-127.

Cui, S., L. Li, R. T. Yu, M. Downes, R. M. Evans, J.-A. Hulin, H. P. Makarenkova and R. Meech
(2019). "β-Catenin is essential for differentiation of primary myoblasts via cooperation with

MyoD and α-catenin." Development (Cambridge, England) 146(6): dev167080.
Dahl, U., A. Sjödin, L. Larue, G. L. Radice, S. Cajander, M. Takeichi, R. Kemler and H. Semb
(2002). "Genetic dissection of cadherin function during nephrogenesis." Mol Cell Biol 22(5):
1474-1487.
89

Das, A., S. Tanigawa, C. M. Karner, M. Xin, L. Lum, C. Chen, E. N. Olson, A. O. Perantoni and
T. J. Carroll (2013). "Stromal-epithelial crosstalk regulates kidney progenitor cell differentiation."
Nat Cell Biol 15(9): 1035-1044.

Denic, A., R. J. Glassock and A. D. Rule (2016). "Structural and Functional Changes With the
Aging Kidney." Advances in chronic kidney disease 23(1): 19-28.

Dickinson, K. K., L. C. Hammond, C. M. Karner, N. D. Hastie, T. J. Carroll and P. Goodyer
(2019). "Molecular determinants of WNT9b responsiveness in nephron progenitor cells." PLoS
One 14(4): e0215139.

Ding, Y., S. Su, W. Tang, X. Zhang, S. Chen, G. Zhu, J. Liang, W. Wei, Y. Guo, L. Liu, Y. G.
Chen and W. Wu (2014). "Enrichment of the beta-catenin-TCF complex at the S and G2 phases
ensures cell survival and cell cycle progression." J Cell Sci 127(Pt 22): 4833-4845.

Duttke, S. H., M. W. Chang, S. Heinz and C. Benner (2019). "Identification and dynamic
quantification of regulatory elements using total RNA." Genome Res 29(11): 1836-1846.

Fetting, J. L., J. A. Guay, M. J. Karolak, R. V. Iozzo, D. C. Adams, D. E. Maridas, A. C. Brown
and L. Oxburgh (2014). "FOXD1 promotes nephron progenitor differentiation by repressing
decorin in the embryonic kidney." Development 141(1): 17-27.

Fukata, M. and K. Kaibuchi (2001). "Rho-family GTPases in cadherin-mediated cell-cell
adhesion." Nat Rev Mol Cell Biol 2(12): 887-897.

Gehart, H. and H. Clevers (2019). "Tales from the crypt: new insights into intestinal stem cells."
Nat Rev Gastroenterol Hepatol 16(1): 19-34.

Glykofrydis, F., E. Cachat, I. Berzanskyte, E. Dzierzak and J. A. Davies (2021). "Bioengineering
Self-Organizing Signaling Centers to Control Embryoid Body Pattern Elaboration." ACS
Synthetic Biology 10(6): 1465-1480.

Goel, A. J., M.-K. Rieder, H.-H. Arnold, G. L. Radice and R. S. Krauss (2017). "Niche Cadherins
Control the Quiescence-to-Activation Transition in Muscle Stem Cells." Cell reports 21(8): 2236-
2250.

Goto, S., H. Yaoita E Fau - Matsunami, D. Matsunami H Fau - Kondo, T. Kondo D Fau -
Yamamoto, K. Yamamoto T Fau - Kawasaki, M. Kawasaki K Fau - Arakawa, I. Arakawa M Fau -
Kihara and I. Kihara "Involvement of R-cadherin in the early stage of glomerulogenesis." (1046-
6673 (Print)).

Gottardi, C. J. and B. M. Gumbiner (2004). "Distinct molecular forms of beta-catenin are
targeted to adhesive or transcriptional complexes." The Journal of cell biology 167(2): 339-349.

Graham, T. A., C. Weaver, F. Mao, D. Kimelman and W. Xu (2000). "Crystal Structure of a
β-Catenin/Tcf Complex." Cell 103(6): 885-896.

Graves, C. L., S. W. Harden, M. LaPato, M. Nelson, B. Amador, H. Sorenson, C. J. Frazier and
S. M. Wallet (2014). "A method for high purity intestinal epithelial cell culture from adult human
and murine tissues for the investigation of innate immune function." Journal of immunological
methods 414: 20-31.
90

Grieshammer, U., C. Cebrian, R. Ilagan, E. Meyers, D. Herzlinger and G. R. Martin (2005).
"FGF8 is required for cell survival at distinct stages of nephrogenesis and for regulation of gene
expression in nascent nephrons." Development 132(17): 3847-3857.

Grobstein, C. (1953). "Inductive epitheliomesenchymal interaction in cultured organ rudiments of
the mouse." Science 118(3054): 52-55.

Gumbiner, B. M. (1996). "Cell adhesion: the molecular basis of tissue architecture and
morphogenesis." Cell 84(3): 345-357.

Guo, Q., A. Kim, B. Li, A. Ransick, H. Bugacov, X. Chen, N. Lindström, A. Brown, L. Oxburgh,
B. Ren and A. P. McMahon (2021). "A β-catenin-driven switch in TCF/LEF transcription factor
binding to DNA target sites promotes commitment of mammalian nephron progenitor cells."
eLife 10: e64444.

Hao, Y., S. Hao, E. Andersen-Nissen, W. M. Mauck, 3rd, S. Zheng, A. Butler, M. J. Lee, A. J.
Wilk, C. Darby, M. Zager, P. Hoffman, M. Stoeckius, E. Papalexi, E. P. Mimitou, J. Jain, A.
Srivastava, T. Stuart, L. M. Fleming, B. Yeung, A. J. Rogers, J. M. McElrath, C. A. Blish, R.
Gottardo, P. Smibert and R. Satija "Integrated analysis of multimodal single-cell data." (1097-
4172 (Electronic)).

Heinz, S., C. Benner, N. Spann, E. Bertolino, Y. C. Lin, P. Laslo, J. X. Cheng, C. Murre, H.
Singh and C. K. Glass (2010). "Simple combinations of lineage-determining transcription factors
prime cis-regulatory elements required for macrophage and B cell identities." Molecular cell
38(4): 576-589.

Heo, I. and H. Clevers (2015). "Expanding intestinal stem cells in culture." Cell research 25(9):
995-996.

Hilliard, S., R. Song, H. Liu, C. H. Chen, Y. Li, M. Baddoo, E. Flemington, A. Wanek, J. Kolls, Z.
Saifudeen and S. S. El-Dahr (2019). "Defining the dynamic chromatin landscape of mouse
nephron progenitors." Biol Open 8(5).

Hinck, L., I. S. Näthke, J. Papkoff and W. J. Nelson (1994). "Dynamics of cadherin/catenin
complex formation: novel protein interactions and pathways of complex assembly." J Cell Biol
125(6): 1327-1340.

Janda, C. Y., L. T. Dang, C. You, J. Chang, W. de Lau, Z. A. Zhong, K. S. Yan, O. Marecic, D.
Siepe, X. Li, J. D. Moody, B. O. Williams, H. Clevers, J. Piehler, D. Baker, C. J. Kuo and K. C.
Garcia (2017). "Surrogate Wnt agonists that phenocopy canonical Wnt and beta-catenin
signalling." Nature 545(7653): 234-237.

Kageyama, T., A. Shimizu, R. Anakama, R. Nakajima, K. Suzuki, Y. Okubo and J. Fukuda
(2022). "Reprogramming of three-dimensional microenvironments for in vitro hair follicle
induction." Science Advances 8(42): eadd4603.

Karner, C. M., R. Chirumamilla, S. Aoki, P. Igarashi, J. B. Wallingford and T. J. Carroll (2009).
"Wnt9b signaling regulates planar cell polarity and kidney tubule morphogenesis." Nat Genet
41(7): 793-799.
91

Karner, C. M., A. Das, Z. Ma, M. Self, C. Chen, L. Lum, G. Oliver and T. J. Carroll (2011).
"Canonical Wnt9b signaling balances progenitor cell expansion and differentiation during kidney
development." Development 138(7): 1247-1257.

Kim, H., J. Wu, S. Ye, C. I. Tai, X. Zhou, H. Yan, P. Li, M. Pera and Q. L. Ying (2013).
"Modulation of beta-catenin function maintains mouse epiblast stem cell and human embryonic
stem cell self-renewal." Nat Commun 4: 2403.

Kim, S. A., C. Y. Tai, L. P. Mok, E. A. Mosser and E. M. Schuman (2011). "Calcium-dependent
dynamics of cadherin interactions at cell-cell junctions." Proc Natl Acad Sci U S A 108(24):
9857-9862.

Kobayashi, A., J. W. Mugford, A. M. Krautzberger, N. Naiman, J. Liao and A. P. McMahon
(2014). "Identification of a multipotent self-renewing stromal progenitor population during
mammalian kidney organogenesis." Stem Cell Reports 3(4): 650-662.

Kobayashi, A., M. T. Valerius, J. W. Mugford, T. J. Carroll, M. Self, G. Oliver and A. P.
McMahon (2008). "Six2 defines and regulates a multipotent self-renewing nephron progenitor
population throughout mammalian kidney development." Cell Stem Cell 3(2): 169-181.

Kohn, A. D. and R. T. Moon (2005). "Wnt and calcium signaling: beta-catenin-independent
pathways." Cell Calcium 38(3-4): 439-446.

Kopan, R., S. Chen and M. Little (2014). "Nephron progenitor cells: shifting the balance of self-
renewal and differentiation." Curr Top Dev Biol 107: 293-331.

Langmead, B. and S. L. Salzberg (2012). "Fast gapped-read alignment with Bowtie 2." Nature
Methods 9(4): 357-359.

Lawlor, K. T., L. Zappia, J. Lefevre, J. S. Park, N. A. Hamilton, A. Oshlack, M. H. Little and A. N.
Combes (2019). "Nephron progenitor commitment is a stochastic process influenced by cell
migration." Elife 8.

Leckband, D. E. and J. de Rooij (2014). "Cadherin adhesion and mechanotransduction." Annu
Rev Cell Dev Biol 30: 291-315.

Lien, W. H. and E. Fuchs (2014). "Wnt some lose some: transcriptional governance of stem
cells by Wnt/beta-catenin signaling." Genes Dev 28(14): 1517-1532.

Lien, W. H., L. Polak, M. Lin, K. Lay, D. Zheng and E. Fuchs (2014). "In vivo transcriptional
governance of hair follicle stem cells by canonical Wnt regulators." Nat Cell Biol 16(2): 179-190.

Lindstrom, N. O., G. De Sena Brandine, T. Tran, A. Ransick, G. Suh, J. Guo, A. D. Kim, R. K.
Parvez, S. W. Ruffins, E. A. Rutledge, M. E. Thornton, B. Grubbs, J. A. McMahon, A. D. Smith
and A. P. McMahon (2018). "Progressive Recruitment of Mesenchymal Progenitors Reveals a
Time-Dependent Process of Cell Fate Acquisition in Mouse and Human Nephrogenesis." Dev
Cell 45(5): 651-660 e654.

Lindstrom, N. O., M. L. Lawrence, S. F. Burn, J. A. Johansson, E. R. Bakker, R. A. Ridgway, C.
H. Chang, M. J. Karolak, L. Oxburgh, D. J. Headon, O. J. Sansom, R. Smits, J. A. Davies and P.
92

Hohenstein (2015). "Integrated beta-catenin, BMP, PTEN, and Notch signalling patterns the
nephron." Elife 3: e04000.

Lindstrom, N. O., J. A. McMahon, J. Guo, T. Tran, Q. Guo, E. Rutledge, R. K. Parvez, G.
Saribekyan, R. E. Schuler, C. Liao, A. D. Kim, A. Abdelhalim, S. W. Ruffins, M. E. Thornton, L.
Baskin, B. Grubbs, C. Kesselman and A. P. McMahon (2018). "Conserved and Divergent
Features of Human and Mouse Kidney Organogenesis." J Am Soc Nephrol 29(3): 785-805.

Lindstrom, N. O., R. Sealfon, X. Chen, R. K. Parvez, A. Ransick, G. De Sena Brandine, J. Guo,
B. Hill, T. Tran, A. D. Kim, J. Zhou, A. Tadych, A. Watters, A. Wong, E. Lovero, B. H. Grubbs,
M. E. Thornton, J. A. McMahon, A. D. Smith, S. W. Ruffins, C. Armit, O. G. Troyanskaya and A.
P. McMahon (2021). "Spatial transcriptional mapping of the human nephrogenic program." Dev
Cell 56(16): 2381-2398 e2386.

Little, M. H., L. J. Hale, S. E. Howden and S. V. Kumar (2019). "Generating Kidney from Stem
Cells." Annu Rev Physiol 81: 335-357.

Little, M. H., S. V. Kumar and T. Forbes (2019). "Recapitulating kidney development: Progress
and challenges." Semin Cell Dev Biol 91: 153-168.

Liu, H., S. Hilliard, E. Kelly, C. H. Chen, Z. Saifudeen and S. S. El-Dahr (2020). "The polycomb
proteins EZH1 and EZH2 co-regulate chromatin accessibility and nephron progenitor cell
lifespan in mice." J Biol Chem 295(33): 11542-11558.

Louro, R., H. I. Nakaya, A. C. M. Paquola, E. A. L. Martins, A. M. d. Silva, S. Verjovski-Almeida
and E. M. Reis (2004). "RASL11A, member of a novel small monomeric GTPase gene family, is
down-regulated in prostate tumors." Biochemical and Biophysical Research Communications
316(3): 618-627.

Madisen, L., T. A. Zwingman, S. M. Sunkin, S. W. Oh, H. A. Zariwala, H. Gu, L. L. Ng, R. D.
Palmiter, M. J. Hawrylycz, A. R. Jones, E. S. Lein and H. Zeng (2010). "A robust and high-
throughput Cre reporting and characterization system for the whole mouse brain." Nat Neurosci
13(1): 133-140.

Mah, S. P., H. Saueressig, M. Goulding, C. Kintner and G. R. Dressler (2000). "Kidney
development in cadherin-6 mutants: delayed mesenchyme-to-epithelial conversion and loss of
nephrons." Dev Biol 223(1): 38-53.

Marable, S. S., E. Chung and J.-S. Park (2020). "Hnf4a is required for the
development of Cdh6-expressing progenitors into proximal tubules in the mouse kidney."
bioRxiv: 2020.2002.2016.951731.

Martz, C. A., K. A. Ottina, K. R. Singleton, J. S. Jasper, S. E. Wardell, A. Peraza-Penton, G. R.
Anderson, P. S. Winter, T. Wang, H. M. Alley, L. N. Kwong, Z. A. Cooper, M. Tetzlaff, P. L.
Chen, J. C. Rathmell, K. T. Flaherty, J. A. Wargo, D. P. McDonnell, D. M. Sabatini and K. C.
Wood "Systematic identification of signaling pathways with potential to confer anticancer drug
resistance." (1937-9145 (Electronic)).

Mazzotta, S., C. Neves, R. J. Bonner, A. S. Bernardo, K. Docherty and S. Hoppler (2016).
"Distinctive Roles of Canonical and Noncanonical Wnt Signaling in Human Embryonic
Cardiomyocyte Development." Stem Cell Reports 7(4): 764-776.
93

McCrea, P. D., B. Turck Cw Fau - Gumbiner and B. Gumbiner "A homolog of the armadillo
protein in Drosophila (plakoglobin) associated with E-cadherin." (0036-8075 (Print)).
McMahon, A. P. (2016). "Development of the Mammalian Kidney." Curr Top Dev Biol 117: 31-
64.

Megason, S. G. and A. P. McMahon "A mitogen gradient of dorsal midline Wnts organizes
growth in the CNS." (0950-1991 (Print)).

Merrill, B. J., U. Gat, R. DasGupta and E. Fuchs (2001). "Tcf3 and Lef1 regulate lineage
differentiation of multipotent stem cells in skin." Genes Dev 15(13): 1688-1705.

Miyamoto, N., M. Yoshida, S. Kuratani, I. Matsuo and S. Aizawa (1997). "Defects of urogenital
development in mice lacking Emx2." Development 124(9): 1653-1664.

Mori, K., H. Nakamura, H. Kurooka, H. Miyachi, K. Tamada, M. Sugai, T. Takumi and Y. Yokota
(2018). "Id2 Determines Intestinal Identity through Repression of the Foregut Transcription
Factor Irx5." Mol Cell Biol 38(9).

Morizane, R. and J. V. Bonventre (2017). "Kidney Organoids: A Translational Journey." Trends
Mol Med 23(3): 246-263.

Mugford, J. W., J. Yu, A. Kobayashi and A. P. McMahon (2009). "High-resolution gene
expression analysis of the developing mouse kidney defines novel cellular compartments within
the nephron progenitor population." Dev Biol 333(2): 312-323.

Mukherjee, S., D. M. Luedeke, L. McCoy, M. Iwafuchi and A. M. Zorn (2022). "SOX transcription
factors direct TCF-independent WNT/beta-catenin responsive transcription to govern cell fate in
human pluripotent stem cells." Cell Rep 40(8): 111247.

Muthukrishnan, S. D., X. Yang, R. Friesel and L. Oxburgh (2015). "Concurrent BMP7 and FGF9
signalling governs AP-1 function to promote self-renewal of nephron progenitor cells." Nat
Commun 6: 10027.

Muzumdar, M. D., B. Tasic, K. Miyamichi, L. Li and L. Luo (2007). "A global double-fluorescent
Cre reporter mouse." Genesis 45(9): 593-605.

Nagafuchi, A. and M. Takeichi (1988). "Cell binding function of E-cadherin is regulated by the
cytoplasmic domain." Embo j 7(12): 3679-3684.

Naiman, N., K. Fujioka, M. Fujino, M. T. Valerius, S. S. Potter, A. P. McMahon and A.
Kobayashi (2017). "Repression of Interstitial Identity in Nephron Progenitor Cells by Pax2
Establishes the Nephron-Interstitium Boundary during Kidney Development." Dev Cell 41(4):
349-365 e343.

Nelson, W. J. and R. Nusse (2004). "Convergence of Wnt, beta-catenin, and cadherin
pathways." Science 303(5663): 1483-1487.

Niessen, C. M., D. Leckband and A. S. Yap (2011). "Tissue organization by cadherin adhesion
molecules: dynamic molecular and cellular mechanisms of morphogenetic regulation." Physiol
Rev 91(2): 691-731.
94

Nishinakamura, R. (2019). "Human kidney organoids: progress and remaining challenges."
Nature Reviews Nephrology 15(10): 613-624.

Nusse, R. and H. Varmus (2012). "Three decades of Wnts: a personal perspective on how a
scientific field developed." EMBO J 31(12): 2670-2684.

O'Brien, L. L. (2019). "Nephron progenitor cell commitment: Striking the right balance." Semin
Cell Dev Biol 91: 94-103.

O'Brien, L. L., A. N. Combes, K. M. Short, N. O. Lindstrom, P. H. Whitney, L. A. Cullen-McEwen,
A. Ju, A. Abdelhalim, O. Michos, J. F. Bertram, I. M. Smyth, M. H. Little and A. P. McMahon
(2018). "Wnt11 directs nephron progenitor polarity and motile behavior ultimately determining
nephron endowment." Elife 7.

O'Brien, L. L., Q. Guo, E. Bahrami-Samani, J. S. Park, S. M. Hasso, Y. J. Lee, A. Fang, A. D.
Kim, J. Guo, T. M. Hong, K. A. Peterson, S. Lozanoff, R. Raviram, B. Ren, B. Fogelgren, A. D.
Smith, A. Valouev and A. P. McMahon (2018). "Transcriptional regulatory control of mammalian
nephron progenitors revealed by multi-factor cistromic analysis and genetic studies." PLoS
Genet 14(1): e1007181.

Ogobuiro, I. and F. Tuma (2022). Physiology, Renal. StatPearls. Treasure Island (FL),
StatPearls PublishingCopyright © 2022, StatPearls Publishing LLC.
Ohto, H., K. Kamada S Fau - Tago, S. I. Tago K Fau - Tominaga, H. Tominaga Si Fau - Ozaki,
S. Ozaki H Fau - Sato, K. Sato S Fau - Kawakami and K. Kawakami "Cooperation of six and
eya in activation of their target genes through nuclear translocation of Eya." (0270-7306 (Print)).

Orsulic, S. and M. Peifer "An in vivo structure-function study of armadillo, the beta-catenin
homologue, reveals both separate and overlapping regions of the protein required for cell
adhesion and for wingless signaling." (0021-9525 (Print)).

Oxburgh, L., A. T. Dudley, R. E. Godin, C. H. Koonce, A. Islam, D. C. Anderson, E. K. Bikoff and
E. J. Robertson (2005). "BMP4 substitutes for loss of BMP7 during kidney development." Dev
Biol 286(2): 637-646.

Ozawa, M., H. Baribault and R. Kemler (1989). "The cytoplasmic domain of the cell adhesion
molecule uvomorulin associates with three independent proteins structurally related in different
species." Embo j 8(6): 1711-1717.

Park, J. S., W. Ma, L. L. O'Brien, E. Chung, J. J. Guo, J. G. Cheng, M. T. Valerius, J. A.
McMahon, W. H. Wong and A. P. McMahon (2012). "Six2 and Wnt regulate self-renewal and
commitment of nephron progenitors through shared gene regulatory networks." Dev Cell 23(3):
637-651.

Park, J. S., M. T. Valerius and A. P. McMahon (2007). "Wnt/beta-catenin signaling regulates
nephron induction during mouse kidney development." Development 134(13): 2533-2539.

Pei, D., X. Shu, A. Gassama-Diagne and J. P. Thiery (2019). "Mesenchymal-epithelial transition
in development and reprogramming." Nat Cell Biol 21(1): 44-53.

95

Peifer, M. and E. Wieschaus "The segment polarity gene armadillo encodes a functionally
modular protein that is the Drosophila homolog of human plakoglobin." (0092-8674 (Print)).

Pepicelli, C. V., A. Kispert, D. H. Rowitch and A. P. McMahon (1997). "GDNF Induces
Branching and Increased Cell Proliferation in the Ureter of the Mouse." Developmental Biology
192(1): 193-198.

Perantoni, A. O., O. Timofeeva, F. Naillat, C. Richman, S. Pajni-Underwood, C. Wilson, S.
Vainio, L. F. Dove and M. Lewandoski (2005). "Inactivation of FGF8 in early mesoderm reveals
an essential role in kidney development." Development 132(17): 3859-3871.

Platt, R. J., S. Chen, Y. Zhou, M. J. Yim, L. Swiech, H. R. Kempton, J. E. Dahlman, O. Parnas,
T. M. Eisenhaure, M. Jovanovic, D. B. Graham, S. Jhunjhunwala, M. Heidenreich, R. J. Xavier,
R. Langer, D. G. Anderson, N. Hacohen, A. Regev, G. Feng, P. A. Sharp and F. Zhang (2014).
"CRISPR-Cas9 knockin mice for genome editing and cancer modeling." Cell 159(2): 440-455.

Pyram, R., A. Kansara, M. A. Banerji and L. Loney-Hutchinson (2012). "Chronic kidney disease
and diabetes." Maturitas 71(2): 94-103.

Ramalingam, H., A. R. Fessler, A. Das, M. T. Valerius, J. Basta, L. Robbins, A. C. Brown, L.
Oxburgh, A. P. McMahon, M. Rauchman and T. J. Carroll (2018). "Disparate levels of beta-
catenin activity determine nephron progenitor cell fate." Dev Biol 440(1): 13-21.

Ransick, A., N. O. Lindstrom, J. Liu, Q. Zhu, J. J. Guo, G. F. Alvarado, A. D. Kim, H. G. Black, J.
Kim and A. P. McMahon (2019). "Single-Cell Profiling Reveals Sex, Lineage, and Regional
Diversity in the Mouse Kidney." Dev Cell 51(3): 399-413 e397.
Reynolds, A. B., J. Daniel, P. D. McCrea, M. J. Wheelock, J. Wu and Z. Zhang (1994).
"Identification of a new catenin: the tyrosine kinase substrate p120cas associates with E-
cadherin complexes." Mol Cell Biol 14(12): 8333-8342.

Rieger, A., E. Kemter, S. Kumar, B. Popper, B. Aigner, E. Wolf, R. Wanke and A. Blutke (2016).
"Missense Mutation of POU Domain Class 3 Transcription Factor 3 in Pou3f3L423P Mice
Causes Reduced Nephron Number and Impaired Development of the Thick Ascending Limb of
the Loop of Henle." PloS one 11(7): e0158977-e0158977.

Rumballe, B. A., K. M. Georgas, A. N. Combes, A. L. Ju, T. Gilbert and M. H. Little (2011).
"Nephron formation adopts a novel spatial topology at cessation of nephrogenesis." Dev Biol
360(1): 110-122.

Rymer, C., J. Paredes, K. Halt, C. Schaefer, J. Wiersch, G. Zhang, D. Potoka, S. Vainio, G. K.
Gittes, C. M. Bates and S. Sims-Lucas (2014). "Renal blood flow and oxygenation drive nephron
progenitor differentiation." Am J Physiol Renal Physiol 307(3): F337-345.

Schneider-Poetsch, T., J. Ju, D. E. Eyler, Y. Dang, S. Bhat, W. C. Merrick, R. Green, B. Shen
and J. O. Liu (2010). "Inhibition of eukaryotic translation elongation by cycloheximide and
lactimidomycin." Nat Chem Biol 6(3): 209-217.

Schnell, J., M. Achieng and N. O. Lindstrom (2022). "Principles of human and mouse nephron
development." Nat Rev Nephrol 18(10): 628-642.

96

Schuijers, J., M. Mokry, P. Hatzis, E. Cuppen and H. Clevers (2014). "Wnt-induced
transcriptional activation is exclusively mediated by TCF/LEF." EMBO J 33(2): 146-156.

Self, M., O. V. Lagutin, B. Bowling, J. Hendrix, Y. Cai, G. R. Dressler and G. Oliver (2006). "Six2
is required for suppression of nephrogenesis and progenitor renewal in the developing kidney."
EMBO J 25(21): 5214-5228.

Shakya, R., F. Watanabe T Fau - Costantini and F. Costantini "The role of GDNF/Ret signaling
in ureteric bud cell fate and branching morphogenesis." (1534-5807 (Print)).

Shibamoto, S., M. Hayakawa, K. Takeuchi, T. Hori, K. Miyazawa, N. Kitamura, K. R. Johnson,
M. J. Wheelock, N. Matsuyoshi, M. Takeichi and et al. (1995). "Association of p120, a tyrosine
kinase substrate, with E-cadherin/catenin complexes." J Cell Biol 128(5): 949-957.

Short, K. M., A. N. Combes, J. Lefevre, A. L. Ju, K. M. Georgas, T. Lamberton, O. Cairncross,
B. A. Rumballe, A. P. McMahon, N. A. Hamilton, I. M. Smyth and M. H. Little (2014). "Global
quantification of tissue dynamics in the developing mouse kidney." Dev Cell 29(2): 188-202.

Stark, K., S. Vainio, G. Vassileva and A. P. McMahon (1994). "Epithelial transformation of
metanephric mesenchyme in the developing kidney regulated by Wnt-4." Nature 372(6507):
679-683.

Stuart, T., A. Butler, P. Hoffman, C. Hafemeister, E. Papalexi, W. M. Mauck, 3rd, Y. Hao, M.
Stoeckius, P. Smibert and R. Satija (2019). "Comprehensive Integration of Single-Cell Data."
Cell 177(7): 1888-1902 e1821.

Takeichi, M. (1993). "Cadherins in cancer: implications for invasion and metastasis." Current
Opinion in Cell Biology 5(5): 806-811.

Tanigawa, S., H. Naganuma, Y. Kaku, T. Era, T. Sakuma, T. Yamamoto, A. Taguchi and R.
Nishinakamura (2019). "Activin Is Superior to BMP7 for Efficient Maintenance of Human iPSC-
Derived Nephron Progenitors." Stem Cell Reports 13(2): 322-337.

Tanigawa, S., H. Wang, Y. Yang, N. Sharma, N. Tarasova, R. Ajima, T. P. Yamaguchi, L. G.
Rodriguez and A. O. Perantoni (2011). "Wnt4 induces nephronic tubules in metanephric
mesenchyme by a non-canonical mechanism." Dev Biol 352(1): 58-69.

Teng, A., M. Nair, J. Wells, J. A. Segre and X. Dai (2007). "Strain-dependent perinatal lethality
of Ovol1-deficient mice and identification of Ovol2 as a downstream target of Ovol1 in skin
epidermis." Biochim Biophys Acta 1772(1): 89-95.

Tran, T., N. O. Lindstrom, A. Ransick, G. De Sena Brandine, Q. Guo, A. D. Kim, B. Der, J. Peti-
Peterdi, A. D. Smith, M. Thornton, B. Grubbs, J. A. McMahon and A. P. McMahon (2019). "In
Vivo Developmental Trajectories of Human Podocyte Inform In Vitro Differentiation of
Pluripotent Stem Cell-Derived Podocytes." Dev Cell 50(1): 102-116 e106.

Tsai, T. Y., M. Sikora, P. Xia, T. Colak-Champollion, H. Knaut, C. P. Heisenberg and S. G.
Megason (2020). "An adhesion code ensures robust pattern formation during tissue
morphogenesis." Science 370(6512): 113-116.

97

Valenta, T., G. Hausmann and K. Basler (2012). "The many faces and functions of beta-
catenin." EMBO J 31(12): 2714-2736.

Vidal, V. P., F. Jian-Motamedi, S. Rekima, E. P. Gregoire, E. Szenker-Ravi, M. Leushacke, B.
Reversade, M. C. Chaboissier and A. Schedl (2020). "R-spondin signalling is essential for the
maintenance and differentiation of mouse nephron progenitors." Elife 9.

Vivante, A., S. Kohl, D. Y. Hwang, G. C. Dworschak and F. Hildebrandt (2014). "Single-gene
causes of congenital anomalies of the kidney and urinary tract (CAKUT) in humans." Pediatr
Nephrol 29(4): 695-704.

Weis, W. I. and W. J. Nelson "Re-solving the cadherin-catenin-actin conundrum." (0021-9258
(Print)).

Wellik, D. M., P. J. Hawkes and M. R. Capecchi (2002). "Hox11 paralogous genes are essential
for metanephric kidney induction." Genes Dev 16(11): 1423-1432.

Wen, L., Y. Miao, Z. Fan, J. Zhang, Y. Guo, D. Dai, J. Huang, Z. Liu, R. Chen and Z. Hu (2021).
"Establishment of an Efficient Primary Culture System for Human Hair Follicle Stem Cells Using
the Rho-Associated Protein Kinase Inhibitor Y-27632." Front Cell Dev Biol 9: 632882.

Xu, J., H. Liu, J. S. Park, Y. Lan and R. Jiang (2014). "Osr1 acts downstream of and interacts
synergistically with Six2 to maintain nephron progenitor cells during kidney organogenesis."
Development 141(7): 1442-1452.

Xu, J., E. Y. Wong, C. Cheng, J. Li, M. T. Sharkar, C. Y. Xu, B. Chen, J. Sun, D. Jing and P. X.
Xu (2014). "Eya1 interacts with Six2 and Myc to regulate expansion of the nephron progenitor
pool during nephrogenesis." Dev Cell 31(4): 434-447.

Yamanaka, H., T. Moriguchi, N. Masuyama, M. Kusakabe, H. Hanafusa, R. Takada, S. Takada
and E. Nishida (2002). "JNK functions in the non-canonical Wnt pathway to regulate convergent
extension movements in vertebrates." EMBO reports 3(1): 69-75.

Yang, R. A.-O., A. A.-O. Meyer, I. A.-O. Droujinine, N. D. Udeshi, Y. Hu, J. Guo, J. A. McMahon,
D. K. Carey, C. Xu, Q. Fang, J. Sha, S. Qin, D. Rocco, J. Wohlschlegel, A. Y. Ting, S. A. Carr,
N. Perrimon and A. A.-O. McMahon "A genetic model for in vivo proximity labelling of the
mammalian secretome." (2046-2441 (Electronic)).

Ying, Q. L., J. Wray, J. Nichols, L. Batlle-Morera, B. Doble, J. Woodgett, P. Cohen and A. Smith
(2008). "The ground state of embryonic stem cell self-renewal." Nature 453(7194): 519-523.

Zhang, X., K. A. Peterson, X. S. Liu, A. P. McMahon and S. Ohba (2013). "Gene regulatory
networks mediating canonical Wnt signal-directed control of pluripotency and differentiation in
embryo stem cells." Stem Cells 31(12): 2667-2679.

98

Chapter 3: β-catenin operates concomitantly with α-catenin and
cadherins to mediate the mesenchymal to epithelial transition of
nephron progenitors
Acknowledgements:
Chapter 3 was written primarily by Helena Bugacov (HB) with edits and commentary from
Andrew McMahon (AM) and Balint Der (BD). Outline of chapter and draft design was performed
by HB and AM with insights from BD. Experimental design for experiments in this chapter were
designed by HB, BD and AM with insight from other lab members. HB performed experiments to
characterize the NPC dynamics in the wild type state as well as with β-catenin removal. Wild
type time lapse recording was done by HB with assistance from Nils Lindstrom (NL) and was
later assisted by (BD). Quantification of NPC dynamics in wild type was done by BD and
movement plots were generated by SK. Immunostaining of cadherins and catenin’s were
performed by HB and BD. JG, HB and BD assisted with guide optimization to remove catenin’s
and cadherins. Cadherin and catenin removal for morphology experiments in NPCs were
optimized, performed with assistance from HB, immunostained, imaged and quantified by
mostly BD. Cadherin and catenin removal for Bulk-mRNA seq experiments in NPCs was
performed by HB. Members of the USC Stem Cell flow cytometry core assisted with FAC
sorting. Script for the analysis of mRNA-seq was developed by McMahon lab members Louisa
Gerhart (LG) and Sunghyun Kim (SK). HB analyzed Bulk mRNA sequencing resulting from
cadherin and catenin experiments. Kari Koppitch (KK) performed scRNA-Seq experiments and
Riana Parvez (RP) and SK analyzed scRNA-seq data used to characterized in vivo cadherin
expression. In vivo immunostaining characterization of catenins and cadherins was performed
by HB and BD.

99

Introduction
Arrangements of cells during organogenesis require coordinated and precise interactions
between neighboring cells. Cell-cell adhesion mediated by Cadherins enable migration,
adhesion and epithelialization; processes that underpin complex tissue organization (Niessen,
Leckband et al. 2011). These signaling interactions are central in morphological events that
occur during embryo development (Clevers and Nusse 2012). One signaling pathway implicated
in tissue morphogenesis across organ development is the Wnt pathway and its canonical
effector β-catenin, which serves roles as a transcriptional regulator and as a component of
cadherin complex (Nelson and Nusse 2004).
During kidney development, several stem/progenitor cell populations coordinate their behaviors
to build a functional kidney (Schnell, Achieng et al. 2022). The nephron, the functional unit of the
kidney, is central to the kidneys’ filtration-function and the maintenance of body homeostasis
and is generated from nephron progenitor cells (NPCs) (McMahon 2016). To ensure that a full
complement of nephrons form during development (14,000 in the mouse, and 1,000,000 in the
human kidney), NPCs balance the processes of differentiation and self-renewal (McMahon
2016). Fate-mapping has shown that NPCs give rise to all unique nephron cell types (at least 22
identified) that impart distinct physiological functions required to sustain adult life (Kobayashi,
Valerius et al. 2008); (Ransick, Lindstrom et al. 2019). Once the NPC pool is depleted at late
fetal or early postnatal (mouse) stages, nephron formation ends.
NPCs are positioned within a structurally unique progenitor niche. NPCs are dynamically
moving around the tips of the growing collecting duct (Martz, Ottina et al.) but remain capable of
movements within the niche and between different CD tips (Combes, Lefevre et al. 2016). Light
and electron microscopy of NPCs has shown cellular extensions from the NPCs towards the CD
(Lehtonen 1975). These are dynamic as time-lapse imaging shows NPCs detach and reattach
100

to the CD during mitosis (O’Brien et al., 2018) suggesting attractive signals maintain their
position at the top of the CD tip within their niche (Combes, Lefevre et al. 2016).
Nephron production is a reiterative process, with each nephrogenic event starting with the
aggregation of NPCs into pretubular aggregates (PTAs). These epithelialize and give rise to
lumenized renal vesicles (RV) (McMahon 2016). The NPC to PTA and RV transition is gradual
and NPCs are progressively recruited to the forming nephron through a mesenchymal to
epithelial transition (MET) with the time of their recruitment directly affecting their proximal-distal
potential and place within the RV (Lindstrom, De Sena Brandine et al. 2018). In the MET of
nephron progenitors there are two main events: the induction of NPCs that shut off an NPC
maintenance transcriptional signature and a rapid ramp up of an induction signature (paper 1)
concomitant with changes of cellular shape and a reorganization of the cellular matrix
components leading to the conversion to an epithelial cell type (Park, Ma et al. 2012, Lindstrom,
De Sena Brandine et al. 2018).
Nephron formation involves several morphogenetic processes (e.g., cell aggregation, cell
movement, mesenchymal-epithelial conversion, cell sorting, and cell shape changes) that
members of the classic cadherin superfamily of cell adhesion molecules have been previously
involved in (Cho, Patterson et al. 1998, Combes, Lefevre et al. 2016, Lawlor, Zappia et al.
2019). Cadherins have been previously implicated in the development of the nephron with
Cadherin 6 (Cdh6) data suggesting that Cdh6 function is required for the early aggregation of
induced mesenchymal cells and their subsequent conversion to epithelium (Cho, Patterson et
al. 1998).
Cadherin molecules reside at the cell membrane and contain a conserved cytoplasmic domain
that interacts with a family of cytoplasmic proteins called Catenins of which α-catenin and β-
catenin are members (Nagafuchi and Takeichi 1988, Ozawa, Baribault et al. 1989, Reynolds,
Daniel et al. 1994, Shibamoto, Hayakawa et al. 1995). The cadherin-catenin complex is required
101

for cadherin-mediated cell adhesion where α-catenin, binds to the cadherin-β-catenin (Hinck,
Näthke et al. 1994) complex which mediates binding to the actin cytoskeleton (Aberle, Butz et
al. 1994, Butz and Kemler 1994). Cadherins cluster in cell-cell contact regions called adherens
junctions. These subcellular structures are important cell-cell signaling centers within cells, and
cadherins are crucial for their establishment and maintenance (Gumbiner 1996).
Previous characterization of Cadherin expression in the developing nephron has shown E-
Cadherin (Cdh1), N-cadherin (Cdh2), P-cadherin (Cdh3), R-Cadherin (Cdh4) and K-Cadherin
(Cdh6) is expressed in the developing nephron (Dahl, Sjödin et al. 2002). Cadherin-6 function is
required for the early aggregation of induced mesenchymal cells and their subsequent
conversion to epithelium (Cho, Patterson et al. 1998) and in Cdh6 mutant kidneys a significant
number of renal vesicles fail to fuse to the ureteric bud dramatically affecting kidney
development and can lead to a loss of nephrons in the adult because of the lack of fusion.
Results from Cadherin removal experiments show that cadherins play an much needed role in
the formation of epithelial structures in the kidney (Mah, Saueressig et al. 2000). Results from
cadherin removal experiments exemplify the need for precise timing and proper coding in order
to orchestrate the morphogenesis and patterning of complex epithelial tissues like the nephron
(Mah, Saueressig et al. 2000).
The creation of combinatorial cadherin mutant strains has yielded inconclusive results;
Moreover, none of the compound knockout strains affected kidney development more than
within the individual cadherin 6 knockout strains posing a challenge for future investigation and
mechanistic undertanding. We revisited this area using an invitro nephron modeling and genetic
removal assays (paper 1) (Brown, Muthukrishnan et al. 2015) along side mouse p0 single cell
RNA- sequencing (sc-RNA-seq) to further compartmentalize cadherin expression in the
developing nephron provided that over 2 decades have passed since initial cadherin expression
in kidney development was published (Cho, Patterson et al. 1998, Dahl, Sjödin et al. 2002).
102

To gain a deeper understanding of β-catenin’s action in coordinating NPC movement and
morphogenesis during nephron formation we employed a system for rapid genetic modification
of NPCs (paper 1) and studied the effects of modulating β-catenin and α-catenin and cadherin
activity on cell morphology in the induction of primary mouse NPCs in vitro (Brown,
Muthukrishnan et al. 2015). Using an in vitro NPC system that models the self-renewing stage
of the developing nephron as well as the early aggregation and formation of the PTA we set out
to molecularly characterize the expression and function of Cadherins in kidney development.
Here we show that NPCs in the self-renewing state are highly mobile and less adherent cells
and express “pre-existing” cadherins Cdh2, Cdh4 and Cdh11. Upon increasing of Wnt activity,
NPCs are inducted and express Cdh3 and Cdh4 that enable cellular aggregation. Simultaneous
removal of Cadherins present at the cell membrane of NPCs in our culture (Cdh2,3,4,11)
disables cellular aggregation but does not disable transcriptional induction suggesting that
transcriptional induction and cellular morphology changes are centered around β-catenin but are
not linked.
Results:
Increasing Wnt/β-catenin activity in nephron progenitor cell culture stabilizes cell-cell
contacts and models the first step of aggregation and cellular induction.
Provided that in vivo genetic experiments did no not provide easily accessible imaging of
nephron progenitors in their self-renewal and early inducted states in a genetically
manipulatable system we decided to observe and quantify the early stages of nephron induction
using time lapse recordings of in vitro primary NPC cultures. To model the cellular dynamics
(cell movements and adhesion) of self-renewing and differentiating NPCs in a genetically
manipulable system we took advantage of a culture protocol to maintain and differentiate NPCs
in vitro (Brown, Muthukrishnan et al. 2015)Mouse NPCs were isolated from embryonic day (E)
103

16.5 kidneys by enzymatic digestion and MACS purification, and cultured in Nephron Progenitor
Expansion Media (NPEM). As expected, NPCs were maintained over multiple generations in
low levels (1.25µM) of the GSK3β inhibitor CHIR99021 while high levels (5µM) promoted
differentiation (Figure 1A) (Guo, Kim et al. 2021). Cell dynamics and cell-to-cell contacts in low
and high CHIR99021 conditions were visualized using NPCs from mTmG mice (Muzumdar,
Tasic et al. 2007) where the cell-membrane is fluorescently tagged with Tomato, and imaged by
time lapse confocal microscopy (Figure 1B).
Membrane intensity as soon as 6 hours most addition of high levels of CHIR increased
suggesting tighter cell-cell adhesion compared to low and no CHIR conditions (Figure 1B)
Cellular tracking of NPCs throughout the time course suggests that paths taken by cells in high
CHIR conditions lead to aggregation and the average distance to neighboring cells is lower in
high CHIR conditions highlighting the aggregation phenotype (Figure 1A,B Supplementary).
NPCs in high CHIR experience far fewer contacts/ cell over the time course as compared to low
and no CHIR suggesting that NPCs in low and no CHIR are more motile and keep shorter
interactions (Figure 1C Supplementary). Cell-cell contact durations in (5µM) CHIR were
longer, suggesting that high CHIR activity stabilizes cell-cell contacts when they are initiated
(Figure 1C Supplementary). NPCs cultured in high levels of CHIR maintained shorter cell-to-
cell distances emphasizing the aggregation phenomenon that occurs upon addition of higher
levels of CHIR (Figure 1J; Figure 1D Supplementary).
Analysis of NPCs in the initial 6 hours of culture suggests that NPCs transition from futile
filopodia connections to strong membrane to membrane interactions upon the addition on high
CHIR in 3 hours (Figure 1C,D). Moreover, NPCs cultured in high CHIR display an epithelial like
cell morphology and are significantly taller than their low CHIR counterparts while having a
smaller cell volume but significantly larger nuclear height (Figure 1 G,H,I,J,K Supplementary).
104

To further characterize the role of β-catenin stabilization mediated by CHIR in resulting in NPC
aggregation we used our previously established (Paper 1) platform for broad, rapid genetic
modification of NPCs in vitro. To observe membrane phenomena occurring during NPC
aggregation used we NPCs from mTmG; Cas9-GFP mice (Muzumdar, Tasic et al. 2007, Platt,
Chen et al. 2014) enabling us to label transfected cells in Green by the addition of Cre mRNA
co-transfected with guides targeting β-catenin (Figure 1E).
In control high CHIR conditions (GFPsgRNA) green cells are interspaced within red aggregates
evenly; however in experimental β-catenin removal conditions (Ctnnb1sgRNA) green NPCs
were excluded from the aggregates and exclusion from aggregates begins as early as 6 hours
(Figure 1E, supplementary Figure 1L).
To screen for cadherin related cell adhesion in our primary nephron progenitor cell culture we
cultured nephron progenitors in media without Calcium as cadherin-based interactions are
calcium dependent (Kim, Tai et al. 2011). Within 10 minutes of changing to Calcium free media,
NPCs lost contact with each other suggesting that their interactions are stabilized by Ca
indicting that they are cadherin based (Figure 1K). Moreover, upon addition of media with
Calcium, cell-cell contacts were quickly re-established at 30 minutes (Figure 1K).

105

106

107

Figure 1: Increasing Wnt/β-catenin activity in nephron progenitor cell culture stabilizes cell-cell contacts
and models the first step of aggregation and cellular induction.
A) Schematic representation of NPC isolation and culture in NPEM supplemented with no (0uM) CHIR, low
(1.25uM) CHIR and high (5uM) CHIR (for more details see (Brown, Muthukrishnan et al. 2015). B) Time lapse
stills of NPC derived from mTmG animals cultured in no (0uM) CHIR, low (1.25uM) CHIR and high (5uM) CHIR.
(See movies attached in supplemental). C) Description of membrance based cell-cell interactions. D)
Quantification of filopodia to membrane-membran contact of NPCs cultured in no (0uM) CHIR, low (1.25uM)
CHIR and high (5uM) CHIR. E) NPCs isolated from mTmG; Cas9-GFP and co-transfected with Cre mRNA and
guides targeting GFP (control) and β-catenin (experimental). Transfected cells switch from red to green. F) Time
lapse stills (see movies attached in supplemental) NPCs cultured in NPEM (Control), DMEM (control) and DMEM
no Ca+ (experimental).

Figure 1 supplemental:
A) Cell tracking of 6 hours of NPCs derived from mTmG animals cultured in no (0uM) CHIR, low (1.25uM) CHIR
and high (5uM) CHIR. B) Average cell distance of NPCs derived from mTmG animals examined low (1.25uM)
CHIR and high (5uM) CHIR to quantify nearest neghbor after 6 hours of culture. C) Quantification of contact
numbers per cell of NPCS derived from mTmG animals cultured in no (0uM) CHIR, low (1.25uM) CHIR and high
(5uM) CHIR and quantification of cell contact duration of NPCS derived from mTmG animals cultured in no (0uM)
CHIR, low (1.25uM) CHIR and high (5uM) CHIR.D) Distance to nearest neighbor of NPCS derived from mTmG
animals cultured in no (0uM) CHIR, low (1.25uM) CHIR and high (5uM) CHIR.E) Immunostaining of E16.5 wild
type kidneys characterizing Six2 (Rymer, Paredes et al.) protien expression in self-renewing NPCs and Jag1
(Schneider-Poetsch, Ju et al.) in induced NPCs (10uM scale bar) (white = DAPI nucelar dye). F) Immunostaining
of E16.5 wild type NPCs cultures in low (1.25uM) CHIR and high (5uM) CHIR characterizing Six2 (Rymer,
Paredes et al.) protien expression in self-renewing NPCs and Jag1 (Schneider-Poetsch, Ju et al.) in induced
NPCs (10uM scale bar) (white = DAPI nucelar dye). G) Low magnification stills (see movies in supplemental) of
NPCs isolated from Cas9-GFP and co-transfected with mCherry mRNA and guides targeting GFP (control) and
β-catenin (experimental). Transfected cells are red.H) Quantification of E16.5 wild type NPCs cultures in low
(1.25uM) CHIR and high (5uM) CHIR characterizing cell hight. I) Quantification of E16.5 wild type NPCs cultures
in low (1.25uM) CHIR and high (5uM) CHIR characterizing cell volume.J) Quantification of E16.5 wild type NPCs
cultures in low (1.25uM) CHIR and high (5uM) CHIR characterizing nuclear hieght. K) Quantification of E16.5 wild
type NPCs cultures in low (1.25uM) CHIR and high (5uM) CHIR characterizing nuclear volume. L) Schematic
highlighting changes in NPC morphology changing from low to high CHIR. (fix figure panel lettering)

108

In vivo and in vitro characterization of Cadherin expression reveals differential cadherin
expression within the self-renewing and patterning developing nephron
Previous reports have used Cdh6 as a maker of induced nephron progenitors upon reporting
that loss of self-renewal marker Six2 leads to aberrant induction of nephron progenitors in vivo
(Self, Lagutin et al. 2006). Cdh6 mutant phenotypes have reportedly been most severe even
compared to compound mutant Cdh6 mutant kidneys. Cdh6 has been previously reported to be
expressed in the developing nephron (Mah, Saueressig et al. 2000) (Cho, Patterson et al.
1998). Moreover, Hnf4a has been reported to regulate Cdh6 expression in the where its protein
is found in the developing proximal tubule (Marable, Chung et al. 2020). Although we detect
Cdh6 expression in the developing proximal tubule using immunofluorescent staining of E16.5
kidneys from a Six2TGC; Tdt ; Hoxb7 Venus to demarcate the developing nephron (tdTomato)
and Ureteric epithelium (Venus) (Kobayashi, Valerius et al. 2008, Chi, Hadjantonakis et al.
2009, Madisen, Zwingman et al. 2010) corroborates Cdh6 expression in the developing
proximal tubule (Supplementary Figure 2C).
Analysis of induced nephron progenitors in vitro suggests that Cdh6 is not expressed in the
membranes of induced NPCs (Supplementary Figure 2A,B). Although more protein is
detected in NPCs cultured in high CHIR, Cdh6 is found mostly in the Golgi as co-staining with
Golgi marker and suggests that NPCs in our in vitro culture are more are not in a mature
enough state to express Cdh6 (Supplementary Figure 2A,B). This could reflect the
progressive recruitment model in which proximalized region of the developing kidney are later
recruits suggesting that our in vitro culture system does not adequality model the
proximalization of the developing nephron (Lindstrom, De Sena Brandine et al. 2018). Although
bulk-mRNA sequencing results of NPCs cultured in Low and High CHIR reveal that Cdh6
mRNA is upregulated (Figure 2C), we decided not to follow up with Cdh6 as a candidate for
109

functional analysis considering its lack of protein product at the membrane of NPCs cultured in
high CHIR (Supplementary Figure 2A,B).
Moreover, single cell RNA -sequencing (sc-RNA-seq) of mouse p0 kidney suggests reveals a
Cadherin code across the developing nephron. Co-expression of Cdh2 and Cdh11 in cells
expressing Six2, and Cited1 suggest that Cdh2 and Cdh11 are expressed in the Self-renewing
compartment of the nephrogenic zone (Figure 2A). Additionally, Cdh2 and Cd11 protein are
detected in the self-renewing compartment of E16.5 kidneys corroborating their scRNA-seq
results. Also, bulk-mRNA sequencing results of NPCs cultured in Low and High CHIR show that
Cdh2 and Cdh11 are expressed at higher level in low CHIR conditions (Figure 2C) and
immunofluorescence staining of NPCs in culture shows both Cdh2 and Chd11 staining at the
membranes of NPCs in culture (Figure 2H,K). Protein and mRNA detection in vivo and in vitro
of Cdh2 and Cdh11 characterize Cdh2 and Cdh11 as pre-existing cadherins that mediate weak
interactions of highly motile nephron progenitor cells (Figure 2B).
sc-RNA-seq of mouse p0 kidney suggests reveals a broad expression of α-catenin (Ctnna1) and
a β-catenin (Ctnnb1) in the self-renewing and induced/patterned regions of the developing
nephron with higher levels of both in induced/patterning regions (Figure 2A). Although present
at higher levels of abundance within different clusters, α-catenin and a β-catenin appear mostly
in the developing distal and podocyte region (Figure 2A).
sc-RNA-seq data and immunofluorescent data suggest that Cdh3 is expressed in the distal
portion of the developing nephron as it co-expressed with distal markers Pou3f3 and Mecom
(Schnell, Achieng et al. 2022) (Figure 2A,E). Cdh4 expression is broader and is expressed in
the developing distal yet found co-expressing most in the developing podocyte region as it most
heavily co-expresses with podocyte marker Mafb (Schnell, Achieng et al. 2022). Cdh4 has also
been previously shown to be expressed in the cap mesenchyme of the nephrogenic niche, renal
vesicle proximal domains of the s-shape body and podocytes of the developing glomerular cleft
110

(Goto, Yaoita E Fau - Matsunami et al. , Dahl, Sjödin et al. 2002). Immunofluorescence
staining of Cdh4 reveals broad expression with protein detection in the proximal and podocyte
region. Cdh3 protein and mRNA is upregulated upon in high CHIR conditions in in vitro cultures
and Cdh3 protein is only found in the membranes of NPCs cultured in high CHIR (Figure 2 C,
I). Cdh4 protein is found at the membranes of NPCs in both low and high CHIR and Cdh4
mRNA is upregulated in high CHIR conditions. Moreover, Cdh4, is a bona fide β-catenin target
gene and has β-catenin and Tcf/Lef transcription factors bound at its cis regulator elements and
its expression is lost upon β-catenin and Tcf/Lef KO (Paper 1). Cdh3 and Cdh4 due to their
expression in high CHIR and loss of expression upon removal of members of the Wnt pathway
suggest that they are updated as a response to Wnt mediated induction during nephrogenesis.
Their precise expression in the developing nephron may later assist to pattern the nephron.
Presence at the cell membrane as well as expression in the developing nephron warrant follow
up functional analysis of Cdh 2,3,4 and 11 (Figure 2B).

111

112

113

In vivo and in vitro characterization of α-catenin expression reveals co-expression with
β-catenin within the self-renewing and patterning developing nephron
Because the cadherin-catenin complex is required for cadherin-mediated cell adhesion (Hinck,
Näthke et al. 1994) and mediates binding to the actin cytoskeleton (Aberle, Butz et al. 1994,
Butz and Kemler 1994) we characterized the protein expression and mRNA levels of β-catenin
and α-catenin in the developing nephron (Figure 2A). We also identified that there exists a
subset of “preexisting cadherins” (Cdh2, Cdh4, Cdh11) that are present at NPC cell membranes
in low CHIR conditions that mediate weak cell-cell interactions and that upon induction (high
CHIR conditions) Cdh3 appears at the cell membrane (Figure 3A). We also profiled the protein
expression and localization of β-catenin and α-catenin within our in vitro culture to assay the
role of β-catenin and its interactions with cadherins and α-catenin in mediating the MET
modeled by our high CHIR conditions.
Figure 2: In vivo and in vitro characterization of Cadherin expression reveals differential cadherin
expression within the self-renewing and patterning developing nephron
A) Schematic representation of developing nephron and sc-RNA-seq of mouse p0 kidney characterizing
Cdh2,Cdh3,Cdh4,Cdh6,Cdh11, Ctnna1 and Ctnnb1 expression. B) Table characterizing Cadherin mRNA and
protein expression in vivo and in vitro in E16.5 wild type NPCs cultures in low (1.25uM) CHIR and high (5uM)
CHIR. C) Bulk mRNA raw count files of Cadherin expression characterizing Cadherin mRNA in E16.5 wild type
NPCs cultures in low (1.25uM) CHIR and high (5uM) CHIR. D) Immunostaining of E16.5 embryonic kidneys in
Six2TGC-tdTomato-Hoxb7-Venus mice showing Cdh2 expression in both uninduced and induced NPCs. E)
Cdh3 IF staining shows strong signal in the distal segment of late RV including the invading cells of the UB tip in
addition to the early nephron forms. F) Cdh4 IF showing Cdh4 expression in uninduced NPCs and higher levels
of Cdh4 in PTA, RV G) Cdh11 IF showing low levels of Cdh11 signal in the uninduced NPCs and an abolished
expression in the RV. H) Representative images of IF staining of Cdh2 showing membrane expression both in
low (1.25 μM) and high (5 μM) CHIR conditions. I) Representative images of IF staining of Cdh3 showing high
levels of Cdh3 signal in high CHIR (5 μM) conditions. J) Representative images of IF staining of Cdh4 showing
membrane expression both in low (1.25 μM) and high (5 μM) CHIR conditions. K) Representative images of IF
staining of Cdh11 showing weak membrane expression both in low (1.25 μM) and high (5 μM) CHIR conditions.

Figure 2 Supplementary:
A) Representative images of IF staining of Cdh6 showing a punctate pattern of protein localization in both low
(1.25 μM) and high (5 μM) CHIR conditions. B) Representative images of IF co-staining with Cdh6 and GM130
Golgi-marker in low (1.25 μM) and high (5 μM) CHIR conditions showing colocalization of Cdh6 and the Golgi-
markers.C) Immunostaining of E16.5 embryonic kidney in Six2TGC-tdTomato-Hoxb7-Venus mice showing the
absence of any labeling in the uninduced NPCs and increased Cdh6 levels in renal vesicle (arrow).D)
Representative images of IF staining of Cdh13 in low (1.25 μM) and high (5 μM) CHIR conditions showing low
levels of membrane localization in a fragmented pattern at the induced NPCs. E) Schematic representation of
nephron development. F) UMAP projection of all clusters in developing nephron.

114

β-catenin and α-catenin proteins co-localize at the membrane within NPCs cultures in low and
high CHIR (Figure 3B,C). β-catenin and α-catenin staining in low and high CHIR reveals
changes in cell membrane morphology as cells in high CHIR are aggregates, appear smaller
(Figure 1F, Figure 3C).
β-catenin and α-catenin proteins co-localize along the entire membrane and in particular along
the apical membrane of induced nephron progenitor cells forming a renal vesicle (Figure 3D).
Co-staining with induction and proximal/medial marker Jagged1 reveals that cells within the
renal vesicle express apical β-catenin and α-catenin throughout all domains of the renal vesicle.
This suggests that β-catenin and α-catenin may in concert mediate focal adherins junctions
within the apical regions of the developing since considering that such subcellular structures are
important cell-cell signaling centers within cells and changes in cell morphology (Gumbiner
1996).
115

116

Individual cadherin removal does not affect jagged1 expression or cell aggregation
We employed the same robust genetic platform previously described by your laboratory
(paper1) for genetic modification of NPCs in vitro using mRNA transfection to target individual
Cadherins. Co-transfection of GFP and mCherry mRNA indicated 80% of cells were reporter
positive suggesting a tight linkage between lipofectione competence and multiple mRNA/sgRNA
uptake (Paper 1). When NPCs were harvested from mice constitutively expressing a Cas9-GFP
allele (Platt, Chen et al. 2014). and transfected with a gRNA targeting GFP and mCherry
reporter mRNA, a 75% reduction in GFP signal was observed 24h post-transfection in
mCherry+ NPCs as measured by fluorescence activated cell sorting FACS (Paper 1). Thus,
mRNA transfection-mediated modification of cells provides a robust means of altering gene
activity in NPCs. To ensure complete individual removal and validate specific antibodies we
tested sgRNA KO of cadherins individually employed a 48-hour KO period (Figure 4A).
Cdh2,3,4,11 removal was robust (~80%) after 48 hours of guide exposure and prior to high
CHIR induction (Supplementary Figure 4A,B,C,D,E).
NPCs transfected with GFP control mRNA aggregate in high CHIR conditions and continue to
express jagged (Figure 4B). NPCs with β-catenin removal after a 48 our guide incubation have
the same lack of aggregation phenotype and loss of Jagged1 as previously described (Paper1)
(Figure 4B,C,D). However, NPCs with Cdh2, 3, 4,11 alone do not loose jagged1 protein
expression and still aggregate (Figure 4, B,C,D,E,F,G).
Figure 3: In vivo and in vitro characterization of α-catenin expression reveals co-expression with β-
catenin within the self-renewing and patterning developing nephron
A) Schematic respresntation of “preexisting cadherins” (Cdh2, Cdh4, Cdh11) that are present at NPC cell
membranes in low CHIR conditions that mediate weak cell-cell interactions and that upon induction (high CHIR
conditions) Cdh3 appears at the cell membrane (BioRender). B) Representative images of IF co-staining of α-
and ß-catenin both in low and high CHIR conditions (1.25 μM and 5 μM, respectively). C) Representative images
of IF co-staining of α- and ß-catenin and induction marker Jagged1 in wild-type E16.5 kidneys.

117

118

119

Compound cadherin removal maintains NPC transcriptional induction status however
ablates cell adhesion and phenocopies α-catenin removal
To address the redundancy of cadherin functions in mediating the mesenchymal to epithelial
transition of nephron progenitors we removed all expressed Cadherins (Cdh2,3,4,11) in our
nephron progenitor culture simultaneously to create a quadruple cadherin KO (QCKO). QCKO
cells do not form aggregates while still expressing Jagged1 suggesting that they are
transcriptionally inducted however morphologically not aggregated (Figure 5A, B,C,D,E).
However, a triple cadherin KO (TCKO) condition removing preexisting cadherins Cdh 2,4,11,
maintaining Cdh3 present does not lead to a lack of aggregation phenotype (Figure 5B).
Moreover, TCKO cells form clusters of mCherry positive cells within aggregates suggesting that
they possibly adhere to each other and self-organize with Cdh3 (Figure 5 B,E).
α-catenin removal was efficient after 48 hours and yielded ~90% protein removal (Figure 5 A,B
Supplementary). α-catenin removal cells do not form aggregates while still expressing Jagged1
suggesting that they are transcriptionally inducted however morphologically not aggregated and
phenocopy the QCKO condition. Cells behave similar to NPCs with β-catenin removed and do
not form part in aggregation, however they still express Jagged1 suggesting they are
transcriptionally induced.
Figure 4: Individual cadherin removal does not affect jagged1 expression or cell aggregation.
A) Schematic diagram of the immunostaining timepoint of single Cdh KO experiment. B) Representative images
of single Cdh KO conditions of the pre-existing cadherins. C) Aggregation quantification of effects of removing
individual Cadherins (Kruskal-Wallis-test). D) Quantification of NPC inuction as measured by Jag1 protein
expxrresion. Ctnnb1-KO is positive CTRL for cell sorting and the lack of induction (ordinary one-way ANOVA). E)
Representative images of the Cdh3 KO condition. Cdh3 is newly expressed in the high CHIR condition. KO of
Cdh3 did not influence neither aggregation. F) Quantification of cell aggregation in Cdh3 KO. Cells still aggregate
without Cdh3 (Kruskal-Wallis-test). G) Quantification of induction determined by Jag-1 IF labeling Ctnnb1-KO is
positive CTRL for cell sorting and the lack of induction or induction (Kruskal-Wallis-test).

Figure 4 supplementary: A) Representative IF images of Cdh2 knock out. B) Quantifications of the membrane
intensity of Cdh2 knock out (unpaired t test).C) Representative IF images of Cdh11 knock out. D) Quantifications
of the membrane intensity of Cdh11 knock out (unpaired t test).E) Representative IF images of Cdh3 knock out.
F) Quantifications of the membrane intensity of Cdh3 knock out (Mann-Whitney test).G) Representative IF
images of Cdh4 knock out. H) Quantifications of the membrane intensity of Cdh4 knock out (unpaired t test).

120

121

Figure 5: Compound cadherin removal maintains NPC transcriptional induction status however ablates
cell adhesion and phenocopies α-catenin removal
A) Schematic diagram of the immunostaining timepoint of the multiple Cdh KO experiment. B) Representative
images of triple Cdh KO condition (pre-existing Cdhs) and quadruple Cdh KO condition (includes the pre-existing
Cdhs and Cdh3). The simultaneous KO of the pre-exisiting cadherins resulted in clustering within the aggregates
(arrows) as shown by the quantification. C) Quantification of cell aggregation (Kruskal-Wallis-test). D)
Quantification of induction determined by Jag-1 IF labeling (Kruskal-Wallis-test). Knocking out Ctnnb1 served as
a positive CTRL in cell sorting and resulting in the lack of induction.E) Quantification of clusters of transfected
(mCherry +) cells within an agregate (ordinary one-way ANOVA). In simultaneous pan-cadherin KO the
transfected cells sorted out phenocopying the Ctnnb1-KO condition. Clustered or individual cells are induced as
well as determined by the quantification of Jag-1 induction marker. F) Representative images of the α-catenin KO
condition. G) Quantification of cell sorting (Kruskal-Wallis-test). H) Quantification of mCherry + cells within
aggregate (Kruskal-Wallis-test). I) Quantification of induction determined by Jag-1 IF labeling (Kruskal-Wallis-
test). Knocking out Ctnnb1 served as a positive CTRL in cell sorting and resulting in the lack of induction.

122

Nephron progenitors with compound cadherin removal and α-catenin removal are not
transcriptionally distinct from induced nephron progenitors.
To transcriptionally profile nephron progenitors in QCKO and α-catenin removal conditions we
performed bulk mRNA-sequencing was performed on biological replicates of FACS sorted
genetically modified NPCs utilizing a 48 hour KO period (Figure 6A). Control samples with GFP
removed after a 48 hour KO period and 24 hour induction expressed well characterized self-
renewal markers Cited1, Sic2, Eya1, Wt1, Osr1, Meox2, Cdh2, Cdh11 in low CHIR conditions
compared to high CHIR absolute Log2FC cut off 0.5; p-adj cut off 0.5 (Figure 6A
Supplementary) (Guo, Kim et al. 2021) (Paper 1). NPCs cultured in high CHIR express higher
levels of canonical NPC induction markers (Wnt4, Jag1, Lef1, Emx2, Ovol1, Lhx1,Pax2,
Cdh13,Cdh4,Cdh3) (Guo, Kim et al. 2021) (Paper 1) with absolute Log2FC cut off 0.5; p-adj cut
off 0.5 (Figure 6A Supplementary).
PCA analysis comparing control and experimental samples in low and high CHIR conditions
demonstrated co-clustering amongst NPCs in all low CHIR conditions, and on QCKO removal in
high CHIR, NPCs appear cluster alognside High CHIR samples on the X axis (36%vairance),
suggesting QCKO NPCs in high CHIR conditions appear transcriptionally distinct from their
control counterparts (Supplementary Figure 6B).
Running DE-Seq2 DEG lists with absolute Log2FC cut off 0.5; p-adj cut off 0.5 yielded an
extensive and expected list of 2512 DEGs comparting low CHIR control and high CHIR samples
(Figure 6C, Supplementary Table 7). DE-Seq2 comparisons with absolute Log2FC cut off 0.5;
p-adj cut off 0.5 of high CHIR QCKO samples and α-catenin KO NPC’s yielded DEG lists
yielded only one DEG, Rasl11a and Ctnna1 respectively. Such short lists from usual cutoffs
Figure 5 supplementary: Validation of Cas9 KO system for α-catenin
A) Representative IF images of α-catenin KOs and matching quantification of the membrane intensity of α-
catenin. B) quantification of α-catenin KO loss of protein. (unpaired t-test)

123

previously applied to all other studies in this system highlight the lack of transcriptional changes
from QCKO NPCs and α-catenin KO samples. The differentially expressed genes in both cases
reflect gene removal as the DEG in α-catenin is α-catenin gene itself (Ctnna1) (figure 6C).
Moreover changes in Rasl11a expression may reflect changes in Cadherin presence at the cell
membrane since Rasl11a is a small GTPase (Louro, Nakaya et al. 2004) and GTPases have
been previously characterized to interact with cadherins at the cell membrane (Fukata and
Kaibuchi 2001). Moreover, Rasl11a is also a DEG comparing control high and low CHIR
conditions so this may also indicate a mild transcriptional response. DEG’s with Log2FC cut off
0.5; p-value cut off 0.5 in low CHIR conditions in QCKO and α-catenin KO samples are RIKEN
cDNA 6030452D12 and Ctnna1. RIKEN cDNA 6030452D12 is a gene model that codes for a
lincRNA that maps next to Cdh3 which could reflect cutting at that location (MGI citation)
(Supplementary Table 5 and 6).
To further investigate DEGs from QCKO and α-catenin KO we performed a less stringent DE-
Seq2 DEG lists with absolute Log2FC cut off 0.5; p-value cut off 0.5 and performed gene
ontology (GO) analysis on genes upregulated as a result of QCKO and α-catenin KO and β-
catenin KO. Although more stringent cut off values were employed to analyze the β-catenin KO
samples because of the large amount and previously characterized genes lost as a result of β-
catenin removal, GO terms related to Cell migration adhesion are upregulated in all 3 KO
conditions compared to control high CHIR conditions (Supplementary Figure 6D). GO terms
such as extracellular matrix organization, Epithelial cell migration, epithelium migration, tissue
migration, positive regulation of cell adhesion, regulation of epithelial cell migration, extracellular
structure reorganization in the top-10 most significant GO terms of both KO conditions reflect a
change in adhesion status rather than inducive status since the terms Urogenital system
development, Kidney development do not appear and there is no change in Wnt4 and Jag1
expression (Paper 1) (Supplementary figure 6A,B,C,D) (Supplementary Tables1,2,3,4,7).
124

A lack of a transcriptional response as a result of QCKO and α-catenin KO samples suggests
that aggregation does not lead to cellular induction (supplementary Figure 6D). Moreover, the
shared phenotype of lack of aggregation but the difference in Jagged1 expression centers β-
catenin in mediating both the transcriptional and cell morphology changes that result in the
induction and MET of nephron progenitors, however induction is not aggregation dependent
(Figure 6B).

125

Figure 6: Nephron progenitors with compound cadherin removal and α-catenin removal are not
transcriptionally distinct from induced nephron progenitors.
A) Schematic representation of quadruple cadherin KO experimental workflow.B) princial componenet analsis
(PCA) of control (low CHIR and High CHIR) and QKO (low CHIR and High CHIR). PC1 = 36% variance relates to
tranascriptional idicutoin staus. Unlike Ctnnb1 KO (high CHIR) which cluster twoards the low CHIR samples, the
QKO in high CHIR is most like controls suggesting they are transcriptionally similar.C) Vendiagram shematic
representation of bulk mRNA seq data. Log2FC cut off 0.5; p-adj cut off 0.5 using DESEQ2 yielded an extensive
and expected list of 2512 DEGs comparting low CHIR control and high CHIR control samples. Experimental
conditions of high CHIR QCKO samples and α-catenin KO NPC’s yielded DEG lists yielded only one DEG,
Rasl11a and Ctnna1 respectively. D) Schematic represntation of mechanism of Wnt/β-catenin in mediating self-
renewal, inducrion and cell morphogensis of NPCs. Low Wnt/β-catenin mediates self-renewal. High Wnt/β-
catenin leads to aggregation and transctiponal changes; however, they are coupled by β-catenin however β-
catenin may operate disciriblty in both roles as QKO and KO of α-catenin does not lead to loss of induction
transcription suggesting that aggregation does not lead to induction.

126

Discussion
Cadherin mediated cell adhesion is required for the initial stages of nephrogenesis. Our in vitro
model has allowed us to model the induction of nephron progenitors. Key insights into the
requirement of cadherins in mediating cell-cell contact upon Wnt mediated induction of
nephrogenesis are changes in cell adhesion (Figure 1B,C,D) and removal of extracellular
calcium, an essential ion in cadherin complexes, resulted in reversible loss of cell-cell contacts
suggesting hat Calcium stabilized cadherin mediated cell contacts in the aggregation of induced
NPCs (Figure1K). Moreover, Wnt4 has been reported to act via a non-canonical calcium
pathway (Tanigawa, Wang et al. 2011), such release of calcium stores may also stabilize
cadherin based interactions during nephron formation (Supplementary Figure 1F).
Our invitro system has enabled us to investigate the self-renewal and induction of NPCs by
modulating levels of CHIR (Paper1) which allows us to model the first step of nephron induction
– the creation of the pre-tubular aggregate (Merrill, Gat et al.) which hall mark feature is the tight
aggregation of cells and upregulation of Wnt4 (Stark, Vainio et al. 1994, Park, Ma et al. 2012).
Our rapid in vitro KO system offers insight into the first step of induction of NPC’s which
implicates and establishes later nephron development (Schnell, Achieng et al. 2022)
sc-RNA-seq analysis using well established markers that pattern the developing nephron have
enables us to compartmentalize cadherin expression throughout the developing nephron. of
mouse p0 kidney suggests reveals a Cadherin code across the developing nephron (Figure 2
Figure 6 Supplementary:
A) Volcano plot of Low CHIR vs High CHIR DesQE2 Bulk RNA seq analysis Log2FC cut off 0.5; p-adj cut off 0.5.
Classical markers of induction (Wnt4, Jag1, Lef1, Cdh3, Cdh4, Lhx1, Ovol1, Emx2) are upregulated in High CHIR
conditions and classical self-renewal genes are upregulated in Low CHIR conditions (Six2, Cited1, Eya1). B)
Gene ontology (GO) analysis using DEG lists generated using DeSEQ2 with Log2FC cut off 0.5; p-adj cut off 0.5
on genes upregulated as a result of β-catenin KO in high CHIR compared to control. C) Gene ontology (GO)
analysis using less stringent DE-Seq2 DEG lists with absolute Log2FC cut off 0.5; p-value cut off 0.5 on genes
upregulated as a result of QKO in high CHIR compared to control. D) Gene ontology (GO) analysis using less
stringent DE-Seq2 DEG lists with absolute Log2FC cut off 0.5; p-value cut off 0.5 on genes upregulated as a
result of α-catenin KO in high CHIR compared to control

127

A,B). Cdh2,Cdh4 and Cdh11 are expressed in the Self-renewing compartment of the
nephrogenic zone (Figure 2A). Protein and mRNA detection in vivo and in vitro of Cdh2 and
Cdh11 characterize Cdh2 and Cdh11 as pre-existing cadherins that mediate weak interactions
of highly motile nephron progenitor cells (Figure 2B).
Cdh3 is expressed in the distal portion of the developing nephron and Cdh4 expression is
broader yet in the developing distal and developing podocyte (Figure 2A). Cdh3 protein and
mRNA is upregulated upon in high CHIR conditions in in vitro cultures and Cdh3 protein is only
found in the membranes of NPCs cultured in high CHIR , suggesting that a Wnt pulse creates
new Cdh3 protein (Figure 2 C, I). However, Cdh4 protein is found at the membranes of NPCs in
both low and high CHIR and Cdh4 mRNA is upregulated in high CHIR conditions, yet Cdh4 and
Cdh3 are β-catenin target genes (Paper 1). Their precise expression in the developing nephron
may later assist to pattern the nephron. Presence at the cell membrane as well as expression in
the developing nephron warrant follow up functional analysis of Cdh 2,3,4 and 11 (Figure 2B).
Redundancy in Cadherin expression has been previously reported (Mah, Saueressig et al.
2000). However, such studies revolve around Cdh6 as most important yet our data suggests
that Cdh6, is not present at the cell membrane at the onset of nephron induction (Figure 2
A,B,C) in our culture system. Moreover, this study highlights an essential role of Cdh3 in
mediating cell-cell contacts in the aggregation of nephron progenitor cells as TCKO and QCKO
phenotypes differ with the additional removal of Cdh3 (Figure 5B,E). Moreover, the change in
phenotype upon Cdh3 removal highlights potential differential adhesive properties within the
cadherin superfamily (Leckband and de Rooij 2014). Transcriptional and cell morphological
similarities between the QCKO and the α-catenin KO in phenotypes indicate that cadherins and
α-catenin work in tandem in mediating cellular rearrangements at the onset of nephrogenesis.
Moreover, a deeper understanding of the cadherin code required for the development of the
nephron may improve in vitro organoid and synthetic kidney cultures as kidney organoids do not
128

generate the full complement of renal cells and do form complete higher order structures
(Nishinakamura 2019). Cadherin expression has been recently reported to pattern the
developing zebrafish spinal by directly modulating adhesion forces. In Zebrafish spine, cell type-
specific combinatorial expression of different classes of create a differential adhesion code is
regulated by the sonic hedgehog morphogen gradient (Tsai, Sikora et al. 2020) . A Wnt pulse in
the developing kidney could potentially establish such a gradient leading to robust patterning in
the mesenchymal to epithelial transition of nephron formation and later patterning to create a
distal to proximal axis in the developing kidney. Further exploration into the cadherin code could
be further modeled kidney organoid cultures and synthetic biology approaches to secrete Wnt
signals to understand how a Wnt pulse leads to cellular organization (Morizane and Bonventre
2017, Glykofrydis, Cachat et al. 2021)
A mechanistic insight into NPC aggregation and the importance of Cadherin based interactions
has translational applications as deeper investigation into the role of cadherin based interactions
can enable an understanding of newer genetic causes that lead to congenital kidney anomalies
such as CAKUT (Vivante, Kohl et al. 2014). Moreover, an understanding of Wnt mediated
signaling and cadherin interactions could have implications towards understanding EMT as
cadherin interactions are critical in cancer (Takeichi 1993).
Methods:
Immunofluorescence staining
For immunofluorescence staining NPCs were cultured on coverslips (Thermanox plastic
coverslip Thermofisher Cat # 174969) , cell cultures were fixed with 4% PFA in PBS for 10 min,
then washed with PBS twice before blocking in 1.5% SEA block (Thermo Fisher Scientific,
107452659) in TBST (0.1% Tween-20 in TBS). After blocking room temperature for 1 hour,
coverslips were switched to primary antibody (diluted in blocking reagent) incubation in 4°
129

overnight. After washing three times with TBST, switched to secondary antibody (diluted in
blocking reagent) incubation 1 hour min in room temperature, shielded from light. This was
followed by three washes with TBST and a final rinse in PBS. Cover slips were then flipped onto
coverglass (VWR® Micro Cover Glasses, Rectangular no1.5 22x60, VWR Cat # 48393-221)
onto 15ul of mounting media (Fluoromount-G™ Mounting Medium (25mL) Themro Cat# 00-
4958-02). After drying overnight, coverglass with cover slips were taped with double sided tape
(Scotch® Permanent Double Sided Tape w/Refillable Dispenser, 1/2" x 6.94 yds., 1" Core, 1
Roll (136)) onto superfrost micro slides 25x75x1mm, cases (VWR Cat # 48311-703) Slides were
kept away from light at 4 degrees prior to confocal imaging.
Modified IF protocol for Cadherin and alpha-catenin KO
Cells were cultured on micro-plate 24 well ibiTreat, tissue culture treated (Cat # 82426). Cells
were washed with pre-warmed PBS and fixed with icecold 4% PFA in PBS on ice for 30 mins.
We applied only gentle manual pipetting to avoid the wash off weakly adhering sorted cells.
NPC isolation and culture
NPEM formulation and NPC isolation followed the published protocol (Brown et al., 2015).
Kidneys were harvested from E16.5 mice embryos and placed into PBS on ice. Each kidney
was expected to yield approximately 150,000 NPCs (100,000 NPCs for B6 background). After
dissection, kidneys were washed with 2mL HBSS (Thermo Fisher Scientific, 14175-095) twice
to remove blood and shaken on a Nutator platform for 2 min at 495rpm, then incubated in 2 mL
HBSS solution containing 2.5 mg/mL collagenase A (Roche, 11 088 793 001) and 10 mg/mL
pancreatin (Sigma, P1625) for 15 min at 37 ℃ while rocking on a Nutator platform at 495 rpm.
The enzymatic reaction was then terminated by the addition of 125ul of fetal bovine serum
(FBS). The resulting supernatant was pelleted then passed through a 40 μM filter, and then
washed with AutoMACS running buffer (Miltenyi, 130-091-221) before spinning down at 500 g
130

for 3 min. The cell pellet, predominantly cell of the cortical nephrogenic zone, was resuspended
in 76 μL of AutoMACS running buffer from 10 pairs of kidneys. NPC enrichment results from the
removal of other cell types in the cell suspension using a combination of PE-conjugated
antibodies as follows:
• Anti-CD105-PE (Miltenyi, 130-102-548), 9 μL
• Anti-CD140-PE (Miltenyi, 130-102-502), 9 μL
• Anti-Ter119-PE (Miltenyi, 130-102-893), 8 μL
• Anti-CD326-PE (Miltenyi, 130-118-075), 1.6 μL
The cells and antibodies were incubated at 4 ℃ for 30 min without agitation on ice, then washed
three times with 1 mL AutoMACS running buffer. To remove unwanted cells (non NPCs) , 20 μL
of anti-PE beads were added to the cell suspension for 30 min on ice. Cells were then washed
three times in 1 mL of running buffer, and finally cells resuspended in 1 mL of AutoMACS
running buffer and sent through the AutoMACS program as described in the published protocol
to remove non-NPC cell types enriching for NPCs (see Brown et al., 2015 for more information
on NPC isolation and NPEM).
24-well NPC culture plates were treated with Matrigel (Corning, 354277) 1:25 in APEL medium
and incubated at room temperature in cell culture hood for at least 1 hr. APEL was then
aspirated off leaving behind remaining Matrigel. For all culture experiments NPCs were seeded
in low CHIR NPEM. Upon seeding cells were shaken 3 times every ten minutes to evenly
distribute cells throughout the well.
Seeding densities:
16-24 h stabilization, induction for 24 h: 300 000 cells/well
16-24 h stabilization, 24 H KO, induction for 24 h: 150 000 cells/well
131

Timelapse: 16-24 h stabilization, 24 h KO, induction for 24 h: 150 000 cells/well
16-24 h stabilization, 48 H KO: 150 000 cells/well
16-24 h stabilization, 48 H KO, induction for 24 h: 100 000 cells/well
In vitro mRNA synthesis
Cre mRNA was created using pCAG-Cre plasmid (Addgene Catalog number #13775), mCherry
mRNA was created using (Addgene pX330-U6-Chimeric_BB-CBh-hSpCas9 Cat# 42230) and
GFPmRNA was made using pCAG-GFP (Addgene Cat# 11150 ).
DNA template for RNA synthesis was created using the forward and reverse primers listed
below with GXL prime star PrimeSTAR® GXL DNA Polymerase (Takara Cat# R050A).
mMESSAGE mMACHINE™ T7 ULTRA Transcription Kit (ThermoFisher Cat# AM1345) was
used for in vitro mRNA synthesis from DNA template to create 5’CAP 3’Polyadenylated tailed
transcripts. Synthesized mRNA was Lithium chloride precipitation and ran on a 1.5% agarose
formaldehyde denaturing gel to validate proper size as well as tailing.
Primers for making DNA Templates:
Cre:
F: CGGTACCCGGGGATCTAATACGACTCACTATAGgccaccatggccaatttactgac
R: CGACTCTAGAGGATCtcacagatcttcttcagaaataagtttttgttcc
mCherry:
F:CGGTACCCGGGGATCTAATACGACTCACTATAGGATCGCCGCCACCATGGGTGAGCAAG
GGCGAGGAGGA
R: CAGGTCGACTCTAGAGGATCCTACTTGTACAGCTCGTCCATGCC
Cell transfection:
132

mRNAs as well as sgRNAs were transfected to NPCs using Lipofectamine™ MessengerMAX™
Transfection Reagent (Thermofisher, Cat # LMRNA015). Per 24 well, 500ng of total mRNA (per
transcript type) were added along with sgRNAs at 1uM concentration. NPCs were transfected
according to manual instructions in OPTI-MEM. NPCs were incubated with OPTI-MEM for 3
hours (See Figure 2A).
CRISPR mediated gene removal
sgRNA targeting GFP were purchased from ThermoFisher true guide gRNA sequence
(GGGCGAGGAGCTGTTCACCG) targeting exon 1 of GFP and designed using Invitrogen True
guide Tool. sgRNAs targeting Ctnnb1 were designed using indephi to maximize frameshift
potential (Shen, 2018 #410) and cross referenced with (Hodgkins, 2015 #411) to minimize off
target effects. We custom ordered Alt-R CRIPSR-Cas9 sgRNA,2nmol sgRNA’s from IDT. We
designed 4 guides, one targeting exon 2, 2 targeting exon3 and one targeting exon6 of B-
catenin. Their sequences are below:
Ctnnb1_sgRNA1-exon2 ATGAGCAGCGTCAAACTGCG
Ctnnb1_sgRNA3-exon3 AGCCAAGCGCTGGACATTAG
Ctnnb1_sgRNA5-exon3 AGCTACTTGCTCTTGCGTGA
Ctnnb1_sgRNA6-exon6 GAGATTATGCAGTGTCGTGA

Other sgRNA’s were ordered from synthego and were reconstituted at 100 pmol/uL in TE buffer
and stored at -20C. gRNA concentration for the knockout experiments was 7.5 pmol/well in total
for a 24-well plate. We used 1. 875 pmol/guide/well in case of quadruple KOs, 2.5
pmol/guide/well for triple KOs. We labelled the cells with fluorescent mCherry by transfecting
500 ng/well mRNA.
133

Cdh3 5' CCGAUGAAGCCCGCUCGGUA 3'
Cdh2 UUACAGCGCAGUCUUACCGA
Cdh11 CACCAGCACAGGGUCAGGCC
Cdh4 CCAUCCCCAGGCCCACCGUG
Ctnna1 CAACAGAUGCAGCCAAAACA
GFP GAGCUGGACGGCGACGUAAA
Ctnnb1 UGUUUUUACAGCUGACCUGA
Ctnnb1 GUUGGACAUGGCCAUGGAGC
Ctnnb1 GAAAAGCUGCUGUCAGCCAC
Ctnnb1 CUGUGGUGGUGGCACCAGAA

FACS sorting mRNA isolation
Prior to FACS sorting NPCs were rinsed once with PBS, then incubated with trypsin for 5 min in
the incubator at 37 degrees Celsius. Reaction was quenched with 10% FBS in Automacs buffer.
NPCs were we pelleted and washed once with Automacs buffer before resuspending Automacs
with in DAPI (dead cell dye DAPI (4',6-Diamidino-2-Phenylindole, Dilactate, 422801, BioLegend
) and DRAQ5 ( DRAQ5™ Live cell dye, NBP2-81125-50ul, NOVUS). 60,000 to 150,000
mCherry+ NPCs were sorted on BD SORP FACS Aria IIu into RLT buffer with 1:100 beta-
mercaptoethanol prior to RNA isolation. RNA-seq
Total RNA integrity was determined using Agilent Bioanalyzer or 4200 Tapestation. Library
preparation was performed with 10ng of total RNA with a Bioanalyzer RIN score greater than
134

8.0. ds-cDNA was prepared using the SMARTer Ultra Low RNA kit for Illumina Sequencing
(Takara-Clontech) per manufacturer's protocol. cDNA was fragmented using a Covaris E220
sonicator using peak incident power 18, duty factor 20%, cycles per burst 50 for 120 seconds.
cDNA was blunt ended, had an A base added to the 3' ends, and then had Illumina sequencing
adapters ligated to the ends. Ligated fragments were then amplified for 12-15 cycles using
primers incorporating unique dual index tags. Fragments were sequenced on an Illumina
NovaSeq-6000 using paired end reads extending 150 bases.
Basecalls and demultiplexing were performed with Illumina’s bcl2fastq2 software. RNA-seq
reads were then aligned to the combined mouse GRCm38 and human GRCh38 Ensembl
release 76 primary assemblies with STAR version 2.5.1a1. Gene counts were derived from the
number of uniquely aligned unambiguous reads by Subread:featureCount version 1.4.6-p52.
Isoform expression of known Ensembl transcripts were estimated with Salmon version 0.8.23.
Sequencing performance was assessed for the total number of aligned reads, total number of
uniquely aligned reads, and features detected. The ribosomal fraction, known junction
saturation, and read distribution over known gene models were quantified with RSeQC version
2.6.24.
Normalized counts tables were ran through DeSEQ2 (Love, 2014 #412) to create differential
gene expression tables with Log2Fc cut offs no less than 1 and p-adjusted values no greater
than 0.05. Significance of Cre and Cas9 intersected gene lists was calculated with
hypergeometric function in R. Differential expression tables were passed through Gene
Ontology package clusterProfiler (Yu, 2012 #413). Data was visualized using ggplot and
Complex heatmap functions in R (Gu, 2016 #414). Benjamini-Hochberg correction (False
Discovery Rate) applied as well as significance associated with intersections compared to all
genes expressed with gene normalized counts greater than or equal to 10 using hypergeometric
test.
135

Sc-RNA-seq analysis
FeaturePlot function in mouse post-neonatal day0 (P0) nephrogenic-lineage cells from
unpublished kidney single-cell data (McMahon lab). We used Seurat analysis to characterize
kidney cell types and create feature and dot plots (Hao, Hao et al.).
Antibodies
Anti-mP-Cadherin (Cdh3), goat IgG, AF761, R&D Systems
Scigen, tdTomato, goat AB, AB8181-200, 1:2000
RFP, 1:4000, Rockland, 600-401-379
Cdh2, BD Transduction Laboratories, 1:100, 610920
CDH11 Monoclonal Antibody (5B2H5), 32-1700, ThermoFisher Scientific, 1:100, monoclonal
mouse IgG1 kappa
Ctnna1 alpha-CAT-7A4, 1:250, 13-9700, ThermoFisher Scientific, monoclonal mouse IgG1
kappaLef1 (C12A5), rabbit, 1:200, 2230S, Cell Signaling Technology
Active Beta catenin S33/S37/T41, rabbit, 1:500, 8814S, Cell Signaling Technology
GFP 1:500, chicken, GFP-1020, Aves labs
Jagged 1, polyclonal goat IgG, AF599 R&D Systems
Cdh4, AF6677, Sheep IgG, 1:100?
GM130

Definition of clusters (include this with the Imaris quantification part)
136

A cluster within the aggregates for the Cdh2+4+11 KO was defined based on the following
criteria: 1) at least five transfected cells were adjacent to each other 2) maximum one non-
transfected cell were included in this cluster 2) the cluster was surrounded by non-transfected
cells entirely and/or it was at the edge of an aggregate. Clusters have been manually counted
and annotated in Imaris.
References:
Aberle, H., S. Butz, J. Stappert, H. Weissig, R. Kemler and H. Hoschuetzky (1994). "Assembly
of the cadherin-catenin complex in vitro with recombinant proteins." J Cell Sci 107 ( Pt 12):
3655-3663.

Brault, V., R. Moore, S. Kutsch, M. Ishibashi, D. H. Rowitch, A. P. McMahon, L. Sommer, O.
Boussadia and R. Kemler (2001). "Inactivation of the beta-catenin gene by Wnt1-Cre-mediated
deletion results in dramatic brain malformation and failure of craniofacial development."
Development 128(8): 1253-1264.

Brown, A. C., S. D. Muthukrishnan and L. Oxburgh (2015). "A synthetic niche for nephron
progenitor cells." Dev Cell 34(2): 229-241.

Butz, S. and R. Kemler (1994). "Distinct cadherin-catenin complexes in Ca(2+)-dependent cell-
cell adhesion." FEBS Lett 355(2): 195-200.

Chi, X., A. K. Hadjantonakis, Z. Wu, D. Hyink and F. Costantini (2009). "A transgenic mouse
that reveals cell shape and arrangement during ureteric bud branching." Genesis 47(2): 61-66.

Cho, E. A., L. T. Patterson, W. T. Brookhiser, S. Mah, C. Kintner and G. R. Dressler (1998).
"Differential expression and function of cadherin-6 during renal epithelium development."
Development 125(5): 803-812.

Clevers, H. and R. Nusse (2012). "Wnt/beta-catenin signaling and disease." Cell 149(6): 1192-
1205.

Combes, A. N., J. G. Lefevre, S. Wilson, N. A. Hamilton and M. H. Little (2016). "Cap
mesenchyme cell swarming during kidney development is influenced by attraction, repulsion,
and adhesion to the ureteric tip." Dev Biol 418(2): 297-306.

Dahl, U., A. Sjödin, L. Larue, G. L. Radice, S. Cajander, M. Takeichi, R. Kemler and H. Semb
(2002). "Genetic dissection of cadherin function during nephrogenesis." Mol Cell Biol 22(5):
1474-1487.

Fukata, M. and K. Kaibuchi (2001). "Rho-family GTPases in cadherin-mediated cell-cell
adhesion." Nat Rev Mol Cell Biol 2(12): 887-897.

137

Glykofrydis, F., E. Cachat, I. Berzanskyte, E. Dzierzak and J. A. Davies (2021). "Bioengineering
Self-Organizing Signaling Centers to Control Embryoid Body Pattern Elaboration." ACS
Synthetic Biology 10(6): 1465-1480.

Goto, S., H. Yaoita E Fau - Matsunami, D. Matsunami H Fau - Kondo, T. Kondo D Fau -
Yamamoto, K. Yamamoto T Fau - Kawasaki, M. Kawasaki K Fau - Arakawa, I. Arakawa M Fau -
Kihara and I. Kihara "Involvement of R-cadherin in the early stage of glomerulogenesis." (1046-
6673 (Print)).

Gumbiner, B. M. (1996). "Cell adhesion: the molecular basis of tissue architecture and
morphogenesis." Cell 84(3): 345-357.

Guo, Q., A. Kim, B. Li, A. Ransick, H. Bugacov, X. Chen, N. Lindström, A. Brown, L. Oxburgh,
B. Ren and A. P. McMahon (2021). "A β-catenin-driven switch in TCF/LEF transcription factor
binding to DNA target sites promotes commitment of mammalian nephron progenitor cells."
eLife 10: e64444.

Hao, Y., S. Hao, E. Andersen-Nissen, W. M. Mauck, 3rd, S. Zheng, A. Butler, M. J. Lee, A. J.
Wilk, C. Darby, M. Zager, P. Hoffman, M. Stoeckius, E. Papalexi, E. P. Mimitou, J. Jain, A.
Srivastava, T. Stuart, L. M. Fleming, B. Yeung, A. J. Rogers, J. M. McElrath, C. A. Blish, R.
Gottardo, P. Smibert and R. Satija "Integrated analysis of multimodal single-cell data." (1097-
4172 (Electronic)).

Hinck, L., I. S. Näthke, J. Papkoff and W. J. Nelson (1994). "Dynamics of cadherin/catenin
complex formation: novel protein interactions and pathways of complex assembly." J Cell Biol
125(6): 1327-1340.

Kim, S. A., C. Y. Tai, L. P. Mok, E. A. Mosser and E. M. Schuman (2011). "Calcium-dependent
dynamics of cadherin interactions at cell-cell junctions." Proc Natl Acad Sci U S A 108(24):
9857-9862.

Kobayashi, A., M. T. Valerius, J. W. Mugford, T. J. Carroll, M. Self, G. Oliver and A. P.
McMahon (2008). "Six2 defines and regulates a multipotent self-renewing nephron progenitor
population throughout mammalian kidney development." Cell Stem Cell 3(2): 169-181.

Lawlor, K. T., L. Zappia, J. Lefevre, J. S. Park, N. A. Hamilton, A. Oshlack, M. H. Little and A. N.
Combes (2019). "Nephron progenitor commitment is a stochastic process influenced by cell
migration." Elife 8.

Leckband, D. E. and J. de Rooij (2014). "Cadherin adhesion and mechanotransduction." Annu
Rev Cell Dev Biol 30: 291-315.

Lindstrom, N. O., G. De Sena Brandine, T. Tran, A. Ransick, G. Suh, J. Guo, A. D. Kim, R. K.
Parvez, S. W. Ruffins, E. A. Rutledge, M. E. Thornton, B. Grubbs, J. A. McMahon, A. D. Smith
and A. P. McMahon (2018). "Progressive Recruitment of Mesenchymal Progenitors Reveals a
Time-Dependent Process of Cell Fate Acquisition in Mouse and Human Nephrogenesis." Dev
Cell 45(5): 651-660 e654.

Louro, R., H. I. Nakaya, A. C. M. Paquola, E. A. L. Martins, A. M. d. Silva, S. Verjovski-Almeida
and E. M. Reis (2004). "RASL11A, member of a novel small monomeric GTPase gene family, is
138

down-regulated in prostate tumors." Biochemical and Biophysical Research Communications
316(3): 618-627.

Madisen, L., T. A. Zwingman, S. M. Sunkin, S. W. Oh, H. A. Zariwala, H. Gu, L. L. Ng, R. D.
Palmiter, M. J. Hawrylycz, A. R. Jones, E. S. Lein and H. Zeng (2010). "A robust and high-
throughput Cre reporting and characterization system for the whole mouse brain." Nat Neurosci
13(1): 133-140.

Mah, S. P., H. Saueressig, M. Goulding, C. Kintner and G. R. Dressler (2000). "Kidney
development in cadherin-6 mutants: delayed mesenchyme-to-epithelial conversion and loss of
nephrons." Dev Biol 223(1): 38-53.

Marable, S. S., E. Chung and J.-S. Park (2020). "Hnf4a is required for the
development of Cdh6-expressing progenitors into proximal tubules in the mouse kidney."
bioRxiv: 2020.2002.2016.951731.

Martz, C. A., K. A. Ottina, K. R. Singleton, J. S. Jasper, S. E. Wardell, A. Peraza-Penton, G. R.
Anderson, P. S. Winter, T. Wang, H. M. Alley, L. N. Kwong, Z. A. Cooper, M. Tetzlaff, P. L.
Chen, J. C. Rathmell, K. T. Flaherty, J. A. Wargo, D. P. McDonnell, D. M. Sabatini and K. C.
Wood "Systematic identification of signaling pathways with potential to confer anticancer drug
resistance." (1937-9145 (Electronic)).

McMahon, A. P. (2016). "Development of the Mammalian Kidney." Curr Top Dev Biol 117: 31-
64.

Merrill, B. J., U. Gat, R. DasGupta and E. Fuchs (2001). "Tcf3 and Lef1 regulate lineage
differentiation of multipotent stem cells in skin." Genes Dev 15(13): 1688-1705.

Morizane, R. and J. V. Bonventre (2017). "Kidney Organoids: A Translational Journey." Trends
Mol Med 23(3): 246-263.

Muzumdar, M. D., B. Tasic, K. Miyamichi, L. Li and L. Luo (2007). "A global double-fluorescent
Cre reporter mouse." Genesis 45(9): 593-605.

Nagafuchi, A. and M. Takeichi (1988). "Cell binding function of E-cadherin is regulated by the
cytoplasmic domain." Embo j 7(12): 3679-3684.

Nelson, W. J. and R. Nusse (2004). "Convergence of Wnt, beta-catenin, and cadherin
pathways." Science 303(5663): 1483-1487.

Niessen, C. M., D. Leckband and A. S. Yap (2011). "Tissue organization by cadherin adhesion
molecules: dynamic molecular and cellular mechanisms of morphogenetic regulation." Physiol
Rev 91(2): 691-731.

Nishinakamura, R. (2019). "Human kidney organoids: progress and remaining challenges."
Nature Reviews Nephrology 15(10): 613-624.

Ozawa, M., H. Baribault and R. Kemler (1989). "The cytoplasmic domain of the cell adhesion
molecule uvomorulin associates with three independent proteins structurally related in different
species." Embo j 8(6): 1711-1717.
139

Park, J. S., W. Ma, L. L. O'Brien, E. Chung, J. J. Guo, J. G. Cheng, M. T. Valerius, J. A.
McMahon, W. H. Wong and A. P. McMahon (2012). "Six2 and Wnt regulate self-renewal and
commitment of nephron progenitors through shared gene regulatory networks." Dev Cell 23(3):
637-651.

Platt, R. J., S. Chen, Y. Zhou, M. J. Yim, L. Swiech, H. R. Kempton, J. E. Dahlman, O. Parnas,
T. M. Eisenhaure, M. Jovanovic, D. B. Graham, S. Jhunjhunwala, M. Heidenreich, R. J. Xavier,
R. Langer, D. G. Anderson, N. Hacohen, A. Regev, G. Feng, P. A. Sharp and F. Zhang (2014).
"CRISPR-Cas9 knockin mice for genome editing and cancer modeling." Cell 159(2): 440-455.

Ransick, A., N. O. Lindstrom, J. Liu, Q. Zhu, J. J. Guo, G. F. Alvarado, A. D. Kim, H. G. Black, J.
Kim and A. P. McMahon (2019). "Single-Cell Profiling Reveals Sex, Lineage, and Regional
Diversity in the Mouse Kidney." Dev Cell 51(3): 399-413 e397.

Reynolds, A. B., J. Daniel, P. D. McCrea, M. J. Wheelock, J. Wu and Z. Zhang (1994).
"Identification of a new catenin: the tyrosine kinase substrate p120cas associates with E-
cadherin complexes." Mol Cell Biol 14(12): 8333-8342.

Schnell, J., M. Achieng and N. O. Lindstrom (2022). "Principles of human and mouse nephron
development." Nat Rev Nephrol 18(10): 628-642.

Self, M., O. V. Lagutin, B. Bowling, J. Hendrix, Y. Cai, G. R. Dressler and G. Oliver (2006). "Six2
is required for suppression of nephrogenesis and progenitor renewal in the developing kidney."
EMBO J 25(21): 5214-5228.

Shibamoto, S., M. Hayakawa, K. Takeuchi, T. Hori, K. Miyazawa, N. Kitamura, K. R. Johnson,
M. J. Wheelock, N. Matsuyoshi, M. Takeichi and et al. (1995). "Association of p120, a tyrosine
kinase substrate, with E-cadherin/catenin complexes." J Cell Biol 128(5): 949-957.

Stark, K., S. Vainio, G. Vassileva and A. P. McMahon (1994). "Epithelial transformation of
metanephric mesenchyme in the developing kidney regulated by Wnt-4." Nature 372(6507):
679-683.

Takeichi, M. (1993). "Cadherins in cancer: implications for invasion and metastasis." Current
Opinion in Cell Biology 5(5): 806-811.

Tanigawa, S., H. Wang, Y. Yang, N. Sharma, N. Tarasova, R. Ajima, T. P. Yamaguchi, L. G.
Rodriguez and A. O. Perantoni (2011). "Wnt4 induces nephronic tubules in metanephric
mesenchyme by a non-canonical mechanism." Dev Biol 352(1): 58-69.

Tsai, T. Y., M. Sikora, P. Xia, T. Colak-Champollion, H. Knaut, C. P. Heisenberg and S. G.
Megason (2020). "An adhesion code ensures robust pattern formation during tissue
morphogenesis." Science 370(6512): 113-116.

Vivante, A., S. Kohl, D. Y. Hwang, G. C. Dworschak and F. Hildebrandt (2014). "Single-gene
causes of congenital anomalies of the kidney and urinary tract (CAKUT) in humans." Pediatr
Nephrol 29(4): 695-704.

140

Chapter 4: Discussion
Discussion:
Wnt/ β-catenin signaling is a deeply conserved and important signaling pathway regulating a
variety of cellular activities in developing and adult metazoans. My studies on pathway activity
have focused on the kidney, in particular the role of canonical (β-catenin dependent and
transcriptional based)(Park, Valerius et al. 2007, Park, Ma et al. 2012) in the regulation of
NPCs. A variety of in vivo genetic studies in the mammalian embryo linked canonical Wnt-
signaling to seemingly opposite functions in the nephrogenic program: maintenance and
expansion of the NPC population, and the induction of NPCs and their commitment to an active
program of nephrogenesis. While these observations could be rationalized by varying levels of
the key Wnt-ligand Wnt9b, intrinsic difficulties inherent in in vivo analysis may confound a clear
understanding.
Consequently, my studies focused on the application of an in vitro model of mammalian NPC
culture under defined conditions, developing approaches to precisely modify gene activity to
“pick apart” the Wnt signaling action. The key findings demonstrate β-catenin’s transcriptional
activity, in conjunction with Lef/Tcf DNA binding partners, is confined to the induction of the
nephrogenic program. Though there appears to be a role for β-catenin in the normal
proliferation of NPCs, here, β-catenin acts through a non-transcriptional mechanism, the nature
of which is unclear. Further, β-catenin’s dual role in transcription and as a critical component of
cadherin complexes in cell adhesion, come together in the inductive program, driving the
aggregation of NPCs, in the initial step of the mesenchymal to epithelial transition central to
generating the epithelial anlagen of the nephron, the renal vesicle.
Decades of work from various prominent groups in the kidney development field such as the
McMahon and Carroll laboratories have argued for β-catenin’s role in regulating the
141

maintenance, expansion of NPCs and induction of NPCs (Karner, Das et al. 2011). However,
how the same signaling output leads to a varied response has been unclear. The in vitro
observation that a low CHIR concentration is required to maintain and expand primary NPCs
while high levels induce them informs an in vivo speculation that there exists a Wnt9b gradient
along the UB and that a concentration of a Wnt9b pulse differentiates the opposing cell fate
outcomes of self-renewal and induction (Brown, Muthukrishnan et al. 2015, Guo, Kim et al.
2021).
The reductionist approach presented in this study has enabled the study of the effects of
removing of β-catenin in early nephron development using a system that models the self-
renewal and induction of NPCs in vitro. The use of mRNA and sgRNA transfection approaches
create an efficient and reliable KO platform for removing genes of interest in a primary cell
culture
My work has characterized unique roles of β-catenin in the 1) self-renewal of NPCs 2) the
transcriptional induction of NPCs and 3) the cellular morphology changes resulting in the
mesenchymal to epithelial (MET) transition of NPCs.
The role of β-catenin in 1) self-renewal of NPCs:
Previously studied 16 genes that display Wnt9b-dependent expression based on ChiP-qPCR of
β-catenin at Cis-regulatory modules suggest that β-catenin mediates gene expression in self-
renewing NPCs (Karner, Das et al. 2011). However, only have les than half that are differentially
expressed low CHIR versus no CHIR and GO term analysis shows only changes in genes
related to cell proliferation rather than the self-renewal program of nehron progenitors (Guo, Kim
et al. 2021). These studies verify those results through changes in cell proliferation yet no
changes in self-renewal gene expression. These results a new paradigm that β-catenin
mediates proliferation non-transcriptionally in self-renewal. IP-mass spec proteomic analysis of
142

nuclear and cytoplasmic cell fractions would be required to study β-catenin’s partners in
mediating proliferation in a non-transcriptional manner.
The role of β-catenin in 2) the transcriptional induction of NPCs:
The tightly controlled events that occur in the creation of the early nephron make NPCs an ideal
system to parse out these key Wnt/ β-catenin centric mechanisms governing self-renewal and
differentiation of stem/progenitors. β-catenin is not just a component of the Wnt signal cascade
(Figure 1A) and in fact because of its essential yet seemingly independent cellular functions
(signaling and structure) independently discovered twice. β-catenin was isolated along with a-
catenin and plakoglobin as proteins that interfaced with Ca+ based cell adhesion molecule E-
cadherin (Cdh1) and were found to link cell adhering structures to cytoskeletal elements
(Ozawa, Baribault et al. 1989). Eventually, β-catenin was found to be regulated by Wnt ligands
and also have structural similarity to other catenin molecules implicating its role in both signaling
and structure (McCrea, Turck Cw Fau - Gumbiner et al. , Orsulic and Peifer , Peifer and
Wieschaus).
The removal of β-catenin in primary nephron progenitors has enabled the screening β-catenin
in early nephron development which have the potential to implicate later processes critical to
nephron patterning. We have been able to validate transcriptional targets by Transcriptional
corroborating DEG with the binding of β-catenin and Tcf/Lef factors using previously published
ChIP-Seq data in primary nephron progenitors cultured in the same system (Guo, Kim et al.
2021). Loss of gene expression up β-catenin and Tcf/Lef KO with corroborating β-catenin or
Tcf/Lef binding at Cis regulatory modules grants such a gene as a bona fide β-catenin/Tcf/Lef
target.
In this we have identified transcription factors Cux2, Bach2, Ovol1 and Emx2 are all bona fide β-
catenin/Tcf/Lef targets. Emx2 and Ovol1 have expression in the distal regions of the developing
143

nephrons validated using mouse p0 single cell RNA seq and RNA-Scope. Ovol1 and Emx2
mutant mice have phenotypes of embryonic cystic kidneys and urogenital defects respectively
with Emx2 mutants failing to upregulate Wnt4 in early nephrogenesis (Miyamoto, Yoshida et al.
1997, Teng, Nair et al. 2007).
We have created a novel Ovol1 KO animal as Ovol1 encodes a zinc finger transcriptional
repressor that is a canonical target of the LEF1/β-catenin complex (Teng, Nair et al. 2007) .
Previous reports have described a C57BL/6 stain-specific reduction in perinatal survival
of Ovol1 mutant mice. Ovol1 mutants display delayed skin barrier acquisition and kidney
epithelial cysts of embryonic onset. Cysts occur as early as E 17.5 and are massive by P25.
Moreover, expression of Ovol2 was up-regulated in Ovol1-deficient epidermis. Genetic analysis
suggests a partial functional compensation by Ovol2 for the loss of Ovol1 and previous reports
have suggested that Ovol1 represses the activity of Ovol2 promoter in a DNA binding-
dependent manner (Teng, Nair et al. 2007).
To further investigate the role of Ovol1 in kidney development we will morphologically and
molecularly characterize kidneys from our novel Ovol1 mutant animal. We will perform entire
kidney bulk-RNA seq on mutant kidneys with the expectation that Ovol1 mutants will have an
increase in Ovol2 and genes related to cystogenesis as well as a loss of genes related to the
distal programming of the developing nephron. We will also derive primary nephron progenitors
from our Ovol1 mutant and characterize their induction potential with the expectation that NPCs
will possibly express less distal markers when cultured in high CHIR.
The role of β-catenin in 3) the cellular morphology changes resulting in the mesenchymal
to epithelial (MET) transition of NPCs:
Nephron formation utilizes both the structural and signaling component of β-catenin coupled
with a canonical Wnt input (Paper1, Paper2) (Park, Valerius et al. 2007, Park, Ma et al. 2012,
144

Combes, Lefevre et al. 2016). To model the cellular dynamics (cell movements and adhesion)
and well as transcriptional changes coupled with cell state changes of self-renewing and
differentiating NPCs in a genetically manipulable system, we took advantage of a culture
protocol to maintain and differentiate NPCs in vitro (Brown, Muthukrishnan et al. 2015).
Removing β-catenin from primary NPCs cultures in NPEM implicates β-catenin in as having a
critical role in signaling and cellular structure during the induction of NPCs. The removal of β-
catenin in this study couples the phenomena of a transcriptional response resulting from Wnt
signaling with a morphological response that yields a MET and puts β-catenin as a key mediator
of both processes. β-catenin removal in high Wnt input conditions reduced NPCs ability to
differentiate and highlighted the role of β-catenin in cell adhesion as β-catenin KO cells were
excluded from aggregates. Lack of changes in cell size upon induction suggest that β-catenin
couples a transcriptional response as well as a cell morphology/ cell- adhesion/ cell
reorganization response in response to a high Wnt input and is mediated by β-catenin.
A MET driven cell morphology change and partnered with wnt target genes changes is not
unique to nephrogenesis. NPCs in the self-renewing state are highly mobile and less adherent
cells and express “pre-existing” cadherins. Upon increasing of Wnt activity, NPCs are inducted
and express de novo cadherins that enable cellular aggregation. Simultaneous removal of
Cadherins present at the cell membrane of NPCs in our culture disables cellular aggregation, a
similar response to that of β-catenin removal. However, Cadherin and alpha catenin removal
does not disable transcriptional induction suggesting that transcriptional
145

induction and cellular morphology changes are centered around β-catenin but are not
dependent on each other.
To mechanistically dissect the role of β-catenin in mediating a Wnt signaling response and a cell
morphology change it would be appropriate to take advantage of the rapid inactivation of β-
catenin using CRISPR/Cas9 gene
editing and over express mutant
forms of β-catenin using pre-
established mRNA-based lipid
droplet introduction. Central to the
question of how a Wnt mediated
ligand increases the cellular
concentration of β-catenin and how
a cytoplasmic increase leads to a
nuclear as well as cellular
rearrangement response requires β-catenin mutant rescue experiments.
To distinguish the features and operations of β-catenin in various roles within a cell one could
also use proximity labeling (Yang, Meyer et al.) on identified interaction molecules such as
cadherins (Cdh2) or transcription factors (Tcf7). Labeling β-catenin locally by proximity ligation
with biotin and then tracing biotinylated proteins would enable us to understand the unique
interaction partners β-catenin has to perform unique roles within a cell in mediating proliferation,
cell adhesion and transcription.
Future experiments to mechanistically probe β-catenin’s multiple functions:
To articulate the role of β-catenin in mediating signaling and structure during the MET of
nephron progenitors one could target β-catenin using Cas9-GFP derived NPCs and add
Figure 1: Schematic representation of β-catenin-cadherin -catenin
interactions in mediating MET.

146

sgRNA’s targeting β-catenin as well as use mice with a conditional β-catenin allele and add Cre
mRNA to create a null β-catenin (Brault, Moore et al. 2001, Platt, Chen et al. 2014). Over
expression of a (F253D;F293D) or (A295W;A1296W) mutant form of β-catenin in high CHIR
conditions would result in rescuing the transcriptional target expression (upregulation of
jagged1) however would result in cells still forming part of an aggregate as the ability to interact
with cadherin complexes is maintained. Rescuing back a mutant form of β-catenin with (K312E)
or (K435E) mutants would yield similar results as a β-catenin mutant as the ability to interact
with cadherins and Tcf/Lef transcription factors would be impaired. However, we would expect
the same result as α-catenin removal in NPCs f cells losing aggregation potential however still
expressing Jagged1 upon (T120A) and (T122A) mutations.
Overexpression of mutant forms of β-catenin using primary nephron progenitors could enable us
to molecularly distinguish how β-catenin mediates signaling responses and cellular
rearrangements during organ
morphogenesis.
Crystal structures of β-catenin-Tcf3 (Tcf7l1)
have identified key residues essential for β-
catenin Tcf/Lef interaction as well as residues
affecting β-catenin Cadherin interactions
(Graham, Weaver et al. 2000) (Figure). β-
catenin interacts with cadherins and Tcf/Lef
transcription factors via its middle armadillo
domain (Valenta, Hausmann et al. 2012).
Mutation of Tcf/ β-catenin interaction
domains (K312E, K435E) disturb
β-catenin/Tcf binding and β-
Figure 2: Schematic representation of β-catenin point mutations
affecting Tcf/Lef, α-catenin, cadherin interactions.

147

catenin/c-cadherin interactions. However, F253D;F293D and A295W;A1296W double mutants
disrupt β-catenin/Tcf interactions while keeping β-catenin/Cadherin interactions intact
suggesting that distinct residues within the armadillo domain can be used to distinguish β-
catenin/cadherin interactions and β-catenin/Tcf interactions.
β-catenin also interfaces with α-catenin though its armadillo domain; however, mutations to
T120 and V122 residues to Alanine within this domain have been able to interfere with α-catenin
while enabling Axin2 and other Wnt target gene activity and disturb the differentiation of
myoblasts (Cui, Li et al. 2019). Interestingly β-catenin-α-catenin interaction may also be
involved in the pro-proliferative functions of Wnt/β-catenin in satellite cells were a loss in α-
catenin- β-catenin interactions concomitant with removal of cadherin binding resulted in a break
in quiescence of satellite cells by increasing free total cytoplasmic β-catenin and increasing
nuclear β-catenin/TCF complexes and therefore activating Wnt target gene expression (Goel,
Rieder et al. 2017).
In sum, the results of this body of work have created a novel platform to molecularly
characterize the initiation of induction in nephrogenesis. Although we have come to a deeper
understanding of the role of Wnt/β-catenin signaling in coupling the transcriptional induction and
the cell morphology changes at the outset of nephrogenesis, this study has opened a vast area
with a rigorous, efficient and rapid hypothesis testing platform for further exploration of the
mechanism of β-catenin and its targets.
Comparison of Wnt/B-catenin actions in other mammalian stem/progenitor cell systems:
The work provided in this thesis utilizing bulk isolation of primary NPCs provides a powerful
model for deepening a mechanistic understanding of the regulatory processes balancing
maintenance, expansion, commitment, and responsiveness to Wnt input that extend beyond the
nephron progenitor because of the broad range of activities that Wnt/β-catenin signaling has in
148

regulating adult stem and progenitor populations in metazoans. The power of this platform not
only lies in the use of a primary cell culture with an indefinite supply of cells but also in the
power to introduce mRNAs of choice and a rigorous, efficient and rapid use of mRNA and
sgRNA transfection. This approach enables a reliable KO platform for investigating genes of
interest while utilizing a robust primary progenitor/stem cell modeling platform that adequately
models self-renewal and induction.
The use of bulk isolation of primary nephron progenitor cells which facilitates the culture of a
larger number of NPCs and is only limited by mouse availability is unique (Brown,
Muthukrishnan et al. 2015). Other well characterized stem/progenitor systems that rely on Wnt
instinctive cues like the intestinal stem cells (iSC) and hair follicle stem cells (HFSC) the have
primary 2D culture systems. The iSC system has a variety of primary organoid cultures that
enable investigation and primary duodenum 2D culture systems that could employ the same
methods as the work presented in this thesis and remove gene activity using a Cas9 expressing
animal (Graves, Harden et al. 2014) (Platt, Chen et al. 2014, Heo and Clevers 2015). The iSC
field mostly employs a 3D organoid culture system which uses a laminin-rich 3D matrix which
fosters an environment that enables rapid proliferation. On the other hand, iSC 2-dimensional
(2D) colonies consists mostly of clonogenic stem cells. Here, colonies of intestinal stem cells
retain self-renewal capability and maintain genomic stability after many passages. However,
primary iSCs are only able to differentiate under specific air-liquid interface conditions. An
advantage of the primary NPCs culture system used in this thesis is that one can induce
differentiation by only a simple increase in a 4-fold concentration of CHIR in culture (Graves,
Harden et al. 2014).
In the hair follicle system, rock inhibitor has been used to examine the potential to culture
primary HFSCs. (Wen, Miao et al. 2021). In this cells were able to remain in a self-renewal like
state however, transplantation back into an animal graft was required to induce differentiation
149

suggesting that there is not an effective 2D self-renewal and induction in vitro model that would
enable the investigation of the wnt mediated self-renewal and induction of primary HFSCs
(Wen, Miao et al. 2021). Recent advancements have generated hair follicles using
reprogramming of cell microenvironments enabling the investigation of developmental
mechanisms involved in hair follicle morphogenesis and pigmentation (Kageyama, Shimizu et
al. 2022). However, this system is in 3D which makes introduction of CRISPR/Cas9 editing
components more challenging. The HFSC system is transcriptionally similar to the NPC as
Tcf7l1 and Tcf7l2 are expressed in the quiescent Wnt (inactive or low) state and upon a
canonical Wnt input express “activating” Tcf7 and Lef1 and cells transition to a more induced
and highly proliferative state (Merrill, Gat et al. 2001, Lien and Fuchs 2014, Lien, Polak et al.
2014, Guo, Kim et al. 2021).
Concluding remarks:
The idea that there exist two distinct pools of β-catenin has been debated over decades within
the Wnt community (Valenta, Hausmann et al. 2012), distinct molecular forms of β-catenin have
been shown to have unique roles in the nucleus and at the cell membrane mediating
transcription and cell adhesion respectively (Gottardi and Gumbiner 2004). The observation that
β-catenin removal leads to a lack of aggregation and lack of induction status while the removal
of cadherins and α-catenin only results in lack of aggregation while maintaining an induction
status suggest that there may be two distinct pools of β-catenin within the cell. At the
membrane, β-catenin may turn over more rapidly because of this may result in the lack of
aggregation demonstrated from the removal of cell adhesion complexes, get the pool of β-
catenin in the nucleus may be safe from destruction and therefore maintain an induction
signature. If there were one pool of β-catenin, the loss of cadherins and α-catenin would require
some β-catenin to exit the nucleus and compensate for the loss of adhesion molecules leading
to a decrease in Jagged1. However, Jagged1 expression persists in cadherin and α-catenin
150

mutants possibly through a protected pool of nuclear β-catenin. Nuclear and cytoplasmic
fractioning of cadherins and α-catenin mutants probing for β-catenin protein using proteomics
would enable a mechanistic understanding of the β-catenin pools.
The power the primary NPC platform lies in the indefinite supply of cells from mice, which
enables the use of transgenic mice models. The 2D culture enables the introduction of rapid
mRNA and sgRNA transfection in a system that models Wnt supported self-renewal and
induction. Understanding the transcriptional outputs of β-catenin has therapeutic potential and
will improve kidney organoid cultures. Moreover, Wnt signaling plays a key role directing stem
cell/progenitor populations in many organ systems. Problems in the interactions of β-catenin
with Tcf factors, cadherins and other components of the Wnt pathway drives a number of
cancers (Clevers and Nusse 2012). Therefore, although this body of work has shed light into the
transcriptional programming and requirements of β-catenin for cellular rearrangements
necessary at the outset of nephrogenesis, our findings are likely to have broader significance by
gaining a deeper mechanistic understanding of the key Wnt signaling effector β-catenin
(Clevers, Loh et al. 2014), thus enhancing our knowledge about the development, maintenance
potential through adult stem cell populations and repair of other organ systems, and to cancer.

151

References:
Angers, S. and R. T. Moon (2009). "Proximal events in Wnt signal transduction." Nat Rev Mol
Cell Biol 10(7): 468-477.

Brault, V., R. Moore, S. Kutsch, M. Ishibashi, D. H. Rowitch, A. P. McMahon, L. Sommer, O.
Boussadia and R. Kemler (2001). "Inactivation of the beta-catenin gene by Wnt1-Cre-mediated
deletion results in dramatic brain malformation and failure of craniofacial development."
Development 128(8): 1253-1264.

Brown, A. C., S. D. Muthukrishnan and L. Oxburgh (2015). "A synthetic niche for nephron
progenitor cells." Dev Cell 34(2): 229-241.

Carroll, T. J., J. S. Park, S. Hayashi, A. Majumdar and A. P. McMahon (2005). "Wnt9b plays a
central role in the regulation of mesenchymal to epithelial transitions underlying organogenesis
of the mammalian urogenital system." Dev Cell 9(2): 283-292.

Clevers, H., K. M. Loh and R. Nusse (2014). "Stem cell signaling. An integral program for tissue
renewal and regeneration: Wnt signaling and stem cell control." Science 346(6205): 1248012.

Clevers, H. and R. Nusse (2012). "Wnt/beta-catenin signaling and disease." Cell 149(6): 1192-
1205.

Combes, A. N., J. G. Lefevre, S. Wilson, N. A. Hamilton and M. H. Little (2016). "Cap
mesenchyme cell swarming during kidney development is influenced by attraction, repulsion,
and adhesion to the ureteric tip." Dev Biol 418(2): 297-306.

Cui, S., L. Li, R. T. Yu, M. Downes, R. M. Evans, J.-A. Hulin, H. P. Makarenkova and R. Meech
(2019). "β-Catenin is essential for differentiation of primary myoblasts via cooperation with
MyoD and α-catenin." Development (Cambridge, England) 146(6): dev167080.

De, A. "Wnt/Ca2+ signaling pathway: a brief overview." (1745-7270 (Electronic)).
Gehart, H. and H. Clevers (2019). "Tales from the crypt: new insights into intestinal stem cells."
Nat Rev Gastroenterol Hepatol 16(1): 19-34.

Goel, A. J., M.-K. Rieder, H.-H. Arnold, G. L. Radice and R. S. Krauss (2017). "Niche Cadherins
Control the Quiescence-to-Activation Transition in Muscle Stem Cells." Cell reports 21(8): 2236-
2250.

Graham, T. A., C. Weaver, F. Mao, D. Kimelman and W. Xu (2000). "Crystal Structure of a
β-Catenin/Tcf Complex." Cell 103(6): 885-896.

Graves, C. L., S. W. Harden, M. LaPato, M. Nelson, B. Amador, H. Sorenson, C. J. Frazier and
S. M. Wallet (2014). "A method for high purity intestinal epithelial cell culture from adult human
and murine tissues for the investigation of innate immune function." Journal of immunological
methods 414: 20-31.

Guo, Q., A. Kim, B. Li, A. Ransick, H. Bugacov, X. Chen, N. Lindström, A. Brown, L. Oxburgh,
B. Ren and A. P. McMahon (2021). "A β-catenin-driven switch in TCF/LEF transcription factor
binding to DNA target sites promotes commitment of mammalian nephron progenitor cells."
eLife 10: e64444.
152

Heo, I. and H. Clevers (2015). "Expanding intestinal stem cells in culture." Cell research 25(9):
995-996.

Kageyama, T., A. Shimizu, R. Anakama, R. Nakajima, K. Suzuki, Y. Okubo and J. Fukuda
(2022). "Reprogramming of three-dimensional microenvironments for in vitro hair follicle
induction." Science Advances 8(42): eadd4603.

Karner, C. M., A. Das, Z. Ma, M. Self, C. Chen, L. Lum, G. Oliver and T. J. Carroll (2011).
"Canonical Wnt9b signaling balances progenitor cell expansion and differentiation during kidney
development." Development 138(7): 1247-1257.

Lien, W. H. and E. Fuchs (2014). "Wnt some lose some: transcriptional governance of stem
cells by Wnt/beta-catenin signaling." Genes Dev 28(14): 1517-1532.

Lien, W. H., L. Polak, M. Lin, K. Lay, D. Zheng and E. Fuchs (2014). "In vivo transcriptional
governance of hair follicle stem cells by canonical Wnt regulators." Nat Cell Biol 16(2): 179-190.

McCrea, P. D., B. Turck Cw Fau - Gumbiner and B. Gumbiner "A homolog of the armadillo
protein in Drosophila (plakoglobin) associated with E-cadherin." (0036-8075 (Print)).

McMahon, A. P. (2016). "Development of the Mammalian Kidney." Curr Top Dev Biol 117: 31-
64.

Merrill, B. J., U. Gat, R. DasGupta and E. Fuchs (2001). "Tcf3 and Lef1 regulate lineage
differentiation of multipotent stem cells in skin." Genes Dev 15(13): 1688-1705.

Miyamoto, N., M. Yoshida, S. Kuratani, I. Matsuo and S. Aizawa (1997). "Defects of urogenital
development in mice lacking Emx2." Development 124(9): 1653-1664.

Nusse, R. and H. Clevers (2017). "Wnt/beta-Catenin Signaling, Disease, and Emerging
Therapeutic Modalities." Cell 169(6): 985-999.

Orsulic, S. and M. Peifer "An in vivo structure-function study of armadillo, the beta-catenin
homologue, reveals both separate and overlapping regions of the protein required for cell
adhesion and for wingless signaling." (0021-9525 (Print)).

Ozawa, M., H. Baribault and R. Kemler (1989). "The cytoplasmic domain of the cell adhesion
molecule uvomorulin associates with three independent proteins structurally related in different
species." Embo j 8(6): 1711-1717.

Park, J. S., W. Ma, L. L. O'Brien, E. Chung, J. J. Guo, J. G. Cheng, M. T. Valerius, J. A.
McMahon, W. H. Wong and A. P. McMahon (2012). "Six2 and Wnt regulate self-renewal and
commitment of nephron progenitors through shared gene regulatory networks." Dev Cell 23(3):
637-651.

Park, J. S., M. T. Valerius and A. P. McMahon (2007). "Wnt/beta-catenin signaling regulates
nephron induction during mouse kidney development." Development 134(13): 2533-2539.

Peifer, M. and E. Wieschaus "The segment polarity gene armadillo encodes a functionally
modular protein that is the Drosophila homolog of human plakoglobin." (0092-8674 (Print)).
153

Platt, R. J., S. Chen, Y. Zhou, M. J. Yim, L. Swiech, H. R. Kempton, J. E. Dahlman, O. Parnas,
T. M. Eisenhaure, M. Jovanovic, D. B. Graham, S. Jhunjhunwala, M. Heidenreich, R. J. Xavier,
R. Langer, D. G. Anderson, N. Hacohen, A. Regev, G. Feng, P. A. Sharp and F. Zhang (2014).
"CRISPR-Cas9 knockin mice for genome editing and cancer modeling." Cell 159(2): 440-455.

Teng, A., M. Nair, J. Wells, J. A. Segre and X. Dai (2007). "Strain-dependent perinatal lethality
of Ovol1-deficient mice and identification of Ovol2 as a downstream target of Ovol1 in skin
epidermis." Biochim Biophys Acta 1772(1): 89-95.

Valenta, T., G. Hausmann and K. Basler (2012). "The many faces and functions of beta-
catenin." EMBO J 31(12): 2714-2736.

van Amerongen, R., A. Mikels and R. Nusse (2008). "Alternative Wnt Signaling Is Initiated by
Distinct Receptors." Science Signaling 1(35): re9-re9.

Wang, Y., C. J. Zhou and Y. Liu (2018). Chapter Six - Wnt Signaling in Kidney Development
and Disease. Progress in Molecular Biology and Translational Science. J. Larraín and G.
Olivares, Academic Press. 153: 181-207.

Wen, L., Y. Miao, Z. Fan, J. Zhang, Y. Guo, D. Dai, J. Huang, Z. Liu, R. Chen and Z. Hu (2021).
"Establishment of an Efficient Primary Culture System for Human Hair Follicle Stem Cells Using
the Rho-Associated Protein Kinase Inhibitor Y-27632." Front Cell Dev Biol 9: 632882.

Yang, R. A.-O., A. A.-O. Meyer, I. A.-O. Droujinine, N. D. Udeshi, Y. Hu, J. Guo, J. A. McMahon,
D. K. Carey, C. Xu, Q. Fang, J. Sha, S. Qin, D. Rocco, J. Wohlschlegel, A. Y. Ting, S. A. Carr,
N. Perrimon and A. A.-O. McMahon "A genetic model for in vivo proximity labelling of the
mammalian secretome." (2046-2441 (Electronic)).

Ying, Q. L., J. Wray, J. Nichols, L. Batlle-Morera, B. Doble, J. Woodgett, P. Cohen and A. Smith
(2008). "The ground state of embryonic stem cell self-renewal." Nature 453(7194): 519-523.

Abstract (if available)

Abstract Wnt/β-catenin signaling is a highly conserved molecular pathway that plays a crucial role in stem/progenitor systems and cancer. β-catenin, the main Wnt pathway effector, has two pools within a cell: one for cell-cell adhesion at the membrane and the other for transcriptional functions in the nucleus. However, the mechanism by which β-catenin mediates both roles remain unclear.

The tightly controlled, well characterized system of nephrogenesis is an ideal model to decouple the roles of β-catenin at the membrane and in the nucleus. In kidney development, a delicate balance of nephron progenitor cell self-renewal and differentiation is required for the mesenchymal to epithelial transition (MET) in nephrogenesis and is driven by Wnt/β-catenin signaling. Given an ability to isolate and manipulate large numbers of NPCs in tissue culture (Brown 2015), we can dissect the dual nature of β-catenin as a transcriptional activator and component of a cell membrane complex in adhesion.

I pioneered a method using CRISPR/Cas9 gene editing to rapidly remove β-catenin, Tcf/Lef factors and simultaneous cadherin genes in primary NPCs. We have characterized the effects of modulating β-catenin and integrated RNA-seq results from β-catenin’s removal with mouse ChIP-seq and mouse single cell RNA -seq data. Functional analysis of β-catenin removal provides strong evidence for β-catenin regulation of NPC proliferation, independent of a direct Lef/Tcf associated transcriptional program. Together these data suggest β-catenin mediates aggregation, the first step in MET, through catenin cadherin cell adhesion complexes, stabilizing cell-cell contacts and transcriptional activation within these structures initiating the nephrogenic program. The studies provide new insight into the direct transcriptional role of Lef/Tcf/β-catenin complexes associated with the initiation of a nephron forming program. Overall, this study enhances an understanding of the molecular mechanisms underlying kidney development and stem/progenitor systems.

Linked assets

β-catenin couples self-renewal, induction and epithelial morphogenesis and patterning at the outset of mammalian nephrogenesis

Conceptually similar

CSV

β-catenin couples self-renewal, induction... [Chapter 2, Table 24]

CSV

β-catenin couples self-renewal, induction... [Chapter 2, Table 15]

CSV

β-catenin couples self-renewal, induction... [Chapter 2, Table 18]

CSV

β-catenin couples self-renewal, induction... [Chapter 2, Table 25]

CSV

β-catenin couples self-renewal, induction... [Chapter 2, Table 9]

CSV

β-catenin couples self-renewal, induction... [Chapter 2, Table 17]

CSV

β-catenin couples self-renewal, induction... [Chapter 2, Table 3]

CSV

β-catenin couples self-renewal, induction... [Chapter 2, Table 5]

CSV

β-catenin couples self-renewal, induction... [Chapter 2, Table 8]

CSV

β-catenin couples self-renewal, induction... [Chapter 2, Table 13]

CSV

β-catenin couples self-renewal, induction... [Chapter 2, Table 14]

CSV

β-catenin couples self-renewal, induction... [Chapter 2, Table 22]

CSV

β-catenin couples self-renewal, induction... [Chapter 2, Table 6]

CSV

β-catenin couples self-renewal, induction... [Chapter 2, Table 7]

CSV

β-catenin couples self-renewal, induction... [Chapter 2, Table 10]

CSV

β-catenin couples self-renewal, induction... [Chapter 2, Table 16]

CSV

β-catenin couples self-renewal, induction... [Chapter 2, Table 21]

CSV

β-catenin couples self-renewal, induction... [Chapter 3, Table 3]

CSV

β-catenin couples self-renewal, induction... [Chapter 2, Table 2]

CSV

β-catenin couples self-renewal, induction... [Chapter 2, Table 11]

Asset Metadata

Creator Bugacov, Helena (author)

Core Title β-catenin couples self-renewal, induction and epithelial morphogenesis and patterning at the outset of mammalian nephrogenesis

School Keck School of Medicine

Degree Doctor of Philosophy

Degree Program Development, Stem Cells and Regenerative Medicine

Degree Conferral Date 2023-05

Publication Date 05/01/2023

Defense Date 02/14/2023

Publisher University of Southern California (original), University of Southern California. Libraries (digital)

Tag developmental biology,kidney,nephron formation,nephron progenitor cell,OAI-PMH Harvest,stem cell,Wnt signaling,β-catenin

Format theses (aat)

Language English

Contributor Electronically uploaded by the author (provenance)

Advisor Fraser, Scott (committee chair), Bell, Oliver (committee member), McMahon, Andrew (committee member), Pastor-Soler, Nuria (committee member), Ying, Qilong (committee member)

Creator Email hbugacov@usc.edu

Permanent Link (DOI) https://doi.org/10.25549/usctheses-oUC113089495

Unique identifier UC113089495

Identifier etd-BugacovHel-11742.pdf (filename)

Legacy Identifier etd-BugacovHel-11742

Document Type Dissertation

Format theses (aat)

Rights Bugacov, Helena

Internet Media Type application/pdf

Type texts

Source 20230501-usctheses-batch-1034 (batch), University of Southern California (contributing entity), University of Southern California Dissertations and Theses (collection)

Access Conditions The author retains rights to his/her dissertation, thesis or other graduate work according to U.S. copyright law. Electronic access is being provided by the USC Libraries in agreement with the author, as the original true and official version of the work, but does not grant the reader permission to use the work if the desired use is covered by copyright. It is the author, as rights holder, who must provide use permission if such use is covered by copyright.

Repository Name University of Southern California Digital Library

Repository Location USC Digital Library, University of Southern California, University Park Campus MC 2810, 3434 South Grand Avenue, 2nd Floor, Los Angeles, California 90089-2810, USA

Repository Email cisadmin@lib.usc.edu