University of Southern California Dissertations and Theses

Disruption of immature Sertoli cell functions by endocrine disruptors and analgesic drugs

(USC Thesis Other)

Disruption of immature Sertoli cell functions by endocrine disruptors and analgesic drugs

PDF

Download

Open document

Flip pages

Download a page range

Download transcript

Copy asset link

Request this asset

Transcript (if available)

Content DISRUPTION OF IMMATURE SERTOLI CELL FUNCTIONS BY ENDOCRINE
DISRUPTORS AND ANALGESIC DRUGS
by
MAIA CORPUZ-HILSABECK
A Dissertation Presented to the
FACULTY OF THE USC GRADUATE SCHOOL
UNIVERSITY OF SOUTHERN CALIFORNIA
In Partial Fulfillment of the
Requirements for the Degree
DOCTOR OF PHILOSOPHY
(MOLECULAR PHARMACOLOGY AND TOXICOLOGY)
AUGUST 2023
Copyright 2023 Maia Corpuz-Hilsabeck

ii

DEDICATION

This dissertation is dedicated to my husband, Tyler Hilsabeck, who has been there
for me since the beginning of my career in science and cheered me on the entire way.
For my family, especially my grandmother who always believed I would go to great heights
including receiving my Ph.D. from University of Southern California (USC). Lastly, for my
colleagues and professors at USC who challenged me to be the best version of scientist
I was meant to be.

iii

ACKNOWLEDGEMENTS

I would like to sincerely thank my Ph.D. advisor, Dr. Martine Culty who has truly
broadened my research background having introduced me to the field of toxicology.
Under Dr. Culty’s supervision, I have become a well-rounded scientist, gained skills as a
scientific writer, and presenting my research to a general or professional audience. I’m
truly appreciative of Dr. Culty’s willingness to mold and guide me through my Ph.D. and
I would not be where I am today without her taking a chance on me as her graduate
student.
I am ever grateful for the knowledge and expertise in reproductive biology that
Dr. Vassilios Papadopoulos has bestowed upon me. Dr. Papadopoulos always
encouraged me to think outside of basic science and to think of how the research I am
doing is applicative to real-world scenarios. His never-ending support for my success as
a graduate student at USC was always felt and I express my utmost appreciation for his
guidance.
I would like to thank Dr. Curtis Okamoto who supported me to fullest extent
throughout my time at USC. Not only is he a great professor to have in class but could
also see eye-to-eye with graduate students’ potential as Ph.D. candidates. My time at
USC would not be the same if I did not have the guidance and knowledge bestowed to
me by Dr. Okamoto.
I would like to thank the senior lab members of the Culty and Papadopoulos lab
that willingly helped me with any questions I had. Chantal Sottas has been a great
source of support with the ins and outs of my dissertation project and always provided
critical feedback. I am so grateful for the founding support and training by Drs. Amy
Tran, Casandra Walker, Lu Li, Yuchang Li, Melanie Galano, and Christina Lin. Their
continued guidance and help in my research project has been instrumental over the
years.
I would also like to thank my lab mates for being great peers to get initial
feedback on research ideas, and friendship throughout my time. Spending time in the
lab surrounded by witty, intelligent graduate students like Samuel Garza, Nidia
Espinoza, and Garrett Cheung has propelled me to get to this point in my career. I

iv

would also like to acknowledge the direct contributions of my mentee Nicole Mohajer on
my project that I have the most faith in will go to great heights as a contributor to the
scientific field.

v

TABLE OF CONTENTS
DEDICATION................................................................................................................... ii
ACKNOWLEDGEMENTS............................................................................................... iii
LIST OF TABLES........................................................................................................... vii
LIST OF FIGURES.........................................................................................................viii
ABSTRACT.......................................................................................................................x
Chapter 1: Introduction.....................................................................................................1
1.1 Abstract............................................................................................................1
1.2 Introduction......................................................................................................2
1.3 Mechanisms regulating Sertoli cell development and function in the
developing gonad.............................................................................................3
1.3.1 Fetal Sertoli cells and their role in driving fetal testis formation.......3
1.3.2 Neonatal and immature Sertoli cell, regulation of proliferation.........4
1.3.3 Interaction of Sertoli cell with germ cells, a role in gonocyte
proliferation and migration................................................................7
1.3.4 Mature Sertoli cell and terminal differentiation.................................9
1.3.5 Role of Sertoli cell in primary undifferentiated and
differentiating spermatogonia....................................................................10
1.3.6 Blood-testis-barrier and immune privilege......................................11
1.4 Consequences of exposing Sertoli cells to endocrine disrupting
chemicals. .....................................................................................13
1.4.1 Phthalates......................................................................................13
1.4.2 Effects of pharmaceuticals on Sertoli cells.....................................15
1.4.3 Nonsteroidal anti-inflammatory drugs (NSAIDs) ...........................15
1.5 Effects of EDC mixtures and EDC-pharmaceutical mixtures on
Sertoli cells. ...................................................................................16
1.5.1 Genistein and DEHP mixtures........................................................18
1.5.2 DBP and Nonyl Phenol mixtures....................................................18
1.5.3 Phthalate mixtures..........................................................................19
1.5.4 Paracetamol and EDCs..................................................................19
1.6 Discussion and concluding remarks..............................................................20
1.7 Acknowledgements........................................................................................24

Chapter 2: Determining effects of EDCs and drugs on immature Sertoli cell
development in vitro......................................................................................24
2.1 Abstract..........................................................................................................24
2.2 Introduction....................................................................................................26
2.3 Methods.........................................................................................................28
2.3.1 Chemicals.......................................................................................28
2.3.2 TM4 Sertoli cell line culture............................................................28
2.3.3 Primary cell isolation......................................................................28
2.3.4 Sertoli cell treatments.....................................................................29
2.3.5 Cell viability....................................................................................29

vi

2.3.6 Cell proliferation.............................................................................29
2.3.7 Gene expression measured by qRT-PCR......................................30
2.3.8 PGD2 & PGE2 ELISA....................................................................31
2.3.9 Immunofluorescent (IF) staining....................................................32
2.3.10 Whole transcriptome sequencing (Total RNA-seq) .......................32
2.3.11 Statistical Analysis..........................................................................33
2.4 Results...........................................................................................................33
2.4.1 Sertoli cell viability and proliferation are dysregulated by
exposure to APAP and GEN..........................................................33
2.4.2 Eicosanoid pathway is dysregulated in immature Sertoli cells
exposed to APAP, GEN, and their mixtures...................................40
2.4.3 Estrogen receptors dysregulation in immature Sertoli cells by
APAP and GEN...............................................................................45
2.4.4 Dysregulation of immature Sertoli cell differentiation by APAP
and GEN.........................................................................................46
2.5 Discussion......................................................................................................53
2.5.1 Dysregulation of Sertoli cell development by APAP and GEN……53
2.5.2 Similarities and differences between TM4 cells and PND8
immature Sertoli cells.....................................................................55
2.5.3 Is there a link between APAP and GEN effects on Sox9 and
eicosanoid pathway?......................................................................57
2.5.4 Mechanisms dysregulated in immortalized and
primary immature Sertoli cells........................................................58
2.6 Conclusion.....................................................................................................60
2.7 Acknowledgements........................................................................................60

Preface to Chapter 3.......................................................................................................61

Chapter 3: Investigating molecular mechanisms involved in dysregulation of
immature Sertoli cell functions by EDCs and drugs......................................62
3.1 Abstract..........................................................................................................62
3.2 Introduction....................................................................................................63
3.3 Methods.........................................................................................................64
3.3.1 Cell cultures and treatments...........................................................64
3.3.2 Gene expression analysis in immature Sertoli cells.......................65
3.3.3 Immunofluorescent (IF) staining.....................................................66
3.3.4 Antibody array................................................................................67
3.3.5 RNA-seq analysis by whole transcriptome sequencing.................67
3.3.6 Statistical Analysis..........................................................................68
3.4 Results...........................................................................................................68
3.4.1 Pharmacological inhibition of estrogen signaling in immature
Sertoli cells................................................................................................68
3.4.2 JUN transcriptional regulation of estrogen signaling in
immature Sertoli cells................................................................................73
3.4.3 Antibody array discovers potential target of AG50 exposure.........77
3.5 Discussion......................................................................................................79

vii

3.5.1 Pharmacological inhibition of estrogen signaling in immature
Sertoli cells.....................................................................................79
3.5.2 JUN transcriptional regulation dysregulated by AC and GEN
mixture............................................................................................81
3.6 Conclusion.....................................................................................................82
3.7 Acknowledgments..........................................................................................82

Chapter 4: Summary, Challenges, and Future Perspectives..........................................84
4.1 Summary........................................................................................................84
4.1.1 Summary of Aim 1..........................................................................84
4.1.2 Summary of Aim 2..........................................................................84
4.1.3 Summary Diagram.........................................................................84
4.2 Challenges.....................................................................................................85
4.2.1 in vitro models of Sertoli cells...........................................................85
4.2.2 Elucidating mechanisms of toxicant mixtures..................................85
4.3 Future Perspectives.......................................................................................86
4.3.1 Contribution to the field of toxicology...............................................86
4.3.2 Role of cJUN and GP130 in mediating AC+GEN mixture effects....86
4.4 Conclusion.....................................................................................................86

References.....................................................................................................................88

Appendices...................................................................................................................108
Appendix 1: Supplemental Table 1....................................................................108
Appendix 2: Supplemental Table 2....................................................................124

viii

LIST OF TABLES
Table 1. Types of EDC and EDC-drugs mixtures reported to affect Sertoli cells...........16
Table 2. List of down- and up-regulated genes in TM4 and PND8 Sertoli cells
treated with 50 µM APAP, GEN or their mixtures…...……...…..………...........51
Table 3. Common functional pathways altered in TM4 cells and PND8 rat
Sertoli cells by 50µM APAP+GEN mixture…...…...………………….……........52
Table 4. Functional pathways uniquely dysregulated by 50µM APAP+GEN mixture
in TM4 cells.....………...……...………….…………………….………………......53
Table 5. Functional pathways uniquely dysregulated by 50µM APAP+GEN
mixture in PND8 rat Sertoli cells... …………………………………….……........53
Table 6. Protein targets either downregulated or upregulated after AG50 exposure
compared to vehicle in PND8 rat Sertoli cells……………….......……………...78
Supplemental Table 1. Complete list of 592 differentially expressed genes
altered by AG50 mixture in TM4 cells..........………………....108
Supplemental Table 2. Complete list of 168 differentially expressed genes in
PND8 rat Sertoli cells exposed to AG50 mixture………........124

ix

LIST OF FIGURES
Figure 1. Toxicant mixtures targeting Sertoli cells in testis. ..........................................22
Figure 2. Effects of APAP, IB, GEN, and MEHP on TM4 cell viability measured
by MTT assays. ... ..........................................................................................34
Figure 3. APAP and GEN but not MEHP inhibit cell proliferation and Sox9
expression in TM4 Sertoli cells. .....................................................................36
Figure 4. Comparison of the transcriptome and selected genes between immature
mouse TM4 Sertoli cells and PND8 rat Sertoli cells. .....................................38
Figure 5. Exposure to APAP and GEN decreases Sox9 expression in mouse
TM4 and PND8 rat Sertoli cells. ....................................................................40
Figure 6. Effects of APAP and GEN on prostaglandin synthesis and Cox1 and
Cox2 expression in TM4 and PND8 immature Sertoli cells…........................43
Figure 7. Cox-related genes are altered by exposure to APAP, GEN and their
mixtures in TM4 and PND8 rat Sertoli cells. ..................................................44
Figure 8. Effects of APAP and GEN on the expression of estrogen receptors in
TM4 cells and PND8 rat Sertoli cells………....................................................46
Figure 9. Expression of immature Sertoli cell marker Amh and mature Sertoli cell
Ar in TM4 and PND8 Sertoli cells in response to APAP and GEN................47
Figure 10. Differentially expressed genes in TM4 cells and PND8 Sertoli cells
treated with 50 µM APAP, GEN and APAP-GEN mixture.........……............48
Figure 11. Sertoli cell markers are dysregulated by AC+GEN mixture that
include ER-α/β and GPER signaling............................................................69
Figure 12. Eicosanoid related genes dysregulated by AC+GEN mixture that
were dysregulated in opposite trends by inhibitors of estrogen signaling....70
Figure 13. Gene expression of Gper and Estrogen receptor-α (ER-α) were
pharmacologically inhibited by ICI 182,780 and G15 alone and in
combination with AG50 mixtures in TM4 cells…………………………..........71
Figure 14. GPER expression in TM4 cells treated with pharmacological
inhibitors and AG50 mixtures.......................................................................72
Figure 15. TNF signaling pathway illuminating differentially expressed genes in
green (downregulated) or red (upregulated) altered by exposure to
AG50 in TM4 cells (and PND8 rat Sertoli cells. Fold change cutoff
ranged from -2 to 2 witheither a p-value or false discovery rate of 0.05......73
Figure 16. RNA-seq analysis of differentially expressed gene counts for Jun after
exposure to A50, G50, and AG50 in TM4 cells….........................................74
Figure 17. Activation of c-JUN was analyzed by performing IF staining for
phosphorylated c-JUN expression in TM4 cells exposed to A50, G50,
and AG50......................................................................................................75
Figure 18. Phospho-c-JUN expression in PND8 rat Sertoli cells after 24-hour
exposure to AG50 mixtures alone and in combination with ICI 182,780
and G15 inhibitors.........................................................................................76
Figure 19. Antibody array compared between AG50 and vehicle conditions in
PND8 rat Sertoli cells containing >300 targets. ...........................................77
Figure 20. RNA-seq analysis of differentially expressed gene counts for Il6st
(Gp130) after 24-hour exposure to A50, G50, and AG50 in TM4 cells
and PND8 rat Sertoli cells. ...........................................................................79

x

Figure 21. Graphical summary of potential mechanisms involved in dysregulation
of immature Sertoli cell functions by GEN effects altering ER-α/β and
GPER signaling. ...........................................................................................85

xi

ABSTRACT

The objective of this dissertation is to determine the molecular mechanisms driving
dysregulation of male gonad development using immature Sertoli cells as a model after
exposure to endocrine disrupting chemicals (EDCs) and drugs that are critical in male
reproductive health. Sertoli cells are instrumental to the developing male gonad and
nurture male germ cells from fetal life to adulthood. Disrupting their functions could
dysregulate spermatogenesis and contribute to male infertility. EDCs and analgesic drugs
such as acetaminophen (APAP) were individually shown to disrupt male gonad
development and cause reproductive disorders. Infants may be exposed to dietary soy
phytoestrogen genistein (GEN) and acetaminophen (APAP).
For this study, we hypothesized that disrupting immature Sertoli cell development
with exposure to EDCs and analgesic drugs contributes to the adverse effects of these
compounds. We outlined two major specific aims to address our hypothesis. Firstly, we
determined there was a significant dysregulation to immature Sertoli cell function by
exposure to APAP, GEN and their mixtures which disrupted cell viability, proliferation, the
expression of Sertoli cell markers, prostaglandins, and eicosanoid pathway genes. These
data were generated by implementing an immortalized mouse Sertoli cell line TM4 and
isolated postnatal-day 8 rat Sertoli cells to determine the effects of APAP and GEN, alone
or mixed, at concentrations measured in human blood. Secondly, we performed RNA-seq
analysis and identified differentially expressed genes in both cell types, with GEN and
APAP+GEN mixture inducing more changes than APAP. Functional pathways, including
those of p53 and TNF, were common targets of APAP and GEN in both cell types.
Pharmaceutical inhibitors of estrogen receptor -α/-β (ER-α/-β) and G protein-coupled
receptor 30 (GPR30) altered the effects of GEN and GEN mixtures. Together with RNA-
seq data, these experiments identified the transcription factor JUN, critical for Sertoli-
germ cell junctions and the inflammatory cytokine receptor Glycoprotein 130 (Gp130) as
main targets. These findings suggest that APAP and GEN adverse reproductive effects
might be driven in part by the dysregulation of immature Sertoli cells.

1

Chapter 1: INTRODUCTION
1

1.1 ABSTRACT
Sertoli cells play essential roles in male reproduction, from supporting fetal testis
development to nurturing male germ cells from fetal life to adulthood. Dysregulating
Sertoli cell functions can have lifelong adverse effects by jeopardizing early processes
such as testis organogenesis, and long-lasting processes such as spermatogenesis.
Exposure to endocrine disrupting chemicals (EDCs) is recognized as contributing to the
rising incidence of male reproductive disorders and decreasing sperm counts and quality
in humans. Some drugs also act as endocrine disruptors by exerting off-target effects on
endocrine tissues. However, the mechanisms of toxicity of these compounds on male
reproduction at doses compatible with human exposure are still not fully resolved,
especially in the case of mixtures, which remain understudied. Here I present an overview
of the mechanisms regulating Sertoli cell development, maintenance, and functions, and
then surveys what is known on the impact of EDCs and drugs on immature Sertoli cells,
including individual compounds and mixtures, and pinpointing at knowledge gaps.
Performing more studies on the impact of mixtures of EDCs and drugs at all ages is crucial
to fully understand the adverse outcomes these chemicals may induce on the
reproductive system.

1
This chapter is derived from a manuscript entitled “Impact of endocrine disrupting chemicals
and pharmaceuticals on Sertoli cell development and functions” by Corpuz-Hilsabeck, M. and
Culty, M.

2

1.2 INTRODUCTION
Sertoli cells are a critical somatic cell type of the male gonad that produce signaling
molecules playing key roles in fertility and reproduction, by regulating and supporting
germ cell development. Highlighted in this review are mechanisms by which Sertoli cells
are regulated during male gonad development and their function thereafter, from birth to
adulthood (França et al., 2016). Additionally, this project seeks to underscore the
consequences of exposing fetal and/or perinatal Sertoli cells to endocrine disrupting
chemicals (EDCs) as well as to drugs reported to target Sertoli cells. Chemicals are
characterized as EDCs based on their ability to perturb hormonal homeostasis, by either
disrupting the production of hormones by endocrine tissues, their metabolism, or their
functions by altering hormone receptors on target tissues (Gore et al., 2015a; Knazicka
et al., 2015; Li & Spade, 2021). While the term “endocrine disruptor”, often referred to as
EDC, was coined in the 1990s by Theo Colborn and colleagues, its definition has evolved
over the last decades and varies between scientific societies, regulatory and
governmental agencies worldwide (Schug et al., 2016). The health risk assessment of
EDCs has been complicated by the acknowledgement of the complexity of EDC effects.
There is now a greater understanding of short- and long-term, as well as
transgenerational effects, of secondary effects due to increased susceptibility rather than
direct adverse effect on target tissues/cells, the recognition that mixtures might have
different effects than their individual components, and the advances in molecular
approaches, large databases and bioinformatic tools, that have unraveled complex
mechanisms of toxicity within biological targets of EDCs. To date, there is still some
controversy on which toxic substance should be categorized as EDC. Several consensus
statement articles have addressed this issue, as well as the challenge posed by the low
dose and non-monotonic effects of some EDCs, and their regulatory implications (Gore
et al., 2015b; Solecki et al., 2017; Vandenberg et al., 2012). Among the environmental
chemicals targeting Sertoli cells, phthalates, xenoestrogens, and metals such as
cadmium, are characterized as EDCs.
Despite their critical role, fewer studies have examined the toxic effects of EDCs
on Sertoli cells relatively to those focusing on androgen-producing Leydig cells or germ
cells. There is a gap of knowledge on the mechanisms by which toxic substances,

3

including EDCs and their mixtures, create a hostile environment during critical
developmental periods of the male gonad and how Sertoli cells contribute to the adverse
reproductive phenotypes resulting from EDC exposures. The review first summarizes
Sertoli cell functions across development and adulthood, then discusses studies reporting
the adverse effects of individual EDCs and mixtures, as well as few drugs, on immature
Sertoli cells, looking at possible relationships between Sertoli cell disruption and
outcomes on testis and male reproduction. The review illustrates the scarcity of
publications on the topic, further highlighting the importance of performing more studies
to identify potential targets and/or mechanisms disrupted in Sertoli cells during key
developmental periods by these toxicants.

1.3 Mechanisms regulating Sertoli cell development and function in the developing
gonad
1.3.1 Fetal Sertoli cells and their role in driving fetal testis formation
The establishment of Sertoli cells from somatic cell lineage is initiated by the Sry
gene, encoding for the transcription factor Sex Determining Region Y (SRY) (Yao et al.,
2015). The indispensable and remarkable role of SRY is demonstrated by the existence
of XY humans with frameshift or single base mutations in Sry gene who develop as
phenotypic females, whereas the significant expression of Sry gene in an XX individual,
mainly due to abnormal Sry translocation to a X chromosome, leads gonads to develop
along the male sexual axis (Koopman et al., 1991; Wilhelm, Palmer, et al., 2007). These
data indicate the importance of SRY in directing gonadal somatic progenitor cells toward
the Sertoli cell fate since its absence or dysfunction causes cells to differentiate into
granulosa cells along the ovarian pathway. Newly formed Sertoli cells express SRY which
targets SOX9 expression toward testis formation (Yao et al., 2015). SOX9 and fibroblast
growth factor 9 (FGF9) communication during early gonad development regulates testis
morphogenesis (DiNapoli & Capel, 2008). In addition, Prostaglandin D2 (PGD2), a small
eicosanoid produced through an enzymatic cascade including cyclooxygenase and PG
synthase enzymes from the initial precursor arachidonic acid, induces SOX9 expression
in an autocrine fashion within Sertoli cells, that represses the ovarian pathway during
male sex determination. The establishment of Sertoli cell lineage in the gonads allows for

4

the organization of testis cords, testis-specific vascular patterning, and appearance of
other somatic cell types: Leydig cells, peritubular myoid cells (PTMs) (Yao et al., 2015).
The appearance of other somatic cell types including Leydig and PTM cells
depends on a specific threshold number of Sertoli cells and leads to the
compartmentalization of the testis into the testis/ seminiferous cords, where
spermatogenesis will take place at puberty, surrounded by a basement membrane and
either a single (rodent) or multiple (human) layer of PTM cells, and the interstitium for
androgen production (Yao et al., 2015). Fetal cord formation localizes Sertoli and germ
cells inside the cords, while Leydig cell clusters, blood vessels, hematopoietic and other
somatic cell types are found in the interstitium. Multiple factors contribute to inducing
endothelial cell migration for testis vasculature formation, including fibroblast growth
factor 9 (FGF9), platelet-derived growth factor (PDGF) A, B (PDGFB), and C (PDGFC),
bone morphogenetic protein (BMPs), and anti-Mullerian hormone (AMH), most of them
produced by Sertoli cells (França et al., 2016; Yao et al., 2015). Sertoli cell-derived
hedgehog ligand desert hedgehog (DHH) signaling has been shown to specify Leydig cell
lineage, impact testis cord formation, and regulate fetal Leydig cell differentiation (Bitgood
et al., 1996; O’Donnell et al., 2022; Yao & Capel, 2002; Yao et al., 2015).
During fetal development, newly formed Sertoli cells regulate fetal germ cell
development. At around embryonic day (E) E12.5 in mice, Sertoli cells are competent to
inhibit the retinoic acid (RA) pathway by expressing the RA-degrading enzyme CYP26B1,
when combined with primordial germ cells (PGCs). This process is critical to suppress
meiotic entry in male germ cells, while upregulating male germ cell markers that ensure
male germ cell differentiation (Ohta et al., 2012). However, this property is lost by E15.5
and E18.5, when Sertoli cells no longer express enough CYP26B1 for degrading RA and
suppressing meiotic entry. A second wave of Sertoli cell proliferation and expansion
(Tarulli et al., 2012) is signaled by fetal Leydig cells to elongate testis cords (Yao et al.,
2015).

1.3.2 Neonatal and immature Sertoli cell, regulation of proliferation
The regulation of Sertoli cell proliferation begins during the fetal to early postnatal period,
continuing into the late neonatal period and stopping before puberty, depending on the

5

species (Meroni et al., 2019b; Sharpe et al., 2003). Key factors that stimulate Sertoli cell
proliferation and development of the male gonad are follicle-stimulating hormone (FSH),
insulin-growth factor family (IGF-I and IGF-2), activins, inhibins, and the release of
specific cytokines (Meroni et al., 2019b). FSH is important in Sertoli cell proliferation
during fetal and early postnatal period, whereas FSH regulates differentiation after
cessation of mitosis at puberty (Meroni et al., 2019b; Orth, 1984; Sharpe et al., 2003).
FSHR expression in males is solely found in Sertoli cells (Heckert & Griswold, 1993).
Earlier studies investigated immature Sertoli cell proliferation by treating isolated rat
Sertoli cells with FSH, which stimulated MEK-1 activation leading to downstream
phosphorylation and nuclear relocation of ERK1/2. In turn, cyclin D1 (CCND1) is
upregulated to promote cell cycle progression and sustain proliferation (Crépieux et al.,
2001; Ni et al., 2019).
The insulin family of growth factors is involved in growth, metabolism, and
reproduction, and can be found during early development in proliferative Sertoli cells
(Meroni et al., 2019b). IGFs bind to IGF receptors that are coupled to downstream
signaling pathways such as that of phosphatidylinositol 3-kinase (PI3K)/protein kinase B
(AKT) via the Insulin Receptor Substrates (IRS1-4), adaptor proteins. IRS2 positively
mediates IGF-1 receptor signaling in neonatal Sertoli cells for regulating proliferation,
involving paracrine signaling to PI3K/Akt (Khan et al., 2002) and ERK1/2 pathways
(Villalpando et al., 2008). Of the transforming growth factor (TGF) b superfamily, activins
and inhibins are gonadal peptides that play a role in the regulation of Sertoli cell
proliferation (Meroni et al., 2019b). Activins include activin A (bAbA) and activin B (bBbB),
with activin A being mainly produced and secreted by fetal Leydig cells during fetal testis
development. Secretion of activin A by Leydig cells is shown in human fetal testis to
increase Sertoli cell proliferation directly (Archambeault et al., 2011). A significant
decrease of activin A concentration is observed in Sertoli cells as they progress to their
mature, non-proliferative state (Barakat et al., 2008). Inhibins, specifically Inhibin B, may
ultimately play a supportive role in activin A-induced Sertoli cell proliferation (Meroni et
al., 2019b). Additionally, Sertoli cells secrete specific cytokines, such as two types of
Interleukin 1 (IL-1), IL-1a and IL-1b, which were shown to increase DNA synthesis and
Sertoli cell number in vitro, suggesting a role in Sertoli cell proliferation (Petersen et al.,

6

2002). Additionally, data suggests tumor necrosis factor (TNF) a as a positive regulator
of Sertoli cell proliferation (Petersen et al., 2004).
Factors that inhibit or cause cessation of Sertoli cell proliferation to initiate Sertoli
maturation include androgens, thyroid hormone, estrogens, and retinoic acid (RA)
(Meroni et al., 2019b). Androgen production and modulation is key to male fertility and
spermatogenesis. Androgens diffuse through the plasma membrane to bind androgen
receptor (AR) in the cytoplasm, where it is sequestered by heat shock proteins in the
absence of ligand. AR is expressed post-proliferation in Sertoli cells, suggesting a role in
cell differentiation (Meroni et al., 2019b). The critical timing of AR signaling in Sertoli cells
and its role in their maturation was demonstrated with a transgenic conditional mouse
model (TgSCAR) in which AR was prematurely expressed in Sertoli cells, triggering
androgen-driven processes such as lumen formation too early and shortening the time to
spermatid formation, eventually reducing postmeiotic development and testis size (de
Franca et al., 1995; Hazra et al., 2013; Sun et al., 2015; van Haaster et al., 1993).
Thyroid hormone (TH) including triiodothyronine (T3) has been shown to inhibit
proliferation and stimulates differentiation of culture neonatal Sertoli cells (Cooke et al.,
1994). TH has a significant role in Sertoli cell maturation based on extensive evidence
showing a negative regulation of Sertoli cell proliferation (Cooke & Meisami, 1991).
Inhibition of FSH-stimulated Sertoli cell mitosis is mediated by TH and its inhibitory effect
is supported by increased expression of cell cycle inhibitors p21Cip1 and p27Kip1
(Buzzard et al., 2003). TH may control metabolism via AMPK pathway, contributing to its
effects in Sertoli cell maturation, as shown by recent reports of AMPK activation reducing
FSH-stimulated Sertoli cell proliferation (Riera et al., 2012). Such interactions between
two endocrine tissues are important to note, as they further imply that EDCs affecting one
endocrine tissue could have indirect effects on another endocrine tissue.
Initial studies of the regulation of Sertoli cell proliferation showed that in vivo
administration of estrogen in rats reduced Sertoli cell number (Atanassova et al., 1999).
A study showed that blocking estrogen receptors (ERs) with the non-specific ER
antagonist ICI 182,780, as well as the aromatase inhibitor letrozole, increased porcine
Sertoli cell proliferation, supporting the idea that estrogens halt Sertoli cell proliferation
(Berger et al., 2013). Estrogen receptor (ER) a (ESR1) is also shown to be higher at the

7

proliferative state of Sertoli cells, while ER b (ESR2) increases with age during the
differentiation of Sertoli cells. Studies suggest that estrogens are involved in both
proliferation and maturation of Sertoli cells depending on the estrogen receptor isoform
present (Meroni et al., 2019b). The ratio of ERa and ERb is physiologically important to
determine the end of Sertoli cell proliferation and start of cell differentiation (Lucas et al.,
2014). Retinoic acid (RA), specifically all-trans RA (atRA), has been studied for its effects
in cessation of Sertoli cell proliferation. AtRA presence led to increased expression of
p21CIP1 and p27KIP1 which are major players in cell cycle arrest and differentiation of
Sertoli cells (Buzzard et al., 2003).

1.3.3 Interaction of Sertoli cell with germ cells, a role in gonocyte proliferation and
migration
It is known that gonocyte proliferation occurs while Sertoli cells are actively
proliferating during fetal and neonatal phases. Mouse and rat gonocytes proliferate first
around gestational day (GD) GD14 until GD16, followed by quiescence until they resume
proliferation, at three days after birth in rat and one or two days earlier in mouse (Basciani
et al., 2008; Vergouwen et al., 1991). Gonocyte proliferation occurs simultaneously to
their migration from the center of the seminiferous cords to the basement membrane at
the periphery of the cords (Culty, 2009). Sertoli cells were observed to complete
proliferation by postnatal day (PND) 17 in mice (Vergouwen et al., 1991) based on the
absence of [3H]thymidine-labelling at that age and in PND20 rats when the presence of
thyroid hormone regulates maturation initiation in Sertoli cells (Cooke et al., 1994). The
study of Sertoli cell proliferation in fetal and postnatal rats has shown that these cells have
proliferative capacity through PND 21, when [3H]thymidine-labelling was no longer
detected (Orth, 1982).
Gonocyte markers have not been specifically identified to signify induction of
resumption of mitotic cell cycle progression, but some factors appear to be associated
with quiescence. In mouse testes, gonocytes with increased expression of retinoblastoma
1 (Rb1) and cyclin D kinase inhibitors p15, p16, p21, and p27 proteins are found to
coincide with the quiescent period (Yang & Oatley, 2015). Initiation of gonocyte population
out of quiescence and resumption of cell cycle progression is regulated by Sertoli cells

8

proliferative state. A mouse conditional knockout of Activin A, member of TGFb
superfamily, suggests induction of cell cycle arrest modulated by Rb1 and p21 expression
(Hasthorpe et al., 2000; Sehy et al., 1992). Activin A and TGFb-1 expression significantly
decrease after birth, which coincides with resumption of gonocyte proliferation . During
neonatal development, fibroblast growth factor 2 (FGF2) and leukemia inhibition factor
(LIF) are secreted by Sertoli cells as paracrine signals for synergistic stimulation of
gonocyte survival (Cortes et al., 1987; Van Dissel-Emiliani et al., 1996), while neonatal
gonocyte proliferation is regulated by a combination of PDGF-BB and 17b-estradiol
(Culty, 2009; Thuillier et al., 2010).
Gonocyte migration and expansion have been shown to be impaired in testes from
knockout mice for Doublesex- And Mab-3-Related Transcription Factor 1 (DMRT1), a
gene involved in testis development and Sertoli cell differentiation, suggesting some
influence in Sertoli-secreted DMRT1 on gonocyte activities (Raymond et al., 2000).
Additionally, the Sertoli cell-secreted transcriptional regulator SIN3A was shown to
support the transition of a subset of gonocytes to undifferentiated spermatogonia (Payne
et al., 2010). Moreover, Sertoli cells release selective cytokines, including KIT ligand
(KITL), platelet-derived growth factor (PDGF), and C-X-C motif chemokine 12 (CXCL12)
that influence the migratory behavior of gonocytes (Culty, 2009). KITL deficiency in mice
led to impairment of adhesion between gonocytes and Sertoli cells. Studies in mouse
testis at PD 1-5 showed that PDGF inhibition led to an increased number of centrally
located gonocytes and apoptotic cells (Basciani et al., 2008). Yang and Oatley
hypothesize that CXCL12 has a regulatory role on gonocyte migration, based on CXCL12
expression being significantly reduced in Sertoli cells that are SIN3A-deficient,
concomitant with an apparent disruption of gonocyte migration (Yang & Oatley, 2015).
During germ cell development, gonocytes that failed migration require apoptosis
(Culty, 2009; Manku & Culty, 2015). Manku and Culty investigated the effects of
inadequate gonocyte differentiation and formation of testicular germ cell tumor (TGCT),
reporting that differentiating gonocytes and spermatogonia had upregulated pro-apoptotic
genes Gadd45a and Cycs compared to non-differentiating gonocytes (Manku & Culty,
2015). This highlights the important role of the phagocytic activity of Sertoli cells for
removing residual gonocytes that failed to migrate toward basement membrane (Yang &

9

Oatley, 2015). This is true also in the pubertal and adult testes, in which the maintenance
of normal spermatogenesis relies on Sertoli cells’ phagocytic activity (Lv et al., 2020).
Apoptotic germ cells and residual bodies are phagocytized by Sertoli cells, which maintain
the physical and environmental support needed for spermatogenesis (Lv et al., 2020;
Wang et al., 2006). A study by Yokonishi et al. replaced an existing Sertoli cell population
in male mice with fresh pluripotent Sertoli cells xenografts and showed improvement of
spermatogenesis by an increase in spermatogonial survival (Yokonishi et al., 2020).

1.3.4 Mature Sertoli cell and terminal differentiation
Two waves of Sertoli cell proliferation are known to occur throughout its lifespan:
firstly, during late fetal and early neonatal life dividing more than fivefold, and secondly
just before puberty in which Sertoli cells grow more than twofold (Cortes et al., 1987;
Orth, 1982). Androgen receptor (AR) expression in Sertoli cell signifies maturation of the
cells after proliferation and their responsiveness to androgen during spermatogenesis
(Rey et al., 2009). Sertoli cells acquire AR expression post-differentiation, at the onset of
puberty (Sharpe et al., 2003). Willems et al. underlined the importance of AR in Sertoli
cell using AR ablation models which caused abnormal Sertoli cell maturation and germ
cell development (Willems et al., 2010). Sertoli cell androgen receptor knockout
(SCARKO) model studies further showed AR importance in Sertoli cell maturation,
demonstrated by increased permeability of the blood-testis- barrier (BTB), and evidence
of a cell-autonomous activation of AR, important for normal Sertoli cell function (Rey et
al., 2009; Willems et al., 2010).
Sertoli cells undergoing differentiation from fetal into a more mature stage can be
identified by specific markers and transcription factors such as FSH, AMH, SRY (male
gonad), NR5A1 (SF1), GATA4, WT1, SOX9, and DMRT1. During Sertoli cell
development, NR5A1, GATA4, and WT1 are seen as major transcription factors important
in directing fetal somatic cells to fetal Sertoli cell fate (Rotgers et al., 2018a). SOX9 is
known to be expressed throughout the lifetime of a male rat, albeit more strongly in the
prenatal period, followed by a large decrease after birth (K. Fröjdman et al., 2000; Rotgers
et al., 2018a). Nonetheless, SOX9 likely plays a significant role in adult germ cell
differentiation as it is still expressed in adult Sertoli cells. DMRT1 has been shown to be

10

important for testis differentiation in most mammalian species (Raymond et al., 2000).
Deleting murine DMRT1 causes Sertoli cells to over-proliferate in the testis as well as
induces germ cell death, possibly related to a defect in Sertoli cells. The role of AMH in
Sertoli cell fate has been thoroughly investigated. Based on data collected from mice in
the late perinatal period (PND 0-7), AMH was found to differentially regulate Sertoli cell
development depending on its concentration (Rehman et al., 2017). Indeed, AMH at low
concentrations promoted Sertoli cell proliferation, whereas high concentrations of AMH
induced apoptosis. The expression of proapoptotic proteins was upregulated, including
cleaved caspase-3 and Bax in the presence of AMH with a decrease of the anti-apoptotic
protein Bcl-2. In the presence of higher AMH expression, stem cell factor (Scf) which
regulates Sertoli cell development, was also increased. The authors concluded that the
timely expression of AMH and its receptor AMHRII in spermatogenesis may act in a
paracrine or autocrine manner during testicular development. More recently, AMH
secreted by Sertoli cells was shown to play a structural role in the formation of mouse
testis (Wang et al., 2020). Mice positive for Amh-Cre and Diphtheria Toxin A (DTA) were
used to generate offspring with Sertoli cell-ablated AMH, which were found to present
disruption of testis cords and loss of germ cells. Mislocalization and reduction of a smooth
muscle actin (SMA)-labeled peritubular myoid (PTM) cells were also observed in Sertoli
cell Amh-Cre; DTA mice. While it is known that there are markers to identify Sertoli cells
at the mature and differentiated state, questions regarding the dynamic state of Sertoli
cell and whether it is terminally differentiated have come up (Oliveira et al., 2015; Tarulli
et al., 2012).

1.3.5 Role of Sertoli cell in primary undifferentiated and differentiating spermatogonia
Spermatogonia differentiation happens alongside the maturation and
differentiation of Sertoli cells. The repression of c-KIT expression in gonocytes induces
the transition to undifferentiated spermatogonia. Re-establishment of c-KIT expression in
undifferentiated spermatogonia leads to transition into differentiated spermatogonia
(Yang & Oatley, 2015; Yang et al., 2013). In the presence of KITL expression, a transition
from spermatogonial stem cells (SSCs) to differentiated c-KIT-positive spermatogonia
occurs. FGF2, glial cell derived neurotrophic factor (GDNF), and CXCL12 are secreted

11

by Sertoli cells that induce a response in undifferentiated spermatogonia to 1)
translationally repress c-KIT expression and 2) transition to differentiated spermatogonia
(Yang et al., 2013). GDNF is negatively regulated by NOTCH1 signaling, likely to balance
stimulation by FGF2 and FSH in Sertoli cells causing gonocytes exit from quiescence
(Garcia et al., 2013). RA secreted by Sertoli cells induces the progression to
undifferentiated spermatogonia, a process initially observed in vitamin A-deficient rats
and mice, with testes unable to proceed with normal spermatogenesis until RA was
reintroduced (Van Pelt & De Rooij, 1991). The concept of an RA intermediate produced
by Sertoli cells during the transition from gonocytes to differentiating spermatogonia is
becoming increasingly accepted as it was only confirmed within the last decade, based
on paracrine communication between Sertoli cells and the transitioning gonocytes (Yang
& Oatley, 2015). The mature Sertoli cell is known for its impact on tubular architecture,
peritubular myoid cell fate, and adult LC number (Rebourcet et al., 2014). Gap junctional
protein (GJA1) which is also known as Connexin 43 (CX43) is vital in Sertoli cell
differentiation, but not for spermatogonia cell maintenance/self-renewal (Sridharan et al.,
2007). Recently, mTOR signaling was shown to be involved to during PI3K/Akt signaling
of spermatogenesis and regulates GJA1 within Sertoli cells (Boyer et al., 2016).

1.3.6 Blood-testis-barrier and immune privilege
Sertoli cells and the formation of the BTB create a significant defense mechanism
in the testis (Cheng & Mruk, 2012; Kaur et al., 2014; Mruk & Cheng, 2015). The initial
formation of the BTB occurs during puberty and two distinct sections form, based on a
division of the seminiferous epithelium by tight junctions (TJs) along the basal region of
Sertoli cells into adluminal and basal compartments (França et al., 2016). The BTB
require CX43 (or GJA1) expression to maintain normal development and regulation of its
dynamics (Hollenbach et al., 2018; Sridharan et al., 2007). Adult Sertoli cells lie at the
basal lamina of seminiferous epithelium, in which BTB are comprised of not only TJs but
also of basal ectoplasmic specializations (ES), desmosomes, and gap junctions (GJs)
(Kaur et al., 2014). Occludin, claudins-3, -5, -11, zonula occludens (ZO) -1, -2, and -3 and
junction adhesion molecules A and B (JAM-A and JAM-B, respectively) are some of the
major junction proteins which bridge communication across the BTB (Hermo et al., 2010).

12

Occludin and claudin-11 junction proteins are most important in the maintenance of
barrier integrity (França et al., 2016). Androgens not only play a major role in Sertoli cell
maturation but also mediate the formation of newly formed Sertoli cell TJs by regulating
Claudin-3 expression and maintaining TJs structure, possibly involving Claudin-13, and
noncanonical tight junction protein 2 isoform (Tjp2iso3) (Chakraborty et al., 2014).
The BTB is absent in perinatal and juvenile periods, although some of its junctional
proteins are already observed in low levels at these ages, but not organized as they
become during puberty to form the BTB, which provides germ cell protection from immune
cells (França et al., 2016). Studies elucidating the compartmentalization of immune cells
from auto-immunogenic cells, ultimately showed that germ cells are sequestered from
immune cells including macrophages, T cells, and dendritic cells via one (rodent) or more
(human) layers of peritubular myoid cells (Kaur et al., 2013; Kaur et al., 2014). Therefore,
a tight control of keeping autoimmunogenic germ cells physically away from immune cells
is established by the selective BTB between Sertoli cells and myoid cells (Kaur et al.,
2014). Altogether, the studies cited above depict the BTB as a plastic and highly dynamic
structure, where the interaction between signaling molecules such as the focal adhesion
kinase FAK and the
SRC Proto-Oncogene, Non-Receptor Tyrosine Kinase (SRC) kinase, their regulation and
interaction with TJ proteins and actin filaments, participate to the functional remodeling of
the BTB, allowing the movement of germ cells, while insuring its essential barrier function.
Immune modulation by Sertoli cells contributes to the immune privilege of the adult
testis (Kaur et al., 2014). Recent review of Sertoli cell contributions to the immune
privileged testis by Qu et al. (2020) include inter-Sertoli cell junctions, Fas ligand, Activin,
IGF-1, epidermal growth factor, TGFb, and lipocalin (Qu et al., 2020). Induction of
regulatory T cells (Tregs) by Notch/JAGGED1 signaling and stimulation of peripheral
conversion of CD4+FOXP3- T cells to functional CD4+FOXP3+ Tregs in the presence of
mouse Sertoli cell conditioned medium has been shown (Campese et al., 2014). Most
recently, Kaur et al. (2020) used neonatal pig Sertoli cells to suggest a Sertoli cell
immunosuppression mechanism via upregulated CD4 and CD8 Tregs and other
immunoregulatory factors to improve survival of xenografts (Kaur et al., 2020).

13

Due to their ability to produce immunomodulatory factors and maintaining the
immune privilege status of the seminiferous tubules, Sertoli cells have recently been
successfully used to provide immune protection to pancreatic islets xenotransplants and
proposed as novel therapeutic tools in a number of diseases (Washburn et al., 2022),
broadening the scope of these cells beyond reproduction.

1.4 Consequences of exposing Sertoli cells to endocrine disrupting chemicals
EDCs represent a particular type of toxic substances, including natural and
manmade chemicals, that target the endocrine system at the developmental and/or
functional levels from fetal to adult life. A major target of EDCs is the developing
reproductive system (Diamanti-Kandarakis et al., 2009). The testis is a complex
endocrine tissue regulated not only through the hypothalamus-pituitary-gonadal axis via
pituitary hormones and negative feedbacks from Leydig and Sertoli cells, but also by
interactions with other endocrine tissues, such as the adrenals (Martinez-Arguelles et al.,
2013). The detrimental effects of EDCs on fetal and perinatal Sertoli cells can have
lifelong adverse consequences on testicular functions, primarily spermatogenesis, and
male fertility. Changes in Sertoli cell proliferation rates and differentiation, cytoskeleton,
BTB and Sertoli cell-germ cell adhesion, have been observed in response to EDCs
(Cheng et al., 2011; de Freitas et al., 2016; Gao et al., 2015; Mruk & Cheng, 2015; Siu et
al., 2009). Gao et al. state in their expert opinion that despite knowing that toxicants such
a carbendazim and phthalates act on microtubule-based Sertoli cell cytoskeleton, while
PFOS, BPA, and cadmium act on actin-based Sertoli cell cytoskeleton, the mechanism
by which these effects occur is still largely unanswered. This section will highlight the
EDCs used in this study including phthalates, xenoestrogens, and analgesic drugs.

1.4.1 Phthalates
Phthalates (phthalic acid esters) are another group of EDCs that causes disruption
to male reproductive function, found in consumer products such as shampoo, cosmetics,
hairspray, food packaging and other consumer products. Phthalates, also known for their
use as plasticizers, include di(2-ethylhexyl) phthalate (DEHP), metabolized to bioactive
MEHP, as well as di(n-butyl) phthalate (DBP) that breaks down into mono(n-butyl)

14

phthalate (MBP) (Creasy et al., 1983; Ma et al., 2020; Reis et al., 2015). The deleterious
effects of these phthalates on fetal testis function are well documented, including
decreased androgen production, and some effects on Sertoli cells, such as decreased
secretion of Androgen Binding Protein (ABP) and induction of morphologic changes in
prepubertal rat Sertoli cells by MEHP (Creasy et al., 1983; Reis et al., 2015). Additionally,
FSH receptor signaling was altered in immature Sertoli cells exposed to MEHP (Heindel
& Powell, 1992). In cultured human fetal testes, Amh mRNA expression as well as germ
cell number were reduced by MEHP treatment, with an increase in germ cell apoptosis
detected by caspase-3-positive immunostaining (Lambrot et al., 2009).
Human studies, such as that conducted on the mother-child Hokkaido Study
Sapporo Cohort, have also established a strong correlation between maternal phthalate
exposure and abnormal Sertoli cell function in their infants (Araki et al., 2014). In this
study, the concentration of MEHP, major bioactive metabolite of DEHP, was determined
in the blood of pregnant women, while a panel of reproductive hormones were measured
in cord blood to determine Sertoli and Leydig cell functions in the infants. The study
showed that the Sertoli cell marker Inhibin B was decreased in a dose-dependent manner
with increasing maternal levels on MEHP, identifying perinatal Sertoli cells as phthalate
targets. However, since Leydig cell markers were also decreased in cord blood, one
cannot conclude if Sertoli cells were primary or secondary targets of the phthalate in this
case (Araki et al., 2014). Although such studies are essential for the validation and
extrapolation of findings in animal models to humans, they also illustrate some of the
limitations of in vivo, organ and organoid studies, which reflect better real exposure
conditions at the organism or tissue levels but complicate the determination of primary vs
secondary target cells of EDCs, based on physiological parameters.
MEHP was found to induce oxidative stress in prepubertal rat Sertoli cells, an effect
that was attenuated by combining MEHP with a low dose of genistein, suggesting a
protective effect of genistein (Zhang et al., 2017). Elucidating the mechanisms by which
phthalates cause dysfunction in testes is critical. Exposure of fetal and postnatal mice to
DEHP at 2mg/kg/day and above, was found to prevent Sertoli cell differentiation by
downregulating genes involved in Sertoli cell differentiation such as Sox9, FGF9, and
DMRT1 . Furthermore, the sex determination pathway, Gadd45g à Gata4/Fog2 à Sry

15

à Sox9 à FGF9 was altered in the same treatment conditions. A more recent study of
MEHP exposure in mouse Sertoli cell line TM4 was performed to assess transcriptomic
alterations (Wang et al., 2019). Based on high-throughput sequencing of RNA collected
from TM4 cells, genes that were differentially expressed associated with the Gene
Ontology (GO) term “extracellular region” when treated with high and low MEHP doses.
Most recently, Ma et al. (2020) found that DBP causes abnormal proliferation of Sertoli
cells in prenatal stage of male mice at low concentrations, via ubiquitination of interleukin-
1 receptor-related kinase 1 (IRAK1) (key proliferation-related protein) by downregulating
the E3 ubiquitin ligase Pellino 2 (Peli2) (Ma et al., 2020). They also suggested the
activation of the intrinsic apoptotic pathway to increase apoptosis of TM4 cells when
exposed to 10mM MBP.
1.4.2 Effects of pharmaceuticals on Sertoli cells
Several pharmaceuticals have been found to disrupt Sertoli cell functions as off
target effects. The importance of identifying such drugs is evident in view of the multiple
and essential roles played by Sertoli cells, from the initiation and regulation of testis
development in fetus to the maintenance of spermatogenesis and immune privilege
in adult. Some of these pharmaceuticals exert their toxic effects by altering key structures
in Sertoli cells, while others impair their hormonal function, such as the production of the
nonsteroidal hormones Inhibin B and AMH. This short section presents examples of
analgesic/antipyretic drugs individually altering Sertoli cells.

1.4.3 Nonsteroidal anti-inflammatory drugs (NSAIDs)
Another drug class important to examine for potential unintended effects on gonad
development is that of NSAIDs. Recently, Ibuprofen was shown to downregulate AMH
and SOX9 expression in human fetal Sertoli cell, suggesting decreased Sertoli cell
maturation as a result . Sharma et al. attribute Selenium (Se) deficiency in maintaining
ROS levels to preventing testicular toxicity from prolonged use of Ibuprofen (Sharma et
al., 2020). They concluded that supplementation of Se via antioxidant enzymes along with
Ibuprofen may alleviate Ibuprofen-induced male reproductive toxicity. Acetaminophen, a
common analgesic drug, was shown to cause dysregulation to testis development in F1

16

offspring (Rossitto et al., 2019). This was indicated by delayed Sertoli cell maturation and
Leydig cells that were hyperplasic in mouse F1 testes.

1.5 Effects of EDC mixtures and EDC-pharmaceutical mixtures on Sertoli cells
Because humans may be concomitantly exposed to multiple EDCs, as well as to
pharmaceuticals and EDC mixtures, it has become evident that a thorough risk
assessment of exposures to EDCs and to pharmaceuticals with reproductive side effects
should consider the possibility that mixtures might not have the same effects as their
individual components. There is sufficient evidence of EDCs modifying their respective
effects or triggering transcriptome changes or biological responses unique to mixtures, to
justify the inclusion of mixtures in toxicology studies (Ribeiro et al., 2017). However,
selecting what mixtures to study, the doses of each chemical, the ages and lengths of
exposures, the endpoints to examine, to emulate realistic human exposures and generate
data that can be used in risk assessment and recommendations is a difficult task .
Co-existing chemicals in the environment, such as metals, xenoestrogens,
phthalates, pesticides, and pharmaceutical drugs each have their own mechanisms of
action on male reproduction but understanding whether their mixtures could induce
further dysregulation is lacking and crucial to investigate. A compilation of published
studies observing the effects of mixtures of toxicants, including EDCs and drugs, on
Sertoli cells’ function and/or development is presented in Table 1.

TABLE 1. Types of EDC and EDC-drugs mixtures reported to affect Sertoli cells.
EDC/drug mixtures Treatment type Sertoli cell molecular/cellular
changes; altered phenotypes
Citations
Genistein and DEHP
(phytoestrogen +
phthalate plasticizer)
Rats; in utero exposure from GD14 to birth; gavage with
GEN + DEHP mixture; each at 10 mg/kg/day
decreased Sertoli cell marker gene
expression Amh and Wt-1 in
PND120 adult rat testes
Jones et al.,
2014 (162)
Genistein and
phthalate
DEHP
Rats; in utero exposure from GD14 to birth; gavage with
DEHP alone or
GEN + DEHP mixture; each at 10 mg/kg/day
caused decreased Sertoli cell
marker Abp gene expression in
PND6 juvenile rat testes
Jones et al.,
2015 (163)
Genistein and
phthalate
DEHP
Rats; in utero exposure from GD14 to birth; gavage with
GEN + DEHP mixtures at 0.1 or 10 mg/kg/day
In adult rat testes (PND120):
altered morphology of
seminiferous tubules. Increased
rate of abnormal testicular
phenotypes such as Sertoli-cell
Walker et
al.,
(164)

17

only; atrophied tubules; germ cell
sloughing in lumen
DBP and Nonylphenol
(NP)
(Phthalate plasticizer +
chemical used in
industrial and
consumer products)
In vitro; isolated primary Sertoli cells from 30 day-old
Rat; mixtures of
NP (range 0.01–50 µM) and MBP (range 10–20000 µM)
Additive effects on decreased cell
viability of Sertoli cells, but no
dramatic morphological changes
Li et al.,
(165)
DBP/MBP and
Nonylphenol (NP)
(phthalates + chemical
used in
industrial/consumer
processes)
In vitro; isolated primary rat Sertoli cells from 9-day-old
rats; NP (range 0.01–50 µM) and MBP (range 10–20000
µM).
Synergistic effect on viability and
LDH leakage rate (plasma
membrane integrity) at lower
concentrations, but antagonistic
efffect at higher concentrations.
Testing 2 mathematical models
based on the Loewe additivity
(LA) theory and the Bliss
independence (BI) theory.
Hu et al.,
(166)
DBP/MBP and
Nonylphenol (NP)
(phthalates + chemical
used in
industrial/consumer
processes)
In vitro; Sertoli cells isolated from 9-day-old rats; NP
(0.1, 1, 10 mM),
MBP
(0.1, 1, 10 mM), NP + MBP (mixtures at same dose for
both). In vivo: PND23–35 rats gavaged with DBP and NP
as single or mixed compounds
Disrupted structure/function of
Sertoli cells and dysregulated
hormone levels in serum by
exposure to NP and DBP
Hu et al.,
(167)
Phthalate mixtures:
Diethyl phthalate
(DEP), diphenyl
phthalate (DPP), and
dimethyl isophthalate
(DMIP)
In vitro: primary Sertoli cells isolated from 3-weeks old
male mice. In vivo: 3-weeks-odl rats exposed by gavage
for long-term (45 days)
In vitro exposures: Gene
expression changes in mouse
Sertoli cell markers transferrin,
testin, occludin In vivo: decreased
protein expression of 3b-HSD,
connexin-43, and occludin after 45
days exposure. alteration of tight
junctions, widening of
intercellular space with phthalates.
Kumar et
al.,
(168)
Anti-malaria
insecticides:
DDT, DDE, DM
Industrial
pollutant/plasticizer:
NP Phytoestrogens:
coumestrol, genistein
In utero, lactation, then direct exposure of rats up to
PND104. exposure to a mixture of DDT, DDE and
deltamethrin (DM) (35 mg/kg); to pnonylphenol (p-NP)
(2.5ug/kg); and phytoestrogens (2.5ug/kg)
Sertoli cell toxicity shown by
thinner epithelium and reduced
germ cell layers. Decreased
Anogenital distance (AGD)
Patrick et
al.,
(169)
Paracetamol mixed
with
EDCs: Estrogenic
(BPA, 4MBC, butyl
paraben, OMC).
Anti-androgenic: DBP,
DEHP, vinclozolin,
prochloraz,
procymidone, linuron,
pp’DDE,
epoxiconazole
In utero; Rats; oral gavage from gestation (GD7-21), and
lactation (PND
1-22), using 3 doses of total mixture (TotalMix100, 200,
450). Doses in
(mg/kg/day). Mix of 4 estrogens (4-MBC) (6, 12, 27),
(BPA (0.15; 0.3;
0.6) butyl paraben (6, 12, 27), octyl methoxycinnamate
(OMC) (12, 24, 54). 8 anti-androgens: DBP, DEHP,
vinclozolin, prochloraz, procymidone, linuron, pp’DDE,
epoxiconazole (3 doses each; values between 1 and 9);
paracetamol (80, 160, 360)
Delayed Sertoli cell maturation in
adult testes. Some rats at PND300
showed Sertoli cell only
phenotype in ST after exposure to
EDCs i.e. DBP, DEHP, pesticides,
and paracetamol mixtures.
Paracetamol decreased sperm
count
Axelstad et
al.,
(170)
genistein, (GEN); di-2(ethylhexyl) phthalate, (DEHP); di(n-butyl) phthalate, (DBP); nonylphenol, (NP); mono-butyl phthalate,
(MBP); 1,1,1-trichloro-2,2-bis(p-chlorophenyl) ethane. (DDT).

18

1.5.1 Genistein and DEHP mixtures
Postnatal exposure of infants can happen in a clinical setting through soy-formula
containing the phytoestrogen GEN, whilst receiving medical intervention with phthalate-
containing medical tubing and equipment. DEHP which is not covalently bound, leaches
onto the fluids and can reach out the infant via ingestion during medical intervention.
Jones et al. performed in utero exposures studies in Sprague-Dawley rat with GEN and
DEHP mixtures at 10mg/kg/day, observing morphological changes, as well as
transcriptome changes and inflammatory responses in testes of offspring (Jones et al.,
2014). The study identified Sertoli cells as one of the target testicular cell types, based on
alteration of mRNA expression for Sertoli markers Amh and Wt1, in adult PND120 rats.
Following this study, Jones et al. performed in utero exposure to GEN and DEHP at the
same dosing as previously mentioned to further analyze the effects of GEN-DEHP
mixtures in PND3 and PND6 rat testes, representing early gene responses. While various
genes were altered, including antioxidant genes, it is interesting that the authors saw a
decreased expression of ABP after exposure to either DEHP alone or GEN+DEHP
mixture in PND6 rat testes. They also observed Wt-1 gene expression to be decreased
significantly after exposure to DEHP alone but not GEN+DEHP mixture in PND3 rat
testes. To complement these studies, Walker et al. analyzed the testes of adult rats
exposed in utero to 0.1 and 10 mg/kg/day GEN+DEHP mixtures and observed an
increased rate of abnormal testicular phenotypes characterized by Sertoli cells only in
EDC-treated rats (Walker et al., 2020).

1.5.2 DBP and Nonyl Phenol mixtures
Another type of phthalate, DBP (and its metabolite MBP), was studied in mixture
with nonyl phenol (NP) which has weak estrogenic activity, on Sertoli cells isolated from
prepubertal rats (Li et al., 2010). While they reported no remarkable changes on Sertoli
cell morphology, a decreased cell viability was observed by Cell Counting Kit-8 (CCK-8)
assay after 24-hour exposure to high concentrations of DBP (100 μM) and NP (10 μM)
mixture. Additionally, the effects of NP and MBP were studied in vitro by treating 30-day-
old primary rat Sertoli cells and analyzing the data via two mathematical models, Loewe
additivity (LA) and Bliss Independence (BI) theory, used during risk assessments of EDCs

19

(Hu et al., 2012). The authors concluded that these two mathematical models were able
to indicate whether the combined effect of NP+DBP mixture had an antagonistic effect on
cell viability and lactate dehydrogenase (LDH) leakage assay, which evaluates plasma
membrane integrity. Furthermore, the authors extended their previous study of NP+MBP
mixtures by performing an in vitro analysis of primary rat Sertoli cells simultaneously with
an in vivo analysis of PND23-35 rats exposed to the same chemicals, using the BI model
to quantify their data (Hu et al., 2014). The comparison of in vitro
and in vivo Sertoli cell dysregulation by NP+MBP mixtures suggested that the BI model
was able to predict interactions between estrogenic and antiandrogenic effects of the
chemicals.

1.5.3 Phthalate mixtures
Kumar et al. performed a study to determine the effects of exposure to a mixture
of three phthalates: diethyl phthalate (DEP), diphenyl phthalate (DPP), and dimethyl
isophthalate (DMIP), using both in vivo and in vitro treatment of immature Sertoli cells
(Kumar et al., 2015). Data collected from in vitro treatment of 3-week-old primary mouse
Sertoli cells exposed for 24 hours to the phthalate mixture showed some similar trends to
the in vivo data on mRNA expression for various Sertoli cell markers. Additionally, in vitro
exposure to the phthalate mixture was suggested to alter the structural and functional
integrity of primary Sertoli cell culture, as seen in transmission electron microscopy (TEM)
data.

1.5.4 Paracetamol and EDCs
Paracetamol/acetaminophen is an over-the-counter analgesic and antipyretic drug
widely used by pregnant women and young children, that has been reported in
epidemiological studies to correlate with an increased incidence of male reproductive
disorders. Since these disorders are also associated with exposure to EDCs, Axelstad et
al. examined the effects of in utero exposure to paracetamol alone and in combination
with estrogenic and antiandrogenic EDCs, to explore the effects of these mixtures on
male fertility (Axelstad et al., 2018). Mostly concerned with changes in sperm count post-
exposure to mixtures, the authors found that the testes of rats exposed to estrogens,

20

antiandrogens, and paracetamol mixtures presented seminiferous tubules with reduced
germinal epithelium thickness and Sertoli-cell only phenotypes. Individual pesticides or
insecticides are known to affect male reproduction, which can be further impacted by
exposure to mixtures of pesticides. Patrick et al. used mixtures mimicking the exposure
conditions of field workers in South Africa, where malaria as a public health threat (Patrick
et al., 2016). These areas have significant EDCs contaminants including the anti-malaria
insecticides 1,1,1-trichloro-2,2-bis(p-chlorophenyl) ethane (DDT), 1,1-dichloro-2,2-bis(p-
chlorophenyl)ethylene (DDE), and deltamethrin (DM). Additionally, people living in these
areas are highly exposed to nonylphenol and cultural diets containing coumestrol,
genistein, and zearalenone. Based on in utero, lactational, and direct exposure to these
EDCs as mixtures, seminiferous tubules were found to have larger luminal sizes,
suggesting Sertoli cell toxicity and altered fluid retention. In comparison, Durand et al.
(2017) studied the mixed effects of two common fungicides carbendazim (CBZ) and
iprodione (IPR), as androgenic and anti-androgenic prototypes, on pubertal rat
seminiferous tubules (STs) in culture (Durand et al., 2017). Ex vivo treatment of cultured
STs from prepubertal rats that were exposed to CBZ, IPR, or the mixture, showed altered
ratios of germ to somatic cell (Sertoli) populations and reduced levels of key junctional
proteins Cx43 and Claudin 11 in samples exposed to the mixture. Lastly, Petricca et al.
reported the dysregulation of TM4 Sertoli cell proliferation, cell cycle arrest, and
mitochondria dysfunction in response to treatments with fungicides triazoles,
ketoconazole and miconazole and imidazole, prochloraz as mixtures, showing synergistic
effects (Petricca et al., 2022).

1.6 Discussion and concluding remarks

This review summarizes the mechanisms regulating Sertoli cell development and
functions from fetal to postnatal ages, emphasizing their pivotal role in regulating and
sustaining spermatogenesis, and provides a literature survey on the adverse effects of
fetal and perinatal exposure to EDCs and drugs on Sertoli cells. Although studies on
individual chemicals can be found relatively easily, the same cannot be said on the effects
of EDC mixtures and more complex paradigms mixing EDCs and drugs, on Sertoli cells

21

at different ages. The fact that humans are commonly exposed to such mixtures warrants
more research to close these gaps of knowledge. Several studies looking at EDC
mixtures and EDC-drugs mixtures are discussed here (Figure 1). Additive and synergistic
effects of some of these mixtures have been reported, further underscoring the need for
performing risk assessment with mixtures, in addition to individual chemicals.
While studies have clearly demonstrated that EDCs target Sertoli cells in animal
models, there is a lack of epidemiological and demographic data examining the
contribution of Sertoli cells to adverse phenotypes due to EDC exposure in human.
However, correlations can be inferred from studies reporting adverse effects of EDCs on
genes and functional pathways known to play a role in Sertoli cell, and epidemiological
data associating the disruption of these genes and pathways with male infertility in
human. For example, while the negative feedback of Sertoli cell-produced
Inhibin B on the hypothalamus and pituitary and its regulatory role on testicular functions
is well-established, a study reported the predictive value of circulating Inhibin B levels for
male infertility in human, based on the finding that infertile men had lower levels of
systemic Inhibin B than fertile men (Stewart & Turner, 2005).
Other studies have questioned the possible role of xenobiotic exposure in humans
by examining the expression levels of nuclear receptors known to bind EDCs in parallel
to assessing male fertility. This is the case of a study that compared the expression levels
of the Aryl hydrocarbon receptor (AhR) in fertile men and men with unexplained infertility
(Bidgoli et al., 2011). AhR binds EDCs such as tetrachlorodibenzo-p-dioxin (TCDD) and
Polycyclic Aromatic Hydrocarbons (PAHs), known to target Sertoli and Leydig cells and
to increase male infertility in animal models. The authors reported increased levels on
AhR in Sertoli, Leydig and spermatid cells in testicular biopsies of infertile men in
comparison to fertile men, proposing the measurement of AhR expression as a diagnostic
biomarker for idiopathic male infertility. These studies illustrate the convergence of animal
studies identifying hormones and nuclear receptors targeted by EDCs in Sertoli cells with
male infertility in human, in which the altered status of the same proteins correlates with
infertility, suggesting EDC exposures as possible causes of the diseases.

22

In recent years, the idea of combining the identification of new diagnostic tools with
the development of new therapies has emerged, defined as “theragnostics”, principally
applied to pharmaceutical research, where a theragnostic target can be a
single molecule or its interactome that can be used both as diagnostic and therapeutic
tool, applied to a specific disease, and devoid of human toxicity (Bacanlı et al., 2022;
Ozdemir et al., 2006). An example of that is the identification of NOX5-induced uncoupling
of endothelial NO synthase identified both as a cause and potential therapeutic target of
age-related hypertension (Elbatreek et al., 2020). Recently, the usefulness of the
theragnosis strategy has been extended to the determination of toxicant targets related
to disease, that could be used both in the prediction/diagnosis of toxicant-associated
disease and as therapeutic targets countering the toxicant adverse effects. This was
convincingly illustrated in a study where Keratin-18 level in serum was identified as a
diagnostic and prognostic of alcohol-associated hepatitis and further proposed as
theragnosis marker for predicting the efficacy of prednisolone therapy (McClain et al.,
2021).

Figure 1. Toxicant mixtures targeting Sertoli cells in testis. The zoom-in illustrates various
testicular cell types, including Leydig and peritubular myoid cells in the interstitium, and in the
seminiferous tubules, Sertoli cells and germ cells, from spermatogonia to subsequent
spermatogenic cells resulting in spermatozoa, which are released in the lumen. Sertoli cells
play a vital role during male gonad development and throughout spermatogenesis in
adulthood, acting as “nurse cells” of germ cells. Thus, assessing the impact of EDC and drug
exposures on these cells is important. Some of the mixtures discussed in this review are
highlighted here. A dashed arrow suggests indirect effects of exposure to toxicant mixtures on
Sertoli cells, whereas a solid arrow suggests direct effects of exposure to toxicant mixtures on
Sertoli cells.

23

Applying the same concept to Sertoli cell toxicity in relation to male infertility could
be advantageous. Indeed, using the example above of lower Inhibin B blood levels
correlating with male infertility in human, and findings that inhibin B was reduced in
rodents exposed to EDCs suggest that Inhibin B could potentially constitute a
theragnostic, providing both a diagnostic helping to recognize cases of infertility involving
Sertoli cell disruption, as well as a possible therapeutic tool. For example, since low
circulating inhibin B levels correlated with abnormal spermatogenesis and infertility,
identifying low Inhibin B levels could warn of possible adverse effects of a test
compound on Sertoli cells, and one could aim at increasing circulating Inhibin B by
upregulating its production by Sertoli cells. However, such intervention would require a
clear understanding of the mechanisms regulating the production of both alpha and beta
B subunits of Inhibin B, and the formation of the functional alpha-beta B dimer. Then, on
could target the molecular pathway(s) regulating these processes. On the other end, in
case when Inhibin B is abnormally elevated such as in inflammatory conditions (Okuma
et al., 2005), which have been associated with EDC exposures, one could try reducing
the excess circulating Inhibin B by immunoneutralization with a specific anti-inhibin B
monoclonal antibody (targeting either the alpha subunit or the dimer), or by modulating
its regulation, as a way to reduce the negative feedback of Inhibin B on the anterior
pituitary that blocks FSH production.
However, the production of adult Inhibin B is differently regulated than in younger
ages from birth to puberty: while testosterone and germ cells contribute to Inhibin B
regulation in adult, FSH plays a major role in infancy to childhood, where a positive
relationship is observed between Inhibin B and FSH, in contrast to the negative feedback
typical of adulthood (Anderson & Sharpe, 2000). As highlighted in this review, the effects
of EDCs in perinatal periods and adulthood on Sertoli cells are very different, with the
ability of immature Sertoli cells to proliferate or differentiate being primary targets at young
ages, whereas a primary target in the adult Sertoli cells is the maintenance of a functional
BTB. Thus, identifying specific functional pathways and proteins that are disrupted as part
of the mechanisms of toxicity of EDCs or pharmaceuticals in immature vs differentiated
adult Sertoli cells is essential.

24

The combination of in vitro and ex vivo Sertoli cell models corresponding to critical
developmental periods, in association with transcriptomics, epigenetics, proteomics and
metabolomic approaches, computer modeling and system biology, should help
understanding the mechanisms driving harmful EDC and mixed toxicants effects on the
male reproductive system, and performing more powerful risk assessment (Cote et al.,
2016).

1.7 Acknowledgements
This work was supported by funds from the University of Southern California School of
Pharmacy to MC; and did not receive any grant from funding agencies. The authors are
thankful to the USC School of Pharmacy for its financial support.

25

Chapter 2: DETERMINING EFFECTS OF EDCs AND DRUGS ON IMMATURE
SERTOLI CELL DEVELOPMENT in vitro
OBJECTIVE (AIM 1): To determine the effects of EDCs and drugs on immature Sertoli
cell development using mouse immortalized cell line TM4 and isolated PND8 rat Sertoli
cells.

2.1 ABSTRACT
Sertoli cells are essential for germ cell development and function. Their disruption by
endocrine disrupting chemicals (EDCs) or drugs could jeopardize spermatogenesis,
contributing to male infertility. Perinatal exposure to EDCs and acetaminophen (APAP)
disrupts male reproductive functions in animals and humans. Infants can be exposed
simultaneously to the dietary soy phytoestrogen genistein (GEN) and APAP used for fever
or pain relief. Our goal was to determine the effects of 10-100 µM APAP and GEN, alone
or mixed, on immature Sertoli cells, using mouse TM4 Sertoli cell line and postnatal-day
8 rat Sertoli cells, by measuring cell viability, proliferation, prostaglandins, genes and
protein expression and functional pathways. 50 µM APAP decreased viability, while 100
µM APAP and GEN decreased proliferation. Sertoli cell and eicosanoid pathway genes
were affected by GEN and mixtures, with downregulation of Sox9, Cox1, Cox2 and genes
relevant for Sertoli cell function, while genes involved in inflammation were increased.
RNA-seq analysis identified p53 and TNF signaling pathways as common targets of GEN
and GEN mixture in both cell types. These results suggest that APAP and GEN
dysregulate immature Sertoli cell function and may aid in elucidating novel EDC and drug
targets contributing to the etiology of male infertility.

1
This chapter is derived from a research manuscript in publishing review entitled “ Dysregulation
of immature Sertoli cell functions by exposure to acetaminophen and genistein in rodent cell
models” by Corpuz-Hilsabeck, et al.

26

2.2 Introduction
Sertoli cells (SCs), the “nurse cells” of germ cells in the male gonad (Griswold,
2018), play an essential role in the organization of seminiferous cords, testis-specific
vascular patterning, and appearance of other somatic cell types such as Leydig and
peritubular myoid cells in testis development, and in regulating spermatogenesis
throughout life (Corpuz-Hilsabeck, 2023; França et al., 2016). Androgen receptor
expression delineates their switch from an immature-proliferating status to the mature,
androgen responsive adult-type Sertoli cells formed at pre-puberty (Corpuz-Hilsabeck,
2023; Griswold, 2018). Fetal and/or perinatal exposures to environmental endocrine
disrupting chemicals (EDCs) during male gonad development can have long-lasting
effects thereafter, including disorders such as cryptorchidism, Sertoli cell only syndrome,
and infertility (Martinez-Arguelles et al., 2013; Skakkebaek et al., 2016).
Phthalates (phthalic acid esters) are a class of EDCs found ubiquitously in the
environment that cause male reproductive disorders (Martinez-Arguelles et al., 2013;
Walker et al., 2021). Di(2-ethylhexyl) phthalate (DEHP) and its biologically active
metabolite mono(2-ehtylhexyl) phthalate (MEHP) are found commonly used in shampoo,
cosmetics, hairspray, food packaging, and medical equipment. Xenoestrogens are also
common in the environment. Among them, the phytoestrogen genistein (GEN) is found
mainly in soy-based food products, and humans are exposed to it through diet, in
particular babies fed soy-based baby formula are exposed to high levels of GEN (Setchell
et al., 1997; Suen et al., 2022). In utero exposure to GEN was shown to alter testicular
function and signaling pathways in neonatal and adult rats (Thuillier et al., 2009; Walker
et al., 2020). There are limited studies examining the effects of EDC mixtures on the male
reproductive system, and their potential contribution to reproductive disorders, including
male infertility. In previous in vivo studies, we showed that in utero exposure to mixtures
of GEN and DEHP at doses found in human dysregulated more male reproductive
development than individual EDCs. Specifically, a higher rate of abnormal testicular
phenotypes consisting of atrophied tubules with Sertoli-cell-only phenotype was observed
in postnatal day 120 (PND120) rat testes exposed in utero to 0.1 and 10mg/kg/day of
GEN+DEHP mixtures (Walker et al., 2020) (Jones et al., 2014) (Jones et al., 2015). These
studies unveiled short-term oxidative stress events and long-term changes in innate

27

immune cells, in particular macrophages, suggesting inflammatory processes. Genes and
proteins representative of Leydig cells, germ cells and Sertoli cells were affected by in
utero exposures to GEN and DEHP. The expression of the Sertoli cell markers Abp and
Amh was downregulated in PND6 and PND120 rat testes following in utero exposures to
GEN and DEHP mixtures (Jones et al., 2014; Jones et al., 2015; Walker et al., 2020). The
in vitro study of the effects of GEN and MEHP at 10 µM and up on the C18-4
spermatogonial cell line further confirmed that undifferentiated spermatogonia were direct
targets of these EDCs, and showed that the eicosanoid pathway was disrupted, including
the gene and protein expression of Cox1 and Cox2 and prostaglandins production (Tran-
Guzman et al., 2022). These data put together, drive a compelling argument that
exposure to EDCs and drugs with Cox inhibiting properties such as APAP and NSAIDs
during perinatal phases of male gonad development could also disrupt immature Sertoli
cell function and development.
The pharmaceutical class of non-steroidal anti-inflammatory drugs (NSAIDs) such
as ibuprofen (Ibu) and analgesic drugs like acetaminophen (N-acetyl-para-aminophenol;
APAP; paracetamol) are commonly used to treat infants diagnosed with pain, severe
fever and some chronic diseases (Kristensen et al., 2016; Tran-Guzman & Culty, 2022).
Global prevalence of analgesic use across 10,000 pregnant women in the U.S. in 2005
and 6,500 pregnant women in 2013 showed that acetaminophen was the highest used
analgesic compared NSAIDs or other analgesic drugs (Zafeiri et al., 2021). These
pharmaceutical drugs are increasingly scrutinized for their effects on reproductive
development and function (Ben Maamar et al., 2017; Kristensen et al., 2016).
Intergenerational effects of high exposure to APAP and IB during pregnancy are
suspected to be at the origin of second and third generation offspring experiencing
lowered sperm count, delayed Sertoli cell maturation, and decrease in spermatogonia A
pool size (Rossitto et al., 2019).
The overall goal for the present study was to examine the effects of APAP/NSAIDs
and EDCs on immature Sertoli cells, to simulate infant exposure to these chemicals,
individually or as mixtures, as it can happen in the clinic setting or at home. There is a
gap of knowledge on the possible contribution of Sertoli cell dysregulation by EDCs and
pharmaceuticlas on male fertility. Studies on APAP in mixture with estrogenic and anti-

28

androgenic EDCs found in the environment showed that these exposures disrupted male
fertility (Axelstad et al., 2018; Corpuz-Hilsabeck, 2023), in support of our hypothesis. We
aimed at finding whether mixtures of EDCs and APAP/NSAIDs to which infants are
commonly exposed could worsen the effects of individual EDCs and/or pharmaceuticals
in immature Sertoli cells. The expectation was that exposure to these chemicals would
dysregulate immature Sertoli cell function and development, suggesting potential long-
term effects that could contribute to male infertility and reproductive disorders.
2.3 Materials and Methods
2.3.1 Chemicals
Genistein (4’,5,7-Trihydroxyisoflavone) (GEN, G), mono (2-ethylhexyl) phthalate (MEHP,
M), acetaminophen (APAP, A), and Ibuprofen (Ibu, Ib) were purchased from Sigma-
Aldrich (St. Louis, MO, USA). Stock solutions of 10
-1
GEN were dissolved in ultra-pure
grade dimethyl sulfoxide (DMSO from VWR Interational, Radnor, PA, USA) and MEHP,
APAP, and IB were dissolved in 100% ethanol (Commercial Alcohols, USA). Stock
solutions were stored at -20˚C.
2.3.2 TM4 Sertoli cell line culture
Murine Sertoli cell line TM4 (Cat. no. CRL-1715, ATCC, Manassas, VA, USA) were
cultured in GibcoÔ DMEM containing 4.5g/L d-Glucose, L-glutamine, and 110 mg/L of
sodium pyruvate (Thermo Fisher Scientific, Waltham, MA, USA) supplemented with either
10% heat-inactivated FBS (Regular-FBS, REG-FBS) or charcoal-stripped FBS (CS-FBS)
(Sigma Aldrich, St. Louis, MO, USA) and 1% Penicillin-Streptomycin solution 100X
(CorningÔ).
2.3.3 Primary cell isolation
Sertoli cells were isolated from postnatal day (PND) 8 rat testes as previously described
(Manku & Culty, 2015; Manku, Mazer, et al., 2012; Manku, Wing, et al., 2012). Testes
from 10 rat pups were decapsulated per experiment, sequential enzymatic dissociation
was performed, followed by differential plating O/N of the trypsin supernatant containing
Sertoli, myoid and germ cells, in RPMI 1640 medium (Invitrogen, Burlington, ON, CA)
with 5% heat inactivated FBS (Sigma Aldrich, St. Louis, MO, USA) at 37˚C, 3.5%CO2.
Next day, floating germ cells were removed by aspirating media and washes. Sertoli cells

29

were lifted by short trypsin treatment and replated in 10% FBS, Regular(Reg) or Charcoal-
stripped (CS) (Sigma-Aldrich, St. Louis, MO, USA) followed by treatments. Sertoli cell
purity was assessed based on Vimentin IF staining for Sertoli cells and α-SMA for
peritubular myoid cells, and nuclear DAPI dye for total cell numbers. Analysis with ImageJ
(FIJI) software of several samples gave a Sertoli cell purity of 68% (Supplemental Fig. 1).
2.3.4 Sertoli cell treatments
TM4 or PND8 rat Sertoli cells were plated in 6, 12, 24, or 96-well Corning culture-treated
plates at 10,000-1,000,000 cells/well for assays including qPCR, cell viability (MTT), and
cell proliferation (EdU). TM4 cells were grown overnight to reach 60-70% confluency in
media containing either REG-FBS or CS-FBS, then treated accordingly. After replating in
appropriate culture dish, PND8 rat Sertoli cells were grown over three hours to adhere,
then treatments were added. All treatments were diluted in cell culture medium containing
10% of either REG-FBS or CS-FBS and filtered with 0.2µm filters to prevent bacterial
contamination. Cells were treated with vehicle (containing the same % DMSO and ethanol
as treatments), or 10, 50, and 100µM of APAP, IB, GEN, and MEHP alone or as mixtures,
for 24 to 72 hours.
2.3.5 Cell viability
TM4 cells were plated in 96-well CorningÔ culture-treated microplates at 10,000 cells/
well and incubated overnight at 37˚C 5% CO2. MTT cell viability assay was followed
according to the manufacturer’s protocol (Roche Cell proliferation kit I MTT, Sigma
Aldrich, St. Louis, MO, USA). TM4 cells were cultured in DMEM supplemented with 10%
heat-inactivated FBS exposed to APAP, IB, GEN, and MEHP alone or as a mixture over
a 24-hour period. MTT reagent was added at the end of 24-hour incubation to incubate
for an additional 4 hours at 37˚C. Thereafter, 100µl solubilization solution was added to
each well and incubate overnight at 37˚C with humidity. Conversion of MTT reagent to
formazan crystals was measured using the VICTOR™ X5 Multilabel Plate Reader
(PerkinElmer, Inc., Waltham, MA, USA). Data are expressed as a fold change compared
to vehicle and calculated from three independent experiments conducted in triplicates.
2.3.6 Cell proliferation
TM4 cells were plated in 96-well CorningÔ culture-treated microplates at 10,000 cells/
well and incubated overnight at 37˚C 5% CO2. Cells were treated for 24 hours with EDCs

30

and APAP/NSAIDs alone or as mixtures diluted in 10% CS-FBS supplemented medium.
Incubation of 10µM EdU (5’-ethynyl-2’-deoxyuridine) was performed over the last 6 hours
of the 24-hour treatment as recommended by Click-iT™ EdU HCS assay (Invitrogen,
Carlsbad, CA, USA) manufacturer protocol. Cells in culture plate were washed with 1X
PBS and fixed to culture plate using 4% paraformaldehyde followed by a 0.1% Triton X-
100 permeabilization surfactant. Click-IT reaction was added to each well and incubated
in dark for 30 minutes at room temperature. Cells were subjected to a PBS wash step
and 100µl of HCS NuclearMask added at a 1:2000 dilution per well. After a 30 min
incubation at room temperature in the dark, cells were washed twice with PBS before
imaging. Fluorescent-labeled DNA was measured by Biotek Cytation 5 imaging and
quantification with GEN5 software (Biotek, Winooski, Vermont, USA).

2.3.7 Gene expression measured by qRT-PCR
TM4 Sertoli cells were plated at 100,000-150,000 cells/well whereas primary PND8 rat
Sertoli cells were plated 450,000-600,000 cells/well in a 24-well culture plate. ZymoÔ
Quick-RNA Miniprep plus kit was used for total RNA extraction from TM4 cells and
PND8 rat Sertoli cells (Zymo, Irvine, CA, USA). cDNA synthesis of TM4 cells and PND8
rat Sertoli cells from total RNA extracted using the PrimeScriptÔ RT Master Mix (Takara
Bio, Mountain View, CA, USA). The qPCR thermal cycler used for gene expression
analysis is BioRad CFX384 Touch Real-Time PCR System. Cycling conditions for
qPCR were as follows: initial step at 95 ◦C followed by 40 cycles at 95 ◦C for 15 s, 60 ◦C
for 1 min. This was followed by both melting curves and cooling cycles. The SYBR
Green system was used for gene amplification and comparative threshold cycle (Ct)
method used to analyze data, normalized to Gapdh.

Table 1. Primer sets for q-PCR analysis.
Gene Forward Primer Reverse Primer Product
Size (bp)
Rat
Gapdh CCATTCTTCCACCTTTGATGCT TGTTGCTGTAGCCATATTCATTGT 98
Sox9 TGCTGAACGAGAGCGAGAAG ATGTGAGTCTGTTCGGTGGC 160
Amh GTGGGTGGCAGCAGCACTAGG CGGGCTGTTTGGCTCTGATTCCCG 69
Ar CGGTCGAGTTGACATTAGTGAAGGACC ATTCCTGGATGGGACTGATGGT 66

31

Cox1 AGGTGTACCCACCTTCCGTA GGTTTCCCCTATAAGGATGAGGC 242
Cox2 ACGTGTTGACGTCCAGATCA CTTGGGGATCCGGGATGAAC 234
Ptgds ATTCAAGCTGGTTCCGGGAG CAGGAACGCGTACTCATCGT 242
Esr1 GCCACTCGATCATTCGAGCA CCTGCTGGTTCAAAAGCGTC 107
Ppar-α TGCGGACTACCAGTACTTAGGG GCTGGAGAGAGGGTGTCTGT 72
Mouse
Rps29 TGAAGGCAAGATGGGTCAC GCACATGTTCAGCCCGTATT 127
Cox1 CCTCTTTCCAGGAGCTCACA TCGATGTCACCGTACAGCTC 70
Cox2 CAGGACTCTGCTCACGAAGG ATCCAGTCCGGGTACAGTCA 231
Ptgds GGCTCCTGGACACTACACCT CTGGGTTCTGCTGTAGAGGGT 160
Ptges GGCTCCTCCAAAGACGGAAA TGGCACAGCATGGGTCTTAG 226
Ptgdr2 CACGTGTCGGTGCTGTTG GATGAGTCCGTTTTCCACCA 63
Amh GGGGAGACTGGAGAACAGC AGAGCTCGGGCTCCCATA 67
Ar ACCAGATGGCGGTCATTCAG TGTGCATGCGGTACTCATTG 135
Sox9 TCGGACACGGAGAACACC GCACACGGGGAACTTATCTT 96
Esr1 TCTCCTCAAACACATCCCGTG GGCGAGTTACAGACTGGCTC 96
Gper CCTGGACGAGCAGTATTACGATATC TGCTGTACATGTTGATCTG 77
Err-α CGCTGTCAGCTGGAGGAA ACCTTGGGCTCCGGCA 199
Err-β TCTTCCCAGCTCCCACAGTA CCCCATGCAAGCTTCGTAGT 106

2.3.8 PGD2 & PGE2 ELISA
TM4 cells plated at 250,000 cells/well in 12-well culture-treated plates and
incubated overnight at 37˚C 5% CO2. TM4 cells were treated with either APAP, GEN, or
the mixture at 50µM concentration that was dissolved in culture medium containing 10%
CS-FBS for a 24-hour treatment. Comparison of REG-FBS and CS-FBS supplemented
DMEM was performed (refer to Figure 2). Prostaglandin D2 and E2 ELISA assays were
purchased from Cayman Chemical (Ann Arbor, MI, USA). DMEM medium supplemented
with 10% CS-FBS was used without cells and conditioned media from control and treated
TM4 Sertoli cells and stored in -80˚C for later use in ELISA assay. Measurement of %B/B0
was performed using Cayman Chemical Excel spreadsheet for ELISA (Competitive)
Analysis available online. Each condition was performed in two separate experiments
with duplicates (n=4).

32

2.3.9 Immunofluorescent (IF) staining
TM4 cells were plated at either 125,000 cells/well in 24-well culture-treated plate
or 50,000 cells/well in 8-well chamber and grown overnight at 37˚C 5% CO2. Treatment
for 24 hours followed thereafter. Cells were washed with 1X PBS and fixed to culture plate
or slide chamber with 4% paraformaldehyde. Cell were permeabilized by addition of 0.1%
Trion-X 100 in 1X PBS solution for a 10-minute incubation at room temperature. Blocking
step for IF staining was performed by adding 5% donkey serum in 0.5% BSA in 1X PBS
solution to incubate for 30 minutes at room temperature. Antibodies incubated on cells at
1:100-1:300 diluted in 5% donkey serum in 0.5% BSA in 1X PBS solution overnight at
4˚C. Sox9 (anti-rabbit, catalog no. Ab185966, Abcam, USA) COX1 (anti-rabbit, catalog
no. 4841S, Cell Signaling, USA), COX2 (anti-rabbit, catalog no. ab52237, Abcam, USA),
ER-α (anti-rabbit, catalog no. MA1-310, Thermo Fisher Scientific, USA), PCNA (anti-
mouse, catalog no. sc-56, Santa Cruz), and α-Tubulin (anti-mouse, catalog no. T9026,
Thermo Fisher Scientific, USA) were used for IF staining in TM4 cells. Next day, cell
culture plate or slide chamber was washed three times with 1X PBS and decanting
between washes at room temperature. Secondary antibody was used at 1:400 dilution in
5% donkey serum in 0.5% BSA in 1X PBS solution which cells were incubated in dark for
30 minutes at room temperature. Fluorescent-labeled cells were washed three times with
1X PBS to remove excess antibody solution and slide chamber removed before addition
of DAPI-mounting medium and coverslip for glass slides. Cells were imaged and
fluorescence quantified using Biotek Cytation 5 imager and GEN5 software (Biotek,
Winooski, Vermont, USA). Fold change of immunofluorescent protein expression was
compared between treatment and vehicle conditions (n=4).

2.3.10 Whole transcriptome sequencing (Total RNA-seq)
Whole transcriptome sequencing or total RNA-seq was performed on an Illumina
Nextseq2000 platform by Keck Molecular Genomics Core (MGC) at University of
Southern California. Total RNA from both TM4 cells and 10 PND8 rat pups treated with
A50, G50, and AG50 was extracted as previously described above (n = 2-3 biological
replicates per species and condition). These RNA samples were submitted to the Keck

33

Molecular Genomics Core for library preparation and whole-transcriptome sequencing.
Quality control of RNA samples was performed using the Agilent Bioanalyzer 2100 and
samples with RIN > 8 were approved for Total RNA-seq analysis. cDNA libraries were
prepared using Takara SMARTer® Stranded Total RNA-Seq Kit v2 (Pico Input
Mammalian) and sequenced at read length of 2x100 cycles. Raw sequencing data was
provided by Keck MGC and further analyzed using Partek
®
Flow
®
software, v10.0 for
analysis. Within Partek
®
Flow
®
software, the Database for Association, Visualization and
Integrated Discovery (DAVID) software (https://david.ncifcrf.gov/) linked to the Kyoto
Encyclopedia of Genes and Genomes (KEGG) database (https://www.genome.jp/kegg/)
and Ingenuity Pathway Analysis (IPA) were used for gene ontology and pathway
enrichment analysis.

2.3.11 Statistical Analysis
Statistical analysis was performed using one-way ANOVA with post-hoc Tukey’s
or Fisher’s LSD tests for multiple comparison or unpaired two-tailed Student’s t-test for
cell viability, proliferation, qPCR, ELISA, and quantification of IF staining data analysis.
Total RNA-seq analysis was performed by normalization of differentially expressed gene
(DEG) counts using the DeSeq2 method within Partek
®
Flow
®
software. DEG counts were
determined by setting an FDR or p-value cut-off of 0.05 and fold-changes of -2 to +2.
2.4 Results
2.4.1 Sertoli cell viability and proliferation are dysregulated by exposure to APAP
and GEN
Measurement of cell viability by MTT assay of TM4 Sertoli cells showed significant
28 to 45% decreases in viability after 24h treatment with APAP at 50 and 100 µM
respectively. IB and GEN affected minimally viability at 100µM, with 17 and 14%
decreases respectively, while MEHP had no effect on cell viability (Fig. 1A). All IB-EDCs
and GEN-MEHP mixtures showed levels similar to control cells, whereas mixtures of
APAP with EDCs at 50 and 100 µM decreased viability compared to controls, but overall
had less effects than APAP alone (Fig. 1A). Because FBS contains prostaglandins (PGs)
and the effects of drugs inhibiting Cox enzymes were tested, we compared TM4 cells

34

growth rates and responses to APAP and GEN treatments up to 72h in regular vs
charcoal-stripped FBS, which contains less PGs than untreated FBS (Tran-Guzman et
al., 2022). The growth rate of control TM4 cells over 48h was similar in REG-FBS and
CS-FBS supplemented medium (Fig. 1B). Cell viability over 72h showed no effect with 10
µM APAP and GEN (Fig. 1B). Similar inhibitory effects of 50 and 100 µM APAP on viability
were found for both FBS types, with decreases ranging from 60 to 80 % with 50 µM, and
80 to 90 % with 100 µM APAP at 48 and 72h (Fig. 1C). Viability declined also with GEN,
from 20 to 40 % with 50 µM and 40 to 60 % with 100 µM at 48h and 72h, similarly with
both serum types (Fig. 1B). APAP-GEN (AG) mixtures had effects similar to APAP alone.
Considering that the type of FBS used did not impact noticeably the results, subsequent
experiments were performed in medium supplemented with CS-FBS.

Figure 2. Effects of APAP, IB, GEN, and MEHP on TM4 cell viability measured by MTT
assays. (A) Cell viability after 24h treatments with vehicle (Veh), APAP, IB, GEN or MEHP
at 10, 50, and 100µM, alone or mixed, in 10% Reg-FBS. (B) Cell growth at 24 and 48h in
Reg-FBS vs CS-FBS (raw absorbance values). (C) Cell viability in medium containing
10% Reg-FBS or CS-FBS from 24 to 72 hours. Black: vehicle. Colors: indicated
treatments. Data are means ± SEM of three independent experiments performed in
triplicates. One-way ANOVA, multiple comparisons; * p≤0.05; ** p≤0.01; *** p≤0.001.

35

Next, cell proliferation was measured in TM4 cells by Click-iT™ EdU assays. 24h
treatment with APAP reduced proliferation in a dose-dependent manner, with a
decreasing trend at 50µM and significant 70 % decrease with 100µM. GEN at ≤ 50µM did
not affect proliferation, whereas 100µM reduced proliferation by 60 % (Fig. 2A). APAP
and APAP+GEN at 10 µM slightly increased cell proliferation compared to vehicle. At 100
µM, MEHP significantly increased proliferation by 1.5-fold, but it did not modify the effects
of either GEN and APAP (Fig. 2A). Proliferating Cell Nuclear Antigen (PCNA) protein (red)
and the Sertoli cell marker Sox9 (green) were decreased by 50 µM GEN and the mixture,
in agreement with the EdU data, but not APAP, and they co-localized in nuclei (Fig. 2B).
Because MEHP did not decrease proliferation and viability, the remaining experiments
focused on APAP and GEN, which could decrease the numbers of Sertoli cells, which
could have negative effects on germ cell development and spermatogenesis.

36

Figure 3. APAP and GEN but not MEHP inhibit cell proliferation and Sox9 expression in
TM4 Sertoli cells. (A) EdU assay was performed in TM4 cells after 24h exposure to APAP
and GEN alone and mixted at 10, 50, and 100 µM. Data are means ± SEM of three
independent experiments performed in triplicates. One-way ANOVA, multiple
comparisons; * p≤0.05; ** p≤0.01; *** p≤0.001. (B) Representative pictures of co-IF
staining of PCNA (red) and Sox9 (green) in TM4 cells treated for 24h with 50µM APAP
and GEN, alone or in mixture. Scale bar: 50 µm.

To verify that the data obtained with the immature mouse TM4 Sertoli cell line were
applicable to primary immature Sertoli cells, we performed experiments on enriched
postnatal-day (PND)8 rat Sertoli cells, an age at which Sertoli cells are immature and non-
responsive to androgen. Because imortalized TM4 cells were generated from PND11-13

37

mice, a slightly more advanced age, we first compared the transcriptome of the two Sertoli
cell populations by whole transcriptome sequencing (RNA-seq) of control mouse TM4
cells and PND8 rat Sertoli cells, by comparing > 15,000 orthologue genes identified in
mouse and rat libraries (Fig 3A). Based on the mean expression of orthologues in control
samples between immature mouse and rat Sertoli cells, the linear correlation gave
coefficients of 0.684 (pearson) and 0.77 (spearman). Looking at data after log2
transformation of the mean expression values, gave correlation coefficient for
Spearman's test of 0.774 and for Pearson's test 0.757. These correlation coeficients
indicated an overall good transcriptome similarity between the two Sertoli cell models.
The expression levels of the Sertoli cell marker Sox9 was in the same relatively
low abundance range, between 10 to 30 RPM (Reads per million mapped reads
corresponding to Sox9) in TM4 and PND8 spermatogonia (Fig. 3B). We also examined
the expression levels of different estrogen receptors types to which GEN could potentially
bind, and genes of the eicosanoid pathway targeted by Cox inhibitors (Fig. 3C-D). A
comparison across receptors known to bind estrogenic molecules and selective estrogen
receptor modulators showed that the ranking of relative abundance of the genes was
similar in both cell types, although PND8 Sertoli cells expressed 2 to 8 times less of each
gene than TM4 cells. Estrogen Receptor α (Esr1, Erα) was the most abundant receptor
in both TM4 cells and PND8 Sertoli cells, followed by the orphan Estrogen Related
Receptor α (Essra, Esrr-α, Err-α), the G Protein-coupled Estrogen Receptor
Gper1/Gpr30, Essrβ (Esrrb, Err-β), and the Estrogen Receptor β (Esr2, Erβ) (Fig. 3C).
Comparison of Cox-related genes relative gene expression showed that they
were expressed at similar levels in both cell types. However, Cox1 and Cox2 (Ptgs1 and
Ptgs2) were the most abundant and expressed at comparable levels in TM4 cells,
whereas Pla2 and Cbr1 were the highest in PND8 Sertoli cells, and Cox2 (Ptgs2) was
15 times higher than Cox1 (Ptgs1) (Fig. 3D). With the exception of the higher
expression level of Esr1 in TM4 cells, the relative gene expression levels observed in
TM4 and PND8 rat Sertoli cells were within a similar range, ≤ 100. Overall, the
comparison of the two Sertoli cell models showed a good correlation between their
transcriptomes in control cells, suggesting that the two immature Sertoli cell models

38

have comparable transcriptomes and functions, despite being from different rodent
species, further validating the use of TM4 cells as surrogates for immature Sertoli cells.

Figure 4. Comparison of the transcriptome and selected genes between immature mouse
TM4 Sertoli cells and PND8 rat Sertoli cells. Relative gene expression was determined
by RNA-seq analysis. (A) Correlation plot of orthologous genes between TM4 and PND8
Sertoli cells. Relative expression level of Sox9 (B), estrogen receptors (C) and Cox-
related genes (D) in TM4 cells and PND8 rat Sertoli cells. Data are the mean ± SEM of
samples from three experiments per cell type. Each cell preparation of rat Sertoli cells
was obtained by pooling the Sertoli cells from 10 PND8 rat pups.

The expression of Sex-determination and Sertoli cell specific marker Sox9 was
measured by qPCR analysis in cells treated for 24h with 10 to 100 µM APAP and GEN
alone or mixed in both TM4 cells and primary PND8 rat Sertoli cells (Fig. 4A). In TM4

39

cells, Sox9 mRNA levels were significantly reduced by 39 and 35 % of the control levels
by 50 and 100 µM APAP, while there was a 40 to 50 % reduction of Sox9 in cells treated
with GEN starting at 10 µM, showing toxicity at lower dose for GEN than APAP (Fig. 4A).
The mixture has similar effects as GEN. In PND8 Sertoli cells, 100 µM APAP significantly
decreased Sox9 expression by 30%, while 50 and 100 µM of GEN decreased Sox9 by
36 and 28 %, respectively, and the mixture had similar effects (Fig. 4A). Additionally, in
TM4 cells co-stained for α-Tubulin (red) and Sox9 (green) proteins, the number of cells
with Sox9 positive nuclear signal was highly reduced by 50µM GEN and APAP-GEN
mixture, in agreement with the decreases in mRNA levels (Fig. 4B). The proportion of
Sox9-positive cells after APAP exposure was also decreased, but to a lesser extent (Fig.
4B).

40

Figure 5. Exposure to APAP and GEN decreases Sox9 expression in mouse TM4 and
PND8 rat Sertoli cells. (A) Sox9 mRNA expression analyzed by qPCR after 24h treatment
with APAP and GEN at 10, 50, and 100 µM was observed in TM4 and PND8 rat Sertoli
cells cultured in CS-FBS supplemented media. Each condition was performed in triplicate
in three independent experiments and plotted as mean ± SEM. One-way ANOVA, multiple
comparisons; * p≤0.05; ** p≤0.01; *** p≤0.001. (B) Representative pictures of Sox9
protein IF signal (green) in TM4 cells after 24h treatment with vehicle (Veh) or 50µM
APAP and GEN, alone or mixed. Negative control were obtained using only a secondary
antibody. Cytoplasm was labelled using α-tubulin IF signal (red), contrasting with Sox9
and DAPI (blue) nuclear localization. Scale bars: 50 µm.

2.4.2 Eicosanoid pathway is dysregulated in immature Sertoli cells exposed to APAP,
GEN, and their mixtures

41

APAP is known to inhibit Cox activity and decrease PG synthesis in some tissues
and cells, including adult human testis (Albert et al., 2013). Similarly, GEN was reported
by us and others to alter Cox enzymes and PG synthesis in spermatogonia and prostate
cancer (Swami et al., 2009; Tran-Guzman et al., 2022). Thus, we postulated that it could
also be the case in Sertoli cells. Indeed, both APAP and GEN reduced the levels of PGD2
and PGE2 secreted by TM4 cells treated for 24h with 50 µM APAP and GEN, alone and
as mixtures, with GEN exerting stronger inhibitory effects. PGD2 was reduced by 49%
with APAP, 60% by GEN and 63 % by the mixture respectively (Fig. 5A). APAP decreased
PGE2 by 68%, GEN reduced it by 75% and their mixture exerted the strongest inhibitory
effects, with 89% decrease of PGE2, 4.4 pg/ml PGE2 secreted by treated cells compared
to control levels at nearly 40 pg/ml (Fig. 5A). Noticeable, PGD2 concentration in control
TM4 cell supernatants was 18 times higher than that of PGE2, although the transcript of
Ptges was 8 times higher than that of Ptgds in TM4 cells (Fig. 3D), suggesting that the
levels of enzymes and/or activities did not match the levels of synthase transcripts.
Measurement of PGD2 and PGE2 concentrations in TM4 cells cultured in medium with
10% REG-FBS (with higher PG contents) showed a similar inhibitory trend when exposed
to 50µM APAP or GEN alone and as mixtures (data not shown).
In TM4 cells the gene expression of Cox1 and Cox2 was decreased in RNA-seq
analysis after 24h exposure to 50µM APAP and GEN alone and as mixtures compared to
vehicle, with stronger inhibitions induced by GEN and the mixtures (Fig. 5B). Validation
by qPCR analysis showed significant downregulation of Cox1 and Cox2 genes by GEN
alone and APAP+GEN mixture at 10 to 100 µM in TM4 cells, in agreement with the RNA-
seq data (Fig. 5C). However, APAP alone did not significantly decrease Cox1 and Cox2
expression, in contrast to RNA-seq data. This discrepancy could be due to the use of
more samples for qPCR analysis and suggest more variability in the effects of APAP on
TM4 cells. Protein levels of Cox 1 (green, left panels) and Cox2 (green, right panels)
measured by immunofluorescence and quantified in TM4 cells showed significant
decreases after exposure to GEN alone and APAP+GEN mixture at 50µM, in agreement
with the changes in mRNA found by RNA-seq and qPCR (Fig. 5D-E). APAP did not
decrease, but rather showed an increasing trend in Cox1 and Cox2 protein levels, in
accord with the qPCR data for APAP effects on transcripts. Notably, TM4 cell morphology

42

was changed by GEN, with the cells and their nuclei appearing larger than in control and
APAP-treated cells.
In PND8 rat Sertoli cells, Cox1 expression was not affected by APAP, but 100µM
of GEN and the mixture caused significant upregulation of Cox1 expression. Cox2
expression was significantly decreased by APAP and GEN alone, while it was close to
control levels with APAP+GEN mixtures at 50 and 100µ M (Fig. 5F).
Taken together, the mRNA and protein data showed that GEN disrupted more
Cox1 and Cox 2 expression and PG synthesis than APAP. Moreover, the effects of GEN
on Cox2 were similar in TM4 cells and immature rat Sertoli cells.

43

Figure 6. Effects of APAP and GEN on prostaglandin synthesis and Cox1 and
Cox2 expression in TM4 and PND8 immature Sertoli cells. (A) PGD2 and PGE2 levels
were measured by ELISA assays in the supernatant of cells treated with 50 µM of APAP,
GEN and their mixture for 24h. (B) Total RNA-seq analysis showing Ptgs1 (Cox1) and
Ptgs2 (Cox2) in TM4 cells exposed to 50µM APAP and GEN alone or mixed for 24h. (C)
mRNA expression of Cox1 and Cox2 measured by qPCR analysis in TM4 cells treated
for 24h with 10, 50, and 100µM of APAP, GEN or mixtures. Data are means ± SEM of
three independent experiments performed in triplicates. One-way ANOVA, multiple
comparisons; * p≤0.05; ** p≤0.01; *** p≤0.001. (D) Protein expression of Cox1 and Cox2
in TM4 cells exposed to 50µM APAP and GEN alone or mixed for 24h examined by
immunofluorescent staining. Green: Cox1 (left) and Cox2 (right) proteins; Red: α-Tubulin
expression, used to label the cytoplasm. Blue: DAPI nuclei staining. Representative

44

pictures are shown. Scale bars: 50 µm. (E) Quantification of Cox1 and Cox2 signal
intensity plotted as fold change in mean intensity signal at 488nm as a compared to
control. Two independent experiments with duplicates per condition were performed and
plotted as means ± SEM. (F) mRNA expression of Cox1 and Cox2 measured by qPCR
analysis in PND8 rat Sertoli cells treated for 24h with 10, 50, and 100µM of APAP, GEN
or mixtures. Data are means ± SEM of three independent experiments performed in
triplicates. One-way ANOVA, multiple comparisons; * p≤0.05; ** p≤0.01; *** p≤0.001.

Next, we examined the expression of the PGD2 synthase, Ptgds and PGE2
synthase, Ptges and the receptor for PGD2, DP2 in TM4 cells by qPCR analysis. The
expression of Ptgds was significantly upregulated by 4- to 6-fold in cells exposed to APAP
at 50 µM and GEN at 10 and 50 µM and the mixtures as compared to vehicle (Fig. 6A).
APAP had no effect on PGD2 receptor Dp2 (Ptgdr2), but GEN and the mixture at 50 µM
increased its expression by over 2-folds (Fig. 6B). Ptges expression was not significantly
affected by exposure to APAP and GEN, except for a 1.8-fold increase with APAP at 50
µM (Fig. 6C).
In PND8 rat Sertoli cells, Ptgds expression showed upregulation trends in cells
treated with GEN alone, and it was significantly increased by APAP+GEN mixture at
50µM (Fig. 6D). These changes were similar to the changes in Ptgds expression
observed in TM4 cells.

PND8 rat
Sertoli cells
TM4 cells C Ptges
3
2
0
1
Gene expression
Fold change over control
Ptgds
16
12
8
0
Gene expression
Fold change over control
4
TM4 cells A Dp2
3
2
0
1
Gene expression
Fold change over control
TM4 cells B
Ptgds
2.0
1.0
0.5
0.0
1.5
Gene expression
Fold change over control
D

45

Figure 7. Cox-related genes are altered by exposure to APAP, GEN and their mixtures
in TM4 and PND8 rat Sertoli cells. Ptges, Ptgds, and DP2 (Ptgdr2) expression was
determined in cells treated for 24h with APAP and GEN, alone and as mixtures, at 10, 50,
and 100µM. (A, B, C) Gene expression in TM4 cells. (D) Gene expression in TM4 cells in
PND8 rat Sertoli cells. Each condition was performed in triplicate in three separate
experiments, and presented as mean ± SEM reported. One-way ANOVA, multiple
comparisons; * p≤0.05; ** p≤0.01; *** p≤0.001.

2.4.3 Estrogen receptors dysregulation in immature Sertoli cells by APAP and GEN
We examined next if APAP or GEN affected the expression of estrogen receptors
by measuring the transcript levels of Esr1 and Gper in TM4 and PND8 rat Sertoli cells by
qPCR analysis. Gper showed variable levels in cells treated with APAP, and decreasing
trends with GEN and the mixtures. The most striking effect was the 4-fold increase of
Esr1 mRNA in cells treated with APAP at 50 and 100 µM, a 2-fold increasing trend with
GEN and the mixtures at 10 and 50 µM, and significant 2.8-fold and 3-fold increases with
100 µM GEN and the mixture respectively (Fig. 7A). In PND8 rat Sertoli cells, Esr1 was
minimally affected by APAP and GEN, but the mixtures induced dose-dependent
decreases, with a significant 50% decrease with 100 µM APAP+GEN (Fig. 7A).
Immunostaining of ERα (green) in TM4 cells treated with GEN and APAP+GEN mixture
at 50µM was decreased (Fig. 7C), which was different from the mRNA changes observed.

46

Figure 8. Effects of APAP and GEN on the expression of estrogen receptors in TM4 cells
and PND8 rat Sertoli cells. (A) Gper and Esr1 gene expression in TM4 cells (A) and Esr1
in rat Sertoli cells after 24h exposure to APAP and GEN alone or mixed at 10, 50, and
100µM. Data are the means ± SEM of 3 experiments each performed in triplicate for each
condition. One-way ANOVA, multiple comparisons; * p≤0.05; ** p≤0.01; *** p≤0.001. (B)
Representative pictures of immunofluorescent staining of ER-α (green) in TM4 cells
treated with 50 µM of APAP, GEN or the mixture. DAPI (blue) nuclei staining. Scale: 50
µm.

2.4.4 Dysregulation of immature Sertoli cell differentiation by APAP and GEN
To assess the effects of APAP and GEN on immature Sertoli cell differentiation, we
measured the mRNA expression of Amh, a marker of fetal and neonatal immature Sertoli
cells, and the Androgen Receptor Ar which is expressed in differentiated mature Sertoli
cells, in TM4 cells and PND8 rat Sertoli cells. In TM4 cells, the gene expression Amh was
significantly upregulated in a dose-dependent manner by exposure to APAP alone and
APAP+GEN mixtures at 50 and 100µM, reaching 2.5-fold increases, and by 100µM GEN
(Fig. 8A). In contrast, Amh showed a decreasing trend in PND8 Sertoli cells, with a
significant 40% decrease by APAP+GEN at 100µM (Fig. 8B).
The expression of the mature Sertoli cell marker Ar was upregulated in TM4 cells
by 2-folds with 100 µM APAP and 10 and 50 µM GEN (Fig. 8A), while their mixture

47

induced an initial 3-fold increase, but a dose-dependent inhibition by GEN at 50 and 100
µM respectively (Fig. 8A). In PND8 rat Sertoli cells, Ar expression was significantly
reduced by all treatments, with a maximum decrease at 40% of the control values. The
difference in the responses to APAP and GEN between the two cell types suggests that
the rat PND8 Sertoli cells were not at the exact same developmental stage as the mouse
TM4 cells, which were generated from PND11 to 13 mice, closer to the period at which
Sertoli cells differentiate. This also suggest that early immature and late immature Sertoli
cells may have opposite responses to APAP and GEN.

Figure 9. Expression of immature Sertoli cell marker Amh and mature Sertoli cell Ar in
TM4 and PND8 Sertoli cells in response to APAP and GEN. Gene expression was
analyzed by qPCR. Data are expressed as means ± SEM of three experiments with
each condition performed as triplicate. One-Way ANOVA with multiple comparisons. *
p≤0.05; ** p≤0.01; *** p≤0.001.
3.5 APAP and GEN disrupt TM4cells and PND8 Sertoli cell transcriptomes
To identify key molecular mechanisms and functional pathways dysregulated by
APAP and GEN, we analyzed their transcriptome by Total RNA-seq analysis to identify
differentially expressed genes (DEGs), followed by pathway analysis with KEGG and

48

Ingenuity Pathway Analysis (IPA), on TM4 and PND8 rat Sertoli cells treated for 24h with
vehicle or 50µM APAP, GEN or their mixture. Venn diagrams representing DEG counts
for each treatment type in each Sertoli cell model found 704 DEGs in TM4 cells and 256
DEGs in PND8 Sertoli cells for all treatments together, with most DEGs occurring in cells
treated with GEN and the mixture (Fig. 9A, B; full list in Supplemental Table 1). These
data indicated a heightened sensitivity of the immortalized TM4 cells to GEN compared
to the PND8 Sertoli cells (110 GERs in TM4 cells vs 40 DEGs in PND8 Sertoli cells
respectively), suggesting a more limited ability of the cell line to adapt to the
environmental/dietary stressor GEN (Fig. 9A, B). The results also implied that the PND8
Sertoli cells had similar susceptibility to APAP and GEN (48 vs 40 DEGs respectively)
(Fig. 9A, B). DEGs comparison highlighted that the effects observed in response to the
mixtures were mainly driven by GEN in both cell types. Indeed, there were only 2 DEGs
were uniquely detected in TM4 cells exposed to APAP, 4 common between APAP and
the mixture, and 37 common to APAP, GEN and the mixture. The remaining DEGs were
attributed to GEN and the mixture, including 367 common between these conditions, and
37 shared with APAP too. Interestingly, in PND8 Sertoli cells, there were 48 DEGs unique
to APAP treatment, and none shared with GEN or the mixture, suggesting a very
distinctive effect of APAP on immature Sertoli cells. In PND8 Sertoli cells, the majority of
the DEGs were found in cells treated with GEN and the mixture, with 63% being common
to both. This further hinted at the absence of interaction between the eicosanoid and
estrogen pathway in immature PND8 Sertoli cells, whereas the two pathways shared
common targets in TM4 cells. Overall, these data supported the results obtained by
measuring specific gene related to Sertoli cell functions by qPCR analysis.

Figure 10. Differentially expressed genes in TM4 cells and PND8 Sertoli cells treated
with 50 µM APAP, GEN and APAP-GEN mixture. RNA-seq analysis was used to analyze
the transcriptomes of immature TM4 cells and PND8 rat Sertoli cells treated with APAP
and GEN alone or mixed. Venn diagrams display statistically significant differentially

49

expressed gene (DEG) counts using false discovery rate or p-value ≤ 0.05 with a cutoff
range of -2 to +2 in Partek Flow.

Looking at the 10 most up- and down-regulated genes by 50 µM APAP, GEN or
their mixture in both cell types showed that the amplitude of fold changes with GEN and
the mixture was stronger in TM4 cells that in primary Sertoli cells. Despite sharing
common target pathways, the most up- and down-regulated DEGs were different between
cell types. Some genes were shared between GEN and the mixture, and a few were also
altered by APAP, but to a lesser extend (Table 2). For example, Ereg, a growth factor of
the EGF family secreted by Sertoli cells (Chen et al., 2016), was decreased by 5-fold with
APAP, but by 15- and 18-fold by GEN and the mixture, respectively. Similarly, Hbegf
(Heparin-Binding EGF-Like Growth Factor), which is involved in ErbB signaling pathway
and Akt regulation, was downregulated by 3-fold with APAP but 12-fold by GEN and the
mixture. Since AKT is involved in the regulation of immature Sertoli cell proliferation and
anti-apoptosis (Chen et al., 2022), decreases in proteins regulating its activity could
antagonize immature Sertoli cell functions. Other DEGs were unique for one treatment,
such as Lif (Leukemia Inhibitory Factor) secreted by Sertoli cells under TNFa control and
important for SSC survival (França et al., 2016), that was decreased by 3-fold by APAP
only. Another important factor produced by Sertoli cells is the chemokine Ccl20 (CC-
chemokine ligand 20) that was reduced by 10- and 13-fold by GEN and the mixture,
respectively. Since Ccl20 was recently shown to be released in Sertoli cell exosomes that
regulate Leydig cell survival (Ma et al., 2022), reducing its production by Sertoli cells could
hinder Leydig cell function. Another gene downregulated by ~9-fold in GEN-treated TM4
cells is Usp18 (Ubiquitin specific protease 18), shown in other models to promote
proliferation and be negatively regulated by Wt1 (Wilms tumor gene), a transcription factor
known to play a role in spermatogenesis (Shahidul Makki et al., 2013) (Wang et al., 2013),
and to inhibits interferon signaling (Honke et al., 2016). Thus, Ups18 reduction could have
multiple consequences. The most decreased gene was Fosl1, part of transcription factor
AP-1 complex, that was reduced by 15- and 22-fold by GEN and the mixture respectively.
Fosl1 is normally upregulated in immature Sertoli cells (Gautam et al., 2018), and thus,
its decrease could perturb their development. Among upregulated genes, Mettl26
(Methyltransferase like 26; JFP2) was upregulated by ~8-fold by APAP and GEN, but

50

nothing is known on the role of this enzyme. The gene Greb1 (growth regulating estrogen
receptor binding 1) which has been reported to be regulated by Esr1 in TM4 cells and
primary Sertoli cells (Lin et al., 2014), and to be involved in hormone-responsive breast
and prostate cancers, was increased by 3.5-fold only by APAP+GEN mixture. However,
its function has yet to be discovered. More is knowing on the role of the cholesterol
esterifying enzyme Acat2 (Acetyl-CoA Acetyltransferase 2), that was increased by 3-fold
by APAP and by 5-fold by GEN and the mixture. Acat2 is known to play a role in
cholesterol homeostasis in testis (Akpovi et al., 2014), and its increase could dysregulate
cholesterol in Sertoli cells.
In PND8 Sertoli cells, different up- and down-regulated genes were at the top of
the list, despite many genes , the most decreased (by 13-fold) gene by APAP was
Hoxb1 (Homeobox b1), a transcription factor involved in morphogenesis and is
associated with gene repression (Singh et al., 2021). The transcription repressor E2F8
was decreased is E2F8 by GEN and the mixture, by more than 5-fold. This gene is
involved in some cancers, and in the switch from mitosis to meiosis in female germ cells
(Zhang et al., 2023). However, its role in Sertoli cell is unknown. Cdca3 (Cell division
cycle associated 3) was also decreased by ~5-fold by GEN and the mixture. Increase in
this gene is associated with poor prognosis in several cancers, but nothing has been
reported for a role in Sertoli cells. PBK (PDZ Binding Kinase; Spermatogenesis-Related
Protein Kinase) is another gene with no known function in testis that was reduced by
~5-fold by GEN and the mixture. The most upregulated gene in PND8 Sertoli cells is
Gdf15 (growth differentiation factor 15), a member of the TGFb family that is secreted
and activates Smad signaling cascade. It has been shown to be involved in cell repair,
to be increased in inflammation and oxidative stress, and in testicular cancer (Altena et
al., 2015). A gene known for its critical role in connecting Sertoli and germ cells and
regulating Sertoli cell development and spermatogenesis is the Gap junction alpha-1
protein (Gja1; Connexin 43) (Sridharan et al., 2007). In this study, Gja1 KD in mice was
shown to delay Sertoli cell maturation and aberrantly maintain their proliferation in
adulthood. In the present study, Gja1 was upregulated by ~4-fold in GEN-treated TM4
cells, suggesting that it could participate to early Sertoli cell maturation, as suggested by
the finding of androgen receptor increase in GEN-treated cells compared to control cells

51

(Fig. 8A). Interleukin 6 (Il6) is another gene increased by 5-fold and 2.7-fold by GEN
and the mixture respectively. Ptx3 (pentraxin 3), which increased by 2.6-fold with GEN,
is also involved in inflammation and cancer (Bogdan et al., 2022) . It is expressed in the
male reproductive tract and semen (Doni et al., 2009).

Table 2. List of down- and up-regulated genes in TM4 and PND8 Sertoli cells treated with
50 µM APAP, GEN or their mixtures.

KEGG analysis for pathway enrichment and functions commonly altered in TM4
Sertoli cells and PND8 rat Sertoli cells exposed to 50 µM APAP-GEN mixture highlighted
terms including viral carcinogenesis, necroptosis, transcriptional misregulation in cancer,
p53 signaling pathway, cellular senescence, TNF-signaling pathway and pathway
involving protein interaction with cytokine and cytokine receptor (Table 3A). It is
interesting that the shared pathways suggest that the mixture of APAP and GEN (mainly
driven by GEN) disrupts genes related to cancer and inflammation. Exclusive to TM4 cells

52

exposed to the mixture were pathways such as Ribose biogenesis, AMPK, NF-kappa β,
IL-17, Steroid biosynthesis and TGF-β signaling were detected, including pathways
known to play a role in Sertoli cell functions (Table 3B). PND8 rat Sertoli cells exposed to
AG50 highlighted FoxO, 3 types of cancers, PI3K-Akt and JAK-STAT signaling pathways,
also involved in Sertoli cell functions (Table 3C). Following the KEGG pathway analysis,
Ingenuity Pathway Analysis (IPA) database showed predicted changes to key signaling
molecules in the estrogen and eicosanoid signaling pathways in TM4 cells treated for 24h
with 50 µM APAP-GEN mixture (Supplemental Fig.2, A, B). IPA hignlighted more
downregulated genes and predicted inhibition in the estrogen receptor and eicosanoid
related pathways. Some of the genes that were the most up- or down-regulated fitted
withing these functional categories, with genes decreased by GEN potentially disrupting
Sertoli cell functions, whereas some of the upregulated genes suggested inflammatory
processes.

Table 3. Common functional pathways altered in TM4 cells and PND8 rat Sertoli cells by 50µM
APAP+GEN mixture.

TM4 cells PND8 rat Sertoli cells
Pathway description Enrichment
Score
P-value Genes
Enrichment
Score
P-value Genes
Necroptosis
18.7
7.39E-
09
22 3.4
3.50E-
02
4
Viral carcinogenesis
10.1
4.01E-
05
20 9.9
5.17E-
05
9
Transcriptional misregulation in
cancer
13.5
1.36E-
06
21 7.0
9.35E-
04
7
MicroRNAs in cancer
6.8
1.10E-
03
14 4.0
1.80E-
02
5
p53 signaling pathway
5.9
2.61E-
03
8 12.5
3.73E-
06
7
Cellular senescence
6.0
2.47E-
03
14 10.8
1.95E-
05
9
TNF signaling pathway
4.5
1.16E-
02
9 3.9
2.10E-
02
4
Viral protein interaction with
cytokine and cytokine receptor
5.2
5.72E-
03
8 3.1
4.32E-
02
3

53

Table 4. Functional pathways uniquely dysregulated by 50µM APAP+GEN mixture in
TM4 cells.

Table 5. Functional pathways uniquely dysregulated by 50µM APAP+GEN mixture in
PND8 rat Sertoli cells.

2.5. Discussion
2.5.1 Dysregulation of Sertoli cell development by APAP and GEN
The goal of this study was to examine whether exposing infants to common EDCs
and frequently used antipyretic/analgesic drugs could present a risk to the developing
male reproductive system by altering immature Sertoli cell functions, and whether
concomitant exposures would have different outcomes than individual compounds.

TM4 cells
Pathway description Enrichment
Score
P-value Genes
Ribosome biogenesis in eukaryotes 15.8 1.40E-07 15
NOD-like receptor signaling
pathway
8.2 0.000270 16
AMPK signaling pathway 4.6 0.0100 10
NF-kappa B signaling pathway 4.0 0.0185 8
IL-17 signaling pathway 3.6 0.0280 7
Steroid biosynthesis 3.5 0.0291 3
TGF-beta signaling pathway 3.4 0.0343 7
Cytosolic DNA-sensing pathway 3.0 0.0500 5

PND8 rat Sertoli cells
Pathway description Enrichment
Score
P-value Genes
Foxo signaling pathway 8.6 0.000180 7
Melanoma 3.7 0.0252 3
Glioma 3.6 0.0283 3
PI3K-Akt signaling pathway 3.5 0.0298 7
Pancreatic cancer 3.5 0.0316 3
Rheumatoid arthritis 3.5 0.0316 3
Hematopoietic cell lineage 3.4 0.0351 3
JAK-STAT signaling pathway 3.3 0.0368 4

54

Although the first set of experiments and the analysis of gene markers of Sertoli cells
included APAP, IB, GEN and MEHP as treatments, in view of the minimal or no effects
observed with ibuprofen and MEHP, we decided to focus on APAP and GEN, which both
exerted significant effects on TM4 Sertoli cells. The present study showed that exposure
to APAP at a concentration in the range of levels measured in children (Brown et al.,
1992) decreased the viability and disregulated cellular proliferation of immature TM4
Sertoli cells, while it altered the expression of genes important for Sertoli cell functions
both in TM4 cells and PND8 Sertoli cells. While the cytotoxic effect of APAP alone and in
mixtures was clear at 50 µM, similar to levels measured in children blood upon treatments
with recommended doses, a concentration of 100 µM killed most cells by 48h treatment.
By contrast, GEN exterted mainly cytostatic effects, as shown by minimal effects on
viabilty concomitent to decreases in proliferation. Such cytostatic effect of GEN was
reported for other testicular cells, including our study on the C18-4 undifferentiated
seprmatogonial cell line (Tran-Guzman et al., 2022). While several studies have shown
that in utero or perinatal exposure to APAP dysregulates male reproductive development
(David Møbjerg Kristensen et al., 2011; Tran-Guzman & Culty, 2022) and exerts
intergenerational effects on testes (Rossitto et al., 2019), there are no current studies
comparing the effects of EDCs in combination with exposure to analgesic drugs in infants
(Corpuz-Hilsabeck, 2023). The present study highlights effects induced by either APAP
or GEN individually, identifying functions, genes and functional pathways more
susceptible to either compound, and also identify genes that are more disrupted by the
combinaison of the two compounds, further contributing to the current knowledge on
possible origins of male infertility.
The finding that the immature Sertoli cell marker Amh was upregulated by APAP,
GEN and the mixtures in TM4 cells in a dose-response manner suggested the
dysregulation of the developmental program of the cells. In this case, APAP acted at a
lower dose than GEN, suggesting a role for the eicosanoid pathway in Amh
expressionwhereas the effects of GEN may have been due to intracellular signaling in
response to high estrogen exposure (Valeri et al., 2020). The fact that the mixture effects
were similar to those of each individual compound suggests that both APAP and GEN
disrupted Amh production via the same mechanism. The upregultion by APAP alone

55

suggests that APAP exposure contributes to increased immature Sertoli cell signature
(Sharpe et al., 2003). Interestingly, Amh dysregulation has been associated with
reproductive disorders, including Sertoli cell-only tubules, Leydig cell hyperplasia, and
Mullerian duct syndrome (Behringer et al., 1994; Knebelmann et al., 1991; Sharpe et al.,
2003).
While the expression of mature Sertoli cell marker Ar in TM4 cells was increased
only by the highest dose of APAP, it increased starting at 10 µM with GEN and the
mixtures, indicating a high sensitivity of the cells to GEN, a soy phytoestrogen to which
many babies are exposed via soy-based formula. Our data revealing that a low dose of
10 µM GEN, similar to the blood levels found in soy-formula fed babies (Rozman et al.,
2006) was sufficient to disrupt the expression of genes important for Sertoli cell functions
such as Sox9 and several eicosanoid pathway genes, including Cox2 in TM4 and PND8
Sertoli cells, might be a concern. Our observations that APAP alone had no effect at low
dose, but that the largest increase in Ar was found with the mixture suggests a synergistic
trend between GEN and APAP on Ar expression at low dose, with a dose-dependently
decreased to basal levels only seen with the mixtures. Together with the decreases in
cell proliferation, the negative correlation between Amh and Ar expression observed with
the mixtures, could reflect a disruption of the proliferation needed to establish adequate
numbers of Sertoli cells, as well as alteration of Sertoli cell maturation process, causing
functional impairment that could have deleterious consequences later in life (Rey et al.,
2009; Sharpe et al., 2003).

2.5.2 Similarities and differences between TM4 cells and PND8 immature Sertoli
cells
The upregulation of Amh and Ar in TM4 cells treated with APAP and GEN
contrasted with the downregulation of both genes in PND8 Sertoli cells, suggesting
differential effects, despite a close similarity in the trascriptomes of the two Sertoli cell
models, and their comparable responses for Sox9 gene. As a hallmark Sertoli cell marker,
Sox9 gene expression in TM4 cells and PND8 rat Sertoli cells were similarly decreased,
suggesting that the TM4 cell line recapitulates some of the effects that APAP and GEN
might exert on primary non-immortalized immature Sertoli cells. Sox9 protein expression

56

also was decreased in TM4 cells exposed to GEN and the mixture, validating the results
observed on transcript levels. Sox9 is a transcription factor important in sex determination
and involved in Sertoli cell maturation and expressed in adult testis via Sertoli cells (Kim
Fröjdman et al., 2000; Rotgers et al., 2018a, 2018b). Some of the differences observed
between the two Sertoli cell models could be due to the fact that TM4 cells were generated
from late juvenile mice (PND11-13) (Mather, 1980), when some Sertoli cells start entering
the maturation process, compared to the immature primary Sertoli cells isolated from
PND8 rats, an age at which rat Sertoli cells are all immature. It could also reflect the fact
that TM4 are immortalized cells, a process that can alter developmental processes,
compared to primary cells undergoing active and dynamic developmental changes.
Although it is generally accepted that mice do not express androgen binding protein (ABP)
which binds testosterone in testis, one study in CD1 mice testes reported that ABP gene
was expressed, but at in much lower extent than what is observed in rat, leading to
significantly lower levels of ABP protein produced in mice (Wang et al., 1989). The
discrepancy between Ar expression in TM4 cells and primary rat Sertoli cells could be
related to their difference in ABP levels, with mouse testis containing higher levels of free
testosterone available for its receptor and possible feedback effects.
A noticeable difference between TM4 and PND8 Sertoli cells is the levels of
estrogen receptors in basal conditions and in response to APAP and GEN. Total RNA-
seq analysis of TM4 confirmed the lack or very low level of Esr2 expression in both cell
types. This is also supported by studies that suggested that ER-α and ER-β expression
in rat Sertoli cells changed depending of age (Lucas et al., 2014). Other studies reported
effects of the non-steroidal mycotoxin Zearalenone on TM4 cells, described as estrogen-
responsive via Esr1 and Gper1 expression (Savard et al., 2022). Zearalenone was
suggested to act as xenoestrogen mediating Sertoli cell differentiation through increases
in ROS production via MAPK pathway. The extent of dysregulation to TM4 cells and
primary PND8 rat Sertoli cells following exposure to the common analgesic/antipyretic
APAP, and the frequent dietary exposure to GEN suggest the need to address how
dysregulation occurs when concomitant exposures to APAP and GEN take place, further
complicating the assessment of possible reproductive harm at fetal or perinatal ages
(Boizet-Bonhoure et al., 2022).

57

2.5.3 Is there a link between APAP and GEN effects on Sox9 and eicosanoid
pathway?
The decreased levels of Sox9 in TM4 cells as well as in PND8 immature rat Sertoli
cells, together with other shared endpoints, infer that APAP and GEN might alter
immature Sertoli cell function and possibly induce a delay in Sertoli cell maturation. This
finding coincides with Rossitto and colleagues, who observed the F0 offspring of pregnant
mothers who received APAP alone had a slight decrease in Sox9 expression compared
to control (Rossitto et al., 2019). Moreover, Sox9 is suggested to play a major role in L-
PGDS/PGD2 pathway during fetal development (Kugathas et al., 2016; Moniot et al.,
2009; Wilhelm, Hiramatsu, et al., 2007; Wilhelm et al., 2005). In fetal mice at 13.5 days
post-coitum (dpc), the ablation of Sox9 caused decreased production of L-PGDS and
therefore the accumulation of PGD2 in mouse testis was reduced (Moniot et al., 2009).
Our findings of decreased Sox9 expression in both TM4 cells and PND8 Sertoli cells after
exposure to APAP and GEN alone or as mixtures, and the concomitent decreases of
PGD2 and PGE2, suggest that both processes could be related also in our models.
Moreover, the increased expression of Ptdgs in TM4 cells could be a compensatory
response to the reduced levels of PGs and Coxs genes and proteins. PGD2 was found
to be crucial during development and reproduction (Rossitto et al., 2015) as it interacts
with L-Pgds and Sox9, facilitating normal Sertoli-germ cell interaction and acting
independently of fibroblast growth factor 9 (FGF9)/Sox9 regulatory loop. One can
speculate that the upregulation of PGD2 receptor DP2 in TM4 cells by GEN and mixtures
corresponds to a compasatory upregulation of the whole PGD2 pathway in response to
the decreases in PGs.
Changes in the expression of Cox2 and Ptgds in response to GEN in PND8 rat
Sertoli cells suggested some synonymous trends with TM4 cells. Both Cox genes showed
mostly decreased expression by exposure to GEN alone and mixed by RNA-seq analysis,
qPCR and protein detection in cells. However, there were some discrepencies for APAP
alone between the RNA-seq and qPCR data, which may be due to the different samples
used in these experiments. The downregulation trends were more prominent in TM4 cells,
but none the less there were similar decreases for Cox2 and increases for Ptgds between

58

TM4 cells and PND8 rat Sertoli cells. Kristensen et al. studied effects of exposure to EDCs
and analgesic drugs such as the xenoestrogen bisphenol A (BPA) and APAP on the
synthesis of PGD2 in the juvenile Sertoli cell line SC5 (David M Kristensen et al., 2011).
In that cell model, PGD2 levels were shown to be decreased by APAP or BPA alone,
similarly to our findings with APAP and the phytoestrogen GEN in TM4 cells.
2.5.4 Mechanisms dysregulated in immortalized and primary immature Sertoli cells
Major functional pathways altered in both TM4 and PND8 rat Sertoli cells identified
by KEGG pathway enrichment analysis included p53, and TNF signaling pathways, based
on treatments with 50µM APAP+GEN mixture. Genes highlighted in alcoholism were
related to ethanol signaling to histones H3 and H4 acetylation that involve genes such as
Hdac5, H2ac12, H3c7, and H4c3. Histone deacetylases mediate reactive oxygen species
(ROS) production which is also controlled by PGD2 as an adaptive stress mechanism to
promote cell survival in TM4 cells (Rossi et al., 2016). p53 signaling was detected in both
Sertoli cell types which included the downregulation of Cdkn1a and Ccnd1 by exposure
to AG50 whereas Cdkn1a and Mdm2, which mediates oncogene activation, were
upregulated in PND8 rat Sertoli cells. Elucidating these signaling discrepancies between
TM4 and PND8 rat Sertoli cells will help further identifying new target genes and pathways
possibly involved in cases of male infertility.
Using KEGG database for pathway analysis in TM4 cells identified AMPK, NF-
kappa β, and TGF-β signaling as targets. While steroid biosynthesis was affected in TM4
cells, one can speculate that it may be due to the dysregulation by both GEN and APAP.
Prolonged exposure to APAP in a xenograft model of human fetal testis was reported to
decrease testosterone production (van den Driesche et al., 2015), likely due to alterations
of steroidogenic enzymes Cyp11a1 and Cyp17a1 expression. In our total RNA-seq
analysis performed on postnatal models corresponding to juvenile ages, DEG counts
showed that the 24-dehydrocholesterol reductase gene (Dhcr24) was upregulated after
exposure to GEN and the mixture, which is key in cholesterol biosynthesis (Supplemental
Table 1). The cholesterol esterifying enzyme Acat2 was also upregulated (Table 2).
Considering that cholesterol is the key precursor to steroidogenesis (Li et al., 2018;
Walker et al., 2021; Zirkin & Papadopoulos, 2018) and that Sertoli cells produce
estrogens from androgens synthesized by Leydig-cells after birth (as well as before birth

59

in human and rat), the unregulation of enzymes involved in steroid production may lead
to disrupted sertoli cell fucntions, including the regulation of germ cells.
Most DEG counts identified by RNA-seq analysis in TM4 cells were due to G50
and AG50 treatments in TM4 and PND8 Sertoli cells. The molecular mechanisms
highlighted in PND8 rat Sertoli cells exposed to AG50 included PI3K-Akt, and JAK-STAT
signaling, which are important in Sertoli cell proliferation (Meroni et al., 2019a; Ni et al.,
2019). Moreover, Sertoli cell proliferation was proposed to be mediated via NF-kappa Β
signaling in a PI3K-Akt and ERK1/2-dependent manner, stimulated by the binding of
estradiol on ER-α in 15-day old rats (Lucas et al., 2014). The altered pathways identified
in the current study corroborate the possible involvement of NF-kappa β signaling in
Sertoli cell proliferation, highlighted in TM4 cells, and PI3k-Akt and ERK1/2 signaling in
PND8 rat Sertoli cells. GEN action was also shown to be mediated in fetal mouse testes
by interaction with ER-α, supported by diminished inhibitory effects of GEN in ER-α
knockout mice (Lehraiki et al., 2011). Here, we found that GEN upregulated Esr1
expression in TM4 cells, but not in PND8 Sertoli cells. The differences on Esr1/ER-α
expression in our models could be attributed to age difference between postnatal ages
(Lucas et al., 2014), as well as with fetal ages. In comparison, we showed that exposure
to GEN alone and the mixtures caused a downregulation of GPER expression in TM4
cells. A comparative study on GPER, ER-α and ER-β expression in Sertoli cells derived
from 5-, 15, and 120-day old rats found that while ER-α/ER-β played a role in Sertoli cell
proliferation, Gper expression mediated by E2 binding was involved in apoptotic signaling
(Chimento et al., 2020; Lucas et al., 2010). Future studies of Gper expression along with
apoptotic markers such as Bax and Bcl2 after exposure to GEN and APAP+GEN mixtures
in TM4 cells may elucidate the possibility that GPER-mediated estrogen signaling could
balance cell proliferation and apoptosis processes. The comparison of the data obtained
between TM4 and PND8 Sertoli cells should further be nuanced by the knowledge that
the functional pathways identifed here have been shown in other models such as cancers
to crosstalk with each other. This is the case with NF-kappa Β and Stat3, found to
crosstalk and promote the progression of several cancer types (Grivennikov & Karin,
2010).

60

2.6 CONCLUSION
This study attempted to bridge the gap of knowledge that exists on the possibility
that effects of EDC and analgesic drug exposure on male infants may contribute to male
reproductive disorders such as infertility by disrupting Sertoli cells, essential to
spermatogenesis. Using two models of immature rodent Sertoli cells, our results showed
that Sertoli cell function and development was dysregulated by exposure to APAP and
GEN alone and as mixtures in both TM4 cells and PND8 rat Sertoli cells in culture. Gene
expression studies overall highlighted similar effects by APAP and GEN on critical genes
and biological functions, and on Cox-related genes. These data highlight the need for
caution while exposing infants to analgesic drugs such as APAP, and the possibility that
exposure to estrogenic EDCs such as GEN might also exert adverse effects.
Furthermore, the likelyhood that such chemicals acting on different molecular pathways
might have common functional and gene targets should be considered while evaluating
the potential reproductive toxicity of these compounds. Additionally, p53, TNF, and TGF-
β signaling pathways detected as targets in both Sertoli cell models herein provides a
snapshot of possible mechanisms in Sertoli cells that may be involved in male infertility.

2.7 ACKNOWLEDGMENTS

We acknowledge the co-author Nicole Mohajer for her contribution to the current study.
Additionally, the support of Chantal Sottas for maintaining optimal working conditions
throughout the project, for helping with the initial student training in basic methods, as
well as for sharing her opinion about the project. We would also like to greatly thank the
USC Norris Molecular Genomics Core for sequencing our RNA samples for total RNA-
seq analysis and the bioinformatics team as USC Norris Library for the guidance and
support of the extensive total RNA-seq analysis including orthologue gene expression
comparison of mouse and rat Sertoli cells.

61

Preface to Chapter 3:
Aim 1 (Chapter 2) sought to address whether immature Sertoli cell functions are
disrupted by exposure to analgesic drugs such as acetaminophen (AC) and EDCs such
as GEN and MEHP alone and as mixtures. Epidemiological studies have shown that AC
and GEN individually contribute to male reproductive disorders including infertility and
that disrupted Sertoli cell function/development may be involved. Therefore, the second
aim of this dissertation project sough to identify the molecular mechanisms involved in
disruption of immature Sertoli cell functions by exposure to AC and EDCs such as GEN
as a mixture. Infants can be exposed to these mixtures as they may be fed soy-based
baby formula containing GEN and are prescribed AC for fever and/or pain as it is the
most tolerable. Our understanding of key molecular targets and/or pathways involved in
disruption to immature Sertoli cell functions by exposure to AC and GEN can begin to
outline potential therapeutic targets and some of the origins of male infertility.

62

Chapter 3: INVESTIGATING MOLECULAR MECHANISMS INVOLVED IN
DYSREGULATION OF IMMATURE SERTOLI CELL FUNCTIONS BY EDCs AND
DRUGS

OBJECTIVE (AIM 2): To investigate the molecular mechanisms driving the dysregulation
of immature Sertoli cell development by exposure to EDCs and drugs using mouse
immortalized cell line TM4 and isolated PND8 rat Sertoli cells.

3.1 ABSTRACT
Exposure to analgesic/antipyretic drugs such as acetaminophen (AC, A) and
endocrine disrupting chemicals (EDCs) during male gonad development can disrupt male
reproductive health and lead to male infertility. Sertoli cells are instrumental to the
developing male gonad during fetal development and postnatal life (Corpuz-Hilsabeck,
2023; França et al., 2016; Griswold, 2018). Immature Sertoli cells, TM4 cells and isolated
postnatal day 8 (PND8) rat Sertoli cells were treated in culture with AC and the
phytoestrogen genistein (GEN) for 24 hour. Our previous study showed that immature
Sertoli cell functions including cell viability, proliferation, and differentiation were
dysregulated by GEN and AC+GEN mixture, 50µM. In this study, our goal was to
determine the molecular mechanisms involved in these adverse effects. Pharmacological
inhibition of estrogen receptor-α/β (ER-α/β) and G protein-coupled estrogen receptor
(GPER) was achieved by using the ER antagonist ICI 182,780 (ICI) and GPER antagonist
G15, respectively, simultaneously with AC+GEN mixture at 50µM (AG50) for 24 hours.
qPCR analysis of Sertoli cell specific markers and eicosanoid-related genes were showed
differential alteration by ICI and G15 alone and as mixtures with AG50. RNA-seq analysis
by whole transcriptome sequencing identified TNF signaling pathway as significantly
altered in both TM4 cells and PND8 rat Sertoli cells. Since this pathway involves
transcriptional regulation by the transcription factor JUN, the phosphorylation of c-JUN
was examined by immunofluorescence. P-Jun was altered by AG50 mixture alone and in
combination with ICI 182,780 and G15 treatments in PND8 rat Sertoli cells. Protein
expression of >300 signaling targets was assessed by antibody array of PND8 rat Sertoli
cells treated with AG50 or vehicle. This unveiled several over- and under-expressed

63

proteins. Among them, Glycoprotein 130 (GP130), a type 1 cytokine receptor, was
upregulated in AG50-treated PND8 rat Sertoli cells compared to vehicle. These data
suggest that GEN and AC+GEN mixtures dysregulate immature Sertoli cell functions in
an ER-α/β and GPER-dependent manner which involve transcription regulation by JUN
and inflammatory response by GP130 via TNF signaling. Although the data indicated the
strong influence of GEN in altering Sertoli cell transcriptome and functional pathways, the
data also highlight changes uniquely triggered by AC-GEN mixtures, and others by AC
alone, suggesting complex effects on infant testis which deserve further investigation.

3.2 INTRODUCTION

Male infertility and reproductive disorders have been on the rise over the last few
decades, which can be in part attributed to exposure to endocrine disrupting chemicals
(EDCs) and pharmaceuticals, including mixtures (Corpuz-Hilsabeck, 2023). Moreover,
exposures during a critical developmental period have been shown to translate to long-
term effects in adulthood, which may involve targeting Sertoli cells that are instrumental
throughout postnatal life and spermatogenesis. Epidemiological studies have shown that
analgesic drugs including acetaminophen (AC, APAP, A) and ibuprofen (Ib) have
intergenerational effects on Sertoli cells that dictate the overall development and
maintenance of testis homeostasis (Rossitto et al., 2019). While there is a delay between
GEN exposure and reproductive outcomes, the level of dysregulation to male
reproductive health by GEN exposure has been historically studied and clinical
implications are summarized (Suen et al., 2022).
Immature Sertoli cells’ function and count may be dysregulated by exposure to
EDCs and analgesic/antipyretic drugs and lead to the disruption of male gonad
development. Previously, using a Sertoli cell line and isolated rat immature Sertoli cells
as in vitro models, we showed the disruption of immature Sertoli cell functions by
exposure to the analgesic/antipyretic drug AC and EDCs commonly found in the
environment, the phytoestrogen genistein (GEN) and the plasticizer Di(2-ethylhexyl)
phthalate (DEHP), alone and as mixtures. Infants can be exposed to AC-EDC mixtures
as they are surrounded by medical equipment containing phthalates like DEHP, and

64

ingesting soy-based baby formula containing GEN, and concomitantly being treated with
AC for feverish symptoms or pain. In mouse immortalized TM4 Sertoli cells (Mather,
1980), Sertoli cell markers of development and maintenance including sex-determination
and Sertoli cell specific marker SRY-box transcription factor 9 (Sox9) and Anti-mullerian
hormone (Amh) were shown to be downregulated at the gene and protein level after 24
hour exposure to AC and GEN alone and as mixtures at ≤50µM. Furthermore, we
examined the effects of AC+GEN mixtures on the eicosanoid pathway which showed a
decrease of cyclooxygenase 1 (Cox1) and 2 (Cox2) expression at the gene and protein
level. A compensatory role downstream of the cyclooxygenase pathway was suggested
as we saw significantly elevated levels of prostaglandin D synthase (Ptgds) expression in
TM4 cells exposed to AC+GEN mixture.
Based on the dysregulation observed in both TM4 cells and postnatal day 8
(PND8) rat Sertoli cells exposed to GEN alone and as a mixture with AC, we seek to
address the molecular mechanisms of GEN and its influence on estrogen signaling.
Estrogen receptor-α/β (ER-α/β) also known as ESR1 and 2, present in various cell types
including immature Sertoli cells, are mostly localized in the cytoplasm bound to chaperone
proteins when unbound to ligand, and as dimers in the nucleus when bound to estrogen,
but a small percent is also found tethered to the plasma membrane (Luconi et al., 2002;
Moriarty et al., 2006; Savard et al., 2022; Yawer et al., 2022). Additionally, G protein
coupled estrogen receptor (GPER) is a plasma membrane bound receptor that
dynamically changes via estrogen signaling to translocate to other organelles including
endoplasmic reticulum and Golgi apparatus (Luo & Liu, 2020). By these two mechanisms
of estrogen signaling, we speculate a crosstalk communication between these two
receptors as well as mediating other cellular functions related to proliferation,
differentiation, and apoptosis.
The goal of this study is to bridge the gap of knowledge that exists on exposures
to AC and GEN as mixtures and the mechanisms that drive their effects on immature
Sertoli cell functions. The molecular targets and mechanisms regulating these effects may
be broaden our understanding of male infertility.

65

3.3 METHODS

3.3.1 Cell cultures and treatments

Primary cell isolation was performed to isolate Sertoli cells from postnatal day
(PND) 8 rat testes as previously described (Manku & Culty, 2015; Manku, Mazer, et al.,
2012; Manku, Wing, et al., 2012). Testes from 10 rat pups per experiment were
decapsulated, sequential enzymatic dissociation was performed, followed by differential
plating O/N of the trypsin supernatant containing Sertoli, myoid and germ cells, in RPMI
1640 medium (Invitrogen, Burlington, ON, CA) with 5% heat inactivated FBS (Sigma
Aldrich, St. Louis, MO, USA) at 37˚C, 3.5%CO2. Next day, floating germ cells were
removed by aspirating media and washes.
Murine Sertoli cell line TM4 (Cat. no. CRL-1715, ATCC, Manassas, VA, USA) were
cultured in GibcoÔ DMEM containing 4.5g/L d-Glucose, L-glutamine, and 110 mg/L of
sodium pyruvate (Thermo Fisher Scientific, Waltham, MA, USA) supplemented with 10%
charcoal-stripped FBS (CS-FBS) (Sigma Aldrich, St. Louis, MO, USA) and 1% Penicillin-
Streptomycin solution 100X (CorningÔ).
All treatments were diluted in cell culture medium containing 10% CS-FBS and
filtered with 0.2µm filters to prevent bacterial contamination. Cells were treated with
vehicle (containing the same % DMSO and ethanol as treatments), 50µM acetaminophen
(APAP, A), 50µM Genistein (4’,5,7-Trihydroxyisoflavone) (GEN, G), 1µM ER-α/β
antagonist ICI 182,780 (catalog no. 531042; Sigma-Aldrich, St. Louis, MO, USA) and
10nM selective GPER antagonist G15 (catalog no. 3678; Tocris Bioscience, Bristol, UK)
alone or as mixtures over a 24-hour exposure in vitro at 37˚C 5%CO2.

3.3.2 Gene expression analysis in immature Sertoli cells
TM4 cells or PND8 rat Sertoli cells were plated at 125-150,000 cells/well in 24-well
microplates in triplicate per condition. After overnight incubation in 37˚C for cell
expansion/proliferation, cells were treated with APAP and EDC alone or in combination
for 24 hours. To collect cell pellets, all wells in 24-well microplate were rinsed with 1X
PBS (Santa Cruz Biotechnology, TX, USA) and 300µl of RNA lysis buffer was added to

66

each well to collect for RNA extraction. After extraction and DNase treatment was
performed using Zymo Quick-RNA Mini prep kit, I performed cDNA synthesis using
Takara PrimeScript qPCR Master Mix. Gene expression analysis was performed on a
BioRad CFX384 Touch Real-Time PCR System. Cycling conditions for qPCR were as
follows: initial step at 95 ◦C followed by 40 cycles at 95 ◦C for 15 s, 60 ◦C for 1 min. This
was followed by both melting curves and cooling cycles. The SYBR Green system was
used for gene amplification and comparative threshold cycle (Ct) method used to analyze
data.

Table 1. Primer sets for q-PCR analysis.
Gene Forward Primer Reverse Primer Product Size
(bp)
Mouse
Rps29 TGAAGGCAAGATGGGTCAC GCACATGTTCAGCCCGTATT 127
Cox1 CCTCTTTCCAGGAGCTCACA TCGATGTCACCGTACAGCTC 70
Cox2 CAGGACTCTGCTCACGAAGG ATCCAGTCCGGGTACAGTCA 231
Ptgds GGCTCCTGGACACTACACCT CTGGGTTCTGCTGTAGAGGGT 160
Amh GGGGAGACTGGAGAACAGC AGAGCTCGGGCTCCCATA 67
Ar ACCAGATGGCGGTCATTCAG TGTGCATGCGGTACTCATTG 135
Sox9 TCGGACACGGAGAACACC GCACACGGGGAACTTATCTT 96
Esr1 TCTCCTCAAACACATCCCGTG GGCGAGTTACAGACTGGCTC 96
Gper CCTGGACGAGCAGTATTACGATATC TGCTGTACATGTTGATCTG 77

3.3.3 Immunofluorescent (IF) staining
TM4 cells or PND8 rat Sertoli cells at 50-80,000 cells/well in 8-well culture slides (Corning,
Glendale, AZ, USA) and incubated at 37˚C 5%CO2 to allow cells to expand and proliferate
to 50-60% confluency. Cells were then treated with APAP and EDCs alone or in
combination for 24 hours following thereafter. To fix the cells onto the slides, 4%
paraformaldehyde solution was used and incubated on cells for 10-15 minutes at room
temperature. To stop fixation step, slides were rinsed twice with 1X PBS before IF staining
began. Beginning IF staining, we first incubated the fixed microscope slide with 0.1%
Triton-X for 10 minutes to permeabilize the cell monolayer. Blocking step for IF staining
was performed by adding 5% donkey serum in 0.5% BSA in 1X PBS solution to incubate

67

for 30 minutes at room temperature. Following this step, we incubated with 1:100-1:300
diluted in 5% donkey serum our primary antibodies: phospho-c-JUN (anti-rabbit, catalog.
no. 9164S, Cell Signaling), GPER (anti-rabbit, catalog no. PA5-28647, Invitrogen), and
VIM (anti-mouse, catalog. no. ab20346, Abcam). Secondary antibody was used at 1:400
dilution in 5% donkey serum in 0.5% BSA in 1X PBS solution which cells were incubated
in dark for 30 minutes at room temperature. Fluorescent-labeled cells were washed three
times with 1X PBS to remove excess antibody solution and slide chamber removed before
addition of DAPI-mounting medium and coverslip for glass slides.

3.3.4 Antibody array
PND8 rat Sertoli cells were plated at 1x10^6 cells/ 100mm dish and treated for 24 hours
with either AC+GEN 50µM or vehicle containing equivalent concentration of
ethanol/DMSO mixture as treated PND8 rat Sertoli cells. After treatment, cell pellets were
collected by rinsing each 100mm dish with sterile 1X PBS (Santa Cruz Biotechnology,
TX, USA) and adding 1X cell lysis buffer at 2x10
7
cells/ml based on manufacturer’s
protocol for Ray Biotech Rat L2 array membrane kit (catalog no. AAR-BLM-2-2,
Peachtree Corners, GA, USA). The kit contains two L-series antibody array membranes,
one membrane for a treated protein sample to compare to a control protein sample
incubated on the second membrane. Manufacturer’s protocol was followed for
preparation of cell lysates from PND8 rat Sertoli cells treated in culture by biotinylating
protein samples that were incubated overnight and followed by a two-hour room
temperature incubation with HRP-conjugated streptavidin step. Following completion of
the HRP-conjugated streptavidin incubation, the membranes were washed as described
in manufacturer protocol then imaged using the Azure 600 Imaging System (Azure
Biosystems, Dublin, CA, USA).

3.3.5 RNA-seq analysis by whole transcriptome sequencing
Previously, we performed whole transcriptome sequencing from TM4 and PND8 rat
Sertoli cells and described the method in more detail (see Chapter 2, section 2.3.10 of
this dissertation). The same database, which contains differentially expressed gene

68

counts for both TM4 cells and PND8 rat Sertoli cells treated with APAP/AC, GEN, alone
or mixed, will be investigated more herein.

3.3.6 Statistical Analysis
Statistical analyses were performed by one-way ANOVA with post-hoc Tukey’s or
Fisher’s LSD tests for multiple comparison using Prism version 9.0 (GraphPad
Software, San Diego, CA). This statistical analysis approach was used for statistical
significance in qPCR data whereas RNA-seq analysis was statistically analyzed with
Partek
®
Flow
®
software.

3.4 RESULTS
3.4.1 Pharmacological inhibition of estrogen signaling in immature Sertoli cells
Treatment of TM4 cells using pharmacological inhibition of ER-α/-β antagonist ICI
182,780 at 1µM or GPER antagonist G15 at 10nM alone and in combination with AG50
mixtures caused differential gene expression of Sertoli cell markers and estrogen-
responsive genes after 24-hour exposure (Figs. 11-13). Sox9 expression was decreased
by exposure to AG50 mixture alone and was not recovered by simultaneous exposure to
ICI 182,780 or G15 inhibitors compared to vehicle (Fig. 11). Expression of Sertoli specific
marker Amh was significantly decreased by exposure to AG50 mixture and was
significantly upregulated when simultaneously treated with ICI+AG50 mixture for 24 hours
to an expression level toward vehicle (Fig. 11).

69

Figure 11. Sertoli cell markers are dysregulated by AC+GEN mixture that include ER-α/β
and GPER signaling. Pharmacological inhibitors ICI 182,780 and G15 were treated in
culture with AC+GEN mixture 50µM for 24 hours in TM4 cells. Sox9 expression was
significantly downregulated by treatment of ICI +G50 and ICI+AG50 mixtures which was
observed to an even greater downregulation with G15 and G50, AG50, and
ICI+G15+AG50 treatments. Samples used were n=5-6, two separate experiments, with
triplicate per condition.

Eicosanoid pathway related genes including upstream Cyclooxgenase 1 (Cox1) and
downstream of PGH2 precursor, Prostaglandin D Synthase (Ptgds) gene expression
were affected in opposing trends by AG50 mixture and when pharmacological inhibited
with ICI 182,780 and G15 in combination with AG50 mixture (Fig. 12). Cox1 expression
was significantly downregulated by exposure to AG50 mixture which was also
downregulated by exposure to ICI+AG50 treatment but to a lesser extent that trends
toward an expression level similar to vehicle. In comparison, simultaneous treatment with
G15 and AG50 mixture only significantly decreased Cox1 expression in a manner similar
to AG50 alone (Fig. 12). Ptgds expression was upregulated by exposure to G50 and
AG50 which was similarly observed in TM4 cells simultaneously treated with ICI+AG50
and G15+AG50 mixtures.

70

Figure 12. Eicosanoid related genes dysregulated by AC+GEN mixture that were
dysregulated in opposite trends by inhibitors of estrogen signaling. Cox1 expression
significantly decreased after exposure to AG50 while treatment with ICI and AG50 were
decreased but to a lesser extent comparably to AG50 alone. In contrast, G15 treatment
with AG50 mixture did not recover Cox1 expression toward a level observed by vehicle
significantly. Both ICI 182,780 and G15 treated with AG50 mixture in TM4 cells appeared
to increase Cox1 expression compared to AG50 alone but at an overall decreased level
compared to vehicle. In contrast, Ptgds expression was significantly upregulated by G50
and AG50 mixtures which was not recovered when ICI 182,780 and/or G15 treatment
was added together with AG50 mixtures compared to vehicle.

Analysis of gene expression for ER-α and Gper was conducted in TM4 cells that were not
significantly altered by exposure to AG50 mixture alone (Fig. 13). When simultaneously
exposed to ICI+AG50 treatment, GPER expression was significantly decreased by more
than 50% compared to vehicle. Interestingly, addition of G15+G50 or G15+AG50 mixture
simultaneously caused a significant decrease of more than 80% compared to vehicle
which is more drastic than effects observed with ICI 182,780 treatment. As expected, we
observed a decrease of GPER expression with G15 alone but not to a significant extent.
Esr1 (ER-α) expression was not significantly altered after exposure to AG50 mixture but
suggested upregulation of Esr1 expression. This became more prominent with addition
of ICI+AG50 mixture for 24 hour exposure and was significantly upregulated by inhibition
with both ICI and G15 in combation with AG50 mixtures.

71

Figure 13. Gene expression of Gper and Estrogen receptor-α (ER-α) were
pharmacologically inhibited by ICI 182,780 and G15 alone and in combination with AG50
mixtures in TM4 cells. Gper expression was not significantly affected by AG50 mixture
which was similar to vehicle but when ICI was added, a significant decrease of Gper
expression was observed. This was also observed to a more downregulated extent by
G15 inhibitor in combination with G50, AG50 or ICI+G15+AG50. In contrast, ER-α
expression was not significantly affected by exposure to AG50 and more importantly
significantly altered expression after treatment with both ICI and AG50 which upregulated
ER-α expression.

Immunofluorescent signal of GPER expression in TM4 cells was observed after 24-hour
treatment with ICI 182,780 and G15 inhibitors alone and in combination with AG50
mixtures (Fig. 14). GPER expression appeared to be localized in a diffused manner within
cytoplasm of flattened cells whereas a brighter green expression in a ring-shape around
nucleus in the cytoplasm of rounded cells all within vehicle condition. Exposure to A50
appeared to be increased compared to vehicle with less diffused GPER expression in
cytoplasm. Exposure to G50 and AC+GEN mixture causes GPER expression to be
decreased and compartmentalized to not only the nuclear membrane but also bound to
endoplasmic reticulum. Less GPER expression was apparent in TM4 cells exposed to
AG50 than G50 that may suggest an additive or synergistic effect.

72

Figure 14. GPER expression in TM4 cells treated with pharmacological inhibitors and
AG50 mixtures. A 24-hour exposure to 1µM ICI 182,780 and 10nM G15 alone and in
combination with AG50 mixtures in TM4 cells altered GPER expression levels by
immunofluorescent staining. Culture and subsequent treatment were performed in 8-well
chamber slides that represent one replicate per condition.

73

In comparison, when we treated with ICI 182,780 or G15 alone, GPER expression
appeared more highly expressed compared to vehicle and was markedly decreased by
simultaneous exposure to AG50 mixture and exposure to both inhibitors with AG50
mixture (Fig. 14).

3.4.2 JUN transcriptional regulation of estrogen signaling in immature Sertoli cells
Based on our RNA-seq analysis in TM4 cells, an increase of DEG count (red
colored) of Jun transcription factor was detected that is involved in TNF signaling after
exposure to AG50 mixture (Fig. 15).
Figure 15. TNF signaling pathway illuminating differentially expressed genes in green
(downregulated) or red (upregulated) altered by exposure to AG50 in TM4 cells (and

74

PND8 rat Sertoli cells. Fold change cutoff ranged from -2 to 2 with either a p-value or
false discovery rate of 0.05.

Dot plot analysis of Jun expression in TM4 cells showed exposure to A50 caused
an increase in Jun transcript counts whereas a decrease of Jun by exposure to G50 was
observed compared to vehicle (Fig. 16). This difference of effects on Jun transcript levels
between A50 and G50 is not observed after exposure to AG50 mixture which appeared
similar to vehicle.

Figure 16. RNA-seq analysis of differentially expressed gene counts for Jun after
exposure to A50, G50, and AG50 in TM4 cells.

Furthermore, TM4 cells exposed to A50, G50, and AG50 showed decreased phospho-c-
JUN signaling in green fluorescence after 24-hour treatment with G50 (Fig. 17). Exposure
to AG50 appears also to have decreased phosphor-c-JUN expression but to a lesser
extent compared to vehicle. Fluorescent expression of phospho-c-JUN appears to agree
with the detected transcript levels of Jun in RNA-seq data shown above suggested by
similar trends of alteration to Jun at the gene or protein level (Fig. 16).

75

Figure 17. Activation of c-JUN was analyzed by performing IF staining for phosphorylated
c-JUN expression in TM4 cells exposed to A50, G50, and AG50. Cells were plated in 8-
well culture slides and treated for 24 hours which suggested a decrease in phospho-c-
JUN by exposure to G50 alone. Exposure to AG50 caused a decreased green,
fluorescent expression but to a lesser extent than G50.

Phosphorylation of c-JUN expression was altered in PND8 rat Sertoli cells after
treatment with 1µM ICI 182,780 and 10nM G15 inhibitors in combination with AG50
mixture over a 24-hour treatment (Fig. 18). Exposure to both G50 and AG50 appeared to
decrease phosphorylated cJUN activity and similarly, exposure to ICI or G15 alone
appeared with decreased phospho-c-JUN expression in green. Interestingly, treatment
with ICI 182,780 and G50 appeared to markedly increase phosphorylated c-JUN
expression which was not observed by GPER inhibitor G15 co-treated with G50.
Additionally, AG50 mixture with either inhibitors ICI or G15 exposure did not increase
phospho-c-JUN as observed in ICI+G50. Once we inhibited ER-α/-β (with ICI 182,780)

76

and GPER (with G15) expression and AG50 mixture, we observed upregulated
expression of phospho-c-JUN but to a lesser extent than observed in ICI+G50 treatment
(Fig. 18).

77

Figure 18. Phospho-c-JUN expression in PND8 rat Sertoli cells after 24-hour exposure
to AG50 mixtures alone and in combination with ICI 182,780 and G15 inhibitors. Exposure
to G50 and AG50 mixture suggested a decrease in phospho-c-JUN expression and
similarly in ICI or G15 treatment alone compared to vehicle. With repression of ER-α/β
signaling by ICI 182,780 and G50 treatment, a high expression of phospho-c-JUN was
detected by high green, fluorescent expression within the nuclei of PND8 rat Sertoli cells.
G15 and G50 treatment did not appear upregulated in phospho-c-JUN expression
compared to control and similarly when AC is present in the mixture including ICI+AG50
and G15+AG50 a decreased phospho-c-JUN expression is also observed. Having added
both inhibitors ICI 182,780 and G15 with AG50 mixture simultaneously, increased
phospho-c-JUN expression was observed compared to vehicle.

3.4.3 Antibody array discovers potential target of AG50 exposure
Pathway analysis of the RNA-seq data identified several signaling pathways
significantly altered in TM4 and rat PND8 Sertoli cells treated for 24 hours with 50 μM AG
mixture as compared to control cells. To further substantiate these data, we performed
an antibody array containing >300 signaling molecules as potential target proteins. This
permitted to survey at once a vast range of functional pathways possibly altered by AG
exposure in PND8 rat Sertoli cells, which could provide novel insight into targets involved
in the dysregulation of immature Sertoli cells (Fig. 19).

Figure 19. Antibody array compared between AG50 and vehicle conditions in PND8
rat Sertoli cells containing >300 targets. Each membrane was incubated with protein
lysate collected from PND8 rat Sertoli cells treated for 24 hours with AC and GEN at
50µM in combination or with vehicle (containing similar % of DMSO and ethanol).

78

Each antibody was present as a pair of two adjacent spots, and only changes
similar in both spots were considered. We identified fifteen pairs of target proteins
visible both in the vehicle and the AG50 samples, and five additional pairs only
observed on the AG50 array. The entire lists of antibody targets identified in both AG50,
and vehicle conditions is in the Appendix section of this dissertation. Target proteins
included basal cell adhesion molecule (BCAM), cathepsin B (CTSB), Map2k6 mitogen-
activated protein kinase kinase 6 (Mkk6), and Wnt 5 a (Wnt5a). Moreover, the array
identified proteins differentially expressed between control and AG50 treatment in PND8
rat Sertoli cells, listed in Table 6.

Table 6. Protein targets either downregulated or upregulated after AG50 exposure
compared to vehicle in PND8 rat Sertoli cells.

Of note, the expression of glycoprotein 130 (GP130/CD130), encoded by the gene Il6st
(Interleukin 6 Cytokine Family Signal Transducer), was increased after exposure to
AG50 treatment, as observed in the AG50 antibody array membrane compared to the
vehicle membrane. This result was in agreement with the RNA-seq analysis of Gp130
gene, showing an upregulation of Il6st transcript counts in PND8 rat Sertoli cells after
exposure to G50 and AG50, to a greater extent than in TM4 cells (Fig. 20).

79

Figure 20. RNA-seq analysis of differentially expressed gene counts for Il6st (Gp130)
after 24-hour exposure to A50, G50, and AG50 in TM4 cells and PND8 rat Sertoli cells.
Exposure to G50 and AG50 caused an increase in Il6st transcript levels compared to
vehicle that is observed in both TM4 and PND8 rat Sertoli cells to a greater extent.

3.5 DISCUSSION

3.5.1 Pharmacological inhibition of estrogen signaling in immature Sertoli cells
The goal of this study was to determine the molecular mechanisms involved in the
dysregulation of immature Sertoli cell functions by exposure to AC and GEN as a mixture,
which could present a risk to the developing male reproductive system and be related to
reproductive disorders including male infertility. We previously observed that GEN alone
and as mixture with AC, significantly dysregulated Sertoli cell marker gene expression
and proteins, and altered functional pathways, some common between the mouse TM4
cell and enriched rat PND8 Sertoli cell models (Corpuz-Hilsabeck et al. 2023 Submitted
article). The present study further identified JUN and GP130 as potential targets that
could play a role in this dysregulation. Moreover, the data suggest the existence of a
complex interplay between the ER and GPER estrogen signaling pathways, further
modulated by co-exposure to acetaminophen.
Sertoli cells are a major source of estrogens in immature rats, but the production of
estrogens switches over to Leydig and germ cells in adulthood (Carreau et al., 2006;
Carreau & Hess, 2010; Papadopoulos et al., 1986). Estrogen response independent of

80

ER-α signaling was shown to be critical for normal testosterone secretion in studies
performed in adult male ER-α knockout mice (McDevitt et al., 2007). While mouse fetal
Sertoli cells were reported to produce testosterone (T), this is not the case in postnatal
Sertoli cells, as used in this study. Although adult Sertoli cells have been shown to
regulate Leydig cell functions (Boujrad et al., 1995), at the postnatal ages corresponding
to immature Sertoli cells (up to ~ PND15 in rat) there is minimal testosterone produced,
early on by remaining fetal-type Leydig cells, then by adult-type Leydig cell progenitors
(Zirkin & Papadopoulos, 2018). Thus, GEN disruptive effects on estrogen signaling in
immature Sertoli cells should not influence testosterone secretion, but the existence of a
similar effect in mature Sertoli cells could aid in T production. Lucas et al. (2011) review
on estrogen actions in testis emphasized 17β-estradiol regulation on Sertoli cell function
in immature rats (Lucas et al., 2011). More specifically, 17β-estradiol causes the
translocation of ESR1 and ESR2 to the plasma membrane during activation of Sertoli cell
proliferation and GPER activation induces the phosphorylation of mitogen-activated
protein kinase 3/1 by epidermal growth factor receptor and the regulation of BCL2/BAX
for antiapoptotic protein expression. The small molecular structure of GEN may behave
similarly to 17β-estradiol and may hijack the normal estrogen signaling as described
above to dysregulate homeostasis and maintenance of immature Sertoli cell functions.
More recently, Lustofin et al. (2022) used both TM4 cells and primary Sertoli cells from
PND20 rats, treating them with ER-α/β antagonist ICI 182,780 and GPER antagonist G15
to understand the signaling mechanisms of nuclear and membrane receptors for sex
steroids mediating the effects of testosterone and 17β-estradiol in determining cell fate
and function (Lustofin et al., 2022). Concerned with elucidating the roles of Notch ligands
for Notch signaling pathway that involve estrogen receptor signaling via ER-α/β and
GPER, this study emphasized the importance of immature Sertoli cells mediating sex
steroid synthesis in normal spermatogenesis and fine-tuning of ER-α vs. ER-β activation,
which are differentially expressed depending on factors present in cell cultures.
We can speculate that GEN binding or targeting may be preferential via binding to ER-
α and GPER in immature Sertoli cells since ER-β levels were lowly detected in TM4 and
PND8 rat Sertoli cells (Corpuz-Hilsabeck et al. 2023, Submitted).

81

Studies of GPER localization have suggested other organelles such as endoplasmic
reticulum and Golgi apparatus, depending on the tissue and cell type (Luo and Liu,
2020)). Their studies on GPER localization were based of previous studies performed
by Revankar et al. (2005) who failed to detect fluorescently labeled E2 derivatives at the
plasma membrane but rather detected signal in the intracellular compartment, at the
endoplasmic reticulum, when visualizing the extra- and intracellular binding properties of
GPER using COS-7, monkey kidney fibroblast cells (Revankar et al., 2005). In line with
Revankar and colleagues’ findings, the dynamic changes to GPER expression along
with ER-α signaling were shown to be regulated in pachytene spermatocytes via
EGFR/ERK/c-JUN signaling, to maintain balance between cellular proliferation and
apoptosis (Chimento et al., 2010). These studies on GPER localization and expression
aid in explaining some of our findings in which exposure to GEN and AC+GEN mixture,
and support the idea that this process could be involved in dysregulation of immature
Sertoli cell functions.

3.5.2 JUN transcriptional regulation is dysregulated by AC and GEN mixture
Based on our results showing the disruption of phosphorylated c-JUN expression
after exposure to AC+GEN mixture, we speculate that JUN to plays a role in signaling
mediated by ER-α and/or GPER. Previous studies have shown that the phosphorylation
of c-JUN N-terminal kinase (JNK) was involved in the transcriptional regulation and in
mediating the apoptotic effects of 1,3-dinitrobenzene (1,3-DNB) via MAPK signaling in
TM4 cells (Lee et al., 2009). Liu et al. (2022) recently discovered a novel role of Pax
transactivation domain-interacting protein (PTIP) associated protein 1 (PA1) to cooperate
with JUN in regulating Connexin 43 which is an important factor in tight junction
maintenance between Sertoli cells and germ cells in the developing and adult testis (Liu
et al., 2022)
Glycoprotein 130 (GP130) plays a role in interleukin 6 (IL-6) signaling as it is a
non-ligand-binding glycoprotein that becomes associated with IL6-R when binding IL-6
ligand (Taga et al., 1989). GP130 expression was studied in immature rat primary Sertoli
cells which demonstrated a stimulation of Gp130 mRNA expression by addition of either
interleukin-1-β (IL-β) or IL-6 (Fujisawa et al., 2002). In early studies of testicular cytokines,

82

IL-6 and and interferon ɣ (IFN-ɣ) were suggested to mediate signal transducers and
activators of transcription 3 and 1 (STAT-3 and STAT-1) by regulating immediate early
genes such as c-fos, junB, and c-myc in primary Sertoli cells (Jenab & Morris, 1997).
Additionally, c-JUN forms the early transcription factor AP-1 when combined with c-FOS.
RNA-seq analysis of Chromodomain helicase DNA-binding 4 (CHD4) knocked
down in cultured spermatogonial stem cells resulted in apoptosis-related genes Jun and
Nfkb1 upregulation and was accompanied by abnormal activation of TNF signaling
pathway (Li et al., 2022). This study supports the research findings herein which
speculate that GEN and AC+GEN mixture regulates activation of c-Jun that involves
dysregulation of GP130 expression which is a mediator of IL-6 signaling and TNF
signaling pathway. A possible interaction between GPER and ERs that will need to be
further examined is based on the fact that cAMP produced as a result of GPER activation
is the key activating signal of Protein Kinase A (PKA), a very abundant kinase in immature
ASertoli cells, which is critical for their proliferation. More relevant to our hypothesis of
crosstalk between ER and GPER signaling pathways is the fact that PKA has been shown
to phosphorylate ERs, modulating their action in proliferating cells (Yamakawa & Arita,
2004)

3.6 CONCLUSION
The goal of this study was to investigate the molecular mechanisms involved in
dysregulation of immature Sertoli cell functions by exposure to the analgesic/antipyretic
drug AC and the EDC GEN in mixture. The two in vitro models of immature Sertoli cells
used in the study exhibited altered protein expression of phosphorylated c-JUN and
differential effects on gene expression of Sertoli cell specific and eicosanoid-related
genes when treated with pharmacological inhibitors of ER-α/β and GPER and AG50
mixture. Taken together, the antibody array for signaling molecules and the RNA-seq
analysis of differentially expressed genes, identified GP130 as a target of AG50,
suggesting GP130 to be another key player involved in the signaling mechanisms of
AC+GEN mixture. In conclusion, the disruption of immature Sertoli cell function by
AC+GEN mixture likely involves signaling via ER-α/β and GPER in conjunction with

83

transcriptional regulation by JUN and inflammatory response by GP130. These signaling
targets could further be characterized for getting insight into the origins of male infertility
and could lead to potential new therapeutic targets.

3.7 ACKNOWLEDGMENTS
We acknowledge the co-author Nicole Mohajer for her contribution to the current study.
Additionally, the support of Chantal Sottas for maintaining optimal working conditions
throughout the project, for helping with the initial student training in basic methods, as
well as for sharing her opinion about the project. We would also like to greatly thank the
USC Norris Molecular Genomics Core for sequencing our RNA samples for total RNA-
seq analysis and the bioinformatics team as USC Norris Library for the guidance and
support of the extensive total RNA-seq analysis including orthologue gene expression
comparison of mouse and rat Sertoli cells.

84

CHAPTER 4: SUMMARY, CHALLENGES, AND FUTURE PERSPECTIVES

4.1 SUMMARY
4.1.1 Summary of Aim 1 (Chapter 2)
Our data showed that dysregulation of immature Sertoli cell function was
observed after exposure to analgesic drug AC and GEN and MEHP alone and as
mixtures. Functions shown to be dysregulated included cell proliferation, viability, and
differentiation of immature Sertoli cells including TM4 cells and primary PND8 rat Sertoli
cells. Pathways targeted by exposure to AC and GEN alone and as mixtures in
immature Sertoli cells included eicosanoid pathway and estrogen signaling.

4.1.2 Summary of Aim 2 (Chapter 3)
To perform a vast survey of genes altered in molecular pathways that could
mediate the dysregulation of immature Sertoli cell functions as we described in Aim 1,
we performed RNA-seq analysis of TM4 cells and PND8 rat Sertoli cells. We uncovered
molecular pathways that were highlighted in both immature Sertoli cell types including
p53 and TNF signaling pathways that were altered by exposure to AG50 mixtures.
Additionally, we found that pharmacological inhibition of GEN targets, ER-α/β and
GPER signaling, may be useful in corroborating the molecular targets identified from
RNA-seq analysis that are altered as a result of exposure to AG50 mixture in immature
Sertoli cells. Lastly, cJUN activation is likely part of dysregulation of immature Sertoli
cell functions in conjunction with signaling of inflammatory markers such as GP130.

4.1.3 Summary Diagram of Aim 2
Based on the molecular mechanisms we elucidated in Aim 2 that can mediate
GEN binding and signaling by AC+GEN mixtures to alter immature Sertoli cells, we
propose the molecular mechanisms shown in the graphical summary shown below (Fig.
21). Although we did not show it to keep the diagram simple, the activation of PKA by
cAMP can lead to crosstalk of the GPER pathway with that of ERs in immature Sertoli
cells.

85

Figure 21. Graphical summary of potential mechanisms involved in the dysregulation of
immature Sertoli cell functions by GEN effects altering ER-α/β and GPER signaling.

4.2 Challenges
4.2.1 in vitro models of Sertoli cells
We examined two immature Sertoli cell models, the mouse immortalized cell line
TM4 and PND8 rat Sertoli cells to determine how closely each depicts the
characteristics known to be hallmarks of Sertoli cells. While we found that both models
exhibit critical Sertoli cell marker gene/protein expression, and shared many gene,
pathways and protein responses, the study also showed that part of the data did not
agree between the two Sertoli cell models after exposure to AC and EDC treatment
alone or as mixtures. While we did not show extensive protein expression data for for
both cell types, focusing more on TM4 protein profiles, we can speculate that some of
the data will likely not coincide for both models as well. Our interpretation of these
discrepancies is attributed to the difference of age between the two models, TM4 cells
were isolated between day 11 to 13 from mice, which is getting close to the time when

86

they initiate maturation to adult type, whereas primary rat Sertoli cells were isolated on
postnatal day 8, which represents a period at which Sertoli cells are highly proliferative
and still several days away from starting the process of differentiation to adult-type
Sertoli cells. Moreover, we can appreciate from our extensive analysis of differences
and similarities in their transcriptomes from RNA-seq analysis, as well as the
measurement of eicosanoid-related and estrogen-responsive genes (Chapter 2), that
TM4 cells and PND8 rat Sertoli cells share many genes and functional pathways,
including those representative of immature Sertoli cells.

4.2.2 Elucidating mechanisms of toxicant mixtures

In Chapter 1 of this dissertation, we thoroughly discuss the available literature
that analyze the impact on male gonad development, spermatogenesis, and fertility of
exposure to mixtures of EDCs and drugs. While there are some substantial findings by
many research groups on these mixtures relevant to human exposure, there is clearly a
lack of data hampering our ability to accurately ascertain the effects of these
substances on male infertility. This can be summed up to the fact that individually,
analgesic drugs such as acetaminophen and EDCs such as genistein are known to alter
critical biological pathways, and the mixtures likely cause crosstalk of these altered
pathways to further complicate interpretations.

4.3 Future Perspectives

4.3.1 Contribution to the field of toxicology
The findings herein provide a solid basis in understanding the possible effects of
exposure to mixtures on infants, suggesting that an analgesic drug such as
acetaminophen, and EDCs such as GEN and DEHP can contribute to the dysregulation
of male gonad development and in the long-term, male infertility. This is the first study in
the field of toxicology to address the effects of AC and GEN as a mixture which provides
data showing differential responses in immature Sertoli cell to exposures to AC and
GEN alone and to their mixtures. Our study overall gives the field of toxicology more

87

reasons to emphasize research on EDC and drug mixture effects on male reproductive
health and fertility.

4.3.2 Role of cJUN and GP130 in mediating AC+GEN mixture effects
The discovery of cJUN and GP130 as potential targets, involved in the
dysregulation of immature Sertoli cell functions by GEN effects on ER-α/β and GPER
signaling was described in Chapter 3. We showed that cJUN is activated in primary
PND8 rat Sertoli cells treated with ER-α/β antagonist ICI 182,780 and GPER antagonist
G15. We also found that total cJUN gene expression was altered by pharmacological
inhibition of ERs and GPER, added to AG50 mixture in immature Sertoli cells.
Additionally, characterizing the effects of these compounds by immunofluorescent
staining or western blotting of GP130 would be critical for the interpretation of the data
showing alterations of GP130 signaling by GEN and AG mixtures.

4.4 Conclusion
Based on the findings of this dissertation project, immature Sertoli cells provide
valuable insight as in vitro models in understanding how EDC and drugs, alone and in
mixtures, may disrupt male gonad development, an important and poorly understood
risk to male reproductive health. Immature Sertoli cells were shown to be dysregulated
by exposure to AC, GEN, and their mixture at concentrations relevant to human
exposure. Mixtures are complex and critical to study, as these can have additive,
synergistic or compensatory effects on male gonad development, as suggested by this
dissertation project. The potential signaling mechanisms and targets mentioned here
can contribute to therapeutic targets and understanding some of the origins of male
infertility.

88

Bibliography

Akpovi, C. D., Murphy, B. D., Erickson, R. P., & Pelletier, R. M. (2014, Aug).
Dysregulation of testicular cholesterol metabolism following spontaneous
mutation of the niemann-pick c1 gene in mice. Biol Reprod, 91(2), 42.
https://doi.org/10.1095/biolreprod.114.119412

Albert, O., Desdoits-Lethimonier, C., Lesne, L., Legrand, A., Guille, F., Bensalah, K.,
Dejucq-Rainsford, N., & Jegou, B. (2013, Jul). Paracetamol, aspirin and
indomethacin display endocrine disrupting properties in the adult human testis in
vitro. Hum Reprod, 28(7), 1890-1898. https://doi.org/10.1093/humrep/det112

Altena, R., Fehrmann, R. S., Boer, H., de Vries, E. G., Meijer, C., & Gietema, J. A.
(2015). Growth differentiation factor 15 (GDF-15) plasma levels increase during
bleomycin- and cisplatin-based treatment of testicular cancer patients and relate
to endothelial damage. PLoS One, 10(1), e0115372.
https://doi.org/10.1371/journal.pone.0115372

Anderson, R., & Sharpe, R. (2000). Regulation of inhibin production in the human male
and its clinical applications. International journal of andrology, 23(3), 136-144.

Araki, A., Mitsui, T., Miyashita, C., Nakajima, T., Naito, H., Ito, S., Sasaki, S., Cho, K.,
Ikeno, T., & Nonomura, K. (2014). Association between maternal exposure to di
(2-ethylhexyl) phthalate and reproductive hormone levels in fetal blood: the
Hokkaido study on environment and children's health. PloS one, 9(10), e109039.

Archambeault, D. R., Tomaszewski, J., Childs, A. J., Anderson, R. A., & Yao, H. H.-C.
(2011). Testicular somatic cells, not gonocytes, are the major source of functional
activin A during testis morphogenesis. Endocrinology, 152(11), 4358-4367.

Atanassova, N., McKinnell, C., Walker, M., Turner, K., Fisher, J., Morley, M., Millar, M.,
Groome, N., & Sharpe, R. (1999). Permanent effects of neonatal estrogen
exposure in rats on reproductive hormone levels, Sertoli cell number, and the
efficiency of spermatogenesis in adulthood. Endocrinology, 140(11), 5364-5373.

Axelstad, M., Hass, U., Scholze, M., Christiansen, S., Kortenkamp, A., & Boberg, J.
(2018). EDC IMPACT: Reduced sperm counts in rats exposed to human relevant
mixtures of endocrine disrupters. Endocrine connections, 7(1), 139-148.

Bacanlı, M., Secerli, J., Karayavuz, B., Erdem, O., & Erdoğan, H. (2022). Is a non-
cytotoxic and non-genotoxic novel bioinspired dipeptide structure synthesis
possible for theragnostic applications? Drug and Chemical Toxicology, 1-9.

Barakat, B., O'Connor, A. E., Gold, E., de Kretser, D. M., & Loveland, K. L. (2008).
Inhibin, activin, follistatin and FSH serum levels and testicular production are

89

highly modulated during the first spermatogenic wave in mice. Reproduction,
136(3), 345-359.

Basciani, S., De Luca, G., Dolci, S., Brama, M., Arizzi, M., Mariani, S., Rosano, G.,
Spera, G., & Gnessi, L. (2008). Platelet-Derived Growth Factor Receptor β-
Subtype Regulates Proliferation and Migration of Gonocytes. Endocrinology,
149(12), 6226-6235. https://doi.org/10.1210/en.2008-0349

Behringer, R. R., Finegold, M. J., & Cate, R. L. (1994). Müllerian-inhibiting substance
function during mammalian sexual development. Cell, 79(3), 415-425.

Ben Maamar, M., Lesné, L., Hennig, K., Desdoits-Lethimonier, C., Kilcoyne, K. R.,
Coiffec, I., Rolland, A. D., Chevrier, C., Kristensen, D. M., Lavoué, V., Antignac,
J.-P., Le Bizec, B., Dejucq-Rainsford, N., Mitchell, R. T., Mazaud-Guittot, S., &
Jégou, B. (2017, 2017/03/10). Ibuprofen results in alterations of human fetal
testis development. Scientific Reports, 7(1), 44184.
https://doi.org/10.1038/srep44184

Berger, T., Conley, A. J., Van Klompenberg, M., Roser, J. F., & Hovey, R. C. (2013).
Increased testicular Sertoli cell population induced by an estrogen receptor
antagonist. Molecular and Cellular Endocrinology, 366(1), 53-58.

Bidgoli, S. A., Karimi, M., Asami, Z., Baher, H., & Zavarhei, M. D. (2011). Association
between testicular Aryl hydrocarbon Receptor levels and idiopathic male
infertility: A case–control study in Iran. Science of the total environment, 409(18),
3267-3273.

Bitgood, M. J., Shen, L., & McMahon, A. P. (1996, 1996/03/01/). Sertoli cell signaling by
Desert hedgehog regulates the male germline. Current Biology, 6(3), 298-304.
https://doi.org/https://doi.org/10.1016/S0960-9822(02)00480-3

Bogdan, M., Meca, A. D., Turcu-Stiolica, A., Oancea, C. N., Kostici, R., Surlin, M. V., &
Florescu, C. (2022, Dec 4). Insights into the Relationship between Pentraxin-3
and Cancer. Int J Mol Sci, 23(23). https://doi.org/10.3390/ijms232315302

Boizet-Bonhoure, B., Déjardin, S., Rossitto, M., Poulat, F., & Philibert, P. (2022). Using
experimental models to decipher the effects of acetaminophen and NSAIDs on
reproductive development and health. Frontiers in Toxicology, 4.

Boujrad, N., Ogwuegbu, S. O., Garnier, M., Lee, C.-H., Martin, B. M., & Papadopoulos,
V. (1995). Identification of a stimulator of steroid hormone synthesis isolated from
testis. Science, 268(5217), 1609-1612.

Boyer, A., Girard, M., Thimmanahalli, D. S., Levasseur, A., Céleste, C., Paquet, M.,
Duggavathi, R., & Boerboom, D. (2016). mTOR Regulates Gap Junction Alpha-1
Protein Trafficking in Sertoli Cells and Is Required for the Maintenance of

90

Spermatogenesis in Mice1. Biology of Reproduction, 95(1).
https://doi.org/10.1095/biolreprod.115.138016

Brown, R. D., Wilson, J. T., Kearns, G. L., Eichler, V. F., Johnson, V. A., & Bertrand, K.
M. (1992, Mar). Single-dose pharmacokinetics of ibuprofen and acetaminophen
in febrile children. J Clin Pharmacol, 32(3), 231-241.
https://doi.org/10.1002/j.1552-4604.1992.tb03831.x

Buzzard, J. J., Wreford, N. G., & Morrison, J. R. (2003). Thyroid Hormone, Retinoic
Acid, and Testosterone Suppress Proliferation and Induce Markers of
Differentiation in Cultured Rat Sertoli Cells. Endocrinology, 144(9), 3722-3731.
https://doi.org/10.1210/en.2003-0379

Campese, A. F., Grazioli, P., de Cesaris, P., Riccioli, A., Bellavia, D., Pelullo, M., Padula,
F., Noce, C., Verkhovskaia, S., & Filippini, A. (2014). Mouse Sertoli cells sustain
de novo generation of regulatory T cells by triggering the notch pathway through
soluble JAGGED1. Biology of Reproduction, 90(3), 53, 51-10.

Carreau, S., Delalande, C., Silandre, D., Bourguiba, S., & Lambard, S. (2006,
2006/02/26/). Aromatase and estrogen receptors in male reproduction. Molecular
and Cellular Endocrinology, 246(1), 65-68.
https://doi.org/https://doi.org/10.1016/j.mce.2005.11.021

Carreau, S., & Hess, R. A. (2010). Oestrogens and spermatogenesis. Philosophical
Transactions of the Royal Society B: Biological Sciences, 365(1546), 1517-1535.

Chakraborty, P., William Buaas, F., Sharma, M., Smith, B. E., Greenlee, A. R., Eacker,
S. M., & Braun, R. E. (2014). Androgen-Dependent Sertoli Cell Tight Junction
Remodeling Is Mediated by Multiple Tight Junction Components. Molecular
endocrinology (Baltimore, Md.), 28(7), 1055-1072.
https://doi.org/10.1210/me.2013-1134

Chen, K. Q., Wei, B. H., Hao, S. L., & Yang, W. X. (2022, Jul). The PI3K/AKT signaling
pathway: How does it regulate development of Sertoli cells and spermatogenic
cells? Histol Histopathol, 37(7), 621-636. https://doi.org/10.14670/HH-18-457

Chen, S. R., Hao, X. X., Zhang, Y., Deng, S. L., Wang, Z. P., Wang, Y. Q., Wang, X. X.,
& Liu, Y. X. (2016, Apr 5). Androgen receptor in Sertoli cells regulates DNA
double-strand break repair and chromosomal synapsis of spermatocytes partially
through intercellular EGF-EGFR signaling. Oncotarget, 7(14), 18722-18735.
https://doi.org/10.18632/oncotarget.7916

Cheng, C. Y., & Mruk, D. D. (2012). The Blood-Testis Barrier and Its Implications for
Male Contraception. Pharmacological Reviews, 64(1), 16-64.
https://doi.org/10.1124/pr.110.002790

91

Cheng, C. Y., Wong, E. W. P., Lie, P. P. Y., Li, M. W. M., Su, L., Siu, E. R., Yan, H. H. N.,
Mannu, J., Mathur, P. P., Bonanomi, M., Silvestrini, B., & Mruk, D. D. (2011,
2011/01/01). Environmental toxicants and male reproductive function.
Spermatogenesis, 1(1), 2-13. https://doi.org/10.4161/spmg.1.1.13971

Chimento, A., De Luca, A., Nocito, M. C., Avena, P., La Padula, D., Zavaglia, L., &
Pezzi, V. (2020). Role of GPER-Mediated Signaling in Testicular Functions and
Tumorigenesis. Cells, 9(9), 2115. https://www.mdpi.com/2073-4409/9/9/2115

Chimento, A., Sirianni, R., Delalande, C., Silandre, D., Bois, C., Andò, S., Maggiolini, M.,
Carreau, S., & Pezzi, V. (2010, 2010/05/14/). 17β-Estradiol activates rapid
signaling pathways involved in rat pachytene spermatocytes apoptosis through
GPR30 and ERα. Molecular and Cellular Endocrinology, 320(1), 136-144.
https://doi.org/https://doi.org/10.1016/j.mce.2010.01.035

Cooke, P. S., & Meisami, E. (1991). Early Hypothyroidism in Rats Causes Increased
Adult Testis and Reproductive Organ Size but Does Not Change Testosterone
Levels*. Endocrinology, 129(1), 237-243. https://doi.org/10.1210/endo-129-1-237

Cooke, P. S., Zhao, Y.-D., & Bunick, D. (1994). Triiodothyronine inhibits proliferation and
stimulates differentiation of cultured neonatal Sertoli cells: possible mechanism
for increased adult testis weight and sperm production induced by neonatal
goitrogen treatment. Biology of Reproduction, 51(5), 1000-1005.

Corpuz-Hilsabeck, M., Culty, M. (2023). Impact of endocrine disrupting chemicals and
pharmaceuticals on Sertoli cell development and functions. Frontiers in
Endocrinology.

Cortes, D., Müller, J., & Skakkebaek, N. E. (1987, Aug). Proliferation of Sertoli cells
during development of the human testis assessed by stereological methods. Int J
Androl, 10(4), 589-596. https://doi.org/10.1111/j.1365-2605.1987.tb00358.x

Cote, I., Andersen, M. E., Ankley, G. T., Barone, S., Birnbaum, L. S., Boekelheide, K.,
Bois, F. Y., Burgoon, L. D., Chiu, W. A., & Crawford-Brown, D. (2016). The Next
Generation of Risk Assessment multi-year study—highlights of findings,
applications to risk assessment, and future directions. Environmental health
perspectives, 124(11), 1671-1682.

Creasy, D. M., Foster, J. R., & Foster, P. M. (1983). The morphological development of
di-n-pentyl phthalate induced testicular atrophy in the rat. The Journal of
pathology, 139(3), 309-321.

Crépieux, P., Marion, S., Martinat, N., Fafeur, V., Vern, Y. L., Kerboeuf, D., Guillou, F., &
Reiter, E. (2001, 2001/08/01). The ERK-dependent signalling is stage-specifically
modulated by FSH, during primary Sertoli cell maturation. Oncogene, 20(34),
4696-4709. https://doi.org/10.1038/sj.onc.1204632

92

Culty, M. (2009). Gonocytes, the forgotten cells of the germ cell lineage. Birth Defects
Research Part C: Embryo Today: Reviews, 87(1), 1-26.

de Franca, L. R., Hess, R. A., Cooke, P. S., & Russell, L. D. (1995). Neonatal
hypothyroidism causes delayed Sertoli cell maturation in rats treated with
propylthiouracil: evidence that the Sertoli cell controls testis growth. The
Anatomical Record, 242(1), 57-69.

de Freitas, A. T. A. G., Ribeiro, M. A., Pinho, C. F., Peixoto, A. R., Domeniconi, R. F., &
Scarano, W. R. (2016, 2016/08/01/). Regulatory and junctional proteins of the
blood-testis barrier in human Sertoli cells are modified by monobutyl phthalate
(MBP) and bisphenol A (BPA) exposure. Toxicology in Vitro, 34, 1-7.
https://doi.org/https://doi.org/10.1016/j.tiv.2016.02.017

Diamanti-Kandarakis, E., Bourguignon, J.-P., Giudice, L. C., Hauser, R., Prins, G. S.,
Soto, A. M., Zoeller, R. T., & Gore, A. C. (2009). Endocrine-disrupting chemicals:
an Endocrine Society scientific statement. Endocrine reviews, 30(4), 293-342.

DiNapoli, L., & Capel, B. (2008). SRY and the Standoff in Sex Determination. Molecular
Endocrinology, 22(1), 1-9. https://doi.org/10.1210/me.2007-0250

Doni, A., Paffoni, A., Nebuloni, M., Ragni, G., Pasqualini, F., Valentino, S., Bonetti, S.,
Mantovani, A., Somigliana, E., & Garlanda, C. (2009, Jun). The long pentraxin 3
is a soluble and cell-associated component of the human semen. Int J Androl,
32(3), 255-264. https://doi.org/10.1111/j.1365-2605.2007.00845.x

Durand, P., Martin, G., Blondet, A., Gilleron, J., Carette, D., Janczarski, S., Christin, E.,
Pointis, G., & Perrard, M.-H. (2017). Effects of low doses of carbendazim or
iprodione either separately or in mixture on the pubertal rat seminiferous
epithelium: An ex vivo study. Toxicology in Vitro, 45, 366-373.

Elbatreek, M. H., Sadegh, S., Anastasi, E., Guney, E., Nogales, C., Kacprowski, T.,
Hassan, A. A., Teubner, A., Huang, P.-H., & Hsu, C.-Y. (2020). NOX5-induced
uncoupling of endothelial NO synthase is a causal mechanism and theragnostic
target of an age-related hypertension endotype. PLoS Biology, 18(11), e3000885.

França, L. R., Hess, R. A., Dufour, J. M., Hofmann, M. C., & Griswold, M. D. (2016). The
Sertoli cell: one hundred fifty years of beauty and plasticity. Andrology (Oxford),
4(2), 189-212. https://doi.org/10.1111/andr.12165

Fröjdman, K., Harley, V. R., & Pelliniemi, L. J. (2000). Sox9 protein in rat sertoli cells is
age and stage dependent. Histochemistry and cell biology, 113, 31-36.

93

Fröjdman, K., Harley, V. R., & Pelliniemi, L. J. (2000, Jan). Sox9 protein in rat sertoli
cells is age and stage dependent. Histochem Cell Biol, 113(1), 31-36.
https://doi.org/10.1007/s004180050004

Fujisawa, M., Okuda, Y., Fujioka, H., & Kamidono, S. (2002). Expression and regulation
of gp130 messenger ribonucleic acid in cultured immature rat Seroli cells.
Endocrine research, 28(1-2), 1-8.

Gao, Y., Mruk, D. D., & Cheng, C. Y. (2015). Sertoli cells are the target of environmental
toxicants in the testis - a mechanistic and therapeutic insight. Expert opinion on
therapeutic targets, 19(8), 1073-1090.
https://doi.org/10.1517/14728222.2015.1039513

Garcia, T. X., DeFalco, T., Capel, B., & Hofmann, M.-C. (2013). Constitutive activation of
NOTCH1 signaling in Sertoli cells causes gonocyte exit from quiescence.
Developmental Biology, 377(1), 188-201.

Gautam, M., Bhattacharya, I., Rai, U., & Majumdar, S. S. (2018). Hormone induced
differential transcriptome analysis of Sertoli cells during postnatal maturation of
rat testes. PLoS One, 13(1), e0191201.
https://doi.org/10.1371/journal.pone.0191201

Gore, A. C., Chappell, V. A., Fenton, S. E., Flaws, J. A., Nadal, A., Prins, G. S., Toppari,
J., & Zoeller, R. T. (2015a). EDC-2: the Endocrine Society's second scientific
statement on endocrine-disrupting chemicals. Endocrine reviews, 36(6), E1-
E150.

Gore, A. C., Chappell, V. A., Fenton, S. E., Flaws, J. A., Nadal, A., Prins, G. S., Toppari,
J., & Zoeller, R. T. (2015b). Executive summary to EDC-2: the Endocrine
Society's second scientific statement on endocrine-disrupting chemicals.
Endocrine reviews, 36(6), 593.

Griswold, M. D. (2018). 50 years of spermatogenesis: Sertoli cells and their interactions
with germ cells. Biology of Reproduction, 99(1), 87-100.

Grivennikov, S. I., & Karin, M. (2010, Feb). Dangerous liaisons: STAT3 and NF-kappaB
collaboration and crosstalk in cancer. Cytokine Growth Factor Rev, 21(1), 11-19.
https://doi.org/10.1016/j.cytogfr.2009.11.005

Hasthorpe, S., Barbic, S., Farmer, P., & Hutson, J. (2000). Growth factor and somatic
cell regulation of mouse gonocyte-derived colony formation in vitro. Journal of
reproduction and fertility, 119(1), 85-92.

Hazra, R., Corcoran, L., Robson, M., McTavish, K. J., Upton, D., Handelsman, D. J., &
Allan, C. M. (2013, Jan). Temporal role of Sertoli cell androgen receptor

94

expression in spermatogenic development. Mol Endocrinol, 27(1), 12-24.
https://doi.org/10.1210/me.2012-1219

Heckert, L., & Griswold, M. D. (1993). Expression of the FSH receptor in the testis.
Recent Prog Horm Res, 48, 61-77. https://doi.org/10.1016/b978-0-12-571148-
7.50006-3

Heindel, J. J., & Powell, C. J. (1992, 1992/07/01/). Phthalate ester effects on rat sertoli
cell function in vitro: Effects of phthalate side chain and age of animal. Toxicology
and applied pharmacology, 115(1), 116-123.
https://doi.org/https://doi.org/10.1016/0041-008X(92)90374-2

Hermo, L., Pelletier, R. M., Cyr, D. G., & Smith, C. E. (2010). Surfing the wave, cycle,
life history, and genes/proteins expressed by testicular germ cells. Part 5:
intercellular junctions and contacts between germs cells and Sertoli cells and
their regulatory interactions, testicular cholesterol, and genes/proteins associated
with more than one germ cell generation. Microscopy Research and Technique,
73(4), 409-494.

Hollenbach, J., Jung, K., Noelke, J., Gasse, H., Pfarrer, C., Koy, M., & Brehm, R. (2018).
Loss of connexin43 in murine Sertoli cells and its effect on blood-testis barrier
formation and dynamics. PloS one, 13(6), e0198100.
https://doi.org/10.1371/journal.pone.0198100

Honke, N., Shaabani, N., Zhang, D. E., Hardt, C., & Lang, K. S. (2016, Nov 3). Multiple
functions of USP18. Cell Death Dis, 7(11), e2444.
https://doi.org/10.1038/cddis.2016.326

Hu, Y., Li, D.-M., & Han, X.-D. (2012). Analysis of combined effects of nonylphenol and
Monobutyl phthalate on rat Sertoli cells applying two mathematical models. Food
and chemical toxicology, 50(3-4), 457-463.

Hu, Y., Wang, R., Xiang, Z., Qian, W., Han, X., & Li, D. (2014). Antagonistic effects of a
mixture of low-dose nonylphenol and di-n-butyl phthalate (monobutyl phthalate)
on the Sertoli cells and serum reproductive hormones in prepubertal male rats in
vitro and in vivo. PloS one, 9(3), e93425.

Jenab, S., & Morris, P. L. (1997). Transcriptional Regulation of Sertoli Cell Immediate
Early Genes by Interleukin-6 and Interferon-γ Is Mediated through
Phosphorylation of STAT-3 and STAT-1 Proteins*. Endocrinology, 138(7), 2740-
2746. https://doi.org/10.1210/endo.138.7.5243

Jones, S., Boisvert, A., Duong, T. B., Francois, S., Thrane, P., & Culty, M. (2014).
Disruption of rat testis development following combined in utero exposure to the
phytoestrogen genistein and antiandrogenic plasticizer di-(2-ethylhexyl)
phthalate. Biology of reproduction, 91(3), 64, 61-14.

95

Jones, S., Boisvert, A., Francois, S., Zhang, L., & Culty, M. (2015). In utero exposure to
di-(2-ethylhexyl) phthalate induces testicular effects in neonatal rats that are
antagonized by genistein cotreatment. Biology of reproduction, 93(4), 92, 91-14.

Kaur, G., Mital, P., & Dufour, J. M. (2013, Jan). Testisimmune privilege - Assumptions
versus facts. Anim Reprod, 10(1), 3-15.

Kaur, G., Thompson, L. A., & Dufour, J. M. (2014). Sertoli cells–immunological sentinels
of spermatogenesis. Seminars in Cell & Developmental Biology,

Kaur, G., Wright, K., Mital, P., Hibler, T., Miranda, J. M., Thompson, L. A., Halley, K., &
Dufour, J. M. (2020). Neonatal Pig Sertoli Cells Survive Xenotransplantation by
Creating an Immune Modulatory Environment Involving CD4 and CD8
Regulatory T Cells. Cell transplantation, 29, 0963689720947102.

Khan, S. A., Ndjountche, L., Pratchard, L., Spicer, L., & Davis, J. S. (2002). Follicle-
stimulating hormone amplifies insulin-like growth factor I-mediated activation of
AKT/protein kinase B signaling in immature rat Sertoli cells. Endocrinology,
143(6), 2259-2267.

Knazicka, Z., Forgacs, Z., Lukacova, J., Roychoudhury, S., Massanyi, P., & Lukac, N.
(2015). Endocrine disruptive effects of cadmium on steroidogenesis: human
adrenocortical carcinoma cell line NCI-H295R as a cellular model for
reproductive toxicity testing. Journal of Environmental Science and Health, Part
A, 50(4), 348-356.

Knebelmann, B., Boussin, L., Guerrier, D., Legeai, L., Kahn, A., Josso, N., & Picard, J.
(1991). Anti-Müllerian hormone Bruxelles: a nonsense mutation associated with
the persistent Müllerian duct syndrome. Proceedings of the National Academy of
Sciences, 88(9), 3767-3771.

Koopman, P., Gubbay, J., Vivian, N., Goodfellow, P., & Lovell-Badge, R. (1991,
1991/05/01). Male development of chromosomally female mice transgenic for
Sry. Nature, 351(6322), 117-121. https://doi.org/10.1038/351117a0

Kristensen, D. M., Hass, U., Lesné, L., Lottrup, G., Jacobsen, P. R., Desdoits-
Lethimonier, C., Boberg, J., Petersen, J. H., Toppari, J., & Jensen, T. K. (2011).
Intrauterine exposure to mild analgesics is a risk factor for development of male
reproductive disorders in human and rat. Human Reproduction, 26(1), 235-244.

Kristensen, D. M., Mazaud-Guittot, S., Gaudriault, P., Lesné, L., Serrano, T., Main, K.
M., & Jégou, B. (2016). Analgesic use—prevalence, biomonitoring and endocrine
and reproductive effects. Nature Reviews Endocrinology, 12(7), 381-393.

96

Kristensen, D. M., Skalkam, M. L., Audouze, K., Lesné, L., Desdoits-Lethimonier, C.,
Frederiksen, H., Brunak, S., Skakkebæk, N. E., Jégou, B., & Hansen, J. B.
(2011). Many putative endocrine disruptors inhibit prostaglandin synthesis.
Environmental Health Perspectives, 119(4), 534-541.

Kugathas, S., Audouze, K., Ermler, S., Orton, F., Rosivatz, E., Scholze, M., &
Kortenkamp, A. (2016). Effects of common pesticides on prostaglandin D2
(PGD2) inhibition in SC5 mouse Sertoli cells, evidence of binding at the COX-2
active site, and implications for endocrine disruption. Environmental Health
Perspectives, 124(4), 452-459.

Kumar, N., Srivastava, S., & Roy, P. (2015). Impact of low molecular weight phthalates
in inducing reproductive malfunctions in male mice: Special emphasis on Sertoli
cell functions. General and Comparative Endocrinology, 215, 36-50.

Lambrot, R., Muczynski, V., Lécureuil, C., Angenard, G., Coffigny, H., Pairault, C.,
Moison, D., Frydman, R., Habert, R., & Rouiller-Fabre, V. (2009, Jan). Phthalates
impair germ cell development in the human fetal testis in vitro without change in
testosterone production. Environ Health Perspect, 117(1), 32-37.
https://doi.org/10.1289/ehp.11146

Lee, Y. S., Yoon, H.-J., Oh, J.-H., Park, H.-J., Lee, E.-H., Song, C.-W., & Yoon, S. (2009,
2009/09/10/). 1,3-Dinitrobenzene induces apoptosis in TM4 mouse Sertoli cells:
Involvement of the c-Jun N-terminal kinase (JNK) MAPK pathway. Toxicology
Letters, 189(2), 145-151.
https://doi.org/https://doi.org/10.1016/j.toxlet.2009.05.014

Lehraiki, A., Chamaillard, C., Krust, A., Habert, R., & Levacher, C. (2011). Genistein
impairs early testosterone production in fetal mouse testis via estrogen receptor
alpha. Toxicology in Vitro, 25(8), 1542-1547.

Li, D., Hu, Y., Shen, X., Dai, X., & Han, X. (2010). Combined effects of two
environmental endocrine disruptors nonyl phenol and di-n-butyl phthalate on rat
Sertoli cells in vitro. Reproductive Toxicology, 30(3), 438-445.

Li, H., & Spade, D. J. (2021). REPRODUCTIVE TOXICOLOGY: Environmental
exposures, fetal testis development and function: Phthalates and beyond.
Reproduction, 162(5), F147-F167.

Li, L., Zirkin, B. R., & Papadopoulos, V. (2018). Leydig cell androgen synthesis.
Encyclopedia of Reproduction; Elsevier: Baltimore, MD, USA, 215-221.

Li, P., Tang, J., Yu, Z., Jin, C., Wang, Z., Li, M., Zou, D., Mang, X., Liu, J., Lu, Y., Miao,
S., Wang, L., Li, K., & Song, W. (2022, Nov 14). CHD4 acts as a critical regulator
in the survival of spermatogonial stem cells in mice†. Biol Reprod, 107(5), 1331-
1344. https://doi.org/10.1093/biolre/ioac162

97

Lin, J., Zhu, J., Li, X., Li, S., Lan, Z., Ko, J., & Lei, Z. (2014, Nov). Expression of
genomic functional estrogen receptor 1 in mouse sertoli cells. Reprod Sci, 21(11),
1411-1422. https://doi.org/10.1177/1933719114527355

Liu, B., Liu, C., Ma, B., Zhang, R., Zhao, Z., Xiao, S., Cao, W., Ma, Y., Zhu, G., & Li, W.
(2022). PA1 participates in the maintenance of blood–testis barrier integrity via
cooperation with JUN in the Sertoli cells of mice. Cell & Bioscience, 12(1), 1-20.

Lucas, T. F., Pimenta, M. T., Pisolato, R., Lazari, M. F. M., & Porto, C. S. (2011). 17β-
estradiol signaling and regulation of Sertoli cell function. Spermatogenesis, 1(4),
318-324.

Lucas, T. F. G., Lazari, M. F. M., & Porto, C. S. (2014, 2014/01/25/). Differential role of
the estrogen receptors ESR1 and ESR2 on the regulation of proteins involved
with proliferation and differentiation of Sertoli cells from 15-day-old rats.
Molecular and Cellular Endocrinology, 382(1), 84-96.
https://doi.org/https://doi.org/10.1016/j.mce.2013.09.015

Lucas, T. F. G., Royer, C., Siu, E. R., Lazari, M. F. M., & Porto, C. S. (2010). Expression
and Signaling of G Protein-Coupled Estrogen Receptor 1 (GPER) in Rat Sertoli
Cells1. Biology of reproduction, 83(2), 307-317.
https://doi.org/10.1095/biolreprod.110.084160

Luconi, M., Forti, G., & Baldi, E. (2002, 2002/04/01/). Genomic and nongenomic effects
of estrogens: molecular mechanisms of action and clinical implications for male
reproduction. The Journal of Steroid Biochemistry and Molecular Biology, 80(4),
369-381. https://doi.org/https://doi.org/10.1016/S0960-0760(02)00041-9

Luo, J., & Liu, D. (2020). Does GPER really function as a G protein-coupled estrogen
receptor in vivo? Frontiers in endocrinology, 11, 148.

Lustofin, S., Kamińska, A., Brzoskwinia, M., Cyran, J., Kotula-Balak, M., Bilińska, B., &
Hejmej, A. (2022). Nuclear and Membrane Receptors for Sex Steroids Are
Involved in the Regulation of Delta/Serrate/LAG-2 Proteins in Rodent Sertoli
Cells. International Journal of Molecular Sciences, 23(4), 2284.

Lv, C., Wang, X., Guo, Y., & Yuan, S. (2020). Role of Selective Autophagy in
Spermatogenesis and Male Fertility. Cells, 9(11), 2523.

Ma, T., Hou, J., Zhou, Y., Chen, Y., Qiu, J., Wu, J., Ding, J., Han, X., & Li, D. (2020,
2020/08/01). Dibutyl phthalate promotes juvenile Sertoli cell proliferation by
decreasing the levels of the E3 ubiquitin ligase Pellino 2. Environmental Health,
19(1), 87. https://doi.org/10.1186/s12940-020-00639-1

98

Ma, Y., Zhou, Y., Zou, S. S., Sun, Y., & Chen, X. F. (2022, Feb 4). Exosomes released
from Sertoli cells contribute to the survival of Leydig cells through CCL20 in rats.
Mol Hum Reprod, 28(2). https://doi.org/10.1093/molehr/gaac002

Manku, G., & Culty, M. (2015, May-Jun). Dynamic changes in the expression of
apoptosis-related genes in differentiating gonocytes and in seminomas. Asian J
Androl, 17(3), 403-414. https://doi.org/10.4103/1008-682x.146101

Manku, G., Mazer, M., & Culty, M. (2012). Neonatal testicular gonocytes isolation and
processing for immunocytochemical analysis. In Germline Development (pp. 17-
29). Springer.

Manku, G., Wing, S. S., & Culty, M. (2012). Expression of the ubiquitin proteasome
system in neonatal rat gonocytes and spermatogonia: role in gonocyte
differentiation. Biology of Reproduction, 87(2), 44, 41-18.

Martinez-Arguelles, D., Campioli, E., Culty, M., Zirkin, B., & Papadopoulos, V. (2013).
Fetal origin of endocrine dysfunction in the adult: the phthalate model. The
Journal of steroid biochemistry and molecular biology, 137, 5-17.

Mather, J. P. (1980). Establishment and characterization of two distinct mouse testicular
epithelial cell lines. Biology of reproduction, 23(1), 243-252.

McClain, C. J., Vatsalya, V., & Mitchell, M. C. (2021). Keratin-18: Diagnostic, Prognostic
and Theragnostic for Alcohol-Associated Hepatitis. The American journal of
gastroenterology, 116(1), 77.

McDevitt, M. A., Glidewell-Kenney, C., Weiss, J., Chambon, P., Jameson, J. L., &
Levine, J. E. (2007). Estrogen response element-independent estrogen receptor
(ER)-α signaling does not rescue sexual behavior but restores normal
testosterone secretion in male ERα knockout mice. Endocrinology, 148(11),
5288-5294.

Meroni, S. B., Galardo, M. N., Rindone, G., Gorga, A., Riera, M. F., & Cigorraga, S. B.
(2019a). Molecular mechanisms and signaling pathways involved in sertoli cell
proliferation. Frontiers in endocrinology, 10, 224.

Meroni, S. B., Galardo, M. N., Rindone, G., Gorga, A., Riera, M. F., & Cigorraga, S. B.
(2019b, 2019-April-16). Molecular Mechanisms and Signaling Pathways Involved
in Sertoli Cell Proliferation [Review]. Frontiers in Endocrinology, 10(224).
https://doi.org/10.3389/fendo.2019.00224

Moniot, B., Declosmenil, F., Barrionuevo, F., Scherer, G., Aritake, K., Malki, S., Marzi, L.,
Cohen-Solal, A., Georg, I., & Klattig, J. r. (2009). The PGD2 pathway,
independently of FGF9, amplifies SOX9 activity in Sertoli cells during male
sexual differentiation.

99

Moriarty, K., Kim, K. H., & Bender, J. R. (2006). Estrogen Receptor-Mediated Rapid
Signaling. Endocrinology, 147(12), 5557-5563. https://doi.org/10.1210/en.2006-
0729

Mruk, D. D., & Cheng, C. Y. (2015). The mammalian blood-testis barrier: its biology and
regulation. Endocrine reviews, 36(5), 564-591.

Ni, F.-D., Hao, S.-L., & Yang, W.-X. (2019, 2019/07/17). Multiple signaling pathways in
Sertoli cells: recent findings in spermatogenesis. Cell Death & Disease, 10(8),
541. https://doi.org/10.1038/s41419-019-1782-z

O’Donnell, L., Smith, L. B., & Rebourcet, D. (2022). Sertoli cells as key drivers of testis
function. Seminars in cell & developmental biology,

Ohta, K., Yamamoto, M., Lin, Y., Hogg, N., Akiyama, H., Behringer, R. R., & Yamazaki,
Y. (2012). Male Differentiation of Germ Cells Induced by Embryonic Age-Specific
Sertoli Cells in Mice1. Biology of Reproduction, 86(4).
https://doi.org/10.1095/biolreprod.111.095943

Okuma, Y., O’Connor, A. E., Muir, J. A., Stanton, P. G., de Kretser, D. M., & Hedger, M.
P. (2005). Regulation of activin A and inhibin B secretion by inflammatory
mediators in adult rat Sertoli cell cultures. Journal of endocrinology, 187(1), 125-
134.

Oliveira, P. F., Martins, A. D., Moreira, A. C., Cheng, C. Y., & Alves, M. G. (2015). The
Warburg effect revisited—lesson from the Sertoli cell. Medicinal research
reviews, 35(1), 126-151.

Orth, J. M. (1982). Proliferation of Sertoli cells in fetal and postnatal rats: a quantitative
autoradiographic study. The Anatomical Record, 203(4), 485-492.

Orth, J. M. (1984, Oct). The role of follicle-stimulating hormone in controlling Sertoli cell
proliferation in testes of fetal rats. Endocrinology, 115(4), 1248-1255.
https://doi.org/10.1210/endo-115-4-1248

Ozdemir, V., Williams-Jones, B., Glatt, S. J., Tsuang, M. T., Lohr, J. B., & Reist, C.
(2006). Shifting emphasis from pharmacogenomics to theragnostics. Nature
biotechnology, 24(8), 942-946.

Papadopoulos, V., Carreau, S., Szerman-Joly, E., Drosdowsky, M., Dehennin, L., &
Scholler, R. (1986). Rat testis 17β-estradiol: identification by gas
chromatography-mass spectrometry and age related cellular distribution. Journal
of steroid biochemistry, 24(6), 1211-1216.

100

Patrick, S. M., Bornman, M. S., Joubert, A. M., Pitts, N., Naidoo, V., & De Jager, C.
(2016). Effects of environmental endocrine disruptors, including insecticides used
for malaria vector control on reproductive parameters of male rats. Reproductive
Toxicology, 61, 19-27.

Payne, C. J., Gallagher, S. J., Foreman, O., Dannenberg, J. H., Depinho, R. A., &
Braun, R. E. (2010). Sin3a Is Required by Sertoli Cells to Establish a Niche for
Undifferentiated Spermatogonia, Germ Cell Tumors, and Spermatid Elongation.
STEM CELLS, 28(8), 1424-1434. https://doi.org/https://doi.org/10.1002/stem.464

Petersen, C., Boitani, C., Fröysa, B., & Söder, O. (2002, 2002/01/15/). Interleukin-1 is a
potent growth factor for immature rat Sertoli cells. Molecular and Cellular
Endocrinology, 186(1), 37-47. https://doi.org/https://doi.org/10.1016/S0303-
7207(01)00680-3

Petersen, C., Fröysa, B., & Söder, O. (2004, 2004/02/01/). Endotoxin and
proinflammatory cytokines modulate Sertoli cell proliferation in vitro. Journal of
Reproductive Immunology, 61(1), 13-30.
https://doi.org/https://doi.org/10.1016/j.jri.2003.10.003

Petricca, S., Celenza, G., Luzi, C., Cinque, B., Lizzi, A. R., Franceschini, N., Festuccia,
C., & Iorio, R. (2022). Synergistic Activity of Ketoconazole and Miconazole with
Prochloraz in Inducing Oxidative Stress, GSH Depletion, Mitochondrial
Dysfunction, and Apoptosis in Mouse Sertoli TM4 Cells. International Journal of
Molecular Sciences, 23(10), 5429. https://www.mdpi.com/1422-0067/23/10/5429

Qu, N., Ogawa, Y., Kuramasu, M., Nagahori, K., Sakabe, K., & Itoh, M. (2020).
Immunological microenvironment in the testis. Reproductive medicine and
biology, 19(1), 24-31.

Raymond, C. S., Murphy, M. W., O'Sullivan, M. G., Bardwell, V. J., & Zarkower, D.
(2000). Dmrt1, a gene related to worm and fly sexual regulators, is required for
mammalian testis differentiation. Genes & development, 14(20), 2587-2595.

Rebourcet, D., O'Shaughnessy, P. J., Pitetti, J.-L., Monteiro, A., O'Hara, L., Milne, L.,
Tsai, Y. T., Cruickshanks, L., Riethmacher, D., & Guillou, F. (2014). Sertoli cells
control peritubular myoid cell fate and support adult Leydig cell development in
the prepubertal testis. Development, 141(10), 2139-2149.

Rehman, Z. u., Worku, T., Davis, J. S., Talpur, H. S., Bhattarai, D., Kadariya, I., Hua, G.,
Cao, J., Dad, R., Farmanullah, Hussain, T., & Yang, L. (2017). Role and
mechanism of AMH in the regulation of Sertoli cells in mice. The Journal of
steroid biochemistry and molecular biology, 174, 133-140.
https://doi.org/10.1016/j.jsbmb.2017.08.011

101

Reis, M. M., Moreira, A. C., Sousa, M., Mathur, P. P., Oliveira, P. F., & Alves, M. G.
(2015, Aug). Sertoli cell as a model in male reproductive toxicology: Advantages
and disadvantages. J Appl Toxicol, 35(8), 870-883.
https://doi.org/10.1002/jat.3122

Revankar, C. M., Cimino, D. F., Sklar, L. A., Arterburn, J. B., & Prossnitz, E. R. (2005). A
transmembrane intracellular estrogen receptor mediates rapid cell signaling.
Science, 307(5715), 1625-1630.

Rey, R. A., Musse, M., Venara, M., & Chemes, H. E. (2009). Ontogeny of the androgen
receptor expression in the fetal and postnatal testis: its relevance on Sertoli cell
maturation and the onset of adult spermatogenesis. Microscopy research and
technique, 72(11), 787-795.

Ribeiro, E., Ladeira, C., & Viegas, S. (2017). EDCs mixtures: a stealthy hazard for
human health? Toxics, 5(1), 5.

Riera, M. F., Regueira, M., Galardo, M. N., Pellizzari, E. H., Meroni, S. B., & Cigorraga,
S. B. (2012). Signal transduction pathways in FSH regulation of rat Sertoli cell
proliferation. American Journal of Physiology-Endocrinology and Metabolism,
302(8), E914-E923.

Rossi, S. P., Windschüttl, S., Matzkin, M. E., Rey-Ares, V., Terradas, C., Ponzio, R.,
Puigdomenech, E., Levalle, O., Calandra, R. S., & Mayerhofer, A. (2016).
Reactive oxygen species (ROS) production triggered by prostaglandin D2
(PGD2) regulates lactate dehydrogenase (LDH) expression/activity in TM4 Sertoli
cells. Molecular and Cellular Endocrinology, 434, 154-165.

Rossitto, M., Marchive, C., Pruvost, A., Sellem, E., Ghettas, A., Badiou, S., Sutra, T.,
Poulat, F., Philibert, P., & Boizet-Bonhoure, B. (2019). Intergenerational effects on
mouse sperm quality after in utero exposure to acetaminophen and ibuprofen.
The FASEB Journal, 33(1), 339-357.

Rossitto, M., Ujjan, S., Poulat, F., & Boizet-Bonhoure, B. (2015). Multiple roles of the
prostaglandin D2 signaling pathway in reproduction. Reproduction, 149(1), R49-
R58.

Rotgers, E., Jørgensen, A., & Yao, H. H.-C. (2018a). At the Crossroads of Fate-Somatic
Cell Lineage Specification in the Fetal Gonad. Endocrine reviews, 39(5), 739-
759. https://doi.org/10.1210/er.2018-00010

Rotgers, E., Jørgensen, A., & Yao, H. H.-C. (2018b). At the crossroads of fate—somatic
cell lineage specification in the fetal gonad. Endocrine reviews, 39(5), 739-759.

Rozman, K. K., Bhatia, J., Calafat, A. M., Chambers, C., Culty, M., Etzel, R. A., Flaws, J.
A., Hansen, D. K., Hoyer, P. B., Jeffery, E. H., Kesner, J. S., Marty, S., Thomas, J.

102

A., & Umbach, D. (2006, Dec). NTP-CERHR expert panel report on the
reproductive and developmental toxicity of genistein. Birth Defects Res B Dev
Reprod Toxicol, 77(6), 485-638. https://doi.org/10.1002/bdrb.20087

Savard, C., Gawhary, S., Boyer, A., & Chorfi, Y. (2022). Assessment of Zearalenone-
Induced Cell Survival and of Global Gene Regulation in Mouse TM4 Sertoli Cells.
Toxins, 14(2), 98. https://www.mdpi.com/2072-6651/14/2/98

Schug, T. T., Johnson, A. F., Birnbaum, L. S., Colborn, T., Guillette Jr, L. J., Crews, D. P.,
Collins, T., Soto, A. M., Vom Saal, F. S., & McLachlan, J. A. (2016). Minireview:
endocrine disruptors: past lessons and future directions. Molecular
Endocrinology, 30(8), 833-847.

Sehy, D. W., Shao, L. E., Tsai, W. M., Yu, J., & Yu, A. L. (1992). Activin A-induced
diffrentiation in K562 cells is associated with a transient hypophosphorylation of
RB protein and the concomitant block of cell cycle at G1 phase. Journal of
cellular biochemistry, 50(3), 255-265.

Setchell, K. D., Zimmer-Nechemias, L., Cai, J., & Heubi, J. E. (1997). Exposure of
infants to phyto-oestrogens from soy-based infant formula. The Lancet,
350(9070), 23-27.

Shahidul Makki, M., Cristy Ruteshouser, E., & Huff, V. (2013, Mar 10). Ubiquitin specific
protease 18 (Usp18) is a WT1 transcriptional target. Exp Cell Res, 319(5), 612-
622. https://doi.org/10.1016/j.yexcr.2012.12.021

Sharma, P., Kaur, P., Ghanghas, P., Kaur, J., & Kaushal, N. (2020, 2020/09/01/).
Selenium Ameliorates Ibuprofen Induced Testicular Toxicity by Redox Regulation:
Running Head: Se protects against NSAID induced testicular toxicity.
Reproductive Toxicology, 96, 349-358.
https://doi.org/https://doi.org/10.1016/j.reprotox.2020.08.005

Sharpe, R. M., McKinnell, C., Kivlin, C., & Fisher, J. S. (2003, Jun). Proliferation and
functional maturation of Sertoli cells, and their relevance to disorders of testis
function in adulthood. Reproduction, 125(6), 769-784.
https://doi.org/10.1530/rep.0.1250769

Singh, N. P., De Kumar, B., Paulson, A., Parrish, M. E., Scott, C., Zhang, Y., Florens, L.,
& Krumlauf, R. (2021, Feb 3). Genome-Wide Binding Analyses of HOXB1
Revealed a Novel DNA Binding Motif Associated with Gene Repression. J Dev
Biol, 9(1). https://doi.org/10.3390/jdb9010006

Siu, E. R., Mruk, D. D., Porto, C. S., & Cheng, C. Y. (2009). Cadmium-induced testicular
injury. Toxicology and applied pharmacology, 238(3), 240-249.

103

Skakkebaek, N. E., Rajpert-De Meyts, E., Buck Louis, G. M., Toppari, J., Andersson, A.-
M., Eisenberg, M. L., Jensen, T. K., Jørgensen, N., Swan, S. H., & Sapra, K. J.
(2016). Male reproductive disorders and fertility trends: influences of environment
and genetic susceptibility. Physiological reviews, 96(1), 55-97.

Solecki, R., Kortenkamp, A., Bergman, Å., Chahoud, I., Degen, G. H., Dietrich, D.,
Greim, H., Håkansson, H., Hass, U., & Husoy, T. (2017). Scientific principles for
the identification of endocrine-disrupting chemicals: a consensus statement.
Archives of Toxicology, 91, 1001-1006.

Sridharan, S., Simon, L., Meling, D. D., Cyr, D. G., Gutstein, D. E., Fishman, G. I.,
Guillou, F., & Cooke, P. S. (2007, May). Proliferation of adult sertoli cells following
conditional knockout of the Gap junctional protein GJA1 (connexin 43) in mice.
Biol Reprod, 76(5), 804-812. https://doi.org/10.1095/biolreprod.106.059212

Stewart, J., & Turner, K. J. (2005). Inhibin B as a potential biomarker of testicular
toxicity. Cancer Biomarkers, 1(1), 75-91.

Suen, A. A., Kenan, A. C., & Williams, C. J. (2022). Developmental exposure to
phytoestrogens found in soy: New findings and clinical implications. Biochemical
Pharmacology, 195, 114848.

Sun, Y., Yang, W., Luo, H., Wang, X., Chen, Z., Zhang, J., Wang, Y., & Li, X. (2015,
2015/01/01/). Thyroid hormone inhibits the proliferation of piglet Sertoli cell via
PI3K signaling pathway. Theriogenology, 83(1), 86-94.
https://doi.org/https://doi.org/10.1016/j.theriogenology.2014.08.003

Swami, S., Krishnan, A. V., Moreno, J., Bhattacharyya, R. S., Gardner, C., Brooks, J. D.,
Peehl, D. M., & Feldman, D. (2009, May 1). Inhibition of prostaglandin synthesis
and actions by genistein in human prostate cancer cells and by soy isoflavones
in prostate cancer patients. Int J Cancer, 124(9), 2050-2059.
https://doi.org/10.1002/ijc.24161

Taga, T., Hibi, M., Hirata, Y., Yamasaki, K., Yasukawa, K., Matsuda, T., Hirano, T., &
Kishimoto, T. (1989, 1989/08/11/). Interleukin-6 triggers the association of its
receptor with a possible signal transducer, gp130. Cell, 58(3), 573-581.
https://doi.org/https://doi.org/10.1016/0092-8674(89)90438-8

Tarulli, G. A., Stanton, P. G., & Meachem, S. J. (2012). Is the adult Sertoli cell terminally
differentiated? Biology of Reproduction, 87(1), 13, 11-11.

Thuillier, R., Manku, G., Wang, Y., & Culty, M. (2009). Changes in MAPK pathway in
neonatal and adult testis following fetal estrogen exposure and effects on rat
testicular cells. Microscopy research and technique, 72(11), 773-786.

104

Thuillier, R., Mazer, M., Manku, G., Boisvert, A., Wang, Y., & Culty, M. (2010, May).
Interdependence of platelet-derived growth factor and estrogen-signaling
pathways in inducing neonatal rat testicular gonocytes proliferation. Biol Reprod,
82(5), 825-836. https://doi.org/10.1095/biolreprod.109.081729

Tran-Guzman, A., & Culty, M. (2022). Eicosanoid Biosynthesis in Male Reproductive
Development: Effects of Perinatal Exposure to NSAIDs and Analgesic Drugs.
Frontiers in Toxicology, 4.

Tran-Guzman, A., Moradian, R., Cui, H., & Culty, M. (2022). In vitro impact of genistein
and mono (2-ethylhexyl) phthalate (MEHP) on the eicosanoid pathway in
spermatogonial stem cells. Reproductive Toxicology, 107, 150-165.

Valeri, C., Lovaisa, M. M., Racine, C., Edelsztein, N. Y., Riggio, M., Giulianelli, S.,
Venara, M., Bedecarrás, P., Ballerini, M. G., di Clemente, N., Lamb, C. A.,
Schteingart, H. F., & Rey, R. A. (2020, 2020/09/15). Molecular mechanisms
underlying AMH elevation in hyperoestrogenic states in males. Scientific Reports,
10(1), 15062. https://doi.org/10.1038/s41598-020-71675-7

van den Driesche, S., Macdonald, J., Anderson, R. A., Johnston, Z. C., Chetty, T., Smith,
L. B., McKinnell, C., Dean, A., Homer, N. Z., & Jorgensen, A. (2015). Prolonged
exposure to acetaminophen reduces testosterone production by the human fetal
testis in a xenograft model. Science translational medicine, 7(288), 288ra280-
288ra280.

Van Dissel-Emiliani, F. M., De Boer-Brouwer, M., & De Rooij, D. G. (1996). Effect of
fibroblast growth factor-2 on Sertoli cells and gonocytes in coculture during the
perinatal period. Endocrinology, 137(2), 647-654.
https://doi.org/10.1210/endo.137.2.8593814

van Haaster, L. H., de Jong, F. H., Docter, R., & de Rooij, D. G. (1993). High neonatal
triiodothyronine levels reduce the period of Sertoli cell proliferation and
accelerate tubular lumen formation in the rat testis, and increase serum inhibin
levels. Endocrinology, 133(2), 755-760. https://doi.org/10.1210/en.133.2.755

Van Pelt, A. M. M., & De Rooij, D. G. (1991). Retinoic Acid Is Able to Reinitiate
Spermatogenesis in Vitamin A-Deficient Rats and High Replicate Doses Support
the Full Development of Spermatogenic Cells. Endocrinology, 128(2), 697-704.
https://doi.org/10.1210/endo-128-2-697

Vandenberg, L. N., Colborn, T., Hayes, T. B., Heindel, J. J., Jacobs Jr, D. R., Lee, D.-H.,
Shioda, T., Soto, A. M., vom Saal, F. S., & Welshons, W. V. (2012). Hormones
and endocrine-disrupting chemicals: low-dose effects and nonmonotonic dose
responses. Endocrine reviews, 33(3), 378-455.

105

Vergouwen, R. P. F. A., Jacobs, S. G. P. M., Huiskamp, R., Davids, J. A. G., & de Rooij,
D. G. (1991, 01 Jan. 1991). Proliferative activity of gonocytes, Sertoli cells and
interstitial cells during testicular development in mice. Reproduction, 93(1), 233-
243. https://doi.org/10.1530/jrf.0.0930233

Villalpando, I., Lira, E., Medina, G., Garcia-Garcia, E., & Echeverria, O. (2008). Insulin-
like growth factor 1 is expressed in mouse developing testis and regulates
somatic cell proliferation. Experimental biology and medicine, 233(4), 419-426.

Walker, C., Garza, S., Papadopoulos, V., & Culty, M. (2021). Impact of endocrine-
disrupting chemicals on steroidogenesis and consequences on testicular
function. Molecular and Cellular Endocrinology, 527, 111215.

Walker, C., Ghazisaeidi, S., Collet, B., Boisvert, A., & Culty, M. (2020). In utero exposure
to low doses of genistein and di-(2-ethylhexyl) phthalate (DEHP) alters innate
immune cells in neonatal and adult rat testes. Andrology, 8(4), 943-964.

Wang, H., Wang, H., Xiong, W., Chen, Y., Ma, Q., Ma, J., Ge, Y., & Han, D. (2006, 01
Sep. 2006). Evaluation on the phagocytosis of apoptotic spermatogenic cells by
Sertoli cells in vitro through detecting lipid droplet formation by Oil Red O
staining. Reproduction, 132(3), 485-492. https://doi.org/10.1530/rep.1.01213

Wang, L., Dou, T., Li, S., & Liu, Y. (2019, Apr). Transcriptome profiling and pathway
analysis of the effects of mono-(2-ethylhexyl) phthalate in mouse Sertoli cells.
Exp Ther Med, 17(4), 2821-2829. https://doi.org/10.3892/etm.2019.7239

Wang, X. N., Li, Z. S., Ren, Y., Jiang, T., Wang, Y. Q., Chen, M., Zhang, J., Hao, J. X.,
Wang, Y. B., Sha, R. N., Huang, Y., Liu, X., Hu, J. C., Sun, G. Q., Li, H. G., Xiong,
C. L., Xie, J., Jiang, Z. M., Cai, Z. M., Wang, J., Wang, J., Huff, V., Gui, Y. T., &
Gao, F. (2013). The Wilms tumor gene, Wt1, is critical for mouse
spermatogenesis via regulation of sertoli cell polarity and is associated with non-
obstructive azoospermia in humans. PLoS Genet, 9(8), e1003645.
https://doi.org/10.1371/journal.pgen.1003645

Wang, Y .-M., Sullivan, P. M., Petrusz, P., Yarbrough, W., & Joseph, D. R. (1989,
1989/05/01/). The androgen-binding protein gene is expressed in CD1 mouse
testis. Molecular and Cellular Endocrinology, 63(1), 85-92.
https://doi.org/https://doi.org/10.1016/0303-7207(89)90084-1

Wang, Y .-Q., Cheng, J.-M., Wen, Q., Tang, J.-X., Li, J., Chen, S.-R., & Liu, Y.-X. (2020).
An exploration of the role of Sertoli cells on fetal testis development using cell
ablation strategy. Molecular reproduction and development, 87(2), 223-230.
https://doi.org/10.1002/mrd.23309

106

Washburn, R. L., Hibler, T., Thompson, L. A., Kaur, G., & Dufour, J. M. (2022).
Therapeutic application of Sertoli cells for treatment of various diseases.
Seminars in Cell & Developmental Biology,

Wilhelm, D., Hiramatsu, R., Mizusaki, H., Widjaja, L., Combes, A. N., Kanai, Y., &
Koopman, P. (2007). SOX9 regulates prostaglandin D synthase gene
transcription in vivo to ensure testis development. Journal of Biological
Chemistry, 282(14), 10553-10560.

Wilhelm, D., Martinson, F., Bradford, S., Wilson, M. J., Combes, A. N., Beverdam, A.,
Bowles, J., Mizusaki, H., & Koopman, P. (2005). Sertoli cell differentiation is
induced both cell-autonomously and through prostaglandin signaling during
mammalian sex determination. Developmental biology, 287(1), 111-124.

Wilhelm, D., Palmer, S., & Koopman, P. (2007). Sex determination and gonadal
development in mammals. Physiological reviews.

Willems, A., Batlouni, S. R., Esnal, A., Swinnen, J. V., Saunders, P. T. K., Sharpe, R. M.,
França, L. R., De Gendt, K., & Verhoeven, G. (2010). Selective ablation of the
androgen receptor in mouse sertoli cells affects sertoli cell maturation, barrier
formation and cytoskeletal development. PloS one, 5(11), e14168-e14168.
https://doi.org/10.1371/journal.pone.0014168

Yamakawa, K., & Arita, J. (2004). Cross-talk between the estrogen receptor-, protein
kinase A-, and mitogen-activated protein kinase-mediated signaling pathways in
the regulation of lactotroph proliferation in primary culture. The Journal of Steroid
Biochemistry and Molecular Biology, 88(2), 123-130.

Yang, Q.-E., & Oatley, J. M. (2015). Early postnatal interactions between Sertoli and
germ cells. In M. D. Griswold (Ed.), Sertoli Cell Biology (Second Edition) (pp. 81-
98). Academic Press. https://doi.org/https://doi.org/10.1016/B978-0-12-417047-
6.00003-X

Yang, Q.-E., Racicot, K. E., Kaucher, A. V., Oatley, M. J., & Oatley, J. M. (2013).
MicroRNAs 221 and 222 regulate the undifferentiated state in mammalian male
germ cells. Development, 140(2), 280-290. https://doi.org/10.1242/dev.087403

Yao, H. H.-C., & Capel, B. (2002, 2002/06/15/). Disruption of Testis Cords by
Cyclopamine or Forskolin Reveals Independent Cellular Pathways in Testis
Organogenesis. Developmental Biology, 246(2), 356-365.
https://doi.org/https://doi.org/10.1006/dbio.2002.0663

Yao, H. H.-C., Ungewitter, E., Franco, H., & Capel, B. (2015). Establishment of fetal
Sertoli cells and their role in testis morphogenesis. In M. D. Griswold (Ed.),
Sertoli Cell Biology (Second Edition) (pp. 57-79). Academic Press.
https://doi.org/https://doi.org/10.1016/B978-0-12-417047-6.00002-8

107

Yawer, A., Sychrová, E., Raška, J., Babica, P., & Sovadinová, I. (2022). Endocrine-
disrupting chemicals affect Sertoli TM4 cell functionality through dysregulation of
gap junctional intercellular communication in vitro. Food and Chemical
Toxicology, 164, 113004.

Yokonishi, T., McKey, J., Ide, S., & Capel, B. (2020). Sertoli cell ablation and
replacement of the spermatogonial niche in mouse. Nature communications,
11(1), 1-11.

Zafeiri, A., Mitchell, R. T., Hay, D. C., & Fowler, P. A. (2021). Over-the-counter
analgesics during pregnancy: a comprehensive review of global prevalence and
offspring safety. Human reproduction update, 27(1), 67-95.

Zhang, F. L., Feng, Y. Q., Wang, J. Y., Zhu, K. X., Wang, L., Yan, J. M., Li, X. X., Wang,
J. J., Ge, W., De Felici, M., & Shen, W. (2023, Feb 17). Single cell epigenomic
and transcriptomic analysis uncovers potential transcription factors regulating
mitotic/meiotic switch. Cell Death Dis, 14(2), 134. https://doi.org/10.1038/s41419-
023-05671-w

Zhang, L., Gao, M., Zhang, T., Chong, T., Wang, Z., Zhai, X., Wu, Z., & Li, H. (2017,
2017 Annual
//). Protective Effects of Genistein against Mono-(2-ethylhexyl) Phthalate-Induced
Oxidative Damage in Prepubertal Sertoli Cells [Report]. BioMed Research
International, 2017. https://link-gale-
com.libproxy2.usc.edu/apps/doc/A557301436/AONE?u=usocal_main&sid=AON
E&xid=7bfcb980

Zirkin, B. R., & Papadopoulos, V. (2018). Leydig cells: formation, function, and
regulation. Biology of reproduction, 99(1), 101-111.

108

APPENDICES

Appendix 1: Supplemental Table 1. Complete list of 592 differentially expressed
genes altered by AG50 mixture in TM4 cells.

Gene name P-value FDR step up Fold change
Fosl1 1.19E-27 1.08E-24 -2.24E+01
Ereg 2.19E-31 2.60E-28 -1.78E+01
Mx1 3.19E-08 4.44E-06 -1.57E+01
Il1rl1 1.39E-53 5.36E-50 -1.56E+01
Tgtp2 8.87E-17 3.76E-14 -1.44E+01
Gbp3 3.49E-49 1.05E-45 -1.37E+01
Ccl20 7.76E-05 3.90E-03 -1.29E+01
Dusp5 1.04E-07 1.26E-05 -1.25E+01
Hbegf 3.01E-34 4.08E-31 -1.21E+01
Ifit3 6.59E-75 5.95E-71 -1.13E+01
Egr3 2.94E-05 1.76E-03 -1.09E+01
Iigp1 3.19E-33 4.12E-30 -1.01E+01
Tgtp1 7.22E-12 1.90E-09 -9.94E+00
Lif 3.07E-26 2.52E-23 -9.41E+00
Cmpk2 9.96E-14 3.03E-11 -9.27E+00
Cxcl11 9.84E-04 3.15E-02 -9.05E+00
Cdkn1a 5.98E-06 4.40E-04 -9.00E+00
Il33 6.38E-04 2.24E-02 -8.86E+00
Hmga2 7.96E-71 5.39E-67 -8.68E+00
Ifit3b 1.61E-30 1.74E-27 -8.67E+00
Errfi1 7.21E-47 1.96E-43 -8.40E+00
Gm4951 2.11E-11 5.14E-09 -8.39E+00
Prkg2 9.85E-53 3.34E-49 -8.13E+00
Usp18 3.16E-42 6.12E-39 -8.07E+00
Phf11d 1.79E-06 1.57E-04 -7.93E+00
Epha2 3.22E-26 2.57E-23 -7.86E+00
Igtp 3.02E-19 1.61E-16 -7.82E+00
Phlda1 3.47E-15 1.25E-12 -7.82E+00
Ifi211 3.77E-39 6.01E-36 -7.77E+00
Plau 6.19E-09 1.01E-06 -7.58E+00
Ifit1 2.89E-80 7.83E-76 -7.49E+00
Plaur 9.17E-07 8.78E-05 -7.16E+00
Unc13c 3.87E-04 1.49E-02 -7.05E+00

109

Gene name P-value FDR step up Fold change
Oasl1 3.83E-05 2.20E-03 -6.98E+00
Trim30d 2.33E-10 4.81E-08 -6.94E+00
Rsad2 2.20E-31 2.60E-28 -6.90E+00
Spp1 1.13E-65 5.12E-62 -6.63E+00
H1f1 6.31E-66 3.42E-62 -6.51E+00
Oas3 1.18E-11 3.01E-09 -6.45E+00
Ifi204 4.86E-44 1.10E-40 -6.27E+00
Mx2 1.37E-07 1.59E-05 -6.24E+00
Sox9 1.46E-04 6.65E-03 -6.02E+00
Gm3362 5.06E-04 1.85E-02 -5.91E+00
Trim30a 8.43E-26 6.53E-23 -5.86E+00
Gm18852 5.18E-05 2.80E-03 -5.84E+00
Rbm47 7.39E-04 2.50E-02 -5.76E+00
Egr1 3.56E-29 3.57E-26 -5.66E+00
Ifi44 5.71E-45 1.41E-41 -5.45E+00
Dusp6 3.48E-16 1.45E-13 -5.45E+00
Cxcl10 1.44E-11 3.65E-09 -5.40E+00
Ifi202b 1.65E-41 2.98E-38 -5.39E+00
Zbp1 2.26E-09 4.02E-07 -5.37E+00
Ier5l 1.87E-04 8.21E-03 -5.35E+00
Gm8995 1.11E-28 1.07E-25 -5.24E+00
Ndst3 5.04E-05 2.74E-03 -5.24E+00
Grk1 1.33E-03 4.01E-02 -5.17E+00
Maff 1.10E-07 1.32E-05 -4.98E+00
Tnnt2 1.17E-05 7.89E-04 -4.97E+00
Gm4070 6.36E-76 8.62E-72 -4.97E+00
Sms-ps 2.97E-07 3.12E-05 -4.97E+00
Serpine1 3.34E-11 7.87E-09 -4.96E+00
Gm50388 7.68E-04 2.59E-02 -4.92E+00
Duxf3 9.03E-04 2.94E-02 -4.81E+00
Il18rap 3.60E-04 1.40E-02 -4.75E+00
Chka 7.50E-15 2.51E-12 -4.64E+00
Npr3 2.20E-06 1.86E-04 -4.61E+00
Timm8a1 2.29E-21 1.38E-18 -4.58E+00
Apobec1 1.88E-05 1.21E-03 -4.57E+00
Irgm2 3.54E-13 1.02E-10 -4.53E+00
Ackr3 8.74E-04 2.87E-02 -4.51E+00

110

Gene name P-value FDR step up Fold change
Oas2 3.76E-07 3.87E-05 -4.49E+00
Tm4sf1 6.01E-15 2.06E-12 -4.48E+00
Gm9797 2.29E-07 2.50E-05 -4.47E+00
Irgm1 3.68E-23 2.50E-20 -4.44E+00
Hmga1 5.91E-08 7.56E-06 -4.37E+00
Traf1 9.01E-05 4.42E-03 -4.29E+00
Gpr141 1.14E-03 3.56E-02 -4.28E+00
Ptgs2 1.88E-10 3.95E-08 -4.27E+00
Tnfrsf12a 2.83E-15 1.05E-12 -4.24E+00
H2-T24 1.74E-04 7.75E-03 -4.24E+00
Rtp4 3.51E-07 3.64E-05 -4.24E+00
Cth 7.84E-21 4.34E-18 -4.23E+00
Klf5 1.14E-13 3.44E-11 -4.23E+00
Mtmr10 2.63E-10 5.27E-08 -4.22E+00
Ly6a 1.18E-11 3.01E-09 -4.21E+00
Ccn2 6.63E-08 8.36E-06 -4.19E+00
AC167036.1 2.64E-05 1.62E-03 -4.14E+00
9930111J21Rik2 4.02E-06 3.07E-04 -4.14E+00
Cul1 3.43E-13 1.00E-10 -4.13E+00
Fhl2 1.77E-05 1.14E-03 -4.09E+00
Ccnd1 3.77E-17 1.76E-14 -4.09E+00
Inhba 3.25E-09 5.58E-07 -4.07E+00
Dusp4 1.11E-05 7.60E-04 -4.02E+00
H1f2 1.69E-39 2.86E-36 -3.97E+00
Gbp4 8.30E-05 4.14E-03 -3.89E+00
Oaf 3.15E-04 1.26E-02 -3.88E+00
Oasl2 2.10E-15 8.01E-13 -3.87E+00
Wdr43 2.47E-34 3.52E-31 -3.87E+00
Pnpt1 5.75E-17 2.55E-14 -3.87E+00
Parp12 4.38E-15 1.54E-12 -3.86E+00
Parp11 8.08E-10 1.54E-07 -3.84E+00
H3c7 9.41E-12 2.45E-09 -3.84E+00
Nmi 2.94E-07 3.11E-05 -3.84E+00
Hmga1b 1.61E-18 8.26E-16 -3.82E+00
Ankrd1 2.14E-24 1.53E-21 -3.82E+00
Nab2 4.42E-09 7.40E-07 -3.82E+00
Xaf1 1.27E-07 1.49E-05 -3.82E+00

111

Gene name P-value FDR step up Fold change
Crybg1 2.06E-04 8.85E-03 -3.80E+00
Isg15 5.35E-05 2.88E-03 -3.78E+00
Etv5 8.79E-04 2.88E-02 -3.77E+00
Gbp10 7.69E-04 2.59E-02 -3.75E+00
Ifi203 1.70E-15 6.59E-13 -3.73E+00
9930111J21Rik1 3.01E-10 5.92E-08 -3.70E+00
Mphosph10 1.18E-21 7.30E-19 -3.66E+00
Gbp7 5.60E-05 2.99E-03 -3.66E+00
Ier2 2.17E-09 3.92E-07 -3.64E+00
Gbp2b 1.93E-07 2.15E-05 -3.62E+00
H1f3 1.33E-25 9.99E-23 -3.60E+00
Ddx60 1.04E-10 2.23E-08 -3.59E+00
Tusc3 2.22E-06 1.87E-04 -3.57E+00
Samd9l 8.54E-24 5.93E-21 -3.56E+00
H3c2 6.96E-19 3.63E-16 -3.56E+00
Mir100hg 1.01E-06 9.60E-05 -3.55E+00
Ifit1bl2 1.21E-03 3.75E-02 -3.53E+00
Ccl2 2.57E-29 2.67E-26 -3.53E+00
Rpl22l1 7.00E-04 2.40E-02 -3.53E+00
H1f4 8.05E-28 7.52E-25 -3.51E+00
Gbp6 3.86E-09 6.49E-07 -3.49E+00
Ptprk 1.02E-08 1.57E-06 -3.47E+00
Mitd1 1.42E-04 6.53E-03 -3.46E+00
Calcrl 4.04E-04 1.54E-02 -3.44E+00
Gm5446 5.56E-04 2.00E-02 -3.42E+00
Rbpj 6.02E-14 1.88E-11 -3.40E+00
Pnp 1.36E-08 2.05E-06 -3.39E+00
Flrt2 5.81E-04 2.08E-02 -3.39E+00
Ier3 6.13E-04 2.17E-02 -3.38E+00
Gbp9 3.69E-07 3.81E-05 -3.34E+00
Slfn8 4.02E-05 2.31E-03 -3.33E+00
Itprip 9.16E-08 1.11E-05 -3.33E+00
Rras2 3.18E-17 1.51E-14 -3.32E+00
Smim3 3.34E-04 1.32E-02 -3.32E+00
Rbpj-ps3 4.65E-15 1.62E-12 -3.31E+00
Itga6 1.22E-06 1.14E-04 -3.30E+00
Herc6 2.56E-09 4.44E-07 -3.30E+00

112

Gene name P-value FDR step up Fold change
Etv4 1.38E-03 4.11E-02 -3.29E+00
Dcp2 1.94E-09 3.52E-07 -3.27E+00
Gbp2 4.76E-11 1.08E-08 -3.25E+00
Ddx10 4.09E-11 9.40E-09 -3.22E+00
Coq7 1.10E-03 3.47E-02 -3.21E+00
H3c1 8.54E-08 1.05E-05 -3.20E+00
Esf1 5.84E-21 3.30E-18 -3.20E+00
Capn1 8.32E-04 2.76E-02 -3.18E+00
Ccl7 5.26E-17 2.37E-14 -3.18E+00
Isg20 1.34E-04 6.20E-03 -3.16E+00
2610021A01Rik 7.35E-05 3.74E-03 -3.13E+00
H2ac12 7.38E-05 3.75E-03 -3.12E+00
Parp9 4.16E-11 9.47E-09 -3.11E+00
Mex3c 5.41E-16 2.22E-13 -3.10E+00
Iffo2 2.29E-04 9.60E-03 -3.09E+00
Snrpf 9.57E-06 6.74E-04 -3.08E+00
H2-T23 9.88E-04 3.16E-02 -3.05E+00
Gm5611 1.56E-04 7.05E-03 -3.05E+00
Ifi35 7.94E-05 3.99E-03 -3.05E+00
Apol9b 2.74E-13 8.06E-11 -3.04E+00
Ipo4 8.89E-05 4.37E-03 -3.03E+00
Gm20559 2.05E-04 8.83E-03 -3.02E+00
Grem1 5.02E-08 6.45E-06 -3.01E+00
Cnbp 5.41E-35 8.15E-32 -3.00E+00
Tlr3 1.26E-03 3.86E-02 -3.00E+00
H4c12 3.21E-08 4.44E-06 -2.99E+00
Parp14 2.26E-07 2.50E-05 -2.99E+00
Sfi1 7.40E-05 3.75E-03 -2.98E+00
H4f16 6.42E-15 2.18E-12 -2.98E+00
H4c3 3.41E-05 1.99E-03 -2.97E+00
Tor3a 7.87E-13 2.24E-10 -2.97E+00
Phb2 5.98E-07 6.00E-05 -2.95E+00
Heatr1 4.02E-07 4.11E-05 -2.95E+00
Stat1 4.16E-08 5.50E-06 -2.94E+00
Hist1h2ap 5.41E-11 1.20E-08 -2.93E+00
Oas1g 9.26E-04 3.00E-02 -2.92E+00
H3c8 2.08E-04 8.90E-03 -2.90E+00

113

Gene name P-value FDR step up Fold change
Nop58 5.13E-21 2.96E-18 -2.90E+00
Eif1a 8.79E-11 1.91E-08 -2.88E+00
H2ac4 2.30E-04 9.64E-03 -2.87E+00
Trmt10c 8.35E-07 8.08E-05 -2.87E+00
Oas1a 7.22E-04 2.46E-02 -2.86E+00
Ltv1 1.04E-05 7.21E-04 -2.86E+00
Thumpd1 4.50E-08 5.86E-06 -2.86E+00
Ipo7 1.50E-20 8.11E-18 -2.86E+00
Ddx18 3.89E-06 2.98E-04 -2.85E+00
Plscr2 2.06E-06 1.77E-04 -2.85E+00
Diaph3 9.62E-06 6.76E-04 -2.84E+00
Ascc3 1.90E-13 5.67E-11 -2.80E+00
Wdr75 1.17E-09 2.17E-07 -2.79E+00
Nop56 3.19E-21 1.88E-18 -2.78E+00
Trnt1 1.41E-08 2.09E-06 -2.78E+00
H4c1 3.28E-05 1.93E-03 -2.77E+00
H2ac10 1.94E-04 8.44E-03 -2.77E+00
Zfp51 1.07E-03 3.38E-02 -2.77E+00
Hspe1 1.30E-08 1.98E-06 -2.77E+00
Rps7 2.47E-04 1.03E-02 -2.76E+00
Rsl1d1 1.36E-15 5.34E-13 -2.75E+00
E2f4 1.05E-05 7.27E-04 -2.75E+00
H3f3b 5.19E-25 3.80E-22 -2.74E+00
Thoc1 6.87E-06 4.99E-04 -2.74E+00
Slc4a4 1.67E-03 4.84E-02 -2.74E+00
Mrps31 4.86E-05 2.66E-03 -2.73E+00
Carnmt1 1.17E-04 5.51E-03 -2.73E+00
Gm15484 4.85E-05 2.66E-03 -2.73E+00
Fhdc1 3.55E-05 2.06E-03 -2.72E+00
Sp110 1.70E-03 4.93E-02 -2.72E+00
Slit2 2.38E-06 1.96E-04 -2.71E+00
Twistnb 1.14E-07 1.36E-05 -2.71E+00
Npm3 1.24E-04 5.77E-03 -2.71E+00
Rasa1 1.10E-08 1.68E-06 -2.71E+00
Ttn 1.25E-03 3.82E-02 -2.71E+00
Sp100 5.75E-04 2.06E-02 -2.71E+00
Eif4a-ps4 2.57E-26 2.18E-23 -2.71E+00

114

Gene name P-value FDR step up Fold change
Tmcc3 7.51E-04 2.54E-02 -2.70E+00
AC147806.2 1.83E-04 8.05E-03 -2.70E+00
Plin2 1.44E-09 2.66E-07 -2.69E+00
Rab39b 1.53E-04 6.94E-03 -2.69E+00
Arid5a 3.73E-05 2.15E-03 -2.69E+00
Tsr1 5.98E-10 1.15E-07 -2.69E+00
Npm1 8.47E-22 5.47E-19 -2.68E+00
Naa20 8.45E-06 6.04E-04 -2.68E+00
Arap2 3.32E-09 5.67E-07 -2.66E+00
Chchd4 1.15E-03 3.59E-02 -2.66E+00
Ube2l6 2.50E-04 1.03E-02 -2.66E+00
Frmd4a 9.84E-05 4.75E-03 -2.66E+00
H4c4 6.47E-12 1.72E-09 -2.65E+00
Acot9 7.93E-09 1.27E-06 -2.63E+00
Nampt 7.27E-09 1.17E-06 -2.63E+00
Gm10269 8.38E-05 4.15E-03 -2.63E+00
Ifit2 3.01E-10 5.92E-08 -2.63E+00
Bcar3 2.35E-06 1.95E-04 -2.62E+00
Gm43302 6.45E-04 2.25E-02 -2.61E+00
H3c10 1.29E-03 3.92E-02 -2.60E+00
Uchl3 4.92E-04 1.82E-02 -2.60E+00
Pcdh19 2.98E-05 1.78E-03 -2.59E+00
Dkc1 1.37E-08 2.05E-06 -2.58E+00
Crls1 1.24E-07 1.47E-05 -2.58E+00
Hist1h4n 1.46E-07 1.67E-05 -2.57E+00
Rrp8 1.30E-03 3.94E-02 -2.56E+00
Rpl10a 5.21E-06 3.91E-04 -2.56E+00
Nsun2 2.15E-08 3.12E-06 -2.56E+00
Nip7 2.42E-06 1.97E-04 -2.56E+00
Gm6477 2.35E-14 7.49E-12 -2.55E+00
Agfg1 1.82E-06 1.58E-04 -2.55E+00
Dnajc2 3.22E-11 7.66E-09 -2.55E+00
Rars 7.50E-16 3.03E-13 -2.54E+00
Apol9a 2.05E-11 5.04E-09 -2.54E+00
Gm16433 3.32E-04 1.32E-02 -2.54E+00
Gm27219 3.38E-04 1.33E-02 -2.53E+00
Ppid 2.59E-08 3.69E-06 -2.52E+00

115

Gene name P-value FDR step up Fold change
Txnip 4.01E-11 9.30E-09 -2.52E+00
Tma16 3.09E-08 4.34E-06 -2.52E+00
H3c15 3.56E-11 8.33E-09 -2.51E+00
Nudcd1 5.77E-06 4.26E-04 -2.50E+00
Anxa3 5.59E-14 1.76E-11 -2.50E+00
H2ac6 1.64E-05 1.06E-03 -2.50E+00
Tmem70 7.43E-04 2.52E-02 -2.49E+00
Ppa1 1.21E-04 5.66E-03 -2.49E+00
Farsb 1.31E-05 8.68E-04 -2.48E+00
H3c4 1.13E-07 1.35E-05 -2.48E+00
Itga3 1.78E-04 7.85E-03 -2.47E+00
H3c3 2.56E-04 1.05E-02 -2.47E+00
Hist1h2an 1.73E-03 4.98E-02 -2.45E+00
Tnfaip3 4.04E-04 1.54E-02 -2.45E+00
Dnttip2 1.96E-14 6.32E-12 -2.45E+00
H2ac13 1.57E-06 1.41E-04 -2.45E+00
Gm25432 9.36E-06 6.61E-04 -2.45E+00
Wdr12 2.39E-06 1.97E-04 -2.45E+00
Nes 3.69E-15 1.31E-12 -2.45E+00
Ttc39c 4.11E-05 2.33E-03 -2.45E+00
Ddx58 1.31E-06 1.21E-04 -2.45E+00
Slc25a33 7.02E-04 2.40E-02 -2.45E+00
Srsf10 5.44E-06 4.05E-04 -2.44E+00
Rwdd1 7.07E-05 3.62E-03 -2.43E+00
Zfp948 3.57E-06 2.77E-04 -2.43E+00
Irf9 1.52E-05 9.93E-04 -2.42E+00
Nme1 2.51E-08 3.61E-06 -2.42E+00
Pus10 3.88E-04 1.49E-02 -2.41E+00
Ivns1abp 9.29E-10 1.76E-07 -2.40E+00
Utp18 3.67E-06 2.84E-04 -2.40E+00
Smu1 1.91E-06 1.65E-04 -2.40E+00
H1f5 3.37E-08 4.64E-06 -2.40E+00
Gm12669 7.08E-08 8.89E-06 -2.39E+00
Helz2 3.61E-09 6.12E-07 -2.38E+00
H2ac7 1.07E-03 3.39E-02 -2.38E+00
Eif3i 3.38E-06 2.64E-04 -2.37E+00
Psmd6 4.43E-08 5.83E-06 -2.36E+00

116

Gene name P-value FDR step up Fold change
Zfp131 3.33E-06 2.61E-04 -2.36E+00
Riok1 4.79E-05 2.64E-03 -2.35E+00
Slc7a11 2.88E-07 3.07E-05 -2.35E+00
Vcam1 2.60E-05 1.60E-03 -2.34E+00
Lrrfip1 1.36E-08 2.05E-06 -2.33E+00
Srp72 1.01E-08 1.57E-06 -2.33E+00
Serbp1 1.24E-22 8.19E-20 -2.33E+00
Gm9118 3.88E-17 1.78E-14 -2.33E+00
Nifk 1.39E-04 6.42E-03 -2.32E+00
Ptpn12 1.93E-05 1.24E-03 -2.32E+00
Noc3l 2.59E-06 2.08E-04 -2.32E+00
Uba3 1.28E-07 1.50E-05 -2.31E+00
Tcea1 2.54E-06 2.05E-04 -2.31E+00
Wdr36 2.41E-06 1.97E-04 -2.31E+00
Adss 6.54E-05 3.39E-03 -2.30E+00
Nabp1 6.45E-04 2.25E-02 -2.30E+00
Gsto1 8.19E-05 4.09E-03 -2.30E+00
Ndrg1 1.04E-05 7.21E-04 -2.29E+00
Cycs 2.51E-04 1.04E-02 -2.29E+00
H2ac8 3.89E-04 1.49E-02 -2.28E+00
H1f0 6.18E-17 2.66E-14 -2.28E+00
Dars 2.65E-07 2.88E-05 -2.27E+00
Ddx3x 1.93E-17 9.34E-15 -2.27E+00
5430416N02Rik 7.91E-04 2.64E-02 -2.26E+00
Zfp622 5.27E-05 2.84E-03 -2.26E+00
Zfpm2 2.42E-06 1.97E-04 -2.26E+00
Rbm39 6.08E-17 2.66E-14 -2.26E+00
Runx1 9.16E-04 2.98E-02 -2.26E+00
Trim8 8.62E-06 6.15E-04 -2.25E+00
Vegfa 8.90E-09 1.39E-06 -2.25E+00
D10Wsu102e 1.22E-05 8.13E-04 -2.24E+00
Gm7666 2.27E-04 9.54E-03 -2.24E+00
Krr1 6.54E-05 3.39E-03 -2.23E+00
Psph 2.03E-07 2.25E-05 -2.23E+00
Zfp930 1.01E-03 3.22E-02 -2.23E+00
Myc 1.71E-07 1.93E-05 -2.23E+00
Tlk2 4.09E-08 5.49E-06 -2.22E+00

117

Gene name P-value FDR step up Fold change
Dcun1d5 2.90E-06 2.32E-04 -2.21E+00
Mrpl20 1.65E-03 4.80E-02 -2.21E+00
H2ax 1.04E-06 9.87E-05 -2.20E+00
Insig2 7.78E-04 2.61E-02 -2.20E+00
H3c6 4.27E-04 1.61E-02 -2.20E+00
Aen 8.26E-04 2.74E-02 -2.20E+00
Mthfd1l 3.20E-05 1.89E-03 -2.20E+00
Nmd3 1.16E-05 7.85E-04 -2.20E+00
Cep83 5.16E-05 2.80E-03 -2.19E+00
Sdad1 4.97E-04 1.83E-02 -2.19E+00
Ebna1bp2 5.91E-05 3.13E-03 -2.19E+00
Pa2g4 1.43E-10 3.06E-08 -2.19E+00
Cct8 2.52E-10 5.18E-08 -2.19E+00
Tomm70a 2.86E-10 5.70E-08 -2.18E+00
Chordc1 3.28E-04 1.30E-02 -2.18E+00
H4c2 3.00E-06 2.40E-04 -2.18E+00
Gtpbp4 6.23E-08 7.93E-06 -2.18E+00
Stc2 1.23E-06 1.15E-04 -2.18E+00
Memo1 1.89E-04 8.27E-03 -2.17E+00
Pvr 1.51E-03 4.45E-02 -2.17E+00
Fam136a 8.50E-04 2.80E-02 -2.17E+00
Nmt2 5.33E-06 3.98E-04 -2.16E+00
H4c14 4.94E-04 1.83E-02 -2.16E+00
Slc30a4 7.35E-14 2.27E-11 -2.15E+00
Etf1 1.86E-11 4.67E-09 -2.15E+00
H2ac15 7.49E-06 5.40E-04 -2.15E+00
Ptgs1 6.91E-04 2.38E-02 -2.14E+00
Gnpnat1 1.63E-04 7.36E-03 -2.14E+00
Txnl1 3.19E-05 1.89E-03 -2.13E+00
Dync1li1 1.29E-04 5.98E-03 -2.13E+00
C1qbp 2.19E-05 1.38E-03 -2.13E+00
S100a10 3.54E-08 4.83E-06 -2.13E+00
Nhp2 2.06E-05 1.31E-03 -2.13E+00
Gtf2f2 1.15E-03 3.58E-02 -2.12E+00
Eif3e 1.07E-09 2.01E-07 -2.12E+00
Eif3s6-ps2 9.64E-05 4.67E-03 -2.12E+00
Nudt4 5.36E-09 8.81E-07 -2.11E+00

118

Gene name P-value FDR step up Fold change
Gm21596 1.38E-06 1.26E-04 -2.11E+00
Abce1 7.97E-16 3.18E-13 -2.11E+00
Tagln2 9.91E-06 6.94E-04 -2.11E+00
Eif4a1 7.88E-07 7.69E-05 -2.10E+00
Cops3 2.44E-05 1.52E-03 -2.10E+00
H2ac20 4.62E-08 6.00E-06 -2.10E+00
Trim25 2.52E-05 1.56E-03 -2.10E+00
Gm6563 3.90E-08 5.26E-06 -2.09E+00
Irf1 7.39E-04 2.50E-02 -2.09E+00
Nup205 2.33E-05 1.47E-03 -2.08E+00
Angptl2 1.65E-03 4.80E-02 -2.08E+00
Ppp1r14b 1.45E-04 6.62E-03 -2.07E+00
Gpbp1 6.75E-05 3.48E-03 -2.07E+00
Rsbn1 3.09E-04 1.24E-02 -2.07E+00
Ermp1 3.18E-05 1.89E-03 -2.06E+00
Snai2 1.43E-04 6.58E-03 -2.06E+00
Tcea1-ps1 2.05E-06 1.77E-04 -2.06E+00
Shcbp1 6.74E-04 2.33E-02 -2.06E+00
Sinhcaf 7.92E-04 2.64E-02 -2.05E+00
Exosc9 2.75E-04 1.12E-02 -2.04E+00
Eif3m 1.56E-03 4.59E-02 -2.04E+00
Cdh11 2.57E-10 5.23E-08 -2.04E+00
Adh7 4.57E-05 2.54E-03 -2.03E+00
Gm10053 4.24E-05 2.40E-03 -2.03E+00
Mak16 1.45E-05 9.53E-04 -2.03E+00
Gask1b 1.13E-05 7.71E-04 -2.02E+00
Mrpl12 2.08E-04 8.90E-03 -2.02E+00
Ppia 5.51E-10 1.07E-07 -2.02E+00
Tfrc 6.30E-05 3.30E-03 -2.02E+00
Nol8 3.01E-05 1.79E-03 -2.02E+00
Ddx21 3.75E-08 5.08E-06 -2.01E+00
Bcat1 5.22E-07 5.26E-05 -2.01E+00
Xbp1 1.72E-05 1.11E-03 -2.01E+00
Irf2bp2 1.31E-06 1.21E-04 -2.00E+00
Gm5148 8.21E-07 7.97E-05 -2.00E+00
Tsc2 9.79E-04 3.14E-02 2.01E+00
Mt1 2.34E-04 9.75E-03 2.02E+00

119

Gene name P-value FDR step up Fold change
Pxdn 6.05E-04 2.15E-02 2.02E+00
Polr2a 2.24E-06 1.87E-04 2.02E+00
Dynll2 1.72E-03 4.95E-02 2.02E+00
Brca1 1.02E-03 3.23E-02 2.02E+00
Twsg1 4.39E-04 1.64E-02 2.03E+00
Fam114a1 1.29E-03 3.92E-02 2.03E+00
Map1a 6.51E-06 4.76E-04 2.04E+00
Snord17 4.11E-04 1.56E-02 2.04E+00
Kank2 5.55E-04 2.00E-02 2.04E+00
Washc2 5.13E-06 3.87E-04 2.04E+00
Fdft1 1.17E-03 3.64E-02 2.05E+00
Copz1 8.82E-04 2.89E-02 2.05E+00
Mrip-ps 9.28E-05 4.51E-03 2.05E+00
Add1 3.79E-07 3.89E-05 2.06E+00
Uap1l1 8.40E-05 4.15E-03 2.07E+00
P4ha1 5.56E-04 2.00E-02 2.09E+00
Glg1 2.96E-08 4.19E-06 2.09E+00
Samd4b 8.01E-04 2.67E-02 2.09E+00
Nek9 9.12E-04 2.97E-02 2.10E+00
Grn 2.23E-06 1.87E-04 2.10E+00
Ncam1 2.06E-08 3.02E-06 2.11E+00
Calcoco1 2.26E-04 9.53E-03 2.11E+00
Elovl5 1.37E-04 6.30E-03 2.12E+00
Dennd5a 1.07E-04 5.09E-03 2.13E+00
Anxa6 7.55E-05 3.81E-03 2.13E+00
Psap 9.75E-10 1.84E-07 2.13E+00
Gm10282 8.46E-04 2.80E-02 2.14E+00
Mtss1 6.39E-05 3.35E-03 2.14E+00
Myl12b 3.33E-05 1.95E-03 2.14E+00
Mcoln1 1.32E-03 3.98E-02 2.14E+00
Ubc 4.86E-07 4.94E-05 2.15E+00
Ankrd40 3.25E-04 1.29E-02 2.16E+00
Aplp2 3.20E-08 4.44E-06 2.16E+00
Nfatc1 8.92E-04 2.92E-02 2.16E+00
Ctsa 1.20E-05 8.01E-04 2.16E+00
Arl5a 7.95E-08 9.84E-06 2.17E+00
Hectd4 1.79E-04 7.92E-03 2.17E+00

120

Gene name P-value FDR step up Fold change
Os9 4.67E-05 2.59E-03 2.20E+00
Flywch1 1.91E-04 8.33E-03 2.20E+00
Ubb 5.95E-12 1.60E-09 2.21E+00
Maf 3.52E-04 1.38E-02 2.21E+00
Pcdhgc3 1.64E-05 1.06E-03 2.21E+00
Foxo1 1.30E-05 8.62E-04 2.21E+00
Palld 6.28E-07 6.24E-05 2.21E+00
Ccpg1 1.39E-03 4.15E-02 2.22E+00
Cxcl12 4.50E-04 1.68E-02 2.23E+00
Neu1 1.59E-03 4.66E-02 2.23E+00
Wdr81 8.33E-04 2.76E-02 2.23E+00
Acox1 4.37E-04 1.64E-02 2.24E+00
Tmem59 1.67E-04 7.47E-03 2.24E+00
Ube3b 1.15E-05 7.77E-04 2.24E+00
Taf2 1.16E-04 5.47E-03 2.24E+00
Pip5k1c 3.33E-04 1.32E-02 2.25E+00
Arhgap42 7.81E-08 9.71E-06 2.25E+00
Cd99l2 1.28E-04 5.94E-03 2.26E+00
Zfc3h1 7.18E-06 5.19E-04 2.26E+00
Cyb5a 1.64E-04 7.38E-03 2.29E+00
Akr1c14 2.87E-07 3.07E-05 2.29E+00
Mki67 8.78E-15 2.90E-12 2.29E+00
Ptpra 9.71E-07 9.27E-05 2.30E+00
Tle5 1.14E-05 7.75E-04 2.30E+00
Fnip2 6.98E-09 1.13E-06 2.30E+00
Snhg4 1.96E-04 8.49E-03 2.31E+00
Rere 2.95E-07 3.11E-05 2.31E+00
Thbs1 9.23E-22 5.82E-19 2.32E+00
2310022B05Rik 6.48E-08 8.21E-06 2.32E+00
Bcl9l 5.39E-05 2.90E-03 2.32E+00
Fam221b 7.07E-05 3.62E-03 2.33E+00
Rhoq 3.13E-06 2.49E-04 2.33E+00
Ccdc136 9.45E-04 3.04E-02 2.34E+00
Gm25890 1.53E-04 6.94E-03 2.34E+00
Saa3 1.90E-09 3.48E-07 2.36E+00
Ubn1 5.76E-06 4.26E-04 2.37E+00
Pdcd4 2.07E-04 8.87E-03 2.38E+00

121

Gene name P-value FDR step up Fold change
Idh1 3.41E-04 1.34E-02 2.38E+00
Antxr1 8.43E-11 1.84E-08 2.39E+00
Ccnb2 6.04E-04 2.15E-02 2.39E+00
Prss23 5.92E-10 1.15E-07 2.39E+00
Pdia4 8.73E-13 2.47E-10 2.40E+00
Ftl1-ps1 2.78E-11 6.66E-09 2.42E+00
Jpt1 2.58E-04 1.06E-02 2.44E+00
Arl6ip1 2.78E-05 1.69E-03 2.46E+00
Bcl9 4.51E-05 2.52E-03 2.47E+00
Man2b1 5.04E-04 1.85E-02 2.47E+00
Dctn1 1.11E-07 1.34E-05 2.48E+00
Mdc1 3.50E-08 4.80E-06 2.50E+00
Abcc5 6.08E-04 2.16E-02 2.51E+00
Ctns 2.24E-04 9.49E-03 2.51E+00
Ckap2l 9.00E-07 8.65E-05 2.51E+00
Gja1 2.99E-15 1.10E-12 2.53E+00
Nt5dc2 7.50E-05 3.79E-03 2.53E+00
Incenp 1.31E-05 8.69E-04 2.58E+00
Hdac5 2.66E-05 1.63E-03 2.61E+00
Slc48a1 2.34E-06 1.95E-04 2.62E+00
Lamb2 2.11E-05 1.34E-03 2.62E+00
Med23 2.22E-05 1.40E-03 2.64E+00
Irs1 1.21E-07 1.43E-05 2.64E+00
Gas2l3 3.83E-04 1.48E-02 2.65E+00
Pcyox1 1.36E-07 1.58E-05 2.66E+00
Gpam 2.28E-07 2.50E-05 2.67E+00
Ttc28 3.53E-06 2.75E-04 2.67E+00
Pld3 7.29E-05 3.71E-03 2.68E+00
Clspn 1.33E-03 4.01E-02 2.70E+00
Pfkfb3 9.43E-04 3.04E-02 2.70E+00
Marf1 3.05E-05 1.82E-03 2.70E+00
C2cd3 4.62E-04 1.72E-02 2.71E+00
Gm42047 8.47E-18 4.18E-15 2.72E+00
Ubb-ps 2.82E-05 1.70E-03 2.72E+00
Mmp11 1.65E-04 7.42E-03 2.74E+00
Malat1 1.46E-26 1.28E-23 2.75E+00
Pfn2 4.36E-04 1.64E-02 2.76E+00

122

Gene name P-value FDR step up Fold change
Mtss2 2.00E-06 1.73E-04 2.76E+00
Gm17300 2.74E-04 1.11E-02 2.77E+00
Cpt1a 1.14E-05 7.76E-04 2.78E+00
Abhd4 6.12E-05 3.22E-03 2.79E+00
C3 2.19E-15 8.24E-13 2.79E+00
Ulk2 1.35E-03 4.05E-02 2.80E+00
Mboat2 2.11E-04 8.95E-03 2.83E+00
Dag1 4.49E-08 5.86E-06 2.83E+00
Kif20a 1.43E-08 2.12E-06 2.83E+00
Trp53inp2 5.52E-04 2.00E-02 2.85E+00
Hmox1 4.14E-07 4.22E-05 2.88E+00
Ccni 2.66E-09 4.60E-07 2.89E+00
Selenop 2.94E-04 1.19E-02 2.90E+00
Snord15a 2.49E-04 1.03E-02 2.91E+00
Nynrin 1.76E-04 7.78E-03 2.92E+00
Wdr6 9.28E-05 4.51E-03 3.01E+00
Ttyh3 1.21E-03 3.76E-02 3.02E+00
Nek2 1.61E-05 1.04E-03 3.06E+00
Cpne1 5.76E-05 3.06E-03 3.08E+00
Mxd4 5.45E-06 4.05E-04 3.10E+00
Abca3 9.31E-05 4.51E-03 3.10E+00
Ccng2 1.54E-04 6.97E-03 3.21E+00
Zmiz2 4.72E-05 2.60E-03 3.22E+00
Gm22988 9.32E-04 3.02E-02 3.26E+00
Ftl1 2.33E-31 2.63E-28 3.29E+00
Sord 1.80E-06 1.57E-04 3.33E+00
Cryab 2.76E-05 1.69E-03 3.37E+00
Rnf181 1.43E-06 1.29E-04 3.40E+00
Abca2 9.31E-06 6.59E-04 3.40E+00
Dhcr24 1.21E-03 3.75E-02 3.43E+00
Gm16576 6.92E-04 2.38E-02 3.44E+00
Pcyt2 1.65E-04 7.42E-03 3.44E+00
Edem2 1.74E-04 7.75E-03 3.50E+00
Greb1 4.85E-12 1.34E-09 3.54E+00
Thra 3.82E-06 2.94E-04 3.60E+00
Nbl1 3.52E-04 1.38E-02 3.63E+00
Ulk1 1.74E-06 1.55E-04 3.75E+00

123

Gene name P-value FDR step up Fold change
Mreg 3.26E-06 2.58E-04 3.76E+00
Scd2 1.59E-43 3.31E-40 3.88E+00
Dzip1 1.14E-06 1.07E-04 4.05E+00
Acacb 6.33E-04 2.23E-02 4.18E+00
B4gat1 1.30E-03 3.93E-02 4.64E+00
Acat2 1.39E-07 1.60E-05 5.23E+00
CT010467.1 3.84E-06 2.95E-04 5.25E+00
Mettl7a1 6.12E-07 6.10E-05 5.89E+00
Gm12895 4.37E-05 2.45E-03 6.13E+00
AA474408 8.28E-04 2.75E-02 8.94E+00
Lars2 1.75E-06 1.55E-04 9.76E+00
Mettl26 3.11E-07 3.25E-05 1.29E+01
Gm23201 3.56E-04 1.39E-02 1.50E+01
Mir6236 5.31E-04 1.93E-02 1.85E+01
S100g 1.71E-03 4.93E-02 1.89E+01
n-R5s193 7.29E-05 3.71E-03 2.02E+01
n-R5s115 4.38E-04 1.64E-02 2.16E+01
Gm42826 3.05E-04 1.22E-02 2.49E+01
Gm23971 4.80E-08 6.20E-06 3.55E+01
Snord34 1.09E-03 3.45E-02 4.49E+01
mt-Tv 3.62E-04 1.41E-02 4.84E+01
Gm37376 6.27E-04 2.21E-02 4.89E+01
Gm23935 8.36E-04 2.76E-02 5.33E+01
mt-Tk 9.36E-04 3.02E-02 5.85E+01
n-R5s56 6.91E-06 5.01E-04 5.93E+01
mt-Tg 4.64E-05 2.58E-03 6.48E+01
Gm26197 2.64E-04 1.08E-02 7.30E+01
mt-Tp 2.43E-04 1.01E-02 7.61E+01
n-R5s2 1.30E-04 6.03E-03 7.76E+01
Snora7a 1.06E-03 3.35E-02 7.78E+01
Gm15564 1.68E-04 7.49E-03 8.20E+01
Rnu3b2 8.04E-05 4.03E-03 9.34E+01
Rnu3b1 4.65E-05 2.58E-03 1.02E+02
Gm24245 2.86E-05 1.72E-03 1.06E+02
Gm23650 2.74E-05 1.68E-03 1.09E+02
Snord99 2.77E-05 1.69E-03 1.19E+02
Gm24601 1.14E-05 7.76E-04 2.61E+02

124

Gene name P-value FDR step up Fold change
Rnu2-10 8.76E-06 6.23E-04 2.97E+02
n-R5-8s1 1.43E-06 1.29E-04 5.20E+02
n-R5s106 1.26E-06 1.17E-04 5.49E+02
n-R5s130 1.26E-06 1.17E-04 5.49E+02

Appendix 2: Supplemental Table 2. Complete list of 168 differentially expressed
genes in PND8 rat Sertoli cells exposed to AG50 mixture.

Gene name P-value FDR step up Fold change
Ttll13 6.40E-04 1.92E-02 -1.26E+01
H2ac10 3.82E-39 5.53E-36 -8.28E+00
Pimreg 9.09E-04 2.57E-02 -6.10E+00
E2f8 9.53E-08 8.58E-06 -5.40E+00
Uhrf1 6.39E-26 4.81E-23 -5.24E+00
Cdca3 1.40E-08 1.43E-06 -5.23E+00
Pbk 2.67E-04 9.41E-03 -4.45E+00
Hist1h2bg 5.98E-07 4.45E-05 -4.40E+00
Ckap2l 5.00E-10 6.87E-08 -4.20E+00
Hist1h2bc 2.33E-04 8.33E-03 -4.17E+00
Cdca5 5.13E-06 3.03E-04 -4.14E+00
Sgo2 3.58E-05 1.66E-03 -4.08E+00
Racgap1 4.07E-09 4.64E-07 -4.06E+00
Fam83d 6.88E-07 5.10E-05 -4.04E+00
Nr0b1 2.18E-14 5.48E-12 -4.04E+00
E2f7 9.68E-06 5.29E-04 -3.88E+00
Cilp 5.08E-13 1.05E-10 -3.85E+00
Tk1 1.40E-11 2.46E-09 -3.73E+00
Cdc6 8.56E-05 3.48E-03 -3.72E+00
Mki67 1.28E-39 2.01E-36 -3.71E+00
Ube2c 1.55E-04 5.89E-03 -3.70E+00
Shcbp1 3.76E-07 2.96E-05 -3.66E+00
H3c1 8.51E-04 2.44E-02 -3.64E+00
Iqgap3 2.86E-05 1.36E-03 -3.64E+00
Cep55 9.59E-07 6.76E-05 -3.63E+00
ENSRNOG00000055111 7.15E-05 2.97E-03 -3.63E+00
Spag5 1.36E-09 1.76E-07 -3.62E+00
Esco2 7.54E-04 2.20E-02 -3.61E+00

125

Gene name P-value FDR step up Fold change
Kif4a 2.71E-09 3.29E-07 -3.60E+00
Clspn 9.36E-09 1.01E-06 -3.58E+00
Rad51 1.86E-04 6.82E-03 -3.57E+00
Cenpu 9.39E-05 3.78E-03 -3.54E+00
Mcm5 3.59E-18 1.50E-15 -3.51E+00
Ccnb1 1.77E-05 8.89E-04 -3.49E+00
Egf 1.27E-03 3.37E-02 -3.40E+00
Mcm10 1.32E-08 1.36E-06 -3.39E+00
Plk1 5.20E-09 5.73E-07 -3.38E+00
Hist1h2ac 4.11E-07 3.18E-05 -3.37E+00
Kifc1 1.56E-07 1.33E-05 -3.33E+00
Cdkn2c 6.28E-04 1.89E-02 -3.33E+00
Kif2c 2.29E-06 1.47E-04 -3.33E+00
Cenpf 1.11E-22 6.96E-20 -3.32E+00
Ect2 3.87E-07 3.02E-05 -3.32E+00
Dhrs3 3.77E-13 7.98E-11 -3.30E+00
Cdkn3 5.28E-04 1.64E-02 -3.24E+00
Cdca2 9.45E-07 6.74E-05 -3.23E+00
Tacc3 2.06E-07 1.71E-05 -3.22E+00
Ccna2 1.09E-09 1.43E-07 -3.21E+00
Nuf2 7.84E-07 5.75E-05 -3.20E+00
Birc5 6.94E-04 2.06E-02 -3.19E+00
Ncapg 1.73E-09 2.18E-07 -3.19E+00
Kif14 1.37E-04 5.27E-03 -3.18E+00
Kif20a 2.81E-07 2.24E-05 -3.16E+00
ENSRNOG00000008450 1.22E-10 1.83E-08 -3.15E+00
Aurkb 4.40E-07 3.37E-05 -3.14E+00
Top2a 1.00E-30 9.96E-28 -3.13E+00
Ttk 1.03E-04 4.10E-03 -3.13E+00
Cit 3.72E-05 1.71E-03 -3.05E+00
Kif18b 9.63E-09 1.04E-06 -3.05E+00
Kif20b 3.57E-09 4.23E-07 -3.04E+00
Cd93 1.33E-03 3.51E-02 -3.03E+00
Kif11 3.30E-09 3.94E-07 -3.02E+00
Cdk1 4.33E-05 1.96E-03 -3.00E+00
Nusap1 4.79E-05 2.13E-03 -2.99E+00
Cdc45 9.02E-05 3.64E-03 -2.99E+00

126

Gene name P-value FDR step up Fold change
Prc1 5.60E-12 1.06E-09 -2.98E+00
Ndc80 9.80E-08 8.73E-06 -2.95E+00
Diaph3 1.08E-11 1.96E-09 -2.93E+00
Cenpe 1.18E-20 6.34E-18 -2.86E+00
H1f1 4.91E-15 1.42E-12 -2.85E+00
Aspm 2.30E-16 7.74E-14 -2.85E+00
ENSRNOG00000070055 1.14E-03 3.08E-02 -2.83E+00
Kntc1 6.35E-09 6.95E-07 -2.81E+00
Tcf19 4.23E-06 2.55E-04 -2.81E+00
Melk 4.49E-05 2.01E-03 -2.80E+00
Kif23 1.20E-07 1.05E-05 -2.79E+00
Cenpa 9.18E-04 2.59E-02 -2.77E+00
RT1-CE15 8.84E-04 2.51E-02 -2.76E+00
Tpx2 6.88E-18 2.81E-15 -2.74E+00
Ticrr 1.30E-04 5.05E-03 -2.73E+00
Cenph 7.88E-04 2.29E-02 -2.68E+00
ENSRNOG00000064540 1.83E-03 4.53E-02 -2.66E+00
Hmmr 3.58E-06 2.22E-04 -2.65E+00
Espl1 1.12E-05 5.95E-04 -2.64E+00
Rrm2 1.37E-04 5.27E-03 -2.64E+00
Hist2h3c2 4.70E-16 1.47E-13 -2.63E+00
Mfap5 1.45E-03 3.77E-02 -2.60E+00
Dscc1 1.98E-03 4.81E-02 -2.60E+00
ENSRNOG00000023122 1.62E-03 4.15E-02 -2.56E+00
Mcm3 5.21E-11 8.45E-09 -2.56E+00
Plk4 1.88E-05 9.37E-04 -2.55E+00
Mybl2 1.98E-06 1.29E-04 -2.53E+00
Arhgap11a 2.13E-13 4.61E-11 -2.51E+00
Tbx18 3.26E-07 2.59E-05 -2.49E+00
ENSRNOG00000018113 5.20E-21 2.89E-18 -2.49E+00
Bub1b 4.34E-05 1.96E-03 -2.49E+00
Hjurp 4.32E-06 2.58E-04 -2.46E+00
Serpinf1 1.76E-05 8.88E-04 -2.43E+00
Wnt2b 1.52E-03 3.95E-02 -2.39E+00
Kif15 1.85E-06 1.22E-04 -2.38E+00
Trip13 1.45E-05 7.47E-04 -2.37E+00
Zfp367 5.52E-05 2.39E-03 -2.35E+00

127

Gene name P-value FDR step up Fold change
Hist1h2ak 1.94E-03 4.74E-02 -2.35E+00
Bub1 2.02E-09 2.51E-07 -2.33E+00
Sgo1 1.83E-03 4.53E-02 -2.31E+00
Mastl 1.38E-03 3.63E-02 -2.30E+00
ENSRNOG00000068602 1.75E-13 3.82E-11 -2.27E+00
Cdca8 6.41E-04 1.92E-02 -2.26E+00
Cyp26b1 9.55E-07 6.76E-05 -2.26E+00
Dlgap5 8.02E-05 3.28E-03 -2.25E+00
Cip2a 3.43E-05 1.60E-03 -2.25E+00
Knl1 9.84E-15 2.73E-12 -2.24E+00
Cdc20 2.52E-08 2.47E-06 -2.23E+00
Cmklr1 8.08E-05 3.29E-03 -2.23E+00
H1f5 3.71E-09 4.36E-07 -2.23E+00
Bard1 8.85E-04 2.51E-02 -2.22E+00
ENSRNOG00000070694 7.68E-08 7.02E-06 -2.22E+00
Anln 5.88E-07 4.41E-05 -2.21E+00
Prex2 1.37E-06 9.41E-05 -2.20E+00
Tll1 1.87E-04 6.84E-03 -2.18E+00
Aurka 5.94E-04 1.81E-02 -2.17E+00
Ncaph 1.65E-05 8.41E-04 -2.16E+00
ENSRNOG00000066099 2.00E-06 1.31E-04 -2.16E+00
Mms22l 6.95E-05 2.91E-03 -2.13E+00
Brip1 4.47E-04 1.43E-02 -2.13E+00
Dpep1 1.84E-05 9.21E-04 -2.12E+00
Fam180a 1.21E-03 3.25E-02 -2.12E+00
Vegfd 3.74E-09 4.38E-07 -2.12E+00
AABR07070307.1 4.01E-04 1.31E-02 -2.11E+00
Chek1 8.53E-04 2.44E-02 -2.10E+00
Myo7a 1.44E-06 9.79E-05 -2.08E+00
Abca8a 1.03E-04 4.10E-03 -2.07E+00
Chtf18 9.97E-04 2.76E-02 -2.07E+00
Sema5a 1.50E-09 1.91E-07 -2.07E+00
C1qtnf1 5.71E-05 2.46E-03 -2.07E+00
Fgd5 4.58E-05 2.04E-03 -2.06E+00
H19 2.58E-11 4.42E-09 -2.06E+00
Ptn 1.07E-09 1.41E-07 -2.05E+00
Dtl 1.06E-03 2.90E-02 -2.04E+00

128

Gene name P-value FDR step up Fold change
Col1a1 2.90E-89 9.09E-86 -2.00E+00
Ptprv 8.39E-17 3.04E-14 2.00E+00
Col7a1 4.99E-05 2.20E-03 2.01E+00
Fas 9.34E-10 1.26E-07 2.01E+00
Tp53inp1 4.58E-11 7.50E-09 2.03E+00
Mdm2 1.43E-30 1.35E-27 2.05E+00
Ftl1 9.52E-93 3.59E-89 2.05E+00
AC128848.1 3.41E-07 2.70E-05 2.06E+00
Cd55 2.77E-17 1.06E-14 2.06E+00
Slc27a3 7.96E-14 1.81E-11 2.11E+00
Csf1 1.01E-98 6.33E-95 2.14E+00
Pde4b 2.78E-07 2.23E-05 2.14E+00
ENSRNOG00000033776 2.46E-04 8.73E-03 2.19E+00
Ptx3 9.43E-32 1.05E-28 2.26E+00
Abca1 6.70E-69 1.58E-65 2.33E+00
AABR07005031.1 1.52E-06 1.02E-04 2.33E+00
Ephx1 3.04E-19 1.43E-16 2.38E+00
Pde4d 2.74E-12 5.37E-10 2.49E+00
Nqo1 9.70E-23 6.30E-20 2.54E+00
Csf2rb 1.12E-03 3.03E-02 2.56E+00
ENSRNOG00000031540 2.77E-08 2.70E-06 2.60E+00
Il6 8.36E-04 2.40E-02 2.73E+00
Eda2r 5.03E-26 3.95E-23 2.82E+00
Cd80 3.24E-09 3.89E-07 3.40E+00
Cdkn1a 8.58E-94 4.04E-90 3.40E+00
Abcb1b 3.69E-113 3.48E-109 3.94E+00
Star 3.91E-179 7.37E-175 4.21E+00
Gdf15 8.82E-15 2.48E-12 5.88E+00
ENSRNOG00000062930 2.95E-05 1.40E-03 1.55E+02

Appendix 3: Table of total protein array pairs between AG50 and vehicle conditions
tested in PND8 rat Sertoli cells.

129

Abstract (if available)

Abstract The objective of this dissertation is to determine the molecular mechanisms driving dysregulation of male gonad development using immature Sertoli cells as a model after exposure to endocrine disrupting chemicals (EDCs) and drugs that are critical in male reproductive health. Sertoli cells are instrumental to the developing male gonad and nurture male germ cells from fetal life to adulthood. Disrupting their functions could dysregulate spermatogenesis and contribute to male infertility. EDCs and analgesic drugs such as acetaminophen (APAP) were individually shown to disrupt male gonad development and cause reproductive disorders. Infants may be exposed to dietary soy phytoestrogen genistein (GEN) and acetaminophen (APAP). For this study, we hypothesized that disrupting immature Sertoli cell development with exposure to EDCs and analgesic drugs contributes to the adverse effects of these compounds. We outlined two major specific aims to address our hypothesis. Firstly, we determined there was a significant dysregulation to immature Sertoli cell function by exposure to APAP, GEN and their mixtures which disrupted cell viability, proliferation, the expression of Sertoli cell markers, prostaglandins, and eicosanoid pathway genes. These data were generated by implementing an immortalized mouse Sertoli cell line TM4 and isolated postnatal-day 8 rat Sertoli cells to determine the effects of APAP and GEN, alone or mixed, at concentrations measured in human blood. Secondly, we performed RNA-seq analysis and identified differentially expressed genes in both cell types, with GEN and APAP+GEN mixture inducing more changes than APAP. Functional pathways, including those of p53 and TNF, were common targets of APAP and GEN in both cell types. Pharmaceutical inhibitors of estrogen receptor -α/-β (ER-α/-β) and G protein-coupled receptor 30 (GPR30) altered the effects of GEN and GEN mixtures. Together with RNAseq data, these experiments identified the transcription factor JUN, critical for Sertoligerm cell junctions and the inflammatory cytokine receptor Glycoprotein 130 (Gp130) as main targets. These findings suggest that APAP and GEN adverse reproductive effects might be driven in part by the dysregulation of immature Sertoli cells.

Linked assets

University of Southern California Dissertations and Theses

Conceptually similar

PDF

Effects of endocrine disrupting chemicals and pharmaceuticals on rodent immature Sertoli cell functions

PDF

Identification of functional pathways altered in testis by in utero exposure to low doses of genistein and DEHP

PDF

Eicosanoid regulation of spermatogonial stem cell development

PDF

Effect of acetaminophen and ibuprofen on spermatogenesis and cell signaling mechanisms

PDF

Fetal exposure to genistein and DEHP mixtures alters the expression of genes involved in critical testicular functions in adult rats

PDF

Mitochondrial dynamics regulate Leydig cell health and integrity

PDF

Endocrine disrupting chemicals: identifying reproductive toxic effects and disease of endocrine disrupting chemicals on male spermatogenesis

PDF

The role of translocator protein (TSPO) in mediating the effects of mitotane in human adrenocortical carcinoma cells

PDF

Employing engineered exosomes for combating colon cancer and engineering CD38 as an optimized drug carrier

Asset Metadata

Creator Corpuz-Hilsabeck, Maia L. (author)

Core Title Disruption of immature Sertoli cell functions by endocrine disruptors and analgesic drugs

School School of Pharmacy

Degree Doctor of Philosophy

Degree Program Molecular Pharmacology and Toxicology

Degree Conferral Date 2023-08

Publication Date 06/23/2023

Defense Date 05/05/2023

Publisher University of Southern California (original), University of Southern California. Libraries (digital)

Tag acetaminophen,cyclooxygenases,endocrine disrupting chemicals,functional pathways,gene expression,genistein,male reproduction,OAI-PMH Harvest,proliferation,Sertoli cells,SOX9

Format theses (aat)

Language English

Contributor Electronically uploaded by the author (provenance)

Advisor Culty, Martine (committee chair), Duncan, Roger (committee member), Papadopoulos, Vassilios (committee member)

Creator Email maiacorpuz@hotmail.com,mlcorpuz@usc.edu

Permanent Link (DOI) https://doi.org/10.25549/usctheses-oUC113190023

Unique identifier UC113190023

Identifier etd-CorpuzHils-11986.pdf (filename)

Legacy Identifier etd-CorpuzHils-11986

Document Type Dissertation

Format theses (aat)

Rights Corpuz-Hilsabeck, Maia L.

Internet Media Type application/pdf

Type texts

Source 20230627-usctheses-batch-1058 (batch), University of Southern California (contributing entity), University of Southern California Dissertations and Theses (collection)

Access Conditions The author retains rights to his/her dissertation, thesis or other graduate work according to U.S. copyright law. Electronic access is being provided by the USC Libraries in agreement with the author, as the original true and official version of the work, but does not grant the reader permission to use the work if the desired use is covered by copyright. It is the author, as rights holder, who must provide use permission if such use is covered by copyright.

Repository Name University of Southern California Digital Library

Repository Location USC Digital Library, University of Southern California, University Park Campus MC 2810, 3434 South Grand Avenue, 2nd Floor, Los Angeles, California 90089-2810, USA

Repository Email cisadmin@lib.usc.edu