University of Southern California Dissertations and Theses

Cell and gene therapy in the murine model of adenosine deaminase deficiency

(USC Thesis Other)

Cell and gene therapy in the murine model of adenosine deaminase deficiency

PDF

Download

Open document

Flip pages

Download a page range

Download transcript

Copy asset link

Request this asset

Transcript (if available)

Content CELL AND GENE THERAPY IN THE MURINE MODEL OF

ADENOSINE DEAMINASE DEFICIENCY

by

Denise Ann Carbonaro

A Dissertation Presented to the
FACULTY OF THE GRADUATE SCHOOL
UNIVERSITY OF SOUTHERN CALIFORNIA
In Partial Fulfillment of the
Requirements for the Degree
DOCTOR OF PHILOSOPHY
(SYSTEMS BIOLOGY AND DISEASE)

August 2009

Copyright 2009 Denise Ann Carbonaro

ii
Epigraph
“What we know about biology is what we know in our current state of
ignorance.”
Dr. Mildred Brammer, Ph.D.
Chair, Department of Biology, Ithaca College, circa 1982.

iii
Dedication

To my husband, Marc Louis Sarracino, for supporting all of my endeavors and
for making life fun…

iv
Acknowledgements

I would first like to acknowledge and thank my mentor, Dr. Donald B. Kohn, MD.
Without Don’s guidance, support, encouragement, patience and friendship,
none of this would have been possible. It was only because of his steadfast
leadership, that I ever considered embarking on the graduate school
path….again. I am especially grateful for the flexibility Don allows so I could
wear all the ‘hats’ I need to wear in my life. The last 15 years have been
extraordinary; and, I hope the next 15 are just as wonderful.

I would also like to thank the Program Director of Systems Biology and Disease
(SBD), Dr. Alicia McDonough, Ph.D. Alicia supported my application to USC
when others did not and gave me the opportunity to explain why I would be a
successful candidate. Obviously without her support, there would not be a
dissertation. Alicia has developed a program based on support, guidance, and
scientific inquiry. This was the perfect program for me. I will always remember
Alicia’s kind words, advice and encouragement. I would also like to thank Dawn
Burke for being the super administrator of SBD and for keeping us organized.

Of course, I would like to thank the members of my committee: Dr. Carolyn
Lutzko, PhD., Dr. Gay Crooks, MD, Dr. Grace Aldrovandi, MD, and Dr. Gregor
Adams, PhD, for all of their thoughtful comments and suggestions. I do

v
appreciate the time and effort that it takes to be on a graduate student
committee; and, I am especially grateful that you all said yes with enthusiasm. I
would like to add thanks to Dr. Carolyn Lutzko, PhD. Carolyn taught me to do
all of the murine methods that made the science in this dissertation possible.
She is a women who really does it all; with grace and determination.

I would also like to give a heartfelt thank you to Xiangyang Jin, without whom
most of this work would not have been done….at least, not in a timely manner.
XY has been instrumental in all aspects of this work and his contribution cannot
be understated. I thank him for all the countless hours of cell culture, titering,
cloning, southern blots, northern blots, ADA enzyme assays and for even
making PEG-ADA when it was so absolutely necessary…and so completely
beyond my ability and time constraints. Many others contributed technical
support to this project as well. The vector core (in all of its various
configurations) has been so vitally important in providing the viral supernatant
that provided the “cure” for my mice. The animal care staff who have been so
helpful in taking care of my mice, especially Renee Traub Workman, who has
kept my mice happy and healthy, and Vinnie Guarniere, who keeps the facility
running smoothly. I will miss the CHLA ACF so much especially as we move on
to UCLA! I’d also like to thank my summer students, Alex Morelan, Ian
Morelan, and Michael Hackman for their contributions to this work and their
continuing interest.

vi

I would like thank Dr. Michael Blackburn and Dr. Rodney Kellems, at the
University of Texas School of Medicine, for producing the mouse model of ADA
deficiency and for providing the mice to our laboratory and many thanks to Dr.
Melissa Aldrich, PhD, for the thorough protocols and thoughtful emails when I
first started to work with these mice. I also want to thank all the patients, nurses
and attending physicians in Division of Research Immunology/BMT who have
procured PEG-ADA to keep the mice alive. Also, special thanks goes to Lynn
Gordon and Enzon, Inc. for the gift of PEG-ADA. And finally, I would like to
thank the mice for the ultimate sacrifice, and for being so sweet and never biting
me.

During the last 19 years at Childrens Hospital Los Angeles (CHLA) I have met
so many interesting and smart people; many of who have influenced me
greatly. I would like to use this opportunity to reflect on some these people.
First, I would like to thank Dr. Frederick Hall, Ph.D., my first mentor and the
father of my children, Nicholas and Michael Hall. It would be unfair and untrue
to say that Fred was not important to my development as a scientist. Among
many things, Fred taught me the art of working from the paper to the
experiment, and not the other way around. He also taught me that science is
never done so you need to celebrate the small victories. Lastly, Fred taught me
truth in the notion of “if you dream it, it will happen”.

vii

The following women are among the smart and influential people I have met at
CHLA. Ingrid Bahner, who was so instrumental in helping me start over after my
divorce, taught me to enjoy the small pleasures of life; Linda Heiss, taught me
that the Poisson Distribution is important and that one should strive to
experience life on a grand scale; Eleanor Tsark taught me what hard work and
stamina really looks like; Stephanie Halene taught me how to jump in and ‘just
do it’; Sunita Haas taught me how to really laugh and that I should be careful
with my words; Tanja Gruber taught me planning is essential to completing the
task; Barbara Engel taught me that finding one’s true soul mate can be
transformative; Sarah Nightingale, taught me practice really does make it
perfect; Jesusa Arevalo, taught me how to be enthusiastic about anything;
Dianne Skelton taught me how to do great northerns and what loyalty and
perseverance looks like; Xiao Jin Yu, taught me how to do great southerns and
that wisdom is a gift bestowed onto just a few; and lastly, my “Jewish mother”,
Natasha Perelman, who has loved me unconditionally, taught me what it means
to keep your dreams alive and what ‘doing for your family’ really entails.

Not to leave out the men: there have been lots of influential men as well. Paul
Robbins reminded me that science and music can go hand in hand, and that a
guitar should never languish under the bed; Dennis Haas taught me that there
is more than one path to academic success; Aaron Logan taught me that you

viii
can be really good at lots of things, if you work smart; Greg Podsakoff, taught
me that money won’t make you happy and that true happiness means following
your heart; and lastly, Eric Dudl taught me how to do FACs analysis properly
and that, unfortunately, life is short.

I have a few words for my current lab mates and divisional friends who have
provided the friendship, support and encouragement, when I needed it the
most. I would like to thank Kit Shaw for her quiet, comfortable presence and
great friendship; Roger Hollis for the sweets, the gifts and the super viral
supernatant, who with Shantha Senadherra, make up the most efficient vector
core, Eszter Pais for being so helpful with the ‘ins and outs’ of the graduate
program, Teiko Sumiyoshi for demonstrating that great science and great shoes
are simpatico, Cinnamon Hardee for helping with the mice and who reminds me
so much of myself when I was younger, Francesca Giannoni for her insight in
murine immunology and for offering to speak Italian with me…when I am ready,
Satiro De Oliveira for interesting conversations on Kohn lab dynamics and
future life paths, Lora Barksky for tons of holiday memories and Holiday Teas,
Eva Zielinska and Monika Smorgosweska for great conversations and Polish
culture, Linda Dukes, for the shared experience of raising the two Nick’s, and
my wonderful ‘brown friends’, Suparna Mishna, Dinithi Senadhherra and Ann
George for technical tips and insightful lunch conversations. Last but not least,
I would like thank Chris Choi, my former lab mate, who encouraged me to apply

ix
to graduate school, answered all my GRE questions and gave me unwaivering
support.

Lastly, and most importantly, I would like to thank my family. My husband,
Marc, who has transformed my life. With Marc, life is easy….and fun…and
because he makes my life is fun and easy, he made doing things like going to
graduate school in my 44
th
year an easy decision. I can never really thank him
enough for all of the help in raising two sons, in keeping a home, and for all
around support and encouragement. I especially like it when he says “Right
On” and then I know life is good. I would also like to thank Marc’s parents, Nina
Ahlstrin, as well as Louie and Pat Sarracino, who have been so loving,
generous, supportive and encouraging; standing in for my own parents who
have since passed on. And finally, I would like to thank my children, Nicholas
and Michael Hall, for being so understanding and encouraging when I was
totally stressed out…especially at exam time. For them, I hope they have
learned through my experience that accomplishment is really just a series of
hoops we need to jump through. We are Sparta!

x

Table of Contents

Epigraph ii

Dedication iii

Acknowledgments iv

List of Figures xii

Abstract xvi

Chapter 1: Adenosine Deaminase Deficiency: 1
The Human and Murine Experience
Introduction 1
ADA-Deficiency: The Human Experience 4
ADA-Deficiency: The Murine Experience 28

Chapter 2: Neonatal Bone marrow Transplantation of the 49
Murine Model of ADA-Deficiency
Abstract 49
Introduction 50
Materials and Methods 51
Results 48
Discussion 64

Chapter 3: Neonatal Intravenous Administration of 80
Lentiviral Vector Expressing Human ADA:
A Novel Form of Enzyme Replacement
Therapy for ADA-Deficiency
Abstract 80
Introduction 80
Materials and Methods 83
Results 92
Discussion 112

xi
Chapter 4: Gene Therapy ex vivo in ADA Deficient Mice: 118
The Role of Enzyme Replacement Therapy
and Cytoreduction
Abstract 118
Introduction 119
Materials and Methods 121
Results 127
Discussion 147

Chapter 5: Concluding Remarks and Future Directions 154
Table 5-1. Summary of hematopoietic 158
stem cell transplantation and gene therapy
studies in ADA-deficient mice.

Bibliography 163

xii
List of Figures

Figure 1-1. Adenosine Deaminase enzyme activity. 3

Figure 1-2. Human Adenosine Deaminase: Gene and 5
regulatory elements.

Figure 1-3. Bicistronic retroviral vector construct: LASN. 16

Figure 1-4. The MoMLV LTR and MND LTR. 22

Figure 1-5. Retroviral Construct with the MFG Fragment. 23

Figure 2-1. Immunophenotype and lymphocyte function 57
at 16 days after neonatal BMT.

Figure 2-2. Immunophenotype at 60 days after neonatal BMT. 59

Figure 2-3. Lmphocyte function at 60 days after neonatal BMT. 60

Figure 2-4. ADA specific activity after neonatal BMT. 62

Figure 2-5. Substrate levels after neonatal BMT. 63
.
Figure 2-6. Quantitative PCR approach for determining donor 66
chimerism.

Figure 2-7. Donor chimerism at 16 days after neonatal BMT. 67

Figure 2-8. Donor chimerism at 60 days after neonatal BMT. 68

Figure 2-9. Survival after neonatal BMT with or without 70
cytoreductive conditioning.

Figure 2-10. Donor chimerism in tissues after neonatal BMT and 71
cytoreductive conditioning.

Figure 2-11. Donor chimerism in thymocytes, lymphocytes, and 72
myeloid populations after neonatal BMT and
cytoreductive conditioning.

Figure 2-12. Immunophenotype after cytoreduction and neonatal BMT. 73

xiii
Figure 3-1. Map of the SMPU-R-MND-huADA. 93

Figure 3-2. Vector Characterization SMPU-R-MND-huADA. 94

Figure 3-3. Experimental plan for neonatal injection of a lentiviral 95
vector expressing huADA in ADA-deficient mice.

Figure 3-4. Survival in ADA-deficient mice after receiving neonatal 97
injections of a lentiviral vector expressing huADA.

Figure 3-5. Dose escalation and marking after neonates after 98
injection of a lentiviral vector expressing huADA.

Figure 3-6. Proviral marking in PB after neonatal injection of a 100
lentiviral vector expressing huADA.

Figure 3-7. Proviral marking at two and six months after neonatal 101
injection of a lentiviral vector expressing huADA.

Figure 3-8. ADA enzyme activity in ADA-deficient mice two 102
months after neonatal injection of a lentiviral vector
expressing huADA.

Figure 3-9. Zymogram analysis to detect ADA enzyme activity in 103
tissues after neonatal injection of a lentiviral
vector expressing huADA.

Figure 3-10. Immunoreactive ADA in livers after neonatal injection 104
of a lentiviral vector expressing huADA.

Figure 3-11. Immunoreactive ADA in liver and lung two months after 105
neonatal injection of a lentiviral vector expressing huADA.

Figure 3-12. Absolute numbers of thymocyte and splenocyte in 106
ADA-deficient mice after neonatal injection of a lentiviral
vector expressing huADA.

Figure 3-13. Absolute numbers of thymocyte sub-populations in 107
ADA-deficient mice after neonatal injection of a
lentiviral vector expressing huADA.

xiv
Figure 3-14. Absolute numbers of splenocyte sub-populations in 108
ADA-deficient mice after neonatal injection of a
lentiviral vector expressing huADA.

Figure 3-15. Mitogenic stimulation in ADA-deficient mice after 109
neonatal injection of a lentiviral vector expressing huADA.

Figure 4-1. Retroviral construct expressing human ADA. 128

Figure 4-2. Experimental Schema: Ex-vivo gene transfer with 130
retroviral vector MMA into ADA-deficient marrow.

Figure 4-3. Transduction efficiency and survival after gene therapy. 131

Figure 4-4. Proviral marking in ADA-deficient mice after ex vivo 133
gene therapy.

Figure 4-5. Proviral marking in ADA-deficient hematopoietic tissue 134
after ex vivo gene therapy.

Figure 4-6. Immunophenotype and function after ex vivo gene therapy. 136

Figure 4-7. Absolute number of marked cells after cytoreductive 137
conditioning and ex vivo gene therapy.

Figure 4-8. Experimental Schema: Effects of short-course (1 month) 138
ERT verses long-course ERT after gene therapy on
frequency of gene marking and immune reconstitution.

Figure 4-9. Proviral marking in ADA-deficient mice after ex vivo 139
gene therapy: a comparison of long-course ERT and
short-course ERT.

Figure 4-10. Peripheral blood (PB) white blood cells (WBC) and 141
lymphocytes concentration after ex vivo gene therapy.

Figure 4-11. Absolute number of thymocytes and splenocytes after 143
ex vivo gene therapy.

Figure 4-12. Absolute number of thymic sub-populations after ex vivo 144
gene therapy.

xv
Figure 4-13. Absolute number of splenic B cells after ex vivo 145
gene therapy.

Figure 4-14. Absolute number of splenic T cells after ex vivo 146
gene therapy.

xvi
Abstract

I have investigated three different therapeutic approaches for the treatment of
adenosine deaminase (ADA)-deficient severe combined immunodeficiency (SCID)
using a murine model of ADA deficiency. The first two approaches were performed in
neonates (d1-3) prior to enzyme replacement therapy (ERT) and investigated the use
of hematopoietic stem cell transplantation (HSCT) and in vivo gene therapy (GT). The
last approach were performed in young adults, after 8 weeks of ERT, and investigated
the role of cytoreductive conditioning and ERT in ex vivo retroviral mediated gene
therapy. ADA-deficient neonates who received whole marrow HSCT, without
cytoreductive conditioning, had immune reconstitution, but had very low donor
chimerism (5-10%), and chimerism was multi-lineage. With increasing doses of
cytoreductive of total body irradiation, donor chimerism increased significantly (30-
50%), however, chimerism remained multi-lineage. These results are in contrast to the
lymphoid specific donor chimerism observed in another murine model of SCID (X-link)
that has a T lymphoid intrinsic defect. When ADA-deficient neonates received a single
intravenous dose (1x108 transducing units (TU)/ml) of a lentiviral vector expressing
human ADA, they had long term survival and good immune reconstitution. Proviral
marking was mostly in the liver and lung, and secondary transplants showed no
evidence of hematopoietic stem cell (HSC) transduction, suggesting the mice were
corrected by systemic detoxification in trans. In an effort to delimit the role of
cytoreductive conditioning and concurrent ERT during ex vivo HSC gene therapy, mice
were conditioned with either 200 or 900 cGy total body irradiation (TBI) and ERT was
either continued or discontinued. Conditioning dose was very important for
engraftment of transduced HSC, with 100-1000 fold more engraftment at 900 cGy

xvii
compared to 200 cGy. ERT did not decrease the amount engraftment; as neither did
1 month of ERT post GT. These studies have been useful in understanding the
important aspects required for a good clinical outcome and lasting benefit, in current
and future cell and gene therapy for ADA-SCID.

1
Chapter 1
Adenosine Deaminase Deficiency:
The Human And Murine Experience

Introduction
Adenosine Deaminase (ADA) Deficiency is caused by a monogenic defect in the gene
encoding for ADA and is an autosomal recessive trait. In humans, ADA deficiency
results in a metabolic defect in all cells; however, the most salient pathological
phenotype is a severe combined immunodeficiency (SCID) (Giblett, et al., 1972).
Patients with ADA-deficiency are diagnosed as infants with recurrent infections, failure
to thrive, pan-lymphopenia (no T, B or NK cells) and an associated lack of humoral and
cellular immunity (Hershfield, 1998). Without treatment, ADA-deficient SCID patients
succumb to opportunistic infections and die in infancy. ADA deficiency can be treated
with hematopoietic stem cell transplantation (HSCT), enzyme replacement therapy
(ERT) with pegylated bovine ADA and more recently with gene therapy (Hershfield and
Mitchell, 2001; Kohn and Candotti, 2009). The discussion that follows will examine
normal ADA expression, activity and function, and the metabolic consequences that
produce the pathological phenotype associated with ADA deficiency in humans and in
the murine ADA gene knockout model. I will also discuss recent advances in the
clinical care of ADA-deficient patients and future therapeutics in regards to recent
research in the murine model and speculate on how that research may or may not
apply to the current clinical research for ADA-deficient SCID.

2
Adenosine Deaminase
ADA is a key enzyme in purine nucleoside metabolism and it has a highly conserved
amino acid sequence in highly diverse organisms; this is especially true for the
residues surrounding the active site (Chang, et al., 1991). ADA is responsible for the
irreversible deamination of adenosine (Ado) and 2’-deoxyadenosine (dAdo) to inosine
and 2’-deoxyinosine, respectively, which are either converted to xanthine and uric acid
for excretion in the urine or enter a purine salvage pathway (Hershfield and Mitchell,
2001). ADA requires a water-bound, divalent cation (zinc atom or cobalt) in the
catalytic pocket for enzymatic activity. A glutamic acid residue in the pocket donates
an electron to the N1 of the adenine ring of adenosine to reduce the double bond at
N1-C6 (Figure 1.1). The water bound cation is the source of the hydroxyl group that is
added to C6. Upon release of the ammonia, through a poorly understood mechanism,
inosine (or 2’-deoxyinosine) is formed (as reviewed in Cristalli, et al., 2001).

In humans, ADA exists as two isoforms: ADA1 and ADA2. The minor isoform, ADA2,
exists as a monomer (100 kDa) and is the predominant isoform in plasma/serum
(Ratech, et al., 1981). ADA2 is thought to be a member of ADA-related growth factors
and may be active during inflammation or hypoxia where Ado concentrations may be
very high (Zavialov and Engstom, 2005). The major isoform, ADA1, is responsible for
most of the intracellular enzymatic activity. ADA1 is found as the small catalytically
active ADA (35-40 kDa; SADA) and the large ADA (280-300 kDa; LADA or ecto-ADA),
which is a complex of SADA with the ADA conversion factor complexing protein (ADA-
CP), a non-catalytic homodimeric glycoprotein (110 kDa). ADA-CP or ecto-ADA is a

3

plasma membrane associated protein and is now known to be identical to
CD26/dipeptidyl peptidase IV (DPP-IV), a surface antigen of activated T cells. In ADA
deficiency the lack of ecto-ADA may diminish the co-stimulatory function of CD26
(Martin, et al., 1995). Furthermore, ecto-ADA may be important in regulating the
amount of extracellular adenosine available for binding to G-protein coupled adenosine
receptors; and in ADA deficiency high surplus extracellular ADA could lead to aberrant
adenosine mediated signaling (Franco, et al., 1998). Although, only a fraction of CD26
molecules complex with ADA, it is not clear if extracellular ADA is relevant to the
Figure 1-1. Adenosine Deaminase enzyme activity. A schematic drawing of
the deamination of adenosine to form inosine. Glutamine donates an electron to
reduce the double bond at N1 making the C6 more susceptible to hydroxide
nucleophilic attack derived from the water bound to the Zn molecule, while
histadine stabilizes the attacking hydroxide (Cristalli, 2001).

4
catastrophic events associated with substrate accumulation in ADA deficiency
(Hershfield, 1998).

Adenosine Deaminase Deficiency: The Human Experience
Human Adenosine Deaminase
The human (hu) ADA gene is 32 kb, with 12 exons and 11 introns (Valerio, et al., 1983;
Wiginton, et al., 1983; Orkin, et al., 1983), and resides on the long arm of chromosome
20 (20q13.11) (Mohandes, et al., l984). ADA expression, although ubiquitous, is
controlled in a tissue-specific and developmentally-specific pattern. ADA is expressed
in a defined pattern over a thousand-fold range, with the highest levels in cortical
thymocytes. Expression in mature thymocytes is 1-5% of cortical thymocyte
expression, suggesting ADA is essential at a specific stage of thymopoiesis (Chechik,
et al., 1981). ADA gene expression must be regulated such that some tissues will
have high expression, some low and some will have varying levels during different
stages of differentiation and development. Regulation of ADA levels occurs mainly at
the level of transcriptional initiation, transcriptional arrest, and via cis–regulatory
elements and trans-acting factors to achieve temporal and spatial expression patterns
(Figure 1-2; Dusing, et al., 1994). The ADA basal promoter is a CAAT and TATA-less
promoter with six Sp1 binding sites, and is located 81 bp upstream from the
transcriptional start site (Valerio, et al., 1985; Wiginton, et al, 1986). Deletion analysis
indicates that the proximal Sp1 binding site is required for activation of expression to
detectable levels and the more distal Sp1 sites are required for further activated
expression (Dusing, et al., 1994). However, in reporter assays, the upstream
sequences (3.7 kb) and the first exon failed to promote expression, unless a 12.8 kb

5
fragment of the first intron was included, resulting in profoundly high expression in
thymic tissue (Aronow, et al., 1989). Within the first intron there is a 4-10 kb segment
that has an array of DNase I hypersensitive sites (HS) that vary according to tissue and

cell type. Deletion of this region eliminated high levels of expression in transgenic
mice. DNase I HS III has a T cell enhancer core and a 200 bp domain that contains
transcription factor binding sites for AP1, E box, C-Myb, Ets, and LEF-1. This
Figure 1-2. Human Adenosine Deaminase: Gene and regulatory elements.
A. Human ADA depicting the 5' UTR region containing six Sp1 transcription
factor binding sites upstream of the promoter region, which is -81bp from the
transcription start site. The proximal Sp1 site is required for ADA expression.
Human ADA has 12 exons and introns, depicted by black boxes and grey areas,
respectively.
B. First intron thymic regulatory elements include DNAse 1 hypersensitive (HS)
sites; specifically the HS III required T cell enhancer core, the HS II facilitator
sequence and the Alu-rich facilitator (Aronow, et al., 1992).

6
enhancer and other flanking sequences were required for position-independent and
copy-proportional expression in thymocytes, while another downstream element
appears to enhance the ADA expression in the duodenum (Aronow, et al., 1992;
Dusing, et al., 1997). ADA expression in the epithelial lining in the duodenum is
required for the breakdown of dietary Ado and dAdo, such that they are not absorbed
to act as signaling molecules. (Hershfield and Mitchell, 2001). In cells lines,
differences in ADA activity do not correlate with rates of initiation of ADA mRNA and it
was found that post-transcriptional regulation resulted in arrest of transcript elongation
within exon 1 as a mechanism to further regulate ADA gene expression (Chen, et al.,
1990).

Over 60 mutations in the ADA gene can result in ADA deficiency with the majority
being single amino acid substitutions (~67%), followed by deletions and aberrant
splicing (15%) and very few nonsense mutations (reviewed in Hershfield and Mitchell,
2001; Hershfield, 2003). Of the characterized amino acid substitutions, only two
interact with the active site (Figure 1-2). The first involves hydrogen bonding of the N-1
of the nucleoside (Glu217->Lys338) and the second coordinates with the divalent
cation (His15->Asp248). Other amino acid substitutions are close to the active site and
are thought to cause misalignment within the active site, especially in those patients
with partial ADA deficiency. Most deletions are short and introduce premature
translation stop signals, whereas splice site mutations are intronic single base pair
substitutions that cause exon skipping or premature translation stop signals. Both
types of mutations drastically reduce the levels of ADA mRNA and have essentially no
activity (Arredondo-Vega, et al., 1998).

7

ADA-Deficient SCID
ADA-deficient SCID represents ~20% of all SCID diagnosed and represents ~1 in
200,000-1,000,000 live births (Hershfield and Mitchell, 2001). A close examination of
the characterized defects, including the timing and severity of presenting symptoms
clearly demonstrate a strong genotype-phenotype relationship. When the ADA
expression of 29 amino acid sequence-altering alleles was quantified in an ADA-
deleted strain of E. coli, there was a strong inverse correlation between the amount of
enzyme produced and the red-cell dAXP level, providing a relationship between the
genotype and the resultant phenotype (Arredondo-Vega, et al., 1998). ADA deficiency
is an autosomal recessive trait; however, most patients are heteroallelic for a particular
mutation. Those homozygous for two types of severe mutations (deletions, nonsense
mutation, amino acid substitution in the active site) will usually have very little or no
ADA activity (Hershfield, 2003). These patients will present in infancy and have pan-
lymphopenia, recurrent opportunistic infections and will not thrive. Other mutations
may result in some ADA activity from a mutant protein or may result in some RNA
processing at a mutant splice site. Patients with some ADA activity (<1%) will present
later in childhood with “delayed onset” ADA SCID, and usually suffer unexplained T-cell
lymphopenia and chronic pulmonary insufficiency (Levy, et al., 1988).

Evidence from two populations indicates that somewhere around 1-4% of normal ADA
activity is adequate for normal immune function. The first such population include
people who have “partial expression” of ADA (<5%), typically caused by the expression
of ADA from either a splice variant or mis-folded protein and typically do not have a

8
SCID phenotype (Hirschhorn, et al., 1986; Ariga, et al., 2001). The other population
with partial ADA deficiency is a tribe of bushman from the Kalahari Desert, the !Kung.
An ADA gene polymorphism results in 2-3% of normal ADA activity in red blood cells,
10-12% of normal leukocyte ADA activity and permits normal immune function
(Jenkins, et al., 1976). Despite considerable heterogeneity in the genotype and
pathology of ADA deficient patients, a consistent pattern emerges: high levels of
urinary Ado, ATP depletion and dATP accumulation in erythrocytes, associated with
profound cellular and humoral immunodeficiency (Morgan, et al., 1987). Even though
ADA is ubiquitously expressed in all cells, the lymphocyte populations are the most
affected by the absence of ADA and results in the SCID phenotype.

There are several mechanisms involved in the lymphotoxicity observed in ADA SCID;
with most mediated by the intracellular accumulation Ado and dAdo. dAdo
accumulation inhibits S-adenosylhomocysteine (AdoHcy) hydrolase and causes the
accumulation of AdoHcy. AdoHcy is a competitive inhibitor of all transmethylation
reactions involved in vital cell processes, such as gene expression, RNA splicing, and
protein synthesis. (Hershfield, et al.,1979). Additionally, accumulating Ado also acts to
increase AdoHcy, which is normally hydrolyzed to Ado and homocysteine in a
reversible reaction, by driving the reaction to form even more AdoHcy (reviewed in
Hershfield and Mitchell, 2001). dAdo accumulation also results in ATP depletion as
dAdo is converted to dATP, causing a disruption in deoxynucleotide synthesis. The
expanded dATP pool precipitates its cytotoxic effects via several mechanisms. DNA
replication relies on the tightly regulated production and maintenance of dNTPs pools
by the reduction of NDPs via the action of ribonuclease reductase. However,

9
accumulating dATP is an inhibitor of ribonuclease reductase and results in dNTP pool
depletion and the inhibition of DNA synthesis (Cohen, et al., 1983). dATP
accumulation also results in the disruption of the dNTP pool balance which may modify

the action of terminal deoxynucleotidyl transferase (Tdt), the enzyme responsible for
producing immunologic diversity by inserting nucleotides in the N regions of
immunoglobulins and T cell receptors (Komori, et al., 1993). Accumulation of dATP
and AdoHcy has been also shown to induce apoptosis by promoting the release of
cytochrome c from mitochondria and associating with apoptotic protease activating
factor-1 (Apaf-1) to form the apoptosome and subsequent caspase activation (Ratter,
et al., 1996; Li, et al., 1997, Yang and Cortopassi,1998).

Hematopoietic Stem Cell Transplantation (HSCT) For ADA SCID
HSCT has been used to treat ADA-deficiency successfully with HLA matched sibling
marrow, HLA matched unrelated donor (MUD) marrow, or T cell depleted
haploidentical parental marrow; albeit with varied results (Parkman et al., 1975). The
preferred treatment is HSCT with a matched sibling donor which has the most
favorable outcome. However, in most cases, a fully histocompatible sibling donor is
not available and complications can arise when the marrow is not fully histocompatible,
such as graft versus host disease (GVHD) or graft rejection. Another post-transplant
complication can be opportunistic infections, especially reactivated, latent and/or
acquired donor-derived infections. The other added complication is that ADA-deficient
SCID patients may be very ill and suffering from opportunistic infections at diagnosis,
especially for the first child in a family identified as being ADA deficient. These factors

10
conspire to make the success rate for HSCT sub-optimal at best (Hershfield and
Mitchell, 2001).

Many reports on the success of HSCT for SCID pool data from all types of molecular
defects that cause a SCID phenotype. This is not surprising since twenty years passed
between when the first molecular defect associated with the SCID phenotype was
identified (ADA; 1972) and a second molecular defect was identified (1993) (reviewed
in Buckley, 2004). Later reports have now analyzed HSCT for all SCID according to

the specific genetic defect. This is important since most, if not all, of the defects that
cause SCID are lymphoid intrinsic and exclusively affect some aspect of lymphoid
activation and/or proliferation, whereas ADA deficiency is a systemic metabolic
disorder that is most pronounced in the thymic environment.

In two separate large clinical studies of HSCT, when patients with an HLA-identical
sibling donor were transplanted without the use of cytoablative conditioning, survival
was very high (n=12; 100%) (Fischer, et al.,1990; Buckley, et al.,1999). Donor
chimerism was nearly 100 percent for T cells, and mixed in other lineages. In one of
the first long term follow-up reports on chimerism after non-ablated HSCT for ADA
SCID, patients had donor derived T cells, but host derived myeloid and erythroid
lineages; thus the RBC dATP levels were lower than before HSCT, but still significantly
higher than in normal controls (Hirschhorn, et al.,1981). Depending on the study, the
survival rate dropped precipitously using a T-depleted haplo-identical parent donor (0-
60% survival); with only 60% of the initial survivors living past 6 years (Haddad, et al.,

11
1998). T cells are not found in these patients for 3-4 months, and if found, they are not
fully functional for 8-12 months. Mortality in the T depleted haploidentical transplant
patients is usually associated with serious opportunistic infections that may be due to
delayed T cell engraftment (Hershfield and Mitchell, 2001). Cytoreductive conditioning
has been used successfully in several reported cases of T-depleted haploidentical
transplant for ADA SCID, including one report where donor NK engraftment was
observed (Silber, et al., 1987; Bluetters-Sawatzki, et al. 1989; Gaines, et al., 1991).

Enzyme Replacement Therapy (ERT)
Soon after the discovery that ADA deficiency resulted in SCID, the addition of
exogenous calf intestinal ADA or erythrocyte ADA to cultures of ADA-deficient
lymphocytes was shown to restore mitogenic proliferative responses (Polmar, et al.,
1975). Furthermore, when an ADA deficient child was given transfusions of RBC, but
not plasma, mitogenic responses of lymphocytes were restored, as well as evidence of
a radiographic ‘thymic shadow’ and immunoglobulin synthesis. The patient had
reductions of lymphocyte dATP and remained infection free for 17 years. The authors
speculated that ERT with exogenous ADA could be a potential treatment for ADA SCID
patients who did not have a histocompatible donor (Polmar, et al., 1976).

Polyethylene glycol (PEG) was covalently conjugated to bovine ADA (PEG-ADA) and
was shown to decrease the immunogenicity and increase the half-life to 28 hrs in mice
(Davis, et al., 1981). PEG-ADA does not cross blood cellular membranes nor does it
bind to CD26. Despite the fact that dATP is poorly transported across the cell
membrane, detoxification of lymphocytes occurs because of the reversible conversion

12
of dATP to dAdo, which is freely transported and is in equilibrium with plasma dAdo
(Hershfield and Mitchell, 2001). In a clinical trail, PEG-ADA was administered via intra-
muscular injection to an ADA-deficient patient. Plasma ADA levels were ~2 fold higher
than normal erythrocyte ADA levels and completely reversed the metabolic
consequences of ADA deficiency. Erythrocyte dATP decreased and AdoHcy hydrolase
activity increased with subsequent improvement in cellular immune function
(Hershfield, et al, 1987). In 1990, ERT with pegylated ADA received FDA orphan drug
approval (Adagen!, Enzon, Inc., Pistcataway, NJ). Since then, ERT has become an
alternative for patients lacking a HLA matched sibling (Hershfield and Mitchell, 2001).

In patients receiving ERT for 1-5.5 years, 59% produce IgG anti-ADA antibodies
(epitopes to the bovine ADA not PEG), which were associated with enhanced enzyme
clearance in two patients (Chaffee, et al., 1992). Tolerance was induced in one of the
two patients and the patient remained on ERT for 36 months (Chun, et al., 1993).
Patients do not develop an allergic reaction nor is mortality (20%) associated with
toxicity but rather due to the immunodeficiency and pre-existing severe infections. In
patients responding to ERT, T lymphocyte ontogeny and immune reconstitution appear
to occur in a manner similar to that observed in ADA deficient patients receiving
haploidentical HSCT, with ADA-deficient thymic progenitors maturing into functional T
lymphocytes (Weinberg, et al., 1993). However, long term follow-up of patients
receiving ERT with PEG-ADA, revealed low thymic output, B cell oligoclonality and
increased apoptosis in peripheral T cells. Those T cells that were present represented
a broad repertoire, capable of cytokine production and proliferation in response to
mitogens (Malacarne, et al., 2005). In a retrospective study, patients receiving ERT for

13
several years or more showed improvement in their lymphocyte counts that peaked
well below normal counts. At the time of the chart review, all patients had lymphocyte
counts approaching their pre-ERT lymphocyte counts, with an accompanying gradual
decline in lymphocyte mitogenic and antigenic responses. Despite the low counts and
declining functionality, these patients continued to have protective immunity (Chan, et
al., 2005).

ERT with ADAGEN, an orphan drug with a limited patient pool, is very expensive,
costing approximately $250,000-300,000 per year. ERT has been available for almost
20 years, and some patients are reaching adulthood. However, some have and many
may become ineligible for coverage under their parents’ insurance policy. Others have
already reached the lifetime benefit cap of their policies, causing some patients to forgo
this life sustaining treatment (DB Kohn, personal communication). Because of the lack
of suitable donors and the complications of HSCT combined with the expensive and
non-curative nature of ERT, alternative therapies are rapidly being developed and are
on the path to becoming the new standard of care (Kohn and Candotti, 2009).

Gene Therapy For ADA-Deficient SCID
There were many reasons why retroviral mediated gene transfer for the correction of
SCID was first attempted for ADA deficient SCID. First and foremost, ADA deficient
SCID was the only form of SCID for which a relevant gene had been identified and
cloned, and the relatively small cDNA could be accommodated in a retroviral construct
(Gasper and Kinnon, 1996). However, there were other factors that made ADA SCID a
good model for the nascent field of gene therapy.

14

One of the most important factors was that ADA SCID, and indeed all forms of SCID,
are postulated to give corrected T cells a selective advantage over the non-corrected T
cells. Indeed, the HSCT experience for ADA SCID did show donor T cells engrafting
and completely repopulating the T cell compartment (Hirschhorn, et al., 1981).
Furthermore, there were case reports detailing the spontaneous reversion of SCID
producing mutations for ADA deficiency, X-linked SCID, Wiskott Aldrich Syndrome and
others (reviewed in Arredondo-Vega, et al., 2002). As in HSCT, the T cell
compartment can become completely repopulated with the progeny from the T cell
progenitor in which the reversion had taken place, thus demonstrating a strong
selective advantage for the corrected cell. Researchers hypothesized that correcting a
few hematopoietic stem cells or early progenitors would give rise to progeny that could
repopulate the T lymphoid compartment (Kohn, 1997). Another important factor was
that the ADA gene had been described as a housekeeping gene displaying a complex
pattern of expression but it did not require precise and regulated expression for clinical
benefit. This feature was especially important for use within a retroviral construct that
would drive constitutive expression from a viral enhancer/promoter (Gasper and
Kinnon, 1996; Kohn, 2001). Wide ranges of ADA expression are tolerated: congenital
over-expression of erythroid ADA, caused hemolytic anemia but is not life- threatening
( Valentine, et al., 1977) and very low (1-4%) amounts of ADA expression could
provide adequate immune function as shown by the !Kung tribesman (Jenkins, et al.,
1976). Finally, the experience from ERT, indicated that wide variation in ADA
concentration could be tolerated. Once a week, the plasma ADA levels are two fold

15
higher than normal erythrocyte ADA levels, then falling to trough levels far below
normal 5-7 days later (Hershfield, et al., 1993).

Gene Therapy For ADA SCID - Early Studies
The early gene therapy clinical trials for ADA deficiency used mature T lymphocytes as
their target cell for gene correction. The bicistronic retroviral vector construct, LASN,
was based on the Moloney Murine Leukemia Virus (MMLV) and expressed human
ADA and the neomycin resistance gene. In 1990, two young girls (aged 2-4) on ERT
with diminishing lymphocyte function, received repeated infusions (11-12 infusions over
10-24 months) of transduced peripheral T lymphocytes that had been expanded in vitro
in the presence of anti-CD3 and rIL2 (Blaese, et al., 1995). After 10 years, 20% of
circulating T cells, with the inserted gene, were present in one patient, but less than
0.1% in the other (Muul, et al., 2003). Remarkably, this study revealed more about
mature T lymphocyte longevity than the efficacy of gene transfer, since both patients
remained on ERT through the study duration and little clinical benefit was seen.

In another study, PBL and autologous bone marrow (BM) cells were independently
transduced with structurally similar vectors that differed only in some restriction sites
located in a non-functional region of the backbone (Bordignon, et al., 1995.). The PBL
were transduced by co-cultivation with vector producing cells and expanded with PHA
and low dose IL-2. The BM was transduced with vector supernatant over three days
and maintained in long term culture conditions on an adherent stromal layer without

16

exogenous growth factors. Transduction efficiency was more varied in the PBL (2-
40%) and more consistent in the BM (30-40%). The patients received repeated
infusions over a 2 year period. Initially, nearly all of the gene marked cells contained
the vector sequences used to transduce the PBL, but after a period of three years,
gene marked cells across multiple lineages contained vectors sequences used to
transduce the bone marrow cells (Bordignon, et al., 1995). This analysis provided
substantial evidence for the use of stem cell populations for multilineage correction of
blood cells, as well as provided insight in the potential for selective advantage of
transduced bone marrow cells. Further long-term analysis of patients treated with
transduced PBL revealed that, in one patient, ERT may have indeed blunted the
selective advantage of the transduced cells. The patient had sustained marking of PBL
at 1-2% the second year after gene therapy, with declining immune function. It was
concluded that concurrent ERT was not supporting T lymphopoiesis and ERT was
tapered down until ceased. During the period of ERT cessation, the frequency of
transduced PBL increased, and although dATP levels also increased steadily there
Figure 1-3. Bicistronic retroviral vector construct: LASN.
Derived from the Murine Moloney Leukemia Virus. Viral 5’ LTR
enhancer/promoter drives huADA gene expression. The neomycin (neoR) gene
expression is driven by the SV40 early immediate promoter. " is the retroviral
packaging signal.

17
was improvement in T cell counts and responses to neo-antigens (Aiuti, et al., 2002b).
Although PBL transduction did not engender long lasting clinical benefit, removal of
ERT appeared to put selective pressure on the transduced cells (Aiuti, et al., 2009).

Gene Therapy For ADA SCID – Clinical Trails With Isolated HSC
Other studies ensued, using isolated CD34+ cells as the target population. In one
study, CD34+ cells were isolated from bone marrow and transduced by co-cultivation
with a retroviral packaging line for 90 hours in the presence of IL-3. Gene transfer
efficacy was poor (5-12%) and there was no evidence of lymphoid transduction. The
patients were receiving ERT (one started 3 months post-gene therapy) and showed
little evidence of marked cells in the marrow or periphery (Hoogerbrugge, et al., 1996).

In another study in which three patients, the sibling of affected individuals and were
diagnosed in utero, had their CD34+ cells isolated from their umbilical cord blood (CB)
and transduced by the addition of retroviral vector supernatant (three cycles) in the
presence of IL-3, IL-6 and stem cell factor. The cells were re-infused on day 4 of life
and the patients were started on ERT. Gene transfer efficacy was between 12.5-
21.5% for the three patients and the frequency of gene marked cells after 18 months
was between 1 marked cell in 100,000 to 1 marked cell in 3000 cells (0.001-0.03%);
however, the frequency for gene-marked progenitors was 100 fold higher (Kohn, et al.,
1995). The patients were maintained on ERT, although one patient never had the ERT
dose adjusted for growth and the other patients had their doses stepped down to a half
dose after 18 months. With decreasing ERT, ADA plasma concentrations did
decrease, but erythrocyte dATP did not increase. Furthermore, after 4 years the

18
frequency of gene marked cells in PBL increased to 1% in all three patients, while the
frequency of gene marked granulocytes only increased to 0.1%. When PBL were
sorted by flow cytometry, the frequency of gene marked T lymphocytes (CD3+) had
increased substantially to 1-10%, while the frequency of monocytes (CD13+CD14+)
and B lymphocytes (CD19+) increased only 0.01-0.1%.
Four years after gene therapy, ERT was completely stopped in the patient with the
highest level of gene marking (10%). After 2 months without ERT, the patient had
evidence of opportunistic infections and was restarted on ERT. While off PEG-ADA,
plasma ADA levels decreased more than 100 fold, erythrocyte dATP increased 100
fold, and there was a substantial decrease in AdoHcy hydrolase activity. Antigenic T
cell responses were lost, and B and NK cell counts dropped precipitously. However, T
cell counts and mitogenic responses remained the same, and the frequency of gene
marked lymphocytes increased to 30%. RT-PCR analysis for vector ADA expression
in PBL revealed expression only when the PBL were stimulated with
phytohemagglutinin (PHA) in vitro, indicating there may be no functional ADA
expression in non-activated cells (Kohn, et al., 1998). Proviral vector integration
analysis of PBL samples collected from this same patient revealed a single vector
integrant was predominant and at eight years post-gene therapy, analysis of PB T cell
clones, revealed 13 out 220 clones had proviral vector sequences with 82% of the
vector containing clones positive for the predominant integrant. TCR rearrangement
analysis showed the clones were generated from polyclonal thymopoiesis. This
analysis indicates that a low number of transduced CB HSC or progenitors could
engraft and produce mature blood cells without cytoreductive conditioning. However,
there was a lack of clear clinical benefit (Schmidt, et al., 2003).

19

Gene Therapy For ADA SCID – Advances In Transduction Conditions
Although these studies showed the transduction of PBL T lymphocytes and HSC was
possible and re-infusion of these cells was safe and non-toxic, no clinical benefit was
observed. Future studies would require changes in the materials and methods used to
enhance the probability of successful and efficacious gene transfer. Evaluating the
early experience is complicated at best. Target cell populations and transduction
conditions varied among these early studies, making it difficult to determine the
relevant aspects of the transduction. Furthermore, many of the conditions used were
based on the extrapolation of in vitro transduction studies or in vivo murine
transplantation or xenotransplantation studies. However, since the inception of the
earliest gene therapy clinical trials, a number of advances have been made in the
development of tools and in the refinement of the conditions used for transduction
(Kohn, 2002 ).
The use of retroviral vectors requires the activation of quiescent populations to
proliferate. The disintegration of the nuclear envelop during mitosis is necessary for
vector integration into the host cell genome; however, most HSC are quiescent and are
in the G
0
/G
1
phases of cell cycle (Miller, et al., 1990; Nolta and Kohn, 1990). Cytokines
are utilized to activate the HSC and to move the cells out of G
0
; nevertheless the most
primitive cells appear to be resistant to cytokine stimulation (IL-3, IL-6, SCF). The
addition of flt-3 ligand (Flt-3), an early-acting cytokine, increased transduction efficiency
and increased long-term engraftment of human HSC in immune-deficient mice (Doa, et
al., 1997). Another cytokine, thrombopoietin (TPO) or megakaryocyte growth and

20
development factor, has also been shown to promote viability in murine HSC, which
express the receptor, c-mpl, for TPO (Borge, et al., 1996).

Studies also demonstrated that the presence of a monolayer of bone marrow stromal
cells to support the hematopoietic stem cells was important for the engraftment and
long term hematopoiesis of transduced HSC (Dao, et al., 1997). Although stromal
support has been utilized in some studies, it required an additional bone marrow
aspirate and was time consuming, so alternatives were explored (Parkman, et al.,
2000). Fibronectin, an extracellular matrix glycoprotein protein, binds to membrane
integrins and is important for adhesion and migration of HSC (Williams, et al., 1991).
The C-terminal fragment of fibronectin, CH-296, (Retronectin; Takara, Japan) has been
shown to engage HSC integrins and acts to enhance transduction of HSC without
impacting homing or inducing differentiation (Moritz, et al., 1994; Pollack, et al., 1998;
Dao, et al., 1998). It has also been shown that preloading the fibronectin fragment
(FN) with repeated applications of viral supernatant to the CH-296 effectively
concentrates the virus (Hanenberg, et al., 1997). When compared to transduction of
rhesus HSC on autologous stroma, those cells transduced on FN resulted in multi-
lineage, long term, stable engraftment of transduced cells (Wu, et al., 2000).

The use of fetal calf serum (FSC) in the transduction medium also presents potential
problems. The use of animal materials for cells to be infused into human subjects
poses risks for transmission of viruses, prions, etc. One patient receiving repeated
infusions of transduced PBL developed an immune response to the FCS (Blaese, et

21
al., 1995; Muul, et al., 2003). Serum free media alternatives have now been developed
and are currently being used in clinical trials.

Gene Therapy for ADA SCID – Advances In Retroviral Vectors
The stability and persistence of expression of the human ADA cDNA within MMLV
retroviral vector constructs has been problematic. When transduced bone marrow
expressing a transgene was isolated from primary murine recipients and transplanted
into secondary recipients, there was transgene silencing that was associated with
methylation of the MMLV long terminal repeat (LTR) (Figure 1-4; Robbins, et al., 1998;
Halene, et al., 1998). To address this issue, the MMLV LTR was replaced with the
myeloproliferative sarcoma virus (MPSV) LTR improving ADA expression when
compared to MMLV (Figure 1-4; Onodera, et al., 1998). The removal of two cis- acting
repressor elements also resulted in increased transgene expression in embryonic
carcinoma cells that normally restrict transcription from murine retroviruses (Challita, et
al., 1995; Robbins, et al., 1997). One of the elements was a repressor binding site
located in the MMLV primer binding site (PBS). Replacing the MMLV PBS with the
dl587rev PBS, from an endogenous murine retroviral strain that uses a different primer
binding site lacking the repressor binding site, was shown to be mostly responsible for
increasing expression in murine HSC (Haas, et al., 2003). Furthermore, removal of
the negative control region (NCR) from the MPSV LTR, which binds the YY-1
transcriptional repressor factor also minimally enhanced expression. However, the
combination of all three modifications, the MPSV LTR with NCR removal, and the
dl587 PBS (MND), in the MMLV backbone resulted in the most stable and persistent

22
transgene expression and was associated with the least amount of methylation
(Robbins, et al., 1998; Halene, et al., 1998; Wang, et al., 1998).

Another potential problem with the vector constructs used in the early clinical trials was
the inclusion of a reporter gene expression cassette. Therapeutic vectors carrying
selectable marker genes facilitated the generation and isolation of retroviral producer
clones and the titration of the retroviral vector. However, there is evidence that
selectable marker genes have elicited immune responses resulting in the clearance of
transduced cells (Riddell, et al., 1996; Jung, et al., 1998). Onodera and colleagues,
(1998) removed the neomycin resistance gene to create a simplified vector containing
just the therapeutic ADA gene. With a simplified vector, there is one transcript off of
the LTR enhancer/promoter and less possibility of promoter interference with the two
expression cassettes. To facilitate splicing and export of the LTR transcript, many
Figure 1-4. The MoMLV LTR and
MND LTR.
The MoMLV LTR is derived from
the Murine Moloney Leukemia
Virus (MMLV). The viral 5’ LTR
enhancer/promoter is located in the
U3 region. The U3 region contains
the Negative control region, a cis-
repressor of expression, depicted
by the thin box 5’ of the R region.
The primer-binding site (PBS) is
derived form the MoMLV and
contains a repressor binding site.
The MND LTR is derived from the
Myeloproliferative Sarcoma Virus,
and does not contain the negative
control region. The PBS is derived
from an endogenous retrovirus.
The dl587 PBS lacks a repressor
binding site.

23

vectors contain the MFG fragment that has a splice acceptor site and the
transcriptional start site of the MMLV env gene is aligned with that of the transgene
(Figure 1-5; Hwang, et al., 1984; Krall, et al., 1996).

The low transduction efficiencies obtained in the early clinical trials has suggested that
the use of an alternative to the murine amphotropic envelope might be better for the
transduction of human HSC and other progenitor populations (von Kalle, et al, 1994;
Figure 1-5. Retroviral Construct with the MFG Fragment.
A. Retroviral Genome depicting the 5’ and 3’ LTR, the splice donor (SD) and splice
acceptor (SA), and three retroviral genes: gag, pol and env. The three viral genes
are expressed from spliced transcripts.
B. The MFG fragment is the 3’ end of gag including the packaging signal " and the
5’ UTR of the env gene. The ATG start signal of env is aligned precisely at the ATG
start signal of the exogenous gene. The MFG has been shown to increase
expression in retroviral constructs (Krall, et al., 1996).

24
Bunnell, et al., 1995; Onodera, et al., 1998; Relander, et al., 2002). Efficient
transduction by an amphotropic retrovirus has been shown to be dependent on the
high expression of the retrovirus receptor, the Pit1 phosphate sympoter, which has
been found to be poorly expressed on HSC cell lines (Sabatino, et al., 1997; Kurre, et
al., 1999). In a comparison of the amphotropic virus, gibbon ape leukemia virus
(GALV), or the vesicular stomatitis virus (VSV) envelope on transducing murine HSC or
SCID mouse repopulating cells (SRC), the GALV envelope was shown to be best for
preserving the engraftment of SRC in serum free conditions (Relander, et al., 2002).
GALV pseudotyped retroviruses had more engraftment of transduced baboon marrow
when compared to an amphotropic pseudotyped retrovirus (Kiem, et al., 1997).
Furthermore, transduction of baboon marrow cells was highest with a GALV
pseudotyped retrovirus, when prestimulated (24h) and transduced (48h) in the
presence of IL-6, FLT3, SCF, and MGDF when plated on the fibronectin fragment CH-
296 (Kiem, et al., 1998).

Thus, a number of advances were made in both the tools and conditions for
transduction and many have been implemented in more recent clinical trails.
However, when all things are considered, the problem of low transduction efficiency
and engraftment in past clinical gene therapy trials for ADA-deficient SCID, may also
be the result of an inappropriate approach (Kohn, 2002).

25
Gene Therapy For ADA SCID – New Approaches
In the studies previously discussed, ERT was a confounding variable that hampered
the ability to make a full assessment of immune function associated with the success
or failure of gene therapy. Furthermore, albeit the patient sample size was limited and
seemingly anecdotal, ERT appeared to blunt the selective advantage of the gene
corrected cells in previous studies (Aiuti, et al., 2002b; Kohn, et al., 1998). The
presence of non-corrected cells resulted in a lower frequency of gene marked cells
being observed in any given analysis. However, ethical constraints prevented the
removal of concurrent ERT during the course of ADA gene therapy clinical trials.

Another factor in the poor results was the low engraftment of transduced cells. Gene
marking and transplantation studies conducted in mice without prior cytoreductive
conditioning resulted in little or no marking (Mardiney, et al., 1996). Furthermore, other
studies indicated that the use of cytoreductive conditioning appeared to decrease host
stem cell function allowing for the engraftment of transduced cells (Goebel, et al.,
2002). Rhesus macaques transplanted with transduced HSC after conditioning with a
low-morbidity regimen of sub-lethal irradiation (320-400 cGy), had PBL proviral
marking that persisted for 4 months at 10-15% (Rosenzweig, et al., 1999).

The importance of these two factors has been highlighted in two on-going clinical trials
for ADA-deficient SCID. In both trials, the previously discussed advances in
transduction conditions and constructs were made in an effort to improve the
transduction efficiency. Vector constructs were designed to minimize transcriptional
repression and packaged with the GALV envelope, cytokine cocktails were amended,

26
and HSC were isolated and transduced on FN. However, in one trial, conducted in
Italy, 2 patients who lacked access to ERT, were given nonmyeloablative dosages of
busulfan (one quarter of a fully ablative dose), prior to the re-infusion of their
transduced HSC (Aiuti, et al., 2002a). In another study, conducted in the US, patients
already receiving ERT were maintained on ERT and where not given cytoreductive
conditioning (n=4) prior to the re-infusion of their transduced HSC (Sokolic, et al.,
2007). Although, these patients were not directly compared in the same study, the
study parameters are similar enough to make a comparison. Those patients receiving
cytoreductive conditioning and no ERT, had immune reconstitution and systemic
detoxification, accompanied with multilineage long-term engraftment of transduced
cells. Those patients not receiving cytoreductive conditioning and continued on ERT
had lower gene transfer efficiency and engraftment of the transduced HSC. However,
because the patients remained on ERT, it is impossible to determine the effects of
gene transfer on immune reconstitution and systemic toxicity due to ADA deficiency;
but little clinical benefit was observed. Since then, more patients were enrolled in
both studies and all were given nonmyeloablative conditioning and had ERT
discontinued.

The Italian study has 10 patients in long-term follow-up. At present, all 10 patients are
alive and well. One patient resumed ERT, but 9 out 10 patients treated have had
progressive immune reconstitution, with increases in T lymphocyte populations and
function, including cytokine production, and mitogen/antigen responses. Five patients
have evidence of antigen-specific antibodies and IVIG was discontinued (Aiuti, et al.,
2009a). All patients have expression of ADA enzyme activity in PBMC and systemic

27
detoxification of adenine nucleotides. Gene marking was detected in all myeloid and
lymphoid populations, and clonal analysis revealed a polyclonal T cell population.
Integration analysis also showed shared vector integrations in multiple lineages
indicating the engraftment of transduced multipotent HSC (Aiuti, et al., 2007). The US
study has enrolled 6 patients, with early results indicating there is higher gene marking,
increased ADA RBC levels, and decreased erythrocyte dATP levels, compared to the
prior subjects who did not receive busulfan and remained on PEG-ADA ERT. One
patient was ill and resumed ERT after four months, but gene marking and ADA activity
has continued to increase (Sokolic, et al., 2007).

Another ongoing study being conducted in England, also discontinued ERT in one
patient with a poor response to ERT, and the patient received cytoreductive
conditioning with melphalan instead of busulfan. After two years, the patient has
immune reconstitution and systemic detoxification. However, immune reconstitution
has been more T lymphoid specific, with more T and NK gene marked cells than B
cells, and very little granulocytes marked (Gasper, et al., 2006). These results suggest
the type of conditioning may be important to the ontogeny of the graft and in the
kinetics of immune reconstitution (Aiuti, et al., 2009b).

Thus, it seems the combination of ERT and cytoreductive conditioning can result in
sustained engraftment of transduced HSC and multilineage engraftment. However, it
is not clear which parameter is more important or if the synergy of both is essential. In
another study, conducted in Japan, two patients were not given cytoreductive
conditioning, but ERT was discontinued. These patients have had a delayed immune

28
reconstitution and reduction of dATP. These results may suggest that conditioning
may increase the rate of immune reconstitution (Otsu, et al., 2006). Since none of
these patients have any indication of developing a lymphoproliferative disorder seen in
the children treated in gene therapy clinical trials for X-linked SCID (Hacein-Bey, et al.,
2003), these studies suggest that gene therapy for ADA-deficient SCID may soon
become the standard of care.

Adenosine Deaminase Deficiency: The Murine Experience
Murine Model Of ADA Deficiency
The murine model of ADA-deficiency was produced by targeted ADA gene knockout by
introducing a neomycin cassette by homologous recombination at the AatII site in Exon
5. The knockout of both ADA alleles resulted in a more severe and complicated
pathological phenotype. ADA is required for post-implantation development and
embryos homozygous for the ADA knockout allele die peri-natally of severe
hepatocellular damage (Wakamiya, et al., 1995; Blackburn, et al., 1995: Migchielsen,
et al., 1996). Mutant (ADA-/-) pups survive gestation only after crossing heterozygote
mice (ADA+/-) with a transgenic mouse model (ADA+/-Tg+) carrying an ADA mini-gene
in which ADA expression was restricted to the placental trophoblasts (ADA-/-Tg+) (Shi,
et al., 1997; Blackburn, et al., 1997; Blackburn, et al., 1998). Post-natally there is no
ADA expression, and by day 20-22 the ADA-deficient pups die of severe lung
insufficiency (Blackburn, et al., 2000). The decline of the ADA-/-pup starts as early as
day 12 and is characterized by rapid and labored breathing, and eventually the mice
become cyanotic and die. The nature of the pulmonary insufficiency is characterized
by abnormal lung development, macrophage activation and eosinophil infiltration

29
(Blackburn, et al., 1998). Ado levels were dramatically increased in 3 week old ADA-/-
mice compared to age matched normal congenic mice. However, administration of
ERT or genetically restoring ADA expression to the forestomach prevented
accumulation of Ado and ensuing pulmonary insufficiency (Blackburn, et al., 2000).
These mice can be rescued from certain death with ERT using PEG-ADA (Blackburn,
et al., 2000), with HSCT (Mortellaro, et al., 2006: Carbonaro, et al., 2008), with ex vivo
gene transfer using either retroviral (Carbonaro, et al., 2006) or lentiviral vectors
expressing human ADA (Mortellaro, et al., 2006), or with in vivo gene transfer using
direct intravenous injection of a lentiviral vector expressing human ADA (Carbonaro, et
al., 2006).

SCID Phenotype In ADA-Deficient Mice
Prior to death, untreated ADA-deficient mice also have profound lymphopenia and
drastically reduced serum immunoglobulins, both characteristic of a SCID phenotype
(Blackburn, et al, 1998). Gross examination of the thymus and spleen of ADA deficient
mice (d14-18) reveals lymphoid organs that are drastically reduced in size and
cellularity (Apasov, et al., 2001; Aldrich, et al., 2003). Thymic structure is characterized
by a disruption of thymic demarcation between the cortex and medulla, and a lack of
Hassel’s corpuscles (Blackburn, et al., 1998). The thymocytes that are present are
blocked at the double negative stage (CD4- CD8-), and are accompanied with
respective decreases in single positive (CD4+, CD8+) and double positive thymocytes
(CD4+CD8+) (Blackburn, et al., 1998; Apasov, et al., 2001). Splenic structure is also
dramatically disrupted, with a decrease in red cells in the red pulp, disorganized white
pulp populated with few megakaryocytes, and virtually non-existent germinal centers

30
(Blackburn, et al., 1998; Aldrich, et al., 2003). The lack of germinal center formation
prevents antigen-dependent B cell maturation in the spleen and points to a profound
intrinsic defect within the B cell compartment that is independent of the lack of CD4 T
cell help normally seen in SCID (Aldrich, et al., 2003). Disturbances are also seen in
other lymphoid structures. Specifically, in the gut-associated lymphoid tissue (GALT),
Peyer’s Patches are structurally intact but lack germinal centers (Xu, et al., 2000).
High doses ERT (analogous to human ERT) can restore lymphocytes in the thymus
and spleen, but not in Peyer’s Patches (Blackburn, et al., 2000; Xu, et al., 2000).

Among the tissues examined, dAdo accumulation was highest in the thymus and
spleen. Substrate analysis revealed that dAdo was 500 fold higher and dATP was 80
fold higher in the thymus of the ADA -/- mice than in age-matched congenic mice,
implicating dAdo accumulation in the lymphotoxicity observed in ADA-/- (Blackburn, et
al., 1998). Indeed, analysis of thymocyte populations in situ revealed extensive
clusters of apoptotic T cells in ADA-/- mice when compared to ADA+/- littermates,
although no difference were seen in the number of apoptotic cells in the spleen and
lymph nodes (Apasov, et al., 2001). Accumulation of dAdo in the spleen was 200 fold
higher than in the normal mice, however, there was less formation of dATP than in the
thymus (Blackburn, et al., 2000). Nevertheless, dATP formation was much higher in
the spleens of ADA deficient mice compared the bone marrow, where there was no
difference in dATP formation, marrow cellularity or in B cell lymphopoiesis. The
increase in splenic dATP was correlated with the impairment of germinal center
formation, antigen dependent B cell maturation, and B cell memory generation, as well
as an increase in B cell apoptosis (Aldrich, et al., 2003). Murine fetal thymic organ

31
cultures (FTOC), an in vitro model for thymocyte development, have been used to
study ADA deficient thymocyte development under conditions of substrate
accumulation. ADA inhibition with 2’-deoxycoformycin (dCF) or the use of ADA
deficient thymi (E14-15) caused a development block of thymocyte populations
between DNIII (CD4-CD8-CD25+CD44low) or DNIV (CD4-CD8-CD25-CD44low),
consequently failing to pass development checkpoints and undergoing apoptosis.
These events were mediated by dATP generation from the accumulation of dAdo
during apoptosis after thymocytes failed the #-selection checkpoint. The accumulation
of dATP and dAdo were reversible, to some degree, by the targeted deletion of Apaf-1,
over-expression of bcl2, or with the addition of a pan-caspase inhibitor (Thompson, et
al, 2000). Later studies examined the consequences of ADA deficiency on later stages
of thymocyte development by using dCF to inhibit ADA in normal thymi or using DP
thymocytes (E17) sorted from ADA deficient thymi. These studies showed ADA
inhibition or deficiency prevented the further development of DP thymocytes to the
mature SP (either CD4 or CD8) stage. The use of an adenosine kinase inhibitor that
prevents the phosphorylation of dAdo to dATP rescued thymic DP cultures by 60-200
fold and prevented mitochondria-dependent apoptosis associated with dATP
accumulation (Van De Wiele, et al., 2006). More recently, chimeric FTOC of human
ADA deficient thymocytes were shown to have reduced cellular expansion and
differentiation, especially in mature thymocytes due to accumulation of dATP and
apoptosis. The use of adenosine deoxycytidine kinase inhibitors restored thymocyte
differentiation and proliferation (Joachims, et al., 2008).

32
Extracellular Substrate Accumulation And Adenosine Receptor Activation
Recent work suggests that there may be other mechanisms contributing to the
profound defects in lymphoid activation and proliferation observed in both ADA
deficient mice and humans, as well as to the severe pulmonary insufficiency observed
in ADA deficient mice (Hershfield, 2005; Cassani, et al., 2008). Ado, unlike dAdo, has
other physiological actions unrelated to lymphocyte survival and has been shown to be
important in signaling involved in neurotransmission, heart rate regulation, platelet
aggregation and inflammation. Ado signaling is mediated by Ado ligand binding of four
types of G-protein coupled Ado receptors (AR), classified as A1, A2A, A2B, and A3,
according to their affinity for Ado and their ability activate adenylate cyclase. AR A1
(high Ado affinity) and AR A3 (low Ado affinity) inhibit the activation of adenylate
cyclase, whereas AR A2 (low Ado affinity; 2A 100 fold higher Ado affinity than A2B)
activate adenylate cyclase and cAMP (Palmer and Stiles, 1995). dAdo can also
activate AR 2A, but with 1000 fold less affinity than Ado (Fredholm, et al., 2001). Both
Ado and dAdo are freely transported across the cell membrane, and the extracellular
accumulation of ADA substrates may be as important as the intracellular accumulation
in the pathophysiology observed in ADA deficient SCID (Hershfield, 2005).

Ligand binding to adenosine receptors (AR) has consequences on T and B cell
responses to antigen-receptor engagement (Hershfield, 2005). Ado activation of AR
A2A has shown to be immunosuppressive by decreasing T cell activation and
proliferation (Huang, et al., 1997) and Il-2 production (Mirabet, et al., 1999). The
activation of adenylate cyclase and cAMP results in increased activation of Protein
Kinase A (PKA) and decreased activation of NF-$B, a transcription factor that supports

33
survival, proliferation and differentiation of immature lymphocytes and sustains their
survival after antigenic stimulation (Ruland and Mak, 2003). In BCR-stimulated murine
B cells, as well as LPS and TLR4 stimulated B cells, exogenous Ado was shown to
inhibit NF-$B activation, via AR A2 elevation of cAMP and PKA. The elevated levels of
PKA blocked the phosphorylation of I$B required for NF-$B activation and may cause
BCR-stimulated B cells to become anergic (Minguet, et al., 2005). Similarly,
exogenous Ado acting through AR A2 was associated with less T cell receptor (TCR)
activation in mature murine T cells in vitro (Asapov, et al., 2000) and less TNF-induced
NF-$B activation of Jurkat cells (Majumbar and Aggarwal, 2003). Despite differences
in the relative amount of AR expression between mice and humans, the role of NF-$B
in T cell activation was not restricted to murine lymphocytes (Lukashev, et al., 2003).
Recent analysis of human ADA deficient T cells showed defects in TCR/CD28
proliferation and cytokine production was associated with reduced Zap-70
phosphorylation, Ca++ flux, ERK1/2 signaling, and defective CREB and NF-$B
transcriptional events. Exogenous dAdo exacerbated the inhibition of T cell activation
via aberrant A2A signaling and PKA activation, suggesting that the extracellular effects
may be relevant to the pathophysiology of ADA deficiency. These effects were
reversed after the same patients were given HSC gene therapy with a retroviral vector
expressing huADA (Cassani, et al., 2008).

And lastly, it is important to understand that the loss of ADA expression affects both the
intracellular and extracellular isoforms of ADA. As discussed earlier, ADA can localize
at the T cell surface through interactions with CD26/DPPIV to form LADA or ecto-ADA,
and may have co-stimulatory function (Morimoto, et al., 1998). It has been shown that

34
ecto ADA may be important in potentiating T cell proliferation in co-cultures with
antigen pulsed, dendritic cells (DC) within the immunological synapse. Furthermore, it
was shown that ecto-ADA associates with AR A2B on the DCs, possibly to limit the
amount of Ado engagement with the AR, and with the CD26 on the lymphocyte
(Pacheco, et al., 2005). More recently it was shown in cells over-expressing CD26,
that ecto-ADA was essential for regulating the extracellular Ado levels and AR 2B
engagement (Sharoyan, et al., 2006). Saturating the CD26 with ecto-ADA in the
presence of extracellular Ado resulted in decrease AR engagement and decreased
cAMP, whereas, treatment with dCF, a ADA inhibitor, resulted in Ado engagement of
the AR and increased cAMP (Hashikawa, et al., 2004). Although, it is not clear how
the combination of accumulating intracellular substrates, Ado mediated activation of
ARs and the loss of ecto-ADA collaborate to produce the pathophysiology associated
with the loss of ADA expression, each should be considered a tenable component.

Tissue-specific Phenotype in ADA-Deficient Mice
The biggest point of departure between the murine and human disease in ADA
deficiency is the lethality of the knockout and lung insufficiency. The tissue-specific
requirement for ADA enzyme activity appears to be different in the mouse compared to
the human. Indeed, there are differences in the organization of the regulatory
elements controlling the amount of tissue-specific ADA expression (Dusing, et al.,
1994). Like in the human ADA promoter, the mouse ADA promoter lacks a CAAT box
and is TATA-less . However, the promoter sequence in mice is closer to TATA
consensus sequence than in humans and does require the binding of TFIID. Both the
human and murine promoter UTR contains Spe1 binding sites. Sp1 binding is required

35
at the proximal site and at other more distal sites to upregulate tissue-specific
expression levels (Innis, et al., 1991). However, in the mouse some tissues that are
most affected by ADA deficiency, the upper gastrointestinal track, the placenta and the
thymus, have the highest levels of Sp1; and others like the lung and liver, have the
lowest concentration of Sp1, suggesting other forms of regulation (Dusing, et al.,
1994). It is also possible that the affects of intracellular and extracellular substrate
accumulation associated with ADA deficiency are different in the mouse compared to
the human. For example, regulated adenosine mediated signaling through adenosine
receptors seems to be very important in maintaining lung homeostasis in the mouse.
Thus, it appears that phenotypic differences arise on multiple levels (regulation of
expression, substrate concentration, signaling) and that it is not possible to say what is
specifically responsible for making the murine experience different from the human
experience. The next few sections will examine those differences in more detail.

Pulmonary Insufficiency In ADA-Deficient Mice
ADA deficient mice die between day 19-20 of a severe pulmonary insufficiency that is
associated with high levels of Ado in the lung (Blackburn, et al., 1998). The mice
develop features of chronic lung disease that includes eosinophilia and activated
macrophages, mucinous metaplasia and airway destruction (Blackburn, et al., 2000).
Many human ADA-deficient patients display the hallmarks of pulmonary insufficiency
and other chronic pulmonary conditions such as asthma and bronchial inflammation
(Hershfield and Mitchell, 2001). However, It is not clear if these symptoms are the
result a purine disturbance or the result of recurrent infections or both. ADA deficient
mice are housed in pathogen-free colonies and are not subject to the affects of

36
recurrent infections making it easier to discern the affects of the metabolic disturbance
alone. When ADA deficient mice were treated with ERT, Ado levels were reduced in
the lung, which prevented some aspects of the pulmonary insufficiency, suggesting
Ado is important in producing the lung phenotype (Blackburn, et al., 2000b). Indeed,
ADA deficient mice were used to show that elevated Ado was associated with
increased pulmonary inflammation, pro-fibrotic expression and collagen deposition
(Chunn, et al., 2005). Furthermore, IL-13 was strongly induced in ADA-/- mice and
caused Ado accumulation and augmentation of AR A1, A2B, and A3. In transgenic
mice over-expressing IL-13, the IL-13 induced an inflammatory and remodeling
response that caused respiratory failure and death. ERT was found to diminish the IL-
13 induced Ado accumulation, inflammation, fibrosis and alveolar destruction. And
finally, Ado alveoli concentration, and subsequent AR signaling, it was shown to be
important in regulating the activity of epithelial sodium channels (ENaC) and chloride
channels (cystic fibrosis transmembrane conductance channel, CTFR), necessary for
maintaining proper alveolar fluid regulation (Factor et al., 2007, reviewed in Krindler
and Shapiro, 2007).

Several studies have tried to determine the effects of accumulated Ado, specifically in
terms of extracellular Ado mediated activation and signaling of the ARs. AR
antagonists and AR knockout mouse models (alone or on the ADA-/- background)
have been used to delineate the role of the various ARs in producing the pulmonary
inflammation and airway destruction observed in ADA deficient mice (Sun, et al., 2006;
Morschi, et al., 2008). When AR A3 activity was ablated, with either an antagonist or
genetically ablated on the ADA-/- background, there was a decrease in the migration of

37
eosinophils from the periphery to the lung and reduced mucus production (Young, et
al., 2004). Although the mice still required ERT to live, these results suggested that AR
A3 played a role in the eosinophilia. When ADA-/- mice were treated with an AR A2B
antagonist, the mice showed less pulmonary inflammation, fibrosis, and alveolar
airspace enlargement, as well as reduced proinflammatory cytokines and chemokines
(Sun, et al., 2006). These two studies suggest a role for extracellular Ado mediated
activation of AR A3 and AR2B in producing the pulmonary insufficiency observed in
ADA-/- and perhaps in their human counterpart.

Heptocellular Damage In ADA-Deficient Mice
Without exception, ADA-/- die perinatally of heptocellular damage characterized by
severe liver cell degeneration that is associated with modest accumulations of Ado,
dAdo and dAXP (Migchielsen, et al., 1995; Wakamiya, et al., 1995). More remarkable
was that AdoHyc hydrolase was inhibited by 85% and AdoHyc was 5-6 fold above
normal (Migchielsen, et al., 1995). Similar to ADA-/- mice, an ADA-deficient patient
was found to have neonatal jaundice and elevated serum aminotransferase
concentrations that were associated with enlarged hepatocytes and biliary stasis
(Bollinger, et al., 1996). Administration of 10ug/g dCF, an ADA inhibitor, to mice
induced spotty liver necrosis and hemorrhage (Ratech, et al., 1985). However, when
mice were treated dCF and ectopic dAdo, the necrosis was fatal (Renshaw and
Harrap, 1986). A patient receiving dCF and an analog of dAdo for the treatment of
leukemia also developed acute hepatic necrosis that was associated with AdoHyc
accumulation (Hershfield, et al., 1983). Hershfield points out that it is important to
remember ADA deficiency may be hepatotoxic; especially if patients are being

38
conditioned for HSCT with hepatotoxic cytoablative drugs (Hershfield, 1997). This
assertion could also be applied to patients receiving cytoreductive conditioning and
discontinuation of ERT in preparation for gene therapy. These patients could have a
rapid accumulation of hepatotoxic substrates and metabolites with drastically reduced
plasma ADA, not unlike the patient treated dCF and the dAdo analog. Therefore, it will
be important to monitor liver enzymes before and after cytoreductive conditioning for
gene therapy.

Gestation In ADA-Deficient Mice
Many phenotypes observed in ADA deficient mice are observed in human ADA
deficient patients (Blackburn, et al., 1998). However, there are some abnormalities
that are either less severe or less defined in one or the other or simply not shared at
all. ADA deficient mice clearly display some multi-system defects that are not
compatible with life. An example of a phenotype that is less defined in humans and
lethal in mice would be the severe lung phenotype (Blackburn, et al., 2000). An
example of a phenotype not shared, is the apparent requirement for ADA during
gestation (Knudsen, et al., 1991; Blackburn, et al., 1997). The mere fact that ADA
deficient patients are born illustrates that ADA is not a requirement for gestation in
humans as it is in mice. ADA deficient mice not carrying the trophoblast specific ADA
expression cassette (Tg+) die prenatally of hepatocellular damage (Wakamiya, et al.,
1995; Blackburn, et al., 1995: Migchielsen, et al., 1996). However, even when the
ADA mice are homozygous Tg+, a multi-system deficit remains. Male ADA-/-Tg+ can
breed successfully when rescued with either ERT, HSCT or gene transfer ex vivo or in
vivo. In contrast, female ADA -/-Tg+ mice, rescued with ERT, do not produce pups

39
when crossed to male ADA-/-Tg+ or ADA+/-Tg+ mice. Furthermore, the same female
ADA-/-Tg+ mouse, rescued with either HSCT or with gene transfer, will not produce
pups when crossed with a rescued male ADA-/-Tg+ but will produce ADA+/-Tg+ pups
only and the litter size is half (3-5 pups) the expected size (6-10 pups) when crossed
with an ADA+/-Tg+ (n=5). According to Mendelian genetics, the litters should be 50%
ADA-/-Tg+ and ADA+/-Tg+. The loss of the ADA-/-Tg+ pups (~50%) suggests the
Tg+ is not enough to sustain the pups when the dam is a rescued ADA-/-Tg+ female,
highlighting the gestational requirement for ADA (Carbonaro, unpublished
observations). ERT with PEG-ADA has increased the number of females of child
bearing age. In the unlikely event a ADA-/- female becomes pregnant and is carrying
an ADA-/- fetus (mated to +/- male), it is not clear if this child would be carried to term.

HSCT Of The ADA-Deficient Mice
Neonatal HSCT was performed in ADA -/- and their ADA+/- littermates to determine
engraftment prior to ERT which would be necessary for survival past day 20. Each pup
received 5 x 10^6 congenic ADA+/+ marrow cells and no cytoreductive conditioning.
Transplanted ADA-/- mice had long-term survival, with multisystem correction with near
normal lymphocyte counts and mitogenic responses. However, engraftment was not
lymphoid specific, with 1-3% of T, B, myeloid cells donor derived. In fact, donor
chimerism was higher in the lung than the thymus, spleen and bone marrow. Despite
the higher chimerism in the lung, Ado levels remained elevated. Only when the
neonates were subjected to increasing doses of total body irradiation (TBI; 100-400
cGy) were there modest increases in hematopoietic engraftment. As an added
experimental control, the murine model for X-linked SCID, the common gamma C

40
knockout, was used as a representative model for a lymphoid intrinsic defect.
Neonates received 5 x 10^6 congenic marrow cells and no cytoreductive conditioning;
engraftment was lymphoid specific, and 90-100% of the T cells and 50% of the B cell
were donor derived. There were very few donor derived myeloid cells. These results
indicated that restoration of immune function occurred by rescue of the endogenous
ADA-deficient lymphocytes through cross-correction from the engrafted ADA-replete
donor cells (Carbonaro, et al., 2008).

In another study, HSCT was evaluated against HSC lentiviral transduction for
correction of the ADA-deficient SCID phenotype (Mortellaro, et al., 2006). Neonates
receiving 5-7x10^6 ADA+/+ marrow cells and conditioned with a split dose of 300 cCy
TBI, had 80% total engraftment 17 weeks after transplant and complete correction of
phenotype and metabolic disturbances. Young adult ADA-/- were transplanted with 15
x 10^6 ADA+/+ marrow cells after conditioning with a cytoreductive dose of 600 cGy.
Donor engraftment peaked at nearly 90% at week 7 and fell to 50% by week 28.
Engraftment was accompanied by increases in RBC ADA activity and decreases in
dAXP levels, compared to untreated mice (Mortellaro, et al., 2006). The combination
of a non-lethal dose of TBI and the increased cell dose resulted in much higher levels
of engrafted donor cells; however, the graft was still lymphoid non-specific. Taken
together these results indicate that when the genetic defect is not specific to lymphoid
cells as it is in the murine model for X-linked SCID, there may be multilineage
engraftment.

41
Retroviral Mediated Gene Therapy In ADA-Deficient Mice
In ongoing clinical gene therapy trials for ADA-deficient SCID, clinical benefit has been
observed with the current protocol of discontinuing ERT and conditioning with a
nonmyeloablative dose of busulfan prior to re-infusion of retrovirally transduced
autologous CD34+ cells. Prior clinical trials did not discontinue ERT and there was no
cytoreductive conditioning to ‘make space’ for re-infusion of the transduced cells,
resulting in very low engraftment of transduced cells and provided no clinical benefit
(Aiuti et al., 2009). Since the patients remained on ERT, it was hypothesized that there
was no selective advantage for the engraftment and expansion of the corrected cells.
However, it is not clear if removal of ERT or cytoreduction provides the most clinical
benefit or if it is the synergy of both. In an effort to delimit the role of these two
variables, ADA-/- mice were conditioned with either 200 cGy or 900 cGy and
transplanted with 5x10^6 transduced ADA-/-marrow cells, and were either maintained
on ERT or not. Those mice receiving the higher TBI dose (900 cGy) had 100 fold more
marked cells than those mice receiving the lower TBI dose (200 cGy). However, there
was no difference in the amount of proviral marking between those mice remaining on
ERT and those mice not remaining on ERT, and, in fact, in those mice receiving 200
cGy and remaining on ERT, thymic CD4+/CD8+ cells had 10 fold more proviral copies
than those mice not remaining on ERT (Carbonaro, et al., 2006). Given that the DNA
isolated from mice on ERT contains DNA from ADA corrected and uncorrected cells,
effectively diluting the corrected cell DNA, this is a remarkable finding. These results
suggest cytoreductive conditioning is the more relevant variable in providing clinical
benefit to ADA-deficient patients.

42
Lentiviral Mediated Gene Therapy In ADA-Deficient Mice
Lentiviral vectors are being developed for a number of clinical applications. These
vectors have several distinct advantages over the gamma-retroviral vectors being used
in the current clinical trials for ADA SCID. First, lentiviral vectors are capable of
transducing more quiescent populations since they do not require disintegration of the
nuclear envelope for entry into the nucleus and integration of the viral genome. The
ability to transduce non-dividing cells means less cytokine stimulation is required,
potentially reducing the risk of HSC terminal differentiation. Furthermore, those
populations shown to be largely resistant to cytokine stimulation are more susceptible
to lentiviral transduction (Uchida, et al., 1998; Case, et al., 1999). Trans- and cis-
acting elements are responsible for entry into the nucleus. Trans-acting viral proteins
contain nuclear localization signals to direct the pre-integration complex (PIC) to the
nuclear pores (Bukrinsky, et al., 1993). A cis-acting element, the central polypurine
tract (cPPT) acts as a triple DNA flap that targets the PIC to the nuclear pore (Zennou,
et al., 2000). The second important advantage is that the current generation of lentiviral
vectors self-inactivates (SIN) the viral enhancer/promoter because there is a deletion at
in the U3 region in the 3’ LTR that is copied during replication at the 5’LTR (Zuffrey, et
al., 1998). This deletion is important in reducing the chance of transactivating or
dysregulating an oncogene or tumor suppressor gene upon integration in the host cell
genome, as happened in the transactivation of the LMO2 oncogene in gene therapy
trials for X-linked SCID (Hacein-Bey, et al., 2003). The inactivation of the viral
promoter also allows for the use of a tissue specific or a weaker promoter to drive
expression of the transgene (Logan, et al., 2002). Thus, it is not surprising that ADA

43
expressing lentiviral vectors are being evaluated for safety and efficacy in pre-clinical
trials.

The murine model offers an obvious choice in which to test these newly developed
vectors. To test the efficacy of ex vivo lentiviral mediated gene transfer, ADA-/- mice
were transplanted with ADA-/- bone marrow cells transduced with a SIN lentiviral
vector expressing human ADA form the murine phosphoglycerate kinase (PGK)
promoter. Specifically, marrow was harvested from ADA-/- mice at 2 weeks of age and
RBC depleted marrow was transduced with a lentiviral vector expressing human ADA
in the presence of SCF, FLT-3, IL-6, IL-3 and Tpo. ADA-/- recipients were conditioned
with 600 cGy before receiving 15x10^6 cells. Engraftment of the transduced donor
cells was multi-lineage and donor chimerism was ~30% with an average copy number
of 14 copies per donor cell. Those mice receiving less donor cells (~14% engraftment)
and having lower copies per donor cell (0.11) died within one month. When mice had
long-term survival (4 mo), the levels of erythroid dAXP were normalized, despite a drop
in ADA RBC levels to below those measured in ADA+/- mice. Gene transfer of a
lentiviral vector restored lymphocyte differentiation and immune function, including
antigen-specific antibody responses (Mortellaro, et al., 2006). These studies showed
that lentiviral vectors could be utilized in the current clinical gene therapy protocols.

In a very different approach, lentiviral vectors expressing human ADA were used to
correct neonatal mice with in vivo gene transfer. Neonatal mice were given a single
intravenous injection of l.0 x 10^11 TU/kg of lentiviral vector. Mice given this dose
have long-term survival due to amelioration of the lethal lung insufficiency and normal

44
lymphocyte counts and function. Those mice receiving 10 fold less vector did not
survive. As expected with intravenous delivery, most of the proviral copies were found
in the liver. There was very little marking in the lymphoid tissues, and no evidence of
progenitor or HSC transduction by secondary transplantation of primary recipients.
Mice that received intravenous vector and were started on ERT had no differences in
proviral marking in all tissues analyzed. ADA activity was highest in the liver, and it is
presumed that there was correction in trans of circulating lymphocytes (Carbonaro, et
al., 2006). This novel approach is non-invasive and could provide for treatment even
for a child that is critically ill and not well enough for ex vivo gene therapy or who is
currently receiving ERT.

Is The Murine Model Relevant To Current Clinical Research?
It is clear that the murine ADA gene knockout model of ADA deficiency does not model
the human presentation of ADA-deficiency in all respects. For one, knockout of the
ADA gene in mice results in perinatal death caused by severe hepatocellular damage
(Migchielsen, et al., 1995; Wakamiya, et al., 1995). When ADA expression is restored
to placental trophoblasts during gestation, ADA-/- pups are born but die 20 days later
of severe pulmonary insufficiency (Blackburn, et al., 2000b). In humans, the
presentation of the immune deficient SCID phenotype is the diagnosing feature and the
source of morbidity (Hershfield, 1998). The ADA-/- mouse is not born with pan-
lymphopenia and thymic dysfunction, but develops it in the 2-3 weeks before dying
(Blackburn, et al., 1998). It is not clear if humans develop a lung phenotype, given
those ADA deficient patients suffering from chronic lung inflammation or obstruction
usually had a long history of respiratory infection which could make lung pathology

45
associated with purine disturbances difficult to isolate. Humans and mice do share
other phenotypic abnormalities such as skeletal and renal abnormalities, as well as
profound metabolic disturbances in purine metabolism that does result in a SCID
phenotype (Blackburn, et al., 1998).

Beyond the shared SCID phenotype, it has been difficult to determine how relevant the
ADA-deficient mouse models ADA-deficient patients. It has been shown that ADA-
deficient patients with a naturally occurring reversion of the mutant allele in a single
precursor, can have the entire T cell compartment replaced with progeny from the
corrected precursor, demonstrating a strong selective advantage for the
normal/normalized cells (Hirschhorn, et al., 1981; Ariga, et al., 2001). However, in
ADA-deficient mice, experimental evidence suggests that corrected T cells do not have
a selective advantage. At first glance, it appears the ADA-deficient mouse is not a
good model of human ADA-deficient SCID. But, a quick review of the evidence may
suggest a different conclusion.

HSCT and GT can be a curative treatment for ADA-deficiency in humans and mice.
ADA-deficient patients receiving HSCT without cytoreductive conditioning have very
low HSC engraftment and little evidence of multi-lineage expansion, but there is
enough donor T cell expansion to replace the entire T cell compartment (Hirschhorn, et
al., 1981). ADA-deficient patients receiving GT without cytroreductive conditioning and
receiving ERT have low engraftment of transduced cells and very little evidence of
multi-lineage expansion, but there is some expansion of T cells arising from corrected
autologous T cells with decreasing ERT (Aiuti, et al., 2002b; Kohn, et al., 1998).

46
However, when ADA-deficient patients are given a moderate dose of a myeloablative
agent and ERT is discontinued prior to receiving GT, there is more engraftment and
multi-lineage expansion, however, the expansion is more lymphoid specific with 90% of
T cells and 50% of B cells arising from corrected precursors (Aiuti, et al., 2009a). In
the murine model of ADA-deficiency, however, when ADA-/- are given HSCT without
cytoreductive conditioning, engraftment is very low (<5%), and there is no evidence of
lymphoid specific expansion (Carbonaro, et al., 2008). When cytoreductive
conditioning is used, there is improved engraftment (<20%)and multi-lineage
expansion, but still no evidence of lymphoid specific expansion (Mortellaro, et al.,
Carbonaro, et al., 2008). Likewise, when ADA-deficient mice are given moderate
conditioning without ERT (200cGy) and ADA-/- marrow cells transduced with a high
expressing human ADA vector (MND-ADA), there is low engraftment and multi-lineage
expansion that is not lymphoid specific, and even more so with a higher cytoreductive
dose (900 cGy) (Carbonaro, et al., 2006). If given a lower dose of conditioning (600
cGy) and ADA-/- marrow cells transduced with lower expressing ADA vector (PGK-
ADA), there is lower engraftment but there is lymphoid specific expansion (Mortellaro,
et al., 2006). Although these findings may appear to be inconclusive, a consistent
pattern does emerge.

There appears to be a relationship between the amount of enzyme activity per kg and
the nature of engraftment. If either mice and humans are given a treatment that results
in a less amount ADA enzyme activity per kg, the engraftment and expansion of
corrected cells will be more lymphoid specific. If the treatment results in more ADA
enzyme activity per kg, the engraftment and expansion of corrected cells will be more

47
multi-lineage and less lymphoid specific. For instance, human ADA-deficient patients
receive a much lower HSCT dose per kg (1-2 magnitudes) than in HSCT studies
conducted in the ADA-deficient mice resulting in lymphoid specific engraftment and
expansion in humans and multilineage engraftment in mice (Carbonaro, et al., 2008;
Fischer, et al., 1990; Buckley, et al., 1999). Likewise, it is important to recognize in
HSCT 100% of the engrafted cells are corrected, whereas in HSC GT, ~15-50% of the
progenitors are corrected (Aiuti, et al., 2009). These figures do not include the
variability associated with engraftment of transduced cells and maybe less than 1% of
the corrected HSC engraft. Thus, there is even less ADA expression per kg with
current GT protocols and the engraftment and expansion is lymphoid specific (Aiuti, et
al., 2009). In the mouse, when transduction rates approach 75-90%, there is
multilineage engraftment. Taken together, these data suggest that with more ADA
expression there will be more cross correction or correction in trans of non-corrected
cells and the graft will look less lymphoid specific.

The best example of non-specific cross correction is ERT, where there is correction of
multiple systems and tissues in both humans and mice (Hershfield, et al., 1987;
Weinberg, et al., 1993; Blackburn, et al., 2000a). Likewise, a single intravenous
injection of a lentiviral vector expressing ADA, results in very high levels of ADA
expression in the liver that presumably corrects all blood cell lineages in trans
(Carbonaro, et al., 2006). Thus it seems that the more ADA expressed, the more likely
there will be cross correction of uncorrected cells in all lineages, and any selective
pressure is negated. More often experimental conditions in the mouse are designed
to promote correction of the lethal pulmonary insufficiency and survival. Once there is

48
adequate ADA expression for survival, there appears to be adequate ADA expression
for correction in trans of all blood cell lineages, thus negating the selective pressure on
the T lymphoid cells. Thus, it may look like there is no selective advantage in mice,
when in fact we cannot reproduce the conditions to see the selective advantage.

It is not clear how the murine experience relates to the human experience. It is clear
the mouse is not a small human and there are inherent differences that cannot and
should not be ignored. Despite these differences, the inference is there are profound
metabolic disturbances associated with ADA deficiency in the mouse and human, and
thus it is reasonable to expect the murine experience and human experience will have
similar attributes in their pathology and in the kinetics and mechanism of correction.
Therefore, if there are improvements in the HSCT and GT approaches to human ADA
SCID, such that level of correction approaches the level of correction in the mouse,
then the human and murine experience may, indeed, be relevant to each other.

49
Chapter 2.
Neonatal Bone Marrow Transplantation Of The Murine
Model of ADA-Deficient SCID

ABSTRACT
Adenosine deaminase (ADA)-deficient severe combined immune deficiency (SCID)
may be treated by allogeneic hematopoietic stem cell transplantation without prior
cytoreductive conditioning, although the mechanism of immune reconstitution is
unclear. We studied this process in a murine gene knock-out model of ADA-deficient
SCID. Newborn ADA-deficient pups were transplanted by intravenous infusion of
normal congenic bone marrow, without prior cytoreductive conditioning, that resulted in
long-term survival, multi-system correction, and nearly normal lymphocyte numbers
and mitogenic proliferative responses. Only 1-3% of lymphocytes and myeloid cells
were of donor origin without a selective expansion of donor-derived lymphocytes;
immune reconstitution was by endogenous, host-derived ADA-deficient lymphocytes.
Pre-conditioning of neonates with 100-400 cGy of total-body irradiation prior to normal
donor marrow transplant increased the levels of engrafted donor cells in a radiation
dose-dependent manner, but the chimerism levels were similar for lymphoid and
myeloid cells. The absence of selective reconstitution by donor T lymphocytes in the
ADA-deficient mice indicates that restoration of immune function occurred by rescue of
endogenous ADA-deficient lymphocytes through cross-correction from the engrafted
ADA-replete donor cells. Thus, ADA-deficient SCID is unique in its responses to non-
myeloablative bone marrow transplant, which has implications for clinical BMT or gene
therapy.

50

Introduction
Adenosine deaminase (ADA)-deficiency causes 15-20% of human severe combined
immunodeficiency (SCID), most notably resulting in a profound pan-lymphocytopenia
(Hershfield, and Mitchell, 2001). Without treatment, most SCID patients die within the
first years of life as a result of viral or bacterial infections. The current standard of care
for ADA-deficient SCID with an HLA-matched sibling donor, is bone marrow
transplantation, without prior marrow cytoreductive conditioning (Small, et al., 2004;
Buckley, et al., 1999). Allogeneic transplantation with unfractionated, whole marrow
from an HLA-matched sibling into an unconditioned SCID recipient usually results in
complete and enduring restoration of immunity. The exact mechanisms by which non-
myeloablative allogeneic transplantation leads to immune reconstitution in SCID are
not fully understood. Typically, very low levels of donor cell engraftment in the bone
marrow are present, but essentially normal levels of donor lymphocytes are found in
the blood and central lymphoid sites (van Leeuwen, et al., 1994; Tjonnfjord, et al.,
1994; Haddad, et al., 1999). These observations have led to the concept of “selective
engraftment/expansion” of genetically normal T lymphocytes or progenitors in SCID
patients from the few donor stem or progenitor cells that engraft.

We used a murine model of ADA-deficient SCID to characterize the effects of the
transplantation of congenic normal bone marrow. Knock-out of the ADA gene in
mice caused perinatal mortality from hepatocellular damage, but crossing-in an ADA
transgene expressed exclusively in placental trophoblasts allowed survival through
gestation (Wakamiya,

et al., 1995; Migchielsen, et al. 1995; Blackburn, et al., 1995).

51
However, ADA is required for post-natal life as well, and the ADA-deficient pups die by
the fourth week of life from severe pulmonary insufficiency (Blackburn, et al., 2000).
Treatment of ADA-deficient mice with enzyme replacement therapy (ERT) by chronic
administration of a clinical preparation of pegylated bovine ADA (PEG-ADA) begun
shortly after birth or by “in vivo gene therapy” using intravenous injection of a lentiviral
vector expressing ADA into neonates will keep the mice alive for more than 6 months,
with partial restoration of immunity (Blackburn, et al., 2000; Carbonaro, et al., 2006).
Mortellaro, et al. (2006) recently reported successful immune restoration in ADA-
deficient mice by transplantation of bone marrow corrected by transduction with an
ADA lentiviral vector, following fully cytoablative conditioning.

To model the transplantation of ADA-deficient SCID patients with HLA-matched sibling
donors without the use of cytoreductive conditioning, we transplanted neonatal ADA-
deficient mice by intravenous infusion of normal, ADA replete, donor bone marrow
without cytoreductive treatment. These mice had prolonged survival, with significant
immune restoration, but only low levels of donor cell engraftment. Unexpectedly, there
was no selective expansion of donor lymphocytes, relative to myeloid engraftment,
contrary to typical findings in SCID patients transplanted without cytoreduction. These
findings suggest that the mechanisms of immune restoration after non-myeloablative
transplantation in ADA-deficient SCID may be novel.

Materials and Methods
Mice. A murine model of ADA deficiency (background of 129/Sv and FVB/N) was
generated and characterized by the Kellems group

(Blackburn, et al., 1998). When

52
ADA ERT was administered, weekly intramuscular injection of 300 U/kg of ADA-GEN
(Enzon Pharmaceutical, Piscataway, New Jersey) were given. Mice were housed in
accordance with IACUC (Saban Research Institute at Childrens Hospital Los Angeles)
and the National Institutes of Health guidelines. All animals were handled in laminar
flow hoods and housed in micro-insulator cages in a pathogen-free colony.

Neonatal bone marrow transplantation (BMT). Neonatal BMT was described by
Sands et al. (1999). Congenic normal (+/+) donor mice were euthanized with CO
2

narcosis. Femurs and tibias were harvested and washed in sterile Hanks Balanced
Salt Solution without phenol red (HBSS). Under aseptic conditions, marrow was
flushed from the femur, tibia and humerus bone using a 23 g needle and 1 cc syringe
filled with HBSS and centrifuged for 10 minutes at 800 x g at 10
o
C and re-suspended at
5.0 x 10^7 cells/ml in injectable 0.9% sodium chloride (Hospira, Inc., Lake Forest, IL).
Neonates (1-3 days old) were injected via the superficial temporal vein with 100 ul (5.0
x 10^6 cells) using a 30 g needle. Pups were immediately returned to the dam.
Genotyping was performed as described (Wakamiya, et al., 1995; Carbonaro, et al.,
2006).

Cytoablative conditioning. Neonatal mice were transplanted either with or without
prior cytoablative conditioning by total body irradiation on the day of bone marrow
transplant (100, 200, or 400 cGy from a
137
Cesium source or busulfan (Sigma, St
Louis) was administered to the pregnant dam (15 mg/kg), 18 days post-coitus

(Yoder,
et al., 1996).

53
Chimerism. Chimerism of normal donor cells in the ADA-deficient mice was
determined by quantitative real-time PCR (qPCR), measuring the uninterrupted ADA
gene of donor cells against the background of the disrupted ADA gene in the knock-out
mice. DNA was extracted from peripheral blood samples using PURGENE KIT
(Gentra, Minneapolis, MN) and resuspended in Tris-EDTA (TE) buffer and from
thymus, spleen, bone marrow, liver and lung using Proteinase K digestion followed by
phenol/chloroform extraction and resuspended in TE.

A primer/probe set for qPCR was designed to detect the normal donor ADA allele. The
primer/probe set spanned the Aat1 site in exon 5, the site of ADA gene disruption by
insertion of the neomycin resistance gene: forward primer is: tccctcttcctctctccacaca,
the reverse primer is: cacagaatggaccggacctt and the Tamra probe is: FAM-
tcacccctgatgacgttgtggatcttg-Tamra. Another primer/probe set was used to quantify the
knock-out allele by measuring the neomycin resistance gene: forward primer is:
actgggcacaacagacaatcg, the reverse primer is: cctcgtcctgcagttcattca, and the Tamra
probe is: TET-aagaccgacctgtccggtgccc-Tamra. The primers were used at 400 nM and
the probe at 50 nM and all reactions were performed with 10 ng of template and
Universal Master Mix (Applied Biosystems, Inc (ABI); Fullerton, CA) in the 7700
Sequence Detector (ABI) under default conditions. All unknown samples were
compared to a standard curve constructed from mixtures (100%, 70%, 50%, 30%,
10%, 3%, 1%, 0.3%, 0%) of homozygote normal (+/+) tail DNA diluted in homozygote
ADA-deficient (-/-) tail DNA.

54
Analysis of recipients. Recipient mice were euthanized at 16 days, 60 days, 240
days after neonatal BMT and perfused with 15 ml of phosphate buffer solution (PBS).
The thymus, spleen, liver, and lung were harvested and cell suspensions were made
by pressing tissue through a 70 um sterile nylon cell strainer (BD Falcon #352350, BD
Biosciences, Bedford MA). Bone marrow was collected from femurs and tibias. Cell
isolation and immunophenotype analysis were done as described (Carbonaro, et al.,
2006).

Lymphocyte proliferative function was assessed by stimulating splenocytes with
concanavalin A (conA) for 48 hours, pulsing with
3
H-thymidine for 20 hours and
determining the stimulation index compared to cells not treated with conA. Proliferation
was also assessed in response to stimulation with lipopolysacharride (LPS; 10ug/m;
Sigma, St. Louis, MO)

(Stack, et al., 1999). B-cell function was also assessed in vivo,
by vaccination with Pneumovax 23 (Merck, Whitehous Station, NJ); 10ul in 100 ul of
injectable 0.9% sodium chloride (Hospira, Inc., Lake Forest, IL) was injected
intraperitoneal (Wardermann, et al., 2002). Pre-immune blood samples were collected
at 5 days prior to vaccination and post-immune samples were harvested eight days
post vaccination. All blood samples were collected into heparinized tubes and
centrifuged at 600 x g for 10 minutes. Sera were harvested and frozen at -20C. Sera
were analyzed by ELISA to Pneumovax 23 as described (Wardermann, et al., 2002).

Neonatal BMT in !c-knock-out mice. The !c (common cytokine receptor gamma)
gene knock-out mice (B6.129S4-Il2rg
tm1Wjl/J
) were purchased from Jackson
Laboratories (Bar Harbor, ME). Mice are on a C57/BL/6 strain background and are
CD45.1 (Ly5.1) allotype. Normal marrow donors were C576/SJL (Ly5.2). !c-knock-out
neonates were injected with 5 x 10^6 cells of unfractionated whole marrow, without

55
cytoreductive conditioning. Donor chimerism was determined by flow cytometry using
a PE conjugated anti mouse CD45.1 monoclonal antibody (#553776; BD Pharmingen,
San Jose, CA) to detect the CD45.1 donor cells.

ADA enzyme activity and substrate analysis. Mice were euthanized under
anesthesia, tissues were removed and frozen rapidly in liquid nitrogen. ADA enzyme
activity assay was performed as described (Blackburn, et al., 2000). Adenine
nucleosides were extracted from frozen lungs using 0.4 N perchloric acid as described

(Knudsen, et al., 1992), and adenosine and deoxyadenosine were separated and
quantified using reversed phase HPLC according to established procedures (Knudsen,
et al., 1992). Adenosine levels were normalized to protein content and values are
given as nanomoles of adenosine or deoxyadenosine per milligram protein.

Statistical analysis. Survivorship analysis was performed using the Kaplan-Meier
approach. Tests between groups were made using the log rank tests. Comparisons
between treatment groups over time (or using different conditions) were made using a
general linear model For the chimerism data, tissue types and treatments (normal,
untreated ADA-/-, ADA-/- BMT, ADA-/- ERT, ADA+/+) were the independent variables
along with all possible two-way interactions. Initially, a main-effects stepwise
procedure was used followed by inclusion of all additional two-way interactions that
reached statistical significance (p<0.05).

56
Results
ADA-deficient (ADA-/-) mice were treated by intravenous infusion of ADA-replete bone
marrow from congenic donors as a model of the clinical practice of non-ablated
transplant from HLA-matched sibling donors for patients with SCID. Because of the
early mortality in these ADA gene knock-out mice without treatment, BMT was
performed in the neonatal period, to potentially rescue them from lethality without
imposing other therapies (such as ERT) that could complicate analyses. Mice were
treated with a single dose of unfractionated, freshly isolated bone marrow, injected
intravenously (via the superficial temporal (facial) vein), between days 1 and 3 after
birth, without cytoreduction. Whole litters, homozygous ADA -/- mice and
heterozygous ADA +/- mice (ADA -/- males x ADA +/- females), were transplanted and
subsequently genotyped. Mice were analyzed at 16, 60 and 240 days after neonatal
Analysis of lymphocytes in spleens showed the untreated ADA-deficient mice to have
low numbers of B lymphocytes (CD19+) and T lymphocytes (CD4+ and CD8+)
compared to normal mice (Figure 2-1C). Neonatal BMT led to a significant
BMT. Transplanted mice showed signs of multi-system correction. Survival for a
cohort of mice that were maintained for at least one year after neonatal BMT without
further intervention was >83% (n=6).

Analysis of immune reconstitution. To characterize the effects of transplantation on
immune reconstitution, mice were analyzed at 16 days after birth, prior to death of
untreated ADA-deficient mice. The untreated ADA-deficient mice were severely
lymphocyte-deficient in thymus and spleen at day +16, compared to the age-matched

57

Figure 2-1. Immunophenotype and lymphocyte function at 16 days after
neonatal BMT. All mice were age-matched (16 days) in the experimental arms: (1)
ADA-/- (n=4), (2) ADA-/- ERT (n=4), (3) ADA-/- BMT (n=7), and (4) ADA+/+ (n=5),
Sub-populations were calculated by multiplying the total numbers of cells in the
thymus or spleen by the percentage of cells in each sub-population.* Significantly
higher than untreated ADA-deficient mice (p<0.001) **Significantly higher than
untreated ADA-deficient mice (p<0.007). (Mean+/-SEM).
A. Absolute numbers of thymocytes and splenocytes.
B. Absolute numbers in each thymocyte sub-population (CD4+; CD8+; double
positive (DP): CD4+/CD8+; double-negative (DN): CD4-/CD8-)
C. Absolute numbers in each splenocyte sub-population (CD4+; CD8+; CD19+)
D. Lymphocyte proliferative function was assessed by stimulating splenocytes with
concanavalin A (conA) for 48 hours, pulsing with
3
H-thymidine for 20 hours and
determining the stimulation index compared to cells not treated with ConA.

58
normal control mice (Figure 2-1A). In contrast, transplanted ADA-deficient mice
showed increased absolute numbers of thymocytes and splenocytes, with the number
of thymocytes significantly higher after BMT than in the untreated ADA-/- mice
(p<0.001). ADA-/- mice treated with PEG-ADA ERT, showed similar improvements in
lymphocyte numbers.

Analysis of T lymphocyte subsets in the thymus from untreated ADA-deficient mice
showed lower numbers of double negatives(DN; CD4-/CD8-), double positives (DP;
CD4+/CD8+ (p<0.001)) and single positives (CD4+ ( p<0.007) and CD8+(p<0.001))
compared to normal control mice (Figure 2-1B). The increase in the total thymocyte
population in the BMT recipients was highlighted by significant increases in the
numbers of single positive CD4+ (p<0.007) and CD8+ (p<0.007) cells and DP
CD4+/CD8+ (p<0.001) and DN CD4-/CD8- (p<0.007) cells. Similar findings were seen
in the ADA-deficient mice receiving ERT with PEG-ADA.

Analysis of lymphocytes in spleens showed the untreated ADA-deficient mice to have
low numbers of B lymphocytes (CD19+) and T lymphocytes (CD4+ and CD8+)
improvement in the number of splenic B lymphocytes (p<0.001), but smaller increases
in splenic T lymphocyte numbers. These responses were also seen in the mice
treated with PEG-ADA ERT. 3C). Thus, neonatal BMT without prior cytoreductive
conditioning led to partial restoration of lymphocyte numbers and function at 2 months,
similar to that achieved by chronic ERT.

59

Figure 2-2. Immunophenotype at 60 days after neonatal BMT.
The mice were age-matched (60 days) in the experimental arms: (1) ADA+/+(n=4),
(2) ADA-/- BMT (n= 6), and (3) ADA-/- ERT (n=7). Absolute numbers were
calculated by multiplying the total numbers of cells collected from the organ by the
percentage of cells in each sub-population. Data from the
ADA-/- with no treatment (at day 16) from Figure 2-1 are reproduced here as a
historical control.* Significantly higher than untreated ADA-deficient mice (p<0.001)
**Significantly higher than untreated ADA-deficient mice, or those treated with
neonatal BMT or ERT (p<0.001). (Mean+/-SEM).
A. Absolute numbers of thymocytes and splenocytes.
B. Absolute numbers in each thymocyte sub-population (CD4+; CD8+; double
positive (DP): CD4+/CD8+; double-negative (DN): CD4-/CD8-).
C. Absolute numbers in each splenocyte sub-population (CD4+; CD8+; CD19+).

60

Figure 2-3. Lymphocyte function at 60 days after neonatal BMT
The mice were age-matched (60 days) in the experimental arms. * Significantly
higher than untreated ADA-deficient mice (p<0.001) **Significantly higher than
untreated ADA-deficient mice, or those treated with neonatal BMT or ERT (p<0.001).
(Mean+/-SEM).
A. Lymphocyte proliferative function to conA (1) ADA+/+(n=4), (2) ADA-/- BMT (n=
6), and (3) ADA-/- ERT (n=7).
B. Lymphocyte proliferative function was assessed by stimulating splenocytes with
LPS for 48 hours, pulsing with
3
H-thymidine for 20 hours and determining the
stimulation index compared to cells not treated with LPS (1) ADA-/- BMT (n=5), (2)
ADA-/-ERT (n=2),(3) ADA+/+(n=2).
C. IgM production in response to vaccination with Pneumovax 23 in vivo. Pre-
immune sera were collected prior to vaccination and compared to sera collected 8
days post-vaccination. IgM production was assessed by ELISA. (1) ADA-/- BMT
(n=5), (2) ADA+/+(n=3).

61

To assess immune function, the mitogenic responses of splenocytes were measured
following stimulation with concanavalin A (conA) (Figure 2-1D). The ADA-deficient
mice had very low proliferative responses to conA and these were only slightly higher
in 16 day old mice treated with either neonatal BMT or PEG-ADA ERT.

For analysis at day 60, it was not possible to assess untreated ADA (-/-) mice since
they uniformly died in the first month; therefore, the same data from the untreated
ADA-deficient day +16 mice from Figure 2-1 are shown for comparison. At day 60, we
observed that ADA-deficient mice treated by neonatal BMT had significantly higher
levels of total thymocytes and splenocytes than untreated ADA-deficient mice historical
controls (p<0.001) (Figure 2-2A), with thymocyte CD4+, CD4+CD8+(DP) and CD4-
CD8-(DN) populations significantly higher than untreated ADA-deficient mice (p<0.001)
Figure 2-2B). The thymocyte DN cell population after BMT was significantly higher than
all treatment groups (p<0.001) including ADA+/+ mice and may suggest a partial
block in maturation. By day 60, splenic B cells numbers were not significantly
improved in ADA-deficient mice after BMT, nor with ERT, in contrast to numbers
observed at day 16. Splenic T lymphocytes (CD4+ and CD8+) were significantly
higher (p<0.001) than the untreated day+16 controls, but these were not at fully normal
levels (Figure 2-2C). The mitogenic responses of splenic T cells to conA (Figure 2-3A)
and splenic B cells to LPS (Figure 2-3B) from mice after BMT or PEG-ADA ERT did
reach normal levels. Finally, in response to vaccination with Pneumovax 23,
transplanted mice produced similar amounts of IgM compared to ADA+/+ mice (Figure

62

Analysis of ADA enzyme activity and substrate concentration. We measured the
level of ADA enzyme activity in tissue samples from the mice at 16 and 60 days after
birth (Figure 2-4A-D). In the normal control mice, the highest levels of ADA enzyme
activity were seen in the thymus and the spleen (100-300 nmoles/min/mg), with 10-fold
Figure 2-4. ADA specific activity after neonatal BMT.
ADA enzyme specific activity (nmoles of adenosine converted to inosine/min/mg
protein) was determined in tissue lysates. Age-matched, ADA+/+ congenic
controls were compared at day 16 (n=4) and day 60 (n=2) to untreated ADA-/-
mice (n=3) and ADA-/- treated with neonatal BMT at day 16 (n=3) and day 60 (n-
6) and to ADA-/- mice receiving ERT with PEG-ADA at day 16 (n=2) and at day
60 (n=2). A. Thymus B. Spleen C. Lung D. Liver.

63

lower levels in the liver and lung, and a further 10-30-fold lower level of activity. ADA-
deficient mice treated with neonatal BMT had 5-10 fold lower levels of ADA enzyme
activity in all tissues analyzed compared to ADA+/+ mice at day+16 and day+60. By
day+60 there was no difference in the levels achieved by both BMT and ERT in all
tissues analyzed.

Figure 2-5. Substrate levels after neonatal BMT.
Age-matched, ADA+/+ congenic controls were compared at day 16 (n=4) and day
60 (n=2) to untreated ADA-/- mice (n=3) and ADA-/- treated with neonatal BMT at
day 16 (n=3) and day 60 (n-6) and to ADA-/- mice receiving ERT with PEG-ADA
at day 16 (n=2) and at day 60 (n=2). ADA substrate concentrations (nmoles/mg
protein) of adenosine and deoxyadenosine:
A. Thymus B. Spleen C. Lung D. Liver

64
Concentrations for two ADA substrates, adenosine and deoxyadenosine, were also
analyzed and these levels were inversely related to the amount of ADA specific activity
(Figure 2-5A-C). In general, however, concentrations of adenosine in the tissues
analyzed from the ADA -/- mice after BMT were always between 100 and 1000 fold
higher than the concentrations of adenosine measured in ADA+/+ mice with BMT or
ERT with PEG-ADA. The concentrations of deoxyadenosine were greatly reduced in
the spleen, liver and lung; however, in the thymus, levels remained100 to 1000 fold
higher with either neonatal BMT or ERT compared to levels in ADA +/+ mice. Taken
together, by day+60, BMT achieved levels of detoxification similar to those measured
with ERT. However, despite the improvements in lymphocytes numbers seen,
unexpectedly there was not a concordant increase in the level of ADA enzyme activity
in the lymphoid organs

Analysis of donor chimerism in ADA-deficient mice. To assess the level of
engraftment of normal donor cells in various organs, we developed a quantitative PCR
(qPCR) assay to measure the frequency of the normal, uninterrupted ADA gene in
donor cells, but not the disrupted ADA gene in the knock-out allele (Figure 2-6). To
validate this assay, DNA from some tissues was also analyzed for chimerism using
qPCR for the neomycin resistance gene inserted into the knockout ADA allele, in
addition to qPCR for the uninterrupted ADA allele. The amount of neomycin resistance
gene was the reciprocal of the amount of uninterrupted ADA allele in all tissues tested
(data not shown).

65
Engraftment of the donor marrow was evident by day +16 (Figure 2-7). Levels of donor
cell chimerism in peripheral blood lymphocytes, and in thymus, spleen, liver and lung
were comparable among tissues and ranged between 0.5-9.0%. Heterozygote litter
mates were also analyzed as an internal control for the accuracy of the qPCR assay;
these mice are expected to have >50% “donor chimerism” measured, due to the
presence of one normal ADA allele in their genomes plus the small percentage of
normal donors cells with two intact ADA alleles. The level of “donor chimerism”
measured in the heterozygotes was 50% or more, with many mice having chimerism
well above 50% suggesting there was some engraftment of donor-derived cells in the
heterozygotes (Figure 2-7).

Levels of donor chimerism at day +60 were highest in the spleen (p<0.05) and lung
(p<0.002) compared to the thymus and marrow, ranging between 0.5-8.0% (Figure 2-
8). Cells sorted from the lymphoid tissues had similar levels of donor chimerism to
those observed in the unsorted cell suspension from the whole organs (CD4+ and
CD8+ thymocytes - 0.2-0.5%; CD19+ B splenocytes - 0.8-3.0%; CD11b+ myeloid bone
marrow cells – 1.0-3.0%). Most surprising, however, was the significantly higher level
of donor chimerism seen in CD11b+ marrow cells (myeloid) compared to CD4+
thymocytes (p<0.001) and CD19+ splenocytes (p<0.006). The levels of donor
chimerism in CD19+ cells and total splenocytes was also higher than that of the CD4+
thymocytes (p<0.01).

66
Analysis of donor chimerism in !c gene knock-out mice after neonatal BMT. The
absence of selective donor engraftment or expansion of ADA-replete lymphocytes in
the thymus and spleen, compared to myeloid cells, was a surprising finding. We

expected to observe that the reconstitution of thymocytes and splenocytes after
neonatal BMT would be the result of selective expansion of normal donor-derived
lymphocytes expressing ADA enzyme, from a relatively low level of stem cell (and
hence myeloid) engraftment in the absence of cytoreduction.

To determine if this lack of selective expansion was specific to the ADA-deficient SCID
model, we performed an analogous experiment in which !c gene knock-out mice, a
model of human X-linked SCID, received a neonatal transplant of unprocessed
congenic bone marrow without cytoreduction. Because the !c gene knock-out is on
the C57/BL6j strain background (in contrast to the mixed FV1 x 129 background of the
Figure 2-6. Quantitative PCR approach for determining donor chimerism.
A real-time quantitative PCR (qPCR) primer/probe set was designed to amplify the
normal, wild-type ADA allele at the site of disruption in the mutant allele by insertion
of the Neo gene at the unique Aat2 site in exon 5. A second set of primers/probe
were designed to the neomycin resistance gene inserted at the Aat2 site in the
mutant allele.

67

ADA-/- mice), we could inject !c gene knock-out SCID neonates (Ly5.1) with congenic
marrow harvested from normal C57/SJL (Ly5.2) mice, without prior cytoreduction and
use FACS analysis to determine donor chimerism (Ly5.2). In the !c gene knock-out
mice, at day +60 after neonatal BMT, thymocytes (CD4+ and CD8+) were mostly
donor-derived (50-97% Ly5.2+), splenic B lymphocytes showed moderate donor
chimerism (4-35%) and myeloid cells showed a low level of donor chimerism (0.3-
1.0%) (Figure 2-8). This pattern in the !c gene knock-out mice of selective donor
engraftment and expansion of thymocytes and to a lesser extent of splenic B
lymphocytes, compared to myeloid cells, is the pattern expected for SCID recipients of
Figure 2-7. Donor chimerism at 16 days after neonatal BMT.
Whole litters borne of heterozygous matings were injected with normal
donor bone marrow within the first 1-3 days after birth; the individual
genotypes were subsequently determined from tail DNA. Mice were
euthanized at 16 days of age and DNA from tissues was analyzed to
measure donor chimerism. Both homozygous ADA -/- mice and
heterozygous +/- mice were analyzed, with the heterozygote littermates
(50% normal allele) serving an internal controls for the qPCR
measurements.

68
BMT without cytoreduction. Thus, the pattern observed in the ADA gene knock-out
mice without selective donor lymphoid expansion is unique to that model.

Effects of cytoreduction on survival. To examine the relationship between partial
marrow cytoreduction and donor engraftment in the murine model of ADA-deficient
SCID, sub-myeloablative dosages of total body irradiation (TBI - 100-400 cGy) were
Figure 2-8. Donor chimerism at 60 days after neonatal BMT. In ADA-deficient
mice (n=7), chimerism was determined at day 60 after neonatal BMT, analyzing
DNA from tissue fragments as well as from the indicated cell sub-populations
isolated with immunomagnetic beads from thymus (CD4+ and CD8+ T cells),
spleen (CD19+ B cells) and bone marrow (CD11b+ myeloid cells). !C gene
knock-out mice (Ly5.1) were treated by neonatal infusion of normal congenic
bone marrow (Ly5.2, !C +/+) and euthanized after 60 days (n=4). Cells from
thymus, (CD4+ and CD8+ T cells), spleen (CD19+ B cells) and bone marrow
(CD11b+ myeloid cells) were analyzed by flow cytometry to measure donor
chimerism, based on the percentage of cells of the indicated cell sub-populations
expression Ly5.2. Statistical analysis for ADA-/- only: *Significantly higher than
thymus (p,0.05), marrow (p<0.05), and liver (p<0.05) **Significantly higher than
CD4 (p<0.01) ***Significantly higher than CD19(p<0.006) and CD4(p<0.001).

69
used to irradiate entire litters, 1-2 h prior to neonatal BMT. As an alternative method
for cytoreduction, busulfan (15mg/kg) was administered to the pregnant dam (18 days
post coitus or approximately 3 days prior to birth), an approach which has been
reported to induce moderate cytoreduction in the neonates

(Yoder, et al., 1996).

The survival of mice receiving neonatal BMT without conditioning (0 cGy) or with
radiation dosages of 100, 200 or 400 cGy TBI, as well as those mice receiving busulfan
in utero, is shown (Figure 2-9). Survival was inversely related to the irradiation dose
(p<0.001). For those transplanted mice that received no TBI (0 cGy) (n=14), or 100
cGy TBI (n=25), or in utero busulfan prior to BMT (n=21), survival was above 90%. Of
mice receiving 200 cGy TBI (n=22), six died within the first two weeks after TBI and
BMT, but the remaining sixteen survived until at least day +240 (73% survival), when
they were euthanized. The group of mice receiving 400 cGy TBI (n=20) had one death
within the first two weeks, but then had a continued progressive mortality over the next
months for a final survival rate of 20% by day +240.

Chimerism at 240 days after neonatal BMT. The levels of donor chimerism in mice
receiving no cytoreduction or Busulfan was between 1-15% in the thymus, spleen,
bone marrow, lungs and liver at +240 days, was similar to those seen at +16 and +60
days after neonatal BMT (Figure 2-10). However, the administration of 100, 200 or
400 cGy TBI did increase the level of donor chimerism in a dose dependent manner in
the thymus (p<0.001), spleen (p<0.03) and bone marrow (p<0.001), but not in the lung
or liver

70

Donor chimerism was also measured in cells sorted from the thymus (CD4+ and CD8+
T lymphocytes), the spleen (CD19+ B lymphocytes) and the bone marrow (CD11b+
myeloid cells) (Figure 2-11). In mice receiving no cytoreduction or in utero busulfan,
donor chimerism in purified cell populations was similar to the level of donor chimerism
seen in the bulk cell suspensions (0.6-10%)(Figure 2-10). The administration of 100,
200 or 400 cGy did increase donor chimerism in a dose dependent manner in T
lymphocytes (p<0.001), B lymphocytes (p<0.001) and in myeloid cells (p<0.05). As in
the non-conditioned transplants, the donor chimerism levels in lymphoid and myeloid
cells were equivalent. The one surviving mouse that received 400 cGy TBI had furth
Figure 2-9. Survival after neonatal BMT with or without cytoreductive
conditioning.
Survival was recorded after ADA-deficient mice received neonatal BMT
without cytoreduction (n= 14) or with cytoreduction using busulfan given to the
pregnant dam (n=21), or by total body irradiation (TBI) of 100 cGy (n=25), 200
cGy (n=22), or 400 cGy (n=20). Survivorship was subjected to Kaplan-Meier
analysis, and shows a significant dose response with increasing doses of TBI
(p<0.001).

71

increases of donor chimerism seen in all analyzed cell lineages with between 30-80%
donor chimerism. Thus, cytoreductive conditioning with TBI, but not with busulfan as
used, led to increased levels of donor engraftment without a selective advantage in the
lymphoid compartment. These findings are in marked contrast to donor chimerism
measured in !c-gene knock-out mice 200 days after neonatal BMT without
cytoreduction. CD4/8+ cells were almost 100% donor derived and CD19+ cells were
Figure 2-10. Donor chimerism in tissues after neonatal BMT and
cytoreductive conditioning. Chimerism was determined in tissues from
ADA-deficient mice (no cytoreduction, n= 3; Busulfan, n=6; 100 cGy, n=7;
200 cGy, n=2; and 400 cGy, n=1) after 240 days. *Dose response of
chimerism with increasing TBI dosage is significant in thymus (p<0.001),
spleen (p<0.05), and marrow (p<0.001).

72

30-55% donor derived, whereas the CD11b had less than 0.5% donor chimerism
(Figure 2-11).

Analysis of immune reconstitution in response to cytoreductive conditioning.
There was not a significant dose-response with increasing dose of TBI in the absolute
number of T lymphocytes or T lymphocyte sub-sets (Figures 2-12A-B). The absolute
numbers of splenocytes (p<0.001), as well as the absolute number of CD19+
Figure 2-11. Donor chimerism in thymocytes, lymphocytes, and myeloid
populations after neonatal BMT and cytoreductive conditioning.
Chimerism was determined in cells from thymus, (CD4+ and CD8+
thymocytes), spleen (CD19+ B cells), and bone marrow (CD11b+ myeloid
cells) isolated from ADA-deficient mice (no cytoreduction, n= 5; Busulfan, n=6;
100 cGy, n=9; 200 cGy, n=2; and 400 cGy, n=1). %C gene knock-out mice
(Ly5.1) were treated by neonatal infusion of normal congenic bone marrow
(Ly5.2, !C +/+) and euthanized after 200 days (n=4). Statistical analysis for
ADA-/- mice only: *Dose response is significant in CD4+ cells (p<0.001),
CD19+ cells (p<0.001), and CD11b+ cells (p<0.05).

73
splenocytes (p<0.001) did show a significant increase (Figures 2-12C). Furthermore,
200 cGy or more resulted in full restoration of the absolute numbers of splenocytes and
CD19+ cells compared to ADA+/+ mice.

Figure 2-12. Immunophenotype after cytoreduction and neonatal BMT. All
mice were age-matched (200-240 days) in the experimental arms: ADA-deficient
mice (no cytoreduction, n= 3; 100 cGy, n=7; 200 cGy, n=2; and 400 cGy, n=1;
Busulfan, n=6;) after 240 days *
A. Absolute numbers of thymocytes and splenocytes (Mean+/-SEM). *Significant
dose response in splenocytes (p<0.001).
B. Absolute numbers in each thymocyte sub-population (CD4+; CD8+; double
positive (DP): CD4+/CD8+; double-negative (DN): CD4-/CD8-).
C. Absolute numbers in each splenocyte sub-population (CD4+; CD8+; CD19+)
*Significant dose response in CD19+ (p<0.001).

74
Discussion
Since 1968, allogeneic HSCT for infants with SCID from HLA-matched sibling donors,
by infusing unprocessed bone marrow without prior cytoreductive conditioning, has
been life-saving to prevent the lethality of SCID

(Small, et al., 2004; Buckley, et al.,
1999). These transplanted patients generally develop protective immune function with
a donor-derived immune system, despite low levels of donor engraftment, based on
chimerism analyses of myeloid or progenitor cells (van Leeuwen, et al., 1994;
Tjonnfjord, et al., 1994; Haddad). Using a murine model of ADA-deficient SCID, we
report a similar profound improvement in survival by transplanting unprocessed
congenic bone marrow into recipients without prior cytoreductive conditioning. The
non-ablative bone marrow transplant also prevented the mouse-specific complication
of pulmonary death in infancy. The transplanted mice had significant immune
reconstitution. Strikingly, we observed that the lymphoid compartment was not mostly
reconstituted by donor-derived ADA-replete cells, but by endogenous, host-derived
ADA-deficient cells.

Immune reconstitution was evident at the earliest time analyzed after neonatal
transplant, (post-natal day +16), when direct comparisons could be made to age-
matched untreated ADA-deficient controls. However, the degree of immune
reconstitution that developed in mice was lower than in normal age-matched controls;
the absolute numbers of thymocytes and splenocytes were reduced, and there was an
absence of a proliferative response to conA, indicating poor functional activity. The
numbers of thymocytes and splenocytes remained subnormal when the neonatal BMT
recipients when analyzed at 2 and 8 months of age. Despite, their low number,

75
splenocytes responded to stimulation with conA and LPS; and, furthermore, BMT
recipients were capable of producing IgM in response to vaccination with Pneumovax
23. Thus, while multiple indices of immune reconstitution were significantly improved
by the non-conditioned BMT, they remained subnormal for age. The protective
benefits from this partial degree of immune reconstitution are unclear, since the mice
are fostered in a pathogen-free environment. Patients with ADA-deficiency on PEG-
ADA ERT appreciate immune reconstitution that is highly protective from infections,
despite significantly sub-normal numbers of blood T, B and NK lymphocytes (Weinberg
et al., 1993; Chan, et al., 2005; Malacarne, et al., 2005). The presence of the intact
ADA gene in the donors and the ADA gene knock-out allele in recipients allowed donor
chimerism to be measured over a wide range and with high accuracy using real-time
PCR to quantify the normal donor ADA allele. Additionally, ADA enzyme activity and
reduction of cytotoxic substrates, adenosine and deoxyadenosine in tissues and cells
also served as a measure of donor cell engraftment. The levels of engraftment of
myeloid cells (and presumably HSC) ranged from 0.3-3.0% in the marrow, and spleen,
similar to the levels of donor engraftment reported in human SCID patients receiving
non-conditioned transplants (van Leeuwen, et al., 1994; Tjonnfjord, et al., 1994;
Haddad, et al., 1998). The neonatal mice (~ 2 gm) received 5 x 10e6 nucleated bone
marrow cells, representing a cell dosage of 2.5x10e9 cells/kg. In clinical allogeneic
HSCT for SCID, the typical bone marrow cell dosage may be 1-2 orders of magnitude
lower (e.g. 5 x 10e7-10e8/kg). However, multiple factors may underlie the donor
engraftment levels besides marrow cell dosage including species-specific marrow stem
cell content and the ages of the recipients (neonatal mice vs. infant humans).

76
The finding that 0.3-3.0% of the T and B cells in the thymus, spleen and blood were
donor-derived, based on measurements of ADA enzyme activity relatively uncorrected
substrate levels (especially in the thymus) and low donor cell chimerism, indicates that
>90% of the lymphocytes in the transplanted mice are host-derived, ADA-deficient
cells. In patients receiving PEG ADA ERT, the development and survival of ADA-
deficient lymphocytes occurs, although the mechanism is likely indirect, with the
pegylated protein primarily circulating in plasma leading to systemic lowering of
adenine nucleotide pools (Blackburn, et al., 2000). The reconstitution with ADA-
deficient cells in the transplanted mice suggests that trans-rescue occurred; the total
mass of ADA-replete donor cells must produce sufficient ADA enzymatic activity to
allow survival of the ADA-deficient lymphoid cells, presumably by lowering the levels of
toxic deoxyadenosine metabolites, either systemically or locally in lymphoid organs.

We reported a similar pattern of immune reconstitution with mostly endogenous ADA-
deficient lymphocytes from direct in vivo ADA gene delivery using a single intravenous
injection of a lentiviral vector in ADA-deficient neonatal mice (Carbonaro, et al., 2003).
We found there was minimal transduction of HSC or lymphocytes; ADA expression
from the vector was highest in the liver and lungs, which provided a systemic source of
ADA enzyme or functioned as a metabolic sink for adenine nucleotides.

In contrast to expectations from non-ablated BMT for SCID patients, there was not a
higher level of donor-derived lymphoid cells compared to myeloid cells. This surprising
finding demonstrates that in this murine model of ADA-deficient SCID there is not a
selective advantage for development and survival of normal lymphoid cells. As a

77
comparison, similar non-conditioned neonatal transplants of normal bone marrow were
performed with a different murine model of SCID (X-linked SCID from !c gene knock-
out). These recipients showed the ”classical” engraftment/reconstitution pattern of
SCID with selective expansion of donor-derived lymphocytes. The genetic defect in
intracellular signaling in response to cytokines in !c deficiency would be expected to be
cell-intrinsic and therefore not amenable to trans-rescue; only genetically normal
lymphoid progenitor cells expressing the normal !c gene would be expected to
develop. In contrast, the donor-derived ADA replete hematopoietic and lymphoid cells
may be acting, in effect as in vivo ERT, by provision of ADA enzyme activity that
promotes the development of endogenous lymphoid progenitors, with no disadvantage
relative to donor lymphocytes.

We compared the findings in ADA-deficient mice receiving neonatal BMT without any
conditioning to those in mice receiving low dosages of total body irradiation (TBI) or
systemic busulfan prior to HSCT. We observed that relatively low dosages of TBI
increased donor chimerism approximately 10-fold over that in the non-conditioned
recipients, reaching levels as high as 10-30%. The increases of donor chimerism were
TBI-dosage dependant for the hematopoietic and lymphoid organs (bone marrow,
spleen and thymus), but not in the solid organs (liver and lung). The highest dosage of
TBI given to neonatal mice, 400 cGy, was highly toxic, with progressive death of
recipients. The lowest dosage of TBI that was used, 100 cGy, was well tolerated with
survival equivalent to that achieved in non-conditioned mice, yet with significantly
higher engraftment levels. It is not known whether the modest improvement in
engraftment would out-weight potential late effects from the neonatal radiation.

78
Busulfan, as administered, had no discernable effects, with all measured outcome
values of engraftment and immune reconstitution being indistinguishable from those in
non-conditioned mice. Differences between the strains of mice used may explain the
lack of effect from busulfan we found, in contrast to those reported by Yoder

(1996).

Recovery of B cell activity with production of normal quantities and qualities of
immunoglobulins remains a major clinical problem after allogeneic HSCT for SCID. As
high as 50% of patients may not produce adequate levels of antibodies, despite
adequate T cell reconstitution, and require chronic intravenous immunoglobulin therapy
(Buckley, et al., 1999). In one retrospective analysis, SCID patients who received
cytoreduction prior to allogeneic HSCT had a higher rate of adequate B cell recovery
than non-conditioned patients. We observed that B cell numbers were normal after
HSCT following 100-200 cGy TBI, but not without TBI; although the mice were capable
of producing IgM in response to Pneumovax 23 vaccination. Future studies will need
to address B cell reconstitution in more detail.

The degree to which there is selective donor lymphoid expansion compared to myeloid
engraftment in ADA-deficient SCID patients after allogeneic HSCT has not been
reported, with all publications on post-transplant chimerism describing patients with
other genetic forms of SCID. A selective advantage exists in ADA-deficient SCID
patients who have overall low amounts of ADA-expressing cells, based upon rare case
reports of ADA-deficient SCID patients who had a spontaneous reversion of the ADA
mutation in a stem or progenitor cell with subsequent increase in ADA-expressing T
cells, as well as observations from patients who underwent gene therapy targeting T

79
cells or umbilical cords blood CD34+ cells followed by intermittent treatment and
withdrawal of ADA ERT (Hirschhorn, et al., 1994; Ariga, et al., 2001; Arredondo-Vega,
et al., 2002; Aiuti, et al., 2002; Kohn, et al., 1998; ). In patients receiving gene therapy
using autologous hematopoietic stem cells transduced by a retroviral vector with
cytoreductive marrow conditioning using moderate dosages of busulfan, the level of
gene-corrected T lymphocytes approached 75-100%, whereas myeloid cells with the
inserted ADA gene were 10-100-fold lower, indicating the occurrence of a selective
lymphoid expansion (Aiuti, et al., 2002; Gasper, et al., 2006). Nevertheless, in mice,
we observed that a moderate level of chimerism of normal donor cells produced
sufficient ADA enzyme to lead to trans-rescue of ADA-deficient lymphocytes, in effect
blunting any potential selective advantage of the ADA-replete lymphocytes. It remains
to be determined whether our findings predict those that occur in non-conditioned ADA-
deficient patients, or if differences in purine metabolic pathways between mice and
humans lead to different outcomes. The potential for trans-rescue, without
comprehensive correction, may lead to novel clinical applications and a better
understanding of the pathophysiology of ADA-deficient SCID.

80
Chapter 3.
Neonatal Intravenous Administration of Lentiviral Vector
Expressing Human ADA: A Novel Form of Enzyme
Replacement Therapy for ADA-Deficiency

Abstract

Using a murine model of adenosine deaminase-deficient severe combined immune
deficiency syndrome (ADA-deficient SCID), we have developed a novel and non-
invasive method of gene transfer for the sustained systemic expression of human ADA
as enzyme replacement therapy. The method of delivery is an HIV-1-based lentiviral
vector given systemically by intravenous injection on day 1-2 of life. In this paper, we
characterized the bio-distribution of the integrated vector, the expression levels of ADA
enzyme activity in various tissues, as well as the efficacy of systemic ADA expression
to correct the ADA-deficient phenotype in this murine model. The long-term expression
of enzymatically active ADA achieved by this method, primarily from transduction of
liver and lung, restored immunological function and significantly extended survival.
These studies illustrate the potential for sustained in vivo production of enzymatically
active ADA, as an alternative to therapy by frequent injection of exogenous ADA
protein.

Introduction

Genetic deficiency of adenosine deaminase (ADA) is an autosomal recessive disorder
that occurs in 1:200,000-1,000,000 live births and is responsible for approximately 20%
of human Severe Combined Immune Deficiency (SCID) (Hershfield, 1998). The ADA
gene encodes a 41 kDa zinc protein that is responsible for the deamination of
adenosine and deoxyadenosine in the purine salvage pathway (Wiginton, et al., 1986).

81
In the absence of ADA, adenosine and deoxyadenosine accumulate in all tissues, but
accumulate to levels that are lymphotoxic in thymus, spleen and bone marrow (Giblett,
et al., 1972). Young infants with ADA-deficient SCID present with opportunistic
infections, failure to thrive, lymphopenia, and an absence of cellular or humoral
immunity (Hershfield, 1998). Typically, there is pan-lymphopenia with severely
reduced frequencies of T, B and NK lymphocytes. Untreated infants die in infancy.

An allogeneic bone marrow transplant (BMT) can be completely curative for ADA-
deficient SCID patients when an MHC-matched sibling donor is available. However,
results are significantly poorer for those receiving a haplo-identical T cell-depleted
bone marrow or marrow from a matched unrelated donor (Haddad, et al., 1998;
Buckley, et al., 1999; Smorgorzewska, et al., 2000). The other available treatment for
ADA-deficient SCID is enzyme replacement therapy (ERT) with polyethelyne glycol
conjugated bovine ADA (PEG-ADA; Adagen!, Enzon, Inc, Pistcatway, NJ). While
PEG-ADA therapy leads to initially robust lymphoid repopulation with circulating T, B,
and NK cells and the production of active immunity, the number and function of
circulating T, B and NK cells are well below age-matched control values and decline
over years of treatment (Weinberg, et al., 1993; Chan, et al., 2005). Not only is ERT
with PEG-ADA sub-optimal, it is a chronic therapy requiring intramuscular injections
twice weekly and it is a very expensive medicine (>$200,000/year per patient).

For these reasons and a postulated selective advantage for those cells with normal
ADA expression, ADA-deficient SCID was an early candidate disease for studies of
gene therapy. Initial trials for gene therapy involved gene transfer ex vivo of the human

82
ADA cDNA using a murine gamma-retrovirus into mature T-cells that had developed in
patients receiving PEG-ADA (Blaese, et al., 1995). Subsequent trials focused on gene
transfer to autologous hematopoietic stem cells (HSC), because the T lymphocytes
they produce may have a selective advantage over the non-corrected cells to restore
immune function. For both of these gene therapy approaches, patients were
maintained on PEG-ADA enzyme replacement, which may have blunted the selective
survival advantage of gene-corrected lymphocytes. Additionally, no cytoreductive
chemotherapy was given to “make space” for the gene modified cells, due to concerns
over toxicity. No evidence of clinical benefits was observed in these early trials
(Bordignon, et al., 1995; Hoogerbrugge, et al., 1996; Kohn, et al., 1998). More
recently, a group of ADA-deficient SCID patients were treated without concomitant
PEG-ADA therapy and with cytoreduction using sub-myeloablative dosages of the
chemotherapy agent Busulfan. Clinical and therapeutic benefits, with selective
outgrowth of gene corrected T cells, have been observed (Aiuti, et al., 2002; Aiuti, et
al., 2009). However, because this method of gene transfer includes the harvest of
marrow, purification of autologous HSC, ex vivo transduction and re-infusion of the
gene corrected cells after administration of chemotherapy, it is invasive and has
inherent risks.

Concurrent to the development of clinical trials using gene therapy for ADA-deficient
SCID, two groups produced murine models of ADA-deficient SCID by homologous
recombination. Both groups found that these ADA gene knock-out mice died late in
gestation from severe hepatocellular damage (Wakamiya, et al., 1995; Migchielsen, et
al., 1995). Kellems and co-workers engineered a placental trophoblast-specific

83
expression cassette or mini-gene for ADA expression only during gestation, which was
used to create transgenic mice (Blackburn, et al., 1995). The mice hemizygous for the
mini-gene were crossed with mice heterozygous for the mutant ADA allele, to produce
ADA-deficient pups capable of adequate ADA expression during gestation to allow
survival beyond birth, but with no detectable ADA expression during the postnatal
period (Blackburn, et al., 1998). These mice exhibit a SCID phenotype but die from
non-infectious pulmonary insufficiency and inflammation between days 19-21, unless
maintained on ERT with PEG-ADA (Blackburn, et al., 2000a; Blackburn, et al., 2000b)
or rescued with a wild-type congenic bone marrow transplant (Mortellaro, et al., 2006;
Carbonaro, et al., 2008)

Using this murine model of ADA-deficient SCID, we have developed a novel and non-
invasive method of gene transfer for the sustained systemic expression of human ADA
as enzyme replacement therapy. The method of delivery is an HIV-1-based lentiviral
vector given systemically via the temporal vein on day 1-2 of life. In this paper, we
characterized the bio-distribution of the integrated vector, the expression levels of ADA
enzyme activity in various tissues, as well as the efficacy of systemic ADA expression
to correct the ADA-deficient phenotype in this murine model.

Methods
Mice. A murine model of ADA deficiency, on a mixed background of 129/Sv and
FVB/N, was generated and characterized by Blackburn, et al., (1998). This model
utilized a two-stage genetic engineering strategy to overcome the lethal phenotype of
murine ADA deficiency. ADA gene knockout in the mouse results in a lethal phenotype

84
that is rescued by the insertion of an ADA mini-gene directing ADA expression in the
placenta only during gestation (Blackburn, et al., 2000b). These ADA-deficient
homozygous knock-out mice with the placental mini-gene are born viably, but die at
approximately post-natal day 19 of pulmonary insufficiency (Blackburn, et al., 1998).
Just prior to death, the ADA-deficient pups are small compared to their littermates,
have labored breathing and exhibit a SCID phenotype (pan-lymphopenia).

Homozygous ADA gene knockout sires (ADA-/-) were rescued for breeding with the
transplant of wild-type congenic marrow as neonates (Carbonaro, et al., 2008) and
were crossed with heterozygous (ADA-/-) to produce litters with 50% ADA-deficient
pups. The genotypes of the mice were determined by Southern blot of DNA extracted
from tail biopsies at 21-25 days of age. Mice were housed in accordance with the
IACUC (Saban Research Institute at Childrens Hospital Los Angeles) and the National
Institutes of Health guidelines. All animals were handled in laminar flow hoods and
housed in micro-insulator cages in a pathogen-free colony.

Lentiviral vector construct. The HIV-1 based lentiviral vector, SMPU-MND-ADA,
was used for gene transfer. SMPU (developed by Paula Cannon, Childrens Hospital
Los Angeles) is a self-inactivating (SIN) HIV-1-based lentiviral vector backbone that
has minimal gag sequences, the central polypurine tract (cPPT), and three tandem
copies of the UES polyadenylation enhancing sequences from SV40 in the 3’ LTR
(Wang, et al., 2003). The U3 region from the 3’ LTR of the MND retroviral vector was
cloned upstream of a normal human ADA cDNA (a gift from David Williams, Children’s
Hospital of Cincinnati) (Robbins, et al., 1997).

85

Lentiviral supernatant production and characterization. The SMPU-MND-ADA
lentiviral vector was produced by triple plasmid transfection of 10 ug of pSMPU-MND-
ADA vector transfer plasmid, 10 ug of pCMV&8.9 (Zuffrey, et al., 1998) and 2 ug of the
pMD.G plasmid (Naldini, et al., 1996) encoding for the VSV-G envelope into 293T cells
(American Type Culture Collection {ATCC}, Manassas, VA) in DMEM medium
supplemented with 10% (v/v) fetal bovine serum, penicillin (100 "g/ml), streptomycin
(100 "g/ml), and 2 mM L-glutamine. Viral supernatant was harvested after 48 hours,
filtered through a 0.2 "m filter and concentrated ~1,000 fold by using Centricon plus 70
ultra-filtration filters (Millipore, Bedford, MA) followed by ultracentrifugation at 25,000 x
g for 2 hours (Case, et al., 1996). Viral pellets were resuspended in phosphate
buffered saline (PBS) and stored in 50 ul aliquots at –80°C. Titer was measured by the
transduction of HT29 cells (colorectal adenocarcinoma, #HTB-38, ATCC) in ratios of
1:5,000, 1:50,000 and 1:500,000 of viral supernatant to medium. Southern blot was
performed on DNA extracted using the DNAeasy Kit (Qiagen, Hilden, Germany),
digested with high concentration Kpn1, which cuts once in each integrated LTR.
These samples were compared to DNA extracted and similarly digested, from a clonal
population of HT29 cells containing 1 proviral copy of SMPU-MND-huADA, followed by
hybridization with a probe for human ADA cDNA. Using densitometry, the titer of the
viral supernatant was calculated to be 1.0 x 10^10 HT29 transducing units per ml
(TU/ml).

Injection of lentivirus. Lentiviral supernatant was thawed at 37
0
C and diluted in 0.9%
saline (injection, USP; APP, Schaumburg, IL) and polybrene (8"g/ml final

86
concentration; Sigma, St. Louis, MO) to give a dose of 1.6 x 10^7 or 1.6 x 10^8 TU in a
50 ul injection volume. Injections of neonates (post-natal days 1-3; 1.0-1.9 g) were
made via the superficial temporal vein with a 30g needle on a 1 cc syringe (Sands and
Barker 1993). All neonates were returned to their dam as intact litters. Some control
litters were treated with ADA enzyme replacement therapy, by weekly intramuscular
injection of 300 U/kg of ADAGEN! (Enzon Pharmaceutical, Piscataway, New Jersey),
considered to be a low dose regime as described by Blackburn, et al., (2000b).

Isolation of T, B and myeloid cells. After euthanasia, mice were perfused via cardiac
puncture with 15 ml of PBS and the thymus, spleen and bone marrow were each
harvested into 4 ml of PBS with 1.0% fetal calf serum (FCS) in a six well plate. Single
cell suspensions were made by forcing the tissue through a 70 µm mesh with the
sterile end of a 1 cc syringe plunger. The cells were counted for total number of cells
within the organ, pelleted and re-suspended in PBS with 1% FCS as a 1.0 x 10^7
cells/ml suspension. Antibodies conjugated to magnetic beads were used to purify T
cells (anti-CD4/8) from the thymus, B cells (anti-CD19) from the spleen and myeloid
cells (anti-CD11b) from the bone marrow with a magnetic separation system
(Antibodies, LS Midi columns and magnetic separation apparatus; Miltenyi Biotec,
Auburn, CA). Samples of the unpurified cells and the purified cells were set aside for
immunophenotype determination and the remainders of the cells were used to extract
DNA for determination of proviral copy number.

Immunophenotype. All antibodies and appropriate isotype controls are murine
specific and are from BD/Pharmingen (San Diego, CA). Prior to perfusion, peripheral

87
blood was harvested at the time of sacrifice for staining with the following antibodies for
the determination of immunophenotype: anti-CD4-PE and anti-CD8-APC, anti-CD19-
PE and anti-CD45APC, anti-Mac1-PE/anti-Gran1-PE and anti-CD45-APC, anti-DX5
(pan NK)-PE/anti-CD3-APC. Single cell suspensions of the thymus, spleen and bone
marrow, as described above, were stained with the following: thymocytes with anti-
CD4-PE and anti-CD8-APC; splenic T cells with anti-CD4-PE and anti-CD8-APC,
splenic B cells with anti-CD19-PE and anti-CD45-APC; bone marrow cells anti-CD11b
(myeloid)-PE and anti-CD45-APC. All cell populations were analyzed on a FACs
Calibur (Becton Dickenson, Immunocytometry Systems, San Jose, CA), and analyzed
with CellQuest Software (Becton Dickenson). Total cell counts were determined by
CBC analysis on a 950 Hemavet Analyzer (Drew Scientific, Dallas TX).

Proliferation assay of splenocytes. Splenocytes were made into a single cell
suspension, red blood cells were lysed with ACK buffer and one third of the cell
suspension was used to determine proliferation in response to concanavallin A (ConA)
mitogenic stimulation. For each animal, splenocytes were plated at 2.5 x 10^5 and 3.5
x 10^5 cells per well in 96-well, U-bottom plates with (stimulated) and without
(unstimulated) ConA (60 mg/ml; Sigma, St Louis, MO) was added. After incubation at
37ºC (5% CO
2
) for 48 hours, the cells were pulsed with
3
H thymidine (0.2 "Ci per well)
and incubated for an additional 20 hours. Cells were harvested with a Ph.D. Harvester
(Brandel, Gaithersburg, MD) and counted in a Beckman Scintillation Counter (BD, San
Diego, CA). The stimulation index was calculated by dividing the average c.p.m. of
the stimulated population by the average c.p.m. of a parallel unstimulated population.

88
Secondary mouse transplants and progenitor assay. At the time of euthanasia,
bone marrow was harvested from the mice injected with the lentiviral vector and 2.0 x
10^6 bone marrow cells were injected into age matched, congenic (ADA +/+), lethally
irradiated (2 x 600 cGy within 16 hours) recipient mice to serve as secondary hosts.
Bone marrow progenitor assays were also performed using marrow cells by plating
5,000 and 20,000 cells (in duplicate) in Murine Progenitor Media (Stem Cell
Technologies, Vancouver, BC) and supplemented with human recombinant
erythropoietin (Amgen, Thousand Oaks, CA), fungizone (0.05 "g/ml; Invitrogen,
Carlsbad, CA), and penicillin/streptomycin (Invitrogen, 100 "g/ml). Colonies were
grown for 10 –12 days. Individual colonies were plucked and DNA was extracted by
phenol/chloroform extraction and re-suspended in 25 ul of TE. PCR was performed
with primers designed to amplify integrated sequences of SMPU-MND-huADA with the
sense primer located in the 3' end of the human ADA cDNA (sense: ctg cag ccc aag
ctc ctc) and the antisense primer in the vector backbone 3' of the ADA cDNA
(antisense: gga gtg aat tag ccc ttc cag tc). Amplification was done in a 50 ul reaction:
5 ul of the template DNA, 5 ul of PCR 10X buffer, 3ul of 25 mM MgCl2, 1 ul 10 mmol
dNTP, 1 ul of 10 pmole/ul of each primer, 0.5 U of taq polymerase and 33.5 ul of water.
PCR was performed by 1 cycle of 95
o
C for 5 minutes, 60
o
C for 1 minute, and 95
o
C for
1 minute and 72
o
C for 1 minute, followed by 30 cycles of 95
o
C for 1 minute, 60
o
C for 1
minute and 72
o
C for 1 minute. PCR for murine beta-actin was used to confirm the
adequacy of the amount of starting template (Robbins, et al., 1997).

Proviral copy number. Proviral copy numbers were determined by real time
quantitative PCR (qPCR) and, in some cases, re-confirmed with Southern blot. DNA

89
was extracted, using the Purgene Whole Blood Extraction Kit (Minneapolis, MN), from
peripheral blood samples obtained at 30, 60, 120 and 180 days post injection. DNA
from tissues and cells populations purified from lymphoid tissues was extracted using
phenol/chloroform and re-suspended in TE. All DNA was quantitated using fluorimetry
and a DNA specific dye (Hoescht dye; Sigma, St. Louis, MO). Quantitative PCR was
performed with primers and probe designed to amplify integrated sequences of SMPU-
MND-huADA: sense primer (ctg cag ccc aag ctc ctc), antisense primer (gga gtg aat
tag ccc ttc cag tc) and the TAMRA probe sequence (acc aat gac tta caa ggc agc tgt
aga tct tag cc). The primer concentrations (sense and antisense) were 400 nM and the
probe concentration was 50 nM in all reactions. All reactions utilized Universal Master
Mix (Applied Biosystems, Inc. {ABI} , Fullerton, CA) and were run under default
conditions in the 7700 Sequence Detector System (ABI). Each of the wells contained
300 ng of template DNA and they were compared to 300 ng of DNA from a set of copy
number standards. The standards were produced using a clonal population of HT29
cells containing two copies of the SMPU-MND-ADA provirus (as determined by
Southern blot), diluted into DNA of untransduced HT29 cells, yielding a detection
sensitivity of 1:100,000 vector-containing cells or 0.00001 copies/cell.

ADA enzyme activity. After euthanasia, blood was collected from each mouse by
cardiac puncture into heparinized tubes and then centrifuged at 4,000 x g for 10
minutes at RT. The plasma and RBC pellet were flash-frozen in liquid nitrogen and
stored at -80
o
C until analysis. The thymus, spleen, lung, and liver were also harvested
from each mouse and segments were flash frozen in liquid nitrogen and stored at –
80
o
C. Samples were sonicated for 15 sec at 30 watts each time in 400 to 600 ul of

90
homogenization buffer (25 mM Tris, pH 7.8, 1 mM EDTA, 5 mM beta-mercaptoethanol)
and kept on ice until three rounds of sonication were finished. Cell lysates were
centrifuged at 20,000 rpm for 13 min in a microcentrifuge and supernatants were
transferred to new tubes. Complete Proteinase Inhibitor Cocktail (Roche Molecular
Biochemicals, Indianapolis, IN) was added and the supernatants were ultracentrifuged
at 55,000 rpm for 1 hr at 4
o
C. The resultant supernatants were again transferred to
new tubes and subjected to protein assay by Bradford protein assay (Bio-Rad,
Hercules, CA) using micro-titer plates. ADA specific activity was determined using the
procedure of Agarwal & Parks (1978) as described (Chinsky, et al., 1990). Briefly,
ADA activity was determined under saturating substrate conditions at 25°C in a
reaction mixture containing 1.4 mM adenosine, 50 mM sodium phosphate, pH 7.4, in a
total volume of 1 ml of which 5-100 "l was tissue homogenate. The decrease in
absorbance at 265 nm resulting from the deamination of adenosine to inosine was
continuously monitored spectrophotometrically and rate of inosine production was
calculated at linearity. Zymogram analysis of ADA enzyme activity in tissues was
performed as described using electrophoresis in thin agarose gels, followed by
formazan detection for ADA enzyme activity (Blackburn, et al., 2000a).

Immunohistochemistry. Mice were perfused with PBS after sacrifice and tissues
were harvested into 10% buffered formalin for 24 hours, after which the tissues were
washed in distilled water for 60 minutes and then transferred to 100% ethanol at -20
o
C
until the tissue were processed further. Tissues were dehydrated at room temperature
in 100% ethanol for 30 minutes and cleared in 100% toluene for 30 minutes, followed

91
by two changes of toluene, one hour each. Tissues were infiltrated with paraffin with
three changes of paraffin for 1 hour each, prior to embedding.

The sections were stained with either anti-human ADA H-300, a rabbit polyclonal IgG
with an epitope corresponding to amino acids 64-363 of the human ADA protein (Santa
Cruz Biotechnology, Inc., Santa Cruz, CA) or C-20, a goat polyclonal IgG with an
epitope mapping to the C-terminus of human ADA protein (Santa Cruz Biotechnology).
Sections were deparaffinated and re-hydrated with distilled water and was blocked with
0.5% hydrogen peroxide in methanol for 10 minutes and then washed with distilled
water for 5 minutes. Antigen retrieval was performed by microwaving in citrate buffer,
pH 6.0, for 15 minutes, followed by a wash with distilled water for 5 minutes and
another wash with 0.05% Tween 20 in Tris buffered solution (TBST) for 5 minutes.
The sections were blocked with 5% donkey normal serum in 1% BSA, 0.1% Triton X-
100 in 0.05% Tween 20 in phosphate buffered solution (PBST) for 1 hour. Following
the protein block, the sections were incubated in streptavidin blocking solution (Vector
Laboratories Inc., Burlingame CA) for 15 minutes and washed with TBST. The
sections were then incubated in biotin blocking solution (Vector Laboratories Inc.,
Burlingame CA) for 15 minutes. After blocking, sections were incubated with goat anti-
ADA (polyclonal; N-300; Santa Cruz, Santa Cruz, CA) at a dilution 1:400 in 2% donkey
normal serum, 0.1% BSA in PBST overnight at 4C. Sections were washed with TBST
2x5 minutes and then incubated in donkey anti-goat-biotin (Jackson ImmunoResearch
Laboratories, West Grove PA) at a dilution of 1:1000 in PBS for 30 min at RT.
Sections were washed in TBST 2x5 minutes and incubated in streptavidin conjugated
to horse-radish peroxidase (Jackson ImmunoResearch Laboratories, West Grove, PA)

92
at a dilution of 1:1000 in PBS for 30 minutes. Sections were washed again in TBST
and developed with DAB (DakoCytomation, Carpinteria, CA) for 4 minutes, after which,
the sections were washed once in TBST for 5 minutes and then in distilled water for 5
minutes. Sections were stained with Gill's hematoxylin stain (Electron Microscopy
Sciences, Hatfield, PA) for 30 seconds, and dehydrated in ethanol and toluene and
covered with a clear cover-slip.

Statistical analysis. Survivorship analysis was performed using the Kaplan-Meier
approach. Tests between groups were made using the log rank tests. Comparisons
between treatment groups over time (or using different conditions) were made using a
general linear model. For the marking and activity data, the log base 10 of the
measured values was used for the independent variable. When there was significant
intra-mouse correlation, the mouse was considered as a random effect. For the
marking data, tissue and time were the independent variables along with all possible
two-way interactions. Initially, a main-effects stepwise procedure was used followed by
inclusion of all additional two-way interactions that reached statistical significance
(p<0.05). For the activity data, tissues types and treatments (wild-type, enzyme
replacement, and vector) were the independent variables along with the possible two-
way interactions with the treatment.

Results
Lentiviral supernatant production and characterization. The human ADA cDNA
was carried by an HIV-1 based lentiviral vector, SMPU, a self inactivating (SIN)
lentiviral vector containing minimal HIV-derived sequences and elements to enhance

93
nuclear import (cPPT) and transcript polyadenylation (Figure 3-1). The ADA cDNA
was expressed from an internal promoter, the MND-U3 enhancer/promoter, modified
from the murine gamma-retrovirus Myeloproliferative Sarcoma virus (MPSV)(Ostertag,
et al., 1980; Challita, et al., 1995). The MND promoter yields a high level of expression
in murine and human hematopoietic and lymphoid cells (Halene, et al., 1999). The
vector was packaged with an HIV-1 packaging plasmid lacking HIV-1 accessory
proteins and pseudotyped with the VSV-G envelope. Viral supernatant was produced
and concentrated 1,000-fold and was shown to have high ADA enzyme activity when
used to transduce human and murine cell lines in vitro (data not shown). The titer of
the SMPU-MND-ADA viral supernatant used for all of these studies was determined to
be 1x 10^10 transducing units per ml (TU/ml) by Southern blot in which the bands from
transduced cells were compared to the bands produced by serially diluting DNA from

Figure 3-1. Map of the SMPU-R-MND-huADA. The SMPU-R-MND-huADA
vector, derived from HIV-1, has a self-inactivating LTR, a minimal gag region,
the central polypurine tract, three tandem copies of the SV40 UES
polyadenylation enhancer to augment polyadenylation of vector transcripts, a
minimal RRE and the MND enhancer/promoter driving human ADA cDNA
expression. The vector was packaged with an HIV-1 packaging plasmid without
accessory proteins using (p8.9) and pseudotyped with the VSV-G envelope.

94

cells containing one proviral copy of the human ADA cDNA into DNA from non-
transduced cells (Figure 3-2).

Injection of lentiviral vector expressing human ADA. The experimental outline is
presented in Figure 3-3. ADA-deficient (ADA-/-) male sires, rescued by congenic bone
marrow transplant, were crossed to heterozygous (+/-) females to produce litters
containing 50% ADA-deficient mice. Between days 1-3, entire litters of neonates were
injected with either 1.0 x 10^7 TU per pup or 1.0 x 10^8 TU per pup. The site of
injection was the temporal vein following the method described in Sands and Barker

Figure 3-2. Vector characterization of SMPU-R-MND-huADA. Lentiviral vector
titer was determined by Southern blot analysis of HT29 cells transduced with
dilutions of concentrated viral supernatant at either 1:500, 1:5,000, 1:50,000. A
radiolabelled probe to the huADA cDNA was used to visualize the vector bands
and densitometry was used to compare the vector bands to those of a standard
clonal cell population known to contain 2 copies/cell of the same vector. Titer of
the concentrated vector preparation was determined to be 1.0 x 10^10 TU)/ml.

95

(1993). Control litters of mice were treated by weekly intramuscular injection of PEG-
ADA enzyme replacement therapy (ERT). Mice were subsequently genotyped by
Southern blot of DNA extracted from tail biopsies by day 30. From those mice
determined to be ADA-/-, peripheral blood samples were taken on days 30 and 60, and
in some cases, days 120 and 180. Mice were euthanized and tissue analyses were
performed at either day 60 or 180. Secondary transplants were performed with the
bone marrow harvested from these long-term survivors to evaluate the level of
transduction of long-lived HSC. ADA-deficient male mice that had received the vector
Figure 3-3. Experimental plan for neonatal injection of a lentiviral vector
expressing huADA in ADA-deficient mice. At day 0-2 after birth, entire litters of
mice (-/- and +/-) were injected with either 1.0 x 10^7 or 1.0 x 10^8 TU per pup.
The mice were genotyped by day +30 and peripheral blood samples were collected
at days +30, 60, 120 and 180 for copy number analysis. At day + 60 (n=5) and day
+ 180 (n=5), mice were euthanized and analyzed for proviral copy number, ADA
enzyme activity, immunophenotype, immunohistochemistry, colony-forming assay
and secondary transplants. ADA -/- and ADA +/- mice that had received the
lentiviral vector as neonates were also cross-bred to assess the presence or
absence of vector sequences in the germ line.

96
as neonates were crossed with ADA heterozygous female mice (who were also
neonatal recipients of vector), to assess the possibility of germ-line transmission of
vector sequences.

Survival and dosage. The murine model of ADA deficiency is a stringent model
because ADA-/- pups die at day 19-21 of severe pulmonary insufficiency unless
rescued with enzyme replacement therapy with weekly intra-muscular injections of the
PEG-ADA (Blackburn, et al, 2000a). Survival was analyzed using the Kaplan-Meier
approach (Figure 3-4). ADA-/- pups receiving no treatment (n=7) died between days
19-21. Those ADA-/- mice receiving 1.0 x 10^7 TU of lentiviral vector and no ERT
(n=7), did have increased survival (p<0.001 compared to untreated mice), but all died
between days 35-45. ADA-deficient mice that received 1.0 x 10^8 TU of lentiviral
vector (n=10) had prolonged survival to 180 days (70%; p<0.001 compared to the
lower dose recipients or to untreated mice) at which point they were euthanized for
analysis. Of the mice receiving 1.0 x 10^8 of the vector, some mice (n=4) had received
ERT with PEG ADA (300U/kg weekly) until day 45 and some did not (n=6). Three mice
died with the appearance of disease-related symptoms of respiratory distress and
wasting between 16-24 weeks after treatment (n=2 received ERT; n=1 received no
ERT). Of the remaining 7 mice, 5 were analyzed further for ADA vector copy number,
ADA enzyme activity, immunophenotype and function. Another cohort of ADA -/- mice
also received 1.0 x 10^8 TU and no ERT; these mice all survived until they were
euthanized at 2 months for analysis and were not included in the analysis of survival.

97

ADA gene transfer and copy number analysis. ADA gene transfer was determined
by quantifying the number of vector proviral copies in the genomic DNA of cells
isolated from ADA-/- mice that had received neonatal injection of the lentiviral vector by
using quantitative PCR (qPCR). Primers and probes were specific for the 3’ end of the
human ADA cDNA and vector backbone sequences (Figure 3-1). The amplification
curves of the samples were compared to those created by serially diluted DNA
extracted from a clonal cell population known to contain two integrated copies of the
provirus into DNA of non-transduced cells.
Figure 3-4. Survival in ADA-deficient mice after receiving neonatal injection of
a lentiviral vector expressing huADA. ADA-deficient mice were either untreated
(n=7) or injected with either 1.0 x 10
7
TU (n=7) or 1.0 x 10
8
TU (n=10) per pup.
Survival of the animals was tracked to day +180, at which time the animals were
euthanized (n=5) for tissue analysis. Survivorship was subjected to Kaplan-Meier
analysis. Of the mice receiving 1.0 x 10^8 of the vector, some mice (n=5) had
received ERT with PEG ADA (300U/kg weekly) until day 45 and some did not (n=5).
Three mice appeared to die with disease-related symptoms of respiratory distress
and wasting (n=2 received ERT; n=1 received no ERT), one mouse died from
apparent malocclusion (ERT) and one mouse was euthanized at day +180 but
determined to have a liver tumor (no ERT) and was not analyzed.

98

Peripheral blood samples were taken from mice receiving either 1.0 x 10^7 TU (n=7) or
1.0 x 10^8 TU (n=11) at day 30 and DNA was extracted from the white blood cells.
Samples were also collected from mice receiving 1.0 x 10^8 TU at days 60 (n=15), 120
(n=10) and 180 (n=7) post-injection. Copy number analysis revealed low levels of
vector marking in peripheral blood leukocytes. At day 30, the mean vector marking
was 1.5 x 10^-5 copies per cell in those mice receiving 1.0 x 10^7 TU, and 2.2 x 10^-5
copies per cell in those mice receiving 1.0 x10^8 TU and was not significantly different
by Log Rank analysis (Figure 3-5).. Marking of peripheral blood leukocytes in mice
that received 1.0 x 10^8 TU significantly increased to 4.0 x 10^-4 copies per cell at day
60 (p<0.05), declined to 5.0 x 10^-5 copies per cell at day 120, and continued to
Figure 3-5. Dose escalation and marking after neonatal injection of a
lentiviral vector expressing huADA. Peripheral blood (PB) samples were
collected at day 30 from mice that received 1.0 x 10^7 TU/pup and from
mice that received 1.0 X 10^8 TU/pup.

99
significantly decline (p<0.01 when compared by Log Rank analysis to d30, d60 and
d120) until marking was undetectable by day 180 (Figure 3-6).

Copy number analysis was also performed by qPCR on DNA extracted from the lung,
liver, thymus, spleen and bone marrow from ADA-/- mice at 2 months (n=5) or at 6
months (n=5) after neonatal intravenous injection of lentiviral vector (Figure 3-7).
Comparisons between the levels of gene marking in tissues over time were made
using a general linear model. The results of the analyses are displayed as predicted
means as grey bars. If two groups had different predicted means, they were
considered significantly different (p<0.05) based on the linear model. Proviral marking
was highest in the liver, compared to other organs. At two months there were 4.2
copies/cell of vector in the liver, although this declined 20-fold by 6 months to 0.21
copies/cell. The levels of gene marking in the lungs were higher than in the lymphoid
organs at 2 months (0.07 copies/cell) and was slightly decreased at 6 months (0.018
copies/cell). Compared to the liver and lung, proviral marking was much lower in the
thymus at both 2 months (0.004 copies/cell; p<0.05) and 6 months (0.0024 copies/cell;
p<0.05); in the spleen at 2 months (0.004 copies/cell; p<0.05) and 6 months (0.0028
copies/cell; p<0.05); and in the bone marrow at 2 months (0.004 copies/cell; p<0.05)
and at 6 months (0.0004 copies/cell; p<0.05). In cells sorted from the lymphoid organs,
e.g. CD4+/CD8+ T-cells from the thymus and CD19+ B-cells from the spleen, proviral
marking was similar to that observed in fragments from the whole organ from which the
cells were isolated. In all cases, the levels of proviral marking in the hemato-lymphoid
organs were 10-1000-fold lower than the levels of marking observed in the liver and
lung tissues analyzed.

100

Southern blot analysis of the vector species present in the liver at 2 months and six
months showed that non-integrated vector LTR circles were present at 2 months but
not at 6 months (data not shown). However, these vector LTR circles only represented
10% of the total amount of vector detected by southern copy and their loss would not
account for the 10 fold difference (90%) in copy number seen between 2 and 6 months.

ADA enzyme activity. ADA enzyme activity was determined in the thymus, spleen,
liver, lung and plasma (Figure 3-8). Linear analysis was used to determine predicted
means (horizontal gray bars) and groups with differing predicted means were
Figure 3-6. Proviral marking in PB after neonatal injection of a lentiviral
vector expressing huADA. Mice were injected with 1.0x10^8 TU/pup and
peripheral blood samples were collected at day +30 (n=11), day +60 (n=15), day
+120 (n=10) and day +180 (n=7). Copy number was determined by qPCR.

101

significantly different (p<0.05). ADA enzyme activity in the thymus and spleen of ADA-/-
mice injected with the lentiviral vector as neonates were significantly lower than in
those activities found in wild-type mice (p<0.05). In the thymus, spleen and lungs, the
levels of ADA enzymatic activity were similar in ADA -/- mice treated with the vector or
with ADA enzyme replacement therapy. In contrast, ADA enzyme activity in the liver
was always higher (2-10 fold; p<0.05) in mice treated with the lentiviral vector than in
wild-type mice and 10-100-fold higher than in the livers of mice receiving ADA ERT.
with the vector (p<0.05) or wild-type mice.
Figure 3-7. Proviral marking at two and six months after neonatal injection of a
lentiviral vector expressing huADA. Mice were euthanized and tissues were
harvested and analyzed at either 2 months (n=5) or at 6 months (n=5). Of the five
animals analyzed at 6 months, two mice had received weekly ERT with 300 U/kg of
PEG-ADA until day +45; three mice received no ERT. From four of the mice
analyzed at 6 months (ERT n=1; no ERT n=3), cells were isolated using
immunomagnetic separation from the thymus (CD4+CD8+) and spleen (CD19+).
Predicted means from general linear regression is shown by the gray horizontal bars

102

Another method to examine ADA activity is by zymogram analysis, with separation of
proteins from tissues using gel electrophoresis, followed by formazan staining of the
gel to detect ADA enzymatic activity. Zymogram analysis depicted the high levels of
ADA enzyme activity observed in the spleen and thymus of a wild-type mouse,
compared to the relatively lower levels of ADA enzyme activity seen in the liver and
lung (Figure 3-9). However, in ADA-deficient mice, that had received neonatal
injection of the lentiviral vector, there was a remarkable lack of ADA enzyme activity in
the thymus and spleen, but very high levels of ADA enzyme activity in the liver.

Figure 3-8. ADA enzyme activity in ADA-deficient mice two months after
neonatal injection of a lentiviral vector expressing huADA. Mice were
euthanized and blood, thymus, spleen, lung, and liver were harvested and
analyzed at 2 months (n=5). Predicted means from general linear regression is
shown by the gray horizontal bars.

103

Immunohistochemistry. Immunohistochemical analysis of ADA protein expressed in
tissues was performed with either an antibody to ADA protein that cross-reacts with
human and mouse ADA (Santa Cruz, N-300) or an antibody specific to human ADA
(C-20), which is what is expressed by the lentiviral vector. Wild-type liver stained with
N-300 anti-ADA, revealed low levels of immunoreactive ADA protein distributed
relatively homogenously in all of the cells with no spots of dark staining (Figure 3-10).
From ADA-deficient mice injected with the lentiviral vector, livers stained with the N-

Figure 3-9. Zymogram analysis to detect ADA enzyme activity in tissues after
neonatal injection of a lentiviral vector expressing huADA. Analysis was
performed on the samples from one wild-type mouse, one ADA-deficient mouse
treated with enzyme replacement therapy and two mice that received the lentiviral
vector injection as neonates and had gene marking levels in the liver of 1 and 12
copies per cell, respectively. Samples were loaded as 2.5 mg protein per lane.

104

300 anti-ADA antibody revealed very dark cluster of cells with immunoreactive protein,
focally distributed throughout the sections. Furthermore, the level (qualitative) of
staining found in the liver sections corresponded to the amount of ADA enzyme activity
and the number of proviral copies detected in the livers, respectively. Immunoreactive
ADA protein detected with an antibody specific for human ADA (C-20) was found to be
focally distributed in both the liver and lung with some cells distinctly stained within
Figure 3-10. Immunoreactive ADA in livers after neonatal injection of a lentiviral
vector expressing huADA. Livers were harvested and fixed in 10% formalin,
processed and embedded with paraffin, sectioned and stained with an antibody that
cross-reacts with human and mouse ADA protein (N-300, Santa Cruz, Santa Cruz, CA).
A. Wild-type (ADA+/+) liver section stained with an antibody specific to ADA protein.
B - F. Sections of liver from ADA-deficient (ADA-/-) mice 2 months after neonatal
injection of lentiviral vector. Proviral copy numbers and corresponding ADA enzyme
activities are also shown.

105

fields of unstained cells, suggesting the possibility there is focal clonal expansion of
transduced cells during development of the neonatal liver and lung (Figure 3-11).

Correction of immune function. To determine if neonatal injection of the lentiviral
vectors expressing human ADA was sufficient for restoration of immune cell
populations, the absolute numbers of lymphocyte populations in the thymus and spleen
were determined, as well as the ability of splenic T cells to proliferate in response to
Figure 3-11. Immunoreactive ADA in liver and lung two months after
neonatal injection of a lentiviral vector expressing huADA.
A and B. Liver sections were stained with an antibody specific for human ADA
(C-20, Santa Cruz, Santa Cruz, CA). Panel A is 200X and Panel B is 400X.
C and D. Lung sections were stained with an antibody specific for human ADA
(C-20, Santa Cruz, Santa Cruz, CA). Panel C is 400X and Panel D is 630X.

106
mitogenic stimulation. Mice receiving neonatal injections of the lentivirus were
compared to age-matched (2 months) control mice,

ADA-deficient mice receiving a low dose (Blackburn, et al., 2000a) of ERT with weekly
injections of PEG-ADA (300 mg/kg), and untreated ADA-deficient mice at day 16, prior
to expected death between days 19-21. All populations were analyzed using general

Figure 3-12. Absolute numbers of thymocytes and splenocytes in ADA-
deficient mice after neonatal injection of a lentiviral vector expressing
huADA. The absolute numbers of thymocyte and splenocyte populations
were determined in wild-type mice (day +60, n=3), untreated ADA-deficient
mice (day +16, n=5), ADA-deficient mice on ERT (day +60, n=7), ADA-
deficient mice day +60 after receiving ADA Vector (n=5). Inset graph shows
the predicted means from linear regression analysis. There is a significant
difference when the values for the predicted means differ between treatments
within a cell population.

107

linear analysis to determine differences between treatment groups (wild-type, untreated
ADA -/-, ERT, and vector) of the different cell populations. Predicted means are plotted
as inset graphs to indicate significant differences between groups (p<0.05) (Figures 3-
12-15).
Figure 3-13. Absolute numbers of thymocyte sub-populations in ADA-
deficient mice after neonatal injection of a lentiviral vector expressing huADA.
Thymocytes were stained with anti-CD4-PE and anti-CD8-APC and FACS analysis
was performed. Sub- populations were determined in wild-type mice (day +60, n=3),
untreated ADA-deficient mice (day +16, n=5), ADA-deficient mice on ERT (day +60,
n=7), ADA-deficient mice day +60 after receiving ADA vector (n=5). The total
numbers were calculated by multiplying the total numbers of cells by the percentage
of cells in each population divided by 100. Inset graph shows the predicted means
from linear regression analysis. There is a significant difference when the values
for the predicted means differ between treatments within a cell population.

108

Untreated ADA-deficient mice were severely lymphocyte-deficient with low absolute
numbers of thymocytes (1.95x10^7 cells) and splenocytes (2.7x10^7 cells) compared
to wild-type mice (24.3x10^7 thymocytes and 15x10^7 splenocytes) (p<0.05 for both
cell types) (Figure 3-12). Those mice receiving low dose ERT, which should be
enough to keep the animals alive but not correct the SCID phenotype, had slight
improvement in the absolute numbers of thymocytes (5.8 x10^7 cells) and splenocytes
(3.2x10^7 cells), but were significantly lower than wild-type mice (p<0.05). Mice
Figure 3-14. Absolute numbers of splenocyte sub-populations in ADA-
deficient mice after neonatal injection of a lentiviral vector expressing
huADA. Splenocytes were stained with anti-CD4-PE and anti-CD8-APC, or with
anti-CD19-PE and anti-CD45-APC, and analyzed by FACS. Sub- populations
were determined in wild-type mice (day +60, n=3), untreated ADA-deficient mice
(day +16, n=5), ADA-deficient mice on ERT (day +60, n=7), ADA-deficient mice
day +60 after receiving ADA vector (n=5). The total numbers were calculated by
multiplying the total numbers of cells by the percentage of cells in each
population divided by 100. Inset graph shows the predicted means from linear
regression analysis. There is a significant difference when the values for the
predicted means differ between treatments within a cell population.

109
receiving neonatal injections of the lentiviral vector had 50% of the wild-type number of
thymocytes (13.7x10^7 cells) and 30% of the wild-type number of splenocytes
(5.3x10^7 cells), but this was significantly lower than wild-type, but significantly higher
the mice treated with enzyme replacement (p<0.05 for both).

The absolute number and the percentage of thymic T cell sub-populations (single-
positive {SP} CD4+, {SP} CD8+, double positive {DP} CD4+/CD8+, and double-
Figure 3-15. Mitogenic stimulation in ADA-deficient mice after neonatal
injection of a lentiviral vector expressing huADA. Lymphocyte proliferation
was assessed in wild-type mice (day +60, n=3), untreated ADA-deficient mice
(day +16, n=5), ADA-deficient mice on ERT (day +60, n=7), ADA-deficient mice
day +60 after receiving ADA vector (n=5). Splenic lymphocytes were stimulated
with ConA for 48 hours and pulsing with
3
H-thymidine for 20 hours. Cells were
harvested and counted for incorporated
3
H-thymidine CPM. The stimulation index
was calculated by dividing the CPM (in triplicate) of cells stimulated with ConA by
the CPM (in triplicate) of cells not stimulated. Inset graph shows the predicted
means from linear regression analysis. There is a significant difference when the
values for the predicted means differ between treatments within a cell population.

110
negative {DN} CD4-/CD8-) were also analyzed (Figure 3-13). As seen for the total
number of thymocytes, these sub-populations were also all extremely low in untreated
ADA-deficient mice (0.2x10^7 CD4+ cells; 0.06x10^7 CD8+ cells, 0.23x10^7 DN cells;
1.3x10^7 DP cells) compared to wild-type (6.5x10^7 CD4+ cells; 1.1x10^7 CD8+ cells,
DN 1.9x10^7 cells; 15.4x10^7 DP cells) (p<0.05 for each cell population). ADA -/- mice
injected with the lentiviral vector had a significant increase in the number of the CD4+
thymocytes (5.26x10^7 CD4+cells) and double-negative thymocytes (2.2x10^7 DN
cells), compared to untreated mice, but not CD8+ or double-negative thymocytes
(0.5x10^7 CD8+ cells; 6.1x10^7 DP cells). In the mice treated with the lentiviral vector,
the CD4+ thymocytes reached 80% of the wild-type level.

The splenic T cell populations (CD4+, CD8+) and splenic B cell populations (CD19+)
were also analyzed for absolute cell numbers and percentages (Figure 3-14). ADA-
deficient mice had very few detectable splenic CD4+ T-cells (0.09x10^7cells), splenic
CD8 cells (0.08x10^7 cells) and CD19+ B cells (0.61x10^7cells) compared to wild-type
mice (6x10^7 sCD4+cells; 2.2x10^7 sCD8+ cells; 7.0x10^7 CD19+ cells) (p<0.05 for
each cell population). ADA-deficient mice receiving neonatal injection of lentiviral
vector had 58% of the wild-type number of CD4+ (3.5x10^7 cells), 45% of the wild-type
number of CD8+ cells (1.0x10^7 cells) and 63% CD19+ cells (4.4x10^7 cells). The
number of splenic CD4+ T and CD19+ B lymphocytes were significantly higher than in
untreated ADA-deficient mice, but remained significantly lower than in wild-type mice
(p<0.05). There were no differences in the relative percentage of each population
(CD4+, CD8+, CD4+/CD8+, CD4-/CD8-) within mice between treatment groups (data
not shown).

111

Stimulation assays were performed on splenic T lymphocytes to determine if they were
capable of responding to mitogenic stimulation with ConA after neonatal injection of the
lentiviral vector (Figure 3-15). Splenic T lymphocytes isolated from untreated ADA-
deficient mice were unable to proliferate in response to mitogenic stimulation with
ConA. ADA-deficient mice that received treatment with either the lentiviral vector as
neonates or continuous low dose ERT had average stimulation indices of 72% and
60%, respectively, which was not different that for wild-type mice, but which was
significantly better than for untreated ADA-deficient mice (p<0.05).

Evaluation of transduction of murine HSC and germ line. In an effort to determine
if there was transduction of hematopoietic stem cells, bone marrow was harvested from
ADA -/- mice injected with the lentiviral vector as neonates and transplanted into
lethally irradiated, secondary recipients (n=6). At 3 months post BMT, there was no
evidence of vector gene marking in the peripheral blood or bone marrow as determined
by qPCR (data not shown). Furthermore, marrow cells plated at the time of bone
marrow harvest produced very few colony forming units (CFUs) that contained the
vector sequences by PCR (1 of 12, 2 of 22 and 3 of 31 colonies {average=10.8%}
grown from 3 different mice).

Multiple pairs of mice, all of which were injected with the lentiviral vector as neonates
(ADA-/- males and ADA+/- females), were cross-bred to produce F1 generations of
mice. Genomic DNA from tail biopsies from F1 mice (n=31 mice representing the
analysis of n=62 gametes) was subjected to qPCR to determine if there were vector

112
sequences present. There was no evidence of vector sequence in any of the mice
analyzed.

Discussion
For ADA-deficient SCID patients, the use of ex vivo gene transfer by retroviral vectors
into autologous HSC in combination with low dose busulfan chemotherapy and the
withholding of PEG-ADA enzyme replacement therapy appears to be beneficial for
immune reconstitution (Aiuti, et al., 2002; Aiuit, et al., 2009). However, this approach is
clearly an invasive procedure that may pose risks from the effects of the chemotherapy
and/or from insertional oncogenesis from vector sequences inserted into HSC.
Additionally, stem cell-directed gene therapy may be minimally effective for post-
adolescent children, due to decreased thymic function (Trasher, et al., 2005).
Therefore, development of novel approaches to treat ADA-deficient SCID remains
important and a method to provide continuous enzyme replacement may be palliative.

We observed that a single intravenous injection of a lentiviral vector carrying the
human ADA cDNA at the higher of the two dosages evaluated led to prolonged survival
of the ADA-deficient mice to at least six months in most cases, compared to the early
death by three weeks of age uniformly seen in untreated mice. Thus, the systemically-
administered lentiviral vector is able to provide adequate levels of ADA enzyme activity
to prevent or forestall the otherwise fatal phenotype.

113
In addition to prolonged survival, the mice treated with the intravenous vector also had
significant improvement of their immunological systems, with increased numbers of T
and B cells and reconstitution of mitogen-induced T cell proliferative responses. It is
not known if the prolonged survival is due, at least in part, to the immunological
reconstitution, since the mice are kept in clean animal facilities for immune-deficient
mice and may not be challenged with potential pathogens.

The improvements in lymphocyte number and function occurred despite the low
frequency of gene transduction seen in T and B lymphocytes from blood, thymus and
spleen, as well as other blood and marrow cells, including clonogenic myeloid
progenitor cells and transplantable HSC. In fact, proviral marking in peripheral blood
was detectable at three months but not at six months. The levels of gene-marked cells
were similar among T and B lymphocytes and myeloid cells, indicating the absence of
a selective survival of gene-corrected lymphocytes. This is quite different from the
strong selective advantage observed on gene-corrected T lymphoid cells in SCID
patients undergoing matched sibling bone marrow transplant in the absence of marrow
cytoablation or in XSCID infants treated with gene therapy by retroviral vector-
mediated gene transfer to their bone marrow hematopoietic stem cells (Fischer, et al.,
2002). However, the lack of a selective advantage was clearly observed is ADA-
deficient mice when they were given congenic, whole marrow transplants without any
cytoreductive conditioning (Mortellaro, et al., 2006; Carbonaro, et al., 2008).

These findings may indicate that the lymphoid system is rescued in trans by metabolic
effects of ADA produced in other organs analogous to the effects of administered PEG-

114
ADA enzyme replacement, rather than in cis by selective survival of gene-corrected
cells. The observation that there is detectable enzyme activity in the plasma of the
mice injected with the lentiviral vector suggests that some of the ADA enzyme is
leaving the cells where it is expressed and being distributed systemically. This trans-
rescue would be unique to the ADA-deficient form of SCID where the critical missing
protein can have a systemic effect, either by circulating as a source of ADA enzyme
activity or by acting as a metabolic sink, breaking down deoxyadenosine and
adenosine nucleosides and lowering total body pools. Other forms of SCID would not
be expected to benefit from systemic administration of the relevant gene, since the
encoded proteins are cell intrinsic (e.g. common cytokine receptor gamma, Jak3,
Rag1/2).

The lack of HSC transduction by the systemically administered vector stands in
contrast to findings by other investigators. Pan et al, (2002) reported evidence of gene
marking in the bone marrow of mice (0.21-22.7% gene frequency) at 40 days after tail
vein injection of a VSV-pseudotyped lentiviral vector into 8 week old mice. However,
no observations were reported beyond the initial 40 day time-point and secondary
transplants into lethally irradiated recipients were not done. Injection of an
amphotropic MLV-based gamma-retrovirus expressing canine factor IX (1.0 x 10^10
TU/kg) into neonatal hemophilia B mice led to transduction of HSC (up to 0.1 vector
copy per cell), resulting in marked blood cells of all lineages and in transplantable HSC
evaluated in secondary bone marrow recipients, for a total of 28 months (Xu, et al.,
2004). The use of the amphotropic murine Moloney retroviral based vector may be
one reason for the differences in HSC transduction observed between this study and

115
ours. It is not known whether the avoidance of HSC transduction that we observed
would represent a safer approach for gene therapy of human ADA-deficient patients,
compared to approaches targeting HSC, in light of the recent lymphoproliferative
disease associated with gene transfer into HSC of the gamma-C gene in X-linked SCID
(Hacein-Bey, et al., 2003).

We observed the highest levels of integrated vector sequences and expressed ADA
enzymatic activity in the liver, with the lung the second highest of the organs studied.
This bio-distribution pattern is what is typically seen for most viral vectors administered
into the bloodstream of mice, e.g. lentiviral (Pan, et al., 2002; Kobayashi, et al., 2005),
gamma-retroviral (Xu, et al., 2004) and adeno-associated virus (Daly, et al., 1999). It
may reflect the patterns of blood flow, with the lung capillary bed being the first
traversed after injection into a peripheral vein, and the liver parenchyma being more
accessible to vector particles because the endothelial fenestrae of the sinusoids allows
direct access from blood to hepatocytes.

The levels of ADA enzyme in the liver of the treated mice exceeded those in the liver
from wild-type mice, with 2-10-times greater than normal levels of ADA enzyme activity
seen in the liver at 2 months, when there were 1-10 copies of vector per cell on
average. This high level of ADA may be responsible for the beneficial effects of survival
and multi-system correction, including immune function, as either a source of enzyme
that can be distributed systemically or as a “sink” where adenosine and
deoxyadenosine nucleosides can be catabolized. The pattern of liver cells expressing
ADA protein, as revealed by immunohistochemical staining showed focal clusters of

116
positive cells scattered between areas with no detectable immunoreactive ADA protein.
This pattern suggests either single cells were transduced by the vector and multiplied
in situ to form local colonies of transduced cells or focal groups of cells were
transduced by the vector, due to non-uniform access of the liver cells to the vector.
The frequency and density of ADA-expressing foci correlated with the average vector
copy/cell and the ADA enzyme activity measured from the same livers, in each of the
five animals studied.

The lung had the second highest vector copy number and ADA enzyme activity of the
organs examined. Immunoreactive ADA protein was detected in cells in the alveoli, but
not the airways. It is not known whether transduction of pulmonary cells and local
production of ADA is responsible, in part, for the prolonged survival and protection from
the otherwise fatal pulmonary complications describe in ADA-deficient mice
(Blackburn, 2000b). Potentially, the ADA expressed in the liver is sufficient to prevent
the pulmonary complications.

Taken together, these results show that neonatal intravenous injection of a lentiviral
vector expressing human ADA in ADA-/- mice is sufficient to correct laboratory
parameters of immune function, despite the low level of proviral marking and enzyme
activity in the thymus and spleen. Uncorrected ADA-/- pups suffer multi-system failure,
all of which seem to be corrected after a single injection of 1.0 x 10^8 TU after birth,
suggesting the ADA enzyme being produced and detected in the liver, and to a lesser
extent the lung, is correcting these systems, in trans.

117
The specific mechanism(s) by which systemic administration of the lentiviral vector
prolonged the survival of these ADA-deficient mice remain uncertain. Nevertheless,
three of the ten mice followed for six months died between 3-6 months after treatment,
with symptoms similar to those seen in untreated mice, with progressive respiratory
effort and wasting. These relatively late deaths may be a reflection of the decreasing
amounts of vector and ADA enzyme activity seen at six months after vector injection,
compared to two months. It is possible that treatment with a higher dosage of vector
will confer greater benefit and prolonged survival for a greater percentage of mice. The
higher dosage we used, 1 x 10
8
TU for each 1 gm newborn mouse, would convert to
approximately 1 x 10
12
TU for a 10 kg child, if dosing scale-up is linear with body mass.
With current methods for lentiviral vector production, this dosage would represent the
product of an entire 10-50L lot of vector supernatant. While each dosage of vector
could cost in the range of $200,000-300,000 to produce and certify with current
lentiviral vector production methods, this would be equivalent to the cost for PEG-ADA
ERT for one patient for just a single year. However, further dosage escalation may be
limited by the maximal dose it is feasible to produce and vector production capabilities
will be an important factor in moving this type of therapy to the clinic. A better
understanding of the mechanisms of action of this therapeutic approach may allow
greater efficacy to be achieved, with obtainable amounts of vector. The relative merits
of alternative vector systems for achieving liver enzyme productions, especially AAV
serotype 8, remains to be studied for this model compared to lentiviral vectors. Despite
these potential limitations, the use of intravenous lentiviral vector delivery of the ADA
gene may provide.

118
Chapter 4 - Gene Therapy ex vivo in ADA Deficient Mice:
The Role of Enzyme Replacement Therapy and
Cytoreduction

Abstract
ADA-Deficiency results is a severe combined immunodeficiency (ADA-SCID) that is
currently treated by hematopoietic stem cell transplantation (HSCT) with HLA matched
sibling donor marrow or with enzyme replacement therapy (ERT) with pegylated bovine
ADA (PEG-ADA). Recent clinical trials have shown gene therapy (GT) for ADA-
deficient SCID is safe and can provide significant, long-term clinical benefit when
patients are given cytoreductive conditioning with a non-myeloablative dose of busulfan
and ERT is discontinued (Aiuti, et al, 2009). To determine the relative contribution of
the conditioning regime and the ERT discontinuation, we used the murine model of
ADA-deficiency. ADA-deficient mice were either conditioned with 900 cGy (900) or 200
cGy (200) of TBI prior to receiving whole marrow that had been transduced with a
retroviral vector expressing human ADA. After GT, these mice were then continued on
ERT (+ERT) or not (-ERT). The 900+ERT and 900-ERT mice had 100-1000 fold more
proviral marking compared to 200+ERT and 200-ERT mice. There was no difference
in proviral marking between 900+ERT and 900-ERT. However, there was a slight
increase in marking in the spleen, lung and liver; and significant increases (100 fold) in
the thymus, of 200+ERT mice compared to 200-ERT. Immune re-constitution was
more robust in 200+ERT mice compared to 200-ERT and 900+/-ERT mice. Also,
when ERT was given 1 month following GT, proviral marking was the same after 16
weeks as the 200+ERT and 200-ERT mice. In conclusion, cytoreduction is very
important for engraftment and expansion of transduced HSC. However, the use of

119
ERT is less of an important factor in engraftment and expansion; and, may even be
benefit engraftment by providing a detoxified environment of engraftment of HSC and
subsequent thymopoiesis.

Introduction
In humans, adenosine deaminase (ADA) deficiency results in a severe combined
immunodeficiency (SCID), and, if left untreated, results in infant mortality (Hershfield, et
al., 1998). ADA is responsible for deamination of adenosine (Ado) and 2'-
deoxyadenosine (dAdo) to form inosine and 2'-deoxyinosine, respectively. Without
ADA, Ado and dAdo both accumulate in all tissues, however, it is the accumulation of
dAdo and subsequent dATP formation that represent the major mechanism of toxicity
in T lymphocytes (Morgan, et al., 1987). The preferred treatment for ADA-deficient
SCID (ADA SCID) is hematopoietic stem cell transplantation (HSCT) with a matched
sibling donor or if a matched sibling donor is not available, with a parental T-depleted
haploidentical donor. However, when a matched sibling donor is not available there is
significant morbidity and mortality due to graft verses host disease (GVHD) (Haddad, et
al., 1998; Smorgorzweska et al., 2000). When a suitable donor is not available or the
patient is too ill for transplantation, the patient is started on enzyme replacement
therapy (ERT) with bovine ADA conjugated to polyethylene glycol (PEG-ADA;
Adagen!, Enzon, Inc, Piscataway, NJ). While ERT will increase lymphocyte counts
and immune function, lymphocyte counts will remain below normal and immune
function will decrease over time (Chan, et al., 2005). Since the current standard of
care is suboptimal, ADA-deficient SCID is an ideal candidate for gene therapy
approaches. Furthermore, it has been hypothesized that correction of a few

120
autologous hematopoietic stem cells (HSCs) would result in corrected T cell progeny
that would have a strong selective advantage and would eventually fill the T cell
compartment (Kohn, 2002). The selective advantage of corrected T cells in ADA
SCID has been observed in patients that have had a spontaneous reversion of the
mutation in one T cell precursor and over time the T cell compartment is entirely made
up of corrected T cells (Hirschhorn, et al., 1996; Ariga, et al., 2001).

The earliest gene therapy (GT) clinical trials for ADA deficiency used murine retroviral
vectors to transduce a variety of target cells: peripheral T lymphocytes, bone marrow
(Blaese, et al., 1995: Bordignon et al., 1995), CD34+ isolated from bone marrow
(Hoogerbrugge, et al., 1996), and cord blood (Kohn et al., 1995). In all of these
studies, patients were not given cytoreductive conditioning prior to receiving
transduced cells and all patients remained on ERT. These studies demonstrated
safety but not efficacy, as the frequency of gene marked cells remained very low and
there was no evident clinical benefit. However, these studies did showed an
accumulation of gene corrected T cells that increased in frequency when the ERT dose
was either deceased or discontinued, suggesting ERT may blunt the selective
outgrowth of the gene corrected cells (Bordignon, et al., 1995; Kohn, et al., 1998).
Long-term follow-up studies have indicated these cells can persists for more than 10
years, contain different and multiple vector integration sites and are not the selective
expansion of a single T cell clone (Schmidt, et al., 2003; Muul, et al., 2003). In later
trials, after improvements were made in the constructs (methylation resistant) and in
the transduction conditions (fibronectin, cytokines), patients given GT without
cytoreductive conditioning and remained on enzyme replacement therapy did not have

121
clinical benefit. However, when patient given GT with a moderate dose of busulfan and
ERT was discontinued, there was significant clinical benefit, indicating that changing
the approach was essential (Kohn, 2002). Patients treated with this revised protocol
had immune reconstitution with multilineage engraftment of transduced cells, ADA
enzyme activity in all lineages with no detection of toxic metabolites associated with the
accumulation of toxic substrates in ADA deficiency (Aiuti et al., 2002). A recent
publication analyzes the long-term follow-up (1.8-10 years) of these patients, now
numbered at 10, and highlights the success of the revised approach that gave
significant, long-term, clinical benefit (Aiuti et al., 2009).

Although the new approach has conferred clinical benefit, there could be improvements
in outcomes by delimiting the role of cytoreduction and the role of ERT cessation, as
well as determining the potential for a synergistic effect. Thus, the following studies
used a retroviral vector currently being evaluated in clinical gene therapy trials and the
ADA-deficient mouse model to address questions regarding the role of cytoreduction
and ERT in ex vivo gene therapy for ADA SCID (Sokolic, et al., 2006). These
experiments clearly demonstrate the importance of cytoreductive conditioning in
retroviral mediated clinical gene therapy for ADA-deficient SCID.

Materials and Methods
Retroviral vector, packaging and vector stability. The human ADA cDNA was
cloned in the retroviral vector, MND-MFG-huADA (MMA). The ATG transcription start
site of the huADA cDNA was cloned precisely at the ATG transcription start site of the
MMLV env gene, located in the MFG fragment, via the Nco1 restriction site in the env

122
gene (Krall, et al., 1996.). MMA was packaged in GP+E+86 cells (D-10: Dulbecco’s
Modified Essential Medium (DMEM) and 10% FCS, 100 U penicillin/streptomycin), in
which the MMLV gag/pol genes and the MMLV env gene are on two different LTR/"
deleted plasmids (Markowitz, et al., 1988). The pool of transduced GPE cells were
subjected to limiting dilution and clonal populations were grown. Viral supernatants
were harvested from each clone and used to transduce NIH 3T3 cells. After 2 weeks,
genomic DNA was isolated from the transduced cells and Southern blot for the vector
was performed to determine if the construct was intact after integration. The semi-
quantitative Southern blot was performed by digesting 10 ug of genomic DNA isolated
from the clones and a copy number standard (EcoRV) and separated on a 1% Tris
Borate EDTA (TBE) agarose gel at 30 V overnight, and transferred to a nylon
membrane. After cross-linking the DNA to the membrane, a radiolabelled probe to the
human ADA cDNA was hybridized to the membrane as described in Krall, et al. (1996).

Mice. A two stage murine model of ADA deficient SCID (background of 129/Sv and
FVB/N) was generated characterized and provided to us by the Kellems group
(Blackburn, et al., 1998). These mice have trophoblast specific expression of ADA
during gestation, but post-natally they are completely ADA deficient (ADA-/-). ERT
was administered to the mice by weekly intramuscular injection of 300 U/kg of
ADAGEN! (Enzon Pharmaceutical, Piscataway, New Jersey). Mice were housed in
accordance with IACUC (Saban Research Institute at Childrens Hospital Los Angeles)
and the National Institutes of Health guidelines. All animals were handled in laminar
flow hoods and housed in micro-insulator cages in a pathogen-free colony.

123
Bone marrow harvest and adult HSCT. Normal congenic (ADA+/+) female mice
(aged 8-10 weeks) to serve as donors of ADA-replete bone marrow were euthanized
with CO
2
narcosis. Using a 23 g needle attached to 1 ml syringe, bone marrow was
harvested by flushing the bone marrow with Hank’s balanced salt solution (HBSS) from
the femur, tibia, and humeral bones. Pooled marrow was centrifuged for 10 minutes at
800 x g at 10
o
C and re-suspended at 5.0 x 10^7 cells/ml in 0.9% saline (injection, USP;
APP, Schaumburg, IL). Male ADA-/- mice, aged 8-10 weeks, were injected via the tail
vein with 5x10^6 cells and maintained on ERT for 2 months. The mice were not
subjected to cytoreductive conditioning prior to transplant of ADA-replete marrow.

Bone marrow harvest and transduction. As described in the preceding section,
marrow was harvested from ADA-/- male donor mice (8-10 weeks) treated with an
intraperitoneal injection (IP) of 150 mg/kg 5-fluorouracil (5-FU; Americian Pharaceutical
Partners (APP); Schaumberg, IL) at day -3 and euthanized with CO
2
narcosis on day 0.
The pooled marrow was centrifuged for 10 minutes at 800 x g at 10
o
C and re-
suspended in 1 x 10^6 cells/ml in basal bone marrow media (BBMM): Iscove’s
Modified Dulbecco’s Medium supplemented with 30% fetal calf serum (FCS), 1%
bovine serum albumin (BSA; Stem Cell Technologies, Vancouver, Canada), 100 uM 2-
#-mercaptoethanol, 2 mM glutamine, 100 U/ml penicillin/streptomycin and freshly
supplemented with murine IL-3 (10 ng/ml; Biosource International, Inc, Camarillo CA),
murine IL-6 (25 ng/ml; Biosource) and murine stem cell factor (SCF; 2.5 ng/ml;
Biosource). The cells were plated on fibronectin fragment CH-296 (20 mg/ml;
Retronecitin, Takara BIO Inc, Otsu Japan) coated plates. Once in culture, whole
marrow was incubated for 48 hours for pre-stimulation in the presence of the cytokines

124
(mIL-3, IL-6 and SCF) in BBMM. After 48 hours, one half of the medium any tnon-
adherent cells in the flask was asceptically transferred to a 50 ml concial tube and
centrifuged at 800 x g for 10 minutes. The supernatant (medium) was discarded and
the non-adherent cells were re-suspended in the same volume of retroviral vector
supernatant, supplemented with 4 ug/ml polybrene (Sigma, St. Louis MO). After 24
hours, the transduction procedure was repeated with fresh retroviral vector
supernatant.

Cytoablative conditioning and transplantation. Recipient mice were transplanted
with retroviral vector transduced bone marrow cells after receiving cytoreductive
condition by total body irradiation (TBI) on the day of bone marrow transplant (0, 200,
or 900 cGy from a
137
Cesium source). Transduced cells were washed with phenol red-
free HBSS two times and removed from the flask with cell dissociation buffer
(Invitrogen, Carlsbad, CA), for 15 min at 37
o
C. Transduced whole marrow cells were
re-suspended in 0.9% sodium chloride at 5.0 x 10^7 cells/ml and transduced lineage-
depleted cells were re-suspended likewise at 5.0 x 10^6 cells/ml. Male and female
ADA-deficient mice, aged 8-10 weeks, were injected via the tail vein with 5 x 10^6 cells
transduced whole marrow cells or 5 x 10^5 transduced lineage depleted cells. After
transplant, mice were maintained for 3 weeks on tetracycline (100 ug/ml in drinking
water).

Necropsy, tissue harvest, and immunohistochemical analysis. At various time-
points following transplantation, mice were euthanized with CO
2
narcosis and perfused
via cardiac puncture with 15 ml of PBS. The thymus, spleen, bone marrow, liver and

125
right lungs were each harvested into ice cold PBS with 1.0% fetal calf serum (PBS-
1%FCS) in a six well plate. Thymus, spleen, and liver were fixed in 2% para-
formaldehyde followed by dehydration in 100% ethanol. The left lung was perfused
with 2% paraformaldehyde prior to fixing. Immunohistochemistry was performed as
described using anti-huADA monoclonal antibody (C-20; Santa Cruz Biotechnology,
Santa Cruz, CA) (Carbonaro, et al., 2006).

Isolation of T, B and myeloid cells. Using the sterile end of a 1 cc syringe plunger,
single cell suspensions were made by forcing the tissue through a 70 µM mesh. The
cells were counted to measure the total number of cells within the organ, pelleted and
resuspended in PBS-1%FCS as a 1.0 x 10
7
cells/ml suspension. Antibodies conjugated
to magnetic beads were used to purify T cells (anti-CD4/8) from thymocytes, B cells
(anti-CD19) from spleen and myeloid cells (anti-CD11b) from bone marrow with a
magnetic separation system (Antibodies, LS Midi columns and magnetic separation
apparatus: Miltenyi Biotec, Auburn, CA). Samples of the unpurified cells and the
purified cells were set aside for immunophenotype determination and the remainder of
the cells were used to extract DNA for determination of proviral copy number.

Immunophenotype. All antibodies and appropriate isotype controls used are murine
specific and are from BD/Pharmingen (San Diego, CA). Prior to perfusion, peripheral
blood was harvested at the time of euthanasia for staining with the following antibodies
for the determination of immunophenotype: anti-CD4-PE/anti-CD8-APC (T
lymphocytes), anti-CD19-PE/anti-CD45APC (B lymphocytes), anti-Mac1-PE/anti-
Gran1-PE/anti-CD45-APC (myeloid cells), anti-DX5 (pan NK)-PE/anti-CD3-APC (NK

126
lymphocytes). Single cell suspensions of the thymus, spleen and bone marrow, as
described above, were stained with the following: thymocytes with anti-CD4-PE and
anti-CD8-APC; splenic T cells with anti-CD4-PE and anti-CD8-APC, splenic B cells
with anti-CD19-PE and anti-CD45-APC; bone marrow cells with anti-CD11b (myeloid)-
PE and anti-CD45-APC. All cell populations were analyzed on a FACS Calibur (with
CellQuest Software (Becton Dickenson, Immunocytometry Systems, San Jose, CA).
Total cell counts were determined by CBC analysis on a 950 Hemavet Analyzer (Drew
Scientific, Dallas TX).

Proliferation assays and B cell function. Splenocytes were made into a single cell
suspension, red cells were lysed with ACK buffer and one third of the cell suspension
was used to determine proliferation in response to concanavallin A (ConA; Sigma
C2631) stimulation. For each animal, splenocytes were plated in triplicate at 2.5 x
10^5 and 3.5 x 10^5 cells per well in 96-well, U-bottom plates with (stimulated) and
without (unstimulated) ConA (60 mg/ml). After incubation at 37ºC (5% CO
2
) for 48
hours, the cells were pulsed with
3
H-thymidine (1 "Ci per well) and incubated for an
additional 20 hours. Cells were harvested with a Ph.D. Harvester (Brandel,
Gaithersburg, MD) and counted in a Beckman Scintillation Counter (BD, San Diego,
CA). The stimulation index was calculated by dividing the average c.p.m. of the
stimulated population by the average c.p.m. of a parallel unstimulated population.

Proviral copy number. Proviral copy numbers were determined by real time
quantitative PCR (qPCR). DNA from tissues and cells populations purified from
lymphoid tissues was extracted using phenol/chloroform and re-suspended in TE. All

127
DNA was quantitated using fluorimetry and a DNA specific dye (Hoescht dye).
Quantitative PCR was performed with primers and probe designed to amplify
integrated sequences of MND-MFG-huADA: sense primer (5’ - tca atg cgg cca aat cta
gtt), anti-sense primer (5' - tgg act aat cga tac cgt cga c - 3') and the TAMRA probe
sequence (6FAM - tcg acc tgc tct ata aag cct atg gga tgc - Tamra). The primer
concentrations (sense and antisense) were 400 nM and the probe concentration was
50 nM in all reactions. All reactions utilized Universal Master Mix (Applied Biosystems,
Inc. (ABI; Fullerton, CA) and were run under default conditions in the 7900 Sequence
Detector System (ABI). Each of the wells contained 350 ng of template DNA and they
were compared to 350 ng of DNA from a set of copy number standards. The
standards were produced using a clonal population of HT29 cells containing two copies
of the MND-MFG-ADA provirus (as determined by Southern blot analysis), diluted into
DNA of untransduced HT29 cells for sensitivity of 1:100,000 cells or 0.00002
copies/cell.

Results
ADA deficiency in the mouse results in a severe multi-system defect that includes
severe combined immunodeficiency (SCID) as well as pulmonary insufficiency that is
fatal by day 20 of life. Thus, survival after gene therapy and cessation of ERT is a
potent test for efficacy. The first series of experiments were designed to delimit the
role of cytoreduction prior to gene therapy and the role of ERT after gene therapy.

128
Retroviral packaging and titer. The retroviral vector, MND-MFG-ADA, consists of the
Moloney Murine Leukemia Virus Backbone, with a modified retroviral LTR referred to
as MND (Figure 4-1A). MND is a retroviral LTR isolated from the myeloproliferative
sarcoma virus (M) that has a transcription factor binding site (sp1), with the deletion of
a conserved sequence shown to bind a repressor of transcription known as the
‘negative control region’ (N), and the primer binding site (PBS) of an endogenous
murine retrovirus, the dl587rev (D), which has a G to A mutation at bp +160, drastically

Figure 4-1. Retroviral construct expressing human ADA.
A. MND-MFG-huADA (MMA) was packaged in GP+E cells and were pseudotyped
with an ecotropic envelope.
B. Transduced clones were analyzed for copy number and vector stability by
Southern Blot.
*Clones used to make viral supernatant for the transduction of marrow in these
studies.

129
reducing the restriction of expression in embryonic carcinoma cells and in murine HSC
compared to the MMLV PBS (Challita, et al.,1995; Haas, et al., 2003). The MND LTR
was shown to have consistent and persistent expression in murine HSC after
transplantation into primary and secondary recipients when compared to the MMLV
LTR (Robbins, et al., 1998; Halene, et al., 1999). Bi-sulfide sequencing and
methylation sensitive Southern blot revealed that the MND vector was more resistant to
silencing associated with the methylation of CpG islands in the LTR (Wang, et al.,
1998). The MFG fragment is a small fragment of the 5’ untranslated region of MMLV
env that contains a splice acceptor site that has been shown to enhance splicing and
increase expression of the transgene (Krall, et al., 1995). MMA was packaged in
GP+E cells (Markowitz, et al., 1988). The transduced pool was subjected to limited
dilution and clonal populations were grown. Viral supernatant was harvested from the
clones and used to transduce 3T3 cells. After 2 weeks, genomic DNA was isolated
from the transduced cells and southern analysis for the vector was performed to
determine if the construct was intact after integration (Figure 4-1B). The hybridized
band (probe is to the ADA cDNA) is the correct size and there is no evidence of
rearrangements. Based on the amount of ADA enzyme activity (~120 U/mg/min)
detected in the 3T3 cells, clones #3 and #18 were elected as the producer clone for
these experiments (data not shown).

130

Experimental design. Whole marrow was isolated from 8-10 week old ADA-deficient
male donors and transduced after 48 hours of pre-stimulation in IL-3, IL-6 and Stem
Cell Factor (Figure 4-2). Recipient mice were conditioned with either 200 or 900 cGy
total body irradiation (TBI) and then either maintained on ERT (250 U/kg PEG-ADA IM
weekly) or not (200+/-ERT or 900+/-ERT). Each recipient received 5 x 10^6 cells in a
100 ul volume. Quantitative polymerase chain reaction (qPCR) was used to determine
the gene transfer efficiency of the transplanted cells for each experiment. Prior to
infusion, the transduced marrow cells were found to contain between 0.1 and 1.2
copies per cell (Figure 4-3A).
Figure 4-2. Ex-vivo gene transfer with retroviral vector MMA into ADA-deficient
marrow: experimental design.

131

Survival. In general, those mice that were not maintained on ERT had lower survival
levels than those mice that were maintained on ERT after transplant (Figure 4-3B).
Mice conditioned with 900 cGy without ERT (900-ERT) had 50% survival out to four
months, compared to 67% survival in mice conditioned with 900 cGy and receiving
ERT (900+ERT). Those mice conditioned with 200 cGy without ERT (200-ERT) had
58% survival compared to 73% survival in mice conditioned with 200 cGy and receiving
ERT (200+ERT).
Figure 4-3. Transduction efficiency and survival after gene therapy. ADA-
deficient (ADA-/-) marrow was transduced and administered to ADA-/-recipients,
conditioned either with 200 cGy or 900 cGy. The recipients were either maintained
on enzyme replacement therapy (ERT) or not.
A. Efficiency of transduction was determined by qPCR in transduced marrow on
the day of infusion.
B. Survival of recipients to 120 days

132

Proviral marking in tissues. After 4 months post transplant, the mice were
euthanized and the tissues were analyzed for vector copy numbers by qPCR (Figure
4-4). The copy number was significantly higher (p<0.01) in all tissues analyzed from
those recipients conditioned with 900 cGy (900+/-ERT) than recipients conditioned with
200 cGy (200+/-ERT). There were no significant differences in the amounts of vector
proviral marking in the lymphoid tissue (thymus, spleen, marrow) between those
animals maintained on ERT or not. Proviral marking was 1000-fold higher in the
thymus (1 copy/cell) and 100-fold higher in the spleen (0.8 copies/cell) and marrow (0.5
copies/cell) of 900+/- mice mice compared to 200+/- ERT mice. However, in those
mice conditioned with 200 cGy, there were more copies per cell in the lung (>6-fold)
and liver (>10 fold; p<0.01) in 200+ERT mice compared to 200-ERT mice.

Proviral marking In Isolated T, B and myeloid cells. Cells were isolated from the
thymus, spleen and marrow to determine the vector copy numbers in thymic T cells,
splenic B cells and in marrow myeloid cells (Figure 4-5). Across all conditions, there
was no difference in the level of vector proviral marking between the isolated cells from
the spleen (CD19+) and the marrow (CD11b+) compared to the tissues from which the
cells were isolated. However, in the thymus of 200+ERT mice, there was 10-fold more
marking in the CD4+/CD8+ cells than in all thymocytes, and there was significantly
more marking (100-fold; p<0.01) in CD4+/CD8+ thymocytes isolated from the thymus
of 200+ERT mice compared to the CD4+/CD8+ thymocytes isolated from the thymus of
200-ERT mice. There was no difference in the amount of marking in tissues and

133
isolated cell populations from 900+ERT mice compared to 900-ERT mice. In contrast,
there was always slightly more marking in all tissues and isolated cell populations from
200+ERT mice compared to 200-ERT mice, although these differences were only
significant for the thymus in 200+ERT mice (p<0.01).

Figure 4-4. Proviral marking in ADA-deficient mice after ex vivo gene
therapy.
The ADA-/- recipient mice were conditioned with either 900 or 200 cGy and
remained on ERT or not (900+ERT, n=10; 900-ERT, n=12; 200+ERT, n=9;
200-ERT, n=6). Tissues were harvested 4 months after recipients received
transduced cells **Significantly higher marking with 900 cGy compared to 200
cGy (p<0.01). Data are means plus or minus SEM.

134

Absolute lymphocyte counts and immunophenotype. The 200+ERT mice had
significantly more absolute total thymocytes (p<0.01, Figure 4-6A) and significantly
more single positive CD4+ and CD8+ thymocytes (p<0.05, Figure4-6B) than 200-ERT
mice, 900+ERT and 900-ERT mice. The 200+ERT mice also had significantly more
total splenocytes (p<0.05) and significantly more splenic CD19+ B-cells
(CD19+p<0.05) compared to 200-ERT mice, 900+ERT and 900-ERT mice (Figure 4-
6A and 4-6C). The 200+ERT mice also had significantly more splenic T cell cells
(CD4+ and CD8+, p<0.01) compared to the 200-ERT mice (p<0.05; Figure 3C). In
Figure 4-5. Proviral marking in ADA-deficient hematopoietic tissue after ex
vivo gene therapy. The recipient mice were conditioned with either 900 or 200
cGy and remained on ERT or not (900+ERT, n=10; 900-ERT, n=12; 200+ERT,
n=9; 200-ERT, n=6). Tissues were harvested and cells were isolated 4 months
after recipient ADA-/- mice received transduced cells. *Significantly higher
marking with ERT than without (p<0.05). **Significantly higher marking with 900
cGy compared to 200 cGy (p<0.01). Data are means plus or minus SEM.

135
fact, 4 months after gene therapy 200+ERT mice there was no difference in
lymphocyte counts, especially in the spleen, compared to mice that received HSCT of
normal congenic marrow with no conditioning (HSCT-ERT) (Figure 4-6A-D).

Mitogenic proliferation assay. When equivalent numbers of splenic T cells were
stimulated with ConA, there were no differences in the stimulation index for mice from
any of the experimental arms. These results suggest that the cells that are present are
fully functional, even when the absolute numbers differ (Figure 4-6D).

Absolute number of gene marked cells. The absolute number of marked cells in
the thymus, spleen, and their relative sub-populations, was determine by multiplying
the copy number in either the thymus or spleen by the absolute number of the relevant
population of cells. In Figure 4-6, we observed more cells in the thymus, spleen and
their relative sub-populations in the 200+ERT mice. However, the increase in cell
number on ERT would be a combination of the corrected or gene marked cells, as well
as the uncorrected cells rescued by ERT. The analysis of absolute marked cells
reveals that there are significantly more marked cells in the thymus and spleen in
900+/-ERT (100-1000 fold; p<0.01) mice compared to 200+/-ERT mice in all
populations (Figure 4-7). Although not significant, the 900+ERT mice had 4.0 fold
more marked cells in the thymus and in the DP thymocyte sub-population compared to
the 900-ERT mice. The 200+ERT had significantly more marked cells in the thymus
(10 fold; p<0.05) and in all of the thymic subpopulations (15-100 fold; p<0.05)
compared to the 200-ERT mice. This finding is similar to the significant difference in
copy number (100-fold; p<0.05) that was observed in CD4/CD8 cells isolated and

136

Figure 4-6. Immunophenotype and function after ex vivo gene therapy.
The recipient mice were conditioned with either 900 or 200 cGy and remained on ERT
or not. All mice were age-matched in the experimental arms (Control ADA+/+, n=6;
900+ERT, n=10; 900-ERT, n=12; 200+ERT, n=9; 200-ERT, n=6; ADA-/- BMT, n=3;
ADA-/-ERT, n=6). * Significantly higher than 200-ERT (p<0.05) **Significantly higher
than 900-ERT (p<0.01). (Mean+/-SEM).
A. Absolute number of thymocytes and splenocytes.
B. Absolute number of thymic sub-populations (CD4+; CD8+; double positive (DP):
CD4+/CD8+; double-negative (DN): CD4-/CD8-).
C. Absolute number of splenic sub-populations (CD4+; CD8+; CD19+).
D. Lymphocyte proliferative function was assessed by stimulating splenocytes with
concanavalin A (conA). Cells plated at 2.5x10^5 and 3.5 x 10^5 cells/well. Only data
of 3.4 x 10^5 cells/well are shown. The stimulation index is result of c.p.m. of
stimulated cells divided by c.p.m. of unstimulated cells.

137
analyzed separately for copy number in 200+ERT and 200-ERT mice (Figure 4-5).
However, there was no difference in the number of marked mature lymphocyte
populations (splenocytes, sCD19+, sCD4+, sCD8+) between those mice on ERT and
those not on ERT at either TBI dose.

Figure 4-7. Absolute number of marked cells after cytoreductive conditioning
and ex vivo gene therapy. Recipient mice were conditioned with either 900 or 200
cGy and remained on ERT or not. (Mean+/-SEM). * Significantly higher than
200+ERT and 200-ERT (p<0.05) **Significantly higher than 200+ERT and 200-ERT
(p<0.01). Absolute number of cells determined by multiplying the frequency of marked
cells in either the thymus or spleen by the absolute number of cells in the subset.
A. Thymocytes and splenocytes.
B. Thymic sub-populations (CD4+; CD8+; double positive (DP): CD4+/CD8+; double-
negative (DN): CD4-/CD8-).
C. Splenic sub-population (CD4+; CD8+; CD19+).

138
Long Course ERT And Short Course ERT After Gene Therapy
Experimental design. The next series of experiments were designed to evaluate the
effects of short-course (1 month) ERT verses long-course ERT after gene therapy
(Figure 4-8). Marrow was harvested from male donor ADA-/- mice and transduced with
the MMA retroviral vector. All recipients were conditioned with 200 cGy TBI and either
maintained on ERT for the duration of the experiment (200+ERT), or only for one
month after the gene therapy (200+1m ERT, or not at all (200-ERT). Recipients were
euthanized and analyzed at either 2, 4, 10 or 16 weeks. Mice were analyzed for tissue
copy number, immunophenotype, T and B cell function, and absolute marking of
lymphocyte populations. All mice were conditioned with low dose TBI, therefore,
surivival was high, with only two mice (one 200+ERT and one 200-ERT; 2 out of 32
total treated) dying within one month of GT (data not shown).

Figure 4-8. Experimental Schema: Effects of short-course (1 month) ERT
verses long-course ERT after gene therapy on frequency of gene marking and
immune reconstitution. ADA-/- recipient mice were conditioned with 200 cGy
and either remained on ERT for the duration of the experiment (solid line), remained
on ERT for 1 month (4 wk) after GT (solid line to dotted line) or did not remain on
ERT after GT (dotted line). Recipients were analyzed at 2, 4, 10 and 16 weeks.

139
Proviral marking. At 2 weeks after gene therapy there was no difference in proviral
marking in the thymus, spleen, bone marrow, lung and liver from 200+ERT mice
compared to 200-ERT mice. Marking was approximately 0.1 copies/cell in all tissues
analyzed (Figure 4-9). At 4 weeks after gene therapy, there was no difference in
marking in all tissues analyzed from 200+ERT mice compared to 200-ERT mice,
although marking was 10 fold lower (0.01 copies/cell) in all tissues except the lung,
which remained unchanged (0.1 copes/cell).

Figure 4-9. Proviral marking in ADA-deficient mice after ex vivo gene therapy:
a comparison of long-course ERT and short-course ERT. Recipients were
conditioned with 200 cGy prior to GT and either maintained on ERT long term or for
one month or not at all. Mice were analyzed at 2, 4, 10, and 16 weeks (2w n=2, 4w
n=3, 10w n=4, 16w n=4). Proviral copy number determine by qPCR on DNA
extracted from cell suspensions. Data are means plus or minus SEM.

140

At 4 weeks, ERT was discontinued in a portion of the 200+ERT mice to evaluate the
effect of ERT for 1 month after gene therapy (200+1m ERT). At 10 weeks, there was
no difference in marking in all tissues analyzed from 200+ERT mice compared to 200-
ERT mice. However, marking increased ~5-10 fold (0.05-0.10 copies/cell) in thymus,
spleen, and marrow and decreased 10 fold (0.01 copies/cell) in the lungs from
200+ERT and 200-ERT mice from week 4 to week 10. At week 10, six weeks after
ERT was discontinued, marking was 10 fold less in the thymus (0.01 copies/cell) and
bone marrow (0.001 copies/cell) from 200+1m ERT mice compared to marking in the
thymus and bone marrow from 200+ERT and 200-ERT mice. Interestingly, when
compared to their original cohort, 200+ERTmice at 4 weeks, marking in the 200+1m
ERT mice remained the same in the thymus (0.01 copies/cell), increased 10 fold in the
spleen (0.1 copies/cell) and decreased 10 fold lower in the bone marrow (0.001
copies/cell) and lung (0.1 copies/cell) from week 4 to week 10.

By week 16, however, there was no difference in proviral marking in the thymus,
spleen and bone marrow between the treatment groups, 200+ERT, 200-ERT and
200+1m ERT. However, marking in the lung and liver from 200+ERT mice was less
(~5 fold) compared to marking in the lung and liver of 200-ERT and 200+1m ERT mice.
Furthermore, marking decreased ~3-10 fold in all tissues from 200+ERT mice from
week 10 to week 16, whereas marking in all tissues from 200-ERT mice was
unchanged from week 10 to week 16. Marking increased 10 fold in bone marrow and
was unchanged in other tissues from 200+1m ERT mice from week 10 to week 16.

141
Peripheral blood cell count. All recipients received 200 cGy for cytoreductive
conditioning prior to being infused with transduced whole marrow. At the time of
euthanasia, peripheral blood (PB) was harvested via cardiac puncture prior to
perfusion for complete cell count (CBC) to monitor white blood cells (WBC) and
lymphocyte counts. With time, the concentration of PB WBC increased with time in all
treatment groups (Figure 4-10). There are no significant differences in lymphocyte
counts across the time points (2, 4, 10, 16 weeks) or between the treatment groups.

Figure 4-10. Peripheral blood (PB) white blood cells (WBC) and
lymphocytes concentration after ex vivo gene therapy. Concentration
determined by complete blood cell (CBC) count. Peripheral blood was
harvested by cardiac puncture prior to perfusion with PBS. Mice were
analyzed at 2, 4, 10, and 16 weeks (2w n=2, 4w n=3, 10w n=4, 16w n=4).
Each treatment group had n=3, except 16w-ERT n=4. Data are means plus or
minus SEM.

142
Absolute lymphocyte counts andi immunophenotype. Compared to the
previously described experiment, mice were analyzed at multiple time intervals that
allowed for the examination of lymphocyte populations in the period just after
conditioning and GT. The absolute number of thymocytes was ~2 fold higher in those
mice remaining on ERT in weeks 2, 4, and 10, but by week 16 there is no difference
between 200+ERT and 200-ERT (Figure 4-11A). There was a steady increase (2 fold)
in the number of thymocytes in both 200+ERT and 200-ERT between weeks 2 to 4,
however, this increase was followed by a steady decrease between weeks 4 to 16. At
10 weeks, 6 weeks without ERT, 200+1m ERT mice had 3 fold more thymocytes
compared to 200-ERT mice. The absolute number of thymocytes across all time
points and treatment groups approached the number of thymocytes measured in
normal mice.

The absolute number of marked thymocytes was 6 fold higher at 2 weeks in the
200+ERT mice compared to 200-ERT (Figure 4-11B). However, by 4 weeks, the
number of marked thymocytes decreased 10 fold in both 200+ERT and 200-ERT mice
even though week 4 had the most total thymocytes. As seen in the total thymic
population, the absolute number of thymic sub-populations (single positive CD4+ and
CD8+, double positive CD4+/CD8+ (DP) and double negative CD4-/CD8-) was highest
at 4 weeks, whereas the number of marked thymocytes was lowest at 4 weeks in both
200+ERT and 200-ERT mice (Figure 4-12). Despite higher absolute DP counts in
200+1m ERT mice compared to 200+ERT and 200-ERT at 10 weeks, there was no
difference in the number of marked thymocytes between the 200+ERT, 200-ERT and
200+1m ERT mice at 16 weeks.

143

Figure 4-11. Absolute number of thymocytes and splenocytes after ex
vivo gene therapy. Recipients were conditioned with 200 cGy prior to GT
and either remained on ERT long term or short term or not at all. Cell
suspensions were made from whole thymus and spleen, and counted. Mice
were analyzed at 2, 4, 10, and 16 weeks (2w n=2, 4w n=3, 10w n=4, 16w
n=4). Each treatment group had n=3, except 16w-ERT n=4. Data are means
plus or minus SEM.
A. Absolute number of marked thymocytes and splenocytes. Absolute
number of thymocytes/splenocytes was multiplied by the frequency of marked
cells in either the thymus or spleen.
B. Absolute number of thymocytes and splenocytes.

144

Figure 4-12. Absolute number of thymic sub-populations after ex vivo
gene therapy. Recipients were conditioned with 200 cGy prior to GT and either
remained on ERT long term or short term or not at all. Mice were analyzed at 2,
4, 10, and 16 weeks (2w n=2, 4w n=3, 10w n=4, 16w n=4). Thymic sub-
populations were determined by flow cytometry (CD4+; CD8+; double positive
(DP): CD4+/CD8+; double-negative (DN): CD4-/CD8-). Data are means plus or
minus SEM.
A. Absolute number of marked cells in the thymic sub-populations. The
absolute number of thymic sub-populations was multiplied by the frequency of
marked cells in thymus.
B. Absolute number of thymocyte sub-populations was determined by
multiplying the percentage of cells in a sub-population by the absolute number
of thymocytes in the thymus.

145

Unlike the thymocytes, the absolute number of splenocytes was uniformly half the
number of splenocytes in normal mice across all time points and treatments (Figure 4-
11A) and the absolute number of CD19+ B lymphocyte and CD4+ and CD8+ T
Figure 4-13. Absolute number of splenic B cells after ex vivo gene therapy.
Recipients were conditioned with 200 cGy prior to GT and either remained on ERT
long term or short term or not at all. Mice were analyzed at 2, 4, 10, and 16 weeks
(2w n=2, 4w n=3, 10w n=4, 16w n=4). Data are means plus or minus SEM.
A. Absolute number of marked splenic CD19+ B cells. The absolute number of
splenic B-cells was multiplied by the frequency of marked cells in spleen.
B. Absolute number of splenic CD19+ B cells was determined by multiplying the
percentage of CD19+ B cells by the absolute number of splenocytes.

146
lymphocyte populations did not vary across time points or treatments (Figure 4-13A
and Figure 4-14A). However, as in the thymocytes, the absolute number of gene
marked splenocytes was also lowest at week 4, when the total number was the highest

Figure 4-14. Absolute number of splenic T cells after ex vivo gene therapy. Recipients
were conditioned with 200 cGy prior to GT and either remained on ERT long term or
short term or not at all. Mice were analyzed at 2, 4, 10, and 16 weeks (2w n=2, 4w
n=3, 10w n=4, 16w n=4). Data are means plus or minus SEM.
A. Absolute number of marked splenic CD4+ and CD8+ T cells. The absolute number
of splenic T cells was multiplied by the frequency of marked cells in spleen.
B. Absolute number of splenic CD4+ and CD8+ T cells was determined by multiplying
the percentage of T cell sub-population by the absolute number of splenocytes.

147
(Figure 4-11B). However, the absolute number of marked lymphocytes sharply
decreased (10 fold) at week 4, and rebounded by week 10. But by week 16, there
were less lymphocytes in 200+ERT and 200+1m ERT mice, compared to 200-ERT
mice (Figure 4-13B and Figure 4-14B).

Discussion
ADA-deficient SCID can be cured with HSCT from a matched sibling, if one is available
(Hershfield, et al., 1998) or can be treated chronically with ERT with PEG-ADA,
although immune function is below normal and declines with time (Chan, et al., 2005).
Gene therapy for ADA SCID is a promising alternative for those patients lacking a
matched sibling donor and for those not responding to ERT. Although early trials
demonstrated safety, there was no clinical benefit. In the years between the early trials
and later trials, significant advances were made in the retroviral constructs,
transduction conditions and approach to the therapy (Kohn and Candotti, 2009).

In current gene therapy trials, ADA-deficient patients are conditioned with a
cytoreductive dose of busulfan and ERT is discontinued prior to re-infusion of
autologous, retrovirally transduced CD34+ cells (Aiuti, et al., 2002; Sokolic, et al.,
2007). It was hypothesized that conditioning would ‘make space’ in the marrow
compartment and the removal of ERT would give the transduced cells a selective
advantage. This approach has resulted in high frequency of gene marked cells,
especially in the T cell compartment, and a clear clinical benefit for the patients (Aiuti,
et al., 2009), These results are in contrast to the first generation of clinical trials in
which patients were not conditioned and ERT was not discontinued. As a result, the

148
frequency of gene marked cells was very low and there was no clinical benefit (Muul, et
al., 2003; Kohn, et al., 1998). However, from these clinical studies it is impossible to
determine the individual role of the relevant factors. As gene therapy moves closer to
becoming a standard of care for ADA-deficient SCID, it will be important to know if the
cytoreductive conditioning or the cessation of ERT or the synergy of both is most
important for the engraftment of transduced HSC and for possible improvement of the
protocol.

Cytoreductive conditioning. ADA-deficient mice were conditioned with either 200 or
900 cGy of TBI, and transplanted with transduced ADA-/- marrow. After
transplantation, ERT was either continued or not. Mice receiving the 900+/-ERT
(900+ERT and 900-ERT) always had higher proviral marking (10-1000 fold) in the
thymus, spleen, marrow, lung and liver compared to the proviral marking in tissues
form mice receiving 200+/-ERT (200+ERT and 200-ERT) (Figure 4-4). Also, the
absolute number of marked cells in the thymus and spleen was 100-1000 fold higher in
the 900+/-ERT mice compared to the 200+/-ERT mice (Figure 4-7). These results
indicate that the dose of cytoreductive conditioning with TBI is important in determining
the amount of engraftment and expansion of transduced HSC and progenitors.
Likewise, patients that had the longest period of neutropenia following conditioning with
busulfan and GT, had the highest frequency of gene marked cells (Aiuti, et al, 2009a).
Thus, it seems that conditioning is very important in the amount of engraftment. The
use of a moderate dose of conditioning, such as used in the current clinical trials, is
sufficient and not associated with high risk. Depsite the higher engraftment at 900

149
cGy, the use of more cytoablative conditioning is not warrented since the higher dose
was associated with decreased survival especially in those mice without ERT (Figure
4-3).

ERT. The use of concurrent PEG-ADA ERT in patients/mice receiving gene corrected
cells has been a confounding variable in determining the efficacy of engraftment and
expansion of corrected cells in ADA SCID. In the early clinical trials for ADA
deficiency, some patients with a higher frequency of gene marked cells either had their
ERT reduced or discontinued and this resulted in an increase in the detection of gene
marked cells in peripheral blood T lymphocytes (Kohn, et al., 1998; Aiuti, et al., 2002b).
Also, in one patient, uncorrected cells obscured a population of corrected T cells,
arising from a progenitor that had experienced a spontaneous reversion of a mutant
allele, when the patient resumed ERT (Arredondo-Vega, et al., 2002). From these
results researchers hypothesized that concurrent ERT may blunt the selective
advantage of the gene corrected cells, thus decreasing the detection of marked cells
(Kohn, 2002).

As described earlier, ADA-/- mice were conditioned with either 900 or 200 cGy and
maintained on ERT or not. Surprisingly, there was no difference in the amount of gene
marking detected in any analyzed tissue from 900+ERT mice compared to 900-ERT
mice (Figure 4-4). Similarly, there was no difference in the amount of gene marking
detected in the thymus, spleen, and marrow from 200+ERT mice compared to 200-
ERT mice. However, the proviral copy number in CD4+/CD8+ thymocytes isolated
from the thymus was 100 fold higher from the 200+ERT mice compared to the 200-

150
ERT mice (Figure 4-5). Likewise, there was a 100 fold increase in the absolute
number of marked thymocytes in the 200+ERT mice compared to the 200-ERT mice.
ADA is normally expressed at high levels in the (cortical) thymus, and is required for
the deamination of adenosine (Ado) and 2'-deoxyadenosine (dAdo) that accumulate
with apoptotic activity associated with positive and negative selection in thymopoiesis
(Chechik, et al, 1981). Developing thymocytes are especially vulnerable to the
accumulation of dAdo in the absence of ADA and never mature and eventually
undergo apoptosis. After engraftment of corrected HSC and T cell progenitors,
thymopoiesis may need to occur in a sufficiently de-toxified thymus in order to
maximize the number of corrected thymocytes. The presence of ERT may augment
the ADA supplied by the corrected thymocyte to further expand the population.

Proviral marking was also increased in the lung and liver in 200+ERT mice compared
to 200-ERT mice. It is not known if this is an accumulation or an expansion of blood
cells within the de-toxified organ. Given survival was slightly higher in 200+ERT than
200-ERT, it is not clear how important the increased marking in the lung and/or liver is
to survival. Mortellaro, et al. (2006) reported that in mice conditioned with 600cGy and
given no ERT, there was a threshold of marking that had to be achieved for survival.

Selective expansion in lymphocytes. In patients conditioned with one quarter of a
myeloablative dose of busulfan, marking is seen in all blood cell lineages, with the
highest frequency of gene marked cells in peripheral blood mature T lymphocytes
(88%) and B lymphocytes (52%) compared to other non-lymphoid lineages (3-10%)
(Aiuti, et al., 2009). Patients undergoing HSCT, also see the selective engraftement

151
and expansion of mature T cells (Hirschhorn, et al., 1981). However, in the ADA-
deficient mouse, HSCT with whole congenic marrow did not show a selective
advantage for normal lymphocytes (Mortellaro, et al., 2006; Carbonaro, et al., 2008).

In this study the only indication that there may be some selective expansion of mature
lymphocytes was seen in 200-ERT mice after 16 weeks without ERT (Figure 4-13B
and Figure 4-14B). The 200-ERT had 3-4 fold more splenicor mature B and T
lymphocytes compared to the 200+ERT and 200+1m ERT mice. A selective
expansion of mature lymphocytes has been observed in young adult ADA-deficient
mice when conditioned with 600 cGy prior to infusion of lentivirally transduced ADA-/-
marrow without concurrent ERT (Mortellaro, et al., 2006). Proviral marking was
observed in all blood cell lineages, but the engraftment of donor cells was highest in
mature splenic T and B lymphocytes compared to thymocytes and bone marrow
erythroid and myeloid cells, indicating a stronger selective advantage for corrected
mature lymphocytes.

The difference between the whole marrow HSCT and GT in the ADA-deficient mouse
may be in the actual dose of corrected cells administered. In HSCT, 100% of the cells
express ADA and in GT, only some portion of those transduced cells will express ADA.
We hypothesize that there is a certain threshold for observing a selective advantage for
the mature lymphocyte populations. In HSCT of ADA-deficient mice, there may be
enough ADA expression for systemic detoxification and rescue of uncorrected cells.
Given the severe pulmonary insufficiency, experimental design favors survival over
designing experiments to define a threshold dose for phenotype correction of selective

152
outgrowth of corrected cells. In Mortellaro, et al., the cells dose for HSCT was !5 x
10^6 red cell depleted bone marrow cells/mouse. In neonates, 5 x 10^6 whole bone
marrow cells were administered to each pup (Mortelllaro, et al., 2006; Carbonaro, et
al., 2008). Both of these doses are 1-2 magnitudes higher than doses administered to
ADA-deificient patients receiving HSCT.

ERT detoxifies the whole environment and reduces accumulation of the cytotoxic
substrates and their metabolites, thus allowing survival of the corrected and non-
corrected cells (Hershfield, 1998). In ADA-deficient patients given GT or in patients
with the spontaneous reversion of a destabilizing mutation, expansion starts from a
smaller pool of cells (1 or more cells) compared to the larger pool of uncorrected cells.
Thus, when there is rescue of the larger un-corrected population with ERT, the smaller
population can be obscured and over time the corrrected population becomes
undetectable (Arredondo-Vega, et al., 2002).

In the discussion, Arredondo-Vega, et al. (2002), points out that in order to discuss
whether concomitant ERT contributes to the success of HSC gene therapy for ADA
SCID, it is important to note that there is no evidence that ERT with PEG-ADA
suppresses the growth or viability of ADA-expressing cells. If ERT diminished the
expansion of corrected cells, then the detection of proviral sequences should have
decreased as the number of uncorrected cells increased. However, in this study, the
detection of proviral sequences remained the same or increased when they were
diluted in DNA from uncorrected cells rescued by ERT. This finding suggests that

153
there must have been a similar amount of expansion of both corrected and uncorrected
cells in the presence of ERT.

The only time dilution of proviral sequences or a pseudo decrease in marking can be
readily seen in this study is in the first month after GT. At week 4, the total number of
cells is very high compared to the absolute number of marked cells, indicating most of
the lymphocytes are uncorrected cells (Figures 4-11 to Figure 4-14). The rescue of the
uncorrected cells in both 200-ERT and 200+ERT mice may be the result of transduced
differentiated marrow cells sufficiently detoxifing the thymic environment to allow
development of uncorrected thymocytes.

Taken together these data indicate that cytoreduction probably plays the biggest role in
the success of gene therapy in current clinical trails. These data also indicated ERT
does not diminish the detection of gene marked cells and may even increase the
amount of thymopoiesis. However, the goal of GT is to be curative, and not to have
patients remain on ERT. With that said, there may be a role for ERT in the early
engraftment period, especially in newly diagnosed children who may be gravely ill or
may be harboring latent infections. The application of a short course of ERT may
allow for an earlier administration of the gene therapy protocol with less adverse
events.

154
Chapter 5.
Concluding Remarks And Future Directions

Using the ADA-deficient mouse, I have investigated three different therapeutic
approaches for the treatment of ADA-deficient SCID. The first two approaches were
administered to neonates prior to enzyme replacement therapy (ERT): hematopoietic
stem cell transplantation (HSCT) with whole marrow (Chapter 2) and in vivo gene
therapy (GT) with a single administration of a lentiviral vector expressing human ADA
(Chapter 3). The last approach was administered to young adults, after 8 weeks of
ERT and was designed to answer specific questions regarding the role of cytoreductive
conditioning and the role of ERT in ex vivo retroviral mediated gene therapy (Chapter
4). All of these studies were performed in an effort to understand the important
aspects required for a good clinical outcome and lasting benefit for patients with ADA-
deficient SCID. However, in the murine model, the phenotype associated with ADA
deficiency is more complicated and severe than observed in ADA-deficient patients,
and the results of these studies appear to be disparate when compared to the human
experience.

Allogeneic transplantation with unfractionated, whole marrow from an HLA-matched
sibling into an unconditioned ADA SCID recipient is usually curative. Despite very low
levels of donor cell engraftment in the bone marrow, there is good immune
reconstitution and essentially normal levels of donor lymphocytes are found in the
blood and central lymphoid sites (van Leeuwen, et al., 1994; Tjonnfjord, et al., 1994;
Haddad, et al., 1999). It has been hypothesized that there is a selective advantage for
the engraftment and expansion of genetically normal T lymphocytes that arise from

155
very few engrafted donor stem or progenitor cells (Hirschhorn, et al., 1978; Ariga, et al.,
2001). Indeed, there is evidence that genetically normal T cells and progenitors have
selective engraftment and expansion when ADA-deficient patients are given non-
myeloablative HSCT (Hirschhorn, et al., 1981). Also, there is evidence of selective
expansion in cases in which there has been a spontaneous reversion of the mutated
allele in a single T cell progenitor (Ariga, et al., 2001; Arredondo-Vega, et al., 2003). In
both cases, the one or few genetically normal T lymphoid progenitor cells expand to fill
the entire T cell compartment.

On onset of these studies, we knew the murine model was not an exact model of the
human disease, given the requirement for ADA in gestation and severe lung
phenotype. However, there was an expectation that the SCID phenotype would be
similar and would reflect the human experience with HSCT and GT. Thus, it was
surprising to determine that ADA-deficient neonates receiving HSCT without
cytoreductive conditioning had long-term survival but chimerism was uniformly low and
not at all lymphoid specific (Chapter 2; Carbonaro et al., 2008). Despite the low
chimerism, non-ablative HSCT resulted in immune reconstitution. But, the lymphoid
compartment was reconstituted mainly with endogenous, host-derived ADA-deficient
cells, not by donor-derived ADA-replete cells. When neonates were conditioned with
increasing doses (100-400cGy) of total body irradiation (TBI), there was an increase in
the amount of donor engraftment in the hematopoietic tissues, but there was no real
evidence of corrected lymphoid expansion. This was in direct contrast to the murine
model of X-linked SCID, in which ~100% of the T cells and ~50% of the B cells were
donor-derived 6 months post HSCT (Carbonaro, et al., 2008). Similar results were

156
found when 5 week old ADA-/- mice that were transplanted after being conditioned with
600 cGy TBI (Mortellaro, et al., 2006). Donor chimerism was high in all lineages but
there was no indication of lymphoid specific engraftment and/or expansion. From this
experience, it is clear that SCID arising from a metabolic deficiency is not the same as
SCID arising from a T cell intrinsic defect.

The differences seen in the mouse compared to humans was not limited to HSCT. In
on-going gene therapy clinical trails, clinical benefit has been seen for patients
conditioned with a moderate dose of busulfan and ERT was discontinued prior to
retroviral mediated gene therapy. It has been hypothesized that concurrent ERT
following GT blunted the selective advantage of genetically corrected T cells in earlier
trials. In this study, mice were either given 200 or 900 cGy and remained on ERT or
not (Chapter 4; Carbonaro, et al., 2006b). We found no evidence of blunting with
ERT, as the detection of proviral sequence was the same with or without ERT.
However, we found that cytoreduction is very important in the engraftment of
transduced HSC. Only at the lower TBI dosage, where marking was uniformly low, did
we see some evidence of mature lymphoid expansion. Most surprising, however, was
the increase (100 fold) in proviral marking observed in immature thymocytes in mice
transplanted after low dose TBI (200 cGy) and remaining on ERT, indicating that
detoxification of the thymus may increase thymocyte development. In fact, considering
that vector DNA should have been diluted out with uncorrected DNA and reducing the
marking observed, it is remarkable that marking increases 100 fold, indicating the
increase in marking and expansion of corrected cells is even greater than 100 fold.

157

In the ADA-deficient mouse, HSCT and GT resulted in correction of the SCID
phenotype and immune reconstitution without a lymphoid expansion or selective
advantage for corrected cells, suggesting that trans-rescue had occurred. In order for
this to be the case, the total mass of ADA expressing cells must have produced
sufficient amounts of active ADA to allow survival of the ADA-deficient lymphoid cells.
Indeed, it appears that if there is sufficient ADA for correction of the severe and fatal
lung insufficiency there is enough ADA for immune reconstitution with corrected and
uncorrected cells. Likewise, there appears to be a threshold for a minimal amount of
ADA expression required for survival (Mortellaro, et al., 2006). However, due to the
severity of the murine model, our experimental design favors survival and not dose
dependent engraftment. If this is true, there could be an explanation as to why
corrected murine lymphocytes do not appear to have the same selective advantage as
corrected human lymphocytes. A review of the relevant factors inherent in these
studies may aid in understanding a key relationship between the amount active
enzyme produced and the amount of multi-lineage/lymphoid specific engraftment
observed (Table 5-1).

It appears the following 3 factors are most important in determining the amount of ADA
enzyme that is actually available for detoxification on a per kg basis: the percentage of
corrected cells in the cell dose (transduction efficiency), the actual cell dose per kg,
and the amount of cytoreduction or myeloablation. In other words, if there is infusion
many corrected cells, like in HSCT when all of the donor cells carry two working copies

158
Table 5-1. Summary of hematopoietic stem cell transplantation and gene
therapy studies in ADA-deficient mice.
Congenic Hematopoietic Stem Cell Transplantation
Cytoreductive dose (TBI) 0 cGy
1
100 cGy
1
200 cGy
1
600 cGy
2

Age at Transplant Neonate Neonate Neonate 5 wks
Cell dose per kg 2.5x10^9 2.5x10^9 2.5x10^9 7.5x10^9
Gene corrected cells (%) 100 100 100 100
Donor chimerism (splenic) ~8% ~30% ~50% ~85%
Multi-lineage chimerism yes yes yes yes
Lymphoid specific chimerism no no no no
ERT never never never no
Potential ADA expression very low low-mod moderate high
Autologous ADA Gene-Transduced Whole Marrow
Cytoreductive dose (TBI) 0 cGy
3
200 cGy
3
600 cGy
2
900 cGy
3

Age at Transplant 8-10 wk 8-10 wk 5 wk 8-10 wk
Cell dose per kg 2.5x10^9 2.5x10^9 7.5x10^9 2.5x10^9
Vector Type !-retroviral !-retroviral Lentiviral !-retroviral
Gene corrected cells (%) 75 75 91 75
Donor chimerism (splenic) died nd ~40% nd
Frequency of marked cells na 0.1% 200% 100%
Copy number per donor cell na nd 5.0 nd
Copy number per cell na 0.001 2.0 1.0
Multi-lineage chimerism na yes yes yes
Lymphoid specific chimerism na mature mature no
ERT no no no no
Potential ADA expression none low Mod-high mod-high
1
Carbonaro,

et al., 2008.
2
Mortellaro,

et al., 2006.
3
Chapter 4; Carbonaro, et al., 2006b.

of ADA, and the cell dose is >10^9 cells/kg, there will be more than enough ADA
expression to correct for the murine phenotype and to rescue all blood cell lineages,
including the lymphocytes. The addition of cytoreduction, resulting in less uncorrected
cells taking up space and more corrected cells eventually engrafting, will substantially
increase the amount ADA expression per kg available for detoxification and rescue.

Consider the following evidence in retroviral mediated gene transfer studies. When
ADA-deficient mice conditioned with a near myeloablative dose of TBI (900 cGy), there

159
is high marking and probably high ADA expression per kilogram (kg), resulting in
multilineage engraftment and no evidence of lymphoid specific expansion (Carbonaro,
et al, 2006b). When ADA-deficient mice were conditioned with a low sub-
myeloablative dose of TBI (200 cGy), there is very low marking and probably very low
ADA expression per kg, resulting in multi-lineage engraftment and more selective
pressure on mature lymphocytes; but not in immature thymocytes (Carbonaro, et al,
2006b). When ADA-deficient humans are conditioned with a sub-myeloablative dose
of busulfan, there is multi-lineage engraftment with a moderate selective expansion of
mature lymphocytes (Aiuti, et al., 2009). Since we never examine the thymocyte
population in humans it really is impossible to say what selective pressure is seen. In
current human GT trials, the cell doses are on the order of 10^6-8 cells/kg with a
transduction efficiency of 15-50%. It is not clear how much ADA is being produced on
mg per kg basis in human GT clinical trials compared to the murine studies. What is
clear is that in all of the murine studies to date the cell doses are 1-2 orders of
magnitude higher with much better transduction efficiency and probably a lot more
ADA expression per kg. Perhaps if the human gene therapy data were analyzed on a
per patient basis and corrected for cell dose and transduction efficiency, perhaps the
human experience after GT would look very similar to the murine experience.

In the final analysis of the murine studies, combined with information gathered from the
myriad of human HSCT studies, I hypothesize that if ADA expressed per kg is high
enough (past some as of yet undefined threshold), the more the graft will be multi-
lineage and less lymphoid specific, because there is rescue of all uncorrected blood
cells in trans. Likewise, if there is infusion of a few corrected cells, as in some current

160
human HSCT and GT or the result of a spontaneous reversion, the corrected cells do
not make enough ADA per kg and simply cannot rescue the uncorrected cells. The
uncorrected cells eventually die and leave the few corrected cells to expand and fill the
compartment, exclusively. In the murine model, we cannot reproduce these conditions
without the mice dying. Therefore, testing this hypothesis will have to wait until our
current human HSCT and GT approaches improve such that the corrected cell dose is
above the threshold for ADA expression per kg for correction in trans.

As pointed out by Neff, et al., (2006), starting with a limited pool of corrected cells has
inherent pitfalls. First, it is possible that the cells will not engraft. Second, the cells
could be or could become oligoclonal and third, in the case of progenitors, there could
be clonal exhaustion. Another inherent risk is the invasive nature of procuring those
stem cells and progenitors. However, with ADA-deficient SCID, if we consider the
premise that the amount of ectopic ADA expression per kg is the key determinant in
correction of the SCID phenotype, than this approach may not be necessary. It is
important to remember ADA-deficient SCID is very different than SCID caused by a
lymphoid intrinsic defect. ADA-deficiency is a metabolic disorder that results in the
accumulation of intracellular and extracellular substrates, Ado and dAdo, both of which
cross the cell membrane freely and have intra- and extra-cellular equilibrium. Thus, it
may not be necessary to start with a very small population of hard to engraft, corrected
HSC. If there is correction in trans, than any population of cells that is expressing
ectopic ADA may be sufficient for detoxification, much in the same manner as
exogenous PEG-ADA. Likewise, if ectopic expression does not need to be limited to a
blood cell than correcting any long-lived cell might be adequate and easier to do.

161
Indeed, ADA-deficient neonates treated with a single administration of lentiviral vector,
had long-term survival and immune reconstitution (Chapter 3; Carbonaro, et al., 2006).
Yet, there was no evidence of significant HSC transduction and very low proviral
marking in the hematopoietic tissues and no evidence, whatsoever, of lymphoid
specific expansion. ADA expression was in the supra normal range in the liver and
lungs, which apparently provided a systemic source of ADA enzyme and/or functioned
as a metabolic sink for adenine nucleotides.

As the current standard of care for ADA-deficient SCID expands to include ex vivo
gene therapy along with HSCT and ERT, the development of future treatment options
may include In vivo gene therapy as a novel, non-invasive approach to treating ADA-
deficiency. Current efforts are centered on determining the optimal dose while
maximizing biodistribution, and minimizing toxicity. Because the severe murine
phenotype is not representative of the human phenotype, less vector may be required
for immune reconstitution in humans. We are currently using ADA-deficient mice and
immune competent rhesus monkeys to investigate the use of different viral vectors,
pseudotypes and the post-production modification of the viral particles as a mean of
reducing the amount of vector required for systemic detoxification. Without stem cell
transduction, life long correction may not be possible, despite the post mitotic nature of
the liver and lung, and the vector may need to be re-administered. Thus, we will also
need to investigate the effects of re-administration of vector and possible
immunological consequences.

162
In conclusion, the ADA deficient mouse, though an imperfect model, can be used to
ask specific questions regarding current approaches, and most importantly, it can be
used for the development of new approaches for the treatment of ADA-deficiency in
humans.

163
Bibliography

Aiuti, A., Vai, S., Mortellaro, A., Casorati, G., Ficara, F., Andolfi, G., Ferrari, G.,
Tabucchi, A., Carlucci, F., Ochs, H.D., Notarangelo, L.D., Roncarolo, M.G., and
Bordignon, C. Immune reconstitution in ADA-SCID after PBL gene therapy and
discontinuation of enzyme replacement. Nat Med 2002a 8:423-425.

Aiuti, A., Slavin, S., Aker, M., Ficara, F., Deol,a S., Mortellaro, A., Morecki, S., Andolfi,
G., Tabucchi, A., Carlucci, F., Marinello, E., Cattaneo, F., Vai, S., Servida, P., Miniero,
R., Roncarolo, M.G., and Bordignon, C. Correction of ADA-SCID by stem cell gene
therapy combined with nonmyeloablative conditioning. Science 2002b 296:2410-2413.

Aiuti, A., Cassani, B., Andolfi, G., Mirolo, M., Biasco, L., Recchia, A., Urbinati, F.,
Valacca, C., Scaramuzza, S., Aker, M., Slavin, S., Cazzola, M., Sartori, D., Ambrosi,
A., Di Serio, C., Roncarolo, M.G., Mavilio, F., and Bordignon, C.. Multilineage
hematopoietic reconstitution without clonal selection in ADA-SCID patients treated with
stem cell gene therapy. J Clin Invest 2007 117:2233-2240.

Aiuti, A., Cattaneo, F., Galimberti, S., Benninghoff, U., Cassani, B., Callegaro, L.,
Scaramazza, S., Andolfi, G., Miralo, M., Brigida, I., Tabacchi, A., Carlucci, F., Eibl, M.,
Aker, M., Slavin, S., Al-mousa, H., Al Ghonaium, A., Ferster, A., Duppenthaler, A.,
notarangelo, L., Wintergerst, W., Buckley R.H., Bregni, M., Marktel, S., Valsecchi,
M.G., Rossi, P., Ciceri, F., Miniero, R., Bordignon, C., and Roncarolo, M-G. Gene
therapy for immunodeficiency due to adenosine deaminase deficiency. NEJM 2009a
360:447-458,.

Aiuti, A., Brigida, I., Ferrua, F., Cappelli, B., Chiesa, R., Marktel, S., and Roncarolo, M-
G. Hematopoietic stem cell gene therapy for adenosine deaminase deficient-SCID.
Immunol Res 2009b Epub 18 Feb 09.

Aldrich, M.B., Blackburn, M.R., and Kellems, R.E. The importance of adenosine
deaminase for lymphocyte development and function. Biochem Biophys Res Comm
2000 373:311-315.

Aldrich, M.B., Chen, W., Blackburn, M.R., Martinez-Valdez, Datta, S.K., and Kellems,
R.E. Impaired germinal center maturation in adenosine deaminase deficiency. J
Immunol 2003 171:5562-5570.

Agarwals, R.P., and Parks, Jr., R.E. Adenosine deaminase from human erythrocytes.
Methods Enzymol 1978 51:502-507.

Ariga T., Oda N., Yamaguchi K., Kawamura N., Kikuta H., Taniuchi S., Kobayashi Y.,
Terada K., Ikeda H., Hershfield M.S., Kobayashi K., and Sakiyama Y.. T-cell lines
from 2 patients with adenosine deaminase (ADA) deficiency showed the restoration of
ADA activity resulted from the reversion of an inherited mutation. Blood 2001 97:2896-
2899.

164
Aronow, B., Lattier, D., Silbiger, R., Dusing, M., Hutton, J., Jones, G., Stock, J.,
McNeish, J., Potter, S., Witte, D., and Wiginton, D. Evidence for a complex regulatory
array in the first intron of the human adenosine deaminase gene. Gene Dev 1989
3:1384-1400.

Aronow, B.J., Silbiger, R.N., Dusing, M.R., Stock, J. L., Yager, K. L., Potter, S., Hutton,
J.J., and Wiginon, D.A. Functional analysis of the human adenosine deaminase gene
thymic regulatory region and its ability to generate position-independent transgene
expression. Mol Cell Biol 1992 12:4170-4185.

Apasov, S.G., Koshiba, M., Chused, T.M., and Sitkovsky, M.V. Effects of extracellular
ATP and adenosine on different thymocyte subsets: Possible role of ATP-gated
channels and G protein-coupled purinergic receptors J Immunol 1997 158:5095-5105.

Apasov, S.G., Chen, J.F., Smith, P.T., Schwarzschild, M.A., Fink, J.S., and Sitkovsky
M.V. Study of A(2A) adenosine receptor gene deficient mice reveals that adenosine
analogue CGS 21680 possesses no A(2A) receptor-unrelated lymphotoxicity. Br J
Pharmacol 2000 131:43-50.

Apasov, S.G., Blackburn, M.R., Kellems, R.E., Smith, P.T., and Sitkovsky M.V.
Adenosine deaminase deficiency increases thymic apoptosis and causes defective T
cell receptor signaling. J. Clin Invest 2001 108:131-141.

Arredondo-Vega, F.X., Santisteban, I., Daniels, S., Toutain, S., and Hershfield, M.S.
Genotype-phenotype correlations based on expressed acivity of 29 mutant alleles. Am
J Hum Genet 1998 63:1049-1059.

Arredondo-Vega, F.X., Santisteban, I., Richard, E., Bali, P., Koleilat, M., Loubser, M.,
Al-Ghonaium, A., Al-Helali, M., and Hershfield, M.S. Adenosine deaminase deficiency
with mosaicism for a "second-site suppressor" of a splicing mutation: decline in
revertant T lymphocytes during enzyme replacement therapy. Blood 2002 99:1005-
1013.

Blackburn, M.R., Wakamiya, M., Caskey, C.T., and Kellems, R.E. Tissue-specific
rescue suggests that placental adenosine deaminase is important for fetal
development in mice. J Biol Chem 1995 270:23891-23894.

Blackburn, M.R., Knudsen, T.B., and Kellems, R.E. Genetically engineered mice
demonstrate that adenosine deaminase is essential for early post-implantation
development. Development 1997 124:3089-3097.

Blackburn, M.R., Datta, S.K., and Kellems, R.E. Adenosine deaminase-deficient mice
generated using a two-stage genetic engineering strategy exhibit a combined
immunodeficiency. J Biol Chem 1998 273:5093-5100.

165
Blackburn, M.R., Volmer, J.B., Thrasher, J.L., Zhong, H., Crosby, J.R., Lee, J.J., and
Kellems, R.E. Metabolic consequences of adenosine deaminase deficiency in mice
are associated with defects in alveogenesis, pulmonary inflammation, and airway
obstruction. J Exp Med 2000b 192:159-170.

Blackburn, M.R., Aldrich, M., Volmer, J.B., Chen, W., Zhong, H., Kelly, S., Hershfield,
M.S., Datta, S.K., and Kellems, R.E. The use of enzyme therapy to regulate the
metabolic and phenotypic consequences of adenosine deaminase deficiency in mice.
J Biol Chem 2000a 275:32114-32121.

Blaese, R.M., Culver, K.W., Miller, A.D., Carter, C.S., Fleisher, T., Clerici, M, Shearer,
G., Chang, L., Chiang, Y., Tolstochev, P., Greenblatt, J.J., Rosenberg, S.A, Klein, H.,
Berger, M., Mullen, C.A., Ramsey, W.J., Muul, L., Morgan, R.A., and Anderson W.F. T
lymphocyte-directed gene therapy for ADA- SCID: Initial trial results after 4 years.
Science 1995 270:475-480.

Bluetters-Sawatzki, R., Friedrich, W., Ebell, W., Vetter, U., Stoess, H., Goldmann, S.F.,
and Kleihauer, E. HLA-haploidentical bone marrow transplantation in three infants with
adenosine deaminase deficiency: stable immunological reconstitution and reversal of
skeletal abnormalities. Eur J Pediatr 1989 149:104-109.

Bordignon, C., Notarangelo, L.D, Nobili, N., Ferrari, G., Casorati, G., Panina, P.,
Mazzolari, E., Maggioni, D., Rossi, C., Servida, P., Ugazio, A.G., and Mavilio, F. Gene
therapy in peripheral blood lymphocytes and bone marrow for ADA- immunodeficient
patients. Science 1995 270:470-475.

Borge, O.J., Ramsfjell, V., Veiby, O.P., Murphy, M.J., Jr., Lok, S., and Jacobsen, S.E.
Thrombopoietin, but not erythropoietin promotes viability and inhibits apoptosis of
multipotent murine hematopoietic progenitor cells in vitro. Blood 1996 88:2859–2870.

Bollinger, M.E., Arrendondo-Vega, F.X., Santisteban, I., Schwarz, K., Hershfield, M.S.,
and Lederman, H.M. Hepatic dysfunction as a complication of adenosine deaminase
deficiency. N Engl J Med 1996 334:1367-1371.

Buckley, R.H., Schiff, S.E., Schiff, R.I., Markert, L., Williams, L.W., Roberts, J.L., Myers,
L.A., and Ward, F.E. Hematopoietic stem-cell transplantation for the treatment of severe
combined immunodeficiency. N Engl J Med 1999 340:508-516.

Buckley, R.H. The multiple causes of human SCID. J Clin Invest 2004 114:1409-
1411.

Bunnell, B.A., Muul, L.M., Donahue, R.E., and Blaese, R.M. High efficiency retroviral-
mediated gene transfer into human and nonhuman primate peripheral blood
lymphocytes. PNAS 1995 92:7739-7743.

166
Bukrinsky, M.I., Haggerty, S., Dmpsy, M.P., Sharova, N., Adzhubel, A., Spitz, L., Lewis,
P., Goldfarb. D., Emerman, M., and Stevenson, M. A nuclear localization signal within
HIV-1 matrix protein that governs infection of non-dividing cells. Nature 1993 365:666-
669.

Carbonaro, D.A., Jin, X., Petersen, D., Wang, X., Dorey, F., Kil, K.S., Aldrich, M,.
Blackburn, M.R., Kellems, R.E., and Kohn, D.B. In Vivo Transduction by Intravenous
Injection of a Lentiviral Vector Expressing Human ADA into Neonatal ADA Gene
Knock-out Mice: A Novel Form of Enzyme Replacement Therapy for ADA-Deficiency.
Mol Ther 2006 13:1110-1120.

Carbonaro, D.A., Jin, X., Pepper, K. and Kohn, D.B. Enzyme replacement therapy with
pegylated adenosine deaminase (PEG-ADA) does not impede immune reconstitution
following transplantation of gene-corrected bone marrow cells in the murine model of
ADA-SCID. Mol Ther 2006b 13:S419.

Carbonaro, D.A., Jin, X., Cotoi, D., Mi, T., Yu, X-J., Skelton, D.C., Dorey, F., Kellems,
R.E., Blackburn, M.R., and Kohn, D.B. Neonatal bone marrow tranplantation of ADA-
deficient SCID mice results in immunologic reconstitution despite low levels of
engraftment and an absence of selective donor T lymphoid expansion. Blood 2008
111:57455754.

Case, S.S., Price, M.A, Jordan, C.T., Xu, X-J., Wang, L., Bauer, G., Haas, D.L., Xu, D.,
Stripecke, R., Naldini, L., Kohn, D.B. and Crooks, G.M. Stable transduction of
quiescent CD34(+)CD38(-) human hematopoietic cells by HIV-1 based lentiviral
vectors. PNAS 1998 96:2988-2993.

Cassani, B., Mirolo, M., Cattaneo, F., Benninghoff, U., Hershfield, M., Carlucci, F.,
Tabucchi, A., Bordignon, C.., Roncarolo, M.G., and Aiuti, A. Altered intracellular and
extracellular signaling leads to impaired T-cell functions in ADA-SCID patients. Blood
2008 111:4209-4219.

Cavazzana-Calvo, M., Hacein-Bey, S., de Saint Basile, G., Gross, F., Yvon, E.,
Nusbaum, P., Selz, F., Hue, C., Certain, S., Casanova, J.L., Bousso, P., Le Deist, F.,
and Fischer, A. Gene therapy of human severe combined immunodeficiency (SCID)-
X1 disease. Science 2000 288:669-672.

Chaffee, S., Mary, A., Stiehm, E.R., Girault, D., Fischer, A., and Hershfield, M.S. IgG
antibody response to polyethylene glycol-modified adenosine deaminase in patients
with adenosine deaminase deficiency. J Clin Invest 1992 89:1643-1651.

Challita, P.M., Skelton, D., El-Khoueiry, A., Yu, X-J., Weinberg, K.I. and Kohn, D.B.
Multiple modifications in cis-elements of the LTR of retroviral vectors lead to increased
expression and decreased DNA methylation in embryonic carcinoma (EC) cells. J Virol
1995 69:748-755

167
Chan, B., Wara, D., Bastian, J., Hershfield, M.S., Bohnsack, J., Azen, C.G., Parkman,
R., Weinberg, K., and Kohn, D.B. Long-term efficacy of enzyme replacement therapy
for adenosine deaminase (ADA)-deficient severe combined immunodeficiency (SCID).
Clin Immunol 2005 117:133-143.

Chang, Z., Nygaard, P., Chonault, A.C., and Kellems, R.E. Deduced amino acid
sequence of Escherichia coli adenosine deaminase reveals evolutionary conserved
amino acid residues: implication for catalytic function. Biochemistry 1999 30:2273-
2280.

Chechik, B., Schrader, W.P., and Minowada, J. An immunomorphologic study of the
distribution in human thymus tissue, normal thymocytes, and hemataopoietic cell lines.
J Immunol 1981 126:1003-1007.

Chen, Z., Harless, M.L., Wright, D.A., and Kellems, R.E. Identification and
characterization of transcriptional arrest sites in exon 1 of the human adenosine
deaminase gene. Mol Cell Biol 1990 10:4555-4564.

Chinsky, J.M., Ramamurthy, V., Fanslow, W.C., Ingolia, D.E., Blackburn, M.R., Shaffer,
K.T., Higley, H.R., Trentin, J.J., Rudolph, F.B., Knudsen, T.B., and Kellems, R.E.
Developmental expression of adenosine deaminase in the upper alimentary tract of
mice. Differentiation 1990 42:172-183.

Chun, I.D., Lee, N., Kobayashi, R.H., Chaffee, S., Hershfield, M.S., and Stiehm, E.R.
Suppression of an antibody to adenosine-deaminase (ADA) in an ADA-deficient patient
receiving polyethylene glycol modified adenosine deaminase. Ann Allergy 1993
70:462-466.

Chunn, J.I., Molina, J.G., Yang, T.M., Xia, Y., Kellems, R.E. and Blackburn, M.R.
Adenosine-dependent pulmonary fibrosis in adenosine deaminase-deficient mice.
J Immunol 2005 175:1937-1946.

Cohen, A., Barankiewicz, J., Lederman, H.M., and Gelfand E. Purine and pyrimidine
metabolism in human T lymphocyte regulation of deoxyribonucleotide metabolism.
J Biol Chem 1983 268:12334-12340.

Cristalli, G., Costanzi, S., Lambertucci, C., Lupidi, G., Vittori, S., Volpini, R., and
Camaioni, E. Adenosine deaminase: functional implications and different classes of
inhibitors. Med Res Rev 2001 21:105-128,.

Davis, S., Abuchowski, A., Park, Y.K. and Davis, F.F. Alteration of the circulating life
and antigenic properties of bovine adenosine deaminase in mice by attachment of
polyethylene glycol. Clin Exp Immunol 1981 46:649-652.

Daly, T., Vogler, C., Levy, B., Haskins, M.E., and Sands, M.S. Neonatal gene transfer
leads to widespread correction of pathology in a murine model of lysosomal storage
disease. PNAS 1999 96:2296-2300.

168

Dao, M.A., Hannum, C.H., Kohn, D.B., and Nolta, J.A. Flt3 ligand preserves the ability
of human CD34+ progenitors to sustain long-term hematopoiesis in immune-deficient
mice after ex vivo retroviral-mediated transduction. Blood 1997 89:446-456.

Dao, M.A., Shah, A.J., Crooks, G.M., and Nolta, J.A. Engraftment and retroviral
marking of CD34+ and CD34+/CD38- human hematopoietic progenitors assessed in
immune-deficient mice. Blood 1998 91:1243-1255.

Dusing, M.R. and Wigninton, D.A. Sp1 is essential for both enhancer-mediated and
basal activation of the TATA-less human adenosine deaminase promoter. Nucleic
Acid Res 1994 22:669-677.

Dusing, M.R., Brickner, A.G., Thomas, M.B., and Wiginton, D.A. Regulation of
duodenal specific expression of the human adenosine deaminase gene. J Biol Chem
1997 272:26634.

Factor, P., Mutlu, G.M., Chen, L, Mohameed, J., Akhmedov, A.T., Meng, F,J,, Jilling,
T,, Lewis, E.R., Johnson, M.D., Xu, A., Kass, D., Martino, J.M., Bellmeyer, A., Albazi,
J.S., Emala, C., Lee, H.T., Dobbs, L.G., and Matalon, S. Adenosine regulation of
alveolar fluid clearance. PNAS 2007 104:4083-4088.

Fischer, A., Landais, P., Friedrich, W., Morgan, G., Gerritsen, B., Fasth, A., Porta, F.,
Griscelli, C., Goldman, S.F., Levinsky, R., and Vossen, J. European experience of
bone-marrow transplantation for severe combined immunodeficiency. Lancet 1990
336:850-854.

Franco, R., Valenzuela, A., Lluis, C., and Blanco, J. Enzymatic and extraenyzmatic
role of ecto-adenosine deaminase in lymphocytes. Immunol Rev 1998 161:27-42.

Fredholm, B.B., Irenius, E., Dull, B., and Schulte, G. Comparison of the potency of
adenosine as an agonist at human adenosine receptors expressed in Chinese hamster
ovary cells. Biochem Pharmacol 2001 61:443-448.

Gaines, A.D., Schiff, S.E., and Buckley, R.H. Donor type natural killer cells after
haploidentical T cell-depleted bone marrow stem cell transplantation in a patient with
adenosine deaminase-deficient severe combined immunodeficiency. Clin Immunol
Immunolpathol 1991 60:299-304.

Gasper, H.B. and Kinnon, C. Gene therapy for adenosine deaminase deficiency. In:
Gene Therapy, In Lemoine, N.R., and Cooper, D.N. (Eds) BIOS Scientific Publishers,
Ltd. Oxford, UK 1996 pp 225-239

169
Gaspar, H.B., Parsley, K.L., Howe, S., King, D., Gilmour, K.C., Sinclair, J., Brouns, G.,
Schmidt, M., Von Kalle, C., Barington, T., Jakobsen, M.A., Christensen, H.O., Al
Ghonaium, A., White, H.N., Smith, J.L., Levinsky, R.J., Ali, R.R., Kinnon, C., and
Thrasher, A.J. Gene therapy of X-linked severe combined immunodeficiency by use of
a pseudotyped gammaretroviral vector. Lancet 2004 364:2181-2187.

Gaspar, H.B. and Thrasher, A.J. Gene therapy for severe combined
immunodeficiencies. Expert Opin Biol Ther 2005 5:1175-1182.

Gaspar, H.B., Bjorkegren, E., Parsley, K., Gilmour, K.C., King, D., Sinclair, J., Zhang,
F., Giannakopoulos, A., Adams, S., Fairbanks, L.D., Gaspar, J., Henderson, L., Xu-
Bayford, JH, Davies, E.G., Veys, P.A., Kinnon, C., and Thrasher, A.J. Successful
reconstitution of immunity in ADA-SCID by stem cell gene therapy following cessation
of PEG-ADA and use of mild preconditioning. Mol Ther 2006 14:505-513.

Giblett, E.R., Anderson, J.E., Cohen, F., Pollara, B., and Meuwissen, H.J. Adenosine-
deaminase deficiency in two patients with severely impaired cellular immunity. Lancet
1972 2:1067-1069.

Goebel, W.S., Yoder, M.C., Pech, N.K., and Dinauer, M.C. Donor chimerism and stem
cell function in a murine congenic transplantation model after low-dose conditioning:
effects of a retroviral-mediated gene transfer protocol and implications for gene
therapy. Exp Hematol 2002 30:1324-1332.

Haas, D.L., Lutzko, C., Logan, A., Cho, G.J., Skelton, D., Jin Yu, X., Pepper, K.A., and
Kohn, D.B. The Moloney murine leukemia virus repressor binding site represses
expression in murine and human hematopoietic stem cells. J Virol 2003 77:9439-9450.

Hacein-Bey-Abina, S., Le Deist, F., Carlier, F., Bouneaud, C., Hue, C., De Villartay,
J.P., Thrasher, A.J., Wulffraat, N., Sorensen, R., Dupuis-Girod, S., Fischer, A., Davies,
E.G., Kuis, W., Leiva, L., and Cavazzana-Calvo, M. Sustained correction of X-linked
severe combined immunodeficiency by ex vivo gene therapy. NEJM 2000 346:1185-
93.

Hacein-Bey-Abina, S., Von Kalle, C., Schmidt, M., McCormack, M.P., Wulffraat, N.,
Leboulch, P., Lim, A., Osborne, C.S., Pawliuk, R., Morillon, E., Sorensen, R., Forster,
A., Fraser, P., Cohen, J.I., de Saint Basile, G., Alexander, I., Wintergerst, U., Frebourg,
T., Aurias, A., Stoppa-Lyonnet, D., Romana, S., Radford-Weiss, I., Gross, F., Valensi,
F., Delabesse, E., Macintyre, E., Sigaux, F., Soulier, J., Leiva, L.E., Wissler, M., Prinz,
C., Rabbitts, T.H., Le Deist, F., Fischer, A., and Cavazzana-Calvo, M. LMO2-
associated clonal T cell proliferation in two patients after gene therapy for SCID-X1.
Science 2003 302:415-419.

Haddad, E., Landais, P., Friedrich, W., Gerritsen, B., Cavazzana-Calvo, M., Morgan,
G,, Bertrand, Y., Fasth, A., Porta, F., Cant, A., Espanol, T, Muller, S., Veys, P.,
Vossen, J., and Fischer, A. Long-term immune reconstitution and outcome after HLA-
nonidentical T-cell depleted bone marrow transplantation for severe combined
immunodeficiency: A European Retrospective. Blood 1998 91:3646-3653.

170

Halene, S., Wang, L., Cooper, R., Bockstoce, D.C., Robbins, P.B., and Kohn, D.B.
Improved expression in murine hematopoietic and lymphoid cells after transplantation
of bone marrow transduced with a modified retroviral vector. Blood 1999 94:3349-
3357.

Hanenberg, H., Hashino, K., Konishi, H., Hock, R.A., Kato, I., and Williams, D.A.
Optimization of fibronectin-assisted retroviral gene transfer into human CD34+
hematopoietic cells. Hum Gene Ther 1997 10:2193-2206.

Harrap, K.R. and Renshaw, J. Intracellular nucleotide pools and their significance in
antimetabolite therapy. Antibiot Chemother 1980 28:68-77.

Hashikawa, T., Hooker, S.W., Maj, J.G. Knott-Craig, C.J., Takedashi, M., Murakami,
S., and Thompson, L.F. Regulation of adenosine receptor engagement by ecto-
adenosine deaminase. FASEB J 2004 18:131-133.

Hershfield, M.S. Apparent suicide inactivation of human lymphoblast S-
adenosylhomocysteine hydrolase by 2’-deoxyadenosine and adenine arabinoside: a
basis for direct toxic effects of analogs of adenosine. J Biol Chem 1979 254:22-25.

Hershfield, M.S., Kerdich, N.M., Ownby, D.R., Ownby, H., and Buckley, R. In vivo
inactivation of erythrocyte S-adenosylhomocysteine hydrolase by 2;-deoxyadenosine in
adenosine deaminase-deficient patients. J Clin Invest 1979 63:807-811.

Hershfield, M.S., Kredich, N.M., Koller, C.A., Mitchell, B.S., Kurtzberg, J., Kinney, T.R.,
and Falletta, J.M. S-adenosylhomocysteine catabolism and basis for acquired
resistance during treatment of T-cell acute lymphoblastic leukemia with 2'-
deoxycoformycin alone and in combination with 9-beta-D-arabinofuranosyladenine.
Canc Res 1983 43:3451-3458.

Hershfield, M.S. Buckley, R.H., Greenberg, M.L., Melton, A.L., Schiff, R., Hatem, C.,
Kurtzberg, J., Markert, M.L., Kobayashi, R.H., Kobayashi, A.L., and Abuchowski, A.
Treatment of adenosine deaminase deficiency with polyethylene glycol-modified
adenosine deaminase. NEJM 1987 316:589-596.

Hershfield, M.S. Enzyme replacement therapy of adenosine deaminase deficiency with
polyethylene glycol-modified adenosine deaminase (PEG-ADA). Immunodeficiency
1993 4:93-97.

Hershfield, M.S., Arredondo-Vegam F.X., and Santisteban, I. Clinical expression,
genetics and therapy of adenosine deaminase (ADA) deficiency. J Inherit Metab Dis
1997 20:179-185.

Hershfield, M.S. Adenosine deaminase deficiency: clinical expression, molecular basis,
and therapy. Semin Hematol 1998 35:291-298.

171
Hershfield, M.S. and B.S. Mitchell. Immunodeficiency diseases caused by adenosine
deaminase deficiency and purine nucleoside phosphylase deficiency. In Scriver, C.R.,
Beaudet, A.L., Sly, W.S. and Valle, D. (Eds.) The Metabolic and Molecular Basis of
Inherited Disease, 8
th
Edition. McGraw-Hill, New York 2001 pp 2585-2625.

Hershfield, M.S. Genotype is an important determinant of phenotype in adenosine
deaminase deficiency. Curr Opin Immunol 2003 15:571-577.

Hershfield, M.S. New insights into adenosine-receptor-mediated imuunosuppression
and the role of adenosine in causing the immunodeficiency associated with adenosine
deaminase deficiency. Eur J Immunol 2005 35:25-30.

Hirschhorn, R., Mariniuk, F. and Rosen, F.S. Adenosine deaminase activity in normal
tissues and tissues from a child with severe combined immunodeficiency and
adenosine deaminase deficiency. Clin Immunuol Immunopathol 1978 9:287-292.

Hirschhorn, R., Roegner-Maniscalco, V., Kuritsky, L. and Rosen, F.S. Bone marrow
transplantation only partially restores purien metabolites to normal n adenosine
deaminase-deficient patients. J Clin Invest 1981 68:1387-1393.

Hirschhorn, R., and Ellenbogen, A. Genetic heterogeneity in adenosine deaminase
(ADA) deficiency: five different mutations in five new patients with parial ADA
deficiency. Am J Hum Genet 1986 38:13-25.

Hirschhorn, R., Yang, D.R., Israni, A., Huie, M.L. and Ownby, D.R. Somatic mosaicism
for a newly identified splice-site mutation in a patient with adenosine deaminase-
deficient immunodeficiency and spontaneous clinical recovery. Am J Hum Genet 1994
55:59-68.

Hirschhorn, R., Yang, D.R., Puck, J.M., Hiue, M.L., Jiang ,C.K., and Kurlandsky, L.E.
Spontaneous in vivo reversion to normal of an inherited mutation in a patient with
adenosine deaminase deficiency. Nat Genet 1996 13:290-295.

Hoogerbrugge, P.M., van Beusechem, V.W., Fisher, A., Debree, M., le Deist, F.,
Perignon, J.L., Morgan, G., Gaspar, B., Fairbanks, L.D., Skeoch, C.H., Moseley, A.,
Harvey, M., Levinsky, R.J., and Valerio, D. Bone marrow gene transfer in three
patients with adenosine deaminase deficiency. Gene Ther 1996 3:179-183.

Huang, S., Apasov, S., Koshiba, M., and Sitkovsky, M. Role of A2a extracellular
adenosine receptor-mediated signaling in adenosine-mediated inhibition of T-cell
activation and expansion. Blood 1997 90:1600-10.

Hwang, L.-HS., Park, J., and Gilboa, E. Role of intron-contained sequences in
formation of Moloney murine leukemia virus env mRNA. Mol Cell Biol 1984 4:2289-
2297.

172
Jenkins, T., Rabson, A.R., Nurse, G.T., and Lane, A.B. Deficiency of adenosine
deaminase not associated with severe combined immunodeficiency. J Pediatr 1976
89:732-736.

Joachim, M.L., Marble, P.A., Laurent, A.B., Pastuszko, P., Paliotta, Blackburn, M.R.,
and Thompson, L.F. Restoration of adenosine deaminase-deficient human thymocyte
development in vitro by inhibition of deoxynucleoside kinases. J Immunol 2008
181:8153-8161.

Jung, D., Jaeger, E., Caveux, S., Blankenstein, T., Hilmes, C., Karbach, J., Moebius,
U., Knuth, A., Huber, C., and Seliger, B. Strong immunogenic potential of a B7
retroviral expression vector: generation of HLA-B7-restricted CTL response against
selectable marker genes. Hum Gene Ther 1998 9:53-62.

Kiem, H-P. Heyward, S., Winkler, A., Potter, J., Allen, J.M., Miller, A.D., and Andrews,
R.G. Gene transfer into marrow repopulating cells: comparison between
amphotrophic and gibbon ape leukemia virus pseudotyped retroviral vectors in a
competitive repopulation assay in baboons. Blood 1997 90:4638-4645.

Kiem, H-P, Andrews, R.G., Morris, J., Peterson, L., Heyward, S., Allen, J.M., Rasko,
J.E., Potter, J., and Miller, A.D. Improved gene transfer into baboon marrow
repopulating cells using recominant human fibronectin fragment CH-296 in combination
with interleukin-6, stem cell factor, FLT-3 ligand, and megakaryocyte growth and
development factors. Blood 1998 92:1878-1886.

Kobayashi,

H., Carbonaro,

D., Pepper,

K., Petersen,

D., Ge, S., Jackson,

H.A.,
Shimada, H., Moats, R., and Kohn,

D.B. Neonatal Gene Therapy of MPS I Mice by
Intravenous Injection of a Lentiviral Vector. Mol Ther 2005 11:776-789.

Kohn , D.B., Weinberg, K.I., Nolta, J.A., Heiss, L.N., Lenarsky, C., Crooks, G.M.,
Hanley, M.E., Annett, G., Brooks, J.S., El-Khoureiy, A., Lawrence, K., Wells, S., Shaw,
K., Moen, R.C., Bastian, J., Williams-Herman, D.E., Elder, M., Wara, D., Bowen, T.,
Hershfield, M.S., Mullen, C.A., Blaese, R.M., and Parkman, R. Engraftment of gene-
modified cells from umbilical cord blood in neonates with adenosine deaminase
deficiency. Nat Med 1995 1:1017-1026.

Kohn, D.B., Hershfield, M.S., Carbonaro, D., Shigeoka, A., Brooks, J., Smogorzewska,
E.M., Barsky, L.W., Chan, R., Burotto, F., Annett, G., Nolta, J.A., Crooks, G., Kapoor,
N., Elder, M., Wara, D., Bowen, T., Madsen, E., Snyder, F.F., Bastian, J., Muul, L.,
Blaese, R.M., Weinberg, K., and Parkman, R. T lymphocytes with a normal ADA gene
accumulate after transplantation of transduced autologous umbilical cord blood CD34+
cells in ADA-deficient SCID neonates. Nature Medicine 1998 4:775-780

Kohn, D.B. Gene therapy for hematopoietic and immune disorders. Bone Marrow
Transplant 1996 3:S55-8.

Kohn 2001. Gene therapy for genetic haematological disoders and
immunodeficiencies. J Intern Med 2001 249:379-390.

173

Kohn, D.B. and Candotti, F. Gene therapy fulfilling its promise. NEMJ 2009 360:518-
521.

Knudsen, T.B., Blackburn, M.RR., Chinsky, J.M., Airhart, M.J., and Kellems, R.E.
Ontogeny of adenosine deaminase in the mouse deciduas and placenta:
Immunolocalization and embryo transfer studies. Biol Reprod 1991 44:171-184.

Komori, T., Okada, A., Stewart, V., and Alt, F.W. Lack of N regions in antigen receptor
variable region genes of TdT-deficient lymphocytes. Science 1993 261:1171-1755.

Krall, W.J., Skelton, D.C., Yu, X-J., Riviere, I., Lehn, P., Mulligan, R.C., and Kohn, D.B.
Increased levels of spliced RNA account for augmented expression from the MFG
retroviral vector in hematopoietic cells. Gene Ther 1996 3:37-48.

Kreindler, J.L. and Shapiro, S.D. Lung turn to AA (adenosine analogues) to dry out.
Nature Medicine 2007 13:406-408.

Kurre, P., Kiem, H-P., Morris, J., Heyward, S., Battini, J.L., and Miller, A.D. Efficient
transduction by an amphotrophic retrovirus vector is dependent on high-level
expression of the cell surface virus receptor. J Virol 1999 73:495-500.

Levy, Y., Hershfield, M.S., Fernandez-Mejia, C., Polmar, S.H., Scudiery, D., Berger,
M., and Sorensen, R.U. Adenosine deaminase deficiency with late onset of recurrent
infections: response to treatment polyethylene glycol-modified adenosine deaminase
(PEG-ADA) J Pediatr 1988 113:312-317.

Li, P., Nijhawan, D., Budihardjo, I., Srininvasula, S.M., Ahmad, M., Alnemri, E.S., and
Wang, X. Cytochrome C and dATP-dependent formation of Apaf-1/caspase-9 complex
initiates an apoptotic protease cascade. Cell 1997 91:479-489.

Logan, A.C., Lutzko, C., and Kohn, D.B. Advances in lentiviral vector design for gene-
modification of hematopoietic stem cells. Curr Opin Biotech 2002 13:429-436.

Lukashev, D.E., Smith, P.T., Caldwell, C.C., Ohta, A., Apasov, S.G. and Sitkovsky,
M.V. Analysis of A2a receptor-deficient mice reveals no significant compensatory
increases in the expression of A2b, A1, and A3 adenosine receptors in lymphoid
organs. Biochem Pharmacol 2003 65:2081-2090.

Majumbar, S. and Aggarwal, B.B. Adenosine suppresses activation of nuclear factor-
$B selectively induced by tumor necrosis factor in different cell types. Oncogene 2003
22:1206-1218.

Malacarne, F., Benicchi, T., Notarangelo, L.D., Mori, L., Parolini, S., Caimi, L.,
Hershfield, M, Notarangelo, L.D., and Imberti, L. Reduced thymic output, increased
spontaneous apoptosis and oligoclonal B cells in polyethylene glycol-adenosine
deaminase-treated patients. Eur J Immunol 2005 35:3376-3386.

174
Mardinay, M, 3
rd
, and Malech, H.L. Enhanced engraftment of hematopoietic progenitor
cells in mice treated with granulocyte colony-stimulating factor before low-dose
irradiation: Implications for gene therapy. Blood 1996 15:4049-4056.

Markowitz, D., Goff, S., and Bank, A. A safe packaging line for gene transfer:
separating viral genes on two different plasmids. J Virol 1988 1120-1124.

Martin, M., Huguet J., Centelles J.J., and Franco, R. Expression of ecto-adenosine
deaminase and CD26 in human T cells triggered by the TCR-CD3 complex. J Immunol
1995 155:4630-4643.

Migchielsen, A.A.J., Breuer, M.L., van Room, M.A., te Riele, H., Zurcher, C.,
Ossendorp, F., Toutain, S., Hershfield, M.S., Berns, A., and Valerio, D. Adenosine-
deaminase-deficient mice die perinatally, exhibitin liver-cell degeneration, small
intestinal cell death and lung atelectasis. Nat Genet 1995 10:279-287.

Migchielsen, A.A.J., Breuer, M.L., Hershfield, M.S., and Valerio, D. Full genetic
rescue of adenosine deaminase-deficient mice through introduction of the human
gene. Hum Mol Genet 1996 5:1523-1532,

Miller, D.G., Adam, M.A., and Miller, A.D. Gene transfer by retrovirus vectos occurs
only in cells that are actively replicating at the time of infection. Mol Cell Biol 1990
10:4239-4242

Minguet, S., Huber, M., Rosendranz, L., Schamel, W.W.A., Reth, M., and Brummer, T.
Adenosine and cAMP are potent inhibitors of the NF-$B pathway downstream of
immunoreceptors. Eur J. Immunol 2005 35:31:41.

Mirabet, M., Herrera, C., Cordero, O.J., Mallol, J., Lluis, C., and Franco, R. Expression
of A2B adenosine receptors in human lymphocytes: their role in T cell activation.
J Cel Sci 1999 112:491-502.

Mohandes, T., Sparkes, R.S., Suh, E.J. and Hershfield, M.S. Regional localization of
the human genes for S-adenosylhomocysteine hydrolase (cen>q131) and adenosine
deaminase (q131>qter) on chromosome 20. Hum genet 1984 66:292.

Morimoto, C. and Scholossman, S.F. the structure and function of CD26 in the T-cell
immune response. Immunol Rev 1998 161:55-70.

Morgan, G., Levinsky, R.J., Hugh-Jones, K., Fairbanks, L.D., Morris, G.S., and
Simmonds, H.A. Heterogeneity of biochemical, clinical and immunological parameters
in severe combined immunodeficiency due to adenosine deaminase. Clin Exp
Immunol 1987 70:491-499.

Moritz, T., Dutt, P., Xiao, X., Carstanjen, D., Vik, T., Hanenberg, H., and Williams, D.A.
Fibronectin improves transduction of reconstituting hematopoietic stem cells by
retroviral vectors: evidence of direct viral binding to chymotryptic carboxy-terminal
fragments. Blood 1996 88:855-862.

175

Morschi, E., Molina, J.G., Volmer, J.B., Mohsenin, A., Pero, P.S., Hong, J.S.,
Kheradmand, F., Lee, J.J., and Blackburn, M.R. A3 adenosine receptor signaling
influences pulmonary inflammation and fibrosis. Am J Respir Cell Mol Biol 2008
39:697-705.

Mortellaro, A., Hernandez, R.J., Guerrini, M.M., Carlucci, F., Tabucchi, A., Ponaoni, M.,
Sanvito, F., Doglioni, C., DiSerio, C., Biasco, L., Follenzi, A., Naldini, L., Bordignon, C.,
Roncarolo, M.G. and Aiuti, A. Ex vivo gene therapy with lentiviral vectors rescues
adenosine deaminase (ADA)-deficient mice and corrects their immune and metabolic
defects. Blood 2006 108:2979-2988.

Muul, L.M., Tuschong, L.M., Soenen, S.L., Jagadeesh, G.J., Ramsey, W.J., Long, Z.,
Carter, C.S., Garabedian, E.K., Alleyne, M., Brown, M., Bernstein, W., Schurman, S.H.,
Fleisher, T.A., Leitman, S.F., Dunbar, C.E., Blaese, R.M., and Candotti, F. Persistence
and expression of the adenosine deaminase gene for 12 years and immune reaction to
gene transfer components: long-term results of the first clinical gene therapy trial.
Blood 2003 101:2563-2569

Naldini, L., Blomer, U., Gallay, P., Ory, D., Mulligan, R., Gage, F.H., Verma, I.M., and
Trono D. In vivo gene delivery and stable transduction of nondividing cells by a
lentiviral vector. Science 1999 272:263-267.

Neff, T., Beard, B.C. and Kiem, H-P. Survival of the fittest: in vivo selection and stem
cell gene therapy. Blood 2006 107:1751-1755.

Nolta, J.A., and Kohn, D.B. Comparison of the effects of growth factors on retroviral
vector-mediated gene transfer and the proliferative status of human hematopoietic
progenitor cells. Human Gene Therapy 1980 1:257-268.

Olah, M.E. and Stiles, G.L. Adenosine receptor subtypes: Characteristics and
therapeutic regulation. Ann Rev Pharmacol Toxicol 1995 35:581-606.

Onodera, M., Ariga, T., Kawamura, N., Kobayashi, I., Otsu, M., Yamada, M., Tame, A.,
Furuta, H., Okano, M., Matsumoto, S., Kotani, H., McGarrity, G.J., Blaese, R.M. and
Sakiyama, Y. Successful peripheral T-lymphocyte-directed gene transfer for a patient
with severe combined immune deficiency caused by adenosine deaminase deficiency.
Blood 1998 91:30-36.

Onodera, M., Nelson, D.M., Yachie, A., Jagadeesh, G.J., Bunnell, B.A., Morgan R.A.,
and Blaese, R.M. Development of improved adenosine deaminase retroviral vectors.
J Virol 1998 72:1769-1774

Orkin, S.H., Dadonna, P.E., Shewach, D.S., Markham, A.F., Bruns, G.A., Goff, S.C.,
and Kelley, W. Molecular cloning of human adenosine deaminase gene sequences. J
Biol Chem 1983 258:12753-12756.

176
Otsu, M., Nakajima, M., Kida, M., Maeyama, Y., Toita, N., Hatano, N., Kawamura, N.,
Kobayashi, R., Tatszawa, O., Onodera, M., Candotti, F., Bali, P., Hershfield, M.S.,
Sakiyama, Y., and Ariga, T. Stem cell therapy with no pre-conditioning for the ADA-
deficiency patients leads to generalized detoxification and delayed by steady
hematological reconstitution. Mol Ther 2006 13:S418.

Ozsahin, H., Arredondo-Vega, F.X., Santisteban, I., Fuhrer, H., Tuchschmid, P.,
Jochum, W., Aguzzi, A., Lederman, H.M., Fleischman, A., Winkelstein, J.A., Seger,
R.A. and Hershfield, M.S. Adenoisne deaminase (ADA) deficiency in adults. Blood
1997 89:2849-2855.

Pacheco, R., Marinez-Navio, J.M., Lejeue, M., Climent, N., Oliva, H., Gatell, J.M.,
Gallart, T., Mallol, J., Lluis, C., and Franco, R. CD26, adesine deaminase, and
adenosine receptors mediate costimulatory signals in the immunological synaspse.
PNAS 2005 102:9583-9588.

Palmer, T.M. and Stiles, G.L. Adenosine receptors. Neuropharm 1995 34:683-694.

Parkman, R., Weinberg, K., Crooks, G., Nolta, J., Kapoor, N., and Kohn, D. Gene
therapy for adenosine deaminase (ADA) deficiency. Ann Rev Med 2000 51:33-47.

Pan, D., Gunther, R., Duan, W., Wendell, S., Kaemmerer, W., Kafri, T., Verma, I.M.,
and Whitley, C.B. Biodistribution and toxicity studies of VSVG-psuedotyped lentiviral
vector intravenous administration in mice with the observation of in vivo transduction of
bone marrow. Mol Ther 2002 6:19-29.

Pollock, K.E., Hanenberg, H., Noblitt, T.W., Schroeder, W.L., Kato, I., Emanuel, D., and
Williams, D.A. High-efficiency gene transfer into normal and adenosine deamniase
deficient T lymphocytes is mediated by transduction on recombinant fibronectin
fragments. J Virol 1998 72:4882-4892.

Polmar, S.H., Wetzler, E.M., Stern, R.C., and Hirschhorn, R. Restoration of in-vitro
lymphocyte responses with exogenous adenosine deaminase in a patient with severe
combined immunodeficiency. Lancet 1975 2:743-746.

Polmar, S.H., Stern, R.C., Schwartz, A.L., Wetzler, E.M., Chase, P.A., and Hirschhorn,
R. Enzyme replacement therapy for adenosine deaminase deficiency and severe
combined immunodeficiency. NEJM 1976 295:1337-1343.

Ratech, H., Thorbecke, G.J., Meredith, G., and Hirschorn, R. Comparison and
possible homology of isozymes of adenosine deaminase in aves and humans.
Enzyme 1981 26:74-84.

Ratech, H., Hirschhorn, R., and Thorbecke, G.J. Effects of deoxycoformycin in mice:
III. A murine model reproducing multi-system pathology of human adenosine
deaminase deficiency. Am J Pathol 1985 119:65-72.

177
Ratter, F., Germer, M., Fischbach, T., Schultz-Osthoff, K., Peter, M.E., Droge, W.,
Drammer, P.H., and Lehmann, V. S-adenosylhomocysteine as a physiological
modulator of Apo-1-mediated apoptosis. Int Immunol 1996 8:1139-1147.

Relander, T., Karlsson, S., and Richter, J. Oncoretroviral gene transfer to NOD/SCID
repopulating cells using three different viral envelopes. J Gene Med 2002 4:122-132.

Renshaw, J. and Harrap, K.R. In vivo inhibition of mouse liver methyltransferase
enzymes following treatment with 2’deoxycoformycin and 2’-deoxyadenosine. Adv Exp
Med Biol 1986 195 Part B:673-675.

Riddle, S.R., Elliott, M., Lewinsohn, D.A., Gilbert, M.J., Wilson, L., Manley, S.A.,
Lupton, S.D., Overell, R.W., Reynolds, T.C., Corey, L., and Greenberg, P.D. T-cell
mediated rejection of gene-modified HIV-specific cytotoxic T lymphocytes in HIV-
infected patients. Nat Med 1996 2:216-223.

Robbins, P.B., Yu, X-J., Skelton, D.M., Pepper, K.A., Waserman, R.M., Zhu, L., and
Kohn, D.B. Increased probablility of expression from modified retroviral vectors in
embryonal stem cells and embryonal carcinoma cells. J Virol1997 71:9466-9474.

Robbins, P.B., Skelton D.M., Yu, X-J, Halene S.A., Leonard, E.H., and Kohn, D.B.
Consistent, persistent expression from modified retroviral vectors in murine
hematopoietic stem cells. PNAS 1998 95:10182-10187.

Rosenzweig, M., MacVittie, T.J., Harper, D., Hempel, D., Glickman, R.L., Johnson,
R.P., and Farese, A.M., Whiting-Theobald, N., Linton, G.F., Yamaski, G., Jordan, C.T.,
and Malech, H.L. Efficient and durable gene marking of hematopoietic progenitor cells
in nonhuman primates after nonablative conditioning. Blood 1999 94:2271-2286.

Ruland, J. and Mak, T.W. From antigen to activation specific signal transduction
pathways linking antigen receptors to NF-$B. Semin Immunol 2003 15:177-183.

Sabatino, D.E., Do, B-K.Q., Pyle, L.C., Seidel, N.E., Girard, L.J., Daye Srpatt, S., Orlic,
D. and Bodine, D.M. Amphotropic or gibbon ape leukemia virus retrovirus binding and
transduction correlates with the level of receptor mRNA in human hematopoietic cell
lines. Blood Cell Mol Disease 1997 23:422-433.

Sands, M.S. and Barker, J.E. Percutaneous intravenous injection in neonatal mice.
Lab Anim Sci 1999 49:328-330.

Schmidt, M., Carbonaro, D., Speckmann, C., Wissler, M., Bohnsack, J., Nolta, J.A.,
Kohn, D.B., and von Kalle, C. Clonality analysis after retroviral-mediated gene
transfer to cord blood CD34+ cells of an ADA-deficient SCID infant. Nat Med 2003
9:463-468.

Schrader, W.P., Woodward, F.J. and Pollara, B. Purification of an adenosine
deaminase complexing protein from human plasma. J Biol Chem 1979
254:11964-11968.

178
Sharoyan, S., Antonyan, A., Mardanyan, S., Lupidi, G., and Cristalli, G. Influence of
dipeptidy peptidase IV on enzymatic properties of adenosine deaminase. Acta Biochim
Polonica 2006 53:539-546.

Shi, D., Winston, J.H., Blackburn, M.R., Datta, S.K., Hanten, G., and Kellems, R.E.
Diverse genetic regulatory motifs required for murine adenosine deaminase gene
expression in the placenta. J Biol Chem 1997 272:2334-2341.

Silber, G.M., Winkelstein, J.A., Moen, R.C., Horowitz, S.D., Trigg, M., and Hong, R.
Reconstitution of T- and B-cell function after T-lymphocyte-depleted haploidentical
bone marrow transplantation in severe combined immunodeficiency due to adenosine
deaminase deficiency. Clin Immunol Immunopathol 1987 44:317-320.

Small, T.N., Freidrich, W., and O’Reilly, R.J. Hematopoietic stem cell transplantation for
Immunodeficiency diseases. In Blume, K.C., Forman, S.J., and Appelbaum, F.R., (Eds.)
Hematopoietic Stem Cell Transplantation, 3rd Edition. Blackwell Science Ltd., Malden,
MA 2004 pp1430-1442.

Smorgorzweska, E.M., Brooks, J., Annnett, G., Kapoor, N., Crooks, G.M., Kohn, D.B.,
Parkman, R., and Weinberg, K.I. T cell depleted haploidenitcal bone marrow
transplantation for the treatment of children with severe combined immunodeficiency.
Arch Immunol Ther. Exp (Warsz) 2000 48:111-118.

Sokolic, R., Podsakoff, G., Muul., L., Engel, B., Jagadeesh, J., Garabedian, E.,
Carbonaro, D., Tuschong, L., Ireland, J., Hershfield, M., Tisdale, J., Dunbar, C.,
Wayne, A., Kohn, D., and Candotti, F. Comparative Results of Gene Therapy for
Adenosine Deaminase Deficiency with or without PEG-ADA Withdrawal and
Myelosuppressive Chemotherapy. Blood (ASH Annual Meeting Abstracts), Nov 2007
110: 501.

Stack, A.S., Alatman-Hamadzic, S.A., Morris, P.J., London, S.D., and London, L.
Polycholrinated biphenyl mixtures (Aroclors) inhibit LPS-induced murine splenocyte
proliferation in vitro. Toxicol 1999 139:137-154.

Stephan, V, Wahn, V., Le Deist, F., Dirksen, U., Broker, B., Muller-Fleckenstein, I.,
Horneff, G., Schroten, H., Fischer, A., and De Saint-Basile G. Atypical X-linked severe
combined immunodeficiency due to possible spontaneous reversion of the genetic
defect in T cells. NEJM 1996 335:1563-1567.

Sun, C-X., Zhong, H., Mohsenin, A., Morschi, E., Chunn, J.L., Molina, J.G., Belardinelli,
L., Zeng, D., and Blackburn, M.R. Role A2B adenosine receptor signalling in
adenosine –dependent pulmonary inflammation and injury. J Clin Invest 2006
116:2173-2182.

Thompson, L.F., Van de Wiele, C.J., Laurent , A.B., Hooker, S.W., Vaughn, J.G.,
Jiang, H., Khare, K., Kellems, R.E., Blackburn, M.R., Hershfield, M.S., and Resta, R.
Metabolites from apoptotic adenosine deaminase-deficient fetal thymic organ cultures.
J Clin Invest 2000 106:1149-1157.

179

Thrasher, A.J., Hacein-Bey-Abina, S., Gaspar, H.B., Blanche, S., Davies, E.G.,
Parsley, K., Gilmour, K., King, D., Howe, S., Sinclair, J., Hue, C., Carlier, F., von Kalle,
C.,
de Saint Basile, G., le Deist F., Fischer, A., and Cavazzana-Calvo, M. Failure of
SCID-X1 gene therapy in older patients. Blood 2005 105:4255-4257.

Tjonnfjord, G.E., Steen, R., Veiby, O.P., Friedric,h W., and Egeland, T. Evidence for
engraftment of donor-type multi-potent CD34+ cells in a patient with selective T-
lymphocyte reconstitution after bone marrow transplantation for B- SCID. Blood 1994
84:3584-3589.

Valentine, W.N., Paglia, D.E., Tartaglia, A.P., and Gilsanz, F. Hereditary hemolytic
anemia with increased red cell adenosine deaminase (45- to 70-fold) and decreased
adenosine triphosphate. Science 1977 195:783-785.

Valerio, D., Duyvesteyn, M.G.C., Meera Kahn, P., van Kessel, A.G., deWaard, A., and
van der Eb, A. Isolation of cDNA clones for human adenosine deaminase. Gene 1983
25:231-240.

Valerio, D., Guyvesteyn, M.G.C., Dekker, B.M.M., Weeda, G., Berkvens, T.M., van der
Voorn, L., van Ormondt, H., and van der Eb, A.J. Adenosine deaminase:
characterization and expression of a gene with a remarkable promoter. EMBO J 1985
4:437-443.

van der Wiele, C.J., Joachims, M.L., Fesler, A.M., Vaughn, J.G., Blackburn, M.R.,
McGee, S.T., and Thompson, L.F. Further differentiation of murine double-positive
thymocytes is inhibited in adenosine deaminase-deficient murine fetal thymic organ
culture. J Immunol 2006 176:5925-5933.

van Leeuwen, J.E., van Tol, M.J., Joosten, A.M., Schellekens, P.T., van den Bergh, RL.,
Waaijer, J.L., Oudeman-Gruber, N.J., van der Weijden-Ragas, C.P., Roos, M.T., and
Gerritsen, E.J. Relationship between patterns of engraftment in peripheral blood and
immune reconstitution after allogeneic bone marrow transplantation for (severe)
combined immunodeficiency. Blood 1994 84:3936-3947.

von Kalle ,C., Kiem, H-P., Goehle, S., Darovsky, B., Heimfeld, S., Torok-Storb, B.,
Storb, R., and Schuening, F.G. Increased gene transfer into human hematopoietic
progenitor cells by extended in vitro exposure to a pseudotyped retroviral vector.
Blood 1994 84:2890-2897.

Wada , T., Schurman, S.H., Otsu, M., Garabedian, E.K., Ochs, H.D., Nelson, D.L., and
Candotti, F. Somatic mosaicism in Wiskott--Aldrich syndrome suggests in vivo
reversion by a DNA slippage mechanism. PNAS 2000 98:8697-8702.

Wang, L., Robbins, P.B., Carbonaro, D.A., and Kohn, D.B. High-resolution analysis of
cytosine methylation in the 5’ long terminal repeat of retroviral vectors. Human Gene
Ther 1998 9:2321-2323.

180

Wang, X., Rosol, M., Ge, S., Petersen D., McNamara, G., Pollack, H., Kohn, D.B.,
Nelson, M.D., and Crooks, G.M. Dynamic tracking of human hematopoietic stem cell
engraftment using in vivo bioluminescence imaging. Blood 2003 102:3478-82.

Wardermann, H., Boehm, T., Dear, N., and Carsetti, R. B-1a B cells that link the
innate and adaptive immune responses are lacking in the absence of a spleen. J Exp
Med 2002 195:771-780.

Wakamiya, M., Blackburn, M.R., Jurecic, R., McArthur, M.J., Geske, R.S., Cartwright,
Jr. J, Mitani, K., Vaishnav, S., Belmont, J.W., Kellems, R.E., Finegold, M.J.,
Montgomery, Jr. C.A., Bradley, A., and Caskey, C.T. Disruption of the adenosine
deaminase gene causes hepatocellular impairment and perinatal lethality in mice.
PNAS 1995 92:3673-3677.

Weinberg, K., Hershfield, M.S., Bastian, J., Kohn, D., Sender, L., Parkman, R., and
Lenarsky, C. T lymphocyte ontogeny in adenosine deaminase-deficient severe
combined immune deficiency after treatment with polyethylene glycol-modified
adenosine deaminase. J Clin Invest 1993 92:596-602.

Wiginton, D.A., Adrian G.S., Friedman, D., Suttle, D.P., and Hutton, J.J. Cloning of
cDNA sequences of human adenosine deaminase. PNAS 1983 80:7481-7485.

Wiginton, D.A., Kaplan, D.J., States, J.C., Akeson, A.L., Perme, C.M., Bilyk, I.J.,
Vaughn, A.J., Lattier, D.L., and Hutton, J.J. Complete sequence and structure of the
gene for human adenosine deaminase. Biochem 1986 25:8234-8244.

Williams, D.A., Rios, M., Stephens, C., and Patel, V.P. Fibronectin and VLA-4 in
haematopoietic stem cell-microenvironment interactions. Nature 1991 352:438-41.

Winston, J.H., Hanten, G.R., Overbeek, P.A., and Kellems, R.E. 5' flanking sequences
of the murine adenosine deaminase gene direct expression of a reporter gene to
specific prenatal and postnatal tissues in transgenic mice. J Biol Chem 1992
267:13472-13479.

Winston, J.H., Hong, L., Datta, S.K., and Kellems, R.E. An intron I regulatory region
from the murine adenosine deaminase gene can activate heterologous promoters for
ubiquitous expression in transgenic mice. Somat Cell Mol Genet 1996 22:261-278.

Wu, T., Kim, H.J., Sellers, S.E., Meade, K.E., Aaricola, B.A., Metzger, M.E., Kato, I.,
Donahue, R.E., Dunbar, C.E., and Tinsdale, J.F. Prolonged high-level detection of
retrovirally marked hematopoietic cells in non-human primates after transduction of
CD34+ progenitors using clinically feasible methods. Mol Ther 2000 1:285-293.

Xu, L., O'Malley, T., Sands, M.S., Wang, B., Meyerrose, T., Haskins, M.E., and Ponder,
K.P. In vivo transduction of hematopoietic stem cells after neonatal intravenous
injection of an amphotrophic retroviral vector in mice. Mol Ther 2004 10:37-44.

181
Xu, P. and Kellems, R.E. Function of murine adenosine deaminase in the
gastrointestinal tract. Biochem Biophys Res Comm 2000 269:749-757.

Yoder, M.C., Cumming, J.G., Hiatt, K., Mukherjee, P., and Williams, D.A. A novel
method of myeloablation to enhance engraftment of adult bone marrow cells in
newborn mice. Biol Blood Marrow Transplant 1996 2:59-67.

Yang, J.C. and Cortopassi, G.A. dATP causes specific release of cytochrome C from
mitochondria. Biochem Biophys Res Commun 1998 250:454-457.

Young, H.W.J., Molina, J.G., Dimina, D., Zhong, H., Jacobson, M., Chan, L-N.L., Chan,
T-S., Lee, J.J., and Blackburn, M.R. A3 adenosine receptor signaling contributes to
airway inflammation and mucus production in adenosine deaminase-deficient Mice. J
Immunol 2004 173:1380-1389.

Zavialov, A.V. and Engstrom, A. Human ADA2 belongs to a new family of growth
factors with adenosine deaminase activity. Biochem J 2005 391:51-57.

Zennou, V., Petit, C., Guetard, D., Nerhbass, U., Montagnier, L., and Charneau, P.
HIV-1 genome nuclear import is mediated by a central DNA flap. Cell 2000 101:173-
185.

Zufferey, R., Dull, T., Mandel, R.J., Bukovsky, A., Quiroz, D., Naldini L., and Trono, D.
Self-inactivating lentivirus vector for safe and efficient in vivo gene delivery. J Virol
1998 72:9873-80.

Abstract (if available)

Abstract I have investigated three different therapeutic approaches for the treatment of adenosine deaminase (ADA)-deficient severe combined immunodeficiency (SCID) using a murine model of ADA deficiency. The first two approaches were performed in neonates (d1-3) prior to enzyme replacement therapy (ERT) and investigated the use of hematopoietic stem cell transplantation (HSCT) and in vivo gene therapy (GT). The last approach were performed in young adults, after 8 weeks of ERT, and investigated the role of cytoreductive conditioning and ERT in ex vivo retroviral mediated gene therapy. ADA-deficient neonates who received whole marrow HSCT, without cytoreductive conditioning, had immune reconstitution, but had very low donor chimerism (5-10%), and chimerism was multi-lineage. With increasing doses of cytoreductive of total body irradiation, donor chimerism increased significantly (30-50%), however, chimerism remained multi-lineage. These results are in contrast to the lymphoid specific donor chimerism observed in another murine model of SCID (X-link) that has a T lymphoid intrinsic defect. When ADA-deficient neonates received a single intravenous dose (1x108 transducing units (TU)/ml) of a lentiviral vector expressing human ADA, they had long term survival and good immune reconstitution. Proviral marking was mostly in the liver and lung, and secondary transplants showed no evidence of hematopoietic stem cell (HSC) transduction, suggesting the mice were corrected by systemic detoxification in trans. In an effort to delimit the role of cytoreductive conditioning and concurrent ERT during ex vivo HSC gene therapy, mice were conditioned with either 200 or 900 cGy total body irradiation (TBI) and ERT was either continued or discontinued. Conditioning dose was very important for engraftment of transduced HSC, with 100-1000 fold more engraftment at 900 cGy compared to 200 cGy. ERT did not decrease the amount engraftment

Linked assets

University of Southern California Dissertations and Theses

Conceptually similar

PDF

Non-viral and viral hematopoietic progenitor cell gene therapy

PDF

Pre-transplant conditioning and the role of the microenvironment during hematopoietic reconstitution

PDF

Gene therapy for the prevention and treatment of leukemia

PDF

The role of vitamin D in pediatric hematopoietic stem cell transplantation

PDF

Role of the bone marrow niche components in B cell malignancies

PDF

Rational selection of CRISPR/Cas9 guide RNAs for homology directed genome editing and its utility in the development of gene therapies

PDF

The role of endoplasmic reticulum chaperones in regulating hematopoietic stem cells and hematological malignancies

PDF

Bone marrow derived mesenchymal stem cells promote survival and drug resistance in tumor cells

PDF

Clinical outcomes of allogeneic hematopoietic stem cell transplant in acute lymphoblastic leukemia patients: a quality improvement project and systematic review meta-analysis

PDF

Exploration of the roles of cancer stem cells and survivin in the pathogenesis and progression of prostate cancer

PDF

Molecular characterization of the HIV-1 Vpu protein and its role in antagonizing the cellular restriction factor BST-2/tetherin both in vitro and in vivo

Asset Metadata

Creator Carbonaro, Denise Ann (author)

Core Title Cell and gene therapy in the murine model of adenosine deaminase deficiency

School Keck School of Medicine

Degree Doctor of Philosophy

Degree Program Systems Biology

Publication Date 08/07/2009

Defense Date 04/24/2009

Publisher University of Southern California (original), University of Southern California. Libraries (digital)

Tag adenosine deaminase,gene therapy,hematopoietic stem cell transplantation,OAI-PMH Harvest,severe combined immunodeficiency

Language English

Contributor Electronically uploaded by the author (provenance)

Advisor Lutzko, Carolyn (committee chair), Adams, Gregor B. (committee member), Aldrovandi, Grace (committee member), Crooks, Gay M. (committee member), Kohn, Donald B. (committee member)

Creator Email dcarbona@usc.edu,dsarracino@ucla.edu

Permanent Link (DOI) https://doi.org/10.25549/usctheses-m2525

Unique identifier UC1346207

Identifier etd-Carbonaro-3048 (filename),usctheses-m40 (legacy collection record id),usctheses-c127-185039 (legacy record id),usctheses-m2525 (legacy record id)

Legacy Identifier etd-Carbonaro-3048.pdf

Dmrecord 185039

Document Type Dissertation

Rights Carbonaro, Denise Ann

Type texts

Source University of Southern California (contributing entity), University of Southern California Dissertations and Theses (collection)

Repository Name Libraries, University of Southern California

Repository Location Los Angeles, California

Repository Email cisadmin@lib.usc.edu