University of Southern California Dissertations and Theses

Mechanisms of airway multiciliated cell differentiation

(USC Thesis Other)

Mechanisms of airway multiciliated cell differentiation

PDF

Download

Open document

Flip pages

Download a page range

Download transcript

Copy asset link

Request this asset

Transcript (if available)

Content Mechanisms of airway multiciliated cell differentiation
by
Erik James Quiroz
A Dissertation Presented to the
FACULTY OF THE USC KECK SCHOOL OF MEDICINE
UNIVERSITY OF SOUTHERN CALIFORNIA
In Partial Fulfillment of the
Requirements for the Degree
DOCTOR OF PHILOSOPHY
(DEVELOPMENT, STEM CELLS, & REGENERATIVE MEDICINE)
May 2024
Copyright 2024 Erik James Quiroz

ii
Dedication
To my friends and family that have seen me through this stage of my life. To my friends for the
memories, to my family for always believing in me, and to Meritxell – for your patience, your
perspective, and for the support that only a partner can provide.

iii
Acknowledgements
A large portion of the work presented here was performed in collaboration with Drs. Chris Kintner
and Seongjae Kim at the Salk institute. The genesis of this project came directly from their model
of induced multiciliogenesis in mouse embryonic fibroblast, published in 2018. For the work
presented here, Dr. Kintner’s expertise was invaluable when conceptualizing and designing many
of the initial experiments. Dr. Kim conducted the experiments in fibroblasts and performed the
coimmunoprecipitations. Dr. Kim’s technical experience and guidance was also critical in my
development in my training and development as a scientist.
The guidance and support of my mentor Dr. Amy Ryan was also critical, not only for work
presented here, but also for my cumulative development as a scientist up to this point. I may have
never pursued scientific research as a career without finding a place to gain experience as a
volunteer in the Ryan lab. My professional career then started with Dr. Ryan’s belief that I was
qualified to work as a lab technician. Most importantly, Dr. Ryan believed in my potential as a
scientist, and despite a weak undergraduate record, sponsored my admission into a graduate
program. I thank Dr. Ryan for her continuous belief in my potential, and for showing me how to
use that potential.
I also had the privilege of working with all the different members of the Ryan Lab over the course
of this project, all of whom gave their advice, technical support, or time at some level. I thank our
different lab managers Reem Elteriefi, Ngan Doan and Gregory Bonde, for their expertise and
support; nothing would have gotten done without them. I thank the postdoctoral scientists, Drs.
Janna Nawroth and Ben Calvert, who provided valuable training and advice, and Dr. Lalit Gautam
who provided the transcriptomic analysis on this project. I would also like to thank all the
undergraduates who volunteered their time. I appreciated the help with experiments as well as
the opportunity to teach and provide mentorship, and I hope the experience was worth it for them
as well.
There were also various research cores that provided services or training that were integral to the
completion of this project, especially the viral vector cores of the Salk Institute and the University
of Iowa. Additionally, the UNC Marisco Lung Institute provided the training in human bronchial
epithelial cell isolation and culture that allowed me to perform all of my experiments.
Finally, I thank the members of my qualifying exam the thesis committees, which include Drs. Zea
Borok, Parviz Minoo, Zhongwei Li and Senta Georgia. Trying to plan the committee meetings
around the schedule of four professors gave me a new appreciation for how busy senior
academics are. I appreciate the time they gave to me and thank them again for their guidance
during graduate school.
The majority of diagrams present here were generated in BioRender. Portions of the funding for
this research project and my role as a graduate research assistant were provided by Hastings
Foundation, Cystic Fibrosis Foundation grants FIRTH17XX0 and FIRTH21XX0, and NIHNHLBI: RO1HL139828. Thank you to everyone whose taxes or donations support scientific
research.

iv
TABLE OF CONTENTS
Dedication.......................................................................................................................ii
Acknowledgements........................................................................................................iii
List of Tables ................................................................................................................. v
List of Figures ................................................................................................................vi
List of Abbreviations .................................................................................................... viii
Abstract ......................................................................................................................... x
Chapter 1: Introduction ................................................................................................. 1
Airway epithelial function and composition in healthy and diseased
airways ..................................................................................................... 1
Cellular plasticity of the airway epithelium................................................ 3
Multiciliated cell differentiation.................................................................. 5
Chapter 2: Methods .................................................................................................... 11
Chapter 3: RBL2 represses multicilin transcriptional activity....................................... 22
Introduction ............................................................................................ 22
Results ................................................................................................... 26
Discussion ............................................................................................. 31
Chapter 4: RBL2 is dispensable for multiciliated cell differentiation............................ 47
Introduction ............................................................................................ 47
Results ................................................................................................... 50
Discussion.............................................................................................. 54
Chapter 5: AKT and DNA replication pathway regulation in multiciliogenesis ............. 62
Introduction ............................................................................................ 62
Results ................................................................................................... 62
Discussion.............................................................................................. 69
References .................................................................................................................. 88
Appendices.................................................................................................................. 98
Appendix A: Common and uniquely significantly upregulated DEGs
across multicilin vs Rbl2 ....................................................................... 99
Appendix B: Proteomics of multicilin/E2F4VP16 interactions.............. 118
Appendix C: Gene Ontology results of MCI/siRBL2/E2F4VP16.......... 136
Appendix D: Common and uniquely upregulated DEGs across multicilin
vs NOTCH inhibition and multiciliated related gene lists ...................... 139

v
List of Tables
Table 2.1: Oligonucleotide sequences for qRT-PCR primers and RNA interference
experiments................................................................................................................... 19
Table 2.2: Vector information and nucleotide sequences for shRNA ............................ 20
Table 2.3: Antibody Information .................................................................................... 21
Table 2.4: RBL2 targeting sgRNA sequences............................................................... 21

vi
List of Figures
Figure 1.1: Diagram of health airway epithelium structure and function.......................... 8
Figure 1.2: Types of airway epithelial remolding in disease ............................................ 9
Figure 1.3: Multiciliated cell differentiation..................................................................... 10
Figure 3.1: Schematic of cell cycle and multiciliogenesis.............................................. 36
Figure 3.2: MCC protein expression is induced by multicilin/E2F4-VP16 transduction
in MEFs ......................................................................................................................... 37
Figure 3.3: Multicilin physically interacts with Rbl2 in mouse embryonic fibroblasts ..... 38
Figure 3.4: MCC protein expression induced by multicilin/Rbl2 knockdown in MEFs ... 39
Figure 3.5: Rbl2 depletion increases the transcriptional activity of multicilin
stimulating multiciliogenesis in fibroblasts ..................................................................... 40
Figure 3.6: Transcriptome profiling confirms induction of multiciliogenesis in the
presence of siRbl2 or E2f4VP16 compared to multicilin alone...................................... 41
Figure 3.7: Heatmap of total gene expression comparing Multicilin/siRBL2 and
Multicilin/E2f4VP16 MEFs ............................................................................................. 43
Figure 3.8: Heatmap of MCC associated gene expression comparing
multicilin/siRBL2 and multicilin/E2f4VP16 MEFs........................................................... 44
Figure 3.9: RBL2 inhibits the activity of multicilin in HBECs.......................................... 45
Figure 3.10: RBL2 repression of E2F4 in multicilin induced multiciliogenesis ............... 46
Figure 4.1: Air-liquid Interface model of airway epithelial differentiation........................ 56
Figure 4.2: RBL2 knockdown does not impact the efficiency of multiciliated cells ........ 57
Figure 4.3: Co-IP of multicilin and RBL2 in HBECs at the ALI....................................... 58
Figure 4.4: Air-liquid interface attenuates the interaction between RBL2 and
multicilin ........................................................................................................................ 59
Figure 4.5 Regulation of multiciliogenesis and the activity of multicilin by RBL2........... 60
Figure 4.6 RBL2 knockdown increases HBEC doubling capacity while maintain
differentiation capacity in vitro ....................................................................................... 61
Figure 5.1: Transcriptional analysis in submerged HBECs with NOTCH inhibition
and exogenous multicilin ............................................................................................... 72
Figure 5.2: NOTCH inhibition potentiates exogenous multicilin activity in submerged
HBECs .......................................................................................................................... 74
Figure 5.3: Gene ontology analysis reveals NOTCH inhibition regulate of PI3K genes
and a multicilin induction of DNA-replication related genes........................................... 76
Figure 5.4: Organoid Single Cell Atlas reveals that DNA-replication genes are
specifically expressed in the deuterosomal cell population ........................................... 78
Figure 5.5: Suppression of cell cycle by CDK4/6 inhibition does inhibit multiciliated
cell differentiation .......................................................................................................... 79

vii
Figure 5.6: Inhibition of CDK4/6 in HBECs down regulates cell cycle gene expression
but does not affect differentiation or multiciliated induced DNA replication genes ........ 81
Figure 5.7: Phospho-protein/kinase array comparing protein expression in
submerged HBECs with multicilin induction and NOTCH inhibition .............................. 83
Figure 5.8: Inhibition of AKT multiciliated and goblet cell differentiation in HBECs at
ALI................................................................................................................................. 85
Figure 5.9: Submersion and IL-3 differentially repress multiciliated cell differentiation
in HBECs....................................................................................................................... 86

viii
List of Abbreviations
ALI: air-liquid interface
APC/C: anaphase-promoting complex or cyclosome
ASL: airway surface liquid
BCH: basal cell hyperplasia
DMSO: dimethyl sulfoxide
CCNA1: cyclin A1
CCNA2: cyclin A2
CCNE: cyclin E1
CCND: cyclin D1
CCNO: cyclin O
CDK2: cyclin dependent kinase 2
CDK4/6: cyclin dependent kinase 4 and 6
CDT1: chromatin licensing and DNA replication factor 1
CHAF1B: chromatin assembly factor 1 subunit B
COPD: chronic obstructive pulmonary disease
CTRL: control
DAPT: N-[N-(3, 5-difluorophenacetyl)-l-alanyl]-s-phenylglycinet-butyl ester
DEGs: Differentially expressed genes
DLL1: delta-like ligands 1
DLL2: delta-like ligands 2
DLL3: delta-like ligands 3
DLL4: delta-like ligands 4
DOX: doxycycline hyclate
DREAM: dimerization partner, RB-like, E2F, and multi-vulval class
DEUP1: deuterosome assembly protein 1
FBS: fetal bovine serum
FOXJ1: forkhead box J1
GMNC: geminin coiled-coil domain containing
GMNN: geminin DNA replication inhibitor
HAECs: human airway epithelial cells
HBECs: human bronchial epithelial cells
JAG1: Jagged-1
JAG2: Jagged-2

ix
NICD: NOTCH intracellular domain
NKX2-1: NK2 homeobox 1
MCT: mucociliary transport
MCC: mucociliary clearance
MCH: mucous cell hyperplasia
MCIDAS: multiciliate differentiation and DNA synthesis associated cell cycle protein
MKI67: marker of proliferation Ki-67
MUC5AC: mucin 5AC, oligomeric mucus/gel-forming
MYB: MYB proto-oncogene, transcription factor
P-ALI: Pneumacult-ALI media
PCD: Primary ciliary dyskinesia
PCL: Periciliary layer
P-EX+: Pneumacult-Ex Plus media
RB: retinoblastoma
RB1: RB transcriptional corepressor 1
RBL1: RB transcriptional corepressor like 1
RBL2: RB transcriptional corepressor like 2
SCGB1A1: secretoglobin family 1A member 1
sgRNA: single guide RNA
siNTC: non-targeting control siRNA
shNTC: non-targeting control shRNA
shRNA: short hairpin RNA
shRBL2: RBL2 targeting shRNA
siRNA: Short interfering RNA
siRBL2: RBL2 targeting siRNA
SQM: squamous metaplasia
Sub: submerged
TP73: tumor protein p73
TP63: tumor protein p63
VTX: Vertex Ultroser-G media

x
Abstract
A core pathophysiologic feature underlying many respiratory diseases is multiciliated cell
dysfunction, leading to inadequate mucociliary clearance. Due to the prevalence and highly
variable etiology of mucociliary dysfunction in respiratory diseases, it is critical to understand the
mechanisms controlling multiciliogenesis that may be targeted to restore functional mucociliary
clearance. Multicilin, in a complex with E2F4, is necessary and sufficient to drive multiciliogenesis
in airway epithelia, however this does not apply to all cell types, nor does it occur evenly across
all cells in the same cell population. This project further investigated how co-factors regulate the
ability of multicilin to drive multiciliogenesis. Combining data in mouse embryonic fibroblasts and
human bronchial epithelial cells (HBECs), RBL2 is identified as a repressor of the transcriptional
activity of multicilin. Knockdown of RBL2 in submerged cultures allows for multicilin driven
activation of multiciliogenesis. However, phosphorylation of RBL2 and a loss of its ability to
interact with multicilin occurs during normal HBEC differentiation. As RBL2 is dispensable for
normal differentiation, knock-out of RBL2 allows for increased doubling capacity of HBECs while
maintaining differentiation capacity. Further investigation into the mechanisms regulating
multicilin and RBL2 revealed a role for NOTCH and AKT signaling in RBL2 phosphorylation, as
well as a role for AKT signaling in HBEC differentiation. Further investigation into multicilin
induced gene expression indicated a previously unreported induction of DNA replication genes in
HBECs, which is unaffected by inhibition of cell cycle through CDK4/6 inhibition. As E2F4
canonically complexes with RBL2 to repress cell cycle genes, a process regulated by CDK4/6,
the data presented here offers additional insight into how multiciliated cells co-opt cell cycle
regulators during multiciliogenesis. As senescence and loss of functional multiciliated cells are
hallmarks of many airway diseases, investigation into pathways affecting RBL2 function may
provide insight into how to restore, or prevent loss of, multiciliated cells in disease.

1
Chapter 1: Introduction
In 2019, pulmonary related diseases, if counted cumulatively, would amount to the second leading
cause of death worldwide (behind ischaemic heart disease) at 13.7%, with chronic obstructive
pulmonary disease (COPD), lower respiratory infections, and cancers accounting for 5.8%, 4.7%,
and 3.2% of total deaths respectively(1). This data does not include a global viral respiratory
outbreak, such as the 1918-1920 influenza or Covid-19 pandemics which killed as many as 100
million and 14.83 million respectively(2, 3). Additionally, the global burden of COPD is projected
to cost between INT$3.327–5.516 trillion between 2020-2050, with 600 million active cases at the
end of that time frame(4, 5). While chronic and acute pulmonary disease differ in many ways,
there are similar pathophysiological characteristics present across multiple diseases. Namely a
loss of airway epithelial homeostasis and function, impacting its ability as a vital innate defense
system leading progressively to worse symptoms and loss of lung function. Therefore, to address
the substantial burdens incurred by respiratory diseases, it is critical to understand the
mechanisms regulating both airway epithelial maintenance and differentiation (maturation) and
how they may be mis-regulated in disease. This project focuses on the multiciliated cells of the
airway epithelium and aims to expand the understanding of the mechanisms regulating their
differentiation and function in addition to how these processes may be manipulated to increase
their differentiation potential in vitro.
Airway epithelial function and composition in healthy and diseased airways
The airway epithelium provides a critical innate defense system for an organ that is constantly
exposed to the outside environment and accomplishes this role through functions at several levels
of structural organization(6). At an organ system level, the airway and nasal epithelia perform the
function of mucociliary clearance. Secretory cells produce antimicrobial peptides and mucins
which form a gel-like mucous layer which is separated from the epithelium by a thin liquid known
as the periciliary layer (PCL), together composing the airway surface liquid (ASL). A healthy
human airway epithelium has approximately 2.7 square feet of surface area from the trachea to

2
bronchioles alone, all of which in up to covered in up to 30µM of ASL. The ASL captures foreign
particles that can then be cleared from the airways to the throat, using the mechanical force
generated by the cilia of multiciliated cells in the PCL. The cleared particles are then discarded
down the esophagus into the stomach (7-9). At the tissue level, the cells of the airway epithelium
join together to act as a physical barrier against foreign particles while simultaneously regulating
permeability and ion transport to maintain the proper pH and viscosity of the ASL, which is critical
for maintaining functional mucociliary clearance(10). Finally, at a cellular level, the airway
epithelium acts as an intercellular signaling hub regulating cellular response injury, insult, and
infection in order to maintain homeostasis and distribution of cell types needed to maintain a
functional barrier and mucociliary clearance(11).
Integral to the function of the airway epithelium is its structural organization, depicted in
Figure 1.1. Healthy airway epithelium is simple in arrangement but morphologically appears to
be stratified, meaning that while the basolateral sides of all epithelial cells are in contact with the
basement membrane, there is a stratification of the size and shape of different cell types and only
a portion of cells exposed to the luminal space. Basal cells are the putative adult stem cell of the
airway epithelium, are cuboidal in shape, and are not exposed to the lumen. During differentiation
of basal cells to more mature cell types, such as multiciliated and secretory cells, cells elongate
becoming columnar with junctions forming on their apical sides. This arrangement allows for a
single layered epithelium, with both the progenitor cells protected from the environment and
functional differentiated cells maximizing their apical surface area in contact with the environment.
Both acute lung injury and chronic lung disease can lead to airway remodeling and
changes in the cellular composition of airway epithelium, resulting in a decreased lung function
(12). Basal cell hyperplasia, (BCH), squamous metaplasia (SQM), and mucous cell hyperplasia
(MCH), depicted in Figure 1.2, are pathological changes common to acute lung injury and chronic
lung disease and are caused cellular repair and inflammation pathways(13-15). BCH is
characterized by a benign hyperproliferation of basal cells and often coincides with SQM (Figure

3
1.2a), resulting in stratification of the epithelium and a resemblance to squamous epithelium such
as the skin or esophagus(16-18). SQM is putative adaptive-defense mechanism resulting in a
reversible non-malignant change in cellular identify as a response to insults, such as chronic
inflammation, cigarette smoke, and DNA damage, and creates an epithelial layer that may be
more resistant to further injury(19-21). In the airways, SQM is multistage process characterized
by BCH accompanied with epithelial stratification and the appearance of a top layer of squamous
cells marked in the airway by high expression of certain proteins associated with terminal
squamous epithelial differentiation, namely keratins and members of the epidermal differentiation
complex (EDC) such as involucrin (IVL) loricrin (LOR), small proline rich protein 1B (SPPR1B),
and S100 calcium binding protein A8 (S100A8)(22, 23). While temporary, reversible SQM is
thought to be beneficial process, providing partial maintenance of the epithelial barrier while
supporting wound healing(24). However, many chronic lung diseases such as COPD, cystic
fibrosis (CF), and asthma can lead to long-term remodeling events, disrupting epithelial
homeostasis and reducing the function of the airway. The loss of tight junctions accompanied by
SQM, can make the epithelium more susceptible to acute infections and accompanying cellular
signaling responses associated with inflammation and immune response, which can also lead to
persistent MCH. MCH is characterized by an increase in both the number of goblet secretory cells
and the amount of their mucous secretion (Figure 1.2b). Ultimately, a common aspect of these
pathological changes is a loss of multiciliated cells and functional mucociliary clearance, and to
address this problem will require further understanding as to why airway epithelial cells lose their
cellular plasticity in disease where airway remodeling is persistent.
Cellular plasticity of the airway epithelium
To better understand the mechanisms regulating the pathological progression of airway
epithelial remolding and subsequent loss of multiciliated cells, it is necessary to put multiciliated
cell differentiation into context with inherent cellular plasticity of the airways. Plasticity in the
airways can be defined as the ability of cells to respond to their environment by changing gene

4
expression, resulting in phenotypic changes or lineage conversions (25, 26). During embryonic
development all lung epithelial cells are derived from a portion of the endodermal lineage known
as the primordial lung progenitors, marked early in development by expression of the transcription
factor NK2 homeobox 1 (NKX2-1), which in coordination with the surrounding lung mesoderm
gives rise to the complicated structure of the airway epithelium(27, 28). Initially, opposing NKX2.1
and SRY-box transcription factor 2 (SOX2) expression patterns induce separation of the NKX.2.1
expressing lung buds from the SOX2 expressing trachea(29). The airway epithelium then
proceeds to grow by branching, directed by signals from the mesenchyme to distal tip budding
progenitors(30). These SOX2/SOX9 double positive cells appear to give rise to all the cells of the
airway epithelium, which represent a diverse population of progenitor and functional
(differentiated) cells in the adult airway epithelium(31).
As the putative adult stem cell of the airway, basal cells are characterized by their ability
to maintain homeostasis through normal proliferation and differentiation. While multiple basal cell
populations have been described in the airway epithelium, canonical basal cells can be identified
by expression markers such as tumor protein p63 (TP63) and keratin 5 (KRT5)(32). Under
homeostatic conditions, airway epithelial cell turnover is replenished by the basal cells, which
naturally proliferate and differentiate under regulation by Notch signaling(33). Notch signaling is
a well characterized pathway in many tissues and cell models and is known to mediate cell fate
choice through contact dependent signaling(34). In humans there are variety of Notch ligands and
receptors; Notch1/2/3, delta-like ligands 1-4s (DLL1-4) and Jagged-1 and 2 (JAG1, JAG2). In
canonical Notch signaling, these interact with each other to mediate γ -secretase cleavage of the
Notch intracellular domain (NICD). Upon cleavage, the NICD is translocated to the nucleus to
regulate the expression of Notch target genes, dependent on it complex formation with
transcriptional co-activators or co-repressors(35). Basal cell proliferation is maintained in the
absence of Notch signals, with progenitor cells expressing JAG1 and JAG2, and differentiation is
triggered by expression of Notch3 in a subpopulation of basal cells, leading to activation of Notch

5
signaling by JAG1 and JAG2 in neighboring basal cells. This Notch3 mediated signaling leads to
differentiation into an intermediate basal cell type known as a parabasal cell, which can be further
pushed to differentiate into a secretory lineage by expression of Notch1/2, while its absence leads
to multiciliated cell differentiation(33). The balance of Notch receptors expression and cell fate
choice is likely governed by Notch-mediated lateral inhibition, a mechanism well described in
Notch signaling, where activation of Notch receptors repress expression of Notch ligand in the
same cell(36).
Active NOTCH signaling pushes airway epithelial cells down a secretory lineage, starting
first with the club cells. Club cells are multipotent secretory cells marked by the expression of
secretoglobin family 1A member 1 (SCGB1A1) that maintain the ability to proliferate as well as
differentiate into a multiciliated cell upon the withdrawal of Notch signaling. While the signals
regulating club cell proliferation have not been well characterized, it is known that high levels of
Notch1/2 or interleukin 13 (IL13) can induce differentiation into goblet cells(33, 37). Goblet cells
are mucin secreting cells marked by expression of SAM pointed domain containing ETS
transcription factor (SPDEF) and mucin 5AC, oligomeric mucus/gel-forming (MUC5AC) and their
cellular plasticity has not been well characterized. Notch signaling has also been suggested to
play a role in differentiation into rare airway epithelial cell types, such as pulmonary
neuroendocrine cells and ionocytes, however the mechanisms regulating their differentiation are
still unknown(38). Interestingly, Notch3 activation has been reported to skew intermediate cells
towards a secretory cell fate, while the complete inhibition of Notch1-3 still leads differentiation
into multiciliated cells, indicating the presence of additional signals that can facilitate basal cell
differentiation to multiciliated cells(33, 39, 40). As the loss of cellular plasticity and capacity for
multiciliated cell differentiation is common airway diseases, the importance of multiciliated cells
and regulation of their differentiation is described in depth the following section.

6
Multiciliated cell differentiation
Multiciliated cells are key drivers of directional ciliary flow and mucociliary transport along
the epithelia of many tissues besides the airways, including reproductive tract, and brain(41-46).
In the airways, multiciliated cells play an integral role in the lung’s primary innate defense system,
by providing both a physical barrier from the environment and the mechanical force that drives
mucus, pathogens, and foreign debris out of the lungs in a process called mucociliary clearance
(47). Due to their central role in maintaining airway homeostasis, loss of multiciliated cells or
dysregulation of multiciliated cell function is a critical pathophysiologic feature underlying many
respiratory diseases, including COPD and CF(12, 48). Primary ciliary dyskinesia (PCD), a genetic
disease arising from mutations in cilia related genes, results in non-motile, dyskinetic, or absent
cilia, and symptomatically recapitulates secondary ciliary dyskinesia, characterized as the
disruption of ciliary function from disease or injury(49-53). The cellular machinery that
orchestrates the formation of multiple motile cilia, a process known as multiciliogenesis is
incredibly complex, and this is reflected in the amount of genes causative of PCD, with mutations
in over 60 of genes encoding for proteins with various functions in multiciliogenesis have been
identified as causative of PCD (54, 55). The complexity of multiciliogenesis is further emphasized
by the fact that approximately 65% PCD screened PCD patients have mutations that are unable
to be identified with current genetic testing panels, highlighting unknown (56).
To accomplish their function, each airway multiciliated cell must generate ~150 motile cilia,
which are complicated microtubule-based organelles anchored to the plasma membrane by a
structure known as basal body(57). Basal bodies are protein structures produced by the
modification of centrioles, through the addition of a variety of appendages that allows for
membrane docking, microtubule organization, and axoneme nucleation (58). The centriole is
cylindrical microtubule-based organelle that serves two cell cycle dependent functions in nonmulticiliated cells. During rest and growth phase (G0 and G1) the centriole can migrate to the cell

7
membrane and form the basal body to anchor the primary ciliary, a structure used mainly to for
signal transduction(59). During cell cycle, centriole duplication occurs via the mother centriole
duplication pathway from late G1 through G2 phase and is controlled by centrosomal protein 63
(CEP63). Then during mitosis the mother centriole separates from the newly formed daughter
and they migrate to opposite sides of the nucleus to serves as microtubule organizing centers
and facilitate chromosome separation(60). In order to generate the massive amounts of centrioles
needed for multiciliated cell differentiation, multiciliogenesis utilizes deuterosomal-mediated
centriole biogenesis(61). Deuterosome are protein structures that allow for de novo centriole
biogenesis by utilizing a CEP63 paralog known as deuterosome assembly protein 1 DEUP1. To
facilitate deuterosomal-mediated centriole biogenesis multiciliated cells employ a unique
transcriptional program that induces DEUP1 along with necessary cell cycle proteins that facilitate
centriolar biogenesis without entering cell cycle (Figure 1.3).
Geminin family proteins, geminin coiled-coil domain containing (GMNC) and Multicilin,
encoded by the gene multiciliate differentiation and DNA synthesis associated cell cycle protein
(MCIDAS), have been identified as master transcriptional regulators of multiciliogenesis,
controlling both the induction of deuterosome-mediated centriole biogenesis and activating the
gene regulatory network necessary to produce motile cilia(44, 62-65). Upstream of GMNC and
Multicilin, inhibition of NOTCH signaling is critical in regulating multiciliogenesis; a direct link
between NOTCH-mediated cell fate determination and induction of Multicilin remains
unknown(66). GMNC and Multicilin share similar sequence homology, with a conserved coiledcoil domain and carboxy terminus; however, GMNC has been shown to help specify multiciliated
cell fate, while Multicilin is sufficient to induce multiciliogenesis and can bypass GMNC(66). During
multiciliogenesis, multicilin acts transcriptionally in a complex with cell cycle transcription factors
E2F4 or E2F5, along with dimerization partner DP-1, activating the expression of centriole
biogenesis genes and key downstream transcription factors, including c-MYB, TP73, and

8
FOXJ1(62). FOXJ1 is a key transcriptional factor in the formation of motile cilia and in combination
with other motile cilia transcription factors such as RFX2/3 and FOXN, regulate the formation of
the cilia axoneme and mechanical components responsible for cilia motility.
Paradoxically, the multicilin driven activation of multiciliogenesis occurs despite the wellcharacterized role of the E2F4 and E2F5 in post-mitotic cells as repressors of gene expression
during cell cycle progression. E2F4 specifically mediates senescence by acting in a complex with
the retinoblastoma (RB) family of co-repressors in the dimerization partner, RB-like, E2F and
multivuval class B (DREAM) complex(67). Since E2F4 and E2F5 repressive activity is normally
induced during mitotic exit, it suggests that there is a specific cellular context in multiciliated cells
that allows for E2F4 and E2F5 to switch to transcriptional activators. While this is partially
explained by the presence of co-activators multicilin and GMNC, it is unknown how multiciliated
cells manage to induce the large amount of cell cycle genes needed for centriolar biogenesis
while maintaining a post mitotic state.

9
Figure 1.1: Diagram of health airway epithelium structure and function. The healthy airway
epithelium forms a barrier maintained by tight junctions and composed various cell types, mainly of those
depicted, in a pseudostratified layer sitting onto of a basement membrane and layer of mesenchyme.
Goblet cells secrete a variety of mucins which form a gel-like substance that sits on top of a liquid
periciliary layer (PCL), together composing the airway surface liquid (ASL). Pathogens and foreign
particles trapped the ASL and are moved out of the lung by multiciliated cells in a process call
mucociliary clearance. Functional MCC relies on maintenance of ASL pH and viscosity, which is
regulated by the transport of ions and H2O between the cells and the ASL.

10
Figure 1.2: Types of airway epithelial remolding in disease: (a) Depiction of basal cell hyperplasia,
characterized by over-proliferation basal cells (purple) and stratification, with the formation of a densely
packed basal cell layer below the columnar cells. Basal cell hyperplasia is associated with squamous
metaplasia, as the columnar layer replaced with a stratified epithelium, topped by differentiated
squamous cells. (b) Depiction of mucous cell hyperplasia. Typically, inflammation and epithelial
remolding leads to both an increase in the proportion of total goblet cells (green) and the amount of
mucous they secrete.
Figure 1.3: Multiciliated cell differentiation. Canonically, multiciliated cell differentiation begins in a
cycling progenitor cell, which upon exit from cell cycle and low levels on Notch signaling, induces
expression of transcriptional co-activator GEMC1 (GMNC). GEMC1 interacts with E2F5 to induce
expression of downstream transcription factors such as Multicilin and TP73. Activation of multicilin
induces expression of deuterosome-mediated massive centriole biogenesis in an intermediate cell type
known as a deuterosomal cell. Centrioles then migrate to and dock with the apical cell membrane to
form the basal bodies that anchor and nucleate the multiple motile cilia. Transcription factors such as
FOXJ1 and RFX2/3 regulate the formation of the cilia axoneme and maturation of the multiciliated cell.

11
Chapter 2: Materials and Methods1
Cell culture
Mouse embryonic fibroblasts (MEFs): Freshly prepared primary MEFs were obtained from
the Genome Manipulation Core at the Salk Institute (strain DR4, non-irradiated). MEFs were
grown in DMEM supplemented with 10% fetal bovine serum (FBS) and 0.1 mM non-essential
amino acid (#11140-050; Invitrogen) in a 37°C humidified incubator with 5% CO2. Only MEFs
cultured for less than 4 passages were used in experiments.
Human bronchial epithelial cells (HBECs): Primary HBECs were either a gift from Dr.
Steve Brody (Wash U) or isolated from explant donor lungs as previously described(69) and
cultured for one passage in Airway Epithelial Growth Medium (Promocell C-21160). Continued
passaging of HBECs was performed in Pneumacult-Ex Plus (StemCell Technologies #05040)
and differentiation of cells was performed in differentiation media, either PnuemaCult-ALI
(StemCell Technologies #05001) or VALI media(70) on Transwell inserts (Corning #3470, #3460).
Expansion and differentiation of HBECs was performed according to the Pneumacult-ALI
manufacturer guidelines, with the exception that all cell culture surfaces were coated in PureCol
(Advanced Biomatrix #5005) according to product guidelines. The use of de-identified HBECs
was approved by the IRB of both the University of Southern California and the University of Iowa
as “not Human Subjects Research.”
Small Molecule inhibition: Quantities of powdered small molecule inhibitors were
purchased and then dissolved in dimethyl sulfoxide (DMSO) to produce concentrated stock
solutions that were stored at -80°C until used. Vendor information and stock solutions
concentrations were as follows: N-[N-(3, 5-difluorophenacetyl)-l-alanyl]-s-phenylglycinet-butyl
ester (DAPT, 10mM), MK-2206 2HCL (10mM), Palbociclib (10mM). Directly before adding media
to cells, drug stocks were added to cell-culture media at the necessary volumes to give final
1 Large portions of this chapter were published in Cell Death and Disease (68)

12
concentrations as listed in experiments. All experiments using small molecule inhibitors used
corresponding volumes of the vehicle DMSO in the cell culture media for controls. Media was
once for the duration of drug treatments.
Virus production and infection
pAd/CMV/V5 expressing mouse Multicilin and E2f4 proteins: The plasmids used in this
study are modified from those described in Kim et al(71). Mouse Multicilin (GenBank:
AK134107.1) was obtained from the Riken mouse FANTOM clone library (clone ID 5830438C23).
Mouse E2f4 (NCBI Ref: NM_148952.1) was derived from a cDNA obtained from Dharmacon
(clone ID 4987691), by using the full-length coding domain (wildtype) or by using a C-terminal
truncation (1–774bp) that was replaced with the transcriptional activation domain of VP16 (Viral
Protein 16; amino acids 413–490) from the UL48 gene of Herpes Simplex Virus-1 (HSV-1;
GenBank: KM222726.1). The NLS based on SV40 T-antigen (PKKKRKV) and the 6xmyc tags
were derived from the CS2 vectors. S2 cleavage sequence used in this study was T2A. Genes
assembled in a pENTR/D-TOPO vector (K240020, Invitrogen) were validated by sequencing, and
then transferred to the pAd/CMV/V5-DEST vector (#V49320; Invitrogen) using Gateway cloning.
Adenovirus: Adenoviruses were generated by GT3 core at the Salk Institute. Vector DNAs
were initially transfected into 293T cells, validated for intact protein expression by immunoblot
and immunostaining, and then used to generate crude adenovirus lysates and titer calculated.
Primary MEFs were plated with 10% FBS-DMEM for overnight, then treated with 2% FBS-DMEM
for 1 day before adenovirus infection. Adenovirus infection was performed by adding the
adenovirus crude lysate to the MEF cells for four hours, washing with pre-warmed PBS once,
then growing infected cells with 2% FBS-DMEM. The cells were subjected to relevant analysis
according to days post-infection (PI).
Lentivirus production and infection: Lentiviruses were generated in either the GT3 Core
Facility of the Salk Institute or University of Iowa Viral Vector Core

13
(http://www.medicine.uiowa.edu/vectorcore). Additionally, lentivirus was also prepared using the
calcium-phosphate transfection method(72) and third generation lentiviral packaging plasmids,
pMDLg/RRE, pRSV-Rev, and pMD2.G (#12253, #12251, #12259; Addgene) as previously
described(73). RBL2 and non-targeting control shRNA lentiviral transfer plasmids were either
purchased from Sigma or generated by cloning sequences into pSicoR-Ef1a-mCh-Puro-Puro
(#31847;Addgene, see Supplementary Table S5) as previously described(74). Doxycycline
inducible-FLAG-Multicilin lentiviral transfer plasmid was received as a gift from Alvarez R & Verma
IM, (Unpublished).
Gene Knockdown (KD) Experiments
RBL2 KD via siRNA transfection: MEFs were grown in 10% FBS-DMEM overnight, then
treated with 2% FBS-DMEM. Six hours after serum-reduced treatment, siRNAs were transfected
into MEFs using Lipofectamine RNAiMAX (Invitrogen, #13778150) according to the
manufacturer’s instructions. The transfection is performed by adding the pre-mixed complex of
siRNA with the reagent in reduced serum media (Opti-MEM; Invitrogen, #31985062) to cells
without a media change. Eighteen hours later, the cells were washed with 2% FBS-DMEM and
infected with the indicated adenovirus. Four hours after infection, the cells were washed with prewarmed PBS once, 2% FBS-DMEM once then grown under serum-reduced condition with 2%
FBS-DMEM. The cells were subjected to further analysis according to days post-infection (PI).
The siRNA for negative control (#12935–113) and siRNAs against Rbl1 (AM16708 ID#151420),
Rbl2#1 (AM16708 ID#151423), Rbl2#2 (AM16708 ID#68825), Rbl2#3 (AM16708 ID#68921) were
purchased from Thermo Fisher Scientific. The oligo sequences of siRNAs used in this study;
siRbl1 (5′-GCU AAG UUA AGC UUA AUA Ctt-3′), siRbl2#1 (5′-CCU UCA UUG GUU AGC AUG
Utt-3′) and siRbl2#2 (5′-GGG AAA UGA CCU UCA UUG Gtt-3′), siRbl2#3 (5’-GGG ACC GCU
GAA GGA AAC Utt-3’) (Supplementary Table S2.1).
RBL2 knockdown via shRNA transduction: HBECs cultured in Pneumacult-Ex Plus were

14
dissociated into single cell suspensions using Accutase (#AT 104, Innovative Cell Technologies),
counted, and the appropriate number of cells per infection condition were pelleted by
centrifugation at 400g for 5 minutes. Cells were then resuspended at a density of 500K cells/mL
in lentivirus diluted to an MOI of 20 in Pneumacult-Ex Plus with 10 µg/mL polybrene (#TR-1003,
Millipore Sigma) and incubated at 37°C for 2 hours, vortexed every 20 minutes to prevent cell
clumping. Without removing the virus, cells were seeded at the appropriate cell density for either
cell expansion or air-liquid interface differentiation and then incubated overnight 37°C. Virus was
removed the next day and cells were cultured in 1µg/mL puromycin for at least three days before
use in experiments. Lentivirus transfer plasmids for shRNA vectors and targeting and hairpin loop
sequences are listed in Table S2.2
Real time quantitative polymerase chain reaction (qRT-PCR)
Total RNA was isolated from experimental MEFs (Quick-RNA prep kit; ZYMO
RESEARCH, #R1054) or HBECs (Quick-RNA Microprep Kit; ZYMO RESEARCH, #R1051) and
at least 500ng RNA was converted in cDNA using High-Capacity cDNA Reverse Transcription Kit
(Applied Biosystems, # 4368814). Gene expression was then assayed by quantitative PCR using
PowerUp SYBR (Applied Biosystems, #A25742) and appropriate primer pairs in triplicate on the
ABI Prism 7900HT thermal cycler (Applied Biosystems, #4329001) or the QuantStudio5 (Applied
Biosystems, # A28575) . Gene expression in HBECs and MEFs was normalized using reference
genes RPLP0 and Gapdh respectively and calculated as log2 fold change versus the average of
control samples as stated. Primer sequences are listed in Supplementary Table S2.1.
Immunoprecipitation, immunoblotting analysis, and silver staining
For identifying proteins interacting with FLAG-tagged Multicilin by MASS analysis, MEFs
were infected by pAd/CMV/V5 vector encoding 3xFLAG-Multicilin, NLS-6xmyc-E2f4ΔCt-VP16-
T2A-Multicilin, and NLS-6xmyc-E2f4WT-T2A-Multicilin. Non-infected MEFs were used as the
negative control. Two days after infection, the non-infected MEFs or infected MEFs were lysed in

15
lysis buffer (50mM HEPES-KOH [pH 7.5], 500NaCl, 5mM EDTA [pH 8.0]), 2% Triton, DNase I
(10ug/ml)) by incubation on ice for 20min. Lysates were cleared by centrifugation at 12,000 rpm
for 20 min at 4 °C, then precleared by incubation with Protein G agarose (Invitrogen #20397)
agitating for 1hr at 4°C. Spun-down beads were incubated with FLAG M2 agarose (Sigma
#A2220) agitating for 2.5 hours at 4°C. The beads were washed twice with wash buffer (1:1 mix
of 50mM HEPES and Lysis buffer), washed with lysis buffer twice, then washed twice again with
wash buffer. Spun-down beads were incubated with 40uL of FLAG peptide (500ng/mL) for bound
protein elution overnight at 4°C. Elutes were subjected to protein sampling for further immunoblot
analysis and silver staining. Eluted protein samples and experimental protein lysates were
subjected to SDS-PAGE and transferred to a PVDF membrane that was then blocked with 0.5%
casein blocker (#161-0783, Bio-Rad) in PBS for 30 min followed by incubation with the indicated
primary antibodies overnight at 4 °C in 0.1% Tween-20 in blocking buffer. After extensive washing
in 0.1% Tween-20 in PBS, the blots were incubated with Alexa 680 or 800-conjugated anti- mouse
or rabbit secondary antibodies (Invitrogen, A21058, A21076, A32735) for 45 min at room
temperature, washed with 0.1% Tween-20 in PBS, and imaged using Odyssey (LI-COR). Silver
staining was performed with Pierce Silver Stain Kit (Thermo #24612) based on the manufacturer’s
instructions.
Mass Spectrometry analysis
Samples were precipitated by methanol/ chloroform and redissolved in 8 M urea/100 mM
TEAB, pH 8.5. Proteins were reduced with 5 mM tris(2-carboxyethyl)phosphine hydrochloride
(TCEP, Sigma-Aldrich) and alkylated with 10 mM chloroacetamide (Sigma-Aldrich). Proteins were
digested overnight at 37ºC in 2 M urea/100 mM TEAB, pH 8.5, with trypsin (Promega). Digestion
was quenched with formic acid, 5 % final concentration. The digested samples were analyzed on
a Fusion Orbitrap tribrid mass spectrometer (Thermo). The digest was injected directly onto a 30
cm, 75 um ID column packed with BEH 1.7um C18 resin (Waters). Samples were separated at a

16
flow rate of 300 nl/min on a nLC 1000 (Thermo). Buffer A and B were 0.1% formic acid in water
and 0.1% formic acid in 90% acetonitrile, respectively. A gradient of 1-35% B over 110 min, an
increase to 50% B over 10 min, an increase to 90% B over 10 min and held at 90%B for a final
10 min was used for 140 min total run time. Column was re-equilibrated with 15 µl of buffer A prior
to the injection of sample. Peptides were eluted directly from the tip of the column and
nanosprayed directly into the mass spectrometer by application of 2.5 kV voltage at the back of
the column. The Orbitrap Fusion was operated in a data dependent mode. Full MS scans were
collected in the Orbitrap at 120K resolution with a mass range of 400 to 1600 m/z and an AGC
target of 5e5. The cycle time was set to 3 sec, and within these 3 secs the most abundant ions
per scan were selected for CID MS/MS in the ion trap with an AGC target of 1e4 and minimum
intensity of 5000. Maximum fill times were set to 50 ms and 100 ms for MS and MS/MS scans,
respectively. Quadrupole isolation at 1.6 m/z was used, monoisotopic precursor selection was
enabled, and dynamic exclusion was used with exclusion duration of 5 sec. Protein and peptide
identification were done with Integrated Proteomics Pipeline – IP2 (Integrated Proteomics
Applications). Tandem mass spectra were extracted from raw files using RawConverter(75) and
searched with ProLuCID(76) against Uniprot mouse database. The search space included all
fully-tryptic and half-tryptic peptide candidates. Carbamidomethylation on cysteine was
considered as a static modification. Data was searched with 50 ppm precursor ion tolerance and
600 ppm fragment ion tolerance. Identified proteins were filtered to using DTASelect(77) and
utilizing a target-decoy database search strategy to control the false discovery rate to 1% at the
protein level(78).
Immunocytochemistry and image processing
MEF centriolar and cilia imaging was performed as previously described(71). HBECs were
grown on Corning 6.5mm Transwell inserts (#3470) or Nunc Lab-Tek chamber slides (#177445)
and fixed in 4% paraformaldehyde in PBS overnight at 4°C. Cells were concurrently permeabilized

17
and blocked-in antibody dilution buffer (5% bovine serum albumin, 0.3% Triton X-100, PBS) for
one hour at room temperature in antibody dilution buffer before incubation with antibodies (Table
2.3). Samples were incubated at room temperature with primary antibodies for 2 hours and
secondary antibodies for 45 minutes. Counterstains in PBS were performed directly after
secondary antibody incubation (DAPI 1µg/mL 5 minutes, Phalloidin (Biolegend#424203) 5
units/mL), with (3x) 5-minute PBS washes performed after primary antibody and counterstain
incubations. Samples were mounted with No. 1.5 coverslips using Fluoromount-G mounting
medium (Invitrogen #00-4958-02). Fluorescent image tile scans were performed on either the
DMi8 (Leica) or Revolution (Echo) fluorescent microscope systems and processed in Fiji(79).
TP73 positive cells were quantified by thresholding for positive DAPI and TP73 signal based on
control samples, water shedding and then analyzing particle counts to give the number of nuclei
positive for each stain. Cilia area coverage was calculated by thresholding for positive acetylated
α-tubulin staining and then dividing by the area covered by counterstain (Phalloidin), with a
threshold set high enough to give positive signal for the entire cell coverage area. For Cilia
quantification three independent experiments were performed in each of which 153-310 cells were
counted per experiment totaling 676 cells for siCTL, 660 cells for siRbl2 and 651 cells for
E2f4VP16.
RNA sequencing
Total RNA was isolated using Quick-RNA prep kit (Zymo Research Cat#R1054). RNAseq
libraries were constructed with Illumina Truseq RNA Sample Preparation kit v2 according to the
manufacturer’s instructions and sequenced on a HiSeq 2500 at 1x50 base pairs to a depth of 20-
40 million reads. Each RNAseq condition was performed in triplicate with RNAs isolated from
three individual experiments using MEFs. Preprocessing of fastq files and differential expression
analysis was performed using tools available on Galaxy server (https://usegalaxy.org/). Quality
check and adapter trimming of the reads were performed with fastQC

18
(http://www.bioinformatics.babraham.ac.uk/projects/fastqc) and FastP tools(80) respectively.
Reads were mapped to the mouse reference genome assembly
(GCF_000001635.27_GRCm39_genomic.fna) and BAM files were generated using RNASTAR(81). Further genomic feature was assigned with featureCounts(82) using mouse genomic
coordinates file (GCF_000001635.27_GRCm39_genomic.gtf). Finally differential gene
expression analysis was performed using DEseq2 tool(83). For differential expression studies,
genes with Log2 fold change ≥ 2 (compared to Control/NTC) were considered and adjusted p
value ≤ 0.05 was set as threshold value for statistical significance. r-Log normalized counts for
genes with significant differential expression were used to generate heatmaps and Euclidean
clustering method was applied. pHeatmap, ggplot2, dplyr, tidyverse and their dependency
packages were used to generate heatmaps and volcano plots in RStudio (RStudio Team, 2020;
R Core Team, 2021). Codes and processed data files used for volcano plots and Heatmaps is
available in Git-Hub repository (https://github.com/gautam-lk/RyanLab_RBL2). Scatterplots were
prepared in GraphPad Prism (Version 9.4.1) and a web-based tool, InteractiVenn,
(http://www.interactivenn.net/index2.html) was used to generate Venn diagram(s) using
differentially expressed genes (DEGs) with log2 fold change>2 and adj. p<0.5 compared to
uninfected cells (Appendix A), and a cilia gene list obtained from previously published reports
(84, 85). The Gene Ontology based biological, cellular and molecular functions were predicted
using g:Profiler (https://biit.cs.ut.ee/gprofiler/gost).
Cilia beat frequency analysis
ALI inserts were placed on glass bottom dishes (VWR #75779-574) and cilia movement
was captured using a 60x water immersion objective on an inverted Zeiss microscope system
equipped with a heated CO2 chamber and highspeed camera with video capture and CBF
analysis performed using Sisson-Ammons Video Analysis Software (SAVA). At least 5 random
field of views with beating cilia were captured per sample, with at least 3 samples analyzed per

19
condition.
Statistical Analysis.
Data was analyzed in GraphPAD Prism 9.4.1 and are expressed as the mean with error
bars representing SEM. Data represents 4-6 biological replicates and 1-3 experimental replicates
or two independent sets of target and control shRNA, per experiment, as indicated in the figure
legends. Paired biological samples are denoted in each figure by data point symbol shape when
not otherwise labeled. Comparison of treatment to control groups was performed by two-tailed
students paired t-test or ratio paired t-test, as appropriate. Comparisons of multiple groups was
performed by 2-way ANOVA followed by post-hoc Tukey’s multiple comparison test. P value
significance is as follows: *P < 0.05, **P < 0.01, ***P < 0.001, ****P < 0.0001.
Table 2.1: Oligonucleotide sequences for qRT-PCR primers and RNA interference
experiments
Mouse qRT-PCR Primers
Primer Target Sequence
Rbl2 Forward 5’-GAGAAGCTGGAGCGGATACT-3’
Rbl2 Reverse 5’-TCTGGCTGGAAATGCTGAGA-3’
Ccno Forward 5’-CTGCAGCTCCCTACTCAACC-3’
Ccno Reverse 5’-CCTTTCGGAAGTCGTAGCAG-3’
Deup1 Forward 5’-ATATGAGAACGAAAGACTCCGA-3’
Deup1 Reverse 5’-TGGCTAATTCTGTCTCCACTG-3’
Mcidas Forward 5’-CCGAGCCCTTCCAGATCAAG-3’
Mcidas Reverse 5’-TTAGGGTCACGATTGTGCAGG-3’
Gapdh Forward 5'-AGGTCGGTGTGAACGGATTTG-3'
Gapdh Reverse 5'-TGTAGACCATGTAGTTGAGGTCA-3'
Mouse siRNA Sequences
siRNA Catalog# Sequence
siRbl1 AM16708 ID#151420 GCU AAG UUA AGC UUA AUA Ctt
siRbl2#1 AM16708 ID#151423 CCU UCA UUG GUU AGC AUG Utt
siRbl2#2 AM16708 ID#68825 GGG AAA UGA CCU UCA UUG Gtt
siRbl2#3 AM16708 ID#68921 GGG ACC GCU GAA GGA AAC Utt
siCTRL #12935–113 Not Provided
Human qRT-PCR Primers

20
Primer Target Sequence
RBL2 Forward 5’ - CACCTTGCCAGTTCCACAGC - 3’
RBL2 Reverse 5’ - TGGAGGAGCATCCATATTTGCCT - 3’
SAS6 Forward 5’ - GCCTGCACATTCCAGCAGCA - 3’
SAS6 Reverse 5’ - GTTCCTGAACCAGGGTGGCT - 3’
DEUP1 Forward 5’ - TGACATGGAGAACCAAGCCCA - 3’
hDEUP1 Reverse 5’ - CGTGTCTCCAAGCCCGCAT - 3’
TP73 Forward 5’ - GCAAGCGTGCCTTCAAGCAG - 3’
TP73 Reverse 5’ - CGTGTCCTCGTCTCCATGCC - 3’
FOXJ1 Forward 5’ - GCTACTTCCGCCACGCAGAT - 3’
FOXJ1 Reverse 5’ - TTCGTCCTTCTCCCGAGGCA - 3’
SCGB1A1 Forward 5’ - ACCATGAAACTCGCTGTC - 3’
SCGB1A1 Reverse 5’ - TCATAACTGGAGGGTGTGTCC - 3’
MUC5AC Forward 5’ - ACCAATGCTCTGTATCCTTCCC - 3’
MUC5AC Reverse 5’ -TGGTGGACGGACAGTCACT - 3’
MCIDAS Forward 5’ -TGGCGGACCAGAACCAGAGA - 3’
MCIDAS Reverse 5’ - GTTCGGCTGGCGAGTTCCTT - 3’
CDT1 Forward 5’ - GCGCAGGACCAGGACAC -3’
CDT1 Reverse 5’ - GTAGGGCAGCACGAGTCCC - 3’
CHAF1B Forward 5’ - TCCAAGGAGTAACCTGGGACC - 3’
CHAF1B Reverse 5’ - TCCAAGGAGTAACCTGGGACC - 3’
RAD51D Forward 5’ - TCCAAGGAGTAACCTGGGACC - 3’
RAD51D Reverse 5’ - TCCAAGGAGTAACCTGGGACC - 3’
MYB Forward 5’ - GAAGACCCCGGCACAGCATA - 3’
MYB Reverse 5’ - TCCCCAAGTGACGCTTTCCA - 3’
RPLP0 Forward 5’-CCGTGATGCCCAGGGAAGAC-3’
RPLP0 Reverse 5’-GCATCTGCTTGGAGCCCACA-3’
Table 2.2: Vector information and nucleotide sequences for shRNA
human shRNA Sequences
shRNA
Lentivirus
Transfer
Plasmid
Backbone
Catalog# Target Sequence Hairpin Loop
NTC#1 pSicoR-Ef1amCh-Puro
N.A. (Cloned from
Adggene #31845) ATATGTCGCCGACCTAGCGAT TTGGATCCA
NTC#2 pLKO.1 Addgene #136035 CCTAAGGTTAAGTCGCCCTCG CTCGAG
RBL2#1 pSicoR-Ef1amCh-Puro
N.A.(Cloned from
Adggene #31845) GCACTTTCTACAATGTGAA TTCAAGAGA
RBL2#2 pLKO.1 Sigma Mission RNAi
#TRCN0000039923 GCTGAGAGAAATATGGAACTT CTCGAG

21
Table 2.3: Antibody Information
Antibody Target Vendor Catalog Number
RBL1 Proteintech 13354-1-AP
RBL2
CellSignaling
Technologies 13610
STIL Bethyl A302-441
γ-Tubulin Santacruz sc-17787)
CEP164 Santacruz sc-240226),
ARL13B NeuroMab 75-287
DEUP1 Atlas antibodies HPA010986
SAS-6 Santacruz sc-81431
FOXJ1 eBioscience 14-9965
RBL2 S672 abcam ab284755
FLAG Sigma F4042
CCDC39 Atlas antibodies HPA035364
RSPH9 Atlas antibodies HPA031703
TP73 Atlas antibodies HPA027314
ß-Actin Genetex GT5512
Table 2.4: RBL2 targeting sgRNA sequences
sgRNA Sequence(5'-3')
RBL2#1 UUUUAAUAAGAUGAAGAAGU
RBL2#2 GAAAUAUGAACCCAUUUUUC
RBL2#3 UUCCUUCCUCGCUGCUGACG

22
Chapter 3: RBL2 represses multicilin transcriptional activity2
Introduction
While induction of multicilin expression is known to be necessary and sufficient to drive
multiciliogenesis in certain model systems, including xenopus skin and kidney, zebrafish embryos,
mouse radial glial cells, and mouse airway epithelial cultures, it has become apparent that this
does not apply to all cell types, nor does it occur evenly across all cells of the same cell population
(64, 86, 87). In mouse embryonic fibroblasts (MEFs), a cell type that does not undergo
multiciliogenesis during normal differentiation, expression of multicilin alone is insufficient to
efficiently stimulate multiciliogenesis, generating only a few basal bodies and cilia(71). Efficient
ectopic formation of multiple cilia can only be induced by multicilin after both serum starvation and
co-expression with an E2F4 transgene, modified by replacing the C-terminus with a VP16
transactivator(71). Taken together this suggests that for the induction of multiciliogenesis,
multicilin is reliant on a specific cellular context conducive to the activation of E2F4 transcriptional
activity. Understanding the mechanisms regulating multicilin and E2F4 interaction and activity
may therefore be critical to providing insight into potential methods of restoring the loss of
functional multiciliated cells that is characteristic of many airway diseases.
Multicilin and its out-paralog, GMNC, were initially identified for through their putative roles
in cell cycle regulation, as their shared ancestor is geminin DNA replication inhibitor (GMNN), a
key regulator of cell cycle through the binding and inhibition of the ability of chromatin licensing
and DNA replication factor 1 (CDT1) to initiate DNA origin replication licensing during S-phase(88-
90). In 2010, GMNC was initially characterized in Xenopus larvae for the ability of GMNC to
promote DNA replication and through interactions with replication factors TopBP1, Cdc25 and
Cdk2/Ccne1(89). In 2011, multicilin was characterized in human cell lines, Hela and 293T, for
ability of multicilin to bind GMNN through their shared coiled-coiled domains, subsequently
2 Large portions of this chapter were published in Cell Death and Disease (68)

23
inhibiting the ability of GMNN to bind CDT1 and stalling cells in S-phase(88). The interest in
GMNC and multicilin then shifted from a focus on novel cell cycle regulation to a focus on roles
as master transcriptional regulators of multiciliogenesis, after both proteins were described as
necessary and sufficient to drive multiciliogenesis in multiple systems. The ability of GMNC and
multicilin to act as transcriptional co-activators during multiciliogenesis, as well as GMNC and
multicilin target genes, have been well described. However, the mechanisms regulating GMNC
and multicilin transcriptional activity have only recently been begun to be investigated. Most
recently described are interactions with TP73 and TRRAP, as well as a demonstration that
differences in the C-terminal TIRT domains of GMNC and multicilin confer differential affinity for
SWI/SNF subcomplexes(66, 91-95). There is currently a plethora of data that indicates an
unexplored and complex relationship between the cell cycle and regulation of multiciliogenesis
through multicilin, its transcription factor complex, and its transcriptional targets that needs to be
warrants further investigation.
Multiciliogenesis appears to be intrinsically reliant on cell cycle pathways, through the
process of centriole biogenesis, as key cell cycle regulators “moonlight” in the process of centriole
biogenesis but appear to have slightly altered regulation mechanisms, possibly through the use
meiosis-related proteins that have co-opted their function(96). Cyclin dependent kinase 1 (CDK1),
an essential driver of both mitosis and meiosis, is necessary for centriole growth during
multiciliogenesis (97). Cyclin dependent kinase 2 (CDK2) is responsible for phosphorylation of or
RB (retinoblastoma) transcriptional repressor 1 (RB1), subsequent induction of cell cycle genes,
and cell cycle progression to S-phase (Figure 3.1) and has also been demonstrated to be
necessary for multiciliogenesis in mouse tracheal epithelial cells (98). Canonically, during cell
cycle, cyclin E (CCNE1) and cyclin A2 (CCNA2) activate CDK2 enzymatic activity to promote the
G1/S and S/G2 transitions respectively(99-101). However, during multiciliogenesis CDK2
associates specifically with CCNA1, a cyclin normally associated with meiosis, to facilitate

24
deuterostome-mediated centriole biogenesis(98). Further support for mitosis-meiosis adapted
mechanisms playing a role in multiciliogenesis is demonstrated in a report of F-box protein 43
(FBXO43) regulation of centriole biogenesis in Xenopus larvae skin(102). FBXO43 mediates
arrest of meiosis in metaphase II, through inhibition of the anaphase-promoting complex or
cyclosome (APC/C), and is similarly employed in multiciliogenesis to regulate APC/C targets
necessary to promote postmitotic basal body production, such as CCNA1 and cyclin B (CCNB)
(102). While each these of these studies links multiciliogenesis to cell cycle through regulation
cyclin dependent kinase and centriole biogenesis, no direct link has been made as to their
possible regulation of multicilin activity despite extensive characterization of multicilin interaction
with E2F family transcription factors, key regulators of cell cycle whose activity is intrinsically
linked to CDK activity.
Previous studies have reported a two-step mechanism controlling the induction of
multiciliogenesis, with an initial upregulation of GMNC that mediates the specification of
multiciliated cell fate and induces downstream activation of multicilin which then drives
multiciliogenesis (64, 66). Loss of either GMNC or multicilin similarly result in reduced generation
of motile cilia (RGMC), a type of PCD where multiple cilia per cell do not form, indicating that
despite their similarities they do not serve totally redundant functions(65, 103). The majority of
the distinction in GMNC and multicilin function likely lies in preferential differences in the
transcription factors for which they complex with, as GMNC and MCIDAS have been shown to
have similar yet distinct patterns of gene expression activation(66). GMNC more effectively
complexes with E2F5 than E2F4 and the GMNC-E2F5 complex is thought to specify multiciliated
cell fate by driving expression of multicilin and other downstream multiciliogenesis transcriptional
regulators. GMNC induced multicilin then complexes with both E2F4 and E2F5 to potentiate
multiciliogenesis through, activation of massive centriole biogenesis, upregulation in expression
of downstream transcription factors, and positive feedback loop through activation of NOTCH

25
inhibition by miRNAs (66, 91, 93). In this proposed two-step model, multicilin can substitute for
GMNC but GMNC cannot substitute for multicilin in multiciliogenesis, which may be due to the
ability of multicilin to efficiently complex with E2F4 as well as E2F5.
The function of E2F4 and E2F5 in potentiating multicilin activity further highlights the
innate relationship between cell cycle and multiciliated cell differentiation. The E2F family of
transcription factors, consisting of E2Fs 1-7, have been well characterized in their canonical roles
as cell cycle regulators(104-107). E2F1, E2F2, and E2F3 are transcriptional activators who,
together with their dimerization partners transcription factor Dp-1 and 2 (TFDP1 and TFDP2),
have been characterized to have some specific differences in functionality, but for the purposes
of cell cycle can be categorized together due to their shared mechanism of regulation(105, 108).
At the start of cell cycle, during G1, the RB1 is mainly hypo-phosphorylated, allowing for it to bind
and inhibit the transcriptional activity of E2F1-3. After receiving cellular signals promoting
proliferation, increased levels of cyclin D (CCND) mediate the enzymatic activity of cyclin
dependent kinase 4 and 6 (CDK4/6) which increase levels of mono-phosphorylated of RB1,
stimulating some RB1 dissociation from E2Fs1-3 and inducing partial E2F1-3 activity. Growth
factor signaling together with E2F1-3 activity induces expression of CCND and CCNE, causing a
positive feedback loop. CCNE and CDK2 complex and hypo-phosphorylate RB1 causing total
dissociation E2F1-3 which drives cells past the G1/S restriction point as depicted in Figure 3.1.
E2F4 and E2F5 are canonically known transcriptional repressors of cell cycle and specifically
inhibit expression of cell cycle genes during senescence and quiescence. This process is
dependent on interactions with RB transcriptional repressor like 1 and 2 (RBL1 and RBL2) which
are also regulated by phosphorylation from CDK2 and CDK4/6. RBL1 and RBL2 act as
transcriptional co-repressors for E2F4 and E2F5 by recruiting various epigenetic regulators to
inhibit expression of cell cycle genes(109-112). While both combinations of interactions
consisting of RBL1 or RBL2 and E2F4 or E2F5 have been observed in senescence, the most well

26
described is E2F4 and RBL2 in the DREAM complex. While canonically functioning as repressor
overall, DREAM complex components are also were well described in transcriptional activator
complexes such as B-MYB–MuvB complex which binds to FOXM1 to induce mitotic gene
expression. Taken together, the specific conditions needed to induce ectopic multiciliogenesis,
the differential roles CDKs play in regulating E2F1-3 and E2F4/5 through RB1, RBL2 and RBL2,
and the dual role of E2F4 as a cell cycle repressor and activator of multiciliogenesis indicates
there is specific cellular context in which multicilin is able to function, intrinsically cell cycle and
differentiation, and may give lead to mis-regulation in airway disease.
In this chapter, it is hypothesized that the multicilin and E2F4 activity in multiciliated cell
differentiation is dependent on specific interactions with additional, yet to be identified corepressor or activators. Evidence is provided for a physical interaction between RBL2 and
multicilin during G0 which also supports that this interaction is mediated in complex with E2F4,
through its C-terminal domain. Additionally, it is established that RBL2 has the ability to inhibit
multicilin transcriptional activity and the induction of multicilin mediated multiciliogenesis. Finally,
it is demonstrated that the knock down of RBL2 expression allows for exogenous multicilin to
drive ectopic formation of multiple motile cilia in both MEF and HBECs. Taken together, this data
provides further support for the existence of a, yet uncharacterized, mechanism by which
differentiating multiciliated cells can co-opt cell cycle regulation machinery to induce the
expression of cell cycle gene necessary for multiciliogenesis, without entering cell cycle. Further
investigation into this mechanism may provide insight as to the loss of functional multiciliated cell
differentiation in disease.
Results
E2F4 C-terminus substitution with VP16 attenuates RBL2-multicilin interaction in MEFs
In their canonical roles, the E2F4 pocket protein binding domain (PPBD) is known to bind corepressors, such as RBL1/2, to mediate the inhibition of cell cycle gene expression, while the

27
transactivating domain (TAD) of E2F family proteins associates with epigenetic modifiers to
activate transcription of cell cycle genes (Figure 3.2a)(113). It has previously been reported that
overexpression of multicilin is not sufficient to induce multiciliogenesis effectively in MEFs(71).
However, this block could be overcome by overexpressing multicilin along with a modified form
of E2F4 where both the PPBD and TAD domains were replaced with a viral transactivation domain
VP16 (E2f4ΔCT-VP16), as evidenced by robust centriole amplification and increased expression
of multiciliogenesis-related proteins (Figure 3.2b,c)(71). Here proteomics was performed in order
to determine whether the proteins associated with the multicilin complex change when cells
express multicilin along with wildtype E2F4 (limited multiciliogenesis) compared to E2f4ΔCTVP16 (extensive multiciliogenesis).
Adenoviral vectors were used to express multicilin tagged at the N-terminus with 3xFLAG
(FLAG-MCI, Figure 3.3a), FLAG-MCI along with wildtype E2F4 (FLAG-MCI+E2f4, Figure 3.3b),
or FLAG-MCI along with E2f4ΔCT-VP16 (FLAG-MCI+E2f4VP16, Figure 3.3c). MEFs were
transduced, and immunoprecipitation performed using FLAG to co-purify proteins complexed to
multicilin. The bound proteins to FLAG-MCI were eluted and silver staining performed to identify
the MCI-3xFLAG (Figure 3.3e). Mass spectrometry analysis identified multiple proteins with
similar abundance between FLAG-MCI and FLAG-MCI+E2f4VP16, with 8 of the 10 most
abundant proteins being present in both conditions. These proteins included known multicilin
binding partners, TFDP-1, GMNN, E2F4, and E2F5, as well as ribosomal proteins whose
interaction with multicilin has not previously been described: RPS27, RPS27L and RPS14 (Figure
3.3d). A complete list of the proteins complexed with multicilin is included in Appendix B. The
other 2 of the 10 most abundant proteins bound to FLAG-MCI were 26S protease regulatory
subunit 7 (PSMC2) and Retinoblastoma-like protein 2 (RBL2). Notably, RBL2 had the largest
decrease in relative abundance comparing FLAG-MCI to E2f4VP16 of all proteins detected in
both samples, with a ratio of 9.2:1.

28
Immunoblotting analysis detected a strong interaction between multicilin and RBL2 in
MEFs expressing either FLAG-MCI or FLAG-MCI+E2f4; however, the RBL2-multicilin interaction
was abolished in MEFs expressing FLAG-MCI+E2f4VP16 (Figure 3.2f). Similarly, an interaction
with RBL1 was observed in MEFs expressing FLAG-MCI in the presence of E2f4, but not
E2f4VP16 (Figure 3.3f). The retinoblastoma family of proteins, including RB, RBL1 and RBL2,
have been well characterized in their roles as cell cycle inhibitors through interactions with the
E2F family of transcription factors(114, 115). The RBL2-E2F4 complexes have been identified as
the predominant repressors of cell cycle genes during quiescence(114, 115). Taken together, the
canonical role of RBL2 as a co-repressor of E2F4 and our observation that RBL2 complexes
strongly with multicilin in the presence of E2f4 relative to E2f4ΔCT-VP16, suggest that RBL2 may
regulate the capacity of the multicilin transcriptional complex to activate multiciliated cell gene
expression.
RBL2 represses the ability of multicilin to drive ectopic multiciliogenesis in MEFs
To further investigate a regulatory role of RBL2 in the multicilin-E2F4 transcriptional complex, we
tested siRNAs for Rbl2 knockdown in MEFs (siRbl2#1-3, Supplementary Table 2.1), identifying
siRbl2#1 (siRbl2) as most efficient at reducing Rbl2 gene expression, with a reduction of
1.42±0.44 log2 fold change compared to a non-targeting control (siCTL) (Figure 3.4a). An siRNA
targeting Rbl1 (siRbl1) was also tested and compared as an additional control. Successful
knockdown was validated at the protein level by western blot (Figure 3.4a, Figure 3.5b-c).
Multicilin-expressing, Rbl2-depleted MEFs (FLAG-MCI+siRbl2) showed a marked
increase in the transcriptional activation of core multiciliogenesis genes Ccno, Deup1 and Mcidas
relative to control siRNA MEFs (FLAG-MCI+siCTL), reaching levels comparable to those in
multicilin-expressing MEFs with E2f4VP16 (FLAG-MCI-E2f4VP16) (Figure 3.5b). Similar
increases were observed at the protein level, since a depletion of RBL2, but not RBL1, in
multicilin-expressing MEFs significantly induced the expression of centriolar assembly proteins,

29
STIL and DEUP1 (Figure 3.5a), as well as ciliary axonemal protein, CCDC39 (Figure 3.4). In
multicilin-expressing MEFs with siRbl2, robust centriole amplification was observed as shown in
representative confocal images showing DEUP1 and SAS-6, markers of centriole amplification
via the deuterosome pathway (Figure 3.5c, Figure 3.4d). Immunoblotting confirmed the presence
of axonemal proteins, CCDC39 and RSPH9, in both siRbl2 and E2f4VP16, but not siCTL,
indicating sufficient activation of late stage multiciliogenesis by Multicilin only in the absence of
multicilin interaction with RBL2 (Figure 3.5d). The formation of cilia was validated by
immunostaining with cilia marker, ARL13B, and basal body marker, CEP164 (Figure 3.5e).
Quantification of cilia number per cell revealed that multicilin induction efficiently stimulated
multiciliogenesis in Rbl2-depleted and E2f4VP16 expressing, but not in control siRNA-transfected
MEFs, with average percentages of cells with >10 cilia at 28.6±1.5%, 29.0±3.0%, and 2.7±0.6%,
mean±S.E.M. respectively (Figure 3.5e).
To further evaluate the ability of RBL2 to regulate multicilin-dependent activation of
multiciliogenesis, we performed bulk RNA-sequencing to determine multicilin-induced
transcriptional changes comparing multicilin induced MEFS with siCTL, siRbl2 or E2f4VP16 to
non-infected MEFs (Supplementary Table 2.2). Multicilin-induction with E2f4VP16 induced the
most dramatic changes in overall gene expression compared to the non-infected MEFs, with
similar trends occurring in the presence of siRbl2 and with siCTL having less substantial
transcriptional changes (Figure 3.7). Evaluating a panel of multiciliated cell related genes(84),
both E2f4VP16 and siRbl2 induce comparable transcriptional changes, while siCTL more closely
reflects non-infected MEFs (Figure 3.6a, Figure 3.8). Gene Ontogeny (GO) analysis of
differentially expressed genes (DEGs) comparing experimental conditions and the non-infected
controls (adj p>0.05, |FC|>2) highlighted significant enrichment in multicilin-induced MEFs, in the
presence of either E2F4VP16 or siRbl2, for biological processes (GO:BPs) such as cilium
organization, cilium movement, and protein localization to cilium as well cellular components

30
(GO:CCs) cilium, centriole, manchette and dynein axonemal particle (Figure 3.6b). Multicilininduction with siCTL had a significant enrichment in GO:CC deuterosome and GO:BPs cilium
organization and multiciliated differentiation; however, the most significantly enriched GO:BPs
were immune system process and response to interferon-beta (Figure 3.6b). Similar numbers of
DEGs from these GO terms were also noted in the E2F4VP16 and siR2 MEFs, however the
greater total number of DEGs decreased the enrichment significance for these GO terms
(Appendix C). Comparing common DEGs between samples, multicilin-induced MEFs with
E2F4VP16 have higher MCC gene expression compared to Rbl2-depleted MEFs (Figure 3.6c),
however both are significantly increased compared to siCTL (Figure 3.6d-e). The Venn diagram
shown in Figure 3.6f compares all DEGs, with >2-fold changes in expression, across all
experimental conditions relative to non-infected controls. We identified 448 DEGs significantly
upregulated specifically in the multicilin-induced and Rbl2-depleted or E2F4VP16 expressing
MEFs, but not in the multicilin-induced siCTL MEFs (Figure 3.6g). Of these 448 genes, 99 are
present in a previously reported mouse MCC-associated gene list (Figure 3.6g, Appendix A)
(84, 85). This data supports a regulatory role for the suppression of Rbl2 in enabling multicilin to
activate transcriptional pathways to induce massive centriole biogenesis and form multiple motile
cilia.
RBL2 knockdown increases the transcriptional activity of multicilin in submerged HBECs.
As MEFs are not a cell type inherently capable of multiciliogenesis during normal
differentiation the effect of RBL2 knockdown on multicilin transcriptional activity was tested in a
more physiological relevant cell, namely HBECs. The interaction of RBL2 and multicilin in
conditions inhibitory to Multiciliogenesis was evaluated, as this is the environment most likely to
support RBL2 repressive activity. HBECs do not typically multiciliate in vitro while submerged, as
the hypoxic environment provided by submersion stimulates NOTCH activity, inhibiting
multiciliated cell differentiation and expression of multicilin. In an experiment outlined in Figure

31
3.9a, HBECs were transfected with a lentiviral vector containing a doxycycline hyclate (DOX)
inducible FLAG-tagged multicilin transgenes, and then expression was induced for 4 days dox
induction in submerged cultures. Induction alone (red bars, Figure 3.9b) had no effect on RBL2
expression, but significantly increased expression of MCC genes TP73, endogenous MCIDAS,
and FOXJ1 (Figure 3.9b). RBL2 knockdown alone had no significant impact on TP73 gene or
protein expression (Figure 3.9b-e), however, increased MCC gene expression was observed for
FOXJ1 (Figure 3.9b). Interestingly, the combination of RBL2-knockdown and multicilin-induction
led to a significant increase in the expression of MCC genes SAS6, DEUP1, TP73 and FOXJ1
(blue bars + DOX, Figure 3.9b), the number of TP73-positive cells (Figure 3.9c,d), and total
TP73 protein expression (Figure 3.9e) when compared to either condition alone. Additionally,
only in the combination of RBL2-knockdown and multicilin-induction were we able to observe
some cells with multi-nucleated basal bodies and visible cilia axonemes, shown in confocal
images for pericentrin and acetylated alpha tubulin (Figure 3.9f). We also found that multicilininduced MCCs with RBL2 depletion had active ciliary beating (data not shown) indicating
functional cilia differentiation. These data support a new role for RBL2 in the direct inhibition of
the activity of multicilin. Only in the absence of RBL2 can multicilin efficiently drive the
transcriptional network necessary for multiciliogenesis.
Discussion
These experiments were designed to elucidate the mechanisms that regulate the potential
of human airway epithelial cells to become multiciliated, by specifically investigating the proteins
that complex with multicilin and their ability to modify multicilin transcriptional activity. The data
presented here demonstrates that in G0 cells, there exists a physical interaction between RBL2
and multicilin, likely in complex with the transcription factor for which multicilin acts as co-activator,
E2F4. Consequently, the replacement of the C-terminal domain of E2F4 in an E2F4-VP16 protein
construct disrupts the interaction of RBL2 with the Multicilin-E2F4 complex, prospectively due to

32
the lack of an RBL2 binding domain in E2F4-VP16. The presence of RBL2 is also demonstrated
to repress multicilin induced gene expression, as the depletion of RBL2 increases the
transcriptional activity of Multicilin in MEFs comparable to the levels seen with E2F4-VP16.
Additionally, exogenous expression of multicilin alone is insufficient to induce formation of multiple
motile cilia in HBECs in submerged cultures, and only in the absence of RBL2 can HBECs
undergo ectopic multiciliogenesis. Collectively, this data indicates the existence of a previously
unexplored role for RBL2 as a repressor of multicilin driven multiciliogenesis. This new
mechanism is illustrated in the schematic in Figure 3.10.
This project builds on previously published work that demonstrated multiciliogenesis can
be induced in MEFs, a mesenchymal cell type that is not innately capable of MCC differentiation,
through a process requiring serum starvation and exogenous expression of multicilin and
E2F4ΔCT-VP16(71). Serum starvation is a cell culture technique where the growth supporting
serum supplement, commonly FBS, is omitted from the cell culture media in order to deprive cells
of the growth factors, cytokines, and metabolites necessary for stimulating growth and
division(116). As FBS is composed of a complex and often undefined combination of factors, the
serum starvation process regulates a variety of cellular signaling pathways, including stress
response, apoptosis and glycolysis; but is mainly used as a method of arresting cells in G0 of the
cell cycle(116-121). While several reports have demonstrated that entry into the cell cycle
disrupts multiciliogenesis in various systems, a recent report proposes that in cycling radial glial
cells GMNC induces DNA damage in S-phase, which mediates cell cycle arrest and multiciliated
cell differentiation through activation of the TP53-TP73-P21 pathway (97, 102, 122). Collectively,
this suggests that a specific cellular state is required to potentiate multiciliogenesis downstream
of multicilin induction, specifically requiring G0/G1 arrest and additional unknown factors that can
facilitate the role of E2F4 as a transcriptional activator. The data in this project furthers supports
this hypothesis by demonstrating that the cellular state conducive to multiciliogenesis specifically

33
requires exit from the cell cycle as well as the absence of physical interaction between RBL2 and
multicilin.
The identification of RBL2 as a repressor of multicilin activity in serum starved MEFs is
not surprising as there are several precedents supportive of this mechanism. Primarily, RBL2 is
a well characterized co-repressor of E2F4 in serum starved MEFs(123). In the MEF derived cell
line, NIH3T3, serum starvation has been shown decrease acetylation and increase CDK mediated
hyper-phosphorylation of RBL2, which can subsequently disrupt E2F4/5-RBL2 interactions, (123-
125). For multicilin driven ectopic multiciliogenesis in MEFs, serum starvation may be necessary
to prevent entrance into the cell cycle but likely has the additional effect of inhibiting CDK mediated
RBL2 phosphorylation and promoting RBL2 repression of E2F4 transcriptional targets. As RBL2-
depleted MEFs expressing FLAG-MCI were able to generate cilia comparable to that of multicilininduced MEFs expressing E2F4ΔCT-VP16, it is likely that exogenous multicilin in MEFs has an
innate capacity to utilize endogenous E2F4 to function as a transcriptional co-activator. However,
the transcriptional activity of the multicilin-E2F4 complex is reduced by the presence of active
RBL2, which is able to bind to the PPDB in the C-terminal domain of unmodified E2F4. Together,
the necessity for both cell cycle arrest (which increases RBL2 activity) and siRNA/shRNA
mediated RBL2 depletion for efficient multicilin driven ectopic multiciliogenesis in MEFs and
submerged HBECs suggests that in normally differentiating multiciliated cells there exists a
mechanism to maintain cell cycle arrest while simultaneously reducing RBL2 activity. As the coopting of CDK function has already been shown to be necessary for multiciliogenesis, CDK activity
offers a potential mechanism for RBL2 inactivation in during multiciliated cell differentiation.
However, as multiple CDKs regulate both quiescence and the progression of G1/S phase through
the phosphorylation of RBL2 and RB1 respectively (Figure 3.1), and it is currently not fully known
how CDKs become active during in multiciliated cell differentiation, there is need to further
investigate the mechanisms by which CDKs may be differentially regulated in cell cycle and

34
multiciliogenesis.
Likely connected to CDK regulation, further delineation is also required for the respective
roles of RBL1 and RBL2 in multiciliogenesis. In this project RBL1, another known E2F4 corepressor, was not efficiently co-immunoprecipitated with FLAG-MCI when expressed without
exogenous E2F4 in MEFs. These results conflict with a report that characterized both multicilin
and GMNC protein-protein interactomes and demonstrated strong interactions for each with both
RB and RBL1, but conspicuously not RBL2(91). A potential explanation for this phenomenon may
be provided by differential experimental conditions, as the authors used non-serum starved AD293 cells, a cellular context would that affects the preferential binding partners of RBL1 and RBL2.
AD-239 cells are a HEK293 embryonic kidney cell line derivative, which was initially transformed
using sheared adenoviral virus 5 causing expression of adenovirus early region 1A (E1A) (126).
E1A expression results in the translation of proteins well characterized to for their ability to bind
pocket domains and effect changes in the functions of RB family proteins(127). Additionally nonserum starvation may have attenuated protein interactions with RBL2, as RBL2 has been reported
to preferentially associate with E2F4 during G0 and G1, while RBL1/E2F4 complexes form mainly
during S-phase of the cell cycle(128). As the MEFs in the experiments described here are not
transformed and are quiescent due to serum starvation, it is likely they provide a cellular context
that maximizes RBL2 interaction with E2F4. Cellular context may also explain why RBL1 only
complexed with multicilin when wildtype E2F4 was overexpressed, as well as why RBL1
knockdown did not increase the capacity of multicilin to induce multiciliogenesis. As endogenous
E2F4 will preferentially bind RBL2, RBL1 knockdown had no effect on multicilin activity in the MEF
model. Additionally, in the presence of adenoviral overexpression of E2F4 likely saturated E2F4-
RBL2 complex formation, providing excess exogenous E2F4 that was then able to complex with
RBL1. Taken together, this data highlights the need for considerate evaluation of cellular context
of known RB and E2F family interactions as well as need to further evaluate multicilin function in

35
a more physiologically relevant model.
The experiments in this chapter present encountered several limitations when exploring
the relevance of RBL2 mediated repression of multicilin in multiciliogenesis, which center on the
use of conditions that do not support multiciliated cell differentiation. Primary ciliogenesis is well
established to require cell cycle exit and while progression through S-phase has been shown to
interrupt multiciliogenesis, it has not been established whether HBECs actually enter a classic G0
state before the multiciliated cell differentiation. A recent report demonstrating that radial glial cells
use a DNA damage response pathway induced by GMNC target genes to mediate cell cycle arrest
and activation of cell cycle genes. Deuterosomal cells are a population of cells identified in by
single-cell RNA sequencing that are characterized by high expression of genes related to
deuterosome-mediated centriole biogenesis, but also score as high as proliferating basal cells
when assessed for signature expression of cell genes Taken together, this suggests a role for the
activation of cell cycle that may not recapitulated in the serum-starved MEF model presented
here. The use of submerged HBECs presented a more physiologically relevant model, as
submersion has been shown to inhibit multiciliated cell differentiation via hypoxia upstream of
NOTCH signaling. Additionally, multicilin has been demonstrated to able to drive multiciliogenesis
in GMNC null zebrafish nephron progenitors. While RBL2 knockdown allowed for increased
induction of multiciliated cell genes by multicilin in submerged cultures, for formation of multiple
motile cilia was sparse. Together, this indicates that either inhibition of NOTCH signaling,
increased oxygen concentration, GMNC expression or some combination is necessary for
multicilin driven multiciliated cell differentiation in HBECs. This process will need to be
investigated in differentiating HBECs and is further discussed in Chapter 4.

36
Figure 3.1: Schematic of cell cycle and multiciliogenesis. Proliferating cells in early growth phase (G0)
have hypo-phosphorylated RB1 protein, which acts to prevent E2F1-3 transcriptional activity. Growth factor
signaling causes an increase in CCND levels which complex with CD4/6 to mono-phosphorylate RB and
increase its transcriptional activity which along with sustained growth factor signaling increases CCNE
complexes with CDK2 to hyperphosphorylated RB1, allowing for full activation of E2F1-3 transcriptional
activity, which induces cell cycle gene expression to push cells into the DNA replication phase of cell cycle
(S). CDK4/6 and CDK2 also phosphorylate RBL1/2, which prevents them from complexing with E2F4/5 in
order to actively repress cell cycle gene expression and maintain cells in rest phase (G0). G0 is generally
believed to be required for cells to undergo multiciliogenesis upon inhibition of NOTCH or active IL-8/STAT3
signaling. During multiciliogenesis, E2F4/5 binds multicilin to actively induce multiciliated cell gene
expression.

37

38
Figure 3.2: MCC protein expression is induced by Multicilin/E2F4-VP16 transduction in MEFs. (a)
Diagram depicting mouse E2f4 protein domains and replacement of c-terminal amino acids (aa) 249-
410 with VP16 transcriptional activation domain (VP16 AD) (b) Western blot comparing non-infected
MEFs and MEFs infected with FLAG-MCI or FLAG-MCI+E2f4VP16. (c) Confocal imaging of MEFs
infected with FLAG-MCI or FLAG-MCI+E2f4VP16 for deuterosome mediated centriolar biogenesis
proteins Deup1 (red) and Sas6 (green) with DNA counterstain (DAPI, blue). Scale Bars = 10 µm.
Figure 3.3: Multicilin physically interacts with Rbl2 in mouse embryonic fibroblasts. (a-c)
Schematics of the adenoviral constructs for FLAG-MCI (a), FLAG-MCI+E2f4 (b), and FLAGMCI+E2f4VP16 (c). (d) Normalized spectral abundance factor (NSAF) for the top 10 most abundant
proteins co-immunoprecipitating with FLAG-MCI relative to FLAG-MCI+E2f4VP16 (see Supplemental
Table 1). (e) Representative silver stain of total protein lysate, the red arrowhead indicates 3xFLAGMCI. (f) Representative Western blot analysis for Rbl1, Rbl2, and FLAG for total protein (top) and
immunoprecipitations (IP, bottom) with FLAG from non-infected mouse embryonic fibroblasts (MEFs)
and MEFs infected with Ad5 FLAG-MCI, FLAG-MCI+E2f4 and FLAG-MCI+E2f4VP16.

39
Figure 3.4: MCC protein expression induced by Multicilin transduction/Rbl2 knockdown in MEFs.
(a) qRT-PCR analysis for Rbl2 expression in MEFs in the presence of siRNA targeting Rbl2 (siRBL2#1,
siRBL#2) or two non-targeting control siRNA (siCTL#1, siCTL#2). N=2 experimental replicates and 2
technical replicates for each. Gene expression relative to Gapdh and normalized to siCTLs. Data
represents mean±SEM. (b-c) Western blot analysis with antibodies against given proteins for noninfected MEFs and MEFs infected with FLAG-MCI and transfected with given siRNAs and (c) siCTL and
siRBL2 at 0.5% and 2% of transfection mix. (d) Confocal imaging comparing non-infected to FLAG-MCI
± siRNA-RBL2 for deuterosome mediated centriolar biogenesis proteins Deup1 (red) and Sas6 (green)
with DNA counterstain (DAPI, blue). Scale Bars = 50 µm and 10 µm.

40
Figure 3.5: Rbl2 depletion increases the transcriptional activity of Multicilin stimulating
multiciliogenesis in fibroblasts. (a) Representative Western blot for RBL2, RBL1 and centriole
biogenesis proteins STIL and DEUP1, comparing FLAG-Multicilin in the presence of a non-targeting
siRNA (siCTL) or siRNA targeting Rbl1 (siRbl1), Rbl2 (siRbl2), or both siRbl1 and siblL2 (siRbl1/2). (b)
qRT-PCR for MCC genes Mcidas, Ccno and Deup1 comparing FLAG-Multicilin with either siRbl2 or
E2f4VP16 relative to siCTL (Data expressed as mean±SEM., N=2 experimental replicates, normalized
to Gapdh). (c) Confocal images comparing FLAG-Multicilin in the presence of either siCTL or siRbl2
stained for centriole biogenesis markers Deup1 (red), Sas-6 (green) and nuclei are counterstained with
DAPI (blue). Scale bars = 20 µm. (d) Representative Western blot comparing FLAG-Multicilin in the
presence siCTL, siRbl2, or E2f4VP16 for Rbl2, Rbl1, FLAG, axonemal proteins CCDC39 and RSPH9
and γ-Tubulin (loading control). (e) Confocal images for cilia marker ARL3B (green) and basal body
marker CEP164 (red) nuclei are counterstained with DAPI (blue). (f) Cilia are quantified per cell, data
represents mean±SD, N=3, **** P<0.0001, unpaired t-test. Scale bar = 10 µm.

41

42
Figure 3.6. Transcriptome profiling confirms induction of multiciliogenesis in the presence of
siRbl2 or E2f4VP16 compared to Multicilin alone. (a) Unsupervised heatmap of RNA-seq data for
MCC-associated genes comparing non-infected MEFs and FLAG-MCI MEFs with either siCTL, siRbl2
or E2f4VP16. (b) Gene ontology (GO) analysis of differentially expressed genes (DEGs) (Supplemental
Table 3) comparing non-infected MEFs and FLAG-MCI MEFs with either siCTL, siRbl2 or E2f4VP16.
GO terms include biological process (GO:BP) and cellular components (GO:CC). (c-e) Scatter plots
comparing significant DEGs in FLAG-MCI MEFs (relative to uninfected, absolute log2 fold change>2,
adj. p<0.5) for siRbl2 vs siCTL (c), E2f4VP16 vs siCTL (d), and siRbl2 vs E2f4VP16 (e). (f-g) Venn
diagrams representing significantly increased DEGs in FLAG-MCI relative to uninfected controls (log2
fold change>2, adj. p<0.5, Supplemental Table S5) comparing siRbl2, siCTL and E2f4VP16 (f) and
compared to known MCC-specific genes (g). N=3 experimental replicates for all RNAseq data.

43
Figure 3.7: Heatmap of total gene expression comparing Multicilin/siRBL2 and
Multicilin/E2f4VP16 MEFs. Heatmap representing gene expression from RNAseq of non-infected
MEFs and MEFs infected with FLAG-MCI+siCTL, FLAG-MCI+siRBL2 or FLAG-MCI+E2f4VP16.

44
Figure 3.8: Heatmap of MCC associated gene expression comparing Multicilin/siRBL2 and
Multicilin/E2f4VP16 MEFs. Heatmap representing only MCC-associated gene expression from
RNAseq of non-infected compared to FLAG-MCI+siCTL, FLAG-MCI+siRBL2 or FLAG-MCI+E2f4VP16
MEFs.

45

46
Figure 3.10: RBL2 repression of E2F4 in multicilin induced multiciliogenesis. Media conditions
causing exit from cell cycle into G0 is necessary for multiciliogenesis, but also activates RBL2 mediated
repression of endogenous E2F4. In order for exogenous multicilin to induce multiciliogenesis in G0 cells,
RBL2 must be depleted (siRNA/shRNA) to allow for multicilin co-activation of E2F4 transcriptional
activity.
Figure 3.9: RBL2 inhibits the activity of Multicilin in HBECs. (a) Diagram of experimental design,
depicting the HBEC culture techniques used to generate the 4 experimental conditions analyzed in this
two-variable experiment (+/- Multicilin, +/-RBL2) (b) qRT-PCR for HBECs comparing non-targeting
controls (shNTC#2, red) to RBL2 (shRBL2#2, blue) in the presence (DOX) or absence (Veh, H2O) of
Multicilin induction. Gene expression is relative to RPLP0 and normalized to the NTC shRNA. N=4
biological replicates, n=2 experimental replicates (squares, triangles). (c) Representative IF images for
FLAG (Green), TP73 (Cyan) and DNA (DAPI, blue) in HBECs. Scale bars represent 200 µm. (d)
Quantification of TP73 positive cells. N=3-4 biological replicates per shRNA (e) Representative Western
blot for RBL2, TP73 and FLAG in HBECs comparing shNTC#2 to shRBL2#2 in the presence (DOX) or
absence (Veh) of Multicilin induction (f) Representative confocal images of basal bodies (Pericentrin,
cyan) and cilia (acetylated α-tubulin, ATUB, green) with DNA counterstain (DAPI, blue) in shRBL2 with
Multicilin induction. Scale bars represent 25 µm. Data represents mean±SEM and is compared using a
2-way ANOVA and post-hoc Tukey’s multiple comparisons test (a&c) with significance at *P < 0.05,
**P < 0.01, ***P < 0.001, ****P < 0.0001.

47
Chapter 4: RBL2 regulation of HBEC differentiation3
Introduction
As the RBL2 mediated repression of multicilin activity demonstrated in Chapter 3 utilized
exogenous multicilin expression in conditions where cells that would not normally undergo
multiciliogenesis, the goal of this chapter is to investigate the role of RBL2 in more physiologically
relevant conditions. Additionally, as RBL2 is canonically described as a mediator of senescence,
this chapter also evaluates the role of RBL2 in proliferating progenitor cell prior to differentiation.
Together, by evaluating RBL2 function in both proliferating and differentiating HBECs, this chapter
aims to connect two key aspects of HBEC and demonstrate how they regulate multiciliated cell
differentiation.
Currently the gold standard for modeling airway epithelial differentiation is the use of an
air-liquid interface model, as depicted in Figure 4.1. In the standard model, HBEC proliferating
progenitors in growth media are seeded at a high density on a collagen coated and porous (0.4µM
holes) polyester membrane at the bottom of a plastic chamber known as a cell culture insert(69).
This cell culture insert is placed in a standard tissue culture well, creating inside and outside
chamber which interface with the apical and basolateral surfaces of the cell layer. After the cells
reach confluency, the integrity of the epithelial barrier between the chambers can be validated by
testing for transepithelial electrical resistance (TEER)(129). Once the HBECs have developed
adequate tight junctions to prevent liquid transfer between chambers, growth media can be
removed from the apical and basolateral chambers, and differentiation media is added to the
basolateral chamber only. This creates the ALI which stimulates HBEC differentiation via the
exposure to air on the apical surface and cytokines in the basolateral differentiation media. Over
the course of weeks cells polarize, differentiate, and form a pseudostratified epithelium akin to
that of the in vivo airway epithelium. Airway epithelial ALI cultures consist of a distribution of basal
3 Large portions of this chapter were published in Cell Death and Disease(68)

48
cells, multiciliated cells, club cells, goblets cells and have even been documented produce rarer
cell types such as pulmonary neuroendocrine and ionocytes(130). The ability of the ALI model to
recapitulate many aspects of the airway epithelium including disease and injury modeling, drug
testing and key has made it instrumental to the field of airway biology, however there are key
draw backs that have limited its utility.
While the isolation and culture of human airway epithelial cells (HAECs) from both healthy
and diseased patients has been well established, the availability of primary lung tissue is limited,
and demand is continuously increasing as healthy uninjured lungs are prioritized for
transplantation. Diseased lung tissue not suitable for transplantation is usually isolated
postmortem or post transplantation: at the end stage of lung disease after years of infection and
damage, negatively affecting the quality, quantity, and utility of cellular isolations. While isolated
primary HBECs are able to undergo cell population expansion in vitro, their doubling capacity is
limited. Time in culture has been shown to activate a variety of cellular pathways in HBECs such
as, TGF-ß signaling and Rho-associated protein kinase (ROCK) pathway, that stimulate
premature senescence and loss of differentiation capacity (23, 69, 131-133). Advances in cell
culture media formulations and the inclusion of small molecular inhibitors for TGF-ß and ROCK
pathways have therefore greatly increased the ability of HBECs to expand in vitro. Currently, the
best way to expand HBECs is technique known as conditional reprogrammed cell (CRC) culture,
where cells are grown in co-culture with mitotically in-activated 3T3-J2 cells, a MEF cell line(134).
Despite these advances in HBEC cell culture techniques, there are still limitations. Feeder free
cells have a limited capacity for expansion and differentiation and do not expand well as single
cell colonies. CRC offers the potential for massive expansion of basal cell progenitors, but relies
on undefined, xenogenic conditions and is much more laborious than standard cell culture
techniques.
Cell lines offer a useful alternative to primary donor derived HBECs, as they grow

49
indefinitely and are more amenable to genetic manipulation, yet they also have their draw backs.
The ease of producing gene-edited or transgene expressing cell lines and their ability for
expansion in massive quantities have made cell lines key for large scale drug discovery. Several
cell lines expressing mutant CFTR transgenes were used in large scale drug screens that have
resulted in the current standard regiment CF treatment, after further validation in primary HBECs
(70, 135, 136). Cell lines have also been used to study many basic cellular mechanisms in the
airway, such as inflammatory and stress responses to a variety of conditions, including cigarette
smoke, lipopolysaccharide challenge, oxidative stress, and cytokines (137-141). Despite their
utility, cell lines offer limited capacity for studying multiciliated cell differentiation. This is likely due
to how immortalized human bronchial epithelial cells are derived. Cell lines are either isolated
from tumors or immortalized from primary HBECs using techniques to stimulate increased cell
cycle activity and inhibit senescence. Both of these methods support proliferation at the detriment
of differentiation capacity. Multiciliated cell differentiation is especially repressed due to the need
for specific activation of cell cycle regulators during multiciliogenesis, as overexpression of cell
cycle regulators has been shown to induce re-entrance into the cell cycle during differentiation(97,
98, 102). Initially cell lines were immortalized using viral gene expression such as simian virus 40
or HPV genomes, however more recently HBEC lines been derived with exogenous expression
of hTERT, CDK2 and CDK4(131, 142). While there are many reasons as to why the alteration of
key cell cycle regulation mechanisms can reduce the capacity for multiciliated cell differentiation,
the influence of CDK2 and CDK4 may be explained by their roles in the inhibition of senescence
through RBL1/2 phosphorylation and the promotion of cell cycle through phosphorylation of RB1.
In this chapter two hypothesis are investigated. First, that the knockdown of RBL2 in HBEC
at the ALI promotes multiciliated cell differentiation. Second, that RBL2 knockout in proliferating
HBECs will delay senescence while maintaining their capacity for multiciliated cell differentiation.
Data is presented to contradict the first hypothesis, as RBL2 knockdown is not demonstrated to

50
not affect the differentiation of HBECs at ALI. Evidence is presented suggesting that as a part of
multiciliated cell differentiation down stream of NOTCH inhibition and cell fate choice HBECs are
able to phosphorylate RBL2, interrupting any interaction with and repression of multicilin activity.
Additionally, date is presented in support of the second hypothesis, as RBL2 knockout HBECs
have increased doubling capacity and are able to efficiently multiciliate at late passages. Overall,
this data suggests that while RBL2 does not repress multiciliogenesis during normal multiciliated
cell differentiation, there exists a link between the regulation of senescence and differentiation
through RBL2 activity.
Results
RBL2 expression does not change the extent of multiciliogenesis from HBECs
Since knockdown of Rbl2 allowed Multicilin to induce ectopic multiciliogenesis in MEFs, a
cell type that is not innately capable of multiciliated cell differentiation, it was investigated whether
RBL2 knockdown in human airway multiciliated cell progenitors can potentiate multiciliogenesis.
To accomplish this the differentiation of human HBECs at the air-liquid interface (ALI) was
compared with or without the knockdown of RBL2 by lentiviral delivered shRNA as depicted in
Figure 4.1b. qRT-PCR analysis after 14 days of ALI differentiation confirmed that shRNAs
targeting RBL2 (shRBL2#1 and #2) significantly decreased expression of RBL2 when compared
to non-targeting controls (shNTC#1 and #2), by 2.37±0.63 and 1.30±0.19 log2 fold change,
respectively (Figure. 4.2a). The reduction in RBL2 expression resulted in a modest increase in
the expression of early multiciliated cell related differentiation genes including SAS6, DEUP1 and
TP73 (Figure 4.2b), however the expression of genes associated with differentiated human
airway epithelium, including goblet (MUC5AC), club (SCGB1A1), and multiciliated (FOXJ1) cells
was not significantly changed (Figure 4.2c). This suggests that the proportion of multiciliated cells
generated in the presence of RBL2 knockdown was unaffected. Immunoblotting confirmed
knockdown of RBL2 at the protein level alongside increased expression of TP73, while more

51
mature multiciliated cell markers, FOXJ1 and axonemal protein CCDC39, did not significantly
increase (Figure 4.2d-e). Immunostaining for cilia maker acetylated α-tubulin (ATUB) was used
to evaluate the efficiency of multiciliated cell differentiation by quantifying the area of ciliated cell
coverage on the apical cell surface layer at ALI day 14, while live video analysis was used to
measure cilia beat frequency (CBF). No significant changes in total ciliated cell coverage, nor in
CBF were detected in RBL2 knockdowns compared to controls (Figure 4.2g-h). These data
demonstrates that an ectopic reduction of RBL2 expression does not change multiciliated cell
maturation or function during HBEC differentiation at the ALI. Taken together with the finding in
Chapter 3 that the presence of RBL2 can repress exogenous multicilin activity, this data suggests
that RBL2 activity may already be endogenously regulated during the early stages of HBEC
differentiation at the ALI.
ALI culture phosphorylates RBL2, allowing multicilin to drive multiciliogenesis in HBECs
To determine whether RBL2 interactions with multicilin are indeed altered during the early phase
of ALI differentiation of HBECs, RBL2-multicilin interactions were evaluated by comparing ALI to
submerged cultures in differentiation media. DOX mediated induction of lentiviral-transduced
FLAG-tagged multicilin in HBECs was performed over a 4-day period prior to sample collection
(Figure 4.3a, Figure 4.4 4.1a-b). Immunoprecipitation of FLAG-tagged multicilin and
immunoblotting for RBL2 revealed a higher amount of RBL2 complexed with multicilin in the
submerged cultures (Fig. 4.3a, Sub D0 and Sub D4), compared to ALI cultures (Figure 4.3a, ALI
D4 and ALI D21). Total RBL2 remained consistent in all conditions (Figure 4.3a, Figure 4.4b).
These data demonstrate that ALI culture attenuates the direct interaction between RBL2 and
multicilin in HBECs, which in turn allows for multicilin transcriptional activity to drive MCC
differentiation.
Cyclin dependent kinases are known to phosphorylate the RB family of proteins,
interrupting their interaction with E2F family transcription factors to regulate gene expression and

52
cell cycle progression(106, 143). Canonically, RBL1/2 interactions with E2F4/5 actively repress
cell cycle genes(115). The ability of multicilin to co-opt E2F4 to induce centriole biogenesis in
cells not actively dividing, suggests a mechanism whereby RBL2 may be phosphorylated and
inactivated. RBL2 has over 26 reported phosphorylation sites(144-146), of which
hyperphosphorylation is associated with dissociation from E2F4 and RBL2 degradation(144, 147,
148). Among these phosphorylation sites, phosphorylation of serine 672 (S672) by CDK4/6 has
been shown to be important for attenuating E2F4-RBL2 interactions and is necessary for
ubiquitination and degradation(147). We therefore investigated whether S672 RBL2
phosphorylation status differed between HBECs in ALI and submerged culture. We observed no
significant difference in total RBL2 protein expression while S672-phosphorylated RBL2 (S672-
RBL2) was significantly higher in HBECs cultures at the ALI compared to submerged (Figure
4.4b-d). Immunoblotting analysis confirmed that multiciliated cell differentiation was activated,
evidenced by the induction of protein expression of multicilin transcriptional targets, FOXJ1 and
TP73, at Day 4 of ALI differentiation (Figure 4.4b). These data suggest that the RBL2-dependent
regulation of multicilin activity, during ALI differentiation, is associated with increased RBL2
phosphorylation at S672.
Expression of Multicilin in HBECs is known to be dependent on inhibition of NOTCH
signaling downstream of air exposure(52). To determine if RBL2 phosphorylation in differentiating
HBECs can be regulated by either NOTCH inhibition or multicilin activity, independent of ALI,
NOTCH signaling was inhibited using 5 µM of the γ-secretase inhibitor N-[N-(3,5-
difluorophenacetyl)-L-alanyl]-S-phenylglycine t-butyl ester (DAPT) and induced multicilin for 4
days in HBECs submerged in differentiation media. Immunoblotting analysis revealed that
inhibition of NOTCH signaling alone decreased total RBL2 protein expression, while multicilin
induction alone increased S672-RBL2 expression; both conditions resulted in increases in S672-
RBL2:total RBL2 (Fig. 4.4e-f). Interestingly, only the combination of NOTCH-inhibition and

53
Multicilin-induction significantly increased the S672-RBL2:total RBL2 compared to each factor
alone (Fig. 4.4f-g). This data supports a regulation of RBL2 phosphorylation downstream of both
NOTCH-inhibition and multicilin-induction and suggests that they work synergistically to
phosphorylate RBL2 at S672.
RBL2 depletion in HBECs facilitates population doubling in vitro
RBL2 is canonically characterized as mediator senescence through co-repression of E2F4
target genes (115). Taken together in consideration with the data presented here showing RBL2
is capable of repressing multicilin activity and is dispensable for multiciliated cell differentiation,
lead to the hypothesis that depletion of RBL2 in proliferating HBECs can increase doubling
potential while maintaining differentiation capacity in vitro.
To investigate this hypothesis, the RBL2 coding sequence was cloned into a DOXinducible lentiviral vector and transduced in to HBECs. After puromycin selection HBECs were
grown for a single passage treated with DOX and compared to vehicle (H2O) treated controls.
qRT-PCR of gene expression revealed a significant increase and decrease in RBL2 and MKI67
respectively(Figure 4.6a). Additionally, there was an increase in the senescence related gene
SPRR1B, but no significant change in the other senescence related genes tested IL1-ß, SPRR1B,
and IVL (Figure 4.6a). Interestingly, overexpression of RBL2 appeared to increase expression of
multiciliated cell related genes MCIDAS and TP73 while decreasing expression of secretory cell
markers, goblet and club, MUC5AC and SGCB1A1 respectively (Figure 4.6a). Proliferation rate
of HBECs quantified by comparing cell numbers at the beginning and end of the passage and
calculating the average doubling rate per day; overexpression of RBL2 significantly decreased
HBEC proliferation (Figure 4.6b).
As overexpression of RBL2 decreased the proliferation rate of HBECs, we next tested the
effect of RBL2 depletion. HBECs were nucleofected with mix of CRISPR/Cas9 ribonucleoproteins
consisting of several different single guide RNAs (sgRNAs) targeting RBL2 or Cas9 alone as a

54
control. HBECs were then continuously cultured, with cell counts taken at each passage to
calculate total population doublings. There was no apparent increase in population doubling time
between biological replicates, however 4/5 knockouts were able to be continuously cultured for at
least 38 days, as opposed to only 1/5 of the controls (Figure 4.6c). Observations of morphology
at passage where controls ceased to proliferate indicated signs of senescence as cells became
spread out, flattened and elongated, while RBL2 knockouts were able to maintain a packed
cuboidal morphology (Figure 4.6d). Passaging at low cellular density (50 cells/cm2
) revealed that
cells were able to form colonies from single cells (Figure 4.6e). Finally, differentiation of RBL2-
knock out cells that were continuously cultured past the senescence of the corresponding controls
demonstrated the ability of RBL2-knock cells to maintain the capacity for multiciliated and
secretory cell differentiation as observed by immunofluorescent staining for acetylated-αtubulin
and secretory cell marker BPI fold containing family A member 1 (BPIFA1, also known as PLUNC)
(Figure 4.6f). Taken together this preliminary data indicates that depletion of RBL2 in HBECs
increases doubling capacity while maintaining HBEC capacity for multiciliated cell differentiation.
Discussion
The experiments in this chapter were designed to investigate the role of RBL2 in HBEC
proliferation and differentiation. RBL2 expression was demonstrated to be dispensable for
multiciliated cell differentiation at the ALI, due to phosphorylation at S672 and subsequent
dissociation from multicilin. This phosphorylation event was shown to be downstream of NOTCH
inhibition and was facilitated by multicilin expression. Additionally, depletion of RBL2 was shown
to increase the ability of HBECs to passage in vitro, without losing their ability to differentiate.
The observation that RBL2 is dispensable in multiciliated cell differentiation in HBECs is
interesting as it provides further support of a mechanism present in multiciliogenesis that is able
to differentially regulate the activation of cell cycle genes. In addition to its ability to interrupt
interactions with E2F4, phosphorylation of RBL2 at S672 has been demonstrated to be

55
specifically mediated by CDK4/6 and not CDK2, unlike the majority of identified RBL2
phosphorylation sites. In the context of multiciliated cell differentiation, this presents several
possibilities: 1) CDK4/6 is active in differentiating multiciliated cells, 2) a different CDK is able to
phosphorylate RBL2 at S672, or 3) a kinase outside of the CDK family is responsible. The first
scenario is potentially problematic, as CDK4/6 activity would likely drive RB1 monophosphorylation and push cells into S-phase. The second scenario is more plausible, as CDK1
has been shown to be active during multiciliated cell differentiation and has overlapping function
with CDK2-6 as CDK1 is sufficient to drive cell cycle in their absence (97, 149). CDK2 may also
be able to phosphorylate S672, as CDK2 has been shown to be active and necessary during
multiciliated cell differentiation (98). This would require a mechanism of HBEC specific CDK2-
RBL2 interaction, whose context would need to be evaluated against conflicting reports; the use
of cancer cell lines in these reports may have affected other post-translational modifications, such
as acetylation, of RBL2 that have recently been shown to be important for CDK2-RBL2
interactions(125, 144, 147, 150) . Scenario 3 would be most interesting, as several reports have
identified additional phosphorylation by other kinases, including AKT serine/threonine kinase 1
(AKT1) and glycogen synthase kinase 3 beta (GSK3ß), that can phosphorylate RBL2(151, 152).
Importantly, any future evidence supporting any of the three scenarios would provide further
insight into how cell cycle and multiciliogenesis genes are differentially regulated during
multiciliated cell differentiation.
Currently, the most promising data presented in this chapter is the evidence for the use of
RBL2 knock-down to increase basal cell proliferation capacity in vitro. This process will be referred
to as partial-immortalization. Immortalization is a term used to described cells that can bypass
replicative induced senescence from telomere loss, and RBL2 has not been shown to directly
regulate telomere length. It is likely that RBL2 knock down prevents cytokine mediate entrance
into G0, and that RBL2 knockout HBECs passaged for long enough would eventually reach

56
replicative senescence, hence the term partial-immortalization. The data presented here is still
preliminary and offers a variety of questions to address.
Figure 4.1: Air-liquid Interface model of airway epithelial differentiation. (a) Standard differentiation
protocol for HBECs involves seeding progenitors submerged on a trans well membrane with expansion
media in the apical and basolateral chambers, for several days. After the cells produce sufficient transepithelial electrical resistance (TEER), indicating the formation of tight junctions, media is removed from
the apical chamber and the basolateral chamber is replaced with differentiation media. Over the course
of 2-4 weeks a pseudostratified epithelium with secretory and multiciliated cells appears. (b) In order to
efficiently transduce all cells, progenitors are simultaneously seeded in suspension with virus. After
puromycin selection all cells are transduced and expressing transgenes (red). Cells can then be
differentiated and evaluated at day 14 for multiciliated cell differentiation.

57
Figure 4.2: RBL2 knockdown does not impact the efficiency of MCC differentiation in HBEC. qRTPCR comparing HBECs treated with shRNA-RBL2 (shRNA#1 (filled circles), shRNA#2 (open squares))
or a non-targeting control (NTC) at Day 14 if ALI culture for RBL2 (a), early MCC markers SAS6, Deup1
and TP73 (b) and differentiated epithelial cell markers FOXJ1 (MCC), CC10 (club), and Muc5AC (goblet)
(c). Data is corrected for RPLP0 and normalized to NTC shRNA, N=4-5 biological replicates each with
n=1-2 experimental replicates paired for each shRNA. (d) Representative Western blot for shRNA#1
and NTC#1 at Day 14 ALI for RBL2 and MCC proteins CCDC39, TP73 and FOXJ1. (e) Quantification
of protein expression from N=3 biological replicates for each shRNA. (f) Quantification of cilia coverage
at D14 ALI expressed as a ratio of area of total acetylated α-tubulin (ATUB, cilia) over total growth area
(area F-Actin), N=5-6 biological replicates each n=1-2 experimental replicates. (g) Analysis of cilia beat
frequency (CBF) at D14 ALI, N=4-5 biological replicates. (h) Representative IF images of ATUB (green),
scale bars represent 1 mm and 100 µm. Data is expressed as mean±SEM and compared using twotailed paired t-tests (a-c &e) ratio-paired t-test (f) paired t-test (g) and *P<0.05, ** P<0.01, *** P<0.001,
**** P<0.0001.

58
Figure 4.3: Co-IP of Multicilin and RBL2 in HBECs at the ALI. (a) Experimental outline for Multicilin
induction at the air-liquid interface. (b) Western blot analysis for RBL2 and FLAG of total protein and coIP with FLAG from HBECs transduced with doxycycline inducible FLAG-Multicilin. Cells treated with
doxycycline for 4 days prior to sample collection at different given timepoints of air-liquid differentiation
(ALI) or after 4 days submerged in differentiation media (Submerged Day 4).

59
Figure 4.4: Air-liquid interface attenuates the interaction between RBL2-Multicilin. (a)
Representative Western blot for total protein and immunoprecipitation with FLAG in FLAG-MCI induced
HBECs either submerged (Sub) or ALI culture. (b) Representative Western Blot for total RBL2,
phosphorylated serine 672 RBL2 (RBL2 S672) and MCC proteins TP73 and FOXJ1 at D0, D4 (Sub)
and ALI D4. Protein quantification for total-RBL2 (c) and RBL2 S672:total RBL2 (d), N=6 biological
replicates. (e) Representative Western blot for Multicilin-induced HBECs at Sub D4 in the presence of
5 µM DAPT or vehicle. (f) Protein quantification for DAPT treatment from N=3, from 1-2 biological
replicates and 1-2 experimental replicates. Data represents mean±SEM and is compared using a paired
t-test (c-d) and 2-way ANOVA and post-hoc Tukey’s multiple comparisons test (f).

60
Figure 4.5 Regulation of Multiciliogenesis and the activity of Multicilin by RBL2. Schematic
depicting the new mechanism of regulating MCI activity during multiciliogenesis. Unphosphorylated
RBL2 binds to E2F4 and inhibits Multicilin-induction of MCC gene expression. Differentiation at an airliquid interface and inhibition of NOTCH signaling both phosphorylate RBL2 and dissociate it from the
E2F4/Multicilin complex, allowing for induction of MCC gene expression.

61

62
Chapter 5: AKT and DNA replication pathway regulation in multiciliogenesis
Introduction
Both inhibition of Notch signaling and expression of multicilin have been shown to be
necessary and sufficient to induce multiciliogenesis in several models where cells are intrinsically
capable of undergoing multiciliogenesis(153-155). Notch signaling has been shown to act
downstream of exposure to the air-liquid interface, but inhibition of Notch signaling is insufficient
to fully divert all cells to a multiciliated cell fate(52). Additionally, Chapter 3 demonstrated that
exogenous expression of multicilin alone is insufficient to drive multiciliogenesis in submerged
HBECs, a cell type that has an innate ability for multiciliated cell differentiation at the ALI.
Together, these observations lead to the question of whether inhibition of Notch signaling,
independently of exposure to air-liquid interface, facilitates cellular changes that allow multicilin
to drive multiciliogenesis in HBECs. The goal of this chapter is to evaluate possible interactions
between inhibition of Notch signaling and multicilin expression.
Results
Inhibition of NOTCH signaling potentiates multicilin transcriptional activity
To investigate whether inhibition of Notch signaling affected the transcriptional activity of
multicilin, independently of the air-liquid interface, HBECs with a with a DOX-inducible multicilin
transgene were submerged in differentiation media and treated with a vehicle control (CTRL), a
Figure 4.6: RBL2 depletion increases HBEC population capacity doubling while maintaining
differentiation potential. (a) qRT-PCR analysis of HBECs comparing vehicle treated (CTRL, solid
symbols) to 4 days of over expression of RBL2 (RBL2, outlined symbols) for RBL2, cell cycle marker
MKI67, senescence associated genes IL6, IL1ß, SPRR1B and IVL, secretory markers SCGB1A1 and
MUC5A and multiciliated cell markers MCIDAS and TP73 (b) Average population doubling rate of
HBECs overexpressing RBL2 for one passage (c) Population doubling rates over 8-10 passages of
RBL2 knockout HBECs (orange) vs controls (blue). (d) Representative brightfield images depicting
morphology of passage control and RBL2 knockout HBECs (e) Brightfield images depicting HBEC
colony formation from single cell seeding density. (f) Representative immunofluorescence image
depicting efficient differentiation into multiciliated (ATUB, green) and secretory (PLUNC, cyan) cells with
F-actin counter stain (red).

63
Notch signaling inhibitor (DAPT), doxycycline (MCI), or DAPT and doxycycline (MCI+DAPT). After
4 days of treatment cells were transcriptionally profiled by bulk-RNA sequencing. Principle
component analysis (PCA) confirmed that the pattern of sample clustering was influenced by both
biological replicate and by condition (Figure 5.1a). Unsupervised hierarchical clustering of gene
expression revelated clusters with a common pattern of gene expression across DAPT, MCI, and
MCI+DAPT samples, with the strongest distinction apparent between the MCI+DAPT and CTRL
(Figure 5.1b, clusters 6/3/1). Visualization of the samples transcriptional profiles in a heatmap
containing only multiciliated related genes(156) revealed that the pattern of genes expression in
Figure 5.1a was consistent with levels of induction of the multiciliated cell genes, highlighted by
expression of key transcriptional regulators of multiciliogenesis MCIDAS, TP73, MYB, and FOXJ1
(Figure 5.2a). Further confirmation of a multiciliated cell related gene expression pattern among
DAPT, MCI, and MCI+DAPT samples was provided by comparisons of differentially expressed
genes (DEGs). Analysis of all significantly upregulated DEGs relative to CTRL (log2 fold
change>2, adj-p>0.05) revealed 31 overlapping DEGs between MCI and MCI+DAPT. There were
278 DEGs specific to MCI+DAPT, and 14 genes common across all three conditions (Figure
5.1c, Appendix D). Comparison of these DEGs lists with a multiciliated cell related gene list(156)
revealed that 3 of the 31 and 3 of the 14 overlapping DEGs were key multiciliated related genes,
MCIDAS, MYB, TP73, FOXJ1, CCDC20B, and DRC1, while 43 of 278 of the MCI+DAPT only
DEGs were also cilia related (Figure 5.2b, Appendix D). This data indicates that while both
multicilin and NOTCH inhibition alone can significantly induce a small number of key multiciliated
cell related genes in submerged HBECs, the combination of multicilin and NOTCH inhibition is
needed to efficiently induce activation of the multiciliogenesis transcriptional program.
To further characterize induction of multiciliated cell related genes by Notch inhibition and
multicilin, expression levels were evaluated for the multiciliated cell genes that could be
significantly induced either by notch inhibition or multicilin alone. Volcano plots showed clear
increases in log2 fold change and adjusted p-value (p-adj) for the specified multiciliated related

64
DEGs, CDC20B, TP73, FOXJ1, MCIDAS, MYB and DRC1 (Figure 5.1c-e). Evaluation of a
synergistic interaction between Multicilin and Notch inhibition was evaluated by qRT-PCR
analysis of MCIDAS, P73, MYB and FOXJ1 expression with 2-way ANOVA followed by post-hoc
Tukey’s multiple comparison test. There was no observed significant interaction between Notch
inhibition and multicilin induction for any of the listed genes (not shown), and while there was a
trending increase in expression peaking in MCI+DAPT samples, only FOXJ1 had a significant
increase in expression in over multicilin alone (Figure 5.1f). This data suggests that the effects
Notch inhibition and multicilin expression in submerged HBECs are additive.
Multicilin induces expression of DNA replication associated genes
GO analysis was performed on the DEGs of DAPT, MCI and MCI+DAPT relative to CTRL
in order to further investigate the roles of Notch inhibition and multicilin in multiciliated cell
differentiation. The main GO:BPs observed for MCI and MCI+DAPT involved DNA replication and
cilium organization and assembly. There was also a trend of higher normalized enrichment scores
(NESs) for MCI+DAPT, while DAPT only showed significant (but lower) NESs for 3 of the 10
GO:BPs (Figure 5.3a). Analysis of significantly enriched KEGG pathway showed negative NESs
for DAPT and MCI+DAPT for cellular signaling pathways such as PI3-AKT, Il-17 and TNF, with a
large overlap of intersections between the lists (Figure 5.3a). MCI alone had a negative NES for
cell cycle pathway, while both MCI and MCI+DAPT had positive NESs for Oxidative
phosphorylation and DNA replication. As determined by Venn diagram analysis, MCI and
MCI+DAPT had 28 significantly upregulated genes that were not induced by DAPT alone and did
not overlap with the multiciliated cell related gene list (Figure 5.2b). This presented a list of
potentially novel multicilin regulated genes. To evaluate any potential relationship between the 28
genes, string analysis was performed followed by GO analysis for BPs and annotated keywords
(UnitProt). The only significant hit for GO:BP was for regulation of DNA-templated DNA
replication, and for keywords were DNA replication and DNA damage (Figure 5.3c). The genes
from the string analysis showed interactions and were also identified in the GO analysis were

65
RAD51D, RFC2, LIG1, CHAF1B, CDT1, and E2F7 and in addition to SLFN11 will be referred to
as multicilin associated DNA replication genes. For validation of the transcriptomic analysis, gene
expression for RAD51, LIG1, CHAF1B, and CDT1 along with cell cycle marker MKI67 was
assessed by qRT-PCR with 2-way ANOVA followed by post-hoc Tukey’s multiple comparison
test. Expression of the multicilin associated DNA replication genes followed a similar pattern as
the multiciliated cell genes in figure 5.2f, with the exception that none of them were significantly
induced by Notch inhibition. Additionally, their gene expression levels did not reflect the levels of
cell cycle gene expression as represented by MKI67 (figure 5.2f).
To evaluate whether the expression of multicilin associated DNA replication genes is
unique to submerged HBECs with exogenous multicilin, or if they are a signature of normally
differentiating basal cells, single cell transcriptomic data from the organoid single cell atlas
(OSCA) was assessed(157). The OSCA provides transcriptomic data from over 300K single cells,
with identification of clusters of cells as populations shown here as basal (1,2, supra and
transitioning, TAB, marked by TP63), proliferating (MKI67), deuterosomal (MCIDAS), ciliated
(FOXJ1, TP73), secretory (club and goblet, marked by SCB1A1, SPDEF and MUC5AC) and rare
(ionocytes and pulmonary neuroendocrine cells marked by FOXI1 or ASCL1) (Figure 5.4a,b).
CDT1 is expressed highly during the G1/S phase transition as it licenses DNA replication, while
MKI67 is expressed highly during G2 and mitosis, making a comparison of co-expression useful
for visualizing proliferating cell populations. Co-expression analysis revealed a distinct patter of
transition from CDT1 to MKI67 expression in proliferating basal cells however only CDT1 was
expressed in deuterosomal cell (Figure 5.4b-d). Bubbleplot/heatmap analysis for multicilin
associated DNA replication genes as well as cell cycle (CCNA2, CCNE1) vs multiciliated (CCNA1,
CCNE1) cyclins confirmed their expression in deuterosomal cells. Additionally, based on UnitPro
keywords from figure 5.3c, a pattern appeared showing similar expression of DNA replication
associated genes (LIG1, CDT1, and RFC2) between deuterosomal cells and proliferating basal,
but much higher expression of DNA damage associated genes (SLFN11,E2F7, RAD51D, and

66
CHAF1B) in deuterosomal cells.
As recent report demonstrated a role for GMNC mediated DNA damage response
pathway in multiciliogenesis in mouse radial glial cells(122). As this study stated the transition
through G1/S was necessary for GMNC induced DNA damage mediated centriole biogenesis, it
is plausible that a similar mechanism may occur in HBECs through multicilin associated DNA
replication genes. To evaluate if cell cycle is necessary for multiciliated cell differentiation a halfmaximal inhibitory concentration curve (IC50) for the CDK4/6 inhibitor Palbociclib was determined
by measuring phosphorylation of the CDK4/6 target RB1-pS807/811 in proliferating HBECs after
48 hours of treatment. RB1-pS807/811 and total RB1 expression was assayed by
immunofluorescence and relative fluorescent intensity (RFI) was quantitated over a Palbociclib
dilution range from 0.030µM to 10µM, giving an IC50 of 250nm (Figure 5.5a,b). A similar range
of CDK4/6 inhibition by Palbociclib was observed in HBECs at the ALI by western blot and no cell
death was observed at concentrations up to 30µM (Figure 5.5c, data not shown). To efficiently
inhibit CDK4/6 activity, HBECs were treated with a concentration of 1µM Palbociclib from day 2-
4 of ALI differentiation. Treatment prevented phosphorylation of RB at pS807/811 but did not
appear to affect the ratio of RBL2 pS672 to total RBL2 (Figure 5.5d,e). Immunofluorescence
staining of whole ALI inserts confirmed a dramatic increase in RB pS807/811 in treated cells but
did not show a difference in the amount of multiciliated cell differentiation as indicated by
expression of pericentrin and acetylated-αtubulin (Figure 5.5f). Differentiation and proliferation
capacity of Palbociclib treated HBECs was further assessed by qRT-PCR comparing Day 0 ALI,
Day 4 ALI vehicle control (Day 4), and Day 4 1µm Palbociclib (Day 4 Palb) treated samples. Day
4 Palb samples had no significant decreases versus Day 4 in expression of multiciliated cell genes
GEMC1, MCIDAS, CCNO, and FOXJ1, basal cell marker TP63, club cell marker SCGB1A1 or
goblet cell marker MUC5AC(Figure 5.6). Cyclins involved multiciliogenesis (CCNE1 and CCNA2)
similarly remained unchanged while cell cycle genes (CCNA2 and MKI67) significantly decreased
in Day 4 Palb samples (Figure 5.6). Interestingly, while there was not a consistent induction of

67
multicilin associated DNA replication genes at day 4 ALI, treatment with Palb did not significantly
decrease expression of any of the four genes assayed (CDT1, CHAF1B, LIG1B and RAD51D).
Taken together this data indicates that expression of multicilin associated DNA replication genes
is a part of normal multiciliated cell differentiation and is independent of CDK4/6 mediated cell
cycle entry.
Multicilin induces expression of DNA replication associated genes
The additive effect observed between multicilin induction and Notch inhibition in figure
5.2f suggests that multicilin does not function completely downstream of Notch inhibition as
previously described. One possible explanation is that inhibition of Notch not only activates
multicilin expression, but also provides a cellular context conducive to multicilin activity. This
explanation would be in supported by that data presented in figure 4.4e-f, showing a synergistic
interaction between the inhibition of Notch signaling and the induction of multiciliogenesis on the
phosphorylation of RBL2 at S672. However, RBL2 pS672 phosphorylation has been described
to be specifically mediated by CDK4/6. The data presented here in figure 5.5d,e demonstrates
that in differentiating HBECs at the ALI, RBL2 pS672 phosphorylation occurs despite inhibition of
CDK4/6 activity by Palbociclib. Taken together this data indicates that multiciliated cell
differentiation utilizes an alternative kinase to phosphorylate RBL2 at pS672 and this happens
independently of normal entrance into the cell cycle.
To characterize possible kinase signaling pathways that may be facilitated by Notch
inhibition and/or multicilin in HBECs independently of ALI, a phospho explorer antibody array was
used to assay protein phosphorylation status in samples of submerged HBECs in the conditions
of CTRL, DAPT, MCI and DAPT+MCI. By comparing differential protein expression relative to
CTRL several possible outliers were identified as being differentially or synergistically regulated
by DAPT and MCI (Figure 5.7a-c). To better asses possible synergist interaction between Notch
inhibition and multicilin, a synergy score for each protein was calculated by adding together the
expressions (relative to CTRL) for MCI and DAPT, and then subtracting them from the relative

68
expression of MCI+DAPT. In this model of synergistic expression, if induction of protein
expression is perfectly additive between MCI and DAPT, the resulting score would be zero. A
score greater than zero would indicate that MCI+DAPT expression is greater than adding the
individual expressions of MCI and DAPT, while a negative score indicates the opposite. The top
hits for synergy score included many PI3K-AKT signaling proteins, such as AKT1, p130Cas, and
PKCs.
To further investigate a possible role for PI3K-AKT signaling in multiciliated cell
differentiation and proliferation capacity of HBECs were treated with AKT1/2/3 inhibitor (1µM MK2206). Gene expression as assessed by qRT-PCR comparing Day 0 ALI, Day 4 ALI vehicle
control (Day 4), and Day 4 1µM MK-2206 (Day 4 AKT inh). Day 4 AKT inh versus Day 4 had no
significant changes in squamous cell markers SPRR1B and IVL, or proliferation marker MIK67
(Figure 5.8a). Notably, there were significant decreases in Day 4 AKT expression of multiciliated
cell genes GEMC1, MCIDAS, TP73, and FOXJ1, and goblet cell markers MUC5AC and SPDEF,
yet there was a significant increase in the club cell marker SCG1A1. Additionally,
immunofluorescence staining for ATUB and pericentrin of ALIs treated for 7 days with 1µM MK2206 revealed significant reduction of basal body formation and cilia coverage compared to Day
7 controls (Figure 5.8b,c). Western blot analysis revealed a significant decrease in the ratio of
RBL2 pS672 to total RBL2 in Day 4 Akt inh samples compared to Day 4 controls (Figure 5.8d,e).
AKT phosphorylation targets (AKT pS473, p70S6K pT389) were also assessed, but did not
appear to be significantly decreased in Day 4 Akt inh compared to Day 4. As AKT inhibition caused
a unique gene expression pattern, decreasing all differentiation related genes except club marker
SCGB1A1, additional 4 day treatments of conditions known to inhibit multiciliated cell
differentiation were assessed by qRT-PCR. Submersion either inhibited or did not significantly
affect expression of the differentiation genes assayed (GEMC1, CCNO, MCIDAS, TP73, FOXJ1,
SCGB1A1, MUC5AC and SPDEF). Treatment with 10ng/mL IL13 inhibited multiciliated cell genes
expression with the exception of GMNC1 and P73. Notably no condition significantly increased

69
expression of SCGB1A1. Taken together this data indicates a role for AKT signaling in the
differentiation of airway epithelial cells, possibly independent of ALI, NOTCH signaling, and IL13
signaling.
Discussion
The experiments in this chapter were designed to investigate the interaction of multicilin
expression and Notch inhibition during multiciliated cell differentiation. The data presented here
demonstrates an additive effect between Notch inhibition and multicilin for the induction of
multiciliated cell genes, indicating that inhibition of Notch signaling not only induces multicilin
expression but also facilitates multicilin activity. Interestingly, a set of multicilin associated DNA
replication genes was identified as being expressed outside of proliferating cells, specifically in
deuterosomal cells. The expression of these multicilin associated DNA replication genes is
independent on CDK4/6 activity during multiciliated cell differentiation. Furthermore CDK4/6
activity was shown to be unnecessary for HBEC differentiation at the ALI, as well for ALI induced
phosphorylation of RBL2 at S672. In an effort to identify possible kinase pathways that may be
influence multiciliated cell differentiation, a protein phosphorylation array demonstrated
synergistic increases in phosphorylation of PI3K-AKT signaling proteins. Finally, AKT signaling
was demonstrated as necessary for HBEC differentiation into multiciliated and goblet, but not club
cells.
The fact that Notch inhibition and multicilin demonstrated an additive effect on the
induction of multiciliated cell related genes presents an interesting and previously unexplored
interaction regulating the transcriptional program controlling multiciliogenesis in HBECs.
Currently, inhibition of Notch signaling is believed down regulate the activity of hes related family
bHLH transcription factor with YRPW motif 1 (HEY1) , resulting in the alleviation of transcriptional
repression of multicilin and GMNC target genes(158). In the submerged model presented in this
chapter, it is possible that in the absence of Notch inhibition results in persistent levels of HEY1

70
activity that exogenous over-expression of multicilin is unable to overcome. However, multicilin
has been shown to efficiently induce multiciliated cell differentiation in many pathways,
independently of any upstream activation by inhibition of Notch signaling. These observations,
taken together with the high levels of induced multicilin expression in the submerged model, make
it unlikely that the additive effect of Notch inhibition on multicilin activity is a result of repression
from HEY1, however this assumption may prove difficult to assess directly. An alternate
explanation for the additive effect between Notch inhibition and multicilin is a synergistic affect on
the phosphorylation of RBL2, as shown in figure 4.4e,f. This would subsequently decrease the
interaction of RBL2 with multicilin and increase multiciliated cell gene expression, similar to what
was observed in the shRBL2 knockdown depicted in figure 3.9. The mechanism by which RBL2
phosphorylation is possibly regulated by Notch inhibition and multicilin is still unclear, however
the data presented in this chapters provides specific insights. The experimental data in this
chapter conflicts with previous reports stating that phosphorylation of RBL2-S672 is specifically
mediated by CDK4/6 activity. The data presented here demonstrates that HBECs at the ALI
treated with the CDK4/6 inhibitor Palbociclib lost phosphorylation of RB1 at 807/811, as expected,
but maintained phosphorylation of RBL2 at S672 and proceeded to differentiate. This
contradiction can possibly be explained by a previously undescribed ability of an alternate kinase
to phosphorylate RBL2 at S672. Even though it was ruled out in earlier reports, CDK2 may be the
able to phosphorylate RBL2 at S672, as it is still active during multiciliogenesis, but utilizes
different cyclin partners than during normal cell cycle. AKT is another possible candidate, as the
data presented in this chapter indicates that inhibition of AKT in HBECs at the ALI reduces levels
of RBL2 pS672 and inhibits differentiation capacity. However, AKT has many substrates and
affects a variety of cellular processes. This could make it difficult to establish a direct link between
AKT activity and RBL2 phosphorylation in HBEC differentiation. A potential experiment that may
provide further insight into the relationship between HBEC differentiation and AKT activity is to
attempt a rescue of differentiation capacity in AKT inhibited HBECs by Notch inhibition or the

71
addition of IL8 or IL13.
Another interesting observation in this chapter was the identification of multicilin
associated DNA replication genes. The data in this chapter suggests that there are two types of
multicilin associated DNA genes – DNA replication and DNA Damage. Genes that were present
at similar levels in both proliferating cells and deuterosomal cells (CDT1, RFC2 and LIG1) are
more associated with DNA replication. Genes that were more highly expressed in deuterosomal
cells (SLFN11,E2F7, RAD51D, and CHAF1B) were more likely to be associated with DNA
damage. A precedent for phenomenon this was recently reported in radial glial cells, where
GMNC induced DNA damage in cycling cells, through activation of P53/P21/TP73 pathway,
resulting in a cell cycle stall that allowed for differentiation into ependymal cells(122). As HBEC
and radial glial cells share a similar transcriptional program that regulates their multiciliated cell
differentiation, it is plausible that HBECs may share this DNA damage mechanism. However, the
data presented here shows that entrance into the cell cycle is not required for HBEC differentiation
into multiciliated cells, as CDK4/6 inhibition had no effect on differentiation. However, CDK4/6
inhibition also failed to significantly affect the expression of the multicilin associated DNA
replication genes, indicating that this mechanism may be acting independently of the cell cycle.
High levels of CDT1 have been shown to induce replication stress and induce DNA-PK signaling,
which may provide a method of activating AKT in differentiating cells. A future aim of this project
is to assess replication stress upon multicilin overexpression. If hypothesis holds true it would be
interesting to see if DNA-PK specific inhibitors could affect multiciliated cell differentiation. Taken
together this data may provide further insight into the link between cell cycle and multiciliated cell
differentiation.

72

73
Figure 5.1: Transcriptional analysis in submerged HBECs with NOTCH inhibition and exogenous
multicilin. (a) Principle component analysis (PCA) of 3 biological replicates for in 2 variable experiment
for inhibition of NOTCH signaling by DAPT (NOTCHi), exogenous multicilin expression (MCI) or both
(MCI_NOTCHi). (b) Heat map of unsupervised hierarchical clustering gene expression. Similar
expression patterns across treated conditions is noted by cluster number (clusters 1,3,6). (c) Ven
diagram indicating the number of significantly upregulated DEGs (log2 fold change>2, adj-p>0.05),
relative to control, that are commonly or uniquely expressed across conditions.

74

75
Figure 5.2: NOTCH inhibition potentiates exogenous multicilin activity in submerged HBECs (a)
Heat of multiciliated cell specific gene expression for HBECs in submerged differentiation media and
treated with vehicles (CTRL), DAPT (NOTCHi), exogenous multicilin expression (MCI) or both
(MCI_NOTCHi). (b) Ven diagram indicating the number of significantly upregulated DEGs (log2 fold
change>2, adj-p>0.05), relative to control, that are commonly or uniquely expressed across conditions
and if they are present in a multiciliated related genes list. (c-d) Volcano pot of significantly
DEGs (absolute log2 fold change value >2, adj-p>0.05) relative to CTRL, for the three treated conditions.
Key multiciliated cell genes are labeled, as well as 2 highly DEG PAQR4, PTGS2 and TMEM200B. (f)
qRT-PCR validation of expression of key multiciliated cell related genes, as well as the DOX induced
multicilin (mMCIDAS). Data represents mean±SEM and is compared using a 2-way ANOVA and posthoc Tukey’s multiple comparisons test (a&c) with significance at *P < 0.05, **P < 0.01, ***P < 0.001,
****P < 0.0001. Significance of variation from interaction between variables was analyzed but not shown.

76

77
Figure 5.3: Gene ontology analysis reveals NOTCH inhibition regulate of PI3K genes and a
multicilin induction of DNA-replication related genes. (a) Gene ontology analysis for biological
process demonstrating upregulation of cilia related biological process by multicilin induction (MCI) and
NOTCH inhibition (DAPT). (b) Gene ontology analysis for KEGG pathways reveal a repression of PI3KAKT related genes by DAPT and induction and an induction of DNA replication by MCI. (c) STRING
analysis of the 29 genes from venn diagram analysis (Figure 5.1b, Supplementary Table 5.1) that are
significantly in MCI and MCI+DAPT, but not DAPT, and are not present in the list of previously identified
multiciliated cell related genes. GO and GO-term analysis of the genes is presented, and nodes are
colored corresponding to their presence in identified gene-list (d) qRT-PCR validation of expression of
several DNA replication genes identified in (c), as well as cell cycle marker MKI67. Data represents
mean±SEM and is compared using a 2-way ANOVA and post-hoc Tukey’s multiple comparisons test
(a&c) with significance at *P < 0.05, **P < 0.01, ***P < 0.001, ****P < 0.0001. Significance of variation
from interaction between variables was analyzed but not shown.

78
Figure 5.4: Organoid Single Cell Atlas reveals that DNA-replication genes are specifically
expressed in the deuterosomal cell population. (a) Cell population clustering of human airway
epithelial cells in vitro, as presented the by Organoid Single Cell Atlas (b) Bubbleplot/heatmap of airway
epithelial cell type makers for multiciliated cells (TP73, FOXJ1, MCIDAS), club cells (SCGB1A1), goblet
cells (MUC5AC, SPDEF), ionocytes (FOXI1), pulmonary neuroendocrine cells (ASCL1), basal cells
(TP63) and proliferating basal cells (MKI67) (c) Gene co-expression of CDT1 and MKI67, depicted by
gradient color, including number of cells with expression (d) Bubbleplot/heatmap of DNA replication
genes inducted by multicilin (LIG1, CDT1, RFC2, SLFN11, E2F7, RAD51D, CHAF1B) as well as cyclins
differentially expressed in cell cycle and multiciliogenesis (CCNE1, CCNA2, CCNA1).

79

80
Figure 5.5 Suppression of cell cycle by CDK4/6 inhibition does inhibit multiciliated cell
differentiation. (a) Representative immunofluorescence of total cells (DNA, DAPI, blue), total RB1
(green), and serine 807/811 phosphorylated RB1 (RB1 pS807//811) (b) IC50 curve for Palbociclib
inhibition of RB phosphorylation at serine 807/811 in confluent HBECs submerged in growth media after
48 hours. (c) Representative western blot for expression of RB1 and RB1 pS807//811 in serial dilutions
of Palbociclib at day 4 ALI after 48-hour treatment. (d) Representative westerns for total RBL2 and RBL2
phosphorylated at serine 672 (RBL2 p-S672) after 48 hours treatment with 1µM Palbociclib. (e)
Quantitation of 4 biological replicates of western blot presented in (d). (f) Immunofluorescence of tile
scans and representative regions of interest for (DNA, DAPI, blue), basal cells (CK5, red), and the cell
cycle marker RB1 pS807//811 (Cyan), as well as cilia (Acetyl-αTUB, green) and basal bodies
(pericentrin, cyan). Scale bars represent 3.0mm and 100µm. Comparison in (e) is a paired t-test and
*P<0.05, ** P<0.01, *** P<0.001, **** P<0.0001.

81

82
Figure 5.6: Inhibition of CDK4/6 in HBECs down regulates cell cycle gene expression but does
not affect differentiation or multiciliated induced DNA replication genes. qRT-PCR for cell cycle
genes (CCNE1, CCNA1, CCNA2, and MKI67) basal cell marker (TP63), multiciliated cell related genes
(GEMC1, MCIDAS, CCNO, and FOXJ1), goblet cells (MUC5AC), club cells (SCGB1A1) and DNA
replication genes inducted by multicilin (LIG1, CDT1, RAD51D, and CHAF1B). Comparisons are
between HBECs in growth media at Day 0 ALI (Grey), with Day 4 in differentiation at ALI (blue), or at
Day 4 ALI after 48 hours of treatment with 1.0µM Palbociclib. Log2 fold change is relative to day 0.
Comparisons are made by one-way ANOVA with followed by Tukey’s multiple comparisons test and
*P<0.05, ** P<0.01, *** P<0.001, **** P<0.0001.

83

84
Figure 5.7: Phospho-protein/kinase array comparing protein expression in submerged HBECs
with multicilin induction and NOTCH inhibition. (a-c) Linear comparisons of differential protein
expression (Relative to untreated control), for induced multicilin (MCIDAS), NOTCH inhibition (DAPT),
and simultaneous multicilin induction and NOTCH inhibition (MCIDAS+DAPT). Several proteins of
interest lying outside the general expression distribution have been labeled (orange). (d) Distribution of
synergy scores calculated (using log2 fold change in protein expression vs control) as cumulative
MCIDAS and DAPT expression, subtracted by MCIDAS+DAPT expression.

85

86
Figure 5.8: Inhibition of AKT multiciliated and goblet cell differentiation in HBECs at ALI (a) qRTPCR for cell cycle genes (multiciliated cell related genes (GEMC1, MCIDAS, TP73, and FOXJ1), club
cells (SCGB1A1), goblet cells (MUC5AC and SPDEF), squamous cell markers (SPRR1B and IVL) and
proliferating cells (MKI67). Comparisons are between HBECs in growth media at Day 0 ALI (Grey, Day
0), with Day 4 in differentiation at ALI (blue, Day 4), or at Day 4 ALI after 96 hours of treatment with
1.0µM MK-2206 (orange, Day 4 AKT inh). Log2 fold change is relative to day 0. Comparisons are made
by one-way ANOVA with followed by Tukey’s multiple comparisons test and *P<0.05, ** P<0.01, ***
P<0.001, **** P<0.0001. (b) Representative immunofluorescence of cell outlines (F-actin counterstain,
blue), basal bodies (pericentrin, green), and cilia (ATUB, cyan). (c) Total cilia coverage calculated from
5 biological replicates using the total area of cilia ATUB stain/ total area F-actin counterstain (d)
Representative western blot for listed protein expressions. (e) Quantitation of 4 biological replicates of
(d).

87
Figure 5.9: Submersion and IL-3 differentially repress multiciliated cell differentiation in HBECs.
qRT-PCR for basal cell marker (TP63), multiciliated cell related genes (GEMC1, MCIDAS, CCNO, TP73,
and FOXJ1), goblet cells (MUC5AC), club cells (SCGB1A1) and proliferating cells (MKI67).
Comparisons are between HBECs in growth media at Day 4 ALI (ALI, Grey), with Day 4 submerged in
differentiation (submerged, blue), or at Day 4 ALI after 4 days of treatment with 10ng/mL IL-13. Log2 fold
change is relative to ALI. Comparisons are made by one-way ANOVA with followed by Tukey’s multiple
comparisons test and *P<0.05, ** P<0.01, *** P<0.001, **** P<0.0001.

88
References
1. Organization WH. Global Health Estimates 2020: Deaths by Cause, Age, Sex, by
Country and by Region, 2000-2019 2020 [Available from:
https://www.who.int/data/gho/data/themes/mortality-and-global-health-estimates/ghe-leadingcauses-of-death.
2. Johnson NP, Mueller J. Updating the accounts: global mortality of the 1918-1920
"Spanish" influenza pandemic. Bull Hist Med. 2002;76(1):105-15.
3. Msemburi W, Karlinsky A, Knutson V, Aleshin-Guendel S, Chatterji S, Wakefield J. The
WHO estimates of excess mortality associated with the COVID-19 pandemic. Nature.
2023;613(7942):130-7.
4. Boers E, Barrett M, Su JG, Benjafield AV, Sinha S, Kaye L, et al. Global Burden of
Chronic Obstructive Pulmonary Disease Through 2050. JAMA Netw Open.
2023;6(12):e2346598.
5. Chen S, Kuhn M, Prettner K, Yu F, Yang T, Barnighausen T, et al. The global economic
burden of chronic obstructive pulmonary disease for 204 countries and territories in 2020-50: a
health-augmented macroeconomic modelling study. Lancet Glob Health. 2023;11(8):e1183-e93.
6. Johnston SL, Goldblatt DL, Evans SE, Tuvim MJ, Dickey BF. Airway Epithelial Innate
Immunity. Front Physiol. 2021;12:749077.
7. Mercer RR, Russell ML, Roggli VL, Crapo JD. Cell number and distribution in human
and rat airways. Am J Respir Cell Mol Biol. 1994;10(6):613-24.
8. Karamaoun C, Sobac B, Mauroy B, Van Muylem A, Haut B. New insights into the
mechanisms controlling the bronchial mucus balance. PLoS One. 2018;13(6):e0199319.
9. Rubin BK. Physiology of airway mucus clearance. Respir Care. 2002;47(7):761-8.
10. Ganesan S, Comstock AT, Sajjan US. Barrier function of airway tract epithelium. Tissue
Barriers. 2013;1(4):e24997.
11. Hewitt RJ, Lloyd CM. Regulation of immune responses by the airway epithelial cell
landscape. Nat Rev Immunol. 2021;21(6):347-62.
12. Tilley AE, Walters MS, Shaykhiev R, Crystal RG. Cilia dysfunction in lung disease. Annu
Rev Physiol. 2015;77:379-406.
13. Zhang Y, Black KE, Phung TN, Thundivalappil SR, Lin T, Wang W, et al. Human Airway
Basal Cells Undergo Reversible Squamous Differentiation and Reshape Innate Immunity. Am J
Respir Cell Mol Biol. 2023;68(6):664-78.
14. Juan LS, Freije A, Sanz-Gomez N, Jimenez-Matias B, Pleguezuelos-Manzano C, Sanz
JR, et al. DNA damage triggers squamous metaplasia in human lung and mammary cells via
mitotic checkpoints. Cell Death Discov. 2023;9(1):21.
15. Shim JJ, Dabbagh K, Ueki IF, Dao-Pick T, Burgel PR, Takeyama K, et al. IL-13 induces

89
mucin production by stimulating epidermal growth factor receptors and by activating neutrophils.
Am J Physiol Lung Cell Mol Physiol. 2001;280(1):L134-40.
16. Crystal RG. Airway basal cells. The "smoking gun" of chronic obstructive pulmonary
disease. Am J Respir Crit Care Med. 2014;190(12):1355-62.
17. Jetten AM. Multistep process of squamous differentiation in tracheobronchial epithelial
cells in vitro: analogy with epidermal differentiation. Environ Health Perspect. 1989;80:149-60.
18. Rigden HM, Alias A, Havelock T, O'Donnell R, Djukanovic R, Davies DE, et al.
Squamous Metaplasia Is Increased in the Bronchial Epithelium of Smokers with Chronic
Obstructive Pulmonary Disease. PLoS One. 2016;11(5):e0156009.
19. Yuan S, Norgard RJ, Stanger BZ. Cellular Plasticity in Cancer. Cancer Discov.
2019;9(7):837-51.
20. Gray AC, McLeod JD, Clothier RH. A review of in vitro modelling approaches to the
identification and modulation of squamous metaplasia in the human tracheobronchial
epithelium. Altern Lab Anim. 2007;35(5):493-504.
21. Denisov EV, Schegoleva AA, Gervas PA, Ponomaryova AA, Tashireva LA, Boyarko VV,
et al. Premalignant lesions of squamous cell carcinoma of the lung: The molecular make-up and
factors affecting their progression. Lung Cancer. 2019;135:21-8.
22. Herfs M, Hubert P, Poirrier AL, Vandevenne P, Renoux V, Habraken Y, et al.
Proinflammatory cytokines induce bronchial hyperplasia and squamous metaplasia in smokers:
implications for chronic obstructive pulmonary disease therapy. Am J Respir Cell Mol Biol.
2012;47(1):67-79.
23. Araya J, Cambier S, Markovics JA, Wolters P, Jablons D, Hill A, et al. Squamous
metaplasia amplifies pathologic epithelial-mesenchymal interactions in COPD patients. J Clin
Invest. 2007;117(11):3551-62.
24. Bolton SJ, Pinnion K, Oreffo V, Foster M, Pinkerton KE. Characterisation of the proximal
airway squamous metaplasia induced by chronic tobacco smoke exposure in spontaneously
hypertensive rats. Respir Res. 2009;10(1):118.
25. Borok Z, Whitsett JA, Bitterman PB, Thannickal VJ, Kotton DN, Reynolds SD, et al. Cell
plasticity in lung injury and repair: report from an NHLBI workshop, April 19-20, 2010. Proc Am
Thorac Soc. 2011;8(3):215-22.
26. Tata PR, Rajagopal J. Plasticity in the lung: making and breaking cell identity.
Development. 2017;144(5):755-66.
27. Minoo P, Hamdan H, Bu D, Warburton D, Stepanik P, deLemos R. TTF-1 regulates lung
epithelial morphogenesis. Dev Biol. 1995;172(2):694-8.
28. McCulley D, Wienhold M, Sun X. The pulmonary mesenchyme directs lung
development. Curr Opin Genet Dev. 2015;32:98-105.
29. Kuwahara A, Lewis AE, Coombes C, Leung FS, Percharde M, Bush JO. Delineating the

90
early transcriptional specification of the mammalian trachea and esophagus. Elife. 2020;9.
30. Rawlins EL. Lung epithelial progenitor cells: lessons from development. Proc Am Thorac
Soc. 2008;5(6):675-81.
31. Danopoulos S, Alonso I, Thornton ME, Grubbs BH, Bellusci S, Warburton D, et al.
Human lung branching morphogenesis is orchestrated by the spatiotemporal distribution of
ACTA2, SOX2, and SOX9. Am J Physiol Lung Cell Mol Physiol. 2018;314(1):L144-L9.
32. Daniely Y, Liao G, Dixon D, Linnoila RI, Lori A, Randell SH, et al. Critical role of p63 in
the development of a normal esophageal and tracheobronchial epithelium. Am J Physiol Cell
Physiol. 2004;287(1):C171-81.
33. Mori M, Mahoney JE, Stupnikov MR, Paez-Cortez JR, Szymaniak AD, Varelas X, et al.
Notch3-Jagged signaling controls the pool of undifferentiated airway progenitors. Development.
2015;142(2):258-67.
34. Zhou B, Lin W, Long Y, Yang Y, Zhang H, Wu K, et al. Notch signaling pathway:
architecture, disease, and therapeutics. Signal Transduct Target Ther. 2022;7(1):95.
35. Hori K, Sen A, Artavanis-Tsakonas S. Notch signaling at a glance. J Cell Sci.
2013;126(Pt 10):2135-40.
36. Sjoqvist M, Andersson ER. Do as I say, Not(ch) as I do: Lateral control of cell fate. Dev
Biol. 2019;447(1):58-70.
37. Kondo M, Tamaoki J, Takeyama K, Nakata J, Nagai A. Interleukin-13 induces goblet cell
differentiation in primary cell culture from Guinea pig tracheal epithelium. Am J Respir Cell Mol
Biol. 2002;27(5):536-41.
38. Cumplido-Laso G, Benitez DA, Mulero-Navarro S, Carvajal-Gonzalez JM.
Transcriptional Regulation of Airway Epithelial Cell Differentiation: Insights into the Notch
Pathway and Beyond. Int J Mol Sci. 2023;24(19).
39. Vladar EK, Kunimoto K, Rojas-Hernandez LS, Spano JM, Sellers ZM, Joo NS, et al.
Notch signaling inactivation by small molecule gamma-secretase inhibitors restores the
multiciliated cell population in the airway epithelium. Am J Physiol Lung Cell Mol Physiol.
2023;324(6):L771-L82.
40. Gomi K, Arbelaez V, Crystal RG, Walters MS. Activation of NOTCH1 or NOTCH3
signaling skews human airway basal cell differentiation toward a secretory pathway. PLoS One.
2015;10(2):e0116507.
41. Brooks ER, Wallingford JB. Multiciliated cells. Curr Biol. 2014;24(19):R973-82.
42. Hoque M, Kim EN, Chen D, Li FQ, Takemaru KI. Essential Roles of Efferent Duct
Multicilia in Male Fertility. Cells. 2022;11(3).
43. Meunier A, Azimzadeh J. Multiciliated Cells in Animals. Cold Spring Harb Perspect Biol.
2016;8(12).

91
44. Li Q, Han Z, Singh N, Terre B, Fame RM, Arif U, et al. Disruption of GMNC-MCIDAS
multiciliogenesis program is critical in choroid plexus carcinoma development. Cell Death Differ.
2022;29(8):1596-610.
45. Roberson EC, Tran NK, Konjikusic MJ, Fitch RD, Gray RS, Wallingford JB. A
comparative study of the turnover of multiciliated cells in the mouse trachea, oviduct, and brain.
Dev Dyn. 2020;249(7):898-905.
46. Wallmeier J, Dallmayer M, Omran H. The role of cilia for hydrocephalus formation. Am J
Med Genet C Semin Med Genet. 2022;190(1):47-56.
47. Cao Y, Chen M, Dong D, Xie S, Liu M. Environmental pollutants damage airway
epithelial cell cilia: Implications for the prevention of obstructive lung diseases. Thorac Cancer.
2020;11(3):505-10.
48. Ancel J, Belgacemi R, Diabasana Z, Perotin JM, Bonnomet A, Dewolf M, et al. Impaired
Ciliary Beat Frequency and Ciliogenesis Alteration during Airway Epithelial Cell Differentiation in
COPD. Diagnostics (Basel). 2021;11(9).
49. Raidt J, Loges NT, Olbrich H, Wallmeier J, Pennekamp P, Omran H. Primary Ciliary
Dyskinesia. Presse Med. 2023:104171.
50. Wilson R. Secondary ciliary dysfunction. Clin Sci (Lond). 1988;75(2):113-20.
51. Armengot M, Milara J, Mata M, Carda C, Cortijo J. Cilia motility and structure in primary
and secondary ciliary dyskinesia. Am J Rhinol Allergy. 2010;24(3):175-80.
52. Gerovac BJ, Valencia M, Baumlin N, Salathe M, Conner GE, Fregien NL. Submersion
and hypoxia inhibit ciliated cell differentiation in a notch-dependent manner. Am J Respir Cell
Mol Biol. 2014;51(4):516-25.
53. Jorissen M, Willems T. The secondary nature of ciliary (dis)orientation in secondary and
primary ciliary dyskinesia. Acta Otolaryngol. 2004;124(4):527-31.
54. Zariwala MA, Knowles MR, Leigh MW. Primary Ciliary Dyskinesia. In: Adam MP,
Feldman J, Mirzaa GM, Pagon RA, Wallace SE, Bean LJH, et al., editors. GeneReviews((R)).
Seattle (WA)1993.
55. Wallmeier J, Nielsen KG, Kuehni CE, Lucas JS, Leigh MW, Zariwala MA, et al. Motile
ciliopathies. Nat Rev Dis Primers. 2020;6(1):77.
56. Lucas JS, Barbato A, Collins SA, Goutaki M, Behan L, Caudri D, et al. European
Respiratory Society guidelines for the diagnosis of primary ciliary dyskinesia. Eur Respir J.
2017;49(1).
57. Mao S, Shah AS, Moninger TO, Ostedgaard LS, Lu L, Tang XX, et al. Motile cilia of
human airway epithelia contain hedgehog signaling components that mediate noncanonical
hedgehog signaling. Proc Natl Acad Sci U S A. 2018;115(6):1370-5.
58. Vertii A, Hung HF, Hehnly H, Doxsey S. Human basal body basics. Cilia. 2016;5:13.

92
59. Venkatesh D. Primary cilia. J Oral Maxillofac Pathol. 2017;21(1):8-10.
60. Breslow DK, Holland AJ. Mechanism and Regulation of Centriole and Cilium Biogenesis.
Annual Review of Biochemistry. 2019;88(1):691-724.
61. Klos Dehring DA, Vladar EK, Werner ME, Mitchell JW, Hwang P, Mitchell BJ.
Deuterosome-mediated centriole biogenesis. Dev Cell. 2013;27(1):103-12.
62. Kyrousi C, Arbi M, Pilz GA, Pefani DE, Lalioti ME, Ninkovic J, et al. Mcidas and GemC1
are key regulators for the generation of multiciliated ependymal cells in the adult neurogenic
niche. Development. 2015;142(21):3661-74.
63. Arbi M, Pefani DE, Taraviras S, Lygerou Z. Controlling centriole numbers: Geminin
family members as master regulators of centriole amplification and multiciliogenesis.
Chromosoma. 2018;127(2):151-74.
64. Kyrousi C, Lalioti ME, Skavatsou E, Lygerou Z, Taraviras S. Mcidas and
GemC1/Lynkeas specify embryonic radial glial cells. Neurogenesis (Austin).
2016;3(1):e1172747.
65. Terre B, Piergiovanni G, Segura-Bayona S, Gil-Gomez G, Youssef SA, Attolini CS, et al.
GEMC1 is a critical regulator of multiciliated cell differentiation. EMBO J. 2016;35(9):942-60.
66. Lu H, Anujan P, Zhou F, Zhang Y, Chong YL, Bingle CD, et al. Mcidas mutant mice
reveal a two-step process for the specification and differentiation of multiciliated cells in
mammals. Development. 2019;146(6).
67. Guiley KZ, Liban TJ, Felthousen JG, Ramanan P, Litovchick L, Rubin SM. Structural
mechanisms of DREAM complex assembly and regulation. Genes Dev. 2015;29(9):961-74.
68. Quiroz EJ, Kim S, Gautam LK, Borok Z, Kintner C, Ryan AL. RBL2 represses the
transcriptional activity of Multicilin to inhibit multiciliogenesis. Cell Death Dis. 2024;15(1):81.
69. Fulcher ML, Gabriel S, Burns KA, Yankaskas JR, Randell SH. Well-differentiated human
airway epithelial cell cultures. Methods Mol Med. 2005;107:183-206.
70. Neuberger T, Burton B, Clark H, Van Goor F. Use of primary cultures of human
bronchial epithelial cells isolated from cystic fibrosis patients for the pre-clinical testing of CFTR
modulators. Methods Mol Biol. 2011;741:39-54.
71. Kim S, Ma L, Shokhirev MN, Quigley I, Kintner C. Multicilin and activated E2f4 induce
multiciliated cell differentiation in primary fibroblasts. Sci Rep. 2018;8(1):12369.
72. Chen C, Okayama H. High-efficiency transformation of mammalian cells by plasmid
DNA. Mol Cell Biol. 1987;7(8):2745-52.
73. Dull T, Zufferey R, Kelly M, Mandel RJ, Nguyen M, Trono D, et al. A Third-Generation
Lentivirus Vector with a Conditional Packaging System. Journal of Virology. 1998;72(11):8463-
71.
74. Salomonis N, Schlieve CR, Pereira L, Wahlquist C, Colas A, Zambon AC, et al.

93
Alternative splicing regulates mouse embryonic stem cell pluripotency and differentiation.
Proceedings of the National Academy of Sciences. 2010;107(23):10514-9.
75. He L, Diedrich J, Chu YY, Yates JR, 3rd. Extracting Accurate Precursor Information for
Tandem Mass Spectra by RawConverter. Anal Chem. 2015;87(22):11361-7.
76. Xu T, Park SK, Venable JD, Wohlschlegel JA, Diedrich JK, Cociorva D, et al. ProLuCID:
An improved SEQUEST-like algorithm with enhanced sensitivity and specificity. J Proteomics.
2015;129:16-24.
77. Tabb DL, McDonald WH, Yates JR, 3rd. DTASelect and Contrast: tools for assembling
and comparing protein identifications from shotgun proteomics. J Proteome Res. 2002;1(1):21-
6.
78. Peng J, Elias JE, Thoreen CC, Licklider LJ, Gygi SP. Evaluation of multidimensional
chromatography coupled with tandem mass spectrometry (LC/LC-MS/MS) for large-scale
protein analysis: the yeast proteome. J Proteome Res. 2003;2(1):43-50.
79. Schindelin J, Arganda-Carreras I, Frise E, Kaynig V, Longair M, Pietzsch T, et al. Fiji: an
open-source platform for biological-image analysis. Nat Methods. 2012;9(7):676-82.
80. Chen S, Zhou Y, Chen Y, Gu J. fastp: an ultra-fast all-in-one FASTQ preprocessor.
Bioinformatics. 2018;34(17):i884-i90.
81. Dobin A, Davis CA, Schlesinger F, Drenkow J, Zaleski C, Jha S, et al. STAR: ultrafast
universal RNA-seq aligner. Bioinformatics. 2013;29(1):15-21.
82. Liao Y, Smyth GK, Shi W. featureCounts: an efficient general purpose program for
assigning sequence reads to genomic features. Bioinformatics. 2014;30(7):923-30.
83. Love MI, Huber W, Anders S. Moderated estimation of fold change and dispersion for
RNA-seq data with DESeq2. Genome Biol. 2014;15(12):550.
84. Marshall CB, Mays DJ, Beeler JS, Rosenbluth JM, Boyd KL, Santos Guasch GL, et al.
p73 Is Required for Multiciliogenesis and Regulates the Foxj1-Associated Gene Network. Cell
Rep. 2016;14(10):2289-300.
85. Treutlein B, Brownfield DG, Wu AR, Neff NF, Mantalas GL, Espinoza FH, et al.
Reconstructing lineage hierarchies of the distal lung epithelium using single-cell RNA-seq.
Nature. 2014;509(7500):371-5.
86. Stubbs JL, Vladar EK, Axelrod JD, Kintner C. Multicilin promotes centriole assembly and
ciliogenesis during multiciliate cell differentiation. Nat Cell Biol. 2012;14(2):140-7.
87. Zhou F, Rayamajhi D, Ravi V, Narasimhan V, Chong YL, Lu H, et al. Conservation as
well as divergence in Mcidas function underlies the differentiation of multiciliated cells in
vertebrates. Dev Biol. 2020;465(2):168-77.
88. Pefani DE, Dimaki M, Spella M, Karantzelis N, Mitsiki E, Kyrousi C, et al. Idas, a novel
phylogenetically conserved geminin-related protein, binds to geminin and is required for cell
cycle progression. J Biol Chem. 2011;286(26):23234-46.

94
89. Balestrini A, Cosentino C, Errico A, Garner E, Costanzo V. GEMC1 is a TopBP1-
interacting protein required for chromosomal DNA replication. Nat Cell Biol. 2010;12(5):484-91.
90. Wohlschlegel JA, Dwyer BT, Dhar SK, Cvetic C, Walter JC, Dutta A. Inhibition of
eukaryotic DNA replication by geminin binding to Cdt1. Science. 2000;290(5500):2309-12.
91. Lewis M, Terre B, Knobel PA, Cheng T, Lu H, Attolini CS, et al. GEMC1 and MCIDAS
interactions with SWI/SNF complexes regulate the multiciliated cell-specific transcriptional
program. Cell Death Dis. 2023;14(3):201.
92. Lalioti M-E, Arbi M, Loukas I, Kaplani K, Kalogeropoulou A, Lokka G, et al. GemC1
governs multiciliogenesis through direct interaction with and transcriptional regulation of p73.
Journal of Cell Science. 2019;132(11).
93. Walentek P, Quigley IK, Sun DI, Sajjan UK, Kintner C, Harland RM. Ciliary transcription
factors and miRNAs precisely regulate Cp110 levels required for ciliary adhesions and
ciliogenesis. Elife. 2016;5.
94. Balestra FR, Gonczy P. Multiciliogenesis: multicilin directs transcriptional activation of
centriole formation. Curr Biol. 2014;24(16):R746-9.
95. Ma L, Quigley I, Omran H, Kintner C. Multicilin drives centriole biogenesis via E2f
proteins. Genes Dev. 2014;28(13):1461-71.
96. Levine M, Holland A. Cell cycle proteins moonlight in multiciliogenesis. Science.
2017;358(6364):716-8.
97. Al Jord A, Shihavuddin A, Servignat d'Aout R, Faucourt M, Genovesio A, Karaiskou A, et
al. Calibrated mitotic oscillator drives motile ciliogenesis. Science. 2017;358(6364):803-6.
98. Vladar EK, Stratton MB, Saal ML, Salazar-De Simone G, Wang X, Wolgemuth D, et al.
Cyclin-dependent kinase control of motile ciliogenesis. Elife. 2018;7.
99. Fagundes R, Teixeira LK. Cyclin E/CDK2: DNA Replication, Replication Stress and
Genomic Instability. Front Cell Dev Biol. 2021;9:774845.
100. Hu B, Mitra J, van den Heuvel S, Enders GH. S and G2 phase roles for Cdk2 revealed
by inducible expression of a dominant-negative mutant in human cells. Mol Cell Biol.
2001;21(8):2755-66.
101. Bacevic K, Lossaint G, Achour TN, Georget V, Fisher D, Dulic V. Cdk2 strengthens the
intra-S checkpoint and counteracts cell cycle exit induced by DNA damage. Sci Rep.
2017;7(1):13429.
102. Kim S, Chien YH, Ryan A, Kintner C. Emi2 enables centriole amplification during
multiciliated cell differentiation. Sci Adv. 2022;8(13):eabm7538.
103. Boon M, Wallmeier J, Ma L, Loges NT, Jaspers M, Olbrich H, et al. MCIDAS mutations
result in a mucociliary clearance disorder with reduced generation of multiple motile cilia. Nat
Commun. 2014;5:4418.

95
104. Xie D, Pei Q, Li J, Wan X, Ye T. Emerging Role of E2F Family in Cancer Stem Cells.
Front Oncol. 2021;11:723137.
105. Attwooll C, Lazzerini Denchi E, Helin K. The E2F family: specific functions and
overlapping interests. EMBO J. 2004;23(24):4709-16.
106. Sun A, Bagella L, Tutton S, Romano G, Giordano A. From G0 to S phase: a view of the
roles played by the retinoblastoma (Rb) family members in the Rb-E2F pathway. J Cell
Biochem. 2007;102(6):1400-4.
107. Black AR, Azizkhan-Clifford J. Regulation of E2F: a family of transcription factors
involved in proliferation control. Gene. 1999;237(2):281-302.
108. Wenzel PL, Chong JL, Saenz-Robles MT, Ferrey A, Hagan JP, Gomez YM, et al. Cell
proliferation in the absence of E2F1-3. Dev Biol. 2011;351(1):35-45.
109. Arvanitis DA, Spandidos DA. Deregulation of the G1/S phase transition in cancer and
squamous intraepithelial lesions of the uterine cervix: a case control study. Oncol Rep.
2008;20(4):751-60.
110. Cao L, Peng B, Yao L, Zhang X, Sun K, Yang X, et al. The ancient function of RB-E2F
pathway: insights from its evolutionary history. Biol Direct. 2010;5:55.
111. Gaubatz S, Lindeman GJ, Ishida S, Jakoi L, Nevins JR, Livingston DM, et al. E2F4 and
E2F5 play an essential role in pocket protein-mediated G1 control. Mol Cell. 2000;6(3):729-35.
112. Tyagi A, Agarwal C, Agarwal R. The cancer preventive flavonoid silibinin causes
hypophosphorylation of Rb/p107 and Rb2/p130 via modulation of cell cycle regulators in human
prostate carcinoma DU145 cells. Cell Cycle. 2002;1(2):137-42.
113. Hsu J, Sage J. Novel functions for the transcription factor E2F4 in development and
disease. Cell Cycle. 2016;15(23):3183-90.
114. Henley SA, Dick FA. The retinoblastoma family of proteins and their regulatory functions
in the mammalian cell division cycle. Cell Div. 2012;7(1):10.
115. Litovchick L, Sadasivam S, Florens L, Zhu X, Swanson SK, Velmurugan S, et al.
Evolutionarily conserved multisubunit RBL2/p130 and E2F4 protein complex represses human
cell cycle-dependent genes in quiescence. Mol Cell. 2007;26(4):539-51.
116. Pirkmajer S, Chibalin AV. Serum starvation: caveat emptor. Am J Physiol Cell Physiol.
2011;301(2):C272-9.
117. Rashid MU, Coombs KM. Serum-reduced media impacts on cell viability and protein
expression in human lung epithelial cells. J Cell Physiol. 2019;234(6):7718-24.
118. Hayes O, Ramos B, Rodriguez LL, Aguilar A, Badia T, Castro FO. Cell confluency is as
efficient as serum starvation for inducing arrest in the G0/G1 phase of the cell cycle in granulosa
and fibroblast cells of cattle. Anim Reprod Sci. 2005;87(3-4):181-92.
119. Kues WA, Anger M, Carnwath JW, Paul D, Motlik J, Niemann H. Cell cycle

96
synchronization of porcine fetal fibroblasts: effects of serum deprivation and reversible cell cycle
inhibitors. Biol Reprod. 2000;62(2):412-9.
120. Dalman A, Eftekhari-Yazdi P, Valojerdi MR, Shahverdi A, Gourabi H, Janzamin E, et al.
Synchronizing cell cycle of goat fibroblasts by serum starvation causes apoptosis. Reprod
Domest Anim. 2010;45(5):e46-53.
121. Golpour M, Akhavan Niaki H, Khorasani HR, Hajian A, Mehrasa R, Mostafazadeh A.
Human fibroblast switches to anaerobic metabolic pathway in response to serum starvation: a
mimic of warburg effect. Int J Mol Cell Med. 2014;3(2):74-80.
122. Ortiz-Alvarez G, Fortoul A, Srivastava A, Moreau MX, Bouloudi B, Mailhes-Hamon C, et
al. p53/p21 pathway activation contributes to the ependymal fate decision downstream of
GemC1. Cell Rep. 2022;41(11):111810.
123. Cobrinik D, Lee MH, Hannon G, Mulligan G, Bronson RT, Dyson N, et al. Shared role of
the pRB-related p130 and p107 proteins in limb development. Genes Dev. 1996;10(13):1633-
44.
124. Schwarze F, Meraner J, Lechner M, Loidl A, Stasyk T, Laich A, et al. Cell cycledependent acetylation of Rb2/p130 in NIH3T3 cells. Oncogene. 2010;29(42):5755-60.
125. Ullah F, Khurshid N, Fatimi Q, Loidl P, Saeed M. Mutations in the acetylation hotspots of
Rbl2 are associated with increased risk of breast cancer. PLoS One. 2022;17(4):e0266196.
126. Graham FL, Smiley J, Russell WC, Nairn R. Characteristics of a human cell line
transformed by DNA from human adenovirus type 5. J Gen Virol. 1977;36(1):59-74.
127. Liu X, Marmorstein R. Structure of the retinoblastoma protein bound to adenovirus E1A
reveals the molecular basis for viral oncoprotein inactivation of a tumor suppressor. Genes Dev.
2007;21(21):2711-6.
128. Zini N, Trimarchi C, Claudio PP, Stiegler P, Marinelli F, Maltarello MC, et al. pRb2/p130
and p107 control cell growth by multiple strategies and in association with different
compartments within the nucleus. J Cell Physiol. 2001;189(1):34-44.
129. Srinivasan B, Kolli AR, Esch MB, Abaci HE, Shuler ML, Hickman JJ. TEER
measurement techniques for in vitro barrier model systems. J Lab Autom. 2015;20(2):107-26.
130. Prescott RA, Pankow AP, de Vries M, Crosse KM, Patel RS, Alu M, et al. A comparative
study of in vitro air-liquid interface culture models of the human airway epithelium evaluating
cellular heterogeneity and gene expression at single cell resolution. Respir Res.
2023;24(1):213.
131. Piao CQ, Liu L, Zhao YL, Balajee AS, Suzuki M, Hei TK. Immortalization of human small
airway epithelial cells by ectopic expression of telomerase. Carcinogenesis. 2005;26(4):725-31.
132. Zhang C, Lee HJ, Shrivastava A, Wang R, McQuiston TJ, Challberg SS, et al. LongTerm In Vitro Expansion of Epithelial Stem Cells Enabled by Pharmacological Inhibition of
PAK1-ROCK-Myosin II and TGF-beta Signaling. Cell Rep. 2018;25(3):598-610 e5.

97
133. Mou H, Vinarsky V, Tata PR, Brazauskas K, Choi SH, Crooke AK, et al. Dual SMAD
Signaling Inhibition Enables Long-Term Expansion of Diverse Epithelial Basal Cells. Cell Stem
Cell. 2016;19(2):217-31.
134. Peters-Hall JR, Coquelin ML, Torres MJ, LaRanger R, Alabi BR, Sho S, et al. Long-term
culture and cloning of primary human bronchial basal cells that maintain multipotent
differentiation capacity and CFTR channel function. Am J Physiol Lung Cell Mol Physiol.
2018;315(2):L313-L27.
135. Carlile GW, Robert R, Zhang D, Teske KA, Luo Y, Hanrahan JW, et al. Correctors of
protein trafficking defects identified by a novel high-throughput screening assay. Chembiochem.
2007;8(9):1012-20.
136. Van Goor F, Straley KS, Cao D, Gonzalez J, Hadida S, Hazlewood A, et al. Rescue of
DeltaF508-CFTR trafficking and gating in human cystic fibrosis airway primary cultures by small
molecules. Am J Physiol Lung Cell Mol Physiol. 2006;290(6):L1117-30.
137. Zielen S, Trischler J, Schubert R. Lipopolysaccharide challenge: immunological effects
and safety in humans. Expert Rev Clin Immunol. 2015;11(3):409-18.
138. Zhang Z, Leir SH, Harris A. Oxidative stress regulates CFTR gene expression in human
airway epithelial cells through a distal antioxidant response element. Am J Respir Cell Mol Biol.
2015;52(3):387-96.
139. Higham A, Bostock D, Booth G, Dungwa JV, Singh D. The effect of electronic cigarette
and tobacco smoke exposure on COPD bronchial epithelial cell inflammatory responses. Int J
Chron Obstruct Pulmon Dis. 2018;13:989-1000.
140. Acheva A, Haghdoost S, Sollazzo A, Launonen V, Kamarainen M. Presence of Stromal
Cells Enhances Epithelial-to-Mesenchymal Transition (EMT) Induction in Lung Bronchial
Epithelium after Protracted Exposure to Oxidative Stress of Gamma Radiation. Oxid Med Cell
Longev. 2019;2019:4120379.
141. Stewart CE, Torr EE, Mohd Jamili NH, Bosquillon C, Sayers I. Evaluation of
differentiated human bronchial epithelial cell culture systems for asthma research. J Allergy
(Cairo). 2012;2012:943982.
142. Ramirez RD, Sheridan S, Girard L, Sato M, Kim Y, Pollack J, et al. Immortalization of
human bronchial epithelial cells in the absence of viral oncoproteins. Cancer Res.
2004;64(24):9027-34.
143. Roufayel R, Mezher R, Storey KB. The Role of Retinoblastoma Protein in Cell Cycle
Regulation: An Updated Review. Curr Mol Med. 2021;21(8):620-9.
144. Hansen K, Farkas T, Lukas J, Holm K, Ronnstrand L, Bartek J. Phosphorylationdependent and -independent functions of p130 cooperate to evoke a sustained G1 block.
EMBO J. 2001;20(3):422-32.
145. Lizcano JM, Deak M, Morrice N, Kieloch A, Hastie CJ, Dong L, et al. Molecular basis for
the substrate specificity of NIMA-related kinase-6 (NEK6). Evidence that NEK6 does not
phosphorylate the hydrophobic motif of ribosomal S6 protein kinase and serum- and

98
glucocorticoid-induced protein kinase in vivo. J Biol Chem. 2002;277(31):27839-49.
146. Litovchick L, Florens LA, Swanson SK, Washburn MP, DeCaprio JA. DYRK1A protein
kinase promotes quiescence and senescence through DREAM complex assembly. Genes Dev.
2011;25(8):801-13.
147. Tedesco D, Lukas J, Reed SI. The pRb-related protein p130 is regulated by
phosphorylation-dependent proteolysis via the protein-ubiquitin ligase SCF(Skp2). Genes Dev.
2002;16(22):2946-57.
148. Bhattacharya S, Garriga J, Calbo J, Yong T, Haines DS, Grana X. SKP2 associates with
p130 and accelerates p130 ubiquitylation and degradation in human cells. Oncogene.
2003;22(16):2443-51.
149. Santamaria D, Barriere C, Cerqueira A, Hunt S, Tardy C, Newton K, et al. Cdk1 is
sufficient to drive the mammalian cell cycle. Nature. 2007;448(7155):811-5.
150. Enrico TP, Stallaert W, Wick ET, Ngoi P, Wang X, Rubin SM, et al. Cyclin F drives
proliferation through SCF-dependent degradation of the retinoblastoma-like tumor suppressor
p130/RBL2. Elife. 2021;10.
151. Pentimalli F, Forte IM, Esposito L, Indovina P, Iannuzzi CA, Alfano L, et al. RBL2/p130 is
a direct AKT target and is required to induce apoptosis upon AKT inhibition in lung cancer and
mesothelioma cell lines. Oncogene. 2018;37(27):3657-71.
152. Litovchick L, Chestukhin A, DeCaprio JA. Glycogen synthase kinase 3 phosphorylates
RBL2/p130 during quiescence. Mol Cell Biol. 2004;24(20):8970-80.
153. Tsao PN, Vasconcelos M, Izvolsky KI, Qian J, Lu J, Cardoso WV. Notch signaling
controls the balance of ciliated and secretory cell fates in developing airways. Development.
2009;136(13):2297-307.
154. Liu Y, Pathak N, Kramer-Zucker A, Drummond IA. Notch signaling controls the
differentiation of transporting epithelia and multiciliated cells in the zebrafish pronephros.
Development. 2007;134(6):1111-22.
155. Marnellos G, Deblandre GA, Mjolsness E, Kintner C. Delta-Notch lateral inhibitory
patterning in the emergence of ciliated cells in Xenopus: experimental observations and a gene
network model. Pac Symp Biocomput. 2000:329-40.
156. Vasquez SSV, van Dam J, Wheway G. An updated SYSCILIA gold standard (SCGSv2)
of known ciliary genes, revealing the vast progress that has been made in the cilia research
field. Mol Biol Cell. 2021;32(22):br13.
157. Lee W, Lee S, Yoon JK, Lee D, Kim Y, Han YB, et al. A single-cell atlas of in vitro
multiculture systems uncovers the in vivo lineage trajectory and cell state in the human lung.
Exp Mol Med. 2023;55(8):1831-42.
158. Byrnes LE, Deleon R, Reiter JF, Choksi SP. Opposing transcription factors MYCL and
HEY1 mediate the Notch-dependent airway stem cell fate decision. bioRxiv.
2022:2022.10.05.511009.

99
Appendices
Appendix A: Common and uniquely significantly upregulated DEGs across multicilin vs
Rbl2
MCI MCI+E2F4VP16 MCI and
MCI+siRBL2
MCI+siRbl2 and
MCI+E2F4VP16
Ifi44l LOC118568593 LOC118568593 Lrrc56
Eomes Dab1 Dab1 Nrsn1
Pkd2l1 Wdr54 Wdr54 Gm52910
Slco1a5 Nudc Nudc 1700029J07Rik
Ret Gm41114 Gm41114 Gm52350
Areg Mapkbp1 Mapkbp1 Cep95
Ces2g Gm567 Gm567 Fam217a
Acer2 Prkce Prkce Pou4f1
Dynap Esam Esam Cdiptos
Gbp2 Usp49 Usp49 Gm15638
H2-T23 Camk1d Camk1d Smkr-ps
Csn3 Gm51725 Gm51725 Gm14963
Olr1 Zswim2 Zswim2 Fhod3
Bhlha15 Cep97 Cep97 Cep43
Gm10499 LOC115487808 LOC115487808 Tspan7
Ifi211 Fsd1l Fsd1l AI182371
Nppc C130060C02Rik C130060C02Rik Gstm6
Mmp9 Gm40493 Gm40493 A830052D11Rik
Calca 1110002L01Rik 1110002L01Rik Onecut1
Tfpi2 Fitm2 Fitm2 Gm46412
Gm8909 Khdrbs3 Khdrbs3 Nudt10
Tap1 Gm46822 Gm46822 Spink2
Zdbf2 AI429214 AI429214 Tchh
H2-Q2 Gm34655 Gm34655 Mreg
Derl3 Cdk5rap2 Cdk5rap2 Ccdc69
Xaf1 Gm33363 Gm33363 Gm26799
Gvin2 Gm27572 Gm27572 4930507D05Rik
Tmem132e 1810008I18Rik 1810008I18Rik Dmrtb1
Kcnb2 Gm52340 Gm52340 Cep135
Herc6 Gm32133 Gm32133 5330413P13Rik
Ifit3b 5830432E09Rik 5830432E09Rik Ropn1l
Ccl5 Gm12500 Gm12500 Hunk
Slfn5 Nyx Nyx 4930412C18Rik
Phf11b 4930451G09Rik 4930451G09Rik Pcsk6
Gbp10 AA543186 AA543186 Nova1

100
Clca3a1 Ccdc191 Ccdc191 Foxa2
Bst2 B9d1 B9d1 9530077C05Rik
Psmb8 1700001O22Rik 1700001O22Rik 1700019G24Rik
MCI+siRbl2 Elfn2 Elfn2 Syt16
Cwh43 Ankrd6 Ankrd6 Ang2
Aurka Gm1123 Gm1123 Barhl2
Cenpi Prl6a1 Prl6a1 Gm29862
Wnk2 Herc3 Herc3 Gm41396
Atp8a2 Gm30057 Gm30057 Ruvbl2
Tecrl LOC118567694 LOC118567694 Pcgf5
Lingo1 Slc6a19 Slc6a19 Gdf15
Slc6a4 Lrrc30 Lrrc30 Ccdc74a
Scn9a Gm26512 Gm26512 Casp4
Slitrk1 Klhl41 Klhl41 Xrra1
Fanci Dusp2 Dusp2 Kcnrg
Pxylp1 4930471E19Rik 4930471E19Rik Ifi208
D030068K23Rik Lrrc37a Lrrc37a Ift22
Tcim Gm36188 Gm36188 Tmem67
Cntn4 Gm45231 Gm45231 Poc1a
Phf11a H3c6 H3c6 Ifi207
Fignl1 Gm39590 Gm39590 Chrnb4
Eme1 Gm33679 Gm33679 Bbs1
Cdkn1c Gm52565 Gm52565 Pcnt
Islr2 Paxip1 Paxip1 4921507G05Rik
Fgf15 Abca12 Abca12 Lmod2
Pfkfb1 Gm30181 Gm30181 H4c8
Gm33319 Ankrd34b Ankrd34b Wnt7a
Abcc8 Rasal1 Rasal1 Ces2e
Fam189a1 Odf2l Odf2l 4632428C04Rik
Slc44a3 Sdcbp2 Sdcbp2 Intu
Dhdh Bend7 Bend7 Gm40863
Cacng8 Ttc6 Ttc6 Mctp2
Casz1 Gm4890 Gm4890 Spata31d1b
Rad54b Gpr20 Gpr20 Atp6v1c2
Miat Smco3 Smco3 Kcna3
Gm10532 Serpinb6c Serpinb6c Elovl2
Gm5532 Arhgap32 Arhgap32 Cav2
Gm11496 Rbl1 Rbl1 Tas1r1
Lor Met Met Gm7361
Tmem158 Gm35429 Gm35429 Gm6650

101
Cd163 Gm52174 Gm52174 Apol9a
Adcyap1 Psd2 Psd2 D730003K21Rik
Gm31078 Gm46810 Gm46810 Gm36738
Tmem132c 2610020C07Rik 2610020C07Rik Adora2a
Gpr37 Pkd1l1 Pkd1l1 Grin2c
Elapor1 Lcn12 Lcn12 Gm52907
Xdh Rrm2 Rrm2 LOC118567905
Dnaaf4 Map3k1 Map3k1 Tbc1d31
Wdhd1 Mc1r Mc1r Cfap74
Palm3 Crisp2 Crisp2 Gm7094
Alkal2 Gm34542 Gm34542 Gm2721
Orm3 Gm46052 Gm46052 Lgals3bp
Cdh9 Fam216a Fam216a Ism2
Tmprss2 Agrp Agrp Ift80
Gm30339 Ccdc17 Ccdc17 Slc17a8
1600029I14Rik Stra6l Stra6l Gm34889
Gm35828 H3c1 H3c1 Gm2102
Spint1 Wfdc8 Wfdc8 Flywch2
Ercc6l Gm34299 Gm34299 Gm26871
Lad1 Gm41611 Gm41611 Fibcd1
Col6a4 Gm38514 Gm38514 9930111J21Rik1
Has2 Gm52129 Gm52129 Ripk4
Hsd3b1 Orc1 Orc1 Gm52041
Wfdc3 AI225912 AI225912 Scml2
Car4 Gclc Gclc Bbox1
Map3k21 Map4k2 Map4k2 Ttc39aos1
Trpa1 9230110K08Rik 9230110K08Rik Lrrc70
Cd55os Art4 Art4 Jade3
Calb1 Gm40573 Gm40573 Neto2
Ckmt1 Gm37292 Gm37292 Ankrd54
Rgs9 Arhgef16 Arhgef16 LOC115488342
Mlxipl Poc5 Poc5 Plekha7
Cd55 Kcnj15 Kcnj15 H2-Q7
Zwilch Raet1e Raet1e Got1l1
Shisa3 Gm41125 Gm41125 Dxo
Tnfrsf9 Gm32322 Gm32322 Gm6981
Rem2 Akap14 Akap14 Dnaaf2
Gm36860 0610039K10Rik 0610039K10Rik Mesp2
Cdk1 Gm49249 Gm49249 Ccdc171
Calb2 Npy5r Npy5r Foxd2os

102
Aoc1 Hoatz Hoatz Adgrb2
Mal Gclm Gclm Hspa1l
Spag5 Katnb1 Katnb1 Ifi209
Rln1 Gm30042 Gm30042 Lncenc1
Hrob Cenpj Cenpj Erfl
Ifit1bl2 Gm35574 Gm35574 Cdk5r1
Kcnj5 Gm14206 Gm14206 Dennd5b
Rad51ap1 Bbs4 Bbs4 P2rx3
Cep55 Tcfl5 Tcfl5 Rif1
Gbp2b Septin1 Septin1 Il6
Misp3 Ctsh Ctsh Nemp1
Dsg2 Cd200r2 Cd200r2 Pgbd5
LOC118568382 Fam110c Fam110c Ribc1
Pcdh8 Samd3 Samd3 Stk36
Lipg Gtf2a1l Gtf2a1l Paqr9
Ltk Sox3 Sox3 Adam5
Ihh Gad1os Gad1os Ppp1r1b
Slc18a1 LOC118568179 LOC118568179 Pnmal1
Csrnp3 1810021M19Rik 1810021M19Rik LOC118567733
C7 Gm42266 Gm42266 Ddx43
Gm39283 Pik3cb Pik3cb Slco4a1
Clec10a 2310030G06Rik 2310030G06Rik Rnf32
Nudt11 Spink10 Spink10 Piwil4
Pip5k1b Dipk1a Dipk1a Cracdl
Slc38a11 Raph1 Raph1 Spata24
Rph3al Samd15 Samd15 Spata4
Lpar3 Tnni3 Tnni3 Tctn2
Lrrc71 C030034L19Rik C030034L19Rik Ltb
Mybpc1 Gm4876 Gm4876 Traf3ip1
Chodl Gm30771 Gm30771 Gm34632
Tfr2 Gm39317 Gm39317 Nqo1
A530020G20Rik 3110083C13Rik 3110083C13Rik Pkd2l2
Wdr76 Spocd1 Spocd1 Dna2
Gm46226 Fam187a Fam187a LOC118567504
Phkg1 LOC118568677 LOC118568677 Gm33667
Ntrk2 Hmga1 Hmga1 Dnah3
Lbx1 Phip Phip Asrgl1
Nphs2 Ccnf Ccnf Cfap20dc
Cyp2s1 Cftr Cftr Zfand4
Stra6 Efcab7 Efcab7 Syna

103
Plppr4 Gm32389 Gm32389 Gm49974
Gabra2 Gm41498 Gm41498 Gm14199
Vwc2 H3f3a H3f3a Hrh1
Mstn 1110032A03Rik 1110032A03Rik Pkn3
Cfap73 Dpcd Dpcd Map9
Cyb561 Gm36753 Gm36753 Apol7a
Mamdc2 Tmem52 Tmem52 Ccdc177
Col6a5 LOC118568242 LOC118568242 Cntrl
Cldn11 Gm30257 Gm30257 4921536K21Rik
Slc30a10 Gm13889 Gm13889 1700037C18Rik
Krt8 Togaram2 Togaram2 Gm21011
Scin Gm46766 Gm46766 Iqgap2
Ccdc78 Gm43868 Gm43868 Rxfp2
Matn3 4930550C14Rik 4930550C14Rik Cnnm1
Mgam Ppp1r16a Ppp1r16a Prph
Glb1l2 Ly6g6g Ly6g6g Nhlrc4
Prob1 Gm11769 Gm11769 Liph
3425401B19Rik Tmem212 Tmem212 Gm16083
Gm30474 Gm32632 Gm32632 Abhd15
Plac1 Gm35807 Gm35807 Ccdc88c
2210409E12Rik Gm46270 Gm46270 Rundc3b
Gdf7 D830014E11Rik D830014E11Rik Filip1
Gm9991 Gm51794 Gm51794 2010204K13Rik
Smim24 Nphp1 Nphp1 Plxnb3
Mmp27 Gm40191 Gm40191 Slc35g1
Ccl8 Gcnt2 Gcnt2 Stk32a
Ifit1bl1 LOC117997403 LOC117997403 Dnah8
Klhdc9 Shisa6 Shisa6 Gm11827
Lrat Gm31485 Gm31485 Igsf11
AI593442 LOC118567600 LOC118567600 Gm11837
Ccna1 1700064M15Rik 1700064M15Rik Tex11
Cbln2 Sox11 Sox11 A930003A15Rik
Gm52877 Calhm4 Calhm4 Pim2
MCI and
MCI+E2F4VP16 Bdkrb1 Bdkrb1 Dsc2
Efcab11 LOC118568057 LOC118568057 Gm30284
Ccp110 Gm51454 Gm51454 Ube2t
Bcl6b Efcab5 Efcab5 1700007K13Rik
Wdr78 A630089N07Rik A630089N07Rik Spef1
Tspan7 Prex1 Prex1 Hes2

104
Kif19a Tex30 Tex30 Gm46825
Cma1 Tgm1 Tgm1 Gm15728
Tbx20 Gm39675 Gm39675 Exph5
Lrrc6 2700049A03Rik 2700049A03Rik Tal2
Dnah12 Scn3b Scn3b 4930512H18Rik
Efcab12 Npnt Npnt Agbl2
Ddo Ctnnd2 Ctnnd2 Ankef1
Alox5 Gm31288 Gm31288 Ccdc121
Gm33387 Tspan2os Tspan2os Cracd
Mreg Dusp14 Dusp14 Cfap298
Dnah2 Cdh5 Cdh5 Rhbdl3
Sox18 Gm45938 Gm45938 Gm46162
Ppp1r1b Gm39728 Gm39728 Casp7
Igsf11 Gm32574 Gm32574 Fam50b
Ina C130036L24Rik C130036L24Rik Nmb
Plk4 E230025N22Rik E230025N22Rik LOC108169029
Fsip1 Gm30005 Gm30005 Gm31281
Bves Gm16217 Gm16217 Dnajc22
Spaca9 Glrp1 Glrp1 Gm2762
Cfap58 Mr1 Mr1 4933439K11Rik
Ccdc13 Gm10636 Gm10636 Cep83
Ttc39a 5430402O13Rik 5430402O13Rik Sele
Ccdc40 Gm36495 Gm36495 Rbm24
Mdh1b Cntd1 Cntd1 H2-Q4
Plekha7 Gm41804 Gm41804 Phf11d
Casp7 Ltb4r1 Ltb4r1 Cdt1
Kndc1 Ankrd42 Ankrd42 Fbxo36
Kif9 Gm34739 Gm34739 Hspa4l
Slc39a4 Wdpcp Wdpcp Gm39215
Fank1 Gm46382 Gm46382 Mndal
Nkx2-9 Ntf5 Ntf5 Neurod1
Lrrn1 Cplx1 Cplx1 Xk
4932438H23Rik Gm36229 Gm36229 Bves
6820408C15Rik 5430401H09Rik 5430401H09Rik Gm2788
Ubxn10 LOC118568759 LOC118568759 Cfap43
Hmgcll1 Gm35823 Gm35823 Cfap53
Ston2 Tctex1d2 Tctex1d2 Syce2
Katnal2 Gm19710 Gm19710 Efhc2
Morn3 Nrg2 Nrg2 Cpne5
Mapk10 Gm36543 Gm36543 Coro6

105
Lgals3bp Fam186b Fam186b Ttc39d
Cracd Vmn1r4 Vmn1r4 Ccpg1os
Rif1 Mgst2 Mgst2 Ankk1
Tchh 9430018G01Rik 9430018G01Rik H2-Q5
Ttc34 Gm13583 Gm13583 Dock3
Prrg4 Gm33327 Gm33327 Gm973
Dnah9 Gm29897 Gm29897 Hhatl
Satb1 Gm33251 Gm33251 Tnni1
Pkn3 Gm26637 Gm26637 Styxl1
Syce2 Sdk1 Sdk1 Zc2hc1c
Myo5c Gm31054 Gm31054 Flrt1
Kif24 Mtfr2 Mtfr2 Ina
Ifi207 Inpp4b Inpp4b Gm20684
Aox3 Gm35750 Gm35750 5430425K12Rik
Meig1 Gpr174 Gpr174 Nphp4
Serpinb10 S100a3 S100a3 Cep128
C230072F16Rik Ccdc61 Ccdc61 Fam81b
Wscd1 LOC118568699 LOC118568699 Slfn9
Pou3f2 Smc1b Smc1b Gm34414
4930512H18Rik B3gnt3 B3gnt3 Hmgcll1
Sp9 Ptchd4 Ptchd4 Serpinb2
Ces2e Nup210 Nup210 Cdkl4
Wdr90 Gm41192 Gm41192 Cnih2
Hyls1 Klkb1 Klkb1 1700030J22Rik
Coro6 4933405D12Rik 4933405D12Rik Syt7
Stk33 Svopl Svopl Cdk15
Lncenc1 Rhpn1 Rhpn1 Prrt4
Mak Gm20655 Gm20655 Cfap100
Dtl Cage1 Cage1 Fndc11
Cldn3 2810408I11Rik 2810408I11Rik Lrrn1
Armc3 Grip1 Grip1 LOC118567416
Lonrf3 Cps1 Cps1 Rnf157
Mapk15 Btnl9 Btnl9 Fam184a
Cfap45 Dlk2 Dlk2 Alms1
Rsph1 Klhl4 Klhl4 Gm28209
Fam184a LOC118567650 LOC118567650 Iqck
Rnf157 Plin5 Plin5 Plaat1
Cntfr Cnga2 Cnga2 Kbtbd6
Cfap69 Gm52568 Gm52568 Rsph14
Stil Mir6999 Mir6999 Dnaaf6b

106
Gm867 Dbndd1 Dbndd1 Fam167a
Ccdc88c Qser1 Qser1 Vwa1
Coro2a Gm13846 Gm13846 Pbx4
Gm41848 Gm29985 Gm29985 Nek2
Elmod1 Hesx1 Hesx1 4930505A04Rik
Nek5 Cep120 Cep120 Ttll8
Ppp1r36 Gm38405 Gm38405 Fam227a
Tsnaxip1 Mbnl3 Mbnl3 Gm42023
Elavl4 Carhsp1 Carhsp1 Mcpt8
Dock3 Galnt16 Galnt16 Dnaaf3
Vwa3b Gm27197 Gm27197 Axdnd1
Clec2l Gm30331 Gm30331 Maneal
Slco4a1 Tmem253 Tmem253 Sp9
Sele Grk1 Grk1 Ccdc89
Gdf15 Dsp Dsp Flt4
Gm13709 S100a2 S100a2 1700003F12Rik
Cited1 Gm46868 Gm46868 Dnah7b
Tex11 Gm32931 Gm32931 Ulk4
Dyrk3 Rap1gap2 Rap1gap2 Iqcd
Il6 Slc35f1 Slc35f1 Lonrf3
Ankrd45 Defb23 Defb23 Oscp1
Kcnh3 Prr32 Prr32 H2-Q9
Spag8 Ugt1a6a Ugt1a6a Mycbpap
P2rx3 Slc35d1 Slc35d1 Dtl
Plekhh1 Gm52860 Gm52860 Hp
Dnaaf1 Spata3 Spata3 Serpinb10
Erich2 Lrwd1 Lrwd1 Dzank1
Fcho1 Fbxl13 Fbxl13 Doc2b
Pak6 Ablim3 Ablim3 Aifm3
Ccdc114 Gpr141 Gpr141 Prrg4
Pcdhgc4 4933406C10Rik 4933406C10Rik Rsph9
Ppp2r2c Gm35055 Gm35055 Mapk10
Rfx2 A930006K02Rik A930006K02Rik Ttc26
Mixl1 Gm34699 Gm34699 A430108G06Rik
Tube1 Lrrc8b Lrrc8b Aox4
Dnaic1 Sgk2 Sgk2 2510003B16Rik
Alox12 Gm41011 Gm41011 Elavl4
Cfap70 Kctd4 Kctd4 Efcab6
H2-Q7 Shisal2b Shisal2b Etfbkmt
Tnfrsf19 Foxo6 Foxo6 Rp1
Pla2g4c Gm5577 Gm5577 Spag1

107
Plek2 Nod2 Nod2 Adgrb1
Fhad1 Hrh2 Hrh2 Gabrb3
Cfap54 1700066B19Rik 1700066B19Rik Dnah7c
Ptch2 9230116N13Rik 9230116N13Rik Rasd1
Tekt4 Ascl2 Ascl2 Efcab10
Slfn9 Adam28 Adam28 Gm19437
Apol9a Gm46801 Gm46801 Gm30767
Gabrb3 Gm40140 Gm40140 Wdr93
Aard Nlrp12 Nlrp12 Pidd1
Spata17 Cfap300 Cfap300 Caps2
Cdt1 Cby1 Cby1 Cma1
Pidd1 H3c3 H3c3 Ifi205
Mns1 Gm44867 Gm44867 Ifi203
Wdr63 Trim59 Trim59 Kif6
Mndal Snai3 Snai3 Tfap2e
Kcnq3 Prps1l1 Prps1l1 Ccdc160
Atg9b LOC118567327 LOC118567327 Crocc2
Serpinb2 Gm33648 Gm33648 Rpgr
Ankk1 Gm39633 Gm39633 Rgs22
Diras2 Slc9a3r1 Slc9a3r1 Fam161a
Gm11992 D030040B21Rik D030040B21Rik Coro2a
Pax5 Tcp11x2 Tcp11x2 Wdr31
H2-Q10 Fbxw10 Fbxw10 Rttn
Enkur Phf10 Phf10 Gm12059
Ttll6 Ccdc57 Ccdc57 Klhl40
Ttc25 Ccdc68 Ccdc68 Faah
E2f8 Cntrob Cntrob Cldn3
H2-K2 Gm41707 Gm41707 Ccdc153
Cds1 Gm13657 Gm13657 Bcl6b
Robo3 Myl10 Myl10 Acoxl
Spata18 Gm36818 Gm36818 Nlrc5
Lrrc34 Gm46302 Gm46302 Ccdc173
Cadps2 LOC115490137 LOC115490137 Gm13709
Ccdc151 Tmprss11d Tmprss11d Catip
Bmp7 Rimbp3 Rimbp3 Scn4b
Flt4 Gm39769 Gm39769 LOC118568236
Ak7 Mroh8 Mroh8 Gm47708
Jag2 Gm9530 Gm9530 Gm41604
1700086L19Rik Gab2 Gab2 Gm5431
Gm41616 Ano7 Ano7 Efhc1
Ifi205 4632427E13Rik 4632427E13Rik 4933403O08Rik

108
Eno4 Gm40038 Gm40038 Apol9b
Zfp711 Gm38597 Gm38597 Ttc39a
Tnfsf18 Abcc12 Abcc12 Cntfr
Sez6 Galnt1 Galnt1 Slc47a2
Ttll9 Zfp382 Zfp382 Plch1
Oas3 Acot12 Acot12 Gm11772
Dnah11 LOC118567732 LOC118567732 Lrp2bp
Plvap Arid5a Arid5a Cfap77
Fam81a Gm15834 Gm15834 Insm2
Mcpt8 Gm32733 Gm32733 Serpinb1b
Strip2 LOC118568325 LOC118568325 Dpy19l2
H2-K1 Tent5d Tent5d Ccp110
Cfap65 Gm40190 Gm40190 Pla2g4c
Ccdc180 Arl4a Arl4a Ccdc30
Gbp5 Gm26944 Gm26944 Ccdc18
Cep152 Gm39526 Gm39526 Cfap99
Rsph4a Prl8a9 Prl8a9 Lmln
Fam183b Nav2 Nav2 Necab1
H2-Q5 Mir1a-1hg Mir1a-1hg Gm31127
Mgat5b 5033406O09Rik 5033406O09Rik Kcnh4
Ccdc113 Gm28809 Gm28809 Poln
Slc38a3 Bach2os Bach2os Clec2l
Drc3 Zfp473 Zfp473 Pax5
Hydin LOC118567721 LOC118567721 Fbxo16
Ifi203 Gm46638 Gm46638 Bnip5
Dnah6 Il5 Il5 Wdr90
Chst5 Ltb4r2 Ltb4r2 H2bc6
Epha5 Cyp2j12 Cyp2j12 Gm41616
Spag16 Ighe Ighe Nwd1
Nek11 8430429K09Rik 8430429K09Rik Ston2
Ttc21a Kirrel3os Kirrel3os Clgn
Stk32a Ssx2ip Ssx2ip Ryr2
Phf11d Fam83c Fam83c Gbp3
Cmpk2 Kcnj8 Kcnj8 Agbl4
Mst1 4930581F22Rik 4930581F22Rik Zmynd12
Vwa3a A730043L09Rik A730043L09Rik Gm35611
Iqcg H2bc11 H2bc11 Cetn4
Pifo Klf1 Klf1 Fut9
Hrk Mir17hg Mir17hg Mdm1
Tbx21 Gm31024 Gm31024 Stil
Tcp11 Clec2f Clec2f Ubxn11

109
E2f7 Apol8 Apol8 Fcho1
1700013F07Rik 4930448E22Rik 4930448E22Rik Irf7
Dhx58 Bcl2l15 Bcl2l15 Tex16
Ptprt Gm20005 Gm20005 Calcoco2
Clic6 Fkbp5 Fkbp5 Tube1
Olfr1372-ps1 Uox Uox Slfn8
Slfn8 Mir670hg Mir670hg Ldlrad2
Epcam Cep76 Cep76 Cited1
Crtac1 Tjp3 Tjp3 Alox12
Cfap126 Slc1a2 Slc1a2 Smim5
Ankrd35 Slf1 Slf1 Plekhh1
Nme5 Casp3 Casp3 Gm31045
Efhb Nkx6-2 Nkx6-2 Aox3
Apol9b Dnaaf5 Dnaaf5 Gzma
Ccdc96 Gm13830 Gm13830 Jhy
Ryr2 5730419F03Rik 5730419F03Rik Gm51887
Nlrc5 LOC118568401 LOC118568401 Dnah1
Slfn10-ps Ccm2l Ccm2l Gm33387
Gbp3 Gm33887 Gm33887 Gm40449
Gldc 9530053A07Rik 9530053A07Rik Dmkn
Gm12250 Gm45470 Gm45470 Daw1
Usp43 Gm39325 Gm39325 1700034J05Rik
Lrrc23 Gm3052 Gm3052 E2f8
Foxn4 Gm5103 Gm5103 Mok
D430041D05Rik Colq Colq Usp18
C1ql1 Gm30827 Gm30827 Tmem107
Rgs20 Ets1 Ets1 Spag17
Drc1 Cnksr1 Cnksr1 4930444P10Rik
H2-Q4 Trim63 Trim63 C330020E22Rik
Tekt1 Gm32551 Gm32551 Ttc16
Kif27 Gm33864 Gm33864 Tnfrsf19
Spag6l Muc15 Muc15 Spef1l
H2-Q9 Stom Stom Kcnq3
Mlf1 Fam155a Fam155a Ngef
Usp18 LOC118567682 LOC118567682 Plk4
1700016K19Rik Ugt1a6b Ugt1a6b Oas1a
Ccdc146 Gm32406 Gm32406 Slfn10-ps
Dnajb13 Rexo5 Rexo5 Pak6
Ildr2 Lyzl4 Lyzl4 Robo3

110
Dnali1 Sun3 Sun3 Plek2
Irf7 Gm41570 Gm41570 Ccdc87
Rab15 A430035B10Rik A430035B10Rik Fam166c
Dynlrb2 Gabrr1 Gabrr1 Kif24
Lrriq1 Katnip Katnip Wdr66
Zmynd10 Rbp2 Rbp2 Pacsin1
Maats1 Fermt1 Fermt1 Ccdc184
Lrrc9 4931440J10Rik 4931440J10Rik Ccdc65
Cfap206 Gm52252 Gm52252 Slc38a3
Spef2 Spn Spn Pih1d2
Ak9 Tfap2c Tfap2c Oas2
Oas1a H4c14 H4c14 1700003E16Rik
Stox1 Spint2 Spint2 Ccdc81
Vipr1 Prl8a6 Prl8a6 Zfp711
Chrna3 Lhx1 Lhx1 2810459M11Rik
Iqub Gm33460 Gm33460 Stpg1
Oas2 1700017M07Rik 1700017M07Rik Saxo2
Gm4841 Gm9899 Gm9899 Slc39a4
Iigp1 Meiob Meiob Riiad1
Rsad2 Gprc5d Gprc5d Myo5c
2410004P03Rik Armc4 Armc4 Katnal2
Cfap44 LOC118568126 LOC118568126 Cmpk2
Cfap52 5330439A09Rik 5330439A09Rik Dhx58
F830016B08Rik H2bc22 H2bc22 Fam189a2
Cacng4 Gm52120 Gm52120 Armc2
Oasl1 LOC115487216 LOC115487216 Dcdc2a
Drc7 Gm34056 Gm34056 Mgat5b
Ccno Dhh Dhh Fam161b
Myb Best3 Best3 Cabcoco1
Hap1 Cxcl17 Cxcl17 Hyls1
Shisa8 Gm4131 Gm4131 Cadps2
Trp73 LOC118568732 LOC118568732 Prss22
Cdc20b Ccdc181 Ccdc181 Tctex1d4
Deup1 Gm34130 Gm34130 Muc13
Foxj1 Gm39783 Gm39783 4933417O13Rik
Mcidas Kcnc2 Kcnc2 Atg9b
MCI and
MCI+siRbl2
and
MCI+E2F4VP16
Gm32058 Gm32058 Dlec1

111
Efcab11 Il20rb Il20rb Cfap299
Ccp110 H2-Q6 H2-Q6 Adgrg3
Bcl6b Adrb3 Adrb3 Lhb
Wdr78 Trpv1 Trpv1 Ak8
Tspan7 Acsbg1 Acsbg1 Tcte1
Kif19a Paqr5 Paqr5 Efcab11
Cma1 Duox2 Duox2 Gm12250
Lrrc6 Sigirr Sigirr Dyrk3
Dnah12 Gpt Gpt Gm9875
Efcab12 1700095J03Rik 1700095J03Rik Jag2
Ddo Myrfl Myrfl 1700088E04Rik
Gm33387 St14 St14 Ccdc39
Mreg Gm51709 Gm51709 Gbp5
Dnah2 LOC118568758 LOC118568758 Epha5
Sox18 Ubash3a Ubash3a Ptprt
Ppp1r1b Gm19600 Gm19600 Ccdc187
Igsf11 Gm39383 Gm39383 Serpinb5
Ina D830015G05Rik D830015G05Rik Diras2
Plk4 Gm33742 Gm33742 Pacrg
Fsip1 LOC118567838 LOC118567838 Cep126
Bves Gm51701 Gm51701 Pcdhgc4
Spaca9 Gm17197 Gm17197 Plvap
Cfap58 Gm51933 Gm51933 Dnah7a
Ccdc13 Gm32998 Gm32998 Epcam
Ttc39a Nsd2 Nsd2 Ankrd35
Ccdc40 Gm41309 Gm41309 Hrk
Mdh1b Gm41666 Gm41666 Spa17
Plekha7 Edaradd Edaradd Armh1
Casp7 4930570G19Rik 4930570G19Rik Ptch2
Kndc1 Cnksr2 Cnksr2 Nme9
Kif9 1700019J19Rik 1700019J19Rik Cfap221
Slc39a4 Col17a1 Col17a1 Mixl1
Fank1 Gm30706 Gm30706 Bbof1
Lrrn1 Kdm4d Kdm4d Ccdc170
4932438H23Rik Morn1 Morn1 Map3k19
6820408C15Rik Gm34320 Gm34320 E230016K23Rik
Ubxn10 Eva1a Eva1a Rfx2
Hmgcll1 Hs3st6 Hs3st6 Lrrc10b
Ston2 Cmah Cmah Ttc29
Katnal2 6330525I24Rik 6330525I24Rik Fam81a

112
Morn3 Gm42144 Gm42144 Fgl1
Mapk10 Fam47e Fam47e Ccdc192
Lgals3bp Abhd12b Abhd12b Ribc2
Cracd Thegl Thegl Ccdc103
Rif1 Gm5737 Gm5737 Gldc
Tchh Astl Astl Cep152
Ttc34 Otud1 Otud1 Strip2
Prrg4 4930578L24Rik 4930578L24Rik Zfp819
Dnah9 Sfn Sfn Ccdc60
Pkn3 Gm51779 Gm51779 Gm807
Syce2 Mir449c Mir449c Dbpht2
Myo5c Iqch Iqch Tex52
Kif24 Gm30397 Gm30397 Sgcg
Ifi207 4933433G15Rik 4933433G15Rik Gm31268
Aox3 Marchf10 Marchf10 Crip3
Meig1 Gm35782 Gm35782 Dydc2
Serpinb10 Gm5127 Gm5127 Mst1
C230072F16Rik Ang Ang Cfap97d2
Wscd1 Slfnl1 Slfnl1 Lrrc43
Pou3f2 Lrrc51 Lrrc51 Nags
4930512H18Rik P2ry1 P2ry1 Kif9
Sp9 Scrib Scrib Gm41848
Ces2e Anks1b Anks1b Adgrb3
Wdr90 Rfx3 Rfx3 Gm28729
Hyls1 4930509E16Rik 4930509E16Rik E2f7
Coro6 Gm38137 Gm38137 Odf3b
Stk33 LOC118568695 LOC118568695 Fsip1
Lncenc1 9530051G07Rik 9530051G07Rik Capsl
Mak Otud4 Otud4 Adgb
Dtl Hsp90aa1 Hsp90aa1 Ppp1r42
Cldn3 Gm40692 Gm40692 Wdr78
Armc3 Gm36195 Gm36195 Wscd1
Lonrf3 Gm52920 Gm52920 Spaca9
Mapk15 Tlx3 Tlx3 Cibar2
Cfap45 Gm34931 Gm34931 Casc1
Rsph1 Gm46404 Gm46404 D130043K22Rik
Fam184a Gm4827 Gm4827 Sox18
Rnf157 2900024J01Rik 2900024J01Rik Tbx21
Cntfr 4930511M06Rik 4930511M06Rik Crtac1
Cfap69 Ccdc158 Ccdc158 Bmp7

113
Stil Frmpd2 Frmpd2 Iigp1
Gm867 Gm51568 Gm51568 Lrrc74b
Ccdc88c Gm35037 Gm35037 Vwa3b
Coro2a Rasl11a Rasl11a Efcab1
Gm41848 Ptprn2 Ptprn2 1700012B09Rik
Elmod1 Npffr1 Npffr1 Gm19935
Nek5 Tdrd12 Tdrd12 Cfap69
Ppp1r36 Gm31769 Gm31769 Iqca
Tsnaxip1 Gm34349 Gm34349 Lrguk
Elavl4 Gm34973 Gm34973 Ccdc150
Dock3 5730480H06Rik 5730480H06Rik Ppp1r32
Vwa3b Phf24 Phf24 Tmem232
Clec2l Gm34891 Gm34891 Olfr1372-ps1
Slco4a1 Gpr68 Gpr68 Cfap46
Sele Slc16a11 Slc16a11 Ankrd66
Gdf15 Rpgrip1l Rpgrip1l Dnah2
Gm13709 Pou4f3 Pou4f3 Ddo
Cited1 Platr7 Platr7 Fank1
Tex11 Urah Urah Ccdc148
Dyrk3 Tigd4 Tigd4 Gas2l2
Il6 Sgk3 Sgk3 Cds1
Ankrd45 Fgf16 Fgf16 Tppp3
Kcnh3 Plch2 Plch2 Clic6
Spag8 Icam2 Icam2 C1ql1
P2rx3 4930524J08Rik 4930524J08Rik Dnah5
Plekhh1 Gm51956 Gm51956 Efcab12
Dnaaf1 Cxcr6 Cxcr6 Ildr2
Erich2 Gm13491 Gm13491 Fbxo43
Fcho1 Frmpd3 Frmpd3 4932438H23Rik
Pak6 Tanc2 Tanc2 Ccdc13
Ccdc114 Gm32694 Gm32694 Mns1
Pcdhgc4 LOC118568450 LOC118568450 Cfap54
Rfx2 Lrrc57 Lrrc57 Elmod1
Mixl1 Tcte2 Tcte2 Ccdc114
Tube1 Gm35977 Gm35977 Rsph1
Dnaic1 Rims2 Rims2 Ppil6
Alox12 Gm10634 Gm10634 Lrrc46
Cfap70 Myh14 Myh14 Ttll9
H2-Q7 Gm17057 Gm17057 Sez6
Tnfrsf19 Dcdc5 Dcdc5 Fam216b
Pla2g4c Gm46435 Gm46435 Cfap45

114
Plek2 9130015G15Rik 9130015G15Rik Wdr38
Fhad1 E2f4 E2f4 Cfap57
Cfap54 Gm29243 Gm29243 Rgs20
Ptch2 Gm12295 Gm12295 Ptchd3
Tekt4 Gm40723 Gm40723 Lrrc18
Slfn9 Npas1 Npas1 Ube2u
Apol9a Gm9861 Gm9861 Chst5
Gabrb3 Heph Heph Dnaic2
Aard H2bc9 H2bc9 1700086L19Rik
Spata17 Gm46303 Gm46303 Rab15
Cdt1 Pinlyp Pinlyp 1110017D15Rik
Pidd1 Gm17399 Gm17399 Rsad2
Mns1 Plscr4 Plscr4 Cfap61
Wdr63 Gm8251 Gm8251 Pou3f2
Mndal Grm8 Grm8 Morn5
Kcnq3 Awat2 Awat2 Stmnd1
Atg9b Eaf2 Eaf2 F830016B08Rik
Serpinb2 Slc5a1 Slc5a1 Ccdc40
Ankk1 Tdrd5 Tdrd5 Aard
Diras2 Marchf4 Marchf4 Spata17
Gm11992 Trmt9b Trmt9b Dnah11
Pax5 Ptprk Ptprk Kcnh3
Enkur Gm20627 Gm20627 Oasl1
Ttll6 1700097N02Rik 1700097N02Rik Cfap58
Ttc25 LOC118567673 LOC118567673 Ttc25
E2f8 Gm28874 Gm28874 Stk33
Cds1 Gm30802 Gm30802 Gm4841
Robo3 Gm38564 Gm38564 Gm867
Spata18 Gm41577 Gm41577 Eno4
Lrrc34 8030451A03Rik 8030451A03Rik Gm11992
Cadps2 Nos3 Nos3 Ppp1r36
Ccdc151 Gm30352 Gm30352 Usp43
Bmp7 Ccdc162 Ccdc162 Ccdc151
Flt4 Gm36414 Gm36414 Ankrd45
Ak7 Gm39857 Gm39857 Lrrc6
Jag2 Fzd10 Fzd10 Morn3
1700086L19Rik Sema6b Sema6b 1700013F07Rik
Gm41616 Fancd2os Fancd2os Mak
Ifi205 Slc37a1 Slc37a1 6820408C15Rik
Eno4 Gm32219 Gm32219 Kndc1
Zfp711 LOC118567801 LOC118567801 Zbbx

115
Sez6 Gm21149 Gm21149 Cfap47
Ttll9 Gm35824 Gm35824 Nme5
Dnah11 Gm2449 Gm2449 Vipr1
Plvap Rpl31-ps12 Rpl31-ps12 Mlf1
Fam81a Insm1 Insm1 Ttc34
Mcpt8 Trpc5os Trpc5os Iqcg
Strip2 Kcng3 Kcng3 Kif19a
Cfap65 Gm33721 Gm33721 Nek5
Ccdc180 Adamdec1 Adamdec1 Fhad1
Gbp5 LOC118567969 LOC118567969 Armc3
Cep152 Plb1 Plb1 Dkkl1
Rsph4a Rnf208 Rnf208 Enkur
Fam183b BC018473 BC018473 Mapk15
H2-Q5 Sfmbt1 Sfmbt1 Erich2
Mgat5b Hook1 Hook1 Ttc21a
Ccdc113 Gm31493 Gm31493 Tsnaxip1
Slc38a3 Acox2 Acox2 Drc3
Drc3 2810029C07Rik 2810029C07Rik Cfap70
Hydin Tmem74 Tmem74 Dnah12
Ifi203 Upp1 Upp1 Ubxn10
Dnah6 Gm40436 Gm40436 Drc1
Chst5 Gm42338 Gm42338 1700028P14Rik
Epha5 Gm39853 Gm39853 D430041D05Rik
Spag16 Gm35019 Gm35019 Cfap161
Nek11 Gm10832 Gm10832 Rsph4a
Ttc21a H1f1 H1f1 Kif27
Stk32a Gm41928 Gm41928 Spag8
Phf11d Cuzd1 Cuzd1 Mdh1b
Cmpk2 Dsc1 Dsc1 Ccdc96
Mst1 Map7d2 Map7d2 Dnah6
Vwa3a Odf3l1 Odf3l1 Spag16
Iqcg Gm45971 Gm45971 C230072F16Rik
Pifo LOC118568736 LOC118568736 Dnah9
Hrk Nectin4 Nectin4 Ttll6
Tbx21 Gm52294 Gm52294 Cfap126
Tcp11 Gm38565 Gm38565 Efhb
E2f7 Pld6 Pld6 Hydin
1700013F07Rik Gm36841 Gm36841 Lrrc34
Dhx58 4833415N18Rik 4833415N18Rik Wdr63
Ptprt Nlrp9b Nlrp9b Vwa3a
Clic6 Myo7b Myo7b Dnaic1

116
Olfr1372-ps1 Syk Syk Tekt4
Slfn8 Gm32688 Gm32688 Ccdc113
Epcam Hsf2bp Hsf2bp Ccdc180
Crtac1 Gm41409 Gm41409 Chrna3
Cfap126 4930444F02Rik 4930444F02Rik Nek11
Ankrd35 Olfr287 Olfr287 Pifo
Nme5 LOC118568167 LOC118568167 Spef2
Efhb Rsf1os1 Rsf1os1 Tcp11
Apol9b Ccdc194 Ccdc194 Stox1
Ccdc96 Wnt4 Wnt4 Lrrc9
Ryr2 Cyyr1 Cyyr1 Spata18
Nlrc5 Myot Myot Dnaaf1
Slfn10-ps Gm34945 Gm34945 Meig1
Gbp3 Ceacam20 Ceacam20 Zmynd10
Gldc Gm41512 Gm41512 Fam183b
Gm12250 Gm46832 Gm46832 Dnajb13
Usp43 Syt5 Syt5 1700016K19Rik
Lrrc23 Gm51623 Gm51623 Ak7
Foxn4 Alpk2 Alpk2 Hap1
D430041D05Rik Gm36904 Gm36904 Spag6l
C1ql1 Fcamr Fcamr Dnali1
Rgs20 Exoc3l2 Exoc3l2 Cacng4
Drc1 Plaat5 Plaat5 Foxn4
H2-Q4 Nexmif Nexmif Lrriq1
Tekt1 Gm35344 Gm35344 Ccdc146
Kif27 LOC118567987 LOC118567987 Ak9
Spag6l Il2ra Il2ra Maats1
H2-Q9 LOC118568384 LOC118568384 Cfap65
Mlf1 1700012P22Rik 1700012P22Rik Tekt1
Usp18 Dsg3 Dsg3 Cfap44
1700016K19Rik Gm38794 Gm38794 Iqub
Ccdc146 Il23r Il23r Lrrc23
Dnajb13 Gm26851 Gm26851 2410004P03Rik
Ildr2 Msx3 Msx3 Cfap206
Dnali1 Tm4sf4 Tm4sf4 Ccno
Irf7 4930519F16Rik 4930519F16Rik Myb
Rab15 Gm39404 Gm39404 Dynlrb2
Dynlrb2 Gm51874 Gm51874 Shisa8
Lrriq1 Cyp26b1 Cyp26b1 Cfap52
Zmynd10 Mir449b Mir449b Trp73

117
Maats1 Cecr2 Cecr2 Drc7
Lrrc9 BC049715 BC049715 Cdc20b
Cfap206 Pkp1 Pkp1 Deup1
Spef2 Gm52217 Gm52217 Foxj1
Ak9 Gm52526 Gm52526 Mcidas
Oas1a Drd2 Drd2
Stox1 Gm3336 Gm3336
Vipr1 Slbp Slbp
Chrna3 Sag Sag
Iqub Ssmem1 Ssmem1
Oas2 Ndst3 Ndst3
Gm4841 Gm33869 Gm33869
Iigp1 Six3 Six3
Rsad2 Trank1 Trank1
2410004P03Rik Dsc3 Dsc3
Cfap44 LOC118568482 LOC118568482
Cfap52 Slc17a2 Slc17a2
F830016B08Rik Heatr4 Heatr4
Cacng4 Ccne1 Ccne1
Oasl1 Tfec Tfec
Drc7 Lhx2 Lhx2
Ccno Gm41527 Gm41527
Myb Gm26777 Gm26777
Hap1 Map6d1 Map6d1
Shisa8 Ccne2 Ccne2
Trp73 Glra3 Glra3
Cdc20b A630034I12Rik A630034I12Rik
Deup1 Car2 Car2
Foxj1 Saa4 Saa4
Mcidas 4930417H01Rik 4930417H01Rik
Cnga3 Cnga3
Gm46819 Gm46819
Gm41754 Gm41754
Prima1 Prima1
Slc5a8 Slc5a8
Gm40727 Gm40727
1700042G15Rik 1700042G15Rik
Gm51667 Gm51667
Gm35829 Gm35829
Gm29927 Gm29927

118
Gm39712 Gm39712
Gm26947 Gm26947
B230208H11Rik B230208H11Rik
AI504432 AI504432
H3c8 H3c8
Tmem54 Tmem54
Ccdc110 Ccdc110
Odaph Odaph
Pcdh12 Pcdh12
Themis Themis
H4c1 H4c1
Gm13584 Gm13584
D930007P13Rik D930007P13Rik
LOC118568604 LOC118568604
Lincred1 Lincred1
Glyat Glyat
Trim38 Trim38
Cacna1i Cacna1i
Gm9696 Gm9696
Gm16146 Gm16146
Gsg1l Gsg1l
Nkx2-4 Nkx2-4
Phyhipl Phyhipl
Ugt8a Ugt8a
Syt10 Syt10
Fat2 Fat2
Gabra5 Gabra5
Appendix B: Proteomics of multicilin interactions
NSAF
(A)_FLAGMulticilin
NSAF
(B)_FLAGMulticilinE2f4-VP16
Ration
A:B Protein
0.0776921 0.040419396 1.9221477 Multicilin OS=Mus musculus GN=Mcidas PE=1 SV=1
0.0044965 0.014437337 0.3114513 Transcription factor Dp-1 OS=Mus musculus GN=Tfdp1 PE=1
SV=1
0.0041482 0.009257275 0.4481021 Transcription factor E2F4 OS=Mus musculus GN=E2f4 PE=2
SV=1
0.0042856 0.00512166 0.8367652 Geminin OS=Mus musculus GN=Gmnn PE=1 SV=1
0.0034104 0.003149438 1.0828729 Transcription factor E2F5 OS=Mus musculus GN=E2f5 PE=1
SV=2
0.0035549 0.002446804 1.4528543 40S ribosomal protein S27 OS=Mus musculus GN=Rps27
PE=1 SV=3

119
2.62E-04 0.002058388 0.127278 Transcription factor Dp-2 OS=Mus musculus GN=Tfdp2 PE=1
SV=2
0.0028373 0.001996333 1.4212706 40S ribosomal protein S14 OS=Mus musculus GN=Rps14
PE=2 SV=3
0.0030912 0.001957443 1.5791894 40S ribosomal protein S27-like OS=Mus musculus GN=Rps27l
PE=2 SV=3
7.82E-04 9.91E-04 0.7895948 40S ribosomal protein S21 OS=Mus musculus GN=Rps21
PE=2 SV=1
2.02E-04 9.23E-04 0.218657 Cysteine and glycine-rich protein 2 OS=Mus musculus
GN=Csrp2 PE=1 SV=3
8.75E-04 8.08E-04 1.0828728 Homer protein homolog 3 OS=Mus musculus GN=Homer3
PE=1 SV=2
0.0011128 7.83E-04 1.4212706 60S ribosomal protein L38 OS=Mus musculus GN=Rpl38 PE=2
SV=3
7.38E-04 7.79E-04 0.9475137 40S ribosomal protein S3a OS=Mus musculus GN=Rps3a
PE=1 SV=3
0.0011846 7.50E-04 1.5791894 Peroxiredoxin-4 OS=Mus musculus GN=Prdx4 PE=1 SV=1
0.0017391 7.28E-04 2.3893822 26S protease regulatory subunit 7 OS=Mus musculus
GN=Psmc2 PE=1 SV=5
0.0015456 7.18E-04 2.1534402 BAG family molecular chaperone regulator 2 OS=Mus
musculus GN=Bag2 PE=1 SV=1
4.48E-04 7.09E-04 0.6316757 Up-regulated during skeletal muscle growth protein 5 OS=Mus
musculus GN=Usmg5 PE=1 SV=1
8.87E-04 6.65E-04 1.3335377 T-complex protein 1 subunit alpha OS=Mus musculus
GN=Tcp1 PE=1 SV=3
8.16E-04 6.15E-04 1.3265191 DNA replication factor Cdt1 OS=Mus musculus GN=Cdt1 PE=1
SV=1
7.83E-04 6.09E-04 1.2859114 Calumenin OS=Mus musculus GN=Calu PE=1 SV=1
2.71E-04 5.37E-04 0.5053407 Glutaminyl-peptide cyclotransferase-like protein OS=Mus
musculus GN=Qpctl PE=2 SV=1
0.0014393 5.27E-04 2.7310689 26S protease regulatory subunit 6A OS=Mus musculus
GN=Psmc3 PE=1 SV=2
1.25E-04 5.27E-04 0.2368784 Cysteine-rich protein 2 OS=Mus musculus GN=Crip2 PE=1
SV=1
6.45E-04 5.11E-04 1.2633517 Ubiquitin-like protein ISG15 OS=Mus musculus GN=Isg15
PE=1 SV=4
0.001611 5.00E-04 3.2215466 Interferon-induced transmembrane protein 3 OS=Mus
musculus GN=Ifitm3 PE=1 SV=1
3.42E-04 4.81E-04 0.7106353 60S acidic ribosomal protein P1 OS=Mus musculus GN=Rplp1
PE=2 SV=1
8.11E-04 4.71E-04 1.7227521 Reticulocalbin-2 OS=Mus musculus GN=Rcn2 PE=2 SV=1
0.001167 4.62E-04 2.5267032 Protein S100-A6 OS=Mus musculus GN=S100a6 PE=1 SV=3
6.58E-04 4.48E-04 1.4686462 Apoptosis-inducing factor 1, mitochondrial OS=Mus musculus
GN=Aifm1 PE=1 SV=1
0.0010917 4.36E-04 2.5041433 26S protease regulatory subunit 4 OS=Mus musculus
GN=Psmc1 PE=1 SV=1
7.88E-04 4.32E-04 1.8221417 Argininosuccinate synthase OS=Mus musculus GN=Ass1 PE=1
SV=1
0.0011803 4.26E-04 2.7696555 26S protease regulatory subunit 6B OS=Mus musculus
GN=Psmc4 PE=1 SV=2

120
0.001189 4.25E-04 2.7974213 Calcium-binding mitochondrial carrier protein Aralar1 OS=Mus
musculus GN=Slc25a12 PE=1 SV=1
2.65E-04 4.19E-04 0.6316758 Protein S100-A11 OS=Mus musculus GN=S100a11 PE=1
SV=1
0 4.18E-04 N.A. Mediator of RNA polymerase II transcription subunit 31
OS=Mus musculus GN=Med31 PE=1 SV=2
3.06E-04 4.15E-04 0.7369551 Cyclin-dependent kinase 1 OS=Mus musculus GN=Cdk1 PE=1
SV=3
9.43E-04 4.10E-04 2.3011047 Proteasome subunit alpha type-2 OS=Mus musculus
GN=Psma2 PE=1 SV=3
9.42E-04 3.87E-04 2.4364637 Proteasome subunit alpha type-7 OS=Mus musculus
GN=Psma7 PE=1 SV=1
0 3.81E-04 N.A. High mobility group protein HMGI-C OS=Mus musculus
GN=Hmga2 PE=1 SV=1
8.39E-04 3.65E-04 2.3011049 Proteasome subunit alpha type-1 OS=Mus musculus
GN=Psma1 PE=1 SV=1
0.001101 3.62E-04 3.0399395 26S proteasome non-ATPase regulatory subunit 2 OS=Mus
musculus GN=Psmd2 PE=1 SV=1
2.86E-04 3.62E-04 0.7895947 Coiled-coil-helix-coiled-coil-helix domain-containing protein 3,
mitochondrial OS=Mus musculus GN=Chchd3 PE=1 SV=1
2.70E-04 3.57E-04 0.758011 60S ribosomal protein L9 OS=Mus musculus GN=Rpl9 PE=1
SV=2
4.13E-04 3.49E-04 1.1843921 Mitochondrial 2-oxoglutarate/malate carrier protein OS=Mus
musculus GN=Slc25a11 PE=1 SV=3
7.52E-04 3.45E-04 2.1792816 DnaJ homolog subfamily A member 1 OS=Mus musculus
GN=Dnaja1 PE=1 SV=1
4.46E-04 3.43E-04 1.3028313 ADP/ATP translocase 4 OS=Mus musculus GN=Slc25a31
PE=2 SV=1
0 3.40E-04 N.A. Transcription initiation factor TFIID subunit 12 OS=Mus
musculus GN=Taf12 PE=1 SV=1
6.11E-04 3.39E-04 1.8025871 Ras GTPase-activating-like protein IQGAP1 OS=Mus musculus
GN=Iqgap1 PE=1 SV=2
7.35E-04 3.37E-04 2.1792817 26S protease regulatory subunit 8 OS=Mus musculus
GN=Psmc5 PE=1 SV=1
5.09E-04 3.36E-04 1.516022 40S ribosomal protein S5 OS=Mus musculus GN=Rps5 PE=1
SV=3
2.16E-04 3.31E-04 0.6514157 ATP-dependent RNA helicase DDX3X OS=Mus musculus
GN=Ddx3x PE=1 SV=3
6.43E-04 3.17E-04 2.0303866 Mitochondrial carrier homolog 2 OS=Mus musculus GN=Mtch2
PE=1 SV=1
4.27E-04 3.10E-04 1.3782017 Receptor-interacting serine/threonine-protein kinase 3 OS=Mus
musculus GN=Ripk3 PE=1 SV=2
3.40E-04 3.07E-04 1.1054326 T-complex protein 1 subunit beta OS=Mus musculus GN=Cct2
PE=1 SV=4
4.04E-04 2.99E-04 1.3535911 Sideroflexin-3 OS=Mus musculus GN=Sfxn3 PE=1 SV=1
8.31E-04 2.92E-04 2.8425409 26S proteasome non-ATPase regulatory subunit 11 OS=Mus
musculus GN=Psmd11 PE=1 SV=3
3.95E-04 2.90E-04 1.3620509 Bifunctional glutamate/proline--tRNA ligase OS=Mus musculus
GN=Eprs PE=1 SV=4
9.20E-04 2.85E-04 3.2215462 Proteasome subunit beta type-1 OS=Mus musculus
GN=Psmb1 PE=1 SV=1

121
6.61E-04 2.84E-04 2.3257154 26S proteasome non-ATPase regulatory subunit 3 OS=Mus
musculus GN=Psmd3 PE=1 SV=3
8.08E-04 2.84E-04 2.8425409 Proteasome subunit alpha type-5 OS=Mus musculus
GN=Psma5 PE=1 SV=1
7.39E-04 2.78E-04 2.6530383 Proteasome subunit alpha type-6 OS=Mus musculus
GN=Psma6 PE=1 SV=1
4.05E-04 2.77E-04 1.4643393 T-complex protein 1 subunit gamma OS=Mus musculus
GN=Cct3 PE=1 SV=1
0 2.73E-04 N.A. Retinol-binding protein 4 OS=Mus musculus GN=Rbp4 PE=2
SV=2
0 2.72E-04 N.A. Actin-related protein 2/3 complex subunit 5 OS=Mus musculus
GN=Arpc5 PE=2 SV=3
4.02E-04 2.70E-04 1.4889502 Guanine nucleotide-binding protein G(i) subunit alpha-2
OS=Mus musculus GN=Gnai2 PE=1 SV=5
2.55E-04 2.69E-04 0.9475137 Eukaryotic translation initiation factor 5A-2 OS=Mus musculus
GN=Eif5a2 PE=2 SV=3
0.0012294 2.60E-04 4.7375684 Proteasome subunit beta type-5 OS=Mus musculus
GN=Psmb5 PE=1 SV=3
3.01E-04 2.54E-04 1.1843921 GTP-binding nuclear protein Ran, testis-specific isoform
OS=Mus musculus GN=Rasl2-9 PE=2 SV=1
1.19E-04 2.51E-04 0.4737568 rRNA 2'-O-methyltransferase fibrillarin OS=Mus musculus
GN=Fbl PE=2 SV=2
1.66E-04 2.45E-04 0.6767955 Polymerase I and transcript release factor OS=Mus musculus
GN=Ptrf PE=1 SV=1
0 2.45E-04 N.A. Transcription elongation factor B polypeptide 1 OS=Mus
musculus GN=Tceb1 PE=1 SV=1
0 2.43E-04 N.A. Dynein light chain Tctex-type 1 OS=Mus musculus GN=Dynlt1
PE=1 SV=1
1.58E-04 2.37E-04 0.6632596 Galectin-3-binding protein OS=Mus musculus GN=Lgals3bp
PE=1 SV=1
1.31E-04 2.31E-04 0.5685082 60S ribosomal protein L5 OS=Mus musculus GN=Rpl5 PE=1
SV=3
1.40E-04 2.30E-04 0.6091159 Transcription intermediary factor 1-beta OS=Mus musculus
GN=Trim28 PE=1 SV=3
2.54E-04 2.30E-04 1.1054326 DnaJ homolog subfamily B member 11 OS=Mus musculus
GN=Dnajb11 PE=1 SV=1
2.13E-04 2.25E-04 0.9475136 60S ribosomal protein L22-like 1 OS=Mus musculus
GN=Rpl22l1 PE=1 SV=1
7.02E-05 2.22E-04 0.3158379 Phosphoserine aminotransferase OS=Mus musculus
GN=Psat1 PE=1 SV=1
0 2.21E-04 N.A. 14 kDa phosphohistidine phosphatase OS=Mus musculus
GN=Phpt1 PE=2 SV=1
7.25E-04 2.19E-04 3.3162981 26S proteasome non-ATPase regulatory subunit 13 OS=Mus
musculus GN=Psmd13 PE=1 SV=1
2.06E-04 2.17E-04 0.9475137 Small nuclear ribonucleoprotein Sm D3 OS=Mus musculus
GN=Snrpd3 PE=1 SV=1
0 2.17E-04 N.A. Serine/threonine-protein kinase RIO1 OS=Mus musculus
GN=Riok1 PE=2 SV=2
2.57E-04 2.17E-04 1.1843921 Mitochondrial inner membrane protein OS=Mus musculus
GN=Immt PE=1 SV=1
0 2.12E-04 N.A. 28S ribosomal protein S15, mitochondrial OS=Mus musculus
GN=Mrps15 PE=2 SV=2

122
3.53E-04 2.09E-04 1.6844688
Serine/threonine-protein phosphatase 2A 65 kDa regulatory
subunit A alpha isoform OS=Mus musculus GN=Ppp2r1a PE=1
SV=3
2.44E-04 2.06E-04 1.1843921 T-complex protein 1 subunit zeta OS=Mus musculus GN=Cct6a
PE=1 SV=3
3.71E-04 2.06E-04 1.800276 Succinate dehydrogenase [ubiquinone] flavoprotein subunit,
mitochondrial OS=Mus musculus GN=Sdha PE=1 SV=1
2.90E-04 2.04E-04 1.4212706 Surfeit locus protein 4 OS=Mus musculus GN=Surf4 PE=2
SV=1
2.65E-04 2.03E-04 1.3028313 T-complex protein 1 subunit delta OS=Mus musculus GN=Cct4
PE=1 SV=3
3.42E-04 2.03E-04 1.6844688 Dolichyl-diphosphooligosaccharide--protein glycosyltransferase
subunit 1 OS=Mus musculus GN=Rpn1 PE=1 SV=1
4.16E-04 2.02E-04 2.0529463 Eukaryotic initiation factor 4A-I OS=Mus musculus GN=Eif4a1
PE=1 SV=1
7.64E-05 2.02E-04 0.3790055 Erlin-2 OS=Mus musculus GN=Erlin2 PE=1 SV=1
1.90E-04 2.01E-04 0.9475137 Fragile X mental retardation protein 1 homolog OS=Mus
musculus GN=Fmr1 PE=1 SV=1
3.79E-04 2.00E-04 1.8950274 T-complex protein 1 subunit theta OS=Mus musculus GN=Cct8
PE=1 SV=3
1.38E-04 1.94E-04 0.7106353 Succinate dehydrogenase [ubiquinone] iron-sulfur subunit,
mitochondrial OS=Mus musculus GN=Sdhb PE=1 SV=1
3.67E-04 1.94E-04 1.8950274 ER lumen protein retaining receptor 2 OS=Mus musculus
GN=Kdelr2 PE=2 SV=1
0 1.91E-04 N.A. Unconventional myosin-Id OS=Mus musculus GN=Myo1d
PE=1 SV=1
9.47E-04 1.90E-04 4.9744467 Serine/threonine-protein phosphatase PGAM5, mitochondrial
OS=Mus musculus GN=Pgam5 PE=2 SV=1
6.31E-04 1.90E-04 3.3162979 Interferon-induced transmembrane protein 2 OS=Mus
musculus GN=Ifitm2 PE=1 SV=1
0 1.90E-04 N.A. 6-pyruvoyl tetrahydrobiopterin synthase OS=Mus musculus
GN=Pts PE=2 SV=2
5.72E-04 1.87E-04 3.0611983 26S proteasome non-ATPase regulatory subunit 1 OS=Mus
musculus GN=Psmd1 PE=1 SV=1
3.08E-04 1.86E-04 1.6581489 Voltage-dependent anion-selective channel protein 2 OS=Mus
musculus GN=Vdac2 PE=1 SV=2
0 1.84E-04 N.A. Mediator of RNA polymerase II transcription subunit 25
OS=Mus musculus GN=Med25 PE=1 SV=1
4.80E-04 1.82E-04 2.6319827 Calcium-binding mitochondrial carrier protein Aralar2 OS=Mus
musculus GN=Slc25a13 PE=1 SV=1
1.04E-04 1.82E-04 0.5685082 Alpha-centractin OS=Mus musculus GN=Actr1a PE=2 SV=1
1.53E-04 1.82E-04 0.8422343 Fragile X mental retardation syndrome-related protein 1
OS=Mus musculus GN=Fxr1 PE=1 SV=2
0.0016701 1.81E-04 9.222466 Retinoblastoma-like protein 2 OS=Mus musculus GN=Rbl2
PE=1 SV=3
8.54E-05 1.80E-04 0.4737569 RuvB-like 1 OS=Mus musculus GN=Ruvbl1 PE=1 SV=1
0 1.80E-04 N.A. Serine/threonine-protein phosphatase 6 catalytic subunit
OS=Mus musculus GN=Ppp6c PE=2 SV=1
0 1.79E-04 N.A. Actin-related protein 2/3 complex subunit 5-like protein
OS=Mus musculus GN=Arpc5l PE=1 SV=1

123
4.22E-04 1.78E-04 2.3687842 Golgi-associated plant pathogenesis-related protein 1 OS=Mus
musculus GN=Glipr2 PE=2 SV=3
1.21E-04 1.71E-04 0.7106353
Dihydrolipoyllysine-residue acetyltransferase component of
pyruvate dehydrogenase complex, mitochondrial OS=Mus
musculus GN=Dlat PE=1 SV=2
1.08E-04 1.71E-04 0.6316758 Kinesin-1 heavy chain OS=Mus musculus GN=Kif5b PE=1
SV=3
1.35E-04 1.71E-04 0.7895947 Histone deacetylase 1 OS=Mus musculus GN=Hdac1 PE=1
SV=1
0 1.69E-04 N.A. Caveolin-2 OS=Mus musculus GN=Cav2 PE=1 SV=1
1.33E-04 1.68E-04 0.7895947 Histone deacetylase 2 OS=Mus musculus GN=Hdac2 PE=1
SV=1
9.48E-05 1.67E-04 0.5685082 Eukaryotic initiation factor 4A-III OS=Mus musculus GN=Eif4a3
PE=2 SV=3
1.57E-04 1.66E-04 0.9475137 Putative ATP-dependent RNA helicase Pl10 OS=Mus musculus
GN=D1Pas1 PE=2 SV=1
0 1.66E-04 N.A. 40S ribosomal protein S10 OS=Mus musculus GN=Rps10
PE=1 SV=1
3.12E-04 1.64E-04 1.8950274 Proteasome subunit alpha type-7-like OS=Mus musculus
GN=Psma8 PE=2 SV=1
1.77E-04 1.64E-04 1.0828727 Heterogeneous nuclear ribonucleoprotein L OS=Mus musculus
GN=Hnrnpl PE=1 SV=2
0 1.60E-04 N.A. Eukaryotic translation initiation factor 2-alpha kinase 3 OS=Mus
musculus GN=Eif2ak3 PE=1 SV=1
0 1.59E-04 N.A. Translationally-controlled tumor protein OS=Mus musculus
GN=Tpt1 PE=1 SV=1
0 1.57E-04 N.A. Eukaryotic translation initiation factor 4B OS=Mus musculus
GN=Eif4b PE=1 SV=1
3.57E-04 1.57E-04 2.2740327 Coatomer subunit gamma-1 OS=Mus musculus GN=Copg1
PE=2 SV=1
7.42E-05 1.57E-04 0.4737569 Serine-threonine kinase receptor-associated protein OS=Mus
musculus GN=Strap PE=1 SV=2
1.69E-04 1.56E-04 1.0828728 Lipoma-preferred partner homolog OS=Mus musculus GN=Lpp
PE=1 SV=1
1.10E-04 1.55E-04 0.7106353 Guanine nucleotide-binding protein G(i) subunit alpha-1
OS=Mus musculus GN=Gnai1 PE=2 SV=1
0 1.53E-04 N.A. Integral membrane protein 2C OS=Mus musculus GN=Itm2c
PE=2 SV=2
2.87E-04 1.51E-04 1.8950274 ADP-ribosylation factor-like protein 1 OS=Mus musculus
GN=Arl1 PE=2 SV=1
9.56E-05 1.51E-04 0.6316758 EH domain-containing protein 2 OS=Mus musculus GN=Ehd2
PE=1 SV=1
4.84E-04 1.50E-04 3.2215467 26S proteasome non-ATPase regulatory subunit 12 OS=Mus
musculus GN=Psmd12 PE=1 SV=4
1.71E-04 1.50E-04 1.1370165 Ribonuclease inhibitor OS=Mus musculus GN=Rnh1 PE=1
SV=1
1.78E-04 1.50E-04 1.1843921 DnaJ homolog subfamily B member 6 OS=Mus musculus
GN=Dnajb6 PE=1 SV=4
4.97E-04 1.50E-04 3.3162981 Chromobox protein homolog 3 OS=Mus musculus GN=Cbx3
PE=1 SV=2
9.24E-05 1.46E-04 0.6316758 Elongation factor 1-delta OS=Mus musculus GN=Eef1d PE=1
SV=3

124
1.04E-04 1.46E-04 0.7106353 Beta-centractin OS=Mus musculus GN=Actr1b PE=1 SV=1
4.60E-05 1.46E-04 0.3158379 Poly(U)-binding-splicing factor PUF60 OS=Mus musculus
GN=Puf60 PE=2 SV=2
2.97E-04 1.46E-04 2.0407987 Coatomer subunit alpha OS=Mus musculus GN=Copa PE=1
SV=2
2.75E-04 1.45E-04 1.8950275 S-methyl-5'-thioadenosine phosphorylase OS=Mus musculus
GN=Mtap PE=1 SV=1
0 1.45E-04 N.A. Non-POU domain-containing octamer-binding protein OS=Mus
musculus GN=Nono PE=1 SV=3
0 1.45E-04 N.A. Hsp90 co-chaperone Cdc37 OS=Mus musculus GN=Cdc37
PE=2 SV=1
1.35E-04 1.43E-04 0.9475136 Apoptosis regulator BAX OS=Mus musculus GN=Bax PE=1
SV=1
1.32E-04 1.39E-04 0.9475137 UDP-glucose 6-dehydrogenase OS=Mus musculus GN=Ugdh
PE=1 SV=1
7.75E-04 1.36E-04 5.6850823 Proteasome subunit beta type-2 OS=Mus musculus
GN=Psmb2 PE=1 SV=1
0 1.36E-04 N.A. Dynactin subunit 2 OS=Mus musculus GN=Dctn2 PE=1 SV=3
2.23E-04 1.35E-04 1.658149 Eukaryotic initiation factor 4A-II OS=Mus musculus GN=Eif4a2
PE=2 SV=2
5.99E-04 1.33E-04 4.5006902 DnaJ homolog subfamily A member 2 OS=Mus musculus
GN=Dnaja2 PE=1 SV=1
3.15E-04 1.33E-04 2.3687841 Ras-related protein Rab-18 OS=Mus musculus GN=Rab18
PE=2 SV=2
0 1.31E-04 N.A. Heterogeneous nuclear ribonucleoproteins C1/C2 OS=Mus
musculus GN=Hnrnpc PE=1 SV=1
3.48E-04 1.31E-04 2.6530383 Sarcoplasmic/endoplasmic reticulum calcium ATPase 2
OS=Mus musculus GN=Atp2a2 PE=1 SV=2
3.00E-04 1.29E-04 2.3161444 Coatomer subunit beta OS=Mus musculus GN=Copb1 PE=1
SV=1
7.29E-05 1.28E-04 0.5685082 Prolyl 4-hydroxylase subunit alpha-1 OS=Mus musculus
GN=P4ha1 PE=2 SV=2
0.0010516 1.28E-04 8.2117858 26S proteasome non-ATPase regulatory subunit 7 OS=Mus
musculus GN=Psmd7 PE=1 SV=2
1.21E-04 1.27E-04 0.9475137 Serine/threonine-protein phosphatase PP1-gamma catalytic
subunit OS=Mus musculus GN=Ppp1cc PE=1 SV=1
1.20E-04 1.27E-04 0.9475137 T-complex protein 1 subunit epsilon OS=Mus musculus
GN=Cct5 PE=1 SV=1
0 1.26E-04 N.A. Membrane-associated progesterone receptor component 2
OS=Mus musculus GN=Pgrmc2 PE=1 SV=2
1.19E-04 1.26E-04 0.9475137 Serine/threonine-protein phosphatase PP1-beta catalytic
subunit OS=Mus musculus GN=Ppp1cb PE=1 SV=3
1.18E-04 1.25E-04 0.9475136 Serine/threonine-protein phosphatase PP1-alpha catalytic
subunit OS=Mus musculus GN=Ppp1ca PE=1 SV=1
0 1.24E-04 N.A. Matrix-remodeling-associated protein 8 OS=Mus musculus
GN=Mxra8 PE=2 SV=1
5.81E-05 1.23E-04 0.4737568
Serine/threonine-protein phosphatase 2A 55 kDa regulatory
subunit B gamma isoform OS=Mus musculus GN=Ppp2r2c
PE=2 SV=1
3.30E-05 1.22E-04 0.2707182 Pyridoxal-dependent decarboxylase domain-containing protein
1 OS=Mus musculus GN=Pdxdc1 PE=1 SV=2

125
1.83E-04 1.21E-04 1.5160217 Sentrin-specific protease 3 OS=Mus musculus GN=Senp3
PE=1 SV=1
0 1.20E-04 N.A. Glucose-induced degradation protein 8 homolog OS=Mus
musculus GN=Gid8 PE=2 SV=1
8.94E-05 1.18E-04 0.7580109 Peptidyl-prolyl cis-trans isomerase FKBP10 OS=Mus musculus
GN=Fkbp10 PE=1 SV=2
0 1.17E-04 N.A. Twinfilin-1 OS=Mus musculus GN=Twf1 PE=1 SV=2
0 1.17E-04 N.A. Integrin alpha-3 OS=Mus musculus GN=Itga3 PE=1 SV=1
1.47E-04 1.16E-04 1.2633515 26S proteasome non-ATPase regulatory subunit 8 OS=Mus
musculus GN=Psmd8 PE=1 SV=2
0 1.16E-04 N.A. Drebrin OS=Mus musculus GN=Dbn1 PE=1 SV=4
1.10E-04 1.16E-04 0.9475137 Guanine nucleotide-binding protein G(k) subunit alpha OS=Mus
musculus GN=Gnai3 PE=1 SV=3
3.82E-04 1.15E-04 3.3162977 Proteasome subunit beta type-6 OS=Mus musculus
GN=Psmb6 PE=1 SV=3
2.73E-04 1.15E-04 2.3687843 Protein transport protein Sec61 subunit alpha isoform 1
OS=Mus musculus GN=Sec61a1 PE=2 SV=2
1.57E-04 1.15E-04 1.3605324 Cytoplasmic dynein 1 heavy chain 1 OS=Mus musculus
GN=Dync1h1 PE=1 SV=2
9.39E-05 1.13E-04 0.8290745 Alanine--tRNA ligase, cytoplasmic OS=Mus musculus GN=Aars
PE=1 SV=1
1.42E-04 1.12E-04 1.2633517 Homer protein homolog 1 OS=Mus musculus GN=Homer1
PE=1 SV=2
1.06E-04 1.12E-04 0.9475137 Probable ATP-dependent RNA helicase DDX5 OS=Mus
musculus GN=Ddx5 PE=1 SV=2
7.00E-05 1.11E-04 0.6316758 Protein arginine N-methyltransferase 1 OS=Mus musculus
GN=Prmt1 PE=1 SV=1
1.04E-04 1.10E-04 0.9475137 WD repeat-containing protein 76 OS=Mus musculus
GN=Wdr76 PE=2 SV=1
6.92E-05 1.10E-04 0.6316757 Nucleosome assembly protein 1-like 4 OS=Mus musculus
GN=Nap1l4 PE=1 SV=1
6.62E-04 1.07E-04 6.1588389 Proteasome subunit alpha type-3 OS=Mus musculus
GN=Psma3 PE=1 SV=3
3.05E-04 1.07E-04 2.842541 Coatomer subunit delta OS=Mus musculus GN=Arcn1 PE=1
SV=2
1.18E-04 1.04E-04 1.1370164 ATP-dependent RNA helicase DDX3Y OS=Mus musculus
GN=Ddx3y PE=1 SV=2
3.93E-04 1.04E-04 3.790055 Proteasome subunit beta type-4 OS=Mus musculus
GN=Psmb4 PE=1 SV=1
5.90E-05 1.04E-04 0.5685082 Arginine--tRNA ligase, cytoplasmic OS=Mus musculus
GN=Rars PE=2 SV=2
9.76E-05 1.03E-04 0.9475137 Integral membrane protein 2B OS=Mus musculus GN=Itm2b
PE=2 SV=1
9.41E-05 9.93E-05 0.9475137 TAR DNA-binding protein 43 OS=Mus musculus GN=Tardbp
PE=1 SV=1
0 9.91E-05 N.A. Lupus La protein homolog OS=Mus musculus GN=Ssb PE=1
SV=1
0 9.88E-05 N.A. Prostate tumor-overexpressed gene 1 protein homolog
OS=Mus musculus GN=Ptov1 PE=2 SV=1
2.29E-04 9.68E-05 2.3687843 Voltage-dependent anion-selective channel protein 3 OS=Mus
musculus GN=Vdac3 PE=1 SV=1

126
2.27E-04 9.58E-05 2.3687842 Translocon-associated protein subunit alpha OS=Mus
musculus GN=Ssr1 PE=1 SV=1
1.34E-04 9.45E-05 1.4212705 Enoyl-CoA hydratase, mitochondrial OS=Mus musculus
GN=Echs1 PE=1 SV=1
2.22E-04 9.39E-05 2.3687843 Importin subunit beta-1 OS=Mus musculus GN=Kpnb1 PE=1
SV=2
6.59E-05 9.27E-05 0.7106353 PDZ and LIM domain protein 5 OS=Mus musculus GN=Pdlim5
PE=1 SV=4
8.57E-05 9.04E-05 0.9475137 Cyclin-dependent kinase 3 OS=Mus musculus GN=Cdk3 PE=1
SV=2
2.53E-04 8.90E-05 2.8425408 Very-long-chain enoyl-CoA reductase OS=Mus musculus
GN=Tecr PE=1 SV=1
4.19E-04 8.84E-05 4.7375685 26S proteasome non-ATPase regulatory subunit 14 OS=Mus
musculus GN=Psmd14 PE=1 SV=2
0 8.75E-05 N.A. Protein MAATS1 OS=Mus musculus GN=Maats1 PE=2 SV=3
0 8.73E-05 N.A. rRNA/tRNA 2'-O-methyltransferase fibrillarin-like protein 1
OS=Mus musculus GN=Fbll1 PE=2 SV=1
4.12E-05 8.69E-05 0.4737568 Tumor protein p73 OS=Mus musculus GN=Tp73 PE=1 SV=1
2.74E-04 8.62E-05 3.1809386 CAD protein OS=Mus musculus GN=Cad PE=2 SV=1
0 8.62E-05 N.A. Eukaryotic peptide chain release factor GTP-binding subunit
ERF3A OS=Mus musculus GN=Gspt1 PE=1 SV=2
2.40E-04 8.43E-05 2.8425409 Reticulocalbin-1 OS=Mus musculus GN=Rcn1 PE=1 SV=1
0 8.41E-05 N.A. ELAV-like protein 1 OS=Mus musculus GN=Elavl1 PE=1 SV=2
0 8.20E-05 N.A. L-lactate dehydrogenase B chain OS=Mus musculus GN=Ldhb
PE=1 SV=2
0 8.19E-05 N.A. Putative helicase MOV-10 OS=Mus musculus GN=Mov10
PE=1 SV=2
4.61E-05 8.12E-05 0.5685082 Serine/threonine-protein phosphatase 6 regulatory subunit 3
OS=Mus musculus GN=Ppp6r3 PE=1 SV=1
7.67E-05 8.10E-05 0.9475137 Matrin-3 OS=Mus musculus GN=Matr3 PE=1 SV=1
2.04E-04 8.09E-05 2.5267032 Phenylalanine--tRNA ligase alpha subunit OS=Mus musculus
GN=Farsa PE=2 SV=1
1.52E-04 8.04E-05 1.8950273 Sodium/potassium-transporting ATPase subunit alpha-1
OS=Mus musculus GN=Atp1a1 PE=1 SV=1
7.50E-05 7.92E-05 0.9475137 Cyclin-dependent kinase 2 OS=Mus musculus GN=Cdk2 PE=1
SV=2
0 7.92E-05 N.A. Erlin-1 OS=Mus musculus GN=Erlin1 PE=1 SV=1
1.49E-04 7.84E-05 1.8950274 FERM, RhoGEF and pleckstrin domain-containing protein 1
OS=Mus musculus GN=Farp1 PE=1 SV=1
0 7.76E-05 N.A. Heterogeneous nuclear ribonucleoproteins A2/B1 OS=Mus
musculus GN=Hnrnpa2b1 PE=1 SV=2
7.33E-05 7.74E-05 0.9475137 Guanine nucleotide-binding protein G(o) subunit alpha OS=Mus
musculus GN=Gnao1 PE=1 SV=3
7.33E-05 7.74E-05 0.9475137 Homer protein homolog 2 OS=Mus musculus GN=Homer2
PE=1 SV=1
0 7.67E-05 N.A. Nucleolar protein 58 OS=Mus musculus GN=Nop58 PE=1
SV=1
1.08E-04 7.59E-05 1.4212705 45 kDa calcium-binding protein OS=Mus musculus GN=Sdf4
PE=2 SV=1
7.19E-05 7.59E-05 0.9475136 Septin-2 OS=Mus musculus GN=Sept2 PE=1 SV=2

127
0 7.58E-05 N.A. F-box/WD repeat-containing protein 11 OS=Mus musculus
GN=Fbxw11 PE=1 SV=1
7.73E-05 7.14E-05 1.0828728 Myb-binding protein 1A OS=Mus musculus GN=Mybbp1a PE=1
SV=2
0 7.11E-05 N.A. Sperm flagellar protein 2 OS=Mus musculus GN=Spef2 PE=2
SV=2
1.10E-04 6.96E-05 1.5791895 ATPase family AAA domain-containing protein 3 OS=Mus
musculus GN=Atad3 PE=1 SV=1
6.59E-05 6.96E-05 0.9475137 Guanine nucleotide-binding protein G(s) subunit alpha isoforms
short OS=Mus musculus GN=Gnas PE=1 SV=1
9.74E-05 6.85E-05 1.4212705 Transmembrane protein 43 OS=Mus musculus GN=Tmem43
PE=1 SV=1
0 6.79E-05 N.A. F-box/WD repeat-containing protein 1A OS=Mus musculus
GN=Btrc PE=1 SV=2
0 6.67E-05 N.A.
SWI/SNF-related matrix-associated actin-dependent regulator
of chromatin subfamily E member 1 OS=Mus musculus
GN=Smarce1 PE=1 SV=1
6.12E-05 6.46E-05 0.9475137 Histone deacetylase 3 OS=Mus musculus GN=Hdac3 PE=1
SV=1
6.05E-05 6.39E-05 0.9475137 Heat shock protein 105 kDa OS=Mus musculus GN=Hsph1
PE=1 SV=2
0 6.19E-05 N.A. OTU domain-containing protein 4 OS=Mus musculus
GN=Otud4 PE=1 SV=1
3.86E-05 6.11E-05 0.6316758 Annexin A6 OS=Mus musculus GN=Anxa6 PE=1 SV=3
4.62E-05 6.10E-05 0.7580109 Regulator of nonsense transcripts 1 OS=Mus musculus
GN=Upf1 PE=1 SV=2
0 6.09E-05 N.A. Sulfide:quinone oxidoreductase, mitochondrial OS=Mus
musculus GN=Sqrdl PE=1 SV=3
2.01E-04 6.06E-05 3.3162978 Coatomer subunit beta' OS=Mus musculus GN=Copb2 PE=2
SV=2
2.87E-04 6.05E-05 4.7375685 Cytochrome b-c1 complex subunit 2, mitochondrial OS=Mus
musculus GN=Uqcrc2 PE=1 SV=1
0 6.04E-05 N.A.
Dihydrolipoyllysine-residue succinyltransferase component of
2-oxoglutarate dehydrogenase complex, mitochondrial
OS=Mus musculus GN=Dlst PE=1 SV=1
0 5.92E-05 N.A. Unconventional myosin-Va OS=Mus musculus GN=Myo5a
PE=1 SV=2
8.30E-05 5.84E-05 1.4212705 Sorting and assembly machinery component 50 homolog
OS=Mus musculus GN=Samm50 PE=1 SV=1
0 5.64E-05 N.A. Leucine-rich repeat flightless-interacting protein 1 OS=Mus
musculus GN=Lrrfip1 PE=1 SV=2
7.90E-05 5.56E-05 1.4212705 Fascin OS=Mus musculus GN=Fscn1 PE=1 SV=4
5.20E-05 5.49E-05 0.9475137 Calcium/calmodulin-dependent protein kinase type II subunit
delta OS=Mus musculus GN=Camk2d PE=1 SV=1
7.71E-05 5.43E-05 1.4212706 tRNA-splicing ligase RtcB homolog OS=Mus musculus
GN=Rtcb PE=2 SV=1
0 5.39E-05 N.A. General transcription factor IIF subunit 1 OS=Mus musculus
GN=Gtf2f1 PE=1 SV=2
1.50E-04 5.27E-05 2.8425414 Hydroxymethylglutaryl-CoA synthase, cytoplasmic OS=Mus
musculus GN=Hmgcs1 PE=1 SV=1
9.97E-05 5.26E-05 1.8950274 Importin subunit alpha-3 OS=Mus musculus GN=Kpna4 PE=1
SV=1

128
4.91E-05 5.18E-05 0.9475137 Calcium/calmodulin-dependent protein kinase type II subunit
gamma OS=Mus musculus GN=Camk2g PE=1 SV=1
7.29E-05 5.13E-05 1.4212706 EH domain-containing protein 1 OS=Mus musculus GN=Ehd1
PE=1 SV=1
4.79E-05 5.06E-05 0.9475137 Calcium/calmodulin-dependent protein kinase type II subunit
beta OS=Mus musculus GN=Camk2b PE=1 SV=2
9.51E-05 5.02E-05 1.8950273 Src substrate cortactin OS=Mus musculus GN=Cttn PE=1
SV=2
5.84E-05 4.93E-05 1.1843921 Constitutive coactivator of PPAR-gamma-like protein 1
OS=Mus musculus GN=FAM120A PE=1 SV=2
0 4.85E-05 N.A. Filamin A-interacting protein 1-like OS=Mus musculus
GN=Filip1l PE=1 SV=2
1.12E-04 4.72E-05 2.3687842 Nucleolar protein 56 OS=Mus musculus GN=Nop56 PE=1
SV=2
1.78E-04 4.71E-05 3.7900547 Matrix metalloproteinase-14 OS=Mus musculus GN=Mmp14
PE=2 SV=3
0 4.63E-05 N.A. Collagen alpha-1(XVIII) chain OS=Mus musculus GN=Col18a1
PE=1 SV=4
6.54E-05 4.31E-05 1.5160218 Centrosomal protein of 170 kDa OS=Mus musculus
GN=Cep170 PE=1 SV=2
4.04E-05 4.27E-05 0.9475136 A-kinase anchor protein 8-like OS=Mus musculus GN=Akap8l
PE=1 SV=1
5.99E-05 4.22E-05 1.4212704 Probable ATP-dependent RNA helicase DDX17 OS=Mus
musculus GN=Ddx17 PE=2 SV=1
3.86E-05 4.07E-05 0.9475137 Fragile X mental retardation syndrome-related protein 2
OS=Mus musculus GN=Fxr2 PE=1 SV=1
0 4.01E-05 N.A. Unconventional myosin-XVIIIa OS=Mus musculus GN=Myo18a
PE=1 SV=2
8.73E-05 3.95E-05 2.2108652 Importin-9 OS=Mus musculus GN=Ipo9 PE=1 SV=3
0 3.94E-05 N.A. Unconventional myosin-Ia OS=Mus musculus GN=Myo1a
PE=2 SV=2
2.48E-05 3.93E-05 0.6316758
UDP-N-acetylglucosamine--peptide Nacetylglucosaminyltransferase 110 kDa subunit OS=Mus
musculus GN=Ogt PE=1 SV=2
2.45E-05 3.89E-05 0.6316759 Ubiquitin-like modifier-activating enzyme 1 OS=Mus musculus
GN=Uba1 PE=1 SV=1
9.70E-05 3.84E-05 2.5267031 Exportin-1 OS=Mus musculus GN=Xpo1 PE=1 SV=1
0 3.78E-05 N.A. Pericentrin OS=Mus musculus GN=Pcnt PE=1 SV=2
6.88E-05 3.63E-05 1.8950275 Cartilage oligomeric matrix protein OS=Mus musculus
GN=Comp PE=1 SV=2
2.27E-05 3.59E-05 0.6316758 Cell division cycle and apoptosis regulator protein 1 OS=Mus
musculus GN=Ccar1 PE=1 SV=1
0 3.52E-05 N.A. Ankyrin repeat and FYVE domain-containing protein 1 OS=Mus
musculus GN=Ankfy1 PE=2 SV=2
8.05E-05 3.40E-05 2.3687843 Transitional endoplasmic reticulum ATPase OS=Mus musculus
GN=Vcp PE=1 SV=4
3.58E-05 3.24E-05 1.1054326 Talin-1 OS=Mus musculus GN=Tln1 PE=1 SV=2
0 3.19E-05 N.A. Protein argonaute-2 OS=Mus musculus GN=Ago2 PE=1 SV=3
8.95E-05 3.15E-05 2.8425411 Dynamin-2 OS=Mus musculus GN=Dnm2 PE=1 SV=2
4.47E-05 3.15E-05 1.4212706 Coatomer subunit gamma-2 OS=Mus musculus GN=Copg2
PE=2 SV=1

129
0 3.01E-05 N.A. CDK5 regulatory subunit-associated protein 2 OS=Mus
musculus GN=Cdk5rap2 PE=1 SV=3
2.82E-05 2.98E-05 0.9475137 ATP-dependent RNA helicase A OS=Mus musculus GN=Dhx9
PE=1 SV=2
0 2.95E-05 N.A. RNA-binding protein 10 OS=Mus musculus GN=Rbm10 PE=1
SV=1
8.84E-05 2.94E-05 3.0004601 E3 ubiquitin-protein ligase UBR5 OS=Mus musculus GN=Ubr5
PE=1 SV=2
5.43E-05 2.87E-05 1.8950273 Thrombospondin-3 OS=Mus musculus GN=Thbs3 PE=1 SV=2
2.72E-05 2.87E-05 0.9475136 Kinesin heavy chain isoform 5C OS=Mus musculus GN=Kif5c
PE=1 SV=3
5.39E-05 2.85E-05 1.8950274 Thrombospondin-4 OS=Mus musculus GN=Thbs4 PE=1 SV=1
1.76E-05 2.78E-05 0.6316757 Zinc finger protein 518A OS=Mus musculus GN=Znf518a PE=2
SV=1
2.59E-05 2.73E-05 0.9475137 E3 ubiquitin-protein ligase NEDD4-like OS=Mus musculus
GN=Nedd4l PE=1 SV=2
8.97E-05 2.71E-05 3.3162975 Sodium/potassium-transporting ATPase subunit alpha-3
OS=Mus musculus GN=Atp1a3 PE=1 SV=1
8.91E-05 2.69E-05 3.3162977 Sodium/potassium-transporting ATPase subunit alpha-2
OS=Mus musculus GN=Atp1a2 PE=1 SV=1
2.53E-05 2.67E-05 0.9475137 Kinesin heavy chain isoform 5A OS=Mus musculus GN=Kif5a
PE=1 SV=3
2.52E-05 2.66E-05 0.9475137 Sodium/potassium-transporting ATPase subunit alpha-4
OS=Mus musculus GN=Atp1a4 PE=1 SV=3
7.54E-05 2.65E-05 2.8425411 Potassium-transporting ATPase alpha chain 1 OS=Mus
musculus GN=Atp4a PE=1 SV=3
2.51E-05 2.65E-05 0.9475137 Potassium-transporting ATPase alpha chain 2 OS=Mus
musculus GN=Atp12a PE=1 SV=3
2.29E-05 2.42E-05 0.9475137 Guanine nucleotide-binding protein G(s) subunit alpha isoforms
XLas OS=Mus musculus GN=Gnas PE=2 SV=1
5.54E-05 2.34E-05 2.3687845 Thrombospondin-2 OS=Mus musculus GN=Thbs2 PE=1 SV=2
5.51E-05 2.33E-05 2.3687841 Leucine--tRNA ligase, cytoplasmic OS=Mus musculus
GN=Lars PE=1 SV=2
7.78E-05 2.19E-05 3.5531762 Fatty acid synthase OS=Mus musculus GN=Fasn PE=1 SV=2
4.10E-05 2.16E-05 1.8950274 Vigilin OS=Mus musculus GN=Hdlbp PE=1 SV=1
5.07E-05 2.14E-05 2.3687844 Dynactin subunit 1 OS=Mus musculus GN=Dctn1 PE=1 SV=3
0 1.95E-05 N.A. Enhancer of mRNA-decapping protein 4 OS=Mus musculus
GN=Edc4 PE=1 SV=2
1.22E-05 1.93E-05 0.6316759 Dedicator of cytokinesis protein 7 OS=Mus musculus
GN=Dock7 PE=1 SV=3
0 1.74E-05 N.A. Mediator of RNA polymerase II transcription subunit 1 OS=Mus
musculus GN=Med1 PE=1 SV=2
0 1.51E-05 N.A. Trinucleotide repeat-containing gene 6B protein OS=Mus
musculus GN=Tnrc6b PE=2 SV=2
0 1.51E-05 N.A. Unconventional myosin-Vb OS=Mus musculus GN=Myo5b
PE=2 SV=2
1.37E-05 1.44E-05 0.9475137 Receptor-type tyrosine-protein phosphatase F OS=Mus
musculus GN=Ptprf PE=1 SV=1

130
1.36E-05 1.44E-05 0.9475137 Receptor-type tyrosine-protein phosphatase S OS=Mus
musculus GN=Ptprs PE=1 SV=1
1.36E-05 1.43E-05 0.9475137 Receptor-type tyrosine-protein phosphatase delta OS=Mus
musculus GN=Ptprd PE=1 SV=3
0 1.29E-05 N.A. Spectrin beta chain, erythrocytic OS=Mus musculus GN=Sptb
PE=1 SV=4
4.57E-05 1.21E-05 3.7900546 Prolow-density lipoprotein receptor-related protein 1 OS=Mus
musculus GN=Lrp1 PE=1 SV=1
8.68E-04 0 N.A. 26S proteasome non-ATPase regulatory subunit 6 OS=Mus
musculus GN=Psmd6 PE=1 SV=1
5.87E-04 0 N.A. Sequestosome-1 OS=Mus musculus GN=Sqstm1 PE=1 SV=1
4.97E-04 0 N.A. Ferritin light chain 1 OS=Mus musculus GN=Ftl1 PE=1 SV=2
4.73E-04 0 N.A. Myeloid leukemia factor 2 OS=Mus musculus GN=Mlf2 PE=1
SV=1
4.30E-04 0 N.A. SPARC OS=Mus musculus GN=Sparc PE=1 SV=1
4.02E-04 0 N.A. Protein S100-A10 OS=Mus musculus GN=S100a10 PE=1
SV=2
3.74E-04 0 N.A. Mitochondrial intermembrane space import and assembly
protein 40 OS=Mus musculus GN=Chchd4 PE=1 SV=1
3.55E-04 0 N.A. Ferritin light chain 2 OS=Mus musculus GN=Ftl2 PE=2 SV=2
3.46E-04 0 N.A. Integral membrane protein 2A OS=Mus musculus GN=Itm2a
PE=2 SV=2
3.38E-04 0 N.A. Ras-related C3 botulinum toxin substrate 1 OS=Mus musculus
GN=Rac1 PE=1 SV=1
3.30E-04 0 N.A. Myotrophin OS=Mus musculus GN=Mtpn PE=1 SV=2
3.28E-04 0 N.A. Proteasome subunit beta type-7 OS=Mus musculus
GN=Psmb7 PE=1 SV=1
3.17E-04 0 N.A. Proteasome subunit beta type-3 OS=Mus musculus
GN=Psmb3 PE=1 SV=1
2.95E-04 0 N.A. Coatomer subunit epsilon OS=Mus musculus GN=Cope PE=2
SV=3
2.79E-04 0 N.A. ADP-ribosylation factor-like protein 8A OS=Mus musculus
GN=Arl8a PE=2 SV=1
2.57E-04 0 N.A. Transcription and mRNA export factor ENY2 OS=Mus
musculus GN=Eny2 PE=2 SV=1
2.46E-04 0 N.A. Galectin-3 OS=Mus musculus GN=Lgals3 PE=1 SV=3
2.42E-04 0 N.A. ATP synthase subunit d, mitochondrial OS=Mus musculus
GN=Atp5h PE=1 SV=3
2.41E-04 0 N.A. Transmembrane protein 165 OS=Mus musculus GN=Tmem165
PE=2 SV=2
2.10E-04 0 N.A. Serine/threonine-protein phosphatase 2A catalytic subunit
alpha isoform OS=Mus musculus GN=Ppp2ca PE=1 SV=1
2.04E-04 0 N.A. cAMP-dependent protein kinase type I-alpha regulatory subunit
OS=Mus musculus GN=Prkar1a PE=1 SV=3
2.03E-04 0 N.A. ATP synthase F(0) complex subunit B1, mitochondrial OS=Mus
musculus GN=Atp5f1 PE=1 SV=1
2.02E-04 0 N.A. Thioredoxin-dependent peroxide reductase, mitochondrial
OS=Mus musculus GN=Prdx3 PE=1 SV=1
2.02E-04 0 N.A. Microfibril-associated glycoprotein 4 OS=Mus musculus
GN=Mfap4 PE=1 SV=1

131
1.90E-04 0 N.A. Cellular retinoic acid-binding protein 1 OS=Mus musculus
GN=Crabp1 PE=1 SV=2
1.85E-04 0 N.A. Peroxiredoxin-5, mitochondrial OS=Mus musculus GN=Prdx5
PE=1 SV=2
1.78E-04 0 N.A. Cytochrome b5 type B OS=Mus musculus GN=Cyb5b PE=1
SV=1
1.74E-04 0 N.A. Oligosaccharyltransferase complex subunit OSTC OS=Mus
musculus GN=Ostc PE=2 SV=1
1.69E-04 0 N.A. Prefoldin subunit 2 OS=Mus musculus GN=Pfdn2 PE=2 SV=2
1.68E-04 0 N.A. Serine/threonine-protein phosphatase 2A catalytic subunit beta
isoform OS=Mus musculus GN=Ppp2cb PE=1 SV=1
1.62E-04 0 N.A. Chloride intracellular channel protein 1 OS=Mus musculus
GN=Clic1 PE=1 SV=3
1.61E-04 0 N.A. Vitamin K epoxide reductase complex subunit 1 OS=Mus
musculus GN=Vkorc1 PE=2 SV=1
1.59E-04 0 N.A. Immunity-related GTPase family M protein 1 OS=Mus
musculus GN=Irgm1 PE=1 SV=1
1.53E-04 0 N.A. Cathepsin B OS=Mus musculus GN=Ctsb PE=1 SV=2
1.43E-04 0 N.A. Prohibitin OS=Mus musculus GN=Phb PE=1 SV=1
1.42E-04 0 N.A. Transcription factor E2F3 OS=Mus musculus GN=E2f3 PE=1
SV=2
1.41E-04 0 N.A. Ras-related protein Rap-1A OS=Mus musculus GN=Rap1a
PE=2 SV=1
1.41E-04 0 N.A. Ras-related protein Rap-1b OS=Mus musculus GN=Rap1b
PE=2 SV=2
1.41E-04 0 N.A. Transforming growth factor beta-1-induced transcript 1 protein
OS=Mus musculus GN=Tgfb1i1 PE=1 SV=2
1.40E-04 0 N.A. ADP-ribosylation factor-like protein 8B OS=Mus musculus
GN=Arl8b PE=2 SV=1
1.37E-04 0 N.A. Type 1 phosphatidylinositol 4,5-bisphosphate 4-phosphatase
OS=Mus musculus GN=Tmem55b PE=1 SV=1
1.35E-04 0 N.A. Ras-related C3 botulinum toxin substrate 3 OS=Mus musculus
GN=Rac3 PE=1 SV=1
1.35E-04 0 N.A. Ras-related C3 botulinum toxin substrate 2 OS=Mus musculus
GN=Rac2 PE=2 SV=1
1.32E-04 0 N.A. CTP synthase 1 OS=Mus musculus GN=Ctps1 PE=1 SV=2
1.32E-04 0 N.A. Voltage-dependent anion-selective channel protein 1 OS=Mus
musculus GN=Vdac1 PE=1 SV=3
1.31E-04 0 N.A. Sarcoplasmic/endoplasmic reticulum calcium ATPase 1
OS=Mus musculus GN=Atp2a1 PE=2 SV=1
1.30E-04 0 N.A. Prohibitin-2 OS=Mus musculus GN=Phb2 PE=1 SV=1
1.25E-04 0 N.A. Estradiol 17-beta-dehydrogenase 12 OS=Mus musculus
GN=Hsd17b12 PE=2 SV=1
1.25E-04 0 N.A. Calreticulin OS=Mus musculus GN=Calr PE=1 SV=1
1.24E-04 0 N.A. Glutathione S-transferase P 1 OS=Mus musculus GN=Gstp1
PE=1 SV=2
1.21E-04 0 N.A. ER lumen protein retaining receptor 3 OS=Mus musculus
GN=Kdelr3 PE=2 SV=1
1.20E-04 0 N.A. Ras-related protein Rab-11A OS=Mus musculus GN=Rab11a
PE=1 SV=3

132
1.19E-04 0 N.A. Ras-related protein Rab-11B OS=Mus musculus GN=Rab11b
PE=1 SV=3
1.19E-04 0 N.A. Plasmalemma vesicle-associated protein OS=Mus musculus
GN=Plvap PE=2 SV=1
1.17E-04 0 N.A. Graves disease carrier protein homolog OS=Mus musculus
GN=Slc25a16 PE=2 SV=1
1.16E-04 0 N.A. Histone H1.5 OS=Mus musculus GN=Hist1h1b PE=1 SV=2
1.15E-04 0 N.A. Guanine nucleotide-binding protein G(I)/G(S)/G(T) subunit
beta-2 OS=Mus musculus GN=Gnb2 PE=1 SV=3
1.10E-04 0 N.A. Mitochondrial import inner membrane translocase subunit
TIM50 OS=Mus musculus GN=Timm50 PE=1 SV=1
1.07E-04 0 N.A. Vesicle-associated membrane protein-associated protein B
OS=Mus musculus GN=Vapb PE=2 SV=3
1.01E-04 0 N.A. Calpain-6 OS=Mus musculus GN=Capn6 PE=1 SV=2
1.01E-04 0 N.A. Fatty acyl-CoA reductase 1 OS=Mus musculus GN=Far1 PE=1
SV=1
9.99E-05 0 N.A. Dolichol-phosphate mannosyltransferase subunit 1 OS=Mus
musculus GN=Dpm1 PE=2 SV=1
9.82E-05 0 N.A. Importin subunit alpha-1 OS=Mus musculus GN=Kpna2 PE=1
SV=2
9.78E-05 0 N.A. T-complex protein 1 subunit zeta-2 OS=Mus musculus
GN=Cct6b PE=2 SV=4
9.70E-05 0 N.A. RNA-binding protein 14 OS=Mus musculus GN=Rbm14 PE=1
SV=1
9.58E-05 0 N.A. Ubiquitin thioesterase OTUB1 OS=Mus musculus GN=Otub1
PE=1 SV=2
9.55E-05 0 N.A. T-complex protein 1 subunit eta OS=Mus musculus GN=Cct7
PE=1 SV=1
9.48E-05 0 N.A. Pyrroline-5-carboxylate reductase 3 OS=Mus musculus
GN=Pycrl PE=2 SV=2
9.26E-05 0 N.A. Asparagine synthetase [glutamine-hydrolyzing] OS=Mus
musculus GN=Asns PE=2 SV=3
9.24E-05 0 N.A. KN motif and ankyrin repeat domain-containing protein 2
OS=Mus musculus GN=Kank2 PE=1 SV=1
9.21E-05 0 N.A. Dolichyl-diphosphooligosaccharide--protein glycosyltransferase
subunit STT3A OS=Mus musculus GN=Stt3a PE=1 SV=1
9.12E-05 0 N.A. Discoidin domain-containing receptor 2 OS=Mus musculus
GN=Ddr2 PE=1 SV=2
9.04E-05 0 N.A. WD repeat-containing protein 18 OS=Mus musculus
GN=Wdr18 PE=1 SV=1
9.04E-05 0 N.A. Septin-11 OS=Mus musculus GN=Sept11 PE=1 SV=4
8.98E-05 0 N.A. Four and a half LIM domains protein 3 OS=Mus musculus
GN=Fhl3 PE=1 SV=2
8.79E-05 0 N.A. Transcription factor E2F2 OS=Mus musculus GN=E2f2 PE=1
SV=2
8.74E-05 0 N.A. Keratin, type I cytoskeletal 9 OS=Mus musculus GN=Krt9 PE=1
SV=3
8.62E-05 0 N.A. Keratin, type II cytoskeletal 80 OS=Mus musculus GN=Krt80
PE=2 SV=1
8.17E-05 0 N.A. Ribose-phosphate pyrophosphokinase 1 OS=Mus musculus
GN=Prps1 PE=1 SV=4

133
8.11E-05 0 N.A. Myeloid-associated differentiation marker OS=Mus musculus
GN=Myadm PE=2 SV=2
8.06E-05 0 N.A. Sideroflexin-1 OS=Mus musculus GN=Sfxn1 PE=1 SV=3
7.99E-05 0 N.A. Cytochrome c1, heme protein, mitochondrial OS=Mus
musculus GN=Cyc1 PE=1 SV=1
7.90E-05 0 N.A. Monocarboxylate transporter 1 OS=Mus musculus
GN=Slc16a1 PE=1 SV=1
7.77E-05 0 N.A. Splicing factor 3A subunit 3 OS=Mus musculus GN=Sf3a3
PE=2 SV=2
7.75E-05 0 N.A. Periostin OS=Mus musculus GN=Postn PE=1 SV=2
7.50E-05 0 N.A. Aldehyde dehydrogenase, mitochondrial OS=Mus musculus
GN=Aldh2 PE=1 SV=1
7.49E-05 0 N.A. Dynamin-1 OS=Mus musculus GN=Dnm1 PE=1 SV=2
7.42E-05 0 N.A.
Bifunctional methylenetetrahydrofolate
dehydrogenase/cyclohydrolase, mitochondrial OS=Mus
musculus GN=Mthfd2 PE=1 SV=1
7.31E-05 0 N.A.
NADH dehydrogenase [ubiquinone] 1 alpha subcomplex
subunit 10, mitochondrial OS=Mus musculus GN=Ndufa10
PE=1 SV=1
7.28E-05 0 N.A. Macrophage-expressed gene 1 protein OS=Mus musculus
GN=Mpeg1 PE=2 SV=1
7.25E-05 0 N.A. Mitogen-activated protein kinase 1 OS=Mus musculus
GN=Mapk1 PE=1 SV=3
7.17E-05 0 N.A. Very-long-chain (3R)-3-hydroxyacyl-[acyl-carrier protein]
dehydratase 3 OS=Mus musculus GN=ptplad1 PE=1 SV=2
7.13E-05 0 N.A. Fructose-bisphosphate aldolase A OS=Mus musculus
GN=Aldoa PE=1 SV=2
7.04E-05 0 N.A. Biglycan OS=Mus musculus GN=Bgn PE=2 SV=1
6.93E-05 0 N.A. Signal transducer and activator of transcription 1 OS=Mus
musculus GN=Stat1 PE=1 SV=1
6.89E-05 0 N.A.
NADH dehydrogenase [ubiquinone] 1 alpha subcomplex
subunit 9, mitochondrial OS=Mus musculus GN=Ndufa9 PE=1
SV=2
6.87E-05 0 N.A. Minor histocompatibility antigen H13 OS=Mus musculus
GN=Hm13 PE=1 SV=1
6.81E-05 0 N.A. E3 ubiquitin-protein ligase RNF213 OS=Mus musculus
GN=Rnf213 PE=2 SV=1
6.69E-05 0 N.A. Ribosomal biogenesis protein LAS1L OS=Mus musculus
GN=Las1l PE=1 SV=1
6.68E-05 0 N.A. Mitochondrial carrier homolog 1 OS=Mus musculus GN=Mtch1
PE=2 SV=1
6.64E-05 0 N.A. Transmembrane 9 superfamily member 3 OS=Mus musculus
GN=Tm9sf3 PE=1 SV=1
6.59E-05 0 N.A. Calnexin OS=Mus musculus GN=Canx PE=1 SV=1
6.46E-05 0 N.A. Plasminogen activator inhibitor 1 OS=Mus musculus
GN=Serpine1 PE=1 SV=1
6.35E-05 0 N.A. Solute carrier family 35 member E1 OS=Mus musculus
GN=Slc35e1 PE=2 SV=2
6.33E-05 0 N.A. Cathepsin D OS=Mus musculus GN=Ctsd PE=1 SV=1
6.28E-05 0 N.A. Cell division cycle protein 16 homolog OS=Mus musculus
GN=Cdc16 PE=2 SV=1

134
6.24E-05 0 N.A. Kelch-like ECH-associated protein 1 OS=Mus musculus
GN=Keap1 PE=1 SV=1
6.23E-05 0 N.A. Phosphoglycerate kinase 1 OS=Mus musculus GN=Pgk1 PE=1
SV=4
6.17E-05 0 N.A. Isoleucine--tRNA ligase, cytoplasmic OS=Mus musculus
GN=Iars PE=2 SV=2
6.11E-05 0 N.A. Multifunctional protein ADE2 OS=Mus musculus GN=Paics
PE=1 SV=4
5.89E-05 0 N.A. Ubiquitin carboxyl-terminal hydrolase 7 OS=Mus musculus
GN=Usp7 PE=1 SV=1
5.76E-05 0 N.A. E3 ubiquitin-protein ligase UBR4 OS=Mus musculus GN=Ubr4
PE=1 SV=1
5.76E-05 0 N.A. Tubulin gamma-1 chain OS=Mus musculus GN=Tubg1 PE=1
SV=1
5.62E-05 0 N.A. Dipeptidyl peptidase 1 OS=Mus musculus GN=Ctsc PE=2
SV=1
5.55E-05 0 N.A. Procollagen C-endopeptidase enhancer 1 OS=Mus musculus
GN=Pcolce PE=1 SV=2
5.49E-05 0 N.A. Aspartyl aminopeptidase OS=Mus musculus GN=Dnpep PE=2
SV=2
5.46E-05 0 N.A. Polynucleotide 5'-hydroxyl-kinase NOL9 OS=Mus musculus
GN=Nol9 PE=1 SV=1
5.41E-05 0 N.A. Cytochrome b-c1 complex subunit 1, mitochondrial OS=Mus
musculus GN=Uqcrc1 PE=1 SV=2
5.35E-05 0 N.A. 116 kDa U5 small nuclear ribonucleoprotein component
OS=Mus musculus GN=Eftud2 PE=2 SV=1
5.28E-05 0 N.A. Ephrin type-B receptor 1 OS=Mus musculus GN=Ephb1 PE=1
SV=1
5.26E-05 0 N.A. Ephrin type-B receptor 4 OS=Mus musculus GN=Ephb4 PE=1
SV=2
5.23E-05 0 N.A. Ephrin type-B receptor 3 OS=Mus musculus GN=Ephb3 PE=1
SV=2
5.10E-05 0 N.A. Activin receptor type-1 OS=Mus musculus GN=Acvr1 PE=2
SV=2
5.06E-05 0 N.A. Zinc finger protein RFP OS=Mus musculus GN=Trim27 PE=1
SV=2
5.00E-05 0 N.A. Sarcoplasmic/endoplasmic reticulum calcium ATPase 3
OS=Mus musculus GN=Atp2a3 PE=2 SV=3
4.99E-05 0 N.A. 6-phosphofructokinase, liver type OS=Mus musculus GN=Pfkl
PE=1 SV=4
4.99E-05 0 N.A. Aconitate hydratase, mitochondrial OS=Mus musculus
GN=Aco2 PE=1 SV=1
4.96E-05 0 N.A. Cytoplasmic dynein 1 light intermediate chain 1 OS=Mus
musculus GN=Dync1li1 PE=1 SV=1
4.95E-05 0 N.A. Uncharacterized aarF domain-containing protein kinase 1
OS=Mus musculus GN=Adck1 PE=2 SV=1
4.90E-05 0 N.A. Putative adenosylhomocysteinase 2 OS=Mus musculus
GN=Ahcyl1 PE=1 SV=1
4.71E-05 0 N.A. Serine beta-lactamase-like protein LACTB, mitochondrial
OS=Mus musculus GN=Lactb PE=1 SV=1
4.62E-05 0 N.A. Proline-, glutamic acid- and leucine-rich protein 1 OS=Mus
musculus GN=Pelp1 PE=1 SV=2

135
4.56E-05 0 N.A. DNA damage-binding protein 1 OS=Mus musculus GN=Ddb1
PE=1 SV=2
4.51E-05 0 N.A. Dynamin-3 OS=Mus musculus GN=Dnm3 PE=1 SV=1
4.27E-05 0 N.A. Histone-arginine methyltransferase CARM1 OS=Mus musculus
GN=Carm1 PE=1 SV=2
4.24E-05 0 N.A. Putative adenosylhomocysteinase 3 OS=Mus musculus
GN=Ahcyl2 PE=1 SV=1
4.05E-05 0 N.A. WD repeat-containing protein 26 OS=Mus musculus
GN=Wdr26 PE=2 SV=3
3.99E-05 0 N.A. Ephrin type-A receptor 2 OS=Mus musculus GN=Epha2 PE=1
SV=3
3.92E-05 0 N.A. Transmembrane 9 superfamily member 2 OS=Mus musculus
GN=Tm9sf2 PE=2 SV=1
3.92E-05 0 N.A. Ephrin type-B receptor 2 OS=Mus musculus GN=Ephb2 PE=1
SV=2
3.90E-05 0 N.A. Ephrin type-A receptor 7 OS=Mus musculus GN=Epha7 PE=1
SV=2
3.78E-05 0 N.A. A-kinase anchor protein 8 OS=Mus musculus GN=Akap8 PE=1
SV=1
3.76E-05 0 N.A. Ephrin type-A receptor 6 OS=Mus musculus GN=Epha6 PE=2
SV=2
3.73E-05 0 N.A. Glutamine--fructose-6-phosphate aminotransferase
[isomerizing] 1 OS=Mus musculus GN=Gfpt1 PE=1 SV=3
3.55E-05 0 N.A. Platelet-derived growth factor receptor beta OS=Mus musculus
GN=Pdgfrb PE=1 SV=1
3.43E-05 0 N.A. Vitamin K-dependent gamma-carboxylase OS=Mus musculus
GN=Ggcx PE=2 SV=1
3.37E-05 0 N.A. Signal transducer and activator of transcription 3 OS=Mus
musculus GN=Stat3 PE=1 SV=2
3.31E-05 0 N.A. 6-phosphofructokinase type C OS=Mus musculus GN=Pfkp
PE=1 SV=1
3.30E-05 0 N.A. Ras GTPase-activating-like protein IQGAP2 OS=Mus musculus
GN=Iqgap2 PE=1 SV=2
3.19E-05 0 N.A. Protein SON OS=Mus musculus GN=Son PE=1 SV=2
3.07E-05 0 N.A. MAP7 domain-containing protein 1 OS=Mus musculus
GN=Map7d1 PE=1 SV=1
2.99E-05 0 N.A. Programmed cell death 6-interacting protein OS=Mus musculus
GN=Pdcd6ip PE=1 SV=3
2.85E-05 0 N.A. Desmoglein-1-gamma OS=Mus musculus GN=Dsg1c PE=1
SV=1
2.85E-05 0 N.A. Eukaryotic translation initiation factor 3 subunit C OS=Mus
musculus GN=Eif3c PE=1 SV=1
2.69E-05 0 N.A. Reticulon-3 OS=Mus musculus GN=Rtn3 PE=1 SV=2
2.64E-05 0 N.A. Rho guanine nucleotide exchange factor 2 OS=Mus musculus
GN=Arhgef2 PE=1 SV=4
2.63E-05 0 N.A. Ephrin type-A receptor 4 OS=Mus musculus GN=Epha4 PE=1
SV=2
2.50E-05 0 N.A. Importin-7 OS=Mus musculus GN=Ipo7 PE=1 SV=2
2.46E-05 0 N.A. Desmoglein-1-alpha OS=Mus musculus GN=Dsg1a PE=2
SV=2

136
2.45E-05 0 N.A. Desmoglein-1-beta OS=Mus musculus GN=Dsg1b PE=1 SV=1
2.44E-05 0 N.A. Retinoblastoma-like protein 1 OS=Mus musculus GN=Rbl1
PE=1 SV=3
2.44E-05 0 N.A. Rab GTPase-activating protein 1 OS=Mus musculus
GN=Rabgap1 PE=1 SV=1
2.38E-05 0 N.A. Constitutive coactivator of PPAR-gamma-like protein 2
OS=Mus musculus GN=Fam120c PE=2 SV=3
2.38E-05 0 N.A. ATP-citrate synthase OS=Mus musculus GN=Acly PE=1 SV=1
2.16E-05 0 N.A. Exportin-5 OS=Mus musculus GN=Xpo5 PE=2 SV=1
2.15E-05 0 N.A. Protein FAM83H OS=Mus musculus GN=Fam83h PE=1 SV=1
2.11E-05 0 N.A. Cullin-associated NEDD8-dissociated protein 1 OS=Mus
musculus GN=Cand1 PE=2 SV=2
1.84E-05 0 N.A. Unconventional myosin-IXb OS=Mus musculus GN=Myo9b
PE=1 SV=2
1.51E-05 0 N.A. Protein MON2 homolog OS=Mus musculus GN=Mon2 PE=2
SV=2
1.41E-05 0 N.A. Plexin-B2 OS=Mus musculus GN=Plxnb2 PE=1 SV=1
1.05E-05 0 N.A. Cation-independent mannose-6-phosphate receptor OS=Mus
musculus GN=Igf2r PE=1 SV=1
5.93E-06 0 N.A. E3 ubiquitin-protein ligase HUWE1 OS=Mus musculus
GN=Huwe1 PE=1 SV=5
5.51E-06 0 N.A. Probable E3 ubiquitin-protein ligase MYCBP2 OS=Mus
musculus GN=Mycbp2 PE=1 SV=2
Appendix C: Gene Ontology results of MCI/siRBL2/E2F4VP16
GO terms for multicilin+siCTRL vs unifected
term_name term_id adjusted_p_value negative_log10_of_adjusted_p_value
protein binding GO:0005515 1.40E-39 38.85257238
binding GO:0005488 1.30E-26 25.88659612
carbohydrate derivative binding GO:0097367 4.00E-10 9.397949167
identical protein binding GO:0042802 3.68E-09 8.434295165
anion binding GO:0043168 6.11E-09 8.213653919
signaling receptor binding GO:0005102 4.79E-08 7.320027471
purine ribonucleoside
triphosphate binding GO:0035639 7.30E-08 7.136624627
purine ribonucleotide binding GO:0032555 1.20E-07 6.921908935
ribonucleotide binding GO:0032553 1.95E-07 6.709253745
purine nucleotide binding GO:0017076 2.08E-07 6.682465578
small molecule binding GO:0036094 4.73E-07 6.325541067
natural killer cell lectin-like
receptor binding GO:0046703 8.20E-07 6.086198612
nucleotide binding GO:0000166 8.46E-07 6.072825961
nucleoside phosphate binding GO:1901265 8.46E-07 6.072825961
TAP complex binding GO:0062061 4.6E-06 5.337216622
MHC class I protein binding GO:0042288 6.52E-06 5.185917164
double-stranded RNA binding GO:0003725 2.21E-05 4.656532488

137
2'
-5'
-oligoadenylate synthetase
activity GO:0001730 5.26E
-05 4.27893858
ion binding GO:0043167 6.11E
-05 4.213873863
MHC protein binding GO:0042287 7.87E
-05 4.104214732
T cell receptor binding GO:0042608 8.12E
-05 4.090348441
molecular function activator
activity GO:0140677 0.000266 3.57498326
beta
-
2
-microglobulin binding GO:0030881 0.000321 3.49417019
TAP2 binding GO:0046979 0.000855 3.067954805
low
-density lipoprotein particle
binding GO:0030169 0.000855 3.067954805
GTPase activity GO:0003924 0.001009 2.996002878
TAP1 binding GO:0046978 0.001226 2.911476167
TAP binding GO:0046977 0.001226 2.911476167
CD8 receptor binding GO:0042610 0.001226 2.911476167
ribonucleoside triphosphate
phosphatase activity GO:0017111 0.001495 2.825383727
pattern recognition receptor
activity GO:0038187 0.001677 2.775536047
ATP binding GO:0005524 0.002066 2.68490833
adenyl ribonucleotide binding GO:0032559 0.002302 2.637964087
signaling receptor regulator
activity GO:0030545 0.002389 2.621804947
adenyl nucleotide binding GO:0030554 0.00314 2.5031257
GTP binding GO:0005525 0.003388 2.47009786
cytoskeletal motor activity GO:0003774 0.00394 2.404499086
structural constituent of
postsynaptic intermediate
filament cytoskeleton
GO:0099184 0.005199 2.284053233
microtubule motor activity GO:0003777 0.007531 2.123136185
molecular function regulator
activity GO:0098772 0.008776 2.056682728
guanyl ribonucleotide binding GO:0032561 0.009232 2.034699001
guanyl nucleotide binding GO:0019001 0.009232 2.034699001
pyrophosphatase activity GO:0016462 0.009396 2.027057093
hydrolase activity, acting on acid
anhydrides, in phosphorus
-
containing anhydrides
GO:0016818 0.009676 2.014304291
hydrolase activity, acting on acid
anhydrides GO:0016817 0.009676 2.014304291
dynein light intermediate chain
binding GO:0051959 0.011477 1.940184812
cytokine binding GO:0019955 0.011693 1.932073843
cytokine activity GO:0005125 0.016605 1.779760302
receptor ligand activity GO:0048018 0.016878 1.772667355
peptide antigen binding GO:0042605 0.020449 1.689318093
lipoprotein particle binding GO:0071813 0.021739 1.662763497
protein
-lipid complex binding GO:0071814 0.021739 1.662763497
signaling receptor activator
activity GO:0030546 0.022584 1.646196621
chemokine activity GO:0008009 0.027911 1.554226562
protein
-containing complex
binding GO:0044877 0.029596 1.528772889
minus
-end
-directed microtubule
motor activity GO:0008569 0.030464 1.51621743
immune system process GO:0002376 1.86E
-47 46.73007773

138
response to interferon-beta GO:0035456 7.71E-24 23.11271207
cell motility GO:0048870 1.10E-23 22.95677135
cilium organization GO:0044782 5.13E-21 20.28988394
multi-ciliated epithelial cell
differentiation GO:1903251 0.001072 2.969848969
synapse pruning GO:0098883 0.001072 2.969848969
superoxide metabolic process GO:0006801 0.002968 2.527592801
positive regulation of DNAtemplated transcription GO:0045893 0.010349 1.985117533
neurofilament bundle assembly GO:0033693 0.020939 1.679052037
postsynaptic intermediate
filament cytoskeleton
organization
GO:0099185 0.020939 1.679052037
respiratory burst GO:0045730 0.038601 1.413398668
adhesion of symbiont to host GO:0044406 0.045787 1.339258633
cytoplasm GO:0005737 8.62E-25 24.06454594
MHC class I peptide loading
complex GO:0042824 2.96E-06 5.52907917
receptor complex GO:0043235 0.000563 3.249456872
Golgi medial cisterna GO:0005797 0.002491 2.60364165
complement component C1
complex GO:0005602 0.002805 2.55209753
postsynaptic intermediate
filament cytoskeleton GO:0099160 0.002805 2.55209753
deuterosome GO:0098536 0.027175 1.56582964
cis-Golgi network membrane GO:0033106 0.037401 1.427111782
GO terms for multicilin+siRBL2 vs unifected
protein binding GO:0005515 7.25E-34 33.13940835
minus-end-directed microtubule
motor activity GO:0008569 1.77E-09 8.752978236
calcium ion binding GO:0005509 0.000126 3.897915549
pattern recognition receptor
activity GO:0038187 0.00171 2.766982247
transferase activity, transferring
phosphorus-containing groups GO:0016772 0.038073 1.419387954
low-density lipoprotein particle
binding GO:0030169 0.043922 1.357320021
structural constituent of
postsynaptic intermediate
filament cytoskeleton
GO:0099184 0.049916 1.30175635
cilium organization GO:0044782 7.29E-62 61.13719447
cilium movement GO:0003341 4.64E-52 51.3339457
cytoskeleton organization GO:0007010 5.01E-30 29.30031247
defense response GO:0006952 1.93E-27 26.71400102
phosphorylation GO:0016310 0.000151 3.820019179
protein localization to cilium GO:0061512 0.000197 3.706534796
synapse pruning GO:0098883 0.000659 3.18136244
regulation of membrane potential GO:0042391 0.003119 2.505965156
cell killing GO:0001906 0.003292 2.482561292
actin filament-based process GO:0030029 0.0089 2.050621053
regulation of protein metabolic
process
GO:0051246 0.031759 1.498131794
homeostatic process GO:0042592 0.039018 1.408735569
regulation of phosphate
metabolic process GO:0019220 0.040475 1.392808204
regulation of kinase activity GO:0043549 0.045854 1.33862578

139
Fc-gamma receptor signaling
pathway GO:0038094 0.049605 1.304470883
cilium GO:0005929 4.92E-60 59.30763779
extracellular region GO:0005576 8.34E-13 12.07882989
centriole GO:0005814 1.22E-11 10.91469269
manchette GO:0002177 3.52E-07 6.453155472
dynein axonemal particle GO:0120293 4.57E-06 5.339790104
phagocytic cup GO:0001891 0.000249 3.603757987
receptor complex GO:0043235 0.00354 2.451000405
membrane raft GO:0045121 0.007759 2.110210986
neurofilament GO:0005883 0.011888 1.924901983
postsynaptic intermediate
filament cytoskeleton GO:0099160 0.020767 1.682632919
term_name term_id adjusted_p_value negative_log10_of_adjusted_p_value
protein binding GO:0005515 1.15E-34 33.9376963
minus-end-directed microtubule
motor activity GO:0008569 7.36E-08 7.133013434
calcium ion binding GO:0005509 1.75E-06 5.757373651
monoatomic ion channel activity GO:0005216 0.000865 3.063009681
anion binding GO:0043168 0.005453 2.263370765
TAP complex binding GO:0062061 0.041107 1.386082188
cilium organization GO:0044782 5.07E-65 64.29488358
cilium movement GO:0003341 2.18E-47 46.66124269
developmental process GO:0032502 5.63E-31 30.24987124
cell surface receptor signaling
pathway GO:0007166 7.15E-07 6.145615121
cell adhesion GO:0007155 3.98E-05 4.399999864
blood circulation GO:0008015 0.000173 3.762494581
protein localization to cilium GO:0061512 0.000512 3.290408394
cellular response to interferonbeta GO:0035458 0.001154 2.93789473
non-canonical Wnt signaling
pathway GO:0035567 0.005117 2.290964189
metal ion transport GO:0030001 0.015578 1.807499771
negative regulation of hydrolase
activity GO:0051346 0.02953 1.529731821
hepatic stellate cell activation GO:0035733 0.045066 1.346155548
cilium GO:0005929 1.46E-63 62.835815
extracellular region GO:0005576 2.14E-17 16.67057267
centriole GO:0005814 2.19E-15 14.6598774
plasma membrane region GO:0098590 5.93E-10 9.226872731
manchette GO:0002177 1.80E-08 7.745780529
dynein axonemal particle GO:0120293 7.65E-05 4.11611666
ion channel complex GO:0034702 0.000145 3.839264845
plasma membrane protein
complex GO:0098797 0.01716 1.765478287
Appendix D: Common and uniquely upregulated DEGs across multicilin vs NOTCH
inhibition and multiciliated related gene lists
[MCI] [NOTCHi] and
[MCI_NOTCHi] [MCI_NOTCHi] [CiliaGene] [CiliaGene] [CiliaGene]

140
HERC5 ALDH3A1 CFAP45 ABCC4 HIF1A RPGRIP1
LAMP3 PLA2G4F CIMAP3 ABLIM1 HNF1B RPGRIP1L
HJURP FCGBP_1 ARNT2 ABLIM3 HSD11B1 RRP7A
DEPDC1 DUOX2 PCSK6 ACE2 HSP90AA1 RSPH3
CKAP2L IL6R KCNMA1 ACTR2 HSPA8 RSPH6A
TOP2A SPRR3 RAB36 ADAM17 HSPB11 RSPH9
ESCO2 SLC1A3 RIBC2 ADAMTS20 HTR6 RTTN
KIF4A RAB26 DNAH3 ADCY3 HTT RUVBL1
NDC80 RHBDL1 TPPP3 ADCY5 HYLS1 RUVBL2
[MCI] and
[NOTCHi] and
[MCI_NOTCHi]
ATP10B MAP3K12 ADCY6 IFT122 SALL1
CEMIP KLRC3 CLXN ADGRV1 IFT140 SASS6
WDR38 SECTM1 POGLUT3 AGBL5 IFT172 SAXO1
VCAN TMEM71 RFC4 AGR3 IFT20 SCAPER
HAS2 LINC02009 EFHC2 AHI1 IFT22 SCLT1
ITGB3 COL21A1 E2F8 AIPL1 IFT27 SDCCAG8
SLC13A5 PCP4L1 SPATA17 AK8 IFT43 SENP3
MYH16 LYPD6B DNAI7 AKT1 IFT46 SEPT2
POSTN DUSP13B DNAAF11 ALMS1 IFT52 SEPT6
CDH2 LINC02940 PIERCE1 ALPK1 IFT57 SEPT7
KANK4 CD36 PRR29 ANAPC2 IFT74 SHH
FGF1 MESP1 GGT6 ANKRD26 IFT80 SIAH2
[MCI] and
[NOTCHi] and
[MCI_NOTCHi]
and [CiliaGene]
VWCE RAET1E ANKS3 IFT81 SIRT2
CDC20B LOC105378520 GDPD2 ANKS6 IFT88 SLC9A3R1
TP73 BMP7 FAM81B ANO1 IGF1 SMAD2
FOXJ1 LOC105374325 C2orf50 ANO2 IGF1R SMAD3
[NOTCHi] and
[MCI_NOTCHi]
and [CiliaGene]
S100A12 RMI2 ARF4 INPP5B SMO
NGFR GRIN1 IQUB ARHGAP36 INPP5E SNAP25
RCSD1 SLCO4A1 CFAP90 ARL13B INTU SNAP29
GPR161 CAPN9 E2F1 ARL2 INVS SNX10
TUBA1A KLRC2 CIBAR2 ARL2BP IQCB1 SNX17
TUBB2A FAM3B NMU ARL3 IQCE SPA17
TUBB3 TARID FOXRED2 ARL6 IQCG SPAG1
[NOTCHi] and
[CiliaGene] SH2D3C ADGRB2 ARMC2 IRS1 SPAG16
SLC47A2 CD7 DTHD1 ARMC4 JADE1 SPAG17
GLI2 NEURL1B PLAAT2 ARMC9 JAZF1 SPATA7
ADAMTS9 PTGS2 HPSE ASAP1 JHY SREBF1
[MCI] and
[MCI_NOTCHi]
and [CiliaGene]
NRARP VWA3B ATAT1 KATNAL1 SRGAP3
MCIDAS CHP2 TCF7 ATG3 KATNAL2 SSNA1
MYB CYP27C1 CXCR2 ATG5 KCNF1 SSTR3
DRC1 AMIGO2 CSRP3-AS1 ATMIN KCNH1 SSX2IP

141
[MCI] and
[MCI_NOTCHi] GPR157 DHFR ATOH1 KCNJ10 STK11
PAQR4 RHOV ODAD1 ATP4A KCNJ13 STK36
TMEM200B SKIL CIITA ATXN10 KCNQ1 STK38L
KREMEN2 TAGLN DYDC2 AURKA KCTD10 STOML3
CHAF1B OTULINL C7orf57 B9D1 KCTD17 STUB1
CARHSP1 LBH LRRC46 B9D2 KDM3A STX3
CDT1 PMEPA1 LOC124900978 BAG6 KIAA0556 SUFU
SLFN11 COL1A2 C21orf58 BBIP1 KIAA0586 SYNE1
ANXA9 CXCL1 ZBBX BBOF1 KIAA0753 SYNE2
CDCA7L MAB21L4 CHRM4 BBS1 KIAA1549 TAPT1
RAD51D COL22A1 SIRPB2 BBS10 KIF13B TAZ
ISM1 TPM1 MELK BBS12 KIF14 TBC1D30
HELLS SCD5 LOC105372535 BBS2 KIF17 TBC1D32
LOC112694756 FLRT2 HOATZ BBS4 KIF19 TBC1D7
LIG1 NUAK1 TSPAN7 BBS5 KIF24 TBCCD1
RFC2 HES2 GPAT3 BBS7 KIF27 TCHP
GALNT16 CDKN2B FLVCR2 BBS9 KIF2A TCTEX1D2
MELTF SOCS2 PIH1D2 C11orf74 KIF3A TCTN1
CCDC171 FAM171B DOK7 C2CD3 KIF3B TCTN2
BHLHA15 CILP MAP1A C8orf37 KIF3C TCTN3
ARMC3 RND1 CYSRT1 CACNA1C KIF5B TEKT2
GAS7 DSC2 C10orf67 CATIP KIF6 TEKT4
FOXD2-AS1 MYOM3 LOC105370455 CAV1 KIF7 TEKT5
E2F7 KDR DNAAF8 CBY1 KIFC1 TESK1
GSDMA PIK3CD EEF1A2 CC2D2A KISS1R TGBFBR1
IGFBPL1 NOTCH3 SAMD15 CCDC114 KIZ TGBFBR2
FST SH3KBP1 PPIL6 CCDC13 KLC1 TGFB1
LOC107987223 KRT17 PKN3 CCDC151 LCA5 TMEM107
SERPINB4 SPOCK1 LCE1B CCDC181 LIMA1 TMEM138
[MCI_NOTCHi]
and [CiliaGene] SCGB1A1 DCST1-AS1 CCDC28B LIMK2 TMEM17
ZMYND10 WNK2 RIBC1 CCDC39 LRBA TMEM216
CCNO NEXN LCE1C CCDC40 LRRC23 TMEM231
STIL CASC15 C5 CCDC66 LRRC34 TMEM237
CCDC103 MSRB3 SAXO2 CCDC78 LRRC45 TMEM67
RSPH4A WNT5B LOC105374355 CCP110 LRRC56 TNPO1
CEP78 C1orf74 TNNT2 CCT2 LRRC6 TOGARAM1
PLK4 NKILA CFAP206 CDC14A LRRK2 TOPORS
UBXN10 SMOX EFCAB12 CDC20 LUZP1 TPPP2
DNAH7 CREG2 RHBDL3 CDH23 LZTFL1 TPRA1
CFAP52 CXCL8 ATP6V0A4 CDK10 MACF1 TRAF3IP1
TEKT1 FERMT2 TCHH CDK20 MAGI2 TRAPPC10
DNAAF1 SERPINB7 KRT78 CDKL5 MAK TRAPPC3
DRC3 PDCD1LG2 LRRIQ1 CDKN1B MAL TRAPPC9
FOXN4 FILIP1L SHISA8 CELSR2 MAP1LC3A TRIM32
RSPH1 IL11 CAPSL CELSR3 MAPK1 TRIP11
SPAG6 TGFBI LOC102724378 CENPF MAPK15 TRPV4
CFAP161 LINC02725 COCH CENPJ MAPK3 TRRAP
DRC7 IVL BCO2 CEP104 MAPKAP1 TSC1
TTLL9 MIR503HG LINC02560 CEP120 MAPRE1 TSC2

142
ROPN1L CNN1 PYGO1 CEP128 MARCHF7 TSGA10
CFAP43 CREB5 AKAP14 CEP131 MARK4 TTBK2
CCDC65 SERPINE1 C6orf118 CEP135 MAS1 TTC12
NME5 ACTBL2 LOC102723568 CEP162 MCHR1 TTC17
MCM2 EDN1 SPAG8 CEP164 MCRS1 TTC21B
DNAI1 EIF4EBP1 CENPM CEP170 MDM1 TTC23
CFAP65 SPHK1 CASC2 CEP19 MIB1 TTC25
SPEF2 CCL22 IGFLR1 CEP250 MIR182 TTC26
MNS1 SERPINE2 LOC107986298 CEP290 MIR183 TTC29
MORN5 EBI3 CFAP276 CEP350 MIR34B TTC30A
SPEF1 LIPG S100A7 CEP41 MIR34C TTC30B
HYDIN TNC SLC30A2 CEP68 MKKS TTC6
DAW1 NTM C9orf152 CEP72 MKS1 TTC8
RIPOR2 FSTL3 EPIST CEP83 MLF1 TTK
CFAP57 HES4 CDK1 CEP89 MMP21 TTLL1
NEK10 TGM2 OR10H1 CEP97 MOK TTLL3
AK7 CCN2 CNIH2 CETN2 MPHOSPH9 TTLL5
DNAH6 PID1 SVOPL CETN3 MTOR TTLL6
CFAP54 CRLF1 PTPN22 CFAP100 MYH10 TTLL8
GAS2L2 MEX3A EFHB CFAP126 MYO15A TUB
CFAP69 CSDC2 ELN-AS1 CFAP157 MYO3B TUBA1C
DLEC1 LOC105369370 CCDC187 CFAP221 MYO5A TUBA4A
NEDD9 MTNR1A CENPI CFAP298 MYO7A TUBB4B
TUBB2B GLIPR1 MAP3K19 CFAP300 NDE1 TUBE1
[NOTCHi] SERPINB9 LOC105373551 CFAP36 NEK1 TUBGCP2
ALDH3B1 SLC2A3 LINC02827 CFAP410 NEK2 TUBGCP3
DLK2 ENC1 CIMIP1 CFAP47 NEK3 TUBGCP4
PHYHIP VIM DNAH12 CFAP53 NEK4 TUBGCP5
GCLC TLR4 S100A8 CFAP58 NEK8 TUBGCP6
CPA4 ADRA1B THSD7A CFAP70 NEURL4 TULP1
ZNF648 MYEOV ANKRD45 CHMP4B NFE2L2 TULP3
ATP6V1C2 ADAMTS6 SPMIP6 CILK NIN TXNDC15
PTGS1 DNAJC22 CERKL CIP2A NINL UBR5
ANKRD20A5P GRB10 DNAI3 CLCN4 NME3 ULK4
KRT15 KIAA1755 KCNH3 CLDN2 NME7 UMOD
RAB37 CX3CL1 ZNF833P CLRN1 NME8 USH1C
CYP26A1 MEX3B LINC00589 CLUAP1 NOTCH1 USH1G
CEL CXCL3 TREH CNGA1 NOTO USH2A
SLC34A2 CCL20 SLAMF7 CNGA2 NPHP1 USP14
AKR1B10 FOXC2 RAB9B CNGA4 NPHP3 USP8
SMPD3 GFI1 ATG9B CNGB1 NPHP4 USP9X
CYP4F35P HEY2 SELL CPLANE1 NPY2R VANGL2
LINC02159 LAMC2 LOC107986617 CPLANE2 NPY5R VCP
CLDN10 PGLYRP4 CFAP73 CRB3 NR1H4 VDAC3
LOC105377548 ANXA6 CLCA3P CRHR2 NUDC VHL
CYP4F29P CLDN14 TLCD3B CROCC NUDT16L1 VPS45
MAOB CPA6 DAPL1 CSNK1D NUMB VPS4A
CH25H PDPN LOC124906104 CSPP1 NUP205 WASF3
SHOC1 ROR1 LOC124902464 CTNNB1 NUP214 WDPCP
HPGD ADAM19 ITGB6 CUL7 NUP35 WDR11
CREB3L1 COL1A1 IL1R1 CYLD NUP37 WDR19

143
NMRAL2P MN1 PTHLH CYS1 NUP62 WDR34
DUOXA2 PPBP CDK14 DCDC2 NUP93 WDR35
LOC105371114 SMAD7 CDH13 DDX59 NUP98 WDR44
FAM3D ODAPH CALD1 DIAPH1 OCRL WDR5
RBM20 MEDAG ITGA2 DISC1 ODF2 WDR60
GP1BA SLC2A5 LGALS1 DNAAF2 OFD1 WDR62
CYP2A6 KDELR3 TGFBR1 DNAAF3 ONECUT1 WDR63
TSPAN2 HEYL MT1X DNAAF4 OPN1LW WDR66
SUSD2 TPM1-AS KRT6A DNAAF5 OPN1MW WDR78
RAET1L SPOCD1 STX2 DNAAF6 OPN1MW2 WDR90
AFAP1L2 MYL7 TENM2 DNAH1 OPN1SW WDR92
NCF2 ALDH1L2 ADAMTS7 DNAH10 OPRL1 WHRN
MYL9 HS3ST2 KLF7 DNAH11 ORC1 WRAP73
PRR5L VSIG10L2 PGM2L1 DNAH17 P2RY14 XPNPEP3
ARHGEF37 SOX9 IFFO2 DNAH2 PACRG YAP1
CTTNBP2 LOC124902256 DIXDC1 DNAH5 PACSIN1 YIF1B
CRYBG2 FN1 PYCR1 DNAH9 PACSIN2 ZIC2
KRT16 IGFL1 KLK13 DNAI2 PAFAH1B1
SLC16A12 PDGFB CYP26B1 DNAJB13 PARD3
ADM2 LINC02879 LRRN1 DNAL1 PARD6A
SPRR2F STC2 MAP2 DNALI1 PCARE
HTR1D LOC124903398 VGLL3 DNMBP PCDH15
PDZK1 MMP2 TGFB2 DPCD PCM1
TPPP COL13A1 SORL1 DPYSL2 PCNT
GLIPR2 SLC29A4 THBS1 DRD1 PDE4C
MMP13 RCN3 PLXND1 DRD2 PDE6A
CSF2 FLRT2-AS1 PDE5A DRD5 PDE6B
ETV5 TRAF3IP3 LHB DVL1 PDE6D
TRIM36 LINC02188 INPP4B DYNC2H1 PDE6G
BMP8B NOX4 JPH2 DYNC2LI1 PDZD7
ARHGAP31 SERPINA3 UCHL1 DYNLL1 PIBF1
L1TD1 LOC124901104 PTPRB DYNLL2 PIFO
SPRR2D ANGPTL4 TENM4 DYNLRB1 PIK3AP
ADGRE2 LTBP2 CDON DYNLRB2 PIK3C2A
THEMIS2 RBP1 TMEM45A DYNLT1 PIK3R4
LOC101927189 MAF DKK3 DZANK1 PKD1
ITGA1 ZNF469 BMP2 DZIP1 PKD1L1
EGOT C2CD4A CBSLR DZIP1L PKD2
IL32 ACTA1 FKBP7 E2F4 PKD2L1
MMP12 WNT5A KCTD15 EFCAB7 PKHD1
TGM5 ANKRD1 LARGE2 EFHC1 PLA2G3
SLC39A2 PLEKHO1 MTSS1 EGFR PLK1
ZNF232-AS1 DPYSL3 AKAP12 EHD1 POC1A
MYOZ1 KIF26B EPHA4 EHD3 POC1B
TNFRSF19 PROKR2 KRT17P1 ENKUR POC5
RRAD PAPPA SDK2 ENTR1 POMK
LRRC32 DIRAS1 KRT14 EVC PPARA
COL4A1 SLIT3 LOC124903879 EVC2 PPP1R42
CD83 ZNF385C DACT1 EXOC3 PPP5C
LEISA1 CA8 MIR100HG EXOC4 PQBP1
CXCL6 LIMCH1 EXOC5 PRDX1

144
NACAD LRRC3 EXOC6 PRICKLE1
BCL11A OLFM2 EXOC6B PRICKLE2
OLFML2B INHBA EZH2 PRICKLE3
NPR3 COL12A1 FAM149B1 PRKACA
CCNA1 SLC38A4 FAM161A PRKACG
ADAMTS15 FAM183BP PROM1
L1CAM FAM92A PRPF31
KRT6C FAM92B PRPF6
HEY1 FANK1 PRPF8
CGB8 FBF1 PRPH2
FAP FGFR3 PTCH1
ADGRA2 FHDC1 PTGER4
CDH6 FLCN PTK2
MEIS3 FLNA PTPDC1
RPSAP52 FNBP1L PTPN11
AXIN2 FOPNL QRFPR
THBD FSD1 RAB10
FGF5 FSIP2 RAB11A
HHIP FSTL1 RAB11FIP3
ALOX5AP FUZ RAB17
MMP9 GALNT11 RAB23
PCDHGB4 GALR2 RAB28
TF GALR3 RAB29
KCNA7 GAS8 RAB34
SYT1 GLI1 RAB3IP
CD86 GLI3 RAB8A
HIC1 GLIS2 RABEP2
KRT6B GMNC RABL2A
COL5A1 GNAT1 RABL2B
CLDN14-AS1 GNB1 RAN
VIM-AS1 GOLGB1 RANBP1
LINC00862 GPBAR RCAN2
CUX2 GPR173 RFX2
SLC17A9 GPR20 RFX3
EFNA2 GPR22 RFX4
LOC105374433 GPR83 RFX7
FOXL1 GPR88 RHO
LINC01705 GPSM1 RILPL1
COMP GRK1 RILPL2
SLCO4C1 GRK2 ROM1
LINC02551 GSK3B RP1
TMCC2 HAP1 RP1L1
C5orf46 HAVCR1 RP2
MEG3 HDAC6 RPGR

Abstract (if available)

Abstract A core pathophysiologic feature underlying many respiratory diseases is multiciliated cell dysfunction, leading to inadequate mucociliary clearance. Due to the prevalence and highly variable etiology of mucociliary dysfunction in respiratory diseases, it is critical to understand the mechanisms controlling multiciliogenesis that may be targeted to restore functional mucociliary clearance. Multicilin, in a complex with E2F4, is necessary and sufficient to drive multiciliogenesis in airway epithelia, however this does not apply to all cell types, nor does it occur evenly across all cells in the same cell population. This project further investigated how co-factors regulate the ability of multicilin to drive multiciliogenesis. Combining data in mouse embryonic fibroblasts and human bronchial epithelial cells (HBECs), RBL2 is identified as a repressor of the transcriptional activity of multicilin. Knockdown of RBL2 in submerged cultures allows for multicilin driven activation of multiciliogenesis. However, phosphorylation of RBL2 and a loss of its ability to interact with multicilin occurs during normal HBEC differentiation. As RBL2 is dispensable for normal differentiation, knock-out of RBL2 allows for increased doubling capacity of HBECs while maintaining differentiation capacity. Further investigation into the mechanisms regulating multicilin and RBL2 revealed a role for NOTCH and AKT signaling in RBL2 phosphorylation, as well as a role for AKT signaling in HBEC differentiation. Further investigation into multicilin induced gene expression indicated a previously unreported induction of DNA replication genes in HBECs, which is unaffected by inhibition of cell cycle through CDK4/6 inhibition. As E2F4 canonically complexes with RBL2 to repress cell cycle genes, a process regulated by CDK4/6, the data presented here offers additional insight into how multiciliated cells co-opt cell cycle regulators during multiciliogenesis. As senescence and loss of functional multiciliated cells are hallmarks of many airway diseases, investigation into pathways affecting RBL2 function may provide insight into how to restore, or prevent loss of, multiciliated cells in disease.

Linked assets

University of Southern California Dissertations and Theses

Conceptually similar

PDF

Mechanisms that dictate beta cells’ response to stress in the context of genetic mutation, pregnancy, and infection

PDF

Transcriptional and epigenetic mechanisms underlying sensory hair cell differentiation and regeneration

PDF

Functional compensation between hematopoietic stem cell clones in vivo

PDF

The organ of Corti sensory progenitor cell competence is controlled by SoxC transcription factors

PDF

Characterization of metabolically distinct muscle resident fibro-adipogenic subpopulations reveals a potentially exploitable mechanism of skeletal muscle aging and disease

PDF

The role of ERK1/2 in mouse embryonic stem cell fate control

PDF

Long-term maintenance of developmental enhancers enables hair cell regeneration in the zebrafish inner ear

PDF

Generation of patterned and functional kidney organoids that recapitulate the adult kidney collecting duct system

PDF

The autism-associated gene SYNGAP1 regulates human cortical neurogenesis

PDF

Fibroblastic connective tissue cells: the blastema stem cells and source of large-scale chondrogenesis in the regenerating lizard tail

PDF

Novel roles for Maf1 in embryonic stem cell differentiation and adipogenesis

PDF

FGFR2 Regulates Connective Tissue Development in the Skull

PDF

Skeletal cell fate plasticity in zebrafish bone development and regeneration

PDF

Shifting topology of stem cells and molecular expression during feather regenerative cycling

PDF

Peripheral myelin protein 22 promotes intestinal epithelial cell survival and barrier function maintenance

PDF

Molecular role of EZH2 overexpression in Colorectal Cancer progression

PDF

Deciphering heterogeneity of preleukemic clonal expansion

PDF

Dissecting the heterogeneity of mouse hematopoietic stem cells in vivo

PDF

Discovery of a novel role for Sonic Hedgehog during the early stages of large-scale murine rib regeneration

PDF

Identification of therapeutic targets for neurons and microglia in amyotrophic lateral sclerosis

Asset Metadata

Creator Quiroz, Erik James (author)

Core Title Mechanisms of airway multiciliated cell differentiation

School Keck School of Medicine

Degree Doctor of Philosophy

Degree Program Development,Stem Cells and Regenerative Medicine

Degree Conferral Date 2024-05

Publication Date 04/23/2024

Defense Date 03/07/2024

Publisher Los Angeles, California (original), University of Southern California (original), University of Southern California. Libraries (digital)

Tag human airway epithelial cells,MCIDAS,multiciliated cells,multicilin,multiciliogenesis,OAI-PMH Harvest,RBL2

Format theses (aat)

Language English

Contributor Electronically uploaded by the author (provenance)

Advisor Georgia, Senta (committee chair), Li, Zhongwei (committee member), Minoo, Parviz (committee member), Ryan, Amy (committee member)

Creator Email erikjamesquiroz@gmail.com,erik-quiroz@uiowa.edu

Permanent Link (DOI) https://doi.org/10.25549/usctheses-oUC113892986

Unique identifier UC113892986

Identifier etd-QuirozErik-12851.pdf (filename)

Legacy Identifier etd-QuirozErik-12851

Document Type Dissertation

Format theses (aat)

Rights Quiroz, Erik James

Internet Media Type application/pdf

Type texts

Source 20240422-usctheses-batch-1143 (batch), University of Southern California (contributing entity), University of Southern California Dissertations and Theses (collection)

Access Conditions The author retains rights to his/her dissertation, thesis or other graduate work according to U.S. copyright law. Electronic access is being provided by the USC Libraries in agreement with the author, as the original true and official version of the work, but does not grant the reader permission to use the work if the desired use is covered by copyright. It is the author, as rights holder, who must provide use permission if such use is covered by copyright.

Repository Name University of Southern California Digital Library

Repository Location USC Digital Library, University of Southern California, University Park Campus MC 2810, 3434 South Grand Avenue, 2nd Floor, Los Angeles, California 90089-2810, USA

Repository Email cisadmin@lib.usc.edu