University of Southern California Dissertations and Theses

A transgenic mouse model with overexpression of human RAGE in endothelial cells presents enhanced amyloid-beta transport into the brain

(USC Thesis Other)

A transgenic mouse model with overexpression of human RAGE in endothelial cells presents enhanced amyloid-beta transport into the brain

PDF

Download a page range

Download transcript

Copy asset link

Request this asset

Transcript (if available)

Content 1

A TRANSGENIC MOUSE MODEL WITH OVEREXPRESSION OF HUMAN
RAGE IN ENDOTHELIAL CELLS PRESENTS ENHANCED AMYLOID-
BETA TRANSPORT INTO THE BRAIN

by
Sanket Vilas Rege

A Thesis Presented to the
FACULTY OF THE USC GRADUATE SCHOOL
UNIVERSITY OF SOUTHERN CALIFORNIA
In Partial Fulfillment of the
Requirements for the Degree
MASTER OF SCIENCE
(PHYSIOLOGY AND BIOPHYSICS)

August 2015
2

Table of Contents

1. Abstract……………………………………………………………………… page 3

2. Introduction………………………………………………………………… page 4

3. Materials and Methods………………………………………………………. page 7

4. Results………………………………………………………………………... page 13

5. Discussion……………………………………………………………………. page 24

6. References…………………………………………………………………… page 27
3

Abstract
The receptor for advanced glycation end-products (RAGE) binds to a repertoire of
ligands resulting in sustained periods of cellular activation and perturbation as observed
in chronic inflammatory responses associated with diabetes, Alzheimer’s disease (AD),
and amyloidoses. Studies have shown that RAGE in the endothelium is a mediator for
cerebral blood flow (CBF) changes, inflammatory cytokines upregulation, as well as
disruption of tight junction proteins resulting from RAGE-ligand interaction, thus
signifying a pivotal role in vascular dysfunction. In this study we have generated Tie2-
hRAGE
+/0
mice, a transgenic mouse model, in order to determine the effects of
overexpressing human RAGE (hRAGE) in endothelial cells. The expression was
confirmed by qRT-PCR, mass spectrometry, Western blotting, and immunofluorescence
staining. We observed an increased influx of Aβ into the brain after systemic
administration of fluorescent-labeled Aβ with these mice; while the levels of transporters
responsible for clearing Aβ from the brain, such as low density lipoprotein receptor-
related protein 1 (LRP1) and p-glycoprotein 1 (Pgp1), remained unaltered. The
expression of tight junction proteins in brain microvessels was also unchanged in these
mice. Thus, we have established a mouse model retaining an intact blood-brain-barrier in
the resting state with hRAGE overexpressed in the endothelium. This mouse model
provides a valuable tool for studying the contribution of vascular RAGE upregulation to
chronic diseases like AD, diabetes, and inflammatory disorders, along with the ability to
target RAGE with inhibitors to assess the potential to rescue the phenotype seen with
disease models alone.

4

Introduction
The receptor for advanced glycation end-products (RAGE) belongs to the
immunoglobulin (Ig) superfamily (Neeper et al. 1992, Xie et al. 2008). This pattern-
recognition receptor binds to a number of ligands including, advanced glycation end-
products (AGEs), S100/calgranulins, amphoterin, and Aβ via its single extracellular V
domain and two C domains, while a short cytoplasmic tail allows for the RAGE-ligand
interaction mediated signaling pathways (Yan et al. 1996, Dattilo et al. 2007). These
pathways typically result in increased cellular stress, which is then amplified by the
enhanced expression of the receptor in environments rich in its ligands; this gives rise to
the continued cellular perturbation and dysfunction as observed in chronic diseases such
as diabetes, inflammation, and Alzheimer’s disease (AD) (Bucciarelli et al. 2002,
Bierhaus et al. 2005, Schmidt et al. 2009).
One of the main pathological characteristics of Alzheimer’s disease (AD) is the
accumulation and deposition of Aβ in the brain and around cerebral vessels. Aβ
accumulation in the brain arises from faulty clearance of the peptide across the blood-
brain barrier (BBB) (Zlokovic 2008, Zlokovic 2011). Endothelial RAGE is specifically
involved in the transport of Aβ across the BBB and into the brain (Deane et al. 2003).
Previous studies have shown that RAGE mediated transport of Aβ at the BBB causes NF-
κB-dependent endothelial cell activation and neuroinflammatory response, as well as
suppression of cerebral blood flow (CBF) via endothelin-1 (ET-1) upregulation (Mackic
et al. 1998a, Deane et al. 2003, Deane et al. 2012). Notably, increased levels of RAGE-
positive brain capillaries have been shown in mouse models of AD as well as in AD
patients (Deane et al. 2004, Jeynes & Provias 2008). The vascular hypothesis of AD
suggests that early cerebrovascular changes lead to brain hypoperfusion and/or BBB
5

breakdown, resulting in accumulation of neurotoxins and subsequent neurodegeneration
(Zlokovic 2011). The interaction of RAGE with Aβ has also been shown to disrupt tight
junction proteins at the BBB (Kook et al. 2012), indicating a role in the vascular
hypothesis of AD and therefore a potential therapeutic target. RAGE also plays a crucial
role in other vascular pathologies associated with chronic disorders. For example, in
diabetic retinopathy, the AGE-RAGE interaction causes vascular hyper-permeability and
thrombogenic reactions in endothelial cells by vascular endothelial growth factor (VEGF)
and plasminogen activator inhibitor-1 (PAI-1) induction (Yamagishi et al. 2006, Matsui
et al. 2010). Endothelial RAGE is also upregulated in patients with chronic bronchitis,
emphysema, and chronic obstructive pulmonary disorder (Morbini et al. 2006, Chen et al.
2014). To better understand the influence of endothelial RAGE expression on the
progression of such chronic inflammatory disorders, we considered its effect in the
absence of any predestined vascular pathology.
Mouse models overexpressing RAGE have been created in the past to study its
role in diabetes-induced vascular injury as well as in ischemia and neuro-inflammation
(Yamamoto et al. 2001, Hassid et al. 2009, Fang et al. 2010, Son et al. 2012). However,
it remains unclear as to whether increased levels of RAGE in an environment bearing
physiologically normal levels of its ligands would have any detrimental effects. Here we
have developed and characterized Tie2-hRAGE
+/0
mice, a transgenic mouse line
overexpressing human RAGE (hRAGE) specifically in endothelial cells under the control
of the Tie-2 promoter. In order to better elucidate the role of RAGE we sought out the
possibility of pathological changes to vasculature resulting solely from overexpressing
hRAGE. We analyzed the expression of hRAGE by qRT-PCR, mass spectrometry,
Western blotting, and immunohistochemistry. We measured the levels of other BBB
receptors and tight junction proteins to assess the integrity of the brain endothelium. We
6

then determined the proper functioning of the receptor by in vivo optical imaging of
systemically administered Cy5.5-Aβ
1-40
. This mouse model facilitates developing our
understanding of the impact of vascular RAGE up-regulation to chronic inflammatory
diseases.
All experiments, data analyses, and figures presented in this thesis were
performed and produced by me, Sanket V. Rege, under the guidance of my committee
chair and principal investigator, Dr. Berislav V. Zlokovic, with the exception of the
construction of the transgene and subsequent microinjection into pronuclear eggs,
resulting in the transgenic mice that are characterized here, which was conducted by Dr.
Ekaterina Hatch in conjunction with the Transgenic Core at the University of Rochester,
NY.

7

Materials and Methods
Construction of transgenic mice
A mouse 2.1-kb Tie-2 promoter was PCR amplified from the pT2HlacZpA11.7 vector
(provided by T.N. Sato, Harvard Medical School) using primers K45/K46 (see List of
primers) and cloned into the SalI site of pBluescriptSK vector (Stratagene, La Jolla, CA)
via “in-fusion” ligation (Clontech, Mountain View, CA). The Tie-2 enhancer, comprising
the 10.5-kbp first intron sequences of the murine Tie-2 gene, was cut out of the
pT2HlacZpA11.7 vector via NaeI/SalI sites and ligated into the newly generated Tie-2
promoter Bluescript vector. The 1.3-kbp hRAGE cDNA (clone ID: 4718076 Thermo
Scientific, Waltham, MA) was cloned between the Tie-2 promoter and enhancer to
generate Tie2-hRAGE via ClaI site using primers K66/K67 (see List of primers). This
cloning step was also performed as “in-fusion” ligation; the Kozak sequence (GCCACC)
and a SMV polyA tail were attached to hRAGE for proper in vivo processing. The final
construct was microinjected into pronuclear mouse eggs at the University of Rochester
Transgenic Core (Schlaeger et al. 1997). The generated founder transgenes were
characterized and line propagation developed. To screen for transgenic mice, genomic
DNA was isolated from tail biopsies and PCR-analyzed using primers K81/K82 (see List
of primers) (Yamamoto et al. 2001).
qRT-PCR
Total RNA was isolated from various tissues of control and transgenic mice using SV
Total RNA Isolation System (Z3100, Promega, Madison, WI). Primer sequences for
hRAGE mRNA detection were 5’-AAGCCCCTGGTGCCTAATGAG-3’ and 5’-
CACCAATTGGACCTCCTCCA-3’ (nucleotides 508-528 and 728-747 in GenBank
8

AB036432); those for mouse GAPDH mRNA detection were 5’-
ACCACAGTCCATGCCATCAC -3’ and 5’- CACCACCCTGTTGCTGTAGCC -3’
(GenBank M32599). RT-qPCR was performed using qScript One-Step SYBR Green
qRT-PCR Kit, ROX (95088-050, Quanta Biosciences, Gaithersburg, MD). The RT-PCR
products from the brain and heart of the control and transgenic mice were run on 2%
agarose gel containing ethidium bromide. The relative hRAGE expression in the
transgenic mice was calculated using the ΔΔCq method using GAPDH as an internal
control for normalizing data.
Immunoprecipitation and mass spectrometry analysis of hRAGE
hRAGE was immunoprecipiated from isolated brain micovessels of Tie2-hRAGE
+/0
mice
for subsequent confirmation by mass spectrometry analysis. Brain microvessels were
isolated as described previously (Wu et al. 2003). Immunoprecipitation of hRAGE was
performed using Dynabeads Protein G Immunoprecipitation Kit (10007D, Life
Technologies, Carlsbad, CA) following the manufacturer’s protocol. 6.5µg of mouse
anti-hRAGE (MAB1145, R&D Systems, Minneapolis, MN) was used for binding to the
Dynabeads. Crosslinking was done using 5mM BS
3
crosslinkers (21585, Thermo
Scientific). 5µg of immunoprecipitated protein sample was then subjected to tryptic
digestion using In-solution Tryptic Digestion and Guanidination Kit (89895, Thermo
Scientific) according to the manufacturer’s instructions, with the exception of the
guanidination step. The sample was then cleaned and prepped for mass spectrometry
analysis using Pierce C18 Spin Columns (89870, Thermo Scientific). Mass spectrometry
was conducted at the USC Proteomics Core using Orbitrap LC-MS (Thermo Scientific)
to confirm protein identity and sequence.
Immunoblotting of isolated brain microvessels and microvessel-depleted brains
9

Brain microvessels from control and Tie2-hRAGE
+/0
mice were isolated, as we described
previously (Wu et al. 2003). Microvessel-depleted brains and microvessels were lysed in
RIPA buffer (50 mM Tris, pH 8.0, 150 mM NaCl, 0.1% SDS, 1.0% NP-40, 0.5% sodium
deoxycholate and Roche protease inhibitor cocktail). Samples were then subjected to gel
electrophoresis using 4–12% NuPAGE Tris-Acetate gels (Life Technologies), with 6μg
loaded for microvessels and 100 μg for depleted brains, and transferred to a nitrocellulose
membrane. Membranes were blocked with 5% milk, incubated with primary antibody
overnight at 4 °C, and then incubated with the appropriate HRP-conjugated secondary
antibody for 1 hour at room temperature. The primary antibodies used were goat anti-
hRAGE (AF1145, R&D Systems), rabbit anti-LRP85 (AB92544, ABCAM, Cambridge,
England), mouse anti-Pgp1 (517310, Calbiochem,), rabbit anti-ZO-1 (40-2200, Life
Technologies), rabbit anti-Claudin-5 (AB15106, ABCAM), rabbit anti-Occludin
(AB167161, ABCAM), and rabbit anti-β-actin (Cell Signaling, Danvers, MA).
Membranes were then treated with Immobilon Western ECL detection buffers (Millipore,
Billerica, MA), exposed to CL-XPosure film (Thermo Scientific) and developed in X-
OMAT 3000 RA film processor (Kodak, Rochester, NY). The relative abundance of
studied proteins in microvessels and depleted brains was determined with scanning
densitometry and β-actin as a loading control.
Immunofluorescent and fluorescent staining
Mice were anesthetized intraperitoneally with 100mg/kg ketamine and10mg/kg xylazine
and transcardially perfused with phosphate buffer saline (PBS) containing EDTA. Brains
were dissected and embedded into optimal cutting temperature (OCT) compound (Tissue-
Tek, Torrance, CA) on dry ice. OCT embedded fresh frozen brain tissue sections were
cryosectioned at a thickness of 20µm and subsequently fixed in ice cold 4%
paraformaldehyde. Sections were blocked with 5% normal donkey serum (Jackson
10

Immunolaboratories) for 60 min and incubated in primary antibody diluted in blocking
solution overnight at 4 °C. Sections were washed in PBS and incubated with fluorophore-
conjugated secondary antibodies. To visualize brain microvessels, sections were also
incubated with biotin- or fluorescein-conjugated L. esculentum lectin (1:200, Vector
Labs, Burlingame, CA). Sections were subsequently coverslipped with fluorescent
mounting medium (Dako, Glostrup, Denmark). Primary antibodies used were goat anti-
hRAGE (1:100, AF1145, R&D Systems), rabbit monoclonal anti-Pdgfrβ (1:100, #3169,
Cell Signaling), and rabbit monoclonal anti-CD13 (1:100, #AB10831, ABCAM). Similar
staining protocol was used for the isolated brain microvessels after cytospinning onto
slides.
Labeling of Aβ
1-40
with Cy5.5 NHS Ester
Synthetic human Aβ
1-40
and Aβ
40-1
(scrambled Aβ) was purchased from Biopeptides Co.,
Inc (San Diego, CA). Cy5.5 labeling kits (Cy5.5™ Mono NHS ester) and free Cy5.5
were purchased from Lumiprobe. Aβ
1-40
and Aβ
40-1
(1mg, molecular weight 4330D) were
labeled with the near infrared fluorescent dye Cy5.5 (molecular weight 1128.42D) using
the labeling kit (Cy5.5™ Mono NHS ester) as per manufacturer’s instructions. 1 mg of
Aβ peptides was dissolved in 250µl of 10mM NaOH, 12.5µl 1M HEPES (H4034, Sigma-
Aldrich, St. Louis, MO), and 80µl of carbonate buffer (pH 9.1), 45µl of Cy5.5 NHS Ester
(400µg in DMSO) was added to this and incubated for 3 hours at room temperature
(Zhang et al. 2013). Free Cy5.5 was subjected to the same treatment in the absence of
peptides. The labeled peptide was purified using a column Microcon Ultracel YM-3
(Regenerated cellulose 3000 MWCO, Millipore) to remove any unincorporated Cy5.5.
The amount of labeled peptides was quantified using a BCA Protein Assay kit (Thermo
Scientific) following the manufacturer’s instructions (Zhang et al. 2013).
11

Optical imaging of Cy5.5-Aβ
1-40
in vivo
Control and Tie2-hRAGE
+/0
mice, 2-3 month old, were injected via the tail vein with free
Cy5.5 dye (~100μg in 60μl volume), or Cy5.5-labeled Aβ
40-1
or Aβ
1-40
(~100μg in 60μL
volume) and were imaged at specific time points post injection. The animals were
anesthetized with inhaled isoflurane (3% for induction and 1% for maintenance) and the
hair from the head was completely removed using hair removal cream prior to the
experiment. Image capture was performed using the iBox Explorer2 Imaging
Microscope. Mice were placed on the imaging stage, maintained at 37°C, for the duration
of each imaging experiment. Image acquisition was accomplished using the OptiChemi
610 CCD camera, cooled to 55°C below ambient, and an optical system consisting of
interchangeable custom lenses. Bright field and fluorescence images were captured
separately at 1x1 binning for each time point with a neutral density and a 710BP40nm
emission filter, respectively. Excitation of Cy5.5 utilized the BioLite™ Xe MultiSpectral
Light Source (UVP, LLC) with a 630/45 nm band pass excitation filter. Each NIR
fluorescence image was histogram-adjusted and pseudo colored using VisionWorks®LS
Acquisition and Analysis Software (UVP, LLC). To quantitate the signal intensity for
each image, an area density measurement window was selected for a region of interest
(ROI) on each raw image using ImageJ. Background intensity was then subtracted from
this value to calculate mean density. All data points were normalized to the average
signal intensity at 90 minutes in the control mice. The half-life of the fluorescence
intensity was determined by representing the signal intensity profiles of each mouse on a
logarithmic scale and acquiring the slopes for the increasing and decreasing phases of the
curve.

12

List of primers
Name Sequence Application

K45

3’-CCCCCTCGAGGTCGACAAGCTTACTAAGATCTAATGAAAATCAAGA-5’

In-fusion for Tie-2
promoter (forward).

K46

3’-TATCGATACCGTCGAAAGCTTTCAACAACTCACAACTTTGC-5’

In-fusion for Tie-2
promoter (reverse).

K66

3’-AGGTCGACGGTATCGGCCACCATGGCAGCCGGAA-5’
In-fusion for Tie2-
hRAGE construct
(forward).

K67

3’-ATATCAAGCTTATCGCGACGGTATACAGACATGATAAGA-5’
In-fusion for Tie2-
hRAGE construct
(reverse).

K81

3’-CTGAAAATGCTGACCAGGACCT-5’

Tie-2-RAGE transgenic
screening (forward).

K82

3’-GAAGAGGGAGCCGTTGGGAA-5’

Tie-2-RAGE transgenic
screening (reverse).
Statistics
All data were analyzed by Student's t-test. A p-value less than 0.05 was considered
statistically significant.

13

Results
Expression of hRAGE transgene
Tie2-hRAGE
+/0
mice were created by introducing a transgene with hRAGE DNA,
under the control of the endothelial-specific murine Tie-2 promoter (Schlaeger et al.
1997, De Palma et al. 2003), into fertilized ova of C57BL/6J mice (Figure 1A). PCR
analysis using primers specific to Tie2-hRAGE transgene confirmed the genotype of the
progeny (Figure 1B). Active transcription of hRAGE was observed by qRT-PCR in the
brain, heart, lungs, liver, kidney, muscle, and skin tissue of transgenic mice but not in
age-matched controls (Figure 2). hRAGE was immunoprecipitated from isolated brain
microvessel lysates of transgenic mice using an antibody against hRAGE. This was then
analyzed by mass spectrometry for protein identification and sequencing, confirming that
it was in fact hRAGE (Figure 2B, top graph). Furthermore, S100A was detected in the
protein sample illustrating that a ligand for RAGE had been co-immunoprecipitated with
the receptor (Figure 2B, bottom graph). Immunofluorescence examination of isolated
brain microvessels demonstrated that the Tie2-hRAGE
+/0
mice expressed hRAGE and co-
localized significantly with the vessel marker biotinylated lectin, while there was no
expression of hRAGE in the age-matched controls or with non-immune IgG (Figure 3A).
Immunofluorescence staining for pericytes using antibodies against the pericyte-marker
CD13 along with those against hRAGE showed no co-localization with pericyte cell
bodies in isolated brain microvessels (Figure 3B). High magnification confocal
microscopy analysis of hRAGE distribution in the mouse brain capillary endothelium in
situ confirmed predominant hRAGE localization on the luminal (apical) side of the brain
endothelium (Figure 3C) as observed with endogenous mouse RAGE (Cheng et al.
2005).
14

Figure 1. Transgenic constructs and PCR analysis. (A) A mouse Tie-2 promoter was cloned
into the SalI site of pBluescriptSK (pBS) vector and the Tie-2 enhancer was ligated into the newly
generated Tie-2 promoter pBS vector. The hRAGE cDNA was then cloned between the Tie-2
promoter and enhancer to generate Tie2-hRAGE construct. (B) Genomic DNA isolated from tail
biopsies of progeny was PCR-analyzed using primers K81/K82 to determine genotype. Lanes 1
and 3 show positive bands for Tie2-hRAGE
+/0
expressing mice.

15

Figure 2. Confirmation of hRAGE transgene expression. (A) Representative image of cDNA
products after qRT-PCR of RNA isolated from various tissues. (B) The relative gene expression of
hRAGE in 3 month old Tie2-hRAGE
+/0
mice in comparison to age-matched controls (n=3). (C)
Mass spectrometry analysis of hRAGE immunoprecipitated from isolated brain microvessels.
S100/calgranulins, a ligand for RAGE, was co-imuunoprecipitated. Top panel; Sequence:
VLSPQGGGPWDSVAR, Identified with: SEQUEST (v1.20); XCorr: 3.67, Probability: 0.00, Ions
matched by search engine: 17/28, Fragments used for search: b; b-H ₂O; b-NH ₃; y; y-H ₂O; y-NH ₃.
Bottom panel; Sequence: LLETECPQYIR, C6-Carbamidomethyl (57.02146 Da), Identified with:
SEQUEST (v1.20); XCorr: 3.45, Probability: 0.00, Ions matched by search engine: 16/20,
Fragments used for search: b; b-H ₂O; b-NH ₃; y; y-H ₂O; y-NH ₃.
16

Figure 3. Expression of hRAGE limited to endothelium. (A) Immunofluorescence staining of
isolated brain microvessels from Tie2-hRAGE
+/0
mice and controls at 3 months of age using anti-
hRAGE specific polyclonal antibody and vessel-marker biotinylated lectin. Yellow represents co-
localization between hRAGE and endothelial cells. (B) Immunofluorescence staining of isolated
brain microvessels from Tie2-hRAGE
+/0
mice at 3 months of age using anti-hRAGE specific
polyclonal antibody, vessel-marker biotinylated lectin, and pericyte-marker CD13. Yellow
represents co-localization between hRAGE and endothelial cells. Cyan represents co-localization
between hRAGE and pericyte processes. (C) A representative high magnification confocal
scanning analysis of lectin-positive endothelium (red), hRAGE immunodetection in the capillary
endothelium (green), and pericyte-marker Pdgfrβ (blue) in brain in situ in a Tie2-hRAGE
+/0
mouse.
Merged: yellow. Chart: hRAGE relative signal intensity (green) plotted over the endothelial-
specific lectin signal intensity (red) and the pericyte-marker Pdgfrβ signal intensity (blue). A
indicates abluminal side; L, luminal side.
17

Expression of other blood-brain-barrier proteins
Immunoblotting of isolated brain microvessels from Tie2-hRAGE
+/0
and age-
matched control mice demonstrated no difference in the expression levels of low density
lipoprotein receptor-related protein 1 (LRP1) and P-glycoprotein 1 (Pgp-1) at 3 months of
age (Figure 4). There was also no expression of hRAGE in the control mice, as seen by
the absence of a positive band with the anti-hRAGE antibody (Figure 4). Immunoblotting
against tight junction proteins ZO-1, occludin, and claudin-5 in isolated brain
microvessels from transgenic and age-matched controls revealed no statistically
significant difference in their expression levels at 3 months of age (Figure 5).

Figure 4. Expression of other cell-surface receptors and transporters in brain endothelium.
Western blotting of isolated brain microvessels from Tie2-hRAGE
+/0
mice and age-matched
controls at 3 months of age with antibodies against LRP-85, Pgp1, and hRAGE. Densitometric
analysis of band intensities shows relative levels of LRP-85, Pgp1, and hRAGE normalized to
actin in Tie2-hRAGE
+/0
mice and age-matched controls at 3 months of age (n=4).

18

Figure 5. Expression of tight junction proteins in brain endothelium. Western blotting of
isolated brain microvessels from Tie2-hRAGE
+/0
mice and age-matched controls at 3 months of
age with antibodies against tight junction proteins ZO-1, occluding, and claudin-5. Densitometric
analysis of band intensities shows relative levels of tight junction proteins ZO-1, occludin, and
claudin-5 normalized to actin in Tie2-hRAGE
+/0
mice and age-matched controls at 3 months of age
(n=4).

19

Functional analysis of hRAGE
In order to assess the proper functioning of hRAGE in vivo, Cy5.5-labeled
amyloid-beta (Cy5.5-Aβ
1-40
) was administered systemically and the fluorescence intensity
from shaved heads of control and transgenic mice was measured over a period of 6 hours
(Figure 6A). To control for any variation in the amount of Cy5.5-Aβ
1-40
administered to
each animal, all intensity values were normalized to the initial signal measured
immediately after systemic injection of the fluorescent peptide (Figure 6B). Cy5.5-
labeled scrambled amyloid beta (Cy5.5-Aβ
40-1
) and free Cy5.5 was used as a negative-
control for the experiment (Figure 6C). Pseudo-colored images of the fluorescence
intensities from the head ROIs of Tie2-hRAGE
+/0
mice exhibited greater intensity than
age-matched controls at 60, 120, 240, and 300 minutes after injection (Figure 7A). The
period from 90 minutes to 360 minutes after injection was used to analyze differences in
intensity and Cy5.5-Aβ
1-40
kinetics between the control and transgenic mice as this
represented a relatively stable period after the initial surge and subsequent decline in
intensity from the administration of the fluorescent peptide and circulation in the
bloodstream respectively (Zhang et al. 2013). The average fluorescence intensity
measured from the head ROIs of control mice at 90 minutes was thus set to 1, and all
other intensities were presented as relative to that value (Figure 7B). The fluorescence
intensities from the head ROIs of Tie2-hRAGE
+/0
mice were significantly higher (p<0.05)
than that of age-matched controls at 120, 150, 180, and 240 minutes after Cy5.5-Aβ
1-40

injection (Figure 7B). To rule out the possibility of differences in fluorescence intensity
resulting from intracranial vasculature, phosphate-buffered saline (PBS) perfused brains
were imaged ex vivo 150 minutes after injection. Pseudo-colored images of the brains
revealed a higher intensity signal from the Tie2-hRAGE
+/0
brain in comparison to the
control brain (Figure 7C). Analysis of the average peak signal from each mouse in vivo
20

demonstrated a 4-fold increase in (p<0.05) fluorescence intensity from the ROIs of
transgenic mice in comparison to that of age-matched controls (Figure 8A). In order to
compare the dynamics of Cy5.5-Aβ
1-40
in Tie2-hRAGE
+/0
mice, the slopes of the two
phases of the fluorescence intensity profile were determined and compared to that of the
control mice (Figure 8B). The Tie2-hRAGE
+/0
mice presented an approximately 4 times
greater slope in the influx phase and retention phases with respect to age-matched
controls. Further analysis of Cy5.5-Aβ
1-40
dynamics were established by taking the log of
the intensities for each phase in each mouse and calculating the half-life, i.e. the time
taken to reach half the peak signal in either phase (Figure 8C). The fluorescence intensity
half-life for the influx phase was nearly 3 times faster in Tie2-hRAGE
+/0
mice (t1/2 =
23.45 ± 6.25 minutes) compared to control mice (t1/2 = 61.16 ± 20.59 minutes), while the
half-life decay for the retention phase was about 1.5 times slower in Tie2-hRAGE
+/0
mice
(t1/2 = 93.58 ± 30.58 minutes) compared to control mice (t1/2 = 56.72 ± 6.37 minutes),
further illustrating the trend observed with the comparison of the slopes.
21

Figure 6. Optical imaging of Cy5.5- A β
1-40
in vivo. (A) Representative image showing head ROI
for measuring the fluorescence intensity after intravenous administration of Cy5.5-Aβ
1-40
or Cy5.5-
Aβ
scrambled
. White box shows area used for quantitative analysis of fluorescence intensity. (B)
Pseudo-colored representative images shows the relative fluorescence intensities from the ROIs of
a Tie2-hRAGE
+/0
mouse and age-matched control at 3-4 months of age at 100, 200, and 300
minutes after scrambled Cy5.5-Aβ
40-1
injection. (C) Fluorescence intensity profile from the ROIs
of Tie2-hRAGE
+/0
mice and age-matched controls at 3-4 months of age (n=2) injected with
scrambled Cy5.5-Aβ
40-1
. (D) Fluorescence intensity profile from the ROIs of Tie2-hRAGE
+/0
mice
and age-matched controls at 3-4 months of age (n=6) injected with Cy5.5-Aβ
1-40
. All intensity
values were normalized to the initial intensity value within the transgenic and control groups
before averaging. Black box shows period of profile used for analysis of Cy5.5-Aβ
1-40
dynamics.
22

Figure 7. Relative fluorescence intensities after administration of Cy5.5-A β
1-40
. (A) Pseudo-
colored representative images shows the relative fluorescence intensities from the ROIs of a Tie2-
hRAGE
+/0
mouse and age-matched control at 3-4 months of age at 60, 120, 240, and 300 minutes
after Cy5.5-Aβ
1-40
injection. (B) The time-dependent fluorescence intensities measured between
90 and 360 minutes. The data is represented as relative fluorescence intensity normalized to that of
WT average at 90 minutes (means + SEM, n=6). *, p<0.05, student t-test, Tie2-hRAGE
+/0
vs. WT
for each time point. (C) Pseudo-colored representative images shows the relative fluorescence
intensities ex vivo from the brains of a Tie2-hRAGE
+/0
mouse and age-matched control 150
minutes after Cy5.5-Aβ
1-40
injection.

23

Figure 8. Comparison of Cy5.5- A β
1-40
dynamics in transgenic and WT mice. (A) The peak
fluorescence intensities from the ROIs of Tie2-hRAGE
+/0
mice represented as relative to that of
age-matched controls at 3-4 months of age (means + SEM, n=6). (B) The slopes of the
fluorescence intensities profiles from the ROIs of Tie2-hRAGE
+/0
mice and age-matched controls
at 3-4 months of age (means, n=6). The fluorescence intensity profile was separated into an influx
and retention phase based on the time of the peak signal. (C) The half-lives for the two phases of
the fluorescence intensity profile from the ROIs of Tie2-hRAGE
+/0
mice and age-matched controls
at 3-4 months as determined from the logs of the intensity profiles for each individual mouse
(means + SEM, n=6).

24

Discussion
In this study, we demonstrated by the in vivo tracking of the near-infrared
fluorescent tracer Cy5.5 conjugated to Aβ peptide that Tie2-hRAGE
+/0
mice
overexpressing hRAGE specifically in endothelial cells show a significant increase in the
influx of Aβ into the brain. Previous studies have determined Cy5.5-Aβ
1-40
to be stable in
circulation for up to 8 hours, presenting a similar biodistribution and elimination kinetics
to that observed with the more commonly used [
125
I]-Aβ peptides (Zhang et al. 2013,
Mackic et al. 1998b). Since approximately 80% of [
125
I]-Aβ is cleared from circulation an
hour after administration in an adult monkey (Mackic et al. 2002), our analysis was
conducted 90 minutes after administration of Cy5.5-Aβ
1-40
, representing fluorescence
signal measured predominantly from the brain rather than surrounding vasculature.
Quantitative analysis of the peak signal intensities illustrated that there was up to 4 times
more Cy5.5-Aβ
1-40
accumulated in the transgenic mice brains in comparison to control
mice. Furthermore, analysis of the rising phase of the intensity profile demonstrated a 3-
fold increase in the rate of influx with Tie2-hRAGE
+/0
. This indicates a fully functional
hRAGE being overexpressed in the vasculature of these mice. We confirmed the
difference in fluorescence intensity of Cy5.5-Aβ
1-40
was originating from within the brain
by imaging perfused brains ex vivo 150 minutes after administration. Interestingly, there
was also a decrease in the rate of Cy5.5-Aβ
1-40
retention, rousing the possibility of altered
levels of expression of other transporters and receptors of Aβ in the transgenic mice.
LRP1 is one such receptor that mediates transport of Aβ peptides out of the brain, and is
downregulated in normal aging rodents and humans, as well as in AD models and AD
patients (Deane et al. 2004, Donahue et al. 2006). Pgp-1 is another receptor that is
involved in the efflux of Aβ and it too is implicated in AD (Cirrito et al. 2005). However,
levels of both LRP1 and Pgp-1 were unchanged in the Tie2-hRAGE
+/0
mice. Since
25

hRAGE expression results in more Cy5.5-Aβ
1-40
being transported into the brain, it is
likely that there is simply more available for clearance by other Aβ transporters present at
physiologically normal levels, unlike that seen with disease mouse models.
The interaction of RAGE with its ligands, specifically Aβ peptides, has been
shown to promote a change in the levels of tight junction protein expression at the BBB
(Carrano et al. 2011, Kook et al. 2012). The disruption of the BBB was characterized by
significant reductions in occludin, claudin-5, and ZO-1 in the studies; these changes were
all associated with an increased expression of RAGE. Furthermore, the phenotype was
reversed upon blocking RAGE (Carrano et al. 2011). Since the Aβ-RAGE interaction is
implicated in the breakdown of the BBB it was imperative to determine if overexpression
of hRAGE alone would cause any disruption to tight junction proteins of the brain
endothelium. Analysis of tight junction protein levels in brain microvessels of Tie2-
hRAGE
+/0
proved no alterations. This further clarifies the point that the overexpression of
hRAGE is the solitary reason for greater Cy5.5-Aβ
1-40
fluorescence intensity arising from
the head ROIs of the transgenic mice, owing to increased transport of the peptide across
the BBB and into the brain.
In summary, Tie2-hRAGE
+/0
mice offer a strong tool to further elucidate the
extent to which endothelial RAGE expression mediates vascular changes in chronic
diseases like AD, diabetes, and inflammatory disorders. Since these mice present no
pathological changes to their vasculature, it would be valuable to see whether crossing
these mice with disease models of AD or diabetes would exacerbate the pathological
changes detected in the disease models alone. Previous studies have demonstrated that
RAGE overexpression in neurons resulted in increased stroke volumes after ischemia
(Hassid et al. 2009), while another group observed increased glomerular hypertrophy
after crossing hRAGE overexpressing mice with a diabetes model (Yamamoto et al.
26

2001). Examination of the BBB after crossing Tie2-hRAGE
+/0
mice with a diabetic mouse
model would give relevant insight into the common mechanisms underlying the vascular
dysfunction in AD and diabetes. In addition, currently established RAGE inhibitors could
be utilized both in vivo and in vitro with this model to distinguish the impact of RAGE
overexpression on disease progression (Deane et al. 2012). It is already known that
RAGE is an important mediator of the inflammatory response behind chronic diseases,
and that as RAGE expression increases with its activation the RAGE-ligand interaction
results in an amplified stress response. We can now determine whether a higher level of
RAGE expression preceding onset of disease pathology contributes to disease
progression.

27

References
Bierhaus, A., Humpert, P. M., Morcos, M., Wendt, T., Chavakis, T., Arnold, B., Stern, D.
M. and Nawroth, P. P. (2005) Understanding RAGE, the receptor for advanced
glycation end products. J Mol Med (Berl), 83, 876-886.
Bucciarelli, L. G., Wendt, T., Rong, L. et al. (2002) RAGE is a multiligand receptor of
the immunoglobulin superfamily: implications for homeostasis and chronic
disease. Cell Mol Life Sci, 59, 1117-1128.
Carrano, A., Hoozemans, J. J., van der Vies, S. M., Rozemuller, A. J., van Horssen, J.
and de Vries, H. E. (2011) Amyloid Beta induces oxidative stress-mediated
blood-brain barrier changes in capillary amyloid angiopathy. Antioxid Redox
Signal, 15, 1167-1178.
Chen, L., Wang, T., Guo, L., Shen, Y., Yang, T., Wan, C., Liao, Z., Xu, D. and Wen, F.
(2014) Overexpression of RAGE Contributes to Cigarette Smoke-Induced Nitric
Oxide Generation in COPD. Lung, 192, 267-275.
Cheng, C., Tsuneyama, K., Kominami, R. et al. (2005) Expression profiling of
endogenous secretory receptor for advanced glycation end products in human
organs. Mod Pathol, 18, 1385-1396.
Cirrito, J. R., Deane, R., Fagan, A. M. et al. (2005) P-glycoprotein deficiency at the
blood-brain barrier increases amyloid-beta deposition in an Alzheimer disease
mouse model. J Clin Invest, 115, 3285-3290.
Dattilo, B. M., Fritz, G., Leclerc, E., Kooi, C. W., Heizmann, C. W. and Chazin, W. J.
(2007) The extracellular region of the receptor for advanced glycation end
products is composed of two independent structural units. Biochemistry, 46,
6957-6970.
28

De Palma, M., Venneri, M. A. and Naldini, L. (2003) In vivo targeting of tumor
endothelial cells by systemic delivery of lentiviral vectors. Hum Gene Ther, 14,
1193-1206.
Deane, R., Du Yan, S., Submamaryan, R. K. et al. (2003) RAGE mediates amyloid-beta
peptide transport across the blood-brain barrier and accumulation in brain. Nat
Med, 9, 907-913.
Deane, R., Singh, I., Sagare, A. P. et al. (2012) A multimodal RAGE-specific inhibitor
reduces amyloid β-mediated brain disorder in a mouse model of Alzheimer
disease. J Clin Invest, 122, 1377-1392.
Deane, R., Wu, Z., Sagare, A. et al. (2004) LRP/amyloid beta-peptide interaction
mediates differential brain efflux of Abeta isoforms. Neuron, 43, 333-344.
Donahue, J. E., Flaherty, S. L., Johanson, C. E. et al. (2006) RAGE, LRP-1, and amyloid-
beta protein in Alzheimer's disease. Acta Neuropathol, 112, 405-415.
Fang, F., Lue, L. F., Yan, S. et al. (2010) RAGE-dependent signaling in microglia
contributes to neuroinflammation, Abeta accumulation, and impaired
learning/memory in a mouse model of Alzheimer's disease. FASEB J, 24, 1043-
1055.
Giri, R., Shen, Y., Stins, M., Du Yan, S., Schmidt, A. M., Stern, D., Kim, K. S.,
Zlokovic, B. and Kalra, V. K. (2000) beta-amyloid-induced migration of
monocytes across human brain endothelial cells involves RAGE and PECAM-1.
Am J Physiol Cell Physiol, 279, C1772-1781.
Hassid, B. G., Nair, M. N., Ducruet, A. F., Otten, M. L., Komotar, R. J., Pinsky, D. J.,
Schmidt, A. M., Yan, S. F. and Connolly, E. S. (2009) Neuronal RAGE
expression modulates severity of injury following transient focal cerebral
ischemia. J Clin Neurosci, 16, 302-306.
29

Jeynes, B. and Provias, J. (2008) Evidence for altered LRP/RAGE expression in
Alzheimer lesion pathogenesis. Curr Alzheimer Res, 5, 432-437.
Kook, S. Y., Hong, H. S., Moon, M., Ha, C. M., Chang, S. and Mook-Jung, I. (2012)
Aβ₁₋₄₂-RAGE interaction disrupts tight junctions of the blood-brain barrier via
Ca² ⁺-calcineurin signaling. J Neurosci, 32, 8845-8854.
Mackic, J. B., Bading, J., Ghiso, J., Walker, L., Wisniewski, T., Frangione, B. and
Zlokovic, B. V. (2002) Circulating amyloid-beta peptide crosses the blood-brain
barrier in aged monkeys and contributes to Alzheimer's disease lesions. Vascul
Pharmacol, 38, 303-313.
Mackic, J. B., Stins, M., McComb, J. G. et al. (1998a) Human blood-brain barrier
receptors for Alzheimer's amyloid-beta 1- 40. Asymmetrical binding,
endocytosis, and transcytosis at the apical side of brain microvascular endothelial
cell monolayer. J Clin Invest, 102, 734-743.
Mackic, J. B., Weiss, M. H., Miao, W., Kirkman, E., Ghiso, J., Calero, M., Bading, J.,
Frangione, B. and Zlokovic, B. V. (1998b) Cerebrovascular accumulation and
increased blood-brain barrier permeability to circulating Alzheimer's amyloid
beta peptide in aged squirrel monkey with cerebral amyloid angiopathy. J
Neurochem, 70, 210-215.
Matsui, T., Takeuchi, M. and Yamagishi, S. (2010) Involvement of aldosterone-
mineralocorticoid receptor system in advanced glycation end product (AGE)-
elicited plasminogen activator inhibitor-1 (PAI-1) expression in diabetes. Int J
Cardiol, 145, 566-567.
Morbini, P., Villa, C., Campo, I., Zorzetto, M., Inghilleri, S. and Luisetti, M. (2006) The
receptor for advanced glycation end products and its ligands: a new inflammatory
pathway in lung disease? Mod Pathol, 19, 1437-1445.
30

Neeper, M., Schmidt, A. M., Brett, J., Yan, S. D., Wang, F., Pan, Y. C., Elliston, K.,
Stern, D. and Shaw, A. (1992) Cloning and expression of a cell surface receptor
for advanced glycosylation end products of proteins. J Biol Chem, 267, 14998-
15004.
Schlaeger, T. M., Bartunkova, S., Lawitts, J. A., Teichmann, G., Risau, W., Deutsch, U.
and Sato, T. N. (1997) Uniform vascular-endothelial-cell-specific gene
expression in both embryonic and adult transgenic mice. Proc Natl Acad Sci U S
A, 94, 3058-3063.
Schmidt, A. M., Sahagan, B., Nelson, R. B., Selmer, J., Rothlein, R. and Bell, J. M.
(2009) The role of RAGE in amyloid-beta peptide-mediated pathology in
Alzheimer's disease. Curr Opin Investig Drugs, 10, 672-680.
Son, S. M., Jung, E. S., Shin, H. J., Byun, J. and Mook-Jung, I. (2012) Aβ-induced
formation of autophagosomes is mediated by RAGE-CaMKKβ-AMPK signaling.
Neurobiol Aging, 33, 1006.e1011-1023.
Sturchler, E., Galichet, A., Weibel, M., Leclerc, E. and Heizmann, C. W. (2008) Site-
specific blockade of RAGE-Vd prevents amyloid-beta oligomer neurotoxicity. J
Neurosci, 28, 5149-5158.
Takuma, K., Fang, F., Zhang, W. et al. (2009) RAGE-mediated signaling contributes to
intraneuronal transport of amyloid-beta and neuronal dysfunction. Proc Natl
Acad Sci U S A, 106, 20021-20026.
Wu, Z., Hofman, F. M. and Zlokovic, B. V. (2003) A simple method for isolation and
characterization of mouse brain microvascular endothelial cells. J Neurosci
Methods, 130, 53-63.
Xie, J., Reverdatto, S., Frolov, A., Hoffmann, R., Burz, D. S. and Shekhtman, A. (2008)
Structural basis for pattern recognition by the receptor for advanced glycation
end products (RAGE). J Biol Chem, 283, 27255-27269.
31

Yamagishi, S., Nakamura, K., Matsui, T. et al. (2006) Pigment epithelium-derived factor
inhibits advanced glycation end product-induced retinal vascular
hyperpermeability by blocking reactive oxygen species-mediated vascular
endothelial growth factor expression. J Biol Chem, 281, 20213-20220.
Yamamoto, Y., Kato, I., Doi, T. et al. (2001) Development and prevention of advanced
diabetic nephropathy in RAGE-overexpressing mice. J Clin Invest, 108, 261-268.
Yan, S. D., Chen, X., Fu, J. et al. (1996) RAGE and amyloid-beta peptide neurotoxicity
in Alzheimer's disease. Nature, 382, 685-691.
Yan, S. D., Yan, S. F., Chen, X. et al. (1995) Non-enzymatically glycated tau in
Alzheimer's disease induces neuronal oxidant stress resulting in cytokine gene
expression and release of amyloid beta-peptide. Nat Med, 1, 693-699.
Yan, S. F., Ramasamy, R. and Schmidt, A. M. (2010) The RAGE axis: a fundamental
mechanism signaling danger to the vulnerable vasculature. Circ Res, 106, 842-
853.
Zhang, W., Xiong, H., Callaghan, D., Liu, H., Jones, A., Pei, K., Fatehi, D., Brunette, E.
and Stanimirovic, D. (2013) Blood-brain barrier transport of amyloid beta
peptides in efflux pump knock-out animals evaluated by in vivo optical imaging.
Fluids Barriers CNS, 10, 13.
Zlokovic, B. V. (2005) Neurovascular mechanisms of Alzheimer's neurodegeneration.
Trends Neurosci, 28, 202-208.
Zlokovic, B. V. (2008) New therapeutic targets in the neurovascular pathway in
Alzheimer's disease. Neurotherapeutics, 5, 409-414.
Zlokovic, B. V. (2011) Neurovascular pathways to neurodegeneration in Alzheimer's
disease and other disorders. Nat Rev Neurosci, 12, 723-738.

Abstract (if available)

Abstract The receptor for advanced glycation end‐products (RAGE) binds to a repertoire of ligands resulting in sustained periods of cellular activation and perturbation as observed in chronic inflammatory responses associated with diabetes, Alzheimer’s disease (AD), and amyloidoses. Studies have shown that RAGE in the endothelium is a mediator for cerebral blood flow (CBF) changes, inflammatory cytokines upregulation, as well as disruption of tight junction proteins resulting from RAGE‐ligand interaction, thus signifying a pivotal role in vascular dysfunction. In this study we have generated Tie2-hRAGE+/0 mice, a transgenic mouse model, in order to determine the effects of overexpressing human RAGE (hRAGE) in endothelial cells. The expression was confirmed by qRT-PCR, mass spectrometry, Western blotting, and immunofluorescence staining. We observed an increased influx of Aβ into the brain after systemic administration of fluorescent‐labeled Aβ with these mice

Linked assets

University of Southern California Dissertations and Theses

Conceptually similar

PDF

Macrophage-specific Stat3 deletion in a mouse model of Alzheimer’s disease

PDF

Understanding the role of APP and DYRK1A in human brain pericytes

PDF

KcsA: mutational analysis of ion selectivity with molecular dynamics

PDF

Protein phosphatase 2A and annexin A5: modulators of cellular functions

PDF

Identification of therapeutic targets in human cerebral brain organoid models of neurodegeneration

PDF

Synaptic circuits for information processing along the central auditory pathway

PDF

Characterization of invariant natural killer T cells in a novel humanized HBV-transgenic model

PDF

The role of fibroblast growth factor signaling on postnatal hepatic progenitor cell expansion

PDF

Differential effect of ethanol and r-sulforaphane on regulation of heme oxygenase-1 in endothelial cells

PDF

The histone H2A deubiquitinase MYSM1 regulates CCR9 expression on CD4⁺ T cells and thymocytes

PDF

The role of LGR5 in the pathogenesis of Ewing sarcoma: a marker of aggressive disease and a contributor to the malignant phenotype

PDF

Effects of ascorbate on cytotoxicity and morphological transformation induced by insoluble chromium (VI) compounds in C3H 10T1/2 Cl 8 mouse embryo cells

PDF

Using novel small molecule modulators as a tool to elucidate the role of the Myocyte Enhancer Factor 2 (MEF2) family of transcription factors in leukemia

Asset Metadata

Creator Rege, Sanket Vilas (author)

Core Title A transgenic mouse model with overexpression of human RAGE in endothelial cells presents enhanced amyloid-beta transport into the brain

School Keck School of Medicine

Degree Master of Science

Degree Program Physiology and Biophysics

Publication Date 06/30/2015

Defense Date 05/28/2015

Publisher University of Southern California (original), University of Southern California. Libraries (digital)

Tag Alzheimer's disease,amyloid‐beta,blood‐brain barrier,OAI-PMH Harvest,RAGE

Format application/pdf (imt)

Language English

Contributor Electronically uploaded by the author (provenance)

Advisor Zlokovic, Berislav V. (committee chair), Farley, Robert A. (committee member), Kaslow, Harvey R. (committee member)

Creator Email sanketrege@gmail.com,srege@usc.edu

Permanent Link (DOI) https://doi.org/10.25549/usctheses-c3-583266

Unique identifier UC11301074

Identifier etd-RegeSanket-3530.pdf (filename),usctheses-c3-583266 (legacy record id)

Legacy Identifier etd-RegeSanket-3530.pdf

Dmrecord 583266

Document Type Thesis

Format application/pdf (imt)

Rights Rege, Sanket Vilas

Type texts

Source University of Southern California (contributing entity), University of Southern California Dissertations and Theses (collection)

Access Conditions The author retains rights to his/her dissertation, thesis or other graduate work according to U.S. copyright law. Electronic access is being provided by the USC Libraries in agreement with the a...

Repository Name University of Southern California Digital Library

Repository Location USC Digital Library, University of Southern California, University Park Campus MC 2810, 3434 South Grand Avenue, 2nd Floor, Los Angeles, California 90089-2810, USA