University of Southern California Dissertations and Theses

Glucocorticoids and Runx2 synergistically stimulate Wif1 and compromise pre-osteoblats in vitro

(USC Thesis Other)

Glucocorticoids and Runx2 synergistically stimulate Wif1 and compromise pre-osteoblats in vitro

PDF

Download a page range

Download transcript

Copy asset link

Request this asset

Transcript (if available)

Content i

Glucocorticoids and Runx2 synergistically Stimulate Wif1 and
Compromise Pre-osteoblasts in vitro

by

Eri Morimoto Champagne

A Thesis Presented to the
FACULTY OF THE GRADUATE SCHOOL
UNIVERSITY OF SOUTHERN CALIFORNIA
In Partial Fulfillment of the Degree
MASTER OF SCIENCE
(BIOCHEMISTRY AND MOLECULAR BIOLOGY)
August 2015

Copyright 2015 Eri Morimoto Champagne
ii

Dedication

To my dearest grandfather Yoshihiro Morimoto.

iii
Acknowledgements

I would like to thank Dr. Frenkel for giving me the opportunity to participate in his lab and learn
many techniques as well as Dr. Tokes for guiding me through this program with kindness. I
would like to thank Dr. Stallcup and Dr. Hacia for giving me feedback to improve my thesis.

I would like to express my appreciation to previous and current members of the Frenkel lab for
their helpfulness: Nyam Osor Chimge, Gillian Little, Helty Adisetiyo, Anthony Martin, and Jiali
Yu. I would like to especially thank Nyam Osor Chimge for her kind support and Jiali Yu for her
encouragement.

iv
Table of Content

Dedication ii

Acknowledgements iii

Table of Content iv

Abstract v

Chapter 1: Introduction 1

Chapter 2: Materials and Methods 3
2.1 Cell Cultures 3
2.2 Microarray Analysis 3
2.3 Quantitative RT-qPCR 4
2.4 Knockdown 4
2.5 Western Blot 5
2.6 Collection of Secreted Proteins 5
2.7 Crystal Violet Staining 6
2.8 Fluorescence-Activated Cell Sorting (FACS) Analysis 6

Chapter 3: Results 7
3.1 GCs selectively antagonize or synergize with Runx2 in a locus-specific manner 7
3.2 Synergistic Stimulation of Wif1 by Runx2 and GCs is unique among Wnt antagonists 13
3.3 Focal loss of cells in MSC cultures expressing Runx2 and treated with GCs 16
3.4 Introduction of Runx2 along with GCs induce polyploidy 22

Chapter 4: Discussion 26

Bibliography 29

v
Abstract

For over six decades, glucocorticoids (GCs) have been used to treat inflammatory diseases such
as rheumatoid arthritis, but their long-term use causes severe side effects, including bone loss.
The molecular mechanisms underlying GC-induced osteoporosis (GIO), are not fully understood,
limiting the development of bone-sparing GC treatment protocols. We have previously shown that
treatment of pluripotent murine mesenchymal stem cells (MSCs) with GCs inhibited osteoblast
differentiation driven by the master regulator Runx2 and that this was associated with inhibition
of Runx2 target gene expression at several loci. To determine the effect of GCs and Runx2
genome wide, we employed expression microarrays. Among several unexpected results, GCs and
Runx2 synergistically stimulate Wnt inhibitory factor 1 (Wif1). At the same time, co-treatment of
the MSC cultures with GCs and Runx2, but not any of them alone, induced cell polyploidy.
Furthermore, we noticed areas of cell loss in our microplates, specifically in cultures co-treated
with GCs and Runx2, and microscopic evaluation of these areas demonstrated cell debris. The
areas of cell loss were observed in the cultures expressing a non-specific shRNA, but not when
Wif1 was silenced with each of two independent shRNAs. These results indicate that GCs and
Runx2 together compromise MSC cultures in a Wif1-dependent manner. Interestingly, the
combined negative effect of GCs and Runx2 was developmental stage-dependent. It was observed
when cultures were treated during early differentiation stages (day ~5), but not in mature cultures
(day ~12) even though the synergistic stimulation of Wif1 was observed in both the early and
mature stages of differentiation. Therefore, Wif1 may play a role in the development of GIO, and
blocking Wif1 during GC treatments may reduce their skeletal side effect.

KEY WORDS: Wif11; Glucocorticoids; Runx2; osteoporosis; mesenchymal stem cells

1
Chapter 1: Introduction

High doses of GCs are frequently used to treat severe inflammatory diseases such as
rheumatoid arthritis; however, their long-term use causes osteoporosis and osteonecrosis in both
men and women and also reduces the bone turnover which may continue even they no longer
receive GC treatment (Weinstein, 2012a). Since some physicians have been known to prescribe
GCs without fully considering the adverse effects of GCs on the skeleton, many patients
suffering from bone complications including avascular necrosis, osteoporosis, and fractures have
brought their cases to court (Weinstein, 2012b). Understanding the molecular mechanism of GIO
will help develop improved GC-based anti-inflammatory therapies by reducing the deleterious
skeletal effect. Excess GCs induce apoptosis in osteoblast and osteocytes (retired osteoblasts
embedded in the bone matrix), leading to a reduction of bone formation, while GCs inhibit
osteoprotegerin that inhibits osteoclastgenesis, leading to increased osteoclast number and
function and hence increased bone resorption (Compston, 2010). Those impacts on osteoblasts
and osteocytes result in long-term state of decreased bone formation (Compston, 2010).
Therefore, the impact on osteoblast lineage seems more critical in bone-loss than osteoclasts.
It is well established that Wnt signaling is essential for bone formation (Bodine and Komm,
2006). In the canonical Wnt pathway, Wnt ligands bind co-receptors composed of frizzled and
low-density lipoprotein receptor-related protein (Lrp) 5/6 (Bhanot et al., 1996; Tamai et al.,
2000). Receptor activation leads to the release of dephosphorylatedβ -catenin from a protein
complex that includes adenomatous polyposis coli (Apc), glycogen synthase kinase (Gsk3), and
Axin. The released β -catenin binds transcription factors, LEF/TCF that induce osteoblast
differentiation (Colaianni et al., 2014). Particularly, the canonical Wnt signal is upregulated in
osteogenic mesenchymal condensations during early skeletal development (Day et al., 2005). In
the non-canonical pathway, Wnt ligands bind frizzled and activate other pathways, including the
planar cell polarity or the calcium pathway (Liu et al., 1999).
Wnt signal can be inhibited by various antagonists including Deckkopf (Dkk) 1, Dkk2,
Secreted frizzled related protein 1 (Sfrp1), and Wif1. Dkk1 is a secreted protein and inhibits
canonical Wnt signaling by binding LRP5/6 (Bafico et al., 2001; Glinka et al., 1998). Dkk2 also
binds LRP5/6, but depending on Kremen 2 regulation, it can either stimulate or inhibit the

2
canonical Wnt signaling (Mao and Niehrs, 2003; Wu et al., 2000). Sfrp1 is highly homologous to
Frizzled receptors and inhibits both canonical and non-canonical Wnt pathway by directly
binding Wnt proteins (Dennis et al., 1999; Kawano and Kypta, 2003; Xu et al., 1998; Yang et al.,
2009). Wif1 is a secreted protein that binds Wnt proteins and inhibits both canonical and non-
canonical Wnt signaling just like Sfrp1 (Hsieh et al., 1999; Kawano and Kypta, 2003). Wif1 has
a CpG island located in its promoter region which is often methylated in tumor cells (Mazieres et
al., 2004). Compared to other Wnt antagonists, Wif1 is highly expressed in the base of the colon
crypt, suggesting that Wif1 contributes to stem cell pool maintenance (Byun et al., 2005).
Our previous study showed that GCs suppresses Runx2-driven osteoblast differentiation, and
accordingly, GCs antagonized Runx2-mediated stimulation of several target genes (Koromila et
al., 2014). Because glucocorticoid receptor (GR) can have a physical interaction with Runx2
(Koromila et al., 2014; Ning and Robins, 1999), it is possible that this interaction prevents
interaction of Runx2 with its target genes. Similar effects from the interaction between Runx2
and steroid hormone receptors including estrogen receptor (Khalid et al., 2008) and androgen
receptor (Baniwal et al., 2009) have been reported.
In this study, we employed the murine mesenchymal stem cell line, ST2/Rx2
dox
, in which
Runx2 can be induced by treatment with doxycycline (dox) (Baniwal et al., 2012). We analyzed
global changes in gene expression in response to Runx2 (dox), GCs (dex), and the combination
of both (dox and dex) using Illumina BeadChips. We found that Wif1 was dramatically up-
regulated almost 200-fold by dox and dex co- treatment at 72 hrs while the individual treatments
with dox and dex yielded 4 and 8-fold-changes, respectively. At the same time, we discovered
that cells are lost in cultured treated by dox and dex in approximately 3 days. Cell loss occurs
also with dex treatment alone but not as much as dox and dex co-treatment. To investigate the
role of Wif1, we created shRNA-mediated-WIF1 knock down cell lines (ST2/Rx2
dox
/Wif1
KD
),
and cell loss was completely suppressed in both conditions. In addition, cell loss happened only
during the early differentiation stage from MSCs. Once cells get matured, Wif1 does not induce
cell loss any more. This is a novel discovery to show that Wif1 might be the key gene causing
GIO, and blocking Wif1 in GC treatments may reduce the bone loss side effect.

3
Chapter 2: Methods and Materials

2.1 Cell Cultures
The murine ST2/Rx2
dox
cell line was previously constructed (Baniwal et al., 2012). Cells were
cultured in RPMI-1640 supplemented with L-glutamine (Mediatech, Manassas, VA) as well as
10 % Fetal Bovine Serum (FBS; from GEMNI BIO-PRODUCTS, CA). All condition medium
contain L-ascorbic acid 2-phosphate sesquimagenesim salt hydrate (AA; Sigma, St Louis, MO)
and β -Glycerophosphate (BGP; Sigma). AA was dissolved in distilled water (5 mg/mL stock
solution), and 50µ g/mL was used as a final concentration. BGP was dissolved in distilled water
as well (1 M stock solution), and the final concentration was 10
-2
M. Doxycycline (dox;
Calbiochem, La Jolla, CA) was dissolved in distilled water (1 mg/mL stock solution), and
dexamethasone (dex; Sigma) was dissolved in ethanol (1mM and 0.1mM stock solution). Final
dox concentration was 200 ng/mL, and dex was diluted in 1:1000 to make 10
-6
and 10
-7
M. 0.1 %
ethanol was used as vehicle. Conditions are usually labeled C, D, G, and DG. The detail
components are shown below.
Table 1. Components of conditions

2.2 Microarray Analysis
Quadruplicate RNA samples were extracted from ST2/Rx
dox
using Aurum Total RNA kit (Bio-
Rad Laboratories, Inc., Hercules, CA). 20µ L (25ng/µ L) from each sample was used for
microarray analysis at UCLA Neuroscience Genomics Core using MouseRef-8 v2.0 Expression
BeadChips (Illumina, San Diego, CA). Partek Genome Suite
®
(St. Louis, Missouri).was used to
make scatter plots

4
2.3 Quantitative RT-qPCR
700 ng - 1µ g of RNA was reverse-transcribed using qScript
TM
cDNA SuperMix synthesis
(Quanta BioSciences, Inc., Gaithersburg, MD). The cDNA was diluted in 1:10 with nuclease-
free water. CFX96 real time PCR system (Bio-Rad) and the iQTM SYBR Green Supermix (Bio-
Rad) were used for gene expression analysis. Primer sequences are listed below in table 1
(ValueGene inc., San Diego, CA). Error bars represent the positive standard deviations to avoid
excess overlapping.

Table 2. Primer sequences used for RT-qPCR
Primer Sequences (5’ → 3’)
Sult1a1 F TTCTGCATTCCCCACATTGC R GCTCCATGTTGCTGGGGTTC
Orm1 F AGTGCTGAGGAAACATGGGG R GCTGACCGCACCTATCCTTT
Psca F TGCTGCTCTGCAGTGCTATT R GAGTCCAATGGCCCGGATG
C3 F AGCCCAACACCAGCTACATC R GAATGCCCCAAGTTCTTCGC
Serpina3h F CACCAGGAGCTAGCTATCACAGAC R GGACTTCATGGACTGCCACC
Timp4 F TGCACGAAGCTTTCTGGAGG R TTGGCCCGTATCACTAGAGC
Ehd3 F GCCGACCACTGATTCCTTCA R TCATACCCTCGGCTGATCCT
4732456N10Rik F GAAGAGTTTCGGAGGTGGCA R GGCAGCGTCCACATCTTTTT
Wif1 F CTGTGCTCTAAGCCCGTCTG R AGATGGTGGGGTAGGGGTTC
Crispld2 F GCGAAGGTCTTTGGCTCTCT R GTGTTCAGGCTCTCCGACTG
Dkk1 F CCTGACCTTTGCCTGTTTGC R TGTTCCCGCCCTCATAGAGA
Dkk2 F CCCCTGGCATTCCCATCTTT R GCCTGCCCCAGGCTTTT
Sfrp1 F ACTGCGCCTTTGTCCCC R GGCAGTTCTTGTTGAGCAGC
Atg5 F ACCTCGGTTTGGCTTTGGTT R ACCACACATCTCGAAGCACA
Becn1 F GCTGTAGCCAGCCTCTGAAA R ATGGCTCCTCTCCTGAGTTAGC
18S F GTAACCCGTTGAACCCCATT R CCATCCAATCGGTAGTAGCG

2.4 Knockdown
Two shRNA plasmids were used to knock down Wif1 in ST2/Rx2
dox
(Sigma-Aldrich, St Louis,
MO). 100 mL of bacteria culture was incubated overnight, and HiPure Plasmid Midiprep Kit was
used to purify the plasmids (Life technologies, Carlsbad, CA). The expression plasmid was co-
transfected along with lentiviral helper plasmids pMD.G1 and pCMV R8.91 into HEK293T cells
with jet PRIME transfection reagent (Polyplus-transfection S.A.,

5
Illkirch-Graffenstaden, France). HEK293T cells was incubated in DMEM with 4.5 g/L glucose,
L-glutamine and sodium pyruvate (Mediatech). The culture media containing the vial particles
were harvested after 24 and 48 hrs. Total 20 mL media was aliquoted into 1 mL that was used to
infect ST2/Rx2
dox
. ST2/Rx2
dox
/Wif1
KD
was selected by puromycin (5µ g/mL) for at least one
week. The selection was verified by RT-qPCR, western blot, and immunofluorescence analyses.

2.5 Western Blot
Proteins of cell lysate were collected in 100 µ L of lysing buffer containing 1 % of protease
inhibitor, 150 mM NaCl, 1 mM EDTA, and 1% Triton X-100. Cell lysates were subjected to
SDS-PAGE, and proteins were transferred to Amersham Hybond-P PVDF membranes
(Piscataway, NJ). After blocking with 5 % of milk, the membranes were incubated with a
primary antibody overnight at 4 . Wif1 was used in 1:1000 (Abcam, Cambridge, England), and
actin was in 1:200. Membranes were incubated with secondary antibody for 1 h and visualized
by the Thermo Scientific ECL detection system (Waltham, MA).

2.6 Collection of Secreted Proteins
After 48 hrs of incubation in condition media (2 mL, 6-well plate), cells were treated in 1 mL
of RPMI Medium 1640 with L-glutamine and 10% of charcoal stripped serum but no phenol red
(life technologies). Next day, 250 µ L of trichloroacetic acid (100%, dissolved in distilled water)
was added in each 1 mL medium, and the mixture was incubated at 4 for 10 min. The samples
were centrifuged at 14,000 rpm, 4 for 5 min. Supernatant was discarded, and pallet was
washed by 200 µ L of acetone at -20 . The samples were centrifuged and washed in the same
way one more time. 100 µ L of lysing buffer was added, and the mixture was vortexed every 10
min for 1 hr at room temperature. The samples were centrifuged at 14,000 rpm, 4 , for 10 min .
The supernatant was used for western blot.

6
2.7 Crystal Violet Staining
Cells were fixed by 4 % of formaldehyde in PBS (Avantor, Center Valley, PA). 0.05% of
crystal violet (1% stock solution in distilled water) was to stain cells. The samples were
incubated for 30 min and washed with distilled water.

2.8 Fluorescence-Activated Cell Sorting (FACS) Analysis
Cell pellets were collected and resuspended by PBS. While vortexing 100% ethanol at -20 ℃,
cells in PBS were added to the cold ethanol drop by drop. Afterwards, cell pellets were collected
by centrifugation. Ethanol was discarded, and the pallets were incubated in PBS for 15 min. Cell
pellets were collected again, and 750 µ L of PI/RNase Staining Buffer was added to each pallet
(BD Biosciences, San Jose, CA). FACSDiva Version 6 software (BD Biosciences, San Jose, CA)
was used for data analysis.

7
Chapter 3: Results

3.1 GCs selectively antagonize or synergize with Runx2 in a locus-specific
manner.
Runx2 is a master regulator of osteoblast differentiation and bone formation (Banerjee et al.,
1997; Komori et al., 1997). In a previous study (Koromila et al., 2014), we showed that many
Runx2 target genes were suppressed by glucocorticoids. In order to determine how the
combination of Runx2 and GCs affect the global gene expression in MSCs, we treated
ST2/Rx2
dox
cells with dox, dex, and dox plus dex. Total RNA was extracted and analyzed by
hybridization to Illumina BeadChips. Consistent with our previous study (Koromila et al., 2014),
Runx2-driven gene expression was generally attenuated by GCs (Fig. 1A). For example,
leukotriene C4 synthase (Ltc4S) was 25-fold up-regulated by in response to dox, not changed
with dex treatment; however, its dox stimulation was attenuated to 12-fold change (FC)
(P=5.14E-9) when dox and dex were co-administered, which appears as a negative value for
DG/D (Fig. 1A).
On the other hand, we were interested in identifying genes with high FC in DG/D. These genes
are synergistically expressed in the presence of dox and dex at much higher level than dox alone.
If any of them were a strong inhibitor of osteoblast differentiation, it would explain why Runx2-
driven osteoblast differentiation was suppressed. To do this, we excluded genes with less than 5
FC in DG/D and reanalyzed the remaining genes (Fig. 1B). The transcript levels of 13 genes
were not significantly different between dex alone and dox plus dex treatments (Fig. 1B). In
other words, they are dex-responsive, and adding dox did not affect the dex-driven stimulation.
We revaluated the top 10 genes in DG/D using RT-qPCR (Fig. 1C). RNA samples were
harvested at 24, 48, and 72 hrs. Their fold-changes were compared to the control at 24 hrs
(defined as 1 for each gene) in each gene. Some genes including Wif1, C3, and Crispld2 were
up-regulated by more than 500-fold at 72 hours with dox and dex treatment (Fig. 1C). These data
showed that GCs do not always antagonize Runx2 but can also synergize with Runx2 to
stimulate some of its target genes.

8

Fig. 1
A

9

B

10
C

0"
200"
400"
600"
800"
1000"
1200"
1400"
1600"
1800"
2000"
24h" 48h" 72h"
Rela%ve'Gene'expression'
Sult1a1'

11

0"
200"
400"
600"
800"
1000"
1200"
1400"
1600"
1800"
2000"
24h" 48h" 72h"
Rela%ve'Gene'expression'
Crispld2'

12
Fig. 1. GCs selectively antagonize or synergies with Runx2 in a locus-specific manner. (A)
ST2/Rx2dox cells were treated for 48 hrs with dox (D), GCs (G), dox and GCs (DG), or vehicle
(C). Scatter plot shows the fold-change of DG/D versus D/C for each gene. Genes with
statistically significance in DG/D are marked in red (FDR<0.05). (B) Genes with at least a 5–FC
in DG/D were reanalyzed in the new plot. Genes marked in green had significantly different gene
expressions between DG and G. Genes marked in black did not have statistically significance in
DG/G. (C) Relative gene expressions of the top 10 genes in DG/D at 3 time points. Only positive
error bars (onestandard deviation) are shown for the purpose of clarity. Some genes including
C3, Wif1, and Crispld2 were synergistically stimulated by dox and dex more than 500-fold at 72
hrs.

13
3.2 Synergistic stimulation of Wif1 by Runx2 and GCs is unique among Wnt
antagonists.
Because Wif1 inhibits Wnt signal that is one of the most important pathways in osteoblast
replication, differentiation and survival (Bodine and Komm, 2006; Ma et al., 2013), we
investigated Wif1 further. ST2/Rx2
dox
cells were treated with vehicle, dox, dex, dox+dex for 72
hours, and proteins were harvested from either cell lysates or conditioned media. Similar to the
RT-qPCR results (Fig. 1C), Wif1 protein levels were high in cells treated with dox and dex while
other conditions barely displayed a band in cell lysate (Fig. 2A). Secreted Wif1 protein levels
from media were also high in dox and dex, and a band was not even detectable in other
conditions (Fig. 2A). To test if the synergistic stimulation by dox and dex by GCs and Runx2
was specific to Wif1 among Wnt antagonists, we assessed the expression of other Wnt
antagonists under the same conditions by RT-qPCR analysis. Unlike Wif1, Dkk1 and Dkk2
displayed a significant increase at 48 hrs with dox, dex (10
-7
M), and dox plus dex (10
-6
&
-7
M)
(Fig. 2B). Their fold-change of control at 24 hrs was not set to 1 because the gene expression
was not detectable by our method. Not only control at 24 hrs was undetectable for Dkk1 and
Dkk2. For Dkk1, all conditions at 24 hrs, control at 72 hrs, dox at 72 hrs, dex (1uM) at 48 and 72
hrs, dex (100nM) at 48 and 72 hrs. For Dkk2, all conditions at 24 hrs, control at 72 hrs, dex
(100nM) at 72 hrs, and dox plus dex (100nM) at 72 hrs were not detectable. Sfrp1 was up-
regulated with dox and dex (10
-7
M) but not dox and dex (10
-6
M) at 72 hrs (Fig. 2B). Rather,
Sfrp1 responded more to dex alone (Fig. 2B). Even though Dkk1, Dkk2, and Sfrp1 had
significant increases with dox and dex, considering the scale of stimulation, Wif1 seems to have
a greater impact on the gene expression profiles of treated cells under these conditions.

14

Fig. 2
A

Coomassie
Sec. Wif1
β-actin
40 kD
40 kD
C D G DG
Coomassie
Wif1

15
B

Fig. 2. Synergistic Stimulation of Wif1 by Runx2 and GCs is unique among Wnt antagonists. (A)
Stimulation of Wif1 is translational. The amount of Wif1 protein increased significantly with dox
and dex. Secreted Wif1 protein was detectable only with dox and dex. (B) Gene expressions of
Wnt antagonists; Dkk1, Dkk2, and Sfrp1. Some of the gene expressions of Dkk1 and Dkk2 were
not detectable. They were stimulated most by dox at 48 hrs. Sfrp responded better with dex alone
than dox and dex. Only positive error bars (one standard deviations) were shown for the purpose
of clarity.

16
3.3 Focal loss of cells in MSC cultures expressing Runx2 and treated with
GCs.
Because the Wnt signaling pathway plays a critical role in osteoblast replication and survival,
we assessed cellular viability in ST2/Rx2
dox
culture treated with vehicle, dox, dex, or dox+dex
for 3, 5, or 7 days. Experiment began with 100% of cell confluency to induce cell differentiation.
The culture dishes were first analyzed by crystal violet staining, a method for assessing cell
viability and adhesion. Staining of day 0 cultures showed that cells were viable before
commencement of treatment, and they were well stained through out the entire well (Fig. 3A).
With vehicle or dox only, cells continued growing and were viable through the entire well (Fig.
3A). However, cultures treated with dox + dex for 3, 5, and 7 days displayed massive loss of
cells with specific areas typically near the edges of the wells being completely devoid of crystal
violet staining. Cells were also occasionally lost from cultures treated with dex alone (Fig. 3A),
but this observation was more reproducible in cultures treated with dox + dex. Microscopic
examination of the areas that did not stain with crystal violet demonstrated the presence of cell
debris (Fig. 3B). Additionally, cultures treated with dex alone reproducibly displayed lighter
crystal violet staining (Fig. 3A), indicating that cell proliferation was inhibited by
glucocorticoids. In contrast, cultures treated with dox alone or dox + dex were stained with
intensity similar to control cultures (Fig. 3A). Therefore, co-treatment with dox appeared to
overcome the antiproliferative effect of glucocorticoids, but the co-treatment sensitized cultures
to a process that leads to loss of cells. The nature of this process remains to be investigated.
To test the role of Wif1 in the cell loss caused by Runx2 plus GCs, we treated two
ST2/Rx2
dox
/Wif1
KD
cell lines, which also express hairpin RNAs that silence Wif1. Silencing of
Wif1 expression in the two cell lines ST2/Rx2
dox
/Wif1
KD1
and ST2/Rx2
dox
/Wif1
KD1
, is
demonstrated in Fig. 3D. We treated each of these cell lines with dox, dex, and dox+dex for 3, 5,
and 7 days and compared them to the cultures expressing Wif1 normally. As shown in Fig. 3A,
no cell loss was seen in either Wif1
KD1
or Wif1
KD2
cell line. The data suggests that Wif1
stimulation by Runx2 and GCs induces cell loss.
We previously reported that GCs do not have any impact to cell development once cells
achieve a certain degree of maturation (Gabet et al., 2011). Thus, we tested if Wif1 stimulation
can still lead to cell loss in more mature cultures. We cultured cells in differentiation mediium
for 10 days and treated them with the same four conditions for 72 hrs. Under these conditions,

17
we did not observe any cell loss in any condition in either the ST2/Rx2
dox
/ shNS , Wif1
KD1
,
Wif1
KD2
cell line (Fig. 3A, bottom two rows). From the same experiment, RNA was collected at
the 48 hr time point to measure Wif1 gene expression. Wif1 expression responded to treatment
with dox and/or dex in the same pattern as it in the less mature cultures (Fig. 3C). In other words,
dox and dex synergistically induced Wif1 expression in manner independent of the
differentiation stage, but cell loss was induced only in the early stage of differentiation. Since
Wif1 directly binds Wnt proteins, it can affect both canonical and non-canonical Wnt pathways.
Interestingly, Axin2 gene expression, which is considered a marker for canonical Wnt/B-catenin
signaling (Yan et al., 2001), was not inhibited in cultures treated with dox and dex at any time
points (Fig. 3E). It suggests that Wif1-mediated loss of cells might have occurred through non-
canonical Wnt signaling.

18
Fig. 3
A

B

19

C

D

0
20
40
60
80
100
120
C D G DG
Relative Gene Expression
Wif1
Wif1
Coomassie
Coomassi
Sec. Wif1

20
E

Fig. 3. Runx2 induction and GC treatment together induce focal cell loss in a manner dependent
on Wif1. (A) Top panels: ST2/Rx2
dox
cell cultures were treated with dox, dex, dox+dex, or
vehicle (ascorbic acid and BGP were included in all conditions) for 3, 5, or 7 days and stained
with crystal violet. Note the focal cell loss in cultures treated with dex only or dox + dex. This
cell loss was not observed in ST2/Rx2dox cell cultures in which Wif1 was silenced (Wif1 KD
1

and Wif1 KD
2
). Bottom panels: Cells as above were grown in differentiation media for 10 days

21
and after that, treated with dox and/or dex for 3 days and 5 days. Note that local cell loss was not
observed in any condition, including in ST2/Rx2
dox
/shNS cells. (B) Cells were imaged by a light
microscope. Cells treated with dox and dex (DG) had a lot of debris around the foci with cell
loss. (C) RNA was harvested after 48 hrs of treatment which started after 10 days growing in
differentiation media. Wif1 was stimulated in the same manner as the early stage. (D) Proteins
from cell lysate and the conditioned medium of ST2/Rx2
dox
/shNS , Wif1 KD
1
, and Wif1 KD
2
were collected 3 days after treatment with dox and/or dex. A protein level of Wif1 was compared
on western blotting. The result showed that Wif1 protein from cell lysate was suppressed in Wif1
KD cell lines. Secreted Wif1 protein in Wif1 KD cell lines was not even detectable. (E) RNA
was harvested from ST2/Rx2
dox
cells 24, 48, and 72hrs after treated with dox, dex, dox+dex, or
vehicle. The relative gene expression levels of Axin2 were compared by RT-qPCR. Axin2
expression was not inhibited in cells treated with dox and dex. Rather, its expression were
significantly higher than control when they were treated with dex or dox + dex. This observation
suggests that Wif1 stimulation does not affect the Wnt canonical pathway.

22
3.4 Introduction of Runx2 along with GCs induce polyploidy
To address the hypothesis that the cell loss in cultures treated with dox + dex (Fig. 3A)
occurred through cell death, we used the propidium iodide (PI) staining technique followed by
FACS analysis in which cells undergoing apoptosis display a “sub-G1 ” DNA quantity. Samples
were collected after 48 hrs of treatment, and there was no sign of apoptosis (Fig. 4A). These
results suggest that loss of cells after treatment with dox and dex might not have occurred
through apoptosis, but rather through a process that involves polyploidy. Supporting this notion,
microscopic evaluation of cultures treated with dox + dex exhibited cells with multiple nuclei
(Fig. 4B). For a possibility of autophagy, we measured expression of gene markers, autophagy
protein 5 (Atg5) and beclin 1 (Becn1) after 72 hrs of treatment. There was no significant
difference between conditions except a decrease with dox and dex for Becn1 (Fig. 4B). If there
were autophagy movements, these gene markers should increase. Thus, autophagy does not seem
to explain the cell loss observed after dox and dex treatments.

23
Fig. 4
A

24
B

C

*

25
Fig. 4. Induction of Runx2 along with GC treatment induces polyploidy. (A) Cells were treated
with dox (D), dex (G), dox+dex (DG), or vehicle (C). They were fixed after 48 hrs of treatment
and stained with propidium iodide followed by cell cycle analysis using flow cytometry. It
showed a peak after the second peak (G2/M), suggesting that some cells polyploid. (B) Images
taken by light microscopy of ST2/Rx2
dox
/shNS cells with multi-nuclei in the culture treated with
dox and dex. (C) Relative gene expressionof autophagy markers were measured by RT-qPCR.
Becn1 had a significant decrease with dox and dex (DG) from control.

26
Chapter 4: Discussion

In this study, we demonstrated that synergistic interaction between Runx2 and GCs leads to
robust stimulation of Wif1 expression and cell loss. Our previous study showed that GCs
antagonize Runx2 and suppress expression of many Runx2 target genes (Koromila et al., 2014).
Global gene expression analysis revealed that Runx2 and GCs are not only antagonizing each
other, but can also synergize specific target genes. For example, cysteine-rich secretory protein
LCCL domain-containing 2 (Crispld2) was up-regulated by over 1,000 [1]-folds with dox and dex
after 72 hrs (Fig 1C). Wif1 was one of these genes that were synergistically stimulated by Runx2
and GCs. We chose to focus on Wif1 because it has a strong impact on Wnt signaling essential
for bone formation (Bodine and Komm, 2006). Indeed, the synergistic stimulation of Wif1 by
Runx2 and GCs induced cell loss; cells with dox and dex were lost more than with dex alone
(Fig. 3A). If GCs only suppress Runx2 activity, cell loss would be be greater with dex treatment
alone than dox and dex co-treatments.[2]. Cells with dox displayed the darkest crystal violet
staining; which I interpret as them having increased proliferation due to over-expressed Runx2
(Fig. 3A).
Although cells treated with dex do not over-express Runx2 transcript, ST2/Rx2
dox
cells
express endogenous Runx2 at higher levels in the early differentiation stage (Maruyama et al.,
2007; Yu et al., 2014). This provides evidence that Wif1 can be stimulated by GCs and
endogenous Runx2. In fact, Wif1 was 8.4 fold up-regulated dex treatment at 72 hrs (197.5-folds
with dox and dex, Fig. 1C), and cultured cells treated with dex showed a less cell loss, compared
to cell cultures co-treated with dox and dex (Fig. 3A). Meanwhile, the most obvious feature of
cultured cells treated with dex was a lighter color of crystal violet staining (Fig. 3A). It indicates
that GCs suppressed cell proliferation, which has been reported by other studies as well
(Baschant et al., 2012).
Importantly, inhibition of cell proliferation by GCs did not win over over-expressed Runx2, as
incidated by the dark crystal violet color staining in cultured cells treated with dox and dex (Fig.
3A). In other words, cells with dox and dex showed strong cell proliferation ability, but
stimulation of Wif1 induced cell loss. In fact, Wif1 knockdowns rescued cells from being lost in
both culture treated with dex alone and dox and dex co-treatments. Therefore, cell loss did not

27
occur due to the inhibition of proliferation by GCs. Instead, I hypothesize that cell loss was due
to Wif1 activity. Furthermore, this Wif1-induced cell loss was limited to the early differentiation
stage in MSCs. Once cells matured, Wif1 no longer induces cell loss (Fig. 3A). This might be
able to explain why GC treatments decrease bone turnover, and the level of bone turnover does
not return to normal despite patients stopping treatment. It is well known that GCs inhibit
osteoblast differentiation through various pathways; for example, GCs inhibit BMP2 in pre-
osteoblasts (Gabet et al., 2011; Luppen et al., 2008). However, rather than inhibition of
differentiation, losing stem cells should cause more severe long-term bone loss. If cells were just
arrested undifferentiated, once GCs are gone, cells would be able to differentiate normally and
reform the bone. It is reported that transplanting mesenchymal stem cells to bone significantly
increased the rate of bone formation and helped from bone-loss (Yao et al., 2013). Therefore,
although GCs inhibit osteoblast differentiation by other pathways, blocking Wif1 in GC
treatments would save mesenchymal stem cells from dying and it would reduce the bone-loss
and fasten the recovery.
Although mechanistic basis for cell loss has not been determined, the microscopic pictures
showed significant amounts of cell debris in the empty areas (Fig. 3B), which is consistent with
cell death or loss of cell adhesion. We still do not known why cells are specifically being lost at
the bottom of the well and not other areas. We do note that when changing cell culture media,
gentle suction was placed at that region of the plate with extreme care not to touch the plate
itself. To address the hypothesis that the cells are simply beginning to lose adhesive properties
and are thus being lifted off the plate in response to gentle suction, we changed the area of the
well subjected to suction and looked for cell loss. However, this it did not change our result. We
do note a study investigating that polarity in stem cells which found that a loss of Par polarity
protein 3-Like (Par3L) activity causes caspase-3 mediated apoptosis to prevent self-renewal but
does not affect the survival of differentiated cells (Huo and Macara, 2014). Therefore, it is
theorectically possible that MSCs in a well might have sensed a polarity and a particular side of
cells might have been affected.
Although it is one of several possible explanations for the observed cell loss, we have made
numerous attempts to find evidence of cell death. Because apoptosis, necrosis, and autophagic
programmed cell death are major mechanisms of cell death, we conducted FACS analyses to
determine if an apoptotic signal was present in these cells. The result showed no signal before

28
the first peak (G0/G1), inidicating that apoptosis was not occurring (Fig. 4A). Instead, there were
some signals after the second peak (G2/M), which is indicative of polyploidy. We do note that
polyploidy can induce cell death (Sabelli et al., 2013; Zong et al., 1998). Endomitosis and
endocycle provide two mechanisms that can lead to polyploidy. Endomitosis is a form of
endoreplication in which cells undergo aspects of mitosis but fail to execute telophase and/or
celll division, while endocycle successively replicates cellular genomes but skips mitosis and
thereby yielding polyploidy. Although both can be mononucleated, some studies show multiple
nuclei in endomitosis (Huang et al., 2005; Sher et al., 2013). As shown in Fig. 4B, some cells
contain multi-nuclei, which is consistent with endomitosis. Meanwhile, we also examined the
gene expressions of Atg5 and Becn1 that are often used as autophagy markers (Kassiotis et al.,
2009). However, the only significant change was a decrease in DG in Becn1 expression relative
to control (Fig. 4B). This indicates that autophagy explains the observed cell loss.
For the future research, we continue looking for an explanation of the observed cell loss. As
stated above, one of my favored hypothesis is cell death; however, I still have not investigated
changes in cell adhesion in great depth. Furthermore, investigating cell cycle proteins could
allow us to explore the possibility of endomitosis. FACS analysis could be conducted for Wif1
KDs too. If the signal for polyploidy were different between control and KDs, it would be a
strong suggestion that Wif1 induces polyploidy which ultimately leads to cell loss through an
undetermined mechanisms. In addition, we have not known how Wif1 is stimulated by GCs and
Runx2. As stated early, GR makes a physical interaction with Runx2 (Koromila et al., 2014;
Ning and Robins, 1999). Therefore, as a possibility, GR and Runx2 could bind a promoter of
enhancer of Wif1 only when they are together. To confirm the hypothesis, Chip-seq would be
required.

29
Bibliography

Bafico, A., Liu, G., Yaniv, A., Gazit, A., and Aaronson, S.A. (2001). Novel mechanism of Wnt
signalling inhibition mediated by Dickkopf-1 interaction with LRP6/Arrow. Nature Cell Biology
3, 683-686.
Banerjee, C., McCabe, L.R., Choi, J.Y., Hiebert, S.W., Stein, J.L., Stein, G.S., and Lian, J.B.
(1997). Runt homology domain proteins in osteoblast differentiation: AML3/CBFA1 is a major
component of a bone-specific complex. Journal of Cellular Biochemistry 66, 1-8.
Baniwal, S.K., Khalid, O., Sir, D., Buchanan, G., Coetzee, G.A., and Frenkel, B. (2009).
Repression of Runx2 by androgen receptor (AR) in osteoblasts and prostate cancer cells: AR
binds Runx2 and abrogates its recruitment to DNA. Molecular Endocrinology 23, 1203-1214.
Baniwal, S.K., Shah, P.K., Shi, Y., Haduong, J.H., Declerck, Y.A., Gabet, Y., and Frenkel, B.
(2012). Runx2 promotes both osteoblastogenesis and novel osteoclastogenic signals in ST2
mesenchymal progenitor cells. Osteoporosis international : a journal established as result of
cooperation between the European Foundation for Osteoporosis and the National Osteoporosis
Foundation of the USA 23, 1399-1413.
Baschant, U., Lane, N.E., and Tuckermann, J. (2012). The multiple facets of glucocorticoid
action in rheumatoid arthritis. Nature Reviews Rheumatology 8, 645-655.
Bhanot, P., Brink, M., Samos, C.H., Hsieh, J.C., Wang, Y., Macke, J.P., Andrew, D., Nathans, J.,
and Nusse, R. (1996). A new member of the frizzled family from Drosophila functions as a
Wingless receptor. Nature 382, 225-230.
Bodine, P.V., and Komm, B.S. (2006). Wnt signaling and osteoblastogenesis. Reviews in
Endocrine and Metabolic Disorders 7, 33-39.
Byun, T., Karimi, M., Marsh, J.L., Milovanovic, T., Lin, F., and Holcombe, R.F. (2005).
Expression of secreted Wnt antagonists in gastrointestinal tissues: potential role in stem cell
homeostasis. Journal of Clinical Pathology 58, 515-519.
Colaianni, G., Brunetti, G., Faienza, M.F., Colucci, S., and Grano, M. (2014). Osteoporosis and
obesity: Role of Wnt pathway in human and murine models. World Journal of Orthopedics 5,
242-246.

30
Compston, J. (2010). Management of glucocorticoid-induced osteoporosis. Nature Reviews
Rheumatology 6, 82-88.
Day, T.F., Guo, X., Garrett-Beal, L., and Yang, Y. (2005). Wnt/beta-catenin signaling in
mesenchymal progenitors controls osteoblast and chondrocyte differentiation during vertebrate
skeletogenesis. Developmental Cell 8, 739-750.
Dennis, S., Aikawa, M., Szeto, W., d'Amore, P.A., and Papkoff, J. (1999). A secreted frizzled
related protein, FrzA, selectively associates with Wnt-1 protein and regulates wnt-1 signaling.
Journal of Cell Science 112 ( Pt 21), 3815-3820.
Ducy, P., Desbois, C., Boyce, B., Pinero, G., Story, B., Dunstan, C., Smith, E., Bonadio, J.,
Goldstein, S., Gundberg, C., et al. (1996). Increased bone formation in osteocalcin-deficient
mice. Nature 382, 448-452.
Ducy, P., Zhang, R., Geoffroy, V., Ridall, A.L., and Karsenty, G. (1997). Osf2/Cbfa1: a
transcriptional activator of osteoblast differentiation. Cell 89, 747-754.
Gabet, Y., Noh, T., Lee, C., and Frenkel, B. (2011). Developmentally regulated inhibition of cell
cycle progression by glucocorticoids through repression of cyclin A transcription in primary
osteoblast cultures. Journal of Cellular Physiology 226, 991-998.
Glinka, A., Wu, W., Delius, H., Monaghan, A.P., Blumenstock, C., and Niehrs, C. (1998).
Dickkopf-1 is a member of a new family of secreted proteins and functions in head induction.
Nature 391, 357-362.
Hsieh, J.C., Kodjabachian, L., Rebbert, M.L., Rattner, A., Smallwood, P.M., Samos, C.H.,
Nusse, R., Dawid, I.B., and Nathans, J. (1999). A new secreted protein that binds to Wnt proteins
and inhibits their activities. Nature 398, 431-436.
Huang, X., Dai, W., and Darzynkiewicz, Z. (2005). Enforced adhesion of hematopoietic cells to
culture dish induces endomitosis and polyploidy. Cell Cycle 4, 801-805.
Inoue, T., Nakayama, Y., Li, Y., Matsumori, H., Takahashi, H., Kojima, H., Wanibuchi, H.,
Katoh, M., and Oshimura, M. (2014). SIRT2 knockdown increases basal autophagy and prevents
postslippage death by abnormally prolonging the mitotic arrest that is induced by microtubule
inhibitors. The FEBS Journal 281, 2623-2637.

31
Kassiotis, C., Ballal, K., Wellnitz, K., Vela, D., Gong, M., Salazar, R., Frazier, O.H., and
Taegtmeyer, H. (2009). Markers of autophagy are downregulated in failing human heart after
mechanical unloading. Circulation 120, S191-197.
Kawano, Y., and Kypta, R. (2003). Secreted antagonists of the Wnt signalling pathway. Journal
of Cell Science 116, 2627-2634.
Khalid, O., Baniwal, S.K., Purcell, D.J., Leclerc, N., Gabet, Y., Stallcup, M.R., Coetzee, G.A.,
and Frenkel, B. (2008). Modulation of Runx2 activity by estrogen receptor-alpha: implications
for osteoporosis and breast cancer. Endocrinology 149, 5984-5995.
Koromila, T., Baniwal, S.K., Song, Y.S., Martin, A., Xiong, J., and Frenkel, B. (2014).
Glucocorticoids antagonize RUNX2 during osteoblast differentiation in cultures of ST2
pluripotent mesenchymal cells. Journal of Cellular Biochemistry 115, 27-33.
Liu, X., Liu, T., Slusarski, D.C., Yang-Snyder, J., Malbon, C.C., Moon, R.T., and Wang, H.
(1999). Activation of a frizzled-2/beta-adrenergic receptor chimera promotes Wnt signaling and
differentiation of mouse F9 teratocarcinoma cells via Galphao and Galphat. Proceedings of the
National Academy of Sciences of the United States of America 96, 14383-14388.
Luppen, C.A., Chandler, R.L., Noh, T., Mortlock, D.P., and Frenkel, B. (2008). BMP-2 vs.
BMP-4 expression and activity in glucocorticoid-arrested MC3T3-E1 osteoblasts: Smad
signaling, not alkaline phosphatase activity, predicts rescue of mineralization. Growth factors 26,
226-237.
Ma, Y., Ren, Y., Han, E.Q., Li, H., Chen, D., Jacobs, J.J., Gitelis, S., O'Keefe, R.J., Konttinen,
Y.T., Yin, G., et al. (2013). Inhibition of the Wnt-beta-catenin and Notch signaling pathways
sensitizes osteosarcoma cells to chemotherapy. Biochemical and Biophysical Research
Communications 431, 274-279.
Mao, B., and Niehrs, C. (2003). Kremen2 modulates Dickkopf2 activity during Wnt/LRP6
signaling. Gene 302, 179-183.
Maruyama, Z., Yoshida, C.A., Furuichi, T., Amizuka, N., Ito, M., Fukuyama, R., Miyazaki, T.,
Kitaura, H., Nakamura, K., Fujita, T., et al. (2007). Runx2 determines bone maturity and
turnover rate in postnatal bone development and is involved in bone loss in estrogen deficiency.

32
Developmental dynamics : an official publication of the American Association of Anatomists
236, 1876-1890.
Mazieres, J., He, B., You, L., Xu, Z., Lee, A.Y., Mikami, I., Reguart, N., Rosell, R., McCormick,
F., and Jablons, D.M. (2004). Wnt inhibitory factor-1 is silenced by promoter hypermethylation
in human lung cancer. Cancer Research 64, 4717-4720.
Ning, Y.M., and Robins, D.M. (1999). AML3/CBFalpha1 is required for androgen-specific
activation of the enhancer of the mouse sex-limited protein (Slp) gene. The Journal of Biological
Chemistry 274, 30624-30630.
Sabelli, P.A., Liu, Y., Dante, R.A., Lizarraga, L.E., Nguyen, H.N., Brown, S.W., Klingler, J.P.,
Yu, J., LaBrant, E., Layton, T.M., et al. (2013). Control of cell proliferation, endoreduplication,
cell size, and cell death by the retinoblastoma-related pathway in maize endosperm. Proceedings
of the National Academy of Sciences of the United States of America 110, E1827-1836.
Sher, N., Von Stetina, J.R., Bell, G.W., Matsuura, S., Ravid, K., and Orr-Weaver, T.L. (2013).
Fundamental differences in endoreplication in mammals and Drosophila revealed by analysis of
endocycling and endomitotic cells. Proceedings of the National Academy of Sciences of the
United States of America 110, 9368-9373.
Tamai, K., Semenov, M., Kato, Y., Spokony, R., Liu, C., Katsuyama, Y., Hess, F., Saint-Jeannet,
J.P., and He, X. (2000). LDL-receptor-related proteins in Wnt signal transduction. Nature 407,
530-535.
Weinstein, R.S. (2012a). Glucocorticoid-induced osteonecrosis. Endocrine 41, 183-190.
Weinstein, R.S. (2012b). Glucocorticoid-induced osteoporosis and osteonecrosis. Endocrinology
and metabolism clinics of North America 41, 595-611.
Wu, W., Glinka, A., Delius, H., and Niehrs, C. (2000). Mutual antagonism between dickkopf1
and dickkopf2 regulates Wnt/beta-catenin signalling. Current Biology: CB 10, 1611-1614.
Xu, Q., D'Amore, P.A., and Sokol, S.Y. (1998). Functional and biochemical interactions of Wnts
with FrzA, a secreted Wnt antagonist. Development 125, 4767-4776.
Yang, Z.Q., Liu, G., Bollig-Fischer, A., Haddad, R., Tarca, A.L., and Ethier, S.P. (2009).
Methylation-associated silencing of SFRP1 with an 8p11-12 amplification inhibits canonical and

33
non-canonical WNT pathways in breast cancers. International Journal of Cancer 125, 1613-1621.
Yao, W., Guan, M., Jia, J., Dai, W., Lay, Y.A., Amugongo, S., Liu, R., Olivos, D., Saunders, M.,
Lam, K.S., et al. (2013). Reversing bone loss by directing mesenchymal stem cells to bone. Stem
Cells 31, 2003-2014.
Yu, J., Adisetiyo, H., Little, G.H., Vangsness, C.T., Jr., Jiang, J., Sternberg, H., West, M.D., and
Frenkel, B. (2014). Initial Characterization of Osteoblast Differentiation and Loss of RUNX2
Stability in the Newly Established SK11 Human Embryonic Stem Cell-Derived Cell Line.
Journal of Cellular Physiology 230, 237-241.
Zong, Z.P., Fujikawa-Yamamoto, K., Ota, T., Murakami, M., Li, A.L., Yamaguchi, N., Tanino,
M., and Odashima, S. (1998). Apoptotic cell death of high polyploid cells in a cultured sarcoma
cell line. Cell Structure and Function 23, 231-237.

Abstract (if available)

Abstract For over six decades, glucocorticoids (GCs) have been used to treat inflammatory diseases such as rheumatoid arthritis, but their long‐term use causes severe side effects, including bone loss. The molecular mechanisms underlying GC‐induced osteoporosis (GIO), are not fully understood, limiting the development of bone‐sparing GC treatment protocols. We have previously shown that treatment of pluripotent murine mesenchymal stem cells (MSCs) with GCs inhibited osteoblast differentiation driven by the master regulator Runx2 and that this was associated with inhibition of Runx2 target gene expression at several loci. To determine the effect of GCs and Runx2 genome wide, we employed expression microarrays. Among several unexpected results, GCs and Runx2 synergistically stimulate Wnt inhibitory factor 1 (Wif1). At the same time, co‐treatment of the MSC cultures with GCs and Runx2, but not any of them alone, induced cell polyploidy. Furthermore, we noticed areas of cell loss in our microplates, specifically in cultures co‐treated with GCs and Runx2, and microscopic evaluation of these areas demonstrated cell debris. The areas of cell loss were observed in the cultures expressing a non‐specific shRNA, but not when Wif1 was silenced with each of two independent shRNAs. These results indicate that GCs and Runx2 together compromise MSC cultures in a Wif1‐dependent manner. Interestingly, the combined negative effect of GCs and Runx2 was developmental stage‐dependent. It was observed when cultures were treated during early differentiation stages (day ~5), but not in mature cultures (day ~12) even though the synergistic stimulation of Wif1 was observed in both the early and mature stages of differentiation. Therefore, Wif1 may play a role in the development of GIO, and blocking Wif1 during GC treatments may reduce their skeletal side effect.

Linked assets

University of Southern California Dissertations and Theses

Conceptually similar

PDF

Runx2 interactions with the osteoblast genome

PDF

Preosteoblast-specific RUNX2 promotes RANKL membrane association: antagonism by sex steroids through a non-genomic mechanism

PDF

RUNX2 & sex steroids: molecular mechanisms in regulating bone turnover

PDF

RUNX2 stimulates osteoblast-driven osteoclastogenesis by RANKL presentation

PDF

Inhibitory effects of estradiol and SERMs on RUNX2-driven osteoblast differentiation and gene expression

PDF

The role of Runx2 in the development of the tendon-bone attachment unit

PDF

The effect of estradiol on TAZ in stromal cell line ST2 in osteoblast differentiation and ER+breast cancer cell

PDF

Cryopreserved umbilical cord mesenchymal stem cells therapy for the treatment of knee osteoarthritis: in-vitro evaluation and phase I clinical trial protocol

PDF

Developing novel in vitro model systems to investigate therapeutic hypotheses for peroxisome biogenesis disorders

PDF

Topical adipose-derived stem cell therapy ameliorates radiation-induced delayed wound healing

PDF

Pten deletion in adult pancreatic beta-cells induces cell proliferation and G1/S cell cycle progression

PDF

Wnt/β-catenin/p300 induced transcription is critical for the differentiation and maintenance of Paneth cells

PDF

An overview of Alzheimer’s disease and the potential for APP-beta secretase-interaction as a therapeutic target

PDF

Ethanol induced modulation of microglial P2X7 receptor expression and its role in neuroinflammation

PDF

G9a, GLP and HP1γ facilitate glucocorticoid-induced apoptosis in B-ALL cells

PDF

Creating a multiple micrornia expression vector to target GRP78, an ER chaperone and signaling regulator in cancer

PDF

Mechanisms of nuclear translocation of pyruvate dehydrogenase and its effects on tumorigenesis of hepatocellular carcinoma…

PDF

From mesenchymal stem cell therapy to discovery of drug therapy for systemic sclerosis

PDF

In vitro generation of chondrocyte-osteoblast hybrid cells through differentiation of ATDC5 cells

PDF

The role of Hic-5 in glucocorticoid receptor binding to chromatin

Asset Metadata

Creator Champagne, Eri Morimoto (author)

Core Title Glucocorticoids and Runx2 synergistically stimulate Wif1 and compromise pre-osteoblats in vitro

School Keck School of Medicine

Degree Master of Science

Degree Program Biochemistry and Molecular Biology

Publication Date 07/16/2015

Defense Date 04/07/2015

Publisher University of Southern California (original), University of Southern California. Libraries (digital)

Tag glucocorticoids,mesenchymal stem cells,OAI-PMH Harvest,osteoporosis,RUNX2,Wif1

Format application/pdf (imt)

Language English

Contributor Electronically uploaded by the author (provenance)

Advisor Frenkel, Baruch (committee member), Hacia, Joseph G. (committee member), Stallcup, Michael R. (committee member), Tokes, Zoltan A. (committee member)

Creator Email echampag@usc.edu,erim1004@gmail.com

Permanent Link (DOI) https://doi.org/10.25549/usctheses-c3-595782

Unique identifier UC11301220

Identifier etd-ChampagneE-3614.pdf (filename),usctheses-c3-595782 (legacy record id)

Legacy Identifier etd-ChampagneE-3614.pdf

Dmrecord 595782

Document Type Thesis

Format application/pdf (imt)

Rights Champagne, Eri Morimoto

Type texts

Source University of Southern California (contributing entity), University of Southern California Dissertations and Theses (collection)

Access Conditions The author retains rights to his/her dissertation, thesis or other graduate work according to U.S. copyright law. Electronic access is being provided by the USC Libraries in agreement with the a...

Repository Name University of Southern California Digital Library

Repository Location USC Digital Library, University of Southern California, University Park Campus MC 2810, 3434 South Grand Avenue, 2nd Floor, Los Angeles, California 90089-2810, USA