University of Southern California Dissertations and Theses

Conjugation of CpG oligodeoxynucleotides to tumor‐targeting antibodies for immunotherapy of solid tumors

(USC Thesis Other)

Conjugation of CpG oligodeoxynucleotides to tumor‐targeting antibodies for immunotherapy of solid tumors

PDF

Download a page range

Download transcript

Copy asset link

Request this asset

Transcript (if available)

Content

CONJUGATION OF CPG OLIGODEOXYNUCLEOTIDES TO TUMOR-
TARGETING ANTIBODIES FOR IMMUNOTHERAPY OF SOLID TUMORS

By

Julie Kau Jang

A Dissertation Presented to the
FACULTY OF THE USC GRADUATE SCHOOL
UNIVERSITY OF SOUTHERN CALIFORNIA
In Partial Fulfillment of the
Requirements for the Degree
DOCTOR OF PHILOSOPHY
(INTEGRATIVE BIOLOGY OF DISEASE)

August 2015
COPYRIGHT 2015 Julie Kau Jang

DEDICATION

To my family, for their constant love and support.

i

TABLE OF CONTENTS

List of Tables ii
List of Figures iii
Abstract 1
Chapter 1 Introduction 2
Chapter 2 Cytoreductive chemotherapy improves the biodistribution of
antibodies directed against tumor necrosis in murine solid
tumor models
16
Chapter 3 Generation of tumor-targeted antibody/CpG
oligodeoxynucleotide immunoconjugates
44
Chapter 4 Systemic delivery of chTNT-3/CpG oligodeoxynucleotide
immunoconjugates for immunotherapy in murine solid tumor
models
69
Chapter 5 Conclusions and future directions 110
Appendix 135
Acknowledgements 139
Bibliography 143

ii

LIST OF TABLES

Table 1.1 List of toll-like receptors and their ligands 7
Table 4.1 Three major classes of CpG 73
Table 4.2 Sequences of constructs and oligo:antibody ratios 74
Table 4.3 Antibodies used in flow cytometry experiments 81
Table 5.1 Rational therapeutic combinations with CpG 125

iii

LIST OF FIGURES

Figure 1.1 Polarizing the immune system in cancer immunotherapy 5
Figure 1.2 Cellular responses to CpG 9
Figure 2.1 Five-day biodistribution of
125
I-NHS76 in Colon 26-bearing
BALB/c mice
27
Figure 2.2 Three-day biodistribution of
125
I-chTNT-3 28
Figure 2.3 One-day biodistribution of
125
I-chTNT-3 or
125
I-chTNT-3
F(ab’)2 in LS174T tumor-bearing nude mice
28
Figure 2.4 MicroPET/CT imaging of
64
Cu-Sar-chTNT-3 in MAD109-
bearing BALB/c mice following VP-16 (30 mg/kg)
pretreatment
30
Figure 2.5 Immunohistochemistry of MAD109 tumors pretreated with VP-
16 (30 mg/kg)
32
Figure 2.6 Three-day biodistribution of
125
I-chTNT-3 administered 1 day
after chemotherapy treatment of MAD109-bearing mice with
and without chTNT-3/IL-2 pretreatment
34
Figure 3.1 Immunoconjugation reactions for the generation of
antibody/CpG.
54
Figure 3.2 Size exclusion chromatography isolating antibody/CpG
immunoconjugates
55
Figure 3.3 Visualization of antibody/CpG immunoconjugates after agarose
gel electrophoresis by tandem ethidium bromide and
Coomassie Blue R-250 staining
57
Figure 3.4 Binding of native antibody and immunoconjugates to antigen-
positive cells
60
Figure 3.5 IL-6 response to antibody/CpG and free CpG in vitro 62
Figure 4.1 Higher order structures formed by class A CpG 84
Figure 4.2 Size and charge separation of chTNT-3/CpG conjugates 85
Figure 4.3 chTNT-3/CpG co-localizes with TLR9 in vitro and targets
tumor in vivo
87
iv

Figure 4.4 Array of cytokines induced by chTNT-3/CpG1826 88
Figure 4.5 Cytokines produced in response to chTNT-3/CpG1585 and
chTNT-3/CpG1826, without CD3 stimulation
90
Figure 4.6 Cytokine production in response to chTNT-3/CpG1585 and
chTNT-3/CpG1826, with CD3 stimulation
91
Figure 4.7 Heat map of cytokine expression in response to free CpG and
chTNT-3/CpG conjugates
92
Figure 4.8 Class A and B CpG sequences decrease tumor burden and
improve survival in highly (Colon 26) and poorly (B16)
immunogenic different tumor models when conjugated to
chTNT-3
94
Figure 4.9 Optimal effect on tumor growth requires delivery of CpG to the
tumor
97
Figure 4.10 CpG-moiety on cetuximab/CpG is active in vitro 99
Figure 4.11 FACS analysis of TDLN in tumor-bearing mice treated with
chTNT-3/CpG1826
100
Figure 5.1 Immunogenicity spectrum of six common murine tumor models 114
Figure 5.2 In vitro activity of CpG 7909 on murine cells 117
Figure 5.3 Conjugation methods for antibody-drug conjugate (ADC)
development
118
Figure 5.4 Combining VP-16 and chTNT-3/CpG1826 in a Colon 26 tumor
model
124
Appendix
Figure 4.1
Internalization and co-localization of chTNT-3 moiety of
chTNT-3/CpG-biotin
136
Appendix
Figure 4.2
IL-2, IL-17(F), IFN-γ, and IFN-α release in response to CpG or
chTNT-3/CpG without CD3 stimulation, and IL-4 release with
CD3 stimulation
137
Appendix
Figure 4.3
Individual tumor curves for mice treated with PBS, chTNT-
3/CpG1585, and chTNT-3/CpG1826
138

1

ABSTRACT
As the second leading cause of death in the United States, cancer is a significant
human and economic burden, and recurrence limits successful outcomes. Unlike current
mainstays of treatment —surgery, chemotherapy, and radiotherapy —immunotherapy has
the potential to prevent recurrence by mounting an immune response and memory against
a specific cancer. However, immunotherapy is limited when cancers escape detection and
eradication by the immune system. The scientific and medical communities have applied
pathogens and pathogen-associated molecules directly into tumors to enhance tumor
immunogenicity with varying degrees of success. One of these agents is a toll-like receptor
9 agonist, CpG oligodeoxynucleotides (CpG). In the presence of tumor antigens, CpG
promote anti-tumor immune responses. Optimal effects require intratumoral delivery,
thereby limiting its use in metastatic disease. However, the majority of cancer clinical trials
evaluating CpG use systemic routes of administration.
Because intratumoral injections are not always feasible in clinical applications, we
conjugated CpG to a tumor-targeting antibody to enable systemic delivery. This
dissertation describes the conjugation of CpG to chimeric antibody TNT-3 (chTNT-3). In
addition to characterizing the biodistribution of chTNT-3 in combination with
chemotherapy and methods for chemical conjugation, chTNT-3/CpG immunoconjugates
were evaluated in murine solid tumor models, where systemically delivered chTNT-3/CpG
reduced tumor burden and improved survival. Importantly, this study showed that
conjugation to a tumor-targeting antibody, as opposed to an irrelevant antibody, was crucial
for efficacy. These preclinical findings demonstrate the therapeutic potential of chTNT-
3/CpG in cancer immunotherapy, and answer an unmet need in current clinical trials.

CHAPTER 1

INTRODUCTION

In 2015, cancer immunotherapy made its way into mainstream news media with
early updates on a clinical trial directly injecting modified poliovirus (PVS-RIPO) into the
tumors of glioblastoma multiforme. While the virus itself is oncolytic, PVS-RIPO elicits
immune responses against the infected tumor cells [1]. The concept of administering
pathogens to cure malignancies started over a century ago, when two German physicians
Wilhelm Busch and Fredrich Fehleisen (reviewed in [2]) began inoculating cancer patients
with the causative agent of erysipelas (Streptococcus pyogenes), a skin infection of the
upper dermis. Independently, American physician William B. Coley noticed a sarcoma
patient who went into remission following a fortuitous episode of erysipelas [3]. Shortly
thereafter, in 1891, Coley began directly injecting live Streptococcal cultures into patients’
tumors, with his first test patient brought into remission [3, 4]. Attributing the therapeutic
effects to the toxins produced by bacteria, he developed preparations of killed S. pyogenes
and Serratia marcescens, now known as Coley’s toxins [5]. Over the next several decades,
he and many other physicians treated several hundred malignancies with mixed bacterial
preparations with varying degrees of success. It was only appreciated later in Coley’s
career that the toxins, even if administered intravenously, had to reach tumors for their
therapeutic effect (reviewed in [6]).
2

1.1 IMMUNOTHERAPY AND IMMUNE ESCAPE
Without the theory of immunosurveillance that we have today, Coley theorized
“that the toxic products of the erypsipelas streptococci might bring about such changes in
the bloodserum as to destroy the parasite of cancer” [3]. While vague, he described a
phenomenon that would be exploited by immunotherapy almost a century later. Today,
cancer immunotherapies include a wide variety of approaches, with the commonality of
manipulating components of the immune system to destroy cancer cells.
Immunosurveillance, or the idea that the immune system naturally is capable of detecting
and eradicating transformed cells [7], underlies many of these approaches. Several
observations support this theory, including the higher incidences of cancers of viral and
non-viral etiologies in immunosuppressed patients and naturally occurring tumor-
infiltrating lymphocytes (reviewed in [8, 9]). However, if immune cells normally survey
the body for precancerous cells, cancers exist by subverting the immune system in
processes known as immune evasion and immune escape (reviewed in [10, 11]).
While immunosurveillance is difficult to prove, the ability of malignancies to alter
immune components is well established (reviewed in [8-12]), with immune escape being
inducted as one of the new hallmarks of cancer [13]. Conceptually, tumor escape may occur
due to a lack of immunostimulatory signals or through an increase in immunoinhibitory
signals. The immunogenicity of tumors depend on the tumor’s expression of tumor-
associated and tumor-specific antigens, as well as the ability of those antigens to be
presented on major histocompatibility complex (MHC) molecules. Cancers often have low
surface MHC expression due to genomic and transcriptional changes, and this contributes
to poor immunogenicity. On the other side of the spectrum, some tumors are highly
3

immunogenic. As evidence of their immunogenicity, theses tumors may have abundant
tumor-infiltrating lymphocytes. However, these tumors exist by blocking the effector phase
of immune responses. Tumor cells can accomplish this feat by expressing
immunosuppressive ligands (e.g., PD-L1) and suppressive cytokines (e.g., IL-10 and TGF-
β) (reviewed in [14, 15]). Moreover, tumors often recruit suppressive immune cells,
including type 2 tumor-associated macrophages, T regulatory cells (Tregs), and myeloid-
derived suppressor cells (MDSC). In addition to supporting the growth of tumors, these
cell types limit the ability of natural killer (NK) cells and cytotoxic T lymphocytes (CTL)
from eliminating tumors.
Successful immunotherapy of cancer requires two important aspects, essentially
the activation of immune effector cells and the reversal of immune evasion by the tumor.
When both occur, immunotherapy becomes a powerful and robust method of cancer
treatment. To date, our laboratory has tested several immune molecules, including
cytokines [16-18], chemokines [19, 20], and co-stimulatory proteins [21-26] for their
ability to stimulate immune cells and reverse immune suppression. In summary, these
molecules are an attempt to skew the tumor microenvironment towards supportive
conditions for anti-tumor immunity (Figure 1.1). While some approaches, such as the
adoptive transfer of ex vivo stimulated or genetically modified T cells, try to bypass the
need for innate immunity, optimal responses may occur when the innate and adaptive
immune systems work cooperatively towards anti-tumor immunity (reviewed in [27-29]).
Key to having the right innate immune cells [type 1 macrophages, NK, and immunogenic
dendritic cells (DC)] and adaptive cells (CTL) activated is the production of T-helper 1
4

(TH1) cytokines (e.g., IL-2, IL-12, IFN- γ, etc.). Figure 1.1 summarizes some of the key
cells and molecules that promote anti-tumor immunity [27, 30, 31].

1.2 TOLL-LIKE RECEPTOR AGONISTS
Injecting tumors with live bacteria, virus, or Coley’s toxins are variations of in situ
vaccination. While the pathogens may have direct effects on surrounding cells, the longer-
lasting actions are due to immune responses. In a natural infection, pathogen-associated
molecular patterns (PAMPs) alert innate immune cells to the presence of pathogens. As
some innate components address the infected cells and pathogens directly, other innate
Figure 1.1. Polarizing the immune system in cancer immunotherapy.
Immunotherapy redirects the immune system towards tumor rejection.
Immunogenic DC (dendritic cells) express costimulatory molecules, such as
CD40, CD80, and CD86, while tumors and other immune cells may express
inhibitory ligands, such as PD-L1 and B7-H3. M1 (type 1 tumor-associated
macrophages), M2 (type 2 tumor associated macrophages), CD8 CTL (cytotoxic
T lymphocytes), TH1 CD4 (helper T cells), NK (natural killer cells), MDSC
(myeloid derived suppressor cells), Treg (T regulatory cells), PGE2
(prostaglandin E2), and IDO (indoleamine 2,3-dioxygenase).
5

immune cells will prime the adaptive immune responses. The adaptive components attempt
to neutralize infected cells or pathogens through the production of antibodies and the killing
action of CTL. Importantly, the adaptive immune cells generate a “memory” of the
infection, so that in a repeat encounter with the specific pathogen, adaptive immunity can
occur rapidly and more efficiently to prevent or shorten clinical manifestations of the
illness. In cancers that are hidden from the immune system, the addition of PAMPs to the
tumor microenvironment activates local immune responses. Essentially, the presence of
the pathogens or PAMPs, such as Coley’s toxins, “alerts” the immune system that a
potentially diseased process is present.
Toll-like receptors (TLR) are a class of germline-encoded receptors that recognize
PAMPs and potently activate the immune system. In spite of their different ligands,
localization, and downstream activity, TLR activation generally results in the translocation
of the transcription factor nuclear factor κB (NF- κB) into the nucleus and subsequent
transcription of pro-inflammatory genes. TLR activation promotes TH1 responses, although
this may be context dependent, as several TLR agonists induce the production of TH2 and
TH17 cytokines in specific settings (reviewed in [32]). Because of their immunomodulatory
properties and promotion of TH1 responses, many TLR agonists are used as vaccine
adjuvants, in the treatment of asthma and allergies, and in cancer therapy. While many TLR
agonists are in clinical trials, only three agonists (BCG, MPL, and imiquimod) are
approved by the United States Food and Drug Administration for use in human cancers. A
list of TLR agonists is included in Table 1.1. While we will discuss TLR9 and its agonist,
readers are referred to several reviews on TLR agonists and their therapeutic uses [33-35].
6

Expression Agonist
Examples of Common
Synthetic Agonists
TLR1 extracellular bacterial lipoprotein Pam3Cys derivatives, BCG
TLR2 extracellular
bacterial lipoproteins,
peptidoglycan, HSP70
Pam3Cys, Pam2Cys
derivatives, BCG
TLR3 intracellular dsRNA poly(I:C)
TLR4 extracellular
lipopolysaccharide, HSP60,
HSP70
BCG, MPL
TLR5 extracellular bacterial flagellin
TLR6 extracellular bacterial lipoproteins Pam2Cys derivatives, BCG
TLR7 intracellular ssRNA
imidazoquinoline
compounds (e.g.,
resiquimod
TLR8 intracellular ssRNA
imidazoquinoline
compounds (e.g.,
resiquimod
TLR9 intracellular unmethylated CpG DNA CpG, BCG

Table 1.1. List of toll-like receptors and their ligands. TLR10-13 are not well
characterized and not listed here. List compiled from [35-37]. Pam3Cys (tri-palmitoyl-S-
glyceryl cysteine), Pam2Cys (di-palmitoyl-S-glyceryl cysteine), BCG (bacillus Calmette–
Guérin vaccine), MPL (monophosphoryl lipid A), and poly(I:C) (polyinosine-polycytidylic
acid).

In the context of cancer therapy, one well-studied class of TLR agonists include
CpG oligodeoxynucleotides (CpG). These TLR9 agonists have unmethylated cytosine-
guanine motifs commonly found in microbial DNA but are uncommon in mammalian
7

genomes [38]. CpG rapidly activates plasmacytoid DC and B cells to promote the
production of TH1 cytokines, enhance antigen presentation, and antibody production [39-
41] (Figure 1.2). By delivering these PAMPs into tumors, we can potentially alter the tumor
microenvironment towards anti-tumor immunity. With this approach, CpG has been
studied in many murine syngeneic tumor models [42-61]. From these models, CpG not
only elicited anti-tumor responses from macrophages, NK, and T cells, it also reduced the
suppressive activity of MDSC and promoted their differentiation into type 1 macrophages
[51, 62]. As previously discussed, successful immunotherapy needs to promote tumor
immunogenicity as well as reverse mechanisms of immunosuppression. Of great
importance, observations from mouse models suggested that CpG can do both.
Like most therapeutics in clinical trials, CpG has not exhibited the same level of
success seen in animal models [63-74]. In trials of non-Hodgkin’s lymphoma, basal cell
carcinoma, and melanoma, several of the trials noted improvement in NK activity [64-66],
activation of myeloid and plasmacytoid DC [66], decreases in the number of Tregs [66],
and favorable cytokine secretion [65, 67]. In spite of immune modulation, most studies
observed partial responses only in a minority of patients [63-65, 69, 70, 72-74]. In several
randomized clinical trials evaluating CpG in combination with chemotherapy or erlotinib
(anti-EGFR antibody) for the treatment of non-small cell lung cancer, CpG did not improve
survival [72-74] and increased toxicity [72, 73]. Following these results, Pfizer
discontinued their pursuit of combining CpG (PF-3512676) with chemotherapy for the
treatment of non-small cell lung cancer, and terminated four ongoing clinical trials [75].
Surprisingly, many of the clinical trials did not heed observations from preclinical
models. In animal models, CpG needed to be in the presence of tumor antigens, either in
8

the form of a vaccine or administered directly into or around the tumor space to generate
effective anti-tumor immunity [45, 47, 51]. Excluding trials using CpG as a vaccine
component, over 70% of the cancer trials nationally registered describe the systemic
administration (subcutaneous, intramuscular, or intravenous, with subcutaneous being the
most common) of CpG in their protocols (ClinicalTrials.gov, [64, 65, 68-70, 72-74]).

Figure 1.2. Cellular responses to CpG. CpG activates TLR9 on
B cells and plasmacytoid DC to enhance antibody production and
antigen presenter cell (APC) function. CpG also binds to TLR9
induced on other immune cells types with unknown significance.
Taken from Klinman, D.M. 2004 [34].
9

1.3 SUMMARY
After Coley reported the success of treating sarcoma patients with erysipelas, his
work did not gain wide acceptance from the medical community due to the inability of the
community to replicate his work consistently (reviewed in [6]). The difficulty in replicating
his results stemmed from different reagent preparations and the varied dosages and routes
of administration. Now, more than one century later, clinical trials with CpG face similar
challenges. In addition to the different reagents and dose regimens, clinical trials are using
suboptimal routes of delivery of CpG. From these trials, questions arise as to how we can
harness the full potential of this immunotherapeutic agent.
Unlike in animal studies with subcutaneous tumors, repeated intratumoral delivery
is impractical for patients. In most cases, disease is located internally and often
disseminated. To enable systemic delivery, we chemically conjugated CpG to tumor-
targeting antibodies, most notably chTNT-3, an antibody targeting the tumor’s necrotic
core, which is abundant in tumor antigens. The subsequent chapters of this dissertation
describe the tumor targeting capability of chTNT-3, methods for chemical conjugation, and
the in vivo evaluation of chTNT-3/CpG immunoconjugates in two mouse tumor models.
We hypothesized that by conjugating CpG to chTNT-3, we can systemically deliver CpG
in tumor-bearing mice to generate anti-tumor immune responses. Lastly, we discuss some
of the exciting directions for the development of chTNT-3/CpG as a therapeutic for human
cancers.

10

REFERENCES
1. Pol JG, Marguerie M, Arulanandam R, Bell JC, Lichty BD. Panorama from the
oncolytic virotherapy summit. Mol Ther. 2013; 21: 1814-8.
2. Oelschlaeger TA. Bacteria as tumor therapeutics? Bioeng Bugs. 2010; 1: 146-7.
3. Coley WB. The treatment of malignant tumors by repeated inoculations of
erysipelas. With a report of ten original cases. 1893. Clin Orthop Relat Res. 1991: 3-11.
4. Coley WB. II. Contribution to the Knowledge of Sarcoma. Ann Surg. 1891; 14:
199-220.
5. Coley WB. The Treatment of Inoperable Sarcoma by Bacterial Toxins (the Mixed
Toxins of the Streptococcus erysipelas and the Bacillus prodigiosus). Proc R Soc Med.
1910; 3: 1-48.
6. Nauts HC, Swift WE, Coley BL. The treatment of malignant tumors by bacterial
toxins as developed by the late William B. Coley, M.D., reviewed in the light of modern
research. Cancer Res. 1946; 6: 205-16.
7. Burnet FM. Immunological aspects of malignant disease. Lancet. 1967; 1: 1171-4.
8. Kim R, Emi M, Tanabe K. Cancer immunoediting from immune surveillance to
immune escape. Immunology. 2007; 121: 1-14.
9. Swann JB, Smyth MJ. Immune surveillance of tumors. J Clin Invest. 2007; 117:
1137-46.
10. Dunn GP, Bruce AT, Ikeda H, Old LJ, Schreiber RD. Cancer immunoediting: from
immunosurveillance to tumor escape. Nature immunology. 2002; 3: 991-8.
11. Zitvogel L, Tesniere A, Kroemer G. Cancer despite immunosurveillance:
immunoselection and immunosubversion. Nature reviews Immunology. 2006; 6: 715-27.
12. Khanna R. Tumour surveillance: missing peptides and MHC molecules. Immunol
Cell Biol. 1998; 76: 20-6.
13. Hanahan D, Weinberg RA. Hallmarks of cancer: the next generation. Cell. 2011;
144: 646-74.
14. Schreiber TH, Raez L, Rosenblatt JD, Podack ER. Tumor immunogenicity and
responsiveness to cancer vaccine therapy: the state of the art. Semin Immunol. 2010; 22:
105-12.
15. Zitvogel L, Kroemer G. Targeting PD-1/PD-L1 interactions for cancer
immunotherapy. Oncoimmunology. 2012; 1: 1223-5.
16. Sharifi J, Khawli LA, Hu P, Li J, Epstein AL. Generation of human interferon
gamma and tumor Necrosis factor alpha chimeric TNT-3 fusion proteins. Hybrid
Hybridomics. 2002; 21: 421-32.
17. Mizokami MM, Hu P, Khawli LA, Li J, Epstein AL. Chimeric TNT-3
antibody/murine interferon-gamma fusion protein for the immunotherapy of solid
malignancies. Hybridoma and hybridomics. 2003; 22: 197-207.
18. Li J, Hu P, Khawli LA, Yun A, Epstein AL. chTNT-3/hu IL-12 fusion protein for
the immunotherapy of experimental solid tumors. Hybrid Hybridomics. 2004; 23: 1-10.
19. Li J, Hu P, Khawli LA, Epstein AL. Complete regression of experimental solid
tumors by combination LEC/chTNT-3 immunotherapy and CD25(+) T-cell depletion.
Cancer research. 2003; 63: 8384-92.
20. Li J, Hu P, Khawli LA, Epstein AL. LEC/chTNT-3 fusion protein for the
immunotherapy of experimental solid tumors. J Immunother. 2003; 26: 320-31.
11

21. Liu A, Hu P, Khawli LA, Epstein AL. Combination B7-Fc fusion protein treatment
and Treg cell depletion therapy. Clin Cancer Res. 2005; 11: 8492-502.
22. Hu P, Arias RS, Sadun RE, Nien YC, Zhang N, Sabzevari H, et al. Construction
and preclinical characterization of Fc-mGITRL for the immunotherapy of cancer. Clin
Cancer Res. 2008; 14: 579-88.
23. Zhang N, Sadun RE, Arias RS, Flanagan ML, Sachsman SM, Nien YC, et al.
Targeted and untargeted CD137L fusion proteins for the immunotherapy of experimental
solid tumors. Clin Cancer Res. 2007; 13: 2758-67.
24. Liu A, Hu P, Khawli LA, Epstein AL. B7.1/NHS76: a new costimulator fusion
protein for the immunotherapy of solid tumors. J Immunother. 2006; 29: 425-35.
25. Flanagan ML, Khawli LA, Hu P, Epstein AL. H60/TNT-3 fusion protein activates
NK cells in vitro and improves immunotherapeutic outcome in murine syngeneic tumor
models. J Immunother. 2006; 29: 274-83.
26. Sadun RE, Hsu WE, Zhang N, Nien YC, Bergfeld SA, Sabzevari H, et al. Fc-
mOX40L fusion protein produces complete remission and enhanced survival in 2 murine
tumor models. J Immunother. 2008; 31: 235-45.
27. Shanker A, Marincola FM. Cooperativity of adaptive and innate immunity:
implications for cancer therapy. Cancer Immunol Immunother. 2011; 60: 1061-74.
28. Vesely MD, Kershaw MH, Schreiber RD, Smyth MJ. Natural innate and adaptive
immunity to cancer. Annu Rev Immunol. 2011; 29: 235-71.
29. Liu Y, Zeng G. Cancer and innate immune system interactions: translational
potentials for cancer immunotherapy. J Immunother. 2012; 35: 299-308.
30. Braumuller H, Wieder T, Brenner E, Assmann S, Hahn M, Alkhaled M, et al. T-
helper-1-cell cytokines drive cancer into senescence. Nature. 2013; 494: 361-5.
31. Monjazeb AM, Zamora AE, Grossenbacher SK, Mirsoian A, Sckisel GD, Murphy
WJ. Immunoediting and antigen loss: overcoming the achilles heel of immunotherapy with
antigen non-specific therapies. Front Oncol. 2013; 3: 197.
32. Netea MG, Van der Meer JW, Sutmuller RP, Adema GJ, Kullberg BJ. From the
Th1/Th2 paradigm towards a Toll-like receptor/T-helper bias. Antimicrob Agents
Chemother. 2005; 49: 3991-6.
33. Akira S, Takeda K. Toll-like receptor signalling. Nature reviews Immunology.
2004; 4: 499-511.
34. Klinman DM. Immunotherapeutic uses of CpG oligodeoxynucleotides. Nature
reviews Immunology. 2004; 4: 249-58.
35. Kaczanowska S, Joseph AM, Davila E. TLR agonists: our best frenemy in cancer
immunotherapy. J Leukoc Biol. 2013; 93: 847-63.
36. Gnjatic S, Sawhney NB, Bhardwaj N. Toll-like receptor agonists: are they good
adjuvants? Cancer J. 2010; 16: 382-91.
37. Abbas AK, Lichtman AH, Pillai S. Basic immunology functions and disorders of
the immune system. Fourth edition. ed. Philadelphia, PA: Elsevier/Saunders,; 2014. p. ix,
320 pages color illustrations 24 cm.
38. Tokunaga T, Yamamoto H, Shimada S, Abe H, Fukuda T, Fujisawa Y, et al.
Antitumor activity of deoxyribonucleic acid fraction from Mycobacterium bovis BCG. I.
Isolation, physicochemical characterization, and antitumor activity. Journal of the National
Cancer Institute. 1984; 72: 955-62.
12

39. Weiner GJ. The immunobiology and clinical potential of immunostimulatory CpG
oligodeoxynucleotides. J Leukoc Biol. 2000; 68: 455-63.
40. Chu RS, Targoni OS, Krieg AM, Lehmann PV, Harding CV. CpG
oligodeoxynucleotides act as adjuvants that switch on T helper 1 (Th1) immunity. The
Journal of experimental medicine. 1997; 186: 1623-31.
41. Krieg AM, Yi AK, Matson S, Waldschmidt TJ, Bishop GA, Teasdale R, et al. CpG
motifs in bacterial DNA trigger direct B-cell activation. Nature. 1995; 374: 546-9.
42. Kawarada Y, Ganss R, Garbi N, Sacher T, Arnold B, Hammerling GJ. NK- and
CD8(+) T cell-mediated eradication of established tumors by peritumoral injection of CpG-
containing oligodeoxynucleotides. Journal of immunology. 2001; 167: 5247-53.
43. Heckelsmiller K, Rall K, Beck S, Schlamp A, Seiderer J, Jahrsdorfer B, et al.
Peritumoral CpG DNA elicits a coordinated response of CD8 T cells and innate effectors
to cure established tumors in a murine colon carcinoma model. Journal of immunology.
2002; 169: 3892-9.
44. Sharma S, Karakousis CP, Takita H, Shin K, Brooks SP. Intra-tumoral injection of
CpG results in the inhibition of tumor growth in murine Colon-26 and B-16 tumors.
Biotechnology letters. 2003; 25: 149-53.
45. Amos SM, Pegram HJ, Westwood JA, John LB, Devaud C, Clarke CJ, et al.
Adoptive immunotherapy combined with intratumoral TLR agonist delivery eradicates
established melanoma in mice. Cancer immunology, immunotherapy : CII. 2011; 60: 671-
83.
46. Schettini J, Kidiyoor A, Besmer DM, Tinder TL, Roy LD, Lustgarten J, et al.
Intratumoral delivery of CpG-conjugated anti-MUC1 antibody enhances NK cell anti-
tumor activity. Cancer Immunol Immunother. 2012; 61: 2055-65.
47. Betting DJ, Yamada RE, Kafi K, Said J, van Rooijen N, Timmerman JM.
Intratumoral but not systemic delivery of CpG oligodeoxynucleotide augments the efficacy
of anti-CD20 monoclonal antibody therapy against B cell lymphoma. J Immunother. 2009;
32: 622-31.
48. Lonsdorf AS, Kuekrek H, Stern BV, Boehm BO, Lehmann PV, Tary-Lehmann M.
Intratumor CpG-oligodeoxynucleotide injection induces protective antitumor T cell
immunity. J Immunol. 2003; 171: 3941-6.
49. Buhtoiarov IN, Sondel PM, Wigginton JM, Buhtoiarova TN, Yanke EM, Mahvi
DA, et al. Anti-tumour synergy of cytotoxic chemotherapy and anti-CD40 plus CpG-ODN
immunotherapy through repolarization of tumour-associated macrophages. Immunology.
2011; 132: 226-39.
50. Wingender G, Garbi N, Schumak B, Jungerkes F, Endl E, von Bubnoff D, et al.
Systemic application of CpG-rich DNA suppresses adaptive T cell immunity via induction
of IDO. European journal of immunology. 2006; 36: 12-20.
51. Shirota Y, Shirota H, Klinman DM. Intratumoral injection of CpG oligonucleotides
induces the differentiation and reduces the immunosuppressive activity of myeloid-derived
suppressor cells. J Immunol. 2012; 188: 1592-9.
52. Weigel BJ, Rodeberg DA, Krieg AM, Blazar BR. CpG oligodeoxynucleotides
potentiate the antitumor effects of chemotherapy or tumor resection in an orthotopic murine
model of rhabdomyosarcoma. Clin Cancer Res. 2003; 9: 3105-14.
13

53. Balsari A, Tortoreto M, Besusso D, Petrangolini G, Sfondrini L, Maggi R, et al.
Combination of a CpG-oligodeoxynucleotide and a topoisomerase I inhibitor in the therapy
of human tumour xenografts. Eur J Cancer. 2004; 40: 1275-81.
54. Pratesi G, Petrangolini G, Tortoreto M, Addis A, Belluco S, Rossini A, et al.
Therapeutic synergism of gemcitabine and CpG-oligodeoxynucleotides in an orthotopic
human pancreatic carcinoma xenograft. Cancer Res. 2005; 65: 6388-93.
55. Bourquin C, Schreiber S, Beck S, Hartmann G, Endres S. Immunotherapy with
dendritic cells and CpG oligonucleotides can be combined with chemotherapy without loss
of efficacy in a mouse model of colon cancer. Int J Cancer. 2006; 118: 2790-5.
56. Gekeler V, Gimmnich P, Hofmann HP, Grebe C, Rommele M, Leja A, et al. G3139
and other CpG-containing immunostimulatory phosphorothioate oligodeoxynucleotides
are potent suppressors of the growth of human tumor xenografts in nude mice.
Oligonucleotides. 2006; 16: 83-93.
57. Rayburn ER, Wang W, Zhang R, Wang H. Experimental therapy for colon cancer:
anti-cancer effects of TLR9 agonism, combination with other therapeutic modalities, and
dependence upon p53. Int J Oncol. 2007; 30: 1511-9.
58. Reinis M, Simova J, Indrova M, Bieblova J, Bubenik J. CpG oligodeoxynucleotides
are effective in therapy of minimal residual tumour disease after chemotherapy or surgery
in a murine model of MHC class I-deficient, HPV16-associated tumours. Int J Oncol. 2007;
30: 1247-51.
59. Petrangolini G, Tortoreto M, Perego P, Carenini N, De Cesare M, Balsari A, et al.
Combination of metronomic gimatecan and CpG-oligodeoxynucleotides against an
orthotopic pancreatic cancer xenograft. Cancer Biol Ther. 2008; 7: 596-601.
60. Johnson EE, Buhtoiarov IN, Baldeshwiler MJ, Felder MA, Van Rooijen N, Sondel
PM, et al. Enhanced T-cell-independent antitumor effect of cyclophosphamide combined
with anti-CD40 mAb and CpG in mice. J Immunother. 2011; 34: 76-84.
61. Sommariva M, De Cecco L, De Cesare M, Sfondrini L, Menard S, Melani C, et al.
TLR9 agonists oppositely modulate DNA repair genes in tumor versus immune cells and
enhance chemotherapy effects. Cancer Res. 2011; 71: 6382-90.
62. Zoglmeier C, Bauer H, Norenberg D, Wedekind G, Bittner P, Sandholzer N, et al.
CpG blocks immunosuppression by myeloid-derived suppressor cells in tumor-bearing
mice. Clin Cancer Res. 2011; 17: 1765-75.
63. Carpentier A, Laigle-Donadey F, Zohar S, Capelle L, Behin A, Tibi A, et al. Phase
1 trial of a CpG oligodeoxynucleotide for patients with recurrent glioblastoma. Neuro
Oncol. 2006; 8: 60-6.
64. Link BK, Ballas ZK, Weisdorf D, Wooldridge JE, Bossler AD, Shannon M, et al.
Oligodeoxynucleotide CpG 7909 delivered as intravenous infusion demonstrates
immunologic modulation in patients with previously treated non-Hodgkin lymphoma. J
Immunother. 2006; 29: 558-68.
65. Pashenkov M, Goess G, Wagner C, Hormann M, Jandl T, Moser A, et al. Phase II
trial of a toll-like receptor 9-activating oligonucleotide in patients with metastatic
melanoma. J Clin Oncol. 2006; 24: 5716-24.
66. Molenkamp BG, van Leeuwen PA, Meijer S, Sluijter BJ, Wijnands PG, Baars A,
et al. Intradermal CpG-B activates both plasmacytoid and myeloid dendritic cells in the
sentinel lymph node of melanoma patients. Clin Cancer Res. 2007; 13: 2961-9.
14

67. Hofmann MA, Kors C, Audring H, Walden P, Sterry W, Trefzer U. Phase 1
evaluation of intralesionally injected TLR9-agonist PF-3512676 in patients with basal cell
carcinoma or metastatic melanoma. J Immunother. 2008; 31: 520-7.
68. Manegold C, Gravenor D, Woytowitz D, Mezger J, Hirsh V, Albert G, et al.
Randomized phase II trial of a toll-like receptor 9 agonist oligodeoxynucleotide, PF-
3512676, in combination with first-line taxane plus platinum chemotherapy for advanced-
stage non-small-cell lung cancer. J Clin Oncol. 2008; 26: 3979-86.
69. Thompson JA, Kuzel T, Drucker BJ, Urba WJ, Bukowski RM. Safety and efficacy
of PF-3512676 for the treatment of stage IV renal cell carcinoma: an open-label,
multicenter phase I/II study. Clin Genitourin Cancer. 2009; 7: E58-65.
70. Weber JS, Zarour H, Redman B, Trefzer U, O'Day S, van den Eertwegh AJ, et al.
Randomized phase 2/3 trial of CpG oligodeoxynucleotide PF-3512676 alone or with
dacarbazine for patients with unresectable stage III and IV melanoma. Cancer. 2009; 115:
3944-54.
71. Carpentier A, Metellus P, Ursu R, Zohar S, Lafitte F, Barrie M, et al. Intracerebral
administration of CpG oligonucleotide for patients with recurrent glioblastoma: a phase II
study. Neuro Oncol. 2010; 12: 401-8.
72. Hirsh V, Paz-Ares L, Boyer M, Rosell R, Middleton G, Eberhardt WE, et al.
Randomized phase III trial of paclitaxel/carboplatin with or without PF-3512676 (Toll-like
receptor 9 agonist) as first-line treatment for advanced non-small-cell lung cancer. J Clin
Oncol. 2011; 29: 2667-74.
73. Manegold C, van Zandwijk N, Szczesna A, Zatloukal P, Au JS, Blasinska-
Morawiec M, et al. A phase III randomized study of gemcitabine and cisplatin with or
without PF-3512676 (TLR9 agonist) as first-line treatment of advanced non-small-cell
lung cancer. Ann Oncol. 2012; 23: 72-7.
74. Belani CP, Nemunaitis JJ, Chachoua A, Eisenberg PD, Raez LE, Cuevas JD, et al.
Phase 2 trial of erlotinib with or without PF-3512676 (CPG 7909, a Toll-like receptor 9
agonist) in patients with advanced recurrent EGFR-positive non-small cell lung cancer.
Cancer Biol Ther. 2013; 14: 557-63.
75. Pfizer Inc. (2007) Pfizer discontinues clinical trials for PF-3512676 combined with
cytotoxic chemotherapy in advanced non-small cell lung cancer [Press release]. Available
from: http://press.pfizer.com/press-release/pfizer-discontinues-clinical-trials-pf-3512676-
combined-cytotoxic-chemotherapy-advance

15

16

CHAPTER 2

CYTOREDUCTIVE CHEMOTHERAPY IMPROVES THE BIODISTRIBUTION
OF ANTIBODIES DIRECTED AGAINST TUMOR NECROSIS IN MURINE
SOLID TUMOR MODELS
1

ABSTRACT

Current strategies in cancer treatment employ combinations of different treatment
modalities, which include chemotherapy, radiotherapy, immunotherapy, and surgery.
Consistent with a combinatorial approach, the present study demonstrates how
cytoreductive agents can potentiate the delivery of radiolabeled, necrosis-targeting
antibodies (NHS76, chTNT-3 and chTNT-3 F(ab’)2 fragment) to tumors.
125
I-labeled
antibodies were administered at various time points following a single dose of
chemotherapy in multiple murine tumor models (Colon 26 and MAD109 tumors in
BALB/c mice and LS174T xenografts in athymic nude mice), and the biodistribution of
the antibodies were determined by measuring radioactivity in harvested tissues. All
chemotherapeutics in this study (5-fluorouracil, etoposide, vinblastine, paclitaxel, and
doxorubicin) resulted in statistically significant increases in tumor-specific uptake of
radiolabeled antibodies. The combination of chemotherapy and vasoactive agent (chTNT-
3/IL-2) in the pretreatment regimen further increased tumor-specific accumulation of
antibodies. Using microPET/CT imaging, we further demonstrated clinical relevancy of
using chemotherapy pretreatment to increase antibody uptake. Results of biodistribution
and imaging data reveal specific time frames following chemotherapy when necrosis-
targeting antibodies are best delivered, either for imaging or radiotherapy. The present
work offers the prospect of using cytoreductive chemotherapy to increase tumor
accumulation of radiolabeled necrosis-targeting antibodies.

1
All data using
125
I were already collected prior to my joining the study. In addition to
analyzing these existing datasets, I designed and carried out a follow-up biodistribution
study using micro-Positron Emission Tomography imaging. The following chapter is
modified from a publication in Molecular Cancer Therapeutics (Jang et al. Cytoreductive
chemotherapy improves the biodistribution of antibodies directed against tumor necrosis
in murine solid tumor models. 2013; 12: 2827-36.).

17

2.1 BACKGROUND
In patients with solid tumors, responses to treatments are monitored using computer
tomography (CT), magnetic resonance imaging (MRI), positron emission tomography
(PET) scans using
18
F-fluorodeoxyglucose (
18
F-FDG) [1, 2], or by measuring tumor
markers present in the serum, such as CEA in colon [3] and breast cancer [4] or PSA in
prostate cancer (reviewed in [5]). In most situations, it takes 4-6 weeks before a difference
in tumor size is appreciated by CT or MRI, while in the case of serum markers, there are
only a few markers currently available (reviewed in [3, 4, 6]). Under current methods,
patients are required to complete a full course of therapy before they are monitored for
tumor reduction [1-3]. Because of the associated toxicity of chemotherapy combinations,
there is a need to monitor responses to therapy promptly. With that need in mind, our
laboratory previously described how tumor necrosis can be imaged using monoclonal
antibodies, designated Tumor Necrosis Therapy (TNT), directed against universally
present, stable antigens retained by necrotic cells [7]. Since necrosis is an early result of
successful therapy, TNT can monitor cytoreductive therapies by imaging before and after
therapy. As opposed to imaging with
18
F-FDG where decreased
18
F-FDG uptake reflects
therapeutic responses, TNT uptake should increase with therapeutic responses and can be
used more immediately following therapy.
After the first descriptions of TNT [7], we continued to generate new antibodies
that have improved uptake in necrotic and degenerating areas of tumors. Two chimeric
TNT antibodies, chTNT-1 and chTNT-3, were developed and binding studies confirmed
that chTNT-3 is principally directed against single-stranded DNA and RNA, and does not
cross react with chTNT-1, which is directed against structures in the nucleosomes [8, 9].

18

In addition, a human TNT-1 antibody, designated NHS76, was generated using phage
display methods [10]. Unlike
18
F-FDG, which is solely used for imaging tumors by PET,
radiolabeled TNT are currently in clinical trials for therapy of recurrent lung carcinomas
and brain cancers. These ongoing clinical studies provide strong evidence that TNT
specifically target tumors in patients and deliver radiation to the tumor site [11-13].
Because TNT are also ideal imaging agents due to their ability to target the majority of
human and animal solid tumors, we developed chTNT-3 single chain derivatives (scFv,
diabody and triabody), and Fab and F(ab )2 fragments that clear rapidly yet retain their
ability to localize to tumors [14, 15].
With this technology, our laboratory pioneered the use of TNT immunoconjugates,
such as TNT/IL-2 fusion proteins, to induce transient vasopermeability in tumor vessels
[16-18]. TNT/IL-2 conjugates alter the physiologic state of tumor vessels to enhance the
tumor uptake of monoclonal antibodies and other macromolecules. These vasoactive
reagents can potentiate the effects of chemotherapy on the pharmacokinetics of drugs and
antibodies administered subsequently [16-18].
In this chapter, we demonstrate that TNT has better uptake following chemotherapy
pretreatment. The addition of targeted-IL-2 (chTNT-3/IL-2) to the chemotherapy
pretreatment further improved TNT uptake. For these studies, TNT antibodies (chTNT-3,
NHS76), and chTNT-3 F(ab’)2 were characterized in vivo to define their pharmacokinetic
properties following chemotherapy in solid tumor-bearing mice. chTNT-3 was also
investigated with microPET/CT to illustrate how this approach can be translated to the
clinical imaging of tumors following chemotherapy.

19

2.2 MATERIALS AND METHODS
Reagents
chTNT-3 (IgG1), chTNT-3 F(ab’)2, and human monoclonal antibody NHS76
(IgG1) were genetically engineered, expressed, and purified as described previously [9,
10, 14, 15]. The fusion protein, designated chTNT-3/IL-2, was constructed and expressed
in NS0 cells using the glutamine synthetase expression system [16]. Sulfo-NHS (N-
hydroxysulfosuccinimide) and EDC (ethyl(dimethylaminopropyl) carbodiimide) were
purchased from Sigma-Aldrich (St. Louis, MO). 1,4,7,10-tetraazacyclododecane-1,4,7,10-
tetraacetic acid (DOTA) was purchased from Macrocyclics, Inc. (Dallas, TX). Dicarboxyl-
functionalized chelator BaBaSar was purchased from KeraFast, Inc. (Boston, MA) [19].
Size-exclusion PD-10 columns were purchased from GE Healthcare (Little Chalfont,
United Kingdom). Copper-64 (
64
Cu) was obtained from Washington University (St. Louis,
MO) and University of Wisconsin (Madison, WI). All chemotherapeutic drugs including
5-fluorouracil (5-FU), paclitaxel, doxorubicin, vinblastine, and etoposide (VP-16) were
purchased from Sigma-Aldrich.

In Vitro Studies
Radiolabeling Antibodies with
125
I
Purified chTNT-3, chTNT-3 F(ab’)2, and NHS76 monoclonal antibodies were
radiolabeled with iodine-125 (
125
I) using chloramine-T [9, 14, 20]. Two hundred Ci of
125
I and 20 µl of an aqueous solution of chloramine-T (2 mg/mL) were added to 100 µg of
antibody in 100 µl phosphate-buffered saline (PBS). The solution was quenched after two
minutes with sodium metabisulfite. Each reaction mixture was purified using a Sephadex

20

G-25 column and yielded 85-90% recovered radiolabeled products. The radiolabeled
antibody preparations were diluted with PBS for injection and administered within two
hours after labeling. Radioiodinated antibodies were analyzed using an analytical instant
thin-layer chromatography (ITLC) system consisting of silica gel impregnated glass fiber
sheets (Gelman Sciences, Ann Arbor, MI). Strips (2 x 20 cm) were activated by heating at
110°C for 15 minutes prior to use, spotted with 1 µl of sample, eluted with methanol/water
(80:20), and analyzed for protein-bound and free radioiodine.

Radiolabeling Antibodies with
64
Cu
Primary amines on lysine residues of chTNT-3 were conjugated with DOTA to
form DOTA-chTNT-3. DOTA was incubated with EDC and Sulfo-NHS for 30 minutes at
pH 5.5 with a 10:5:4 molar ratio of DOTA:EDC:Sulfo-NHS to synthesize DOTA-OSSu,
as reported previously [21, 22]. DOTA-OSSu was cooled to 4°C and added to chTNT-3 in
0.1 M borate buffer, pH 8.5. The evaluated molar ratios of chTNT-3 to DOTA-OSSu in
the reaction mixture were 1:2, 1:5, 1:10, and 1:20. The reactions were incubated at 4°C
overnight. DOTA-chTNT-3 was purified using PD-10 columns.
For chTNT-3 conjugated to a sarcophagine cage (Sar-chTNT-3), amines on the
lysine side chains of chTNT-3 were conjugated with the bifunctional chelator BaBaSar.
BaBaSar-N-hydroxysulfosuccinimidyl (BaBaSar-OSSu) was synthesized by incubating
BaBaSar with EDC and Sulfo-NHS at a molar ratio of 5:5:4 [19, 23]. BaBaSar-OSSu was
cooled to 4°C and added to chTNT-3 in 0.1 M borate buffer, pH 8.5. The molar ratio of
chTNT-3 to BaBaSar-OSSu was 1:5 in the reaction mixture. The reaction was incubated at
4°C overnight. BaBaSar-chTNT-3 was purified using PD-10 columns.

21

All
64
Cu labeling reactions for DOTA-chTNT-3 and Sar-chTNT-3 were
performed using the same protocol [23], where DOTA-chTNT-3 or Sar-chTNT-3 were
loaded with
64
CuCl2 (1-2 mCi per 50 µg of antibody) in 0.1 N ammonium acetate buffer,
pH 5.5. The reaction mixture was incubated for one hour at 40°C with constant shaking.
The
64
Cu-labeled antibodies were purified using PD-10 columns.

Immunoreactivity and Stability of Radioimmunoconjugates
The in vitro immunoreactivities of radiolabeled chTNT-3, F(ab’)2, and NHS76
preparations were evaluated by an indirect fixed-cell radioimmunoassay using Raji cells
(American Type Culture Collection, Manassas, VA) developed in our laboratory for TNT
antibodies [8]. The in vitro serum stability of radiolabeled antibodies was also evaluated to
determine whether deiodination occurs in the presence of serum. For this study, each
radiolabeled antibody was incubated in triplicate in fresh mouse serum at 100 µg/mL at
37°C in a humidified incubator with 5% CO
2
. At 0, 1, 3, 5, and 8 days, protein-bound
radioactivity was determined by adding 900 µl of 10% trichloroacetic acid to 100 µl
aliquots of radiolabeled antibody in serum. After five minutes incubation at room
temperature, protein precipitates were recovered by centrifugation, and the radioactivity in
500 µl of supernatant was determined using a gamma counter.

Pharmacokinetics and Biodistribution Studies
Tumor Models
The Madison 109 (MAD109) murine lung adenocarcinoma cell line was obtained
from the National Cancer Institute (Frederick, MD) in 1990. The Colon 26 murine

22

colorectal adenocarcinoma and the LS174T human colon tumor cell lines were obtained
from American Type Culture Collection in 1999 and 1989, respectively. LS174T was
authenticated by short tandem repeat profiling in 2013 (ATCC and Promega, Madison,
WI). Cell lines were cultured in RPMI-1640 medium supplemented with 10% fetal bovine
serum (Hyclone, Logan, UT), L-glutamine, penicillin G, and streptomycin. Six-week old
female BALB/c and athymic nude (Foxn1
nu
) mice were purchased from Harlan
Laboratories (San Diego, CA). Institutional Animal Care and Use Committee approved
protocols and guidelines for the humane care and use of animals in research were followed
in all experiments.
For heterotransplantation of LS174T cell line, a 0.2 mL inoculum containing 3x10
6
cells was subcutaneously injected in the left flank of athymic nude mice. For the Colon 26
and MAD109 models, BALB/c mice were injected with a 0.2 mL inoculum containing
3x10
6
tumor cells subcutaneously in the left flank. The tumors were grown until they
reached approximately 1 cm in diameter (1-3 weeks).

Chemotherapy Pretreatment
Animal studies were performed to determine tumor uptake of the
125
I-labeled
chTNT-3,
125
I-labeled F(ab’)2, or
125
I-labeled NHS76 antibody with or without
chemotherapy pretreatment, using 5-FU (50 mg/kg), doxorubicin (10 mg/kg), VP-16 (30
mg/kg), paclitaxel (20 mg/kg), and vinblastine (1.4 mg/kg). Dosing was modified from
previous murine therapeutic studies [18]. Separate groups of tumor-bearing animals (n=4-
5 mice/group) were given intraperitoneal (i.p.) injections of drugs dissolved in 1 mL
phosphate-buffered saline (PBS) at different times prior to a single intravenous (i.v.) dose

23

of
125
I-labeled antibody (20 Ci/10 g) into the tail vein. In all the experiments, the animals
were sacrificed at different times (1-5 days) for biodistribution analyses, where blood, lung,
liver, spleen, stomach, kidney and tumor were weighed and measured for radioactivity with
a 1282 Compugamma Counter (LKB Wallac, Victoria, Australia) [15, 20]. For each mouse
tissue or organ, the data were expressed as the percentage of injected dose/gram of tissue.

Combined Vasopermeability Enhancing Agents and Chemotherapy Pretreatment
The ability of combining chTNT-3/IL-2 and chemotherapeutic drugs to increase
tumor uptake of antibodies directed against DNA was examined in the MAD109 tumor
model. In this study, MAD109-bearing BALB/c mice were injected i.v. with chTNT-3/IL-
2 2.5 hour before the i.p. injection of VP-16 (30 mg/kg) or vinblastine (1.4 mg/kg),
followed 1 day later with an i.v. administration of
125
I-chTNT-3 (20 Ci/10 g). The effect
of chemotherapy with and without chTNT-3/IL-2 pre-treatment on tumor uptake was
evaluated by biodistribution analyses performed 3 days after the administration of
125
I-
chTNT-3, as described above.

Imaging Study
Whole-body imaging was performed at the USC Molecular Imaging Center. Six-
week-old female BALB/c mice were prepared in a similar manner as the biodistribution
experiments. Three x 10
6
MAD109 cells were injected subcutaneously in the flank and
grown until reaching approximately 1 cm in diameter. Mice received VP-16 (30 mg/kg) 2,
3, or 5 days before delivery of
64
Cu-Sar-chTNT-3 (100 Ci). PBS was used as a control
for mice receiving no pretreatment. Three mice were used for each pretreatment group.

24

Micro-PET/CT images were acquired using the Genesys
4
(Sofie Biosciences,
Culver City, CA) and InveonCT (Siemens Healthcare, Malvern, PA) scanners,
respectively. Mice were anesthetized with 2% isoflurane in oxygen during induction of
anesthesia, injections, and throughout microPET/CT scans. Animals were given 100 Ci
of
64
Cu-Sar-chTNT-3. After 2 and 24 hours, mice were anesthetized and placed into
imaging chambers equipped with a heated coil to maintain body temperature and gas
anesthesia. Scans on the Genesys
4
consisted of 20 minute acquisitions and were
reconstructed with the maximum likelihood and expectation maximization (MLEM)
algorithm using Sofie Biosciences software. MicroCT data were acquired after PET scans.
CT scans were acquired using the Inveon Acquisition Workplace software (Siemens
Healthcare) using the following settings: 80 keV, 500 µA, binx4, low magnification, 360
o

covered in 180 steps with two bed positions to produce a cube of 768 transaxial pixels x
923 axial pixels and a 104 m voxel size. CT scans were reconstructed using Cobra 6.9.4
(Exxim Computing Corporation, Pleasanton, CA) and co-registered with the Genesys
4

microPET data using AMIDE software (http://amide.sourceforge.net/) [24]. Regions of
interest were drawn over tumor and muscle from the right forelimb on decay-corrected
whole body coronal sections. Becquerel per volume of tissue was determined for regions
of interest using AMIDE. Data are represented as tumor to muscle ratios.

Immunohistochemistry
MAD109 tumors were excised from mice following microPET/CT imaging.
Tumors were fixed in 10% formalin, and bisected prior to embedding in paraffin. Five
micron tissue sections were stained with hematoxylin and eosin. Tissue sections were also

25

stained for PECAM-1 (CD31) using goat polyclonal anti-CD31 antibody (Santa Cruz
Biotechnology, Dallas, TX). Three evaluators blinded to pretreatment groups counted the
number of blood vessels per high-power field (BV/HPF, 400X) in 10 different fields of
view for each tumor. Images were captured on a Leitz Orthoplan microscope (Wetzlar,
Germany) using a Nikon DS-Fi2 camera (Melville, NY) and on a stereo microscope using
a SPOT RTke camera (Spot Imaging Solutions, Sterling Heights, MI).

Statistical Analysis
Significance levels were determined using two-way analysis of variance
(ANOVA), with pretreatment and organs as the independent variables. Two-way ANOVA
was followed by Bonferonni’s (for comparisons between two pretreatment groups) or
Tukey’s (for comparisons between three or more pretreatment groups) multiple
comparisons test. For analysis of the microPET scans, tumor:muscle ratios were compared
using one-way ANOVA followed by Tukey’s multiple comparisons test for differences
between pretreatment groups. Mean blood vessel densities per high-power field were
compared using a one-way ANOVA. Multiple comparisons tests were only done if
significance was found at the primary level of analysis. Statistical analysis was done using
GraphPad Prism software (GraphPad, La Jolla, CA).

2.3 RESULTS
Generation and In Vitro Evaluation of Radioimmunoconjugates
All antibody preparations (chTNT-3, F(ab’)2, and NHS76) showed a radiolabeling
efficiency of 80-85% with
125
I. Instant thin-layer chromatography analysis of
125
I-labeled

26

TNT indicated that all
125
I was TNT-bound. In addition, the radiolabeled TNT were
examined for deiodination in mouse serum over a five-day incubation period at 37 C.
Ninety-five percent of the activity was trichloroacetic acid precipitable for all the
derivatives, indicating minimal release of free radioiodine in serum over this time period.
In immunoassays with fixed and permeabilized Raji cells, all
125
I-labeled antibodies
retained a minimum of 70% binding activity compared to unlabeled parent antibodies.
For radiolabeling with
64
Cu, different reaction ratios were tested for DOTA-
chTNT-3 conjugation. The radiolabeling yields were 55.3%, 52.5%, 54.7% and 44.7% for
DOTA/chTNT-3 reaction ratios of 2:1, 5:1, 10:1, and 20:1, respectively. The radiolabeling
yield for Sar-chTNT-3 was 73.3%. Unlike DOTA-chTNT-3 conjugates, Sar-chTNT-3
retained 100% of binding ability compared to chTNT-3, and was therefore used in all
subsequent experiments with
64
Cu-labeled chTNT-3 (
64
Cu-Sar-chTNT-3).

Biodistribution and Imaging Studies
Chemotherapeutic Drug Pretreatment
Using biodistribution and imaging studies in tumor-bearing mice following
chemotherapy pretreatment, we measured the uptake of TNT antibodies into tumors and
host tissues. Tumor-bearing mice received single doses of different cytoreductive agents
such as 5-FU, doxorubicin, VP-16, paclitaxel, and vinblastine. In order to determine the
relationship between timing of pretreatment and tumor uptake, mice received i.p. injections
of chemotherapy prior to i.v. delivery of
125
I-labeled antibodies. Six representative
examples of the studies are shown in Figures 2.1-2.3 which illustrate marked differences
in tumor uptake of
125
I-labeled NHS76, chTNT-3, and F(ab’)2 between chemotherapy-

27

pretreated and non-pretreated mice. In the Colon 26 tumor model, pretreatment with 5-FU
(p<0.0001) and paclitaxel (p<0.0001) increased uptake into tumors compared to no
pretreatment, with greatest uptake occurring in tumors pretreated 2 days before receiving
125
I-NHS76 (Figure 2.1).
125
I-chTNT-3 behaved similarly to
125
I-NHS76, and demonstrated
increased uptake into MAD109 tumors pretreated with VP-16 (Figure 2.2A) and LS174T
xenograft tumors pretreated with 5-FU (Figure 2.2B) compared to non-pretreated tumors.
In LS174T tumor-bearing mice, pretreatment with doxorubicin 18 hours prior to
administration of
125
I-antibodies increased tumor uptake of
125
I-chTNT-3 and of
125
I-
chTNT-3 F(ab’)2 (Figure 2.3).

Figure 2.1. Five-day biodistribution of
125
I-NHS76 in Colon 26-bearing BALB/c
mice.
125
I-NHS76 was administered 1-3 days after pretreatment with (A) 5-FU (50
mg/kg) and (B) paclitaxel (20 mg/kg). Error bars represent standard error of the mean.
N=5 mice/group, *p< 0.05, **p<0.01, ***p<0.001, ****p<0.0001.

28

Figure 2.2. Three-day biodistribution of
125
I-chTNT-3.
125
I-chTNT-3 was
administered (A) 1-3 days after pretreatment with VP-16 (30 mg/kg) in MAD109
tumor-bearing BALB/c mice and (B) 1 day after 5-FU (50 mg/kg) in LS174T tumor-
bearing nude mice. Error bars represent standard error of the mean. N=4 mice/group,
*p<0.05, **p<0.01, ***p<0.001, ****p<0.0001.

Figure 2.3. One-day biodistribution of
125
I-chTNT-3 or
125
I-chTNT-3 F(ab’)2 in
LS174T tumor-bearing nude mice. (A)
125
I-chTNT-3 and (B)
125
I-chTNT-3 F(ab’)2
were administered 18 hours after pretreatment with doxorubicin (10 mg/kg). Error bars
represent standard error of the mean. N=5 mice/group, ****p<0.0001,
DOX=doxorubicin.

29

While the optimal times for TNT administration following chemotherapy varied,
experiments with multiple pretreatment times (1-3 days prior to receiving
125
I-antibodies)
showed maximal antibody uptake with chemotherapy pretreatment given 2-3 days prior
(Figures 2.1 and 2.2A). In such cases, optimal tumor necrosis may take longer than 24
hours to occur and/or normal tissues may need some time to repair so as to not reduce TNT
availability to tumor necrosis sites. The relationship between TNT uptake and
chemotherapy pretreatment was consistent with multiple antibody formats, different tumor
models, and different chemotherapeutic agents (Figure 2.1-2.3). Furthermore, there were
no statistically significant increases in antibody uptake in blood and host tissues in mice
pretreated with chemotherapy compared to non-pretreated mice (Figures 2.1-2.3).

Imaging Studies
Imaging studies highlighted the potential of using TNT for clinical imaging of
tumors. MicroPET/CT imaging of
64
Cu-Sar-chTNT-3 in MAD109-bearing mice showed
improved uptake in tumors pretreated with VP-16 (p<0.001, Figure 2.4), and is consistent
with biodistribution data shown in Figure 2.2A. There was greater uptake of
64
Cu-Sar-
chTNT-3 into tumor relative to muscle, with the largest tumor/muscle ratios occurring in
mice receiving pretreatment 2 and 3 days before administration of
64
Cu-Sar-chTNT-3
(p<0.001 and p<0.01 compared to no pretreatment, respectively, Figure 2.4A). Mice
receiving pretreatment 5 days before administration of
64
Cu-Sar-chTNT-3 did not have
statistically different tumor/muscle ratios from mice receiving no pretreatment (p=0.57),
which further suggests that there is a critical window of time that
64
Cu-Sar-chTNT-3 can
be administered following chemotherapy to maximize antibody uptake.

30

Figure 2.4. MicroPET/CT imaging of
64
Cu-Sar-chTNT-3 in MAD109-bearing
BALB/c mice following VP-16 (30 mg/kg) pretreatment.

31

To ensure that differences in antibody uptake are not due to differences in tumor
sizes, representative tumors from each group are shown in Figure 2.4B and were not
statistically different in mass. Representative views of the microPET/CT scans are shown
in coronal sections (Figure 2.4C) and whole-body volume rendering (Figure 2.4D). Unlike
the biodistribution data shown in Figures 2.1-2.3, there is signal in the liver detected by
PET (Figures 2.4C-D), which can be expected when using
64
Cu as opposed to
125
I as the
radiolabel. In spite of liver uptake, microPET/CT scans clearly demonstrated the uptake of
64
Cu-Sar-chTNT-3 by tumors in all treatment groups, with greatest tumor uptake in mice
receiving VP-16 2-3 days before
64
Cu-Sar-chTNT-3 administration. As expected, tumors
pretreated with chemotherapy had larger areas of necrosis as shown by H&E staining
(Figure 2.5A). Necrosis was present in all tumor sections, but larger and more necrotic
areas were observed in tumors from mice pretreated with VP-16. In contrast, blood vessel
densities were not different among pretreatment groups (p=0.53, Figure 2.5B). While it is
possible that other mechanisms may contribute, such as vascular permeability changes, the
increase in necrotic antigen is likely responsible for the increased uptake of chTNT-3 by
tumors pretreated with chemotherapy.

(Figure 2.4 continued) (A) Tumor to muscle ratios of radioactivity per volume of tissue
measured 1 day post-injection of
64
Cu-Sar-chTNT-3. Error bars represent standard error
of the mean. N=3 mice/group, *p<0.05, **p<0.01, ***p<0.001. (B) Excised tumors
from mice shown in C and D. (C) Representative PET/CT coronal sections. (D)
Representative whole-body PET images.

32

Figure 2.5. Immunohistochemistry of MAD109 tumors pretreated with VP-16 (30
mg/kg). (A) Representative sections from mice receiving no pretreatment, and from
mice receiving VP-16 2-5 days prior to receiving
64
Cu-Sar-chTNT-3. Mice were
sacrificed 1 day later and tumors were stained with H&E. Largest intact areas of
necrosis from each section are shown on the right at 40x magnification, with areas of
necrosis outlined in black. (B) PECAM-1 staining of tumor tissues, 250x magnification.
Arrows point to examples of PECAM-1-positive vessels. (C) Average number of
PECAM-1-positive vessels per high powered field. Values were averaged from three
blinded observers, who each scored 10 fields of view. Error bars represent standard
error of the mean. Differences were not statistically significant. N=3 tumors/group.

33

Combined Vasopermeability Enhancing Agents and Chemotherapy Pretreatment
We previously described the benefit of chTNT-3/IL-2 pretreatment in the delivery
of therapeutic molecules, both antibodies and drugs, to solid tumors [16]. In this study, we
hypothesized that chTNT-3/IL-2 can increase the permeability of tumor blood vessels to
increase uptake of subsequently administered chemotherapy, which can further increase
the uptake of TNT. MAD109-bearing BALB/c mice received chTNT-3/IL-2 2.5 hour
before receiving chemotherapy (vinblastine or VP-16), followed by i.v. delivery of
125
I-
chTNT-3 24 hours later (Figure 2.6A). Tumor uptake of
125
I-chTNT-3 increased
significantly with administration of chTNT-3/IL-2 in combination with vinblastine
compared to no pretreatment (p<0.0001) and pretreatment with vinblastine alone (p<0.01)
(Figure 2.6B). Similarly, administering VP-16 after chTNT-3/IL-2 increased tumor uptake
compared to no pretreatment (p<0.0001) and pretreatment with VP-16 alone (p<0.0001)
(Figure 2.6C). Uptake of radiolabel into normal organs was not statistically different
between pretreatment groups. Although not shown here, previous studies showed that
tumor uptake of
125
I-TNT antibodies following chTNT-3/IL-2 alone to be similar to uptake
following chemotherapy pretreatment (data not shown) [16, 18]. Since the chTNT-3/IL-2
vasoconjugate and chemotherapy agents have different mechanisms of action (increased
vasopermeability and increased necrosis, respectively), these approaches may have
additive or synergistic effects in increasing TNT uptake into tumors when used together.

34

2.4 DISCUSSION
In the past decade, antibodies have emerged as a key tool for both the treatment and
monitoring of cancer. As a therapeutic agent, antibodies may provide direct cytotoxicity to
cancer cells (e.g., trastuzumab, rituximab), inhibit a mechanism for survival of cancer cells
(e.g., bevacizumab), or deliver other therapeutic agents to the tumor (e.g., trastuzumab
emtansine, ibritumomab tiuxetan). While the use of antibodies in monitoring of cancer has
been largely limited to the detection of serum biomarkers, antibodies are being further
developed for their use in monitoring cancer by PET imaging, such as the use of
111
In-
Figure 2.6. Three-day biodistribution of
125
I-chTNT-3 administered 1 day after
chemotherapy treatment of MAD109-bearing mice with and without chTNT-3/IL-
2 pretreatment. (A) Timeline of experiment. (B) Vinblastine (1.4 mg/kg) and (B) VP-
16 (30 mg/kg) pretreatment. Error bars represent standard error of the mean. N=4
mice/group. *p<0.05, **p<0.01, ***p<0.001, ****p<0.0001.

35

caromab pendetide (ProstaScint) for the imaging of prostate cancer post-prostatectomy
[25]. However, the ability of antibodies to penetrate tumor tissue can limit their therapeutic
efficacy and value as imaging agents. Because antibodies are used often in combination
with chemotherapy or other treatment modalities, the effects of chemotherapy on the
biodistribution and pharmacokinetics of antibodies, and vice versa, must be considered.
For example, while the combination of bevacizumab (anti-VEGF) and trastuzumab (anti-
HER2) made headway in clinical trials for advanced HER2
+
breast cancer [26],
bevacizumab also decreased the accumulation of trastuzumab in tumors due to
normalization of tumor blood vessels [27, 28]. Likewise, the use of bevacizumab reduced
delivery of chemotherapy to tumors in non-small cell lung cancer patients [29]. These two
examples illustrate the importance of optimizing dosing regimens and studying the
pharmacokinetic changes caused by treatment combinations.
Previous studies demonstrated the use of radiolabeled TNT in therapy [11-13, 16,
30] and in the imaging of tumors [15, 31]. We show here the versatility of using TNT
following chemotherapy in different tumor models. While we previously described TNT
targeting solid tumors [8-15], we specifically demonstrate here that tumor uptake of TNT
is aided by chemotherapy treatment. Furthermore, the enhanced antibody uptake seen with
chemotherapy pretreatment was not accompanied by increased uptake into non-tumor, host
tissues. Because higher tumor to normal tissue uptake ratios are desirable for lowering
systemic toxicity, increasing therapeutic potential, or increasing specificity in imaging,
TNT administration following chemotherapy is ideal for therapy when using radiolabeled
TNT or TNT-drug conjugates, or for monitoring necrotic response to chemotherapy by
imaging. We emphasize that timing of the delivery of antibody after chemotherapy was

36

critical to maximizing uptake into tumors. In solid tumor models, 5-FU- and paclitaxel-
pretreated mice had optimal tumor uptake when TNT was administered 48 hours after
pretreatment (Figure 2.1), whereas optimal TNT administration occurred 72 hours after
pretreatment when using VP-16 (Figure 2.2A). While different drugs and doses
demonstrated different optimal pretreatment times for TNT uptake, they all fell in the range
of 2-3 days before TNT administration. Different time frames are expected in human
studies and with different dose regimens. However, the concepts presented here can be
used to base future clinical trials involving patients receiving TNT or TNT-conjugates post-
chemotherapy.
Other methods of inducing necrosis, such as radiofrequency ablation (RFA), are
also expected to increase TNT uptake in tumors. Anderson et al. demonstrated specificity
of TNT localization to RFA sites in patients with hepatic metastasis of different histological
origins [31]. Their results with RFA and our results with chemotherapy show that TNT are
not limited to a specific tumor type or to any one method of inducing necrosis. Similar in
concept, other studies demonstrated increased uptake and therapeutic efficacy of antibodies
to intracellular tumor antigens when combined with methods of inducing necrosis, such as
radiation or chemotherapy [32-34]. In these studies, necrosis likely resulted in the release
and availability of intracellular tumor antigens to antibody binding. While these studies
appreciate the advantage of combining antibody therapy with radiation or chemotherapy,
future studies should take into account that maximal uptake of antibodies targeting necrosis
or intracellular antigens may not occur immediately following and only within a couple of
days of administering necrosis-inducing agents.

37

As in the case of antibodies to intracellular antigens [32-34], the effects of
chemotherapy on TNT uptake are likely attributable to increases in necrosis (Figure 2.5A).
While changes in tumor vasculature could contribute to improved antibody uptake, mean
vessel densities, as assessed by CD31 staining, were not significantly different among VP-
16 pretreated and non-pretreated tumors (Figures 2.5B-C). Studies on vascular changes
with chemotherapy suggested that many agents would not improve the uptake of
macromolecules, including antibodies, into tumors [35-40]. Several agents, including VP-
16 [35], doxorubicin [37], cyclophosphamide [38], methotrexate [38], dacarbazine [36],
vinblastine [39], and 5-FU [38, 40], reduced angiogenesis, blood vessel density and
permeability. While these agents may normalize tumor blood vessels, normalization of
blood vessels can decrease the uptake and accretion of antibodies in tumors [27, 28].
However, the effects of chemotherapy on tumor vasculature may depend on mechanism of
action and dosing. Other studies demonstrated that some cytoreductive agents, like taxanes,
increased tumor vessel diameter and permeability [41, 42], which could increase antibody
delivery to tumors. While the increase in necrosis is a likely explanation for enhanced TNT
uptake due to the broad range of cytoreductive agents used, further studies can investigate
how specific chemotherapies alter tumor interstitial pressure, availability of antigens, and
penetration and retention of TNT in tumor tissue.
To improve uptake of antibody, we included a study combining vasoactive agent,
chTNT-3/IL-2, to chemotherapy as part of the pretreatment regimen. We showed that
chTNT-3/IL-2 in conjunction with vinblastine or VP-16 increased the uptake of chTNT-3
into tumor tissue compared to vinblastine or VP-16 alone. IL-2 enhances vascular
permeability, as exemplified by its induction of vascular leak syndrome [43] and

38

observations made in tumor models [16-18, 44-46]. In a mouse xenograft tumor model,
pretreatment with free IL-2 increased tumor uptake of radiolabeled antibodies, but also
increased uptake into normal lungs, liver, spleen, and kidney [44]. Due to non-specific
vascular effects and toxicity, localization of IL-2 to the tumor microenvironment is ideal.
Consequently, IL-2 was conjugated to several antibodies targeting antigens released during
necrosis [16, 18, 46], with one conjugate (NHS-IL-2 or Selectikine) completing phase I
clinical trials in solid tumors and non-small cell lung cancer [47-49]. In our murine tumor
models, chTNT-3/IL-2 and chemotherapy pretreatment did not increase
125
I-chTNT-3
uptake in IL-2-sensitive normal tissues such as, lung, liver, and kidneys (Figure 2.6B-C).
These findings with chTNT-3/IL-2 were similar to results in studies using IL-2 conjugated
to an anti-CEA antibody, which resulted in enhanced vascular permeability in CEA
+
tumor
but not host organs [45].
In this study, pretreatment with chemotherapy (vinblastine or VP16) and chTNT-
3/IL-2 exhibited additive or synergistic effects in the uptake of radiolabeled chTNT-3 into
tumor tissue. Because we showed that several chemotherapeutic drugs as single agents
could enhance the uptake of TNT, we expect that chemotherapy can improve the tumor-
specificity of chTNT-3/IL-2 as well. Since chemotherapy and therapeutic antibodies are
often given in cycles, one can imagine the accumulating benefit with each cycle of
chemotherapy and chTNT-3/IL-2. With each dose of chemotherapy, more chTNT-3/IL-2
would be expected to accumulate into tumor tissue. With greater accretion of chTNT-3/IL-
2 in the tumor, greater vascular permeability, and therefore, greater entry of drugs and other
therapeutics with less side effects in normal tissue would be expected.

39

Another potential benefit of the chTNT-3/IL-2 conjugate not explored in this study
is the pivotal role IL-2 plays in stimulating lymphocytes and activating killer cells, such as
natural killer and CD8
+
cytotoxic T cells. For this reason, IL-2 is used in the treatment of
melanoma and renal cell carcinoma [50]. Targeting IL-2 to the tumor, not only enhances
vascular permeability, but could also serve as a stimulatory molecule for immune cells at
the tumor site. The combination of cytotoxic agents with immunotherapy is appealing,
since some chemotherapeutic drugs can elicit and contribute to an immune response
(reviewed in [51]). This study did not investigate host immune responses, but future studies
can explore the presence of activated immune cells in the tumor as a result of pretreatment
with chemotherapy and chTNT-3/IL-2.
In summary, we demonstrated that pretreatment with different chemotherapeutic
drugs (5-FU, paclitaxel, VP-16, doxorubicin, and vinblastine) enhanced the uptake of
radiolabeled TNT in several different murine solid tumor models. Our studies with
chemotherapy and chTNT-3/IL-2 exemplify how immunotherapy and chemotherapy can
be used in combination to increase the delivery of treatment to tumors. In addition, we
demonstrated that PET/CT imaging with radiolabeled TNT can monitor the extent of
necrosis early after drug administration to fulfill an important unmet clinical need.

2.5 ACKNOWLEDGMENTS
The authors wish to acknowledge Jingzhong (James) Pang for technical assistance
with the animal studies. This study was supported in part by grant 2R01-CA83001 from
the National Cancer Institute, and Cancer Therapeutics Laboratories, Inc. (Los Angeles,
CA).

40

REFERENCES
1. Saba N. Post-treatment surveillance of squamous carcinoma of head and neck. In:
Basow D, editor. UpToDate. Waltham, MA; 2013.
2. Mauch P, Friedberg, JW. Monitoring of the patient with classical Hodgkin's
Lymphoma during and after treatment. In: Basow D, editor. UpToDate. Wiltham, MA;
2013.
3. Jacobson B, Moy B, Farraye F. Surveillance after colorectal cancer resection. In:
Basow D, editor. UpToDate. Waltham, MA; 2013.
4. Duffy MJ. Serum tumor markers in breast cancer: are they of clinical value? Clin
Chem. 2006; 52: 345-51.
5. Lilja H, Ulmert D, Vickers AJ. Prostate-specific antigen and prostate cancer:
prediction, detection and monitoring. Nat Rev Cancer. 2008; 8: 268-78.
6. Scott AM, Larson SM. Tumor imaging and therapy. Radiol Clin North Am. 1993;
31: 859-79.
7. Epstein AL, Chen FM, Taylor CR. A novel method for the detection of necrotic
lesions in human cancers. Cancer Res. 1988; 48: 5842-8.
8. Miller GK, Naeve GS, Gaffar SA, Epstein AL. Immunologic and biochemical
analysis of TNT-1 and TNT-2 monoclonal antibody binding to histones. Hybridoma. 1993;
12: 689-98.
9. Smith JD, Hornick PI, Rasmi N, Rose ML, Yacoub MH. Effect of HLA
mismatching and antibody status on "homovital" aortic valve homograft performance. The
Annals of thoracic surgery. 1998; 66: S212-5.
10. Sharifi J, Khawli LA, Hu P, King S, Epstein AL. Characterization of a phage
display-derived human monoclonal antibody (NHS76) counterpart to chimeric TNT-1
directed against necrotic regions of solid tumors. Hybrid Hybridomics. 2001; 20: 305-12.
11. Chen S, Yu L, Jiang C, Zhao Y, Sun D, Li S, et al. Pivotal study of iodine-131-
labeled chimeric tumor necrosis treatment radioimmunotherapy in patients with advanced
lung cancer. Journal of clinical oncology : official journal of the American Society of
Clinical Oncology. 2005; 23: 1538-47.
12. Yu L, Ju DW, Chen W, Li T, Xu Z, Jiang C, et al. 131I-chTNT radioimmunotherapy
of 43 patients with advanced lung cancer. Cancer biotherapy & radiopharmaceuticals.
2006; 21: 5-14.
13. Hdeib A, Sloan A. Targeted radioimmunotherapy: the role of (1)(3)(1)I-chTNT-
1/B mAb (Cotara) for treatment of high-grade gliomas. Future Oncol. 2012; 8: 659-69.
14. Khawli LA, Biela BH, Hu P, Epstein AL. Stable, genetically engineered F(ab')(2)
fragments of chimeric TNT-3 expressed in mammalian cells. Hybrid Hybridomics. 2002;
21: 11-8.
15. Khawli LA, Biela B, Hu P, Epstein AL. Comparison of recombinant derivatives of
chimeric TNT-3 antibody for the radioimaging of solid tumors. Hybrid Hybridomics. 2003;
22: 1-9.
16. Hornick JL, Khawli LA, Hu P, Sharifi J, Khanna C, Epstein AL. Pretreatment with
a monoclonal antibody/interleukin-2 fusion protein directed against DNA enhances the
delivery of therapeutic molecules to solid tumors. Clinical cancer research : an official
journal of the American Association for Cancer Research. 1999; 5: 51-60.

41

17. LeBerthon B, Khawli LA, Alauddin M, Miller GK, Charak BS, Mazumder A, et al.
Enhanced tumor uptake of macromolecules induced by a novel vasoactive interleukin 2
immunoconjugate. Cancer Res. 1991; 51: 2694-8.
18. Khawli LA, Hu P, Epstein AL. NHS76/PEP2, a fully human vasopermeability-
enhancing agent to increase the uptake and efficacy of cancer chemotherapy. Clinical
cancer research : an official journal of the American Association for Cancer Research.
2005; 11: 3084-93.
19. Liu S, Li Z, Yap LP, Huang CW, Park R, Conti PS. Efficient preparation and
biological evaluation of a novel multivalency bifunctional chelator for 64Cu
radiopharmaceuticals. Chemistry. 2011; 17: 10222-5.
20. Khawli LA, Mizokami MM, Sharifi J, Hu P, Epstein AL. Pharmacokinetic
characteristics and biodistribution of radioiodinated chimeric TNT-1, -2, and -3
monoclonal antibodies after chemical modification with biotin. Cancer biotherapy &
radiopharmaceuticals. 2002; 17: 359-70.
21. Li ZB, Cai W, Cao Q, Chen K, Wu Z, He L, et al. (64)Cu-labeled tetrameric and
octameric RGD peptides for small-animal PET of tumor alpha(v)beta(3) integrin
expression. J Nucl Med. 2007; 48: 1162-71.
22. Wu Y, Zhang X, Xiong Z, Cheng Z, Fisher DR, Liu S, et al. microPET imaging of
glioma integrin {alpha}v{beta}3 expression using (64)Cu-labeled tetrameric RGD peptide.
J Nucl Med. 2005; 46: 1707-18.
23. Li Z, Jin Q, Huang C, Dasa S, Chen L, Yap LP, et al. Trackable and Targeted Phage
as Positron Emission Tomography (PET) Agent for Cancer Imaging. Theranostics. 2011;
1: 371-80.
24. Loening AM, Gambhir SS. AMIDE: a free software tool for multimodality medical
image analysis. Mol Imaging. 2003; 2: 131-7.
25. Hardie AD, Rieter WJ, Bradshaw ML, Gordon LL, Young MA, Keane TE.
Improved performance of SPECT-CT In-111 capromab pendetide by correlation with
diffusion-weighted magnetic resonance imaging for identifying metastatic pelvic
lymphadenopathy in prostate cancer. World J Urol. 2013.
26. Hurvitz S, Pegram M, Lin L, Chan D, Allen H, Dichmann R, et al. Final results of
a phase II trial evaluating trastuzumab and bevacizumab as first line treatment of HER2-
amplified advanced breast cancer. Cancer Res. 2009; 24: 854s (Abstract #6094).
27. Pastuskovas CV, Mundo EE, Williams SP, Nayak TK, Ho J, Ulufatu S, et al. Effects
of anti-VEGF on pharmacokinetics, biodistribution, and tumor penetration of trastuzumab
in a preclinical breast cancer model. Mol Cancer Ther. 2012; 11: 752-62.
28. Arjaans M, Oude Munnink TH, Oosting SF, Terwisscha van Scheltinga AG,
Gietema JA, Garbacik ET, et al. Bevacizumab-induced normalization of blood vessels in
tumors hampers antibody uptake. Cancer Res. 2013; 73: 3347-55.
29. Van der Veldt AA, Lubberink M, Bahce I, Walraven M, de Boer MP, Greuter HN,
et al. Rapid decrease in delivery of chemotherapy to tumors after anti-VEGF therapy:
implications for scheduling of anti-angiogenic drugs. Cancer Cell. 2012; 21: 82-91.
30. Li J, Hu P, Khawli LA, Yun A, Epstein AL. chTNT-3/hu IL-12 fusion protein for
the immunotherapy of experimental solid tumors. Hybrid Hybridomics. 2004; 23: 1-10.
31. Anderson PM, Wiseman GA, Lewis BD, Charboneau JW, Dunn WL, Carpenter
SP, et al. A phase I safety and imaging study using radiofrequency ablation (RFA) followed

42

by 131I-chTNT-1/B radioimmunotherapy adjuvant treatment of hepatic metastasis.
Cancer Therapy. 2003; 1: 297-306.
32. Desrues B, Lena H, Brichory F, Ramee MP, Toujas L, Delaval P, et al. Monoclonal
antibody Po66 uptake by human lung tumours implanted in nude mice: effect of co-
administration with doxorubicin. British journal of cancer. 1995; 72: 1076-82.
33. Phaeton R, Wang XG, Einstein MH, Goldberg GL, Casadevall A, Dadachova E.
The influence of proteasome inhibitor MG132, external radiation, and unlabeled antibody
on the tumor uptake and biodistribution of (188)re-labeled anti-E6 C1P5 antibody in
cervical cancer in mice. Cancer. 2010; 116: 1067-74.
34. Noguchi T, Kato T, Wang L, Maeda Y, Ikeda H, Sato E, et al. Intracellular tumor-
associated antigens represent effective targets for passive immunotherapy. Cancer Res.
2012; 72: 1672-82.
35. Panigrahy D, Kaipainen A, Butterfield CE, Chaponis DM, Laforme AM, Folkman
J, et al. Inhibition of tumor angiogenesis by oral etoposide. Experimental and therapeutic
medicine. 2010; 1: 739-46.
36. Liu P, Zhang C, Chen J, Zhang R, Ren J, Huang Y, et al. Combinational therapy of
interferon-alpha and chemotherapy normalizes tumor vasculature by regulating pericytes
including the novel marker RGS5 in melanoma. J Immunother. 2011; 34: 320-6.
37. Roy Chaudhuri T, Arnold RD, Yang J, Turowski SG, Qu Y, Spernyak JA, et al.
Mechanisms of tumor vascular priming by a nanoparticulate doxorubicin formulation.
Pharmaceutical research. 2012; 29: 3312-24.
38. Bottini A, Berruti A, Bersiga A, Brizzi MP, Allevi G, Bolsi G, et al. Changes in
microvessel density as assessed by CD34 antibodies after primary chemotherapy in human
breast cancer. Clinical cancer research : an official journal of the American Association for
Cancer Research. 2002; 8: 1816-21.
39. Sersa G, Krzic M, Sentjurc M, Ivanusa T, Beravs K, Cemazar M, et al. Reduced
tumor oxygenation by treatment with vinblastine. Cancer Res. 2001; 61: 4266-71.
40. Basaki Y, Chikahisa L, Aoyagi K, Miyadera K, Yonekura K, Hashimoto A, et al.
gamma-Hydroxybutyric acid and 5-fluorouracil, metabolites of UFT, inhibit the
angiogenesis induced by vascular endothelial growth factor. Angiogenesis. 2001; 4: 163-
73.
41. Griffon-Etienne G, Boucher Y, Brekken C, Suit HD, Jain RK. Taxane-induced
apoptosis decompresses blood vessels and lowers interstitial fluid pressure in solid tumors:
clinical implications. Cancer Res. 1999; 59: 3776-82.
42. Watts ME, Woodcock M, Arnold S, Chaplin DJ. Effects of novel and conventional
anti-cancer agents on human endothelial permeability: influence of tumour secreted
factors. Anticancer research. 1997; 17: 71-5.
43. Cotran RS, Pober JS, Gimbrone MA, Jr., Springer TA, Wiebke EA, Gaspari AA,
et al. Endothelial activation during interleukin 2 immunotherapy. A possible mechanism
for the vascular leak syndrome. J Immunol. 1988; 140: 1883-8.
44. Nakamura K, Kubo A. Effect of interleukin-2 on the biodistribution of technetium-
99m-labelled anti-CEA monoclonal antibody in mice bearing human tumour xenografts.
Eur J Nucl Med. 1994; 21: 924-9.
45. Nakamura K, Kubo A. Biodistribution of iodine-125 labeled monoclonal
antibody/interleukin-2 immunoconjugate in athymic mice bearing human tumor
xenografts. Cancer. 1997; 80: 2650-5.

43

46. Gillies SD, Lan Y, Hettmann T, Brunkhorst B, Sun Y, Mueller SO, et al. A low-
toxicity IL-2-based immunocytokine retains antitumor activity despite its high degree of
IL-2 receptor selectivity. Clinical cancer research : an official journal of the American
Association for Cancer Research. 2011; 17: 3673-85.
47. Gillessen S, Gnad-Vogt US, Gallerani E, Beck J, Sessa C, Omlin A, et al. A phase
I dose-escalation study of the immunocytokine EMD 521873 (Selectikine) in patients with
advanced solid tumours. Eur J Cancer. 2013; 49: 35-44.
48. Laurent J, Touvrey C, Gillessen S, Joffraud M, Vicari M, Bertrand C, et al. T-cell
activation by treatment of cancer patients with EMD 521873 (Selectikine), an IL-2/anti-
DNA fusion protein. J Transl Med. 2013; 11: 5.
49. van den Heuvel MM, Verheij M, Boshuizen R, Belderbos J, Dingemans AM, De
Ruysscher D, et al. NHS-IL2 combined with radiotherapy: preclinical rationale and phase
Ib trial results in metastatic non-small cell lung cancer following first-line chemotherapy.
J Transl Med. 2015; 13: 32.
50. Rosenberg SA, Yang JC, Topalian SL, Schwartzentruber DJ, Weber JS, Parkinson
DR, et al. Treatment of 283 consecutive patients with metastatic melanoma or renal cell
cancer using high-dose bolus interleukin 2. JAMA. 1994; 271: 907-13.
51. Baxevanis CN, Perez SA, Papamichail M. Combinatorial treatments including
vaccines, chemotherapy and monoclonal antibodies for cancer therapy. Cancer
immunology, immunotherapy : CII. 2009; 58: 317-24.

44

CHAPTER 3

GENERATION OF TUMOR-TARGETED ANTIBODY/CPG
OLIGODEOXYNUCLEOTIDE CONJUGATES
1

ABSTRACT

A number of monoclonal antibodies against tumor-associated antigens have been
developed for the treatment of cancer. Conjugation to immunostimulatory ligands, such
as toll-like receptor 9 agonist CpG oligodeoxynucleotides (CpG), may enhance the
anti-tumor effects of such antibodies. The present study describes methods for the
chemical conjugation of CpG to two clinically approved monoclonal antibodies, Rituxan
(rituximab, anti-CD20) and Herceptin (trastuzumab, anti-HER2). Compared to their
parent antibodies, antibody/CpG immunoconjugates maintained their ability to bind
antigen in vitro. Furthermore, immunoconjugates stimulated IL-6 production from
murine macrophage cell line J774A.1 in a comparable manner as unconjugated CpG.
These studies demonstrate the feasibility of generating antibody/CpG immunoconjugates
and methods for their in vitro evaluation.

1
The following chapter is modified from a publication in Journal of Immunological
Methods (Li et al. Generation of tumor-targeted antibody-CpG conjugates. Journal of
Immunological Methods. 2013; 389: 45-51.).

45

3.1 BACKGROUND
Conventional cancer treatment modalities, such as surgery, radiation therapy, and
chemotherapy, remain limited in their ability to reach metastatic disease and to eliminate
cancer cells without collateral damage to normal tissues. Monoclonal antibodies targeted
to tumor-associated antigens or tumor growth factors were developed for cancer therapy
with the goal of overcoming these challenges. The inherent specificity of antibodies
allows systemic administration of these reagents, while concentrating their activity to the
tumor microenvironment (reviewed in [1]).
Cancer treatments currently use a number of tumor-targeting monoclonal
antibodies, including Herceptin (trastuzumab) for HER2
+
, Erbitux (cetuximab) for
EGFR
+
, and Rituxan (rituximab) and Zevalin (ibritumomab tiuxetan) for CD20
+

malignancies. Since their advent in cancer therapy, several mechanisms of action have
been described that contribute to their antitumor effects in vivo (reviewed in [1, 2]). By
binding and blocking ligand-receptor growth and survival pathways, antibodies can elicit
cell death directly. Antibodies without inherent cytotoxic activity may still elicit death of
tumor cells by delivering chemical agents (e.g., trastuzumab emantasine) or radiation
(e.g.,
90
Y-ibritumomab tiuxetan) to the tumor microenvironment.
Therapeutic antibodies can also target multiple components of the immune
system to combat cancer. Some antibodies do not bind tumor-specific antigens, but target
and inhibit antigens that enable tumors to avoid detection or elimination by the immune

46

system, a phenomenon known as immune escape. Antagonistic antibodies to regulatory
checkpoints in the immune system, like CTLA-4 (ipilimumab) or PD-1 (nivolumab),
reverse tumor-driven immune tolerance and promote the killing of tumor cells by T cells
[3-6]. Whereas anti-CTLA-4 and anti-PD-1 antibodies remove obstacles for immune
responses, antibodies to tumor antigens can promote anti-tumor immune responses.
Engagement of the Fc regions of tumor cell-bound antibodies with complement proteins
and Fc receptors on natural killer cells, macrophages, and dendritic cells trigger host
immune mechanisms, such as complement-mediated cytotoxicity (CMC),
antibody-dependent cellular cytotoxicity (ADCC), and antibody-dependent cellular
phagocytosis (ADCP). Alterations to the Fc portion and the use of specific isotypes can
enhance ADCC, ADCP, and CMC activities (reviewed in [7]). Many other antibody
modifications to promote immune responses have been described. These modifications
include reengineering antibody structures to directly link tumor cells with effector T cells,
regardless of T cell receptor specificity (i.e., bispecific T cell engagers, or BiTE®) [8],
and the linkage of antibodies to co-stimulatory molecules, cytokines, and other
immunostimulatory agents (reviewed in [9]).
This chapter describes the methodology for conjugating the toll-like receptor
(TLR) 9 agonist CpG oligodeoxynucleotides (CpG) to tumor-targeting antibodies,
trastuzumab and rituximab. CpG are phosphorothioated oligodeoxynucleotides
containing motifs of unmethylated cytosine-phosphate-guanosine dinucleotides [10],

47

which are infrequent in mammalian genomes [11]. These synthetic
oligodeoxynucleotides mimic bacterial and viral DNA, and are known to stimulate
human and murine dendritic cells [12-15], B cells [10, 16], and natural killer cells [17]
(reviewed in [18]). In addition to activation of innate immune responses and the
promotion of T-helper 1 (TH1)-dominated immune responses [19, 20], CpG reduces the
activity of immune suppressor cell populations like myeloid-derived suppressor cells
(MDSC) in vivo [21-23]. These immune responses to CpG are mediated through
TLR9-dependent and –independent pathways, and appear to be varied across species and
the route of administration in humans and animal models [18, 24, 25]. In vivo studies in
experimental tumor models showed that intratumoral delivery of CpG promoted survival
and decreased tumor burden in murine models of melanoma [26-28], colon
adenocarcinoma [26, 29], and pancreatic adenocarcinoma [29]. Moreover, mice that
achieved complete cancer remission with intratumoral CpG therapy developed a
protective memory response as indicated by resistance to tumor re-challenge [26].
However, the anti-tumor effects of free CpG require intratumoral delivery, as
intraperitoneal and intravenous injections did not improve survival or significantly
reduce tumor burden [22, 28], likely due to its rapid clearance and biodistribution away
from the tumor sites. In addition, intratumoral CpG did not reduce tumor burden at
remote uninjected sites [28], further illustrating the limitations of free CpG.

48

While intratumoral CpG demonstrated promise in pre-clinical investigations,
translation of this approach to patients is limited by the fact that most cancers are not
readily accessible to repeated intratumoral injections. A more feasible approach to CpG
immunotherapy is the development of tumor-targeted CpG reagents that may be given
systemically. The chapter describes novel methods for the conjugation of clinically
approved monoclonal antibodies with CpG, and assays to evaluate antibody binding and
CpG bioactivity. By combining the tumor-targeting features of monoclonal antibodies
with the beneficial anti-tumor effects of CpG therapy, a potent new immunotherapy for
cancer is possible.

3.2 MATERIALS AND METHODS
Cell Lines
Jurkat, MDA-MB-468, SK-BR-3, SK-OV-3, Raji, and Ramos cell lines were
obtained from the American Type Culture Collection (Manassas, VA). D2F2/E2, a gift
from Dr. Manuel Penechet (David Geffen School of Medicine at the University of
California, Los Angeles), is a murine mammary tumor cell line stably transfected with
human HER2 (hu-HER2). J774A.1 monocytic cell line was as a gift from Dr. Stephen A.
Stohlman (Cleveland Clinic Foundation, Cleveland, OH). NS0-20 cells were generated
by stable transfection of NS0 murine myeloma cells with human CD20 (hu-CD20). All
cell lines were maintained in complete medium (RPMI-1640 supplemented with 10%

49

fetal bovine serum, L-glutamine, penicillin G, and streptomycin) in humidified 5% CO2,
37°C incubators.

Chemical Reagents
Monoclonal antibodies trastuzumab (Herceptin) and rituximab (Rituxan) were
purchased from Genentech (South San Francisco, CA). The hetero-bifunctional
cross-linker N-ε-maleimidocaproyl-oxysulfosuccinimide ester (Sulfo-EMCS) and
dithiothreitol (DTT) were purchased from Pierce (Rockford, IL). Tris base
(2-Amino-2-(hydroxymethyl)-1,3-propanediol) was purchased from EMD Millipore
(Billerica, MA). Ethylenediaminetetraacetic acid (EDTA), bovine serum albumin (BSA),
and L-cysteine were purchased from Sigma-Aldrich (St. Louis, MO). CpG sequences
were synthesized with a phosphorothioate backbone for improved stability and nuclease
resistance, and a C3-thiol modification at the 3’ end by Integrated DNA Technologies
(Coralville, IA). The biologically active, murine-specific sequence CpG-1826
(5’-TCCATGACGTTCCTGACGTT-3’) was used for these studies [30].

Chemical Conjugation
Purified trastuzumab and rituximab were combined with Sulfo-EMCS in 0.05
mM phosphate buffer containing 1 mM EDTA (PBE, pH 7.4) at
antibody-to-Sulfo-EMCS mole ratios ranging from 1:5 to 1:10. This mixture was

50

incubated with continuous rocking at room temperature for 1 hour. Following incubation,
conjugated antibody (antibody-EMCS) was purified by Zeba
TM
Spin Desalting Columns
(7K molecular weight cut off, Pierce) in PBE buffer.
Thiol-modified CpG were reduced with excess DTT (0.1 M) in 1 mM EDTA, 20
mM Tris buffer (TE, pH 8.3-8.5) for 2 hours at room temperature. Subsequently, excess
DTT was removed using Pierce
TM
Dextran Desalting Columns (5K molecular weight cut
off, Pierce). The activated CpG were chemically conjugated to the linker-modified
antibody (antibody-EMCS) by overnight incubation at 4 C (CpG-to-antibody-EMCS
mole ratios ranging from 5:1 to 10:1), followed by quenching residual reactive EMCS
with L-cysteine. Unconjugated CpG were removed from the reaction by gel filtration
using a Sephacryl S-100 column (GE Healthcare, Little Chalfont, United Kingdom). The
concentration of antibody/CpG conjugates was determined by UV spectrophotometry
using the absorbance at 260 and 280 nm and equations 1 and 2.
A260 = εCpG,260 × CCpG + εmAb,260 × CmAb (1)
A280 = εCpG,280 × CCpG + εmAb,280 × CmAb (2)

Gel Electrophoresis
Purified antibody/CpG conjugates, unconjugated CpG, and unconjugated
antibodies were analyzed by gel electrophoresis in 1.5% agarose in a horizontal gel
system. Oligodeoxynucleotides were visualized using ethidium bromide, followed by

51

Coomassie Blue staining for protein. Coomassie Blue staining consisted of immersing
the agarose gel in staining solution (0.05% Coomassie Blue R-250 in 50% methanol and
10% acetic acid) for 2 hours at room temperature, followed by destaining in 40%
methanol and 5% acetic acid for approximately 4 hours at room temperature.

Fluorescence Microscopy
NS0-20 or D2F2/E2 cells were seeded overnight on chamber slides. Prior to
staining, cells were gently washed with phosphate-buffered saline (PBS), fixed with
ice-cold acetone for 10 minutes at -20
o
C, washed again with PBS, and then blocked for 1
hour with 1% BSA in PBS. Cells were stained with antibody alone or conjugates for 15
minutes at room temperature, using rituximab and rituximab/CpG on NS0-20 cells and
trastuzumab and trastuzumab/CpG on D2F2/E2 cells. Specific binding was detected by
incubation with goat anti-human IgG-FITC (Life Technologies, Carlsbad, CA). Image
acquisition was performed using an Axio Imager Zeiss Z1 fluorescence microscope
(Carl-Zeiss, Oberkochen, Germany) connected to a SPOT RTke camera (Spot Imaging
Solutions, Sterling Heights, MI).

Flow Cytometry
Antibody binding was also confirmed using flow cytometry. SK-BR-3, SK-OV-3,
D2F2/E2, and MDA-MB-468 cells were used to test trastuzumab and trastuzumab/CpG

52

conjugates. NS0-20, Raji, Ramos, and Jurakt cells were used to test rituximab and
rituximab/CpG conjugates. Adherent cell lines were detached using Detachin (Genlantis,
San Diego, CA) prior to staining. Possible Fc receptors on NS0-20, Raji, Ramos, and
Jurkat cell lines were blocked using purified mouse IgG2a, which can block both human
and mouse Fc receptors, for 10 minutes prior to antibody staining. Cells were stained
with isotype control (human IgG1, clone A111, in-house), free CpG, antibody, or
antibody/CpG conjugates in 2% fetal bovine serum in PBS for 30 minutes to 1 hour at
4
o
C. Cells were washed twice with PBS and either stained with goat polyclonal
anti-human Fc-FITC (Life Technologies) for primary antibody detection or YOYO-1
(Life Technologies) for oligodeoxynucleotide detection. For detection of rituximab or
trastuzumab, cells were stained with anti-human Fc-FITC in 2% fetal bovine serum in
PBS for 30 minutes at 4
o
C, and washed twice with PBS prior to acquisition on a flow
cytometer. To detect CpG, YOYO-1 was added to samples on ice 5 minutes prior to
running on a flow cytometer at a final working concentration of 0.25 µM. All samples
were analyzed using the Attune Acoustic Focusing Cytometer (Life Technologies) and
FlowJo software (Tree Star, Ashland, OR).

Assay for Bioactivity
Evaluation of CpG activity was performed by measuring cytokine production
after in vitro treatment of murine monocyte cell line J774A.1 with antibody (rituximab or

53

trastuzumab), antibody/CpG conjugate, free CpG, or PBS control. J774A.1 cells were
cultured in complete medium in 96-well tissue culture-treated plates at 0.25x10
5
cells/well. Concentrations of antibody/CpG conjugates were used to correspond to 1, 5,
or 10 µg/mL of CpG, and concentrations of antibody alone were equivalent to the
antibody concentrations of antibody/CpG conjugates. After 24 hours, supernatants were
collected and analyzed for IL-6 protein levels by ELISA (DuoSet mIL-6 ELISA kit,
R&D Systems, Minneapolis, MN). Differences in mean IL-6 production among
treatment groups were evaluated for statistical significance using ANOVA followed by
Tukey’s test for pair-wise comparisons. Data were analyzed and graphs were made using
GraphPad Prism software (GraphPad, La Jolla, CA).

3.3 RESULTS
Generation of Antibody/CpG Immunoconjugates
Because modifications to the 5’-end of CpG can negate its bioactivity [31], we
conjugated antibodies to the 3’-end of CpG to maintain immunostimulatory activity
using a novel approach summarized in Figure 3.1. The N-hydroxysuccininimide (NHS
ester) in Sulfo-EMCS reacted with primary amines on the antibody to form stable amide
bonds (Figure 3.1A), whereas the maleimide group in Sulfo-EMCS reacted with the
sulfhydryl group on reduced thiol-modified CpG to form stable and non-cleavable
thioether linkages (Figures 3.1B-C). Because antibody cysteine residues are generally

54

involved in disulfide bonds, in theory there should be no free sulfhydryl groups available,
although low levels may exist in specific antibodies [32]. The stepwise approach using a
heterobifunctional crosslinker for conjugation minimizes undesirable polymerization or
antibody/antibody and CpG/CpG conjugations. In addition, the presence of a spacer arm
(9.4 Å) in between the NHS ester and maleimide group limits possible steric hindrance
between the antibody and CpG moieties.

During conjugation, different ratios of antibody to Sulfo-EMCS (from 1:5-10)
and of CpG to antibody-EMCS (from 5-10:1) were tested. Reactions using a 1:5 mole
Figure 3.1. Immunoconjugation reactions for the generation of antibody/CpG.
(A) Primary amines on the antibody reacted with the NHS ester on Sulfo-EMCS. (B)
3’-modified CpG were reduced to yield a free sulfhydryl group. (C) The sulfhydryl
group on CpG reacted with the maleimide group in the antibody-EMCS conjugates to
form antibody/CpG.

55

ratio of antibody to Sulfo-EMCS and a 5:1 mole ratio of CpG to antibody-EMCS
resulted in the greatest amount of antibody/CpG conjugates, and were used for all
subsequent experiments. Using these optimized ratios for conjugation yielded
immunoconjugates with an average of 2.2 CpG molecules per rituximab antibody and 4.3
CpG molecules per trastuzumab antibody. As indicated by the well-resolved peak,
chromatograms of the conjugation demonstrated that antibody/CpG conjugates could be
purified from unconjugated CpG but not from unconjugated antibody by size exclusion
chromatography (Figure 3.2).

Figure 3.2. Size exclusion chromatography isolating antibody/CpG
immunoconjugates. Immunoconjugates and antibodies are eluted at a lower
retention time (left peak), while smaller molecules like unconjugated, free
CpG have longer retention times (right peak).

56

To confirm that isolated conjugates contained both CpG and antibody, we stained
samples separated on an agarose gel under non-reducing conditions with ethidium
bromide and Coomassie Blue R-250. Ethidium bromide is a fluorescent dye routinely
used to stain DNA, whereas Coomassie Blue R-250 is a dye routinely used to stain for
proteins. As predicted, unconjugated antibody (lane 1) did not stain with ethidium
bromide (Figure 3.3A), but produced a positive band with Coomassie Blue staining
(Figure 3.3B). Conversely, unconjugated CpG (lane 2) stained positively with ethidium
bromide but not with Coomassie Blue. Antibody/CpG conjugate stained positively with
both ethidium bromide and Coomassie Blue, demonstrating the presence of both CpG
and antibody moieties following gel electrophoresis (lane 3, Figure 3.3). The direction of
migration in the gel also reflected the charge modifications following conjugation.
Because trastuzumab and rituximab have isoelectric points of 8.45 and 8.68, respectively,
they carry a slight positive charge in running buffer (Tris-acetate-EDTA buffer) and
migrated towards the negatively charged cathode (lane 1, Figure 3.3B). Due to the
negative charge of its phosphorothioate backbone, CpG migrated in the opposite
direction towards the positively charged anode (lane 2, Figure 3.3A). In ethidium
bromide staining (Figure 3.3A) and the Coomassie Blue staining (Figure 3.3B),
antibody/CpG appeared as a single band spanning the well (lane 3). The broadness of this
band is likely due to variations in the number of CpG molecules conjugated per antibody.

57

The lack of migration of the antibody/CpG conjugate to either pole suggests a neutral
charge, which may be expected when combining the positively charged antibodies with
negatively charged CpG.

Intact Antigen Binding of Immunoconjugates
Modification of monoclonal antibodies by chemical conjugation, like the addition
of CpG to lysine residues, can alter their binding characteristics. The effects of CpG
conjugation on antigen binding in rituximab and trastuzumab conjugates were evaluated
using microscopy and flow cytometry techniques. Parent rituximab and rituximab/CpG
Figure 3.3. Visualization of antibody/CpG immunoconjugates after agarose gel
electrophoresis by tandem (A) ethidium brodmide and (B) Coomassie Blue R-250
staining. The same gel is shown in (A) and (B). Lanes 1) parent antibody, 2) free
CpG, and 3) antibody/CpG conjugates. The gel shown is representative of gel
electrophoresis done for both rituximab/CpG and trastuzumab/CpG and their parent
antibodies.

58

immunoconjugates showed comparable specific staining of hu-CD20
+
NS0-20 cells
(Figure 3.4A). Similarly, trastuzumab/CpG immunoconjugates bound to hu-HER2
+

D2F2/E2 cells comparably to native trastuzumab (Figure 3.4A). While rituximab usually
produces a ring pattern in CD20
+
lymphoma cells, transfection of CD20 into NS0 cells
(generating the NS0-20 cell line) produced a speckled membrane immunofluorescence
pattern possibly due to differences in transfected and endogenous expression of the CD20
antigen. Non-specific binding of immunoconjugates was evaluated by microscopy using
the parental D2F2 (hu-HER2 negative) and NS0 (hu-CD20 negative) cell lines. Neither
antibody nor immunoconjugate showed positive binding to the negative cell lines (data
not shown).
Microscopy studies evaluating the immunoconjugates used murine cell lines
transfected with human antigen in anticipation of using these cell lines for potential
tumor studies in immunocompetent mice. To confirm that immunconjugates bound
endogenous antigen expressed on human cancer cell lines, immunoconjugates were
evaluated by flow cytometry on several cell lines. Unlike imaging studies, flow
cytometry can detect presence of the CpG moiety, using nucleotide-staining dye
YOYO-1. YOYO-1 is a membrane impermeable dye that exhibits higher quantum yields
when complexed to single-stranded and double-stranded DNA compared to the free dye
[33]. With these properties, YOYO-1 can detect CpG at the cell surface. Because
antibody/CpG conjugates are heterogeneous for antibody-to-CpG ratios (i.e., there will

59

be some antibody molecules with no CpG attached), it was important to ensure that the
antibodies binding to antigen also carried the CpG moieties.
CD20
-
human leukemia cell line Jurkat and CD20
+
human lymphoma cell lines
Raji and Ramos were used to evaluate binding of rituximab/CpG conjugates (Figure
3.4B). In CD20
+
cell lines, cells incubated with rituximab/CpG stained positively with
YOYO-1 compared to cells incubated with free CpG, rituximab, or an isotype control
antibody. By contrast, YOYO-1 staining in CD20
-
Jurkat cells was not different among
cells incubated with isotype control, free CpG, rituximab, or rituximab/CpG.
As expected, CD20
+
Raji and Ramos were positive for both rituximab and
rituximab-CpG binding, as detected by an anti-human Fc secondary reagent, while Jurkat
cells were negative for staining. NS0-20 (hu-CD20
+
), D2F2/E2 (hu-HER2
+
), human
breast cancer lines SK-BR-3 (hu-HER2
+
) and MDA-MB-468 (hu-HER2
-
), and human
ovarian cancer line SK-OV-3 (hu-HER2
+
) are adherent cell lines and could not be stained
with YOYO-1 due to permeabilization of these cell lines after detachment from cell
culture surfaces. However, positive FITC (antibody) staining was noted in rituximab and
rituximab/CpG stained NS0-20 (data not shown), and in trastuzumab and
trastuzumab/CpG stained SK-BR-3, SK-OV-3, and D2F2/E2 (Figure 3.3C), confirming
that immunoconjugates bound antigen-expressing cells. There was some non-specific
staining of MDA-MB-468 cells with trastuzumab/CpG, but staining was less intense than
in HER2
+
cells (Figure 3.3C).

60

Antibody/CpG Immunoconjugates Retain Biologic Activity of CpG
To evaluate whether conjugation to antibodies disrupted the immunologic activity
of CpG, we tested the ability of immunoconjugates to elicit IL-6 secretion from murine
Figure 3.4. Binding of native antibody and immunoconjugates to antigen-positive
cells. (A) Fluorescence microscopy of hu-CD20
+
NS0-20 and hu-HER2
+
D2F2/E2
cells (400x magnification). (B) Flow cytometry histograms quantifying CpG
(YOYO-1-positive) and rituximab (FITC-positive) moieties at the cell surface. (C)
Flow cytometry histograms quantifying trastuzumab at the cell surface
(FITC-positive).

61

monocyte/macrophage J774A.1 cells (hu-CD20
-
, hu-HER2
-
) in vitro (Figure 3.5). The
biologic activity of CpG in the immunoconjugates was compared with free CpG and
unmodified antibody. Compared with vehicle control-treated cells, free CpG and
rituximab/CpG treatment produced a statistically significant increase in IL-6 production
at all doses (p<0.0001, Figure 3.5A). At doses of 5 and 10μg/mL CpG, free CpG and
rituximab-CpG caused significantly more IL-6 production than antibody alone
(p<0.0001). Interestingly, treatment with rituximab alone resulted in a small increase in
IL-6 production compared to vehicle control at all doses (p<0.0001). However, this effect
was not dose-dependent. Because J774A.1 cells are negative for human CD20,
immunostimulatory effects were likely due to Fc receptors binding the Fc portion of
rituximab. In contrast, free CpG and rituximab/CpG stimulated IL-6 secretion in a
dose-dependent manner. At higher doses (5 and 10 µg/mL), rituximab/CpG was more
biologically active than free CpG (p<0.0001). The increase in IL-6 may reflect greater
stability, improved cellular localization of the CpG, and/or additive effects with Fc
receptor engagement. Based on mean IL-6 concentrations and activity of rituximab alone,
additive effects of the CpG and antibody moieties are probable.
Similarly, trastuzumab/CpG immunoconjugates exhibited intact CpG activity,
producing statistically significant increases in IL-6 production at all doses
(p<0.0001-0.01). Unlike rituximab, trastuzumab alone did not significantly increase IL-6
compared to vehicle control (p=0.96, 0.92, and 0.49, at 1, 5, and 10 µg/mL doses,

62

respectively), and trastuzumab/CpG showed equivalent activity to free CpG at all
concentrations tested (p=0.86, 0.64, and 0.99 at 1, 5, and 10 µg/mL doses, respectively).

Figure 3.5. IL-6 response to antibody/CpG and free CpG in vitro. The biologic
activity of CpG in immunoconjugates for (A) rituximab and (B) trastuzumab were
evaluated in monocytic J774A.1 cells. The concentration of purified antibody
corresponded to the antibody concentration of the corresponding immunoconjugate.
Error bars represent standard error of the mean (n=3). *p<0.05, **p<0.01,
***p<0.001, ****p<0.0001.

63

3.4 DISCUSSION
Targeted cancer therapy using monoclonal antibodies has the potential to
selectively eliminate malignant cells, including primary and metastatic disease, while
minimizing effects on normal surrounding tissues. In addition to the inherent ADCC and
CMC capabilities of some antibodies, modifications can improve the anti-tumor effects
of these reagents. Conjugation of innate immune agonists, like TLR ligands, to
tumor-directed antibodies can deliver potent immunotherapy stimuli to the tumor
microenvironment to activate immune cells and reverse immune tolerance. While
intratumoral CpG delivery is highly effective in eliciting anti-tumor immune responses in
murine tumor models in vivo [22, 26-29], this approach is rarely feasible in cancer
patients due to tumor location and/or widespread disease. However, conjugation of CpG
to tumor-targeting antibodies potentially allows systemic administration (e.g.,
intravenously) of the reagent and concentration in the tumor microenvironment, the latter
of which is required to generate anti-tumor immune responses.
This chapter describes methods for the conjugation of tumor-targeted monoclonal
antibodies to CpG and for the in vitro evaluation of binding and immune activity of the
antibody and CpG moieties, respectively. We covalently linked the 3’-end of CpG to
primary amines on antibodies using a non-cleavable cross-linker. Schettini et al.
described a different approach for conjugation of CpG to anti-MUC1 antibody for the
immunotherapy of pancreatic cancer [29]. In their approach, they conjugated the 5’-end

64

of amine-modified CpG to primary amines on anti-MUC1 antibody using Solulink’s (San
Diego, CA) proprietary bioconjugation technology based on S-4FB (succinimidyl
4-formylbenzoate) and S-HyNic (succinimidyl 6-hydrazinonicotinate acetone hydrazine)
reactions. This approach requires the conjugation of CpG and antibody to two separate
reagents (S-4FB and S-HyNic) prior to their conjugation to each other, whereas the
approach described in this chapter used a single cross-linking reagent (Sulfo-EMCS).
Interestingly, the conjugation proposed by Schettini et al. generated anti-tumor responses
attributed to TLR9-independent stimulation of NK cell-mediated ADCC [29]. In
contrast, the present study linked the 3’-end of CpG to antibodies to preserve CpG
potency and TLR9 binding.
Unmodified rituximab also demonstrated immunostimulatory effects and likely
contributed to the immunostimulatory effects of the rituximab/CpG conjugate in vitro.
On the other hand, trastuzumab alone did not stimulate IL-6 secretion. Unlike the
humanized antibody trastuzumab, rituximab is a chimeric antibody, and it is possible that
its murine regions may have some stimulatory effect on the murine macrophage cell line.
Another possible mechanism may include Fc interactions with Fc receptors, which are
crucial for rituximab’s anti-tumor effects in patients and mouse tumor models [34]
(reviewed in [35]). Although therapeutic IgG1 antibodies likely have the same Fc domain,
their affinity to Fc receptors may differ due to glycosylation differences. Further
investigation is needed to explain why rituximab, but not trastuzumab, stimulated IL-6

65

secretion in J774A.1 cells. However, we emphasize that rituximab’s effect was low and
not dose-dependent, unlike effects seen with the immunoconjugates and CpG alone.
Future immunotherapy studies in experimental tumor models will evaluate the
therapeutic activity of antibody/CpG conjugates in vivo. In addition to potentially
concentrating CpG at the tumor site, conjugation of CpG to tumor-targeted antibodies
may have additional beneficial effects. When the targeting antibody has cytotoxic activity
(e.g., ADCC), as in the cases of trastuzumab and rituximab, the resulting tumor cell death
and release of antigens could act synergistically with CpG to promote antigen
presentation and activation of immune effector cells. Furthermore, antibody targeting and
binding to the surface of tumor cells may enhance internalization of the CpG moiety or
persistence of CpG at the tumor site(s) to provide improved bioactivity compared to free
CpG. The approach described in this chapter demonstrates the feasibility of generating
antibody/CpG immunoconjugates. The next chapter will describe the evaluation of an
antibody/CpG conjugate for immunotherapy in several murine tumor models.

3.5 ACKNOWLEDGEMENTS
We acknowledge Nicholas Landsman and Nicholas Arger (University of Southern
California, Los Angeles, CA), who helped developed the conjugation chemistry. The
work presented in this chapter was funded by Cancer Therapeutics Laboratories, Inc.
(Los Angeles, CA).

66

REFERENCES
1. Weiner LM, Murray JC, Shuptrine CW. Antibody-based immunotherapy of
cancer. Cell. 2012; 148: 1081-4.
2. Deonarain MP. Recombinant antibodies for cancer therapy. Expert Opin Biol
Ther. 2008; 8: 1123-41.
3. Yuan J, Gnjatic S, Li H, Powel S, Gallardo HF, Ritter E, et al. CTLA-4 blockade
enhances polyfunctional NY-ESO-1 specific T cell responses in metastatic melanoma
patients with clinical benefit. Proc Natl Acad Sci U S A. 2008; 105: 20410-5.
4. Topalian SL, Hodi FS, Brahmer JR, Gettinger SN, Smith DC, McDermott DF, et
al. Safety, activity, and immune correlates of anti-PD-1 antibody in cancer. N Engl J Med.
2012; 366: 2443-54.
5. Weber JS, Hamid O, Chasalow SD, Wu DY , Parker SM, Galbraith S, et al.
Ipilimumab increases activated T cells and enhances humoral immunity in patients with
advanced melanoma. J Immunother. 2012; 35: 89-97.
6. Wolchok JD, Kluger H, Callahan MK, Postow MA, Rizvi NA, Lesokhin AM, et
al. Nivolumab plus ipilimumab in advanced melanoma. N Engl J Med. 2013; 369:
122-33.
7. Natsume A, Niwa R, Satoh M. Improving effector functions of antibodies for
cancer treatment: Enhancing ADCC and CDC. Drug Des Devel Ther. 2009; 3: 7-16.
8. Staerz UD, Kanagawa O, Bevan MJ. Hybrid antibodies can target sites for
attack by T cells. Nature. 1985; 314: 628-31.
9. Lechner MG, Russell SM, Bass RS, Epstein AL. Chemokines, costimulatory
molecules and fusion proteins for the immunotherapy of solid tumors. Immunotherapy.
2011; 3: 1317-40.
10. Krieg AM, Yi AK, Matson S, Waldschmidt TJ, Bishop GA, Teasdale R, et al.
CpG motifs in bacterial DNA trigger direct B-cell activation. Nature. 1995; 374: 546-9.
11. Bird RP, Draper HH. Effect of malonaldehyde and acetaldehyde on cultured
mammalian cells: Growth, morphology, and synthesis of macromolecules. J Toxicol
Environ Health. 1980; 6: 811-23.
12. Hartmann G, Krieg AM. CpG DNA and LPS induce distinct patterns of
activation in human monocytes. Gene Ther. 1999; 6: 893-903.
13. Hartmann G, Weiner GJ, Krieg AM. CpG DNA: a potent signal for growth,
activation, and maturation of human dendritic cells. Proc Natl Acad Sci U S A. 1999; 96:
9305-10.
14. Jakob T, Walker PS, Krieg AM, von Stebut E, Udey MC, V ogel JC. Bacterial
DNA and CpG-containing oligodeoxynucleotides activate cutaneous dendritic cells and
induce IL-12 production: implications for the augmentation of Th1 responses. Int Arch
Allergy Immunol. 1999; 118: 457-61.

67

15. Krug A, Rothenfusser S, Hornung V , Jahrsdorfer B, Blackwell S, Ballas ZK, et
al. Identification of CpG oligonucleotide sequences with high induction of
IFN-alpha/beta in plasmacytoid dendritic cells. Eur J Immunol. 2001; 31: 2154-63.
16. Zhu P, Liu X, Treml LS, Cancro MP, Freedman BD. Mechanism and regulatory
function of CpG signaling via scavenger receptor B1 in primary B cells. J Biol Chem.
2009; 284: 22878-87.
17. Ballas ZK, Rasmussen WL, Krieg AM. Induction of NK activity in murine and
human cells by CpG motifs in oligodeoxynucleotides and bacterial DNA. J Immunol.
1996; 157: 1840-5.
18. Krieg AM. CpG motifs in bacterial DNA and their immune effects. Annu Rev
Immunol. 2002; 20: 709-60.
19. Chu RS, Targoni OS, Krieg AM, Lehmann PV , Harding CV . CpG
oligodeoxynucleotides act as adjuvants that switch on T helper 1 (Th1) immunity. J Exp
Med. 1997; 186: 1623-31.
20. Zimmermann S, Egeter O, Hausmann S, Lipford GB, Rocken M, Wagner H, et
al. CpG oligodeoxynucleotides trigger protective and curative Th1 responses in lethal
murine leishmaniasis. J Immunol. 1998; 160: 3627-30.
21. Zoglmeier C, Bauer H, Norenberg D, Wedekind G, Bittner P, Sandholzer N, et al.
CpG blocks immunosuppression by myeloid-derived suppressor cells in tumor-bearing
mice. Clin Cancer Res. 2011; 17: 1765-75.
22. Shirota H, Klinman DM. Effect of CpG ODN on monocytic myeloid derived
suppressor cells. Oncoimmunology. 2012; 1: 780-2.
23. Shirota Y , Shirota H, Klinman DM. Intratumoral injection of CpG
oligonucleotides induces the differentiation and reduces the immunosuppressive activity
of myeloid-derived suppressor cells. J Immunol. 2012; 188: 1592-9.
24. Krieg AM, Efler SM, Wittpoth M, Al Adhami MJ, Davis HL. Induction of
systemic TH1-like innate immunity in normal volunteers following subcutaneous but not
intravenous administration of CPG 7909, a synthetic B-class CpG oligodeoxynucleotide
TLR9 agonist. J Immunother. 2004; 27: 460-71.
25. Sanjuan MA, Rao N, Lai KT, Gu Y , Sun S, Fuchs A, et al. CpG-induced tyrosine
phosphorylation occurs via a TLR9-independent mechanism and is required for cytokine
secretion. J Cell Biol. 2006; 172: 1057-68.
26. Sharma S, Karakousis CP, Takita H, Shin K, Brooks SP. Intra-tumoral injection
of CpG results in the inhibition of tumor growth in murine Colon-26 and B-16 tumors.
Biotechnol Lett. 2003; 25: 149-53.
27. Buhtoiarov IN, Sondel PM, Wigginton JM, Buhtoiarova TN, Yanke EM, Mahvi
DA, et al. Anti-tumour synergy of cytotoxic chemotherapy and anti-CD40 plus
CpG-ODN immunotherapy through repolarization of tumour-associated macrophages.
Immunology. 2011; 132: 226-39.

68

28. Amos SM, Pegram HJ, Westwood JA, John LB, Devaud C, Clarke CJ, et al.
Adoptive immunotherapy combined with intratumoral TLR agonist delivery eradicates
established melanoma in mice. Cancer Immunol Immunother. 2011; 60: 671-83.
29. Schettini J, Kidiyoor A, Besmer DM, Tinder TL, Roy LD, Lustgarten J, et al.
Intratumoral delivery of CpG-conjugated anti-MUC1 antibody enhances NK cell
anti-tumor activity. Cancer Immunol Immunother. 2012; 61: 2055-65.
30. Chace JH, Hooker NA, Mildenstein KL, Krieg AM, Cowdery JS. Bacterial
DNA-induced NK cell IFN-gamma production is dependent on macrophage secretion of
IL-12. Clin Immunol Immunopathol. 1997; 84: 185-93.
31. Kandimalla ER, Bhagat L, Yu D, Cong Y , Tang J, Agrawal S. Conjugation of
ligands at the 5'-end of CpG DNA affects immunostimulatory activity. Bioconjug Chem.
2002; 13: 966-74.
32. Chumsae C, Gaza-Bulseco G, Liu H. Identification and localization of unpaired
cysteine residues in monoclonal antibodies by fluorescence labeling and mass
spectrometry. Anal Chem. 2009; 81: 6449-57.
33. Cosa G, Focsaneanu KS, McLean JR, McNamee JP, Scaiano JC. Photophysical
properties of fluorescent DNA-dyes bound to single- and double-stranded DNA in
aqueous buffered solution. Photochem Photobiol. 2001; 73: 585-99.
34. Clynes RA, Towers TL, Presta LG, Ravetch JV . Inhibitory Fc receptors
modulate in vivo cytotoxicity against tumor targets. Nat Med. 2000; 6: 443-6.
35. Lim SH, Beers SA, French RR, Johnson PW, Glennie MJ, Cragg MS.
Anti-CD20 monoclonal antibodies: historical and future perspectives. Haematologica.
2010; 95: 135-43.

69

CHAPTER 4

SYSTEMIC DELIVERY OF CHTNT-3/CPG
OLIGODEOXYNUCLEOTIDE IMMUNOCONJUGATES FOR
IMMUNOTHERAPY IN MURINE SOLID TUMOR MODELS

ABSTRACT

CpG oligodeoxynucleotides (CpG) potently activate the immune system by
mimicking microbial DNA. Conjugation of CpG to chTNT-3, an antibody targeting the
necrotic centers of tumors, enables the systemic delivery of CpG to tumors, where it can
activate the immune system in the presence of tumor antigens. We compared chTNT-3/CpG
immunoconjugates to free CpG in its ability to stimulate the immune system in vitro and
reduce tumor burden as a monotherapeutic agent in vivo. Intraperitoneal injections of
chTNT-3/CpG delayed tumor growth and improved survival in both Colon 26 tumor-
bearing BALB/c mice and B16 tumor-bearing C57BL/6 mice. Compared to saline-treated
mice, chTNT-3/CpG decreased tumor volumes by 72% in Colon-26-bearing mice and 79%
in B16-bearing mice, and was similar to intratumoral injections of free CpG. Systemically
delivered free CpG and CpG conjugated to an isotype control antibody did not reduce
tumor burden or improve survival, indicating that CpG needs to localize into tumors for its
therapeutic effect.

70

4.1 BACKGROUND
For several centuries, records describe the therapeutic effects of infectious disease
processes on malignancy [reviewed in [1]]. These observations led to preclinical and
clinical studies directly injecting attenuated pathogens or molecules associated with
pathogens (pathogen-associated molecular patterns, or PAMPs) into the tumor space [2].
Pathogens and PAMPs promote the ability of immune cells to identify tumors as a diseased
environment (i.e., improve the immunogenicity of tumors). Unlike T cell receptors or
antibodies which are antigen-specific, the receptors for PAMPs are germline encoded and
critical to innate immunity. Because immunotherapies solely relying on T cell or antibody
activity work well in immunogenic tumors with high antigen expression but poorly in
tumors of low immunogenicity [3], inclusion of the innate immune system in
immunotherapy offers the opportunity to combat a wider range of cases. With the
recognition that innate immune cells, such as macrophages and natural killer cells, can
destroy tumor cells, and that there is extensive cross-talk between the innate and adaptive
arms of immunity, targeting the innate immune system with PAMPs is an intuitive
approach to cancer immunotherapy [reviewed in [4]].
Toll-like receptor (TLR) agonists are a group of PAMPs that include CpG
oligodeoxynucleotides (CpG), which are TLR9 agonists characterized by unmethylated
cytosine-guanine motifs found commonly in microbial DNA but not in mammalian
genomes [5]. As a TLR9 agonist, CpG rapidly activates cells of the innate immune system,
such as plasmacytoid dendritic and natural killer cells as well as B cells, to promote the
production of T-helper 1 (TH-1) cytokines and enhance cross-presentation of antigens by
professional antigen-presenting cells [6]. Intratumoral (i.t.) or peritumoral injections of

71

CpG elicited immune responses against tumors in murine subcutaneous models of
melanoma [7-10], fibrosarcoma [7], renal cell carcinoma [8], colon adenocarcinoma [8, 9,
11], pancreatic adenocarcinoma [11], and lymphoma [12]. Following its success in murine
tumor models, CpG were used in clinical trials for a wide range of cancers, including
glioblastoma, renal cell carcinoma, melanoma, non-small cell lung cancer, and non-
Hodgkin’s lymphoma [reviewed in [13-15]]. However, optimal therapeutic effects were
generally limited to local intratumoral injections; and disappointing clinical results [16, 17]
were in part due to its poor efficacy when given systemically or in non-tumor sites [8, 10,
12, 13, 18]. Rapid clearance of small oligodeoxynucleotides (oligos) and inadequate CpG
accumulation in tumors may limit systemic delivery. Furthermore, non-targeted systemic
CpG may actually hamper immune responses by inducing immunosuppressive
mechanisms, such as indoleamine 2,3-dioxygenase (IDO) [19]. Because multiple
intratumoral injections over time are not feasible clinically in many cases and may not
result in an abscopal effect [20], we explored the use of CpG as an antibody conjugate to
allow its accumulation in tumors when administered systemically.
Using the approach described in the previous chapter [21], we chemically linked
the 3’-end of thiol-modified CpG to primary amines (lysine residues) on chimeric TNT-3
antibody. chTNT-3 [22] belongs to a series of antibodies, designated as Tumor Necrosis
Therapy (TNT), directed against ubiquitous and stable nucleic acid antigens retained in
necrotic tissues [23]. By binding nucleic acid antigens that are universally present in solid
tumors regardless of species, TNT antibodies can be used in both experimental animal
models and clinical settings. Furthermore, TNT antibodies target necrotic regions which
contain an abundance of tumor antigens released from degenerating tumor cells, making

72

them ideal for conjugation or fusion to immunostimulatory molecules. Several TNT
antibodies are in clinical trials for the radiotherapy of lung and brain cancers, where they
demonstrated binding and retention in tumors with minimal or no binding to normal tissues
[24-26], and for the immunotherapy of solid tumors as fusion proteins with cytokine
moieties IL-12 (clinical trial #NCT01417546) and IL-2 [27]. In preclinical tumor models,
we demonstrated the tumor-targeting specificity of chTNT-3 and its derivatives in imaging
studies [28-30], and as therapeutic fusion proteins [31-36].
This chapter describes the conjugation of two different classes of CpG (class A and
B) to chTNT-3. Both classes of CpG are TLR9 agonists, but preferentially elicit distinct
cytokine responses, likely due to their structural differences (Table 4.1). Class B CpG (or
type K), with a fully phosphorothioated backbone, principally act on monocytes and B cells
to promote IL-6, IL-10, and IL-12 secretion, and antibody production [[37], reviewed in
[38]]. In contrast, class A (or type D) CpG are characterized as having a mixed
phosphodiester-phosphorothioate backbone, and aggregate into high-order structures due
to their poly-G tail and palindrome sequences. Although a weak stimulator of B cells, class
A CpG potently activate dendritic cells and promote the secretion of type I IFNs and IL-
12 [[39], reviewed in [38]]. While most tumor studies and clinical trials utilized class B
sequences, we compare the two classes as antibody conjugates for their ability to generate
anti-tumor responses in highly (Colon 26) and poorly (B16) immunogenic tumor models.
To our knowledge, this is the first in vivo study of antibody/CpG conjugates delivered
systemically as a monotherapy in preclinical models of solid tumors.

73

Example Sequence
Structural
Characteristics
Activity
Class A (type D)
GGggtcaac:gttgaGGGGGG

(murine example, CpG1585)
 mixed PS/PD backbone
 palindrome
(underlined) flanks
CpG
 3’ poly-G tail (green)
 higher-ordered
structures
 strongly induces IFN-α
secretion
 moderately induces
pDC maturation
 weakly stimulates B
cells
Class B (type K)
TCCATGACGTTCCTGACGTT

(murine example, CpG1826)
 phosphorothioated
backbone
 linear
 strongly activates B
cells
 strongly induces pDC
maturation
 weakly induces IFN-α
secretion
Class C
TCGTCGTTTTCGGCGC:GCGCCG

(human/murine example,
CpG2395)
 phosphorothioated
backbone
 palindrome
(underlined)
 palindrome forms
duplexes
 5’-TCGTCG
 induces pDC
maturation
 induces IFN-α
secretion
 activates B cells

Table 4.1. Three major classes of CpG. Adapted from [40]. Phosphorothioate (PS)
backbone in uppercase. Phosphodiester (PD) linkages in lowercase. Colon punctuation
represents center of the palindrome. C-G motifs in red. Class P and class S sequences not
shown here.

4.2 MATERIALS AND METHODS
Cell Lines
J774A.1 murine monocytic cell line was acquired in 1997 from Dr. Stephen A.
Stohlman (Cleveland Clinic Foundation, Cleveland, OH). B16-F10 melanoma and Colon
26 adenocarcinoma were acquired in 1988 and 1999, respectively, from American Type
Culture Collection (Manassas, VA). All cell lines were grown in RPMI-1640 supplemented

74

with 10% fetal bovine serum (Hyclone, Logan, UT), non-essential amino acids (NEAA),
penicillin G, and streptomycin (Gemini Bio-Products, West Sacramento, CA)

CpG Sequences
All oligonucleotides were purchased from Integrated DNA Technologies
(Coralville, IA). CpG1585 is a class A murine CpG sequence, CpG1826 is a class B murine
CpG sequence, and sc1585 and sc1826 are negative controls for CpG1585 and CpG1826,
respectively. To enable conjugation, the 3’-ends contained a C3 thiol modifier. For
sequences, see Table 4.2.

Experiment Construct Sequence
Oligo:Ab
Ratio
Fig. 1
chTNT-3/CpG1826-
biotin
5’-biotin-
TCCATGACGTTCCTGACGTT-3’
3.5:1
Figs. 2, 3 chTNT-3/CpG1585 5’-GGggtcaacgttgaGGGGGG-3’ 8.7:1
Fig. 2 chTNT-3/sc1585 5’-GGggtcaagcttgaGGGGGG-3’ 8.7:1
Fig. 3 chTNT-3/CpG1826 5’-TCCATGACGTTCCTGACGTT-3’ 4.4:1
Figs. 2, 4, 5 chTNT-3/CpG1826 5’-TCCATGACGTTCCTGACGTT-3’ 2.8:1
Figs. 2, 4 chTNT-3/sc1826 5’-TCCATGAGCTTCCTGAGCTT-3’ 3.5:1
Fig. 4 cetuximab/CpG1826 5’-TCCATGACGTTCCTGACGTT-3’ 4.4:1

Table 4.2. Sequences of constructs and oligo:antibody ratios. C-G or G-C motifs are
underlined. Bases in uppercase have a phosphorothioate backbone and bases in lower case
have a phosphodiester linkage.

Conjugation of Antibodies with CpG
Conjugation of CpG to antibodies used the approach described in Chapter 3 [21].
In this chapter, chTNT-3 or cetuximab were incubated with Sulfo-EMCS (Pierce,
Rockford, IL) at 1:6 antibody-to-Sulfo-EMCS ratio in phosphate-buffered saline (PBS)

75

containing 1 mM ethylenediaminetetraacetic acid (EDTA) with continuous rocking for 1
hour at room temperature. The excess cross-linker was removed using Zeba
TM
Spin
Desalting Columns (Pierce, Rockford, IL). Thiol-modified CpG1826 or sc1826 was
reduced in 0.1 M DTT for 1 hour at room temperature. Excess DTT was removed using
PD-10 Desalting Columns (GE Healthcare, Little Chalfont, United Kingdom). Reduced
thiol-modified CpG was mixed with antibody/EMCS at a 6:1 ratio overnight at 4
o
C.
Unconjugated CpG was separated from chTNT-3/CpG by gel filtration using a Sephacryl
S-100 column (GE Healthcare).
Because of its poly(G) motif, CpG1585 self-assembles into higher order structures
known as G-tetrads [41, 42]. To prevent precipitation during conjugation, thiol-modified
CpG1585 was mixed with native CpG1585 at a 1:3 ratio in 10 mM MOPS buffer. This
mixture was heated at 95
o
C for 5 minutes and cooled to room temperature to allow
reannealing. This thiol-modified/native CpG1585 mixture was reduced in DTT and
desalted prior to conjugation with chTNT-3/EMCS (8:1 ratio) as described above. The
oligo:antibody ratios for the final products are listed in Table 4.2.

Isolectric Focusing of Conjugates
Following purification, immunoconjugates were compared to chTNT-3 for charge
modifications. Antibody and immunoconjugates (0.1-1 µg of protein) were diluted in
Novex® IEF Sample Buffer pH 3-10 and electrophoresed on Novex® pH 3-10 IEF gels,
using the XCell SureLock® Mini-Cell apparatus and Novex® IEF Anode and Cathode
Buffers (Life Technologies, Carlsbad, CA). Running conditions were 100 V for 1 hour,
followed by 200 V for 1.5 hours. Gels were then soaked in 0.2% SDS in Towbin buffer

76

(25 mM Tris, 192 mM glycine, 20% methanol) to enable migration of the proteins towards
the anode during transfer onto a PVDF membrane. Transfer conditions were 75 V for 1
hour in pre-chilled 0.2%SDS/Towbin buffer using a Mini Trans-Blot® Cell apparatus
(Bio-Rad, Hercules, CA). PVDF membranes were blocked overnight at 4
o
C in 5%
milk/TBST (Tris-buffered saline, 0.1% Tween 20) and probed with goat anti-human IgG-
HRP secondary (1:20,000 dilution, Abcam, Cambridge, UK) in 2% milk/TBST for 1 hour
at room temperature. Following washes in TBST, antibody detection was accomplished
using Immobilon Western Chemiluminescent HRP Substrate (EMD Millipore) and
exposure of the membrane to an X-ray film (CL-Xposure Film, Pierce).

Fluorescence Microscopy Co-localization Studies
J774A.1 cells seeded on poly-D-lysine coated coverslips (Neuvitro, Vancouver,
WA) were incubated with CpG-biotin, chTNT-3, or chTNT-3/CpG-biotin in complete
medium at 37°C for 60 minutes. Cells were washed in PBS and fixed in 2%
paraformaldehyde for 15 minutes and permeabilized with 0.5% Triton-X100 for 15
minutes. Nonspecific antibody binding sites were blocked with 5% BSA/PBS-Tween20
(PBST). Permeabilized cells were incubated with polyclonal rabbit anti-mouse TLR9
antibody (Pierce) in 1% BSA/PBST overnight at 4°C. Cells were washed in PBST and
stained with streptavidin-Alexa Fluor®488 or goat anti-human IgG-Alexa Fluor®488, and
goat anti-rabbit IgG-Alexa Fluor®568 (Life Technologies, Carlsbad, CA) in 1%
BSA/PBST for 1 hour at room temperature. To detect unwanted cross-reactivity of
antibodies, cells incubated with chTNT-3, chTNT-3/CpG-biotin, or CpG-biotin were
incubated with all secondary stains in the absence of anti-TLR9 antibody, and naïve cells

77

were stained with anti-TLR9 and all secondary stains. Coverslips were washed and
mounted on slides using Fluoroshield Mounting Medium with DAPI (Abcam, Cambridge,
MA). Cells were visualized by PerkinElmer UltraVIEW spinning disk confocal
microscope with a 60x water immersion objective (Waltham, MA).

Radiolabeling of chTNT-3/CpG1826
chTNT-3/CpG186 was radiolabeled with iodine-125 (
125
I) using chloramine-T, as
previously described [29]. Here, 1 mCi (37 MBq) of
125
I and 20 µl of an aqueous solution
of chloramine-T (2 mg/ml) were added to 100 µg of chTNT-3/CpG1826. The solution was
quenched after 2 minutes with sodium metabisulfite. The reaction was purified using a
Sephadex G-25 column and yielded 85-90% recovered radiolabeled products.
125
I-chTNT-
3/CpG1826 was administered within 2 hour after labeling.
To evaluate if deiodination occurs in the presence of serum, radiolabeled conjugate
was incubated in triplicate in fresh mouse serum at 100 µg/ml at 37°C in a humidified
incubator. At 0, 1, 3, 5, and 8 days, protein-bound radioactivity was determined by adding
900 µl of 10% trichloroacetic acid to 100µl aliquots of radiolabeled conjugate in serum.
After 5 minutes incubation at room temperature, protein precipitates were recovered by
centrifugation, and the radioactivity in 500 µl of supernatant was determined using a
gamma counter. No release of radioiodine was observed over this time period.

Mice
Six-week-old naïve female BALB/c and C57BL/6 mice were used in this study. All
mice were purchased from Harlan Laboratories (Indianapolis, IN). All protocols using mice

78

were approved by University of Southern California’s Institutional Animal Care and Use
Committee (IACUC).

Biodistribution Studies
Colon 26 tumors were grown subcutaneously until reaching approximately 0.5 cm
in diameter. Mice were given potassium iodide in their drinking water for 3 days to block
thyroid uptake of free radioiodide. Mice were then injected with 100 µCi (10 µg) of
125
I-
chTNT-3/CpG1826. Groups of mice were euthanized 1, 3, and 5 days post-injection (n=5
mice/time point) and organs, blood, and tumors were removed and weighed. Radioactivity
was measured with a gamma counter.

In Vitro Activity of chTNT-3/CpG1826 Analyzed by Protein Array
To screen the cytokines secreted in response to chTNT-3/CpG1826, the spleen from
a Colon 26-tumor bearing BALB/c mouse was isolated. Splenocytes were acquired by
flushing the spleen with medium and passing cells through a 70 µm filter followed by red
blood cell lysis with BD Pharm Lyse
TM
(BD Biosciences, San Jose, CA). Cells were
incubated in low serum medium (2.5% FBS in RPMI-1640 supplemented with NEAA) in
6-well plates (2.5x10
6
cells in 2 mL per well) with or without chTNT-3/CpG1826
(corresponding to 10 µg/mL of CpG) for 3 days. Supernatants from untreated and chTNT-
3/CpG1826-treated cells were analyzed using a sandwich-based protein array with capture
antibodies on a nitrocellulose membrane (Mouse Cytokine Array C1, RayBiotech,
Norcross, GA). Arrays were semi-quantitatively analyzed using ImageJ [43].

79

In Vitro Assay for Cytokine Production by Multiplex Analysis
Splenocytes from naïve BALB/c mice (n=3 mice) were acquired as described
above. Leukocytes (2.5x10
5
cells/200 µL) were incubated in low serum medium with or
without plated anti-CD3 stimulation, in the presence of chTNT-3, CpG1585, CpG1826,
chTNT-3/CpG1585, chTNT-3/CpG1826, chTNT-3/sc1585, or chTNT-3/sc1826,
(corresponding to 0.1, 1.0, or 10 µg/mL of oligo, or 83 µg/mL antibody) for 4 days at 37
o
C
in a humidified incubator. Anti-CD3 antibody (clone 145-2C11, eBioscience, San Diego,
CA) was plated by incubating 5 µg/mL antibody in PBS on non-treated tissue culture plates
at 4
o
C overnight, followed by three washes with PBS.
Supernatants were collected and measured for cytokine production using Bio-
Plex® Multiplex System (Bio-Rad). A custom set panel was made to analyze mouse IL-2,
IL-4, IL-6, IL-12p40, IL-12p70, and IFN-γ. A separate panel analyzed mouse IL-17(F) and
IL-23p19. Data were collected on the Bio-Rad Bio-Plex Suspension Array System at the
USC Immune Monitoring Core. For quantification of IFN-α, supernatants were analyzed
using the mouse IFN-α Platinum ELISA kit (eBioscience).

In Vitro Activity of Cetuximab/CpG1826
Splenocytes from a naïve female BALB/c mouse were collected as described
previously and incubated in low serum medium (2.5x10
5
cells/200 µL) in the absence or
presence of cetuximab, CpG1826, or cetuximab/CpG1826 for four days. Concentrations
of cetuximab were 0.54, 5.4, and 54 µg/mL, corresponding to 0.1, 1.0, and 10 µg/mL of

80

CpG. IL-6 concentrations were measured in the supernatants using Mouse IL-6
Quantikine ELISA Kit (R&D, Minneapolis, MN).

Tumor Treatment Studies
Two million B16 cells and Colon 26 cells were injected subcutaneously into the
left flank of C57BL/6 and BALB/c mice, respectively. When average tumor sizes reached
75-100 mm
3
, all mice were randomized into treatment groups (n=6 mice/group). Mice then
received treatments diluted in PBS by intraperitoneal (i.p.) or intratumoral (i.t.) injection
daily for 5 days. Tumor volumes were determined by length, width, and height
measurements using a caliper (volume=length x width x height). Tumor volumes were
either measured daily or every other day, as indicated in the figures. For survival analysis,
an event was considered to have occurred if a mouse was found dead, or had to be
euthanized due to conditions previously specified in IACUC protocols.
Treatments included antibodies (chTNT-3 or cetuximab), free CpG (CpG1826),
immunoconjugates (chTNT-3/CpG1826, chTNT-3/CpG1585, and cetuximab/CpG1826),
or free CpG with parental chTNT-3 (chTNT-3 + CpG1826). As a negative control, chTNT-
3/sc1826 was used. Each dose corresponded to either 18 or 10 µg of oligo (50-100 µg
antibody), as specified in the figure legends.

Flow Cytometry Analysis of Tumor-Draining Lymph Nodes
Colon 26 tumor-bearing BALB/c mice were treated with PBS or chTNT-
3/CpG1826 (doses corresponding to 10 µg of CpG) daily for 5 days by i.p. injections (n=3

81

mice/group). Three days following the last dose, contralateral (CL) and tumor-draining
inguinal lymph nodes (TDLN) were acquired. Cells were flushed from lymph nodes and
passed through a 70 µm filter followed by red blood cell lysis with BD Pharm Lyse
TM
. Fc
receptors (FcR) were blocked with a mouse FcR blocking agent (Miltenyi Biotec, Bergisch
Gladbach, Germany) prior to staining. Cells were stained with anti-CD4-FITC, anti-CD8-
APC, anti-CD3-APC-Cy7, anti-CD25-FITC, and/or anti-CD4-PE. For IFN-γ staining, cells
were fixed in 2% paraformaldehyde, followed by permeabilization in 1X Permeabilization
Buffer (eBioscience) and staining with anti-IFN-γ-PE. For FoxP3 detection, cells were
fixed and permeabilized in FoxP3 Fixation/Permeabilization solutions (eBioscience) prior
to staining with anti-FoxP3-APC. All antibody clones and manufacturers are listed in Table
4.3. Cells were washed three times prior to collection on the Attune Flow Cytometer with
the blue/red laser configuration (Life Technologies). Data were analyzed using FlowJo
software (Tree Star, Ashland, OR).
Antigen Conjugate Clone Isotype Manufacturer
CD3ε APC-Cy7 145-2C11
Armenian
Hamster IgG
Biolegend
CD4 FITC RM4-5 Rat IgG2a BD Biosciences
CD4 PE GK1.5 Rat IgG2b eBioscience
CD8α APC 53-6.7 Rat IgG2a eBioscience
CD25 FITC PC61 Rat IgG1 BD Biosciences
FoxP3 APC FJK-16s Rat IgG2a eBioscience
IFN-γ PE XMG1.2 Rat IgG1
Tonbo
Biosciences
Table 4.3. Antibodies used in flow cytometry experiments.

82

Statistical Analysis
Biodistribution and tumor:organ ratio of chTNT-3/CpG uptake were analyzed by
two-way ANOVA with time and organ as the independent variables, followed by Tukey’s
test for pairwise comparisons after significance was found in the primary analysis. In vitro
cytokine concentrations were analyzed by one-way ANOVA followed by Dunnett’s test to
compare every treatment with PBS (control group). In the Colon 26 model, tumor volume
curves over time were compared using two-way repeated measures ANOVA followed by
Tukey’s test for pairwise comparisons between each treatment group after significance was
found in the primary analysis. Due to the loss of mice in the B16 tumor model prior to 30
days, group comparisons on tumor volumes were analyzed up to day 13. To account for
repeatedly measured tumor volumes over days, treatment groups were compared using
generalized estimating equations (GEE), followed by pairwise comparisons by day with p-
values adjusted for false discovery rate. Survival curves were compared using a log-rank
test. The percentages of T regulatory cells in TDLN were compared using a two-tailed
unpaired t-test. All statistical analyses were carried out using GraphPad Prism 6 Software
(La Jolla, CA). GEE analysis was carried out using SASv9.4 (SAS Institute, Cary, NC).

4.3 RESULTS
Characterization of chTNT-3/CpG1826 and chTNT-3/CpG1585
We used the approach discussed in Chapter 3 to conjugate CpG to primary amines
on chTNT-3. However, because CpG1585, a class A CpG, has a poly-guanine motif,
CpG1585 forms higher order structures (Figure 4.1A), with each CpG molecule interacting
with multiple CpG molecules through hydrogen bonds. If an antibody is linked to several

83

CpG molecules and these CpG molecules bind CpG linked to other antibody molecules,
conjugation would result in the formation of noncovalent polymers (Figure 4.1B). When
first attempting to conjugate thiol-modified CpG1585 with chTNT-3, the reaction
repeatedly formed precipitations in spite of varying the ratio of thiol-modified CpG1585
to chTNT-3/EMCS. To minimize the formation of these noncovalent polymers, we mixed
thiol-modified CpG1585 with unmodified CpG1585 prior to conjugation. By allowing
thiol-modified CpG to form higher order structures with unmodified CpG, we limited the
ability of chTNT-3/CpG1585 to form complexes with other chTNT-3/CpG1585 molecules
(Figure 4.1C). Using size exclusion chromatography, we could separate free CpG1826
(monomer 6,625 g/mol) from conjugates (≥ 150,000 g/mol), but not CpG1585 from
chTNT-3/CpG1585 (Figure 4.2A). Consequently, all subsequent experiments with chTNT-
3/CpG1585 included unconjugated and conjugated CpG1585.
Conjugating CpG to lysine residues on an antibody yielded a heterogeneous
distribution of immunoconjugates with varying ratios of CpG payload. In an attempt to
isolate conjugates of differing antibody-to-CpG ratios, conjugates were analyzed by
isoelectric focusing. chTNT-3 has an isoelectric point of 8.8, and is positive at physiologic
pH. The negatively charged phosphorothioate backbone of CpG and neutralization of the
positive charge on lysines lowered the isoelectric points of both chTNT-3/CpG1826 and
chTNT-3/CpG1585 compared to chTNT-3 (Figure 4.2B). While we were able to detect
charge differences between parent (lanes 1-3) and conjugated chTNT-3 (lanes 4-7), we
could not resolve individual bands and instead see a streak (lane 4) reflecting the wide
distribution in CpG-to-antibody ratio (Figure 4.2B). Individual bands could not be resolved
with different film exposures or lower protein loading.

84

Figure 4.1. Higher order structures formed by class A CpG. (A) Model for spontaneous
nanoparticle formation by CpG-A. Image was adapted from Kerkmann et al. 2005 [42].
(B) Noncovalent polymerization of chTNT-3/CpG1585 conjugates when using thiol-
modified CpG. (C) Conjugation of chTNT-3/CpG1585 to other chTNT-3/CpG1585
molecules is minimized by mixing thiol-modified CpG1585 with native CpG1585, which
will not cross-link to antibody.

85

B
Lanes 1: chTNT-3, 1 µg
2: chTNT-3, 0.5 µg
3: chTNT-3, 0.1 µg
4: chTNT-3/CpG1826, 1 µg
5. chTNT-3/CpG1826, 0.5 µg
6. chTNT-3/CpG1826, 0.1 µg
7. chTNT-3/CpG1585, 1 µg

A
Figure 4.2. Size and charge separation of chTNT-3/CpG conjugates. (A) FPLC
chromatogram. Red arrow represents injection of chTNT-3/CpG1826. Green arrow
represents injection of chTNT-3/CpG1585. Peak 1=unconjugated antibody and chTNT-
3/CpG1826, 2=free CpG1826, 3=unconjugated antibody, chTNT-3/CpG1585, and free
CpG1585. Flow rate was 0.6 mL/min (B) Western blot of antibody and conjugates
separated by IEF gel electrophoresis. Blot was probed with anti-human IgG-HRP.
Loading of conjugates correspond to protein content (0.1-1 µg).

86

Intact Binding of chTNT-3/CpG In Vitro and In Vivo
Because CpG engages TLR9 in endosomes to stimulate immune cells, we
demonstrate that chTNT-3/CpG conjugates were internalized and bound to TLR9 in a
similar manner to free CpG in murine monocytic cell line J774A.1 (Figure 4.3A). Although
J774A.1 cells bound unconjugated chTNT-3, likely through Fc:FcR interactions as
demonstrated by membranous staining patterns (Figure 4.3A), cells did not internalize
chTNT-3, even after 2 hours incubation at 37
o
C (data not shown). This finding suggests
that internalization of chTNT-3/CpG required the presence of the oligo. Because chTNT-
3/CpG is chemically conjugated via a non-cleavable linker, the chTNT-3 moiety of the
conjugate also co-localized with TLR9 and the CpG moiety (Appendix Figure 4.1).
In addition to preserving the ability of CpG to co-localize with TLR9, chemical
conjugation permitted chTNT-3 to bind it target antigen in vivo. Biodistribution studies in
Colon 26 tumor-bearing BALB/c mice demonstrated tumor uptake and retention of
125
I-
chTNT-3/CpG. At each time point analyzed (1-5 days), tumor uptake of
125
I-chTNT-3/CpG
was greater than uptake in normal organs and blood (p<0.0001, Figure 4.3B) and
comparable to tumor uptake of parental chTNT-3 [28, 44]. Whereas chTNT-3/CpG cleared
rapidly from normal tissues and blood,
125
I-chTNT-3/CpG exhibited a tumor uptake of
5.1±0.7 (mean±SD) %ID/g 24 hours post-injection, and was retained by tumors after 5
days (4.1±0.3 %ID/g). The rapid clearance of
125
I-chTNT-3/CpG in blood and normal
organs resulted in increasing tumor:organ uptake ratios for every organ over time
(p<0.0001, Figure 4.3C). Using whole-body radioactivity to estimate half-life,
125
I-chTNT-
3/CpG had a half-life of 48.0±1.2 hours which was considerably shorter than the previously
reported half-life of
125
I-chTNT-3 134.2±4.0 hours [28, 44].

87

Figure 4.3. chTNT-3/CpG co-localizes with TLR9 in vitro and targets tumors in vivo.
(A) Fluorescent microscopy demonstrating internalization of chTNT-3/CpG-biotin and
CpG-biotin and co-localization with TLR9 (600x magnification). chTNT-3 was detected
using α-huIgG-AF488 (top panel, green). CpG-biotin was detected using streptavidin-
AF488 (bottom two panels, green). TLR9 was detected using α-TLR9 and α-rabbit IgG-
AF568 (red). Images are representative of 3 independent experiments. (B) Biodistribution
of
125
I-chTNT-3/CpG1826 over 5 days expressed as %ID/g. Statistical significances are
shown for tumor compared to normal organs. (C) Biodistribution expressed as tumor:organ
ratio of %ID/g. Statistical significances are shown for comparisons between time points.
Error bars shown represent SEM. N=5 mice/time point, ***p<0.001, ****p<0.0001.

88

Immunostimulatory Activity of chTNT-3/CpG In Vitro
Because chemical modifications can change the physical properties of CpG,
especially the tertiary structure of class A CpG, we compared cytokine responses to
chTNT-3/CpG and free parental CpG in vitro. In order to develop an assay for this
comparison, we first screened the supernatants of splenocytes incubated with chTNT-
3/CpG1826 for the production of 22 cytokines and chemokines using a protein array
(Figure 4.4). From these cytokines, we chose to analyze IL-2, IL-4, IL-6, IL-10, IL-12p40,
IL-12p70, IL-17(F), IL-23p19, and IFN-γ in subsequent assays by a multiplex assay and
IFN-α by ELISA.

Figure 4.4. Array of cytokines induced by chTNT-3/CpG1826. Splenocytes from a
Colon 26 tumor-bearing mouse was incubated with PBS (control, top blot) or chTNT-
3/CpG1826 (corresponding to 10 µg/mL of CpG, bottom blot) for 4 days. Supernatants
were applied to a protein microarray. The density of each spot was acquired using ImageJ
and normalized to the spots from the control supernatants (top blot). The blue numbers on
the blot correspond to the numbered cytokine or chemokine on the right. Error bars
represent the SEM between duplicate spots.

89

In the following multiplex cytokine analysis, we used CpG1585 as a class A CpG
and CpG1826 as class B. Following four days of incubation, murine BALB/c splenocytes
treated with chTNT-3/CpG1826 or free CpG1826 produced IL-6, IL-10, IL-12p40, and IL-
12p70 in a dose-dependent manner (p<0.0001, Figure 4.5). On the other hand, chTNT-
3/CpG1585 and free CpG1585 did not produce statistically significant amounts of IL-6,
but did produce significant amounts of IL-12p40 and IL-12p70 (p<0.0001, Figure 4.5)
compared to negative controls. In the absence of CD3 stimulation, IL-2, IL-4, IL-17(F),
IL-23p19, IFN-γ and IFN-α production were undetectable or below 100 pg/mL in all
treatment groups (Appendix Figure 4.2).
In combination with T cell stimulation using an agonistic antibody to CD3,
CpG1826 and chTNT-3/CpG1826 increased IL-23p19 (p<0.0001) and IFN-γ secretion
(p<0.05), and decreased IL-17(F) (p<0.01) (Figure 4.6). chTNT-3/CpG1826 in
combination with CD3 stimulation decreased IL-4 levels in a dose-dependent manner
(p<0.01, Appendix Figure 4.2). In the absence or presence of CD3 stimulation, cytokine
profiles were similar for chTNT-3/CpG1826 and free CpG1826, and demonstrated
induction of pro-inflammatory and TH1 cytokines.
While both CpG1585 and chTNT-3/CpG1585 similarly induced IL-12, only free
CpG1585 significantly increased secretion of IL-2 when combined with CD3 stimulation
(p<0.0001, Figure 4.6). Conversely, with CD3 stimulation, chTNT-3/CpG1585
significantly increased IFN-γ (12-fold compared to PBS control, p<0.0001), IL-23p19
(p<0.0001), and IFN-α secretion in a dose-dependent manner, whereas free CpG1585 only
moderately increased IFN-γ (4-fold compared to PBS control, p<0.05) and did not induce
IL-23p19 secretion (Figure 4.6). CpG1585 also induced IFN-α secretion, but not in a dose

90

dependent manner (Figure 4.6). In general, both conjugates (chTNT-3/CpG1585 and
chTNT-3/CpG1826) and free CpG sequences increased the secretion of cytokines that
promote anti-tumor immunity but differed in exactly which cytokines were preferentially
secreted. Figure 4.7 summarizes the cytokines produced by CpG and immunoconjugates
relative to PBS-treated cells.

Figure 4.5. Cytokines produced in response to chTNT-3/CpG1585 and chTNT-
3/CpG1826, without CD3 stimulation. Cytokines were measured using Luminex xMAP
technology. Means were compared to the means of PBS-treated splenocytes (control), and
adjusted for multiple comparisons using Dunnett’s method. Error bars shown represent
SEM. N=3 mice/treatment, *p<0.05, **p<0.01, ***p<0.001, ****p<0.0001. CpG-
A=CpG1585, CpG-B=CpG1826, sc-A and sc-B are negative control oligos for CpG-A and
CpG-B, respectively.

91

Figure 4.6. Cytokine production in response to chTNT-3/CpG1585 and chTNT-
3/CpG1826, with CD3 stimulation. Cytokines were measured using Luminex xMAP
technology, except for IFN-α, which was analyzed by ELISA. Means were compared to
the means of CD3-stimulated, PBS-treated splenocytes (control), and adjusted for multiple
comparisons using Dunnett’s method. Error bars shown represent SEM. N=3mice/
treatment (except IL-17(F), n=2), *p<0.05, **p<0.01, ***p<0.001, ****p<0.0001. CpG-
A=CpG1585, CpG-B=CpG1826, sc-A and sc-B are negative control oligos for CpG-A and
CpG-B, respectively.

92

Figure 4.7. Heat map of cytokine expression in response to free CpG and chTNT-
3/CpG conjugates. In the top map, expression was normalized to cytokine concentrations
in PBS-treated supernatants without CD3 stimulation. In the bottom map, expression was
normalized to cytokine concentrations in CD3-stimulated, PBS-treated supernatants. Fold
change is expressed on a logarithmic scale.

93

chTNT-3/CpG Delays Tumor Growth In Vivo
By delivering CpG to the tumor microenvironment, systemically administered
chTNT-3/CpG can potentially stimulate the immune system in the presence of tumor
antigens. In two different subcutaneous solid tumor models, Colon 26 adenocarcinoma and
B16 melanoma, chTNT-3/CpG reduced tumor volumes and delayed growth (p<0.0001,
Figure 4.8A) following five daily i.p. injections of doses corresponding to 18 µg of CpG.
chTNT-3/CpG1585 (class A) reduced mean tumor volumes by 63% (day 30 mean±SD:
1,478±829 vs. 541±297 mm
3
; p<0.0001) in the Colon 26 tumor model and by 65% (day
13: 4,139±1,346 vs. 1,463±718 v. mm
3
; p<0.01) in the B16 model. chTNT-3/CpG1826
(class B) reduced mean tumor volumes by 72% (day 30: 1,478±829 vs. 418±112 mm
3
;
p<0.0001) in the Colon 26 model and by 79% (day 13 4,139±1,346 vs. 888±152 mm
3
;
p<0.01) in the B16 model. These results highlight the therapeutic potential of chTNT-
3/CpG in two divergent types of tumors.
While different classes of CpG induce distinct sets of cytokines (Figure 4.7),
chTNT-3/CpG1585 (class A) and chTNT-3/CpG1826 (class B) had similar reductions in
tumor growth for both tumor models. Mice treated with chTNT-3/CpG1826 had slightly
smaller mean tumor volumes than mice treated with chTNT-3/CpG1585 in both models,
but differences only reached statistical significance on day 13 in the B16 model (p<0.05).
For individual tumor volume curves of each mice, see Appendix Figure 4.3.
By delaying tumor growth, chTNT-3/CpG1585 and chTNT-3/1826 improved
survival in Colon 26 (p<0.05) and B16 (p<0.001) models (Figure 4.8B). One of the six
Colon 26 tumor-bearing mice treated with chTNT-3/CpG1585 had no palpable tumor by
day 25 (Appendix Figure 4.3). This mouse achieved a memory response against Colon 26

94

cells, as indicated by the lack of tumor growth following tumor rechallenge on the opposite
flank (data not shown). However, as the survival curves illustrate, the majority of chTNT-
3/CpG-treated mice in the Colon 26 model and all of the treated mice in the B16 model
eventually died or were euthanized due to the progression and/or metastasis of their tumors.

(Figure 4.8 continued on next page)

95

Figure 4.8. Class A and B CpG sequences decrease tumor burden and improve
survival in highly (Colon 26) and poorly (B16) immunogenic tumor models when
conjugated to chTNT-3. (A) Tumor volume curves in BALB/c mice-bearing Colon 26
adenocarcinoma and C57BL6 mice-bearing B16 melanoma. Dose of chTNT-3/CpG1585
and chTNT-3/CpG1826 corresponded to 18 µg of CpG. Arrows indicate when treatments
were administered. Open symbols ( , , ) represent data points where n=3-4 mice due
to death of mice prior to that time point. Error bars represent standard error of the mean.
(B) Kaplan-Meier survival curves, with data symbols representing mice alive at the end of
study. N=5-7 mice/group. Statistically significant differences between chTNT-3/CpG1585
or chTNT-3/CpG1826 and PBS treatment are represented by *p<0.05, ** p<0.01, ***
p<0.001, ****p<0.0001. ‡p<0.05 between chTNT-3/CpG1585 and chTNT-3/CpG1826.

96

Effect of chTNT-3/CpG on tumor growth depends on its ability to localize to tumor
Except as a vaccine adjuvant, numerous studies established that systemic delivery
of free CpG is ineffective in eliciting anti-tumor immunity [8, 10, 12, 13, 18], partly due to
its rapid clearance. chTNT-3/CpG1585 and chTNT-3/1826 monotherapies likely delayed
tumor growth and improved survival by delivering the CpG moiety to the tumor, and may
have increased CpG half-life. To demonstrate that tumor accumulation is critical, we
compared systemically delivered chTNT-3/CpG1826 to free CpG1826 (administered i.t.
and i.p.), CpG1826 conjugated to cetuximab (cetuximab/CpG1826, i.p.), and co-
administered but unconjugated CpG1826 and chTNT-3 (chTNT-3 + CpG1826, i.p.) in the
Colon 26 murine tumor model. Cetuximab (Erbitux) is a chimeric anti-human EGFR
antibody that does not cross-react with murine EGFR and does not bind to Colon 26 cells.
For this study, cetuximab served as a negative isotype control for chTNT-3.
Systemically delivered chTNT-3/CpG1826 and intratumoral free CpG1826 had
statistically significantly smaller tumor volumes compared to every other treatment group,
and were the only two treatment groups to be statistically different than PBS treatment
(p<0.0001, Figure 4.9A). By day 29 of the study, tumor volumes were smaller by 66% in
chTNT-3/CpG1826-treated mice (320±174 mm
3
; p<0.0001) and by 70% in CpG1826 (i.t.)-
treated mice (277±291 mm
3
; p<0.0001) compared to PBS treatment (931±599 mm
3
).
Surprisingly, cetuximab/CpG1826 treatment did not result in smaller tumor volumes than
PBS treatment, in spite of demonstrating immunostimulatory activity in vitro (Figure 4.10).

97

(Figure 4.9 continued on next page)

98

Figure 4.9. Optimal effect on tumor growth requires delivery of CpG to the tumor.
(A) Tumor volume curves in Colon 26 tumor-bearing BALB/c mice. Treatment groups are
divided into two graphs for easier visualization. All doses corresponded to 10 µg of oligo
(CpG1826 or sc1826). Arrows indicate when treatments were administered. Error bars
represent standard error of the mean. (B) Kaplan-Meier survival curves, with data symbols
representing mice alive at the end of study. N=6 mice/group. Statistically significant
differences between chTNT-3/CpG1826 or CpG (i.t.) and PBS treatment are represented
by *** p<0.001, ****p<0.0001.

99

Corresponding survival data demonstrated an improvement in survival with
chTNT-3/CpG1826 (i.p.) and CpG1826 (i.t.) (p<0.0001, Figure 4.9B). While most of the
mice still died or were euthanized due to tumor progression, one of the six mice treated
with chTNT-3/CpG1826 and one of the mice treated with CpG1826 (i.t.) had no palpable
tumors 90 days after the start of the study. Both of these mice developed a protective
memory response against Colon 26, as indicated by the lack of tumor growth upon
rechallenge with Colon 26 on the opposite flank.
As expected, co-administration of unconjugated chTNT-3 and CpG1826 did not
delay tumor growth or improve survival (Figure 4.9), indicating that the beneficial effects
of chTNT-3/CpG1826 requires chemical conjugation of the two components. In addition,
this study demonstrated that CpG-specific responses mediated the anti-tumor effects of
chTNT-3/CpG1826, as no reduction in tumor volume or improvement in survival was seen
with chTNT-3 conjugated to a negative control oligo (chTNT-3/sc1826) (Figure 4.9).

Characterization of TDLN by Flow Cytometry
To characterize immune responses to chTNT-3/CpG1826 in vivo, we analyzed the
inguinal lymph nodes from Colon 26 tumor-bearing mice three days following the last dose
Figure 4.10. CpG-moiety on
cetuximab/CpG is active in
vitro. Naïve BALB/c splenocytes
were incubated with cetuximab,
free CpG, or cetuximab/CpG and
supernatants were analyzed for
IL-6 concentrations. Error bars
represent SEM of triplicated
samples in one experiment.

100

of chTNT-3/CpG1826 and PBS (n=3 mice/group). There was a small, but statistically
significant reduction in the percentage of T regulatory cells in the TDLN of mice treated
with chTNT-3/CpG1826 compared to PBS (8.3±0.6 v. 5.7±0.4%; p<0.01, Figure 4.11A).
In two of three mice treated with chTNT-3/CpG1826, TDLN contained IFN-γ-producing
cells, whereas no mice treated with PBS had detectable IFN-γ production (Figure 4.11B).
Contralateral lymph nodes were similar between chTNT-3/CpG1826 and PBS treatment
groups (data not shown). According to FACS analysis, CD3
+
T cells comprised most of
the IFN-γ producing cells (Figure 4.11B), indicating that, in addition to an innate immune
response, chTNT-3/CpG1826-treatment elicited an adaptive immune response.

Figure 4.11. FACS analysis of TDLN in tumor-bearing mice
treated with chTNT-3/CpG1826. (A) T-regs were defined as
CD3
+
CD4
+
FoxP3
+
. Error bars represent standard error of the mean.
N=3 mice/group, **p<0.01. (B) Intracellular staining for IFN-γ.

101

4.4 DISCUSSION
The immunomodulatory activity of CpG and its ability to generate anti-tumor
immune responses have been well-characterized [7-12]. In spite of its success in preclinical
models, its dependence on intratumoral injections or co-administration with tumor antigen
limits its clinical use. Clinical trials have used intratumoral and systemic CpG as a
monotherapy, vaccine adjuvant, and in combination with chemotherapy with mixed results
[reviewed in [14, 15]]. While systemic delivery of CpG decreased tumor volumes in a small
subset of patients’ tumors, optimal anti-tumor effects are only seen when CpG is given in
the presence of tumor antigens [8, 10, 12, 13, 18]. To meet this requirement, we conjugated
CpG to solid tumor-targeting antibody chTNT-3. The conjugation methods we describe
retain CpG’s ability to mount immune responses and affect tumor growth.
Other groups have conjugated CpG to tumor-targeting antibodies, anti-Mucin1 [11]
and anti-HER2/neu [45], and demonstrated anti-tumor responses in murine subcutaneous
tumors [45]. However, anti-MUC1/CpG and anti-neu/CpG were administered
intratumorally when evaluated as a monotherapeutic agent. Systemic administration of
anti-neu/CpG was evaluated only when given in combination with T-reg depleting agents
and was never compared to free CpG in combination with T-reg depleting agents [45],
making it difficult to draw conclusions about systemically delivered anti-neu/CpG. In our
present work, we evaluated systemically delivered chTNT-3/CpG as a monotherapy in two
different models, and compared it to intratumoral and systemic free CpG.
Additionally, chTNT-3/CpG conjugation employed a noncleavable linker at the 3’-
end, whereas anti-neu was conjugated to the 5’-end of CpG using a cleavable linker. The
use of a noncleavable linker negated activity of anti-neu/CpG [45], and can be explained

102

by previous studies demonstrating that modifications to the 5’-end of CpG reduced its
immune activity [46]. Using a noncleavable linker offers the theoretical advantage of
greater in vivo stability, and future studies need to compare the pharmacokinetics and
therapeutic effects between different linkers used in antibody/CpG conjugates.
Other groups also modified CpG to improve its in vivo stability and circulating half-
life [47]. By conjugating CpG to dinitrophenyl haptens (DNP-CpG) and immunizing mice
to DNP, DNP-CpG complexed with endogenous antibodies to increase its circulating half-
life. Although this method increased CpG uptake into tumors, uptake was not tumor-
specific as other normal organs also increased DNP-CpG uptake. Because systemic
delivery of DNP-CpG delayed tumor growth in Colon 26 tumors, we expected isotype
control antibody-conjugated CpG to delay tumor growth. However, cetuximab/CpG did
not decrease tumor burden or improve survival (Figure 4.9). These observations
differentiate CpG from other immunotherapeutic agents (B7.1-Fc, B7.2-Fc, Fc-OX40L,
and antibody/IL-2 fusion proteins) that do not require tumor-specificity to affect tumor
growth [48, 49].
Like other immunoconjugates, tumor uptake of systemic chTNT-3/CpG does not
come close to 100% (Figure 4.3), yet it delayed tumor growth and improved survival
almost equivalently to intratumoral CpG (Figure 4.9). This observation has been repeated
in four other independent mouse experiments (in Colon 26 and B16 models) not shown
here with oligo doses ranging from 10-30 µg per injection. In theory, the entire intratumoral
CpG dose reaches the tumor. However, intratumoral injections does not prevent CpG from
leaking at the injection site or reaching systemic circulation due to high tumor interstitial
pressures, perhaps limiting the clinical trials that administer free CpG intratumorally. This

103

explanation is supported by findings demonstrating that intratumoral injections of tumor-
targeting antibody/CpG conjugates exhibit superior therapeutic effects over intratumoral
injections of free CpG [11]. In our biodistribution experiments with systemic
administration, Colon 26 tumors retained chTNT-3/CpG over several days (80% retention
from day 1 to day 5, Figure 4.3), and this retention of chTNT-3/CpG may explain our
observations. These results mirror the findings we obtained with radiolabeled chTNT-3,
where, unlike other antibodies, chTNT-3 is retained for long periods of time due to its
binding of necrotic regions in tumors [22, 23]. A limitation is that our biodistribution
experiments directly measured the presence of the chTNT-3 and not the CpG moiety.
Future studies will need to label CpG directly and compare pharmacokinetics of
systemically administered chTNT-3/CpG and intratumorally injected CpG.
A unique aspect of this study was the inclusion of class A CpG immunoconjugates.
In spite of their different activities in vitro (Figures 4.5-7), immunoconjugates of CpG1826
and CpG1585 behaved similarly in vivo. Because they both strongly induced IL-12
secretion with and without added CD3 stimulation (Figures 4.5-7), this would suggest that
IL-12 may be the critical mediator for in vivo responses against tumors. However, because
IL-12 shares a subunit (IL-12p40) with IL-23, studies showing induction of IL-12p40 with
CpG may really be measuring IL-23. For this reason, we looked at IL-23p19 and IL-12p70
in addition to IL-12p40, and showed that chTNT-3/CpG1585 and chTNT-3/CpG1826
induced both IL-12 and IL-23 secretion (Figures 4.6-7). Although IL-23 may promote
tumor growth through IL-17 and STAT-3 pathways [50], there is mounting evidence that
IL-23 can support TH1-mediated anti-tumor immune responses [51, 52]. Because IL-17(F)
was not upregulated by chTNT-3/CpG, IL-23 may have contributed to the conjugate’s

104

therapeutic effect, and these results warrant further investigation into the role of IL-12 and
IL-23 in tumor immunity.
In addition to characterizing activity, progress of chTNT-3/CpG into the clinic will
require improving its therapeutic effect. chTNT-3/CpG delayed tumor growth but did not
cure the majority of tumor-bearing mice. In the Colon 26 model, 1 of 6 mice treated with
chTNT-3/CpG1585 (Figure 4.8, Appendix Figure 4.3), 1 of 12 mice treated with chTNT-
3/CpG1826 (Figures 4.8-9) and 1 of 6 mice treated with intratumoral CpG1826 (Figure
4.9) were cured of their tumors. When looking at TDLN, while all 3 of the 3 mice treated
with chTNT-3/CpG had a lower percentage of T regs than mice treated with PBS, only 2
of the 3 mice demonstrated IFN-γ production (Figure 4.11). This finding indicated that
chTNT-3/CpG elicited adaptive immune responses in some but not all of the treated mice.
Approaches to improve efficacy may include optimizing dose, combining chTNT-3/CpG
with agents reversing immunosuppressive mechanisms (e.g., anti-PD-1 or anti-PD-L1
antibodies), and/or combining chTNT-3/CpG with cytoreductive chemotherapies to
increase necrotic antigen available to chTNT-3 [29].
In spite of these limitations, enabling delivery of CpG to tumors after systemic
administration has clear benefits considering most cancers are not easily accessible to
intratumoral injections and may have multiple sites. We demonstrated the feasibility of
using chTNT-3/CpG to treat solid tumors in two different strains of mice. Unlike
previously studied immunotherapeutic regimens (a modified dendritic vaccine approach)
that produced therapeutic effects in immunogenic tumor models with high expression of
histocompatibility complexes (Colon 26, RENCA, 4T1) but not poorly immunogenic
models (MAD109, Lewis lung carcinoma, B16) [3], chTNT-3/CpG1585 and chTNT-

105

3/CpG1826 delayed tumor growth and improved survival in tumors of varying
immunogenicities. In light of the results with chTNT-3/CpG as a monotherapeutic agent,
we are encouraged that the systemic use of CpG immunoconjugates is a significant step
forward in the employment of innate immunity in cancer treatment.

Acknowledgements
The authors would like to acknowledge Dr. Wendy Jean Mack (University of
Southern California, Los Angeles, CA) for her statistical analysis of the B16 tumor model.
The project described was supported in part by the National Center for Research Resources
and the National Center for Advancing Translational Sciences, National Institute of Health
(NIH), through award numbers TL1TR000132 and UL1TR00013; the National Cancer
Institute (NCI) through award number P30CA014089; and Cancer Therapeutics
Laboratories, Inc. (Los Angeles, CA).

106

REFERENCES
1. Wiemann B, Starnes CO. Coley's toxins, tumor necrosis factor and cancer research:
a historical perspective. Pharmacology & therapeutics. 1994; 64: 529-64.
2. Coley WB. The treatment of malignant tumors by repeated inoculations of
erysipelas. With a report of ten original cases. 1893. Clin Orthop Relat Res. 1991: 3-11.
3. Lechner MG, Karimi SS, Barry-Holson K, Angell TE, Murphy KA, Church CH, et
al. Immunogenicity of murine solid tumor models as a defining feature of in vivo behavior
and response to immunotherapy. J Immunother. 2013; 36: 477-89.
4. Liu Y, Zeng G. Cancer and innate immune system interactions: translational
potentials for cancer immunotherapy. J Immunother. 2012; 35: 299-308.
5. Tokunaga T, Yamamoto H, Shimada S, Abe H, Fukuda T, Fujisawa Y, et al.
Antitumor activity of deoxyribonucleic acid fraction from Mycobacterium bovis BCG. I.
Isolation, physicochemical characterization, and antitumor activity. Journal of the National
Cancer Institute. 1984; 72: 955-62.
6. Chu RS, Targoni OS, Krieg AM, Lehmann PV, Harding CV. CpG
oligodeoxynucleotides act as adjuvants that switch on T helper 1 (Th1) immunity. The
Journal of experimental medicine. 1997; 186: 1623-31.
7. Kawarada Y, Ganss R, Garbi N, Sacher T, Arnold B, Hammerling GJ. NK- and
CD8(+) T cell-mediated eradication of established tumors by peritumoral injection of CpG-
containing oligodeoxynucleotides. Journal of immunology. 2001; 167: 5247-53.
8. Heckelsmiller K, Rall K, Beck S, Schlamp A, Seiderer J, Jahrsdorfer B, et al.
Peritumoral CpG DNA elicits a coordinated response of CD8 T cells and innate effectors
to cure established tumors in a murine colon carcinoma model. Journal of immunology.
2002; 169: 3892-9.
9. Sharma S, Karakousis CP, Takita H, Shin K, Brooks SP. Intra-tumoral injection of
CpG results in the inhibition of tumor growth in murine Colon-26 and B-16 tumors.
Biotechnology letters. 2003; 25: 149-53.
10. Amos SM, Pegram HJ, Westwood JA, John LB, Devaud C, Clarke CJ, et al.
Adoptive immunotherapy combined with intratumoral TLR agonist delivery eradicates
established melanoma in mice. Cancer immunology, immunotherapy : CII. 2011; 60: 671-
83.
11. Schettini J, Kidiyoor A, Besmer DM, Tinder TL, Roy LD, Lustgarten J, et al.
Intratumoral delivery of CpG-conjugated anti-MUC1 antibody enhances NK cell anti-
tumor activity. Cancer immunology, immunotherapy : CII. 2012; 61: 2055-65.
12. Betting DJ, Yamada RE, Kafi K, Said J, van Rooijen N, Timmerman JM.
Intratumoral but not systemic delivery of CpG oligodeoxynucleotide augments the efficacy
of anti-CD20 monoclonal antibody therapy against B cell lymphoma. J Immunother. 2009;
32: 622-31.
13. Murad YM, Clay TM. CpG oligodeoxynucleotides as TLR9 agonists: therapeutic
applications in cancer. BioDrugs : clinical immunotherapeutics, biopharmaceuticals and
gene therapy. 2009; 23: 361-75.
14. Holtick U, Scheulen ME, von Bergwelt-Baildon MS, Weihrauch MR. Toll-like
receptor 9 agonists as cancer therapeutics. Expert opinion on investigational drugs. 2011;
20: 361-72.

107

15. Krieg AM. CpG still rocks! Update on an accidental drug. Nucleic acid
therapeutics. 2012; 22: 77-89.
16. Link BK, Ballas ZK, Weisdorf D, Wooldridge JE, Bossler AD, Shannon M, et al.
Oligodeoxynucleotide CpG 7909 delivered as intravenous infusion demonstrates
immunologic modulation in patients with previously treated non-Hodgkin lymphoma. J
Immunother. 2006; 29: 558-68.
17. Weber JS, Zarour H, Redman B, Trefzer U, O'Day S, van den Eertwegh AJ, et al.
Randomized phase 2/3 trial of CpG oligodeoxynucleotide PF-3512676 alone or with
dacarbazine for patients with unresectable stage III and IV melanoma. Cancer. 2009; 115:
3944-54.
18. Shirota Y, Shirota H, Klinman DM. Intratumoral injection of CpG oligonucleotides
induces the differentiation and reduces the immunosuppressive activity of myeloid-derived
suppressor cells. Journal of immunology. 2012; 188: 1592-9.
19. Wingender G, Garbi N, Schumak B, Jungerkes F, Endl E, von Bubnoff D, et al.
Systemic application of CpG-rich DNA suppresses adaptive T cell immunity via induction
of IDO. European journal of immunology. 2006; 36: 12-20.
20. Hofmann MA, Kors C, Audring H, Walden P, Sterry W, Trefzer U. Phase 1
evaluation of intralesionally injected TLR9-agonist PF-3512676 in patients with basal cell
carcinoma or metastatic melanoma. J Immunother. 2008; 31: 520-7.
21. Li Z, Jang JK, Lechner MG, Hu P, Khawli L, Scannell CA, et al. Generation of
tumor-targeted antibody-CpG conjugates. Journal of immunological methods. 2013; 389:
45-51.
22. Hornick JL, Sharifi J, Khawli LA, Hu P, Biela BH, Mizokami MM, et al. A new
chemically modified chimeric TNT-3 monoclonal antibody directed against DNA for the
radioimmunotherapy of solid tumors. Cancer biotherapy & radiopharmaceuticals. 1998;
13: 255-68.
23. Epstein AL, Chen FM, Taylor CR. A novel method for the detection of necrotic
lesions in human cancers. Cancer research. 1988; 48: 5842-8.
24. Chen S, Yu L, Jiang C, Zhao Y, Sun D, Li S, et al. Pivotal study of iodine-131-
labeled chimeric tumor necrosis treatment radioimmunotherapy in patients with advanced
lung cancer. Journal of clinical oncology : official journal of the American Society of
Clinical Oncology. 2005; 23: 1538-47.
25. Hdeib A, Sloan A. Targeted radioimmunotherapy: the role of (1)(3)(1)I-chTNT-
1/B mAb (Cotara) for treatment of high-grade gliomas. Future Oncol. 2012; 8: 659-69.
26. Yu L, Ju DW, Chen W, Li T, Xu Z, Jiang C, et al. 131I-chTNT radioimmunotherapy
of 43 patients with advanced lung cancer. Cancer biotherapy & radiopharmaceuticals.
2006; 21: 5-14.
27. van den Heuvel MM, Verheij M, Boshuizen R, Belderbos J, Dingemans AM, De
Ruysscher D, et al. NHS-IL2 combined with radiotherapy: preclinical rationale and phase
Ib trial results in metastatic non-small cell lung cancer following first-line chemotherapy.
Journal of translational medicine. 2015; 13: 32.
28. Hornick JL, Sharifi J, Khawli LA, Hu P, Bai WG, Alauddin MM, et al. Single
amino acid substitution in the Fc region of chimeric TNT-3 antibody accelerates clearance
and improves immunoscintigraphy of solid tumors. Journal of nuclear medicine : official
publication, Society of Nuclear Medicine. 2000; 41: 355-62.

108

29. Jang JK, Khawli LA, Park R, Wu BW, Li Z, Canter D, et al. Cytoreductive
chemotherapy improves the biodistribution of antibodies directed against tumor necrosis
in murine solid tumor models. Molecular cancer therapeutics. 2013; 12: 2827-36.
30. Khawli LA, Biela B, Hu P, Epstein AL. Comparison of recombinant derivatives of
chimeric TNT-3 antibody for the radioimaging of solid tumors. Hybridoma and
hybridomics. 2003; 22: 1-9.
31. Li J, Hu P, Khawli LA, Epstein AL. Complete regression of experimental solid
tumors by combination LEC/chTNT-3 immunotherapy and CD25(+) T-cell depletion.
Cancer research. 2003; 63: 8384-92.
32. Li J, Hu P, Khawli LA, Epstein AL. LEC/chTNT-3 fusion protein for the
immunotherapy of experimental solid tumors. J Immunother. 2003; 26: 320-31.
33. Biela BH, Khawli LA, Hu P, Epstein AL. Chimeric TNT-3/human beta-
glucuronidase fusion proteins for antibody-directed enzyme prodrug therapy (ADEPT).
Cancer biotherapy & radiopharmaceuticals. 2003; 18: 339-53.
34. Flanagan ML, Khawli LA, Hu P, Epstein AL. H60/TNT-3 fusion protein activates
NK cells in vitro and improves immunotherapeutic outcome in murine syngeneic tumor
models. J Immunother. 2006; 29: 274-83.
35. Hornick JL, Khawli LA, Hu P, Sharifi J, Khanna C, Epstein AL. Pretreatment with
a monoclonal antibody/interleukin-2 fusion protein directed against DNA enhances the
delivery of therapeutic molecules to solid tumors. Clinical cancer research : an official
journal of the American Association for Cancer Research. 1999; 5: 51-60.
36. Mizokami MM, Hu P, Khawli LA, Li J, Epstein AL. Chimeric TNT-3
antibody/murine interferon-gamma fusion protein for the immunotherapy of solid
malignancies. Hybridoma and hybridomics. 2003; 22: 197-207.
37. Krieg AM, Yi AK, Matson S, Waldschmidt TJ, Bishop GA, Teasdale R, et al. CpG
motifs in bacterial DNA trigger direct B-cell activation. Nature. 1995; 374: 546-9.
38. Hanagata N. Structure-dependent immunostimulatory effect of CpG
oligodeoxynucleotides and their delivery system. International journal of nanomedicine.
2012; 7: 2181-95.
39. Krug A, Rothenfusser S, Hornung V, Jahrsdorfer B, Blackwell S, Ballas ZK, et al.
Identification of CpG oligonucleotide sequences with high induction of IFN-alpha/beta in
plasmacytoid dendritic cells. European journal of immunology. 2001; 31: 2154-63.
40. Krieg AM. Therapeutic potential of Toll-like receptor 9 activation. Nat Rev Drug
Discov. 2006; 5: 471-84.
41. Sen D, Gilbert W. Formation of parallel four-stranded complexes by guanine-rich
motifs in DNA and its implications for meiosis. Nature. 1988; 334: 364-6.
42. Kerkmann M, Costa LT, Richter C, Rothenfusser S, Battiany J, Hornung V, et al.
Spontaneous formation of nucleic acid-based nanoparticles is responsible for high
interferon-alpha induction by CpG-A in plasmacytoid dendritic cells. The Journal of
biological chemistry. 2005; 280: 8086-93.
43. Schneider CA, Rasband WS, Eliceiri KW. NIH Image to ImageJ: 25 years of image
analysis. Nat Methods. 2012; 9: 671-5.
44. Khawli LA, Mizokami MM, Sharifi J, Hu P, Epstein AL. Pharmacokinetic
characteristics and biodistribution of radioiodinated chimeric TNT-1, -2, and -3

109

monoclonal antibodies after chemical modification with biotin. Cancer biotherapy &
radiopharmaceuticals. 2002; 17: 359-70.
45. Sharma S, Dominguez AL, Manrique SZ, Cavallo F, Sakaguchi S, Lustgarten J.
Systemic targeting of CpG-ODN to the tumor microenvironment with anti-neu-CpG hybrid
molecule and T regulatory cell depletion induces memory responses in BALB-neuT
tolerant mice. Cancer research. 2008; 68: 7530-40.
46. Kandimalla ER, Bhagat L, Yu D, Cong Y, Tang J, Agrawal S. Conjugation of
ligands at the 5'-end of CpG DNA affects immunostimulatory activity. Bioconjugate
chemistry. 2002; 13: 966-74.
47. Palma E, Cho MJ. Improved systemic pharmacokinetics, biodistribution, and
antitumor activity of CpG oligodeoxynucleotides complexed to endogenous antibodies in
vivo. Journal of controlled release : official journal of the Controlled Release Society.
2007; 120: 95-103.
48. Lechner MG, Russell SM, Bass RS, Epstein AL. Chemokines, costimulatory
molecules and fusion proteins for the immunotherapy of solid tumors. Immunotherapy.
2011; 3: 1317-40.
49. Tzeng A, Kwan BH, Opel CF, Navaratna T, Wittrup KD. Antigen specificity can
be irrelevant to immunocytokine efficacy and biodistribution. Proc Natl Acad Sci U S A.
2015; 112: 3320-5.
50. Teng MW, Andrews DM, McLaughlin N, von Scheidt B, Ngiow SF, Moller A, et
al. IL-23 suppresses innate immune response independently of IL-17A during
carcinogenesis and metastasis. Proc Natl Acad Sci U S A. 2010; 107: 8328-33.
51. Lo CH, Lee SC, Wu PY, Pan WY, Su J, Cheng CW, et al. Antitumor and
antimetastatic activity of IL-23. Journal of immunology. 2003; 171: 600-7.
52. Kaiga T, Sato M, Kaneda H, Iwakura Y, Takayama T, Tahara H. Systemic
administration of IL-23 induces potent antitumor immunity primarily mediated through
Th1-type response in association with the endogenously expressed IL-12. Journal of
immunology. 2007; 178: 7571-80.

110

CHAPTER 5

CONCLUSIONS AND FUTURE DIRECTIONS

In the previous chapters, we demonstrated how Tumor Necrosis Therapy (TNT)
antibodies target multiple types of both human and murine solid tumors. Capitalizing on
this feature, we conjugated pathogen-associated oligodeoxynucleotides (CpG) to chTNT-
3 to allow systemic delivery of CpG to tumors. In two different tumor models, chTNT-
3/CpG delayed tumor growth and improved survival, with efficacy requiring the
conjugation of CpG to a tumor-targeting antibody. In relation to current clinical trials, this
concluding chapter reviews the strengths and limitations of our studies and approach not
previously discussed, and the exciting directions for the development of chTNT-3/CpG as
a clinical therapeutic.

5.1 STRENGTHS and LIMITATIONS
chTNT-3 as a Delivery Agent to Tumors
Targeting necrotic regions, a universal feature of solid tumors, is a convenience not
fully appreciated by the cancer research community, as antibody-drug conjugates and
radioantibodies in development tend to target specific tumor types. The most obvious
advantage is the potential application of TNT reagents in a wide variety of cancers. Because

111

the development of therapeutics for any disease is costly, broadening the use of these
reagents will make them more appealing for investors and pharmaceutical companies, as
well as potentially serving the needs of a larger population. The second advantage is their
ability to target tumors with low cell surface expression of antigens (e.g., CD20, HER2,
MUC1, etc.) due to immunoediting or immune escape. Another related but distinct benefit
is the distribution of TNT antibodies to hypoxic areas of tumors, where dying or necrotic
cells release abundant antigens and damage-associated molecular patterns. In the context
of immunotherapy, TNT reagents can be powerful in bringing immunomodulatory
molecules to poorly immunogenic tumors and to sites needing just the right signals to tip
the scale (Figure 1.1) towards an effective anti-tumor immune response. Lastly, the fourth
advantage to TNT reagents is their concomitant use in preclinical animal and human
clinical studies.
In Chapter 2, we demonstrated how cytoreductive chemotherapies can improve the
uptake of TNT reagents. We conducted this study in anticipation of combining chTNT-
3/CpG with chemotherapy, which is addressed later in this chapter. Another application of
our findings not truly explored would be use of TNT agents in monitoring response to
chemotherapy. A strong limitation to our biodistribution studies in Chapter 2 was the
unstandardized design where different TNT reagents were used with different
chemotherapies of varying doses at different time frames, making it difficult to compare
reagents or dosing regimens. The reason for the heterogeneous design was that the studies
were exploratory and taken from different study periods, with the PET imaging
experiments conducted almost a decade after collection of the other biodistribution
experiments. In spite of design limitations, all of the biodistribution data support that

112

chemotherapy can improve TNT uptake, and that optimal time frames exist when TNT
agents should be administered following chemotherapy.

Conjugation of CpG to Antibodies and Their Evaluation In Vivo
Chapters 3 and 4 discussed the advantages of conjugating CpG to primary amines
on chTNT-3. The conjugation method is not limited to chTNT-3 and can be applied to
other therapeutic antibodies. In Chapter 3, we conjugated CpG to therapeutic antibodies
trastuzumab (Herceptin) and rituximab (Rituxan), but have yet to evaluate them in in vivo
xenograft models. Unlike chTNT-3, trastuzumab and rituximab bind viable cells and are
therapeutic without conjugation to CpG. By comparing rituximab/CpG or
trastuzumab/CpG to rituximab or trastuzumab and chTNT-3/CpG, we can determine if
immunoconjugates have additive or synergistic effects between the therapeutic antibody
and CpG moieties.
Three strengths of our studies on chTNT-3/CpG include the following: 1) the
inclusion of an isotype control antibody conjugate (discussed in detail in Chapter 4), 2)
novel conjugation of class A CpG to antibody, and 3) demonstration of efficacy in two
different types of tumors. While various methods to conjugate or complex class B CpG to
antibodies exist [1-3], conjugation of class A CpG to protein has not been described until
now, likely due to the complicated structured conferred by the poly-guanine tail of the
oligo. In spite of successful conjugation, free CpG1585 (class A) could not be separated
from chTNT-3/CpG1585, and therefore treatment with chTNT-3/CpG1585 actually
includes free chTNT-3, free CpG1585, and the immunoconjugate. The use of ion-exchange

113

chromatography may be a better alternative to size exclusion chromatography for
purification and should be pursued in future studies.
As briefly discussed in the previous chapter and eluded to in the previous section,
chTNT-3 allowed us to systemically deliver CpG and demonstrated efficacy in two
different types of tumors. The real significance of our findings lies in the dissimilar immune
signatures of the Colon 26 and B16 tumor models (Figure 5.1). While the Colon 26 tumor
model is highly immunogenic and relies on the recruitment of T regulatory cells (Tregs) to
survive, the B16 model is poorly immunogenic [4]. Accordingly, in previously published
studies, the Colon 26 model was more amenable to immunotherapy consisting of a
dendritic cell vaccine, cyclophosphamide, and 5-fluorouracil, whereas immunotherapy
showed no improvement in tumor volumes or survival in the B16 model [4]. Because CpG
promotes antigen presentation and immune activation, we hypothesized that CpG would
show greater therapeutic effect in a poorly immunogenic model and only marginal effects
in a highly immunogenic model. Surprisingly, chTNT-3/CpG demonstrated temporal
efficacy in both Colon 26 and B16 models. Efficacy in the Colon 26 model suggested that
CpG may reverse or inhibit mechanisms of immunosuppression in the tumor
microenvironment, although this may be an indirect or downstream effect of immune
activation. Our findings with chTNT-3/CpG are consistent with other mouse studies
demonstrating efficacy of intratumoral CpG in a wide variety of tumor types [1, 5-10].
While we demonstrated therapeutic activity, we did not fully address mechanisms
responsible for effect. Numerous animal studies highlight the important roles of dendritic
cells, macrophages, natural killer cells, and T cells in response to CpG treatment [1, 5-32],
but studies have yet to look at changes in blood vessel permeability and expression of

114

histocompatibility complexes in tumors in response to CpG therapy. These changes would
promote entry of immune cells into tumors and their ability to recognize tumor cells.
Furthermore, two different classes of CpG showed similar efficacy in both Colon 26 and
B16 models (Figure 4.8). Questions remain as to why these conjugates behaved similarly
and how they contributed to anti-tumor immunity in poorly and highly immunogenic
settings.

Figure 5.1. Immunogenicity spectrum of six common
murine tumor models. Diagram was created by Melissa
Lechner (University of Southern California, Los Angeles,
CA).

A limitation of our tumor studies was the use of subcutaneous tumor models. The
use of orthotopic or metastatic models would better evaluate the clinical value of using
chTNT-3 as a delivery agent. Although metastasis was not measured, the B16 melanoma
model is highly metastatic, and metastasis would have affected the survival curves (Figure
4.8B). We chose subcutaneous models to compare different types of tumors and to allow
external tumor volume measurements over time. Orthotopic or metastatic models would
require a single endpoint measurement or expensive imaging approaches for measuring
tumor volumes. However, because smaller tumors have less necrosis, metastatic models
consisting of multiple small tumors may better identify the therapeutic limitations of

115

chTNT-3/CpG. In our studies, subcutaneous models adequately demonstrated proof-of-
principle that systemically delivered chTNT-3/CpG could delay tumor growth and promote
survival, but further evaluations of the immunoconjugates should consider using more
clinically relevant models.
Perhaps the most important limitation to generalizing our findings is the difference
between human and murine TLR9 biology. While TLR9 can be induced on human
monocytes [33, 34], granulocytes [35], and T cells [36], only B cells and plasmacytoid
dendritic cells constitutively express TLR9 (reviewed in [37, 38]). In mice, multiple resting
cells express TLR9, including B cells, monocytes, all dendritic cell subsets, and natural
killer cells (reviewed in [37, 38]). Therefore, what we observed in murine studies may not
translate to efficacy in humans. However, we are encouraged by findings in clinical trials
demonstrating clinical responses to intratumorally administered CpG [39-42]. These trials
confirmed that CpG can elicit immune responses against tumors in humans, and we
propose the conjugation of human TLR9 agonists to tumor-targeting antibodies like
chTNT-3 to improve these responses.

5.2 FUTURE DIRECTIONS
Current Objectives and Status of TNT-3/CpG
From the described studies, we are in partnership with an undisclosed
biopharmaceutical company to develop TNT-3/CpG for human cancer treatment. In this
endeavor, our laboratory has chimeric and fully humanized TNT-3 available for
conjugation. While we have more biodistribution and therapeutic data using chTNT-3, a
humanized antibody may be less immunogenic and less likely to generate anti-

116

immunoconjugate antibodies from human patients. As we move forward, the following list
represents points requiring attention, in order of their priority:
 Selection of human TLR9 ligand CpG sequence
 Optimization of conjugation chemistry
 Optimization of dose regimen
 Limitations on efficacy
 Exploration of combination therapies

Selection of Human TLR9 Ligand CpG Sequences
Animal studies with chTNT-3/CpG1585 and chTNT-3/CpG1826 showed proof-of-
principle that systemic immunoconjugates could treat murine solid tumors. However,
CpG1585 and CpG1826 are highly specific for murine TLR9 and cannot be applied to use
in humans. Because the activity of the CpG moiety is highly dependent on its sequence,
even when comparing two sequences within a class of CpG, we should choose a sequence
that we can potentially translate to clinical use before conducting further explorations.
Over 70% of the CpG involved in clinical cancer trials uses CpG 7909 (or CpG
2006, PF-3512676), developed by Coley Pharmaceutical Group (Wellesley, MA) and
licensed by Pfizer (New York, NY). CpG 7909 is a class B sequence (5’-
TCGTCGTTTTGTCGTTTTGTCGTT-3) specific for human TLR9 (a partial agonist for
murine TLR9). Parallel to CpG1826 being the most well-studied CpG sequence in mice,
CpG 7909 is the most well-studied CpG studied in humans. Its in vitro activity and in vivo
safety profile are well established [41-45] (reviewed in [46]). However, we should express
caution in selecting CpG 7909 considering its lack of clinically meaningful responses in
cancer trials (although these results may be attributed to systemic delivery) (reviewed in

117

[38, 46]). Another disadvantage is its decreased activity on murine cells, which would
make evaluating immunoconjugates in preclinical animal models difficult. However, while
we saw minimal activity in vitro using a murine cell line (Figure 5.2), another group has
demonstrated therapeutic activity of CpG 7909 in mice [15]. Ideally, we should use CpG
with activity in mice and humans, or accept that immunoconjugates may not perform well
in mouse models. If new sequences are screened, the multiplex cytokine assay described
in Chapter 4 (Figures 4.5-7) can compare in vitro activities of CpG on murine splenocytes
and human peripheral blood mononuclear cells.

Optimization of Conjugation Chemistry
Several options exist for conjugating molecules to antibodies. The most common
approaches use a chemical linker that react to primary amines or sulfhydryl groups. These
approaches can be applied to most antibodies, but would result in conjugates with a
heterogeneous distribution of CpG-to-antibody ratios. In other words, following removal
of free CpG, immunoconjugates would include antibodies with 0, 1, 2, or more CpG
molecules attached (Figure 5.3). Furthermore, these approaches are subject to high lot-to-
Figure 5.2. In vitro activity of
CpG 7909 on murine cells.
Murine monocyte/macrophage
cell line J774.1 were incubated
with immunoconjugates for 24
hours at 37
o
C. IL-6 was
measured using the Endogen
Mouse IL-6 ELISA Kit (Pierce,
Rockford, IL). Error bars
represent standard error of the
mean between two independent
experiments ran in triplicate.

118

lot inconsistencies. In spite of these limitations, this approach is used in several clinically
available antibody-drug conjugates, such as trastuzumab emtansine (T-DM1, Kadcyla®)
and ibritumomab tiuxetan (Zevalin®) which also link their payloads to lysine residues.
Alternatively, other methods make site-specific conjugations possible by inserting residues
into the antibody. While site-specific conjugations would improve product consistency,
most techniques require genetic engineering of the antibody (reviewed in [47]). An
exception is an enzymatic approach using mutant glycosyltransferases to add a reactive
sugar residue to carbohydrates on the Fc fragment [48].

Figure 5.3. Conjugation methods
for antibody-drug conjugate
(ADC) development. (A) Lysine
conjugation results in a drug-to-
antibody ratio (DAR) of 0–8 and
potential conjugation at ~40 lysine
residues per antibody. (B)
Conjugation through reduced inter-
chain disulfide bonds results in a
DAR of 0–8 and potential
conjugation at eight cysteine
residues per antibody. (C) Site-
specific conjugation utilizing two
engineered cysteine residues results
in a DAR of 0–2 and conjugation at
two sites/antibody. Figure and
legend taken from Panowksi et al.
2014 [47].

119

Regardless of the conjugation method employed, in vivo biodistribution of the CpG
moiety will be informative. In Chapter 4, we showed that Colon 26 tumors accumulated
chTNT-3/CpG1826 (Figures 4.3B-C). Because
125
I was added to tyrosine residues, only
the antibody moiety was directly measured. PET or optical imaging of the CpG moiety
would allow us to measure whole body biodistribution and at multiple times (see Figure
2.4 for an example). In addition, combining imaging modalities would allow us to look at
the antibody and CpG moieties simultaneously. However, the tracers and probes available
for imaging require modifications to CpG that would likely alter its in vivo behavior. A
more viable approach may be to make radioactive oligos using
3
H,
35
S, and
14
C, and
measure radioactivity in harvested organs (see Figures 2.1-3, 2.6 for examples of cut-and-
count method for biodistribution data). In these biodistribution experiments, it will be
important to compare systemically administered chTNT-3/CpG to intratumoral injections
of free CpG. Inferring from our therapy studies (Figures 4.8-9), I anticipate that free CpG
will readily leave the tumor site, whereas chTNT-3/CpG will accumulate into tumors.

Optimization of Dosing Regimen
Previously published CpG studies in murine tumor models used 10-200 µg of CpG
per dose given once or several times over the course of two weeks [1, 5-10, 22, 49, 50].
For our studies, we administered doses of chTNT-3/CpG that included 10-18 µg of CpG
for five consecutive days. Due to the costs of thiol-modified CpG, we had a limited amount
of reagent available and used as much as we could for each mouse study. In spite of these
low doses, we demonstrated therapeutic activity. A possible explanation is that we started
treatment when tumors were relatively small (75-100 mm
3
). However, we emphasize that

120

at these volumes, in the Colon 26 model, tumors were already between 7-9 mm in
diameter—half of our diameter limit (15 mm) for humane endpoints. In the rapidly growing
B16 model, placebo-treated mice had less than a week to live starting from these tumor
volumes. Therefore, our volumes were reasonable starting points for initiating treatment.
In partnering with a pharmaceutical company, we are less constrained in financial
resources, and can now explore the optimal doses, routes of administration, and dosing
schedule. While optimizing dosing may seem straight forward, a more complex study
design may allow us to address some of the limitations seen in animal models and clinical
trials with CpG. In murine models, smaller tumors but not larger tumors were more
amenable to monotherapy with CpG [5, 6, 10, 31]. Because larger, more established tumors
are likely to have more immunosuppressive signals, I hypothesize that there is a certain
threshold amount of CpG required to be in the tumor microenvironment per volume of
tumor tissue to observe efficacy. In other words, there has to be enough CpG in the tumor
microenvironment for the immune system to overcome immunosuppression (Figure1.1).
Using a multivariable study design in mice, we can look at survival or tumor volume curves
as a function of dose, tumor size at the initiation of treatment, and whether treatment was
initiated early or late. Because current therapies are dosed according to the size of the
patient and not the size of the tumors, this will be an important study, not only for the
development of chTNT-3/CpG as a therapeutic, but for all immunotherapies.

Limitations of Efficacy
In our studies, chTNT-3/CpG delayed tumor growth to improve survival, but did
not result in complete remission in the majority of mice (combining chTNT-3/CpG1585

121

and chTNT-3/CpG1826 treatment groups, 2 of 18 Colon 26 and 0 of 12 B16 tumor-bearing
mice had complete remissions, Figures 4.8-9). Furthermore, only a subset of treated mice
(2 out of 3) had IFN-γ-producing cells in the tumor-draining lymph nodes three days after
the last treatment dose. As discussed in the previous section, a significant limitation was
dosage. Our doses, corresponding to 10-18 µg of CpG, fall into the lower range of doses
used in animal studies [1, 5-10, 22, 49, 50]. Furthermore, only a percentage (less than 10%)
of this injected dose will actually accumulate in the tumor (Figure 4.3B). With these
considerations, it is surprising that the efficacy of chTNT-3/CpG was comparable to
intratumoral CpG, and likely reflected the persistence of CpG in the tumor site. As we
increase the dosage, we have to look at tumors and host immune system to see what cell
types [(Tregs, myeloid-derived suppressor cells (MDSC)], cytokines (IL-10), and
molecules (PD-1) limit efficacy.
In vivo evaluation should consider the possibility of the mice producing anti-
immunoconjugate antibodies. With conjugation of CpG to chTNT-3, the mice may produce
mouse anti-human antibodies. While the use of chTNT-3 or huTNT-3 in humans would
be less concerning, human anti-human antibodies to therapeutic antibodies have been
observed [51-53]. Furthermore, mice and patients may generate antibodies to the CpG
moiety. In 37 patients who received CpG 7909 alone or as part of a vaccine adjuvant, 21
developed anti-CpG antibodies specific to the phosphorothioated backbone [54]. Of the
patients developing antibodies, most had received 4-8 doses of CpG (full range: 2-37
doses). Although the development of anti-CpG antibodies did not hamper vaccine immune
responses in these patients [54], they may affect other responses to CpG and therapeutic
efficacy.

122

Exploration of Combination Therapies
CpG in the tumor microenvironment may server as a beacon, alerting immune cells
to the presence of the tumor. Therefore, it makes sense to combine CpG therapy with other
forms of immunotherapies directed at stimulating the adaptive immune system or inhibiting
suppression for a synergistic effect. Table 5.1 (on pages 123-124) lists several therapies
that may work well with CpG, and includes references for published animal studies and
completed or ongoing clinical trials.
Conjugation of CpG chTNT-3 gives another advantage for combining treatments.
Therapies inducing tumor cell death will increase the necrotic antigens available to chTNT-
3, and thus, improve uptake of the immunoconjugates (discussed in Chapter 2). In addition
to debulking tumors, several of these therapies, including chemotherapy, can elicit an
immunogenic death. Delivering CpG to these areas with abundant tumor antigens and other
damage-associated molecular patterns may provide the right signals to generate anti-tumor
immunity. However, combining immunotherapy with chemotherapy or radiotherapy may
also be counterproductive, considering many chemotherapeutics and radiotherapy are
immunosuppressive. To evaluate chemotherapy as an adjunct to CpG therapy, we
conducted a pilot study where etoposide (VP-16) was given two days before initiating
treatment with chTNT-3/CpG1826 in the Colon 26 tumor model, with dosing based on data
shown in Chapter 2. Surprisingly, pretreatment with VP-16 offered no therapeutic benefit
and even negated efficacy of chTNT-3/CpG (compare blue and black curves, Figure 5.4).
Our results are of the minority, considering the numerous publications
demonstrating efficacy when combining CpG with chemotherapy in murine tumor models
[14-24], which may be a reflection of publication bias against null results. In our study,

123

VP-16 might have depleted the immune cells needed to respond to CpG, and other
chemotherapies or doses should be explored. However, clinical trials using chemotherapy
and CpG support our findings. While combining CpG to a taxane and platinum based
chemotherapy regimen for non-small cell lung cancer improved clinical responses in a
smaller phase 2 trial [55], subsequent trials showed no benefit in combining CpG with
chemotherapy in melanoma [45] and increased toxicity in non-small cell lung cancer [56,
57]. Following these findings, several clinical trials combining CpG and chemotherapy for
treatment of non-small cell lung cancer were terminated (ClinicalTrials.gov). In spite of
these observations, CpG and chemotherapy may still be a good, or at least compatible,
combination. We need to explore the chemotherapies that were compatible in previous
mouse models [14-24] and take a rational approach to designing the dosing regimen.
Several chemotherapies can destroy Tregs and MDSC with some measure of
selectivity [58-60]. These suppressive cell types are roadblocks to successful cancer
immunotherapy and their destruction may permit immune effector cells to function in
response to CpG stimulation. Other groups demonstrated synergistic effects when
combining intratumoral CpG with cyclophosphamide [22, 23]. However, of these studies,
one observed mild lymphopenia and anergic T cells in response to combination treatment
[22] and both studies concluded that synergisms was independent of T effector cells but
dependent on macrophages [22, 23]. Because the chemotherapy dose and dose schedule
are critical to balancing the depletion of suppressor cells with the depletion of other
immune cells, it may be difficult to translate findings to the clinic. Another viable approach
to addressing immunosuppression includes the use of antibodies against
immunosuppressive molecules. While these therapies may not directly address Tregs or

124

MDSC, they can remove the checkpoints (e.g., PD-1, CTLA-4) that inhibit immune
effector cell function. These types of therapeutics should be tailored to the tumor,
otherwise we will increase toxicity without therapeutic benefit in tumors that do not utilize
these checkpoints. Other logical treatment combinations with chTNT-3/CpG are listed in
Table 5.1 with their advantages and disadvantages, and will not be further discussed here.

Figure 5.4. Combining VP-16 and chTNT-3/CpG1826 in a Colon 26 tumor model.
BALB/c Colon 26 tumor-bearing mice received PBS or VP-16 (30 µg/g, i.p.) on day 9
and PBS or chTNT-3/CpG1826 (10 µg of CpG, i.p.) daily on days 11-15. Tumor
volumes were measured every other day for 30 days. Tumor volumes were compared
using a repeated measures two-way ANOVA, followed by Tukey’s post-hoc test for
pairwise comparisons between each group. Error bars represent standard error of the
mean. Statistical significance are only shown for differences between VP-16 + chTNT-
3/CpG1826 and PBS. N=5-6 mice/group, *p<0.05, **p<0.01. Survival rates were
analyzed using a log-rank test. An event was considered to have occurred if a mouse
died or reached humane endpoints.

125

Table 5.1. Rational therapeutic combinations with CpG.

Combination Rationale Challenges Existing Studies
Cytoreductive
Localized
radiotherapy
 Smaller tumor volumes may be
more amenable to CpG therapy
[5, 6, 10]
 Necrosis may increase uptake of
chTNT-3/CpG (Chapter 2)
 Release of tumor antigens in
necrotic regions
 Possible immunogenic cell death
 May destroy immune cells,
negating the effects of CpG

 Murine studies [12-
14]
 Clinical trials [61,
62]
 Ongoing clinical
trials
(NCT02254772,
NCT01745354)
Chemotherapy  Same as localized radiotherapy  Same as localized radiotherapy
 Murine studies [14-
24]
 Clinical trials [45,
55-57]
Reverse Suppression
Low dose
cyclophosphamide
or 5-FU
 Tregs and MDSC limit the
efficacy of most if not all
immunotherapies
 Cyclophosphamide can target
Tregs [58, 59]
 5-FU shown to target MDSC [60]
 Dosing may not be generalizable
to whole population
 May destroy other immune
populations
 Murine [18, 22, 23]
anti-IL-10/IL-10R
antagonistic
antibodies
 CpG promotes the secretion of
IL-10 in animal models [63] and
human studies [41, 64]
 IL-10 down-regulates TH1
cytokines
 IL-10 be critical for production of
anti-tumor antibodies
 Controversial role of IL-10 in
tumor suppression (reviewed in
[65])
 Murine study [25]

126

(Table 5.1 continued)

Blockade of
immune
checkpoints (e.g.,
CTLA-4, PD-1)
 May address mechanisms of
immune escape used by tumors
 Not tumor specific; associated
with autoimmunity
 Depends on mechanisms of
immune escape used by tumors
(i.e., expression of those
checkpoints in the tumor)
 Murine studies [26,
27]
 Ongoing clinical
trial
(NCT02254772)
Tumor-Directed
Antibodies
Antibodies with
ADCC and ADCP
activity (e.g.
rituximab and
trastuzumab)
 Direct toxicity may result in
smaller tumor volumes
 CpG can enhance antigen
presentation following
phagocytosis
 CpG directly or indirectly
activates NK cells
 CpG upregulates expression of
CD20 on lymphoma cells [66]
 CpG also upregulates expression
of CD20 on normal B cells [66]
 CpG induces proliferation of B
cells, and may cause malignant
cells to proliferate
 Murine studies [9,
28-30]
 Clinical trials [61,
67, 68],
NCT00031278,
NCT00043394,
NCT00824733)
Immunostimulatory
TLR-3/7/8
agonists
 Potential activation of discrete
and overlapping
immunostimulatory pathways
 Requires intratumoral injection
 Conjugation to antibodies have
not been developed
 May be redundant
 Murine study [31]
Adoptive cell
therapies
 chTNT-3/CpG can “reactivate” or
“redirect” dendritic cells entering
the tumor microenvironment
 CpG induces secretion of
chemokines to recruit cells into
tumors
 Heterogeneous regimens for ex
vivo preparation of cells for
adoptive transfer
 Murine study [32]

127

5.3 CLOSING REMARKS
In this dissertation, I described how conjugation of CpG to chTNT-3 allowed
systemic delivery of CpG to necrotic sites for the treatment of tumors. Importantly, efficacy
depended on conjugation of CpG to an antibody targeting the tumor microenvironment. In
this regard, chTNT-3/CpG is different from other immunostimulatory molecules
(costimulatory molecules B7.1, B7.2, and OX40L [69], and IL-2 cytokine [70]) that do not
require tumor localization to affect tumor growth. While the difference is initially
perplexing, tumor localization of CpG makes sense. Unlike B7.1, B7.2, OX40L, and IL-2
which target receptors on T cells, CpG serves a very different function in alerting immune
cells as to what entities may be pathogenic. In the absence of a tumor or tumor antigens,
CpG may be incapable of promoting anti-tumor immune cells [6, 8, 9, 50, 71].
In our conceptual model, CpG 1) enhances the uptake and presentation of tumor
antigens from necrotic cells by antigen presenting cells, and 2) promotes a permissive
tumor microenvironment that can support incoming effector cells. This model and other
mechanisms need to be evaluated in future tumor studies with CpG. Several hematopoietic
and non-hematopoietic cancer express TLR9, and CpG may affect their growth directly.
Because CpG induces proliferation of TLR9 expressing immune cells (reviewed in [72,
73], it seems counterintuitive to administer CpG to TLR9 expressing tumors. Nonetheless,
lymphomas account for most of the neoplasms in CpG clinical trials. These trials may be
justified by animal studies demonstrating direct cytotoxic effects of CpG on TLR9
expressing tumor cells [74-76]. Questions remain as to how generalizable these findings
are and whether CpG promotes the growth of some TLR9 expressing cancers.

128

By conjugating CpG to chTNT-3, we addressed an important limitation plaguing
CpG clinical trials. Using a tumor-targeting antibody, we can deliver CpG to previously
inaccessible tumors. Now comes the challenge of translating our work to something that
clinicians can use for human patients. In highlighting the unanswered questions and
limitations from our studies, this chapter makes recommendations for the further
development of chTNT-3/CpG and for future studies in mouse models. These anticipated
models will hopefully guide future clinical trials using chTNT-3/CpG. By exploring the
limitations and full potential of chTNT-3/CpG as a monotherapy and in combination with
other treatment modalities, we can develop an effective agent for cancer immunotherapy.

129

REFERENCES
1. Schettini J, Kidiyoor A, Besmer DM, Tinder TL, Roy LD, Lustgarten J, et al.
Intratumoral delivery of CpG-conjugated anti-MUC1 antibody enhances NK cell anti-
tumor activity. Cancer immunology, immunotherapy : CII. 2012; 61: 2055-65.
2. Palma E, Cho MJ. Improved systemic pharmacokinetics, biodistribution, and
antitumor activity of CpG oligodeoxynucleotides complexed to endogenous antibodies in
vivo. Journal of controlled release : official journal of the Controlled Release Society.
2007; 120: 95-103.
3. Sharma S, Dominguez AL, Manrique SZ, Cavallo F, Sakaguchi S, Lustgarten J.
Systemic targeting of CpG-ODN to the tumor microenvironment with anti-neu-CpG hybrid
molecule and T regulatory cell depletion induces memory responses in BALB-neuT
tolerant mice. Cancer research. 2008; 68: 7530-40.
4. Lechner MG, Karimi SS, Barry-Holson K, Angell TE, Murphy KA, Church CH, et
al. Immunogenicity of murine solid tumor models as a defining feature of in vivo behavior
and response to immunotherapy. J Immunother. 2013; 36: 477-89.
5. Kawarada Y, Ganss R, Garbi N, Sacher T, Arnold B, Hammerling GJ. NK- and
CD8(+) T cell-mediated eradication of established tumors by peritumoral injection of CpG-
containing oligodeoxynucleotides. J Immunol. 2001; 167: 5247-53.
6. Heckelsmiller K, Rall K, Beck S, Schlamp A, Seiderer J, Jahrsdorfer B, et al.
Peritumoral CpG DNA elicits a coordinated response of CD8 T cells and innate effectors
to cure established tumors in a murine colon carcinoma model. J Immunol. 2002; 169:
3892-9.
7. Sharma S, Karakousis CP, Takita H, Shin K, Brooks SP. Intra-tumoral injection of
CpG results in the inhibition of tumor growth in murine Colon-26 and B-16 tumors.
Biotechnology letters. 2003; 25: 149-53.
8. Amos SM, Pegram HJ, Westwood JA, John LB, Devaud C, Clarke CJ, et al.
Adoptive immunotherapy combined with intratumoral TLR agonist delivery eradicates
established melanoma in mice. Cancer immunology, immunotherapy : CII. 2011; 60: 671-
83.
9. Betting DJ, Yamada RE, Kafi K, Said J, van Rooijen N, Timmerman JM.
Intratumoral but not systemic delivery of CpG oligodeoxynucleotide augments the efficacy
of anti-CD20 monoclonal antibody therapy against B cell lymphoma. J Immunother. 2009;
32: 622-31.
10. Lonsdorf AS, Kuekrek H, Stern BV, Boehm BO, Lehmann PV, Tary-Lehmann M.
Intratumor CpG-oligodeoxynucleotide injection induces protective antitumor T cell
immunity. J Immunol. 2003; 171: 3941-6.
11. Chu RS, Targoni OS, Krieg AM, Lehmann PV, Harding CV. CpG
oligodeoxynucleotides act as adjuvants that switch on T helper 1 (Th1) immunity. The
Journal of experimental medicine. 1997; 186: 1623-31.
12. Milas L, Mason KA, Ariga H, Hunter N, Neal R, Valdecanas D, et al. CpG
oligodeoxynucleotide enhances tumor response to radiation. Cancer Res. 2004; 64: 5074-
7.
13. Mason KA, Ariga H, Neal R, Valdecanas D, Hunter N, Krieg AM, et al. Targeting
toll-like receptor 9 with CpG oligodeoxynucleotides enhances tumor response to
fractionated radiotherapy. Clin Cancer Res. 2005; 11: 361-9.

130

14. Rayburn ER, Wang W, Zhang R, Wang H. Experimental therapy for colon cancer:
anti-cancer effects of TLR9 agonism, combination with other therapeutic modalities, and
dependence upon p53. Int J Oncol. 2007; 30: 1511-9.
15. Weigel BJ, Rodeberg DA, Krieg AM, Blazar BR. CpG oligodeoxynucleotides
potentiate the antitumor effects of chemotherapy or tumor resection in an orthotopic murine
model of rhabdomyosarcoma. Clin Cancer Res. 2003; 9: 3105-14.
16. Balsari A, Tortoreto M, Besusso D, Petrangolini G, Sfondrini L, Maggi R, et al.
Combination of a CpG-oligodeoxynucleotide and a topoisomerase I inhibitor in the therapy
of human tumour xenografts. Eur J Cancer. 2004; 40: 1275-81.
17. Pratesi G, Petrangolini G, Tortoreto M, Addis A, Belluco S, Rossini A, et al.
Therapeutic synergism of gemcitabine and CpG-oligodeoxynucleotides in an orthotopic
human pancreatic carcinoma xenograft. Cancer Res. 2005; 65: 6388-93.
18. Bourquin C, Schreiber S, Beck S, Hartmann G, Endres S. Immunotherapy with
dendritic cells and CpG oligonucleotides can be combined with chemotherapy without loss
of efficacy in a mouse model of colon cancer. Int J Cancer. 2006; 118: 2790-5.
19. Gekeler V, Gimmnich P, Hofmann HP, Grebe C, Rommele M, Leja A, et al. G3139
and other CpG-containing immunostimulatory phosphorothioate oligodeoxynucleotides
are potent suppressors of the growth of human tumor xenografts in nude mice.
Oligonucleotides. 2006; 16: 83-93.
20. Reinis M, Simova J, Indrova M, Bieblova J, Bubenik J. CpG oligodeoxynucleotides
are effective in therapy of minimal residual tumour disease after chemotherapy or surgery
in a murine model of MHC class I-deficient, HPV16-associated tumours. Int J Oncol. 2007;
30: 1247-51.
21. Petrangolini G, Tortoreto M, Perego P, Carenini N, De Cesare M, Balsari A, et al.
Combination of metronomic gimatecan and CpG-oligodeoxynucleotides against an
orthotopic pancreatic cancer xenograft. Cancer Biol Ther. 2008; 7: 596-601.
22. Buhtoiarov IN, Sondel PM, Wigginton JM, Buhtoiarova TN, Yanke EM, Mahvi
DA, et al. Anti-tumour synergy of cytotoxic chemotherapy and anti-CD40 plus CpG-ODN
immunotherapy through repolarization of tumour-associated macrophages. Immunology.
2011; 132: 226-39.
23. Johnson EE, Buhtoiarov IN, Baldeshwiler MJ, Felder MA, Van Rooijen N, Sondel
PM, et al. Enhanced T-cell-independent antitumor effect of cyclophosphamide combined
with anti-CD40 mAb and CpG in mice. J Immunother. 2011; 34: 76-84.
24. Sommariva M, De Cecco L, De Cesare M, Sfondrini L, Menard S, Melani C, et al.
TLR9 agonists oppositely modulate DNA repair genes in tumor versus immune cells and
enhance chemotherapy effects. Cancer Res. 2011; 71: 6382-90.
25. Vicari AP, Chiodoni C, Vaure C, Ait-Yahia S, Dercamp C, Matsos F, et al. Reversal
of tumor-induced dendritic cell paralysis by CpG immunostimulatory oligonucleotide and
anti-interleukin 10 receptor antibody. J Exp Med. 2002; 196: 541-9.
26. Houot R, Levy R. T-cell modulation combined with intratumoral CpG cures
lymphoma in a mouse model without the need for chemotherapy. Blood. 2009; 113: 3546-
52.
27. Mangsbo SM, Sandin LC, Anger K, Korman AJ, Loskog A, Totterman TH.
Enhanced tumor eradication by combining CTLA-4 or PD-1 blockade with CpG therapy.
J Immunother. 2010; 33: 225-35.

131

28. van Ojik HH, Bevaart L, Dahle CE, Bakker A, Jansen MJ, van Vugt MJ, et al. CpG-
A and B oligodeoxynucleotides enhance the efficacy of antibody therapy by activating
different effector cell populations. Cancer Res. 2003; 63: 5595-600.
29. Roda JM, Parihar R, Carson WE, 3rd. CpG-containing oligodeoxynucleotides act
through TLR9 to enhance the NK cell cytokine response to antibody-coated tumor cells. J
Immunol. 2005; 175: 1619-27.
30. Wooldridge JE, Ballas Z, Krieg AM, Weiner GJ. Immunostimulatory
oligodeoxynucleotides containing CpG motifs enhance the efficacy of monoclonal
antibody therapy of lymphoma. Blood. 1997; 89: 2994-8.
31. Zhao BG, Vasilakos JP, Tross D, Smirnov D, Klinman DM. Combination therapy
targeting toll like receptors 7, 8 and 9 eliminates large established tumors. J Immunother
Cancer. 2014; 2: 12.
32. Lou Y, Liu C, Lizee G, Peng W, Xu C, Ye Y, et al. Antitumor activity mediated by
CpG: the route of administration is critical. J Immunother. 2011; 34: 279-88.
33. Saikh KU, Kissner TL, Sultana A, Ruthel G, Ulrich RG. Human monocytes
infected with Yersinia pestis express cell surface TLR9 and differentiate into dendritic
cells. J Immunol. 2004; 173: 7426-34.
34. Eaton-Bassiri A, Dillon SB, Cunningham M, Rycyzyn MA, Mills J, Sarisky RT, et
al. Toll-like receptor 9 can be expressed at the cell surface of distinct populations of tonsils
and human peripheral blood mononuclear cells. Infect Immun. 2004; 72: 7202-11.
35. Hayashi F, Means TK, Luster AD. Toll-like receptors stimulate human neutrophil
function. Blood. 2003; 102: 2660-9.
36. Gelman AE, LaRosa DF, Zhang J, Walsh PT, Choi Y, Sunyer JO, et al. The adaptor
molecule MyD88 activates PI-3 kinase signaling in CD4+ T cells and enables CpG
oligodeoxynucleotide-mediated costimulation. Immunity. 2006; 25: 783-93.
37. Iwasaki A, Medzhitov R. Toll-like receptor control of the adaptive immune
responses. Nat Immunol. 2004; 5: 987-95.
38. Holtick U, Scheulen ME, von Bergwelt-Baildon MS, Weihrauch MR. Toll-like
receptor 9 agonists as cancer therapeutics. Expert Opin Investig Drugs. 2011; 20: 361-72.
39. Carpentier A, Laigle-Donadey F, Zohar S, Capelle L, Behin A, Tibi A, et al. Phase
1 trial of a CpG oligodeoxynucleotide for patients with recurrent glioblastoma. Neuro
Oncol. 2006; 8: 60-6.
40. Carpentier A, Metellus P, Ursu R, Zohar S, Lafitte F, Barrie M, et al. Intracerebral
administration of CpG oligonucleotide for patients with recurrent glioblastoma: a phase II
study. Neuro Oncol. 2010; 12: 401-8.
41. Molenkamp BG, van Leeuwen PA, Meijer S, Sluijter BJ, Wijnands PG, Baars A,
et al. Intradermal CpG-B activates both plasmacytoid and myeloid dendritic cells in the
sentinel lymph node of melanoma patients. Clin Cancer Res. 2007; 13: 2961-9.
42. Hofmann MA, Kors C, Audring H, Walden P, Sterry W, Trefzer U. Phase 1
evaluation of intralesionally injected TLR9-agonist PF-3512676 in patients with basal cell
carcinoma or metastatic melanoma. J Immunother. 2008; 31: 520-7.
43. Link BK, Ballas ZK, Weisdorf D, Wooldridge JE, Bossler AD, Shannon M, et al.
Oligodeoxynucleotide CpG 7909 delivered as intravenous infusion demonstrates
immunologic modulation in patients with previously treated non-Hodgkin lymphoma. J
Immunother. 2006; 29: 558-68.

132

44. Pashenkov M, Goess G, Wagner C, Hormann M, Jandl T, Moser A, et al. Phase II
trial of a toll-like receptor 9-activating oligonucleotide in patients with metastatic
melanoma. J Clin Oncol. 2006; 24: 5716-24.
45. Weber JS, Zarour H, Redman B, Trefzer U, O'Day S, van den Eertwegh AJ, et al.
Randomized phase 2/3 trial of CpG oligodeoxynucleotide PF-3512676 alone or with
dacarbazine for patients with unresectable stage III and IV melanoma. Cancer. 2009; 115:
3944-54.
46. Krieg AM. CpG still rocks! Update on an accidental drug. Nucleic Acid Ther. 2012;
22: 77-89.
47. Panowksi S, Bhakta S, Raab H, Polakis P, Junutula JR. Site-specific antibody drug
conjugates for cancer therapy. MAbs. 2014; 6: 34-45.
48. Boeggeman E, Ramakrishnan B, Pasek M, Manzoni M, Puri A, Loomis KH, et al.
Site specific conjugation of fluoroprobes to the remodeled Fc N-glycans of monoclonal
antibodies using mutant glycosyltransferases: application for cell surface antigen detection.
Bioconjug Chem. 2009; 20: 1228-36.
49. Wingender G, Garbi N, Schumak B, Jungerkes F, Endl E, von Bubnoff D, et al.
Systemic application of CpG-rich DNA suppresses adaptive T cell immunity via induction
of IDO. Eur J Immunol. 2006; 36: 12-20.
50. Shirota Y, Shirota H, Klinman DM. Intratumoral injection of CpG oligonucleotides
induces the differentiation and reduces the immunosuppressive activity of myeloid-derived
suppressor cells. J Immunol. 2012; 188: 1592-9.
51. Ritter G, Cohen LS, Williams C, Jr., Richards EC, Old LJ, Welt S. Serological
analysis of human anti-human antibody responses in colon cancer patients treated with
repeated doses of humanized monoclonal antibody A33. Cancer Res. 2001; 61: 6851-9.
52. Goto S, Goto H, Tanoshima R, Kato H, Takahashi H, Sekiguchi O, et al. Serum
sickness with an elevated level of human anti-chimeric antibody following treatment with
rituximab in a child with chronic immune thrombocytopenic purpura. Int J Hematol. 2009;
89: 305-9.
53. Lunardon L, Payne AS. Inhibitory human antichimeric antibodies to rituximab in a
patient with pemphigus. J Allergy Clin Immunol. 2012; 130: 800-3.
54. Karbach J, Neumann A, Wahle C, Brand K, Gnjatic S, Jager E. Therapeutic
administration of a synthetic CpG oligodeoxynucleotide triggers formation of anti-CpG
antibodies. Cancer Res. 2012; 72: 4304-10.
55. Manegold C, Gravenor D, Woytowitz D, Mezger J, Hirsh V, Albert G, et al.
Randomized phase II trial of a toll-like receptor 9 agonist oligodeoxynucleotide, PF-
3512676, in combination with first-line taxane plus platinum chemotherapy for advanced-
stage non-small-cell lung cancer. J Clin Oncol. 2008; 26: 3979-86.
56. Hirsh V, Paz-Ares L, Boyer M, Rosell R, Middleton G, Eberhardt WE, et al.
Randomized phase III trial of paclitaxel/carboplatin with or without PF-3512676 (Toll-like
receptor 9 agonist) as first-line treatment for advanced non-small-cell lung cancer. J Clin
Oncol. 2011; 29: 2667-74.
57. Manegold C, van Zandwijk N, Szczesna A, Zatloukal P, Au JS, Blasinska-
Morawiec M, et al. A phase III randomized study of gemcitabine and cisplatin with or
without PF-3512676 (TLR9 agonist) as first-line treatment of advanced non-small-cell
lung cancer. Ann Oncol. 2012; 23: 72-7.

133

58. Zhao J, Cao Y, Lei Z, Yang Z, Zhang B, Huang B. Selective depletion of
CD4+CD25+Foxp3+ regulatory T cells by low-dose cyclophosphamide is explained by
reduced intracellular ATP levels. Cancer Res. 2010; 70: 4850-8.
59. Ghiringhelli F, Larmonier N, Schmitt E, Parcellier A, Cathelin D, Garrido C, et al.
CD4+CD25+ regulatory T cells suppress tumor immunity but are sensitive to
cyclophosphamide which allows immunotherapy of established tumors to be curative. Eur
J Immunol. 2004; 34: 336-44.
60. Vincent J, Mignot G, Chalmin F, Ladoire S, Bruchard M, Chevriaux A, et al. 5-
Fluorouracil selectively kills tumor-associated myeloid-derived suppressor cells resulting
in enhanced T cell-dependent antitumor immunity. Cancer Res. 2010; 70: 3052-61.
61. Witzig TE, Wiseman GA, Maurer MJ, Habermann TM, Micallef IN, Nowakowski
GS, et al. A phase I trial of immunostimulatory CpG 7909 oligodeoxynucleotide and 90
yttrium ibritumomab tiuxetan radioimmunotherapy for relapsed B-cell non-Hodgkin
lymphoma. Am J Hematol. 2013; 88: 589-93.
62. Goldstein MJ, Varghese B, Brody JD, Rajapaksa R, Kohrt H, Czerwinski DK, et
al. A CpG-loaded tumor cell vaccine induces antitumor CD4+ T cells that are effective in
adoptive therapy for large and established tumors. Blood. 2011; 117: 118-27.
63. Yi AK, Yoon JG, Yeo SJ, Hong SC, English BK, Krieg AM. Role of mitogen-
activated protein kinases in CpG DNA-mediated IL-10 and IL-12 production: central role
of extracellular signal-regulated kinase in the negative feedback loop of the CpG DNA-
mediated Th1 response. J Immunol. 2002; 168: 4711-20.
64. Duramad O, Fearon KL, Chan JH, Kanzler H, Marshall JD, Coffman RL, et al. IL-
10 regulates plasmacytoid dendritic cell response to CpG-containing immunostimulatory
sequences. Blood. 2003; 102: 4487-92.
65. Oft M. IL-10: master switch from tumor-promoting inflammation to antitumor
immunity. Cancer Immunol Res. 2014; 2: 194-9.
66. Mankai A, Buhe V, Hammadi M, Youinou P, Ghedira I, Berthou C, et al.
Improvement of rituximab efficiency in chronic lymphocytic leukemia by CpG-mediated
upregulation of CD20 expression independently of PU.1. Ann N Y Acad Sci. 2009; 1173:
721-8.
67. Leonard JP, Link BK, Emmanouilides C, Gregory SA, Weisdorf D, Andrey J, et al.
Phase I trial of toll-like receptor 9 agonist PF-3512676 with and following rituximab in
patients with recurrent indolent and aggressive non Hodgkin's lymphoma. Clin Cancer Res.
2007; 13: 6168-74.
68. Friedberg JW, Kim H, McCauley M, Hessel EM, Sims P, Fisher DC, et al.
Combination immunotherapy with a CpG oligonucleotide (1018 ISS) and rituximab in
patients with non-Hodgkin lymphoma: increased interferon-alpha/beta-inducible gene
expression, without significant toxicity. Blood. 2005; 105: 489-95.
69. Lechner MG, Russell SM, Bass RS, Epstein AL. Chemokines, costimulatory
molecules and fusion proteins for the immunotherapy of solid tumors. Immunotherapy.
2011; 3: 1317-40.
70. Tzeng A, Kwan BH, Opel CF, Navaratna T, Wittrup KD. Antigen specificity can
be irrelevant to immunocytokine efficacy and biodistribution. Proc Natl Acad Sci U S A.
2015; 112: 3320-5.

134

71. Murad YM, Clay TM. CpG oligodeoxynucleotides as TLR9 agonists: therapeutic
applications in cancer. BioDrugs : clinical immunotherapeutics, biopharmaceuticals and
gene therapy. 2009; 23: 361-75.
72. Krieg AM. From A to Z on CpG. Trends Immunol. 2002; 23: 64-5.
73. Krieg AM. CpG motifs in bacterial DNA and their immune effects. Annu Rev
Immunol. 2002; 20: 709-60.
74. Noack J, Jordi M, Zauner L, Alessi D, Burch A, Tinguely M, et al. TLR9 agonists
induced cell death in Burkitt's lymphoma cells is variable and influenced by TLR9
polymorphism. Cell Death Dis. 2012; 3: e323.
75. Ben Abdelwahed R, Cosette J, Donnou S, Crozet L, Ouakrim H, Fridman WH, et
al. Lymphoma B-cell responsiveness to CpG-DNA depends on the tumor
microenvironment. J Exp Clin Cancer Res. 2013; 32: 18.
76. Qi XF, Zheng L, Kim CS, Lee KJ, Kim DH, Cai DQ, et al. CpG
oligodeoxynucleotide induces apoptosis and cell cycle arrest in A20 lymphoma cells via
TLR9-mediated pathways. Mol Immunol. 2013; 54: 327-37.

135

APPENDIX

136

Appendix Figure 4.1. Internalization and co-localization of chTNT-3 moiety of chTNT-
3/CpG-biotin. (A) Fluorescent microscopy demonstrating internalization of chTNT-3-
moiety and co-localization with TLR-9 at 60 min. chTNT-3 was detected using α-huIgG-
AF488 (green). TLR-9 was detected using α-TLR-9 and α-rabbit IgG-AF568 (red). (B)
chTNT-3 moiety stays conjugated with the CpG-biotin moiety following internalization at
60 min. CpG-biotin was detected using streptavidin-AF488 (green) and chTNT-3 was
detected using α-huIgG-AF568 (red).

137

Appendix Figure 4.2. IL-2, IL-17(F),
IFN-γ, and IFN-α release in response
to CpG or chTNT-3/CpG without
CD3 stimulation, and IL-4 release
with CD3 stimulation. Without CD3
stimulation, production of IL-4 was
undetectable. *p<0.05, **p<0.01,
***p<0.001, ****p<0.0001, N=3 mice,
except IL-17(F) where N=2 mice. Error
bars shown represent SEM. CpG-
A=CpG1585, CpG-B=CpG1826.

138

Appendix Figure 4.3. Individual tumor curves for mice treated with PBS, chTNT-
3/CpG1585, and chTNT-3/CpG1826. (A) Colon 26 tumor model in BALB/c mice. (B)
B16 tumor model in C57BL/6 mice.

139

ACKNOWLEDGEMENTS

Thesis Committee Members:
Clive R. Taylor, MD, PhD (Chair)
Alan L. Epstein, MD, PhD (Mentor)
Omid Akbari, PhD
Harvey R. Kaslow, PhD
Minnie McMillan, PhD

Integrative Biology of Disease Chair:
Martin Kast, PhD

I want to thank Dr. Alan L. Epstein for his unwavering intellectual and emotional
support these past four years. In addition to sharing his scientific knowledge, he
exemplified the skills necessary to leading a laboratory and to facing the challenges that
come with academic research. When I was discouraged, he gave me reassurance and
encouragement. Most importantly, he showed me kindness and patience, and I will try to
carry that with me as I move forward. I cannot express enough the deep gratitude I feel
towards my mentor and friend.

I thank my thesis committee for their constructive feedback and encouragement
these past several years. Their suggestions improved my science, writing, and presentation
skills. They have given me the confidence to proudly present my work. As Committee
Chair, I want to especially thank Dr. Clive R. Taylor for his advice and support for my

140

career development. He has often relieved my anxieties with the dissertation and MD/PhD
training.

My dissertation would not be possible without the work from Drs. Peisheng Hu and
Leslie A. Khawli. Their expertise in protein biochemistry guided the conjugation
approaches and provided most of the reagents I worked with. In addition, I thank them for
the many opportunities they kindly gave me to write and publish.

A special acknowledgement goes out to David E. Canter, who worked by my side
the past two years. I will never forget the many times we had to troubleshoot in the middle
of experiments, and I thank him for his patience in that regard. He has been such a delight
to work with and our conversations helped the time pass in the animal facilities.

I also thank Drs. Melissa G. Lechner and Trevor A. Angell for their guidance —in
research, medicine, and parenting. They have been great role models as physician-scientists
in-training and good friends. I thank them for the opportunities to work on breast implant-
associated lymphomas and thyroid cancer, and I hope to work with them again.

I also would like to thank the many friends and colleagues at the Keck School of
Medicine and in the laboratory of Dr. Alan L. Epstein who have been a pleasure to work
with. They include the following: Ryan Park, Brandon Wolfe, Ryan Graff, Sarah Russell,

141

Tian Zhu (Henry), Courtney Nguyen, Mitri Khoury, Stephanie Wu, Zhongjun Li (Johnny),
Long Zheng (Larry), Lisa Yan, Diane DeSilva, Saman Karimi, Katrin Tiemann, Maggie
Yun, Mandy Han, and Lily Lourdes.

I thank the Southern California Clinical & Translational Science Institute (SC
CTSI) for the opportunities given to me this past year to learn additional methods of
scientific analysis and to present my work nationally. I also want to recognize my TL-1
and KL-2 colleagues and instructors, especially Drs. Cecilia Patino-Sutton and Melissa
Wilson, for their feedback on writing and oral presentations.

I acknowledge the following financial support for my graduate training: the Breast
Cancer Research Program funded by the Department of Defense (grant W81XWH-11-1-
0466), the SC CTSI TL1 pre-doctoral fellowship funded by the National Center for
Advancing Translational Science and National Institutes of Health (grant TL1TR000132),
Philanthropic Educational Organization Scholars Award, and Cancer Therapeutics
Laboratories, Inc.

Last but not least, I want to express my deepest gratitude to my family. My husband
Brian Wu has been a pillar of support the last few years. I could not have asked for a better
partner in the workplace or home. He is there with me in the laboratory on the weekends
and at odd hours of the night. I will never forget how he helped me pipet at 2:00 in the
morning on several occasions. I thank my brother Timothy for commiserating with me and

142

his guidance over my medical education. I thank the Wu-parents for their loving support,
and their wisdom and advice on balancing work and motherhood. I have to especially
recognize Shuenn-Jue Wu (Wu-mom) for her help in editing my thesis and sharing her
experiences as a female senior scientist. I also want to thank God for the opportunities
given to me, and my parents, who pray constantly for me. I greatly appreciate my parents
who have gone out of their way to make my life easier. My thesis belongs as much to them
as it does to me. Finally, I thank the baby Julian, who has not helped me progress with my
PhD but is the best distraction I could ever ask for.

143

BIBLIOGRAPHY

Pfizer discontinues clinical trials for PF-3512676 combined with cytotoxic chemotherapy
in advanced non-small cell lung cancer [Press release]. (2007) [cited; Available
from: http://press.pfizer.com/press-release/pfizer-discontinues-clinical-trials-pf-
3512676-combined-cytotoxic-chemotherapy-advance
Abbas AK, Lichtman AH, Pillai S. Basic immunology functions and disorders of the
immune system. Fourth edition. ed. Philadelphia, PA: Elsevier/Saunders,; 2014. p.
ix, 320 pages color illustrations 24 cm.
Akira S, Takeda K. Toll-like receptor signalling. Nat Rev Immunol. 2004;4:499-511.
Amos SM, Pegram HJ, Westwood JA, John LB, Devaud C, Clarke CJ, Restifo NP,
Smyth MJ, Darcy PK, Kershaw MH. Adoptive immunotherapy combined with
intratumoral TLR agonist delivery eradicates established melanoma in mice.
Cancer Immunol Immunother. 2011;60:671-83.
Anderson PM, Wiseman GA, Lewis BD, Charboneau JW, Dunn WL, Carpenter SP,
Chew T. A phase I safety and imaging study using radiofrequency ablation (RFA)
followed by 131I-chTNT-1/B radioimmunotherapy adjuvant treatment of hepatic
metastasis. Cancer Therapy. 2003;1:297-306.
Arjaans M, Oude Munnink TH, Oosting SF, Terwisscha van Scheltinga AG, Gietema JA,
Garbacik ET, Timmer-Bosscha H, Lub-de Hooge MN, Schroder CP, de Vries EG.
Bevacizumab-induced normalization of blood vessels in tumors hampers antibody
uptake. Cancer Res. 2013;73:3347-55.
Ballas ZK, Rasmussen WL, Krieg AM. Induction of NK activity in murine and human
cells by CpG motifs in oligodeoxynucleotides and bacterial DNA. J Immunol.
1996;157:1840-5.
Balsari A, Tortoreto M, Besusso D, Petrangolini G, Sfondrini L, Maggi R, Menard S,
Pratesi G. Combination of a CpG-oligodeoxynucleotide and a topoisomerase I
inhibitor in the therapy of human tumour xenografts. Eur J Cancer.
2004;40:1275-81.
Basaki Y, Chikahisa L, Aoyagi K, Miyadera K, Yonekura K, Hashimoto A, Okabe S,
Wierzba K, Yamada Y. gamma-Hydroxybutyric acid and 5-fluorouracil,
metabolites of UFT, inhibit the angiogenesis induced by vascular endothelial
growth factor. Angiogenesis. 2001;4:163-73.
Baxevanis CN, Perez SA, Papamichail M. Combinatorial treatments including vaccines,
chemotherapy and monoclonal antibodies for cancer therapy. Cancer Immunol
Immunother. 2009;58:317-24.

144

Belani CP, Nemunaitis JJ, Chachoua A, Eisenberg PD, Raez LE, Cuevas JD, Mather CB,
Benner RJ, Meech SJ. Phase 2 trial of erlotinib with or without PF-3512676 (CPG
7909, a Toll-like receptor 9 agonist) in patients with advanced recurrent EGFR-
positive non-small cell lung cancer. Cancer Biol Ther. 2013;14:557-63.
Betting DJ, Yamada RE, Kafi K, Said J, van Rooijen N, Timmerman JM. Intratumoral
but not systemic delivery of CpG oligodeoxynucleotide augments the efficacy of
anti-CD20 monoclonal antibody therapy against B cell lymphoma. J Immunother.
2009;32:622-31.
Biela BH, Khawli LA, Hu P, Epstein AL. Chimeric TNT-3/human beta-glucuronidase
fusion proteins for antibody-directed enzyme prodrug therapy (ADEPT). Cancer
Biother Radiopharm. 2003;18:339-53.
Bird RP, Draper HH. Effect of malonaldehyde and acetaldehyde on cultured mammalian
cells: Growth, morphology, and synthesis of macromolecules. J Toxicol Environ
Health. 1980;6:811-23.
Bleich A, Janus LM, Smoczek A, Westendorf AM, Strauch U, Mahler M, Hedrich HJ,
Fichtner-Feigl S, Scholmerich J, Falk W, Hofmann C, Obermeier F. CpG motifs
of bacterial DNA exert protective effects in mouse models of IBD by antigen-
independent tolerance induction. Gastroenterology. 2009;136:278-87.
Boeggeman E, Ramakrishnan B, Pasek M, Manzoni M, Puri A, Loomis KH, Waybright
TJ, Qasba PK. Site specific conjugation of fluoroprobes to the remodeled Fc N-
glycans of monoclonal antibodies using mutant glycosyltransferases: application
for cell surface antigen detection. Bioconjug Chem. 2009;20:1228-36.
Bottini A, Berruti A, Bersiga A, Brizzi MP, Allevi G, Bolsi G, Aguggini S, Brunelli A,
Betri E, Generali D, Scaratti L, Bertoli G, Alquati P, Dogliotti L. Changes in
microvessel density as assessed by CD34 antibodies after primary chemotherapy
in human breast cancer. Clin Cancer Res. 2002;8:1816-21.
Bourquin C, Schreiber S, Beck S, Hartmann G, Endres S. Immunotherapy with dendritic
cells and CpG oligonucleotides can be combined with chemotherapy without loss
of efficacy in a mouse model of colon cancer. Int J Cancer. 2006;118:2790-5.
Braumuller H, Wieder T, Brenner E, Assmann S, Hahn M, Alkhaled M, Schilbach K,
Essmann F, Kneilling M, Griessinger C, Ranta F, Ullrich S, Mocikat R, Braungart
K, Mehra T, Fehrenbacher B, Berdel J, Niessner H, Meier F, van den Broek M,
Haring HU, Handgretinger R, Quintanilla-Martinez L, Fend F, Pesic M, Bauer J,
Zender L, Schaller M, Schulze-Osthoff K, Rocken M. T-helper-1-cell cytokines
drive cancer into senescence. Nature. 2013;494:361-5.
Buhtoiarov IN, Sondel PM, Wigginton JM, Buhtoiarova TN, Yanke EM, Mahvi DA,
Rakhmilevich AL. Anti-tumour synergy of cytotoxic chemotherapy and anti-
CD40 plus CpG-ODN immunotherapy through repolarization of tumour-
associated macrophages. Immunology. 2011;132:226-39.

145

Burnet FM. Immunological aspects of malignant disease. Lancet. 1967;1:1171-4.
Carpentier A, Laigle-Donadey F, Zohar S, Capelle L, Behin A, Tibi A, Martin-
Duverneuil N, Sanson M, Lacomblez L, Taillibert S, Puybasset L, Van Effenterre
R, Delattre JY, Carpentier AF. Phase 1 trial of a CpG oligodeoxynucleotide for
patients with recurrent glioblastoma. Neuro Oncol. 2006;8:60-6.
Carpentier A, Metellus P, Ursu R, Zohar S, Lafitte F, Barrie M, Meng Y, Richard M,
Parizot C, Laigle-Donadey F, Gorochov G, Psimaras D, Sanson M, Tibi A, Chinot
O, Carpentier AF. Intracerebral administration of CpG oligonucleotide for
patients with recurrent glioblastoma: a phase II study. Neuro Oncol. 2010;12:401-
8.
Carpentier AF. [Cancer immunotherapy with CpG-ODN]. Med Sci (Paris). 2005;21:73-7.
Chace JH, Hooker NA, Mildenstein KL, Krieg AM, Cowdery JS. Bacterial DNA-induced
NK cell IFN-gamma production is dependent on macrophage secretion of IL-12.
Clin Immunol Immunopathol. 1997;84:185-93.
Chamoto K, Takeshima T, Wakita D, Ohkuri T, Ashino S, Omatsu T, Shirato H,
Kitamura H, Togashi Y, Nishimura T. Combination immunotherapy with
radiation and CpG-based tumor vaccination for the eradication of radio- and
immuno-resistant lung carcinoma cells. Cancer Sci. 2009;100:934-9.
Chen S, Yu L, Jiang C, Zhao Y, Sun D, Li S, Liao G, Chen Y, Fu Q, Tao Q, Ye D, Hu P,
Khawli LA, Taylor CR, Epstein AL, Ju DW. Pivotal study of iodine-131-labeled
chimeric tumor necrosis treatment radioimmunotherapy in patients with advanced
lung cancer. J Clin Oncol. 2005;23:1538-47.
Chennaoui M, Drogou C, Carpentier AF, Guezennec CY, Gomez-Merino D. Cytokine
content in lymphoid and white adipose tissues after repeated CpG
oligodeoxynucleotide administration in trained rats. Vaccine. 2010;28:1814-8.
Chu RS, Targoni OS, Krieg AM, Lehmann PV, Harding CV. CpG oligodeoxynucleotides
act as adjuvants that switch on T helper 1 (Th1) immunity. J Exp Med.
1997;186:1623-31.
Chumsae C, Gaza-Bulseco G, Liu H. Identification and localization of unpaired cysteine
residues in monoclonal antibodies by fluorescence labeling and mass
spectrometry. Anal Chem. 2009;81:6449-57.
Clynes RA, Towers TL, Presta LG, Ravetch JV. Inhibitory Fc receptors modulate in vivo
cytotoxicity against tumor targets. Nat Med. 2000;6:443-6.
Coley WB. II. Contribution to the Knowledge of Sarcoma. Ann Surg. 1891;14:199-220.

146

Coley WB. The Treatment of Inoperable Sarcoma by Bacterial Toxins (the Mixed Toxins
of the Streptococcus erysipelas and the Bacillus prodigiosus). Proc R Soc Med.
1910;3:1-48.
Coley WB. The treatment of malignant tumors by repeated inoculations of erysipelas.
With a report of ten original cases. 1893. Clin Orthop Relat Res. 1991:3-11.
Cosa G, Focsaneanu KS, McLean JR, McNamee JP, Scaiano JC. Photophysical
properties of fluorescent DNA-dyes bound to single- and double-stranded DNA in
aqueous buffered solution. Photochem Photobiol. 2001;73:585-99.
Cotran RS, Pober JS, Gimbrone MA, Jr., Springer TA, Wiebke EA, Gaspari AA,
Rosenberg SA, Lotze MT. Endothelial activation during interleukin 2
immunotherapy. A possible mechanism for the vascular leak syndrome. J
Immunol. 1988;140:1883-8.
Deng S, Zhu S, Qiao Y, Liu YJ, Chen W, Zhao G, Chen J. Recent advances in the role of
toll-like receptors and TLR agonists in immunotherapy for human glioma. Protein
Cell. 2014;5:899-911.
Deonarain MP. Recombinant antibodies for cancer therapy. Expert Opin Biol Ther.
2008;8:1123-41.
Desrues B, Lena H, Brichory F, Ramee MP, Toujas L, Delaval P, Dazord L. Monoclonal
antibody Po66 uptake by human lung tumours implanted in nude mice: effect of
co-administration with doxorubicin. Br J Cancer. 1995;72:1076-82.
Duffy MJ. Serum tumor markers in breast cancer: are they of clinical value? Clin Chem.
2006;52:345-51.
Dunn GP, Bruce AT, Ikeda H, Old LJ, Schreiber RD. Cancer immunoediting: from
immunosurveillance to tumor escape. Nat Immunol. 2002;3:991-8.
Duramad O, Fearon KL, Chan JH, Kanzler H, Marshall JD, Coffman RL, Barrat FJ. IL-
10 regulates plasmacytoid dendritic cell response to CpG-containing
immunostimulatory sequences. Blood. 2003;102:4487-92.
Eaton-Bassiri A, Dillon SB, Cunningham M, Rycyzyn MA, Mills J, Sarisky RT, Mbow
ML. Toll-like receptor 9 can be expressed at the cell surface of distinct
populations of tonsils and human peripheral blood mononuclear cells. Infect
Immun. 2004;72:7202-11.
Epstein AL, Chen FM, Taylor CR. A novel method for the detection of necrotic lesions in
human cancers. Cancer Res. 1988;48:5842-8.
Flanagan ML, Khawli LA, Hu P, Epstein AL. H60/TNT-3 fusion protein activates NK
cells in vitro and improves immunotherapeutic outcome in murine syngeneic
tumor models. J Immunother. 2006;29:274-83.

147

Friedberg JW, Kim H, McCauley M, Hessel EM, Sims P, Fisher DC, Nadler LM,
Coffman RL, Freedman AS. Combination immunotherapy with a CpG
oligonucleotide (1018 ISS) and rituximab in patients with non-Hodgkin
lymphoma: increased interferon-alpha/beta-inducible gene expression, without
significant toxicity. Blood. 2005;105:489-95.
Gekeler V, Gimmnich P, Hofmann HP, Grebe C, Rommele M, Leja A, Baudler M,
Benimetskaya L, Gonser B, Pieles U, Maier T, Wagner T, Sanders K, Beck JF,
Hanauer G, Stein CA. G3139 and other CpG-containing immunostimulatory
phosphorothioate oligodeoxynucleotides are potent suppressors of the growth of
human tumor xenografts in nude mice. Oligonucleotides. 2006;16:83-93.
Gelman AE, LaRosa DF, Zhang J, Walsh PT, Choi Y, Sunyer JO, Turka LA. The adaptor
molecule MyD88 activates PI-3 kinase signaling in CD4+ T cells and enables
CpG oligodeoxynucleotide-mediated costimulation. Immunity. 2006;25:783-93.
Ghiringhelli F, Larmonier N, Schmitt E, Parcellier A, Cathelin D, Garrido C, Chauffert
B, Solary E, Bonnotte B, Martin F. CD4+CD25+ regulatory T cells suppress
tumor immunity but are sensitive to cyclophosphamide which allows
immunotherapy of established tumors to be curative. Eur J Immunol.
2004;34:336-44.
Gillessen S, Gnad-Vogt US, Gallerani E, Beck J, Sessa C, Omlin A, Mattiacci MR,
Liedert B, Kramer D, Laurent J, Speiser DE, Stupp R. A phase I dose-escalation
study of the immunocytokine EMD 521873 (Selectikine) in patients with
advanced solid tumours. Eur J Cancer. 2013;49:35-44.
Gillies SD, Lan Y, Hettmann T, Brunkhorst B, Sun Y, Mueller SO, Lo KM. A low-
toxicity IL-2-based immunocytokine retains antitumor activity despite its high
degree of IL-2 receptor selectivity. Clin Cancer Res. 2011;17:3673-85.
Gnjatic S, Sawhney NB, Bhardwaj N. Toll-like receptor agonists: are they good
adjuvants? Cancer J. 2010;16:382-91.
Goldstein MJ, Varghese B, Brody JD, Rajapaksa R, Kohrt H, Czerwinski DK, Levy S,
Levy R. A CpG-loaded tumor cell vaccine induces antitumor CD4+ T cells that
are effective in adoptive therapy for large and established tumors. Blood.
2011;117:118-27.
Goto S, Goto H, Tanoshima R, Kato H, Takahashi H, Sekiguchi O, Kai S. Serum
sickness with an elevated level of human anti-chimeric antibody following
treatment with rituximab in a child with chronic immune thrombocytopenic
purpura. Int J Hematol. 2009;89:305-9.
Griffon-Etienne G, Boucher Y, Brekken C, Suit HD, Jain RK. Taxane-induced apoptosis
decompresses blood vessels and lowers interstitial fluid pressure in solid tumors:
clinical implications. Cancer Res. 1999;59:3776-82.

148

Hanagata N. Structure-dependent immunostimulatory effect of CpG
oligodeoxynucleotides and their delivery system. Int J Nanomedicine.
2012;7:2181-95.
Hanahan D, Weinberg RA. Hallmarks of cancer: the next generation. Cell. 2011;144:646-
74.
Hardie AD, Rieter WJ, Bradshaw ML, Gordon LL, Young MA, Keane TE. Improved
performance of SPECT-CT In-111 capromab pendetide by correlation with
diffusion-weighted magnetic resonance imaging for identifying metastatic pelvic
lymphadenopathy in prostate cancer. World J Urol. 2013.
Hartmann G, Krieg AM. CpG DNA and LPS induce distinct patterns of activation in
human monocytes. Gene Ther. 1999;6:893-903.
Hartmann G, Weiner GJ, Krieg AM. CpG DNA: a potent signal for growth, activation,
and maturation of human dendritic cells. Proc Natl Acad Sci U S A.
1999;96:9305-10.
Hayashi F, Means TK, Luster AD. Toll-like receptors stimulate human neutrophil
function. Blood. 2003;102:2660-9.
Hdeib A, Sloan A. Targeted radioimmunotherapy: the role of (1)(3)(1)I-chTNT-1/B mAb
(Cotara) for treatment of high-grade gliomas. Future Oncol. 2012;8:659-69.
Heckelsmiller K, Beck S, Rall K, Sipos B, Schlamp A, Tuma E, Rothenfusser S, Endres
S, Hartmann G. Combined dendritic cell- and CpG oligonucleotide-based immune
therapy cures large murine tumors that resist chemotherapy. Eur J Immunol.
2002;32:3235-45.
Heckelsmiller K, Rall K, Beck S, Schlamp A, Seiderer J, Jahrsdorfer B, Krug A,
Rothenfusser S, Endres S, Hartmann G. Peritumoral CpG DNA elicits a
coordinated response of CD8 T cells and innate effectors to cure established
tumors in a murine colon carcinoma model. J Immunol. 2002;169:3892-9.
Hirsh V, Paz-Ares L, Boyer M, Rosell R, Middleton G, Eberhardt WE, Szczesna A,
Reiterer P, Saleh M, Arrieta O, Bajetta E, Webb RT, Raats J, Benner RJ, Fowst C,
Meech SJ, Readett D, Schiller JH. Randomized phase III trial of
paclitaxel/carboplatin with or without PF-3512676 (Toll-like receptor 9 agonist)
as first-line treatment for advanced non-small-cell lung cancer. J Clin Oncol.
2011;29:2667-74.
Hofmann MA, Kors C, Audring H, Walden P, Sterry W, Trefzer U. Phase 1 evaluation of
intralesionally injected TLR9-agonist PF-3512676 in patients with basal cell
carcinoma or metastatic melanoma. J Immunother. 2008;31:520-7.

149

Holtick U, Klein-Gonzalez N, von Bergwelt-Baildon MS. Potential of Toll-like receptor
9 agonists in combined anticancer immunotherapy strategies: synergy of PAMPs
and DAMPs? Immunotherapy. 2011;3:301-4.
Holtick U, Scheulen ME, von Bergwelt-Baildon MS, Weihrauch MR. Toll-like receptor 9
agonists as cancer therapeutics. Expert Opin Investig Drugs. 2011;20:361-72.
Hornick JL, Khawli LA, Hu P, Sharifi J, Khanna C, Epstein AL. Pretreatment with a
monoclonal antibody/interleukin-2 fusion protein directed against DNA enhances
the delivery of therapeutic molecules to solid tumors. Clin Cancer Res.
1999;5:51-60.
Hornick JL, Sharifi J, Khawli LA, Hu P, Bai WG, Alauddin MM, Mizokami MM,
Epstein AL. Single amino acid substitution in the Fc region of chimeric TNT-3
antibody accelerates clearance and improves immunoscintigraphy of solid tumors.
J Nucl Med. 2000;41:355-62.
Hornick JL, Sharifi J, Khawli LA, Hu P, Biela BH, Mizokami MM, Yun A, Taylor CR,
Epstein AL. A new chemically modified chimeric TNT-3 monoclonal antibody
directed against DNA for the radioimmunotherapy of solid tumors. Cancer
Biother Radiopharm. 1998;13:255-68.
Houot R, Levy R. T-cell modulation combined with intratumoral CpG cures lymphoma
in a mouse model without the need for chemotherapy. Blood. 2009;113:3546-52.
Hu P, Arias RS, Sadun RE, Nien YC, Zhang N, Sabzevari H, Lutsiak ME, Khawli LA,
Epstein AL. Construction and preclinical characterization of Fc-mGITRL for the
immunotherapy of cancer. Clin Cancer Res. 2008;14:579-88.
Hurvitz S, Pegram M, Lin L, Chan D, Allen H, Dichmann R, Hagenstad C, Barstis J,
Hermann R, Hu E, Moroose R. Final results of a phase II trial evaluating
trastuzumab and bevacizumab as first line treatment of HER2-amplified advanced
breast cancer. Cancer Res. 2009;24:854s (Abstract #6094).
Iwasaki A, Medzhitov R. Toll-like receptor control of the adaptive immune responses.
Nat Immunol. 2004;5:987-95.
Jacobson B, Moy B, Farraye F. Surveillance after colorectal cancer resection. In: Basow
D, editor. UpToDate. Waltham, MA; 2013.
Jakob T, Walker PS, Krieg AM, von Stebut E, Udey MC, Vogel JC. Bacterial DNA and
CpG-containing oligodeoxynucleotides activate cutaneous dendritic cells and
induce IL-12 production: implications for the augmentation of Th1 responses. Int
Arch Allergy Immunol. 1999;118:457-61.
Jang JK, Khawli LA, Park R, Wu BW, Li Z, Canter D, Conti PS, Epstein AL.
Cytoreductive chemotherapy improves the biodistribution of antibodies directed

150

against tumor necrosis in murine solid tumor models. Mol Cancer Ther.
2013;12:2827-36.
Johnson EE, Buhtoiarov IN, Baldeshwiler MJ, Felder MA, Van Rooijen N, Sondel PM,
Rakhmilevich AL. Enhanced T-cell-independent antitumor effect of
cyclophosphamide combined with anti-CD40 mAb and CpG in mice. J
Immunother. 2011;34:76-84.
Kaczanowska S, Joseph AM, Davila E. TLR agonists: our best frenemy in cancer
immunotherapy. J Leukoc Biol. 2013;93:847-63.
Kaiga T, Sato M, Kaneda H, Iwakura Y, Takayama T, Tahara H. Systemic administration
of IL-23 induces potent antitumor immunity primarily mediated through Th1-type
response in association with the endogenously expressed IL-12. J Immunol.
2007;178:7571-80.
Kandimalla ER, Bhagat L, Yu D, Cong Y, Tang J, Agrawal S. Conjugation of ligands at
the 5'-end of CpG DNA affects immunostimulatory activity. Bioconjug Chem.
2002;13:966-74.
Karbach J, Neumann A, Wahle C, Brand K, Gnjatic S, Jager E. Therapeutic
administration of a synthetic CpG oligodeoxynucleotide triggers formation of
anti-CpG antibodies. Cancer Res. 2012;72:4304-10.
Kawarada Y, Ganss R, Garbi N, Sacher T, Arnold B, Hammerling GJ. NK- and CD8(+)
T cell-mediated eradication of established tumors by peritumoral injection of
CpG-containing oligodeoxynucleotides. J Immunol. 2001;167:5247-53.
Kerkmann M, Costa LT, Richter C, Rothenfusser S, Battiany J, Hornung V, Johnson J,
Englert S, Ketterer T, Heckl W, Thalhammer S, Endres S, Hartmann G.
Spontaneous formation of nucleic acid-based nanoparticles is responsible for high
interferon-alpha induction by CpG-A in plasmacytoid dendritic cells. J Biol
Chem. 2005;280:8086-93.
Khanna R. Tumour surveillance: missing peptides and MHC molecules. Immunol Cell
Biol. 1998;76:20-6.
Khawli LA, Biela B, Hu P, Epstein AL. Comparison of recombinant derivatives of
chimeric TNT-3 antibody for the radioimaging of solid tumors. Hybrid
Hybridomics. 2003;22:1-9.
Khawli LA, Biela BH, Hu P, Epstein AL. Stable, genetically engineered F(ab')(2)
fragments of chimeric TNT-3 expressed in mammalian cells. Hybrid
Hybridomics. 2002;21:11-8.
Khawli LA, Hu P, Epstein AL. NHS76/PEP2, a fully human vasopermeability-enhancing
agent to increase the uptake and efficacy of cancer chemotherapy. Clin Cancer
Res. 2005;11:3084-93.

151

Khawli LA, Mizokami MM, Sharifi J, Hu P, Epstein AL. Pharmacokinetic characteristics
and biodistribution of radioiodinated chimeric TNT-1, -2, and -3 monoclonal
antibodies after chemical modification with biotin. Cancer Biother Radiopharm.
2002;17:359-70.
Kim R, Emi M, Tanabe K. Cancer immunoediting from immune surveillance to immune
escape. Immunology. 2007;121:1-14.
Klinman DM. Immunotherapeutic uses of CpG oligodeoxynucleotides. Nat Rev Immunol.
2004;4:249-58.
Krieg AM. CpG motifs in bacterial DNA and their immune effects. Annu Rev Immunol.
2002;20:709-60.
Krieg AM. From A to Z on CpG. Trends Immunol. 2002;23:64-5.
Krieg AM. Therapeutic potential of Toll-like receptor 9 activation. Nat Rev Drug Discov.
2006;5:471-84.
Krieg AM. CpG still rocks! Update on an accidental drug. Nucleic Acid Ther.
2012;22:77-89.
Krieg AM, Efler SM, Wittpoth M, Al Adhami MJ, Davis HL. Induction of systemic
TH1-like innate immunity in normal volunteers following subcutaneous but not
intravenous administration of CPG 7909, a synthetic B-class CpG
oligodeoxynucleotide TLR9 agonist. J Immunother. 2004;27:460-71.
Krieg AM, Yi AK, Matson S, Waldschmidt TJ, Bishop GA, Teasdale R, Koretzky GA,
Klinman DM. CpG motifs in bacterial DNA trigger direct B-cell activation.
Nature. 1995;374:546-9.
Krug A, Rothenfusser S, Hornung V, Jahrsdorfer B, Blackwell S, Ballas ZK, Endres S,
Krieg AM, Hartmann G. Identification of CpG oligonucleotide sequences with
high induction of IFN-alpha/beta in plasmacytoid dendritic cells. Eur J Immunol.
2001;31:2154-63.
Laurent J, Touvrey C, Gillessen S, Joffraud M, Vicari M, Bertrand C, Ongarello S,
Liedert B, Gallerani E, Beck J, Omlin A, Sessa C, Quaratino S, Stupp R, Gnad-
Vogt US, Speiser DE. T-cell activation by treatment of cancer patients with EMD
521873 (Selectikine), an IL-2/anti-DNA fusion protein. J Transl Med. 2013;11:5.
LeBerthon B, Khawli LA, Alauddin M, Miller GK, Charak BS, Mazumder A, Epstein
AL. Enhanced tumor uptake of macromolecules induced by a novel vasoactive
interleukin 2 immunoconjugate. Cancer Res. 1991;51:2694-8.
Lechner MG, Karimi SS, Barry-Holson K, Angell TE, Murphy KA, Church CH, Ohlfest
JR, Hu P, Epstein AL. Immunogenicity of murine solid tumor models as a

152

defining feature of in vivo behavior and response to immunotherapy. J
Immunother. 2013;36:477-89.
Lechner MG, Russell SM, Bass RS, Epstein AL. Chemokines, costimulatory molecules
and fusion proteins for the immunotherapy of solid tumors. Immunotherapy.
2011;3:1317-40.
Leonard JP, Link BK, Emmanouilides C, Gregory SA, Weisdorf D, Andrey J,
Hainsworth J, Sparano JA, Tsai DE, Horning S, Krieg AM, Weiner GJ. Phase I
trial of toll-like receptor 9 agonist PF-3512676 with and following rituximab in
patients with recurrent indolent and aggressive non Hodgkin's lymphoma. Clin
Cancer Res. 2007;13:6168-74.
Li J, Hu P, Khawli LA, Epstein AL. Complete regression of experimental solid tumors by
combination LEC/chTNT-3 immunotherapy and CD25(+) T-cell depletion.
Cancer Res. 2003;63:8384-92.
Li J, Hu P, Khawli LA, Epstein AL. LEC/chTNT-3 fusion protein for the immunotherapy
of experimental solid tumors. J Immunother. 2003;26:320-31.
Li J, Hu P, Khawli LA, Yun A, Epstein AL. chTNT-3/hu IL-12 fusion protein for the
immunotherapy of experimental solid tumors. Hybrid Hybridomics. 2004;23:1-10.
Li Z, Jang JK, Lechner MG, Hu P, Khawli L, Scannell CA, Epstein AL. Generation of
tumor-targeted antibody-CpG conjugates. J Immunol Methods. 2013;389:45-51.
Li Z, Jin Q, Huang C, Dasa S, Chen L, Yap LP, Liu S, Cai H, Park R, Conti PS.
Trackable and Targeted Phage as Positron Emission Tomography (PET) Agent
for Cancer Imaging. Theranostics. 2011;1:371-80.
Li ZB, Cai W, Cao Q, Chen K, Wu Z, He L, Chen X. (64)Cu-labeled tetrameric and
octameric RGD peptides for small-animal PET of tumor alpha(v)beta(3) integrin
expression. J Nucl Med. 2007;48:1162-71.
Lilja H, Ulmert D, Vickers AJ. Prostate-specific antigen and prostate cancer: prediction,
detection and monitoring. Nat Rev Cancer. 2008;8:268-78.
Lim SH, Beers SA, French RR, Johnson PW, Glennie MJ, Cragg MS. Anti-CD20
monoclonal antibodies: historical and future perspectives. Haematologica.
2010;95:135-43.
Link BK, Ballas ZK, Weisdorf D, Wooldridge JE, Bossler AD, Shannon M, Rasmussen
WL, Krieg AM, Weiner GJ. Oligodeoxynucleotide CpG 7909 delivered as
intravenous infusion demonstrates immunologic modulation in patients with
previously treated non-Hodgkin lymphoma. J Immunother. 2006;29:558-68.
Liu A, Hu P, Khawli LA, Epstein AL. Combination B7-Fc fusion protein treatment and
Treg cell depletion therapy. Clin Cancer Res. 2005;11:8492-502.

153

Liu A, Hu P, Khawli LA, Epstein AL. B7.1/NHS76: a new costimulator fusion protein
for the immunotherapy of solid tumors. J Immunother. 2006;29:425-35.
Liu P, Zhang C, Chen J, Zhang R, Ren J, Huang Y, Zhu F, Li Z, Wu G. Combinational
therapy of interferon-alpha and chemotherapy normalizes tumor vasculature by
regulating pericytes including the novel marker RGS5 in melanoma. J
Immunother. 2011;34:320-6.
Liu S, Li Z, Yap LP, Huang CW, Park R, Conti PS. Efficient preparation and biological
evaluation of a novel multivalency bifunctional chelator for 64Cu
radiopharmaceuticals. Chemistry. 2011;17:10222-5.
Liu Y, Zeng G. Cancer and innate immune system interactions: translational potentials
for cancer immunotherapy. J Immunother. 2012;35:299-308.
Lo CH, Lee SC, Wu PY, Pan WY, Su J, Cheng CW, Roffler SR, Chiang BL, Lee CN,
Wu CW, Tao MH. Antitumor and antimetastatic activity of IL-23. J Immunol.
2003;171:600-7.
Loening AM, Gambhir SS. AMIDE: a free software tool for multimodality medical
image analysis. Mol Imaging. 2003;2:131-7.
Lonsdorf AS, Kuekrek H, Stern BV, Boehm BO, Lehmann PV, Tary-Lehmann M.
Intratumor CpG-oligodeoxynucleotide injection induces protective antitumor T
cell immunity. J Immunol. 2003;171:3941-6.
Lou Y, Liu C, Lizee G, Peng W, Xu C, Ye Y, Rabinovich BA, Hailemichael Y, Gelbard
A, Zhou D, Overwijk WW, Hwu P. Antitumor activity mediated by CpG: the
route of administration is critical. J Immunother. 2011;34:279-88.
Lunardon L, Payne AS. Inhibitory human antichimeric antibodies to rituximab in a
patient with pemphigus. J Allergy Clin Immunol. 2012;130:800-3.
Lund JM, Alexopoulou L, Sato A, Karow M, Adams NC, Gale NW, Iwasaki A, Flavell
RA. Recognition of single-stranded RNA viruses by Toll-like receptor 7. Proc
Natl Acad Sci U S A. 2004;101:5598-603.
Manegold C, Gravenor D, Woytowitz D, Mezger J, Hirsh V, Albert G, Al-Adhami M,
Readett D, Krieg AM, Leichman CG. Randomized phase II trial of a toll-like
receptor 9 agonist oligodeoxynucleotide, PF-3512676, in combination with first-
line taxane plus platinum chemotherapy for advanced-stage non-small-cell lung
cancer. J Clin Oncol. 2008;26:3979-86.
Manegold C, van Zandwijk N, Szczesna A, Zatloukal P, Au JS, Blasinska-Morawiec M,
Serwatowski P, Krzakowski M, Jassem J, Tan EH, Benner RJ, Ingrosso A, Meech
SJ, Readett D, Thatcher N. A phase III randomized study of gemcitabine and
cisplatin with or without PF-3512676 (TLR9 agonist) as first-line treatment of
advanced non-small-cell lung cancer. Ann Oncol. 2012;23:72-7.

154

Mangsbo SM, Sandin LC, Anger K, Korman AJ, Loskog A, Totterman TH. Enhanced
tumor eradication by combining CTLA-4 or PD-1 blockade with CpG therapy. J
Immunother. 2010;33:225-35.
Mankai A, Buhe V, Hammadi M, Youinou P, Ghedira I, Berthou C, Bordron A.
Improvement of rituximab efficiency in chronic lymphocytic leukemia by CpG-
mediated upregulation of CD20 expression independently of PU.1. Ann N Y Acad
Sci. 2009;1173:721-8.
Mason KA, Ariga H, Neal R, Valdecanas D, Hunter N, Krieg AM, Whisnant JK, Milas
L. Targeting toll-like receptor 9 with CpG oligodeoxynucleotides enhances tumor
response to fractionated radiotherapy. Clin Cancer Res. 2005;11:361-9.
Mauch P, Friedberg, JW. Monitoring of the patient with classical Hodgkin's Lymphoma
during and after treatment. In: Basow D, editor. UpToDate. Wiltham, MA; 2013.
Meng Y, Carpentier AF, Chen L, Boisserie G, Simon JM, Mazeron JJ, Delattre JY.
Successful combination of local CpG-ODN and radiotherapy in malignant glioma.
Int J Cancer. 2005;116:992-7.
Milas L, Mason KA, Ariga H, Hunter N, Neal R, Valdecanas D, Krieg AM, Whisnant
JK. CpG oligodeoxynucleotide enhances tumor response to radiation. Cancer Res.
2004;64:5074-7.
Miller GK, Naeve GS, Gaffar SA, Epstein AL. Immunologic and biochemical analysis of
TNT-1 and TNT-2 monoclonal antibody binding to histones. Hybridoma.
1993;12:689-98.
Mizokami MM, Hu P, Khawli LA, Li J, Epstein AL. Chimeric TNT-3 antibody/murine
interferon-gamma fusion protein for the immunotherapy of solid malignancies.
Hybrid Hybridomics. 2003;22:197-207.
Molenkamp BG, van Leeuwen PA, Meijer S, Sluijter BJ, Wijnands PG, Baars A, van den
Eertwegh AJ, Scheper RJ, de Gruijl TD. Intradermal CpG-B activates both
plasmacytoid and myeloid dendritic cells in the sentinel lymph node of melanoma
patients. Clin Cancer Res. 2007;13:2961-9.
Monjazeb AM, Zamora AE, Grossenbacher SK, Mirsoian A, Sckisel GD, Murphy WJ.
Immunoediting and antigen loss: overcoming the achilles heel of immunotherapy
with antigen non-specific therapies. Front Oncol. 2013;3:197.
Murad YM, Clay TM. CpG oligodeoxynucleotides as TLR9 agonists: therapeutic
applications in cancer. BioDrugs. 2009;23:361-75.
Nakamura K, Kubo A. Effect of interleukin-2 on the biodistribution of technetium-99m-
labelled anti-CEA monoclonal antibody in mice bearing human tumour
xenografts. Eur J Nucl Med. 1994;21:924-9.

155

Nakamura K, Kubo A. Biodistribution of iodine-125 labeled monoclonal
antibody/interleukin-2 immunoconjugate in athymic mice bearing human tumor
xenografts. Cancer. 1997;80:2650-5.
Natsume A, Niwa R, Satoh M. Improving effector functions of antibodies for cancer
treatment: Enhancing ADCC and CDC. Drug Des Devel Ther. 2009;3:7-16.
Nauts HC, Swift WE, Coley BL. The treatment of malignant tumors by bacterial toxins
as developed by the late William B. Coley, M.D., reviewed in the light of modern
research. Cancer Res. 1946;6:205-16.
Netea MG, Van der Meer JW, Sutmuller RP, Adema GJ, Kullberg BJ. From the Th1/Th2
paradigm towards a Toll-like receptor/T-helper bias. Antimicrob Agents
Chemother. 2005;49:3991-6.
Noguchi T, Kato T, Wang L, Maeda Y, Ikeda H, Sato E, Knuth A, Gnjatic S, Ritter G,
Sakaguchi S, Old LJ, Shiku H, Nishikawa H. Intracellular tumor-associated
antigens represent effective targets for passive immunotherapy. Cancer Res.
2012;72:1672-82.
Oelschlaeger TA. Bacteria as tumor therapeutics? Bioeng Bugs. 2010;1:146-7.
Oft M. IL-10: master switch from tumor-promoting inflammation to antitumor immunity.
Cancer Immunol Res. 2014;2:194-9.
Olbert PJ, Schrader AJ, Hofmann R, Hegele A. [Immunostimulatory CpG
oligodeoxynucleotides (CpG-ODN) in an orthotopic murine transitional cell
carcinoma (TCC) model. Effect on local cytokine expression]. Urologe A.
2008;47:1133-4, 6.
Palma E, Cho MJ. Improved systemic pharmacokinetics, biodistribution, and antitumor
activity of CpG oligodeoxynucleotides complexed to endogenous antibodies in
vivo. J Control Release. 2007;120:95-103.
Panigrahy D, Kaipainen A, Butterfield CE, Chaponis DM, Laforme AM, Folkman J,
Kieran MW. Inhibition of tumor angiogenesis by oral etoposide. Exp Ther Med.
2010;1:739-46.
Panowksi S, Bhakta S, Raab H, Polakis P, Junutula JR. Site-specific antibody drug
conjugates for cancer therapy. MAbs. 2014;6:34-45.
Pashenkov M, Goess G, Wagner C, Hormann M, Jandl T, Moser A, Britten CM, Smolle
J, Koller S, Mauch C, Tantcheva-Poor I, Grabbe S, Loquai C, Esser S, Franckson
T, Schneeberger A, Haarmann C, Krieg AM, Stingl G, Wagner SN. Phase II trial
of a toll-like receptor 9-activating oligonucleotide in patients with metastatic
melanoma. J Clin Oncol. 2006;24:5716-24.

156

Pastuskovas CV, Mundo EE, Williams SP, Nayak TK, Ho J, Ulufatu S, Clark S, Ross S,
Cheng E, Parsons-Reponte K, Cain G, Van Hoy M, Majidy N, Bheddah S, dela
Cruz Chuh J, Kozak KR, Lewin-Koh N, Nauka P, Bumbaca D, Sliwkowski M,
Tibbitts J, Theil FP, Fielder PJ, Khawli LA, Boswell CA. Effects of anti-VEGF
on pharmacokinetics, biodistribution, and tumor penetration of trastuzumab in a
preclinical breast cancer model. Mol Cancer Ther. 2012;11:752-62.
Petrangolini G, Tortoreto M, Perego P, Carenini N, De Cesare M, Balsari A, Zunino F,
Pratesi G. Combination of metronomic gimatecan and CpG-
oligodeoxynucleotides against an orthotopic pancreatic cancer xenograft. Cancer
Biol Ther. 2008;7:596-601.
Phaeton R, Wang XG, Einstein MH, Goldberg GL, Casadevall A, Dadachova E. The
influence of proteasome inhibitor MG132, external radiation, and unlabeled
antibody on the tumor uptake and biodistribution of (188)re-labeled anti-E6 C1P5
antibody in cervical cancer in mice. Cancer. 2010;116:1067-74.
Pol JG, Marguerie M, Arulanandam R, Bell JC, Lichty BD. Panorama from the oncolytic
virotherapy summit. Mol Ther. 2013;21:1814-8.
Pratesi G, Petrangolini G, Tortoreto M, Addis A, Belluco S, Rossini A, Selleri S, Rumio
C, Menard S, Balsari A. Therapeutic synergism of gemcitabine and CpG-
oligodeoxynucleotides in an orthotopic human pancreatic carcinoma xenograft.
Cancer Res. 2005;65:6388-93.
Ramakrishnan B, Boeggeman E, Manzoni M, Zhu Z, Loomis K, Puri A, Dimitrov DS,
Qasba PK. Multiple site-specific in vitro labeling of single-chain antibody.
Bioconjug Chem. 2009;20:1383-9.
Rayburn ER, Wang W, Zhang R, Wang H. Experimental therapy for colon cancer: anti-
cancer effects of TLR9 agonism, combination with other therapeutic modalities,
and dependence upon p53. Int J Oncol. 2007;30:1511-9.
Reinis M, Simova J, Indrova M, Bieblova J, Bubenik J. CpG oligodeoxynucleotides are
effective in therapy of minimal residual tumour disease after chemotherapy or
surgery in a murine model of MHC class I-deficient, HPV16-associated tumours.
Int J Oncol. 2007;30:1247-51.
Ritter G, Cohen LS, Williams C, Jr., Richards EC, Old LJ, Welt S. Serological analysis
of human anti-human antibody responses in colon cancer patients treated with
repeated doses of humanized monoclonal antibody A33. Cancer Res.
2001;61:6851-9.
Roda JM, Parihar R, Carson WE, 3rd. CpG-containing oligodeoxynucleotides act through
TLR9 to enhance the NK cell cytokine response to antibody-coated tumor cells. J
Immunol. 2005;175:1619-27.

157

Rosenberg SA, Yang JC, Topalian SL, Schwartzentruber DJ, Weber JS, Parkinson DR,
Seipp CA, Einhorn JH, White DE. Treatment of 283 consecutive patients with
metastatic melanoma or renal cell cancer using high-dose bolus interleukin 2.
JAMA. 1994;271:907-13.
Roy Chaudhuri T, Arnold RD, Yang J, Turowski SG, Qu Y, Spernyak JA, Mazurchuk R,
Mager DE, Straubinger RM. Mechanisms of tumor vascular priming by a
nanoparticulate doxorubicin formulation. Pharm Res. 2012;29:3312-24.
Saba N. Post-treatment surveillance of squamous carcinoma of head and neck. In: Basow
D, editor. UpToDate. Waltham, MA; 2013.
Sadun RE, Hsu WE, Zhang N, Nien YC, Bergfeld SA, Sabzevari H, Lutsiak ME, Khawli
L, Hu P, Epstein AL. Fc-mOX40L fusion protein produces complete remission
and enhanced survival in 2 murine tumor models. J Immunother. 2008;31:235-45.
Saikh KU, Kissner TL, Sultana A, Ruthel G, Ulrich RG. Human monocytes infected with
Yersinia pestis express cell surface TLR9 and differentiate into dendritic cells. J
Immunol. 2004;173:7426-34.
Sanjuan MA, Rao N, Lai KT, Gu Y, Sun S, Fuchs A, Fung-Leung WP, Colonna M,
Karlsson L. CpG-induced tyrosine phosphorylation occurs via a TLR9-
independent mechanism and is required for cytokine secretion. J Cell Biol.
2006;172:1057-68.
Sato A, Iwasaki A. Induction of antiviral immunity requires Toll-like receptor signaling
in both stromal and dendritic cell compartments. Proc Natl Acad Sci U S A.
2004;101:16274-9.
Schettini J, Kidiyoor A, Besmer DM, Tinder TL, Roy LD, Lustgarten J, Gendler SJ,
Mukherjee P. Intratumoral delivery of CpG-conjugated anti-MUC1 antibody
enhances NK cell anti-tumor activity. Cancer Immunol Immunother.
2012;61:2055-65.
Schmitt E, Parcellier A, Ghiringhelli F, Casares N, Gurbuxani S, Droin N, Hamai A,
Pequignot M, Hammann A, Moutet M, Fromentin A, Kroemer G, Solary E,
Garrido C. Increased immunogenicity of colon cancer cells by selective depletion
of cytochrome C. Cancer Res. 2004;64:2705-11.
Schneider CA, Rasband WS, Eliceiri KW. NIH Image to ImageJ: 25 years of image
analysis. Nat Methods. 2012;9:671-5.
Schreiber TH, Raez L, Rosenblatt JD, Podack ER. Tumor immunogenicity and
responsiveness to cancer vaccine therapy: the state of the art. Semin Immunol.
2010;22:105-12.
Scott AM, Larson SM. Tumor imaging and therapy. Radiol Clin North Am. 1993;31:859-
79.

158

Sen D, Gilbert W. Formation of parallel four-stranded complexes by guanine-rich motifs
in DNA and its implications for meiosis. Nature. 1988;334:364-6.
Sersa G, Krzic M, Sentjurc M, Ivanusa T, Beravs K, Cemazar M, Auersperg M, Swartz
HM. Reduced tumor oxygenation by treatment with vinblastine. Cancer Res.
2001;61:4266-71.
Shanker A, Marincola FM. Cooperativity of adaptive and innate immunity: implications
for cancer therapy. Cancer Immunol Immunother. 2011;60:1061-74.
Sharifi J, Khawli LA, Hu P, King S, Epstein AL. Characterization of a phage display-
derived human monoclonal antibody (NHS76) counterpart to chimeric TNT-1
directed against necrotic regions of solid tumors. Hybrid Hybridomics.
2001;20:305-12.
Sharifi J, Khawli LA, Hu P, Li J, Epstein AL. Generation of human interferon gamma
and tumor Necrosis factor alpha chimeric TNT-3 fusion proteins. Hybrid
Hybridomics. 2002;21:421-32.
Sharma S, Dominguez AL, Manrique SZ, Cavallo F, Sakaguchi S, Lustgarten J. Systemic
targeting of CpG-ODN to the tumor microenvironment with anti-neu-CpG hybrid
molecule and T regulatory cell depletion induces memory responses in BALB-
neuT tolerant mice. Cancer Res. 2008;68:7530-40.
Sharma S, Karakousis CP, Takita H, Shin K, Brooks SP. Intra-tumoral injection of CpG
results in the inhibition of tumor growth in murine Colon-26 and B-16 tumors.
Biotechnol Lett. 2003;25:149-53.
Shirota H, Klinman DM. Effect of CpG ODN on monocytic myeloid derived suppressor
cells. Oncoimmunology. 2012;1:780-2.
Shirota Y, Shirota H, Klinman DM. Intratumoral injection of CpG oligonucleotides
induces the differentiation and reduces the immunosuppressive activity of
myeloid-derived suppressor cells. J Immunol. 2012;188:1592-9.
Smith JD, Hornick PI, Rasmi N, Rose ML, Yacoub MH. Effect of HLA mismatching and
antibody status on "homovital" aortic valve homograft performance. Ann Thorac
Surg. 1998;66:S212-5.
Sommariva M, De Cecco L, De Cesare M, Sfondrini L, Menard S, Melani C, Delia D,
Zaffaroni N, Pratesi G, Uva V, Tagliabue E, Balsari A. TLR9 agonists oppositely
modulate DNA repair genes in tumor versus immune cells and enhance
chemotherapy effects. Cancer Res. 2011;71:6382-90.
Staerz UD, Kanagawa O, Bevan MJ. Hybrid antibodies can target sites for attack by T
cells. Nature. 1985;314:628-31.
Swann JB, Smyth MJ. Immune surveillance of tumors. J Clin Invest. 2007;117:1137-46.

159

Teng MW, Andrews DM, McLaughlin N, von Scheidt B, Ngiow SF, Moller A, Hill GR,
Iwakura Y, Oft M, Smyth MJ. IL-23 suppresses innate immune response
independently of IL-17A during carcinogenesis and metastasis. Proc Natl Acad
Sci U S A. 2010;107:8328-33.
Thompson JA, Kuzel T, Drucker BJ, Urba WJ, Bukowski RM. Safety and efficacy of PF-
3512676 for the treatment of stage IV renal cell carcinoma: an open-label,
multicenter phase I/II study. Clin Genitourin Cancer. 2009;7:E58-65.
Tokunaga T, Yamamoto H, Shimada S, Abe H, Fukuda T, Fujisawa Y, Furutani Y, Yano
O, Kataoka T, Sudo T, et al. Antitumor activity of deoxyribonucleic acid fraction
from Mycobacterium bovis BCG. I. Isolation, physicochemical characterization,
and antitumor activity. J Natl Cancer Inst. 1984;72:955-62.
Topalian SL, Hodi FS, Brahmer JR, Gettinger SN, Smith DC, McDermott DF, Powderly
JD, Carvajal RD, Sosman JA, Atkins MB, Leming PD, Spigel DR, Antonia SJ,
Horn L, Drake CG, Pardoll DM, Chen L, Sharfman WH, Anders RA, Taube JM,
McMiller TL, Xu H, Korman AJ, Jure-Kunkel M, Agrawal S, McDonald D,
Kollia GD, Gupta A, Wigginton JM, Sznol M. Safety, activity, and immune
correlates of anti-PD-1 antibody in cancer. N Engl J Med. 2012;366:2443-54.
Tzeng A, Kwan BH, Opel CF, Navaratna T, Wittrup KD. Antigen specificity can be
irrelevant to immunocytokine efficacy and biodistribution. Proc Natl Acad Sci U
S A. 2015;112:3320-5.
van den Heuvel MM, Verheij M, Boshuizen R, Belderbos J, Dingemans AM, De
Ruysscher D, Laurent J, Tighe R, Haanen J, Quaratino S. NHS-IL2 combined
with radiotherapy: preclinical rationale and phase Ib trial results in metastatic
non-small cell lung cancer following first-line chemotherapy. J Transl Med.
2015;13:32.
Van der Veldt AA, Lubberink M, Bahce I, Walraven M, de Boer MP, Greuter HN,
Hendrikse NH, Eriksson J, Windhorst AD, Postmus PE, Verheul HM, Serne EH,
Lammertsma AA, Smit EF. Rapid decrease in delivery of chemotherapy to tumors
after anti-VEGF therapy: implications for scheduling of anti-angiogenic drugs.
Cancer Cell. 2012;21:82-91.
van Ojik HH, Bevaart L, Dahle CE, Bakker A, Jansen MJ, van Vugt MJ, van de Winkel
JG, Weiner GJ. CpG-A and B oligodeoxynucleotides enhance the efficacy of
antibody therapy by activating different effector cell populations. Cancer Res.
2003;63:5595-600.
Vesely MD, Kershaw MH, Schreiber RD, Smyth MJ. Natural innate and adaptive
immunity to cancer. Annu Rev Immunol. 2011;29:235-71.
Vicari AP, Chiodoni C, Vaure C, Ait-Yahia S, Dercamp C, Matsos F, Reynard O,
Taverne C, Merle P, Colombo MP, O'Garra A, Trinchieri G, Caux C. Reversal of
tumor-induced dendritic cell paralysis by CpG immunostimulatory

160

oligonucleotide and anti-interleukin 10 receptor antibody. J Exp Med.
2002;196:541-9.
Vincent J, Mignot G, Chalmin F, Ladoire S, Bruchard M, Chevriaux A, Martin F, Apetoh
L, Rebe C, Ghiringhelli F. 5-Fluorouracil selectively kills tumor-associated
myeloid-derived suppressor cells resulting in enhanced T cell-dependent
antitumor immunity. Cancer Res. 2010;70:3052-61.
Wang H, Gou SJ, Zhao MH, Chen M. The expression of Toll-like receptors 2, 4 and 9 in
kidneys of patients with anti-neutrophil cytoplasmic antibody (ANCA)-associated
vasculitis. Clin Exp Immunol. 2014;177:603-10.
Watts ME, Woodcock M, Arnold S, Chaplin DJ. Effects of novel and conventional anti-
cancer agents on human endothelial permeability: influence of tumour secreted
factors. Anticancer Res. 1997;17:71-5.
Weber JS, Hamid O, Chasalow SD, Wu DY, Parker SM, Galbraith S, Gnjatic S, Berman
D. Ipilimumab increases activated T cells and enhances humoral immunity in
patients with advanced melanoma. J Immunother. 2012;35:89-97.
Weber JS, Zarour H, Redman B, Trefzer U, O'Day S, van den Eertwegh AJ, Marshall E,
Wagner S. Randomized phase 2/3 trial of CpG oligodeoxynucleotide PF-3512676
alone or with dacarbazine for patients with unresectable stage III and IV
melanoma. Cancer. 2009;115:3944-54.
Weigel BJ, Rodeberg DA, Krieg AM, Blazar BR. CpG oligodeoxynucleotides potentiate
the antitumor effects of chemotherapy or tumor resection in an orthotopic murine
model of rhabdomyosarcoma. Clin Cancer Res. 2003;9:3105-14.
Weiner GJ. The immunobiology and clinical potential of immunostimulatory CpG
oligodeoxynucleotides. J Leukoc Biol. 2000;68:455-63.
Weiner LM, Murray JC, Shuptrine CW. Antibody-based immunotherapy of cancer. Cell.
2012;148:1081-4.
Wiemann B, Starnes CO. Coley's toxins, tumor necrosis factor and cancer research: a
historical perspective. Pharmacol Ther. 1994;64:529-64.
Wingender G, Garbi N, Schumak B, Jungerkes F, Endl E, von Bubnoff D, Steitz J,
Striegler J, Moldenhauer G, Tuting T, Heit A, Huster KM, Takikawa O, Akira S,
Busch DH, Wagner H, Hammerling GJ, Knolle PA, Limmer A. Systemic
application of CpG-rich DNA suppresses adaptive T cell immunity via induction
of IDO. Eur J Immunol. 2006;36:12-20.
Witzig TE, Wiseman GA, Maurer MJ, Habermann TM, Micallef IN, Nowakowski GS,
Ansell SM, Colgan JP, Inwards DJ, Porrata LF, Link BK, Zent CS, Johnston PB,
Shanafelt TD, Allmer C, Asmann YW, Gupta M, Ballas ZK, Smith BJ, Weiner
GJ. A phase I trial of immunostimulatory CpG 7909 oligodeoxynucleotide and 90

161

yttrium ibritumomab tiuxetan radioimmunotherapy for relapsed B-cell non-
Hodgkin lymphoma. Am J Hematol. 2013;88:589-93.
Wolchok JD, Kluger H, Callahan MK, Postow MA, Rizvi NA, Lesokhin AM, Segal NH,
Ariyan CE, Gordon RA, Reed K, Burke MM, Caldwell A, Kronenberg SA,
Agunwamba BU, Zhang X, Lowy I, Inzunza HD, Feely W, Horak CE, Hong Q,
Korman AJ, Wigginton JM, Gupta A, Sznol M. Nivolumab plus ipilimumab in
advanced melanoma. N Engl J Med. 2013;369:122-33.
Wooldridge JE, Ballas Z, Krieg AM, Weiner GJ. Immunostimulatory
oligodeoxynucleotides containing CpG motifs enhance the efficacy of monoclonal
antibody therapy of lymphoma. Blood. 1997;89:2994-8.
Wu Y, Zhang X, Xiong Z, Cheng Z, Fisher DR, Liu S, Gambhir SS, Chen X. microPET
imaging of glioma integrin {alpha}v{beta}3 expression using (64)Cu-labeled
tetrameric RGD peptide. J Nucl Med. 2005;46:1707-18.
Yi AK, Yoon JG, Yeo SJ, Hong SC, English BK, Krieg AM. Role of mitogen-activated
protein kinases in CpG DNA-mediated IL-10 and IL-12 production: central role
of extracellular signal-regulated kinase in the negative feedback loop of the CpG
DNA-mediated Th1 response. J Immunol. 2002;168:4711-20.
Yu L, Ju DW, Chen W, Li T, Xu Z, Jiang C, Chen S, Tao Q, Ye D, Hu P, Khawli LA,
Taylor CR, Epstein AL. 131I-chTNT radioimmunotherapy of 43 patients with
advanced lung cancer. Cancer Biother Radiopharm. 2006;21:5-14.
Yuan J, Gnjatic S, Li H, Powel S, Gallardo HF, Ritter E, Ku GY, Jungbluth AA, Segal
NH, Rasalan TS, Manukian G, Xu Y, Roman RA, Terzulli SL, Heywood M,
Pogoriler E, Ritter G, Old LJ, Allison JP, Wolchok JD. CTLA-4 blockade
enhances polyfunctional NY-ESO-1 specific T cell responses in metastatic
melanoma patients with clinical benefit. Proc Natl Acad Sci U S A.
2008;105:20410-5.
Zhang N, Sadun RE, Arias RS, Flanagan ML, Sachsman SM, Nien YC, Khawli LA, Hu
P, Epstein AL. Targeted and untargeted CD137L fusion proteins for the
immunotherapy of experimental solid tumors. Clin Cancer Res. 2007;13:2758-67.
Zhao BG, Vasilakos JP, Tross D, Smirnov D, Klinman DM. Combination therapy
targeting toll like receptors 7, 8 and 9 eliminates large established tumors. J
Immunother Cancer. 2014;2:12.
Zhao J, Cao Y, Lei Z, Yang Z, Zhang B, Huang B. Selective depletion of
CD4+CD25+Foxp3+ regulatory T cells by low-dose cyclophosphamide is
explained by reduced intracellular ATP levels. Cancer Res. 2010;70:4850-8.
Zhao S, Zhang Y, Zhang Q, Wang F, Zhang D. Toll-like receptors and prostate cancer.
Front Immunol. 2014;5:352.

162

Zhu P, Liu X, Treml LS, Cancro MP, Freedman BD. Mechanism and regulatory function
of CpG signaling via scavenger receptor B1 in primary B cells. J Biol Chem.
2009;284:22878-87.
Zimmermann S, Egeter O, Hausmann S, Lipford GB, Rocken M, Wagner H, Heeg K.
CpG oligodeoxynucleotides trigger protective and curative Th1 responses in
lethal murine leishmaniasis. J Immunol. 1998;160:3627-30.
Zitvogel L, Kroemer G. Targeting PD-1/PD-L1 interactions for cancer immunotherapy.
Oncoimmunology. 2012;1:1223-5.
Zitvogel L, Tesniere A, Kroemer G. Cancer despite immunosurveillance:
immunoselection and immunosubversion. Nat Rev Immunol. 2006;6:715-27.
Zoglmeier C, Bauer H, Norenberg D, Wedekind G, Bittner P, Sandholzer N, Rapp M,
Anz D, Endres S, Bourquin C. CpG blocks immunosuppression by myeloid-
derived suppressor cells in tumor-bearing mice. Clin Cancer Res. 2011;17:1765-
75.

Abstract (if available)

Abstract As the second leading cause of death in the United States, cancer is a significant human and economic burden, and recurrence limits successful outcomes. Unlike current mainstays of treatment—surgery, chemotherapy, and radiotherapy—immunotherapy has the potential to prevent recurrence by mounting an immune response and memory against a specific cancer. However, immunotherapy is limited when cancers escape detection and eradication by the immune system. The scientific and medical communities have applied pathogens and pathogen‐associated molecules directly into tumors to enhance tumor immunogenicity with varying degrees of success. One of these agents is a toll‐like receptor 9 agonist, CpG oligodeoxynucleotides (CpG). In the presence of tumor antigens, CpG promote anti‐tumor immune responses. Optimal effects require intratumoral delivery, thereby limiting its use in metastatic disease. However, the majority of cancer clinical trials evaluating CpG use systemic routes of administration. ❧ Because intratumoral injections are not always feasible in clinical applications, we conjugated CpG to a tumor‐targeting antibody to enable systemic delivery. This dissertation describes the conjugation of CpG to chimeric antibody TNT-3 (chTNT-3). In addition to characterizing the biodistribution of chTNT-3 in combination with chemotherapy and methods for chemical conjugation, chTNT-3/CpG immunoconjugates were evaluated in murine solid tumor models, where systemically delivered chTNT-3/CpG reduced tumor burden and improved survival. Importantly, this study showed that conjugation to a tumor‐targeting antibody, as opposed to an irrelevant antibody, was crucial for efficacy. These preclinical findings demonstrate the therapeutic potential of chTNT-3/CpG in cancer immunotherapy, and answer an unmet need in current clinical trials.

Linked assets

University of Southern California Dissertations and Theses

Conceptually similar

PDF

Stable expression of human B7-H4 in a mouse mammary tumor model as a target for cancer immunotherapy

PDF

Human myeloid-derived suppressor cells in cancer: Induction, functional characterization, and therapy

PDF

Immunotherapy of cancer

PDF

Lym-1 epitope targeted chimeric antigen receptor (CAR) T cells for the immunotherapy of cancer

PDF

Development of TCR-like antibody and novel chimeric antigen receptor for cancer immunotherapy

PDF

Novel approaches of mobilizing human iNKT cells for cancer immunotherapies

Asset Metadata

Creator Jang, Julie Kau (author)

Core Title Conjugation of CpG oligodeoxynucleotides to tumor‐targeting antibodies for immunotherapy of solid tumors

School Keck School of Medicine

Degree Doctor of Philosophy

Degree Program Integrative Biology of Disease

Publication Date 07/20/2015

Defense Date 05/13/2015

Publisher University of Southern California (original), University of Southern California. Libraries (digital)

Tag antibody,CpG oligodeoxynucleotides,immunoconjugates,immunotherapy,mouse models,OAI-PMH Harvest,solid tumors,toll‐like receptor agonists

Format application/pdf (imt)

Language English

Contributor Electronically uploaded by the author (provenance)

Advisor Epstein, Alan L. (committee chair), Taylor, Clive R. (committee chair), Akbari, Omid (committee member), Kaslow, Harvey R. (committee member), McMillan, Minnie (committee member)

Creator Email juliejan@usc.edu,juliekjang@gmail.com

Permanent Link (DOI) https://doi.org/10.25549/usctheses-c3-600472

Unique identifier UC11300607

Identifier etd-JangJulieK-3647.pdf (filename),usctheses-c3-600472 (legacy record id)

Legacy Identifier etd-JangJulieK-3647.pdf

Dmrecord 600472

Document Type Dissertation

Format application/pdf (imt)

Rights Jang, Julie Kau

Type texts

Source University of Southern California (contributing entity), University of Southern California Dissertations and Theses (collection)

Access Conditions The author retains rights to his/her dissertation, thesis or other graduate work according to U.S. copyright law. Electronic access is being provided by the USC Libraries in agreement with the a...

Repository Name University of Southern California Digital Library

Repository Location USC Digital Library, University of Southern California, University Park Campus MC 2810, 3434 South Grand Avenue, 2nd Floor, Los Angeles, California 90089-2810, USA