University of Southern California Dissertations and Theses

The role of Prkci in stem cell maintenance and cell polarity using a 3-D culture system

(USC Thesis Other)

The role of Prkci in stem cell maintenance and cell polarity using a 3-D culture system

PDF

Download a page range

Download transcript

Copy asset link

Request this asset

Transcript (if available)

Content
THE ROLE OF PRKCI IN STEM CELL MAINTENANCE
AND CELL POLARITY USING A 3-D CULTURE SYSTEM.

By

In Kyoung Mah

A Dissertation Presented to the
FACULTY OF THE USC GRADUATE SCHOOL
UNIVERSITY OF SOUTHERN CALIFORNIA
In Partial Fulfillment of the
Requirements for the Degree
DOCTOR OF PHILOSOPHY
(GENETIC, MOLECULAR, AND CELLULAR BIOLOGY)

May 2014

Copyright 2014 In Kyoung Mah

ii
Acknowledgements
First of all, I would like to recognize and express my heartfelt gratitude to my advisor, Dr.
Francesca Mariani for her professional guidance, encouragement and patient supervisions. It
was her constant encouragement and guidance that inspired me to finish my projects. I would
like to thank my thesis committee, Dr. Cheng-Ming Chuong, Dr. Robert Maxson and
Dr. Agnieszka Kobielak for their priceless insights and encouragement that assisted me to
succeed in my project. I am particularly grateful to my past and present lab members, Dr.
Jennifer Fogel, Audrey Izuhara, Thu Zan Thein, Raha Shirkhani, Nikita Tripuraneni, and Sophia
Tran for their supports and kindness. Thank you for all the great times.
Finally, I would like to thank my parents and family for their constant love and supports. Most
particularly, I would like to say a big thank to my husband, Kwang Hyun Song for his selfless
support and understanding. I would also like to thank precious son, Ian Song for his smiles and
love. Without their love and support, I could not finish this journey.

iii
Table of contents
List of Tables v
List of Figures vi
Abstract vii
Chapter 1: Introduction 1
The Protein kinase C family 1
Structure of Protein kinase C 1
The maturation and regulation of Protein kinase C 4
Atypical PKCs and Par3-Par6-aPKC complex 7
Cell polarity 9
Epithelial cell structure and polarity 11
Asymmetric cell division 12
Embryonic stem cells (ESCs) and molecular mechanisms of pluripotency 15
Embryoid bodies (EBs) formation and development 16
Numb and Notch 20
Ezrin 22
Thesis perspective 23
Chapter 2: Pluripotency and Prkci 24
2.1 Introduction 24
2.2 Results 26
2.2.1EBs made from Prkci-/- ESCs mimic the phenotype of
Prkci-/- embryo.
26
2.2.2 Prkci-/- cells retain characteristics of pluripotency in EBs. 30
2.2.3 Functional tests for pluripotency 34
2.2.4 Erk1/2 signaling pathway is related to maintenance of
stem cells during EB development.
38
2.3 Discussion 42
2.4 Summary 45
Chapter 3: Multipotency and Prkci 46
3.1 Introduction 46
3.2 Results 48
3.2.1 Neural stem cell populations are increased in Prkci-/-EBs. 48
3.2.2 Cardiomyocyte and erythrocyte progenitors are increased
in Prkci-/- EBs.
53
3.2.3 Prkci-/- cells preferentially undergo symmetric cell 57
3.2.4 Additional loss of Prkcz results in an even higher percentage
of cells that are Oct4, SSEA1, and Stella positive.
61
3.3 Discussion 65
3.4 Summary 70
Chapter 4: Prkci, cell polarity, and cavitation 71
4.1 Introduction 71
4.2 Results 73
4.2.1 Cavitation and polarity are defective in Prkci-/- embryoid bodies. 73
4.2.2 Cell death and proliferation are normal in -/- EBs. 77
4.2.3 Defective BMP signals 82
4.2.4 Cell adhesive characteristics of Prkci-/- cells. 88
4.2.5 Overexpressed Ezrin recovers phenotype partially 93
4.2.6 Cell mixing experiments 100
iv
4.3 Discussion 104
4.4 Summary 110
Chapter 5: Final discussion and future directions 112
Chapter 6: Materials and methods 117
Mouse ESC culture 117
EB formation 117
ESC differentiation assay and Alkaline phosphatase assay 118
Neural differentiation of EB and ESCs 118
Beating cardiomyocyte differentiation of EB 119
Colony forming assay 119
Secondary EB formation 119
Histology of EB 119
Immunofluorescence studies 119
Rhodamine phalloidin staining 120
Western blotting analysis 121
RT-PCR 121
Cell sorting 122
Real time ready custom panel analysis 122
Open array analysis 123
PKC inhibitor treatment 123
Recombinant DNA construction 124
Transient cDNA expression in ESCs 124
Prkci knockdown using lentivirus 125
TUNEL assay 125
BrdU incorporation 126
Cell adhesion assay 126
Cell-cell aggregation assay 126
BMP4 rescue experiments 127
Cell mixing EB 127
Cell proliferation and cell doubling time 127
Statistical analysis 128
References 131

v
List of Tables
Table 6.1 Antibodies and dilution ratios

129
Tabl2 6.2 Primer sequences and annealing temperatures 130

vi
List of Figures

Figure 1.1 Structure of Protein kinase C

3
Figure 1.2 The maturation and regulation of cPKCs

6
Figure 1.3 Molecular interactions among Par3-Par6-aPKC complex

8
Figure 1.4 Cell polarity in Drosophila oocyte and mammalian epithelial cell

10
Figure 1.5 Asymmetric cell division

14
Figure 1.6 The differentiation of embryoid body

19
Figure 2.1 Mouse and EB phenotype

28
Figure 2.2 Prkci-/- cells retain characteristics of pluripotency in several
different assays.

32
Figure 2.3 Cells with pluripotent characteristics maintain pluripotency
in several assays

36
Figure 2.4 Erk1/2 signaling pathway is related to maintenance of stem cells.

40
Figure 3.1 Neural stem cell populations are increased in -/- EBs.

51
Figure 3.2 Cardiomyocyte and erythrocyte progenitors are increased
in Prkci-/-EBs.

55
Figure 3.3 Prkci-/- cells undergo symmetric cell division preferentially.

59
Figure 3.4 Additional loss of Prkcz results in an even higher percentage of
cells that are Oct4, SSEA1, and Stella positive.

63
Figure 4.1 Abnormal polarity in Prkci-/-EBs

75
Figure 4.2 Normal cell death and proliferation in -/- EBs

79
Figure 4.3 Abnormal BMP signaling and recovery assay

85
Figure 4.4 Enhanced adhesive character in -/- EBs.

90
Figure 4.5 Overexpressed Ezrin recovers the phenotype partially.

96
Figure 4.6 Recovery of cavitation and morphology by cell mixing experiments 101

vii
Abstract
Atypical PKCs (aPKC) (Prkci and Prkcz) are key signaling components that have been
demonstrated to control asymmetric cell division and apical-basal polarity in all animals. aPKCs
can be distinguished from other members of the PKC gene family by the presence of only a
single copy of the cysteine-rich, zinc finger-like motif in the C1 domain. In addition, unlike other
PKCs, aPKCs are not activated by DAG or calcium. However, the importance of this molecule
has not been studied during mouse development. I have observed that loss of Prkci results in a
failure of the early mouse embryo to undergo cavitation, with the formation of multiple luminal
structures. In order to better understand the requirement for Prkci in mammalian cells, I have
employed an in vitro system, embryoid body (EB) formation that mimics this embryonic
phenotype. Using this system I find that loss of Prkci leads to the expansion of pluripotent
populations within EBs. These pluripotent cells can be maintained in stem cell culture, can
differentiate into germ layers and form secondary EBs, and exhibit a gene expression profile
similar to normal ESCs. Absence of Prkci also results in the enhanced generation of specific
multipotent populations such as neural stem cells, cardiac, and erythrocyte progenitors. The
ability to differentiate is not compromised as these progenitor populations can undergo
differentiation when induced. I believe that the reason for the increase in pluripotent and
multipotent populations is due to a favoring of symmetric cell division as indicated by symmetric
Numb localization and downstream activation of Notch and Hes5 in Prkci null cells. Additional
inhibition of other PKC isoforms including Prkcz results in an even higher percentage of cells
that expressOct4 and SSEA1and interestingly also Dppa3 (Stella) and Ddx4 (VASA). These
studies indicate that the precise control of symmetric vs. asymmetric cell division via atypical
PKCs influences the generation of multipotent, pluripotent, and possibly even totipotent
populations. These observations suggest that inhibition of Prkci and/or Prkcz may be useful for
developing regenerative therapies.
viii
As I expected, cell polarity is impaired Prkci null cells however this defect does not
dramatically affect the cell death and proliferation in -/- EBs. Absence of Prkci results in the
reduced and mislocalized BMP signaling in -/- EBs, but exogenously added BMP4 cannot
recover the phenotype of failed cavitation. Enhanced adhesive characteristic of -/- ESC and
mislocalized expression of adhesion molecules associated with adherens junctions (AJs) and
tight junctions (TJs) are observed. Overexpression of Ezrin as a direct downstream effector of
Prkci signaling induces the recovery of cell polarity and partial cavitiaion when transiently
expressed. Finally, highly recovered cavitation occurs when polarity competent ESCs and Prkci-
/- ESCs are mixed during EB formation. Together these findings indicate that cell polarity
regulated by Prkci is critical for morphogenesis during EB formation.

1
Chapter 1. Introduction
Cell polarity is essential for normal cell development and homeostasis due to its role in
cellular functions including asymmetric cell division, cell differentiation, and the formation of
epithelial structure. Atypical protein kinase Cs (PKCs) are major players in controlling cell
polarity. In this chapter, I will review the structure and regulation of atypical PKCs, two functions
of cell polarity, the characteristics of embryonic stem cells and embryoid bodies, and the
function of Numb and Notch signaling.
The Protein kinase C family
The PKC isoforms, a family of serine-threonine kinases are involved in cell proliferation,
cell growth and survival through multiple signaling pathways (Kikkawa et al., 1989). The PKC
family includes at least 10 isoforms and is divided into three subgroups based on sequence
homology, biochemical regulation and required cofactors for activation: The conventional (c)
PKCs: α, βI, βII, and γ; the novel (n) PKCs: δ, ε, η and θ; and the atypical (a)PKCs: ζ and λ/ɩ.
The cPKCs are dependent on calcium, diacylglycerol (DAG), phosphatidylserine for their
activation in the C1 and C2 domains. The nPKCs do not require calcium but are still dependent
on diacylglycerol and phosphatidylserine for their activation. Unlike other kinases, aPKCs are
not activated by DAG or calcium (Jaken, 1996). aPKCs can be distinguished from other
members of the PKC gene family by the presence of only a single copy of the cysteine-rich, zinc
finger-like motif in the C1 domain.
Structure of Protein kinase C
The structure of PKC family members includes an amino-terminal regulatory domain and
carboxyl-terminal catalytic domain (Fig. 1.1). C1-C2 form the regulatory domain and C3-C4 form
the catalytic domain (Oliva et al., 2005). The regulatory domain is important for secondary
messenger binding such as DAG and calcium (Oliva et al., 2005). These domains consist of
several conserved (C1-C4) and variable regions (V1-V5) (Newton, 2003). cPKCs and nPKC
2
have two cysteine-rich C1 domains (C1a and C1b) that bind to DAG or phorbol esters(Burns
and Bell, 1991; Ichikawa et al., 1995). aPKCs have a single copy of the cysteine-rich, zinc
finger-like motif in the C1 domain, so they cannot bind to DAG or phorbol esters (Hurley et al.,
1997; Jaken, 1996). The cPKCs have a C2 domain that has calcium binding site(Johnson et al.,
2000). The nPKCs have a C2 like domain that lacks a calcium binding site, as a result, nPKCs
are not sensitive to calcium (Benes et al., 2005). aPKCs do not have a C2 domain and are
therefore not sensitive to calcium. Instead a PB1 domain in aPKCs plays a role in protein-
protein interaction that is important for controlling their functions in cells (Moscat et al., 2009).
The C3 domain has the ATP binding site and C4 has the substrate binding site (Oliva et al.,
2005). All PKC isoforms have a pseudo-substrate (PS) domain that is located in the regulatory
region. The PS domain keeps PKCs in an inactive state by blocking the substrate binding
sites(Kazi, 2011). Upon binding to the regulatory domain, factors can release PS from the
substrate binding sites and then make PKCs active (Orr and Newton, 1994).

3

Figure 1.1 Structure of Protein kinase C.
PKCs are subgrouped into three families: classical PKCs, novel PKCs and atypical PKS. The
Regulatory domain consists of C1 domain or C1 variant domain, C2 domain or C2 variant
domain, and a conserved PS. C3 contains a conserved catalytic domain, activation loop, turn
motif, and hydrophobic motif (Xiao and Liu, 2013).
This is modified figure 1 from Xiao H, Liu M (2013) Atypical protein kinase C in cell motility. Cell
Mol Life Sci. 70:3057-3066.

4
The maturation and regulation of Protein kinase C
PKCs are matured and activated by highly regulated phosphorylations (Fig. 1.2)(Newton,
2010). There are three phosphorylation sites for the activation of PKCs: the activation loop, the
turn motif, and the hydrophobic motif (Keranen et al., 1995). Newly synthesized PKC is weakly
attached to the membrane and in an inactive state. The PS blocks the substrate binding sites
and the activation loop is opened(Dutil and Newton, 2000). Phosphorylation of the activation
loop is mediated by PDK-1 and is necessary for promoting phosphorylations of other motifs
(Dutil et al., 1998). Phosphorylation of the activation loop then triggers autophosphorylation of
the turn motif (Newton, 2001). This phosphorylation is important for stabilization of PKC and this
phosphorylation protects the degradation of active PKC(Bornancin and Parker, 1996; Newton,
2001). The final step is the phosphorylation of the hydrophobic motif that is important for
stabilizing PKC from proteolytic degradation (Balendran et al., 2000). Only cPKCs and nPKCs
have this final phosphorylation step because aPKCs are not phosphorylated at the hydrophobic
motif. After serial phosphorylations, PKC is released to the cytosol but not active because of
bound PS at the substrate binding site. The mature PKC is regulated by secondary messengers
DAG, calcium, phosphatidylserine. Agonist-mediated hydrolysis of PIP2 yields two secondary
messengers: calcium and DAG. Later calcium binds to the C2 domain of cPKC and promotes
translocation of cPKC to the membrane. This binding then promotes the binding of the C1
domain to membrane bounded DAG. The engagement of C1 and C2 domains on the membrane
cause the conformational change of cPKC and then release the auto-inhibitory PS from the
substrate biding sites(Schechtman and Mochly-Rosen, 2001). Because nPKCs do not have C2
domain nPKCs depend on C1b domain that can bind to DAG containing membranes with higher
affinity (Giorgione et al., 2006). However, aPKCs which lack the C2 are not dependent on DAG
or calcium for their activity. Instead, aPKCs have PB1 domain in the N-terminal regulatory
domain. This highly acidic domain can interact with basic surface of PB1 domains such as found
5
in ZIP/p62 and Par6. These protein-protein interactions can additionally regulate aPKC activity
(Hirano et al., 2004).
The biological functions of activated PKCs are regulated by receptor for activated C
kinases (RACKs). Because RACKs are isoform specific, different RACKs can bind different
PKCs to help correct cellular localization 1998)(Mochly-Rosen and Gordon, 1998).

6

Figure 2. The maturation and regulation of cPKCs.
Serial phosphorylations lead to the maturation of PKCs. Activated PKCs are regulated by
secondary messengers: DAG, calcium, and phosphatidylserine. (Modified from Newton, 2010).
This is figure 3 from Newton AC (2010) Protein Kinase C: poised to signal. Am J Physiol
Endocrinol Metab 298: E395-E402.

7
Atypical PKCs and Par3-Par6-aPKC complex
aPKCs play a pivotal role in several cellular functions such as cell mobility, cell migration,
asymmetric cell division, the establishment of epithelial cell apical-basal polarity and cell
proliferation (Chen and Zhang, 2013; Liu et al., 2006). There are two aPKCs: PKCiota and
PKCzeta. These two aPKCsshare72% amino acid sequence homology between them
(Nishizuka, 1995). aPKCs are the major components of the Par3-Par6-aPKC complex (Suzuki
and Ohno, 2006). Par3 and Par6 as scaffold proteins can bind to each component of aPKC
complex and other polarity related proteins (Macara, 2004).The PB domain of aPKCs interacts
with the PB domain of Par6 and the central kinase domain of aPKCs bind to the CR3 domain of
Par3. In addition, the PDZ domains of Par3 and Par6 interact each other (Fig. 1.3)(Ohno, 2001).
In mammalian epithelial cells, the GTP bound form of Cdc42 can bind to the CRIB
domain of Par6, leading to phosphorylation and conformational change of Par6. This Cdc42
bound Par6 can then phosphorylate and activate associated aPKCs and leading to
phosphorylation of PAR3, finally to the formation of the Par3-Par6-aPKC complex (Horikoshi et
al., 2009; Ohno, 2001).
In Drosophila neuroblasts, loss of DaPKC or DmPar6 leads to defective localization of
Par3 that is no longer apically localized (Petronczki and Knoblich, 2001; Wodarz et al., 2000).
Drosophila aPKC -/-s show polarity defects in neuroblast and epithelial cells (Rolls et al., 2003).
Several studies of Drosophila neuroblast development suggest that aPKCs are essential for cell
polarity.

8

Figure 1.3 Molecular interactions among Par3-Par6-aPKC complex.
Each component of aPKC complex interacts with another component via a specific
domain(Ohno, 2001). This is figure 2 from Ohno S (2001). Intercellular junctions and cellular
polarity: the PAR-aPKC complex, a conserved core cassette playing fundamental roles in cell
polarity. Curr Opin Cell Biol. 13(5):641-648.

9
Cell polarity
Cell polarity, including the production of asymmetrically localized cellular molecules is
essential for cellular processes such as asymmetric cell division, cell migration, epithelia
formation, and cell differentiation (St Johnston and Ahringer, 2010). The common steps of cell
polarity are: a polarity cue, regulation of the cytoskeleton, distribution of polarity molecules, and
transduction of polarity (St Johnston and Ahringer, 2010). Although found in diverse cell types
and organisms, cell polarity is regulated by the evolutionarily conserved Par3-Par6-aPKC
complex (Kemphues et al., 1988; Suzuki and Ohno, 2006). In epithelial cells, thePar3-Par-6-
aPKC complex becomes asymmetrically localized (Suzuki and Ohno, 2006). Studies on the role
of the aPKC complex in Drosophila have shown that the aPKC complex works with other
polarity regulating proteins such as Crumbs/PALS1, Dlg/Scrib/Lgl, MARK1/2 (Par1), 14-3-3
(Par5) and LKB1(Par4) to regulate cell polarity by distinct distributions(St Johnston and Ahringer,
2010). In the Drosophila oocyte, the anterior and lateral cortex have the distribution of the aPKC
complex, but the posterior region of oocytes have Par1 expression with Lgl (Fig.1.4)(Doerflinger
et al., 2010) and it has been proposed that this mutually inhibitory antagonistic distribution of
proteins maintains cell polarity in oocyte (Doerflinger et al., 2010). Recent studies showed that
the aPKC complex exhibits similar functions in mammalian epithelial cells. In mammalian
epithelial cells, the aPKC complex is also proposed to establish and maintain epithelial cell
polarity by a mutually antagonistic interaction with the Lgl complex (Fig.1.4)(Suzuki et al., 2004).
aPKC complex that localizes in apical region keeps the Lgl complex exclusively in basal and
lateral region of epithelial cell (Yamanaka et al., 2006) Among the functions of aPKCs in cell
polarity, I will next discuss epithelial formation and asymmetric cell division in detail.

10

Figure 1.4 Cell polarity in Drosophila oocyte and mammalian epithelial cell
(Left) aPKC complex is localized in anterior and lateral cortex, but Par1 and Lgl are expressed
in posterior of an oocyte cell. (Right)Mutually inhibitory interactions complex, the Crumbs
complex, and the Lgl complex are required for the formation of epithelial cell (St Johnston and
Ahringer, 2010).This is figure 2 from St Johnston D, Ahringer J (2010) Cell polarity in eggs and
epithelia: Parallels and diversity. Cell 141:757-774

11
Epithelial cell structure and polarity
Epithelial cells form an orderly layer that acts as barriers between different cell
compartments, or the inside of organism and outer environment (Chen and Zhang, 2013). The
structure of epithelial cells contains TJs, AJs, and desmosomes (Fig. 1.4)(St Johnston and
Ahringer, 2010). The TJ functions as a barrier to prevent the diffused movement of membrane
proteins in apical and lateral domains (Tanos and Rodriguez-Boulan, 2008). The TJ is also
important for organizing epithelial cell polarity (Kohler and Zahraoui, 2005). The TJs are
localized between the apical and lateral domains and these junctions consist of Occludin, JAMs,
and Claudins. The cytoplasmic tail of Occludin and Claudin can interact to Zo-1, Zo-2 and
MAGUK that lead to the proper assembly of TJs (Kohler and Zahraoui, 2005). AJs are localized
underneath the tight junctions and supply the main mechanical links between epithelial cells.
AJs between cells involve a multiple protein complex linking intracellular actin to E-cadherin via
cytoplasmic adaptor proteins α and β-catenin (St Johnston and Ahringer, 2010). E-cadherin can
bind β-catenin directly and interact indirectly with α-catenin via β-catenin (Yamada et al., 2005).
Actin binds to α-catenin directly (Yamada et al., 2005) and cytoskeleton of actin binds to the
intradomain of E-cadherin (Leckband and Sivasankar, 2000).
The desmosome is below the AJ and TJ and is essential for maintaining cell-cell
adhesion (Delva et al., 2009). The desmosome consist of desmosomalcadherins (desmogleins
and desmocollins), the plakin family of cytolinkers and cytoplasm proteins (Chidgey and
Dawson, 2007).The cytoplasmic parts of the desmosome containing desmoplakin, plakoglobin
and plakophilins interact with the desmosomal cadherin tails. The desmoplakins can bind to
intermediate filaments and then serve as the bridge to the cytoskeleton (Delva et al., 2009).
How epithelial cell apical-basal polarity is established is not completely understood but
apical-basal polarity is fundamental for the formation of epithelial tissues(Martin-Belmonte and
Perez-Moreno, 2012).Studies, primarily in Drosophila, have shown that three major components
including the aPKC complex, the Crumbs complex, and the Scribble complex are essential for
12
the initiation of apical-basal polarity (Martin-Belmonte and Perez-Moreno, 2012; St Johnston
and Ahringer, 2010). The Crumbs complex containing CRB, PALS1, and PATJ is important for
the establishment of the apical membrane, the aPKC complex is essential for the initiation of the
apical lateral membrane border, and the Scribble complex including Scribble, Lgl, and Dlg
specifies the basolateral membrane (Tanos and Rodriguez-Boulan, 2008). aPKC complex
initially interacts with the Crumb complex via Par6 and then aPKC can phosphorylate and
activate Crumbs, (Assemat et al., 2008; Sotillos et al., 2004). By these interactions, aPKC and
Crumb complexes establish the apical membrane and the TJ lateral border(Tanos and
Rodriguez-Boulan, 2008). Lgl of the Scribble complex can interact with the aPKC complex and
inhibit aPKC activity (Betschinger et al., 2003). Therefore, the phosphorylation of key proteins
by the initial association of three complexes with each other leads to basal localization of the
Scribble complex and apical localization of aPKC and Crumb complexes (Goldstein and Macara,
2007).
Asymmetric cell division
The balance between self-renewal and differentiation is regulated by evolutionarily
conserved asymmetric cell division (Inaba and Yamashita, 2012). A symmetric cell division
generates two daughter cells that have same fate, whereas an asymmetric cell division
generates two daughter cells with different cell fates (Fig.1.5)(Morrison and Kimble, 2006;
Tajbakhsh et al., 2009). Well-defined steps of an asymmetric cell division are the establishment
of cell polarity within a cell, the alignment of mitotic spindle, and asymmetric segregation of cell
fate determinants (Knoblich, 2008; Macara and Mili, 2008).For example, in Drosophila, an
asymmetrically dividing neuroblast generates another neuroblast and a ganglion mother cell
(Bello et al., 2008). This division is regulated by apically localized aPKC complex mediated
spindle orientation combined with basally localized cell fate determinants such as Numb and
Miranda (Knoblich, 2008; Siller and Doe, 2009). Recent progress has shown that mammalian
stem cells divide asymmetrically using similar mechanisms as Drosophila neuroblasts. For
13
example, one study shows that overexpression of Par6 or Par3 promotes generation of
progenitors via symmetric cell division in the developing cerebral cortex using a time-lapse
video microscopy. They suggest that mouse neural progenitor cells divide asymmetrically
through an involvement of the aPKC complex (Costa et al., 2008).

14

Figure 1.5 Asymmetric cell division
Asymmetric cell division gives rise to two different fate cells via asymmetric cell fate
determinants such as the aPKC complex (Knoblich, 2008). This is modified figure 1 from
Knoblich JA (2008) Mechanisms of Asymmetric stem cell division. Cell 132:583-597

15
Embryonic stem cells (ESCs) and molecular mechanisms of pluripotency
Mouse ESCs that are derived from inner cell mass of blastocyst (Evans and Kaufman,
1981) can give rise to three germ layers including ectoderm, mesoderm, and endoderm
lineages(Takahashi and Yamanaka, 2006). The cells of endoderm lineage can further
differentiate into gut cells, pancreatic cells, and thyroid cells. The mesoderm precursors can
differentiate into cardiovascular cells, skeletal muscle cells, and smooth muscle cells. The
ectoderm gives rise to the neuron cells, pigment cells, and skin cells of the epidermis (Kingham
and Oreffo, 2013).
In addition to the ability to differentiate into any type of cell, ESCs exhibit the capacity for
self-renewal (Takahashi and Yamanaka, 2006). To maintain the pluripotency of ESCs in culture,
differentiation must be inhibited with anti-differentiation agents such as leukemia inhibitory factor
(LIF) (Bard and Ross, 1991). Within an organism, the balance between self-renewal and
differentiation is important during embryo development and organogenesis and for maintaining
tissue homeostasis (He et al., 2009). An imbalance between self-renewal and differentiation in
stem cells can lead to a defect in tissue development and in the adult a defect in homeostasis
leading to an increase in the possibility of cancer and abnormal tissue formation (Weissman,
2000).
Intrinsic molecular mechanisms to regulate the pluripotency of ESCs have not been
understood completely. However, the transcription factors Oct4, Sox2, and Nanog play
important roles. Oct4, the POU transcription factor is a critical regulator for the pluripotency in
mouse embryos and ESCs in culture (Niwa et al., 2000). Knock down of Oct4 leads to loss of
pluripotency and differentiation into the trophectoderm (Niwa et al., 2000). TheSox2
transcription factor is expressed and required for pluripotency in ESCs and embryos (Avilion et
al., 2003; Masui et al., 2007). Sox2 collaborating with Oct4 induces the activation of pluripotency
related genes including Nanog (Masui et al., 2007; Okamoto et al., 1990). Nanog as a
downstream gene of Oct4 is also expressed in inner cell mass of mouse embryo and mESCs
16
and is important for the regulation of pluripotency (Mitsui et al., 2003; Rodda et al., 2005).
Nanog knockout ESCs easily undergo spontaneous differentiation in ES cell culture and
overexpression of Nanog results in maintaining pluripotency without LIF condition culture
(Chambers et al., 2003; Mitsui et al., 2003). Therefore, Oct4, Sox2 and Nanog form a core
transcriptional regulatory network to regulate the expression of pluripotent related genes (He et
al., 2009).
ESCs can be maintained when they are cultured in the presence of a feeder layer of
fibroblasts LIF, and BMP. The feeder layer can produce the growth factors that block
differentiation and can provide physical support for ESC growth (Niwa et al., 1998). LIF is
generated from mouse fibroblasts and inhibits the differentiation of mouse ESCs in culture (Bard
and Ross, 1991) through the activation of Janus kinase and signal transducer and activator of
transcription 3 (JAK/STAT3) signaling (Niwa et al., 1998). BMPs are also required for
maintaining the pluripotency of ESCs (Ying et al., 2003). BMPs through SMAD signaling can
inhibit differentiation and can suppress neural differentiation (Ying et al., 2003).Therefore,
extrinsic regulatory factors are essential for ESC self-renewal in cell culture.
Embryoid bodies (EBs) formation and development
When ESCs are cultured in suspension without anti-differentiation agents such as LIF
and a feeder layer, three-dimensional aggregates, embryoid bodies (EBs), are spontaneously
generated from ESCs (Doetschman et al., 1985; Kurosawa, 2007). Although the EB never
develops a structure that resembles an embryo, EBs can form three germ layers and mimics
many aspects of cell differentiation of early post-implantation stage embryos(Desbaillets et al.,
2000). Cells of the developing EB can further differentiate into advanced committed cell types
such as cardiomyocytes, endothelial cell, neuronal cells, hematopoietic precursors (Desbaillets
et al., 2000). Early stages of embryo development is hard to access and use for biochemical
and molecular studies, EBs made by genetically modified ESCs are the powerful method to
study the mechanism of early embryogenesis and organogenesis (Coucouvanis and Martin,
17
1995; Li and Yurchenco, 2006). In addition, EBs can differentiate into various types of cells, so
this characteristic becomes a powerful tool for tissue bioengineering and regenerative medicine
(Desbaillets et al., 2000).
Among several methods used to induce the formation of EBs, the suspension method,
hanging drop method and methods using U bottomed 96-well plates are popularly applied to
study stem cell differentiation and tissue development (Desbaillets et al., 2000; Kurosawa,
2007). When ESCs are grown without LIF and feeder cells in suspension or in drops or in U
bottomed 96 wells, ESCs can spontaneously form aggregates. Among these three methods, I
used the hanging drop method and the suspension method.
The development of EBs is similar to the formation of proamniotic cavity of embryo
(Coucouvanis and Martin, 1995). After ESCs are culture in suspension or hanging drops, small
and loose aggregates through cell-cell adhesion are formed. The size of EB depends on the
number of initial cells (Dang et al., 2004). Following the formation of aggregates, a primitive
endoderm layer similar to the primitive endoderm of the embryo is formed on the outer surface
of the EB (Fig. 1.6). The differentiation and formation of primitive endoderm is induced by BMP
signaling (Coucouvanis and Martin, 1999) and FGF signaling (Chen et al., 2000). The primitive
endoderm cells secrete laminin, collagen IV, and other basement membrane components to
form the basement membrane between the endoderm and the undifferentiated cells of the EB
and neighboring cells in contact with the basement membrane become polarized (Fig. 1-6)(Li et
al., 2002). The primitive endoderm further differentiates into the visceral and parietal endoderm
(Li et al., 2001). The cells that are not in direct contact with the basement membrane begin
undergoing apoptosis to create initial small cavities, whereas the neighboring cells indirect
contact with basement membrane are protected from apoptosis and differentiate into a polarized
columnar epithelium (Fig. 1-6)(Coucouvanis and Martin, 1995; Murray and Edgar, 2000). Small
cavities are further merged inward to become a single cavity surrounded by a columnar
epithelium (Fig. 1-6)(Coucouvanis and Martin, 1995; Li et al., 2003). The columnar epithelium of
18
the EB is similar to the embryonic ectoderm or the epiblast in the embryo. Later, the EB
becomes cystic (Coucouvanis and Martin, 1995; Murray and Edgar, 2000). In this study, EBs
were used to study the role of PKC iota (Prkci) in pluripotent stem cells, multipotent stem cells,
and differentiation.

19

Figure 1-6. The differentiation of embryoid body.
Schematic drawing of EB development: (a)Undifferentiated cell aggregates, (b) endoderm
formation, (c) basement membrane formation (d) small cavities, (e) completion of cavitation and
columnar epithelium(Li et al., 2003).This is figure 2 from Li S, Edgar D, Fässler R, Wadsworth W,
and Yurchenco PD (2003) The role of laminin in embryonic cell polarization and tissue
organization. Developmental cell 4:613-624

20
Numb and Notch
Numb was first identified as a cell fate determinant important for the development of the
sensory organ in Drosophila (Uemura et al., 1989) and is evolutionarily conserved from flies to
mammals (Yan, 2010). Numb is an adaptor protein that can regulate several cell functions
including asymmetric cell division, cell fate determination, cell adhesion, cell migration, and
ubiquitination of proteins that are part of related signaling pathways such as Notch, Hedgehog,
and p53 (Gulino et al., 2010).
Numb is essential for regulating asymmetric cell division and functions as a cell fate
determinant by inhibiting Notch activity. For example, Numb is asymmetrically distributed during
asymmetric cell division in the Drosophila sensory organ precursors and loss of numb results in
aberrant production of supporting cells instead of differentiated sensory neurons by symmetric
cell division (Rhyu et al., 1994). One study shows that Numb inhibits Notch signaling to specify
neural cell fate during asymmetric cell division in Drosophila MP2 precursors(Spana and Doe,
1996).In mammals, Numb is expressed asymmetrically in dividing cells in mouse cortical
progenitors and rat retinal progenitors (Cayouette et al., 2001; Zhong et al., 1996) and Numb is
localized at the basolateral region of membrane in epithelial cells (Dho et al., 2006). Knockout of
Numb results in reduced asymmetric cell division in mouse cerebral cortical progenitors(Shen et
al., 2002). Overexpression of Numb promotes the generation of neurons (Verdi et al., 1996) and
knock out Numb mice have defects in neuronal differentiation in central nerve system and
peripheral nerve system lineage(Zilian et al., 2001). One study shows that Numb can directly
interact with cytoplasmic domain of Notch1 and mediate the inhibition of nuclear translocation of
activated Notch1, leading to neural differentiation in chick (Wakamatsu et al., 1999). Another
study shows that overexpressed Numb leads to inhibit the expression of Notch1 target genes
during mice T cell development (French et al., 2002).
Studies in Drosophila have been instrumental for understanding the regulatory
mechanism of Numb distribution during asymmetric cell division (Wirtz-Peitz et al., 2008) and
21
the Par3-Par6-aPKC complex has been shown to be crucial for regulating numb activity
(Knoblich, 2008). Before a cell is dividing, the Par6-aPKC complex associated with Lgl localizes
at one side of cell. At the onset of mitosis, activated Aurora-A phosphorylates Par6, allowing
aPKC activation. Activated aPKC can phosphorylate Lgl, leading the dissociation of Lgl from
Par6-aPKC complex and the assembly of Par3-Par6-aPKC complex. Then aPKC can
phosphorylate Numb at the cell cortex, leading to its localization to the opposite pole where the
aPKC complex is not present(Knoblich, 2008; Wang et al., 2006; Wirtz-Peitz et al., 2008). The
phosphorylation of partner of numb (pon) by the Polo kinase is required for asymmetric Numb
localization in Drosophila (Wang et al., 2007).
In mammalian cells, Numb activity is regulated by aPKC complex. Par3 has been shown
to also play an important role in asymmetric cell division via a numb dependent mechanism by
controlling Notch signaling in mouse neocortex (Bultje et al., 2009). Par3 and aPKC can bind to
Numb in HeLa cells and MDCK cells (Nishimura and Kaibuchi, 2007; Wang et al., 2009). Numb
is then phosphorylated by aPKC (Nishimura and Kaibuchi, 2007; Smith et al., 2007). Thus,
several results suggest that asymmetric numb localization is controlled by the aPKC complex
and the principle mechanism of asymmetric numb localization is likely conserved from
Drosophila to mammals.
Notch is a transmembrane receptor that is activated by binding with its ligands such as
Delta-like and Jagged (Ahimou et al., 2004; Talora et al., 2008). By undergoing several
proteolytic cleavages, a Notch intracellular domain (ICD) is generated, released into the cytosol
and translocated into the nucleus (Bray, 2006; Gordon et al., 2008). Later the Notch ICD
interacts with CBF1/Su (H)/Lag1 transcription factor and then releases co-repressors to activate
the downstream target genes such as Hes and Hes-related genes (Gude and Sussman, 2012;
Struhl and Adachi, 1998).Notch is crucial for several cellular functions including cell-cell
communication, stem cell maintenance, cell fate determination, and cell differentiation (Gude
and Sussman, 2012). Numb was identified as a Notch inhibitor in Drosophila (Talora et al.,
22
2008). In Drosophila and mammals, numb acts as an adaptor protein that binds to both Notch
ICD and the E3-ubiquitin ligase, Itch. These interactions result in polyubiquitination and
degradation of membrane bound Notch (McGill and McGlade, 2003). Overexpressed numb
boosts the degradation of Notch ICD that is not tethered in membrane(McGill and McGlade,
2003). Loss of Numb results in no degradation of Notch 1 and maintenance of Notch1 at the cell
surface (McGill et al., 2009).These studies suggest that the expression levels of numb can
regulate the ability of Notch ICD to mediate transcription. In chapter 4, I will discuss the
functions of Numb and Notch in stem cell maintenance.
Ezrin
Ezin is a member of the ERM (Ezrin, Radixin, Moesin) family and is a linker protein
between the cell membrane and F-actin on the surface of cells (Neisch and Fehon, 2011). The
C-terminal domain of ERM proteins interact with F-actin whereas the N-terminal domain directly
interacts with proteins and lipids of plasma membrane (Heiska et al., 1998; Serrador et al., 2002)
or indirectly binds to the plasma membrane via EBP50 proteins (Bretscher et al., 2000; Morales
et al., 2004). The ERM protein family is involved in cellular and developmental functions such as
cell migration, cell morphology, the organization of epithelial cells, and lumen formation of
epithelial tubes(Bretscher et al., 2002; Fehon et al., 2010). Specifically Ezrin plays an important
role in cell adhesion, cell polarity, and epithelial structure and cell migration (Bretscher et al.,
2002). Ezrin is apically expressed in preimplantation stage of embryo (Dard et al., 2004; Louvet
et al., 1996) and is also expressed in intestinal epithelial cells (Saotome et al., 2004).
Ezrin is produced as an inactive form due to the interaction between the C-terminal and
N-terminal domain that blocks protein binding sites in the cytoplasm (Gary and Bretscher, 1993).
Activation of Ezrin involves binding of PIP2 to the N-terminal domain and phosphorylation of a
threonine 567 residue in the C-terminal domain (Fievet et al., 2004), thus freeing the C-terminal
and N-terminal domain of Ezrin. After activation, the N-terminal domain of Ezrin interacts with
membrane proteins including CD44 and ICAMs (Bretscher et al., 2002) or EBP50 protein
23
(Morales et al., 2004), while the C-terminal domain of Ezrin can bind to F-actin. Several protein
kinases such as Prkcα (Chuan et al., 2006), Prkcθ (Pietromonaco et al., 1998), Prkci (Wald et
al., 2008), myotonic dystrophy kinase-related Cdc42-binding kinase (Nakamura et al., 2000)can
regulate and phosphorylate a threonine in C terminal domain. The alpha helical domain of the
central region of Ezrin is essential for recruiting PKA and regulates the activity of a cyclic AMP-
dependent protein kinase on membrane proteins (Dransfield et al., 1997). In Chapter 5, I will
investigate the function of Ezrin in cell polarity and EB development.
Thesis perspective
The aim of this dissertation is to determine the requirement of Prkci for stem cell
differentiation, asymmetric cell division, and polarity in mouse cells. In chapter 2, I will describe
studies showing that loss of Prkci induces pluripotent stem cell populations in ESCs and EBs.
Chapter 3 describes the enhanced generation of multipotent stem cell populations in
differentiating Prkci-/- cells. In chapter 4, I will explain that disrupted cell polarity by loss of Prkci
leads to the failure of cavitation and propose that Ezrin is downstream of Prkci. In chapter 5,
discussion and future directions are presented. Chapter 6 will describe the materials and
methods in detail.
The study of the requirement of Prkci in stem cell differentiation provides new
perspective of molecular mechanism of self-renewal and differentiation in mammalian cells.
Additionally, this study suggests new ways to generate multipotent stem cell populations. Finally,
the study on Prkci and EB differentiation will give new perspective that cell polarity is important
for transmitting cell differentiation signals and completing differentiation in EB development.

24
Chapter 2. Pluripotency and Prkci

2.1 Introduction

aPKCs are key signaling components involved in cell proliferation, differentiation,
carcinogenesis, cell polarity and asymmetric cell division (Ohno, 2001). aPKCs are a central
component of the evolutionarily conserved Par3-Par6-aPKC complex. Activated cdc42 results in
a conformational change of Par6, leading the phosphorylation and activation of aPKC. Par3 acts
as a scaffolding protein necessary to recruit Par6/aPKC to sites where its activity is required.
This trimeric complex regulates the formation and maintenance apical-basal epithelial polarity
and neural progenitors (Ghosh et al., 2008; Suzuki and Ohno, 2006). Prkcz is primarily
expressed in lung and brain whereas Prkci is widely expressed during mouse embryo
development (Kovac et al., 2007). Prkcz deficient mice are normal with different phenotypes in
Peyer’s patches and spleens. Prkcz is related to functions in the innate immune system(Leitges
et al., 2001). In contrast inactivation of Prkci results in embryonic lethality(Seidl et al., 2013;
Soloff et al., 2004). Thus Prkci is required for early embryo development.
ESCs are able to differentiate into a wide variety of cell types, so ESCs are great
sources for studying the lineage commitment and cell-based therapy (Smith, 2001). LIF is a key
effector to maintain the pluripotency and the ability of differentiation of ESC in vitro ESCs culture.
LIF induces the activation of JAK/STAT3 via triggered LIF/gp130 heterodimeric receptor
complex. Once activated, STAT3 can enter the nucleus and regulate numerous genes that are
related to pluripotency (Matsuda et al., 1999; Niwa et al., 1998). Knockdown of JAK1 by RNAi
promotes differentiation of mouse ESCs (Ernst et al., 1996) but overexpression of STAT3 can
promote self-renewal without LIF (Matsuda et al., 1999). C-myc, a helix-loop-helix transcription
factor is the direct target of JAK/STAT3 and the expression level of c-myc is decreased without
25
LIF in ESC culture (Cartwright et al., 2005). Phosphatydilinositol-3 kinase (PI3K)-AKT pathways
are also important for regulating the maintenance of ESCs (Paling et al., 2004). AKT expression
is decreased during ESC differentiation and the expression of a constitutively activated AKT
inhibits the differentiation of mESCs (Watanabe et al., 2006). Inactivation of Extracellular-signal-
regulated kinases 1/2 (Erk1/2) and glycogen synthase kinase-3 (GSK3) pathways are also
important for the self-renewal of mouse ESCs. Erk1/2 is increasingly expressed with the
withdrawal of LIF and inhibition of Erk1/2 leads to the maintenance of pluripotency of mouse
ESCs (Burdon et al., 1999). Upon the withdrawal of LIF, the activity of GSK3 is increased
rapidly and leads to degradation of c-myc by the phosphorylation of c-myc (S58) (Umehara et
al., 2007).The inhibition of GSK3β with a GSK inhibitor leads to the maintenance of pluripotency
of mouse ESCs in the absence of LIF (Sato et al., 2004). There are many strategies to
differentiate ESCs. Among them, spontaneous formation of three dimensional cell aggregates
called EBs is the most attractive and practical method to induce differentiation (Doetschman et
al., 1985; Keller, 1995). Development of EBs mimics early post-implantation development of
embryos in terms of potency and morphology (Coucouvanis and Martin, 1995; Martin and Evans,
1975).
Recent studies have shown that the inhibition of Prkcz by PKC inhibitor (Gö6983)
maintains mouse and rat stem cell via inhibiting NF-κB signaling (Dutta et al., 2011; Rajendran
et al., 2013). They show that mouse and rat ESCs with Gö6983 can maintain ESC self-renewal
without LIF and have the ability to differentiate into multilineages and generate chimeras. Thus,
these studies suggest us that loss of Prkci might lead to maintain self-renewal in ESCs and
retain pluripotency during EB development.
In this chapter, I investigated the role of Prkci in ESCs differentiation using Prkci -/- EBs
systems. I present that loss of Prkci leads to sustained pluripotency during EB development.

26
2.2 Results

2.2.1 EBs made from Prkci-/-ESCs mimic the phenotype of Prkci-/-embryo.

Mice heterozygous for a Prkci null allele (Soloff et al., 2004) were intercrossed to
generate Prkci-/- embryos at different stages. No obvious phenotype could be observed in
harvested blastocyst stage embryos (data not shown), however by implantation (E5.5) and
through E9.0, null embryos could clearly be identified (Fig.2.1B). Null embryos failed to undergo
normal cavitation of the both the embryonic and extra-embryonic ectoderm. Instead many small
cavities formed surrounded by epithelia. Histological analysis suggested that some embryonic
components were able to develop such as the nervous system and that the anterior-posterior
axis could still form, however by E9.0 the embryo failed to turn, no further development ensued
and the embryos were resorbed. These observations are consistent with another null allele
recently described (Seidl et al., 2013). Using the early embryo to studying the function of Prkci
poses numerous challenges. To facilitate our studies, I employed the simple in vitro EB culture
system which allows for the differentiation of ESCs in 3-dimensions (Coucouvanis and Martin,
1995, 1999). To first compare EB development, I produced heterozygous and -/- cells. EBs
were then generated and collected at different time-points, fixed, sectioned and examined
histologically with nuclear fast red staining. Like EBs made from wild-type cells, EBs made from
Prkci+/- ESCs formed a loose endodermal layer on the outside of the EB and a single cavity.
The process of cavitation is not entirely clear, however, it appears that small micro-cavities form
surrounded by polarized epithelia and these cavities then fuse to form a single cavity
surrounded by columnar epithelium. In addition, cells in the center are removed through
programmed cell death. Various stages of this process can be seen in EBs made with Prkci+/-
cells(Fig. 2.1C). EBs created from Prkci-/- cells exhibited a very different morphology, however.
Although an endodermal-like layer formed, micro cavities and epithelia were still be present,
27
programmed cell death was high (Fig.4.2C’), and actively proliferating cells still remained in the
center (Fig.4.2E’, F’). Sometimes no cavities formed at all. In addition, later on (eg. day 12), -/-
EBs were much less likely to contain large cystic regions (Fig. 2.1D). Some of these
observations have been also seen by others (Seidl et al., 2013). Since these observations are
similar to the Prkci null embryonic phenotype (Fig. 2.1A, Seidl et al., 2013), I believe the EB
system represents a useful way to analyze the morphological and differentiation potential of
Prkci -/- ESCs in vitro.
To control for the possibility that feeder cells might become incorporated into the null
EBs and influence their development and to be assured that the EBs constituted entirely of -/-
cells, I assayed for Prkci gene expression by RT-PCR. I found that Prkci was not expressed at
detectable levels in null EBs even after 10 days of culture (Fig. 2.1E). The dramatic differences
in morphology during EB development could be due to a failure in the ability of the Prkci-/- cells
to differentiate. However, analysis by RT-PCR using embryonic germ layers markers for
endoderm (Gata6 and Afp), ectoderm (Fgf5), mesoderm (T), and factors implicated in EB cell
death (Bmp2 and Bmp4) (Coucouvanis and Martin, 1999) showed that cells in Prkci-/- EBs
express markers for the major germ layers. Thus it seemed unlikely that the morphological
differences observed are due to the inability to form one of the 3 germ layers or a failure to
induce cell death signals (Fig.2.1F).

28

Figure 2.1 Mouse and EB phenotype.
(A-B) Sagittal sections from control and Prkci null mouse embryos at the stages indicated.
Cavitation fails to occur in Prkci-/- embryos and although some aspects of normal development
occur, embryos never turn and most are in the process of resorption at E9.0.
(C)The formation of EBs mimics early embryonic development. As seen in wildtype lines,
Prkci+/-EBs form a single hollow cavity surrounded by columnar epithelia, embryonic ectoderm,
and an endodermal layer.
(D) Prkci-/- EBs phenocopy the embryonic phenotype and fail to form a single cavity, instead
forming many small cavities or no cavities at all.

29

Figure.2.1 continued.
(E) Prkci -/- EBs do not express Prkci gene even after 12 days of culture demonstrating that no
wildtype feeders or other cells are present in the EB.
(F)Although the morphological development is abnormal, RT-PCR analysis shows that the Prkci
null EBs are capable of expressing germ layer markers at levels similar to Prkci+/- EBs.

30
2.2.2 Prkci -/- cells retain characteristics of pluripotency in EBs.

Recent studies have shown that EBs generated with cells with a knock-down of the gene
Timeless do not cavitate properly and contain a large number of cells expressing Oct4 in the EB
center core(O'Reilly et al., 2011). These studies suggested to me that a failure of cavitation
could be caused simply by a delay in differentiation and by an accumulation of pluripotent cells
in the EB. Thus, I first tested whether -/-ESCs are resistant to differentiation by examining
colony morphology after removing LIF. Using Alkaline Phosphatase (AP) staining, I found that
after 4 days under differentiation conditions, Prkci -/- ES colonies retained a crisp rounded outer
boundary and had strong AP expression at the edge. In contrast, Prkci +/-colonies had an
uneven outer boundary and lost AP expression at the edge (Fig. 2.2A-A’). To more definitively
mark pluripotent cells in the EB, Oct4 and E-cadherin protein expression was assayed by
immunohistochemistry (Nichols et al., 1998; Redmer et al., 2011). After 12 days of EB
development, Prkci +/- EBs had very few Oct4/E-cadherin positive cells (Fig.2.2B-B’). However,
in null EBs, cells expressing Oct4 protein were found in large clusters. There was some
variability in where Oct4 positive cells could be found, sometimes with the core of the EB (Fig
2.2C’), other times mostly at the outer-most edges of the EB (Fig. 2. 2D’).
I also determined if the Oct4 positive cells in the EB could express another pluripotency
marker, stage-specific embryonic antigen 1(SSEA-1)(Meissner et al., 2007). By examining
adjacent sections in a -/- EB, I found that Oct4 positive cells could also be SSEA1 positive (Fig.
2.2E). To quantify the number of Oct4 and SSEA1 positive cells, Prkci +/-and Prkci -/-day 12
EBs were dissociated and subjected to Fluorescence-activated cell sorting (FACS) analysis.
FACS data showed that Prkci -/- EBs had six times more Oct4 positive cells (22% ± 1.5% vs.
3.5 % ± 2%) and three times more SSEA1 positive cells than Prkci+/- EBs (15% ±1.9% vs. 5%±
1.2% in SSEA1 positive cells) (Fig. 2.2F-G). In order to further examine whether Oct4 positive
and SSEA1 positive cells expressed other stem cell markers, Oct4+ and SSEA1+ sorted cells
31
from day 12 EBs were assessed for the expression of Oct4, Nanog and Sox2 by real time RT-
PCR (using a RealTime Ready custom panel). Sorted Prkci -/-positive cells (dark green bars)
were compared with Prkci +/-ESCs (light green bars) from day 12 EBs and normalized to -/+
whole EBs. I found that these genes were highly upregulated in the Oct4+ and SSEA1+cells null
cells. In addition, relative expression levels were similar to or even higher than those seen in
Prkci +/- ESCs (Fig. 2.2H). Therefore, together these data suggest that Prkci -/- EBs contain
large numbers of pluripotent stem cells despite being cultured under differentiation conditions.

32

Figure 2.2 Prkci -/- cells retain characteristics of pluripotency in several different assays.
(A-A’) After 4 days of culture without LIF, +/- colonies display differentiation at the outer edges
(light alkaline phosphatase staining) while Prkci -/- ESCs still have a pluripotent phenotype
(distinct red boundary at the colony edge).
(B-B’) After 12 days of culture +/-EBs only have a few Oct4/E-cadherin positive cells.
(C-D) Prkci null EBs contain many Oct4/E-cadherin positive cells that can be found in clusters
toward the middle of the EB or at the edges. There are also more E-cadherin positive cells
some of which are not Oct4 positive.
(E-E’) Adjacent sections in a -/- EB show that the Oct4 positive cells are likely also SSEA1+
positive.
(F-G) Flow analysis shows that dissociated day 12 EBs made from Prkci -/- cells contain six
times more Oct4+ cells than found in Prkci +/- EB population. Also, Prkci -/- EBs have three
times more SSEA1 positive cells than found in +/- EBs.
33

Figure 2.2 continued.
(H)Sorted Oct4 and SSEA1 positive cells from Prkci -/- EBs (dark green) upregulate stem cell
marker genes when compared to Prkci +/- EB expression. The levels of expression are similar
to those seen in Prkci +/- Oct4+ and SSEA1+ cells. These data represent one of three
experiments.

34
2.2.3 Functional tests for pluripotency

The expression of pluripotency markers supports the idea that the generation of
pluripotent cells is favored in EBs made from null cells. However, additional functional tests are
needed to determine if these cells behave as expected. For example, if primary EBs have a
pluripotent cell population with the capacity to undergo cell division and self-renewal, it has been
shown that they can easily form secondary EBs (Chan et al., 2003; O'Reilly et al., 2011; Qu et
al., 1997). I therefore tested Prkci -/- and +/- EBs for their ability to generate secondary EBs at
different days of culture. EBs at different stages were collected, dissociated, and re-plated at
2500 cells per 1ul to determine how many new EBs could be generated. Using this assay, I
found that that Prkci -/- EBs generated significantly more secondary EBs compared to Prkci+/-
EBs, especially from day6, day10, and day12 EBs. Even when plated at very low cell density,
(to control for aggregation), cells from Prkci-/- EBs could generate more secondary EBs than
those from Prkci+/-EBs (Fig. 2.3A). Secondary EBs were small but showed similar morphology
to primary EBs (data not shown).
To test whether SSEA1+ cells could maintain pluripotency during ECS culture, FACS
sorted Prkci-/-SSEA1 positive and SSEA1 negative cells were maintained under ES cell culture
conditions. After two days of culture, SSEA1 negative cells were not able to form identifiable
colonies, however, SSEA1 positive cells formed many distinct colonies (Fig. 2.3B-B’). In order to
determine if at even higher passages, stem cell self-renewal could be maintained, I cultured
sorted cells for longer. SSEA1 negative cells could not be maintained in culture, however
SSEA1 positive cells could be maintained for over 27 passages. Interestingly, there was a
distinct difference in the colonies generated from SSEA1+ cells sorted from Prkci+/-EBs and
Prkci-/- EBs. SSEA1+ Prkci+/-cells formed colonies that easily differentiated at the outer edge
even in the presence of LIF (Fig.2.3C). In contrast SSEA1+ Prkci-/- cells maintained distinct
round colonies (Fig. 2.3C’). Next I determined if SSEA1 positive cells expressed various
35
pluripotency and differentiation markers at levels similar to ESCs. Indeed I found that the
expression levels of Oct4, Nanog, and Sox2 genes were similar to the expression levels in
Prkci+/-ESCs. In addition, differentiated markers (Fgf5, T, Wnt3, and Afp) and tissue stem cell
markers (neural stem cell; Nestin, Sox1, and Neurod, cardiac progenitors; Nkx2-5 and Isl1, and
hematopoietic stem cells; Gata1 and Hba-x) were downregulated at levels similar to Prkci+/-
ESCs (Fig. 2.3D). I then determined if the SSEA1 positive cells could be differentiated into all 3
germ layers by generating EBs in the absence of LIF and assessing germ layer markers by RT-
PCR. Endoderm, ectoderm, and mesoderm markers were expressed in EBs made from
SSEA1+ cells suggesting that these cells had a wide range of potential (Fig. 2.3E). These EBs
had an abnormal morphology, however this was not surprising as they were made from Prkci-/-
cells and therefore more likely to look like the phenotype of unsorted Prkci-/- EBs (Fig.2.3F).
Taken together, the data from several assays indicate that the Oct4 and SSEA1 positive
populations that are enriched in Prkci-/- EBs contain pluripotent stem cells that can be
maintained in stem cell culture conditions and have broad differentiation capacity.

36

Figure 2.3 Cells with pluripotent characteristics maintain pluripotency in several assays
(A) A secondary EB assay demonstrates that dissociated -/- EBs can make significantly more
secondary EBs compared to +/- EBs at medium density. Even in low density conditions, -/- EB
cells can generate more secondary EBs (*: p< 0.05, **: p<0.01).
(B-B’) After 2 days of culture sorted -/- SSEA1 negative cells cannot form colonies in ES culture
conditions while sorted -/- SSEA1 positive cells can form stem cell like colonies (red arrows).
(C-C’) Sorted cells can be maintained for many passages (27 and greater). Prkci +/- sorted cells
make colonies that typically have differentiated cells at the edges of the colonies (C). However, -
/- cells form round colonies with distinct edges (C’).
37

Figure 2.3 continued.
(D)Real time PCR shows that sorted -/- cells express stem cell and differentiation markers
(including some tissue stem cell markers)at similar levels to normal ESCs (compared to +/- EBs).
This graph is a representative of three individual experiments.
(E)SSEA1 sorted cells make EBs that can still express three germ layers genes.
(F)These EBs fail to cavitate normally and have a similar morphology to that seen in -/- EBs.

38
2.2.4 Erk1/2 signaling pathway is related to maintenance of stem cells during EB
development.

The maintenance of stem cells has been shown to require the activation of several
pathways (JAK-STAT3)(Niwa et al., 1998) and the PI3K-AKT pathway (Watanabe et al., 2006))
and the inhibition of other pathways (such as Erk 1/2 (Burdon et al., 1999; Kunath et al.,
2007)and GSK (Sato et al., 2004)). I therefore decided to determine if -/-ESCs had any
alterations in these pathways when compared to control (heterozygous) ESCs and also if these
pathways were at all differentially altered when cells were placed under differentiation conditions.
I first investigated the JAK/STAT3 pathway and found that both STAT3 and phosphorylated
STAT3 levels are not grossly altered and that thep-STAT3/STAT3 ratio is similar between
Prkci+/- and Prkci-/-ESCs and EBs (Fig. 2.4A, C).In addition I did not see any difference in AKT,
p-AKT, or B-catenin levels when comparing +/- to -/- ESCs or EBs (data not shown).Thus it
seems unlikely that the effects observed by the loss of Prkci are due to a significant alteration in
these pathways (JAK/STAT3, PI3K/AKT or GSK).
I next investigated Erk1/2 expression and activation. Strikingly, p-Erk1/2 was markedly
inactivated in Prkci-/-vs. Prkci+/-ESCs. In addition, during differentiation null EBs displayed a
strong pErk1/2 inhibition early (until day6). Later, pErk1/2 was activated strongly presumably as
cells in the EB began differentiating (Fig.2.4A-B). Thus these data suggest that the inactivation
of Erk signaling might be involved in the retention of pluripotency in Prkci-/-ESCs and in early
EBs and is consistent with studies showing Erk1/2 activation to be downstream of Prkci in
various mammalian cell types (Boeckeler et al., 2010; Fields et al., 2007; Litherland et al.,
2010).To examine the localization of pErk1/2 during differentiation, I performed immunostaining
on EBs. In control EBs, pErk1/2 was strongly enriched in the columnar epithelia (Fig.2.4D) while
Prkci-/-EBs overall showed lower pErk1/2 levels. In addition cells with high Oct4 expression
showed a marked inactivation of pErk1/2 signals (Fig.2.4D).
39
I next examined SSEA1 positive cells isolated from -/- EBs. As expected based on ES
and EB studies, SSEA1 positive cells isolated from Day 12 -/- EBs had similar pSTAT3
expression levels to that of ESCs (data not shown) while pErk1/2 levels were low in isolated
Prkci-/-SSEA1 positive cells as well as in passaged SSEA1+ cells (data not shown).Thus these
several pieces of evidence indicate that retention of pluripotency in -/- EBs is correlated with a
very strong inactivation of Erk1/2.I also observed that β-catenin was strongly induced in -/-
SSEA1 positive cells compared to ESCs (Fig. 2.4E).

40

Figure 2.4 Erk1/2 signaling pathway is related to maintenance of stem cells.
(A)Western analysis shows that the level of phosphorylation of STAT3 (Tyrosine(Y)705) is
similar between Prkci+/- and -/- ESCs and EBs. Phosphorylation of ERK1/2(Tyrosine(Y)
202/204) is less activated in null ESCs and early day 6 null EBs compared to +/- EBs and
strongly increased at later EB stages.
(B) Quantification of p-STAT3 normalized to non-phosphorylated STAT3.
(C) Quantification of p-ERK normalized to non-phosphorylated ERK1/2.

41

Figure 2.4 continued.
(D) Immunohistochemistry with an anti-ERK 1/2
pY202/Y204
mAb shows that p-ERK 1/2 is strongly
expressed in the columnar epithelium of +/- EBs. There is less expression in null EBs. Oct4
expression does not co-localize with pERK1/2 expression in both EBs.
(E) Level of phosphorylated STAT3 is less in -/- SSEA1+ sorted cells and -/-ESCs than in +/-
ESCs. Inactivation of ERK1/2 is similar among Prkci +/- ES, Prkci -/-ES, and sorted cells. β-
catenin is strongly expressed in -/- SSEA1+ cells compared to +/- ES and -/-ESCs. A
representative of three experiments.

42
2.3 Discussion
Recent studies have shown that Timeless knockdown EBs had persistent Oct4
expression in center of EBs that failed to form cavity and produced more secondary EBs
(O’Reilly et al, 2011). Overexpressed ectopic expression of Oct4 led to expanded epithelial
progenitors and stem cells via increased β-catenin activity and caused dysplasia in mouse
immature intestinal cells at the expense of differentiation(Hochedlinger et al., 2005). Similarly,
Prkci-/-EB did not form a single cavity (Fig.2.1D) and had persistent Oct4 expression
(Fig.2.2.C.D).Significantly a higher number of secondary EBs were generated (Fig. 2.3A).It is
likely that -/- EBs have persistent pluripotent stem cells that can have the capacity of
differentiation according to several functional studies (Fig.2.3).
These Oct4 positive cells were also β-catenin positive (data not shown). Interestingly,
SSEA1 positive cells induced strong β-catenin expression compared to ESCs (data not
shown).Because the Wnt/ β-catenin is the key downstream of Oct4 in progenitor cells
(Hochedlinger et al., 2005) and plays important role in the self-renewal and differentiation of
several stem cells (Wang and Wynshaw-Boris, 2004), these results suggest that sustained Oct4
expression lead to increase β-catenin activity. Thus this ectopic expression of Oct4 in Prkci-/-
EBs may lead to sustain stem cell population via β-catenin activity.
Erk1/2 has been shown to regulate early mouse development in vitro and in vivo(Kunath
et al., 2007; Nichols et al., 2009). Although a direct interaction between Prkci and Erk1/2 has not
been identified,Erk1/2 has been shown to be a downstream effector of Prkci in other contexts.
For example, knockdown of Prkci leads to decreased Erk1/2 signaling in cancer cells and in
chondrocytes (Litherland et al., 2010; Murray et al., 2011). Consistent with the findings that
inhibition of Erk1/2 increases ES cell self-renewal (Burdon et al., 1999), the results here show
inhibition of Erk1/2 activation in Prkci-/- ES, early EBs, SSEA1 positive cells (Fig.2.4A,
E).Therefore, it is likely that loss of Prkci leads to inactivation of Erk1/2 then inactivated Erk1/2
signaling maintains ESC pluripotency in ESCs and early EB development. To clarify whether
43
Prkci is upstream effector of Erk1/2 signaling, I would need to do further studies. Prkcz can
interact with Erk1/2 in mice livers and hypoxia-exposed cells (Das et al., 2008; Peng et al.,
2008). Since Prkcz was expressed in -/- ESC and EB (Fig. 4.1A), it seems that Prkcz can
interact with Erk1/2 protein in Prkci-/- ESCs. This Prkcz-Erk1/2 interaction can give the
differentiation signals to Prkci-/- ESCs. However this signals cannot diminish the effect of Prkci
mediated Erk1/2 inactivation in ESCs maintenance. Prkcz mediated NF-κB signaling is
important for mouse stem cell differentiation (Dutta et al., 2011). NF- ĸB is the downstream of
Prkci mediated cell survival in human leukemia cell line (Lu et al., 2001).Therefore, it seems that
Prkci mediated NF-ĸB activity might be altered in Prkci-/- EBs. Therefore, I cannot exclude the
possibility that NF-ĸB might be inactivated in Prkci-/-EB and ESCs owing to similar homology
and function of aPKC. One recent study shows that Prkci inhibits NF-κB activity in human
epithelial cells(Forteza et al., 2013).Thus, it is possible that NF-κB activity could be increased
via loss of Prkci. If that is the case, the two different isoforms of aPKC might act differently in
stem cell differentiation using different signaling pathways.
LIF mediated STAT3 signaling is important for maintenance of pluripotency in mouse
ESCs culture. During the differentiation of EBs, STAT3 activity was transiently reduced in initial
EB formation and increases after day5 (Xie et al., 2009). Consistent with previous studies, the
activation of p-STAT3 was triggered during EB development and the extent of activity was
similar between Prkci+/- EB and Prkci-/-EBs (Fig. 2.4A). Similar to p-STAT3 (Y705) activity,
pErk1/2 activity was triggered during differentiation (Fig.2.4A). Interestingly, Oct4 positive cells
did not have pErk1/2 activity (Fig.2.4D). Therefore, it is possible that -/- EBs still get
differentiation signals from STAT3 and Erk1/2 signaling but in Oct4 positive cells pErk1/2 activity
is inhibited then this inactivation of pErk1/2 leads to maintenance of the pluripotent population.
In day12 EBs, pErk1/2 activity was highly increased in both Prkci+/- and Prkci-/- EBs which
correlates with increased differentiation. Thus it is possible that Prkcz-mediated Erk1/2 activity
or Prkcz-mediated NF-κB activity exceeds the effect of inactivated Erk1/2 signaling by loss of
44
Prkci in later stage of EBs or that other pathways may be involved in differentiation. Recently
published studies showed that p-STAT3 (Y705) is required for STAT3 mediated maintenance of
pluripotency and p-STAT3 (S727) promotes stem cell differentiation. Phosphorylation of S727 is
mediated by Erk1/2 signaling (Huang et al., 2013). These studies suggest us that p-STAT3
(S727) activity might be reduced in -/- EBs. Further studies are required to confirm whether p-
STAT3 (S727) activity is changed by loss of Prkci in -/- EBs.
E-cadherin is an important regulator of epithelial homeostasis and has been linked to
mouse ESC pluripotency (Chou et al., 2008). Stem cells have more epithelial characteristics
which have more E-cadherin expression compared to differentiated cells (Li et al., 2010). I found
that E-cadherin was expressed everywhere in -/- EBs (Fig.4.4B’) and was sometimes
colocalized with Oct4 (Fig.2.2C’, D’). In Drosophila germline stem cells (GSCs), E-cadherin is
essential for GSCs to anchor to the niche for long term self-renewal (Jin et al., 2008). E-
cadherin absent GSCs rapidly loose anchorage from the niche, leading to differentiation (Song
et al., 2002). Therefore, it is likely that enhanced cell adhesion by loss of Prkci prohibits Oct4
positive stem cell differentiation via enhanced anchorage to the niche. Thus this information
may be another possible reason why our -/- EB has stabilized epithelial structure (Chapter 4).
The Hippo pathway as a major regulator of growth control and organ size is linked with
apical-basal cell polarity(Genevet and Tapon, 2011). Several apically located proteins including
Merlin, Kibra or Expanded act as upstream negative regulators of the Hippo pathway, leading to
the inactivation of Yki/Yap. Overexpression of aPKC induces the mislocalization of Hpo and
reduces the Hippo activity in Drosophila (Grzeschik et al., 2010). Thus aPKCs are the negative
regulator of Hippo pathway. This regulation might be mediated by interaction with Kibra, a
substrate of aPKC (Buther et al., 2004; Genevet and Tapon, 2011). The Hippo pathway is also
related with stem cell self renewal and differentiation (Liu et al., 2012). Overexpression of Yap
inhibits the differentiation of mouse ESC even in the differentiation condition, whereas
knockdown of Yap induces the differentiation of mouse ESC with LIF (Lian et al., 2010; Tamm
45
et al., 2011). In addition, overexpression of Yap in mice intestine promotes expansion of
intestinal stem cell population(Camargo et al., 2007). Thus, defects in this pathway lead to
propagation of progenitor cell population and self-renewal of ESCs. From several evidences I
assume that loss of Prkci might promote the Hippo pathway, resulting in the expansion of stem
cell population. I would need to further examine this hypothesis.

2.4. Summary

In this chapter, I provide evidences that loss of Prkci in EB system induces the retention
of pluripotent stem cell populations. Loss of Prkci results in a failure of the early mouse embryo
to undergo cavitation, with the formation of multiple luminal structures. -/- EBs mimic the
embryonic phenotype. Although the-/- EB has morphological differences, -/- cells can
differentiate into three germ layers. I show that Oct4 positive cells in -/- EBs are pluripotent stem
cells through several functional assays. These pluripotent stem cell populations can be
maintained in stem cell culture, can differentiate into three germ layers, can form secondary EBs,
and show a similar gene expression pattern to +/- ESCs. The maintenance of pluripotency was
related with an inhibition of Erk1/2 signaling in ESCs and early stage of EB.

46
Chapter 3. Multipotency and Prkci

3.1 Introduction

Cells in developing EBs can further differentiate into a wide variety of specialized cell
types such as hematopoietic precursors, cardiomyocytes, and neuronal cells (Desbaillets et al.,
2000). Primitive hematopoiesis is generated in the blood island of the yolk sac at embryonic day
7.5 and contains primitive erythroid and other lineage progenitors. Later definitive
hematopoiesis is generated from fetal liver, spleen, and bone marrow at embryonic day
11(Desbaillets et al., 2000). Similar to embryos, hematopoietic progenitors develop within EBs
(Choi et al., 2005).The blast colony forming cells are first generated transiently, following the
production of the primitive erythroid progenitors. Later definitive erythroid, myeloid progenitors,
neutrophils, mast cells and megakaryocytes develop (Keller et al., 1993; Lieschke and Dunn,
1995). The generation of hematopoietic progenitors can be obtained by allowing EB
development for 5-20 days, followed by replating EB dissociated single cell into special matrigel
with several cytokines (Wiles and Keller, 1991).
EBs produced by a hanging drop or suspension method can generate cardiomyocytes.
Cardiomyocytes are present between an epithelial region and a basal region of mesechymal cell.
(Hescheler et al., 1997). After transferring into plates, beating foci are spontaneously generated
after 1 to 4 days. Continued differentiation leads to an increase in the number of beating foci
(Hescheler et al., 1997). Immature beating cells are mononuclear and rod-shaped, containing
cell-cell junctions that are typically seen in developing heart cardiomyocytes. The assembly of
myofibrils, the development of sacromere structure, and the formation of gap junctions are
occurs during the maturation of cardiomyocytes (Westfall et al., 1997). ESC-derived
47
cardiomyocytes express Gata4 and Nkx2.5 genes before heart specific genes such as ANF,
MLC-2v, α-MHC, β-MHC are expressed (Miller-Hance et al., 1993).
EBs generate neural precursor cells that when transplanted into the rat brain can
differentiate into neurons, astrocytes, and dendrocytes (Brustle et al., 1997). Retinoic acid
promotes the generation of neurons and glial cells derived from neural progenitor within EBs
(Angelov et al., 1998; Fraichard et al., 1995). Therefore, neural progenitor cells generated within
EBs have the ability to differentiate into mature neural cells.
Asymmetric cell division is an important mechanism whereby a single cell divides into
two different cell fate daughter cells during mitosis. Cell polarity and distinct localization of cell
fate determinants is important for asymmetric cell division. The establishment of cell polarity
relies on the evolutionarily conserved Par3-Par6-aPKC complex (Gomez-Lopez et al., 2014;
Henrique and Schweisguth, 2003), then this complex regulates the segregation of cell fate
determinants (Inaba and Yamashita, 2012; Johnson and Wodarz, 2003). The Par3-Par6-aPKC
complex regulates the basal segregation of evolutionarily conserved Numb, a cell fate
determinant. In drosophila neuroblasts, aPKC and par6 interact with lethal giant larvae (Lgl)
during interphase. Lgl and unphosphorylated par6 act as an inhibitor of kinase activity of aPKC.
During mitosis, AuroraA (AurA) mediated phosphorylation of Par6 leads to phosphorylation of
aPKC, then active aPKC can phosphorylate lgl to release it from cortex. Later baz (Par3) can be
associated with Par6-aPKC complex (Betschinger et al., 2003; Wirtz-Peitz et al., 2008). Baz-
par6-aPKC complex can phosphorylate Numb and excluding it from the apical cortex. Then
phosphorylated Numb localizes to basal region (Wang et al., 2006; Wirtz-Peitz et al., 2008). In
mammals, Par3-Par6-aPKC complex also can phosphorylate Numb and regulate unequal
localization of Numb during asymmetric cell division (Smith et al., 2007). Then Numb function as
a cell fate determinant by inhibiting Notch signaling to prevent self-renewal (Wang et al., 2006).
Numb’s interaction with α-Adaptin, an endocytic protein, might regulate the intracellular
endocytosis of Notch signaling (Berdnik et al., 2002; Knoblich, 2008). Stem cells and progenitor
48
cells can be maintained by balancing between self- renewal and differentiation that can be
controlled by asymmetric cell division (Gomez-Lopez et al., 2014). Abnormal asymmetric cell
division by mislocalization and abnormal accumulation of cell fate leads to generation of stem
cell like daughter cells, continuing proliferation, and then resulting in tumor initiation in
Drosophila (Cabernard and Doe, 2009; Goh et al., 2013). Loss of cell polarity proteins such as
E-cadherin, β-catenin, or p53 results in enhanced symmetric cell division because of loss of
control of asymmetric cell division, and then lead to initiation and expansion of tumor in
mammals (Martin-Belmonte and Perez-Moreno, 2012). Thus asymmetric cell division is an
important cellular mechanism to maintain stem cell and progenitor cell population.
In this chapter, I present that loss of Prkci results in enhanced mixed multipotent stem
cell populations. I also hypothesize that favored symmetric cell division by loss of Prkci results in
enhanced generation of pluripotent and multipotent stem cells.

3.2 Results

3.2.1 Neural stem cell populations are increased in Prkci-/-EBs.

As expected based on our previous results, OpenArray analysis showed that day 13-20
Prkci-/-EBs had highly upregulated pluripotency and stemness markers including Oct4, Utf1,
Nodal, Xist, Fgf4, Gal, Lefty1, andLefty2.InterestinglyI also noticed that several markers for
specific tissues and tissue stem cells were highly upregulated in -/- vs. +/- EBs including Sst,
Syp, and Sycp3 (neural related genes), Isl1 (cardiac progenitor marker), Hba-x, and
Cd34(hematopoietic markers) (Fig.3.1A). I therefore decided to determine if loss of Prkci might
favor the generation of neural, cardiac and hematopoietic cells types and/or stem cells.
I first determined whether differentiated neurons and/or neural progenitor cells might be
particularly abundant in Prkci-/- EBs by assessing neural marker expression by
49
immunohistochemistry. Nestin and Pax6 expression are markers of neural progenitor cells and
neural stem cells in particular(Conti and Cattaneo, 2010; Sansom et al., 2009; Tohyama et al.,
1992). Analysis of day 12 EBs showed that null EBs seemingly contained many more Nestin
positive cells than +/- EBs (Fig.3.1B-C). To quantify neurogenesis in -/- vs. +/- EBs, images of
Pax6 immunohistochemistry (which were easier to quantify because Pax6 is nuclear) were
collected at different time points and quantified using a pixel count method(Fogel et al., 2012). I
found that Pax6 positive cells were more abundant in day 9 and day 13 Prkci-/- EBs compared
to +/- EBs although this difference was no longer evident at day 16 of culture presumably
because most of the new neurons had differentiated (Fig. 3.1D). The idea that these neural
stem cells, although null for Prkci, were capable of differentiation was supported by the
observation that an early neuronal marker (Tuj1) and a terminally differentiated neural cell
marker (Map2) were expressed in Prkci-/- EBs (Fig. 3.1C’-C’’). The neuronal fate can be
promoted by Retinoic Acid (RA) both in EBs and ESCs (Bain et al., 1995; Fraichard et al., 1995;
Xu et al., 2012). RA treatment of both Prkci+/- and -/- EBs induced neurons that expressed the
differentiated neural genes Map2 and Tuj1as assessed by RT-PCR (Fig. 3.1E). However the
neural stem cell marker genes (Sox1and Pax6) were still more highly induced in Prkci-/-vs.
Prkci+/- EBs particularly at the day 6 + 4 time-point (Fig. 3.1E).I next examined this induction
with immunohistochemistry and found that RA treatment induced a different response in Prkci+/-
vs. Prkci-/-EBs with RA-treatment inducing a small population of Tuj1 positive cells and a large
population of Nestin positive cells in the null context (Fig. 3.1F-G). Again the RA treated -/-
neurons were not incapable of undergoing differentiation since the neurons could express
terminally differentiated neuronal marker proteins (NeuroD, NeuN, and Map2)(Xu et al.,
2012)(Fig.3.1G’-G’’’). I also assessed the generation of neural cells from ESCs in monolayer
culture using special media that promotes neural stem cells (Xu et al., 2012) supplemented with
a low concentration of RA. Similar to the EB assay, this culture condition results in the induction
of neural cells (Fig.3.1H). Again, I found that Prkci-/-ESCs generated a larger Nestin and
50
smaller Tuj1 positive population compared to Prkci+/- ESCs (Fig.3.1I). Map2 positive and Tuj1
positive cells could still be found in the null cultures suggesting that the neurons that were
generated could still undergo differentiation(Fig. 3.1I’). Thus using several different neural-
induction assays, I find that the absence of Prkci correlates with the production of more neural
stem cells and that although these cells may favor self-renewal, they are still capable of
undergoing differentiation.

51

Figure 3.1 Neural stem cell populations are increased in -/- EBs.
(A)Day 13-20 +/- and -/- EBs were assayed by a stem cell panel OpenArray. The genes listed
here were highly upregulated with the bolded genes upregulated 4Cts or higher. In particular,
Oct4 and Utf1 (pluripotent stem cell markers), Hba-x and CD34 (hematopoietic cell markers),
Islet-1(cardiac marker), and Sst, Syp, and Sycp3 (neural related genes) are highly upregulated.
(B-C)Both Prkci +/- and Prkci -/- EBs have Nestin positive populations (neural stem cell marker)
after 12 days of culture. Tuj1 (early neuronal marker) and Map2 (terminally differentiated
neuronal marker) are expressed in -/- EBs after day 12 of culture (C’ and C’’).
(D) Day 13 EBs were analyzed for Pax6 expression and then images were used to analyze
levels of expression. The pixel count ratio of Pax6 positive cells in -/- EBs is significantly higher
than found in +/- EBs.
(E)RA treatment in EB culture induces upregulation of neural stem cell markers (Pax6, Nestin,
and Sox1) and neural differentiation markers (Map2 and Tuj1)in both Prkci +/- and -/- EBs.

52

Figure 3.1 continued.
(F)Retinoic acid (RA) treatment induces differentiation into neurons. In Prkci +/- EBs the
induction at day 4 of culture results in more Tuj1 positive neurons than Nestin positive neurons.
(G)However, inducted -/- EBs have, at the same time point, a small Tuj1 population and a larger
Nestin positive population. Although small Tuj1 populations exist in -/- EBs, these cells can
terminally differentiate into neural cells (G’-G’’’) (H) Similar to RA treatment, Prkci -/-ESCs
cultured inN2B27, a media that supports neural stem cells, produces more Nestin positive cells
and few Tuj-1 positive cells (I). -/-cells can still differentiate into Map2 (inset) and Tuj-1 positive
cells (terminal neural cells)(I’).

53
3.2.2 Cardiomyocyte and erythrocyte progenitors are increased in Prkci -/- EBs.

I was further intrigued by the strong expression ofIsl1 (a cardiac stem cell marker) in
Prkci-/-EBs in our OpenArray analysis, so I examined EBs for Isl1 expression by
immunohistochemistry. I found that Prkci-/- EBs contained larger Isl1 clusters compared with
Prkci+/-EBs and this was confirmed using an image quantification assay (Fig. 3.2A-A’, C). RA
treatment can promote cardiac fates in vitro (Niebruegge et al., 2008; Wobus et al., 1994).
Although cardiac progenitors are marked by Isl1 expression, differentiated cardiac cells and
ventral spinal neurons also express Isl1(Ericson et al., 1992), therefore I also examined the
expression of Nkx2.5 (a better stem cell marker and also a regulator of cardiac progenitor
determination (Brown et al., 2004) by immunohistochemistry and by RT-PCR.I found that
Nkx2.5 was highly upregulated even without RA induction in null EBs (Fig.3.2D). RA induction
led to more cells expressing Nkx2.5 in both Prkci +/- and -/- EBs (Fig.3.2D). In addition, cells
expressing Nkx2.5 were more prevalent in RA treated Prkci-/- EBs compared to +/- EBs
(Fig.3.2B-B’).
The abundant cardiac progenitors found in -/- EBs are capable of undergoing
differentiation based on immunohistochemistry for α-Actinin in untreated and RA treated EBs
(Fig.3.2E-E’, F-F’). When comparing patterns of expression, I noticed that α-Actinin was
expressed in the outer epithelial region in both -/- and +/- EBs but also expressed with the core
of null EBs (Fig. 3.2E-E’). In addition more cells exhibited the striated pattern characteristic of α-
Actinin in -/- vs. +/- EBs with RA induction(Fig. 3.2F-F’). Cardiomyocyte function could be
assessed by determining the percentage of EBs at Day 6 and 12 that were visibly beating(Fig.
3.2G). More beating Prkci-/- EBs at both time points suggesting that the abundant
cardiomyocyte progenitors in the null EB are fully capable of undergoing differentiation.
Hba-x (hemoglobin X, alpha-like embryonic chain in Hba complex or zeta globin)(Leder
et al., 1997) and Cd34expressionis increased in null EBs (Fig.3.1A). Hba-x mRNA expression is
54
restricted to blood islands within the yolk sac (Lux et al., 2008) and is found in the primitive
erythrocyte populations (Trimborn et al., 1999). Cd34 is primitive hematopoietic stem cell
marker and plays a significant role in early hematopoiesis (Sutherland et al., 1992). This
suggested to me that null EBs might contain abundant primitive HSCs. To examine whether
primitive hematopoietic progenitors can differentiate into erythrocytes, a colony forming assay
(Baum et al., 1992; Miyamoto et al., 2007) was performed with cells isolated from dissociated
null and heterozygous EBs at different time points. I found that red colonies (Fig.3.2I) were
produced significantly earlier and more readily in Prkci-/- compared to Prkci+/-EBs(Fig.3.2H).By
Realtime-PCR, upregulation of Hba-x, Cd34, and Sca1 genes confirmed the results of
OpenArray (Fig.3.2J). In addition, I found Gata1, an erythropoiesis-specific factor, and Epor, an
erythropoietin receptor that mediates erythroid cell proliferation and differentiation (Zhou, 2001),
to be highly upregulated in Prkci-/-EBs vs. Prkci+/-EBs (Fig.3.2J). These data indicate that the
loss of Prkci promotes the generation of primitive erythroid progenitors that can differentiate into
erythrocytes.
To determine if the tissue stem cells identified above were also represented in the Oct4
positive population that I described earlier, I examined the expression ofPax6, Isl1, and Oct4 in
adjacent EB sections. I found that cells expressing Oct4 appeared to represent a distinct
population from those expressing Pax6 and Isl1 (although some cells were Pax6 and Islet1
double positive) (Fig. 3.2K-M).

55

Figure 3.2 Cardiomyocyte and erythrocyte progenitors are increased in Prkci -/- EBs.
(A-A’, E-E’) Immunohistochemistry shows that Prkci-/- EBs have more Islet1 (cardiac progenitor
marker) and α-Actinin (differentiated marker) positive cells compared to Prkci+/- EBs.
(C) The pixel count ratio for Islet1 expression indicates that null EBs have significantly larger
Islet-1 populations than +/- EBs (p<0.01).
(B-B’, D, F-F’) Using an RA cardiomyocyte induction assay, Nkx2.5 is more highly expressed in
-/- than in +/- EBs, and is more induced with RA treatment (D).RA treatment induces more Nkx
2.5 and α-Actinin expression in -/- than in +/- EBs (B and B’, F and F’).
(G) Null EBs generate significantly more beating EBs with RA treatment compared to +/- EBs
(***:p<0.001, *:p<0.05).
56

Figure 3.2 continued.
(H) Dissociated -/- EBs of different stage can generate early and more red colonies in an HSC
colony forming assay (**:p<0.01).
(I) Examples of red colonies.
(J) Relative HSC marker gene expression is upregulated in -/- whole EBs compared to +/- EBs.
A representative of three independent experiments.
(K-M) Pax6 and Islet1 populations don’t necessarily overlap with the Oct4+ population. Some of
PAX6 positive cells colocalize with Islet1 positive cells.

57
3.2.3 Prkci-/-cells preferentially undergo symmetric cell division

Atypical PKCs (Prkci and Prkcz) have been shown to be important regulators of
asymmetric cell division (Inaba and Yamashita, 2012; Noatynska and Gotta, 2012). Altering the
regulation of asymmetric cell division by manipulating cell polarity related genes leads to the
production of stem-cell like progenitors (neuroblasts)during fly neurogenesis (Cabernard and
Doe, 2009; Goh et al., 2013). Numb is an important cell fate determinant during cell division
(Petersen et al., 2004) and its activity has been shown to regulated by the aPKC complex
(Nishimura and Kaibuchi, 2007; Smith et al., 2007). In addition Numb has been found to interact
directly with Prkci in HeLa cells (Nishimura and Kaibuchi, 2007). Because localization of Numb
can be used as an indicator of symmetric or asymmetric cell division, I examined the expression
and localization of Numb in different contexts. Differences in Numb expression were evident
even in whole EBs. Prkci+/-EBs had a distinct polarized expression of Numb particularly in the
ectodermal and endodermal epithelia (Fig.3.3C). However, Prkci-/-EBs exhibited a more even
distribution of Numb (Fig. 3.3D). To quantify and more clearly observe Numb expression, I
carried out several different assays with both -/- and +/- EBs and ESCs. Cells were scored
according to their Numb expression pattern (symmetric or asymmetric, examples shown in Fig.
3.3C’-D’’in whole EBs, dissociated EBs, differentiated ESCs, and differentiated dissociated
ESCs. I found that regardless of the condition, the symmetric Numb localization pattern was
more prevalent in -/- cells (Fig. 3.3A). I then asked whether the symmetric pattern was more
prevalent in the Oct4 positive subpopulation in the null context by immunostaining for both Oct4
and Numb expression and scoring the Oct4 positive cells. I found that in the Oct4 positive
population, symmetric Numb distribution was more prevalent in the Prkci-/-vs. Prkci+/-context
(Fig. 3.3B). Similarly, to determine whetherPax6 positive cells (presumed neural stem cells)in -/-
EBs were more likely to exhibit symmetric Numb localization, EBs were co-stained with Pax6
and Numb. I found that the Pax6 positive cells in -/- EBs showed significantly more symmetric
58
cell division than in +/- EBs (Fig. 3.3E). These data suggest that within the Oct4 and Pax6
subpopulations (which would be expected to exhibit more symmetric Numb localization) loss of
Prkci favors even more symmetric Numb localization.
Because Numb can be phosphorylated by aPKCs (both Prkci and Prkcz) (Smith et al.,
2007), loss of Prkci might be expected to lead to a decrease in the phosphorylation status of
Numb. There are three phosphorylation sites, serine7 and serine276, and serine295, in Numb
that could be aPKC mediated (Smith et al., 2007). I tested two phospho-Numb antibodies
(Ser295and Ser276) to determine whether p-Numb activity was decreased by loss of Prkci. I
could not detect any p-Numb(Ser295) activity on our EB system. However, I found that p-
Numb(Ser276)was strongly inactivated in Prkci-/- vs. Prkci+/- EBs (Fig. 3.3F-G). Thus, loss of
Prkci leads to a decrease in the phosphorylation of Numb.
Inhibition of Notch signaling by Numb has been observed in flies and mammals (Berdnik
et al., 2002; French et al., 2002). Notch signaling also plays an important role in the balance
between stem cell maintenance and differentiation in various types of stem cells (Artavanis-
Tsakonas et al., 1999; Bray, 2006; Chiba, 2006). I investigated whether reduced Numb activity
might lead to enhanced Notch signaling in Prkci-/-EBs. Notch1 and Hes5 are expressed in
mouse embryo tissue (Katoh and Katoh, 2007; Swiatek et al., 1994). Thus I investigated
activated Notch1 and a downstream transcriptional target Hes5 by immunohistochemistry. In
Prkci-/- EBs I found widespread expression of activated Notch1 at or near the membrane of
most cells (Fig.3.3J -J’) while in +/- EBs, this pattern was observed only in Oct4 positive cells
(Fig.3.3I). The downstream target of Notch signaling, Hes5 was broadly expressed in both -/-
and +/- cells (data not shown) but more strongly expressed in Oct4 positive cells. Taken
together, these results suggest that loss of Prkci result in an increase in symmetric cell division
due to a decrease in Numb activity and enhanced Notch signaling. The combined effects of
favored symmetric cell division and increased Notch activity might lead to sustained pluripotent
and multipotent stem cell populations (Fig. 3.3H).
59
Figure 3.3 Prkci -/- cells undergo symmetric cell division preferentially.
(A)Diffuse expression of Numb (symmetric cell division) is favored in the -/- EB in whole
population, dissociated cells from the EB, differentiated ESCs, and dissociated ESCs (p<0.05).
(B)Prkci null Oct4 positive cells have symmetric Numb distribution when compared to +/-
(p<0.05).
(C-D)Numb expression and localization in whole EBs. Prkci+/-EBs have a distinct polarized
Numb localization within epithelia and is strongly expressed in the endoderm while Prkci-/- EBs
have a more even distribution of Numb. Examples of asymmetric Numb expression (C’) and
symmetric expression (C”) in Prkci+/- differentiated cells. Examples of symmetric Numb division
(D’) and asymmetric cell division (D”) in -/- differentiated cells.
(E) Pax6 positive cells also have preferentially symmetric cell division in -/- EBs (p<0.01).
(F-G)Immunohistochemistry against phospho-Numb (Ser276) shows decreased Numb
phosphorylation in -/- vs. +/- EBs. (H) Working models.
60

Figure 3.3 continued.
(I-J) Activated Notch1 is found in membrane of most null cells including Oct4 positive cells
while in Prkci+/- EBs, membrane Notch1 is only found in the Oct4+ cells.
(K-K’) Oct4 positive cells have Hes5 expression in nucleus.
61
3.2.4 Additional loss of Prkcz results in an even higher percentage of cells that are Oct4,
SSEA1, and Stella positive.

A selective PKC inhibitor (Gö6983) that inhibits PKC α, β, γ, δ, and ζ is sufficient to
maintain mouse and rat ESCs in the absence of LIF(Gschwendt et al., 1996). Among the PKC
isoforms, Prkcz is important for differentiation of mouse and rat ESCs(Dutta et al., 2011;
Rajendran et al., 2013). aPKC (Prkci and Prkcz) share 72% homology in amino acid sequence,
especially in the kinase domain (Akimoto et al., 1994). Data here and recent studies (Dutta et al.,
2011; Rajendran et al., 2013) suggested that treating Prkci -/- cells with this PKC inhibitor, might
lead to better stem cell maintenance compared to inhibition of just Prkci. I found that under
differentiation conditions Prkci +/- ESCs treated with the inhibitor for 4 days still underwent
differentiation (Fig. 3.4A), while treated Prkci -/- ESCs stayed undifferentiated (Fig. 3.4A’). Drug
treatment of +/- EBs could enhance the generation Oct4 expressing cells(Fig. 3.4B) while
treatment of -/-EBs resulted in an even larger Oct4 positive population (Fig. 3.4B’). To quantify
the number of Oct4 positive cells in drug treated EBs, I sorted cells based on fluorescent
labeling. I found that drug treatment doubled the number of Oct4 positive cells in both Prkci+/-
and Prkci-/- EBs (Fig. 3.4C-C’). Interestingly, drug treatment further boosted the generation of
SSEA1 positive cells tripling the number of SSEA1 positive cells in both -/- and +/- EBs (Fig.
3.4D’).
SSEA1 is expressed in Blimp1 positive primordial germ cells (PGCs) derived from
mouse epiblast stem cells(Hayashi and Surani, 2009). Also PGCs are derived from
SSEA1+/Oct4+ cells within EBs (Geijsen et al., 2004). Thus I speculated that the increase in
SSEA1 and Oct4 due to Gö6983 treatment could represent an increase in the generation of
PGC-like cells instead of undifferentiated ESCs. I therefore examined Stella (a marker of PGCs)
expression. As expected, +/- EBs contain small clusters of Stella positive cells as is typical for
EBs made of wildtype cells (Fig. 3.4E)(Ohinata et al., 2005; Payer et al., 2006). The addition of
62
Gö6983to Prkci +/- EBs induced a modest increase in the number Stella positive cells present in
the clusters (Fig. 3.4F). Without drug treatment, null EBs contained more clusters and the
clusters contained more Stella positive cells when compared to +/- EBs (Fig. 3.4E and G).
Interestingly when Prkci -/- EBs were treated with Gö6983the generation of Stella positive cells
was strongly enhanced(Fig. 3.4G and H).Because undifferentiated ESCs can still express
Stella(Hayashi et al., 2008; Payer et al., 2006), I co-stained EBs for Stella and VASA (a more
differentiated PGC marker). I found many cells that were double positive (a little less than half)
(Fig.3.4K) but that there were also VASA only (Fig.3.4J) and Stella only (~2x more than VASA
only) positive populations (Fig. 3.4I). Therefore, the combined effect of both loss of Prkci and
inhibition of Prkcz via Gö6983 treatment leads to the production of Stella and VASA positive
PGC-like cells.

63

Figure 3.4 Additional loss of Prkcz results in an even higher percentage of cells that are
Oct4, SSEA1, and Stella positive
(A) Prkci+/-ESCs differentiate without LIF after 4 days even in the presence ofGö6983. Null
ESCs with drug treatment form distinct colonies even under differentiation conditions (A’).
(B) The addition of the drug results in increased Oct4 positive populations in +/- EBs while drug
treatment of the null EB results in an even larger Oct4 positive population (B’).
(C-D)An even higher percentage of cells are Oct4 positive (C-C’) and SSEA1positive (D-D’)
when +/- or -/- cells are treated with Gö6983.

64

Figure. 3.4 continued.
(E-F) More Stella positive clusters containing a larger number of cells are present in drug
treated +/- EBs.
(G-H) Null EBs also have more Stella positive clusters and cells. Drug treated null EBs exhibit a
dramatic increase in the number of Stella positive cells.
(I-K) Some of Stella positive cells are VASA positive in drug treated null EBs (yellow arrows).
There are VASA only positive cells (green arrow) and Stella only positive cells (red arrow) in
drug treated null EBs.

65
3.3 Discussion
In this chapter, I suggest that balanced symmetric cell division and asymmetric cell
division is required for stem cell maintenance and differentiation.
Asymmetric cell division generates two different cell fates. Asymmetric localization of
cell fate determinants regulates asymmetric cell division. In drosophila, the neuroblast divides
asymmetrically then gives rise to one neuroblast and one ganglion mother cell. Asymmetric
localization of Numb is associated with this asymmetric cell division(Knoblich et al., 1995) and
this Numb distribution is regulated by aPKC complex (Nishimura and Kaibuchi, 2007; Smith et
al., 2007). I have observed that symmetric Numb distribution was significantly increased in -/-
EBs and Oct4 positive and Pax6 positive cells also have equal distribution of Numb (Fig.
3.3A,B,E). Similarly, mutated Numb in larval brain can induce the overproduction of neuroblasts
(Lee et al., 2006a; Wang et al., 2006). Loss of Lgl, a basally localized fate determinant leads to
an increase of the number of neuroblast in mutant fly (Lee et al., 2006)(Lee et al., 2006b).
Drosophila aPKC mutants have a decreased cell proliferation in neuroblasts and reduced aPKC
in lgl mutant recovers normal phenotype that has normal number of neuroblasts (Rolls et al.,
2003).Elevated aPKC activity in lgl mutant fly leads to production stem cell like progenitors by
abnormal Numb segregation in fly neuroblast (Haenfler et al., 2012).Therefore, aPKC is
essential for the self-renewal of neuroblast in Drosophila and mislocalization of aPKC induces
abnormal production of neuroblasts (Haenfler et al., 2012; Lee et al., 2006a; Rolls et al.,
2003).In mammals, loss of Lgl-1, an isoform of Lgl inhibits differentiation of neural progenitor
and promotes cell proliferation, resulting in neoplasia formation (Klezovitch et al., 2004).
Reduced Par3 and Par6 by shRNA leads to neuronal progenitor differentiation via symmetric
cell division, overexpression of Par3 or Par6 inhibits the differentiation of neuronal progenitor
through symmetric cell division(Bultje et al., 2009; Costa et al., 2008). Therefore, aPKCs
promotes self-renewal of stem cells in both Drosophila and mammalian neural cells. Unlike
66
previous studies, Prkci-/- EBs had the expansion of pluripotent and multipotent stem cells via
favoring symmetric cell division (Fig.2.2-3, 3.1-2). Similar to our results, inhibition of aPKCs
prohibits the differentiation of pheochromocytoma cells (Coleman and Wooten, 1994), in other
hands, overexpression of aPKCs in pheochromocytoma cells enhanced nerve growth factor
responses and differentiation(Coleman and Wooten, 1994). In fly Lgl mutants, aPKCs are
mislocalized into basal cortex (Lee et al., 2006b) or enhanced cortical region (Haenfler et al.,
2012). Thus, it seems that the misexpression of aPKC leads to symmetric cell division in several
contexts, resulting in the self-renewal of stem cells. Several previous studies and results here
suggest that abnormal regulation of asymmetric cell division by defects in cell fate determinant
localization leads to induction of inappropriate stem cell populations in lower organism and in
mammals. Inconsistent with our observation, loss of Prkci leads to more asymmetric cell division
in hair cells and induces loss of hair stem cells(Niessen et al., 2013).. They suggest that Prkci is
important for epidermal homeostasis and regulation hair stem cell maintenance versus
differentiation through the function of balancing asymmetric cell division and symmetric cell
division(Niessen et al., 2013). Even though loss of Prkci acts differently in different cell context,
the balance between self-renewal and differentiation is crucial for tissue differentiation.
I observed that loss of Prkci promotes generation of multipotent stem cell such as HSC,
cardiomyocytes, and neural stem cells (Fig. 3.1-2).How can these mutipotent tissue stem cells
be generated? Notch signaling plays an important role in balancing between stem cell
maintenance and differentiation in various of type of stem cells (Artavanis-Tsakonas et al., 1999;
Bray, 2006; Chiba, 2006). Sustained Notch1 activity in embryonic progenitor cells maintains
stem cell and progenitors in an undifferentiated state. However, reactivation of Notch signaling
in newly postmitotic retinal cells leads to complete cell differentiation (Jadhav et al., 2006).
Several studies show the relevance of Notch signaling in HSC differentiation. Notch signaling is
active in HSCs in vivo and reduced during HSCs differentiation. Inhibition of Notch activity
promotes differentiation of HSC(Duncan et al., 2005). In addition, overexpression of
67
constitutively active Notch1 in hematopoietic progenitors and stem cells allows the self-renewal
of HSCs and increased HSC generation (Stier et al., 2002; Varnum-Finney et al., 2000). Recent
studies show that Notch pathways regulate mesodermal cardiogenic differentiation (Rones et al.,
2000). The sustained constitutive activation of Notch1 simulates proliferation of immature
cardiomyocytes in rat myocardium. Several previous studies suggested that activation or
sustained Notch signaling lead to self-renewal of tissue stem cell and increased tissue stem cell
populations. Thus these studies might suggest possible mechanisms for how several tissue
stem cells are significantly produced in -/- EBs. Loss of Prkci promotes equal distribution of
Numb which then lead to symmetric cell division. P-Numb activity is decreased leading to
enhanced Notch activity. Enhanced Notch activity in undifferentiated cells then promotes
generation of tissue stem cells (Fig.3,3H). As evidence for this idea, I noticed that p-Numb was
significantly reduced and activate Notch1 and Hes5 were highly expressed in -/- EB and Oct4
positive cells in -/- EBs (Fig.3.3F-G,I-K’). For better understanding between Notch signaling and
production of tissue stem cells, I would need to investigate whether tissue stem cells can
express Notch and downstream Hes1 and Hes5, and if the treatment with Notch inhibitors such
as DAPT or γ-secretase inhibitor can reduce tissue stem cell populations (Milano et al., 2004;
van Es et al., 2005). Also I need to elucidate the reason why mixed tissue stem cell populations
are generated in Prkci-/- EBs. Sustained Hes1 expression leads to a resistance to differentiation
but can also lead to favored mesodermal fates in mouse ESCs upon induction of differentiation
(Kobayashi and Kageyama, 2010). Because HSC and cardiomyocyte are induced from
mesodermal progenitors, these studies suggest another possible reason for enhanced HSC and
cardiomyocyte generation.
Prkci is required to form AJs and maintain cell polarity in neuroepithelium. Inhibition of
Prkci in mice leads to a disruption of AJs and epithelial structure (Imai et al., 2006). Knockdown
of Prkci in mouse brains reduces Tuj-1 positive cell populations in neural precursor cells.
Reduced Prkci promotes Tbr2 positive basal progenitors and decreases Pax6-positive and Sox2
68
positive radial precursors (Wang et al., 2012). Consistent with these studies, neural induction of
Prkci-/- EBs and ESCs led to reduced Tuj1 positive cells and strongly increased Nestin positive
cells (Fig.3.1 F-I). Promoted Pax6 positive populations in -/- EBs is inconsistent with previous
studies (Wang et al., 2012) (Fig.3.1.D) Because Nestin/Vimentin double positive cells can
become radial cells, further efforts are required to clarify whether Nestin positive cells can
differentiate into a radial precursor to confirm previous studies. However, the link between Prkci
and increased neural stem cell population has not been studied yet. Several published studies
might give a clue for answer. Par3 as a scaffold protein of aPKC complex is important for
regulating asymmetric cell division of neural precursor cell via Notch activity. Knock down of
Par3 in the cortex leads to increased symmetric cell division via Numb activity (Bultje et al.,
2009). Activation of Notch signaling is known to maintain NSC character in contrast, inactivation
of Notch signaling leads to neuronal differentiation and depletes the NSCs(Bertrand et al., 2002;
Kageyama et al., 2008). These previous studies suggest that loss of Prkci might lead to
enhanced Notch signaling then promote increased neural stem cell population. To confirm this
hypothesis, I would need to examine whether neural stem cells have enhanced Notch activity
and inhibition of Notch signaling leads to reduced neural stem cell populations.
Stella and VASA are both considered strong hallmarks of PGCs and their expression in
EBs suggests the presence of cells with PGC-like characteristics. Loss of Prkci resulted in EBs
that contained slightly more PGC-like cells than EBs made from +/- cells suggesting that
inhibition of Prkci is important for PGC generation. Furthermore, although inhibition of PKC α, β,
γ, and δ might also play a role, inhibition of both aPKCs by treating Prkci null cells with the
Prkcz inhibitorGö6983, strongly promoted the generation of Stella/Vasa double positive cells
(Fig. 4.4K).It is unclear what the mechanism for this might be however one possibility is that
blocking both aPKCs is necessary to promote symmetric Numb localization/Notch activation in
PGCs or in PGC progenitor cells which may have ordinarily have strong inhibitions to expansion.
Another possibility is that E-cadherin mediated cell-cell interactions play an important role in
69
PGC formation. Studies have shown that E-cadherin is crucial for germ cell formation and fate
determination among cells containing PGC precursors located within the extra-embryonic
mesoderm (Okamura et al., 2003).E-cadherin is highly expressed in -/- EBs (Fig.2.2 C-D) and
treatment of -/- EBs with Gö6983 strongly increased the generation of E-cadherin positive and
Stella positive cells (Fig. 4.4B’ and data not shown).Enhanced E-cadherin mediated cell-cell
interaction might enhance the specification of PGC precursor and generate more PGC-like cells.
I also need to further investigate whether enhanced PGC production is due to enhanced
proliferation of PGC or enhanced PGC precursor. I noticed that the number of single PGCs was
more increased in double inhibition treatment EBs compared to control EBs. However, Prkci +/-
and Prkci-/-EBs without PKC inhibitor treatment have small clusters of PGC suggesting a few
numbers of PGC precursors (Fig.3.4E-F). I might assume that more PGC precursors are
generated in aPKC double inhibition condition.
Prkci has been identified as a human oncogene, a useful prognostic marker for cancer
and a therapeutic target for the cancer treatment (Fields and Regala, 2007). Overexpression of
Prkci is found in epithelial cancers such as non-small cell lung cancer (NSCLC) cell
lines(Regala et al., 2005) and ovarian cancer (Zhang et al., 2006). In addition, Prkci has been
identified as a critical target of frequent, tumor-specific somatic genetic alteration by gene
amplification and Prkci gene amplification is an important mechanism that drives Prkci
expression in these tumors (Fields et al., 2007). Indeed, the inhibition of Prkci has been
considered as an effective sensitizer for chemotherapy (Jin et al., 2008). However, because
inhibition of Prkci leads to enhanced stem cell generation, results here suggest that Prkci
inhibitor treatment as a therapy for cancer might lead to unintended consequences (tumor
overgrowth). Thus, extending these findings to human stem and cancer stem cells is needed.

70
3.4. Summary

In this chapter, I provide evidence for the hypothesis that favored symmetric cell division
induces the retention of stem cell populations and enhanced specific multipotent stem cell
populations. I show that neural stem cells, cardiac, and erythrocyte progenitors are increased in
-/- EBs compared to +/- EBs. These progenitors can differentiate into specific cell types when
differentiation is induced. I also find that symmetric cell division is favored in -/- EBs even more
in Oct4 positive and Pax6 positive cells. I also show that enhanced Notch signaling likely due to
defective Numb activity is detected in -/- EBs and more strongly in Oct4 positive cells. In
addition, additional inhibition of Prkcz results in an even higher percentage of cells that express
Oct4 and SSEA1and interestingly also Stella and VASA. By these several evidences, I suggest
that asymmetric cell division and cell polarity function of Prkci is essential for embryonic stem
cell differentiation and the balance between maintenance of pluripotency and differentiation in
ESCs and EBs.

71
Chapter 4. Prkci, cell polarity, and cavitation

4.1 Introduction
Programmed cell death (apoptosis) is associated with the formation of
cavities(Coucouvanis and Martin, 1995). Two growth factors: Bmp4 and Bmp2 are identified as
cell death signals involved in EB cavitation (Coucouvanis and Martin, 1999). During the
development of the endoderm in the EB, Bmp4 is produced from the ectodermal core of the EB,
while BMP2 is generated from the endoderm. Bmp2 and Bmp4 act as stimulators to promote
visceral endoderm differentiation. However, during cavitation, BMP4 and BMP2 are secreted
into the core of EB and proposed to lead to cell death in the center. In support of this idea, the
artificial treatment of BMP protein results in the induction of visceral endoderm and cavitation in
S2 EBs that do not form visceral endoderm or undergo cavitation. In addition, the inhibition of
BMP signaling by expressing a dominant negative BMP receptor IB leads to suppression of
visceral endoderm formation and cavitation (Coucouvanis and Martin, 1999).
The aPKC complex is essential for the formation of TJs and AJs in Drosophila and
mammalian epithelial cells (Martin-Belmonte and Perez-Moreno, 2012). In Drosophila, the loss
of aPKCorPar6 or Par3 results in polarity defects in diverse cell types and lethality of the
embryo (Harris and Peifer, 2005; Muller and Wieschaus, 1996; Petronczki and Knoblich, 2001).
aPKC activity is not required for initial recruitment of the AJs but is essential for the maturation
and maintenance of AJs in Drosophila epithelia (Harris and Peifer, 2007). In mammalian
epithelial cells, the aPKC complex is also required for the development of TJs and AJs and the
formation and maintenance of apical-basal polarity (Suzuki et al., 2001). Misexpression of a
dominant negative form of aPKC leads to mislocalization of Par3 and ZO-1 in MDCKII cells.
Also defective aPKC by overexpression of dominant negative form of aPKC results in
mislocalized and diffused expressions of Na(+),K(+)-ATPase , a basolateral membrane marker,
72
and gp135, an apical membrane marker. Another study shows that Prkci inactivation by
expressing a dominant negative form of Prkci does not block the initial formation of spot-like TJs
and AJs but inhibits the development into linear structure of TJs and AJs in MTD1-A epithelial
cells (Suzuki et al., 2002). Conditional knockout of Prkci in neuroepithelial cells results in the
loss of AJs, defective nuclear migration, and shortened apical processes, leading to impaired
neuroepithelial structure (Imai et al., 2006). Therefore, inhibition of expression of Prkci leads to
defects in AJ and TJ structure and thus apical basal polarity in both Drosophila and mammals.
The precise pathways downstream of Prkci that mediate epithelial organization have not
been identified in detail. Ezrin is involved in cellular functions including epithelial cell
morphogenesis, polarity and cell adhesion (Fehon et al., 2010). Previous studies(Wald et al.,
2008) have shown that Prkci interacts with Ezrin according to pull down and
coimmunoprecipitation (CoIP) assays, and activated Prkci leads to the phosphorylation of Ezrin
on the apical side of polarized human intestinal cells in culture. Knockdown of endogenous Prkci
by shRNA and expression of a dominant negative Prkci -/- inhibit the phosphorylation of Ezrin at
the threonine 567residue.Recent studies also show that the inhibition of aPKCs by PKC specific
inhibitor or RNAi leads to a decrease of level of phosphorylated Ezrin (T567) during mouse
eight-cell embryo compaction (Liu et al., 2013). These studies suggest that Prkci and Prkcz are
required for the phosphorylation of Ezrin T567 during mouse eight-cell embryo compaction and
aPKCs act as a key kinase of Ezrin phosphorylation. Therefore, these several studies
suggested to me that Ezrin might be a downstream effector of Prkci during EB development.
The aim of this chapter is to address whether cell polarity is essential for the formation of
cavities in EBs. I examined BMP signaling, overexpressed Ezrin into EBs to see whether
cavitation is rescued, and studied mixed EB formation using wildtype ESCs and Prkci-/- ESCs to
see whether cavitation is recovered.

73
4.2 Results
4.2.1 Cavitation and polarity are defective in Prkci-/- embryoid bodies.

Our previous research showed that loss of Prkci in EB development led to the formation
of multiple cavities or a failure of cavitation (Fig. 2.1.D) and these observations have been
confirmed by others(Seidl et al., 2013). For previous studies, I used two different Prkci-/- ES
cell lines which had been generated by selection for a gene conversion event. To determine
whether knockdown of Prkci has same effect, I used a lentivirus system to knock down Prkci.
Because I already knew that one allele knockout did not affect the embryo or EB phenotype or
the levels of expression of Prkci (see Fig 2.1), I decided to knockdown Prkci in Prkci +/- ESCs
instead of wild type ESCs. To check the efficiency of knockdown, RT-PCR was performed.
Compared to non-silencing shRNA, expression of shPrkci led to no expression of Prkci in two
clones but Prkcz was similarly expressed in both non silencing and shPrkci treated ESCs
(Fig.4.1A). Day3 and day14 EBs made from Prkci knockdown Prkci+/-ESCs still had the
expression of GFP that marks shPrkci expressing cells. Thus the efficiency of shPrkci persisted
during EB culture. To compare EB development in non-silencing shRNA and shPrkci tranduced
ESCs, EBs were collected after different time-points, fixed, sectioned and examined
histologically with nuclear fast red staining. In non-silencing shRNA transduced EBs, a single
cavity surrounded by a columnar epithelium formed (Fig. 4.1.C). However, shPrkc iinfected
Prkci+/- EBs failed to form a cavity (Fig. 4.1.C’). Therefore, knockdown of Prkci leads to a failure
of cavitation similar to the null cells. In order to examine whether Oct4 expression is expressed
in a large number of cells within the Prkci knock down +/- EBs, immunohistochemistry was
performed. Consistent with previous studies (Fig.2.2.C’, D’), Oct4 was expressed in many cells
within shRNA transduced Prkci +/-EBs. Thus, reduction of Prkci leads to similar effects on EB
development and the double null cells. Further studies described here use the null cells.
74
To determine whether polarity is affected by loss of Prkci, I examined the GM130, as a
cis-Golgi protein that is apically expressed (Debnath et al., 2002) and Ncadherin, also an apical
marker (Lo Sardo et al., 2012).GM130 was expressed in the apical region in the ectodermal
epithelium and was localized towards the cavity in Prkci+/- EBs (Fig. 4.1.D), whereas there was
no specific pattern of GM130 orientation in Prkci-/-EBs (Fig.4.1.D’) Similar to GM130, Ncadherin
was distinctly expressed in the apical region of ectodermal epithelium in Prkci+/- EBs (Fig.4.1.E )
while -/- cells had membrane distribution of Ncadherin and showed the apical localization of
Ncadherin only in epithelia surrounding multiple developing cavities (Fig.4.1.E’). Therefore,
these results indicate a defective polarity by loss of Prkci. Because -/- EBs still have Prkcz
expression, it is possible that Prkcz mediated polarity might be acquired in cells surrounding
developing cavities.

75

Figure 4.1 Abnormal polarity in Prkci-/- EBs
(A) shPrkci induced a decrease in Prkci gene expression in heterozygous EBs.
(B) shPrkci infected cells were GFP positive and GFP positive cells were sustained during EB
development.
(C’) The phenotype of shPrkci treated Prkci +/- EBs is similar to that of Prkci -/- EBs. EBs failed
to form a cavity (n = 25). (C) Nonspecific shRNA treated Prkci +/- EB form one single cavity
surrounded by columnar epithelium (C”). Oct4 expression in shPrkci infected Prkci+/-EBs is
similar to Prkci-/- EBs (compare to Chapter 2, Fig 2.2C’ and D’).

76

Figure 4.1 continued.
(D) Immunohistochemistry assay using the GM130 Golgi marker, shows that the Golgi is
usually found oriented on the side of the cell toward to the center of the cavity in Prkci +/-
EBs. (D’) Prkci-/- EBs have a random orientation of the Golgi. These data indicate that cells in
-/- EBs cannot form normal polarity without Prkci.
(E) Ncadherin was detected in apical region of epitheliumin +/- EBs. (E’) Ncadherin was
expressed in membrane in -/- EBs.

77
4.2.2 Cell death and proliferation are normal in -/- EBs.

Previous studies have proposed that the endodermal layer produces death signals
leading to apoptosis of cells within the center of EBs during cavity formation, whereas survival of
ectoderm is associated with its interaction with the basement membrane(Coucouvanis and
Martin, 1995, 1999). These results suggest that ectopic formation of the basal lamina in the EB
core could protect neighboring cells from cell death and lead to abnormal cavity formation. I
therefore analyzed the expression of a common laminin in Prkci+/- EB and -/-EBs by
immunohistochemistry. I found that laminin was deposited normally below the endoderm layer in
-/- EB similar to +/- EBs (Fig.4.2.A) and was not present within the core of the EB. However, the
thickness of laminin expression was slightly increased in -/- EBs (Fig. 4.2.A). I have also
examined the expression of the Laminin β-1gene but I found no difference between +/-and -/-
EBs (Fig.4.2B). These results indicate that Prkci is not required for the development of
basement membrane in EBs and that in the absence of Prkci no ectopic BM was forming.
Because apoptosis mediated cell death is an important signal in the formation of cavities
in EBs (Coucouvanis and Martin, 1995), I performed TUNEL assays on day7 EBs to detect any
differences in cell death levels. TUNEL positive cells were detected near forming cavities in
Prkci+/- EBs (Fig. 2.2C). Inconsistent with previous studies (Seidl et al., 2013), cell death was
not reduced in -/- EBs but TUNEL positive cells were distributed across the entire EBs
(Fig.4.2C). Also the pixel count ratio was similar between Prkci+/- and Prkci-/- EBs (Fig.4.2C’’).
Thus failed cavitation by loss of Prkci is not caused by a dramatic reduction in apoptosis. Genes
require for autophagy are involved in removing dying cells by non-professional phagocytes
during the cavitation in EBs (Qu et al., 2007). I therefore examined the total expression of LC3
(cytosolic LC3I and membrane bound LC3II), a marker of mammalian autophagy (Kabeya et al.,
2000). Western blotting data showed that day3 and day 5 EBs had a reduced LC3I and LC3II
78
expression in early EBs but not in later stage of EBs (Fig.4.2D) but no difference in levels was
detected in +/- vs. -/- EBs. Thus, autophagy and/or phagocytosis is triggered normally in -/- EBs.
If the cell proliferation rate exceeds the cell death rate, cavitation might not occur
normally. To determine whether cell proliferation is increased in -/- EBs, I immunostained day7
and day10 EBs using an anti-phospho-Histone H3 mAb and also labeled day7, day 13, and day
15 EBs with BrdU for 24 hours. The number of phospho-Histone H3 positive cells appeared
similar between Prkci+/- and Prkci-/- EBs (Fig.4.2E-E’). Quantification assays confirmed that the
mitotic cell ratio is similar between Prkci +/- and Prkci -/- day7 and day10 EBs (Fig.4.2.E’’). The
number of BrdU positive cells was slightly increased in Prkci-/- EBs compared to Prkci+/-EBs
(Fig.4.2F’). To further study cell proliferation in ESCs, I examined cell proliferation and cell
doubling times. -/- stem cell proliferated slightly slower, but the cell doubling time was similar
(Fig. 4.2.G-G’). Thus together, several cell proliferation experiments suggest that there is no
dramatic difference detected in cell proliferation rate comparing -/- to +/- cells at the stages
investigated, thus, it seems unlikely that the defective cavitation seen in Prkci-/- EBs is caused
by a sustained increase in cell proliferation rate.

79

Figure 4.2 Normal cell death and proliferation in -/- EBs.
(A) The pattern of laminin deposition was normal in both Prkci+/- and Prkci -/- EBs.
(B) Laminin β-1was expressed similarly between Prkci+/- and Prkci-/-EBs.

80

Figure 4.2 continued.
(C-C’) TUNEL positive cells were primarily found near forming cavities in the +/-EB.
However, TUNEL staining was distributed across the entire in -/- EB. There is no apparent
difference in relative ratio of dead/living cells (C’’).
(D)Total LC3I and LC3II proteins were expressed similarly in both +/- EBs and -/- EBs.
(E-E’) Immunohistochemistry data using phosphorylated H3 antibody (marks cells in mitosis)
indicates that Prkci-/- EBs p-Histone H3 expression is similar to that seen in +/- EBs.
Quantification data shows that proliferation ratio based on pixel count is very similar between
Prkci +/- and Prkci -/- EBs (E’).

81

Figure.4.2 continued.
(F’) BrdU labeling studies show that BrdU positive cells are localize at outer edge of -/-EBs.
Relative BrdU positive ratio based on pixel count is a little bit reduced in -/-EBs (F’’).
(G) -/- ESCs proliferated slightly slower than +/- ESCs. However, cell doubling time is similar
between +/- and -/- cells (G’).
82
4.2.3 Defective BMP signals

Although cell death was not reduced in -/- EBs, apoptotic cells were not localized in the
developing cavity but were distributed throughout the entire EB (Fig.4.2.C-C’’). Previous studies
showed that Bmp2 and Bmp4 might be candidate death signals (Coucouvanis and Martin, 1999),
so mislocalized BMP signaling might lead to a different pattern of cell death in Prkci-/- EB. Thus
I hypothesized that loss or aberrant BMP signaling leads to mislocalized cell death which then
leads multiple cavitation or no cavitation in Prkci -/- EBs. To examine BMP signaling, I examined
the expression levels of Bmp2 and Bmp4. The gene expression pattern was similar in both +/-
and -/- EBs (Fig. 2.1F). To further determine if BMP signaling was altered in any way in the
responding cells, I also studied the expression and localization of phosphorylated (p) Smad1/5,
a definitive readout of canonical BMP signaling, in both Prkci+/- and Prkci-/-EBs(Eom et al.,
2011).I found that phospho-Smad1/5 activity was strong in the center of early +/- and -/- EBs
(Fig.4.3A-A’). During EB differentiation, p-Smad1/5 expression was still found near regions
undergoing cavitation in +/- EBs and eventually localized to the endoderm layer at later stages
(Fig. 4.3A). During Prkci+/- EB development, localization of p-Smad1/5 shifted from the nucleus
to the cytoplasm. However, p-Smad1/5 activity was detected near the outer edge of the EB
(endoderm) not in the core of middle and late -/- EBs (Fig. 4.3A’). p-Smad1/5 was expressed
only in the nuclei in -/- EB cells. Thus p-Smad1/5 was defective and mislocalized in Prkci-/- EBs.
BMP signaling leads to the differentiation of visceral endoderm in EBs (Coucouvanis and Martin,
1999). To determine whether aberrant expression of p-Smad1/5 leads to defective
differentiation of the visceral endoderm, I tested visceral endoderm specific marker expression
(Coucouvanis and Martin, 1999; Duncan et al., 1994; Makover et al., 1989). RT-PCR results
showed that both Hnf4 and Ttr in -/- EBs were delayed compared to +/- EBs (Fig. 4.3B).
Therefore defective BMP signaling may lead to delayed differentiation of the visceral endoderm.
I also examined the cytokeratin EndoA (EndoA) expression to determine whether differentiation
83
of endoderm is altered. Immunohistochemistry results showed that EndoA was expressed
exclusively in endoderm region in +/- EBs (Fig.4.3A’’). However, Endo A was ectopically
expressed in the core of -/- EB along with endoderm layer up to middle stage of EBs. Finally the
expression of EndoA in the core was lost at very later stage EBs (Fig.4.3A’’’). Although
endoderm formation is normal in -/- EBs, EndoA cells are still localized in the core of EB. Thus,
it is likely that proper localization of endodermal cells is inhibited by mislocalized p-Smad1/5
activity. Thus, it is possible that pSmad1/5 activity prevents the ectopic formation of endoderm
in the center EB core.
If abnormal BMP signaling is the reason for the failure of cavitation, artificially added
BMP protein might help to transmit death signals into the EB core of EB and eventually facilitate
cavitation (Coucouvanis and Martin, 1999). To test this hypothesis, I studied the effect of adding
BMP protein during -/- EB development. I used Bmp4 to increase BMP signaling. I found that p-
Smad1/5 activity was enhanced in core of EBs after Bmp4 treatment in middle and late stage of
-/- EBs (Fig.4.3C). As expected, EndoA was no longer ectopically found in the core and
detected exclusively near the endoderm region due to enhanced BMP signaling (Fig.4.3C’).
Because Bmp4 is considered a cell death signal in the EB (Coucouvanis and
Martin,1999), enhanced BMP signaling might lead to increase cell death. TUNEL analysis
results showed that TUNEL positive puncta were increased in BMP4 treated -/- EBs (Fig. 4.3.F-
F’) compared to +/- EBs (Fig. 4.3D-D’) and -/- EBs (Fig. 4.3.E-E’). Thus, the treatment of BMP4
induces increased cell death. Ezrin, an apical maker found in polarized cells, was also
examined to determine if BMP4 treatment stimulates the recovery of Ezrin localization. I found
that Ezrin was detected in apical region of cells surrounding developing cavities and the
endoderm in Prkci+/-EBs (Fig.4.3G) whereas in Prkci-/- EBs, Ezrin was ectopically membranous
detected in the core of EBs and localized in the endoderm(Fig. 4.3G’). I noticed that Ezrin in
BMP4 treated -/- EBs was detected in similar pattern in -/- EB (Fig.4.3G’’). Therefore, it is likely
that BMP4 treatment does not affect Ezrin localization and also possibly fails to rescue cell
84
polarity. In order to determine whether BMP4 treatment induces the recovery of cavitation of -/-
EB, I examined cavitation. With the addition of BMP4, the formation of cavities in Prkci-/- EB
was slightly enhanced compared to control Prkci-/- EBs but the pseudostratified columnar
epithelium was not formed (Fig. 4.3C’’). The percent of EBs with cavities in BMP4 treated -/-
EBs was significantly increased compared to -/- EB, but the extent of recovery was half of the
percent of cavities found in +/- EBs (Fig. 4.3C’’). Therefore these results indicate that addition of
Bmp4 induces a partial recovery in cavitation by enhancing cell death but not by recovering
polarized Ezrin expression and is therefore not sufficient for the recovery of complete cavitation.
Thus it is likely that establishing polarity by Prkci and associated factors is essential for proper
cavity development.

85

Figure 4.3 Abnormal BMP signals and recovery assay
(A and A’’)Day 5 (early), day 7-9 (middle), and day 10-12 (later) EBs are used for this assay.+/-
EBs have strong phospho-SMAD1/5 expression in regions undergoing cavitation. At later stages,
phospho-Smad1/5 is expressed in cytoplasm. In contrast, then expression of phosphorylated
Smad1/5 is decreased in middle and late stage Prkci -/-EBs. Also in middle stage -/- EBs.
phospho-Smad1/5 is found near the outer edge of the EB. In addition late stage -/- EBs have
phopho-Smad1/5 expression in the nucleus.
86

C’’

Figure 4.3 continued.
(A’ and A’’’) EndoA (endoderm marker) expression is localized to the outer endoderm layer in
+/- EBs at all stages. However, in Prkci -/- EBs, EndoA is expressed throughout the EB up to
middle stages. EndoA is localized to the outer endoderm layer in later EB stage.
(B) Expression of other visceral endoderm markers (Hnf4 and Ttr) is delayed in -/- EBs.
(C and C’) BMP4 treatment recovery studies: 15ng BMP4 treatment induces stronger
p-Smad1/5 expression in -/- EBs. EndoA is found within the endoderm in
BMP4 treated -/- EBs as expected. (C’). BMP4 treatment induced partial recovery of cavitation
in -/- EBs.
87

Figure 4.3 continued.
(D-F’) The presence of TUNEL positive puncta is strongly enhanced in BMP4 treated -/- EBs
compared to +/- EB and untreated -/- EB at day3 and day7.
(G-G’’) Ezrin was detected in apical region of cells surrounding developing cavities and in the
endoderm region in +/- EBs, whereas Ezrin was expressed in the membrane of cells (basal) in
the core and localized in the endoderm region. BMP4 treatments: Ezrin was expressed in
endoderm region and the membrane of basal cells in BMP4 treated -/- EBs.

88
4.2.4 Cell adhesive characteristic of Prkci-/- cells

Previous studies have shown that aPKC inactivation inhibits continuous formation of AJs
and leads to failure formation of TJs (Suzuki et al., 2002)). Thus I thought that EBs made of -/-
cells would also lead to defects in AJ and TJ formation. AJs between cells involve a multiple
protein complex linking intracellular actin to cadherin via α and β-catenin (St Johnston and
Ahringer, 2010; Yamada et al., 2005). Thus I examined E-cadherin, β-catenin, and F-actin
expression to determine if AJs are disrupted in -/- EBs. Western blotting results showed that
overall E-cadherin and β-catenin expression was similar between Prkci +/- and Prkci -/- EBs
(Fig. 4.4A). To examine the localization of adhesion molecules, immunohistochemistry was
used. I found that in +/- EBs, E-cadherin was only expressed in apical side of columnar epithelia
(Fig.4.4B), however, in null EBs, E-cadherin was detected throughout the entire EB and in a
membranous distribution (Fig. 4.4B’). Interestingly, E-cadherin positive cells were not p-
Smad1/5 positive cells. Similar to E-cadherin, β-catenin was detected at epithelia and core of -/-
EBs (Fig.4.4C’). Also I studied F-actin localization using rhodamine-phalloidin. F-actin was
highly enriched at the apical side of columnar epithelium and the outer region in +/- EBs (Fig.
4.4D). In -/- EBs, F-actin was detected on the apical side of developing cavities, the core, and
the endoderm (Fig. 4.4D’).F-actin was detected in a clear and uniform pattern at the surface of
+/- EBs (Fig. 4.4E). However, in -/- EBs, I observed a disrupted and irregular pattern of F-actin
(Fig. 4.4E’). I also examined Zo-1, a maker of TJs. Zo-1 was strongly detected in endodermal
cells and apical region of epithelium in +/- EBs (Fig.4.4F), whereas Zo-1 was expressed
diffusely between endodermal cells and the core of -/- EBs (Fig.4.4.F’). Taken together, these
results suggest that even though overall expression of adhesive molecules were similar in both
Prkci+/- and Prkci-/-EBs, the formation of AJ and TJ was defective in -/- EBs and the expression
of adhesion molecules was mislocalized and increased in the core of -/- EBs.
89
I found ectopic epithelia were formed within the core of the -/- EBs (Fig. 2.1D) and in
these epithelia adhesion molecules were more highly expressed(Fig.4.4B’-E).To determine
whether cell-cell adhesion was enhanced in -/- cells, I performed a cell –ECM adhesion assay
and cell-cell aggregation assay. Fibronectin and laminin are the core components of the
basement membrane and expressed at the early stages of mouse embryo development(Cooper
and MacQueen, 1983). Integrins bind cell surface and ECM components such as fibronectin,
vitronectin, and laminin (Hynes, 2002). Among the integrin family, α5β1and α6β1 integrins are
expressed in EB development (Morini et al., 1999). I therefore studied the adhesive
characteristics of -/- cells via cell adhesion assays using laminin, fibronectin and integrinβ1, a
major receptor subunit, as substrate coatings. These assays showed that adhesion to laminin
and integrinβ1but not fibronectin was significantly enhanced in null cells compared to +/- cells
(Fig.4.4G-G’, data not shown). Thus these data suggest that cell to ECM adhesion is enhanced
in -/-ESCs. Interestingly -/- cell adhesion to tissue culture plastic was also enhanced compared
to +/- cells suggesting that -/- cells may have properties that make them more adherent in
general. If -/-ESCs are stickier than +/-ESCs, ESCs might be more prone to form aggregates.
Thus I performed a cell-cell aggregation assay. The results showed that the numbers of 3-
cellaggregates and > 4 cell aggregates in -/-ESCs were significantly higher than that of +/-ESCs
(Fig. 4.4H). These results suggest that -/-ESCs had more adhesive characteristics compared to
+/-ESCs. Taken together, this enhanced adhesion might lead to stabilized ectopic epithelial
structures in the core of Prkci -/- EBs.

90

Figure 4.4 Enhanced adhesive character in -/- EBs.
(A) Western blotting results showed that there was no protein expression difference (E-cadherin
and β-catenin) in +/- EBs and -/- EBs.
(B-C’) Cell adhesion molecules are mislocalized and highly expressed in the core of Prkci -/-
EBs. E-cadherin and β-catenin were expressed in the epithelial layer of +/- EBs. However these
two proteins were also found within the core of -/- EBs.
(B’’) E-cadherin and p-Smad1/5 are expressed distinctly in -/- EBs.
(D-D’) F-actin was detected in apical region of epithelium in +/- EB, but F-actin was expressed
in the core of -/- EBs.
91

Figure 4.4 continued
92

Figure. 4.4 continued.
(E-E’) In +/- EBs, F-actin was detected in a uniform pattern at the surface of EBs. However -/-
EBs had an irregular pattern of F-actin at the surface.
(F-F’) Zo-1 was detected in endodermal cells and apical region of epithelium in +/- EBs. -/- EBs
had irregular expression of Zo-1 in -/- EBs.
(G-G’) Knockout ESCs adhered more to ECM molecules (laminin and integrin β1) than +/-ESCs
(p<0.01) in cell–ECM adhesion assay.
(H) A cell aggregation assay showed that -/- stem cells were significantly more prone to form
aggregates than +/- stem cells (*:p<0.05, **p<0.01).
93
4.2.5 Overexpressed Ezrin recovers phenotype partially.

Ezrin, a membrane-to-cytoskeleton linker, is involved in cellular functions, including
epithelial cell morphogenesis and adhesion (Bretscher et al., 2002). Recent studies showed that
Prkci interacts with Ezrin in Caco-2 cells and knockdown of endogenous Prkci abolishes most
Ezrin phosphorylation of T567 in intestinal epithelial cells. Apical localization of the Prkci was
also shown to be essential for the apical localization of activated Ezrin (Wald et al., 2008).
These studies suggest that Ezrin might be a main downstream effector of the Prkci. Loss of
Prkci might lead to mislocalization of Ezrin in EBs. Therefore, I examined the expression and
localization of Ezrin in EBs. RT-PCR results showed that there was no difference in the levels
Ezrin gene expression. However, I observed a localization difference of Ezrin protein by
immunohistochemistry. I found that Ezrin was expressed in apical region of epithelia
surrounding developing cavities and in the outer endoderm layer in Prkci +/-EBs, but Ezrin was
detected in membrane of cells in the core of early -/- EBs (Fig.4.5C). During EB development,
Ezrin was enriched in the apical layer of the columnar epithelium in +/- EBs. However in -/- EBs,
Ezrin was detected in endoderm region and apical region of the epithelia surrounding multiple
small cavities (Fig. 4.5C).
I hypothesized that as a possible downstream effector of the Prkci, overexpression of
Ezrin in Prkci -/- EBs might partially or fully restore cavity formation. Therefore, I examined the
consequence of overexpressing Ezrin protein on cavitation. GFP-expressing plasmids were
used as controls to indirectly check the efficiency of the overexpression. 60% of GFP positive
cells were observed. Thus, approximately 60% of EB contained cell that had Ezrin expression
acquired by transient overexpression. To check the efficiency of the overexpression, RT-PCR
was performed. -/- EBs with overexpressed Ezrin had slightly increased Ezrin expression. -/-
EBs made of transiently overexpressed Ezrin ESCs were used to see if cavitation recovered. An
immunohistochemistry assay showed induced Ezrin expression in the endoderm region in early
94
stage of EBs and increased numbers of multiple cavities (red arrows) in middle stage EBs
compared to non treated -/- EBs (Fig.4.5.C). Although pseudostratified columnar epithelium was
not recovered, partial recovery of cavitation was observed (Fig.4.5.D). Quantification of the
results clearly showed that the percent of partial cavitation was significantly increased in day7
and day 14 EBs compared to non-transfected Prkci-/-EBs (Fig.4.5.E-E’). Although the percent of
completed cavitation was significantly increased in Ezrin transfected EBs, the extent of
cavitation was less than was normally seen in +/- EBs.
Because I observed that the extent of cavitation was enhanced in Ezrin treated -/- EBs, it
is possible that increased cell death leads to an increase in the extent of cavitation. To
determine whether cell death was enhanced by overexpression of Ezrin, TUNEL staining was
conducted. I did not see enhanced cell death in Ezrin transfected EBs (Fig.4.5F). Because cell
polarity and cavitation were partially recovered, it is possible that the pattern of p-Smad1/5 is
altered by Ezrin overexpression. To determine whether overexpressed Ezrin can help cells
respond to BMP signaling into the core of EB, I examined the p-Smad1/5 activity. The
expression of p-Smad1/5 was significantly increased in the core of Ezrin overexpressed EBs
compared to non-treated -/- EBs (Fig. 4.5H). Interestingly, most p-Smad1/5 positive cells were
not TUNEL positive (Fig.4.5.H). The right distribution of EndoA is the sign of appropriate BMP
signaling. I also examined EndoA expression in transfected and control EBs. The expression
pattern of EndoA was rescued by overexpression of Ezrin. EndoA expression was no longer
found in the core of the -/- EBs in a pattern more similar to +/- EBs (Fig.4.5G). Thus these
results suggest that overexpressed Ezrin in the -/- EBs leads to partial recovery of polarity and
cavitation combined with promoting the normal pattern of p-Smad1/5 and EndoA. However the
effect of Ezrin is not enough to achieve full cavitation. Thus, according to several Ezrin
overexpression assays presented here, it is possible that recovered cell polarity leads to
appropriate ability to respond to BMP signaling, differentiation of endoderm, and partial recovery
of cavitation. Overexpression of Ezrin might also stimulate differentiation. Thus Oct4 expression
95
was examined. An immunohistochemistry assay showed that the number of Oct4 positive cells
in -/- EBs with overexpressed Ezrin was less than that of -/- EBs and more than that of +/- EBs
(Fig.4.5I) suggesting that either differentiation was stimulated or the process of cavitation
removed the Oct4 positive cells.

96

Figure. 4.5 Overexpressed Ezrin recovers the phenotype partially.
(A) RT-PCR results showed that the levels of Ezrin expression were similar in both Prkci+/- and
Prkci-/- EBs.
(B) RT-PCR results showed that Ezrin was slightly increased by overexpressed Ezrin.

97

Figure 4.5 continued
(C) Day 3-4 (early), day 6-8 (middle), and day 10-12 (later) EBs are used for this assay. An
immunohistochemistry assay using an anti-Ezrin antibody shows that Ezrin is expressed in the
apical layer of cells surrounding developing cavities and endoderm layer of Prkci +/-EBs.
However in -/- EBs, Ezrin is found in the core at early stages, then is found at the outer edge of
the EB (endoderm). Transient overexpression of Ezrin in -/- EBs induces the normal expression
of Ezrin (endoderm and apical region). In addition these EBs show increased initiation of
polarity(red arrows). Although epithelial development of the embryonic ectoderm is not
recovered, partial cavitation is observed in Ezrin-treated EBs.

98

Figure 4.5 continued
(D) Phenotype of -/-EBs with overexpression of Ezrin.
(E and E’) Quantification of the percent cavitation. Percent of partial cavitation is significantly
increased in -/- EBs with Ezrin overexpression (*:p<0.05, **:p<0.01) compared to two different
stages of -/- EBs. Complete cavitation in Ezrin treated -/- EBs was rescued significantly
compared to -/- EBs (**:p<0.01). However, the extent of cavitation is less than is normally seen
in +/- EBs.

99

Figure 4.5 continued
(F) There was no difference in the number of TUNEL positive cells between -/- EBs and Ezrin
overexpressed -/- EBs.
(G) By overexpressing Ezrin, EndoA was deposited in endoderm region of EBs.
(H) p-Smad1/5 activity was recovered in the core of EBs by Ezrin treatment.
(I) Oct4 expression was diminished by Ezrin overexpression.
100
4.2.6 Cell mixing experiments

I next asked whether recovery of polarity could be achieved by non-cell autonomous
signals from polarity competent cells and if this could help complete cavitation. For addressing
this question, I applied cell mixing experiments. I used R1- glycophosphatidylinositol (GPI)-
green fluorescent protein (GFP) wild type ESCs that have a GPI anchor that directed GFP to the
plasma membrane(Nowotschin et al., 2009) that can form cavities normally. Using labeled
ESCs, I can easily distinguish -/-ES cell from R1-GPI-GFP ESCs. When EBs were generated
with a ratio of 1:9 or 1:4 or 1:1 (R1-GPI-GFP ESCs: Prkci-/- ESCs), R1 cells were found in
random patches at the early EB stage. At later stages, most R1 cells were detected in ectoderm
epithelia and endoderm layer (data not shown, Fig. 4.6A-A’). In order to investigate whether
polarity competent cells can help to recover the formation of cavities in -/- EBs, histological
morphology was studied with nuclear fast red staining. With 1:9 ratios, 50% of EBs formed a
pseudostratified columnar epithelium but did not fully cavitate (data not shown, Fig. 4.6.B”, B’’’).
With 1:4 ratios, 60% of EBs had a columnar epithelium and 20% of EBs had a nice cavity
(Fig.4.6.B, B”, B’’’). With 1:1 ratios, 93% of EBs formed the pseudostratified columnar epithelium
and 60% of EBs formed a complete cavity (Fig. 4.6.B’, B’’, B’’’). Thus, polarity competent cells
can help to form a cavity when mixed -/- cells. Because cell polarity is rescued by cell mixing
experiments, Ezrin might be expressed in apical side of developing EBs. As I expected, Ezrin
was detected in apical region of developing cavities and endoderm region (Fig. 4.6C). In
addition, if cells in EBs can respond properly with BMP signaling, so EndoA could be normally
expressed in the endoderm area and not found ectopically in the center. As I anticipated, EndoA
was detected predominantly in endoderm region (Fig. 4.6C’). Therefore, full polarity is the
important to develop and complete the formation of cavities in EBs.

101

Figure 4.6 Recovery of cavitation and morphology by cell mixing experiments.
(A) Prkci -/- ESCs and R1-GPI- GFP wildtype cells were mixed. With a ratio of
1 R1: 4 Prkci -/- ESCs, R1 cells are found in random patches at the early EB stage. At
later stages, most GFP labeled cells could be found within epithelia and in the endoderm
layer. (A’) With a 1:1 ratio, GFP labeled cells are in endoderm and epithelial layers.

102

Figure 4.6 continued.
(B) The phenotype of EBs with 1:4 ratios. Developing cavities were formed.
(B’) The phenotype of EBs in different time points with 1:1 ratios. Nice columnar epithelium (red
arrow) and cavitation were formed.
(B’’) The percent of formation of epithelium was highly recovered.
(B’’’) The percent of formation of complete cavitation was highly rescued.

103

Figure 4.6 continued.
(C) Ezrin was detected in apical region of developing cavities in 1:1 ratio mixed EB.
(C’) EndoA development was rescued in 1:1 ratio mixed EBs (the ectopic EndoA staining was
much decreased).

104
4.3 Discussion

Cell polarity and cavitation
I found that loss of Prkci or reduced Prkci induced the failure of cavity formation (Fig.
2.1D, Fig.4.1C’)(Seidl et al., 2013). Cell polarity and cell-cell junctions were also defective in -/-
EBs (Fig.4.1D’, E’ and Fig. 4.4B-F). However, the deposition of basement membrane and
development of the outer endoderm layer was normal (Fig.4.2.A and Fig.2.1D). Cdc42 and
Cdx2 act as regulators of aPKC signaling in different cell contexts and are essential for cell
polarity (Jedrusik et al., 2008; Joberty et al., 2000). Recent studies show that cdc42 null EBs
have defects in cell polarity, the formation of AJs and TJs, and cavitation with normal
development of endoderm and basement membrane (Wu et al., 2007). Also they showed that
knockout of cdc42 leads to the reduction of phosphorylation of Prkcz and abnormal localization
of Prkcz and the overexpressed dominant negative form of Prkcz that actually inhibits Prkcz and
Prkci in EBs leads to similar phenotype as Cdc42 null EBs (Wu et al., 2007). Loss of Cdc42 and
a dominant negative form of Prkcz inhibit both isoforms of aPKC, so the phenotype is more
severe than loss of Prkci. Reduced Cdx2 by inhibitory shRNA expression in Caco-2 cysts
results in the impaired apical basal polarity, multiple small cavities and mislocalized and ectopic
distribution of Prkcz (Gao and Kaestner, 2010). It seems that loss of Cdc42 and Cdx2 results in
the alteration of aPKC activity in lumen formation. In addition, inhibition of Par6B or aPKCs in
the formation of Caco-2 cysts results in the multiple lumen formation (Durgan et al., 2011).They
show that abnormal phenotype is related to impaired mitotic spindle orientation. Unfortunately, I
have not studied spindle orientation yet. These studies might suggest another explanation of
abnormal cavitation in Prkci-/-EBs. Nevertheless, data presented here in combination with
previous studies suggest that an impaired aPKC signaling via loss of Cdc42, Cdx2, Prkci or
Par6 leads to defects in cell polarity and cavitation. Thus, ultimately proper cell polarity may be
the essential feature for the morphological development of the EB.
105
Cell death and proliferation in EB development
Another Prkci knock out study shows that cell death is reduced in developing EBs (Seidl
et al., 2013). Inconsistent with these studies, I found that cell death was not significantly
reduced in -/- EBs (Fig.4.2.C-C’’). Also the pattern of cell proliferation was similar between
Prkci+/- and Prkci-/- EBs (Fig. 4.E-G’).Consistent with our results, apoptosis and cell
proliferation are not altered in conditional Prkci knockout mouse embryos (Imai et al., 2006).
Therefore, cell death and cell proliferation during the development of null EBs may be normal.
Because I observed that -/- EBs are larger than +/- EBs and dying cells that exist in the core of
late EBs are not removed (data not shown), I assumed that the clearance of dying cells are
defect in -/- EBs. The autophagy pathway is used by non-professional phagocytes to removing
dying cells, so I examined the protein expression of LC3I and LC3II in different stage EBs.
However, I found no strong difference in the total expression of LC3I and LC3II (Fig.4.2D).
Therefore, autophagy or phagocytosis appears normal during EB development.
BMP signaling and aPKC complex
I observed that BMP signaling (as evidence by p-Smad1/5 expression) was mislocalized
in -/- EBs (p-Smad 1/5 lost from the center), but BMP4 addition experiments did not rescue the
cavitation completely. One study show that phosphorylated SMAD1/5/8 interacts with each
component of the aPKC complex in chick midbrains using a CoIP assay and these associations
are detected in tight junctions(Eom et al., 2011). They also provide evidence that in BMP
attenuation conditions, the aPKC complex is unstable and degraded in the apical region without
association with BMP signaling (Eom et al., 2011).p-Smad1/5/8 dependent signaling can be
mediated by clathrin-mediated endocytosis (Hartung et al., 2006). Recent studies shows that
the inhibition of dynamin-dependent endocytosis by dynamin-dependent endocytosis specific
inhibitor results in reduced phosphorylation of Smad1/5/8 and delayed nuclear translocation,
leading to delayed osteoblast differentiation (Heining et al., 2011).From these information, I
hypothesize that p-Smad1/5/8 does not associate well with the aPKC complex in the absence of
106
Prkci and this impaired interaction between aPKC complex and p-Smad1/5/8 could inhibit the
delivery of BMPs or endocytosis of BMPs. As evidence for this idea, p-Smad1/5/8 was strongly
expressed in early -/- EB but was only detected in detected in the endoderm layer that is
polarized in middle and late stage -/- EBs (Fig. 4.3.A'). In addition, even though BMP signals
were exogenously recovered in BMP4 treated -/- EBs (Fig. 4.3.C), cell polarity and cavitation
were not rescued completely (Fig. 4.3G, 4.3.C'').Recent studies also show that the depletion of
Prkci in esophageal squamous cell carcinomas leads to enhanced ubiquitin-proteasome
pathway (Liu et al., 2011). Therefore, without appropriate interaction between aPKC complex
and p-SMAD1/5/8, the delivery or endocytosis of BMP signaling could be inhibited or BMP
signaling is easily degraded. To address this question, I would need to investigate whether the
aPKC complex biochemically interacts with p-Smad1/5/8 in the -/- EBs and if degradation of p-
Smad1/5/8 is increased in -/- EBs.
Fgf signaling is also required during endoderm differentiation and laminin1 regulated by
Gata6 is essential for the formation of columnar epithelium (Li et al., 2004). Thus I cannot rule
out the possibility that Fgf signaling and laminin1 are also altered by loss of Prkci and defective
laminin1. However, the endoderm layer and basement membrane are normally deposited in -/-
EBs, so Fgf signaling and laminin1 is unlikely related to the phenotype of -/- EBs.
Enhanced cell adhesion in Prkci-/- EB
Previous studies provide evidence that inhibition of aPKC leads to defects in AJ and TJ
formation (Suzuki et al., 2002) and Cdc42 -/-EBs have an impaired TJ formation (Wu et al.,
2007). Consistent with these previous studies, E-cadherin, β-catenin, F-actin and Zo-1 were
mislocalized and increased in Prkci mutant EBs (Fig.4.4B-F). I also showed that Prkci-/-ESCs
are more adhesive than Prkci+/- ESCs according to a cell-ECM adhesion assay and a cell-cell
aggregation assay (Fig.4.4.G-H). In the Drosophila notum, loss of aPKC leads to ectopic
junctions and the accumulation of endoderm containing E-cadherin(Georgiou et al., 2008). They
also show that aPKC plays an important role in E-cadherin trafficking through endocytosis.
107
Although the relation between aPKCs and other adhesion proteins in endocytosis are not
studied yet, it is likely that loss of Prkci leads to an inhibition in the turnover of adhesion
molecules, resulting in their accumulation.
Ezrin as a downstream effector of Prkci
One study shows that Ezrin can interact with aPKC and can be phosphorylated by aPKC
(Wald et al., 2008). In support of the idea that Ezrin is a downstream effctor of Prcki, I found that
Ezrin was mislocalized to the core of-/- EBs (Fig.4.5C).Other studies showed that
overexpressed wildtype Ezrin and Ezrin T567A (nonphosphorylatable form) can be incorporated
into apical region of membrane but overexpressed Ezrin T567D (phosphomimic form) is
incorporated into the apical region and basal region of the membrane in kidney epithelial cells
and intestinal cells (Coscoy et al., 2002; Zhu et al., 2010). Therefore, these studies indicate that
the phosphorylation of Ezrin might happen after Ezrin is incorporated into apical region of
membrane. Thus I decided to overexpress wildtype Ezrin into Prkci-/-EBs instead of
phosphomimic form of Ezrin. In the Ezrin overexpressing-/- EB, I found that Ezrin was detected
in the apical region of multiple cavities and endoderm region -/-(Fig. 4.5C). I also noticed that
overexpression of Ezrin induced the initiation of cell polarity and partial cavitation (Fig.4.5C).
However transient overexpression cannot be maintained during the long period of EB culture.
Overexpressed Ezrin might be active upto 8 days of EB culture. I observed that day5-7 EBs had
an increase of number of multiple cavities by overexpression of Ezrin culture (Figure. 4.5E) but
day14 EBs did not undergo complete cavitation (Fig.4.5E’). Thus, it seems that transient
overexpression of Ezrin can enhance the formation the initial multiple small lumens found in the
periphery of -/- EBs. To determine whether stable overexpression of Ezrin can rescue the fusion
of cavities and completion of cavities, one would need to make a stable Prkci-/- cell line that
overexpresses Ezrin using an inducible Tet system.

108
Rescuing the -/- phenotype
I observed that impaired cell polarity by loss of Prkci led to abnormal cavitation. Thus, it
is possible that the restoration of cell polarity might rescue -/- phenotype. Partial recovered cell
polarity might lead to an increase of multiple small cavities and full recovery of cell polarity might
allow the completion of cavitation and the formation of columnar epithelium. To rescue
cavitation, I did several experiments including cell mixing, addition of BMP4, and overexpression
of Ezrin.NeitherBMP4 addition or overexpression of Ezrin can fully rescue cavitation. (Figure
4.3H, Figure 4.5E-E’). BMP4 addition promoted normal deposition of EndoA and enhanced cell
death leading to partial cavitation without the formation of pseudostratified columnar epithelium
(Figure. 4.3H).Thus, it is unlikely that added BMP4 can rescue cell polarity and it is just causing
some cavitation by increasing the number of dying cells. Similarly, overexpressed Ezrin
increased the number of multiple small cavities and partial cavity recovery without the formation
a nice columnar epithelium (Fig.3.5D). In Ezrin overexpressed -/- EBs, the expression of EndoA
and phosphorylation of Smad1/5 were similar to +/- EBs (Fig.4.5G-H). Therefore, partially
rescued cell polarity by Ezrin overexpression also rescues the ability to respond to BMP
signaling and the expression of EndoA. Interestingly, I also found that the number of Oct4
positive cells was reduced by overexpression of Ezrin (Fig.4.5I). Thus, it seems that cell
differentiation is partially rescued in Ezrin overexpressed -/- EBs.
In cell mixing experiment with 1:1 R1GPI-GFP: Prkci-/-ESCs, I found that complete
cavitation was highly recovered and a pseudostratified columnar epithelium formed (Fig.4.6B’’-
B’’’). Ezrin and EndoA are also similarly expressed between +/- EBs and mixed EBs (Fig. 4.6C-
C’). Therefore, it is likely that R1 ESCs are rescuing the cell polarity in cell mixing experiment in
a non-cell autonomous fashion. This rescued cell polarity can rescue the phenotype of -/- EBs.
Although I did not examine the formation of AJ and TJ in cell mixed EBs, I suspect that
localization and expression is similar to +/- EBs. To determine whether stem cell population and
multipotent stem cell are decreased in cells mixed EBs, it is necessary to examine Oct4, Pax6,
109
Isl1 expression. If the retention of stem cell populations is reduced, it is likely that cell polarity
mediated by aPKC complex can help the differentiation of epiblast cells. Thus cell polarity is
required for the normal morphological development of EB.
How can R1 wildtype ESCs help rescue polarity, signaling and cavitation in null EBs?
One possibility is that paracrine signaling from wildtype cells can induce an alteration in
behavior and differentiation of null cells via the production of signaling molecules, extra cellular
matrix, or by direct cell-cell interaction (Nicolson, 1994). Paracrine signaling might recover cell
polarity and defective BMP signaling locally; this then leads to completion of cavitation. I found
that a 50% R1 ESC: 50% Prkci-/- ESC ratio can recover the phenotype of null EBs, while a
lower percentage of R1 cells was less effective, suggesting that short range signals might be
more important than long range ones. However, interestingly the phenotype rescue seemed to
also involve a preferential expansion of null cells with fewer wildtype cells present suggesting
that long range signaling might be important but that a threshold of wildtype cells is needed to
generate a sufficient signal. Wildtype R1 cells that are a long distance from Prkci-/- cells might
affect polarity, differentiation signaling, or cell death signaling via signaling cascades among
neighboring cells. In order to investigate these possibilities, I could determine the expression
and localization p-Erk1/2 (or p-Smad1/5) and GFP in mixed EBs of different ratios and examine
whether p-Erk1/2 is expressed in null cells located near GFP-positive wildtype cells. Together
the combined effects of paracrine signaling between cells and the long distance signaling
among neighboring cells might spread throughout the tissue to help form normal polarized
epithelium and a complete cavity. Future studies could be focused on identifying the molecular
identity of this paracrine affect.
Relevance of the in vitro experiments to embryo development
Since EBs created from Prkci-/- ESCs phenocopy the Prkci-/- embryo, a failure in cell
polarity could similarly affect the many cellular and morphological events that pattern the
embryo and extra-embryonic tissues. In null EBs, I noticed that most Oct4 positive cells were E-
110
cadherin positive and that these cells were often localized in ectopic epithelia found in the core
of the EB. Null embryos also have ectopic epithelia (see Fig 2.1B) and these cells might also be
E-cadherin positive and Oct4 positive. Therefore, it is possible that pluripotent stem cells could
accumulate in the null embryo. An accumulation of pluripotent stem cells could be generated via
favored symmetric cell division similar to null EBs. To determine if this might be the case, I
would need to examine the expression of Oct4 and the localization of Numb in the null embryo.
Since ectopic epithelial structures are found in null embryo, it is likely that cell-cell adhesion by
mislocalized cell adhesion molecules is also increased in null embryo. Because the response to
BMP signaling was defective in null EBs, it is possible that BMP signaling is also defective and
mislocalized in the null embryo. Since null EBs contained mixed multipotent populations, it is
possible that some multipotent stem cell populations might be more highly generated in null
embryos. Because the nervous system can still be formed in null embryo, it might be possible to
see if the neural stem cell population is expanded and if the cells are capable of undergoing
differentiation, similar to neural stem cells generated in null EBs. Definitive tests for this and
other lineages would require a conditional knock out of Prkci in neural, cardiac, and erythroid
progenitors.

4.4 Summary

In this chapter, I discussed the role of Prkci as a regulator of cell polarity in the process
of cavitation during the development of EBs. I found that cell polarity was defective in -/- EBs
and cell death and cell proliferation were grossly normal. I showed that BMP signaling was
reduced and mislocalized in -/- EBs but the recovery experiments using BMP4 addition did not
recover the phenotype completely. I also found that adhesion molecules of AJ and TJ were
mislocalized and enhanced in the core of EB. I provide evidence that Prkci-/- ESCs have more
adhesive characteristics compared to Prkci+/- ESCs via cell-ECM adhesion and cell-cell
111
aggregation assays. Overexpression of Ezrin partially recovered cavitation with some recovery
of cell polarity. Finally, I showed that cell mixed EBs had highly recovered cavitation with
cavities surrounded by recovered columnar epithelium. Through serial experiments, I suggest
that cell polarity regulated by Prkci is essential for the development of EBs.

112
Chapter 5. Final discussion and future directions

aPKCs including Prkcz and Prkci have critical cellular functions in cell polarity, cell
proliferation, cell migration, and asymmetric cell division(Chen and Zhang, 2013). The Par3-
Par6-aPKC trimeric complex is essential for those functions (Suzuki and Ohno, 2006). Among
aPKCs cellular functions, I determined that cell polarity and polarity related asymmetric cell
division are essential for stem cell differentiation and EB developments. Loss of Prkci resulted in
accumulation of pluripotent stem cell population and enhanced multipotent stem cell population.
I found that abnormal asymmetric cell division is linked to the maintenance of stem cell
populations (Chapter 2-3). Also I found that loss of Prkci in combination with the inhibition of
other isoforms including Prkcz induced the production of PGC like cells (Chapter 3). Impaired
cell polarity by loss of Prkci resulted in failed cavitation in EBs. The -/- phenotype was partially
rescued by exogenous BMP4 treatment or overexpression of Ezrin and was highly recovered by
mixing -/- cells with polarity competent cells (Chapter 4).
Although a hallmark of pluripotent stem cells, the expression of Oct4 has been seen in
various multipotent stem cells (Roobrouck et al., 2008; Tai et al., 2005). One study shows that
bone marrow derived Oct3/4 positive cells can be differentiated into cardiac myocytes and a
reduction in the expression of Oct3/4 along with an increase in early cardiac markers happens
coincidently during differentiation (Pallante et al., 2007). They suggest that Oct3/4 positive cells
have the plasticity of stem cells, so cardiac myocyte differentiation is a progression from a
plastic stem cell status to a lineage restricted cardiac progenitor status. In contrast to this study,
we found that Oct4 positive cells are not colocalized with Pax6 and Isl1 population (Fig.6K-M).
However, it is possible that differentiated Isl1 positive cells were generated from Oct4 positive
cells.
113
One remaining question is why multipotent stem cells are increased in -/- EBs. Since
Prkcz is still expressed in -/- EBs and has been shown to have a role in promoting differentiation
in ESCs(Dutta et al., 2011; Rajendran et al., 2013), it is possible that Prkcz allows differentiation
of pluripotent Oct4 positive cells into multipotent progenitor cells. One way to test this is to
determine whether inhibition of Prkcz by Gö6983 in -/- EBs inhibits the generation of multipotent
stem cells. It is possible that drug treated -/- EBs have enhanced pluripotent stem cells and
reduced multipotent stem cells. Another study shows that Mesp1 induction in different time
points during EB differentiation can induce mesoderm cells into cardiac, hematopoietic, or
skeletal myogenic progenitors in context dependent manner (Chan et al., 2013). It seems that
Mesp1 is the regulator of mesoderm lineage differentiation. I found that our EBs strongly
generated mesoderm derived HSC and cardiac progenitors compared to +/- EBs (Chapter 3).
Therefore, it is possible that Mesp1 expression pattern in -/- EBs might be altered compared to
+/- EBs. If it is true, that might give a possible clue to solve our question.
Hypoxia supports self-renewal of embryonic stem cell and multipotent stem cells and
may be important for the dedifferentiation of cancer stem cells (Barnhart and Simon, 2007).The
expression of Oct4 is detected in multipotent stem cells and cancer stem cells (Roobrouck et al.,
2008; Tai et al., 2005). Oct4 is the direct substrate of Hypoxia induced factor-2α (HIF-
2α)(Covello et al., 2006). ESC-derived tumors show highly increased HIF-2α and
undifferentiated tissues (Covello et al., 2005).Thus, it is likely that Oct4 expression via HIF-2α is
essential for the maintenance of stem cells (Covello et al., 2005). Notch signaling inhibits
differentiation in stem cells and tumors (Artavanis-Tsakonas et al., 1999; Bray, 2006; Chiba,
2006; Weng and Aster, 2004). Notch1 with direct interaction with HIF-1α can activate
transcription of genes, leading to inhibition of myogenic and neuronal differentiation (Gustafsson
et al., 2005). Therefore, it is likely that Notch signaling mediated by HIF-1α can maintain HSCs,
neural stem cells, myoblast, and cancer stem cells in an undifferentiated condition. I found that
Oct4 positive cells are also Hes5- and activated Notch1 positive (Chapter 3). Although there is
114
no known relation between Prkci and hypoxia, it could be interesting to determine whether Prkci
-/- EBs are more susceptible to hypoxia and HIF-1α or if HIF-2α expression is elevated in -/-
EBs.
According to current cancer stem cell hypothesis, tumors are derived from small
transformed stem cells or progenitor cells that have strong self-renewal ability and can generate
additional cancer stem cell populations and cancer cells (Al-Hajj et al., 2004; Junker et al., 2005;
Pardal et al., 2003). The expression of Oct4 is detected in germ cell tumors, breast cancer and
osteosarcoma, bladder cancer, and cancer stem cell like cells (Chiou et al., 2008; Gibbs et al.,
2005; Hu et al., 2010; Looijenga et al., 2003). Oct4 and Nanog are strongly overexpressed in
poorly differentiated tumors and have a function in stem cell like characteristics in many tumors
(Ben-Porath et al., 2008; Wong et al., 2008). I observed Prkci-/- EBs had persistent Oct4
expression compared to Prkci+/-EBs and Prkci-/-EBs with Gö6983 treatment had even higher
percentage of Oct4 (Chapter2 and 3). Also multipotent stem cell populations along with
pluripotent stem cells are increased in -/- EBs (Chapter 3). Because Prkci-/-EBs have
heterogeneous stem cell populations, it is possible that cancer stem cell populations exist in
EBs. Therefore, I might need to examine whether other cancer stem cell markers along with
increased expression of Oct4 are strongly enhanced.
The relevance of aPKCs in NF-ĸB signaling has been studied in the immune system
(Diaz-Meco and Moscat, 2012). Prkcz can activate NF-ĸB activity after TNF-α, interleukin-1, or
lymphotoxin-β treatment (Diaz-Meco et al., 1994; Lallena et al., 1999; Leitges et al., 2001) and
Prkcz can regulate NF-κB by phosphorylating Ser311 residues of RelA subunit of NF-ĸB (Duran
et al., 2003). Prkci also can activate NF- ĸB activity by stimulated by TNF-α, interleukin-1β
(Bonizzi et al., 1999). NF- ĸB is the downstream of Prkci mediated cell survival in human
leukemia cell line (Lu et al., 2001). In contrast, Prkci inhibits NF-κB activity in human epithelial
cells(Forteza et al., 2013). Recent studies show that the inhibition of NF- ĸB activity by
interacting with Nanog leads to maintenance of pluripotency of ESCs (Torres and Watt, 2008).
115
Overexpression of NF- ĸB induces the differentiation of ESCs whereas inhibition of NF- ĸB by
overexpression of NF- ĸB inhibitor or loss of Ikbkg gene, an upstream regulator of NF- ĸB
induces increased expression of stem cell makers and delayed differentiation. Two studies
show that Prkcz by treating ESC with PKC inhibitor (Gö6983) is essential for multilineage
differentiation in mouse and rat ESCs (Dutta et al., 2011; Rajendran et al., 2013). Together with
previous findings, it is likely that Prkci might regulate the activity of NF- ĸB in different cell types.
Therefore, I cannot exclude the possibility that NF- ĸB might be inactivated in Prkci-/-EB and
ESCs owing to similar homology and function of Prkcz.
I observed that symmetric Numb pattern was prevalent in null EBs (Chapter 3). However
the expression of Numb was examined in single cells. Because Numb is a cell fate determinant
during asymmetric cell division (Knoblich, 2008), it is would be better to determine the
expression and activity of Numb in cells undergoing mitosis. It is very difficult to determine the
precise orientation in the expression of Numb. Pericentrin, a conserved centrosome protein that
is related to the formation of microtubules (Doxsey et al., 1994) is a good marker for cell division
(El-Hashash and Warburton, 2011). Therefore, Pericentrin staining could help to define the
orientation of Numb protein distribution during cell division.
Prkci specific inhibitors such as PSI, a myristoylated aPKC peptide inhibitor (Atwood et
al., 2013) aurothiomalate, a specific inhibitor of Prkci/Par6 binding (Greer et al., 2013), and ICA-
1, [4-(5-amino-4-carbamoylimidazol-1-yl)-2,3-dihydroxycyclopentyl] methyl dihydrogen
phosphate (Pillai et al., 2011) are used to reduce Prkci activity in cancer cell lines. From chapter
2 and 3, I showed that loss of Prkci promotes the accumulation of pluripotent stem cell and
multipotent stem cells. To develop methods for mass generation of certain multipotent stem
cells, I might need to examine which the use of these inhibitors. Ideally very specific Prkci
inhibitors might be preferable.
I found that BMP4 addition and Ezrin overexpression could not perfectly rescue the
phenotype of -/- EBs (Chapter 4). An earlier study on the role of Prkci in mouse embryogenesis
116
shows that overexpression of Prkcz partially recovers the phenotype of Prkci-/- embryo at
embryonic day7.5 but cannot rescue the lethality (Seidl et al., 2013). Therefore it seems that
Prkcz has similar but not the same function in embryogenesis.
In conclusion, these studies on Prkci and stem cell differentiation show new insights into
maintenance of stem cells and generation multipotent stem cells. In addition, these studies on
Prkci and EB differentiation has presented the new perspective that cell polarity is required for
BMP signaling and completing cavitation in EBs. Future studies can address the molecular
mechanism of sustained pluripotency and enhanced multipotency and the possibility of using a
Prkci inhibitor for regenerative therapies.

117
Chapter 6. Materials and Methods
Mouse ESC culture.
Mouse Prkci+/- and Prkci-/- ESCs were obtained from Dr. Rachel Soloff and Dr. Stephen
M. Hedrick, University of California at San Diego(Soloff et al., 2004). Mouse ESCs were
maintained on a feeder layer of mitomycin C treated mouse embryonic fibroblasts in Dulbecco’s
Modification of Eagle’s Medium (DMEM) supplemented with 15% Fetal Bovine Serum (VWR,
SH30071.03, Radnor, PA), 1% Sodium Pyruvate (Millipore, TMS-005-C, Billerica, MA) MEM, 1%
nonessential amino acids (Millipore, TMS-005-C,Billerica, MA), 1% penicillin and streptomycin,
1% L-Glutamine, 0.1 % 2-mercaptoethanol (GIBCO by Life Technologies, Cat# 21985023,
Carlsbad, CA), and 2% leukemia inhibitory factor conditioned media (produced in-house) at
37◦C in humidified air with 5% CO
2
.The ESCs media was changed every day and ESCs were
maintained every other day.
EB formation
Suspension culture and hanging drop methods were used to induce EB formation. To
make suspension culture EBs, subconfluent ESCs were dissociated with 0.25% trypsin-EDTA
into 20-50 cells and ES cell aggregates were then dispersed and cultured on bacteriological
petridishes in ES media without LIF (EB media) for 20 days. To induce cell aggregation using
hanging drop, ESCs were dissociated with 0.25% trypsin-EDTA into single cells and replated on
0.1% gelatin-coated 10 cm cell culture dishes for 1 hour to deplete the feeders. Single cells
were diluted with EB media to produce 250cells/20μL suspension. 20ul droplets containing
250cells were plated onto the lid of a bacteriological petridish. On day3, the ESC cell
aggregates were transferred into suspension culture and cultured for 20 days. The EB media
was changed every other day. Collected EBs were used for immunofluorescence studies and
histological studies. Some EBs were used for various differentiation assays.

118
ESC differentiation assay and Alkaline phosphatase assay
Simple differentiation assay and alkaline phosphatase assay were performed.1.5x10
5

ESCs were plated in 24 well plates then cultured for 5 days in EB media without LIF. Some of
samples were fixed in 4% Paraformaldehyde (PFA) and were used for immunostaining for
detection proteins. Alkaline phosphatase detection kit (Millipore, SCR004) was used for some
samples. ESCs were stained for alkaline phophatase activity according to the manufacturer’s
instructions. ESCs were fixed with 4% PFA for 1minute and rinsed with 1x TBS with 0.05%
Tween20. Prepared staining solution (Fast red violet: Naphthol AS-BI phosphate solution: water
=2:1:1) were added to each well and incubated for 15 minutes at dark. ESCs were rinsed in
1XPBS and covered with 1XPBS.
Neural differentiation of EB and ESCs
Day2 EBs were cultured in 8well Lab-TekII chamber slide (Nalge Nunc international,
154534) with EB media containing 10uM/ml Retinoic Acid (RA) (Sigma; R2625-500MG, St.
Louis, MO) for 4 days and then cultured in EB media for 6days. EB media supplemented with
RA or EB media was changed every other day. Samples were fixed with 4%PFA and
immunostained with Pax6, Nestin, Tuj1, Map2, and NeuN antibodies. Neural differentiation of
ESCs was described previously (Xu et al., 2012). Undifferentiated ESCs were plated onto 0.01%
gelatin –treated 24 well plates at a density of 2*10
4
cells/cm2 in N2B27 medium(1:1mixture of
DMEM/F12(Gibco) supplemented with N2 (Gibco) and Neurobasal medium (Gibco)
supplemented with B27 (Gibco) supplemented with 0.5mM L-glutamine, 0.1mM b-
mercaptoethanol (Gibco) (Kind gift from Qilong Ying from University of Southern California) with
1uM RA for two days then cultured with N2B27 media for 6 days. Then cells were fixed and
immunostained.

119
Beating cardiomyocyte differentiation of EB
Day6 and day12 EBs were plated onto 0.1%gelain treated 24 well plates and cultured
with EB media with 100nM RA for two days then cultured for 4 more days with EB media
(Wobus et al., 1994). Then Beating EBs were counted.
Colony forming assay
Collected EBs are dissociated with 0.25% collagenase type IV (Gibco, 17104-019) into
single cells. The cells were resuspended in MethoCult GF M3434 (StemCell Technologies) and
cultured for 2 weeks. Then the number of red colonies was scored.
Secondary EB formation
Secondary EB formation assay was carried out as described previously (Qu et al., 1997)
EBs from day6 to day16 were dissociated with 0.25% collagenase typeIV into single cells.
2.5*10
5
cells/well (250 cells/ul) for high density condition and 1*10
3
cells/well (1cell/ul) for low
density condition were plated onto 6 well plate EB media containing 0.3% methylcellulose
(Sigma, M6385) and cultured for 15days. Secondary EBs were counted in different time points.
Histology of EBs
Plastic embedding of EBs was performed as manufacturer’s instruction (Immune-Bed kit
from Polysciences, Inc). 4% PFA fixed EBs were dehydrated using serial ethanols (25%, 50%,
75%, and 100%) for each 10 minutes and were infiltrated into infiltration solution at 4
o
C
overnight. Infiltrated samples were plasticized using embedding solution in a plastic vacuum
desiccator for two days. The embedded samples were sectioned into 7 microns thickness
sections using a microtome (Thermo Scientific) and sections were dried at 37
o
C. Samples were
stained using Nuclear Fast Red (NFR) for 5 minutes, washed with water for two times and dried
at 37
o
C.
Immunofluorescence studies
Different stages of EBs were collected and washed with 1X PBS. They were fixed using
4% PFA for 15 minutes at room temperature and washed three times with 1X PBS after fixation.
120
The EBs were permeabilized for 15 minutes with PBS/0.5% Triton-X100 (EMD) (PBST) and
blocked for 1 hour at room temperature using 3% normal goat serum (NGS) in PBST. The EBs
were incubated with primary antibodies at 4
o
C overnight. Detailed information about primary
antibodies is summarized in Table 6.1. The EBs were then washed four times with PBST for
one hour and were incubated with the secondary antibody for one hour at room temperature.
Alexa Fluor® 488 goat anti-rabbit IgG (H+L) antibody (A11008), Alexa Fluor® 488 goat anti-
mouse IgG (H+L) antibody(A11001), Alexa Fluor® 488 goat anti-rat IgG (H+L)
antibody(A11006), Alexa Fluor® 488 rabbit anti-goat IgG (H+L) antibody(A11078), Alexa Fluor®
568 goat anti-rabbit IgG (H+L) antibody (A11011), Alexa Fluor® 568 goat anti-mouse IgG (H+L)
antibody (A11004), and Alexa Fluor® 568 goat anti-rat IgG (H+L) antibody (A11077) (Life
technologies) were diluted in PBST. The EBs were then washed four times with PBST for one
hour. Vectashield fluorescence mounting media containing 4’,6’-Diamidino-2-phenylindole
(DAPI) (Vector Lab) was used to stain the cell nuclei. EBs were then embedded in plastic and
sectioned (see above) and imaged using an Axioimager (Zeiss). To quantify Isl1 and Pax6
positive cells in EBs, the number of Pax6 and Isl1 in EBs were counted in red channel in Adobe
photoshop and the pixel of DAPI of same image was measured (Fogel et al., 2012). Then the
number of positive cells per pixel were calculated and then compared between Prkci+/- and
Prkci-/-EBs. 12 images per Prkci+/- EBs or Prkci-/- EBs were analyzed.
Rhodamine phalloidin staining
Rhodamine phalloidin staining solution (Invitrogen, R415) was applied to stain the F-
actin. Fixed EBs were rinsed in 1XPBS for two times and then stained with 1:40 diluted
Rhodamine phalloidin solution for 20 minutes at room temperature. Then EBs were washed in
1XPBS for two times, mounted with Vectashield fluorescence mounting media, and imaged
using an Axioimager.

121
Western blotting analysis
Harvested ESCs and EBs were lysed with RIPA lysis buffer (50mM Tris pH8.0, 150mM
NaCl, 01% SDS, 0.5% Sodium deoxycholate, 1% NP40, complete protease inhibitor (Roche),
and PhoSTOP phosphatase inhibitor (Roche). DC
TM
Protein assay reagent kit (BioRad, 500-
0111) was used for measuring the concentration of proteins. The absorbance of proteins was
measured at 750nm using spectrophotometer. The equal amount of protein was separated by
SDS/PAGE gel and transferred on PVDF membrane (BioRad). The membranes were blocked
and incubated overnight at 4
o
C with 1:1000 anti-phospho-STAT3 (Tyr705) (Cell signaling,
#9131), 1:1000 anti-STAT3 (Cell signaling, #9132), 1:1000 anti-phospho-p44/42 MAPK
(Erk1/2)(Thr202/Tyr204) (Cell signaling #9101), 1/;1000 anti-p44/42 MAPK(Erk1/2) (Cell
signaling #9102), 1:1000 anti-AKT (Cell signaling, 39272s), 1:1000 anti-phospho-AKT (Ser473)
(Cell signaling, #9271s), 1:1000 anti-alpha-Tubulin (Abcam, ab15246), 1:1000 anti-E-cadherin,
1:1000 anti- ß-catenin, and 1:1000 anti-LC3 (MBL,PD014). Antibody binding was detected by
ECL. Protein quantification was analyzed with Image J.
RT-PCR
Total RNA was extracted using Qiagen RNeasy extraction kit (Qiagen). RNA was
resuspended in 50 ul DEPC H
2
O containing DNase I buffer (Roche, 04716728001), 20 units
DNase I (Roche, 04716728001), 40 units of RNase inhibitor (Roche, 03335399001), and 20mM
DTT and incubated for 30 minutes at 37°C. The sample was reextracted with phenol-chloroform
1:1 (EMD, 6805) and precipitated with 2.5 volumes of ethanol, 0.1 volumes of 10M NH
4
OAc and
10mg glycogen (Calbiochem, 361507) at -20°C for 1 hour and washed with 70% ethanol. The
dried pellet was resuspended in 20ul DEPC H
2
O and stored at -80°C. 1µg RNA was reverse
transcribed using M-MuLV reverse transcriptase (New England Biolabs, M0253S). 1ug RNA
was resuspended in 16ul DEPC H
2
O containing 2mM random hexamers (Amersham
Bioscicenes, 27216601) and 10mM dNTPs (Promega, U1240) and denatured at 65°C for 5
minutes. Reverse transcription reactions containing M-MuLV reverse transcriptase reaction
122
buffer, 200 units of M-MuLV reverse transcriptase and 40 units of RNase inhibitor was added
into RNA and incubated for 1 hour at 42°C, reactions were terminated by heating at 90°C for 10
minutes. PCR reactions were conducted in a 25 ul volume: 1ul of cDNA, Gotag
®
green master
mix (Promega, M71231), 0.5ul of 100ng of each primer. Primer sequences and annealing
temperature used in the RT-PCR are summarized in Table 6.2. PCR programs were presented
as follow: initial denaturation at 95°C for 2 minutes; cycles began with denaturation at 95°C for
20 seconds, then annealing at primer dependent temperature for 30 seconds, extension at 70°C
for 30 seconds, and programs ran 30-35 cycles.
Cell sorting
Harvested EBs were dissociated with 0.25% collagenase typeIV into single cells. Cells
was fixed with 4% PFA and incubated with anti-Oct3/4 antibody overnight at 4 degree. After
primary antibody incubation, cells were washed with 1X PBS for three times, incubated with
secondary Alexa Fluor 488 antibody for 1 hour, and washed with 1XPBS for three times. Live
EB dissociated cells were washed with 1X PBS for two times, incubated with anti-SSEA-1 Alexa
Fluor 488 for 45 minutes on ice and washed with 1X PBS for two times. Stained cells were
purified with the use of a FACS Aria flow cytometer (BD biosciences) on the basis of established
fluorphore. Oct4 positive cells were used to isolate RNA and protein, SSEA-1 positive cells were
plated into 24 well plates in ES media for two days then cells were harvested for RNA and
protein isolations.
Real time ready custom panel analysis
LightCycler
®
480 real time ready custom plate was used for these studies. Total RNA
from harvested EBs was isolated by high pure RNA isolation kit (Roche, 11828665001)
according to the manufacturer’s instructions. Equal amount of RNA was reverse transcribed
using Transcriptor first strand cDNA synthesis kit (Roche, 04379012001) according to the
manufacturer’s instructions. Preparation of PCR was carried out using LightCycler 480 Probes
Master according to the manufacturer’s instructions. PCR was conducted with the
123
LightCycler
®
480 instrument (Roche) with the PCR program: pre-incubation (1 cycle) at 95°C for
10 minutes, amplification (45 cycles) at 95°C for 10 seconds, 60°C for 30 seconds, and 72°C for
one second, and cooling (1 cycle) at 40°C for 30 seconds. The expression levels of the genes
were normalized to the mean of four references genes using delta crossing point (Cp) for
calculation. ΔΔCt method (Livak and Schmittgen, 2001) was used to calculate relative
quantification between Prkci+/- and Prkci-/- EBs.
Open array analysis
109-gene TaqMan® OpenArray® gene expression mouse stem cell panel on the
QuantStudio™ 12K Flex Real-Time PCR System was used for this study. Two EBs were
directly lysed with Single Cell Lysis kit (Ambion, 4458235). Two EBs were incubated with 10ul
single cell lysis DNase I for five minutes and stopped the reaction with 1ul single cell lysis stop
solution. Reverse transcription of each lysate was carried out according to manufacturer’s
instructions (Single Cell-to CT kit (Ambion)). Preamplification and amplification of samples were
performed according to open array manufacturer’s instructions. The results were analyzed using
the ExpressionSuite™ software on the QuantStudio™ 12K Flex Real- Time PCR with
OpenArray® Block System and also imported into a SQL database and analyzed with the
statistical package, R.
PKC inhibitor treatment
5uM PKC inhibitor (Sigma, Gö6983) was used for drug treatment. To study the effect of
PKC inhibitor in ES cell differentiation, ESCs were grown in EB media without feeder layer for
two days. To differentiate ESCs, ESCs were plated on a six well plate with PKC inhibitor or
DMSO then culture for 5 days with changing media for every other day. Drug treated ESCs
were used for making EBs. EBs were cultured continuously in EB media with PKC inhibitor.
Some of EBs was used for cell sorting and immunofluorescence studies.

124
Recombinant DNA construction
Mouse Ezrin full length cDNA were made by PCR.KOD hot start DNA polymerase
(Novagen, 71086-3) were used to generate non mutated DNA. PCR reactions were conducted
in 50ul volume: 1ul cDNA, PCR buffer for KOD Hot Start DNA Polymerase, 200uM dNTPs, 1mM
MgSO4, 0.3uM each primer, 1unit of KOD Hot Start DNA Polymerase. The PCR program were
indicated as follow: initial denaturation at 94 °C for 2 minutes and cycle began with denaturation
at 94°C for 15 seconds, annealing at 60°C for 30 seconds and extension at 72°C for 1 minute
for 40 cycles. Primer sequences used in the PCR were as follows: EcoR1-Ezrin
forward:AAAAAGAATTCATGCCCAAGCCAATCAACGTCCGGGTG and Ezrin-HindIII reverse:
AAAAAAAGCTTCTACATGGCCTCGAACTCGTCAATGCGTTGCTTGG. PCR products and
CS107 plasmid were purified with phenol-chloroform extraction method and were cut by EcoR1
(Promega, R6011) and HindIII (Promega, R6041). Restricted PCR products were inserted in the
EcoR1 site of CS107 plasmid vector using Quick ligation kit (New England Biolabs, M2200S).
Ligated Ezrin CS107 plasmids were transformed into NEB 5-alpha competent E.coli (New
England Biolabs, C2988J) and plated into LB plate with 1x Carbenicillin (VWR, 80030-956).
Picked colonies were inoculated in 2ml LB media with 1x Carbenicillin. Ezrin plasmids were
isolated from grown bacteria using Plasmid mini kit (Qigen, 12123) according to the
manufacturer’s instructions. Ezrin plasmid was cut by EcoR1 and HindIII enzymes to confirm
whether Ezrin DNA is inserted into vector. Confirmed plasmids were sequenced to check
mutations (USC DNA core facility).
Transient cDNA expression in ESCs
3x10
5
ESCs without feeder cells were seeded 24 hour before on 0.1% gelatin treated 6
well plates. 7.2g Ezrin DNA were diluted into 343ul of DMEM media then 14ul of Fugene HD
reagent (Promega, E2311) was added into diluted DNA. Then complex was mixed by vortexing
briefly and incubated for 5-10 minutes at room temperature. 325ul of complex per well was
125
added into ESCs plates. Then ESCs were cultured for 24 hours without changing media.
Transfected ESCs were used for making EBs and isolation RNA and proteins.
Prkci knockdown using lentivirus
The non-silencing pGIPZ shRNAmir control (Open Biosystems,RHS4346) and pGIPZ
containing shRNA against Prkci (Open Biosystems, V2LMM_44740: 5' -
GCATTAAAGCAGCGTATC - 3') are used to knock down endogenous Prkci. 3ug of pGIPZ
control plasmid or pGIPZ shPrkci plasmid vector, 5ug PsPAX2, and 2ug pMD2.G were
cotransfected into 293Tcells in 100mm tissue culture dish. After 24h, the medium was replaced
with ESC media. Supernatant was harvested after 48h then filtered through a 0.45um filter (Pall,
PN4614), directly used to transduce ESCs. 1x10
5
Prkci +/- ESCs were plated into 24 well plates
and were infected with 300ul of lentivirus in the presence of 8ug/mL polybrene (Sigma, H9268).
After 24h, media was changed. After 24h, transuded ESCs were maintained in the ES media
with 3ug/mL puromycin (Sigma, P8833) for two days. ESCs were dissociated with 0.25%
trypsin-EDTA then replated into 6well plate. After48h, GFP positive colonies were picked then
replated into 96well plates after dissociation with 0.25% trypsin-EDTA. After pure GFP positive
cells were acquired, cells were expanded into 24 well plates. Expanded cells were used for
isolating RNA and generating EBs.
TUNEL assay
Plastic sections were washed three times for 5 min with 1xPBS with 0.1% Tween 20
(EMD, 655205), permeabilized for 5 min with 0.1% Triton-X on ice, and then rinsed two times for
5 min with 1xPBS with 0.1% Tween20. Sections were incubated with TUNEL reaction mixture
(In situ cell death detection kit, Roche, 1684795) for 1 hour at 37
o
C and then rinsed two times
for 5 min with 1x PBS with 0.1% Tween 20. Vectashield fluorescence mounting media
containing 4’,6’-Diamidino-2-phenylindole (DAPI) was used to stain the cell nuclei.

126
BrdU incorporation
Cell proliferation was examined by incubating EBs with10uM BrdU (Sigma, B5002) for
24h. The EBs was collected, washed with 1xPBS, and fixed with 4%PFA for 15min at room
temperature. EBs was treated with 3% H
2
O
2
to block endogenous peroxidase activity for 10
minutes at 37
o
C Then EBs was rinsed in 1xPBS, soaked with 2NHCl for 30 minutes at 37
o
C to
denature DNA, and washed in1xPBS. The EBs were permeabilized for 15 minutes with
PBS/0.5% Triton-X100 (PBST) and blocked for 1 hour at room temperature using 3% normal
goat serum in PBST. The EBs was incubated with 1:200 anti-BrdU antibodies (Sigma, B2531) at
4
o
C overnight. The EBs was then washed four times with PBS-T for one hour and was
incubated with the Alexa Fluor® 488 secondary antibodies for one hour at room temperature.
The EBs was then washed four times in PBS-T for one hour. Vectashield fluorescence mounting
media containing 4’,6’-Diamidino-2-phenylindole (DAPI) (Vector Lab) was used to stain the cell
nuclei. Then EBs was used for plastic embedding.
Cell adhesion assay
96 well plates were coated with 20ug/mL fibronectin (BD Biosciences, 610077), 10ug/mL
laminin (Sigma, L2020), and 10ug/mL interginβ1 (Abcam, ab30394) at 4 ℃ overnight. Plates
were blocked for 1 hour at 37 ℃with 1% BSA in DMEM media and then washed with 0.1% BSA
in DMEM. Prkci+/- and -/- ESCs (5 × 10
3
) were added to coated wells and non coated wells and
incubated for 3 hours at 37°C/5% CO
2
in a humidified atmosphere. Nonadherent cells were
washed off with 0.1%BSA in DMEM, fixed with 4% PFA, and then stained with CellMask™
Orange Plasma membrane Stain (Life technologies, C10045) adherent cells were visually
counted microscopically.
Cell-cell aggregation assay
0.5 mL of 0.5% poly-HEMA (Sigma; Cat# P3932-10G) was added into 24 well plates which were
kept in the culture hood without the blower to inhibit the quick drying of the poly-HEMA and
without the lid overnight. 7x10
4
ESCs were incubated with DMEM media that are used for
127
preventing to form aggregates by serum not cell itself for 3hours at 37°C/5% CO
2
in a humidified
atmosphere. Cells were collected into 1.5mL eppendorf tube, fixed with 4% PFA, washed with
1xPBS. Cells were then centrifuged down and re-suspended in 1x PBS and taken images using
a hemacytometer (Bright-line).
BMP4 rescue experiments
Day3 EBs was cultured in the presence of 15ug/ul recombinant human BMP4(R &D
systems, 314-BP) for 4 days. During 4 day, EB media containing BMP4 were replaced every 48
hours. Control cultures without added BMP4 were included. Collected EBs at different time
points were immunostained with phospho-Smad1/5, cytokeratin EndoA antibodies, and Ezrin.
Cell mixing EB
R1 GPI-GFP wildtype ESCs (generously provided by Anna-Katerina Hadjantonakis from
Sloan-Kettering Institute, Nowotschin et al., 2009) and Prkci-/-ESCs were used for these
experiments. A ratio of 1 R1 GPI-GFP : 9 Prkci-/-ESCs and a 1:1 ratio cells were mixed and
used for making EB using hanging drop methods. Single cells were diluted with EB media to
produce 250cells/20μL suspension. 20ul droplets containing 250cells were plated onto the lid of
a bacteriological petridish. On day 3, the ESC cell aggregates were transferred into suspension
culture and cultured until collection for analysis. Collected EBs was fixed, embedded in OCT,
cryosectioned, and immunostained.
Cell proliferation and cell doubling time
5x10
3
Prkci+/- and Prkci-/- ESCs were plated in 24 well plates in ES media. After 24, 48,
72, 96 hours, cell were dissociated with 0.25% trypsin-EDTA, and washed in 1X PBS for two
times, and then counted under the microscope. Triple experiments were performed. Cell
doubling times were calculated by the software available from http://www.doubling-
time.com/compute.php.

128
Statistical analysis
Statistical significance between experimental groups was performed with the unpaired
student t- test using Microsoft Excel.

129
Table 6.1 Antibodies and dilution ratios
Antibody name Company (catalog #) Dilution ratio
Oct4
Santa Cruz Biotechnology, (SC-5279)
1:200
β-catenin Santa Cruz Biotechnology, (SC-7963) 1:100
SSEA1(480) Alexa Fluor 488 Santa Cruz Biotechnology, (SC-7963) 1:200
E-cadherin Invitrogen (13-1900) 1:1000
cytokeratin EndoA
Developmental Studies Hybridoma
Bank(TROMA-I)
1:200
Pax6
Developmental Studies Hybridoma
Bank
1:20
Nestin
Developmental Studies Hybridoma
Bank
1:20
Isl1
Developmental Studies Hybridoma
Bank
1:100
Nkx2-5(N-19) Santa Cruz biotechnology (SC-8697) 1:100
Neuronal Nuclei (NeuN) Millipore (Mab377) 1:100
Map2(2a+2b) Sigma (M2320) 1:100
Numb Abcam (ab14140) 1:50
Phospho-Numb (Ser276) Bioss USA (bs-3311R) 1:100
Tuj1 Sigma (T2200) 1:200
DDX/MVH (Vasa) Abcam (ab27591) 1:100
Stella Santa cruz Biotechnology (SC-67249) 1:200
activated Notch1 Abcam 1:100
Hes5 Abcam 1:200
GM130
BD Transduction Laboratories
(610822)
1:50
Zo1
Developmental Studies hybridoma
bank (R26.4C)
1:5
Phospho-Histon H3 (Ser10) Millipore (06-570) 1:100
CD29 BD Transuction laboratories, (610467) 1:100
Phospho-
Smad1/5(Ser463/465)(41D10)
Cell signaling (9516)
1:50
LAMC1 (Laminin) Sigma (HPA001909) 1:200
Ezrin Abcam (ab4069) 1:50
Phospho-Numb (Ser295)

130
Table 6.2 Primer sequences and annealing temperatures

Gene Primer sequences
Annealing
Temperature
T
F: GCTTCAAGGAGCTAACTAAC
R: CACGAAGTCCAGCAAGAAAG
57
o
C
Afp
F: TTCCCTCATCCTCCTGCTAC
R: TTCTTCTCCGTCACGCACTG
57
o
C
Gata6
F: GCAATGCATGCGGTCTCTAC
R: CTCTTGGTAGCACCAGCTCA
53
o
C
Fgf5
F: CATCTTCTGCAGCCACCTGATCCA
R: AAGTTCCGGTTGCTCGGACTGCTT
53
o
C
Bmp2
F: AGCTGCAAGAGACACCCTTT
R: CATGCCTTAGGGATTTTGGA
53
o
C
Bmp4
F: TGTGAGGAGTTTCCATCACG
R: TTATTCTTCTTCCTGGACCG
53
o
C
Prkci
F: AAGGAGGCAATGAACACC
R: CCGACAAGAAAAGGGTGA
53
o
C
Prkcz
F: GCCTCCCTTCCAGCCCCAGA
R: CACGGACTCCTCAGCAGACAGCA
60
o
C
Sox1
F: AGGCAGCTGGGTCTCAGAAG
R: GAAATCAAAGGCACGCTGTCT
60
o
C
Pax6
F: CATGGCAAACAACCTGCCTAT
R: ATAACTCCGCCCATTCACTGA
60
o
C
Nestin
F: ACTAAGTCCTCAGTGCCAGA
R: AACCTGGAGTCAGAGCAAGT
60
o
C
Tju1
F: ACTAAGTCCTCAGTGCCAGA
R: TGTCGATGCAGTAGGTCTCG
60
o
C
Map2
F:TTCTTTTGCTTGCTCGGGATT
R: ATACAGGGCTTGGTTTATTTCAGAGA
60
o
C
Nkx2-5
F: GCTACAAGTGCAAGCGACAG
R: GGGTAGGCGTTGTAGCCATA
57
o
C
Lamininβ1
F: TGACAAGGAGACGGGACGAT
R: CGTGCCCAGGTAATTGCAG
55
o
C
Hnf
F: CTTCCTTCTTCATGCCAG
R: ACACGTCCCATCTGAAG
49
o
C
Ttr
F: CTCACCACAGATGAGAAG
R: GGCTGAGTCTCTCAATTC
49
o
C
Ezrin
F: ACACCAAGCAACGCATTGACG
R: ACAGTGCTGTCCCAGTGACAAT
58
o
C
18S rRNA
F: GTAACCCGTTGAACCCCATT
R: CCATCCAATCGGTAGTAGCG
53
o
C
131
References
Ahimou, F., Mok, L.P., Bardot, B., and Wesley, C. (2004). The adhesion force of Notch with
Delta and the rate of Notch signaling. The Journal of cell biology 167, 1217-1229.
Akimoto, K., Mizuno, K., Osada, S., Hirai, S., Tanuma, S., Suzuki, K., and Ohno, S. (1994). A
new member of the third class in the protein kinase C family, PKC lambda, expressed
dominantly in an undifferentiated mouse embryonal carcinoma cell line and also in many tissues
and cells. The Journal of biological chemistry 269, 12677-12683.
Al-Hajj, M., Becker, M.W., Wicha, M., Weissman, I., and Clarke, M.F. (2004). Therapeutic
implications of cancer stem cells. Current opinion in genetics & development 14, 43-47.
Angelov, D.N., Arnhold, S., Andressen, C., Grabsch, H., Puschmann, M., Hescheler, J., and
Addicks, K. (1998). Temporospatial relationships between macroglia and microglia during in
vitro differentiation of murine stem cells. Developmental neuroscience 20, 42-51.
Artavanis-Tsakonas, S., Rand, M.D., and Lake, R.J. (1999). Notch signaling: cell fate control
and signal integration in development. Science 284, 770-776.
Assemat, E., Bazellieres, E., Pallesi-Pocachard, E., Le Bivic, A., and Massey-Harroche, D.
(2008). Polarity complex proteins. Biochimica et biophysica acta 1778, 614-630.
Atwood, S.X., Li, M., Lee, A., Tang, J.Y., and Oro, A.E. (2013). GLI activation by atypical protein
kinase C iota/lambda regulates the growth of basal cell carcinomas. Nature 494, 484-488.
Avilion, A.A., Nicolis, S.K., Pevny, L.H., Perez, L., Vivian, N., and Lovell-Badge, R. (2003).
Multipotent cell lineages in early mouse development depend on SOX2 function. Genes &
development 17, 126-140.
Balendran, A., Hare, G.R., Kieloch, A., Williams, M.R., and Alessi, D.R. (2000). Further
evidence that 3-phosphoinositide-dependent protein kinase-1 (PDK1) is required for the stability
and phosphorylation of protein kinase C (PKC) isoforms. FEBS letters 484, 217-223.
132
Bard, J.B., and Ross, A.S. (1991). LIF, the ES-cell inhibition factor, reversibly blocks
nephrogenesis in cultured mouse kidney rudiments. Development 113, 193-198.
Barnhart, B.C., and Simon, M.C. (2007). Metastasis and stem cell pathways. Cancer metastasis
reviews 26, 261-271.
Baum, C.M., Weissman, I.L., Tsukamoto, A.S., Buckle, A.M., and Peault, B. (1992). Isolation of
a candidate human hematopoietic stem-cell population. Proceedings of the National Academy
of Sciences of the United States of America 89, 2804-2808.
Bello, B.C., Izergina, N., Caussinus, E., and Reichert, H. (2008). Amplification of neural stem
cell proliferation by intermediate progenitor cells in Drosophila brain development. Neural
development 3, 5.
Ben-Porath, I., Thomson, M.W., Carey, V.J., Ge, R., Bell, G.W., Regev, A., and Weinberg, R.A.
(2008). An embryonic stem cell-like gene expression signature in poorly differentiated
aggressive human tumors. Nature genetics 40, 499-507.
Benes, C.H., Wu, N., Elia, A.E., Dharia, T., Cantley, L.C., and Soltoff, S.P. (2005). The C2
domain of PKCdelta is a phosphotyrosine binding domain. Cell 121, 271-280.
Berdnik, D., Torok, T., Gonzalez-Gaitan, M., and Knoblich, J.A. (2002). The endocytic protein
alpha-Adaptin is required for numb-mediated asymmetric cell division in Drosophila.
Developmental cell 3, 221-231.
Bertrand, N., Castro, D.S., and Guillemot, F. (2002). Proneural genes and the specification of
neural cell types. Nature reviews Neuroscience 3, 517-530.
Betschinger, J., Mechtler, K., and Knoblich, J.A. (2003). The Par complex directs asymmetric
cell division by phosphorylating the cytoskeletal protein Lgl. Nature 422, 326-330.
Boeckeler, K., Rosse, C., Howell, M., and Parker, P.J. (2010). Manipulating signal delivery -
plasma-membrane ERK activation in aPKC-dependent migration. Journal of cell science 123,
2725-2732.
133
Bonizzi, G., Piette, J., Schoonbroodt, S., Merville, M.P., and Bours, V. (1999). Role of the
protein kinase C lambda/iota isoform in nuclear factor-kappaB activation by interleukin-1beta or
tumor necrosis factor-alpha: cell type specificities. Biochemical pharmacology 57, 713-720.
Bornancin, F., and Parker, P.J. (1996). Phosphorylation of threonine 638 critically controls the
dephosphorylation and inactivation of protein kinase Calpha. Current biology : CB 6, 1114-1123.
Bray, S.J. (2006). Notch signalling: a simple pathway becomes complex. Nature reviews
Molecular cell biology 7, 678-689.
Bretscher, A., Chambers, D., Nguyen, R., and Reczek, D. (2000). ERM-Merlin and EBP50
protein families in plasma membrane organization and function. Annual review of cell and
developmental biology 16, 113-143.
Bretscher, A., Edwards, K., and Fehon, R.G. (2002). ERM proteins and merlin: integrators at the
cell cortex. Nature reviews Molecular cell biology 3, 586-599.
Brown, C.O., 3rd, Chi, X., Garcia-Gras, E., Shirai, M., Feng, X.H., and Schwartz, R.J. (2004).
The cardiac determination factor, Nkx2-5, is activated by mutual cofactors GATA-4 and
Smad1/4 via a novel upstream enhancer. The Journal of biological chemistry 279, 10659-10669.
Brustle, O., Spiro, A.C., Karram, K., Choudhary, K., Okabe, S., and McKay, R.D. (1997). In
vitro-generated neural precursors participate in mammalian brain development. Proceedings of
the National Academy of Sciences of the United States of America 94, 14809-14814.
Bultje, R.S., Castaneda-Castellanos, D.R., Jan, L.Y., Jan, Y.N., Kriegstein, A.R., and Shi, S.H.
(2009). Mammalian Par3 regulates progenitor cell asymmetric division via notch signaling in the
developing neocortex. Neuron 63, 189-202.
Burdon, T., Stracey, C., Chambers, I., Nichols, J., and Smith, A. (1999). Suppression of SHP-2
and ERK signalling promotes self-renewal of mouse embryonic stem cells. Developmental
biology 210, 30-43.
Burns, D.J., and Bell, R.M. (1991). Protein kinase C contains two phorbol ester binding domains.
The Journal of biological chemistry 266, 18330-18338.
134
Buther, K., Plaas, C., Barnekow, A., and Kremerskothen, J. (2004). KIBRA is a novel substrate
for protein kinase Czeta. Biochemical and biophysical research communications 317, 703-707.
Cabernard, C., and Doe, C.Q. (2009). Apical/basal spindle orientation is required for neuroblast
homeostasis and neuronal differentiation in Drosophila. Developmental cell 17, 134-141.
Camargo, F.D., Gokhale, S., Johnnidis, J.B., Fu, D., Bell, G.W., Jaenisch, R., and
Brummelkamp, T.R. (2007). YAP1 increases organ size and expands undifferentiated
progenitor cells. Current biology : CB 17, 2054-2060.
Cartwright, P., McLean, C., Sheppard, A., Rivett, D., Jones, K., and Dalton, S. (2005).
LIF/STAT3 controls ES cell self-renewal and pluripotency by a Myc-dependent mechanism.
Development 132, 885-896.
Cayouette, M., Whitmore, A.V., Jeffery, G., and Raff, M. (2001). Asymmetric segregation of
Numb in retinal development and the influence of the pigmented epithelium. The Journal of
neuroscience : the official journal of the Society for Neuroscience 21, 5643-5651.
Chambers, I., Colby, D., Robertson, M., Nichols, J., Lee, S., Tweedie, S., and Smith, A. (2003).
Functional expression cloning of Nanog, a pluripotency sustaining factor in embryonic stem cells.
Cell 113, 643-655.
Chan, R.J., Johnson, S.A., Li, Y., Yoder, M.C., and Feng, G.S. (2003). A definitive role of Shp-2
tyrosine phosphatase in mediating embryonic stem cell differentiation and hematopoiesis. Blood
102, 2074-2080.
Chan, S.S., Shi, X., Toyama, A., Arpke, R.W., Dandapat, A., Iacovino, M., Kang, J., Le, G.,
Hagen, H.R., Garry, D.J., et al. (2013). Mesp1 patterns mesoderm into cardiac, hematopoietic,
or skeletal myogenic progenitors in a context-dependent manner. Cell stem cell 12, 587-601.
Chen, J., and Zhang, M. (2013). The Par3/Par6/aPKC complex and epithelial cell polarity.
Experimental cell research 319, 1357-1364.
135
Chen, Y., Li, X., Eswarakumar, V.P., Seger, R., and Lonai, P. (2000). Fibroblast growth factor
(FGF) signaling through PI 3-kinase and Akt/PKB is required for embryoid body differentiation.
Oncogene 19, 3750-3756.
Chiba, S. (2006). Notch signaling in stem cell systems. Stem cells 24, 2437-2447.
Chidgey, M., and Dawson, C. (2007). Desmosomes: a role in cancer? British journal of cancer
96, 1783-1787.
Chiou, S.H., Yu, C.C., Huang, C.Y., Lin, S.C., Liu, C.J., Tsai, T.H., Chou, S.H., Chien, C.S., Ku,
H.H., and Lo, J.F. (2008). Positive correlations of Oct-4 and Nanog in oral cancer stem-like cells
and high-grade oral squamous cell carcinoma. Clinical cancer research : an official journal of
the American Association for Cancer Research 14, 4085-4095.
Choi, K., Chung, Y.S., and Zhang, W.J. (2005). Hematopoietic and endothelial development of
mouse embryonic stem cells in culture. Methods in molecular medicine 105, 359-368.
Chou, Y.F., Chen, H.H., Eijpe, M., Yabuuchi, A., Chenoweth, J.G., Tesar, P., Lu, J., McKay,
R.D., and Geijsen, N. (2008). The growth factor environment defines distinct pluripotent ground
states in novel blastocyst-derived stem cells. Cell 135, 449-461.
Chuan, Y.C., Pang, S.T., Cedazo-Minguez, A., Norstedt, G., Pousette, A., and Flores-Morales,
A. (2006). Androgen induction of prostate cancer cell invasion is mediated by ezrin. The Journal
of biological chemistry 281, 29938-29948.
Coleman, E.S., and Wooten, M.W. (1994). Nerve growth factor-induced differentiation of PC12
cells employs the PMA-insensitive protein kinase C-zeta isoform. Journal of molecular
neuroscience : MN 5, 39-57.
Conti, L., and Cattaneo, E. (2010). Neural stem cell systems: physiological players or in vitro
entities? Nature reviews Neuroscience 11, 176-187.
Cooper, A.R., and MacQueen, H.A. (1983). Subunits of laminin are differentially synthesized in
mouse eggs and early embryos. Developmental biology 96, 467-471.
136
Coscoy, S., Waharte, F., Gautreau, A., Martin, M., Louvard, D., Mangeat, P., Arpin, M., and
Amblard, F. (2002). Molecular analysis of microscopic ezrin dynamics by two-photon FRAP.
Proceedings of the National Academy of Sciences of the United States of America 99, 12813-
12818.
Costa, M.R., Wen, G., Lepier, A., Schroeder, T., and Gotz, M. (2008). Par-complex proteins
promote proliferative progenitor divisions in the developing mouse cerebral cortex. Development
135, 11-22.
Coucouvanis, E., and Martin, G.R. (1995). Signals for death and survival: a two-step
mechanism for cavitation in the vertebrate embryo. Cell 83, 279-287.
Coucouvanis, E., and Martin, G.R. (1999). BMP signaling plays a role in visceral endoderm
differentiation and cavitation in the early mouse embryo. Development 126, 535-546.
Covello, K.L., Kehler, J., Yu, H., Gordan, J.D., Arsham, A.M., Hu, C.J., Labosky, P.A., Simon,
M.C., and Keith, B. (2006). HIF-2alpha regulates Oct-4: effects of hypoxia on stem cell function,
embryonic development, and tumor growth. Genes & development 20, 557-570.
Covello, K.L., Simon, M.C., and Keith, B. (2005). Targeted replacement of hypoxia-inducible
factor-1alpha by a hypoxia-inducible factor-2alpha knock-in allele promotes tumor growth.
Cancer research 65, 2277-2286.
Dang, S.M., Gerecht-Nir, S., Chen, J., Itskovitz-Eldor, J., and Zandstra, P.W. (2004). Controlled,
scalable embryonic stem cell differentiation culture. Stem cells 22, 275-282.
Dard, N., Louvet-Vallee, S., Santa-Maria, A., and Maro, B. (2004). Phosphorylation of ezrin on
threonine T567 plays a crucial role during compaction in the mouse early embryo.
Developmental biology 271, 87-97.
Das, M., Burns, N., Wilson, S.J., Zawada, W.M., and Stenmark, K.R. (2008). Hypoxia exposure
induces the emergence of fibroblasts lacking replication repressor signals of PKCzeta in the
pulmonary artery adventitia. Cardiovascular research 78, 440-448.
137
Debnath, J., Mills, K.R., Collins, N.L., Reginato, M.J., Muthuswamy, S.K., and Brugge, J.S.
(2002). The role of apoptosis in creating and maintaining luminal space within normal and
oncogene-expressing mammary acini. Cell 111, 29-40.
Delva, E., Tucker, D.K., and Kowalczyk, A.P. (2009). The desmosome. Cold Spring Harbor
perspectives in biology 1, a002543.
Desbaillets, I., Ziegler, U., Groscurth, P., and Gassmann, M. (2000). Embryoid bodies: an in
vitro model of mouse embryogenesis. Experimental physiology 85, 645-651.
Dho, S.E., Trejo, J., Siderovski, D.P., and McGlade, C.J. (2006). Dynamic regulation of
mammalian numb by G protein-coupled receptors and protein kinase C activation: Structural
determinants of numb association with the cortical membrane. Molecular biology of the cell 17,
4142-4155.
Diaz-Meco, M.T., Dominguez, I., Sanz, L., Dent, P., Lozano, J., Municio, M.M., Berra, E., Hay,
R.T., Sturgill, T.W., and Moscat, J. (1994). zeta PKC induces phosphorylation and inactivation
of I kappa B-alpha in vitro. The EMBO journal 13, 2842-2848.
Diaz-Meco, M.T., and Moscat, J. (2012). The atypical PKCs in inflammation: NF-kappaB and
beyond. Immunological reviews 246, 154-167.
Doerflinger, H., Vogt, N., Torres, I.L., Mirouse, V., Koch, I., Nusslein-Volhard, C., and St
Johnston, D. (2010). Bazooka is required for polarisation of the Drosophila anterior-posterior
axis. Development 137, 1765-1773.
Doetschman, T.C., Eistetter, H., Katz, M., Schmidt, W., and Kemler, R. (1985). The in vitro
development of blastocyst-derived embryonic stem cell lines: formation of visceral yolk sac,
blood islands and myocardium. Journal of embryology and experimental morphology 87, 27-45.
Doxsey, S.J., Stein, P., Evans, L., Calarco, P. D., Kirschner, M. (1994). Pericentrin, a highly
conserved centrosome protein involved in microtubule organization. Cell 76, 639-650.

138
Dransfield, D.T., Bradford, A.J., Smith, J., Martin, M., Roy, C., Mangeat, P.H., and Goldenring,
J.R. (1997). Ezrin is a cyclic AMP-dependent protein kinase anchoring protein. The EMBO
journal 16, 35-43.
Duncan, A.W., Rattis, F.M., DiMascio, L.N., Congdon, K.L., Pazianos, G., Zhao, C., Yoon, K.,
Cook, J.M., Willert, K., Gaiano, N., et al. (2005). Integration of Notch and Wnt signaling in
hematopoietic stem cell maintenance. Nature immunology 6, 314-322.
Duncan, S.A., Manova, K., Chen, W.S., Hoodless, P., Weinstein, D.C., Bachvarova, R.F., and
Darnell, J.E., Jr. (1994). Expression of transcription factor HNF-4 in the extraembryonic
endoderm, gut, and nephrogenic tissue of the developing mouse embryo: HNF-4 is a marker for
primary endoderm in the implanting blastocyst. Proceedings of the National Academy of
Sciences of the United States of America 91, 7598-7602.
Duran, A., Diaz-Meco, M.T., and Moscat, J. (2003). Essential role of RelA Ser311
phosphorylation by zetaPKC in NF-kappaB transcriptional activation. The EMBO journal 22,
3910-3918.
Durgan, J., Kaji, N., Jin, D., and Hall, A. (2011). Par6B and atypical PKC regulate mitotic spindle
orientation during epithelial morphogenesis. The Journal of biological chemistry 286, 12461-
12474.
Dutil, E.M., and Newton, A.C. (2000). Dual role of pseudosubstrate in the coordinated regulation
of protein kinase C by phosphorylation and diacylglycerol. The Journal of biological chemistry
275, 10697-10701.
Dutil, E.M., Toker, A., and Newton, A.C. (1998). Regulation of conventional protein kinase C
isozymes by phosphoinositide-dependent kinase 1 (PDK-1). Current biology : CB 8, 1366-1375.
Dutta, D., Ray, S., Home, P., Larson, M., Wolfe, M.W., and Paul, S. (2011). Self-renewal versus
lineage commitment of embryonic stem cells: protein kinase C signaling shifts the balance.
Stem cells 29, 618-628.
139
El-Hashash, A.H., Warburton, D. (2011). Cell polarity and spindle orientation in the distal
epithelium of embryonic lung. Developmental Dynamics 240, 441-445.
Eom, D.S., Amarnath, S., Fogel, J.L., and Agarwala, S. (2011). Bone morphogenetic proteins
regulate neural tube closure by interacting with the apicobasal polarity pathway. Development
138, 3179-3188.
Ericson, J., Thor, S., Edlund, T., Jessell, T.M., and Yamada, T. (1992). Early stages of motor
neuron differentiation revealed by expression of homeobox gene Islet-1. Science 256, 1555-
1560.
Ernst, M., Oates, A., and Dunn, A.R. (1996). Gp130-mediated signal transduction in embryonic
stem cells involves activation of Jak and Ras/mitogen-activated protein kinase pathways. The
Journal of biological chemistry 271, 30136-30143.
Evans, M.J., and Kaufman, M.H. (1981). Establishment in culture of pluripotential cells from
mouse embryos. Nature 292, 154-156.
Fehon, R.G., McClatchey, A.I., and Bretscher, A. (2010). Organizing the cell cortex: the role of
ERM proteins. Nature reviews Molecular cell biology 11, 276-287.
Fields, A.P., Frederick, L.A., and Regala, R.P. (2007). Targeting the oncogenic protein kinase
Ciota signalling pathway for the treatment of cancer. Biochemical Society transactions 35, 996-
1000.
Fields, A.P., and Regala, R.P. (2007). Protein kinase C iota: human oncogene, prognostic
marker and therapeutic target. Pharmacol Res 55, 487-497.
Fievet, B.T., Gautreau, A., Roy, C., Del Maestro, L., Mangeat, P., Louvard, D., and Arpin, M.
(2004). Phosphoinositide binding and phosphorylation act sequentially in the activation
mechanism of ezrin. The Journal of cell biology 164, 653-659.
Fogel, J.L., Thein, T.Z., and Mariani, F.V. (2012). Use of LysoTracker to detect programmed cell
death in embryos and differentiating embryonic stem cells. Journal of visualized experiments :
JoVE.
140
Forteza, R., Wald, F.A., Mashukova, A., Kozhekbaeva, Z., and Salas, P.J. (2013). Par-complex
aPKC and Par3 cross-talk with innate immunity NF-kappaB pathway in epithelial cells. Biology
open 2.
Fraichard, A., Chassande, O., Bilbaut, G., Dehay, C., Savatier, P., and Samarut, J. (1995). In
vitro differentiation of embryonic stem cells into glial cells and functional neurons. Journal of cell
science 108 ( Pt 10), 3181-3188.
French, M.B., Koch, U., Shaye, R.E., McGill, M.A., Dho, S.E., Guidos, C.J., and McGlade, C.J.
(2002). Transgenic expression of numb inhibits notch signaling in immature thymocytes but
does not alter T cell fate specification. Journal of immunology 168, 3173-3180.
Gao, N., and Kaestner, K.H. (2010). Cdx2 regulates endo-lysosomal function and epithelial cell
polarity. Genes & development 24, 1295-1305.
Gary, R., and Bretscher, A. (1993). Heterotypic and homotypic associations between ezrin and
moesin, two putative membrane-cytoskeletal linking proteins. Proceedings of the National
Academy of Sciences of the United States of America 90, 10846-10850.
Geijsen, N., Horoschak, M., Kim, K., Gribnau, J., Eggan, K., and Daley, G.Q. (2004). Derivation
of embryonic germ cells and male gametes from embryonic stem cells. Nature 427, 148-154.
Genevet, A., and Tapon, N. (2011). The Hippo pathway and apico-basal cell polarity. The
Biochemical journal 436, 213-224.
Georgiou, M., Marinari, E., Burden, J., and Baum, B. (2008). Cdc42, Par6, and aPKC regulate
Arp2/3-mediated endocytosis to control local adherens junction stability. Current biology : CB 18,
1631-1638.
Ghosh, S., Marquardt, T., Thaler, J.P., Carter, N., Andrews, S.E., Pfaff, S.L., and Hunter, T.
(2008). Instructive role of aPKCzeta subcellular localization in the assembly of adherens
junctions in neural progenitors. Proceedings of the National Academy of Sciences of the United
States of America 105, 335-340.
141
Gibbs, C.P., Kukekov, V.G., Reith, J.D., Tchigrinova, O., Suslov, O.N., Scott, E.W., Ghivizzani,
S.C., Ignatova, T.N., and Steindler, D.A. (2005). Stem-like cells in bone sarcomas: implications
for tumorigenesis. Neoplasia 7, 967-976.
Giorgione, J.R., Lin, J.H., McCammon, J.A., and Newton, A.C. (2006). Increased membrane
affinity of the C1 domain of protein kinase Cdelta compensates for the lack of involvement of its
C2 domain in membrane recruitment. The Journal of biological chemistry 281, 1660-1669.
Goh, L.H., Zhou, X., Lee, M.C., Lin, S., Wang, H., Luo, Y., and Yang, X. (2013). Clueless
regulates aPKC activity and promotes self-renewal cell fate in Drosophila lgl mutant larval brains.
Developmental biology 381, 353-364.
Goldstein, B., and Macara, I.G. (2007). The PAR proteins: fundamental players in animal cell
polarization. Developmental cell 13, 609-622.
Gomez-Lopez, S., Lerner, R.G., and Petritsch, C. (2014). Asymmetric cell division of stem and
progenitor cells during homeostasis and cancer. Cellular and molecular life sciences : CMLS 71,
575-597.
Gordon, W.R., Arnett, K.L., and Blacklow, S.C. (2008). The molecular logic of Notch signaling--a
structural and biochemical perspective. Journal of cell science 121, 3109-3119.
Greer, Y.E., Fields, A.P., Brown, A.M., and Rubin, J.S. (2013). Atypical protein kinase Ciota is
required for Wnt3a-dependent neurite outgrowth and binds to phosphorylated dishevelled 2.
The Journal of biological chemistry 288, 9438-9446.
Grzeschik, N.A., Parsons, L.M., Allott, M.L., Harvey, K.F., and Richardson, H.E. (2010). Lgl,
aPKC, and Crumbs regulate the Salvador/Warts/Hippo pathway through two distinct
mechanisms. Current biology : CB 20, 573-581.
Gschwendt, M., Dieterich, S., Rennecke, J., Kittstein, W., Mueller, H.J., and Johannes, F.J.
(1996). Inhibition of protein kinase C mu by various inhibitors. Differentiation from protein kinase
c isoenzymes. FEBS letters 392, 77-80.
142
Gude, N., and Sussman, M. (2012). Notch signaling and cardiac repair. Journal of molecular
and cellular cardiology 52, 1226-1232.
Gulino, A., Di Marcotullio, L., and Screpanti, I. (2010). The multiple functions of Numb.
Experimental cell research 316, 900-906.
Gustafsson, M.V., Zheng, X., Pereira, T., Gradin, K., Jin, S., Lundkvist, J., Ruas, J.L., Poellinger,
L., Lendahl, U., and Bondesson, M. (2005). Hypoxia requires notch signaling to maintain the
undifferentiated cell state. Developmental cell 9, 617-628.
Haenfler, J.M., Kuang, C., and Lee, C.Y. (2012). Cortical aPKC kinase activity distinguishes
neural stem cells from progenitor cells by ensuring asymmetric segregation of Numb.
Developmental biology 365, 219-228.
Harris, T.J., and Peifer, M. (2005). The positioning and segregation of apical cues during
epithelial polarity establishment in Drosophila. The Journal of cell biology 170, 813-823.
Harris, T.J., and Peifer, M. (2007). aPKC controls microtubule organization to balance adherens
junction symmetry and planar polarity during development. Developmental cell 12, 727-738.
Hartung, A., Bitton-Worms, K., Rechtman, M.M., Wenzel, V., Boergermann, J.H., Hassel, S.,
Henis, Y.I., and Knaus, P. (2006). Different routes of bone morphogenic protein (BMP) receptor
endocytosis influence BMP signaling. Molecular and cellular biology 26, 7791-7805.
Hay, B.A., Wolff, T., and Rubin, G.M. (1994). Expression of baculovirus P35 prevents cell death
in Drosophila. Development 120, 2121-2129.
Hayashi, K., Lopes, S.M., Tang, F., and Surani, M.A. (2008). Dynamic equilibrium and
heterogeneity of mouse pluripotent stem cells with distinct functional and epigenetic states. Cell
stem cell 3, 391-401.
Hayashi, K., and Surani, M.A. (2009). Self-renewing epiblast stem cells exhibit continual
delineation of germ cells with epigenetic reprogramming in vitro. Development 136, 3549-3556.
He, S., Nakada, D., and Morrison, S.J. (2009). Mechanisms of stem cell self-renewal. Annual
review of cell and developmental biology 25, 377-406.
143
Heining, E., Bhushan, R., Paarmann, P., Henis, Y.I., and Knaus, P. (2011). Spatial segregation
of BMP/Smad signaling affects osteoblast differentiation in C2C12 cells. PloS one 6, e25163.
Heiska, L., Alfthan, K., Gronholm, M., Vilja, P., Vaheri, A., and Carpen, O. (1998). Association of
ezrin with intercellular adhesion molecule-1 and -2 (ICAM-1 and ICAM-2). Regulation by
phosphatidylinositol 4, 5-bisphosphate. The Journal of biological chemistry 273, 21893-21900.
Henrique, D., and Schweisguth, F. (2003). Cell polarity: the ups and downs of the Par6/aPKC
complex. Current opinion in genetics & development 13, 341-350.
Hescheler, J., Fleischmann, B.K., Lentini, S., Maltsev, V.A., Rohwedel, J., Wobus, A.M., and
Addicks, K. (1997). Embryonic stem cells: a model to study structural and functional properties
in cardiomyogenesis. Cardiovascular research 36, 149-162.
Hirano, Y., Yoshinaga, S., Ogura, K., Yokochi, M., Noda, Y., Sumimoto, H., and Inagaki, F.
(2004). Solution structure of atypical protein kinase C PB1 domain and its mode of interaction
with ZIP/p62 and MEK5. The Journal of biological chemistry 279, 31883-31890.
Hochedlinger, K., Yamada, Y., Beard, C., and Jaenisch, R. (2005). Ectopic expression of Oct-4
blocks progenitor-cell differentiation and causes dysplasia in epithelial tissues. Cell 121, 465-
477.
Horikoshi, Y., Suzuki, A., Yamanaka, T., Sasaki, K., Mizuno, K., Sawada, H., Yonemura, S., and
Ohno, S. (2009). Interaction between PAR-3 and the aPKC-PAR-6 complex is indispensable for
apical domain development of epithelial cells. Journal of cell science 122, 1595-1606.
Hu, L., McArthur, C., and Jaffe, R.B. (2010). Ovarian cancer stem-like side-population cells are
tumourigenic and chemoresistant. British journal of cancer 102, 1276-1283.
Huang, G., Yan, H., Ye, S., Tong, C., and Ying, Q.L. (2013). STAT3 phosphorylation at tyrosine
705 and serine 727 differentially regulates mouse ES cell fates. Stem cells.
Hurley, J.H., Newton, A.C., Parker, P.J., Blumberg, P.M., and Nishizuka, Y. (1997). Taxonomy
and function of C1 protein kinase C homology domains. Protein science : a publication of the
Protein Society 6, 477-480.
144
Hynes, R.O. (2002). Integrins: bidirectional, allosteric signaling machines. Cell 110, 673-687.
Ichikawa, S., Hatanaka, H., Takeuchi, Y., Ohno, S., and Inagaki, F. (1995). Solution structure of
cysteine-rich domain of protein kinase C alpha. Journal of biochemistry 117, 566-574.
Imai, F., Hirai, S., Akimoto, K., Koyama, H., Miyata, T., Ogawa, M., Noguchi, S., Sasaoka, T.,
Noda, T., and Ohno, S. (2006). Inactivation of aPKClambda results in the loss of adherens
junctions in neuroepithelial cells without affecting neurogenesis in mouse neocortex.
Development 133, 1735-1744.
Inaba, M., and Yamashita, Y.M. (2012). Asymmetric stem cell division: precision for robustness.
Cell stem cell 11, 461-469.
Jadhav, A.P., Cho, S.H., and Cepko, C.L. (2006). Notch activity permits retinal cells to progress
through multiple progenitor states and acquire a stem cell property. Proceedings of the National
Academy of Sciences of the United States of America 103, 18998-19003.
Jaken, S. (1996). Protein kinase C isozymes and substrates. Curr Opin Cell Biol 8, 168-173.
Jedrusik, A., Parfitt, D.E., Guo, G., Skamagki, M., Grabarek, J.B., Johnson, M.H., Robson, P.,
and Zernicka-Goetz, M. (2008). Role of Cdx2 and cell polarity in cell allocation and specification
of trophectoderm and inner cell mass in the mouse embryo. Genes & development 22, 2692-
2706.
Jin, Y.T., Ying, X.X., Hu, Y.H., Zou, Q., Wang, H.Y., and Xu, Y.H. (2008). aPKC inhibitors might
be the sensitizer of chemotherapy and adoptive immunotherapy in the treatment of hASIPa-
overexpressed breast cancer. Oncol Res 17, 59-68.
Joberty, G., Petersen, C., Gao, L., and Macara, I.G. (2000). The cell-polarity protein Par6 links
Par3 and atypical protein kinase C to Cdc42. Nature cell biology 2, 531-539.
Johnson, J.E., Giorgione, J., and Newton, A.C. (2000). The C1 and C2 domains of protein
kinase C are independent membrane targeting modules, with specificity for phosphatidylserine
conferred by the C1 domain. Biochemistry 39, 11360-11369.
145
Johnson, K., and Wodarz, A. (2003). A genetic hierarchy controlling cell polarity. Nature cell
biology 5, 12-14.
Junker, K., Wolf, M., and Schubert, J. (2005). Molecular clonal analysis of recurrent bladder
cancer. Oncology reports 14, 319-323.
Kabeya, Y., Mizushima, N., Ueno, T., Yamamoto, A., Kirisako, T., Noda, T., Kominami, E.,
Ohsumi, Y., and Yoshimori, T. (2000). LC3, a mammalian homologue of yeast Apg8p, is
localized in autophagosome membranes after processing. The EMBO journal 19, 5720-5728.
Kageyama, R., Ohtsuka, T., Shimojo, H., and Imayoshi, I. (2008). Dynamic Notch signaling in
neural progenitor cells and a revised view of lateral inhibition. Nature neuroscience 11, 1247-
1251.
Katoh, M., and Katoh, M. (2007). Integrative genomic analyses on HES/HEY family: Notch-
independent HES1, HES3 transcription in undifferentiated ESCs, and Notch-dependent HES1,
HES5, HEY1, HEY2, HEYL transcription in fetal tissues, adult tissues, or cancer. International
journal of oncology 31, 461-466.
Kazi, J.U. (2011). The mechanism of protein kinase C regulation. Front Biol 6, 328-336.
Keller, G., Kennedy, M., Papayannopoulou, T., and Wiles, M.V. (1993). Hematopoietic
commitment during embryonic stem cell differentiation in culture. Molecular and cellular biology
13, 473-486.
Keller, G.M. (1995). In vitro differentiation of embryonic stem cells. Current opinion in cell
biology 7, 862-869.
Kemphues, K.J., Priess, J.R., Morton, D.G., and Cheng, N.S. (1988). Identification of genes
required for cytoplasmic localization in early C. elegans embryos. Cell 52, 311-320.
Keranen, L.M., Dutil, E.M., and Newton, A.C. (1995). Protein kinase C is regulated in vivo by
three functionally distinct phosphorylations. Current biology : CB 5, 1394-1403.
Kikkawa, U., Kishimoto, A., and Nishizuka, Y. (1989). The protein kinase C family: heterogeneity
and its implications. Annual review of biochemistry 58, 31-44.
146
Kingham, E., and Oreffo, R.O. (2013). Embryonic and induced pluripotent stem cells:
understanding, creating, and exploiting the nano-niche for regenerative medicine. ACS nano 7,
1867-1881.
Klezovitch, O., Fernandez, T.E., Tapscott, S.J., and Vasioukhin, V. (2004). Loss of cell polarity
causes severe brain dysplasia in Lgl1 knockout mice. Genes & development 18, 559-571.
Knoblich, J.A. (2008). Mechanisms of asymmetric stem cell division. Cell 132, 583-597.
Knoblich, J.A., Jan, L.Y., and Jan, Y.N. (1995). Asymmetric segregation of Numb and Prospero
during cell division. Nature 377, 624-627.
Kobayashi, T., and Kageyama, R. (2010). Hes1 regulates embryonic stem cell differentiation by
suppressing Notch signaling. Genes to cells : devoted to molecular & cellular mechanisms 15,
689-698.
Kohler, K., and Zahraoui, A. (2005). Tight junction: a co-ordinator of cell signalling and
membrane trafficking. Biology of the cell / under the auspices of the European Cell Biology
Organization 97, 659-665.
Kovac, J., Oster, H., and Leitges, M. (2007). Expression of the atypical protein kinase C (aPKC)
isoforms iota/lambda and zeta during mouse embryogenesis. Gene expression patterns : GEP 7,
187-196.
Kunath, T., Saba-El-Leil, M.K., Almousailleakh, M., Wray, J., Meloche, S., and Smith, A. (2007).
FGF stimulation of the Erk1/2 signalling cascade triggers transition of pluripotent embryonic
stem cells from self-renewal to lineage commitment. Development 134, 2895-2902.
Kurosawa, H. (2007). Methods for inducing embryoid body formation: in vitro differentiation
system of embryonic stem cells. Journal of bioscience and bioengineering 103, 389-398.
Lallena, M.J., Diaz-Meco, M.T., Bren, G., Paya, C.V., and Moscat, J. (1999). Activation of
IkappaB kinase beta by protein kinase C isoforms. Molecular and cellular biology 19, 2180-2188.
Leckband, D., and Sivasankar, S. (2000). Mechanism of homophilic cadherin adhesion. Current
opinion in cell biology 12, 587-592.
147
Leder, A., Daugherty, C., Whitney, B., and Leder, P. (1997). Mouse zeta- and alpha-globin
genes: embryonic survival, alpha-thalassemia, and genetic background effects. Blood 90, 1275-
1282.
Lee, C.Y., Andersen, R.O., Cabernard, C., Manning, L., Tran, K.D., Lanskey, M.J., Bashirullah,
A., and Doe, C.Q. (2006a). Drosophila Aurora-A kinase inhibits neuroblast self-renewal by
regulating aPKC/Numb cortical polarity and spindle orientation. Genes & development 20, 3464-
3474.
Lee, C.Y., Robinson, K.J., and Doe, C.Q. (2006b). Lgl, Pins and aPKC regulate neuroblast self-
renewal versus differentiation. Nature 439, 594-598.
Leitges, M., Sanz, L., Martin, P., Duran, A., Braun, U., Garcia, J.F., Camacho, F., Diaz-Meco,
M.T., Rennert, P.D., and Moscat, J. (2001). Targeted disruption of the zetaPKC gene results in
the impairment of the NF-kappaB pathway. Molecular cell 8, 771-780.
Li, L., Arman, E., Ekblom, P., Edgar, D., Murray, P., and Lonai, P. (2004). Distinct GATA6- and
laminin-dependent mechanisms regulate endodermal and ectodermal embryonic stem cell fates.
Development 131, 5277-5286.
Li, R., Liang, J., Ni, S., Zhou, T., Qing, X., Li, H., He, W., Chen, J., Li, F., Zhuang, Q., et al.
(2010). A mesenchymal-to-epithelial transition initiates and is required for the nuclear
reprogramming of mouse fibroblasts. Cell stem cell 7, 51-63.
Li, S., Edgar, D., Fassler, R., Wadsworth, W., and Yurchenco, P.D. (2003). The role of laminin
in embryonic cell polarization and tissue organization. Developmental cell 4, 613-624.
Li, S., Harrison, D., Carbonetto, S., Fassler, R., Smyth, N., Edgar, D., and Yurchenco, P.D.
(2002). Matrix assembly, regulation, and survival functions of laminin and its receptors in
embryonic stem cell differentiation. The Journal of cell biology 157, 1279-1290.
Li, S., and Yurchenco, P.D. (2006). Matrix assembly, cell polarization, and cell survival: analysis
of peri-implantation development with cultured embryonic stem cells. Methods in molecular
biology 329, 113-125.
148
Li, X., Chen, Y., Scheele, S., Arman, E., Haffner-Krausz, R., Ekblom, P., and Lonai, P. (2001).
Fibroblast growth factor signaling and basement membrane assembly are connected during
epithelial morphogenesis of the embryoid body. The Journal of cell biology 153, 811-822.
Lian, I., Kim, J., Okazawa, H., Zhao, J., Zhao, B., Yu, J., Chinnaiyan, A., Israel, M.A., Goldstein,
L.S., Abujarour, R., et al. (2010). The role of YAP transcription coactivator in regulating stem cell
self-renewal and differentiation. Genes & development 24, 1106-1118.
Lieschke, G.J., and Dunn, A.R. (1995). Development of functional macrophages from
embryonal stem cells in vitro. Experimental hematology 23, 328-334.
Litherland, G.J., Elias, M.S., Hui, W., Macdonald, C.D., Catterall, J.B., Barter, M.J., Farren, M.J.,
Jefferson, M., and Rowan, A.D. (2010). Protein kinase C isoforms zeta and iota mediate
collagenase expression and cartilage destruction via STAT3- and ERK-dependent c-fos
induction. The Journal of biological chemistry 285, 22414-22425.
Liu, H., Jiang, D., Chi, F., and Zhao, B. (2012). The Hippo pathway regulates stem cell
proliferation, self-renewal, and differentiation. Protein & cell 3, 291-304.
Liu, H., Wu, Z., Shi, X., Li, W., Liu, C., Wang, D., Ye, X., Liu, L., Na, J., Cheng, H., et al. (2013).
Atypical PKC, regulated by Rho GTPases and Mek/Erk, phosphorylates Ezrin during eight-cell
embryocompaction. Developmental biology 375, 13-22.
Liu, S.G., Wang, B.S., Jiang, Y.Y., Zhang, T.T., Shi, Z.Z., Yang, Y., Yang, Y.L., Wang, X.C., Lin,
D.C., Zhang, Y., et al. (2011). Atypical protein kinase Ciota (PKCiota) promotes metastasis of
esophageal squamous cell carcinoma by enhancing resistance to Anoikis via PKCiota-SKP2-
AKT pathway. Molecular cancer research : MCR 9, 390-402.
Liu, X.J., He, A.B., Chang, Y.S., and Fang, F.D. (2006). Atypical protein kinase C in glucose
metabolism. Cellular signalling 18, 2071-2076.
Livak, K.J., and Schmittgen, T.D. (2001). Analysis of relative gene expression data using real-
time quantitative PCR and the 2(-Delta Delta C(T)) Method. Methods 25, 402-408.
149
Lo Sardo, V., Zuccato, C., Gaudenzi, G., Vitali, B., Ramos, C., Tartari, M., Myre, M.A., Walker,
J.A., Pistocchi, A., Conti, L., et al. (2012). An evolutionary recent neuroepithelial cell adhesion
function of huntingtin implicates ADAM10-Ncadherin. Nature neuroscience 15, 713-721.
Looijenga, L.H., Stoop, H., de Leeuw, H.P., de Gouveia Brazao, C.A., Gillis, A.J., van
Roozendaal, K.E., van Zoelen, E.J., Weber, R.F., Wolffenbuttel, K.P., van Dekken, H., et al.
(2003). POU5F1 (OCT3/4) identifies cells with pluripotent potential in human germ cell tumors.
Cancer research 63, 2244-2250.
Louvet, S., Aghion, J., Santa-Maria, A., Mangeat, P., and Maro, B. (1996). Ezrin becomes
restricted to outer cells following asymmetrical division in the preimplantation mouse embryo.
Developmental biology 177, 568-579.
Lu, Y., Jamieson, L., Brasier, A.R., and Fields, A.P. (2001). NF-kappaB/RelA transactivation is
required for atypical protein kinase C iota-mediated cell survival. Oncogene 20, 4777-4792.
Lux, C.T., Yoshimoto, M., McGrath, K., Conway, S.J., Palis, J., and Yoder, M.C. (2008). All
primitive and definitive hematopoietic progenitor cells emerging before E10 in the mouse
embryo are products of the yolk sac. Blood 111, 3435-3438.
Macara, I.G. (2004). Par proteins: partners in polarization. Current biology : CB 14, R160-162.
Macara, I.G., and Mili, S. (2008). Polarity and differential inheritance--universal attributes of life?
Cell 135, 801-812.
Makover, A., Soprano, D.R., Wyatt, M.L., and Goodman, D.S. (1989). An in situ-hybridization
study of the localization of retinol-binding protein and transthyretin messenger RNAs during fetal
development in the rat. Differentiation; research in biological diversity 40, 17-25.
Martin-Belmonte, F., and Perez-Moreno, M. (2012). Epithelial cell polarity, stem cells and
cancer. Nature reviews Cancer 12, 23-38.
Martin, F.A., Perez-Garijo, A., and Morata, G. (2009). Apoptosis in Drosophila: compensatory
proliferation and undead cells. The International journal of developmental biology 53, 1341-1347.
150
Martin, G.R., and Evans, M.J. (1975). Differentiation of clonal lines of teratocarcinoma cells:
formation of embryoid bodies in vitro. Proceedings of the National Academy of Sciences of the
United States of America 72, 1441-1445.
Masui, S., Nakatake, Y., Toyooka, Y., Shimosato, D., Yagi, R., Takahashi, K., Okochi, H.,
Okuda, A., Matoba, R., Sharov, A.A., et al. (2007). Pluripotency governed by Sox2 via
regulation of Oct3/4 expression in mouse embryonic stem cells. Nature cell biology 9, 625-635.
Matsuda, T., Nakamura, T., Nakao, K., Arai, T., Katsuki, M., Heike, T., and Yokota, T. (1999).
STAT3 activation is sufficient to maintain an undifferentiated state of mouse embryonic stem
cells. The EMBO journal 18, 4261-4269.
McGill, M.A., Dho, S.E., Weinmaster, G., and McGlade, C.J. (2009). Numb regulates post-
endocytic trafficking and degradation of Notch1. The Journal of biological chemistry 284, 26427-
26438.
McGill, M.A., and McGlade, C.J. (2003). Mammalian numb proteins promote Notch1 receptor
ubiquitination and degradation of the Notch1 intracellular domain. The Journal of biological
chemistry 278, 23196-23203.
Meissner, A., Wernig, M., and Jaenisch, R. (2007). Direct reprogramming of genetically
unmodified fibroblasts into pluripotent stem cells. Nature biotechnology 25, 1177-1181.
Milano, J., McKay, J., Dagenais, C., Foster-Brown, L., Pognan, F., Gadient, R., Jacobs, R.T.,
Zacco, A., Greenberg, B., and Ciaccio, P.J. (2004). Modulation of notch processing by gamma-
secretase inhibitors causes intestinal goblet cell metaplasia and induction of genes known to
specify gut secretory lineage differentiation. Toxicological sciences : an official journal of the
Society of Toxicology 82, 341-358.
Miller-Hance, W.C., LaCorbiere, M., Fuller, S.J., Evans, S.M., Lyons, G., Schmidt, C., Robbins,
J., and Chien, K.R. (1993). In vitro chamber specification during embryonic stem cell
cardiogenesis. Expression of the ventricular myosin light chain-2 gene is independent of heart
tube formation. The Journal of biological chemistry 268, 25244-25252.
151
Mitsui, K., Tokuzawa, Y., Itoh, H., Segawa, K., Murakami, M., Takahashi, K., Maruyama, M.,
Maeda, M., and Yamanaka, S. (2003). The homeoprotein Nanog is required for maintenance of
pluripotency in mouse epiblast and ES cells. Cell 113, 631-642.
Miyamoto, K., Araki, K.Y., Naka, K., Arai, F., Takubo, K., Yamazaki, S., Matsuoka, S., Miyamoto,
T., Ito, K., Ohmura, M., et al. (2007). Foxo3a is essential for maintenance of the hematopoietic
stem cell pool. Cell stem cell 1, 101-112.
Mochly-Rosen, D., and Gordon, A.S. (1998). Anchoring proteins for protein kinase C: a means
for isozyme selectivity. FASEB journal : official publication of the Federation of American
Societies for Experimental Biology 12, 35-42.
Morales, F.C., Takahashi, Y., Kreimann, E.L., and Georgescu, M.M. (2004). Ezrin-radixin-
moesin (ERM)-binding phosphoprotein 50 organizes ERM proteins at the apical membrane of
polarized epithelia. Proceedings of the National Academy of Sciences of the United States of
America 101, 17705-17710.
Morini, M., Piccini, D., De Santanna, A., Levi, G., Barbieri, O., and Astigiano, S. (1999).
Localization and expression of integrin subunits in the embryoid bodies of F9 teratocarcinoma
cells. Experimental cell research 247, 114-122.
Morrison, S.J., and Kimble, J. (2006). Asymmetric and symmetric stem-cell divisions in
development and cancer. Nature 441, 1068-1074.
Moscat, J., Diaz-Meco, M.T., and Wooten, M.W. (2009). Of the atypical PKCs, Par-4 and p62:
recent understandings of the biology and pathology of a PB1-dominated complex. Cell death
and differentiation 16, 1426-1437.
Muller, H.A., and Wieschaus, E. (1996). armadillo, bazooka, and stardust are critical for early
stages in formation of the zonula adherens and maintenance of the polarized blastoderm
epithelium in Drosophila. The Journal of cell biology 134, 149-163.
Murray, N.R., Kalari, K.R., and Fields, A.P. (2011). Protein kinase Ciota expression and
oncogenic signaling mechanisms in cancer. J Cell Physiol 226, 879-887.
152
Murray, P., and Edgar, D. (2000). Regulation of programmed cell death by basement
membranes in embryonic development. The Journal of cell biology 150, 1215-1221.
Nakamura, N., Oshiro, N., Fukata, Y., Amano, M., Fukata, M., Kuroda, S., Matsuura, Y., Leung,
T., Lim, L., and Kaibuchi, K. (2000). Phosphorylation of ERM proteins at filopodia induced by
Cdc42. Genes to cells : devoted to molecular & cellular mechanisms 5, 571-581.
Neisch, A.L., and Fehon, R.G. (2011). Ezrin, Radixin and Moesin: key regulators of membrane-
cortex interactions and signaling. Current opinion in cell biology 23, 377-382.
Newton, A.C. (2001). Protein kinase C: structural and spatial regulation by phosphorylation,
cofactors, and macromolecular interactions. Chemical reviews 101, 2353-2364.
Newton, A.C. (2003). Regulation of the ABC kinases by phosphorylation: protein kinase C as a
paradigm. The Biochemical journal 370, 361-371.
Newton, A.C. (2010). Protein kinase C: poised to signal. American journal of physiology
Endocrinology and metabolism 298, E395-402.
Nichols, J., Silva, J., Roode, M., and Smith, A. (2009). Suppression of Erk signalling promotes
ground state pluripotency in the mouse embryo. Development 136, 3215-3222.
Nichols, J., Zevnik, B., Anastassiadis, K., Niwa, H., Klewe-Nebenius, D., Chambers, I., Scholer,
H., and Smith, A. (1998). Formation of pluripotent stem cells in the mammalian embryo depends
on the POU transcription factor Oct4. Cell 95, 379-391.
Nicolson, G.L. (1992). Paracrine/autocrine growth mechanisms in tumor metastasis. Oncology
Research 4, 389-399.
Niebruegge, S., Nehring, A., Bar, H., Schroeder, M., Zweigerdt, R., and Lehmann, J. (2008).
Cardiomyocyte production in mass suspension culture: embryonic stem cells as a source for
great amounts of functional cardiomyocytes. Tissue engineering Part A 14, 1591-1601.
Niessen, M.T., Scott, J., Zielinski, J.G., Vorhagen, S., Sotiropoulou, P.A., Blanpain, C., Leitges,
M., and Niessen, C.M. (2013). aPKClambda controls epidermal homeostasis and stem cell fate
through regulation of division orientation. The Journal of cell biology 202, 887-900.
153
Nishimura, T., and Kaibuchi, K. (2007). Numb controls integrin endocytosis for directional cell
migration with aPKC and PAR-3. Developmental cell 13, 15-28.
Nishizuka, Y. (1995). Protein kinase C and lipid signaling for sustained cellular responses.
FASEB journal : official publication of the Federation of American Societies for Experimental
Biology 9, 484-496.
Niwa, H., Burdon, T., Chambers, I., and Smith, A. (1998). Self-renewal of pluripotent embryonic
stem cells is mediated via activation of STAT3. Genes & development 12, 2048-2060.
Niwa, H., Miyazaki, J., and Smith, A.G. (2000). Quantitative expression of Oct-3/4 defines
differentiation, dedifferentiation or self-renewal of ESCs. Nature genetics 24, 372-376.
Noatynska, A., and Gotta, M. (2012). Cell polarity and asymmetric cell division: the C. elegans
early embryo. Essays in biochemistry 53, 1-14.
Nowotschin, S., Eakin, G.S., and Hadjantonakis, A.K. (2009). Dual transgene strategy for live
visualization of chromatin and plasma membrane dynamics in murine embryonic stem cells and
embryonic tissues. Genesis 47, 330-336.
O'Reilly, L.P., Watkins, S.C., and Smithgall, T.E. (2011). An unexpected role for the clock
protein timeless in developmental apoptosis. PloS one 6, e17157.
Ohinata, Y., Payer, B., O'Carroll, D., Ancelin, K., Ono, Y., Sano, M., Barton, S.C., Obukhanych,
T., Nussenzweig, M., Tarakhovsky, A., et al. (2005). Blimp1 is a critical determinant of the germ
cell lineage in mice. Nature 436, 207-213.
Ohno, S. (2001). Intercellular junctions and cellular polarity: the PAR-aPKC complex, a
conserved core cassette playing fundamental roles in cell polarity. Current opinion in cell biology
13, 641-648.
Okamoto, K., Okazawa, H., Okuda, A., Sakai, M., Muramatsu, M., and Hamada, H. (1990). A
novel octamer binding transcription factor is differentially expressed in mouse embryonic cells.
Cell 60, 461-472.
154
Okamura, D., Kimura, T., Nakano, T., and Matsui, Y. (2003). Cadherin-mediated cell interaction
regulates germ cell determination in mice. Development 130, 6423-6430.
Oliva, J.L., Griner, E.M., and Kazanietz, M.G. (2005). PKC isozymes and diacylglycerol-
regulated proteins as effectors of growth factor receptors. Growth factors 23, 245-252.
Orr, J.W., and Newton, A.C. (1994). Intrapeptide regulation of protein kinase C. The Journal of
biological chemistry 269, 8383-8387.
Paling, N.R., Wheadon, H., Bone, H.K., and Welham, M.J. (2004). Regulation of embryonic
stem cell self-renewal by phosphoinositide 3-kinase-dependent signaling. The Journal of
biological chemistry 279, 48063-48070.
Pallante, B.A., Duignan, I., Okin, D., Chin, A., Bressan, M.C., Mikawa, T., and Edelberg, J.M.
(2007). Bone marrow Oct3/4+ cells differentiate into cardiac myocytes via age-dependent
paracrine mechanisms. Circulation research 100, e1-11.
Pardal, R., Clarke, M.F., and Morrison, S.J. (2003). Applying the principles of stem-cell biology
to cancer. Nature reviews Cancer 3, 895-902.
Payer, B., Chuva de Sousa Lopes, S.M., Barton, S.C., Lee, C., Saitou, M., and Surani, M.A.
(2006). Generation of stella-GFP transgenic mice: a novel tool to study germ cell development.
Genesis 44, 75-83.
Peng, Y., Sigua, C.A., Rideout, D., and Murr, M.M. (2008). Deletion of toll-like receptor-4
downregulates protein kinase C-zeta and attenuates liver injury in experimental pancreatitis.
Surgery 143, 679-685.
Perez-Garijo, A., Shlevkov, E., and Morata, G. (2009). The role of Dpp and Wg in compensatory
proliferation and in the formation of hyperplastic overgrowths caused by apoptotic cells in the
Drosophila wing disc. Development 136, 1169-1177.
Petersen, P.H., Zou, K., Krauss, S., and Zhong, W. (2004). Continuing role for mouse Numb
and Numbl in maintaining progenitor cells during cortical neurogenesis. Nature neuroscience 7,
803-811.
155
Petronczki, M., and Knoblich, J.A. (2001). DmPAR-6 directs epithelial polarity and asymmetric
cell division of neuroblasts in Drosophila. Nature cell biology 3, 43-49.
Pietromonaco, S.F., Simons, P.C., Altman, A., and Elias, L. (1998). Protein kinase C-theta
phosphorylation of moesin in the actin-binding sequence. The Journal of biological chemistry
273, 7594-7603.
Pillai, P., Desai, S., Patel, R., Sajan, M., Farese, R., Ostrov, D., and Acevedo-Duncan, M.
(2011). A novel PKC-iota inhibitor abrogates cell proliferation and induces apoptosis in
neuroblastoma. The international journal of biochemistry & cell biology 43, 784-794.
Qu, C.K., Shi, Z.Q., Shen, R., Tsai, F.Y., Orkin, S.H., and Feng, G.S. (1997). A deletion
mutation in the SH2-N domain of Shp-2 severely suppresses hematopoietic cell development.
Molecular and cellular biology 17, 5499-5507.
Qu, X., Zou, Z., Sun, Q., Luby-Phelps, K., Cheng, P., Hogan, R.N., Gilpin, C., and Levine, B.
(2007). Autophagy gene-dependent clearance of apoptotic cells during embryonic development.
Cell 128, 931-946.
Rajendran, G., Dutta, D., Hong, J., Paul, A., Saha, B., Mahato, B., Ray, S., Home, P., Ganguly,
A., Weiss, M.L., et al. (2013). Inhibition of protein kinase C signaling maintains rat embryonic
stem cell pluripotency. The Journal of biological chemistry 288, 24351-24362.
Redmer, T., Diecke, S., Grigoryan, T., Quiroga-Negreira, A., Birchmeier, W., and Besser, D.
(2011). E-cadherin is crucial for embryonic stem cell pluripotency and can replace OCT4 during
somatic cell reprogramming. EMBO reports 12, 720-726.
Regala, R.P., Weems, C., Jamieson, L., Khoor, A., Edell, E.S., Lohse, C.M., and Fields, A.P.
(2005). Atypical protein kinase C iota is an oncogene in human non-small cell lung cancer.
Cancer research 65, 8905-8911.
Rhyu, M.S., Jan, L.Y., and Jan, Y.N. (1994). Asymmetric distribution of numb protein during
division of the sensory organ precursor cell confers distinct fates to daughter cells. Cell 76, 477-
491.
156
Rodda, D.J., Chew, J.L., Lim, L.H., Loh, Y.H., Wang, B., Ng, H.H., and Robson, P. (2005).
Transcriptional regulation of nanog by OCT4 and SOX2. The Journal of biological chemistry 280,
24731-24737.
Rolls, M.M., Albertson, R., Shih, H.P., Lee, C.Y., and Doe, C.Q. (2003). Drosophila aPKC
regulates cell polarity and cell proliferation in neuroblasts and epithelia. The Journal of cell
biology 163, 1089-1098.
Rones, M.S., McLaughlin, K.A., Raffin, M., and Mercola, M. (2000). Serrate and Notch specify
cell fates in the heart field by suppressing cardiomyogenesis. Development 127, 3865-3876.
Roobrouck, V.D., Ulloa-Montoya, F., and Verfaillie, C.M. (2008). Self-renewal and differentiation
capacity of young and aged stem cells. Experimental cell research 314, 1937-1944.
Sansom, S.N., Griffiths, D.S., Faedo, A., Kleinjan, D.J., Ruan, Y., Smith, J., van Heyningen, V.,
Rubenstein, J.L., and Livesey, F.J. (2009). The level of the transcription factor Pax6 is essential
for controlling the balance between neural stem cell self-renewal and neurogenesis. PLoS
genetics 5, e1000511.
Saotome, I., Curto, M., and McClatchey, A.I. (2004). Ezrin is essential for epithelial organization
and villus morphogenesis in the developing intestine. Developmental cell 6, 855-864.
Sato, N., Meijer, L., Skaltsounis, L., Greengard, P., and Brivanlou, A.H. (2004). Maintenance of
pluripotency in human and mouse embryonic stem cells through activation of Wnt signaling by a
pharmacological GSK-3-specific inhibitor. Nature medicine 10, 55-63.
Schechtman, D., and Mochly-Rosen, D. (2001). Adaptor proteins in protein kinase C-mediated
signal transduction. Oncogene 20, 6339-6347.
Seidl, S., Braun, U., Roos, N., Li, S., Ludtke, T.H., Kispert, A., and Leitges, M. (2013).
Phenotypical analysis of atypical PKCs in vivo function display a compensatory system at
mouse embryonic day 7.5. PloS one 8, e62756.
Serrador, J.M., Vicente-Manzanares, M., Calvo, J., Barreiro, O., Montoya, M.C., Schwartz-
Albiez, R., Furthmayr, H., Lozano, F., and Sanchez-Madrid, F. (2002). A novel serine-rich motif
157
in the intercellular adhesion molecule 3 is critical for its ezrin/radixin/moesin-directed subcellular
targeting. The Journal of biological chemistry 277, 10400-10409.
Shen, Q., Zhong, W., Jan, Y.N., and Temple, S. (2002). Asymmetric Numb distribution is critical
for asymmetric cell division of mouse cerebral cortical stem cells and neuroblasts. Development
129, 4843-4853.
Siller, K.H., and Doe, C.Q. (2009). Spindle orientation during asymmetric cell division. Nature
cell biology 11, 365-374.
Smith, A.G. (2001). Embryo-derived stem cells: of mice and men. Annual review of cell and
developmental biology 17, 435-462.
Smith, C.A., Lau, K.M., Rahmani, Z., Dho, S.E., Brothers, G., She, Y.M., Berry, D.M., Bonneil,
E., Thibault, P., Schweisguth, F., et al. (2007). aPKC-mediated phosphorylation regulates
asymmetric membrane localization of the cell fate determinant Numb. The EMBO journal 26,
468-480.
Soloff, R.S., Katayama, C., Lin, M.Y., Feramisco, J.R., and Hedrick, S.M. (2004). Targeted
deletion of protein kinase C lambda reveals a distribution of functions between the two atypical
protein kinase C isoforms. Journal of immunology 173, 3250-3260.
Song, X., Zhu, C.H., Doan, C., and Xie, T. (2002). Germline stem cells anchored by adherens
junctions in the Drosophila ovary niches. Science 296, 1855-1857.
Sotillos, S., Diaz-Meco, M.T., Caminero, E., Moscat, J., and Campuzano, S. (2004). DaPKC-
dependent phosphorylation of Crumbs is required for epithelial cell polarity in Drosophila. The
Journal of cell biology 166, 549-557.
Spana, E.P., and Doe, C.Q. (1996). Numb antagonizes Notch signaling to specify sibling neuron
cell fates. Neuron 17, 21-26.
St Johnston, D., and Ahringer, J. (2010). Cell polarity in eggs and epithelia: parallels and
diversity. Cell 141, 757-774.
158
Stier, S., Cheng, T., Dombkowski, D., Carlesso, N., and Scadden, D.T. (2002). Notch1
activation increases hematopoietic stem cell self-renewal in vivo and favors lymphoid over
myeloid lineage outcome. Blood 99, 2369-2378.
Struhl, G., and Adachi, A. (1998). Nuclear access and action of notch in vivo. Cell 93, 649-660.
Sutherland, D.R., Marsh, J.C., Davidson, J., Baker, M.A., Keating, A., and Mellors, A. (1992).
Differential sensitivity of CD34 epitopes to cleavage by Pasteurella haemolytica glycoprotease:
implications for purification of CD34-positive progenitor cells. Experimental hematology 20, 590-
599.
Suzuki, A., Hirata, M., Kamimura, K., Maniwa, R., Yamanaka, T., Mizuno, K., Kishikawa, M.,
Hirose, H., Amano, Y., Izumi, N., et al. (2004). aPKC acts upstream of PAR-1b in both the
establishment and maintenance of mammalian epithelial polarity. Current biology : CB 14, 1425-
1435.
Suzuki, A., Ishiyama, C., Hashiba, K., Shimizu, M., Ebnet, K., and Ohno, S. (2002). aPKC
kinase activity is required for the asymmetric differentiation of the premature junctional complex
during epithelial cell polarization. Journal of cell science 115, 3565-3573.
Suzuki, A., and Ohno, S. (2006). The PAR-aPKC system: lessons in polarity. Journal of cell
science 119, 979-987.
Suzuki, A., Yamanaka, T., Hirose, T., Manabe, N., Mizuno, K., Shimizu, M., Akimoto, K., Izumi,
Y., Ohnishi, T., and Ohno, S. (2001). Atypical protein kinase C is involved in the evolutionarily
conserved par protein complex and plays a critical role in establishing epithelia-specific
junctional structures. The Journal of cell biology 152, 1183-1196.
Swiatek, P.J., Lindsell, C.E., del Amo, F.F., Weinmaster, G., and Gridley, T. (1994). Notch1 is
essential for postimplantation development in mice. Genes & development 8, 707-719.
Tai, M.H., Chang, C.C., Kiupel, M., Webster, J.D., Olson, L.K., and Trosko, J.E. (2005). Oct4
expression in adult human stem cells: evidence in support of the stem cell theory of
carcinogenesis. Carcinogenesis 26, 495-502.
159
Tajbakhsh, S., Rocheteau, P., and Le Roux, I. (2009). Asymmetric cell divisions and asymmetric
cell fates. Annual review of cell and developmental biology 25, 671-699.
Takahashi, K., and Yamanaka, S. (2006). Induction of pluripotent stem cells from mouse
embryonic and adult fibroblast cultures by defined factors. Cell 126, 663-676.
Talora, C., Campese, A.F., Bellavia, D., Felli, M.P., Vacca, A., Gulino, A., and Screpanti, I.
(2008). Notch signaling and diseases: an evolutionary journey from a simple beginning to
complex outcomes. Biochimica et biophysica acta 1782, 489-497.
Tamm, C., Bower, N., and Anneren, C. (2011). Regulation of mouse embryonic stem cell self-
renewal by a Yes-YAP-TEAD2 signaling pathway downstream of LIF. Journal of cell science
124, 1136-1144.
Tanos, B., and Rodriguez-Boulan, E. (2008). The epithelial polarity program: machineries
involved and their hijacking by cancer. Oncogene 27, 6939-6957.
Tohyama, T., Lee, V.M., Rorke, L.B., Marvin, M., McKay, R.D., and Trojanowski, J.Q. (1992).
Nestin expression in embryonic human neuroepithelium and in human neuroepithelial tumor
cells. Laboratory investigation; a journal of technical methods and pathology 66, 303-313.
Torres, J., and Watt, F.M. (2008). Nanog maintains pluripotency of mouse embryonic stem cells
by inhibiting NFkappaB and cooperating with Stat3. Nature cell biology 10, 194-201.
Trimborn, T., Gribnau, J., Grosveld, F., and Fraser, P. (1999). Mechanisms of developmental
control of transcription in the murine alpha- and beta-globin loci. Genes & development 13, 112-
124.
Uemura, T., Shepherd, S., Ackerman, L., Jan, L.Y., and Jan, Y.N. (1989). numb, a gene
required in determination of cell fate during sensory organ formation in Drosophila embryos. Cell
58, 349-360.
Umehara, H., Kimura, T., Ohtsuka, S., Nakamura, T., Kitajima, K., Ikawa, M., Okabe, M., Niwa,
H., and Nakano, T. (2007). Efficient derivation of embryonic stem cells by inhibition of glycogen
synthase kinase-3. Stem cells 25, 2705-2711.
160
van Es, J.H., van Gijn, M.E., Riccio, O., van den Born, M., Vooijs, M., Begthel, H., Cozijnsen, M.,
Robine, S., Winton, D.J., Radtke, F., et al. (2005). Notch/gamma-secretase inhibition turns
proliferative cells in intestinal crypts and adenomas into goblet cells. Nature 435, 959-963.
Varnum-Finney, B., Xu, L., Brashem-Stein, C., Nourigat, C., Flowers, D., Bakkour, S., Pear,
W.S., and Bernstein, I.D. (2000). Pluripotent, cytokine-dependent, hematopoietic stem cells are
immortalized by constitutive Notch1 signaling. Nature medicine 6, 1278-1281.
Verdi, J.M., Schmandt, R., Bashirullah, A., Jacob, S., Salvino, R., Craig, C.G., Program, A.E.,
Lipshitz, H.D., and McGlade, C.J. (1996). Mammalian NUMB is an evolutionarily conserved
signaling adapter protein that specifies cell fate. Current biology : CB 6, 1134-1145.
Wakamatsu, Y., Maynard, T.M., Jones, S.U., and Weston, J.A. (1999). NUMB localizes in the
basal cortex of mitotic avian neuroepithelial cells and modulates neuronal differentiation by
binding to NOTCH-1. Neuron 23, 71-81.
Wald, F.A., Oriolo, A.S., Mashukova, A., Fregien, N.L., Langshaw, A.H., and Salas, P.J. (2008).
Atypical protein kinase C (iota) activates ezrin in the apical domain of intestinal epithelial cells.
Journal of cell science 121, 644-654.
Wang, H., Ouyang, Y., Somers, W.G., Chia, W., and Lu, B. (2007). Polo inhibits progenitor self-
renewal and regulates Numb asymmetry by phosphorylating Pon. Nature 449, 96-100.
Wang, H., Somers, G.W., Bashirullah, A., Heberlein, U., Yu, F., and Chia, W. (2006). Aurora-A
acts as a tumor suppressor and regulates self-renewal of Drosophila neuroblasts. Genes &
development 20, 3453-3463.
Wang, J., Gallagher, D., DeVito, L.M., Cancino, G.I., Tsui, D., He, L., Keller, G.M., Frankland,
P.W., Kaplan, D.R., and Miller, F.D. (2012). Metformin activates an atypical PKC-CBP pathway
to promote neurogenesis and enhance spatial memory formation. Cell stem cell 11, 23-35.
Wang, J., and Wynshaw-Boris, A. (2004). The canonical Wnt pathway in early mammalian
embryogenesis and stem cell maintenance/differentiation. Current opinion in genetics &
development 14, 533-539.
161
Wang, Z., Sandiford, S., Wu, C., and Li, S.S. (2009). Numb regulates cell-cell adhesion and
polarity in response to tyrosine kinase signalling. The EMBO journal 28, 2360-2373.
Warner, S.J., Yashiro, H., and Longmore, G.D. (2010). The Cdc42/Par6/aPKC polarity complex
regulates apoptosis-induced compensatory proliferation in epithelia. Current biology : CB 20,
677-686.
Watanabe, S., Umehara, H., Murayama, K., Okabe, M., Kimura, T., and Nakano, T. (2006).
Activation of Akt signaling is sufficient to maintain pluripotency in mouse and primate embryonic
stem cells. Oncogene 25, 2697-2707.
Weissman, I.L. (2000). Translating stem and progenitor cell biology to the clinic: barriers and
opportunities. Science 287, 1442-1446.
Weng, A.P., and Aster, J.C. (2004). Multiple niches for Notch in cancer: context is everything.
Current opinion in genetics & development 14, 48-54.
Westfall, M.V., Pasyk, K.A., Yule, D.I., Samuelson, L.C., and Metzger, J.M. (1997).
Ultrastructure and cell-cell coupling of cardiac myocytes differentiating in embryonic stem cell
cultures. Cell motility and the cytoskeleton 36, 43-54.
Wiles, M.V., and Keller, G. (1991). Multiple hematopoietic lineages develop from embryonic
stem (ES) cells in culture. Development 111, 259-267.
Wirtz-Peitz, F., Nishimura, T., and Knoblich, J.A. (2008). Linking cell cycle to asymmetric
division: Aurora-A phosphorylates the Par complex to regulate Numb localization. Cell 135, 161-
173.
Wobus, A.M., Kleppisch, T., Maltsev, V., and Hescheler, J. (1994). Cardiomyocyte-like cells
differentiated in vitro from embryonic carcinoma cells P19 are characterized by functional
expression of adrenoceptors and Ca2+ channels. In vitro cellular & developmental biology
Animal 30A, 425-434.
162
Wodarz, A., Ramrath, A., Grimm, A., and Knust, E. (2000). Drosophila atypical protein kinase C
associates with Bazooka and controls polarity of epithelia and neuroblasts. The Journal of cell
biology 150, 1361-1374.
Wong, D.J., Liu, H., Ridky, T.W., Cassarino, D., Segal, E., and Chang, H.Y. (2008). Module map
of stem cell genes guides creation of epithelial cancer stem cells. Cell stem cell 2, 333-344.
Wu, X., Li, S., Chrostek-Grashoff, A., Czuchra, A., Meyer, H., Yurchenco, P.D., and Brakebusch,
C. (2007). Cdc42 is crucial for the establishment of epithelial polarity during early mammalian
development. Developmental dynamics : an official publication of the American Association of
Anatomists 236, 2767-2778.
Xiao, H., and Liu, M. (2013). Atypical protein kinase C in cell motility. Cellular and molecular life
sciences : CMLS 70, 3057-3066.
Xie, X., Chan, K.S., Cao, F., Huang, M., Li, Z., Lee, A., Weissman, I.L., and Wu, J.C. (2009).
Imaging of STAT3 signaling pathway during mouse embryonic stem cell differentiation. Stem
cells and development 18, 205-214.
Xu, J., Wang, H., Liang, T., Cai, X., Rao, X., Huang, Z., and Sheng, G. (2012). Retinoic acid
promotes neural conversion of mouse embryonic stem cells in adherent monoculture. Molecular
biology reports 39, 789-795.
Yamada, S., Pokutta, S., Drees, F., Weis, W.I., and Nelson, W.J. (2005). Deconstructing the
cadherin-catenin-actin complex. Cell 123, 889-901.
Yamanaka, T., Horikoshi, Y., Izumi, N., Suzuki, A., Mizuno, K., and Ohno, S. (2006). Lgl
mediates apical domain disassembly by suppressing the PAR-3-aPKC-PAR-6 complex to orient
apical membrane polarity. Journal of cell science 119, 2107-2118.
Yan, B. (2010). Numb--from flies to humans. Brain & development 32, 293-298.
Ying, Q.L., Nichols, J., Chambers, I., and Smith, A. (2003). BMP induction of Id proteins
suppresses differentiation and sustains embryonic stem cell self-renewal in collaboration with
STAT3. Cell 115, 281-292.
163
Zhang, L., Huang, J., Yang, N., Liang, S., Barchetti, A., Giannakakis, A., Cadungog, M.G.,
O'Brien-Jenkins, A., Massobrio, M., Roby, K.F., et al. (2006). Integrative genomic analysis of
protein kinase C (PKC) family identifies PKCiota as a biomarker and potential oncogene in
ovarian carcinoma. Cancer research 66, 4627-4635.
Zhong, W., Feder, J.N., Jiang, M.M., Jan, L.Y., and Jan, Y.N. (1996). Asymmetric localization of
a mammalian numb homolog during mouse cortical neurogenesis. Neuron 17, 43-53.
Zhou, Y., Zon, L. (2001). Blood cell: lineage restriction. . In Encyclopeia of life science, pp. 1-7.
Zhu, L., Crothers, J., Jr., Zhou, R., and Forte, J.G. (2010). A possible mechanism for ezrin to
establish epithelial cell polarity. American journal of physiology Cell physiology 299, C431-443.
Zilian, O., Saner, C., Hagedorn, L., Lee, H.Y., Sauberli, E., Suter, U., Sommer, L., and Aguet, M.
(2001). Multiple roles of mouse Numb in tuning developmental cell fates. Current biology : CB
11, 494-501.

Abstract (if available)

Abstract Atypical PKCs (aPKC) (Prkci and Prkcz) are key signaling components that have been demonstrated to control asymmetric cell division and apical‐basal polarity in all animals. aPKCs can be distinguished from other members of the PKC gene family by the presence of only a single copy of the cysteine‐rich, zinc finger‐like motif in the C1 domain. In addition, unlike other PKCs, aPKCs are not activated by DAG or calcium. However, the importance of this molecule has not been studied during mouse development. I have observed that loss of Prkci results in a failure of the early mouse embryo to undergo cavitation, with the formation of multiple luminal structures. In order to better understand the requirement for Prkci in mammalian cells, I have employed an in vitro system, embryoid body (EB) formation that mimics this embryonic phenotype. Using this system I find that loss of Prkci leads to the expansion of pluripotent populations within EBs. These pluripotent cells can be maintained in stem cell culture, can differentiate into germ layers and form secondary EBs, and exhibit a gene expression profile similar to normal ESCs. Absence of Prkci also results in the enhanced generation of specific multipotent populations such as neural stem cells, cardiac, and erythrocyte progenitors. The ability to differentiate is not compromised as these progenitor populations can undergo differentiation when induced. I believe that the reason for the increase in pluripotent and multipotent populations is due to a favoring of symmetric cell division as indicated by symmetric Numb localization and downstream activation of Notch and Hes5 in Prkci null cells. Additional inhibition of other PKC isoforms including Prkcz results in an even higher percentage of cells that expressOct4 and SSEA1and interestingly also Dppa3 (Stella) and Ddx4 (VASA). These studies indicate that the precise control of symmetric vs. asymmetric cell division via atypical PKCs influences the generation of multipotent, pluripotent, and possibly even totipotent populations. These observations suggest that inhibition of Prkci and/or Prkcz may be useful for developing regenerative therapies. ❧ As I expected, cell polarity is impaired Prkci null cells however this defect does not dramatically affect the cell death and proliferation in -/- EBs. Absence of Prkci results in the reduced and mislocalized BMP signaling in -/- EBs, but exogenously added BMP4 cannot recover the phenotype of failed cavitation. Enhanced adhesive characteristic of -/- ESC and mislocalized expression of adhesion molecules associated with adherens junctions (AJs) and tight junctions (TJs) are observed. Overexpression of Ezrin as a direct downstream effector of Prkci signaling induces the recovery of cell polarity and partial cavitiaion when transiently expressed. Finally, highly recovered cavitation occurs when polarity competent ESCs and Prkci-/- ESCs are mixed during EB formation. Together these findings indicate that cell polarity regulated by Prkci is critical for morphogenesis during EB formation.

Linked assets

University of Southern California Dissertations and Theses

Conceptually similar

PDF

Pleotropic potential of Stat3 in determining self-renewal, apoptosis, and differentiation in mouse embryonic stem cells

PDF

Role of STAT3 phosphorylation in mouse embryonic stem cell self-renewal and differentiation

PDF

The function of BS69 in mouse embryogenesis and embryonic stem cell differentiation

PDF

Novel roles for Maf1 in embryonic stem cell differentiation and adipogenesis

PDF

Characterization of new stem/progenitor cells in skin appendages

PDF

Molecular basis of mouse epiblast stem cell and human embryonic stem cell self‐renewal

PDF

The cancer stem-like phenotype: therapeutics, phenotypic plasticity and mechanistic studies

PDF

Exploring the molecular and cellular underpinnings of organ polarization using feather as the model system

PDF

Identification and characterization of adult stem cells in the oral cavity

PDF

The role of HES/HEY transcriptional repressors in specification and maintenance of cell fate in the mouse organ of Corti

PDF

Characterization of human embryonic stem cell derived retinal pigment epithelial cells for age-related macular degeneration

PDF

The role of α-catlulin during tumor progression and early mouse development

PDF

Derivation and characterization of human embryonic stem (hES) cells and human induced pluripotent stem (hiPS) cells in clinical grade conditions

PDF

Role of beta-catenin in mouse epiblast stem cell, embryonic stem cell self-renewal and differentiation

PDF

Study of the role of bone morphogenetic proteins in prostate cancer progression

PDF

Investigating the role of STAT3 in mouse and rat embryonic stem cell self-renewal and differentiation

PDF

Molecular mechanism of transforming growth factor-beta signaling in skin wound healing

PDF

The role of endoplasmic reticulum chaperone protein GRP78 in breast cancer

PDF

Exploring stem cell pluripotency through long range chromosome interactions

PDF

Interaction of epigenetics and SMAD signaling in stem cells and diseases

Asset Metadata

Creator Mah, In Kyoung (author)

Core Title The role of Prkci in stem cell maintenance and cell polarity using a 3-D culture system

School Keck School of Medicine

Degree Doctor of Philosophy

Degree Program Genetic, Molecular and Cellular Biology

Publication Date 04/22/2014

Defense Date 03/24/2014

Publisher University of Southern California (original), University of Southern California. Libraries (digital)

Tag asymmetric cell division,multipotency,Numb,OAI-PMH Harvest,pluripotency,Prkci

Format application/pdf (imt)

Language English

Contributor Electronically uploaded by the author (provenance)

Advisor Mariani, Francesca (committee chair), Chuong, Cheng-Ming (committee member), Kobielak, Agnieszka (committee member), Maxson, Robert E., Jr. (committee member)

Creator Email changewor12@gmail.com,imah@usc.edu

Permanent Link (DOI) https://doi.org/10.25549/usctheses-c3-381613

Unique identifier UC11296619

Identifier etd-MahInKyoun-2383.pdf (filename),usctheses-c3-381613 (legacy record id)

Legacy Identifier etd-MahInKyoun-2383.pdf

Dmrecord 381613

Document Type Dissertation

Format application/pdf (imt)

Rights Mah, In Kyoung

Type texts

Source University of Southern California (contributing entity), University of Southern California Dissertations and Theses (collection)

Access Conditions The author retains rights to his/her dissertation, thesis or other graduate work according to U.S. copyright law. Electronic access is being provided by the USC Libraries in agreement with the a...

Repository Name University of Southern California Digital Library

Repository Location USC Digital Library, University of Southern California, University Park Campus MC 2810, 3434 South Grand Avenue, 2nd Floor, Los Angeles, California 90089-2810, USA