University of Southern California Dissertations and Theses

Structural and biochemical studies of DNA helicase complexes: conformational diversity of archaeal MCM

(USC Thesis Other)

Structural and biochemical studies of DNA helicase complexes: conformational diversity of archaeal MCM

PDF

Download a page range

Download transcript

Copy asset link

Request this asset

Transcript (if available)

Content i
STRUCTURAL AND BIOCHEMICAL STUDIES
OF DNA HELICASE COMPLEXES:
CONFORMATIONAL DIVERSITY OF
ARCHAEAL MCM

by

Ian M. Slaymaker

A Dissertation Presented to the
FACULTY OF THE USC GRADUATE SCHOOL
UNIVERSITY OF SOUTHERN CALIFORNIA
In Partial Fulfillment of the
Requirements for the Degree
DOCTOR OF PHILOSOPHY
(MOLECULAR BIOLOGY)

May 2014

Copyright 2014 Ian M. Slaymaker
ii
EPIGRAPH

“Somewhere, something incredible is waiting to be known.”
-Carl Sagan
iii
DEDICATION

To my family: past, present, and future.

iv
ACKNOWLEDGMENTS

I am incredibly grateful to my advisor Xiaojiang Chen for his support as a mentor and a
friend. Your proverbs are always well timed, and I hope someday to be the kind of scientific
mentor that you have been to me. Thank you for the support and the limitless freedom and
opportunities I have enjoyed in your lab. I am excited to see where science will bring both of us
in the future.
I owe special thanks to Ray Stevens. Without Ray I would never have met Xiaojiang or
been lucky enough to come to USC. Ray took a chance on me in 2008, and I will never take for
granted any of the opportunities I have had as a result.
Thanks to Susan Forsburg for her patience and helpful conversation over the last 5 years.
Thank you for allowing me to walk into your office and start talking about MCM on numerous
occasions.
Thanks also to Remo Rohs for his support and advice over the last few years. I am very
lucky to have gotten to know you scientifically and personally, and I am very excited to see your
labs progression into the future.
Thank you also Steve Bradforth for being on my committee. Thanks also to Lin Chen and
Oscar Aparicio for being on my qual committee.
I am also very lucky to have shared a lab with so many brilliant people; thanks to all
Chen lab members. Aaron Brewster and Yang Fu, thank you for working with me for so long on
the MCM project. It was an incredibly hard and fun endeavor and it wouldn’t have been
successful without you. Thanks also to Nimna Ranatunga for all the hard work on the MCM
project. Thanks to Dan Toso for being a great friend and for all the long hours in the UCLA
basement working on EM.
Thanks to Aaron Wolfe for taking on a new and difficult project with me as soon as your
joined the lab, I am excited to see the finished product. Thanks also to Hanjing Yang for being an
amazing scientist and for helping guide our new projects. Thanks to Lauren Holden for being an
incredible friend, lab mom, critical thinker and fun person. Thank you Ganggang Wang and
Dahai Gai for scientific help and conversation. Thanks to Brett Zirkle for being a good friend
v
and reintroducing coffee to my life so I needing to quit drinking it again. Thanks to Ronda
Bransteitter and Courtney Prochnow for bringing excitement to the lab and for being so much
fun to be around. Thanks to Bo Zhou and Jessica Yu for being great office friends and
colleagues. Thanks to Meng Xu for protein help and being generous with his to help others
research. Thanks to Lyon for being a generous cook. Thanks to Xiao xiao for being a great
colleague and hard worker. Thanks to Damian Wang for keeping the lab running in these dark
times. I am grateful to have worked with all of you.
I am very lucky to have come into the Molecular and Computational Biology department
with an exceptional group of people: Aysen Erdem, Zac Ostrow, Dan McCoy, Jared Peace, Tara
Mastro and Nimna Ranatunga. Thanks to Aysen for introducing me to Turkish food and
exploring Los Angeles with me. Thanks to Zac for being a good friend and making my time in
Los Angeles more fun. Thanks to Dan for getting me into disc golf. Thanks to Jared for making
me laugh with all the jokes. Thanks to Reza Kalhor for late night conversation (and burritos),
never ending excitement and great friendship. There are going to be some good stories for the
future. Thanks to Michael Philips for always being a good friend and keeping me on my toes. I
am proud to have known all of you and look forward to lots more ideas and adventures as we
move around the globe.
Finally, I owe great thanks to my family. My mother and father have been incredibly
supportive throughout my entire life and I would never have had the freedom to pursue what I
enjoy were it not for their support. My brothers Sev and Tristan have always given me
perspective and support and I am lucky to have them in my life. My extended family;
grandparents, cousins, uncles and aunts have also always been there for me and if I were to
continue on about all the kindness I have received from my family and friend, I would likely
never come to an end. Thank you all.
vi
TABLE OF CONTENTS
Epigraph ii
Dedication iii
Acknowledgments iv
List of Tables viii
List of Figures ix
Chapter 1: Introduction to DNA replication 1
Chapter 2: An Introduction to MCM Structure 13
2.1 MCM: The Replicative DNA Helicase 13
2.2 Complex organization
1.1.1 Hexamers and double hexamers 16
1.1.2 Higher Order MCM Oligomers 19
2.3 Helicase activity: Models and Mechanisms 21
1.2.1 Steric exclusion 24
1.2.2 Ploughshare 25
1.2.3 Pump model 26
1.2.4 Rotary pump 27
2.4 Domains and features of MCM subunits 29
1.3.1 N-Domain 29
1.3.2 C-Domain 33
1.3.3 Wing helix domain 41
2.5 Inter- and intra-subunit communication 41

Chapter 3: Mutational Analysis of MCM Helicase Activity 45
3.1 Introduction 45
3.2 Results
3.2.1 Mutational Analysis of the EXT 48
3.2.2 Oligomerization 51
3.2.3 ATPase Activity 51
3.2.4 DNA-binding Activity 53
3.2.5 Helicase Activity 55
3.3 Discussion 58
3.4 Experimental Procedures 62

vii

Chapter 4: Mini-chromosome maintenance complexes form a
filament to remodel DNA structure and topology. 64
4.1 Introduction 64
4.2 Results 67
4.2.1 MCM Helical Filament Crystal Structure 67
4.2.2 dsDNA Binding 74
4.2.3 DNA Supercoiling 76
4.2.4 Helix-5 78
4.2.5 N-terminal Hairpin Conformation Supports
Filament Electrostatic Surface 84
4.2.6 Filament Lengths Depends On Type Of Filaments
Formed On dsDNA 85
4.2.7 In vivo α5-deletion of MCM4 in S. pombe 86
4.2.8 Additional Experiments 90
4.3 Discussion 92
4.4 Experimental Procedures 95
Chapter 5: High resolution crystal structure of an MCM N-terminal domain 107
5.1 Introduction 107
5.2 Results 109
5.2.1 Overall structure 109
5.2.2 Subunit structure 110
5.2.3 Subunit interactions 114
5.2.4 Positively charged surface for DNA binding 114
5.2.5 Structural comparison 116
5.2.6 N-terminal hairpins 116
5.2.7 Full-length tapMCM model 117
5.3 Discussion 119
5.4 Experimental Procedures 123

Bibliography 126
viii
LIST OF TABLES

Table 3.1: Kinetic Parameters of EXT-hp Mutants 57

Table 3.2: Summary of Biochemical Assays of EXT-hp Mutants 59

Table 4.1: A survey of the filament lengths of WT MCM and α5-linker mutant
assembled on 1,000 bp dsDNA 87

Table 4.2: Crystallization Statistics for Right Handed Helical Filament of
MCM 99
Table 4.3: Complementation data at permissive temperature 32
0
C in S. pombe.

Table 5.1: Crystallization statistics for tapMCM 126

ix
LIST OF FIGURES

Figure 1.1: Cartoon of origin licensing by pre-RC 3

Figure 1.2 The Mcm2/5 gate 5

Figure 1.3 Helicase activation and origin firing 7

Figure 1.4 CMG Complex 8

Figure 2.1: MCM Double Hexamers Observed in Structural Studies 17

Figure 2.2: The Central Channel of MCM 22

Figure 2.3: Illustration of MCM Unwinding Models 28

Figure 2.4: N-domain Features of ssoMCM 30

Figure 2.5: ATP Pocket With ATP Modeled and Key Residues 35

Figure 2.6: Detailed Structure of the C-domain of ssoMCM 37

Figure 2.7: Important Hairpins and Inserts of ssoMCM 39

Figure 3.1: Overview of EXT-hp Mutations 49

Figure 3.2: The Results of FPLC and ATPase Analysis of EXT-hp Mutants 52

Figure 3.3: Results of DNA Binding Assays With EXT-hp Mutants 54

Figure 3.4: Results of Helicase Assays With EXT-hp Mutants 56

Figure 4.1: Overall features of the MCM filament structure 68

Figure 4.2: Comparison of filament formation and supercoiling of circular
plasmid DNA by WT MCM and the α5-linker mutant 69

Figure 4.3: Models illustrating how dsDNA (red) binds inside the wide and
narrow filaments 70

Figure 4.4: Electron tomography and TEM imaging of MCM-dsDNA filament 71

Figure 4.5: The N-terminal domain structural alignment, and the DNA topology
change induced by MCM 73

x
Figure 4.6: The strong electro-positive “strip” along the helical filament inner
surface for DNA binding 75

Figure 4.7: Comparison of DNA conformational changes induced by WT and
mutant MCM induced 77

Figure 4.8: The structure of two neighboring ssoMCM subunits in the filament
colored by conserved interface 80

Figure 4.9: The helix α5 rotation and its interaction with the α-domain of a
neighboring subunit in the filament 81

Figure 4.10: Helicase activity of ssoMCM-F540A mutant at the interface
between α5 and α-domain 83

Figure 4.11: Phenotypes of mutants (mcm4-Y751A) and wild type mcm4
(mcm4
+
) plasmids transformed in the mcm4 temperature sensitive
and in wild type strains 89

Figure 4.12: ATP pocket and interface features of MCM filament 90

Figure 4.13: Thermal stability of DNA bound by MCM. BSA was used as a
control. 91

Figure 4.14: Micrograph of ssoMCM mixed with nuclotide. 93

Figure 4.15: Examples of electron density and statistics from the validation
program Polygon 100

Figure 4.16: Gel filtration chromatography assay of MCM mutants 104

Figure 5.1: The overall structure of N-tapMCM 112

Figure 5.2: The detailed structure of N-tapMCM subunit 113

Figure 5.3: Structure of two subunits of N-tapMCM from the filament
conformation 114

Figure 5.4: Electrostatics on the surface of N-tapMCM and the DNA binding
model 116

Figure 5.5: Comparison between known MCM structures 119

Figure 5.6: A model for origin remodeling by tapMCM complex 120

1
CHAPTER 1
Introduction
Abstract
Since their discovery nearly 30 years ago, MCM proteins have become known as
the primary replicative helicase in eukaryotes and archaea; unwinding genomic double
stranded DNA (dsDNA). Mcm2-7 proteins are members of the AAA+ family of proteins
that harness energy from ATP hydrolysis for diverse cellular processes (Iyer, Leipe et al.
2004). MCM proteins Mcm2, Mcm3, Mcm4, Mcm5, Mcm6 and Mcm7 (Mcm2-7) form a
toroid complex that encircles DNA as it travels with a replication fork; initiating from
origins and unwinding dsDNA into single stranded DNA (ssDNA) template in an ATP
dependent reaction. Polymerases then copy the ssDNA back into dsDNA, each new copy
segregates to opposing poles of the cell and cytokinesis occurs to generate two
genetically identical cells.
MCM proteins are of great interest to the medical community because
dysregulation of Mcm2-7 complexes lead to genome instability (Bailis and Forsburg
2004; Shima, Alcaraz et al. 2007; Kunnev, Rusiniak et al. 2010). Furthermore, because
quiescent cells are out of cell cycle, MCMs are excellent markers for cancer (Bailis and
Forsburg 2004; Forsburg 2004; Erkan, Strobel et al. 2013).
The following chapters describe experiments using archaeal MCM homologs
which expand on current knowledge of DNA unwinding, helicase loading, and chromatin
binding.

2
Eukaryotic Replication Origin Licensing

Minichromosome maintenance (MCM) proteins were discovered in the early
1980s as a class of enzymes responsible for maintaining the integrity of circular plasmids
(then termed “minichromosomes”) bearing single autonomously replicating sequences
(ARS) in yeast (Maine, Sinha et al. 1984). It is now clear the loss of integrity was caused
by defects in essential replication machinery. Eukaryotic DNA replication requires
sequential formation of priming complexes at origins (known as licensing), progression
through cellular checkpoints employed to limit replication to once per cell cycle, and
activation of the full complement of proteins that generate a replication fork.
ARS sequences in eukaryotes contain origins of replication which flag a region of
DNA for replication fork assembly and subsequent genomic replication initiation
(Mechali 2010). Origin recognition complexes (ORC), a complex of 6 proteins (ORC1-
6), act as a scaffold for the assembly of the pre-replicative complex (pre-RC) at origins; a
process which loads inactive Mcm2-7 helicases onto origin DNA (Remus and Diffley
2009). Studies have shown that prior to Mcm2-7 loading, ORC binds wraps and bends
origin DNA which may indicate a topological distortion of DNA is necessary for helicase
loading (Sun, Kawakami et al. 2012; Sun, Evrin et al. 2013). The pre-RC is a complex of
14 proteins: ORC1-6, Mcm2-7, Cdc6 and Cdt1 (Diffley 2004). A stable complex of all 14
pre-RC components has been observed and is referred to as OCCM, which is to be
distinguished from the pre-RC by an unloaded helicase (ORC-Cdc6-Cdt1-MCM)(Sun,
Evrin et al. 2013). Unloaded helicases are removed from DNA by a high salt wash while
Mcm2-7 complexes that have been loaded remain bound(Edwards, Tutter et al. 2002).
3

Figure 1.1 Cartoon of origin licensing by pre-RC

Cdc6 and multiple molecules of Cdt1 act cooperatively with ORC (specifically
ORC6) in an ATP dependent mechanism to load Mcm2-7 complexes onto dsDNA as a
head to head double hexamer (Remus, Beuron et al. 2009; Takara and Bell 2011;
Fernandez-Cid, Riera et al. 2013; Frigola, Remus et al. 2013). Mcm2-7 recruitment
4
occurs via the C-terminal domain of MCM3 which stimulates ATPase activity of ORC
and Cdc6 (Frigola, Remus et al. 2013).
Once pre-RC components have been assembled and the helicase is loaded, two
kinases Dbf4 Dependent Kinase (DDK) and S-phase-specific Cyclin-dependent Kinase
(S-CDK) are engaged to activate the helicase. DDK phosphorylates Mcm4 or Mcm6
stimulating a domain shift which permits recruitment of additional replication proteins
Cdc45 and GINS (a heterotetramer of Psf1-3 and Sld5) to each Mcm2-7 hexamer
(Fletcher and Chen 2006; Randell, Fan et al. 2010; Sheu and Stillman 2010). This hetero-
complex, known as CMG (for Cdc45-MCM-GINS) or the pre-initiation complex (pre-
IC), constitutes the replicative unwinding complex and harbors active Mcm2-7. Prior to
S-CDK, unphosphorylated Sld3 also stimulates Cdc45 binding to pre-RC proteins
(Aparicio, Stout et al. 1999). In yeast, S-CDK leads to the phosphorylation of Sld2 and
Sld3, scaffold proteins, promoting Cdc45 and GINS complex formation with Mcm2-7
(Tanaka, Umemori et al. 2007). Phosphorylated Sld2 associates with Dpb11, GINS and
DNA polymerase ε in a complex sometimes referred to as a pre-loading complex (pre-
LC)(Kamimura, Tak et al. 2001; Masumoto, Muramatsu et al. 2002; Kanemaki and Labib
2006; Muramatsu, Hirai et al. 2010). The exact mechanism of Sld2 and Sld3 vary slightly
between organisms, but are essentially similar (Labib 2010). Additional proteins Sld7
(which associates with Cdc45 and may be important for origin timing) and Mcm10
(which may be required for proper placement of polymerase δ on the lagging strand) are
also essential for CMG assembly and formation of the pre-IC (Kunkel and Burgers 2008;
Heller, Kang et al. 2011; Tanaka, Nakato et al. 2011).
5
Importantly, S-CDK inhibits pre-RC formation by preventing interaction between
ORC and Cdt1 once S-phase has begun (Chen, de Vries et al. 2007; Chen and Bell 2011).
This inhibits the assembly of competent origins once the CMG has been activated, thus
preventing re-replication (Diffley 2004). Expression of anaphase-promoting
complex/cyclosome (APC), an E3 ubiquitin ligase, is negatively correlated with S-CDK
expression and promotes pre-RC formation by targeting S-CDK for degradation (Peters
2006). Additional mechanisms tightly regulate formation of the replisome by controlling
ATP hydrolysis. It was recently discovered that ATP hydrolysis by Cdc6 stimulates
Mcm2-7 loading; however, if all factors are not present or activated ATP hydrolysis
causes the complex to dissociate from the pre-RC (Speck, Chen et al. 2005; Frigola,
Remus et al. 2013).

Figure 1.2 The Mcm2/5 gate

6

It is not well understood yet how Mcm2-7 encircles DNA as the complex is
loaded to the pre-RC, transitions to the pre-IC and finally is activated as the replication
fork helicase. However, a break in the planer ring of Mcm2-7 between MCM2 and
MCM5 that is regulated by ATP, Cdc45 and GINS, known as the MCM2/5 gate, likely
plays an important role (Bochman, Bell et al. 2008; Bochman and Schwacha 2010; Costa,
Ilves et al. 2011; Lyubimov, Costa et al. 2012). Electron micrographs of CMG
complexes demonstrate that Cdc45 and GINS bind Mcm2-7 at the MCM2/5 interface,
effectively sealing the gate and locking Mcm2-7 onto the DNA (Costa, Ilves et al. 2011).
In the absence of ATP, Cdc45 and GINS, Mcm2-7 was observed mostly as open rings.
This is important as there is evidence indicating that Mcm2-7 must be in the closed
planar conformation to be able to unwind DNA (Vijayraghavan and Schwacha 2012).
This provides a nice model for Mcm2-7 activation in response to S-CDK dependent
CMG assembly, where sealing Mcm2-7 onto DNA also activates the helicase. The CMG
complex is thought to be the processive core of the eukaryotic replisome (Pacek, Tutter et
al. 2006; Ilves, Petojevic et al. 2010; Vijayraghavan and Schwacha 2012).

7

Figure 1.3 Helicase activation and origin firing

8
Once Mcm2-7 is loaded into the pre-RC, dsDNA must be melted into ssDNA to
create a replication bubble. This process is still not understood but almost certainly
involves coordination between MCM subunits, ATP hydrolysis, and CMG formation.
The MCM2/5 gate may play a role in origin firing by allowing a single strand of DNA to
escape the central channel prior to fork progression (further discussed in Chapter 2).
Curiously, in vitro assembled pre-RCs load a Mcm2-7 double hexamer onto dsDNA with
no detectable single strandedness (Remus, Beuron et al. 2009). It is not yet clear whether
double hexamers formed in vitro can be activated as origin melting in vitro has so far
been unattainable. These results and limitations suggest that Mcm2-7 is loaded to the pre-
RC as a head to head double hexamer on undistorted dsDNA, and that origin melting
occurs at a later stage.

Figure 1.4 CMG Complex

9
It is unclear how Mcm2-7 functions as a molecular machine once activated. Structural
and sequence similarities between AAA+ proteins provide some precedent for several
plausible models which will be discussed in Chapter 2 but there is still no consensus
(Iyer, Leipe et al. 2004; Martin, Baker et al. 2005; Erzberger and Berger 2006; Mogni,
Costa et al. 2009).
Chapter 3 attempts to approach the question of helicase mechanism using
biochemistry and mutagenesis to elucidate the involvement of a hairpin (EXT-hp) which
is important for helicase activity. How DNA is threaded through the CMG complex and
how ATP hydrolysis unwinds duplex DNA are still major questions in the field. What is
known comes largely from studies using archaeal MCM orthologs which are discussed
below and in Chapter 2. While no experiments have demonstrated in vitro origin melting
the recent development of semi-in vitro pre-RC assembly makes it likely that
breakthroughs are in the near future (Remus, Beuron et al. 2009).
Recent experiments using single molecule techniques have shown convincingly
that X. laevis Mcm2-7 most likely travels along a single strand of DNA (one CMG per
strand) while unwinding DNA (Yardimci, Loveland et al. 2010; Fu, Yardimci et al. 2011;
Yardimci, Wang et al. 2012). This is strong evidence supporting a strand exclusion model
of DNA unwinding which is discussed further in Chapter 2. Because no ssDNA is
detected after double hexamer formation in vitro, this would require a complicated
reorganization of replication factors to open the MCM hexamers, melt dsDNA, separate a
single strand into each hexamer and then reform the closed Mcm2-7 complex. Several
theories of how this process may occur have been reviewed in (Boos, Frigola et al. 2012).

10
Multiple MCMs load to chromatin

MCM complexes are loaded to DNA reiteratively, recruiting many more
complexes to DNA than just two hexamers (Edwards, Tutter et al. 2002; Bowers, Randell
et al. 2004; Takahashi, Wigley et al. 2005; Randell, Bowers et al. 2006; Kuipers,
Stasevich et al. 2011; Aparicio, Megias et al. 2012). It has been shown repeatedly that an
excess of MCM complexes relative to number of origins are loaded to chromatin.
Experiments in which the number of MCM complexes is depleted show little change in
replication efficiency but cause genome instability (Liang, Hodson et al. 1999; Fitch,
Donato et al. 2003). There is mounting evidence that dormant origins that are licensed by
excess Mcm2-7 are required for human cells to survive replicative stress, however this
does not explain the genome instability cause by depletion (Ge, Jackson et al. 2007;
Ibarra, Schwob et al. 2008; Ge and Blow 2010). This also may not account for the
multiple MCM complexes loaded per origin. Interestingly, there is evidence that MCMs
are involved in chromosome superstructure prior to replication, suggesting a complex
relationship with the genome (Pflumm and Botchan 2001; Christensen and Tye 2003).
There are many studies demonstrating that MCM proteins are involved in cellular
processes beyond DNA replication and it may be short sighted to dismiss those beyond
the replication fork (reviewed in (Forsburg 2004)). In fact, though much focus is given to
Mcm2-7, at least 5 other arrangements of MCM proteins have been observed (Lei,
Kawasaki et al. 1996; Ishimi 1997; Lee and Hurwitz 2000; Prokhorova and Blow 2000;
Yabuta, Kajimura et al. 2003; Kanter, Bruck et al. 2008). Experiments have also shown
that Mcm2-7 complexes are essential for RNA polymerase II mediated transcription
11
(Snyder, Huang et al. 2009) In Chapter 4 I describe a crystal structure of an MCM
complex on dsDNA which alters DNA toplogy and may have functional implications for
chromatin and pre-replication dynamics.

Archaeal Replication

Archaeal replication machinery exhibit aspects of both eukaryotic and bacterial
systems, often activating multiple origins with orthologs of eukaryotic initiators
(Myllykallio, Lopez et al. 2000; Grabowski and Kelman 2003; Robinson, Dionne et al.
2004). Importantly, the replicative helicase in archaea is orthologous in sequence,
structure and function to Mcm2-7 proteins. This is reviewed in-depth in Chapter 2.
Archaeal systems provide a convenient system through which to study replicative
processes and apply what is learned to eukaryotic systems. This is particularly powerful
in crystallographic studies. While it remains to be determined what key differences lay
between eukaryotic and archaeal MCMs, clear similarities in structure and function make
these studies essential in progressing our understanding of MCM complexes. An
important distinction is that many archaea have only a single MCM gene. This is true for
the species of focus in the remaining chapters; Sulfolobus solfataricus. The mcm gene
product of S. solfataricus (ssoMCM) unwinds forked DNA (which mimics a replication
fork) in vitro, does so ATPase dependently and assembles homo hexamers and possibly
double hexamers similarly to its eukaryotic counterpart (McGeoch, Trakselis et al. 2005;
Barry, McGeoch et al. 2007; Moreau, McGeoch et al. 2007; Pucci, De Felice et al. 2007;
Brewster, Wang et al. 2008; Liu, Pucci et al. 2008; Barry, Lovett et al. 2009; Brewster
12
and Chen 2010; Brewster, Slaymaker et al. 2010). In the following chapters I use
ssoMCM as a model to understand how archaeal MCM complexes unwind and interact
with DNA and apply the data to eukaryotic models.

13
CHAPTER 2
AN INTRODUCTION TO MCM STRUCTURE
Reproduced with permission from Ian Slaymaker and Xiaojiang Chen. (2012). MCM
Structure and Mechanics: What We Have Learned from Archaeal MCM. (Subcellular
Biochemistry)

2.1 MCM: The Replicative DNA Helicase

Minichromosome maintenance (MCM) complexes have been identified as the
primary replicative helicase responsible for unwinding the genomic DNA for genome
replication. The focus of this chapter is to discuss the current structural and functional
understanding of MCMs and their role at origins of replication, which are based mostly
on the studies of the MCM protein and its complex from archaea.
Eukaryotes and archaea employ a tightly regulated series of stepwise events to
ensure a complete, high fidelity genome duplication event that occurs once, and only
once, per cell cycle. Origins of replication spaced along the chromosome are engaged by
pre-replication complexes (pre-RCs), which initiate DNA melting at the inception of S-
phase. Two resulting replication forks originated from an origin travel in opposite
directions, unwinding and copying DNA as they go.
Prior to S-phase initiation pre-RCs are assembled at discrete positions along
chromosomes and define and regulate origins of replication. The pre-RC is an ensemble
complex consisting of the origin recognition complex (ORC), Cdc6, Cdt1 and the MCM
helicase. MCM association with chromatin depends on the presence of all three of these
14
factors at the origin (Romanowski, Madine et al. 1996; Donovan, Harwood et al. 1997;
Tanaka, Knapp et al. 1997; Maiorano, Moreau et al. 2000). Most components of the pre-
RC are located specifically at potential origins and act locally to initiate firing. MCM
complexes are unique in this respect, and are found broadly distributed along chromatin
(Liang, Hodson et al. 1999; Pasion and Forsburg 2001; Edwards, Tutter et al. 2002; Bailis
and Forsburg 2003; Bailis and Forsburg 2004; Forsburg 2004; Tabancay and Forsburg
2006; Kuipers, Stasevich et al. 2011). The presence of the pre-RC licenses the origin to
fire and once established, MCM is incorporated into an intermediate pre-initiation
complex (pre-IC) which includes additional factors Cdc45 and GINS (Zou, Mitchell et al.
1997). Kinases CDK and DDK activate the Cdc45-MCM-GINS (CMG) complex,
thought to be the core of the unwinding complex (Aparicio, Ibarra et al. 2006; Aparicio,
Guillou et al. 2009; Ilves, Petojevic et al. 2010; Costa, Ilves et al. 2011).
MCM proteins are AAA+ (ATPases associated with diverse cellular activities)
super family members that are known primarily as protein motors such as helicases.
MCMs unwind genomic double stranded DNA (dsDNA) to expose single stranded
template during S-phase (Pasion and Forsburg 2001; Bailis and Forsburg 2004; Forsburg
2004; Tabancay and Forsburg 2006). Their function is not limited to unwinding DNA,
however. MCM has also been implicated in origin melting, genome repair and
transcriptional regulation. Like all AAA+ enzymes, MCM complexes hydrolize ATP to
fuel their substrate catalysis. Energy is transferred from the AAA+ helicase motor to the
central channel to remodel the bound DNA substrate, splitting the DNA duplex ahead of
the progressing replication fork (Labib, Tercero et al. 2000). Cycles of ATP binding and
15
hydrolysis drive MCM to translocate and unwind long stretches of DNA for the
duplication of the entire genome.
Eukaryotic and archaeal MCM proteins likely evolved from a common ancestor
with AAA+ core components very similar to modern eukaryotic replication machinery.
From this common ancestor, eukaryotes typically evolved 6 MCM genes from which
products form the hetero-oligomeric Mcm2-7 complex, though some have more or
specialized forms. Many archaea however evolved only a single MCM gene that
produces a homo-oligomer with the same basic function as its hetero-hexameric
counterpart. It should be noted that the recently characterized archaeal order
Methanococcales has as many at 8 MCM genes (Walters and Chong 2010). GINS, Cdc6,
PCNA and ORC homologs are also found in several archaeal genomes, indicating an
overall conserved system in both orders of life. For this reason, archaea are used as a
model system to study replication.
Two archaeal MCM proteins, one from the thermophilic archaeon Sulfolobus
solfataricus (ssoMCM) and another from Methanobacterium thermoautotrophicum
(mtMCM), represent the best studied to date. MCM crystal structures from these two
archaea provide the vast majority of structural information available. In the last decade,
three MCM crystal structures have been solved. In order of publication these are: 1) an N
terminal fragment of mtMCM (N-mtMCM) (Fletcher, Bishop et al. 2003), 2) a similar N
terminal fragment of ssoMCM (N-ssoMCM) (Liu, Pucci et al. 2008) , and 3) a 4.3Å near
full length ssoMCM (FL-ssoMCM)(Brewster, Wang et al. 2008). Additionally, an
inactive MCM homolog from the archaeon Methanopyrus kandleri (mkaMCM2) was
solved. FL-ssoMCM and the mkaMCM2 in the inactive deleted form crystallized as
16
monomers, providing valuable new information about subunit domain organization.
Electron micrograph (EM) reconstructions provide low resolution maps of full length
MCM hexamer and double hexamer form (Adachi, Usukura et al. 1997; Gomez-Llorente,
Fletcher et al. 2005; Costa, Pape et al. 2006; Costa, Pape et al. 2006; Costa, van Duinen
et al. 2008; Costa, Ilves et al. 2011). With all of this information taken together, an
understanding of how MCM functions at the core of the replisome begins to emerge.
2.2 Complex Organization
MCM complexes in eukaryotes and archaea assemble into a variety of oligomeric
arrangements including hexamers, heptamers and some larger oligomers. This is not a
surprising observation, as AAA+ proteins commonly form hexameric and heptameric
rings (Erzberger and Berger 2006). Hexameric rings are the most thoroughly
characterized of these and represent the helicase active oligomer. These hexamers
commonly associate in a head to head double hexamer configuration.
2.2.1 Hexamers and double hexamers
MCMs (archaeal and eukaryotic) elute from size exclusion columns at a
molecular weight congruent with hexamers and double hexamers (Chong, Hayashi et al.
2000; Yu, VanLoock et al. 2002; Fletcher, Bishop et al. 2003; Forsburg 2004; Fletcher,
Shen et al. 2005; Gomez-Llorente, Fletcher et al. 2005; McGeoch, Trakselis et al. 2005;
Brewster, Wang et al. 2008; Remus, Beuron et al. 2009; Brewster and Chen 2010;
Brewster, Slaymaker et al. 2010; Gambus, Khoudoli et al. 2011). Closed circular rings of
MCM are clearly visualized by electron micrographs, exhibiting primarily hexameric and
double hexameric rings (Fig. 2.1). It should be noted that heptamers and double
17
heptamers are also found in abundance (Gomez-Llorente, Fletcher et al. 2005; Costa,
Pape et al. 2006; Costa, van Duinen et al. 2008). Hexameric architecture is also
illustrated by both N-mt MCM and N- ssoMCM structure, both which crystallized as
closed planar rings (Fig. 2.1B). However, N-mtMCM crystallized as a head to head
double hexamer, which ssoMCM did not. The double hexamer architecture was recently
shown to be a conserved eukaryotic Mcm2-7 architecture (Evrin, Clarke et al. 2009;
Remus, Beuron et al. 2009; Gambus, Khoudoli et al. 2011).

Figure 2.1 MCM double hexamers observed in structural studies. A) MtMCM double
hexamer electron micrograph reconstruction adapted from(Gomez-Llorente, Fletcher et al.
2005). B) Double hexamer crystal structure of N-mtMCM adapted from(Fletcher, Bishop et
al. 2003). C) ssoMCM full length monomer structure docked into an EM map with side-
channels labled, adapted from (Brewster, Wang et al. 2008).
18
The MCM double hexamer parallels that of SV40 large T antigen (LTag), another
AAA+ hexameric helicase for viral replication in eukaryotic system (Sclafani, Fletcher et
al. 2004). Like MCM, LTag forms both hexamers and head to head double hexamers in
solution and on dsDNA (Valle, Chen et al. 2006; Cuesta, Nunez-Ramirez et al. 2010).
Double hexamer clearly play an essential role for LTag, since in vivo DNA replication is
not permitted when hexamer-hexamer interactions are disrupted. LTag hexamers do
retain helicase activity in vitro however, albeit at a 15 fold lower rate. These
obeservations are echoed by MCM. Site directed mutagenesis disrupting double
hexamerization of mtMCM causes between 5 and 13 fold less unwinding activity
(depending on assay conditions) than wild type (Fletcher, Bishop et al. 2003; Sclafani,
Fletcher et al. 2004; Fletcher, Shen et al. 2005).
Further evidence for the double hexamer is found in the organization of origins
within archaea. Three origins of replication identified in Sulfolobus solfataricus have
oppositely facing ORC homologs flanking an AT rich duplex unwinding element (DUE)
suggesting that hexamers are loaded in opposing directions (Robinson, Dionne et al.
2004). Weaker hydrogen bonding patterns makes AT tracks likely sites for origin
melting. The length of the Sulfolobus DUE is ~65 base pairs, approximately the size of an
MCM double hexamer (based on EM and crystal structure modeling), providing an
attractive model in which an MCM double hexamer is loaded directly onto dsDNA at the
origin between two ORC proteins.
Research showing eukaryotic Mcm2-7 is loaded to origins of replication as
double hexamers, provides convincing evidence for the biological significance of this
oliogomer (Evrin, Clarke et al. 2009; Remus, Beuron et al. 2009; Gambus, Khoudoli et
19
al. 2011). Mcm2-7 double hexamers reconstituted on dsDNA from purified yeast pre-RC
components show that loading occurs in a head-to-head configuration similar to that of
mtMCM (Remus, Beuron et al. 2009). However, there was no indication that DNA had
undergone any melting or unwinding in this study. If the in vitro pre-RC assembly
thoroughly recapitulates in vivo MCM loading, this has significant implications for
initiation and unwinding as it implies that origin melting occurs after MCM is loaded, not
before or during the double hexamer loading/assembly at the origin, which is similar to
the results obtained from the melting study for SV40 LTag system. Components involved
in origin firing are not well understood and it is possible that the double hexamer
contributes to origin melting in coordination with other pre-RC proteins, and once melted
or at certain stage of DNA replication (such as during elongation or approaching
termination of replication), single hexamers carry out unwinding. Single molecule
experiments demonstrated that Xenopus sister replisomes can function independently to
replicate long stretches of DNA under the in vitro assay condition (Yardimci, Loveland et
al. 2010), which is consistent with the above hypothesis.
2.2.2 Higher Order MCM Oligomers
Besides the hexamer and double hexamer, larger MCM oligomers have also
observed by EM, including heptamers, open rings, and filaments (Yu, VanLoock et al.
2002; Chen, Yu et al. 2005; Gomez-Llorente, Fletcher et al. 2005; Costa, Pape et al.
2006; Costa, Pape et al. 2006; Costa, van Duinen et al. 2008; Costa and Onesti 2009).
The largest of these oligomers are filaments, which were first observed in mtMCM EM
preparations, and have been recognized in vitro for multiple archaeal species with
varying length and dimensions (Chen, Yu et al. 2005; Costa, van Duinen et al. 2008).
20
MCM filaments appear to depend on dsDNA, as purification that removes DNA also
prevents filament formation (Costa, Pape et al. 2006; Costa, van Duinen et al. 2008). This
may offer suggest to how the cell responds to exposed dsDNA in G1, and the sequence of
events leading up to replication initiation. Chromosome fluorescent imaging shows that
MCM is not focused at origins of replication but is instead liberally distributed along the
entirety of the chromosome (Kuipers, Stasevich et al. 2011). MCM loading is clearly
dependent on ORC, yet are found distal to ORC binding sites in large quantity (far
exceeding a double hexamer) (Edwards, Tutter et al. 2002; Takahashi, Wigley et al.
2005). It is possible that ORC acts as a nucleation point for MCM filament extension.
Recent work has shown that purified drosophila Mcm2-7 fluctuates between a spiral
“lock washer” state and a planar notched state, the second which has been observed in
archaeal MCM (Costa, Ilves et al. 2011). Inclusion of GINS and Cdc45 induce a planar
notched state of Mcm2-7, and addition of ATP closes the gap, sealing Mcm2-7 into the
closed hexamer. From the filament state, inducing a planar conformation may collapse
the filament to a hexamer, effectively loading MCM to origin. This would suggest that
the before mentioned “lock washer” state is an intermediate between the filament and the
loaded hexamer. Alternativly, MCM filaments may function similarly to the bacterial
initiator Dna-A, proposed to wrap dsDNA around its outer surface as a filament, twisting
the DNA in a way that transfers energy to a particular dsDNA region for duplex melting.
Interestingly, mtMCM hexamers were reported to wrap dsDNA around their outer
surface, inducing a 90˚ bend to the DNA (Costa, van Duinen et al. 2008).

21
2.3 Helicase Activity: Models and Mechanisms
A positively charged central channel runs straight from N- to C-terminal of MCM
hexamers. This is seen clearly in MCM crystal structures and is the primary binding site
for DNA (Fig. 2.2A) (Fletcher, Bishop et al. 2003; Brewster, Wang et al. 2008; Liu,
Pucci et al. 2008). The length of the central channel in full length ssoMCM hexamer is
~118 Å, sufficient for ~35 base pairs of straight B-form DNA (Fletcher, Bishop et al.
2003; Brewster, Wang et al. 2008; Liu, Pucci et al. 2008). The central channel diameter is
sufficient to accommodate either ssDNA or dsDNA, which supports a number of
different unwinding models.
In addition to the primary central channel, side channels within the C-domain are
observed perpendicular to the central channel axis (Fig. 2.1C, 2.2C). A side channel is
found between each pair of monomers for a total of 6 side channels per hexamer
(Brewster, Wang et al. 2008). Although the 4.3Å resolution of the MCM monomer
structure precludes precise sidechain placement, likely positively charged side channels
suggest a path through which DNA traverses during helicase activity (Fig. 2.2C).
Additionally, within the double hexamer a second set of N-terminal side channels is
formed by the head to head interface of the double hexamer zinc binding domains (B-
domain). It should be noted, that the exact biological relevance for the obvious side-
channels has yet to be demonstrated.

22

Figure 2.2. The Central Channel of MCM A) Electrostatics of N-mtMCM double
hexamer structure showing positive central channel. Yellow arrows indicate the
narrowest point. Adapted from (Fletcher, Bishop et al. 2003) B) Ltag hexamer
structures narrowing as a result of nucleotide binding. PS1-hp is colored red.
(Brewster and Chen 2010) C) left; Cartoon of an MCM hexamer and involved
structural features in the central channel. Right; black lines indicate possible pathways
for DNA including or excluding side channels. Adapted from (Brewster, Wang et al.
2008)
23
Although MCM will bind nearly any DNA substrate, it can only unwind DNA
with a forked end, or a 3` overhang and cannot unwind DNA with a 5` overhang or blunt
ended dsDNA (Ishimi 1997; You, Komamura et al. 1999; Shin, Jiang et al. 2003;
Bochman and Schwacha 2008). This holds true for all isolated archaeal and eukaryotic
MCM complexes to date. LTag requires identical substrate specifications for in vitro
helicase activity in most cases, with one notable exception. If LTag is supplied with a
specific origin sequence, it is capable of melting and unwinding long stretches (at least
over one thousand bp) blunt-end dsDNA from the middle portion of the dsDNA. Since
origin DNA is presumably double stranded prior to replication initiation, either MCM or
another factor (or combination of factors) must initially melt the duplex. Interestingly, if
the N-domain of ssoMCM is removed, the remaining C-domain is capable of unwinding
blunt-end dsDNA (Barry, McGeoch et al. 2007), even though the blunt-ended dsDNA
tested is only 44bp long, and it is unclear if much longer blunt-ended dsDNA can be
unwound by this deletion mutant. It is possible that removing the N-terminal domain
simulates an activation step or removes an inhibitory component for origin melting in
vivo. However, no conditions have been found which permit WT MCM unwinding of
blunt-end DNA in vitro. There is some in vivo evidence that MCM contributes to origin
melting prior to S-phase. An mcm5 mutant (mcm5 bob-1) that bypasses a kinase
checkpoint appears to melt DNA prior to S-phase (Geraghty, Ding et al. 2000). These
observations raise the question: is MCM loaded onto dsDNA at origins and melted at a
later stage, or does MCM load onto ssDNA that has been melted by other replication
factors such as ORC and Cdc6? The in vitro reconstitution of a eukaryotic MCM double
hexamer with no indication of origin melting (Remus, Beuron et al. 2009) and failure to
24
detect ssDNA in G1 arrested cells (Geraghty, Ding et al. 2000) seems to suggest the
former.
Once origin DNA is melted, MCM assumes the role of helicase to unwind the
replication forks. A number of unwinding models have been proposed to include the
available data on MCM helicase activity (Fig. 2.3), which will be described below:
2.3.1 Steric Exclusion
The steric exclusion model proposes that the MCM helicase binds ssDNA and
translocates away from the replication bubble, sterically excluding the opposite strand
from the duplex. This model suggests that the active helicase acts as a single hexamer
similar to DnaB family helicases found in prokaryotes and phages (Patel and Picha,
2000). Evidence for the steric exclusion model is MCMs inability to unwind dsDNA
without a 3` ssDNA overhang, suggesting that, at least in vitro, MCM threads onto
ssDNA prior to unwinding (Kelman, Brewster, etc).
If MCM is initially loaded at an origin as a double hexamer, this model implies
the enzyme splits into two hexamers once replication initiation occurs, with each
traveling in opposite directions along ssDNA. Further support for this model comes from
FRET data indicating that the 5` tail rapidly binds and unbinds the outer MCM surface
during helicase activity (Rothenberg 2007).
The crystal structure of a related AAA+ papillomavirus E1 hexameric helicase
provides precedent for the steric exclusion model in helicases. In this structure ssDNA is
caught in the process of translocating through the central channel, excluding the opposing
25
strand (Enemark and Joshua-Tor 2006). Central channel β-hairpins form a spiral staircase
which tracks away from the ssDNA/dsDNA junction, pulling the DNA through the
torroidal hexamer with cycles of ATP hydrolysis. This may have implications for MCM
helicase activity, as there are several hairpins in the central channel that may play
analogous roles (Brewster, Wang et al. 2008).
This model does present a problem. The data showing that an Mcm2-7 loads onto
dsDNA double hexamer at origins (Remus, Beuron et al. 2009), not ssDNA as this model
would suggest would require that MCM reorganize once origin DNA is melted,
switching from dsDNA bound, to ssDNA bound. One possibility for this reorganization
involves a Mcm2-7 “gate” between Mcm2 and Mcm5, which may open to allow ssDNA
out of the central channel (Bochman and Schwacha 2010; Costa, Ilves et al. 2011).
Similarly, archaeal MCMs are often observed to form broken rings. Displacement of the
excluded DNA strand may also engage side channels to direct the newly unwound
ssDNA away from MCM.
2.3.2 Ploughshare
The ploughshare model stipulates that a pinpointed force cleaves dsDNA into
ssDNA within the central channel (Takahashi, Wigley et al. 2005). MCM is loaded onto
DNA in an inactive form (likely a double hexamer) by ORC and other replication factors
and upon S-phase initiation, dsDNA is melted to ssDNA and MCM interacts in such a
way that a steric wedge, or ploughshare, is inserted at the ssDNA/dsDNA junction. By
translocating along the genome MCM pulls the ploughshare through the duplex dsDNA,
cleaving it to ssDNA within the central channel(Takahashi, Wigley et al. 2005). The H2I
26
is a likely candidate for the ploughshare, as it occupies the central channel most
dominantly.
N- and C-domains of ssoMCM have different binding affinities for single stranded and
double stranded DNA, supporting this model (Pucci, De Felice et al. 2007; Liu, Pucci et
al. 2008). However, mtMCM N-domain binds both ssDNA and dsDNA making this an
inconsistent argument (Fletcher, Bishop et al. 2003).
2.3.3 Pump model
Electron micrographs of LTag in the process of unwinding blunt-end origin
containing dsDNA exhibit a curious particle shape suggesting that ssDNA is spooling out
and away from the double hexamer as two loops (often referred to as ‘rabbit ears’)
(Wessel, Schweizer et al. 1992). The crystal structure and EM structure of LTag, as well
as that of MCM, also reveal presence large side-channels on the hexameric or double
hexameric wall. A looping model has been proposed for LTag double-hexamer
unwinding, in which dsDNA is pumped inside the double-hexamer, and the separated
ssDNA inside each of the hexameric helicase are extruded as loops coming out from the
side-channels (Li, Zhao et al. 2003; Gai, Zhao et al. 2004; Sclafani, Fletcher et al. 2004;
Gai, Chang et al. 2010). The two growing DNA forks are held close together by the
double-hexamer helicase while the ssDNA continued to extruded from the side-channel
as loops, that can be captured and utilized by the primases and polymerases as template
for daughter strand synthesis. The similarity of the double-hexamer architecture between
LTag and MCM implies that MCM may function similarly by pulling or pumping
dsDNA into the double hexamer which in turn extrudes ssDNA from its center. Side
27
channels in both MCM and LTag, provide avenues through which newly exposed ssDNA
may be spooled away from the helicase in this model.
Given LTag’s predisposition for forming double hexamers, it is possible that
single hexamers unwind DNA and the double hexamers found in ‘rabbit ears’ images are
artifacts of in vitro unwinding. This also presents a problem in archaea for circular
genomes like those found in Sulfolobus because eventually the double hexamer would be
unable to complete unwinding the DNA. Alternative, the double hexamer helicase may
function for origin melting stage, and perhaps even most of elongation stage, and at a
later stage of elongation termination, the double hexamer has to separate into less
efficient single hexamer to wrap up the replication of the entire genome.
Recent compelling in vitro evidence suggests that sister replisomes can split and
travel in opposite directions, rather than pumping dsDNA through a central point of
unwinding (Yardimci, Loveland et al. 2010). Unlike in vivo conditions where replication
machinery is believed to be anchored to the nuclear matrix, the replisome in this
experiment was free in solution but the two dsDNA ends were anchored to prevent DNA
from being pulled. Despite the anchoring, replication proceeded at normal levels,
indicating that sister replisomes and MCM likely split and travel along DNA in this in
vitro experiment.
2.3.4 Rotary Pump
The rotary pump model arose to explain the large abundance of MCM complexes
on chromatin. This model suggests that MCM complexes translocate bidirectionally away
from sites of loading and are anchored within replication factories (Laskey and Madine
28
2003). Once immobilized, multiple MCM complexes pump DNA through the central
channel, rotating the dsDNA and introducing negative twist which weakens the duplex.
The key to this hypothesis is that two populations of MCM face opposite directions and
untwist DNA in opposite directions, transferring the twist back to origins.
This model hinges on the observation that many MCM complexes are distributed
along chromatin and speculate that they cooperatively unwind DNA. When MCM
numbers are drastically reduced to only a single double hexamer per origin, replication
occurs efficiently regardless (Edwards, Tutter et al. 2002). This indicates that only a
subset of Mcm2-7 complexes bound to chromatin is essential for replication and that this
model may not be plausible.

Figure 2.3. Illustration of MCM unwinding models,
adapted from (Takahashi, Wigley et al. 2005)

29
2.4 Domains and Features of an MCM Subunit
Sequence similarities suggest all MCM proteins share a similar domain
organization and can be separated into two major domains: the N-domain which is split
into A, B and C subdomains, and the C-domain which contains the AAA+ core and a
small far C-terminal subdomain predicted to have a “winged helix” fold. N- and C-
domains are connected by a flexible linker designated the N-C linker. Here we will
discuss the important features of each domain, and how they contribute to the overall
function of MCM complexes.
2.4.1 N Domain
MCM N-domain sequences are poorly conserved between eukaryotic and
archaeal MCMs, and even between MCM subunits within an organism. However,
structure based sequence alignments reveal a conservation of hydrophobic residues
within buried regions, and charged residues within the central channel (Fletcher, Bishop
et al. 2003). This suggests that although the primary sequence has mutated, the function
and overall fold of the N domain remains consistent.
The N domain’s function is thought primarily to be regulatory, because when
deleted, MCM (now just the AAA+ motor) is still capable of unwinding DNA (Barry,
McGeoch et al. 2007; Barry, Lovett et al. 2009). However, substrate specificity and
processivity are lost, indicating that the N domain may be acting as a clamp to hold the
AAA+ domain around dsDNA and prevent haphazard duplex unwinding. SsoMCM and
mtMCM N domains (residues 1-268 and 2-286 respectively) have highly conserved
structure and crystallized as hexamers with 6 fold symmetry and a positively charged
30
central channel (Fletcher, Bishop et al. 2003; Liu, Pucci et al. 2008). As previously
discussed, only mtMCM crystallized as a head-to-head double hexamer.

Figure 2.4. N-domain features of ssoMCM (PDB-ID 3F9V)
Subdomain A is primarily composed of helices, forming a compact bundle which
hangs off the outside of the hexamer (Fig. 2.4) (Fletcher, Bishop et al. 2003; Brewster,
Wang et al. 2008). This subdomain is best known for its role in regulating MCM via
kinases (Geraghty, Ding et al. 2000; Fletcher, Bishop et al. 2003; Chen, Yu et al. 2005;
Fletcher and Chen 2006; Hoang, Leon et al. 2007). A Pro (P83) to Leu mutation within
the A subdomain of yeast MCM5 bypasses a checkpoint mediated by Dbf4-dependent
Cdc7 kinase (DDK), proposed to phosphorylate and promote proper assembly of the
MCM complex (Fletcher and Chen 2006; Hoang, Leon et al. 2007). This Pro aligns to a
31
residue in mtMCM which mediates contact between subdomains A and C and promote a
rotation of subdomain A proposed to activate MCM (Fletcher, Bishop et al. 2003; Chen,
Yu et al. 2005; Fletcher and Chen 2006; Hoang, Leon et al. 2007). Mutation of the
corresponding mtMCM Pro (P62) to Leu causes a only slight shift of A subdomain due to
the large Leu sidechain, however, helicase activity is decreased 14 fold confirming an
conserved regulatory role for subdomain A (Fletcher, Bishop et al. 2003; Fletcher and
Chen 2006). This agrees with EM reconstructions suggesting this domain changes
conformation (Chen, Yu et al. 2005; Fletcher and Chen 2006). In vivo, the archaeal data
suggest that phosphorylation by DDK which targets Mcm4 just prior to replication
initiation may induce a swing out of subdomain A in eukaryotic enzymes (Lei and Tye
2001).
Subdomain B is composed of three antiparallel β sheets, which form a compact
domain at the opposite protein end from the AAA+ motor (Fig.2.4). B subdomains of
neighboring hexameric subunits are in close association with each other around the N
terminal end of the hexamer (Fletcher, Bishop et al. 2003; Liu, Pucci et al. 2008).
Comparison between the N-ssoMCM and N-mtMCM hexamers revealed a rigid body
“bowing in” of N-ssoMCM B subdomains, which narrows the central channel compared
to N-mtMCM (Fletcher, Bishop et al. 2003; Liu, Pucci et al. 2008). This may indicate a
flexibility of the B subdomain in helicase activity or promotion of oliogomerization.
The B subdomain coordinates a zinc at its tip using a CX
2
CX
n
CX
2
CX(C
4
) motif that
folds into an zinc binding domain (Fletcher, Bishop et al. 2003). SsoMCM and mtMCM
also engages a histidine to coordinate zinc, and in ssoMCM, this His replaces one of the
Cys (Fletcher, Bishop et al. 2003; Liu, Pucci et al. 2008). Mcm2-7 subunits have similar
32
motifs capable of binding Zn within their N domains, suggesting a conserved function.
Though little information is available for what this function is, the B-domain appears to
be essential for double hexamerization (Fletcher, Bishop et al. 2003). Mutation of His
146 (found at the tip of the B subdomain) to alanine in ssoMCM severely affects DNA
binding and helicase activity indicating an important, if unclear, role for the B subdomain
(Sclafani, Fletcher et al. 2004; Fletcher, Shen et al. 2005; Gomez-Llorente, Fletcher et al.
2005). Clustering the B subdomain in hexamers may suggest that this mutation affects the
enzymes ability to encircle DNA.
Subdomain C is the core of the N domain, and contains 5 antiparallel β sheets that
curl into a β barrel like structure (Fig.2.4) (Fletcher, Bishop et al. 2003; Brewster, Wang
et al. 2008; Liu, Pucci et al. 2008). C subdomains harbor two particularly interesting
features; a positively charged β hairpin which protrudes into the central channel (Nt-hp)
and a loop known as the allosteric communication loop (ACL) (Fletcher, Bishop et al.
2003; Sakakibara, Kasiviswanathan et al. 2008; Barry, Lovett et al. 2009). These features
act in coordination to modulate the C domain through contacts with hairpins within the
AAA+ core (Sakakibara, Kasiviswanathan et al. 2008; Barry, Lovett et al. 2009). N
domain crystal structures (both of mtMCM and ssoMCM) show that all six Nt-hps point
into the central channel, contributing to the highly positive charge, and likely contacting
DNA (Fletcher, Bishop et al. 2003; Brewster, Wang et al. 2008; Liu, Pucci et al. 2008).
It is unlikely that this hairpin is essential for the physical splitting of the DNA duplex, as
full length MCM maintains helicase activity, though diminished, when it is deleted
(Barry, Lovett et al. 2009). These hairpins may track DNA through the central channel,
analogously to those found in E1. Interestingly, the N domain fragment of mtMCM binds
33
dsDNA only slightly less than full length enzyme, however, when the two positively
charged residues at the tip of the β hairpin (Arg226 and Lys228 in mtMCM) are mutated
to alanine all DNA binding is abrogated (Fletcher, Bishop et al. 2003). This indicates that
the primary N-domain feature interacting with DNA is likely the β hairpin within the
central channel. As mentioned previously, the B subdomain has some influence on DNA
binding, but this may be via oligomeric interactions as opposed to DNA interactions. The
C domain is connected to the AAA+ motor to via the N-C linker which extends from the
β barrel to the distal end of the C-domain (Brewster, Wang et al. 2008). There is some
indication that this linker is flexible, and permits AAA+ domain movement important for
helicase activity (Brewster, Wang et al. 2008).
2.4.2 C Domain
The near full length ssoMCM (FL-ssoMCM) and mkaMCM2 crystal structures
revealed a typical organization of AAA+ features; the Walker A/B motif, P-loop and a 5
parallel β sheet core arranged in a canonical 51432 arrangement (Iyer, Leipe et al. 2004;
Brewster, Wang et al. 2008; Bae, Chen et al. 2009). The C domain is often referred to as
the motor domain, as it carries out the chemo-mechanical motion of MCM. Importantly,
the C domain contains the ATP binding pocket.
ATP Pocket
Two adjacent MCM monomers come together at the subunit interface to form a
complete ATPase pocket (Fig. 2.5) (Iyer, Leipe et al. 2004; Erzberger and Berger 2006).
Although neither a nucleotide bound nor a multimer including the AAA+ domain
structure has been solved, a number of conserved residues contribute to the coordination
34
and hydrolysis of ATP. Related AAA+ protein structures serve as templates for
hypotheses regarding the organization of these residues within the MCM ATP pocket in
lieu of high resolution structure (Iyer, Leipe et al. 2004; Erzberger and Berger 2006).
MCMs, like all AAA+ proteins, have a canonical P-loop motif bearing a conserved
Walker A Lys. ATP is docked into the P-loop, and a coordinated assembly of cis and
trans subunits bind and catalyze the hydrolysis reaction. The Walker A Lys coordinates
and binds the γ phosphate of ATP (Iyer, Leipe et al. 2004; Erzberger and Berger 2006).
The nearby Walker B motif coordinates Mg
++
and water around the immobilized ATP
molecule to catalyze hydrolysis of the γ phosphate, cleaving the ATP to ADP and
phosphate. The Walker B glutamate of the hhhhDE (h is a hydrophobic residue) primes
the water molecule for nucleophilic attack of the γ phosphate. The adjacent subunit
projects a residue known as the arginine finger into the ATP pocket to stabilize and
coordinate the associated nucleotide. If the arginine finger is mutated, MCM can no
longer unwind DNA or hydrolize ATP (Moreau, McGeoch et al. 2007). In the LTag ATP
co-crystal structure (1SVM) the arginine finger (R540) is making polar contacts with the
γ phosphate of ATP (Gai, Zhao et al. 2004). Once hydrolysis has occurred it recesses out
of the LTag ATP pocket and away from the ADP (Li, Zhao et al. 2003; Gai, Zhao et al.
2004). Upon ATP binding within a LTag hexamer, a narrowing of the central channel
ensues (to 14Å) which then relaxes (to 47Å) once hydrolysis occurs and the arginine
finger recedes from the ATP pocket. The global effect is an iris like contraction and
release mechanism, proposed to pump DNA through the central channel (Fig 2.2B) (Gai,
Zhao et al. 2004). Hexamer models of MCM predict the arginine finger is positioned
similarly recessed from the ATP pocket as expected in the open iris state (Brewster,
35
Wang et al. 2008). It is possible that MCM utilizes ATP in an analogous fashion,
tightening the interface between monomers to pull itself along, or pull DNA through the
central channel.

Figure 2.5. ATP pocket with modeled ATP (gray) and key residues labeled.
Additional highly conserved residues are essential for ATPase activity including
sensor 1 and sensor 2 motifs. The sensor 1 motif is on β4 of the AAA+ core sheets and
bears a Asn which coordinates the water molecule in conjunction with the Walker B
glutamate (Story and Steitz 1992; Singleton, Sawaya et al. 2000). The sensor 2 motif is
on a bundle of helices (α6,7,8) and contains a conserved arginine that coordinates and
constrains the ATP within the pocket, usually interacting with the γ phosphate. Sensor 2
is atypically a trans residue in MCM proteins. Together all these residues transmit energy
from hydrolyzed ATP to the central channel.
36
AAA+ proteins also transmit substrate information from the central channel to the
ATP pocket (Zhang and Wigley 2008; Mogni, Costa et al. 2009). MCM’s rate of
hydrolysis notably increases with the addition of DNA (1.2x in ssoMCM)(McGeoch,
Trakselis et al. 2005; Brewster, Slaymaker et al. 2010). This indicates a direct line of
communication from the DNA in the central channel to the ATPase active site. This
occurs via a conserved AAA+ polar residue (T346 in ssoMCM), known as the “glutamate
switch”. The glutamate switch alters the position of the Walker B glutamate within the
hhhhDE motif from an active conformation to an inactive conformation, triggered by
substrate binding (Zhang and Wigley 2008; Mogni, Costa et al. 2009). When the
glutamate switch is mutated, DNA no longer stimulates ATPase activity (Zhang and
Wigley 2008; Mogni, Costa et al. 2009).
All C-domain features discussed so far are common among AAA+ proteins,
though specifically positioned in MCM (Iyer, Leipe et al. 2004; Erzberger and Berger
2006). Recently another essential conserved residue (R331 in ssoMCM) specific to
MCMs was located on a hairpin (EXT-hp) near the ATPase pocket (Moreau, McGeoch et
al. 2007; Brewster, Wang et al. 2008). While the exact role of this residue remains
unclear, it is near enough to the ATP pocket to physically influence the bound nucleotide
(Brewster, Slaymaker et al. 2010). This residue and the hairpin are further discussed
below.

Hairpins, Helices and Inserts
MCM is a member of the Pre-sensor I superclade, shared with LTag, and the Pre-
sensor II insertion clade, shared by the magnesium chelatase BChI. Proteins within this
37
clade are characterized by a number of inserts and modifications to the basic AAA+ core
which sculpt the C-domain into the helicase motor (Iyer, Leipe et al. 2004; Erzberger
and Berger 2006).

Figure 2.6 Detailed structure of the C-domain of ssoMCM (PDB-ID 3F9V). Cream
color represents N-domain.

The PS1-hp is a long hairpin structure predicted to protrude into the central
channel of the MCM hexamer (Fig. 2.5 and 2.6) (McGeoch, Trakselis et al. 2005;
Moreau, McGeoch et al. 2007; Brewster, Wang et al. 2008). A highly conserved lysine
found at the tip of this hairpin is essential for MCMs helicase activity (McGeoch,
Trakselis et al. 2005). Although unable to unwind DNA, the PS1-hp mutant MCM still
binds dsDNA with wild type affinity, suggesting the mutation uncouples DNA binding
from unwinding and the PS1-hp is primarily involved in the unwinding mechanism
(McGeoch, Trakselis et al. 2005). A homologous PS1-hp is found in the LTag central
38
channel, bearing lysines and aromatic residues at its tip, all which are essential for
unwinding (Fig. 2.2B) (Gai, Zhao et al. 2004). Importantly, ATP hydrolysis dramatically
shifts the LTag hairpin 17Å within the central channel during ATP hydrolysis, and
accounts for the central channel “iris” narrowing (Gai, Zhao et al. 2004). Although
perhaps not utilizing the same mechanism as LTag, MCM likely harnesses a similar
hairpin movement for unwinding. PS1-hp may have a specialized role in MCM, such as
positioning DNA within the central channel, tracking DNA translocation similarly to E1,
or prying the duplex open. PS1-hp may also work in conjunction with other features, such
as the helix-2 insert (H2I), to cooperatively unwind DNA and perhaps aspects of
unwinding are delegated to each feature. For example, the H2I may disrupt the DNA
duplex while the PS1-hp pulls the resulting strands apart.
The helix-2 insert (H2I) translates a portion of α2 into the central channel without
interrupting the continuity of α2 hydrogen bonding , creating a hairpin structure with a
piece of helix at its tip (Fig. 2.6) (Iyer, Leipe et al. 2004; Erzberger and Berger 2006;
Brewster, Wang et al. 2008; Bae, Chen et al. 2009). Like the PS1-hp, the H2I extends
into the hexamer central channel where it likely interacts with substrate DNA(Brewster,
Wang et al. 2008). H2I deletion completely abrogates helicase activity without
compromising oliogomerization and interestingly, significantly stimulates ssDNA and
dsDNA binding (Jenkinson and Chong 2006). These mutational effects imply that the
H2I is directly involved in unwinding the DNA duplex, but may also be forcing DNA
into an energetically unfavorable conformation (Jenkinson and Chong 2006). In support
of this, the H2I mutant though having essentially WT basal ATPase levels, has much
higher level of DNA stimulated hydrolysis, suggesting that the enzymes energetic load,
39
normally overcome by nucleotide hydrolysis, is removed and the enzyme is essentially
spinning its wheels. This implies a significant shift of the H2I within the central channel
occurs during ATP hydrolysis, similar to the PS1-hp in LTag. Evidence for this shift is
found in the H2I deletion in mtMCM; when ATP is present, a tryptophan on the H2I is
more solvent exposed than in the nucleotide free enzyme, supporting a conformational
change during helicase activity (Jenkinson and Chong 2006). The H2I is just above the
PS1-hp and protrudes more into the central channel (Brewster, Wang et al. 2008). The
mutational data for PS1-hp and the H2I indicate that both are cooperatively engaged
during helicase activity and likely influence each other based on their positioning.

Figure 2.7 Important hairpins and inserts of ssoMCM. SsoMCM monomer (PDB-ID
3F9V). B) Modeled ssoMCM hexamer illustrating predicted locations of important
hairpins in the central channel. C) Top down view.
40
A hairpin predicted to be on the outer surface of the hexamer and below the side
channels, is appropriately named the external hairpin (EXT-hp)(Fig. 2.6 and 2.7)
(Brewster, Wang et al. 2008). This hairpin harbors the previously mentioned R331
residue involved in ATPase activity. A detailed analysis of each residue of the hairpin
indicated that EXT-hp residues are also involved in DNA binding (Brewster, Wang et al.
2008; Brewster, Slaymaker et al. 2010). This could be interpreted as DNA threading
through the side channels and engaging the EXT-hp. An alternate explanation is that
mutations to the EXT-hp affect the ssoMCM subunit interface, which narrows or distorts
the central channel, negatively influencing DNA binding.
Lastly, a long insertion (PS2-ins) between α5 and α6 reorganizes a canonical
helical bundle domain (lid domain) found in PS1 superclade members (Fig. 2.6)
(Erzberger, Mott et al. 2006). The PS2-ins splits the canonical lid domain into an α helix
bundle (α6,7,8) and α5. α5 remains in its canonical location, but the helix bundle is
repositioned to the opposite side of the subunit and away from the cis ATP pocket
(Brewster, Wang et al. 2008; Bae, Chen et al. 2009). Importantly, this repositions the
sensor 2 arginine on α7 into an atypical trans position (Moreau, McGeoch et al. 2007).
The full length ssoMCM crystal structure revealed that α5 is flanked by two long linkers,
and predicted to associate with the adjacent monomers (Brewster, Wang et al. 2008). This
may represent a key interface at the C terminal domain, and allow elasticity within the
central channel.
The AAA+ core isolated from the N domain is still capable of unwinding DNA,
albeit with much lower processivity and substrate specificity. Therefore this domain is
considered to be the helicase motor that carries out the dynamic motion required for
41
helicase activity. The PS1-hp and helix-2 insert H2I appear to be intimately involved in
the cleavage of duplex DNA and may function as the steric wedge in the ploughshare
model, to redirect ssDNA in the steric exclusion model, or pull DNA through the central
channel in the T-antigen model. Similar hairpins of LTag narrow and widen the central
channel as ATP cycles though, making it likely that these hairpins are analogously
involved in MCM dsDNA unwinding via force exerted by the H2I and the PS1-hp.
2.4.3 Wing Helix Domain
The wing helix domain is very small, and is comprised of a few helices attached
by a linker to α8. When this domain is removed from ssoMCM helicase activity is
significantly stimulated, possibly indicating a regulatory role (Barry, McGeoch et al.
2007). This effect could be due to an influence on the attached α6,7,8 helix bundle which
harbors the sensor 2 arginine. In Eukaryotic MCM the wing helix domain is responsible
for interactions with Cdt1, a protein essential for Mcm2-7 loading (Khayrutdinov, Bae et
al. 2009). An archaeal homolog of Cdt1 has not been discovered yet and it is curious that
this domain is conserved between archaea and eukaryotes.
2.5 Inter- and intra-subunit communication
The planar hexameric ring of MCM subunits comprises the active helicase unit.
Within a hexamer, the interface between each pair of subunits harbors a single ATP
active site, composed of cis and trans subunit contributions, for a total of six ATPase
pockets per helicase unit. In the homohexameric archaeal helicase, each active site is
equivalent, which is not the case in the Mcm2-7 complex, where each active site is
42
unique (Bochman, Bell et al. 2008; Bochman and Schwacha 2008; Bochman and
Schwacha 2010).
The coordination of hydrolysis within hexameric ring helicases fall into one of
several types; concerted, sequential, probabilistic or semi-sequential (Singleton, Sawaya
et al. 2000; Gai, Zhao et al. 2004; Martin, Baker et al. 2005; Crampton, Mukherjee et al.
2006; Enemark and Joshua-Tor 2006). LTag is thought to engage and hydrolyze ATP in
each active site simultaneously, leading to the previously discussed iris like contract and
relax cycles. This is observed in crystal structures containing nucleotides, which have
either all the ATP pockets occupied (by ATP or ADP), or all are empty (Gai, Zhao et al.
2004). Alternatively, ClpX subunits hydrolyze ATP probabilistically, suffering only a 1/6
reduction in enzyme efficiency from a single compromised active site (Martin, Baker et
al. 2005). E1 and DnaB utilize a sequential mode of hydrolysis, in which each hydrolysis
event is promoted by the the neighboring ATPase active site (Donmez and Patel 2006;
Enemark and Joshua-Tor 2006). Without DNA present, ssoMCM indicates a probabilistic
mode of hydrolysis, meaning that hydrolysis cycles of a single subunit are not dictated by
the neighboring subunits. However, during DNA unwinding MCM fits a model between
sequential and random models, often termed semi-sequential (Moreau, McGeoch et al.
2007). This indicates that an individual subunit’s ATP dependent contribution to helicase
activity is dependent on the conformation of other subunits in the complex. In short the
helicase can tolerate several inactive ATP pockets and still function.
A number of structural features at the subunit interface and within the central channel
have been implicated in mediating subunit communication (Moreau, McGeoch et al.
2007; Brewster, Wang et al. 2008; Sakakibara, Kasiviswanathan et al. 2008; Barry,
43
Lovett et al. 2009). The ACL is so named for its role in regulating of the AAA+ domain
via the N domain. The ACL function was initially recognized in mtMCM, and
subsequently validated in ssoMCM (Sakakibara, Kasiviswanathan et al. 2008; Barry,
Lovett et al. 2009). When deleted, the ΔACL mutant retains no helicase activity. This is
curious since the AAA+ domain in isolation retains helicase activity, and therefore the
missing ACL inhibits the helicase mechanism somehow. It was subsequently shown that
adding an Nt-hp deletion to the ΔACL mutant restores helicase activity. The ACL is
therefore proposed to play a role in properly positioning the Nt-hp within the central
channel, and a mis-positioned Nt-hp is the implicated for helicase inhibition of the ΔACL
mutant (Barry, Lovett et al. 2009). It seems likely then that the Nt-hp is preforming a
regulatory role through structural features identified as essential for helicase activity,
possibly the PS1-hp and the H2I. The modeled hexamer of ssoMCM indicates that these
features may in fact be in near each other in the central channel, offering support for this
hypothesis. The N-domain influence the H2I position in the central channel via an
arginine that to supports the ACL (R98 in mtMCM, R110 in ssoMCM). Mutation of this
residue influences the solvent exposure of the H2I tryptophan similarly to ATP
hydrolysis, indication a conformational change of H2I in the central channel. Although
the data is limited, this may support the idea that the ACL regulates influence the central
channel hairpin positions (Sakakibara, Kasiviswanathan et al. 2008; Barry, Lovett et al.
2009). Considered with the semi-sequential subunit communication, subunits may
alternate between “on” and “off” conformations, inducing neighboring monomers to
adopt an opposite conformation.

44
2.7 Conclusion
Archaeal MCM research is in the process of revealing the intricate details of the
enzymes mechanism. Primary sequence conservation and similar complex organization
with eukaryotic Mcm2-7 strongly suggests that archaeal MCM’s mechanistic principals
are transferable across orders of life. For this reason, archaeal enzymes will continue be
the focus of scientific interest and source for landmark replication research.

45
CHAPTER 3

MUTATIONAL ANALYSIS OF MCM HELICASE
ACTIVITY

Reproduced with permission from Brewster AS, Slaymaker IM, Afif SA, Chen XS. 2010.
Mutational analysis of an archaeal minichromosome maintenance protein exterior
hairpin reveals critical residues for helicase activity and DNA binding. BMC Mol Biol.

Contributions:I.M.S created all constructs, I.M.S and S.A.A purified and did all SEC
experiments, I.M.S did all ATPase experiments, I.M.S and A.S.B did all DNA binding
experiments, A.S.B did all helicase experiments, I.M.S, A.S.B and X.J.S designed project.

3.1 Introduction
The mini-chromosome maintenance protein (MCM) complex is an essential
replicative helicase for DNA replication in Archaea and Eukaryotes. While the eukaryotic
complex consists of six homologous proteins (Mcm2-7), the archaeon Sulfolobus
solfataricus has only one MCM protein (ssoMCM), six subunits of which form a
homohexamer. We have recently reported a 4.35Å crystal structure of the near full-length
ssoMCM. The structure reveals a total of four β-hairpins per subunit, three of which are
located within the main channel or side channels of the ssoMCM hexamer model
generated based on the symmetry of the N-terminal Methanothermobacter
thermautotrophicus (mtMCM) structure. The fourth β-hairpin, however, is located on the
exterior of the hexamer, near the exit of the putative side channels and next to the ATP
binding pocket. Here we performed a detailed mutational and biochemical analysis of
residues on this exterior β-hairpin, which showed that some of the residues play a role for
DNA binding as well as for helicase activity. These results implicate several current
theories regarding helicase activity by this critical enzyme.
46
DNA replication is a tightly regulated and efficient process. Central to this
process is the coordinated unwinding of double stranded DNA by the AAA+ family
member MCM (Minichromosome Maintenance protein) protein(Ishimi 1997; You,
Komamura et al. 1999; Lee and Hurwitz 2001). As the replicative helicase, MCM is
required for cellular viability, and is regulated through assembly at the origin in
combination with ORC, and Cdc6, among others, and through phosphorylation by
various replication checkpoint proteins such as CDK and DDK (Bell and Dutta 2002;
Mendez and Stillman 2003; Bowers, Randell et al. 2004).
In eukaryotes, MCM is composed of a heterohexamer formed from the gene
products of 6 homologs (Mcm2-7), all necessary for cell survival (Tye 1999; Bell and
Dutta 2002). Archaeal MCM serves as a model system for studying MCM function as
many strains only have one MCM gene whose product oligomerizes as a homohexamer
or even as a double hexamer (Kelman, Lee et al. 1999; Chong, Hayashi et al. 2000;
Fletcher, Bishop et al. 2003). Several structures have been recently made available that
have helped understanding of the biochemistry involved in DNA unwinding (reviewed
in(Bochman and Schwacha 2009; Costa and Onesti 2009; Sakakibara, Kelman et al.
2009). Specifically, the poorly-conserved N-terminal portion was solved in a double
hexameric configuration from Methanothermobacter thermautotrophicus (N-mtMCM)
(Fletcher, Bishop et al. 2003), and as single hexamers from Sulfolobus solfataricus (N-
ssoMCM)(Liu, Pucci et al. 2008). The near full length MC monomer from Sulfolobus
solfataricus (ssoMCM) was also recently solved (Brewster, Wang et al. 2008). Finally,
the structure of an inactive MCM homolog with natural internal deletions from
Methanopyrus kandleri (MkaMCM2) was also published (Bae, Chen et al. 2009).
47
The crystal structure of ssoMCM structure reveals an elongated fold for the
monomer, with an N-terminal domain whose sequence, but not structure, is poorly
conserved, and a highly conserved C-terminal helicase domain that contains what is
known as the MCM box (Brewster, Wang et al. 2008). The hexamer structures, and
hexamer models of the near-full length structures, reveal a large central channel, through
which DNA is postulated to be threaded.
One of the major structural features of the subunit structure of ssoMCM is the
four obvious β-hairpins projecting from the monomeric ssoMCM. One, located in the N-
terminal domain (NT-hairpin), projects into the central channel and has been implicated
in DNA binding (Fletcher, Bishop et al. 2003; McGeoch, Trakselis et al. 2005; Brewster,
Wang et al. 2008). The other three β-hairpins are located in the C-terminal AAA+
domain: the pre-sensor 1 hairpin (PS1-hp), the helix 2 insertion hairpin (H2I-hp), and the
external hairpin (EXT-hp) (Brewster, Wang et al. 2008).
Residues on the PS1-hp and H2I-hp play a role for helicase activity, are involved
in DNA binding and project into or near the central channel (McGeoch, Trakselis et al.
2005; Jenkinson and Chong 2006). The EXT-hp, however, is located on the exterior side
of the hexamer, near the side channels in the C-terminal domain (Brewster, Wang et al.
2008). The unusual location of this EXT-hp raises interesting questions regarding its
functional role. However, unlike the other β-hairpins, no detailed mutational and
functional analysis of the EXT-hp has been performed, and its role in DNA binding,
ATPase, and helicase activity is not understood. In this work we present a granular
examination of this important structural feature, including a thorough examination of the
hairpin’s role in DNA binding, ATP hydrolysis and helicase activity.
48
3.2 Results
3.2.1 Mutational Analysis of the exterior hairpin.
The EXT-hp sequence is semi-conserved in archaea and eukaryotes (Fig. 3.1A),
which raises intriguing questions as to the functional role of this hairpin next to the side
channel on the exterior of the hexamer. Previously, we showed an EXT-hp triple mutant
was deficient in helicase and ATPase activity (Brewster, Wang et al. 2008). To further
explore this hairpin’s role in helicase function, we created a series of 10 single and
double alanine mutants (numbered M1 to M10), 9 on the EXT-hp and 1 control mutation
of the Walker A lysine involved in ATP binding and hydrolysis (Fig. 3.1B). The 9
hairpin mutants are located in three regions, an inside β-strand that faces towards the
interior side of the hexamer and side channel, a tip, and an outside β-strand that faces
away from hexamer (Fig. 3.1C and 3.1D).

49

Figure 3.1 Overview of EXT-hp mutations. A) Sequence alignments of MCMs across
archaea (top) and eukaryotes (bottom), for the short region corresponding to the EXT-hp.
Sso: Sulfolobus solfataricus. Sac: Sulfolobus acidocaldarius. Prn: Aeropyrum pernix.
Mth: Methanothermobacter thermautotrophicus. Pyf: Pyrococcus furiosus. Tap:
Thermoplasma acidophilum. Sp: Schizosaccharomyces pombe. Sc: Saccharomyces
cerevisiae. Hs: Homo sapiens. Xl: Xenopus laevis. Dm: Drosophila melanogaster. At:
Arabidopsis thaliana. B) Table of mutations used for this work. C) Tilted side view of
the ssoMCM hexamer model, showing the EXT-hp on the external side of the hexamer
and near the side channel. A single subunit is shown in cyan, with its EXT-hp in red.
The ATP binding pocket and side-channel are indicated. D) Close up view of EXT-hp.
Inside and outside refer to towards the central channel and away from the central channel,
respectively. The locations of the residues mutated in this study are colored on the EXT-
hp according to amino acid type, as in panel B.
50
Mutant M1 changes a highly conserved lysine on the exterior side of the hairpin,
but close to the hairpin base. Mutants M2-M7 bear single or double mutations on the
VLED sequence that wraps around the tip. We previously postulated that these residues
could function as a repellent to DNA, similar to the acidic pin in RuvA. M2-M4 change
the properties of the hydrophobic residues, VL. Of the two, the leucine is more
conserved but neither are strongly conserved in eukaryotes or archaea. M5-M8 mutate
the acidic ED region. Of note, the aspartate is highly conserved in archaea, but in
eukaryotes its conservation varies by homolog. For example, in MCM5 it remains an
aspartate, but in MCM3 it is consistently changed to asparagine. M8 changes a well
conserved arginine in archaea that only remains consistently basic in MCM 7, and mostly
so in MCM 2. M9, changing an absolutely conserved arginine at the base of the hairpin,
had been assayed previously for ATPase and helicase activity (Moreau, McGeoch et al.
2007), and was included as an additional control. We further assayed it for DNA binding
differentials. Finally, M10, the Walker A mutant, changes the conserved lysine vital for
ATP hydrolysis (Chong, Hayashi et al. 2000). The Walker A motif is not conserved in
the inactive MCM homolog from Methanopyrus kandleri (Bae, Chen et al. 2009), nor is
the EXT-hp present in that isoform.

51
Oligomerization as assayed by size-exclusion chromatography.
We first assayed oligomeric state to determine if these mutations would affect
folding or hexamerization as compared with the wild type. At 250 mM NaCl, wild type
ssoMCM elutes on a Superose 6 size exclusion column as a hexamer. We found
previously that mutations that affect hexamerization elute as two peaks, with one at lower
oligomeric state, or shifting entirely to a lower oligomeric species (Brewster, Wang et al.
2008). As shown in Fig. 3.2A, all the 10 mutants reported here eluted predominantly as a
hexamer at 250 mM NaCl, indicating that none of the mutants has obvious defects in
oligomerization.

ATPase activity.
We next performed a series of biochemical assays of the mutants to examine their
effect on ATP hydrolysis and other activities. Protein concentrations for these assays
were calibrated by nano-drop and further confirmed by SDS-PAGE in Fig. 3.2B. The
first set of assays determined k
cat
and K
m
values for ATP hydrolysis via the Enzchek
phosphate release assay, as described previous (Brewster, Wang et al. 2008). Activity
curves for wild-type and mutants M3 and M8 are shown in Fig. 3.2C. For each
experiment, an additional test was performed to measure ATPase stimulation upon
addition of Y-shaped fork DNA. WT shows a modest stimulation by the Y-shaped DNA,
as noted previously. M3’s ATPase activity is significantly higher than WT’s. M8’s
ATPase activity is lower, and furthers loses ATPase stimulation upon the addition of
DNA. A summary of k
cat
changes, together with the full data, including K
m
values, is
given in Fig. 3.2D and listed in Table 3.1.
52

Figure 3.2 The results of FPLC and ATPase analysis of EXT-hp mutants. A) FPLC
analysis of the mutations by gel filtration chromatography on a Superose-6 column.
Molecular marker positions, Ferritin (440 kD) and aldolase (158 kD), are indicated by
arrows). B) SDS-PAGE gel analysis of the purified mutant proteins. C) ATPase activity
curves for WT, M3 and M8 in the presence and absence of Y-shaped DNA. Error bars
representing standard error of the mean are present, but in most cases are too small to see.
D) Summary of ATPase data in the presence (black bar) and absence (white bar) of Y-
shaped DNA. Error bars are standard error from curve fitting.

53

DNA-binding activity.
DNA-binding activity of the mutants was determined by EMSAs using a single
stranded and forked DNA substrate (Fig. 3.3, binding constants in Table 1). Generally
speaking, mutations of the hydrophobic tip (mutants M2-M4) increased DNA binding
slightly. Mutations in the conserved aspartate on the tip of the hairpin (M6) showed a
large decrease in dsDNA binding, and the double acidic mutant (M7) had a similar
decrease in ssDNA and dsDNA binding. All of the basic mutations, including M1 on the
outside of the hairpin, decreased ssDNA binding somewhat, and dsDNA binding
significantly, with M8, R329A having the largest effect. These findings indicate that this
hairpin is involved in DNA binding. Additionally, we see highly cooperative DNA
binding in our assays. Previously, using flourescence polarization anisoptropy, we had
seen Hill factors for Y-DNA binding ranging from 1.3 to 3.5 (Brewster, Wang et al.
2008), suggesting cooperativity of DNA binding.

54

Figure 3.3 Results of DNA Binding Assays With EXT-hp Mutants. A) Representative
EMSA gels assaying for DNA binding for WT and M8. Black triangle indicates
increasing protein concentration. Locations of DNA alone and DNA-protein complexes
are indicated. B) The curves of DNA binding for WT and M8. Error bars represent the
standard error of the mean. C) Summary of DNA binding data for all mutants. Error bars
represent standard error from curve fitting.

55
Now, using EMSA assays, we see Hill factors ranging from 4 to as high as 15 for both
ssDNA and Y-DNA, confirming the nature of cooperativity of DNA binding, which is
likely related to the oligomerization of six subunits of ssoMCM upon DNA binding. The
higher Hill factors reported here are likely from the differences in experimental
conditions; for example we have added a heating step by treating the protein-DNA
mixture at 65ºC for 30 minutes during sample preparation, which may allow the protein
to bind DNA better.

Helicase activity.
Helicase assays were then performed on these mutants using radio-labeled forked
DNA substrates (Fig. 3.4). As expected, the R331A and Walker A mutations, which had
no detectable ATPase activity, exhibited no helicase activity, as shown previously
(Chong, Hayashi et al. 2000; Moreau, McGeoch et al. 2007). Generally speaking, those
mutants with lower ATPase and DNA binding activity also has lower helicase activity.
However, the deficits in ATPase and DNA binding of some of the mutations did not
strictly correlate with the level of deficits in helicase activity. In particular, the acidic
mutations that showed significant decreases in DNA binding (M6 and M7), and decreases
in ATPase activity, did not suffer significant decreases in helicase activity, at least under
the assay conditions used here.

56

Figure 3.4 Results of Helicase Assays With EXT-hp Mutants. A) Representative gel
analysis result of helicase assay. B: boiled. UB: unboiled. DNA positions for Y-DNA
and ssDNA are indicated. B) Summary of the quantified helicase activity of all mutants.
Error bars represent standard error of the mean.

57

Table 3.1. Kinetic Parameters of EXT-hp Mutants. All values are calculated based
on monomeric MCM subunit. For each value, standard error is given. Hill: Hill
cooperativity coefficient.

ATPase activity ATPase + Y-DNA ssDNA Binding Y-DNA Binding
Mutant
k
cat
,
min
-1
k
m
, nM
k
cat
,
min
-1
k
m
, nM K
d
, nM Hill K
d
, nM Hill
WT 3.1±0.1 170±20 3.8±0.1 190±20 240±0.5 8.8±0.5 224±7.3 5.8±1.3
M1 1.8±0.1 140±30 3.7±0.5 440±150 317±5.8 4.4±0.3 398±4.0 13.2±1.3
M2 2.4±0.1 120±20 3.6±0.1 160±20 209±5.8 4.7±0.5 230±7.2 10.1±3.3
M3 4.7±0.3 270±40 5.2±0.2 260±30 169±1.3 5.6±0.1 186±6.4 7.9±1.1
M4 3.9±0.1 230±10 5.3±0.2 260±30 165±10.0 13.4±4.3 178±1.5 7.7±0.5
M5 2.9±0.2 60±40 3.7±0.2 180±30 185±0.3 12.1±0.3 224±0.9 11.6±0.4
M6 2.3±0.1 100±20 2.6±0.2 130±30 283±78.7 15.6±20.1 400±6.5 5.6±0.4
M7 2.0±0.1 90±10 2.2±0.1 90±20 444±1.0 10.6±0.5 404±2.6 8.8±0.4
M8 1.8±0.1 170±40 1.7±0.1 170±30 380±1.8 8.0±0.3 483±0.4 9.0±0.03
M9 No Activity No Activity 325±8.3 6.2±0.8 428±2.0 12.9±0.5
M10 No Activity No Activity 267±7.0 4.5±0.5 339±2.6 11.4±2.0
58

3.3 Discussion
The EXT-hp was previously shown to be important for helicase function based on
the study of a triple mutant on its tip (Brewster, Wang et al. 2008). In this report, we
follow up with a systematic mutational and functional study in order to understand how
this externally located β-hairpin immediately next to the exit of the side channels is
involved in helicase function by investigating the specific activities in oligomerization,
DNA binding, ATPase, and DNA unwinding.
The EXT-hp contains residues with hydrophobic, acidic, and basic properties.
There residues were mutated to alanine to examine the contributions of each of these
residues to the various activities associated with helicase function. A summary of the
data is listed in Table 3.2. Mutants M2-M4 contain mutations of hydrophobic residues.
M2 weakens ATPase activity while M3 increases it, simultaneously losing DNA
stimulation. The double mutant M4 cancels these effects. M3 has tighter DNA binding,
with the double mutant retaining this effect. It appears that the increasing ssDNA
binding by these mutants is associated with the reduction of helicase activity. At this
moment, we don’t have a good explanation for this observation. Probably tighter ssDNA
binding by M3 and M4 somehow inhibits efficient DNA translocation by these mutants.
Mutants M5-M7 contain mutations of acidic residues (Table 3.2). M5 showed a
slight increase in ssDNA binding, but no effect on other activities. M6 revealed weaker
ATPase activity, Y-DNA binding and helicase activity. It is interesting that the aspartate
mutation could decrease DNA binding. The puzzling data in this set, however, is the
59
double mutant, M7. Despite the weaker ATPase activity and DNA binding, it showed
near wild-type helicase activity.

Mutant Oligomeric ATPase DNA Binding
No. Mutant State ATPase Stimulation ssDNA Y-DNA Helicase
WT - Hexamer +++ +++ +++ +++ +++
M2 V324A Hexamer ++ +++ +++ +++ +++
M3 L325A Hexamer ++++ ++ ++++ +++ +
M4 VL324AA Hexamer +++ +++ ++++ +++ ++
M5 E326A Hexamer +++ +++ ++++ +++ +++
M6 D327A Hexamer ++ ++ +++ + ++
M7 ED327AA Hexamer ++ ++ + + +++
M1 R323A Hexamer ++ +++ ++ + +
M8 R329A Hexamer ++ ++ + + +
M9 R331A Hexamer 0 0 + + 0
M10 K346A Hexamer 0 0 +++ ++ 0

Table 3.2 Summary of Biochemical Assays of EXT-hp Mutants. Mutations are
grouped by residue type (green: hydrophobic, blue: acidic, red: basic). +++: wild type
activity level. ++++: greater than wild type (more activity or tighter binding). ++: less
than wild type. +: substantially less than wild type. 0: no detectible activity. ATPase
stimulation refers to the increase of ATPase activity upon addition of Y-DNA.

60

For the mutants involved the basic residues (M1, M8-M9), they have the most
profound effect in all the activities assayed. Reduced ATPase activity, DNA binding and
helicase activity are observed across the board. Of note, M9, which had been assayed for
ATPase and helicase activity previously (Moreau, McGeoch et al. 2007), now is revealed
to have compromised DNA binding as well.
Our single and double mutant EMSA assays from the current round of
experiments reveal decreases in DNA binding on the order of 1.5 to 2x fold increases in
K
d
. Mutations in the PS1-hairpin resulted in a similar change in DNA binding (2x fold
increase in K
d
) (McGeoch, Trakselis et al. 2005). Therefore, the EXT-hp appears to be
involved in interactions with DNA, as shown for as other three β-hairpin structural
elements in the MCM structure.
Some of the specific changes in DNA binding caused by mutations appear to be
counter intuitive. For example M6 and M7, which are both changes eliminating negative
charges, have a lowered affinity for DNA. Also, the increase in binding from
hydrophobic mutations is interesting. Similarly, how two basic amino acids on opposite
sides of the hairpin (K323 and R329) could impact DNA binding in similar ways is
unclear. While we are tempted to speculate that the proximity of R329 (decreased DNA
binding, decreased helicase activity) to the putative side-channel implicates the hairpin in
pulling ssDNA through the channel in a side channel extrusion model (see(Brewster,
Wang et al. 2008)), there are other possibilities as well. One possibility is, as proposed by
Rothenberg et al. in a DNA exclusion model (Rothenberg, Trakselis et al. 2007), that one
61
ssDNA may be on the exterior of the hexamer to interact with the EXT-hp while the other
ssDNA is translocated in the central channel.
It is important to note here that decreases in DNA binding seem correlated with
decreases in ATPase activity. The DNA binding defects could be explained by
conformational changes from ATP binding that are not possible in the mutations, which
changes diminish the ability of the rest of the enzyme to bind DNA. Thus these DNA
binding defects could be secondary effects. However, it could easily be argued the other
way around. DNA binding stimulates ATPase activity, so mutations with DNA binding
phenotypes could also result in slowing the rate of ATP hydrolysis as a secondary effect.
This is at least partially borne out by the fact that the k
m
’s for ATPase activity do not
seem unduly affected by the mutations, with the exceptions of M9 and M10 (Table 3.1).
Thus, the enzyme may be still binding ATP with wild-type affinity, but hydrolyzes ATP
slower due to problems with DNA binding.
Finally, R331 is a residue that has fascinated us since we first examined the
ssoMCM structure and compared it to known mutations (Moreau, McGeoch et al. 2007).
As part of an examination of sequence alignments and structure alignments of ssoMCM
with viral hexameric helicase LargeT antigen (LTag), we discovered that R331 align
quite well with LTag K418 that serves as a “lysine finger” and, in combination with
LTag’s arginine finger, coordinates the ATP gamma phosphate in the ATP binding and
hydrolysis (Li, Zhao et al. 2003; Gai, Zhao et al. 2004). K418 is vital for LTag ATPase
and helicase activity(Greenleaf, Shen et al. 2008), which mimics the phenotype we see
here. Thus, the base of the EXT-hp seems directly involved in ATP hydrolysis.
62
The biochemical analysis we present here further establishes the EXT-hp as vital
for the activity of the MCM helicase. Such a role in helicase function probably is
associated mainly with the DNA binding activity of this EXT-hp. How this EXT-hp
interact with DNA and how such interactions are related to unwinding activity will
require further structural and functional analysis in the future.

3.4 Experimental Procedures

Cloning, Purification, and Size Exclusion Analysis.
WT Sulfolobus solfataricus MCM and mutations were cloned and purified in
wash buffer (WB: 50 mM Tris-Cl (pH 8.0), 250mM NaCl, 1 mM DTT), as described
previously (Brewster, Wang et al. 2008) with the following changes: prior to size-
exclusion chromatography, the protein was first purified on a 6 mL Resource Q anion
exchange column. Further, after purification, the protein concentration was assayed by
nano-drop and SDS-PAGE analysis. The protein was then diluted to 10 uM in helicase
buffer (HB, 30 mM Tris acetate (pH 8), 75 mM NaCl, 50 mM potassium acetate, 10 mM
magnesium acetate), aliquoted, and frozen at -80ºC. ~0.5 mg of protein was taken
separately to analyze on size-exclusion chromatography.

Helicase Assays.
Helicase assays were performed exactly as described previously on radio-labeled
Y-shaped DNA substrate(Brewster, Wang et al. 2008). The substrate was created from
annealing two complementary strands. The sequences are: (dT)
44
63
GCTCGTGCAGACGTCGAGGTGAGGACGAGCTCCTCGTGACCACG (strand Y1)
and CGTGGTCACGAGGAGCTCGTCCTCACCTCGACGTCTGCACGAGC (dT)
44

(strand Y2). Experiments were performed in triplicate.

Electrophoretic Mobility Shift Assays
DNA binding constants were determined using electrophoretic mobility shift
assays (EMSAs). ssDNA (strand Y2) or Y-shaped DNA from above was radio labeled
and desalted using a Micro Bio-Spin 6 Column (BIO-RAD). Increasing amounts of
protein were incubated with 1.4 nM DNA in DNA binding buffer (DB, 20 mM Tris-Cl
(pH 7.5), 100mM NaCl, 2mM EDTA, 0.5 mM magnesium chloride) for 30 minutes at
65ºC, then ran on a 5% polyacrylamide gel in 0.5x Tris/borate/EDTA buffer for 90
minutes at 100 V. DNA bands were detected by autoradiography and quantified. %
DNA bound was determined vs. protein concentration and K
d
was calculated as described
in (Greenleaf, Shen et al. 2008). Experiments were performed in duplicate.

ATPase Assays.
ATPase assays were performed as described previously (Brewster, Wang et al.
2008). Experiments were performed in triplicate.

64
CHAPTER 4
MINI-CHROMOSOME MAINTENANCE COMPLEXES
FORM A FILAMENT TO REMODEL DNA STRUCTURE
AND TOPOLOGY

Reproduced with permission from Slaymaker IM, Fu Y, Toso DB, Ranatunga N, Brewster
A, Forsburg SL, Zhou ZH, Chen XS. 2013.Mini-chromosome maintenance complexes
form a filament to remodel DNA structure and topology. Nucleic Acids Res.

Contributions:I.M.S created all ssoMCM constructs, purified and crystallized ssoMCM,
calculated electrostatic, generated models, did topology assays and carried out DNA
melting experiments. I.M.S and D.B.T did electron microscopy, A.B assisted with
crystallography, Y.F did helicase assays and DNA binding experiments, N.R generated
yeast lines and did survival assays, S.L.F, Z.H.Z and X.S.J supervised project.

4.1 Introduction
All organisms must duplicate their genome to provide each new cell with a full
complement of genetic information prior to mitotic division. When a cell enters S-phase,
double stranded genomic DNA is separated into single strands to be copied into sister
chromatids. This process is tightly regulated and highly coordinated to ensure the high
fidelity replication of the genome.
Eukaryotic and archaeal chromosomal DNA replication are initiated by the
stepwise assembly of pre-replicative complexes (pre-RCs), composed of the origin
recognition complex (ORC), Cdc6, and mini-chromosome maintenance (MCM)
complexes (Chong, Mahbubani et al. 1995; Aparicio, Weinstein et al. 1997). These
components cooperatively catalyze the initiation of replication at the origin. Upon
initiation and origin firing, the MCM ring complex, an ATP dependent DNA helicase, is
65
released from the pre-RC to unwind the genome, opening double stranded DNA into
single stranded templates(Labib, Tercero et al. 2000).
Eukaryotes express six essential homologous MCM proteins (Mcm2-7) that form
hetero-hexamers and double hexamers in vitro (Wyrick, Aparicio et al. 2001; Fletcher,
Bishop et al. 2003; Fletcher, Shen et al. 2005; Gomez-Llorente, Fletcher et al. 2005;
Gambus, Khoudoli et al. 2011). Archaeal genomes also encode MCM genes with
sequence and structural homology to eukaryotic Mcm2-7(Iyer, Leipe et al. 2004).
However, many archaea express only a single MCM subunit, which forms homo-
oligomeric complexes with the same function as the eukaryotic heteromeric
complexes(Fletcher, Bishop et al. 2003; Chen, Yu et al. 2005; Erzberger, Mott et al.
2006; Brewster, Wang et al. 2008).
In G1 and leading up to S-phase of the eukaryotic cell cycle, multiple Mcm2-7
hetero-hexamers are recruited to each pre-RC and spread to nearby chromatin(Edwards,
Tutter et al. 2002; Randell, Bowers et al. 2006; Kuipers, Stasevich et al. 2011). Mutations
that limit pre-RC to only a single iteration of MCM recruiting are not viable, which
suggests that the presence of many MCM proteins is a requirement for proper pre-RC
function(Geraghty, Ding et al. 2000; Bowers, Randell et al. 2004; Randell, Bowers et al.
2006; Chen, de Vries et al. 2007; Hoang, Leon et al. 2007; Fu, Yardimci et al. 2011).
This is puzzling as only one or two MCM hexameric rings are sufficient to unwind
DNA(Fletcher, Bishop et al. 2003; Bochman and Schwacha 2008; Fu, Yardimci et al.
2011).
How MCM functions when bound to chromatin prior to and during initiation has
been the subject of much interest, though results often raise more questions than answers.
66
Chromatin bound MCM complexes are categorized into two biochemically
distinguishable subgroups. Salt stable “loaded” complexes are bound tightly to the origin,
locked onto DNA as hexamer or a double hexamer as the active helicase form in
vivo(Remus, Beuron et al. 2009; Gambus, Khoudoli et al. 2011). However, the majority
of MCM is found in salt sensitive “associated” complexes and not specifically located at
origins. These MCM proteins distal from the origin may have different biological
function(s)(Edwards, Tutter et al. 2002; Evrin, Clarke et al. 2009; Francis, Randell et al.
2009; Tsakraklides and Bell 2010). MCM proteins have also been detected associating
with large regions of unreplicated chromatin during G1 and early S-phase (Kuipers,
Stasevich et al. 2011). Despite the large number of MCM proteins in the nucleus,
reduction in MCM gene dosage causes genome instability, demonstrating both the state
and quantity of MCM are essential for cell survival (Liang, Hodson et al. 1999; Pruitt,
Bailey et al. 2007; Shima, Alcaraz et al. 2007; Kunnev, Rusiniak et al. 2010). These
peculiarities are part of what has been termed the “MCM paradox”(Takahashi, Wigley et
al. 2005).
In this study we report a crystal structure of the near full length MCM from the
archaeon Sulfolobus solfataricus (sso) assembled as a wide helical filament with a large
channel along the filament axis. The helical path on the inner wall of the filament binds
dsDNA and untwists its double helix, leading to changes in DNA topology.

67
4.2 Results
4.2.1 MCM Filament Crystal Structure
To examine how MCM functions on chromatin, we set out to determine a crystal
structure of MCM bound to dsDNA. Using a full-length MCM protein from the archeaon
Sulfolobus solfataricus (ssoMCM), crystals were obtained in the presence of 61 bp
dsDNA, but not in the absence of dsDNA, suggesting dsDNA is an integral part of the
structure of the crystal even though we were unable to build DNA into the final model.
The resulting crystal structure shows an unusually large left-handed helical filament (Fig.
4.1A), with 10 subunits per helical turn. Each asymmetric unit contains five MCM
subunits. Although full length MCM protein was used in crystallization, density of a
small wing helix like domain at the C terminus was not visible and thus the final model
contains residues 7-598 and is missing residues 599-686. Recently developed refinement
methods (DEN refinement (Schroder, Levitt et al. 2010), also see Methods) supported
confident placement of side chains in the 4.1Å density map (Fig. 4.12), with excellent
geometry and statistics (Table 4.1). The filament outer diameter measures approximately
175Å and the inner channel opening measures 90 Å (Fig. 4.1A and 4.1B). The filament
has a narrow helical groove formed between the N- and C- terminal ends of monomers.
Parallel to the narrow groove is a furrow on the filament outer surface, with side-channels
that connect to the interior of the filament central channel (Fig. 4.1A).
To exclude the possibility that the filaments are a crystallographic artifact, we
used electron tomography (ET) to detect the oligomeric state of MCM bound to dsDNA
in solution. Filaments were observed only when MCM protein was pre-incubated with
naked dsDNA, but not when incubated with ssDNA or in the absence of DNA (Fig.
68
4.2A,B). Three-dimensional (3D) ET reconstructions of filaments in solution and the
crystal structure match in their dimensions, handedness (Fig. 4.2A), and structural
features such as filament groove and pitch.

Figure 4.1 Overall features of the MCM filament structure. (a) Surface representation
of the crystal structure of the filament of full length ssoMCM. The left-handed filament
contains 10 subunits per turn, with a pitch of 100Å. (b) Top down view through the
filament central channel, with dimensions indicated. (c) View of a MCM monomer
(ribbon in green) in the filament. Important regions of contact are labeled. (d) Monomer
structure, with a neighboring subunit shown in grey. The division of the N-domain and
C-domain is indicated on the right side, with sub domains (A, B, C, N-C linkers,
etc) indicated on the left side of the monomeric structure. Notable structural
features are labeled: Nt-hp (N terminal hairpin); PS1 (pre-sensor 1), EXT
(external hairpin), PH3-lp (pre-helix 3 loop), P-hel (P-loop helix), P-lp (P-loop),
H2I (helix-2 insert), ACL (allosteric communication loop). The ATP binding pocket
is marked with a red asterisk.

69

Figure 4.2 Comparison of filament formation and supercoiling of circular plasmid
DNA by WT MCM and the α5-linker mutant. (a) WT ssoMCM filament on circular
plasmid dsDNA forms the large filament structure (~175Å wide) and induces heavy
supercoils. (b) WT ssoMCM forms a filament on a 1,000 bp linear dsDNA, which has a
diameter of ~175 Å, and a length around ~120 nm, much shorter than that of a 1,000 bp
linear B-form dsDNA (340 nm). (c) α5-linker mutant forms a narrower filament (~125 Å
wide) on circular plasmid DNA, which shows little supercoiling compared with WT. The
result is consistent with what is shown in Fig. 4.3A,B. (d) α5-linker mutant forms a
narrow filament (~125 Å wide) on a 1,000 bp linear dsDNA. The length is ~331 nm,
close to that of a 1,000 bp B-form DNA. All scale bars (black) are 50 nm.

A prior EM study reported a very thin right-handed helical filament a different
archaeal MCM (mtMCM)(Chen, Yu et al. 2005). We were unable to detect any thin
right-handed filament forms by EM, either in ssoMCM or mtMCM, in varying buffer
conditions, with or without DNA or added nucleotides (references (Chong, Mahbubani et
al. 1995; Aparicio, Weinstein et al. 1997), and unpublished results). However, large
filaments of mtMCM with dimensions and features matching our structure here was
70
reported in a supplemental information previously(Costa, van Duinen et al. 2008). Also, a
report for a left-handed open ring structure for Mcm2-7 was published just as we are
preparing this manuscript(Lyubimov, Costa et al. 2012), providing another example of a
left-handed lock-washer (with filament arrangement) open ring for MCM protein.

Figure 4.3 Models illustrating how dsDNA (red)
binds inside the wide and narrow filaments. (a)
Model showing how dsDNA binds to the electro-positive
surface inside the 175Å wide filament in a helical
manner. (b) Model showing how dsDNA threads
through the 125Å narrow filament in a straight manner.

71

Figure 4.4 Electron tomography and TEM imaging of MCM-dsDNA filament. (a)
Side by side comparison of the MCM filament crystal structure and ET reconstruction.
The crystal structure is filtered to 8Å (left) and a central slice of 11 Å thick from the ET
reconstruction is shown to the right. Note, the shadow in the EM image makes it to
appear wider. The superimposition of the crystal structure over the ET reconstruction
image shows a well-matched groove dimension and handedness (see S-Movie 1). (b) An
ET reconstruction of MCM filament showing DNA protruding from the ends (also see S-
Movie 2 for views of different sections). (c) Electron micrograph of wild type filament on
1,000 bp linear dsDNA, forming a filament with 175Å thickness, but a small fraction of it
(bracket) showing filament with similar thickness obtained from a mutant shown in panel
d. (d) Electron micrograph of α5-linker mutant on 1,000 bp linear dsDNA, forming a
filament with 125Å thickness. Black scale bars are 500Å.

72

The structure of the MCM monomer in the filament (Fig. 4.1D) consists of the N-
terminal domain (containing A, B, and C sub-domains) and the C-terminal domain
(containing AAA+, helix-5, and α-subdomains), joined by a long connecting linker (N-C
linker). Despite a similar overall core fold, this structure has some obvious
conformational differences from the previously published model (3F9V (Brewster, Wang
et al. 2008)) in the N- and C-terminal domains, as reflected by an r.m.s.d of 2.5 Å
2
for the
superimposition of the two structures. Compared to the previous structure, the C-terminal
domain is rotated ~17° about the N-C linker and swung away from the central channel.
Within the C-terminal domain, an alpha helix (helix 5, Fig. 4.2A) is rotated 90
o
to take a
different position and orientation. At the N-terminus, the zinc bearing B sub-domain is
shifted in position, revealing a structural flexibility about the β-sheet bridging the B- and
C-subdomains
8,
(Brewster, Wang et al. 2008). Within the N-terminal half, another
noteworthy difference is that the long N-terminal hairpin (Nt-hp) of the structure from the
filament has a large shift to point in a different direction (Fig. 4.5A), generating a
spiraling charged surface differing from that of a hexamer (Fig. 4.5B). The new
conformations of these structural elements in the N and C-terminal halves appear to be
important for contacts in filament formation, as discussed below.

73

Figure 4.5 The N-terminal domain structural alignment, and the DNA topology
change induced by MCM. (a) Alignment of MCM N-terminal structures, showing the
conformational change for the Nt-hp in the filament structure (green), with its Nt-hp
pointing to a different direction to make contact with a neighboring subunit. Monomeric
FL-ssoMCM in yellow (3F9V), N-ssoMCM in orange (2VL6), N-mtMCM in purple
(1LTL). (b) Electrostatic patterning of ssoMCM filament (5 subunits) compared to
electrostatics of a hexamers of the N-terminal ssoMCM. The Nt-hp conformation in the
filament structure makes an electro-positive surface (blue surface) to be naturally
following the spiral path in the filament. The Orange objects represent the DNA with the
expected DNA binding orientation on the filament or the hexamer. (c) DNA topology
footprint with MCM, showing more negative supercoiling of DNA induced by increasing
amount of MCM. Lane 1: Negatively supercoiled pBR233 plasmid; lane 2: Relaxed
(nicked by topoisomerase) plasmid DNA, and lanes 3-9: relaxed plasmid DNA incubated
with increasing concentrations of MCM. OC = open circle, (-)SC = negative supercoiling.
Lk = linker number. Note, lane 6 is the reaction under which the available MCM would
completely coat the entire plasmid DNA, as calculated based on the filament crystal
structure where every 10 MCM subunits will cover approximately 122 bp DNA in A-
form.

74
4.2.2 dsDNA Binds Within The MCM Filament Channel
Although 61 bp dsDNA was present in the crystals (data not shown) only broken
and uninterpretable density was seen within the central channel. To ascertain the location
of dsDNA in the filament we visualized MCM preparations using electron tomography.
dsDNA was detected protruding from both ends of the filament channel in EM
tomographs, indicating dsDNA binds within the central channel (Fig. 4.4B)).
Electrostatic analysis of the crystal structure supported this conclusion by revealing a
highly positively charged inner surface (colored blue in Fig. 4.6A-D), forming a
continuous “blue” strip along the filament interior, implicating a role in DNA binding.
Three notable pairs of residues, K246/R247 of one subunit, and R379/ K381 and
K408/R410 of an adjacent subunit, cluster at the subunit interface to form this electro-
positive strip (Fig. 4.6C,D). To confirm that DNA binds this region, we mutated each
residue pair to Ala and assayed their dsDNA binding activity. Purified mutant and WT
proteins behaved similarly in gel filtration at 250 and 50 mM NaCl, indicating no defects
in folding or oligomerization for the mutants. As predicted, K408A/R410A mutant
completely abolished dsDNA binding (Fig. 4.6E). R379A/K381A and K246A/R247A
mutants individually caused slight decrease in dsDNA affinity, and when combined
dsDNA binding was completely abolished (Fig. 4.6E). These results confirm the DNA
binding role for this spiral electro-positive strip on the filament channel surface.
Examination of these mutants by EM revealed only closed or open ring oligomers; no
filaments were detected in the presence of dsDNA (data not shown).

75

Figure 4.6 The strong electro-positive “strip” along the helical filament inner
surface for DNA binding. (a) Spiral positively charged electrostatic pattern (the blue
strip) along the inner wall of the helical MCM filament. (b) End view of the filament
looking down the filament central axis, showing the spiral electrostatic pattern (the blue
strip) down the central channel. (c) A half turn of the filament (5 subunits), showing the
electrostatic potential surface at -1(red mesh) and 1(blue surface) Kt/e. (d) Arrangement
of the six positively charge residues (or three pairs), as labeled on the electro-positive
strip. (e) Mutational effects of residues on the positively charged strip for dsDNA
binding, (ND = none detected). (f) Top down view along the filament channel, showing
the charged solvent accessible surface along the length of one asymmetric unit length (5
subunits). The periodicity between subunits and the total length of the positively charged
surface of one asymmetric unit is indicated. (g) 61 bp A-form dsDNA modeled on to the
electro-positive strip over a path of five subunits of the filament, showing charged protein
surface and matching periodicity of groove spacing.

76

4.2.3 MCM Filament Stabilizes Negative DNA Supercoils
Knowing that the left-handed MCM filament can bind linear dsDNA in packed
crystal and in solution, as shown above, we subsequently used EM to examine MCM
binding to closed circular plasmid dsDNA. The result revealed that the plasmid DNA
coated by WT MCM filaments became heavily supercoiled (Fig. 4.2A), indicating MCM
can induce topological changes to DNA. As a further observation from the crystal
structure, along the left-handed electro-positive strip on the left-handed filament, we
notice that positively charged residue pairs are spaced periodically ~26Å apart, which is
similar to the groove periodicity of A-form DNA (24.6 Å), but quite different from that
of B-form DNA (35 Å) (Fig. 4.6F, G). Although we cannot confirm that A-form DNA is
indeed present due to a lack of electron density in the crystal structure, we used molecular
modeling to position dsDNA on the electo-positive strip of the left-handed filament,
which would result in a transition from B-form to A-form (Fig. 4.6F, G). Such a
transition to A-form requires untwisting (or net negative twist) to the right-handed duplex
DNA, loosening the double-. Such a local loosening of the right-handed double-helix
introduced through binding to the left-handed MCM filament would generate an increase
in supercoiling of a circular plasmid DNA to compensate for the local untwisting of the
duplex.
77

Figure 4.7 Comparison of DNA conformational changes induced by WT and mutant
MCM induced. (a) DNA topology footprint of 5 -linker mutant of MCM, showing
little supercoiling of the circular plasmid DNA was induced by increasing amount of the
mutant MCM. (b) WT MCM topology footprint in the absence of chloroquine, showing
heavily supercoiled DNA conformation induced in higher concentration of MCM. (c)
WT MCM topology footprint in the presence of chloroquine on the gel to verify the
extend of negative supercoils induced by MCM, as chloroquine is known to shift
negatively coiled circular DNA towards the sample wells relative to chloroquine free gels
shown in panel-b. R: negatively supercoiled pBR233 plasmid was nicked by
topoisomerase to become relaxed (R), and lanes 1-7: the relaxed plasmid was incubated
with increasing concentrations of MCM. OC = open circle, (-)SC = negative supercoiling.
Lk = linker number. Note: * (lane 4) marks the reaction under which the available MCM
would completely coat the entire plasmid DNA, as calculated based on the filament
crystal structure where every 10 MCM subunits will cover approximately 122 bp DNA in
A-form.

78
To confirm that MCM indeed generates and stabilizes negative supercoils, we
used a well-established footprint assay to observe changes in DNA topology(Erzberger,
Mott et al. 2006). In this assay, Topoisomerase I (TopoI) was added to plasmid DNA
bound by MCM to nick the DNA backbone and relieve topological stress of supercoils
introduced by MCM binding, allowing DNA to relax into the lowest energy topoisomer
and then stabilized by ligation. MCM and other proteins were then degraded by
proteinase K to isolate the circular DNA with the altered linking number stabilized by
ligation. The results clearly demonstrated that MCM generated the negatively supercoiled
topoisomers of plasmid DNA in a dose-dependent manner (Fig. 4.5 and 4.7 A-C).
The above results were compared to identical footprinting reactions that were
analyzed on agarose gels containing chloroquine, as chloroquine can bind dsDNA and
change the relative mobility of topoisomers depending on the negative or positive
supercoiling, allowing a differentiation between negative and positive supercoiling(Clark
and Leblanc 2009). The result confirmed that changes in DNA topology induced by
MCM were due to a negative change in linking number (-ΔLk) (compare Fig. 4.7B and
4.7C).

4.2.4 MCM Helix α5 Regulates Oligomerization
Spatial alignment of individual AAA+ subdomains with the previously solved ssoMCM
monomer structure(Brewster, Wang et al. 2008) revealed a 90° rotation of α-helix 5 (α5)
(Fig. 4.9A). This rotation aligns α5 to the three helices of the α-subdomain of the
neighboring subunit to form a four helix bundle. Thus, α5 and the α-subdomain form a
stable inter-subunit, four-helix bundle that tie the two neighboring subunits together (Fig.
79
4.9B,C). Linkers flanking α5 (α5-linkers) contain Gly and Pro, which can provide both
the needed flexibility and rigidity for the linkers to facilitate te α5 orienting itself to
interact with the α-subdomain.
Residues at the binding interface between α5 and α-subdomain helices are highly
conserved between archaeal and eukaryotic MCMs, suggesting it is a site essential for
subunit association and communication (Fig. 4.8). We predicted that anchoring of α5 to
the neighboring α-subdomain and the flexibility of the α5-linkers are important for proper
maintenance of inter-subunit association during subunit assembly of filaments and/or
hexamers. To test this we created mutants of the conserved residues on the interface
between α5 and α-subdomain, and of the Gly and Pro on the α5-linker. By gel filtration
chromatography, these MCM mutants eluted as smaller oligomers than the WT
oligomeric form in 250 mM NaCl buffer (Fig. 4.13A), indicating compromised subunit
association. At 50 mM NaCl, even though the linker mutants still eluted as the smaller
oligomeric form, a few mutants reverted to the WT oligomeric size (data not shown),
suggesting different sensitivity to ionic strength of these mutants.

80

Figure 4.8 The structure of two neighboring ssoMCM subunits in the filament
colored by conserved interface. The structure of two neighboring ssoMCM subunits in
the filament, showing the conserved interface on one subunit (drawn in surface structure)
for binding α5 from a neighbor subunit (drawn in ribbon). The degree of conservation on
the surface structure is obtained from sequence alignment of ssoMCM with S. pombe, H.
sapiens, S. cerevisiae, and X. laevis MCM proteins 2-7, and shown by Consurf server
coloring scheme (at the bottom). Red is highly conserved between MCMs and blue is
highly variable. Helix-5 ( α5) docks to a highly conserved region (indicated).

81

Figure 4.9 The helix α5 rotation and its interaction with the α-domain of a
neighboring subunit in the filament. (a) C-domain structural alignment between the
filament monomer (fila-ssoMCM, green) and the previously determined monomer
structure (3F9V, FL-ssoMCM, yellow). Fila-MCM helix-5 (α5) is rotated 90˚ (red)
relative to the FL-ssoMCM α5. (b) α5 (red) of one subunit (mon2) docks on the α-domain
(blue) of a neighboring subunit (mon1), forming a 4-helix bundle between mon1 and
mon2. The EXT hairpin (cyan) is just above the 4-helix bundle. (c) The side-chains (in
stick model) of the critical residues at the interface between α5 and α-domain, as well as
on the α5-linker (yellow).

82
We also considered whether these mutations would affect filament formation. By
EM examination, we found that these mutants either could not form any filaments, or
formed only irregular “broken” filaments (data not shown). However, one α5-linker
mutant, G485P/G501P, exclusively formed stable filaments with diameters of only
~125Å , approximately 50Å narrower than those observed in WT MCM (Fig. 4.4D).
Interestingly, we also found such narrow filaments (but still larger than and different
from the right-handed thin filament reported previously) occasionally coexist with WT
large filaments as well (bracketed portion in Fig. 4.4C). Therefore, we reason that the
G485P/G501P mutation promotes the formation of narrow filaments, which may be an
alternative, less prevalent form of WT MCM.
Unlike the wide filament that can spiral DNA along its helical electropositive
strip, the narrow filament (formed by G485P/G501P) would only have sufficient space in
the central channel to allow DNA to thread straight through the filament, generating little
or no untwisting of the bound double helix, and thus little or no DNA supercoiling will be
induced. Indeed, EM observation of this mutant bound to circular plasmid DNA revealed
virtually no supercoiling (Fig. 4.3C), and DNA topology footprints also demonstrated
that very little supercoiling occurred in narrow filaments of the α5-linker mutant
(G485P/G501P), and in fact relaxed circular plasmids are stabilized (Fig. 4.7A).
We next designed mutants to test the biological relevance of α5 mediated
oligomerization in yeast S. pombe cells. Although sequence is poorly conserved within
the α5 linker region among archaeal and eukaryotic MCMs, we noticed a conserved
residue F540 (Fig. 4.10A) that is on the α-subdomain but at the interface with α5,
suggesting a conserved role regulating α5 interactions for oligomerization.
83

Figure 4.10 Helicase activity of ssoMCM-F540A mutant at the interface between α5
and α-domain. (a) Alignment of S. solfataricus MCM and S. pombe, H. sapiens, S.
cerevisiae, X. laevis and D. melanogaster MCM4 proteins around the F540 region on α7,
one of the three α-domain helices. The residue aligning to ssoMCM F540 is marked by
(*). (b) Helicase activity of ssoMCM-F540A at different protein concentrations, error
bars were derived from 3 separate experiments. (c) F540A helicase activity is ATP
dependent.

84
We made the F540A equivalent mutation in S. pombe mcm4
+
, which is Y751A, to
test the phenotype in vivo (see Methods). We constructed plasmids containing wild type
mcm4
+
or mcm4-Y751A mutant under control of a weakened thiamine-regulated nmt1
+

promoter, and transformed these into yeast strains with either wt mcm4
+
or a temperature
sensitive allele mcm4ts which is not functional at 36˚C.
Transformants were isolated in the presence of thiamine, which represses the
promoter. WT cells expressing mcm4-Y751A mutant were able to form colonies at all
temperatures and at all levels of expression. However, mcm4-Y751A was not able to
complement mcm4ts at 36°C, indicating that the mutant MCM4 is not functional (Table
4.3, Fig. 4.11). Interestingly, mcm4-Y751A is toxic in mcm4ts even at permissive
temperatures when overproduced (minus-thiamine), as shown by very small colony size
or failure to form colonies, compared to wild type MCM4 or the vector control (Fig.
4.11). The cells are elongated, indicating a cell cycle delay or arrest. This phenotype
indicates that an already attenuated protein (mcm4ts, in this case) is outcompeted by a
dominant lethal mutation (mcm4-Y751A) and suggests that the mutant may form incorrect
and non-functional assemblies with cellular MCM. Interestingly, this mutant in ssoMCM
does not form filaments on dsDNA like wild type as determined by EM, but forms ring-
shaped oligomers (data not shown), and retains approximately 60% WT helicase activity
over a wide range of tested concentrations(Fig. 4.10B, C).
4.2.5 N-terminal Hairpin Conformation Supports Filament Electrostatic Surface
The MCM filament N-terminal domain conformation is largely conserved among
MCM crystal structures (Fig. 4.5A). The superimposition of the N-domain with the N-
ssoMCM (2VL6) has an r.m.s.d of 1.097. However, the N-terminal hairpin (Nt-hp) in
85
MCM filaments adopts a position different from that in the N-ssoMCM and N-mtMCM
structures, it shifts away from the N-terminal B-subdomain and towards the allosteric
communication loop (ACL) (Fig. 4.5A). This Nt-hp conformational change allows it to
make contacts with neighboring B subdomain of the next subunit in the filament
formation, which is in contrast to N-domain of the hexamers (2VL6) in which Nt-hps are
pointing into the central channel solvent in a planar array. Furthermore, this shift of the
Nt-hp that carries positively charged residues on it changes the electro-positive surface
layout from the vertical on a hexamer inner surface to a near horizontal spiral on the inner
filament surface, traveling laterally across subunits (Fig. 4.5B, Fig. 4.6A-C).
4.2.6 Filament Lengths Depends On Type Of Filaments Formed On dsDNA
If wide filaments are spiraling DNA inside the channel to transform B-DNA to A-
DNA, the length of the filament on a 1,000 bp DNA should be significantly shorter than
the length in B-DNA (Fig. 4.3). Likewise, if the narrow filaments of α5-linker mutant
bind the DNA straight through the central channel (Fig. 4.3), their lengths should be near
that of a 1,000bp DNA in B-form. To test this, we measured the length of 18 WT
filaments and 13 α5-linker mutant filaments formed on a linear 1,000 bp dsDNA (Table
4.1). The average filament length measured for the mutant was 284 nm (with a maximum
length of 331 nm), which is near the length calculated for an extended linear B-form
DNA (340 nm), indicating that DNA is likely threaded straight through the central
channel. Strikingly, the average length of WT filaments was 103 nm with a maximum
length of 162 nm. This is far less than the calculated 340 nm for straight B-form DNA
(Table 4.1). The lengths are even shorter than the calculated 240 nm for straight A-form
DNA could be partially be accounted to the unstable ends of the wide filaments, leaving
86
portions of the dsDNA uncoated at both ends which could not be visualized. Nonetheless,
these qualitative observations are consistent with dsDNA being spiraled along the central
channel wall in wide filaments seen in the crystal structure, and straight through the
narrow filaments of α5-linker mutant (Fig. 4.3).
4.2.7 In vivo α5-deletion of MCM4 in S. pombe
As helix α5 is critical for filament formation, we also generated an α5-deletion
(Δ α5) mutant by deleting res. 690-704 of MCM4 from S. pombe, to further test its
biological significance in eukaryotic cells in addition to the previously described point
mutation Y751A that disrupts the interactions between α5 and α-domain of a neighboring
subunit (Fig. 4.9C, Fig. 4.8). When the Δ α5 mutant was expressed from the native mcm4
promoter in a plasmid, the mutant was not able to produce colonies following the
transformation with mcm4 ts (F784Y) strain under permissive temperature conditions,
although the same Δ α5 plasmid was able to successfully produce colonies in the wild
type (strain FY261) at all three temperatures tested (data not shown). This indicates that
the deletion mutant exhibits a synthetic dosage lethality phenotype.
When performing the same transformation experiments with the mutant
derivatives expressed by the weakest nmt1 (“81X”) promoter, we were able to
successfully obtain colonies following transformation from both mutation types with wild
type and mcm4 ts under low expression conditions (+thiamine) although the Δ 690-704
mutant still showed relatively smaller colonies in the mcm4ts host. Upon induction of
the promoter (-thiamine), mcm4ts cells expressing either mutant were no longer able to
produce colonies, again indicating a toxic phenotype (Fig. 4.11).
87
Wild type α5-linker mutant
Image # Length (nm) Image # Length (nm)
101 140.35 34 276.46
99 79.57 32 294.68
97 89.84 29 295.85
93 77.42 27 319.48
86 121.27 25 268.36
84 99.42 23 202.15
80 96.69 18 309.59
78 151.75 16 310.26
76 162.45 14 261.49
56 100.59 12 303.48
54-1 121.21 10 331.90
54-2 111.71 3 301.71
46 85.77 2 211.65
33 93.02
29 60.62
25 84.40
17 65.77
13 120.60
Average
Length 103.47
Average
length 283.62

Table 4.1 A survey of the filament lengths of WT MCM and α5-linker mutant
assembled on 1,000 bp dsDNA. Shows significant differences (also see Fig. 4.2). A fully
extended 1,000 bp linear dsDNA is 340 nm in B-form, and is 240 nm in A-form.

88

Figure 4.11 Phenotypes of mutants (mcm4-Y751A) and wild type mcm4 (mcm4
+
)
plasmids transformed in the mcm4 temperature sensitive and in wild type strains.
Candidates were streaked on EMM-URA+ thiamine and - thiamine plates and incubated
at 25ºC, 32ºC and 36ºC for 7 days. The representation is following 5 days of incubation.
Presence of thiamine suppresses the expression WT or mutant MCM protein from the
transformed plasmid. The drawing on the bottom indicates the layout of the six plates
and the six experiments on each plate with particular clones and the cellular mcm4
genetic backgrounds.

89

Figure 4.12 ATP pocket and interface features of MCM filament. A) and B)
show ATP pocket and interface features relative to the filament. C) Nt-hp, H2I,
PS1 and ACL gather a the subunit interface of two monomers (yellow and
green)Based on the nucleotide containing SV40 crystal structure (PDB-ID-
1SVM), we modeled ATP into the MCM P-loop D). MCM residues 335-365 were
aligned to SV40 residues 419-449 with a r.m.s.d of 1.448. R331 points towards
the modeled ATP ribose , suggesting involvement of the EXT-hairpin in ATP
binding/hydrolysis as well as the nucleotide regulation of the MCM filament.

90
4.2.8 Additional Experiments
Important filament contacts
Analysis of ssoMCM filament contacts were surprisingly consistent with those
demonstrated to be essential for ssoMCM hexamerization (Fig A.1) (Brewster, Wang et
al. 2008). This is significant because it necessarily changes the interpretation of
experiments mutationally targeting these regions. Previous results attributed any changes
in oligomerization observed by gel filtration to defects in hexamerization. It now seems
that this may not be a complete assessment.

Filament formation stabilizes dsDNA

Figure 4.13 Thermal stability of DNA bound by MCM. BSA was used as a control.

We suspected that because ssoMCM filaments loosen the duplex of DNA that we would
see a decrease in thermal stability. However, ssoMCM has a substantial stabilizing effect
on dsDNA (Fig C.1). This could be due to the tightness of binding to both strands
91
simultaneously, preventing duplex separation. It is also worth mentioning that S.
Solfataricus is a thermophile, and that the complex may naturally be more stable at high
temperatures.

Addition of Nucleotide alters filament morphology
To determine if the nucleotide affects the MCM filament formation, I added a
non-hydrolizable ATP analog (ADP-AlF
x
) and imaged the complexes by EM. The
micrographs indicated that the addition of ADP-AlF
x
caused the filament to stretch into a
string of connected monomers, presumably on dsDNA (Fig B.1).

Figure 4.14 Micrograph of ssoMCM mixed with nuclotide. 0.22 mg/mg SsoMCM
mixed with 1 ug of 1000bp dsDNA and 5mM AlF
x
in 50 mM NaCl and
20 mM Hepes 6.75.

92
4.3 DISCUSSION
We described here a novel filament structure of an archaeal MCM that exists both
in crystals and in solution. The formation of this large, left-handed filament requires the
presence of dsDNA, which is spiraled along a continuous positively charged surface strip
on the inner wall of the filament. Remarkably, MCM filament is capable of drastically
changing DNA topology. This topology change is resulted from untwisting the bound
dsDNA, changing the local helical parameters of the duplex from B-form to a looser
isoform that should be similar to A-form DNA (Fig. 4.6F,G). Furthermore we find that
the structural features that mediate filament formation and oligomerization are essential
for eukaryotic MCM4 function and subsequent cell survival.
One possible functional implication of the new structural and biochemical data
described here could be that MCM helical complexes bind and untwist DNA at origins to
facilitate strand separation. Similarly, bacterial replication factor DnaA has been reported
to “screw” dsDNA within a right-handed helical filament, in a comparable manner to
RecA, which is thought to catalyze origin DNA melting and replication initiation
(Duderstadt, Chuang et al. 2011). AAA+ family enzymes, including MCM, share a core
fold similar to that of the RecA family of proteins and perform similar functions in DNA
remodeling. The pitch and angle of RecA filament subunits can adjust in response to
ligands such that a change in filament morphology occurs, and RecA and Rad51 (a
eukaryotic RecA homolog) form both right and left handed helical filaments around DNA
to facilitate disruption of the duplex (Chen, Ko et al. 2007; Cox 2007). This suggests a
corollary for the polymorphisms we and others have observed in MCM.
93
The role for MCM filaments in replication initiation would fit well with the
current understanding of pre-RC architecture. The central channel is large enough to
support a replication bubble and allow an MCM ring to clamp down on newly exposed
single stranded DNA. This would also allow the filament to protect ssDNA from
prolonged exposure to the cellular environment. In this case, the ORC would act as a
nucleation point for filament growth (Edwards, Tutter et al. 2002). A modest
conformational change via the α5 (and possibly other structural elements) would allow a
transition of MCM from the filament form to the active conformation of a hexameric
helicase. Interestingly, reconstituted MCM double hexamer assembled on dsDNA shows
no DNA melting (Remus, Beuron et al. 2009). It is possible that MCM is loaded to the
pre-RC as a double hexamer then transitions to a filament to initiate origin melting,
excluding the lagging strand, and then closing back into a ring. However, the process
described by this scenario seems inefficient. Alternatively, the filament and double
hexamer may exist together around origins, partitioning the role of melting and
unwinding. In any case, other replication factors are certainly involved in helicase
activation. It has been shown that GINS and Cdc45 promote a switch from an open “lock
washer” (or helical conformation of Mcm2-7) to a planar ring (Costa, Ilves et al. 2011).
Given our data, it is possible that GINS and Cdc45 assume a role in switching MCM
from a filament to a ring at melted origin DNA. It’s noted that such “lock washer” form
of Mcm2-7 exists in both left-handed and right-handed open ring structures (Costa, Ilves
et al. 2011; Lyubimov, Costa et al. 2012) .
The MCM proteins that associate with unreplicated chromatin regions away from
the origins (the MCM paradox) remain largely uncharacterized. Within the cell, two
94
chromatin bound MCM populations have been described: an “associated” population that
can be removed by high salt, and a “loaded” population that was shown to be origin-DNA
bound hexamers/double hexamers (Edwards, Tutter et al. 2002). The salt sensitive nature
of MCM filaments suggests that they may be categorized as the “associated” population.
Most studies focus on pre-RC assimilated MCM complexes at replication origins,
however a larger portion of MCM proteins is distributed over a wide ranges of
unreplicated chromatin and distal to replication origins (Kuipers, Stasevich et al. 2011).
The filament form of MCM may partially account for those MCMs associated with
chromatin regions away from the origins, offering a plausible explanation for “the MCM
paradox” phenomenon.
Evidence suggests that MCMs (likely the origin distal MCM population) are
involved in additional functions outside genome replication, such as transcription,
chromatin remodeling and tumor suppression (reviewed in (Forsburg 2004)). MCM
proteins also have a strong affinity for histone subunits, supporting the general
connection between MCM and chromatin architecture (Ishimi, Ichinose et al. 1996;
Ishimi, Komamura-Kohno et al. 2001).
MCM’s capability of mediating DNA topology suggests a common mechanism
that could be utilized to regulate the diverse array of biological processes (such as
replication, chromatin remodeling, transcription) associated with MCMs(Forsburg 2004).
Untwisting of dsDNA bound by MCM filaments would also lead to supercoiling of distal,
unbound dsDNA. Such supercoiling of distal DNA would likely influence chromosome
structure, regulating gene expression and DNA metabolism. A more detailed
95
structure/function understanding paired with further in vivo data will be required to
resolve these exciting possibilities.
Data accession: The atomic model reported here has been deposited to the Protein Data
Bank under the accession number 4FDG.
Acknowledgements: We thank the staff of USC NanoBiophysics core and the staff at
synchrotron beamlines 23ID and 19ID at Argonne National laboratory, and 5.0.2, 8.2.1,
8.3.1 beamlines at Berkeley’s ALS for assistance with data collection. We are grateful to
Pavel Alfone, Nat Echols of PHENIX group, and Axel Brunger for early access to the
program DEN (imbedded in CNS 1.3) designed for low resolution refinement, Lauren
Holden and Jared Peace for critical discussion and manuscript proofing and Lawrence
Lee for helpful discussion. This work is supported by NIH grant GM080338 and
AI055926 to X.S.C, GM071940 to Z.H.Z, and GM GM059321 to S.F.

4.4 Experimental Procedures
ssoMCM Cloning
Wild type (wt) full length S. solfataricus MCM containing residues 1-686 cloned
as His-tagged fusion proteins in vectors pGEX-6P-1. Mutants of MCM were made using
either Quikchange or PIPE(Klock and Lesley 2009) and expressed. Protein was expressed
as previously described (Brewster, Wang et al. 2008).

96
MCM Purification
Full length wt and mutant MCM proteins were purified from E. coli grown at
25°C for 18 hours. Cells were lysed by French-press and centrifuged at 10,000 rpm for 1
hour. Supernatant was passed over nickel resin and washed with 10 column volumes of
high salt Buffer A (1M NaCl, 50 mM HEPES pH 7.5). MCM was eluted with 5 column
volumes of Buffer A supplemented with 250mM imidazole. Eluted MCM fractions were
diluted or dialized to 100mM NaCl and passed over a Resource Q column. MCM was
eluted from the Resource Q by a 10 column volume salt gradient from 50mM to 500mM
NaCl. Resource Q fractions were diluted to 100mM NaCl and passed over a heparin
column. MCM was eluted from the column with a 50mM to 1000mM NaCl linear
gradient. Heparin fractions were collected, concentrated to 1 mL and purified by 2-3
passes over a Superdex 200 column in high salt buffer (2M NaCl, 20 mM HEPES pH 7.5,
2 mM DTT) until satisfactory purity was achieved. Superdex 200 fractions were
concentrated to 30-50 mg/ml and flash-frozen in liquid nitrogen. 2M NaCl was used to
force MCM to stay in a monomeric state.
Crystallization and Structure Determination
To assemble a homogeneous complex, MCM (50 mg/ml) was initially incubated
with a 61 bp dsDNA with a 3` T overhangs on each strand and dialyzed from 2M NaCl to
50 mM overnight at 4 °C. The final crystal form used to solve the structure was grown
from protein alone dialyzed overnight, with the same 61 bp DNA added immediately
before crystallization. DNA strands for annealing into the 61 bp dsDNA
(strand1:tagctattagagcttggtttaattatacaaactcaatatttttcttttttccttcctttat,
strand2:tatcgataatctcgaaccaaattaatatgtttgagttataaaaagaaaaaagaaggaaat) were purchased
97
from Operon and each strand was purified using a MonoQ column (GE), annealed
overnight, and further purified on an Superdex 200 gel filtration column (GE). The
annealed 61 bp dsDNA was incubated with MCM for 30 min before setting up
crystallization trays. Hanging drop crystal trays were set up at 4 °C. Small but long
needle crystals grew to dimensions of ~30x40x200 microns at 4 °C in 2 µl drops with
ratios of 1 – 1.5 µl MCM to 1-0.5 µl of crystallization buffer (7.5% isopropanol, 420 mM
NaSO
4
, and 20 mM HEPES pH 6.75). Crystals were harvested, cryoprotected in 420mM
LiSO4, 25% PEG 400, 25mM HEPES pH 6.75 and flash frozen in liquid nitrogen. Data
was collected at APS beamline GMCA/CAT 23-ID-B (and 19-ID) using the 5 micron
microbeam vectored over the length of the crystal needles.
Diffraction spots were detected up to 3.8 Å with 30 sec exposure at 23-ID-B, an
exposure time that essentially kills the crystal diffraction. As a result, we used a
combination of short exposure time, microbeam, translations along the needle crystals,
and multiple crystals to collect data sufficient for obtaining the highest resolution data set
to 4.29Å. Further optimization led to crystals resistant to radiation damage, and the 4.29Å
structure was refined using this data to 4.1Å (Table 4.2). The crystal is in space group
p21, with five subunits per asymmetric unit.

98

Table 4.2 Crystallization Statistics for Right Handed Helical Filament of MCM.

99

Figure 4.15 Examples of electron density and statistics from the validation program
Polygon. Samples of electron density map sections. (a, b, c) Three sections of 2Fo-Fc
map that show the electron density for the main-chain and side-chain features. (d)
Validation graphic of the final structure generated from Polygon program using Phenix.

The structure was determined by molecular replacement using 3F9V with loops
trimmed off as a search model using the Phaser program in the Phenix suite(Adams,
Afonine et al. 2010). R-free flags (5%) were set at this point and communicated between
Phenix and CNS as needed. The initial model was rebuilt as a polyalanine structure in
Coot with reiterative rounds of solvent flipping and solvent flattening using CNS, density
modification and 5-fold NCS averaging from the CCP4 suite or CNS. Once the main
chain was properly placed, side chains were added and refined using CNS 1.3 DEN low
resolution refinement strategies(Schroder, Levitt et al. 2010). The reference model for
DEN restraints was a hybrid of the N-terminal ssoMCM and homology model of
mkaMCM threaded through 3F9V. The DEN refinement improved the phases at this
resolution, as evident by the improved density and correct side-chain positioning, which
100
is the case for the refinement of another large complex structure(Zhou, Arnett et al.
2012). After DEN refinement, the model was further rebuilt by reiterative rounds of
density modification in CNS and model building in Coot using B-factor sharpening and
Density Modification in CNS (Brunger 2007). Further model improvements were made
using phenix.refine in Phenix version 1.7.2-863(Adams, Afonine et al. 2010). 5-fold
NCS restraints were imposed at all stages. Final refinements with geometry restraints
were done using Refmac and phenix.refine imposing secondary structure restraints, TLS
restraints, Ramachandaran restraints, and 5-fold NCS to a final model R-work/R-free
34.38/35.25 and Ramachandaran statistics 85.3% in the most favored and 0.8% outliers.
Identical set of reflections were used for R-free at all stages of refinement (Table 4.2).
Once the model was refined satisfactorily, validation and final statistics were acquired
using Molprobity server (http://molprobity.biochem.duke.edu/ ) and phenix.validate
(Adams, Afonine et al. 2010) (Fig. 4.12). Our structure fell into the 83
rd
percentile among
structures from 3.25Å to 4.36Å resolution with 0 bad bonds, 0 bad angles, and excellent
statistics among structures of similar resolution. N-terminal residues 1-6 are not included
in the structure as no density was seen. Density for the flexible C-terminal 88 residue
wing-helix domain of ssoMCM was also not visible and thus the final model contains
residues 7-598 for each of the five subunits in the asymmetric unit or half of one helical
turn. Although broken density was observed within the central channel, we were unable
to build a model for dsDNA into the filament.
Transmission Electron Microscopy (TEM) and Electron Tomography
Negatively stained samples were prepared by placing a small drop (~4 μl) of
sample solution onto a glow-discharged carbon-coated copper grid. 200-mesh and
101
100/400 slotted grids were used for TEM and electron tomography, respectively. After a
period of one minute at room temperature, the sample was blotted and a drop of 2.5%
uranyl acetate solution was immediately placed on the grid. After staining for one minute
the drop was blotted off, the grid was washed four times with the same stain solution, and
then allowed to air dry.
The stained samples were visualized with an FEI Tecnai F20 transmission
electron microscope with an accelerating voltage of 200 kV. The samples were imaged at
50,000x to 100,000x with an underfocus value of 3 μm. Tomography tilt series were
taken using the FEI Batch Tomography software with a tilt range from -70
o
to +70
o
. The
tilt series were recorded on a 16 megapixel TVIPS CCD camera.
Alignment of the tilt series was performed using the etomo tomography
processing software from the Imod package(Kremer, Mastronarde et al. 1996). The steps
included removing X-ray hot spots, rough alignment by cross-correlation, and fine
alignment by patch tracking. The aligned tilt series were then used to make 3D
reconstructions using GPU-based SIRT (Simultaneous Iterative Reconstruction
Technique) reconstruction implemented in Inspect3D (FEI). Slices from the 3D
tomography maps were displayed using the slicer tool within the 3dmod program of the
Imod package. Amira (Visage Imaging GmbH, http://www.amira.com/) was used to
segment and to create volume renderings of the 3D density maps of the filaments.
Consurf and Alignments
Conserved region alignments and coloring were done through the conserf server
(http://consurftest.tau.ac.il/)(Glaser, Rosenberg et al. 2005; Ashkenazy, Erez et al. 2010).
Multiple protein alignments were done with the ClustalW server
102
(http://www.ebi.ac.uk/Tools/msa/clustalw2/)(Thompson, Higgins et al. 1994; Larkin,
Blackshields et al. 2007).
MCM DNA Binding Assays
A range of concentrations of purified MCM protein was incubated with 0.2uM
61bp dsDNA in binding buffer (10mM Tris pH 8.0, 50mM NaCl) at room temperature
for 30min. 10ul reactions with 5% glycerol were electrophoresed (in 0.5% agarose,
0.5xTBE) at 90V for 40min. After electrophoresis, gels were stained in ethidium bromide
and visualized under UV light.
Oligomerisation
Purified MCM and MCM mutants were dialyzed in a buffer containing 10mM
HEPES pH 7.5, 50mM NaCl, 2mM DTT. 500ug protein in 100ul was analyzed by gel
filtration chromatography on an analytical Superose 6 column at 4 °C in a buffer
containing 10mM HEPES pH 7.5, 250mM or 50mM NaCl and 2mM DTT.

103

Figure 4.16 Gel filtration (Superose-6) chromatography assay of MCM mutants,
with molecular marker elution profile shown in panel-c at the bottom. (a) Gel filtration
profiles of ssoMCM WT and mutants containing mutations on the α5-linker (Gly or Pro)
and at the interface between α5 and α-domain of two neighboring subunits at 250 mM
NaCl. The results reveal that all these mutants behave differently from WT in
oligomerization. WT profile is indicated by *. (b) Gel filtration profiles of MCM WT
and mutants containing mutations on the electro-positive DNA binding strip, showing
these mutants behave similarly as WT in oligomerisation. The buffer contains 250 mM
NaCl. (c) Elution profile of molecular markers

104
Helicase Assays
Helicase assays were performed as previously described(Brewster, Slaymaker et
al. 2010).
Electrostatics
Electrostatics were calculated using the APBS plug-in as part of the Pymol 1.4
(Unni, Huang et al. 2011).
DNA Topology Footprints
MCM was dialyzed into buffer containing 50 mM NaCl and 10 mM Tris 8 and
diluted to 6 mg/ml. A 15 ul reaction solution containing 500 ng of plasmid DNA
(pBR233, New England Biolabs) and MCM was incubated at room temperature for 30
min. 5 units of E. coli topoisomerase 1 were added to the reaction and incubated for 3
hours at 37˚C. 25 mM EDTA and 5% SDS were added to stop the reaction which was
then deproteinated by addition of proteinase K. Samples were run on a 1% agarose gel
either with or without 1.4 ug/ml of the intercalator chloroquine added.
Yeast Plasmid and Mutation Construction:
Nucleotide changes to introduce the point mutation and the internal deletion were
created using the Phusion site directed mutagenesis kit (New England Biolabs) following
the manufacturer’s instructions. The constructs were sequenced (Laragen and Genewiz)
to confirm the presence of the mutation and to confirm that PCR mutagenesis did not
introduce additional mutations.

105

Plasmid
Wild Type
+ thiamine
Wild Type
- thiamine
mcm4ts L238P
+ thiamine
mcm4ts L238P
- thiamine
pNR29 (mcm4
+
) + + + +
pSLF372 (vector) + + + +
pNR30 mcm4-
Y751A-HA
+ + + +/-
pNR31mcm4-
Δ690-704 ( Δ α5)
+ + - -

Table 4.3. Complementation data at permissive temperature 32
0
C in S. pombe. The
wt and mutant MCM4 expressed in the plasmids is driven under an attenuated nmt
promoter that is only induced in the absence of thiamine.

Yeast Strains and Manipulations:
Fission yeast strains used for the study were grown in yeast extract plus
supplements (YES) or in Edinburgh minimal medium (EMM) with appropriate
supplements. In this work wild type strain refers to FY 261 (h+ can1-1 leu1-32 ade6-
M216 ura4-D18) and mcm4 ts refers to FY 784 (h+ cdc21-M68 ura4-D18 leu1-32 ade6-
M210 can1-1).
Yeast plasmids used for this work are derived from REP82X and contain a ura4+
marker, the weakest nmt promoter and a HA tag at the C terminus. pNR29 served as the
wild type ( positive control) whereas pSLF372 served as the vector only (negative
control). Transformations were carried out by electroporation and candidates were
selected on EMM media lacking uracil, which also contained 15µm thiamine for full
106
repression of the nmt promoter. Plates were allowed to grow at 25 ˚C for ~ 7 days
following the transformation or until colonies were visible.
Once colonies were present complementation analyses of wild type and mcm4
temperature sensitive strains were carried out by streaking six independent colonies from
each transformation on EMM media lacking uracil, supplemented with 15 µM thiamine,
and incubated at 25ºC, 32 ºC and 36 ºC for seven days. Plates were scanned on day 3, 5
and 7. The represented figures are following 5 days of incubation at the designated
temperatures.

107
CHAPTER 5

1.8 Å Crystal Structure of the N-terminal Domain
of an Archaeal MCM

Reproduced with permission by Yang Fu, Ian M. Slaymaker, Ganggang Wang and
Xiaojiang Chen. 2013. (Manuscript submitted)

Contributions: Y.F. wrote manuscript, G.W. purified and crystalized tapMCM, I.M.S
solved the structure and X.S.C supervised the project.

5.1 Introduction
Mini-Chromosome Maintenance (MCM) proteins are the replicative helicases
for chromosome duplication in both eukarya and archaea.(reviewed in (Grabowski and
Kelman 2003; Forsburg 2004)). MCM complexes initiate DNA replication and unwind
double stranded DNA into single stranded substrate for DNA primases and
polymerases(Forsburg 2004). In eukaryotes, the MCM complex consists of six
homologous subunits, Mcm2-7, which forms a ring-shaped hetero hexamer(Wyrick,
Aparicio et al. 2001; Forsburg 2004). In G1 phase, the origin recognition complex (ORC)
binds to origin DNA and recruits the helicase loading factor CDC6 (Dutta and Bell
1997). Cdt1 binds the free hexameric MCM complex and facilitates its loading to an
origin by binding to CDC6 (Kelly and Brown 2000; Bell 2002; Bell and Dutta 2002). At
this stage, MCM is bound to the origin as a catalytically inactive double hexamer
(Bowers, Randell et al. 2004; Evrin, Clarke et al. 2009; Remus, Beuron et al. 2009). After
additional factors are recruited to the origin, cells enter the S-phase. MCM is activated
by GINS and Cdc45, which together form a stable complex to unwind DNA at the
108
replication forks (Ishimi 1997; Moyer, Lewis et al. 2006; Bochman and Schwacha 2008;
Ilves, Petojevic et al. 2010). Evidence suggests that MCM is essential for
both initiation and elongation during replication, (Aparicio, Weinstein et al. 1997) and
that the malfunction of MCM is linked to disease and cancer(Freeman, Morris et al.
1999).
The six homologous MCM subunits belongs to the ATPase associated with
various cellular activities (AAA+) family (Erzberger and Berger 2006). MCM contains
three domains: an N-terminal domain, an AAA+ domain, and a C-terminal domain
(Brewster, Wang et al. 2008) The N-terminal domain is known to play roles in DNA
binding, protein polymerization and processivity of the helicase, while the AAA+ domain
is responsible for ATPase function and DNA unwinding (Fletcher, Bishop et al. 2003;
Barry, McGeoch et al. 2007). The small C-terminal domain is predicted to have a helix-
turn-helix motif that may play a role in double stranded DNA stimulated ATPase activity
(Jenkinson and Chong 2006). Compared to eukarya, most archaeal genomes only have
one MCM gene, which is conserved in both sequence and function with its eukaryotic
counterparts (Sakakibara, Kelman et al. 2009). Thus, archaeal MCM is a simpler and
more thermo-stable homologue of Mcm2-7, making it a good model system for studying
replicative DNA helicases.
Current studies of archaeal MCM indicate that they can form double hexamers,
hexamers, heptamers, and filaments (Yu, VanLoock et al. 2002; Fletcher, Bishop et al.
2003; Pape, Meka et al. 2003; Chen, Yu et al. 2005; Fletcher, Shen et al. 2005; Gomez-
Llorente, Fletcher et al. 2005; Brewster, Wang et al. 2008; Evrin, Clarke et al. 2009;
Remus, Beuron et al. 2009; Slaymaker, Fu et al. 2013). Available evidence suggest that,
109
after origin melting, the double hexamer can separate into two single hexamers, and
each may translocate on a single DNA strand to unwind DNA in a strand exclusive
manner (Fletcher, Shen et al. 2005; Brewster and Chen 2010; Fu, Yardimci et al. 2011;
Gambus, Khoudoli et al. 2011; Graham, Schauer et al. 2011). However, the mechanism
by which MCM loads to origin dsDNA, melts the origin, transitions from a melted origin
to two viable replication forks, and unwinds DNA during replication remains unclear. It
is a reasonable assumption that the conformation of MCM must be dynamic so that the
hexameric ring can open and reclose to bind dsDNA or ssDNA as required at different
stages of replication.
Here, we report a 1.8 Å crystal structure of the N-terminal domain of MCM from
the archaeon thermoplasma acidophilum (tapMCM). This high-resolution structure
reveals that the tapMCM N-terminus forms a right-handed filament with six subunits per
turn. The inner channel of the filament is highly positively charged, with a diameter of 25
Å that can accommodate ssDNA or dsDNA. This structure suggests an open ring
structure for the MCM and provides insights on the dynamic conformations MCM must
adopt to perform its function.
4.2 Results
5.2.1 Overall structure
The full-length tapMCM purified from E.coli was used for crystallization. However,
proteolysis occurred in the crystallization drops that yielded crystals containing only the
N-terminal half (residues 6-262) of the protein. Neither the full-length nor the degraded
AAA+ and C-terminal domains formed any crystals in the drop. We solved the crystal
structure of the N-terminal domain, which shows a right-handed filament that has six
110
subunits per turn (Fig. 5.1A) (Table. 5.1). The six subunits in the filament form a
lockwasher-shaped open ring (Fig.5.1 B,C). The inner channel wall is made up of β-
strands, with N-terminal hairpins (N-hp) pointing to the central channel. The outer layer
of the filament is made of α-helices. The width of the filament is 115 Å. Along the
filament axis, the subunits are organized like a 6-fold symmetric ring (Fig. 5.1B). The
radius of the central channel of the ring is 25 Å, which is sufficient for encircling
ssDNA or dsDNA.
5.2.2 Subunit structure
The N-terminal fragment of tapMCM assembles into three sub-domains: A, B,
and C (Fig. 5.2A,B). When compared with the hexameric ring structure of the previously
reported N-terminal regions of Methanobacterium thermoautotrophicum (mt)MCM and
Sulfolobus solfataricus (sso) MCM (Fletcher, Bishop et al. 2003; Brewster, Wang et al.
2008; Liu, Pucci et al. 2008; Slaymaker, Fu et al. 2013), tapMCM has a unique 3
10
-helix
insertion at the zinc binding motif (Fig. 5.2C), which is not present in any of the known
structures of MCM. Interestingly, this 3
10
-helix insertion is highly positively charged
containing amino acid sequence -RGKDK- and protrudes into the inner channel, which
may help stabilize DNA interactions inside the central channel. Subdomain C connects
subdomain B (Fig. 5.2 A,B). It has five β-strands which are coiled to form an
oligonucleotide/oligosaccharide binding (OB) fold and an N-hp that has been reported to
play a role in DNA binding.(Fletcher, Bishop et al. 2003; McGeoch, Trakselis et al. 2005;
Fletcher, Shen et al. 2008; Slaymaker and Chen 2012)

111

Figure 5.1 The overall structure of N-tapMCM. (a) The side view of the right-handed
filament structure of N-tapMCM that contains six subunits per helical turn. (b) Top view
of the six subunits in one helical turn in a lock washer conformation, with each subunit
colored differently. There is a gap between the first molecule (violet) and the last
molecule (green) in this open ring structure. (c) Side view of panel b rotated by 90˚.

112

Figure 5.2 The detailed structure of N-tapMCM subunit. (a, b) Ribbon model
of the N-tapMCM subunit structure, with the secondary structure labeled. There
are three domains (A, B, and C) colored in violet, yellow and green. (c) Zinc
motif in domain B. The Zinc atom is denoted by a yellow sphere. The four
cysteines are labeled and showed by sticks. The 3
10
-helix insert is labeled.

113

Figure 5.3. Structure of two subunits (colored by green and violet) of N-tapMCM
from the filament conformation. (a,b) Showing the view of the dimer from inside the
filament channel, and (c, d) showing the dimer viewing from outside the filament
channel. The interactions mediated through the N-hp (N-terminal hairpin) are drawn and
highlighted, with the residues involved in the interactions showen by sticks. The
hydrogen bonds are showed by red dash. The interactions are mainly through main chain
hydrogen bonds, except for D188 that is well conserved among other MCM and also
shown to play a role in hexamer formation(Brewster, Wang et al. 2008).

114
5.3 Subunit interactions
The interaction between subunits in the filament is mainly through subdomains B
and C, with the helical domain A projecting away from the channel in a radial fashion
(Fig. 5.1B and Fig. 5.3A,C). The N-hp of domain B in one subunit within the filament
interacts with a β-strand and a loop in the subdomain C of a neighboring subunit (Fig. 5.3
A,B). This interaction is mainly through hydrogen bonds forming between the main chain
atoms of the involved residues. Additionally, a nearby 3
10
-helix in the subdomain C
interacts with the β-strand 5 in a neighboring subunit (Fig. 5.3B), and the only residue
involved in side chain interactions is Asp188 (Fig. 5.3D), a well conserved residue
among MCM proteins. Mutating this conserved Asp to Arg in ssoMCM disrupts
multimerization, (Brewster, Wang et al. 2008) indicating its involvement in intersubunit
interactions.
5.4 Positively charged surface for DNA binding
Analysis of the electrostatics of this structure indicates that the inner channel is
highly positively charged (Fig. 5.4 A,B). The positive charge comes from residues
located in two regions: the N-hp and the 3
10
-helix insert that is uniquely observed in
tapMCM (Fig.5.4 C). The N-hp from each monomer points into the central channel. This
hairpin has been reported to be the DNA binding site of the N-terminal MCM (Fletcher,
Bishop et al. 2003; McGeoch, Trakselis et al. 2005; Fletcher, Shen et al. 2008). In our
structure, part of the hairpin is composed of basic residues (Fig. 5.4 C). In addition,
the unique 3
10
-helix of tapMCM and a loop in the zinc finger domain also contribute to
the positively charged region. Since the width of inner channel is about 25 Å, it can
115
accommodate ssDNA or dsDNA. In addition, the right-handedness of this structure is the
same as that of the helical dsDNA. We made a model of six subunits binding to a B-form
dsDNA (Fig. 5.4 D,E), four of the six N-hps in one turn could bind to the major groove.
The helix pitch of the N-terminal filament is longer than that of the standard B-form
DNA, so the N-hp perfectly does not follow the major groove of the B-form DNA
perfectly. But with a slight stretch of the dsDNA, a better fitting of the N-hp into the
major groove could be achieved.

Figure 5.4. Electrostatics on the surface of N-tapMCM and the DNA binding model.
(a, b) Electrostatic pattern of the structure of a hexameric turn. The positive surface are
colored by blue and the negative by red. The electro-positive surface on the inner channel
surface indicates its DNA binding. (c) The basic residues responsible for the positive
charge surface in the inner channel (shown by sticks). Most of these basic residues are
from the N-hp and a 3
10
-helix insert in the zinc finger domain. (d, e) A B-form DNA
model into the central channel of the hexameric lock washer structure. Four of the six N-
hps in the hexamer model can bind to the major groove of dsDNA. Better fitting of the
entire six subunits requires DNA deformation by stretching the dsDNA.

116
5.5 Structural comparison
The monomer structure of N-terminal tapMCM folds into a similar manner as a
previously published N-terminal mtMCM structure does,(Fletcher, Bishop et al. 2003)
with an RMSD of 1.411 Å
2
for the superimposition of the two structures (Fig. 5.5 A).
They both belong to Euryarchaea and share approximately 30% sequence identity. Unlike
our filament structure, the N-terminal mtMCM forms a double hexamer. Comparing the
monomer structures of the two types of MCMs, one of the two major differences is that
domain A of tapMCM has a loop insertion (Fig. 5.5B), which allows tapMCM domain A
to contact domain B directly through this loop. Since the exact function of domain A is
still unknown, the functional role of this loop insertion is unclear. The second major
difference is the 3
10
-helix insertion in the zinc finger domain that was previously
discussed (Fig. 5.5C). This 3
10
-helix insertion points toward the central channel with
positively charged residues that may help stabilize DNA binding.
5.6 The role of N-terminal hairpins in oligomerization
By aligning the dimer from the double hexamer of N-mtMCM with the dimer
from the filament of tapMCM reported here, we found that the position of the N-hp
of tapMCM in the filament is shifted up toward the N-terminus, which allows the N-hp of
tapMCM to make contacts with a loop in the zinc motif of the neighboring subunit (Fig.
5.5D). This bonding contacts between subunits established by adopting a Nt-hp
conformation different from that in the closed hexameric ring suggests that they may be
important for the spiral filament conformation. Interestingly, in contrast to the upward
shift of the N-hp of tapMCM in this right-handed filament, the N-hp of the ssoMCM
117
shifts downward in the left-handed filament structure (Slaymaker, Fu et al. 2013) when
compared with a N-terminal ssoMCM hexamer structure (Fig. 5.5 E). These three
different conformations of N-hp observed in the three types of oligomers (right-handed
filament, hexamer ring, and left-handed filament) suggest that the N-hp conformation
may play a role in regulating conformations of MCM oligomers. It is worth pointing out
that β8-strand in N-hp is directly connected with the AAA+ motor domain,(Brewster,
Wang et al. 2008) which allows the conformational changes of N-hp to be coupled to
ATP binding and hydrolysis, providing a structural means of regulating conformation.
5.7 Full-length tapMCM model
The C-terminal AAA+ domain is not present in our structure. Full-length
tapMCM has been shown to form hexamers in solution (Haugland, Shin et al. 2006) and
N-terminal tapMCM is involved in oligomerization (Haugland, Rollor et al. 2009). In this
N-tapMCM filament structure, one turn consists of six subunits and forms an open ring.
We want to see if such an hexameric open ring of the N-tapMCM can accommodate the
missing AAA+ domain in the full-length tapMCM. Using the AAA+ containing near full-
length ssoMCM monomer structure (Brewster, Wang et al. 2008) to align into the N-
tapMCM open ring structure, we noticed that there are some minor clashes between
subunits in the AAA+ domain. However, the AAA+ domain connects to the domain-
tapMCM by a flexible N-C linker that can easily allow the adjustment of the positions of
the AAA+ domain to avoid clashes. The conformation of the docked full length model is
like a lock washer (Fig. 5.6 A,B), which is similar to the previously reported structure for
eukaryotic MCM (Costa, Ilves et al. 2011; Lyubimov, Costa et al. 2012).
118

Figure 5.5 Comparison between known MCM structures. (a) Alignment of N-
tapMCM from the filament structure and N-mtMCM from the hexamer structure, with an
RMSD of 1.411 Å
2
. The detailed differences discussed in the text are shown in panels b-
e. (b) The difference in domain A. In tapMCM structure, a long loop insertion in domain
A makes direct contact with domain B. (c) The unique 3
10
-helix insertion in Zinc finger
domain in the N-tapMCM. (d) The shifted Nt-hp in N-tapMCM. When a dimer from the
filament (right-handed) of N-tapMCM are aligned to a dimer from the hexamer of N-
mtMCM, the N-hp in tapMCM is shifted upward to contact its neighbor. This part of the
N-hp in the hexamer of mtMCM is in a more or less straight conformation and does not
make direct contact with a neighboring subunit. (e) Different directions of Nt-hp in
different ssoMCM oligomeric conformations. Here, the Nt-hp in the filament (left-
handed) of ssoMCM is shifted downward compared with the Nt-hp in a hexamer
conformation.

119

Figure 5.6. A model for origin remodeling by tapMCM complex. (a, b) The side and
top views of a lock washer model made from six subunits of the N-terminal tapMCM
structure, but with the AAA+ domain modeled to the N-tapMCM portion to make a near
full length tapMCM structure. There are some minor clashes at the AAA+ domain
between subunits can be avoided by some adjustment of the AAA+ positions around the
long and flexible linker connecting the N and C terminal domains. (c) A model that
shows the role of an open ring conformation of MCM in DNA replication. MCM is
denoted by blue spheres. During DNA replication, the conformation of MCM is dynamic,
which can transition between open and closed rings for function at different stages.

5.3 Discussion
Here we report the 1.8 Å resolution structure of the N- tapMCM, which forms a right-
handed filament. This is different from the previously published crystal structures in the
form of a double hexamer of N-terminal mtMCM, (Fletcher, Bishop et al. 2003) of a
hexamer of N-terminal ssoMCM, (Liu, Pucci et al. 2008) and of a thick left-handed
filament of the near full length ssoMCM (Slaymaker, Fu et al. 2013). The inner channel
of N-tapMCM is positively charged and wide enough to bind ssDNA or dsDNA. The
results reported here, in combination with the previously reported lock washer structure
120
of eukaryotic MCM suggests archaeal MCM may also be able to adopt a lock washer
conformation.
Both archaeal and eukaryotic MCM have been shown to form double-hexamers
(Kelman, Lee et al. 1999; Chong, Hayashi et al. 2000; Fletcher, Bishop et al. 2003; Evrin,
Clarke et al. 2009; Remus, Beuron et al. 2009). Interestingly, the eukaryotic
MCM hexamer ring is closed when binding to Cdt1 before loading to origin and once
loaded, it becomes closed again (Remus, Beuron et al. 2009). Thus, MCM ring has to
change conformation during loading. Studies of some eukaryotic MCM complexes show
that the closed hexamer conformation sometimes is cracked between MCM2 and MCM5
subunits (Bochman and Schwacha 2008; Bochman and Schwacha 2010; Costa, Ilves et
al. 2011; Lyubimov, Costa et al. 2012). Mcm2-7 has been imaged as a lock washer by
Electon Microscopy (EM)(Costa, Ilves et al. 2011; Lyubimov, Costa et al. 2012).
Additionally, the RNA helicase Rho in E.coli adopts an open ring without RNA and
transitions to a closed ring conformation after binding to RNA (Skordalakes and Berger
2003; Skordalakes and Berger 2006; Thomsen and Berger 2009). Therefore, archaeal
MCM may act similarly to switch between an open ring and closed ring conformations to
load on to the origin dsDNA, the process of which is represented in the cartoon model in
(Fig. 5.6 C). The diameter of the inner channel of the N-terminal tapMCM lock washer is
about 25 Å, which is sufficiently wide to accommodate dsDNA as well as ssDNA.
MCM has been proposed to have dual roles for DNA replication: melting the
origin during initiation and unwinding DNA during elongation (Forsburg 2004). In
E.coli, the origin melting for prokaryotic DNA replication is conducted by DnaA, which
forms a filament around DNA to open the origin DNA, followed by the loading of DnaB
121
helicase onto the melted single stranded DNA (Duderstadt, Chuang et al. 2011).
Interestingly, a previous EM study of the archaeal MCM (mtMCM) by negative staining
showed a thin right-handed filament for the full length protein, which contains 7.2
subunits per turn (Chen, Yu et al. 2005). This filament structure revealed from the EM
study has similar dimentions as the high-resolution crystal structure of the N-tapMCM
reported here, even though the helix turn and pitch are not the same. In principle, such
kind of thin filament conformation of MCM forming on dsDNA may stretch DNA
similarly to DnaA filament to melt origin DNA.
The active helicase form of archaeal MCM is a hexamer (Shin, Heo et al. 2009).
In eukaryotic replication, the MCM double hexamer on the origin is shown to split into
single hexmers after origin melting and can function as an independent helicase to
unwind one replication fork (Fu, Yardimci et al. 2011; Gambus, Khoudoli et al. 2011;
Graham, Schauer et al. 2011; Labib 2011). During this MCM loading, origin melting, and
replication fork unwinding, the MCM may need to adopt different conformations, from
an open lockwasher/filament, to a closed circular hexamer/double hexamer encircling
dsDNA, to an open lockwasher/filament ring, and then finally to hexamer encircling
ssDNA (Fig. 5.6C). The helical conformation of N-tapMCM presented here may
resemble the conformation that can encircle dsDNA with the gap in the open-ring
structure enabling the lagging strand to extrude out (Fig. 5.6C). T antigen, a viral
helicase, has been proposed to use an open ring structure to bypass roadblocks that are
covalently linked to DNA (Yardimci, Wang et al. 2012). For eukaryotic MCM, the open
ring of Mcm2-7 is proposed to be closed by associating with GINS and Cdc45, which
may be responsible for enhancing the helicase activity (Aparicio, Guillou et al. 2009;
122
Ilves, Petojevic et al. 2010; Costa, Ilves et al. 2011). Like Mcm2-7, tapMCM also has
low helicase activity by itself and binding to Cdc6 activates the helicase activity
(Haugland, Sakakibara et al. 2008).
Based on current understanding of MCM structures, the conformation of MCM is
very dynamic and plastic, from circular hexamer, double hexamer, heptamer, octamer, to
open lockwasher, and filament (Yu, VanLoock et al. 2002; Fletcher, Bishop et al. 2003;
Pape, Meka et al. 2003; Chen, Yu et al. 2005; Gomez-Llorente, Fletcher et al. 2005;
Costa, Pape et al. 2006; Costa, Pape et al. 2006; Liu, Pucci et al. 2008; Evrin, Clarke et
al. 2009; Jenkinson, Costa et al. 2009; Remus, Beuron et al. 2009; Costa, Ilves et al.
2011; Gambus, Khoudoli et al. 2011; Lyubimov, Costa et al. 2012; Slaymaker, Fu et al.
2013). Compared to the other published structures of archaeal MCM, we found that the
N-hp structure takes three different conformations in the three types of oligomeric
complex: right-handed filament, left-handed filament, and hexameric rings. This suggests
a potential structural role of the N-hp in helping regulate the formation of the three types
of oligomeric states. A yeast mcm5 mutant with N-hp mutations is shown to be deficient
in initiating DNA replication (Leon, Tecklenburg et al. 2008). Even though the most
direct explanation for this deficiency may be the defect for DNA binding, the mutation
could also affect the proper N-hp conformational changes, and thus the conformation
variations of MCM assembly. N-hp is connected with the AAA+ motor domain and ATP
hydrolysis changes the conformations of N-hp (Barry, Lovett et al. 2009). This probably
explains how ATP binding/hydrolysis can change the conformation of MCM from a lock-
washer to a closed ring (Costa, Ilves et al. 2011; Lyubimov, Costa et al. 2012).
123
While this study provides additional insights into the dynamic nature of MCM
structure in its origin loading/melting and DNA unwinding, the molecular details of this
process would require further comprehensive investigation using different approaches,
one of which includes the determination of the complex structures of MCM with DNA
and other partners.
5.4 Experimental Procedures
Cloning and purification of the tapMCM protein
The gene encoding full length tapMCM was cloned into a vector pGex-6p1. The
protein was expressed with an N-terminal His
6
tag. The plasmid pGex-6p1-tapMCM was
transformed to E.coli and the cells were grown in 2XYT broth with 100 mg/ml ampicilin
at 37
0
C. After the OD600 reached 0.6, the cells was induced to overexpress MCM by a
final concentration of 0.5mM Isopropyl β-D-1-thiogalactopyranoside. TapMCM was
purified as previously described for ssoMCM (Slaymaker, Fu et al. 2013). Cell pellets
were resuspended and lysed by French Press in Buffer A (1 M NaCl, 50mM HEPES,
pH7.5, 20 mM Imidazole, 2 mM DTT). Cell lysis was centrifuged at 12000 rpm for 30
min and the supernatant was loaded to a nickel resin. The nickel resin was washed with
10 column volumes of Buffer A. Protein was eluted with Buffer A plus 250mM
imidazole. Eluates were diluted to 100 mM NaCl and and loaded to a Resource Q
column. A gradient of NaCl from 50 mM to 500 mM was applied to elute MCM. The
fractions containing MCM were combined and diluted to 100mM NaCl and then loaded
to a Heparin column. MCM was eluted by a linear gradient of 50 mM NaCl to 1000 mM
NaCl. The fractions containing MCM were pooled and concentrated to 2 ml and
124
subjected to Superdex 200 column chromatography in Buffer B (250mM NaCl, 20mM
Hepes, pH 7.5, 2mM DTT). The fractions containing MCM were concentrated to 30
mg/ml.
Crystallization
The full-length tapMCM protein was used for crystallization trials at 18 °C by the
hanging drop vapor diffusion method. The P6
1
crystals of the tapMCM protein were
grown in solutions containing 0.1 M Hepes pH7.5, 0.2 M MgCl
2
, 15% PEG 400. The
sample from dissolved crystals was analyzed by mass spectrometer which revealed that
the P6
1
crystals was from the N-terminal domain of tapMCM that was the degraded
product of the full length protein.
Data Collection and Structure Determination
Data were collected from cryo-frozen crystals from synchrotron beamlines APS
23-ID-D and ALS 8.2.1. Crystals diffracted to 1.8 Å and a complete data set was
collected from a single crystal. Phases were solved using autoMR within the Phenix suite
(version 1.8.1, build 1168) with a single subunit of mtMCM (PDBID 1LTL) in the space
group P6
1
with one molecule per asymmetric unit of dimensions 93.5, 93.5. 56.2 Å
(Table 5.1)(Fletcher, Bishop et al. 2003; Adams, Afonine et al. 2010). The structure was
partially built with Autobuild then refined using phenix.refine (Adams, Afonine et al.
2010). Rounds of refining and rebuilding in Coot were repeated to a final resolution
range of 1.8-30 Å with a final R-free of 18.17 (Rwork = 21.5) (Table 5.1). Residues 101-
102, 199-206 and 240-243 in the final structure are unmodeled due to poor electron
density.
125
Table 5.1: Crystallization statistics for tapMCM.
Acknowledgements
We thank the staff of USC NanoBiophisics core and the staff at synchrotron beamline
23ID at Argonne National laboratory, and 8.2.1 beamline at Berkeley’s ALS for
assistance with data collection. Accession number: PDB ID 4ME3.

126
Bibliography

Adachi, Y., J. Usukura and M. Yanagida (1997). "A globular complex formation by
Nda1 and the other five members of the MCM protein family in fission yeast."
Genes to cells : devoted to molecular & cellular mechanisms 2(7): 467-479.
Adams, P. D., P. V. Afonine, G. Bunkoczi, V. B. Chen, I. W. Davis, N. Echols, J. J. Headd,
L. W. Hung, G. J. Kapral, R. W. Grosse-Kunstleve, A. J. McCoy, N. W. Moriarty, R.
Oeffner, R. J. Read, D. C. Richardson, J. S. Richardson, T. C. Terwilliger and P. H.
Zwart (2010). "PHENIX: a comprehensive Python-based system for
macromolecular structure solution." Acta crystallographica. Section D,
Biological crystallography 66(Pt 2): 213-221.
Aparicio, O. M., A. M. Stout and S. P. Bell (1999). "Differential assembly of Cdc45p
and DNA polymerases at early and late origins of DNA replication."
Proceedings of the National Academy of Sciences of the United States of
America 96(16): 9130-9135.
Aparicio, O. M., D. M. Weinstein and S. P. Bell (1997). "Components and dynamics of
DNA replication complexes in S. cerevisiae: redistribution of MCM proteins
and Cdc45p during S phase." Cell 91(1): 59-69.
Aparicio, T., E. Guillou, J. Coloma, G. Montoya and J. Mendez (2009). "The human
GINS complex associates with Cdc45 and MCM and is essential for DNA
replication." Nucleic Acids Res 37(7): 2087-2095.
Aparicio, T., A. Ibarra and J. Mendez (2006). "Cdc45-MCM-GINS, a new power player
for DNA replication." Cell Div 1: 18.
Aparicio, T., D. Megias and J. Mendez (2012). "Visualization of the MCM DNA helicase
at replication factories before the onset of DNA synthesis." Chromosoma
121(5): 499-507.
Ashkenazy, H., E. Erez, E. Martz, T. Pupko and N. Ben-Tal (2010). "ConSurf 2010:
calculating evolutionary conservation in sequence and structure of proteins
and nucleic acids." Nucleic acids research 38(Web Server issue): W529-533.
Bae, B., Y. H. Chen, A. Costa, S. Onesti, J. S. Brunzelle, Y. Lin, I. K. Cann and S. K. Nair
(2009). "Insights into the architecture of the replicative helicase from the
structure of an archaeal MCM homolog." Structure 17(2): 211-222.
Bailis, J. M. and S. L. Forsburg (2003). "It's all in the timing: linking S phase to
chromatin structure and chromosome dynamics." Cell Cycle 2(4): 303-306.
Bailis, J. M. and S. L. Forsburg (2004). "MCM proteins: DNA damage, mutagenesis
and repair." Curr Opin Genet Dev 14(1): 17-21.
Barry, E. R., J. E. Lovett, A. Costa, S. M. Lea and S. D. Bell (2009). "Intersubunit
allosteric communication mediated by a conserved loop in the MCM
helicase." Proc Natl Acad Sci U S A 106(4): 1051-1056.
Barry, E. R., A. T. McGeoch, Z. Kelman and S. D. Bell (2007). "Archaeal MCM has
separable processivity, substrate choice and helicase domains." Nucleic Acids
Res 35(3): 988-998.
Bell, S. P. (2002). "The origin recognition complex: from simple origins to complex
functions." Genes Dev 16(6): 659-672.
127
Bell, S. P. and A. Dutta (2002). "DNA replication in eukaryotic cells." Annu Rev
Biochem 71: 333-374.
Bochman, M. L., S. P. Bell and A. Schwacha (2008). "Subunit organization of Mcm2-7
and the unequal role of active sites in ATP hydrolysis and viability."
Molecular and cellular biology 28(19): 5865-5873.
Bochman, M. L. and A. Schwacha (2008). "The Mcm2-7 complex has in vitro helicase
activity." Mol Cell 31(2): 287-293.
Bochman, M. L. and A. Schwacha (2009). "The Mcm complex: unwinding the
mechanism of a replicative helicase." Microbiology and molecular biology
reviews : MMBR 73(4): 652-683.
Bochman, M. L. and A. Schwacha (2010). "The Saccharomyces cerevisiae Mcm6/2
and Mcm5/3 ATPase active sites contribute to the function of the putative
Mcm2-7 'gate'." Nucleic Acids Res 38(18): 6078-6088.
Boos, D., J. Frigola and J. F. Diffley (2012). "Activation of the replicative DNA
helicase: breaking up is hard to do." Current opinion in cell biology 24(3):
423-430.
Bowers, J. L., J. C. Randell, S. Chen and S. P. Bell (2004). "ATP hydrolysis by ORC
catalyzes reiterative Mcm2-7 assembly at a defined origin of replication." Mol
Cell 16(6): 967-978.
Brewster, A. S. and X. S. Chen (2010). "Insights into the MCM functional mechanism:
lessons learned from the archaeal MCM complex." Crit Rev Biochem Mol Biol
45(3): 243-256.
Brewster, A. S., I. M. Slaymaker, S. A. Afif and X. S. Chen (2010). "Mutational analysis
of an archaeal minichromosome maintenance protein exterior hairpin
reveals critical residues for helicase activity and DNA binding." BMC Mol Biol
11: 62.
Brewster, A. S., G. Wang, X. Yu, W. B. Greenleaf, J. M. Carazo, M. Tjajadi, M. G. Klein
and X. S. Chen (2008). "Crystal structure of a near-full-length archaeal MCM:
functional insights for an AAA+ hexameric helicase." Proc Natl Acad Sci U S A
105(51): 20191-20196.
Brunger, A. T. (2007). "Version 1.2 of the Crystallography and NMR system." Nature
protocols 2(11): 2728-2733.
Chen, L. T., T. P. Ko, Y. C. Chang, K. A. Lin, C. S. Chang, A. H. Wang and T. F. Wang
(2007). "Crystal structure of the left-handed archaeal RadA helical filament:
identification of a functional motif for controlling quaternary structures and
enzymatic functions of RecA family proteins." Nucleic acids research 35(6):
1787-1801.
Chen, S. and S. P. Bell (2011). "CDK prevents Mcm2-7 helicase loading by inhibiting
Cdt1 interaction with Orc6." Genes & development 25(4): 363-372.
Chen, S., M. A. de Vries and S. P. Bell (2007). "Orc6 is required for dynamic
recruitment of Cdt1 during repeated Mcm2-7 loading." Genes Dev 21(22):
2897-2907.
Chen, Y. J., X. Yu, R. Kasiviswanathan, J. H. Shin, Z. Kelman and E. H. Egelman (2005).
"Structural polymorphism of Methanothermobacter thermautotrophicus
MCM." J Mol Biol 346(2): 389-394.
128
Chong, J. P., M. K. Hayashi, M. N. Simon, R. M. Xu and B. Stillman (2000). "A double-
hexamer archaeal minichromosome maintenance protein is an ATP-
dependent DNA helicase." Proc Natl Acad Sci U S A 97(4): 1530-1535.
Chong, J. P., H. M. Mahbubani, C. Y. Khoo and J. J. Blow (1995). "Purification of an
MCM-containing complex as a component of the DNA replication licensing
system." Nature 375(6530): 418-421.
Christensen, T. W. and B. K. Tye (2003). "Drosophila MCM10 interacts with
members of the prereplication complex and is required for proper
chromosome condensation." Molecular biology of the cell 14(6): 2206-2215.
Clark, D. J. and B. Leblanc (2009). "Analysis of DNA supercoiling induced by DNA-
protein interactions." Methods in molecular biology 543: 523-535.
Costa, A., I. Ilves, N. Tamberg, T. Petojevic, E. Nogales, M. R. Botchan and J. M. Berger
(2011). "The structural basis for MCM2-7 helicase activation by GINS and
Cdc45." Nat Struct Mol Biol 18(4): 471-477.
Costa, A. and S. Onesti (2009). "Structural biology of MCM helicases." Critical
reviews in biochemistry and molecular biology 44(5): 326-342.
Costa, A., T. Pape, M. van Heel, P. Brick, A. Patwardhan and S. Onesti (2006).
"Structural basis of the Methanothermobacter thermautotrophicus MCM
helicase activity." Nucleic Acids Res 34(20): 5829-5838.
Costa, A., T. Pape, M. van Heel, P. Brick, A. Patwardhan and S. Onesti (2006).
"Structural studies of the archaeal MCM complex in different functional
states." J Struct Biol 156(1): 210-219.
Costa, A., G. van Duinen, B. Medagli, J. Chong, N. Sakakibara, Z. Kelman, S. K. Nair, A.
Patwardhan and S. Onesti (2008). "Cryo-electron microscopy reveals a novel
DNA-binding site on the MCM helicase." The EMBO journal 27(16): 2250-
2258.
Cox, M. M. (2007). "Motoring along with the bacterial RecA protein." Nature reviews.
Molecular cell biology 8(2): 127-138.
Crampton, D. J., S. Mukherjee and C. C. Richardson (2006). "DNA-induced switch
from independent to sequential dTTP hydrolysis in the bacteriophage T7
DNA helicase." Molecular cell 21(2): 165-174.
Cuesta, I., R. Nunez-Ramirez, S. H. Scheres, D. Gai, X. S. Chen, E. Fanning and J. M.
Carazo (2010). "Conformational rearrangements of SV40 large T antigen
during early replication events." Journal of molecular biology 397(5): 1276-
1286.
Diffley, J. F. (2004). "Regulation of early events in chromosome replication." Current
biology : CB 14(18): R778-786.
Donmez, I. and S. S. Patel (2006). "Mechanisms of a ring shaped helicase." Nucleic
acids research 34(15): 4216-4224.
Donovan, S., J. Harwood, L. S. Drury and J. F. Diffley (1997). "Cdc6p-dependent
loading of Mcm proteins onto pre-replicative chromatin in budding yeast."
Proceedings of the National Academy of Sciences of the United States of
America 94(11): 5611-5616.
Duderstadt, K. E., K. Chuang and J. M. Berger (2011). "DNA stretching by bacterial
initiators promotes replication origin opening." Nature 478(7368): 209-213.
129
Dutta, A. and S. P. Bell (1997). "Initiation of DNA replication in eukaryotic cells."
Annu Rev Cell Dev Biol 13: 293-332.
Edwards, M. C., A. V. Tutter, C. Cvetic, C. H. Gilbert, T. A. Prokhorova and J. C. Walter
(2002). "MCM2-7 complexes bind chromatin in a distributed pattern
surrounding the origin recognition complex in Xenopus egg extracts." J Biol
Chem 277(36): 33049-33057.
Enemark, E. J. and L. Joshua-Tor (2006). "Mechanism of DNA translocation in a
replicative hexameric helicase." Nature 442(7100): 270-275.
Erkan, E. P., T. Strobel, G. Lewandrowski, B. Tannous, S. Madlener, T. Czech, N.
Saydam and O. Saydam (2013). "Depletion of minichromosome maintenance
protein 7 inhibits glioblastoma multiforme tumor growth in vivo." Oncogene.
Erzberger, J. P. and J. M. Berger (2006). "Evolutionary relationships and structural
mechanisms of AAA+ proteins." Annu Rev Biophys Biomol Struct 35: 93-114.
Erzberger, J. P., M. L. Mott and J. M. Berger (2006). "Structural basis for ATP-
dependent DnaA assembly and replication-origin remodeling." Nature
structural & molecular biology 13(8): 676-683.
Evrin, C., P. Clarke, J. Zech, R. Lurz, J. Sun, S. Uhle, H. Li, B. Stillman and C. Speck
(2009). "A double-hexameric MCM2-7 complex is loaded onto origin DNA
during licensing of eukaryotic DNA replication." Proc Natl Acad Sci U S A
106(48): 20240-20245.
Fernandez-Cid, A., A. Riera, S. Tognetti, M. C. Herrera, S. Samel, C. Evrin, C. Winkler,
E. Gardenal, S. Uhle and C. Speck (2013). "An ORC/Cdc6/MCM2-7 complex is
formed in a multistep reaction to serve as a platform for MCM double-
hexamer assembly." Molecular cell 50(4): 577-588.
Fitch, M. J., J. J. Donato and B. K. Tye (2003). "Mcm7, a subunit of the presumptive
MCM helicase, modulates its own expression in conjunction with Mcm1." The
Journal of biological chemistry 278(28): 25408-25416.
Fletcher, R. J., B. E. Bishop, R. P. Leon, R. A. Sclafani, C. M. Ogata and X. S. Chen (2003).
"The structure and function of MCM from archaeal M.
Thermoautotrophicum." Nat Struct Biol 10(3): 160-167.
Fletcher, R. J. and X. S. Chen (2006). "Biochemical activities of the BOB1 mutant in
Methanobacterium thermoautotrophicum MCM." Biochemistry 45(2): 462-
467.
Fletcher, R. J., J. Shen, Y. Gomez-Llorente, C. S. Martin, J. M. Carazo and X. S. Chen
(2005). "Double hexamer disruption and biochemical activities of
Methanobacterium thermoautotrophicum MCM." The Journal of biological
chemistry 280(51): 42405-42410.
Fletcher, R. J., J. Shen, L. G. Holden and X. S. Chen (2008). "Identification of amino
acids important for the biochemical activity of Methanothermobacter
thermautotrophicus MCM." Biochemistry 47(38): 9981-9986.
Forsburg, S. L. (2004). "Eukaryotic MCM proteins: beyond replication initiation."
Microbiol Mol Biol Rev 68(1): 109-131.
Francis, L. I., J. C. Randell, T. J. Takara, L. Uchima and S. P. Bell (2009). "Incorporation
into the prereplicative complex activates the Mcm2-7 helicase for Cdc7-Dbf4
phosphorylation." Genes Dev 23(5): 643-654.
130
Freeman, A., L. S. Morris, A. D. Mills, K. Stoeber, R. A. Laskey, G. H. Williams and N.
Coleman (1999). "Minichromosome maintenance proteins as biological
markers of dysplasia and malignancy." Clinical cancer research : an official
journal of the American Association for Cancer Research 5(8): 2121-2132.
Frigola, J., D. Remus, A. Mehanna and J. F. Diffley (2013). "ATPase-dependent quality
control of DNA replication origin licensing." Nature 495(7441): 339-343.
Fu, Y. V., H. Yardimci, D. T. Long, A. Guainazzi, V. P. Bermudez, J. Hurwitz, A. van
Oijen, O. D. Scharer and J. C. Walter (2011). "Selective Bypass of a Lagging
Strand Roadblock by the Eukaryotic Replicative DNA Helicase." Cell 146(6):
931-941.
Gai, D., Y. P. Chang and X. S. Chen (2010). "Origin DNA melting and unwinding in
DNA replication." Current opinion in structural biology 20(6): 756-762.
Gai, D., R. Zhao, D. Li, C. V. Finkielstein and X. S. Chen (2004). "Mechanisms of
conformational change for a replicative hexameric helicase of SV40 large
tumor antigen." Cell 119(1): 47-60.
Gambus, A., G. A. Khoudoli, R. C. Jones and J. J. Blow (2011). "MCM2-7 form double
hexamers at licensed origins in Xenopus egg extract." J Biol Chem 286(13):
11855-11864.
Ge, X. Q. and J. J. Blow (2010). "Chk1 inhibits replication factory activation but allows
dormant origin firing in existing factories." The Journal of cell biology
191(7): 1285-1297.
Ge, X. Q., D. A. Jackson and J. J. Blow (2007). "Dormant origins licensed by excess
Mcm2-7 are required for human cells to survive replicative stress." Genes &
development 21(24): 3331-3341.
Geraghty, D. S., M. Ding, N. H. Heintz and D. S. Pederson (2000). "Premature
structural changes at replication origins in a yeast minichromosome
maintenance (MCM) mutant." The Journal of biological chemistry 275(24):
18011-18021.
Glaser, F., Y. Rosenberg, A. Kessel, T. Pupko and N. Ben-Tal (2005). "The ConSurf-
HSSP database: the mapping of evolutionary conservation among homologs
onto PDB structures." Proteins 58(3): 610-617.
Gomez-Llorente, Y., R. J. Fletcher, X. S. Chen, J. M. Carazo and C. San Martin (2005).
"Polymorphism and double hexamer structure in the archaeal
minichromosome maintenance (MCM) helicase from Methanobacterium
thermoautotrophicum." J Biol Chem 280(49): 40909-40915.
Grabowski, B. and Z. Kelman (2003). "Archeal DNA replication: eukaryal proteins in
a bacterial context." Annu Rev Microbiol 57: 487-516.
Graham, B. W., G. D. Schauer, S. H. Leuba and M. A. Trakselis (2011). "Steric exclusion
and wrapping of the excluded DNA strand occurs along discrete external
binding paths during MCM helicase unwinding." Nucleic Acids Res 39(15):
6585-6595.
Greenleaf, W. B., J. Shen, D. Gai and X. S. Chen (2008). "Systematic study of the
functions for the residues around the nucleotide pocket in simian virus 40
AAA+ hexameric helicase." Journal of virology 82(12): 6017-6023.
131
Haugland, G. T., C. R. Rollor, N. K. Birkeland and Z. Kelman (2009). "Biochemical
characterization of the minichromosome maintenance protein from the
archaeon Thermoplasma acidophilum." Extremophiles 13(1): 81-88.
Haugland, G. T., N. Sakakibara, A. L. Pey, C. R. Rollor, N. K. Birkeland and Z. Kelman
(2008). "Thermoplasma acidophilum Cdc6 protein stimulates MCM helicase
activity by regulating its ATPase activity." Nucleic Acids Res 36(17): 5602-
5609.
Haugland, G. T., J. H. Shin, N. K. Birkeland and Z. Kelman (2006). "Stimulation of MCM
helicase activity by a Cdc6 protein in the archaeon Thermoplasma
acidophilum." Nucleic Acids Res 34(21): 6337-6344.
Heller, R. C., S. Kang, W. M. Lam, S. Chen, C. S. Chan and S. P. Bell (2011). "Eukaryotic
origin-dependent DNA replication in vitro reveals sequential action of DDK
and S-CDK kinases." Cell 146(1): 80-91.
Hoang, M. L., R. P. Leon, L. Pessoa-Brandao, S. Hunt, M. K. Raghuraman, W. L.
Fangman, B. J. Brewer and R. A. Sclafani (2007). "Structural changes in Mcm5
protein bypass Cdc7-Dbf4 function and reduce replication origin efficiency in
Saccharomyces cerevisiae." Molecular and cellular biology 27(21): 7594-
7602.
Ibarra, A., E. Schwob and J. Mendez (2008). "Excess MCM proteins protect human
cells from replicative stress by licensing backup origins of replication."
Proceedings of the National Academy of Sciences of the United States of
America 105(26): 8956-8961.
Ilves, I., T. Petojevic, J. J. Pesavento and M. R. Botchan (2010). "Activation of the
MCM2-7 helicase by association with Cdc45 and GINS proteins." Mol Cell
37(2): 247-258.
Ishimi, Y. (1997). "A DNA helicase activity is associated with an MCM4, -6, and -7
protein complex." J Biol Chem 272(39): 24508-24513.
Ishimi, Y., S. Ichinose, A. Omori, K. Sato and H. Kimura (1996). "Binding of human
minichromosome maintenance proteins with histone H3." The Journal of
biological chemistry 271(39): 24115-24122.
Ishimi, Y., Y. Komamura-Kohno, K. Arai and H. Masai (2001). "Biochemical activities
associated with mouse Mcm2 protein." J Biol Chem 276(46): 42744-42752.
Iyer, L. M., D. D. Leipe, E. V. Koonin and L. Aravind (2004). "Evolutionary history and
higher order classification of AAA+ ATPases." J Struct Biol 146(1-2): 11-31.
Jenkinson, E. R. and J. P. Chong (2006). "Minichromosome maintenance helicase
activity is controlled by N- and C-terminal motifs and requires the ATPase
domain helix-2 insert." Proc Natl Acad Sci U S A 103(20): 7613-7618.
Jenkinson, E. R., A. Costa, A. P. Leech, A. Patwardhan, S. Onesti and J. P. Chong (2009).
"Mutations in subdomain B of the minichromosome maintenance (MCM)
helicase affect DNA binding and modulate conformational transitions." J Biol
Chem 284(9): 5654-5661.
Kamimura, Y., Y. S. Tak, A. Sugino and H. Araki (2001). "Sld3, which interacts with
Cdc45 (Sld4), functions for chromosomal DNA replication in Saccharomyces
cerevisiae." The EMBO journal 20(8): 2097-2107.
132
Kanemaki, M. and K. Labib (2006). "Distinct roles for Sld3 and GINS during
establishment and progression of eukaryotic DNA replication forks." The
EMBO journal 25(8): 1753-1763.
Kanter, D. M., I. Bruck and D. L. Kaplan (2008). "Mcm subunits can assemble into two
different active unwinding complexes." The Journal of biological chemistry
283(45): 31172-31182.
Kelly, T. J. and G. W. Brown (2000). "Regulation of chromosome replication." Annu
Rev Biochem 69: 829-880.
Kelman, Z., J. K. Lee and J. Hurwitz (1999). "The single minichromosome
maintenance protein of Methanobacterium thermoautotrophicum DeltaH
contains DNA helicase activity." Proc Natl Acad Sci U S A 96(26): 14783-
14788.
Khayrutdinov, B. I., W. J. Bae, Y. M. Yun, J. H. Lee, T. Tsuyama, J. J. Kim, E. Hwang, K. S.
Ryu, H. K. Cheong, C. Cheong, J. S. Ko, T. Enomoto, P. A. Karplus, P. Guntert, S.
Tada, Y. H. Jeon and Y. Cho (2009). "Structure of the Cdt1 C-terminal domain:
conservation of the winged helix fold in replication licensing factors." Protein
Sci 18(11): 2252-2264.
Klock, H. E. and S. A. Lesley (2009). "The Polymerase Incomplete Primer Extension
(PIPE) method applied to high-throughput cloning and site-directed
mutagenesis." Methods in molecular biology 498: 91-103.
Kremer, J. R., D. N. Mastronarde and J. R. McIntosh (1996). "Computer visualization
of three-dimensional image data using IMOD." Journal of structural biology
116(1): 71-76.
Kuipers, M. A., T. J. Stasevich, T. Sasaki, K. A. Wilson, K. L. Hazelwood, J. G. McNally,
M. W. Davidson and D. M. Gilbert (2011). "Highly stable loading of Mcm
proteins onto chromatin in living cells requires replication to unload." J Cell
Biol 192(1): 29-41.
Kunkel, T. A. and P. M. Burgers (2008). "Dividing the workload at a eukaryotic
replication fork." Trends in cell biology 18(11): 521-527.
Kunnev, D., M. E. Rusiniak, A. Kudla, A. Freeland, G. K. Cady and S. C. Pruitt (2010).
"DNA damage response and tumorigenesis in Mcm2-deficient mice."
Oncogene 29(25): 3630-3638.
Labib, K. (2010). "How do Cdc7 and cyclin-dependent kinases trigger the initiation
of chromosome replication in eukaryotic cells?" Genes & development
24(12): 1208-1219.
Labib, K. (2011). "Building a double hexamer of DNA helicase at eukaryotic
replication origins." EMBO J 30(24): 4853-4855.
Labib, K., J. A. Tercero and J. F. Diffley (2000). "Uninterrupted MCM2-7 function
required for DNA replication fork progression." Science 288(5471): 1643-
1647.
Larkin, M. A., G. Blackshields, N. P. Brown, R. Chenna, P. A. McGettigan, H. McWilliam,
F. Valentin, I. M. Wallace, A. Wilm, R. Lopez, J. D. Thompson, T. J. Gibson and
D. G. Higgins (2007). "Clustal W and Clustal X version 2.0." Bioinformatics
23(21): 2947-2948.
133
Laskey, R. A. and M. A. Madine (2003). "A rotary pumping model for helicase
function of MCM proteins at a distance from replication forks." EMBO reports
4(1): 26-30.
Lee, J. K. and J. Hurwitz (2000). "Isolation and characterization of various complexes
of the minichromosome maintenance proteins of Schizosaccharomyces
pombe." The Journal of biological chemistry 275(25): 18871-18878.
Lee, J. K. and J. Hurwitz (2001). "Processive DNA helicase activity of the
minichromosome maintenance proteins 4, 6, and 7 complex requires forked
DNA structures." Proceedings of the National Academy of Sciences of the
United States of America 98(1): 54-59.
Lei, M., Y. Kawasaki and B. K. Tye (1996). "Physical interactions among Mcm
proteins and effects of Mcm dosage on DNA replication in Saccharomyces
cerevisiae." Molecular and cellular biology 16(9): 5081-5090.
Lei, M. and B. K. Tye (2001). "Initiating DNA synthesis: from recruiting to activating
the MCM complex." Journal of cell science 114(Pt 8): 1447-1454.
Leon, R. P., M. Tecklenburg and R. A. Sclafani (2008). "Functional conservation of
beta-hairpin DNA binding domains in the Mcm protein of Methanobacterium
thermoautotrophicum and the Mcm5 protein of Saccharomyces cerevisiae."
Genetics 179(4): 1757-1768.
Li, D., R. Zhao, W. Lilyestrom, D. Gai, R. Zhang, J. A. DeCaprio, E. Fanning, A.
Jochimiak, G. Szakonyi and X. S. Chen (2003). "Structure of the replicative
helicase of the oncoprotein SV40 large tumour antigen." Nature 423(6939):
512-518.
Liang, D. T., J. A. Hodson and S. L. Forsburg (1999). "Reduced dosage of a single
fission yeast MCM protein causes genetic instability and S phase delay." J Cell
Sci 112 ( Pt 4): 559-567.
Liu, W., B. Pucci, M. Rossi, F. M. Pisani and R. Ladenstein (2008). "Structural analysis
of the Sulfolobus solfataricus MCM protein N-terminal domain." Nucleic Acids
Res 36(10): 3235-3243.
Lyubimov, A. Y., A. Costa, F. Bleichert, M. R. Botchan and J. M. Berger (2012). "ATP-
dependent conformational dynamics underlie the functional asymmetry of
the replicative helicase from a minimalist eukaryote." Proc Natl Acad Sci U S
A 109(30): 11999-12004.
Maine, G. T., P. Sinha and B. K. Tye (1984). "Mutants of S. cerevisiae defective in the
maintenance of minichromosomes." Genetics 106(3): 365-385.
Maiorano, D., J. Moreau and M. Mechali (2000). "XCDT1 is required for the assembly
of pre-replicative complexes in Xenopus laevis." Nature 404(6778): 622-625.
Martin, A., T. A. Baker and R. T. Sauer (2005). "Rebuilt AAA + motors reveal
operating principles for ATP-fuelled machines." Nature 437(7062): 1115-
1120.
Masumoto, H., S. Muramatsu, Y. Kamimura and H. Araki (2002). "S-Cdk-dependent
phosphorylation of Sld2 essential for chromosomal DNA replication in
budding yeast." Nature 415(6872): 651-655.
McGeoch, A. T., M. A. Trakselis, R. A. Laskey and S. D. Bell (2005). "Organization of
the archaeal MCM complex on DNA and implications for the helicase
mechanism." Nat Struct Mol Biol 12(9): 756-762.
134
Mechali, M. (2010). "Eukaryotic DNA replication origins: many choices for
appropriate answers." Nature reviews. Molecular cell biology 11(10): 728-
738.
Mendez, J. and B. Stillman (2003). "Perpetuating the double helix: molecular
machines at eukaryotic DNA replication origins." BioEssays : news and
reviews in molecular, cellular and developmental biology 25(12): 1158-
1167.
Mogni, M. E., A. Costa, C. Ioannou and S. D. Bell (2009). "The glutamate switch is
present in all seven clades of AAA+ protein." Biochemistry 48(37): 8774-
8775.
Moreau, M. J., A. T. McGeoch, A. R. Lowe, L. S. Itzhaki and S. D. Bell (2007). "ATPase
site architecture and helicase mechanism of an archaeal MCM." Molecular cell
28(2): 304-314.
Moyer, S. E., P. W. Lewis and M. R. Botchan (2006). "Isolation of the Cdc45/Mcm2-
7/GINS (CMG) complex, a candidate for the eukaryotic DNA replication fork
helicase." Proc Natl Acad Sci U S A 103(27): 10236-10241.
Muramatsu, S., K. Hirai, Y. S. Tak, Y. Kamimura and H. Araki (2010). "CDK-dependent
complex formation between replication proteins Dpb11, Sld2, Pol (epsilon},
and GINS in budding yeast." Genes & development 24(6): 602-612.
Myllykallio, H., P. Lopez, P. Lopez-Garcia, R. Heilig, W. Saurin, Y. Zivanovic, H.
Philippe and P. Forterre (2000). "Bacterial mode of replication with
eukaryotic-like machinery in a hyperthermophilic archaeon." Science
288(5474): 2212-2215.
Pacek, M., A. V. Tutter, Y. Kubota, H. Takisawa and J. C. Walter (2006). "Localization
of MCM2-7, Cdc45, and GINS to the site of DNA unwinding during eukaryotic
DNA replication." Molecular cell 21(4): 581-587.
Pape, T., H. Meka, S. Chen, G. Vicentini, M. van Heel and S. Onesti (2003). "Hexameric
ring structure of the full-length archaeal MCM protein complex." EMBO Rep
4(11): 1079-1083.
Pasion, S. G. and S. L. Forsburg (2001). "Deconstructing a conserved protein family:
the role of MCM proteins in eukaryotic DNA replication." Genet Eng (N Y) 23:
129-155.
Peters, J. M. (2006). "The anaphase promoting complex/cyclosome: a machine
designed to destroy." Nature reviews. Molecular cell biology 7(9): 644-656.
Pflumm, M. F. and M. R. Botchan (2001). "Orc mutants arrest in metaphase with
abnormally condensed chromosomes." Development 128(9): 1697-1707.
Prokhorova, T. A. and J. J. Blow (2000). "Sequential MCM/P1 subcomplex assembly
is required to form a heterohexamer with replication licensing activity." The
Journal of biological chemistry 275(4): 2491-2498.
Pruitt, S. C., K. J. Bailey and A. Freeland (2007). "Reduced Mcm2 expression results in
severe stem/progenitor cell deficiency and cancer." Stem Cells 25(12): 3121-
3132.
Pucci, B., M. De Felice, M. Rocco, F. Esposito, M. De Falco, L. Esposito, M. Rossi and F.
M. Pisani (2007). "Modular organization of the Sulfolobus solfataricus mini-
chromosome maintenance protein." The Journal of biological chemistry
282(17): 12574-12582.
135
Randell, J. C., J. L. Bowers, H. K. Rodriguez and S. P. Bell (2006). "Sequential ATP
hydrolysis by Cdc6 and ORC directs loading of the Mcm2-7 helicase." Mol Cell
21(1): 29-39.
Randell, J. C., A. Fan, C. Chan, L. I. Francis, R. C. Heller, K. Galani and S. P. Bell (2010).
"Mec1 is one of multiple kinases that prime the Mcm2-7 helicase for
phosphorylation by Cdc7." Molecular cell 40(3): 353-363.
Remus, D., F. Beuron, G. Tolun, J. D. Griffith, E. P. Morris and J. F. Diffley (2009).
"Concerted loading of Mcm2-7 double hexamers around DNA during DNA
replication origin licensing." Cell 139(4): 719-730.
Remus, D. and J. F. Diffley (2009). "Eukaryotic DNA replication control: lock and
load, then fire." Current opinion in cell biology 21(6): 771-777.
Robinson, N. P., I. Dionne, M. Lundgren, V. L. Marsh, R. Bernander and S. D. Bell
(2004). "Identification of two origins of replication in the single chromosome
of the archaeon Sulfolobus solfataricus." Cell 116(1): 25-38.
Romanowski, P., M. A. Madine, A. Rowles, J. J. Blow and R. A. Laskey (1996). "The
Xenopus origin recognition complex is essential for DNA replication and
MCM binding to chromatin." Current biology : CB 6(11): 1416-1425.
Rothenberg, E., M. A. Trakselis, S. D. Bell and T. Ha (2007). "MCM forked substrate
specificity involves dynamic interaction with the 5'-tail." The Journal of
biological chemistry 282(47): 34229-34234.
Sakakibara, N., R. Kasiviswanathan, E. Melamud, M. Han, F. P. Schwarz and Z. Kelman
(2008). "Coupling of DNA binding and helicase activity is mediated by a
conserved loop in the MCM protein." Nucleic acids research 36(4): 1309-
1320.
Sakakibara, N., L. M. Kelman and Z. Kelman (2009). "Unwinding the structure and
function of the archaeal MCM helicase." Mol Microbiol 72(2): 286-296.
Schroder, G. F., M. Levitt and A. T. Brunger (2010). "Super-resolution biomolecular
crystallography with low-resolution data." Nature 464(7292): 1218-1222.
Sclafani, R. A., R. J. Fletcher and X. S. Chen (2004). "Two heads are better than one:
regulation of DNA replication by hexameric helicases." Genes & development
18(17): 2039-2045.
Sheu, Y. J. and B. Stillman (2010). "The Dbf4-Cdc7 kinase promotes S phase by
alleviating an inhibitory activity in Mcm4." Nature 463(7277): 113-117.
Shima, N., A. Alcaraz, I. Liachko, T. R. Buske, C. A. Andrews, R. J. Munroe, S. A.
Hartford, B. K. Tye and J. C. Schimenti (2007). "A viable allele of Mcm4 causes
chromosome instability and mammary adenocarcinomas in mice." Nature
genetics 39(1): 93-98.
Shin, J. H., G. Y. Heo and Z. Kelman (2009). "The Methanothermobacter
thermautotrophicus MCM helicase is active as a hexameric ring." J Biol Chem
284(1): 540-546.
Shin, J. H., Y. Jiang, B. Grabowski, J. Hurwitz and Z. Kelman (2003). "Substrate
requirements for duplex DNA translocation by the eukaryal and archaeal
minichromosome maintenance helicases." The Journal of biological
chemistry 278(49): 49053-49062.
136
Singleton, M. R., M. R. Sawaya, T. Ellenberger and D. B. Wigley (2000). "Crystal
structure of T7 gene 4 ring helicase indicates a mechanism for sequential
hydrolysis of nucleotides." Cell 101(6): 589-600.
Skordalakes, E. and J. M. Berger (2003). "Structure of the Rho transcription
terminator: mechanism of mRNA recognition and helicase loading." Cell
114(1): 135-146.
Skordalakes, E. and J. M. Berger (2006). "Structural insights into RNA-dependent
ring closure and ATPase activation by the Rho termination factor." Cell
127(3): 553-564.
Slaymaker, I. M. and X. S. Chen (2012). "MCM Structure and Mechanics: What We
Have Learned from Archaeal MCM." Subcell Biochem 62: 89-111.
Slaymaker, I. M., Y. Fu, D. B. Toso, N. Ranatunga, A. Brewster, S. L. Forsburg, Z. H.
Zhou and X. S. Chen (2013). "Mini-chromosome maintenance complexes form
a filament to remodel DNA structure and topology." Nucleic Acids Res.
Snyder, M., X. Y. Huang and J. J. Zhang (2009). "The minichromosome maintenance
proteins 2-7 (MCM2-7) are necessary for RNA polymerase II (Pol II)-
mediated transcription." The Journal of biological chemistry 284(20):
13466-13472.
Speck, C., Z. Chen, H. Li and B. Stillman (2005). "ATPase-dependent cooperative
binding of ORC and Cdc6 to origin DNA." Nature structural & molecular
biology 12(11): 965-971.
Story, R. M. and T. A. Steitz (1992). "Structure of the recA protein-ADP complex."
Nature 355(6358): 374-376.
Sun, J., C. Evrin, S. A. Samel, A. Fernandez-Cid, A. Riera, H. Kawakami, B. Stillman, C.
Speck and H. Li (2013). "Cryo-EM structure of a helicase loading intermediate
containing ORC-Cdc6-Cdt1-MCM2-7 bound to DNA." Nature structural &
molecular biology 20(8): 944-951.
Sun, J., H. Kawakami, J. Zech, C. Speck, B. Stillman and H. Li (2012). "Cdc6-induced
conformational changes in ORC bound to origin DNA revealed by cryo-
electron microscopy." Structure 20(3): 534-544.
Tabancay, A. P., Jr. and S. L. Forsburg (2006). "Eukaryotic DNA replication in a
chromatin context." Curr Top Dev Biol 76: 129-184.
Takahashi, T. S., D. B. Wigley and J. C. Walter (2005). "Pumps, paradoxes and
ploughshares: mechanism of the MCM2-7 DNA helicase." Trends in
biochemical sciences 30(8): 437-444.
Takara, T. J. and S. P. Bell (2011). "Multiple Cdt1 molecules act at each origin to load
replication-competent Mcm2-7 helicases." The EMBO journal 30(24): 4885-
4896.
Tanaka, S., R. Nakato, Y. Katou, K. Shirahige and H. Araki (2011). "Origin association
of Sld3, Sld7, and Cdc45 proteins is a key step for determination of origin-
firing timing." Current biology : CB 21(24): 2055-2063.
Tanaka, S., T. Umemori, K. Hirai, S. Muramatsu, Y. Kamimura and H. Araki (2007).
"CDK-dependent phosphorylation of Sld2 and Sld3 initiates DNA replication
in budding yeast." Nature 445(7125): 328-332.
Tanaka, T., D. Knapp and K. Nasmyth (1997). "Loading of an Mcm protein onto DNA
replication origins is regulated by Cdc6p and CDKs." Cell 90(4): 649-660.
137
Thompson, J. D., D. G. Higgins and T. J. Gibson (1994). "CLUSTAL W: improving the
sensitivity of progressive multiple sequence alignment through sequence
weighting, position-specific gap penalties and weight matrix choice." Nucleic
acids research 22(22): 4673-4680.
Thomsen, N. D. and J. M. Berger (2009). "Running in reverse: the structural basis for
translocation polarity in hexameric helicases." Cell 139(3): 523-534.
Tsakraklides, V. and S. P. Bell (2010). "Dynamics of pre-replicative complex
assembly." The Journal of biological chemistry 285(13): 9437-9443.
Tye, B. K. (1999). "MCM proteins in DNA replication." Annual review of biochemistry
68: 649-686.
Unni, S., Y. Huang, R. M. Hanson, M. Tobias, S. Krishnan, W. W. Li, J. E. Nielsen and N.
A. Baker (2011). "Web servers and services for electrostatics calculations
with APBS and PDB2PQR." Journal of computational chemistry 32(7): 1488-
1491.
Valle, M., X. S. Chen, L. E. Donate, E. Fanning and J. M. Carazo (2006). "Structural
basis for the cooperative assembly of large T antigen on the origin of
replication." Journal of molecular biology 357(4): 1295-1305.
Vijayraghavan, S. and A. Schwacha (2012). "The eukaryotic mcm2-7 replicative
helicase." Sub-cellular biochemistry 62: 113-134.
Walters, A. D. and J. P. Chong (2010). "An archaeal order with multiple
minichromosome maintenance genes." Microbiology 156(Pt 5): 1405-1414.
Wessel, R., J. Schweizer and H. Stahl (1992). "Simian virus 40 T-antigen DNA helicase
is a hexamer which forms a binary complex during bidirectional unwinding
from the viral origin of DNA replication." Journal of virology 66(2): 804-815.
Wyrick, J. J., J. G. Aparicio, T. Chen, J. D. Barnett, E. G. Jennings, R. A. Young, S. P. Bell
and O. M. Aparicio (2001). "Genome-wide distribution of ORC and MCM
proteins in S. cerevisiae: high-resolution mapping of replication origins."
Science 294(5550): 2357-2360.
Yabuta, N., N. Kajimura, K. Mayanagi, M. Sato, T. Gotow, Y. Uchiyama, Y. Ishimi and H.
Nojima (2003). "Mammalian Mcm2/4/6/7 complex forms a toroidal
structure." Genes to cells : devoted to molecular & cellular mechanisms 8(5):
413-421.
Yardimci, H., A. B. Loveland, S. Habuchi, A. M. van Oijen and J. C. Walter (2010).
"Uncoupling of sister replisomes during eukaryotic DNA replication." Mol
Cell 40(5): 834-840.
Yardimci, H., X. Wang, A. B. Loveland, I. Tappin, D. Z. Rudner, J. Hurwitz, A. M. van
Oijen and J. C. Walter (2012). "Bypass of a protein barrier by a replicative
DNA helicase." Nature 492(7428): 205-209.
You, Z., Y. Komamura and Y. Ishimi (1999). "Biochemical analysis of the intrinsic
Mcm4-Mcm6-mcm7 DNA helicase activity." Molecular and cellular biology
19(12): 8003-8015.
Yu, X., M. S. VanLoock, A. Poplawski, Z. Kelman, T. Xiang, B. K. Tye and E. H. Egelman
(2002). "The Methanobacterium thermoautotrophicum MCM protein can
form heptameric rings." EMBO Rep 3(8): 792-797.
138
Zhang, X. and D. B. Wigley (2008). "The 'glutamate switch' provides a link between
ATPase activity and ligand binding in AAA+ proteins." Nature structural &
molecular biology 15(11): 1223-1227.
Zhou, B., D. R. Arnett, X. Yu, A. Brewster, G. A. Sowd, C. L. Xie, S. Vila, D. Gai, E.
Fanning and X. S. Chen (2012). "Structural basis for the interaction of a
hexameric replicative helicase with the regulatory subunit of human DNA
polymerase alpha-primase." The Journal of biological chemistry 287(32):
26854-26866.
Zou, L., J. Mitchell and B. Stillman (1997). "CDC45, a novel yeast gene that functions
with the origin recognition complex and Mcm proteins in initiation of DNA
replication." Molecular and cellular biology 17(2): 553-563.

Abstract (if available)

Abstract Since their discovery nearly 30 years ago, MCM proteins have become known as the primary replicative helicase in eukaryotes and archaea

Linked assets

University of Southern California Dissertations and Theses

Conceptually similar

PDF

Structure and function of archaeal McM helicase

PDF

Structural and biochemical studies of large T antigen: the SV40 replicative helicase

PDF

Essential and non-essential helicases maintain genome stability in Schizosaccharomyces pombe

PDF

Biochemical characterization and structural analysis of two hexameric helicases for eukaryotic DNA replication

PDF

Mechanism study of SV40 large tumor antigen atpase and helicase functions in viral DNA replication

PDF

Structural and biochemical studies of two DNA transaction enzymes

PDF

Simulating the helicase motor of SV40 large tumor antigen

PDF

Different alleles of fission yeast mcm4 uncover different roles in replication

PDF

The role of Cdc7 in replication fork progression in response to DNA damage

PDF

Structural studies of two key factors for DNA replication in eukaryotic cells

PDF

Destabilization of the replication fork protection complex is associated with meiotic defects in fission yeast

PDF

Biochemical studies of APOBEC protein family

PDF

X-ray structural studies on DNA-dependent protein kinase catalytic subunit:DNA co-crystals

PDF

Structure and regulation of lymphoid tyrosine phosphatase (LYP) in autoimmune response

PDF

Forkhead transcription factors control genome wide dynamics of the S. cerevisiae replication timing program

PDF

The function of Rpd3 in balancing the replicaton initiation of different genomic regions

PDF

Understanding the genetic architecture of complex traits

PDF

Computational analysis of DNA replication timing and fork dynamics in S. cerevisiae

PDF

Structural and biochemical determinants of APOBEC1 substrate recognition and enzymatic function

PDF

Biochemical mechanism of TopBP1 recruitment to sites of DNA damage

Asset Metadata

Creator Slaymaker, Ian M. (author)

Core Title Structural and biochemical studies of DNA helicase complexes: conformational diversity of archaeal MCM

School College of Letters, Arts and Sciences

Degree Doctor of Philosophy

Degree Program Molecular Biology

Publication Date 02/18/2014

Defense Date 12/14/2013

Publisher University of Southern California (original), University of Southern California. Libraries (digital)

Tag crystallography,DNA replication,DNA topology,helicase,MCM,OAI-PMH Harvest,structure,unwinding

Format application/pdf (imt)

Language English

Contributor Electronically uploaded by the author (provenance)

Advisor Chen, Xiaojiang S. (committee chair), Bradforth, Stephen E. (committee member), Forsburg, Susan (committee member)

Creator Email iamslaymaker@gmail.com,islay@broadinstitute.org

Permanent Link (DOI) https://doi.org/10.25549/usctheses-c3-363791

Unique identifier UC11297100

Identifier etd-SlaymakerI-2251.pdf (filename),usctheses-c3-363791 (legacy record id)

Legacy Identifier etd-SlaymakerI-2251.pdf

Dmrecord 363791

Document Type Dissertation

Format application/pdf (imt)

Rights Slaymaker, Ian M.

Type texts

Source University of Southern California (contributing entity), University of Southern California Dissertations and Theses (collection)

Access Conditions The author retains rights to his/her dissertation, thesis or other graduate work according to U.S. copyright law. Electronic access is being provided by the USC Libraries in agreement with the a...

Repository Name University of Southern California Digital Library

Repository Location USC Digital Library, University of Southern California, University Park Campus MC 2810, 3434 South Grand Avenue, 2nd Floor, Los Angeles, California 90089-2810, USA