University of Southern California Dissertations and Theses

The histone H2A deubiquitinase MYSM1 regulates CCR9 expression on CD4⁺ T cells and thymocytes

(USC Thesis Other)

The histone H2A deubiquitinase MYSM1 regulates CCR9 expression on CD4⁺ T cells and thymocytes

PDF

Download a page range

Download transcript

Copy asset link

Request this asset

Transcript (if available)

Content

THE HISTONE H2A DEUBIQUITINASE MYSM1 REGULATES CCR9
EXPRESSION ON CD4
+
T CELLS AND THYMOCYTES

by

Peter Christian Yates

A Dissertation Presented to the
FACULTY OF THE USC GRADUATE SCHOOL
UNIVERSITY OF SOUTHERN CALIFORNIA
In Partial Fulfillment of the Requirements of the Degree
DOCTOR OF PHILOSOPHY
(GENETICS, MOLECULAR CELLULAR BIOLOGY)

December 2013

Copyright 2013 Peter Christian Yates

ii

DEDICATION
I dedicate this dissertation to my parents: Ralph and Lynn. Thank you for you constant
love and support throughout this process. Because of you both, I am a better person.

iii

ACKNOWLEDGEMENTS

First, I would like to thank my advisor, Dr. Si-Yi Chen. You have constantly pushed me
throughout my graduate career and helped me achieve more than I could have thought
possible. I greatly appreciate the time and effort you have devoted over the past five years
and thank you for the opportunities you have afforded me.

I would like to thank my dissertation committee members, Dr. Michael Stallcup, Dr.
Omid Akbari, and Dr. Judd Rice for your support and guidance. I truly value all of the
input I have received and am indebted to all of you for your time and consideration
throughout this process.

I would like to thank all the past and present members of the Chen lab: Lindsey Jones,
Viji Nandakumar, Hae Jung Won, Suzi Sanchez, Quan Nguyen, Xue Huang, Xiaoxia
Jiang, Lifeng Wang, Tao Wong, Bangxing Hong, Yuchia Chou, Linda Zang, and Tim
Guyon. The daily camaraderie has been essential and something I will truly miss.

I would like to thank Dr. William DePaolo and the members of his lab for technical
assistance with the colitis models, as well as general critiques and guidance.

I would like to thank my undergraduate mentor, Dr. Angela Panoskaltsis-Mortari. I am
indebted to your generosity and kindness. I would not be where I am today without your
help.

I would like to thank my parents and my family. Words cannot adequately express the
sense of gratitude I feel toward you all.

Lastly, I would like to thank Annie Salamone. It is impossible for me to overstate how
much your love and support have meant to me throughout this process.

iv

TABLE OF CONTENTS

DEDICATION................................................................................................................... ii
ACKNOWLEDGEMENTS ............................................................................................ iii
LIST OF TABLES ........................................................................................................... vi
LIST OF FIGURES ........................................................................................................ vii
ABSTRACT .................................................................................................................... viii

CHAPTER 1: INTRODUCTION

1.1 Chemokines....................................................................................................................1
1.2 T cell Progenitor Development ......................................................................................3
1.3 Thymic Colonization .....................................................................................................5
1.4 Thymocyte Development ...............................................................................................8
1.5 Thymocyte Emigration ................................................................................................14
1.6 Naïve T cell Migration .................................................................................................15
1.7 T cell Migration of the Intestinal Mucosa....................................................................18
1.8 Aberrant Homing to the Intestinal Mucosa ..................................................................21
1.9 Histones........................................................................................................................23
1.10 The Ubiquitination/Deubiquitination of Histones Proteins .......................................24
1.12 MYSM1 .....................................................................................................................25
1.13 Conclusion .................................................................................................................28

CHAPTER 2: MYSM1 REGULATES CCR9 EXPRESSION ON CD4
+

T Lymphocytes

2.1 Abstract ........................................................................................................................29
2.2 Introduction ..................................................................................................................30
2.3 Materials and Methods ......................................................................................................... 33
2.4 Results ..........................................................................................................................38
2.4.1 Altered T cell composition in the peripheral lymphoid organs and
small intestine of MYSM1 KO Mice ...................................................................39
2.4.2 Elevated expression of CCR9 on CD4
+
T cells in MYSM1 KO mice ...............42
2.4.3 Naïve MYSM1 KO CD4
+
T cells are hypersensitive to retinoic
acid stimulation ..................................................................................................45
2.4.4 MYSM1 KO T cells possess increased homing efficiency in vitro ....................49

v

2.4.5 MYSM1 KO T cells possess increased homing efficiency in vivo ....................51
2.4.6 MYSM1 KO mice are more susceptible to DSS induced colitis ........................53
2.4.7 MYSM1 KO mice have altered expression of CCR9-related
transcription factors ............................................................................................55
2.4.8 MYSM1 interacts with the CCR9 locus .............................................................57
2.5 Discussion ....................................................................................................................60
2.6 Acknowledgements ......................................................................................................63

CHAPTER 3: MYSM1 REGULATES CCR9 EXPRESSION DURING
THYMOCYTE DEVELOPMENT

3.1 Abstract ........................................................................................................................65
3.2 Introduction ..................................................................................................................66
3.5 Materials and Methods .................................................................................................68
3.3 Results ..........................................................................................................................72
3.3.1 Thymocyte development is altered in MYSM1 KO mice ..................................72
3.3.2 MYSM1 KO thymocytes display reduced expression of CCR9 ........................76
3.3.3 MYSM1 KO thymocytes possess reduced capacity for
CCL25-mediated migration ................................................................................80
3.3.4 CCR9 Expression on bone marrow-derived precursors and ETP .......................83
3.3.5 Thymocyte proliferation and apoptosis in MYSM1 KO mice............................86
3.3.6 Proliferation and activation of MYSM1 KO peripheral T cells .........................90
3.4 Discussion ....................................................................................................................94
3.5 Acknowledgements ......................................................................................................97

CHAPTER 4: SUMMARY AND FUTURE DIRECTIONS

4.1 Introduction ..................................................................................................................98
4.2 MYSM1’s Role in Gut-Specific Homing ....................................................................98
4.3 MYSM1’s Role in Thymocyte Development ............................................................103
4.4 Conclusion .................................................................................................................107

REFERENCES ...............................................................................................................108

vi

LIST OF TABLES

1.1 Table of CC Chemokines .............................................................................................. 3
1.2 Table of qRT-PCR Primers ..........................................................................................64

vii

LIST OF FIGURES

1.1 Overview of regulated migration events during T cell development ............................4
1.2 A potential mechanistic model for thymic settling ........................................................6
1.3 Regulation of early thymocyte development by transcription factors ..................................10
1.4 Vitamin A and the imprinting of small intestinal trafficking ......................................19
1.5 MYSM1 Regulation of transcriptional initiation and elongation ................................26
2.1 Lymphocyte composition of WT and MYSM1-defcient mice ....................................40
2.2 Naïve and activated T cells in PLO .............................................................................41
2.3 CCR9 expression of mature lymphocytes in the peripheral lymphoid
organs of WT and MYSM1 KO mice .....................................................................43
2.4 LP lymphocyte CCR9 expression and CCR9 mRNA expression in
the PLO of WT and MYSM1 KO mice ....................................................................44
2.5 MYSM1 KO T cells display increased sensitivity to RA stimulation in vitro ............47
2.6 Enhanced expression of CCR9 and α4β7 on MYSM1 KO T cells
during RA stimulation..................................................................................................48
2.7 MYSM1-deficient CD4
+
T cells preferentially migrate to CCL25 .............................50
2.8 MYSM1-deficient CD4
+
T cells preferentially migrate to small intestinal
compartments ...............................................................................................................52
2.9 MYSM1 KO mice are sensitive to orally-induced acute DSS colitis ..................................54
2.10 MYSM1 alters the expression of CCR9-related transcription factors .......................56
2.11 MYSM1 diagram of the Ccr9 gene locus ..................................................................58
2.12 MYSM1 interacts with the Ccr9 locus.......................................................................59
3.1 MYSM1 KO mouse thymic size and cellularity ..........................................................73
3.2 Characterization of MYSM1 KO mouse thymocyte populations ................................74
3.3 Characterization of MYSM1 KO mouse DN thymocyte populations .........................75
3.4 CCR9 expression of on total thymocytes of WT and MYSM1 KO mice ...................77
3.5 CCR9 expression on thymic subpopulations of WT and MYSM1 KO mice ..............78
3.6 CCR9 expression on thymic DN populations of WT and MYSM1 KO mice .............79
3.7 CCR9 mediated chemotaxis of WT and MYSM1 KO thymocytes .............................81
3.8 Migratory capacity of WT and MYSM1 KO thymocyte subpopulations....................82
3.9 Characterization of ETPS in WT and MYSM1 KO mice............................................84
3.10 Expression of CCR9 on BM-derived progenitors and ETP in WT and
MYSM1 KO mice ......................................................................................................85
3.11 Proliferation of WT and MYSM1-deficent thymocyte subsets .................................87
3.12 Apoptosis levels in thymocyte subsets of WT and MYSM1 KO ..............................89
3.13 T cell proliferation and activation are altered in MYSM1 KO mice .........................91
3.14 Apoptosis levels in peripheral T cells in WT and MYSM1 KO mice .......................93

viii

ABSTRACT

Directed cellular migration, also known as homing, is the hallmark of an efficient
and effective immune system. Not only is cellular migration a necessary requirement to
attain developmental maturity for multiple immunological lineages, it is a fundamental
functional mechanism that ensures coordinated and specific immune responses.
Dysregulated immunological homing can result in a myriad of consequences including
autoimmune disorders or the inability to proper engage and clear pathogenic organisms.
To facilitate successful migration, cells are dependent on a series of specific ligand-
receptor interactions that are unique for individual anatomical compartments.
Chemotactic cytokines, a particular group of soluble signaling molecules that
induce a migratory response by binding to cellular G protein-coupled receptors, are
indispensable in cellular migration. The chemokine CCL25 and its receptor, CCR9, are
integral for the development of thymocytes as well as inflammatory cell responses in the
small intestine and colon. Expression of CCR9 by thymic settling progenitor cells has
been shown to be critical for transmigration through the thymic endothelium. Mice that
lack CCR9 expression display defects in thymic colonization. Moreover, the ability of
mature lymphocytes to migrate to the small intestine is contingent on the expression of
CCR9. Recently, the novel histone H2A deubiquitinase MYSM1 has been implicated as a
regulator of T cell development and function. Using a MYSM1-deficent mouse model, I
report in this dissertation that MYSM1 is required for optimal expression of CCR9 on
CD4
+
T helper cells as well as developing thymocytes.

ix

Examination of CCR9 on CD4
+
and CD8
+
T cells in MYSM1 KO mice revealed
elevated levels of expression in a number of peripheral lymphoid organs. MYSM1 KO
mice exhibited increased accumulation of T lymphocytes in the gut-associated lymphoid
tissues and the intestinal lamina propria. In the intestinal context, CCR9 expression is
induced through uptake of the vitamin A metabolite, retinoic acid (RA). Stimulation of
naïve MYSM1 KO CD4
+
T cells with RA resulted in elevated levels of CCR9 expression
compared to similarly treated WT cells. Moreover, RA-stimulated MYSM1 KO T cells
displayed greater chemotactic sensitivity to CCL25 in vitro and homed more efficiently
to the small intestine in vivo. I also show that MYSM1 interacts with the Ccr9 locus and
implicate MYSM1 in the regulation of several CCR9-related transcription factors.
Next, I investigated MYSM1’s role in CCR9 regulation during thymocyte
development. CCR9 expression is necessary for optimal thymic colonization and cellular
localization during thymopoiesis. Surprisingly MYSM1-deficient bone marrow-derived
progenitors possess diminished levels of CCR9 expression and are inhibited from
properly settling the thymus. Expression of CCR9 on MYSM1-deficient thymocytes is
decreased as well, resulting in diminished chemotactic sensitivity toward CCL25.
MYSM1-deficient thymocytes also exhibit significantly altered levels of proliferation and
apoptosis that likely contribute to contracted thymocyte populations observed in MYSM1
KO mice. Collectively, these results suggest that MYSM1 is a novel regulator of CCR9
expression and likely plays a role in the optimal development and function of T
lymphocytes.

1

CHAPTER 1
INTRODUCTION

1.1 CHEMOKINES
Chemokines are small, soluble cytokine signaling molecules that induce a migratory
response when matched with the target cell that possesses the complimentary receptor
specific for the chemokine’s structural motif. All chemokines are relatively similar in size
(8-10 kDa) and carry conserved cysteine residues that define their characteristic shape
(Handel and Domaille 1996). The primary function of chemokines is to direct cellular
migration to an explicit tissue or anatomical area by binding to complimentary G-protein
coupled chemokine receptors (Cyster 2005, Charo and Ransohoff 2006). Generally,
chemokine ligands are present on the endothelial layers of blood vessels as well as the
extracellular matrix of organ tissues to help facilitate entry of chemokine receptor-
bearing circulating cells to these locations (Rot and von Andrian 2004). Currently, there
are over 70 known chemokine ligands and receptors that are divided by common
structural motifs (Zlotnik and Yoshie 2000, Charo and Ransohoff 2006) (Table 1.1).
Generally chemokines are divided into two functional groups: homeostatic and
inflammatory. Homeostatic cytokines are constitutively expressed and are generally
responsible for developmentally necessary migration. Inflammatory cytokines are usually
upregulated during pathogenic activity, in which they actively direct cells to the specific
sites of infection (Luster 1998, Kim and Broxmeyer 1999, Gerard and Rollins 2001).
Dysregulation of chemokines and chemokine receptors has been shown to have dramatic

2

effects on immune system development and functional capability (Mora 2008, Koboziev,
Karlsson et al. 2010, Thomas and Baumgart 2012).

Table 1.1 CC Family of Chemokine and Chemokine Receptors *MIP denotes macrophage
inflammatory protein, MCP: monocyte chemoattractant protein, HCC: hemofiltrate chemokine,
Th2 type 2 helper T cells, TARC thymus and activation-regulated chemokine, MDC:
macrophage-derived chemokine, LARC: liver and activation-regulated chemokine, ELC:
Epstein–Barr I1-ligand chemokine, SLC secondary lymphoid-tissue chemokine, TECK: thymus-
expressed chemokine, CTACK: cutaneous T-cell–attracting chemokine, and MEC: mammary-
enriched chemokine. Table adapted from Charo and Ransohoff, 2006

3

1.2 T CELL PROGENITOR DEVELOPMENT
Functionally mature T cells develop in thymus. However, the thymus does not possess a
population of self-renewing stem cells. T cells originate from bone marrow-derived
progenitors where, before migrating to the thymus to become functionally mature, they
undergo several rounds of differentiation in the bone marrow (Kondo, Weissman et al.
1997, Boehm and Bleul 2006, Bhandoola, von Boehmer et al. 2007) (Fig 1.1). Migration
of bone-marrow progenitors to the thymus is a complex, highly regulated process that is
not entirely understood.
The first hematopoietic progenitors that are capable of seeding the thymus
originate in the bone marrow and are characterized by the lack of lineage markers
expressed on mature immunological cell types as well as by the expression of the stem
cell-specific markers SCA1 and c-KIT (Bhandoola, von Boehmer et al. 2007). These
cells, broadly termed as LSK cells, are actually a heterogeneous mixture of various stem
cells whose differentiation potential can be further characterized by expression of other
markers such as FLT3, CD48 and CD150 (Kiel, Yilmaz et al. 2005). The most potent
LSK cell types express CD150 and are known as long-term self-renewing HSCs. Once
expression of CD150 is lost so is the ability to self-renew, but these cells still possess the
capacity to form all hematopoietic lineages and are designated as multipotent progenitors
(MPP) (Adolfsson, Borge et al. 2001, Christensen and Weissman 2001, Adolfsson,
Mansson et al. 2005, Kiel, Yilmaz et al. 2005). Once MPPs begin to express FLT3, they
upregulate several lymphoid-specific genes and are known as lymphoid-primed MPPs
(LMPP) (Igarashi, Gregory et al. 2002, Yokota, Kouro et al. 2003).

4

Figure 1.1 Overview of regulated migration events during T cell development. Within the
bone marrow, hematopoietic stem cells (HSCs) differentiate into multipotential progenitors
(MPPs). A subset of MPPs that are FLT3
hi
initiates transcription of the genes encoding RAG1 and
RAG2 and are termed lymphoid-primed multipotential progenitors (LMPPs; also known as
ELPs). Subsequent lymphoid-primed bone marrow progenitors include common lymphoid
progenitor (CLPs). All these progenitors will make T cells if placed within the thymus. However,
the ability of hematopoietic progenitors to migrate to the thymus is regulated, requiring among
other molecules the CC-chemokine receptor 9 (CCR9), which is expressed by subsets of LMPPs
and CLPs, and CCR7, which is expressed by some LMPPs and highly expressed on CLPs. The
identity of in vivo thymus settling progenitors (TSPs) has not been precisely determined, but they
likely include LMPPs and CLPs. TSPs enter the thymus near the cortico-medullary junction,
where they may spend a prolonged period of time as KIT
+
DN1 thymocytes (also known as
ETPs) before migrating to the subcapsular zone as double-negative 2 (DN2) and double-negative
3 (DN3) cells. DN3 cells require CXCR4 to efficiently develop into double-positive (DP)
thymocytes. These DP thymocytes express high levels of CCR9; however, the function of CCR9
in DP thymocytes remains unclear. DP thymocytes that undertake appropriate interactions with
self peptide–MHC complexes on cortical thymic epithelial cells (positive selection), upregulate
expression of CCR7 and mature into single-positive (SP) mature T cells that migrate into the
thymic medulla. Residence in the medulla (where negative selection occurs) is followed by
emigration regulated by S1P
1
. Figure taken from (Love and Bhandoola 2011).

5

LMPPs that express CD127 are termed common lymphoid progenitors (CLP) (Schwarz,
Sambandam et al. 2007). It has recently been shown that HSCs and MPPs are incapable
of colonizing the thymus, while LMPPs and CLPs possess thymic colonization potential
(Scimone, Aifantis et al. 2006, Lai and Kondo 2007, Schwarz, Sambandam et al. 2007).
Therefore, it is widely believed that the ability of bone marrow-derived progenitors to
settle the thymus is gained at the latter stages of HSC differentiation.

1.3 THYMIC COLONIZATION
Efficient progenitor settling of the thymus is dependent on an ordered series of receptor-
ligand interactions. Although the exact mechanism is still under investigation, progenitor
entry into the thymus from circulation is believed to mirror mature lymphocyte entry into
lymph nodes (von Andrian and Mackay 2000, Scimone, Aifantis et al. 2006). In that,
lymphocytes circulating through post-capillary venules use a succession of selectins,
chemokine receptors, and integrins to halt movement and extravaste through the
endothelial wall of thymus (von Andrian and Mackay 2000) (Figure 1.2). Selectins bind
to endothelial-expressed selectin ligands, which slow the cell so that it “rolls” along the
endothelial surface. Close contact with the endothelial surfaces allows interaction with
the chemokines expressed by endothelial cells. Chemokines bind to G-protein coupled
receptors expressed on a cell’s surface. Correct chemokine receptor-ligand interaction
activates the cell and causes the conformational change of cell surface integrins.

6

Figure 1.2 A potential mechanistic model for thymic settling. TSPs arrive at the thymus via
the bloodstream. The interaction between surface PSGL-1 on these progenitors and P-selectin on
the thymic endothelial cells slows the progenitors and causes them to roll. By closely associating
with the endothelial cells, the progenitors gain access to soluble chemokines available near the
vessel wall, including CCL19 and CCL25. These chemokines bind and signal through CCR9 and
CCR7 on the progenitors, causing conformational changes in integrin dimers. Once activated, the
integrins can now bind their ligands on the endothelial surface with high affinity and mediate firm
arrest of the progenitors. This adhesion is followed by the transmigration (diapedesis) of the
progenitor through the endothelial layer into the thymic parenchyma where they can proceed
down the T cell developmental path. Figure taken from (Zlotoff and Bhandoola 2011).

7

The conformational change of integrins leads to a high-affinity state that binds to ligands
on the endothelial surface. Integrin binding abrogates all movement of the cell and likely
mediates the cell’s migration through the endothelial wall.
Bone marrow-derived progenitors express the selectin ligand PSGL-1 and bind to
P-selectin on thymic endothelial cells (Gossens, Naus et al. 2009). Ablation of PSGL-1
has been shown to reduce the number of early thymic progenitors (ETP), the first
detectable progenitors that have colonized the thymus from bone marrow progenitors,
and inhibit the generation of mature thymocytes (Rossi, Corbel et al. 2005). Recent
studies have identified two key chemokine signals that are necessary for optimal thymic
colonization, CCR7 and CCR9 (Krueger, Willenzon et al. 2010, Zlotoff, Sambandam et
al. 2010)
Both LMPP and CLP cell populations have been shown to actively express CCR7
and CCR9 (Benz and Bleul 2005, Schwarz, Sambandam et al. 2007, Zlotoff, Sambandam
et al. 2010). Thymic endothelial cells have high expression levels both CCR7 and CCR9
ligands (CCL19, CCL21 and CCL25) (Uehara, Grinberg et al. 2002, Uehara, Song et al.
2002, Ueno, Hara et al. 2002, Liu, Ueno et al. 2005, Gossens, Naus et al. 2009).
Moreover, CCL19 and CCL21, the CCR7 ligands, are expressed in the medulla and
CCL25, the CCR9 ligand, is expressed by thymic stromal cells. Mice that lack either the
CCR7 or CCR9 were shown to possess smaller populations of ETPs and lower rates of
thymic settling. However, individual CCR7 or CCR9 KO mice displayed near-normal
thymic cellularity and size indicating several compensatory or alternative mechanisms are
present to facilitate proper thymocyte development (Krueger, Willenzon et al. 2010,

8

Zlotoff, Sambandam et al. 2010). This was revealed with CCR7 and CCR9 double KO
mice, which displayed a complete ablation of thymic colonization with a 100-fold
reduction of ETPs yet surprisingly possessed near normal levels of thymocyte cellularity.
It was revealed that compensatory proliferation by a subset of early intrathymic
progenitors propelled normal thymocyte cellularity. Although it is clear that CCR7 and
CCR9 are involved in proper thymic settling, the mechanisms by which their expression
is regulated are still unknown.

1.4 THYMOCYTE DEVELOPMENT
The thymus is comprised of three distinct anatomical areas: the medulla, the cortex, and
the subcapsular zone (Fig. 1.1). Once the early progenitors egress from circulation into
the thymus, they initially reside in the cortical medullary junction and undergo several
rounds of proliferation before becoming committed as ETPs, which signals irreversible
commitment to the T cell lineage (Lind, Prockop et al. 2001). Thymocyte development is
primarily characterized by the transition of cells through four stages of maturation that
culminate with high levels of CD4 or CD8 expression.
Specific surface markers are used to delineate the unique stages of thymocyte
development (Love and Bhandoola 2011, Dzhagalov and Phee 2012). The first stage is
characterized by the lack of expression of both CD4 and CD8 and is known as the double
negative (DN) stage. DN thymocytes transition to a CD4
+
CD8
+
double positive state
(DP) and then into either a CD4
+
single positive (CD4SP) or a CD8
+
single positive
(CD8SP) state. The DN stage is further divided into distinct stages based upon the

9

specific expression of FLT3, c-Kit, SCA-1, CD25, and CD44 (Fig. 1.3). ETPs that
express FLT3, c-Kit, and CD44 are classified as DN1 cells (Benz and Bleul 2005). The
loss of FLT3 and SCA-1 expression is associated with DN1 migration into the cortex as
well as the transition to the DN2 stage (Plotkin, Prockop et al. 2003). CCR7 and CCR9
have been implicated in DN1 migration to the cortex, but mislocalized DN1 cells proceed
normally through thymocyte development (Uehara, Grinberg et al. 2002, Benz and Bleul
2005). A number of transcription factors are involved in ETP to DN2 maturation
including, Notch, T-cell Factor 1, E2A, Runx, and GATA3 (Bain, Engel et al. 1997, Dias,
Mansson et al. 2008, Hosoya, Kuroha et al. 2009, Weber, Chi et al. 2011). Silencing any
of these transcription factors will result with developmental arrest in the DN1 or DN2
stage. DN2 cells continue to migrate through the cortex to the subcapsular zone
coinciding with the upregulation in expression of the transcription factor Bcl11b. Increase
in Bcl11b, as well as down regulation of CD44 indicate a transition to the DN3 stage
(Ikawa, Hirose et al. 2010). Once DN3 cells reach the subcapsular zone, the process of
irreversible T cell lineage commitment begins. First, DN3 thymocytes undergo V(D)J
rearrangement of the T cell receptor (TCR) β-chain (TCRb), TCRγ-chain (TCRg) and
TCRδ-chain (TCRd) (Wolfer, Wilson et al. 2002). Rearrangement of the TCRd and
TCRg genes initiates commitment to γδ T cell lineage. On the other hand, the
rearrangement of the Tcrb gene locus initiates expression of the pre-TCR (Michie and
Zuniga-Pflucker 2002, Baldwin, Sandau et al. 2005). Pre-TCR signaling, also known as
β-selection induces proliferation of DN3 cells, down regulation of CD25, and the

10

upregulation of CCR9, all of which indicate transition to the DN4 stage of thymocyte
development

Fig. 1.3 Regulation of early thymocyte development by transcription factors. The stages of early T-cell
differentiation are shown in the middle. On the top, the expression of the markers defining each stage is shown. The
stages during which each transcription factor functions are shown at the bottom. The black arrows indicate the points
where transcription factors are required, whereas the black bar indicates inhibition by Id3. Taken from (Naito,
Tanaka et al. 2011)

11

(Norment, Bogatzki et al. 2000). Similar to earlier stages, CCR9 expression in the
DN4 stage correlates with the proper localization of thymocytes; however, DN4 cells
lacking CCR9 still develop properly (Benz and Bleul 2005). With the transition from the
DN3 stage to the DN4 stage, thymocytes begin to migrate out of the subcapsular zone
and back into the cortex. Once entering the cortex, DN4 thymocytes leave the DN stage
and start to express high levels of CD4 and CD8, indicating entrance to the DP stage of
thymocyte development.
The DP thymocyte stage represents the largest proportion of cells within the
thymus. DP cells continue to express elevated levels of CCR9 and are especially sensitive
to the CCR9 ligand, CCL25 (Norment, Bogatzki et al. 2000, Wurbel, Malissen et al.
2006). In the cortex, DP thymocytes start to express the TCRα chain, which replaces the
pre-TCR with a mature and fully functional αβ TCR complex. These cells then undergo a
process known as positive selection. Here, the ability of the αβ TCR complex to generate
an activation signal (CD69) to self-ligands is examined. Cortical epithelial cells express a
peptide-MHC (p-MHC) complex that interacts with the newly formed αβ TCR complex
and provides signals for further DP cell maturation (Dzhagalov and Phee 2012). It has
been shown that DP thymocytes that react to MHC class I peptides differentiate into
CD8SP thymocytes while DP thymocytes that react to MHC class II peptides
differentiate into CD4SP thymocytes (Singer, Adoro et al. 2008). This is a highly
selective process where only a small portion of DP cells will be allowed to mature. DP
cells that do not generate an activation signal (CD69
-
) in response to p-MHC interaction
arrest and die in the cortex while cells that generate activation signals (CD69
+
) transition

12

to either a CD4SP or CD8SP state. Activated DP thymocytes (CD4
+
CD8
+
CD69
+
) express
high levels of CCR7 and CCR9, and show heightened sensitivity to their respective
ligands compared to non-activated DP thymocytes (CD4
+
CD8
+
CD69
-
) (Kurobe, Liu et al.
2006, Davalos-Misslitz, Worbs et al. 2007). Moreover, CD4SP and CD8SP thymocytes
that express CD69 also express high levels of CCR9 and CCR7 (Misslitz, Pabst et al.
2004, Wurbel, Malissen et al. 2006). It is believed that expression of CCR7 and CCR9
coordinate and direct the migration of activated DP and SP cells to the thymic medulla
where they can undergo negative selection and eventual thymic emigration (Yin, Ladi et
al. 2007, Singer, Adoro et al. 2008).
The thymic medulla is the primary site for expression of CCR7 ligands, CCL19
and CCL21. Mice that are deficient in CCR7 expression exhibit inefficient migration of
positively-selected DP thymocytes to the medulla and will subsequently develop
autoimmune disorders by failing to undergo negative selection (Davalos-Misslitz,
Rieckenberg et al. 2007). Since CCL25 is expressed primarily in the cortex it is theorized
that CCR9 may act antagonistically toward CCR7 which directs migration toward the
medulla (Nitta, Nitta et al. 2009). As activated DP thymocytes begin to transition to SP
thymocytes, CCR9 expression on these cells begins to diminish (Wurbel, Malissen et al.
2006). Moreover, it has recently been shown that the receptor semaE3-plexinD1, which is
upregulated following positive selection significantly inhibits attraction toward CCL25
(Choi, Duke-Cohan et al. 2008). Therefore, the inability to react toward CCL25 coupled
with medullary CCL19 and CCL21 expression propels thymocytes to cross the cortico-
medullary junction and into the medulla. However, CCR9-deficient mice do not display

13

any defects in the migration or localization of SP thymocytes and its precise mechanism
in DP thymocyte development is still unknown (Ehrlich, Oh et al. 2009).
Negative selection, the process by which self-reactive thymocytes are removed
from the cellular milieu, occurs once thymocytes enter the medulla and is the last
maturation stage before thymic emigration. The medulla contains a number of specialized
ways to display self-antigens to SP thymocytes. Thymic epithelial cells display tissue
specific proteins (Derbinski and Kyewski 2010). Medullary dendritic cells present
blood-borne antigens (Baba, Nakamoto et al. 2009). Circulating dendritic cells display
extrathymic antigens (Bonasio, Scimone et al. 2006). SP thymocytes that react to self-
antigens are subject to pro-apoptotic stimulation and eventually undergo apoptosis
(Ehrlich, Oh et al. 2009). As the SP thymocytes scan all of the self-antigens they begin to
transition from an activated, semi-mature state (CD69
high
CD62L
low
CD24
hi
) to a quiescent
mature state (CD69
low
2CD62L
high
CD24
low
) (Kishimoto and Sprent 1997). It has been
shown that SP thymocytes only spend 4-5 days in the medulla compared to several weeks
in the other phases of thymocyte differentiation (McCaughtry, Wilken et al. 2007). Yet, it
has been shown that all thymocytes interact with every antigen during this time. It has
been proposed that migration through the thymus is directed by the signals that brought
them to the thymus, CCR7 and CCR9. Both CD4SP and CD8SP thymocytes still possess
CCR9 expression and are attracted to CCL25 (Wurbel, Malissen et al. 2006). Moreover,
specific sets of medullary SP thymocytes express the chemokines CCR8 and CXCR4
(Schabath, Muller et al. 1999, Kremer, Carramolino et al. 2001). It has been implicated
that disrupted chemokine expression on SP medullary thymocytes may cause

14

developmental defects (Davalos-Misslitz, Worbs et al. 2007, Trampont, Tosello-
Trampont et al. 2010). A requirement of chemokine expression for thymic egress has not
been determined and in depth characterization of chemokine-dependent migration inside
the thymic medulla has yet to be completed.

1.5 THYMOCYTE EMIGRATION
Mature thymocytes egress from the thymus and into circulation in a chemokine
dependent manner. Expression of Pertussis toxin, a known inhibitor of G-protein coupled
receptors, has been shown to severely inhibit thymocyte egress (Chaffin, Beals et al.
1990, Chaffin and Perlmutter 1991). However, ablation of traditional thymus-related
chemokines, CCR7, CCR9, CCR4 and CXCR4 are not directly involved in this inhibition
(Schabath, Muller et al. 1999, Davalos-Misslitz, Worbs et al. 2007, Schwarz, Sambandam
et al. 2007). It was later revealed through screening of small molecule
immunosuppressive drugs that sphingosine-1-phosphate receptor 1 (S1P1) is primarily
responsible for optimal thymocyte egress (Allende, Dreier et al. 2004, Matloubian, Lo et
al. 2004). Disruption of S1P1 inhibits thymocytes from entering the circulation and
overexpression of S1P1 induces aberrant egress of DP thymocytes (Zachariah and Cyster
2010). It has been shown that CD69 is a primary regulator of S1G1 (Shiow, Rosen et al.
2006). When CD69 is expressed on positively selected DP and SP thymocytes, S1G1 is
not expressed. However, as CD69 expression diminishes as SP thymocytes gain maturity,
S1P1 expression increases concomitantly. Moreover, inhibition of CD69 increases
thymocyte egress in a S1G1 dependent process (Shiow, Rosen et al. 2006, Zachariah and

15

Cyster 2010). Both CD69 and S1G1 expression are believed to be under the direction of
TCR signaling.
When thymocytes undergo positive selection, the TCR chain is activated, which
in turn activates the phosphoinositide 3-kinase (PI3K)–AKT pathway (Cantrell 2003).
PI3K controls the post translational state of the common transcription factor forkhead box
O1 (FOXO1) where PI3K phosphorylates FOXO1, diminishing its DNA binding ability.
FOXO1 has been shown to be necessary for the expression of the transcription factor
Kruppel-like factor 2, which is directly responsible for expression of thymic export
proteins: S1G1, CD62L and CCR7 (Carlson, Endrizzi et al. 2006, Fabre, Carrette et al.
2008, Sinclair, Finlay et al. 2008). Thymocytes exit the thymus in a comparable way that
bone marrow-derived progenitors enter the thymus, where chemokines (CCR7) and
structural adhesion proteins (CD62L) facilitate the transmigration through the vascular
wall and back into circulation (Ueno, Hara et al. 2002). Moreover, these markers are
critical for proper T cell homing and in turn, T cell functional development in the
periphery, as well.

1.6 NAÏVE T CELL MIGRATION
Upon exit from the thymus, naïve T cell migration and entry into lymphoid tissue is
directed by the coordinated regulation of cell surface adhesion receptor expression.
Invariably, naïve T cells will migrate through lymphatic vessels and eventually enter
peripheral lymph nodes (LN) via expression of LFA and CCR7 (Campbell, Hedrick et al.
1998, Gunn, Tangemann et al. 1998). LNs are organized lymphoid structures positioned

16

throughout the peripheral tissues of the body. LNs serve several important functions in
the regulation of immune function including the storage and collection of antigens and
antigen presenting cells (APCs) (Gowans and Knight 1964). LNs recruit large numbers of
naïve T cells from circulation, serve as a site for antigen presentation and affect the
functional ability of the cells located within them. LNs provide an environment in which
primary and secondary effector reactions are initiated and directed or, on the flip side,
where immune tolerance is maintained (Scheinecker, McHugh et al. 2002). Homing and
entry into LNs is directed by the expression of specific proteins expressed by the
lymphocytes and the LNs (Butcher and Picker 1996).
As has been previously noted, naive T cell entry into the LNs is regulated by three
distinct adhesion events that each requires ligand-receptor specificity for optimal
transmigration (von Andrian and Mackay 2000). As a prerequisite for thymic emigration,
naïve T cells should express CD62L and CCR7 (Campbell, Hedrick et al. 1998). As the
lymphocytes are traveling through the circulation, lymphocyte-expressed selectins
(CD62L) bind to endothelial-expressed selectin ligands (PNAD) (Streeter, Rouse et al.
1988, Berg, Robinson et al. 1991). Selectin binding causes the lymphocytes to draw near
to and “roll” slowly along the endothelial surface. Rolling allows the lymphocytes to
interact with chemokine ligands (CCL21) also expressed on the endothelial surface.
Accurate chemokine ligand and receptor interactions (CCL21-CCR7) induce strong
integrin-based adhesion (LFA1) and transmigration through the wall of the vessel (von
Andrian and Mempel 2003). Without the proper ligand-receptor expression pattern, entry
into the LN does not occur. Although expression of CD62L and CCR7 will allow entry

17

into peripheral LNs, it does not grant entry into the secondary tissue associated with the
lymph node (Butcher, Williams et al. 1999, von Andrian and Mackay 2000, Masopust,
Vezys et al. 2001). It has been shown that during activation of naïve T cells within
lymph nodes, expression of lymphocyte homing markers is altered.
It is within LNs that naïve T cells become functionally active. Professional
antigen presenting cells (APCs) accumulate in LNs waiting to interact with a cognate
naïve T cell. If the naive T cell recognizes the cognate antigen, the cell will begin to
mount an effector response to destroy the antigen source or it will become tolerant and
die (von Andrian and Mempel 2003). It has been shown that when naïve cells are
exposed to antigen in a specific lymph node, they preferentially home to the secondary
tissue associated with the lymph node in a process known as imprinting (Guy-Grand,
Griscelli et al. 1978, Campbell and Butcher 2002). During activation, TCR and
costimulatory factor uptake induce the expression of specific cellular surface homing
markers (Kantele, Zivny et al. 1999). Different anatomical locations require unique
receptor sets as a way to enhance the specificity of coordinated inflammatory reactions.
For example, T cells that are activated in cutaneous lymph nodes upregulate the
expression of the chemokine CCR4, which allows transmigration and entry into the
dermal layers (Sigmundsdottir and Butcher 2008). On the other hand, T cells activated in
mesenteric lymph nodes (MLN) and Peyer’s Patches (PP) express CCR9, which allows
entrance into the gut mucosal tissues including the small intestine and colon (Johansson-
Lindbom, Svensson et al. 2003, Mora, Bono et al. 2003).

18

1.7 T CELL MIGRATION TO THE INTESTINAL MUCOSA
The intestinal mucosa is comprised of the intestinal epithelium and the underlying
intestinal lamina propria. Interspersed within the intestinal mucosa is gut associated
lymphoid tissue (GALT). The GALT is a network of MLNs and PPs that organize and
facilitate inflammatory responses throughout the intestinal tract. The intestines are a
primary location for immunological activity as the mucosal layers of the intestine are
constantly bombarded with commensal and pathogenic organisms. Not surprisingly, the
intestinal mucosa and GALT are home to a large number of lymphocytes. Highly
regulated and coordinated immune responses in the intestine are essential to ensure
homeostasis and immune tolerance. The modulation of T cell localization is a key aspect
in the regulation of intestinal immune responses (Fig. 1.4).
Naïve T cells enter MLNs and PPs from circulation through high-endothelial
venules via CD62L and CCR7 (Marchesi and Gowans 1964, Girard and Springer 1995).
Within MLNs and PPs, naïve T cells encounter antigens from APCs usually in the form
of CD103
+
dendritic cells (DC). During antigen presentation, the T cells begin to take on
a gut-specific phenotype (Johansson-Lindbom, Svensson et al. 2005). Meaning, T cells
down regulate expression of CD62L and CCR7 and upregulate expression of CCR9 and
the integrin receptor, α4β7. After leaving the MLN or PP and reentering circulation,
CCR9 and α4β7 allow the cell entry through the endothelium of the small intestine
(Butcher, Williams et al. 1999). The CCR9 ligand, CCL25 is found on the endothelial
surface of the intestine (Vicari, Figueroa et al. 1997, Zabel, Agace et al. 1999, Kunkel,
Campbell et al. 2000).

19

Figure 1.4 Vitamin A and the imprinting of small intestine trafficking. Vitamin A is obtained
through the diet as retinol which is locally processed to retinol. Retinol is oxidized to retinal by
alcohol dehydrogenases (ADH), and retinal is then oxidized to the active metabolite retinoic acid
(RA) by retinal dehydrogenases (RALDH). The small intestines absorb vitamin A and efficiently
process retinol to RA; these retinoids are therefore represented at high concentrations in the gut
wall. DCs in the lamina propria process antigen internalized by M cells and are educated by the
local environment. Mucosal DCs, in particular the educated CD103
+
subset, also express enzymes
(ADH, RALDH) necessary for processing retinol to RA. Mucosal DCs bearing processed antigen
transport it to the draining MLN, where they present it to naive T cells. CD103
+
DCs from the
small intestines induce rapid and robust RA-dependent signaling in antigen-reactive naive T cells
in the MLN, efficiently imprinting the T cells with small intestine–homing properties by
upregulating CCR9 and α4β7. Mucosal DCs also support B cell differentiation into small
intestine-homing IgA
+
ASCs, a process that involves synergy between IL-5 or IL-6, RA and DCs.
DCs may present antigen in the context of RA to memory or effector T cells in the lamina
propria, as well, potentially reinforcing their expression of small intestine–homing receptors
CCR9 and α
4
β
7
. MAdCAM, mucosal vascular addressin cell adhesion molecule; RAR, retinoic
acid receptor; RXR, retinoid X receptor. Although CCL25 is primarily produced by intestinal
epithelial cells, the ligand becomes tethered to the endothelium to aid in transmigration.
Circulating gut-specific T cells will bind CCL25; this binding induces the active confirmation of
α4β7. Active α4β7 binds to its endothelially-expressed ligand, MadCAM-1 (Zabel, Agace et al.
1999). Once bound to MadCAM-1, the gut-specific T cell will transmigrate through the intestinal
endothelium and into the intestinal lamina propria (LP) (Svensson, Marsal et al. 2002). It has also
been shown that CCR9 is required for migration through the epithelial basement membrane,
which separates the LP from the intestinal epithelium. In CCR9 KO mice, T cell populations in
the LP are reduced (Wurbel, Malissen et al. 2001, Uehara, Grinberg et al. 2002). Moreover,
CCR9-deficient T cells that are adoptively transferred into WT mice display a reduction in ability
to migrate to the LP. Figure taken and adapted from (Sigmundsdottir and Butcher 2008)

20

Although it has been known that CCR9 was upregulated on gut-specific T cells,
the mechanism by which its expression was induced was only determined recently. The
vitamin A metabolite, retinoic acid (RA), has been shown to be essential for optimal
expression of CCR9 (Iwata, Hirakiyama et al. 2004). RA is generated by gut-specific
CD103
+
DCs and released during antigen presentation with naïve T cells (Jaensson,
Uronen-Hansson et al. 2008). It has been shown that splenic DCs are also able to
generate and secrete RA, but to a much lower extent than gut-specific DCs (Dudda,
Lembo et al. 2005). Gut DCs express high levels of retinal dehydrogenases compared to
splenic DCs, which allow them to process vitamin A into RA more efficiently than
splenic DCs (Coombes and Maloy 2007, Jaensson, Uronen-Hansson et al. 2008). RA
synthesis produces two common RA isoforms, 9-cis and all-trans, and occurs
intracellularly through the progressive oxidation of vitamin A to retinal and eventually to
retinoic acid (Blomhoff and Blomhoff 2006).
After being taken up by the lymphocyte, RA binds to ligand-dependent retinoic
acid transcription factor heterodimers. The heterodimers consist of retinoic acid receptors
(RAR) and retinoid acid receptors (RXR), where each family is comprised of α, β, and γ
isoforms (RARα, RARβ, RARγ, RXRα, RXRβ, RXRγ) (Chambon 1996). Blockage of
RAR and RXR signaling severely inhibits the expression of CCR9 (Iwata, Hirakiyama et
al. 2004, Coombes and Maloy 2007, Sun, Hall et al. 2007). Once the heterodimer binds to
RA, the entire complex translocates into the nucleus where they bind to cis-acting DNA
sequences called RA response elements (RARE). The Ccr9 locus lacks a traditional
RARE site, but does possess a RARE half-site near its first exon that has shown the

21

ability to bind RAR/RXR heterodimers (Ohoka, Yokota et al. 2011). Here, the
heterodimers interact with the common T cell transcription factor, nuclear factor of
activated t cells 2 (NFATc2), to initiate transcription of CCR9. It should be noted that in
addition to RA, typical TCR-mediated signaling, including CD28 costimulatory signaling
is required for optimal CCR9 expression (Ohoka, Yokota et al. 2011). TCR stimulation
allows for the nuclear translocation of NFATc2 by increasing the intracellular Ca
+
levels,
which activates the calcium-dependent phosphatase, calcineurin. Calcineurin
dephosphorylates NFATc2, which allows it to translocate into the nucleus (Engedal,
Gjevik et al. 2006). Clearly, CCR9 expression and immunological migration is a
complex, highly regulated process that involves multiple components.

1.8 ABERRANT HOMING TO THE INTESTINAL MUCOSA
The dysregulation of T cell homing has been implicated in chronic intestinal
inflammation disorders such as Crohn’s disease and ulcerative colitis. Both Crohn’s
disease and ulcerative colitis are types of inflammatory bowel disease (IBD) that are the
result of inappropriate immune responses to nonpathogenic commensal organisms
(Baumgart and Carding 2007, Baumgart and Sandborn 2007). Although both diseases
primarily manifest themselves in the gastrointestinal tract, IBD patients often develop
extra-intestinal autoimmune disorders that involve the joints, eyes, liver, skin, and lungs
(Camus, Piard et al. 1993, Orchard 2003). This indicates the importance of elucidating
the mechanisms surrounding IBD development and pathogenesis.

22

Chronic inflammatory diseases including Crohn’s disease and ulcerative colitis
are characterized by the rapid recruitment and subsequent retention of lymphocytes at
inflammatory sites (von Andrian and Mackay 2000, Baumgart and Carding 2007).
However, the mechanisms by which these disorders develop are still poorly
characterized. A number of recent clinical studies show that disrupting homing receptor-
ligand interactions is a burgeoning therapeutic strategy in the treatment of IBD (von
Andrian and Engelhardt 2003). Because over 90% of T cells found in the small intestine
express the homing markers CCR9 and α4β7, monoclonal antibodies used to disrupt these
markers became a primary focus for researchers (Eksteen, Miles et al. 2004). Blocking
α4β7 integrin delayed the onset of early chronic ileitis in mouse models, but did not
disrupt the incidence or severity of the disease (Hesterberg, Winsor-Hines et al. 1996).
When inhibiting CCR9 with antibodies, researchers were able to delay the onset and
severity of ileitis, but not fully abrogate the disease (Rivera-Nieves, Ho et al. 2006). This
indicates that CCR9 plays an important role in the development of colitis but that
multiple mechanisms are likely involved.
A small molecule inhibitor of CCR9, CCX282, is currently being tested in human
patients with moderate to severe Crohn’s disease. CCX282 has been shown to inhibit
CCR9 mediated chemotaxis of human cells in vitro and normalize experimental Crohn’s
disease in animal models (Walters, Wang et al. 2010). Full results from the clinical trial
have not yet been published; however, early indications are that the efficacy of CCX282
in humans is greatly reduced compared to animal models (GlaxoSmithKlein 2010). These
results make it clear that understanding the mechanisms for regulation of CCR9 and other

23

homing markers will likely be essential in developing future treatments for those
afflicted.

1.9 HISTONES
Histone proteins, found in eukaryotic cells, package genomic DNA into ordered
structural units known as nucleosomes. In nucleosomes, DNA wraps around a histone
octamer consisting of two H2A-H2B dimers and an H3-H4 tetramer. The organization of
DNA into nucleosomal subunits allows DNA to compact itself in such a manner to
conserve space within the cell (Olins and Olins 1974). The compaction of DNA also
provides the cell with another way to control and alter the expression of certain genes.
Post-translational modifications, characterized by the covalent addition or removal of
residues to locations on the nucleosome, result in molecular forces that work to enhance
or lessen the winding tension of the DNA (Li and Widom 2004). The release of tension
allows transcriptional machinery access to particular segments of DNA that would not
normally be accessible (Kouzarides 2007). Moreover, specific residues provide
conformational compatibility/incompatibility, which recruits or blocks the binding of the
necessary cellular machinery to the residue of interest, thereby altering gene transcription
(Ramsey, Knijnenburg et al. 2010). Broadly, the alteration of histone residues through
post-translational modification is known as epigenetic modification.

24

1.10 THE UBIQUITINATION/DEUBIQUITINATION OF HISTONE PROTEINS
Monoubiquitination is a common epigenetic histone modification, but its physiological
function is poorly characterized. Traditionally, protein ubiquitination (polyubiquitination)
has been associated with the degradation of proteins (Pickart 2004). Polyubiquitinated
proteins are targeted and transported to the proteasome (Chau, Tobias et al. 1989).
However, ubiquitin has also been shown to covalently bind specific residues on the
histone core proteins H2A and H2B (Goldknopf, Taylor et al. 1975). Despite its
discovery in 1975, the physiological roles of histone monoubiquitination, as well as the
mechanisms by which it operates, are still poorly understood. However, the recent
identification of a number of novel histone ubiquitinases and deubiquitinases my help
shed some light on the topic.
Particularly, studies have shown that the monoubiquitination of histone proteins
can positively and negatively influence the activation of transcription (Wang, Wang et al.
2004). Moreover, studies of the H2B ubiquitination state revealed that deubiquitinated
H2B is required for the progression of transcription elongation (Chandrasekharan, Huang
et al. 2009). Investigations into H2A ubiquitinase/deubquitinase enzymes have also
revealed a similar role. H2A ubiquitinase, 2A-HUB was recently found to hinder the
expression of specific chemokine genes in an N-CoR/HDAC1/3 corepressor complex by
inhibiting elongation (Zhou, Zhu et al. 2008). Another H2A ubiquitinase Ring1B/Ring2
has been shown as a core component of the Polycomb Repressive Complex 1 (PRC1) (de
Napoles, Mermoud et al. 2004). PRC1 is involved in the regulation and function of
hematopoietic development (Majewski, Ritchie et al. 2010). Moreover, Ring1B has

25

recently been implicated as a regulator Th2 driven pulmonary inflammation by inhibiting
the apoptosis of Th2 effector cells (Suzuki, Iwamura et al. 2010). Another recently
discovered H2A deubiquitinase, MYSM1, has been shown to function as a coactivator of
androgen receptor in transcription initiation (Zhu, Zhou et al. 2007). Moreover, new
insights into MYSM1’s role in hematopoietic development and immunological function
have recently been characterized.

1.11 MYSM1
The histone H2A deubiquitinase MYSM1 (Myb-like, SWIRM and MPN domains 1)
regulates the expression of specific genes. Structurally, MYSM1 contains several
domains commonly associated with histone deubiquitinases. MYSM1 contains a
JAMM/MPN
+
domain, named for its JAB1/MPN/MOV34 motifs, which possess
metalloprotease activity (Zhu, Zhou et al. 2007). Metalloproteases have been shown to
hydrolyze the isopeptide bonds that are associated with ubiquitin chains in an ATP
dependent manner (Sato, Yoshikawa et al. 2008). MYSM1 also contains the SWIRM
DNA/Histone binding domain. SWIRM is named for its composition of Swi2, Rsc8, and
Moira proteins, which belong to the SI/SNF-family of ATP dependent chromatin
remodeling complexes (Yoneyama, Tochio et al. 2007). The Myb-like binding domain is
structurally similar to the DNA binding domain of Myb-related proteins, which are
commonly found in histone binding transcriptional regulators (Boyer, Latek et al. 2004).
MYSM1 was shown to have a stable interaction with the histone acetyltransferase
p300/CBP- associated factor (p/CAF) (Zhu, Zhou et al. 2007). It was proposed that

26

MYSM1 and p/CAF regulate the transcription of genes in a coordinated, stepwise manner
consisting of histone acetylation and subsequent histone deubiquitination. The
deubiquitination of histone H2A causes the dissociation of linker histone H1 from the
nucleosome, which allows transcription machinery access to the DNA (Zhu, Zhou et al.
2007) (Fig. 1.5).

Figure 1.5 MYSM1 Regulation of Transcriptional Initiation and Elongation. At the initiation
step, the 2A-DUB-p/CAF complex is recruited to the promoter region of PSA in response to
ligand, removing the repressive uH2A mark from the acetylated nucleosomes and dissociating
linker histones in a stepwise manner. Taken and adapted from (Zhou, Zhu et al. 2008)

27

Although most of the underlying physiological roles for MYSM1 are unknown,
recent studies have uncovered several novel functions for MYSM1 in immunological
development and function through the generation of MYSM1-deficient mice.
Morphologically, MYSM1 KO mice were fertile and viable but possessed gross
abnormalities in growth and tail formation. Moreover, the peripheral lymphoid organs,
spleen and thymus, were dramatically reduced in size and cellularity (Jiang, Nguyen et al.
2011). Unsurprisingly, MYSM1 mice displayed a number of severe immunological
defects in hematopoietic development. MYSM1 KO mice suffer from lymphopenia with
reductions in cellularity of all mature B and T lymphocytes (Nijnik, Clare et al. 2012). An
MYSM1 promoter-driven reporter showed that MYSM1 is active throughout T cell
development in the thymus as well as B cell development in the bone marrow. Our lab
has shown that MYSM1 has a cell intrinsic role in the successful development of mature
B cells through the regulation of the B cell critical transcription factor EBF1 (Jiang,
Nguyen et al. 2011). EBF1 transcription was initiated by MYSM1 through the removal of
a silencing ubiquitin residue from the Ebf1 promoter region. Moreover, MYSM1 was
found to play a role in the recruitment of other transcription factors to Ebf1.
MYSM1 is also involved in the in the development and function of HSCs (Wang,
Nandakumar et al. 2013). MYSM1-deficient HSCs lost the ability to self-renew due to an
inability to remain quiescent coupled with increased apoptosis. MYSM1 was implicated
in the regulation of the critical HSC transcription factor Gfi1. Rescue of Gfi1 in MYSM1
KO cells ablated some of the physiological manifestations. Although HSC defects may

28

play a role in the T cell reductions of MYSM1 mice, MYSM1 regulation of T cell
development and function is still and active area of research.

1.12 CONCLUSION
It is clear that chemokines play an important role in the generation and maintenance of
immunological homeostasis. However, the mechanisms that govern the expression of
chemokines are poorly understood. Here, I have examined the role that the novel histone
H2A deubiquitinase MYSM1 plays in regulating the expression of the chemokine CCR9
in mice. Through the characterization of a MYSM1-deficeint mouse model, I show that
MYSM1 controls T cell expression of CCR9 during activation in the intestinal mucosa by
enhancing the cell’s sensitivity to RA. Moreover, I go on to show that MYSM1 is likely
involved in the regulation of CCR9 during thymocyte development and may influence the
differentiation capacity and function of mature T cells. These studies further elucidate
previously unknown physiological functions of MYSM1 and its ability to influence the
expression of chemokines.

29

CHAPTER 2
MYSM1 Regulates CCR9 Expression on CD4
+
T Lymphocytes (Yates P,
Nandakumar, V, Wang T, Jones L, Chen SY. Journal of Immunology
(Under Review)

2.1 ABSTRACT
Efficient lymphocyte migration to the small intestine is dependent on the expression of
the chemokine receptor CCR9. The vitamin A metabolite, retinoic acid (RA), induces
expression of CCR9 during lymphocyte activation in gut-associated lymphoid tissue
(GALT). It has been shown that optimal CCR9 expression is dependent on a number of
transcription factors including RA receptors (RARs), retinoid X receptors (RXRs), and
NFATc2. However, much of the regulatory mechanism surrounding CCR9 expression
remains unclear. Recently, the novel histone H2A deubiquitinase MYSM1 has been
implicated in the regulation of a number of T cell functions including activation and
differentiation. In this article, we report that MYSM1 is required for optimal expression
of CCR9 on T helper cells in MYSM1-deficient (knockout [KO]) mice. MYSM1 KO
mice displayed increased accumulation of CD4
+
and CD8
+
T cells in the small intestine
compared to WT counterparts. MYSM1 KO CD4
+
and CD8
+
T cells in various
compartments expressed elevated levels of CCR9. Upon stimulation with RA, naïve
MYSM1 KO CD4
+
T cells exhibited heightened levels of CCR9 expression compared to
similarly treated WT cells. RA stimulated MYSM1 KO T cells migrated more efficiently
to the CCR9 ligand, CCL25, in vitro and more efficiently to the small intestine, in vivo.

30

We also show that MYSM1 interacts with the Ccr9 locus and implicate it in the
regulation of several CCR9-related transcription factors. These results suggest that
MYSM1is a novel regulator of CCR9 induction on T cells and likely plays a role in
maintaining intestinal homeostasis and tolerance.

2.2 INTRODUCTION
Directed lymphocyte migration is essential for the development and maintenance of
immunity and immune tolerance (Butcher, Williams et al. 1999, von Andrian and
Mackay 2000, Masopust, Vezys et al. 2001, Ley, Laudanna et al. 2007, Hall, Grainger et
al. 2011). The site-specific homing of lymphocytes occurs based on the expression of
unique sets of trafficking markers that correspond to different anatomical locations
throughout the body (Guy-Grand, Griscelli et al. 1978, Kantele, Zivny et al. 1999,
Campbell and Butcher 2002). Naive lymphocytes can enter secondary lymphoid organs
from the bloodstream but are restricted from entering secondary tissues until activation
(von Andrian and Mackay 2000, Masopust, Vezys et al. 2001). Lymphocytes then
express a pattern of receptors that allows entrance into the secondary tissue that is
associated with the activation site (Guy-Grand, Griscelli et al. 1978, Kantele, Zivny et al.
1999, Campbell and Butcher 2002). For example, lymphocytes activated in the gut
related peripheral lymphoid organs, e.g. mesenteric lymph node (MLN) and Peyer’s
Patches (PP) express the chemokine receptor CCR9 and the integrin α4β7, which
facilitate effective homing to the small intestine (Hamann, Andrew et al. 1994, Berlin,
Bargatze et al. 1995, Abitorabi, Mackay et al. 1996, Mackay, Andrew et al. 1996, Zabel,

31

Agace et al. 1999, Kunkel, Campbell et al. 2000, Papadakis, Prehn et al. 2000, Wurbel,
Philippe et al. 2000, Marsal, Svensson et al. 2002, Svensson, Marsal et al. 2002, Pabst,
Ohl et al. 2004, Stenstad, Ericsson et al. 2006). Conversely, lymphocytes activated in the
cutaneous lymph nodes primarily express the chemokine receptors CCR4 and CCR8,
which facilitates migration to the skin (Sigmundsdottir and Butcher 2008).
CCR9 interacts with the chemokine ligand CCL25, which is expressed by epithelial
cells of the thymus and the small intestine, inducing adhesion and chemotaxis (Vicari,
Figueroa et al. 1997, Zabel, Agace et al. 1999, Kunkel, Campbell et al. 2000, Wurbel,
Philippe et al. 2000, Wurbel, Malissen et al. 2007). CCR9 expression is induced during
antigen presentation by stimulation of the TCR signaling pathway and the uptake of the
vitamin A metabolite, retinoic acid (RA) (Iwata, Hirakiyama et al. 2004). RA is produced
by a subset of CD103
+
dendritic cells in the mesenteric lymph node (MLN) and Peyer’s
Patches (PP) that possess retinaldehyde dehydrogenase (Niederreither, Fraulob et al.
2002, Iwata, Hirakiyama et al. 2004, Johansson-Lindbom, Svensson et al. 2005, Coombes
and Maloy 2007, Jaensson, Uronen-Hansson et al. 2008). Once taken up by T cells, RA
binds to ligand-dependent transcription factors, RA receptors (RAR) and retinoid acid
receptors (RXR) which heterodimerize and translocate into the nucleus (Mangelsdorf and
Evans 1995, Chambon 1996, Bastien and Rochette-Egly 2004). In the nucleus, RAR and
RXR heterodimers bind to cis-acting DNA sequences known as RA response elements
(RAREs) and interact with NFATc2 to bind to a RARE half-site in the intro near the first
exon of Ccr9 to initiate transcription (Ohoka, Yokota et al. 2011). This process involves

32

several highly coordinated levels of regulation; however, the regulation of the chromatin
structure at the Ccr9 locus is still under investigation.
Histone modifications are essential for chromatin remodeling and transcriptional
regulation (Jenuwein and Allis 2001, Li, Carey et al. 2007). Although many histone
modifications such as acetylation and methylation are well characterized, histone
ubiquitination and its physiological role are still an active area of research (Zhang 2003,
Osley 2004). Protein ubiquitination is involved in many cellular processes including
protein degradation, cell cycle regulation, DNA repair, and transcriptional regulation
(Komander, Clague et al. 2009). Several newly characterized ubiquitin ligases and
deubiquitinases have offered new insight into the physiological role of this class of
molecules (Joo, Zhai et al. 2007, Zhu, Zhou et al. 2007, Nakagawa, Kajitani et al. 2008,
Zhao, Lang et al. 2008, Scheuermann, de Ayala Alonso et al. 2010). Recently, studies
characterizing the H2A ubiquitination state revealed crucial roles in the development and
function of lymphocytes (Zhu, Zhou et al. 2007, Jiang, Nguyen et al. 2011, Nijnik, Clare
et al. 2012).
MYSM1, the Myb-like, SWIRM and MPN domain containing-protein 1, has recently
been characterized as a novel H2A deubiquitinase (Zhu, Zhou et al. 2007, Sato,
Yoshikawa et al. 2008, Jiang, Nguyen et al. 2011)]. The SANT and SWIRM domains
provide binding affinity for DNA and linker histones, respectively (Boyer, Latek et al.
2004, Yoneyama, Tochio et al. 2007). The MPN domain possesses an intrinsic
metalloprotease domain that hydrolyzes the isopeptide bonds of ubiquitin residues (Sato,
Yoshikawa et al. 2008). MYSM1 associates with a complex containing the histone

33

acetyltransferase PCAF, which is required for gene activation in prostate cancer cells
(Zhu, Zhou et al. 2007). MYSM1 is expressed widely throughout the immune system and
is required for normal hematological development (Nijnik, Clare et al. 2012). MYSM1 is
also required for B cells to achieve full developmental potential through interaction with
the EBF1 gene locus (Nijnik, Clare et al. 2012). MYSM1 has been implicated in the
transcriptional regulation of certain chemokines; however, the physiological role of
MYSM1 in chemokine regulation is still under investigation (Zhu, Zhou et al. 2007).
In the current study, we use a MYSM1 KO mouse model to characterize the role of
ubiquitination in the transcriptional regulation of the chemokine CCR9. We observed a
significant increase of CCR9 expression on T cells in the absence of MYSM1. MYSM1-
deficient T cells possessed heightened chemotactic ability to the CCR9 ligand, CCL25,
and were more effective at homing to the intestinal lamina propria (LP) than WT
counterparts. We found that MYSM1-deficient T cells were hypersensitive to RA
stimulation and overexpressed CCR9 compared to wild type controls. Furthermore, we
implicate MYSM1regulation of several CCR9-related transcription factors and show that
MYSM1 interacts with the CCR9 locus.

2.3 MATERIALS AND METHDOS

Mice
The generation of MYSM1-deficient mice was performed as previously described (Jiang,
Nguyen et al. 2011). Briefly, to generate MYSM1 deficient mice, we utilized an MYSM1

34

mRNA truncation strategy. An MYSM1 targeted vector, which consists of an FRT
flanked splice acceptor (En2 SA, lac Z, neomycin, and poly(A) sequence followed by a
loxP site, was inserted into an intron of the intact MYSM1 gene. The insertion of this
cassette produces truncated mRNA during transcription. The splice acceptor captures the
RNA transcript and an added polyadenylation sequence truncates the transcript,
preventing further transcription downstream of the cassette. In addition, the expression of
Cre removes the floxed third exon of MYSM1. MYSM1 mRNA truncation-first floxed
sperm in the C57BL/6J background were provided by the KOMP repository at UC Davis.
The USC Transgene Core Facility carried out the in vitro fertilization, microinjection,
chimera production, and generation of MYSM1 mRNA truncation-first mice. WT
littermates were used as controls for all experiments. Mice were maintained in Specific
Pathogen Free barrier facilities and all experiments were carried out under the approval
of the University of Southern California Institutional Animal Care and Use Committee.

FACS
Multicolor flow cytometry was performed on mice as previously described (Sharabi,
Aldrich et al. 2008, Song, Evel-Kabler et al. 2008, Jiang, Nguyen et al. 2011). Single cell
suspensions from spleen, MLN, peripheral lymph nodes (PLN), PP, and LP were
prepared and stained with CD16/CD32 Fc-blocking antibody in flow cytometry buffer for
20 min at 4 degree C. Samples were then stained with directly conjugated antibodies
(CD3ε, CD4, CD8, CD44, CD45RB, CCR9, α4β7, B220, PNA) from BD Biosciences

35

(BD). Data were collected on a FACS Canto II (BD) and the analysis performed with
FlowJo software (TreeStar).

PP and LP Lymphocyte Isolation
PP and LP lymphocytes were isolated as previously described (Arstila, Arstila et al.
2000). The entire small intestine was harvested and flushed with PBS. PPs were excised
and the intestine was opened longitudinally and cut into 0.5 cm sections. The sections
were then placed RPMI 1640 containing 1% dialyzed BSA, 1mM EGTA, 1.5mM MgCl
2

for 2 x 20 min at 37 Cº to remove intraepithelial lymphocytes and epithelial cells. The
intestinal pieces were then digested in RPMI 1640 containing 20% FCS and 100U/mL
collagenase (type VIII; Sigma-Aldrich) for 60 min at 37 Cº. PP and LP were stained with
mAbs for flow cytometry analysis.

T-cell isolation and culture
Naive T-cells were isolated from spleen and mesenteric lymph nodes as previously
described (Iwata, Hirakiyama et al. 2004). Briefly, CD4
+
CD62L
high
T-cells were purified
using MACS Naive T-cell Kit (Miltenyi Biotec) according to manufacturer’s instructions.
Purity was >97%. Purified cells were plated on tissue culture dishes coated with 5ug/mL
anti-CD3 mAb and 3ug/mL anti-CD28 mAb for 2 d. Cells were resuspended in fresh
medium containing various concentrations of all-trans-retinoic acid (Sigma-Aldrich), as
indicated and 100 U/mL IL-2 for 2 d.

36

Chemotaxis Assay
Chemotaxis Assays were performed as previously described (Campbell and Butcher
2002). 5 x10
5
cells were placed in the upper well of a Corning Transwell plate, with or
without the presence of chemokine in the lower chamber. Transwell experiments were
performed with chemokine concentrations previously shown to induce maximum
chemotaxis (100 nM TARC and 240 nM TECK). After 1 h, the numbers of migrated cells
in the lower chamber were counted and are represented as a percentage of total cell input.

Competitive Homing Assay
In vivo competitive homing assays were performed as previously described (Iwata,
Hirakiyama et al. 2004). Purified MLN T-cells from WT and MYSM1-deficient mice and
stimulated with RA as described earlier. Cells were harvested after 4 d and were labeled
for 15 min with 5 μg/mL TRITC and 0.85 μM CFSE, respectively, at 37 Cº. Cells were
then washed 3X with PBS containing FCS. Five million cells of each population were
mixed and injected intravenously into Rag1
-/-
recipient mice. Recipient mice were
sacrificed 16 h after injection. PLN, MLN, PP, and LP were harvested and the labeled
cells were detected by flow cytometry. Homing index was calculated as the number of
KO cells divided by the number or WT cells.

Dextran Sodium Sulfate Induced Colitis
Dextran sodium sulfate (DSS) induced colitis was performed as previously described
(Fukata, Michelsen et al. 2005). DSS (USB Corporation) was made into a 2.5% w/v

37

solution in distilled water and filtered through a 0.22 μM cellulose acetate filter. DSS
solution was substituted for mouse drinking water in individual cages for 7 d. After 7 d,
DSS water was replaced with normal drinking water. Survival, weight, and blood in stool
were monitored daily (n=12 mice per group for WT and MYSM1 KO). Stool blood was
monitored visually and with Hemoccult strips (Beckman Coulter). Scoring was as
follows: 0, none; 1, trace (Hemoccult); 2, strong positive (Hemoccult); 4, gross
hemorrhage. Mice were sacrificed when weight reached 80% of starting weight.

Quantitative RT-PCR
Quantitative RT-PCR was performed as previously described (Sharabi, Aldrich et al.
2008, Jiang, Nguyen et al. 2011). Total RNA was purified from isolated cells and tissues
using RNeasy Microkit (Qiagen) according to manufacturer’s instructions. Reverse
transcription was completed using the iScript kit (BIO-RAD) according to manufacturer’s
instructions to create cDNA. A SYBR Green PCR kit (BIO-RAD) was used to complete
real-time PCR and the results were quantified using an ICycler IQ (BIO-RAD).
Sequences for the sense and anti-sense primers used are as listed in Table S1.

Chromatin Immunoprecipitation
Chromatin Immunoprecipitation (ChIP) was performed using the Simple ChIP kit (Cell
Signaling) according to manufacturer’s instructions. Briefly, 1 x 10
6
CD4
+
T cells were
cross-linked with 1% vol/vol formaldehyde. Chromatin was isolated, and then digested
with mung bean nuclease (MNase), sheared by sonication, and then immunoprecipitated

38

with anti-MYSM1 antibody or IgG. The immunoprecipitated DNA was washed and
eluted according to manufacturer’s instructions. Eluted DNA and sheared input material
was then analyzed by RT-PCR according to manufacturer’s protocol (Illumina).

Statistics
Groups of 3 to 10 mice were used for statistical analysis. P values were calculated using
Student’s t test. Statistical significance was described as: * = p < 0.05 and ** = p < 0.01.

2.4 RESULTS
To investigate the function of MYSM1 in T cell development and activity, we generated
MYSM1 mRNA truncation-first floxed mice from MYSM1-targeted sperm, as previously
described (Jiang, Nguyen et al. 2011). Homozygous (-/-) mice were fertile and viable, but
did possess skeletal deformation, growth retardation and severe lymphopenia (Jiang,
Nguyen et al. 2011, Nijnik, Clare et al. 2012). Heterozygous +/- mice did not differ in
growth, morphology or viability from their WT littermates. Mice were housed under
specific pathogen free conditions.

2.4.1 Altered T cell composition in the peripheral lymphoid organs and small
intestine of MYSM1 KO mice
Previous studies have shown MYSM1 KO mice possess an altered lymphocyte
composition in the primary lymphoid tissues such as thymus and spleen (Jiang, Nguyen
et al. 2011, Nijnik, Clare et al. 2012). Using flow cytometry, we examined the

39

lymphocyte composition of the peripheral lymphoid organs including PLN, MLN, and PP
as well as the intestinal LP (Fig. 2.1). CD4
+
T cell frequency of MYSM1 KO mice was
significantly increased in the PLN, MLN and LP when compared to WT mice (Fig. 1A).
MYSM1 KO CD4
+
T cell frequency in the PP was increased as well, but only slightly
above the levels monitored in WT mice. CD8
+
T cell frequency was dramatically
decreased in PLN and MLN of MYSM1 KO mice (Fig. 2.1A). Frequency of CD8
+
T cells
in the PP and LP of MYSM1 KO mice was virtually unchanged to frequency levels of
WT mice. Absolute values of CD4
+
and CD8
+
T cells in MYSM1 KO mice were also
assessed by flow cytometry (Fig. 2.1B). Overall, MYSM1 KO mice displayed severe
lymphopenia in the PLN and PP with significant reductions in both CD4
+
and CD8
+
T
cell populations (Fig. 2.1B). Interestingly, CD4
+
T cell populations were relatively
unchanged in the MLN of MYSM1 KO mice and only a slight decrease of CD8
+
T cells
(Fig. 2.1B). Moreover, MYSM1 KO mice possessed significantly increased numbers of
CD4
+
and CD8
+
T cells in the LP compared to WT mice (p < 0.05).
Because CD4
+
T cell accumulation in the LP is associated with T cell activation
and inflammatory responses, we examined the activation state of CD4
+
T cells found in
the lymph nodes associated with intestinal T cell priming in WT and MYSM1 KO mice
(Fig. 2.2A-C). First, we defined naïve CD4
+
T cells as CD45RB
high
/CD44
low
and
memory/activated CD4
+
T cells as CD45RB
low
/ CD44
high
(Fig. 2.2A). Based upon this
gating strategy, we evaluated the frequency of naïve and activated/memory T cells in the
peripheral lymphoid compartments of WT and MYSM1 KO mice.

40

Fig. 2.1 Lymphocyte composition of WT and MYMS1-deficient mice. A and B, Single cell
suspensions from PLN, MLN, PP, and LP of WT and MYSM1 KO mice were stained with
fluorescent antibodies and analyzed by flow cytometry. A. Cell surface expression of CD4 and
CD8 markers in selected peripheral lymphoid organs of WT and MYMS1 KO mice (gated only
by scatter). Percentage of total lymphocytes is indicated in each panel and is representative of six
or more repeats. B. Absolute numbers of indicated population from the peripheral lymphoid
organs and LP of WT and MYSM1 KO mice. Data are presented as mean ± SEM for six
independent experiments. Data are presented as mean ± SEM for six independent experiments.
Statistical significance is expressed: * p < 0.05
WT MYSM1 KO
CD4
CD8
PP
17.6
3.62
15.7
2.59
7.53
85.3
49.4
18.5
PLN
4.47
21.4
57.0
90.1
49.0
9.87
33.8
9.22
LP MLN
Absolute Number of Cells
*
*
*
*
*
A
B

41

Fig. 2.2 Naïve and Activated T cells in PLO A. Gating strategy for naïve and activated/memory
CD4
+
T cells in peripheral lymphoid organs. Naïve CD4
+
T cells are gated as gated CD4
+
/B220
-

/CD44low /CD45RBhigh. Activated/Memory CD4
+
T cells are gated CD4
+
/B220
-
/CD44high
/CD45low. B. Frequency of Naïve CD4
+
T cells in PLN, MLN, and PP of WT and MYSM1 KO
mice. C. Frequency of CD4
+
Memory/Activated T cells in PLN, MLN, and PP of WT and
MYSM1 KO mice. B and C. Data are presented as mean ± SEM for six independent
experiments. Statistical significance is expressed: * p < 0.05.
Memory/Activated T cells
PLN MLN PP
0
10
20
30
40
WT
MYSM1 KO
% of CD4+
Naive T cells
PLN MLN PP
0
20
40
60
80
100
WT
MYSM1 KO
% of CD4+

Naiv
e
A
B
C

42

We detected no significant change in the frequency of naïve CD4
+
T cells of
MYSM1 KO peripheral lymphoid organs (Fig 2.2B). However, examination of PLN and
MLN showed an increase of memory/activated CD4
+
T cells populations in MYSM1 KO
mice (Fig. 2.2C). MYMS1 KO PP did not possess any significant change in
memory/activated CD4
+
T cell populations. This data clearly shows an accumulation of
the CD4
+
T cells in the small intestine of MYSM1 KO mice. The increase of
activated/memory CD4
+
T cells in the MLN suggests that the accumulation of T cells in
the lamina propria could be the result of enhanced gut imprinting.

2.4.2 Elevated expression of CCR9 on CD4
+
T cells in MYSM1 KO mice
Since T cell migration to the intestinal lamina propria is based upon the expression of the
chemokine receptor CCR9, we wanted to evaluate the expression level of CCR9 on
MYSM1 KO T cells. It has been shown that naïve CD4
+
T cells do not express CCR9 and
that CCR9 expression is only induced during activation (Wurbel, Malissen et al. 2006).
On the other hand, naïve CD8
+
cells possess a basal level of CCR9 expression (CCR9
low
),
and then express higher levels of CCR9 (CCR9
high
) upon activation (Wurbel, Malissen et
al. 2006). With this in mind, we first used flow cytometry to determine the level of CCR9
expression on naive CD4
+
and CD8
+
splenocytes in WT and MYSM1 KO mice (Fig.
2.3A). MYSM1 KO CD4
+
and CD8
+
splenocytes displayed no significant difference in
CCR9 expression compared to WT splenocytes.

43

Fig 2.3 CCR9 expression of mature lymphocytes in the peripheral lymphoid organs of WT and MYSM1 KO
mice. A. CCR9 cell surface expression on naïve CD4
+
and CD8
+
T splenocytes from WT and MYSM1 KO mice.
CCR9 expression of MYSM1 KO T splenocytes (black lines) is overlaid WT CCR9 expression (gray filled curves).
Upper Panel, CCR9 expression on WT and MYSM1 KO naïve CD4
+
T splenocytes (gated CD4
+
/B220
-
/CD44
low

/CD45RB
high
lymphocytes). Lower Panel, CCR9 expression on WT and MYSM1 KO naïve CD8
+
T splenocytes
(gated CD3ε
+
/CD8
+
CD44
low
/PNA
low
). B. CD44 vs CCR9 expression of CD4
+
and CD8
+
T cells from PLN, MLN,
and PP of WT and MYSM1 KO mice. The percentage of CD44
high
/CCR9
+
cells is indicated on each graph. Top row,
CD4
+
T cells (gated CD4
+
/B220
-
lymphocytes) of WT and MYSM1 KO mice. Bottom row, CD8+ T cells (gated
CD3ε
+
/CD8
+
lymphocytes)..

A
B

44

Fig. 2.4 LP lymphocyte CCR9 expression and CCR9 mRNA expression of in the PLO of
WT and MYSM1 KO mice. A. CCR9 cell surface expression of LP T cells from WT and
MYSM1 KO mice. B. Fold change (MYMS1 KO/WT) of CD4
+
T cell CCR9 mean fluorescent
intensity. Statistical significance is expressed: **, p < 0.01; *, p < 0.05. C. Ccr9 mRNA
expression of WT and MYMS1 KO CD4
+
T cells isolated from PLN, MLN, PP, and LP. MYSM1
KO Ccr9 expression is normalized to WT Ccr9 expression. Data are pooled from three
independent experiments.

* **
B
C
A

45

Next, we evaluated CCR9 expression on activated (CD44
high
) CD4
+
and CD8
+

lymphocytes in the PLN, MLN, and PP of WT and MYSM1 KO mice (Fig. 2.3B).
MYSM1 KO mice exhibited elevated levels of CCR9 expression in activated CD4
+
and
CD8
+
T cell populations in the PLN, MLN and PP compared to WT mice. We then
evaluated the level CCR9 expression of lymphocytes found in the intestinal LP (Fig.
2.4A). MYSM1 KO CD4
+
T cells in the LP expressed > 2 fold more brightly (by mean
fluorescence) than WT LP CD4
+
lymphocytes (Fig. 2.4B). Corresponding qRT-PCR of
CD4
+
T cells revealed elevated levels of CCR9 mRNA in PLN, MLN, and PP as well
(Fig. 2.4C). These data clearly show that MYSM1 KO CD4
+
T cells possess elevated
levels of CCR9 expression and that this increase occurs during T cell activation.

2.4.3 Naïve MYSM1 KO CD4
+
T cells are hypersensitive to retinoic acid stimulation
Previous studies have shown that activation of naïve CD4
+
T cells in the presence of RA
induces expression of CCR9, as well as α4β7 (Iwata, Hirakiyama et al. 2004). In order to
evaluate the increase of CCR9 expression detected on MYSM1 KO CD4
+
T cells, we
induced CCR9 expression in WT and MYSM1 KO CD4
+
T cells in response to TCR
stimulation and the presence of RA, in vitro. Naive splenic CD4
+
T-cells (isolated via
MACS) were stimulated with plate-bound anti-CD3 and anti-CD28 mAbs in the presence
of graduated concentrations of RA for 2 d. Cells were then transferred to fresh media
without mAbs but in the presence of Il-2 and RA. After 2 d surface expression of CCR9
and α4β7 was measured by flow cytometry.

46

When stimulated with RA, naïve MYSM1 KO CD4
+
T cells expressed higher
levels of CCR9 and α4β7 at every RA concentration administered (Fig 2.5A). A larger
percentage of MYMS1 KO naïve CD4
+
T cells were induced to express CCR9 than WT
naïve CD4
+
T cells (Fig. 2.6A) Upon induction with physiological concentrations of RA
(0.1-10 nM) , WT expression of CCR9 plateaus between 30-40% of cells in B10.D2 mice
(Takeuchi, Yokota et al. 2010). Only upon stimulation with an physiologically
uncommon concentration such as 1000 nM do WT CD4
+
T cells express CCR9 at levels
greater than 40% (Takeuchi, Yokota et al. 2010). MYSM1 KO naïve T cells surpass that
level of CCR9 expression with the lowest administered RA concentration, 0.1 nM (Fig.
2.6A). Induction of MYSM1 KO T cells with RA concentrations beyond 0.1 nM results
in CCR9 expression on well over 60% of cells (Fig. 2.6A). qRT-PCR of RA stimulated
cells confirms that MYSM1 KO CD4
+
T cells have higher Ccr9 mRNA levels than RA-
induced WT CD4
+
T cells (Fig. 2.6B). Furthermore, MYSM1 KO cells expressed higher
levels of α4β7 in a concentration dependent manner than WT counterparts (Fig. 2.6C).
These results indicate that MYMS1 is involved with regulating CCR9 expression during
CD4
+
T cell activation in gut-tropic conditions.

47

A
Fig 2.5 MYSM1 KO T cells display increased sensitivity to RA stimulation in vitro. A. WT and MYSM1 KO Naïve CD4+
T cells (isolated via MACS) were stimulated with mAbs to CD3 and CD28 in the presence of graduated concentrations of all-
trans-retinoic acid for 2 d. and then cultured in fresh media without antibodies the same concentration of RA and the addition
of IL-2 for 2 d. A. Upper row, cell surface expression of CCR9 on MYSM1 KO (black line) and WT cells (gray filled area)
after RA-stimulation, as determined by flow cytometry. Lower row, cell surface expression of α4β7 on MYSM1 KO (black
line) and WT cells (gray filled area) after RA-stimulation, as determined by flow cytometry. Data represents individual
experiment with three repeats.

48

Fig. 2.6 Enhanced expression of CCR9 and α4β7 on MYSM1 KO T cells during RA
stimulation. A. Percentage of RA-stimulated WT and MYSM1 KO cells expressing CCR9. Data
displayed as mean ± SEM for three experiments. B. Relative levels of Ccr9 mRNA within RA-
stimulated WT and MYSM1 KO cells. Relative mRNA levels are normalized to GAPDH and
data expressed at mean ± SEM for three experiments. C. α4β7 expression of RA-stimulated WT
and MYSM1 KO cells as displayed by ΔMFI ± SEM for three experiments.

C
B
A

49

2.4.4 MYSM1 KO T cells possess increased homing efficiency in vitro
We have shown that MYSM1 KO T cells naturally possess enhanced expression
of CCR9. Moreover, naïve MYSM1 KO T cells display an increased sensitivity to RA
stimulation during culture, which resulted in elevated levels of CCR9 expression. To
determine if the increase of CCR9 expression correlated with an increase in chemotactic
activity to the CCR9 ligand CCL25, we employed an in vitro chemotaxis assay (Fig. 2.7).
WT and MYSM1 KO Naïve CD4
+
T cells mice were stimulated with plate bound anti-
CD3 and anti-CD28 mAbs in the presence or absence of 10 nM RA, the common
physiological concentration. Cultured cells were placed in upper well of a transwell dish
and allowed to migrate to the lower chamber containing chemokine. MYSM1 KO CD4
+

T cells without RA stimulation displayed heightened chemotactic activity toward CCL25
compared to comparably treated WT cells (Fig. 2.7). Similarly, RA-stimulated naive
splenic CD4
+
T cells from MYSM1 KO mice exhibited much greater chemotactic activity
toward CCL25 than stimulated WT cells (Fig. 2.7). These results demonstrate that the
enhanced expression of CCR9 on MYSM1 KO CD4
+
T cells is fully functional and
reactive to appropriate stimuli.

50

Fig. 2.7 MYSM1-deficient CD4
+
T cells preferentially migrate to CCL25. WT and MYSM1
KO Naïve CD4
+
T cells (isolated via MACS) were expanded with or without 10 nM all-trans-RA
and chemotactic ability was measured. WT or MYSM1 KO cells were added to the upper
chamber of a transwell assay with optimal concentration of the chemokine ligand CCL25 (240
nM) placed in the lower chamber. After 2 h, migrated cells in the lower chamber were counted
and expressed as a percentage of input cells. Mean and SEM are shown for no less than 3
individual experiments. *, p < 0.05. **, p < 0.01

**
*

51

2.4.5 MYSM1 KO T cells possess increased homing efficiency in vivo
Our previous experiments demonstrated that MYSM1-deficient CD4
+
T cells accumulate
in the LP of MYSM1 KO mice and exhibit increased chemotactic activity toward CCL25
in vitro. We wanted to confirm that the increase in MYSM1 KO CD4
+
T cell migration
was due to the cell intrinsic increase of CCR9 expression and not some other
environmental factor. In order to evaluate migration ability, we performed competitive
homing experiments. Naïve WT and MYSM1 KO CD4
+
T cells (isolated via MACS)
were activated and expanded with 10 nM RA as described for in vitro experiments. After
4 d., cells were labeled with fluorescent dyes: CFSE for WT and TRITC for MYSM1 KO
cells. Equal number of cells were mixed together and adoptively transferred into WT
recipient mice via tail vein injection. Spleen, PLN, MLN, PP and LP were harvested 16 h.
post-injection and cell migration was measured by flow cytometry (Fig. 2.8B). Both
populations homed equally well to the spleen. MYSM1 KO cells were represented in the
MLN, PP, and LP to a larger extent than WT cells (Fig 2.8A). These results were not
altered by switching the dyes (Data not shown). This finding suggests that the increase in
MYSM1 KO T cell migration to the intestinal LP was a result of the cell intrinsic
upregulation of CCR9.

52

Fig. 2.8 MYSM1-deficient CD4
+
T cells preferentially migrate to small intestinal compartments.
A and B. WT and MYSM1 KO cells were labeled with CFSE and TRITC, respectively. WT and MYSM1
KO cells were mixed in a 1:1 (left panel) ratio and injected i.v. into WT mice. After 16 h, cellular content
of spleen, PLN, MLN, PP and LP was examined by flow cytometry. A. Homing index, ratio of MYSM1
KO cells to WT cells, is displayed as mean with SEM for 3 experiments. B. Representative examples of
flow cytometry CFSE
+
(WT) and TRITC
+
(MYSM1 KO) are shown for indicated organs. Statistical
significance is expressed: **, p < 0.01
B
A
*
Homing Index (KO / WT)

53

2.4.6 MYSM1 KO mice are more susceptible to DSS induced colitis
MYSM1 KO cells have demonstrated preferential migration to the small intestine and
related lymphoid tissues. It has been implicated that aberrant homing of lymphocytes to
the small intestine is associated with inflammatory bowel disorders such as ulcerative
colitis and Crohn’s disease (Picarella, Hurlbut et al. 1997, Kato, Hokari et al. 2000,
Matsuzaki, Tsuzuki et al. 2005, Farkas, Hornung et al. 2006, Goto, Arimura et al. 2006).
DSS administered via drinking water has been shown to recapitulate inflammatory bowel
disease symptoms by causing intestinal epithelial injury and inflammation (Fukata,
Michelsen et al. 2005). We wanted to determine if the excess accumulation of
lymphocytes to the small intestine of MYSM1 KO mice would enhance the symptoms of
DSS-induced acute colitis.
Drinking water with 2.5% DSS was administered to WT and MYSM1 KO mice
for 7 days followed by normal drinking water. Survival, weight, and blood in stool were
monitored daily (n=10 mice per group for WT and MYSM1 KO). Stool blood was
monitored visually and with Hemoccult strips (Beckman Coulter). Scoring was as
follows: 0, none; 1, trace (Hemoccult); 2, strong positive (Hemoccult); 4, gross
hemorrhage. Mice were harvested when mice reached 80% of starting weight.

54

Fig. 2.9 MYSM1 KO mice are sensitive to orally-induced acute DSS colitis. WT and MYSM1
KO mice (n=6) were administered 2.5% DSS via drinking water for 7 d and then followed by
normal drinking water for 7 d. Mortality, weight and presence of fecal occult blood were
measured. A. Mean percentage weight change of WT and MYSM1 KO mice presented with
SEM. B. Percent survival of WT and MYSM1 KO mice. C. Hemoccult score of WT and MYSM1
mice presented as mean with SEM. Scoring was completed as follows: 0, no observable or
measureable sign of blood; 1, trace (Hemoccult); 2, strong positive (Hemoccult); 4, gross
hemorrhage. All figures are representative of individual experiments repeated 3 times.

55

During DSS administration, MYSM1 mice lost significantly more weight than WT mice
during the same period (Fig. 2.9A). MYSM1 mice had a median survival of 9 days while
WT mice had a median survival of 12 days (Fig. 2.9B). MYSM1 mice also had higher
incidence of blood in the stool resulting in a larger average Hemoccult score at all
measured time-points (Fig. 2.9C). These results indicate that the lack of MYSM1
enhances the severity of DSS-induced colitis.

2.4.7 MYSM1 KO mice have altered expression of CCR9-related transcription
factors
Optimal expression of CCR9 is regulated by a specific set of transcription factors
(Takeuchi, Yokota et al. 2010, Ohoka, Yokota et al. 2011, Wang, Thangamani et al.
2013). Given that MYSM1 KO mice possess elevated levels of CCR9 expression, we
wanted to examine whether MYSM1 regulates the transcription factors that are
associated with CCR9 expression. We performed qRT-PCR with WT and MYSM1 KO
CD4
+
T cells isolated from MLN (Fig. 6). MYSM1 KO T cells displayed increased
mRNA levels for NFATc2, RARβ, RXRα and RXRγ. Interestingly, RARα was
significantly reduced in MYSM1 KO CD4
+
T cells. These results suggest that MYSM1 is
involved in regulating the transcription of several CCR9-related transcription factors.

56

FIGURE 2.10 MYSM1 alters the expression of CCR9-related transcription factors. A.
Expression of representative CCR9-related transcription factors in WT and MYSM1 KO CD4
+
T
cells. mRNA levels were detected by qRT-PCR assays. mRNA levels were normalized to
GAPDH and presented relative to the expression level found in WT cells. Data are presented as
mean ± SEM and are representative of 3 independent experiments.
D
a
H
e
*
*
*
*

57

2.4.8 MYSM1 Interacts with the CCR9 locus
We have shown that expression of CCR9 protein and Ccr9 mRNA are elevated in
MYSM1-deficient CD4
+
T cells. Because of this, we wanted to interrogate MYSM1’s
interaction with the Ccr9 gene locus. As detailed in Figure 2.11, the CCR9 locus is
comprised of four exons and 3 introns. Exon 1 encodes a 5’ untranslated region. The
second exon, a non-coding exon as well, has an undetermined function. Exons 3 and 4 are
both coding exons. Exon 3 encodes for the N-terminal extracellular domain while exon 4
encodes for the seven-transmembrane domain as well as the C-terminal domain. Previous
studies have shown that the 5’ flanking region contains several common promoter
elements including the TATA box, a κB-like site and several NFAT-binding sites
(Ohoka, Yokota et al. 2011). To determine what, if any, interactions MYSM1 has with
the promoter region of Ccr9 and we examined MYSM1’s binding capability through
ChIP assay.
We generated a panel of PCR primers that encompass the promoter, the 5’ coding
region in addition to most of the Ccr9 locus (Fig. 2.12A). Immunoprecipitation with the
anti-MYSM1 antibody revealed the binding of MYSM1 in the promoter region of Ccr9
while control IgG failed to bind (Fig. 7B). In addition, we examined MYSM1 binding to
the Ccr9 locus in CD4
+
T cells after RA stimulation (Fig. 2.12B). Naïve WT cells were
cultured with mAbs anti-CD3 and anti-CD28 in the presence or absence of 10 nM RA.

58

Fig. 2.11 Diagram of the Ccr9 mouse gene locus. The binding of MYSM1 to the CCR9
gene locus was assessed in various cell lineages B and C. ChIP assay probing Ccr9 locus and
regulatory region via MYSM1 antibody or IgG control. Binding to the Ccr9 gene locus was
determined by real-time PCR. Fold changes are representative of three independent
experiments.

59

*

Fig. 2.12 MYSM1 interacts with the Ccr9 locus. A. WT CD4
+
T cells (isolated via MACS)
were cultured with anti-CD3 and anti-CD28 mAbs for 2 d. B. WT naïve CD4
+
T cells (isolated
via MACS) were cultured with mAbs CD3 and CD28 in the presence or absence of 10 nM all-
trans-RA for 2 d. Cells were further cultured without antibodies in fresh media containing 20U/ml
Il-2 for 2 days. Cells underwent ChIP and were analyzed for MYSM1 binding to the Ccr9 locus
via qRT-PCR.

B
A

60

ChIP revealed that MYSM1 dissociates from the promoter region of Ccr9 during RA
stimulation. These results suggest that MYSM1 interacts with the promoter region of
Ccr9 in either a direct or indirect manner and that disassociation of MYSM1 may be
required for optimal CCR9 expression.

2.5 DISCUSSION
The regulation of chemokine expression is essential in coordinating effective immune
responses. Histone deubiquitinases have been implicated in the regulation of chemokine
transcription; however, the extent of that regulation is not fully understood (Zhu, Zhou et
al. 2007, Zhou, Zhu et al. 2008). This study identifies the histone H2A deubiquitinase
MYSM1 as a potential transcriptional regulator of the chemokine CCR9 in CD4
+
T
lymphocytes. Cell surface expression of CCR9 was elevated in MYSM1-deficient CD4
+

T and those cells were more effective at migrating to the chemokine CCL25 and the
small intestinal lamina propria. MYSM1-deficient CD4
+
T cells were more effective at
upregulating CCR9 expression through RA induction. Furthermore, we show that
MYSM1 KO mice possessed altered levels of CCR9-related transcription factors and that
MYSM1 interacts with the promoter region of the Ccr9 locus. These findings implicate
MYSM1 as a potential mediator of intestinal inflammatory responses through the
mediation of CCR9 transcription and provide more detail to the role of chromatin
modification in T lymphocyte activity.
We show that T cells deficient for MYSM1 displayed exaggerated levels of CCR9
protein. CCR9 expression has been associated with T cells entrance and accumulation

61

within the small intestine (Zabel, Agace et al. 1999, Kunkel, Campbell et al. 2000). Our
results are indicative of an accumulation of T cells within the intestinal lamina propria of
MYSM1 KO mice. In vivo competitive homing assay results showing increased
migration of MYSM1-KO cells to the lamina propria compared to WT cells indicate that
this is a cell intrinsic mechanism independent. Previous studies have indicated that naïve
CD4
+
T cells do not express cell surface CCR9 and that optimal CCR9 expression occurs
during TCR stimulation in the presence retinoic acid (Iwata, Hirakiyama et al. 2004,
Ohoka, Yokota et al. 2011). Similar to WT CD4
+
naïve T cells, our results show that
naïve MYSM1 KO CD4
+
T cells do not express CCR9. However, activated CD4
+
/CD44
+

T cells in the GALT of MYSM1 KO mice exhibited CCR9 expression several fold higher
than WT counterparts. Moreover, we found that when naïve MYSM1-KO T cells are
stimulated in the presence of RA, they consistently express higher levels of CCR9
compared to WT counterparts. These results indicate that overexpression of CCR9 does
not occur during thymocyte development but likely occurs during T cell activation in the
GALT.
Expression of CCR9 is the culmination of a highly regulated sequence of events
involving the convergence of multiple components. TCR stimulation induces expression
of several key CCR9-related transcription factors, including the retinoid acid receptor
factors RXRα and RXRβ (Bastien and Rochette-Egly 2004). These factors
heterodimerize with other RARs and in conjunction with NFATc2 and common
transcriptional machinery, bind to the retinoic acid response element in the Ccr9 5’
promoter region (Ohoka, Yokota et al. 2011). MYSM1 KO cells possessed elevated

62

levels of several RXRs and RARs that are involved in the initiation of CCR9
transcription. Examination of the Ccr9 locus revealed MYSM1 binding to the 5’
promoter region in WT cells. Furthermore, we investigated MYSM1 binding during RA
stimulation and found that MYSM1 is bound to the promoter until RA stimulation, at
which point it disassociates. These findings imply that MYSM1 is involved in the
repression of CCR9 and that its presence is required for optimal CCR9 expression.
Previous studies have shown that optimal CCR9 expression requires transient
TCR stimulation but sustained TCR stimulation even in the presence of RA negatively
effects CCR9 expression (Ohoka, Yokota et al. 2011). The exact mechanism of
repression is unknown, but NFATc1 is believed to play a role as it is a mediator for other
cytokines and NFATc1 expression is down regulated during CCR9 expression (Ohoka,
Yokota et al. 2011). qRT-PCR shows no significant difference in levels of NFATc1
mRNA expression in of MYSM1 KO cells. This suggests that MYSM1 KO CCR9
overexpression is not the result diminished NFATc1 expression.
Recent studies have shown that the well-known transcription factor BATF is also
required for optimal CCR9 expression through interaction with the RARα subunit of the
transcriptional machinery (Wang, Thangamani et al. 2013). Acetylation of histone H4,
generally associated with transcriptional activity, was also detected on the Ccr9 promoter
region during activation (Wang, Thangamani et al. 2013). However, general regulation of
the Ccr9 locus is still an active area of investigation.
The histone deubiquitinase MYSM1 is widely expressed throughout the immune
system and has demonstrated involvement with gene regulation in several hematological

63

lineages (Jiang, Nguyen et al. 2011, Nijnik, Clare et al. 2012). MYSM1 generally acts as
a transcriptional activator through its interaction with the HAT PCAF/KAT2B, MYSM1
preferentially deubiquitinates hyperacetylated nucleosomes (Zhu, Zhou et al. 2007).
Deubiquitination of histone H2A allows the recruitment the protein FACT, which eases
chromatin inhibition of transcriptional elongation (Zhu, Zhou et al. 2007). MYSM1 has
been shown to directly upregulate the expression of specific chemokines, such as
RANTES and IP-10 (Zhou, Zhu et al. 2008). More recently, our lab has shown that
MYMS1 was shown to derepress EBF1, a protein essential for B cell development and
maturation (Jiang, Nguyen et al. 2011). Since MYSM1 generally acts as a transcriptional
activator, our results would indicate that MYSM1 likely regulates the expression of a
negative regulator within the CCR9 transcriptional activation pathway.
The physiological role of MYSM1-related CCR9 repression is not entirely
evident. MYSM1 may provide another level of regulatory specificity, which would
ensure CCR9 expression only during appropriate situations. Further study of MYSM1’s
binding partners is required to further elucidate its function in this context. Although, this
finding still has implications in the treatment of cell mediated inflammatory diseases,
such as ulcerative colitis.

2.6 ACKNOWLEDGMENTS
The authors thank William DePaolo for technical assistance and critiques; Bangxing
Hong, Xiaoxia Jiang and all the members of the laboratory for technical assistance and
suggestions.

64

Table 1.2. Primers used for qRT-PCR of CCR9-related transcription factors

Gene Primer Sequence
CCR9
CCAAGGTCAGTATAAGGT
TGCTCATTCATCAAGTTC
Itgb7
GGTGGATTCATCAACTGT
ATGTAATCTTGGTATCTAACTCA
Rara
AAGTACACTACGAACAAC
TCCACAGTCTTAATGATG
Rarb
ATGACACAACTACCGAAT
GACTAACTTGCTGATTATCC
Rarg
CTTCAGACGCAGCATTCA
TGGTGACCTTGTTGATGATAC
Rxra
ACAGCAGTCTCAGGATTATAG
CCAACACAGGACAGATGA
Rxrb
GTGAGGACTATATGTCTACC
GAGCCAGGATGAAGAATC
Rxrg
AGTAGTAGCCACGAAGAC
ATGTCACCGTAGGATTCT
Nfatc1
TCACAGAAGCCTTATAGC
AATTACACAGAGCAGACA
Nfatc2
GCACTCACAATTATAGAA
AACCTCAACTTATCTGTA
Nfatc3
CAAGGAACAGATGCTCAT
GGCTCAAGTGGAAGATAG

65

CHAPTER 3
MYSM1 REGULATES CCR9 EXPRESSION DURINGTHMYOCYTE
DEVELOPMENT

3.1 ABSTRACT
Developmental maturity of T lymphocytes is achieved in the thymus. However, like all
hematopoietic linages, T cells originate from bone marrow-derived progenitors. In order
to generate functionally mature T cells, progenitor populations must emigrate from the
bone marrow, and selectively home to and enter the thymus. This process, known as
thymocyte settling or colonization is a highly regulated process that is directed by
specific ligand-receptor interactions between the migrating progenitor cell and its
environment. In particular, the chemokine receptor CCR9 has been shown to play a vital
role not just in thymic settling, but in thymocyte development, as well. However, the
mechanisms that regulate CCR9 expression during thymic settling and thymocyte
development are poorly characterized. Recently, we have shown that the novel histone
H2A deubiquitinase MYSM1 is a regulator of CCR9 expression in the context of gut-
specific homing. In this article, we report that MYSM1 is required for optimal expression
of CCR9 on bone marrow-derived progenitors. Absence of MYSM1 impairs the ability of
bone marrow-derived progenitor populations from properly colonizing the thymus.
Moreover, we show that MYSM1-deficient thymocytes fail to upregulate CCR9 at the
appropriate developmental stages and that these cells possess diminished chemotactic
sensitivity to the CCR9 ligand, CCL25. In addition to diminished capacity for thymic

66

settling and response to CCL25, MYSM1-deficientn thymocytes possess significantly
altered levels of proliferation apoptosis that are likely involved in the contracted
thymocyte populations and modified capacity to undergo typical thymocyte development.
These results suggest that MYSM1is a novel regulator of CCR9 induction on bone
marrow progenitors and thymocytes and likely plays a role in the development and
functional maturity of peripheral T cells.

3.2 INTRODUCTION
T cell development primarily occurs in the thymus. The thymus lacks a native progenitor
cell population and is reliant upon bone marrow (BM)-derived thymic settling progenitor
(TSP) cells to settle and populate the thymus (Scollay, Smith et al. 1986, Donskoy and
Goldschneider 1992). Circulating TSPs enter the thymus though venules in the cortico-
medullary junction via multiple receptor-ligand interactions (Schwarz and Bhandoola
2004, Bhandoola, von Boehmer et al. 2007). TSPs have not been clearly identified due to
believed scarcity (Kadish and Basch 1976). Once inside the thymus, the BM progenitors
enter the early T-lineage progenitor (ETP) population. ETP’s proceed to proliferate and
progress through the CD4
-
CD8
-
double negative (DN) stages of T cell development. DN
thymocytes differentiate into CD4
+
CD8
+
double positive (DP), which undergo T cell
receptor selection to produce CD4 or CD8 single-positive (SP) mature thymocytes that
emigrate from the thymus into circulation (Allman, Sambandam et al. 2003).
TSP entrance to the thymus is not entirely understood. A mechanism that utilizes
selectins, chemokines, and integrins, analogous to mature lymphocyte entry into lymph

67

nodes, has been implicated (Schwarz, Sambandam et al. 2007). Along those lines recent
studies have identified several molecules that regulate progenitor entry into the thymus
including the CC-chemokine receptor CCR9, CCR7, and the P-selectin glycoprotein
ligand 1 (Rossi, Corbel et al. 2005, Gossens, Naus et al. 2009, Krueger, Willenzon et al.
2010, Zlotoff, Sambandam et al. 2010). CCR9 is expressed on a number of BM
progenitor populations that are capable of settling the thymus. CCR9-deficient mice have
shown reduction of thymic settling by BM progenitor cells and lower numbers of ETPs.
Moreover, BM cells from CCR9 KO mice are disadvantaged in competitive BM
transplants displaying reduced thymopoiesis and reconstitution (Uehara, Grinberg et al.
2002, Schwarz, Sambandam et al. 2007, Svensson, Marsal et al. 2008).
A role for CCR9 has also been suggested in the intrathymic migration of
thymocytes. Once CCR9 expressing progenitors enter the thymus, they undergo extensive
proliferation to generate ETPs and down regulate CCR9 as the thymocytes enter the DN
stages of thymopoiesis (Benz, Heinzel et al. 2004). Once the thymocytes reach DN3,
transition to the DN4 stage depends upon expression and signaling by the pre-TCR. Pre-
TCR signaling has been shown to upregulate CCR9, which is essential proper migration
and localization to the thymic subcapsular zone (Norment, Bogatzki et al. 2000).
Although mislocalization of thymocytes in the DN3 stage doesn’t appear to alter
maturation to the DP thymocyte stage, the regulation of CCR9 during this process is still
under investigation.
Histone modifications are essential for chromatin remodeling and transcriptional
regulation. The novel H2A deubiquitinase has been revealed to crucial roles in the

68

development and function of lymphocytes. MYSM1 associates with a complex
containing the histone acetyltransferase PCAF, which is required for gene activation in
prostate cancer cells MYSM1 is expressed widely throughout the immune system and is
required for normal hematological development (Zhu, Zhou et al. 2007). MYSM1 is also
required for B cells to achieve full developmental potential through interaction with the
EBF1 gene locus (Jiang, Nguyen et al. 2011). MYSM1 has been implicated in the
transcriptional regulation of certain chemokines; however, the physiological role of
MYSM1 in chemokine regulation is still under investigation (Zhou, Zhu et al. 2008).
In the current study, we use a MYSM1 KO mouse model to characterize the role
of ubiquitination in the regulation of thymocyte development. We observed a significant
decrease in the number of thymocytes in all subpopulations of MYSM1 KO cells. The
expression of CCR9 on thymocytes was hindered with almost total ablation in DN3 and
DN4 in MYSM1 KO mice. MYSM1 KO thymocyte cells possessed a diminished
chemotactic response to the CCR9 ligand CCL25. We found that MYSM1-deficient
thymocytes were highly apoptotic and exhibited lower rates of proliferation. We
implicate MYSM1 as regulator of CCR9 expression during thymocyte maturation and a
factor required for optimal T cell development and function.

3.2 MATERIALS AND METHODS
Mice
MYSM1 KO mice were generated as previously described (Jiang, Nguyen et al. 2011).
Briefly, we employed an MYSM1 mRNA truncation strategy. An MYSM1 targeting

69

vector consisting of an FRT flanked splice acceptor (En2 SA, lac Z, neomycin, and
poly(A) sequence which is followed by a loxP site, was inserted into the intron of the
intact MYSM1 gene locus. Cassette insertion produces a truncated version of MYSM1
mRNA through the addition of a polyadenylation sequence to the transcript, which
prevents further transcription downstream of the cassette. The expression of Cre removes
the floxed third exon of MYSM1as well. The KOMP repository at UC Davis provided
the MYSM1 mRNA truncation-first floxed sperm on the C57BL/6J background. In vitro
fertilization, microinjection, chimera production, and generation of MYSM1 truncation-
first mice were completed with help of the USC Transgene Core Facility. WT, age and
sex-matched littermates were used as controls for the experiments. Mice were maintained
in Specific Pathogen Free barrier facilities at the University of Southern California. All
experiments were completed under the approval of the University of Southern California
Institutional Animal Care and Use Committee.

Cell Preparation and Flow Cytometry
Multicolor flow cytometry were performed as previously described (Krueger, Willenzon
et al. 2010, Jiang, Nguyen et al. 2011). Briefly, single cell suspensions from mouse
thymus, spleen and lymph nodes were prepared by mechanical disruption. Samples were
stained with directly conjugated antibodies: lineage markers, CD4, CD8, CD25, CD29,
CD44, CD117, CD127, CD135, CCR9, and SCA-1. Flow cytometry was performed
using a FACSCanto II and FACSDiva software (BD Biosciences). Flow cytometry
analysis was completed with FlowJo software (Tree Star). Thymocyte subpopulations:

70

DN (CD3
-
CD4
-
CD8
-
), DP (CD4
+
CD8
+
), CD4SP (CD4
+
CD8
-
), and CD8SP (CD8
+
CD4
-
)
were isolated to >97% purity with a FACSAria III (BD Biosciences) cell sorter.

Chemotaxis Assay
Chemotaxis assay was performed as previously described (Hong, Song et al. 2011).
Briefly, individual thymocyte populations were placed in the upper well of Transwell
plates with a 5 μM pore size (Corning). Optimal concentrations of murine cytokines
(240nM TECK/CCL25) were placed in the lower chamber and migration was monitored
after 2 h. Migrated cells were collected by centrifugation, counted, and are represented as
a percentage of cell input. TECK/CCL25 murine cytokine was obtained from PeproTech.

In vitro T cell Proliferation Assay
In vitro T cell proliferation assay was performed as previously described (Hong, Song et
al. 2011). T cells were purified via MACS from WT or MYSM1 KO mice using CD4
+
or
CD8
+
T cell isolation kits (Miltenyi Biotec). T cells were cultured with anti-CD3 and
anti-CD28 antibodies for 4 d. T cell proliferation was assessed by adding 1 μCi [3H]TdR
per well for the last 8 hours of culture and measured using a MicroBeta scintillation
counter (TopCount NXT, Packard). Triplicate determinations were performed and are
representative of repeated experiments.

71

Cell Cycle and Apoptosis Analysis
In vivo incorporation of BrdU (BD Pharmingen) was performed as previously described
(Hong, Song et al. 2011). BrdU was injected intraperitoneally into mice at a
concentration of 2 mg/ml. Animals were sacrificed after 2 hours. Thymocytes were
isolated and stained for CD4, CD8, CD24, CD44, CD117, BrdU and 7-AAD. Samples
were analyzed by flow cytometry for the incorporation of BrdU. Cellular apoptosis was
determined by staining with Annexin V staining kit (BD Pharmingen). WT and MYSM1
KO thymocytes were stained for CD4, CD8, CD25, CD44, PI and Annexin V.
Thymocyte subpopulations were electronically gated and percent of thymocytes that have
incorporated Annexin V was determined by flow cytometry.

ELISA
ELISA was performed as previously described (Hong, Song et al. 2011). Supernatant
from in vitro T cell cultures was harvested and detection was performed with commercial
cytokine ELISA kits per manufacturer’s instructions (BD Biosciences). All samples were
tested in triplicate.

Statistical Analysis
Data were analyzed using Student’s t test.

72

3.4 RESULTS
3.4.1 Thymocyte development is altered in MYSM1 KO mice
MYSM1 KO mice have previously shown defects in hematopoietic development (Jiang,
Nguyen et al. 2011, Nijnik, Clare et al. 2012, Nandakumar, Chou et al. 2013, Wang,
Nandakumar et al. 2013). We wanted to examine whether any lymphopoietic changes in
MYSM1 KO mice extended to thymocyte and T cell development. In order to accomplish
this, we isolated thymocytes from WT and MYSM1 KO mice and stained for common
thymocyte lineage markers CD4, CD8, CD25 and CD44 and analyzed by flow cytometry.
Upon initial examination, MYSM1 KO mice had gross morphological differences in
thymic size and cellularity (Fig. 3.1A). MYSM1 KO thymi displayed reductions in total
cell numbers (Fig. 3.1B). In addition, the composition of thymocyte subpopulations was
greatly altered (Fig. 3.2A). The frequency of DP and CD4SP thymocytes is reduced
MYSM1 KO mice, while the frequency of DN and CD8SP thymocytes is increased (Fig.
3.2B). Absolute values for all thymic subpopulations of MYSM1 KO mice are reduced
(Fig. 3.2C).

73

Fig. 3.1 MYSM1 KO mouse thymic size and cellularity. A. Representative image of
reduced thymic size of MYSM1 KO mice compared to WT littermates. B. Comparison of
total cell numbers from the thymus of WT and MYSM1 KO mice.

WT MYSM1 KO
0
5.0 10
7
1.0 10
8
1.5 10
8
2.0 10
8
2.5 10
8
A
B

74

Fig. 3.2 Characterization of MYSM1 KO mouse thymocyte populations. A.
Representative fluorescent plot displaying the expression of CD4 and CD8 on
thymocytes from WT and MYSM1 KO mice. B. Frequency of thymocyte populations:
CD4-CD8- (DN), CD4+CD8+ (DP), CD4+CD8- (CD4SP), and CD8+CD4- (CD8SP)
from WT and MYSM1 KO mice. C. Total cell number of thymocyte populations from
WT and MYSM1 KO mice.

DN DP CD4 SP CD8 SP
0
20
40
60
80
100
WT
MYSM1 KO
DN DP CD4 SP CD8 SP
0
5 10
07
1 10
08
2 10
08
WT
MYSM1 KO
A
B
C

75

Fig. 3.3 Characterization of MYSM1 KO mouse DN thymocyte populations
A. Representative fluorescent plot of CD25 and CD44 expression from WT and MYSM1
KO mice representing DN thymic stages. B. Frequency of DN thymocyte subpopulations:
CD44+CD25- (DN1), CD44+CD25+ (DN2), CD25+CD44- (DN3), and CD25-CD44-
(DN4). C. Total cell number of DN thymocyte subpopulations of WT and MYSM1 KO
mice. All flow cytometry panels represent individual experiments that have been repeated
at least three times.
DN 1 DN 2 DN 3 DN 4
0
20
40
60
80
100
WT
MYSM1 KO
DN 1 DN 2 DN 3 DN 4
0
5 10
05
1 10
06
2 10
06
2 10
06
3 10
06
WT
MYSM1 KO
A
B
C

76

Next, we analyzed the double negative thymocyte subpopulations of MYSM1 KO
mice. MYSM1 KO mice exhibited a significant reduction of DN2 and DN3 thymocyte
frequency (Fig. 3.3A). The frequency of DN4 thymocytes in MYSM1 KO mice was
significantly increased where greater than 80% of all DN cells were in the DN4 stage
(Fig. 3.3B. Similar to the overall cellularity, absolute values for all of the DN
subpopulations in MYSM1 KO mice were drastically reduced (Fig. 3.3C). These data
indicate the MYSM1 is required for optimal T cell development.

3.3.2 MYSM1 KO thymocytes display reduced expression of CCR9
We have previously shown that MYSM1 has a role regulating the expression of the
chemokine receptor CCR9 in mature CD4
+
T cells. Since CCR9 is primarily expressed on
maturing thymocytes, we wanted to evaluate CCR9 expression on MYSM1-deficient
thymocytes (Fig 3.4-3.6). Examination of whole thymocytes from MYSM1 KO mice
revealed a decrease in cell surface CCR9 expression (Fig. 3.4A, B). Because CCR9
expression is dynamic throughout thymocyte development, we analyzed the individual
thymocyte subpopulations of MYSM1 KO mice for CCR9 expression. All
subpopulations of MYSM1KO thymocytes displayed reduced levels of CCR9 expression
(Fig. 3.5A, B).

77

Fig. 3.4 CCR9 expression of on total thymocytes of WT and MYSM1 KO mice. Cells from
WT and MYSM1 KO thymus were stained and analyzed by flow cytometry. A. CCR9 expression
was determined (black line) and overlaid isotype IgG controls (gray line). CCR9 expression on
total thymocytes (gated by scatter) of WT and MYSM1 KO mice. B. Measure of relative fold
change of CCR9-specific mean fluorescent intensity in MYSM1 KO total thymocytes. All flow
cytometry panels represent individual experiments that have been repeated at least three times

0.0
0.5
1.0
1.5
CCR9-Specific
Mean Fluorescence
WT MYSM1 KO
A
B

78

DN DP CD4 SP CD8 SP
0.0
0.5
1.0
1.5
WT
MYSM1 KO
CCR9-Specific
Mean Fluorescence

Fig. 3.5 CCR9 expression on thymic subpopulations of WT and MYSM1 KO mice. A. CCR9
expression was determined (black line) and overlaid isotype IgG controls (gray line). CCR9
expression of corresponding thymocyte subpopulations in WT and MYSM1 KO mice. B. Graph
indicating relative fold change of CCR9-specific mean fluorescence of MYSM1 KO thymocyte
subpopulations compared to WT thymocyte subpopulations. All flow cytometry panels represent
individual experiments that have been repeated at least three times.
A
B

79

CCR9-Specific
Mean Fluorescence

Fig. 3.6 CCR9 expression on thymic DN populations of WT and MYSM1 KO mice. CCR9
expression was determined (black line) and overlaid isotype IgG controls (gray line). A. CCR9
expression of corresponding double negative thymocyte subpopulations in WT and MYSM1 KO
mice. B. Graph indicating relative fold change of CCR9-specific mean fluorescence of MYSM1
KO thymocyte DN subpopulations compared to WT thymocyte DN subpopulations. All flow
cytometry panels represent individual experiments that have been repeated at least three times.
DN 1 DN 2 DN 3 DN 4
0.0
0.5
1.0
1.5
WT
MYSM1 KO
A
B

80

CCR9 expression is initially upregulated during the DN3 stage of thymocyte
development (Norment, Bogatzki et al. 2000). Because of this, we wanted to examine
CCR9 expression on DN thymocytes in MYSM1 KO mice. MYSM1 KO DN thymocytes
expressed reduced levels of CCR9 compared to WT thymocytes at all stages of DN
development (Fig 3.6A, B). MYSM1 KO thymocytes do upregulate CCR9 at DN3, but to
a much lower level than WT thymocytes.

3.3.3 MYSM1 KO thymocytes possess reduced capacity for CCL25-mediated
migration
It has been shown that CCR9
+
thymocytes preferentially migrate to the chemokine ligand
CCL25 (Zlotnik and Yoshie 2000). Since MYSM1-deficient thymocytes displayed
reduced levels of CCR9 migration, we wanted to examine the functional homing ability
of MYSM1-deficient thymocytes to CCL25. Single cell suspensions of WT and MYSM1
KO thymocytes were placed into the upper chamber of a transwell plate. The lower
chamber contained media alone or media with CCL25. After 2 h, cells in the lower
chamber were stained against typical thymocyte subpopulation markers and analyzed by
flow cytometry. Migration of MYSM1 KO thymocytes to CCL25 was dramatically
reduced compared to WT thymocytes (Fig. 3.7 & 3.8). The largest reduction of
migration was observed in the CD4SP thymocyte population where MYSM1 KO
thymocytes showed a 3-fold decrease in migratory ability compared to WT CD4SP
thymocytes. This data indicates that the reduction of CCR9 expression observed in
MYSM1 correlates with a reduction in migratory capacity to the CCR9 ligand, CCL25.

81

Fig. 3.7 CCR9 mediated chemotaxis of WT and MYSM1 KO thymocytes. Flow cytometry
analysis of WT and MYSM1 KO thymocytes that have migrated in response to CCL25 or control
media. Migrated thymocyte populations in the lower chamber of transwell plates were stained and
analyzed for population frequency. The input population is also displayed. Numbers displayed are
representative of indicated populations.

82

Fig. 3.8 Migratory capacity of WT and MYSM1 KO thymocyte subpopulations. Migratory
capacity of WT and MYSM1 KO thymocyte subpopulations. Data is presented as percent of input
cells that migrated to lower chamber mean ± SEM. Data is representative of 3 individual
experiments.

83

3.3.4 CCR9 Expression on bone marrow-derived precursors and ETPs
CCR9 has been implicated in the ability of bone marrow-derived progenitors to colonize
the thymus (Uehara, Grinberg et al. 2002). Expression of CCR9 has been identified on
several early hematopoietic lineages including the lin-SCA-1+c-Kit+ (LSK) lineage and
common lymphoid progenitor (CLP) cells (Krueger, Willenzon et al. 2010, Zlotoff,
Sambandam et al. 2010). Ablation of CCR9 on the LSK and CLP populations results in a
diminished capacity to colonize the thymus and negatively alters the size of the ETP
population in the thymus (Schwarz, Sambandam et al. 2007). We have already shown
that thymocyte CCR9 expression is reduced in MYSM1 KO mice. Therefore, we wanted
to determine the level of CCR9 expression on bone marrow-derived progenitors in
MYSM1 KO mice (Fig. 3.10). Previous results from our lab have shown that while
absolute numbers of LSK and CLP cells are reduced, the frequency of those cells in the
bone marrow of MYSM1 mice is relatively unchanged (Jiang, Nguyen et al. 2011). Bone
marrow from WT and MYSM1 KO mice was isolated and CCR9 expression was
determined on LKS and CLP cell populations. MYSM1 KO LSK cells (lin
-
CD117
high
SCA-1
+
) possessed diminished levels of CCR9 expression compared to WT
counterparts (Fig. 3.10B). Similarly, MYSM1 KO CLP (lin
-
CD127
+
CD117
+
SCA-1
+
)
showed a significant reduction of CCR9 expression compared to WT CLPs. These data
suggest that MYSM1 may regulate the expression of CCR9 on specific lineages of bone
marrow-derived progenitors.
It has been shown that CCR9 is expressed on a subset of thymocytes (ETP) that
denote the most recent thymic immigrants (Schwarz and Bhandoola 2004).

84

Fig. 3.9 Characterization of ETPs in WT and MYSM1 KO mice. A, Thymocytes from WT
and MYSM1 KO mice were stained with antibodies for lineage markers, CD25, CD44, and
CD117 and analyzed by flow cytometry. Early T cell progenitors (ETP) are defined as: lin
-
CD25
-
CD44
+
CD117
+
. ETP Frequency (B) and absolute values(C) are displayed. Data presented are
mean ± SEM and is representative of 3 individual experiments. *p < 0.05. **p<0.01
WT MYSM1 KO
0.000
0.005
0.010
0.015
0.020
0.025
% of Thymocytes
WT MYSM1 KO
0
10000
20000
30000
40000
Total Cell Number
A
B
C

85

Fig. 3.10 Expression of CCR9 on BM-derived Progenitors and ETP in WT and MYSM1 KO
Mice. A, CCR9 expression of WT and MYSM1 ETPs. Thymocytes were stained with lineage
markers, CD25, CD44, CD117 and CCR9 and then analyzed by flow cytometry. CCR9
expression (black line) is overlaid IgG control expression (grey line). Percent of ETPs expressing
CCR9 is also displayed. B, Bone marrow cells from WT and MYSM1 KO cells were stained for
lineage markers, SCA-1, CD117, CD127, and CCR9 and were analyzed by flow cytometry. LSK
cells were defined as lin
-
CD117
high
SCA-1
+
. CLP cells were defined as lin
-
CD117
+
CD127
+
SCA-
1
+
. Expression of CCR9 on LSK and CLP populations is displayed. Frequencies of gates are
indicated on displays. Percent of CCR9 expressing cells within independent populations is
displayed. Dot plots and histograms are representative examples of at least three experiments.
Graphs are pooled data from 3 independent experiments with 3 mice per group and represent
mean ± SEM. *p < 0.05.

A
B

86

In CCR9 KO mice, the ETP population is severely reduced (Schwarz, Sambandam et al.
2007). To further characterize the role of MYSM1 in the regulation CCR9 expression, we
characterized the ETP population in WT and MYSM1 KO. Thymocytes from WT and
MYMS1 KO mice were isolated and stained and analyzed by flow cytometry (Fig 3.9A).
First, we quantified the ETP (lin
-
CD25
-
CD44
+
CD117
+
) population in WT and MYSM1
KO mice. Similar to CCR9 KO mice, MYSM1 KO mice displayed a reduction in ETP
frequency and absolute number. ETP’s in MYSM1 KO mice were over 3-fold lower than
WT counterparts. Next we measured the expression of CCR9 on ETPs from WT and
MYSM1 KO mice (Fig 3.10A). Surface expression of CCR9 was greatly diminished on
MYSM1 KO ETPs compared to WT ETPs. In summary, bone marrow-derived progenitor
populations and ETPs possess diminished levels of CCR9 expression in MYSM1 KO
mice. These data suggest that MYSM1 is involved in the expression of CCR9 thymic
settling progenitors (TSP) and may play a role regulating thymic colonization.

3.3.5 Thymocyte proliferation and apoptosis in MYSM1 KO mice
Studies of CCR9-deficient mice have demonstrated that despite problems with TSPs
colonizing the thymus, thymocyte development and cellularity appear relatively normal
(Schwarz, Sambandam et al. 2007). Recently, two groups have implicated compensatory
thymocyte proliferation in the DN3 stages of CCR9-deficent mice as the impetus for
regained cellularity (Krueger, Willenzon et al. 2010, Zlotoff, Sambandam et al. 2010).

87

Fig. 3.11 Proliferation of WT and MYSM1-deficent Thymocyte Subsets. A-C. WT and
MYSM1 KO mice were pulsed with BrdU for 2 hours and monitored for proliferation by
determining BrdU incorporation. Thymocytes from WT and MYSM1 KO mice were harvested
and stained for CD4, CD8, CD24, CD44, CD117, BrdU and 7-AAD. A Cell cycle progression of
total thymocytes from WT and MYSM1 KO mice is displayed. B, C. Thymocyte subpopulations
were electronically gated and percent BrdU incorporation among the subpopulations is displayed
as mean ± SEM for 3 independent experiments.

% BrdU Thymocytes
Total DN DP CD4 CD8
0
5
10
15
WT
MYSM1 KO
% BrdU Thymocytes
ETP DN1 DN2 DN3 DN4
0
5
10
15
20
A
B
C

88

We have already shown in this paper that the thymic cellularity of MYSM1 KO mice is
reduced in all lineages (Fig 3.1). Next we wanted to examine the proliferative capacity of
MYSM1 KO thymocytes at various stages of development (Fig. 3.11). WT and MYSM1
KO mice were pulsed with BrdU for 2 h. Then, thymocytes were isolated, stained, and
analyzed for BrdU incorporation via flow cytometry. Total thymocytes from MYSM1
KO mice showed reduced incorporation of BrdU after the 2 h pulse (Fig. 3.11).
Interestingly, apoptotic cells were dramatically increased among MYSM1 KO
thymocytes. Examining individual thymocyte populations revealed that nearly 10% of
MYSM1 KO DN thymocytes were labeled with BrdU compared with less than 5% of
WT DN thymocytes. Next, we wanted to evaluate the individual DN subpopulation for
BrdU incorporation. ETPs and thymocytes in DN2, DN3 and DN4 from MYSM1 KO
mice displayed a 2-fold increase in BrdU staining. No difference was observed in BrdU
incorporation during the DN1 stage. These data indicate that MYSM1 KO thymocytes
are in line with previous reports where upon ETP decreases due to chemokine ablation,
compensatory proliferation attempts to rectify the discrepancy.
Yet in MYSM1 KO mice, normal thymocyte cellularity is not regained (Fig. 3.1).
To address this deficiency, we evaluated levels of apoptosis in the thymocyte
subpopulations of WT and MYSM1 KO mice (Fig. 3.12). Thymocytes were isolated and
stained for thymocyte subpopulation markers, Annexin V and propidium iodide (PI).
Annexin V binds to the protein phosphatidylserine, which is externalized during the early
stages of apoptosis.

89

Fig. 3.12 Apoptosis levels in thymocyte subsets of WT and MYSM1 KO mice A. WT and
MYSM1 KO thymocytes were examined for apoptosis by Annexin V/PI. WT and MYSM1 KO
thymocytes were stained for CD4, CD8, CD25, CD44, PI and Annexin V. B. Cell death in
thymocyte subpopulations were electronically gated and percent of thymocytes that have
incorporated Annexin V is presented as mean ± SEM for 3 independent experiments. *p < 0.05.
**p< 0.01
% Annexin V Thymocytes
DN
DP
CD4SP
CD8SP
0
5
10
15
20
*
*
** **

90

Since PI is a total DNA stain, viable cells exclude PI with an intact cellular membrane
while cells in the late stages of apoptosis have their nucleic material exposed. Therefore,
cells that stain positive for annexin V and PI are in a late apoptotic state while cells that
stain positively only for annexin V are in the early apoptotic states. During thymocyte
development, SP cells that react during negative selection undergo apoptosis. Hence, we
analyzed the CD4SP and CD8SP lineages for apoptosis, first (Fig. 3.12B). MYSM1 KO
CD4SP and CD8SP thymocytes possess significantly larger populations of early
apoptotic cells. Late apoptotic cells are also elevated in MYSM1 KO mice but not to the
same extent as early apoptotic cells. Overall, the amount annexin V
+
cells in the SP
linages were increased nearly 3-fold. Higher instances of annexin V staining were also
observed in the DN and DP subpopulations. These data indicate that MYSM1-deficient
thymocytes possess altered levels of cellular apoptosis, which may contribute to the
reduction of thymic cellularity observed in MYSM1 KO mice.

3.3.6 Proliferation and activation of MYSM1 KO peripheral T cells
We have shown that MYSM1 KO thymocytes possess altered patterns of proliferation
compared to WT counterparts (Fig. 3.11). We wanted to determine the proliferative
capabilities of peripheral T cells in MYSM1 KO mice (Fig. 3.13). CD4
+
or CD8
+
T cells
were isolated from WT and MYSM1 KO spleens and cultured in the presence or absence
of mAbs CD3 and CD28 for at least 96 hours. During the last 8 hours, 1 μCi [
3
H] was
added per culture well and T cell proliferation was determined by measuring [
3
H]
incorporation.

91

Figure 3.13 T cell Proliferation and Activation are altered in MYSM1 KO Mice. Splenic
CD4
+
and CD8
+
T cells from WT and MYSM1 KO mice were isolated and cultured
independently for 4 d in the presence or absence of mAbs CD3 and CD28. A, The proliferative
capacity of isolated WT and MYSM1 KO T cells was measured through [
3
H]thymidine
incorporation. Data are presented as mean ± SEM for 3 independent experiments. B, Supernatant
from cultured cells was analyzed for the presence of IL-2 and IFN-γ by ELISA. Data are
presented as mean ± SEM for 3 independent experiments. C, The supernatant from cultured CD4
+

T cells was analyzed for the presence of IL-4 by ELISA. Data are presented as mean ± SEM for 3
independent experiments. *p < 0.05.
*
*
*
*

92

MYSM1 KO CD4
+
T cells proliferated less intensely than WT CD4
+
T cells (Fig. 3.13).
MYSM1 KO CD8
+
T cells, on the other hand, displayed similar proliferation levels to
those of WT CD8
+
T cells. Since peripheral T cell proliferation occurs during activation,
we also monitored for the production of the proinflammatory cytokines. Supernatant from
the T cell culture was harvested and analyzed for the presence of IL-2 and IFN-γ by
ELISA (Fig. 3.13B). Following activation, MYSM1 KO CD4
+
T cells produced
significantly less IL-2 and IFN-γ compared to WT CD4+ T cells. Production of IL-2 and
IFN-γ was not significantly altered in MYSM1 KO CD8
+
T cells compared to WT
counterparts. It has been shown that the proliferation and differentiation of CD4
+
T cells
are affected by the production and uptake of IL-4 (Howard and Paul 1983). Therefore, we
also analyzed the ability of MYSM1 KO CD4
+
T cells to produce IL-4 (Fig. 3.13C).
Unsurprisingly, production of IL-4 by MYSM1 KO CD4
+
T cells was significantly lower
than WT CD4
+
T cells. These data indicate that MYSM1-deficient peripheral lymphoid
CD4
+
T cells possess altered proliferation and activation potentials.
We also demonstrated that MYSM1 KO thymocytes have elevated levels of
apoptosis (Fig. 3.12). Next, we measured the levels of apoptosis in peripheral CD4
+
and
CD8
+
T cells (Fig 3.14). The frequency of MYSM1 KO CD4
+
T cells in the late apoptotic
phase was not significantly different; however, the percentage of MYSM1 KO CD4
+
T
cells in the early apoptotic phase was significant. Interestingly, the number of MYSM1
KO CD8
+
T cells that stained positive for annexin V was 3-fold higher than WT CD8
+
T
cells.

93

Fig. 3.14 Apoptosis levels peripheral T cells in WT and MYSM1 KO mice A. WT and
MYSM1 KO T cells were examined for apoptosis by Annexin V/PI. WT and MYSM1 KO
thymocytes were stained for CD4, CD8, PI and Annexin V. B. Cell death - peripheral T cell
populations were electronically gated and percent of cells that have incorporated Annexin V is
presented as mean ± SEM for 3 independent experiments. *p < 0.05.

*

94

These data suggest that mature lineages of peripheral T cells in MYSM1 KO mice have a
higher rate of apoptosis, which may affect their functional ability. Although more
research is needed to determine how MYSM1 influences T cell viability.

3.5 DISCUSSION

In this article we show a novel role for MYSM1 in the regulation of thymocyte
development. We show that the thymocyte development in MYSM1 KO mice is severely
altered, where MYSM1 thymuses are reduced in size and cellularity. We further
implicate MYSM1 as regulator of CCR9 expression on multiple hematopoietic cell
lineages as well as at various points during thymocyte development. MYSM1 regulation
of CCR9 likely contributes to impaired thymic colonization and the resulting
lymphopenic phenotype observed in MYSM1 KO mice. Moreover, we suggest that the
reduction of CCR9 expression likely contributes to the dysregulation of thymocyte
proliferative capacity in MYSM1 KO thymocytes. Overall, we show original roles for
MYSM1 in thymocyte development and T cell function and demonstrate novel
physiological consequences for H2A ubiquitination.
Our lab has previously shown that the novel histone deubiquitinase MYSM1 has
critical roles in hematopoietic development including B cell maturation and HSC
viability (Jiang, Nguyen et al. 2011, Wang, Nandakumar et al. 2013). Moreover, others
have reported reductions in thymic cellularity and have demonstrated that the MYSM1
promoter is activated at several points throughout thymocyte development, indicating that

95

MYSM1 has a cell intrinsic role in the optimal thymocyte development. However,
MYSM1’s physiological role in thymocyte development is not fully understood. Our
initial observations support the finding that MYSM1 is heavily involved in thymocyte
development. We confirm that MYSM1 KO mice display reduced thymic size and
cellularity and report several alterations in frequency of particular thymic subpopulations
(Fig. 3.1-3.3). We then go on to demonstrate that MYSM1 mice are impaired in their
ability to express the chemokine receptor CCR9 (Fig. 3.4-3.6). It has been shown that the
passage of thymocytes through the different developmental stages is directed by the
regulated expression of specific chemokine markers (Love and Bhandoola 2011). For
example, CCR9 has been implicated in the mechanism CD4SP vs. CD8SP determination,
where high levels of CCR9 expression correlate with CD4SP selection and high levels of
CCR7 expression correlate with CD8SP selection (Singer, Adoro et al. 2008). MYSM1
KO mice have normal levels of CCR7 expression (data not shown) with reductions in
CCR9 expression (Fig. 3.2). MYSM1 KO mice also displayed a change in CD4SP and
CD8SP frequency with increases in CD8SP and decrease in CD4SP populations. It is
possible that the reduction of CCR9 on DP thymocytes may play a role in influencing SP
thymocyte determination.
Previous studies have also reported that CCR9 is expressed on a number of
hematopoietic lineages including LSKs and CLPs (Schwarz, Sambandam et al. 2007). In
conjunction with other chemokine receptors, such as CCR7, expression of CCR9 is
believed to facilitate entry of bone marrow-derived progenitors into the thymus (Krueger,
Willenzon et al. 2010, Zlotoff, Sambandam et al. 2010). When CCR9 expression is

96

knocked down in mice, thymic colonization by bone marrow-derived progenitors is
reduced (Schwarz, Sambandam et al. 2007). In MYSM1-deficient mice, we observed
severe reductions of CCR9 expression on LSK and CLP bone marrow populations (Fig.
3.10). It has been reported elsewhere that in competitive bone marrow transplants,
MYSM1 cells fail to repopulate the thymus resulting in a complete breakdown of
thymocyte development (Nijnik, Clare et al. 2012). Our data suggests it is possible that
the failure of MYSM1 KO bone marrow to reconstitute the thymus could be influenced
by the reduction of CCR9 on MYSM1 bone marrow progenitor cells. Furthermore, we
show that ETPs, the population of cells that are the most recent thymic immigrants, was
significantly reduced in MYSM1-deificent mice (Fig. 3.9). The ETPs present in MYSM1
KO mice displayed reduced expression of CCR9 (Fig. 3.10A), indicating that thymic
entry likely has redundant mechanisms. We have previously demonstrated that MYSM1
KO mice have reductions in HSC cellularity caused by the inability to maintain
quiescence (Wang, Nandakumar et al. 2013). We acknowledge that alterations in
progenitor cell proliferation may also contribute to the ineffectiveness of thymic
colonization in MYSM1 KO mice. Furthermore, to accurately determine the ability of
MYSM1-deficient bone marrow progenitors to colonize the thymus, future work
characterizing individual progenitor populations is required.
Although the thymic colonization of bone marrow-derived progenitor cells is
diminished when CCR9 expression is knocked down in mice, the size and cellularity of
the thymus remains relatively similar to normal (Schwarz, Sambandam et al. 2007). It has
been suggested that a compensatory mechanism of cell proliferation during the DN3

97

stage of thymocyte development is believed to resolve the initial discrepancy in
cellularity (Krueger, Willenzon et al. 2010, Zlotoff, Sambandam et al. 2010). Similar to
CCR9 KO mice, MYSM1 KO mice had reductions in ETP populations (Fig. 3.9).
Moreover, when we analyzed the proliferation of thymic subsets in MYSM1 KO mice,
we observed increases in several DN populations including the ETP, DN2, DN3, and
DN4 populations (Fig. 3.11). However, normal thymic cellularity was not restored in
MYSM1 KO mice (Fig. 3.1 and 3.2). To address this, we also measured the apoptotic
populations of the thymocyte subpopulations and observed that apoptosis was increased
in all MYSM1 KO thymocyte subpopulations (Fig. 3.12). The exact causes of the
elevated apoptotic rates are unknown but may be linked to the negative selection of
thymocytes as SP cells that do not pass this stage succumb to apoptosis. Further research
needs to be done to elucidate the exact mechanism. However, we propose that despite the
increase in DN thymocyte proliferation, the combination of a dramatically smaller
progenitor cell population coupled with increases in apoptosis contribute to the failure of
MYSM1 KO thymocytes to reach normal levels of thymic cellularity. Moreover, these
defects likely contribute to the reduction of mature T cell populations in the periphery of
MYSM1 KO mice but further studies are needed to determine the exact mechanism.

3.6 ACKNOWLEDGEMENTS
The authors would like to thank Bangxing Hong and Sung Lee for technical assistance.

98

CHAPTER 4
SUMMARY AND FUTURE DIRECTIONS

4.1 INTRODUCTION
I have used a MYSM1-deficient mouse model to characterize the expression of CCR9
expression during thymocyte development and intestinal inflammatory responses. CCR9
expression on developing thymic progenitors ensures proper localization and eventual
colonization of the mouse thymus (Schwarz, Sambandam et al. 2007). However, most
CCR9 expression is diminished on developmentally mature thymocyte and recent thymic
emigrants (Wurbel, Malissen et al. 2006). However, when circulating T cells are active in
the GALT of mice, CCR9 expression is dramatically upregulated to facilitate their access
to the intestinal epithelium (Wurbel, Malissen et al. 2001, Uehara, Grinberg et al. 2002,
Iwata, Hirakiyama et al. 2004). When MYSM1 is removed from the mouse system,
CCR9 expression is modified in a cell specific, anatomically distinct manner. Here, I
establish MYSM1 as a novel regulator of CCR9 expression in CD4
+
T cells and
thymocytes. Moreover, I also characterize a novel physiological role for MYSM1 in
regulation of thymocyte development and intestinal inflammatory processes.

4.2 MYSM1’s ROLE IN GUT-SPECIFIC HOMING
The chemokine receptor, CCR9, is primarily expressed on developing thymocytes and
gut-specific inflammatory cells. In both anatomical compartments, CCR9 directs the
movement of cells for optimal functional capacity. While inroads have been made in

99

elucidating the regulatory mechanisms in recent years, the epigenetic regulation of the
Ccr9 locus is poorly characterized. The novel histone H2A deubiquitinase MYSM1 has
been implicated in the regulation of chemokine expression (Zhou, Zhu et al. 2008). Using
a MYSM1-deficient mouse model I implicate MYSM1 as a novel mediator of CCR9
expression in the intestinal mucosa. In Chapter 2 I attempt to characterize the altered
frequency of T cells in the peripheral lymphoid organs of MYSM1 KO mice, as well as
increases in CCR9 expression on CD4
+
T cell populations.
Using flow cytometry, I show that MYSM1 KO mice have an accumulation of
CD4
+
T cells in the PLN and MLN when compared to WT mice. It has been described
that MYSM1 KO mice display severe lymphopenia in the spleen and peripheral lymph
nodes. My findings confirmed lymphopenic conditions in the PLN of MYSM1 KO mice,
however, I did not detect a change in the T cell populations with MYSM1 KO MLNs.
Based on traditional T cell development patterns, T cell accumulation in the MLN is
indicative of T cell activation/ proliferation and strong inflammatory reactions within the
intestine. I then showed that MYSM1 KO mice have elevated populations of activated T
cells in the MLN. Although aberrant expression of homing markers has been implicated
in autoimmune disorders of the intestines, a number of explanations exist including loss
of tolerance to commensal bacteria. Another possibility is that MYSM1 KO mice
developed malformations or damage to the intestinal epithelial. Disruption of the
intestinal epithelial layer is associated with dramatic increases in invasive inflammatory
cells (Okayasu, Hatakeyama et al. 1990, Dieleman, Ridwan et al. 1994). Histology of the
small intestine (Data not shown) of MYSM1 KO mice reveals alterations to the small

100

intestine epithelium although it is unknown if the differences are inherited or developed.
Further studies to characterize the development of intestinal morphology as well as the
microbial microenvironment of MYSM1 KO would be useful in clarifying alternative
inflammatory scenarios. Moreover, a thorough characterization of intestinal regulatory T
cells (Tregs) could help elucidate what role, if any, loss of tolerance could play in the
accumulation of T cells in the aforementioned compartments.
Traditionally, when T cells are activated, they are ‘imprinted’ with characteristics
that allow the cell to enter the secondary tissue associated with the lymph node
(Villablanca, Russo et al. 2008). When T cells are activated within MLNs, they begin to
express CCR9. Because of this, I examined the expression of CCR9 on MYSM1-defcient
T cells. First, analysis of naïve splenic T cell populations did not reveal a significant
difference in CCR9 expression levels. Naïve CD8
+
T cells naturally possess a basal level
of CCR9 expression, which was detected in MYSM1 KO cells but not significantly
different that WT cells (Wurbel, Malissen et al. 2006, Wurbel, Malissen et al. 2007).
Evaluation of activated T cells in the PLN, MLN, and PP of WT showed elevated levels
of CCR9 expression on MYSM1 KO T cell populations. The corresponding increase of
CCR9 mRNA expression was confirmed by qRT-PCR. It has been shown that induction
of T cell expressed CCR9 is dependent on the uptake of RA by the T cell during antigen
presentation (Iwata, Hirakiyama et al. 2004). Therefore, I cultured naïve T cells isolated
from WT and MYSM1 KO mice with various concentrations of RA and assessed the
subsequent expression of CCR9. At every RA concentration tested, MYSM1 KO cells
displayed elevated levels of CCR9 expression. MYSM1-deificent CD4
+
T cells display

101

hypersensitivity towards RA stimulation, in which the expression of downstream RA
targets is significantly enhanced. Previous studies have shown that RA also enhances the
generation and commitment of Treg cells (Benson, Pino-Lagos et al. 2007). Moreover,
RA was also shown to increase expression of CCR9 by Tregs (Moore, Sauma et al.
2009). Further studies into Treg commitment of MYSM1-deficient cells are needed to
provide insight into the broad role of MYSM1 in CCR9 regulation for specific cell
lineages.
The largest differences observed in CCR9 expression between WT and MYSM1
KO cells occurred at RA levels that are physiologically uncommon. Moreover, this
culture system does not entirely recapitulate the in vivo environment in which T cell
activation occurs. It is likely a number of other costimulatory factors are at play in the
generation of gut-specific T cells. The inclusion and characterization of a DC/T cell
culture system may provide more insights into the exact environmental milieu at the time
of CCR9 induction.
CCR9 is responsive to the chemokine ligand CCL25. CCL25 is primarily
expressed by the intestinal epithelium, but is tethered by the intestinal endothelium to
facilitate T cell transmigration into the intestinal LP (Zabel, Agace et al. 1999, Kunkel,
Campbell et al. 2000, Wurbel, Philippe et al. 2000). To show that the increase in
intestinal homing is a cell intrinsic effect, I performed an in vivo competitive homing
experiment. Upon analysis, MYSM1 KO T cells displayed preferential homing the
intestinal LP and GALT. It should be noted that entrance into the intestinal LP is
dependent on other factors besides CCR9, including α4β7. We monitored MYSM1 KO T

102

cell expression of α4β7 and noted that it was slightly elevated but not significantly so in
vivo. Elevated levels of α4β7 expression may play a role in the increased in vivo homing
we observed of MYSM1 KO T cells. Further characterization of functional α4β7
expression in MYSM1 KO mice would help to elucidate what role, if any, it plays in
modifying gut-specific homing.
Aberrant expression of homing markers has been implicated in the development
of chronic intestinal inflammatory disorders such as Crohn’s disease and ulcerative colitis
(Baumgart and Carding 2007). To test MYSM1 KO mice for any sensitivity for intestinal
inflammatory disorders, I utilized a chemically induced mouse model for colitis. MYSM1
KO mice displayed higher change in weight loss and lower rates of survival compared to
WT mice. Moreover, MYSM1 KO mice presented higher Hemoccult scores indicating
an elevated presence of colorectal hemorrhaging. Chemically induced colitis models
induce high levels of intestinal and colonic inflammatory responses (Okayasu,
Hatakeyama et al. 1990, Dieleman, Ridwan et al. 1994). However, they fail to
recapitulate the mechanism by which autoimmune inflammatory disorders. It has been
shown the transferring CD25
-
CD4
+
T cells into non-congenic hosts will generate a colitis
model more reflective of the natural development and progression of the disease. The
implementation and characterization of this model with MYSM1-deficeint T cells would
go a long way in establishing MYSM1’s physiologic role in the development of chronic
intestinal inflammatory disorders.
CCR9 expression is regulated by a number of transcription factors that act in a
coordinated manner to ensure optimal expression of the chemokine receptor. Ligand-

103

dependent RARs and RXRs heterodimerize and interact with the common T cell
transcription factor NFATc2 to induce CCR9 expression (Ohoka, Yokota et al. 2011). To
help elucidate MYSM1’s regulatory mechanisms, I investigated the gene expression
levels of the transcription factors commonly associated with CCR9 expression. MYSM1
KO mice have increased levels of a number of CCR9-related transcription factors
including NFATc2, RARβ, and RXRα. It is not clear if MYSM1 directly regulates any of
these genes or if regulation is through some secondary mechanism. Moreover, it is
unclear if MYSM1 directly interacts with any of the CCR9-related transcription factors to
regulate transcription. Characterization of MYSM1’s interactions with CCR9-realted
transcription factors can be interrogated through co-immunoprecipitation (Co-IP)
experiments. Briefly, transfection of HEK293T cells with MYSM1 and relevant
transcription factor plasmids followed by Co-IP would determine if MYSM1 is directly
binding to a specific transcription factor. If any interaction is detected, alterations in the
binding affinity of that transcription factor to the CCR9 locus in MYSM1 KO cells can
be determined through ChIP analysis. Overall, these experiments would help elucidate
the mechanism by which MYSM1 alters CCR9 expression in the context of intestinal
homing and provide further insight into the physiological role of MYSM1.

4.3 MYSM1’s ROLE IN THYMOCYTE DEVELOPMENT
Although T cells develop in the thymus, the thymus does not contain a self-renewing
progenitor population. All T cells start as bone marrow-derived progenitor cells that
migrate to, and eventually settle, the thymus. The exact cell population that colonizes the

104

thymus has not been determined, but it has been shown that expression of CCR9 by
circulating progenitor cells is required for entry into the thymus (Schwarz, Sambandam et
al. 2007). Moreover, CCR9 is required for the proper localization and migration of cells
during thymocyte development (Uehara, Grinberg et al. 2002). Because I implicate
MYSM1 as a novel regulator of CCR9 in the context of gut-specific T cell homing in
Chapter 2, I investigated what role, if any, MYSM1 had in the regulation of CCR9 during
thymus colonization and thymocyte development. Surprisingly, in Chapter 3 I implicate
MYSM1 as a positive regulator of CCR9 expression on bone marrow-derived progenitor
populations, as well as, developing thymocyte populations.
The earliest expression of CCR9 has been detected on LSK populations in the
BM. Although LSK populations themselves do not home to the thymus, their progeny,
CLPs, have shown the ability to generate functional thymocytes (Schwarz, Sambandam
et al. 2007). Here, I show that both the LSK and CLP populations of MYSM1 KO mice
have significantly reduced levels of CCR9 expression. This indicates that the earliest
induction of CCR9 on bone marrow-derived progenitor populations is inhibited. In CCR9
KO mice, ETP populations are dramatically reduced, indicating an inability to
transmigrate into the thymus (Lai and Kondo 2007). MYSM1 KO mice displayed a
similar phenotype. ETP populations were dramatically smaller in MYSM1 KO mice
compared to WT counterparts. Moreover, CCR9 expression on ETP cells was reduced
when compared to WT ETPs. These results suggest that the lack of CCR9 expression of
thymic settling progenitor populations inhibits entry into the thymus in MYSM1 KO
mice. Previous groups have shown that in competitive BM transplant assays; MYSM1

105

KO cells fail to generate functional thymocytes (Nijnik, Clare et al. 2012). To fully
characterize the ability of MYSM1 KO progenitor populations to settle the thymus,
adoptive transfer experiments with individual progenitor populations, such as CLPs,
LMPP, etc. should be performed. Moreover, it has been shown that the developmental
potential of bone marrow-derived progenitor populations can be assessed though
intrathymic injection of individual cell populations (Bhandoola, von Boehmer et al.
2007). Intrathymic injection of MYSM1-deficeint populations could help characterize at
what point, if at all, the differential potential of MYSM1 KO cells is compromised.
Besides thymic entry, expression of CCR9 is used to direct specific thymocyte
populations to anatomically distinct regions of the thymus during thymocyte
development. ETPs undergo massive proliferation at which point they lose expression of
CCR9, which is believed to direct migration away from the thymic cortex. This occurs at
stage DN3 and until thymic emigration; most thymocyte subpopulations express some
level of CCR9. After several differentiation stages, thymocytes must upregulate CCR9 to
migrate through the cortex (Michie and Zuniga-Pflucker 2002, Baldwin, Sandau et al.
2005). When examining MYSM1 KO thymocyte subpopulations, I discovered that
MYSM1 KO thymocytes in the DN3 stage failed to upregulate CCR9. Moreover, CCR9
expression in the proceeding stages, DN4, DP and SP, was reduced in MYSM1 KO mice.
Loss of CCR9 expression was confirmed through qRT-PCR and a loss of chemotactic
responsiveness to CCL25, in vitro. It is still unknown whether the loss of CCR9
expression on MYSM1 KO thymocyte subpopulation alters the localization of
thymocytes and their migration through the cortex and subcapsular regions of the thymus.

106

Histological examination of the thymus would help characterize the distribution of
thymocytes throughout the thymus and determine if migration to particular compartments
is altered. Moreover, more work is needed to determine the binding capacity of MYSM1
to the Ccr9 locus in thymocytes. I show that MYSM1 interacts either directly or
indirectly to the Ccr9 locus in mature T cell populations, but need to confirm that
interaction in thymocyte populations.
Although the absence of CCR9 on bone marrow-derived progenitors prevents
optimal settling of the thymus, thymic size and cellularity are not altered. On the other
hand, MYSM1 KO mice possess significantly smaller populations of thymocytes and
total cellularity. A compensatory proliferative mechanism during the DN3 stage of
thymocyte development is implicated in maintenance of normal cellularity in WT mice
(Krueger, Willenzon et al. 2010, Zlotoff, Sambandam et al. 2010). MYSM1 KO mice
also show elevated rates of proliferation in the DN stages yet normal thymic cellularity is
not regained. Annexin V staining with MYSM1 KO thymocytes indicated significantly
increased levels of apoptosis in all MYSM1-deficient thymocyte subpopulations. I
contend that the increased levels of apoptosis as well as diminished progenitor
populations prevent optimal thymocyte development. However, increased rates of
apoptosis are likely independent of any CCR9-realated mechanism. Further evaluation
and characterization of the apoptotic pathways including expression of Bcl-2 and other
genes may provide some insight into this mechanism.
Finally, I show that mature, peripheral T cells in MYSM1 KO mice have altered
proliferation and activation patterns. Based upon this data it would appear that MYSM1

107

KO mice would possess diminished capacity to maintain immune homeostasis. More
work to characterize the in vivo ability of MYSM1 KO mice to respond to pathogenic
organisms is needed. Moreover, the differential capacity of naïve T cells would likely
yield interesting results as I have shown that CD4
+
and CD8
+
T cell distributions are
altered in the periphery of MYSM1 KO mice.

4.4 CONCLUSION
In this dissertation, I have presented a novel physiological role for MYSM1 in the
regulation of the chemokine CCR9. MYSM1 seems to affect expression of CCR9 in a
cell specific fashion. CD4
+
T cells in MYSM1 KO mice displayed sensitivity to RA
stimulation and overexpress CCR9 in a gut-specific context, which lead to accumulation
of cells in the LP of the small intestinal LP. Surprisingly, the lack of MYSM1 had the
opposite effect on developing thymocytes. MYSM1 KO thymocytes displayed inhibited
expression of CCR9 and were unable to maintain normal thymic cellularity, which likely
contributes to the altered frequency and cellularity of peripheral T cells. Further work is
needed to fully elucidate the regulatory mechanism of MYSM1 in these different
contexts.

108

REFERENCES
Abitorabi, M. A., C. R. Mackay, E. H. Jerome, O. Osorio, E. C. Butcher and D. J. Erle
(1996). "Differential expression of homing molecules on recirculating lymphocytes from
sheep gut, peripheral, and lung lymph." J Immunol 156(9): 3111-3117.
Adolfsson, J., O. J. Borge, D. Bryder, K. Theilgaard-Monch, I. Astrand-Grundstrom, E.
Sitnicka, Y. Sasaki and S. E. Jacobsen (2001). "Upregulation of Flt3 expression within
the bone marrow Lin(-)Sca1(+)c-kit(+) stem cell compartment is accompanied by loss of
self-renewal capacity." Immunity 15(4): 659-669.
Adolfsson, J., R. Mansson, N. Buza-Vidas, A. Hultquist, K. Liuba, C. T. Jensen, D.
Bryder, L. Yang, O. J. Borge, L. A. Thoren, K. Anderson, E. Sitnicka, Y. Sasaki, M.
Sigvardsson and S. E. Jacobsen (2005). "Identification of Flt3+ lympho-myeloid stem
cells lacking erythro-megakaryocytic potential a revised road map for adult blood lineage
commitment." Cell 121(2): 295-306.
Allende, M. L., J. L. Dreier, S. Mandala and R. L. Proia (2004). "Expression of the
sphingosine 1-phosphate receptor, S1P1, on T-cells controls thymic emigration." J Biol
Chem 279(15): 15396-15401.
Allman, D., A. Sambandam, S. Kim, J. P. Miller, A. Pagan, D. Well, A. Meraz and A.
Bhandoola (2003). "Thymopoiesis independent of common lymphoid progenitors." Nat
Immunol 4(2): 168-174.
Arstila, T., T. P. Arstila, S. Calbo, F. Selz, M. Malassis-Seris, P. Vassalli, P. Kourilsky
and D. Guy-Grand (2000). "Identical T cell clones are located within the mouse gut
epithelium and lamina propia and circulate in the thoracic duct lymph." J Exp Med
191(5): 823-834.
Baba, T., Y. Nakamoto and N. Mukaida (2009). "Crucial contribution of thymic Sirp
alpha+ conventional dendritic cells to central tolerance against blood-borne antigens in a
CCR2-dependent manner." J Immunol 183(5): 3053-3063.
Bain, G., I. Engel, E. C. Robanus Maandag, H. P. te Riele, J. R. Voland, L. L. Sharp, J.
Chun, B. Huey, D. Pinkel and C. Murre (1997). "E2A deficiency leads to abnormalities
in alphabeta T-cell development and to rapid development of T-cell lymphomas." Mol
Cell Biol 17(8): 4782-4791.

109

Baldwin, T. A., M. M. Sandau, S. C. Jameson and K. A. Hogquist (2005). "The timing of
TCR alpha expression critically influences T cell development and selection." J Exp Med
202(1): 111-121.
Bastien, J. and C. Rochette-Egly (2004). "Nuclear retinoid receptors and the transcription
of retinoid-target genes." Gene 328: 1-16.
Baumgart, D. C. and S. R. Carding (2007). "Inflammatory bowel disease: cause and
immunobiology." Lancet 369(9573): 1627-1640.
Baumgart, D. C. and W. J. Sandborn (2007). "Inflammatory bowel disease: clinical
aspects and established and evolving therapies." Lancet 369(9573): 1641-1657.
Benson, M. J., K. Pino-Lagos, M. Rosemblatt and R. J. Noelle (2007). "All-trans retinoic
acid mediates enhanced T reg cell growth, differentiation, and gut homing in the face of
high levels of co-stimulation." J Exp Med 204(8): 1765-1774.
Benz, C. and C. C. Bleul (2005). "A multipotent precursor in the thymus maps to the
branching point of the T versus B lineage decision." J Exp Med 202(1): 21-31.
Benz, C., K. Heinzel and C. C. Bleul (2004). "Homing of immature thymocytes to the
subcapsular microenvironment within the thymus is not an absolute requirement for T
cell development." Eur J Immunol 34(12): 3652-3663.
Berg, E. L., M. K. Robinson, R. A. Warnock and E. C. Butcher (1991). "The human
peripheral lymph node vascular addressin is a ligand for LECAM-1, the peripheral lymph
node homing receptor." J Cell Biol 114(2): 343-349.
Berlin, C., R. F. Bargatze, J. J. Campbell, U. H. von Andrian, M. C. Szabo, S. R. Hasslen,
R. D. Nelson, E. L. Berg, S. L. Erlandsen and E. C. Butcher (1995). "alpha 4 integrins
mediate lymphocyte attachment and rolling under physiologic flow." Cell 80(3): 413-
422.
Bhandoola, A., H. von Boehmer, H. T. Petrie and J. C. Zuniga-Pflucker (2007).
"Commitment and developmental potential of extrathymic and intrathymic T cell
precursors: plenty to choose from." Immunity 26(6): 678-689.

110

Blomhoff, R. and H. K. Blomhoff (2006). "Overview of retinoid metabolism and
function." J Neurobiol 66(7): 606-630.
Boehm, T. and C. C. Bleul (2006). "Thymus-homing precursors and the thymic
microenvironment." Trends Immunol 27(10): 477-484.
Bonasio, R., M. L. Scimone, P. Schaerli, N. Grabie, A. H. Lichtman and U. H. von
Andrian (2006). "Clonal deletion of thymocytes by circulating dendritic cells homing to
the thymus." Nat Immunol 7(10): 1092-1100.
Boyer, L. A., R. R. Latek and C. L. Peterson (2004). "The SANT domain: a unique
histone-tail-binding module?" Nat Rev Mol Cell Biol 5(2): 158-163.
Butcher, E. C. and L. J. Picker (1996). "Lymphocyte homing and homeostasis." Science
272(5258): 60-66.
Butcher, E. C., M. Williams, K. Youngman, L. Rott and M. Briskin (1999). "Lymphocyte
trafficking and regional immunity." Adv Immunol 72: 209-253.
Campbell, D. J. and E. C. Butcher (2002). "Rapid acquisition of tissue-specific homing
phenotypes by CD4(+) T cells activated in cutaneous or mucosal lymphoid tissues." J
Exp Med 195(1): 135-141.
Campbell, J. J., J. Hedrick, A. Zlotnik, M. A. Siani, D. A. Thompson and E. C. Butcher
(1998). "Chemokines and the arrest of lymphocytes rolling under flow conditions."
Science 279(5349): 381-384.
Camus, P., F. Piard, T. Ashcroft, A. A. Gal and T. V. Colby (1993). "The lung in
inflammatory bowel disease." Medicine (Baltimore) 72(3): 151-183.
Cantrell, D. A. (2003). "Regulation and function of serine kinase networks in
lymphocytes." Curr Opin Immunol 15(3): 294-298.
Carlson, C. M., B. T. Endrizzi, J. Wu, X. Ding, M. A. Weinreich, E. R. Walsh, M. A.
Wani, J. B. Lingrel, K. A. Hogquist and S. C. Jameson (2006). "Kruppel-like factor 2
regulates thymocyte and T-cell migration." Nature 442(7100): 299-302.

111

Chaffin, K. E., C. R. Beals, T. M. Wilkie, K. A. Forbush, M. I. Simon and R. M.
Perlmutter (1990). "Dissection of thymocyte signaling pathways by in vivo expression of
pertussis toxin ADP-ribosyltransferase." EMBO J 9(12): 3821-3829.
Chaffin, K. E. and R. M. Perlmutter (1991). "A pertussis toxin-sensitive process controls
thymocyte emigration." Eur J Immunol 21(10): 2565-2573.
Chambon, P. (1996). "A decade of molecular biology of retinoic acid receptors." FASEB
J 10(9): 940-954.
Chandrasekharan, M. B., F. Huang and Z. W. Sun (2009). "Ubiquitination of histone
H2B regulates chromatin dynamics by enhancing nucleosome stability." Proc Natl Acad
Sci U S A 106(39): 16686-16691.
Charo, I. F. and R. M. Ransohoff (2006). "The many roles of chemokines and chemokine
receptors in inflammation." N Engl J Med 354(6): 610-621.
Chau, V., J. W. Tobias, A. Bachmair, D. Marriott, D. J. Ecker, D. K. Gonda and A.
Varshavsky (1989). "A multiubiquitin chain is confined to specific lysine in a targeted
short-lived protein." Science 243(4898): 1576-1583.
Choi, Y. I., J. S. Duke-Cohan, W. B. Ahmed, M. A. Handley, F. Mann, J. A. Epstein, L.
K. Clayton and E. L. Reinherz (2008). "PlexinD1 glycoprotein controls migration of
positively selected thymocytes into the medulla." Immunity 29(6): 888-898.
Christensen, J. L. and I. L. Weissman (2001). "Flk-2 is a marker in hematopoietic stem
cell differentiation: a simple method to isolate long-term stem cells." Proc Natl Acad Sci
U S A 98(25): 14541-14546.
Coombes, J. L. and K. J. Maloy (2007). "Control of intestinal homeostasis by regulatory
T cells and dendritic cells." Semin Immunol 19(2): 116-126.
Cyster, J. G. (2005). "Chemokines, sphingosine-1-phosphate, and cell migration in
secondary lymphoid organs." Annu Rev Immunol 23: 127-159.

112

Davalos-Misslitz, A. C., J. Rieckenberg, S. Willenzon, T. Worbs, E. Kremmer, G.
Bernhardt and R. Forster (2007). "Generalized multi-organ autoimmunity in CCR7-
deficient mice." Eur J Immunol 37(3): 613-622.
Davalos-Misslitz, A. C., T. Worbs, S. Willenzon, G. Bernhardt and R. Forster (2007).
"Impaired responsiveness to T-cell receptor stimulation and defective negative selection
of thymocytes in CCR7-deficient mice." Blood 110(13): 4351-4359.
de Napoles, M., J. E. Mermoud, R. Wakao, Y. A. Tang, M. Endoh, R. Appanah, T. B.
Nesterova, J. Silva, A. P. Otte, M. Vidal, H. Koseki and N. Brockdorff (2004).
"Polycomb group proteins Ring1A/B link ubiquitylation of histone H2A to heritable gene
silencing and X inactivation." Dev Cell 7(5): 663-676.
Derbinski, J. and B. Kyewski (2010). "How thymic antigen presenting cells sample the
body's self-antigens." Curr Opin Immunol 22(5): 592-600.
Dias, S., R. Mansson, S. Gurbuxani, M. Sigvardsson and B. L. Kee (2008). "E2A proteins
promote development of lymphoid-primed multipotent progenitors." Immunity 29(2):
217-227.
Dieleman, L. A., B. U. Ridwan, G. S. Tennyson, K. W. Beagley, R. P. Bucy and C. O.
Elson (1994). "Dextran sulfate sodium-induced colitis occurs in severe combined
immunodeficient mice." Gastroenterology 107(6): 1643-1652.
Donskoy, E. and I. Goldschneider (1992). "Thymocytopoiesis is maintained by blood-
borne precursors throughout postnatal life. A study in parabiotic mice." J Immunol
148(6): 1604-1612.
Dudda, J. C., A. Lembo, E. Bachtanian, J. Huehn, C. Siewert, A. Hamann, E. Kremmer,
R. Forster and S. F. Martin (2005). "Dendritic cells govern induction and reprogramming
of polarized tissue-selective homing receptor patterns of T cells: important roles for
soluble factors and tissue microenvironments." Eur J Immunol 35(4): 1056-1065.
Dzhagalov, I. and H. Phee (2012). "How to find your way through the thymus: a practical
guide for aspiring T cells." Cell Mol Life Sci 69(5): 663-682.

113

Ehrlich, L. I., D. Y. Oh, I. L. Weissman and R. S. Lewis (2009). "Differential
contribution of chemotaxis and substrate restriction to segregation of immature and
mature thymocytes." Immunity 31(6): 986-998.
Eksteen, B., A. E. Miles, A. J. Grant and D. H. Adams (2004). "Lymphocyte homing in
the pathogenesis of extra-intestinal manifestations of inflammatory bowel disease." Clin
Med 4(2): 173-180.
Engedal, N., T. Gjevik, R. Blomhoff and H. K. Blomhoff (2006). "All-trans retinoic acid
stimulates IL-2-mediated proliferation of human T lymphocytes: early induction of cyclin
D3." J Immunol 177(5): 2851-2861.
Fabre, S., F. Carrette, J. Chen, V. Lang, M. Semichon, C. Denoyelle, V. Lazar, N.
Cagnard, A. Dubart-Kupperschmitt, M. Mangeney, D. A. Fruman and G. Bismuth
(2008). "FOXO1 regulates L-Selectin and a network of human T cell homing molecules
downstream of phosphatidylinositol 3-kinase." J Immunol 181(5): 2980-2989.
Farkas, S., M. Hornung, C. Sattler, K. Edtinger, M. Steinbauer, M. Anthuber, H. J.
Schlitt, H. Herfarth and E. K. Geissler (2006). "Blocking MAdCAM-1 in vivo reduces
leukocyte extravasation and reverses chronic inflammation in experimental colitis." Int J
Colorectal Dis 21(1): 71-78.
Fukata, M., K. S. Michelsen, R. Eri, L. S. Thomas, B. Hu, K. Lukasek, C. C. Nast, J.
Lechago, R. Xu, Y. Naiki, A. Soliman, M. Arditi and M. T. Abreu (2005). "Toll-like
receptor-4 is required for intestinal response to epithelial injury and limiting bacterial
translocation in a murine model of acute colitis." Am J Physiol Gastrointest Liver Physiol
288(5): G1055-1065.
Gerard, C. and B. J. Rollins (2001). "Chemokines and disease." Nat Immunol 2(2): 108-
115.
Girard, J. P. and T. A. Springer (1995). "High endothelial venules (HEVs): specialized
endothelium for lymphocyte migration." Immunol Today 16(9): 449-457.
GlaxoSmithKlein (2010). "A single dose, randomized, five-period crossover study to
assess the relative bioavailability of four new formulations of the CCR9 receptor
antagonist GSK1605786A (CCX282) in healthy male and female subjects. ."
GlaxoSmithKlein Clinical Study Register.

114

Goldknopf, I. L., C. W. Taylor, R. M. Baum, L. C. Yeoman, M. O. Olson, A. W.
Prestayko and H. Busch (1975). "Isolation and characterization of protein A24, a
"histone-like" non-histone chromosomal protein." J Biol Chem 250(18): 7182-7187.
Gossens, K., S. Naus, S. Y. Corbel, S. Lin, F. M. Rossi, J. Kast and H. J. Ziltener (2009).
"Thymic progenitor homing and lymphocyte homeostasis are linked via S1P-controlled
expression of thymic P-selectin/CCL25." J Exp Med 206(4): 761-778.
Goto, A., Y. Arimura, Y. Shinomura, K. Imai and Y. Hinoda (2006). "Antisense therapy
of MAdCAM-1 for trinitrobenzenesulfonic acid-induced murine colitis." Inflamm Bowel
Dis 12(8): 758-765.
Gowans, J. L. and E. J. Knight (1964). "The Route of Re-Circulation of Lymphocytes in
the Rat." Proc R Soc Lond B Biol Sci 159: 257-282.
Gunn, M. D., K. Tangemann, C. Tam, J. G. Cyster, S. D. Rosen and L. T. Williams
(1998). "A chemokine expressed in lymphoid high endothelial venules promotes the
adhesion and chemotaxis of naive T lymphocytes." Proc Natl Acad Sci U S A 95(1): 258-
263.
Guy-Grand, D., C. Griscelli and P. Vassalli (1978). "The mouse gut T lymphocyte, a
novel type of T cell. Nature, origin, and traffic in mice in normal and graft-versus-host
conditions." J Exp Med 148(6): 1661-1677.
Hall, J. A., J. R. Grainger, S. P. Spencer and Y. Belkaid (2011). "The role of retinoic acid
in tolerance and immunity." Immunity 35(1): 13-22.
Hamann, A., D. P. Andrew, D. Jablonski-Westrich, B. Holzmann and E. C. Butcher
(1994). "Role of alpha 4-integrins in lymphocyte homing to mucosal tissues in vivo." J
Immunol 152(7): 3282-3293.
Handel, T. M. and P. J. Domaille (1996). "Heteronuclear (1H, 13C, 15N) NMR
assignments and solution structure of the monocyte chemoattractant protein-1 (MCP-1)
dimer." Biochemistry 35(21): 6569-6584.
Hesterberg, P. E., D. Winsor-Hines, M. J. Briskin, D. Soler-Ferran, C. Merrill, C. R.
Mackay, W. Newman and D. J. Ringler (1996). "Rapid resolution of chronic colitis in the

115

cotton-top tamarin with an antibody to a gut-homing integrin alpha 4 beta 7."
Gastroenterology 111(5): 1373-1380.
Hong, B., X. T. Song, L. Rollins, L. Berry, X. F. Huang and S. Y. Chen (2011). "Mucosal
and systemic anti-HIV immunity controlled by A20 in mouse dendritic cells." J Clin
Invest 121(2): 739-751.
Hosoya, T., T. Kuroha, T. Moriguchi, D. Cummings, I. Maillard, K. C. Lim and J. D.
Engel (2009). "GATA-3 is required for early T lineage progenitor development." J Exp
Med 206(13): 2987-3000.
Howard, M. and W. E. Paul (1983). "Regulation of B-cell growth and differentiation by
soluble factors." Annu Rev Immunol 1: 307-333.
Igarashi, H., S. C. Gregory, T. Yokota, N. Sakaguchi and P. W. Kincade (2002).
"Transcription from the RAG1 locus marks the earliest lymphocyte progenitors in bone
marrow." Immunity 17(2): 117-130.
Ikawa, T., S. Hirose, K. Masuda, K. Kakugawa, R. Satoh, A. Shibano-Satoh, R.
Kominami, Y. Katsura and H. Kawamoto (2010). "An essential developmental
checkpoint for production of the T cell lineage." Science 329(5987): 93-96.
Iwata, M., A. Hirakiyama, Y. Eshima, H. Kagechika, C. Kato and S. Y. Song (2004).
"Retinoic acid imprints gut-homing specificity on T cells." Immunity 21(4): 527-538.
Jaensson, E., H. Uronen-Hansson, O. Pabst, B. Eksteen, J. Tian, J. L. Coombes, P. L.
Berg, T. Davidsson, F. Powrie, B. Johansson-Lindbom and W. W. Agace (2008). "Small
intestinal CD103+ dendritic cells display unique functional properties that are conserved
between mice and humans." J Exp Med 205(9): 2139-2149.
Jenuwein, T. and C. D. Allis (2001). "Translating the histone code." Science 293(5532):
1074-1080.
Jiang, X. X., Q. Nguyen, Y. Chou, T. Wang, V. Nandakumar, P. Yates, L. Jones, L.
Wang, H. Won, H. R. Lee, J. U. Jung, M. Muschen, X. F. Huang and S. Y. Chen (2011).
"Control of B cell development by the histone H2A deubiquitinase MYSM1." Immunity
35(6): 883-896.

116

Johansson-Lindbom, B., M. Svensson, O. Pabst, C. Palmqvist, G. Marquez, R. Forster
and W. W. Agace (2005). "Functional specialization of gut CD103+ dendritic cells in the
regulation of tissue-selective T cell homing." J Exp Med 202(8): 1063-1073.
Johansson-Lindbom, B., M. Svensson, M. A. Wurbel, B. Malissen, G. Marquez and W.
Agace (2003). "Selective generation of gut tropic T cells in gut-associated lymphoid
tissue (GALT): requirement for GALT dendritic cells and adjuvant." J Exp Med 198(6):
963-969.
Joo, H. Y., L. Zhai, C. Yang, S. Nie, H. Erdjument-Bromage, P. Tempst, C. Chang and
H. Wang (2007). "Regulation of cell cycle progression and gene expression by H2A
deubiquitination." Nature 449(7165): 1068-1072.
Kadish, J. L. and R. S. Basch (1976). "Hematopoietic thymocyte precursors. I. Assay and
kinetics of the appearance of progeny." J Exp Med 143(5): 1082-1099.
Kantele, A., J. Zivny, M. Hakkinen, C. O. Elson and J. Mestecky (1999). "Differential
homing commitments of antigen-specific T cells after oral or parenteral immunization in
humans." J Immunol 162(9): 5173-5177.
Kato, S., R. Hokari, K. Matsuzaki, A. Iwai, A. Kawaguchi, S. Nagao, T. Miyahara, K.
Itoh, H. Ishii and S. Miura (2000). "Amelioration of murine experimental colitis by
inhibition of mucosal addressin cell adhesion molecule-1." J Pharmacol Exp Ther 295(1):
183-189.
Kiel, M. J., O. H. Yilmaz, T. Iwashita, O. H. Yilmaz, C. Terhorst and S. J. Morrison
(2005). "SLAM family receptors distinguish hematopoietic stem and progenitor cells and
reveal endothelial niches for stem cells." Cell 121(7): 1109-1121.
Kim, C. H. and H. E. Broxmeyer (1999). "Chemokines: signal lamps for trafficking of T
and B cells for development and effector function." J Leukoc Biol 65(1): 6-15.
Kishimoto, H. and J. Sprent (1997). "Negative selection in the thymus includes
semimature T cells." J Exp Med 185(2): 263-271.

117

Koboziev, I., F. Karlsson and M. B. Grisham (2010). "Gut-associated lymphoid tissue, T
cell trafficking, and chronic intestinal inflammation." Ann N Y Acad Sci 1207 Suppl 1:
E86-93.
Komander, D., M. J. Clague and S. Urbe (2009). "Breaking the chains: structure and
function of the deubiquitinases." Nat Rev Mol Cell Biol 10(8): 550-563.
Kondo, M., I. L. Weissman and K. Akashi (1997). "Identification of clonogenic common
lymphoid progenitors in mouse bone marrow." Cell 91(5): 661-672.
Kouzarides, T. (2007). "Chromatin modifications and their function." Cell 128(4): 693-
705.
Kremer, L., L. Carramolino, I. Goya, A. Zaballos, J. Gutierrez, M. d. C. Moreno-Ortiz, A.
C. Martinez and G. Marquez (2001). "The transient expression of C-C chemokine
receptor 8 in thymus identifies a thymocyte subset committed to become CD4+ single-
positive T cells." J Immunol 166(1): 218-225.
Krueger, A., S. Willenzon, M. Lyszkiewicz, E. Kremmer and R. Forster (2010). "CC
chemokine receptor 7 and 9 double-deficient hematopoietic progenitors are severely
impaired in seeding the adult thymus." Blood 115(10): 1906-1912.
Kunkel, E. J., J. J. Campbell, G. Haraldsen, J. Pan, J. Boisvert, A. I. Roberts, E. C. Ebert,
M. A. Vierra, S. B. Goodman, M. C. Genovese, A. J. Wardlaw, H. B. Greenberg, C. M.
Parker, E. C. Butcher, D. P. Andrew and W. W. Agace (2000). "Lymphocyte CC
chemokine receptor 9 and epithelial thymus-expressed chemokine (TECK) expression
distinguish the small intestinal immune compartment: Epithelial expression of tissue-
specific chemokines as an organizing principle in regional immunity." J Exp Med 192(5):
761-768.
Kurobe, H., C. Liu, T. Ueno, F. Saito, I. Ohigashi, N. Seach, R. Arakaki, Y. Hayashi, T.
Kitagawa, M. Lipp, R. L. Boyd and Y. Takahama (2006). "CCR7-dependent cortex-to-
medulla migration of positively selected thymocytes is essential for establishing central
tolerance." Immunity 24(2): 165-177.
Lai, A. Y. and M. Kondo (2007). "Identification of a bone marrow precursor of the
earliest thymocytes in adult mouse." Proc Natl Acad Sci U S A 104(15): 6311-6316.

118

Ley, K., C. Laudanna, M. I. Cybulsky and S. Nourshargh (2007). "Getting to the site of
inflammation: the leukocyte adhesion cascade updated." Nat Rev Immunol 7(9): 678-
689.
Li, B., M. Carey and J. L. Workman (2007). "The role of chromatin during transcription."
Cell 128(4): 707-719.
Li, G. and J. Widom (2004). "Nucleosomes facilitate their own invasion." Nat Struct Mol
Biol 11(8): 763-769.
Lind, E. F., S. E. Prockop, H. E. Porritt and H. T. Petrie (2001). "Mapping precursor
movement through the postnatal thymus reveals specific microenvironments supporting
defined stages of early lymphoid development." J Exp Med 194(2): 127-134.
Liu, C., T. Ueno, S. Kuse, F. Saito, T. Nitta, L. Piali, H. Nakano, T. Kakiuchi, M. Lipp,
G. A. Hollander and Y. Takahama (2005). "The role of CCL21 in recruitment of T-
precursor cells to fetal thymi." Blood 105(1): 31-39.
Love, P. E. and A. Bhandoola (2011). "Signal integration and crosstalk during thymocyte
migration and emigration." Nat Rev Immunol 11(7): 469-477.
Luster, A. D. (1998). "Chemokines--chemotactic cytokines that mediate inflammation."
N Engl J Med 338(7): 436-445.
Mackay, C. R., D. P. Andrew, M. Briskin, D. J. Ringler and E. C. Butcher (1996).
"Phenotype, and migration properties of three major subsets of tissue homing T cells in
sheep." Eur J Immunol 26(10): 2433-2439.
Majewski, I. J., M. E. Ritchie, B. Phipson, J. Corbin, M. Pakusch, A. Ebert, M.
Busslinger, H. Koseki, Y. Hu, G. K. Smyth, W. S. Alexander, D. J. Hilton and M. E.
Blewitt (2010). "Opposing roles of polycomb repressive complexes in hematopoietic
stem and progenitor cells." Blood 116(5): 731-739.
Mangelsdorf, D. J. and R. M. Evans (1995). "The RXR heterodimers and orphan
receptors." Cell 83(6): 841-850.

119

Marchesi, V. T. and J. L. Gowans (1964). "The Migration of Lymphocytes through the
Endothelium of Venules in Lymph Nodes: An Electron Microscope Study." Proc R Soc
Lond B Biol Sci 159: 283-290.
Marsal, J., M. Svensson, A. Ericsson, A. H. Iranpour, L. Carramolino, G. Marquez and
W. W. Agace (2002). "Involvement of CCL25 (TECK) in the generation of the murine
small-intestinal CD8alpha alpha+CD3+ intraepithelial lymphocyte compartment." Eur J
Immunol 32(12): 3488-3497.
Masopust, D., V. Vezys, A. L. Marzo and L. Lefrancois (2001). "Preferential localization
of effector memory cells in nonlymphoid tissue." Science 291(5512): 2413-2417.
Matloubian, M., C. G. Lo, G. Cinamon, M. J. Lesneski, Y. Xu, V. Brinkmann, M. L.
Allende, R. L. Proia and J. G. Cyster (2004). "Lymphocyte egress from thymus and
peripheral lymphoid organs is dependent on S1P receptor 1." Nature 427(6972): 355-360.
Matsuzaki, K., Y. Tsuzuki, H. Matsunaga, T. Inoue, J. Miyazaki, R. Hokari, Y. Okada, A.
Kawaguchi, S. Nagao, K. Itoh, S. Matsumoto and S. Miura (2005). "In vivo
demonstration of T lymphocyte migration and amelioration of ileitis in intestinal mucosa
of SAMP1/Yit mice by the inhibition of MAdCAM-1." Clin Exp Immunol 140(1): 22-31.
McCaughtry, T. M., M. S. Wilken and K. A. Hogquist (2007). "Thymic emigration
revisited." J Exp Med 204(11): 2513-2520.
Michie, A. M. and J. C. Zuniga-Pflucker (2002). "Regulation of thymocyte
differentiation: pre-TCR signals and beta-selection." Semin Immunol 14(5): 311-323.
Misslitz, A., O. Pabst, G. Hintzen, L. Ohl, E. Kremmer, H. T. Petrie and R. Forster
(2004). "Thymic T cell development and progenitor localization depend on CCR7." J Exp
Med 200(4): 481-491.
Moore, C., D. Sauma, J. Morales, M. R. Bono, M. Rosemblatt and J. A. Fierro (2009).
"Transforming growth factor-beta and all-trans retinoic acid generate ex vivo transgenic
regulatory T cells with intestinal homing receptors." Transplant Proc 41(6): 2670-2672.
Mora, J. R. (2008). "Homing imprinting and immunomodulation in the gut: role of
dendritic cells and retinoids." Inflamm Bowel Dis 14(2): 275-289.

120

Mora, J. R., M. R. Bono, N. Manjunath, W. Weninger, L. L. Cavanagh, M. Rosemblatt
and U. H. Von Andrian (2003). "Selective imprinting of gut-homing T cells by Peyer's
patch dendritic cells." Nature 424(6944): 88-93.
Naito, T., H. Tanaka, Y. Naoe and I. Taniuchi (2011). "Transcriptional control of T-cell
development." Int Immunol 23(11): 661-668.
Nakagawa, T., T. Kajitani, S. Togo, N. Masuko, H. Ohdan, Y. Hishikawa, T. Koji, T.
Matsuyama, T. Ikura, M. Muramatsu and T. Ito (2008). "Deubiquitylation of histone
H2A activates transcriptional initiation via trans-histone cross-talk with H3K4 di- and
trimethylation." Genes Dev 22(1): 37-49.
Nandakumar, V., Y. Chou, L. Zang, X. F. Huang and S. Y. Chen (2013). "Epigenetic
control of natural killer cell maturation by histone H2A deubiquitinase, MYSM1." Proc
Natl Acad Sci U S A.
Niederreither, K., V. Fraulob, J. M. Garnier, P. Chambon and P. Dolle (2002).
"Differential expression of retinoic acid-synthesizing (RALDH) enzymes during fetal
development and organ differentiation in the mouse." Mech Dev 110(1-2): 165-171.
Nijnik, A., S. Clare, C. Hale, C. Raisen, R. E. McIntyre, K. Yusa, A. R. Everitt, L.
Mottram, C. Podrini, M. Lucas, J. Estabel, D. Goulding, F. Sanger Institute Microarray,
P. Sanger Mouse Genetics, N. Adams, R. Ramirez-Solis, J. K. White, D. J. Adams, R. E.
Hancock and G. Dougan (2012). "The critical role of histone H2A-deubiquitinase Mysm1
in hematopoiesis and lymphocyte differentiation." Blood 119(6): 1370-1379.
Nitta, T., S. Nitta, Y. Lei, M. Lipp and Y. Takahama (2009). "CCR7-mediated migration
of developing thymocytes to the medulla is essential for negative selection to tissue-
restricted antigens." Proc Natl Acad Sci U S A 106(40): 17129-17133.
Norment, A. M., L. Y. Bogatzki, B. N. Gantner and M. J. Bevan (2000). "Murine CCR9,
a chemokine receptor for thymus-expressed chemokine that is up-regulated following
pre-TCR signaling." J Immunol 164(2): 639-648.
Ohoka, Y., A. Yokota, H. Takeuchi, N. Maeda and M. Iwata (2011). "Retinoic acid-
induced CCR9 expression requires transient TCR stimulation and cooperativity between
NFATc2 and the retinoic acid receptor/retinoid X receptor complex." J Immunol 186(2):
733-744.

121

Okayasu, I., S. Hatakeyama, M. Yamada, T. Ohkusa, Y. Inagaki and R. Nakaya (1990).
"A novel method in the induction of reliable experimental acute and chronic ulcerative
colitis in mice." Gastroenterology 98(3): 694-702.
Olins, A. L. and D. E. Olins (1974). "Spheroid chromatin units (v bodies)." Science
183(4122): 330-332.
Orchard, T. (2003). "Extraintestinal complications of inflammatory bowel disease." Curr
Gastroenterol Rep 5(6): 512-517.
Osley, M. A. (2004). "H2B ubiquitylation: the end is in sight." Biochim Biophys Acta
1677(1-3): 74-78.
Pabst, O., L. Ohl, M. Wendland, M. A. Wurbel, E. Kremmer, B. Malissen and R. Forster
(2004). "Chemokine receptor CCR9 contributes to the localization of plasma cells to the
small intestine." J Exp Med 199(3): 411-416.
Papadakis, K. A., J. Prehn, V. Nelson, L. Cheng, S. W. Binder, P. D. Ponath, D. P.
Andrew and S. R. Targan (2000). "The role of thymus-expressed chemokine and its
receptor CCR9 on lymphocytes in the regional specialization of the mucosal immune
system." J Immunol 165(9): 5069-5076.
Picarella, D., P. Hurlbut, J. Rottman, X. Shi, E. Butcher and D. J. Ringler (1997).
"Monoclonal antibodies specific for beta 7 integrin and mucosal addressin cell adhesion
molecule-1 (MAdCAM-1) reduce inflammation in the colon of scid mice reconstituted
with CD45RBhigh CD4+ T cells." J Immunol 158(5): 2099-2106.
Pickart, C. M. (2004). "Back to the future with ubiquitin." Cell 116(2): 181-190.
Plotkin, J., S. E. Prockop, A. Lepique and H. T. Petrie (2003). "Critical role for CXCR4
signaling in progenitor localization and T cell differentiation in the postnatal thymus." J
Immunol 171(9): 4521-4527.
Ramsey, S. A., T. A. Knijnenburg, K. A. Kennedy, D. E. Zak, M. Gilchrist, E. S. Gold,
C. D. Johnson, A. E. Lampano, V. Litvak, G. Navarro, T. Stolyar, A. Aderem and I.
Shmulevich (2010). "Genome-wide histone acetylation data improve prediction of
mammalian transcription factor binding sites." Bioinformatics 26(17): 2071-2075.

122

Rivera-Nieves, J., J. Ho, G. Bamias, N. Ivashkina, K. Ley, M. Oppermann and F.
Cominelli (2006). "Antibody blockade of CCL25/CCR9 ameliorates early but not late
chronic murine ileitis." Gastroenterology 131(5): 1518-1529.
Rossi, F. M., S. Y. Corbel, J. S. Merzaban, D. A. Carlow, K. Gossens, J. Duenas, L. So,
L. Yi and H. J. Ziltener (2005). "Recruitment of adult thymic progenitors is regulated by
P-selectin and its ligand PSGL-1." Nat Immunol 6(6): 626-634.
Rot, A. and U. H. von Andrian (2004). "Chemokines in innate and adaptive host defense:
basic chemokinese grammar for immune cells." Annu Rev Immunol 22: 891-928.
Sato, Y., A. Yoshikawa, A. Yamagata, H. Mimura, M. Yamashita, K. Ookata, O. Nureki,
K. Iwai, M. Komada and S. Fukai (2008). "Structural basis for specific cleavage of Lys
63-linked polyubiquitin chains." Nature 455(7211): 358-362.
Schabath, R., G. Muller, A. Schubel, E. Kremmer, M. Lipp and R. Forster (1999). "The
murine chemokine receptor CXCR4 is tightly regulated during T cell development and
activation." J Leukoc Biol 66(6): 996-1004.
Scheinecker, C., R. McHugh, E. M. Shevach and R. N. Germain (2002). "Constitutive
presentation of a natural tissue autoantigen exclusively by dendritic cells in the draining
lymph node." J Exp Med 196(8): 1079-1090.
Scheuermann, J. C., A. G. de Ayala Alonso, K. Oktaba, N. Ly-Hartig, R. K. McGinty, S.
Fraterman, M. Wilm, T. W. Muir and J. Muller (2010). "Histone H2A deubiquitinase
activity of the Polycomb repressive complex PR-DUB." Nature 465(7295): 243-247.
Schwarz, B. A. and A. Bhandoola (2004). "Circulating hematopoietic progenitors with T
lineage potential." Nat Immunol 5(9): 953-960.
Schwarz, B. A., A. Sambandam, I. Maillard, B. C. Harman, P. E. Love and A. Bhandoola
(2007). "Selective thymus settling regulated by cytokine and chemokine receptors." J
Immunol 178(4): 2008-2017.
Scimone, M. L., I. Aifantis, I. Apostolou, H. von Boehmer and U. H. von Andrian
(2006). "A multistep adhesion cascade for lymphoid progenitor cell homing to the
thymus." Proc Natl Acad Sci U S A 103(18): 7006-7011.

123

Scollay, R., J. Smith and V. Stauffer (1986). "Dynamics of early T cells: prothymocyte
migration and proliferation in the adult mouse thymus." Immunol Rev 91: 129-157.
Sharabi, A. B., M. Aldrich, D. Sosic, E. N. Olson, A. D. Friedman, S. H. Lee and S. Y.
Chen (2008). "Twist-2 controls myeloid lineage development and function." PLoS Biol
6(12): e316.
Shiow, L. R., D. B. Rosen, N. Brdickova, Y. Xu, J. An, L. L. Lanier, J. G. Cyster and M.
Matloubian (2006). "CD69 acts downstream of interferon-alpha/beta to inhibit S1P1 and
lymphocyte egress from lymphoid organs." Nature 440(7083): 540-544.
Sigmundsdottir, H. and E. C. Butcher (2008). "Environmental cues, dendritic cells and
the programming of tissue-selective lymphocyte trafficking." Nat Immunol 9(9): 981-
987.
Sinclair, L. V., D. Finlay, C. Feijoo, G. H. Cornish, A. Gray, A. Ager, K. Okkenhaug, T.
J. Hagenbeek, H. Spits and D. A. Cantrell (2008). "Phosphatidylinositol-3-OH kinase and
nutrient-sensing mTOR pathways control T lymphocyte trafficking." Nat Immunol 9(5):
513-521.
Singer, A., S. Adoro and J. H. Park (2008). "Lineage fate and intense debate: myths,
models and mechanisms of CD4- versus CD8-lineage choice." Nat Rev Immunol 8(10):
788-801.
Song, X. T., K. Evel-Kabler, L. Shen, L. Rollins, X. F. Huang and S. Y. Chen (2008).
"A20 is an antigen presentation attenuator, and its inhibition overcomes regulatory T cell-
mediated suppression." Nat Med 14(3): 258-265.
Stenstad, H., A. Ericsson, B. Johansson-Lindbom, M. Svensson, J. Marsal, M. Mack, D.
Picarella, D. Soler, G. Marquez, M. Briskin and W. W. Agace (2006). "Gut-associated
lymphoid tissue-primed CD4+ T cells display CCR9-dependent and -independent homing
to the small intestine." Blood 107(9): 3447-3454.
Streeter, P. R., B. T. Rouse and E. C. Butcher (1988). "Immunohistologic and functional
characterization of a vascular addressin involved in lymphocyte homing into peripheral
lymph nodes." J Cell Biol 107(5): 1853-1862.

124

Sun, C. M., J. A. Hall, R. B. Blank, N. Bouladoux, M. Oukka, J. R. Mora and Y. Belkaid
(2007). "Small intestine lamina propria dendritic cells promote de novo generation of
Foxp3 T reg cells via retinoic acid." J Exp Med 204(8): 1775-1785.
Suzuki, A., C. Iwamura, K. Shinoda, D. J. Tumes, M. Y. Kimura, H. Hosokawa, Y. Endo,
S. Horiuchi, K. Tokoyoda, H. Koseki, M. Yamashita and T. Nakayama (2010).
"Polycomb group gene product Ring1B regulates Th2-driven airway inflammation
through the inhibition of Bim-mediated apoptosis of effector Th2 cells in the lung." J
Immunol 184(8): 4510-4520.
Svensson, M., J. Marsal, A. Ericsson, L. Carramolino, T. Broden, G. Marquez and W. W.
Agace (2002). "CCL25 mediates the localization of recently activated CD8alphabeta(+)
lymphocytes to the small-intestinal mucosa." J Clin Invest 110(8): 1113-1121.
Svensson, M., J. Marsal, H. Uronen-Hansson, M. Cheng, W. Jenkinson, C. Cilio, S. E.
Jacobsen, E. Sitnicka, G. Anderson and W. W. Agace (2008). "Involvement of CCR9 at
multiple stages of adult T lymphopoiesis." J Leukoc Biol 83(1): 156-164.
Takeuchi, H., A. Yokota, Y. Ohoka, H. Kagechika, C. Kato, S. Y. Song and M. Iwata
(2010). "Efficient induction of CCR9 on T cells requires coactivation of retinoic acid
receptors and retinoid X receptors (RXRs): exaggerated T Cell homing to the intestine by
RXR activation with organotins." J Immunol 185(9): 5289-5299.
Thomas, S. and D. C. Baumgart (2012). "Targeting leukocyte migration and adhesion in
Crohn's disease and ulcerative colitis." Inflammopharmacology 20(1): 1-18.
Trampont, P. C., A. C. Tosello-Trampont, Y. Shen, A. K. Duley, A. E. Sutherland, T. P.
Bender, D. R. Littman and K. S. Ravichandran (2010). "CXCR4 acts as a costimulator
during thymic beta-selection." Nat Immunol 11(2): 162-170.
Uehara, S., A. Grinberg, J. M. Farber and P. E. Love (2002). "A role for CCR9 in T
lymphocyte development and migration." J Immunol 168(6): 2811-2819.
Uehara, S., K. Song, J. M. Farber and P. E. Love (2002). "Characterization of CCR9
expression and CCL25/thymus-expressed chemokine responsiveness during T cell
development: CD3(high)CD69+ thymocytes and gammadeltaTCR+ thymocytes
preferentially respond to CCL25." J Immunol 168(1): 134-142.

125

Ueno, T., K. Hara, M. S. Willis, M. A. Malin, U. E. Hopken, D. H. Gray, K. Matsushima,
M. Lipp, T. A. Springer, R. L. Boyd, O. Yoshie and Y. Takahama (2002). "Role for
CCR7 ligands in the emigration of newly generated T lymphocytes from the neonatal
thymus." Immunity 16(2): 205-218.
Vicari, A. P., D. J. Figueroa, J. A. Hedrick, J. S. Foster, K. P. Singh, S. Menon, N. G.
Copeland, D. J. Gilbert, N. A. Jenkins, K. B. Bacon and A. Zlotnik (1997). "TECK: a
novel CC chemokine specifically expressed by thymic dendritic cells and potentially
involved in T cell development." Immunity 7(2): 291-301.
Villablanca, E. J., V. Russo and J. R. Mora (2008). "Dendritic cell migration and
lymphocyte homing imprinting." Histol Histopathol 23(7): 897-910.
von Andrian, U. H. and B. Engelhardt (2003). "Alpha4 integrins as therapeutic targets in
autoimmune disease." N Engl J Med 348(1): 68-72.
von Andrian, U. H. and C. R. Mackay (2000). "T-cell function and migration. Two sides
of the same coin." N Engl J Med 343(14): 1020-1034.
von Andrian, U. H. and T. R. Mempel (2003). "Homing and cellular traffic in lymph
nodes." Nat Rev Immunol 3(11): 867-878.
Walters, M. J., Y. Wang, N. Lai, T. Baumgart, B. N. Zhao, D. J. Dairaghi, P. Bekker, L.
S. Ertl, M. E. Penfold, J. C. Jaen, S. Keshav, E. Wendt, A. Pennell, S. Ungashe, Z. Wei,
J. J. Wright and T. J. Schall (2010). "Characterization of CCX282-B, an orally
bioavailable antagonist of the CCR9 chemokine receptor, for treatment of inflammatory
bowel disease." J Pharmacol Exp Ther 335(1): 61-69.
Wang, C., S. Thangamani, M. Kim, B. H. Gu, J. H. Lee, E. J. Taparowsky and C. H. Kim
(2013). "BATF is required for normal expression of gut-homing receptors by T helper
cells in response to retinoic acid." J Exp Med 210(3): 475-489.
Wang, H., L. Wang, H. Erdjument-Bromage, M. Vidal, P. Tempst, R. S. Jones and Y.
Zhang (2004). "Role of histone H2A ubiquitination in Polycomb silencing." Nature
431(7010): 873-878.

126

Wang, T., V. Nandakumar, X. X. Jiang, L. Jones, A. G. Yang, X. F. Huang and S. Y.
Chen (2013). "The control of hematopoietic stem cell maintenance, self-renewal and
differentiation by Mysm1-mediated epigenetic regulation." Blood.
Weber, B. N., A. W. Chi, A. Chavez, Y. Yashiro-Ohtani, Q. Yang, O. Shestova and A.
Bhandoola (2011). "A critical role for TCF-1 in T-lineage specification and
differentiation." Nature 476(7358): 63-68.
Wolfer, A., A. Wilson, M. Nemir, H. R. MacDonald and F. Radtke (2002). "Inactivation
of Notch1 impairs VDJbeta rearrangement and allows pre-TCR-independent survival of
early alpha beta Lineage Thymocytes." Immunity 16(6): 869-879.
Wurbel, M. A., B. Malissen and J. J. Campbell (2006). "Complex regulation of CCR9 at
multiple discrete stages of T cell development." Eur J Immunol 36(1): 73-81.
Wurbel, M. A., M. Malissen, D. Guy-Grand, B. Malissen and J. J. Campbell (2007).
"Impaired accumulation of antigen-specific CD8 lymphocytes in chemokine CCL25-
deficient intestinal epithelium and lamina propria." J Immunol 178(12): 7598-7606.
Wurbel, M. A., M. Malissen, D. Guy-Grand, E. Meffre, M. C. Nussenzweig, M.
Richelme, A. Carrier and B. Malissen (2001). "Mice lacking the CCR9 CC-chemokine
receptor show a mild impairment of early T- and B-cell development and a reduction in
T-cell receptor gammadelta(+) gut intraepithelial lymphocytes." Blood 98(9): 2626-2632.
Wurbel, M. A., J. M. Philippe, C. Nguyen, G. Victorero, T. Freeman, P. Wooding, A.
Miazek, M. G. Mattei, M. Malissen, B. R. Jordan, B. Malissen, A. Carrier and P. Naquet
(2000). "The chemokine TECK is expressed by thymic and intestinal epithelial cells and
attracts double- and single-positive thymocytes expressing the TECK receptor CCR9."
Eur J Immunol 30(1): 262-271.
Yin, X., E. Ladi, S. W. Chan, O. Li, N. Killeen, D. J. Kappes and E. A. Robey (2007).
"CCR7 expression in developing thymocytes is linked to the CD4 versus CD8 lineage
decision." J Immunol 179(11): 7358-7364.
Yokota, T., T. Kouro, J. Hirose, H. Igarashi, K. P. Garrett, S. C. Gregory, N. Sakaguchi,
J. J. Owen and P. W. Kincade (2003). "Unique properties of fetal lymphoid progenitors
identified according to RAG1 gene expression." Immunity 19(3): 365-375.

127

Yoneyama, M., N. Tochio, T. Umehara, S. Koshiba, M. Inoue, T. Yabuki, M. Aoki, E.
Seki, T. Matsuda, S. Watanabe, Y. Tomo, Y. Nishimura, T. Harada, T. Terada, M.
Shirouzu, Y. Hayashizaki, O. Ohara, A. Tanaka, T. Kigawa and S. Yokoyama (2007).
"Structural and functional differences of SWIRM domain subtypes." J Mol Biol 369(1):
222-238.
Zabel, B. A., W. W. Agace, J. J. Campbell, H. M. Heath, D. Parent, A. I. Roberts, E. C.
Ebert, N. Kassam, S. Qin, M. Zovko, G. J. LaRosa, L. L. Yang, D. Soler, E. C. Butcher,
P. D. Ponath, C. M. Parker and D. P. Andrew (1999). "Human G protein-coupled
receptor GPR-9-6/CC chemokine receptor 9 is selectively expressed on intestinal homing
T lymphocytes, mucosal lymphocytes, and thymocytes and is required for thymus-
expressed chemokine-mediated chemotaxis." J Exp Med 190(9): 1241-1256.
Zachariah, M. A. and J. G. Cyster (2010). "Neural crest-derived pericytes promote egress
of mature thymocytes at the corticomedullary junction." Science 328(5982): 1129-1135.
Zhang, Y. (2003). "Transcriptional regulation by histone ubiquitination and
deubiquitination." Genes Dev 17(22): 2733-2740.
Zhao, Y., G. Lang, S. Ito, J. Bonnet, E. Metzger, S. Sawatsubashi, E. Suzuki, X. Le
Guezennec, H. G. Stunnenberg, A. Krasnov, S. G. Georgieva, R. Schule, K. Takeyama,
S. Kato, L. Tora and D. Devys (2008). "A TFTC/STAGA module mediates histone H2A
and H2B deubiquitination, coactivates nuclear receptors, and counteracts heterochromatin
silencing." Mol Cell 29(1): 92-101.
Zhou, W., P. Zhu, J. Wang, G. Pascual, K. A. Ohgi, J. Lozach, C. K. Glass and M. G.
Rosenfeld (2008). "Histone H2A monoubiquitination represses transcription by inhibiting
RNA polymerase II transcriptional elongation." Mol Cell 29(1): 69-80.
Zhu, P., W. Zhou, J. Wang, J. Puc, K. A. Ohgi, H. Erdjument-Bromage, P. Tempst, C. K.
Glass and M. G. Rosenfeld (2007). "A histone H2A deubiquitinase complex coordinating
histone acetylation and H1 dissociation in transcriptional regulation." Mol Cell 27(4):
609-621.
Zlotnik, A. and O. Yoshie (2000). "Chemokines: a new classification system and their
role in immunity." Immunity 12(2): 121-127.

128

Zlotoff, D. A. and A. Bhandoola (2011). "Hematopoietic progenitor migration to the
adult thymus." Ann N Y Acad Sci 1217: 122-138.
Zlotoff, D. A., A. Sambandam, T. D. Logan, J. J. Bell, B. A. Schwarz and A. Bhandoola
(2010). "CCR7 and CCR9 together recruit hematopoietic progenitors to the adult
thymus." Blood 115(10): 1897-1905.

Abstract (if available)

Abstract Directed cellular migration, also known as homing, is the hallmark of an efficient and effective immune system. Not only is cellular migration a necessary requirement to attain developmental maturity for multiple immunological lineages, it is a fundamental functional mechanism that ensures coordinated and specific immune responses. Dysregulated immunological homing can result in a myriad of consequences including autoimmune disorders or the inability to proper engage and clear pathogenic organisms. To facilitate successful migration, cells are dependent on a series of specific ligand- receptor interactions that are unique for individual anatomical compartments. ❧ Chemotactic cytokines, a particular group of soluble signaling molecules that induce a migratory response by binding to cellular G protein-coupled receptors, are indispensable in cellular migration. The chemokine CCL25 and its receptor, CCR9, are integral for the development of thymocytes as well as inflammatory cell responses in the small intestine and colon. Expression of CCR9 by thymic settling progenitor cells has been shown to be critical for transmigration through the thymic endothelium. Mice that lack CCR9 expression display defects in thymic colonization. Moreover, the ability of mature lymphocytes to migrate to the small intestine is contingent on the expression of CCR9. Recently, the novel histone H2A deubiquitinase MYSM1 has been implicated as a regulator of T cell development and function. Using a MYSM1-deficient mouse model, I report in this dissertation that MYSM1 is required for optimal expression of CCR9 on CD4⁺ T helper cells as well as developing thymocytes. ❧ Examination of CCR9 on CD4⁺ and CD8⁺ T cells in MYSM1 KO mice revealed elevated levels of expression in a number of peripheral lymphoid organs. MYSM1 KO mice exhibited increased accumulation of T lymphocytes in the gut-associated lymphoid tissues and the intestinal lamina propria. In the intestinal context, CCR9 expression is induced through uptake of the vitamin A metabolite, retinoic acid (RA). Stimulation of naïve MYSM1 KO CD4⁺ T cells with RA resulted in elevated levels of CCR9 expression compared to similarly treated WT cells. Moreover, RA-stimulated MYSM1 KO T cells displayed greater chemotactic sensitivity to CCL25 in vitro and homed more efficiently to the small intestine in vivo. I also show that MYSM1 interacts with the Ccr9 locus and implicate MYSM1 in the regulation of several CCR9-related transcription factors. ❧ Next, I investigated MYSM1’s role in CCR9 regulation during thymocyte development. CCR9 expression is necessary for optimal thymic colonization and cellular localization during thymopoiesis. Surprisingly MYSM1-deficient bone marrow-derived progenitors possess diminished levels of CCR9 expression and are inhibited from properly settling the thymus. Expression of CCR9 on MYSM1-deficient thymocytes is decreased as well, resulting in diminished chemotactic sensitivity toward CCL25. MYSM1-deficient thymocytes also exhibit significantly altered levels of proliferation and apoptosis that likely contribute to contracted thymocyte populations observed in MYSM1 KO mice. Collectively, these results suggest that MYSM1 is a novel regulator of CCR9 expression and likely plays a role in the optimal development and function of T lymphocytes.

Linked assets

University of Southern California Dissertations and Theses

Conceptually similar

PDF

The essential role of histone H2A deubiquitinase MYSM1 in natural killer cell maturation and HSC homeostasis

PDF

Mysm1, a histone de-ubiquitinase, is essential for dendritic cell development and function

PDF

Epigenetic control of B cell development by histone deubiquitinase Mysm1/2A-DUB

PDF

The histone methyltransferase SMYD5 plays a role in regulating plasma-cell antibody production and macrophage inflammatory cytokine secretion in vivo

PDF

Epigenetic plasticity of cultured female human embryonic stem cells and regulation of gene expression and chromatin by PR-SET7 mediated H4K20me1

PDF

Novel roles for Maf1 in embryonic stem cell differentiation and adipogenesis

PDF

Understanding and controlling mitotic errors leading to aneuploidy in early ovarian cancer development

PDF

Multiple functions of the PR-Set7 histone methyltransferase: from transcription to the cell cycle

PDF

Kaposi's sarcoma associated herpes-virus induces cellular proxi expression to modulate host gene expression that benefits viral infection and oncogenesis

PDF

Molecular characterization of the HIV-1 Vpu protein and its role in antagonizing the cellular restriction factor BST-2/tetherin both in vitro and in vivo

PDF

The effect of tumor-mediated immune suppression on prostate cancer immunotherapy

PDF

Characterization of a fragment in secreted Hsp90α with potential therapeutic benefits in wound healing and cancer

PDF

Differential role of two coactivators, CCAR1 and CARM1, for dysregulated beta-catenin activity in colorectal cancer cell growth and gene expression

PDF

SUMOylation regulates RNA polymerase III -- dependent transcripton via MAF1

PDF

The role of endoplasmic reticulum chaperones in regulating hematopoietic stem cells and hematological malignancies

PDF

Stable expression of human B7-H4 in a mouse mammary tumor model as a target for cancer immunotherapy

PDF

Generation and characterization of humanized anti-CD19 chimeric antigen receptor T (CAR-T) cells for the treatment of hematologic malignancies

PDF

The role of endoplasmic reticulum protein GRP78 in normal hematopoeises and PTEN-null leukemogenesis

PDF

Effects of chromatin regulators during carcinogenesis

PDF

The role of histone H4 lysine 20 monomethylation in gene expression and differentiation

Asset Metadata

Creator Yates, Peter Christian (author)

Core Title The histone H2A deubiquitinase MYSM1 regulates CCR9 expression on CD4⁺ T cells and thymocytes

School Keck School of Medicine

Degree Doctor of Philosophy

Degree Program Genetic, Molecular and Cellular Biology

Publication Date 11/08/2013

Defense Date 10/17/2013

Publisher University of Southern California (original), University of Southern California. Libraries (digital)

Tag CCR9,deubiquitinase,MYSM1,OAI-PMH Harvest,trafficking

Format application/pdf (imt)

Language English

Contributor Electronically uploaded by the author (provenance)

Advisor Chen, Si-Yi (committee chair), Akbari, Omid (committee member), Rice, Judd C. (committee member), Stallcup, Michael R. (committee member)

Creator Email peterchristianyates@gmail.com,peteryat@usc.edu

Permanent Link (DOI) https://doi.org/10.25549/usctheses-c3-345310

Unique identifier UC11296642

Identifier etd-YatesPeter-2143.pdf (filename),usctheses-c3-345310 (legacy record id)

Legacy Identifier etd-YatesPeter-2143.pdf

Dmrecord 345310

Document Type Dissertation

Format application/pdf (imt)

Rights Yates, Peter Christian

Type texts

Source University of Southern California (contributing entity), University of Southern California Dissertations and Theses (collection)

Access Conditions The author retains rights to his/her dissertation, thesis or other graduate work according to U.S. copyright law. Electronic access is being provided by the USC Libraries in agreement with the a...

Repository Name University of Southern California Digital Library

Repository Location USC Digital Library, University of Southern California, University Park Campus MC 2810, 3434 South Grand Avenue, 2nd Floor, Los Angeles, California 90089-2810, USA