University of Southern California Dissertations and Theses

Preferential translation of Drosophila heat shock protein 70 and heat shock protein 90 mRNAs during heat shock

(USC Thesis Other)

Preferential translation of Drosophila heat shock protein 70 and heat shock protein 90 mRNAs during heat shock

PDF

Download

Open document

Flip pages

Download a page range

Download transcript

Copy asset link

Request this asset

Transcript (if available)

Content PREFERENTIAL TRANSLATION OF DROSOPHILA HEAT SHOCK PROTEIN 70 AND HEAT SHOCK PROTEIN 90 MRNAS DURING HEAT SHOCK by Ruhi Ahmed A Dissertation Presented to the FACULTY OF THE GRADUATE SCHOOL UNIVERSITY OF SOUTHERN CALIFORNIA In Partial Fulfillment of the Requirements for the Degree DOCTOR OF PHILOSOPHY (MOLECULAR PHARMACOLOGY & TOXICOLOGY) August 2003 Copyright 2003 Ruhi Ahmed Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. UMI Number: 3116653 Copyright 2003 by Ahmed, Ruhi All rights reserved. INFORMATION TO USERS The quality of this reproduction is dependent upon the quality of the copy submitted. Broken or indistinct print, colored or poor quality illustrations and photographs, print bleed-through, substandard margins, and improper alignment can adversely affect reproduction. In the unlikely event that the author did not send a complete manuscript and there are missing pages, these will be noted. Also, if unauthorized copyright material had to be removed, a note will indicate the deletion. ® UMI UMI Microform 3116653 Copyright 2004 by ProQuest Information and Learning Company. All rights reserved. This microform edition is protected against unauthorized copying under Title 17, United States Code. ProQuest Information and Learning Company 300 North Zeeb Road P.O. Box 1346 Ann Arbor, Ml 48106-1346 Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. UNIVERSITY OF SOUTHERN CALIFORNIA THE GRADUATE SCHOOL UNIVERSITY PARK LOS ANGELES, CALIFORNIA 90089-1695 This dissertation, written by jZ v H i A h u &D under the direction o f h fiV dissertation committee, and approved by all its members, has been presented to and accepted by the Director o f Graduate and Professional Programs, in partial fulfillment o f the requirements fo r the degree of DOCTOR OF PHILOSOPHY •Director Date Augus t 12, 2 Q Q 3 „ -tation Committee Chair Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. Dedication This Ph.D. thesis is dedicated to my mother for all her love and support. Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. Acknowledgements The development of this dissertation would have been impossible without the following individuals. I am forever indebted to the guidance and teachings of Dr. Roger Duncan, the help and support of Costa, and the love and support of my Dad, Mom and Ednan. I also would like to thank all my friends for all their help and support, especially Sylvia, Anne-Cecile, Hagen, Mark, Hiroe and Karen. 1 1 1 Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. Table of Contents Dedication.............. ii Acknowledgements....................................... iii List of Figures ................ vii-ix Abstract................ x-xi I. Introduction..................................................................................................1 1. Heat-Shock Proteins...................................................................................................... 1 1.1. Transcriptional Regulation of the Heat-Shock Response....................................3 1.1.1. Heat Shock Transcription Factors................................................................. 4 1.1.2. The Heat Shock Element............................. 6 1.1.3. HSF-HSE Interactions......................................... 7 1.1.4. Rapid Response of Heat Shock Genes.......................................................... 8 1.1.5. Heat Shock Induction.............................. 10 1.2. Regulation Of the Heat Shock Response via RNA Processing and ENA Turn over ..............................................................................................................................13 2. Review of Protein Synthesis....................................................................................... 14 2.1. Translation Initiation In Eukaryotes................................................................. 19 3. Translational Regulation of the Heat-Shock Response....................... 21 3.1. Repression of Non-Heat Shock Protein mRNA Translation Activity 22 3.1.1. Recovery of Non-Heat Shock Protein mRNA Translation Activity 24 3.1.2. Mechanisms and Molecular Events Underlying Repression and Recovery of Non-Heat Shock Protein mRNA Translation Activity.................................... 25 3.2. Preferential Translation of Heat-Shock Protein mRNAs.................................. 37 3.2.1. Structural Elements of HSP mRNAs................................................. 39 3.2.2. Mechanisms and Molecular Events Underlying HSP mRNA Translation Activity..................................................................................................................... 41 4. Researching the molecular mechanisms of translational control during heat shock44 II. Materials & Methods .................... 48 1. Western Blot Analysis of HSP70 Transgenes................................ 48 2. Protein Labeling and Quantitation............................................................................. 49 3. RNA Isolation and Quantitation................................................................................. 50 4. Northern Blot Analysis of R N A ........................................... 50 5. RNA Secondary Structure Predictions................................................... 52 6. Protein Two-Dimensional Isoelectric Focusing/SDS-PAGE...................................52 7. Construction of HSP70 Plasmid Expression Vectors............................................... 54 iv Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. 7.1 MT301............................................................................ 54 7.2 MT306....................................................................................................................59 7.3 MT10 Revert........................................................... 60 7.4 MT20 Revert......................................................................................................... 60 7.5 Short70.......................................................................... 61 7.6 MT22 plasmid....................................................................................................... 61 7.7 Scrambled # 81........................... 62 7.8 Scrambled # 82............................................... 63 8. Construction of HSP90 Plasmid Expression Vectors ................64 8.1 MT90...................................................................................................................... 64 8.2 MT86............... 64 8.3 MT87.............................................. 65 8.4 MT88............................................................................... 65 8.5 MT89...................................................................................................................... 66 8.6 M T83........................................................................................ 66 8.7 MT84........................................................................................................... 67 8.8 MT85...................................................................................................................... 67 9. Cell Culture & Transfection Experiments................................................................. 68 10. Trichloroacetic Acid (TCA) Precipitation Assay................................... 69 11. Bradford Assay........................ 69 12. (3-Gal A ssay............................................................................................................... 70 13. Sucrose Density Gradient Analysis.......................................................................... 70 III. The Preferential Translation of HSP70 mRNA ...............................73 1. Identification of the sequence elements in HSP70 mRNA that confer preferential translation...................................................................................................................73 2. Sequence elements located within the first 20 nucleotides of the HSP70 5’UTR can confer preferential translation .............................................................................. 74 3. Truncations in the 5’UTR of Drosophila HSP70 and HSP22 leads to a decrease in heat shock preferential translation.............................................................................. 81 4. The organization of nucleotides (+206 to +242) in the 5’UTR of Drosophila HSP70 is also necessary for heat shock preferential translation..............................83 5. Discussion Of The Hsp70 Results.............................................................................. 88 IV. The Preferential Translation of HSP90 mRNA.................................96 1. Determining whether another translational control mechanism accounts for some instances of heat shock preferential translation, i.e., characterizing other hsp mRNAs 5'UTRs to identify possible exceptions................................................... 96 2. HSP90 mRNA is Translationally Repressed at Normal Temperatures and is De- Repressed during Heat Shock..................................... 96 3. The Translation Efficiency of HSP90 Increases with Increases in Temperature... 99 4. The increase in translation efficiency of HSP90 mRNA occurs because of an in crease in the rate of initiation, as well as elongation................ 103 v Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. 5. The AUG-proximal region of the HSP90 leader sequence is responsible for heat shock preferential translation....................................................................................114 6. Discussion Of The HSP90 Results ................................ 126 Bibliography..................... 134 Appendix............... 152 v i Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. List of Figures 1.1 Scheme of protein synthesis..................................................................................... . 15 1.2 Mechanism of Eukaryotic Translation Initiation .................................................... . 17 2.1 List of Primers used for PCR amplification of Drosophila HSP 5’UTRs 55 2.2 Schematic Representation of the Construction Strategy used in Creating the Parental Plasmid MT301.............................................................................................58 3.1 Construction and analysis of plasmid MT306........................................................... 75 3.2 Schematic representation of the different test 5’UTRs that were constructed to identify sequence elements................................... 77 3.3 The Translation of HSP70 mutant plasmid ACTIO Revert vs. MT306 during Heat Shock......................................... 79 3.4 The Translation of HSP70 mutant plasmid MT20 Revert vs. MT306 during Heat Shock................ 80 3.5 The Translation of HSP70 mutant plasmid Short70 vs. MT306 during Heat Shock ._ 82 3.6 Construction and analysis of Drosophila MT22 - transgene with a truncated HSP22 5’UTR. ____ 84 3.7 Comparing the Translation of Drosophila Short70 vs. Drosophila M T22 85 3.8 The Translation of HSP70 mutant plasmid Scrambled #81 vs. MT306 during Heat Shock ................ 86 3.9 The Translation of HSP70 mutant plasmid Scrambled #82 vs. MT306 during Heat Shock ...... 87 4.1 SDS-PAGE analysis of HSP90 protein in normal and heat shocked cells 97 4.2 2-D (IEF/SDS-PAGE) analysis of HSP90 proteins in normal and heat shocked cells ....... 98 4.3 Northern Blot Analysis of HSP90 and HSP70 RNA levels in Drosophila S2 cells before and after heat shock ...................................................................................100 Vll Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. 4.4 SDS-PAGE analysis of HSP90 protein levels at different temperatures..............101 4.5 SDS-PAGE analysis of HSP90 protein levels at different temperatures in the presence of Actinomycin D .......................................................................................102 4.6 2-D (IEF/SDS-PAGE) analysis of HSP90 protein levels at different temperatures ................. 104 4.7 Northern Blot Analysis of HSP90 and HSP70 RNA levels at different temperatures............................................................................................................... 105 4.8 The Translation Efficiency of HSP90 mRNA at different temperatures in normal and actinomycin D treated cells................................................................................106 4.9 The Translation Efficiency of HSP70 mRNA at different temperatures in normal cells_______ 107 4.10 Sucrose Density Gradient/Northem Blot analysis of HSP90 mRNA at different temperatures.................................................................... 108 4.11 Sucrose Density Gradient/N orthem Blot analysis of HSP70 mRNA at different temperatures..............................................................................................................110 4.12 Sucrose Density Gradient/Northern Blot analysis of HSP90 mRNA in normal, heat shocked and EDTA treated cells...............................................................................I l l 4.13 Sucrose Density Gradient/Northern Blot analysis of HSP90 mRNA in normal, heat shocked and Puromycin treated cells....................................................................... 113 4.14 HSP90 plasmid constructs with cap-proximal and AUG-proximal deletions in their leader sequence.........................................................................................................116 4.15 Construction and analysis of Drosophila MT90 - a transgene with a full length HSP90 5’UTR......................... 117-118 4.16 The Translation of HSP90 mutant plasmid - MT86 vs. MT90 during Heat Shock ......... ........................... ........_ _ _ _ _ _ ....................._ _ _ _ _ ........... 119 4.17 The Translation of HSP90 mutant plasmid - MT87 vs. MT90 during Heat Shock _ _ _ _ _ 120 4.18 The Translation of HSP90 mutant plasmid - MT88 vs. MT90 during Heat Shock 121 vm Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. 4.19 The Translation of HSP90 internal deletion mutant plasmid - MT89 vs. MT90 during Heat Shock................................................................................................... 122 4.20 The Translation of HSP90 mutant plasmid - MT85 vs. MT90 during Heat Shock ..................................................................................................................... 123 4.21 The Translation of HSP90 mutant plasmid - MT84 vs. MT90 during Heat Shock .................................................................................................124 4.22 The Translation of HSP90 mutant plasmid - MT83 vs. MT90 during Heat Shock .....................................................................................................................................125 4.23 Secondary Structure predictions of mRNAs from Drosophila and different Rhizobia 130 i x Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. ABSTRACT Translational control plays a critical role in regulating the expression of key proteins, e.g., proto-oncogenes, transcription factors and neural receptors. Heat shock in Droso phila provides an excellent model system for understanding the molecular mechanisms of translational control because HSP mRNAs are preferentially and efficiently translated when virtually all other mRNAs are excluded. Even though the HSP mRNAs 5’UTR is known to be sufficient for preferential translation, the mechanism of preferential translation remains unresolved. Mutagenesis of a minimal HSP70 5'UTR determined that features in its first 20 nucleotides are necessary but not sufficient for heat shock translation. We demonstrate that a plasmid with a short ened leader sequence of 37 nucleotides translates at room temperatures but not at heat shock and, contrary to published results, a truncated HSP22 5’UTR plasmid does not translate during heat shock. Moreover, the organization of the nucleotide sequence +206 to +235 is important and required for heat shock translatability. To establish whether another translational control mechanism accounts for some in stances of heat shock preferential translation, we selected the HSP90 mRNA. IEF/SDS- PAGE analysis demonstrated that, unlike other HSPs, heat shock increases the synthesis of HSP90, even though its mRNA transcription was blocked. Moreover, HSP90 transla tional efficiency increases proportionally to increases in temperature. Sucrose density gradients established an HSP90 RNA profile at different temperatures, and showed that increases in rates of initiation and elongation were responsible for the increase in transla tional efficiency. We designed an HSP90 transgene to establish that full length HSP90 5’UTR is suffi- x Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. cient to confer preferential translation, and mutagenized it to identify the sequences that confer preferential translation. It was demonstrated that the AUG-proximal nucleotides in the 5’UTR are critical for heat shock preferential translation of HSP90 mRNA. We pro pose that Drosophila HSP90 is translationally regulated in a temperature dependent man ner: Heat shock melts the considerable secondary structure of HSP90 5’UTR and exposes a hitherto cryptic ribosomal recruitment site that allows HSP90 mRNA to recruit ribo somes during heat shock and preferentially translate. Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. I. Introduction 1. Heat-Shock Proteins All animal, plant and bacterial cells are designed to cope with rapid changes in their environment, including exposure to elevated temperatures, heavy metals, toxins, oxi dants, and bacterial and viral infections, via a rapid and often dramatic change in the pat terns of their gene expression, resulting in the elevated synthesis of a family of proteins called heat shock proteins (Lindquist and Craig 1988; Morimoto, Tissieres, et al. 1990). In general, heat shock proteins (HSPs) ensure survival under stressful conditions, which, if left unchecked, would lead to irreversible cell damage and untimely cell death. Heat shock proteins are often referred to as molecular chaperones, i.e., HSPs bind to cellular proteins that are denaturing due to environmental stress and help prevent irre versible denaturation. In addition, they promote refolding of proteins to their native states so that their normal biological functions can be recovered following the stress. In some cases, HSPs even allow organisms to continue their growth and development at slightly less extreme temperatures (Lindquist 1993). There is even a subset of heat shock proteins that are induced at specific stages of development in several organisms, which suggests that HSPs also play a role in normal growth and differentiation (Kurtz, Rossi, et al. 1986). Accordingly, heat shock proteins have an essential role in protein biosynthesis, specifically in the synthesis, transport, and translocation of proteins and in the regulation of protein conformation (Bohen and Yamamoto 1994; Brodsky and Schekman 1994; Craig, Baxter, et al. 1994; Dice, Agarraberes, et al. 1994; Frydman and Hartl 1994; Georgopulos, Lieberek, et al. 1994; Gething, Blond-Elguindi, et al. 1994; Hightower, Sa- 1 Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. dis, et al. 1994; Langer and Neupert 1994; Randall, Topping, et al. 1994; Willison and Kubota 1994). Heat shock proteins have been classified into six major families according to their molecular size: HSP 100, HSP90, HSP70, HSP60, HSP40, and the small heat shock pro teins like HSP27. Within each gene family are members that are constitutively expressed, inducibly regulated, and/or targeted to different compartments. For instance, HSP90 functions in both the cytosolic and nuclear compartments, whereas GRP94 (glucose- regulated protein 94) performs an analogous function in the endoplasmic reticulum. Likewise, members of the HSP70 family exhibit complex patterns of growth regulated and stress-induced gene expression and are targeted to different subcellular compart ments. For instance, Hsc70 (constitutive HSP70) and HSP70 (inducible HSP70) proteins are cytosolic and nuclear, whereas Grp78 is localized to the endoplasmic reticulum and mHSP70 (mitochondrial HSP70) is a mitochondrial localized protein (Jolly and Mori- moto 2000). The magnitude of the effect that even one of the HSPs has on cell survival is remark able. For instance, when cultures of the yeast Saccharomyces cerevisiae are incubated at 37°C to induce thermotolerance and are then exposed to 50°C for 10 minutes, wild type cells survive a 1000-fold better than isogenic cells carrying mutations in the HSP 104 gene (Sanchez and Lindquist 1990). Likewise, when rat fibroblasts are transformed with a gene that produces HSP70 constitutively and are shifted directly from normal growth temperatures to 45°C, survival in the transformants can be as much as a 1000-fold better than the original cell line (Li, Li, et al. 1991). Therefore, it is not surprising that cells have evolved mechanisms to insure that HSPs are produced as rapidly as possible upon 2 Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. exposure to stress. For instance, in Drosophila cells, HSP70 is virtually undetectable at normal temperatures. However, after 1 hour at 37°C, it is estimated that the expression of HSP70 is induced at least 10,000-fold and becomes one of the most abundant proteins present in the cells (Lindquist 1980). Clearly, only the concerted action of several differ ent regulatory mechanisms can drive such a dramatic response. Indeed, as described be low, mechanisms acting at the level of transcription, translation, RNA processing and RNA turnover all come into play. 1.1. Transcriptional Regulation of the Heat-Shock Response In addition to the fact that my research work in this thesis has focused on the mo lecular processes that regulate the synthesis of the HSPs of Drosophila melanogaster, there are several reasons that make the heat shock gene system of Drosophila an appro priate model to discuss the transcriptional activation of heat shock genes in general. First, the major heat shock genes of Drosophila are induced approximately 200-fold by heat shock (Lis, Neckameyer, et al. 1981), while, at the same time, most pre-existing tran scription in these cells is repressed, which, of course, simplifies the detection of RNA and protein products from these genes. Next, the induction of heat shock genes is mediated by proteins that are present in uninduced cells (Zimarino and Wu 1987) - the immediacy of this response has facilitated several kinetic investigations of the mechanism of activation of these genes (O'brien and Lis 1993). Also, there is considerable literature on the pro moter sequences of heat shock genes (Bienz and Pelham 1987), their chromatin structure (Eissenberg, Cartwright, et al. 1985) and their DNA sequence elements and protein fac tors that participate in the regulation of their transcription (Lis and Wu 1993). Finally, the 3 Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. compatibility of the components of heat shock promoters to those of other unrelated genes in Drosophila cells indicates that some of the principles regarding the interaction of transcription factors and heat shock promoters are applicable to transcriptional regula tion in general (Garabedian, Shepherd, et al. 1986; Fischer, Giniger, et al. 1988; Kraus, Lee, et al. 1988; Martin, Giangrande, et al. 1989). 1.1.1. Heat Shock Transcription Factors A heat shock transcription factor (HSF) was first identified in heat shocked Droso phila melanogaster nuclear extracts as a protein component that could specifically bind to a regulatory site of the HSP70 gene (Parker and Topol 1984; Wu 1984)] and as a purified fraction that could promote transcription in an in vitro cell free system (Parker and Topol 1984). HSFs were subsequently purified from yeast (Sorger and Pelham 1987), Droso phila (Wu, Wilson, et al. 1987), and cultured human cells (Goldenberg, Luo, et al. 1988). At present, the genes encoding HSFs from these and other species (e.g., chicken and to mato) have also been cloned and characterized: HSF is encoded by a single copy gene in the yeasts Saccharomyces cerevisiae, Kluyveromyces lactis, and Schizosaccharomyces pombe; a single copy gene has also been isolated in Drosophila-, other higher eukaryotes possess multiple HSFs (three in the mouse, human, chicken and tomato genomes - an ad ditional factor, HSF4, has been identified in human cells) (Sorger and Pelham 1988; Wiederrecht, Seto, et al. 1988; Clos, Westwood, et al. 1990; Scharf, Rose, et al. 1990; Jakobsen and Pelham 1991; Rabindran, Giorgi, et al. 1991; Sarge, Zimarino, et al. 1991; Schuetz, Gallo, et al. 1991; Gallo, Prentice, et al. 1993; Nakai and Morimoto 1993; Na- kai, Tanabe, et al. 1997). 4 Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. Interspecies comparisons indicate that 85-95% of the amino acid sequences are con served amongst vertebrate HSF1, whereas, within a single species, the HSFs have an overall sequence identity of 40%. HSFs from different organisms share a number of structural features, such as, a conserved DMA-binding domain (approximately 100 amino acids), which exhibits a winged helix-turn-helix motif, located near the amino terminus (Harrison, Bohm, et al. 1994). Adjacent to this DNA-binding domain is a second con served region, that is approximately an 80 residue hydrophobic repeat containing three leucine zippers responsible for the trimerization of the factor (Peteranderl and Nelson 1992). In Drosophila and in larger eukaryotes with the exception of human HSF4, the carboxy terminus contains an additional leucine zipper which has been suggested to have a role in the negative regulation of HSF activity, suppressing trimer formation (Nakai and Morimoto 1993; Rabindran, Haroun, et al. 1993). In addition, transcriptional activation domains have been mapped to regions near the carboxy terminus of HSFs (Green, Schu- etz, et al. 1995). Other features unique to certain HSFs (Saccharomyces cerevisiae HSF, spliced variants of mouse and human HSF2, HSF4) are the presence of amino-terminal transactivation domains that have variable transactivation properties. In mammalian cells, HSFs are coexpressed, negatively regulated, and activated upon specific environmental and physiological events (Morimoto, Kroeger, et al. 1996; Voellmy 1996). HSF 1 and HSF3 function as stress responsive activators and both are required for maximal heat shock responsiveness (Tanabe, Kawazoe, et al. 1998), whereas, HSF2 is activated during embryonic development and differentiation (Schuetz, Gallo, et al. 1991; Sistonen, Sarge, et al. 1992). HSF4 was discovered in human cells and appears to be preferentially expressed in the human heart, brain, skeletal muscle and pan- 5 Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. creas (Nakai, Tanabe, et al. 1997). Differently from other HSFs, HSF4 constitutively binds to DNA but lacks the properties of a transcriptional activator, and it has been sug gested to be a negative regulator of the heat shock response (Nakai, Tanabe, et al. 1997). This diversity of HSFs not only provides a redundancy and specialization of stress sig nals, and a means to differentially control the rate of transcription of heat-shock genes but also provides a chance of novel interactions with other regulatory factors thus expanding the link between cell stress and other genetic networks. The heat inducible binding of HSF is probably the major regulatory step in transcriptional regulation upon heat shock. 1.1.2. The Heat Shock Element The binding of activated HSF to cis-acting, upstream DNA sequence elements com monly termed heat shock elements (HSEs), specifies the transcriptional activation of heat-shock genes. However, it is worth noting that HSEs mediate the response not only to heat shock, but also to some other forms of stress such as exposure to heavy metal ions or amino acid analogs. The HSE element was first identified as a sequence required for heat inducibility of the Drosophila HSP70 gene (Mirault, Southgate, et al. 1982; Pelham 1982). Further analyses led to the definition of an HSE as a repeating array of the 5-bp sequence 5’-nGAAn-3’ (->), where each repeat is inverted relative to the immediately adjacent repeat (Amin, Ananthan, et al. 1988; Perisic, Xiao, et al. 1989). All heat shock promoters, from different genes and diverse organisms, have the same 5-bp building block. The number of these 5-bp building units in a functional HSE can vary but usually ranges from three to six. However, the number of HSEs associated with different heat shock genes can vary, as can the distance between these HSEs. For example, the pro- 6 Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. moter region of the Drosophila HSP70 gene has four HSEs numbered I, II, III, and IV, each containing three or four 5-bp units, while the HSP83 gene, on the other hand, has a single HSE containing eight 5-bp units. In addition, the location of the HSEs within the promoter is another variable and may range from about 40 bases upstream of the tran scriptional start site of the HSP70 gene to as far as 270 bases in the HSP27 gene (Amin, Ananthan, etal. 1988). 1.1.3. HSF-HSE Interactions The native HSF trimer displays a remarkable flexibility in its ability to interact with the HSEs containing different numbers and arrangements of 5 bp units. The smallest ar ray that shows detectable binding of DmHSF in vitro contains two 5 bp units in either a head-to-head (nGAAnnTTCn; -><€-) or tail-to-tail (<~>) configuration. Interestingly, HSF binds to both these sequences with similar affinity. High resolution footprinting as says have shown that bound HSF covers and is centered similarily on both of these se quences. DNase I footprinting assays have shown that as the length of an HSE containing two 5 bp units is increased in 5 bp installments, there is a propiortional ~5 bp increase in the footprint produced by HSF. Taken together these results suggest that the 5 bp unit is a site of interaction with each DNA binding domain of HSF and that detectable binding is provided by two adjacent binding sites in opposite orientation (Perisic, Xiao, et al. 1989). Thus, a complete, minimal binding site for trimeric HSF is provided by three 5 bp units, i.e., —y or The binding affinity of HSF has been shown to increase as the number of 5 bp units within an HSE increases, and HSF binds cooperatively to 5 bp units (Topol, Ruden, et al. 7 Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. 1985; Xiao, Perisic, et al. 1991). This cooperativity leads to particularly tight binding when the number of 5 bp units in an array of six and more. Such HSF-HSE complexes dissociate with a half life of greater than 48 hours (Xiao, Perisic, et al. 1991). Coopera tive binding of HSF is even more pronounced at full heat shock temperatures, suggesting that longer arrays of 5 bp units have a particularity striking advantage in sequestering HSF at these temperatures. Since different members of the heat shock gene family have varying numbers of 5 bp units, the resulting range in affinities for HSF may account in part for their differential response to heat shock (Lindquist 1980). Although, the binding affinities might differ, the HSF-HSE interaction appears to be strikingly similar in all or ganisms. This finding is supported by in vitro interference and footprinting experiments and in vivo transfection and footprinting experiments that reveal a similar modular recog nition of the 5 bp unit by HSFs from different species and a remarkable consistency in the topography of protein-DNA contacts within the motif (Kingston, Schuetz, et al. 1987; Morgan, Williams, et al. 1987; Wiederrecht, Shuey, et al. 1987; Mosser, Theodorakis, et al. 1988; Perisic, Xiao, et al. 1989; Williams and Morimoto 1990; Abravaya, Phillips, et al. 1991; Cunniff, Wagner, et al. 1991; Gallo, Schuetz, et al. 1991; Sarge, Zimarino, et al. 1991). 1.1.4. Rapid Response of Heat Shock Genes The promoters of Drosophila heat shock genes are primed for a rapid response to the heat shock stimulus. The chromatin structures of the uninduced promoters are in open configuration as evidenced by their nuclease hypersensitivity (Wu 1980; Costlow and Lis 1984). At least two different transcription factors are bound to the uninduced promoters, 8 Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. GAGA factor and TBP (Wu 1984; Thomas and Elgin 1988; Giardina, Perezriba, et al. 1992). GAGA factor is a transcription factor that has been shown to bind to alternating GA-CT sequences upstream of many Drosophila genes (Biggin and Tjian 1988; Soeller, Poole, et al. 1988; Thomas and Elgin 1988; Gilmour, Thomas, et al. 1989). TBP is the DNA sequence specific binding component of TF1ID, the general transcription factor complex that binds to the TATA region approximately 30 bp upstream of the site of tran script initiation in many RNA polymerase II promoters (Hoey, Dynlacht, et al. 1990). RNA polymerase II is also associated with the uninduced heat shock promoter. In vivo UV cross-linking has demonstrated that the uninduced HSP70 promoter has ap proximately one RNA polymerase II complex located in the region between nucleotides - 12 and +65 relative to the transcriptional start site (+1) (Gilmour and Lis 1986). Nuclear run on assays showed that this polymerase is transcriptionally engaged but paused after synthesizing 25 nucleotides (Rougvie and Lis 1988). This paused polymerase was de fined at higher resolution to be between +17 and +37 by using the DNA modifying rea gent KMn04 to map the transcription bubble (Giardina, Perezriba, et al. 1992). A similar interval was derived by determining the length of the short RNAs associated with the paused polymerase (Rasmussen and Lis 1993). Within this interval are two preferred po sitions, separated by approximately one turn of the DNA helix. The distribution of the paused polymerase on the uninduced HSP26 and HSP27 genes is similar to that found on the HSP70 gene but begins about 10 bp farther into the gene (Giardina, Perezriba, et al. 1992; Rasmussen and Lis 1993). A region upstream of the HSP70 TATA box, which includes GAGA sequences and the HSEs, can program the formation of a paused polymerase on a non heat shock gene 9 Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. promoter that normally displays no detectable pausing (Lee, Kraus, et al. 1992). Al though mutations in the GAGA element reduce the level of paused polymerase several fold, mutations in the HSE have little effect on generating the pause. In addition, se quences around the start site can also have a role in generating paused RNA polymerase. Alterations to the hybrid HSP70 promoter that reduce pausing also reduce the heat in- ducibility of the promoter, indicating that the formation of a paused polymerase is an im portant intermediate in the pathway to full transcriptional activation (Lee, Kraus, et al. 1992). Mutations in upstream GAGA repeats also affect the nuclease hypersensitivity of the promoter region as seen in the transgenic Drosophila fly lines that contain variants of the HSP26 gene promoter (Lu, Wallrath, et al. 1992; Lu, Wallrath, et al. 1993). In contrast, mutations in the HSEs have little consequence on the nuclease hypersensitivity of heat shock promoters (Lu, Wallrath, et al. 1993). The binding of GAGA factors to the GAGA element appears to be critical for the interruption of normal nucleosome packaging of at least some heat shock promoters, and it may act by directly displacing nucleosomes from the heat shock promoter. Since TBP is unable to bind to a TATA sequence covered by a nucleosome in vitro (Workman and Buchman 1993), the action of a GAGA factor may be a necessary first step in opening the promoter. This “open” promoter may in turn allow entry and pausing of RNA polymerase II. 1.1.5. Heat Shock Induction The presence of a paused polymerase at the 5’ end of uninduced heat shock genes suggests that these genes can rapidly respond to heat shock. Kinetic analysis of the distri- 10 Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. bution of polymerase following heat shock as measured by nuclear run on assays and in vivo UV cross linking assays reveal a rapid induction of transcription (O'Brien and Lis 1993). The paused polymerase elongates from the HSP70 promoter within 30-60 sec onds, and the first wave of polymerase reaches the 3’ end of the gene within 120 seconds (giving an elongation rate of ~1.2 kb/min). A similar rapid induction of transcription is seen for the small heat shock genes (HSP22, HSP23, HSP26 and HSP27). Consistent with this rapid induction, HSF, the transcriptional activator of heat shock genes, acquires the ability to bind to HSEs within 30 seconds after heat shock (Zimarino and Wu 1987). The rapid binding of HSF to its target HSEs is the major change that accompanies heat shock. This binding is likely to be facilitated by a nucleosome-free promoter, as HSF (at least human HSF) is unable to bind to HSEs packaged in nucleosomes (Taylor, Workman, et al. 1991). Although heat shock changes the architecture of a heat shock promoter, many features of the uninduced promoter persist. Both the GAGA and the TATA elements remain occupied after heat shock induction. Although the transcription bubble associated with the paused polymerase also persists after full heat shock (Giardina, Perezriba, et al. 1992), additional melting of DNA in the region of the start site is detected, presumably due to entry oif the next polymerase. Pausing of polymerase con tinues to occur even after the HSP70 gene becomes trancriptionally active as assayed by nuclear run ons and by measuring the short RNAs produced by the paused polymerase (O' Brien and Lis 1991; Giardina, Perezriba, et al. 1992; Rasmussen and Lis 1993). Therefore, elongation of polymerase from the pause remains the rate limiting step in tran scription even in induced cells. Entry of new polymerases to this open promoter is faster 11 Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. than the rate at which paused polymerases escape into a productive elongation mode, i.e., once per 6 seconds. Heat shock causes two major changes in HSF. First, because of heat stress there is an appearance of non-native proteins and release of HSF interacting chaperones, therefore HSF DNA-binding activity is de-repressed and the HSF monomers multimerize to form trimers (Westwood, Clos, et al. 1991). Second, HSFs undergo a posttranslational modifi cation, i.e., they are phosphorylated at multiple serine residues (Sorger 1990) , and can now bind to HSEs resulting in stress induced transcription (Morimoto, Kroeger, et al. 1996; Voellmy 1996). Activated HSF may interact directly with the paused polymerase to stimulate elongation. This type of modification is postulated for the action of the bacte riophage X Q protein on the paused polymerase at the 5’end of the late operon (Roberts 1988). Alternatively, HSF may act by increasing the rate if initiation of transcription of additional polymerases. The entry of a new polymerase may be essential to obtain release of paused polymerase, resulting in the coupling of initiation and elongation. HSF may also increase the rate of elongation by severing interactions between the paused polym erase and the basal transcription factors. It may do this by directly or indirectly stimulat ing phosphorylation of the paused polymerase. Upon heat shock, elongating polymerases are partially phosphorylated, and this phosphorylation may have a role in stimulating a paused polymerase to resume elongation. There is also a possibility that HSF may facili tate polymerase elongation by removing or altering nucleosomes or by antagonizing HI, which can act as a repressor of transcription (Croston, Kerrigan, et al. 1991; Layboum and Kadonaga 1991). All the above factors combine to give heat shock genes a rapid in duction when the cells are challenged. 12 Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. 1.2. Regulation Of the Heat Shock Response via RNA Processing and RNA Turn over Another regulation of HSPs occurs at the step of mRNA splicing. During heat shock, the splicing mechanism is impaired and, thus, transcripts that have introns cannot be processed. However, since all primary transcripts of heat shock genes (except HSP90) lack intervening sequences, they do not require splicing and are rapidly transported from the nucleus to the cytosol, where they are efficiently translated (Yost and Lindquist 1986; Yost, Petersen, et al. 1990). Changes in the stability of HSP mRNAs are also important in regulating the expres sion of HSPs. In Drosophila cells, it was observed that, at 25°C, the half life of HSP70 mRNA was less than 15 minutes. However, when the cells were shifted to 36.5°C, HSP70 mRNA half life was greater than 6 hours. That is, the mechanism for degrading HSP70 mRNAs in Drosophila cells at normal temperatures was disrupted by heat shock (Petersen and Lindquist 1988; Petersen and Lindquist 1989). Studies have demonstrated that it is Poly(A) tail shortening that appears to play a key role in regulating HSP mRNA expression. Specifically, in Drosophila melanogaster, deadenylation of HSP70 mRNA is rapidly followed by degradation. Heat shock stabilizes the HSP messages because it dis rupts the mechanism of mRNA deadenylation, which in turn leads to their degradation. It was also established that in cells maintained at high temperatures, the two processes of deadenylation and degradation could be uncoupled and HSP70 RNAs could be deadeny- lated without being degraded. Moreover, these deadenylated mRNAs were translated with low efficiency. Therefore, deadenylation allows HSP70 synthesis to be repressed even when degradation of the mRNA is blocked (Dellavalle, Petersen, et al. 1994). A 13 Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. similar degradation mechanism appears to operate in mammals and yeast (Lindquist 1993). Hence, it is the inactivation of the mechanism of deadenylation, combined with the burst of new transcription, that allows HSP mRNAs to accumulate so rapidly and to such high levels at high temperatures. 2. Review of Protein Synthesis The synthesis of proteins in both eukaryotic and prokaryotic cells involves two major steps. The first step is the transcription of DNA information to mRNA and the second step is the translation of this mRNA into protein. The translation of mRNA into proteins has three stages, namely initiation, elongation and termination. All three stages are cata lyzed by the interaction of numerous macromolecules, such as initiation, elongation and termination factors, ribosomes, tRNAs, t-RNA synthetases and mRNAs (Hershey 1991; Kozak 1992; Rhoads 1993; Mathews, Hershey, et al. 2000). A schematic of these inter actions is shown in Figure 1.1. Initiation involves a number of steps, catalyzed by proteins called initiation factors (IFs). Because the process is complex, many details are still being elucidated. The major differences between prokaryotic and eukaryotic translation occur during initiation. The initiator tRNA in prokaryotes is a formyl-Met tRNA, while in eukaryotes it is simply a Met-tRNA. Eukaryotic initiation requires at least ten initiation factors (eIF-2, eIF-2B, eIF-3, eIF-4A, eIF-4B, eIF-4C, eIF-4D, eIF-4E, eIF4F, eIF-5 and eIF-6), in contrast to prokaryotic initiation, which requires only three factors (IF-1, IF-2, IF-3). Prokaryotic mRNAs are polycistronic and contain the Shine-Dalgarno sequence (a region compli mentary to the 3' end of the 16S rRNA) that facilitates binding to the 30S ribosome. In 14 Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. Figure 1.1: Scheme of protein synthesis PO LY SO M ES mRNA tR N A (IP) E F -2 , GDP, Pi tRNA PROTEINS E F -2 .G T P (f)M et-tR N A , IF 's .G T P m R N A ,(A T P) EF-I, GDP, Pi IF‘$, GDP, Pi (A D P + P i) (IF) A -tR N A , E F -I.G T P Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. contrast, eukaryotic mRNAs are generally monocistronic, contain a 5' 7-methyl guanosine (m7G) cap structure and have a 3' polyadenylated tail. A recognizable Shine- Dalgarno sequence is not present in eukaryotic mRNAs. The binding of mRNA to the 40S ribosome in eukaryotes is facilitated by initiation factors eIF-4A, eIF-4B and eIF4F. These factors presumably unwind the RNA 5' to 3' in an ATP dependent manner. ATP is not a requirement for prokaryotic translation and functional equivalents of eIF-4A, elF- 4B and eIF4F are absent in prokaryotes. Translation initiation in eukaryotes results in the formation of an 80S initiation com plex, which consists of a ribosome bound to mRNA and to a charged initiator tRNA. First, the mRNA and the initiator tRNA are bound to a free 40S ribosomal subunit and then the larger 60S subunit attaches to form the functional ribosome. Binding of mRNA and tRNA also requires binding of several initiation factors (eIF-3, eIF-4C, eIF-2, elF- 4A, eIF-4B and eIF4F), as can be seen from Figure 1.2. The exact order of binding of these factors is still unknown but it is thought that eIF-3 and eIF-4C bind to the 40S ribo somal subunit. Then, eIF-2, GTP, Met-tRNA ternary complex bind to form the 43 S pre initiation complex. With the help of eIF-4A, eIF-4B and eIF4F, an mRNA molecule binds to form the 48S complex. Once this occurs, some of the initiation factors that were previously bound to the small subunit are thought to disassociate in order to make way for the binding of the large subunit to form the 80S ribosomal complex. Because the ini tiator tRNA is already bound to the P-site of the ribosome, the synthesis of a protein chain can begin directly with the binding of a second aminoacyl tRNA to the A-site of the ribosome (Pain 1996). 16 Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. Figure 1.2: Mechanism of Eukaryotic Translation Initiation 40S subunit eIF-3 Met-tRNAft-GTP — eIF-2 eIF-3*40S eIF-4C - Met-tRNA,*eIF-2"GTP t eIF-3*40S*Met-tRNAi*eIF-2*GTP mRNA ATP - eIF-4F/eIF-(iso)4F -elF-4A — eIF-4B ADP+Pi [elF-4F*eIF-4A*eIF-4B*mRNA] —► eIF-4B eIF-3*40S*mRNA, Met-tRNAi*eIF-2*GTP eIF-4F/eIF-(iso)4F eIF-4A eIF-5 -------- eIF-4C ------ 60S subunit 80S»mRNA*Met-tRNAi eIF-5 A -------------- ELONGATION Met-tRNA, eIF-2*GTP eIF-2B*eIF-2*GTP eIF-2B < - GTP eIF-2B*eIF-2 ► GDP eIF-2B*eIF-2”GDP -► eIF-2*GDP----------------- — ► Pj+elF-3+eIF-4C+eIF-5 Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. The next step in translation is elongation. Elongation of the peptide chain is a cyclic process that adds one amino acid residue to the C-terminal end of a growing polypeptide chain and is similar in both eukaryotes and prokaryotes. High fidelity and processivity are the key features of the process. This process is catalyzed by three elongation factors, namely eEF-lA, eEF-lB and eEF-2 in eukaryotes (homologous to the prokaryotic EF-Tu, EF-Ts and EF-G respectively). Eukaryotic eEF-lA (EF-Tu in prokaryotes) forms a ter nary complex with GTP and aminoacyl-tRNA, prior to the binding of the tRNA to the ribosomal A site. The bound GTP is hydrolyzed by eEF-lA following ribosome binding and an eEF-lA*GDP binary complex is released along with P;. The eEF-lA*GDP is then regenerated to eEF-lA»GTP by eEF-lB (prokaryotic EF-Ts). The growing peptide chain in the P-site is transferred to the amino group of the aminoacyl-tRNA in the A-site and a new peptide bond is formed. The eEF-2*GTP (eEF-G in prokaryotes) complex catalyzes the GTP dependent translocation of the ribosome by one codon on the mRNA. The empty tRNA is then released from the P-site, the peptidyl tRNA is shifted to the P-site and a new codon is positioned on the A-site. Another eEF-lA ternary complex can then associ ate with the ribosomal A-site and the cycle continues until a termination codon is recog nized. Termination of translation is the final step. The signal for termination is the translo cation of one of the stop codons (UAA, UGA or UAG) into the ribosomal A-site. Since no tRNAs recognize these codons, release factors then catalyze the release of the peptide chain from the ribosome and translation is terminated. How the release factors work is still not clear. 18 Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. 2.1. Translation Initiation In Eukaryotes Eukaryotic initiation occurs in three stages: (i) formation of the 43S initiation com plex; (ii) formation of the 48S initiation complex; and (iii) formation of the 80S initiation complex. These various stages are illustrated in Figure 1.2. This outline of the initiation process is based on in vitro studies done by several laboratories, which have isolated and characterized initiation factors from many kinds of eukaryotic cells (Pain 1986; Sonen- berg 1988; Hershey 1991; Merrick 1992; Rhoads 1993; Hershey and Merrick 2000). (T ) Formation of the 43S initiation complex: The ribosomes are dissociated into free 40S and 60S subunits, and are prevented from reassociating by the action of eIF-3 and eIF-6. The factor eIF-4C stabilizes the 40S»eIF-3 complex, which associates with a ter nary complex of eIF-2, GTP and Met-tRNA to form the 43 S initiation complex. The ter nary complex can then bind to the 40S ribosomal subunit, and is enhanced by the binding of eIF-3 and mRNA to the ribosome. Initiation of translation can be regulated at this step by phosphorylation of eIF-2. This phosphorylation of the a subunit of eIF-2 makes it un able to interact with the recycling factor (eIF-2B) and exchange GDP for GTP. Iii) Formation of the 48S initiation complex: This step involves the binding of mRNA to the 43S initiation complex and requires several initiation factors, eIF-4A, eIF-4B, eIF4F, and ATP. It is thought that eIF4F is the first factor to associate with the mRNA because it contains a a protein that interacts with the m7 GpppG cap structure at the 5’ end. This binding of eIF4F to the m7 G cap of the mRNA is not ATP dependent. The or der of binding of eIF-4A and eIF-4B is not yet conclusively known. Once these factors are assembled on the mRNA, they are thought to catalyze an ATP dependent unwinding of the mRNA, so that the 40S ribosome can be seated onto the correct initiation codon. In 19 Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. mammalian systems all three factors (i.e., eIF-4A, eIF-4B and eIF4F) are required for ATP hydrolysis, whereas in plants, only eIF-4A and eIF4F are required for ATP hydroly sis, while eIF-4B merely stimulates this activity. All this occurs in vitro in the absence of 40S ribosomal subunit and the exact process of binding of 40S ribosomal subunit to mRNA is unclear. In the scanning model pro posed by Kozak (Kozak 1978), the 40S subunit binds near the 5' end of the mRNA. Then, in an ATP dependent manner, the 40S ribosome moves along until it reaches an initiation codon in the proper context, 5' (G/A)NNAUG(G/A) 3' for vertebrate mRNA (26), 5' (A/Y)A(A/U)AAUGUGU 3’ for yeast mRNA (28), and 5' ANNAUGGCU 3’ for plant mRNA (32) (where N = purines and Y - pyrimidines). Scanning stops when the ribo some encounters the correct initiation codon, presumably due to the recognition by the anticodon of the Met-tRNA and associated initiation factors with the ribosome. This step ends the formation of the 48S initiation complex. (in) Formation of the 80S initiation complex: This step involves the eIF-5 catalyzed hydrolysis of the GTP associated with eIF-2. This hydrolysis causes the release of elF- 2®GDP, eIF-3 and other factors from the ribosome. The 60S subunit now binds to the 40S subunit forming the 80S ribosomal complex. The 80S ribosomal complex is now ready to carry out polypeptide elongation. It is important to note that the method of translation initiation described in the pre ceding paragraphs is the canonical ribosome scanning cap-dependent translation initiation pathway used by the majority of cellular capped mRNAs. Viruses, uncapped mRNA and even some capped mRNAs, can use other modes of initiation codon selection such as, leaky scanning, termination-reinitiation, ribosome shunting, and cap independent internal 20 Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. initiation (Mathews, Hershey, et al. 2000). Leaky scanning occurs when a portion of the 43 S pre-initiation complexes continue to scan past the first cap-proximal AUG and initi ate at a downstream AUG, and this is caused by inefficient recognition of the first initia tor codon. In termination-reinitiation, a second initiation event occurs following the translation of an upstream open reading frame (uORF). It is postulated that after transla tion of a short uORF is complete, the 60S subunit dissociates from the mRNA while the 40S ribosomal subunit continues scanning. The ribosome shunting mechanism is where ribosomes are loaded onto mRNA by a cap-dependent process, but then bypass large segments of the 5’UTR to resume scanning before initiating translation at a downstream AUG. The principal alternative to cap-dependent translation is cap-independent internal initiation, in which ribosomes are directed to internal AUGs by a specific sequence in the mRNA called an internal ribosomal entry Site (IRES). 3. Translational Regulation of the Heat-Shock Response The two major mechanisms by which cells control the heat shock response are tran scriptional regulation (described earlier) and translational regulation. Translational regu lation is an important factor in the heat shock responses of organisms as diverse as Tetra- hymena, flies, mammals, and soybeans (Lindquist 1993; Duncan 1996; Schneider 2000). There are two principal events comprising translational control during heat shock: (i) The general repression of the translation of non-heat shock protein messenger RNAs, which may be either transient or prolonged, and likely restricts the production of missense, in complete, or malfolded proteins that might subsequently have deleterious effects on cell growth; (ii) The preferential translation of heat shock protein (HSP) mRNAs, which pro- 21 Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. vides a mechanism for the rapid, massive accumulation of these beneficial proteins under adverse circumstances. The magnitude of general repression or preferential translation differs substantially between cell types, species, and specific circumstances of heat shock. Detailed descriptions of these two events and their molecular bases are considered in the following sections. 3.1. Repression of Non-Heat Shock Protein mRNA Translation Activity During heat shock, a major translational event affecting non-heat shock protein mRNAs is their repression, which is observed in virtually all organisms. However, re pression occurs at different rates in different organisms. For instance, in Drosophila cells which normally grow at 22-25°C, protein synthesis inhibition becomes detectable at around 32-3 3°C (~10°C above their normal growth temperature), reaches approximately 50% inhibition at 34°C, and exceeds 90% inhibition at 37°C. In mammalian cells, protein synthesis is more than 80% inhibited at 41°C, which is only 4°C above their normal growth temperature, and heat shocks at 45°C are commonly employed. Though there is no significant increase in overall protein synthesis as temperature is raised from 41°C, alterations that occur in translation regulating molecules do appear. For most cell types repression is not due to the normal mRNAs being degraded or substantially modified (ex cept yeast (Lindquist 1981), in which heat induced mRNA degradation is observed and accounts at least in part for the decreased normal mRNA translation). The absence of mRNA degradation has been demonstrated by in vitro translation assays of mRNAs ex tracted from heat-shocked cells, which reveal no loss of activity (Kruger and Benecke 1981; Lindquist 1981; Petersen and Mitchell 1981). Moreover, when new RNA synthesis 22 Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. is prevented by treatment with inhibitors preceding return to normal temperature, full translation recovery can occur using the pre-existing mRNAs (DiDomenico, Bugaisky, et al. 1982a; Duncan and Hershey 1989). So, what does cause the onset of translational re pression? An intracellular event that causes heat shock translational repression is the accumula tion of improperly folded proteins. The hypothesis is that, as heat shock increases, the amount of denatured proteins increase and this causes chaperones to redistribute to these preferred substrates. The dissociation of chaperones from regulatory proteins, such as HCR (an eIF2a kinase), results in a change in the activity of the protein (e.g., HCR is ac tivated and it phosphorylates eIF2a) and thereby inhibits protein synthesis. Evidence for this hypothesis comes from several studies. For instance, denatured proteins cause trans lational repression upon addition to rabbit reticulocyte lysates. This repression is due to the titration of HSP70 off the heme regulated eIF2a kinase, resulting in its activation (Matts, Hurst, et al. 1993). In addition, cell lines overexpressing HSP70 recover transla tion following heat shock more rapidly because they dephosphorylate eIF2 more rapidly and this helps restore protein synthesis (Chang, Liu, et al. 1994). Another intracellular event that contributes to heat shock translational repression is the activation of calcium-dependent pathways. Studies have shown that agents that in crease intracellular free calcium can cause greater heat-shock induced translational re pression (Burdon 1987), while calcium chelators can reduce repression. This clearly sug gests that calcium-dependent signaling pathways may be involved during heat shock. One possibility is that Ca(2+) alters the structural stability of HSPs, resulting in their impaired chaperone function and a lower protective ability towards other proteins. Specifically, 23 Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. measurements indicate that Ca(2+) decreases both secondary and tertiary-quaternary structure stability of alpha-crystallin (a small HSP), which leads to a partial unfolding of the protein and a clear decrease in its chaperone activity (Del Valle, Escribano, et al. 2002). Another mechanism by which calcium induces greater heat shock induced transla tional repression, is by delaying the induction of the HSPs. This has been shown by ele vating intracellular calcium ion levels by exposure to the ionophore A23187 or thapsigar- gin, which inhibits the conversion of HSF-1 from a latent cytoplasmic form to its active nuclear/DNA binding form and thereby delaying the transcriptional activation of HSPs (Soncin, Asea, et al. 2000). 3.1.1. Recovery of Non-Heat Shock Protein mRNA Translation Activity As described earlier, heat shock causes the repression of non-heat shock protein mRNA translation. Another major translational event affecting non-heat shock protein mRNAs is recovery. Whereas repression of non-heat shock mRNAs occurs within min utes, recovery requires several hours. For instance, resumption of translation in Droso phila can be first detected after ~1 hour, following a moderate (33-34°C) to severe heat shock (36-37°C) and increases progressively over the next 4-6 hours, until full activity is restored - mammalian cells also respond with similar kinetics of restoration. Recovery in Drosophila cells is delayed if a more severe heat shock (>39°C) is administered (DiDomenico, Bugaisky, et al. 1982a; Lindquist 1993). Prolonged recovery intervals suggest that synthesis of new proteins may be required to help restore global protein synthesis. Studies have indicated that in Drosophila, it is the synthesis and accumulation of the HSP70 protein to certain threshold levels that regulates 24 Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. synchronous recovery of normal non-heat shock cellular mRNAs (DiDomenico, Bugaisky, et al. 1982; DiDomenico, Bugaisky, et al. 1982a). Moreover, it has also been shown that reducing the synthesis, or the levels of functional HSP70, delays recovery un til a threshold level of active HSP70 is reached (Solomon, Rossi, et al. 1991), while, overexpressing HSP70 accelerates recovery (Liu, Li, et al. 1992; Li and Duncan 1995). Similar results were also obtained in mammalian studies (Mizzen and Welch 1988), which suggests that HSP70-based translation reactivation is an ancient conserved strat egy. There are various mechanisms by which HSP70 can help restore translational recov ery, and these include: (i) HSP70 is a chaperone protein and it is likely that its chaperone like activities in protein disaggregation and refolding help regulate restoration (Gething and Sambrook 1992); (ii) HSP70 has been shown to colocalize with ribosomes during recovery, which suggests a direct role in ribosome reactivation (Welch and Suhan 1986; Beck and Demaio 1994); (iii) HSP70 is postulated to accelerate the reactivation of heat shock inhibited protein synthesis initiation factors (Liu, Li, et al. 1992; Li and Duncan 1995). 3.1.2. Mechanisms and Molecular Events Underlying Repression and Recovery of Non- Heat Shock Protein mRNA Translation Activity Unquestionably heat shock severely inhibits protein synthesis of non heat shock mRNAs. Sucrose density gradient analyses has demonstrated that this inhibition occurs at the phase of translation initiation, because heat shocked cells show a disaggregation of polyribosomes into inactive monosomes and ribosomal subunits (Duncan and Hershey 1984). Inhibition at the step of initiation could involve a number of translation initiation 25 Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. factors and proteins, such as, eIF2, eIF2a kinases, eIF4F complex, etc. One model of in hibition is that heat shock activates eIF2a kinases such as, HRI and PKR. The kinases in turn would phosphorylate eIF2 and thereby inhibit its activity, which would lead to a re pression of global translation. Another model that is proposed is that heat shock inhibits the eIF4F complex, which is involved in binding the mRNAs, unwinding them and helps in recruiting the ribosomes for translating the mRNAs. If the eIF4F complex is impaired, all mRNAs that are eIF4F dependent would be translationally inhibited. The mechanisms and molecular events postulated in these models are discussed in detail below: • 43S Pre-initiation Complex Formation: A first step in the translation initiation pathway is the formation of the 43 S pre-initiation complex. As mentioned earlier, ribosomes are dissociated into free 40S and 60S subunits, and are prevented from reassociating by the action of eIF-3 and eIF-6. The factor eIF-4C stabilizes the 40S®eIF-3 complex, which associates with a ternary complex of eIF2, GTP and Met-tRNA to form the 43 S initiation complex. Initiation of translation can be regulated at this step by phosphorylation of eIF2. Heat shocked cells show a dis tinct impairment in the 43 S pre-initiation complex formation (Panniers and Hen- shaw 1984), which suggests that the binding of eIF2+GTP+Met-tRNA is impaired - and studies implicate eIF2 as the cause. In fact, it has been shown that eIF2 is significantly inhibited by heat shock (Duncan and Hershey 1984). However, this hypothesis has been met with mixed success because of conflicting results. Pan niers, et al., prepared a cell-free protein synthesizing system (lysate) from heat- shocked Ehrlich ascites tumor cells, that reflected the inhibition of protein synthe sis in intact cells at elevated temperatures (Panniers, Stewart, et al. 1985), and they 26 Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. detected little reactivation of translation when they added highly purified eIF2 to these heat shocked cell lysates. Whereas, Burdon, et al. (Burdon, Gill, et al. 1987) observed marked stimulation of translation upon addition of elF2 to their heat shocked cell lysates. Note that these differences in observation may have resulted from subtle variations in the preparation and the status of the in vitro extracts used. These results can also be rationalized if we assume that heat shock inhibits more than one translation initiation factor or the 43 S pre-initiation complex, and this hy pothesis is supported by other studies discussed in the following sections. • The inhibition of eIF2: phosphorylating eIF2 inhibits its activity. The phosphory lation of the a subunit of eIF2 makes it unable to interact with the recycling factor (eIF2B) and exchange GDP for GTP, therefore, the activity of the eIF2 initiation factor is inhibited and protein synthesis is decreased. Fleat shock has been shown to increase the phosphorylation state of eIF2a in a temperature dependent manner, i.e., eIF2a is not significantly phosphorylated at low heat shock temperatures (41- 42°C), more phosphorylated at mild heat shock temperatures (43°C), hyperpho- phorylated at severe heat shock temperatures (44-45°C), and is dephosphorylated during recovery (37°C) (Duncan and Hershey 1984; Debenedetti and Baglioni 1986; Duncan and Hershey 1989). Thus, it is possible that the repression of protein synthesis during heat shock occurs because of a lesion in eIF2 activity. Further more, transfection experiments in mammalian cells have provided compelling evi dence implicating eIF2a phosphorylation as the cause of translational repression (Kaufman, Davies, et al. 1989; Murtha-Riel, Davies, et al. 1993). For example, an 27 Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. eIF2a plasmid with Serine51 to Alanine51 mutation was constructed (mutant eIF2a plasmid was non-phosphorylatable, and can not inhibit eIF2 activity) and transfected into mammalian cells. The over-expression of this eIF2a construct re duced the extent of heat shocked translational repression from 80% to approxi mately 50% (Murtha-Riel, Davies, et al. 1993). However, recovery of protein syn thesis in this study was only partial, which indicates that while eIF2a phosphorylation may have a role in translational repression, it cannot ac count for the whole story. Also, since this study was done at heat shock tempera tures of 43.5°C, it cannot explain why mild heat shock temperatures (41-42°C) re sult in significant (70-90%) repression while, at the same time, there is little or no heat shock induced phosphorylation of eIF2oc (Duncan and Hershey 1989). Heat shocked Drosophila cells also show a similar result (Duncan, Cavener, et al. 1995). Drosophila cells that had been severely heat shocked at 37°C, showed more than 90% inhibition of protein synthesis but with no evidence of eIF2a phos phorylation. Therefore, eIF2a phosphorylation may cause of repression of non-heat shock mRNAs translation, but it appears to be one of the many factors contributing to repression and only under severe heat shock circumstances. Another line of evidence that provides evidence that eIF2a phosphorylation cannot be the primary cause of translational repression of non-heat shock mRNAs, is the activity of the eIF2a kinases. Phosphorylation of eIF2a was found to be a common regulatory mechanism of protein translation under various stress condi tions and it is carried out by a family of eIF2a kinases. At present, there are four 28 Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. known eIF2oc kinases, and they are: interferon-induced double-stranded RNA- dependent eIF2a kinase (PKR); the GCN2 protein kinase; the mammalian endo plasmic reticulum resident kinase (PERK); and the heme-regulated inhibitor kinase (HRI). Normally, these eIF2a kinases are in a repressed state because they are complexed with molecular chaperones which inhibit their kinase activity. How ever, heat shock derepresses them, because the molecular chaperones are titrated off to sequester denatured proteins, and they are now free to phosphorylate eIF2a and inhbit protein synthesis. Studies have not yet determined which of the above mentioned kinases play a major role in heat shock induced translational inhibition (Lu, Han, et al. 2001; Zhao, Tang, et al. 2002). In fact, the activation of PKR dur ing heat shock did not appear to induce repression of non-heat shock mRNA translation at all (Zhao, Tang, et al. 2002). Therefore, it is not surprising that eIF2a does not significantly account for translational repression. In summary, eIF2 and the phosphorylation of the eIF2a subunit may cause translational repression but only when the cells are severely heat shocked, and are unlikely to be the primary cause of repression. Therefore, studies focused on other protein factors to answer the question about what causes translation repression in non heat shock mRNAs. • The eIF4F Cap-binding Complex: Eukaryotic eIF4F is a complex containing three subunits, eIF-4G (a scaffolding protein), eIF-4E (an mRNA cap binding pro tein) and eIF-4A (an RNA helicase). The eIF4F complex appears to have the fol lowing functional properties: (i) it supports the binding of mRNA to 40S ribosomal 29 Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. subunits; (ii) it catalyzes RNA-dependent ATPase activity; and (iii) it catalyzes ATP-dependent RNA helicase activity (Mathews, Hershey, et al. 2000). Conse quently, the complex plays a critical role in the initiation of translation and any problems with it would lead to a repression of protein synthsis. Experiments quan titating initiation factor activities in mammalian cells have shown that eIF4F is sig nificantly inhibited by heat shock (Duncan and Hershey 1984). Additionally, ex periments have also shown that addition of eIF4F can restore non-heat shock mRNA translation in heat-shocked cell-free systems from both mammalian (Panniers, Stewart, et al. 1985) and Drosophila cells (Zapata, Maroto, et al. 1991), implicating a heat-induced lesion in this factor. Therefore, eIF4F appears to be a key protein regulator of repression of non-heat shock mRNAs translation. The function of eIF4E (the cap binding subunit of eIF4F) is also potentially regulated by phosphorylation. It has been shown that phosphorylation of eIF4F via phosphorylation of its subunits eIF-4E and eIF-4G, increases its initiation activity (Lamphear and Panniers 1990; Lamphear and Panniers 1991; Morley, Dever, et al. 1991). For instance, chemical cross-linking of eIF4F to cap-labeled mRNA, showed that phosphorylation increased the interaction of both the eIF-4E and elF- 4G subunits of eIF4F with the 5' end of mRNA (Morley, Dever, et al. 1991). This effect was manifested by a stimulation of initiation complex formation and meas ured by an increase in the association of labeled mRNA with 40 S ribosomal subunits in the translation system. Thus, phosphorylation of eIF4F appears to en hance binding to mRNA, resulting in a stimulation of protein synthesis at initiation (Morley, Dever, et al. 1991). Additionally, a moderate (43°C) to severe heat shock 30 Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. (>43°C) of mammalian cells can substantially decrease eIF-4E phosphorylation, and hence implicates eIF4F inactivation as a cause of heat shock induced transla tional repression (Duncan, Milbum, et al. 1987; Duncan and Hershey 1989; Lam phear and Panniers 1990; Lamphear and Panniers 1991). However, more recent structural data and biophysical studies indicate that phosphorylation actually de creases the affinity of eIF4E for cap or capped RNA (Scheper and Proud 2002). In addition, another Scheper study shows that decreasing the eIF4E availability under stressful conditions does not seem to be a general mechanism to inhibit protein synthesis by heat shock (Scheper, Mulder, et al. 1997). Therefore, there is some discrepancy in the reports that state that increases in the phosphorylation levels lead to an increase in eIF4E activity. Furthermore, upon heat shock (37°C) of Dro sophila cells or a milder heat shock (41-42°C) of mammalian cells, even though translational repression still occurs, there is no detectable dephosphorylation of eIF4F (Duncan and Hershey 1989; Duncan, Cavener, et al. 1995). Therefore, as with eIF2a phosphorylation, inactivation of eIF4F (via eIF-4E dephosphorylation) appears not to be the major cause of protein syntheis inhibition, and causes repres sion of protein synthesis only under severe heat shock circumstances. There is also evidence that the dissociation of the eIF4F complex leads to a de crease in its activity and/or protein synthesis (Sonenberg 1996; Gingras, Raught, et al. 1999; Marissen, Gradi, et al. 2000; Morino, Imataka, et al. 2000). It has also been shown that at moderate (43°C) to severe heat shock (>43°C), the mammalian eIF4F complex dissociates, releasing free eIF-4E (Duncan, Milbum, et al. 1987; Lamphear and Panniers 1990; Lamphear and Panniers 1991). These results would 31 Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. imply that dissociation of the eIF4F complex leads to a decrease in protein synthe sis. Yet, similar to the findings for eIF2a and eIF4E, during mild heat shock (41- 42°C) elF4F complex disruption is not observed, even though translational repres sion occurs (Duncan and Hershey 1989). Therefore, eIF4F complex dissociation cannot be the primary cause of protein synthsis inhibition. A number of studies have shown that eIF-4E incorporation into the eIF4F com plex is regulated by eIF-4E binding protein(s) (elF4E-BPs) (Lin, Kong, et al. 1994; Pause, Belsham, et al. 1994; Fletcher, McGuire, et al. 1998; Gingras, Kennedy, et al. 1998; Gingras, Gygi, et al. 1999; Patel, McLeod, et al. 2002) and suggest a pos sible basis for complex dissociation during heat shock. These papers showed that when eIF4E-BPs are dephosphorylated, they associate with eIF4E and prevent it from forming an active eIF4F complex, and as can be expected a correlated de crease in protein synthesis was observed. Studies have also shown that heat shock induces the dephosphorylation of eIF4E-BPs, and therefore it could be assumed that translational repression was occurring because of eIF4E-BP activity (Vries, Flynn, et al. 1997; Wang, Flynn, et al. 1998). However, Scheper, et a l, investi gated changes in the phosphorylation of eIF4E and eIF4E-BP during heat shock and indicated that in Rat H35 cells, although eIF4E-BP phosphorylation was in creased by heat shock (thus decreasing the eIF4E availability), this did not seem to be a general mechanism to inhibit protein synthesis (Scheper, Mulder, et al. 1997). The dissociation of the eIF4F subunit was also observed in heat-shocked (37°C) Drosophila cells (Zapata, Maroto, et al. 1991). However, this result is not 32 Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. uncontested because another study did not find any significant eIF4F dissociation in Drosophila (Duncan, Cavener, et al. 1995). Thus, eIF4F complex dissociation and eIF4E phosphorylation does occur in cells, but similar to the results of eIF2a, the findings are controversial. Also these events occur only during severe heat stress, and not initially when protein synthesis is significantly inhibited, which leaves researchers with the question as to what does regulate the translation of non heat shock mRNAs during heat shock. • eIF2B: The proteins eIF2 acts to bring Met-tRNA to the 40S ribosomal subunit, by binding to Met-tRNA and GTP. The initiation factor eIF2B is a guanine nucleotide exchange factor that acts to replace GDP on eIF2 by GTP. Phosphorylating eIF2B represses the protein, it can no longer interact with eIF2 and is unable to carry out the GDP/GTP exchange, which in turn inhibits eIF2 activity and hence protein synthesis. Recently, Scheper, et al. have provided evidence that the regulation of eIF2B activity represses non-heat shock mRNAs translation (Scheper, Mulder, et al. 1997). The study showed that in mammalian cells, heat shock temperatures (41- 44°C°C) rapidly inhibited the activity of this guanine nucleotide exchange factor and the levels of protein synthesis. Likewise, recovery of protein synthesis coin cided with the recovery of eIF2B activity. This correlation between protein synthe sis rates and the activity of eIF2B demonstrates that at mild to moderate heat shock temperatures, the activity of eIF2B may be critical for the translation of non heat shock mRNAs. • eIF-4B: Experiments have shown that eIF-4B, another phosphoprotein initiation factor, is also loosely associated with eIF4F. eIF-4B has been shown to have a 33 Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. number of different functions. In wheat, eIF-4B stimulates the ATP dependent un winding of the 5’UTR of the mRNA by eIF-4A and eIF4F (Abramson, Dever, et al. 1988). In mammalian systems eIF-4B alone appears to have helicase activity, but in yeast systems eIF-4B does not appear to have helicase activity in association with eIF-4A. Human eIF-4B has also been shown to bind ribosomal 18S RNA and a non-specific mRNA simultaneously, and eIF-4B from rabbit reticulocytes has been observed to bind ribosomes (Hughes, Dever, et al. 1993; Methot, Pickett, et al. 1996). Recent evidence indicates that eIF-4B may be important in mediating an interaction between the 5’UTR and the 3’UTR of mRNAs, along with eIF4F and poly-A binding protein (Pablp). It has been shown that, in the yeast and wheat systems, eIF-4B binds Pablp and increases the affinity of Pablp for poly- adenylated mRNA (Le, Tanguay, et al. 1997). Nonetheless, the gene for yeast elF- 4B is not required for survival (Altmann, Muller, et al. 1993). In recent years, it has been hypothesized that the activity of eIF-4B is regulated via phosphorylation. This initiation factor dissociates during moderate to severe heat-shock and is substantially de-phosphorylated in wheat, mammalian and Dro sophila cells, while hyperphosphorylation of eIF-4B’s multiple serine residues cor relates with the activation of protein synthesis (Duncan, Milbum, et al. 1987; Duncan and Hershey 1989; Duncan, Cavener, et al. 1995; Gallie, Le, et al. 1997). Therefore, it is possible that during heat shock eIF-4B activity is inhibited because of dephosphorylation and it cannot help with eIF4F helicase activity. This would involve it in the repression of non-heat shock mRNAs translation. 34 Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. • Rate of Elongation: Thus far, regulations at the step of translation initiation ap pear to be the primary way non-heat shock cellular mRNAs translation is re pressed. However, a few reports suggest that alterations in elongation rates may also accompany heat shock. In particular, it was determined that, during heat-shock of Drosophila cells, the rate elongation of normal mRNAs is significantly (15-to 30- fold) reduced, relative to the rate of the efficiently translated heat shock mRNAs (Ballinger and Pardue 1983). It has also been shown that during heat shock of chicken reticulocytes, the synthesis of a single heat shock protein, HSP70, increases greater than 10-fold, while the level of HSP70 mRNA increases less than 2-fold during the same period. Treatment of control and heat shocked cells with the initiation inhibitor pactamycin revealed that a major control point for HSP70 syn thesis in reticulocytes is the elongation rate of the HSP70 nascent peptide (Theodorakis, Banerji, et al. 1988). Thus, the rate of translation elongation also ap pears to play a role in the control of protein synthesis during heat shock. • Small Heat-Shock Protein (HSP27): The small heat shock proteins (sHSPs) are a conserved and ubiquitous protein family, with the ability to convey thermoresis tance to cells. It has been suggested that their participation in protecting the native conformation of proteins may also be important for the translational recovery of non-heat shock mRNAs (Landry, Chretien, et al. 1989; Landry, Chretien, et al. 1991; Ehmsperger, Graber, et al. 1997). A recent study has elucidated a molecular mechanism for the role of HSP27 in maintaining and recovering eIF4F-dependent non-heat shock mRNA translation in heat-shocked mammalian cells. The mecha nism is that during heat shock, eIF4G protein becomes denatured and therefore a 35 Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. target for a molecular chaperone such as HSP27. HSP27 binds it due to hydropho bic interactions and prevents eIF4G from further denaturation or malfolding. And once the stress is removed, HSP27 can dissociate from the eIF4G protein, which can then resume its role as a translation initiation factor. Specifically, in heat- shocked HeLa, 293 and 293T cells, 90-95% of eIF-4G is specifically aggregated with FISP27 into heat shock granules, with kinetics that parallel the disassembly of eIF4F complexes and the inhibition of normal cellular mRNA translation. The re covery of non-heat shock mRNA translation following heat shock, correlates with the release of eIF-4G from aggregated HSP27 complexes and reformation of eIF4F (Cuesta, Laroia, et al. 2000). Furthermore, it has also been shown that enhanced expression of HSP27 in cell lines, protects the translational apparatus and enhances the rate and extent of recovery of non-heat shock protein synthesis following heat shock (Mizzen and Welch 1988; Carper, Rocheleau, et al. 1997). Taken together, these findings suggest a role for the smaller HSPs in the restoration of non-heat shock mRNA translation. To summarize, eIF2a and eIF4F are the key factors that regulate translation for non heat shock mRNAs during moderate to severe heat-shock in mammalian cells. Under conditions of mild heat stress, protein synthesis inhibition appears to be caused in part by a decrease in eIF2B activity. In severe heat shocked (37°C) Drosophila cells - which re tain the capacity to translate HSP mRNAs very efficiently, as described below - neither eIF2a nor eIF4F appear to be substantially modified, although eIF4F complex dissocia tion does occur. Therefore, determining the identity of the translational regulators in Dro sophila is an important research question. 36 Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. 3.2. Preferential Translation of Heat-Shock Protein mRNAs In Drosophila, another major translational event during heat shock is the preferential translation of the heat shock protein (HSP) mRNAs. Preferential translation is when HSP mRNAs are very efficiently translated when virtually all of the non-heat shock mRNAs are severely repressed. This is due to unique structural features in heat shock mRNAs that enable them to bypass the initiation factor lesions (see earlier sections). However, it is important to note that exclusive translation of HSP mRNAs during heat shock is not ob served to the same extent in all cell types. For instance, in Drosophila during heat shock, HSP mRNAs can be translated at least 50X more efficiently than non-heat shock mRNAs, yet in mammalian cells, the translation efficiency of HSP mRNAs is similar to or only a few fold greater than non-heat shock mRNAs (Hickey and Weber 1982; Duncan and Hershey 1989). Moreover, preferential translation of HSP mRNAs may depend upon the severity of the heat shock. For instance, Drosophila HSP mRNAs are induced at 31- 32°C, yet overall translation is not significantly repressed at this temperature and hence there is no preferential translation. Marked preferential translation is observed at 33- 37°C, but at temperatures above 39°C, even HSP mRNAs cannot be translated (DiDomenico, Bugaisky, et al. 1982a). Therefore, preferential HSP mRNA translation is a phenomenan that is possibly restricted to a temperature window, which may be broad as is the case in Drosophila cells, or narrow in the case of mammalian cells. Clearly, since HSP mRNAs are translated during heat shock while co-existing non heat shock mRNAs are not, HSP mRNAs must be recognizably different to the transla tional machinery of heat shocked cells. To explain this, a model hypothesized that prefer ential translation of HSP mRNA occurs because mRNAs transcribed during heat shock 37 Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. are “marked” for activity; for instance, tagged with unique nuclear proteins during trans lation or nuclear processing. However, this model has been disproven by showing that a non-heat shock mRNA expressed from a heat-shock promoter during heat-shock cannot be translated (Klemenz, Hultmark, et al. 1985). Another model hypothesized that, since high temperatures are sufficient to repress normal translation, a structure within non-heat shock mRNAs, required for their translation, may simply melt at high temperatures and thereby prevent translation. This model has also been disproven by showing that, when pre-existing non-heat shock mRNAs and HSP mRNAs are mixed and translated in het erologous cell-free lysates over the range of 25 to 37°C, the overall efficiency of their translation varies, yet at all temperatures the two classes of mRNAs behave identically (Lindquist 1981). Furthermore, this model has been disproven by showing that transla tional specificity is retained in cell-free Drosophila lysates, which means that lysates pre pared from cells growing at normal temperatures translate both pre-existing mRNA and HSP mRNAs at 30°C, but lysates prepared from heat shocked cells can translate only HSP mRNAs (Storti, Scott, et al. 1980; Kruger and Benecke 1981; Di Nocera and Dawid 1983). In addition, this model has also been disproven by showing that when heat shocked cells are returned to normal temperatures, pre-existing messages do not immedi ately return to normal translation, but instead HSPs continue to be the exclusive products of protein synthesis for up to several hours (DiDomenico, Bugaisky, et al. 1982). Several studies, derived almost exclusively from investigations in Drosophila because of its marked capacity to vigorously translate HSP mRNAs during heat shock, have con firmed that it is indeed special sequence elements or features in HSP mRNAs that confer 38 Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. preferential translation. The particular features that allow preferential translation in Dro sophila are discussed in the next section. 3.2.1. Structural Elements of HSP mRNAs Gene fusion and sequence analyses experiments have shown that the 5’UTR of HSP mRNAs contains sufficient primary sequence information for preferential translation. Specifically, gene fusion experiments have linked the Drosophila HSP70 5’UTR to the 5’UTR and coding region of a non-heat shock mRNA and showed that these chimeric mRNAs were translated during heat shock (Di Nocera and Dawid 1983). Moreover, sub sequent analysis also determined that the precise amounts and organization of the por tions of the 5’UTR can significantly influence the preferential translation extent of these chimeric mRNAs. Sequence analysis comparisons of several distinct Drosophila HSP mRNAs have re vealed common characteristics that could contribute to their preferential translation: (i) relatively long length (200-250 nucleotides) of 5’UTRs; (ii) conserved sequence blocks in similar positions to the cap site (at +2 and +93), which imply an important regulatory function (Holmgren, Corces, et al. 1981; Hultmark, Klemenz, et al. 1986); (iii) very high adenosine content (45-50%) (Ingolia and Craig 1981), which corresponds to (iv) a low potential for forming secondary structures (as compared to most non-HSP mRNA 5’ UTRs). But which (if any) of these elements were critical for HSP mRNA preferential translation? Therefore, to determine whether length of the 5’UTR was influencing translation, a series of experiments of progressive 5’-end deletions of the HSP70 5’UTR was done 39 Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. (McGarry and Lindquist 1985). The experiments demonstrated that these deletions did result in a decrease in translation during heat-shock (McGarry and Lindquist 1985; Mcgarry 1986; Lindquist and Petersen 1990). However, a large (-170) nucleotide dele tion construct that retained the first 38 nucleotides translated relatively well (-70% of wild type) (McGarry and Lindquist 1985), clearly indicating that long length per se is not required. Moreover, deleting approximately 230 nucleotides from the Drosophila HSP22 5’UTR, while retaining the first 27 nucleotides, also had no detrimental effect on the preferential translation of the HSP22 mRNA (Hultmark, Klemenz, et al. 1986). Overall, these results suggest that long length per se is not critical, and that the cap proximal por tion of the 5’UTR of HSP mRNAs is a primary determinant for their preferential transla tion. Experiments also investigated if the conserved sequence blocks have an important regulatory function (McGarry and Lindquist 1985). HSP deletion mutants were made lacking either of the two conserved sequence segments or both, yet they all translated ef ficiently during heat shock. This result suggests that neither the conserved features at the 5’ terminus of the 5’UTR nor the internal conserved region are required for heat-shock translatability (McGarry and Lindquist 1985). To address the question of whether there are essential sequence elements anywhere in the HSP70 5’UTR, a series of overlapping, small (-25-60) nucleotide deletion mutants covering the entire 5’UTR were prepared and all translated relatively well during heat shock (McGarry and Lindquist 1985; Mcgarry 1986). This clearly indicates that there is no single essential sequence element at any point throughout the 5’UTR. 40 Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. Studies were also performed to explore whether low overall secondary structure (due to the high adenosine content in HSP 5’UTRs) in the HSP 5’UTRs could influence translation. Lindquist and Petersen constructed plasmids with artificial A-rich 5’UTRs that retained the authentic base composition of the HSP70 5’UTR but had the nucleotide order scrambled (Lindquist and Petersen 1990). These plasmids failed to translate during heat-shock, showing that neither a high adenosine content nor an unstructured 5’UTR are sufficient for conferring preferential translation. However, even though the unstructured 5’UTR may not be sufficient to confer preferential translation, it is definitely required - (Hess and Duncan 1996) showed that the introduction of modest secondary structure in hibited heat-shock translation. To summarize, in the 5’UTR region, neither long length nor conserved sequence ele ments identified to date are required for HSP mRNA preferential translation. Moreover, the absence of a secondary structure is required but not sufficient. Furthermore, according to the findings discussed above, HSP mRNA preferential translation appears to be de pendent on specific sequences within the HSP 5’UTR. Clearly, determining which these sequences are and why they are functionally significant will provide clues to the mo lecular mechanisms regulating preferential translation. 3.2.2. Mechanisms and Molecular Events Underlying HSP mRNA Translation Activity Several research studies have attempted to explain the preferential translation of HSP mRNAs by, first, examining the capacity of HSP mRNAs to bypass an eIF4F lesion. This stems from the fact (discussed earlier) that eIF4F is inhibited by heat shock even though HSP mRNAs translate efficiently during heat shock. In Drosophila, studies (Zapata, Ma- 41 Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. roto, et al. 1991) showed that cell free translation lysates that were made from heat shocked cells reproduced the in vivo HSP mRNA discrimination, and that supplementa tion with eIF-4E partially restored non-heat shock mRNA translation. Conversely, in vi tro eIF-4E limitations caused by treatment with the m7 G cap analog, with eIF-4E or elF- 4G antibody or with the foot-and-mouth disease virus (FMDV) L protease, resulted in normal translation being substantially more inhibited than HSP mRNA translation (Maroto and Sierra 1988; Zapata, Maroto, et al. 1991; Zapata, Martinez, et al. 1994; Song, Gallie, et al. 1995). Along the same lines, in vivo decrease of eIF4F abundance by expressing antisense eIF-4E RNA reduced normal mRNA translation, yet HSP mRNAs were induced and translated efficiently (Joshi-Barve, Debenedetti, et al. 1992). Furthermore, another critical issue is whether HSP mRNA translation can occur by cap-independent, internal initiation, or whether HSP mRNAs can competitively sequester a minimal amount of active eIF4F, resulting in their preferential, efficient translation. The latter issue is as yet unresolved. As for the former issue, whether HSP mRNA translation can occur by cap-independent, internal initiation, it has been shown by several experi ments that the Drosophila and human HSP70 5’UTRs do not contain an IRES. For in stance, the addition o f-38 nucleotides to the 5’ end of HSP70 mRNA, blocked preferen tial translation (McGarry and Lindquist 1985); the introduction of stem loops in the 5’UTR at various positions blocked preferential translation (Hess and Duncan 1996); and experiments that used bicistronic constructs (the gold standard for determining the pres ence of an IRES) failed to translate (Vivinus, Baulande, et al. 2001). Instead, the human HSP70 mRNAs have been shown to translate by a ribosome shunting mechanism (Yueh and Schneider 2000). Specifically, the human HSP70 5’UTR contains one element simi- 42 Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. lar to the adenoviral tripartite leader sequence (the adenoviral sequences are able to re cruit ribosomes). This element in the human HSP70 5’UTR is postulated to recruit ribo somes to the mRNA independent of the eIF4F complex and therefore direct a high level of translation by ribosome shunting (Yueh and Schneider 2000). However, other uniden tified elements must also be involved in promoting translation by the human HSP70 5’UTR because deletion of the 18S rRNA complementarities reduces but does not elimi nate translation. Although the coding sequence of the human HSP70 gene is highly ho mologous to the Drosophila coding sequence of the Drosophila HSP70, the 5’UTRs of the two mRNAs are completely unrelated. At present, it is not known by which mecha nism Drosophila HSP mRNAs translate. An alternative line of research studies to explain the preferential translation of HSP mRNAs was prompted by the observation that many sequence or structural features of mRNAs that regulate translation are recognized by trans-acting protein factors, e.g., the iron-responsive regulatory site in ferritin mRNA requires specific protein binding to elicit its translational effect (Rouault and Harford 2000). Thus, if heat shock were to induce HSP specific tram-acting factors, which could bind to sequence or structural features of HSP mRNAs, it would enable them to circumvent translational repression and be prefer entially translated. However, preferential translation of the HSP mRNAs does not seem to require such an mRNA/protein interaction. An extensive investigation of RNA/protein interactions between the Drosophila HSP70 5’UTR and lysate proteins, using gel retar dation, UV-light cross-linking, and biotin labeling affinity purification, failed to detect any marked changes in sequence specific protein binding upon heat shock (Hess and Duncan 1994). This result, although negative, is consistent with preferential HSP mRNA 43 Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. translation being primarily determined by its minimal secondary structure which allevi ates a requirement for unwinding factors. In summary, nucleotide sequence analyses of HSP mRNA 5’UTRs have established some of the general features required for preferential translation during heat-shock. How ever, quite a few uncertainties remain: What is the identity of the specific 5’UTR se quences required for preferential translation? Are they reiterated throughout the 5’UTR? How do they act? The preferential translation of HSP mRNAs has been partially ex plained on the basis of eIF4F inactivation, since HSP mRNAs appear to have a reduced requirement for this factor. However, this is not true for all HSP mRNAs, e.g., HSP90 mRNA translation appears to be sensitive to depletion of eIF4F levels (Zapata, Maroto, et al. 1991)(R. Ahmed and R. Duncan, unpubl. results). In addition, human HSP70 mRNA has been shown to use a ribosome shunting mechanism to initiate translation, but it is not as of yet clear, by which general mechanism Drosophila HSP mRNAs translate. 4. Researching the molecular mechanisms of translational control during heat shock Drosophila HSP mRNAs are preferentially and efficiently translated at a time when virtually all other mRNAs are excluded from active translation. Heat shock in Drosophila melanogaster provides an excellent model system for understanding the molecular mechanisms of translational control and many other aspects of the regulation of gene ex pression, since the magnitude of induction of HSP mRNAs in Drosophila is very high while at the same time there is nearly complete inhibition of non-heat shock mRNA translation. Moreover, because Drosophila cells are homogeneous and growth conditions 44 Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. of the cell cultures are strictly regulated, the variability that is commonly present in com plete organisms is eliminated. As described earlier, even though the 5’UTR of HSP mRNAs is sufficient to confer preferential translation, the sequence specific elements and mechanisms required for preferential translation within this rather long (>200) stretch of nucleotides are still uni dentified. For instance, a truncation/deletion analysis of the Drosophila HSP70 5’UTR failed to identify any short segments, analogous to promoter elements for transcription, that could confer preferential translation to a reporter coding sequence. Rather, elements promoting preferential translation activity appeared to be distributed throughout the leader, roughly proportional to the length of the leader retained. Moreover, 5’UTRs of length less than 50 nucleotides were inactive (Holmgren, Corces, et al. 1981), although one study did show that a short leader, containing only the first 27 nucleotides of the HSP22 5’UTR, conferred fully active preferential translation (Hultmark, Klemenz, et al. 1986), the reason for this was unclear. Furthermore, theories to explain the mechanism of preferential translation under heat shock were also unsuccessful. For instance, Hess and Duncan (Hess and Duncan 1994) were not able to identify such a translational mecha nism utilizing specific mRNA binding proteins. However, (Sprengart, Fuchs, et al. 1996; Sprengart and Porter 1997; Yueh and Schneider 2000) established that during heat shock, as with some bacterial prokaryotic and eukaryotic mRNAs, an RNA-RNA interaction can be utilized to recruit ribosomes for translation initiation. One of the objectives of my research work is to identify the nucleotide sequences re quired for preferential translation of HSP mRNAs during heat shock in Drosophila. To 45 Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. accomplish this, firstly, a minimum length heat shock-active HSP70 5'UTR will be mutagenized to determine the features that confer preferential translation upon heat shock mRNAs. Secondly, I will compare our finding for HSP70 5'UTR to HSP22 5’UTR re sults. Finally, RNA based complementarity and modeling analyses will be done to under stand the mechanism by which the identified features help Drosophila HSP70 preferential translation. In addition, another objective of this study is to establish that a different translational control mechanism accounts for the preferential translation of HSP90 mRNAs. HSP90 mRNAs possess several features that distinguish it from other HSP mRNAs, e.g., the HSP90 mRNA contains introns, its 5'UTR contains significant secondary structure, its translation rate is sensitive to eIF4F depletion. To demonstrate that a different transla tional control mechanism accounts for HSP90 mRNA, we will first show that HSP90 translation is inefficient at normal temperatures, but is activated several fold during heat shock. Next, the mechanism of HSP90 mRNA preferential translation will be investi gated using strategies similar to the ones employed for HSP70. A mutagenesis approach will be used to create various test 5'UTRs to identify the critical elements in the HSP90 5’UTR sequence that are necessary for translation during heat shock. Moreover, sucrose density gradient experiments will be done to establish an RNA profile of HSP90 and HSP70 mRNAs at different temperatures, and to compare if HSP90 translation differs from that of other HSPs. Finally, our work will develop particular insights in the preferential translation of HSP90 mRNA with broad implications in the understanding of the basic translation mo- 46 Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. lecular mechanisms. Moreover, our results will help structure a theory to clarify the mo lecular basis for heat shock translational control and, possibly, reveal a new mode for dis criminatory mRNA translation. 47 Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. II. Materials & Methods 1. Western Blot Analysis of HSP70 Transgenes Polyclonal antibodies against HSP70 (gift of Dr. Susan Lindquist) were used to detect the endogenous HSP70 and the transgene HSP70 protein levels. The protein samples were electrophoresed in 10.5% SDS-PAGE, along with kaleidoscope protein markers (BIO-RAD) for 1.5 hours at 100 Volts. The gels were then transferred to PVDF mem brane (Immobilon-P, Millipore Corp.) for 1 hour at 70 volts, in a liquid transfer tank (BIO-RAD) using Laemmli formulation SDS/PAGE running gel tank buffer (with SDS reduced to 0.01% and methanol added to 10%). After the transfer, proteins were stained with 0.1% amido Schwartz in destaining solution (80% methanol, 2% acetic acid) for ~5 min, destained with three rinses of destaining solution, and preblocked with 5% nonfat milk (Carnation) in TBS buffer (20 mM Tris-HCL pH7.6, 137 mM NaCl, 0.05% Tween- 20) for 30 min at room temperature, on a rocker table. The membrane was then rinsed 3X for 10 minutes each with TBS buffer. The blot is next incubated with the rat anti-HSP70 primary antibody (1:10,000 dilution) for 2 hours, rinsed 3X for 10 minutes each with TBS buffer, and then incubated with the secondary anti-rat HRP antibody (1 : 30 000 di lution) for 1 hour. Once the 1 hour incubation finished, the blot was washed 6 X for 10 minutes each with TBS, and the subsequent steps followed guidelines provided in the ECL Western blotting kit (Amersham; chemiluminescence detection using HYPERfilm). Protein bands were quantified by densitometry using the VersaDoc 1000 imaging system (BIO-RAD). 48 Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. 2. Protein Labeling and Quantitation Drosophila S2 cells were scraped from T25 flasks into 15 mL falcon tubes, pelleted by brief centrifugation (30 seconds) in a clinical centrifuge, and resuspended in Grace's Media lacking methionine (Invitrogen). The cells were then transferred to 20 ml glass scintillation vials, with a stir flea, for experimental manipulations and analyses. Induction of the transgenes under metallothionein promoter control was by induction with 500 mM copper sulfate for 3h. Heat shocked cells were incubated in a 36°C water bath with stir ring for 15 min, at which time ~5 X 106 cells were labeled with 15-20 jL tC i [3 5S]methionine (ICN Biochemicals) for 15 min. At the end of the 15 minutes, incubation was stopped and cells were washed twice with 4°C wash buffer (50 mM KCL, 15 mM MgSCX, 4 mM CaCh, 3 mM KH2PO4, 10 mM dextrose, 8.4 mM HEPES, and 20 pg/mL cycloheximide). The cells were then pelleted by brief centrifugation (30 seconds) and lysed with 100-150 pL of Ampholyse buffer (~9.8 M Urea, 5% pH 3.5-10 ampholine car rier Ampholytes (BIO-RAD), 2% Nonidet P-40 (NP-40), 1% P-mercaptoethanol). The concentration of the protein lysates was calculated using the Bradford Assay and the ra dioactivity was measured by the TCA Precipitation Assay. Analysis by one- and two- dimensional gel electrophoresis is as described below. Gels were dried and exposed to film for 4-5 days. Protein bands/spots were quantitated by densitometry (BIO-RAD Ver- saDoclOOO imaging system). Transgene mRNA translational efficiency was calculated as the protein synthesis rate (band/spot intensity) per unit transgene mRNA (3 2 P c.p.m. on Northern blot, normalized by methylene-blue staining or endogenous HSP70 hybridiza tion; see below). Translational efficiencies are reported relative to MT301 (wild type HSP70 5'UTR) in most cases. 49 Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. 3. RNA Isolation and Quantitation RNA was extracted from ~5 X 106 cells using TRIzol reagent (Invitrogen) as recom mended by manufacturer. In brief, cells were first pelleted in a microfuge (30 seconds, 14000 rpm) and then lysed with 200 pL of TRIzol. The lysed mixture was incubated at room temperature for 5 minutes and then 40 pL of 100% chloroform was added and the tubes were shaken vigorously, and further incubated for 3 minutes at room temperature. The mixture was then centrifuged in a 4°C microfuge for 15 minutes at 14000 rpm. After centrifugation, the aqueous layer of the mixture was removed to a fresh 1.5 mL eppendorf tube and mixed with an equal volume of 100% isopropanol for RNA precipitation. The tubes were then incubated at -20°C overnight, and centrifuged the next day in a 4°C mi crofuge for 15 minutes at 14000 rpm. The precipitated RNA was resuspended in a final volume of 25 pL of DEPC treated water. The final RNA concentration was measured in a Beckman UV spectrophotometer. 4. Northern Blot Analysis of RNA Radioactive Probes: DNA fragments to be used for probes were digested from plas mids and gel purified by electrophoresis through a 1% low melting agarose gel. The puri fied fragments were labeled using the random primer labeling method (Feinberg and Vo- gelstein, 1984) with a few modifications. In brief, 10 ng of DNA was added to sterile water in a total volume of 10 pL and the tube placed in boiling water for 4 minutes. After 4 minutes the tubes were rescued, briefly spun in a centrifuge and the following items were added to the tubes in a sequential manner: 5 pg of random primer (hexamer), 1 pg BSA, 5 pL 5X labeling buffer (IX labeling buffer is 50 mM Tris pH 8.0, 5 mM MgCE, 1 50 Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. mM 2-mercaptoethanol, 0.2 mM HEPES pH 6 .8 ), 0.4 mM dNTPs (minus dATP), 10 pCi [a 3 2P] dATP (ICN), and 5 U of Klenow enzyme (Invitrogen). The final reaction volume was 20 pL, and the DNA+primer tubes were incubated for 2 hours at 37°C. After the in cubation, DNA labeling reaction was stopped by adding EDTA to a final concentration of 5 mM. The probes were then purified by using quick spin columns for ralabeled DNA purification (Roche), and quantitated by TCA assay. Sample Preparation. Electrophoresis and Blotting: 2 pL (~5 pg) of RNA samples were mixed with 5 pL of 1.4X RNA sample buffer (IX RNA sample buffer is 50% For- mamide, 7% Formaldehyde, IX MOPS [20mM MOPS, 8 mM sodium acetate, 1 mM EDTA pH 7.0], and 0.05% bromophenol blue/xylene cyanol), denatured by heating at 65°C for 5 minutes, and immediately chilled on ice for 3 minutes. The samples were then electrophoresed on a 1.25% agarose-formaldehyde denaturing gel (1.25 gm agarose, IX MOPS, 660 mM Formaldehyde), and RNA was transferred to a nytran membrane (Schleicher & Schuell) by capillary transfer overnight in 2X SSC buffer (IX SSC buffer is 0.15 M NaCl, 0.015 M sodium citrate pH 7.0). RNA was cross-linked to the nylon by ultraviolet cross-linking (1200 KJ/20 seconds) using the Ultra-Lum UV crosslinker. The membrane was then stained with 0.04% methylene blue for 5 minutes and washed with DEPC treated water twice to determine RNA integrity, transfer efficiency, equal loading of samples and the position of 18S and 28S rRNA. Hybridization and Quantitation: The blot was prehybridized for 2 hours at 42°C in a pre-hybridization buffer (4X SSC, 50% deionized Formamide, 5X Denhradt’s solution [0.1% BSA, 0.1% SDFS, 0.1% Ficoll, 0.1% polyvinylpolypyrolidone]), 0.4% SDS and 51 Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. 200 jig/mL denatured salmon sperm DNA) in a roller hybridization oven (Robbins scien tific, Model 400). After the preincubation, the blot was then hybridized overnight at 42°C in hybridization buffer (4X SSC, 50% deionized Formamide, 0.4% SDS) containing lxlO 6 cpm/mL of denatured radiolabeled probe. After overnight hybridization, the blot was washed at room temperature for 20 minutes in wash buffer A (2X SSC), followed by two washes at 65°C for 30 minutes each in wash buffer B (2X SSC, 0.1% SDS), followed by another two washes at 65°C for 30 minutes each in wash buffer C (0.2X SSC, 0.1% SDS). The blots were then dried, covered with saran wrap, and exposed to film at -70°C for 3 hours. After which the film was developed and bands quantified by densitometry (BIO-RAD VersaDoc 1000 Imaging System). 5. RNA Secondary Structure Predictions All RNA secondary structures were predicted with the MFOLD program (v. 3.1) pro vided by Zucker, et. al. (Zucker, Mathews, et al. 1999), the program is also available on the internet (http://www.bioinfo.math.rpi.edu/~mfold/ma). 6. Protein Two-Dimensional Isoelectric Focusing/SDS-PAGE Lysate preparation: Cells were labeled (-1.5 X 106 cells labeled with 15-20 pCi [3 5S]methionine (ICN Biochemicals) for 15 minutes, and pelleted by brief centrifugation in a low speed (clinical) centrifuge. The pellets were then washed several times (3X) with 4°C wash buffer (50mM KCL, 15mM MgS04.7H20 , 4mM CaCl2, 3mM KH2P 0 4, 10 mM dextrose, 8.4 mM HEPES, and 20 pg/mL cycloheximide) for about 50 seconds each. Following the final wash and aspiration, the cells were lysed by incubation in 100 pL of IEF Buffer (-9.8 M Urea, 5% pH 3.5-10 ampholine carrier Ampholytes (BIO-RAD), 2% 52 Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. Nonidet P-40 (NP-40), 1% (3-mercaptoethanol) for 30 seconds. This gives a protein con centration of ~2 mg/ml in the final lysate. The lysates were cleared of nuclei by mi crocentrifugation for 30 seconds, and the supernatant used for analysis. 2D Gels (IEF/SDS-PAGE): Two dimensional IEF/SDS/PAGE was performed basi cally as described by Farrell, et a l, (Farrell, Balkow, et al. 1977), with modifications as described by Duncan and Hershey (Duncan and Hershey 1984) to promote spot focusing. First-D tube gels were polymerized in standard lab supply glass tubing, ~4 mm O.D., to a height of 13.5 cm. A 1.5 cm blank space was left to accommodate sample. The first di mension gel mix contained -9.8 M Urea, 2/3 5-7, 1/3 3.5-10 Ampholine carrier am pholytes (BIO-RAD), 2% (NP-40), 3.5% acrylamide, 5.35% bisacrylamide, polymerized with 1.4 pL TEMED and 2 pL 10% ammonium persulfate/mL. The upper and lower electrode solutions were 50 mM NaOH and 25 mM phosphoric acid respectively. Gels were pre-run for 400-600 V -h with the tubes containing 35 pL of IEF buffer, topped with 50% IEF Buffer (1:1 IEF BuffenEEO). This was then removed, about 50 pL (~2 pg/pl) of sample loaded, overlayed with 3:1 IEF BufferiHhO. The gels were then run for about 16 hours at 800 V. After the run was finished, the gels were extruded from the glass tubes and placed in 5 mL of equilibration buffer (60mM Tris-HCL pH 6 .8 , 2.3% SDS, 5% (3 - mercaptoethanol, 10% glycerol) for 15 minutes. They gels were then either frozen at - 70°C till further use or overlayed onto the second dimension gels. Second Dimension: The sample running methods are as described by O'Farrell (O'Farrell 1975), using the Laemmli formulation buffers, with a few modifications. The second dimensional running gel was (11.0 cm x 13.5 cm x 0.75 mm) with a 1 cm stacking gel overlayed. The running gel was 10.5% acrylamide, the stacking gel 3% acrylamide. 53 Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. The equilibrated first dimension gel was layered upon the stacking gel and sealed in place with hot 1% agarose dissolved in equilibration buffer. Gels were run at 20 mA for about 4 hours, at which time the bromophenol blue tracking dye reached the lower buffer reser voir. Gels were fixed in 5:4:1 methanol:water-.acetic acid, dried onto whatman 3MM pa per and exposed to Kodak X-OMAT film for 4-5 days. 7. Construction of HSP70 Plasmid Expression Vectors All primers (desalted, 0.5 nmoles) were from Operon Technologies, and a list of them can be seen in Figure 2.1. All restriction enzymes were purchased from New England Biolab. The Topo 2.1 vector which is used for ligation of PCR products was purchased from Invitrogen. All plasmids were sequenced by automated DNA sequencing at the USC Norris Cancer Center Microchemical Facility. 7.1 MT301 A founder plasmid was constructed to create all the mutant plasmids. This founder plasmid (MT301) contains a Drosophila metallothionein promoter, precisely fused to the full length HSP70 5’UTR/deleted HSP70 coding body/3’UTR. The HSP70 coding body will be deleted to a 44 kDa form. The metallothionein promoter was incorporated to al low regulated expression at both non-heat shock and heat shock temperatures for com parison of mRNA translation at non-heat shock vs. heat shock conditions. The deletion within the coding region permits separate concurrent assays of transgene and endogenous HSP70 expression. A PCR based strategy will be used to create the mutant plasmids. 54 Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. Reproduced w ith permission o f th e copyright owner. Further reproduction prohibited without permission. DU66: 5 ' - CGTCTACGGAGCGAGAATTCAATTC- 3 ' DU67: 5 ' -GGTGCCCAGATCGATTCCAATAGC-3' DU68: 5 ' -GCTCGCAATTGATTCGTTGCAGGACAGGATGT-3' DU69: 5 ' -CGTTGAATACGTAGCTCTCCAGA-3 ' DU70: 5 ' -GGTGCCCAGATCGATTCCAATAGCAGCCATGGTGTGTGA-3 ' DU71: 5 ' -GCTCGGAATTCTTGAAAAAAATTTCGTA-3' DU72: 5 ' - CGTGCCATGGCTTGTATGTATGTTTTTCGTT- 3 ' DU73: 5 ' -GCTCGGAATTCAATTACAACCGAGACACGTCAATTCAAAAAAGAATTTCAACAAGTTACC-3 ' DU74: 5 ' -GCTCGGAATTCAATTCAAACAAGCACACGTCAATTCAAAAAAGAATTCCAACAAGTTACC- 3 ' DU75: 5 ' -GCTCGGAATTCAATTCAAACAAGCAAAGTGAACACGTCGCCACACACAATGCCTGCTATT-3 ' DU76: 5 ' -GCTCGGAATTCAAAAAAACCAAACCAACTGCTCCCAACTACAATGCCTGCTATTGGAATC-3' DU81: 5 ' -GCAGCCATGGTGTGTGTGTGTTTTGCGACAATCTTGATTTTACACGTTAGCGACGTGTTC-3' DU82: 5 ' -GCAGCCATGGTGTGTGTTATCAAGTGTTGGGACTTTAACTTTTCCGTTAGCGACGTGTTC- 3 ' DU83: 5 ' -GCAGCCATGGCTTGTTTACGACGCACACCGTACGA-3' DU84: 5 ' -GCAGCCATGGCTTGTGGAAATTCACAAAACTTTTC-3' DU85: 5 ' -GCAGCCATGGCTTGTATACAGATATTTTCACTTTG- 3 ' DU86: 5 ' -GCACGGAATTCGCAGCGTCTGAAAAGTTTTG-3 ' DU87: 5 ' - GCACGGAATTCTATACAAAGCAAAGTGAAAA-3 ' DU88: 5 ' - GCACGGAATTCCCTTTATTCTGTGAATAGAA-3 ' DU89: 5 ' -CTCGGAATTCTTGAAAAAAATTTCGTACGGTGTGCGTCGTAACCTTTATTCTGTGAATAG-3 ' U i Lft Figure 2.1: List o f Primers used fo r P C R amplification o f Drosophila H S P 5’UTRs. Plasmid pDm301 contains the Drosophila heat shock promoter precisely fused to nu cleotides 1-242 of the Drosophila HSP70 5’UTR/linked to an internally deleted HSP70 coding region/3’UTR and was constructed by McGarry (McGarry and Lindquist 1985). pDm301 was modified by Hess (Hess and Duncan 1996), to add a single G nucleotide as +1 of the transcript. The addition of the G nucleotide created an EcoRI site at the start of transcription, and had no detectable effect on mRNA translation during heat shock, plas mid was renamed pDm301*. However, during the course of my experiments this plasmid did not work as expected, i.e., it failed to give proper restriction digest patterns and did not express transgene. Therefore, pDM301* was recreated using a different PCR based strategy (described below and in Appendix, A .l) and renamed MT301. Plasmid MT301 differs from pDm301* in only one respect. That is, pDm301* contains the heat shock promoter, which was replaced by the metallothionein promoter in MT301. The Drosophila HSP70 gene encoded by the plasmid pDM301 (McGarry and Lind quist 1985), was used as the PCR amplification target. The upstream 5’ primer (DU-6 6 ), deleted one of the first six nucleotides of the authentic HSP70 5’UTR, and added a 5’ terminal G as the new capping nucleotide, this converted the remainder (+1-+5) nucleo tides to an EcoRI restriction site, which facilitated subsequent plasmid construction, fu ture in vitro transcription studies, and did not impair heat shock. The downstream 3’ primer (DU-67), hybridize slightly beyond the unique Clal site in pDm301*. The PCR amplified sequence will then be digested using EcoRI/Clal enzymes and inserted into the EcoRI/Clal digested pMT-SL17.6 vector (Hess and Duncan, 1996). The recipient pMT- SL17.6 vector contains the Drosophila metallothionein promoter precisely fused to the 56 Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. Drosophila HSP70 5’UTR (but with designed stem loops)/linked to an internally deleted HSP70 coding region/3’UTR (Figure 2.2). The PCR reaction mix contained lng of template pDM301 DNA, 250 nM of each primer, 200 pM dNTPs, 2.5 U of Taq DNA polymerase (Fischer Scientific) and IX PCR buffer (50 mM NaCl, 1.5 mM MgCl2, 10 mM Tris-HCL pH9.0, 0.1% Triton X-100) (Fischer Scientific), in a 50 pL reaction volume. The reaction mixture was then amplified over 22-25 cycles (95°C for 30 sec., 65°C for 1 min., 72°C for 1.5 min.) The PCR reac tion was then run out on a 1% agarose gel, and the PCR product was gel purified (as per manufacturers instructions) by using the GeneClean II Kit (BiolOl). The purified insert was then ligated with the Topo2.1 vector (Invitrogen). In brief, in the ligation reaction, 3 pL of the purified insert was added to a tube alongwith with 1 pL of the linearized Topo 2.1 vector, 10X buffer, 1U of Ligase enzyme, and sterile water in a total reaction volume of 10 pL. The reaction was incubated overnight at 16°C. The next day, the reaction mix ture was used to transform SCS-110 cells (Invitrogen). The transformation was done as follows: 10 pL of the ligation mix was gently pipeted into a 50 pL aliquot of chemically competent SCS-110 cells. The cells were incubated on ice for 30 minutes, and then heat shocked in a water bath at 42°C for exactly 30 seconds. Next, the tubes were placed on ice for 2 minutes to rest, and 200 pL of SOC media was added to them. The tubes were then incubated for 1 hour in a 37°C shaker. After the in cubation was over, a 50 pL and 200 pL aliquot taken out of the tubes and plated directly on LB+Ampicillin (50 pg/mL) plates. The plates were then placed in a 37°C incubator overnight. The next day, individual colonies were selected for further analysis. 57 Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. Figure 2.2 Schematic Representation of the Construction Strategy used in Creating the Parental Plasmid MT301 EcoRI Clal a) PCR amplify " with priraets mi6i and 0089 b) Gel purify ficoRI-Clal fragment Amp pDM301 Topo 2.1 EcoRI insert end Clal EcoRI Clal r) ligate EcpM-CIal fragment with Topo 2,1 vector Amp PMTSL17.6 Clal 301/Topo 2.1 ft Digest PMTSLn.6 with BeoRI/Oal enzymes g) CIPthe digested PMTSl.lid plasmid and gel purify vector EcoRI Clal d) Digest 3 G 1 /Topo 2 i wi* fcoRl't i.-tl enzymes e) Gel purify 242bp insert Amp Clal EcoRI PMTSL17.6 h) ligate the linearized PMTSLl7,b with EeoRI/Cla! insert i) Sew vector M T301 EcoRI Clal Amp MT301 58 Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. Selected colonies were grown in 2 mL of liquid LB+Amp(50 pg/mL) till they reached log phase of growth (usually 8 hours), after which they were used for plasmid prepara tion. Plasmids were prepared (as per manufacturers instructions) using the QIAprep Spin- Column Mini Plasmid Prep Kits (Qiagen). Once we obtained the purified plasmid, we did a digest using the EcoRI and the Clal enzymes to restrict our insert. This insert was then gel purified and ligated with the EcoRI/Clal digested recipient vector. Correctly achieved insertion was verified by sequencing. 7.2 MT306 A PCR based amplification approach was also empolyed to construct MT306. The Drosophila HSP70 gene encoded by the plasmid pDm306 (McGarry and Lindquist, 1985) was used as the PCR amplification target. Plasmid pDm306 contains the Droso phila heat shock promoter precisely fused to nucleotides 1-37, 206-242 of the Drosophila HSP70 5’UTR/linked to an internally deleted HSP70 coding region/3’UTR. The upstream 5’ primer (DU-6 6 ), hybridized to the nucleotides at the start of tran scription in the 5’UTR (also creating an EcoRI site), and the downstream 3’ primer (DU- 69), hybridized slightly beyond the unique SnaBI site in the coding region pDm306*. The PCR amplified sequence o f-1200 nucleotides was then digested using EcoRI/SnaBI en zymes and inserted into the EcoRI/SnaBI digested MT301 parent plasmid (Appendix, A.2). Correctly achieved insertion was verified by sequencing. The resulting plasmid MT306 contained the Drosophila metallothionein promoter precisely fused to nucleotides 1-37, 206-242 of the Drosophila HSP70 5’UTR/linked to an internally deleted HSP70 coding region/3’UTR. 59 Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. 7.3 MT10 Revert We used the MT306 plasmid as the PCR amplification target to construct this vector. The upstream primer used to construct this plasmid retains the first 10 nucleotides of MT306, and then scrambles the nucleotides 11-37, the rest of the 5’UTR nucleotides (206-242) are identical to MT306 (Figure 3.2). The upstream 5’ primer (DU-73), hybrid ized to the EcoRI site at the start of transcription, the downstream 3’ primer (DU-69), hy bridized at the SnaBI site in the coding region. The PCR amplified 5’UTR sequence of -1200 nucleotides was then digested using EcoRI/SnaBI enzymes and inserted into the EcoRI/SnaBI digested MT306 parent plasmid (Appendix, A.3). Correctly achieved inser tion was verified by sequencing. The resulting plasmid MT10 Revert contained the Dro sophila metallothionein promoter precisely fused to nucleotides 1-37 (11-37 scrambled)/ 206-242 of the Drosophila HSP70 5’UTR/linked to an internally deleted HSP70 coding region/3’UTR. The metallothionein promoter was later replaced with the Drosophila ac- tin promoter creating ACT10 Revert. 7.4 MT20 Revert We used the MT306 plasmid as the PCR amplification target to construct this vector. The upstream primer used to construct this plasmid retains the first 20 nucleotides of MT306, and then scrambles the nucleotides 21-37, the rest of the 5’UTR nucleotides (206-242) are identical to MT306 (Figure 3.2). The upstream 5’ primer (DU-74), hybrid ized to the EcoRI site at the start of transcription, the downstream 3’ primer (DU-69), hy bridized at the SnaBI site in the coding region. The PCR amplified 5’UTR sequence of -1200 nucleotides was then digested using EcoRI/SnaBI enzymes and inserted into the 60 Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. EcoRI/SnaBI digested MT306 parent plasmid (Appendix, A.4). Correctly achieved inser tion was verified by sequencing. The resulting plasmid MT20 Revert contained the Dro sophila metallothionein promoter precisely fused to nucleotides 1-37 (21-37 scrambled)/ 206-242 of the Drosophila HSP70 5’UTR/linked to an internally deleted HSP70 coding region/3’UTR. 7.5 Short70 We used the MT306 plasmid as the PCR amplification target to construct this vector. The upstream primer used to construct this plasmid retains the first 35 nucleotides of MT306, and then adds nucleotides 235-242 of the 5’UTR (keeps AUG in context) (Fig ure 3.2). The upstream 5’ primer (DU-75), hybridized to the EcoRI site at the start of transcription, the downstream 3’ primer (DU-69), hybridized at the SnaBI site in the coding region. The PCR amplified 5’UTR sequence of -1200 nucleotides was then di gested using EcoRI/SnaBI enzymes and inserted into the EcoRI/SnaBI digested MT306 parent plasmid (Appendix, A.5). Correctly achieved insertion was verified by sequencing. The resulting plasmid Short70, contained the Drosophila metallothionein promoter pre cisely fused to nucleotides 1-35/235-242 of the Drosophila HSP70 5’UTR/linked to an internally deleted HSP70 coding region/3’UTR. 7.6 MT22 plasmid We used the MT306 plasmid as the PCR amplification target to construct this vector. The upstream primer used to construct this plasmid retains the first 30 nucleotides of the Hultmark HSP22 construct (+1-+6 are modified to create an EcoRI site), and then adds the authentic 7 nucleotides which are AUG proximal in the Drosophila HSP22 5’ UTR, 61 Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. linked to nucleotides 1-18 of the HSP70 coding region. The upstream 5’ primer (DU-76), hybridized to the EcoRI site at the start of transcription, the downstream 3’ primer (DU- 69), hybridized at the SnaBI site in the coding region. The PCR amplified 5’UTR se quence o f-1200 nucleotides was then digested using EcoRI/SnaBI enzymes and inserted into the EcoRI/SnaBI digested MT306 parent plasmid (Appendix, A.6 ). Correctly achieved insertion was verified by sequencing. The resulting plasmid MT22 contained the Drosophila metallothionein promoter precisely fused to nucleotides 1-37 (of the Dro sophila HSP22)/linked to an internally deleted HSP70 coding region/3’UTR. 7.7 Scrambled #81 We used the MT306 plasmid as the PCR amplification target to construct this vector. In the first step, an upstream primer (DU-6 8 ) introduced an Mfel site at the start of the metallothionein promoter in MT306, and a downstream primer (DU-70) mutates the AUG into an Ncol site. We now have an intermediate MT306-Nco plasmid (Appendix, A.7), that could be used to build Scrambled #81. In the next step, an 5’ upstream primer (DU-6 8 ) hybridized to the start of the metallothionein promoter, and a downstream primer (DU-81) is used to scramble nucleotides 206-235 of MT306, nucleotides 236-242 were retained as in the MT306-Nco construct. The PCR amplified 5’UTR sequence of -400 nucleotides was then digested using Mfel/Ncol enzymes and inserted into the Mfel/Ncol digested MT306-Nco parent plasmid (Appendix, A.8). Correctly achieved in sertion was verified by sequencing. The resulting plasmid Scrambled #81 contained the Drosophila metallothionein promoter precisely fused to nucleotides 1-37/206-242 (206- 235 are scrambled) of the Drosophila HSP70 5’UTR/linked to an internally deleted 62 Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. HSP70 coding region/3’UTR. A second construct called ActScrambled #81 was later cre ated, in which the metallothionein promoter was replaced by the Drosophila actin pro moter. 7.8 Scrambled #82 We used the MT306 plasmid as the PCR amplification target to construct this vector. In the first step, an upstream primer (DU-6 8 ) introduced an Mfel site at the start of the metallothionein promoter in MT306, and a downstream primer (DU-70) mutates the AUG into an Ncol site. We now had an intermediate MT306-Nco plasmid (Appendix, A.7), that could be used to build Scrambled #82. In the next step, an 5’ upstream primer (DU-6 8 ) hybridized to the start of the metallothionein promoter, and a downstream primer (DU-82) is used to scramble nucleotides 206-235 of MT306, nucleotides 236-242 were retained as in the MT306-Nco construct. The PCR amplified 5’UTR sequence of -400 nucleotides was then digested using Mfel/Ncol enzymes and inserted into the Mfel/Ncol digested MT306-Nco parent plasmid (Appendix, A.9). Correctly achieved in sertion was verified by sequencing. The resulting plasmid Scrambled #82 contained the Drosophila metallothionein promoter precisely fused to nucleotides 1-37/206-242 (206- 235 are scrambled) of the Drosophila HSP70 5’UTR/linked to an internally deleted HSP70 coding region/3’UTR. A second construct called ActScrambled #81 was later cre ated, in which the metallothionein promoter was replaced by the Drosophila actin pro moter. 63 Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. 8. Construction of HSP90 Plasmid Expression Vectors 8.1 MT90 The specific strategy that I will attempt will be as follows. A founder plasmid will be used to create all the mutant plasmids. This founder plasmid (MT90) will contain a Dro sophila metallothionein promoter, precisely fused to the full length HSP90 5’UTR/ HSP70 coding body/ HSP70 3’UTR. The HSP70 coding body will be deleted to a 44 kDa form. A PCR based strategy was used to create the mutant plasmids. The Drosophila HSP90 gene encoded by the plasmid pDm83 (gift of Dr. H. Lip- schitz) was used as the PCR amplification target. An upstream 5’ primer (DU-71), intro duced an EcoRI restriction site at the start of transcription, which facilitated subsequent plasmid construction, and did not impair heat shock. The downstream 3’ primer (DU- 726), hybridized slightly beyond the start of translation and by mutating two nucleotides created an Ncol site at the AUG (maintains AUG in context). The PCR amplified se quence (-200 bp) was then ligated into the Topo 2.1 vector. From here the insert was then digested using EcoRI/NcoI enzymes and inserted into the EcoRI/NcoI digested MT306-Nco vector (Appendix, A. 10). The new MT90 vector contains the Drosophila metallothionein promoter precisely fused to the Drosophila full length HSP90 5’UTR/linked to an internally deleted HSP70 coding region/HSP70 3’UTR. 8.2 MT86 We used the MT90 plasmid as the PCR amplification target to construct this vector. The 5’ upstream primer (DU-8 6 ) hybridized at the EcoRI site at the start of transcription in MT90, and was designed to delete -40 cap proximal nucleotides of the HSP90 5’UTR, 64 Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. the downstream primer (DU-69) hybridized at the unique SnaBI site in the coding region. The PCR amplified 5’UTR sequence of ~1160 nucleotides was then digested using EcoRI/SnaBI enzymes and inserted into the EcoRI/SnaBI digested MT90 parent plasmid (Appendix, A .ll). Correctly achieved insertion was verified by sequencing. The resulting plasmid MT8 6 contained the Drosophila metallothionein promoter precisely fused to nu cleotides 1-6/45-155 (7-44 are deleted) of the Drosophila HSP90 5’UTR/linked to an in ternally deleted HSP70 coding region/HSP70 3’UTR. 8.3 MT87 We used the MT90 plasmid as the PCR amplification target to construct this vector. The 5’ upstream primer (DU-87) hybridized at the EcoRI site at the start of transcription in MT90, and was designed to delete -70 cap proximal nucleotides of the HSP90 5’UTR, the downstream primer (DU-69) hybridized at the unique SnaBI site in the coding region. The PCR amplified 5’UTR sequence of -1130 nucleotides was then digested using EcoRI/SnaBI enzymes and inserted into the EcoRI/SnaBI digested MT90 parent plasmid (Appendix, A. 12). Correctly achieved insertion was verified by sequencing. The resulting plasmid MT8 6 contained the Drosophila metallothionein promoter precisely fused to nu cleotides 1-6/79-155 (7-78 are deleted) of the Drosophila HSP90 5’UTR/linked to an in ternally deleted HSP70 coding region/HSP70 3’UTR. 8.4 MT88 We used the MT90 plasmid as the PCR amplification target to construct this vector. The 5’ upstream primer (DU-8 8 ) hybridized at the EcoRI site at the start of transcription in MT90, and was designed to delete -100 cap proximal nucleotides of the HSP90 65 Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. 5’UTR, the downstream primer (DU-69) hybridized at the unique SnaBI site in the cod ing region. The PCR amplified 5’UTR sequence of -1100 nucleotides was then digested using EcoRr/SnaBI enzymes and inserted into the EcoRI/SnaBI digested MT90 parent plasmid (Appendix, A. 13). Correctly achieved insertion was verified by sequencing. The resulting plasmid MT8 6 contained the Drosophila metallothionein promoter precisely fused to nucleotides 1-6/115-155 (7-114 are deleted) of the Drosophila HSP90 5’UTR/linked to an internally deleted HSP70 coding region/HSP70 3’UTR. 8.5 MT89 We used the MT90 plasmid as the PCR amplification target to construct this vector. The 5’ upstream primer (DU-89) hybridized at the EcoRI site at the start of transcription in MT90, and was designed to anneal to nucleotides 1-39, delete nucleotides 40-115, and then to re-hybridize to nucleotides 110-127 of the HSP90 5’UTR (total nucl. deleted -80). The downstream primer (DU-69) hybridized at the unique SnaBI site in the coding region. The PCR amplified 5’UTR sequence of ~1120 nucleotides was then digested us ing EcoRI/SnaBI enzymes and inserted into the EcoRI/SnaBI digested MT90 parent plasmid (Appendix, A. 14). Correctly achieved insertion was verified by sequencing. The resulting plasmid MT8 6 contained the Drosophila metallothionein promoter precisely fused to nucleotides 1-39/116-155 (40-115 are deleted) of the Drosophila HSP90 5’UTR/linked to an internally deleted HSP70 coding region/HSP70 3’UTR. 8.6 MT83 We used the MT90 plasmid as the PCR amplification target to construct this vector. The 5’ upstream primer (DU-6 8 ) hybridized at the Mfel site at the start of the metal- 66 Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. lothionein promoter in MT90, the downstream primer (DU-83) hybridized at the Ncol site at the start of translation, and was designed to delete -110 AUG proximal nucleotides of the HSP90 5’UTR. The PCR amplified 5’UTR sequence o f-300 nucleotides was then digested using Mfel/Ncol enzymes and inserted into the Mfel/Ncol digested MT90 par ent plasmid (Appendix, A.l 5). Correctly achieved insertion was verified by sequencing. The resulting plasmid MT83 contained the Drosophila metallothionein promoter pre cisely fused to nucleotides 1-38/149-155 (39-148 are deleted) of the Drosophila HSP90 5’UTR/linked to an internally deleted HSP70 coding region/HSP70 3’UTR. 8.7 MT84 We used the MT90 plasmid as the PCR amplification target to construct this vector. The 5’ upstream primer (DU-6 8 ) hybridized at the Mfel site at the start of the metal lothionein promoter in MT90, the downstream primer (DU-84) hybridized at the Ncol site at the start of translation, and was designed to delete -80 AUG proximal nucleotides of the HSP90 5’UTR. The PCR amplified 5’UTR sequence o f-320 nucleotides was then digested using Mfel/Ncol enzymes and inserted into the Mfel/Ncol digested MT90 par ent plasmid (Appendix, A .l6 ). Correctly achieved insertion was verified by sequencing. The resulting plasmid MT84 contained the Drosophila metallothionein promoter pre cisely fused to nucleotides 1-73/149-155 (74-148 are deleted) of the Drosophila HSP90 5’UTR/linked to an internally deleted HSP70 coding region/HSP70 3’UTR. 8.8 MT85 We used the MT90 plasmid as the PCR amplification target to construct this vector. The 5’ upstream primer (DU-6 8 ) hybridized at the Mfel site at the start of the metal- 67 Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. lothionein promoter in MT90, the downstream primer (DU-85) hybridized at the Ncol site at the start of translation, and was designed to delete -40 AUG proximal nucleotides of the HSP90 5’UTR. The PCR amplified 5’UTR sequence of -360 nucleotides was then digested using Mfel/Ncol enzymes and inserted into the Mfel/Ncol digested MT90 par ent plasmid (Appendix, A. 17). Correctly achieved insertion was verified by sequencing. The resulting plasmid MT85 contained the Drosophila metallothionein promoter pre cisely fused to nucleotides 1-107/149-155 (108-148 are deleted) of the Drosophila HSP90 5’UTR/linked to an internally deleted HSP70 coding region/HSP70 3’UTR. 9. Cell Culture & Transfection Experiments D.melanogaster Schneider SL2 cells were cultured at 22-23°C in Schneider’s Droso phila Medium (Invitrogen, Inc) containing 10% fetal calf serum, 20 mM L-glutamine, 100 units/mL penicillin, 0.1 mg/mL streptomycin, 0.25 mg/mL amophotericin B (Invitro gen). Twenty four hours prior to transfection the cells were seeded at a density of 1-1.5 x 106 /mL in a T25 flask (Coming). Cells were transfected by the calcium phosphate DNA precipitation method. Ten micrograms (pg) of purified plasmid DNA was mixed with 250 microliters (pL) of 0.5M CaCl2 in a total volume of 500 pL in a 1.5 mL eppendorf tube (Axygen). The CaCl2 -DNA complex was then added in a dropwise fashion to 500 pL of 2X HEPES-buffered saline (280 mM NaCl, lOmM KCL, 1.5 mM Na2 P 0 4.2H20, and 50 mM HEPES), as we simultaneously bubbled the HEPES solution. The mixture was then incubated at room temperature for 15 minutes. After incubation, the CaCl2- DNA-HEPES mixture was added slowly to the cells in the T25 flask, and the flask was gently rocked to mix the medium, which became turbid. The calcium supplemented me- 68 Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. dia was removed 16-18 hours post transfection, and replaced with fresh Schneider’s Me dia with 10% PCS. Cells were then allowed to recover, and harvested 48-72 hours post transfection for further analysis. These subsequent analyses included western blots, TCA precipitation assays, (3-Gal assays, Bradford assays, 1D and 2D Gel analysis, and north ern blots. 10. Trichloroacetic Acid (TCA) Precipitation Assay Radioactivity of labeled protein samples and probes was quantitated using the TCA assay. In a glass test tube (13 x 100 mm) we added 1 mL of water, a couple of drops of 5% non-fat milk (Carnation) solution (or 200 jxg/mL of denatured salmon sperm DNA for analysis of DNA samples), and 300 pL of 30% TCA Acid (VWR Scientific). The test tube was briefly vortexed and then placed on ice for 10 minutes. At the end of the incu bation, the solution was poured over Whatman GF/A filters (VWR Scientific) that had been placed in a manifold, the filters were then rinsed 2X with 5% TCA Acid solution and 1X with sterile water. After the rinsing, the filters were removed and placed under a heat lamp for 20 minutes for drying. Once dry, the filters were placed in 10 mL scintilla tion vials containing 2 mL of scintillation fluid (0.34% PPO, 0.003% POPOP dissolved in toluene), and radioactivity was counted by direct scintillation counting (in c.p.m) in a Beckman scintillation counter. 11. Bradford Assay The protein concentration of samples was quantified using the Bradford assay (Bio- Rad) as per manufacturer’s instructions. In brief, the 4X Bradford assay reagent was di luted with water to give a IX concentration, and 1 mL of this solution was aliquoted into 69 Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. glass tubes (13 x 100 mm, VWR). To each tube, BSA (1 mg/mL) was added at increasing concentrations (typically 0-16 mg/mL) to give a standard curve. An aliquot of 2 jil from each of the protein samples was then added to a glass test tube with 1 mL of IX reagent (no BSA) and concentration of the sample measured against the standards. 12. P-Gal Assay An aliquot of ~1 X 106 cells was removed from transfected flasks, and cells were pelleted by brief centrifugation (1 minute, 4000 rpm). They were resuspended in 1 mL of wash buffer (100 mM KCL, 0.4 mM M gS0 4 .7H20 , 0.7 mM CaCl2, 0.3 mM KH2 P 0 4, 10 mM dextrose, 20 mM HEPES) and centrifuged again for 1 minute at 4000 rpm. The cell pellets were then lysed in 250 |iL of lysis buffer (65 mM KOAc, 0.5 mM MgOAc, 1M HEPES pH 7.2, 0.5% TX-100). The Bradford assay (BioRad) was performed to estimate the protein concentrations in the cell lysates (typically 2.5 p,g/pL). An aliquot of the sam ple is then transferred to a microtiter plate (Falcon 3911) containing 50 pL of 4 mg/mL O-nitrophenyl p-D-galactopyranoside (ONPG) solution (Sigma-Aldrich), and incubated for 30 minutes-2 hours at 37°C. Optical density readings were taken at 405 nm in a plate reader to measure P-Gal activity. Typically, untransfected cells gave no quantifiable O.D (<0.010 A4 0 5 ). 13. Sucrose Density Gradient Analysis Preparation of Cell Lysates: Cells from a T75 flask (~7.5xl07 cells) were pelleted by brief centrifugation in a low speed (clinical) centrifuge. The pellets were washed several times (3X) with 4°C wash buffer (50 mM KCL, 15 mM M gS0 4 .7H20 , 4 mM CaCl2, 3 70 Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. mM KH2PO4, 10 mM dextrose, 8.4 mM HEPES, and 20 pg/mL cycloheximide) for -50 seconds each. The cell pellets were then lysed in 4°C polysome buffer (125 mM KCL, 12.5 mM MgC12, 25 mM EGTA, 10 mM HEPES pH 6 .8 , 1 mM DTT, 10% Triton X- 100, 10 mg/mL cycloheximide) by homogenization. Nuclei and cell debris were removed by centrifugation for 30 seconds in a microfuge, and the supernatants layered on top of 20-45% sucrose gradients (mass/volume). Gradients were centrifuged for 1.75 hours at 36000 rpm, 4°C, in an SW41 rotor. After centrifugation the gradients were fractionated into fifteen 1 mL fractions (Gilson peristaltic pump, speed 425, 20 seconds for each frac tion), and RNA was extracted from each fraction as described below. Preparation of RNA Samples: RNA was extracted from the sucrose density gradient fractions by using a single step guanidium isothiocyanate method (Chomczynski and Sacchi 1987) with modifications. In a 1.5 mL eppendorf tube, 350 pL of extraction buffer (4M guanidium thiocyanate, 25 mM sodium citrate pH 7.0, 0.5% sarkosyl, 0.1M 2- mercaptoethanol) was added to an equal amount of sample. Then, phenol-chloroform- isopropanol (25:24:1) were added sequentially to the lysate, with thorough mixing by in version after adding each reagent. The final mixture was shaken vigorously and placed on ice for 5 minutes. After incubation, the tubes were microfuged for 15 minutes at 14000 rpm, and the upper aqueous phase was transferred to a fresh tube. RNA was precipitated with 1/10X of 3M sodium acetate pH 4.0, and equal volume of isopropanol for 1 hour at - 20°C, after which the tubes were centrifuged again for 15 minutes at 14000 rpm. The RNA pellet was resuspended in 10 pL of DEPC treated distilled water. Gel Electrophoresis and Northern Blots: 5 pL of the RNA samples were electropho- resed in 1.25% formaldehyde-agarose denaturing gels. After electrophoresis, samples 71 Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. were then transferred from gel to nylon membranes, hybridized to probes, washed, dried, exposed to film and the RNA bands quantitated as decribed in earlier sections. 72 Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. III. The Preferential Translation of HSP70 mRNA 1. Identification of the sequence elements in HSP70 mRNA that confer preferential translation. A major obstacle in identifying the critical features or sequence elements in HSP70 mRNA that confer preferential translation is the demonstrated redundancy in the leader. That is, segments from anywhere in the leader can be deleted and still preferential trans lation is retained. Consequently, we first established a shortened 5’ UTR in which most or all of the redundancy is removed, while still retaining a minimal active element. I use the terminology “active” to refer to a 5’UTR that promotes preferential translation >50% as compared to full length HSP70 5’UTR plasmid MT301 (see Materials and Methods). Plasmid pDm306 is a plasmid that was first constructed in Dr. Susan Lindquist’s labora tory (McGarry and Lindquist 1985), and it contains the Drosophila heat shock promoter linked to nucleotides 1-37/ linked to nucleotides 206-242 of the Drosophila HSP70 5’UTR/linked to an internally deleted HSP70 coding region/3’UTR, and translated -40% relative to the wild type HSP70 plasmid. The parent construct (MT306) that I created for my studies follows the Lindquist con struct, however, MT306 has a different promoter and a modified start of transcription. MT306 contains a Drosophila metallothionein promoter, which allowed regulated ex pression at both non-heat shock and heat shock temperatures for comparison of mRNA translation at non-heat shock vs. heat shock conditions. The plasmid MT306 also has a single 5’ terminal G nucleotide added, as the new capping nucleotide, which converts the remainder +2-+6 nucleotides of the 5’UTR to an EcoRI site. This conversion of the first six nucleotides to an EcoRI site (which significantly simplified subsequent plasmid con- 73 Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. struction) did not increase translation at heat shock, compare translation of MT306 to a control plasmid with a full length HSP70 5’UTR called MT301 (Figure 3.1). In addition, it appears that the deletion of nucleotides 38-205 of the HSP70 5’UTR did not signifi cantly affect the translation of MT306 during heat shock and the average translation of MT306 during heat shock is -77%, as compared to MT301 (Figure 3.1, where MT301 is normalized to 100%). Therefore, this parent plasmid MT306 contained a minimal 5’UTR that was active at heat shock. This is the original plasmid that was used to create all the subsequent plasmids that I did mutagenesis analysis on to determine the features that con fer preferential translation. 2. Sequence elements located within the first 20 nucleotides of the HSP70 5’UTR can confer preferential translation. Presented below are the nucleotides sequences of four 5’UTRs. The first shows a se quence based upon the 5’UTR of a plasmid created by Lindquist and Petersen, to investi gate preferential translation of HSP70 mRNA (Lindquist and Petersen 1990). They took the first 50 nucleotides of the HSP70 5’ UTR and scrambled their order while retaining the base composition. This plasmid’s mRNA failed to translate during heat shock. Thus, sequence #1, which contains nucleotides 1-52/ linked to 206-242 of the Drosophila HSP70 5’UTR, contains no sequence elements sufficient to confer preferential transla tion. The MT306 sequence (#2) is the truncated 5’UTR, which promotes efficient trans lation during heat shock. Plasmid MT306 contains the nucleotides 1-37/ linked to 206- 242 (the slash shows the junction) of the Drosophila HSP70 5’UTR, and contains se quence elements sufficient to confer preferential translation. 74 Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. Figure 3.1: Construction and analysis of plasmid MT306. (A) Schematic representation of the differences in the 5’UTRs of plasmid MT301 (full length HSP70 5’UTR) and plasmid MT306 (truncated HSP70 5’UTR). (B) Translation of MT306 and MT301 during heat shock. Drosophila S2 cells were transfected with the plasmids using calcium phosphate method. Forty eight hours post transfection cells were treated with CuS04 for 3 h to induce transgene expression. Half of each culture was then heat shocked at 37°C for 30 min. Cells were pulse-labeled with [35S] methionine for 15 minutes (at both 24 and 37°C). Protein samples (from both 24 and 37°C) were prepared and analyzed by IEF/SDS-PAGE as described (see Materials and Methods). Translation of the transgenes during heat shock was calculated as the amount of protein synthesized at heat shock (3 5 S c.p.m of the transgene spot in 2D gels), divided by amount of protein synthesized at room temperature (3 5 S c.p.m of the transgene spot in 2D gels). The experiment was repeated 5 times and the averaged results are reported. The values for both mRNAs are normalized to 1 . (A) 5’ UTR HSP70 Coding Region 3’ UTR MT301 mRNA MT301 MT306 T ran slation o f p lasm id MT306 during H eat S h o c k ■ Heat Shock 37'C; MT306 MT301 Plasmid Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. Scrambled Sequence (#1): CAGCAACGAGA CAACCGAGAC ACGTCAATTC AAAAAAGAAATACGACTAAA/TTTCA - ACACA CAATG MT306 Sequence (#2): GAATrC&ATT CAA&CAAGCA AAGTGAAt'AC (JTrG C TA A G /TTTCA - ACACA CAATG * * ■ * * * * * * * * -k k k k k k k k k MT10 Revert (#3): GAATTCAATT CAACCGAGAC ACGTCAATTC AAAAAAGAA/TTTCA - ACACA CAATG MT2Q Revert (#4): GAATTC&AfT CAA^C^AG(S|| ACGTCAATTC AAAAAAGAA/TTTCA - ACACA CAATG From the aligned sequences (#1 and #2) it can be seen that there are some differences between the scrambled sequence and MT306. However, we can infer from the previously discussed results of MT306 that a deletion of nucleotides 38-52 from MT306 5’UTR (nucl. present in Scrambled Sequence #1) did not increase heat shock translation. Like wise, the conversion of the first six nucleotides (highlighted in MT306 sequence #2) to an EcoRI site also did not increase translation. Therefore, only the differences in the re maining nucleotides convert a heat shock translation promoting 5’UTR (MT306) to one that fails to promote (scrambled sequence). It can be determined from the above aligned sequences #1 and #2 that there are only 19 nucleotides (after the EcoRI site nucleotides) that are actually different (marked by asterisk and highlighted). Therefore, somewhere within these few nucleotide differences lies the key to heat shock preferential translation. Consequently, the first goal was to recreate nucleotides 1-10 of the scrambled se quence plasmid (a plasmid that does not translate) to resemble their counterparts in MT306 (a plasmid that translates) (Figure 3.2). These 10 nucleotides were then followed by nucleotides 11-37 of scrambled sequence, while the remaining nucleotides 206-242 were the same as in MT306 (see above aligned sequence #3, MT10 Revert). Although the 76 Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. Figure 3.2: Schematic representation of the different test 5’UTRs that were constructed to identify sequence elements. A PCR based strategy was used to construct the plasmids (see Materials and Methods), and all nucleotide sequences were verified by DNA sequen cing. Scram bled Sequence (does not translate) M T 306 (translates like H SP 70w t) M T 10R (N ucl. 1-10 changed with counterparts from M T 306) M T 20R (N ucl. 1-20 changed w ith counterparts from M T 306) Short70 (nucleotides 206- 235 have been deleted) Scram bled #81 (nucleotides 206 -2 3 7 are different) Scram bled #82 (nucleotides 2 0 6 -2 3 7 are different) 77 Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. modifications made in creating MT10 Revert (a three nucleotide change, highlighted in sequence #3) were minimal, this construct translated poorly at best (data not shown). However, this plasmid also failed to translate at normal growth temperatures, which im plies a problem with the plasmid’s translation capacity in general. Northern analysis showed that there was RNA present and sequence data analysis of the 5’UTR did not show any errors which could lead to a block in translation. Therefore, there was no obvi ous explanation as to why there should be no protein expressed at normal growth tem perature. In order to bypass this problem, a second construct was created called ActlO Revert. This plasmid was identical to MT10 Revert except that the metallothionein pro moter was replaced by the Drosophila Actin promoter. However, this change also did not make any difference, as the plasmid’s mRNA still translated very poorly at both normal growth temperature and heat shock. The average translation of ActlO Revert mRNA during heat shock was -14% of the control MT306 (Figure 3.3). In another plasmid I swapped nucleotides 1-20 of the scrambled Sequence #1, with their counterparts in the MT306 plasmid (Figure 3.2). Nucleotides 21-37 were retained the same as in the original scrambled sequence, and the remaining nucleotides 206-242 were the same as in MT306. The change of nucleotides 1-21 significantly boosted trans lation during heat shock. As can be seen in (Figure 3.4), the average translation of MT20 Revert was -98% as compared to the translation of MT306 during heat shock. Therefore, this small group of nucleotide changes significantly affected the rate of translation during heat shock. Once it had been determined that nucleotides 1-20 were important in restoring trans lation, the next objective was to identify if these nucleotides were enough to restore 78 Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. Figure 3.3: The Translation of HSP70 mutant plasmid ACTIO Revert vs. MT306 during Heat Shock. Drosophila S2 cells were transfected with the plasmids using calcium phosphate method. Forty eight hours post transfection cells were treated with CuS04 for 3 h to induce transgene expression. Half of each culture was then heat shocked at 37°C for 30 min. Cells were pulse-labeled with [3 5 S] methionine for 15 minutes (at both 24 and 37°C). Protein samples (from both 24 and 37°C) were prepared and analyzed by IEF/SDS-PAGE as described (see Materials and Methods). Translation of the transgenes during heat shock was calculated as the amount of protein synthesized at heat shock (3 5 S c.p.m of the transgene spot in 2D gels), divided by amount of protein synthesized at room temperature (3 5 S c.p.m of the transgene spot in 2D gels). The experiment was repeated 3 times and the averaged results are reported. The values for both mRNAs are normalized to 1. Translation of plasmid ACT10 Revert during Heat Shock 1.4 | B H eat Shock 37°C MT306 ACT10 Revert Plasmid 79 Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. Figure 3.4: The Translation of HSP70 mutant plasmid MT20 Revert vs. MT306 during Heat Shock. Drosophila S2 cells were transfected with the plasmids using calcium phosphate method. Forty eight hours post transfection cells were treated with CuS04 for 3 h to induce transgene expression. Half of each culture was then heat shocked at 37°C for 30 min. Cells were pulse-labeled with [3 5 S] methionine for 15 minutes (at both 24 and 37°C). Protein samples (from both 24 and 37°C) were prepared and analyzed by IEF/SDS-PAGE as described (see Materials and Methods). Translation of the transgenes during heat shock was calculated as the amount of protein synthesized at heat shock (3 5 S c.p.m of the transgene spot in 2D gels), divided by amount of protein synthesized at room temperature (3 5 S c.p.m of the transgene spot in 2D gels). The experiment was repeated 5 times and the averaged results are reported. The values for both mRNAs are normalized to 1. Translation of plasmid MT20 Revert during Heat Shock ■ Heat Shock 37°C MT20 Revert MT306 P lasm id 80 Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. translation at heat shock. A plasmid had already been constructed in our lab with a mini mal 5’UTR that contained only nucleotides 1-37 of the HSP70 5’UTR (Hess and Duncan 1996), but had failed to translate during heat shock. One possible explanation for this finding could be that the AUG was not in good context. Therefore, I recreated this plas mid using a different strategy (see Materials and Methods). The Short70 construct retains nucleotides 1-37/linked to nucleotides 235-242 of MT306 5’UTR (Figure 3.2). Nucleo tides 1-20 are the important ones, nucleotides 21-37 are retained since they appear to be redundant and have no effect in translation of MT20 Revert, and nucleotides 235-242 are retained so that the initiator AUG context does not become a variable. This truncated plasmid translated well during normal growth temperature, but the av erage translation of Short70 during heat shock was very poor, -6% as compared to the translation of MT306 (Figure 3.5). Therefore, the deletion of nucleotides 206-234 had a deleterious effect on the Short70’s ability to translate during heat shock. 3. Truncations in the 5’UTR of Drosophila HSP22 leads to a decrease in heat shock preferential translation. The results obtained for Short70 were inconsistent with the observation that the Dro sophila HSP22 5’UTR deletion mutant, which retained only -37 nucleotides, confered good preferential translation during heat shock (Hultmark, Klemenz, et al. 1986). There fore, I re-examined HSP22 (nucleotides +1-+37 construct) to independently verify previ ous observations and to compare it with the results we obtained for Short70. The plasmid MT22 contains nucleotides +1-+37 of the Hultmark HSP22 construct (under the control of the metallothionein promoter), linked to the HSP70 coding region/ HSP70 3’ UTR 81 Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. Figure 3.5: The Translation of HSP70 mutant plasmid Short70 vs. MT306 during Heat Shock. Drosophila S2 cells were transfected with the plasmids using calcium phosphate method. Forty eight hours post transfection cells were treated with CuS04 for 3 h to induce transgene expression. Half of each culture was then heat shocked at 37°C for 30 min. Cells were pulse-labeled with [3 5 S] methionine for 15 minutes (at both 24 and 37°C). Protein samples (from both 24 and 37°C) were prepared and analyzed by IEF/SDS-PAGE as described (see Materials and Methods). Translation of the transgenes during heat shock was calculated as the amount of protein synthesized at heat shock (3 5 S c.p.m of the transgene spot in 2D gels), divided by amount of protein synthesized at room temperature (3 5 S c.p.m of the transgene spot in 2D gels). The experiment was repeated 6 times and the averaged results are reported. The values for both mRNAs are normalized to 1. An * denotes significance of P < 0.05 (using a standard t-Test: Paired two sample for means). Translation of plasmid ShortTO during Heat Shock [■H eat Shock 37°C Short70 MT306 Plasm id 82 Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. (Figure 3.6). The MT22 construct translated well during normal temperatures, but con trary to published results, it translated poorly at heat shock temperatures -20% as com pared to MT306. Although this result is conflicting with the results of Hultmark, et al., (they showed that the truncated plasmid translated close to wild type levels), it is more consistent with what we observed for Short70 (Figure 3.7). That is, both plasmids (Short70 and MT22) are able to translate at normal growth temperature but fail to do so during heat shock. 4. The organization of nucleotides (+206 to +242) in the 5’UTR of Drosophila HSP70 is also necessary for heat shock preferential translation. The results obtained for MT306 and MT20 Revert indicate that the plasmids which contained nucleotides +206-+242 translated significantly better during heat shock as compared to truncated plasmids, such as Short70. This could mean that length is the prin cipal reason why plasmid MT306 (+1 -+37/+206-+242) translates so much better than Short70 (+1-+37). Therefore a complementary series of experiments was performed to determine whether nucleotides in the +206-+242 segment are critical. To test this, two constructs were created in which 30 nucleotides of an A-rich scrambled order sequence (i.e., randomizations of +206-+235) were added after nucleotide +37, and the resultant plasmids were called Scrambled #81 and Scrambled #82 (Figure 3.2). These two plas mids translated well during normal temperatures (average translation of Scrambled #81 is -66%, and the average translation of Scrambled #82 is -73% of MT301, data not shown). However, both Scrambled #81 and Scrambled #82 translated poorly during heat shock, i.e., average translation of Scrambled #81 is -18% (Figure 3.8), and average translation 83 Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. Figure 3.6: Construction and analysis of Drosophila MT22 - transgene with a truncated HSP22 5’UTR.. (A) Schematic representation of the difference in the Drosophila HSP70 transgene with the HSP70 5’UTR (MT306) and the Drosophila HSP70 transgene with the HSP22 5’UTR (MT22). (B) The Translation of mutant plasmid MT22 vs. MT306 during Heat Shock. Drosophila S2 cells were transfected with the plasmids using calcium phosphate method. Forty eight hours post transfection cells were treated with CuS04 for 3 h to induce transgene expression. Half of each culture was then heat shocked at 37°C for 30 min. Cells were pulse-labeled with [3 5 S] methionine for 15 minutes (at both 24 and 37°C). Protein samples (from both 24 and 37°C) were prepared and analyzed by IEF/SDS-PAGE as described (see Materials and Methods). Translation of the transgenes during heat shock was calculated as the amount of protein synthesized at heat shock (3 5 S c.p.m of the transgene spot in 2D gels), divided by amount of protein synthesized at room temperature (3 5 S c.p.m of the transgene spot in 2D gels). The experiment was repeated 2 times and the averaged results are reported. The values for both mRNAs are normalized to 1. An * denotes significance of P < 0.05 (using a standard t-Test: Paired two sample for means). (A) Metallothionein HSP70 Coding Region HSP70 3’ UTR Promoter ! HSP70M T 3 i Metallothionein Promoter 1 MT22 HSP22 5’ UTR I (B) Translation of plasmid MT22 during Heat Shock ;n H e a t Shock 37°C! MT306 MT22 P lasm id 84 Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. Figure 3.7: Comparing the Translation of Drosophila Short70 vs. Drosophila MT22. Graph shows a comparison of the average translation of Short70 (HSP70 5’UTR, nucl. 1- 37), vs. MT22 (HSP22 5’UTR, nucl. 1-37), and MT306 (HSP70 5’UTR, nucl. 1-242) at heat shock. Drosophila S2 cells were transfected with the plasmids using calcium phosphate method. Forty eight hours post transfection cells were treated with CuS04 for 3 h to induce transgene expression. Half of each culture was then heat shocked at 37°C for 30 min. Cells were pulse-labeled with [3 5 S] methionine for 15 minutes (at both 24 and 37°C). Protein samples (from both 24 and 37°C) were prepared and analyzed by IEF/SDS-PAGE as described (see Materials and Methods). Translation of the transgenes during heat shock was calculated as the amount of protein synthesized at heat shock (3 5 S c.p.m of the transgene spot in 2D gels), divided by amount of protein synthesized at room temperature (3 5 S c.p.m of the transgene spot in 2D gels), and the averaged results are reported. The values for all transgenes are normalized to 1. A Comparison of the Translation of Short70 v. MT22 T [■H eat Shock 37°Cj j MT306 Short70 MT22 P lasm id 85 1.4 1.2 0 1 1 0 . 8 - S 0.6 0.4 0.2 0 Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. Figure 3.8: The Translation of HSP70 mutant plasmid Scrambled #81 vs. MT306 during Heat Shock. Drosophila S2 cells were transfected with the plasmids using calcium phosphate method. Forty eight hours post transfection cells were treated with CuS04 for 3 h to induce transgene expression. Half of each culture was then heat shocked at 37°C for 30 min. Cells were pulse-labeled with [3 5 S] methionine for 15 minutes (at both 24 and 37°C). Protein samples (from both 24 and 37°C) were prepared and analyzed by IEF/SDS-PAGE as described (see Materials and Methods). Translation of the transgenes during heat shock was calculated as the amount of protein synthesized at heat shock (3 5 S c.p.m of the transgene spot in 2D gels), divided by amount of protein synthesized at room temperature (3 5 S c.p.m of the transgene spot in 2D gels). The experiment was repeated 3 times and the averaged results are reported. The values for both mRNAs are normalized to 1. An * denotes significance of P < 0.05 (using a standard t-Test: Paired two sample for means). Translation of plasmid Scrambled #81 during Heat Shock [ i Heat Shock 37"C Scrambled #81 MT306 Plasm id 86 Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. Figure 3.9: The Translation of HSP70 mutant plasmid Scrambled #82 vs. MT306 during Heat Shock. Drosophila S2 cells were transfected with the plasmids using calcium phosphate method. Forty eight hours post transfection cells were treated with CuS04 for 3 h to induce transgene expression. Half of each culture was then heat shocked at 37°C for 30 min. Cells were pulse-labeled with [3 5 S] methionine for 15 minutes (at both 24 and 37°C). Protein samples (from both 24 and 37°C) were prepared and analyzed by IEF/SDS-PAGE as described (see Materials and Methods). Translation of the transgenes during heat shock was calculated as the amount of protein synthesized at heat shock (3 5 S c.p.m of the transgene spot in 2D gels), divided by amount of protein synthesized at room temperature (3 5 S c.p.m of the transgene spot in 2D gels). The experiment was repeated 4 times and the averaged results are reported. The values for both mRNAs are normalized to 1. An * denotes significance of P < 0.05 (using a standard t-Test: Paired two sample for means). Translation of plasmid Scrambled #82 during Heat Shock 1. 2 - ■ H eat Shock 37°C Scrambled #82 MT306 Plasm id 87 Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. of Scrambled #82 is -10% (Figure 3.8), as compared to MT306. Therefore, the results clearly demonstrate that length per se is not critical, and that scrambling the order of nu cleotides +206-+235 has a deleterious effect on the plasmids ability to translate during heat shock. 5. Discussion Of The HSP70 Results The 5’UTRs of heat shock mRNAs contain necessary and sufficient signals to pro mote preferential translation during heat shock. This was established by showing that a chimeric mRNA containing an HSP 5’UTR and coding body and the 3’UTR of a non heat shock mRNA is preferentially translated during heat shock. Although HSP mRNAs’ 5’UTRs are typically long, length did not appear to be required, because substantially truncated 5’UTRs (-70 nucleotides of HSP70 5’UTR and -35 nucleotides of HSP22 5’UTR) retained 50-100% full length activity. Adenosine content per se was not suffi cient, because 5’UTRs created by scrambling the order of authentic HSP70 5’UTR nu cleotides did not have activity. Finally, the minimal degree of secondary structure did ap pear to be significant and required. That is, the incorporation of a relatively small degree of secondary structure into full length, wild type 5’UTR blocked its activity under heat shock conditions, but had no inhibitory effect on translation under non-heat shock, nor mal circumstances. Although the paucity of secondary structure appeared to be essential for efficient heat shock translation, other factors also played a role. This is because a scrambled order 5’UTR (mentioned above) had relatively little secondary structure yet it did not promote heat shock translation, which suggests that sequence specific elements are required for preferential translation. 88 Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. My objective was to determine what features in the sequence of HSP70 5’UTR confer preferential translation properties to HSP70 mRNA during heat shock. The plasmid MT306 contained a truncated 5’UTR (-75 nucleotides) as compared to the full length 5’UTR HSP70 plasmid, MT301 (242 nucleotides). This plasmid MT306 was also de signed with an inducible metallothionein promoter, so that I could measure translation both at normal growth temperature (to make sure that plasmid was able to translate under normal conditions) and heat shock temperature. Once I had established that this truncated plasmid translated well, i.e., average translation of MT306 ranged -75% of MT301 dur ing heat shock, I used MT306 plasmid as the parent plasmid upon which I based the con struction of all the other mutant plasmids, and as the control against which the translation of all the other test 5’UTR plasmids was measured. The plasmid MT10 Revert did not translate at either normal growth temperature or at heat shock in a number of trials (n=7, data not shown). In order to confirm that this lack of protein expression was not due to a problem in transcription, I did Northern blots and confirmed that RNA was present. The plasmid was also sequenced in an attempt to see if there were any errors in the 5’ UTR region, such as, a mistake proximal to the AUG codon which could lead to a block in translation or an early stop codon, but to no avail. Therefore, I recreated the plasmid with the Drosophila Actin promoter and sequenced it. Once again, there was no, or at best, very poor expression of protein at both normal growth temperature and at heat shock. Although, it was rather surprising that MT10 Re vert or ACTIO Revert did not translate at normal growth temperature, this can be due to the fact that for some inexplicable reason the mRNA just failed to translate, or, that this 89 Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. low basal expression was an actual result. That is, manipulation of the 5’UTR of the MT10 Revert affects the translation capacity of the mRNA in general. The next plasmid that I tested was MT20 Revert, which reverted the first 20 nucleo tides of the scrambled sequence plasmid, Sequence #1, to resemble that of the wild type plasmid. This change of nucleotides 1-20 allowed the plasmid to translate during heat shock at levels similar to MT306. This result demonstrates that the critical nucleotides that restored heat shock transalatabilty to scrambled Sequence #1, reside between +1 and +20, and that nucleotides +21 to +35 have no effect. The above mentioned result clearly show that the first 20 nucleotides of the wild type sequence are necessary for heat shock translation, but are they sufficient? To confirm whether they are sufficient I made a truncated plasmid called Short70, that contained only the first 37 nucleotides of MT306 and which contained an in-context AUG. This plasmid translated similar to wild type levels at normal growth temperature, which meant that there was no impairment in the plasmid’s ability to translate. However, translation during heat shock was severely inhibited. This demonstrated that the 5’ proximal nucleotides were necessary but not sufficient for translation during heat shock and that nucleotides +206 to +242 also have a role to play in heat shock translation. The results that I obtained for Short70 showed that the plasmid, although it could translate at normal growth temperatures, did not translate at heat shock. In contrast, a previous study had shown that retaining the first ~30 nucleotides of the Drosophila HSP22 5’UTR was enough to confer heat shock translation (Hultmark, Klemenz, et al. 1986). Therefore, to compare the findings of Short70 with that of Hultmark, et al., I had to recreate their HSP22 plasmid. The MT22 plasmid is the Drosophila HSP22 plasmid 90 Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. with the minimal 5’UTR, but it under the control of the metallothionein promoter. This allowed me to compare the translation of MT22 plasmid with Short70 translation at both room and heat shock temperatures. The MT22 plasmid translated well at normal growth temperature, but did very poorly at heat shock temperature. This result is similar to what I obtained for Short70 and did not agree with previously published results. Therefore, the truncated leader plasmids are able to translate at normal growth temperatures but were severely inhibited at heat shock, which demonstrated that nucleotides +206 to +242 are indeed important for heat shock translation. An alternative explanation could be that deleting nucleotides +206 to +242 simply creates a leader sequence that was too short, and that the decrease in heat shock transla tion was due to a length effect. Therefore, two plasmids (Scrambled #81 and Scrambled #82) were created, that retained the first 37 nucleotides, but added nucleotides +206 to +242 in a random fashion. These two plasmids also were also able to translate at normal growth temperature but failed to do so at heat shock. This was an interesting result be cause it implies that it is not length per se that decreased translation during heat shock of Short70, but rather that there was some dependence on the specific sequence organization of nucleotides +206 to +242 as well. The results stated above clearly show that the plasmids that translated well during heat shock required both the 5’-proximal and the AUG-proximal nucleotides, i.e., both the first -20 nucleotides and the last -40 nucleotides are required for HSP mRNAs to preferentially translate during heat shock. In the following we present explanations of why these nucleotides are required. 91 Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. It has already been established that prokaryotic ribosomes are guided to the mRNA by RNA-RNA interactions between segments of the mRNA and the 3’ terminus of the 16S rRNA. Specifically, the segments of the mRNA are the Shine-Dalgamo sequence (immediately preceding the initiator AUG) and the Downstream Box (immediately fol lowing the AUG). And, as mentioned previously, analogous RNA-RNA interactions that influence eukaryotic and viral mRNA translation have also been characterized (Yueh and Schneider 1996; Yueh and Schneider 2000). I have been able to identify, using computer based complementarity searches, several regions of potential 18S rRNA-HSP70 5’UTR RNA interaction, some of which are listed below. 1 AATT-CAA 7 HSP70 (where 1=5' cap) 13 TTAATGTT 20 18S rRJMA (where 1 = 3' terminus) 2 ATTCAATT-CAAA 13 HSP70 11 TA—TTAATGTTT 21 18S rRNA It is important to note that the prokaryotic Shine-Dalgamo and Downstream Box se quence interactions rarely represent perfect complementarity and have a similar fraction of mismatches as those presented above. The sequence elements identified from MT20 Revert center on and overlap with both of these areas of complementarity. Therefore, it is very likely that during heat shock when translation initiation factors are impaired, these 20 nucleotides are critical for recruiting ribosomes and they help in preferential transla tion of HSP mRNAs because they can bypass the initiation factor lesions. Thus, scram bling this region of nucleotides (as in the Scrambled Sequence plasmid) completely abolishes heat shock translation, because the HSP mRNA alongwith other normal cellular heat shock mRNAs cannot recruit ribosomes and therefore cannot initiate translation. 92 Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. AGTTCAAAAAAACCAAAOCAA -HSP22 AGTTGAATTCAAAAAGCCAAA - HS P2 3 AGATCGAATTCAAAAATCGAG -HSP26 AGTCTAAACTGAAAAATTGAA -HSP27 ATTTGAAATC. A A ACAGTCAAA -HSP68 AATTCAATTCAAACAAGCAAA -HSP70 AGTCTTGAAAAAAATTTCGTA -HSP90 AgTTcAAatcAAAcAa- C- AA -c o n s e n s u s seq u en ce Interestingly, Holmgren, et a l, (Holmgren, Corces, et al. 1981), and Garbe, et a l, (Garbe, Bendena, et al. 1989), have noted that the first few nucleotides of the Drosophila HSP mRNAs are similar in sequence. If we do a similar sequence alignment (see above) of the cap proximal 21 nucleotides from various Drosophila HSP mRNAs, it can be seen that nucleotides (1-20) appear to be fairly conserved for all of them (excluding HSP90), which implies that Drosophila HSP mRNAs are using what appears to be an conserved strategy for HSP preferential translation. Accordingly, when other nucleotide sequences are substituted for this portion of the leader, as in the studies done by McGarry (McGarry and Lindquist 1985), Peterson (Petersen and Lindquist 1988), and Hess (Hess and Duncan 1996), or stem loops introduced (Hess and Duncan 1996), it disrupts the recruit ment of the ribosomes during heat shock and thereby inhibits the translation of HSP70 mRNA. Therefore, we hypothesize that elements in the first 20 nucleotides in HSP70 mRNA can confer preferential translation, and they act by recruiting ribosomes directly via RNA-RNA interaction. The last ~40 nucleotides that allow HSP mRNAs to preferentially translate during heat shock could be required for the following two reasons. First, it has been suggested before that there is a degenerate sequence motif reiterated throughout the leader (Hess 93 Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. and Duncan 1996). It is possible that a certain number of these repeated motifs are re quired for heat shock preferential translation, and therefore scrambling the order of nu cleotides +206-+235 decreases the number of required sequence motifs and thereby re duces heat shock preferential translation. To test this hypothesis, one can employ a strat egy similar to what we utilized in identifying the first 20 nucleotides, i.e., do blockwise reversions of the scrambled nucleotides to resemble MT306, and to identify the critical nucleotides that restore preferential translation. The identity of these nucleotides may suggest if they are part of a motif sequence. Second, a certain length of authentic HSP70 5’UTR sequence might be needed for heat shock preferential translation. Our results (discussed above, compare MT306 and MT20 Revert vs. Short70, MT22, Scrambled #81 and #82), and other studies (Di Nocera and Dawid 1983) (McGarry and Lindquist 1985), indicate that this length of authentic HSP 5’UTR is -60 nucleotides long. Therefore, scrambling nucleotides +206-+235 may have impaired translation because a certain length of functional HSP70 5’UTR sequence is deleted that is required for heat shock preferential translation. An experiment to test this hypothesis would be to append -60 nucleotides of the authentic HSP70 5’UTR to the scrambled nucleotides and to see whether this restores translation during heat shock. In conclusion, we have demonstrated that features present in the first 20 nucleotides of the HSP70 5’UTR are necessary, but not sufficient, for conferring heat shock prefer ential translation to the HSP mRNAs, and that nucleotides 21-37 are not neccessary. We have also demonstrated that a plasmid with a shortened HSP70 leader sequence of only 37 nucleotides, and a plasmid with a shortened HSP22 leader sequence of only 37 nu cleotides, are capable of translating at normal growth temperatures but not at heat shock. 94 Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. Which is in contradiction to published work by Hultmark, et al., where a truncated HSP22 efficiently translated during heat shock. Moreover, we demonstrated that the or ganization of the nucleotide sequence +206 to +235 is important and required for heat shock translatability. Finally, based on complementarity comparisons, we propose a model of ribosome recruitment via RNA-RNA interactions, as the mechanism by which Drosophila HSP70 preferentially translates during heat shock. Based on the experimental results and research conclusions above, three important lines of further investigation are motivated: (i) determine the detailed mechanism of translational regulation of HSP70 and confirm our proposed model above; (ii) identify which other HSP mRNAs may be using the same translational mechanism and under which conditions; and (iii) explore the broad implications in gene regulation and gene expression optimization. 95 Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. IV. The Preferential Translation of HSP90 mRNA 1. Determining whether another translational control mechanism accounts for some instances of heat shock preferential translation, i.e., characterizing other hsp mRNAs 5'UTRs to identify possible exceptions. There is evidence that not all hsp mRNAs utilize the same preferential translation pathway, even though their efficient expression during heat shock may suggest so. HSP90 mRNA is one such mRNA, because HSP90 mRNA translation is strongly inhib ited by antibody to eIF4F, to the same extent as non-heat shock mRNAs, whereas HSP70, HSP22 and other main HSP mRNAs are not appreciably inhibited. However, since all HSP mRNAs, including hsp90 mRNA, translate efficiently during heat shock, an eIF4F inhibition based pathway cannot be the whole story. HSP90 mRNA unlike other HSP RNAs, exclusively contains an intervening sequence of introns. In addition, the HSP90 5’UTR, unlike other HSP 5’UTRs that are relatively unstructured, also uniquely contains substantial secondary structure, typical of the amount found in most non-heat shock mRNAs. These characteristics of hsp90 mRNA translation strongly suggest that it trans lates by a different preferential translation mechanism. Therefore, I examined the transla tional control of HSP90 mRNA to identify the unique mechanisms by which HSP90 mRNAs preferentially translate during heat shock. 2. HSP90 mRNA is Translationally Repressed at Normal Temperatures and is De- Repressed during Heat Shock. Both ID and 2D gel protein analysis show the patterns of protein synthesis, and that following heat shock, HSP90 protein synthesis increases (Figures 4.1 and 4.2 compare 96 Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. Figure 4.1: SDS-PAGE analysis of HSP90 protein in normal and heat shocked cells. Drosophila S2 cells were transfected with the plasmid MT301 using calcium phosphate method. Forty eight hours post transfection cells were treated with CuS04 for 3 h to induce transgene expression. Half of each culture was then heat shocked at 37°C for 30 min. Cells were pulse labeled with [3 5 S] methionine for 15 minutes (at 24°C {C}, 37°C {HS} and 37°C + actinomycin D - 100 jxg I mL {HS+ActD}). Proteins were extracted and equal amounts of protein were analyzed by SDS-PAGE and autoradiography (see Materials and Methods). HSP90 HSP70 HSP70m x 3 0 1 (reporter transgene) — HSP 26/28 HSP 22/23 C HS HS+ActD 97 Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. Figure 4.2: 2-D (IEF/SDS-PAGE) analysis of HSP90 proteins in normal and heat shocked cells. Drosophila S2 cells were transfected with the plasmid MT301 using calcium phosphate method. Forty eight hours post transfection cells were treated with CuS04 for 3 h to induce transgene expression. Half of each culture was then heat shocked at 37°C for 30 min. Cells were pulse labeled with [3 5 S] methionine for 15 minutes (at 24°C {C}, 37°C {HS} and 37°C + actinomycin D - 100 pg/mL {HS+ActD}). Proteins were extracted and equal amounts of protein were analyzed by IEF/SDS-PAGE and autoradiography (see Materials and Methods). x n I T ) > M O 98 Pre-HS HS HS+ActD IEF HSP70 1 ..f ....: # * ' * 2 4 t - ■ * , HSP90 * ■ ^ * +» . * 4 # HSP70M no i ■ ' .. pH Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. control vs. heat shock). To determine if this result only occurs because of an increase in the rate of HSP90 mRNA transcription, Actinomycin D (a transcriptional inhibitor) was added to prevent new heat shock mRNA synthesis. Results from both ID and 2D gel protein analysis also show that this increase in HSP90 protein levels occurs despite the presence of actinomycin D (Figures 4.1 and 4.2 compare control vs. heat shock + ActD). An explanation for this result could be that there is an increase in HSP90 mRNA despite the presence of actinomycin D. However, it can be seen in Figure 4.3 that the increase in the amount of HSP90 protein occurs from a constant amount of HSP90 mRNA. Thus, the induced synthesis of HSP90 without a proportional increase in mRNA levels suggests that HSP90 mRNA at normal growth temperature is in a translationally repressed state. 3. The Translation Efficiency of HSP90 increases with increases in temperature. The next objective was to see whether the increase in HSP90 translation was propor tional to increases in temperatures. As can be seen from Figure 4.4, HSP90 translation increases proportionally to increases in temperature (compare 23°C - 35°C). Moreover, this increase occurs despite the presence of Actinomycin D in the cells (Figure 4.5, com pare 23°C - 35°C). The results in Figure 4.5 also show that in the presence of Actinomy cin D, HSP70 protein synthesis is significantly inhibited. We also calculated the changes in the translation efficiency (T.E.) of HSP90 mRNA over a wide range of different temperatures. The translation efficiency of HSP90 mRNA and HSP70 mRNA was calculated as the protein synthesis rate (3 5 S c.p.m of the trasngene spot in 2D gels) per unit transgene mRNA (3 2 P c.p.m on the northern blot), and all T.E. values were normalized to 34°C. The amount of HSP90 protein synthesized at different 99 Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. Figure 4.3: Northern Blot Analysis of HSP90 and HSP70 RNA levels in Drosophila S2 cells before and after heat shock. Drosophila S2 cells were maintained at 23°C (pre-HS) or heat shocked (HS) at 37°C for 30 minutes, +/- actinomycin D (100 jig/mL). Aliquots were collected from Pre-HS, HS and HS+ActD cells. Total RNAs were isolated, samples were electrophoresed on a 1.25% formaldehyde agarose gel, transferred to a nylon membrane, and hybridized to [3 2 P] labeled probes overnight and blots exposed to film for 3 hours. Pre-HS HS+ActD HSP90 « g HSP70 HSP70m t3 0 100 Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. Figure 4.4: SDS-PAGE analysis of HSP90 protein levels at different temperatures. Drosophila S2 cells were maintained at 23°C, or heat shocked over a range of temperatures for 30 minutes, and aliquots were pulse-labeled with 15-20 jiCi [3 5 S] methionine for 15 minutes. Proteins were extracted and equal amounts of protein were analyzed by SDS-PAGE and autoradiography as described (see Materials and Methods). Temperature (°C) 23 29 30 31 32 33 34 35 36 37 ■ 11 HSP90 m HSP70 Tubulin ■ 4 — Actin HSP 26/28 •4— HSP 22/23 101 Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. Figure 4.5: SDS-PAGE analysis of HSP90 protein levels at different temperatures in the presence of Actinomycin D (100 pg/mL). Drosophila S2 cells were maintained at 23°C, or heat shocked over a range of temperatures for 30 minutes in the presence of actinomycin D, and aliquots were pulse-labeled with 15-20 pCi [3 3 S] methionine for 15 minutes. Proteins were extracted and equal amounts of protein were analyzed by SDS- PAGE and autoradiography as described (see Materials and Methods). Temperature (°C) 23 29 30 31 32 33 34 35 36 37 HSP90 <— HSP70 Tubulin Actin < — HSP 26/28 <— HSP 22/23 102 Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. temperatures was calculated from 2D gels (Figure 4.6), and the levels of RNA were quantitated from Northern Blots (Figure 4.7). As can be seen from the results (Figure 4.8, without actinomycin D), HSP90 has a low T.E. at normal growth temperatures (compare 23°C vs. 35°C), which increases as the temperature is increased. That is, the T.E. of HSP90 appears to increase proportionally to increases in temperature (Figure 4.8, with actinomycin D). The results are different for HSP70 mRNA, because the T.E. of HSP70 appears to be quite high at normal growth temperatures and remain high with increases in temperature (Figure 4.9). This result demonstrates that the translational efficiency differs in FISP90 and HSP70 mRNA. And, that the translation efficiency of HSP90 mRNA in creases with heat shock, and the increase in T. E. is proportional to increases in tempera ture. 4. The increase in translation efficiency of HSP90 mRNA occurs because of an in crease in the rate of initiation, as well as elongation. The above mentioned experiments established that there is an increase in the transla tion efficiency of HSP90 mRNAs. To probe how the translation of HSP90 mRNA is al tered to account for its increasing rate of translation we used sucrose density gradients analyses (see Materials and Methods). The distribution of HSP90 and HSP70 mRNA was analyzed by northern blot hybridization (see Materials and Methods) to determine the distribution of HSP90 mRNA on polysomes, monosomes and ribonucleoprotein particles and then compare it to the RNA profile of HSP70. As can be seen in Figure 4.10, HSP90 mRNA at 24°C, is present in the heavier polysome associated fractions (Fraction # 1-6). However, as the cells are heated, the mRNAs appear to shift towards the smaller 103 Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. Figure 4.6: 2-D (IEF/SDS-PAGE) analysis of HSP90 protein levels at different temperatures. Drosophila S2 cells were heat shocked over a range of temperatures for 30 minutes, and aliquots were pulse labeled with 15-20 jiCi [3 5 S] methionine for 15 minutes. Proteins were extracted and equal amounts of protein were analyzed by IEF/SDS-PAGE and autoradiography as described (see Materials and Methods). 23 Hsp90 . . : J ( Tubulin A ctin 2 9 #' * *♦. .. ’ ♦ , * #■ - •*- " 30 # * - ^ ■ » ' • t i. , ♦ 31 * « ' , 1 . , * 32 J" ......-." m , * 33 •« r ... ....... . ' * • * • , " 3 4 * 1 1 " ■ * ? “% .r V - # 35 * * , - 36 m ^ a s i .. Hsp90 + Hsp70 Similar panels were obtained for Actinomycin D-treated cells (data not shown) 104 Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. Figure 4.7: Northern Blot Analysis of HSP90 and HSP70 RNA levels at different temperatures. Drosophila S2 cells were maintained at 23°C, or heat shocked over a range of temperatures for 30 minutes, with or without actinomycin D (100 |ig/mL). Total RNAs were isolated, samples were electrophoresed on a 1.25% formaldehyde agarose gel, transferred to a nylon membrane, and hybridized to [3 2 P] labeled probes overnight, and blots exposed to film for 3 hours. 23 29 30 31 32 33 34 35 36 37 o 105 Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. Figure 4.8: The Translation Efficiency of HSP90 mRNA at different temperatures in normal and actinomycin D treated cells (100 (ig/mL). Translational efficiency was calculated as the protein synthesis rate (3 5 S c.p.m of the trasngene spot in 2D gels) per unit transgene mRNA (3 2 P c.p.m on the northern blot). T.E. values in normal cells are normalized to 34°C, and in act D treated cells are normalized to 35°C. 110 o $ 1 0 0 0 *o 90 © N 80 l 7 0 1 60 O £ 50 0 ) 13 1 40 © 30 1 1 20 10 23 29 30 31 32 33 34 35 36 37 Temperature (°C) 23 29 30 31 32 33 34 35 36 37 Temperature (°C) without Actinomycin D with Actinomycin D 106 Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. Figure 4.9: The Translation Efficiency of HSP70 mRNA at different temperatures in normal cells. Translational efficiency was calculated as the protein synthesis rate (3 5 S c.p.m of the trasngene spot in 2D gels) per unit transgene mRNA (3 2 P c.p.m on the northern blot). All T.E. values are normalized to 35°C. _1G00 0 | 900 | 800 © N « 70 1 O 600 | 500 | 400 © | 300 0 1 200 c | 100 23 29 30 3 1 32 33 34 35 36 37 Temperature (°C) without Actinomycin D 107 Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. Profile of HSP90 mRNA at Different Tem peratures Figure 4.10s Sucrose Density Gradient/Northern Blot analysis of HSP90 mRNA at different temperatures. Cells (~7.5xl07 cells) were pelleted, then lysed in 4°C polysome buffer and microfuged briefly, the supernatants layered on top of 20-45% sucrose gradients (mass/volume). Gradients were centrifuged for 1.45 hours at 36000 rpm, 4°C, in an SW41 rotor. After centrifugation, the gradients were fractionated into fifteen 1 mL fractions and RNA was extracted from each fraction. Then, RNA samples were electrophoresed in a 1.25% formaldehyde agarose gel, transferred to a nylon membrane and hybridized with [3 2 P] labeled probe. Then, blots were washed, dried and exposed to film. The graphical representation of the RNA band intensity in the different fractions, bands were quantitated using BIO-RAD VersaDoc 1000 imaging system. 0.35 0.3 0.25 0.2 0.15 0.1 0.05 0 • 23°C 32°C 34°C 36°C 1 2 3 4 5 6 7 8 9 10 11 12 13 14 L arge P o ly so m e s Sm all P o ly so m e s 8 0 S Fraction Number Fraction number 4 5 6 7 8 9 80S 10 11 12 13 14 15 Hsp83 ► 23°C 32°C 34°C ^ 36°C Large polysomes Small polysomes 108 Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. polysome associated fractions (Fraction # 7-10). The disaggregation of the polysomal ri bosomes by heat shock is characteristic of an initiation block to translation. In contrast, HSP70 mRNA appears to translate at the same rate at different tempera tures because the RNA profile does not shift, i.e., HSP70 appears to always be in the same fractions (Fraction # 2-5) (Figure 4.11). The results for HSP90 were surprising (i.e., heat shock appears to cause a decrease in the amount of HSP90 mRNA sedimenting with large polysomes), since we know that protein synthesis increases as we increase the tem perature. Therefore, the rate of translation initiation must be increasing, so why the shift towards the smaller polysome associated fractions ? One explanation could be that HSP90 mRNA is not really associated with heavy polysomes at normal growth tempera ture, but is instead packaged into fast-sedimenting messenger ribonucleoproteins (mRNPs). In order to verify that HSP90 mRNAs are associated with large polysomes at normal growth temperature, cell lysates were treated with EDTA. EDTA is a chelator of Mg2+ ions, and causes the dissociation of ribosomes, therefore if HSP90 is really associated with actively translating ribosomes, it should shift to the lower fractions after EDTA treatment. Treatment with EDTA released HSP90 mRNA towards the smaller polysomal region of the gradient (Fraction #8-13) (Figure 4.12), showing that HSP90 mRNA is really associated with large polysomes at normal growth temperature. Treatment of heat shocked cells with EDTA also had similar results, i.e., HSP90 mRNA shifted towards the post ribosomal fractions (Fraction # 9-12) from the smaller polysomal fractions (Figure 4.12). This result clearly demonstrates that HSP90 mRNA is sedimenting with polysomes, and not inactive mRNP particles. 109 Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. Figure 4.11: Sucrose Density Gradient/Northern Blot analysis of HSP70 mRNA at dif ferent temperatures. Cells (~7.5xl07 cells) were pelleted, then lysed in 4°C polysome buffer and microfuged briefly, the supernatants layered on top of 20-45% sucrose gradi ents (mass/ volume). Gradients were centrifuged for 1.45 hours at 36000 rpm, 4°C, in an SW41 rotor. After centrifugation, the gradients were fractionated into fif teen 1 mL fractions and RNA was extracted from each fraction. RNA samples were then electrophoresed in a 1.25% formaldehyde agarose gel, transferred to nylon membrane and hybridized with [3 2 P] labeled probe. Blots were then washed, dried and exposed to film. The graphical representation of the RNA band intensity in the differ ent fractions, bands were quantitated using BIO-RAD VersaDoc 1000 im aging system. ! 0.5 Profile of H SP70 mRNA Transiation at Different ] T a iro e ra tu re s j 0.45 ■ 0.4 0.35 0.3 § 0 .2 5 0.2 0.15 -~-23°c; » 32°Ci 34°C' 36°C| 0.1 5 0.05 1 2 3 4 5 6 7 8 9 10 11 L arge P oly so m es Small P oly so m es Fraction Number 12 13 14 8 0 S ! i Fraction number 80S S 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 23°C Hsp70 32°C 34°C : 36°C Large polysomes Small polysomes 110 Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. Reproduced w ith permission o f th e copyright owner. Further reproduction prohibited without permission. Figure 4.12: Sucrose Density Gradient/Northern Blot analysis of HSP90 mRNA in normal, heat shocked and EDTA treated cells. Control (23°C) and heat shocked cells (36°C) were pelleted, lysed in 4°C polysome buffer, treated with EDTA (170 mM) and layered on top of 20-45% sucrose gradients (mass / volume). Gradients were centrifuged for 1.45 hours at 36000 rpm, 4°C, in an SW41 rotor. After centrifugation the gradients were fractionated into fifteen 1 mL fractions and RNA was extracted from each fraction. RNA samples were then electrophoresed in a 1.25% formaldehyde agarose gel, transferred to nylon membrane and hybridized with [3 2 P] labeled probe. Blots were then washed, dried and exposed to film. RNA bands were quantitated using BIO RAD VersaDoc 1000 imaging system. Sucrose Gradient KNA Profile of HSFSO in Control Colly o " U Large Polysom es Small Polysom es Fraction Number 12 “ !3 14 80S Sucrose Gradient RNA Profile of HSP90 in Heat Shocked Cells 1000 J 900 ! 800 700 600 } ) 500 400 300 200 100 0 1 2 3 4 5 Large Polysom es Fraction Number 7 8 9 10 11 12 13 Small Polysom es 80S Sucrose Gradient RNA Profile of HSP90 in Control + EDTA Cells 1 2 3 4 5 6 7 8 U r g e Polysom es Sm a" P o l o n i e s Fraction Number Sucrose Gradient RNA Profile of IISP90 in Heat Shocked + EDTA Cell: 400 350 j 300 | I 250 { I 100 | 12 80S 13 14 9 10 11 2 3 4 Large Polysom es 5 6 7 Small Polysom es 8 1 Fraction Number The previous experiment established that the HSP90 mRNAs are polysome associ ated, however it was possible that a significant portion of the HSP90 mRNAs which were in the heavier polysomal fractions, were associated with ribosomes that were in a state of elongation arrest, and therefore inactive. Thus, to further establish that HSP90 mRNA is associated with actively translating ribosomes, we used Puromycin to disrupt polysomes. Puromycin is an aminoacyl t-RNA analog, that binds to the A-site of only actively trans lating ribosomes and disrupts elongation. Therefore, after Puromycin treatment, actively translated mRNAs which are associated with the heavier polysomes, should shift to the smaller fractions of the gradient. Control and heat shocked cells were incubated in the presence of 100 pg/ml puromycin for 10 minutes, and the polysome distribution of HSP90 mRNAs was determined. As can be seen from Figure 4.13, the incubation of ei ther the control or heat shocked cells with puromycin released HSP90 mRNA towards the smaller polysomal region of the gradient. This verifies the fact that HSP90 mRNA is as sociated with actively translating polysomes at both normal growth temperature and at heat shock. Moreover, because the synthesis of HSP90 protein is increasing with heat shock, we know that the rate of initiation must be increasing, and because HSP90 protein synthesis increases with heat shock despite the shift towards the smaller polysomes, it clearly points to the fact that the rate of elongation must also be increasing (and at a greater rate than initiation) to compensate. 112 Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. Reproduced w ith permission o f th e copyright owner. Further reproduction prohibited without permission. Figure 4.13: Sucrose Density Gradient/Northern Blot analysis of HSP90 mRNA in normal, heat shocked and Puromycin treated cells. Control (23°C) and heat shocked cells (36°C) were pelleted, lysed in 4°C polysome buffer, treated with puromycin (100pig/mL) and layered on top of 20-45% sucrose gradients (mass / volume). Gradients were centrifuged for 1.45 hours a t 36000 rpm, 4°C, in an SW41 rotor. After centrifugation the gradients were fractionated into fifteen 1 mL fractions and RNA was extracted from each fraction. RNA samples were then electrophoresed in a 1.25% formaldehyde agarose gel, transferred to nylon membrane and hybridized with [3 2 P] labeled probe. Blots were then washed, dried and exposed to film. RNA bands were quantitated using BIO-RAD VersaDoc 1000 imaging system. Sucrose Gradient RNA Profile of HSP90 in Control Cells 500 400 g 300 200 100 0 1000 900 800 700 600- 8 500 400 - 300 200 i 100 - T o A - W . J 1. 1234 567 89 10 Large Polysom es Small Polysom es Fraction Number r * . 12 13 80S Sucrose Gradient RNA Profile of HSP90 in Heat Shocked Cells 1 2 3 4 5 6 7 8 9 Large Polysom es Small Polysom es Fraction Number 10 11 12 13 8 0 S 14 Sucrose Gradient RNA Profile of HSP90 tn Control + Puromycin Coils 700 600 j 500- 400 i |l 300 ft 200 100 ot 700 ■ : 600 | 500 I 400 300 [ 200 100 • x n . 1 2 3 4 5 6 7 8 9 Large Polysom es Small P olysom es Fraction Number 11 12 80S Sucrose Gradient RNA Profile of HSP90 in Heal Shocked i Puromycin Colls 1 2 3 4 5 6 7 8 9 10 11 12 13 Large Polysom es Small P olysom es SOS Fraction Number 5. The AUG-proximal region of the HSP90 leader sequence is responsible for heat shock preferential translation. The sucrose density gradients lead to the conclusion that at normal growth tempera tures HSP90 mRNAs appear to be in a state of translation repression, and that the in crease in translation efficiency during heat shock, is because of an increase in the rate of initiation as well as elongation. Subsequently, we attempted to identify the critical re gions in the HSP90 5’UTR that were required for heat shock translation. As can be seen from Figure 4.14, several mutant plasmids were created. One of the reporter plasmids has the full length HSP90 5UTR (150 nucleotides), while the other test plasmids have trun cated 5’UTRs. The first set of mutant plasmids have their 5’UTRs systematically deleted from the cap-proximal end. The second set of plasmids have their 5’UTRs systematically deleted from the AUG-proximal ends. There is also an internal deletion mutant, which retains the cap proximal and the AUG proximal nucleotides, but has a large deletion in the central portion of the HSP90 5’ UTR. Transfection experiments, and 2D-gel analyses showed that plasmid MT90 (which has the full length HSP90 5’UTR) could translate at heat shock, the average translation of HSP90 during heat shock is -80% of its translation at normal growth temperature (Figure 4.15). That is, plasmid MT90 had all the elements present in its 5’UTR that are necessary and sufficient to confer preferential heat shock translation. Once this was established, plasmid MT90 became the control plasmid for all subsequent experiments. Transfection experiments with the mutant plasmids demonstrated that if we delete the first forty, cap-proximal nucleotides, it still allowed plasmid MT86 to translate at heat shock. The average translation of MT86 at heat shock is -43% of control MT90 transla- 114 Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. tion at heat shock (Figure 4.16). Deleting an additional thirty nucleotides also did not have a significant effect on heat shock translation, because average translation of plasmid MT 87 also ranged at -44% of control plasmids translation during heat shock (Figure 4.17). Finally, when -100 cap-proximal nucleotides were deleted, it can be seen that the translation of MT88 is almost completely abolished at heat shock, average translation of MT88 is -9% as compared to MT90 (Figure 4.18). However, this loss of translation may be due to a length effect. The internal deletion mutant plasmid MT89 which has nucleotides -+40 to +110 re moved, is also capable of translating during heat shock. The average translation of MT89 during heat shock is -45% of MT90 translation (Figure 4.19). Interestingly, removal of -forty AUG-proximal nucleotides as in plasmid MT85, al most completely eliminates heat shock translation. That is, the average translation of MT85 at heat shock is -14% of MT90 translation (Figure 4.20). Deleting another 30 AUG-proximal nucleotides in MT84 further decreased heat shock translation. The aver age translation of MT84 at heat shock is -8% of MT90 translation (Figure 4.21). The construct MT83 has -110 nucleotides deleted, and the average translation of MT83 at heat shock is also very poor, -9% of MT90 translation (Figure 4.22). All the AUG- proximal mutants were capable of translating at normal growth temperatures as compared to the translation of MT90 (data not shown). However, at heat shock temperatures, all three mutant plasmids failed to translate (Figures 4.20, 4.21 and 4.22). These results clearly demonstrate that the forty AUG-proximal nucleotides are critical for conferring preferential translation to HSP90 mRNA during heat shock. 115 Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. Figure 4.14: HSP90 plasmid constructs with cap-proximal and AUG-proximal deletions in their leader sequence. A PCR based strategy was used to synthesize the various test 5’UTRs for mutant HSP90 plasmids, and figure shows the deletions made in the full length HSP90 5’UTR. Solid bars (light green) represent the 5’UTR present in the plasmids, dashed lines represent the areas of deletion, and numbers correspond to the nucleotide number in the HSP90 5’UTR. Metallothionein Promoter MT90 MT86 MT87 MT88 MT85 MT84 MT83 MT89 5’ UTR HSP70 Coding Region 3’ UTR 6 45 1 6 79 1 _____________ 6 115 I ........................................ 38 39 107 73 149 ::r 149 I 149 I 115 HSP90 wt HSP70 MT306 116 Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. Figure 4.15: Construction and analysis of Drosophila MT90 - a transgene with a full length HSP90 5’UTR. (A) Schematic representation of the difference in the Drosophila HSP70 transgene with the HSP70 5’UTR (MT306) and the Drosophila HSP70 transgene with the HSP90 5’UTR (MT90). (B) 2-D (IEF/SDS-PAGE) analysis of HSP90 transgene in heat shocked cells (37°C). Drosophila S2 cells were transfected with the plasmid using calcium phosphate method. Forty eight hours post transfection cells were treated with CuS04 for 3 h to induce transgene expression. Half of each culture was then heat shocked at 37°C for 30 min. Cells were pulse-labeled with [35S] methionine for 15 minutes (at 37°C). Protein samples were prepared and analyzed by IEF/SDS-PAGE as described (see Materials and Methods). (C) The Translation of MT90 mRNA. Graph shows the average translation of MT90 at room temperature (23°C, blue bars) and heat shock (37°C, red bars). Translation was calculated as the amount of protein synthesized (3 5 S c.p.m of the transgene spot in 2D gels), and then averaged from n=6 experiments. 117 Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. Reproduced w ith permission o f th e copyright owner. Further reproduction prohibited without permission. (A) Metallothionein Promoter ■ HSP70 5’ UTR 3’ UTR HSP70, M T306 Metallothionein Promoter * HSP90 5’ UTR HSP70 Coding Region HSP90, M T90 (B) 0 0 HSP70 wt f HSP70a c HSP90 wt t t HSP70 AC (C) Translation of plasmid MT90 at Room Temperature and Heat Shock M T9G Plasm id js Room Temp 24°C | m Heat Shock 37°C Figure 4.16: The Translation of HSP90 mutant plasmid MT86 vs. MT90 during Heat Shock. Drosophila S2 cells were transfected with the plasmids using calcium phosphate method. Forty eight hours post transfection cells were treated with CuS04 for 3 h to induce transgene expression. Half of each culture was then heat shocked at 37°C for 30 min. Cells were pulse-labeled with [3 5 S] methionine for 15 minutes (at both 24 and 37°C). Protein samples (from both 24 and 37°C) were prepared and analyzed by IEF/SDS-PAGE as described (see Materials and Methods). Translation of the transgenes during heat shock was calculated as the amount of protein synthesized at heat shock (3 5 S c.p.m of the transgene spot in 2D gels), divided by amount of protein synthesized at room temperature (3 5 S c.p.m of the transgene spot in 2D gels). The experiment was repeated 4 times and the averaged results are reported. The values for both mRNAs are normalized to 1. Translation of plasmid M T86 during Heat Shock ;BHeat Shock 37°C MT86 MT90 Plasmid 119 Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. Figure 4.17: The Translation of HSP90 mutant plasmid MT87 vs. MT90 during Heat Shock. Drosophila S2 cells were transfected with the plasmids using calcium phosphate method. Forty eight hours post transfection cells were treated with CuS04 for 3 h to induce transgene expression. Half of each culture was then heat shocked at 37°C for 30 min. Cells were pulse-labeled with [3 5 S] methionine for 15 minutes (at both 24 and 37°C). Protein samples (from both 24 and 37°C) were prepared and analyzed by IEF/SDS-PAGE as described (see Materials and Methods). Translation of the transgenes during heat shock was calculated as the amount of protein synthesized at heat shock (3 5 S c.p.m of the transgene spot in 2D gels), divided by amount of protein synthesized at room temperature (3 5 S c.p.m of the transgene spot in 2D gels). The experiment was repeated 3 times and the averaged results are reported. The values for both mRNAs are normalized to 1. Translation of plasmid MT87 during Heat Shock ■ Heat Shock 37°C P lasm id 120 Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. Figure 4.18: The Translation of HSP90 mutant plasmid MT88 vs. MT90 during Heat Shock. Drosophila S2 cells were transfected with the plasmids using calcium phosphate method. Forty eight hours post transfection cells were treated with CuS04 for 3 h to induce transgene expression. Half of each culture was then heat shocked at 37°C for 30 min. Cells were pulse-labeled with [3 5 S] methionine for 15 minutes (at both 24 and 37°C). Protein samples (from both 24 and 37°C) were prepared and analyzed by IEF/SDS-PAGE as described (see Materials and Methods). Translation of the transgenes during heat shock was calculated as the amount of protein synthesized at heat shock (3 5 S c.p.m of the transgene spot in 2D gels), divided by amount of protein synthesized at room temperature (3 5 S c.p.m of the transgene spot in 2D gels). The experiment was repeated 3 times and the averaged results are reported. The values for both mRNAs are normalized to 1. An * denotes significance of P < 0.03 (using a standard t-Test: Paired two sample for means). Translation o f plasmid M T88 during Heat Shock W H eat Shock 37°C MT88 P lasm id 121 Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. Figure 4.19: The Translation of HSP90 internal deletion mutant plasmid MT89 vs. MT90 during Heat Shock. Drosophila S2 cells were transfected with the plasmids using calcium phosphate method. Forty eight hours post transfection cells were treated with CuS04 for 3 h to induce transgene expression. Half of each culture was then heat shocked at 37°C for 30 min. Cells were pulse-labeled with [3 : > S] methionine for 15 minutes (at both 24 and 37°C). Protein samples (from both 24 and 37°C) were prepared and analyzed by IEF/SDS-PAGE as described (see Materials and Methods). Translation of the transgenes during heat shock was calculated as the amount of protein synthesized at heat shock (3 5 S c.p.m of the transgene spot in 2D gels), divided by amount of protein synthesized at room temperature (3 5 S c.p.m of the transgene spot in 2D gels). The experiment was repeated 3 times and the averaged results are reported. The values for both tnRNAs are normalized to 1. Translation of plasmid MT89 during Heat Shock ;« H e a t Shock 3 7 ’C MT90 Plasm id 122 Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. Figure 4.20: The Translation of HSP90 mutant plasmid MT85 vs. MT90 during Heat Shock. Drosophila S2 cells were transfected with the plasmids using calcium phosphate method. Forty eight hours post transfection cells were treated with CuS04 for 3 h to induce transgene expression. Half of each culture was then heat shocked at 37°C for 30 min. Cells were pulse-labeled with [3 5 S] methionine for 15 minutes (at both 24 and 37°C). Protein samples (from both 24 and 37°C) were prepared and analyzed by IEF/SDS-PAGE as described (see Materials and Methods). Translation of the transgenes during heat shock was calculated as the amount of protein synthesized at heat shock (3 5 S c.p.m of the transgene spot in 2D gels), divided by amount of protein synthesized at room temperature (3 5 S c.p.m of the transgene spot in 2D gels). The experiment was repeated 5 times and the averaged results are reported. The values for both mRNAs are normalized to 1. An * denotes significance of P < 0.03 (using a standard t-Test: Paired two sample for means). Translation of plasmid MT85 during Heat Shock ■ H eat Shock 37°C MT90 Plasm id 123 Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. Figure 4.21: The Translation of HSP90 mutant plasmid MT84 vs. MT90 during Heat Shock. Drosophila S2 cells were transfected with the plasmids using calcium phosphate method. Forty eight hours post transfection cells were treated with CuS04 for 3 h to induce transgene expression. Half of each culture was then heat shocked at 37°C for 30 min. Cells were pulse-labeled with [3 5 S] methionine for 15 minutes (at both 24 and 37°C). Protein samples (from both 24 and 37°C) were prepared and analyzed by IEF/SDS-PAGE as described (see Materials and Methods). Translation of the transgenes during heat shock was calculated as the amount of protein synthesized at heat shock (3 5 S c.p.m of the transgene spot in 2D gels), divided by amount of protein synthesized at room temperature (3 5 S c.p.m of the transgene spot in 2D gels). The experiment was repeated 5 times and the averaged results are reported. The values for both mRNAs are normalized to 1. An * denotes significance of P < 0.03 (using a standard t-Test: Paired two sample for means). Translation of plasmid MT84 during Heat Shock ■ Heat Shock 37’C MT90 Plasm id 124 Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. Figure 4.22: The Translation of HSP90 mutant plasmid MT83 vs. MT90 during Heat Shock. Drosophila S2 cells were transfected with the plasmids using calcium phosphate method. Forty eight hours post transfection cells were treated with CuS04 for 3 h to induce transgene expression. Half of each culture was then heat shocked at 37°C for 30 min. Cells were pulse-labeled with [3 5 S] methionine for 15 minutes (at both 24 and 37°C). Protein samples (from both 24 and 37°C) were prepared and analyzed by IEF/SDS-PAGE as described (see Materials and Methods). Translation of the transgenes during heat shock was calculated as the amount of protein synthesized at heat shock (3 5 S c.p.m of the transgene spot in 2D gels), divided by amount of protein synthesized at room temperature (3 5 S c.p.m of the transgene spot in 2D gels). The experiment was repeated 5 times and the averaged results are reported. The values for both mRNAs are normalized to 1. An * denotes significance of P < 0.03 (using a standard t-Test: Paired two sample for means). Translation of plasmid MT83 during Heat Shock 1.4 - 1.2 - 1 0.8 I- a 0 . 6 - S o •§ 0.4 i Heat Shock 37°C 0.2 MT90 MT83 Plasm id 125 Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. 6. Discussion Of The Hsp90 Results One of the main objectives of this study was to determine whether another transla tional control mechanism accounts for some instances of heat shock preferential transla tion. HSP90 mRNA was selected because it possesses several features that distinguish it from other HSP mRNAs. For instance, its 5'UTR contains significant secondary struc ture, its translation rate is sensitive to eIF4F depletion, and its translation rate during normal growth temperature is relatively inefficient. That is, the levels of HSP90 protein dramatically increase as we increase temperature. Our results (discussed below) demon strate that F1SP90 mRNA translation is indeed unique from other Drosophila FISPs, such as HSP70. The increase in temperature induced the synthesis of HSP90 protein without a pro portional increase in HSP90 mRNA levels during heat shock (an increase in HSP70 pro tein synthesis is dependent upon increase in mRNA levels). This result provided us with the first evidence that FISP90 mRNAs in control cells were in a translationally repressed state. We therefore calculated the translational efficiency of HSP90 mRNA at different temperatures and compared it to HSP70 mRNA. Our results verified that the translation of HSP90 increases with temperature. We further established that the increase in HSP90 translation is proportional to increases in temperature. The results were different for HSP70, i.e., the T.E. of HSP70 mRNA did not increase proportionally to increases in temperature. Thus, the results determined that the rate of HSP90 mRNA trasnlation is increasing, and in a temperature dependent fashion. The next objective was to establish how the translation of HSP90 mRNA is altered to account for its increasing rate of translation. Sucrose density gradient analyses showed 126 Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. that as we heat shock cells, the HSP90 mRNA moves into the smaller polysome fractions. This disaggregation of the polysomal ribosomes by heat shock is characteristic of an ini tiation block to translation. This was surprising, because it is expected that actively translated RNAs (HSP90 protein synthesis increased with heat shock) move into heavier polysome associated fractions. Therefore, we first needed to establish whether HSP90 mRNAs were actually associated with the heavier polysomes at normal growth tempera- O -f- tures. EDTA is a chelator of Mg ions, which is needed by ribosomes for subunit asso ciation. Therefore, if we chelate the Mg2 + ions, the ribosomes can no longer associate and they fall apart, and any mRNA associated with them would be released and would move into the less dense fractions. Treatment of cells with EDTA showed that HSP90 mRNAs is indeed associated with polysomes, because HSP90 mRNAs moves towards the smaller polysome associated fractions. It was possible that at normal growth temperature, although HSP90 mRNA was asso ciated with polysomes, it was actually associated with polysomes that were not actively translating. To eliminate this possibility, we used puromycin to treat the cells. Puromycin can only bind to actively translating ribosomes and disrupt them, therefore, mRNAs asso ciated with these ribosomes would be released and would move into the less dense frac tions. Treatment of cells with puromycin further established that HSP90 mRNAs were polysome associated and that these ribosomes were not in an arrested state but rather ac tively translating. Nevertheless, how does one account for the shift (at heat shock) of HSP90 mRNA towards the smaller polysome associated fraction with an increase in protein synthesis? We know that because the synthesis of HSP90 protein is increasing with heat shock, the 127 Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. rate of initiation must be increasing, and because HSP90 protein synthesis increases with heat shock despite the shift towards the smaller polysomes, this clearly points to the fact that the rate of elongation must also be increasing (and at a greater rate than initiation) to compensate for the shift. Thus, the increase in the translation of HSP90 mRNA is due to an increase in the rate of initiation as well as elongation. Finally, the major unresolved problem concerns the mechanism of control of HSP90 synthesis at the initiation/elongation level. The HSP90 5’UTR, unlike other HSPs, con tains substantial secondary structure, typical of the amounts found in most non-heat shock mRNAs. Therefore, one possibility is that a stable secondary structure in the HSP90 mRNA prevenst the efficient transit of ribosomes on HSP90 mRNA. This pres ence of substantial secondary structure would also imply that unlike other HSPs, HSP90 would be dependent upon factors with helicase activity (e.g., eIF4F) to translate during normal temperatures. Support for this hypothesis comes from a study that showed trans lation of HSP90 is sensitive to depletion of eIF4F levels (Zapata, Maroto et al. 1991). Preliminary experiments in our laboratory also show that overexpressing eIF4E-BPl (and therefore indirectly inhibiting eIF4F complex) has less of an inhibitory effect during heat shock on transgene HSP90 (R. Ahmed and R. Duncan, unpublished results). Therefore, it is possible that at normal growth temperatures HSP90 mRNA has to compete with other cellular mRNAs for a limited amount of eIF4F for efficient translation, and this makes HSP90 mRNA dependent and translationally repressed. However, since all HSP mRNAs, including HSP90 mRNA, translate efficiently dur ing heat shock, an eIF4F inhibition based pathway cannot be the whole story. For in stance, it is possible that analogous to some forms of viral translation (Hentze 1997), 128 Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. HSP90 mRNA may also translate via an internal initiation pathway which is inhibited at normal growth temperatures. In particular, we propose that heat shock melts the HSP90 5’UTR to display (activate) a “cryptic” IRES site (as a direct or protein mediated conse quence of heating), which would then efficiently be able to recruit ribosomes. Since, competition exists between the cap-dependent and internal initiation pathways for ribo somes, heat shock induced inhibition of cap-dependent activity would thus allow an in ternal initiator like hsp90 mRNA to be more efficiently translated. Interestingly, a number of studies have proposed that temperature regulated melting of secondary structure of mRNAs, influences heat shock gene expression by controlling ribosome access to the ribosome binding sites (Yura, Kawasaki et al. 1990; Nagai, Yu- zawa et al. 1991; Nagai, Yuzawa et al. 1991) (Morita, Kanemori et al. 1999; Morita, Ta naka et al. 1999) (Nocker, Hausherr et al. 2001). In particular, the Nocker study was of interest to us because of a number of reasons. Firstly, the mechanism they put forward (originally proposed by Yura et al., for bacterial heat shock factor Sigma-32) is very similar to what we hypothesized above. That is, at normal growth temperature, the mRNA would form a secondary structure that occludes the ribosome binding site and the translation initiation codon and thereby prevent ribosome access. And, upon heat shock this structure would melt and enable ribosome loading and transit. The only difference between our two models is that, we also suggest that at normal temperatures HSP90 mRNA translates (albeit inefficiently) because of the helicase activity of eIF4F. Secondly, the structure of ROSE mRNA leader sequence is strikingly similar to the predicted structure of the HSP90 5’UTR (Figure 4.23). That is, HSP90 mRNA 5’UTR also has the presence of complimentary stretches of nucleotides, interrupted by internal 129 Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. Figure 4.23: Secondary Structure predictions of mRNAs from Drosophila and different Rhizobia. The secondary structure of the different mRNAs was predicted using the latest version of MFOLD (v. 3.1), and the similarity of HSP90 5’UTR is compared to Rhizobial 5’UTRs. The boxed portion of the mRNA is the 5’UTR sequence, and +1 represents the first transcribed nucleotide. Rhkabutm i p . N C R 2 3 4 BOSEm +1 / J +1 Drosophila HSP90 < y 130 Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. loops and peripheral loops, and the location of the translational start codon in first paired stretch of nucleotides. Therefore, it is likely that heat shock mediates a temperature de pendent melting of the imperfectly base paired HSP90 5’UTR nucleotides (this would also make eIF4F unnecessary), and exposes a hitherto cryptic ribosomal entry site. This ribosomal entry site would then allow the HSP90 mRNA to compete for ribosomes and preferentially translate during heat shock. Finally, in the Nocker study, the most important region for translational regulation was mapped to the 3’-end of the 5’UTR. This is in accordance with our findings, which show that deletion of the AUG proximal nucleotides completely abolishes translation. The rationale for this is simple - deletion of the AUG proximal nucleotides results in a much more stable stem structure, without the loop formations, therefore, the the 5’UTR cannot be easily melted. Thus, the presence of functional eIF4F complexes would again be necessaiy, and without which the HSP90 mRNA would not be able to translate at heat shock. In conclusion, our research results demonstrate that HSP90 mRNAs are polysome- associated yet translationally repressed in non heat shocked cells. These conclusions are based on the following: (i) sucrose density gradient analyses show that HSP90 mRNA sediments with large polysomes at normal growth temperature; (ii) EDTA or puromycin treatment causes the release of HSP90 mRNA from polysomes; and (iii) increasing the temperature proportionally increases the translation efficiency of HSP90 mRNA. Fur thermore, the experimental results demonstrated that the increase in the rate of translation of HSP90 mRNA is not just due to an increase in translation initiation but it is also due to 131 Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. a (much larger) increase in the rate of elongation (note that other HSPs appear to be ini tiation limited). Based on our experimental results we also determined that the full length HSP90 5’UTR has all the elements that are necessary and required for heat shock preferential translation. Moreover, the critcal region of the HSP90 5’UTR, responsible for heat shock translation, is -40 nucleotides in the AUG-proximal region of the leader. This is different from other HSPs (e.g., HSP70 discussed in an earlier section), whose -40 cap-proximal nucleotides appear to be important for regulation of heat shock preferential translation. Therefore, our research results provide clear evidence that another translational control mechanism accounts for HSP90 mRNA translation. We finally propose a model (similar to that hypothesized for bacterial heat shock factor Sigma-32 and rhizobial heat shock ROSE mRNAs) to account for the unique translation behaviour of HSP90. Specifically, in our model Drosophila HSP90 translation is not only regulated by initiation factor eIF4F activity during normal temperatures, but is also translationally regulated in a temperature dependent manner. Heat shock relieves this repression by melting the substantial secondary structure of HSP90 mRNA, exposing hitherto cryptic ribosomal recruitment sites that allow the HSP90 mRNA to recruit ribo somes. This recruitment of ribosomes by HSP90 during heat shock allows the HSP90 mRNA to preferentially translate at a time when other eIF4F dependent cellular RNAs are unable to translate, due to a heat shock induced lesion in this factor’s activity. Based on the experimental results and research conclusions above, three important lines of further investigation are motivated: (i) identify the detailed mechanism of trans lational regulation of HSP90 and confirm our proposed model above; (ii) identify which 132 Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. other eukaryotic mRNAs use the same translational mechanism of an mRNA-based thermosensor that can regulate the expression of its genes; (iii) to explore the broad im plications in gene regulation and gene expression optimization; and (iv) now that we have demonstrated that HSP90 translates using a different mechanism than other HSP, it is an interesting and important research question which other HSPs translate differently and determine those unique and most likely surprising other translational mechanisms - which of course opens up a whole new area of research inquiries. 133 Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. Bibliography Abramson, R. D., T. E. Dever, et al. (1988). "Biochemical-Evidence Supporting a Mechanism for Cap-Independent and Internal Initiation of Eukaryotic Messenger- Rna." Journal of Biological Chemistry 263(13): 6016-6019. Abravaya, K., B. Phillips, et al. (1991). "Heat Shock-Induced Interactions of Heat-Shock Transcription Factor and the Human Hsp70 Promoter Examined by Invivo Foot- printing." Molecular and Cellular Biology 11(1): 586-592. Altmann, M., P. P. Muller, et al. (1993). "A Saccharomyces-Cerevisiae Homolog of Mammalian Translation Initiation Factor-4b Contributes to Rna Helicase Activ ity." Embo Journal 12(10): 3997-4003. Amin, J., J. Ananthan, et al. (1988). "Key Features of Heat-Shock Regulatory Elements." Molecular and Cellular Biology 8(9): 3761-3769. Ballinger, D. G. and M. L. Pardue (1983). "The Control of Protein-Synthesis During Heat-Shock in Drosophila Cells Involves Altered Polypeptide Elongation Rates." CeU 33(1): 103-113. Beck, S. C. and A. Demaio (1994). "Stabilization of Protein-Synthesis in Thermotolerant Cells During Heat-Shock - Association of Heat-Shock Protein-72 with Ribo- somal-Subunits of Polysomes." Journal of Biological Chemistry 269(34): 21803- 21811. Bienz, M. and H. R. B. Pelham (1987). "Mechanisms of Heat-Shock Gene Activation in Higher Eukaryotes." Advances in Genetics Incorporating Molecular Genetic Medicine 24: 31-72. Biggin, M. D. and R. Tjian (1988). "Transcription Factors That Activate the Ultrabitho rax Promoter in Developmentally Staged Extracts." Cell 53(5): 699-711. Bohen, S. P. and K. R. Yamamoto (1994). Modulation of Steroid Receptor Signal Trans duction by Heat Shock Proteins. The Biology of Heat Shock Proteins and Mo lecular Chaperones. R. I. Morimoto, Tissieres, A., and Georgopoulos, C. Cold Spring Harbor, New York, Cold Spring Harbor Laboratory Press: 311-334. Brodsky, J. L. and R. Schekman (1994). Heat Shock Cognate Proteins and Polypeptide Translocation Across the Endoplasmic Reticulum Membrane. The Biology of Heat Shock Proteins and Molecular Chaperones. R. I. Morimoto, Tissieres, A., and Georgopoulos, C. Cold Spring Harbor, New York, Cold Spring Harbor Labo ratory Press: 85-109. 134 Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. Burdon, R. H. (1987). "Temperature and animal cell protein synthesis." Svmp.Soc.Exp.Biol. 41: 113-133. Burdon, R. H., V. Gill, et al. (1987). "Oxidative stress and heat shock protein induction in human cells." Free Radical Res. Commun. 3: 129-139. Carper, S. W., T. A. Rocheleau, et al. (1997). "Heat shock protein 27 stimulates recovery of RNA and protein synthesis following a heat shock." Journal of Cellular Bio chemistry 66(2): 153-164. Chang, G. C., R. Liu, et al. (1994). "Rat Fibroblasts Transfected with the Human 70-Kda Heat-Shock Gene Exhibit Altered Translation and Eukaryotic Initiation Factor-2- Alpha Phosphorylation Following Heat-Shock." International Journal of Hyper thermia 10(3): 325-337. Chomczynski, P. and N. Sacchi (1987). "Single-Step Method of Rna Isolation by Acid Guanidinium Thiocyanate Phenol Chloroform Extraction." Analytical Biochem istry 162(1): 156-159. Clos, J., J. T. Westwood, et al. (1990). "Molecular-Cloning and Expression of a Hex- americ Drosophila Heat-Shock Factor Subject to Negative Regulation." Cell 63(5): 1085-1097. Costlow, N. and J. T. Lis (1984). "High-Resolution Mapping of Dnase 1-Hypersensitive Sites of Drosophila Heat-Shock Genes in Drosophila-Melanogaster and Sac- charomyces-Cerevisiae." Molecular and Cellular Biology 4(9): 1853-1863. Craig, E. A., B. K. Baxter, et al. (1994). Cytosolic hsp70s of Saccharomyces cerevisiae: Roles in Protein Synthesis, Protein Translocation, Proteolysis and Regulation. The Biology of Heat Shock Proteins and Molecular Chaperones. R. I. Morimoto, Tis sieres, A., and Georgopoulos, C. Cold Spring Harbor, New York, Cold Spring Harbor Laboratory Press: 31-52. Croston, G. E., L. A. Kerrigan, et al. (1991). "Sequence-Specific Antirepression of His- tone Hl-Mediated Inhibition of Basal Rna Polymerase-Ii Transcription." Science 251(4994): 643-649. Cuesta, R., G. Laroia, et al. (2000). "Chaperone Hsp27 inhibits translation during heat shock by binding eIF4G and facilitating dissociation of cap-initiation complexes." Genes & Development 14(12): 1460-1470. Cunniff, N. F. A., J. Wagner, et al. (1991). "Modular Recognition of 5-Base-Pair DNA- Sequence Motifs by Human Heat-Shock Transcription Factor." Molecular and Cellular Biology 11(7): 3504-3514. 135 Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. Debenedetti, A. and C. Baglioni (1986). "Activation of Hemin-Regulated Initiation Fac- tor-Ii Kinase in Heat-Shocked Heia-Cells." Journal of Biological Chemistry 261(1): 338-342. Del Valle, L. J., C. Escribano, et al. (2002). "Calcium-induced decrease of the thermal stability and chaperone activity of alpha-crystallin." Biochimica Et Biophvsica Acta-Proteins and Proteomics 1601(1): 100-109. Dellavalle, R. P., R. Petersen, et al. (1994). "Preferential Deadenylation of Hsp70 Mes- senger-Rna Plays a Key Role in Regulating Hsp70 Expression in Drosophila- Melanogaster." Molecular and Cellular Biology 14(6): 3646-3659. Di Nocera, P. P. and I. B. Dawid (1983). "Transient Expression of Genes Introduced into Cultured-Cells of Drosophila." Proceedings of the National Academy of Sciences of the United States of America-Biological Sciences 80(23): 7095-7098. Dice, J. F., F. Agarraberes, et al. (1994). Heat Shock 70-kD Proteins and Lysosomal Proteolysis. The Biology of Heat Shock Proteins and Molecular Chaperones. R. I. Morimoto, Tissieres, A., and Georgopoulos, C. Cold Spring Harbor, New York, Cold Spring Harbor Laboratory Press: 137-151. DiDomenico, B. J., G. E. Bugaisky, et al. (1982). "Heat-Shock and Recovery Are Medi ated by Different Translational Mechanisms." Proceedings of the National Acad emy of Sciences of the United States of America-Biological Sciences 79(20): 6181-6185. DiDomenico, B. J., G. E. Bugaisky, et al. (1982a). "The Heat-Shock Response Is Self- Regulated at Both the Transcriptional and Posttranscriptional Levels." Cell 31(3): 593-603. Duncan, R. and J. W. B. Hershey (1984). "Evaluation of Isoelectric-Focusing Running Conditions During Two-Dimensional Isoelectric-Focusing Sodium Dodecyl Sul- fate-Polyacrylamide Gel-Electrophoresis - Variation of Gel Patterns with Chang ing Conditios and Optimized Isoelectric-Focusing Conditions." Analytical Bio chemistry 138(1): 144-155. Duncan, R. and J. W. B. Hershey (1984). "Heat Shock-Induced Translational Alterations in Hela-Cells - Initiation-Factor Modifications and the Inhibition of Translation." Journal of Biological Chemistry 259(19): 1882-1889. Duncan, R., S. C. Milburn, et al. (1987). "Regulated Phosphorylation and Low Abun dance of Hela-Cell Initiation-Factor Eif-4f Suggest a Role in Translational Con trol - Heat-Shock Effects on Eif-4f." Journal of Biological Chemistry 262(1): 380- 388. 136 Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. Duncan, R. F. (1996). Translational Control during Heat-Shock. Translational Control. J. W. B. Hershey, M. B. Mathews and N. Sonenberg. Cold Spring Harbor, Cold Spring Harbor Laboratory Press: 271-293. Duncan, R. F., D. R. Cavener, et al. (1995). "Heat-Shock Effects on Phosphorylation of Protein-Synthesis Initiation-Factor Proteins Eif-4e and Eif-2-Alpha in Droso phila." Biochemistry 34(9): 2985-2997. Duncan, R. F. and J. W. B. Hershey (1989). "Protein-Synthesis and Protein- Phosphorylation During Heat-Stress, Recovery, and Adaptation." Journal of Cell Biology 109(4): 1467-1481. Ehmsperger, M., S. Graber, et al. (1997). "Binding of non-native protein to Hsp25 during heat shock creates a reservoir of folding intermediates for reactivation." Embo Journal 16(2): 221-229. Eissenberg, J. C., I. L. Cartwright, et al. (1985). "Selected Topics in Chromatin Struc ture." Annual Review of Genetics 19: 485-536. Farrell, P. J., K. Balkow, et al. (1977). "Phosphorylation of Initiation-Factor Elf-2 and Control of Reticulocyte Protein-Synthesis." Cell 11(1): 187-200. Fischer, J. A., E. Giniger, et al. (1988). "Gal4 Activates Transcription in Drosophila." Nature 332(6167): 853-856. Fletcher, C. M., A. M. McGuire, et al. (1998). "4E binding proteins inhibit the translation factor eIF4E without folded structure." Biochemistry 37(1): 9-15. Frydman, J. and F.-U. Hartl (1994). Molecular Chaperone Functions od hsp70 and hsp60 in Protein Folding. The Biology of Heat Shock Proteins and Molecular Chaper ones. R. I. Morimoto, Tissieres, A., and Georgopoulos, C. Cold Spring Harbor, New York, Cold Spring Harbor Laboratory Press: 251-283. Gallie, D. R., H. Le, et al. (1997). "The phosphorylation state of translation initiation factors is regulated developmentally and following heat shock in wheat." Journal of Biological Chemistry 272(2): 1046-1053. Gallo, G. J., H. Prentice, et al. (1993). "Heat-Shock Factor Is Required for Growth at Normal Temperatures in the Fission Yeast Schizosaccharomyces-Pombe." Mo lecular and Cellular Biology 13(2): 749-761. Gallo, G. J., T. J. Schuetz, et al. (1991). "Regulation of Heat-Shock Factor in Schizosac- charomyces-Pombe More Closely Resembles Regulation in Mammals Than in Saccharomyces-Cerevisiae." Molecular and Cellular Biology 11(1): 281-288. 137 Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. Garabedian, M. J., B. M. Shepherd, et al. (1986). "A Tissue-Specific Transcription En hancer from the Drosophila Yolk Protein-1 Gene." Cell 45(6): 859-867. Garbe, J. C., W. G. Bendena, et al. (1989). "Sequence Evolution of the Drosophila Heat- Shock Locus Hsr-Omega .1. The Nonrepeated Portion of the Gene." Genetics 122(2): 403-415. Georgopulos, C., K. Lieberek, et al. (1994). Properties of the Heat Shock Proteins of Es cherichia coli and the Autoregulation of the Heat Shock Response. The Biology of Heat Shock Proteins and Molecular Chaperones. R. I. Morimoto, Tissieres, A., and Georgopoulos, C. Cold Spring Harbor, New York, Cold Spring Harbor Labo ratory Press: 209-249. Gething, M.-J., S. Blond-Elguindi, et al. (1994). Structure, Function, and Regulation of the Endoplasmic Reticulum Chaperone, BiP. The Biology of Heat Shock Proteins and Molecular Chaperones. R. I. Morimoto, Tissieres, A., and Georgopoulos, C. Cold Spring Harbor, New York, Cold Spring Harbor Laboratory Press: 111-135. Gething, M. J. and J. Sambrook (1992). "Protein Folding in the Cell." Nature 355(6355): 33-45. Giardina, C., M. Perezriba, et al. (1992). "Promoter Melting and Tfiid Complexes on Drosophila Genes Invivo." Genes & Development 6(11): 2190-2200. Gilmour, D. S. and J. T. Lis (1986). "Rna Polymerase-Ii Interacts with the Promoter Re gion of the Noninduced Hsp70 Gene in Drosophil-Melanogaster Cells." Molecu lar and Cellular Biology 6(11): 3984-3989. Gilmour, D. S., G. H. Thomas, et al. (1989). "Drosophila Nuclear Proteins Bind to Re gions of Alternating C-Residues and T-Residues in Gene Promoters." Science 245(4925): 1487-1490. Gingras, A. C., S. P. Gygi, et al. (1999). "Regulation of 4E-BP1 phosphorylation: a novel two-step mechanism." Genes & Development 13(11): 1422-1437. Gingras, A. C., S. G. Kennedy, et al. (1998). "4E-BP1, a repressor of mRNA translation, is phosphorylated and inactivated by the Akt(PKB) signaling pathway." Genes & Development 12(4): 502-513. Gingras, A. C., B. Raught, et al. (1999). "eIF4 initiation factors: Effectors of mRNA re cruitment to ribosomes and regulators of translation." Annual Review of Bio chemistry 68: 913-963. 138 R eproduced with permission of the copyright owner. Further reproduction prohibited without permission. Goldenberg, C. J., Y. Luo, et al. (1988). "Purified Human Factor Activates Heat-Shock Promoter in a Hela Cell-Free Transcription System." Journal of Biological Chemistry 263(36): 19734-19739. Green, M., T. J. Schuetz, et al. (1995). "A Heat Shock-Responsive Domain of Human Hsfl That Regulates Transcription Activation Domain Function." Molecular and Cellular Biology 15(6): 3354-3362. Harrison, C. J., A. A. Bohm, et al. (1994). "Crystal-Structure of the DNA-Binding Do main of the Heat-Shock Transcription Factor." Science 263(5144): 224-227. Hentze, M. W. (1997). "Translation - elF4G: A multipurpose ribosome adapter?" Science 275(5299): 500-501. Hershey, J. W. B. (1991). "Translational Control in Mammalian-Cells." Annual Review of Biochemistry 60: 717-755. Hershey, J. W. B. and W. C. Merrick (2000). Pathway and Mechanism of Initiation of Protein Synthesis. Translational Control of Gene Expression. M. B. Mathews, J. W. B. Hershey and N. Sonenberg. Cold Spring Harbor, Cold Spring Harbor Labo ratory Press: 33-88. Hess, M. A. and R. F. Duncan (1994). "Rna/Protein Interactions in the 5'-Untranslated Leader of Hsp70 Messenger-Rna in Drosophila Lysates - Lack of Evidence for Specific Protein-Binding." Journal of Biological Chemistry 269(14): 10913- 10922. Hess, M. A. and R. F. Duncan (1996). "Sequence and structure determinants of Droso phila Hsp70 mRNA translation: 5'-UTR secondary structure specifically inhibits heat shock protein mRNA translation." Nucleic Acids Research 24(12): 2441- 2449. Hickey, E. and L. A. Weber (1982). Preferential Translation of Heat-Shock mRNAs in HeLa Cells. Cold Spring Harbor, N.Y., Cold Spring Harbor Press. Hightower, L. E., S. E. Sadis, et al. (1994). Interactions of Vertebrate hsc70 and hsp70 with Unfolded Proteins and Peptides. The Biology of Heat Shock Proteins and Molecular Chaperones. R. I. Morimoto, Tissieres, A., and Georgopoulos, C. Cold Spring Harbor, New York, Cold Spring Harbor Laboratory Press: 179-207. Hoey, T., B. D. Dynlacht, et al. (1990). "Isolation and Characterization of the Drosophila Gene Encoding the Tata Box Binding-Protein, Tfiid." Cell 61(7): 1179-1186. 139 R eproduced with permission of the copyright owner. Further reproduction prohibited without permission. Holmgren, R., V. Corces, et al. (1981). "Sequence Homologies in the 5' Regions of 4 Drosophila Heat-Shock Genes." Proceedings of the National Academy of Sci ences of the United States of America-Biological Sciences 78(6): 3775-3778. Hughes, D. L., T. E. Dever, et al. (1993). "Further Biochemical-Characterization of Rab bit Reticulocyte Eif-4b." Archives of Biochemistry and Biophysics 301(2): 311- 319. Hultmark, D., R. Klemenz, et al. (1986). "Translational and Transcriptional Control Ele ments in the Untranslated Leader of the Heat-Shock Gene Hsp22." Cell 44(3): 429-438. Ingolia, T. D. and E. A. Craig (1981). "Primary Sequence of the 5' Flanking Regions of the Drosophila Heat-Shock Genes in Chromosome Subdivision 67b." Nucleic Acids Research 9(7): 1627-1642. Jakobsen, B. K. and H. R. B. Pelham (1991). "A Conserved Heptapeptide Restrains the Activity of the Yeast Heat-Shock Transcription Factor." Embo Journal 10(2): 369-375. Jolly, C. and R. I. Morimoto (2000). "Role of the heat shock response and molecular chaperones in oncogenesis and cell death." Journal of the National Cancer Insti tute 92(19): 1564-1572. Joshi-Barve, S., A. Debenedetti, et al. (1992). "Preferential Translation of Heat-Shock Messenger-Rnas in Hela-Cells Deficient in Protein-Synthesis Initiation-Factors Eif-4e and Eif-4-Gamma." Journal of Biological Chemistry 267(29): 21038- 21043. Kaufman, R. J., M. V. Davies, et al. (1989). "The Phosphorylation State of Eukaryotic Initiation Factor-Ii Alters Translational Efficiency of Specific Messenger-Rnas." Molecular and Cellular Biology 9(3): 946-958. Kingston, R. E., T. J. Schuetz, et al. (1987). "Heat-Inducible Human Factor That Binds to a Human Hsp70 Promoter." Molecular and Cellular Biology 7(4): 1530-1534. Klemenz, R., D. Hultmark, et al. (1985). "Selective Translation of Heat-Shock Messen- ger-Rna in Drosophila-Melanogaster Depends on Sequence Information in the Leader." Embo Journal 4(8): 2053-2060. Kozak, M. (1978). "How Do Eukaryotic Ribosomes Select Initiation Regions in Messen- ger-Rna." Cell 15(4): 1109-1123. Kozak, M. (1992). "Regulation of Translation in Eukaryotic Systems." Annual Review of Cell Biology 8: 197-225. 140 R eproduced with permission of the copyright owner. Further reproduction prohibited without permission. Kraus, K. W., Y. H. Lee, et al. (1988). "Sex-Specific Control of Drosophila-Melanogaster Yolk Protein-1 Gene-Expression Is Limited to Transcription." Molecular and Cellular Biology 8(11): 4756-4764. Kruger, C. and B. J. Benecke (1981). "Invitro Translation of Drosophila Heat-Shock and Non-Heat-Shock Messenger-Rnas in Heterologous and Homologous Cell-Free Systems." CeU 23(2): 595-603. Kurtz, S., J. Rossi, et al. (1986). "An Ancient Developmental Induction - Heat-Shock Proteins Induced in Sporulation and Oogenesis." Science 231(4742): 1154-1157. Lamphear, B. J. and R. Panniers (1990). "Cap Binding-Protein Complex That Restores Protein-Synthesis in Heat-Shocked Ehrlich Cell Lysates Contains Highly Phos- phorylated-Eif-4e." Journal of Biological Chemistry 265(10): 5333-5336. Lamphear, B. J. and R. Panniers (1991). "Heat-Shock Impairs the Interaction of Cap- Binding Protein Complex with 5' Messenger-Rna Cap." Journal of Biological Chemistry 266(5): 2789-2794. Landry, J., P. Chretien, et al. (1989). "Heat-Shock Resistance Conferred by Expression of the Human Hsp27 Gene in Rodent Cells." Journal of Cell Biology 109(1): 7-15. Landry, J., P. Chretien, et al. (1991). "Phosphorylation of Hsp27 During Development and Decay of Thermotolerance in Chinese-Hamster Cells." Journal of Cellular Physiology 147(1): 93-101. Langer, T. and W. Neupert (1994). Chaperoning Mitochondrial Biogenesis. The Biology of Heat Shock Proteins and Molecular Chaperones. R. I. Morimoto, Tissieres, A., and Georgopoulos, C. Cold Spring Harbor, New York, Cold Spring Harbor Labo ratory Press: 53-83. Layboum, P. J. and J. T. Kadonaga (1991). "Role of Nucleosomal Cores and Histone-Hl in Regulation of Transcription by Rna Polymerase-Ii." Science 254(5029): 238- 245. Le, H., R. L. Tanguay, et al. (1997). "Translation initiation factors eIF-iso4G and eIF-4B interact with the poly(A)-binding protein and increase its RNA binding activity." Journal of Biological Chemistry 272(26): 16247-16255. Lee, H. S., K. W. Kraus, et al. (1992). "DNA-Sequence Requirements for Generating Paused Polymerase at the Start of Hsp-70." Genes & Development 6(2): 284-295. Li, D. X. and R. F. Duncan (1995). "Transient Acquired Thermotolerance in Drosophila, Correlated with Rapid Degradation of Hsp70 During Recovery." European Jour nal of Biochemistry 231(2): 454-465. 141 R eproduced with permission of the copyright owner. Further reproduction prohibited without permission. Li, G. C., L. G. Li, et al. (1991). "Thermal Response of Rat Fibroblasts Stably Trans fected with the Human 70-Kda Heat-Shock Protein-Encoding Gene." Proceedings of the National Academy of Sciences of the United States of America 88(5): 1681-1685. Lin, T. A., X. M. Kong, et al. (1994). "Phas-1 as a Link between Mitogen-Activated Protein-Kinase and Translation Initiation." Science 266(5185): 653-656. Lindquist, S. (1980). "Translational Efficiency of Heat-Induced Messages in Drosophila- Melanogaster Cells." Journal of Molecular Biology 137(2): 151-158. Lindquist, S. (1980). "Varying Patterns of Protein-Synthesis in Drosophila During Heat- Shock - Implications for Regulation." Developmental Biology 77(2): 463-479. Lindquist, S. (1981). "Regulation of Protein-Synthesis During Heat-Shock." Nature 293(5830): 311-314. Lindquist, S. (1993). Autoregulation of the Heat-Shock Response. Translational Regula tion of Gene Expression 2. J. Ilan. New York, Plenum Press: 279-320. Lindquist, S. (1993). Translational regulation in the heat shock response of Drosophila cells. Translational Regulation of Gene Expression. J. Ilan. New York, NY., Ple num Press. II: 187-207. Lindquist, S. and E. A. Craig (1988). "The Heat-Shock Proteins." Annual Review of Ge netics 22:631-677. Lindquist, S. and R. Petersen (1990). "Selective Translation and Degradation of Heat- Shock Messenger-Rnas in Drosophila." Enzyme 44(1-4): 147-166. Lis, J. and C. Wu (1993). "Protein Traffic on the Heat-Shock Promoter - Parking, Stall ing, and Trucking Along." Cell 74(1): 1-4. Lis, J. T., W. Neckameyer, et al. (1981). "Cloning and Characterization of 9-Heat-Shock- Induced Messenger-Rnas of Drosophila-Melanogaster." Gene 15(1): 67-80. Liu, R. Y., X. C. Li, et al. (1992). "Expression of Human Hsp70 in Rat Fibroblasts En hances Cell-Survival and Facilitates Recovery from Translational and Transcrip tional Inhibition Following Heat-Shock." Cancer Research 52(13): 3667-3673. Lu, L. R., A. P. Han, et al. (2001). "Translation initiation control by heme-regulated eu karyotic initiation factor 2 alpha kinase in erythroid cells under cytoplasmic stresses." Molecular and Cellular Biology 21(23): 7971-7980. 142 R eproduced with permission of the copyright owner. Further reproduction prohibited without permission. Lu, Q., L. L. Wallrath, et al. (1992). "Promoter Sequence Containing (Ct)N Bullet(Ga)N Repeats Is Critical for the Formation of the Dnase-I Hypersensitive Sites in the Drosophila-Hsp26 Gene." Journal of Molecular Biology 225(4): 985-998. Lu, Q., L. L. Wallrath, et al. (1993). "(Ct)N.(Ga)N Repeats and Heat-Shock Elements Have Distinct Roles in Chromatin Structure and Transcriptional Activation of the Drosophila-Hsp26 Gene." Molecular and Cellular Biology 13(5): 2802-2814. Marissen, W. E., A. Gradi, et al. (2000). "Cleavage of eukaryotic translation initiation factor 4GII correlates with translation inhibition during apoptosis." Cell Death and Differentiation 7(12): 1234-1243. Maroto, F. G. and J. M. Sierra (1988). "Translational Control in Heat-Shocked Droso phila Embryos - Evidence for the Inactivation of Initiation Factor(S) Involved in the Recognition of Messenger-Rna Cap Structure." Journal of Biological Chem istry 263130V. 15720-15725. Martin, M., A. Giangrande, et al. (1989). "Induction and Repression of the Drosophila- Sgs-3 Glue Gene Are Mediated by Distinct Sequences in the Proximal Promoter." Embo Journal 8(2): 561-568. Mathews, M. B., J. W. B. Hershey, et al., Eds. (2000). Translational Control of Gene Ex pression. Cold Spring Harbor, Cold Spring Harbor Laboratory Press. Matts, R. L., R. Hurst, et al. (1993). "Denatured Proteins Inhibit Translation in Hemin- Supplemented Rabbit Reticulocyte Lysate by Inducing the Activation of the Heme-Regulated Eif-2-Alpha Kinase." Biochemistry 32(29): 7323-7328. Mcgarry, T. J. (1986). Genetic analysis of heat shock protein synthesis. Department of Biochemistry. Chicago, University of Chicago. McGarry, T. J. and S. Lindquist (1985). "The Preferential Translation of Drosophila Hsp70 Messenger-Rna Requires Sequences in the Untranslated Leader." Cell 42(3): 903-911. Merrick, W. C. (1992). "Mechanism and Regulation of Eukaryotic Protein-Synthesis." Microbiological Reviews 56(2): 291-315. Methot, N., G. Pickett, et al. (1996). "In vitro RNA selection identifies RNA ligands that specifically bind to eukaryotic translation initiation factor 4B: The role of the RNA recognition motif." Rna-a Publication of the Rna Society 2(1): 38-50. Mirault, M. E., R. Southgate, et al. (1982). "Regulation of Heat-Shock Genes - a DNA- Sequence Upstream of Drosophila-Hsp70 Genes Is Essential for Their Induction in Monkey Cells." Embo Journal 1(10): 1279-1285. 143 R eproduced with permission of the copyright owner. Further reproduction prohibited without permission. Mizzen, L. A. and W. J. Welch (1988). "Characterization of the Thermotolerant Cell .1. Effects on Protein-Synthesis Activity and the Regulation of Heat-Shock Protein- 70 Expression." Journal of Cell Biology 106(4): 1105-1116. Morgan, W. D., G. T. Williams, et al. (1987). "2 Transcriptional Activators, Ccaat-Box- Binding Transcription Factor and Heat-Shock Transcription Factor, Interact with a Human Hsp70-Gene Promoter." Molecular and Cellular Biology 7(3): 1129- 1138. Morimoto, R. I., P. E. Kroeger, et al. (1996). The transcriptional regulation of heat shock genes: A plethora of heat shock factors and regulatory conditions. Stress- Inducible Cellular Responses. U. Feige, R. I. Morimoto, I. Yahara and B. S. Polla. Basel-Boston-Berlin, Birkhauser-Verlag: 139-163. Morimoto, R. I., A. Tissieres, et al. (1990). The stress response, function of the proteins, and perspectives. Stress proteins in biology and medicine. R. I. Morimoto, Tis sieres, A., and Georgopoulos, C. Cold Spring Harbor, New York, Cold Spring Harbor Laboratory Press: 1-36. Morino, S., H. Imataka, et al. (2000). "Eukaryotic translation initiation factor 4E (eIF4E) binding site and the middle one-third of eIF4GI constitute the core domain for cap-dependent translation, and the C-terminal one-third functions as a modulatory region." Molecular and Cellular Biology 20(2): 468-477. Morita, M., M. Kanemori, et al. (1999). "Heat-induced synthesis of sigma(32) in Es cherichia coli: Structural and functional dissection of rpoH mRNA secondary structure." Journal of Bacteriology 181(2): 401-410. Morita, M. T,, Y. Tanaka, et al. (1999). "Translational induction of heat shock transcrip tion factor sigma(32): evidence for a built-in RNA thermosensor." Genes & De velopment 13(6): 655-665. Morley, S. J., T. E. Dever, et al. (1991). "Phosphorylation of Eif-4f by Protein-Kinase-C or Multipotential S6 Kinase Stimulates Protein-Synthesis at Initiation." Journal of Biological Chemistry 266(8): 4669-4672. Mosser, D. D., N. G. Theodorakis, et al. (1988). "Coordinate Changes in Heat-Shock Element-Binding Activity and Hsp70 Gene-Transcription Rates in Human-Cells." Molecular and Cellular Biology 8(11): 4736-4744. Murtha-Riel, P., M. V. Davies, et al. (1993). "Expression of a Phosphorylation-Resistant Eukaryotic Initiation Factor-Ii Alpha-Subunit Mitigates Heat-Shock Inhibition of Protein-Synthesis." Journal of Biological Chemistry 268(17): 12946-12951. 144 R eproduced with permission of the copyright owner. Further reproduction prohibited without permission. Nagai, H., H. Yuzawa, et al. (1991). "Interplay of 2 Cis-Acting Messenger-Rna Regions in Translational Control of Sigma-32 Synthesis During the Heat-Shock Response of Escherichia-Coli." Proceedings of the National Academy of Sciences of the United States of America 88(23): 10515-10519. Nagai, H., H. Yuzawa, et al. (1991). "Regulation of the Heat-Shock Response in Es- cherichia-Coli - Involvement of Positive and Negative Cis-Acting Elements in Translational Control of Sigma-32 Synthesis." Biochimie 73(12): 1473-1479. Nakai, A. and R. I. Morimoto (1993). "Characterization of a Novel Chicken Heat-Shock Transcription Factor, Heat-Shock Factor-Iii, Suggests a New Regulatory Path way." Molecular and Cellular Biology 13(4): 1983-1997. Nakai, A., M. Tanabe, et al. (1997). "HSF4, a new member of the human heat shock fac tor family which lacks properties of a transcriptional activator." Molecular and Cellular Biology 17(1): 469-481. Nocker, A., T. Hausherr, et al. (2001). "A mRNA-based thermosensor controls expres sion of rhizobial heat shock genes." Nucleic Acids Research 29(23): 4800-4807. O' Brien, T. and T. S. Lis (1991). "RNA polymerase II pauses at the 5'end of the tran scriptionally induced Drosophila hsp70 gene." Molecular and Cellular Biology 11: 5285-5290. O'Brien, T. and J. T. Lis (1993). "Rapid Changes in Drosophila Transcription after an In stantaneous Heat-Shock." Molecular and Cellular Biology 13(6): 3456-3463. O'Farrell, P. H. (1975). "High resolution two-dimensional electrophoresis of proteins." Journal of Biological Chemistry 250(10): 4007-4021. Pain, V. M. (1986). "Initiation of Protein-Synthesis in Mammalian-Cells." Biochemical Journal 235(3): 625-637. Pain, V. M. (1996). "Initiation of protein synthesis in eukaryotic cells." European Journal of Biochemistry 236(3): 747-771. Panniers, R. and E. C. Henshaw (1984). "Mechanism of Inhibition of Polypeptide-Chain Initiation in Heat-Shocked Ehrlich Ascites Tumor-Cells." European Journal of Biochemistry 140(1): 209-214. Panniers, R., E. B. Stewart, et al. (1985). "Mechanism of Inhibition of Polypeptide-Chain Initiation in Heat-Shocked Ehrlich Cells Involves Reduction of Eukaryotic Initia tion Factor-4f Activity." Journal of Biological Chemistry 260(17): 9648-9653. 145 R eproduced with permission of the copyright owner. Further reproduction prohibited without permission. Parker, C. S. and J. Topol (1984). "A Drosophila Rna Polymerase-Ii Transcription Factor Contains a Promoter-Region-Specific DNA-Binding Activity." Cell 36(2): 357- 369. Patel, J., L. E. McLeod, et al. (2002). "Cellular stresses profoundly inhibit protein synthe sis and modulate the states of phosphorylation of multiple translation factors." European Journal of Biochemistry 269(12): 3076-3085. Pause, A., G. J. Belsham, et al. (1994). "Insulin-Dependent Stimulation of Protein- Synthesis by Phosphorylation of a Regulator of 5'-Cap Function." Nature 371(6500): 762-767. Pelham, H. R. B. (1982). "A Regulatory Upstream Promoter Element in the Drosophila Hsp 70 Heat-Shock Gene." Ce» 30(2): 517-528. Perisic, O., H. Xiao, et al. (1989). "Stable Binding of Drosophila Heat-Shock Factor to Head-to-Head and Tail-to-Tail Repeats of a Conserved 5-Bp Recognition Unit." Cell 59(5): 797-806. Peteranderl, R. and H. C. M. Nelson (1992). "Trimerization of the Heat-Shock Tran scription Factor by a Triple-Stranded Alpha-Helical Coiled-Coil." Biochemistry 31(48): 12272-12276. Petersen, N. S. and H. K. Mitchell (1981). "Recovery of Protein-Synthesis after Heat- Shock - Prior Heat-Treatment Affects the Ability of Cells to Translate Messenger- Rna." Proceedings of the National Academy of Sciences of the United States of America-Biological Sciences 78(31: 1708-1711. Petersen, R. and S. Lindquist (1988). "The Drosophila Hsp70 Message Is Rapidly De graded at Normal Temperatures and Stabilized by Heat-Shock." Gene 72(1-2): 161-168. Petersen, R. B. and S. Lindquist (1989). "Regulation of Hsp70 Synthesis by Messenger- Rna Degradation." Cell Regulation 1(1): 135-149. Rabindran, S. K., G. Giorgi, et al. (1991). "Molecular-Cloning and Expression of a Hu man Heat-Shock Factor, Hsfl." Proceedings of the National Academy of Sciences of the United States of America 88(16): 6906-6910. Rabindran, S. K., R. I. Haroun, et al. (1993). "Regulation of Heat-Shock Factor Trimer Formation - Role of a Conserved Leucine Zipper." Science 259(5092): 230-234. 146 R eproduced with permission of the copyright owner. Further reproduction prohibited without permission. Randall, L. L., T. B. Topping, et al. (1994). The Basis of Recognition of Nonnative Structure by the Chaperone SecB. The Biology of Heat Shock Proteins and Mo lecular Chaperones. R. I. Morimoto, Tissieres, A., and Georgopoulos, C. Cold Spring Harbor, New York, Cold Spring Harbor Laboratory Press: 285-297. Rasmussen, E. B. and J. T. Lis (1993). "In-Vivo Transcriptional Pausing and Cap Forma tion on 3 Drosophila Heat-Shock Genes." Proceedings of the National Academy of Sciences of the United States of America 90(17): 7923-7927. Rhoads, R. E. (1993). "Regulation of Eukaryotic Protein-Synthesis by Initiation-Factors." Journal of Biological Chemistry 268(5): 3017-3020. Roberts, J. W. (1988). "Phage-Lambda and the Regulation of Transcription Termination." Cell 52(1): 5-6. Rouault, T. A. and J. B. Harford (2000). Translational Control of Ferritin Synthesis. Translational Control of Gene Expression. M. B. Mathews, J. W. B. Hershey and N. Sonenberg. Cold Spring Harbor, Cold Spring Harbor Laboratory Press: 655- 670. Rougvie, A. E. and J. T. Lis (1988). "The Rna Polymerase-Ii Molecule at the 5' End of the Uninduced Hsp70 Gene of Drosophila-Melanogaster Is Transcriptionally En gaged." CeU 54(6): 795-804. Sanchez, Y. and S. L. Lindquist (1990). "Hspl04 Required for Induced Thermotoler ance." Science 248(4959): 1112-1115. Sarge, K. D., V. Zimarino, et al. (1991). "Cloning and Characterization of 2 Mouse Heat- Shock Factors with Distinct Inducible and Constitutive DNA-Binding Ability." Genes & Development 5(10): 1902-1911. Scharf, K. D., S. Rose, et al. (1990). "3 Tomato Genes Code for Heat-Stress Transcrip tion Factors with a Region of Remarkable Homology to the DNA-Binding Do main of the Yeast Hsf." Embo Journal 9(13): 4495-4501. Scheper, G. C., J. Mulder, et al. (1997). "Inactivation of eIF2B and phosphorylation of PHAS-I in heat-shocked rat hepatoma cells." Journal of Biological Chemistry 272(43): 26850-26856. Scheper, G. C. and C. G. Proud (2002). "Does phosphorylation of the cap-binding protein eIF4E play a role in translation initiation?" European Journal of Biochemistry 269(22): 5350-5359. 147 R eproduced with permission of the copyright owner. Further reproduction prohibited without permission. Schneider, R. J. (2000). Translational Control during Heat-Shock. Translational Control of Gene Expression. N. Sonenberg, J. W. B. Hershey and M. B. Mathews. Cold Spring Harbor, Cold Spring Harbor Laboratory Press: 581-593. Schuetz, T. J., G. J. Gallo, et al. (1991). "Isolation of a Cdna for Hsf2 - Evidence for 2 Heat-Shock Factor Genes in Humans." Proceedings of the National Academy of Sciences of the United States of America 88(16): 6911-6915. Sistonen, L., K. D. Sarge, et al. (1992). "Activation of Heat-Shock Factor-Ii During He- min-Induced Differentiation of Human Erythroleukemia-Cells." Molecular and Cellular Biology 12(9): 4104-4 111. Soeller, W. C., S. J. Poole, et al. (1988). "Invitro Transcription of the Drosophila- Engrailed Gene." Genes & Development 2(1): 68-81. Solomon, J. M., J. M. Rossi, et al. (1991). "Changes in Hsp70 Alter Thermotolerance and Heat-Shock Regulation in Drosophila." New Biologist 3(11): 1106-1120. Soncin, F., A. Asea, et al. (2000). "Role of calcium activated kinases and phosphatases in heat shock factor-1 activation." International Journal of Molecular Medicine 6(6): 705-710. Sonenberg, N. (1988). "Cap-Binding Proteins of Eukaryotic Messenger-Rna - Functions in Initiation and Control of Translation." Progress in Nucleic Acid Research and Molecular Biology 35: 173-207. Sonenberg, N. (1996). mRNA 5' Cap-binding Protein eIF4E and control of Cell Growth. Translational Control. J. W. B. Hershey, M. B. Mathews and N. Sonenberg. Cold Spring Harbor, Cold Spring Harbor Laboratory Press: 245-269. Song, H. J., D. R. Gallie, et al. (1995). "M(7)Gpppg Cap Dependence for Efficient Translation of Drosophila 70-Kda Heat-Shock-Protein (Hsp70) Messenger-Rna." European Journal of Biochemistry 232(3): 778-788. Sorger, P. K. (1990). "Yeast Heat-Shock Factor Contains Separable Transient and Sus tained Response Transcriptional Activators." Cell 62(4): 793-805. Sorger, P. K. and H. R. B. Pelham (1987). "Purification and Characterization of a Heat- Shock Element Binding-Protein from Yeast." Embo Journal 6(10): 3035-3041. Sorger, P. K. and H. R. B. Pelham (1988). "Yeast Heat-Shock Factor Is an Essential DNA-Binding Protein That Exhibits Temperature-Dependent Phosphorylation." Cell 54(6): 855-864. 148 R eproduced with permission of the copyright owner. Further reproduction prohibited without permission. Sprengart, M. L., E. Fuchs, et al. (1996). "The downstream box: An efficient and inde pendent translation initiation signal in Escherichia coli." Embo Journal 15(3): 665-674. Sprengart, M. L. and A. G. Porter (1997). "Functional importance of RNA interactions in selection of translation initiation codons." Molecular Microbiology 24(1): 19-28. Storti, R. V., M. P. Scott, et al. (1980). "Translational Control of Protein-Synthesis in Re sponse to Heat-Shock in Drosophila-Melanogaster Cells." Cell 22(3): 825-834. Tanabe, M., Y. Kawazoe, et al. (1998). "Disruption of the HSF3 gene results in the se vere reduction of heat shock gene expression and loss of thermotolerance." Embo Journal 17(6): 1750-1758. Taylor, I. C. A., J. L. Workman, et al. (1991). "Facilitated Binding of Gal4 and Heat- Shock Factor to Nucleosomal Templates - Differential Function of DNA-Binding Domains." Genes & Development 5(7): 1285-1298. Theodorakis, N. G., S. S. Banerji, et al. (1988). "Hsp70 Messenger-Rna Translation in Chicken Reticulocytes Is Regulated at the Level of Elongation." Journal of Bio logical Chemistry 263(28): 14579-14585. Thomas, G. H. and S. C. R. Elgin (1988). "Protein DNA Architecture of the Dnase-I Hy persensitive Region of the Drosophila Hsp26 Promoter." Embo Journal 7(7): 2191-2201. Topol, J., D. M. Ruden, et al. (1985). "Sequences Required for Invitro Transcriptional Activation of a Drosophila Hsp 70 Gene." Cell 42(2): 527-537. Vivinus, S., S. Baulande, et al. (2001). "An element within the 5 ' untranslated region of human Hsp70 mRNA which acts as a general enhancer of mRNA translation." European Journal of Biochemistry 268(7): 1908-1917. Voellmy, R. (1996). Sensing stress and responding to stress. Stress-Inducible Cellular Responses. U. Feige, R. I. Morimoto, I. Yahara and B. S. Polla. Basel-Boston- Berlin, Birkhauser-Verlag: 121-137. Vries, R. G. J., A. Flynn, et al. (1997). "Heat shock increases the association of binding protein-1 with initiation factor 4E." Journal of Biological Chemistry 272(52): 32779-32784. Wang, X. M., A. Flynn, et al. (1998). "The phosphorylation of eukaryotic initiation factor eIF4E in response to phorbol esters, cell stresses, and cytokines is mediated by distinct MAP kinase pathways." Journal of Biological Chemistry 273(16): 9373- 9377. 149 R eproduced with permission of the copyright owner. Further reproduction prohibited without permission. Welch, W. J. and J. P. Suhan (1986). "Cellular and Biochemical Events in Mammalian- Cells During and after Recovery from Physiological Stress." Journal of Cell Biol ogy 103(5): 2035-2052. Westwood, J. T., J. Clos, et al. (1991). "Stress-Induced Oligomerization and Chromoso mal Relocalization of Heat-Shock Factor." Nature 353(6347): 822-823. Wiederrecht, G., D. Seto, et al. (1988). "Isolation of the Gene Encoding the S-Cerevisiae Heat-Shock Transcription Factor." Cell 54(6): 841-853. Wiederrecht, G., D. J. Shuey, et al. (1987). "The Saccharomyces and Drosophila Heat- Shock Transcription Factors Are Identical in Size and DNA-Binding Properties." Cell 48(3): 507-515. Williams, G. T. and R. I. Morimoto (1990). "Maximal Stress-Induced Transcription from the Human Hsp70 Promoter Requires Interactions with the Basal Promoter Ele ments Independent of Rotational Alignment." Molecular and Cellular Biology 10(6): 3125-3136. Willison, K. R. and H. Kubota (1994). The Structure, Function, and Genetics of the Chaperonin containing TCP-1 (CCT) in Eukaryotic Cytosol. The Biology of Heat Shock Proteins and Molecular Chaperones. R. I. Morimoto, Tissieres, A., and Georgopoulos, C. Cold Spring Harbor, New York, Cold Spring Harbor Labora tory Press: 299-312. Workman, J. L. and A. R. Buchman (1993). "Multiple Functions of Nucleosomes and Regulatory Factors in Transcription." Trends in Biochemical Sciences 18(3): 90- 95. Wu, C. (1980). "The 5' Ends of Drosophila Heat-Shock Genes in Chromatin Are Hyper sensitive to Dnase-I." Nature 286(5776): 854-860. Wu, C. (1984). "2 Protein-Binding Sites in Chromatin Implicated in the Activation of Heat-Shock Genes." Nature 309(5965): 229-234. Wu, C. (1984). "Activating Protein Factor Binds Invitro to Upstream Control Sequences in Heat-Shock Gene Chromatin." Nature 311(5981): 81-84. Wu, C., S. Wilson, et al. (1987). "Purification and Properties of Drosophila Heat-Shock Activator Protein." Science 238(4831): 1247-1253. Xiao, H., O. Perisic, et al. (1991). "Cooperative Binding of Drosophila Heat-Shock Fac tor to Arrays of a Conserved 5 Bp Unit." Cell 64(3): 585-593. 150 R eproduced with permission of the copyright owner. Further reproduction prohibited without permission. Yost, H. J. and S. Lindquist (1986). "Rna Splicing Is Interrupted by Heat-Shock and Is Rescued by Heat-Shock Protein-Synthesis." Cell 45(2): 185-193. Yost, H. J., R. B. Petersen, et al. (1990). "Rna-Metabolism - Strategies for Regulation in the Heat-Shock Response." Trends in Genetics 6(7): 223-227. Yueh, A. and R. J. Schneider (1996). "Selective translation initiation by ribosome jump ing in adenovirus-infected and heat-shocked cells." Genes & Development 10(12): 1557-1567. Yueh, A. and R. J. Schneider (2000). "Translation by ribosome shunting on adenovirus and hsp70 mRNAs facilitated by complementarity to 18S rRNA." Genes & De velopment 14(4): 414-421. Yura, T., Y. Kawasaki, et al. (1990). "Roles and Regulation of the Heat-Shock Sigma- Factor Sigma-32 in Escherichia-Coli." Antonie Van Leeuwenhoek International Journal of General and Molecular Microbiology 58(3): 187-190. Zapata, J. M., F. G. Maroto, et al. (1991). "Inactivation of Messenger-Rna Cap-Binding Protein Complex in Drosophila-Melanogaster Embryos under Heat-Shock." Jour nal of Biological Chemistry 266(24): 16007-16014. Zapata, J. M., M. A. Martinez, et al. (1994). "Purification and Characterization of Eu karyotic Polypeptide-Chain Initiation-Factor 4f from Drosophila-Melanogaster Embryos." Journal of Biological Chemistry 269(27): 18047-18052. Zhao, M. J., D. Tang, et al. (2002). "Double-stranded RNA-dependent protein kinase (pkr) is essential for thermotolerance, accumulation of HSP70, and stabilization of ARE-containing HSP70 mRNA during stress." Journal of Biological Chemistry 277(46): 44539-44547. Zimarino, V. and C. Wu (1987). "Induction of Sequence-Specific Binding of Drosophila Heat-Shock Activator Protein without Protein-Synthesis." Nature 327(6124): 727- 730. Zucker, M., D. H. Mathews, et al. (1999). Algorithims and thermodynamics for RNA secondary structure prediction: a practical guide. RNA Biochemistry and Bio technology. J. Barciszewski and B. F. C. Clark. Dordrecht, The Netherlands, Kluwer Academic: 11-43. 151 R eproduced with permission of the copyright owner. Further reproduction prohibited without permission. A p p e n d i x Construction of plasmid MT301 Clal a) Pf 'R amplify pDM301*with primers DU66 and I>U67 b) Gel purify EeoRl-Oal fragment Amp pDM 301 Topo 2.1 EcoRI insert end Clal EcoRI Clal c) ligate EcoRi-Clal fragment with Topo 2,1 vector Amp EcoRI PM TSL17.6 Clal f) Digest PMTSL.17.6 with EcoRl/Cla.1 enzymes g) O P the digested PM1SL17.6 plasmid and gel purity vector t r EcoRI Clal d) Digest 301/1'opo 2,1 will] EcoRl/Clal enzymes e) Gel purify 242bp insert Amp Clal EcoRI PM TSL17.6 h) Lieate the linearized PMTS1.17.6 wit It EcoRI/Clal insert i) New vector M l 301 EcoRI Clal Amp MT301 152 R eproduced with permission of the copyright owner. Further reproduction prohibited without permission. Construction of plasmid MT306 EcoRI a) P C R amplify pl)M306* with primes 1)1166 and OU69 b) (iel purify EcoRl-SnaBI fragment Amp Topo 2.1 EcoRI SnaBI insert end SnaBI EcoRI O ligate EcoRI-SnaBI fragment with Topo 2.1 Amp EcoRI MT301 SnaBI SnaBI 306/Topo 2.1 f) Digest MT301 with EcoRI/SnaBI enzymes g) CIP the digested MT301 plasmid and gel purify vector EcoRI d) Digest 306/Topo 21 with EcoSI/SnaBl enzymes e) Gel purify ~1200bp insert Amp SnaBI EcoRI MT301 SnaBI h) Ligate the linearized M l 301 with EcoRI/SnaBI insert i) New vector MT306 EcoRI Amp M T306 SnaBI 153 R eproduced with permission of the copyright owner. Further reproduction prohibited without permission. Construction of plasmid MT10 Revert EcoRI a) K 'R amplify MT306 with primers DU73 and 01169 b) Gel purify EcoRl-SnaBI fragment Amp M T306 Topo 2.1 EcoRI SnaBI insert end SnaBI EcoRI c) ligate EcoRl-SnaBI fragment with Topo 2.1 Amp EcoRI M T306 SnaBI SnaBI lOR/Topo 2.1 f) Digest MT306 with EcoRI/SnaBI enzymes g) CJP the digested MT306 plasmid and gel purify vector EcoRI d) Digest lOK/I'opo 2.1 with EcoRI/SnaBI enzymes e) Gel purify ~12Q0bp insert Amp SnaBI EcoRI M T306 SnaBI h) ligate the linearized MT306 with EcoRI/SnaBI insert: i) New vector MT10 Revert EcoRI Amp M T10 Revert SnaBI 154 R eproduced with permission of the copyright owner. Further reproduction prohibited without permission. Construction of plasmid MT20 Revert EcoRI a) R'R amplify MT30n with primers I51J74 and DU69 b) Gel purify EcoRl-SnaBI fragment Amp M T306 Topo 2.1 EcoRI SnaBI insert end SnaBI EcoRI c) ligate EcoRI-SnaBI fragment witb Topo 2.I Amp EcoRI M T306 SnaBI SnaBI f) Digest MT306 with EcoRI/SnaBI enzymes g) C1P the digested MT306 plasmid and gel purify vector t r EcoRI d> Digest 2UR/Topo 2.1 with EcoRI/SnaBI enzymes e) Gel purify -~1200bp insert Amp SnaBI EcoRI M T306 h) ligate the linearized MT306 with EcoRI/SnaBI insert i 1 New vector MT20 Revert EcoRI Amp M T20 Revert SnaBI 155 R eproduced with permission of the copyright owner. Further reproduction prohibited without permission. Construction of plasmid Short70 EcoRI a) PCR amplify MT306 with primers DU 75 and DU69 b) tie) purify KcoRl-SnaB) fragment Amp M T306 Topo 2.1 EcoRI SnaBI insert end SnaBI EcoRI c) Ligate EcoRl-SnaBI fragment with Topo 2.1 Amp EcoRI M T306 SnaBI SnaBI S70/Topo 2.1 f) Digest Mfr306 with EcoRI/SnaBI enzymes g) CIP the digested MI 306 plasmid and gel purify vector EcoRI d) Digest S?0/T'OpG 2.1 with EcoRI/SnaBI enzymes e) Gel purify ~1200bp insert Amp M T306 SnaBI EcoRI SnaBI h) ligate the linearized MT306 with EcoRI/SnaBI insert i) New vector Shoit70 EcoRI Amp Short70 SnaBI 156 R eproduced with permission of the copyright owner. Further reproduction prohibited without permission. Construction of plasmid MT22 EcoRI a) PCR amplify M1306 with primers 01176 and 0U69 b) Oel purity EcoRl-SnaBI fragment Amp M T306 Topo 2.1 EcoRI SnaBI insert end SnaBI EcoRI c) Ligate EcoRI SnaBI fragment with lopo 2 .1 Amp EcoRI M T306 SnaBI SnaBI M T22/Topo 2.1 f) Digest .V IT A > 6 with EcoRI/SnaBI enzymes g) CIP the digested MT 306 plasmid and gel purify vector EcoRI d) Digest MT227Topo 2.1 with EeoRl/SnaBl enzymes e) Gd purify -) 200bp insert Amp M T306 EcoRI SnaBI SnaBI 1 1 1 Ligate the linearized MT306 with EcoRI/SnaBI insert i) New vector MT22 EcoRI Amp M T22 SnaBI 157 R eproduced with permission of the copyright owner. Further reproduction prohibited without permission. Construction of plasmid MT306-NcoI Mfel Clal a) PCR amplify MT306 with primers DU7Q ami UU68 li) tie! purify- Mfel-Cial fragment Amp MT306 Topo 2.1 Mfel insert end Mfel Clal «> Ligate EcoRl-4'.ial fragment with Topo 2.1 vector Amp Mfel M T306 Ncol Clal 306-N co/Topo 2.1 f) Digest MT306 with Mfel/Clal enzymes g) C1P the digested MT306 plasmid and gd purify vector Mfel Clal d) Digest 3(Xv-Ncol/Topo 2.1 with Mfel/Clal enzymes e) Gd purify -40t)bp insert Amp Mfel Clal M T306 h) ligate the linearized MT306 with EcaRi/CIal insert i) New vector MT306 Ncol Mfel Ncol Amp M T306-NcoI 158 R eproduced with permission of the copyright owner. Further reproduction prohibited without permission. Construction of plasmid MT81 Mfel Ncol a) PCR amplify MT3Q6 witb primers DIJ81 and 01168 b) <5el purify Mfel-Ncol fragment Amp M T306 Mfel Topo 2.1 'insert end Ncol Mfel Ncol c) Ligate EcoRI-Clal fragment witb lope XI vector Amp Mfel Ncol 81/T opo 2.1 f) Digest MT306 Ncol with Mfel/Ncol enzymes g) {.S’ the digested MI306-Na>i plasmid and gel purify vector Mfel Ncol d) Digest 81/TopoXi witb Mfel/Ncol enzymes e) Gel purify -400bp Amp Mfel Ncol M T306-N coI b) Ligate the linearized M l 306 with EcoRl/Ncol insert i) New vector M l 81 Ncol Amp MT81 159 R eproduced with permission of the copyright owner. Further reproduction prohibited without permission. Construction of plasmid MT82 Mfel Ncol a) PCR arapl ify M I306 with primers 1)1182 and 1 1 1 168 b) Gel purify Mfel-Ncol Amp M T306 Topo 2.1 Mfel insert end Ncol Mfel Ncol c) Ligate FxoRl-Cial fragment with Topo 2.1 vector Amp Mfel M T 306-N col Ncol 82/T opo 2.1 f) Digest MT306"Ncol with Mfel/Ncol enzymes g) CIP the digested MT306*fta>! plasmid and gel purify vector Mfel Ncol Digest 82/Topo 2.1 with Mfel/Ncol enzymes Gel purify ~4()0bp Amp Mfel Ncol M T306-N coI h) Ligate the linearized M l 306 with EcoRl/Ncol insert i) New vector MT82 i r Mfel Ncol Amp M T82 160 R eproduced with permission of the copyright owner. Further reproduction prohibited without permission. Construction of plasmid MT90 Ncol PCR amplify pDM$3 witlj primers DU71 and DU72B Gel purify EeoRI-Ncol fragment Amp pDM83 EcoRI Topo 2.1 insert end Ncol EcoRI Ncol c) Ligate EcoRI Ncoi fragment with Topo 2.1 vector Amp EcoRI M T306-NcoI Ncol 90/Topo 2.1 f) Digest MT306-Ncol with EcoRl/Ncol enzymes g) C1P die digested Ml 306 Ncol plasmid and gel purify vector ^ r EcoRI . . T ▼ . Ncol d) Digest W lo p o 2,1 willi EcoRI/Ncol enzymes e) Gel purify' ~200bp insert Amp EcoRI Ncol Ligate the linearized MT 306-Ncol with EcoRl/Ncol insert New vector MT90 ▼ EcoRI Ncol Amp MT90 161 R eproduced with permission of the copyright owner. Further reproduction prohibited without permission. Construction of plasmid MT86 EcoRI a) R 'R amplify MT90 wilt primers DU86 and DIJ69 b) Gel purify EcoRI-SnaBI fragment Amp M.T90 Topo 2.1 EcoRI SnaBI insert end SnaBI EcoRI c) ligate EcoRI-SnaBi fragment with Topo 2.1 Amp EcoRI MT90 SnaBI 86/Topo 2.1 f) Digest MT90 with BeoRI/SnaBl enzymes g) O P the digested M 190 plasmid and gel purify vector SnaBI EcoRI d) Digest 86/Topo XI with EcoRI/SnaBI enzymes e) Gel purify ~1200bp insert Amp SnaBI EcoRI M T90 SnaBI b) Ligate the linearized MT90 with EcoRI/SnaBI insert i) New vector MTS6 EcoRI Amp M T86 SnaBI 162 R eproduced with permission of the copyright owner. Further reproduction prohibited without permission. Construction of plasmid MT87 EcoRI a) Pt 'R amplify MT90 with primers DU87 and 0U69 b) Gel purity EcoRi-SnaBl fragment Amp M T90 Topo 2.1 EcoRI SnaBI insert end SnaBI EcoRI c) ligate EcoRl-SnaBl fragment with Topo 2.! Amp EcoRI MT90 SnaBI 87/Topo 2.1 0 Digest MT90 with EcoRl/SnaBl enzymes g) C1P the digested MT90 plasmid and gd purify vector SnaBI r f EcoRI d) Digest 87/Topo 2.1 with EcoRI/SnaBI enzymes e) Gel purify -rl2(X)bp insert Amp SnaBI EcoRI M T90 SnaBI h) ligate the linearized MT90 with EcoRl/SnaBi insert i) New vector MT87 EcoRI Amp MT87 SnaBI 163 R eproduced with permission of the copyright owner. Further reproduction prohibited without permission. Construction of plasmid MT88 EcoRI a) Pi R amplify M W ) with primers MBS and IIU69 b) <Jei purify EcoRI -SnaBI fragment Amp M T90 Topo 2.1 EcoRI SnaBI insert end SnaBI EcoRI c) Ligate EcoRI -SnaBI fragment with Topo 2.1 Amp EcoRI M T90 SnaBI 88/Topo 2.1 f) Digest MT90 with EcoRI/SnaBI enzymes g) C1P the digested MT90 plasmid and gel purify vector SnaBI t r EcoRI d) Digest 88/Topo2,I with EcoRl/SnaRl enzymes e) (Jei purify -12O0t>p insert Amp SnaBI EcoRI M T90 SnaBI h) Ligate the linearized MT90 with EcoRI/SnaBI insert I) New vector V iTH S EcoRI Amp MT88 SnaBI 164 R eproduced with permission of the copyright owner. Further reproduction prohibited without permission. Construction of plasmid MT89 EcoRI a) PCR amplify MT90 with primers DII89 and DU69 b) Gel purify EcoRl-SnaBl fragment Amp M T90 Topo 2.1 EcoRI SnaBI insert end SnaBI EcoRI c) Ligate EcoRl- SnaBl fragment with Topo 2. I Amp EcoRI M T90 SnaBI 89/Topo 2.1 f) Digest MT90 with EcoRI/SnaBI enzymes g) O P the digested MT90 plasmid and gel purify vector SnaBI EcoRI d> Digest 89/Topo 2.1 with EcoRI/SnaBI aizymes e) Gel purify -12U0bpinsert Amp SnaBI EcoRI M T90 SnaBI h) ligate the linearized MT90 with EcoRI/SnaBI insert i) New vector MT89 EcoRI Amp MT89 SnaBI 165 R eproduced with permission of the copyright owner. Further reproduction prohibited without permission. Construction of plasmid MT83 Mfel Ncol a) PCR amplify MT90 with primers 1X183 and IXJ68 b) Gel purify Mfel-Neoi fragment Amp M T90 Mfel Topo 2.1 end Ncol Mfel Ncol c) 1 agate Mfel Ncol fragment with Topo 2,1 vector Amp Mfel M T 90 Ncol 83/T opo 2.1 f) Digest MT90 with Mfel/Ncol enzymes g) CIP the digested MV90 plasmid and gel purify vector Mfel Ncol d) Digest 83/Topo 2,1 with Mfei/Ncol enzymes e) Gel purify -400bp insert Amp Mfel Ncol M T90 h) Ligate the linearized MT90 with Mfel/Ncol insert i) New vector MT83 Mfel Ncol Amp M T83 166 R eproduced with permission of the copyright owner. Further reproduction prohibited without permission. Construction of plasmid MT84 Mfel Ncol a) PCR amplify MT90 with primers OUS4 and DU68 b) Gel purify Mfel-Ncol fragment Amp M T90 Topo 2.1 Mfel insert end Ncol Mfel Ncol c) Ligate Mfel- Ncol fragment with Topo 2.1 vector Amp M fel M T 90 Ncol 84/T opo 2.1 f) Digest MT90 with Mfel/Neol enzymes g) C1P the digested MT90 plasmid and gel purify vector Mfel Ncol d) Digest 84/Topo 2.1 with Mfel/Neol enzymes e) Gel purify ~400bp insert Amp Mfel Ncol M T90 h) Ligate the linearized MT9Q with Mfel/Ncol insert i> New vector MT84 Mfel Ncol Amp M T84 167 R eproduced with permission of the copyright owner. Further reproduction prohibited without permission. Construction of plasmid MT85 Mfel Ncol a) PCR amplify MT90 with primers DU85 and D1168 b) Ge! purify Mfel-Ncol fragment Amp M T90 Mfel Topo 2.1 end Ncol Mfel Ncol c) Ligate Mfel-Neel fra; with Tepo 2.1 vector Amp M fel M T 90 Ncol 85/T opo 2.1 f) Digest M i’90wi fit Mfel/Ncol enzymes g) CIP the digested MT90 plasmid and gel purify vector Mfel Ncol d) Digest 85/Tope 2.1 with Mfel/Ncol enzymes e) Gel purify -400bp insert Amp Mfel Ncol MT9Q h) Ligate the linearized MT90 with Mfel/Ncol insert i) New vector MT85 IF Mfel Ncol Amp M T 85 168 R eproduced with permission of the copyright owner. Further reproduction prohibited without permission.

Linked assets

University of Southern California Dissertations and Theses

Conceptually similar

PDF

Preferential translation of heat shock proteins

PDF

The mechanism for the regulation of RNA polymerase I-dependent transcription

PDF

Glutathione metabolism and transport in cystic fibrosis airway epithelia

PDF

Enhancement of mitochondrial antioxidative defenses and aging in Drosophila melanogaster

PDF

Modulation of macrophage glutathione synthesis by oxidized LDL and the effects of glutathione content on cell-mediated LDL oxidation

PDF

Topology of superoxide and hydrogen peroxide production in mitochondria

PDF

Protein Phosphorylation Changes And Map Kinase Activation During Heat Shock In Drosophila Cells

PDF

Transcriptional regulation of the rat alpha-ENaC gene by multiple signaling pathways

PDF

Translation and human disease

PDF

An updated review of intracellular mRNA localization

PDF

Dynamic regulation of vasopressin, a mnemonic neuropeptide, induction of calcium signaling and V1a vasopressin receptors in the rat cerebral cortex

PDF

Discovery of a novel role of vasopressin in astrocytes: Vasopressin-induced cytoplasmic and nuclear calcium and kinases signaling cascade and modulation of astrocytes immune function

PDF

Nonreceptor tyrosine kinase Etk /Bmx: Function and regulation in epithelial cells

PDF

Homeostatic regulation of intracellular signaling networks by Etk /Bmx

PDF

Structural analysis of alpha-synuclein studied by site-directed spin labeling

PDF

Pathways of dopamine oxidation mediated by nitric oxide

PDF

A mutational analysis on monoamine oxidase

PDF

Roles of PKC isoforms in vasopressin V1a receptor signal desensitization

PDF

Interaction between guanylate cyclase activator proteins (GCAPs) and other photoreceptor proteins: A yeast two-hybrid screen

PDF

Fanconi's anemia and oxidative stress

Asset Metadata

Creator Ahmed, Ruhi (author)

Core Title Preferential translation of Drosophila heat shock protein 70 and heat shock protein 90 mRNAs during heat shock

Degree Doctor of Philosophy

Degree Program Molecular Pharmacology and Toxicology

Publisher University of Southern California (original), University of Southern California. Libraries (digital)

Tag Health Sciences, Pharmacology,Health Sciences, Pharmacy,Health Sciences, Toxicology,OAI-PMH Harvest

Language English

Contributor Digitized by ProQuest (provenance)

Permanent Link (DOI) https://doi.org/10.25549/usctheses-c16-625904

Unique identifier UC11335088

Identifier 3116653.pdf (filename),usctheses-c16-625904 (legacy record id)

Legacy Identifier 3116653.pdf

Dmrecord 625904

Document Type Dissertation

Rights Ahmed, Ruhi

Type texts

Source University of Southern California (contributing entity), University of Southern California Dissertations and Theses (collection)

Access Conditions The author retains rights to his/her dissertation, thesis or other graduate work according to U.S. copyright law. Electronic access is being provided by the USC Libraries in agreement with the au...

Repository Name University of Southern California Digital Library

Repository Location USC Digital Library, University of Southern California, University Park Campus, Los Angeles, California 90089, USA