University of Southern California Dissertations and Theses

Antibody-cytokine/chemokine fusion proteins in the immunotherapy of solid tumors

(USC Thesis Other)

Antibody-cytokine/chemokine fusion proteins in the immunotherapy of solid tumors

PDF

Download

Open document

Flip pages

Download a page range

Download transcript

Copy asset link

Request this asset

Transcript (if available)

Content ANTIBODY-CYTOKINE/CHEMOKINE FUSION PROTEINS IN
THE IMMUNOTEHRAPY OF SOLID TUMORS
by
Jiali Li
A Dissertation Presented to the
FACULTY OF THE GRADUATE SCHOOL
UNIVERSITY OF SOUTHERN CALIFORNIA
In Partial Fulfillment of the
Requirements for the Degree
DOCTOR OF PHILOSOPHY
(PATHOBIOLOGY)
August 2003
Copyright 2003 Jiali Li
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
UMI Number: 3116741
INFORMATION TO USERS
The quality of this reproduction is dependent upon the quality of the copy
submitted. Broken or indistinct print, colored or poor quality illustrations and
photographs, print bleed-through, substandard margins, and improper
alignment can adversely affect reproduction.
In the unlikely event that the author did not send a complete manuscript
and there are missing pages, these will be noted. Also, if unauthorized
copyright material had to be removed, a note will indicate the deletion.
®
UMI
UMI Microform 3116741
Copyright 2004 by ProQuest Information and Learning Company.
All rights reserved. This microform edition is protected against
unauthorized copying under Title 17, United States Code.
ProQuest Information and Learning Company
300 North Zeeb Road
P.O. Box 1346
Ann Arbor, Ml 48106-1346
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
UNIVERSITY OF SOUTHERN CALIFORNIA
THE GRADUATE SCHOOL
UNIVERSITY PARK
LOS ANGELES, CALIFORNIA 90089-1695
This dissertation, written by
JIALI LI
under the direction o f h dissertation committee, and
approved by all its members, has been presented to and
accepted by the Director o f Graduate and Professional
Programs, in partial fulfillment of the requirements fo r the
degree of
DOCTOR OF PHILOSOPHY
Director
Date August 1 2 . 2003
Dissertation Committee
Qu-
Chair
m it
tr
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
DEDICATION
I want to dedicate this dissertation to my parents.
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
ACKNOWLEDGMENTS
I give my sincere appreciation to my mentor, Dr. Alan Epstein, for his
guidance, patience and believe in me. I am very fortunate to be able to work with
him during the past four years.
I also want to thank the rest of my committee, Dr. Press, Dr. McMillan, and
Dr. Markland, for their invaluable advice during my graduate studies and their time
for helping me with my dissertation.
Finally, people in Dr. Epstein’s lab, Peisheng, Leslie, Maggie, Meg, Amy,
Nan, Jianghua, James, and Sam, make my time here so interesting and memorable,
I would not be able to finish my thesis without their help, encouragement, and
friendship. Especially Meg, who reviewed my dissertation several times, I know
how painful it is.
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
TABLE OF CONTENTS
DEDICATION ------------------------------------------------------------------------------------ ii
ACKNOWLEDGMENTS ---------------------------------------------------------------------iii
LIST OF FIGURES -----------------------------------------------------------------------------v
ABSTRACT -------------------- —------ —--------------------------------- vii
CHAPTER 1. INTRODUCTION ---------------------------------------------------------- 1
REFERENCES: -------------------------------------------------------------------- 8
CHAPTER 2: LEC/CHTNT-3 FUSION PROTEIN FOR THE IMMUNOTHERAPY
OF EXPERIMENTAL SOLID TUMOR ........................ 14
ABSTRACT: ------------------------------------------------------------------------------ 14
INTRODUCTION: 15
MATERIALS AND METHODS: 18
RESULTS: 27
DISCUSSION: 44
REFERENCES: 48
CHAPTER 3: THE DEPELTION O REGULATORY T-CELL ENHANCE THE
THERAPETUCIFUNCITON OF LEC/CHTNT-3 IN EXPERIMENTAL SOLID
TUMORS. ----------------------------------------------------------- 53
ABSTRACT: ------------------------------------------------------------------------------ 53
INTRODUCTION: 54
MATERIALS AND METHODS: 56
RESULTS: 62
DISCUSSION: 85
REFERENCES: 91
CHAPTER 4: ANTIBODY/HUIL-12 FUSION PROTEIN FOR THE
IMMUNOTHERAPY OF EXPERIMENTAL SOLID TUMORS ------------------- 96
ABSTRACT -------------------------------------------------------------------------------96
INTRODUCTION: 97
MATERIALS AND METHODS -----------------------— — --------------- 99
RESULTS: 106
DISCUSSION: 121
REFERENCE: 124
CHAPTER 5: SUMMARY AND FUTURE DIRECTIONS: -1 2 9
BIBLIOGRAPHY----------- 136
iv
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
Chapter 2:
Figure 2-1: Schematic draw demonstrating the construction of LEC/chTNT-3 29
Figure 2-2: Electrophoretic identification of purified LEC/chTNT-3 31
Figure 2-3: Chemotaxic activity of LEC/chTNT-3 32
Figure 2-4: Twelve and 24 hour biodistribution of LEC/chTNT-3 in MAD109 34
tumor-bearing B ALB/c mice
Figure 2-5: Immunotherapy of tumor-bearing B ALB/c mice 37
Figure 2-6: H & E. staining of MAD 109 tumor section after completion of 40
LEC/chTNT-3 immunotherapy
Figure 2-7: hnmunohistochemical staining showing infiltration o f 41
lymphocytes in Colon 26 tumor-bearing mice
Figure 2-8: Flow cytometric analysis of Colon 26 tumors 44
Chapter 3:
Figure 3-1: Combination LEC/chTNT-3 immunotherapy and T-cell depletion 65
in Colon 26-tumor bearing mice
Figure 3-2: Combination LEC/chTNT-3 immunotherapy and CD25 T-cell 6 8
depletion in tumor-bearing mice
Figure 3-3: Re-challenging studies 70
Figure 3-4: Infiltration of lymphocytes subpopulation into tumor sites studied 74
by FACS
Figure 3-5: Intracellular IFN-y expression analyzed by FACS 78
Figure 3-6: EFN-y knock-out mouse studies 79
Figure 3-7: Perforin knock-out mouse studies 81
Figure 3-8: Tumor specific T-cell proliferation assay 83
Figure 3-9: Cytokine expression analyzed by real-time PCR 8 6
v
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
C hapter 4 %
Figure 4-1: Schematic drawn of chTNT-3/huIL-12 fusion protein 111
Figure 4-2: SDS-PAGE demonstrated the purity and right assembling of 112
fusion protein chTNT-3/huIL-12
Figure 4-3: Bioactivity of chTNT-3/huIL-12 was demonstrated by a PBL 114
proliferation assay
Figure 4-4: Cytotoxicity of chTNT-3/huIL-12 115
Figure 4-5: The production o f IFN-y was detected by ELISA 118
Figure 4-6: The half-life of chTNT-3/huIL-12 119
Figure 4-7: Biodistribution study of chTNT-3/huIL-12 in LS174 tumor- 121
bearing nude mice
Figure 4-8: The immunotherapeutic effect of chTNT-3/huIL-12 in PBL/SCED 124
mice model
vi
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
ABSTRACT
Chemokines are small proteins which are involved in leucocyte migration
and angiogenesis. The human liver-expression chemokine (LEC) has been shown to
chemoattract monocytes, lymphocytes, and polymorphonuclear leukocytes (PMNs)
by binding to CCR1 and CCR 8 chemokine receptors. Because of its potency as a
chemoattractant for these immune cells, LEC was used to genetically engineer a
fusion protein with chTNT-3, a monoclonal antibody which targets tumors by
binding to DNA exposed in necrotic regions. By genetically linking the C-terminus
of LEC to the chTNT-3 heavy chain variable region, a fusion protein was generated
which retains LEC chemotaxis function and antibody binding ability.
Immunotherapy studies performed in three solid tumor models of the B ALB/c mouse
showed between 37-55% tumor reduction. Immunohistochemical studies on tumor
sections showed heavy infiltration of immune cells including CD4+ and CD 8 + T-
cells, PMNs, B-cells, and CD1 lc+CDl lb+ dendritic cells, and dramatic blood vessel
thrombosis in the LEC/chTNT-3 treated groups.
In order to determine if additional therapeutic methods could enhance the
anti-tumor effects of LEC/chTNT-3 immunotherapy, specific T-cell subsets were
depleted prior to the use of LEC/chTNT-3. These experiments demonstrated that
depletion of CD25+ T-reg cells markedly enhanced the anti-tumor effects o f
LEC/chTNT-3. By contrast, depletion of CD 8 + and NK cells negated the
LEC/chTNT-3 immunotherapy. Depletion studies with other chTNT-3/cytokine
vii
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
fusion proteins including of IL-2, IFN-y, and GM-CSF showed no significant
improvement, indicating that combination therapy with anti-CD25+ antisera requires
LEC localization to tumor in order to produce complete regression. To study the
mechanism of this response, immunotherapeutic studies were repeated in knock-out
mice and showed that successful immunotherapy was dependent on the presence of
IFN-y but not perforin. Other studies using real-time PCR, ex vivo proliferation, and
intracellular cytokine staining with lymphocytes from tumor draining lymph nodes,
suggested that this treatment combination was associated with increased Thl
cytokine expression, enhanced T-cell activation, and increased IFN-y producing T-
cells. These studies suggest that LEC/MAb fusion proteins when used in
combination with CD25+ T-cell depletion may be a viable method of immunotherapy
for the treatment of solid tumors.
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
CHAPTER 1
INTRODUCTION
Antibodies are a unique class of proteins, which bind their antigens with a
high degree of affinity and specificity, are stable in circulation and can be modified
by genetic engineering. The mouse B-cell hybridoma technique for the production of
monoclonal antibodies was invented by Kohler & Milstein 27 years ago [1]. Since
that time in vitro antibody production has lead to the development of various
diagnostic and therapeutic reagents, some of which have been used for tumor
therapy. Depending on their antigen targets, antibodies themselves may exert anti
tumor effects by inducing apoptosis [2 ], interfering with ligand-receptor interactions
[3], or preventing the expression of proteins that are critical for cancer cell survival
[4]-
The most unique characteristic of antibodies is their specific targeting to
antigens. In the context of tumor therapy, ideal antigens should be uniquely
expressed or over-expressed by cancer cells, without being sheded into the
circulation. In addition to finding appropriate tumor antigens, the immunogenicity of
xenogeneic antibodies, disordered vasculature structure in tumors, increased
hydrostatic pressure in tumors, limited number o f infiltrating effector cells, and
immunosuppressive tumor microenvironment are all barriers that impede antibody
therapy [5].
Tumor Necrosis Therapy (TNT), developed in our laboratory, is a unique
approach to cancer imaging and therapy utilizing necrotic cells as a target for the
1
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
selective binding of monoclonal antibodies (MAbs) [6-9]. TNT represents a radical
departure from current methods that employ MAbs to bind to tumor-associated cell
surface antigens. TNT is based upon the hypothesis that MAbs against intracellular
antigens found in all cells show preferential localization in malignant tumors due to
the presence of abnormally permeable, degenerating cells not found in normal
tissues. It has long been recognized that rapidly dividing tumors contain a
proportion o f degenerating or dead cells but, with attention focused upon attempts to
kill the dividing cells, the degenerating component has largely been ignored. In
tumors, the imperfect vasculature and impaired phagocytic response permit the
accumulation of degenerating cells, often with the formation of large areas of
necrosis, long recognized by pathologists to be a typical feature of malignant tumors.
Thus, the accumulation within tumors of a high proportion of dying cells constitutes
a major distinction between malignant tumors and normal tissues, where sporadic
cell death occurs at a relatively low rate and is accompanied by a rapid (within
minutes) and orderly removal of necrotic elements from the tissue. Contrarily, TNT
antibodies diffusing into viable regions of the tumor and normal tissues do not bind
and are removed from the circulation by normal clearance mechanisms. Hence, TNT
provides a novel approach for specifically targeting necrotic regions of tumors and
can be used to deliver diagnostic [7] and therapeutic reagents into these regions,
which are oftentimes situated deep within the central core of tumors.
My studies here try to overcome some o f the drawbacks of classical antibody
therapeutic methods and address two issues: how to increase the number o f effector
2
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
cells at the tumor site, and how to activate the immune system to overcome the
immunosuppressive tumor microenvironment.
One approach to enhance the therapeutic function o f antibodies is to engineer
antibodies with immune stimulating factors, such as cytokines. The first
immunocytokines, also called antibody-cytokine fusion proteins, were constructed
by Gillies et al. in 1991 [10, 11], The rationale for antibody-cytokine fusion proteins
is to achieve optimal biological effectiveness by using the unique targeting ability of
antibodies to direct multifunctional cytokines to the tumor microenvironment [12]. If
cytokines could be efficiently delivered to tumor sites, they may be used more
efficiently and stimulate and expand immune effector cells, this efficient delivery
should have minimized dose-related toxic side-effects. Our laboratory has generated
several TNT antibody-cytokine fusion proteins, which have been tested in vitro and
in vivo. TNT-3/IL-2, the first TNT fusion protein developed in our laboratory, retains
the binding specificity of the parent TNT-3 antibody as well as the biological activity
of IL-2. Pre-treatment with TNT-3/IL-2 can potentially increase the uptake of other
MAbs and drugs [13]. In addiction to TNT/IL-3, TNT-3/TNF-a and TNT-3/hu IFN-y
have also been developed for the immunotherapy of cancer. [14], In vitro
characterization studies demonstrate that both the IFN-y and TNF-a fusion proteins
are able to maintain their binding affinity to antigen as well as their direct cytotoxic
effect and immunomodulatory functions. When IFN-y and TNF-a fusion proteins are
combined at optimal doses, they demonstrate a 30% direct cellular cytotoxicity of
3
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
human colon carcinoma cells, of which approximately 14% can be attributed to
apoptosis.
In Chapter 2, a new chemokine/antibody fusion protein was generated.
Chemoldnes are small (7-15kD), structurally related soluble proteins that are
involved in leukocyte and dendritic cell chemotaxis, PMN degranulation, and
angiogenesis [15, 16]. Based on the position and number of cysteine residues, they
are divided into four families: CXC (a), CC ((3), C (y), and CX3C [17]. Chemokines
have complex roles in tumor biology. They can act as autocrine growth factors to
promote the progress of malignancy [18], reform blood vessel structure as
angiogenic [19, 20] or angiostatic factors [21, 22], or induce the infiltration of host
leukocytes [23]. Thus therapeutic applications of chemokines in cancer research are
focused on their angiostatic and chemotactic activities.
One o f the therapeutic effects of chemokines is their ability to attract
lymphocytes, which has been proven by gene transfection studies o f MCP-1 [24],
TCA-3 [25], IP-10 [26], RANTES [27], and MIG [28]. Since one of the limitations
of cancer therapy is the decreased penetration of effector cells into tumor sites, the
use of chemokine-antibody fusion proteins to recruit more lymphocytes to the tumor
microenvironment may be a promising approach. The human chemokine LEC
(liver-expression chemokine; also known as NCC-4, LMC, and HCC-4) was
originally found in an expression sequence tag library and later mapped to
chromosome 17q in the CC chemokine cluster [29, 30]. LEC has been shown to
attract monocytes, lymphocytes, and PMNs upon binding to CCR1 and CCR 8
4
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
chemokine receptors [31]. Since the N-terminus of chemokines is important to
binding to receptors, we fused the chemokine LEC to the N-terminal variable region
of chTNT-3, and named it LEC/chTNT-3. This fusion protein, to our knowledge, is
the first chemokine fusion protein that has been applied in anti-tumor studies in
animal models. Therapeutic data showed LEC/chTNT-3 exacted anti-tumor effects
in three well-established solid tumor models: lung carcinoma MAD 109, colon
carcinoma Colon 26, and renal carcinoma RENCA. The infiltration o f multi-arm
immune cells (CD4+ and CD 8 + T cells, dendritic cells, PMN and B cells) has been
demonstrated by immunohistochemistry studies.
Another issue of antibody-mediated cancer immunotherapy is the presence of
suppressive immune environment in cancer patients. In our studies, despite dramatic
infiltration of immune cells observed in LEC/chTNT-3 treated animals, tumor
growth was only reduced to 40-60% as compared to control treated groups, and the
mice eventually died from cancer. We hypothesized that these results may be due to
incomplete activation of infiltrating lymphocytes. In Chapter 3, several studies
which were performed to overcome the suppressive effects o f the tumor
microenvironment were addressed.
Suppressive T cells were first identified by North et al. [32-48]. Their studies
showed that the elimination of CD4+ T cells, can induce significant anti-tumor and
anti-infection effects in animal models. Only after the characterization of this
subpopulation by Sakaguchi et al. in 1995 [49], was it recognized that a small
subpopulation o f CD4 + T-cell which express CD25, were responsible for this
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
profound immunosuppression in tumor-bearing mice. These T reg cells are a minor
(8-10%) population of T cells, but depletion of T reg results in the generation of
autoimmune diseases. On the other hand, the removal of T reg increases the anti
tumor effect on recently established animal tumor models [50]. Even though the
exact mechanism of T reg remains unknown, two theories are well accepted: one is
cytokine-dependent interaction, and the other is a cell-cell contact dependent
mechanism [50].
Since the depletion o f T reg removes a suppressive “brake” of the immune
system and activates effector immune cells, it would be a rational therapeutic
strategy to combine T reg depletion with LEC/chTNT-3 treatment, whereby the
chemokine fusion protein (retained at tumor sites) should bring more activated
effector cells to the tumor microenvironment. Single lymphocyte subpopulation
depletion experiments were performed to analyze the correlation between the fusion
protein LEC/chTNT-3 and lymphocyte subsets (NK, CD 8 + and CD4+ T cells). Our
therapeutic data implied that NK and CD 8 + T-cell are essential for LEC/chTNT-3
anti-tumor function, as depletion of these two lymphocytes can reverse the
therapeutic function of LEC/chTNT-3. On the other hand, removal o f CD4+ T cells
dramatically boosts the anti-tumor effect o f LEC/chTNT-3. This combination
treatment results in complete eradication o f well-established Colon 26 and RENCA
tumors in B ALB/c mice which was further confirmed by a more specific
CD4+CD25+ T-cell depletion by the intra-peritoneal injection of the anti-CD25
antibody, PC61.
6
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
To study further synergistic effects of LEC/chTNT-3 with T reg depletion,
peripheral (spleen) and tumor-associated (tumor draining lymph nodes, TDLN)
lymphoid organs were removed at different time points post-treatment, and the
activation o f T cells was confirmed by tumor-specific proliferation. The dramatic
trafficking effect of LEC/chTNT-3 was also confirmed by performing the same assay
on spleen lymphocytes. Even though we observed tumor specific activation of T
cells in spleen from CD25+ T-cell depleted mice, there were no activated T cells in
the spleens of mice receiving LEC/chTNT-3 and CD25+ T-cell depletion
combination. In TDLN, however, there was double the amounts of activated T cells
(42% versa 20%) in combination treated mice than in mice treated by depletion
alone. Resulting tumor-free mice were re-challenged with the same tumor cell lines
two to three months after treatment completion, and they remained tumor free 60
days after re-challenge.
Chapter 4 introduces another fusion protein, chTNT-3/huIL-12. Interleukin-
12 (IL-12) is an important cytokine, since it targets two both NK and T cells. As a
Thl cytokine, IL-12 promotes the generation of CD 8 + cytotoxic T lymphocytes
(CTL) and the production o f IFN-y, which induced the production o f the
antiangiogenic signal, IFN-y induced protein 10 (IP-10). The production o f IFN-y
also induces the expression o f IL-12 by dendritic cells and phagocytes, which is a
strong positive feedback mechanism [51-54], The benefit of IL-12 fusion proteins is
that IL-12 is a very toxic cytokine and systemic treatment with free IL-12 oftentimes
results in severe side effects [55]. To avoid a host immune response to recombinant
7
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
IL-12, it is necessary to have a human version IL-12 for treatment of cancer patients.
Thus, we generated a human IL-12 fusion protein, chTNT-3/huIL-12. The difficulty
of generating a IL-12 fusion protein is that IL-12 has two sub-units: p35 and p40
which form biologically active IL-12 under physiological conditions by disulfide
bonds [56-58], In this study, we engineered in a 15-amino acid (Gly4 Ser) 3 linker
between the p35 subunit and the chTNT-3 heavy chain. As demonstrated by SDS-
PAGE and biological activity assays,a pure fusion protein was obtained, which
retains 80% of the proliferative activity of IL-12 moiety . Since chTNT-3/huIL-12 is
a human IL-12 fusion protein, it is difficult to test its in vivo immunotherapeutic
effect in immunocompetent mice. Here, we introduced a chimeric system,
huPBL/SCED mice, which builds a human immune system into mice by transfusing
human peripheral blood into an immunodeficient SCID mouse model [59]. By
transfusing IL-2 activated human PBLs back into SCID mice weekly, treatment with
fusion protein chTNT-3/huIL-12 showed a 45% reduction in tumor growth in a
DU 145-bearing huPBL/SCID mice model.
The studies presented in this dissertation suggest that these fusion proteins
have potential as immunotherapeutic reagents or as adjuvants combined with other
therapeutic approaches.
References:
1. Kohler, G. and C. Milstein, Continuous cultures o f fused cells secreting
antibody o f predefined specificity. Nature, 1975. 256(5517): p. 495-7.
8
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
2. Trauth, B.C., et al., Monoclonal antibody-mediated tumor regression by
induction o f apoptosis. Science, 1989. 245(4915): p. 301-5.
3. Waldmann, T.A., Monoclonal antibodies in diagnosis and therapy. Science,
1991. 252(5013): p. 1657-62.
4. Teramoto, T., et al., Inhibitory effect o f anti-epidermal growth factor receptor
antibody on a human gastric cancer. Cancer, 1996. 77(8 Suppl): p. 1639-45.
5. Mehren Mv, M., G.P. Adams, and L.M. Weiner, Monoclonal antibody
therapy fo r cancer. Annu Rev Med, 2003. 54: p. 343-69.
6 . Chen, F.-M., et al., Diffusion and binding o f monoclonal antibody TNT-1 in
multicellular tumor spheroids. J Natl Cancer Inst, 1991. 83: p. 200-204.
7. Epstein, A.L., et al., Radioimmunodetection o f necrotic lesions in human
tumors using 1-131 labeled TNT-1 F(ab)2 monoclonal antibody. Antibody,
Immunoconjugates, and Radiopharmaceuticals, 1991. 4: p. 151-161.
8 . Epstein, A.L., F.-M. Chen, and C.R. Taylor, A novel method fo r the detection
o f necrotic lesions in human cancers. Cancer Research, 1988. 48: p. 5842-
5848.
9. Homick, J.L., et al., chTNT-3/B, a new chemically modified chimeric
monoclonal antibody directed against DNA fo r the tumor necrosis treatment
o f solid tumors. Cancer Biotherapy and Radiopharmaceuticals, 1998.13: p.
255-268.
10. Gillies, S.D., et al., Expression o f genetically engineered immunoconjugates
o f lymphotoxin and a chimeric anti-ganglioside GD2 antibody. Hybridoma,
1991.10(3): p. 347-356.
11. Gillies, S., et al., Antibody-targeted interleukin-2 stimulates T-Cell killing o f
autologous tumor cells. Proc Natl Acad Sci USA, 1992. 89: p. 1428-1432.
12. Lode, H.N., et al., Immunocytokines: a promising approach to cancer
immunotherapy. Pharmacol Ther, 1998. 80(3): p. 277-92.
13. Homick, J.L., et al., Pretreatment with a monoclonal antibody/interleukin-2
fusion protein directed against DNA enhances the delivery o f therapeutic
molecules to solid tumors. Clin Cancer Res, 1999. 5(1): p. 51-60.
14. Sharifi, I., et a l, Generation o f Human Interferon Gamma and Tumor
Necrosis Factor Alpha Chimeric TNT-3 Fusion Proteins. Hybrid
Hybridomics, 2002. 21(6): p. 421-32.
9
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
15. Mackay, C.R., Chemokines: immunology's high impact factors. Nat
Immunol, 2001. 2: p. 95-101.
16. Gerard, C. and B.J. Rollins, Chemokines and disease. Nat Immunol, 2001. 2:
p. 108-115.
17. Vaddi, K., M. Keller, and R.C. Newton, The Chemokine facts book. 1997.
18. Schadendorf, D., et al., IL-8produced by human malignant melanoma cells
in vitro is an essential autocrine growth factor. Journal of Immunology,
1993.151(5): p. 2667-2675.
19. Gupta, S.K., et al., Chemokine receptors in human endothelial cells.
Functional expression o f CXCR4 and its transcriptional regulation by
inflammatory cytokines. J Biol Chem, 1998. 273(7): p. 4282-7.
20. Salcedo, R., et al., Vascular endothelial growth factor and basic fibroblast
growth factor induce expression o f CXCR4 on human endothelial cells: In
vivo neovascularization induced by stromal-derived factor-1 alpha. Am J
Pathol, 1999.154(4): p. 1125-35.
21. Belperio, J.A., et al., CXC chemokines in angiogenesis. J Leukoc Biol, 2000.
6 8 ( 1 ): p. 1 -8 .
22. Strieter, R.M., et al., Role o f C-X-C chemokines as regulators o f angiogenesis
in lung cancer. Journal of Leukocyte Biology, 1995. 57: p. 752-762.
23. Hirose, K., et al., Chemokine gene transfection into tumour cells reduced
tumorigenicity in nude mice in association with neutrophilic infiltration.
British Journal o f Cancer, 1995. 72: p. 708-714.
24. Manome, Y., et al., Monocyte chemoattractantprotein-1 (MCP-1) gene
transduction: an effective tumor vaccine strategy fo r non-intracranial
tumors. Cancer Immunology and Immunotherapy, 1995. 41: p. 227-235.
25. Laning, J., et al., Inhibition o f in vivo tumor growth by the beta chemokine,
TCA3. The Journal o f Immunology, 1994.153: p. 4625.
26. Luster, A.D. and P. Leder, IP-10, a-C-X-C- Chemokine, Elicits a Potent
Thymus-dependent Antitumor Response In Vivo. Journal of Experimental
Medicine, 1993.178: p. 1057-1065.
27. Mule, J.J., et a l, RANTES Secretion by Gene-Modified Tumor Cells Results
in Loss o f Tumorigenicity In Vivo: Role o f Immune Cell Subpopulations.
Human Gene Therapy, 1996. 7: p. 1545-1553.
10
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
28. Ruehlmann, J.M., et a l, MIG (CXCL9) chemokine gene therapy combines
with antibody-cytokine fusion protein to suppress growth and dissemination
o f murine colon carcinoma. Cancer Res, 2001. 61(23): p. 8498-503.
29. Hedrick, J.A., et al., Characterization o f a novel chemokine, HCC-4, whose
expression is increased by interleukin-10. Blood, 1998. 91(11): p. 4242-4247.
30. Narase, K., et al., A YAC contig o f the human CC chemokine genes clustered
on chromosome 17qll.2. Genomics, 1996. 34: p. 236-240.
31. Howard, O.M.Z., et al., LEC induces chemotaxis and adhension by
interacting with CCR1 and CCR8. Blood, 2000. 96: p. 840-845.
32. Mills, C.D. and R.J. North, Ly-1 +2- suppressor T cells inhibit the expression
o f passively transferred antitumor immunity by suppressing the generation o f
cytolytic Tcells. Transplantation, 1985. 39(2): p. 202-8.
33. Dye, E.S. and R.J. North, Tcell-mediated immunosuppression as an obstacle
to adoptive immunotherapy o f the P815 mastocytoma and its metastases. J
Exp Med, 1981.154(4): p. 1033-42.
34. North, R.J., Cyclophosphamide-facilitated adoptive immunotherapy o f an
established tumor depends on elimination o f tumor-induced suppressor T
cells. J Exp Med, 1982.155(4): p. 1063-74.
35. Mills, C.D. and R.J. North, Expression o f passively transferred immunity
against an established tumor depends on generation o f cytolytic T cells in
recipient. Inhibition by suppressor Tcells. J Exp Med, 1983.157(5): p. 1448-
60.
36. North, R.J., Gamma-irradiation facilitates the expression o f adoptive
immunity against established tumors by eliminating suppressor T cells.
Cancer Immunol hnmunother, 1984. 16(3): p. 175-81.
37. North, R.J., The therapeutic significance o f concomitant antitumor immunity.
I. LY-1-2+ T cells from mice with a progressive tumor can cause regression
o f an established tumor in gamma-irradiated recipients. Cancer Immunol
Immunother, 1984.18(2): p. 69-74.
38. North, R.J., The therapeutic significance o f concomitant antitumor immunity.
II. Passive transfer o f concomitant immunity with Ly-1 +2- T cells primes
established tumors in T cell-deficient recipients fo r endotoxin-induced
regression. Cancer Immunol Immunother, 1984. 18(2): p. 75-9.
11
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
39. North, R.J. and I. Bursuker, T cell-mediated suppression o f the concomitant
antitumor immune response as an example o f transplantation tolerance.
Transplant Proc, 1984.16(2): p. 463-9.
40. Dye, E.S. and R J. North, Specificity o f the T cells that mediate and suppress
adoptive immunotherapy o f established tumors. J Lenkoc Biol, 1984. 36(1):
p. 27-37.
41. North, R J. and E.S. Dye, Ly 1 +2- suppressor Tcells down-regulate the
generation o fL y 1-2+ effector T cells during progressive growth o f the P815
mastocytoma. Immunology, 1985. 54(1): p. 47-56.
42. DiGiacomo, A. and R.J. North, T cell suppressors o f antitumor immunity. The
production o f Ly-1-,2+ suppressors o f delayed sensitivity precedes the
production o f suppressors ofprotective immunity. J Exp Med, 1986.164(4):
p. 1179-92.
43. North, R.J., Radiation-induced, immunologically mediated regression o f an
established tumor as an example o f successful therapeutic
immunomanipulation. Preferential elimination o f suppressor T cells allows
sustained production o f effector T cells. J Exp Med, 1986. 164(5): p. 1652-
66.
44. Digiacomo, A. and R.J. North, Subtherapeutic numbers o f tumour-sensitized,
L3T4+, Ly 1 +2- T cells are needed fo r endotoxin to cause regression o f an
established immunogenic tumour. Immunology, 1987. 60(3): p. 367-73.
45. Hill, J.O., M. Awwad, and R J. North, Elimination o f CD4+ suppressor T
cells from susceptible BALB/c mice releases CD8+ T lymphocytes to mediate
protective immunity against Leishmania. J Exp Med, 1989. 169(5): p. 1819-
27.
46. North, R.J. and M. Awwad, Elimination o f cycling CD4+ suppressor T cells
with an anti-mitotic drug releases non-cycling CD8+ T cells to cause
regression o f an advanced lymphoma. Immunology, 1990. 71(1): p. 90-5.
47. Dunn, P.L. and R.J. North, Selective radiation resistance o f immunologically
induced T cells as the basis fo r irradiation-induced T-cell-mediated
regression o f immunogenic tumor. J Leukoc Biol, 1991. 49(4): p. 388-96.
48. Dunn, P.L. and R J. North, Early gamma interferon production by natural
killer cells is important in defense against murine listeriosis. Infect Immun,
1991. 59(9): p. 2892-900.
12
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
49. Sakaguchi, S., et al., Immunologic self-tolerance maintained by activated T
cells expressing IL-2 receptor alpha-chains (CD25). Breakdown o f a single
mechanism o f self-tolerance causes various autoimmune diseases. J
Immunol, 1995.155(3): p. 1151-64.
50. Shevach, E.M., CD4+ CD25+ suppressor T cells: more questions than
answers. Nat Rev Immunol, 2002. 2(6): p. 389-400.
51. Sirianni, M.C., et al., Natural killer cell stimulatory factor (NKSF)/IL-12 and
cytolytic activities o f PBL/NK cells from human immunodeficiency virus type-
1 infected patients. Scand J Immunol, 1994. 40(1): p. 83-6.
52. Banks, R.E., P.M. Patel, and P.J. Selby, Interleukin 12: a new clinical player
in cytokine therapy. Br J Cancer, 1995. 71(4): p. 655-9.
53. Bermudez, L.E., M. Wu, and L.S. Young, Interleukin-12-stimulated natural
killer cells can activate human macrophages to inhibit growth o f
Mycobacterium avium. Infect Immun, 1995. 63(10): p. 4099-104.
54. Brunda, M.J., Role ofIL12 as an anti-tumour agent: current status and future
directions. Res Immunol, 1995.146(7-8): p. 622-28.
55. Lamont, A.G. and L. Adorini, IL-12: a key cytokine in immune regulation.
Immunol Today, 1996.17(5): p. 214-7.
56. Kim, T., et al., An ovalbumin-IL-12 fusion protein is more effective than
ovalbumin plus free recombinant IL-12 in inducing a T helper cell type 1-
dominated immune response and inhibiting antigen-specific IgEproduction.
Journal of Immunology, 1997.158: p. 4137-4144.
57. Penichet, M.L., E.T. Harvill, and S.L. Morrison, Antibody-IL-2 fusion
proteins: a novel strategy fo r immune protection. Hum Antibodies, 1997.
8(3): p. 106-18.
58. Gillies, S.D., et al., Antibody-IL-12 fusion proteins are effective in SCID
mouse models o f prostate and colon carcinoma metastases. J Immunol, 1998.
160(12): p. 6195-203.
59. Murphy, W.J., et al., Human-mouse lymphoid chimeras: host-vs.-graft and
graft-vs.-host reactions. Eur J Immunol, 1992. 22(6): p. 1421-7.
13
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
CHAPTER 2
LEC/CHTNT-3 FUSION PROTEIN FOR THE IMMUNOTHERAPY
OF EXPERIMENTAL SOLID TUMOR
Abstract:
The human chemokine LEC (liver-expression chemokine) was originally
found in an expressed sequence tag library and later the LEC gene was located to
chromosome 17q in the CC chemokine gene cluster. LEC has been shown to
chemoattract monocytes, lymphocytes, and polymorphonuclear leukocytes (PMNs)
by its binding to CCR1 and CCR8 chemokine receptors. Because of its potency as a
chemoattractant for immune cells, LEC was used to genetically engineer a fusion
protein with chTNT-3, a monoclonal antibody previously shown to target tumors by
binding to DNA exposed in necrotic zones. Because the N-termini of chemokines is
important for their activity, the C-terminus o f LEC was genetically linked to the
chTNT-3 heavy chain variable region and along with the light chain gene,
cotransfected into NSO murine myeloma cells using the glutamine synthetase gene
amplification system. The expressed LEC/chTNT-3 fusion protein was purified by
tandem protein-A affinity and ion-exchange chromatography and chemotaxis and
binding assays confirmed the bioactivity o f the purified fusion protein.
Pharmacokinetic and biodistribution studies in vivo showed that LEC/chTNT-3 had a
biologic half-life o f 3 hr and had good uptake in tumor (2.4% injected dose/gram)
which remained stable at 12 and 24 hr post-injection. Immunotherapy studies
14
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
performed in three solid tumor models of the B ALB/c mouse showed between 37-
55% tumor reduction at 19 days post-implantation. Immunohistochemical studies
using tumor sections obtained at different time points after the administration of
control chTNT-3 and LEC/chTNT-3 showed heavy infiltration of CD4+ and CD8 + T-
cell, PMNs, B-cell, and CD1 lc+ CDl lb + dendritic cells in the LEC/chTNT-3 treated
groups. The results of these studies demonstrate that this novel fusion protein has
potent anti-tumor activity that is associated with the infiltration of different
subpopulations of immune cells. The targeting of LEC to necrotic areas of tumors
where the release of tumor antigens is prevalent may be a new approach for the
immunotherapy o f solid tumors.
Introduction:
Chemokines are small (7-15kD), secreted, and structurally related soluble
proteins that are involved in leukocyte and dendritic cell chemotaxis, PMN
degranulation, and angiogenesis (1,2). Based on the position and number of cysteine
residues, they are divided into four families: CXC (a), CC ((3), C (y) and CX3 C (3).
Due to their important role in the immune system, chemokines have been utilized to
treat inflammations and autoimmune diseases (4), HIV (5), and cancer (3). Because
of their ability to recruit leukocytes into tumors, act as anti-angiogenic agents, and
stimulate host anti-cancer immune responses, chemokines are promising reagents in
cancer therapy (6 ).
15
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
The human chemokine liver-expression chemokine (LEC, also known as
NCC-4, LMC, and HCC-4) was originally found in an expression sequence tag
library and later mapped to chromosome 17q in the CC chemokine cluster (7). The
LEC gene in the mouse is a pseudogene which has lost its function due to the
insertion of an intron (7). LEC has been shown to chemoattract monocytes,
lymphocytes, and PMNs upon binding to CCR1 and CCR 8 chemokine receptors (8 ).
LEC is unique because unlike any other chemokine, it is the first chemokine whose
mRNA expression is strongly increased and stabilized by the presence of IL-10. In
vitro studies indicate that LEC requires a much higher concentration to induce
maximum chemotaxis than it does for adhesion (8).
The potential therapeutic applications of LEC have been studied by
Giovarelli et al. (9), who showed that mammary carcinoma TSA cells engineered to
express LEC inhibit the metastatic spread o f tumor and induce tumor rejection due to
an impressive infiltration of macrophages, dendritic cells, T cells, and PMNs and the
production o f IFN-y and IL-12 (9). To function, chemokines are elaborated
principally at the site of injury or infection and have a very short half-life due to their
small size. Since systemic administration is associated with severe side effects (10-
1 2 ), it is difficult to obtain high local concentrations o f chemokines in tumors in
order to achieve an effective immune response. To circumvent this problem, gene
therapy, intra-tumoral injection, and the systemic use o f chemokine/antibody fusion
proteins are possible solutions. It is on this latter approach that our laboratory has
focused its attention since we have developed a universal method to target solid
16
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
tumors with monoclonal antibodies (MAbs). Designated Tumor Necrosis Therapy
(TNT), we have discovered that MAbs that target intracellular antigens retained by
degenerating cells are able to bind specifically to necrotic regions of tumors (13,14).
Using this approach, we have begun to develop a panel of fusion proteins consisting
of cytokines that have the potential to elicit an effective immune response against
experimental tumors of the mouse (10-13). In an effort to expand this work, we
now present a new TNT fusion protein linked with LEC that we believe can be
especially effective as an immunostimulatory reagent for the treatment of solid
tumors. TNT MAbs may be ideal targeting reagents for this approach for two
important reasons. First, TNT binds an antigen (nucleic acid) that is universally
present in all tumors and species, enabling it to be used conveniently in both
experimental animals and man. Secondly, TNT targets necrotic regions of tumors
that tend to be central in location and contain an abundance of tumor antigens
released from degenerating tumor cells (14). Unlike cytokines such as IL-2 and IL-
12 that have been used to construct fusion proteins with MAbs (10,15), chemokines
require linkage to the C-terminus of the molecule to avoid hindering the receptor-
binding site located at the N-terminus. Hence, antibody fusion proteins consisting of
chemokines require linkage to the N-terminus o f the heavy chain variable region as
originally discovered by Challita-Eid et al. (16) who produced the first active
chemokine/antibody fusion protein using the chemokine RANTES. In the present
report, we now describe the generation and testing of a second antibody/chemokine
fusion protein consisting of chTNT-3 and LEC which targets central necrotic areas
17
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
of tumor to chemoattract and amplify responding lymphoid and dendritic cells
capable of inducing an effective anti-tumor immune response in experimental solid
tumors o f the mouse.
M aterials and M ethods:
Reagents
The Glutamine Synthetase Gene Amplification System and expression
plasmids pEE12 and pEE6/hCMV-B were purchased from Lonza Biologies, Inc.
(Slough, UK). Restriction endonucleases, Vent Polymerase, Taq Polymerase, T4
DNA ligase, and other molecular biology reagents were purchased from New
England BioLabs (Beverly, MA). MEM non-essential amino acids solution,
penicillin-streptomycin solution, double-stranded and single-stranded DNA from calf
thymus, single-stranded DNA from salmon testes, nucleohistone, Dulbecco’s
phosphate buffered saline (PBS), chloramine T, sodium metabisulfite, hydrogen
peroxide, ABTS (2,2’-azino-bis(3-ethylbenzthiazoline-6-sulfonic acid) diammonium
salt), protease from Streptomyces griseus, avidin, and HABA (4-
hydroxyazobenzene-2-carboxylic acid) were all purchased from Sigma Chemical Co.
(St. Louis, MO). RPMI-1640 medium and Hybridoma-SFM medium without L-
glutamine, was purchased from Life Technologies (San Diego, CA). Characterized
and dialyzed fetal bovine sera were obtained from HyClone Laboratories, Inc.
(Logan, UT). Iodine-125 was obtained as sodium iodide in 0.1N sodium hydroxide
from DuPont/New England Nuclear (North Billerica, MA).
18
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
Antibody and cell lines
The THP-1 human monocytic, the Hep-G2 human liver carcinoma, the Colon
26 murine colon carcinoma, the RENCA murine renal cell carcinoma, and the Raji
African Burkitt's lymphoma cell lines were all obtained from American Type Culture
Collection (Manassas, VA). The Madison 109 (MAD 109) murine lung carcinoma
cell line was obtained from the National Cancer Institute (Frederich, MD). These
above cell lines were grown in RPMI-1640 medium supplemented with 10%
characterized fetal bovine serum, L-glutamine, penicillin G, and streptomycin
(Gemini BioProducts, Woodland, CA). The NSO murine myeloma cell line was
obtained from Lonza Biologies, Ltd. (Slough, UK) and grown in non-selective
medium consisting of Hybridoma-SFM supplemented with 10% characterized fetal
bovine serum, L-glutamine, MEM non-essential amino acids solution, penicillin G
(100 U/ml), and streptomycin (100 pg/ml). Selective medium was made according
to the protocol provided by Lonza Biologies, Ltd. for the Glutamine Synthetase Gene
Amplification System and consisted o f Hybridoma-SFM without glutamine
supplemented with 10% dialyzed fetal bovine serum (Hyclone), glutamate (500pM),
asparagine (500pM), nucleosides (Sigma Chemical Co.) [adenosine, guanosine,
cytidine, and uridine (30pM), thymidine (10pM)], non-essential MEM amino acids,
penicillin G (100 U/ml), and streptomycin (lOOpg/ml). Human recombinant LEC
and polyclonal goat-anti-LEC antiserum were purchased from Peprotech Inc (Rocky
Hill, NJ). HRPO-conjugated goat anti-human IgG (Fc specific) was purchased from
19
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
CalTag Laboratories (Burlingame, CA). Six-week-old female BALB/c mice were
obtained from Harlan Sprague Dawley (Indianapolis, IN).
Construction, expression, and purification o f LEC/chTNT-3
The plasmids carrying the light (pEE6/hCMV-LC) and heavy (pEE12/HC)
chain genes of chTNT-3 were produced as described previously (17). The human
LEC gene was cloned by RT-PCR (18) from the HepG2 hepatocarcinoma cell line
using TRIzol (Invitrogen, Carlsbad, CA) to obtain total RNA. The mature cDNA of
LEC was then amplified by PCR using primers 5’ TCTAGAATGAAGGTCTCC-
GAGGCTGCC 3’ and 5’ GCGGCCGCCTGGGAGTTGAGGAGCTG 3’ inserted
into the N-terminus of chTNT-3 heavy chain gene by X bal and N otl under the
translation of an antibody leader sequence. The resulting fusion gene was then
inserted into the expression vector pEE12 and cotransfected with pEE6/TNT-3 light
chain by electroporation into NSO cells as prescribed by the Glutamine Synthetase
Gene Amplification System.
Cell culture medium was changed weekly after transfection for 3 weeks at
which time the best expressing clone was chosen by an indirect ELISA assay of
culture supernatant using crude DNA as antigen as previously described (17). To
produce large quantities of the fusion protein, the high expressing clone was grown
in aerated 8 liter stir flasks in selective media containing 5% heat-inactivated (68°C
for 1 hour with intermittent stirring) dialyzed fetal calf serum to eliminate the
induction o f proteolytic enzymes by the NSO cells during incubation and the
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
breakage o f the fusion protein. The secreted fusion protein was then purified from
clarified cell culture supernatant by tandem protein-A affinity and ion-exchange
chromatography procedures. The purity of fusion protein was checked by sodium
dodecyl sulfate-polyacrelamide gel electrophoresis (SDS-PAGE) under denaturing
conditions and by HPLC as previously described (17) using 0.05M phosphate buffer
and 0.4M sodium perchlorate, pH 6.1 as the solvent system. After purification, the
fusion protein was filtered through a 0.22 pm Nalgene disposable filter unit,
aliquoted, and stored at -80°C for long-term storage in 10 ml sterile tubes.
Chemotaxis assay
The bioactivity o f the fusion protein was demonstrated by measuring the
migration o f target cells in a 96-well microchemotaxis chamber (Neuroprobe,
Gaithersburg, MD) as described in the manufacturer’s protocol. Briefly,
LEC/chTNT-3, recombinant human LEC, or parental chTNT-3 were serially diluted
from 0.39nM to 50nM in binding medium (RPMI 1640 with 1% BSA and
25mmol/L HEPES) (8,18) and placed in the lower chamber o f the microchemotaxis
apparatus. One hundred jjlL binding medium containing 105 THP-1 human
monocytic cells were then added to the upper chamber and after 1.5 h of incubation
in a humidified 5% CO2 , 37°C incubator, the percentage o f migrated cells was
calculated to determine the migration index (average number o f cells exposed to
chemokine and fusion protein divided by the average number o f cells exposed to
binding media). All assays were performed in triplicate.
21
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
Radiolabeling of LEC/chTNT-3 and stability of radioconiugate
1 2 :5 I-labeled fusion protein was prepared using a modified chloramine-T
method as described previously (17,19). Briefly, lm Ci (37MBq) of radioiodine and
20 pL o f an aqueous solution of chloramine-T (2 mg/mL) were added to a 5 mL-test
tube containing 100 pg LEC/chTNT-3 in 100 pL PBS. The solution was quenched
after 2 min with 20 pL of an aqueous solution of sodium metabisulfite. Each
reaction mixture was purified using a Sephadex G-25 column and typically had a 90-
95% recovery yield. The radiolabeled antibodies were diluted with PBS for
injection, stored at 4°C, and administered within 2h after radiolabeling.
Radioiodinated antibodies were analyzed using an analytical instant thin layer
chromatography (ITLC) system consisting o f silica gel impregnated glass fiber
(Gelman Sciences, Ann Arbor, MI). Strips (2 x 20 cm) were activated by heating at
110°C for 15 min prior to use, spotted with lp L of sample, air dried, and eluted with
methanol/EbO (80:20) for approximately 10 cm, again air dried, cut in half, and
counted to determine protein bound and free radioiodine. ITLC analysis revealed an
Rf value o f 0 (MAb-bound) and a radiochemical purity of greater than 99%. In vitro
serum stability was also evaluated as described previously (17). Briefly,
radioiodinated MAbs were incubated for 48 hr in mouse serum at 37°C. After
trichloroacetic acid precipitation and centrifugation, MAb-bound radioactivity was
measured in a gamma counter. Approximately 95% of the activity was
trichloroacetic acid precipitable and virtually no release o f free radioiodine was
detected over this time period.
22
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
Avidity determination
In order to determine the avidity constant of the purified LEC/chTNT-3, a
fixed cell radioimmunoassay was performed as described previously (20). Briefly,
target Raji lymphoma cells were washed once with PBS, fixed in EM grade 2%
paraformaldehyde (Polysciences, Warrington, PA) for ten minutes at room
temperature, and washed again in PBS before being stored in PBS containing 0.2%
sodium azide at 4°C. Ten to 110 ng of 1 2 5 I-labeled LEC/chTNT-3 was then
incubated with IQ6 fixed Raji cells for 1 hour at room temperature. The cells were
washed three times with PBS containing 1% bovine serum albumin to remove any
unbound antibody and counted in a gamma counter. The amount of fusion protein
bound was determined from the remaining cell-bound radioactivity (cpm) and the
specific activity of the fusion protein. Scatchard plot analysis of the data was used to
obtain the slope from which the equilibrium or avidity constant K was calculated by
the equation K = -(slope/w) where n is the valence of the antibody (2 for IgG).
Clearance studies
Six-week-old female BALB/c mice were used to determine the
pharmacokinetic clearance of 1 2 5 I-LEC/chTNT-3. A group of mice (n=5) previously
fed with potassium iodide in the drinking water for 2-3 days to block the thyroid
1 95
uptake of free radioiodide, were administered i.v. injections of I-labeled fusion
proteins (30-40 pCi/mouse) using a 0.1 m l inoculum. The whole body activity at
injection and selected time points post-injection was measured with a CRC-7
23
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
microdosimeter (Capintec, Inc., Pittsburgh, PA). The data were analyzed and half-
lives were determined by the PSTRJP pharmacokinetic program (MicroMath, Inc.,
Salt Lake City, UT). Results are expressed as the mean ± standard deviation, and
significance levels (P values) were determined using the Wilcoxon rank-sum test.
Biodistribution studies
Groups (n=5) of six-week-old female tumor-bearing BALB/c mice were used
to determine the biodistribution o f 1 2 5 I-LEC/chTNT-3. Briefly, mice were injected
with 0.2 ml containing 107 MAD 109 subcutaneously in the left flank using a
University Animal Care Committee-approved protocol. The tumors were grown for 5
days until they reached approximately 0.5 cm in diameter. Mice were then injected
intravenously with a 0.1 mL inoculum containing 100pCi/10pg o f 1 2 5 I-labeled
LEC/chTNT-3. Groups of mice were sacrificed by sodium pentobarbital overdose at
3, 6, 12, and 24 hours post-injection and organs, blood, and tumors were removed
and weighed, and the radioactivity in the samples was measured in a gamma counter.
For each mouse, the data were expressed as percent injected dose/gram (%ID/g) and
tumor-to-organ ratio. From these data, the mean ± standard deviation was calculated
for each group. Significance levels (P values) were determined using the Wilcoxon
rank-sum test.
24
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
Treatment studies
Groups (n=7) o f six-week old female BALB/c mice were injected
subcutaneously in the left flank with a 0.2mL inoculum containing approximately
107 o f MAD 109 cells, Colon 26 cells, or RENCA cells under a University Animal
Care Committee-approved protocol. The tumors were grown for 7 days until they
reached approximately 0.5cm in diameter. Groups of tumor-bearing mice were
treated intravenously with a 0.1 ml inoculum containing LEC/chTNT-3 (20pg) or
control chTNT-3 (20pg). All groups were treated 5x daily and tumor growth was
monitored every other day by caliper measurement in three dimensions. Tumor
volumes were calculated by the formula: length x width x height. The results were
expressed as the mean ± standard deviation and the significance levels (.P values)
were determined using the Wilcoxon rank-sum test.
Immunohistochemistrv
Groups (n=7) of BALB/c mice were injected in the left flank with 107 tumor
cells as described above. Seven days after tumor implantation, mice were treated
intravenously with LEC/chTNT-3 (20pg), PBS, or chTNT-3 (20pg) 5x daily. Mice
from each group were sacrificed at 10, 12, 14 and 16 days after tumor implantation
and tumors were excised and either fixed in 10% neutral buffered formalin (VWR
Scientific, West Chester, PA) for paraffin embedding or snap frozen in liquid
nitrogen in O.C.T. compound (Lab-Tek Products, Naperville, 1 1 1 ) for frozen
sectioning. Paraffin embedded sections from MAD 109 tumor-bearing mice were
25
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
stained with hematoxylin and eosin (H&E) for morphological studies. For
immunohi stochemi cal studies, frozen sections of tumors from Colon 26 tumor-
bearing mice were stained with biotinylated anti-CD4+, anti-CD8+, anti-CD 1 lb+,
anti-Panendothelial, anti-CD 1 lc+ , anti-CD 19+ , anti-CD3e+, and anti-45R+ (BD
PharMingen, San Diego, CA) antibody to stain lymphoid, PMN, and dendritic cell
subpopulations. Sections were then incubated with HRP-conjugated streptavidin
and developed with colorimetric agent before being stained with H&E.
Microscopic findings were recorded by an Optronix digital camera.
FACs analysis of lymphocyte subsets
Tumors were removed 3 days after the completion o f LEC/chTNT-3
treatment and manually cut into 2-3 mm pieces in a petri dish. The tissue fragments
were then digested with 0.01% DNAse, 0.01% hyaluronidase, and 0.1% collagenase
(Sigma Chemical Co, St. Louis, Mo) in RPMI-1640 medium without serum for 2-3
hrs at 37°C with continuous stirring. Single cell suspensions were then washed twice
with 0.1% FCS in PBS and stained by standard flow cytometric methods using
FITC-conjugated anti-CD 1 lc and APC-conjugated anti-CD 1 lb antibodies (BD
PharMingen).
26
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
Results:
Construction, expression, and purification of LEC/cfaTNT-3
The construction of chTNT-3 heavy and light chains was described
previously (17). Since the N-terminus of chemokines is essential for bioactivity, we
fused the C-terminus of the LEC gene to the N-terminus of the chTNT-3 heavy chain
gene with a 5 amino acid universial linker (Gfy^Ser). The fused LEC/chTNT-3
heavy chain gene (Figure 2-1) was translated under an antibody leader sequence and
the expressed fusion protein was found to retain its biological activities as shown
below. The highest LEC/chTNT-3 producing subclone secreted approximately
20ug/ml/106 cells/24hours in static culture. The molecular mass and assembly of the
fusion protein was demonstrated by a reducing SDS-PAGE ( Figure 2-2), which
revealed two bands at approximately 25 and 67 kD, corresponding to the antibody
light chain and the sum of the chimeric immunoglobulin heavy chain and LEC,
respectively. The purity of the construct was confirmed by HPLC, which showed
that the LEC/chTNT-3 had a main peak with a retention time of approximately 442s.
These analyses showed that the fusion protein remained intact even after storage at -
80°C for up to six months.
Chemotaxis assay
The biological activity o f the fusion protein was demonstrated by a
chemotactic assay using the human monocytic cell line, THP-1. As shown in Figure
2-3, free human recombinant LEC and the fusion protein induced THP-1 cell
27
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
Figure 2-1:
pEE12
pEE 6
Schematic diagram demonstrating the construction of LEC/chTNT-3.
A linker consisting of Gly4Ser was inserted between the LEC gene and
the chTNT-3 heavy chain variable region.
LEC linker VH Heavy chain gamma
N XC N C
CL
N
%
28
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
migration. The migration of THP-1 cells exposed to the fusion protein was dose
dependent starting at a concentration as low as 1.6nM and peaking at concentration
of 12.5nM. Free human recombinant LEC peaked at a higher concentration of about
25nM in this assay. THP-1 cells exposed to the parental antibody (chTNT-3) did not
show any migration verifying the biologic activity of the LEC moiety of the fusion
protein.
Avidity determination
IOC
A binding study was conducted in which I-labeled LEC/chTNT-3 was
incubated with fixed Raji cells and the bound radioactivity was used to calculate the
avidity constant Ka for the fusion protein by Scatchard analysis. The LEC/chTNT-3
was found to have a similar binding constant (l.OxlO9 M '1 ) to chTNT-3 (lA xK ^M '1 )
(17) indicating that the genetic linkage of LEC to the variable region of the chTNT-3
heavy chain did not interfere with antigen binding.
Pharmacokinetic and biodistribution studies
It has previously been demonstrated that half-life values of antibody
clearance from mice determined by whole-body radioactivity are statistically
indistinguishable from that calculated by blood sampling (21). Therefore, whole-
body radioactivity studies were performed to establish the half-life (T1/2) of the 1 2 5 I-
LEC/chTNT-3 fusion protein. Mice were injected intravenously with the
radiolabeled antibody and whole body radioactivity at the time o f injection and
29
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
Figure 2-2: Electrophoretic identification of purified LEC/chTNT-3. Reduced
Coomassie Blue-stained 10% SDS-PAGE gel showing (A) chTNT-3,
(B) LEC/chTNT-3, and (C) standard molecular weight markers.
209KD
124KD
80KD
49.1KD
■ ■ ■ I F
34.8KD
28.9KD
20.6KD
7.1 KD
B
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
Figure 2-3: Chemotaxic activity of LEC/chTNT-3. THP-1 human monocytic
leukemia cells were used in a chemotaxis chamber to determine the
biologic activity of the LEC/chTNT-3, free LEC, and chTNT-3
(negative control).
E chTNT-3
0 Free LEC
■ LEC/chTNT-3
I B
3.2 6.3 12.5
Concentration (nM)
25
31
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
hereafter were measured with a microdosimeter. From these studies, it was
determined that the 1 2 5 I-LEC/chTNT-3 was found to have a T 1/2 of 3h +_20rain (.P<
0.01).
To demonstrate tumor uptake o f 1 2 5 I-LEC/chTNT-3, biodistribution studies
were performed in MAD109 tumor-bearing BALB/c mice. As shown in Figure 2-
4A ,1 2 5 I-LEC/chTNT-3 demonstrated a tumor uptake of 2.4% ID/g (P<0.01) at both
12 and 24h post-injection. The rapid clearance of 1 2 5 I-LEC/chTNT-3 also showed a
decrease in radioactivity levels in blood and most of the other normal tissues
(p<0.01) at all time points resulting in high tumor-to-organ ratios (Figure 2-4B).
These data demonstrate that the radiolabeled LEC/chTNT-3 specifically bound to
tumor with excellent retention at the tumor site. Interestingly, the normal organ
showing the highest uptake was the liver but retention by this organ was minimal as
indicated by the 2:1 tumor/liver ratio seen at 24 hr.
Immunotherapy studies
The anti-tumor activity of the LEC/chTNT-3 was studied in tumor-bearing
BALB/c mice using RENCA, MAD 109, and Colon 26 tumor models. Seven days
after implantation of tumor, mice were treated 5x daily with 20pg o f LEC/chTNT-3
or control chTNT-3. As shown in Figure 2-5, LEC/chTNT-3 treatment at day 19 of
the study showed a 55 % (P< 0.05) tumor growth reduction in the Colon 26 tumor
model, a 37% (P<0.05) reduction in the MAD 109 tumor model, and a 42% (P<0.05)
reduction in the RENCA tumor model as compared to chTNT-3 treated controls.
32
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
Figure 2-4: Twelve and 24 hour biodistribution o f LEC/chTNT-3 in MAD 109
tumor-bearing BALB/c mice. Tumor uptake was measured by (A)
percent injected dose/gram of 1 2 5 I-labeled LEC/chTNT-3 and (B)
tumor/normal organ ratio.
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
% Injected Dose/gram
A
H 12 h LEC/chTNT -3
□ 24 h LEC/chTNT-3
2.5-1
1.5
0.5
blood heart lung liver spleen stomach kidney tumor
B
18-]
16-
H 12h LEC/chTNT-3
□ 24h LEC/chTNT-3
14
O 10
spleen stomach kidney Mood heart Mug liver
Organs
34
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
Figure 2-5: Immunotherapy o f tumor-bearing BALB/c mice with LEC/chTNT-3
(20pg) or PBS at one-day interval x 5 (A-C). Panel A: Colon 26 tumor-
bearing BALB/c mice, Panel B: MAD 109 tumor-bearing BALB/c mice.
Panel C: RENCA tumor-bearing BALB/c mice.
35
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
chTNT-3 (20ug)
LEC/chTNT-3 (20ug)
a
u
w-
19 17 11 13 IS 7 9
3.5
§ 3
chTNT-3 (20ug)
LEC/chTNT-3 (20ug)
a
a
©
>
19 9 13 15 17 7 11
s r
a
o
a
5
0.8
0.7
0.6
0.5
0.4
0.3
0.2
0.1
0
chTNT-3 (20ug)
LEC/chTNT-3 (20ug)
19 7 9 11 13 15 17
36
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
Immunohistochemistrv studies
The anti-cancer activity of chemokines has been attributed to the recruitment
of dendritic cells, PMNs, and lymphoid cell subpopulations into the tumor and to
their anti-angiogenic activity. Hence, it is of interest to identify which
subpopulations were responsible for the anti-tumor activity o f the fusion protein. To
accomplish this, histological and immunohistochemical studies were performed on
tumor sections removed from treated mice. Morphological studies shown in Figure
2-6 reveal that LEC/chTNT-3 treatment induced marked necrosis and congestion of
blood vessels in the tumor samples studied. The number of blood vessels in treated
and control mice, however, was not found to be different as determined by
immunohistochemical staining with a panendothelial antibody (data not shown).
LEC/chTNT-3 treated tumors also showed a marked infiltration o f lymphoid cells in
these sections. Figure 2-7 illustrates the immunohistochemical results obtained with
a series of B-cell, T-cell, dendritic, and PMN specific antibodies to identify the
presence of subpopulations infiltrating the tumors. For these studies, frozen sections
from Colon 26-bearing BALB/c mice were prepared 4 days after the completion o f
treatment (16 days after tumor implantation) for immunohistochemical staining. The
results of these studies revealed that the infiltration of PMNs (Figure 2-7 B),
dendritic cells (Figure 2-7D), B cells (Figure 2-7 F), and T cells (Figure 2-7H, 2-7 J)
was higher in the LEC/chTNT-3 treated tumors than the control antibody treated
group. Tumors removed at earlier time points showed that the infiltration of
dendritic cells and macrophages were observed first by the third day of treatment and
37
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
remained in the tumor until 4 days after the completion of treatment. By contrast, T
cell (CD4+ and CD8+) infiltration (15-20 cells/4Q0x field) was less dramatic that that
seen for dendritic cells and was first seen two days after the completion of therapy
(data not shown).
FACs analysis of lymphocyte subsets
As shown in Figure 8, two-color staining o f infiltrating lymphocytes in tumor
samples removed from mice 3 days after the completion o f treatment showed that
14.0% of CD1 lc+ CDl lb + dendritic cells infiltrated the LEC/chTNT-3 treated group
(Figure 2-8B) as compared to only 7. 9% in the chTNT-3 treated group (Figure 2-
8 A). These results verify the dendritic origin of the CD1 lc+ cells seen in the
immunohistochemical studies described above.
38
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
Figure 2-6: H.& E staining of MAD1Q9 tumor obtained five days after completion
of LEC/chTNT-3 immunotherapy. Morphological appearance of
tumors removed from mice treated with (A) chTNT-3 (control) and (B)
LEC/chTNT-3 showing dramatic blood vessel thrombosis, widespread
necrosis, and lymphocyte infiltration (x850).
39
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
Figure 2-7: ImmunoMstochemical staining showing infiltration of lymphocytes in
Colon 26 tumor-bearing mice. Mice from control group (A, C, E, G, I)
and LEC/chTNT-3 treated group (B, D, F, H, J) were sacrificed 3 days
after the treatment, and sections were stained with anti-LyG ( A, B), anti-
CD 11C( C,D), anti-CD45R(E, F), anti-CD4 (G,H), and anti-CD8 ( I, J).
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
I < .......
^ B B B H I B s ia - ^ f K itt* ;:;»?.a
* ^ H B 3
t / ^ / \ * * * # ' » * , '
1 > # * • * , *• * $ , 1 ^
i - ; . A i
P I
« P - .#
m m m r n m
^W iillllllil
41
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
Figure 2-7: (continued)
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
C D llb
Figure 2-8: Flow cytometric analysis of Colon 26 tumors removed from (A)
chTNT-3 control (B) and LEC/chTNT-3 treated mice. Single cell
suspensions of tumors removed 3 days after completion of treatment
were doubly stained with FITC-conjugated anti-CD 11c and APC-
conjugated anti-CD lib to identify infiltrating dendritic cells.
C D llc
43
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
Discussion:
In this study, the chemokine/antibody fusion protein LEC/chTNT-3 was
genetically engineered and found to retain both antibody targeting ability and
chemokine activity. After RANTES (16), this is the second chemokine to be used to
generate a fusion protein with anti-tumor potential. First pioneered by Gillies (22),
cytokine/antibody fusion proteins represent a new immunotherapeutic approach that
targets potent immunoregulatory molecules into tumors. To date, IL-2 (10,12,22-
24), IL-12 (15), IFNy (13), TNFa (13,25), and GM-CSF (11,26) have been used to
genetically engineer fusion proteins. Attached to different antibodies, these fusion
proteins have been tested in several experimental tumor models o f the mouse for
their targeting properties and anti-tumor activity (20-24). All of these fusion
proteins were made by linking the cytokine to the C-terminus o f the antibody heavy
chain which is on the opposite end of the antibody molecule to the antigen binding
site. As stated above, this genetic approach had to be altered because the N-termini
of chemokines are involved with the receptor binding o f this class o f molecules (16).
Fortunately, engineering chemokines to the heavy chain variable region was not
found to reduce the binding avidity or specificity of the antibody moiety (16,27) and
the expressed fusion protein had proper folding and secretion. Due to the significant
difference in size between LEG which is approximately 15 kD and chTNT-3 which
is 150 kD, there was a risk that the fusion protein may change the natural structure of
LEG and disturb chemokine-receptor interactions. To minimize this potential
problem, a 5 amino acid linker (Gly^Ser) was inserted between the chemokine and
44
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
the variable region o f antibody to increase the flexibility of the fusion protein. A
chemotaxis assay was used to demonstrate the bioactivity o f the LEG moiety of the
fusion protein compared to negative (chTNT-3) and positive (recombinant LEG)
controls. Upon exposure to LEC/chTNT-3 and recombinant human LEG, human
monocytic THP-1 cells were found to migrate through the Sum filter barrier with a
peak response seen at 12.5 and 25nM, respectively, demonstrating the high potency
of the fusion protein.
In vivo, the pharmacokinetic properties o f LEC/chTNT-3 was quite different
than chTNT-3 alone (whole body half-life of 3 hr vs 134 hr). Despite its rapid
elimination, however, the LEC/chTNT-3 retained its ability to localize to tumor
although it also had a relatively higher affinity for the liver at early time points (7%
ID/g). Since other cytokine-antibody fusion proteins do not show this level of early
uptake in the liver, this may be due to the presence of LEC receptor in this organ.
By 24h, however, LEC/chTNT-3 uptake in all the normal organs, including the liver
(0.8%ID/g), dropped significantly while tumor uptake remained constant at 2% ID/g.
Several studies have utilized chemokines to produce or enhance anti-tumor immune
responses in experimental tumor models. In gene transfer studies using EL4 and
MCA205 mouse tumor models, investigators found that RANTES secretion (a CC
chemokine) markedly decreased the tumorigenicity o f engineered tumor cells (28).
Likewise, another CC chemokine, EBI1-ligand (ELC/CCL19) genetically engineered
into murine breast carcinoma cells enabled the mice to reject these tumors even upon
secondary challenge (29). These and studies like them have shown that chemokines
45
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
are promising reagents for cancer immunotherapy. Except for the RANTES fusion
protein (16), however, investigators have limited their experience with chemokines
to gene transfer experiments (30), to intratumoral injection studies (31), and to the
development of improved tumor vaccines by genetically linking chemokines to
tumor antigens as described by Biragyn et al. (32). Since TNT MAbs are capable of
targeting necrosis present in all solid tumors, our laboratory is in a unique position to
test the effectiveness of targeted cytokines and chemokines to experimental tumors
knowing that these reagents can then be generated into fully human fusion proteins
for subsequent trial in patients. To date, TNT based fusion proteins have been
generated with IL-2 (10), GM-CSF (11), TN Fa (13), IFNy (13), and more recently,
IL-3, IL-4, and IL-12 (unpublished). Most o f these fusion proteins have been found
to have anti-tumor activity especially when used in combination. The success of the
present study, which demonstrates the feasibility o f generating a chemokine/TNT
antibody fusion protein, is an important step forward since it shows that the linkage
of chemokines and other immunoregulatory proteins to the N-terminus o f the TNT
heavy chain variable region will result in functional reagents.
The ability of chemokines to induce the transendothelial migration and tumor
invasion of infiltrating dendritic, lymphoid cells, and PMNs has been well
documented (33) but their effects on tumor vasculature are more obscure. It is
thought that immune cell infiltration is dependent on the presence of the chemokine
and the induction of adhesion molecules on vessels in the tumor or sites of
inflammation (34). It is also known that macrophage and dendritic cell infiltration
46
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
into tumor precedes T and B cell migration, a finding confirmed in our
immunohistochemical studies. Hedrick et al. (18) in fact suggest that LEC attracts
resting monocytes and has no apparent effect on resting T and B cells or neutrophils.
They claim that the early infiltration of dendritic cells may be responsible for the
expression of adhesion molecules which is responsible for the delayed migration and
activation o f T lymphocytes. Giovarelli et al. (9) in fact demonstrated that tumor
cells genetically engineered to express LEC induced the production of IL -ip, TNFa,
and IFNy and a higher expression of adhesion molecules on tumor vasculature.
Unlike some ELR-CXC chemokines which are angiostatic (35-37), LEC did not
appear to damage existing tumor blood vessels as evidenced by the absence of red
cell extravasation in these studies. LEC/chTNT-3 treatment did, however, induce
significant vessel congestion and downstream tumor necrosis which may have
contributed to its overall anti-tumor effect.
Our working hypothesis is that a combination of cytokines and/or
chemokines may be required to orchestrate a complete anti-tumor response. The
synergistic effect o f these important immunoregulatory molecules is well
documented (38-40) and undoubtedly involves the biologic activity of antigen
presenting cells (macrophages, dendritic cells), effector T cells, B lymphocytes, and
neutrophils. Because LEC is capable of attracting all these cell types into the tumor
parenchyma, it is a very promising immunotherapeutic reagent. Its administration
may, however, be optimized by combining its use with other immunoregulatory
molecules which are either anti-angiogenic in nature or amplifiers o f the immune
47
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
response. In summary, the results o f this study confirm the potential of this new
fusion protein composed of an antibody capable of targeting antigen rich central
necrotic zones of tumors and a chemokine which induces the migration and
infiltration of several different arms o f the immune system. As a fusion protein,
LEC/chTNT-3 may be an important component of an effective immunotherapeutic
approach, which, after further genetic engineering, can be used in humans as a novel
anti-cancer reagent.
References
1. Mackay CR. Chemokines: immunology's high impact factors. Nat Immunol.
2001;2:95-101
2. Gerard C, Rollins BJ. Chemokines and disease. Nat Immunol. 2001 ;2:108-
115
3. Vaddi K, Keller M, Newton RC. The Chemokine facts book. 1997
4. Miyagishi R, Kikuchi S, Fukazawa T, Tashiro K. Macrophage inflammatory
protein-1 in the cerebrospinal fluid of patients with multiple sclerosis and
other inflammatory neurological diseases. JN euro Sci. 1995;129:223-227
5. Baroudy BM. A Small molecule antagonist of CCR5 that effectively inhibits
HIV-1 potential as a novel antiretroviral agent. 7th Conference on
Retroviruses and Opportunistic Infections. 2000
6. Homey, B., A. Muller, and A. Zlotnik, Chemokines: agents fo r the
immunotherapy o f cancer? Nat Rev Immunol, 2002. 2(3): p. 175-84.
7. Naruse K, Ueno M, Satoh T, Nomiyam H, Tei H, Takeda M, Ledbetter D,
Coillie V, Opdenakker G, Gunge N, Sakaki Y, Mura R. A YAC contig of the
human CC chemokine genes clustered on chromosome 17ql 1.2. Genomics.
1996;34:236-240
48
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
8. Howard OMZ, Dong HF, Shirakawa A-K, Oppenheim JJ. LEC induces
chemotaxis and adhension by interacting with CCR1 and CCR8. Blood.
2000;96:840-845
9. Giovarelli M, Cappello P, Fomi G, Salcedo TM, Paul A., LeFleur DW,
Nardelli B, Carlo ED, Lollini P-L, Ruben S, Ullrich S, Garotta G, Musiani P.
Tumor rejection and immune memory elicited by locally released LEC
chemokine are associated with and impressive recruiteent of APCs,
lymphocytes, and granulocytes. JImmunol. 2000; 164:3200-3206
10. Homick J, Khawli L, Hu P, Sharifi J, Khanna C, Epstein A. Pretreatment
with a monoclonal antibody/interleukin-2 fusion protein directed against
DNA enhances the delivery of therapeutic molecules to solid tumors. Clin
Cancer Res. 1999;5:51-60
11. Homick JL, Khawli LA, Hu P, Lynch M, Anderson PM, Epstein AL.
Chimeric CLL-1 antibody fusion proteins containing granulocyte
macrophage colony-stimulating factor or interleukin-1 with specificity for B-
Cell malignancies exhibit enhanced effector functions while retaining tumor
targeting properties. Blood. 1997;89:4437-4447
12. Hu P, Homick JL, Glasky MS, Yun A, Milkie MN, Khawli LA, Anderson
PM, Epstein AL. A chimeric Lym-1 /interleukin 2 fusion protein for
increasing tumor vascular permeability and enhancing antibody uptake.
Cancer Res. 1996;56:4998-5004.
13. Sharifi J, Khawli LA, Li J, Hu P, Epstein AL. Generation of human
interferon gamma and tumor necrosis factor alpha chimeric TNT-3 fusion
proteins. Hybridoma and Hybridomics. in press
14. Chen F-M, Hansen EB, Taylor CR, Epstein AL. Diffusion and binding of
monoclonal antibody TNT-1 in multicellular tumor spheroids. J Natl Cancer
Inst. 1991;83:200-204
15. Gillies SD, Lan Y, Wesolowski IS, Qian X, Reisfeld RA, Holden S, Super
M, Lo KM. Antibody-IL-12 fusion proteins are effective in SO D mouse
models of prostate and colon carcinoma metastases. J Immunol.
1998;160:6195-6203.
16. Challita-Eid P, Abboud C, Morrison S, Penichet M, Rosell K, Poles T,
Hilchey S, Planelles V, Rosenblatt J. A RANTES-antibody fusion protein
retains antigen specificity and chemokine function. J Immunol.
1998;161:3729-3736
49
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
17. Homick JL, Hu P, Khawli LA, Biola BH, Yun A, Sharifi J, Taylor CR,
Epstein AL. chTNT-3/B, a new chemically modified chimeric monoclonal
antibody directed against DNA for the tumor necrosis treatment of solid
tumors. Cancer Biotherapy and Radiopharmaceuticals. 1998;13:255-268
18. Hedrick JA, Helms A, Vicari A, Zlotnik A. Characterization o f a novel
chemokine, HCC-4, whose expression is increased by interleukin-10. Blood.
1998;91:4242-4247
19. Epstein AL, Chen D, Ansari A, Najafi A, Siegel M, Lee K, Hu E, Rosen P,
Watkins K, Stain S, Weaver F, Taylor CR. Radioimmunodetection of
necrotic lesions in human tumors using 1-131 labeled TNT-1 F(ab')2
monoclonal antibody. Antibody, Immunoconjugates, and
Radiopharmaceuticals. 1991;4:151-161
20. Frankel ME, Gerhard W. The rapid determination of binding constants for
antiviral antibodies by a radiommunoassay: an analysis of the interaction
between hybridoma proteins and influenza vims. Mol Immunol. 1979;16:101-
106
21. Zuckier LS, Georgescu L, Chang CJ, ScharffMD, Morrison SL. The use of
severe combined immunodeficiency mice to study the metabolism of human
immunoglobulin G. Cancer. 1994;73:794-799
22. Gillies S, Reilly E, LO K-M, Reisfeld RA. Antibody-targeted interleukin-2
stimulates T-Cell killing of autologous tumor cells. Proc Natl Acad Sci U S
A. 1992;89:1428-1432
23. Penichet ML, Harvill ET, Morrison SL. Antibody-IL-2 fusion proteins: a
novel strategy for immune protection. Hum Antibodies. 1997;8:106-118
24. Penichet ML, Dela Cruz JS, Shin SU, Morrison SL. A recombinant IgG3-(IL-
2) fusion protein for the treatment o f human HER2/neu expressing tumors.
Hum Antibodies. 2001;10:43-49
25. Christ O, Matzku S, Burger C, Zoller M. Interleukin 2-antibody and tumor
necrosis factor-antibody fusion proteins induce different antitumor immune
responses in vivo. Clin Cancer Res. 2001;7:1385-1397.
26. Batova A, Kamps A, Gillies SD, Reisfeld RA, Yu AL. The Chl4,18-GM-
CSF fusion protein is effective at mediating antibody-dependent cellular
cytotoxicity and complement-dependent cytotoxicity in Vitro. Clin Cancer
Res. 1999;5:4259-4263
50
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
27. Peng LS, Penichet ML, Morrison SL. A single-chain EL-12 IgG3 antibody
fusion protein retains antibody specificity and IL-12 bioactivity and
demonstrates antitumor activity. J Immunol. 1999;163:250-258.
28. Mule JJ, Custer M, Averbook B, Yang JC, Weber IS, Goeddel DV, Roseberg
SA, Schall T. RANTES secretion by gene-modified tumor cells results in loss
of tumorigenicity In Vivo: role of immune cell subpopulations. Human Gene
Therapy. 1996;7:1545-1553
29. Braun SE, Chen K, Foster RG, Kim CH, Hromas R, Kaplan MH, Broxmeyer
HE, Cometta K. The CC chemokine CK beta-1 l/MIP-3 beta/ELC/Exodus 3
mediates tumor rejection of murine breast cancer cells through NK cells. J
Immunol. 2000; 164:4025-4031
30. Yao L, Pike SE, Pittaluga SP, Chemey B, Gupta G, Jaffe ES, Tosato G. Anti
tumor activities of the angiogenesis inhibitors interferon-inducible protein-10
and the calreticulin fragment vasostatin. Cancer Immunol Immunother.
2002;51:358-366
31. Arenberg D, Zlotnick A, Strom S, Burdick M, Strieter R. The murine CC
chemokine, 6C-kine, inhibits tumor growth and angiogenesis in a human lung
cancer SCED mouse model. Cancer Immunol Immunother. 2001;49:587-592
32. Biragyn A, Tani K, Grimm MC, Weeks S, Kwak LW. Genetic fusion of
chemokines to a self tumor antigen induced protective, T-cell dependent
antitumor immunity. Nat Biotechnol. 1999;17:253-259
33. Rollins BJ. Chemokines and Cancer. 1999
34. Carlos TM. Leukocyte recruitment at sites of tumor: dissonant orchestration.
JLeukoc Biol. 2001;70:171-184
35. Belperio JA, Keane MP, Arenberg DA, Addison CL, Ehlert JE, Burdick MD,
Strieter RM. CXC chemokines in angiogenesis. JLeukoc Biol. 2000;68:1-8
36. Baggiolini M, Dewald B, Moser B. HUMAN CHEMOKINES: An Update.
Ann Rev Immunol. 1997;15:675-705
37. Arenberg DA, Kunkel SL, Polverini PJ, Morris SB, Burdick MD, Glass MC,
Taub DT, Iannettoni MD, Strieter RM. Interferon-inducible protein 10 (IP-
10) is an angiostatic factor that inhibits human non-small cell lung cancer
(NSCLC) tumorigenesis and spontaneous metastases. J Exp Med.
1996;184:981
51
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
38. Emtage P, Wan Y, Hitt M, Graham F, Muller W, Zlotnik A, Gauldie J.
Adenoviral vectors expressing lymphotactin and interleukin 2 or
lymphotactin and interleukin 12 synergize to facilitate tumor regression in
murine breast cancer models. Human Gene Therapy. 1999;10:697-709
39. Dilloo D, Bacon K, Holden W, Zhong W, Burdach S, Zlotnik A, Brenner M.
Combined chemokine and cytokine gene transfer enhances antitumor
immunity. Nat Med. 1996;2:1090-1095
40. Narvaiza I, Mazzolini G, Barajas M, Duarte M, Zaratiegui M, Qian C,
Melero I, Prieto J. Intratumoral coinjection of two adenoviruses, one
encoding the chemokine IFN-gamma-inducible protein-10 and another
encoding IL-12, results in Marked antiatumoral synergy. J Immunol. 2000;
164:3221-3122
52
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
CHAPTER 3
COMPLETE REGRESSION OF EXPERIMENTAL SOLID TUMORS
BY COMBINATION LEC/CHTNT-3 IMMUNOTHERAPY AND
CD25+ T-CELL DEPLETION
Abstract
LEC/chTNT-3, a chemokine fusion protein previously generated in our
laboratory, produces a 40-60% reduction in well-established solid tumors of the
B ALB/c mouse. In this study, CD25+ T-cell depletion was used in combination
with LEC/chTNT-3 treatment to enhance the therapeutic value o f this approach. In
two tumor models (Colon 26 and RENCA), this combination immunotherapy
produced complete regression of established subcutaneous tumors after five days of
intravenous treatment. To show that targeted LEC is critical to these results, similar
combination studies were performed with chTNT-3/cytokine fusion proteins
consisting of human IL-2, murine IFN-y, and murine GM-CSF using identical
treatment regimens. These studies showed no improvement, indicating that
combination therapy with anti-CD25+ antisera requires LEC localization to tumor in
order to produce complete regression. To study the mechanism of this remarkable
response, immunotherapeutic studies were repeated in knock-out mice and showed
that successful immunotherapy was dependent on the presence o f IFN-y but not
perforin. Other studies using real-time PCR, ex vivo proliferation, and intracellular
53
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
cytokine staining with lymphocytes from tumor draining lymph nodes, suggested
that this combination treatment was associated with increased Thl cytokine
expression, enhanced T-cell activation, and increased IFN-y production by T-cell.
Re-challenge experiments showed that combination LEC/chTNT-3 treatment and
CD25+ T-cell depletion produced long-acting memory cells capable of preventing re-
engraftment of the same but not different tumor cell lines. These studies suggest that
LEC/MAb fusion proteins when used in combination with CD25+ T-cell depletion
may be a viable method of immunotherapy for the treatment of solid tumors.
Introduction
Studies o f CD4+ CD25+ T-cell (T regulatory cell, suppressor T-cell) have
been published for over 20 years, but only recently, have their important regulatory
roles in autoimmune disease and cancer been recognized [1-3], CD4+ CD25+ T-cell
constitutively express CD25 (interleukin-2 receptor a chain) on its surface and
constitutes 5-10% of CD4+ T-cell in humans and rodents. Even though a whole
body of work has been published in CD4+ CD25+ T-cell subset, most of them were
about autoimmune diseases, and the properties o f T-regulatory cells (T-reg) still
remain unknown. Recent studies indicate that there may be two mechanisms
regarding the regulatory functions o f T-reg: one is cell-cell contact-dependent, and
the other one is cytokine-dependent, including IL-4 or IL-10 mediated [4]. Most
recently, it was found that the cytotoxic T lymphocyte-associated antigen 4 (CTLA-
54
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
4), which is constitutively expressed on CD4’ rCD25+ T-cell plays a key role in T
cell-mediated dominant immunologic self-tolerance [5].
It is clear that T-reg is essential in immune system homeostasis [6-8], and the
manipulation o f its function should have potential therapeutic effects in the clinic [9].
Enhancement o f T-reg may be beneficial for autoimmune diseases, and the removal
of T-reg should result in increased immune responses, which will facilitate the
induction of tumor immunity [10-12]. Indeed, recent studies have demonstrated that
in vivo injection of anti-CD25 antibody caused the regression of leukemia and solid
tumors in animal models [10, 13]. In most of these studies, CD4+ or CD4+ CD25+ T-
cell depletion was highly tumor suppressive, but T-reg depletion alone resulted in
either incomplete tumor reduction or a delay in the growth o f well-established
implants. Combination therapy seems to be more effective, as exemplified by
Sutmuller’s study which revealed a synergistic effect o f CTLA-4 blockage and the
depletion of CD4+ CD25+ T-cell in tumor therapy [14].
Here we propose a new approach: the depletion o f CD4+ CD25+ T-cell
combined with a chemokine fusion protein treatment. There is a strong correlation
between the infiltration of lymphocytes into tumor sites and increased survival,
which suggests that T lymphocytes contribute to tumor remission [15]. Many
methods have been developed to increase the penetration o f lymphocytes to the
tumor microenvironment. Chemokine/antibody fusion proteins are logical
candidates to direct lymphocyte migration due to the chemoattxactive properties of
their chemokine moiety on different populations of lymphocytes by receptor-ligand
55
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
interactions [16-18]. LEC/chTNT-3 is a fusion protein generated in our laboratory
which was genetically engineered to link the liver expression chemokine (LEC) to
monoclonal antibody chTNT-3, which targets the necrotic regions of tumors [19].
Previously we demonstrated that LEC/chTNT-3 attracts different subpopulations of
lymphocytes including CD4+ and CD8+ T-cell, PMNs, dendritic cells, and B-ceil
[19]. Although dramatic lymphocyte migration has been observed in the tumors of
treated mice, treatment with LEC/chTNT-3 alone only resulted in a 40-50%
reduction of tumor growth. In this study, we combined the use of LEC/chTNT-3
with methods to deplete T-regulatory cells to determine the value of both treatments
in the immunotherapy o f well-characterized tumors o f the mouse.
M aterials and Methods
Antibodies and cell lines
Hybridomas, including rat anti-mouse L3T4 (anti-CD4) mAb GK1.5, anti-
lyt-2.3 (anti-CD8) mAh 2.43, and anti- IL-2 (anti-CD25) receptor mAb 7D4 and
PC61 were purchased from American Type Culture Collection (ATCC, Manassas,
VA). To obtain sufficient quantities of reagents, hybridoma cells were grown in
Integra CL 1000 culture chambers (IBS Integra Biosciences, Switzerland) and
purified by ammonium sulphate precipitation following by Q-sepharose ion-
exchange chromatography (Bio-Rad Laboratories, Hercules, California). Anti-asialo
GM1 (anti-NK) was purchased from Wako Pure Chemical Industries Ltd. (Osaka,
Japan). The Colon 26 murine colon carcinoma and the RENCA murine renal cell
56
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
carcinoma were obtained from the American Type Culture Collection (Manassas,
VA). Madison 109 (MAD 109), a murine lung carcinoma, was purchased from the
National Cancer Institute (Frederich, MD).
Animals
Perforin and IFN-y knock-out mice were generously provided by Dr. Stephan
Stohlman (Department of Microbiology, USC Keck School o f Medicine, Los
Angeles, CA). Six-week-old female BALB/c mice were obtained from Harlan
Sprague Dawley (Indianapolis, IN).
Depletion of lymphocyte subsets in vivo
Antibodies were administered one day before tumor implantation for CD25+
T-cell depletion studies or six days after tumor implantation for the depletion o f the
other T-cell subsets. For CD4+, CD8+, and CD25+ T-cell depletion, 0.5mg of anti-
CD4 antibody (GK1.5), anti-CD8 antibody (2.43), or anti-CD25 (PC61) were
injected i.p. in a 1 ml inoculum, and repeated every 5 days. For NK cell depletion,
0.35 mg o f anti-asialo GM1 was injected i.p. every 7 days. Depletion of specific T-
cell subsets was confirmed by flow cytometric analyses of splenocytes using normal
mice (data not shown).
57
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
Immunotherapy studies
Groups (n=5) of six-week old female BALB/c mice were injected
subcutaneously in the left flank with a 0.2ml inoculum containing approximately 107
of Colon 26, RENCA, or MAD 109 under a University Animal Care Committee-
approved protocol. The tumors were grown for 7 days until they reached
approximately 0.5cm in diameter. Groups of tumor-bearing mice (with or without
lymphocyte subset depletion) were treated intravenously with a 0.1ml inoculum
containing LEC/chTNT-3 (20pg) or control chTNT-3 (20pg). All groups were
treated daily x5 and tumor growth was monitored every other day by caliper
measurement in three dimensions. Tumor volumes were calculated by the formula:
length x width x height. The results were expressed as the mean+standard deviation
and the significance levels (P values) were determined using the Wilcoxon rank-sum
test.
Re-challenge experiments
One to six months after the completion of treatment, tumor-free mice from
previous studies and control naive mice were challenged with 107 cells o f Colon 26
and MAD 109 or Colon 26 and RENCA in the left and right flanks, respectively. The
injection sites were observed for 3-4 weeks. To study the presence o f CD4+CD25+ T-
cell in different groups, TDLN were removed and CD4+ CD25+ T-cell was stained
with PE-anti-CD25 and FITC-anti-CD4 for FACs analysis.
58
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
Infiltration of lymphocytes by flow cytometric analysis
Tumors from control and treated mice were aseptically removed on days 9,
15, and 20 after tumor implantation and manually cut into 2-3 mm pieces in a culture
petri dish. The small tissue fragments were then digested with 0.01% DNAse, 0.01%
hyaluronidase, and 0.1% collagenase (all from Sigma Chemical Co.) in R P M I1640
medium for 2-3 hrs at 37°C with continuous stirring. The resulting single cell
suspensions were then washed twice with 0.1% PCS in PBS and stained by standard
flow cytometry methods. To detect subpopulations of lymphocytes infiltrating these
tissues, the following conjugated antibodies were used for FACs: PE-anti-CD4,
FITC-anti-CD8, PE-anti-PMN, FITC-anti-CD25, APC-anti-CDllb, FITC-anti-
CD1 lc, and FITC-anti-NKl.l (BD Biosciences PharMingen, San Diego, CA).
Intracellular IFN-y production
Tumor draining lymph nodes (TDLN) from control and treated mice were
removed from mice on days 15 and 20 after tumor implantation. Single cell
suspensions were obtained as described above, and 2xl06 viable cells/well were
plated into a 24-well plate. Intracellular IFN-y production assay performed by first
stimulating the cells for 4hr in complete RPMI 1640 medium containing lOng/ml
PMA (Sigma, Aldrich) and lOOOng/ml of ionomycin (Sigma) in the presence of
GolgiStop (BD PharMingen). Cells were then washed, and mouse Fc receptors were
blocked with Ifig Fc Blocking antibody (CD16/CD32) per IQ6 cells in lOOp.1 of
Staining Buffer (1% Fetal Bovine Serum in PBS) for 15min at 4 °C. Cells were then
59
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
stained with a PE-conjugated anti-CD3e antibody for 30 min at 4 °C,
fixed/permeabilized with lOOpl Cytofix/Cytoperm (BD PharMingen) for 15min at
4°C, and washed with 300pi of Perm/Wash (BD PharMingen). The fixed cells were
then resuspended in 50pl Perm/Wash containing o f FITC-conjugated anti-IFN-y
antibody (BD PharMingen) for 30 min at 4 °C in the dark. Cells were washed and
resuspended in FACs buffer, and the intracellular production o f IFN-y was analyzed
Knock-out mouse immunotheray studies
For the perforin knock-out mouse studies, 107 Colon 26 cells were implanted
on day 1 in the left flank, and mice were depleted of CD4+ T-cell on day 6 with
0.5mg/mouse of GK1.5 which was repeated every 5 days. Treatment began on day 7
when tumors reached 0.5 cm in diameter. Mice were divided into 3 groups and
treated with (a) PBS, (b) chTNT-3 (20pg/mouse), or (c) LEC/chTNT-3
(20pg/mouse) intravenously with a 0.1ml inoculum. All groups were treated daily
for 5 days and tumor volumes were monitored every other day. For the IFN-y
knock-out mouse studies, Colon 26 tumor-bearing mice were divided into four
groups and treated for five consecutive days intravenously with (a) control chTNT-3
(20pg/mouse), (b) LEC/chTNT-3 (20pg/mouse), (c) CD25+ depletion and control
chTNT-3 (20pg/mouse), or (d) CD25+ depletion and LEC/chTNT-3 (20fig/mouse).
Tumor volumes were monitored by caliper measurement as described above.
60
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
T-cell proliferation assay
The proliferation of T-cell was measured by a modified flow cytometry
method [20, 21]. TDLN from control and treated mice were removed from tumor-
bearing mice on days 15 and 20 after tumor implantation. Single cell suspensions
were obtained by mincing the lymph nodes in a petri-dish and labeled with 5-(and-
6)-carboxyfluorescein diacetate, succinimidyl ester (CFSE) (Molecular Probes,
Eugene, OR) with the following modification. Briefly, cells were washed with PBS
twice, resuspended in PBS containing l-5jaM of CFSE, incubated at 37°C for 5-10
min, and the reaction stopped by addition o f 1 ml of pre-warmed 10% FBS in PBS
into each tube to remove any unbound CFSE. 2xl06 cells/well were then washed 2x
with 1% FBS in PBS and plated in a 24-well plate. Tumor lysates previously
obtained by 4 repeated freeze/thaw cycles using liquid nitrogen and a 37°C water
bath and stored frozen in lOOpl aliquot at-80°C , were thawed and centrifuged at
1,200 rpm as the source of tumor antigen. Tumor lysate was added to each well at a
final concentration of lOpg/ml, and the cells were collected at 20 and 50hr after
incubation. Cells were stained with PE-conjugated anti-CD3e to stain CD3+ T-cell.
The effect of tumor cell lysate stimulation on the proliferation o f CD3+ T-cell was
determined by FACs analysis.
Detection o f cytokines by real-time PCR.
Tumors were removed at days 9, 12, and 15 after tumor implantation for real
time PCR analysis of infiltrating lymphocytes. For these studies, single cell
61
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
suspensions of tumors were incubated in tissue culture flasks containing RPMI 1640
medium and 10% PCS for 3hr at 37 °C to separate non-attached lymphocytes from
tumor cells. Primers for selected cytokines were designed by software provided by
the ABI PRISM® 7900HT Sequence Detection System (Applied Biosystems,
Foster, CA). Briefly, total lymphocyte RNA was extracted by TRIzol (Gibco,
Rockville, MD) and 1 pg of total RNA was reverse transcribed into cDNA using a
Superscript cDNA systhesis kit (Invitrogen Life technologies, CA). The remaining
DNA was removed by a DNA-free kit (Ambion, Inc, Austin, TX) according to the
manufacturer’s protocol. The real-time PCR reaction mixture (20jul reaction)
consisted of 5pi of cDNA, 10pl of SYBR Green Master Mix (Applied Biosystems),
2 pi o f primers (3.3pM) and Ipl o f water. The PCR reaction was performed for 30
cycles, and the quantity of cytokines was detected by the ABI PRISM® 7900HT
Sequence Detection System (Applied Biosystems).
Results
Combination LEC/chTNT-3 immunotherapy and T-cell subset depletion in Colon 26
tumor-bearing mice
NK cells, CD4+ and CD8+ T-cell have been proved necessary for tumor
immunotherapy. Our previous data have shown that LEC/chTNT-3 treatment can
dramatically increase the infiltration o f different sub-populations o f lymphocytes into
tumor sites, including CD4+ and CD8+ T-cell, PMNs, dendritic cells, and B-cell [19].
In order to determine the relative roles of NK, CD4+ and CD8+ T-cell subsets in
62
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
tumor sites, including CD4+ and CD8+ T-cell, PMNs, dendritic cells, and B-cell [19].
In order to determine the relative roles o f NK, CD4+ and CD8+ T-cell subsets in
LEC/chTNT-3 immunotherapy, each o f these populations was first depleted starting
one day before the initiation of LEC/chTNT-3 immunotherapy. As shown in Figure
3-1, the depletion o f NK and CDS^ T-cell destroyed the anti-tumor effects of
LEC/chTNT-3, providing supporting data o f the immunotherapeutic role of these
subset in LEC-induced immunotherapy. In contrast to these results, CD4+ T-cell
depletion, when combined with LEC/chTNT-3 treatment caused complete tumor
remission by 17-19 days, and these mice remained tumor-free 6 months later. CD4+
T-cell depletion combined with control antibody chTNT-3 produced approximately
50% reduction in tumor growth compared to mice treated with chTNT-3 alone
(Figure 3-1), demonstrating the importance of this T-cell subset in cancer
immunotherapy.
Combination LEC/chTNT-3 immunotherapy and CD25+ T-cell depletion in tumor-
bearing mice
In order to determine whether CD25+ T-cell was responsible for the above
effects seen with CD4+ T-cell depletion, CD25+ T-cell were depleted by PC61. As
above, depletion was performed one day before tumor implantation and repeated
every 5 days. FACs analysis o f splenocyts removed from these mice demonstrated
essentially complete depletion of this small subpopulation of CD4+ cells. As shown
63
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
Figure 3-1: 4-6 week BALB/c mice were implanted with 107 Colon 26
subcutaneously and divided into eight groups. One day before treatment,
mice were depleted o f CD4T T-cell by anti-CD4 (GK1.3), CD8+ T-cell by
anti-CD8 (2.43), or NK cells by anti-asialo GM1. Control groups were
treated with control antibody chTNT-3 (20pg/mouse) with or without T-
cell, or NK cells depletion. Experimental groups were treated with fusion
protein LEC/chTNT-3 (20pg/mouse) with or without depletion.
64
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
Volume(cm3)
1.6
1.4
1.2 -
1 ■
0.8 -
0.6
0.4 ■
0.2 ■
0
'chTNT-3
•CD4 depleted +LECchTNT-3
CD8 depleted +LEC/chTNT-3
NK depleted +LEC/ehTNT-3
®CD4 depleted
"CD8 depleted
"NK depleted
'LEC/chTNT-3
Control
mi
CD4 depletion control
LEC/chTNT-3
LEC/chTNT-3+CD4 depletion
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
Figure 3-2: Four to six-week old BALB/c mice were injected with anti-CD25 (PC61)
antibody at O.Smg/mouse, and repeated every 5 days. Mice were then
implanted with 107 Colon 26 (A) or RENCA (B) subcutaneously.
Treatment was started 7 days after for Colon 26 or 15 days after tumor
implantation for RENCA. Control groups were treated with control
antibody chTNT-3 (20pg/mouse), and experimental groups were treated
with fusion protein LEC/chTNT-3 (20pg/mouse). Treatment was repeated
every day for 5 days, and the growth o f tumors was monitored by a
caliper (length x width x height).
66
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
Tumor Volume (cm3 )
A
1.4
— chTNT-3
—O— LEC/chTNT-3
—A™ chTNT-3+CD25 depletion
— LEC/cbTNT-3+CD25 depletion
1.2
0.8
0.6
0.4
0.2
19 17 11 13 15 7 9
B
0.7 -|
chTNT-3
LEC/chTNT-3
chTNT-3+CD25 depletion
LEC/chTNT-3+CD25 depletion
0.6 -
0.5 -
0.4 -
0.3 -
0.2 -
27 19 23 25 15 17
I Days
\ Treatment
67
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
in Figure 3-2, the depletion o f CD25+ T-cell combining control antibody treatment
dramatically decreased the tumor growth by 70% and 60% in Colon 26 (Figure 3-
2A) and RENCA models (Figure 3-2B), respectively. These results were similar to
that seen with LEC/chTNT-3 treatment alone. However, the combination of
LEC/chTNT-3 immunotherapy and CD25+ depletion caused complete remission of
these well-established tumors for up to 6-8 months.
Tumor Re-challenge
Tumor-regressed mice from previous treatments (LEC/chTNT-3 and CD25
depletion) and nai've mice were implanted with Colon 26 and MAD109 or Colon and
RENCA (data not shown). Two weeks after the implantation, all of the naive mice
had solid tumors growing on their left (Colon 26) and right (MAD 109) thighs
(Figure 3-3A), while the tumor-regressed mice (60 days after previous tumor
implantation) only have tumor growing on the right thigh (MAD 109) (Figure 3-3B),
and the MAD109 tumor sizes were much smaller (50% reduction) than naive mice.
While the tumor-regressed mice which implanted with Colon 26 and RENCA had no
tumor growth 30 days after the challenge. The presence o f CD4+CD25+ T-cell in
TDLN was also measured. In naive mice, CD4+CD25+ T-cell constitutes 9.7% of
total T-cell (Figure 3-3C), while in 2-3 month tumor-regressed mice, they constitutes
5% of totoal T-cell (Figure 3-3D), however 13% of total T-cell was observed in 5-6
month tumor-regressed mice (Figure 3-3E).
68
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
Figure 3-3: Re-challenging studies: naive mice (A) and 2-3 month Colon 26 tumor-
regressed mice from previous treatment (B) were implanted with Colon
26 and MAD 109 on their left and right thighs respectively. Sites were
observed for 2-3 weeks after implantation. The presence of CD4+CD25+
T -cell in TDLN from naive mice (C), 2-3 month tumor-regressed mice
(D), and 5-6 month tumor-regressed mice (E) was detected by FACs.
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
71
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
Infiltration o f lymphocytes subpopulations into tumor sites studied by FACs
To measure the infiltration of lymphocytes into the tumor microenvironment,
tumors were removed on day 15 after tumor implantation. Single cell suspensions
were obtained and stained with surface antibodies to quantify the penetrating
lymphocytes within the tumors. Percentage of infiltrating CD8+ T-cell is shown in
Figure 3-4A: both LEC/chTNT-3 treated groups (with or without CD25 depletion)
showed more infiltrating CD8+ T-cell (1.5% and 2.5% respectively) than their
control groups (0.6% and 1.04% respectively). However, the depletion of CD25 did
not increase the actual number of infiltrating CD8+ T cell, it may be that the
proportion of activated infiltrating CD8+ T-cell was increased. A similar
phenomenon was also observed in infiltrating DC measured by double stained with
anti-CD 1 lc and anti-CD lib antibodies (Figure 3-4B). The treatment of
LEC/chTNT-3 with or without CD25 depletion both showed more (14.12% and
11.67% respectively) CD1 lb + CD1 lc+ infiltration than control groups (7.98% and
5.08% respectively). To determine the infiltrated CD4+ T-cell, CD25 and CD4
double staining was applied. There was more CD4+ T-cell in both CD25 depleted
groups. The treatment of LEC/chTNT-3 induced almost double the amount of CD4+
T-cell (4.9% versa 2.6%) in tumor regions (Figure 3-4C).
72
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
Figure. 3-4: The infiltration of lymphocytes was studied by FACs. Tumors were
removed on day 10 after tumor implantation, single cell suspensions
were obtained, and the infiltration of CD8+, PMN (A), CD1 lb +CDl lc+
DC (B), and CD4+ , CD25+ T cells (C) was studied by flow cytometry.
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
+
oc
C
O 200 400 600 300 1000
chTNT-3
0 200 400 600 S O C
LEC/chTNT-3
0 200 400 600 800 1000
1l.46%
4 v * * * .
*« 8
4 [ "a ’ v --
J . * * .
i f
s “ c ;?
chTNT-3 & CB25+ depletion
0 200 400 600 800 1000
LEC/chTNT-3 & CD25+ depletion
PMN
B
+
G
U
•• i ' *
A - ’1; .
* "v .
V - 1 4 .1 2 %
0 200 400 600 800 1000
chTNT-3
0 200 400 600 800 1003
LEC/chTNT-3
5.08%
0 200 400 600 800 1000
1.1.67%
200 400 800 800 1000
chTNT-3 & CD25+ depletion LEC/chTNT-3 & CD25+ depletion
C D llc
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
Figure 3-4 (continued)
V*
C
u
| ' . 4
• 1.8 %
* *
I
n I
. 1.38%
! . ' '
fa i-------------- - ...............................
200 400 600 800 1000
chTNT-3
2.66%
0 200 400 600 800 1000
2.3%
2.33%
0 200 400 600 800 1000
LEC/chTNT-3
0 200 400 600 800 1000
chTNT-3 & CD25+ depletion LEC/chTNT-3 & CD25+ depletion
CD4+
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
Intracellular IFN-y production
IFN-y is an important cytokine for cancer therapy and is also a marker for T
cell activation. T cells from TDLN were collected and stained with anti-CD3e (a T-
cell surface marker) and their intracellular IFN-y levels were analyzed. Intracellular
FACs analysis (Figure 3-5) showed that in the control antibody (chTNT-3) treated
group, the IFN-y producing T-cell comprised 10.9% of total T cell population, while
IFN-y producing T-cell comprised 15.7% of total T cells population in the
LEC/chTNT-3 treated group. However, in the CD25 depletion background, IFN-y
producing T-cell comprised 25.6% of total T cells in the LEC/chTNT-3 group, which
almost double the percentage o f the control (chTNT-3) treated groups.
IFN-y knock-out mouse studies
The increased production of IFN-y in CD25-depleted mice suggests that this
cytokine m ay play a role in the anti-tumor effect observed in the depletion studies.
To test this, IFN-y knock-out mice were implanted with Colon 26 tumor cells
subcutaneously. CD25 depletion and treatment with LEC/chTNT-3 or chTNT-3 were
performed as described above. As shown in Figure 3-6, even though LEC/chTNT-3
still reduced tumor growth to about 40% as compared with control antibody treated
group, the combination of CD25 depletion resulted in a similar growth curve, which
suggested that IFN-y is required for activated effector cells resulting from CD25
depletion to carry out the anti-tumor effect. Furthermore, the reduction of tumor
76
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
Figure 3-5: The intracellular cytokine IFN-y expression was detected by FACs.
TDLN were removed from tumor-bearing mice at day 20. Single cell
suspension was obtained, and stimulated with lOng/ml of PMA and
lOOng/ml of ionomycine in the presence of GolgiStop for 4-6 hours. Cells
were then stained with surface marker anti-CD3e, and fixed with
Cytofix/cytoperm. The INF-y production was detected by staining with
FITC-anti-IFN-y.
chTNT-3
LEC/chTNT-3
]"' t '" " ( TfT T 'T "j"— I r,. . . .I -|-'TT|-
chTNT-3+CD25
LEC/chTNT-3+CD25 depletion
---------------------------- ► IFN-y
77
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
Figure 3-6: IFN-y knock-out (GKO) mice were depleted o f CD25+ T cells by PC61
one day before tumor implantation. Mice were implanted with 107 Colon
26 /mouse. Mice were treated with control antibody chTNT-3
(20fig/mouse) or fusion protein LEC/chTNT-3 (20pg/mouse) when tumor
reached 0.5 cm in diameter. Treatment was repeated every day for 5 days.
Growth of tumors was monitored by caliper (length x width x height).
0.8
chTNT-3
LEC/chTNT-3
chTNT-3+CD25 depletion
LEC/chTNT-3+CD25 depletion
0.2
0.1
9 11 14 16 18 20
Days
78
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
growth by 35% in LEC/chTNT-3 treated IFN-y knockout mice implies that IFN-y is
not essential for the anti-tumor function of this fusion protein.
Perforin knock-out mouse studies
Perforin is a downstream factor critical for NK and CD8+ T-cell function. To
test whether the combination of CD4+ depletion and LEC/chTNT-3 treatment
enhanced NK and CD8+ T cell function via cell to cell contact utilizing the perforin
pathway, perforin-knock out (PKO) mice were used in place of normal B ALB/c
mice. For these studies, Colon 26-bearing PKO mice were treated with anti-CD4
antibody one day before the initiation of treatment with LEC/chTNT-3 or control
antibody as described above. As shown in Figure 3-7, CD4 depletion performed in
combination with LEC/chTNT-3 treatment still reduced tumor growth by 80% as
compared with control antibody- and PBS-treated groups.
T-cell nroliferation assays
To confirm whether CD25 depletion indeed activates T-cell, a tumor specific
T-cell proliferation assay was performed. CFSE is a vital dye, which can be carried
to daughter cells, enabling quantitation of T-cell proliferation. Colon 26 tumor
lysate was incubated with T-cell to obtain a tumor-specific T cell proliferation. As
shown in Figure 3-8 A, after 20hr incubation with tumor lysate, the proliferation of
shown).
79
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
Figure 3-7: Perforin knock-out (PKO) mice were implanted with Colon 26
subcutaneously. One day before the treatment, mice were depleted of
CD4+ T cells by O.Smg/mouse of anti-CD4 (GK1.3). Mice were treated
with PBS, control antibody chTNT-3 (20jig/mouse), or fusion protein
LEC/chTNT-3 (20pg/mouse) daily x 5. Growth of the tumors was
monitored by caliper (length x width x height).
0.8
LEC/chTNT-3
0.7
chTNT-3
0.6
PBS
0.5
0.4
0.3
0.2
0.1
0
17 13 15 9 11 7
Days
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
More importantly, when the proliferation o f spleen was studied, T cells proliferation
was only observed in the CD25-depleted group, not in LEC/chTNT-3 T-cell in
TDLN was significantly different among depletion and/or treated groups. In the
chTNT-3 treated group, only 1.6% of T cell started to proliferate by 20hr. The
treatment with LEC/chTNT-3 increased the proliferating T-cell to about 3.0%, while
the depletion o f CD25 dramatically induced the proliferation o f T-cell to about 20%,
as combined with LEC/chTNT-3, 42% of T cell proliferation was observed and the
more shifting o f T cell population to the left indicated the more dividing of T-cell.
This effect was also observed after 50hrs incubation (data not shown). More
importantly, when the proliferation of spleen was studied, T cells proliferation was
only observed in the CD25-depleted group, not in LEC/chTNT-3 combining with
CD25 depletion (Figure 3-8B), which suggest that the circulating activated T
lymphocytes migrated into TDLN under the chemoattraction o f LEC/chTNT-3 in
tumor sites, while clear from other normal organs.
Cytokines expression analyzed by real-time PCR
The mRNA level of Thl (IL-2, IFN-y, and TNF-a) and Th2 (IL-4, IL-10, and
TGF-P) cytokines in tumor infiltrating lymphocytes were detected by real-time PCR.
The mRNA levels in the control antibody (chTNT-3) treated group were
standardized as 1, the mRNA levels in other treated groups was compared to control
group, and the ratio was calculated (Figure 3-9). These data implied that the Thl and
Th2 cytokines were highest in LEC/chTNT-3 treated group. When compared the
81
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
Figure 3-8: T-cell proliferation was measured by a tumor-specific proliferation assay.
TDLN (A) and splenocytes (B) were removed from tumor-bearing mice
on day 20. Single cell suspensions were obtained, and labeled with 1-
5pM CFSE, then incubated with tumor lysate at a concentration of
10fig/ml for 20 hrs. CD3e+ T cell proliferation was detected by FACs.
82
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
< D
m
Q
U
200 400 800 B O O 1000
chTN T-3
19.21%
£
i ' ”
■ S ’ " . ^
S „
. , ’ m ' ‘ ” » "■i? •
B
ChTNT-3 & C D 25+
depletion
0 200
&
m
Q
U
400 (
chTNT-3
i” ’ * ’ ! ’ * '
0 200 400 600 800 1000
chTNT-3 & CB25+ depletion
0 200 400 «00 800 1*00
L EC /chTN T-3
40:6?%
L EC /chT N T -3 & CD25+
depletion
-
!
-
\ i 'i t 1 1 t '» v 1 1 * i i it a i
0 200 400 600 800 1000
LEC/chTNT-3
rrT-nrT-p
200 400 600 B O O 1000
CFSE
LEC/chTNT-3 &
-► CD25+ depletion
83
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
Index
Figure 3-9: Cytokine mRNA levels o f tumor infiltrating lymphocytes were detected
by real-time PCR.
Cytokines mRNA levels in tumor infiltrating lymphocytes
□chTNT-3
6 - H LEC/chTNT-3
■chTNT-3+ CD25 depletion
B LEC/chTNT-3+CD25 depletion
IFN-'f IL-2 TNF-a I W tL-10 TGF-pl
Cytokines
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
CD25 depletion groups, the combination treatment group (LEC/chTNT-3 and CD25
depletion) showed higher Thl expression (IFN-y=T.86, IL-2= 2.7, and TNF-a= 2.2)
than the control groups (chTNT-3 and CD25 depletion) (IFN-y= 1.0, IL-2= 1.9, and
TNF-a= 1.6) while less Th2 cytokines expression
Discussion
Many studies have indicated that single immunocytokine cannot eliminate
well-established tumors in animal models. Synergistic effects of combination fusion
protein therapy or o f fusion proteins combined with other anti-cancer therapies are
more promising [22-24]. Our previous studies indicated the chemokine fusion
protein LEC/chTNT-3 alone would only reduce tumor growth by 37% in the
MAD 109 tumor model, while when combined with other fusion proteins (TNT-
3/TNFa, TNT-3/IFNy, and TNT-3/IL-2), the tumor growth was reduced by 67%
(data not shown). We further proved a synergistic effect of combined CD4+CD25+ T-
cell depletion and chemokine/antibody fusion protein treatment on well-established
solid tumors in several murine models.
In this study, the depletion of CD4+ T-cell, or more specifically, CD4+CD25+
T-cell combined with LEC/chTNT-3 resulted in complete tumor remission in two
well-established solid tumor models: Colon 26 and RENCA. By comparison,
combined depletion and treatment with control antibody resulted in only 20% and
0% remission (Colon 26 and RENCA respectively). Studies conducted by Golgher et
al. showed a much higher frequency o f Colon 26 tumor rejection by CD25 depletion
85
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
alone [25]. This difference may be due to the fact that we implanted greater number
of tumor cells (107 ) compared to the number used in their studies (5x104).
CD4+CD25+ T-cell (Suppressor T-cell) was first identified by North et ah: as shown
in their studies, the administration o f anti-CD4 antibody significantly increased the
anti-tumor effect in several sarcoma and mastocytoma tumor models [26, 27].
However, in our tumor models, depletion alone only delayed the establishment of
solid tumor, and the percentage of tumor-free mice was much lower compared to
combination therapy.
Our studies also indicated that this immune response is both tumor-specific
and non-specific. We challenged the tumor-regressed mice two months after the
previous treatment (CD25+ T cell depletion combined with LEC/chTNT-3 treatment)
with two different cancer cell lines at 107 cells/mouse (Colon + MAD 109 and Colon
26 + RENCA). Naive mice had both tumors growing on their thighs, while all mice
receiving combination treatment had only MAD 109 tumors, but no Colon 26 or
RENCA tumors. By contrast, MAD 109 tumors in treated mice were much smaller
than those in control naive mice. This suggested that even 2-3 months after this
combinatorial treatment, these tumor-free mice still had antigen-specific immune
memory. It also indicated possible cross-antigens among Colon 26, RENCA and
MAD 109 tumor cell lines. However, this anti-tumor memory is still time-limited;
when we re-challenged the regressed mice 5-6 months after the first tumor
implantation, they had lost their immunity to both Colon 26 and MAD 109 (data not
shown). Our flow cytometry data indicated that 2-3 months after CD25 depletion,
86
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
CD4+CD25+ T-cell comprised 5% of total CD4+ T lymphocytes compared to 10% in
naive mice. However at 6 months, CD4+ CD25+ T-cell comprised 13% of total CD4+
T-cells, which is slightly higher than levels in naive mice. These results suggested
CD4+CD25+ T-cells regulate immune memory, as did those published by Murakami
et a l, which indicated the presence of CD4+CD25+ T-cells inhibits the proliferation
of CD8+ memory cells [28, 29].
The mechanisms of suppression mediated through CD4+ CD25+ T-cells still
remain unknown. Our immunotherapeutic data from Colon 26 tumor-bearing
perforin knock-out mice indicated that this combinational effect is not associated
with perforin, since the combination o f CD4+ T cell depletion and chemokine fusion
protein LEC/chTNT-3 treatment still resulted in 80% tumor reduction as compared
with CD4+ T cell depletion combined with PBS or control antibody chTNT-3.
Previous studies have shown that the depletion of CD4+ (or CD4+CD25+ ) T-cells
could dramatically induce CD8+ T cell penetration into the tumor site in aB16
melanoma model [30]. To address this, infiltration of different populations of
lymphocytes was measured. However, flow cytometry analysis of lymphocytes in
tumor sites did not support this result in our tumor models. Even though the
treatment with LEC/chTNT-3 consistently induced more lymphocytes infiltration
compared to control antibody-treated groups, the CD25+ T-cell depletion background
did not induce greater numbers of infiltrating lymphocytes, suggesting that it is not
the number but the activation status o f infiltrating lymphocytes which leads to the
reduction of tumor volume.
87
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
One of the possible mechanisms by which CD4+CD25+ T-cells suppress
effector lymphocytes is by a cytokine-mediated pathway. However, more recent
studies showed that CD4+ CD25+ T-cells did not negatively regulate downstream
cells through cytokines (IL-10 or IL-4), since IL-10 or IL-4 knock-out mice still
developed autoimmune diseases after enhancement of the number and function of
CD4+CD25+ T-cells [31-33]. By real-time PCR, we also showed that the depletion
background did not significantly decrease IL-4 cytokine expression or increase Thl
cytokine expression as compared to LEC/chTNT-3 treated alone groups in total
lymphocytes population. By contrast, when compared the two CD25+ T-cell
depleted groups, the combination treatment did result in a higher Thl cytokine (IL-2,
IFN-y, and TNF-a), and less Th2 cytokine (IL-4, IL-10, and TGF-pl) expression. In
another experiment, an anti-IL-10 receptor antibody was injected into tumor-bearing
mice to block the binding of IL-10 to its receptor, and treated mice with the same
fusion protein and control antibody treatment as before (data not shown). Even
though IL-10 is a well-known immuno-suppressive cytokine, the abrogation of IL-10
did not improve the therapeutic effect of LEC/chTNT-3, as compared with the
combination of CD25+ T cell depletion. IL-10 may not be a necessary downstream
suppressive cytokine for T reg function in tumor immunity. On the other hand, some
studies have shown that IL-10 may have some contributory roles in tumor rejection
by enhancing the cytotoxicity of CD8+ T-cells and NK cells [34],
IFN-y is probably a key factor in T cells activation on a CD4+ CD25+ T-cell-
depleted background. Intracellular IFN-y staining showed that the depletion of
88
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
CD4+CD25+ T-cells could significantly increase the number of IFN-y producing T-
cells in combinatorial treatment. When we combined depletion with LEC/chTNT-3
treatment in IFN-y knock-out mice, the depletion of CD4+CD25+ T-cells did not
change the therapeutic effect o f LEC/chTNT-3 on Colon 26 tumor-bearing mice. The
proliferation assay also showed that depletion of CD4+ CD25+ T-cells had no effect
on T-cell activation (data not shown). These data suggest that IFN-y is essential for
the activation o f effector T-cells by depletion o f CD4+ CD25+ T-cells.
Studies conducted by Shevach et al. indicate that CD4+CD25+ T-cells are
potent suppressor o f T cells activation, including CD4+ CD25" T-cells and CD8+ T-
cells. An in vitro assay involving incubation of CD4+CD25‘ T-cell with anti-CD3 and
IL-2 provided evidence for this conclusion [12, 32]. In our study, a tumor-specific T-
cell proliferation assay was performed in an ex vivo model. Lymphocytes from
spleens and TDLN were removed from different treated groups, then incubated with
Colon 26 tumor lysates. As shown in TDLN proliferation assays, the depletion of
CD25+ T-cells dramatically increased the number of activated CD3+ T-cells relative
to the number o f activated T-cells in LEC/chTNT-3 treated group alone, and no
detectable activated T-cells in control antibody (chTNT-3) treated groups. The
combination o f LEC/chTNT-3 and CD25 depletion induced more activated T-cells
than CD25 depletion alone in TDLN (42% versa 20%). A more dramatic finding
was uncovered by the spleenocyte proliferation assay. After incubation with Colon
26 tumor lysate, activated T-cells comprised about 20% of the total T lymphocytes in
the spleen of mice treated with CD25+ T cell depletion alone, while there were no
89
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
activated T-cells in spleens in LEC/chTNT-3 treated groups. These data further
prove the chemoattractive property of LEC/chTNT-3 within the tumor. LEC/chTNT-
3 may help to recruit activated T-cells from circulation to migrate specifically to
tumor microenvironment and TDLN.
This proliferation experiment is o f importance in that it addressed one o f the
concerns o f depletion therapy, namely induction o f autoimmunity. One of the key
functions of CD4+CD25‘ T-cell is to suppress autoimmune disease. As shown by in
vitro and in vivo studies, depletion o f T-cell correlates with the generation of a
variety of autoimmune diseases [35-39]. Thus, therapeutic depletion o f CD4+ CD25+
T-cell may theoretically induce autoimmunity in patients. Increased lever of
CD4+CD25+ T-cell have been found in the circulation of melanoma, pancreas, or
breast adenocarcinoma cancer patients [40, 41], which may play a role in
suppressing the immune response against tumor antigens, the depletion of
CD4+CD25+ T-cell might be beneficial for tumor treatment. Directing these activated
lymphocytes to specific organs (such as tumor sites), while eliminating the damage
to other normal organs would be a substantial concern. Chemokines are ideal
candidates for controlling tissue-specific lymphocytes trafficking and homing:
chemokines and their receptors help control the specificity of memory lymphocyte
subsets by CCL17/CCR4 and CCL27/CCR10 interactions [42-45]. While studies
specific to the chemokine LEG are still underway, existing data show that CCR1 and
CCR8 (both LEG receptors) are expressed on resting and activated lymphocytes
[46], The proliferation assay on lymphocytes from both TDLN and spleen in mice
90
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
suggest that LEC/chTNT-3 could control the specific migration o f activated
lymphocytes, which might decrease possible damage caused by activated
lymphocytes.
In conclusion, our study provides a new approach for tumor immunotherapy.
In the future studies, it would be interesting to examine the differences among cell
lines Colon 26, RENCA, and MAD 109 that produce different responses to
treatment. In addition, CD25 may not be a perfect marker for CD4+ CD25+ T-cell
depletion, as there is small percentage of effector CD8+CD25+ T-cells that are also
depleted. CTLA-4, which is constitutively expressed only on CD4+ CD25+ T-cells
may be a better candidate for specific removal o f CD4+CD25+ T-cell.
References:
1. Mills, C.D. and R.J. North, Ly-1 +2- suppressor T cells inhibit the expression
o f passively transferred antitumor immunity by suppressing the generation o f
cytolytic Tcells. Transplantation, 1985. 39(2): p. 202-8.
2. Hill, J.O., M. Awwad, and R.J. North, Elimination o f CD4+ suppressor T
cells from susceptible BALB/c mice releases CD 8+ T lymphocytes to mediate
protective immunity against Leishmania. J Exp Med, 1989.169(5): p. 1819-
27.
3. Awwad, M. and R.J. North, Radiosensitive barrier to T-cell-mediated
adoptive immunotherapy o f established tumors. Cancer Res, 1990. 50(8): p.
2228-33.
4. Shevach, E.M., CD4+ CD25+ suppressor T cells: more questions than
answers. Nat Rev Immunol, 2002. 2(6): p. 389-400.
5. Takahashi, T., et al., Immunologic self-tolerance maintained by
CD25(+)CD4(+) regulatory T cells constitutively expressing cytotoxic T
lymphocyte-associated antigen 4. J Exp Med, 2000. 192(2): p. 303-10.
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
6. McHugh, R.S. and E.M. Shevach, The role o f suppressor T cells in
regulation o f immune responses. J Allergy Clin Immunol, 2002.110(5): p.
693-702.
7. Annunziato, F., et aL, Phenotype, localization, and mechanism o f suppression
o f CD4(+)CD25(+) human thymocytes. Journal of Experimental Medicine,
2002.196: p. 379-387.
8. Shevach, E.M., et al., Control o f autoimmunity by regulatory T cells. Adv
Exp Med Biol, 2001. 490: p. 21-32.
9. Antony, P.A. and N.P. Restifo, Do CD4+ CD25+ immunoregulatory T cells
hinder tumor immunotherapy? J hnmunother, 2002. 25(3): p. 202-6.
10. Shimizu, J., S. Yamazaki, and S. Sakaguchi, Induction o f tumor immunity by
removing CD25+CD4+ T cells: a common basis between tumor immunity
and autoimmunity. J Immunol, 1999. 163(10): p. 5211-8.
11. Tanaka, H., et al., Depletion o f CD4+ CD25+ regulatory cells augments the
generation o f specific immune T cells in tumor-draining lymph nodes. J
Immunother, 2002. 25(3): p. 207-17.
12. Piccirillo, C.A. and E.M. Shevach, Cutting edge: control o f CD8+ T cell
activation by CD4+CD25+ immunoregulatory cells. J Immunol, 2001.
167(3): p. 1137-40.
13. Onizuka, S., et al., Tumor rejection by in vivo administration o f anti-CD25
(interleukin-2 receptor alpha) monoclonal antibody. Cancer Res, 1999.
59(13): p. 3128-33.
14. Sutmuller, R.P., et al., Synergism o f cytotoxic T lymphocyte-associated
antigen 4 blockade and depletion o f CD25(+) regulatory T cells in antitumor
therapy reveals alternative pathways fo r suppression o f autoreactive
cytotoxic T lymphocyte responses. J Exp Med, 2001.194(6): p. 823-32.
15. Clark, W.H., Jr., et al., Model predicting survival in stage I melanoma based
on tumor progression. J Natl Cancer Inst, 1989. 81(24): p. 1893-904.
16. Wamock, R.A., et al., The role o f chemokines in the microenvironmental
control o fT versus B cell arrest in Peyer's patch high endothelial venules. J
Exp Med, 2000.191(1): p. 77-88.
17. Reiss, Y., et al., CC chemokine receptor (CCR)4 and the CCR10 ligand
cutaneous T cell-attracting chemokine (CTACK) in lymphocyte trafficking to
inflamed skin. J Exp Med, 2001. 194(10): p. 1541-7.
92
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
18. Johnston, B. and B.C. Butcher, Chemokines in rapid leukocyte adhesion
triggering and migration. Semin Immunol, 2002.14(2): p. 83-92.
19. Li, J., et al., LEC/chTNT-3 Fusion Protein fo r the Immunotherapy o f
Experimental Solid Tumors. In press.
20. Renno, T., et al., Cutting Edge: Apoptosis o f Superantigen-Activated T Cells
Occurs Preferentially After a Discrete Number o f Cell Divisions In Vivo. J
Immunol, 1999.162(11): p. 6312-6315.
21. Weston, S. A. and C.R. Parish, New fluorescent dyes fo r lymphocyte
migration studies. Analysis by flow cytometry and fluorescence microscopy. J
Immunol Methods, 1990.133(1): p. 87-97.
22. Gillies, S.D., et al., Bi-functional cytokine fusion proteins fo r gene therapy
and antibody-targeted treatment o f cancer. Cancer Immunol Immunother,
2002. 51(8): p. 449-60.
23. Lode, H.N., et al., Synergy between an antiangiogenic integrin alphav
antagonist and an antibody-cytokine fusion protein eradicates spontaneous
tumor metastases. Proc Natl Acad Sci USA, 1999. 96(4): p. 1591-6.
24. Penichet, M X. and S.L. Morrison, Antibody-cytokine fusion proteins fo r the
therapy o f cancer. J Immunol Methods, 2001. 248(1-2): p. 91-101.
25. Golgher, D., et al., Depletion o f CD25+ regulatory cells uncovers immune
responses to shared murine tumor rejection antigens. Eur J Immunol, 2002.
32(11): p. 3267-75.
26. North, R.J., The therapeutic significance o f concomitant antitumor immunity.
I. LY-1-2+ T cells from mice with a progressive tumor can cause regression
o f an established tumor in gamma-irradiated recipients. Cancer Immunol
Immunother, 1984.18(2): p. 69-74.
27. North, R.J. and E.S. Dye, Ly 1+2- suppressor Tcells down-regulate the
generation ofL y 1-2+ effector T cells during progressive growth o f the P815
mastocytoma. Immunology, 1985. 54(1): p. 47-56.
28. Murakami, M., et al., CD25+CD4+ Tcells contribute to the control o f
memory CD8+ T cells. PNAS, 2002. 99(13): p. 8832-8837.
29. Shevach, E.M., et al., Control o f T-cell activation by CD4+ CD25+
suppressor Tcells. Immunol Rev, 2001.182: p. 58-67.
93
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
30. Nagai, H., et a l, Elimination o f CD4(+) T cells enhances anti-tumor effect o f
locally secreted interleukin-12 on B16 mouse melanoma and induces vitiligo
like coat color alteration. J Invest Dermatol, 2000.115(6): p. 1059-64.
31. Takahashi, T., et al., Immunologic self-tolerance maintained by
CD25+CD4+ naturally anergic and suppressive T cells: induction o f
autoimmune disease by breaking their anergic/suppressive state. Int.
Immunol., 1998.10(12): p. 1969-1980.
32. Thornton, A.M. and E.M. Shevach, CD4+CD25+ Immunoregulatory T Cells
Suppress Polyclonal T Cell Activation In Vitro by Inhibiting Interleukin
2 Production. J. Exp. Med., 1998. 188(2): p. 287-296.
33. Kuhn, R., et al., Interleukin-10-deficient mice develop chronic enterocolitis.
Cell, 1993. 75(2): p. 263-274.
34. Segal, B.M., D.D. Glass, and E.M. Shevach, Cutting Edge: IL-10-producing
CD4+ Tcells mediate tumor rejection. J Immunol, 2002.168(1): p. 1-4.
35. McHugh, R.S., E.M. Shevach, and A.M. Thornton, Control o f organ-specific
autoimmunity by immunoregulatory CD4(+)CD25(+) T cells. Microbes
Infect, 2001.3(11): p. 919-27.
36. Han, H.-S., et al., A New Type o f CD4+ Suppressor Tcell Completely
Prevents Spontaneous Autoimmune Diabetes and Recurrent Diabetes in
Syngeneic Islet-Transplanted NOD Mice. Journal of Autoimmunity, 1996.
9(3): p. 331-339.
37. Van de Keere, F. and S. Tonegawa, CD4+ T Cells Prevent Spontaneous
Experimental Autoimmune Encephalomyelitis in Anti-Myelin Basic Protein T
Cell Receptor Transgenic Mice. J. Exp. Med., 1998.188(10): p. 1875-1882.
38. Itoh, M., et al., Thymus and Autoimmunity: Production o f CD25+CD4+
Naturally Anergic and Suppressive T Cells as a Key Function o f the Thymus
in Maintaining Immunologic Self-Tolerance. J Immunol, 1999.162(9): p.
5317-5326.
39. Morrissey, P., et al., CD4+ Tcells that express high levels o f CD45RB induce
wasting disease when transferred into congenic severe combined
immunodeficient mice. Disease development is prevented by cotransfer o f
purified CD4+ T cells. J. Exp. Med., 1993.178(1): p. 237-244.
40. Javia, L.R. and S. A. Rosenberg, CD4+CD25+ Suppressor Lymphocytes in
the Circulation o f Patients Immunized Against Melanoma Antigens. J
Immunother, 2003. 26(1): p. 85-93.
94
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
41. Liyanage, U.K., et al., Prevalence o f regulatory T cells is increased in
peripheral blood and tumor microenvironment o f patients with pancreas or
breast adenocarcinoma. J Immunol, 2002.169(5): p. 2756-61.
42. Campbell, J.J. and E.C. Butcher, Chemokines in tissue-specific and
microenvironment-specific lymphocyte homing. Cuix Opin Immunol, 2000.
12(3): p. 336-41.
43. Kunkel, E.J. and E.C. Butcher, Chemokines and the tissue-specific migration
o f lymphocytes. Immunity, 2002.16(1): p. 1-4.
44. Campbell, J.J., et al., Expression o f Chemokine Receptors by Lung T Cells
from Normal and Asthmatic Subjects. J Immunol, 2001.166(4): p. 2842-
2848.
45. Morales, J., et al., CTACK, a skin-associated chemokine that preferentially
attracts skin-homing memory Tcells. PNAS, 1999. 96(25): p. 14470-14475.
46. Howard, O.M.Z., et al., LEC induces chemotaxis and adhesion by interacting
with CCR1 and CCR8. Blood, 2000. 96(3): p. 840-845.
95
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
CHAPTER 4
ANTIBODY/HUIL-12 FUSION PROTEIN FOR THE
IMMUNOTHERAPY OF EXPERIMENTAL SOLID TUMORS
A bstract:
Interleukin-12, also known as natural killer cell stimulating factor (NKSF),
facilitates a number o f immune responses and has been shown to be one o f the most
powerful anti-tumor cytokines to date. Fusion proteins allow the targeting of
cytokines to the tumor sites in order to generate a local immune response. In this
study, the fusion protein chTNT-3/huIL-12, consisting of the necrosis targeting
antibody chTNT-3 and human interleukin-12, was constructed and expressed in a
glutamine synthetase gene amplification system. The expression vector consisted of
the huIL-12 p35 subunit cDNA fused to the 3’ end of chTNT-3 heavy chain cDNA.
The activity o f chTNT-3/huIL-12 was confirmed by a standard IL-12 bioactivity
assay, which demonstrated that it induced PBL proliferation similar to recombinant
IL-12. This fusion protein also demonstrated tumor lytic activity by both naive and
IL-2-activated lymphocytes in a cytotoxicity assay against human cancer cell lines
CAP AN, DU145, and PC3-MA. Lymphocytes incubated with chTNT-3/huIL-12
demonstrated an increase in IFN-y production, and this effect was augmented
dramatically by pre-incubation with IL-2. The immunotherapeutic effect o f chTNT-
3/huIL-12 was illustrated by a DU145-bearing PBL-SCID mouse model. These
96
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
results demonstrated that tumor-targeted IL-12 might be an effective
immimotherapeutic reagent for the treatment o f cancer.
Introduction
Immunotherapy is a powerful therapeutic modality for the treatment of
cancer. As we have learned about cancer pathogenesis, rather than cancer cells
escaping immune detection, it may be the host’s innate immune system first fails to
recognize the tumor as a posing danger [1]. Immunotherapy, designed to stimulate
immune system should exert greater therapeutic benefits than classical chemotherapy
or radiotherapy, which by contrast damage immune functions. Much evidence have
shown that cytokines are efficient in initiating an antitumor immune response [2-4].
However, cytokines are short lived, and the high doses required may produce severe
systemic side effect [5, 6]. There are many approaches to achieve the accumulation
and activation of immune effector cells in the vicinity o f tumor cells [7]; in this
study, we focused on the strategy of fusion proteins. Antibody-cytokine fusion
proteins combine the targeting ability of an antibody with the multi-immunological
functions o f cytokines [8], enabling efficient accumulation of cytokines within the
tumor at decreased doses.
Interleukin-12 (IL-12) was discovered in an Epstein-Barr virus-transformed
B cell line [9]. Since its discovery, IL-12 has been found to have therapeutic
functions in both infections and autoimmune diseases: IL-12-based vaccines
suppress pulmonary granuloma formation in Schistosomiasis infection, and IL-12
97
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
inhibitors play important roles in treating autoimmune disease [10,11]. IL-12 is also
a unique cytokine, it is the only heterodimeric cytokine [12], consisting two subunits
(p35 and p40), which automatically forms bioactive cytokine under physiological
conditions. IL-12 has important functions in regulating immune responses via
induction of proliferation and cytotoxicity of T cells and NK cells [13]. As a Thl
cytokine, IL-12 promotes the generation of CD8+ cytotoxic T lymphocytes (CTL)
and the production o f IFN-y; the latter also induces the production o f an IFN-y
induced protein 10 (IP-10), which has anti-angiogenesis function. The production of
IFN-y also further induces the expression of IL-12 by dendritic cells and
microphages by a strong positive feedback mechanism. The activation of NK and T
cells, the increased production of IFN-y, and the downstream anti-angiogenesis effect
have made IL-12 an ideal cytokine in tumor immunotherapy in many animal models
[13-15].
Although IL-12 elicits a strong anti-tumor immune response, its utilization
has been limited due to its severe systemic toxicity [16]. In this study, an
antibody/IL-12 fusion protein has been generated to improve the clinical outcome of
IL-12 therapy. The primary difficulty o f monoclonal antibody therapy is to find a
specific and stable target antigen. Tumor Necrosis Treatment (TNT) utilized MAbs,
which are directed against universal intracellular antigens exposed in necrotic
regions of malignant tumors. Unlike conventional antibody-based strategies, TNT-3
targets the cell debris which is characteristic o f nearly all solid tumors [5, 17-20].
Several fusion proteins have already been developed in our laboratory, including
98
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
TNT-3/GM-CSF, TNT-3/IFN-y, TNT-3/IL-4, TNT-3/IL-2, and TNT-3/TNF-a [21-
23]. All showed good tumor targeting ability while retaining the biological functions
o f cytokines. In this study, a chimeric antibody chTNT-3 was fused with
recombinant human IL-12. chTNT-3 is a single-stranded DNA-binding MAh, with
murine variable regions and human constant regions, the IL-12 p35 subunit was
fused at the C-terminus of chTNT-3 heavy chain, while the subunit p40 was
expressed separately in pEE6 vector. The anti-tumor activity o f this unique fusion
protein has been determined both in vitro and in vivo.
Materials and Methods:
Construction and purification o f chTNT-3/hTL-12
The cDNA encoding murine TNT-3 variable heavy chain (VH) was inserted
into expression vector pEE12 upstream o f the human yl constant heavy chain (CH).
The cDNA encoding murine TNT-3 variable light chain (VL) o f TNT3 was inserted
into expression vector pEE6hCMV-B, into which the human k constant region was
previously cloned [24], The p35 subunit o f human IL-12 was amplified with primers
5’ GGT AAA GCG GCC GCA AGA AAC CATC CCC GTG GCC ACT 3’ and 5’
GGA TGC GGC CGC TTA GGA AGC ATT CAG ATA GCT 3’, and inserted
downstream of the CH via N otl sites. The p40 subunit of IL-12 was amplified with
primers 5’ ACG AAG CTT GCC GCC ACC ATG TGT CAC CAG CAG TTG GTC
and 5’ TCC GGA TCT AGA CTA ACT GCA GGG CAC AGA TGC 3’, and
inserted into expression vector pEE6hCMV-B via restriction enzymes Hind III and
99
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
Xbal sites. Complete faCMV-light chain-SV-40 transcription unit was isolated from
pEE6hCMV-B/light chain as a BgUI-BamHl cassette and inserted at the BamHl site
of the pEE 12-heavy chain plasmid. In this way, the light chain and heavy chain
genes were transcribed under different promoters in the same vector.
The pEE12 vector containing chTNT-3 light chain, human yl heavy
chain/p35 subunit was co-transfected with pEE6hCMV-B/p40 into NSO murine
myeloma cells using the Glutamine Synthetase Gene Amplification System (Lonza
Biologies, Ltd., Slough, UK) according to the manufacturer’s protocol. Briefly, 16-
18 hr after transfection, selective medium was added into each well, the transfectants
took about 3 weeks to grow, by then supernatants were tested by indirect ELISA to
check the presence of fusion protein chTNT-3/huIL-12. Briefly, 96-well flat bottom
plates were coated with crude DNA isolated from tumor cells, cell free supernatant
from transfectant were collected and added into plates, plates were incubated at 37°C
for 1 hour and washed three times with 1% Tween in PBS, monoclonal mouse anti-
huIL-12 antibody (R& D system, Minneapolis, MN) was used as secondary antibody
and plates were developed by horseradish peroxidase (HRPO) method. The clone
producing most Ab was selected from a 24-hour expression assay. The clone was
sub-cloned, the stable expression clone was expanded, and the fusion protein was
purified from culture supernatants using protein A affinity column (Biorad). The
purity and the proper assembling o f chTNT-3/huIL-12 were determined by a
reducing SDS-PAGE gel.
100
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
Biological activity of chTNT-3/huIL-12
The biological activity of chTNT-3/hu!l-12 was measured by a lymphoblast
proliferation assay [25]. Briefly, human peripheral blood lymphocytes (PBL) were
isolated from a healthy volunteer donor by Histopaque-gradient. 107 PBLs were
cultured in AIM-V medium (Gibeco Life Technologies) in the presence of the
mitogen phytohemagglutinin (PHA) at a concentration of lOpg/ml for 3 days. On
day 4, activated lymphoblasts were washed extensively and re-suspended in AIM-V
medium. 5xlQ4 PHA-activated human lymphoblasts in 50 j l l I of medium were added
into each well of a 96-well microtiter plate. Serial dilutions of fusion protein chTNT-
3/huIL-12, recombinant huIL-12 (R&D system, Minneapolis, MN), or chTNT-3
antibody were added into each well to a total volume of lOOpl. After 48-hour
incubation, cell proliferation was measured by CellTiter 96 AQueous One-Solution
Cell Proliferation Assay kit (Promega, Madison, WI), the optical density was read at
490nm.
Radio-labeling o f chTNT-3/huEL-12 and its stability
1
The I-labeled fusion protein was prepared using a modified chloramine-T
method described previously [19, 24], Briefly, lmCi (37MBq) o f radioiodine and 20
pi o f an aqueous solution of chloramine-T (2 mg/ml) were added to a 5 ml-test tube
containing lOOpg chTNT-3/huIL-12 in 100 pi PBS. The solution was quenched after
2 min with 20 pi of an aqueous solution o f sodium metabisulfite. Each reaction
mixture was purified using a Sephadex G-25 column, which typically yielded 90-
101
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
95% o f input. The radiolabeled antibody was diluted with PBS for injection, stored at
4°C, and administered within 2h after radiolabeling. Radioiodinated antibody was
analyzed using an analytical instant thin layer chromatography (ITLC) system
consisting of silica gel impregnated glass fiber (Gelman Sciences, Ann Arbor, MI).
Strips (2 x 20 cm) were activated by heating at 110°C for 15 min prior to use, spotted
with Ipl of sample, air dried and eluted with methanol/BhO (80:20) for
approximately 10 min, again air dried, cut in half, and counted to determine protein
bound and free radioiodine. ITLC analysis revealed an Rf value of 0 (MAb-bound)
and a radiochemical purity o f greater than 99%. In vitro serum stability was
evaluated as described previously [24]. Briefly, radioiodinated MAb was incubated
for 48h in mouse serum at 37°C. After trichloroacetic acid precipitation and
centrifugation, MAb-bound radioactivity was measured in a gamma counter.
Approximately 95% of the activity was trichloroacetic acid precipitable, and
virtually no release o f free radioiodine was detected over this time period.
Determination o f binding avidity
In order to determine the avidity constant o f fusion protein chTNT-3/huIL-
12, a fixed cell radioimmunoassay was performed [26]. Briefly, Raji lymphoma cells
were resuspended in freshly prepared 2% paraformaldehyde PBS, cells were then
incubated with 10 to 110 ng of 1 2 5 I-labeled chTNT-3/huIL-12 for 1 hour at room
temperature. The cells were washed three times with 1% BSA/PBS to remove
unbound antibody and counted in a gamma counter. The amount o f fusion protein
102
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
bound was determined by the remaining cell-bound radioactivity (cpm) and the
specific activity of the fusion protein. Scafchard plot analysis was used to obtain the
slope.
Cytotoxicity assay
The cytotoxicity of IL-2-activated PBL was determined by a non-radioactive
cytotoxicity assay. Briefly, freshly isolated PBLs were incubated with IL-2
(lOOU/ml) for 3 days, then washed extensively to remove any residual IL-2, cultured
with or without IL-12, or chTNT-3/huIL-12 at 37 °C for 16-18 hr. Target tumor cell
lines CAP AN, DU 145, or PMA-CA were plated into 96-well plates at a
concentration of 105 cell/ml. Activated PBL were incubated with target tumor cell
lines at effector: target ratios of 100, 50, 25, 12.5. After a 4-hour incubation, cell
mixtures were centrifuged, supernatants were transferred to a new plate, cytotoxicity
was measured by Cyto Tox 96 Non-Radioactive Cytotoxicity Assay kit (Promega,
Madision, WI). Maximum release was obtained by lysing the target tumor cells with
10% sodium dodecyl sulfate. Spontaneous release was detected in the wells that
contained only target cells. The percentage o f specific lysis or cytotoxicity was
calculated as:
Experimental release-Spontaneous release
% Specific lysis= x 100
Maximal release-Spontaneous
release
103
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
Measurement of interferon-y production measured by enzyme linked immunosorbent
assay (ELISA)
The production of interferon-y (IFN-y) by PBL was measured using a Human
IFN-y ELISA kit (Endogen, Wobum, MA). Briefly, freshly isolated PBLs were
primed with IL-2 (lOOU/ml) for 3 days, washed 3 times with PBS to remove any
residual IL-2, and then added into the 96-well plate at a concentration of 106 /ml.
ChTNT-3/huIL-12 fusion protein, rIL-12, or chTNT-3 were added into each well to a
final concentration o f lpM, lOpM, or lOOpM, respectively. Plates were then
incubated in a 37°C CO2 incubator for 18 hours. Supernatant was collected by
centrifugation, and the concentration o f IFN-y in the supernatant was determined
according to manufacture’s instruction (R&D system, Minneapolis, MN).
Pharmacokinetic studies:
Six-week old BALB/c mice were used to determine the pharmacokinetic
125
clearance o f chTNT-3/huIL-12. Mice (n=5) were administered i.p. injections of I-
labeled fusion protein chTNT-3/huIL-12 (30-40 pCi/mouse). Whole body activity
post-injection and at selected time points were measured with CRC-7
microdosimeter (Capintec, Inc., Pittsburgh, PA). Data were analyzed and half-life
was determined by PSTRIP pharmacokinetic program (MicroMath, Inc., Salt Lake
City, UT).
104
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
Biodistribution studies
Six-week-old nude mice (n=5) were used to determine the biodistribution of
chTNT-3/huIL-12. Briefly, nude mice were injected with 0.2 ml culture medium
containing 107 LS174T colon carcinoma cells s.c. in the left thigh, within about 5
days tumors reached 1.0 cm in diameter. Within each group, individual mouse was
injected i.v. with a 0.1 ml inoculum containing lOOuCi/lOug o f 1 2 5 I-labeled fusion
protein (chTNT-3/hull-12). Animals were sacrificed by sodium pentobarbital
overdose at 24 or 48 hours post-injection, various organs, blood and tumors were
removed and weighed, and radioactivity in the samples was measured in a gamma
counter. Data for each mouse were calculated as median percentage injected
dose/gram (%ID/g) and as median tumor: organ ratios (cpm per gram tumor/cpm per
gram organ). The Wilcoxon rank sum test was performed to detect statistically
significant differences in the biodistribution o f the radiolabeled products (p< 0.05).
chTNT-3/huIL-12 immunotherapy
A human PBL/SCID mouse model was designed to study the therapeutic
function of chTNT-3/huIL-12. Briefly, 0.2 ml of culture medium containing 107
DU145 human prostatic carcinoma cells was implanted subcutaneously into the left
thigh of male CB-17 SCID mice (Taconic, Germantown, NY); within 14 days tumors
reached 0.5 cm in diameter. 3 days before treatment, PBL were isolated from a
healthy donor and incubated with IL-2 (lOOU/ml) for 3 days. 0.1 ml inoculums
containing 106 IL-2 activated PBL were then injected i.v. into each mouse. Mice
105
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
were divided into two groups (n=7) and treated with 20ug of chTNT-3/huIL-12 or
chTNT-3 4 hours later and repeated every day for 5 days. Mice were transfused with
IL-2-activated PBL cells every week for 3 weeks, and the growth o f tumor was
monitored (length x width x height) by caliper measurement.
Result:
Construction and expression o f chTNT-3/huIL-12 fusion protein
The accessibility of p40 is very important for the bioactivity of IL-12. In
order to maintain the activity of IL-12 in the fusion protein, we fused p35 to the C-
terminus of chTNT-3 heavy chain yl with a flexible linker (Gly4 Ser) (Figure 4-1).
Fused chTNT-3 heavy chain/huIL-12 p35 was inserted into expression vector pEE12
under the hCM Vpromoter. Since IL-12 could automatically form functional
heterdimer in physiological conditions, we were able to screen fusion protein
containing both p35 and p40 subunits by the binding of antibody to coated crude
DNA as discussed before, the schematic drawn o f fusion protein was shown in
Figure 4-1. The best expression clone was selected and amplified. The highest
chTNT-3/huIL-12 producing subclone secreted approximately 20pg/ml/106
cells/24hours in static culture. Fusion protein chTNT-3/huIL-12 was purified by
tandem protein-A affinity and ion-exchange chromatography, run on a SDS-PAGE
under denaturing conditions. As shown in Figure 4-2, a 90KD band (chTNT-3 heavy
chain plus p35), a 40KD (p4Q subunit), and a 25KD (light chain) indicated the proper
assembling.
106
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
Figure 4-1: Schematic drawn of chTNT-3/huIL-12 fusion protein, with a linker
between chTNT-3 heavy chain yl and p35 subunit of IL-12.
PEE12
PEE 6
VH CH gamma 1 linker P35
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
Figure 4- 2: SDS-PAGE demonstrated the purity and proper assembling o f chTNT-
3/huIL-12. Lane 1, molecular weight marker; lane 2, chTNT-3; and lane
3, chTNT-3/huIL-12. In Lane 3,the largest band is approximately 90KD,
which is the sum weight of heavy chain plus p35. The 40 KD band
corresponds to the p4Q subunit o f IL-12, and the smallest band (25KD) is
the light chain o f chTNT-3.
Heavy chain/p35
Heavy chain
P40
Light chain
97.5KD
66KD
45KD
31KD
21.5KD
14.5KB
108
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
Biological activities of fusion protein
To determine whether the IL-12 moiety in chTNT-3/huIL-12 still retained its
biological activity, a PBL proliferation assay was performed. Since IL-12 can only
exert effects on activated lymphocytes, PBL were stimulated by PHA for 3 days, and
then incubated with scale concentrations of chTNT-3/huIL-12, recombinant human
IL-12, or antibody chTNT-3. Proliferation of PBL was determined with a Promega
proliferation kit (Figure 4-3). Since one molecule of chTNT-3/huIL-12 contains two
molecules of IL-12, the data shown on the X-axis were the concentration of chTNT-
3/huIL-12. Cells incubated with rIL-12 and chTNT-3/huIL-12 both showed
proliferation, while little proliferation was detected in chimeric TNT-3 medium
alone, which also indicate that IL-12 moiety in fusion protein chTNT-3/huIL-12
remain the cytokine activity.
Cytotoxicity assay:
Recombinant IL-12 has shown indirect cytotoxicity on a variety o f tumor
cells, including Colo, Daudi, and K562 and others, but direct cytotoxicity was only
shown for a minority of cancer cell lines, which express IL-12 receptor. In this study,
human prostatic carcinoma CAP AN, colon carcinoma LS174T and pancreatic
carcinoma DU 145 were chosen as target cells.
Either freshly isolated effector cells (data not shown) or IL-2-primed
effectors exhibited increased cytotoxicity after incubation with fusion protein or free
IL-12 (data not shown), while chTNT-3 and medium alone exhibited no cytotoxicity.
109
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
Figure 4-3: Bioactivity of fusion protein of chTNT-3/huIL-12 was demonstrated by
PBL proliferation assay. PHA-activated healthy donor PBLs were
incubated with increasing concentration of chTNT-3/huIL-12, chTNT-3,
rIL-12, or medium alone for 18 hr. Proliferation was detected by a
Promega Proliferation kit.
0.6
0.5
|
§ 0 . 4
1 5
>
m 0.3
C
©
Q
IS
O 0.2 ■
a
o
0.1 ■
□ rhulL-12
HchTNT-3/rlL-12
H chTNT-3
sLl
1.07 2.14 4.28 8.56
Concentration (pM)
17.12 34.24
110
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
Figure 4-4: Cytotoxicity of fusion protein chTNT-3/huIL-12. Freshly isolated PBL
were incubated with IL-2 (lOOU/ml) for 3 days, washed extensively,
then incubated with chTNT-3 /huIL-12 or chTNT-3 for 18 hr. Cells were
then washed with PBS, and incubated with target cell (A: CAP AN; B;
DU145, C; PCA-MA). Cytotoxicity was measured by the percentage
lysis of target cells.
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
% Lysis
A
♦— chTNT-3/huIL-l 2
2'
O i
chTNT-3
80
61
20
0
25:1 12.5:1 6.25:1 100:1 50:1
B
chTNT-3/huIL-12
100
80 -
cliTNT-3
40 -
20 -
100:1 6.25:1 50:1 25:1 12.5:1
C
70
60 -
50 -
40 -
30 -
20 -
10 -
■*— chTNT-3/huIL-12
o - chTNT-3
100:1 50:1 25:1 12.5: 6.25:1
Effectoritarget
12
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
Nevertheless, priming with IL-2 can dramatically increase the cytotoxic function of
IL-12, which suggests a synergistic effect. After 4 hour incubation with chTNT-
3/huIL-12, at a effector: target ratio of 100, PBL cells showed 100%, 72% and 56%
22%, and 28% lysis respectively, indicating that chTNT-3/huIL-12 can significantly
increase the cytotoxic activity o f PBL (p<0.05).
Interferon-y production by PBL
One of the major anti-tumor functions of IL-12 is that it can stimulate the
production of IFN-y in resting and activated T cells and NK cells. In this study, an
ELISA was conducted to check levels of IFN-y in the supernatant after incubating
PBL with cytokines. Fusion protein can stimulate the production o f IFN-y of resting
PBL cells after 18 hours incubation (data not shown). However, if primed with IL-2
for 3 days, the levels of secreted IFN-y were increased significantly (Figure 4-5).
Fusion protein chTNT-3/huIL-12 and rIL-12 both showed IFN-y-inducing activity
from lpM to lOOpM, but none was detected in the presence o f chTNT-3 alone.
These data indicated that IFN-y production was a function o f the cytokine portion of
the fusion protein.
In vivo pharmacokinetic studies:
The half-life of chTNT-3/huIL-12 was determined by whole body clearance o f 1 2 5 -I
labeled fusion protein. Non-tumor bearing BALB/c mice were injected with radiolabel
113
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
Figure 4-5: The production of IFN-y was detected by an ELISA. Freshly isolated
PBL cells were incubated with rIL-2 (lOOU/ml) for 3 day, cells were
then washed and incubated with different concentrations of rhuIL-12,
chTNT-3/huIL-12, or chTNT-3 for 18hr, the production of IFN-y in the
supernatant was detected by an ELISA kit (Endogen).
I 3 5 0
c 300
BrIL-12
EchTNT-3/hulL-12
H chTNT-3
2 L 200
u. 150
10
Concentratfon(pM)
100
114
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
Antibody binding/total antibody
Figure 4-6: The half-life of chTNT-3/huIL-12 was measured by a whole body
clearance assay with 1 2 5 -I labeled chTNT-3/huIL-12
1.2
1
0.8
0.6
0.4
0.2
0
40 60 20 30 50 0 10
Time Post-injection (hr)
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
antibodies, and at different time points post-injection, whole body radioactivity was
measured. As compared to chTNT-3, which has a half-life o f approximately 124 hr,
the fusion protein chTNT-3/huIL-12 cleared much faster with a half-life of 24 hr
(Figure 4-6).
To examine the tumor uptake of fusion protein under in vivo, a
biodistribution study was performed. Since chTNT-3/huIL-12 contains human
constant region, immunodeficient nude mice bearing a human colon carcinoma
LS174T was utilized. Distribution of chTNT-3/huIL-12 in tumor and normal organs
was observed at 24 h and 48h post-injection. As shown in Figure 4-7A, fusion
protein chTNT-3/huIL-12 was largely cleared from normal organs as observed
between 24 hr and 48 hr post-injection. However, tumor retained 2.6% injected
dose/gram 48 hr post-injection. While, blood, which is the normal organ where drug
accumulated more, only retained 1.7% injected dose/gram. In Figure 4-7B, a tumor:
normal organ ratio was shown. Typically, tumor: blood ratio is the lowest compared
to other organs, in this study, the tumor/blood ratio was 1.2 and 1.8 at 24hr, 48hr
post-injection which indicated fusion protein gradually accumulated at tumor site after
injection while clearing from normal organs and blood circulation
Immunotherapeutic studies:
Since mouse lymphocytes do not express human IL-12 receptor, the
immunotherapeutic function of chTNT-3/huIL-12 on well-established tumor was
performed on a PBL/SCID mouse model. The targeting o f human IL-2 and IL-12 to
116
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
Figure 4-7: Biodistribution study of tumor uptake. 1 2 5 I labeled chTNT-3/huIL-
12 was injected into LS174T bearing nude mice (n=5) Mice were
sacrificed at 24hr or 48 hr post-injection and the radioactivity was
measured. (A) Tumor uptake measure by percent injected
dose/gram o f 125i_jaf5 e] [ e£j chTNT-3/huIL-12 in the indicated
tissues. (B) Tumormormal organ ratio. Mean ± standard
deviation.
117
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
Tumor/Organ ratio
□ chTNT-3/huIL-12 24h
^ HchTNT-3/hiiIL-12 48h
4.5 -
3.5 -
o
TS
0.5 -
0 -i—
leen stomach kidney tumor heart lung liver blood
B
12 n
□ 12hchTNT-3/huIL-l 2 "
S24hchTNT-3/huIL-12
10 -
spleen stomach kidney lung liver blood heart
118
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
Volume ( cm3)
Figure 4-8: The immunotherapeutic effect of chTNT-3/huIL-12 was detected on a
DU 145 tumor-bearing PBL/SCED mouse model. Male SO D mice were
implanted with 107 DU 145, mice were treated with chTNT-3
(20pg/mouse) and chTNT-3/huIL-12 (20pg/mouse) daily x 5 on day 15
when tumor reached 0.5 cm in diameter. Mice also received IL-2
activated PBLs (106 cell/mouse) 4 hr before the first treatment and
repeated weekly.
0.3 n
chTNT-3
0.25 -
- o - chTNT-3/huIL-12
0.15 -
0.05 -
23 19 21 25 15 17
Days
Treatment
119
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
the site o f metastatic tumors has been tested on SO D mice before [27, 28]. In this
study, the anti-tumor function of fusion protein was tested on a well-established solid
tumor model. DU 145 tumor-bearing CB-17 SO D mice were transfused with IL-2
activated PBL cells 4 hour before the treatment and repeated weekly, mice were
treated with 20ug of chTNT-3/huIL2 and control antibody for 5 consecutive days,
and the growth of tumor was monitored. In chTNT-3/huIL-12 treated group, tumor
growth showed 44% reduction as compared with chTNT-3 treated group (p<0.05)
(Figure 4-8).
Discussion:
In this study, we successfully constructed an IL-12 fusion protein chTNT-
3/huIL-12, which retains both the in vitro activity of recombinant IL-12 and antibody
immunoreactivity
Since its discovery in 1994, IL-12 has been considered a powerful anti-tumor
cytokine due its multi functions on anti-angiogenesis, IFN-y induction, and cytolytic
enhancement, but severe systemic effects have limited its application in the clinic
[29], Many approaches have been utilized to solve this problem, such as
intramuscular injection, IL-12 gene therapy and, in this study, antibody-cytokine
fusion proteins.
Unlike other cytokines, IL-12 has two subunits, making it difficult to
construct fusion protein by classical engineer. As a result, there are many different
constructions o f antibody-IL-12 fusion protein [28, 30-32]. Peng and Anderson
120
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
genetically engineered the two subunits (p35 and p40) into a single chain IL-12 with
a flexible linker (scIL-12), Gillies et al. engineered the p35 subunit into the C-
terminus of antibody heavy chain end, and Kim et al. fused the p40 subunit to the C-
terminal region of antibody. Most of these fusion proteins showed good antibody
targeting function and some IL-12 activity. But the fusion of p40 subunit to the
constant region of antibody seems to have much lower (50 fold) bioactivity as
measured in a proliferation assay. As demonstrated by other study, p40 is the subunit
that binds to IL-12 receptor, so the accessibility of p40 is very important in
maintaining the bioactivity of IL-12. In this study, the p35 subunit of IL-12 was
engineered at the C-terminus of chTNT-3 heavy chain, p40 was carried by another
vector pEE6, and when simultaneously transfected into murine myeloma cells, these
two vectors can form biologically active IL-12. This also makes it possible to purify
chTNT-3/huIL-12 by protein A beads.
The biological activity of chTNT-3/huIL-12 was measured by the PHA-
activated PBL proliferation assay. After incubating with different concentrations of
fusion protein (lpM to 34 pM), PBL showed a dose-dependent proliferation curve,
with the highest proliferation at 8.5 pM. As compared with the free huIL-12, the
fusion protein retains about 80% o f recombinant IL-12 activity. This decreased
bioactivity o f chTNT-3/huIL-12 may be due to the conformational change caused by
fusion to antibody.
The in vitro cytotoxicity o f fusion protein chTNT-3/huIL-12 was tested on
three human cancer cell lines: prostatic carcinoma DU145, PC3-MA, and pancreatic
121
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
adenal carcinoma CAP AN. Although chTNT-3/huIL-12 showed increased
cytotoxicity of PBL after 18 hr incubation, this effect was dramatically increased by
first priming with IL-2 for 3 days before incubating with IL-12 fusion protein.
Among the three cancer cell lines we tested, chTNT-3/huIL-12 induced a 50%
increase in cytotoxicity as compared to naive antibody chTNT-3, with the highest
cytolytic activity in prostatic carcinoma PC3-MA. This effect was further confirmed
by in vivo therapeutic studies.
The importance of IL-12’s effect on NK cells and the production of IFN-y in
anti-cancer activity have been demonstrated by many studies [33-35]. Here we proved
that the incubation with fusion protein induced the production of IFN-y in the
chTNT-3/huIL-12-activated PBL culture supernatant.
Despite the large body o f therapeutic studies published about IL-12, most of
the in vivo data were obtained using murine IL-12, simply because mouse animal
models lack the receptor for human IL-12. To overcome this obstacle, the human
PBL/SCID mouse chimeric model has been designed to evaluate human cytokine-
based anti-cancer therapies [27, 28, 36]. In this study, we tested the therapeutic
function o f immunocytokine chTNT-3/huIL-12 on a well-established solid tumor
model. DU 145 was implanted, since it grows better than PC3-MA in male SCID
mice. To establish a human immune environment, mice were transfused with human
lymphokine-activated killer (LAK) cells. PBL from a healthy donor were activated
with IL-2 in vitro for 3 days and then transfused into SCID mice every week. Our
122
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
data indicated that the group treated with chTNT-3/huIL-12 showed a 46% reduction
in tumor growth during the three-week observation period.
The importance of the synergistic effect of IL-12 with other cytokines (GM-
CSF, IL-2, IL-15 and IL-18) has been extensively demonstrated by other studies [37-
41]. Among these, the combination of IL-2 and IL-12 has been studied both in
animal models and clinical studies [42, 43]. Recently, Wang has shown that IL-2 can
up-regulate the expression of IL-12 receptors on NK cells, which dramatically
increases the binding of IL-12 to its effector cells [44]. INF-y is an important anti
tumor factor produced by IL-12, but without the presence of IL-2, the mRNA of
IFN-y is degraded quickly. In this study, the synergistic effect of IL-2 and IL-12 has
been shown with respect to the increasing cytotoxicity and the production IFN-y. The
pre-incubation with IL-2 can decrease the necessary dosage of IL-12 while achieving
a much higher treatment effect. When PBL were directly incubated with IL-12, lysis
of target cells was 10% at an effector: target ratio of 100:1. Even when we increased
the concentration o f cytokine, the lysis o f target cell did not increase, while greater
number o f effector cells died due to the toxicity of IL-12. However, when pre
incubated with IL-2, 40-100% o f target cells died at a lOOpM IL-12 concentration,
and this synergistic effect between IL-12 and IL-2 has been further proved by our in
vivo therapeutic data.
Even though chTNT-3 should be less immunogenic to humans as compared
with murine TNT-3, it is still a chimeric antibody, and its murine variable region
may still induce some immune reaction when used in humans. Therefore, we are
123
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
constructing a folly human antibody fusion protein, NHS76/huIL-12. Since IL-2
dramatically increased the anti-tumor function of IL-12, an antibody-cytokine fusion
protein containing both IL-2 and IL-12 will also be a promising antibody therapy.
References:
1. Smyth, M., D. Godfrey, and J.A. Trapani, A fresh look at tumor
immunosurveilance and immunotherapy, nature immunology, 2001. 2(4): p.
293-299.
2. Wakabayashi, H., P.G. Cavanaugh, and G.L. Nicolson, Purification and
Identification o f Mouse Lung Microvessel Endothelial Cell-derived
Chemoattractant fo r Lung-metastasizing Murine RA W117 Large-Cell
Lymphoma Cells: Identification as Mouse Monocyte Chemotactic Protein-1.
Cancer Research. 55: p. 4458-4464.
3. Rosenberg, S.A., et al., A progress report on the treatment o f 157patients
with advanced cancer using lymphokine activated killer cells and interleukin-
2 or high dose interleukin-2 alone. New England Journal o f Medicine, 1987.
316: p. 889-905.
4. Chan, S.H., et al., Induction o f interferon gamma production by natural killer
cell stimulatory factor: characterization o f the responder cells and synergy
with other inducers. J Exp Med, 1991.173(4): p. 869-79.
5. Baluna, R. and E.S. Vitetta, Vascular leak syndrome: a side effect o f
immunotherapy. Immunopharmacology, 1997. 37: p. 117-132.
6. Lentsch, A.B., F.N. Miller, and M.J.Edwards, Mechanisms o f leukocyte-
mediated tissue injury induced by interleukin-2. Cancer Immunol.
Immunother., 1999. 47: p. 243-248.
7. Christ, O., et al., Efficacy o f Local Versus Systemic Application o f Antibody-
Cytokine Fusion Proteins in Tumor Therapy. Clinical Cancer Research, 2001.
7: p. 985-998.
8. Reisfeld, R.A. and S.D. Gillies, Antibody-interleukin 2 fusion proteins: a new
approach to cancer therapy. J Clin Lab Anal, 1996.10(3): p. 160-6.
124
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
9. Wolf, S.F., et al., Cloning o f cDNAfor natural killer cell stimulatory factor, a
heterodimeric cytokine with multiple biologic effects on T and natural killer
cells. J Immunol, 1991.146(9): p. 3074-81.
10. Leonard, J.P., K.E. Waldburger, and S J . Goldman, Regulation o f
experimental autoimmune encephalomyelitis by interleukin-12. Ann N Y
Acad Sci, 1996. 795: p. 216-26.
11. Germann, T., et al., Characterization o f the adjuvant effect ofIL-12 and
efficacy o f IL-12 inhibitors in type II collagen-induced arthritis. Ann N Y
Acad Sci, 1996. 795: p. 227-40.
12. Trinchieri, G., Immunobiology o f interleukin-12. Immunol Res, 1998.17(1-
2): p. 269-78.
13. Gately, M.K., Interleukin-12: a recently discovered cytokine with potential
fo r enhancing cell-mediated immune responses to tumors. Cancer Invest,
1993.11(4): p. 500-6.
14. Gately, M.K., et al., Interleukin-12: a cytokine with therapeutic potential in
oncology and infectious diseases. Ther Immunol, 1994. 1(3): p. 187-96.
15. Coughlin, C.M., et al., Tumor cell responses to IFNgamma affect
tumorigenicity and response to IL-12 therapy and antiangiogenesis.
Immunity, 1998. 9(1): p. 25-34.
16. Brunda, M.J. and M.K. Gately, Interleukin-12: potential role in cancer
therapy. Important Adv Oncol, 1995: p. 3-18.
17. Chen, F.-M., et al., Diffusion and binding o f monoclonal antibody TNT-1 in
multicellular tumor spheroids. J Natl Cancer Inst, 1991. 83: p. 200-204.
18. Chen, F.-M., C.R. Taylor, and A.L. Epstein, Tumor necrosis treatment o f
M E-180 human cervical carcinoma model with 1311-lableed TNT-1
monoclonal antibody. Cancer Research, 1989. 49: p. 4578-4585.
19. Epstein, A.L., et al., Radioimmunodetection o f necrotic lesions in human
tumors using 1-131 labeled TNT-1 F(ab)2 monoclonal antibody. Antibody,
hnmunoconjugates, and Radiopharmaceuticals, 1991. 4: p. 151-161.
20. Epstein, A.L., F.-M. Chen, and C.R. Taylor, A novel methodfor the detection
o f necrotic lesions in human cancers. Cancer Research, 1988. 48: p. 5842-
5848.
125
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
21. Homick, J., et al., Pretreatment with a monoclonal antibody/interleukin-2
fusion protein directed against DNA enhances the delivery o f therapeutic
molecules to solid tumors. Clin Cancer Res, 1999. 5(1): p. 51-60.
22. Homick, J.L., et al., Chimeric CLL-l antibody fusion proteins containing
granulocyte macrophage colony-stimulating factor or interleukin-1 with
specificity fo r B-Cell malignancies exhibit enhanced effector functions while
retaining tumor targeting properties. Blood, 1997. 89(12): p. 4437-4447.
23. Hu, P., et al., A chimeric Lym-1/interleukin 2 fusion protein fo r increasing
tumor vascular permeability and enhancing antibody uptake. Cancer Res,
1996. 56(21): p. 4998-5004.
24. Homick, J.L., et al., chTNT-3/B, a new chemically modified chimeric
monoclonal antibody directed against DNA fo r the tumor necrosis treatment
o f solid tumors. Cancer Biotherapy and Radiopharmaceuticals, 1998.13: p.
255-268.
25. Gately, M.K., R. Chizzonite, and D.H. Pr, Measurement o f Human and
Mouse Interleukin-12. Current Protocols in Immunology, 1997. 6(16).
26. Frankel, M.E. and W. Gerhard, The rapid determination o f binding constants
fo r antiviral antibodies by a radiommunoassay: an analysis o f the interaction
between hybridomaproteins and influenza virus. Mol Immunol, 1979.16: p.
101-106.
27. Becker, J.C., et al., Eradication o f human hepatic and pulmonary melanoma
metastases in SCID mice by antibody-interleukin 2 fusion proteins. Proc Natl
Acad Sci USA, 1996. 93(7): p. 2702-7.
28. Gillies, S.D., et al., Antibody-IL-12 fusion proteins are effective in SCID
mouse models o f prostate and colon carcinoma metastases. J Immunol, 1998.
160(12): p. 6195-203.
29. Colombo, M.P. and G. Trinchieri, Interleukin-12 in anti-tumor immunity and
immunotherapy. Cytokine Growth Factor Rev, 2002.13(2): p. 155-68.
30. Peng, U.S., M X. Penichet, and S.L. Morrison, A single-chain IL-12 IgG3
antibody fusion protein retains antibody specificity and IL-12 bioactivity and
demonstrates antitumor activity. J Immunol, 1999. 163(1): p. 250-8.
31. Anderson, R., et al., Construction and biological characterization o f an
interleukin-12 fusion protein (Flexi-12): delivery to acute myeloid leukemic
blasts using adeno-associated virus. Human Gene Therapy 10;8(9):1125-35,
1997. 8(9): p. 1125-1135.
126
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
32. Kim, T., et al., An ovalbumin-IL-12 fusion protein is more effective than
ovalbumin plus free recombinant IL-12 in inducing a T helper cell type 1-
dominated immune response and inhibiting antigen-specific IgEproduction.
Journal of Immunology, 1997.158: p. 4137-4144.
33. Fujiwara, H. and T. Hamaoka, Antitumor and antimetastatic effects o f
interleukin 12. Cancer Chemother Pharmacol, 1996. 38(Suppl): p. S22-6.
34. Fujiwara, H. and T. Hamaoka, The anti-tumor effects o f IL-12 involve
enhanced IFN-gamma production by anti-tumor T cells, their accumulation
to tumor sites and in situ IFN-gamma production. Leukemia, 1997. 11 Stippl
3: p. 570-1.
35. Lieberman, M.D., et al., Natural killer cell stimulatory factor (NKSF)
augments natural killer cell and antibody-dependent tumoricidal response
against colon carcinoma cell lines. J Surg Res, 1991. 50(4): p. 410-5.
36. Bankert, R.B., N.K. Egilmez, and S.D. Hess, Human-SCID mouse chimeric
models fo r the evaluation o f anti-cancer therapies. Trends Immunol, 2001.
22(7): p. 386-93.
37. Wang, Z., et al., Combined IL-12 and GM-CSF gene therapy fo r murine
hepatocellular carcinoma. Cancer Gene Ther, 2001. 8(10): p. 751-8.
38. Kikuchi, T., et al., Antitumor activity o f killer cells stimulated with both
interleukin-2 and interleukin-12 on mouse glioma cells. J Immunother, 1999.
22(3): p. 245-50.
39. Ye, J., et al., Cellular and molecular mechanisms o f IFN-gamma production
induced by IL- 2 and IL-12 in a human N K cell line. J Leukoc Biol, 1995.
58(2): p. 225-33.
40. Coughlin, C.M., et al., Interleukin-12 and interleukin-18 synergistically
induce murine tumor regression which involves inhibition o f angiogenesis. J
Clin Invest, 1998.101(6): p. 1441-52.
41. Melero, I , et al., IL-12 gene therapy fo r cancer: in synergy with other
immunotherapies. Trends Immunol, 2001. 22(3): p. 113-5.
42. Zaki, M., et al., Synergistic enhancement o f cell-mediated immunity by
interleukin-12 plus interleukin-2: basis fo r therapy o f cutaneous T cell
lymphoma. J Invest Dermatol., 2002.118(2): p. 366-371.
127
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
43. Li, D., et al., Combination nonviral interleukin 2 and interleukin 12 gene
therapy fo r head and neck squamous cell carcinoma. Arch Otolaryngol Head
Neck Surg, 2001.127(11): p. 1319-1324.
44. Wang, K.S., D.A. Frank, and J. Rit, Specific down-regulation o f interleukin-
12 signaling through induction o f phospho-STA T4 protein degradation.
Blood, 2000. 95(10): p. 3183-3190.
128
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
CHAPTER 5
SUMMARY AND FUTURE DIRECTIONS:
Immunotherapy has been used to treat tumor-bearing hosts for over a century.
Unfortunately, the promise of effective cytokine-based immunotherapy for cancer
remains largely unfulfilled. Despite numerous in vitro and in vivo studies
demonstrating that the stimulatory effects of various cytokines can induce active
leukocyte responses against tumor cells, favorable and consistent immune reactions
have remained elusive in the actual treatment of human disease. Since the innate
immune system involves the interplay of multiple cell populations, which oftentimes
requires specific signals and activators, successful immunotherapy approaches are
likely to demand the combination of multiple cytokines and/or chemokines to recruit
specific effector cells to the tumor, process tumor antigens for presentation, and
induce active immune responses to treat both primary and metastatic disease.
In the preceding chapters, a novel chemokine fusion protein, LEC/chTNT-3, has
been generated. It is the second chemokine fusion protein to be constructed, and is
the first one to have been applied to the immunotherapy in animal models in vivo. As
shown by in vitro studies, even when the chemokine LEC was fused at the variable
region of antibody, this fusion protein still retains antibody-targeting affinity and
comparable expression levels in cell culture. In vivo immunotherapeutic studies
showed that LEC/chTNT-3 reduced the growth o f three solid tumor models (Colon
26, MAD 109, and RENCA) in BALB/c mice.
129
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
More significantly, studies using combination of LEC/chTNT-3 and CD25+
T-cell depletion produced complete remission of established tumor in vivo. Used
alone, LEC/chTNT-3, which indicated induced dramatic infiltration of lymphocytes
into tumor, only induced 40-60% reduction of tumor growth, and mice eventually
succumbed from cancer after the completion of treatment. We hypothesize that the
infiltrating lymphocytes may not be fully activated and that the removal of
suppressive T regulatory cells is required.
T regulatory cells (Treg) were originally named T suppressive cells and were
first identified by North et.al. As early as 1984, these investigators showed that the
depletion of CD4+ T cells by the systemic injection o f anti-CD4 antibody could
result in the complete remission of well-established solid tumors (such as SA1
sarcoma and P815 mastocytoma). However, their studies were largely ignored due to
the unsuccessful cloning of the suppressive cell line. Only after the characterization
of T reg by Sakaguchi et al in 1995 did the existence of this small population o f T
cells get accepted. It is now recognized that CD25+ T cells constitute about 10% of
total CD4+ T cells and less than 1% o f total CD8+ T cells in normal unimmunized
adult mice. As a regulator of immune homeostasis, the depletion o f CD25+ T cells
leads to the development of autoimmune diseases (such as thyroiditis, gastritis,
insulitis, sialoadenitis, adrenalitis, oophoritis, glomerulonephritis, and polyarthritis),
while, the depletion o f T reg boosts anti-tumor responses as shown in recently
established tumor models and anti-inflammatory responses.
130
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
Even though the above CD4+ CD25+ T cel! depletion studies were highly
successful, they only delayed the establishment of tumors and did not produce
complete remission. More recent studies suggest that combination treatment may be
more appropriate, including the depletion o f CD25+ combined with a GM-CSF
tumor vaccine, or the combination of CD25+ depletion and IL-12-producing tumor
cells. In the present study, the T reg depletion approach was combined with
chemokine fusion protein (LEC/chTNT-3) therapy, and this combination treatment
completely regressed two well-established solid tumor models (Colon 26 and
RENCA). The rationale of this synergistic effect is that the removal o f suppressive
regulatory cells activates the immune effector cells, and the presence of
LEC/chTNT-3 at the tumor site, directs these activated cells to migrate to the tumor.
This mechanism would explain the lack o f systemic toxicity seem in mice receiving
combination treatment.
To test whether the immune response to the tumor is antigen-specific or non
specific and how long the immune memory would last, mice in complete remission
were rechallenged with the same tumor cell line (Colon 26) and a different tumor
cell line (MAD 109) 2-3 months and 6 months after the completion of treatment. Our
studies showed that the 2-3 month-regressed mice could prevent tumor growth of
the same tumor cell line while they lost this ability if challenged 6 months later.
FACS analysis o f TDLN showed that the CD4+CD25+ T cells were about 5% of the
total T cell population 2-3 months after treatment completion, but increased to 13%
at 6 months, thereby providing an explanation for these results.
131
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
Mechanistic studies showed that the synergistic effect of combination
immunotherapy was associated with the increased production of Thl cytokines, the
enhanced activation of T cells, and significant IFN-y production. Along with these
relevant studies, additional investigations are needed. First, even though dramatic
tumor regression was observed in two well-established solid tumor models, RENCA
and Colon 26, combination treatment did not show any anti-tumor effect in
MAD 109, a lung carcinoma model. On the other hand, mice that received this
therapy lost weight (1/3) compared to control groups. What are the differences
among these three tumor cell lines? Are their MHC I and MHC II expression
different? Do they express any suppressive cytokines, which may inhibit the immune
reaction? To answer these questions, these three tumor cell lines were stained with
anti-MHC I and anti-MHC II antibodies, and analyzed by FACS. Data suggested that
there was no significant difference between MHC I and MHC II expression on the
cell surface, and real-time PCR showed that there was no detectable mRNA levels of
IL-4, IL-10, and TGF-f5 expressed in the three cell lines.
Secondly, in our animal models (and many other tumor models), CD25
depletion has to be conducted at least one day before tumor implantation. If CD25+ T
cells were depleted 6-7 days after tumor implantation but before the
chemokine/antibody fusion protein treatment, it was not as effective as depletion
before tumor implantation. There m aybe two explanations: one is that some active
CD8+ T cells (less than 1%) also express CD25. After tumor challenge, the
CD8+ CD25‘ cells would be activated and express CD8+CD25+, which would be
132
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
depleted by anti-CD25 antibody, and, therefore, decrease the therapeutic effect. The
other possible reason is that since it usually takes about 5-6 days for T cells to be
functionally active, the delay in depleting the CD25+ T cells could actually delay the
activation of T cells. So by the time T cells were activated, the tumor was already too
advanced to be treated. To test the first possibility, CD8+ T cells could be transferred
back after CD25 depletion to see whether it is possible to retrieve the combination
effect. To test the second possibility, small numbers of tumor cells (103 cells/mouse)
can be implanted so that depletion could be performed when the tumors are still
small enough to be responsive. This study may also mirror more closely the clinical
situation seen on the cancer ward.
Is there a better candidate than CD25 marker? Cytotoxic T lymphocyte
antigen-4 (CTLA-4) may be a good choice, since T reg is the only cell line that
constitutively expresses CTLA-4. CTLA-4 is a T cell activation molecule essential
for the normal homeostasis o f T cell reactivity. Associated with B7, the interaction o f
CTLA-4/B7 plays an inhibitory role in T cell activation. In vivo studies have shown
that the blocking o f CTLA-4/B7 interactions by anti-CTLA-4 monoclonal antibody
treatment can enhance CD4+ T cell expansion in response to a variety of stimuli
(including peptide antigens, superantigens, and parasites), and exacerbate and
accelerate autoimmune disease in murine models. It would be interesting to study the
combinational effect of anti-CTLA-4 antibody treatment with the LEC/chTNT-3
fusion protein in poorly immunogenic tumor models, such as the MAD 109 lung
carcinoma model.
133
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
How to maintain a long-lasting memory? As shown in the re-challenging
studies, mice could reject the same tumor cell line 2-3 months after combination
treatment, but lost this immune memory 6 months after. FACS analysis showed that
after 6 months, the T reg cells increased to about 13% o f total T cells population.
Marakami et.al. showed that the numbers of T cells were inversely correlated with
the numbers of memory phenotype CD8+ T cells in animal models. As shown in our
study, when CD4+ CD25+ T cells are reduced (5%), the regressed-mice retained their
immune memory, but when CD4+CD25+ increased to 13% of total T cells, the
memory was lost. So, would it be possible to deplete the CD4+ CD25+ T cells again
after 6 month to maintain the specific and non-specific immune response?
Finally, it should be noted that the synergistic effect of LEC/chTNT-3
treatment and CD25+ cell depletion appears unique. When CD25+ depletion is used
in combination with other fusion proteins consisting of the same chTNT-3 MAb and
different cytokines, such as IL-2, GM-CSF, or IFN-y, the therapeutic effect of these
combinations are not significantly better than that of the depletion alone. These
negative data might help to establish which components of the LEC induced immune
response are critical for successful cancer immunotherapy.
The studies conducted in this dissertation provide some exciting results for
the immunotherapy of cancer and show the possible synergistic effects of
combination therapy utilizing chemokine/T reg depletion. It is anticipated that this
134
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
novel approach can be tested in the clinic in order to demonstrate its therapeutic
potential in man.
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
BIBLIOGRAPHY
Anntmziato, F., C. L, et al. (2002). "Phenotype, localization, and mechanism of
suppression of CD4(+)CD25(+) human thymocytes." Journal of Experimental
Medicine 196: 379-387.
Antony, P. A. and N. P. Restifo (2002). "Do CD4+ CD25+ immunoregulatory T
cells hinder tumor immunotherapy?" J hnmunother 25(3): 202-6.
Arenberg DA, Kunkel SL, Polverini PJ, Morris SB, Burdick MD, Glass MC, Taub
DT, Iannettoni MD, Strieter RM.(1996) Interferon— inducible protein 10 (IP-10) is an
angiostatic factor that inhibits human non-small cell lung cancer (NSCLC)
tumorigenesis and spontaneous metastases. J Exp Med. ; 184:981
Arenberg D, Zlotnick A, Strom S, Burdick M, Strieter R.(2001) The murine CC
chemokine, 6C-kine, inhibits tumor growth and angiogenesis in a human lung cancer
SCID mouse model. Cancer Immunol Immunother.49:587-592
Awwad, M. and R. J. North (1990). "Radiosensitive barrier to T-cell-mediated
adoptive immunotherapy o f established tumors." Cancer Res 50(8): 2228-33.
Baggiolini M, Dewald B, Moser B. (1997) HUMAN CHEMOKINES: An Update.
Ann Rev Immunol. 15:675-705
Baroudy BM. (2000) A Small molecule antagonist of CCR5 that effectively inhibits
HIV-1 potential as a novel antiretroviral agent. 7th Conference on Retroviruses and
Opportunistic Infections.
Batova A, Kamps A, Gillies SD, Reisfeld RA, Yu AL. (1999) The Chl4,18-GM-
CSF fusion protein is effective at mediating antibody-dependent cellular cytotoxicity
and complement-dependent cytotoxicity in Vitro. Clin Cancer Res. 5:4259-426
Banks, R.E., Patel, P.M. & Selby, P.J. (1995) Interleukin 12: a new clinical player in
cytokine therapy. Br J Cancer 71, 655-9. .
Belperio JA, Keane MP, Arenberg DA, Addison CL, Ehlert IE, Burdick MD, Strieter
RM. (2000) CXC chemokines in angiogenesis. J Leukoc Biol. 68:1-8
Bermudez, L.E., Wu, M. & Young, L.S. (1995) Interleukin-12-stimulated natural
killer cells can activate human macrophages to inhibit growth of Mycobacterium
avium. Infect Immun 63. 4099-104.
136
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
Biragyn A, Tani K, Grimm MC, Weeks S, Kwak LW. (1999) Genetic fusion of
chemokines to a self tumor antigen induced protective, T-cell dependent antitumor
immunity. Nat Biotechnol. 17:253-259
Braun SE, Chen K, Foster RG, Kim CH, Hromas R, Kaplan MH, Broxmeyer HE,
Cometta K. (2000) The CC chemokine CK beta-1 l/MIP-3 beta/ELC/Exodus 3
mediates tumor rejection of murine breast cancer cells through NK cells. J Immunol.
164:4025-4031
Brunda, M.J. Role o f IL12 as an anti-tumour agent: current status and future
directions. Res Immunol 146, 622-28. (1995).
Campbell, J. J., C. E. Brightling, et al. (2001). "Expression of Chemokine Receptors
by Lung T Cells from Normal and Asthmatic Subjects." J Immunol 166(4): 2842-
2848.
Campbell, J. J. and E. C. Butcher (2000). "Chemokines in tissue-specific and
microenvironment-specific lymphocyte homing." Curr Opin Immunol 12(3): 336-41.
Carlos TM. Leukocyte recruitment at sites o f tumor: dissonant orchestration. J
Leukoc Biol. 2001:70:171-184
Chen, F.-M., Hansen, E.B., Taylor, C.R. & Epstein, A.L. (1991) Diffusion and
binding o f monoclonal antibody TNT-1 in multicellular tumor spheroids. JN atl
Cancer Inst 83. 200-204
Chan, S.H. et al. (1991) Induction of interferon gamma production by natural killer
cell stimulatory factor: characterization o f the responder cells and synergy with other
inducers. J Exp Med 173, 869-79.
Challita-Eid P, Abboud C, Morrison S, Penichet M, Rosell K, Poles T, Hilchey S,
Planelles V, Rosenblatt J. (1998) A RANTES-antibody fusion protein retains
antigen specificity and chemokine function. J Immunol. 161:3729-3736
Christ O, Matzku S, Burger C, Zoller M. (2001) Interleukin 2-antibody and tumor
necrosis factor-antibody fusion proteins induce different antitumor immune
responses in vivo. Clin Cancer Res.7:1385-13
Clark, W. H., Jr., D. E. Elder, et al. (1989). "Model predicting survival in stage I
melanoma based on tumor progression." J Natl Cancer Inst 81(24): 1893-904.
DiGiacomo, A. & North, R.J. (1986) T cell suppressors of antitumor immunity. The
production of Ly-l-,2+ suppressors of delayed sensitivity precedes the production of
suppressors of protective immunity. J Exp Med 164, 1179-92
137
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
Digiacomo, A. & North, R.J. (1987) Subtherapeutic numbers of tumour-sensitized,
L3T4+, Ly 1+2- T cells are needed for endotoxin to cause regression of an
established immunogenic tumour. Immunology 60, 367-73
Dilloo D, Bacon K, Holden W, Zheng W, Burdach S, Zlotnik A, Brenner M. (1996)
Combined chemokine and cytokine gene transfer enhances antitumor immunity. Nat
Med. 2:1090-1095
Dunn, P.L. & North, R.J. (1991) Early gamma interferon production by natural
killer cells is important in defense against murine listeriosis. Infect Immun 59, 2892-
900
Dunn, P.L. & North, R.J. (1991) Selective radiation resistance o f immunologically
induced T cells as the basis for irradiation-induced T-cell-mediated regression of
immunogenic tumor. J Leukoc Biol 49, 388-96
Dye, E.S. & North, R.J. (1981)T cell-mediated immunosuppression as an obstacle to
adoptive immunotherapy of the P815 mastocytoma and its metastases. J Exp Mod
154, 1033-42
Dye, E.S. & North, R.J. (1984) Specificity o f the T cells that mediate and suppress
adoptive immunotherapy of established tumors. J Leukoc Biol 36, 27-37
Emtage P, Wan Y, Hitt M, Graham F, Muller W, Zlotnik A, Gauldie J. (1999)
Adenoviral vectors expressing lymphotactin and interleukin 2 or lymphotactin and
interleukin 12 synergize to facilitate tumor regression in murine breast cancer
models. Human Gene Therapy. 10:697-709
Epstein, A.L. (1991) Radioimmunodetection o f necrotic lesions in human tumors
using 1-131 labeled TNT-1 F(ab')2 monoclonal antibody. Antibody,
Immunoconiugates, and Radiopharmaceuticals 4, 151-161
Frankel, M.E. & Gerhard, W. (1979) The rapid determination of binding constants
for antiviral antibodies by a radiommunoassay: an analysis o f the interaction between
hybridoma proteins and influenza virus. Mol Immunol 16, 101-106
Gerard, C. & Rollins, B.J. (2001) Chemokines and disease. Nat Immunol 2, 108-115
Gillies, S., Reilly, E., LO, K.-M. & Reisfeld, R.A. (1992) Antibody-targeted
interleukin-2 stimulates T-Cell killing o f autologous tumor cells. Proc Natl Acad Sci
U S A 89, 1428-1432
Gillies, S.D. (1998) Antibody-IL-12 fusion proteins are effective in SCID mouse
models of prostate and colon carcinoma metastases. J Immunol 160, 6195-203.
138
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
Gillies, S. D., Y. Lan, et al. (2002). "Bi-functional cytokine fusion proteins for gene
therapy and antibody-targeted treatment of cancer." Cancer Immunol Immunother
51(8): 449-60
Giovarelli M, Cappello P, Fomi G, Salcedo TM, Paul A., LeFleur DW, Nardelli B,
Carlo ED, Lollini P-L, Ruben S, Ullrich S, Garotta G, Musiani P. (2000) Tumor
rejection and immune memory elicited by locally released LEC chemokine are
associated with and impressive recruiteent of APCs, lymphocytes, and granulocytes.
J Immunol. 164:3200-3206
Golgher, D., E. Jones, et al. (2002). "Depletion of CD25+ regulatory cells uncovers
immune responses to shared murine tumor rejection antigens." Eur J Immunol
32(11): 3267-75.
Han, H.-S., H.-S. Jun, et al. (1996). "A New Type of CD4+ Suppressor T cell
Completely Prevents Spontaneous Autoimmune Diabetes and Recurrent Diabetes in
Syngeneic Islet-Transplanted NOD Mice." Journal of Autoimmunitv 9(3): 331-339.
Hedrick, J.A., Helms, A., Vicari, A. & Zlotnik, A. (1998) Characterization of a novel
chemokine, HCC-4, whose expression is increased by interleukin-10. Blood 91,
4242-4247
Hill, J. O., M. Awwad, et al. (1989). "Elimination of CD4+ suppressor T cells from
susceptible BALB/c mice releases CD 8+ T lymphocytes to mediate protective
immunity against Leishmania." J Exp Med 169(5): 1819-27.
Homick, J.L. (1997) Chimeric CLL-1 antibody fusion proteins containing
granulocyte macrophage colony-stimulating factor or interleukin-1 with specificity
for B-Cell malignancies exhibit enhanced effector functions while retaining tumor
targeting properties. Blood 89, 4437-4447
Homick JL, Khawli LA, Hu P, Lynch M, Anderson PM, Epstein AL. (1997)
Chimeric CLL-1 antibody fusion proteins containing granulocyte macrophage
colony-stimulating factor or interleukin-1 with specificity for B-Cell malignancies
exhibit enhanced effector functions while retaining tumor targeting properties.
Blood. 89:4437-4447
Homick JL, Hu P, Khawli LA, Biola BH, Yun A, Sharifi J, Taylor CR, Epstein
AL.(1998) chTNT-3/B, a new chemically modified chimeric monoclonal antibody
directed against DNA for the tumor necrosis treatment of solid tumors. Cancer
Biotherapy and Radiopharmaceuticals. 13:255-268
139
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
Homick, J. (1999) Pretreatment with a monoclonal antibody/interleukin-2 fusion
protein directed against DNA enhances the delivery of therapeutic molecules to solid
tumors. Clin Cancer Res 5, 51-60
Howard, O.M.Z., Dong, H.F., Shirakawa, A.-K. & Oppenheim, J.J. (2000) LEC
induces chemotaxis and adhesion by interacting with CCR1 and CCR8. Blood 96,
840-845
Howard, O. M. Z., H. F. Dong, et al. (2000). "LEC induces chemotaxis and adhesion
by interacting with CCR1 and CCR8." Blood 96(3): 840-845.
Hu P, Homick JL, Glasky MS, Yun A, Milkie MN, Khawli LA, Anderson PM,
Epstein AL. A chimeric (1996) Lym-1 /interleukin 2 fusion protein for increasing
tumor vascular permeability and enhancing antibody uptake. Cancer Res.56:4998-
5004.
Itoh, M., T. Takahashi, et al. (1999). "Thymus and Autoimmunity: Production of
CD25+CD4+ Naturally Anergic and Suppressive T Cells as a Key Function of the
Thymus in Maintaining Immunologic Self-Tolerance." J Immunol 162(9): 5317-
5326.
Javia, L. R. and S. A. Rosenberg (2003). "CD4+CD25+ Suppressor Lymphocytes in
the Circulation o f Patients Immunized Against Melanoma Antigens." J hnmunother
26(1): 85-93.
Johnston, B. and E. C. Butcher (2002). "Chemokines in rapid leukocyte adhesion
triggering and migration." Semin Immunol 14(2): 83-92.
Kuhn, R., J. Lohler, et al. (1993). "Interleukin-10-deficient mice develop chronic
enterocolitis." Cell 75(2): 263-274.
Kunkel, E. J. and E. C. Butcher (2002). "Chemokines and the tissue-specific
migration of lymphocytes." Immunity 16(1): 1-4.
Lamont, A.G. & Adorini, L. IL-12: a key cytokine in immune regulation. Immunol
Today 17. 214-7. (1996).
Li, J., P. Hu, et al. (In press). "LEC/chTNT-3 Fusion Protein for the Immunotherapy
of Experimental Solid Tumors."
Laning, J., Kwawasaki, H., Tanaka, E., Luo, Y. & Dorf, M.E. (1994) Inhibition o f in
vivo tumor growth by the beta chemokine, TCA3. The Journal o f Immunology 153,
4625 .
140
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
Liyanage, U. K., T. T. Moore, et al. (2002). "Prevalence of regulatory T cells is
increased in peripheral blood and tumor microenvironment of patients with pancreas
or breast adenocarcinoma." J Immunol 169(5): 2756-61.
Lode, H. N., T. Moehler, et al. (1999). "Synergy between an antiangiogenic integrin
alphav antagonist and an antibody-cytokine fusion protein eradicates spontaneous
tumor metastases." Proc Natl Acad Sci U S A 96(4): 1591-6.
Luster, A.D. & Leder, P.(1993) IP-10, a-C-X-C- Chemokine, Elicits a Potent
Thymus-dependent Antitumor Response In Vivo. Journal of Experimental Medicine
178, 1057-1065 .
Mackay, C.R. (2001) Chemokines: immunology's high impact factors. Nat Immunol
2, 95-101 .
Manome, Y. (1995) Monocyte chemoattractant protein-1 (MCP-1) gene
transduction: an effective tumor vaccine strategy for non-intracranial tumors. Cancer
Immunology and Immunotherapy 41. 227-235.
McHugh, R. S. and E. M. Shevach (2002). "The role o f suppressor T cells in
regulation o f immune responses." J Allergy Clin Immunol 110(5): 693-702.
McHugh, R. S., E. M. Shevach, et al. (2001). "Control of organ-specific
autoimmunity by immunoregulatory CD4(+)CD25(+) T cells." Microbes Infect
3(11): 919-27.
Mills, C.D. & North, R.J. (1985) Ly-1+2- suppressor T cells inhibit the expression of
passively transferred antitumor immunity by suppressing the generation o f cytolytic
T cells. Transplantation 39, 202-8.
Mills, C. D. and R. J. North (1985). "Ly-1+2- suppressor T cells inhibit the
expression o f passively transferred antitumor immunity by suppressing the
generation of cytolytic T cells." Transplantation 39(2): 202-8.
Miyagishi R, Kikuchi S, Fukazawa T, Tashiro K. (1995) Macrophage inflammatory
protein-1 in the cerebrospinal fluid of patients with multiple sclerosis and other
inflammatory neurological diseases. J Neuro Sci. 129:223-227.
Morales, J., B. Homey, et al. (1999). "CTACK, a skin-associated chemokine that
preferentially attracts skin-homing memory T cells." PNAS 96(25): 14470-14475.
141
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
Morrissey, P., K. Charrier, (1993). "CD4+ T cells that express high levels of
CD45RB induce wasting disease when transferred into congenic severe combined
immunodeficient mice. Disease development is prevented by cotransfer of purified
CD4+ T cells." J. Exp. Med. 178(1): 237-244.
Mule, JJ. (1996) RANTES Secretion by Gene-Modified Tumor Cells Results in
Loss o f Tumorigenicity In Vivo: Role of Immune Cell Subpopulations. Human Gene
Therapy 7, 1545-1553 .
Murakami, M., A. Sakamoto, et al. (2002). "CD25+CD4+ T cells contribute to the
control of memory CD8+ T cells." PNAS 99(13): 8832-8837.
Murphy, W.J., Bennett, M., Anver, M.R., Baseler, M. & Longo, D.L. (1992) Human-
mouse lymphoid chimeras: host-vs.-graft and graft-vs.-host reactions. Eur J Immunol
22, 1421-7 .
Nagai, H., I. Hara, et al. (2000). "Elimination of CD4(+) T cells enhances anti-tumor
effect of locally secreted interleukin-12 on B16 mouse melanoma and induces
vitiligo-like coat color alteration." J Invest Dermatol 115(6): 1059-64.
Narvaiza I, Mazzolini G, Barajas M, Duarte M, Zaratiegui M, Qian C, Melero I,
Prieto J. (2000) Intratumoral coinjection o f two adenoviruses, one encoding the
chemokine IFN-gamma-inducible protein-10 and another encoding IL-12, results in
Marked antiatumoral synergy. J Immunol. 164: 3221-3122
Naruse, K. (1996) A YAC contig of the human CC chemokine genes clustered on
chromosome 17ql 1.2. Genomics 34, 236-240 .
North, R.J. (1982) Cyclophosphamide-facilitated adoptive immunotherapy of an
established tumor depends on elimination of tumor-induced suppressor T cells. J Exp
Med 1 5 5 ,1063-74.
North, R.J. & Bursuker, I. (1984) T cell-mediated suppression of the concomitant
antitumor immune response as an example of transplantation tolerance. Transplant
Proc 16, 463-9.
North, R. J. (1984). "The therapeutic significance of concomitant antitumor
immunity. I. LY-1-2+ T cells from mice with a progressive tumor can cause
regression of an established tumor in gamma-irradiated recipients." Cancer Immunol
Immunother 18(2): 69-74.
North, R.J. (1984) Gamma-irradiation facilitates the expression of adoptive
immunity against established tumors by eliminating suppressor T cells. Cancer
Immunol Immunother 16. 175-81.
142
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
North, R.J. (1984) The therapeutic significance of concomitant antitumor immunity.
II. Passive transfer of concomitant immunity with Ly-1+2- T cells primes established
tumors in T cell-deficient recipients for endotoxin-induced regression. Cancer
Immunol Immunother 18. 75-9 .
North, R. J. and E. S. Dye (1985). "Ly 1+2- suppressor T cells down-regulate the
generation of Ly 1-2+ effector T cells during progressive growth of the P815
mastocytoma." Immunology 54(1): 47-56.
North, R J. (1986) Radiation-induced, immunologically mediated regression of an
established tumor as an example of successful therapeutic immunomanipulation.
Preferential elimination of suppressor T cells allows sustained production of effector
T cells. J Exp Med 164, 1652-66 .
Onizuka, S., I. Tawara, et al. (1999). "Tumor rejection by in vivo administration of
anti-CD25 (interleukin-2 receptor alpha) monoclonal antibody." Cancer Res 59(13):
3128-33.
Penichet, M.L., Harvill, E.T. & Morrison, S.L. (1997) Antibody-IL-2 fusion
proteins: a novel strategy for immune protection. Hum Antibodies 8, 106-18 .
Penichet, M. L. and S. L. Morrison (2001). "Antibody-cytokine fusion proteins for
the therapy of cancer." J Immunol Methods 248(1-2): 91-101.
Peng, L.S., Penichet, M.L. & Morrison, S.L. (1999) A single-chain IL-12 IgG3
antibody fusion protein retains antibody specificity and IL-12 bioactivity and
demonstrates antitumor activity. J Immunol 163, 250-8. .
Piccirillo, C. A. and E. M. Shevach (2001). "Cutting edge: control o f CD8+ T cell
activation by CD4+CD25+ immunoregulatory cells." J Immunol 167(3): 1137-40.
Reiss, Y., A. E. Proudfoot, et al. (2001). "CC chemokine receptor (CCR)4 and the
CCR10 ligand cutaneous T cell-attracting chemokine (CTACK) in lymphocyte
trafficking to inflamed skin." J Exp Med 194(10): 1541-7.
Renno, T., A. Attinger, et al. (1999). "Cutting Edge: Apoptosis of Superantigen-
Activated T Cells Occurs Preferentially After a Discrete Number o f Cell Divisions In
Vivo." J Immunol 162(11): 6312-6315.
Rollins BJ. (1999) Chemokines and Cancer.
Rosenberg, S.A. (1987) . A progress report on the treatment of 157 patients with
advanced cancer using lymphokine activated killer cells and interleukin-2 or high
dose interleukin-2 alone. New England Journal of Medicine 316, 889-905.
143
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
Ruehlmann, J.M. (2001) MIG (CXCL9) chemokine gene therapy combines with
antibody-cytokine fusion protein to suppress growth and dissemination o f murine
colon carcinoma. Cancer Res 61, 8498-503 .
Segal, B. M., D. D. Glass, et al. (2002). "Cutting Edge: IL-10-producing CD4+ T
cells mediate tumor rejection." J Immunol 168(1): 1-4.
Sirianni, M.C., Ansotegui, I.J., Aiuti, F. & Wigzell, H. (1994) Natural killer cell
stimulatory factor (NKSF)/IL-12 and cytolytic activities of PBL/NK cells from
human immunodeficiency virus type-1 infected patients. Scand J Immunol 40, 83-6.
Shevach, E. M. (2002). "CD4+ CD25+ suppressor T cells: more questions than
answers." Nat Rev Immunol 2(6): 389-400.
Shevach, E. M., R. S. McHugh, et al. (2001). "Control of T-cell activation by CD4+
CD25+ suppressor T cells." Immunol Rev 182: 58-67.
Shevach, E. M., R. S. McHugh, et al. (2001). "Control of autoimmunity by
regulatory T cells." Adv Exp Med Biol 490: 21-32.
Sharifi J, Khawli LA, Li J, Hu P, Epstein AL.(in press) Generation of human
interferon gamma and tumor necrosis factor alpha chimeric TNT-3 fusion proteins.
Hvbridoma and Hvbridomics.
Shimizu, J., S. Yamazaki, et al. (1999). "Induction of tumor immunity by removing
CD25+CD4+ T cells: a common basis between tumor immunity and autoimmunity."
J Immunol 163(10): 5211-8.
Smyth, M., Godfrey, D. & Trapani, J.A. (2001) A fresh look at tumor
immunosurveilance and immunotherapy, nature immunology 2, 293-299.
Sutmuller, R. P., L. M. van Duivenvoorde, et al. (2001). "Synergism of cytotoxic T
lymphocyte-associated antigen 4 blockade and depletion of CD25(+) regulatory T
cells in antitumor therapy reveals alternative pathways for suppression of
autoreactive cytotoxic T lymphocyte responses." J Exp Med 194(6): 823-32.
Takahashi, T., Y. Kuniyasu, et al. (1998). "Immunologic self-tolerance maintained
by CD25+CD4+ naturally anergic and suppressive T cells: induction of autoimmune
disease by breaking their anergic/suppressive state." Int. Immunol. 10(12): 1969-
1980.
Takahashi, T., T. Tagami, et al. (2000). "Immunologic self-tolerance maintained by
CD25(+)CD4(+) regulatory T cells constitutively expressing cytotoxic T
lymphocyte-associated antigen 4." J Exp Med 192(2): 303-10.
144
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
Tanaka, H., J. Tanaka, et al. (2002). "Depletion of CD4+ CD25+ regulatory cells
augments the generation of specific immune T cells in tumor-draining lymph nodes."
J Immunother 25(3): 207-17.
Thornton, A. M. and E. M. Shevach (1998). "CD4+CD25+ Immunoregulatory T
Cells Suppress Polyclonal T Cell Activation In Vitro by Inhibiting Interleukin
2 Production." J. Exp. Med. 188(2): 287-296.
Vaddi, K., Keller, M. & Newton, R.C. (1997) The Chemokine facts book.
Van de Keere, F. and S. Tonegawa (1998). "CD4+ T Cells Prevent Spontaneous
Experimental Autoimmune Encephalomyelitis in Anti-Myelin Basic Protein T Cell
Receptor Transgenic Mice." J. Exp. Med. 188(10): 1875-1882.
Wakabayashi, H., Cavanaugh, P.G. & Nicolson, G.L. (1980) Purification and
Identification o f Mouse Lung Microvessel Endothelial Cell-derived Chemoattractant
for Lung-metastasizing Murine RAW117 Large-Cell Lymphoma Cells:
Identification as Mouse Monocyte Chemotactic Protein-1. Cancer Research 55,
4458-4464.
Wamock, R. A., J. J. Campbell, et al. (2000). "The role o f chemokines in the
microenvironmental control o fT versus B cell arrest in Peyer's patch high
endothelial venules." J Exp Med 191(1): 77-88.
Weston, S. A. and C. R. Parish (1990). "New fluorescent dyes for lymphocyte
migration studies. Analysis by flow cytometry and fluorescence microscopy." J
Immunol Methods 133(1): 87-97.
Yao L, Pike SE, Pittaluga SP, Chemey B, Gupta G, Jaffe ES, Tosato G. (2002) Anti
tumor activities o f the angiogenesis inhibitors interferon-inducible protein-10 and the
calreticulin fragment vasostatin. Cancer Immunol Immunother.5 1:358-366
Zuckier LS, Georgescu L, Chang CJ, Scharff MD, Morrison SL. (1994) The use of
severe combined immunodeficiency mice to study the metabolism of human
immunoglobulin G. Cancer.73:794-799
145
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.

Linked assets

University of Southern California Dissertations and Theses

Conceptually similar

PDF

Engineering antibodies and antibody /cytokine fusion proteins for the treatment of human malignancies

PDF

B7.1 fusion proteins for cancer immunotherapy

PDF

Breast cancer susceptibility gene 1: A role in transcriptional regulation

PDF

Imaging and prodrug -activating derivatives of chTNT-3 (tumor necrosis therapy) monoclonal antibody

PDF

Characterization of the EWS -FLI1 fusion protein in the tumorigenesis of Ewing's family of tumors

PDF

HER-2/neu-mediated cell migration and invasion

PDF

Downstream targets of the Ewing's sarcoma EWS /FLI -1 fusion gene

PDF

Genetic risk factors in breast cancer susceptibility: The multiethnic cohort

PDF

Optimization of genetically engineered monoclonal antibody and antibody /cytokine fusion proteins for the detection and immunotherapy of solid malignancies

PDF

Development of replication -competent retroviral vectors for efficient, targeted gene therapy of cancer

PDF

An intervention and program evaluation to determine the effectiveness of public health reforms on primary prevention practices by chiropractic interns

PDF

Cytokine regulation of retinal pigment epithelial cell function and behavior

PDF

Immunogenicity of acute lymphoblastic leukemia: In vivo and in vitro studies of Bcr -Abl specific immune responses

PDF

Conjugation of CpG oligodeoxynucleotides to tumor‐targeting antibodies for immunotherapy of solid tumors

PDF

Analysis of the pathological characteristics of breast carcinoma in Hispanic BRCA carriers

PDF

The HER-2/neu oncogene in human breast cancer: From molecular mechanisms to targeted therapies

PDF

An evaluation of a brief HIV /AIDS prevention intervention using normative feedback to promote risk reduction among sexually active college students

PDF

Progesterone signaling in ovarian epithelial tumors

PDF

Functional analysis of MSX2 and its role in skull patterning

PDF

A case/parental/sibling control study of Ewing's sarcoma/peripheral primitive neuroectodermal tumor (pPNET)

Asset Metadata

Creator Li, Jiali (author)

Core Title Antibody-cytokine/chemokine fusion proteins in the immunotherapy of solid tumors

School Graduate School

Degree Doctor of Philosophy

Degree Program Pathobiology

Publisher University of Southern California (original), University of Southern California. Libraries (digital)

Tag health sciences, immunology,health sciences, oncology,health sciences, pathology,OAI-PMH Harvest

Language English

Contributor Digitized by ProQuest (provenance)

Advisor Epstein, Alan L. (committee chair), Markland, Francis (committee member), McMillan, Dr. (committee member), Press, Michael (committee member)

Permanent Link (DOI) https://doi.org/10.25549/usctheses-c16-641720

Unique identifier UC11335089

Identifier 3116741.pdf (filename),usctheses-c16-641720 (legacy record id)

Legacy Identifier 3116741.pdf

Dmrecord 641720

Document Type Dissertation

Rights Li, Jiali

Type texts

Source University of Southern California (contributing entity), University of Southern California Dissertations and Theses (collection)

Access Conditions The author retains rights to his/her dissertation, thesis or other graduate work according to U.S. copyright law. Electronic access is being provided by the USC Libraries in agreement with the au...

Repository Name University of Southern California Digital Library

Repository Location USC Digital Library, University of Southern California, University Park Campus, Los Angeles, California 90089, USA