University of Southern California Dissertations and Theses

Development of replication -competent retroviral vectors for efficient, targeted gene therapy of cancer

(USC Thesis Other)

Development of replication -competent retroviral vectors for efficient, targeted gene therapy of cancer

PDF

Download

Open document

Flip pages

Download a page range

Download transcript

Copy asset link

Request this asset

Transcript (if available)

Content INFORMATION TO USERS This manuscript has been reproduced from the microfilm master. U M I films the text directly from the original or copy submitted. Thus, some thesis and dissertation copies are in typewriter face, while others may be from any type of computer printer. The quality of this reproduction is dependent upon the quality of the copy subm itted. Broken or indistinct print, colored or poor quality illustrations and photographs, print bleedthrough, substandard margins, and improper alignment can adversely affect reproduction. In the unlikely event that the author did not send UMI a complete manuscript and there are missing pages, these w ill be noted. Also, if unauthorized copyright material had to be removed, a note will indicate the deletion. Oversize materials (e.g., maps, drawings, charts) are reproduced by sectioning the original, beginning at the upper left-hand comer and continuing from left to right in equal sections with small overlaps. ProQuest Information and Learning 300 North Zeeb Road, Ann Arbor, M l 48106-1346 USA 800-521-0600 Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. DEVELOPMENT OF REPLICATION-COMPETENT RETROVIRAL VECTORS FOR EFFICIENT, TARGETED GENE THERAPY OF CANCER Copyright 2002 by Christopher Reid Logg A Dissertation Presented to the FACULTY OF THE GRADUATE SCHOOL UNIVERSITY OF SOUTHERN CALIFORNIA In Partial Fulfillment of the Requirements for the Degree DOCTOR OF PHILOSOPHY (PATHOLOGY) May 2002 Christopher Reid Logg Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. U M I Number: 3073808 ___ __® UMI U M I Microform 3073808 Copyright 2003 by ProQuest Information and Learning Company. A ll rights reserved. This microform edition is protected against unauthorized copying under Title 17, United States Code. ProQuest Information and Learning Company 300 North Zeeb Road P.O. Box 1346 Ann Arbor, M l 48106-1346 Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. UNIVERSITY OF SOUTHERN CALIFORNIA The Graduate School University Park LOS ANGELES, CALIFORNIA 90089-1695 This dissertation , w ritten b y ____________Christopher Reid Logg____________ U nder th e d irectio n o f h is D isserta tio n C om m ittee, an d approved b y a il its m em bers, has been p resen ted to an d accepted b y The Graduate School, in p a rtia l fu lfillm en t o f requirem ents fo r th e degree o f DOCTOR OF PHILOSOPHY D ent o f Graduate Studies D ate DISSERTATION COMMITTEE A. Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. Dedication This dissertation is dedicated to ray parents, John and Nancy Logg, and to my wife, Aid. Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. Acknowledgments Special thanks to Nori for all o f his support and guidance and for allowing me to carry out my dissertation project in his laboratory, and to the 1996-2001 members o f the Kasahara lab for providing a great environment to work in. Many good memories were made during this time. I owe thanks to the other members of my dissertation committee: Drs. W. French Anderson, Pradip Roy-Burman, and Michael Stallcup. I would also like to express my appreciation to Dr. Baruch Frenkel for his frequent encouragement and for involving me in my first collaborative research effort. I ll Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. Table of Contents Dedication u Acknowledgments in List of Figures and Tables VI Abstract IX Introduction Chapter I: In Vitro Replication and Genetic Stability of Replication Competent Retroviral Vectors 1.1 Introduction 1.2 Materials and Methods 8 10 1.2.1 Construction of replicating vectors 1.2.2 Cell lines and virus production 1.2.3 Viral Assays 1.2.4 Single cycle infections with replicating vectors 1.2.5 Multiple cycle infections with replicating vectors 1.2.6 Flow cytometry 1.2.7 Southern blot analysis 1.2.8 PCR analysis of viral deletion mutants 1.3 Results 14 1.3.1 Construction of MLV-based replicating vectors 1.3.2 Replication kinetics of vectors through a single infection cycle 1.3.3 Genetic stability of ZAPd-puro, ZAPd-GFP, and ZAPd-hygro upon replication through serial infection cycles 1.3.4 Transmission of GFP by replicating vectors through multiple serial infection cycles 1.3.5 Effect of removal of repeat sequence and replacement of env on genetic stability of replicating vectors 1.3.6 Analysis of deletion variants arising during serial passage 1.4 Discussion 31 Chapter 2: Use of the replicating retrovirus vector for transduction of solid tumors 2.1 Introduction 40 42 2.2 Materials and Methods 2.2.1 Replicating vector 2.2.2 Cell culture 2.2.3 Mouse tumor model IV Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. 2.2.4 Flow cytometry 2.2.5 Immunohistochemistry 2.2.6 Southern blot analysis 2.2.7 Detection of extratumoral spread of vector 2.3 Results 45 2.3.1 Generation of tumors and injection with vector 2.3.2 Flow cytometric analysis of tumor cells 2.3.3 Immunohistochemistry of tumors 2.3.4 Southern blot analysis of tumor DNA 2.3.5 PCR analysis to detect extratumoral spread of vector 2.4 Discussion 53 Chapter 3: Transcriptional targeting of replicating retroviral vectors to 3.2.1 Cell lines and virus production 3.2.2 Construction of plasmids 3.2.3 Luciferase assays 3.2.4 Flow cytometry 3.2.5 Single cycle infection with replicating vectors 3.2.6 Titration of vectors 3.2.7 Multiple cycle infections with replicating vectors 3.2.8 Southern blot analysis 3.2.9 PCR analysis and sequencing 3.3 Results 66 3.3.1 Construction of hybrid probasin-ML V LTRs 3.3.2 Transcriptional activity of hybrid promoters in prostate and non-prostate cells 3.3.3 Construction of replicating vectors containing hybrid LTRs 3.3.4 Replication of targeted vectors in prostate and non-prostate cells 3.3.5 Southern blot analysis of DNA from LNCaP cells infected with ARR2Pb-targeted vectors 3.3.6 Transmission of GFP transgene through multiple cycle infections of LNCaP cells with ARR2Pb-targeted vectors 3.3.7 Stability of hybrid LTRs through multiple infection cycles 3.3.8 Prostate-targeted cell killing with vector encoding suicide gene 3.4 Discussion 92 Future Directions 102 References 107 prostate cells 3.1 Introduction 3.2 Materials and Methods 58 61 v Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. List of Figures and Tables Figure 1 In Vitro Replication and Genetic Stability of Replication- Competent Retroviral Vectors 4 Figure 2 Structure of replication-competent retroviral vectors 15 Figure 3 In vitro replication kinetics of vectors 17 Figure 4 Serial infection procedure for determining effects of prolonged passage on vectors 19 Figure 5 Stability of ZAPd-puro, ZAPd-GFP and ZAPd-hygro genomes over multiple serial infections 20 Figure 6 Transmission of GFP by ZAPd-GFP over multiple serial infection cycles 23 Figure 7 Transmission of GFP by ZAPm-GFP 25 Figure 8 Transmission of GFP by AZE-GFP 26 Figure 9 PCR analysis of transgene insert region of serially passaged viruses 28 Figure 10 Sequence analysis of deletion junctions of vector deletion variants identified by PCR 30 Figure 11 Statistical significance of topoisomerase recognition sites at points of deletion in variants Z l, Z4, M2, and A1 37 Figure 12 Possible secondary structures in vector RNA facilitating observed deletions in IRES-GFP insert 37 Figure 13 Procedure for analysis of vector spread in vivo 46 Figure 14 Spread of ZAPd-GFP through solid tumors in mice as detected by flow cytometry 47 Figure 15 Immunohistochemical staining of tumors injected with ZAPd-GFP 49 Figure 16 Southern blot analysis of genomic DNA from tumors injected with ZAPd-GFP 51 Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. Figure 17 Assay for extratumoral spread of ZAPd-GFP by PCR amplification of GFP transgene from genomic DNA 52 Figure 18 Construction of prostate-targeted hybrid LTRs 67 Figure 19 Cell type-specificity and androgen-inducibility of hybrid wt probasin-LTRs 69 Figure 20 Cell type-specificity and androgen-inducibility of hybrid ARR2Pb-LTRs 71 Figure 21 Probasin promoter-targeted vectors 73 Figure 22 Replication of wild-type probasin promoter-targeted vectors in prostate carcinoma cells 74 Figure 23 Replication of wild-type probasin promoter-targeted vectors in non-prostate cells 76 Figure 24 Replication of ARR2Pb-targeted vectors in prostate carcinoma cells 77 Figure 25 Replication of ARR2Pb-targeted vectors in non-prostate cells 78 Table 1 Titration of ARR2Pb-targeted vectors by LNCaP transduction assay 80 Figure 26 Southern blot analysis of genomic DNA from LNCaP cells infected with ARR2Pb-targeted vectors 81 Figure 27 Analysis of genetic stability of ARR2Pb-targeted vectors over extended replication 83 Figure 28 GFP expression in LNCaP cultures serially infected with vectors targeted by ARR2Pb 84 Figure 29 PCR and sequence analysis of 5’ LTR of ACE-GFP-Ar through 19 serial infection cycles 86 Figure 30 PCR and sequence analysis of 5' LTRs of ACE-GFP-At and ACE-GFP-Ac through 19 serial infection cycles 88 Figure 3 1 Deletion of one copy of the ARR from ACE-GFP-Ar, -At, and -Ac during PCR amplification 90 Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. Abstract Retroviruses were the first viruses to be adapted for use in gene transfer, and defective retroviral vectors remain the most commonly used vector in clinical trials of gene therapy. Nevertheless, the transduction efficiency of these vectors remains insufficient for therapeutically effective in vivo administration. As a means of enhancing gene transfer efficiency, retrovirus vectors could be rendered replication- competent. This would allow the in situ amplification of vector and would therefore presumably permit significantly improved levels of transduction. To investigate this possibility, we constructed a series of replication-competent retroviral vectors derived from murine leukemia virus containing a transgene between the env gene and the 3' LTR. In vitro studies demonstrated that these vectors may be used to stably transmit a functional transgene cassette o f 1.3 kb through multiple serial passages with very high efficiency. Furthermore, injection of the same vector into solid tumors in mice resulted in levels o f tumor cell transduction not possible using defective vectors. The use of such a vector as a therapeutic agent, however, would not be feasible unless there were means to confine replication to targeted tissues. In order to achieve tissue- targeted vector replication, we replaced sequences from the native transcriptional control region of the vector with sequences from the prostate-specific probasin promoter. Our results demonstrate that efficient vector replication can be combined with strict cell type-specificity to achieve high level targeted transduction in vitro. ix Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. Introduction Recombinant viruses are currently the most widely used vehicles for therapeutic gene delivery. Viruses have evolved mechanisms for efficiently entering cells and utilizing host cell metabolism to express their genes, and the exploitation o f these mechanisms by researchers has proven invaluable in the development o f the field o f gene therapy. Vectors developed from several virus species have to date been utilized in clinical trials o f gene therapy, including adenovirus, adeno-associated virus, herpes simplex virus, vaccinia virus, and retrovirus (75). A still larger number o f viruses are presently at preclinical stages o f evaluation as gene delivery tools, including lentiviruses (151), hepatitis viruses (16), SV40 (137), alphaviruses (155), Epstein-Barr virus (125), and negative-strand RNA viruses such as influenza (98). The vast majority o f these vectors are not capable o f replication beyond a single round o f transduction. The most common nonviral approaches for therapeutic gene transfer involve the local injection o f naked plasmid DNA or DNA complexed with cationic polymers or lipids (82, 94). Another technique utilizes a so-called “gene gun” device to introduce DNA bound to gold particles into tissue (162). The primary advantages o f these nonviral methods relative to viral vectors are their safety and the ease with which the reagents involved are produced. Given the ability o f the wild type forms o f some viruses that have been adapted for use as vectors to cause disease, the low pathogenic potential o f nonviral approaches has made them an 1 Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. attractive alternative to viral vectors. However, two m ajor shortcomings o f the current nonviral methods, which have greatly limited the usefulness o f these techniques for gene therapy, are a very low efficiency o f transfection and short duration o f expression in most tissues. Each class o f viral vector possesses particular advantages and disadvantages relative to the others, and no one vector is superior in every relevant aspect. The traits o f an ideal viral vector include high efficiency o f transduction, low immunogenicity, low pathogenic potential, sustained transgene expression, ease o f production, and high transgene size capacity. For different applications, the relative importance o f each o f these traits varies. For example, some transgenes are quite small and will readily fit into any vector, and for gene therapy o f cancer, sustained expression is often not crucial as the goal is usually to simply kill transduced cells. O f the virus vectors, those derived from retroviruses have been the most widely used in clinical studies. The first clinical trials o f gene therapy (3), and in fact recently the first apparently successful trial (15), utilized retrovirus vectors. The characteristics o f these vectors that have attracted such wide interest include their ability to permanently integrate into the host cell genome, the limited immune response they generate, and their moderate transgene size capacity and transduction efficiency. The early adoption o f retroviruses as gene transfer tools was also facilitated by the wide body o f knowledge on retrovirus biology that had been generated earlier by years o f research, which largely concerned the role o f retroviruses in cancer (158). 2 Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. Retroviral vectors are normally generated by introducing sequences necessary for expression o f the essential retroviral genes gag, pol, and env, unlinked from the packaging signal ¥ , into cultured cells, along with a construct comprising a retrovirus genome with intact and one or more therapeutic transgenes in place o f gag, pol, and env (Fig. I). While the proteins required for generating a functional retrovirus are expressed in the cells from the gag, pol, and env sequences, these genes are not themselves packaged into the resulting virus particles due to the absence o f a linked signal. Instead, the sequence containing *P and the therapeutic gene is packaged into particles and subsequently transferred into and expressed in susceptible cells following exposure to the vector. Such vectors cannot further propagate and are therefore “defective.” The original motivation for rendering retroviral vectors defective was concern over the pathogenic potential o f retroviruses (28). Although at the time retroviruses were not known to cause disease specifically in humans or other primates, these viruses were known to often cause diseases in their natural animal hosts. The most common pathologic consequence o f retroviral infection is cancer, mediated by retrovirus-induced oncogene activation (40). Part o f the life cycle o f retroviruses is integration into the host cell genome, which occurs at essentially random locations. Activation o f an oncogene can result by way o f a variety o f mechanisms when an integration occurs nearby. Retrovirus replication is thus tantamount to random mutagenesis o f the host genome, and the fewer integration events that occur, the lower the likelihood that tumorigenesis will result. The use o f defective vectors limits replication to a single cycle, and therefore greatly reduces the likelihood o f 3 Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. A. LTR- 'P •LTR- U3 |R|U5|-----1 gag \ pol env ]- U3 U5 B. promoter|H gag \ pol \ env |- poly A U3 transgene H U3 U5 Fig. I Generation of defective vectors from simple retroviruses. (A) General structure of simple retrovirus genome such as that of MLV. LTR, long terminal repeat; Y, packaging symbol. (B) Recombinant sequences used to produce defective retrovirus vectors. A construct containing the gag, pol, and env genes (upper) encodes the proteins necessary for producing infectious particles but is not packaged due to the deletion of 4*. The LTRs are also often replaced, as shown, with a heterologous promoter and polyadenylation (poly A) signal. In some cases, the gag and pol genes are placed on a separate plasmid from that of env (not shown). The vector construct (lower) contains a transgene in place of the viral genes and possesses an intact 4 * and LTRs. Following transcription into RNA, the vector construct is packaged into virus particles and integrates into the genome of susceptible cells exposed to the particles. Within transduced cells, the vector cannot further propagate because of the absence of the essential gag, pol, and env genes. 4 Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. disease. The absence o f any pathological effects arising from the treatment o f human gene therapy patients with defective retroviral vectors has since indeed demonstrated the safety o f these vectors. However, the gene transfer efficiency o f defective retroviral vectors, although superior to that o f the nonviral methods, has remained insufficient for most therapeutic applications. The most efficient gene transfer with retroviral vectors has been achieved in ex vivo protocols, in which the cells to be transduced are first removed from the patient, transduced by vector in culture, and then reintroduced into the patient. When directly injected into tissue in vivo, however, the transduction efficiency o f retrovirus vectors is markedly lower. In the largest clinical trial o f cancer gene therapy to date, for example, the injection o f retroviral vector packaging cells directly into tumors resulted in transduction o f no more than 0.002% o f the cells in each tumor three weeks after injection (108). The low in vivo transduction efficiency o f retroviral vectors is likely a result o f a combination o f factors, probably most importantly the relative infrequency o f cell division in most tissues and the inability o f the vector to diffuse readily through solid tissue. Inefficiency o f in vivo transduction remains the single most important shortcoming o f retrovirus vectors today. M uch interest has arisen recently in replication-competent viruses as therapeutic agents, particularly for use in treatment o f cancer. The large majority o f these so-called “oncolytic” viruses are not vectors per se, as they do not contain exogenous genes, but instead kill target cells as a normal part o f their life cycle - cell lysis. The replication-competence o f these viruses allows the in situ production 5 Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. and prolonged presence o f virus within tumors, leading to widespread transduction and lysis o f tumor cells. Additionally, recent studies have shown that for several types o f virus, including retroviruses, spread between adjoining cells is much more efficient than infection by cell-free virus (14, 68). As cell-to-cell spread does not normally occur when defective vectors are used, these findings provide an additional rationale for the use o f replicating viruses for in vivo gene transfer. Among the oncolytic viruses are wild type forms or mutants o f adenovirus, herpes simplex virus, vaccinia virus, autonomous parvovirus, reovirus, measles virus, Newcastle disease virus, poliovirus, and vesicular stomatitis virus. Most o f these viruses have a certain degree o f specificity for cancer cells. The adenovirus mutant d ll520 (also known as ONYX-015 or C l-1042), for example, replicates with selectivity for cells that do not express the tumor suppressor protein p53, while wild-type reovirus selectively replicates in cells with an activated Ras signaling pathway and the herpes simplex virus mutant G207 replicates preferentially in mitotically active cells. Some o f these viruses have been further targeted by the introduction o f cellular tissue-specific transcriptional control elements to control the expression o f essential viral genes. The use o f replicating vectors derived from retroviruses would have significant advantages for use in cancer gene therapy over both defective retroviral vectors and replicating oncolytic viruses. W hile a large number o f studies have shown that only a small percentage o f cells are transduced after a single injection o f defective retroviral vector into a tumor, the use o f a nondefective form would allow a low initial transduction to subsequently amplify by the in situ replication o f vector 6 Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. and efficient cell-to-cell spread. Additionally, in comparison to the oncolytic viruses, retroviruses are not inherently cytopathic. Retrovirus vectors can, however, be rendered conditionally cytotoxic by inclusion o f a suicide gene whose product generates cytotoxic products only upon administration o f a nontoxic prodrug. Thus, the cytotoxicity o f a retrovirus vector can be regulated exogenously, while the cell- killing activity o f oncolytic viruses cannot be readily controlled once infection is initiated. This dissertation examines the possibility o f developing replication-competent retroviral (RCR) vectors derived from murine leukemia virus (MLV) for use in cancer gene therapy. Chapter I evaluates the in vitro genetic stability o f a series o f RCR vectors containing transgenes within the MLV 3 ’ UTR. Chapter 2 describes the use o f one o f these vectors for efficient transduction o f tum or cells in vivo. Chapter 3 describes the utilization o f sequences from a tissue-specific cellular prom oter to transcriptionally target replication o f the vectors to prostate cells as a means o f efficiently and selectively killing prostate carcinoma cells. Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. Chapter 1: In Vitro Replication and Genetic Stability of Replication-Competent Retroviral Vectors 1.1 Introduction Replicating retrovirus populations are characterized by a high degree o f genetic change (22). This genetic diversity is the product o f high frequencies o f base misincorporations (10, 48, 114), rearrangements (23, 150), and both homologous (20, 59, 138) and nonhomologous (99, 154, 164) recombination events in the viral genome. Such genetic variability imparts upon retroviruses the ability to adapt quickly to changes in selective pressures. A variety o f replication-competent retroviral vectors have been created by the insertion o f heterologous sequences into full-length viral genomes. Such vectors have been constructed from several retrovirus species, including Rous sarcoma virus (RSV) (9, 92, 105), murine leukemia virus (MLV) (35, 84, 111, 139), spleen necrosis virus (44), human immunodeficiency virus (65, 80, 97, 146), and human foamy virus (123). In the studies in which the structure o f these lengthened viruses was examined subsequent to replication, the inserted sequences were usually found to have been partially or completely lost from the population within three or fewer passages through cultures o f susceptible cells (44, 67, 84, 111, 123, 139). The tendency o f retroviruses to rapidly delete insertions has been observed with various different insert sequences, indicating that the sequence requirements for efficient deletion are fairly permissive. 8 Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. Previous studies that have analyzed in detail deletion mutants o f nondefective retroviruses utilized Rous sarcoma virus, which loses most its src coding sequence upon replication in culture (8, 96, 99, 154). However, differences in the stability o f the RSV src gene in transformed versus non-transformed cells have been reported, suggesting that the presence o f this oncogene may result in selective pressures on cultured viruses not solely based on the virus’s replicative fitness, but also on the cytoproliferative function o f the protein encoded by this gene (8, 93). In this system, examination o f virus stability in the absence o f such selective pressures is therefore difficult. As we are interested in developing replicating retroviral vectors for potential use as therapeutic gene transfer tools, we wanted to determine how vectors such as these might be improved by employing a design different from those previously used. We therefore constructed vectors in which the inserted sequences are positioned between the env gene and the 3 ’ untranslated region (UTR). An RSV- based vector with a similar structure has been described previously, but this avian virus exhibits a post-entry block to replication in mammalian cells and would therefore serve simply as a defective vector if used in humans. We chose instead to construct vectors based on MLV due to this virus’s ability to replicate in cells from a variety o f species, including human, and because its genome is very well characterized. We also desire to know how specific sequences within the vector may contribute to instability during replication. Elucidation o f the influence such sequences on vector stability may aid in the generation o f safer and more effective retroviral vectors. 9 Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. 1.2 Materials and Methods 1.2.1 Construction of replicating vectors An infectious ecotropic Moloney murine leukemia virus (MLV) proviral clone was excised with Nhel, which cuts once within each LTR, from plasmid pZAP (127) (kindly provided by John A Young, Univ. o f Wisconsin) in order to eliminate flanking rat genomic sequences, and ligated to the plasmid backbone o f M LV vector g lZ IN to produce plasmid pZAP2. The region o f the env gene from the unique Nsil site to the termination codon was amplified by polymerase chain reaction (PCR) from pZAP2, and fused to the encephalomyocarditis virus internal ribosome entry site (IRES) amplified from plasmid pEMCF, by overlap-extension PCR (57) using a downstream primer containing a 5 ’ overhang with the restriction sites BstBl and Notl. Plasmids glZ IN and pEMCF were kindly provided by W. French Anderson, University o f Southern California. The region o f M LV from the env termination codon to the 3’ end o f the 3 ’ LTR was also amplified by PCR, introducing Notl and Aftlll sites at the 5 ’ and 3’ ends o f the amplification product, respectively. A 3-way ligation was used to insert this PCR product and the overlap- extension PCR product into pZAP2 at its Nsil site and an AjTill site in the plasmid backbone. The resulting plasmid was termed pZAPd. The puromycin acetyltransferase (puroR ) gene from plasmid pPUR (Clontech) was am plified by PCR and inserted into the Zfe/BI and Notl sites o f pZAPd, in frame with the authentic start codon o f the IRES, producing pZAPd-puro. All PCR amplifications for vector construction were carried out with Pfu DNA polymerase (Stratagene), and all regions o f pZAPd-puro generated by PCR were verified by sequencing. 10 Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. The hygromycin phosphotransferase (hygroR ) gene from plasmid pTK-hygro (Clontech) and the enhanced green fluorescent protein (GFP) cDNA (26) o f plasmid pEG FP-Nl (Clontech) were similarly introduced into pZAPd to produce pZAPd-hygro and pZAPd-GFP, respectively. A pZAPd-GFP-based construct in which an 11-bp region o f homology flanking the IRES-GFP insert was eliminated and replaced by a Mlul site was also generated by overlap extension PCR, and designated pZAPm-GFP. An additional construct in which the M oloney ecotropic envelope was replaced with the amphotropic envelope from 4070A was also generated by overlap extension PCR, and designated pAZE-GFP. The prefix p is omitted in the designation o f virus derived from these constructs. 1.2.2 Cell lines and virus production 293T (37) and NIH3T3 (64) cells were cultivated in Dulbecco’s M odified Eagle M edium with 10% fetal bovine serum (FBS). Virus stock was produced by transfection o f 293T cells using calcium phosphate precipitation with pZAP2, pZAPd-GFP, pZAPd-puro, pZAPd-hygro, pZAPm-GFP, or pAZE-GFP. Virus- containing supernatant was collected 48 hours following transfection and passed through 0.45 pm syringe filters before use. 1.2.3 Viral Assays For reverse transcriptase assays, serial dilutions of vector and wild type MLV virus stock were used to infect NIH3T3 cells at 20% confluency. Every 2 to 3 days for the following 2 weeks, the supernatant was collected and the cells were split 1:4. To quantitate reverse transcriptase activity, each supernatant sample was incubated at 37°C for one hour in a cocktail containing [32P]dTTP, poly(rA) template, and oligo-dT primers (143). The 11 Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. reaction products were then spotted onto nitrocellulose and quantitated with a Molecular Dynamics Storm Phosphorlmager. Virus titers were determined by the UV-XC syncytial assay (120). Briefly, dilutions of the vector-containing supernatant were used to infect NIH3T3 cells, which upon reaching confluence, were exposed to a low dose of UV light in a Stratalinker 1800 (Stratagene), and were overlaid with XC cells. Four days later, the cells were fixed and stained, the number of plaques from each dilution was counted, and the number of plaque-forming units (PFU) per ml of each supernatant was determined. 1.2.4 Single cycle infections with replicating vectors NIH3T3 cells at 20% confluence in 6-cm dishes were infected with stock virus at a multiplicity of infection (MOI) of 0.0005. At 3, 5, and 8 days post-infection, the cells were examined by microscopy, split 1:5, and an aliquot of the cells was analyzed for GFP expression by flow cytometry as described below. An Olympus IMT-2 inverted microscope equipped with a 100W mercury arc lamp and a fluorescein filter cube was used for photomicrography of infected cells. 1.2.5 Multiple cycle infections with replicating vectors NIH3T3 cells at 20% confluence in 6-cm dishes were infected with infected with stock virus at a M OI o f 0.001. A t 2 days post-infection, the cells were split 1:5 and aliquots were analyzed for GFP expression by flow cytometry as described below in the case o f ZAPd-GFP. At 4 days post-infection, the cells were again analyzed for GFP expression by flow cytometry and/or analyzed by Southern blot or PCR after harvesting Hirt DNA as described below, and the culture supernatant 12 Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. was diluted 100-fold and used to infect a fresh population o f NIH3T3 cells. This cycle was repeated several additional times. 1.2.6 Flow cytometry NIH3T3 cells were washed with phosphate buffered saline (PBS), trypsinized and collected by low-speed centrifugation. Cells were resuspended in PBS and analyzed with a Becton Dickinson FACScan using the FL1 emission channel to monitor green fluorescence. 1.2.7 Southern blot analysis DNA prepared by a modified Hirt procedure from infected NIH3T3 cells was digested with ATiel, separated by electrophoresis and blotted onto Hybond-N+ membranes (Amersham Pharmacia Biotech, Piscataway, NJ). Probes were generated by [32P]dCTP-labeled random-priming (Amersham Pharmacia) o f restriction fragments from each specific transgene or a common 2 kb Nhel-Xhol fragment containing MLV LTR-gag sequences. The blots were hybridized and washed under standard conditions, and analyzed by Phosphorlm ager (M olecular Dynamics). 1.2.8 PCR analysis of viral deletion mutants PCR amplification o f Hirt DNA from infected NIH3T3 cells was performed using 5 ’ primers hybridizing to the ecotropic (in the case o f ZAPd-GFP and ZAPm- GFP) or the amphotropic (in the case o f AZE-GFP) env gene and a common 3’ prim er hybridizing to the 3’ LTR. Upon electrophoresis, PCR products that were smaller than the expected size for full-length virus genomes w ere gel-purified and 13 Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. subjected to fluorescent dideoxynucleotide sequencing using an ABI automated system. 1.3 Results 1.3.1 Construction of ML V-based replicating vectors The 550-bp encephalomyocarditis internal ribosome entry site (IRES) (66) followed by a polylinker sequence was first inserted into the ecotropic M oloney m urine leukemia virus (MLV) genome pZAP2 by overlap-extension PCR, positioning the insertion between the env termination codon and a site within the 3' untranslated region (UTR) that binds reverse transcriptase during viral DNA synthesis (160). The resulting construct was designated pZAPd. We then inserted cDNA sequences o f the puromycin acetyltransferase (puroR ) gene or the hygromycin phosphotransferase (hygroR ) gene into the polylinker. These plasmids were designated pZAPd-puro and pZAPd-hygro, and contained IRES-puroR or IRES-hygroR sequence insertions o f 1.15 kb or 1.55 kb, respectively, precisely positioned at the env-UTR boundary (Fig. 2A and B). As mentioned above, we have previously found this insert position to be permissive for functional expression and viral transmission o f a 1.2-kb IRES-p27(kip-l) transgene cassette, at least in single passage culture (133). Stocks of each virus were prepared by transient transfection of 293T cells with the respective plasmids. The initial titers of the ZAPd-puro and ZAPd-hygro virus stocks produced by this method were determined by the XC plaque assay to be 3-6 x 103 PFU/ml. Infection o f NIH3T3 cells with ZAPd-puro and ZAPd-hygro stock vims 14 Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. LTR H gag \ pol env Vector Transgene Insert size ZAPd-puro puromycin acetyl- transferase 1.14 kb ZAPd-hygro hygromycin phospho transferase 1.55 kb ZAPd-GFP T 1.27 kb ZAPm-GFP green fluorescent protein | 1.27 kb AZE-GFP 1 1.27 kb IRES pac IRES hph IRES GFP IRES GFP IRES GFP B. Vector Sequence at 5' border of insert Sequence at 3' border of insert _ A_ . env____________ IRES Z A P d -p u ro ...CGAGCCATAGATAACGTTACTGGC., ZAPd-hygro ZAPd-GFP ZAPm-GFP AZE-GFP MLV 3' UTR ACAAGTAGCGGCCGCGCCATAGATAAAA.. pac hph MLV 3' UTR ..CCGCGCCATAGATAAAATAAAAGATTTTA.. GFP ___________ MLV 3’ UTR ..ACAAGTAGCGGCCGCGCCATAGATAAAA.. env IRES ...CGAACCGTGAACGCGTTACTGGC... 4070A env IRES ...CGAGCCATGACGTACGTTACTGGC.. Fig. 2 Structure of replication-competent retroviral vectors. (A) Schematic representation of vectors, showing insertion site of IRES-transgene cassettes within the MLV genome and the transgene and size of each cassette. (B) Sequences at S' and 3' borders of transgene cassettes for each vector. Nucleotides in bold represent env and transgene stop codons. An 11-bp repeat sequence that flanks the inserts of ZAPd-puro, ZAPd-hygro, and ZAPd-GFP is underlined. Only the 3' copy of the 11-bp sequence is present in ZAPm-GFP and AZE-GFP. 15 Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. conferred resistance to puromycin and hygromycin, respectively, demonstrating expression of the antibiotic resistance transgenes. 1.3.2 Replication kinetics of vectors through a single infection cycle To examine the ability of ZAPd-puro, ZAPd-GFP, and ZAPd-hygro to replicate in cultured cells, we followed RT activity in transfected cultures over a 15-day period. The parental wild type virus, ZAP2, was used in parallel as a control. Both ZAPd-puro and ZAPd-GFP showed approximately the same lag period (3 days) as wild type M LV prior to the appearance o f detectable levels o f RT activity, and thereafter exhibited a time course slightly attenuated compared to that o f wild-type MLV (Fig. 3A), suggesting that the insert-containing viruses replicated with moderately slower kinetics compared to wild type virus. In contrast, ZAPd-hygro was greatly attenuated compared to wild type MLV or the other insert-containing viruses, exhibiting a lag period o f 9 days prior to the appearance o f detectable RT. Thereafter, the rise in RT activity in the ZAPd-hygro-infected cultures was robust, suggesting that it may have derived from the exponential growth o f an initially small revertant population. When propagated on NIH3T3 cells, the titer o f ZAPd- GFP reached 1.2— 3.8 x 10s PFU/ml, while that o f wild type MLV on NIH3T3 cells was 2.1-5.0 x 106 PFU/ml, indicating that the presence o f the 1.3-kb IRES-GFP insert reduced production o f infectious particles by approximately one order o f magnitude. W e also assessed the replication kinetics o f ZAPd-GFP by following spread o f GFP through cells inoculated at an M OI o f 0.0005. GFP fluorescence was detected in only a small percentage (-3% ) o f the cells 3 days post-inoculation, while at 5 16 Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. 100 >, ou J 60 o 10 40 0 3 5 7 9 13 15 1 1 ■ ZAPd-puro -ZAPd-GFP • ZAPd-hygro •ZAP2 ■mock Day B. Day 3 Day 5 Day 8 Fig. 3 In vitro replication kinetics of vectors. (A) NIH3T3 cells were transfected with pZAP2, pZAPd-GFP, pZAPd-puro, or pZAPd-hygro and passaged for 15 days. Culture medium was harvested from confluent cells every two days starting on day 3 and was assayed for reverse transcriptase activity as described in Materials and Methods. Reverse transcriptase activities are expressed in arbitrary units. Values are the mean obtained from two independent experiments. (B) Spread of ZAPd-GFP through a single culture as detected by flow cytometry. NIH3T3 cells were infected at an MOI of 0.0005 and examined at 3, 5, and 8 days post-inoculation. Histograms show fluorescence intensity (horizontal axis) versus cell number (vertical axis). 17 Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. days, approximately one-quarter o f the population exhibited fluorescence. By day 8, approximately 95% o f the cells fluoresced (Fig. 3B), demonstrating that the virus transmitted the GFP marker gene with high efficiency. 1.3.3 Genetic stability of ZAPd-puro, ZAPd-GFP, and ZAPd-hygro upon replication through serial infection cycles We serially re-inoculated fresh plates o f NIH3T3 cells with cell-free ZAPd- puro, ZAPd-GFP, or ZAPd-hygro virus supernatants, using 100-fold dilutions o f conditioned medium from the previous cycle for each subsequent infection, to examine stability over multiple replication cycles (Fig. 4). No antibiotic selection pressure was applied during these infections. Hirt DNA from each serially infected cell population, digested with NheI which cleaves once within each LTR and thus yields a full- length linearized genome, was analyzed by Southern blot using probes specific for the corresponding transgene sequence, (Fig. 5A, C, and E, respectively) or a common probe for the 5’ LTR-gag region of MLV (Fig. 5B, D and F). The ZAPd-puro virus, which contains a 1.15-kb insert, showed no sign of deletion for the first 6 infection cycles, with only the full-length genome containing the insert sequence being detectable during this interval (Fig. 5A and B). At the 7th infection cycle, a variant population was detected at very low levels. This variant population hybridized to the LTR-gag probe (Fig. 5B) but not the pac-specific probe (Fig. 5A), and the genome size of this deletion mutant population appeared to be roughly similar to that of wild-type MLV. Over the subsequent 5 infections, the levels of this deleted population increased, while that o f full-length ZAPd-puro decreased, indicating that loss of the insert eventually imparted a replicative advantage. 18 Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. Reproduced with permission o f th e copyright owner. Further reproduction prohibited without permission. Transfection w ith vector-encoding plasmid Infection 1 (MOI of 0.001) Infection 2 (100x dilution) Infection 3 (100x dilution) Day 21 Day 4 Day 21 Day 4 Infection 4 (100x dilution) Repeat Harvest of proviral DNA and/or FACS analysis Harvest of proviral DNA and/or FACS analysis Harvest of proviral DNA and/or FACS analysis Fig. 4. Serial infection procedure for determining effects of prolonged passage on vectors. Stock virus was generated by transient transfection of 293T cells. After titration of vims, NIH3T3 cells were infected at a MOI of 0.001. At 2 days postinfection, the cells were analyzed by FACS, and at 4 days postinfection the cells were again analyzed by FACS and proviral DNA was isolated for Southern blotting and PCR. Infection num ber P 1 2 3 4 5 6 7 8 9 10 11 12 13 N 9. 4- . - - - I * * ■ « 6.6 - B. 9.4- Infection num ber P 1 2 3 4 5 6 7 8 9 10 11 12 13 N 6.6 - c. 9.4- Infection num ber P 1 2 3 4 5 6 7 8 9 10 11 12 13 N Infection num ber 9.4- P 1 2 3 4 5 6 7 8 9 10 11 12 13 N - o 6.6 - 6.6 - E . Infection num ber P 1 2 3 4 5 6 7 8 N 9 .4 - 1 F. Infection num ber P 1 2 3 4 5 6 7 8 N 9 .4 - 1 6.6 - 6.6 - Fig. 5 Stability of ZAPd-puro, ZAPd-GFP and ZAPd-hygro genomes over multiple serial infections. Replication-competent vectors were subjected to repeated serial passage through NIH3T3 cultures as described in Materials and Methods. Unintegrated proviral DNA was isolated from each virus passage, digested with NheI and subjected to Southern blotting. (A and B) DNA from ZAPd-puro serial infections, using pac probe (A) or MLV LTR-gag probe (B). (C and D) DNA from ZAPd-GFP serial infections, using GFP-speciflc probe (C) or LTR-gag probe (D). (E and F) DNA from ZAPd-hygro serial infections, using hph probe (E) or LTR-gag probe (F). P denotes lanes containing 30 pg of Mzel-digested plasmid DNA encoding the corresponding vector. N denotes lanes containing DNA isolated from mock- infected cells. Intact full-length provirus signals are indicated by solid arrows and deletion mutants are indicated by open arrows. Expected full-length fragment sizes: ZAPd-puro, 9437 bp; ZAPd-GFP, 9559 bp; ZAPd-hygro, 9851 bp. 20 Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. Similarly, the full-length ZAPd-GFP signal was detected, using either a GFP- specifxc probe (Fig. 5C) or the common LTR-gag probe (Fig. 5D), throughout more than 8 serial infection cycles. This high level o f stability was reproducibly and consistently observed through repeated experiments, each conducted with more than 10 serial passages. However, as observed with the ZAPd-puro virus, a progressive diminution in the full-length ZAPd-GFP signal was observed after the 8,h infection cycle, corresponding with the progressive emergence o f a variant virus population sim ilar in size to wild type MLV (Fig.5D), and which was not detected by the GFP probe (Fig.5C). In contrast, proviral DNA from serial infections with ZAPd-hygro exhibited deletions from the first passage (Fig. SE and F). Among the unintegrated proviral species produced upon the first infection, only a very small fraction proved to be full-length ZAPd- hygro (Fig. 5E), and by the second infection a deletion variant similar in size to wild type MLV had completely outgrown the vector (Fig. 5F). 1.3.4 Transmission of GFP by replicating vectors through multiple serial infection cycles Based on the results o f single passage FACS analysis data and the extent o f the deletions observed in ZAPd-GFP over serial passage, we hypothesized that the GFP reporter would greatly facilitate monitoring o f virus replication and stability over multiple replication cycles. Therefore, we again performed serial infections using ZAPd-GFP, examining the cells by FACS at 2 days and 4 days o f each infection cycle. Only a low percentage o f cells in each cycle expressed GFP by Day 2 after inoculation (data not shown). However, the percentage o f GFP-positive 21 Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. cells increased by Day 4 o f each cycle, indicating that GFP transduction was the result o f progressive viral transmission rather than due to high initial levels o f infection. The percentage o f cells transduced by the virus at each Day 4 tim e point, as determ ined by flow cytometry, is shown in Figure 6. Each serial infection up to the 7th-8th cycle consistently generated transduction levels approaching 100% by Day 4 post-inoculation, after which the efficiency o f GFP marker gene transmission was observed to decrease progressively, and almost no spread o f GFP fluorescence was observed by the 15th cycle (Fig. 6). This progressive decrease in GFP transmission observed by FACS correlated closely with the emergence o f the deletion mutant observed by Southern blot above, suggesting that the wild type deletion mutant successfully competes with the insert-containing genome. This competition presumably occurred via superinfection resistance, as in the later infection cycles the maximum percentage o f GFP-positive cells was not further increased beyond Day 4 levels by additional cultivation o f the cells (data not shown). The precise correlation between the loss o f GFP expression and the loss o f full-length forms also suggests that the level o f GFP fluorescence can serve as a reliable surrogate marker for genomic stability and persistence o f the ZAPd-GFP virus over multiple infection cycles. 1.3.5 Effect of removal of repeat sequence and replacement of env on genetic stability of replicating vectors The IRES-transgene insert o f ZAPd-GFP is flanked by an 11-bp repeat that m ight predispose the virus to a recombination event that would reconstitute the wild type M LV sequence (Fig. 2B). We therefore constructed a variant o f ZAPd- 22 Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 Infection num ber Fig. 6 Transmission of GFP by ZAPd-GFP over multiple serial infection cycles. ZAPd- GFP was serially passaged through NIH3T3 cultures as described in Materials and Methods. Four days after each culture was exposed to virus, the cells were examined for GFP expression by flow cytometry. Shown are the percentages of cells expressing GFP at each day 4 time point, with values presented as the average from three independent experiments. Error bars represent standard deviations. 23 Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. GFP, designated ZAPm-GFP, in which mutations were introduced into the upstream 11-bp repeat to eliminate homology with the downstream repeat sequence; these changes consisted o f seven point mutations, including three silent mutations in the last three codons o f env (Fig. 2B). An additional variant o f ZAPd-GFP, in which the M oloney ecotropic envelope was replaced with the 4070A amphotropic envelope, was generated and designated AZE-GFP (Fig. 2). This vector, like ZAPm-GFP, lacks the upstream copy o f the 11-bp repeat found in ZAPd-GFP. ZAPm-GFP replicated with kinetics indistinguishable from ZAPd-GFP, as determined by transmission o f the GFP marker through NIH3T3 cultures after inoculation at low MOI (Fig. 7A). However, elimination o f the upstream 11-bp repeat homology did not appear to prolong the stability o f the virus over multiple infection cycles. Upon serial infection using the same protocol as above, ZAPm- GFP still showed progressively decreasing levels o f Day 4 post-inoculation GFP fluorescence starting from infection cycle 8 (Fig. 7B), indicating that the same progressive loss o f the full-length genome occurred from this cycle onward. AZE-GFP also showed efficient replication and GFP transmission (Fig 8A). However, the replication kinetics o f this vector were found to be slightly attenuated compared to ZAPd-GFP and ZAPm-GFP, and during serial infection experiments the percentage o f GFP-positive cells after infection by the amphotropic virus only reached 80% by each Day 4 time point up to cycle 7 (Fig. 8B), whereas its ecotropic counterparts had consistently reached around 95% by the same tim e point in previous experiments (Fig. 6 and 7B). In each o f the first 7 serial infection cycles, the percentage o f GFP-positive cells did subsequently reach nearly 100% 2 4 Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. Day 3 Day 5 Day 8 ™r B. C L 100- 05 80 - 2 3 4 5 6 7 8 9 10 11 12 13 14 15 Infection number Fig. 7 Transmission of GFP by ZAPm-GFP. (A) Results from infection of single culture of NIH3T3 cells. Cells were infected at an MOI of 0.0005 and grown for 8 days. At 3, 5, and 8 days post-infection the cultures were split and examined for GFP expression by flow cytometry. (B) Results from serial passage of vector through 15 NIH3T3 cultures. Four days after each culture was exposed to virus, the cells were analyzed by flow cytometry. Shown are the percentages of cells expressing GFP at each day 4 time point. Values were obtained from three independent experiments. Error bars indicate standard deviations. 25 Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. B. 5 6 7 8 9 10 11 12 13 14 15 Infection number Fig. 8 Transmission of GFP by AZE-GFP. (A) Results from infection of single culture of NIH3T3 cells. Cells were infected at an MOI of 0.0005 and grown for 8 days. At 3, 5, and 8 days post-infection the cultures were split and examined for GFP expression by flow cytometry. (B) Results from serial passage o f vector through 15 NIH3T3 cultures. Four days after each culture was exposed to virus, the cells were analyzed by flow cytometry. Shown are the percentages of cells expressing GFP at each day 4 time point. Values were obtained from three independent experiments and error bars indicate standard deviations. 2 6 Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. within the next 2 days, confirming that the lower percentage o f fluorescent cells was due to delayed replication o f full-length AZE-GFP and not due to the early emergence o f deletion mutants (data not shown); however, the same time point (Day 4) was utilized throughout for the serial infection experiments in order to preserve consistency in the assay. From cycle 8 onward, a progressive decrease in the percentage o f fluorescent cells at each Day 4 time point was observed, similar to that observed with the ecotropic vectors; this progressive decline in GFP fluorescence in later cycles could not be rescued by prolonged culture o f each serially infected cell population, again indicating the overgrowth o f deletion mutants. 1.3.6 Analysis of deletion variants arising during serial passage We further characterized the deletion mutant populations that arose during the first infection cycle o f ZAPd-hygro and after the 7th or 8lh infection cycles o f ZAPd-GFP, ZAPm-GFP, and AZE-GFP by PCR amplification and sequencing o f Hirt DNA from each cycle. Primers that bind at the 3 ’ end o f env and at the 5’ end o f the 3’ LTR were used to amplify across the IRES-transgene cassette (Fig. 9A). In the case o f ZAPd-hygro, the PCR results indicate that the variant population observed on Southern blot consisted o f a single m ajor species o f deletion mutant (Fig. 9B). In contrast, DNA from passaged ZAPd-GFP, ZAPm-GFP, and AZE- GFP each revealed three m ajor deletion species. However, none o f these could be detected prior to the 7th or 8th infection cycles (Fig. 9C-F and data not shown), and all deleted forms appeared to emerge roughly simultaneously. 27 Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. L T R Fig. 9 PCR analysis of transgene insert region of serially passaged viruses. (A) Hirt DNA from each indicated infection cycle was used as template in PCR using an upstream primer specific for the C-terminal region of the appropriate env gene and a common downstream primer specific for the 3’ UTR-3’ LTR border region of Moloney MLV. (B) Results from PCR amplification of passaged ZAPd-hygro. Overexposure o f this gel (not shown) revealed the presence o f a faint band of approximately the size expected for full-length ZAPd-hygro. (C and D) Results of amplification of proviral DNA isolated from two independent infection series using ZAPd-GFP. (E) Results from passaged ZAPm-GFP. (F) Results from passaged AZE-GFP. M: 100-bp molecular weight marker. Asterisks indicate size of signal expected for undeleted, full-length virus. 28 Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. Sequencing o f the amplified PCR products indicated that deletions occurred through recombination events between both direct and inverted repeats (Fig. 10A and B). Particular deletion patterns occurred repeatedly in independent experiments using different virus constructs (Fig. 10A, H/Z3/Z6 and Z1/Z4/M2/A1) and hence might represent preferred recombinational forms, while the other deletion species were unique to a single experiment or vector (Fig. 10A, A3 and Fig. 10B-C). One o f the recurring deletion species, occurring in both ZAPd-GFP and ZAPd-hygro, exactly matched that o f the wild type env-UTR junction sequence (Fig. 10A, H/Z3/Z6). It is likely that this revertant derived from recombination between the 11-bp direct repeat sequences flanking the IRES-GFP insert, resulting in deletion o f the entire 1296-bp insert and reconstitution o f the wild type sequence. This species emerged rapidly and was the only one present after a single passage o f ZAPd-hygro, but in the case o f ZAPd-GFP, emerged only after multiple replication cycles and was not the only species present. As the upstream copy o f the 11-bp direct repeat had been eliminated in ZAPm-GFP and AZE-GFP, we did not expect to find precise reconstitution o f the wild type sequence, and indeed this did not occur. Another deletion species emerged repeatedly in all three GFP-encoding viruses (Fig. 10A, Z1/Z4/M2/A1). In this variant, recombination occurred between 7-bp direct repeats, one o f which was located in the IRES and the other within the GFP sequence, leading to the loss o f 1142 bp o f the insert. The remaining deletion species differed in sequence and w ere not consistently observed to arise from experiment to experiment. Sequence analysis 2 9 Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. A. Direct repeats Z1, Z4, M2, A 1 : . . . c t g t c t t c t t -A1142 bp- GACGAGgATTC .TCTCGGCATGlGACGAGCTGTA... j GFP IRES f Topo I Topo I I -A1296 bp- H, Z3,Z6 : — ATAGAGTACGA GCCATAGATAAC..........TAGCGGCCGC GCCATAGATAAA... env 3' UTR -A1270 bp- A3 : '.AAGCCGCTTGG AATAAGGCCG...............CGCCATAGAT]AAAATAAAAGAT. ' IRES 3' UTR B. Inverted repeats -A1248 bp- Z2 : ...g t g c g t t t g t c t [ a t a t g t t a t t . ...............c g c c a t a g a t a |a a a t a a a a g a t ... IRES 3' UTR ______________i A1188 bp---------------- 1 _______________ 2 5 : ...CCACCATATTGlCCGTCTTTTG........... c a c t c t c g g c |a t g g a c g a g c t ... IRES GFP ■A1083 bp- M 1 : ...AGGAAGCAg g g g T C T [ gGAAGCTTCTT...........CAAGTAGCGCj j|pCGCGCCATA... IRES 3‘ UTR A 2 : -A1235 bp- ..TATATGTWTTT CCACCATATT... ..CGCCATAGAT AAAATAAAAGA... IRES 3' UTR C. Homologous recombination in M3 MoMLV M3 MMX-CZ3 MoMLV M3 MMX-CZ3 S^CCCCtnTGGTT|TlA^CCTTGATATC|TlACCATTATGGG|AjCC^flgATTGTACT|cgfA|5fFGAT|T]jfl^CfCT aggtccccatggttcacgaccQ tgatatccaccattatgggccccttgattgtacttttattgatcctactct AGGTCCCCATGGTTCA CG ACCTTG ATATCCACCA TTATGG G CCCCTTG A TRAlrA C T T T T A T T lA lA TCCTACTCT TCGGACCCTG(gATTCT[!jAAjTjCG^jffl^TCCA^TTTGT[TjAAAGACAG|^AT^F^TGGT|gCAGGC(]jCTl^GTTtTfr TCG G ACCCTGTATTCTCAACCGCTTGGTCCAGTTTGTAAAAGACAGAATTTCGGTGGTGCAGGCCCTGGTTCT TCG G ACCCTGTATTCTCAACCGCTTGGTCCAGTTTGTAAAAGACAGAATTTCGGTGGTGCAGGCCCTGGTTCT MoMLV M3 MMX-CZ3 GAClTlCAACAlAITATCACCAlGlCTlGlAAiG CSTlATAGAlGTACiGAlGCdAlTAH. -[ATIaIaI ------ 1 A AT A A A AGATTTT ATT GACCCAACAGTATCACCAACTCAAAlGCAATAGATCCAGAAGAAGTGGAATCACGTGAATAAAAGATTTTATT GACCCAACAGTATCACCAACTCAA A T CAATAGATCCAGAAGAAGTGGAATCACGTGAATAAAAGATTTTATT Fig. 10 Sequence analysis of deletion junctions of vector deletion variants identified by PCR. Each of the PCR products shown in Figure 9 was purified from an agarose gel and subjected to sequencing utilizing the corresponding upstream primer used in PCR. Boxed sequences are retained in each deletion variant, while the unboxed sequences are deleted. The length of each deletion is indicated above each sequence. (A) Sequences at deletion junctions of variants whose deletions were flanked by direct repeats in the parental genome. The direct repeats are underlined with arrows. (B) Sequences at deletion junctions characterized by inverted repeats in parental virus. Inverted repeats are underlined with arrows and the orientation of each repeat is indicated by arrow direction. (C) Sequence alignment of ZAPm-GFP variant Ml with parental Moloney MLV and polytropic endogenous retrovirus MMX-CZ3. Envelope stop codons are indicated in bold. 3 0 Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. o f one such variant species, A3, implicated recombination occurring between two dinucleotide repeats (Fig. 10A). Four other deletion species were associated with inverted repeats in the parental virus sequences (Fig. 10B). In three o f these species, one copy o f an inverted repeat was present on each side o f the deletion junction: variant Z2 had a 1248-bp deletion associated with 9-bp inverted repeat sequences, Z5 had a 1188-bp deletion associated with 5-bp inverted repeat sequences, and A2 had a 1235-bp deletion associated with 7-bp inverted repeat sequences, situated at the recombination breakpoints (Fig. I OB). The fourth inverted repeat deletion (M l) was associated with two complete palindromes with the potential to form hairpins aligned at each recombination breakpoint (Fig. I OB). The remaining variant species, M3, generated a PCR product size approximating the wild type MLV ewv-UTR sequence (Fig. 9E). However, sequence alignment analysis showed significant disparities between the M3 sequence and the parental M oloney MLV sequence, and a BLAST search o f GenBank revealed extremely high homology with an endogenous mouse retrovirus sequence ((147); GenBank Accession # AF017530) (Fig. IOC), suggesting that it was derived by recombination o f ZAPm-GFP with endogenous retrovirus present in the NIH3T3 cells. 1.4 Discussion We have constructed a series o f replication-competent MLVs containing insertions at the env-V UTR boundary to examine virus stability over multiple serial infection cycles. O ur results suggest that an insertion at this position can be 31 Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. well tolerated as long as the insert size does not exceed a certain threshold. The transgene cassette was positioned immediately upstream o f M LV sequences thought to be involved in reverse transcription (6, 115, 160) and encapsidation (163). While the positioning o f the insert in our vectors preserves these sequences, w e did observe an approximately 10-fold reduction in titer for ZAPd-GFP compared to wild type MLV, which may be related to one or both o f these functions. Nevertheless, this positioning appears to be minimally disruptive to the overall replicative function o f the virus, while allowing efficient expression o f the inserted transgene sequence. This construct design thus allowed us to exam ine the population dynamics o f lengthened MLV genomes over repeated passaging. The IRES-GFP insert allowed us to easily track virus spread by flow cytometry, with loss o f fluorescence serving as reliable surrogate marker for genetic instability and the concomitant emergence o f deletion mutants. In collaborative studies, we have also successfully employed a similar IRES-GFP insertion in feline leukemia virus to follow FeLV-A to FeLV-B conversion, suggesting that this strategy may prove to be generally useful in studies o f retrovirus replication (17). On comparing replication-competent MLV vectors containing insertions between 1.15 and 1.55 kb, we found striking differences in stability, which correlated with differences in replication kinetics observed in single-cycle infections. ZAPd-hygro, which contains an insert o f 1.55 kb, displayed the most attenuated replication kinetics. When this virus was propagated, it was almost com pletely overgrown after a single passage by a fully deleted revertant possessing w ild type M LV sequence. In contrast, ZAPd-puro and ZAPd-GFP, with 1.15- and 32 Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. 1.3-kb inserts, respectively, exhibited replication kinetics much closer to wild type virus and retained their inserts for much longer periods. Presumably, the replicative fitness o f ZAPd-puro and ZAPd-GFP relative to ZAPd-hygro account, at least in large part, for their greater stability, as they were likely better able to compete with deletion variants that arose during replication. Although the transgene inserts o f ZAPd-puro and ZAPd-GFP were gradually deleted from the replicating population after several infection cycles, our data nevertheless demonstrate that these vectors possess immense gene transfer power. Since we used 100-fold dilutions o f vector at each cycle, only 1% o f the vector that was generated at each cycle was used for infection. If we had carried out serial infections with ZAPd-GFP following the same procedure, but had instead used all o f the vector generated at each infection cycle, over 5 * 102 1 cells could have been transduced, starting from the initial 3 ml o f stock vector generated by one transfection. In contrast, a 3 ml preparation o f defective retrovirus o f the highest available titer is capable o f transducing, even assuming 100% efficiency, only 3 * 109 cells. Sequence analysis o f the deleted variants indicated that some o f the deletions may have occurred through inter- or intra-molecular template switching (69, 101, 144) between short direct repeat sequences within and flanking the transgene cassette. Recombination between an 11-bp direct repeat sequence that flanks the insertions o f ZAPd-hygro and ZAPd-GFP resulted in exact reconstitution o f wild type MLV sequence. Unexpectedly, when variants o f ZAPd-GFP lacking the 33 Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. upstream copy o f the 11-bp repeat were serially passaged, no improvement in stability was observed. One deletion species, arising by recombination between 7-bp direct repeats within the insert occurred in all IRES-GFP-containing vectors. Notably, while sequence analysis revealed that the IRES-GFP cassette contains 77 pairs o f perfect direct repeats o f 7 or more base pairs, only this particular repeat pair was involved in formation o f a deletion mutant. One possibility is that the sequence context o f this specific 7-bp repeat might be particularly recombinogenic. Alternatively, as this repeat is spaced further apart than any o f the other 77 pairs, the frequent occurrence o f this deletion species may simply reflect a higher rate o f recombination between homologous sequences that are spaced further apart (60, 145), although this idea has recently been challenged (2). A third possibility is that, while other deletion species might have arisen through recombination at the other repeats, this particular species exhibits the largest deletion and its genome size is closest to that o f wild type MLV, allowing it to compete more effectively during virus passage. This particular 7-bp repeat was also associated with sequences exhibiting perfect o r near-perfect matches to consensus recognition sites for murine topoisomerases I and II. The topoisomerase cleavage sites were precisely aligned with the termini o f the repeat sequence, possibly implicating one or both o f these enzymes in the mechanism o f recombination. Topoisomerases IB and II have been shown to generate double-strand breaks in DNA (76, 169), and such lesions are often repaired by religation at short direct repeats (117, 118). The consensus 3 4 Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. topoisom erase I and II recognition sequences, respectively, span 4 and 13 nucleotides (13). The probabilities that the matches to the consensus sequences that w e observed were due to chance are calculated in Figure 11. W hile the involvem ent o f these enzymes in the recombination o f our vectors remains a speculation at this point, the possibility o f such mechanisms contributing to retroviral recombination is intriguing. W e also observed frequent deletion between inverted repeats. This type o f deletion has been proposed to occur when reverse transcriptase jum ps over hairpins form ed by such repeats in viral RNA during reverse transcription (99). The potential secondary structures formed by the inverted repeats at the deletion borders o f these variants are schematically depicted in Fig. 12. Interestingly, o f the many deletion junctions that have been characterized in previous studies o f defective retrovirus vectors, the majority occurred between sites w ith directly repeated sequences, but remarkably few occurred between sites having any inverted repeat homology (54, 69, 100, 101, 107, 142, 150, 164). In contrast, about half o f the deletion species we observed occurred by recombination between sequences with significant inverted repeat homology. W e observed one instance o f deletion via homologous recombination with an endogenous polytropic retroviral sequence which resulted in the loss o f the entire IRES-GFP insert. Similar “patch repair” o f an exogenous virus by an endogenous sequence has been observed previously (25, 124), although in the earlier cases the repair was o f a lethal deletion rather than a nonlethal insertion. 35 Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. It is notable that these multiple species o f deletion mutants detected in the ZAPd-GFP, ZAPm-GFP and AZE-GFP infections were in each case undetectable over the first 6-7 infection cycles, and subsequently appeared to emerge simultaneously. Neither Southern blot nor PCR analysis revealed any major deletion intermediates during the serial infections, suggesting that these short deletion mutants were the only major species to arise, and that these were generated without a stepwise series o f progressive deletions. While it remains possible that longer deletion intermediates were present but not amplified efficiently in this assay, this is unlikely as the full-length IRES-GFP sequence could be amplified efficiently, and showed a progressive loss o f amplification signal beginning at cycle 7 or 8, consistent with the Southern blot results. The lack o f intermediate forms could be a consequence o f recombination occurring at an early stage. If reversion was an early event, it occurred at low frequency and it is likely that very few such deletion mutants were present from the first infection cycle. In the case o f ZAPd-hygro, it is clear that revertants were present from the initial infection. However, for the other vectors, the advantage in replicative fitness o f the various deletion mutants may not have been strong enough for these to have become apparent until many cycles had passed. An alternative, though not mutually exclusive explanation, is that at least some o f the revertant species arose simultaneously in later cycles due to the requirement for some prior initiating event which resulted in increased rates o f subsequent recombination. Previous studies have suggested that retroviral recombination occurs within a distinct subpopulation (58), and that one predisposing factor m ight be the 3 6 Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. Position: -5 -4 -3 -2 -1 + 1 +2 +3 +4 +5 *6 +7 +8 Topo I I consensus: C G J S 7 X A N N N / T A C 5'deletion point: C G A G C A T T C C T AG deleted Probability of observed match = V i • V* • Vi • % • % • V i • 1 *1 • 1 • V i • V i • V i = 1/3,236 B f Position: -4 -3 -2 -1 Topo IB consensus (rat): AorT GorC AorT T 5’deletion point: T C T T . deleted Probability of 100% match = V i • 1 4 • !4 • V i = 1/32 Fig. 11 Statistical significance of topoisomerase recognition sites at points of deletion in variants Z l, Z4, M2, and Al. (A) Consensus of mouse topoisomerase II recognition site, aligned with sequence at S' deletion point of deletion variants, and likelihood of the random occurrence of the observed match to the consensus. (B) Consensus for rat topoisomerase IB, aligned with sequence at S' deletion boundary of variants. Arrowheads indicate location of cleavage by each enzyme and bent arrows denote S' deletion border of variants. /C N u u U -A e - i l - A l c - t n G -U A ^-U ., % Z2 u c W * i i T A -U IJ— A b-b U -A y -f C-G-U— A-A-U C - G I I G -C I I G - C I I G— A— // - T - A - C _ G ~ C - c Z5 A2 ^U'//-As z u s u u ' c c X - C ' ^ C - G t l I C - G I I * G - C T I I -I a _ U - U - A - ( J - G C ' " ' A V t G ‘ C A V ^ U - A 'V I I v - t U—A I I U—A I I A—U i i U—A i I U - G - U - A - A - A Fig. 12 Possible secondary structures in vector RNA facilitating observed deletions in IRES-GFP insert. Each structure corresponds to one of the deletion mutants depicted in Figure 10B, with stem structures here corresponding to demarcated regions of inverted repeat homology. Bent arrows delimit deletion boundaries. 37 Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. emergence o f variant forms o f reverse transcriptase that exhibit an increased frequency o f template switching (106, 141). As no external selection pressure was applied on any o f the insert-containing virus populations, all deletion mutants presumably gained predominance through natural selection processes favoring those species that replicated most efficiently. Once detected, the major deletion mutant species all appeared to persist and gain dominance together. Presumably these multiple species, which are all sim ilar in size, were collectively represented by the deletion mutant signal on Southern blot, which also showed no apparent intermediate forms. W hile the PCR analysis employed is not absolutely quantitative, the relative amount o f the amplification products from these deletion species would be predicted to change over multiple infection cycles if any particular species gained dominance over the others; however, this was not observed, suggesting that all three m ajor deletion species could replicate with similar efficiency, and thus remained at an apparent equilibrium. The fact that each o f the deletion variants observed, using various pathways o f recombination, had lost at least 84% o f the IRES-GFP sequence indicates a strong selective advantage for either the natural genome length or for the loss o f insert sequences not contributing to efficient replication. W hile it has become clear that there is no absolute limitation on genome length within a certain range (56, 126), cumulative inefficiencies at multiple stages in the retroviral life cycle may result in an overall replicative disadvantage for viruses harboring exogenous 38 Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. sequences, and thereby subject such genomes to stringent limitations by the process o f natural selection. As our primary interest is the development o f vectors for efficient therapeutic gene transfer, the stability in the vectors described in this study is a centrally important issue. In contrast to previously described RCR vectors, the vectors described here, except for that carrying the hygromycin transgene, were stable over 7-8 cell-free passages. Although this may not appear to represent a very large improvement in stability, this does in fact represent a vast increase in gene transfer power. During the serial infections we carried out with the vectors, each infection was initiated with a 100-fold dilution o f virus produced by the previous infected culture, while the remainder o f virus at each cycle was not used. If we had utilized in the same m anner all o f the ZAPd-GFP virus produced during the first 8 cycles, starting with the 3 ml o f vector stock generated by transfection, over 5 * 102 1 cells could have been transduced with the GFP transgene. An RCR vector that deletes its transgene within 3 or fewer infection cycles, such as those described earlier by other investigators, would be capable o f transducing only a number o f cells many orders o f magnitude lower. Furthermore, a 3 ml preparation o f defective MLV vector o f the highest currently available titer would be able to transduce no more than 3 x 109 cells, even assuming 100% efficiency. In the next chapter, we examine how the gene transfer power o f ZAPd-GFP can be applied to the transduction o f solid tumors in vivo. 39 Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. Chapter 2: Use of a Replicating Retrovirus Vector for Transduction of Solid Tumors 2.1 Introduction Advances in techniques for gene transfer and expression have made feasible the treatment o f cancer at the genetic level by introduction o f exogenous genes into tumor cells (4). Clinical trials utilizing various gene therapy strategies are underway for a variety o f malignancies. However, all o f these strategies require efficient gene transfer and this step has been a major impediment (113, 132, 152). Despite the use o f viral vectors such as retroviruses, gene transfer efficiency in vivo has generally been inadequate for achieving significant therapeutic benefit. Defective murine leukemia virus (M LV)-based retroviral vectors, which have been the most commonly used gene delivery vehicles in clinical gene therapy protocols (113), are incapable o f secondary infection o f adjacent cells due to the deletion o f essential viral genes. More efficient transduction could be achieved if replication-competent retroviruses were used, as the virus would multiply after the initial infection event and each infected target cell would itself become a virus- producing cell. However, uncontrolled virus spread could result in adverse consequences, and the possibility o f generating replication-competent retrovirus (RCR) during vector production has been a prim ary concern o f gene therapy investigators (28). 4 0 Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. Nevertheless, replicating forms o f other virus species, including adenovirus (I, 12, 55, 159), paramyxoviruses (85, 129), herpes virus (104, 157), and reovirus (21, 95) have been recently exploited for cytolytic treatment o f cancer. Replicative retroviral vectors have also been proposed for use in gene therapy (121, 153), but there have been no previous studies reporting the development o f RCR vectors for therapeutic applications. Although retroviruses are not cytolytic, the incorporation o f a suicide transgene into a RCR vector could be used as a means to kill tum or cells, and would also serve as a safety mechanism to eliminate the vector after adequate levels o f transduction are achieved. Furthermore, the initial rationale for use o f defective retroviral vectors in cancer gene therapy would still hold true for RCR vectors, i.e., MLV-based vectors can only transduce cells that are actively dividing (8 8 ), and since the majority o f normal cells are quiescent, transduction would be relatively selective for tumor cells. All previously described replicating murine retroviral vectors have contained transgene inserts, ranging from 100 to 1200 bp, in the U3 region o f the 3' long terminal repeat (LTR) (35, 47, 111, 139). However, vectors based upon this design have proven to be quite unstable, as most o f these earlier constructs began losing their transgene inserts from the first infection cycle (35, 47, 111, 139), and even non-replicating retroviral vectors containing U3 inserts show a high frequency o f recombination and deletion events (70, 86). Thus, none o f these previous replicating M LV vectors has been sufficiently stable to be useful for efficient and reliable gene delivery in vivo. 41 Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. W e therefore sought to develop a stable, non-defective retroviral vector capable o f high-level transduction both in culture and within solid tumors. Employing a unique construct design, we have developed an M LV-based RCR vector that contains an internal ribosome entry site (IRES)-transgene expression cassette inserted precisely at the env-3 ’ untranslated region (UTR) boundary in the MLV genome. We have previously utilized this type o f vector to achieve delivery o f the cell cycle regulator p27(kip-l) to osteoblasts in vitro (133), dem onstrating that this construct design produces a retroviral vector that can efficiently replicate and transduce mammalian cells in culture. Here we demonstrate that this vector is highly stable, being capable o f replicating without observable deletions through multiple serial infection cycles in culture, and can achieve highly efficient gene delivery to solid tumors in vivo; hence this report represents the first use o f such a non-defective retrovirus vector to achieve gene delivery in an adult mammalian host. 2.2 Materials and Methods 2.2.1 Replicating vector Details of the construction of the replicating retrovirus vector plasmid pZAPd-GFP are detailed in Chapter 1. 2.2.2 Cell culture Dulbecco’s modified Eagles medium, supplemented with 10% fetal bovine serum, was used for culture of 293T cells. NMU rat mammary adenocarcinoma cells (24) were grown in minimum essential medium supplemented with 10% fetal bovine serum and 42 Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. antibiotics. All cells were grown at 37°C under 5% C02. The calcium phosphate precipitation method was used to transfect 293T cells with pZAPd-GFP for transient production of virus. Conditioned medium was harvested 48 hours post-transfection and filtered through 0.45 pm syringe filters prior to use injection into mice. 2.2.3 Mouse tumor model Tumors were established by the subcutaneous injection o f 2 x 106 NM U rat breast adenocarcinoma cells into the anterior flanks o f 8-week-old nu/nu BALB/c mice (Simonsen Laboratories, Gilroy, CA). Four weeks later, the tumors had grown to 1-1.5 cm3, at which time they were injected with 6 x 103 PFU vector. At regular intervals thereafter, subsets o f the mice were sacrificed, and their tumors were surgically removed. A portion o f each tumor sample was immediately frozen in liquid nitrogen for later sectioning and immunohistochemical staining. The remaining portion o f each tumor was used for FACS analysis, explantation, and isolation o f genomic DNA for Southern hybridization. 2.2.4 Flow cytometry For FACS analysis and explantation, cell suspensions from tumors were prepared by mincing o f the tissue and incubation for 1-2 hours at 37°C on a rocking platform in Hank’s balanced salt solution containing 100 U/ml collagenase type III and 3 mM CaCL. After removal o f tissue fragments by passage through a cell strainer, dissociated cells were pelleted by low-speed centrifugation, resuspended in PBS, and either analyzed by FACS as described above o r explanted into Dulbecco’s modified Eagles medium containing 10% fetal bovine serum, and grown at 37°C under 5% CO2. 43 Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. 2.2.5 Immunohistochemistry For immunohistochemistry, tumor sections were incubated overnight at 4°C with a 1:8000 dilution o f GFP-specific monoclonal antibody (Clontech). Immunoreactivity was visualized with a Vectastain ABC kit (Vector Laboratories, Burlingame, CA) and diaminobenzidine as chromagen. All sections were counterstained with hematoxylin. 2.2.6 Southern blot analysis Genomic DNA was extracted from tumors at autopsy with the GenomicPrep kit (Amersham Pharmacia Biotech). After NheI digestion and agarose gel electrophoresis, 10 pg of DNA from each sample was transferred onto Hybond-Nl filters (Amersham Pharmacia). The blots were hybridized with a random-prime [32P]dCTP-labeled probe for GFP or the LTR-gag region of MLV, washed at high stringency, and analyzed by Phosphorlmager. 2.2.7 Detection of extratumoral spread of vector Genomic DNA was extracted at autopsy from spleen, lung, kidney, liver, and heart tissue of ZAPd-GFP-injected animals. Six hundred ng of each DNA sample was used in a 50-|il PCR reaction with PCR SuperMix (Life Technologies) and primers for the enhanced GFP. Five pi of the reaction products were resolved on a 1% agarose gel and visualized by ethidium bromide staining. The detection sensitivity of this assay was determined by amplification of the GFP gene from serially diluted pZAPd-GFP plasmid in the presence of untransduced tissue genomic DNA. As an internal control for the amplification procedure, each DNA sample was used in PCR with primers that amplified a 500-bp target within the 4 4 Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. mouse p-casein gene. Tissues from the same organs were also dissociated and grown in explant cultures as described above. 2.3 Results 2.3.1 Generation of tumors and injection with vector The ability of ZAPd-GFP to transmit its transgene through multiple serially infected cultures indicated that this vector might be able to spread within solid tumors in vivo and mediate transfer of the transgene into large numbers of tumor cells. In order to examine the ability o f ZAPd-GFP to achieve efficient gene delivery in tumors, we injected the vector into pre-established mammary cancer xenografts in nude mice. Tumors were established by the subcutaneous injection o f 2 x 106 NMU rat mammary carcinoma cells; after 4 weeks, the tumors had reached volumes o f 1.0-1.5 cm3, and were injected with 6 x 103 PFU ZAPd-GFP (Fig. 13). Subsets o f the mice were sacrificed and their tumors surgically removed at 12, 22, 37, and 49 days after injection o f the vector. 2.3.2 Flow cytometric analysis of tumor cells Following dissociation o f the tumors into single-cell suspensions, the tum or cells were analyzed by flow cytometry for GFP expression (Fig. 14). The first tum or harvest, at 12 days post-injection, revealed minimal transduction in three out o f four o f the tumors examined. One o f the four tumors examined, however, exhibited a moderate transduction level, with approximately 8% o f its constituent cells expressing the GFP transgene. By day 22, the number o f tum or cells infected with the virus had greatly increased. All four o f the tumors removed from the mice 45 Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. Reproduced with permission o f th e copyright owner. Further reproduction prohibited without permission. • • • • Establishment of tumors Injection of ZAPd-GFP into tumors Vector replication Removal and analysis of tumors at 12,22, 37, and 49 days after vector injection. Fig. 13 Procedure for analysis of vector spread in vivo, Balb/c nude mice were injected subcutaneously in both flanks with 2 x 106 NMU tumor cells. After the resulting tumors had reached a size of 1-1.5 cm3 they were directly injected with 6 * 106 PFU of ZAPd-GFP. At 12,22,37, and 49 days after vector injection, tumors were removed from subsets of the mice and were analyzed for virus spread by flow cytometry, Southern blot hybridization, and immunohistochemistry. a\ 2BB Day 12 mi ■ m u n i B m l f ci 3 2BB Day 22 I B 1 0 I B ' IB 4 IB 3 IB* IB® IB* IB 2 IB 3 IB I f ' i i i i i i h | i i H i m O Day 37 Day 49 I 11 mi a 10“ 10 F luorescence intensity Fig. 14 Spread of ZAPd-GFP through solid tumors in mice as detected by flow cytometry. Tumors removed at 12, 22, 37, and 49 days following vector injection were dissociated into single-cell suspensions and analyzed for GFP fluorescence by flow cytometry using FL1. Shaded histograms represent tumors injected with ZAPd- GFP, and open histograms represent untreated tumors. 4 7 Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. at this time showed significant levels o f infection, averaging approximately one- third o f the cell population. Comparable increases in transduction levels occurred by the two subsequent tumor harvests, on the 37th and 49th days after injection o f the vector. By the 49th day, the average transduction level was approximately 75%, with some tumors showing transduction levels approaching 100%. Explantation o f dissociated tum or tissue and subsequent examination by fluorescence microscopy revealed that host-derived stromal cells within the tum or were also transduced by the vector (data not shown). 2.3.3 Immunohistochemistry of tumors Tum or tissue taken at the 22 and 49-day time points was also examined by immunohistochemistry with an anti-GFP antibody to confirm expression o f GFP within the tumors. While tumors removed at the earlier time point revealed patchy staining for GFP, with clusters o f transduced cells adjacent to clusters o f untransduced cells (Fig. 15, upper left panel), low magnification views o f tumor tissue taken at the later time point demonstrate highly efficient transduction throughout the tum or mass (Fig. 15, lower left panel). The latter samples show intense staining in almost every tumor cell, as well as distinct staining in fibroblasts and some endothelial cells (Fig. 15, upper right panel). 2.3.4 Southern blot analysis of tumor DNA To confirm that integrated vector pro virus was present in the tumor cells and that the GFP transgene had been transmitted as part o f the intact vector, we performed Southern analysis on genomic DNA from tumors removed at 12 and 37 days after vector injection. The only bands detected by the GFP probe were the 48 Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. Day 49 Neg, Day 49 Fig. 15 Immunohistochemical staining of tumors injected with ZAPd-GFP. Tumors removed at 22 and 49 days after vector injection were stained using a monoclonal antibody to GFP and counterstained with hematoxylin. Upper left, tumor removed 22 days after vector injection. Upper right and lower left, tumors removed at 49 days. Open arrows indicate transduced fibroblasts and closed arrows indicate transduced endothelial cells. Lower right, negative control tumor removed 49 days after vector injection. Each panel represents a different mouse. (Original magnification: Upper left and lower right, *300; Upper right, *400; Lower left, *6) 49 Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. size expected for full-length ZAPd-GFP (Fig. 16A), demonstrating the presence o f integrated vector and that the high level transduction shown by FACS analysis and immunohistochemistry was the result o f the transmission o f the GFP transgene by intact ZAPd-GFP. The MLV LTR-gag probe also hybridized to the full-length ZA Pd-GFP band, as well as a smaller band that is likely to represent an endogenous provirus present in the NMU cell line or the BALB/c genome, as the same band is present in genomic DNA from the untransduced negative control tumors (Fig. 16B). These results suggest that the transmission o f the GFP transgene through the tumors during the course o f the 37 days was mediated primarily or exclusively by the intact vector, and that deletion variants, if present, occurred only at levels undetectable in our analysis. 2.3.5 PCR analysis to detect extratumoral spread of vector In order to detect any spread o f ZAPd-GFP outside the tumors that might have occurred, a variety o f extratumoral tissues including spleen, lung, kidney, liver, and heart were harvested at the time o f autopsy. High molecular weight DNA was harvested from each o f these tissues and was used, along with DNA extracted from tumors, in PCR with primers specific for the GFP transgene. Amplification o f serial dilutions o f pZAPd-GFP plasmid demonstrated that this assay could detect as few as 140 copies o f GFP in a background o f approximately 100,000 equivalents (600 ng) o f untransduced genomic DNA, representing a transduction level o f about 0.14%. Fig. 17 shows the results o f PCR using samples taken from mice sacrificed 49 days after vector injections. DNA from the tumor injected with vector revealed the presence o f the full-length GFP transgene, but none o f the non-tum or tissues 50 Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. V P 1 2 3 4 5 N Fig. 16 Southern blot analysis of genomic DNA from tumors injected with ZAPd-GFP. Ten micrograms of DNA from each tumor was digested with Nhel and fractionated on an agarose gel. After blotting onto nylon, the fragments were hybridized to a random- primed radiolabeled probe for the GFP transgene or for the MLV LTR-gag sequence. Lanes: V, 30 pg of pZAPd-GFP plasmid DNA digested with Nhel; P, DNA from tumor originating from cells that were infected with ZAPd-GFP prior to their injection into mouse; I and 2, DNA from tumors removed 12 days after vector injection; 3, 4, and S, DNA from tumors removed 37 days after vector injection; N, negative control tumor injected with virus-free supernatant. (A) GFP-probed blot; (B) MLV LTR-gag-probed blot. Top band, full-length ZAPd-GFP; bottom band, nonspecific hybridization signal (also present in negative control tumor). 51 Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. Copies of pZAPd-GFP Fig. 17 Assay for extratumoral spread of ZAPd-GFP by PCR amplification of GFP transgene from genomic DNA. The sensitivity of the assay was determined by amplification using a series of 4-fold serial dilutions of pZAPd-GFP as template in the presence of untransduced genomic DNA (top). Six hundred nanograms of DNA, extracted from tumors and various other tissues at the time of autopsy, was used in PCR analysis for the GFP transgene (middle). Shown are results with tissues taken from mice 49 days after injection of tumors with vector. Expected size of full-length amplification product is 730 base pairs. A 500-bp region of the mouse ^-casein gene was amplified from the same samples as an internal control (bottom). 52 Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. nor the mock-treated tumor sample exhibited amplification with the GFP primers. This unexpected result was also obtained upon examination o f tissues harvested from animals sacrificed at earlier time points (data not shown). Flow cytometric analysis o f the same tissues one week after explanting also revealed the presence o f the GFP transgene only in tumors (data not shown). These results suggest that spread o f the vector originating from a total initial inoculum o f 6 x 103 PFU was minimal over the time course o f these experiments. 2.4 Discussion This study demonstrates that the insertion of exogenous sequences precisely between the env and 3' UTR of MLV results in a replication-competent vector that is able to transduce tumor cells in vivo with high efficiency. We chose this particular insert position because: i) the packaging signal extends past the start codon of the gag gene, and thus positioning a transgene just upstream of the gag gene would likely impair packaging efficiency, ii) the gag and pol coding sequences are initially translated as a single polypeptide which is then cleaved, thus positioning a transgene between these coding sequences might interfere with proteolytic processing, iii) the 3' end of pol overlaps with the S' end of env, precluding the insertion of a transgene between these genes, and iv) positioning the transgene, preceded by an IRES, just downstream of env would allow the transgene to be expressed from both the spliced env transcript as well as the unspliced genomic transcript. While the majority of previously reported U3-insert MLV vectors, whose inserts were 100-1100 bp smaller than that of ZAPd-GFP, began losing their inserted sequences during the first replication cycle (31, 84, 111, 139), ZAPd-GFP was stable 53 Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. through continuous propagation over multiple replication cycles in culture, and furthermore, this vector efficiently replicated within solid tumors in vivo, leading to widespread delivery of the transgene at efficiencies significantly higher than those typically achieved using standard replication-defective retroviral vectors at much higher doses. Despite the deletions observed after approximately 8 in vitro infection cycles with ZAPd-GFP, described in Chapter 1, this vector is able to achieve very high levels of transduction in vivo. Most previous studies using standard replication-defective MLV vectors for tumor transduction in vivo reported efficiencies of less than 10%, despite the use of large doses of vector or vector packaging cells, vector injection at multiple time points, or simultaneous injection of tumor and packaging cells (77, 108, 109, 128, 131, 161) The low in vivo transduction efficiency of defective retroviral vectors has been attributed to the inability of the vector particles to diffuse from the site of injection. The results of clinical trials of retroviral gene transfer into brain tumors in which intratumoral injection o f packaging cells resulted in transduction of cells only within a few cell diameters of the injection tracts lend support to this notion (108, 109). Similar results were observed in studies involving direct intratumoral injection of defective adenovirus vectors (32, 78). In contrast, the present study suggests that the capacity of replication-competent vectors for intercellular spread, which allows transduction of cells not initially exposed to the vector inoculum, largely circumvents such physical obstacles. Cell-to-cell spread has been shown to be more efficient than cell-free transduction for a number of viruses, including HIV (14, 68), and this mode of transmission is not possible with defective vectors. Furthermore, since MLV can only infect mitotically active cells, and the half-life of virion particles (5-8 hours) (19, 91) is much shorter than the average cell cycle time o f most 54 Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. human tumors (3-6 days), continuous release of replicating vector from initially infected cells also increases the likelihood that additional target cells will undergo division and thereby become infected. The replication-competence of the vector described here obviously raises questions about possible pathogenic effects resulting from spread of the vector in the host. Moloney MLV is known to induce thymic lymphoma in newborn mice, and many other murine retroviruses are associated with characteristic malignancies. However, most of these viruses are not pathogenic in adult mice (116). Non-pathogenic strains of MLV have also been described, and these may be amenable for use in the construction of replicating vectors similar to those described here. Initial studies on the activity of amphotropic MLV in rhesus monkeys could find no evidence of pathology in infected animals over a 3-year observation period, despite severe immune suppression at the time of infection and the administration of high doses (mean 7.2 * 107 PFU) of replication-competent MLV (27, 29). A later study, however, revealed that MLV can be oncogenic in primates under certain conditions, based upon the observation that 3 of 10 rhesus monkey recipients of bone marrow cells infected with replication-competent MLV developed T-cell lymphoma (5, 36). These results suggest that while MLV has oncogenic potential in primates, the presence of a normally functioning immune system is sufficient to prevent the realization of this potential. As the mice used in the present study were athymic, the influence of a fully functional immune system on the spread of ZAPd-GFP has yet to be determined. The tumor microenvironment itself is known to be inherently immunosuppressive; therefore it is possible that RCR vector spread would be facilitated within the tumor even in 55 Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. immunocompetent hosts, while extratumoral spread would be restricted by the immune system. The RCR vector was observed to transduce host-derived cells within the tumors, including fibroblasts and endothelial cells, apparently as efficiently as the tumor cells themselves. In some situations, e.g., for angiogenesis inhibition strategies, achieving gene delivery to the non-tumor cell compartment o f tumors may be advantageous. These cells are more homogeneous in nature and lack the propensity of tumor cells to mutate rapidly; hence, such cells may be less likely to develop resistance to introduced therapeutic genes. Nevertheless, the desirability of a mechanism to control RCR vector spread is underscored by the above observation that the vector efficiently transduced host-derived cells within the tumors. This was not unexpected, since Moloney MLV is tropic for murine cells, and in its present form the vector employed in these studies is untargeted, except for its natural selectivity for proliferating cells. However, the finding that spread of this untargeted vector appeared to be confined to the tumor tissue was somewhat unexpected. Since the assay used to detect spread of the vector outside of the tumors, however, was based upon amplification of the GFP transgene, the possibility remains that deletion variants of the vector lacking the transgene sequence were present in the tissues examined. Such deletion variants were not apparent by Southern blot analysis of DNA from the tumor tissue itself. The lack of detectable levels of extratumoral spread may be a consequence of the dilution of any vector that left the tumor, combined with the relative inability o f MLV to infect non-proliferating normal tissues. As mentioned above, incorporating a suicide gene into RCR vectors would not only provide the means to kill transduced tumor cells, but would also serve as a self-limiting 56 Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. safety mechanism to terminate vector spread after adequate levels o f transduction are achieved. An additional means of targeting spread of a replicating vector, and thereby minimizing risk to recipients, would be to engineer the virus to replicate only within particular cell subpopulations. One strategy that has been used to direct retroviral vector tropism is through the modification of the viral envelope protein to target the entry of vectors into cells expressing specific cell-surface proteins (71, 122, 135, 149). Tight control of retroviral tropism has also been achieved by replacement of the retroviral promoter/enhancer with cell type-specific transcriptional control elements, to target expression to particular tissues (34, 62, 63). The development of tissue-targeted RCR vectors would represent a significant improvement in vector technology for gene therapy of cancer. 5 7 Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. Chapter 3: Transcriptional Targeting of Replicating Retroviral Vectors to Prostate Cells 3.1 Introduction The objective o f most strategies o f cancer gene therapy is the outright destruction o f malignant cells. In such a strategy, equally important to the efficient transduction o f tumor cells is the protection o f healthy, normal tissue from the destructive effects o f the vector. Murine leukemia virus itself has little built-in specificity and can replicate efficiently in a very wide variety o f cell types. Thus, without some means to confine vector replication to targeted cells, the use o f the vectors described in the preceding chapters for therapeutic gene transfer would not be feasible. The two basic approaches to targeting retrovirus vectors to particular cell types have been through envelope modification to target cell entry (79) and through the use o f cell type-specific promoters to target transcription from the vector (90). The receptors for MLV envelopes are widely expressed, making it possible for the virus to enter a very broad range o f cell types (74, 89). In order to restrict virus entry to defined subsets o f cells, investigators have modified the envelope to bind preferentially to cells that express certain cell-surface molecules so as to direct entry o f the vector specifically into these cells. Various envelope targeting strategies have been pursued. The earliest involved the bridging o f the vector and the target cell by two linked antibodies - one against the envelope and the other 58 Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. against a surface molecule on the target cell (119). A later bridging approach utilized a soluble recombinant protein consisting o f a retrovirus receptor fused to ligand for a cell surface protein (134, 135). An alternative to vector-cell bridging has been the polypeptide display strategy, genetically engineering the envelope to contain a ligand or single-chain antibody in order to allow direct binding o f the envelope protein o f a vector to a particular protein on the target cell (18, 30, 71, 83, 122, 149). While efficient and specific targeted binding o f vector to cell has been achieved in many instances, the level o f actual transduction by such envelope- targeted vectors has generally been too low to be useful. The primary reason for this lack o f efficient transduction appears to be that efficient triggering o f virus-cell fusion requires a specific interaction between the envelope and its receptor, and that this interaction does not readily occur with modified envelopes (167) or with heterologous surface proteins (7). The transcriptional activity o f M LV also exhibits little cell type-specificity. The enhancer and promoter o f retroviruses are located within the U3 region o f the LTR. The MLV U3 region contains both CAAT and TATA boxes and possesses a 75-bp repeat enhancer sequence that is tightly packed with binding sites for a diverse array o f cellular transcription factors. Many o f these factors, such as the glucocorticoid receptor and members o f the NF1 and ETS families, are expressed in a wide variety o f cell types, probably accounting for the promiscuousness o f the LTR. Promoters and enhancers that are active only in certain cell or tissue types have been long known to exist, and such sequences have been widely used both in 59 Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. targeting defective retrovirus vectors, as well as other vectors from other viruses, and in the generation o f transgenic animals with tissue-specific transgene expression. Promoters that are specifically induced by certain disease-specific cellular conditions are also known. These include, for example, the GRP78 (43) and vascular endothelial growth factor (VEGF) (61, 81) promoters, which are induced by the hypoxic conditions that exist within solid tumors. Still other promoters are selective for malignant forms o f certain tissues, such as the promoters o f the alpha-fetoprotein and carcinoembryonic antigen genes. In a defective retrovirus vector, an exogenous promoter can be placed either between the LTRs or within the U3 region o f the LTR, the primary transcriptional control region o f retroviruses. When enhancer or promoter sequences are placed within U3, often a large portion o f the wild type U3 sequence is also removed to eliminate nonspecific transcriptional activity. W hile the internal promoter configuration is in general easier to construct with defective vectors, the U3 insertion avoids problems with expression due to promoter interference (38, 39). To target the RCR vector described in the previous chapters, we selected to utilize transcriptional targeting by substituting sequences in the U3 region with sequences from the prostate-specific promoter o f the rat probasin gene. Expression o f this gene is highly prostate-specific and a short proximal region (-426 to +28) o f the promoter has been used to generate transgenic mice that express transgenes exclusively in prostatic epithelial cells (51, 52). In vitro studies have also demonstrated that although there is no human homolog for this gene, the promoter retains high activity and prostate-specificity in human cells (73, 112). Controlling 60 Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. replication o f the RCR vector using this promoter m ight allow the efficient delivery o f a cytotoxic transgene specifically to prostate cells as a novel treatment for prostate cancer. Prostate cancer is an excellent candidate for targeted gene therapy. Currently, prostate carcinoma has the highest incidence o f any malignancy and is the second leading cause o f cancer death in men in Europe and North America (33). Patients with locally recurrent and metastatic disease have a very poor prognosis and new ways o f treating this disease are needed (110, 130). Additionally, the prostate is a nonessential gland and its complete ablation is not life-threatening. Several animal models o f prostate cancer are also available, including xenograft-based and transgenic mouse models. The present chapter describes the construction and properties o f a series o f RCR vectors targeted with sequences from the probasin promoter for potential use in gene therapy o f prostate cancer. 3.2 Materials and Methods 3.2.1 Cell lines and virus production 293T, LNCaP (clone FGC) and MDA PCa 2b human prostate carcinoma cells, NM U rat mammary carcinoma cells, and HeLa human cervical carcinoma cells were obtained from the American Type Culture Collection. 293T cells were grown in D ulbecco’s modified Eagle's media with 10 % FBS. LNCaP cells were cultivated in RPM I 1640 with 10% FBS. MDA PCa 2B cells were grown in H am ’s F12K m edia with 20% FBS and supplements as described previously. HeLa and NM U cells were grown in minimum essential Eagle medium with 10% fetal bovine 61 Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. serum. Virus stock was produced by transfection o f 293T cells using Lipofectamine Plus (Life Technologies) with the appropriate plasmid. 3.2.2 Construction of plasmids The vectors described in this study were all constructed using plasmid pACE-GFP- dm, which contains a full-length amphotropic RCR vector encoding GFP, with the CMV promoter in place of the 5’ U3 region. To construct pACE-GFP-dm, the CMV promoter was amplified from plasmid pEGFP-Nl (Clontech), and introduced into plasmid pAZE- GFP at the 5’ U3 region by overlap-extension PCR. The resulting plasmid, pACE-GFP, was then subjected to site-directed mutagenesis to remove the Sad site in the pol gene and to introduce a PmeI site in the 3’ U3 region, creating pACE-GFP-dm. The Sad site was removed by introduction of a single silent point mutation and the Pmel site was created by two point mutations. Subsequent analysis showed that these mutations had no detectable effect on in vitro replication of the vector (data not shown). The introduced Pme I and the remaining Sad site in the 3’ U3 region are both unique in pACE-GFP-dm. To create plasmids pACE-GFP-Pr and pACE-GFP-Ar, we used overlap-extension PCR (57) to replace the 3’ U3 sequences in pACE-GFP-dm, from the unique Nhel site to the 5’ border of the R region, with the proximal rat probasin promoter or the synthetic probasin promoter variant ARR2Pb, respectively. Plasmids pACE-GFP-Pt and pACE-GFP- At were constructed by first amplifying the proximal probasin promoter and ARR2Pb from their 5’ termini to the 5’ borders of their TATA boxes with primers that introduce a 5’ terminal Nhel site and a 3’ terminal Sad site. These PCR products were then used to replace a large stretch of the 3’ U3 region of pACE-GFP-dm from the Nhel site to the Sacl site just upstream of the MLV TATA box. Plasmids pACE-GFP-Pc and pACE-GFP-Ac 62 Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. were constructed by replacement of the 3’ U3 region of pACE-emd-dm from the Nhel site to the Pme I site with sequences of the proximal probasin promoter or ARR2Pb PCR amplified from their 5’ ends to the 5’ borders of their CAAT boxes. Luciferase reporter plasmids were generated using plasmid pGL2-basic (Promega). The entire length of each of the hybrid LTRs from the six targeted vectors were amplified from the vector plasmids using a 5’ primer with a Smal site and a 3’ primer with a Mini site. These products were then introduced into the Smal and Mlul sites upstream of the luciferase cDNA of pGL2-Basic. As a control for quality, each reporter plasmid was prepared twice from independent transformations. 3.2.3 Luciferase assays Cells at 70-80% confluence in 6-well plates were transfected with 3 pg of the appropriate luciferase reporter plasmid using Lipofectamine Plus. Parallel cultures were transfected with plasmid pGL2-Control, which contains the luciferase gene under control of the SV40 promoter and enhancer. Each well was cotransfected with 2pg of the p-gal expression plasmid pCHllO (Pharmacia) as a control for transfection efficiency. For cultures subjected to androgen induction, 5-a-dihydrotestosterone (DHT) was added to the media to a concentration of 1 nM 24 hours post-transfection. At 48 hours post-transfection, the cultures were harvested and extracts were prepared using reporter lysis buffer (Promega). Luciferase activities were measured with the Luciferase Assay System (Promega) and an MLX microtiter plate luminometer (Dynex Technologies), p-galactosidase activities were measured with the P-Galactosidase Enzyme Assay System (Promega). 3.2.4 Flow cytometry Flow cytometric analysis was carried out as described in Chapter 1. 63 Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. 3.2.5 Single cycle infection with replicating vectors LNCaP, MDA PCa 2b, HeLa, or NMU cells at 20%-30% confluence in 6-cm dishes were infected with stock virus at a multiplicity of infection (MOI) of 0.05 after estimation of titer by RNA dot blot and comparison to a stock of ACE-GFP of known titer on NIH3T3 cells. All infections were carried out in the presence of 4 pg/ml polybrene. At 3, 8, and 21 days post-infection, the cells were analyzed for GFP expression by flow cytometry. 3.2.6 Titration of vectors 30% confluent LNCaP cultures were exposed to dilutions of vector produced either from 293T transfection or by LNCaP cultures infected 25 days previously. 24 hours after exposure to the vector, medium on the cells was replaced with fresh media containing 50 pM azidothymidine (Sigma). At 48 hours, fresh azidothymidine was added to each culture. At 72 hours, the cells were analyzed by flow cytometry to determine the number of transduced cells. 3.2.7 Multiple cycle infection with replicating vectors LNCaP cells infected with ACE-GFP-Ar, ACE-GFP-At, or ACE-GFP-Ac were passaged until 21 days post-infection, as described above. At this time point, supernatant from the infected cells, diluted 20-fold in culture media, was placed on fresh cultures of LNCaP cells. Four days later the cells were passaged. At seven days post-infection, the cells were analyzed by flow cytometry for GFP expression and the media was diluted 20- fold and used to infect another fresh population of LNCaP cells. This cycle of infection was repeated until the vectors had been serially passaged through 19 fresh cultures. At seven days post-infection for each cycle, cellular genomic DNA was also harvested for use in PCR analysis as described below. 64 Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. 3.2.8 Southern blot analysis Genomic DNA was isolated from infected LNCaP cells using the GenomicPrep kit (Amersham Pharmacia Biotech). DNA was digested to completion separately with Nhel and Sphl and then repurified by ethanol precipitation. 10 pg of each digested sample was fractionated on an agarose gel and blotted onto Zeta-Probe nylon membrane (Bio-Rad) using a Stratagene Posiblot manifold. A pol-env fragment of Moloney MLV was random- prime labeled with [32P]dCTP using the Prime-It II kit (Stratagene) and hybridized to the membrane in Stratagene QuickHyb hybridization buffer. The hybridized blot was visualized using a Storm Phosphorlmager (Molecular Dynamics). 3.2.9 PCR analysis and sequencing The 5’ LTR of vector provirus DNA in infected LNCaP cells was amplified by PCR with an upstream primer that binds the 22 S’-terminal nucleotides of the U3 region and a downstream primer that binds just upstream of gag. PCR SuperMix (Life Technologies) was used for amplification. The amplified products were separated on polyacrylamide gels and the predominant species were extracted by soaking the excised bands in TE. The purified species were directly sequenced using the downstream PCR primer. PCR of cloned, full-length S’ LTRs was carried out by first isolating the full-length LTR species of each ARR2Pb-targeted vector generated by PCR using genomic DNA from infected LNCaP cells and Pfu polymerase. The full-length LTRs were cloned into plasmid pCR4BIunt-TOPO (Invitrogen). PCR amplification of the LTRs using PCR SuperMix was then carried out as above except that the cloned LTRs were used as template in place of genomic DNA. 65 Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. 3.3 Results 3.3.1 Construction of hybrid probasin-MLV LTRs Like the MLV U3, the probasin promoter contains the common CAAT and TATA box sequences. The proximal probasin promoter contains elements that direct prostate- specific transcription, including a 150-bp sequence called the androgen response region (ARR) (Fig. 18A). Within the ARR are two androgen receptor binding sites, which work cooperatively in the induction o f promoter activity by androgens (72). ARR2Pb is a recombinant variant o f the probasin promoter that contains two copies of the ARR and possesses significantly greater strength in the presence of androgen than the wild type promoter and has equal prostate specificity (165). We constructed a series of 6 reporter plasmids in which the luciferase cDNA is under the control of hybrid MLV LTRs in which portions of the U3 region were substituted with sequences from the wild type (wt) probasin promoter or ARR2Pb (Fig. 18B). Hybrid LTRs Pr and Ar contain the wt probasin promoter and ARR2Pb, respectively, with their transcription start sites fused to the LTR precisely at the 5’ border of the R region. LTRs Pt and At contain the wt probasin promoter and ARR2Pb, respectively, from their 5’ ends to the 5’ end of their TATA boxes, fused to the MLV TATA box. LTRs Pc and Ac contain the wt probasin promoter and ARR2Pb, respectively, from their 5’ ends to the 5’ end of their CAAT boxes, fused to the MLV CAAT box. Each o f these LTRs was designed such that transcription is initiated at the 5’ border of the R region, as occurs in transcription from the wt MLV LTR. 66 Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. A. B. Pr [ P t [ Pc [ TATA CCAAT M L V L T R Proximal probasin promoter ARR2Pb TSS Nhe I CCAAT TATA Z Z Z Z Z Z 1 TATA 564 bp too 567 bp CCAAT t o n 597 bp CCAAT TATA c. A, £ A. i TATA CCAAT jjJQI 632 bp 635 bp 665 bp D. Probasin TSS MLV Pr and Ar ...AAGCTACTCTGCACGCGCCAGTCCTCCG. , Probasin n MLV Pt and At ...CAATCATCCTGAAAGAGCTCAATAAAAG... Probasin MLV PC and Ac ...G GATGCAAG ACAATAAACTAACCAATCA... Fig. 18 Construction of prostate-targeted hybrid LTRs. (A) Sequences used in generating hybrid LTRs. The wild-type MLV LTR (top) comprises the U3, R, and U5 regions. The transcriptional control sequences of MLV are located primarily in the U3 region, which contains canonical CAAT and TATA box sequences. The proximal rat probasin promoter (middle) also contains CAAT and TATA box homologies and an androgen-responsive region (ARR), shown here as a hatched box, which is responsible for induction by androgens. ARR2Pb (bottom) is a synthetic promoter derived from the proximal rat probasin promoter and contains two copies of the ARR. (B) Hybrid probasin-MLV LTRs containing the wild-type probasin promoter. LTRs Pr, Pt, and Pc contain probasin promoter sequences from position -383 to the transcription start site (TSS), the TATA box, or the CAAT box, respectively. (C) Hybrid probasin-MLV LTRs containing ARR2Pb. LTRs Ar, At, and Ac contain ARR2Pb sequences from the 5' end o f the upstream ARR to the transcription start site, the TATA box, or the CAAT box, respectively. In each of the 6 hybrid LTRs, MLV U3 sequences from the Miel site to the CAAT box, TATA box, or TSS are replaced with the corresponding probasin or ARR2Pb sequences. (D) Sequence details of the hybrid LTRs. Shown are the nucleotide sequences at the 3' borders between probasin and MLV sequences in the hybrid LTRs. TATA and CAAT boxes are underlined. 67 Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. 3.3.2 Transcriptional activity of hybrid LTRs in prostate and non-prostate cells LNCaP and MDA PCa 2b prostate carcinoma, HeLa cervical carcinoma, and NMU mammary carcinoma cells were transfected with the reporter plasmids containing the wt probasin promoter-targeted LTRs to assess the transcriptional activity and specificity of the LTRs (Fig. 19). A reporter plasmid containing the luciferase cDNA under the control of the promiscuous SV40 promoter was used in control transfections. Transfections were carried out both in the presence and absence of androgen to determine if the promoter retains androgen inducibility in the context of the LTR. In LNCaP cells, the three hybrid LTRs exhibited similar activity (Fig. 19B). In the absence of androgen, the LTRs had transcriptional strength similar to that of the SV40 promoter. Upon androgen induction, LTR activity increased 2-3 fold, while SV40 promoter activity remained unchanged. A previous study examining the proximal probasin promoter in LNCaP cells showed a stronger induction (~ 15-fold) of the promoter by androgens (165). A possible explanation for the difference is that the previous study used the synthetic androgen R1881 at a concentration of 10 nM, while we used DHT at 1 nM. In MDA PCa 2b cells, the wt probasin promoter-targeted LTRs showed somewhat lower strength than the SV40 promoter and no significant induction by androgen (Fig. 19C). This absence of androgen induction is explainable by the fact that these cells contain a doubly-mutated androgen receptor that displays androgen binding and responsiveness greatly reduced compared to wt receptor (166). In the two non-prostate cell lines, the activity of the hybrid LTRs was vastly lower than that of the SV40 promoter, both in presence and absence of androgen (Fig. 19D and E). Of the three LTRs, Pt displayed the lowest level of activity in these cells. These results demonstrate that the probasin promoter retains its prostate 68 Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. A. _ | luciferase Pr Q2ZZ3 TATA Pt 1 CAAT Pc 1 r/A V /j 1 t s K ZJIh B B SV40 | SV40 promoter/enhancer “ K ^ fpoiyA \— B . 3 _ i cc 40 30 20 10 0 LNCaP & ^ ^ & & <i° ^ without D H T w ith D H T D. HeLa 3 _ l cr 400 300 200 100 0 3s < ? " ^ ^ ^ ,________ C. 3 — I 0£ 80 60 40 20 0 E. 300 250 _j 200 K 150 100 50 0 MDA PCa 2b without D H T w ith D H T NM U without D H T w ith D H T without DH T w ith D H T Fig. 19 Cell type-specificity and androgen-inducibility of hybrid wt probasin-LTRs. (A) The hybrid LTRs were cloned upstream of the luciferase gene in plasmid pGL2 and transfected into prostate and non-prostate cell lines. Cell extracts were prepared and assayed for luciferase activity 48 hours post-transfection. Results from transfection o f LNCaP (B), MDA PCa 2b (C), HeLa (D), and NMU (E) cells are shown. Androgen inductions were carried out with 1 nM DHT. Relative light unit (RLU) values were normalized to promoterless luciferase control vector and were obtained from at least three independent experiments. Error bars indicate standard deviations. 6 9 Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. specificity and androgen inducibility within the context of the MLV LTR. Additionally, the 55-bp sequence between probasin’s TATA box and nucleotide +28, which is included in the constructs targeting transgene expression to prostate in the aforementioned transgenic animals, appears from our results to be dispensable for prostate-specific expression in vitro. The same cell lines were also transfected with the reporter plasmids containing the ARR2Pb-targeted LTRs. In LNCaP cells in the absence of androgen, these hybrid LTRs exhibited similar strength to the wt probasin promoter-containing LTRs and to the SV40 promoter (Fig. 20B). In contrast, in the presence of androgen, transcriptional activity was induced by roughly 1000-fold. The significantly greater activities o f the ARR2Pb-targeted LTRs over the wt probasin LTRs in the presence of androgen are consistent with earlier work comparing the two promoters (165). The ARR2Pb LTRs were also significantly more potent in MDA PCa 2b cells than the wt probasin promoter LTRs (Fig. 20C). Androgen induction of the LTRs in these cells was again negligible. In the non-prostate cell lines, the ARR2Pb LTRs exhibited only very low levels of activity, and were, surprisingly, even weaker in these cells than the wt probasin LTRs (Fig. 20D and E). Despite small differences, the three general hybrid LTR designs - in which the probasin and MLV promoters were fused at the transcription start site, TATA box, or CAAT box - exhibited similar transcriptional strength in prostate-derived cells. In terms of specificity for prostate cells these different designs were also very similar, although the CAAT box fusion design exhibited slightly higher levels of expression in the non-prostate cells than the other two designs. This is probably because of the larger region of the native U3 sequence retained in this design. 70 Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. A. h s s u : luciferase Ar At t s s s s s i I J W U " K ^ -l poiyA ~ — TATA CAAT Ac | e SV40 SV40 promoter/enhancer LNCaP 100000 10000 1000 - 100 - y S > v £ > ^ ^ without D H T C. MDA PCa 2b 300 250 200 150 100 50 0 w ith D H T without D H T w ith D H T D. 400 300 3 £ 200 100 0 HeLa E. 3 _ J o c NMU without D HT w ith D H T 300 250 200 150 100 50 0 without D H T w ith D H T Fig. 20 Cell type-specificity and androgen-inducibility of hybrid ARR2Pb-LTRs. (A) The hybrid LTRs were cloned upstream of the luciferase gene of plasmid pGL2 and transfected into prostate and non-prostate cell lines. Cell extracts were prepared and assayed for luciferase activity 48 hours post-transfection. Results from transfection of LNCaP (B), MDA PCa 2b (C), HeLa (D), and NMU (E) cells are shown. Androgen inductions were carried out with 1 nM DHT. RLU values were normalized to promoterless luciferase control vector and were obtained from at least three independent experiments. Error bars indicate standard deviations. 71 Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. 3.3.3 Construction of replicating vectors containing hybrid LTRs To assess the ability of the hybrid LTRs to function within a replicating MLV and to impart prostate cell-specific replication, we replaced the LTR in an amphotropic, GFP- encoding RCR vector with each of these LTRs (Fig. 21). The hybrid LTRs were introduced into the 3’ LTR position as this copy of the LTR is used to template formation of both the 5’ and 3’ LTRs during reverse transcription. The vector plasmid we used to construct the targeted vectors, pACE-GFP, also contained the CMV promoter in place of the 5’ U3 region. In pilot studies, we found that if the 5’ LTR of the plasmid contains the wt U3, the 5’ LTR in the plasmid can recombine with other plasmid molecules at the 3’ LTR to reconstitute an RCR vector with wt LTRs at both termini (data not shown). Such an event results in contamination of the targeted vector with untargeted vector. Replacement of the 5’ U3 with the CMV promoter prevented this from occurring (data not shown). 3.3.4 Replication of targeted vectors in prostate and non-prostate cells Stocks of the targeted vectors and the untargeted control vector were generated by transient transfection of 293T cells. We analyzed the stocks by RNA dot blot to determine levels of vector for each by comparison to a stock of known titer (data not shown). LNCaP, MDA PCa 2b, HeLa, and NMU cultures were inoculated with the wt probasin vectors at an MOI of 0.05 and vector replication was followed by flow cytometric analysis of the cultures at 3, 8, and 21 days post-infection. Although no exogenous androgen was added to these cultures, all media used during infections was made with untreated serum, and thus contained endogenous androgen. In LNCaP cells, while vector ACE-GFP-Pr did not replicate beyond an initial low level of transduction, ACE-GFP-Pt and ACE-GFP-Pc were capable of replication (Fig. 72 Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. CMV "BB -T gag pol IRES GFP env TS! pACE-GFP-Pr TATA pACE-GFP-Pt [ pACE-GFP-Pc [ pACE-GFP-Ar E e z z z z j jDD CAAT TSS T A T A pACE-GFP-At § pACE-GFP-Ac § CAAT 'M b b Fig. 21 Probasin promoter-targeted vectors. These vectors were constructed by replacement of the 3' wild type LTR of pACE-GFP with the probasin promoter- MLV hybrid LTRs. Shown are the names of the corresponding plasmids, each of which contain the CMV promoter in place of the 5' U3 region. 73 Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. A. 100 V. 80 60 0) o O = ,*_T3 O £ § 5 « 40 20 Day 8 21 8 21 8 21 ACE-GFP ACE-GFP-Pr ACE-GFP-Pt ACE-GFP-Pc B. 100 r 2 * 8 80 o 60 O g g s g 40 20 Day 8 21 ACE-GFP ACE-GFP-Pr ACE-GFP-Pt ACE-GFP-Pc Fig. 22 Replication of wild-type probasin promoter-targeted vectors in prostate carcinoma cells. GFP expression in infected cells was determined by flow cytometric analysis on the indicated days post-infection. Results from infection of LNCaP (A) and MDA PCa 2b cells (B) are shown. Cells were grown in non-stripped serum and no exogenous androgen was added. The vertical axis represents cell number and the horizontal axis represents fluorescence intensity. 74 Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. 22A). The two latter vectors spread with kinetics that were significantly delayed in comparison to the untargeted vector ACE-GFP, reaching fewer than 50% of the cells after three weeks. ACE-GFP-Pt and ACE-GFP-Pc also replicated in MDA PCa 2b cells, although spread occurred only very slowly, each vector transducing approximately 10% of the cells at 3 weeks post-infection (Fig. 22B). ACE-GFP-Pr again showed no evidence of spread in MDA PCa 2b cells. In the non-prostate cell lines, neither ACE-GFP-Pr nor ACE- GFP-Pt showed any sign of replication (Fig. 23). ACE-GFP-Pc, however, appeared to have spread at a very low level in these cells, consistent with the higher non-specific transcriptional activity of the Pc LTR. The same cell lines were also infected with the three vectors targeted by ARR2Pb (Fig. 24). This promoter appeared to be able to support much more efficient vector replication than the wt probasin promoter. In LNCaP cells, ACE-GFP-At and ACE-GFP- Ac replicated with efficiency only moderately lower than the untargeted vector containing the wt LTR (Fig 24A). Infections with ACE-GFP-Ar, however, resulted in much slower transmission of the GFP transgene in these cells. MDA PCa 2b cells supported similar but slightly overall lower levels of replication of the three targeted vectors (Fig 24B), with ACE-GFP-Ar again appearing to replicate much more slowly than the other two viruses. Despite the greatly improved replication kinetics of these vectors in prostate cells in comparison to the wt probasin promoter-targeted vectors, no increase in replication in the non-prostate cell lines was observed (Fig. 25). Like ACE-GFP-Pc, the other vector employing the CAAT box fusion design, ACE-GFP-Ac exhibited very low levels of replication in the non-prostate cells. 75 Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. A. 100 «?■§ 80 a ju £ - 0 60 gSgJ 40 20 Day 8 21 8 21 8 21 8 21 ACE-GFP ACE-GFP-Pr ACE-GFP-Pt ACE-GFP-Pc B. 100 2 3 80 ■ 5 5 o 60 o « 40 20 Day 8 21 ACE-GFP ACE-GFP-Pr ACE-GFP-R ACE-GFP-Pc Fig. 23 Replication of wild-type probasin promoter-targeted vectors in non-prostate cells. GFP expression in infected cells was determined by flow cytometric analysis on the indicated days post-infection. Results from infection of HeLa (A) and NMU cells (B) are shown. Cells were grown in non-stripped serum and no exogenous androgen was added. The vertical axis represents cell number and the horizontal axis represents fluorescence intensity. 76 Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. A. 100 £ * 8 80 0) o »■§ 60 o g gs 2 40 20 8 21 3 8 21 3 8 21 3 8 21 ACE-GFP ACE-GFP-Ar ACE-GFP-At ACE-GFP-Ac B. 100 C O 'S 80 = ® 0) O o = » j_ T 3 O £ ^ 2 40 60 20 Day 8 21 8 21 8 21 8 21 ACE-GFP ACE-GFP-Ar ACE-GFP-At ACE-GFP-Ac Fig. 24 Replication of ARR2Pb-targeted vectors in prostate carcinoma cells. GFP expression in infected cells was determined by flow cytometric analysis on the indicated days post-infection. Results from infection of LNCaP (A) and MDA PCa 2b cells (B) are shown. Cells were grown in non-stripped serum and no exogenous androgen was added. The vertical axis represents cell number and the horizontal axis represents fluorescence intensity. 7 7 Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. A. 1 0 0 r 80 Q ) o «■§ 601 - o » gStO 40 - 8 21 ACE-GFP ACE-GFP-Pr ACE-GFP-Pt ACE-GFP-Pc B. 100 r £ 3 80^ 0 o «■§ 601 - o « 2 8 21 to 40 - ACE-GFP ACE-GFP-Pr ACE-GFP-Pt ACE-GFP-Pc Fig. 25 Replication of ARR2Pb-targeted vectors in non-prostate cells. GFP expression in infected cells was determined by flow cytometric analysis on the indicated days post infection. Results from infection of HeLa cells (A) and NMU cells (B) are shown. Cells were grown in non-stripped serum and no exogenous androgen was added. The vertical axis represents cell number and the horizontal axis represents fluorescence intensity. 78 Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. We titered ARR2Pb-targeted vectors by transduction of LNCaP cells. We determined the titers of vectors produced by transfection of 293T cells as well as those produced by chronically-infected LNCaP cells (Table 1). All three targeted vectors were produced at similar titers by transfection of 293T cells, from 3.2-3.7 * 104 GFP-transducing units per ml, while untargeted vector was produced by transfection at titers somewhat more than twice as high. LNCaP cultures that had been infected for 30 days and had reached maximal transduction levels produced virus at significantly lower titers than did transfection. The titers for ACE-GFP-At, ACE-GFP-Ac, and ACE-GFP replicating on LNCaP cells were 5-9 times lower than the corresponding titers from 293T transfection. ACE-GFP-Ar, by contrast, was produced by infected LNCaP cells at only approximately 300 transducing units per ml - roughly 20-fold lower than the other ARR2Pb-targeted vectors, consistent with the poor replication efficiency of this vector relative to the other two. 3.3.5 Southern blot analysis of DNA from LNCaP cells infected with ARR2Pb- targeted vectors To confirm that the ARR2Pb vectors did not undergo deletion during infection of LNCaP cells, we analyzed integrated proviral DNA from infected LNCaP cells by Southern hybridization. As shown in Figure 26, for each of the vectors, bands only of the expected sizes for full length provirus were obtained, demonstrating that the GFP transgene had been transmitted as part of the intact vectors and that no apparent large-scale deletions or rearrangements occurred in the vectors during a single infection cycle. 79 Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. «■ *» «mp mum mmm -5 5 5 5 bp m m -3971 bp Nhe I ACE-G FP: 5555 bp ACE-GFP-Ar 5593 bp 'ACE-GFP-At: 5596 bp' ACE-G FP-Ac: 5626 bp Sph I v /w LT R HI g ag pol 3971 bp H Nhe\ L env |lRESGFPf- LTR VA/V probe Fig. 26 Southern blot analysis of genomic DNA from LNCaP cells infected with ARR2Pb-targeted vectors. Each DNA sample was digested with Nhel and Sphl, separated on an agarose gel and blotted onto nylon membrane. The membrane was hybridized to a radiolabeled pol-env fragment of MLV. Mock: DNA from mock-infected cells. Control: iV/tel/SpM-digested pAZE-GFP plasmid with DNA from mock-infected cells. A schematic diagram of integrated vector provirus indicating size of restriction fragments for each vector and location of probe is shown. 81 Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. 3.3.6 Transmission of GFP transgene through multiple cycle infections of LNCaP cells with ARR2Pb-targeted vectors Results presented in Chapter 1 demonstrate that the untargeted vectors undergo deletion of the IRES-GFP insert, reflected in the progressive reduction in the percentage of cells expressing GFP during serial passage of the vectors. To determine the stability o f the introduced sequences in the ARR2Pb-targeted vectors during prolonged replication in LNCaP cells we again conducted a series of serial infections in these cells, examining GFP expression and extracting genomic DNA following each infection cycle. The experimental procedure is depicted in Fig. 27A. Figure 28 shows the percentage of cells from each infection cycle, at 7 days post infection, for all three targeted vectors and the untargeted parental vector ACE-GFP. In the serial infections with untargeted vector, the percentage of cells expressing GFP by day 7 post-inoculation remained around 80% for the first 9 cycles, and then decreased progressively thereafter so that by cycle 17 only 2% of the cells expressed the transgene (Fig. 28A). Further cultivation of these cells did not result in a significant increase in the percentage transduced, suggesting that the drop in transduction was the result of deletion of the transgene from the vector. ACE-GFP-Ar and ACE-GFP-At both lasted for a greater number of passages than the untargeted vector, and transduced a smaller percentage of cells at each cycle (Figs 28B and C). ACE-GFP-Ar replication, however, exhibited an initial lag, whereby replication efficiently appeared to greatly improve upon the third infection cycle. Surprisingly, ACE-GFP-Ac appeared to lose the IRES-GFP insert much earlier than the other vectors (Fig. 28D). As early as passage 5, the percentage of transduced cells began to 82 Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. A. Infection 1 Infection 2 (20x dilution) Infection 3 (20x dilution) repeat Day 21 FA C S analysis, D N A extraction FA C S analysis, D N A extraction Day 7 FACS analysis, DNA extraction B. w v LTR H gag \ PCR and gel extraction [ h H- pol env IRESGFF Pj- LTR u w \ Sequencing with 3' primer LTR f— Fig. 27 Analysis of genetic stability of ARR2Pb-targeted vectors over extended replication. (A) Procedure for serial passage of vectors. The serial infections were initiated by exposing LNCaP cells to vector at an MOI of 0.05 followed by 21 days of cultivation. Fresh cultures were then infected with a 20-fold dilution of superatant from these cells. Each subsequent infection cycle was carried out by infection of a fresh population of LNCaP cells with 20- fold dilution o f the supernatant from the previous infection. (B) Genomic DNA isolated from infected LNCaP cells was used as template in PCR amplification of the 5' LTR. The upstream primer binds to the 5' terminus of the U3 region and the downstream primer binds within the packaging signal. Amplification therefore did not distinguish between the wild type and modified forms of the LTR. The resulting PCR products were separated on agarose gels and the predominant species were extracted and sequenced using the downstream primer. 83 Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. A. o. 100 80 0 o > ( O ( / ) S Q. X 0 ) < / ) B. C. o C T ) D. o o > 60 40 20 0 ACE-GFP 0. 100 80 i n i n £ Q . X < u JO I 60 40 20 0 0. 100 80 to to £ Q. X a > JO 3 60 40 20 0 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 Infection number a. 100 ACE-GFP-Ar 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 Infection number ACE-GFP-At 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 Infection number ACE-GFP-Ac 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 Infection number Fig. 28 GFP expression in LNCaP cultures serially infected with vectors targeted by ARR2Pb. Infection number 2 in each series was initiated with a 20-fold dilution of supernatant from infections shown in Fig. 24A, using supernatant from 21 days post infection. Each subsequent infection was also carried out with a 20-fold dilution of supernatant from the previous infection. Flow cytometric analysis was performed at 7-days post-inoculation for each infection cycle. Shown are the percentage o f GFP- expressing cells in each culture infected with (A) ACE-GFP, (B) ACE-GFP-Ar, (C) ACE-GFP-At, and (D) ACE-GFP-Ac at 7 days post-inoculation. 84 Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. decrease. Further cultivation o f cells from passage 6 or later resulted in only very small increases in the number of transduced cells, again indicating deletion of the transgene. 3.3.7 Stability of hybrid LTRs through multiple infection cycles An additional concern of ours was whether or not the hybrid LTRs would remain intact during serial passage. If the vectors were to lose the ARR2Pb sequences through, for example, recombination with endogenous sequences within the host cell genome, vector specificity for prostate cells might be lost. Such an event could represent a risk to any patient treated with a transcriptionally targeted RCR vector. We therefore analyzed genomic DNA extracted from cells infected during serial passage of the vectors to look for any changes in LTR structure. The genomic DNA was used in PCR amplification of the 5’ LTR, followed by sequencing of the resulting products, as outlined in Fig. 27B. PCR on DNA from cells infected during the first passage of ACE-GFP-Ar resulted in a band of approximately the expected size (718 bp) for the intact hybrid LTR, as well as a band that was 200 bp smaller (Fig. 29A). In the second infection, these species were supplanted by three others, all larger than the first two, suggesting that the LTR had undergone recombination during the first two infection cycles. This may explain the apparent jump in replication efficiency observed between the second and third infection cycles with this virus (Fig. 28B). By the seventh infection cycle, the largest of these three variant LTR species had diminished to an undetectable level and another smaller band of approximately 710-bp had appeared. Thereafter, no other visible changes in the size o f the amplified products occurred and the relative levels o f each band remained essentially unchanged. 85 Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. A. Infection # Infection # M 1 2 3 4 5 6 7 N M 8 9 10 1 1 12 13 14 15 16 17 18 19 M 1000 bp- 500 bp- B. Species A (632 bp L T R ) intact L T R § TSS ZJ9B Species B (426 bp L T R ) L T R missing one ■ copy of ARR r ™ TSS JDB Species C (932 bp L T R ) Insertion of C M V prom oter in to L T R between ARR2Pb E _ and TSS. CMV TSS l Z D B ARR2Pb AC A A C TG C C A A C TG G G A T.. • • • • • • • ,.TA AA C TG C C • • • • • C A C T T G G C A ... CMV Species D (821 bp L T R ) Deletion of 1 1 1 bp from variant C by recom bination between sequences in ARR2Pb 5’ ARR2Pb . . . a g c c c a c I a a a t a a a a a t a . , . . c t g t g t a I c a a c t g c c c a c . , 3' ARR2Pb T S S a m i a ... a g c c c a c Ia a a C M V HB .. . c t g t g t a |c 1 a Species E (726 bp L T R ) D eletion of 206 b p from variant C by homologous recom bination between ARRs. TSS CMV Fig. 29 PCR and sequence analysis of 5' LTR of ACE-GFP-Ar through 19 serial infection cycles. Genomic DNA from infected LNCaP cells was used in PCR amplification of the 5' LTR from integrated vector. Sequencing of products from select infection cycles was carried out after gel purification. (A) Results of PCR. Arrowheads indicate PCR products that were sequenced. M: 100-bp marker. N: PCR reaction on DNA from mock-infected cells. (B) Structure of LTRs corresponding to the PCR bands labeled in (A), as determined by sequencing. To the right of the schematic diagrams of LTR variants C and D are the sequences at the 5' (upper) and 3' (lower) regions between which recombination occurred to generate the variants. Black circles represent positions o f sequence identity between aligned sequences. Boxed region indicates 7-nucleotide stretch in which recombination occurred between ARR2Pb and CMV promoter to generate variant C. Bent line indicates recombination point between two regions within ARR2Pb to generate variant D. The -710- bp band that appeared around infection number 6 in (A) was not sequenced. 86 Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. Sequence analysis demonstrated that the large band from passage 1 in fact represented the intact LTR (Fig. 29B). The lower band, however, was missing all ARR2Pb sequences upstream of the 3’ ARR. Homologous recombination appeared to have occurred between the two copies of the ARR to produce this variant. The three larger species that arose in the second vector passage, surprisingly, each contained a large stretch o f the CMV promoter between ARR2Pb sequence upstream and the R region downstream. As these species contain the same sequence at the CMV-R region junction as the 5’ LTR of the vector plasmid, and the CMV sequence was not expected to occur in the vector RNA genome or in either the 293T or NIH3T3 genomes, it is highly likely that these variants arose as a result of plasmid recombination during transfection, as discussed below. Alignment of the ARR2Pb and CMV sequences around the region at which their recombination occurred revealed the presence of a short region of sequence homology between the two at the site of recombination. This homology, which consists of a match of 12 out of 14 nucleotides, presumably facilitated the recombination event. The smallest of the three variants containing CMV promoter sequence, Species E, appears to have arisen from the largest, Species C, as it is identical except that again the ARR2Pb sequences upstream of the 3’ ARR had been deleted. Species C, therefore, also appeared to have undergone recombination between its two ARRs. Species C also seems to have been the precursor to Species D, which is identical except that it lacks an approximately 100-bp internal segment of ARR2Pb. The structure of the LTRs of the other two ARR2Pb-targeted vectors, ACE-GFP-At and ACE-GFP-Ac, were more stable during vector passage. In the analysis o f DNA from ACE-GFP-At infections, only two species of LTR were observed (Fig. 30A). One of these 8 7 Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. Infection # M 1 2 3 4 5 6 7 N M TATA 1000 bp 500 bp intact hybrid L T R hybrid L T R missing ARR2Pb sequences upstream of 3' ARR Infection # M 8 9 10 1 1 12 13 14 15 16 17 18 19 N M 1000 bp. 500 bp. B. Infection # M 1 2 3 4 5 6 7 N M 1000 bp- 500 bpJ CAAT CAAT Q Q intact hybrid L T R hybrid L T R missing ARR2Pb sequences upstream of 3' ARR Infection # 1000 bp- 500 bp- Fig. 30 PCR and sequence analysis of 5' LTRs of ACE-GFP-At and ACE-GFP-Ac through 19 serial infection cycles. Genomic DNA isolated from each infected LNCaP culture was used as template in PCR amplification of the 5' LTR from integrated vector. Sequencing of the predominant products from selected infection numbers was carried out after gel purification. (A) Results using DNA from ACE-GFP-At infections. (B) Results using DNA from ACE-GFP-Ac infections. To the right of the gels are schematic depictions of the structures of the LTRs amplified as determined by sequencing. M: 100-bp marker. N: PCR reaction on DNA from mock-infected cells. The middle band that appeared around infection 12 with ACE-GFP-Ac was not sequenced. 88 Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. corresponded to the intact hybrid LTR. The other represented a variant which again contained a ~200-bp deletion of the ARR2Pb sequence upstream of the 3’ ARR. Similar results were obtained from amplification of DNA from ACE-GFP-Ac infections, except that a third variant appeared around infection cycle 12 (Fig. 30B). Although this variant was not sequenced, it most likely arose by recombination o f the intact LTR, as it appeared only very late in the infection series. A possible explanation for the 200-bp deletion of ARR2Pb sequence that we observed in all three vectors is that the deletions did not occur during vector replication, but rather were generated by the PCR reaction itself. Since the hybrid LTRs contain two copies of the ARR sequence, prematurely terminated amplification products in which polymerization ended within one ARR could prime extension at the other ARR during subsequent amplification cycles. In theory, this would also result in products containing three or more ARRs in addition to products containing a single ARR. Since shorter products are more efficiently amplified in PCR, this might be the reason such longer variants were not observed as well as why the deleted variant appeared in spite o f the initially much larger number of template molecules containing the intact LTR with 2 ARRs. To ascertain whether these variants might merely be artifacts of the PCR, we cloned the bands corresponding to each of the intact LTRs into plasmids and verified their integrity by sequencing. The plasmids were then used as template in PCR using the same primer set and conditions as before (Fig. 31 A). Amplification using each of these plasmids did in fact result in the same 200-bp deletion in each of the three LTRs (Fig. 3 IB), implicating PCR as the source of this deletion. Although there is still the possibility that these deletions also occurred during vector replication, vector containing LTRs with a single ARR would not be 89 Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. A. PCR amplify 5' LTR from - genomic DNA of infected cells Extract PCR products corresponding to full-length LTRs from gel Clone into pCR4Blunt- TOPO Repeat PCR L T R used as template M Ar At Ac m Fig. 31 Deletion of one copy of the ARR from ACE-GFP-Ar, -At, and -Ac during PCR amplification. (A) Experimental procedure. 5' LTRs were amplified by PCR from genomic DNA o f infected cells. The resulting products were resolved by electrophoresis and the intact, full-length LTR from each vector was gel extracted and cloned into plasmid pCRBlunt-TOPO. The cloned LTRs were then used as template in PCR using the same primers and conditions as before. (B) PCR using cloned full- length LTRs as template results in the appearance of the full-length LTR as well as the deleted form. Lane labeled neg contains reaction using unmodified pCR-Blunt-TOPO. 9 0 Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. expected to replicate nearly as efficiently as those with two copies. A previous study has shown that removal of one copy of the ARR from ARR2Pb results in a promoter with greatly reduced transcriptional activity (165). The results of this earlier work and our results with hybrid LTRs containing the wild-type probasin promoter suggest that the loss of one ARR from the ARR2Pb vectors would result in vectors incapable of effectively competing with intact vector. Consequently, even if the 200-bp deletion did occur during vector passage, vectors with the deletion would be expected to be rapidly outgrown by the intact vector, not ever coming to represent any more than a transient and extremely small fraction of the replicating vector population. 3.3.8 Prostate-targeted cell killing with vector carrying suicide gene To test if the observed replicative specificity of the vectors targeted by ARR2Pb could be translated into prostate cell-specific killing, we replaced the GFP transgene in ACE-GFP-At with the gene encoding E. coli purine nucleoside phosphorylase (PNP), producing ACE-PNP-At. An untargeted vector containing the PNP gene, ACE-PNP, was also constructed. PNP converts the nontoxic prodrug 6-methylpurine deoxyriboside (MPDR) into the highly cytotoxic 6-methylpurine. Presumably, administration of MPDR after infection with ACE-PNP-At would result in the killing of cells derived from prostate but not those derived from other tissues. We chose to utilize ACE-GFP-At as a backbone to construct the new vector because, of all the targeted vectors examined in this study, this one exhibits the best combination of efficient replication and specificity for prostate cells. LNCaP, HeLa, and NMU cells were infected with ACE-PNP-At, ACE-PNP, or ACE-GFP and propagated for two weeks to allow virus spread. We then exposed the infected cultures to either 10 or 80 pM MPDR and cultivated the cells for an additional 2 91 Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. days. The wells were subsequently stained to visualize remaining viable cells. Figure 32 shows that LNCaP cells infected with either the targeted or untargeted PNP-encoding vectors were efficiently killed upon exposure to MPDR. A small number of apparently viable ACE-PNP-At-infected cells remained after exposure to the lower concentration of prodrug. Uninfected and ACE-GFP-infected LNCaP cells were not affected by the MPDR. Exposure of HeLa and NMU cultures to MPDR, on the other hand, resulted in widespread cytotoxicity only in those cultures infected with ACE-PNP. Some nonspecific cytotoxicity occurred in all HeLa and NMU cultures exposed to the higher concentration of MPDR. All HeLa and NMU cultures infected with ACE-PNP-At, however, showed the same level of cytotoxicity as those that were uninfected or infected with ACE-GFP. These results demonstrate that ACE-PNP-At, in conjunction with MPDR, can kill cells in a cell type- specific manner. 3.4 Discussion Viral vectors whose replication is confined to particular cell types should provide a valuable addition to the tools available for use in cancer gene therapy. Several recent attempts to transcriptionally target defective retrovirus vectors to specific cell types have m et with success (34, 41, 49, 62, 63, 87, 168). However, defective retrovirus vectors are generally not capable o f high-level transduction in vivo, even when high titer preparations o f the more efficient untargeted forms are used. In Chapter 2 we described the use o f a nondefective retrovirus vector for the transduction o f solid tumors, demonstrating that such a vector is capable o f transmitting a transgene in vivo with efficiency not achievable using defective 92 Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. * LNCaP cells i # 10 |i.M MPDR 80 pM MPDR no drug HeLa cells ?"BHE«o«a 10 pM MPDR 80 pM MPDR no drug NMU cells 10 pM MPDR 80 pM MPDR no drug Fig. 32 In vitro cell killing by ARR2Pb-targeted and untargeted vector encoding PNP. LNCaP, HeLa and NMU cells were infected with ACE-PNP, ACE-PNP-At, or ACE-GFP and grown for 10 days, with splitting every 3 days, to allow vector spread. On day 10, with the cells at approximately 30% confluency, the media was replaced with fresh media containing the indicated concentrations o f 6-MPDR. On day 12, the wells were stained with giemsa to visualize remaining viable cells. 9 3 Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. retroviral vectors. In the present chapter we demonstrate that transcriptional targeting can be applied to an RCR vector to combine high efficiency with highly specific targeting o f particular cell types. Although transcriptionally-targeted RCR vectors have not been previously described, a replication-competent MLV containing sequences from the mouse transthyretin promoter in place o f the U3 enhancer repeats has been constructed and characterized by Feuer and Fan (42). This promoter had been shown earlier to exhibit specificity for cells o f the liver and choroid plexus and was thus introduced into the LTR as a means to target viral replication to these cells. This resulting virus, however, actually possessed a broadened tropism in mice, replicating in brain and liver as well as every other tissue that wild-type MLV replicated in. This is m ost likely at least in part due to the fact that a large portion o f transcriptionally active U3 sequence was not removed during construction o f the virus (50). W e chose to incorporate the prostate-specific probasin promoter into the U3 region o f the vector for three main reasons. First, as discussed in the previous chapter, there are very few other regions o f the MLV genome into which a foreign sequence could be inserted without disturbing virus function. One possible approach would be to replace the IRES with the foreign promoter, but this would result in a vector with targeted transgene expression but untargeted viral replication, as the M LV LTR would still control transcription o f genomic RNA and expression o f the viral proteins. Second, transcription o f the viral genome m ust initiate at the 5 ’ R region. This necessitates having a promoter within U3. Third, the use o f more 9 4 Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. than one promoter in a retrovirus vector often results in promoter interference, whereby one promoter suppresses transcription from the other (38, 39). O ur results help to define how a transcriptionally targeted M LV-based RCR vector can be optimally constructed. First, we have shown that the 380-bp region between the 36th nucleotide o f U3 and the TATA box can be replaced with sequences from a heterologous promoter without significantly reducing the vector’s replicative ability. The sequence contained within this region therefore does not, at least in vitro, appear to play an important role in viral replication other than providing transcriptional regulation. Inclusion o f any o f part o f this 380-bp region in a transcriptionally-targeted vector appears to be unnecessary and would likely only serve to increase non-specific transcription, as we observed with the vectors and LTRs constructed using the CAAT box fusion design. It is notable that replication o f both o f the vectors in which the targeting promoter was fused at the LTR’s transcriptional start site were greatly impaired relative to the vectors having the CAAT or TATA box fusion designs. Given that the LTRs o f all three designs exhibited very similar transcriptional strength in prostate cells, these results imply that the 30-bp wt U3 sequence between the 5’ end o f the TATA box and the 5’ end o f the R region is involved in some stage o f viral replication other than transcription. In human immunodeficiency virus (HTV), the sequence o f U3 downstream o f the TATA box has been shown to play a role in 3’- end formation (45, 148), binding cleavage and polyadenylation specificity factor (CPSF), which recognizes the AAUAAA core polyadenylation signal (46). It has been proposed that the corresponding region o f M LV m ay also play some role in 95 Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. 3’-end formation, through a hairpin loop formed in the viral RN A at the U3-R border (Fig. 33A) (1 1), but this issue has not been formally investigated. Analysis o f the sequences o f C-type retroviruses distantly related to M LV reveals the presence o f very sim ilar structures at the same location, despite extensive differences in nucleotide sequence (Fig. 34). The apparent conservation o f this structure suggests that it may indeed play some role in replication o f type C viruses. The vectors that contain probasin promoter sequence in place o f the M LV sequence in this region are able only to form the upper half o f the structure (Fig. 33B), providing one possible explanation for their impaired replicative efficiency. Although the ACE-GFP-Ar variants that arose during virus passage contained CM V sequence in the 3 ’ terminal region o f U3, they were nevertheless apparently capable o f efficient replication. These variants may have been able to overcome a replicative deficiency resulting from the absence o f the native hairpin structure simply because o f the strength o f the CM V promoter, or alternatively, the CMV promoter m ay have provided a sequence sufficient for formation o f the putative hairpin-loop (Fig. 33C). The CM V promoter-containing variants apparently arose by recombination o f the hybrid CM V-M LV 5’ LTR o f one pACE-GFP-Ar plasmid m olecule with the hybrid ARR2Pb-M LV 3 ’ LTR o f another, as depicted in Fig. 35. Since all o f the sequences involved in formation o f these recombinants are also present in plasmids pACE-GFP-At and pACE-GFP-Ac, we expect that sim ilar recombinants were formed during transfection o f these plasmids. The reason that such variants were not detected during infection with ACE-GFP-At and ACE-GFP-Ac is most likely 96 Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. Reproduced with permission o f th e copyright owner. Further reproduction prohibited without permission. A. ,c- gn i i c ?•? C‘ u ' |l kit B. G*C i i rv L G -C ' g;c - 9 MM c ' ^ A U 9, g- a u i* n , c »g : V j u C*G C .G u *a c . g ;a L i T 'u •G .c 9 * 9 a 9 - 9 g » c r v Rt y * 9 g * c ? * G> l ~ 9 " 9 U 9-% r ° -9 u - g _ ♦ 9 * 9 ' 9 * 9 ' g Rt ? * 9 9 * 9 u , C - A - i - A . c A > - C 'C . C g . A 'A * U' A- C Moloney MLV ACE-GFP-Ar ACE-GFP-Ar variants (■19.9 teal) (-8.9 kcal) containing OW pronwter Fig. 33 Potential RNA secondary structures formed at the U3-R border region of Mo-MLV, ACE-GFP-Ar, and variants of ACE-GFP-Ar containing CMV promoter sequences. (A) Secondary structure formed by Mo-MLV U3-R sequence. As the corresponding sequences of ACE-GFP-At and ACE-GFP-Ac are identical to those of Mo-MLV, the same hairpin- loop may form in these vectors as well. (B) Only a shorter form of the hairpin-loop can form in ACE-GFP-Ar RNA. This vector lacks the 3’ terminal sequence of U3 and is therefore capable only of forming the upper portion of the hairpin. (C) Structure that may occur in ACE-GFP-Ar recombinants containing CMV promoter. Although these recombinants also lack the 3' terminal sequence of U3, a more extensive hairpin loop can form utilizing the 3' terminal nucleotides of the CMV promoter. Bent arrows indicate start of R region. The molar free energies of each structure are shown in parentheses. Secondary structure analysis was carried out with the mfold program. Reproduced w ith permission o f th e copyright owner. Further reproduction prohibited without permission. A. 'A - G A L V (-23.3 kcal) 4 U»A G»C I I A .U c « a , 4 9*9' rT 9*9 w G .C i i C .G i i C«G i i C*G i i C -A #U A-c B. Mo-MLV A | GALV FeLV RaSV BaEV SNV REV-A ,G ' C . u u \ / U*G i i V* FeLV 9*9 (-19.8 kcal) V*$ G«C I I *.U O'^A RaSV (-23.3 kcal) P ~ < \ C v a y* c a , 9*9 U .A A **9 7V*U C«G G*U C»G R j G»U L . i i Rtf'G.C^ 1 — ■ i i\-C C*G i i G»C i i G»C ■ i -G « C N u : 9*9 G*C i i G .C i i f6*? •U«G i i G*C i i U«A C -r A " G 'U BaEV O £ (-27.7 kcal SNV (-27.3 kcal) ».A«U.r -A" G -r U-G / v W C*G i i A«U ;*C«G * * u*A G*C ?•% C*G' g *6 6.6 I G C 9*9 p . c q a C*G j j .A ^ G * L I « i а .u G*C б.6 r.C U 'A - A - u L c-g H 9*9 FeLV RaSV REV (-26.8 kcal) U-A.U GACC AUUC *UUC BaEV SNV REV VO 00 Fig. 34 Hairpin loops can form at the U3-R border in a wide variety of mammalian type C retroviruses. (A) Structures formed by U3-R border sequences of six type C viruses. The molar free energies for each structure are shown in parentheses. (B) Alignment of U3-R region sequences from Mo-MLV and viruses depicted in (A). For each virus, the sequence from the TATA box to the core polyadenylation signal is shown. Below the alignment are bars indicating the ascending and descending strands that form the hairpin in each virus. Abbreviations: GALV, gibbon ape leukemia virus; FeLV, feline leukemia virus; RaSV, rat sarcoma virus; BaEV, baboon endogenous retrovirus; spleen necrosis virus; REV, reticuloendotheliosis virus. gag \ pot | env |ire sg fi env | ire sg f ^ | Pb gag | pot \ env |i Fig. 35 Model mechanism to explain formation of ACE-GFP-Ar variants containing CMV promoter sequences. During initial virus production by transient transfection of 293T cells, the 5' hybrid CMV-MLV LTR of one plasmid molecule, recombines with the 3' hybrid ARR2Pb-MLV LTR of another plasmid molecule via cellular recombination pathways. Homology between the R-U5 regions of the LTR and an - 8-bp region of microhomology between the CMV and probasin promoter sequences (indicated by dashed lines) facilitates the recombination. The products resulting from the recombination include a plasmid molecule containing the CMV promoter in the 3' LTR. Vector encoded by this plasmid is transcribed packaged into replicating virions. 9 9 Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. that they were unable to effectively compete with the intact vectors and were thus rapidly diluted out o f the replicating population to undetectable levels. The use o f a strong tissue-specific promoter for transcriptional targeting therefore may also be important for safety reasons, by preventing the occurrence o f recombinants such as these that may lack tissue-specificity. Our results also demonstrate that a relatively strong promoter is required to support efficient virus replication. Despite the fact that the Pt and Pc wt probasin promoter-targeted LTRs possessed transcriptional strength sim ilar to that o f the SV40 enhancer/promoter, the corresponding vectors replicated with kinetics much slower than vector with the wild type MLV U3. The use o f the much stronger ARR2Pb promoter resulted in greatly improved replicative efficiency, suggesting that even promoters o f moderate strength may not provide adequate transcriptional activity for efficient viral replication. This improvement in efficiency was not accompanied by an increase in non-specific replication. Incorporation o f the PNP suicide transgene into the targeted vector allowed the specific killing o f prostate carcinoma cells in vitro. Remarkably, non-prostate cells infected with this vector displayed no vector-associated toxicity when exposed to levels o f prodrug that completely killed cultures o f prostate cells, despite the fact that the PNP-MPDR system generates highly toxic metabolites and possesses a very potent bystander effect (136). These results constitute the first demonstration o f targeted cell killing by an RCR vector. Further studies will be necessary to assess the in vivo safety and therapeutic efficacy o f such targeted suicide RCR vectors. 100 Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. The results o f this study suggest that transcriptionally targeted RCR vectors could come to represent a useful alternative treatment for a variety o f cancers refractory to conventional therapies. Our vectors should be adaptable for use with other transgenes and promoters targeting different tum or and tissue types. The rapidly growing number o f available therapeutic transgenes and cell type-specific promoters may allow these vectors to be eventually employed in a wide range o f cancer gene therapy applications. 1 0 1 Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. Future D irections The studies described in this dissertation have clearly demonstrated the potential usefulness of replicating retroviral vectors for gene therapy of cancer. However, several questions pertinent to the clinical effectiveness and safety of these vectors remain unanswered. The most important of these are: i) whether the targeted vectors possess leukemogenic or lymphomagenic properties; ii) how a fully-functional immune response will affect spread of these vectors iii) whether the vectors can spread through the circulation to metastatic tumor deposits. As discussed in Chapter 3, targeting of RCR vectors is necessary to minimize the risk o f vector-mediated carcinogenesis in treated patients. Under certain conditions, MLV infection of rodents and non-human primates, and presumably humans, can result in leukemia or lymphoma (36, 116). We expect that these malignancies will not result from infection with probasin promoter-targeted vectors due to lack of vector replication in lymphoid tissue. To test whether or not the targeted vectors are capable of inducing malignancy, animals under the same conditions as those resulting in MLV-induced disease can be infected with targeted vector. Because of the widespread presence of endogenous MLV sequences within the mouse genome, and to a lesser degree in the rat genome, infection of mice or rats with targeted vector may result in replacement of the targeting sequences through recombination within the LTR. Such recombinants might possess similar lymphoid cell tropism and pathogenic properties as wild type virus. Since primates lack endogenous sequences homologous to MLV, such recombination events should not 1 0 2 Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. occur. Non-human primates therefore represent a better model for testing the pathogenic potential of the targeted vectors. The results presented in Chapter 2 suggest that while the transduction efficiency of RCR vectors is remarkably high, an extended period of replication is necessary to achieve widespread gene transfer in a tumor. Maximal tumor transduction levels were observed only after 7 weeks following vector injection. Within this period, an animal with an uncompromised immune system would be able to mount a full response against the vector. The in vivo studies we carried out involved only athymic mice, which lack functional T cells and therefore cannot mount a normal immune response against injected vector, as a human patient could. To examine vector spread in immunocompetent animals, animals bearing tumors derived from syngeneic cells must be used. These may include transgenic mice, animals with chemically-induced tumors or animals bearing tumors from syngeneic tumor cell lines or tissues. Immunodeficient mice of other types may be of use for an additional purpose - identifying which components of the immune system affect vector replication. A large number of mutant mouse lines models with defined immune system defects and different degrees of immunodeficiency are now available. Examining vector replication in these mice may provide a means to identify which components of the immune system are responsible for the response to the vector. A crucially important issue regarding the therapeutic efficacy of these vectors is whether or not they will be able to transduce cells at locations distant from the point of injection. Most cancer patients die not from primary tumors, but from metastases within distant tissues. However, in the studies described here, only tumors that were directly injected were examined for transduction. A simple way of assessing the ability of the 103 Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. vector to spread between distant tumor deposits using the tumor model we employed would be to inject only one of two bilateral tumors with vector. If the vector is in fact capable of reaching distant metastases, both tumors should be transduced after a certain period. A more stringent test would be to examine transduction of true metastatic lesions in animals receiving intravenously administered vector. Other intriguing questions, perhaps not directly related to the therapeutic utility of these vectors, also have yet to be addressed. One of these is, for example, the origin of the deletions of IRES-transgene cassette described in Chapter 1. We discussed the possibility that these were generated by the jumping of reverse transcriptase during synthesis of proviral DNA. An alternative possibility is that at least some of the deletions occurred in vector plasmid after its transfection into 293T cells for production of the initial vector stocks. Transfected DNA is known to undergo frequent double-strand breakage inside transfected cells by an unknown mechanism (156). Deletions may have resulted when two such breaks occurred within the IRES-GFP insert and cellular recombination pathways recircularized the plasmid without the IRES-GFP fragment, or when a single break, followed by exonucleolytic processing and rejoining, occurred (102, 103). As described in Chapter I, all 3 GFP-encoding vectors exhibited a particular IRES-GFP deletion involving a site containing recognition sequences for topoisomerases I and II. These deletions may have been initiated by the action of one or both of these enzymes on transfected plasmid within the 293T cells. Alternatively, such DNA-level recombination involving cellular factors may have occurred not in vector plasmid, but rather in double-stranded proviral DNA during vector replication in NIH3T3 cells. One potential benefit from understanding the mechanism of insert deletion would be that it may enable the generation of more stable 104 Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. vector. If deletions were found to occur during transfection, for example, stability might be improved by the use of cells containing integrated, full-length vector for production of vector stocks. Another interesting question is why replication of the ARR2Pb-targeted vector lacking the 30 nucleotides at the 3’ end of U3, ACE-GFP-Ar, was greatly impaired relative to the vectors containing this sequence. We discussed the possibility that a hairpin loop formed by sequences in this region is required for efficient replication, perhaps playing a role in 3’-end formation. One simple way of testing the necessity of this hairpin loop for viral replication would be to introduce point mutations into ACE-GFP-Ar and ACE-GFP-At that would either restore or disrupt base pairing within the hairpin. A correlation between replicative efficiency and the integrity of the hairpin would suggest a role for this structure in replication. This hairpin may also provide the retrovirus with a means of restricting polyadenylation to the 3’ end of the viral genome. Since the sequences responsible for mediating polyadenylation in retroviruses are located within the LTR, and retroviruses possess an LTR at each terminus, some mechanism must exist to direct polyadenylation exclusively to the 3’ LTR (53). As the putative hairpin is formed by sequences in both the U3 and R regions, this structure can only form at the 3’ terminus of the viral RNA, and is present just 12 nucleotides upstream of the core AAUAAA polyadenylation signal. The presence of this hairpin in the 3’ end of the viral RNA may therefore promote 3’-end processing at this location. Our studies have established replicating retroviral vectors as powerful tools for gene transfer both in vitro and in vivo. In addition to their potential use in gene therapy of cancer, 105 Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. these vectors provide an extremely simple and efficient means for experimental gene transfer and for the study of retrovirus biology. While the generation of transgenic mice is an expensive and labor-intensive process, gene transfer into mice using RCR vectors is comparatively inexpensive and straightforward. Presumably, infection of animals at embryonic or fetal stages with the vectors will permit transduction throughout most tissues (140). The use of tissue-specific promoters may eliminate the later occurrence of malignancy in infected animals and should also permit tissue-targeted transgene expression. The IRES-GFP insert, in conjunction with fluorescence microscopy or flow cytometry provides a means of following viral spread and examining replication kinetics much more convenient than traditional viral assays. Such “tagged” viruses should prove useful in a wide variety of applications in basic retrovirology. 106 Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. References 1. Alemany, R., C. Balague, and D. T. Curiel. 2000. Replicative adenoviruses for cancer therapy. Nat Biotechnol 18:723-7. 2. Anderson, J. A., E. H. Bowman, and W. S. Hu. 1998. Retroviral recombination rates do not increase linearly with marker distance and are limited by the size of the recombining subpopulation. J Virol 72:1195-202. 3. Anderson, W. F. 1992. Human gene therapy. Science 256:808-13. 4. Anderson, W. F. 1984. Prospects for human gene therapy. Science 226:401-9. 5. Anderson, W. F., G. J. McGarrity, and R. C. Moen. 1993. Report to the NIH Recombinant DNA Advisory Committee on murine replication-competent retrovirus (RCR) assays (February 17, 1993). Hum Gene Ther 4:311-21. 6. Bacharach, E., J. Gonsky, D. Lim, and S. P. Goff. 2000. Deletion of a short, untranslated region adjacent to the polypurine tract in Moloney murine leukemia virus leads to formation of aberrant 5' plus-strand DNA ends in vivo. J Virol 74:4755-64. 7. Barnett, A. L., and J. M. Cunningham. 2001. Receptor binding transforms the surface subunit of the mammalian C-type retrovirus envelope protein from an inhibitor to an activator of fusion. J Virol 75:9096-105. 8. Barnier, J. V., M. Marx, P. Dezelee, D. Laugier, F. Poirier, G. Calothy, J. Hillova, and M. Hill. 1990. Transformation-defective mutants with 5' deletions of the src gene are frequently generated during replication of Rous sarcoma virus in established quail fibroblasts. Virology 177:505-14. 9. Barsov, E. V., and S. H. Hughes. 1996. Gene transfer into mammalian cells by a Rous sarcoma virus-based retroviral vector with the host range of the amphotropic murine leukemia virus. J Virol 70:3922-9. 10. Battula, N., and L. A. Loeb. 1974. The infidelity of avian myeloblastosis virus deoxyribonucleic acid polymerase in polynucleotide replication. J Biol Chem 249:4086-93. 11. Benz, E. W., Jr., R. M. Wydro, B. Nadal-Ginard, and D. Dina. 1980. Moloney murine sarcoma proviral DNA is a transcriptional unit. Nature 288:665-9. 12. Bischoff, J. R., D. H. Kirn, A. Williams, C. Heise, S. Horn, M. Muna, L. Ng, J. A. Nye, A. Sampson-Johannes, A. Fattaey, and F. McCormick. 1996. An adenovirus mutant that replicates selectively in p53-deficient human tumor cells. Science 274:373-6. 13. Capranico, G., and M. Binaschi. 1998. DNA sequence selectivity of topoisomerases and topoisomerase poisons. Biochim Biophys Acta 1400:185-94. 107 Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. 14. Carr, J. M., H. Hocking, P. Li, and C. J. Burrell. 1999. Rapid and efficient cell-to-cell transmission of human immunodeficiency virus infection from monocyte-derived macrophages to peripheral blood lymphocytes. Virology 265:319-29. 15. Cavazzana-Calvo, M., S. Hacein-Bey, G. de Saint Basile, F. Gross, E. Yvon, P. Nusbaum, F. Selz, C. Hue, S. Certain, J. L. Casanova, P. Bousso, F. L. Deist, and A. Fischer. 2000. Gene therapy of human severe combined immunodeficiency (SCID)-Xl disease. Science 288:669-72. 16. Chaisomchit, S., D. L. Tyrrell, and L. J. Chang. 1997. Development of replicative and nonreplicative hepatitis B virus vectors. Gene Ther 4:1330-40. 17. Chang, Z., J. Pan, C. Logg, N. Kasahara, and P. Roy-Burman. 2001. A replication- competent feline leukemia virus, subgroup A (FeLV-A), tagged with green fluorescent protein reporter exhibits in vitro biological properties similar to those of the parental FeLV-A. J Virol 75:8837-41. 18. Chu, T. H., and R. Dornburg. 1995. Retroviral vector particles displaying the antigen- binding site of an antibody enable cell-type-specific gene transfer. J Virol 69:2659-63. 19. Chuck, A. S., M. F. Clarke, and B. O. Palsson. 1996. Retroviral infection is limited by Brownian motion. Hum Gene Ther 7:1527-34. 20. Clavel, F., M. D. Hoggan, R. L. Willey, K. Strebel, M. A. Martin, and R. Repaske. 1989. Genetic recombination of human immunodeficiency virus. J Virol 63:1455-9. 21. Coffey, M. C., J. E. Strong, P. A. Forsyth, and P. W. Lee. 1998. Reovirus therapy of tumors with activated Ras pathway. Science 282:1332-4. 22. Coffin, J. M. 1992. Genetic diversity and evolution of retroviruses. Curr. Top. Microbiol. Immunol. 176:143-164. 23. Coffin, J. M. 1986. Genetic variation in AIDS viruses. Cell 46:1-4. 24. Cohen, L. A. 1982. Isolation and characterization of a serially cultivated, neoplastic, epithelial cell line from the N-nitrosomethylurea induced rat mammary adenocarcinoma. In Vitro 18:565-75. 25. Colicelli, J., and S. P. Goff. 1986. Isolation of a recombinant murine leukemia virus utilizing a new primer tRNA. J Virol 57:37-45. 26. Cormack, B. P., R. H. Valdivia, and S. Falkow. 1996. FACS-optimized mutants of the green fluorescent protein (GFP). Gene 173:33-8. 27. Cornetta, K., R. C. Moen, K. Culver, R. A. Morgan, J. R. McLachlin, S. Sturm, J. Selegue, W. London, R. M. Blaese, and W. F. Anderson. 1990. Amphotropic murine leukemia retrovirus is not an acute pathogen for primates. Hum Gene Ther 1:15-30. 108 Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. 28. Cornetta, K., R. A. Morgan, and W. F. Anderson. 1991. Safety issues related to retroviral-mediated gene transfer in humans. Hum Gene Ther 2:5-14. 29. Cornetta, K., R. A. Morgan, A. Gillio, S. Sturm, L. Baltrucki, R. O'Reilly, and W. F. Anderson. 1991. No retroviremia or pathology in long-term follow-up of monkeys exposed to a murine amphotropic retrovirus. Hum Gene Ther 2:215-9. 30. Cosset, F. L., F. J. Morling, Y. Takeuchi, R. A. Weiss, M. K. Collins, and S. J. Russell. 1995. Retroviral retargeting by envelopes expressing an N-terminal binding domain. J Virol 69:6314-22. 31. Coulombe, J., Y. Avis, and D. A. Gray. 1996. A replication-competent promoter-trap retrovirus. J Virol 70:6810-5. 32. de Roos, W. K., J. H. de Wilt, M. E. van Der Kaaden, E. R. Manusama, M. W. de Vries, A. Bout, T. L. ten Hagen, D. Valerio, and A. M. Eggermont. 2000. Isolated limb perfusion for local gene delivery: efficient and targeted adenovirus-mediated gene transfer into soft tissue sarcomas. Ann Surg 232:814-21. 33. Dennis, L. K., and M. I. Resnick. 2000. Analysis of recent trends in prostate cancer incidence and mortality. Prostate 42:247-52. 34. Diaz, R. M., T. Eisen, I. R. Hart, and R. G. Vile. 1998. Exchange of viral promoter/enhancer elements with heterologous regulatory sequences generates targeted hybrid long terminal repeat vectors for gene therapy of melanoma. J Virol 72:789-95. 35. Dillon, P. J., J. Lenz, and C. A. Rosen. 1991. Construction of a replication-competent murine retrovirus vector expressing the human immunodeficiency virus type 1 tat transactivator protein. J Virol 65:4490-3. 36. Donahue, R. E., S. W. Kessler, D. Bodine, K. McDonagh, C. Dunbar, S. Goodman, B. Agricola, E. Byrne, M. Raffeld, R. Moen, and et al. 1992. Helper virus induced T cell lymphoma in nonhuman primates after retroviral mediated gene transfer. J Exp Med 176:1125-35. 37. DuBridge, R. B., P. Tang, H. C. Hsia, P. M. Leong, J. H. Miller, and M. P. Calos. 1987. Analysis of mutation in human cells by using an Epstein-Barr virus shuttle system. Mol Cell Biol 7:379-87. 38. Emerman, M., and H. M. Temin. 1986. Comparison of promoter suppression in avian and murine retrovirus vectors. Nucleic Acids Res 14:9381-96. 39. Emerman, M., and H. M. Temin. 1984. Genes with promoters in retrovirus vectors can be independently suppressed by an epigenetic mechanism. Cell 39:449-67. 40. Fan, H. 1997. Leukemogenesis by Moloney murine leukemia virus: a multistep process. Trends Microbiol 5:74-82. 109 Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. 41. Ferrari, G., G. Salvatori, C. Rossi, G. Cossu, and F. Mavilio. 1995. A retroviral vector containing a muscle-specific enhancer drives gene expression only in differentiated muscle fibers. Hum Gene Ther 6:733-42. 42. Feuer, G., and H. Fan. 1990. Substitution of murine transthyretin (prealbumin) regulatory sequences into the Moloney murine leukemia virus long terminal repeat yields infectious virus with altered biological properties. J Virol 64:6130-40. 43. Gazit, G., G. Hung, X. Chen, W. F. Anderson, and A. S. Lee. 1999. Use of the glucose starvation-inducible glucose-regulated protein 78 promoter in suicide gene therapy of murine fibrosarcoma. Cancer Res 59:3100-6. 44. Gelinas, C., and H. M. Temin. 1986. Nondefective spleen necrosis virus-derived vectors define the upper size limit for packaging reticuloendotheliosis viruses. Proc Natl Acad Sci U S A 83:9211-5. 45. Gilmartin, G. M., E. S. Fleming, and J. Oetjen. 1992. Activation of HIV-1 pre-mRNA 3' processing in vitro requires both an upstream element and TAR. Embo J 11:4419-28. 46. Gilmartin, G. M., E. S. Fleming, J. Oetjen, and B. R. Graveiey. 1995. CPSF recognition of an HIV-1 mRNA 3'-processing enhancer: multiple sequence contacts involved in poly(A) site definition. Genes Dev 9:72-83. 47. Goff, S., P. Traktman, and D. Baltimore. 1981. Isolation and properties of Moloney murine leukemia virus mutants: use of a rapid assay for release of virion reverse transcriptase. J Virol 38:239-48. 48. Gojobori, T., and S. Yokoyama. 1985. Rates of evolution of the retroviral oncogene of Moloney murine sarcoma virus and of its cellular homologues. Proc Natl Acad Sci U S A 82:4198-201. 49. Grande, A., B. Piovani, A. Aiuti, S. Ottolenghi, F. Mavilio, and G. Ferrari. 1999. Transcriptional targeting of retroviral vectors to the erythroblastic progeny of transduced hematopoietic stem cells. Blood 93:3276-85. 50. Graves, B. J., R. N. Eisenman, and S. L. McKnight. 1985. Delineation of transcriptional control signals within the Moloney murine sarcoma virus long terminal repeat. Mol Cell Biol 5:1948-58. 51. Greenberg, N. M., F. DeMayo, M. J. Finegold, D. Medina, W. D. Tilley, J. O. Aspinall, G. R. Cunha, A. A. Donjacour, R. J. Matusik, and J. M. Rosen. 1995. Prostate cancer in a transgenic mouse. Proc Natl Acad Sci U S A 92:3439-43. 52. Greenberg, N. M., F. J. DeMayo, P. C. Sheppard, R. Barrios, R. Lebovitz, M. Finegold, R. Angelopoulou, J. G. Dodd, M. L. Duckworth, J. M. Rosen, and et al. 1994. The rat probasin gene promoter directs hormonally and developmentally regulated expression of a heterologous gene specifically to the prostate in transgenic mice. Mol Endocrinol 8:230-9. 1 1 0 Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. 53. Guntaka, R. V. 1993. Transcription termination and polyadenylation in retroviruses. Microbiol Rev 57:511-21. 54. Hajjar, A. M., and M. L. Linial. 1993. A model system for nonhomologous recombination between retroviral and cellular RNA. J Virol 67:3845-53. 55. Heise, C., T. Hermiston, L. Johnson, G. Brooks, A. Sampson-Johannes, A. Williams, L. Hawkins, and D. Kirn. 2000. An adenovirus El A mutant that demonstrates potent and selective systemic anti-tumoral efficacy. Nat Med 6:1134-9. 56. Herman, S. A., and J. M. Coffin. 1987. Efficient packaging of readthrough RNA in ALV: implications for oncogene transduction. Science 236:845-8. 57. Horton, R. M., H. D. Hunt, S. N. Ho, J. K. Pullen, and L. R. Pease. 1989. Engineering hybrid genes without the use of restriction enzymes: gene splicing by overlap extension. Gene 77:61-8. 58. Hu, W. S., E. H. Bowman, K. A. Delviks, and V. K. Pathak. 1997. Homologous recombination occurs in a distinct retroviral subpopulation and exhibits high negative interference. J Virol 71:6028-36. 59. Hu, W. S., and H. M. Temin. 1990. Genetic consequences of packaging two RNA genomes in one retroviral particle: pseudodiploidy and high rate of genetic recombination. Proc Natl Acad Sci U S A 87:1556-60. 60. Hu, W. S., and H. M. Temin. 1990. Retroviral recombination and reverse transcription. Science 250:1227-33. 61. Ikeda, E., M. G. Achen, G. Breier, and W. Risau. 1995. Hypoxia-induced transcriptional activation and increased mRNA stability of vascular endothelial growth factor in C6 glioma cells. J Biol Chem 270:19761-6. 62. Indraccolo, S., S. Minuzzo, W. Habeler, R. Zamarchi, A. Fregonese, W. H. Gunzburg, B. Salmons, W. Uckert, L. Chieco-Bianchi, and A. Amadori. 2000. Modulation of Moloney leukemia virus long terminal repeat transcriptional activity by the murine CD4 silencer in retroviral vectors. Virology 276:83-92. 63. Jager, U., Y. Zhao, and C. D. Porter. 1999. Endothelial cell-specific transcriptional targeting from a hybrid long terminal repeat retrovirus vector containing human prepro- endothelin-l promoter sequences. J Virol 73:9702-9. 64. Jainchill, J. L., S. A. Aaronson, and G. J. Todaro. 1969. Murine sarcoma and leukemia viruses: assay using clonal lines of contact-inhibited mouse cells. J Virol 4:549-53. 65. Jamieson, B. D., and J. A. Zack. 1998. In vivo pathogenesis of a human immunodeficiency virus type 1 reporter virus. J Virol 72:6520-6. I l l Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. 66. Jang, S. K., H. G. Krausslich, M. J. Nicklin, G. M. Duke, A. C. Palmenberg, and E. Wimmer. 1988. A segment of the S' nontranslated region of encephalomyocarditis virus RNA directs internal entry of ribosomes during in vitro translation. J Virol 62:2636-43. 67. Jespersen, T., M. Duch, M. L. Carrasco, S. Warming, and F. S. Pedersen. 1999. Expression of heterologous genes from an IRES translational cassette in replication competent murine leukemia virus vectors. Gene 239:227-35. 68. Johnson, D. C., and M. T. Huber. 2002. Directed egress of animal viruses promotes cell-to-cell spread. J Virol 76:1-8. 69. Jones, J. S., R. W. Allan, and H. M. Temin. 1994. One retroviral RNA is sufficient for synthesis of viral DNA. J Virol 68:207-16. 70. Junker, U., E. Bohnlein, and G. Veres. 1995. Genetic instability of a MoMLV-based antisense double-copy retroviral vector designed for HIV-1 gene therapy. Gene Ther 2:639-46. 71. Kasahara, N., A. M. Dozy, and Y. W. Kan. 1994. Tissue-specific targeting of retrovir a vectors through ligand-receptor interactions. Science 266:1373-6. 72. Kasper, S., P. S. Rennie, N. Bruchovsky, L. Lin, H. Cheng, R. Snoek, K. Dahlman- Wright, J. A. Gustafsson, R. P. Shiu, P. C. Sheppard, and R. J. Matusik. 1999. Selective activation of the probasin androgen-responsive region by steroid hormones. J Mol Endocrinol 22:313-25. 73. Kasper, S., P. S. Rennie, N. Bruchovsky, P. C. Sheppard, H. Cheng, L. Lin, R. P. Shiu, R. Snoek, and R. J. Matusik. 1994. Cooperative binding of androgen receptors to two DNA sequences is required for androgen induction of the probasin gene. J Biol Chem 269:31763-9. 74. Kavanaugh, M. P., D. G. Miller, W. Zhang, W. Law, S. L. Kozak, D. Kabat, and A. D. Miller. 1994. Cell-surface receptors for gibbon ape leukemia virus and amphotropic murine retrovirus are inducible sodium-dependent phosphate symporters. Proc Natl Acad Sci U S A 91:7071-5. 75. Kay, M. A., J. C. Glorioso, and L. Naldini. 2001. Viral vectors for gene therapy: the art of turning infectious agents into vehicles of therapeutics. Nat Med 7:33-40. 76. Kingma, P. S., A. H. Corbett, P. C. Burcham, L. J. Marnett, and N. Osheroff. 1995. Abasic sites stimulate double-stranded DNA cleavage mediated by topoisomerase II. DNA lesions as endogenous topoisomerase II poisons. J Biol Chem 270:21441-4. 77. Kruse, C. A., M. D. Roper, B. K. Kleinschmidt-DeMasters, S. J. Banuelos, W. R. Smiley, J. M. Robbins, and F. J. Burrows. 1997. Purified herpes simplex thymidine kinase Retrovector particles. I. In vitro characterization, in situ transduction efficiency, and histopathological analyses of gene therapy-treated brain tumors. Cancer Gene Ther 4:118-28. 1 1 2 Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. 78. Kurihara, T., D. E. Brough, I. Kovesdi, and D. W. Kufe. 2000. Selectivity of a replication-competent adenovirus for human breast carcinoma cells expressing the MUCl antigen. J Clin Invest 106:763-71. 79. Lavillette, D., S. J. Russell, and F. L. Cosset. 2001. Retargeting gene delivery using surface-engineered retroviral vector particles. CurrOpin Biotechnol 12:461-6. 80. Lee, A. H., J. M. Han, and Y. C. Sung. 1997. Generation of the replication-competent human immunodeficiency virus type 1 which expresses a jellyfish green fluorescent protein. Biochem Biophys Res Commun 233:288-92. 81. Levy, A. P., N. S. Levy, S. Wegner, and M. A. Goldberg. 1995. Transcriptional regulation of the rat vascular endothelial growth factor gene by hypoxia. J Biol Chem 270:13333-40. 82. Li, S., and L. Huang. 2000. Nonviral gene therapy: promises and challenges. Gene Ther 7:31-4. 83. Liu, L., W. F. Anderson, R. W. Beart, E. M. Gordon, and F. L. Hall. 2000. Incorporation of tumor vasculature targeting motifs into moloney murine leukemia virus env escort proteins enhances retrovirus binding and transduction of human endothelial cells. J Virol 74:5320-8. 84. Lobel, L. I., M. Patel, W. King, M. C. Nguyen-Huu, and S. P. Goff. 1985. Construction and recovery of viable retroviral genomes carrying a bacterial suppressor transfer RNA gene. Science 228:329-32. 85. Lorence, R. M., P. A. Rood, and K. W. Kelley. 1988. Newcastle disease virus as an antineoplastic agent: induction of tumor necrosis factor-alpha and augmentation of its cytotoxicity. J Natl Cancer Inst 80:1305-12. 86. Mavilio, F., G. Ferrari, S. Rossini, N. Nobili, C. Bonini, G. Casorati, C. Traversari, and C. Bordignon. 1994. Peripheral blood lymphocytes as target cells of retroviral vector-mediated gene transfer. Blood 83:1988-97. 87. Mavria, G., (J. Jager, and C. D. Porter. 2000. Generation of a high titre retroviral vector for endothelial cell-specific gene expression in vivo. Gene Ther 7:368-76. 88. Miller, D. G., M. A. Adam, and A. D. Miller. 1990. Gene transfer by retrovirus vectors occurs only in cells that are actively replicating at the time of infection [published erratum appears in Mol Cell Biol 1992 Jan;12(l):433]. Mol Cell Biol 10:4239-42. 89. Miller, D. G., and A. D. Miller. 1994. A family of retroviruses that utilize related phosphate transporters for cell entry. J Virol 68:8270-6. 90. Miller, N., and J. Whelan. 1997. Progress in transcriptionally targeted and regulatable vectors for genetic therapy. Hum Gene Ther 8:803-15. 113 Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. 91. Morgan, J. R., J. M. LeDoux, R. G. Snow, R. G. Tompkins, and M. L. Yarmush. 1995. Retrovirus infection: effect of time and target cell number. J Virol 69:6994-7000. 92. Murakami, M., H. Watanabe, Y. Niikura, T. Kameda, K. Saitoh, M. Yamamoto, Y. Yokouchi, A. Kuroiwa, K. Mizumoto, and H. Iba. 1997. High-level expression of exogenous genes by replication-competent retrovirus vectors with an internal ribosomal entry site. Gene 202:23-9. 93. Neiman, P. E., J. Stone, L. Gilbert, V. J. Fincham, C. McMillin-Helsel, and J. A. Wyke. 1981. Restriction of replication of Rous sarcoma virus mediated by the src region of the genome: analysis of the formation and integration of viral DNA and the effects of conditional and nonconditional mutations in src. Virology 114:516-25. 94. Nishikawa, M., and L. Huang. 2001. Nonviral vectors in the new millennium: delivery barriers in gene transfer. Hum Gene Ther 12:861-70. 95. Norman, K. L., and P. W. Lee. 2000. Reovirus as a novel oncolytic agent. J Clin Invest 105:1035-8. 96. Omer, C. A., K. Pogue-Geile, R. Guntaka, K. A. Staskus, and A. J. Faras. 1983. Involvement of directly repeated sequences in the generation of deletions of the avian sarcoma virus src gene. J Virol 47:380-2. 97. Page, K. A., T. Liegier, and M. B. Feinberg. 1997. Use of a green fluorescent protein as a marker for human immunodeficiency virus type 1 infection. AIDS Res Hum Retroviruses 13:1077-81. 98. Palese, P., H. Zheng, O. G. Engelhardt, S. Pleschka, and A. Garcia-Sastre. 1996. Negative-strand RNA viruses: genetic engineering and applications. Proc Natl Acad Sci US A 93:11354-8. 99. Parvin, J. D., and L. H. Wang. 1984. Mechanisms for the generation of src-deletion mutants and recovered sarcoma viruses: identification of viral sequences involved in src deletions and in recombination with c-src sequences. Virology 138:236-45. 100. Pathak, V. K., and H. M. Temin. 1992. 5-Azacytidine and RNA secondary structure increase the retrovirus mutation rate. J Virol 66:3093-100. 101. Pathak, V. K., and H. M. Temin. 1990. Broad spectrum of in vivo forward mutations, hypermutations, and mutational hotspots in a retroviral shuttle vector after a single replication cycle: deletions and deletions with insertions. Proc Natl Acad Sci U S A 87:6024-8. 102. Pauli, T. T., and M. Gellert. 1998. The 3' to 5' exonuclease activity of Mre 11 facilitates repair of DNA double-strand breaks. Mol Cell 1:969-79. 103. Pauli, T. T., and M. Gellert. 2000. A mechanistic basis for Mrel I-directed DNA joining at microhomologies. Proc Natl Acad Sci U S A 97:6409-14. 114 Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. 104. Pawlik, T. M., H. Nakamura, S. S. Yoon, J. T. Mullen, S. Chandrasekhar, E. A. Chiocca, and K. K. Tanabe. 2000. Oncolysis of diffuse hepatocellular carcinoma by intravascular administration of a replication-competent, genetically engineered herpesvirus. Cancer Res 60:2790-5. 105. Petropoulos, C. J., and S. H. Hughes. 1991. Replication-competent retrovirus vectors for the transfer and expression of gene cassettes in avian cells. J Virol 65:3728-37. 106. Pfeiffer, J. K., M. M. Georgiadis, and A. Telesnitsky. 2000. Structure-based moloney murine leukemia virus reverse transcriptase mutants with altered intracellular direct- repeat deletion frequencies. J Virol 74:9629-36. 107. Pulsinelli, G. A., and H. M. Temin. 1991. Characterization of large deletions occurring during a single round of retrovirus vector replication: novel deletion mechanism involving errors in strand transfer. J Virol 65:4786-97. 108. Rainov, N. G. 2000. A phase III clinical evaluation of herpes simplex virus type 1 thymidine kinase and ganciclovir gene therapy as an adjuvant to surgical resection and radiation in adults with previously untreated glioblastoma multiforme. Hum Gene Ther 11:2389-401. 109. Ram, Z., K. W. Culver, E. M . Oshiro, J. J. Viola, H. L. DeVroom, E. Otto, Z. Long, Y. Chiang, G. J. McGarrity, L. M. Muul, D. Katz, R. M. Blaese, and E. H. Oldfield. 1997. Therapy of malignant brain tumors by intratumoral implantation of retroviral vector-producing cells. Nat Med 3:1354-61. 110. Reese, D. M. 2001. New agents for prostate cancer. Hematol Oncol Clin North Am 15:547-57. 111. Reik, W., H. Weiher, and R. Jaenisch. 1985. Replication-competent Moloney murine leukemia virus carrying a bacterial suppressor tRNA gene: selective cloning of proviral and flanking host sequences. Proc Natl Acad Sci U S A 82:1141-5. 112. Rennie, P. S., N. Bruchovsky, K. J. Leco, P. C. Sheppard, S. A. McQueen, H. Cheng, R. Snoek, A. Hamel, M. E. Bock, B. S. MacDonald, and et al. 1993. Characterization of two cis-acting DNA elements involved in the androgen regulation of the probasin gene. Mol Endocrinol 7:23-36. 113. Robbins, P. D., H. Tahara, and S. C. Ghivizzani. 1998. Viral vectors for gene therapy. Trends Biotechnol 16:35-40. 114. Roberts, J. D., K. Bebenek, and T. A. Kunkel. 1988. The accuracy of reverse transcriptase from HIV-L Science 242:1171-3. 115. Robson, N. D., and A. Telesnitsky. 1999. Effects of 3' untranslated region mutations on plus-strand priming during moloney murine leukemia virus replication. J Virol 73:948-57. 115 Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. 116. Rosenberg, N., and P. Jolicoeur. 1997. Retroviral Pathogenesis, p. 475-585. In J. M. Coffin, S. H. Hughes, and H. Varmus (ed.), Retroviruses. Cold Spring Harbor Laboratory Press, Plainview, N.Y. 117. Roth, D. B., and J. H. Wilson. 1986. Nonhomologous recombination in mammalian cells: role for short sequence homologies in the joining reaction. Mol Ceil Biol 6:4295-304. 118. Rouet, P., F. Smih, and M. Jasin. 1994. Introduction of double-strand breaks into the genome of mouse cells by expression of a rare-cutting endonuclease. Mol Cell Biol 14:8096-106. 119. Roux, P., P. Jeanteur, and M. Piechaczyk. 1989. A versatile and potentially general approach to the targeting of specific cell types by retroviruses: application to the infection of human cells by means of major histocompatibility complex class I and class II antigens by mouse ecotropic murine leukemia virus-derived viruses. Proc Natl Acad Sci U S A 86:9079-83. 120. Rowe, W. P., W. E. Pugh, and J. W. Hartley. 1970. Plaque assay techniques for murine leukemia viruses. Virology 42:1136-9. 121. Russell, S. J. 1994. Replicating vectors for gene therapy of cancer: risks, limitations and prospects. Eur J Cancer 8:1165-71. 122. Russell, S. J., R. E. Hawkins, and G. Winter. 1993. Retroviral vectors displaying functional antibody fragments. Nucleic Acids Res 21:1081-5. 123. Schmidt, M., and A. Rethwilm. 1995. Replicating foamy virus-based vectors directing high level expression of foreign genes. Virology 210:167-78. 124. Schwartzberg, P., J. Colicelli, and S. P. Goff. 1985. Recombination between a defective retrovirus and homologous sequences in host DNA: reversion by patch repair. J Virol 53:719-26. 125. Sclimenti, C. R., and M. P. Calos. 1998. Epstein-Barr virus vectors for gene expression and transfer. CurrOpin Biotechnol 9:476-9. 126. Shin, N. H., D. Hartigan-O'Connor, J. K. Pfeiffer, and A. Telesnitsky. 2000. Replication of lengthened Moloney murine leukemia virus genomes is impaired at multiple stages. J Virol 74:2694-702. 127. Shoemaker, C., J. Hoffman, S. P. Goff, and D. Baltimore. 1981. Intramolecular integration within Moloney murine leukemia virus DNA. J Virol 40:164-72. 128. Short, M. P., B. C. Choi, J. K. Lee, A. Malick, X. O. Breakefleld, and R. L. Martuza. 1990. Gene delivery to glioma cells in rat brain by grafting of a retrovirus packaging cell line. J Neurosci Res 27:427-39. 129. Sinkovics, J. G., and J. C. Horvath. 2000. Newcastle disease virus (NDV): brief history of its oncolytic strains. J Clin Virol 16:1-15. 116 Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. 130. Small, E. J., and D. M. Reese. 2000. An update on prostate cancer research. Curr Opin Oncol 12:265-72. 131. Smiley, W. R., B. Laubert, B. D. Howard, C. Ibanez, T. C. Fong, W. S. Summers, and F. J. Burrows. 1997. Establishment of parameters for optimal transduction efficiency and antitumor effects with purified high-titer HSV-TK retroviral vector in established solid tumors. Hum Gene Ther 8:965-77. 132. Smith, A. E. 1999. Gene therapy— where are we? Lancet 354 Suppl l:SIl-4. 133. Smith, E., R. A. Redman, C. R. Logg, G. A. Coetzee, N. Kasahara, and B. Frenkel. 2000. Glucocorticoids inhibit developmental stage-specific osteoblast cell cycle. Dissociation of cyclin A-cyclin-dependent kinase 2 from E2F4-pl30 complexes. J Biol Chem 275:19992-20001. 134. Snitkovsky, S., T. M. Niederman, R. C. Mulligan, and J. A. Young. 2001. Targeting avian leukosis virus subgroup A vectors by using a TVA-VEGF bridge protein. J Virol 75:1571-5. 135. Snitkovsky, S., and J. A. Young. 1998. Cell-specific viral targeting mediated by a soluble retroviral receptor-ligand fusion protein. Proc Natl Acad Sci U S A 95:7063-8. 136. Sorscher, E. J., S. Peng, Z. Bebok, P. W. Allan, L. L. Bennett, Jr., and W. B. Parker. 1994. Tumor cell bystander killing in colonic carcinoma utilizing the Escherichia coli DeoD gene to generate toxic purines. Gene Ther 1:233-8. 137. Strayer, D. S. 2000. SV40-based gene therapy vectors: turning an adversary into a friend. Curr Opin Mol Ther 2:570-8. 138. Stuhlmann, H., and P. Berg. 1992. Homologous recombination of copackaged retrovirus RNAs during reverse transcription. J Virol 66:2378-88. 139. Stuhlmann, H., R. Jaenisch, and R. C. Mulligan. 1989. Construction and properties of replication-competent murine retroviral vectors encoding methotrexate resistance. Mol Cell Biol 9:100-8. 140. Stuhlmann, H., R. Jaenisch, and R. C. Mulligan. 1989. Transfer of a mutant dihydrofolate reductase gene into pre- and postimplantation mouse embryos by a replication-competent retrovirus vector. J Virol 63:4857-65. 141. Svarovskaia, E. S., K. A. Delviks, C. K. Hwang, and V. K. Pathak. 2000. Structural determinants of murine leukemia virus reverse transcriptase that affect the frequency of template switching. J Virol 74:7171-8. 142. Swain, A., and J. M. Coffin. 1992. Mechanism of transduction by retroviruses. Science 255:841-5. 143. Telesnitsky, A., S. Blain, and S. P. Goff. 1995. Assays for retroviral reverse transcriptase. Methods Enzymol 262:347-62. 117 Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. 144. Temin, H. M. 1993. Retrovirus variation and reverse transcription: abnormal strand transfers result in retrovirus genetic variation. Proc Natl Acad Sci U S A 90:6900-3. 145. Temin, H. M. 1991. Sex and recombination in retroviruses. Trends Genet. 7:71-74. 146. Terwilliger, E. F., B. Godin, J. G. Sodroski, and W. A. Haseltine. 1989. Construction and use of a replication-competent human immunodeficiency virus (HIV-1) that expresses the chloramphenicol acetyltransferase enzyme. Proc Natl Acad Sci U S A 86:3857-61. 147. Tomonaga, K., and J. M. Coffin. 1998. Structure and distribution of endogenous nonecotropic murine leukemia viruses in wild mice. J Virol 72:8289-300. 148. Valsamakis, A., S. Zeichner, S. Carswell, and J. C. Alwine. 1991. The human immunodeficiency virus type 1 polyadenylylation signal: a 3' long terminal repeat element upstream of the AAUAAA necessary for efficient polyadenylylation. Proc Natl Acad Sci US A 88:2108-12. 149. Valsesia-Wittmann, S., A. Drynda, G. Deleage, M. Aumailley, J. M. Heard, O. Danos, G. Verdier, and F. L. Cosset. 1994. Modifications in the binding domain of avian retrovirus envelope protein to redirect the host range of retroviral vectors. J Virol 68:4609-19. 150. Varela-Echavarria, A., C. M. Prorock, Y. Ron, and J. P. Dougherty. 1993. High rate of genetic rearrangement during replication of a Moloney murine leukemia virus-based vector. J Virol 67:6357-64. 151. Vigna, E., and L. Naldini. 2000. Lentiviral vectors: excellent tools for experimental gene transfer and promising candidates for gene therapy. J Gene Med 2:308-16. 152. Vile, R. G., S. J. Russell, and N. R. Lemoine. 2000. Cancer gene therapy: hard lessons and new courses. Gene Ther 7:2-8. 153. Vile, R. G., K. Sunassee, and R. M. Diaz. 1998. Strategies for achieving multiple layers of selectivity in gene therapy. Mol Med Today 4:84-92. 154. Voynow, S. L., and J. M. Coffin. 1985. Evolutionary variants of Rous sarcoma virus: large deletion mutants do not result from homologous recombination. J Virol 55:67-78. 155. Wahlfors, J. J., S. A. Zullo, S. Loimas, D. M. Nelson, and R. A. Morgan. 2000. Evaluation of recombinant alphaviruses as vectors in gene therapy. Gene Ther 7:472-80. 156. Wake, C. T., T. Gudewicz, T. Porter, A. White, and J. H. Wilson. 1984. How damaged is the biologically active subpopulation of transfected DNA? Mol Cell Biol 4:387-98. 157. Walker, J. R., K. G. McGeagh, P. Sundaresan, T. J. Jorgensen, S. D. Rabkin, and R. L. Martuza. 1999. Local and systemic therapy of human prostate adenocarcinoma with the conditionally replicating herpes simplex virus vector G207. Hum Gene Ther 10:2237-43. 118 Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. 158. Weiss, R., and A. Bernstein. 1982. RNA tumor viruses, 2nd ed. Cold Spring Harbor Laboratory, Cold Spring Harbor, N.Y. 159. Wildner, O., J. C. Morris, N. N. Vahanian, H. Ford, Jr., W. J. Ramsey, and R. M. Blaese. 1999. Adenoviral vectors capable of replication improve the efficacy of HSVtk/GCV suicide gene therapy of cancer. Gene Ther 6:57-62. 160. Wohrl, B. M., M. M. Georgiadis, A. Telesnitsky, W. A. Hendrickson, and S. F. Le Grice. 1995. Footprint analysis of replicating murine leukemia virus reverse transcriptase. Science 267:96-9. 161. Yang, L., R. Hwang, L. Pandit, E. M. Gordon, W. F. Anderson, and D. Parekh. 1996. Gene therapy of metastatic pancreas cancer with intraperitoneal injections of concentrated retroviral herpes simplex thymidine kinase vector supernatant and ganciclovir. Ann Surg 224:405-14; discussion 414-7. 162. Yang, N. S., J. Burkholder, B. Roberts, B. Martinell, and D. McCabe. 1990. In vivo and in vitro gene transfer to mammalian somatic cells by particle bombardment. Proc Natl Acad Sci U S A 87:9568-72. 163. Yu, S. S., J. M. Kim, and S. Kim. 2000. The 17 nucleotides downstream from the env gene stop codon are important for murine leukemia virus packaging. J Virol 74:8775-80. 164. Zhang, J., and H. M. Temin. 1993. Rate and mechanism of nonhomologous recombination during a single cycle of retroviral replication. Science 259:234-8. 165. Zhang, J., T. Z. Thomas, S. Kasper, and R. J. Matusik. 2000. A small composite probasin promoter confers high levels of prostate-specific gene expression through regulation by androgens and glucocorticoids in vitro and in vivo. Endocrinology 141:4698-710. 166. Zhao, X. Y., P. J. Malloy, A. V. Krishnan, S. Swami, N. M. Navone, D. M. Peehl, and D. Feldman. 2000. Glucocorticoids can promote androgen-independent growth of prostate cancer cells through a mutated androgen receptor. Nat Med 6:703-6. 167. Zhao, Y., L. Zhu, S. Lee, L. Li, E. Chang, N. W. Soong, D. Douer, and W. F. Anderson. 1999. Identification of the block in targeted retroviral-mediated gene transfer. Proc Natl Acad Sci U S A 96:4005-10. 168. Zhao-Emonet, J. C., G. Marodon, C. Pioche-Durieu, F. L. Cosset, and D. Klatzmann. 2000. T cell-specific expression from Mo-MLV retroviral vectors containing a CD4 mini- promoter/enhancer. J Gene Med 2:416-25. 169. Zhu, J., and R. H. Schiestl. 1996. Topoisomerase I involvement in illegitimate recombination in Saccharomyces cerevisiae. Mol Cell Biol 16:1805-12. 119 Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.

Linked assets

University of Southern California Dissertations and Theses

Conceptually similar

PDF

FGF8, isoform b, is an etiological factor in prostate tumorigenesis

PDF

Development of HA -pseudotyped retroviral vectors for cell -specific gene delivery

PDF

Development of novel adenovirus-retroelement vectors and their applications beyond gene therapy

PDF

A coactivator complex among GRIP1, CARM1, and TIF1alpha contributes to gene activation directed by androgen receptor

PDF

Characterization of target cell entry by murine leukemia viruses

PDF

Anomalies at NGX6 locus: Potential involvement in feline lymphomas

PDF

An E2F-independent mechanism in transcriptional control of the hamster histone H3.2 gene expression

PDF

Analysis of the function and regulation of the 94kDa glycoprotein of the glucose-regulated protein family.

PDF

Biochemical factors determining tumor response to 5,10-dideazatetrahydrofolate, a folate antimetabolite inhibitory to de novo purine biosynthesis

PDF

A review of molecular conjugates and their use in gene therapy with the presentation of a model experiment: Gene therapy with novel fusion proteins that target breast cancer cells

PDF

Characterization of new factors involved in feline leukemia virus (FELV)-mediated leukemogenesis

PDF

Investigation of the role of epigenetic modification of DNA and chromatin in aberrant gene silencing in cancer cells

PDF

Gene therapy for motor neuron degeneration in murine tissue culture and transgenic mouse models of familial amyotrophic lateral sclerosis

PDF

Transcriptional targeting of retroviral vector replication to prostate tumor cells

PDF

Functional analysis of the replicator ACE3 and origin beta required for Drosophila chorion gene amplification

PDF

Analysis of Sonic hedgehog/Patched-1 downstream genes in embryonic feather morphogenesis and the development of novel biotechnologies thereof

PDF

Analysis of multistep mammary tumorigenesis in Wnt1 transgenic mice: The role of fibroblast growth factor-8 in oncogenesis and apoptosis

PDF

A Study Of The Mechanism Of Lead Chromate Induced Neoplastic Transformation Of C3H/10T1/2 Mouse Embryo Cells

PDF

CoCoA, a novel coactivator which acts through the interaction with the bHLH -PAS domains of p160 coactivators, AHR, and ARNT

PDF

The Human 3 Beta-Hydroxysteroid Dehydrogenase Type Ii Gene And Genetic Predisposition To Prostate Cancer

Asset Metadata

Creator Logg, Christopher Reid (author)

Core Title Development of replication -competent retroviral vectors for efficient, targeted gene therapy of cancer

School Graduate School

Degree Doctor of Philosophy

Degree Program Pathology

Publisher University of Southern California (original), University of Southern California. Libraries (digital)

Tag biology, genetics,biology, microbiology,biology, molecular,health sciences, oncology,OAI-PMH Harvest

Language English

Contributor Digitized by ProQuest (provenance)

Advisor Kasahara, Noriyuki (committee chair), Anderson, W. French (committee member), Roy-Burman, Pradip (committee member), Stallcup, Michael R. (committee member)

Permanent Link (DOI) https://doi.org/10.25549/usctheses-c16-222361

Unique identifier UC11334834

Identifier 3073808.pdf (filename),usctheses-c16-222361 (legacy record id)

Legacy Identifier 3073808.pdf

Dmrecord 222361

Document Type Dissertation

Rights Logg, Christopher Reid

Type texts

Source University of Southern California (contributing entity), University of Southern California Dissertations and Theses (collection)

Access Conditions The author retains rights to his/her dissertation, thesis or other graduate work according to U.S. copyright law. Electronic access is being provided by the USC Libraries in agreement with the au...

Repository Name University of Southern California Digital Library

Repository Location USC Digital Library, University of Southern California, University Park Campus, Los Angeles, California 90089, USA