University of Southern California Dissertations and Theses

Identification and characterization of transcriptional regulatory elements in the Msx2 promoter

(USC Thesis Other)

Identification and characterization of transcriptional regulatory elements in the Msx2 promoter

PDF

Download a page range

Download transcript

Copy asset link

Request this asset

Transcript (if available)

Content IDENTIFICATION AND CHARACTERIZATION OF
TRANSCRIPTIONAL REGULATORY ELEMENTS
IN THE Msx2 PROMOTER
Copyright 2002
by
Sean Michael Brugger
A Dissertation Presented to the
FACULTY OF THE GRADUATE SCHOOL
UNIVERSITY OF SOUTHERN CALIFORNIA
In Partial Fulfillment of the
Requirements for the Degree
DOCTOR OF PHILOSOPHY
(BIOCHEMISTRY)
December 2002
Sean Michael Brugger
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
UMI Number: 3093942
UMI
UMI Microform 3093942
Copyright 2003 by ProQuest Inform ation and Learning Company.
All rights reserved. This m icroform edition is protected against
unauthorized copying under Title 17, United States Code.
ProQ uest Inform ation and Learning Com pany
300 North Zeeb Road
P.O. Box 1346
Ann Arbor, Ml 48106-1346
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
UNIVERSITY OF SOUTHERN CALIFORNIA
The Graduate School
University Park
LOS ANGELES, CALIFORNIA 90089T695
This dissertation , w ritten b y
Under th e direction o f h. D issertation
Com m ittee, an d approved b y a ll its m em bers,
Graduate School, in p a rtia l fu lfillm en t o f
has been p re sen ted to an d accepted b y The
requirem ents fo r th e degree o f
DOCTOR OF PHILOSOPHY
Dean o f Graduate Studies
D a te PeceuW 2OUT
DISSER TA TION COMMITTEE
Chairperson
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
DEDICATION
Although it has been a long five years, it would have seemed even longer and
much less fun had it not been for the love, help, and support of my wife Amy. With
that said, I dedicate this dissertation to her.
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
ACKNOWLEDGEMENTS
I would like to acknowledge the uncompromising love and support, both
spiritually and financially, that my parents have given me throughout my higher
education. Without your guidance and help, I would never have been able to reach
this point.
To my dissertation committee members, including Dr. Henry Sucov, Dr.
Peter Laird, Dr. Cheng-Ming Chuong, and Dr. Rahul Warrior, I thank you for your
time, advice, insight, constructive criticism, and most importantly, your kindness.
I would like to thank all those in the Maxson lab who have made my time here very
enjoyable. Stan, it was nice to have another student in the lab that was on the same
page. Thanks for all your help with presentations, computers, and everything else.
By the way, how about some more avacados? Mamoru, you are a great guy and I
have really enjoyed all of our trips to dinner and such. I’ve never met anyone that
works as hard as you and I wish you luck. Nancy, thanks for all of the “fast track”
injections, you made my projects feasible. Yazmin, thanks for all the help and jokes,
you make work fun. Duk, you crack me up, what else can I say.
Jeff Tsou, what a freak you are. I didn’t think I would ever meet such a good
friend in graduate school, but you proved me wrong. You are sick and twisted and
too much fun. I really enjoyed living with you and I will never have a better sports
fan to go to games with Go SC. Good luck to you, I know you will do well in
life.
m
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
Bill Taylor, you are the man. When the Maxson lab was in a jam, you always
came through. I’m not sure how you keep it all together; but it must have something
to do with your extremely young age. When you finally retire, this place is going to
fall apart (note to Norris Cancer Center, get him an apprentice)
Finally, I would like to thank my mentor Robert Maxson. Rob, your lab is a
great place to learn many different techniques. I appreciate that you are willing and
able to talk science or anything else whenever we students need to. I also feel very
fortunate that the lab has such financial stability, allowing us to be well equipped and
giving us the freedom to perform all pertinent experiments.
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
TABLE OF CONTENTS
D E D IC A T IO N ........................................................................................................................................................................II
A C K N O W L E D G E M E N T S ............................................................................................................................................ I l l
L IST O F F IG U R E S ...........................................................................................................................................................V II
A B S T R A C T ..............................................................................................................................................................................X
P R E F A C E ..............................................................................................................................................................................X II
C H A P T E R 1-ID E N T IF IC A T IO N A N D C H A R A C T E R IZ A T IO N O F A B M P -R E S P O N S IV E
M O D U L E IN T H E MSX2 P R O M O T E R .....................................................................................................................1
IN T R O D U C T IO N .................................................................................................................................................................. 1
R E S U L T S ...................................................................................................................................................................................8
Lo calizing a BM P-respo nsiv e elem ent in th e M sx2 prom o ter...............................................................8
I d e n t if ic a t io n o f a 52 bp M sx2 p r o m o te r fr a g m e n t n e c e s s a r y f o r B M P -r e sp o n siv e n e ss .. 19
T he 52 bp m o d ule is sufficient for BM P respo n siv en e ss in the lim b b u d ......................................23
T h e 220 bp a n d 52 bp M sx2 p r o m o te r fr a g m e n ts a r e D p p -resp o n siv e in D r o s o p h il a 32
A n a l y sis of potential cis-regulato ry sites w ithin the BM P-r e spo n siv e m o d u l e..................37
Tr a n s-reg u la to ry facto rs th at a c t th ro ug h th e BM P-respo n siv e m o d u l e ........................... 40
Other potential t r a n s-reg u la to ry f a c t o r s...............................................................................................44
D IS C U S S IO N ......................................................................................................................................................................... 52
Iden tify in g a BM P-r espo nsiv e m o d ule u sin g tr an sg enic m ic e...........................................................52
A6M SX2 EXPRESSION IN THE LIMB IS CORRELATED WITH ENDOGENOUS B M P SIGNALING..................... 54
A6M SX2 EXPRESSION IN THE CARDIAC REGION SUGGESTS A ROLE FOR B M P SIGNALING........................57
Co n se r v a tio n of BM P-D pp ex pressio n c o n t r o l................................................ 60
H o m e o b o x g enes in BM P sig n a l in g .................................................................................................................... 62
F U T U R E D IR E C T IO N S .................................................................................................................................................. 64
C H A P T E R 2 - PAX3 N E G A T IV E L Y R E G U L A T E S MSX2 E X P R E S S IO N D U R IN G M U R IN E
C A R D IA C N E U R A L C R E ST D E V E L O P M E N T ................................................................................................. 67
IN T R O D U C T IO N ............................................................................................................................................................... 67
R E S U L T S ................................................................................................................................................................................ 72
T h e M sx 2'a g e n o ty p e r e s c u e s em b r y o n ic l e t h a l i t y in Pa x 3'a e m b r y o s ..........................................72
v
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
T h e MSX2'1 ' GENOTYPE RESCUES SPECIFIC NEURAL CREST DEFECTS IN SPLOTCH....................................... 72
MSX2 EXPRESSION IS UPREGULATED IN E9.5 PAX3'/' EMBRYOS.........................................................................73
L o c a liz a t io n o f a Pa x 3 r e sp o n s iv e r e g io n in t h e M sx2 p r o m o t e r .....................................................76
I d e n t if ic a t io n o f a f u n c t io n a l c is a c t in g P a x 3 b in d in g s it e in t h e M s x2 p r o m o t e r .............. 81
DISCUSSION..................................................................................................................................87
MATERIALS AND METHODS.................................................................................................... 90
Tr a n sfe c t io n s.................................................................................................................................................................90
Tra n sg en es a n d th e pr oduction of tr an sg enic m ic e............................................................................... 90
B-GALACTOSIDASE STAINING, HISTOLOGY, AND IN SITU HYBRIDIZATION......................................................91
B M P BEAD IMPLANTATION ASSAY..............................................................................................................................91
GENOTYPING.......................................................................................................................................................................92
Electrophoretic M obility Shift A ss a y (E M S A ).........................................................................................92
Tr a n sg en ic fly a n a l y s is ..........................................................................................................................................92
BIBLIOGRAPHY........................................................................................................................... 93
v i
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
LIST OF FIGURES
Figure 1.1: Msx2 genomic map and promoter fragments...............................................9
Figure 1.2: Msx2 promoter-Luciferase assays.............................................................. 10
Figure 1.3: Msx2 transgene constructs............................................................................12
Figure 1.4: A3, A4Msx2-hsplacZ expresssion; BMP bead implantations....................13
Figure 1.5: Timed A4Msx2-hsplacZ limb bud staining (BMP induced).....................15
Figure 1.6: Map of consensus Smad site clustering......................................................17
Figure 1.7: A5Msx2-hsplacZ expression pattern and BMP responsiveness............... 18
Figure 1.8: A6 (52 bp) sequence; A4D transgene..........................................................21
Figure 1.9: A6 fragment is necessary for BMP responsiveness...................................22
Figure 1.10: A6Msx2-hsplacZ expression pattern at El 1.5......................................... 24
Figure 1.11: A6Msx2-hsplacZ expression pattern in earlier embryos.........................25
Figure 1.12: A6Msx2-hsplacZ expression pattern in vibrissae....................................27
Figure 1.13: Bmp2, Bmp4, Bmp7 expression in limb buds.......................................... 28
Figure 1.14: A6Msx2-hsplacZ expression in the limb bud.......................................... 29
Figure 1.15: A6Msx2 expression in the cardiac region (E9.5,10.5)...........................30
Figure 1.16: A6Msx2 expression in the OFT region (E12.5)....................................... 31
vii
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
Figure 1.17: A6Msx2 BMP responsiveness in the limb bud........................................ 33
Figure 1.18: A5Msx2-lacZ expression pattern in Drosophila...................................... 35
Figure 1.19: A6Msx2-lacZ expression pattern in Drosophila...................................... 36
Figure 1.20: mutation analysis of A6Msx2 transgene................................................... 38
Figure 1.21: auto-regulation of the A6Msx2 transgene.................................................42
Figure 1.22: Msxl/2 mutations affect BMP responsiveness........................................ 43
Figure 1.23: Msx2 chromatin immuno-precipitation assay......................................... 45
Figure 1.24: M sxlw ;Msx2('/') double mutant limb phenotype.....................................46
Figure 1.25: A6Msx2-hsplacZ expression in the mandible.......................................... 48
Figure 1.26: A6Msx2-hsplacZ limb expression (E15.5)...............................................50
Figure 1.27: GST-Smad4 can bind the A6Msx2 fragment............................................65
Figure 2.1: Msx2 expression in Splotch (in situ hybridization)...................................75
Figure 2.2: Msx2-lacZ transgene constructs................................................................. 77
Figure 2.3: AlMsx2-lacZ and A2Msx2-lacZ transgene expression............................. 78
Figure 2.4: A4Msx2-hsplacZ transgene expression.......................................................80
Figure 2.5: Pax3-responsive region of the Msx2 promoter...........................................82
Figure 2.6: Pax3 binds a consensus site in the Msx2 promoter....................................83
Figure 2.7: A4Msx2-hsplacZ mutation analysis............................................................84
viii
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
Table 2.1: A4Msx2-hsplacZ transgenic results
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
ABSTRACT
The process through which genes are controlled at their promoters by
temporally and spatially regulated transcription factors is complex and poorly
understood. Distinct modules of DNA are grouped together such that only certain
transcription factors can recognize and bind a promoter sequence for a given gene.
This selectivity of DNA binding, in addition to selective expression of transcription
factors, plays a major role in determining when and where a gene is expressed during
development. The Transforming Growth Factor-(3 (TGF-(3) superfamily is a large
class of secreted signaling ligands essential for the regulation of cell growth, cell
death, and differentiation during animal development. Bone Morphogenetic Proteins
(BMPs), the largest subclass in this family, play critical roles during the development
of many organs and tissues. Msx genes encode homeodomain-containing
transcription factors related to msh in Drosophila and belong to the NK class of
homeobox genes, whose members are highly conserved among metazoans, from
poriferans to chordates. BMPs are coexpressed with Msx genes in many sites during
development and both Msxl and Msx2 have an immediate early response to BMP
signaling. Here we report the identification and characterization of a 52 bp Msx2
promoter fragment capable of responding to endogenous and exogenous BMP2/4
ligand in a temporally and spatially restricted manner. This BMP-responsive module
is necessary for larger Msx2 promoter fragments to respond to BMP signaling and is
sufficient to respond to BMP signals in the mandible and limb buds. Function of this
element has been highly conserved through evolution as this module responds to
Dpp signaling in Drosophila in a spatially and temporally appropriate manner. We
x
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
identified a homeodomain transcription factor consensus site within this BMP-
responsive module that seems to act in concert with consensus Smadl and Smad4
sites to control gene expression in response to BMP signals. We also demonstrate
that M sxl and Msx2 can act through this homeodomain site to control the expression
and the BMP response of the 52 bp Msx2 transgene, suggesting auto-regulation of
gene expression may occur on the endogenous Msx2 promoter.
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
PREFACE
The process through which genes are controlled at their promoters by
temporally and spatially regulated transcription factors is complex and poorly
understood. It is known that distinct modules of DNA are grouped together such that
only certain transcription factors can recognize and bind a promoter sequence for a
given gene. This selectivity of DNA binding, in addition to the selective expression
of the transcription factors, plays a major role in determining when and where a gene
is expressed during development. Although different promoters often share similar
DNA modules, it is the specific combination and arrangement of such modules that
allows for distinct gene expression patterns. We are interested in how signaling
pathways control gene expression during development. Specifically, we want to
understand how transcription factors act to mediate gene expression for a given
signaling pathway. Msx2 is a homeobox gene transcription factor which plays a
significant role during many stages of development. Msx genes are ancient and
highly conserved, and are expressed in complex patterns, making their promoters
good models for studying gene regulation in embryogenesis.
Deciphering how promoters work to control gene expression is not only
essential for understanding development, but may someday prove relevant to
identifying novel clinical targets for treating birth defects and disease. Mutations
that rearrange or change critical promoter sequences can lead to the pathological
misexpression of genes. Understanding exactly which signaling pathways and
factors are acting through such promoter regions would make it easier to find
possible therapeutic remedies. Furthermore, many of the genes used in gene therapy
xii
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
are driven by viral promoters that lack control, tissue specificity, and are often
silenced as a result of epigenetic effects. A basic understanding of different
promoter sequences that are able to direct expression in specific tissues at specific
times would make gene therapy more practical and effective. Currently, lack of
knowledge about precise gene expression by endogenous human promoter elements
and the inability to deliver large promoter constructs in vectors makes such gene
therapy impossible. One can envision the creation of large human artificial
chromosomes that contain multiple therapeutic genes and critical portions of their
endogenous promoters so that expression is tightly controlled.
Msx genes play critical roles during development; abnormal Msx expression
has been implicated in multiple human defects. Thus, Msx2 is a logical gene to use
as a model for studying gene regulation during development. In the following two
chapters, I will discuss what we have learned about the regulation of Msx2 by
sequence specific transcription factors. In the first chapter, I describe how we
identified a module in the Msx2 promoter that responds to the BMP family of
signaling ligands. This module seems to be both necessary and sufficient for the
response of Msx2 transgenes to BMP signals. I identify consensus cis-regulatory
elements located within this BMP-responsive element and show that GC rich
elements and a consensus homeodomain site are essential for expression control and
probably BMP-responsiveness. I also describe in depth a few regions where the
BMP-responsive module is expressed and provide evidence that these regions of
expression accurately mark endogenous BMP signaling at multiple stages throughout
development. In addition, I present data suggesting that Msx2 is capable of auto
regulating its expression and response to BMP, probably through interactions at the
xiii
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
consensus homeodomain binding site located within this element. Finally, I discuss
other candidate transcription factor genes that may function through the consensus
homeodomain site. In the second chapter, I discuss how Pax3 controls Msx2 gene
expression in the developing dorsal neural tube and cardiac neural crest. To study
this epistatic relationship, we again used transgenic and mutant mouse models to
identify a functional transcription factor binding site in the Msx2 promoter. We
believe that Pax3 directly represses Msx2 transcription through this binding site
during murine cardiac development.
These results illustrate how the spatiotemporal pattern of Msx2 expression is
regulated during development through specific transcription factor binding sites.
Investigating Msx2 regulation is important because there are few well described
examples of developmentally regulated gene expression analysis in vivo. In our
experiments, BMP signaling and Pax3 can control expression of Msx2 differently;
Pax3 acts to repress Msx2 expression in the dorsal neural tube while BMP mediators
and Msx2 activate transgene expression in the limb bud. Although it is known that
BMP signaling requires specific signal transduction proteins (Smads) in addition to
sequence specific transcription factors, it is not known if Pax3 protein relies on
additional regulatory proteins to exert its effect. Even so, our experiments have
shown that for both signaling pathways, mutating a single consensus transcription
factor binding site can have a dramatic effect on expression control. Our studies may
provide key insights into understanding how BMP signaling and Pax3 regulate
promoters for other genes at multiple stages in multiple tissues.
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
CHAPTER 1-IDENTIFICATION AND CHARACTERIZATION
OF A BMP-RESPONSIVE MODULE IN THE Msx2 PROMOTER
INTRODUCTION
The Transforming Growth Factor-^ (TGF-(3) superfamily is a large class of
secreted signaling ligands that are essential for the regulation of cell growth, cell
death, and differentiation during animal development. This family includes the
TGF-(3s, Activins, and the Bone Morphogenetic Proteins (BMPs). BMPs, the largest
subclass in this family, play roles in axis formation and establishing polarity as well
as in the development of many organs and tissues. For example, BMP2 and BMP4
act to induce cartilage and bone, ventral mesoderm, cranial neural crest, epidermal
differentiation, and apoptosis (Francis-West et al., 1996; Graham et al., 1994; Hogan,
1996; Kanzler et al., 2000)
How BMP signals elicit such a wide range of biological responses is not well
understood. We are interested in how BMP signals regulate gene expression.
Accumulating data suggests that BMP signal transduction proteins, called Smads, act
in combination with sequence specific transcription factors to confer specificity on
gene activation. To better understand this process, one needs to study the expression
of genes immediately downstream of BMP signals. An example of such an
“immediate early” gene, which can respond to BMP signals in the absence of new
protein synthesis, is Msx2. Because Msx2 is well known as a BMP effector, and has
an immediate early response to BMP signals, its promoter represents a good model
for studying specific gene regulation by BMP signals.
1
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
The BMP signal is transduced to the nucleus by a well characterized
pathway. Signaling is initiated when BMP ligand is bound by a specific pair of Type
I membrane receptor serine-threonine kinases, acting in concert with a specific pair
of Type II membrane receptor serine-threonine kinases (Massague, 1998). High
affinity binding of ligand to the receptors is achieved only when both receptor types
are linked together, forming a heterotetramer; (Liu et al., 1995; Nishitoh et al., 1996;
Nohno et al., 1995; Rosenzweig et al., 1995; ten Dijke et al., 1994). This
heteromeric receptor complex is then auto-activated when the constitutively active
kinase domains of the Type II receptors phosphorylate the GS domain of the Type I
receptors (Massague, 1998; ten Dijke et al., 1996). The activated Type I receptors
then phosphorylate specific Smad family proteins, which are responsible for
communicating the signal from the membrane to the nucleus (Heldin et al., 1997).
The nine mammalian Smad proteins are divided into three classes based on
function; the pathway restricted Smads (1,2,3,5,8), the inhibitory Smads (6,7) and the
common mediator Smad4 (Massague and Chen, 2000). Biochemical studies have
shown that the receptor regulated Smads 2 and 3 transduce TGF-(3 and activin
signals specifically, while Smadl, 5, and 8 are responsible for transducing BMP
signals (Hoodless et al., 1996; Kretzschmar et al., 1997; Liu et al., 1996; Suzuki et
al., 1997; Wiersdorff et al., 1996; Zou et al., 1997). Pathway specific Smads and
Smad4 have two highly conserved protein domains; an amino-terminal MH1 domain
and a carboxy-terminal MH2 domain. In the unphosphorylated state, these two
domains bind each other to inhibit Smad interactions (Baker and Harland, 1996; Liu
et al., 1996). Once a receptor regulated Smad protein is phosphorylated, this
inhibition is relieved and it can associate with Smad4 (Kretzschmar et al., 1997;
2
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
Lagna et al., 1996). This Smad heterodimer then translocates to the nucleus where
target gene activation is achieved (Kretzschmar et al., 1997; Lagna et al., 1996; Liu
et al., 1997; Massague, 1998).
TGF-(3 superfamily signaling was initially deciphered by studying the
Decapentaplegic (Dpp) pathway in Drosophila. Dpp, the closely related ortholog of
BMP2/4, plays multiple critical roles during the development of Drosophila (Bienz,
1997; Ferguson and Anderson, 1992; Frasch, 1995; Lecuit et al., 1996; Spencer et
al., 1982; Zecca et al., 1995). There are two type I serine-threonine kinase receptors,
called Thickveins and Saxaphone, and one type II receptor Punt that transduce the
Dpp signal (Letsou et al., 1995; Nellen et al., 1994; Penton et al., 1994). The
founding member of the Smad gene family, called Mad, was identified because it
was found to be required for Dpp signaling in Drosophila (Raftery et al., 1995;
Sekelsky et al., 1995). Once Mad is phosphorylated, it translocates into the nucleus
with Medea, the Drosophila ortholog of Smad4 (Das et al., 1998 Wisotzkey et al.,
1998). Medea has been shown to act genetically downstream of dpp (Hudson et al.,
1998; Raftery et al., 1995). Although there are representative members for each step
of the Dpp signaling cascade, the pathway has fewer total members when compared
to the BMP signaling cascade.
Smad proteins can, in principle, regulate gene expression through promoters
in several different ways. The MH1 domain is capable of binding DNA directly in
the absence of cofactors (Kim et al., 1997) and the MH2 domain has been shown to
posses transactivation activity (Liu et al., 1997; Shioda et al., 1998). Such direct
binding by MAD can activate promoters in Dpp responsive genes (Kim et al., 1997;
Raftery and Sutherland, 1999; Szuts et al., 1998; Xu et al., 1998). Even though
3
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
Smads have the ability to bind DNA directly in a site-specific manner, they do so
with low affinity (Shi et al., 1998; Wrana, 2000). Thus, the biological significance
of such an “independent” Smad binding mechanism is not known. The Smad4 MH2
domain has been shown to form homotrimers in vitro and although there is evidence
that such trimeric interactions are important functionally (Shi et al., 1997), the
specific role of such trimeric interactions in vivo is not known (Whitman, 1998).
Examples of Smad3 homomers binding DNA in the absence of Smad4 also exist, but
the importance of such interactions in vivo has not been demonstrated (Vindevoghel
et al., 1998).
A second major mechanism by which Smads can regulate transcription is that
they can associate with sequence specific nuclear transcription factors once bound to
DNA, thus producing a synergistically active complex that is able to bind DNA with
higher affinity and specificity (Hua et al., 1998). A variation on this theme is that
Smads can associate with transcription factors prior to binding DNA, resulting in a
stable complex capable of specific, high affinity DNA binding and gene activation
(Chen et al., 1996; Huang et al., 1995; Liu et al., 1997). Because isolated Smad
MH1 domains bind DNA more strongly than full length Smads, such protein-protein
interactions might release inhibitory associations conferred by the MH2 domain or
cause an optimal DNA binding configuration to form. Smad proteins can also
associate with coactivators such as CBP/p300 (Feng et al., 1998; Janknecht et al.,
1998; Pouponnot et al., 1998) and corepressors (Wotton et al., 1999). Identifying
transcription factors capable of interacting with Smad proteins in response to BMP
signals is currently a topic of great interest.
4
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
Specificity of BMP signal transduction is achieved at several steps in the
pathway. First, there are several different type I (BMPRIA, BMPRIB, ActRl) and
type II receptors (BMPRII, ActRII) that can associate in different combinations
(Chen et al., 1998; Hogan, 1996; Liu et al., 1995; Macias-Silva et al., 1998;
Massague, 1998; Massague and Weis-Garcia, 1996; Nohno et al., 1995; Piek et al.,
1999). Second, there are structural elements in the Typel receptors and pathway
specific Smads which can confer specificity for receptor-Smad interactions (Chen et
al., 1998; Chen and Massague, 1999). Third, as has been shown in TGF-(3 signaling,
additional structural elements present in the pathway restricted Smads presumably
allow for association with specific nuclear factors (Chen et al., 1998).
The mechanisms that BMP specific Smad proteins and their associated
transcription factors use to activate target genes are not well defined. A major reason
for this is that to date, few BMP-responsive promoters have been thoroughly
investigated (Hata et al., 2000; Henningfeld et al., 2000; Liberatore et al., 2002; Lien
et al., 2002; Lopez-Rovira et al., 2002). Phosphorylated Smadl/MAD can
translocate to the nucleus by itself (Liu et al., 1997; Wisotzkey et al., 1998) and
although MAD can activate target gene expression in the absence of MEDEA/Smad4
in some tissues (Newfeld et al., 1996), it is not known if activation of gene
expression by Smad proteins alone is biologically significant in general. The DNA-
binding transcription factor OAZ has been found to associate with Smadl during
BMP2 induced activation of Xvent-2 in Xenopus (Hata et al., 2000). In addition, the
transcription factor Xvent-2 has been shown to act as a Smadl-specific coactivator
during maintenance of its own transcriptional regulation (Henningfeld et al., 2002).
Although it is predicted that specificity of BMP signaling must be conferred by such
5
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
sequence specific transcription factors, few examples of BMP-specific transcription
factors have been identified. We have addressed this lack of knowledge by
investigating a promoter that responds robustly to BMP2/4 signals, the Msx2
promoter.
Msx genes encode homeodomain-containing transcription factors related to
msh in Drosophila. The Msx genes belong to the NK class of homeobox genes,
whose members are highly conserved among metazoans, from poriferans to
chordates (Bell et al., 1993; Davidson, 1995; Hewitt et al., 1991; Hill et al., 1989;
Holland, 1991; Robert et al., 1989; Takahashi and Le Douarin, 1990; Yokouchi et
al., 1991). There are three Msx genes in mice (Davidson, 1995) and they perform
many fundamental and complex roles during organogenesis and embryogenesis
(Wang et al., 1996). Their roles in controlling apoptosis, differentiation, and
epithelial-mesenchymal tissue interactions are well described (Bidder et al., 1998;
Catron et al., 1996; Davidson, 1995; Graham et al., 1994; Liu et al., 1999; Lyons et
al., 1992; Mansouri et al., 2001; Marazzi et al., 1997; Su et al., 1991; Vainio et al.,
1993; Wang et al., 1996). Because the expression patterns of M sxl and Msx2 are
mostly overlapping in the mouse, it is thought that functional redundancy is
responsible for the somewhat mild, yet specific phenotypes observed in each
individual mutant (Satokata et al., 2000; Satokata and Maas, 1994).
BMPs are coexpressed with Msx genes in many sites during development
(Davidson, 1995; Francis-West et al., 1994; Hogan et al., 1994; Jones et al., 1991;
Phippard et al., 1996). Both Msxl and Msx2 have been shown to have an immediate
early response to BMP signaling (Hollnagel et al., 1999; Suzuki et al., 1997).
BMP2/4 can induce Msx gene expression in the developing limb bud, tooth
6
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
mesenchyme, facial primordia, neural tube, cranial neural crest, vertebra, hair
follicles, otic vesicle, and eye (Barlow and Francis-West, 1997; Furuta and Hogan,
1998, Graham et al., 1994; Kulessa et al., 2000; Monsoro-Burq et al., 1996; Peters
and Balling, 1999; Vainio et al., 1993; Watanabe and Le Douarin, 1996). In
addition, it has been shown that Msx2 can induce expression of Bmp2 and Bmp4
(Ferrari et al., 1998) and Msxl is required for the expression of Bmp2 and Bmp4 in
palatal mesenchyme (Zhang et al., 2002). The expression patterns of Bmp and Msx
genes in the developing embryo are spatially and temporally complex (Mackenzie et
al., 1991; MacKenzie et al., 1992; Takahashi and Le Douarin, 1990). We are
interested in how BMP signals elicit specific transcriptional responses. Ultimately,
we would like to understand how a signaling pathway can activate different genes in
different ways so that distinct spatiotemporal patterns are produced in response to
those signals.
Here we report the characterization of a BMP-responsive module in the Msx2
promoter. We identify a 52 bp element which is necessary for the BMP
responsiveness of a 560 bp Msx2 promoter fragment in transient transfection and
BMP bead implantations in transgenic embryos. In addition, we show that this 52 bp
element can direct expression to several sites of endogenous BMP signaling in
embryos, and it can respond to BMP ligand in bead implantation assays. Strikingly,
the function of this module has been conserved during evolution so that it responds
to BMP/Dpp signaling in Drosophila in a spatially and temporally restricted manner.
Finally, we demonstrate that Msxl and Msx2 can act through this BMP-responsive
module to control the expression and the BMP response of the 52 bp Msx2 transgene
by auto-regulation.
7
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
RESULTS
Localizing a BMP-responsive element in the Msx2 promoter
We showed previously that transgenic lines containing a 6.2 kb 5’ flanking
genomic fragment of the Msx2 promoter (fig. 1.1, A2) fused to a lacZ reporter
recapitulated endogenous Msx2 expression accurately in a variety of tissues during
embryonic development (Kwang et al., 2002; Lazik et al., 1996; Liu et al., 1994; Liu
et al., 1999). Since Msx2 expression is known to be regulated by the BMP pathway
in vivo, we suspected that the 6.2 kb fragment would contain the BMP-responsive
cis-regulatory machinery. We therefore screened a series of fragments within the 6.2
kb A2 promoter sequence for their ability to respond to BMP2/4 ligand in transient
transfection experiments. Luciferase constructs were generated by fusing the
different Msx2 promoter fragments to a TK minimal promoter in the PGL2 basic
vector (Promega). A 1.8 kb fragment located between -5082 and -3298 bp upstream
of the Msx2 translation start site (fig. 1.1, A3) was able to respond to exogenous
BMP2/4 ligand after transfection into 10T1/2 cells (fig. 1.2; 24 fold induction) or
P19 cells (Daluiski et al., 2001). A nearly identical 1.8 kb fragment (-5018 to -3203)
can drive expression of a lacZ reporter transgene in a pattern that replicates most of
the endogenous Msx2 expression pattern (Kwang et al., 2002). This finding suggests
that many of the promoter’s critical regulatory elements are present in the A3
deletion, including those that respond to BMP signals.
To localize important regulatory regions of the Msx2 promoter, we searched for
regions of identity between the human and murine Msx2 loci. As described
previously (Kwang et al., 2002), a 560 bp fragment of the Msx2 promoter (fig. 1.1,
8
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
Reproduced w ith permission o f th e copyright owner. Further reproduction prohibited without permission.
1 kb
i--------------------- 1
Hindlll Notl Hindlll Hindlll
1800 bp
A3
A4
560
220
52 bp
Murine Msx2 genomic map showing proximal 6.2 kb of promoter upstream of exonl. The 6.2 kb
fragment was used to make the A2Msx2-lacZ transgene, in which lacZ was inserted into exonl.
Promoter fragments used to generate additional lacZ transgenes and luciferase constructs are
shown below the genomic map (fragment designation to the left, fragment size to the right).
Figure 1.1: M sx2 genomic m ap a n d promoter fragments
Reproduced w ith permission o f th e copyright owner. Further reproduction prohibited without permission.
I
® sl« § S
® 2 5
o 1 5
■ K lli
O 10
^■pga
B 1.8Kb
■ 1.8Kb +BMP
□ 5 6 0 b p
■ 560bp +BM P
■ 5 1 Obp
■ 510bp +BM P
Reporter Constructs (Msx2-TK-Luciferase )
Msx2 promoter fragments are BMP-responsive. Constructs were transfected into 10T1/2 cells, induced
with BMP4 ligand 24 hours later, and cell lysates assayed for Luciferase activity after another 24 hours.
Shown are the corrected values for Luciferase activity with error bars, each done in triplicate. The 1.8 kb
A3Msx2 fragment is responsive to BMP4 ligand (24 fold induction), as is the 560 bp A4Msx2 fragment
(18 fold induction). The 510 bp A4DMsx2 fragment, which is missing the 52 bp A6Msx2 BMP-responsive
o module, is not responsive by this assay (1.6 fold induction).
Figure 1.2: M sx2 promoter-Luciferase assays
A4) is sufficient to direct expression in most areas where the endogenous gene is
expressed during embryonic development. This promoter fragment is striking
because a large portion of it (520 bp) shares 87% identity with sequence from the
human MSX2 locus (Kwang et. al, 2002). Few other fragments in the 5’ flanking
sequence of the entire Msx2 promoter (several hundred kb), including the 6.2 kb A2
region, share significant identity.
When tested in our luciferase assay, this 560 bp A4Msx2 fragment was able to
respond to BMP2/4 ligand with a similar relative activity (18 fold induction) to the
larger A3 fragment (fig. 1.2). Multiple independent transgenic embryos and three
stable lines containing a lacZ reporter fused to this promoter fragment were
generated (fig. 1.3A, A4Msx2-hsplacZ) (Kwang et al., 2002). The expression pattern
for this transgene was documented at several stages during development, including
E9.5 (Kwang et al., 2002) and El 1.5 (fig. 1.4A). This A4Msx2-hsplacZ expression
pattern is nearly identical to that produced by the larger 1.8 kb transgene (fig. 1.4B).
To localize the BMP-responsive region even further, we used a bead
implantation assay. For this assay, beads containing BMP4 ligand were placed on
tissues from transgenic mice carrying Msx2 promoter lacZ transgenes. If the
transgene being assayed is capable of responding to BMP signaling in a specific
tissue at a specific time, then the reporter gene should be activated by endogenous or
exogenous BMP ligand. Our hope was that this assay would help us understand how
there can be precise tissue specificity of a BMP-response even when the inducing
ligand is present in significant quantities in tissues in which there is no response. We
first assayed for the ability of limb buds derived from A4Msx2-hsplacZ transgenic
embryos (fig. 1.3A) to respond to exogenous BMP2/4 ligand in bead implantation
11
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
Reproduced w ith permission o f th e copyright owner. Further reproduction prohibited without permission.
A3Msx2-hsplacZ, A4Msx2-hsplacZ, A5Msx2-hsplacZ
Msx2 hsp68 LacZ polyA
Msx2
B.
hsp68
A6 Msx2-hsplacZ
LacZ polyA
> i i i
Schematic diagram of Msx2-lacZ transgene constructs. A) specified Msx2 promoter fragments (A3, A4, A5)
are fused to an hsp68 core minimal promoter, which is fused to a lacZ reporter gene, followed by a SV40 poly
adenylation signal. B) The 52 bp A6Msx2 fragment was multimerized in a head-to-tail fashion. This tetramer
construct was then fused to the same hsplacZ transgene as described above.
to
Figure 1.3: M sx2 transgene constructs
Reproduced w ith permission o f th e copyright owner. Further reproduction prohibited without permission.
560 bp (A4Msx2) 1.8 kb (A3Msx2)
BMP BSA BMP BSA
Whole mount images of E l 1.5 transgenic embryos showing similar expression patterns. A, C) A4Msx2
transgenic embryo and corresponding limb buds from bead implantation assay. B, D) A3Msx2 transgenic
embryo and corresponding limbs buds. Note that affigel-blue agarose beads have inherent light blue color.
Figure 1.4: A3, A4Msx2-hsplacZ expresssion; B M P bead implantations
experiments. We focused on limb buds because it is known BMPs play a key role in
the morphogenetic events of limb patterning and development (Hogan, 1996;
Kawakami et al., 1996; Pizette and Niswander, 2000; Yi et al., 2000), and because
Msx2 is expressed in the progress zone mesenchyme and apical ectodermal ridge
(AER) of developing limbs (Ahn et al., 2001; Liu et al., 1994; Pizette et al., 2001).
Limb buds were excised from El 1.5 embryos and cultured on transwell membranes.
Agarose beads containing either human BMP2/4 protein or BSA were then placed
centrally on the limb tissue prior to incubating O/N. On the following day, the limb
buds were stained for lacZ activity and scored for localized expression around the
BMP bead.
Each of the three stable 560 bp transgenic lines showed strong responsiveness
to BMP ligand (fig. 1.4C). BSA protein control beads never induced any response
(fig. 1.4C). As can be seen in figure 1.4C, BMP beads placed both proximally and
distally on the limb bud induced a response. When BMP beads were placed in either
a more proximal, distal, anterior or posterior position, a response was also elicited
(data not shown). The BMP-induced fi-Galactosidase signal increased with time in
the staining solution (fig. 1.5), and this response was spatially and temporally similar
to that observed with the 1.8 kb transgene (fig. 1.4D). A curious observation at early
time points was that a halo of lacZ negative cells could be seen around the BMP
containing bead (fig. 1.5, 30 minutes). This may represent a situation similar to that
observed in Drosophila wing imaginal discs where cells that produce Dpp at high
levels actually have very low levels of activated MAD (Tanimoto et al., 2000). The
response to BMP ligand seems to be identical on the dorsal and ventral surfaces of
both the forelimb and hindlimb. Although we did not carry out an extensive
14
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
Reproduced w ith permission o f th e copyright owner. Further reproduction prohibited without permission.
15 minutes 30 minutes 60 minutes
90 minutes 120 minutes
Timed staining of A4Msx2 limb buds after BMP bead implantation assay. Limbs were assayed
for lacZ activity for the specified amounts of time prior to washing in PBS to stop the reaction.
All limbs were exposed to BMP beads for the same amount of time prior to staining.
Figure 1.5: Timed A4Msx2-hsplacZ lim b b u d staining (B M P induced)
spatiotemporal survey of BMP-responsive tissues in the A4Msx2-hsplacZ lines, other
tissues that were able to respond to exogenous BMP ligand at El 1.5 are the tail,
mandible, face, and nasal region (data not shown).
Further deletion analysis within the 560 bp fragment was carried out. A 220 bp
fragment (fig. 1.1, A5) comprising the 3’end of the 560 bp fragment was generated
based on the clustering of numerous Smadl and Smad4 consensus binding sites
(Ishida et al., 2000; Johnson et al., 1999; Kusanagi et al., 2000; Lopez-Rovira et al.,
2002; Zawel et al., 1998). Because consensus Smadl/MAD binding sites have been
found in BMP/Dpp-responsive promoter elements already identified (Kim et al.,
1997; Henningfeld et al., 2000), their presence should be predictive. Within this 220
bp region are located 83% (10/12) of the total putative Smadl sites and 58%
(68/118) of the putative Smad4 sites (fig. 1.6). This 220 bp A5 fragment was able to
direct expression in a pattern that was remarkably similar to the 560 bp fragment
(compare fig. 1.7A, B). As can be seen in figure 1.7C and D, expression in the face,
head and neural tube is nearly identical between the two transgenes. One region of
the embryo where an obvious difference in expression can be seen is the posterior
limb bud mesenchyme (arrow, fig. 1.7E). Here, the A5Msx2-hsplacZ transgene is no
longer expressed accurately in the mesenchyme, although normal expression is
retained in the AER (fig. 1.7C). When limbs from A5Msx2-hsplacZ transgenic
embryos were assayed for BMP-responsiveness, we found that both the proximal and
distal beads generated a strong positive response (fig. 1.7E), while the BSA bead did
not (data not shown).
16
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
Reproduced w ith permission o f th e copyright owner. Further reproduction prohibited without permission.
18.00
16.00
< 0
£ 14.00
to
Z J
(0
c
< D
(A
C
o
o
0 )
E
3
z
12.00
10.00
8.00
2.00
2 3 4 5 6 7
70 bp increments (560 bp total)
8
H Smad 4
■ Smad 1
Distribution of Smadl and Smad4 consensus elements within the 560 bp A4Msx2 fragment. Smad
sites found within the 220 bp A5Msx2 fragment are located in segments 6-8. Smad4 sites were
identified by the sequence GNCN/GNCT and Smadl sites by the sequence GCCG.
Figure 1.6: M ap o f consensus Sm ad site clustering
Reproduced w ith permission o f th e copyright owner. Further reproduction prohibited without permission.
220 bp (A5Msx2) BMP
560 bp (A4Msx2
Whole mount images of El 1.5 transgenic embryos stained for lacZ activity. A, C, E) A5Msx2-hsplacZ
embryo with lateral, ventral view and corresponding limb bud from BMP bead implantation assay. B, D,
F) A4Msx2-hsplacZ transgenic embryo with lateral, ventral view and corresponding limb bud (as above).
Figure 1.7: A5Msx2-hsplacZ expression pattern a n d B M P responsiveness
Identification of a 52 bp Msx2 promoter fragment necessary for BMP-responsiveness
When we compared the overlapping regions of different promoter fragments
spanning the 220 bp A5Msx2 element, we found that only those transgenes
containing the extreme 5’ region of the A5 fragment were BMP-responsive. We then
scrutinized the sequence in this 5’ region for sequence specific transcription factor
binding sites. We did this because it has been shown in multiple TGF-(3 and Activin
target genes that Smads can be sequestered to regulatory elements in promoters by
their association with sequence specific transcription factors (Chen et al., 1996; Chen
et al., 1997; Labbe et al., 1998; Labbe et al., 2000; Liu et al., 1997; Massague, 1998;
Wrana, 2000; Zhou et al., 1998). Once this interaction occurs, the Smad MH1
domain binds DNA with high affinity on adjacent sites, which leads to a stable and
active transcriptional complex.
Ultimately, we identified a 52 bp region that we suspected might be important
for BMP-responsiveness in the limb bud assay. We chose this region because it
contained a TAAT homeodomain transcription factor consensus site (Gehring et al.,
1994) with Smadl and Smad4 consensus sites located on each side. Although
transcription factor consensus sites can be found throughout the 220 bp A5Msx2
fragment, few are surrounded by predicted Smadl and Smad4 consensus sites. This
element is located at the 5’ end of the 220 bp fragment (fig. 1.1, A6) and shares 96%
identity with sequence from the human MSX2 locus. Moreover, the promoter
sequence immediately upstream and downstream of this 52 bp fragment (160 bp
combined) shares 95% identity with the human MSX2 locus (Kwang et al., 2002).
This 52 bp fragment is GC rich (75%) and contains numerous putative Smad binding
19
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
sites (fig. 1.8A); including five Mad/Smadl consensus GCCG binding sites (Kim et
al., 1997; Kusanagi et al., 2000) and sixteen Smad4 binding sites with the degenerate
consensus sequence GNCT or GNCN (Johnson et al., 1999; Shi et al., 1998; Zawel
et al., 1998). Interestingly, Smadl has also been shown to bind the GTCT
consensus site (Johnson et al., 1999; Shi et al., 1998). These abutting Smad sites are
arranged in forward and reverse orientation, a pattern seen in many natural TGF-(3
and Dpp-responsive promoter elements (Johnson et al., 1999). Since the
homeodomain consensus site is flanked by both Smadl and Smad4 sites (fig. 1.8A),
we suspected it might have a role in conferring specificity of a BMP response if the
fragment was in fact active.
To determine if the 52 bp sequence was important for BMP responsiveness in
the context of the 560 bp A4 fragment, we generated a 510 bp promoter fragment in
which the 52 bp element was deleted (fig. 1.8B, A4D). Transgenic embryos (7 total)
were produced and BMP2/4 bead implantation assays performed. As can be seen by
comparing the El 1.5 embryos in figure 1.9A and B, deletion of the 52 bp BMP
responsive element results in a dramatic loss of transgene activity in most of the
tissues where it is normally expressed. In four other A4DMsx2-hsplacZ embryos,
there was almost no transgene expression (data not shown). Interestingly though, in
one A4D transgenic embryo, the effect of the mutation was less severe (fig. 1.9C). In
this embryo, several sites of transgene expression were maintained, including
anterior limb mesenchyme (arrow, fig. 1.9F). Despite this finding, BMP bead
implantations in limb buds from all the A4D transgenic embryos were negative (fig.
1.9E, F). That a A4DMsx2-hsplacZ embryo capable of some limb bud expression
did not respond to BMP2/4 ligand is significant because it shows that BMP
20
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
Reproduced w ith permission o f th e copyright owner. Further reproduction prohibited without permission.
10 20 30 40 50
I I I I I
A. A G G C T G A G T G C C G G G C C G A G A G C A ATTAAC G C G G C T C C G G C C G G G C A G G C G C
TC C G A C TC A C G G C C C G G C TC TC G TTA A TTG C G C C G A G G C C G G C C C G TC C G C G
(Smad4=GNCT, GNCN) (Smadl=GCCG) (Homeodomain=TAAT)
B. A4
A4D
A) Sequence of 52 bp A6Msx2 fragment. Putative Smad4 consensus sites are shown in blue, Smadl
consensus sites in red, and the homeodomain consensus in green (defined consensus elements are
also shown below). B) Schematic diagram of how the 510 bp A4DMsx2 fragment was made. To
generate this construct, the 52 bp A6Msx2 fragment was deleted.
to
Figure 1.8: A 6 (5 2 bp) sequence; A 4 D transgene
Reproduced w ith permission o f th e copyright owner. Further reproduction prohibited without permission.
560 bp (A4Msx2) 510 bp#l (A4DMsx2) 510 bp#2 (A4DMsx2)
BMP BMP BMP
Comparison of A4Msx2 and A4DMsx2 expression patterns and BMP responsiveness. A, B, C) Whole mount
lacZ stained El 1.5 transgenic embryos. D, E, F) Forelimbs from embryos shown in A, B, and C, after BMP
bead implantation assay; a response is only seen in MMsx2 limb (D). Arrow in (F) designates region of
anterior limb bud expression retained in this specific A4DMsx2 embryo.
to
to
Figure 1.9; A 6 fragment i s necessary fo r B M P responsiveness
responsiveness in the limb bud assay is not dependent upon the ability of the
transgene to express there. It is always possible this transgene expression pattern
resulted from integration position effect.
We also tested whether deletion of the 52 bp element would result in an
inability of the 510 bp fragment to respond to BMP ligand in a transient transfection
assay. As can be seen in figure 1.2, while the 560 bp A6 promoter construct was
induced 18 fold by BMP treatment, the 510 bp A4D promoter construct was induced
only 1.6 fold. This observation, along with the transgenic data, suggest the 52 bp
element is critical for the BMP responsiveness of the 560 bp A4 Msx2 promoter
fragment, and possibly larger Msx2 promoter fragments. Importantly, the uninduced
basal level of reporter gene activity was not significantly reduced for the 510 bp
fragment (compared to the parental fragment), suggesting the deletion did not render
the fragment incapable of driving reporter gene expression.
The 52 bp module is sufficient for BMP responsiveness in the limb bud
To test whether the 52 bp A6 promoter fragment was capable of responding
to BMP signaling in isolation, we multimerized the A6 fragment into a tetramer, with
each fragment in the same orientation (fig. 1.3B, A6Msx2-hsplacZ). Numerous
independent transgenic embryos (seven total) and three different stable lines were
produced with all showing similar expression patterns (compare fig. 1.10A, B).
Expression of the A6Msx2-hsplacZ transgene was first evident between E8.0 and
E8.5 in the conotruncus, adjacent pharyngeal region, and allantois (fig. 1.11 A). By
E9.5, the expression pattern changed very little, but now strong expression was
evident in pharyngeal arches 1 and 2 (fig. 1.1 IB). The expression pattern at E10-
23
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
Reproduced w ith permission o f th e copyright owner. Further reproduction prohibited without permission.
52 bp (A6Msx2 tetramer#!) 52 bp (A6Msx2 tetramer#2)
A6Msx2 expression pattern is similar in multiple transgenic lines. A, B) Whole mount lacZ stained E l 1.5
transgenic embryos. All A6Msx2 transgenic embryos looked at showed similar expre ssion patterns. The
common regions of expression seen at this stage are the anterior limb bud (alb), cardiac outflow tract (oft),
otic region (ot), nasal region (na), eye, midbrain (mb), ventral neural tube ( vnt) and genital tubercle.
to
Figure 1.10: A6Msx2-hsplacZ expression pattern a t El 1.5
Reproduced w ith permission o f th e copyright owner. Further reproduction prohibited without permission.
A. B. C.
E8.5 E9.5 E10
A6Msx2 (tetramer line #1) expression pattern at early stages. A) E8.5 whole mount lacZ stained
embryo. B) E9.5 whole mount lacZ stained embryo. C) E10 whole mount lacZ stained embryo.
At these stages, strong transgene expression can be seen in the pharyngeal arches (pa), pharyngeal
endoderm (pe), outflow tract of the heart (oft), and the allantois (al).
Figure 1.11: A6Msx2-hsplacZ expression pattern i n earlier embryos
E10.5 was similar to that seen at E9.5 (fig. 1.11C). Regions of expression
consistently seen at E l0.5 include the anterior limb bud, allantois, pharyngeal arches
and the outflow tract (OFT) of the heart; at El 1.5, the anterior limb bud
mesenchyme, genital tubercle, outflow tract of the heart, ventral neural tube,
midbrain, otic vesicle, eye, mandible, and nasal epithelium (fig. 1.10A, B). Later in
development, expression can be found in vibrissae hair follicles (fig. 1.12A, B), and
inner ear structures (data not shown).
The majority of these regions are known sites of BMP2/4 signaling (Chang et
al., 1999 (Chang et al., 1999; Fujiwara et al., 2001; Furuta and Hogan, 1998; Hogan,
1996; Lawson et al., 1999; Tremblay et al., 2001). As can be seen more clearly in
later stages, developing forelimbs from A6Msx2-hsplacZ embryos have transgene
expression in regions that match that seen in Bmp2, Bmp4 and Bmp7 in situ
hybridizations (compare fig. 1.13, 1.14A). This A6Msx2 expression pattern
represents a modified subset of that seen for larger A4Msx2-hsplacZ transgene (fig.
1.14B). Sagittal sections through the cardiac region of E9.5 A6Msx2-hsplacZ
embryos shows transgene expression in pharyngeal arch mesenchyme, pharyngeal
endoderm, and the OFT (conotruncus) endocardial cushion (fig. 1.15A). Similar
sections through E10.5 embryos show expression in first pharyngeal arch
mesenchyme and the OFT cushion (fig. 1.15B). Transverse sections of the OFT
region at E12.5 show A6Msx2-hsplacZ transgene expression is localized to
myocardium in the conotruncus (fig. 1.16A) and OFT cushion in the area of septum
formation (fig. 1.16B). The fact that both Bmp2 and Bmp4 expression has been
documented in the OFT myocardium (Abdelwahid et al., 2001; Jones et al., 1991;
26
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
Reproduced w ith permission o f th e copyright owner. Further reproduction prohibited without permission.
E15.5 A6Msx2 expression in vibrissae. A) Transverse paraffin section was cut through the head
of a whole mount lacZ stained transgenic embryo (tetramer line#l). B) slightly higher magnificati on
of additional hair follicles from another section. In both A and B, lacZ expression can be seen in
developing hair shafts. Sections are counter-stained with nuclear fast red and imaged under brightfield.
to
~ o
Figure 1.12: A6Msx2-hsplacZ expression pattern i n vibrissae
Reproduced w ith permission o f th e copyright owner. Further reproduction prohibited without permission.
BMP2
BMP4
BMP7
(taken from Hogan, 1996)
11.5 d p c 12.5 d p c 13.5 d p c
Whole mount Bmp in situ hybridizations of developing murine limb buds.
Probes to Bmp2, Bmp4 and Bmp7 are shown and the stages (dpc) are indicated
above. Note the interdigit staining for Bmp2 and Bmp7 at E12.5 and E13.5.
to
00
Figure 1.13: Bmp2, Bmp4, Bmp7 expression i n lim b buds
Reproduced w ith permission o f th e copyright owner. Further reproduction prohibited without permission.
El 1.5 E12.5 E13.5
A6Msx2 and A4Msx2 limb bud expression. A) limb buds from whole mount lacZ
stained A6Msx2 embryos are shown at three stages. B) similar A4Msx2 limb buds are
shown at two stages. All limb buds are left forelimbs, shown from the dorsal side with
anterior up. Note interdigit staining for both fragments at E l3.5.
Figure 1.14: A6Msx2-hsplacZ expression i n th e lim b bud
Reproduced w ith permission o f th e copyright owner. Further reproduction prohibited without permission.
A. B.
pam
oft
A6Msx2 cardiac expression (tetramer line#l). A) sagittal paraffin section of whole mount lacZ
stained E9.5 embryo. Strong transgene expression can be seen in the first pharyngeal arch, pharyngeal
endoderm, and the outflow tract. B) similar sagittal section of E10.5 embryo. Expression can be seen
in the first pharyngeal arch and the outflow tract cushion. Ventral neural tube expression is also visible,
pam, pharyngeal arch mesenchyme; pe, pharyngeal endoderm; oft, outflow tract; vnt, ventral neural tube
u >
o
Figure 1.15: A6Msx2 expression i n th e cardiac region (E9.5,10.5)
Reproduced w ith permission o f th e copyright owner. Further reproduction prohibited without permission.
A. B.
con y .
left ven
Right ven
A6Msx2 expression in outflow tract(tetramer line#l). A) transverse paraffin section of whole mount
lacZ stained E12.5 embryo at the level of the conotruncus, below the region of the valves. Transgene
expression is only seen in myocardium of the conotruncus at this level and stage. B) transverse section
of distal outflow tract from same embryo (higher magnification); expression can be seen in outflow tract
cushion in region of septum formation, con, conotruncus; ven, ventricle; at, atrium; oft, outflow tract.
Figure 1.16: A6Msx2 expression i n th e O F T region (E12.5)
Yamagishi et al., 1999) strongly suggests the A6Msx2 fragment is responding to
BMP signals in these cardiac tissues.
When we tested A6Msx2-hsplacZ limb buds in the BMP bead implantation
assay, we found that this element was in fact capable of a strong, though spatially
restricted, BMP response (fig. 1.17A, B). Specifically, BMP beads induced lacZ
expression only in the distal-central limb bud; there was no response to the proximal
bead (fig. 1.17A). In addition, although anterior limb bud tissue was also responsive,
tissue located near all other edges of the limb bud were not (fig. 1.17C). Of all the
tissues other than the limb bud found to be responsive to BMP beads in A4Msx2-
hsplacZ embryos, only the mandible seems to be responsive to exogenous BMP2/4
ligand in these 52 bp A6Msx2-hsplacZ transgenic lines at E l 1.5 (fig. 1.25).
The 220 bp and 52 bp Msx2 promoter fragments are Dpp-responsive in Drosophila
Dpp signaling in Drosophila has been well characterized through extensive
studies, as has TGF-(3 superfamily signaling in mammals. Such studies indicate
there is high conservation between the signal transducing components of the Dpp
and BMP pathways. Based on this conservation, we postulated that the Msx2 BMP-
responsive promoter fragments would respond to Dpp signaling in transgenic flies.
Interestingly, even though the promoter sequence encompassing the 52 bp A6Msx2
fragment has been highly conserved between mice and humans, there does not seem
to be any region in the Drosophila genome which shares this identity. To determine
if sequence conservation is critical for expression control between distant organisms,
we tested Msx2 promoter elements for conservation of function in transgenic flies.
32
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
Reproduced w ith permission o f th e copyright owner. Further reproduction prohibited without permission.
A6Msx2 tetramer#1 A6Msx2 tetramer#2
A6Msx2 tetramer#2
BMP bead implantation assays. Limb buds from E l 1.5 A6Msx2 embryos were excised and
bead implantations performed. A) two BMP beads were placed on limb bud prior to incubating
overnight. B, C) either one BMP bead, or multiple BMP beads were placed on limb buds prior
to incubating overnight. The following day, all limbbuds were fixed and then stained for lacZ
activity. Note that on all three limbs there is only a response around the bead placed in the
middle of the limb. All limbs are left forelimbs, shown from the dorsal side, anterior up.
Figure 1.17: A6Msx2 B M P responsiveness i n th e lim b bud
When transgenic flies were created using the 220 bp A5Msx2 fragment, we
found that transgene expression did in fact mimic Dpp patterns. In Drosophila
embryo visceral mesoderm, dpp expression is restricted to parasegments (ps) 3 and 7
by the function of genes from the HOM/HOX cluster (Bienz, 1994). Dpp secreted
by ps3 and 7 then controls gene expression in specific regions, including the gut. As
can be seen in fig. 1.18, A5Msx2 expression is present in ps3 and 7 during embryo
development in a pattern which matches that of dpp probe (compare fig. 1.18A, B).
This transgene expression can be forced to expand throughout the gut when ectopic
dpp expression is induced with a heat shock promoter (fig. 1.18C). Additionally,
when this A5Msx2 transgene is analyzed in Sll/dppS22 regulatory mutants, lacZ
expression is lost in ps3, but not ps7. This loss of expression in ps3 perfectly reflects
the specific loss of dpp expression in ps3 of Sll/dppS22 embryos (fig. 1.18D, E).
The multimerized A6Msx2 element linked to lacZ was also tested for expression
in transgenic flies. In the early blastoderm embryo, dpp expression is localized to
the dorsal half of the embryo (fig. 1.19A). Expression of the A6Msx2-hsplacZ
transgene matches this dpp pattern as it is localized to the mid dorsal region of the
early blastoderm embryo (fig. 1.19B). In screw (sew) mutants, which have reduced
dpp expression, A6Msx2-hsplacZ transgene expression is lost (fig. 1.19C). When
Dpp signaling is activated ectopically using the Tub Gal4>UAS Dpp transgene,
misexpression of the A6Msx2 transgene results (fig. 1.19D). This expansion of lacZ
activity is restricted to the dorsal half of the embryo and mimics the expansion of
dorsal tissues seen in embryos with ectopic Dpp activity (D'Alessio and Frasch,
1996; Jazwinska et al., 1999). As can be seen in fig. 1.19E, when the Dpp antagonist
brinker (brk) is absent, there is an expansion of the A6Msx2 transgene expression
34
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
Reproduced w ith permission o f th e copyright owner. Further reproduction prohibited without permission.
dpp (wt) A5Msx2 (wt) A5Msx2 (ectopic Dpp)
A5Msx2 (Sll/dppS22 mutant)
dpp (Sll/dppS22 mutant)
The A5Msx2 fragment responds to Dpp in stage 13 Drosophila embryos. A) dpp probe in wildtype
embryo shows expression in parasegment 3 and 7 of the gut. B) A5Msx2 expression showing similar
expression pattern in gut. C) A5Msx2 expression shows expansion in the gut when ectopic Dpp is
driven by a heat shock promoter. D) dpp probe in dppSl l/dppS22 regulatory mutants shows loss of
endogenous dpp expression in parasegment 3. E) A5Msx2 expression in dppSll/dppS22 regulatory
mutants reflects loss of Dpp signaling in parasegment 3.
Figure 1.18: A5Msx2-lacZ expression pattern i n Drosophila
Reproduced w ith permission o f th e copyright owner. Further reproduction prohibited without permission.
dpp (wt) A6Msx2 (wt) A6Msx2 (screw mutant)
A6Msx2 (brinker mutant) A6Msx2 (ectopic Dpp)
The A6Msx2 fragment responds to Dpp in Drosophila early blastoderm embryos. A) dpp probe in
wildtype embryo shows expression is restricted to the dorsal half of the embryo. B) A6Msx2 expression
corresponds to peak levels of Dpp in the mid-dorsal region of embryo. C) A6Msx2 expression is lost in
sew mutants which have reduced levels of Dpp signaling. D) A6Msx2 misexpression is observed in the
dorsal half of the embryo when there is ectopic activation of Dpp signaling using Tub Gal4>UAS Dpp.
E) A6Msx2 misexpression is observed in brk mutants which have increased Dpp signaling.
Os
Figure 1.19: A6Msx2-lacZ expression pattern i n Drosophila
similar to that seen in 1.19D. In older stage 8 embryos, transgene expression is
evident in the dorsal cephalic region, the posterior midgut, and the future
amnioserosa cells (data not shown). All of these regions exhibit Dpp signaling
during development and all show expanded A6Msx2 transgene expression in the Tub
Gal4>UAS Dpp mutant background (data not shown). These experiments show that
the Drosophila Dpp regulatory machinery is able to translate information from the
murine cis-regulatory element into a spatially and temporally appropriate response.
Therefore, there has been strong conservation of function for this BMP-responsive
module over at least 500 million years of evolution.
Analysis of potential cis-regulatory sites within the BMP-responsive module
To identify regions of the 52 bp BMP-responsive element that are critical for
binding regulatory proteins involved in the BMP-response, we generated A6 tetramer
transgenes that contained two distinct mutations. First, we mutated four putative
Smadl consensus sites in combination (fig. 1.20A, 15 nucleotides total). These
mutations were similar to those used to abolish activity of an artificial BMP-
responsive Smad-binding element (Kusanagi et al., 2000). Multiple independent
transgenic embryos (7 total) were obtained at El 1.5. Three of these showed reduced
expression in most regions compared to that seen with the wild type sequence
(compare fig. 1.20B, C), while four others showed no expression at all (data not
shown). Anterior limb bud expression was lost in all of these embryos and none
were BMP-responsive by bead implantation assay in the limb bud (compare fig.
1.20E, F) or in the mandible (data not shown). Interestingly, some embryos showed
37
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
Reproduced w ith permission o f th e copyright owner. Further reproduction prohibited without permission.
A G T A C T -A T TCGTAC
A AGGCTGAGTGCCGGGCCGAGAGCAATTAACGCGGCTCCGGCCGGGCAGGCGC
TCCGACTCACGGCCCGGCTCTCGTTAATTGCGCCGAGGCCGGCCCGTCCGCG
T T - A — A TG T
Tetramer line#l Smadl site mutant HD site mutant
A6Msx2 mutation analysis. A) 52 bp sequence with nucleotide changes used to make the mutant
transgenes shown above and below. For the Smadl site mutant, a total of 15 nucleotieds where changed
to alter the GCCG consensus. For the homeodomain site mutant, 6 nucleotides where changed to alter the
AATTAA core. B, E) whole mount lacZ stained El 1.5 embryo (tetramer #1) and corresponding limb bud
from BMP bead implantation assay. C, F) Smadl site mutant and corresponding limb bud (showing no
co BMP response). Arrows denote regions of ectopic or enhanced expre ssion. D, G) Homeodomain site
mutant and corresponding limb bud (also showing no BMP response).
Figure 1.20: mutation analysis o f A6Msx2 transgene
abnormally strong expression in certain tissues, or developed regions of ectopic
expression in others such as in the C1-C5 vertebral centrum (arrows, fig. 1.20C).
To test whether homeobox genes might play a role in directing the expression
and BMP-responsiveness of our 52 bp A6Msx2 element, we mutated the core 6
nucleotides of the homeodomain consensus site (fig. 1.20A) in isolation and did
similar experiments as with the Smadl mutant transgenes. After analyzing 13
independent El 1.5 transgenic embryos, we found that expression was almost
completely lost in all regions; more specifically, in four embryos, only ventral neural
tube expression was retained consistently (fig. 1.20D). Other regions of expression
such as the eye and midbrain were more sporadic and 9 transgenic embryos showed
no expression at all. Most importantly, BMP bead implantations on the limb buds
did not elicit lacZ expression (fig. 1.20G). Together, these experiments show the
homeodomain and Smadl consensus sites are essential for correct expression of this
BMP-responsive module. These experiments also suggest that the putative binding
sites are essential for BMP-responsiveness. We stress however, that since limb bud
expression has been completely lost in all regions, it remains possible that BMP
responsiveness of the A6Msx2 fragment in the limb bud is dependent on the ability of
the transgene to express there.
To determine if these same transcription factor consensus sites function
during Dpp signaling, we tested whether the mutations would have an effect on Dpp
responsiveness in Drosophila embryos. When transgenic flies were made as before
with the Smadl site mutant transgene, expression was lost (data not shown). When
the transgene bearing the mutated homeodomain consensus site was used, the effect
was less severe (data not shown). This suggests that Smad 1/MAD sites are critical
39
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
for the Dpp response in Drosophila, while the homeodomain site is not. These data
also support our observation that the 52 bp element is able to act more like a “raw”
Dpp-responsive element in Drosophila because it is not dependent upon input from a
homeobox gene, or any other gene that may function through the TAAT site.
Trans-regulatorv factors that act through the BMP-responsive module
Ultimately, we wished to find regulatory proteins that bind the A6Msx2
homeodomain consensus site in vivo. We identified potential candidate homeobox
genes that might be acting through this element based on expression patterns, mutant
phenotypes, and known epistatic relationships. The candidate genes we chose to
investigate initially are Msxl, Msx2, Prxl, Prx2, and Alx4.
The idea that Msx genes may be required in an auto-regulatory manner for the
function of the 52 bp BMP-responsive element is based on several considerations.
First, it has been shown in Xenopus that Xmsx-1 can physically associate with
pathway restricted Smads and the common mediator Smad4 (Yamamoto et al.,
2001). In addition, recent work in Xenopus has shown that Smadl and Xvent-2
physically interact, and that Xvent-2 directly participates (with Smadl) in its own
transcriptional maintenance through an auto-regulatory mechanism (Henningfeld et
al., 2002). It has also been suggested that Msx2 may function in the auto-regulation
of a chicken Msx2 AER enhancer element (Pan et al., 2002). In light of these
findings, we decided to test whether Msxl and/or Msx2 might be functioning through
the A6Msx2 homeodomain site in vivo.
To accomplish this, we bred the A6Msx2-hsplacZ transgene into the Msxl/2
double mutant background. El 1.5 embryos were harvested with all potential Msxl/2
40
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
mutant genotypes for comparison of lacZ expression patterns. We found that in the
hindlimb of El 1.5 Msxl'1 ' ;Msx2'' double mutant embryos, the anterior region of
expression normally seen in A6Msx2-hsplacZ embryos was lost (compare fig. 1.21A,
C). This region of expression was also diminished in Msx2'A embryos (fig. 1.21B).
When BMP bead implantations were carried out on M sxl+ /';Msx2+ /' hindlimbs, the
response was attenuated compared to that from wild type hindlimbs (compare fig.
1.22A, B). M sxl1 ' hindlimbs also showed an attenuated BMP response (data not
shown). Thus, Msxl and Msx2 have an auto-regulatory role and participate in both
the maintenance of A6Msx2-hsplacZ transgene expression and its BMP responsive
ness during hindlimb development. Determining exactly how the double mutant
background affects BMP responsiveness is currently in progress.
Our transgenic experiments show that Msx genes play either a direct or indirect
role in controlling A6Msx2-hsplacZ transgene expression and BMP responsiveness in
the developing hindlimb. However, they do not address whether Msx proteins bind
the homeodomain consensus site on the endogenous Msx2 promoter to control
expression through an auto-regulatory feedback loop in vivo. To test this possibility,
we performed a chromatin immuno-precipitation (ChIP) assay. The ChIP assay is
appropriate because transcription factors that directly associate with a specific
endogenous promoter element following BMP induction can be identified. We used
C14 cells for our source of chromatin as they are derived from undifferentiated E l3
limb bud mesenchyme tissue and represent a good approximation of the cells being
assayed by bead implantation. For the assay, C14 cells were induced with BMP2/4
ligand and chromatin was isolated the following day after crosslinking. An antibody
specific for Msx2 was then used to check for the presence of protein at the A6Msx2
41
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
Reproduced w ith permission o f th e copyright owner. Further reproduction prohibited without permission.
Msx2'f- mutant
Msxl- /-;27' mutant
A6Msx2 expression analysis in the Msx mutant background. All embryos are whole
mount lacZ stained El 1.5 embryos from tetramer line#l. A) wild type background shows
normal transgene expression pattern. B) expression in the anterior portion of the hindlimb
is reduced in the Msx2_ /‘ background. C) anterior hindlimb expression is totally absent in
the M sxl'/v27' mutant background. There may also be a reduction of expression in the
^ anterior region of the forelimb and the outflow tract.
Figure 1.21: auto-regulation o f th e A6Msx2 transgene
Reproduced w ith permission o f th e copyright owner. Further reproduction prohibited without permission.
Wild Type Msxl+ I';2+ I ■
BMP bead implantations in the Msx mutant background. A) a normal response is seen in the
wild type background (tetramer line#l). B) in the heterozygous mutant background, this
response is significantly attenuated compared to that seen for the wild type. The expression
visible around the proximal bead seems to be from its more distal positioning. Both limb buds
are left hindlimbs, viewed from the dorsal side, anterior up.
U>
Figure 1.22: Msxl/2 mutations affect B M P responsiveness
homeodomain consensus site by immuno-precipitation. After performing PCR using
primers that flank the A6Msx2 region, we found that Msx2 was in fact recruited to
the region of the endogenous Msx2 promoter that contains the A6Msx2 fragment
upon stimulation by BMP ligand (fig. 1.23A). No Msx2 protein was found to
associate with this 52 bp element in the absence of BMP induction (fig. 1.23B). As
expected, RNA polymerase II was also found to associate with the A6Msx2 region
after induction with BMP2/4 ligand (compare fig. 1.23C, D). Control PCR reactions
done using template from “minus antibody4 1 immuno-precipitations showed no
product (data not shown).
This experiment, along with the transgenic data, show that (1) Msx2 is required
for A6Msx2-hsplacZ hindlimb expression in embryos, (2) Msx2 functions to confer
BMP responsiveness on this A6Msx2 fragment (possibly by associating with Smad
proteins) and (3) Msx2 can associate with this A6Msx2 region in vivo after induction
by BMP, thus suggesting auto-regulation. Although limb defects are not present in
either the Msxl or Msx2 mutant mouse, we found morphological differences between
the hindlimbs of wild type and double mutant embryos when we analyzed E l6 Msxl
~ A; M sx 2 'a mutant embryos (fig. 1.24A-C). In these embryos, there seems to be a
problem with distal outgrowth of the hindlimb digits, suggesting that AER function
has been compromised.
Other potential trans-regulatorv factors
Prx genes encode paired-class homeodomain containing transcription factors
that are related to the Aristaless gene in Drosophila (Meijlink et al., 1999). Prx
genes play a prominent role in epithelial-mesenchymal tissue interactions during
44
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
Reproduced w ith permission o f th e copyright owner. Further reproduction prohibited without permission.
+ BMP
Msx2 Ab
2 4 5 6 10 C
PolII Ab
-BMP
2 4 5 6 10 C
4^
Chromatin immuno-precipitation assay. A) when C14 cells are induced with BMP4, Msx2 protein
can be found to associate with the A6 region of the endogenous Msx2 promoter. B) This association
is not seen in uninduced cells. C) RNA Polymerase II also associates with the A6 region of the
endogenous Msx2 promoter upon BMP induction. D) This association is not seen in uninduced
cells. Numbers under images denote the relative amounts of template used for the PCR reaction
(pi). (C) stands for GAPDH control. 100 bp marker is visible in A and C.
Figure 1.23: M sx2 chromatin immuno-precipitation assay
Reproduced w ith permission o f th e copyright owner. Further reproduction prohibited without permission.
Msxl/2 double mutant limb phenotype. A) Wild type E13.5 embryo showing normal limb
development. B) M sxl7 ;2 A E13.5 embryo showing what seems to be a truncated hindlimb
with respect to proximal-distal outgrowth. The forelimb looks more normal when compared
to the wild type embryo. C) Enlarged view of E16.5 hindlimb from M sxl1; ! 1 ' embryo. At
this stage, the most anterior digits appear to be short and stubby in nature. No visible
difference is seen in the forelimbs.
4^
Os
Figure 1.24: M sxl(/> ;Msx2w double mutant lim b phenotype
embryogenesis and are essential for normal limb, craniofacial and aortic arch
development (Bergwerff et al., 2000; Martin et al., 1995). Prx double mutants have
pre-axial polydactyly in the hindlimb and both pre and post-axial polydactyly in the
forelimb (Lu et al., 1999; ten Berge et al., 1998). Double mutants also show major
defects in the mandible and maxilla (Ten Berge et al., 1998). Prx genes have been
shown to control Msx2 expression: in the hindlimb of Prx double mutants, Msx2
expression is decreased (Lu et al., 1999). These observations, as well as the fact that
the homeodomain site and flanking nucleotides (important for context specificity)
located in the A6 fragment match the Prx2 consensus binding site (9/10 nucleotides)
(de Jong et al., 1993), led us to suspect that Prx genes might regulate the A6Msx2-
hsplacZ transgene.
We first asked whether Prxlb protein could bind the A6Msx2 homeodomain
consensus site in vitro. To determine this, we performed EMSAs using in vitro
transcribed/translated Prxlb protein and a 30 bp probe which contained the
homeodomain site and flanking sequence. As can be seen in figure 1.25A (lanes 1-
3), Prxlb protein can bind the A6Msx2 homeodomain site. When this site is mutated
as in the transgenic experiments, binding of Prxlb protein is completely lost (fig.
1.25A, lanes 4 and 5). Binding by GST-Smad4 (MH1 domain only) protein is
demonstrated on both the wildtype and mutant probes (fig. 1.25A, lanes 1-5). Prxlb
binding does not seem to be perturbed or enhanced in the presence of GST-Smad4
protein (data not shown), while increasing amounts of Prxlb protein do seem to
affect binding by GST-Smad4 (fig. 1.25A, lanes 1-3). Although this result suggests
that Prxlb protein can not interact with the MH1 domain of Smad4, it is very
possible that Prxlb might interact with the MH2 domain of Smad4. It is also
47
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
Reproduced w ith permission o f th e copyright owner. Further reproduction prohibited without permission.
Smad4- jfcji
Prxlb-
wt mutant wt
Prx protein can bind the A6Msx2 homeodomain site. A) EMSA with Prxlb and GST-Smad4 (MH1)
protein. Probe used in lanes 1-3 was 30bp long and contained the homeodomain site (plus flanking
sequence) from the A6Msx2 fragment. Probe used in lanes 4-5 was identical except it had the same 6
bp homeodomain site mutation used in transgenic analysis. This mutation abolished Prxlb binding,
but had no affecton Smad4 biding. B) tetramer line#l expression in El 1.5 Prxl/2 double heterozygote.
C) tetramerline#l expression in El 1.5 Prxl/2 double mutant, showing ectopic transgene expression in
mandible. D) tetramer line#l shows BMP response in the mandible at El 1.5.
Figure 1.25: A6Msx2-hsplacZ expression i n th e mandible
possible that the GST moiety of the fusion protein simply blocks the ability of Prxlb
to interact with the MH1 domain.
To test whether or not Msx2 and Prxl/2 have an epistatic relationship, we
bred the A6Msx2-hsplacZ transgene into Prxl/2 double mutants. When PrxPA ;Prx2
A ; A6Msx2-hsplacZ+ /' embryos were harvested and the lacZ expression pattern
compared with heterozygous mutant littermates, a difference in transgene expression
pattern was found in the mandible of Prx double mutant embryos at E l 1.5. Here,
there is expanded and ectopic expression of the transgene (compare fig. 1.25B, C),
suggesting that Prx genes act to repress expression of Msx2 through the A6Msx2
homeodomain site. Since this ectopic transgene expression occurs in a region of the
mandible we have found to be BMP-responsive (fig. 1.25D), additional experiments
involving BMP bead implantations in the mandible of Prx double mutant mice are
currently being performed in Dr. James Martin’s lab.
Based on the A6Msx2 expression pattern in the limb, we identified additional
homeobox genes that might play a role in controlling expression and BMP-
responsiveness of our A6Msx2-hsplacZ transgene. One such candidate is Alx4, a
paired-class homeobox gene that functions in epithelial-mesenchymal tissue
interactions (Hudson et al., 1998b). This gene is attractive because it is expressed in
the anterior limb bud mesenchyme and has been shown to define A/P polarity
(Tucker and Wisdom, 1999). In addition, Alx4 mutant mice have pre-axial
polydactyly (Qu et al., 1997) and this phenotype shows increased penetrance in the
hindlimb when these mutants are crossed into the Bmp4 mutant background (Dunn et
al., 1997). Interestingly, we see expression of the A6Msx2-hsplacZ transgene only in
the anterior digit at E15.5 (fig. 1.26). We have now obtained Alx4 mutant mice and
49
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
Reproduced w ith permission o f th e copyright owner. Further reproduction prohibited without permission.
6Msx2 limb expression at E15.5. A) Whole mount lacZ stained hindlimb showing strong
transgene expression in the most anterior digit only. B) Similar expression is seen in the
forelimb anterior digit at this stage, with interdigit staining also visible.
Ln
©
Figure 1.26: A6Msx2-hsplacZ lim b expression (E15.5)
plan on breeding the A6Msx2-hsplacZ transgene into the mutant background so as to
analyze transgene expression and test BMP responsiveness.
51
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
DISCUSSION
We have identified a fragment of the Msx2 promoter capable of responding to
endogenous and exogenous BMP2/4 ligand in developing embryos in a temporally
and spatially restricted manner. This BMP-responsive module is necessary for larger
Msx2 promoter fragments to respond to BMP signaling and is sufficient to respond to
BMP signals in the mandible and limb buds. The function of this element has been
highly conserved through evolution as this module responds to Dpp signaling in
Drosophila in a spatially and temporally appropriate manner. We have also
identified a homeodomain transcription factor consensus site that seems to act in
concert with consensus Smadl and Smad4 sites to control gene expression in
response to BMP signals. Moreover, we have shown that Msx2 can function through
this homeodomain site in vivo, suggesting that auto-regulation of Msx2 gene
expression may occur on the endogenous promoter.
Identifying a BMP-responsive module using transgenic mice
Although other endogenous BMP-responsive promoter elements have been
identified, all were initially found by means of biochemical studies and transfection
assays in tissue culture cells (Hata et al., 2000; Henningfeld et al., 2000; Lopez-
Rovira et al., 2002; Park and Morasso, 2002). Since individual cell lines have
distinct yet homogenous expression profiles that can differ dramatically from other
cell lines, results from such experiments can be conflicting or incomplete, depending
on the cell lines used. In addition, lack of proper chromatin structure in transient
transfection experiments can allow protein-DNA interactions that might not normally
52
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
occur on an endogenous promoter. By using an in vivo BMP bead implantation
assay, we were able to investigate BMP responsiveness in multiple tissues during
embryonic development, in which complex and dynamic interactions between cell
types and signaling pathways occur. Thus, all relevant inputs through cis-acting
promoter modules and trans-acting factors can be studied. As a result, we identified
tissues in the mouse embryo where subtle differences in gene regulation exist in
response to BMP signals. For example, beads containing BMP2/4 ligand can be
placed next to each other on limb buds from A6Msx2 transgenic embryos, yet not
elicit the same response. In addition, BMP2/4 containing beads placed in the
mandible only induce a response in tissue adjacent to the bead, not immediately
around it. Such information is important for understanding how a seemingly simple
signaling pathway that involves only a limited number of BMP ligands, receptors
and downstream mediators can result in complex temporal and spatial gene
regulation.
Even though discreet boundaries of expression can be seen for many genes in
the developing limb bud at El 1.5 (Capdevila and Izpisua Belmonte, 2001; Hogan,
1996; Vogt and Duboule, 1999), the signaling molecules responsible for transducing
this BMP-response in A4Msx2-hsplacZ limb buds seem to be present throughout the
tissue. This is not the case for BMP responsiveness in A6Msx2-hsplacZ limb buds
where only BMP beads placed in the middle or anterior region of the limb bud can
induce a response in the transgene. This result shows that there can be tight spatial
control of gene expression within a given tissue even when abundant amounts of an
activating ligand are present nearby.
53
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
Sites of BMP responsiveness have been lost with the 52 bp A6Msx2 fragment
when compared to the 560 bp and 220 bp fragments. In addition, the A6Msx2
fragment does not respond to endogenous BMP in all the areas where active BMP
signaling is known to occur during development (Hogan, 1996). We surmise the
reason for this restricted expression pattern, as well as the limited responsive regions,
is the spatial and temporal restriction of a sequence specific transcription factors.
Since functional regulatory sequences upstream or downstream of the A6Msx2
fragment could have been lost during deletion analysis, complete spatial and
temporal control of BMP-responsiveness might not be possible for this transgene.
Because the 220 bp A5Msx2 fragment has a nearly complete expression pattern and
is capable of responding to BMP beads both proximally and distally in the limb bud,
it may contain more or all of these cis-acting modules, thus representing a
“complete” BMP-responsive element. We are currently trying to identify additional
cis-acting promoter elements within the A5Msx2 promoter fragment that work in
unison with the 52 bp A6Msx2 module to achieve spatial and temporal specificity to
BMP signals.
A6Msx2 expression in the limb is correlated with endogenous BMP signaling
Although we have shown that the 52 bp BMP-responsive module can respond
to exogenous BMP ligand in transgenic mice, we also wished to know if it was
producing an expression pattern that faithfully represented endogenous BMP
signaling during development of transgenic mice. This is an important question
because the expression pattern we see is quite limited when compared to the many
regions where BMP signaling takes place. To help determine this, we focused on
54
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
transgene expression in areas of the embryo where the role of BMP signaling during
development is well described. Because co-localization of expression in tissues
merely suggests that the 52 bp BMP-responsive module is responding to endogenous
BMP signaling, we are currently performing additional experiments that more
definitively address this question.
BMPs play a key role in the morphogenetic events of limb patterning and
development (Hogan, 1996). During this process, mesenchymal condensation leads
to cartilaginous bodies forming in the correct place at the proper time with the
appropriate shape and number. Specifically, BMP signaling has been shown to be
necessary for prechondrogenic condensation formation and the subsequent
maturation into chondrocytes (Kawakami et al., 1996; Pizette et al., 2000; Yi et al.,
2000), and Bmp2, Bmp4, and Bmp7 are all expressed in the perichondrium of the
developing limb cartilage (Francis et al., 1994; Macias et al., 1997).
During the initiation of autopod development, Bmp4, 7 and Msx2 are co
expressed in the presumptive limb bud region (Ahn et al., 2001). As development
proceeds, Bmp4 and 7 expression tapers off while Bmp2 expression increases, with
Msx2 expression remaining constant (Ahn et al., 2001). The apical ectodermal ridge
(AER) controls limb growth along the proximodistal (PD) axis. Bmp2,4, and 7 are
all expressed in the AER (Francis et al., 1994; Lyons et al., 1990; Lyons et al., 1995).
Experiments in mouse and chick limb buds have shown that BMP signaling is
required for DV patterning, AER induction (Ahn et al., 2001; Pizette et al., 2001),
and AER regression later on (Ganan et al., 1998; Pizette and Niswander, 1999).
Moreover, this AER induction seems to act through a pathway involving Msx genes
(Pizette et al., 2001). A 439 bp promoter fragment from the murine Msx2 gene can
55
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
direct expression exclusively to the AER during limb bud development (Liu et al.,
1994). During early limb development, Bmp2 is expressed in the posterior limb bud
mesenchyme where it acts in the polarizing signaling pathway (Duprez et al., 1996;
Francis et al., 1994) while Bmp4 and Bmp7 reside in both the anterior and posterior
mesenchyme.
It has been shown that BMP signaling plays a direct role in digit identity
specification (Drossopoulou et al., 2000). Bmp2,4 and 7 are all expressed in the
interdigital mesenchyme prior to the establishment of areas of interdigital apoptosis
(Francis et al., 1994; Francis-West et al., 1995; Helder et al., 1995; Laufer et al.,
1997; Luo et al., 1995; Lyons et al., 1990) If a bead containing BMP4 is implanted
on interdigital tissue, apoptosis and regression is accelerated (Ganan et al., 1996;
Macias et al., 1997). If a bead containing a BMP antagonist is implanted there,
apoptosis is blocked and Msxl/Msx2 expression is dramatically down-regulated
(Merino et al., 1999). Analogous inhibition experiments with a dominant negative
BMP receptor also result in reduced apoptosis (Yokouchi et al., 1996; Zou and
Niswander, 1996), while a dominant active BMP receptor leads to increased cell
death and accelerated regression of interdigital tissue (Zou et al., 1997). Reduced
Msx gene expression has been proposed as the mechanism by which interdigital
webbing occurs (Ganan et al., 1998). Digital identity along the A/P axis is specified
by the interdigital mesoderm before it regresses, and this specification requires BMP
signaling (Dahn and Fallon, 2000). This positional information for digit identity is
instilled by the zone of polarizing activity (ZPA) early on (Dahn and Fallon, 2000).
The expression pattern we see in the limb buds of A6Msx2-hsplacZ
transgenic embryos mimics that of Bmp and Msx genes at certain stages. Although
56
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
there is not a perfect overlap between these patterns, the regions of transgene
expression fall completely within those of the endogenous genes. This data, along
with the fact that Bmp and Msx genes play important roles during limb development,
strongly suggests that the A6Msx2 fragment is responding to endogenous BMP
signals in the limb bud.
A6Msx2 expression in the cardiac region suggests a role for BMP signaling
BMP signaling along the dorsal ventral axis is required for induction and
maintenance of cardiogenesis (Schultheiss et al., 1997). More specifically, BMP
activity alone is necessary but not sufficient for heart formation. Early on in cardiac
development, BMP2 is involved in the specification of cardiac lineage in the anterior
mesoderm, where BMP signaling determines which area of the heart field will
actually become heart (Marvin et al., 2001).
The contribution of cardiac neural crest (CNC) to outflow tract septation and
remodeling of the aortic arch arteries is well documented. An additional role for
cardiac crest in myocardial development has also been proposed where the crest play
an indirect but essential role by modifying signals required for myocardial
development (Farrell et al., 1999). These signals, which are transmitted from the
pharyngeal endoderm, get altered by the cardiac crest as they migrate into the region
between the developing cardiovascular system and the pharyngeal endoderm. Proof
for such a role by CNC comes from crest ablation studies where a problem with
excitation-contraction coupling is oberved, leading to decreased ventricular
contractility. Although endocardial development is normal, myocardial development
57
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
is not and it seems that cardiac neural crest must be present in the pharyngeal region
for normal myocardial differentiation and function (Waldo et al., 1999a).
FGF signals have been proposed as candidates since FGF-2 can mimic
ablation experiments. Early on, FGF-2 in the myocardium acts to increase myocyte
proliferation. This FGF signal is not needed later on though and CNC migration and
proliferation acts to form a barrier between the pharyngeal endoderm and
myocardium, thus blocking the FGF signal. So CNC act indirectly during the FGF
transition phase to promote normal cardiac development.
We believe that BMP signals might also be involved in this process.
Recently, it was shown that BMP2 is present in the secondary heart field and outflow
tract myocardium, where it appears to be necessary for secondary myocardial
induction and differentiation (Waldo et al., 2001). During murine cardiogenesis, the
A6Msx2-hsplacZ transgene is expressed in the pharyngeal arches and outflow tract.
Most significantly, it is expressed in the pharyngeal endoderm, in adjacent migrating
cardiac neural crest, and in presumptive myocardium at a time when signaling from
the endoderm to the myocardium is taking place. This expression pattern, together
with the fact that this Msx2 promoter fragment is BMP-responsive, suggests the
BMP pathway may be involved in the signaling mechanism by which the pharyngeal
endoderm influences the myocardium through the cardiac neural crest. A BMP-
specific cardiac reporter such as this is useful for studying cardiac development
because early lethality observed with Bmp2, 4, Smad5 and Bmprll knockout mice
(Chang et al., 1999; Winnier et al., 1995; Zhang and Bradley, 1996) has made it
difficult to asses the actual function of BMP2/4 during heart development (Nakajima
et al., 2000).
58
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
Msx genes are often expressed in areas of epithelial-mesenchymal tissue
interactions (Davidson, 1995). Therefore, it is not surprising that the A6Msx2
element is expressed in such regions during cardiac development. Bmp expression in
late cardiac development suggests a role in valvo-septal development as the
myocardial expression pattern is localized around the atrioventricular (AV) canal and
outflow tract (OFT) cushions (Abdelwahid et al., 2001). Endothelial-mesenchymal
transformation (EMT) is a critical event in endocardial cushion formation, which
leads to the formation of valve and septa primordia (Nakajima et al., 2000). This
process occurs in the outflow tract and atrioventricular canal when the myocardium
initiates EMT by releasing inductive signals across the cardiac jelly which act on the
endocardium. BMP2 and BMP4 have been shown to act during this signaling and
BMP4 can induce apoptosis in endocardial cushion and ventricular myocardium
(Abdelwahid et al., 2001). When the BMPRI1 receptor is mutated, OFT anomalies
arise, including persistent truncus arteriosus (PTA), absence of septation in the
conotruncus (below the valves) and absence of the semilunar valves (Delot et al.,
2003). Noggin misexpression experiments also result in abnormal OFT and
ventricular septum development (Allen et al., 2001). In these experiments, migrating
CNC seem to migrate properly, but fewer cells make it to the cardiac region. In
addition, there is a decrease in the number of proliferating mesenchymal cells within
the proximal cushions of the OFT prior to CNC infiltration; since OFT cushions also
play a role in septation, this phenotype might contribute to PTA (Allen et al., 2001).
In the mouse, Bmp2 and Msx2 have overlapping expression patterns in the
AV canal myocardium, junctional myocardium, valve myocardium, and endocardial
cushion (Abdelwahid et al., 2001; Lakkis and Epstein, 1998; Tanaka et al., 1999).
59
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
Bmp2 has also been documented in the OFT myocardium (Yamagishi et al., 1999).
Bmp4 is expressed in the outer myocardial layer of the developing AV canal, the
endocardial cushion, and OFT myocardium (Abdelwahid et al., 2001; Jones et al.,
1991). Bmp2, 4 and Msx2 expression in the mesenchyme of the AV endocardial
cushion has been linked with apoptosis during differentiation (Abdelwahid et al.,
2001; Zhao and Rivkees, 2000).
Thus, Bmp2, 4 and Msx2 have a regulatory role during development of the
atrioventricular region and the outflow tract during critical phases of heart
morphogenesis. The fact that the A6Msx2 element is expressed in regions of the
heart where active BMP signaling is known to occur further suggests that this
element is responding to endogenous BMP signaling during cardiac development. It
has been proposed that Nkx2.5 may suppress Msx2 expression in ventricular
myocardium (Tanaka et al., 1999). Whether Nkx2.5 is acting through the
homeodomain site in this A6Msx2 fragment to activate or repress expression is not
known.
Conservation of BMP-Dpp expression control
If BMP/Dpp-responsive promoter elements are functionally conserved
between flies and mice, then comparing expression control by them in the two
organisms should allow us to gain insights into the evolution of complex spatial and
temporal gene regulation. An example of a Dpp-responsive enhancer element that
has been well characterized in Drosophila is that of the labial gene (lab 550). This
enhancer is composed of two distinct control elements; the Homeotic Response
Element (HOMRE) and the DPP Response Element (DPPRE). Both of these regions
60
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
are needed for correct spatial restriction, tissue specificity and signal inducibility by
Dpp (Marty et al., 2001). Because the Mad sites present in the DPPRE domain can
not confer Dpp responsiveness alone, it is believed that this enhancer integrates both
a homeotic input and Dpp signaling to create specific responses to dpp (Marty et al.,
2001). This example of labial gene regulation shows there can be tight linkage
between Dpp and input from a homeobox gene transcription factor, something we
observe with our 52 bp BMP-responsive module in mice .
The transgenic experiments in Drosophila show that the 52 bp BMP-
responsive module is a biologically active native element that has been conserved
enough to allow for normal expression control in two organisms that last shared a
common ancestor over 500 million years ago. These experiments also indicate that
the BMP-responsive module is more easily activated in flies than it is in mice;
basically it is expressed in most regions where Dpp signaling occurs, but in limited
regions where BMP signaling occurs. We believe this 52 bp fragment is able to act
as a “basic” Dpp-responsive element in Drosophila because the signaling pathway is
more simplified, thus requiring fewer total inputs to control expression of certain
genes during development. This idea is supported by the fact that only one receptor
activated Smad protein, MAD, is present in Drosophila and it alone transduces all
Dpp signals (Newfeld et al., 1997; Raftery and Sutherland, 1999). In addition,
unlike the Smad sites, the consensus homeodomain site does not seem to be critical
for Dpp signaling in Drosophila and may represent an evolutionary transition from a
more primitive to a more complex promoter element. Fundamentally, organisms
differ from one another not by gene number or type, but mostly by how the genes are
61
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
expressed and interact during development. The precise control of when and where
specific genes are expressed is responsible for the variation we see.
Homeobox genes in BMP signaling
Thus far, no mammalian homeobox gene has been shown to function in
activating a BMP-responsive promoter. In Drosophila, the homeobox gene tinman
plays an important role in the auto-regulation of its own transcriptional response to
Dpp by acting with Mad and Medea (Xu et al., 1998). In Xenopus, the homeobox
gene Xvent-2 has been shown to act as a Smad 1-specific coactivator during
regulation of its own transcription (Henningfeld et al., 2002). Xvent-2 has also been
shown to mediate autocatalytic regulation of BMP4 (Schuler-Metz et al., 2000). The
paired-like homeodomain transcription factors Milk and Mixer mediate activin and
TGF-|3 induced transcription of the goosecoid promoter by interacting with Smad2
from an active Smad2/Smad4 complex (Germain et al., 2000).
Repression of BMP-responsive promoter elements by homeobox genes has
also been documented. For example, repression of the OPN promoter by Hoxc-8 has
been shown to be relieved by the direct binding of Smadl and 4, thus allowing for
activation by BMP (Hullinger et al., 2001; Shi et al., 1999; Yang et al., 2000). In
TGF-(3 signaling, the homeodomain protein TGIF was shown to associate with
Smad2 and HDACs in forming a transcriptional repressor complex (Wotton et al.,
1999).
In this study, we have presented data that shows Msx2 can bind a sequence in
its own promoter in vivo and that this binding is essential for activating transgene
expression and BMP responsiveness of a 52 bp module in the limb bud. Auto-
62
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
regulation through this module may also be responsible for controlling expression in
other regions at different times during development. The extent and biological
significance of this auto-regulation in vivo remain to be determined. Because
anterior limb bud expression in the forelimbs was only partially reduced in Msx
double mutants, it seems that transcription factors other than Msx genes are also
responsible for controlling expression there.
One possible reason the A6Msx2 expression pattern is so limited is that
homeodomain containing transcription factors that act as repressors could be binding
the site. At this time, we have little evidence showing this site is being occupied by
repressors as mutation analysis did not lead to increased expression.
Since the majority of homeodomain containing transcription factors bind the core
TAAT sequence (Gehring et al., 1994), many different possibilities for cross and
auto-regulation of genes containing such sites can occur (Regulski et al., 1991;
Theisen et al., 1996; Zappavigna et al., 1991). In transgenic experiments using a
chicken AER enhancer element, a single TAAT site was shown to be critical for the
AER enhancer activity of that element (Pan et al., 2002). Thus, it is possible that the
homeodomain consensus sequence in the 52 bp BMP-responsive module represents a
critical site for Msx2 gene regulation.
63
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
FUTURE DIRECTIONS
There are many experiments remaining to be done which can better illuminate
the “black box” of target gene activation by BMP signals. First, we wish to better
understand how critical the homeodomain consensus binding site is for controlling
transgene expression and BMP responsiveness. To accomplish this, we have
mutated the site (6 bp) in the context of the 560bp A4Msx2 fragment and will analyze
expression patterns and BMP responsiveness in transgenic embryos. To further
confirm the role of Msx2 in controlling expression and BMP responsiveness through
this site, we will perform additional transient co-transfection experiments in which
an Msx2 expression construct is transfected along with the reporter prior to induction
with BMP2/4. We would also like to obtain additional biochemical data showing
that BMP-restricted Smad proteins and/or Smad4 can bind our 52 bp A6 fragment in
vivo. We are addressing this by performing gel shift assays (EMSA) with nuclear
extracts from 10T1/2 cells treated with BMP2/4 ligand. Since we have antibodies to
both phosphorylated Smadl/5/8 and Smad4, we should be able to do supershift
experiments with the nuclear extracts to prove that these proteins can in fact bind the
A6 fragment. We have already shown that Smad4 can bind this A6 fragment using
bacterial expressed GST-Smad4(MH2) protein (fig. 1.27). We have also begun
chromatin immuno-precipitation assays using C14 cells that have been induced with
BMP2/4. These are exciting experiments that may tell us if BMP-restricted Smad
proteins can bind our BMP-responsive module in the endogenous Msx2 promoter in
response to BMP induction. We will also use the CHIP assay to look for additional
proteins which might be acting on our BMP-responsive element, such as other
64
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
Reproduced w ith permission o f th e copyright owner. Further reproduction prohibited without permission.
Smad4
EMSA using GST-Smad4 (MH1) protein. Smad4 protein readily binds
the 52 bp A6Msx2 fragment. When the amount of protein added to the
binding reaction is titrated, a corresponding increase is bound probe is seen.
ON
U \
Figure 1.27: GST-Smad4 c a n bind th e A6Msx2 fragment
transcription factors and cofactors like P300. Currently, we have antibodies for Prxl
and Prx2 which can be tested in this assay. Ultimately, we would like to use
embryonic tissue as our chromatin source since we know the specific tissues that are
BMP-responsive by our bead implantation assay. Finally, we are performing a yeast
one-hybrid screen so as to identify additional sequence specific transcription factors
that might be acting on our A6 fragment. For this assay, we are again using the
multimerized 52 bp fragment (tetramer) that was used in the transgenic experiments
and a mouse El 1 cDNA library. Initial screens of the library have been done, but the
conditions were not optimized and no obvious candidates were identified.
66
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
CHAPTER 2- Pax3 NEGATIVELY REGULATES Msx2
EXPRESSION DURING MURINE CARDIAC NEURAL CREST
DEVELOPMENT
INTRODUCTION
Neural crest cells are a unique transient population of migratory cells that
participate in the formation of many different tissue types during vertebrate embryo
development, including neurons and glial cells, bones and cartilages, endocrine cells,
and melanocytes (Serbedzija and McMahon, 1997). Neural crest cells form all along
the hindbrain at the boundary of the dorsal neural plate and the surface ectoderm
during neurulation (Kulesa and Fraser, 1998; Selleck and Bronner-Fraser, 1995).
From there, they migrate out along distinct routes to many areas in the developing
embryo.
The cranial neural crest, which originate between the forebrain and 5th somite,
are actually made up of distinct subpopulations of neural crest cells that have specific
functions. One of these subpopulations is called the cardiac neural crest and these
cells are responsible for forming the aortico-pulmonary septum in the developing
heart. Cardiac neural crest originate in rhombomeres 6-8, the region between the
otic vesicle and the 4th somite (Bronner-Fraser, 1995; Waldo et al., 1999). From
there, they migrate specifically through the third, fourth and sixth pharyngeal arches
where they contribute to the thymus, thyroid, and smooth muscle in aortic arch
arteries (Conway et al., 1997a; Waldo et al., 1999). Some of these cardiac neural
67
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
crest continue migrating into the aortic sac and conotruncus where they eventually
contribute to the formation of the aorto-pulmonary septum (Conway et al., 1997a;
Morriss-Kay and Tucket, 1991; Waldo et al., 1999). Experiments including ablation
studies in chick have shown that when the cardiac neural crest fail to migrate, the
outflow tract septum does not form and the aortic arch arteries do not get remodeled
properly (Conway et al., 1997a; Creazzo et al., 1998; Sinning, 1998; Waldo et al.,
1999). Cardiac neural crest also have other cardiac functions that are less well
understood.
Pax3 encodes a transcription factor which contains two DNA binding motifs,
a homeodomain and a paired domain. The paired box was first identified in
Drosophila and is highly conserved among the other eight Pax genes in its family
(Tremblay and Grass, 1994). Pax genes are developmental control genes that exert
many functions during embryogenesis; analysis of spontaneous and transgenic
mouse mutants has revealed that Pax genes are involved in pattern formation and are
key regulators during organogenesis of the eye, brain, muscle, and many other
tissues. When the murine Pax3 gene is mutated, septation of the outflow tract is
compromised, resulting in a condition called persistent trancus arteriosus (Kirby et
al, 1983; Kirby et al., 1985). In addition, there are deficiencies with aortic arch
artery remodeling and myocardial function in general, which leads to death at E l3.5
during murine development (Conway et al., 1997b; Li et al., 1999). Other neural
crest-related defects manifest in neurons, ganglia, melanocytes, and the thymus and
thyroid (Auerbach, 1954; Conway et al., 1997a; Epstein et al., 2000; Franz, 1989;
Henderson et al., 1997; Kwang et al., 2002; Li et al., 1999). Non neural crest-related
68
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
anomalies also exist in Pax3'' embryos, including deficiencies in neurulation and
myogenesis (Borycki et al., 1999; Li et al., 1999).
The mouse mutant Splotch has a loss-of-function mutation in the Pax3 gene,
and thus is a good model for studying neural crest. In Splotch, it is believed that the
initiation of migration of cardiac neural crest is normal; but for some reason, the
numbers of crest that actually reach the outflow tract is reduced, thus resulting in
persistent truncus arteriosus in the majority of embryos (Conway et al., 1997;
Epstein et al., 2000; Serbedzija and McMahon, 1997). Whether some crest die along
the way, take on another cell fate, or simply fail to make the full journey is not
known. What is known is that the problem is cell autonomous, as the specific
directed expression of Pax3 in the dorsal neural tube/neural crest can rescue
embryonic lethality in Splotch embryos (Li et al., 1999). Haploinsufficiency of Pax3
in humans leads to a syndrome called Waardenburg type I and III (Carey et al., 1998;
Chalepakis et al., 1994; Fortin et al., 1997; Machado et al., 2001). Here, similar
defects to those found in Splotch exist (Asher et al., 1996; (Mathieu et al., 1990).
While downstream targets of Pax3 which could directly contribute to the
phenotype observed in Splotch are not known, candidate genes have been proposed.
Versican is a proteoglycan that has been shown to be upregulated in the mesenchyme
(of Splotch embryos) which neural crest migrate through (Henderson et al., 1997).
Tyrp-1, a melanocyte-specific promoter, contains a Pax3 binding site which has been
shown to modulate the proteins expression (Galibert et al., 1999). Other possible
candidates include the tyrosine kinase receptors Met (Epstein et al., 1996) and Ret
(Edery et al., 1994; Lang et al., 2000), and the transcription factor Mr/(Tassabehji et
al., 1994; Watanabe et al., 1998).
69
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
Msx genes are homeodomain containing transcription factors that are
expressed in a variety of tissues (Bell et al., 1992; Davidson, 1995) and have been
shown to be critical for epithelial-mesenchymal tissue interactions during embryonic
development (Catron et al., 1996; Mansouri et al., 2001; Wang et al., 1996). While
Msxl and Msx2 mutant mice show no obvious cardiac anomalies, they do show
defects in tooth development, skull development, hair growth, and other mild
phenotypes (Satokata and Mass, 1994; Satokata et al., 2000), It is believed that
functional redundancy is responsible for the mild phenotypes observed. Although a
complete characterization of the Msxl/Msx2 double mutant has not been performed,
cranial neural crest defects have been seen (Satokata et al., 2000).
Because Msxl, Msx2 and Pax3 are all expressed in the dorsal neural tube and
cardiac crest prior to and during their initial stages of migration (Monsoro-Burq et
al., 1996), we speculated that these genes might functionally interact. To test for a
functional genetic interaction, we bred Pax3 mutant mice with Msx2 mutant mice.
We found that embryos lacking both Msx2 and Pax3 were bom with a normal atrial-
ventricular septum. Thus, not only did loss of Msx2 result in normal septation, but
the cardiac defects normally causing lethality at E l3.5 in Splotch embryos were
rescued. Some non-cardiac neural crest derived anomalies were also partially
rescued in these mice, including the dorsal root ganglia, the thymus and the thyroid.
The fact that genetically manipulating levels of Msx2 in the developing
embryo was able to rescue the lethality of the Pax3 mutation led us to believe that it
might be higher than normal levels of Msx2 that contribute to the lethality of Splotch
embryos. In situ hybridization experiments showed that Msx2 is upregulated in the
post-otic hindbrain of E9.5 Splotch embryos. We also found that Msx2 promoter-
70
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
lacZ transgenes were up-regulated in a similar ectopic pattern in E9.5 Splotch
embryos. These experiments suggest that Pax3 negatively regulates Msx2
expression in the post-otic hindbrain region; the area that cardiac neural crest
originate from. We next addressed whether or not this transcriptional regulation was
occurring by a direct mechanism. To do this, a putative Pax3 binding site in the
Msx2 promoter was mutated and transgenic embryos generated. We found that when
this site was mutated, lacZ expression was upregulated in pattern that resembled that
seen in Splotch embryos. Thus, we conclude that Pax3 acts to directly repress Msx2
expression in the post-otic hindbrain during a critical time for cardiac neural crest
migration.
71
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
RESULTS
The Msx2'A genotype rescues embryonic lethality in Pax3'A embryos
If Pax3 and Msx2 are epistatically related and work together during
development, it is likely that you would see a phenotype upon creating double
mutant (Pax3'A; Msx2'A) embryos. We intercrossed Msx2 mutants with Pax3 mutants
for analysis of the compound mutant phenotype. Surprisingly, we found that pups
were bom (17/77; 22%) with the Pax3'A mutant genotype when the Msx2'A genotype
was also present (Kwang et al., 2002). This was significant because it has been
shown that 100% of Splotch embryos die during development at E13.5 due to
compromised cardiac function (Auerbach, 1954; Conway et al., 1997; Epstein et al.,
2000; Li et al., 1999). In addition, as seen with Splotch embryos, these double
mutant pups exhibit exencephaly with or without spina bifida. Upon birth, the pups
die presumably from respiratory failure as their diaphragm muscle is not properly
developed (Li et al., 1999). This rescue is specific for Msx2 since absence of Msxl
does not suppress the embryonic lethality in Splotch (Kwang et al., 2002). In
addition, we showed that strain effect was not playing a part in the rescue phenotype
(Kwang et al., 2002).
The M sx?1 ' genotype rescues specific neural crest defects in Splotch
To find out if specific morphological defects found in Splotch were being
rescued by the Msx2'A genotype, we compared histological sections at E l3.5 and at
the newborn stage. In wild type and Msx2~'' embryos, we found normal outflow
tracts and aortic arch arteries at E13.5 (Kwang et al., 2002). In contrast, 5/7 Splotch
72
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
embryos at the same stage had either persistent truncus arteriosus and/or aortic arch
anomalies. In the three E13.5 double mutant embryos checked, all had both normal
outflow tracts and aortic arch arteries (Kwang et al., 2002). At the newborn stage,
wild type, Msx2'/', and double mutants all exhibited normal cardiac morphology
(Kwang et al., 2002). These experiments showed that in addition to rescuing
embryonic lethality, the M sxl1 ' genotype rescues cardiac neural crest derived
anomalies normally seen in Splotch. We also checked to see if non-cardiac neural
crest derived anomalies were being rescued in double mutants. Such defects are
found in the thymus, thyroid, dorsal root ganglia, thoracic sympathetic ganglia and
glossopharyngeal nerve of Splotch embryos (Auerbach, 1954; Li et al., 1999). We
found that some of these defects were rescued in double mutant embryos, including
that in the thymus, thyroid and a partial rescue in the dorsal root ganglia (Kwang et
al., 2002). Hence, we conclude that both cardiac neural crest and other cranial neural
crest derived defects normally seen in Splotch embryos are rescued when Msx2 is
absent.
Msx2 expression is upregulated in E9.5 Pax3- /~ embryos
A simple model which can explain how loss of Msx2 leads to the rescue of
lethality in Splotch embryos is that Pax3 acts to repress Msx2 expression in specific
regions of the developing embryo hindbrain. It was shown previously that transgenic
expression of Pax3 in the dorsal neural tube and cardiac neural crest could rescue the
cardiac defects in Splotch (Li et al., 1999). Since this rescue is comparable to that
seen in our double mutant rescue pups, we postulated that a functional interaction
between Msx2 and Pax3 might be occurring in either the cardiac crest, dorsal neural
73
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
tube, or both. We focused on the stages around E9 because this is the time when
cardiac neural crest migrate out from the dorsal neural tube, and Pax3 expression
ceases soon after the crest cells begin to emigrate (Conway et al., 1997; Epstein et
al., 2000). Whole mount in situ hybridization was performed on wild type E9.5
embryos so as to establish the normal expression pattern for Msx2 and Pax3. As can
be seen in figure 2.1, Msx2 expression is stronger in rhombomere 5 (r5) than it is in
the postotic neural tube (r6-8) (fig. 2.IB, E). In contrast, Pax3 expression is stronger
in the postotic neural tube, and weaker in r5 (fig. 2.1 A, D). When we looked at
Msx2 expression in E9.5 Splotch embryos, we saw that expression was increased in
the postotic neural tube (fig. 2.1C, F). This upregulated Msx2 pattern is similar to
the endogenous pattern seen for Pax3 in r6-8 (compare fig. 2.ID and F).
We then cut frozen cross sections from these whole-mount embryos so as to get
a better idea of how the expression pattern changed in the neural tube. In wild type
embryos, Msx2 expression is confined to the dorsal neural tube at r5 (fig. 2.1H). In
r6-8, Msx2 expression is absent from the most dorsal midline region of the neural
tube (arrowhead, fig. 2.IK), but strong medially and weak laterally more ventrally in
the neural tube (arrow, fig. 2.IK). In contrast, Pax3 expression is fairly weak (with a
more ventral-lateral position) in the r5 region of wild type embryos (fig. 2.1G), but
quite strong in r6-8 with expression being uniform throughout the dorsal neural tube
(fig. 2.1J). When we looked at sections from Pax?7 ' embryos, we found ectopic
expression of Msx2 in the neural tube. Here, sections through the r5 region showed
that expression had expanded in a more ventral-lateral pattern (arrow, fig. 2.11),
while sections through the r6-8 region showed a pattern that more closely
approximated that seen for Pax3 (compare fig. 2.1J and L). These observations are
74
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
Figure 2.1: M sxl expression in Splotch (in situ hybridization)
Wildtype Pax3$P'/sP
P rob e: Pax 3 Msx2 Msx2
A B C
n
M sxl expression is upregulated in the Pax3Sp/Sp embryos.
Digoxygenin-labeled antisense probes were used on E9.5 embryos.
M sxl probes used on (B), (C), (E), (F), (H), (I), (K) and (L). Pax3
probes on (A), (D), (G) and (J). Unlabeled brackets indicate postotic
hindbrain. Arrows indicate level of section. In comparing M sxl
antisense between wildtype (B) and Pax3Sp/Sp (C), Pax3Sp/Sp mutants
show upregulation of M sxl expression. This upregulation is similar to
Pax3 expression in wildtype embryos (A). Upon closer magnification
(D-F) and cross sectioning at two levels, (preotic hindbrain (G-I) and
postotic hindbrain (J-L)), we find ectopic upregulation of M sxl in
Pax3Sp/Sp embryos (arrows and arrowheads), ot, otic vesicle; r5,
rhombomere 5. Scale bar: 100 mm.
75
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
consistent with the idea that Pax3 normally acts to repress Msx2 expression in the
dorsal neural tube and cardiac neural crest at E9.5 during development.
Localization of a Pax3 responsive region in the Msx2 promoter
To help determine whether or not Pax3 was acting directly to repress Msx2
transcription, we attempted to identify functional Pax3 protein binding sites in the
Msx2 promoter. To accomplish this, we compared expression patterns of lacZ
transgenes driven by Msx2 promoter fragments in wild type and Splotch embryos at
E9.5. The first transgenic line we analyzed contained a previously characterized 13
kb Msx2 genomic fragment with lacZ inserted into exon 1 (fig. 2.2, AlMsx2-lacZ)
(Liu et al., 1994; Liu et al., 1999). The second transgenic line we checked contained
the same 6 kb upstream Msx2 promoter sequence fused to lacZ, but lacked all
downstream genomic sequence (fig. 2.2, A2Msx2-lacZ) (Liu et al., 1994; Liu et al.,
1999). Both of these transgenes produce expression patterns in wild type embryos
that closely approximate the endogenous expression pattern for Msx2 (Liu et al.,
1994; Liu et al., 1999; Kwang et al., 2002).
After crossing these two transgenes into Pax3+ /' mice and harvesting lacZ+ /';
Pax3 A embryos, we found that transgene expression was upregulated in the postotic
hindbrain of E9.5 Splotch embryos (fig. 2.3A, B). This increased expression was
very similar to that observed previously with the whole-mount in situ hybridization
experiments (fig. 2.1C, F). Cross sections of these embryos also showed that the
expression pattern was expanded in Splotch embryos similarly to the ectopic pattern
seen with the in situ sections (compare fig. 2.3C, D with 2.IK, L). Longitudinal
sections of AlMsx2-lacZ+ /'; Pax3'A embryos showed increased lacZ expression in
76
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
Reproduced w ith permission o f th e copyright owner. Further reproduction prohibited without permission.
1 kb
i------- 1
A lMsx2-lacZ
A2Msx2-lacZ
A3Msx2-hspla cZ
A 4Msx2-hspla cZ
N otl H indlll Hindlll
I I I
i —H ssssa
I i LacZ
Hi Msx2 coding
hsp68 promoter
SV 40 3'UTR
Schematic diagram of the Msx2-lacZ transgene constructs. A1 and A2 constructs have lacZ inserted into the
first exon. A3 and A4 constructs include an hsp68 minimal promoter fused to lacZ reporter.
-j
Figure 2.2: Msx2-lacZ transgene constructs
Figure 2.3: AlMsx2-lacZ and A2Msx2-lacZ transgene expression
A 1M sx2-IocZ
Wildtype Pax3S l’ ,s< ’
tX2Msx2-lacZ
Wildtype Paxi
Wildtype
Pax3s P /s,,
Wildtype Pax3S p /S l’ Wildtype Pax3S p /S p
Msx2 promoter regulation is altered in Pax3Sp/Sp embryos. Using
two distinct transgenic constructs, we find similar increased Msx2
expression through lacZ reporter as seen by in situ results (Figure
2.1). Unlabeled brackets indicate postotic hindbrain (A and B).
Cross sections as marked in (A) show ectopic upregulation of Msx2
promoter (C and D; arrows and arrowheads). Longitudinal sections
(E-J) from hindbrain of AlMsx2-lacZ embryos show upregulation
of Msx2 promoter in preotic crest (pc) and cardiac neural crest (cc)
regions (compare H, J to G, I). Note increased staining in Pax3Sp/Sp
embryos (F, H and J). cc, cardiac crest; n, neural fold; o, otic
vesicle; pc, preotic crest; r5, rhombomere 5. Scale bar: 100 mm.
78
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
preotic crest and postotic cardiac neural crest cells when compared to wild type
embryos (fig. 2.3E-J). This is interesting because although it is known that cardiac
neural crest seem to emigrate from the neural tube normally, it is not exactly known
what happens to these crest as they migrate to the cardiac region (Conway et al.,
1997; Epstein et al., 2000; Henderson et al., 1997; Homyak et al., 2001; Li et al.,
1999; Moase and Trasler, 1991). How an increase of Msx2 expression in these
neural crest populations might be affecting the survival or migration of these cells is
not known, but the fact that their expression profile has changed suggests the cells
might behave differently from their wild type counterparts.
All of these experiments suggested that Pax3 does act to repress Msx2
expression and the functional Pax3 binding site being acted on must be within the 6
kb A2Msx2 promoter fragment. Additional Msx2 promoter -lacZ constructs were
generated to further localize the Pavi-responsive region. A 1.8 kb fragment (fig.
2.2, A3Msx2-hsplacZ) was found to express in a pattern that closely approximated
that seen for the 6 kb A2 fragment (data not shown). Within this 1.8 kb deletion is a
560 bp fragment (fig. 2.2, A4Msx2-hsplacZ) that was also able to direct expression
much like the larger A2Msx2-lacZ construct in the hindbrain (fig. 2.4A). When we
crossed this A4Msx2-hsplacZ transgene into Splotch and analyzed the hindbrain
expression pattern, we found that the transgene was upregulated in the postotic
neural tube (fig. 2.4A, compare arrows B, C). Cross sections from these embryos
showed that the lacZ expansion in theseSplotch embryos (compare fig. 2.4B and C)
was consistent with the ectopic pattern seen previously with the other transgenes and
in situs. Thus, since this 560 bp fragment was sufficient to respond to Pax3 in the
79
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
Figure 2.4: A4Msx2-hsplacZ transgene expression
A 4Msx2-hsplacZ
Wildtype Pax3Sp/Sp
B V I
560 bp promoter fragment (A4Msx2-hsplacZ) of Msx2 promoter is
Pax3-responsive. Unlabeled brackets indicate postotic hindbrain (A).
Upregulation of Msx2 promoter is seen in Pax3Sp/Sp embryos through
whole mount (A) and cross section (B versus C; arrows and
arrowheads). With this construct, both wildtype and Pax3Sp/Sp
embryos show similar staining as in the A lMsx2-lacZ and A2Msx2-
lacZ constructs, o, otic vesicle; r5, rhombomere 5. Scale bar: 100
mm.
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
post-otic hindbrain, it must contain a regulatory element that Pax3 can directly or
indirectly act through.
Identification of a functional cis acting Pax3 binding site in the Msx2 promoter
Having narrowed the Pax?-responsive region down to 560 bp, we next set out
to identify putative Pax3 binding sites. A search of the human genome showed that a
520 bp fragment within our Pax3-responsive region shared 87% identity with
the human MSX2 locus (fig. 2.5). Within this 520 bp fragment there does exist a
consensus Pax3 binding site (fig. 2.5) (Chalepakis and Gruss, 1995; Epstein et al.,
1996). This site matches the sequence published for a region of the Tyrpl promoter
that binds Pax3 and is required for transactivation (Galibert et al., 1999). Gel shifts
were performed on this Pax site using in vitro translated Pax3 protein. As can be
seen in figure 2.6, recombinant Pax3 protein was able to bind this site (Pax site 1), as
well as a published Pax3 binding site (Nf3’) (Epstein et al., 1995). When we
mutated this site (Pax site 1M), the ability of in vitro translated Pax3 protein to bind
it was greatly reduced (fig. 2.6).
Although these EMSA experiments showed Pax3 protein can bind Pax site 1
in vitro, we needed to know whether this site was functional in vivo. To address this,
we generated a new A4Msx2-hsplacZ transgene that contained the Pax site 1M
mutation. A4Msx2 transgenic embryos containing either Pax site 1 or Pax site 1M
were harvested at E9.5 for comparison of hindbrain expression. We found that the
Pax site 1M mutation resulted in upregulated lacZ expression in the hindbrain,
including the postotic neural tube (compare fig. 2.7A and B; table 2.1). Cross
sections of these embryos showed that the ectopic expansion of lacZ was both lateral
81
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
Reproduced w ith permission o f th e copyright owner. Further reproduction prohibited without permission.
l kb
-3776
-95088
Hindi]] Not]
M urine Msx2 g e n o m ic
-3862 'i f '* ' -3303
>87/0 identity with human MSX2 5 * flanking
/Vzvi-responsive region
Pax site 1
-3688
TTG
Tvrp-J
Nf3'
Consensus
Pax site 1M
Murine Msx2
Human MSX2
-94995
87% human homology found in 560 bp Paxi-responsive region of Msx2 promoter. A putative Pax3 binding site is
found in this region, similar to that found in the Tyrpl promoter. Base substitutions used in EMSA (Figure 2.6) are
shown in Pax site 1M. Bold sequence shows match to consensus Pax3 binding site.
00
to
Figure 2.5: Pax3-responsive region o f th e M sx2 promoter
Reproduced w ith permission o f th e copyright owner. Further reproduction prohibited without permission.
Probe
Pax3 protein
Pax3 ■
Nf3' Pax site 1 Pax site 1M
c c
iB B I
i s l i
■
mm
i p • —
Bfl
00
U >
EMSA study shows that Pax site 1 is a functional Pax 3 binding site. Through protein titration, we
show that Pax3 protein binds putative Pax3 binding site, Nf3' (lane 1-4). Pax3 protein also shows
similar affinity to our Pax3 binding site (lane 6-9). Pax3 protein does not bind mutant Pax3 binding
site (Pax sitel M). Mock transcription-translation lystate (with no DNA) was used in our control
lanes (5, 10, and 11).
Figure 2.6: Pax3 binds a consensus site i n th e M sx2 promoter
Figure 2.7: A4Msx2-hsplacZ mutation analysis
M M s x 2 -h s p la c Z
Wildtype Pax site 1M
C ■ [)
►
Using a mutant Pax3 binding site construct (B and D), we
observe ectopic upregulation of Msx2 promoter in wildtype
embryos. Unlabeled brackets indicate postotic hindbrain (A and
B). 5 out of 6 base pairs of Pax3 binding site were mutated in
A4Msx2-hsplacZ. This alone was sufficient to show upregulation
of Msx2 promoter (compare A and B). Cross sections of these
embryos confirm ectopic upregulation of Msx2 promoter as well
(compare C and D; arrow and arrowheads), o, otic vesicle; r5,
rhombomere 5. Scale bar: 100 mm.
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
Table 2.1: A4Msx2-hsplacZ transgenic results
Effect o f Pax site 1 mutation on M M sx2-hsplacZ transgene expression
Transgene
Expressing F O upregulation
Transgenic F O in neural tube
MMsx2-hsplacZ
1 1
1 3
0
1 1
A4Msx2-hsplacZ 7 _7
Pax site 1 mutant 10 7
Embryos were analyzed transiently between E9.5 to E l 1.5 through |3-gal
staining. Comparisons were made to AlMsx2-lacZ and A4Msx2-hsplacZ
results.
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
and ventral (compare fig. 2.7C, D); a pattern similar to that observed for the
AlMsx2-lacZ (fig. 2.3D) and A4Msx2-hsplacZ transgenes in Splotch embryos (fig.
2.4C).
All of these results suggest that Pax site 1 is bound by Pax3 in vivo to repress
Msx2 expression in the dorsal neural tube and cardiac neural crest of E9.5 embryos.
A4Msx2-hsplacZ transgenic embryos with both the wild type and mutant Pax site 1
were also analyzed at El 1.5. Three different embryos were harvested for both
transgenes and serial transverse plastic sections were cut for each. After analyzing
transgene expression in multiple organs including the eye, heart, outflow tract, neural
tube, brain, and pharyngeal region, no obvious differences in lacZ expression could
be found in any tissues other than the hindbrain and caudal region of the neural tube.
Here, lacZ expression was expanded in a lateral-ventral direction along the dorsal
edge of the neural tube (data not shown). This ectopic expression in the caudal
neural tube was very similar to that observed in El 1.5 AlMsx2-lacZ\Splotch
embryos (data not shown). Because this ectopic expression occurs in the same area
as the spina bifida phenotype, it is plausible that ectopic Msx2 expression in Splotch
also plays a role in causing spina bifida. A more detailed analysis of all these
sections would be prudent as subtle variations are difficult to detect and regions of
altered expression may have been missed.
86
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
DISCUSSION
We have identified a molecular mechanism which we believe contributes to
the embryonic death observed in Pax3'/' (Splotch) embryos at E l3.5. This
mechanism involves the transcriptional repression of Msx2 by Pax3 in the postotic
neural tube at a critical time in cardiac neural crest emigration. We have shown that
when Pax3 protein is absent or when it is unable to bind a specific site in the Msx2
promoter, endogenous Msx2 transcripts and Msx2 promoter driven transgenes are
upregulated in the postotic neural tube and cardiac neural crest. If Msx2 is removed
genetically from Splotch embryos, embryonic death is rescued, as well as the cardiac
defects normally present. Together, these results suggest that Pax3 functions to
directly suppress Msx2 expression in the postotic neural tube so that cardiac neural
crest can migrate properly and facilitate normal cardiac development.
It has been shown recently that loss of Pax3 results in a reduction in the
number of cardiac neural crest that ultimately reach the outflow tract (Conway et al.,
2000; Epstein et al., 2000). In addition, it seems that the neural crest defect is cell
autonomous in nature and not caused by aberrant signals they might receive from
surrounding tissues during migration (Li et al., 1999). Our experiments implicate
Msx2 in the Pax3 pathway which acts to direct normal cardiac neural crest
development since loss of Msx2 results in the rescue of embryonic lethality and
cardiac defects normally observed in Splotch embryos. Furthermore, our
experiments show that upregulated, ectopic expression of Msx2 in the postotic neural
tube may be solely responsible for the defects in Splotch embryos which lead to
87
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
embryonic death. What the increased levels and abnormal localization of Msx2 are
doing specifically to hinder cardiac crest migration and or survival is not known.
The fact that the Msxl'1 ' genotype is unable to rescue the lethality of Splotch
embryos (Kwang et al., 2002) is somewhat surprising given that Msxl and Msx2 are
believed to have many functionally redundant roles (Marazzi et al., 1997). Examples
of phenotypes being exacerbated in double mutants compared to that seen in either
single mutant do exist (Satokata et al., 2000). When we performed whole mount in
situ experiments using Msxl probe in wild type and Pax3'A E9.5 embryos, we found
there was an upregulation of endogenous message in the postotic hindbrain similar to
that seen with Msx2 (Kwang et al., 2002). Thus it seems that M sxl is also Pax3
responsive even though no functional Pax3 binding site has been identified in the
Msxl promoter as of yet. The reason for this functional non-equivalence may simply
be the result of subtle differences in protein structure. Evidence supporting this
hypothesis that M sxl and Msx2 have distinct structural differences in the N-terminus
and C-terminus has been presented (Bell et al., 1993).
Although it is possible that multiple transcription factors can bind Pax site 1
in vivo to control Msx2 gene expression, we feel we have provided adequate proof
that at least Pax3 does. The first line of evidence is that Msx2-lacZ transgenes are
upregulated in the postotic neural tube of Splotch embryos much like the way the
endogenous Msx2 gene is. Second, a consensus Pax site exists in the highly
conserved 520 bp region of the Msx2 promoter and this site binds in vitro translated
Pax3 protein specifically. That this is a highly conserved region of the Msx2
promoter and the only fragment which has been shown to direct expression to the
hindbrain further supports our hypothesis. Third, when we mutate this Pax site in
88
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
vivo, we see upregulated and ectopic transgene expression in the postotic neural tube
which mimics the pattern seen in Splotch mutants. In summary, all of these data
support the idea that Pax3 regulates Msx2 expression through a direct effect on its
promoter.
Given that BMPs have a direct role in neural crest formation and that Msx2
function is often directly linked to BMP signaling (Kim et al., 1998; Marazzi et al.,
1997; Selleck et al., 1998; Trousse et al., 2001) it is intriguing to ponder if Pax3,
M sxl and the BMP pathway interact in the postotic neural tube during cardiac neural
crest emigration. Studies have shown that BMPs can regulate Pax3 and Msx2 in the
neural tube (Monsoro-Burq et al., 1996; Timmer et al., 2002). Other Pax genes have
been linked to Msx genes and BMPs during cartilage differentiation (Watanabe et al.,
1998) and tooth development (Peters et al., 1998). In addition, high levels of BMP4
have been shown to induce apoptosis in neural crest (Graham et al., 1994) and
overexpression of M sxl can do the same (Marazzi et al., 1997; Takahashi et al.,
1998). Thus, even though significant apoptosis has not been reported in neural crest
from Splotch embryos, it is possible that BMPs play a role in the upregulated and
ectopic expression of M sxl in PaxS'1 ' neural tubes.
89
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
MATERIALS AND METHODS
Transfections
The A3Msx2luciferase construct contained a 1.8 kb BamHl fragment located
between -5082 and -3298 bp upstream of the Msx2 translation start site. This
fragment was blunt-ended with Klenow and cloned into a Smal site in PGL2
immediately upstream of a TK minimal promoter. The 560 bp A4Msx2luciferase
construct (-3862 to -3303) was generated by PCR and cloned into PGL2 as an Apal-
5’, Xhol-3’ fragment. The A4DMsx2luciferase construct was created by ligating
two PCR products together, with the 52 bp BMP-responsive region being omitted.
This 510 bp fragment was then subcloned into PGL2 the same way as the A4
construct. 10T1/2 cells were transfected with the reporter constructs using superfect
and 24 hours later the cells were induced with BMP2/4 ligand (60ng/ml final). 24
hours later, the cells were harvested and luciferase assays performed using the dual
luciferase system (Promega).
Transgenes and the production of transgenic mice
The AlMsx2lacZ and A2Msx2lacZ transgenic mice have been described previously
(Liu et al., 1994). The A3Msx2-hsplacZ and A4Msx2-hsplacZ transgenic mice have
also previously been described (Kwang et al., 2002). The A5Msx2-hsplacZ construct
contained a 220 bp PCR fragment located between -3521 and -3310 bp upstream of
the Msx2 translation start site. This fragment was cloned the same way as those
previously. The A6Msx2-hsplacZ construct contained a tetramer repeat of the 52 bp
promoter sequence between -3521 and -3469 bp upstream of the Msx2 translation
90
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
start site. This construct was generated using dimer repeat oligos that were ligated
together prior to cloning into a Smal site immediately upstream of the hsp68-lacZ-
SV40 cassette (Kwang et al., 2002). Transgenic mouse embryos were produced as
described by Liu et al. (1994).
fi-galactosidase staining, histology, and in situ hybridization
Embryos were fixed in 4% paraformaldehyde for 30-45 minutes at 4°C prior to
staining (Liu et al., 1994). Adjustments in the length of fixation were made based on
the age of the embryo. Length of staining was overnight at 37°C if not otherwise
stated. Embryo tissue was embedded either in paraffin (for standard histology) or in
Historesin (Lazik et al., 1996) after lacZ staining. Paraffin sections were cut at 6
pm, Historesin sections cut at 4 |im. Some paraffin sections were counterstained
with nuclear fast red (Humason, 1979). Whole mount in situ hybridization and
frozen sectioning was performed as described in Kwang et al., 2002. Photographs
were digitized and the images processed in Adobe PhotoShop.
BMP bead implantation assay
Affigel agarose beads (Biorad) were thoroughly washed in PBS prior to incubating
in .1%BSA with lOOng/pl BMP2/4 (R&D) for 30 minutes at 37°C. BSA beads were
prepared the same way using .1%BSA. Beads were placed on tissue resting upon
transwell membranes and immersed in DMEM media. All tissue samples were
incubated overnight in 6% C02 with the specified beads. The following day, tissues
were fixed for 10 minutes in 4% paraformaldehyde and stained for lacZ activity
either overnight or for the specified time.
91
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
Genotvping
DNA was prepared from mouse tails or embryo yolk sacs as described in Hogan,
1994. Msx2-lacZ transgene genotypes were determined by PCR using primers to
lacZ and Msxl/2 mutant genotypes were determined by PCR as described in Kwang
et al., 2002.
Electrophoretic Mobility Shift Assay ('EMSA')
EMSA was performed as previously described (Kwang et al., 2002).
Transgenic flv analysis
Transgenic flies were produced as described in Arora et al.
92
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
BIBLIOGRAPHY
Abdelwahid, E., Rice, D., Pelliniemi, L. J., and Jokinen, E. (2001). Overlapping and
differential localization of Bmp-2, Bmp-4, Msx-2 and apoptosis in the endocardial
cushion and adjacent tissues of the developing mouse heart, Cell Tissue Res 305, 67-
78.
Ahn, K., Mishina, Y., Hanks, M. C., Behringer, R. R., and Crenshaw, E. B., 3rd
(2001). BMPR-IA signaling is required for the formation of the apical ectodermal
ridge and dorsal-ventral patterning of the limb, Development 128, 4449-61.
Allen, S. P., Bogardi, J. P., Barlow, A. J., Mir, S. A., Qayyum, S. R., Verbeek, F. J.,
Anderson, R. H., Francis-West, P. H., Brown, N. A., and Richardson, M. K. (2001).
Misexpression of noggin leads to septal defects in the outflow tract of the chick
heart, Dev Biol 235, 98-109.
Asher, J. H„ Jr., Harrison, R. W., Morell, R., Carey, M. L., and Friedman, T. B.
(1996). Effects of Pax3 modifier genes on craniofacial morphology, pigmentation,
and viability: a murine model of Waardenburg syndrome variation, Genomics 34,
285-98.
Auerbach, R. (1954). Analysis of the developmental effects of a lethal mutation in
the house mouse, J Experimental Zoology 127, 305-329.
Barlow, A. J., and Francis-West, P. H. (1997). Ectopic application of recombinant
BMP-2 and BMP-4 can change patterning of developing chick facial primordia,
Development 124, 391-8.
Bell, J., Char, B. R., and Maxson, R. (1992). An octamer element is required for the
expression of the alpha H2B histone gene during the early development of the sea
urchin, Dev Biol 150, 363-71.
93
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
Bell, J. R., Noveen, A., Liu, Y. H., Ma, L., Dobias, S., Kundu, R., Luo, W., Xia, Y.,
Lusis, A. J., Snead, M. L., and et al. (1993). Genomic structure, chromosomal
location, and evolution of the mouse Hox 8 gene, Genomics 16, 123-31.
Bergwerff, M., Gittenberger-de Groot, A. C., Wisse, L. J., DeRuiter, M. C., Wessels,
A., Martin, J. F., Olson, E. N., and Kern, M. J. (2000). Loss of function of the Prxl
and Prx2 homeobox genes alters architecture of the great elastic arteries and ductus
arteriosus, Virchows Arch 436, 12-9.
Bidder, M., Latifi, T., and Towler, D. A. (1998). Reciprocal temporospatial patterns
of Msx2 and Osteocalcin gene expression during murine odontogenesis, J Bone
Miner Res 13, 609-19.
Bienz, M. (1994). Homeotic genes and positional signalling in the Drosophila
viscera, Trends Genet 10, 22-6.
Bienz, M. (1997). Endoderm induction in Drosophila: the nuclear targets of the
inducing signals, Curr Opin Genet Dev 7, 683-8.
Borycki, A. G., Li, J., Jin, F., Emerson, C. P., and Epstein, J. A. (1999). Pax3
functions in cell survival and in pax7 regulation, Development 126,1665-74.
Bronner-Fraser, M. (1995). Origins and developmental potential of the neural crest,
Exp Cell Res 218, 405-17.
Capdevila, J., and Izpisua Belmonte, J. C. (2001). Patterning mechanisms controlling
vertebrate limb development, Annu Rev Cell Dev Biol 17, 87-132.
Carey, M. L., Friedman, T. B., Asher, J. H., Jr., and Innis, J. W. (1998). Septo-optic
dysplasia and WS1 in the proband of a WS1 family segregating for a novel mutation
in PAX3 exon 7, J Med Genet 35, 248-50.
Catron, K. M., Wang, H., Hu, G., Shen, M. M., and Abate-Shen, C. (1996).
Comparison of MSX-1 and MSX-2 suggests a molecular basis for functional
redundancy [published erratum appears in Mech Dev 1996 May;56(l-2):223], Mech
Dev 55, 185-99.
94
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
Chalepakis, G., Goulding, M., Read, A., Strachan, T., and Gruss, P. (1994).
Molecular basis of splotch and Waardenburg Pax-3 mutations, Proc Natl Acad Sci U
S A 91, 3685-9.
Chalepakis, G., and Gruss, P. (1995). Identification of DNA recognition sequences
for the Pax3 paired domain, Gene 162, 267-70.
Chang, H., Huylebroeck, D., Verschueren, K., Guo, Q., Matzuk, M. M., and Zwijsen,
A. (1999). Smad5 knockout mice die at mid-gestation due to multiple embryonic and
extraembryonic defects, Development 126, 1631-42.
Chen, X., Weisberg, E., Fridmacher, V., Watanabe, M., Naco, G., and Whitman, M.
(1997). Smad4 and FAST-1 in the assembly of activin-responsive factor, Nature 389,
85-9.
Chen, Y., Lebrun, J. J., and Vale, W. (1996). Regulation of transforming growth
factor beta- and activin-induced transcription by mammalian Mad proteins, Proc Natl
Acad Sci U S A 93, 12992-7.
Chen, Y. G., Hata, A., Lo, R. S., Wotton, D., Shi, Y., Pavletich, N., and Massague, J.
(1998). Determinants of specificity in TGF-beta signal transduction, Genes Dev 12,
2144-52.
Chen, Y. G., and Massague, J. (1999). Smadl recognition and activation by the
ALK1 group of transforming growth factor-beta family receptors, J Biol Chem 274,
3672-7.
Conway, S. J., Bundy, J., Chen, J., Dickman, E., Rogers, R., and Will, B. M. (2000).
Decreased neural crest stem cell expansion is responsible for the conotruncal heart
defects within the splotch (Sp(2H))/Pax3 mouse mutant, Cardiovasc Res 47, 314-28.
Conway, S. J., Henderson, D. J., and Copp, A. J. (1997a). Pax3 is required for
cardiac neural crest migration in the mouse: evidence from the splotch (Sp2H)
mutant, Development 124, 505-14.
95
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
Conway, S. J., Henderson, D. J., Kirby, M. L., Anderson, R. H., and Copp, A. J.
(1997b). Development of a lethal congenital heart defect in the splotch (Pax3)
mutant mouse, Cardiovasc Res 3 6 ,163-73.
Creazzo, T. L., Godt, R. E., Leatherbury, L., Conway, S. J., and Kirby, M. L. (1998).
Role of cardiac neural crest cells in cardiovascular development, Annu Rev Physiol
60, 267-86.
D'Alessio, M., and Frasch, M. (1996). msh may play a conserved role in dorsoventral
patterning of the neuroectoderm and mesoderm, Mech Dev 58, 217-31.
Dahn, R. D., and Fallon, J. F. (2000). Interdigital regulation of digit identity and
homeotic transformation by modulated BMP signaling, Science 289,438-41.
Daluiski, A., Engstrand, T., Bahamonde, M. E., Gamer, L. W., Agius, E., Stevenson,
S. L., Cox, K., Rosen, V., and Lyons, K. M. (2001). Bone morphogenetic protein-3 is
a negative regulator of bone density, Nat Genet 27, 84-8.
Das, P., Maduzia, L. L., Wang, H., Finelli, A. L., Cho, S. H., Smith, M. M., and
Padgett, R. W. (1998). The Drosophila gene Medea demonstrates the requirement for
different classes of Smads in dpp signaling, Development 125, 1519-28.
Davidson, D. (1995). The function and evolution of Msx genes: pointers and
paradoxes, Trends Genet 11,405-11.
de Jong, R., van der Heijden, J., and Meijlink, F. (1993). DNA-binding specificity of
the S8 homeodomain, Nucleic Acids Res 21,4711-20.
Delot, E. C., Bahamonde, M. E., Zhao, M., and Lyons, K. M. (2003). BMP signaling
is required for septation of the outflow tract of the mammalian heart, Development
130, 209-220.
Drossopoulou, G., Lewis, K. E., Sanz-Ezquerro, J. J., Nikbakht, N., McMahon, A.
P., Hofmann, C., and Tickle, C. (2000). A model for anteroposterior patterning of the
vertebrate limb based on sequential long- and short-range Shh signalling and Bmp
signalling, Development 127,1337-48.
96
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
Dunn, N. R., Winnier, G. E., Hargett, L. K., Schrick, J. J., Fogo, A. B., and Hogan,
B. L. (1997). Haploinsufficient phenotypes in Bmp4 heterozygous null mice and
modification by mutations in Gli3 and Alx4, Dev Biol 188, 235-47.
Duprez, D. M., Kostakopoulou, K., Francis-West, P. H., Tickle, C., and Brickell, P.
M. (1996). Activation of Fgf-4 and HoxD gene expression by BMP-2 expressing
cells in the developing chick limb, Development 1 22,1821-8.
Edery, P., Lyonnet, S., Mulligan, L. M., Pelet, A., Dow, E., Abel, L., Holder, S.,
Nihoul-Fekete, C., Ponder, B. A., and Munnich, A. (1994). Mutations of the RET
proto-oncogene in Hirschsprung's disease, Nature 367, 378-80.
Epstein, J. A., Lam, P., Jepeal, L., Maas, R. L., and Shapiro, D. N. (1995). Pax3
inhibits myogenic differentiation of cultured myoblast cells, J Biol Chem 270,
11719-22.
Epstein, J. A., Li, J., Lang, D., Chen, F., Brown, C. B., Jin, F., Lu, M. M., Thomas,
M., Liu, E., Wessels, A., and Lo, C. W. (2000). Migration of cardiac neural crest
cells in Splotch embryos, Development 127,1869-1878.
Epstein, J. A., Shapiro, D. N., Cheng, J., Lam, P. Y., and Maas, R. L. (1996). Pax3
modulates expression of the c-Met receptor during limb muscle development, Proc
Natl Acad Sci U S A 93,4213-8.
Farrell, M., Waldo, K., Li, Y. X., and Kirby, M. L. (1999). A novel role for cardiac
neural crest in heart development, Trends Cardiovasc Med 9, 214-20.
Feng, X. H., Zhang, Y., Wu, R. Y., and Derynck, R. (1998). The tumor suppressor
Smad4/DPC4 and transcriptional adaptor CBP/p300 are coactivators for smad3 in
TGF-beta-induced transcriptional activation, Genes Dev 12, 2153-63.
Ferrari, D., Lichtler, A. C., Pan, Z. Z., Dealy, C. N., Upholt, W. B., and Kosher, R.
A. (1998). Ectopic expression of Msx-2 in posterior limb bud mesoderm impairs
limb morphogenesis while inducing BMP-4 expression, inhibiting cell proliferation,
and promoting apoptosis, Dev Biol 197, 12-24.
97
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
Fortin, A. S., Underhill, D. A., and Gros, P. (1997). Reciprocal effect of
Waardenburg syndrome mutations on DNA binding by the Pax-3 paired domain and
homeodomain, Hum Mol Genet 6 , 1781-90.
Francis, P. H., Richardson, M. K., Brickell, P. M., and Tickle, C. (1994). Bone
morphogenetic proteins and a signalling pathway that controls patterning in the
developing chick limb, Development 120, 209-18.
Francis-West, P. H., Richardson, M. K., Bell, E., Chen, P., Luyten, F., Adelfattah,
A., Barlow, A. J., Brickell, P. M., Wolpert, L., and Archer, C. W. (1996). The effect
of overexpression of BMPs and GDF-5 on the development of chick limb skeletal
elements, Ann N Y Acad Sci 785, 254-5.
Francis-West, P. H., Robertson, K. E., Ede, D. A., Rodriguez, C., Izpisua-Belmonte,
J. C., Houston, B., Burt, D. W., Gribbin, C., Brickell, P. M., and Tickle, C. (1995).
Expression of genes encoding bone morphogenetic proteins and sonic hedgehog in
talpid (ta3) limb buds: their relationships in the signalling cascade involved in limb
patterning, Dev Dyn 203, 187-97.
Francis-West, P. H., Tatla, T., and Brickell, P. M. (1994). Expression patterns of the
bone morphogenetic protein genes Bmp-4 and Bmp-2 in the developing chick face
suggest a role in outgrowth of the primordia, Dev Dyn 2 01,168-78.
Franz, T. (1989). Persistent truncus arteriosus in the Splotch mutant mouse, Anat
Embryol 180, 457-64.
Frasch, M. (1995). Induction of visceral and cardiac mesoderm by ectodermal Dpp in
the early Drosophila embryo, Nature 374,464-7.
Fujiwara, T., Dunn, N. R., and Hogan, B. L. (2001). Bone morphogenetic protein 4
in the extraembryonic mesoderm is required for allantois development and the
localization and survival of primordial germ cells in the mouse, Proc Natl Acad Sci
U S A 98, 13739-44.
98
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
Furuta, Y„ and Hogan, B. L. (1998). BMP4 is essential for lens induction in the
mouse embryo, Genes Dev 12, 3764-75.
Galibert, M. D., Yavuzer, U., Dexter, T. J., and Goding, C. R. (1999). Pax3 and
regulation of the melanocyte-specific tyrosinase-related protein-1 promoter, J Biol
Chem 274, 26894-900.
Ganan, Y., Macias, D., Basco, R. D., Merino, R., and Hurle, J. M. (1998).
Morphological diversity of the avian foot is related with the pattern of msx gene
expression in the developing autopod, Dev Biol 196, 33-41.
Gehring, W. J., Qian, Y. Q., Billeter, M., Furukubo-Tokunaga, K., Schier, A. F.,
Resendez-Perez, D., Affolter, M., Otting, G., and Wuthrich, K. (1994).
Homeodomain-DNA recognition, Cell 78, 211-23.
Germain, S., Howell, M., Esslemont, G. M., and Hill, C. S. (2000). Homeodomain
and winged-helix transcription factors recruit activated Smads to distinct promoter
elements via a common Smad interaction motif, Genes Dev 14,435-51.
Graham, A., Francis-West, P., Brickell, P., and Lumsden, A. (1994). The signalling
molecule BMP4 mediates apoptosis in the rhombencephalic neural crest, Nature 372,
684-6.
Hata, A., Seoane, J., Lagna, G., Montalvo, E., Hemmati-Brivanlou, A., and
Massague, J. (2000). OAZ uses distinct DNA- and protein-binding zinc fingers in
separate BMP- Smad and Olf signaling pathways, Cell 100, 229-40.
Helder, M. N., Ozkaynak, E., Sampath, K. T., Luyten, F. P., Latin, V., Oppermann,
H., and Vukicevic, S. (1995). Expression pattern of osteogenic protein-1 (bone
morphogenetic protein- 7) in human and mouse development, J Histochem
Cytochem 43, 1035-44.
Heldin, C. H., Miyazono, K., and ten Dijke, P. (1997). TGF-beta signalling from cell
membrane to nucleus through SMAD proteins, Nature 390,465-71.
99
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
Henderson, D. J., Ybot-Gonzalez, P., and Copp, A. J. (1997). Over-expression of the
chondroitin sulphate proteoglycan versican is associated with defective neural crest
migration in the Pax3 mutant mouse (splotch), Mech Dev 69, 39-51.
Henningfeld, K. A., Friedle, H., Rastegar, S., and Knochel, W. (2002).
Autoregulation of Xvent-2B; direct interaction and functional cooperation of Xvent-
2 and Smadl, J Biol Chem 277, 2097-103.
Henningfeld, K. A., Rastegar, S., Adler, G., and Knochel, W. (2000). Smadl and
Smad4 are components of the bone morphogenetic protein-4 (BMP- 4)-induced
transcription complex of the Xvent-2B promoter, J Biol Chem 275, 21827-35.
Hewitt, J. E., Clark, L. N., Ivens, A., and Williamson, R. (1991). Structure and
sequence of the human homeobox gene HOX7, Genomics 11, 670-8.
Hill, R. E., Jones, P. F., Rees, A. R., Sime, C. M., Justice, M. J., Copeland, N. G.,
Jenkins, N. A., Graham, E., and Davidson, D. R. (1989). A new family of mouse
homeo box-containing genes: molecular structure, chromosomal location, and
developmental expression of Hox-7.1, Genes Dev 3, 26-37.
Hogan, B., Beddington, R., Constantini, F., and Lacy, E. (1994). Manipulating the
mouse embryo: a laboratory manual. (Plainview, N.Y., Cold Spring Harbor
Laboratory Press).
Hogan, B. L. (1996). Bone morphogenetic proteins in development, Curr Opin Genet
Dev 6 ,432-8.
Holland, P. W. (1991). Cloning and evolutionary analysis of msh-like homeobox
genes from mouse, zebrafish and ascidian, Gene 98, 253-7.
Hoodless, P. A., Haerry, T., Abdollah, S., Stapleton, M., O'Connor, M. B., Attisano,
L., and Wrana, J. L. (1996). MADR1, a MAD-related protein that functions in BMP2
signaling pathways, Cell 85,489-500.
Homyak, T. J., Hayes, D. J., Chiu, L., and Ziff, E. B. (2001). Transcription factors in
melanocyte development: distinct roles for Pax- 3 and Mitf, Mech Dev 101,47-59.
100
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
Hua, X., Liu, X., Ansari, D. O., and Lodish, H. F. (1998). Synergistic cooperation of
TFE3 and smad proteins in TGF-beta-induced transcription of the plasminogen
activator inhibitor-1 gene, Genes Dev 12, 3084-95.
Huang, H. C., Murtaugh, L. C., Vize, P. D., and Whitman, M. (1995). Identification
of a potential regulator of early transcriptional responses to mesoderm inducers in
the frog embryo, Embo J 14, 5965-73.
Hudson, J. B., Podos, S. D., Keith, K., Simpson, S. L., and Ferguson, E. L. (1998a).
The Drosophila Medea gene is required downstream of dpp and encodes a functional
homolog of human Smad4, Development 125, 1407-20.
Hudson, R., Taniguchi-Sidle, A., Boras, K., Wiggan, O., and Hamel, P. A. (1998b).
Alx-4, a transcriptional activator whose expression is restricted to sites of epithelial-
mesenchymal interactions, Dev Dyn 21 3 ,159-69.
Hullinger, T. G., Pan, Q., Viswanathan, H. L., and Somerman, M. J. (2001).
TGFbeta and BMP-2 activation of the OPN promoter: roles of smad- and hox-
binding elements, Exp Cell Res 262, 69-74.
Ishida, W., Hamamoto, T., Kusanagi, K., Yagi, K., Kawabata, M., Takehara, K.,
Sampath, T. K., Kato, M., and Miyazono, K. (2000). Smad6 is a Smadl/5-induced
smad inhibitor. Characterization of bone morphogenetic protein-responsive element
in the mouse Smad6 promoter, J Biol Chem 275, 6075-9.
Janknecht, R., Wells, N. J., and Hunter, T. (1998). TGF-beta-stimulated cooperation
of smad proteins with the coactivators CBP/p300, Genes Dev 12, 2114-9.
Jazwinska, A., Kirov, N., Wieschaus, E., Roth, S., and Rushlow, C. (1999). The
Drosophila gene brinker reveals a novel mechanism of Dpp target gene regulation,
Cell 96, 563-73.
Johnson, K., Kirkpatrick, H., Comer, A., Hoffmann, F. M., and Laughon, A. (1999).
Interaction of Smad complexes with tripartite DNA-binding sites, J Biol Chem 274,
20709-16.
101
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
Jones, C. M., Lyons, K. M., and Hogan, B. L. (1991). Involvement of Bone
Morphogenetic Protein-4 (BMP-4) and Vgr-1 in morphogenesis and neurogenesis in
the mouse, Development 111, 531-42.
Kanzler, B., Foreman, R. K., Labosky, P. A., and Mallo, M. (2000). BMP signaling
is essential for development of skeletogenic and neurogenic cranial neural crest,
Development 127,1095-104.
Kawakami, Y., Ishikawa, T., Shimabara, M., Tanda, N., Enomoto-Iwamoto, M.,
Iwamoto, M., Kuwana, T., Ueki, A., Noji, S., and Nohno, T. (1996). BMP signaling
during bone pattern determination in the developing limb, Development 122, 3557-
66.
Kim, H. J., Rice, D. P., Kettunen, P. J., and Thesleff, I. (1998). FGF-, BMP- and
Shh-mediated signalling pathways in the regulation of cranial suture morphogenesis
and calvarial bone development, Development 125,1241-51.
Kim, J., Johnson, K., Chen, H. J., Carroll, S., and Laughon, A. (1997). Drosophila
Mad binds to DNA and directly mediates activation of vestigial by Decapentaplegic,
Nature 388, 304-8.
Kirby, M. L., Gale, T. F., and Stewart, D. E. (1983). Neural crest cells contribute to
normal aorticopulmonary septation, Science 2 2 0 ,1059-61.
Kirby, M. L., Tumage, K. L., 3rd, and Hays, B. M. (1985). Characterization of
conotruncal malformations following ablation of "cardiac" neural crest, Anat Rec
213, 87-93.
Kretzschmar, M., Liu, F., Hata, A., Doody, J., and Massague, J. (1997). The TGF-
beta family mediator Smadl is phosphorylated directly and activated functionally by
the BMP receptor kinase, Genes Dev 11, 984-95.
Kulesa, P. M., and Fraser, S. E. (1998). Neural crest cell dynamics revealed by time-
lapse video microscopy of whole embryo chick explant cultures, Dev Biol 204, 327-
44.
102
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
Kulessa, H., Turk, G., and Hogan, B. L. (2000). Inhibition of Bmp signaling affects
growth and differentiation in the anagen hair follicle, Embo J 19, 6664-74.
Kusanagi, K., Inoue, H., Ishidou, Y., Mishima, H. K., Kawabata, M., and Miyazono,
K. (2000). Characterization of a bone morphogenetic protein-responsive Smad-
binding element, Mol Biol Cell 11, 555-65.
Labbe, E., Letamendia, A., and Attisano, L. (2000). Association of Smads with
lymphoid enhancer binding factor 1/T cell- specific factor mediates cooperative
signaling by the transforming growth factor-beta and wnt pathways, Proc Natl Acad
Sci U S A 97, 8358-63.
Labbe, E., Silvestri, C., Hoodless, P. A., Wrana, J. L., and Attisano, L. (1998).
Smad2 and Smad3 positively and negatively regulate TGF beta-dependent
transcription through the forkhead DNA-binding protein FAST2, Mol Cell 2,109-20.
Lagna, G., Hata, A., Hemmati-Brivanlou, A., and Massague, J. (1996). Partnership
between DPC4 and SMAD proteins in TGF-beta signalling pathways, Nature 383,
832-6.
Lakkis, M. M., and Epstein, J. A. (1998). Neurofibromin modulation of ras activity is
required for normal endocardial-mesenchymal transformation in the developing
heart, Development 125,4359-67.
Lang, D., Chen, F., Milewski, R., Li, J., Lu, M. M., and Epstein, J. A. (2000). Pax3 is
required for enteric ganglia formation and functions with sox 10 to modulate
expression of c-ret [In Process Citation], J Clin Invest 106, 963-71.
Laufer, E., Pizette, S., Zou, H., Orozco, O. E., and Niswander, L. (1997). BMP
expression in duck interdigital webbing: a reanalysis, Science 278, 305.
Lawson, K. A., Dunn, N. R., Roelen, B. A., Zeinstra, L. M., Davis, A. M., Wright, C.
V., Korving, J. P., and Hogan, B. L. (1999). Bmp4 is required for the generation of
primordial germ cells in the mouse embryo, Genes Dev 13, 424-36.
103
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
Li, J., Liu, K. C., Jin, F., Lu, M. M., and Epstein, J. A. (1999). Transgenic rescue of
congenital heart disease and spina bifida in Splotch mice, Development 126,2495-
503.
Liberatore, C. M., Searcy-Schrick, R. D., Vincent, E. B., and Yutzey, K. E. (2002).
Nkx-2.5 gene induction in mice is mediated by a Smad consensus regulatory region,
Dev Biol 244, 243-56.
Lien, C. L., McAnally, J., Richardson, J. A., and Olson, E. N. (2002). Cardiac-
specific activity of an Nkx2-5 enhancer requires an evolutionarily conserved Smad
binding site, Dev Biol 244, 257-66.
Liu, F., Hata, A., Baker, J. C., Doody, J., Carcamo, J., Harland, R. M., and
Massague, J. (1996). A human Mad protein acting as a BMP-regulated
transcriptional activator, Nature 381, 620-3.
Liu, F., Ventura, F., Doody, J., and Massague, J. (1995). Human type II receptor for
bone morphogenic proteins (BMPs): extension of the two-kinase receptor model to
the BMPs, Mol Cell Biol 15, 3479-86.
Liu, X., Sun, Y., Constantinescu, S. N., Karam, E., Weinberg, R. A., and Lodish, H.
F. (1997). Transforming growth factor beta-induced phosphorylation of Smad3 is
required for growth inhibition and transcriptional induction in epithelial cells, Proc
Natl Acad Sci U S A 9 4 ,10669-74.
Liu, Y. H., Ma, L., Wu, L. Y., Luo, W., Kundu, R., Sangiorgi, F., Snead, M. L., and
Maxson, R. (1994). Regulation of the Msx2 homeobox gene during mouse
embryogenesis: a transgene with 439 bp of 5' flanking sequence is expressed
exclusively in the apical ectodermal ridge of the developing limb, Mech Dev 48,
187-97.
Liu, Y. H., Tang, Z., Kundu, R. K., Wu, L., Luo, W., Zhu, D., Sangiorgi, F., Snead,
M. L., and Maxson, R. E. (1999). Msx2 gene dosage influences the number of
proliferative osteogenic cells in growth centers of the developing murine skull: a
possible mechanism for MSX2-mediated craniosynostosis in humans, Dev Biol 205,
260-74.
104
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
Lopez-Rovira, T., Chalaux, E., Massague, J., Rosa, J. L., and Ventura, F. (2002).
Direct binding of Smadl and Smad4 to two distinct motifs mediates bone
morphogenetic protein-specific transcriptional activation of Idl gene, J Biol Chem
277,3176-85.
Lu, M. F., Cheng, H. T., Lacy, A. R., Kern, M. J., Argao, E. A., Potter, S. S., Olson,
E. N., and Martin, J. F. (1999). Paired-related homeobox genes cooperate in
handplate and hindlimb zeugopod morphogenesis, Dev Biol 205, 145-57.
Luo, G., Hofmann, C., Bronckers, A. L., Sohocki, M., Bradley, A., and Karsenty, G.
(1995). BMP-7 is an inducer of nephrogenesis, and is also required for eye
development and skeletal patterning, Genes Dev 9, 2808-20.
Lyons, G. E., Houzelstein, D., Sassoon, D., Robert, B., and Buckingham, M. E.
(1992). Multiple sites of Hox-7 expression during mouse embryogenesis:
comparison with retinoic acid receptor mRNA localization, Mol Reprod Dev 32,
303-14.
Lyons, K. M., Hogan, B. L., and Robertson, E. J. (1995). Colocalization of BMP 7
and BMP 2 RNAs suggests that these factors cooperatively mediate tissue
interactions during murine development, Mech Dev 50 ,71-83.
Lyons, K. M., Pelton, R. W., and Hogan, B. L. (1990). Organogenesis and pattern
formation in the mouse: RNA distribution patterns suggest a role for bone
morphogenetic protein-2A (BMP-2A), Development 109, 833-44.
Machado, A. F., Martin, L. J., and Collins, M. D. (2001). Pax3 and the splotch
mutations: structure, function, and relationship to teratogenesis, including gene-
chemical interactions, Curr Pharm Des 7, 751-85.
Macias, D., Ganan, Y., Sampath, T. K., Piedra, M. E., Ros, M. A., and Hurle, J. M.
(1997). Role of BMP-2 and OP-1 (BMP-7) in programmed cell death and
skeletogenesis during chick limb development, Development 124,1109-17.
105
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
Macias-Silva, M., Hoodless, P. A., Tang, S. J., Buchwald, M., and Wrana, J. L.
(1998). Specific activation of Smadl signaling pathways by the BMP7 type I
receptor, ALK2, J Biol Chem 275, 25628-36.
MacKenzie, A., Ferguson, M. W., and Sharpe, P. T. (1992). Expression patterns of
the homeobox gene, Hox-8, in the mouse embryo suggest a role in specifying tooth
initiation and shape, Development 115,403-20.
Mackenzie, A., Leeming, G. L., Jowett, A. K., Ferguson, M. W., and Sharpe, P. T.
(1991). The homeobox gene Hox 7.1 has specific regional and temporal expression
patterns during early murine craniofacial embryogenesis, especially tooth
development in vivo and in vitro, Development 111, 269-85.
Mansouri, A., Pla, P., Larue, L., and Gruss, P. (2001). Pax3 acts cell autonomously
in the neural tube and somites by controlling cell surface properties, Development
128,1995-2005.
Marazzi, G., Wang, Y., and Sassoon, D. (1997). Msx2 is a transcriptional regulator
in the BMP4-mediated programmed cell death pathway, Dev Biol 186, 127-38.
Martin, J. F., Bradley, A., and Olson, E. N. (1995). The paired-like homeo box gene
MHox is required for early events of skeletogenesis in multiple lineages, Genes Dev
9 ,1237-49.
Marty, T., Vigano, M. A., Ribeiro, C., Nussbaumer, U., Grieder, N. C., and Affolter,
M. (2001). A HOX complex, a repressor element and a 50 bp sequence confer
regional specificity to a DPP-responsive enhancer, Development 128, 2833-45.
Marvin, M. J., Di Rocco, G., Gardiner, A., Bush, S. M., and Lassar, A. B. (2001).
Inhibition of Wnt activity induces heart formation from posterior mesoderm, Genes
Dev 15, 316-27.
Massague, J. (1998). TGF-beta signal transduction, Annu Rev Biochem 67, 753-91.
Massague, J., and Chen, Y. G. (2000). Controlling TGF-beta signaling, Genes Dev
14, 627-44.
106
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
Massague, J., and Weis-Garcia, F. (1996). Serine/threonine kinase receptors:
mediators of transforming growth factor beta family signals, Cancer Surv 27,41-64.
Mathieu, M., Bourges, E., Caron, F., and Piussan, C. (1990). [Waardenburg's
syndrome and severe cyanotic cardiopathy], Arch Fr Pediatr 47, 657-9.
Meijlink, F., Beverdam, A., Brouwer, A., Oosterveen, T. C., and Berge, D. T.
(1999). Vertebrate aristaless-related genes, Int J Dev Biol 43, 651-63.
Merino, R., Ganan, Y., Macias, D., Rodriguez-Leon, J., and Hurle, J. M. (1999).
Bone morphogenetic proteins regulate interdigital cell death in the avian embryo,
Ann N Y Acad Sci 887,120-32.
Moase, C. E., and Trasler, D. G. (1991). N-CAM alterations in splotch neural tube
defect mouse embryos, Development 113, 1049-58.
Monsoro-Burq, A. H., Duprez, D., Watanabe, Y., Bontoux, M., Vincent, C., Brickell,
P., and Le Douarin, N. (1996). The role of bone morphogenetic proteins in vertebral
development, Development 122, 3607-16.
Morriss-Kay, G., and Tucket, F. (1991). Early events in mammalian craniofacial
morphogenesis, J Craniofac Genet Dev Biol 1 1 ,181-91.
Nakajima, Y., Yamagishi, T., Hokari, S., and Nakamura, H. (2000). Mechanisms
involved in valvuloseptal endocardial cushion formation in early cardiogenesis: roles
of transforming growth factor (TGF)-beta and bone morphogenetic protein (BMP),
Anat Rec 258, 119-27.
Nellen, D., Affolter, M., and Basler, K. (1994). Receptor serine/threonine kinases
implicated in the control of Drosophila body pattern by decapentaplegic, Cell 78,
225-37.
Newfeld, S. J., Chartoff, E. H., Graff, J. M., Melton, D. A., and Gelbart, W. M.
(1996). Mothers against dpp encodes a conserved cytoplasmic protein required in
DPP/TGF-beta responsive cells, Development 122, 2099-108.
107
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
Newfeld, S. J., Mehra, A., Singer, M. A., Wrana, J. L., Attisano, L., and Gelbart, W.
M. (1997). Mothers against dpp participates in a DDP/TGF-beta responsive serine-
threonine kinase signal transduction cascade, Development 124, 3167-76.
Nishitoh, H., Ichijo, H., Kimura, M., Matsumoto, T., Makishima, F., Yamaguchi, A.,
Yamashita, H., Enomoto, S., and Miyazono, K. (1996). Identification of type I and
type II serine/threonine kinase receptors for growth/differentiation factor-5, J Biol
Chem 271, 21345-52.
Nohno, T., Ishikawa, T., Saito, T., Hosokawa, K., Noji, S., Wolsing, D. H., and
Rosenbaum, J. S. (1995). Identification of a human type II receptor for bone
morphogenetic protein-4 that forms differential heteromeric complexes with bone
morphogenetic protein type I receptors, J Biol Chem 270, 22522-6.
Pan, Z. Z., Kronenberg, M. S., Huang, D. Y., Sumoy, L., Rogina, B., Lichtler, A. C.,
and Upholt, W. B. (2002). MSX2 expression in the apical ectoderm ridge is
regulated by an MSX2 and Dlx5 binding site, Biochem Biophys Res Commun 290,
955-61.
Park, G. T., and Morasso, M. I. (2002). Bone morphogenetic protein-2 (BMP-2)
transactivates Dlx3 through Smadl and Smad4: alternative mode for Dlx3 induction
in mouse keratinocytes, Nucleic Acids Res 30, 515-22.
Penton, A., Chen, Y., Staehling-Hampton, K., Wrana, J. L., Attisano, L., Szidonya,
J., Cassill, J. A., Massague, J., and Hoffmann, F. M. (1994). Identification of two
bone morphogenetic protein type I receptors in Drosophila and evidence that Brk25D
is a decapentaplegic receptor, Cell 78, 239-50.
Peters, H., and Balling, R. (1999). Teeth. Where and how to make them, Trends
Genet 15, 59-65.
Peters, H., Neubuser, A., Kratochwil, K., and Balling, R. (1998). Pax9-deficient mice
lack pharyngeal pouch derivatives and teeth and exhibit craniofacial and limb
abnormalities, Genes Dev 12, 2735-47.
108
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
Phippard, D. J., Weber-Hall, S. J., Sharpe, P. T., Naylor, M. S., Jayatalake, H., Maas,
R., Woo, I., Roberts-Clark, D., Francis-West, P. H., Liu, Y. H., et al. (1996).
Regulation of Msx-1, Msx-2, Bmp-2 and Bmp-4 during foetal and postnatal
mammary gland development, Development 122, 2729-37.
Piek, E., Heldin, C. H., and Ten Dijke, P. (1999). Specificity, diversity, and
regulation in TGF-beta superfamily signaling, Faseb J 13, 2105-24.
Pizette, S., Abate-Shen, C., and Niswander, L. (2001). BMP controls proximodistal
outgrowth, via induction of the apical ectodermal ridge, and dorsoventral patterning
in the vertebrate limb, Development 128,4463-74.
Pizette, S., and Niswander, L. (1999). BMPs negatively regulate structure and
function of the limb apical ectodermal ridge, Development 126, 883-94.
Pizette, S., and Niswander, L. (2000). BMPs are required at two steps of limb
chondrogenesis: formation of prechondrogenic condensations and their
differentiation into chondrocytes, Dev Biol 219, 237-49.
Pouponnot, C., Jayaraman, L., and Massague, J. (1998). Physical and functional
interaction of SMADs and p300/CBP, J Biol Chem 273,22865-8.
Qu, S., Niswender, K. D., Ji, Q., van der Meer, R., Keeney, D., Magnuson, M. A.,
and Wisdom, R. (1997). Polydactyly and ectopic ZPA formation in Alx-4 mutant
mice, Development 124, 3999-4008.
Raftery, L. A., and Sutherland, D. J. (1999). TGF-beta family signal transduction in
Drosophila development: from Mad to Smads, Dev Biol 210, 251-68.
Raftery, L. A., Twombly, V., Wharton, K., and Gelbart, W. M. (1995). Genetic
screens to identify elements of the decapentaplegic signaling pathway in Drosophila,
Genetics 139, 241-54.
Regulski, M., Dessain, S., McGinnis, N., and McGinnis, W. (1991). High-affinity
binding sites for the Deformed protein are required for the function of an
autoregulatory enhancer of the Deformed gene, Genes Dev 5, 278-86.
109
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
Robert, B., Sassoon, D., Jacq, B., Gehring, W., and Buckingham, M. (1989). Hox-7,
a mouse homeobox gene with a novel pattern of expression during embryogenesis,
Embo J 8, 91-100.
Rosenzweig, B. L., Imamura, T., Okadome, T., Cox, G. N., Yamashita, H., ten Dijke,
P., Heldin, C. H., and Miyazono, K. (1995). Cloning and characterization of a human
type II receptor for bone morphogenetic proteins, Proc Natl Acad Sci U S A 92,
7632-6.
Satokata, I., Ma, L., Ohshima, H., Bei, M., Woo, I., Nishizawa, K., Maeda, T.,
Takano, Y., Uchiyama, M., Heaney, S., etal. (2000). Msx2 deficiency in mice
causes pleiotropic defects in bone growth and ectodermal organ formation, Nat
Genet 24, 391-5.
Satokata, I., and Maas, R. (1994). Msxl deficient mice exhibit cleft palate and
abnormalities of craniofacial and tooth development, Nat Genet 6, 348-56.
Schuler-Metz, A., Knochel, S., Kaufmann, E., and Knochel, W. (2000). The
homeodomain transcription factor Xvent-2 mediates autocatalytic regulation of
BMP-4 expression in Xenopus embryos, J Biol Chem 275, 34365-74.
Schultheiss, T. M., Burch, J. B., and Lassar, A. B. (1997). A role for bone
morphogenetic proteins in the induction of cardiac myogenesis, Genes Dev 11,451-
62.
Sekelsky, J. J., Newfeld, S. J., Raftery, L. A., Chartoff, E. H., and Gelbart, W. M.
(1995). Genetic characterization and cloning of mothers against dpp, a gene required
for decapentaplegic function in Drosophila melanogaster, Genetics 139, 1347-58.
Selleck, M. A., and Bronner-Fraser, M. (1995). Origins of the avian neural crest: the
role of neural plate-epidermal interactions, Development 121, 525-38.
Selleck, M. A., Garcia-Castro, M. I., Artinger, K. B., and Bronner-Fraser, M. (1998).
Effects of Shh and Noggin on neural crest formation demonstrate that BMP is
required in the neural tube but not ectoderm, Development 125,4919-30.
110
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
Serbedzija, G. N., and McMahon, A. P. (1997). Analysis of neural crest cell
migration in Splotch mice using a neural crest-specific LacZ reporter, Dev Biol 185,
139-47.
Shi, X., Yang, X., Chen, D., Chang, Z., and Cao, X. (1999). Smadl interacts with
homeobox DNA-binding proteins in bone morphogenetic protein signaling, J Biol
Chem 2 7 4 ,13711-7.
Shi, Y., Hata, A., Lo, R. S., Massague, J., and Pavletich, N. P. (1997). A structural
basis for mutational inactivation of the tumour suppressor Smad4, Nature 388, 87-
93.
Shi, Y., Wang, Y. F., Jayaraman, L., Yang, H., Massague, J., and Pavletich, N. P.
(1998). Crystal structure of a Smad MH1 domain bound to DNA: insights on DNA
binding in TGF-beta signaling, Cell 94, 585-94.
Shioda, T., Lechleider, R. J., Dunwoodie, S. L., Li, H., Yahata, T., de Caestecker, M.
P., Fenner, M. H., Roberts, A. B., and Isselbacher, K. J. (1998). Transcriptional
activating activity of Smad4: roles of SMAD hetero- oligomerization and
enhancement by an associating transactivator, Proc Natl Acad Sci U S A 95, 9785-
90.
Sinning, A. R. (1998). Role of vitamin A in the formation of congenital heart defects,
Anat Rec 253, 147-53.
Spencer, F. A., Hoffmann, F. M., and Gelbart, W. M. (1982). Decapentaplegic: a
gene complex affecting morphogenesis in Drosophila melanogaster, Cell 28 ,451-61.
Su, M. W., Suzuki, H. R., Solursh, M., and Ramirez, F. (1991). Progressively
restricted expression of a new homeobox-containing gene during Xenopus laevis
embryogenesis, Development 111, 1179-87.
Suzuki, A., Chang, C., Yingling, J. M., Wang, X. F., and Hemmati-Brivanlou, A.
(1997). Smad5 induces ventral fates in Xenopus embryo, Dev Biol 184,402-5.
I l l
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
Szuts, D., Eresh, S., and Bienz, M. (1998). Functional intertwining of Dpp and
EGFR signaling during Drosophila endoderm induction, Genes Dev 12, 2022-35.
Takahashi, K., Nuckolls, G. H., Tanaka, O., Semba, I., Takahashi, I., Dashner, R.,
Shum, L., and Slavkin, H. C. (1998). Adenovirus-mediated ectopic expression of
Msx2 in even-numbered rhombomeres induces apoptotic elimination of cranial
neural crest cells in ovo, Development 125,1627-35.
Takahashi, Y., and Le Douarin, N. (1990). cDNA cloning of a quail homeobox gene
and its expression in neural crest-derived mesenchyme and lateral plate mesoderm,
Proc Natl Acad Sci U S A 8 7 ,7482-6.
Tanaka, M., Chen, Z., Bartunkova, S., Yamasaki, N., and Izumo, S. (1999). The
cardiac homeobox gene Csx/Nkx2.5 lies genetically upstream of multiple genes
essential for heart development, Development 126,1269-80.
Tanimoto, H., Itoh, S., ten Dijke, P., and Tabata, T. (2000). Hedgehog creates a
gradient of DPP activity in Drosophila wing imaginal discs, Mol Cell 5, 59-71.
Tassabehji, M., Newton, V. E., and Read, A. P. (1994). Waardenburg syndrome type
2 caused by mutations in the human microphthalmia (MITF) gene, Nat Genet 8, 251-
5.
ten Berge, D., Brouwer, A., el Bahi, S., Guenet, J. L., Robert, B., and Meijlink, F.
(1998). Mouse Alx3: an aristaless-like homeobox gene expressed during
embryogenesis in ectomesenchyme and lateral plate mesoderm, Dev Biol 199,11-25.
ten Dijke, P., Miyazono, K., and Heldin, C. H. (1996). Signaling via hetero-
oligomeric complexes of type I and type II serine/threonine kinase receptors, Curr
Opin Cell Biol 8 , 139-45.
ten Dijke, P., Yamashita, H., Ichijo, H., Franzen, P., Laiho, M., Miyazono, K., and
Heldin, C. H. (1994). Characterization of type I receptors for transforming growth
factor- beta and activin, Science 264, 101-4.
112
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
Theisen, H., Haerry, T. E„ O'Connor, M. B., and Marsh, J. L. (1996). Developmental
territories created by mutual antagonism between Wingless and Decapentaplegic,
Development 122, 3939-48.
Timmer, J. R., Wang, C., and Niswander, L. (2002). BMP signaling patterns the
dorsal and intermediate neural tube via regulation of homeobox and helix-loop-helix
transcription factors, Development 129, 2459-72.
Tremblay, K. D., Dunn, N. R., and Robertson, E. J. (2001). Mouse embryos lacking
Smadl signals display defects in extra-embryonic tissues and germ cell formation,
Development 128, 3609-21.
Tremblay, P., and Grass, P. (1994). Pax: genes for mice and men, Pharmacol Ther
61, 205-26.
Trousse, F., Esteve, P., and Bovolenta, P. (2001). Bmp4 mediates apoptotic cell
death in the developing chick eye, J Neurosci 2 1 ,1292-301.
Tucker, S. C., and Wisdom, R. (1999). Site-specific heterodimerization by paired
class homeodomain proteins mediates selective transcriptional responses, J Biol
Chem 274, 32325-32.
Vainio, S., Karavanova, I., Jowett, A., and Thesleff, I. (1993). Identification of
BMP-4 as a signal mediating secondary induction between epithelial and
mesenchymal tissues during early tooth development, Cell 75,45-58.
Vindevoghel, L., Lechleider, R. J., Kon, A., de Caestecker, M. P., Uitto, J., Roberts,
A. B., and Mauviel, A. (1998). SMAD3/4-dependent transcriptional activation of the
human type VII collagen gene (COL7A1) promoter by transforming growth factor
beta, Proc Natl Acad Sci U S A 9 5 ,14769-74.
Vogt, T. F., and Duboule, D. (1999). Antagonists go out on a limb, Cell 99, 563-6.
Waldo, K., Zdanowicz, M., Burch, J., Kumiski, D. H., Stadt, H. A., Godt, R. E.,
Creazzo, T. L., and Kirby, M. L. (1999a). A novel role for cardiac neural crest in
heart development, J Clin Invest 103, 1499-507.
113
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
Waldo, K. L., Kumiski, D. H., Wallis, K. T., Stadt, H. A., Hutson, M. R., Platt, D.
H., and Kirby, M. L. (2001). Conotruncal myocardium arises from a secondary heart
field, Development 128, 3179-88.
Waldo, K. L., Lo, C. W., and Kirby, M. L. (1999b). Connexin 43 expression reflects
neural crest patterns during cardiovascular development, Dev Biol 208, 307-23.
Wang, W., Chen, X., Xu, H., and Lufkin, T. (1996). Msx3: a novel murine
homologue of the Drosophila msh homeobox gene restricted to the dorsal embryonic
central nervous system, Mech Dev 58, 203-15.
Watanabe, Y., Duprez, D., Monsoro-Burq, A. H., Vincent, C., and Le Douarin, N.
M. (1998). Two domains in vertebral development: antagonistic regulation by SHH
and BMP4 proteins, Development 125, 2631-9.
Watanabe, Y., and Le Douarin, N. M. (1996). A role for BMP-4 in the development
of subcutaneous cartilage, Mech Dev 57, 69-78.
Whitman, M. (1998). Smads and early developmental signaling by the TGFbeta
superfamily, Genes Dev 12, 2445-62.
Wiersdorff, V., Lecuit, T., Cohen, S. M., and Mlodzik, M. (1996). Mad acts
downstream of Dpp receptors, revealing a differential requirement for dpp signaling
in initiation and propagation of morphogenesis in the Drosophila eye, Development
122, 2153-62.
Winnier, G., Blessing, M., Labosky, P. A., and Hogan, B. L. (1995). Bone
morphogenetic protein-4 is required for mesoderm formation and patterning in the
mouse, Genes Dev 9, 2105-16.
Wisotzkey, R. G., Mehra, A., Sutherland, D. J., Dobens, L. L., Liu, X., Dohrmann,
C., Attisano, L., and Raftery, L. A. (1998). Medea is a Drosophila Smad4 homolog
that is differentially required to potentiate DPP responses, Development 125,1433-
45.
114
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
Wotton, D., Lo, R. S., Lee, S., and Massague, J. (1999). A Smad transcriptional
corepressor, Cell 97, 29-39.
Wrana, J. L. (2000). Regulation of Smad activity, Cell 100, 189-92.
Xu, X., Yin, Z., Hudson, J. B., Ferguson, E. L., and Frasch, M. (1998). Smad
proteins act in combination with synergistic and antagonistic regulators to target Dpp
responses to the Drosophila mesoderm, Genes Dev 12, 2354-70.
Yamagishi, T., Nakajima, Y., Miyazono, K., and Nakamura, H. (1999). Bone
morphogenetic protein-2 acts synergistically with transforming growth factor-beta3
during endothelial-mesenchymal transformation in the developing chick heart, J Cell
Physiol 180, 35-45.
Yamamoto, T. S., Takagi, C., Hyodo, A. C., and Ueno, N. (2001). Suppression of
head formation by Xmsx-1 through the inhibition of intracellular nodal signaling,
Development 128, 2769-79.
Yang, X., Ji, X., Shi, X., and Cao, X. (2000). Smadl domains interacting with Hoxc-
8 induce osteoblast differentiation, J Biol Chem 275,1065-72.
Yi, S. E., Daluiski, A., Pederson, R., Rosen, V., and Lyons, K. M. (2000). The type I
BMP receptor BMPRIB is required for chondrogenesis in the mouse limb,
Development 127, 621-30.
Yokouchi, Y., Ohsugi, K., Sasaki, H., and Kuroiwa, A. (1991). Chicken homeobox
gene Msx-1: structure, expression in limb buds and effect of retinoic acid,
Development 113,431-44.
Yokouchi, Y., Sakiyama, J., Kameda, T., Iba, H., Suzuki, A., Ueno, N., and
Kuroiwa, A. (1996). BMP-2/-4 mediate programmed cell death in chicken limb buds,
Development 122, 3725-34.
Zappavigna, V., Renucci, A., Izpisua-Belmonte, J. C., Urier, G., Peschle, C., and
Duboule, D. (1991). HOX4 genes encode transcription factors with potential auto-
and cross- regulatory capacities, Embo J 10,4177-87.
115
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
Zawel, L., Dai, J. L., Buckhaults, P., Zhou, S., Kinzler, K. W., Vogelstein, B., and
Kern, S. E. (1998). Human Smad3 and Smad4 are sequence-specific transcription
activators, Mol Cell 7, 611-7.
Zecca, M., Basler, K., and Struhl, G. (1995). Sequential organizing activities of
engrailed, hedgehog and decapentaplegic in the Drosophila wing, Development 121,
2265-78.
Zhang, H., and Bradley, A. (1996). Mice deficient for BMP2 are nonviable and have
defects in amnion/chorion and cardiac development, Development 122, 2977-86.
Zhang, Z., Song, Y., Zhao, X., Zhang, X., Fermin, C., and Chen, Y. (2002). Rescue
of cleft palate in Msxl-deficient mice by transgenic Bmp4 reveals a network of BMP
and Shh signaling in the regulation of mammalian palatogenesis, Development 129,
4135-46.
Zhao, Z., and Rivkees, S. A. (2000). Programmed cell death in the developing heart:
regulation by BMP4 and FGF2, Dev Dyn 217, 388-400.
Zhou, S., Zawel, L., Lengauer, C., Kinzler, K. W., and Vogelstein, B. (1998).
Characterization of human FAST-1, a TGF beta and activin signal transducer, Mol
Cell 2,121-7.
Zou, H., and Niswander, L. (1996). Requirement for BMP signaling in interdigital
apoptosis and scale formation, Science 272, 738-41.
Zou, H., Wieser, R., Massague, J., and Niswander, L. (1997). Distinct roles of type I
bone morphogenetic protein receptors in the formation and differentiation of
cartilage, Genes Dev 11, 2191-203.
116
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.

Linked assets

University of Southern California Dissertations and Theses

Conceptually similar

PDF

Characterization of zebularine: A novel inhibitor of DNA methylation with clinical potential

PDF

Expression and functional studies of the Notch signaling pathway in feather development

PDF

Characterization of hematopoietic stem cell capabilities and properties

PDF

A tale of two tails: Role of histone methyltransferases in transcriptional regulation

PDF

Investigation of the role of epigenetic modification of DNA and chromatin in aberrant gene silencing in cancer cells

PDF

EPR analysis of soluble and membrane -bound annexin A2

PDF

Characterization of target cell entry by murine leukemia viruses

PDF

Isolation and characterization of mouse Zac1, a novel co-regulator for transcriptional activation by nuclear receptors and p53

PDF

A novel candidate ovarian cancer and melanoma tumor suppressor gene on chromosome 6q24.3

PDF

An in vivo study of G protein coupled receptor mediated signaling

PDF

Coactivator synergy for nuclear receptors: Regulatory roles of arginine methyltransferase activity in transcription

PDF

Biochemical basis of SOS-induced mutagenesis: UmuD'(2)C is an error-prone DNA polymerase, Escherichia coli Pol V

PDF

An E2F-independent mechanism in transcriptional control of the hamster histone H3.2 gene expression

PDF

Biochemistry of nonhomologous DNA end joining (NHEJ) and its role in V(D)J recombination

PDF

Development and aging in Caenorhabditis elegans: Gene structure and expression of daf-12 and a longitudinal study of neurons in long-lived individuals

PDF

Analysis of Sonic hedgehog/Patched-1 downstream genes in embryonic feather morphogenesis and the development of novel biotechnologies thereof

PDF

Different roles of p160 coregulators in myogenesis

PDF

Functional analysis of MSX2 and its role in skull patterning

PDF

Cyclooxygenase-2 as a candidate biomarker for progression, prognosis and chemoprevention in various tumor types

PDF

Fate of mammalian neural crest

Asset Metadata

Creator Brugger, Sean Michael (author)

Core Title Identification and characterization of transcriptional regulatory elements in the Msx2 promoter

School Graduate School

Degree Doctor of Philosophy

Degree Program Biochemistry

Publisher University of Southern California (original), University of Southern California. Libraries (digital)

Tag biology, molecular,OAI-PMH Harvest

Language English

Contributor Digitized by ProQuest (provenance)

Advisor Warrior, Rahul (committee chair), Chuong, Cheng-Ming (committee member), Laird, Peter W. (committee member), Sucov, Henry (committee member)

Permanent Link (DOI) https://doi.org/10.25549/usctheses-c16-267034

Unique identifier UC11334655

Identifier 3093942.pdf (filename),usctheses-c16-267034 (legacy record id)

Legacy Identifier 3093942.pdf

Dmrecord 267034

Document Type Dissertation

Rights Brugger, Sean Michael

Type texts

Source University of Southern California (contributing entity), University of Southern California Dissertations and Theses (collection)

Access Conditions The author retains rights to his/her dissertation, thesis or other graduate work according to U.S. copyright law. Electronic access is being provided by the USC Libraries in agreement with the au...

Repository Name University of Southern California Digital Library

Repository Location USC Digital Library, University of Southern California, University Park Campus, Los Angeles, California 90089, USA