University of Southern California Dissertations and Theses

Analysis of Sonic hedgehog/Patched-1 downstream genes in embryonic feather morphogenesis and the development of novel biotechnologies thereof

(USC Thesis Other)

Analysis of Sonic hedgehog/Patched-1 downstream genes in embryonic feather morphogenesis and the development of novel biotechnologies thereof

PDF

Download

Open document

Flip pages

Download a page range

Download transcript

Copy asset link

Request this asset

Transcript (if available)

Content INFORMATION TO USERS This manuscript has been reproduced from the microfilm master. UMI films the text directly from the original or copy submitted. Thus, some thesis and dissertation copies are in typewriter face, while others may be from any type of computer printer. The quality of this reproduction is dependent upon the quality of the copy submitted. Broken or indistinct print, colored or poor quality illustrations and photographs, print bleedthrough, substandard margins, and improper alignment can adversely affect reproduction. In the unlikely event that the author did not send UMI a complete manuscript and there are missing pages, these will be noted. Also, if unauthorized copyright material had to be removed, a note will indicate the deletion. Oversize materials (e.g., maps, drawings, charts) are reproduced by sectioning the original, beginning at the upper left-hand comer and continuing from left to right in equal sections with small overlaps. ProQuest Information and Learning 300 North Zeeb Road, Ann Arbor, Ml 48106-1346 USA 800-521-0600 Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. ANALYSIS OF SONIC HEDGEHOG/PATCHED-1 DOWNSTREAM GENES IN EMBRYONIC FEATHER MORPHOGENESIS AND THE DEVELOPMENT OF NOVEL BIOTECHNOLOGIES THEREOF by Shi-Lung Lin A Dissertation Presented to the FACULTY OF THE GRADUATE SCHOOL UNIVERSITY OF SOUTHERN CALIFORNIA In Partial Fulfillment of the Requirements for the Degree DOCTOR OF PHILOSOPHY (PATHOBIOLOGY) May 2002 Copyright 2002 Shi-Lung Lin Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. UMI Number: 3073805 _ _ ( B ) UMI UMI Microform 3073805 Copyright 2003 by ProQuest Information and Learning Company. All rights reserved. This microform edition is protected against unauthorized copying under Title 17, United States Code. ProQuest Information and Learning Company 300 North Zeeb Road P.O. Box 1346 Ann Arbor, Ml 48106-1346 Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. UNIVERSITY OF SOUTHERN CALIFORNIA The Graduate School U niversity Park LOS ANGELES. CALIFORNIA 90089-1695 This dissertation, w ritte n b y SHI-LUNG LIN U nder th e d irectio n o f D issertation C om m i ttee, an d approved b y a il its members, has been p resented to an d accepted b y The G raduate School , in p a rtia l fu lfillm e n t o f requirem ents fo r th e degree o f D O C TO R O F P H ILO S O P H Y Deaa o f Graduate Studies D a te May 10. 2002_________ D1SSER TA T IO N C O M M IT T E E -------— /( . A - ^ _____ -•'S - ” copyright owner. Further reproduction prohibited without permission. ii ACKNOWLEDGMENTS I would like to thank: * My advisory committee chairman, Dr. Cheng-Ming Chuong, whose immense enthusiasm and optimism inspired me to pursue this work. * My advisory committee members, Dr. Shao-Yao Ying, Dr. Carol A. Miller, Dr. Pradip Roy-Burman and Dr. Timothy J. Triche for their kind support and constructive suggestions. * Dr. Clive R. Taylor and Dr. Michael R. Lieber for their professional instruction and kind advice. * Dr. Randall B. W idelitz for always being available to provide technical advice and assistance. * Dr. Ting-Xin Jiang for teaching me delicate embryological procedures. * All the colleagues whom I have worked with, in particular Chihmin Lin for collaborating with me on many tissue section staining and immunohisto- chemistry projects. * My parents, Keng-Chu Lin and Mei-Hsi Huang, for providing me the environment and opportunity to attain higher education. I am thankful for their unconditional love and support which have sustained me through difficult times. * Special appreciation goes to my lovely wife, Emmy, and the cutest daughter in the world, Samantha, forgiving their infinite love and encouragement. Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. Ill TABLE OF CONTENTS ACKNOWLEDGMENTS........................................................................................ ii LIST OF FIGURES............................................................................................... iv LIST OF TABLES................................................................................................. vi ABSTRACT..........................................................................................................vii CHAPTER 1: Introduction..................................................................................... 1 CHAPTER 2: Development of novel biotechnologies......................................33 CHAPTER 3: Ex vivo silencing of Shh/Ptc1 gene expressions in chicken skin explants and generation of feather-bud-specific poly(A+ ) RNA libraries from Shh/Ptc1 -responding and -knockout embryonic feather cells................................................................84 CHAPTER 4: Identification and confirmation of differentially expressed genes between Shh/Ptc1 -responding and -knockout poly(A+ ) RNA libraries using gene-array hybridization and Northern blot analysis............................................................................... 105 CHAPTER 5: Functional modeling Shh/Ptc1-directed primary downstream genes and screening of Shh/Ptc1 responsive element(s) in its promoter region.....................................................................121 CHAPTER 6: Conclusion..................................................................................138 REFERENCES...................................................................................................143 Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. iv UST OF FIGURES 1.1. Distribution of Sonic hedgehog (Shh) gene transcripts during embryonic feather formation. Data from Dr. Sheree A. Ting-Berreth and Dr. Cheng-Ming Chuong. published in Developmental Dynamics, 1996..........................................................................................4 1.2. Shh/Patched-1 (Ptc1) signal transduction pathway. Data modified from Drs. Ronald L. Johnson and Matthew P. Scott’s drawing published in Current Opinion in Genes & Development, 1998........... 6 1.3. Strategy for using novel genetic and molecular biology approaches in developmental biology research......................................................... 11 1.4. Schematic protocol of C-probe transfection............................................14 1.5. Successful attenuation of Shh and fi-catenin (bCat) expression in an organ culture system containing embryonic chicken skin explants....................................................................................................16 1.6. Schematic illustration depicting RNA-PCR............................................ 20 1.7. The comparison of differential gene expression patterns by microarray analyses.................................................................................22 1.8. Multiple possible interactions among Shh and Ptc1 family members.................................................................................................. 28 2.1. Comparison between C-probes (CP) and traditional hydrogen- binding probes (HP).................................................................................50 2.2. Analysis of gene knockout effects after transfection of probes into activin-induced apoptotic LNCaP cells................................................... 52 2.3. Gene knockout effects on the cell number and morphology of LNCaP cells..........................................................................................................54 2.4. Analysis of different templates for specific gene interference as follows: (1) blank control, (2) mRNA-cDNA hybrid, (3) aRNA-cDNA hybrid and (4) ds-RNA in LNCaP cells...................................................61 Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. V 2.5. Linear plot of growth rate inhibition by D-RNAi action targeted against bcl-2.............................................................................................. 63 2.6. Analysis of a potential D-RNAi-related RdRp enzyme by different a- amanitin sensitivity: (1) 1.5 mg/ml and (2) 0.5 mg/ml.......................... 65 2.7. A proposed D-RNAi mechanism..............................................................67 2.8. Schematic comparison of different mechanisms among posttranscriptional gene silencing (PTGS), RNA interference (RNAi) and D-RNAi.............................................................................................. 69 2.9. Analyses of basic RNA-PCR features.....................................................74 2.10. RNA-PCR using cells micro-dissected from specific regions of pathological sections................................................................................ 76 2.11. Northern blot analyses of gene expression changes...........................78 3.1. Morphological changes of embryonic feather growth after gene attenuation................................................................................................96 3.2. RNA-PCR-amplified mRNA libraries from single skin feather buds......................................................................................................... 98 3.3. Molecular evidence of specific gene knockout in skin feather buds........................................................................................................ 100 4.1. Northern blot analysis of Shh/Ptc1-directed primary downstream genes...................................................................................................... 116 5.1. Functional scheme of identified Shh/Ptc1 downstream genes during embryonic feather morphogenesis....................................................... 129 5.2. Bio-informatic analysis of homologous domains in the Shh/Ptc1 responsive promoters of the identified primary downstream genes...................................................................................................... 131 Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. 4.1. 4.2. UST OF TABLES Gene list of our home-made gene-array............................................. Differential expression levels of all tested genes before and after gene knockout....................................................................................... Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. vii ABSTRACT The Sonic hedgehog/Patched-1 signal transduction pathway is involved in the organogenesis of many tissues, such as the limb, eye, wing, central nerve system and skin appendages. To decipher the downstream control of Shh/Ptc1 signaling in a developmental biology cascade, we have developed a novel molecular and genetic strategy for the detection of Shh/Ptc 1 -directed gene expression alterations at the single cell scale. This high resolution approach was applied to a chicken skin explant culture to identify the Shh/Ptc1 downstream genes corresponding to embryonic feather morphogenesis. The strategy contains three major steps: gene attenuation, differential gene detection and bio-informatic analysis. In principal, the Shh/Ptc1 signaling was attenuated to a certain level, suppressing the activation of downstream genes in the absence of compensatory mechanisms. Single-feather-bud mRNA libraries were then prepared to profile the resulting changes in gene expression. Based on bio-informatic analysis of the altered gene interactions, a functional model of embryonic feather morphogenesis can be built. Using our newly invented C-probe gene knockout, RNA-polymerase cycling reaction and chicken-specific gene-array technologies, a forty-eight gene array was tested to determine the molecular response to Shh/Ptc1 signaling during embryonic chicken feather morphogenesis. Seven out of the forty-eight Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. viii genes were found to be directly downstream to the ShhlPtcl signaling pathway, including Gli1, Tgf-02, Msx2, Tbx4, Lmx1, Smad3 and Smad7. Northern blot analysis confirmed that their expression alterations were biostatistically significant. Many tested genes displayed partial relationships with either Shh or Ptc1, indicating complex cross-talk between members of the Hedgehog/ Patched signaling pathway and molecules participating in other signaling pathways. Computer analysis of homologous domains shared by Gli1, Tgf-f$2 and Msx2 promoters revealed a 37 base-paired consensus sequence. Its homology to known Gli binding sites within human and mouse Shh responsive promoters produced a potential evidence for the synergistic regulation of Shh/Ptc7-directed downstream gene expressions. Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. 1 CHAPTER 1: INTRODUCTION SUMMARY To assess the function of the Sonic hedgehog (Shh)/Patched-1 (Ptc1) pathway in developmental organogenesis, I devised new techniques to suppress the expression of specific genes and to amplify a representative cDNA library from limited cell populations within complex tissues to examine the effects of gene suppression on downstream gene expression. I then examined the promoter regions of the downstream genes to identify a consensus sequence for their coordinated expression. This study was performed using a chicken embryo skin morphogenesis model, focusing on skin from embryonic day E6 to E9 (corresponding to Hamburger-Hamilton stage 26 to 38). Since this pathway is important for the morphogenesis of many organ systems, the findings will have broad ranging applications to the developmental biology community. 1.1 The Shh/Ptc1 Signaling Pathway Organ development requires signal transduction to regulate transcriptional control, which in turn, controls the coordination of cell proliferation, differentiation, migration and programmed cell death Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. 2 (apoptosis) leading to normal morphogenesis. The Hedgehog (Hh)/ Patched (Ptc) signaling pathway has been found to control many organ forming events by inducing specific cell fates or regulating cell growth. For my dissertation research, I studied the involvement of this pathway in feather formation using a chicken skin appendage model system. The expression of Shh determines cell fate during certain stages of feather formation and morphogenesis. As shown in Fig. 1.1 from Ting-Berreth et.al. published in Developmental Dynamics, Shh signaling promotes the proliferation of placode cells in early feather buds of an E7 (stage 30) chicken embryo, yet is associated with apoptotic recession in the barb marginal plates on the feather filament of an E12 (stage 37) chicken embryo (Ting-Berreth, 1996). Similar regulatory mechanisms repeatedly occur during the formation of many other organs and regulatory anomalies are cited as possible causes o f developmental cephalo-defects (Chiang, 1996) and cancers, such as basal cell carcinoma (Johnson, 1996; Oro, 1997; Xie, 1998) and medulloblastoma (Xie, 1997). Although it is unclear how Shh/Ptc signaling directs different developmental events, the identification of downstream gene expression patterns may help us to understand the regulatory mechanisms behind such alternative cell fate determination. Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. 3 Figure 1.1. Distribution of Sonic hedgehog (Shh) gene transcripts during embryonic feather formation. Data from Dr. Sheree A. Ting-Berreth and Dr. Cheng-Ming Chuong. published in Developmental Dynamics, 1996. Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. 4 Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. 5 Figure 1.2. Shh/Patched-1 {Ptc1) signal transduction pathway. Data modified from Drs. Ronald L. Johnson and Matthew P. Scott’s drawing published in Current Opinion in Genes & Development, 1998. Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. 6 j - i W s ? i m Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. C u r r e n t O p in io n i n G en et ic s 4 De v e lop me n t 7 Shh-dependent transcriptional regulation is essential for the development of diverse tissues during embryogenesis (Widelitz, 1999; Chuong, 2000). The expression of Shh responds to upstream signals and then executes downstream gene expression leading to subsequent developmental events. The expressed Shh protein can act over either long or short distances to transduce specific patterning effects. In Drosophila, Hh appears to act directly to specify different cell fates by regulating the gene expression of signaling proteins such as members of the Writ and TGF-P families (Johnson, 1998), and indirectly to establish polarity by inducing secondary signals (Yang, 1997). Similar findings were also discovered during chicken feather formation. In principle as shown in Fig. 1.2 modified from Johnson’s drawing in Current Opinion in Genes & Development, Ptc, an antagonist of this pathway binds to smoothened (Smo), an agonist of the pathway. The binding of Shh to its antagonistic receptor, Ptc, releases Smo so it can then activate glioblastoma (Gli)- associated transcriptional regulation. Because of pre-existing transcriptional coactivators or other regulatory mechanisms possibly involving cholesterol (Porter, 1996), proteolysis (Aza-Blanc, 1997) or the cytoskeleton (Robbins, 1997), the resulting gene expression patterns at different developmental stages have different effects on cell fate determination with profound effects on Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. 8 subsequent organ morphogenesis. It is, however, difficult to detect upstream signaling since these signals have dispersed by the time we observe the developmental response. By analyzing the expression patterns of downstream genes, we can begin to understand the mechanism of how Shh/Ptc signaling mediates organ formation. In this study, the identification of Shh/Ptc 1 -directed downstream gene control was determined in an embryonic feather formation model was performed. The mechanisms underlying feather formation most certainly will be important for the formation of other organ systems. 1.2 Genetic and Molecular Biological Approaches 1.2.1 Strategy of experimental approaches Profiling gene expression patterns in a specific tissue type is the most difficult bottleneck for developmental biology research. The global interactions among diverse tissues can often disguise the real downstream events of a morphogen signal. To circumvent this problem, we focused our research on a skin explant model. This model provides a convenient and focal examination of feather placode development in the absence of systemic effects caused by genetic interference or compensation from surrounding heterogeneous tissues, which might Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. 9 arise in an in vivo study and should produce a more faithful representation of morphogenesis in the skin (Ting-Berreth, 1996). Traditional developmental biology research mainly relies on observations of phenotypic changes. Interpretations of these observations may become confused when molecular genetic evidence is missing. Unfortunately, there is a technical gap for using current molecular biology methods in developmental biology research. Minimally, a thousand to five million cells is required for traditional gene transcript preparations, whereas most developmental biology samples offer only a few homogeneous cells. To overcome this problem, a high resolution approach is needed to provide new genetic and functional information to the existing database. The strategy we proposed contains three major steps: gene attenuation, differential gene detection and bio-informatic analysis as shown in Fig. 1.3. In principal, the gene signaling of interest is reduced to a minimum, at which its downstream genes are mostly inactivated and no compensation effect occurs. Cell-type-specific poly(A)+ RNA libraries are then amplified from the samples before and after gene attenuation, and used for gene-array hybridization to distinguish the changes of downstream gene expressions. Functional modeling of the tested Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. 10 Figure 1.3. Strategy for using a novel genetic and molecular biology approach in developmental biology research. Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. 11 GENE DISTURBANCE: \f. C-probe antisense attenuation 2. D-RNAi posttranscriptional gene silencing Downstream gene expression alterations; > 50~30% specific gene knockout effects with less compensation from lateral signaling. DIFFERENTIAL GENE DETECTION: X f. RNA-polymerase cycling reaction X l . Gene-array hybridization analysis Quantitation of differential expression rates; down- by Shh KO and up-regulated by Ptc1 KO analyzed with in-situ and Northern hybridization. O BIO-INFORMATIC ANALYSIS: X f. Functional modeling X f. Promoter alignment Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. 12 signaling pathway is finally established based on bio-informatic analysis of the downstream gene interactions. 1.2.2 Antisense gene knockout technology The attenuation of Shh/Ptc1 signaling was achieved by an antisense gene knockout methodology. Gene knockout facilitates the determination of a gene function in living cells. Because traditional antisense probes were nuclease sensitive and mediated through hydrogen-bond affinity, exceedingly high concentrations were usually required to obtain sufficient biological effects. To increase the specificity and efficiency of targeting, a modified oligonucleotide probe with a covalent binding capability, termed C-probe, was devised to enhance intracellular gene silencing (Fig. 1.4A). The principle of C-probe technology relies on the inhibitory force of covalent bonding between the C-probe and its targeted gene transcripts, blocking protein synthesis of the targeted gene. Specificity of gene knockout is ensured because the C-5/C-6 carboxyl-groups o f C-probe modified pyrimidines form amide-linkages with the C-6/C-2 carboxyl-groups of natural RNA purines after first forming normal hydrogen bonds (Fig. 1.4B). Thus, only highly matched homologues can form hybrid duplexes resulting in a temporary (2~3 days) but effective blockage of mRNA translation produced by the permanent Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. 13 Figure 1.4. Schematic protocol of C-probe transfection. (A) Specific gene knockout with C-probe, illustrating single-stranding, covalent modification, liposomal transfection and covalent targeting of mRNA by the antisense probe. The covalent modification (B) generates carboxyl groups on the C- 5/C-6 of modified pyrimidines, which can form covalent bonds with the amino-groups on the C-6/C-2 residues of natural purines, respectively. Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. 14 A Intracellular mRNAs Antlaenae Ollgoucleolhlae O ■ O I: CHEMICAL MODIFICATION a Covalently Modified Liposomes Antisense Probes > . # . A A U U U A L . 1 O 2: UPOSOMAL TRANSFECTION O mRNA: C-probe Interaction in Cytoplasms O 3: COVALENT INTERFERENCE Covalent bond formation between mRNA & C-probe 0 4: TRANSLATION INHIBITION (No Protein Synthesis) B Uracil(U)/Thymine(T) o m fA :* + K M "° 4 0^ J h 0 -Nucleotide A - Modified U/T “ T ° + Adenine Modified U/T-Adenine o o S -S - nh. -Nucleotide A - -Nucleotide A - J O >90% -Nucleotide B~ Cytosine(C) tjH2 r t -Nucleotide A - ♦ KMn04 Modified C H2tf ^ c - c - o - ‘f >o- -Nucleotide A - ♦ Guanine t> . Modified C-Guanine <5% “ K * 1 « J . » -Nucleotide A - -Nucleotide B - * Nucleotide A * C-probe; Nucleotide B 3 mRNA Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. 15 Figure 1.5. Successful attenuation of Shh and fi-catenin (bCaf) expression in a embryonic chicken skin explant organ culture system. C-probe knocked out about 73% of Shh and 68% of bCat gene transcript activity within 48 hours. The sense controls for both genes showed minor influence on the transcription rate, indicating that these knockout effects are gene-specific and fundamentally rely on base pairing between the C-probe and the coding mRNA . Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. 17 hybridization of the target mRNA to the C-probe (Ying, 1999). This method is more fully described in Chapter 2. The ability of C-probe to knockout gene expression in a skin explant culture was tested by targeting Shh and fi-catenin (bCat) signaling. Skin explant replicate samples were treated under identical conditions and produced similar results, demonstrating the reproducibility of the C-probe knockout effect. Comparisons of differentially expressed genes between Shh-responding and -knockout skin explants from E7-8 chicken embryos could provide pivotal clues to disclose how transcriptional control regulates embryonic feather formation. To this aim, it has been observed that the use of either Shh- or bCat-antisense C-probes is sufficient to interfere with normal feather growth in the skin explants of E6.5~7 chicken embryos. As Southern blot data shown in Fig. 1.5 demonstrates, the knockout of Shh blocked 71 ±3% of gene transcription activity within 48 hours, while that of bCat provided 68±5% knockout efficiency. The sense controls for both genes showed minor influence on the gene expression rate, indicating that these knockout effects are gene-specific and fundamentally depend on the orientation of the C-probe. 1.2.3 Generation of feather-bud-specific poly(A*) RNA libraries Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. 18 To precisely investigate Shh/Pfc f-directed downstream gene interactions within chicken E8 feather buds (stage 32~33), we developed the RNA-polymerase cycling reaction (RNA-PCR), which is able to amplify intracellular mRNA libraries from a few cells. It is very difficult to perform genetic profiling for limited tissue samples using traditional methods. Traditional methods using reverse transcription-polymerase chain reaction (RT-PCR) require large numbers of cells (103 to 106 ), which are not homogeneous enough for genetic analysis due to rapid mRNA degradation and tissue complexity. The data from bulk heterogeneous samples is usually inconsistent and non-reproducible. The discreet, localized expression of critical genes in a small group of cells will be masked by pooling these cells with surrounding tissues. With the high resolution capacity of RNA-PCR, we have successfully generated full- length mRNA libraries from single feather buds with or without either Shh or Ptc1 knockout for further genetic research. By cycling steps of reverse and in-vitro transcription (Fig. 1.6), the RNA-PCR-derived nucleotide sequences are formed by unique RNA polymerization (a transcription-based reaction). The advantages are: First, single copy RNAs can be increased up to 2000 fold/cycle without mis reading mistakes; Second, transcriptional amplification is linear and does not result in preferential amplification o f abundant RNA species; And Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. 19 Figure 1.6. Schematic illustration depicting RNA-PCR. The RNA-PCR is based on: a) reverse transcription of mRNAs with poly(dT)-primers, b) poly(dC)-tailing of the first-strand cDNAs, c) denaturation and then double- stranding of the DNA templates with oligo(dG)-T7-promoter primers, d) in- vitro transcription from the promoter region to generate multiple RNA copies, and e) repeating steps a)-d) without b) to achieve the desired amount of poly(A)+ RNA for genetic analysis. The pre-cycling procedure comprises steps 1) through 4) to form promoter-linked double-stranded cDNAs, while the cycling procedure consists of steps 5) and 6) to generate mRNAs from the above cDNAs. By repeating another round of amplification, the amplified mRNA products can be used as templates following the same cycling steps to generate more amplified mRNAs and so on. Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. m essenger RNAs pol\(dG)-tailed first-strand cDNAs GGGG double-stranded T7-CCCC cDNAs — GGGG amplified mRNAs (CCCC i A A A A (1) Prevention of Degradation poly(dT) primer (2) Reverse Transcription dGTP (3) Terminal 'IVaasferasc Tailing r lAAAA ■ TTTT CCCC-T7 (4) Denaturation and Double-Stranded cDN A Synthesis ■AAAA iTTTT r T7 RNA polymerase (5) Transcription lAAAA) 2o oo x (6) Repeating steps (2), (4) & (5) w o 21 Figure 1.7. The comparison of differential gene expression patterns by microarray analyses (B). Among RNA-PCR-derived poly(A)+ RNAs from twenty cells, aRNAs amplified by Eberwine's method from twenty cells, and traditional phenol-chloroform extracted total RNAs from one million cells, the results showed a highly compatible population in the abundant (red) and moderate (blue) mRNA species of the extracted and the RNA-PCR- derived RNAs (left) but not the aRNAs (right). The rare (yellow) mRNA populations were, however, markedly different among all three groups, showing a better preservation of rare species in the RNA-PCR-derived RNAs than in either the extracted RNAs or aRNAs. The gray shadow area indicated a low reading zone of signal detection. The 45° diagonal green lines indicate one (near the center) to eight (near the lateral edges) fold changes of expression. (C) A list of distinct features between RNA-PCR and aRNA amplification methods, which may contribute to the different results of microarray analyses. Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. 22 Functional Activin Expression 4 4 ^MA^^ is 5 is a g n i» i^ iy m l ^p) "j— /yyy pcDNAJ pcl>NA3 aRNA ampHlkatian'dcrhrcd RNAs ' - a R N A nmoMc a t f on - - ( r andom r awr ad. pr i mar a) -(randomrevereeprir^ -I - (onty-fotapncflfcoafiaa) Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. 23 third, a limited RNA sample can be preserved using fixed cells as starting material. The identification of useful rare mRNA markers for cancer staging has been reported (Lin, 1999). The detailed methodology is described in Chapter 2. This method is capable of generating a cell-type-specific poly(A)* RNA library of up to 5 kilobases (kb) in length which contains 90% of the original mRNA population. High G-C content RNA species, however, tend to become shorter than their original size. Because the strict proof-reading feature of RNA polymerases, linear amplification is a natural property of transcription-based amplification methods (Van Gelder, 1990; Eberwine, 1992). Linear amplification maintains the accurate ratio of each expressed gene transcript in a library and hence can reflect the original RNA composition. To this end, the RNA-PCR-derived RNA library was experimentally tested by high-density microarray hybridizations as shown in Fig. 1.7B. When applied to affymetrix U95A ver2 genechip analysis (N = 3), both phenol-chloroform-extracted and RNA-PCR-amplified RNA libraries displayed about 4,200 expressed genes on a 12,558 gene chip (33.5±0.3% and 33.2±0.4%, respectively), showing very similar sized RNA populations. The amplified libraries from about twenty LNCaP cells Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. 24 resembled the extracted total RNAs from one million cells. Among all expressed genes, seventeen were completely missing in one of the libraries, indicating a 0.4% loss of representation. Less than 3% of the expressed genes (102 genes) showed more than a three-fold change when comparing the results from these two methods. According to scatter plot analysis (Fig. 1.7B, left), a linear correlation was identified. Although they were not perfectly matched with each other, the above results demonstrated more compatibility than those from a comparison between the extracted RNAs and aRNA libraries prepared by Eberwine's method from twenty LNCaP cells (Fig. 1.7B, right). The aRNA amplification method is widely used to prepare labeled probes for current microarray hybridization. However, due to the utilization of random primers for cycling amplification, the aRNA libraries (N = 3) displayed a less abundant population containing an average of 2243 expressed genes (~17.8%). Taken together, we have overcome the old barrier of developmental biology research using RNA-PCR for genetic analysis at the single-cell scale. These amplified mRNA libraries were found to possess high fidelity, purity, specificity and reproducibility for both Northern blot and microarray analyses. Following the high demand of precise diagnosis in cancer and high-resolution detection for biological development, RNA-PCR Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. 25 is expected to shed light on the molecular regulation of stage-specific gene expression patterning in certain cell populations of interest. 1.2.4 Gene-array analysis Based on the experiences of using RNA-PCR-derived libraries in microarray analysis, we developed a new gene-array technology to identify Shh/Ptc1-downstream genes. Because all commercial microarrays are designed for human/mice research and may not be compatible with chicken genes, our gene-array was prepared using chicken genes and some well-matched gene homologues from mice. All tested genes were suspected to be involved in feather morphogenesis. For accurate measurements of gene-array results, the signal intensity of glyceraldehyde-3-phosphate dehydrogenase (GAPDH), a house-keeping gene, was used to normalize the arrays. The positive genes responding to both Shh and P trf signaling pathways were further tested by Northern blot analysis, showing correct sized genes. These data confirmed the primary downstream genes of the Shh/Ptc1 signaling pathway. 1.2.5 Functional modeling As shown in Fig. 1.8, the response of a primary downstream gene should be down-regulated by Shh knockout and up-regulated by Ptc1 Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. 26 knockout. However, other H/7-like ligands or Ptc receptors share homology with Shh and Ptc1, complicating the analyses. The antagonistic function between Shh and Ptc1 actually serves as a convenient system for our investigation strategy to surmount this complication. Genes responding to suppression of Shh but not P trf or vice versa are not primary candidates to the Shh/Ptrf signaling pathway. To select the primary downstream genes from the above gene-array data, a tested gene had to show more than a 15% change of its mean expression rate after both Shh- and P trf- knockout, respectively. The 15% differential rate was considered significant because it is equivalent to an average 50% change in Northern blot analysis. We preferred not to silence a genes expression completely in order to prevent lethal side-effects to the antisense-treated tissues. The antisense knockout of Shh produced an average 71% attenuation rate as shown in Fig. 1.5B (N = 3), while antisense P trf produced 51% suppression. By increasing or decreasing expression of the Shh/Ptrf pathway by approximately 50% and comparing the expression of downstream genes, we can characterize the role of this pathway in gene regulation and identify the primary downstream genes. Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. 27 Figure 1.8. Multiple possible interactions among Shh and Ptc1 family members. The interaction may also occur between either Shh or Ptc1 and competing Hh or Ptc signaling pathway(s) or other morphogens. Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. 28 Shh/Ptc-1 Related Signaling Pathways: Shh (ligand) other other ligand(s) r receptor(s) I Rc-1 (receptor) I / \ A / \ \ / Shh/Ptc-? Shh/Rc-? Shh/Ptc-1 Shh/Ptc-1 ?/Rc-1 Signaling Signaling Signaling Signaling Signaling ♦ I I * w / transcriptional control by Gli genes downstream to Shh only I \ \ direct downstream genes of Shh/Ptc-1 genes downstream to Shh only R esponse to Shh o r Ptc-1 Knockout: direct downstream genes of Shh/Rc-1 down-reguiated by Shh KO, and up- genes downstream to Ptc-1 only genes downstream to Rc-1 only ♦ ♦ down-regulated by Shh KO, but no down-regulated by Rc-1 KO, but no response to Rc-1 KO. regulated by Ptc-1 KO. response to Shh KO. Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. 29 According to the reported functions of the above primary downstream genes, an interactive model can be proposed for the mechanism of embryonic feather morphogenesis. Additionally, known-function secondary downstream genes may also provide useful hints for the next developmental sequence. The model is built upon current evidence as well as previous findings, and offers us more solid long-term goals for the future work in this field. It has been technically difficult to judge which primary downstream genes are specific to a signaling pathway during biological development since multiple pathways are concurrently active. The strategy employed here, can successfully determine the role of specific pathways in a developmental event. In conjunction with time-course in-situ hybridization and/or immuno- staining data, the genetic evidence provided by our strategy may reveal the molecular details of a developmental stage ex vivo and potentially in vivo. By bridging the gap between biological phenomena and molecular interactions, we have a better understanding of how nature controls the processes underlying organogenesis. Moreover, a similar mechanism could be recapitulated in many organ formation processes. Using the same approach, comparisons between different organotypic mechanisms and/or formation of the same tissue in different species can be easily achieved to characterize the diversity of transcriptional control in a variety of Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. 30 biological contexts. Data from these experiments will be very useful for possible gene therapy and for ex vivo organogenesis in the future. 1.3 Strengths and Weaknesses of the Approaches Although we have tried to establish a consistent and easily accessible experimental condition using a skin explant culture system, the gene expression pattern was found to be slightly different from the in vivo condition. Six out of forty-eight tested genes were mis-expressed in the skin explants. For example, Fgf8 and Frizzie5 were highly expressed in the feather bud region of a skin explant but not in skin in vivo. On the other hand, Fgf4, Smad5, Wnt8c and Wnt14 were detected by in-situ hybridization in the embryonic feather buds but were almost gone in the explant. Therefore, our results must exclude these mis-expressed genes, which may play a role in the Shh/Ptrf downstream pathway. For in-vivo gene analysis, we have continued to develop more advanced technologies, such as D-RNAi transfection, which is suitable for long-term gene silencing (up to 21 days). A method to apply these new techniques to embryos is currently under investigation. The short-term gene attenuation effects of the present C-probe methodology are actually an advantage for detecting alterations of specific Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. 31 downstream genes. Gene expression patterning is highly synergistic and carefully regulated. The complete silencing of a functional gene will induce expression compensation from other gene pathways. The silencing of a crucial gene in a transgenic animal usually results in organ failure and/or embryonic death. Since we need to maintain certain attenuated levels of normal gene expression for cell survival and to reduce compensation effects from other genes, the swift effectiveness of C-probe transfection in suppressing genes by approximately 50% seems ideally suited for our downstream gene determination strategy. In most of the cases, gene attenuation caused temporary developmental retardation but not death. Furthermore, the application of C-probe offers the most flexibility in choosing the best developmental moment for gene suppression and subsequent downstream gene detection. C-probe transfection took 12 hours and most of the early downstream genes were affected around 14~18 hours after gene silencing. Gene attenuation was gradually released after 48 hours, due to the accumulation of new transcripts. Given the short half-life of Shh and P trf proteins, we found that a prime time to examine downstream gene alterations was about 28 hours after treatment. The quality and quantity of our RNA-PCR-derived single-cell libraries has proven to be sufficient and reliable for advanced microarray analysis over 12,558 distinct genes. However, specific genechips for research in Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. 32 chicken are not yet available. The preparation and quality control of our home-made 48-gene array is very tedious. With current resources, we have achieved consistent and reproducible results using at least seven different gene-arrays for each tested sample. The development of a commercially available chicken microarray would facilitate future research in this area. Due to the limited number of genes spotted on an array, many other important genes were omitted in our study. To this end, we hope that the progress of modern microarray technology will quickly reach our field as well. The identification of primary downstream genes will provide crucial answers for the mechanism(s) of Shh/Ptrf -dependent cell fate determination and morphological patterning. After the differentially expressed regulatory genes are identified, their profound interacting functions will become the next important issue toward understanding this biological mechanism. We may consider the differentially expressed genes as molecular markers to assess developmental progression. Expression patterning along with developmental progression and morphological changes may serve as a biological model for testing novel interactions of gene functions in tissues. Since the isolated genes may participate in various functions, the design of a uniform in vivo assay system will be a major challenge in this field. Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. 33 CHAPTER 2: DEVELOPMENT OF NOVEL BIOTECHNOLOGIES SUMMARY We introduce three novel biotechnologies, which were invented in collaboration with Dr. Shao-Yao Ying in the Department of Cell & Neurobiology, University of Southern California. Two gene knockout strategies and one single-cell mRNA library preparation method were developed using a cancer cell system to fulfill the need for detection of Shh/Ptc1 -directed downstream gene expression in our chicken skin culture system. In comparison to the complexity of an organ/tissue culture, the cancer cell line system indeed provided a convenient and assessable system for the evaluation of the feasibility of our newly invented technologies. 2.1 Introduction The ability to acquire intact gene information from a few homogeneous cells (single cells) enables the comparison of gene expression patterns between normal and modified (diseased, treated, etc.) cells at high resolution. Molecular gene analysis relies on RNA or DNA extractions from bulk heterogeneous tissues (> 5000 cells), which usually Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. confer inconsistent and confusing results due to cell heterogeneity. In this chapter I will explain in detail two methods used to suppress gene activity and a method used to generate a cDNA library from limited cell numbers. Two gene knockout and one single-cell mRNA amplification methods were tested to fulfill this goal. Covalently binding probe (C-probe) technology is a gene attenuation method suitable for one-time use and short-term (2~3 days) gene knockout, while mRNA-cDNA hybrid transfection, termed D- RNAi, can induce a stronger and relatively long-term posttranscriptional gene silencing effect up to 21 days (Lin, 1998 and 2000). For the precise measurement of a stage-specific gene expression change without compensation effects from competing signaling pathways, the C-probe method turns out to be a better choice in conjunction with another newly invented mRNA amplification method, RNA-polymerase cycling reaction (RNA-PCR). The RNA-PCR-derived single-cell libraries have proven to possess high fidelity, purity, specificity and reproducibility for both Northern blot and microarray analyses (Lin, 1999). 2.2 Materials and Methods 2.2.1 Specific gene attenuation using covalently binding probe (C-probe) 2.2.1.1 Cell culture and activin treatment Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. 35 LNCaP cells were obtained from the American Type Culture Collection (ATCC, Rockville, MD) and grown in RPMI 1640 medium supplemented with 10% fetal bovine serum with 100 pg/ml gentamycin at 37°C under an atmosphere of 10% CO2 . LNCaP cells were treated with 200 ng/ml activin per day for three days, while control cells were simply treated with medium. Five days after treatment was initiated, a 56% reduction in growth was observed in the activin-treated cells compared to the control by both microscopy and cell counting as previously reported (Lin, 1999). The two groups of cells were independently trypsinized and mRNAs were purified by poly-(dT) dextran columns (Qiagen, Santa Clarita, CA). The quality of isolated mRNAs (2 pg) was assessed on 1% formaldehyde-agarose gels. 2.2.1.2 Preparation of C-probes Following the single-strand DNA amplification method reported by Medori et.al. (Medori, 1996), 100 ng of antisense probes were used in a 100 pi polymerase chain reaction (PCR) containing 30 pmol of antisense primer, 0.3 pmol of sense primer, dNTP mixture (0.2 mM each for dATP, dCTP, dGTP, dTTP), Taq DNA polymerase (3.5 U) and 1.5 mM MgCl2- A thirty cycle PCR amplification was carried out by denaturation at 94°C, annealing at 55°C and extension at 72°C for 1 min in each step. The Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. 36 amplified antisense products (up to 30 pg) were recovered by a microcon- 50 filter (Amicon, Beverly, MA), single-stranded by adding 20 pi alkaline acetyl chloride (3 min, 94°C) and neutralized by 80 pi Tris buffer (10 mM, pH 7.4). After further purification with a microcon-50 filter in 10 ml Tris buffer, 1 pi potassium permanganate reagent (10 mM, pH 10) was added (10 min, 25°C) to generate carboxyl-groups on the C-5/C-6 of pyrimidines in the modified probes. The modified probes can form covalent bonding with amino-groups on the C-6/C-2 of purines from endogenous oligonucleotides. The C-probes were finally collected by a microcon-50 filter into pure chloroform containing 3 mM triethylamine and 3 mM ethyl chloroformate at 4°C for 20 min and recollected by another microcon-50 column in 10 pi of 20 mM Hepes buffer and prepared for liposome mediated transfection. 2.2.1.3 Nuclease resistance assay of C-probes An apoptosin fragment (300 base pairs) served as the target DNA to test the nuclease susceptibility and binding efficiency of an antisense C- probe (300 base oligonucleotide with 70% homology to the apoptosin fragment). Equal amounts of double-stranded fragments and C-probes were mixed for nuclease digestion with or without hybridization. Hybridization was performed at 94°C for 3 min and then 70°C for 16 hours Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. 37 in EEx3 buffer (30 mM EPPS, pH 8.0 at 20°C; 3 mM EDTA). Nuclease digestion was performed with a mixture of DNase I and nuclease S1 (50 U each, Roche) at 25°C for 10 min in 1 x NS1 buffer (0.2 M NaCI, 50 mM sodium acetate, pH 4.5; 1 mM ZnS04, 0.5% glycerol). The results were electrophoresesed on a 2% agarose gel as shown in Fig. 2.1 A. 2.2.1.4 Liposomal transfection Probes (1-50 |xg) were mixed with 50 ml DOTAP liposome (1 mg/ml; Roche) and applied to a 100mm culture dish (12 ml) which contained activin-treated LNCaP cells at 50% confluency. After a 24-hour incubation, the cells took up 60% of the probe-containing liposome. Uptake improved to 100% after two days of incubation. Using liposome-mediated intracellular transfection, the probes can penetrate at least twenty layers of tumor cells (Hsiao, 1997). After five days, genomic DNAs were isolated by an apoptotic DNA ladder kit (Roche) and assessed on a 2% agarose gel. The cell growth and morphology were also examined. The mRNAs from the transfected LNCaP cells were isolated by poly-(dT) dextran columns (Qiagen), fractionated on a 1% formaldehyde-agarose gel after a 24-hour incubation period, and transferred onto nylon membranes (Schleicher & Schuell). Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. 38 2.2.2 Co-suppression of gene homologues using mRNA-cDNA hybrid transfection 2.2.2.1 Primer oligonucleotides Four synthetic oligonucleotides were used in the generation of bcl-2 RNA-DNA hybrids as follows: T7-bcl2 primer (5'-dAAACGACGGC CAGTGAATTG TAATACGACT CACTATAGGC GGATGACTGA GTACCTGAAC CGGC-3') and anti-bc/2 primer (5'-dCTTCTTCAGG CCAGGGAGGC ATGG- 3') for mRNA-cDNA hybrid (D-RNAi) probe preparation: T7-anti-bc/2 primer (5'-dAAACGACGGC CAGTGAATTG TAATACGACT CACTATAGGC CTTCTTCAGG CCAGGGAGGC ATGG-3') and bcl2 primer (5'- dGGATGACTGA GTACCTGAAC CGGC-3*) for antisense RNA (aRNA)-cDNA hybrid (reverse D-RNAi) probe preparation. The design of the sequence- specific primers is based on the same principle used by PCR (50~60% G - C rich), while that of the promoter-linked primers, however, requires a higher G -C content (60-65%) working at the same annealing temperature as above sequence-specific primers due to their unmatched promoter regions. For example, new annealing temperature for the sequence- matched region of a promoter-linked primer is equal to [2°C x (dA + dT) + 3°C x (dC + dG)] x 5/6, not including the promoter region. All primers need Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. 39 to be purified by polyacrylamide gel electrophoresis (PAGE) before use in an RNA-PCR reaction. 2.2.2.2 Cell culture and treatments LNCaP cells were obtained from the American Type Culture Collection (ATCC, Rockville, MD) and grown in RPMI 1640 medium supplemented with 10% fetal bovine serum with 100 mg/ml gentamycin at 37°C under 10% C 02. Androgen withdrawal and resupplement were carried out as previously described (Berchem, 1995) with minor modification. These cultured cells were treated with one dose of 20 nM 5a- androstan-17|3-ol-3-one to induce bcl-2 expression. For liposomal transfection of anti-bcl-2 probes, the probes (5 nM) in DOTAP liposome (Roche Biochemicals) were applied to a 60 mm culture dish which contained LNCaP cells at 15% confluency. After an 18-hour incubation, the cells took up about 60% of the probe-containing liposome. Uptake improved to 100% after 36 hours of incubation. The addition of a-amanitin was completed at the same time as the liposomal transfection. The apoptotic effect of phorbol-12-myristate-13-acetate (10 nM) was initiated at 12 hours after liposomal transfection. The mRNAs from the transfected LNCaP cells were isolated by poly-(dT) dextran columns (Qiagen, Santa Clarita, CA), fractionated on a 1% formaldehyde-agarose gel after a 36- Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. 40 hour incubation period, and transferred onto nylon membranes. After 48- hour transfection, genomic DNAs were isolated by an apoptotic DNA ladder kit (Roche Biochemicals) and assessed on a 2% agarose gel. The cell growth and morphology were also examined by both microscopy and cell counting as previously reported (Lin, 2001). 2.2.2.3 D-RNAi probe preparations For generation of RNA-DNA hybrid probes, an RNA-PCR procedure was modified to produce either mRNA-cDNA or cDNA-aRNA hybrids (Lin, 2000). Total RNAs (0.2 pg) from androgen-withdrawal LNCaP cells were applied to a reaction (40 pi in total) on ice, comprising 4 pi of 10x RT&T buffer (400 mM Tris-HCI, pH 8.3 at 25°C, 400 mM NaCI, 80 mM MgCfe, 2 M betaine, 100 mM DTT and 20 mM spermidine), 1 pM sequence-specific primer for reverse transcription, 1 pM promoter-linked primer for cDNA double-stranding, 2 mM rNTPs, 2 mM dNTPs and RNase inhibitors (10 U). After C. therm./Pwo DNA polymerase mixture (6 U each) was added, the reaction was incubated at 52°C for 3 min, 65°C for 30 min, 94°C for 3 min, 52°C for 3 min and then 68^0 for 3 min. This formed promoter-linked double-stranded cDNA for next in-vitro transcription reaction which was performed by adding T7 RNA polymerase (160 U) and C. therm, polymerase (6 U) into the above reaction. After two hour incubation at Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. 41 37°C, the resulting mRNA transcript was continuously reverse-transcribed to mRNA-cDNA hybrid at 52°C for 3 min and then 65°C for 30 min. The generation of cDNA-aRNA hybrid followed the same procedure except using 1 pM sequence-specific primer for cONA-doublestranding and 1 pM promoter-linked primer for reverse transcription. The RNA-PCR procedure can be reiterated to produce enough RNA-DNA hybrid for gene silencing analysis. For the preparation of double-stranded RNA probes, complementary RNA products were transcribed from both orientations of the above promoter-linked double-stranded cDNAs and mixed together without reiterating reverse transcription activity. The quality of amplified probes were assessed on a 1% formaldehyde-agarose gel. 2.2.2.4 Liposomal transfection See 2.2.1.4. 2.2.3 RNA-polymerase cycling reaction (RNA-PCR) 2.2.3.1 Primer oligonucleotides Primers for RNA-PCR were as follows: a poly(dT)2 4 primer (synthetic dephosphorylated 5’-dT I1TTT T T 1 1 TTTTTTTTTT TTTT-3’ in 100 pmol/pL stock) and another oligo(dG)1 0 CC-T7 promoter primer (synthetic Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. 42 dephosphorylated 5’-dCCAGTGAATT GTAATACGAC TCACTATAGG GAAGioCC-3’ in 100 pmol/piL stock). The poly(dT) 24 primer was used to reverse-transcribe mRNA into first-strand cDNA by MMLV reverse transcriptase, while the oligo(dG)1 0 CC-T7 primer functioned as a forward- primer for the extension of second-strand cDNA from the tailed 3’-end of the first-strand cDNA. The use of MMLV reverse transcriptase usually generates 2~3 dG protruding termini out of the 3’-end of the first-strand cDNA. An RNA promoter was therefore incorporated. All oligonucleotides were synthetic and purified by high-performance liquid chromatography. 2.2.3.2 In situ hybridization and cell preparations. Fresh formaldehyde-prefixed paraffin-embedded sections were dewaxed, dehydrated and refixed by 4% PFA, and then permeabilized by proteinase K (10 pg/ml, Roche) after rinsing with 1x PBS. In-situ hybridization was achieved by a denatured hybridization mixture within a 200 |liI coverslip chamber, containing 40% formamide, 5x SSC, 1x Denhard's reagent, 50 mg/ml salmon testis DNA, 100 mg/ml tRNA, 120 pmol/ml poly(dT)2 4 primer, 10 pmol/ml biotin-labeled activin anti-sense probe (about 700 bases in size) and tissues. After ten hours incubation at 65°C, sections were washed once with 5x SSC at 25°C for 1 hr and once with 0.5x SSC, 20% formamide at 60°C for 30 min to remove unbound Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. 43 probes. A pre-heating step (68°C, 3 min) immersing the sections in a mild denaturing solution (25 mM Tris-HCI (pH 7.0), 1 mM EDTA, 20% formamide, 5% DMSO and 2 mM ascorbic acid) was performed to minimize secondary structures (including cross-links) and to reduce the background. After the temperature was lowered to 45°C, 2,5-diaziridinyl- 1,4-benzoquinone (200 pM, Sigma Chemical) was added to each incubation for a further 30 min. Finally, 0.1x SSC, 20% formamide was applied at 60°C for 30 min to clean sections for chromogenic detection with straptavidin-alkaline phosphatase and Fast Red staining (Roche). Positive and negative results were observed and recorded under a microscope. RNase-free enzymes and DEPC-treated materials were required throughout the procedure. Prostate cancer cells (20-150 cells) from in situ sections of patients’ tissues were isolated by a micromanipulator and directly used in RNA- PCR, while cultured LNCaP cells were preserved in 500 pi of ice-cold 10% formaldehyde in suspension buffer (0.15 M NaCI, pH 7.0, 1 mM EDTA) for the following fixation and permeabilization procedure (2). After one hour incubation with occasional agitation, fixed LNCaP cells were collected with a microcon-50 filter (Amicon, Beverly, MA) and washed by 350 pi of ice-cold PBS with vigorous pipetting. The collection and wash were repeated at least once. The fixed cells were then permeabilized in 500 pi of 0.5% NP40 Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. 44 for one hour with frequent agitation. 0.5% NP40 is able to perforate the cell membrane rather than nuclear membrane, while 2% NP40 will dissolve both membrane structures. After that, three collections and washes were given to cells as before but using 350 pi of ice-cold PBS containing 0.1 M glycine instead. The cells were finally mixed with 0.1 pM poly(dT) 24 primer and resuspended in the same buffer with vigorous pipetting to evenly distribute them into small aliquots (about 20 cells in 10 pi) for RNA-PCR. They could be stored at -80°C for up to two weeks. 2.2.3.3 RNA-PCR. This method is modified from a published RNA-PCR protocol by Lin et.al. (Lin, 1999). About 50~200 fixed cells were preheated at 70°C for 5 min and applied to a reverse transcription (RT) reaction (40 pi), comprising 8 pi of 5x RT&T buffer (300 mM Tris-HCI, pH 8.3 at 25°C, 150 mM KCI, 40 mM MgCI2 , 50 mM dithiothreitol, 2M betaine), 1 pM Poly(dT) 24 primer, dNTPs (1 mM each fordATP, dGTP, dCTP and dTTP) and RNase inhibitors (10 U). After MMLV reverse transcriptase (6 U, Roche) was added, the reaction was incubated at 37°C for 50 min and shifted to 42°C for another 10 min. The resulting cDNAs were collected by a microcon-50 filter, washed once with 1x ddH2 0 and suspended in a tailing reaction (50 pi), comprising 10 pi of 5x tailing buffer (250 mM KCI, 100 mM Tris-HCI, 4 mM CoCI2 , 10 mM MgCI2, Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. 45 pH 8.3 at 20°C) and 0.5 mM dGTP. After terminal transferase (75 U, Roche) was added, the reaction was incubated at 37°C for 20 min with occasionally mix the reaction every 5 min for better tailing coverage. The tailing reaction was stopped by denaturation at 94°C for 3 min and instantly mixed with 1 pM oligo(dG)1 0 CC-T7 primer. After a brief centrifugation, Taq/Pwo DNA polymerase mix (3 U each, Roche) and dNTPs (1 mM each) were added to synthesize promoter-linked double stranded cDNAs at 52°C for 3 min and then 68°C for 7 min. The cells were broken by adding one volume of 2% non-ionic detergent (octylphenoxy)polyethanol for 10 min, and then the cDNA was washed and recollected by a microcon-50 filter in autoclaved ddH2 0 . This completed the pre-cycling steps for the following transcriptional cycling amplification. A transcription reaction (40 pi) was prepared, containing 8 pi of 5x RT&T buffer, rNTPs (1 mM each for ATP, GTP, CTP and UTP), RNA inhibitors (10 U), T7 RNA polymerase (200 U, Roche) and the above cDNAs. After two hours incubation at 37°C, the transcripts were isolated by a microcon-50 filter in 20 pi of DEPC-treated autoclaved ddH2 0 and used directly for the next round of RNA-PCR without the tailing reaction. The quality of RNA products (2 pg) after three rounds of amplification was assessed on a 1% formaldehyde-agarose gel, ranging from 300 bases to above 5 kilobases. Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. 46 2.2.3.4 Northern blot analysis mRNAs (2 |ig) were fractionated on 1% formaldehyde-agarose gels and transferred onto nylon membranes (Schleicher & Schuell, Keene, NH). Probes were labeled with the Prime-lt II kit (Stratagene, La Jolla, CA) by random primer extension in the presence of [3 zP]-dATP (> 3000 Ci/mM, Amersham International, Arlington Heights, IL), and purified with Micro Bio- Spin-6 chromatography columns (Bio-Rad, Hercules, CA). Hybridization was carried out in a mixture of 50% freshly deionized formamide (pH 7.0), 5x Denhardt’s solution, 0.5% SDS, 4x SSPE and 250 pg/ml denatured salmon sperm DNA (18 hr, 42°C). Membranes were sequentially washed twice in 2x SSC, 0.1% SDS (15 min, 25°C), and once each in 0.2x SSC, 0.1% SDS (15 min, 25°C); and 0.2x SSC, 0.1% SDS (30 min, 65°C) before autoradiography. All procedure required proper shielding all the time. 2.3 Results 2.3.1 Specific gene attenuation after C-probe transfection 2.3.1.1 Binding specificity and nuclease resistance of apoptosin C- probes in vitro Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. 47 Although some chemotherapeutic agents can cross-link nucleotide sequences in cells (Tan, 1984; Falletta, 1990), nonspecific crosslinking causes significant toxicity to normal cells (Hartley, 1991). To increase binding specificity without significant cytotoxicity, the carbon 5-6 double bond found in pyrimidines was opened using potassium permanganate followed by oxidation to carboxylic acid (Rubin, 1980). The addition of activating agents such as ethyl chloroformate (Boissonnas, 1951) can further activate these carboxyl groups to form an amide-linkage with the amino groups of purines. Such a covalent bonding reaction generates low levels of carbon dioxide and alcohol which are normally metabolized by cells. Since the covalent bond still maintains the original base pairing specificity, only highly matched homologues can form hybrid duplexes. The affinity of a C-probe to its homologous gene sequence is greatly enhanced by this covalent interaction. As shown in Fig. 2.1 A, the apoptosin C-probes provide 100% binding efficiency (lane e) compared to 53% in traditional probes (lane d). Also, the inability of C-probes to bind to other C- probe molecules is rendered by acetylation (Jering, 1974), resulting in high binding efficiency between the C-probe and its target sequences. Moreover, because of their structural modification, they are highly resistant to nuclease digestion (lane b), even after binding with the targeted sequences (lane e). Such selective covalent bonding fully inhibits the Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. 48 functional activity of the targeted gene. Since covalently bound hybrid duplexes cannot be separated in cells, any enzymatic activity requiring single-stranded nucleotide templates will be effectively shut down. It has been shown that even a polymerase chain reaction (PCR) cannot be performed through the covalently bound hybrid duplexes (Fig. 2.1C). 2.3.1.2 In-cell targeting of antisense C-probes to apoptosin mRNAs To compare the efficiency of binding, mRNAs extracted from labeled control and C-probe transfected LNCaP cells were fractionated by electrophoresis. The autoradiogram (Fig. 2.1 B) shows that the C-probes achieved 100% targeting while the traditional hydrogen-binding probes reached only 43% binding efficiency, based on the strength of radioactive emission. Agarose gel electrophoresis of RT-PCR products amplified from the above hybrids indicates that such covalent bonding completely inhibited polymerase extension activity on the targeted gene transcripts whereas the traditional hydrogen-binding did not. We have observed that the C-probes were effectively activated in transfected cells up to three days without significant degradation or inactivation. The duration of the knockout effects depends on the expression rate of individual genes in cells. 2.3.1.3 Phenotypic changes produced by apoptosin gene attenuation by C-probe transfection Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. 49 Figure 2.1. Comparison between C-probes (CP) and traditional hydrogen- binding probes (HP). (A) In-vitro analysis of binding efficiency and nuclease resistance by gel electrophoresis of digestions, a, double stranded (ds) targeted apoptosin DNA fragments (200 ng); b, single stranded (ss) antisense CP (100 ng); c, hybridization of the targeted DNAs and HP after nuclease digestion; d, same as lane c but without digestion; e, hybridization of CP to the targeted DNAs (100 ng each) after nuclease digestion. (B) Intracellular binding efficiency between apoptosin mRNAs and the two different kinds of antisense probes labeled with 3 3 P. (C) Agarose gel electrophoresis o f RT-PCR products amplified from above the probe-bound apoptosin mRNAs. Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. 50 A Covalent modification: T DNase digestion: — + + — + Hybridization: — ■- + + + a b c d e B HP CP HP CP I.O k b Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. Figure 2.2. Analysis o f gene knockout effects after transfection of probes into activin-induced apoptotic LNCaP cells. LNCaP genomic DNAs were shown: a, without activin treatment; b, with activin treatment; c, with activin treatment and transfection by anti-apoptosin C-probes; d, with activin treatment and transfection by non-modified anti-apoptosin probes; and e, with activin treatment and transfection by sense-apoptosin C-probes. A better rescue effect results from applying antisense C-probes rather than traditional antisense probes, while the sense probes show no effect on preventing activin-induced apoptosis in LNCaP cells. Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. 52 Activin: C-Probes: Traditioal probes: I.Okb 653bp 5 1 2 b p - 394bpJ 21Obp— Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. 53 Figure 2.3. Gene knockout effects on the cell number and morphology of LNCaP cells. Lane a, LNCaP cells without treatment. Lanes b to d activin- treated cells after different transfections, including liposome only (lane b), anti-apoptosin C-probe (lane c) and sense-apoptosin C-probe (lane d). Lane e, the cells counted after transfections of lane a to d demonstrates a 73% rescue effect of anti-apoptosin transfection in the activin-induced cell growth inhibition. The black bar indicates the mean of individual cell numbers counted in each treatment and the gray bar is the variation of each mean (N = 7). Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. 54 S .E h m iS E a Z 5 Treatments Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. 55 We then tested the ability of suppressing apoptosin with anti- apoptosin C-probes to rescue apoptosis using the activin-induced apoptosis model. The results indicated that the antisense apoptosin C- probes protected activin-treated LNCaP cells from apoptotic DNA fragmentation more efficiently than traditional antisense probes, whereas the sense C-probe of apoptosin had no effect (Fig. 2.2). The proliferation rate and morphology of activin-treated LNCaP cells were also changed after the C-probe knockout of apoptosin transcripts (Fig. 2.3). There was a 73% rescue of cell growth after transfecting anti-apoptosin C-probes into activin-treated cells (Fig. 2.3e). The transfection of either sense-apoptosin C-probes or only liposome carriers had no effect on cell apoptosis and morphology after activin treatments, indicating that the knockout results are highly gene-specific. The function o f apoptosin therefore seems related to both cell cycle arrest and apoptosis. 2.3.2 Co-suppression of gene homologues by RNA-DNA hybrid transfection 2.3.2.1 Effects of D-RNAi on specific gene silencing in LNCaP cells To the best of our knowledge, this observation is the first time that D- RNAi was detected in human prostate cancer LNCaP cells, suggesting an effect o f PTGS/RNAi in mammalian cells. RNAi experiments did not show Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. 56 a significant gene silencing in mammalian cells when double-stranded RNA (ds-RNA) was transfected. However, when mRNA-cDNA hybrids were used, significant long-term (> 6 days) PTGS/RNAi-like gene silencing was detected in the tested cells 36 hours after a single transfection, while no or lesser effects were observed in other parallel approaches. As shown in Fig. 2.4, the transfection of bcl-2 mRNA-cDNA hybrids (5 nM) into LNCaP cells was sufficient to silence bcl-2 expression and cause apoptosis as determined by chromatin condensation and genomic DNA laddering fragmentation. However, no specific silencing of bcl-2 expression was observed when double-stranded DNA, ds-RNA or aRNA- cDNA hybrid was transfected. These findings indicate that a mRNA template and/or a RdRp-like enzyme is required for triggering the onset of a D-RNAi mechanism. Previously, the treatment of dehydrotestosterone was shown to inhibit the apoptotic stimuli of phorbol ester and the addition of at least 40 mM antisense DNA probes abolished the inhibition of apoptosis (Reed, 1990; Berchem, 1995). Each transfection of the antisense DNA probes provided an effect of either fast (within 24-hour incubation) or relatively short-term (2~3 days) gene knockout, therefore, the relatively long-term initiation and maintenance of D-RNAi could not be explained by antisense Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. 57 DNA probes themselves. Moreover, the concentration of mRNA-cDNA hybrids required for significant gene-silencing was about a half million fold less than those of antisense DNAs. Thus, the effectiveness of D-RNAi as reported here is not necessarily a result of the cDNA part of the mRNA- cDNA hybrid. 2.3.2.2 Different mechanisms among PTGS, RNAi and D-RNAi We have detected a potential RdRp-dependent mechanism of D- RNAi, which may possess the ability to initiate and maintain, but not to spread, the effects of PTGS/RNAi. As shown in Fig. 2.5, it required at least two to three transfections to produce complete apoptosis in LNCaP cells because the liposomal transfection method we used showed only a 30-40% efficiency (Hsiao, 1997). The observation also indicates that there is no or less spreading effect caused by D-RNAi. Three major mechanical effects for PTGS are initiation, spreading and maintenance, which are also found in numerous inheritable RNAi phenomena (Grant, 1999). Like PTGS, the initiation of D-RNAi takes a relatively long period of time (2-3 days) for specific gene silencing. Other traditional antisense transfection methods, only take hours to reach the same level of gene knockout, but much higher doses are required, frequently resulting in higher cytotoxicity. Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. 58 Furthermore, unlike the effectiveness of the short-term traditional antisense transfections, the effects of PTGS/RNAi may spread from a transfected cell to its neighboring cells and can be maintained for a long period of time (weeks to lifetime) in the transfected cell and daughter cells. Indeed, the self amplification and regulation of PTGS/RNAi/D-RNAi make these specific gene interference phenomena unique to all previous gene silencing mechanisms. Conceivably, these systems seem to be involved in an intracellular defense system for eliminating unwelcome foreign RNAs and transgenes, particularly viral infections and retrotransposon activities (Baulcombe, 2000). This type of defense system in human, however, has been overlooked, probably due to the fact that our current knowledge of the immune system is far more advanced and well-developed. 2.3.2.3 Identification of a potential RdRp-like enzyme for D-RNAi in LNCaP cells We speculate that one of the cellular RNA polymerases plays the role of RdRp in maintaining gene silencing effects. As shown in Fig. 2.6, the addition of a low-dose of a-amanitin (1.5 (xg/ml), an RNA polymerase II- specific inhibitor derived from the Amanita phalloides mushroom toxin, abrogated the apoptosis induced by bcl-2 D-RNAi. Moreover, a-amanitin concentrations up to 3.5 pg/ml caused partial transcriptional inhibition Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. 59 without significant apoptosis induction in the dehydrotestosterone- treated LNCaP cells. A remarkable inhibition of D-RNAi on bcl-2 has been detected although the a-amanitin concentration we tested suppressed only 50% of the transcription activity. These findings suggest that the potential RdRp enzyme for D-RNAi in LNCaP cells is highly a-amanitin-sensitive. 2.3.2.4 Potential D-RNAi mechanism Homologous recombination between intracellular mRNA and the RNA components of a D-RNAi construct is required for specific gene silencing. We found that the [P3 2 ]-labeled DNA component of a D-RNAi construct was intact in a hybrid duplex during the effective period of a D- RNAi phenomenon, while the labeled RNA part was replaced by cold homologues and degraded into small ribonucleotides within a three-day incubation period (Fig. 2.7A). Presently, there is no evidence indicating that these small RNAs can contribute to the gene silencing effect. It is most likely that the D-RNAi construct can facilitate the degradation of non recombinant parts of its mRNA homologues as shown in Fig. 2.7B. By eliminating the integrity of the mRNA homologues, cosuppression by D- RNAi can be useful for silencing specific gene expression. Therefore, the mechanical differences among PTGS, RNAi and D-RNAi may be as illustrated in Fig. 2.8. Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. Figure 2.4. Analysis of different templates for specific gene interference as follows: (1) blank control, (2) mRNA-cDNA hybrid, (3) aRNA-cDNA hybrid and (4) ds-RNA in LNCaP cells. (A) The changes of cell proliferation rate and morphology. Chromosomal DNAs were stained by hematoxylin. Although the ds-RNA transfection also showed minor morphological changes, a significant inhibition of cell growth and chromatin condensation only occurred in the mRNA-cDNA transfection (N = 4). (B) Genomic laddering patterns demonstrated the apoptosis induction of the bcl-2 mRNA-cDNA transfection. (C) Northern blots showed a strong gene silencing effect of the mRNA-cDNA transfection in bcl-2 expression. Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. 61 ^ 1) Blank Control 2) mRNA-cDNA KO 3) aRNA-cDNA KO 4 ) ds-RNA Transfection b-A ctin Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. 62 Figure 2.5. Linear plot of growth rate inhibition by D-RNAi action targeted against bcl-2. The black arrow indicates the time at which the tested probes were first added, while the dotted arrow indicates the time when the second mRNA-cDNA probes were added for double D-RNAi transfection analysis. The proliferation rate of blank control (a), aRNA-cDNA (c) and ds- RNA (d) transfected cells was not affected, whereas the growth of mRNA- cDNA (b and e) transfected cells was remarkably inhibited after 36-hour incubation (N = 4). Because one transfection is not sufficient to reach the entire cell population, a more complete inhibition of cell growth was achieved after double transfections (e), indicating no spreading effect of D- RNAi. Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. xt £ 0) o 4000 3500 3000 2500 2000 1500 1000 500 0 1 Incubation Time (Day) Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. 64 Figure 2.6. Analysis of a potential D-RNAi-related RdRp enzyme by different a-amanitin sensitivity: (1) 1.5 mg/ml and (2) 0.5 mg/ml. (A) The changes of cell proliferation rate and morphology after addition of a- amanitin. A significant reduction of D-RNAi-induced apoptosis was detected at 1.5 but not 0.5 mg/ml a-amanitin addition after mRNA-cDNA transfection (N = 3), showing a dose-dependent release of cell growth inhibition. (B) Genomic laddering patterns demonstrated that apoptotic induction by bcl-2 mRNA-cDNA transfection was blocked by the 1.5 mg/ml a-amanitin addition. (C) Northern blots also showed that the bcl-2 silencing effect of D-RNAi had been prevented as well. Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. 65 A 1) mRNA-cDNA KO 2) mRNA-cDNA KO w /1 .5 u g /m l a-Am anitin w /0 .5 u g /m l a-Am anitin B 12 C 1 2 GAPDH Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. 66 Figure 2.7. A proposed D-RNAi mechanism (A) based on homologous degradation through a novel recombinatory cross-binding phenomenon between the RNA portion of a D-RNAi molecule and its targeted mRNA (B). Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. B D-RNAi f-- m e s s e n g e r R N A s *radioative labeling Degradation " v / s * __ Replacement Homolog Recombination A Cleavage Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. Figure 2.8. Schematic comparison of the different mechanisms among posttranscriptional gene silencing (PTGS), double-stranded RNA interference (RNAi) and D-RNAi. Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. Reproduced w ith permission o f th e copyright owner. Further reproduction prohibited without permission. PTGS stRNA precursor ALG-1 ALG-2 StRNA RDE-? I Repression of mRNA translation RNAi D-RNAi double-stranded RNA mRNA-cDNA hybrid DE-4 siRNA RDE-1} Degradation of mRNA ion RNase- 1 Degradation of mRNA 70 2.3.3 Analysis of RNA-PCR-derived mRNA libraries 2.3.3.1 Product comparison among chemical extraction, chromato graphy and RNA-PCR Poly(A+ ) RNAs generated by RNA-PCR from 20 cells were compared with those by either phenol/chloroform extraction (TRIzol reagent, GIBCO/BRL) or oligo(dT) column chromatography (Qiagen) from 105 cells (Fig. 2.9A). In general, good total cellular mRNA integrity should appear as a smear between approximate 300 bases and 5 kb on an electrophoresis gel with a median size of around 2~3 kb (Sambrook, 1989). It is noteworthy that the full-length conformation at this range actually covers more than 90% of total mRNA in cells. Based on our electrophoresis data, the quality of an RNA-PCR-derived mRNA library has reached the same quality as a smear between 300 bp and 7.4 kb without ribosomal RNA and genomic DNA contamination on a 1% formaldehyde-agarose gel. Northern blot analysis of rare gene transcripts, such as p16, usually not shown in phenol-chloroform extracted RNAs, was clearly detected in an RNA-PCR- derived library, while the signal of GAPDH (a highly abundant house keeping gene) is observed in all tested libraries, indicating a better preservation of rare mRNA species by RNA-PCR amplification. Moreover, RB (4.9 kb), p-actin (2.2 kb), GAPDH (1.7 kb) and p21 (900 bp) gene Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. 71 transcripts were all measured in their correct full-length sizes (Fig. 2.9B), confirming a potential full-length conformation of up to at least 5 kb. 2.3.3.2 High yield of amplified mRNAs by RNA-PCR High yield and linear amplification of transcription-based reactions have been well documented (Van Gelder, 1990; Eberwine, 1992; Lin 1999). Even after a ten-fold dilution of current enzymatic activities, a more than twenty-fold increase of specific mRNA sequences was measured in each cycle of transcriptional amplification (Fig. 2.9C). Such high yield amplification has been proven to be a linear amplification process as shown in Fig. 2.9D. According to the high efficiency of transcriptional amplification (up to 2000-fold/cycle), three rounds of RNA-PCR are theoretically equivalent to thirty-three cycles of PCR amplification (2- fold/cycle). Theoretically, we can amplify a single copy of mRNA more than one billion-fold. However, the high amplification rate also causes quick consumption of starting materials and accumulation of reaction products, resulting in lower efficiency for multiple cycles. Another issue to improve is the prevention of hydrolysis of RNA sequences at elevated temperatures. Still, in our experience, we have acquired 30 pg o f amplified mRNAs in one 50 pi reaction after three rounds of RNA-PCR amplification from 20 cells. This represents a fifteen million-fold increase based upon a comparison Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. 72 between the amount of synthesized mRNAs and that of theoretically presumed mRNAs within a cell (0.1 pg). 2.3.3.3 In vivo analysis of cancerous gene expression in human prostatic epithelium One of the most powerful applications of this procedure is for the analyses of pathological sections. Pathological sections were stained by in situ hybridization (Fig. 2.10A) with probes to activin to identify activin positive and negative cells in vivo. Following microdissection, mRNAs were amplified from the activin-positive and activin-negative epithelial prostatic cancer cells respectively. The amplified mRNAs from malignant, intermediate and neoplastic patients of prostate cancers were generated using RNA-PCR (Fig. 2.1 OB). We further verified the results of this procedure by investigating the behavior of known genes in prostate cancers (Lin, 1999; Ying, 1999). For LNCaP cells, we observed the time- course alterations of p53 and p16 expressions after activin treatment, consistent with previous reports demonstrated by traditional chromatography methods in that both genes were slightly up-regulated (Fig. 2.11 A, left panel). For tissue sections, a similar up-regulation pattern was also seen in patients with intermediate and neoplastic prostate cancers, showing a good correlation (Fig. 2.11, middle panel). However, Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. 73 Figure 2.9. Analyses of basic RNA-PCR features. (A) Comparison between RNA libraries prepared by phenol/chloroform extraction (lane 2), oligo(dT) chromatographic column (lane 3) and RNA-PCR (lane 4) fractionated on a 1% formaldehyde-agarose gel, all ranged from 300 bases to above 7.4 kb based on RNA markers. A uniform smearing pattern of all three products indicates good RNA quality and quantity. p16, a rare and quickly degraded gene transcript can be clearly identified in the RNA- PCR -derived library but not the others, while the abundant GAPDH and P- actin transcript was detected by Northern blots in all three libraries. (B) The amplification level o f a specific gene transcript (activin) between two cycles of RNA-PCR showed a significant 10-fold increase after utilization of a 1/10-fold enzymatic activity (20 U of T7 RNA polymerase). A more than 250- fold amplification rate has been detected when 200 U of T7 RNA polymerase was applied to a RNA-PCR reaction (7). However, this high an amplification rate cannot be observed by gel electrophoresis without dilution. (C) The ratio of amplified gene products in (B) was analyzed by Northern blotting at two pre-determined concentrations (1:9) after two cycles of RNA-PCR amplification. The final ratio (1 :11) was considered to closely match the original 1 : 9 ratio, indicating that the transcriptional amplification is a fairly linear amplification procedure. Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. 74 7.4 kb 5.3 kb 2.8 kb — 1.6 kb 1.2 kb B Northern Blots of RNAPCR-derived genes: RB (4.9kb)-«- p21 (2 .3 k b )-*- g (g } '" ~ b**c' in < 2’2kb> M m -*-G A P D H (1.7kb) p l6 (rare) G APDH (abundant) RNA-PCR-derived mRNA library from 20 cells oligo(dT) column-derived mRNA library from 100,000 cells phenol-extracted total RNA library from 100,000 cells RNA markers from 1.2 to 7.4kb mRNA-cDNA mRNA D 1st cycle RT T rx R T T rx RT Cycle: 1st 2nd lx : 9x ) Transcriptional Amplification (50-250 fold/cycle) 3rd cycle lx : Ux Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. 75 Figure 2.10. RNA-PCR using cells micro-dissected from specific regions of pathological sections. (A) Identification of acf/V/n-positive (red) and activin-negative (blue) prostate cancer epithelial cells by in-situ hybridization. Dotted circles highlight the regions where cells were microscopically isolated with a micromanipulator. For clarity, the background of this section was stained by hematoxylin. This staining was not used in the sections used for cell isolation. (B) 1% denaturing agarose gel electrophoresis of RNA-PCR products from the above isolated cells. Three stages of prostate cancers were identified under a microscope and here are labeled as malignant (M), intermediate (I) and prostatic intra- epithelial neoplasia (PIN). From left to right: RNA markers (lane 1), mRNAs from activin-negative prostatic cancer cells (lane 2, 4 and 6), mRNAs from acf/wn-positive prostatic cancer cells (lane 3, 5 and 7) and negative control of RNA-PCR without cells (lane 8). Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. 76 A 1.6 kb 1.2 kb #8-432 #8-726 #8-571 P a tien t: A c tiv in : 7.4 kb 5.3 kb 2.8 kb 1 2 3 4 5 6 7 8 Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. 77 Figure 2.11. Northern blot analyses of gene expression changes. (A) Comparison between mRNAs made by oligo(dT) column chromatography and RNA-PCR. In vitro mRNAs (left panel) were generated by chromatography from 106 LNCaP cells at different times after activin treatment (after 0, 12, 24, 48, 68 and 120 hours). In vivo mRNAs were amplified by RNA-PCR from twenty isolated cancer cells with (Ac+) or without (Ac-) expression of activin. p53, fi-actin templates (Ambion, Austin, TX) and synthetic p16 were used as probes in panel A. (B) Comparison between in vitro and in vivo mRNAs made by RNA-PCR from twenty cells. The blots of in vitro mRNAs (right panel) displayed differential alterations of gene expression in LNCaP cells before and after activin treatment (120 hours), while the blots of in vivo mRNAs (middle panel) showed the actual differential expression in patients' tissue cells. Probes (about 500 to 750 bases in length) for panel B were isolated from RNA-PCR-derived cDNA libraries prepared from LNCaP cells and amplified by PCR with sequence- specific primers. The sequences of the probes were confirmed by automated sequencing. All detected gene transcripts matched their original mRNA sizes, indicating that they were of good integrity and most likely full-length. Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. 78 A B oUgo(dT)-coIumn chromatography In-vitro h m U fc . b b b ° 2 S ? 3 S RNA-PCR In-vivo _M_ _ I PIN • +• + • + u u g g u w < < < < < < In-vitro T T A S 2 2 B i S < p53(l.9kb) — p l6 (0.8 kb) **— beta-actin (2.1 kb) *•— apoptosin (1.8 kb) apoptostatin (1.3 kb) — p21 (1J kb) Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. 79 the expression of p53 was identical in activin positive and negative cells derived from the malignant cancer patient, suggesting a possible loss of apoptotic regulation. This presumption is likely related to another observation that the more progressive cancer, the less acf/V/n-positive cells were detected by in situ hybridization. 2.3.3.4 Comparison of data consistency between in vitro and in vivo analysis mRNAs generated from prostate cancer sections were further compared with RNA-PCR-derived mRNAs prepared from LNCaP cells (Fig. 2.11B). Both data showed consistent levels of p53 at the neoplastic stage, apoptosin at the malignant and intermediate stages, and p16 and apoptostatin at all three stages. However, some inconsistencies was also observed; the expression of p21 was weak in vivo but clearly expressed in vitro. This may result from individual and stage-related variations, demonstrating the need to maintain caution in extrapolating cell culture data to tissue sections. According to the comparisons of in vivo and in vitro results (Fig. 2.11 A, right & left panels), the RNA-PCR-derived mRNA libraries provide a high resolution profiling for gene expression. A good correlation was well maintained in the comparisons of both methods and results. The Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. 80 expression of p53 and p16 from one million LNCaP cells by chromatography resemble those from twenty LNCaP cells generated by RNA-PCR. Since the RNA-PCR-derived mRNAs from single cells have achieved the same quality, quantity and specificity (up to 5 kb) as traditional RNA preparations, the sample mRNA libraries for a variety of genetic research can be generated and re-amplified by this method without the deviations from cell culture or tissue heterogeneity. 2.4 Discussion The evaluation of the three newly developed biotechnologies showed a very promising potential to fit our needs. The experiences learned from these cancer research experiments will be very useful for developmental biology studies as well. 2.4.1 Combination of gene knockout and RNA-PCR Gene function can be tested in a specific tissue, organ or embryo by perturbation methods. When coupled with in-situ hybridization and/or immunostaining, this approach serves as a gold standard for molecular modeling of a developmental event. The major barrier for this approach is its lack of a quantification to determine its significance. Invention of the RNA-PCR method enables us to overcome the barrier by providing genetic Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. 81 signals for quantitative measurement. It is promising that we have successfully detected picograms of mRNA in both cancer cell lines and in- vivo systems. The data from these preliminary tests convinces us of the feasibility of using the combination of gene disturbance and RNA-PCR in a developmental biology system. In our favorite chicken skin explant model, we now can influence a specific gene expression pattern and then use the new approach to identify the resulting downstream gene alterations as well as their functions in feather morphogenesis. 2.4.2 Temporary gene attenuation versus long-term gene silencing From a developmental biologist’s perspective, it is necessary to perturb gene function and assay the effects at specific developmental stages. In our preliminary experiments, we set up three time points for the detection of gene expression alterations after knockout. Based on the calculated time required for antisense penetration and gene interference, a minimal period of 28 hours is needed to see genetic responses of all tested morphogens in our model. Morphological changes of Shh and (3- catenin knockout samples began at 48 hours and reached maximal effects by 120 hours. Morphogenesis is caused by upstream protein function, which are in turn the downstream results of gene expression. It is understandable that a genetic effect must occur prior to a phenotypic Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. 82 change. Therefore, we used mRNA libraries amplified from 28 hour samples for genetic research and recorded the morphological changes at 120 hours. To precisely predict the appropriate time for sample collection, C- probe transfection turned out to be the best choice. The swift gene attenuation effect provided by C-probes not only paused the progress of developmental events, but minimized global compensation from competing signaling pathways. Although we also developed the D-RNAi method to handle a long-term gene silencing effect, the result is usually too strong to maintain direct downstream gene expression without compensation interference. Lag times preceding the effect of D-RNAi, its tendency toward complete gene knockout and its irreversibility make it less useful for developmental biology research. Therefore, based on our tests, the C-probe method showed more advantages than D-RNAi transfection for genetic research purposes. D-RNAi may hold the edge for therapeutic applications. 2.4.3 Benefit to biological research in all fields Limitations of resolution plague all genetic research. To prevent the heterogeneity of biological tissue samples, gene information from single cells must be acquired. Our studies indicate that RNA-PCR is the only Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. 83 method which can amplify a full-length poly(A+ ) RNA library over a billion fold and still maintain about 90% linearity with the endogenous mRNA. Currently, a more detailed investigation is performed using advanced microarray analysis which is a collaborative work with Dr. Timothy Triche at the Department of Pathology, University of Southern California. The power of high resolution gives us a chance to evaluate single-cell gene expression patterns under a variety of conditions. These conditions include normal, diseased, drug-treated, gene perturbation, developmental stage, and so on. The applications are truly unlimited. Additionally, the ability to compare two different mRNA libraries has permitted inquiries into the role of differentially expressed genes involving the mechanisms of neoplastic transformation, developmental regulation, therapeutic effect, pathological disorder, and cell-physiological phenomena. Understanding the alterations of gene expression between normal and disordered cells is especially important for gene therapy, eugenic improvement, pharmaceutical design and etiological investigations. Many applications and technological combinations can be facilitated by applying RNA-PCR and C-probe for a new level of molecular analyses. Now with this new, easy and reliable procedure, the scientific community and we can re-evaluate molecular gene profiles at the single cell levels without confusing artifacts produced in cell culture systems. Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. 84 CHAPTER 3: E X VIVO SILENCING OF SHH/PTC1 GENE EXPRESSION IN CHICKEN SKIN EXPLANTS AND GENERATION OF FEATHER-BUD-SPECIFIC POLY(A+ ) RNA LIBRARIES FROM SHH/PTCf-RESPO NDING AND -KNO C KO UT FEATHER CELLS SUMMARY In this chapter, we used C-probe and RNA-PCR, described in the last chapter to investigate phenotypic changes and downstream gene regulation in a chicken skin model. Using RNA-PCR in the skin explant culture system, we successfully generated both mRNA and cDNA libraries from a single feather bud. The libraries were tested to be highly pure, specific and reproducible for gene-array and Northern blot analyses. 3.1 Introduction Many previous gene perturbation experiments in feather morphogenesis failed to provide consistent phenomena due to the complexity of interacting signaling pathways in vivo. It is more feasible to test one gene pathway at a time. However, transgenic chicken technology is currently not available. Based on previous in-situ hybridization and immunohistochemistry data, some of the most significant genes will be analyzed using the C-probe antisense gene knockout assay. To Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. 85 investigate gene function in early feather morphogenesis, we partially silenced the gene and examined the phenotypic changes that ensued. In this chapter I will describe our experience with C-probe gene attenuation technology to identify the role of Shh and Ptc1 signaling in chicken E7~8 feather development. This section uses a similar strategy as described in Chapter 1. C-probe was used to suppress either Shh or its antagonist, Ptc1, and the effect on downstream gene expression was assessed using libraries derived using RNA-PCR. Shh expression begins at about the time that feathers evaginate from the two-dimensional skin surface. Ptc1 expression inhibits this effect. Such morphological change involves complicated cell proliferation, differentiation and apoptosis within a very limited area (a few hundred cells). To achieve accurate comparisons between differently treated cells in the same stage and area, we applied antisense C-probe knockout to a skin culture system, in which the stage and condition can be consistently maintained. This gene suppression model offers much less variation than in vivo tests. After microscopic isolation of Shh-responding and Shh- suppressed cells, respectively, single-feather-bud mRNA libraries were generated for differential gene identification before and after gene knockout. The differential genes between the Shh-responding and Shh- suppressed mRNA libraries acutely represent the downstream genes of Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. 86 Shh signaling. The same strategy was also applied using Ptc1 suppression to create the opposite effects as Shh suppression, mimicking Shh activation. Control and Ptc suppressed libraries were made by RNA- PCR and their differential gene expression also reflected genes induced by Shh/Ptc signaling. 3.2 Materials and Methods 3.2.1 Disturbance of normal Shh/Ptc1 expressions in embryonic skin explants 3.2.1.1 Embryos White leghorn fertilized chicken eggs were purchased from SPAFAS (Preston, CT). Embryos were incubated at 37.5°C and were staged according to Hamburger and Hamilton, 1951. 3.2.1.2 Skin explant cultures The methods for skin explant culture are described in Jiang etal., 1999. Briefly, dorsal skins from stage 28 (E6) chicken embryos were peeled using watchmaker’s forceps in Hank’s buffered saline solution (HBSS). The skin explants were then transferred to culture inserts in 6-well culture dishes and incubated in Dulbecco’s modified Eagle’s medium Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. 87 (DMEM) containing 10% fetal calf serum. C-probe-treated skin explants were cultured in DMEM containing 10% fetal calf serum and 20 nM C-probe oligonucleotides directed against the gene of interest. 3.2.1.3 Antisense knockout assay Gene-specific C-probes were made using the protocol of 2.2.1.2. About 4 pg C-probes were mixed with DOTAP cationic liposome reagent (Roche) in a 2 : 3 (v/v) fashion. Transfections were carried out with liposome-mediated intracellular transport of the C- probe into tested chicken skin explants in a 60 mm dish (2 ml). Gene knockout results were confirmed by Northern blots (N = 3) at about 28 hours after transfection, while phenotypic changes of gene knockout were observed at 48 and 120 hours after transfection. The related mRNA libraries at each time points were generated by RNA-polymerase cycling reaction (RNA-PCR, see 2.2.3.3). 3.2.1.4 Tissue sectioning and staining Embedding and sectioning tissue samples after whole-mount in situ hybridization were done as described in Nieto et.al., 1996. Briefly, the samples were fixed in 4% paraformaldehyde overnight at 4°C. The samples were then washed with PBS, MeOH, isopropanol and Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. 88 tetrahydronaphthalene before they were embedded in paraffin wax. The embedded samples were then cut on a microtome at 7-10 pm thickness and mounted on clean slides. The slides were then dewaxed with xylene and mounted under coverslips using mounting media (Richard Allan) and stained by hematoxylin and eosin (H & E). 3.2.1.5 Paraffin section in situ hybridization This procedure was carried out according to procedures described in Nieto et.al., 1996. Briefly, embryos were fixed in 4% paraformaldehyde, dehydrated through an ethanol series (70%, 80%, 95%, 100%), embedded in paraffin wax, sectioned at 7-10 pm thickness and then mounted on TESPA-coated slides. These paraffin sections were then dewaxed in xylene, rehydrated through an ethanol series (100%, 95%, 90%, 80%, 70%. 50%, 30%) and postfixed in 4% paraformaldehyde for 30 min. The specimens were then digested with proteinase K (10 pg/ml) for 5 min, refixed with 4% paraformaldehyde and washed in Tris/glycine buffer. The tissue sections were then hybridized overnight at 60°C in section in situ hybridization buffer (40% formamide, 5x SSC, 1x Denhard’s solution. 100 pg/ml salmon testis DNA, 100 pg/ml tRNA) containing 1 ng/pl of digoxigenin- or biotin-labeled ribonucleotide probes. After post hybridization washes once with 5x SSC at 25°C for 1 hr and once with 0.5x Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. 89 SSC, 20% formamide at 60°C for 30 min, the slides were blocked with blocking solution (1% Roche blocking reagent in 100 mM maleic acid and 150 mM NaCI, pH 7.5) and incubated with alkaline phosphatase conjugated sheep anti-digoxigenin or straptavidin Fab fragment antibody (Roche). The bound antibody was detected with the BM purple substrate or Fast Red staining (Roche) respectively. Positive and negative results were observed and recorded under a 400x microscope. RNase-free enzymes and DEPC-treated materials were required throughout the procedure. 3.2.2 Preparation of single-feather-bud mRNA libraries using RNA-PCR 3.2.2.1 Single-feather-bud isolation and fixation Single feather bud containing 200~500 cells was dissected from the margin of a cultured skin in DMEM buffer under a differential microscope. Isolated cells from three feather buds of the same skin were preserved in 500 pi of ice-cold 10% formaldehyde in suspension buffer (0.15 M NaCI pH 7.0, 1 mM EDTA) for one hour with occasional agitation, collected with a microcon-50 filter and washed by 350 pi of ice-cold PBS with vigorous pipetting. The collection and wash were repeated at least once. The fixed cells were then permeabilized and dissociated in 500 pi of 0.5% non-ionic detergent (octylphenoxy)polyethanol (Sigma) for one hour with frequent agitation. After that, three collections and washes were given to the cells Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. 90 as before but using 350 jil of ice-cold PBS containing 0.1 M glycine instead. The cells were finally mixed with 0.1 pM poly(dT)2 4 primer and resuspended in the same buffer with vigorous pipetting to evenly distribute them into small aliquots (about 50 cells in 10 pi) for frozen stock at -70°C for up to two weeks. For mRNA amplification, the cells from 4 or 5 different skins with the same treatment were mixed and used as starting materials in RNA-PCR preparations. 3.2.2.2 Generation of feather-bud-specific mRNA libraries See 2.2.3.3. 3.2.2.3 Northern blot analysis See 2.2.3.4. 3.2.2.4 Immunohistochemistry Immunohistochemistry of embryos sections was performed as described (Jiang, 1992). The paraffin sections were prepared as described in section 3.2.1.4. The paraffin sections were dewaxed in xylene and rehydrated through an ethanol series and distilled water. After circling around each tissue section with a PAP pen, the sections were incubated with Zeller’s solution (10 mM Tris, 100 mM MgCI2, 5% fetal calf serum, 1% BSA and 0.5% Tween-20, pH 7.4) for 30 min. Then the specimens were Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. 91 incubated with primary antibody (diluted in Zeller’s solution) overnight in a humidified chamber at room temperature. The sections were washed with TBST, incubated with secondary antibody for 2 hr, washed again with TBST and incubated with tertiary antibody for another 2 hr. The sections were washed with PBT and then the bound antibody was detected with the DAB substrate. Secondary antibodies used were biotinylated goat anti- rabbit or biotinylated horse anti-mouse antibodies (Vector). Streptavidin-HRP (Zymed) was added as the tertiary antibody. 3.3 Results 3.3.1 Phenotypic changes o f Shh/Ptc1 knockout in em bryonic skin explants The growth and morphology of new feather buds were observed 28- hour after antisense knockout of Shh (Fig. 3.1). As in our previous findings by in-situ hybridization (Ting-Berreth, 1996), the early Shh expression in a chicken feather bud starts at E6.5 and disappears at about E9, corresponding to the time of embryonic feather elongation. Skin explants treated with different gene-specific antisense probes showed distinguishable morphological changes for each gene knockout effect. The S/?h-knockout skins failed to elongate feather buds after the formation of Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. 92 condensed placodes, whereas the Ptc1-knockout skins seemed to increase optical thickness (possibly caused by either an accumulation of extracellular matrix or intracellular lipids) and potential keratinization. The transfection of both sense probes and liposome controls had very limited effects on growth and skin morphology, similar to the blank control. The Shh/Ptc1-antisense transfection successfully provided a convenient means of comparing differential gene expression between responding and knockout skin explants. These differential genes abundant in the Shh/Ptd- responding cells represent the downstream genes which are stimulated by Shh/Ptd signaling. 3.3.2 Generation of single-feather-bud mRNA libraries using 3.3.2.1 Quality of single-feather-bud mRNA libraries on gel Single-feather-bud RNA libraries amplified from all tested samples ranged in size from 150 bases to above 5 kb (Fig. 3.2). The uniform smearing pattern of the RNA-PCR products showed no contamination from either ribosomal RNAs or genomic DNAs, indicating that a good purity of poly(A+ ) RNA population was achieved. Based on our Northern blot results, the correct sized gene transcripts of Shh, P td , fi-catenin, Lef1 and GAPDH were detected, demonstrating potential full-length specificity for all tested genes. Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. 93 3.3.2.2 Analysis of gene attenuation effects on single-feather-bud mRNAs As shown in Fig. 3.3A, all knockout results were confirmed by Northern blot hybridization (N = 4) with RNA-PCR-derived RNA libraries from E7+1 feather bud cells, providing direct evidence for specific gene attenuation. The reduction rates of Shh, Ptc1 and fi-catenin expression were shown to be about 68±3%, 51±3% and 78±5 respectively, while that of Lef1 was increased to 340±62% due to its fast compensation from the synergistic response of other Lef/Tcf signal molecules. It has been noted that C-probe was not sufficient to silence some transcription factors, such as Lef and c-myc. On the other hand, the compensation between Ptc1 and Ptc2 is less dramatic and can be distinguished using different probes. As they share a conserved domain in the C-terminal but not N-terminal protein sequences (Pearse, 2001), we used a specific probe against the 5’-end mRNA sequence of Ptc1 to measure Ptc1 expression and then used another probe against the 3’-end mRNA of Ptc1 to observe both Ptc1 and Ptc2 expression. The detailed Ptc2 mRNA sequence is, however, unpublished. Some new findings were also detected by the Northern analysis. For example, Shh expression was attenuated to about the 50% level in the Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. 94 P-catenin knockout, while a truncated form of P-catenin was expressed after Shh was silenced. This relationship was not seen between Ptc1 and /3-catenin. It seems that there is a complicated feedback loop between P ~ catenin homologues and Shh, but not Ptc1. Based on the morphological changes in Fig. 3.1, dermal condensation formation at the initiation of feather bud morphogenesis was inhibited in the /3-catenin knockout skin explants. This effect was much less pronounced in the Shh knockout explants, indicating a potential p-catenin function at an earlier developmental stage. Moreover, a reverse negative feedback response was also found between Shh and P trf but not Ptc2; however, the level of feedback was not intensive in the placode area. In either Shh- or Ptc1- knockout samples, the up-regulation of its counterpart was limited to a maximum of 25-30% . Since our pre-determined significance level is 50%, the feedback response of Shh/Ptc1 may not be strong enough to cause any biological effect. Gene knockout effects at the protein level were demonstrated by the immunostaining results for Shh and p-catenin (Fig. 3.3B). In liposomal control samples, both Shh and P-catenin proteins were detected in the feather bud region. Shh is a secretory protein, which displayed a diffuse distribution pattern from the epidermal-dermal junction to the proximal side of the mesenchyme, especially in the posterior region. P-catenin is an Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. 95 Figure 3.1. Morphological changes of embryonic feather growth after gene attenuation. The photographs of skin explant appearances were taken 120 hours after antisense transfection. H & E staining was performed using sample sections from the above skin explants. Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. 96 Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. 97 Figure 3.2. RNA-PCR-amplified mRNA libraries from gene-attenuated skin feather buds. A uniform smear between approximately 150 bases and 5 kb on an electrophoresis gel demonstrated that a pure poly(A+ ) RNA population was attained. Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. 3.0kb — l.Okb — 578b p - 392b p - 150 bp— Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. 99 Figure 3.3. Molecular evidence of specific gene knockout in skin feather buds. (A) Northern blot analysis of the gene attenuation effect after antisense C-probe transfection showed reduced expression rates of 68±3% for Shh, 51 ±3% for Ptc1 and 78±5 for p-catenin respectively (N = 4). (B) The immunostaining results of Shh knockout [Shh(-) KO] and P-catenin knockout [b-Cat(-) KO] samples indicated that suppression also attenuated corresponding protein levels. Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. 100 m K :i “ ' t d> ' V ^ fc = S : § V ) § * T * C O I 0 > l (- ) iQ l OX (-heo-q ■ H O X (-)=>»d H I O X (-)MHS H i ouiosodn H I Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. 101 intracellular protein, displaying a stronger signal in the apical epidermis and the posterior feather mesenchyme. The knockout results of Shh and P-catenin proteins were consistent with the Northern blot data, showing significant decreased protein expression. The P-catenin antibody was able to identify its truncated form and detected a 50% reduction after Shh knockout. The protein expression pattern was more diffuse than normal due to increased cell membrane permeability from the liposome molecules (Hsiao, 1997). Detecting alterations in protein localization is currently a technical hurdle for all genetic tests using liposomal transfection. 3.4 Discussion The ability to attenuate specific genes and produce mRNA libraries from few cells is a marked improvement over existing methods used in developmental biology research. This study demonstrates that cell and developmental response can now be measured based on gene profiles rather than just morphological changes. 3.4.1 Developmental function of Shh in embryonic feather formation Shh is one an early morphogen expressed in the epithelial placodes during feather formation (Ting-Berreth, 1996). Suppressing Shh Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. 102 expression in our skin explant model inhibited feather elongation as expected. The formation of a placode condensation after Shh knockout indicates that some morphogen(s) precede Shh activity during feather induction. Although we observed that a few Shh knockout samples, silenced at the earlier E6 stage displayed sim ilar morphological changes as those produced by P-catenin suppression. In both cases, the invagination of cells into the skin surface was found. This similarity may be caused by the negative feedback interaction between newly found p-catenin homologues and Shh. Based on the phenotypic changes, we believe that the p-catenin signal is required for the outgrowth of feather buds from the skin surface, while Shh is needed to maintain this outgrowth. 3.4.2 Developmental function of Ptc1 in embryonic feather formation Because Ptc is a membrane-bound receptor abundant in the mesenchyme adjacent to sources of Hh signaling (Motoyama, 1998; Lewis 1999), the Ptc1 knockout pattern is expected to relieve its inhibitory effects and increase feather bud elongation. In fact, the feather bud morphology is fairly normal after Ptc1 knockout. We found that Ptc2 expression was increased and may have compensated for decreased Ptc1 expression levels. However, the responses of Ptc1 and Ptc2 to Shh signaling are quite different (Pearse, 2001). In Pearse’s chicken limb bud study, Ptc2 Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. 103 expression was highly stimulated by Shh-soaked beads, while a weak up- regulation of Ptc1 in distal mesenchyme was detected. The expression pattern of Ptc2 was also found to be similar to Fgf4, both of which were mediated via antagonism of BMP signaling. In contrast, the Ptc1 expression in our model was not significantly related to either Shh or noggin expression. It was shown that the Ptc2 can be induced by Shh and inhibited by BMP signaling. Therefore, the Ptc2 compensation effect is most likely one of the downstream responses to the Ptc1 knockout in our study. 3.4.3 Enhancement of developmental biology research to the single cell resolution Unlike other research fields, a developmental biologist deals with tissue, organ and even embryo samples rather than homogeneous cell lines. To understand synergistic gene regulation in vivo, many tissue/organ culture systems were prepared to mimic in-vivo conditions for more consistent and assessable experiments. The methods that we used in this chapter further add convenience, high resolution and reproducibility to the system. Because we can combine multiple sets of RNA-PCR libraries derived from the same experimental procedure to minimize potential sample and manipulation deviations, the results of this study Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. 104 were shown to be statistically significant (N = 4, P < 0.01). The morphological and molecular changes in each case were consistent and specific to the individual gene knockout effect, respectively. We believe that this developmental biology study has maintained the same research quality as our previous work in cancer. Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. 105 CHAPTER 4: IDENTIFICATION AND CONFIRMATION OF DIFFERENTIALLY EXPRESSED GENES BETWEEN SHH/PTC1- RESPONDING AND -KNOCKOUT POLY(A*) RNA LIBRARIES USING GENE-ARRAY HYBRIDIZATION AND NORTHERN BLOT ANALYSIS SUMMARY Gene array analyses were performed on the RNA-PCR derived libraries described in the previous chapter to identify Shh/Ptc1 downstream genes. The convenience of a gene-array method is its ability to screen the expression of multiple genes simultaneously. In conjunction with the use of RNA-PCR-derived mRNA libraries, we can easily acquire a systemic profile of specific gene expression patterns within a few days, instead of many months using other traditional differential display methods. The results generated by this RNA-PCR/gene-array combination were shown to be consistent, reproducible and reliable enough to represent the endogenous gene expression profiles. More novel findings were also discovered disclosing downstream interactions of proteins along the Shh/Pfc "/-related signaling pathways in embryonic feather morphogenesis. 4.1 Introduction Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. 106 Traditional observations of a developmental phenomenon relied heavily upon the results of in-situ hybridization and/or immunohisto chemistry. Although these observations successfully locate gene expression distribution in tissues, they are not quantitatively accurate and usually provide more conditional results. For example, over-staining is a common mistake. The statistical significance of a result is dependent on the intensity of a specific gene expression. Without quantitative evaluations, the significance of many observations could be over- or under estimated. To provide more accurate measurements, the RNA-PCR- derived libraries introduced in chapter 3 were applied to both gene-array and Northern blot analysis to generate measurable significance to Shh/Ptc1 downstream gene expression changes in response to the tested conditions. The trend toward using microarray to simultaneously analyze multiple gene expression patterns began in the year 2000 and has become more and more affordable recently. The beauty of this technology is its time-efficiency for high throughput gene analysis. Based on the same principle, we designed a chicken-specific gene-array to compare Shh/Ptc1 downstream gene expression changes before and after either Shh or Ptc1 knockout. The forty-eight tested genes on the gene-array were selected because they were previously shown to be important for feather Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. 107 morphogenesis. As the gene-array data tends to display less significance than a real result, all positively identified gene clones must be further confirmed by Northern blot analysis (at least four times in our experiments). A positive clone which was down-regulated by Shh knockout and up- regulated by Ptc1 knockout is really a primary downstream gene to the Shh/Ptc1 signal transduction pathway. 4.2 Materials and Methods 4.2.1 Probe labeling The amplified poly(A)+ RNA libraries in section 3.3.1.2 were labeled during the transcription step of RNA-PCR. In-vitro transcription was performed with T7 RNA polymerase (160 U) and with 0.5 pg of an RNA- PCR-derived promoter-linked cDNA library, 7.5 mM unlabeled ATP, CTP and GTP, 5 mM unlabeled UTP, and 2 mM [3 2 P]-UTP (> 3000 Ci/mM, Amersham). Reactions were carried out at 37°C for 2 hr and occasional vortexing of the reaction every 30 min for better RNA elongation. The labeled mRNA was then purified by an RNA affinity resin column (RNeasy spin columns, Qiagen). A sample of 1 pg RNA was separated on a 1% agarose gel to check the size range to verify sequence integrity, and then 10 pg of mRNA was fragmented randomly to an average size of about 150- Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. 108 200 bases by heating at 94°C for 10 min in 40 mM Tris-acetate, pH 8.0, 100 mM KOAc/30 mM MgOAc. 4.2.2 Gene-array analysis Gene-specific templates for membrane blotting were amplified by PCR from distinct plasmid vectors containing individual gene sequences of interest. The use of T3 (5’-dATTAACCCTC ACTAAAGGG-3’), T7 (5’- dGTAATACGAC TCACTATAGG-3’) and SP6 (5’-ATTTAGGTGA CACTATAGAA TA-3’) primers was dependent on the promoter regions which flank the gene insertion of a plasmid. About 10 ng of gene-specific plasmid was applied to a PCR reaction containing 30 pmol of each forward and reverse primer, dNTP mixture (0.2 mM each for dATP, dCTP, dGTP, dTTP), Taq DNA polymerase (3.5 U) and buffer. A thirty cycle PCR amplification was carried out by denaturation at 94°C for 1 min, annealing at 52°C for 1 min and extension at 72°C for 3 min. The amplified products (up to 30 pg) were recovered by a microcon-50 filter (Amicon, Beverly, MA) in 30 pi ddH2 0 , sheared by harsh pipetting for 30 sec and denatured by adding 30 pi of 0.4 N NaOH. The denatured gene-specific templates were then spotted onto a nylon membrane stabilized on a gene-array platform device (Stratagene) and cross-linked to the membrane by UV illumination at 254 nm for 30 sec. Each gene spot on the array contained 10 pg of cDNA fragments sized Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. 109 about 100 bases. The individual location for each spotted gene on the array was shown in Table 4.1. The above 48-well gene array was ready for hybridization with the labeled probes. Hybridization was carried out sim ilar to Northern blotting in QuikHyb solution (Stratagene) at 68°C for 6 hr in a slow rotation chamber. Membranes were sequentially washed twice in 2x SSC, 0.1% SDS (15 min, 25°C), and once each in 0.2x SSC, 0.1% SDS (15 min, 25°C); and 0.2x SSC, 0.1% SDS (30 min, 65°C) before autoradiography. All procedures required proper shielding. 4.2.3 Northern blot analysis See 2.2.3.4. 4.3 Results 4.3.1 Downstream gene responses to the Shh/Ptd gene attenuation As shown in Table 4.2, the red number indicated genes significantly down-regulated in response to the Shh/Ptc1 knockout effect, whereas the green number showed genes significantly up-regulated in response to the same effect. GAPDH, a house-keeping gene was used to normalize each array. An identified gene clone showing changes above 15% (P < 0.01) Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. 110 was considered to be positive. Positive clones down-regulated by Shh knockout and also up-regulated by P td knockout are theoretically directly downstream to the Shh/Ptc1 signaling pathway. Seven out of forty-eight tested genes fulfilled these criteria, including Gli1, Tgf-02, Msx2, Tbx4, Lmx1, Smad3 and Smad7. Surprisingly, BMP4 showed an opposite effect to the above response. Moreover, many tested genes responded to either Shh or Ptc1 signaling, indicating multiple parallel interactions among the two family members and other morphogens. It is strongly suspected that Shh and Ptc are not exclusively coupled to each other. Based on these findings, many competing pathways interact and may be the subject of future studies. Some genes reported for Shh/Ptc downstream in other tissue or animal systems were not directly regulated by the Shh/Ptc1 signaling during embryonic feather morphogenesis. For example, Frizzled-10, a Wnt receptor found to be induced by Shh in stage 18 chick limb bud formation (Kawakami, 2000), was found to be downstream to the P td but not Shh signaling pathway in our system. Zebrafish Wnt4b expression was reduced in Shh and G//2 mutants (Liu, 2000), while chicken Wnt4 expression was not affected by the knockout of either the Shh or P td pathway. Although most o f these previous findings were based on in-situ hybridization or immunohisto-chemistry after gene disturbance (over- Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. 111 Table 4.1. Gene list of our home-made gene-array. Each gene spot contains 10 ng of the gene fragments and matches the location of the gene on the arrays. Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. 112 Row/Column 1 2 3 4 5 6 A r-Fng TGF-P2 cHair Smad7 Fz7 sfrpl B l-Fng FGF4 Msxl Smad8 Fz9 sfrp2 C Ptcl VVnt4 Msx2 Fzl FzlO Pitxl D Shh VVnt5a Smadl Fz2 Frzbl Pitx2 E bCat Wnt3 Smad2 Fz3 Lm xl Tbx4 F Noggin VVntl4 Smad3 Fz4 FGF8 Tbx5 G BMP4 Wnl6 SmadS Fz5 S lit G lil H BMP2 Wnt8c Smad6 Fz6 Notch Gli3 Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. 113 Table 4.2. Differential expression levels of ail tested genes before and after gene knockout. Gene names were shown by their respective abbreviations, such as Shh (sonic hedgehog), Ptc (patched), bCat (fF eaten in), Nogg (noggin), Smd (smad), Fng (fringe), Fz (frizzle) and Ntch (Notch). The green number indicates a gene up-regulated by the treatment listed on the most left-hand side of the Table, while the red numbers indicates a gene down-regulated by the same condition. The gray number shows inconsistent data between in vivo and skin culture systems. The primary downstream genes of Shh/Ptc1 signaling were labeled by dotted square lines, indicating that they were down-regulated by Shh knockout and up-regulated by Ptc1 knockout. Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. 114 Chicken Skin Explant (E7+1) Shh Ptcl bCat G lil GH3 Fgf4 Pixl Pix2 Tbx4 Tbx5 In-Vivo 78.4 84.9 81.9 80.9 86.6 53.8 86.0 85.6 55.8 85.6 Lipo* 74.8 91.1 74.7 78.3 80.7 42.2 77.1 71.2 61.0 86.6 Shh- 24.1 90.5 53.2 i 62.4 • 74.4 25.0 91.2 72.7 i 37.2 i 94.2 Ptc1- 73.1 39.2 70.6 | 92.9 ! 84.8 29.8 90.7 72.6 | 88.0 | 89.5 Bcat- 58.4 84.0 25.7 67.9 65.6 27.8 43.3 55.5 74.8 75.5 Tef-b Bmp2 Bmp4 Nogg Msxl Msx2 Smdl Smd3 Smd6 Smd7 In-Vivo 76.9 84.1 86.3 84.6 25.9 595 59.4 56.2 81.4 59.0 Lipo* 84.5 75.7 82.6 91.5 35.5 65.5 71.5 69.3 76.6 59.8 Shh- ' 43.9 ' 80.5 ! 9 3 7 ! i 63.4 i 69.1 24.9 ' 3L.3 ' 58.0 J 46.7 « i 88.8 S 61.0 ' 40.8 ' Ptc1- i 90.6 i 63.3 88.9 67.5 i 81.4 i 82.0 80.3 i 86.8 i Bcat- 69.5 61.0 83.2 85.6 37.1 66.7 52. L 61.7 51.4 56.0 Wnt3 Wnt4 Wnt5a Wnt6 Wntl4 r-Fng l-Fng sFrp2 Lmxl In-Vivo 455 83.1 67.8 43.1 36.0 83.7 83.9 87.2 74.3 Lipo* 40.0 84.9 73.6 41.3 41.5 89.3 84.6 85.1 71.2 Shh- 29.2 72.8 39.9 32.8 27.5 78.2 84.8 85.6 1 42.1 1 » i i 87.5 i Ptc1- 68.2 78.1 83.9 27.1 59.0 36.2 75.4 86.8 Bcat- 305 61.8 56.9 23.6 27.2 37.6 49.7 93.5 63.6 Fzl Fz2 Fz3 Fz4 Fz7 Fz9 FzlO Frzb Ntch Slit cHair In-Vivo 68.0 76.2 71.3 75.3 27.7 30.8 45.5 33.4 885 59.1 76.4 Lipo* 70.6 82.9 61.3 80.4 28.4 42.0 34.8 39.2 76.7 52.6 71.2 Shh- 74.8 59.0 80.3 71.3 26.8 26.1 24.1 262 83.1 38.6 86.3 Ptc1- 83.5 85.3 78.2 81.7 58.9 72.1 67.0 70.8 74.7 67.7 79.4 Bcat- 83.3 54. L 61.7 22.2 23.3 36.0 34.5 42.4 69.8 305 55. L *N = 6 (liposomal control), others n = 8. **The average rate of GAPDH expression in liposomal controls = 100%. Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. 115 Figure 4.1. Northern blot analysis of Shh/Ptc1-directed primary downstream genes (N = 4). (A) The normal expression rates for GH1, Tbx4, Tgf-02, Msx2, Smad3 and Lmx1 were measured to be 80.4±2.2%, 57.7±0.3, 85.0±1.6, 69.2±6.0, 70.6±1.8 and 72.5±1.9 respectively, after normalization to GAPDH. After Shh knockout, the expression rates for the above listed genes were decreased to 46.2±1.1, 35.7±2.1, 43.0±2.6, 26.4±0.2, 43.2±3.8 and 22.6±0.8 respectively. After Ptc1 knockout, the expression rates for the above listed genes were increased to 117.5±3.9, 93.8±1.5, 114.2±9.0, 100.2±6.8, 95.6±3.8 and 112.7±10.4 respectively. All the transcriptional alterations were above the biostatistic significance level, 30% of changes. Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. 116 < N o h (-)mms o h (-)ow auiosodn C O c /) X E Q Q. < (3 «? 5 I I I I I I I I C M o e o <0 «y n C X E CO T 3 E tn C 4 X (A <S .o • > < « c iS o r iH I © Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. 117 expression and/or mis-expression in most cases), none of them actually provided a strong molecular basis to support their proposals. Our data indicates that the interactions among these downstream genes are far beyond the level, which can be seen by traditional methods. A quantitative measurement must be added to confirm the accuracy of tested molecular alterations. 4.3.2 Northern blot confirmation of the primary downstream genes to Shh/Ptc1 signaling Northern blot analysis is a direct and quantitative measurement for specific gene expression in cells. The utilization of RNA-PCR-derived poly(A+ ) RNA libraries enhances the detectable resolution of this method to the single-cell scale (about 1 picogram level). As shown in Fig. 4.1, we have confirmed the above primary downstream genes of the Shh/Ptc1 signaling pathway by Northern blot hybridization (N = 3 or 4), showing precise comparisons of gene expression alterations in feather buds. A statistical significance was found because the primary downstream genes displayed more than 50% changes after knockout (Fig. 4.1 A, P < 0.01). However, we suspect that the response of Smad7 may result from the synergistic co-induction of Tgf-02 and Smad3, rather than a direct downstream effect of Shh/Ptc1 themselves. This point is supported by the Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. 118 fact that the Smad7 promoter is known to be the first Tgf-P responsive promoter identified in vertebrates and the Tgf-02 can induce the binding of endogenous Smad3 to the Smad7 promoter (Denissova, 2000). 4.4 Discussion In light of the complexity of our findings using homogeneous feather placode cells, it is difficult to believe that the previous data generated from bulk tissue samples could be reliable. 4.4.1 Complicated interactions between Shh and P-catenin signaling pathways Suppressing Shh and p-catenin silenced many downstream genes, including Shh, p-catenin, Smad6 and Frizzle2. P-catenin downstream genes were mostly not related to Ptc1 downstream genes, except Slit. It seems that the interaction between Shh and p-catenin is not modulated through the P trf receptor. Also, the Shh knockout not only attenuated p~ catenin expression but also induced a truncated, potential p-catenin homologue. This homologue was detected by a commercial antibody and our Northern probe, indicating the 5’-end of the P-catenin transcript sequence from +131 to +973 base-pairs was present. The identity and function of this new P-catenin homologue is currently unclear. The only Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. 119 possible sequence information is that it may contain high homology to the 5’-end of P-catenin. 4.4.2 Positive regulation of Ptc1 downstream genes Ptc1 signaling can provide positive regulation to its downstream genes, such as BMP4 and r-Fringe. The antagonistic role of Ptc to the Hh signaling pathway suggested that the Ptc1 function is always inhibitory. This concept was proven to be incorrect by the above data. Although the up-regulation of BMP4 and r-Fringe may be secondary to the downstream of Ptc1 signaling, it showed that Ptc1 can stimulate another Shh inhibitor, BMP4, to suppress feather cell proliferation. In addition to the inhibitory effect of Ptc1 on smoothened (Smo), the expression of BMP4 may be another mechanism for the negative role of Ptc1 in Shh signaling. Therefore, in order to completely release the antagonism o f the Ptc1 effect, the Shh signal needs to not only release Smo signaling but also induce noggin and/or Smad6/7 expression to inhibit the BMP4 function. This point was also supported by the finding that noggin, Smad6 and Smad7 expression were all downstream to Shh signaling. 4.4.3 Consistency and inconsistency between current and previous findings Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. 120 The expression of Gli1 and Tgf-02 have been reported to be downstream of Shh signaling in a variety of developmental biology systems, including neural tube, limb bud and feather (Lee, 1997; Dahmane, 1997; Bai, 2001; Ting-Berreth, 1996). In Drosophila, Wingless, a member of the Wnt family, and Dpp, a member of the Tgf-p superfamily, were proven to be downstream to the Hh/Ptc signaling pathway (Lawrence 1996; Ingham, 1991). However, in more advanced animal systems, the findings based on Drosophila genes become partially correct. There are three Hh, two Ptc and three Gli genes in vertebrates (Ingham, 2000). A far more complicated interactive mechanism among Hh/Ptc signaling pathways can be expected. In E7+1 chicken skin explants, the expression of Gli1 and Tgf-($2 were consistent to the previous reports. Wnt5a expression was found to be regulated by only Shh signaling, while those of Wnt3 and Wnt14 were inhibited by a special Ptc1 pathway, which cannot be offset by the function of Shh. It is very difficult to explain the secondary downstream interactions, such as Wnt members in our current study. More functional assays are needed for further investigation in the future. Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. 121 CHAPTER 5: FUNCTIONAL MODELING OF THE SHH/PTC1- DIRECTED PRIMARY DOWNSTREAM GENES AND SCREENING OF POTENTIAL SHH/PTC1 RESPONSIVE ELEM ENT(S) IN ITS PROMOTER REGION SUMMARY In this chapter, the integration of our current findings and previously reported data was examined. Seeing things from different angles always provides a much clearer view than superficial observations from one perspective. We therefore combined the two kinds o f knowledge and provided a relatively complicated but very clear view of the Shh/Ptc1 signaling mechanism for embryonic feather morphogenesis. It was noted that one morphogen can directly or indirectly interact with multiple other functional proteins to set up the natural rules needed to maintain developmental normality. How nature regulates these rules is highly appreciated. 5.1 Introduction Our current data provides a detailed view of the Shh/Ptc1-directed downstream gene functions. When this information is added to previous observations using fn-situ hybridization and immunostaining a clear picture Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. 122 starts to emerge. The new modeling strategy is based on the time-course and spatial expression patterns of the above identified primary downstream genes discussed in the chapter 4. Since most of the gene functions have been well established in the previous reports, the interaction of these genes in feather morphogenesis can be predicted as an accumulative effect of all involved gene functions within an overlapping frame of time and space. The accuracy of such functional modeling will be, of course, much more reliable than a prediction based on merely observations of phenomena. For synergistic regulation of the above gene functions, a common regulatory domain in the promoters of all identified primary downstream genes is required. Because the Shh/Ptc1 signal transduction pathway functions through the activation of Gli transcription factors, the G//-binding site must be one of the common regulatory domains. The Gli family members are zinc finger-containing proteins encoded by homologues to the Drosophila segment polarity gene cubitus interruptus. Although it has been known that G//-binding sites are highly conserved, sized about 9~11 base-pairs and of high G-C content (Liu, 1998; Dai, 1999), the search for such short homologous domains in a several hundred base-pair promoter sequence is still a tedious task. Fortunately, we have found a useful sequence alignment software on the world wide web. The use of such bio- Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. 123 informatic analysis not only facilitates the identification of homologous domains among multiple associated promoters but also dramatically reduces the time and cost involved. The promoter homologues will be very useful for understanding synergistic gene control in a variety of research fields. 5.2 Materials and Methods 5.2.1 Functional modeling As previous studies of the identified primary Shh/Ptc 1 -downstream genes have provided strong clues for their interactions, a functional model can be assessed in conjunction with in-situ hybridization and/or immunostaining results to predict their functions in embryonic feather morphogenesis. For example, the Shh transcript was detected in the distal area of an E8 feather bud (stage 32-33), while Ptc1 expression was homogeneously distributed in the mesenchymal region adjacent to the source of Shh signaling (Motoyama, 1998; Lewis, 1999). The expression of Tgf-f52 mRNA and protein at the same stage was shown to be abundant within the dermal condensation, especially in the epidermal-dermal junction of a feather bud (Ting-Berreth, 1996). Meanwhile, the Msx2 transcript was detected in the anterior epithelium (Noveen, 1995), while Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. 124 Smad7 is most likely to be present in the posterior region of a feather bud. In addition to the gene expression alterations after Shh and Ptc1 knockout respectively, we now can draw an interactive network for their functional roles in embryonic feather development from skin condensation to feather bud elongation. 5.2.2 Promoter alignment Screening and identifying homologous domains in the promoter region of the identified primary downstream genes provides potential responsive element(s) for the Shh/Ptc1 signaling pathway in early feather formation. Since the Gli protein family comprises the final transcription factors directly responding to Shh/Ptc signaling, the homologous promoter domain could lead to a Gli binding site. Such promoter analysis was performed using a sequence alignment software provided by the Baylor College of Medicine HGSC available at the website address ‘‘http://dot.imgen.bcm.tmc.edu:9331/seq-search/alignment.html”. Because only three (Gli1, Tgf-02 and Msx2) out of the seven primary downstream genes contain known promoter sequences available in the Genbank database (National Institute of Health: www.ncbi.nlm.nih.gov/entrez/), we used these known promoters to search for highly homologous sequence domains for further analysis in the future. Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. 125 5.3 Results 5.3.1 Scheme of the identified primary downstream genes during embryonic feather formation Based on previous in-situ hybridization findings of S/ih-related gene expression in stage E7~8 chicken feather buds, a functional scheme was proposed to connect the current gene-array data and the previous findings. As shown in Fig. 5.1, a clear view of stage-dependent and spatial interactions among the identified Shh and Ptc1 downstream genes was demonstrated. Although many details are still unavailable in this study, the proposed mechanism has displayed many unclear gene interactions during embryonic feather morphogenesis. At the placode stage (E6-6.5), the positive feedback between early Shh signaling and p-catenin was found. In conjunction to the aforementioned morphological data shown in Fig. 3.1, the P-catenin signal seems to precede the Shh signal to set up the condensation zone for feather bud evagination and then Shh starts its cell- proliferative function promoting feather elongation out of the skin surface. Without the support of P-catenin, the orientation of spatial morphogenesis was up-side-down. The functional role of the newly identified Shh- inducible possibly truncated P-catenin homologue in this scheme is still under investigation. Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. 126 At the short feather bud stage (E7~8 embryo), Shh signaling becomes highly activated. Although three members of the Gli family, Gli1, Gli2 and G//3, are known to be the transcriptional activators of the Shh/Ptc1 signaling pathway during the organogenesis of various systems (Altaba, 2002), we currently do not have strong evidence to pinpoint which Gli is involved in the embryonic chicken feather morphogenesis. Because Gli1 has been confirmed to be directly downstream to the Shh signaling and G//3 was always abundant before and after Shh/Ptc1 knockout at this stage (Fig. 4.1), it is most likely that GU3 played a very important role for the downstream gene expression of the Shh/Ptd pathway. However, we did not rule out the potential function of G//2. Since the nucleotide sequence of G//2 is not publicly available, the identification o f the G//2 function in our system will have to wait. The activation of the S/7/7-responsive Gli transcription factor will in turn trigger the onset of primary downstream gene expression, which provides fine-tuned functions for further morphogenetic processes. When feather buds continue to grow out of the skin surface, many morphogens begin to set up anterior-posterior and proximal-distal polarity for the outline of future feather shapes. Some of the identified primary downstream genes were found to be involved in this direction. The bottom part of Fig. 5.1 outlines the distribution of Shh (red), Gli1 (green), Tgf-02 Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. 127 (dark purple), Smad7 (pale purple) and Msx2 (orange) in an E8~8.5 chicken feather bud. Basically, the expression of Shh, Gli1, Tgf-fi2 and Smad7 are in the posterior region, while that of Msx2 is in the anterior epithelium. The distribution of Shh and Tgf-02 secretory proteins could extend to a larger area than shown here. It is clear that the overlapping zone of Shh, Gli1, Tgf-fi2 and Smad7 expression orients the direction of feather bud growth. In the meantime, the Tgf-fl2 and Smad3 interaction in the posterior region of the feather bud could induce the expression of Smad7 (Denissova, 2000), an inhibitor of BMP signaling. The repression of BMP expression in this area may respond to the Shh function for asymmetric feather elongation. 5.3.2 A potential Gli-binding homologous domain in Shh/Ptc1 responsive promoters It is reasonable to believe that there is a homologous domain in the promoter region of all primary downstream genes for the synergistic regulation of Shh/Ptc1 signal-dependent transcriptional control. Such synergistic action of all primary downstream genes is very crucial for normal organogenesis. Because the Shh/Ptc1 signal transduction pathway must function through Gli activity, the G//-binding site should be present in all promoters of the identified Shh/Ptd primary downstream Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. 128 Figure 5.1. Functional scheme of identified Shh/Ptc1 downstream genes during embryonic feather morphogenesis. The solid red arrow indicates interaction proven by both gene-array and Northern blot analyses, while the dotted red arrow represents a potential mechanism proposed by gene- array data. The distributions of Shh (red), Gli1 (green), Tgf-fi2 (dark purple), Smad7 (pale purple) and Msx2 (orange) gene expression in an E8-8.5 chicken feather bud are outlined based on their previous in-situ hybridization results. A dotted green arrow shows the potential feedback maintenance of Shh signaling by Gli1, and the interaction o f Tgf-(32 and Smad3 is indicated by purple lines. Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. 129 Embryonic S tage: b-Catenin____ G li3‘ W nt4' s ,it’ cHair* Pix1&2« P lacode (E6-6.5) r Smd1&6, l&r-Fringe, Fz2&4 C o nden satio n Noggin, W nt5a Shh/Ptc1 r-Fringe BMP4 Y ' Signaling I N < J W nt3, Msx1, 1 Smd5, Fz7,9&10, Frzbl Gli3 A c t iv a t i o n ? ^ Short Bud (E7-7.5) Elongation i G lii, Msx2, Tbx4, Lmx1, y Tgf-b2, Smd3, Smd7 / ✓ Shh G IH ~ ^ ■ u. t anterior J S m t posterior Long Bud » L — A-P Polarity (E8.5-9) ------- ^ -------- I Tgf-b2 + Smd3 ♦ Smd 7 I BMP4 proposed by gene-array data. proven by Northern blots. Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. 130 Figure 5.2. Bio-informatic analysis of homologous domains in the Shh/Ptc1 responsive promoters of the identified primary downstream genes. (A) Computer alignment of the Shh/Ptc1 responsive promoters indicates a 70-80% homology domain conserved among the promoter homologues of Gli1, Tgf-02 and Msx2. It is about 161 bases up-stream to the translation start codon of Gli1, 294 bases up-stream to that of Tgf-(32 and right before that of Msx2. (B) This domain contains two high G-C sequences which share high homology to two of the published human G//- binding sites, 5’-CGCGTCCTG-3’ and 5’-TGCCTGGTC-3\ Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. Reproduced with permission o f th e copyright owner. Further reproduction prohibited without permission. A ____________________________________SUbMUtRHV SCALE N otftng detected 20?* 30% 40*% 90% 60% 70% 60% 90% 100% Identity t 0 100 200 300 400 Gli-1 5'UTR Tgf-b2 S'UIB too 200 400 600 700 •0 0 900 Tgf-b2 S 'U TI H O Msx-2 5'UTR 100 200 300 400 500 700 MO B Shh-RE gctacc--ggagggccgcgtcctgcc-c-ct-cgt-c-tgcacgta G li-1 gccagc—a-agcgcggcgaccgagacc-ca-cgtg--tgcacgta ii in in n mu i ii ii iii iinii i Tgf-bZ gctocc—ggaggtcctcgtcctgcccc-ctgcgtacttgcacgga I I I I I I I I I I I M i l l I I I I I I I I I I I I I I Msx-2 gctccccgggcggccccgctccagccacgctccg—cattcgcgat 132 genes. Based on currently available databases, we found a 37-base-pair conserved domain with 74% homology among the promoter regions of Gli1, Tgf-f52 and Msx2. As shown in Fig. 5.2, this conserved domain is located about 161 bases up-stream to the translation start codon of Gli1, 294 bases up-stream to that of Tgf-02 and right before that of Msx2. We then deduced an artificial common promoter sequence based on the alignment of the above homologous domains, showing a consensus oligonucleotide listed as 5’-GCTACCGGAG GGCCGCGTCC TGCCTGGTCT GCACGTA-3’. Interestingly, this consensus sequence of the Shh/Ptc1 responsive promoter contains two high G-C rich domains which share homology to the published human G//-binding sites (Dai, 1999; Liu, 1998). One of the homologues is 5’-CGCGTCCTG-3\ and the other one is 5’-TGCCTGGTC-3\ The Gli family of zinc finger DNA-binding proteins share highly conserved domains and tend to interact with the high G-C rich domains of a promoter sequence through their metal fingers (Kinzler, 1988& 1990). According to these unique features of Gli, our identified consensus domain is worthy to be further tested with G//3 and/or G//2, when they are available in the future. 5.4 Discussion Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. 133 The innovation of bio-informatic analysis provides revolutionary concepts and an ability to organize huge amounts of data. There is no uniform format for current bio-informatic strategies. Following the progress of this study, we demonstrate a functional modeling strategy for understanding embryonic feather morphogenesis based on the current and previous findings. 5.4.1 The advantages and pitfalls of bio-informatic analysis With the convenience of computer analysis, we can test possible mechanisms with findings under various conditions and transform the experimental data into schematic flowcharts, which offer a clearer and more understandable view of the tested mechanism. Maintaining a balance between data consistency and condition variation is difficult. We adopted data only obtained from chicken feather formation studies for modeling primary downstream gene interactions of Shh/Ptc1 signaling. The model should closely reflect the real condition of interest. Although Shh/Ptc1-associated genes are also found in other tissue or species systems, the expression of genes involved in the specification of cell fate in each system should be unique. Comparing findings from other systems can impede the modeling of a genetic mechanism unless there is a proven link between the systems. Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. 134 5.4.2 Competing signal transduction pathways to the Shh/Ptc1 signal According to our gene-array data, many potential downstream genes were found to be specific to either Shh or Ptc1, but not both. This finding proved the existence of multiple parallel signaling pathways as described in Fig. 1.8. As shown in Fig. 5.1, the expression of noggin and WntSa were uniquely downstream of Shh signaling, whereas that of r-fringe was stimulated by only Ptc1. Wnt3, Msx1 and Smad5 expression were inhibited by Ptc1, and were not released from inhibition by additional Shh signaling. Because Shh at the early feather bud stage is localized around the distal placode epithelium adjacent to the Ptc1 positive mesenchyme, signaling pathways competing for Ptc1 binding can bypass Shh control. It is most likely that a second ligand of Ptc1 may compete against Shh for triggering different Ptc1 downstream responses. 5.4.3 Potential function of GII2/3 in Shh/Ptc1 signaling pathway Since Gli1 was proven to be a downstream gene in our study, G//2 and G//3 become the most likely candidates for responding to the Shh/Ptc1 signaling. The expression of G//3 is highly abundant in the feather bud area of this stage (Fig. 4.1), indicating a strong potential for activation as a primary downstream gene. Previous in vitro studies have shown that all human and mouse Gli proteins bind to a consensus sequence 5’- Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. 135 TGGGTGGTG-3’ through their metal finger regions (Kinzler, 1988; Marigo, 1996) and GH1 is downstream of Shh (Lee, 1997; Dai, 1999). G//3 represses Shh expression in the anterior region of the limb bud (Buscher, 1997), while Gli1 is a positive regulator for maintaining Shh signaling in neural tube development (Lee, 1997). Although sim ilar expression and regulation of G//2 and GU3 has recently been reported in chick limb bud formation (Schweitzer, 2000), we do not know of the existence of G//2 in our model due to the unavailability of G//2 sequence information. Because both G//2 and G//3 proteins are a composite of positive (C-terminal) and negative (N-terminal) regulatory domains to the Shh signaling (Sasaki, 1999), how the Shh signal preserves intact GH2/3 structures to mask their repressive function is another interesting question. 5.4.4 Interactive functions o f Shh/Ptc1 downstream genes The overlapping zone of GIH, Tgf-(32 and Smad3 expression indicates the direction of feather bud formation. GIH function was reported to prolong the Shh signaling effects without the induction of Shh (Lee, 1997). The continuation of G//f-induced S/7/7-independent cell proliferation may provide the growing force to establish proximal-distal polarity. Moreover, the interaction of Tgf-@2 and Smad3 may trigger Smad7 expression (von Gersdorff, 2000; Stopa, 2000; Brodin, 2000) and inhibit Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. 136 BMP signaling in the posterior E8 feather bud. Because BMP4 is an inhibitor for feather growth (Jung, 1998) and our data showed its function to be opposite of Shh/Ptc1 signaling (Tab. 4.2), the Smad7-induced inhibition of BMP4 expression may therefore contribute to the fast growth of the posterior feather bud and result in establishing anterior-posterior polarity. Many more morphogens are involved in the polarity formation of a feather. Based on our current findings and previous data, we provide a functional scheme, which partially explains the feather morphogenesis mechanism. 5.4.5 Synergistic control of Shh/Ptcf-directed transcriptional events Developmental research of signaling pathways usually focuses on transcriptional control and downstream gene expression. A set of signaling-specific transcription factors is needed to modulate the progress of downstream gene-related events and maintain the resulting developmental normality. The synergistic expression of Shh/Ptc1 primary downstream genes were controlled by the activation of G//3 and/or G//2 in this study. Several G//-binding site homologues were also identified in all known promoters of the identified primary downstream genes, such as GIH, Tgf-p2 and Msx2. These potential chicken G//-binding sites not only contain the same conserved properties of all known G//-binding domains, but also share high homology to those of human and mouse. Because we Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. 137 adopted a more homogeneous approach using feather-bud-specific mRNA libraries for genetic analysis, the results were shown to be highly relevant to our and colleagues’ predictions (Ting-Berreth, 1996; Morgan, 1998). This is the first time that we are able to screen promoter homologues based on the primary downstream genes of a developmental signaling pathway. Using heterogeneous samples, it is impossible to identify primary downstream genes and their promoter domain(s) related to a tissue-type-specific signaling pathway. Previous developmental reports usually faced this dilemma by offering more compromising but confusing results. However, the synergistic control of Shh/Ptc1 downstream events cannot be resolved like that. We must use the same or higher stringency as those in molecular genetics research. Following these criteria, we have identified the Shh/Ptc1 primary downstream genes and shown that these downstream genes could be synergistically regulated by a homologous G//-binding site. The final evidence that needs to be further provided is the direct interaction of the potential G//-binding site to a Gli protein, when chicken G//3 or GH2 protein is available. Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. 138 CHAPTER 6: CONCLUSION In this study, a novel developmental biology strategy was developed to investigate signal transduction pathways, the downstream genes of Shh/Ptc1 signaling in embryonic feather morphogenesis were identified, and a bio-informatic mechanism of Shh/Ptc1-directed transcriptional control was proposed. Our strategy adopted three state-of -the-art biotechnologies: C-probe gene attenuation (US Patent No. 6,015,676; PCT Patent No. WO 01/13959A1), RNA-PCR (US Patent No. 6,197,554; PCT Patent No. WO 00/75356A1) and bio-informatics. In our tested chicken skin explant model, we used antisense C- probe to disturb either Shh or P td signaling to observe alterations in downstream gene expression. The gene alterations in early feather placode regions were precisely isolated and amplified by RNA-PCR. The RNA-PCR-amplified gene transcripts were then applied to gene-array analysis for screening the differential downstream genes. After further confirmation by Northern blot analysis, the identified downstream genes were used to propose a functional mechanism for the Shh/Ptd-directed embryonic feather morphogenesis. Traditional gene disturbance methods for developmental research must be improved. Analysis of gene expression from specimens in which Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. 139 over-expression and mis-expression of a morphogen obtained by release from a soaked bead or by virus transfection were usually confused by endogenous gene expression or because the genes were expressed in regions that they would not normally exist. These gain-of-function results were also difficult to correlate with phenotypic changes. Most functional information of morphogens was actually provided by molecular and genetic research. The C-probe technology, which we invented in early 1997 was designed to target specific genes for down-regulation. Based on our tests, its reversible and efficient gene attenuation did offer less tissue damage and more control over endogenous gene expression. A spectrum of 50~80% gene knockout rates were acquired in our tested models, depending on which gene was used. This gene attenuation was strong enough to affect downstream gene expression but was not sustained long enough to cause compensation effects. Therefore, an adjustable gene disturbance system was achieved. Our major breakthrough and contribution to current genetic research in the developmental biology field is the utilization of single-feather-bud mRNA libraries prepared from a precise tissue location of interest. Previous studies using whole heterogeneous samples usually produced inconsistent and confusing results, misleading the field into controversial dilemmas. Our approach offers a much more focused study on Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. 140 phenomena residing within the exact point without external interference. Using more convenient and assessable cancer sample systems, the results have been proven to be highly consistent, reliable and sufficient to provide a much clearer view for both in cell and in vivo studies. With the same advantages, we had successfully applied the single-feather-bud mRNA libraries to current developmental research. Using this data we were able to identify downstream genes and the responsive promoter homologues of Shh/Ptc1 signaling in embryonic feather morphogenesis. Traditional approaches would sum data over a broader area and would never see the precisely localized changes. Based on our gene-array and Northern blot analyses, the downstream genes of Shh/Ptc1 signaling were identified and confirmed. The expressions of Gli1, Tgf-fS2, Msx2, Smad3, Tbx4 and Lmx1 were found to be directly regulated by Shh/Ptc1 signaling. Many other gene interactions were also detected, corresponding to either Shh or Ptc1 regulation. The gene interaction pattern is most likely to be more related to central nerve development than limb bud morphogenesis. These findings provide the best evidence for the concept that cross-talk between multiple signaling pathways determines the final results of a developmental event. Although the same set of signaling pathways can be repeatedly used during the organogenesis of a variety of organ systems, the combination of distinct Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. 141 signal functions at precise locations and times creates unique conditions for specific organ formation. Therefore, sample homogeneity is a key point for understanding such signaling combinations. The same principle will be very important for gene manipulation during further organogenesis in the future. A bio-informatic mechanism was proposed based on both current and previous findings in chicken feather morphogenesis. This study has added molecular and genetic evidence to the previous observations. We confirmed the Shh/Ptc 1 -d irected downstream genes and their interactions and integrated this information with data from previous reports. Taken together, we have sufficient data for the bio-informatic analysis of feather morphogenesis at the tested stage. Although many details still need to be polished by more functional tests, the proposed mechanism indeed provides more solid interactions and directions than ever for the future work in this field. One possibility is that the same strategy can be applied to the identified competing signaling pathways to improve the present mechanism. The ability to profile gene expression patterns in a specific cell type offers us unlimited power to investigate the natural rules o f developmental biology. Following one by one decoding of the related signal transduction Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. 142 pathways, a panoramic view of the developmental event could be revealed. The mechanisms of cell proliferation, differentiation, apoptosis and even migration at the molecular genetic level are gradually becoming clearer. Many of these processes that occur during embryonic development are also re-iterated again and again during adult tissue regeneration and even tumor formation if certain genetic regulations are lost. For example, over- expression of Shh can induce basal cell carcinoma (BCC) in mice (Oro, 1997), and human familial BCC usually displays the loss-of-function of Ptc or the consistent gain-of-function of Gli1 (Hahn, 1996; Johnson, 1996; Dahmane, 1997). The knowledge of developmental mechanisms can be, therefore, very useful for the research in many other fields. How to exploit the applications in the studies of neoplastic transformation, therapeutic effect, pathological disorder, and cell-physiological phenomena will be a major challenge in the near future. Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. 143 REFERENCES Altaba, A.R., Palma, V., and Dahmane, N. (2002). Hedgehog-Gli signaling and the growth of the brain. Nature Reviews 3: 24-33. Aza-Blanc, P., Ramirez-Weber, F.A., Laget, M.P., Schwartz, C., and Kornberg, T.B. (1997). Proteolysis that is inhibited by hedgehog targets cubitus interruptus protein to the nucleus and converts it to a repressor. Cell 89: 1043-1053. Bai, C.B. and Joyner, A.L. (2001). Gli1 can rescue the in vivo function of Gli2. Development 128: 5161-5172. Baulcombe, D.C. (2000). Molecular biology. Unwinding RNA silencing. Science 290: 1108-1109. Baulcombe, D. (2001). RNA silencing. Diced defence. Nature 409:295- 296. Baulcombe, D. (2002). RNA silencing Curr Biol. 12:R82-84. Berchem, G.J., Bosseler, M., Sugars, L.Y., Voeller, H.J., Zeitlin, S., and Gelmann, E.P. (1995). Cancer Res. 55: 735-738. Boissonnas, R.A. (1951). Helvetica Chimica Acta. 34: 874-879. Brodin, G., Ahgren, A., ten Dijke, P., Heldin, C.H., and Heuchel, R. (2000) Efficient TGF-beta induction of the Smad7 gene requires cooperation between AP-1, Sp1, and Smad proteins on the mouse Smad7 promoter. J Biol Chem. 275: 29023-29030. Buscher, D., Bosse, B., Heymer, J., and Ruther, U. (1997). Evidence for genetic control of Sonic hedgehog by Gli3 in mouse limb development. Mech Dev. 62:175-182. Chiang, C., Litingtung, Y., Lee, E., Young, K.E., Corden, J.L., Westphal, H., and Beachy, P.A. (1996). Cyclopia and defective axial patterning in mice lacking Sonic hedgehog gene function. Nature 383:407-413. Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. 144 Chuong, C.M., Patel, N.t Lin, S.L., Jung, H.S., and Widelitz, R.B. (2000). Sonic hedgehog signaling pathway in vertebrate epithelial appendage morphogenesis: Perspectives in development and evolution. CMLS, Cell. Mol. Life Sci. 57: 1672-1681. Crino, P.B., Trajanowski, J.Q., Dichter, M.A., and Eberwine, J. (1996). Embryonic neuronal markers in tumerous sclerosis: single-cell molecular pathology. Proc. Natl. Acad. Sci. USA 93:14152-14157. Dahmane, N., Lee, J., Robins, P., Heller, P., and Ruiz i Altaba, A. (1997). Activation of the transcription factor Gli1 and the Sonic hedgehog signaling pathway in skin tumours. Nature 389:876-881. Dai, P., Akimaru, H., Tanaka, Y., Maekawa, T., Nakafuku, M., and Ishii, S. (1999). Sonic Hedgehog-induced activation of the Gli1 promoter is mediated by GLI3. J. Biol Chem. 274: 8143-8152. Denissova, N.G., Pouponnot, C., Long, J., He, D., and Liu, F. (2000). Transforming growth factor beta -inducible independent binding of SMAD to the Smad7 promoter. Proc Natl Acad Sci U S A 97:6397-6402. Eberwine, J., Yeh, H., Miyashiro, K., Cao, Y., Nair, S., Finnell, R., Zettel, M., and Coleman, P. (1992). Analysis of gene expression in single live neurons. Proc. Natl. Acad. Sci. USA 89: 3010-3014. Embleton, M.J., Gorochov, G., Jones, P.T., and Winter, G. (1992). In-cell PCR from mRNA: amplifying and linking the rearranged immunoglobulin heavy and light chain V-genes within single cells. Nucleic Acids Res. 20: 3831-3837. Falletta, E. (1990). Phase 1 evaluation of diaziquone in childhood cancer. Investigational New Drugs 8: 167-170. Grant, S.R. (1999). Dissecting the mechanisms of posttranscriptional gene silencing: divide and conquer. Cell 96:303-306. Hahn, H., Wicking, C., Zaphiropoulous, P.G., Gailani, M.R., Shanley, S., Chidambaram, A., Vorechovsky, I., Holmberg, E., Unden, A.B., Gillies, S., Negus, K., Smyth, I., Pressman, C., Leffell, D.J., Gerrard, B., Goldstein, A.M., Dean, M., Toftgard, R., Chenevix-Trench, G., Wainwright, B., and Bale, A.E. (1996). Mutations of the human homolog of Drosophila patched in the nevoid basal cell carcinoma syndrome. Cell 85: 841-851. Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. 145 Hampson, I.N., Pope L , Cowling, G.J., and Dexter, T.M. (1992). Chemical crosslinking subtraction; A new method for the generation of subtractive hybridization probes. Nucleic Acids Res. 20: 2899-2907. Hartley, J.A., Berardini, M., Ponti, M., Gibson, N.W., Thompson, A.S., Thurston, D.E., Hoey, B.M., and Butler, J. (1991). DNA cross-linking and sequence selectivity of aziridinylbenzoquinones: a unique reaction at 5-GC- 3' sequences with 2,5-diaziridinyl-1,4-benzoquinone upon reduction. Biochemistry 30:11719-11724. Hsiao, M., Tse, V., Carmel, J., Tsai, Y., Feigner, P.L., Haas, M., and Silverberg, G.D. (1997). Intracavitary liposome-mediated p53 gene transfer into glioblastoma with endogenous wild-type p53 in vivo results in tumor suppression and long-term survival. Biochem Biophys Res Commun. 233:359-364. Hubank, M. and Schatz, D.G. (1994). Identifying differences in mRNA expression by representational difference analysis of cDNA. Nucleic Acids Res. 22: 5640-5648. Ingham, P.W., Taylor, A.M., and Nakano, Y. (1991). Role of the Drosophila patched gene in positional signaling. Nature 353: 184-187. Ingham, P.W., Nystedt, S., Nakano, Y., Brown, W., Stark, D., van den Heuvel, M., Taylor, A.M. (2000). Patched represses the Hedgehog signaling pathway by promoting modification of the Smoothened protein. Curr Biol. 10: 1315-1318. Jering, H., Schorp, G., and Tschesche, H. (1974). Enzymatic cleavage of the N-epsilon-acetyl protecting group from lysine in proteins (Klunitz trypsin-kallikrein inhibitor) in vitro and in vivo. Hoppe Seylers Z Physiol Chem. 355: 1129-1134. Jiang, T.X. and Chuong, C.M. (1992). Mechanism of skin morphogenesis. I. Analyses with antibodies to adhesion molecules tenascin, N-CAM, and integrin. Dev Biol. 150: 82-98. Jiang, T.X., Jung, H.S., Widelitz, R.B., and Chuong, C.M. (1999). Self organization of periodic patterns by dissociated feather mesenchymal cells and the regulation of size, number and spacing of primordia. Development 126: 4997-5009. Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. 146 Johnson, R.L., Rothman, A.L., Xie, J., Goodrich, L.V., Bare, J.W., Bonifas, J.M., Quinn, A.G., Myers, R.M., Cox, D.R., Epstein, E.H. Jr., and Scott, M.P. (1996). Human homolog of patched, a candidate gene for the basal cell nevus syndrome. Science 272: 1668-1671. Johnson, R.L. and Scott, M.P. (1998). New players and puzzles in the hedgehog signaling pathway. Current Opinion in Genetics & Development 8: 450-456. Jung, H.S., Francis-West, P.H., Widelitz, R.B., Jiang, T.X., Ting-Berreth, S., Tickle, C., Wolpert, L., and Chuong, C.M. (1998). Local inhibitory action of BMPs and their relationships with activators in feather formation: implications for periodic patterning. Dev Biol. 196: 11-23. Kinzler, K.W., Ruppert, J.M., Bigner, S.H., and Vogelstein, B. (1988). The GLI gene is a member of the Kruppel family of zinc finger proteins. Nature 332: 371-374. Kinzler, K.W. and Vogelstein, B. (1990). The GLI gene encodes a nuclear protein which binds specific sequences in the human genome. Mol Cell Biol. 10:634-642. Lawrence, D.A. (1996). Transforming growth factor-beta: a general review. Eur Cytokine Netw. 7: 363-374. Lee, J., Platt, K.A., Censullo, P., and Ruiz i Altaba, A. (1997). Gli1 is a target o f Sonic hedgehog that induces ventral neural tube development. Development 124: 2537-2552. Lewis, K.E., Drossopoulou, G., Paton, I.R., Morrice, D.R., Robertson, K.E., Burt, D.W., Ingham, P.W., and Tickle, C. (1999). Expression of ptc and gli genes in talpid3 suggests bifurcation in Shh pathway. Development 126: 2397-2407. Lin, S.L., Chuong, C.M., Widelitz, R.B., and Ying, S.Y. (1999). In vivo analysis o f cancerous gene expression by RNA-polymerase chain reaction. Nucleic Acid Res. 27: 4585-4589. Lin, S.L. and Ying, S.Y. (1999). Differentially expressed genes in activin- induced apoptotic LNCaP cells. Biochem. Biophys. Res. Commun. 257: 187-192. Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. 147 Lin, S.L., Chuong, C.M., and Ying, S.Y. (2001). A novel mRNA-cDNA interference phenomenon for silencing bcl-2 expression in human LNCaP cells. Biochem. Biophys. Res. Commun. 281: 639-644. Lisitsyn, N., Lisitsyn, N., and Wigler, M. (1993). Cloning the differences between two complex genomes. Science 259: 946-951. Liu, A., Majumdar, A., Schauerte, H.E., Haffter, P., and Drummond, I.A. (2000). Zebrafish wnt4b expression in the floor plate is altered in sonic hedgehog and gli-2 mutants. Mech Dev. 91: 409-413. Marigo, V., Johnson, R.L., Vortkamp, A., and Tabin, C.J. (1996). Sonic hedgehog differentially regulates expression of GLI and GLI3 during limb development. Dev Biol. 180: 273-83. Medori, R., Tritschler, H.J., and Gambetti, P. (1992). Production of single stranded DNA for sequencing: An alternative approach. BioTechniques 12: 132-135. Morgan, B.A., Orkin, R.W., Noramly, S., and Perez, A. (1998). Stage-specific effects of sonic hedgehog expression in the epidermis. Dev Biol. 201:1- 12. Motoyama, J., Heng, H., Crackower, M.A., Takabatake, T., Takeshima, K., Tsui, L.C., and Hui, C. (1998). Overlapping and non-overlapping Ptch2 expression with Shh during mouse embryogenesis. Mech Dev. 78: 81-84. Nieto, M.A., Patel, K., and Wilkinson, D.G. (1996). In situ hybridization analysis of chick embryos in whole mount and tissue sections. Methods Cell Biol. 51:219-235. Noveen, A., Jiang, T.X., and Chuong, C.M. (1995). Protein kinase A and protein kinase C modulators have reciprocal effects on mesenchymal condensation during skin appendage morphogenesis. Dev Biol. 171: 677- 693. O’Dell, D.M., Raghupathi, P., Crino, P.B., Morrison, B., Eberwine, J.H., and McIntosh, T.K. (1998). Amplification of mRNAs from single, fixed, TUNEL- positive cells. BioTechniques 25: 566-570. Oro, A.E., Higgins, K.M., Hu, Z., Bonifas, J.M., Epstein, E.Jr., and Scott, M.P. (1997). Basal cell carcinomas in mice overexpression Sonic Hedgehog. Science 276: 817-820. Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. 148 Pearse, R.V. 2nd., Vogan, K.J., and Tabin, C.J. (2001). Ptc1 and Ptc2 transcripts provide distinct readouts of Hedgehog signaling activity during chick embryogenesis. Dev Biol. 239: 15-29. Reed, J.C., Stein, C., Subasinghe, C., Haidar, S., Croce, C.M., Yum, S., and Cohen, J. (1990). Antisense-mediated inhibition of BCL2 protooncogene expression and leukemic cell growth and survival: comparisons of phosphodiester and phosphorothioate oligodeoxynucleotides. Cancer Res. 50: 6565-6570. Porter, J.A., Young, K.E., and Beachy, P.A. (1996) Cholesterol modification of hedgehog signaling proteins in animal development. Science 274: 255- 259. Robbins, D.J., Nybakken, K.E., Kobayasshi, R., Sisson, J.C., Bishop, J.M., and Therond, P.P. (1997). Hedgehog elicits signal transduction by means of a large complex containing the kinesin-related protein costal2. Cell 90: 225-234. Rubin, C.M. and Schmid, C. (1980). Pyrimidine-specific chemical reactions useful for DNA sequencing. Nucleic Acids Res. 8: 4613-4619. Sambrook, J., Fritsch, E.F., and Maniatis, T. (1989). Molecular cloning, 2nd edition: Construction and analysis of cDNA libraries, pp. 8.11-8.35. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY. Sasaki, H., Nishizaki, Y., Hui, C., Nakafuku, M., and Kondoh, H. (1999). Regulation of Gli2 and Gli3 activities by an amino-terminal repression domain: implication of G!i2 and Gli3 as primary mediators of Shh signaling. Development 126: 3915-3924. Schweitzer, R., Vogan, K.J., and Tabin, C.J. (2000). Similar expression and regulation of Gli2 and Gli3 in the chick limb bud. Mech Dev. 98:171-174. Sisson, J.C., Ho, K.S., Suyama, K., and Scott, M.P. (1997). Costal2, a novel kinesin-related protein in the hedgehog signaling pathway. Cell 90: 235- 245. Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. 149 Stopa, M., Anhuf, D., Terstegen, L., Gatsios, P., Gressner, A.M., and Dooley, S. (2000). Participation of Smad2, Smad3, and Smad4 in transforming growth factor beta (TGF-beta)-induced activation of Smad7. THE TGF-beta response element of the promoter requires functional Smad binding element and E-box sequences for transcriptional regulation. J Biol Chem. 275: 29308-29317. Ting-Berreth, S.A. and Chuong, C.M. (1996). Sonic hedgehog in feather morphogenesis: Induction of mesenchymal condensation and association with cell death. Developmental Dynamics 207: 157-170. Van Gelder, E., Raghupathi, P., and Eberwine, J.H. (1990). Amplified RNA synthesized from limited quantities of heterogeneous cDNA. Proc. Natl. Acad. Sci. USA 87:1663-1667. von Gersdorff, G., Susztak, K., Rezvani, F., Bitzer, M., Liang, D., and Bottinger, E.P. (2000). Smad3 and Smad4 mediate transcriptional activation of the human Smad7 promoter by transforming growth factor beta. J Biol Chem. 275:11320-11326. Wollenzien, P.L. and Cantor, C.R. (1982). Marking the polarity of RNA molecules for electron microscopy by covalent attachment of psoralen-DNA restriction fragments. Proc. Natl. Acad. Sci. USA 79: 3940-3944. Xie, J., Johnson, R.L., Zhang, X., Bare, J.W., Waldman, F.M., Cogen, P.H., Menon, A.G. Warren, R.S., Chen, L.C., Scott, M.P., and Epstein, E.Jr. (1997). Mutations of the patched gene in several types of sporadic extracutaneous tumors. Cancer Res. 57: 2369-2372. Xie, J., Murone, M., Luoh, S.M., Ryan, A., Gu, Q., Zhang, C., Bonifas, J.M., Lam, C.W., Hynes, M., Goddard, A., Rosenthal, A., Epstein, E.H. Jr., and de Sauvage, F.J. (1998). Activating Smoothened mutations in sporadic basal cell carcinoma. Nature 391: 90-92. Yang, Y., Drossopoulou, G., Chuang, P.T., Duprez, D., Marti, E., Bumcrot, D., Vargesson, N., Clarke, J., Niswander, L., McMahon, A., and Tickle, C. (1997). Relationship between dose, distance and time in Sonic Hedgehog-mediated regulation of anteroposterior polarity in the chick limb. Development 124: 4393-4404. Ying, S.Y., Chuong, C.M. and Lin, S.L. (1999). Suppression of Activin- Induced Apoptosis by A Novel Antisense Strategy. Biochem. Biophys. Res. Commun. 265: 669-673. Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. 150 Ying, S.Y., Lui, H.M., Lin, S.L., and Chuong, C.M. (1999). Generation of Full- Length cDNA Library from Single Human Prostate Cancer Cells. BioTechniques 27: 410-414. Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.

Linked assets

University of Southern California Dissertations and Theses

Conceptually similar

PDF

Expression and functional studies of the Notch signaling pathway in feather development

PDF

Mechanisms of ovarian cancer predisposition in BRCA1 mutation carriers

PDF

Downstream targets of the Ewing's sarcoma EWS /FLI -1 fusion gene

PDF

A coactivator complex among GRIP1, CARM1, and TIF1alpha contributes to gene activation directed by androgen receptor

PDF

Development of replication -competent retroviral vectors for efficient, targeted gene therapy of cancer

PDF

An examination of the function of the deleted in colorectal carcinoma gene in epithelial tissues

PDF

Anomalies at NGX6 locus: Potential involvement in feline lymphomas

PDF

Biochemical factors determining tumor response to 5,10-dideazatetrahydrofolate, a folate antimetabolite inhibitory to de novo purine biosynthesis

PDF

Identification and characterization of transcriptional regulatory elements in the Msx2 promoter

PDF

Altered skin wound healing in homeobox gene Msx-2 knockout mice

PDF

A POU gene expressed in the early sea urchin embryo: Structure, evolution and requirement for embryonic development

PDF

FGF8, isoform b, is an etiological factor in prostate tumorigenesis

PDF

Study of the role of bone morphogenetic proteins in prostate cancer progression

PDF

The Human 3 Beta-Hydroxysteroid Dehydrogenase Type Ii Gene And Genetic Predisposition To Prostate Cancer

PDF

Health-related quality of life, occupation and prosthesis use in elderly people with lower extremity amputation in Taiwan

PDF

Characterization of the EWS -FLI1 fusion protein in the tumorigenesis of Ewing's family of tumors

PDF

Analysis of multistep mammary tumorigenesis in Wnt1 transgenic mice: The role of fibroblast growth factor-8 in oncogenesis and apoptosis

PDF

Analysis of the function and regulation of the 94kDa glycoprotein of the glucose-regulated protein family.

PDF

Analysis of the HSD3B2 gene in prostate cancer

PDF

Analysis of cis-sequence requirements and functions during Drosophila chorion gene amplification

Asset Metadata

Creator Lin, Shi-Lung (author)

Core Title Analysis of Sonic hedgehog/Patched-1 downstream genes in embryonic feather morphogenesis and the development of novel biotechnologies thereof

School Graduate School

Degree Doctor of Philosophy

Degree Program Pathobiology

Publisher University of Southern California (original), University of Southern California. Libraries (digital)

Tag biology, genetics,biology, molecular,OAI-PMH Harvest

Language English

Contributor Digitized by ProQuest (provenance)

Advisor Chuong, Cheng-Ming (committee chair), Miller, Carol A. (committee member), Roy-Burman, Pradip (committee member), Triche, Timothy J. (committee member), Ying, Shao-Yao (committee member)

Permanent Link (DOI) https://doi.org/10.25549/usctheses-c16-221685

Unique identifier UC11334948

Identifier 3073805.pdf (filename),usctheses-c16-221685 (legacy record id)

Legacy Identifier 3073805.pdf

Dmrecord 221685

Document Type Dissertation

Rights Lin, Shi-Lung

Type texts

Source University of Southern California (contributing entity), University of Southern California Dissertations and Theses (collection)

Access Conditions The author retains rights to his/her dissertation, thesis or other graduate work according to U.S. copyright law. Electronic access is being provided by the USC Libraries in agreement with the au...

Repository Name University of Southern California Digital Library

Repository Location USC Digital Library, University of Southern California, University Park Campus, Los Angeles, California 90089, USA