University of Southern California Dissertations and Theses

Identification and cloning of developmentally regulated genetic loci in transgenic mice by screening for novel expression pattern of the lacZ reporter gene

(USC Thesis Other)

Identification and cloning of developmentally regulated genetic loci in transgenic mice by screening for novel expression pattern of the lacZ reporter gene

PDF

Download

Open document

Flip pages

Download a page range

Download transcript

Copy asset link

Request this asset

Transcript (if available)

Content INFORMATION TO USERS
This manuscript has been reproduced from the microfilm master. UMI films
the text directly from the original or copy submitted. Thus, some thesis and
dissertation copies are in typewriter face, while others may be from any type of
computer printer.
The quality of this reproduction is dependent upon the quality of the
copy submitted. Broken or indistinct print, colored or poor quality illustrations
and photographs, print bleedthrough, substandard margins, and improper
alignment can adversely affect reproduction.
In the unlikely event that the author did not send UMI a complete manuscript
and there are missing pages, these will be noted. Also, if unauthorized
copyright material had to be removed, a note w ill indicate the deletion.
Oversize materials (e.g., maps, drawings, charts) are reproduced by
sectioning the original, beginning at the upper left-hand comer and continuing
from left to right in equal sections with sm all overlaps.
ProQuest Information and Learning
300 North Zeeb Road, Ann Arbor, Ml 48106-1346 USA
800-521-0600
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
NOTE TO USERS
Page(s) not included in the original manuscript
are unavailable from the author or university. The
manuscript was microfilmed as received.
65
This reproduction is the best copy available.
UMI'
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
IDENTIFICATION AND CLONING OF
DEVELOPMENTALLY REGULATED GENETIC LOCI IN
TRANSGENIC MICE BY SCREENING FOR NOVEL
EXPRESSION PATTERN OF THE lacZ REPORTER GENE
By
Yi-Hsin Liu
A Dissertation Presented to the
FACULTY OF THE GRADUATE SCHOOL
UNIVERSITY OF SOUTHERN CALIFORNIA
In Partial Fulfillm ent o f the
Requirements for the Degree
DOCTOR OF PHILOSOPHY
(MICROBIOLOGY)
May 2002
Copyright 2002 Yi-Hsin Liu
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
UMI Number: 3073807
_ _ _ _ _ __ (ft
UMI
UMI Microform 3073807
Copyright 2003 by ProQuest Information and Learning Company.
All rights reserved. This microform edition is protected against
unauthorized copying under Title 17, United States Code.
ProQuest Information and Learning Company
300 North Zeeb Road
P.O. Box 1346
Ann Arbor, Ml 48106-1346
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
UNIVERSITY O F SOUTHERN CALIFORNIA
The G raduate School
U n iversity Park
LOS ANGELES, CALIFORNIA 90089-1695
This dissertation, w ritte n b y
U nder th e d irec tio n o f Ais_. D issertation
Com m i ttee, an d approved b y a ll its members,
has been p resented to an d accepted b y The
G raduate School , in p a rtia l fu lfillm e n t o f
requirem ents lo r th e degree o f
X L H ate. I4u
D O C TO R O F P H IL O S O P H Y
' G raduat e S t udi es
D a te
M a y 10, 2002
D IS S E R TA T IO N C O M M IT T E E
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
Yi-Hsin Liu Leslie P. Weiner, M.D.
ABSTRACT
IDENTIFICATION AND CLONING OF DEVELOPMENTALLY REGULATED
GENETIC LOCI IN TRANSGENIC MICE BY SCREENING FOR NOVEL
EXPRESSION PATTERN OF THE lacZ REPORTER GENE
During the past 80 years, approximately 500 genetic loci were
identified and mapped in mice solely on the basis of phenotypic variations.
However, the molecular analysis of these genetic loci was hampered
primarily by the relatively long gestation period as well as the size and
complexity of the mouse genome. To overcome these difficulties, various
approaches have been devised and successfully utilized. More recently
new genes are being identified and isolated by screening for positional
dependent expression of transgenes in transgenic mice. The lacZ reporter
provides a sensitive and easily assayable gene product to detect expression
in whole embryos. The use of facZ gene as a reporter in transgenic mice
has facilitated screening for possible mutants on the basis of novel patterns
of lacZ expression during embryogenesis. Here I described the usage of
such a system to identify a novel mouse mutant as a result of transgene
integration and attempts to isolate both the genomic sequence and the
mRNA transcript from this newly identified locus.
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
Dedication
I dedicate this dissertation to my late father who has been a source of
inspiration, to Chi who had taught me a great deal on becoming a scientist,
and to my family who have consistently given me moral support.
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
Acknowledgements
My gratitude goes to ail who helped in shaping me one way or another
over the years. I especially like to pay tribute to late Dr. Chi M. Nguyen-Huu
who was instrumental in cultivating my sense of independence and
judgment. He taught me both the serious side and fun side of doing science.
I am grateful to Drs. Robert Maxson, Stanley Tahara, Leslie Weiner, David
Hinton, Peter Nichols, Malcolm Snead, Henry Fong, James Ou, Stephan
Stohlman, and Herold Slavkin. I would also like to thank Mr. Percy Luu and
Mr. Wen-Chung Wei for their expert technical assistance.
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
Table of Contents
Dedication ii
Acknowledgements iii
List of Tables v
List of Figures vi
Introduction 1
Chapter 1-Identification of a novel mouse mutant using the
transgene as a visual tool 16
Chapter 2-Molecular characterization of mouse Msx2 gene promoter
and its regulation during mouse embryonic development 99
References 131
iv
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
List of Tables
Table 1.1 Correlation of genotype to phenotype.
Table 1.2 Strain distribution pattern in Rl mouse strains.
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
List of Figures
Figure 1.1: Structure of the Hoxa5/lacZ transgene. 19
Figure 1.2: Whole-mount detection of (3-gaiactosidase
activity in HoxaS/lacZ transgenic embryos. 21
Figure 1.3: Expression profile of the HoxaS/lacZ transgen in
HoxaS/lacZ- 61 embryos. 33
Figure 1.4: Expression pattern of the lacZ gene in
Hoxa5/lacZ-50 embryos. 40
Figure 1.5: p-galactosidase staining pattern from newborn
to adult in HoxaS/lacZ-50 transgenic mice. 44
Figure 1.6: Homozygous mutants displayed open eyelid
phenotype. 47
Figure 1.7: Southern blot detection of transgenic animals. 53
Figure 1.8: Four copies of Hoxa5/lacZ transgene integrated
together in tandem. 56
Figure 1.9: Restriction map of doe locus preinsertion. 58
Figure 1.10: Sequence comparison between pre- and
post-insertion. 61
Figure 1.11: The transgene array inserted into mouse chromosome
as a single tandem array. 63
Figure 1.12: Restriction map of doe locus pre- and post-insertion. 66
Figure 1.13: A RFLP is associated with doe locus. 67
Figure 1.14: Linkage map of proximal region of mouse
chromosome 12. 71
Figure 1.15: Zooblot 75
vi
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
Figu. o 1.16: Reverse northern. 78
Figure 1.17: Northern blot hybridization to detect transcript(s)
For the doe locus. 80
Figure 1.18: Putative map of doe locus after performing
chromosomal walk. 82
Figure 1.19: Map of doe/1.3-lacZ constructs. 85
Figure 1.20: p-galactosidase staining pattern of the doe/1.3-lacZ
transgenic newborn. 86
Figure 2.1: The mouse Msx2 gene encodes two transcripts. 110
Figure 2.2: Determination of transcription initiation site for mouse
Msx2 gene by primer extension. 113
Figure 2.3: Restriction fragments in the Msx2 gene in P19 cells
were intact. 117
Figure 2.4: Msx2/lacZ fusion gene constructs. 119
Figure 2.5: Whole-mount p-galactosidase staining of Msx2AacZ
transgenic mice. 123
Figure 2.6: Detailed analysis of Msx2/lacZ-5-11 expression in the
mouse embryo. 126
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
Introduction
The development of craniofacial structures involves complex
morphogenetic movements and cellular patterning. Cephalic neural crest
cells contribute significantly to the development of skeletal, connective
tissue, as well as sensory components of the craniofacial region (Couly et
al., 1992; Le Lievre and Le Douarin, 1975; Noden, 1982, 1983a, 1983b,
1986; Le Douarin, 1982, 1986; Couly et al., 1993). Neural crest cells are a
special population of cells; they arise from the lateral edges of the neural
folds at the juncture of the neuroectoderm and the ectoderm (Nichols, 1981,
1986, 1987). In the mouse prior to the closure of neural tube these cells
migrate ventrolaterally to predetermined destinations throughout the embryo
(Serbedzija et al., 1992). They then proliferate and differentiate into various
cellular structures. These include cartilages and bones of the cranial vault
and the face, neurons of sensory, sympathetic and parasympathetic
ganglia, glial and Schwann cells, connective tissues of the skin in the face
including dermis, smooth muscles and adipose tissue, and melanocytes of
the skin (Le Douarin, 1982; Le Douarin, 1986). The facial structures are
developed predominantly from the frontonasal and branchial arch processes
of the early embryo. The nasal pits are formed as a consequence of tissue-
tissue interaction between ectoderm and ectomesenchyme in the forebrain.
As a result of a series of tissue-to-tissue inductions, the nasal placodal
ectoderm becomes dissociated from the forebrain. Cells of the frontonasal
1
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
ectomesenchyme condense, and nasal ectoderm invaginates into this
condensed ectomesenchyme to form the nasal pit Branchial arches are
blocks of mesoderm developed on the ventrolateral aspects of the head,
adjacent to the oral orifice and the primitive pharynx during neurulation.
These arches play a prominent role in the development of the vertebrate
head, giving rise to bones, dermis, adipocytes, and many of the skeletal
muscles in the cephalic region. Initially, each branchial arch is composed of
mesenchyme derived from the intraembryonic mesoderm, and is covered
externally by ectoderm and internally by endoderm. Neural crest cells
originated from cephalic region migrate into these branchial arches and
surround the central core of mesenchymal cells. These cells differentiate
into skeletal structures and connective tissues in the head and neck.
The formation of the face is also accompanied by the development of
the nervous system. Toward the end of neurulation, each branchial arch
starts to receive innervations from a particular cranial nerve in the hindbrain
(.Slavkin, 1979). For instance, innervations in the first branchial arch end up
in the nasal cavity, the tongue and the upper and lower jaws of the adult
face. Although no direct genetic evidence indicates a direct linkage
between normal development of the face and normal development of the
CNS, the interconnection between craniofacial development and CNS
development can be better illustrated by the frequent occurrences of
congenital birth defects both in human populations and in mice. For
2
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
example, persons with oral-facial-digital syndrome (OFD syndrome), a
dominant mutation, display partial clefts in the mid-upper lip, tongue, and
palates, hypoplasia of alar cartilages, also have brain malformation,
including absence of corpus callosum (Jones, 1988). In addition, targeted
mutation in homeobox genes which are known to be expressed in the
hindbrain and spinal cord but not in craniofacial region of the developing
mouse embryo resulted in craniofacial abnormalities and abnormalities
associated with structures of branchial pouch derivatives (Chisaka and
Capecchi, 1991).
Although the anatomy of the face and CNS is well established, little is
known about the underlying molecular mechanisms that regulate their
development. To better understand these processes, detailed molecular
descriptions of pattern formation are required. One objective of
developmental genetic studies is to identify, isolate and functionally
characterize genes that are involved in the control of differentiation programs
during development. Recently, several genes have been shown to express
in the craniofacial region as well in the CNS of developing mouse embryos in
a temporally and spatially restricted manner. The most prominent ones are
transcriptional factors, including homeobox genes and other classes of DNA
binding proteins. Examples of these are Msx1 (MacKenzie et al., 1991),
Msx2 (MacKenzie et al., 1992), S8 (Opstelten et al., 1991), and Pax 3
(Goulding et al., 1991), nuclear proto-oncogenes, such as c-mycand N-myc,
3
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
and nuclear receptors, such as retinoic acid receptor a, (3 , and y (Osumi-
Yamashita et al., 1990). Growth factors including transforming growth
factors, such as bone morphogenetic protein-2A (Lyons et al., 1990), insulin
like growth factors (Ferguson et al., 1992) have been shown to play pivotal
roles in directing the patterning and differentiation of facial skeletal elements.
During the past 80 years, approximately 500 genetic loci were
identified and mapped in mice solely on the basis of phenotypic variations.
The characterization of these “ classical” mouse mutants has played an
invaluable role in the establishment of mammalian genetics and in furthering
our understanding of embryology and the cellular mechanisms underlying
mammalian development. However, the molecular analysis of these genetic
loci was hampered primarily by the relatively long gestation period as well as
the size and complexity of the mouse genome. To overcome these
difficulties, various approaches have been devised and successfully utilized.
Developmentally important genes have been isolated from the mouse using
several experimental strategies. Many developmentally important genes,
such as the Homeotic genes, were isolated on the basis of sequence
homologies to known developmental control genes in other species, such as
Drosophila melanogaster. Many more genes were identified based on
disease linkage analysis and positional cloning. More recently new genes
are being identified and isolated by screening for positional dependent
expression of transgenes in transgenic mice.
4
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
The cloning of Hox complex from the mouse provides an excellent
example of using species conservation as a mean for identification and
isolation of genes that are known to play essential functions in
morphogenesis. Homeotic genes or Hox genes were first identified in fruit fly
Drosophila melanogaster. Most of the known homeotic genes of Drosophila
reside in two gene complexes, the Antennapedia complex (ANT-C), and in
the bithorax complex (BX-C). These Antp class genes include labial (lab),
Proboscipediaa (pb), Deformed (Dfd), Sex combs reduced (Scr),
Antennapedia (Antp), Ultrabithorax (UBX), and abdominal-A (abd-A). Genes
in ANT-C specify segment identities in the posterior head and the thoracic
region of the fly embryos, and genes of the BX-C confers segmental identity
in the posterior thoracic and abdominal segments (McGinnis and Krumlauf,
1992). Loss-of-function mutations in Antp gene resulted in transformation of
posterior thoracic segments into anterior segments. Among the members of
this gene cluster, a highly conserved 180 bp DNA sequence which encodes
60 amino acid DNA binding helix-tum-helix motif, termed homeodomain, was
identified (McGinnis et al., 1984a; Scott and Weiner, 1984). DNA probes
from Drosophila encompass the homeodomain was shown to cross hybridize
at low stringencies to genomic DNA from other species ranging from human
to nematodes (McGinnis et al., 1984a). Subsequently, homeotic complexes
of the mouse and of the human were identified and cloned using Drosophila
homeobox probes by low stringency screening of either the mouse or the
5
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
human genomic libraries (McGinnis et al, 1984b; Hart et al., 1985; Colberg-
Poley et al., 1985a; Colberg-Poley et el, 1985b; Ruddle et al., 1985;
Awgulewitsch et al., 1986; Rubin et al, 1986; Duboule etal, 1986; Malvilio et
al., 1986; Boncinelli etal, 1988). Experimental evidence gathered from null
mutant mice indicated that, like their counter part in Drosophila, mammalian
Hox genes are providing regulatory functions in specifying axial identity along
the anterior-posterior (A-P) axis of the vertebrate body. Targeted mutation of
some of the Hox genes have resulted in abnormalities in the anterior regions
where expression of the targeted Hox gene is prevalent (Hox 1.5, Chisaka
and Capecchi, 1991; Hox 1.6, Lufkin et al., 1991; Chisaka et al, 1992) or
have resulted in the transformation of body structures to more anterior
identities along the anterior-posterior axis (Hox 3.1, Le Mouellic et al, 1992).
The mouse T (Brachyury) locus that was shown to affect mesoderm
formation and notochord development (Hermann etal., 1990) was cloned by
chromosome walking, utilizing various t mutants whose chromosomes
sustained various deletions, DNA rearrangements, or translocations that
involved T locus. Mutations at the T locus induce mild dominant defects in
vertebrate development. Homozygous mutants died at around 10 day of
gestation due to failure to produce sufficient mesoderm during gastrulation
(Chesley 1935; Yanagisawa et al, 1981). A large number of T alleles
bearing a variety of deletions and chromosomal breakpoints have been
isolated in the past 50 years and have provided the basis for physical
6
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
mapping of the T locus to a 75 kb region of mouse chromosome 17
(Herrmann et al., 1990). Within this region a single gene was identified, and
conserved genomic fragments were used to isolate a cDNA clone, pme75.
Deletion of pme75 in many T alleles and rearrangement in at least one T
allele (Hermann et al., 1990), together with the restricted expression of
pme75 in target cell types of T mutants (Wilkinson et al., 1990), strongly
suggests that pme75 is a transcript of the T locus.
Most recently, Bultman et al. (1992) cloned Agouti (a) locus whose
gene product regulates coat color pigmentation in the hair follicles of the
mouse and mutations in this locus is also associated with embryonic
lethality, obesity, diabetes and tumors. Genetic analyses of numerous a
locus mutants have led to the identification of at least 18 dominant and
recessive alleles and pseudo-alleles of agouti. By utilizing a radiation-
induced inversion mutation that brought the limb deformity (Id) into the
proximity of the agouti locus that is normally located 22cM away from Id
locus (Woychik et al., 1990a; Bultman et al., 1991), the breakpoint was
cloned using a DNA probe from previously cloned Id locus. A genomic
fragment next to the breakpoint was shown to have sequence homology
among several mammalian species indicating the presence of a conserved
exon. Subsequent findings of additional agouti alleles indicated that various
agouti mutations were consequences of either loss of function mutations or
gain of function mutations. Loss of function mutation was due to frame-
7
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
shifts in coding region or failure to express the gene which is associated
with non-agouti C57BL strain, and gain of function mutations was a result of
ectopic expression in lethal yellow (Ay) mice (Bultman etal., 1992).
In addition to cloning genes by taking advantage of sequence
conservation and by chromosome walking, a large number of loci have been
isolated by assessing similarities in mutant phenotypes. W locus, which
encodes the proto-oncogene c-kit, and Steel (SI) locus, a gene encodes the
ligand for Kit, were identified on the basis of similar mutant phenotypes
shared by these two genes. Insight into the molecular basis of the W and SI
mutations was obtained with the finding that the receptor tyrosine kinase c-
kit mapped to human chromosome 4 in a region syntenic with mouse
chromosome 5, where the W locus is located. Together with the known
biology of W mutants, this made c-kit a highly attractive candidate gene for
W locus. This possibility was confirmed by showing extremely tight genetic
linkage between W and c-kit in inter-specific crosses (Chabot et al., 1988;
Geissler et al., 1988), and mutations affecting c-kit structure, expression,
and/or function in all W alleles analyzed to date. The identification of c-kit
as the product of the W locus strongly suggested that the SI locus might
encode a ligand for the c-kit receptor (Chabot etal., 1988). Subsequently, a
ligand for c-kit was identified (Flanagan and Leder, 1990; Nocka et al.,
1990; Williams et al., 1990; Zsebo et al., 1990a). This ligand does indeed
map to the SI locus that was rearranged or deleted in independent SI mutant
8
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
isolates (Anderson etal., 1990; Copeland etal., 1990; Huang etal., 1990;
Martin et al., 1990; Zsebo et al., 1990b). Other genes which were isolated
using similar approaches include the undulated (un), Snell's dwarf (dw),
osteopetrotic (op), and shiverer (shi) locus which encodes homeobox-
containing DNA binding protein Pax-1 (Balling et al., 1988), POU domain-
containing transcriptional factor pit-1 (Camper et al., 1990; Li et al., 1990),
macrophage growth factor CSF-1 (Yoshida et al., 1990), and myelin basic
protein (Readhead etal., 1990), respectively.
In recent years, transgenic mice have become an invaluable
experimental system for studying gene expression and gene function in vivo
(Gordon et al., 1980; Gordon and Ruddle, 1981; Brinster et al., 1981;
Costantini and Lacy, 1981; Jaenisch et al., 1981; Harbers et al., 1981;
Wagner et al., 1981; Wagner etal., 1981). Studies thus far have shown that
appropriate temporal and spatial expression patterns are normally
maintained in transgenic animals after an exogenous gene carrying
appropriate promoter elements is introduced into mouse germline.
However, presumably random insertion of the microinjected DNA also
makes it an excellent mutagene (Lacy et al., 1983). Occasionally, a
transgene may insertionally inactivate an endogenous gene. In addition, the
position of insertion may confer a novel expression pattern to the transgene.
This provides a unique opportunity for identifying and isolating new genetic
loci because the expression pattern allows for an initial screen for positional
9
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
effect and the transgene can serve as an excellent tag for cloning the
mutated locus.
Initially, transgenic mice are heterozygous for the integrated
exogenous DNA. A new insertional mutation will be recognized only if its
phenotype is dominant and non-lethal during embryogenesis. To identify
recessive mutations, intercrosses must be set up between heterozygous
transgenic mice and their offspring screened for homozygosity with respect
to the transgene. If the inserted DNA has disrupted the function of a gene
essential for development, no viable homozygous animals will be produced.
On the other hand, if the inserted DNA has caused a non-lethal recessive
mutation, it will only be detected if the homozygous progeny exhibits a
readily recognizable mutant phenotype. In approximately 5 to 10% of
transgenic lines, interruption of an endogenous mouse gene by a transgene
results in a visible abnormal phenotype (Palmiter and Brinster, 1986;
Jeanisch, 1988). The first insertional mouse mutant was discovered by
Jaenisch et al. (1983) in one of 13 transgenic mouse lines carrying Moloney
murine leukemia provirus. Homozygous embryos in one of these lines
(Mov13) was embryonic lethal. Embryos did not survive beyond day 12 of
gestation due to the inactivation of the a1(1) collagen gene (Schnieke etal.,
1983). Since then, a repertoire of mouse insertional mutants identified by
this approach has been accumulating rapidly (reviewed by Reith and
Bernstein, 1991; Meisler, 1992).
10
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
In addition to facilitating cloning of genes that are found to be allelic
to classical mutations, insertional mutagenesis also provides a useful
avenue for the identification and cloning of previously unknown mouse loci.
Many mouse mutants have been identified resulting from disruption of a
functional transcription unit by experimental introduction of ectopic
proviruses, as used to generate the Mov series of mutant mouse strains
(Jaenisch, 1983) or by microinjection of DNA into mouse oocytes. To date,
three novel genes have been successfully cloned from retrovirus-induced
mutants (Mov-13, Schnieke et al., 1983; Mov-34, Soriano et al., 1987;
Grideley et al., 1991; Mpv-17, Weiher et al., 1990). So far, only three new
genes have been isolated from insertional mouse mutant that carried
microinjected DNA, including Id, iv, and H/358 (Woychik etal., 1990; Singh
et al., 1991; Lee et al., 1992). The difficulty in cloning mutant loci can be
attributed partly to transgene-induced chromosomal anomalies. Events
which frequently accompany transgene integration include deletions of the
host chromosomal DNA (Mark et al., 1985; Woychik et al., 1985;
Covarrubias et al., 1986; Lee et al., 1992), duplications of the host DNA
sequences (Wilkie and Palmiter, 1987), cointegration of unlinked mouse
DNA sequences (Covarrubias et al., 1986; Wilkie and Palmiter, 1987),
translocations (Overbeek et al., 1986; Mahon et al., 1988), and
chromosomal rearrangements (Wagner et al., 1983; Covarrubias et al.,
1986, 1987;). Chromosomal rearrangements seen in insertional mutants
11
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
induced by microinjected DNA often complicate molecular analysis of the
primary molecular defect that caused the mutant phenotype. This is
particularly difficult if the rearrangements involve genes distant from the
integration site. Nevertheless, transgene insertions provide a powerful tool
for cloning developmentally important loci, as exemplified by the
identification of RNA transcripts for the mouse limb deformity locus and situs
inversus viscerum (Woychik et al., 1985; Zeller et al., 1989; Woychik et ai,
1990).
The mouse limb deformity (Id) locus was first identified as a recessive
mutation characterized by fusions and reduction in the distal bones of the
limbs that can be traced to a defect in limb bud development (Zeller et al.,
1989). The molecular characterization that involved physical mapping and
cloning of the Id locus was made possible by the fortuitous discovery of a
novel mutation generated by random insertion of a c-myc transgene
(Woychik et al., 1985). Using the transgene as a cloning tag, evolutionarily
conserved coding sequences of the Id locus were cloned and found to
encode a variety of novel proline-rich proteins, termed formins, produced
from a family of differentially spliced, low-abundance mRNA species (Zeller
etai, 1989; Woychik et al., 1990).
Mutations at the situs inversus viscerum locus disrupted the normal
development of asymmetry of the viscera with transposition of thoracic and
abdominal viscera. In other words, organs, such as heart, spleen, and
12
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
stomach in the mutant mouse have found themselves in the opposite side of
their normal positions in the thoracic and abdominal cavities. McNeish etal.
(1990) had identified an insertional mutant mouse that carried microinjected
DNA. This mutation that resulted in craniofacial, limb skeletal, and visceral
malformations was initially named legless (Igl). Genetic complementation
tests confirmed partial allelism of Igl and iv. This was done by crossing
legless mutants to iv homozygotes and scored for co-segregation of Igl and
iv. iv was able to rescue craniofacial and limb defects; however, it was not
able to revert visceral phenotypes. Transgene sequences from the legless
mutant were used to pull out genomic DNA surrounding the insertion site.
An evolutionary conserved DNA fragment was identified and led to the
isolation of cDNA sequences encoded by the legless locus (Singh et. al.,
1991). The true functional nature of this cDNA remains to be tested by
genetic and biochemical means.
Recently, a strategy which was first described in the prokaryotic
system to monitor transcriptionally active regions of the genome was
adopted for use in higher metazoans; it involves the introduction of reporter
constructs into the genome that require the acquisition of c/s-acting DNA
sequences to activate reporter gene expression (Casadaban and Cohen,
1979). In this way, genes are identified based on expression information of
the reporter gene and subsequently cloned from DNA sequences flanking
the site of insertion. In Drosophila, this strategy has been extensively used
13
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
in large-scale screens for genes expressed at particular developmental
stages or in particular developmental lineages (O’Kane and Gehring, 1987;
for review see Bellen et al., 1990). Using transposable P-element based
reporter constructs, thousands of insertions have been generated to monitor
chromosomal loci active during embryogensis. The lacZ reporter provides a
sensitive and easily assayable gene product to detect expression in whole
embryos. About 65% of transgenic lines tested were found to express the
lacZ reporter in a restricted pattern during embryogenesis. Furthermore,
approximately 15% of the P-element insertions caused recessive mutations
that resulted in visible phenotypes.
This approach has been applied to study temporal and spatial
regulation of gene expression during mouse embryogenesis (Zakany et al.,
1988). The use of lacZ gene as a reporter in transgenic mice has also
facilitated screening for possible mutants on the basis of novel patterns of
lacZ expression during embryogenesis (Allen et al., 1988; Kothary et al.,
1988). Several experimental schemes utilizing lacZ gene have been
developed in recent years to identify genetic loci that may have important
function in development. One approach is to introduce lacZ gene under the
control of a minimal promoter into mice and look for lacZ expression in
transgenic embryos. In this “ enhancer trap" scheme, the expression of lacZ
is an indication that the transgene has inserted near the enhancer of a
gene. Another approach is to introduce into mice a gene construct that
14
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
contains an intron and splice acceptor site in front of lacZ gene. Hence the
lacZ gene can only be expressed as a chimeric transcript. Correct splicing
of this chimeric message will allow the production of functional p-
galactosidase fusion proteins. The rapid amplification of cDNA ends
(RACE) protocol (Frohman et al., 1988) will then be used to clone cDNA
sequences spanning the lacZ splice junction. This “ gene trap” approach
greatly facilitated the isolation of novel DNA sequences and at the same
time prevented the synthesis of normal endogenous transcripts and
therefore effectively created null mutations (Skames etai, 1992). It became
apparent that the presence of the lacZ “ tag” in transgenic animals would
facilitate the screening for novel and developmentaiiy regulated genes. In
addition, we would be able to correlate transgene expression profile with
any developmental defect Most importantly, we would be able to use the
transgene as a molecular tag for cloning the host genomic DNA adjacent to
the inserted transgene. Biological characterization of transgenic mutants
and chromosome mapping of the insertion sites can accomplish two
important goals: (1) identification of new functional elements in the
mammalian genome, and (2) molecular isolation of new and previously
inaccessible genes.
15
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
Chapter 1
Identification of a novel mouse mutant using the transgene as a visual
tool
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
16
Introduction
To gain insight into mechanisms underlying region-specific gene
expression in mammalian development and to identify genetic control
elements that will be useful in targeting gene expression in a region-specific
manner to generate mutations for the purpose of understanding function of
normal genes, Zakany et al. (1988) generated lacZ reporter gene constructs
under the control of mouse Hoxa5 (Hox-1.3) regulatory sequences (Figure
1.1). These gene fusions were introduced into mouse germline and the
expression pattern of Hoxa5/lacZ transgenes were assayed for p-
galactosidase activity during mouse embryogenesis. A 912 bp DNA
fragment located immediately 5' to the Hoxa5 protein-coding region was
found to be sufficient to direct p-galactosidase expression in dividing
neurons in the dorsal half of the spinal cord. Intriguingly, this Hoxa5
enhancer also contains a spatial element that limits the reporter gene
expression to within the branchial region of the embryonic spinal cord
(Figure 1.2). This DNA fragment was found to behave as an enhancer
element in an orientation independent manner in addition to acting on
heterologous promoter. However, a lacZ fusion with only a 308 bp fragment
including the proximal Hoxa5 promoter and 5' untranslated region was
shown to be inactive in transgenic animals. In the course of this study, six
stable transgenic lines carrying the 912-bp fragment were established. Two
of these transgenic lines showed interesting lacZ expression patterns during
17
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
embryogenesis and have become the subjects of the current study. The
two important goals are: (1) identification of new functional elements in the
mammalian genome, and (2) molecular isolation of new genes that may
have important function in development.
18
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
1 kb
HoxaS genomic DNA
AccI B glll Xhol SacI EcoRI H in d lll
HoxaS/lacZ transgene
lacZ
Figure 1.1
Figure 1.1: Structure of the Hoxa5 hybrid gene. The schematic structure of
a 4.3kb Accl-Hindlll fragment of the Hoxa5 gene is shown at the top. The
Hoxa5 gene contains two exons separated by a 0.9kb intron. The
HoxaS/lacZ reporter transgene contains the 4.3kb HoxaS fragment with the
E. coli lacZ structural gene inserted immediately downstream of and in-
frame to the initiation codon of mouse Hoxa5 gene.
19
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
Figure 1.2: Whole-mount detection of (3-galactosidase activity in Hoxa5/lacZ
transgenic embryos. (A)The lateral view of an E12 embryo from line 22
reveals transgene expression in the branchial region of the spinal cord,
marked rostrally by the 4th cervical and caudally by the 2nd thoracic spinal
ganglia. (B) The lateral view of an E11.5 embryo from line 61. (C) The
lateral view of an E12 embryo from line 50 reveals transgene expression in
the craniofacial and neuronal elements.
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
20
21
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
Materials and Methods
Mouse Strains and tissue sources
Mouse embryos were obtained by mating hetertozygous transgenic
animals in a mix C57BL/6J x CBA/J hybrid genetic background. The day
that the virginal plug was found was designated as 0.5 day of gestation
(e0.5). For RNA isolation embryos younger than e13.5 were dissected into
the head portion at the level of forelimbs and the remaining into the trunk
portion. Embryos older than e13.5 and newborns were dissected frontally at
the level of the eye and excluding eyes to obtain the face and the remaining
for the brain fraction. For histology, embryos were fixed either in 10%
neutral formalin or in 4% paraformaldehyde in 1X PBS.
Mouse Tail DNA Extraction
Mouse tails of approximately 1 cm long were digested overnight at
55°C by proteinase K (Boehringer Mannheim) at a final concentration of 350
ng/ml in 50mM Tris-OH (pH 8.0), 100mM EDTA (pH 8.0), 0.5% SDS.
Genomic DNAs were purified by extracting once with phenol and once with
phenol/chloroform (1:1). DNAs were precipitated with one volume of 100%
ethanol at room temperature and were resuspended in 100 p .l TE (10mM
Tris, pH 7 .5 ,1mM EDTA, pH 8.0) at 65°C for 1 hour.
Southern Blot Analysis
DNAs were digested with appropriate restriction endonucleases
(Boehringer Mannheim, New England Biolab) and fractionated on 0.8%
22
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
agarose (Research Organics) gel. DNAs in the gel were denatured by
soaking twice for 30 minutes each in 1.5M NaCI, 0.5N NaOH and
neutralized by soaking twice for 30 minutes each in 1M Tris (pH7.4), 1.5M
NaCI. DNAs were then blotted onto either nitrocellulose (Schleicher &
Schuell) or Hybond (Amersham) membranes from a reservoir of 20X SSC
(1X SSC is 0.15 M NaCI/0.015 M sodium citrate, pH 7). DNAs were
immobilized onto the filter either by baking at 80°C for two hours or by UV
crosslinking in a Strataiinker (Strategene). Filters were prehybridized for at
least one hour at 68°C and hybridized for 16 hours at 68°C in 5X SSC, 0.5%
SDS, 5X Denhardt (0.1% bovine serum albumin, 0.1% Ficoll, 0.1%
polyvinylpyrrolidone), and 0.1 mg/ml sheared and denatured herring sperm
DNA with random-primed (Strategene) DNA probes at a concentrations of
approximately 2x106 cpm/ml. Filters were then washed to a final stringency
of 0.1 X SSC/0.1% SDS at 68°C and were exposed to either XAR-5 (Kodak)
or Hyperfilm-MP (Amersham) x-ray films with an intensifying screen at -
80°C.
RNA Isolation
RNAs from cultured cells, mouse whole embryos or microdissected
parts, and adult tissue were prepared by the method of Chomczynski and
Sacchi (Chomczynski and Sacchi, 1987). Briefly, approximately 100 mg of
tissue or 106 cells were homogenized with a Beckman polytron in 1 ml of
solution D (4M guanidinium thiocynate, 25 mM sodium citrate, pH 7.0, 0.5%
23
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
sarcosyl, and 0.1 M p-mercaptoethanol). The homogenate was then
extracted with 1.3 ml phenol/chloroform mixture (0.1 m l of 2 M sodium
acetate, pH 4, 1 ml of water saturated phenol, and 0.2 ml of
chloroform/isoamyl alcohol mix (49:1)). The homogenate was vigorously
mixed, cooled on ice for 15 minutes, and centrifuged at 10,000g for 20
minutes at 4°C. The RNA in the aqueous phase was precipitated with one
volume of isopropanol at -20°C for one hour. RNA was then pelleted for 20
minutes at 10,000g. This RNA pellet was re-dissolved in 0.3ml of solution D
and transferred to a micro-centrifuge tube. RNA was re-precipitated with
two volumes of 100% ethanol.
Polyadenylated RNA was selected on oligo-dT cellulose (type 2)
(Collaborative Research) columns. Oligo-dT cellulose was suspended in
0.05% SDS, 10mM EDTA and loaded onto a column (Isolab). The column
was washed with 10 column volumes 0.3 N NaOH, and was followed by
washes with water. Before loading RNA, the column was washed with 10
column volumes of binding buffer (0.5 M NaCI, 50 mM Tris 7.8, 10 mM
EDTA). The RNA sample was heated at 60°C for five minutes, cooled to
room temperature. The NaCI concentration of the RNA sample was
adjusted to 0.5 M, and the RNA sample was allowed to bind to the oligo-dT
matrix. The column was washed with seven column volumes of binding
buffer after RNA has entered the matrix. Poly (A)+ RNA was eluted with 1
24
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
column volume of H2 0 . Poly (A)+ RNA was subsequently precipitated with
2.5 volumes 100% ethanol and 0.3 M sodium acetate.
Northern Blot Analysis
5-10 pg of RNA sample was mixed with EtBr and was
electrophoresed on a 1.2% agarose gel containing 1.1% formaldehyde. At
the end of electrophoresis, the gel was soaked in 10X SSPE (100mM
NaP04 pH 7.4, 1.5M NaCI, 10mM EDTA) for 45 minutes. RNA was then
blotted onto Hybond (Amersham) nylon membrane by capillary transfer from
a reservoir of 20X SSPE. The 18S and 28S ribosomal RNA served as
molecular weight markers. Blots were hybridized to random-primed probes
either in QuickHyb (Stratagene, San Diego) at 65°C for one hour or in 50%
deionized formamide, 5X Denhardt, 5X SSPE, 1% SDS, and 0.1 mg/mi
sheared and denatured herring sperm DNA at 42°C for 16 hours. Filter was
washed to the final stringency of 0.1X SSC/0.1% SDS at 65°C.
Genomic cloning
To isolate mouse chromosomal DNA flanking the transgene, genomic
DNA from a mouse HoxaS/lacZ homozygote was digested to completion
with the Sac I restriction endonuclease (Boehringer Mannheim) and
electrophoresed through a 0.8% agarose gel. DNA fragments between the
size of approximately 4 to 6.5kb were electroeluted and used to construct a
genomic library in A.Gem2 (Promega). First screening was done using the
lacZ gene as a probe to identify clones that contained transgene
25
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
sequences. Hoxa5 Acc-Sacl and Sacl-Hindlll genomic fragments were
subsequently used to identify clones that contained flanking mouse genomic
sequences among clones that hybridized to the lacZ probe. A genomic
clone that contained an additional 1.3kb genomic sequences was identified.
This 1.3kb Pstl-Sacl genomic fragment was subcloned into pSP-73
(Promega). It detected a larger band on the southern blot that contained
DNAs from non-transgenic and transgenic mice and the larger band co
segregated only with transgenic animals.
To characterize an anonymous 10-kb band in the transgenic animal
that was shown to hybridize to lacZ, genomic DNA fragments between the
size of approximately 9 to 20kb were electroeluted and used to construct a
genomic library in X.Gem11 (Promega, Madison). This 10kb fragment was
capable of self-propagation when we attempted to subclone it. This 10-kb
band was shown to hybridize to pBR322 in addition to lacZ and HoxaS
sequences. Partial sequencing of this 10kb fragment revealed that it
contained a copy of the pUC8 vector.
To isolate genomic sequences corresponding to the pre-insertion
locus, a balb/c mouse genomic library (Invitrogene, San Diego) was
screened. Three overlapping clones were isolated. Restriction mapping of
these clones was performed by using combination of several restriction
endonucleases and southern blot hybridization.
26
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
Phage DNA Isolation
Phage DNA was purified by plate lysate method (Maniatis et al,
1988). Briefly, approximately 106 PFUs were plated out per 150 mm dish.
Agarose dishes were used for this purpose. Phage particles were eluted
with SM, concentrated by 20% (w/v) polyethylene glycol and 2M NaCI in
SM. Purified phage particles were lysed in the presence of 0.1% SDS, 5mM
EDTA. Phage DNA was purified by extraction once with phenol, once with
phenol/chloroform (1:1) and ethanol precipitation.
DNA sequencing
Double-stranded DNA sequencing was carried out by the dideoxy
chain-termination method (Sanger et al., 1977) using the Sequenase kit
(United States Biochemical). 2-3 jig of super-coiled plasmid DNA was
denatured in 0.4N NaOH for five minutes at room temperature. 10 ng of
specific primer was added to the denatured DNA template and ethanol
precipitated. DNA and primer pellet was dissolved in water and sequencing
buffer. Sequencing reaction was earned out according to manufacturer’s
recommendations.
p-Galactosidase expression analysis
Stage specific embryos were obtained by timed pregnancy. The day
that the virginal plug was observed was taken as embryonic day 0.5 (e0.5).
Embryos that were younger than e15.5 were fixed in 10% neutral formalin or
4% paraformaldehyde for 30 minutes at 4°C before staining. Older embryos
27
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
were sectioned saggitally with a razor blade before fixing. Embryos were
then washed three times with 1X phosphate-buffered-saline (PBS) (150mM
NaCI, 15mM sodium phosphate, pH 7.4) and incubated overnight at room
temperature in X-Gal staining solution (2mM MgCfe, 0.01% sodium
deoxycholate, 0.02% NP-40, 0.1% 4-chloro-5-bromo-3-indolyl p-
galactosidase(X-gal), 5mM potassium ferricyanide, 5mM potassium
ferrocynide in PBS) (Sanes et al., 1986). Stained embryos were post-fixed
in 10% neutral formalin or 4% paraformaldehyde. For sectioning, stained
embryos were either equilibrated in 30% sucrose in 4°C for at least 24 hours
before making blocks for crystat section or dehydrated through descending
graded alcohol and embedded in paraffin.
Newborns were sacrificed by CO 2 overdose and were immediately
frozen on the surface of liquid nitrogen and kept at -80°C before making
cryostat sections. X-Gal staining was performed according to the method of
Sanes etai, 1986.
RFLP mapping
Genomic DNAs from several inbred mouse strains were obtained
from the Jackson Laboratory (Bar Harbor, Maine). In order to identify
restriction fragment length polymorphism (RFLP), these ONAs were
digested separately with several restriction endonucleases and analyzed by
Southern blotting. Once a RFLP was found, genomic DNAs from
recombinant inbred mice were then obtained from the Jackson Laboratory
28
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
for southern blot analysis to identify strain distribution pattern of the RFLP.
Linkage was calculated according to the method of Silver and Buckler
(1986).
Generation of transgenic mice via microinjection
Fertilized eggs for microinjection were obtained from superovulated
four to five week old Fi(C57BL/6J x CBA/J) females which were plugged by
Fi(C57BL/6J x CBA/J) adult males. Pseudo-pregnant females for embryo
transfer were produced by mating Fi(C57BL/6J x CBA/J) adult females to
vasectomized Fi(C57BL/6J x CBA/J) adult males. Microinjection and
oviduct transfer of injected zygotes was performed as described (Hogan et
al., 1986). Usually, microinjection and oviduct transfers were performed
within the same day. The concentration of DNA used for injection varied
among different constructs, usually 1-3 pg/ml.
Generation of transgene constructs
To construct the doe/1.3-lacZ gene, a Xhol/Hindlll fragment of pCKT32-47
(Tuggle et al., 1990) was cloned into Sail and Hindlll sites of the
pBluescriptSK II' to generate pYHL1.3/lacZ. A 1.3kb Puvll/Sacl fragment,
which is located immediately 5' to the transgene insertion site, from p2.8,
was subcloned into Pvull/Sacl sites of pSP73 to create pA2. a 4.5kb
genomic fragment was then ligated in the correct orientation into the Sac I
site of pA2 to generate p4.5/2.8ps. A 5.1 kb fragment was liberated from
p4.5/2.8ps by performing EcoRV and Xhol double digestion. Xhol site was
29
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
blunt-ended. The 5.1 kb fragment was then ligated into Xhol site that has
been blunt-ended of pYHL1.3/lacZ to generate pdoe/1.3-lacZ. Two different
orientations of this construct were obtained. Before injection, the doe/1.3-
lacZ transgene was isolated free of vector sequences by performing Not I
and Kpn I double digestion.
30
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
RESULTS
In the course of studying Hoxa5 upstream regulatory elements,
Zakany et al. (1989) had produced six independent transgenic lines that
carried a HoxaS-lacZ fusion gene (Figure. 1.1). Four HoxaS/lacZ transgenic
lines, lines 22, 66, 78, and 80, expressed p-galactosidase in the C4-T2
region of the spinal cord between embryonic day 11 (E11) and day 13 (E13)
(Zakany et al., 1988). Tuggle et al. (1990) had carried this work further by
demonstrating that a region-specific enhancer element within a 604bp
Bglll/Xhol fragment was sufficient for recreating this expression pattern. It
was concluded that the C4-T2 expression pattern was an intrinsic property
of the HoxaS enhancer element. However, two transgenic lines,
HoxaS/lacZ-61 and HoxaS/lacZ-50 expressed the lacZ in entirely different
ways both spatially and temporally. Figure 1.2 compares lacZ expression
patterns of an e12 embryo from HoxaS/lacZ-22 with an embryo of similar
age from the HoxaS/lacZ -50 line and the HoxaS/lacZ-61 line.
Positional dependent expression of HoxaS/lacZ gene in HoxaS/lacZ-61
embryos during embryogenesis
Embryos of E10.5 to E14.5 were analyzed by whole mount staining
for [3-galactosidase activity. Expression of the Hoxa5AacZ transgene was
first detected only in a group of mesenchymal cells in the region of fourth
branchial arch in e10.5 embryos (Figure 1.3A). By E11.5, strong blue
staining was seen in the ventral third of the mandibular, second, and third
31
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
Figure 1.3: Expression profile of HoxaS/lacZ transgene in Hoxa5/7acZ-61
embryos. (A) (3-galactosidase activity is first detected in E10.5 embryo in a
spot of the trunk dorsal lateral to the atrium of the heart (arrowhead). (B)
Blue staining in E11.5 embryo is localized to the ventral tip of the second (*)
and third branchial arches (<) in addition to two focal staining in the trunk
anterior and posterior to the forearm (arrow). (C) Ventral view of an E11.5
embryo. Staining is uniformly strong across the second branchial arch (*).
(D) Lateral view of an E13.5 embryo, p-galactosidase staining is localized
to the lower jaw, the neck, corner of the mouth, and posterior region of the
forearm. Staining in the trunk anterior and posterior of the forelimb
persisted. (E) Staining in the lower jaw, the neck and posterior forearm still
persisted in an E14.5 embryo. (F) Staining in the lower jaw and posterior
region of the forelimb is detected in an E15.5 embryo.
32
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
Figure 1.3
33
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
branchial arches. Staining was also detected caudal to the forelimb in
addition to expression of the lacZ gene in a group of cells rostrally (Figure
1.3B, C). In E13.5 day embryos, blue staining was confined beneath the
chin and caudal to the forelimb (Figure 1.3D). A streak of blue cells was
detected in the proximal posterior surface of the developing forearm (Figure
1.3D). This staining pattern was maintained in E14.5 (Figure 1.3E) and
E15.5 (Figure 1.3F) embryos although the staining in the lower jaw became
very intense.
Discussion
The cells in branchial arches, especially the vental halves of the
second and third arches, which were marked by p-galatosidase activity in
Hoxa5/lacZ-61 embryos, are known to contribute to the formation of hyoid
bones in the neck as well as musculature in the face and the neck. The
staining pattern in line 61 embryos is consistent with the classical fate map.
Since we do not know the nature and the regulation of the gene(s) that
confers this position-dependent expression pattern, we do not know for sure
the lineage relationships among these expressing cells. Nevertheless, the
expression pattern suggests the existence of novel regulatory genetic
elements that can specifically restrict gene expression in a spatial and
temporal manner in the branchial arches during embryonic development.
This also provides evidence for a genetic basis of functional partitioning
within a branchial arch. Understanding the nature of the gene products
34
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
involved may provide important insights to the patterning of the face and the
neck.
Interestingly, however, insertion of the transgene in this instance
does not affect viability or causes any observable morphological alterations
to either heterozygous or homozygous animals (data not shown). This
suggests that the affected locus is not essential for the normal development,
or another gene(s) can functionally complement the mutant locus. The
identification and isolation of this gene will allow for further analysis of this
issue.
Characterization of recessive mutant transgenic line HoxaS/lacZ-50
Expression Pattern in Central Nervous System
The first expression of |3-galatosidase in the CNS was in two focal
areas of the anterior cerebral vesicles (telencephalon) as well as focal
staining of the mesencephalon, rhombencephalon and neural tube in E10.5
embryos (Figure 1.4A). There was focal staining of the anterior
telencephalon, mesencephalon and rhombencephalon, as well as the
hippocampal formation and the gray matter of the spinal cord by E12
(Figure 1.4C). In addition to staining in the brain and the spinal cord, spinal
ganglia started to express p-galactosidase protein at E14.4 (Figure 1.4F).
By the time of birth, there was diffuse staining of olfactory lobes, cerebral
cortex, hippocampi, colliculi, deep cerebral nuclei, and gray matter regions
of brain stem cerebellum, spinal cord, and dorsal root ganglia (Figure 1.41).
35
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
By one week, staining was absent in a large portion of the thalamus (data
not shown). By one month, the staining remained strong in cortex,
hippocampus, and coiliculi; focal staining in the ventral brain was limited to
pontine nuclei, mamillary nuclei and hypothalamic nuclei (data not shown).
Weak staining was present in the ventral pons and in the dorsal medulla
and floor of the fourth ventricle. The staining of cerebellum and the olfactory
lobes was lost by one month of age (data not shown). The pattern of
expression in the CNS in adults (older than two months) was established
and remained the same until one year of age. At this stage, the pattern was
the same as at one month; however the intensity of staining was decreased.
The adult expression pattern in the cortex and hippocampus was
examined in detail by analysis of cryostat sections of the brain,
p-galactosidase activity was present in subsets of neurons in both cerebral
cortex and hippocampus (Figure 1.5B). Within the hippocampus, the
neurons of the dentate gyrus were intensely stained. In the pyramidal cell
layer, most neurons of CA4 and CA2 were positive; however only rare
neurons in CA3 and CA1 regions were stained. In the cerebral cortex, most
neurons were positive with the greatest density of positive neurons in the
lower layer of cortex. The number of positive neurons appeared to be
reduced in posterior parietal and inferior frontal regions. The arachnoid,
ependyma and choroid plexus were negative in all sections.
36
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
Figure 1.4: Expression pattern of lacZ gene in Hoxa5/lacZ-50 embryos. (A)
The expression of p-galactosidase is first detected in E10.5 embryos. In
the CNS, staining is found in two focal areas of the anterior cerebral
vesicles (tel) as well as focal staining of the mesencephalon (mes),
rhombencephalon (hb) and neural tube. Strong staining is also detected in
the ffontalnasal prominence (arrow) and in a triangular patch above the eye
(arrowhead), p-galactosidase is also expressed in 8 somites caudal to the
forelimb buds. Staining is found in the gut as well. (B) Lateral view of an
E11.5 embryo. Blue staining for p-galactosidase is diffusely localized in two
focal patches in the telencephalon and in the wall of mesencephalon.
Dense staining is detected in the midbrain and hindbrain junction (arrow),
where future cerebellum is located, and in the spinal cord. In the facial
region, strong staining is localized in the nasal prominance, maxillary
processes, and in the mandibular arch. Focal staining is also detected in
the mesenchyme anterior to the lens vesicle. In the trunk region, staining in
six somites caudal to the forelimb remains. A structure corresponding to
stomach is also densely stained. (C) In E12.5 embryo, p-galactosidase
activity in the telencephaiic vesicle continues to be confined within a band of
neuroepithelium. Staining in the midbrain now covers the entire structure
and forms a sharp boundary at the forebrain-midbrain junction. Diffuse
staining is detected in the entire hindbrain and throughout the spinal cord.
37
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
Staining is also detected in the diencephalon in the hippocampal formation.
In the facial region, diffuse staining cover entire face. The strongest staining
is found in the future eyelids, in the nasal mesenchyme, and around
vibrasea follicles. lacZ expression begins to appear in dorsal posterior
region of fore- and hindlimbs and kidney (arrow) as well. (D) Lateral view of
an E13.5 embryo. Expression in CNS and face shows no alteration from
previous embryonic stage. The otic vesicle (arrow) is now outlined
noticeably by p-galactosidase staining. Staining in the limbs extends further
into digits. The cartilageous ribs (arrow) show distinct blue staining. (E)
Ventral view of an E14.5 embryo. Conspicuous blue staining outlines the
olfactory lobes (arrows) in the forebrain and digits of the limbs. (F) Dorsal
view of the same E14.5 embryo in F. In addition to lacZ expression in the
brain and spinal cord, the first appearance of p-galactosidase staining in
spinal ganglia is detected at this stage although spinal ganglia (arrows)
were well established between E10.5 and E11 of gestation. (G) Ventral
view of an E15.5 embryo. Strong staining continues to be detected in the
eyelids, the nose, and the mesenchyme surrounding four rows of vibrasea.
The fifth digit of the forelimbs and the first and the fifth digits of the hindlimbs
show strong p-galactosidase staining. The genitalia (arrow) which is
partially covered by the tail also shows strong staining. (H) Lateral view of
the same E15.5 embryo in G. Diffuse staining is detected in the brain, in the
spinal cord, in the facial musculature, the pinna (white arrow), and the
38
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
submaxillary glands (black arrow). (I) Midsagittal section of a newborn
mouse. Diffuse staining is located in the olfactory lobe, cerebral cortex,
hippocampi, colliculi, cerebral cortex, cerebellum, spinal cord, spinal ganglia
and ribs (arrow). In addition, strong p-galactosidase staining covers entire
nasal cavity including cartilages of nasal septum.
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
39
40
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
Expression Pattern in Facial Structures
The first expression of p-galactosidase in the facial region was in
E10.5 transgenic embryos in the frontalnasal prominence and in a triangular
patch above the eye (Figure 1.4A). By day 12, eyelids and upper jaw were
strongly stained in addition (Figure 1.4C). A parasaggital section through
the eye of a E13.5 embryo clearly showed staining of mesenchymal cells
located in the presumptive eyelids (Figure 1.4J). The pinna was stained by
day 13 (Figure 1.4D). By E15, and continuing to birth, the staining became
progressively restricted to a thin ring about both eyes, linear streaks
outlining the vibrasae hair follicles, focal staining of the palate of the upper
jaw and diffuse staining of the nose and the cartilage of nasal septum
(Figure 1.4G; Figure 1.4H). Strong p-galatosidase activity still remained in
the cartilage of nasal septum in one-week old pups (data not shown).
Expression Pattern Outside of Face and CNS
E10.5 embryos showed staining of eight somites caudal to the
forelimbs (Figure 1.4A). A structure dorsalateral to the liver, the stomach,
was stained (Figure 1.4A). By day 12, focal staining in the posterior
proximal region of developing limbs was seen as well as the kidneys (Figure
1.4C). By day 13, the limb staining was localized to small fingers, the small
and large toes, and the boundary of the digits (Figure 1.4D). By this time
there was also focal staining of ribs and it was also stained in newborns
(Figure 1.4D, 1.41). By day 15, genitalia began to show p-galatosidase
41
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
activity (Figure 1.4G). Diffused weak staining was observed in the
submaxillary gland of newborn animals (Figure 1.41).
Expression Pattern in Adult Tissues
Frozen sections of eyes, lungs, heart, kidney, intestine were stained
with X-gal for p-galactosidase activity. Expression in the retina seems to
become highly restricted in adults since at the newborn stage staining is
seen in the entire ganglion layer of the retina (Figure 1.5A). X-gal staining
was limited to a subset of ganglion cells in the ganglion cell layer in adult
neural retina (data not shown). Diffuse staining in the kidney is found in the
tubules (Figure 1.5C). In the lungs, staining is observed in very specific
lung epithelial cells, presumably neural endocrine cells (Figure 1.5D). In the
stomach, p-galatosidase activity is also detected (data not shown).
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
Figure 1.5: p-galactosidase staining pattern from newborn to adult in
Hoxa5/lacZ-50 transgenic mice. (A) Parasaggital section through the eye of
a newborn line 50 transgenic mouse, p-galactosidase staining is detected
in the ganglia layer of neural retina and mesodermal tissue in the eyelid. (B)
Cryostat cross-section of the brain of a 4 week old transgenic mouse,
p-galactosidase expressing cells are scattered in the neocortex and
hippocampus. Within the hippocampus, the neurons of the dentate gyrus
were intensely stained. In the pyramidal cell layer, most neurons of CA1,
CA2, and CA3 were positive. (C) Frozen section of a kidney from a two
mouth old transgenic mouse, p-galactosidase activity is detected only in
cells of convoluted tubules but is absent from glomeruli and collecting ducts.
(D) Frozen section of the lung of the same adult mouse as in (C). Very few
cells showed detectable level of p-galactosidase staining. (E) Frozen
section of the small intestine from the same adult mouse as in (C). Only a
few cells along the outer wall of the intestine stained blue. DG, dentate
gyrus; nc, neocortex; nr, retina; gr, ganglion layer of neural retina; PE,
pigmented epithelium; I, lens; el, eyelid; t, convoluted tubule; g, glomeruli;
CT, collecting duct.
43
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
Figure 1.5
44
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
Genetic characterization of HoxaS/lacZSO
The intriguing lacZ expression pattern in the CNS and craniofacial
region in embryos of Hoxa5/lacZ~50 led us to examine Hoxa5/lacZ-50 mice
for possible physical abnormalities and to correlate these abnormalities to
the inheritance of the transgene. Heterozygous transgenic animals for were
crossed. Newborns were examined for any obvious physical malformation.
Approximately one quarter (22.4%) of newborns were seen to have open
eyelids (Figure 1.6A, 1.6B) although pups normally open their eyelids two
weeks after birth (Figure 1.6C, 1.6D). Figure 1.6B shows a section through
the eye of a newborn whose upper and lower eyelids failed to fuse together.
The opening of eyelids displays various degrees of penetrance ranging from
a size of a pinhole to a wide gap, and some mutants were affected
unilaterally. All newborns that displayed open eyelid phenotype (45 out of
201) died within one or two days after birth. Southern blot and dot blot
analysis indicated that these affected newborns were homozygous for the
transgene. This was done by probing blots with lacZ and by quantitating
lacZ hybridization signals against hybridization signals produced by 28S
rRNA cDNA probe. This result was later confirmed by detecting RLFP using
cloned genomic probes. Figure 1.7 shows a Southern blot of tail DNAs from
a newborn litter. Homozygotes carry an allele that migrated slower on an
agarose gel as a result of transgene insertion. Table 1.1 summarizes data
collected from hemizygous matings. The tight cosegragation of open eyelid,
45
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
Figure 1.6: Homozygous mutants displayed open eyelid phenotype. (A)
Lateral view of a homozygous newborn mouse. The eyeball is exposed
because of the complete absence of the eyelid. (B) Frontal section across
the eye of a homozygous newborn. The upper and the lower eyelids failed to
fuse with each other leaving a wide gap. (C) Lateral view of a heterozygous
newborn littermate. The eye is completely covered by the eyelid. (D) Frontal
section across the eye of a normal newborn. The upper and the lower
eyelids fused together and formed a tight junction between ectoderm.
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
46
Figure 1.6
47
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
Table 1.1
Correlation of genotype to phenotypee among line 50 newborns
# of newborns and their genotype and phenotypes
doe/doe doe/+ +/+
type of mating open-eye death normal normal
doe/+ x d o e /-» - 45 105 51
doe/+ x +/+ 0 32 29
Table 1.1: Correlation of genotype to phenotype. All HoxaS/lacZ-50
newborns which showed open eyelid and death phenotypes were
homozygous for the transgene. The Mendlian pattern of inheritance of the
mutation and the transgene indicated a genetic etiology for the mutant
phenotypes.
48
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
death and homozygosity clearly indicated that we have obtained a recessive
mutant line. The insertion of the transgene was therefore responsible for the
phenotypes that we have observed. We tentatively named this affected
locus doe.
Phenotypic characterization
The scoring for homozygotes was facilitated by the open eyelid
phenotype. Figure 1.6B shows a frontal section through the eye of a
homozygous mutant neonate. It is likely that the mesenchyme of the upper
and the lower eyelids failed to extend far enough thus preventing the fusion
of epithelium although the lens and the cornea were not affected. In
contrast, in the normal mouse the eyelid mesenchyme advanced just
enough allowing the ectoderm to form a tight seal between the upper and
the lower eyelid (Figure 1.6D).
Since a defect in eyelid closure cannot possibly account for the lethal
phenotype in homozygotes, we examined newborns for feeding abnormality
and pulmonary dysfunction. Initially, we have observed that open eye
mutants did not show any sign of feeding because their stomach did not
contain milk. We therefore tested mutants for possible defects that may
cause feeding problems. We examined mutants for the presence of cleft
palates. None of those mutants showed any defect in the palates. We next
tested to see if there is any obstruction in the esophagus leading to the
stomach. We fed mutants with water that contains blue dye. We found that
49
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
the dye entered into stomach without obstruction. However, these mutants
were never found attached to the nippies of the mother for feeding. We
therefore suspected that the lethal phenotype might be due to subtle
changes resulting in physiologic dysfunction, perhaps abnormalities in
sucking behavior. All brain structures that we have examined showed no
obvious gross morphological alterations when compared with brain sections
from non-transgenic mice. Kidney and liver had normal histo-appearance.
Cloning of the doe locus
Isolation of mouse genomic ONA flanking the insertion site
To analyze the nature of the mutation at the doe locus, we cloned the
genomic sequences flanking the transgene. In the first attempt, mutant
mouse genomic DNA was cut to completion with EcoR I and made phage
libraries in Xgt10. Approximately 10® plaques were screened with lacZ
gene as the probe. Only one positive clone (clone #3-4-1) was isolated and
this clone was shown to hybridize to the 5' Xhol-Sacl fragment of Hoxa5 but
not to the 3' Sacl-Hindlll fragment of Hoxa5. A 4kb EcoRI fragment from 3-
4-1 was subcloned in pSP73. This fragment was shown to hybridize to
mutant genomic DNA on a Southern blot Sequencing of the 5’ end
produced only 14bp of unknown sequence in addition to intact Hoxa5
sequences. This clone was soon determined to contain the polylinker
sequence of pUC8 bacterial cloning vector that was used to construct the
HoxaS/lacZ transgene.
50
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
A second genomic library was constructed by taking advantage of the
Sac I site which is present in the transgene as an unique restriction site.
Southern analysis of HoxaS/lacZ -50 genomic DNA identified a 4.8kb and a
5.3kb Sacl genomic bands that represent junction fragments to the left and
the right site of transgene insertion, respectively (Figure 1.7). Densitometric
analysis of bands on the Southern blot suggested that four copies of the
transgene was present together with one copy of pUC vector (Figure 1.7) in
a head-to-tail array.
Therefore, genomic DNA from a homozygous newborn was digested
to completion with Sacl. Genomic DNA fragments between 4.3 and 6.6kb,
where DNA fragments that corresponded to the left and right junctions of the
insertion site banded, was eletroeluted to construct a genomic library in
XGem2 vector. A total of 3.85 x 10^ PFUs was screened with the lacZ
probe. Four positive clones were isolated, clones #2-1-1,4-1-3,14-1-1, and
15-1-2. Clones 2-1-1 and 4-1-3 were shown to hybridize to the 3’ EcoRI-
Hindlll fragment of Hoxa5, and clones 14-1-1 and 15-1-2 hybridized strongly
to the 5’ Accl-Xhol fragment of Hoxa5. These results suggested to us that
clones 14-1-1 and 15-1-2 contained mouse genomic DNA from one side of
the insertion site and that clones 2-1-1 and 4-1-3 contained mouse
sequences from the other side of the insertion site. A 1.5kb mouse
genomic DNA fragment was identified in clones 2-1-1 and 4-1-3. This 1.5kb
genomic fragment contained repetitive sequence because it consistently
51
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
Figure 1.7: Southern blot detection of transgenic animals. Tail genomic
DNAs were digested with Sacl restriction endonuclease and were
fractionated on a 0.8% agarose gel. The blot was probed with a 1.3 kb
Sacl-Pstl fragment isolated from 5' side of the integration site. Lanes 1, 2
and 3 contained genomic DNA isolated from newborn with open eyelid
phenotype. Lanes 4 to 8 contained genomic DNA isolated from newborns
that did not show any abnormal phenotype. Insertion of the transgene
caused mobility shift of a 2.8 kb Sacl fragment in trangenic genomic DNAs
which could be identified by using this probe. Lanes 1 to 3 were thus
identified as DNAs from homozygous mutants. Lanes 4 and 8 contained
DNAs from nontransgenic littermates. DNAs in lanes 5 to 7 came from
heterozygotes newborns.
52
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
1 2 3 4 5 6 7 8
Figure 1.7
53
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
produced smeared bands on genomic Southern blots. A 1.3kb Sacl-Pstl
genomic fragment was isolated from 15-1-2 and subcloned into pSP73.
When this 1.3kb genomic fragment was hybridized to a Southern blot of
Sacl digested genomic DNA from non-transgenic, heterozygous and
homozygous transgenic mice, it detected a unique 2.8kb band in both DNA
samples from the normal and the heterozygous animals (Figure 1.8). It also
detected a novel 4.8kb band in the heterozygous and the homozygous
mice. The 2.8kb was absent in the homozygotes indicating that the
transgene has inserted into this 2.8kb fragment.
Cloning of pre-insertion locus
To isolate genomic DNA from pre-insertion locus, we used this 1.3kb
fragment to screen an EMBL-3 SP6/7 genomic library prepared from a non-
transgenic balb/c mouse to obtain the pre-insertion genomic sequences of
doe locus. We identified and isolated 5 positive clones, #3-1.1.3, 5-1.3.3,
13-1.1.1, 16-1.2.1, and 16-2.2.1, out of about 10® PFUs. Restriction
mapping of these phage clones allowed us to line up 5-1.3.3, 16-1.2.1, and
16-2.2.1. Clones 3-1.1.3 and 13-1.1.1 were products of ligation artifacts.
The three overlapping clones spanned approximately 22kb (Figure 1.9).
Characterization of the integration site
Since microinjected DNA frequently causes DNA deletion and
chromosome rearrangement we decided to rule out this potential
complication for subsequent important experiment of identifying
54
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
Figure 1.8: Four copies of Hox a5/lacZ transgene integrated together in
tandem. Genomic DNA from a homozygous line 50 tail DNA was cleaved
with Sacl restriction endonuclease. The resulting southern blot was
hybridized to lacZ probe. The lacZ probe detected four bands and the size of
three of these bands were as predicted. The band marked with a single
asterisk (* ) corresponds to the 5‘ of the integration. ** corresponds to the 3'
of the integrant. *** marks the unit length resulted from cleavage of head-to-
tail tandem repeat. The small open circle (o) marks an anonymous band
whose existence was a puzzle and was subsquently determined to be a
product of vector cointegration. To the left of the blot is the densitometric
profile for each band on the blot. M, Hindlll digested lambda DNA size
marker.
55
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
Figure 1.8
56
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
Figure 1.9: Restriction map of the doe locus preinsertion. Three
overlapping geomic phage clones (5-1.3.3, 16-1.2.1, and 16-2.2.1) were
identified that spans approximately 22kb.
57
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
03-
03-
03-
S J -
0 » -
B H
«i
< & 3
58
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
transcriptional unit for this locus. We approached these questions in the
following way. We sequenced the integration junctions in the mutant locus
and corresponding region in the subcloned normal mouse DNA. Sequences
revealed that the transgene had inserted directly into a 2.8kb Sacl fragment
without causing any base deletion to the mouse DNA although the
transgene lost five base pairs— two from the 5' side and three from the 3'
side of the transgene array (Figure 1.10). This 2.8kb Sacl fragment was
responsible for the RFLP that we have been observing in Hoxa5/lacZ-50
transgenic animals when we probed genomic Southern blots with the 1.3kb
Sacl-Pstl fragment.
A pUC vector co-intergrated with the transgene
It was frequently observed that transgene can insert into
chromosome with a complicated pattern of arrangement. It is not
uncommon to observe that fragments of genomic DNA from unknown
location on other mouse chromosomes accompanies the transgene in its
integration (Covarrubias et a!., 1986; Wilkie and Palmiter, 1987). Such an
integration event makes interpretation of observed mouse phenotype more
difficult. This complication was also observed in Hoxa5/lacZ-50 genome.
On the Southern blot with transgenic genomic DNA, an anonymous band of
approximately 12kb in size was detected (Figure 1.8). This anonymous
band could not be explained unless we postulate that either unknown pieces
of DNA originated from the host or carried with the transgene co-integrated
59
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
with the Hoxa5/lacZ transgene. In order to address these possibilities, I
constructed another genomic phage library. Size selected, Sacl digested
mutant genomic DNA was cloned into XGem11. Out of 5 x 10^ PFUs
screened, only one lacZ positive clone was isolated. This phage clone, 1-1-
4-a, contained a 12kb insert. This 12kb insert was shown to only hybridize
to the endogenous Hoxa5 gene of the non-transgenic mouse DNA (data not
shown). It was also shown to hybridize to the transgene. Furthermore,
when we attempted to subclone this 12kb fragment, it could survive
ampicillin selection without ligating to a (3-lactamase containing vector,
indicating that a vector-like sequence was present in this fragment. We did
a partial sequence of this 12kb fragment using Hoxa5 primers. Sequence
from this 12kb fragment matched perfectly to pUC8 polylinker and vector
sequences. The sequence also matched the sequence of the phage clone
that we obtained in the first attempt to isolate the junction fragments.
Therefore, we have demonstrated that no host DNA was involved in co-
integration.
The transgene inserted into mouse chromosome as a single tandem
array
Although genetic data suggested to us that the transgene had inserted
into a single chromosome, it did not rule out the possibility that multiple
insertion occurred within a small region of the chromosome, such that
recombination frequency during meiosis would be extremely low to allow for
60
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
BEFOREINSERTION
S IT * O W T M IH S B B XXUKTXO M
▼
OCCCCACCTTCACCAQCTQACTA CTAQCAOOAACACAQTOQCAC CC
cqgggtggaa{ itgqtcqacxqat OATCGTccTTQTQTCACCGTaGG
do* B X Q O t t K X B
AFTER INSERTION
*
tc
GCCCCACCTTCACCAGCTGACTA gacgagct gaggttca CTAGCAQQAACACAOTOOCACCC
CGGGGTOGAAG*GGTCQACTGAT ctgctcga ctccaagt GATCGTCCTTQTGTCACCGTGGG
e g a
♦
n -
Hax a5 /la c Z fcranagen*
Figure 1.10
Figure 1.10: Sequence comparison between pre- and post-insertion.
Sequence comparison indicated that the transgene had inserted directly into
the current position without causing any damage to the surrounding host
DNA sequences although the transgene lost five base pairs.
61
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
Figure 1.11: The transgene array inserted into mouse chromosome as a
single tandem array. Genomic DNAs from homozygotes (doe/doe),
heterozygotes (doe/+), and nontransgenic (+/+) mice were digested with Styl
which cleaves on both sides of the insertion without affecting the transgene
array and electrophoresed through a 0.5% agarose gel. The resulting blots
were hybrized to lacZ probe, p1.3 probe, and pBR322. All these three
probes detected a common band in lanes that contained DNAs from
transgenic mice, indicating the existance of a single insertion event.
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
62
M + / + - d o e H - doe/rtw + / + + / + j^ e /d o e
#fe
- - i-
■V.
• '■ -PJ-’.i''
» .. ' ■ • • ■ « •
• • • * • • ’ - ...'K'
Probe:
pl.3
lac I p lR 322
Figure 1.11
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
segregation. To determine this, we selected a restriction site that did not cut
within the transgene array but was known to cut within the 2.8kb Sacl
fragment so that the transgene array would be released as a single fragment.
We restriction digested genomic DNA from non-transgenic and transgenic
mice and probed the Southern blot with 1.3kb Sacl-Pstl fragment as well as
the lacZ gene. Both probes detected only one band on the Southern blots,
indicating a single insertion site (Figure 1.11). Figure 1.12 depicts the
chromosome map of the doe locus before and after insertion.
Chromosome localization of the doe locus
In order to determine possible allelism to a gene already mapped, we
determined chromosome location of the doe locus. To map the doe locus to
a mouse chromosome, we searched for restriction fragment length
polymorphism (RFLP) associated with this locus. Genomic DNAs from
different inbred mouse strains were digested with EcoRI, Hindlll, Pstl, Mspl,
Taql, and BamHI. Southern blots were probed with genomic probes
generated from the doe locus. A 12kb and an alternative smaller 7.3kb
band were detected when a 4.8kb Sacl (4.8") genomic fragment from doe
locus was hybridized to a panel of BamHi digested genomic DNA from six
inbred mouse strains (AKR/J, C3H/HeJ, C57BL/6J, C57L/J, DBA/2J, SLJ/J).
The 7.3kb BamHi band was inherited only by C57BL/6J strain (Figure 1.13).
We then typed the inheritance of these polymorphic bands in 38
recombinant inbred strains of mice. Comparison of the strain distribution
64
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
NOTE TO USERS
Page(s) not included in the original manuscript
are unavailable from the author or university. The
manuscript was microfilmed as received.
65
This reproduction is the best copy available.
u m t
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
Before integration
Alter integration
site of Insertion
mouse DMA
Ho* o5 /lacZ transgene
pUCS vector sequences
Figure 1.12
Figure 1.12: Restriction map of the doe locus before the insertion and after
the insertion by the HoxaS/lacZ transgene.
66
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
*- *
*
Figure 1.13
Figure 1.13: A RFLP is associated with the doe locus. Genomic DNAs from
six inbred strains of mice were digested with BamHi and electrophoresed
through a 0.8% agarose gel. The DNA blot was hybridized to a 4.8 kb Sacl
fragment (4.8"). This probe detected a 12 kb band in lanes that contained
DNAs from five inbred strains of mice. Only C57BL/6J carries a variant 7.3
kb band.
67
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
Table 1.2: Strain distribution pattern of DNA polymorphism in recombinant
inbred (Rl) strain sets. Genomic DNAs from 26 BxD (C57BL/6J x DBA/2J),
12 BxH (C57BL/6J x C3H/HeJ), and 2 BxJ (C57BL/6J x SJL/J) recombinant
inbred strains were digested by BamHi. Southern blots were hybridized to
4.8" probe. The current RFLP distribution pattern was compared with RFLP
pattern obtained with other known DNA markers. A perfect concordance
was found between 4.8" probe and an anonymous DNA marker, D12Nyu2,
on the proximal arm of the mouse chromosome 12. This indicated that doe
is closely linked to D12Nyu2 on mouse chromosome 12.
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
68
Table 1.2
B x D strains
Locus
1 2 5 ft ft ft 11 12 1ft 11 15 1ft 1ft
doe B D B B B D B D D B B B B
D12Nyu2 B D B B B D B 0 D B B B B
11 2ft
21 22 22 21 2ft 2Z 2ft 2ft 3ft 31 32
doe B D D D D 0 B D B B B B D
D12Nyu2 B -
•
D 0 D B D B B B B 0
B x H strains
Locus
2 2 1 ft Z ft ft 1ft u 12 11 1ft
doe B B B H H B H B H B H H
D12Nyu2 B B B H H B H B H B H H
B x J strains
Locus
1 2
doe J B
0
1
J B
69
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
Figure 1.14: Linkage map of the proximal region of the mouse chromosome
12 (Davisson and Roderick, 1990). To the (eft of the linkage map,
approximate distance in centimorgan (cM) measured from the centromere is
indicated. To the right side of the linkage map, names of mapped loci are
placed at their respective locations
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
70
8.00
1 2
8 .0 0
8.20
8.40
8.90
8.60
8.70
8.80
9.00
9.10
9.20
9.30
9.40
9.90
9.60
9.70
9.80
9.90
012Ertdl29e
012J3
D12Nyul9
Pgkl-rs7
RpsiS-rs8
T(9;12)31H
«bad9J17
cpk
D12Lehl
Di2ficCal
01 2Nyu2 d o e
Lpinl
012Ertd604e
M s9
Rpl36a-rs7
Figure 1.14
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
Searching for transcript(s)
To identify transcript(s) encoded by doe, we approached this in four
different ways. These approaches were based on the premise that the
transgene has integrated into doe gene and functionally inactivated it either
at the level of transcription or at the level of translation.
Screening of mouse embryonic cDNA library.
Soon after we have isolated the 1.3kb Sacl-Pstl genomic fragment
from the mutant mouse genomic library, we used this probe to screen an
e12.5 brain cDNA library (Rubin et al., 1986). A total of 3 x 105 PFUs were
screened without identifying any positive clones. Further screening of
approximately ten million PFUs of e12.5 brain cDNA library with a mixture of
genomic DNA probes did not yield any positive clones.
Zooblot to determine the existence of possible exons
The third approach that we took was to detect cross-hybridization
with genomic DNAs from other species. The rationale for doing this is
based on the fact that nucleic acid sequences of protein coding regions that
are essential for protein function are generally conserved among different
species. Cross-hybridization of genomic sequences will indicate the
existence of possible exons. W e chose human, rabbit, and hamster DNA
for this purpose. The hybridizations were earned out at 40°C in
hybridization solution that contains 43% formamide (McGinnis et al., 1984).
72
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
Blots were washed in low (2X SSC/0.1% SDS, 50°C), moderate (0.5X
SSC/0.1% SDS, 68°C), and high (0.1X SSC/0.1% SDS, 68°C) stringency.
No hybridization to human DNA was observed with either moderate or high
stringent washes although cross hybridization to hamster DNA was
observed with a 700bp Sacl fragment (Figure 1.15). Sequence analysis of
this 700bp fragment did not produce any meaningful exon predictions. In
addition, probes generated from this 0.7kb Sacl fragment did not show to
hybridize to any embryonic as well as newborn Poly-A+ RNA, indicating to
us a low probability that an exon exist. Random stretches of several
genomic fragments were sequenced and searched for possible open
reading frames. None was found.
Reverse Northern using reversely transcribed cDNA probes
The fourth approach that we took was to hybridize radiolabeled
cDNAs to lambda genomic clones. The approach was based on the
assumption that the genomic clones may contain exon sequences, and that
transcription of doe gene in the mutants was either down regulated or
suppressed. I synthesized cDNA probes from poly A+ RNA that was
isolated from the brain of the mutant and non-transgenic mice and
hybridized to cloned genomic DNAs. I did not observe any difference in
hybridization pattern between mutant and normal cDNAs although several
bands hybridized intensely with random and oligo-dT primed cDNAs (Figure
1.16). The hybridization to cloned genomic DNA may be due to the
73
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
presence of repetitive sequences in these genomic fragments. Also, the
sensitivity of this approach is also questionable because only moderately
abundant transcripts, such as p-actin, were detected but not rare transcripts
such as c-myc by this method.
Northern blot of embryonic RNAs
Subsequently, we approached this by performing Northern blot
hybridization. We isolated mRNAffom the heads of days 9,10,11,12, and
14 embryos, and from the brain and face of day 15 embryos and newborns.
The reason for selecting brain and face as the sources for mRNA is
because that the transgene is expressed strongly in these structures. We
have used unique probes spanning most of the 22kb genomic DNA for
hybridization. For positive control, we used mouse Msx2 as a probe. Msx2
is a mouse homolog of Drosophilamsh-Uke homeobox gene that is
expressed in the facial region and choroid plexus in the brain during mouse
embryogenesis. All hybridizations were carried out under stringent
conditions. No specific hybridization was observed with any genomic
probes from the doe locus although Msx2 hybridized very well to all mRNAs
on the blots (Figure 1.17).
74
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
Figure 1.15: Zooblot. (A) Genomic DNAs isolated from the mouse, rabbit,
and human tissues, and a hamster cell line were cleaved with either EcoRI
or Hindlll. The resulting DNA blot was hybridized to the 0.7kb probe. This
0.7kb fragment hybridized strongly to the mouse DNA and weakly to the
hamster DNA as expected. No cross hybridizing signal was detected in
lanes that contained rabbit and human genomic DNA. (B) The same blot
was stripped and probed with mouse c-jun cDNA probe. Unique cross-
hybridizing bands were detected in all lanes. Mo, mouse; Ha, hamster; Ra,
rabbit; Hu, human.
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
75
EcoRI Hindlll
Mo Ha Ra Hu Mo Ha Ra Hu
B
EcoRI Hindlll
Mo HaRaHu Mo Ha Ra Hu
■ S & -
Figure 1.15
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
Figure 1.16: Reverse northern. Phage DNAs were cleaved to completion
with BamHi and fractionated on a 0.8% agarose gel. (A) Lanes 1 to 6
contained DNA from phage clones #3, #8-1, #12, #9-2, #5-1.3.3, and #16-
2.2.1, respectively. Lane 7 contained c-myc plasmid DNA, and lane 8
contained a cDNA fragment of chicken p-actin. The blot was hybridized to
reversely transcribed mixture of random primed and oligo-dT primed
radioactive cDNA using brain mRNA from nontransgenic newoborns as
templates. (B) Lanes 1 to 6 contained DNA from phage clones #3, #8-1,
#12, #9-2, #5-1.3.3, and #16-2.2.1, respectively. Lane 7 to 11 contained
DNA fragments of lacZ gene, 1.3kb Sacl-Pstl fragment and 1.4kb Styl-Sacl
fragment of 2.8 kb Sacl fragment, c-myc, and chicken p-actin, respectively.
Lane 12 contained Hindlll digested lambda DNA molecular weight marker.
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
Figure 1.16
78
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
Figure 1.17: Northern blot hybridization to detect transcript(s) for doe locus.
(A) Poly-A+ RNA from day 9.5 embryonic head (lane 1), day 10.5 embryonic
head (lane 2), day 11.5 embryonic head (lane 3), day 12.5 embryonic head
(lane 4), day 14.5 embryonic head (lane 5), day 15.5 embryonic face (lane
6), day 15.5 embryonic brain (lane 7), newborn face (lane 8), and newborn
brain (lane 9) were separated on formaldehyde-agarose gel, and blotted onto
nylon membrane. The blot was hybridized to a mixture of following probes:
2.8kb, 0.5kb, 3.6kb, 1.3kb Sacl fragments. The blot was exposed for two
days. As a control, the same blot was subsequently hybridized to the first
exon of mouse Msx2 probe. The blot was exposed for approximately 16
hours. (B) The same RNA as in (A) was blotted and probed with 4.8kb and
0.7kb Sacl fragments. The hybridized blot was exposed for two days at -
80°C. The same blot was re-probed with mouse Msx2 first exon and exposed
for 16 hours.
79
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
12 3 4 S 6 7 8 9
2 8 S
1 8 S
I -
B
1 2 3 4 5 6 7 8 9
28 S
18 S
1
I -
Figure 1.17
80
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
Chromosome walking
Hoping to find the coding region for this locus, we attempted
chromosome walk extending further away from the site of insertion. A
mixture of two probes 3.6' and 4.8" that corresponded to either end of
lambda clones was used to screen the balb/c phage genomic library. Four
clones were identified and were shown to overlap the three original phage
genomic clones which were described previously. Two of these clones 8
and 12 were identical which extended approximately 9kb from the original
phage clone 5-1.3.3. Two other clones 3 and 9-2 were shown to overlap
and extend the original phage clone 16-2.2.1. Figure 1.18 depicts a
tentative chromosome map aligning these phage clones. Probes generated
from these new genomic clones were used to hybridize to old Northern blots
containing embryonic as well as newborn mRNAs. These probes did not
detect any hybridizing bands (data not shown).
81
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
10 zo
1 I I L _ J I L _ J 1 , 1 I I I I l— l L__J i I I
2 kb
5-1.3.3
16-2.2.1
3
9-2
8-1 * —
12 **—
Figure 1.18
Figure 1.18: Putative map of doe locus after performing chromosomal walk.
82
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
Enhancer Activity of the doe locus
The HoxaS/lacZ transgene might have inserted into a complex
regulatory domain of the doe locus. The pattern of lacZ expression in line
50 mice might also be a result of combinatorial effect between the Hoxa5
enhancer and doe regulatory elements). To address these questions, we
made three transgene constructs by replacing the Hoxa5 enhancer
sequences with genomic fragments of the doe locus (Figure 1.19). The
Hoxa5 minimal promoter together with intron and 3’ sequences were
previous characterized to be inactive in transgenic animals (Zakany et al,
1988); however, the Hoxa5 promoter could function properly under the
control of heterologous enhancers (Tuggle et al., 1991). Thus, doe/Hoxa5
fusion constructs should show expression in transgenic mice if active
regulatory elements are present in doe genomic fragments. I have identified
a 5.8kb DNA fragment that can direct lacZ expression in the brain, spinal
cord, and spinal ganglia (Figure 1.20). Figure 1.20A shows p-galactosidase
activity of one transgenic newborn in focal areas of the cerebrum and
cerebellum. The staining pattern in the spinal cord and spinal ganglia was
not determined. Figure 1.21B shows a second transgenic animal. The
expression of doe/1.3-lacZ transgene is found in focal areas of the brain, in
the spinal cord, in spinal ganglia and genitalia. These expression patterns
were a subset pattern that was observed in line 50 animals.
83
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
Figure 1.19: Map of doe/1.3-lacZ constructs. To test the hypothesis that the
transgene has inserted into a large regulatory domain of the host
chromosome, three chimeric lacZ reporter constructs were made, pdoe/1.3-
lacZ was created by ligating a 5.9 kb DNA fragment immediately upstream
of the insertion site in front of a mouse Hox 1.3 minimal promoter-/acZ
reporter cassette (1.3/lacZ). pdoeXhol/1.3-lacZ was constructed by linking
11 kb Xhol genomic fragment from phage clone #16-2.2.1 in front of
1.3/lacZ reporter cassette. Two possible orientations are available for these
two plasmids. The doeHindlll/1.3-lacZ fragment for microinjection was
released from the vector by digesting the plasmid with Hindlll restriction
endonuclease.
84
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
doanXaeZ
W B 4
H o s tj
l acZ
doaXhoVIXaaZ
H o * 1. 3
lacZ
doaM ndrtXaeZ
H n u
Figure 1.19
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
Figure 1.20
Figure 1.20: (3-galactosidase staining pattern of transgenic newborns that
carried doe/1.3-lacZ transgene. (A) Diffused blue staining is detected in the
brain (arrow), dorsal spinal cord, spinal ganglia (arrowheads), and the
genital (white arrow). (B) p-galactosidase staining is detected in focal
regions of the brain (arrow) in doe/1.3-lacZ #5.
86
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
Discussion
We have identified a recessive insertional transgenic mutant line
(HoxaS/lacZ-50) among several transgenic lines that carried the Hoxa5AacZ
transgene. Homozygotes of this line died within a after birth, and their
eyelids were not fused together. These phenotypic traits always co
segregated with the HoxaS/lacZ transgene, indicating that the disruption of
an active chromosomal locus by the transgene was the underlying cause for
these abnormalities. This was supported by two pieces of experimental
evidence: (1) The pattern of inheritance of the transgene was in agreement
with Mendelian ratio for a single locus; (2) molecular analysis of the
insertion site indicated that the transgene had inserted into a single site. We
named this disrupted locus doe.
The striking lacZ expression pattern in the craniofacial structures and
CNS in line 50 embryos led us to postulate that the expression of the
transgene is due to positional effect lacZ expression in CNS of line 50
transgenic animal provided a dynamic picture of regulated gene expression
from embryonic stage to adulthood. During early embryogenesis (day 10
and day 11 of gestation), (3-galactosidase activity as an indicator of
transgene expression was restricted to focal areas in the telencephalon and
mesencephalon. By day 12, p-galactosidase activity was more widely
spread to include entire midbrain; however, the expression in the
telencephalon was still restricted to the same focal areas. The expression
87
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
in the telencephalon, now the cerebrum, became wide spread at the
newborn stage. In fact, in newborns, expression in the CNS showed no
spatial restriction. The apparent deregulation in the newborn brain was in
sharp contrast to highly restricted expression pattern in the adult brain. In
the adult brain, p-galactosidase activity was only detected in selected
neurons in the cerebral cortex and in the neurons of the hippocampal
formation.
The expression of the HoxaS/lacZ transgene in line 50 mice might
have been contributed by the presence of the Hoxa5 enhancer in the
transgene. In fact, some of the expression patterns in line 50 mice
overlapped with that of the endogenous Hoxa5 gene. At the transcriptional
level, Hoxa5 messages were first detected in day 8 embryos in the
unsegmented mesoderm that eventually give rise to the thoracic region. By
day 9, cells in neural tube and somites began to make Hoxa5 transcripts
(Dony and Gruss, 1987). In day 12 embryos, Hoxa5 transcripts were
present in abundance in the ventral portion of the developing spinal cord
with an anterior boundary at the level of prevertebra 3 (pv3), or cervical
vertebra 3 (C3) (Gaunt et ai, 1990). In addition, Hoxa5 messages were
made in the mesodermal compartment of the developing lung, stomach, and
the midgut. Ribs expressed high level of Hoxa5 transcripts in day 13
embryos (Dony and Gruss, 1987). However, in day 18 embryos, expression
of Hoxa5 gene was only detectable in the kidney and in the midgut by in situ
88
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
hybridization (Dony and Gruss, 1987). In addition, Hoxa5 transcripts were
detected in the spinal cord, lung, and kidney of newborn mice by primer
extension and RNase protection assays (Zakany et ai, 1988). Expression
of Hoxa5 was found in adult brain, spinal cord, liver, kidney, and gonad by
Northern blot hybridization (Odenwald et al., 1987). At the protein level, by
using an antipeptide antibody specific for HoxaS, Odenwald et al. (1987)
had shown specific immureativity of this polyclonal antibody in neurons of
cerebral cortex, pyramidal and granular neurons of hippocampus, Purkinji
neurons of cerebellum, and neurons in diencephalon and brain stem of adult
animals. During embryogenesis, Hoxa5 proteins were detected in all germ
layers of day 7 and day 8 embryos (Tani et al., 1989). Hoxa5 proteins were
also found to be present in entire brain and spinal cord and in spinal
ganglia, lung, gonad, thymus, and thyroid of day 14 embryos (Tani et al.,
1989). Our study of HoxaS/lacZ-22 mice suggested to us that the 5'
regulatory DNA sequences of Hoxa5 that was used to create these
transgenic mouse lines is only active between day 11 and 14 of gestation
because frozen sections of the brain and spinal cord of transgenic adult
animals did not show any (3-galatosidase activity (data not shown).
However, this does not rule out the possibility that the pattern of transgene
expression in HoxaS/lacZ mice may due to the deregulation of Hoxa5
enhancer element and, therefore, reflects the endogenous Hoxa5 gene
expression pattern with respect to expression in the CNS and in some of
89
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
mesoderm derivatives, such as the lung, kidney and gut. Nevertheless, the
position-dependent expression pattern in the face and limbs are unique
patterns distinct from endogenous Hoxa5 expression pattern.
The expression profile in the facial region is very intriguing for the
following reasons. (1) The expression of the transgene was exclusively
found in the mesoderm; (2) the expression was focal about the eye where
future eyelids will form, and the expression was focal in the nostril and in the
region where vibrasea are formed. Based on these observations, it is
reasonable to hypothesize that gene product(s) of doe is probably involved
in the patterning of the facial structures, especially in the eyelid formation.
The development of the eyelids had been characterized at
morphological levels. In mice, eyelids form as processes around the eye on
day 13 of gestation. From days 14 to 16 the upper and lower eyelids grow
across the eye and become tightly fused between ectoderm by day 17 (Pei
and Rhodin, 1970). The eyelids remain fused until approximately 14 day
post partum (Theiler, 1972). Developing eyelids consist of an epithelial
sheet of ectodermal origin enclosing loose mesenchyme, the cells of which
are likely of cephalic neural crest origin (Serbedzija, Bronner-Frazer, and
Frazer, 1992). The epithelial layer becomes the epidermis on the outer
eyelid surface and the conjunctiva on the inner eyelid surface. The
mesenchymal layer becomes the dermis. Covering the outer surface of the
eyelids during their growth and fusion is an additional cell layer, also of
90
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
ectodermal origin, the periderm that is shedded after birth. The
development of the eyelid probably involves cell migration and probably cell
proliferation. In the beginning of this process, cells along the margin of the
eye opening take on a rounded morphology and protrude out to form a
“ leading edge” . This leading edge is followed by more and more clumps of
rounded cells which grow across the cornea and eventually converge on the
fusion line near the midline of the eye (Hams and McLeod, 1982).
Interestingly, similar processes were also observed in digit fusion as well as
in pinna fusion (Maconnachie, 1979). However, we did not observe any
abnormalities that were associated with either digit fusion or pinna fusion in
line 50 mice, indicating different molecular processes are utilized.
The open eye-lid phenotype appeared to be caused by the failure of
eyelid mesenchymal cells to migrate or/and to maintain sufficient growth.
The closure of eyelids of mutant animals were ranging from one eye to both
eyes, and the degree of opening of the eyelids range from a tiny slit to a
complete opening. The incomplete penetrance of the open-eyelid phenotype
indicates influences of modifier gene(s) that is present in the hybrid genetic
background. Similar defect of the eye-lids had been described for several
spontaneous mutants: open eyelids(Mackensen, 1960), gaping lids (Kelton
and Smith, 1964) and lidgap-Miller (Hams and Fraser, 1968). Open eyelids
also appeared to be a common phenotype in many spontaneous and X-ray
induced mouse mutants that showed pleiotropic defects, such as congenital
91
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
hydrocephalus (Gruneberg, 1953) and first arch (McLeod et. al., 1980;
Juriloff and Harris, 1983) mutants. The molecular basis for this apparently
common defect is unknown. It appears that more than one gene locus is
involved since open eyelid mutations were mapped onto different
chromosomes (Miller, 1964). Ectopic expression of Hox genes, such as
Hox 1.1 (Kessel et al., 1990), Hox 2.3 (McLain etai, 1992), and paired box
gene, such as Pax 3 (Dressier et al., 1993), can also lead to open eye
phenotype, pointing to the involvement of transcriptional factors that are
known to be important in regulating axial identities in mouse embryos. The
gene produces) encoded by the doe locus may be directly or indirectly
involved in the processes that make the eyelids. The lacZ staining around
the eyelids argues in favor of this possibility. This population of lacZ
positive cells may be expressing factors that are essential for eyelid
formation. It is reasonable to speculate about the possible functions of doe
gene products. The doe gene may encode for an extracellular matrix
protein or cell surface receptor that is essential for cell-cell interaction or cell
migration in eyelid formation as well as in other morphological processes. It
is also likely that doe proteins are transcriptional factors or regulatory
molecules involved in signal transduction pathways that induce the
proliferation of mesenchyme.
Nevertheless, the mutation that causes eyelid defect could not
account for death phenotype. The fact that homozygotes were able to
92
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
survive the initial hours after birth indicating that their pulmonary and
circulatory systems were functional at that stage. Sections of the kidneys
and livers indicated no gross morphological abnormality although defects at
subcellular level remain possible. Since (3-galactosidase was made
abundantly in the developing brain and in almost all structures of the
newborn brain, any defect that affects neuronal circuitry associated with
pulmonary and/or circulatory functions would be conceivably lethal. The
fact that homozygotes lacked signs of feeding also suggested possible
malformation associated with feeding reflexes, including olfaction in
searching out for nipples, attachment to nipples, and muscular motor
functions of sucking. In the absence of any fine anatomical and histological
indicators, a molecular approach may be more fruitful in the sense that once
the gene responsible for these phenotypes is found detailed expression
pattern will help in defining the anatomical locations of possible defects.
In order to understand the doe locus at the molecular level, we
cloned the genomic sequences flanking the integration site spanning
approximately 20kb. Comparisons between sequences flanking the
transgene and the sequences from the wild type locus indicated that the
insertional event did not cause any alteration to the DNA sequences around
the integration site. The transgene has inserted into the doe locus in a
tandem array. Judging from densitometric data, the tandem array contained
four copies of the transgene. One of these transgene copies contained a
93
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
pUC8 vector into which the transgene was cloned. The anonymous 10kb
band was a result of the presence of this vector. This 10kb transgene
fragment was able to confer ampicillin resistance and could propagate like a
plasmid in E. coli hosts (data not shown). It was also shown to hybridize to
pBR322 but not to other mouse genomic sequences except to the Hoxa5
(data not shown). The significance of this prokaryotic sequence in
influencing the expression of the transgene is yet to be determined. There
were documented reports showing that the presence of vector sequences is
highly inhibitory to the appropriate expression off certain genes, such as p-
globin (Chada et al., 1985; Townes et al., 1985; Kolliaas et al., 1986),
a-actin (Shani, 1986), and a-fetoprotein (Hammereta!., 1987).
With the isolation of genomic sequences from the region we were
able to RFLP map the affected locus to the mouse chromosome 12. We
choose to use the 4.8kb Sacl fragment as the probe for it is the only probe
that detected polymorphic bands on Southern blots. We have analyzed total
38 recombinant inbred (Rl) strains. When we compared strain distribution
patterns from our study with that of other chromosome markers, an exact
concordance was found between this locus and an anonymous
chromosome 12 specific DNA marker, D12Nyu2, indicating linkage of these
loci on chromosomal 12. It was estimated with 95% confidence that the doe
locus is located within 2.3 centimorgans (cM) on either side of D12Nyu2
(Silver and Buckler, 1986).
94
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
Mapping of the doe locus to chromosome 12 allowed us to search for
candidate genes for this locus. Within the 3 cM or 6000 kb (1 cM is
equivalent to 20,000 kb in mouse genome) of the D12Nyu2 marker locus,
following genes or DNA polymorphic markers were positioned: Nmyc-1, Ode
(ornithine decarboxylase), Pol-7, D12Leh1, Apob (apolipoprotein B), Rnr12,
Pmv-37, and Synd (syndecan gene) were found in one side; Es-25 (kidney
arylesterase-25) was found in the other side of D12Nyu2. Mmv-18 and cpk
(polycystic kidney) gene were mapped to the same location as D12Nyu2.
Among these genes, Nmyc-1 is a known protooncogene that encodes a
transcriptional factor that is expressed during mouse embryogenesis
(Downs et al., 1989; Keto et al., 1991; Mugrauer et al., 1988; Himing et al.,
1991). Syndecan-1 gene encodes a transmembrane cell surface
proteoglycan that bears both heparan sulfate and chondroitin sulfate and
that links the cytoskeleton to the interstitial matrix via its cytoplasmic
domain. It is shown to bind in vitro to extracellular matrix components, such
as fibrillar collagens types I, III, and V (Koda et al., 1985), fibronectin
(Saunders and Bemfield, 1988), thrombospondin (Sun et al., 1989),
tenascin (Salmivirta et al., 1991), and neurite growth-promoting protein
amphoterin p30 (Salmivirta et al., 1992). The functional relationship among
these genes and the doe locus remains to be investigated.
We have attempted to identify transcript(s) encoded by doe by
Northern hybridization on mRNA from the face, brain of embryonic day 9.5,
95
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
10.5, 11.5, 12.5, 14.5, 15.5, and newborns using unique genomic probes
generated from phage clones. We were not able to detect any transcript
(Figure 1.16). The lack of positive hybridization signal was not due to poorly
made probes because the probes used detected as low as 10pg of control
DNA (data not shown). In addition, Msx2, a mouse homeobox gene that
encodes a transcriptional factor, hybridized strongly to these mRNAs,
indicating the integrity of these mRNAs as well as the detection limit by this
method. Hence, it might be that the probes that we used did not contain
any exons or that the amount of doe transcripts is below detection by
Northern blot One feasible approach is to utilizing exon-trap method by
taking advantage of the RNA splicing mechanism existed in eukaryotes. An
unkown DNA sequence can be cloned within an intron between two exons
of a known gene and transfected into cultured cells. Cytoplasmic mRNA is
then harvested from transfected cells and RT-PCR amplified using primers
of known exons flanking the splice sites. Any alteration to the expected size
of the PCR product will indicate the presence of an unkown sequence due
to a novel splicing event. This unknown sequence could be a potential exon
present in the unknown DNA.
Where in the doe locus did the insertion of the transgene occurred?
One possibility is that the transgene inserted into one of the exons of the
doe locus. Two pieces of experimental evidence indicated that this is not
the case. First the 2.8kb Sacl fragment where insertion took place did not
96
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
show hybridization signal with embryonic RNAs on a Northern blot. Second,
sequences around the insertion site do not contain any significant open
reading frame based on results obtained by running a computer program
called Geneld that predicts the likelihood of the presence of an exon(s)
within a given sequence (Guigo et al., 1992; data not shown). The second
possibility is that the transgene inserted into an intronic region of the doe
gene that affected either transcription or proper splicing of the nascent RNA
transcripts. In fact, this is the way a provirus prevented the trancription of
a1(l) procollagen gene that resulted in embryonic lethality in Mov13 mice
(Jaenisch et al., 1983; Harbers et al., 1984; Hartung et al., 1986; Baker et
al., 1991). In Mov13 mice, a Moloney murine leukemia virus was inserted
into the first intron of the mouse a1(l) procollagen gene. The blockage of
transcription was a result of a possible disruption or displacement of cis-
acting regulatory DNA sequences present in the intron. In the situation of
line 50 mice, there is no concrete experimental evidence that would allow us
to discount the likelihood of this possibility, except that this intron must be
huge (larger than 20kb) because none of the probes generated from this
cloned region detected any hybridizing signal on Northern blots. Several
mouse genes were reported to contain huge introns. For example the
mouse activin receptor type II gene has an intron of greater than 40kb in
length and another 12.9kb long intron (Matzuk and Bradley, 1992). Other
examples include mouse iiver/bone/kidney-type alkaline phosphatase gene,
97
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
which has a 32kb intron (Terao etai, 1990), and mouse C^-methylguanine-
DNA methyl-transferase gene which has a 34kb intron and an intron greater
than 90kb long (Shiraishi eta i, 1992), and mouse N-cadherin gene whose
first and second exons are 34.2kb and greater than 100kb long, respectively
(Miyatani et al., 1992). Therefore, it is not unlikely that we had cloned part of
a huge intron of doe locus. The third possibility is that the transgene
inserted into a locus control region (LCR) that are found in a number gene
clusters, such as human p-globin locus, and human red and green cone
pigment gene locus (Wang et al., 1992). In the case of human p-globin
gene, the LCR is composed of 5 major DNase I hypersensitive sites, HS5-
HS1. These hypersensitive sites are located greater than 50kb upstream of
p-globin gene. Targeted insertion of a hygromycin B resistance gene
between two DNase I hypersensitive sites, HS2 and HS1, within the LCR
effectively shut off transcription of p-globin gene (Kim et al., 1992). In the
light of this study, it becomes a viable mechanism how insertion of the
transgene may have inactivate the doe locus. This third possibility is
supported by one important piece of experimental evidence. Transgenic
mice that carry a doe/Hoxa5-lacZ chimeric construct were shown to express
□-galactosidase protein in the brain and spinal ganglia, indicating that DNA
sequences flanking the inserted transgene in line 50 indeed have
transcriptional regulatory activities. In this particular instance, a 5.2kb
genomic fragment brought about transcriptional activity to the transgene.
98
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
Chapter 2
Molecular characterization of mouse Msx2 gene promoter and its
regulation during mouse embryonic development
99
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
Introduction
Craniofacial development involves a series of complex interactions
between the epithelium and mesenchyme. Most of the craniofacial
structures are derivatives of the migratory cephalic neural crest cells.
Although much of the anatomical characteristics as well as the embryonic
origin of craniofacial structures was well defined from studies based on avian
system, little is known about the molecular basis that leads to the formation
of craniofacial structures.
Recent application of in situ hybridization technology has led to the
discovery of many genes that are actively expressed in a strictly temporal
and spatial manner during embryogenesis. For a long time these genes
have been thought to play important roles in cell differentiation and cell
growth control. Several of these genes are known to play central role in
mediating actions of retinoic acid, such genes as retinoic acid receptor
genes, cellular retinol and retinoic acid binding protein genes. Many growth
factor genes, such as transforming growth factors, are also expressed in
craniofacial regions. Recently, several homeobox genes have been shown
to be expressed in the cranial facial region of the mouse embryo. Homeobox
genes encode helix-turn-helix type of transcriptional factors. These genes
were initially identified and characterized in Drosophila. The highly
conserved 180 bp DNA binding homeodomain facilitated isolation of
100
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
homologous homeobox genes in human, mice, chicken, quail, Xenopus, sea
urchin, ascidian, and hydra.
Homeobox-containing genes have been implicated in the control of
patttern formation during development. They have been shown to be
involved in specification of positional identity, segmentation, and body pattern
during Drosophila development (Gehring, 1987; Ingham, 1988). The
significance of homeobox genes in controlling vertebrate development is only
starting to be unrevealed. Targeted mutagenesis in mouse has shown that
these genes play a central role in specifying anterior-posterior axis of
vertebrate body. For instance, targeted inactivation of Hox 3.1 leads to
duplication of ribs.
Homeobox genes can be grouped into eleven classes (Scott et al.,
1989; Su et. al., 1991) based on amino acid sequences of the homeodomain.
A lot of work has been focused on the Antennapedia class of homeobox
genes. These homeobox genes are expressed in CNS with a restricted
anterior boundary and mesodermal tissues of vertebrate body during
development. However, the msh class of homeobox genes, Msx1 and Msx2
differs from Antennapedia homeobox genes in several respects. Unlike the
Antennapedia class of homeobox genes, Msx1 and Msx2 are not linked to
the Hox complex and their expression pattern significantly deviates from
members of the Hox complex. These genes are expressed mainly in neural
crest and neural crest derived craniofacial structures in chick, quail, and
101
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
mouse embryos. Their importance in epithelial-mesenchymal interaction and
organogenesis is implicated based on their expression profile during
embryogenesis. In Xenopus, XMsx1.1, the counterpart of mouse Msx1, is
expressed in the dorsal mesoderm of gastrulating embryo (Su et. al., 1991)
along the anterior-posterior axis. At the tail-bud stage, XMsx1.1 RNA was
detected in the presumptive and definitive neural crest cells and other cells in
the dorsal region of the neural tube. In the mouse, Msx1 expression was
detected in regions of embryos that are known to undergo extensive
epithelial-mesenchymal interactions including mesenchyme and epithelium of
the progress zones of developing limb buds (Hill et ai, 1989; Robert et al.
1989), condensing mesenchymal cells surrounding the invaginating dental
epithelia or dental papilla, epithelium of anterior pituitary (MacKenzie et al.,
1991a) and optic vasicle (Monaghan etai., 1991).
Similarly, Msx2 expression during vertebrate embryonic development
also correlates well with its possible involvement in pattern formation during
organogenesis. The Msx2 showed an overlapping and in some instances
reciprocity of expression to that of the Msx1. In the limb buds, Msx2
expression was confined to the ventral and distal ectoderm and the ventral
mesoderm in contrast to MsxVs expression throughout limb buds of day 9.5
mouse embryos (Davidson et al., 1991). The Msx2 gene is continuously
expressed in the apical ectodermal ridge (AER) whereas Msx1 expression is
extinguished by day 11.5 (Davidson et al., 1991). In the developing eye,
102
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
Msx2 is expressed in the neural epithelium and overlaying ectoderm which
later invaginates and becomes the lens (Monaghan et al., 1991). Msx2
expression is continued in embryonic lens and neural retina as well as the
surface ectoderm that will eventually develop into cornea. Msx1 expression
is mostly confined to tissue in the prospective region of the ciliary body
(Monaghan et al., 1991). In craniofacial region, Msx2 is expressed in the
neural crest-derived mesenchyme of all four branchial arches (MacKenzie et
al., 1992). Msx2 is also expressed in the mesenchyme of the frontonasl
process, surrounding the otic vesicle and beneath the cranial ectoderm of the
forebrain. With fusion of the maxillary processes, Msx2 is expressed in the
mesenchyme of the closure zone closest to the oral cavity.
Mouse Msx2 gene has been cloned and sequenced. It is mapped to
distal region of mouse chromosome 13 (Bell et al., 1993). Most recently,
Jabs et al (1993) have found a genetic correlation between mutation in
human Msx2 gene and craniosynostosis Boston type, a human congenital
defect associated with premature closure of sutures in calvaria. A single
base change in the homeodomain resulted in an alteration at the amino acid
level. At position 7 of the homeodomain, a histidine residue had substituted
for a proline as a result of this single base mutation. The molecular
mechanism responsible for this morphological defect is not clear.
Msx2 is expressed in suture-associated mesenchymal cells of
prenatal and neonatal mice. Tissue interactions between sutures and
103
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
underlying dura are apparently required to maintain sutures in an open state
(Opperman et al., 1993). The strong association of Msx2 expression with
inductive tissue interactions suggested to us that an analysis of Msx2
regulation would help uncover the signal transduction pathways that underlie
such interactions. According, we have begun to analyze the Msx2 promoter
with the ultimate goal of identifying cis-regulatory elements that respond to
inductive interactions or intracellular signaling molecules.
Material and Methods
Cell Culture
P19 embryonal carcinoma cells (McBumey et al., 1982) were grown
in DMEM supplemented with 7.5% calf serum and 2.5% fetal bovine serum
(Sigma). For retinoic acid induction experiments, stock retinoic acid solution
of 10'3 M in ethanol was diluted in culture medium into 1 C T 6 M just before
use. Cycloheximide was used at the concentration of 20 (ig/ml.
Cos-7 and CV-1 cells were grown in DMEM supplemented with 10%
fetal bovine serum (Sigma).
DNA Transfection
Calcium phosphate method (Gorman et al., 1982) was used for DNA
transfection into P19 and Cos-7 cells. Briefly, cells were transfected at a
density of 7x10s cells per 10 cm plate. A total of 10 jig of plasmid DNA was
used per transfection per plate. pBluescript was added to make up the
difference in weight when co-transfection with a second plasmid was
104
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
required. Medium was changed once the day after the transfection. Fourty-
eight hours after transfection, cells were washed once in 1X PBS and fixed
with 4% paraformaldehyde for 30 minutes at 4°C. Cells were then washed
three times with 1X PBS and stained with X-gal staining solution for one to
two hours at 37°C.
Primer extension
Approximately 6 x 105 CPM of end-labeled primer (21mer
oligonucleotide) was mixed to 5 to 15 ug of either total or Poly-A+ RNA and
ethanol precipitated. The pellet was resuspended in 30 ul of hybridization
buffer containing 40mM PIPES (pH 6.4), 1mM EDTA (pH 8.0), 0.4M NaCI,
and 80% formamide and was heated for 10 minutes at 85°C before
transferring into a 30°C water bath for annealing overnight. The annealing
reaction was stopped by ethanol precipitation. This was followed by
extension reaction. The pellet was dissolved in reverse transcription
cocktail containing 1X reverse transcriptase reaction buffer, 1mM of each
dNTP, 1 unit/|xl RNasin, 50 units AMV reverse transcriptase and RNase free
water to a final volume of 20 |il. The extension reaction was carried out for
2 hours at 42°C. The reaction was halted by adding 1 |il 0.5M EDTA and
1(il DNase-free RNaseA and incubated for 30 minutes at 37°C.
Transgene constructs
A 568 bp Spel-Sacll fragment encoding the first 10 amino adds of
Msx2 protein was subcloned into the Spel and Smal sites of pBluescript II
105
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
SK- vector (Stratagene) to generate the parent plasmid pMsx2TATA.
Subsequently, a promoterless lacZ gene that also lacks an ATG codon was
removed from pMC1871 (Pharmacia) and ligated into Smal/Pstl site of
pMsxZTATA to generate pMsx2TATA-lacZ. Nucleotide sequencing
confirmed that the lacZ gene was in frame with the Msx2 gene. The
remaining portion of the exon 1, as well as the intron, exon 2 and 3' flanking
sequences (3 kb) of Msx2 genomic ONA were ligated 3' of the lacZ gene at
the Pstl/Xhol site as a 7.2 kb Nael/Xhol fragment to create pMsx2/lacZ-1.
The Nael site of the Msx2 gene and the Psti site of the lacZ gene were
deleted in the process of cloning.
To generate pMsx2/lacZ-5-11, a 5 kb Spel-Xhol fragment 5' of the
Msx2 promoter was blunt-end ligated into the Spel site of pSKII-Msx2/lacZ-
1 ANot. pSKII-Msx2/lacZ-lANot was made first by Klenow fill-in of the Notl
site in the first exon of pSKII-Msx2/lacZ-1. The Notl site in the 5 kb Spel-
Xhol fragment was also deleted by Klenow fill-in. For injection, the
eukaryotic DNA fragment was removed from the vector sequences by Notl
and Xhol double digestion. To generate pMsx2/lacZ-5-15pA, Msx2
sequences 3' of the lacZ gene were replaced by the SV40 polyadenylation
sequences from pSVbeta-galactosidase (Promega). The DNA fragment
used for injection was released by cleaving the plasmid with Notl and Xhol.
pMsx2/lacZ-1-6pA was created by ligating an EcoRI-Xhol fragment
that contains an SV40 polyadenylation sequence and approximately 50 bp of
106
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
lacZ sequences in place of the EcoRI-Xhol fragment of pMsx2TATA-lacZ.
Cleavage with Spel and Xhol released the Msx2/lacZ-1-6pA fragment for
microinjection. pMsx2/lacZ-1-6HXpA was isolated from pMsx2/lacZ-1-6pA
by digestion with Hindlll and Xhol.
Generation of Transgenic Mice via Microinjection
Fertilized eggs were obtained from superovulated, four to five week
old Fi(C57BL/6J x CBA/J) females impregnated by Fi(C57BL/6J x CBA/J)
adult males. Pseudopregnant females for embryo transfer were produced by
matings between CD1 adult females and vasectomized CD1 adult males.
Microinjection and oviduct transfer of injected zygotes was performed as
described (Hogan et al., 1986). Usually, both procedures were performed on
the same day. The concentration of DNA used for injection was 1-3 (ig/ml.
Results
Mouse Msx2 gene produces two different transcripts
The expression profile of the Msx2 during embryonesis has been well
worked out by using in situ hybridization (Hill et al., 1989; Roberts et a/.,
1989; MacKenzie et a!., 1991a; MacKenzie et al., 1991b). However, no
description of the transcript(s) for mouse Msx2 existed in the literature.
Chicken Msx2 (GMsx2) and Quail Msx2 (QMsx2) genes were shown to make
one transcript (Coelho et al., 1991; Takahashi and Le Douarin, 1990).
Surprisingly, two transcripts of different sizes, a 1.4kb and a 2.2kb transcript,
were detected for the mouse Msx2 gene (Figure 2.1). Both transcripts were
107
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
made from day 9 to day 15 of gestation. The expression of Msx2 gene
appeared to extend beyond the embryonic stage because Msx2 expression
was found in the brain and face of newborn mice. The 1.4kb transcript
always appeared more abundantly in comparison to the 2.2kb transcript.
Both mRNA species are believed to utilize the same two identified exons
based on following experimental evidences. Either exon 1 or exon 2 probe
hybridized to both transcripts. Northern blot hybridization using probes
covering approximately 5.4kb upstream sequence from putative
transcriptional initiation site did not detect neither the 1.4kb or the 2.2kb
transcripts (Liu, Kundu and Maxson, unpublished observation). The
molecular nature of the 2.2kb transcript is still under investigation. It is
certain that the 2.2kb band on the Northern blot is not due to cross
hybridization with transcripts of another related gene because exon 1 probe
only detected a single band on the genomic Southern blot (Figure 2.1) under
moderately stringent hybridization conditions. It is not coded by the 3.6 kb
intron because the intron sequence does not contain any reasonably sized
open reading frame (Noveen and Maxson, unpublished observation).
Promoter characterization
The transcriptional initiation sites for the 1.4kb transcript have been
mapped by primer extension and RNase protection assay to within 127bp
upstream of the translation initiation codon (Liu, Ma and Maxson,
unpublished observation). Primer extension mapped the transcriptional
108
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
Figure 2.1: The mouse Msx2 gene encodes two transcripts. The mouse
Msx2 gene encodes two transcripts of different sizes and both are
transcribed during mouse embryogenesis. PolyA+ RNAs from the head of
day 9.5 (iane 1), 10.5 (lane 2), 11.5 (lane 3), 13.5 (lane 4), and 14.5 (lane 5)
embryos, from the face of day 15.5 embryos (lane 6) and newborn mice (lane
8), and from the brain of day 15.5 embryos (lane 7) and newborns (lane 9)
were electrophoretically separated on formaldehyde agarose gel and blotted
onto nylon membrane. The blot was hybridized to the 1.6kb BamHI fragment
which contains the entire first exon of the mouse Msx2 gene. Two RNA
species were shown to hybridize to the probe in all lanes. The larger RNA
species was estimated to be about 2.2kb long. The fast migrating band was
estimated to be about 1.4kb long which matched the predicted molecular
weight based the sequence. The relative abundance of these two transcripts
differed remarkably between day 9.5 and day 14.5 although this difference is
reduced in day 15.5 embryos and in newborns.
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
110
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
initiation sites to position 63 and 83 relative to the ATG codon (Figure 2.2).
RNase protection confirmed the primer extension results although multiple
protected bands were observed. By using an antisense RNA probe covering
sequences from Apal to Sacll site (data not shown), the longest protected
band and also the major protection product was mapped to position 127 and
the shortest protected band was mapped to position 63 relative to the
initiation codon. Examination of the sequences upstream of the
transcriptional initiation site has yielded a CAAT box like sequence at
position -64 relative to the transcriptional initiation site and an SP1 site at -97.
No TATA like sequences was found downstream of the CAAT box. The 200
bp Spel-Apal fragment is extremely GC rich and probably constitutes a basal
promoter for the Msx2 gene (Figure 2.2) because a fusion construct of Msx2
carrying Spel-Sacll fragment and lacZ gene is active in transgenic mice.
Transcriptional regulation of mouse Msx2 gene
Msx2 expression is probably tightly regulated during embryonic
development. In order to understand its regulation, we first examined the
sequence requirements for the appropriate spatial and temporal regulation as
an initial step for identifying molecules in the regulatory cascade. Based on
sequence analysis as well as experimental evidence from studies on chicken
limb buds, we postulated that mouse Msx2 may be regulated by a
mechanism that involves retinoic acid. Expression of GMsx2 was repressed
in limb buds after the limb buds were exposed to retinoic acid (Yokouchi et
111
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
Figure 2.2: Determination of transcription initiation site for mouse Msx2
gene by primer extension. A 5’ end-labeled DNA oligonucleotide of 21mer
that spans the translation initiation ATG codon was annealed to newborn
brain polyA+ RNA (12.5 fig). For sizing the extended products, a Msx2
sequencing ladder was prepared using the same primer. Upon extension
with AMV reverse transcriptase and gel electrophoresis, two major products
corresponded to an A on the coding strand 95 bases upstream from ATG
and a G on the coding strand 66 nucleotides from ATG. One minor
extension product was detected at the position 70 relative to ATG.
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
112
A
spe z
A C A A A C A T A C & T A C T 'T P G ^ C T C A T A C T G C X S A C C rrrA T A A A T G T T C
TG CC A TC G C C AC C AG A A AC A C IT T AA A C A Q
A C C C C TTAC A C r T T ’ :x :AG r r T GOG C G A T T A T A A C C C T T GAOCGATCGCCT A A T A A C A A C,:C ,rO C T G AC? q C T CCT CT A A T T A A C T C C T A A
* 3 3 4
- 2 4 4
f f P l A ^ a Z C A A T
v r r r e a a a c o g g c c g g c c c a a g c g c o c c a a c c c t c t c c a g o g a c a o c c a a t c
CCCCTCg G XGGACAC C C T QGGCT C CC
CGAG TC'T rCG CT T G A C A GT r GCCAG CG CACTCGCGCGCCGACAOCTACGCQGCC C A C A A A S T C A T C C C T T CT CC G ACTAAAG GCGGTG AC
x fcc yrA C TO O CCGGCCCGG C rC C T OO G CCTOGAOGACCOCAOOGCAOCGCACAGCAOCqCACC - 1 1 7
V L A C P G P G P G G A E C S A E E R A
B
G A T C
<
<
a
m
■
■ s i*® 1
i ?
Figure 2.2
113
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
al., 1991). Grafting of normal ectoderm from apical ectodermal ridge (AER)
to the limb bud of the limbless mutant was able to increase and maintain
GMsx2 expression in the mesenchyme of limbless limb buds (Robert et al.,
1991). Xenografts of quail and mouse apical ectoderm could also induce
ectopic GMsx2 expression in chick limb buds (Robert et al., 1991; Davidson
et al., 1991). Therefore, Msx2 may be regulated by the presence of retinoic
acid.
One of obvious approaches is to study the promoter of Msx2 gene in
an in vitro system. It is known that teratocarcinoma cells respond to retinoic
acid by invoking a differentiation program. Two teratocarcinoma cell lines,
F9 and P19, have been used extensively to study gene activation by retinoic
acid. Upon treatment with retinoic acid, F9 cells differentiate into endoderm-
like phenotype (Strickland etal., 1980); whereas P19 cells differentiate into
neurons and glial cells (McBumey etal., 1982). We first performed Northern
blot hybridization with total RNA from undifferentiated P19 and F9 cells.
Interestingly, Msx2 expression was detected in both cell lines. Apparently,
Msx2 gene is constitutively expressed in these teratocarcinoma cell lines.
Expression was not affected by cyclohexamide at a concentration of
0.02mg/ml even when the drug was present in the culture medium for upto 5
hours long (data not shown). The deregulation of Msx2 gene expression in
P19 cells was probably not due to DNA rearrangement in the vicinity of the
promoter region since the banding pattern of Msx2 gene in P19 genome on a
114
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
Southern blot was indistinguishable from either C57BL/6J or an Msx2 allele
in mouse fibroblast Sto cell line (Figure 2.3) although we could not rule out
the possibility of point mutations.
Since Msx2 is expressed constitutively in P19, the simplest
assumption is that these cells produce all the factors that are essential for
maintaining Msx2 expression. Therefore, P19 cells may be an excellent in
vitro system for examining Msx2 promoter activity. I constructed various
Msx21lacZ transgenes (Figure 2.4) and transfected into P19 cells and
assayed for (3-galactosidase activity. Surprisingly, none of the constructs
showed any expression although cells that were transfected by the positive
control plasmid, pSV-p-Galactosidase, did show p-galactosidase activity.
The transfections were repeated on CV-1 and Cos-7 cells without success.
We therefore abandoned the idea of studying the Msx2 transcriptional
regulation in an in vitro system in favor of a transgenic approach until a
suitable cell line is located.
Promoter analysis in transgenic mice
Many studies have shown that regulatory gene sequences
when introduced into mouse can, to a good approximation, recapitulate the
expression profile of the endogenous gene. Our aim was to determine the
sequence requirements for generating the normal pattern of expression for
Msx2 gene in transgenic mice and enhancers that we identified will hopefully
115
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
Figure 2.3: Restriction fragments of the Msx2 gene in P19 cells were intact.
Constitutive Msx2 expression in teratocarcinoma P19 cells probably was not
caused by DNA rearrangement in the vincinity of the promoter region.
Genomic DNAs isolated from cultured P19 cells (lanes 1, 4, 7, 10), Sto
fibroblast cells (lanes 2, 5, 8, 11), and C57BL/6J inbred mouse tail (lanes 3,
6, 9, 12) were digested by BamHI (lanes 1, 2, 3), Hindlll (lanes 4, 5, 6),
EcoRI (lanes 7, 8, 9) and Bglll (lanes 10, 11, 12). The resulting DNA blot
was probed with the BssHII-BamHI Msx2 exon 1 probe.
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
116
1 2 3 4 5 6 7 8 9 1 0 1 1 1 2
Figure 2.3
117
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
Figure 2.4: Msx2AacZ fusion gene constructs. The lacZ gene was fused in
frame to Msx2 in the first exon to make the backbone plasmid
p8.1TATA/lacZ. Msx2/lacZ-1 was made by ligating a 7kb Nael (blunt) -Xhol
fragment of XA to the Pstl (blunt)/Xhol sites of p8.1TATA/lacZ. Msx2/lacZ-5-
11 contains the entire XA with two Not I sites deleted. Msx2/lacZ-2.4-6
contains only 2.4kb Not l-Spel fragment upstream from the promoter.
Msx2/lacZpA1-6 was constructed by replacing portion of the lacZ gene with
the lacZ gene and SV40 polyadenylation site of pSV-p-galactosidase.
Msx2/lacZpA5-15 was made by replacing Notl-Aatll fragment of
Msx2/lacZpA1-16 with Notl-Aatll fragment of Msx2/lacZ-5-11. Msx2/1.3 lacZ
was constructed by ligating the Not l-Spe I fragment of Msx2 gene upstream
of 1.3/lac Z fusion construct
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
Msx2 gane
Noll Spe I Not I
Msx2/1acZ-5-11
Msx2/lacZ>2.4*6
lacZ
■ S I
lacZ
1 kb
Msx2/1acZ-1
M#x2/lacZp5-15
Msx2/lacZpA1*6
lacZ
■ “ Tp A !
pASV40
lacZ
PASV40
Msx2/1.3-lacZ
lacZ
Hox 1.3
Figure 2.4
119
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
become important reagents for targeting gene expression and for generating
conditional transgenic animals for selective knock-outs.
I have used Msx2AacZ constructs that I had made for the transfection
experiments to do the transgenic studies (Figure 2.4). The lacZ gene was
fused in frame to Msx2 at the Sac II site, which was blunt-ended, of the first
exon to form 8.1TATA/lacZ. This plasmid served as the backbone for all
Msx2/\acZ reporter gene constructs. Msx2/lacZ-1 was made by ligating a
7kb Nael-Xhol fragment of A .4 downstream of the lacZ gene. This 7kb
genomic fragment provided an intron as well as polyadenylation signal to the
reporter gene. Msx2/lacZ-1 contains about 260bp upstream of the putative
basal promoter for Msx2 gene. Msx2/lacZ-5-11 contains the entire lambda
clone, X4. However, the two Notl sites were deleted by Klenow fill-in. This
construct was made to maximize the chances of obtaining endogenous Msx2
pattern. Msx2/lacZ-5-15pA was constructed to eliminate the influence of the
intron as well as sequences 3' of the coding region. Msx2/lacZ-1-6pA was
made to narrow down the basal promoter. Other constructs were designed
to bracket sequence requirements for region and/or tissue specific elements.
Msx2/1.3 lacZ was constructed by ligating the Notl-Spel fragment of Msx2
gene upstream of 1.3/lacZ fusion construct. 1.3/lacZ contains the basal
promoter of Hoxa5 gene that was shown to be inactive in transgenic embryos
in the absence of an enhancer. This construct will allow us to test whether
regulatory elements of Msx2 gene can function on heterologous promoter.
120
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
Constructs Msx2/lacZ-1, and Msx2/lacZ-5-11 have been used to
create transgenic animals. Embryos were taken out at different stages of
gestation and analyzed for p-galactosidase activity. In embryos that carried
Msx2/lacZ-1 transgene, lacZ expression was restricted in the telencephalon
and trailed into the mandible (Figure 2.5A). Construct Msx2/lacZ-5-11
contained 5.2 kb of 5' upstream sequences, both exons, the intron, and
approximately 3kb of 3' flanking sequences. We generated three stable lines
bearing the Msx2/IacZ-5-11 transgene and examined its pattern of
expression at several stages of embryogenesis. At day E9, p-galactosidase
activity was detected in two narrow streams of cells stretching from the
hindbrain to the branchial region. These streams corresponded to the
migratory route of the neural crest into the first and second brachial arches
(Serbedzija etal., 1992; Fukiishi and Morriss-Kay, 1992) (Figure 2.5B, 2.6A,
B). We also detected beta galactosidase staining in the forebrain, in the
region of the brachial arches, in the body wall overlying the heart, and in the
tail (Figure 2.5B, 2.6). These sites are also consistent with sites of Msx2
expression identified by in situ hybridization (MacKenzie et al., 1992;
Takahashi et al., 1991; Robert et al., 1991). By day E12, lacZ expression
was found in a number of sites previously documented by in situ
hybridization. Figure shows a whole-mount stained embryo that illustrates
the complex pattern of expression of the Msx2AacZ-5-11 transgene. LacZ
activity was present (i) in the retina, (ii) in the mesenchyme and surface
1 2 1
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
Figure 2.5: Wholemount p-galactosidase staining of Msx2/lacZ transgenic
mice. (A) A F O transgenic embryo that carried Msx2/lacZ-1 construct. LacZ
gene expression was mainly detected in the forebrain of this E10.5 embryo.
(B) and (C) Wholemount X-gal staining of an E10.5 embryo that carried the
Msx2/lacZ-5-11 construct. Intense blue staining was detected in the
craniofacial, limb buds, heart, spinal ganglia, branchial arches, optic
vesicles.
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
122
123
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
ectoderm of the head, (iii) in the mesenchyme of the maxilla and mandible,
(iv) in the neuroectoderm of the roof of the hindbrain, (v) in the body wail
encasing the heart and the abdomen, and (vi) in the otic vesicle. LacZ
expression was also detected in the limb buds in both the apical ectodermal
ridge and in the subjacent mesenchyme (Figure 2.6).
We did observe some disimilarities in the patterns of Msx2/lacZ-5-11
transgene expression and endogenous Msx2 expression. The transgene
was expressed in spinal ganglia (data not shown), while the endogenous
Msx2 gene apparently is not. In addition, the Msx2 transgene was not
expressed detectably in the developing tooth, though a number of studies
have demonstrated Msx2 transcripts in dental epithelium and mesenchyme
throughout tooth development (MacKenzie et al., 1992). Nevertheless, our
data show that the Msx2/!acZ-5-11 transgene was able to reproduce the
majority of the intricate spatial pattern of Msx2 expression during the interval
between E9 and E12. Furthermore, in the newborn mouse, this construct
was expressed in mesenchymal cells in calvarial sutures in a manner
indistinguishable from the endogenous Msx2 gene.
124
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
Figure 2.6: Detailed analysis of the expression pattern of the Msx2/lacZ-5-
11 transgene in the mouse embryo. (A) and (B). Coronal sections of a x-gal
stained E10 embryo. Blue staining was found in the mesenchyme beneath
the presumptive epidermis, in the retina (arrow in D), in spinal ganglia, in
trigeminal ganglia (white arrows in B), in the Rathke’s pouch (black arrow in
B), in the roof cells of the neural tube (arrow in C), in the limb bud (arrow in
E), and in the anterior roof of the otic vesicle (arrow in F).
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
Figure 2.6
126
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
Discussion
During mouse embryogenesis, Msx2 is transcribed to make two
transcripts of different sizes, 1.4 kb and 2.2 kb. Both of these transcripts
were made at different ratios in the face and brain of developing embryos.
The 1.4 kb transcript was made more abundantly than that of the 2.2 kb
message. The molecular nature for the 2.2kb message is not clear;
however, it shares the same two identified exons with that of the 1.4 kb
transcript. This 2.2 kb transcript may be a result of splicing with an exon at
least 5.5 kb upstream from the first exon. Several homeobox genes of
Antennapedia class,.including Hox 4.3 (Izpisua-Belmonte etal., 1990), Hox
3.2 (Erselius etal., 1990), Hox 2.1 (Krumlauf etal., 1987), Hox 2.6 (Graham
ef al., 1988), Hoxa5 (Zakany et al., 1988), and Hox 1.7 (Rubin et al., 1987)
have been shown to have multiple transcripts possibly by alternative splicing
or by utilizing separate promoters. It is also likely that this 2.2 kb transcript is
a result of alternative polyadenylation downstream from the first poly(A)
addition site. Nevertheless, these two transcripts are coordinated
regulated. More work is required to define the molecular nature of the 2.2
kb transcript. One possible approach is to use DNA from the 3’ of the
poly(A) addition site as probes for RNA gel blots; one should detect a
hybridization signal in the case of alternative polyadenylation. The second
approach is to screen a mouse cDNA library to identify clones that contain
sequences unique to this 2.2 kb transcript
127
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
Since two distinct transcripts are expressed and coordinately
regulated during mouse embryogenesis, it is reasonable to speculate that
these two different transcripts may play different roles, post-transcriptionally.
We will need to identify the cDNA sequence for the long transcript in order
to make any useful predictions as what intrinsic functions this transcript may
encode.
Mouse Msx2 gene is expressed constitutively in mouse
teratocarcinoma P19 and F9 cells. Unlike other Homeobox genes of
Antennapedia class which are expressed only upon induction by retinoic
acid in F9 cells (Fibi etal., 1988; Murphy etal., 1988; Kessel etal., 1987), it
appears that Msx2 is controlled by a different regulatory mechanism. This
may also imply a functional role for Msx2 in cellular differentiation. Msx2
gene product may be a maintenance factor that prevents teratocarcinoma
cells from entering differentiation pathway in the absence of differentiation-
inducing molecules, such as retinoic acid, and DMSO. Such a function was
assigned to Msx1 by a recent study done by Song et al (1992) on oncogenic
potential of Msx1. High level of Msx1 expression in F3 myoblasts was able
to inhibit myotube formation and cause transformation and induce tumour in
nude mice (Song et al., 1992). It is interesting to point out that although the
homeodomain of Msx1 and Msx2 differ only by two amino acids, forced
expression of Msx2 in F3 cells did not result in morphological transformation
of these cells. This suggested that the target genes for Msx1 and Msx2 are
128
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
different, but it does not rule out the possibility that Msx2 gene has
transforming potential. The F9 or P19 cells are an excellent in vitro model
for studying oncogenic potential of Msx2 gene. One can postulate that
Msx2 gene products provide a repressor function that can be removed by
retinoic acid induced intracellular activities. A simple approach to address
this hypothesis is to grow F9 cells or P19 cells in the presence of Msx2
antisense oligo or express Msx2 antisense message in these cells. The
outcome for these experiments may be that cells become differentiated, or
subtle changes may occur at the molecular level. Some gene markers for
differentiation may be turned on, for example, Hox gene clusters, neuron
specific or endoderm specific markers. It is known that upon induction by
retinoic acid, genes of Hox complex are activated sequentially (Simeone et
al., 1990; Simeone et al., 1991). Changes can also be assessed by
checking on several biochemical markers (Strickland et al., 1980). The
second approach to assess the oncogenic potential is to force expression of
Msx2 gene in embryonic cells, such as retinoblasts.
The in vivo regulation of the mouse Msx2 gene expression seems to
involve a complex set of cis-acting DNA elements. This became more
apparent to us after we have observed the expression pattern of Msx2/lacZ-
5-11 transgene in transgenic embryo. Msx2/lacZ-5-11 carries 5.4 kb
upstream sequences in addition to two exon and a 3.5 kb intron plus
approximately 3 kb of genomic sequences downstream of the coding region.
129
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
With this gene construct, we only recapitulated a majority of Msx2
expression profile. Embryo that expressed Msx2/lacZ-1 gene construct
showed a unique expression pattern that did not match the Msx2/lacZ-5-11
pattern although Msx2/lacZ-5-11 contains all the sequence information that
is present in Msx2/lacZ-1. The simplest explanation for non-overlapping
expression pattern is positional effect. This could only be ruled out by
generating several transgenic animals that show similar expression
patterns. Data from other similar studies have indicated that enhancer
elements for highly regulated genes, such as homeobox genes, may be
modular. In other word, assembly of different combinations of regulatory
c/s-elements is expected to generate different expression patterns.
130
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
References
Allen, N. D., Cran, D. G., Barton, S. C., Hettle, S., Reik, W., and Surani, M.
A. (1988). Transgenes as probes for active chromosomal domains in mouse
development. Nature 333, 852-855.
Anderson, D. M., Lymaan, S. D., Baird, A., Wignall, J. M., Eisenman, J.,
Rauch, C., March C. J., Boswell, H. S., Gimpel, S. D., Cosman, D., and
Williams, D., E. (1990). Molecular cloning of mast cell growth factor, a
hematopoietin that is active in both membrane bound and soluble forms. Cell
63, 235-243.
Awgulewitsch, A., Utset, M. F., Hart, C. P., McGinnis, W., and Ruddle, F. H.
(1986). Spatial restriction in expression of a mouse homeobox locus within
the central nervous system. Nature 320, 328-335.
Balling, R., Deutsch, U., and Gruss, P. (1988). undulated, a mutation
affecting the development of the mouse skeleton, has a point mutation in the
paired box of Pax-1. Cell 55, 531-535.
Balling, R., Mutter, G., Gruss, P., and Kessel, M. (1989). Craniofacial
abnormalities induced by ectopic expression of the homeobox gene Hox-1.1
in transgenic mice. Cell 58, 337-347.
Bellen, H. J., O'kane, C. J., Wilson, C., Grossniklaus, U., Pearson, R. K., and
Gehring, W. J. (1989). P-element-mediated enhancer detection: A versatile
method to study development in Drosophila. Genes & Dev. 3,1288-1300.
Bellen, H., Wilson, C., and Gehring, W. J. (1990). dissecting the complexity
of the nervous system by enhancer detection. BioEssays 12,199-204.
Boncinelli, E., Somma, R., Acampora, D., Pannese, M., D’Esposito, M.,
Faiella, A., and Simeone, A. (1988). Organisation of human homeobox
genes. Hum. Reprod. 3, 880-886.
Bonnerot, C., Grimber, G., Briand, P., and Nicolas, J.-F. (1990). Patterns of
expression of position-dependent integrated transgenes in mouse embryo.
Proc. Natl. Acad. Sci. USA 87,6331-6335.
Brinster, R. L., Chen, H. Y., Trumbauer, M., Sanear, A. W., Warren, R., and
Palmiter, R. D. (1981). somatic expression of herpes thymidine kinase in
mice following injection of a fusion gene into eggs. Cell 27,223-231.
Bultman, S. J., Michaud, E. J., and Woychik, R. P. (1992). Molecular
characterization of the mouse Agouti locus. Cell 71,1195-1204.
131
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
Bultman, S. J., Russell, L. B., Butierrez-Espeieta, G., and Woychik, R. P.
(1991). Molecular characterization of a region of DNA associated with
mutations at the agouti locus in the mouse. Proc. Natl. Acad. Sci. USA 88,
8062-8066.
Camper, S. A., Saunders, T. L., Kattz, R. W., and Reeves, R. H. (1990). The
pit-1 transcription factor gene is a candidate for the murine Snell dwarf
mutation. Genomics 8, 586-590.
Casadaban, M. J., and Cohen, S. N. (1979). Lactose genes fused to
exogenous promoters in one step using a Mu-lac bacteeriophage: in vivo
probe for transcriptional control sequences. Proc. Natl. Acad. Sci. USA 76,
4530-4533.
Chabot, B., Stephenson, D. A., chapman, W . M., Besmer, P., and Bernstein,
A. (1988). The proto-oncogene c-kit encoding a transmembrane tyrosine
kinase receptor maps to the mouse W locus. Nature 335, 88-89.
Charron, J., Malynn, B. A., Fisher, P., Stewart, V., Jeannotte, L., Goff, S. P.,
Robertson, E. J., and Alt, F. W. (1992). Embryonic lethality in mice
homozygous for a targeted disruption of the N-myc gene. Genes & Dev. 6,
2248-2257.
Chesley, P. (1935). Development of the short-tailed mutant in the house
mouse. J. Exp. Zool. 70,429-459.
Chisaka, O., and Capecchi, M. (1991). Rgionally restricted developmental
defects resulting from targetted disruption of the mouse homeobox gne
hox1.5. Nature 350, 473-479.
Chisaka, O., Musci, T., and Capecchi, M. (1992). Developmental defects of
the ear, cranial nerves and hindbrain resulting from targetted disruption of the
mouse homeobox gene Hox-1.6. Nature 355, 516-520.
Coelho, C. N. D., Krabbenhoft, K. M., Upholt, W. B., Fallon, J. F., and
Kosher, R. A. (1991). Altered expression of the chicken homeobox-
containing genes GHox-7 and GHox-8 in the limb buds of limbless mutant
chick embryos. Development 113,1487-1493.
Coelho, C. N. D., Sumoy, L., Rodgers, B. J., Davidson, D. R., Hill, R. E.,
Upholt W. B., and Kosher, R. A. (1991). Expression of the chicken
homeobox-containing gene GHox-8 during embryonic chick limb
development. Mech. Dev. 34,143-154.
132
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
Colberg-Poley, A. M., Voss, S. D., Chowdhury, K., and Gruss, P. (1985a).
Structual analysis of murine genes containing homeo box sequences and
theeir exparession in embryonal carcinoma cells. Nature 314, 713-718.
Colberg-Poley, A. M., Voss, S. D., Chowdhury, K., Stewart, C. L., Wagner, E.
F., and Gruss, P. (1985b). clustered homeo boxes are differentially
expressed during murine development. Cell 43, 39-45.
Copland, N. G., Gilbert, D. J., Cho, B. C., Donovan, P. J., Jenkins, N. A.,
cosman, D., Anderson, D., Lyman, S. D., and Williams, D. E. (1990). Mast
cell growth factor maps near the Steel locus on mouse chromosome 10 and
is deleted in a number of Steel alleles. Cell 63,175-183.
Costantini, F., and Lacy, E. (1981). Introduction of a rabbit b-globin gene into
the mouse germline. Nature 294, 92-94.
Couly, G. F., Coltey, P. M., and Le Douarin, N. M. (1992). The developmental
fate of the cephalic mesoderm in quail-chick chimeras. Development 114, 1-
15.
Covarrubias, L., Nishida, Y., and Mintz, B. (1986). Early postimplantation
embryo lethality due to DNA rearrangements in a transgenic mouse strain.
Proc. Natl. Acad. Sci. USA 83, 6020-6024.
Covarrubias, L., Nishida, Y., Terao, M., D'Eustachio, P., and Mintz, B.
(1987). cellular DNA rearrangements and early developmental arrest caused
by DNA insertion in transgenic mouse embryos. Mol. Cell. Biol. 7, 2243-
2247.
Crenshaw, E. B., Ryan, A., Dillon, S. R., Kalla, K., and Rosenfeld, M. G.
(1991). wocko, a neurological mutant generated in a transgenic mouse
pedigree. J. Neurosci. 11,1524-1530.
Davidson, D. R., Crawley, A., Hill, R. E., and Tickle, C. (1991). Position-
dependent expression of two related homeobox genes in developing
vertebrate limbs. Nature 352,429-431.
Dony, C., and Gruss, P. (1987). Specific expression of the HOx 1.3 homeo
box gene in murine embryonic structures originating from or induced by the
mesoderm. EMBO J. 6,2965-2975.
Downs, K. M., Martin, G. R., and Bishop, J. M. (1989). Contrasting patterns
of myc and N-myc expression during gastrulation of the mouse embryo.
Genes & Dev. 3, 860-869.
133
permission of the copyright owner. Further reproduction prohibited without permission.
Duboule, D., Baron, A., Mahl, P., and Galliot, B. (1986). A new homeobox is
present in overlapping cosmid clones which define the mouse Hox-1 locus.
EMBO J. 5, 1973-1980.
Erselius, J. R., Goulding, M. D., and Gruss, P. (1990). Structure and
expression pattern of the murine Hox-3.2 gene. Development 110, 629-642.
Fibi, M., Zink, B., Kessel, M„ Colberg-Poley, A. M., Labeit, S., Lehrach, H.,
and Gruss, P. (1988). coding sequence and expression of the homeobox
gene Hox 1.3. Development 102, 349-359.
Flanagan, J. G., and Leder, P. (1990). The kit ligand: a cell surface molecule
altered in Steel mutant fibroblasts. Cell 63,185-194.
Frohman, M. A., Dush, M. K., and Martin, G. R. (1988). Rapid production of
full length cDNAs from rare transcripts: Amplification using a single gene-
specific oligonucleotide primer. Proc. Natl. Acad. Sci. USA 85, 8998-9002.
Gaunt, S. J., Coletta, P. L., Pravtcheva, D., and Sharpe, P. T. (1990). Mouse
Hox-3.4: homeobox sequence and embryonic expression patterns compared
with other members of the Hox gene network. Development 109, 329-339.
Geissler, E. N., Ryan, M. A., and Housman, D. E. (1988). The dominant-
white spotting (W) locus of the mouse encodes the c-kit proto-oncogene. Cell
55,185-192.
Gordon, J. W., and Ruddle, F. H. (1981). Integration and stable germ line
transmission of genes injected into mouse pronuclei. Science 214, 1244-
1246.
Gordon, J. W., Scangos, G. A., Plotkin, D. J., Barbosa, J. A., and Ruddle, F.
H. (1980). Genetic tmasformation of mouse embryos by microinjection of
purified DNA. Proc. Natl. Acad. Sci. USA 77, 7380-7384.
Goulding, M. D., Chalepakis, G., Deutsch, V., Erselius, J. R., and Gruss, P.
(1991). Pax-3 a novel murine DNA binding protein expressed during early
neurogenesis. EMBO J. 10,1135-1147.
Graham, A., Papalopulu, N., Lorimer, J., McVey, J. H., Tuddenham, E. G. D.,
and Krumlauf, R. (1988). Characterization of a murine homeo box gene, Hox-
2.6, related to the Drosophila Deformed gene. Genes & Dev. 2,1424-1438.
permission of the copyright owner. Further reproduction prohibited without permission.
Gridley, T., Gray, D. A., Orr-Weaver, T., Soriano, P., Barton, D. E., francke,
U., and Jaenisch, R. (1990). Molecular analysis of the Mov 34 mutation:
Transcript disrupted by proviral integration in mice is conserved in
Drosophila. Development 109, 235-242.
Gruneberg, H. (1953). Genetical studies on the skeleton of the mouse. VII.
Congenital hydrocephalus. J. Genet. 51, 327-358.
Harbers, K., Jahner, D., and Jaenisch, R. (1981). Microinjection of cloned
retroviral genomes into mouse zygotes: integration and expression in the
animal. Nature 293, 540-542.
Harbers, K., Kuehn, M., Delius, H., and Jaenisch, R. (1984). Insertion of
retrovirus into the first intron of alpha 1(1) collagen gene leads to embryonic
lethal mutation in mice. Proc. Natl. Acad. Sci. USA 81,1504-1508.
Harris, M. W., and Fraser, F. C. (1968). Lidgap in newborn mice: a study of
its cause and prevention. Teratol. 1,417-424.
Harris, M. J., and Juriloff, D. M. (1986). Eyelid development and fusion
induced by cortisone treatment in mutant, lidgap-Miller, foetal mice. A
scanning electron microscope study. J. Embryol. exp. Morph. 91,1-18.
Harris, M. J., and McLeod, M. J. (1982). Eyelid growth and fusion in fetal
mice. A scanning electron microscope study. Anat. Embryol. 164,207-220.
Hart, C. P., Awgulewitsch, A., Fainsod, A., McGinnis, W., and Ruddle, F. H.
(1985). Homeo box gene complex on mouse chromosome 11: molecular
cloning, expression in embryogenesis, and homology to a human homeo box
locus. Cell 43, 9-18.
Herrmann, B. G., Labeit, S., Poustka, A., King, T. R., and Lehrach, H. (1990).
Cloning of the T gene required in mesoderm formation in the mouse. Nature
343, 617-622.
Hill, R. E., Jones, P. F., Rees, A. R., Sime, C. M., Justice, M. J., Copeland,
N. G., Jenkins, N. A., Graham, E., and Davidson, D. R. (1989). A new family
of mouse homeo box-containing genes: molecular structure, chromosomal
location, and developmental expression of Hox-7.1. Genes & Dev. 3,26-37.
Himing, U., Schmid, P., Schulz, W. A., Rettenberger, G., and Hameister, H.
(1991). A comparative analysis of N-myc and c-myc expression and cellular
proliferation in mouse organogenesis. Mech. Dev. 33,119-125.
135
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
Huang, E., Nocka, K., Beier, D. R., Chu, T.-Y., Buck, J., Lahm, H.-W.,
Wellner, D., Leder, P., and Besmer, P. (1990). The hematopoietic growth
factor KL is encoded at the Steel locus and is the ligand of the c-kit receptor,
the gene product of the W locus. Cell 63, 225-233.
Izpisua-Belmonte, J.-C., Dolle, P., Renucci, A., Zappavigna, V., Falkenstein,
H., and Duboule, D. (1990). Primary structure and embryonic expression
pattern of the mouse Hox-4.3 homeobox gene. Development 110, 733-745.
Jaenisch, R. (1988). Transgenic animals. Science 240,1468-1474.
Jaenisch, R., Jahner, D., Nobis, P., Simon, I., Lohler, J., Harbers, K., and
Grotkopp, D. (1981). chromosomal position and activation of retroviral
genomes inserted into the germ line of mice. Cell 4, 519-529.
Jaenisch, R., Harbers, K., Schnieke, A., Lohler, J., chumakov, I., Jahner, D.,
Grotkopp, D., and Hoffmann, E. (1983). Germline integration of Moloney
Murine Leukemia virus at the Mov13 locus leads to recessive lethal mutation
and early embryonic death. Cell 32, 209-216.
Jones, K. L. (1988). Smith's Recognizable Patterns of Human Malformation.
Philadelphia: W. B. Saunders Co.
Juriioff, D. M., and Harris, M. J. (1983). Abnormal facial development in the
mouse mutant first arch. J. Craniofacial Genet, and Dev. Biol. 3, 317-337.
Kelton, D. E., and Smith, V. (1964). Gaping, a new open eyelid mutation in
the house mouse. Genetics 50, 261-262. (Abstract.)
Kessel, M., Balling, R., and Gruss, P. (1990). vraiations of cervical vertebrae
after expression of a Hox 1.1 transgene in mice . Cell 61, 301-308.
Keto, K., Kanamori, A., Wakamatsu, Y., Sawai, S., and Kondos, H. (1991).
Tissue distribution of N-myc expression in the early organogenesis period of
the mouse embryo. Dev. Growth Differ. 33,29-36.
Kothary, R., Clapoff, S., Brown, A., Campbell, R., Peterson, A., and Rossant,
J. (1988). A trangene containing lacZ inserted into the dystonia locus is
expressed in neural tube. Nature 335,435-437.
Krulewski, T. F., Neumann, P. E., and Gordon, J. W. (1989). Insertional
mutation in a transgenic mouse allelic with Purkinje cell degeneration. Proc.
Natl. Acad. Sci. USA 86, 3709-3712.
136
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
Krumlauf, R., Holland, P. W. H., McVey, J. H., and Hogan, B. L. M. (1987).
Developmental and spatial patterns of expression of the mouse homeobox
gene, Hox 2.1. Development 99,603-617.
Lacy, E., Roberts, S., Evans, E. P., Burtenshaw, M. D., and Costantini, F. D.
(1983). A foreign b-globin gene in transgenic mice: Integration at abnormal
chromosomal positions and expression in inappropriate tissues. Cell 34, 343-
358.
Langner, C.A., Birkenmeier, E.H., Ben-Zeev, O., Schotz, M.C., Sweet, H.O.,
Davisson, M.T., and Gordon, J.l. (1989). The fatty liver dystrophy (fid)
mutation. A new mutant mouse with a developmental abnormality in
triglyceride metabolism and associated tissue-specific defects in lipoprotein
lipase and hepatic lipase activities. J. Biol. Chem. 264, 7994-8003.
Le Douarin, N. M. (1982). The Neural Crest. Cambridge: Cambridge
University Press.
Le Douarin, N. M. (1986). Ontogeny of the peripheral nervous system from
the neural crest and the placodes. A developmental model studied on the
basis of the quail-chick chimaera system. The Harvey Lectures, Series 80,
137-186.
Lee, J. J., Radice, G., Perkins, C. P., and Costantini, F. (1992). Identification
and characterization of a novel, evolutionarily conserved gene disrupted by
the murine Hb58 embryonic lethal transgene insertion. Development 115,
277-288.
Le Lievre, C. S., and Le Douarin, N. M. (1975). Mesenchymal derivatives of
the neural crest analysis of chimaeric quail and chick embryos. J. Embryol.
exp. Morph. 34,125-154.
LeMouellic, H., Lallemand, Y., and Brulet, P. (1992). Homeosis in the mouse
induced by a null mutation in the Hox 3.1 gene. Cell 69,251-264.
Li, S., Crenshaw, E. B., Rawson, E. J., Simmons, D. M., Swanson, L. W.,
and Rosenfeld, M. G. (1990). Dwarf locus mutants lacking three pituitary cell
types result from mutations in the POU-domain gene pit-1. Nature 347,528-
533.
Lufkin, T., Dierich, A., LeMeur, M., Mark, M., and Chambon, P. (1991).
Disruption of the Hox-1.6 homeobox gene results in defects in a region
corresponding to its rostral domain of expression. Cell 66,1105-1119.
137
permission of the copyright owner. Further reproduction prohibited without permission.
Lyons, K. M., Pelton, R. W., and Hogan, B.L.M. (1990). Organogenesis and
pattern formation in the mouse: RNA distribution patterns suggest a role for
Bone Morphogenic Protein-2A (BMP-2A). Development 109, 833-844.
Mackensen, J. S. (1960). "Open eyelids" in newborn mice. J. Hered. 51,188-
190.
MacKenzie, A., Ferguson, M. W. J., and Sharpe, P. T. (1992). Expression
patterns of the homeobox gene, Hox-8, in the mouse embryo suggest a role
in specifying tooth initiation and shape. Development 115, 403-20.
MacKenzie, A., Ferguson, M. W. J., and Sharpe, P. T. (1991b). Hox-7
expression during murine craniofacial development. Development 113, 601-
611.
MacKenzie, A., Leeming, G., Jowett, A. K., Ferguson, M. W. J., and Sharpe,
P. T. (1991a). The homeobox gene Hox-7.1 has specific regional and
temporal expression patterns during early murine craniofacial
embryogenesis, especially tooth development in vivo and in vitro.
Development 111, 269-285.
Maconnachie, E. (1979). A study of digit fusion in the mouse embryo. J.
Embryol. exp. Morph. 49, 259-276.
Mahon, K. A., Overbreek, P. A., and Westphal, H. (1988). Prenatal lethality in
a tmasgenic mouse line is the result of a chromosomal translocation. Proc.
Natl. Acad. Sci. USA 85,1165-1168.
Mandell, J., Koch, W.K,. Nidess, R., Preminger, G.M., and McFarland, E.
(1983). Congenital polycystic kidney disease. Genetically transmitted infantile
polycystic kidney disease in C57BL/6J mice. Am. J. Pathol. 113, 112-114.
Mark, W. H., Signorelli, K., and Lacy, E. (1985). An insertional mutation in a
transgenic mouse line results in developmental areest at day 5 of gestation.
Cold Spring Harbor Symp. Quant. Biol. 50, 315-320.
Martin, F. H., Suggs, S. V., Langley, K. E., Lu, H. S., Ting, J., Okino, K. H.,
Moms, C. F., McNeice, I. K., Jacobsen, F. W., Mendiaz, E. A., Birkett, N. C.,
Smith, K. A., Johnson, M. J., Parker, V. P., Flores, J. C., Patel, A. C., Fisher,
E. F., Erjavec, H. O., Herrera, C. J., Wypych, J., Sachdev, R. K., Pope, J. A.,
Leslie, I., Wen, D., Lin, C.-H., Cupples, R. L , and Zsebo, K. M. (1990).
Primary structure and functional expression of rat and human stem cell factor
DNAs. Cell 63,203-211.
138
permission of the copyright owner. Further reproduction prohibited without permission.
Matzuk, M. M., and Bradley, A. (1992). Structure of the mouse activin
receptor type II gene. Biochem. Biophys. Res. Com. 185, 404-413.
Maviiio, F., Simeone, A., Giampolo, A., Faiella, A., Zappavigna, V.,
Acampora, D., Poiana, G., Russo, G., Peschle, C., and Boncinelli, E. (1986).
Differential and stage-related expression in embryonic tissues of a new
human homeobox gene. Nature 324,664-668.
McBumey, M. W., Jones-Villeneuve, E. M. V., Edwards, M. K. S., and
Anderson, P. J. (1982). Control of muscle and neuronal differentiation in a
cultured embryonic carcinoma cell line. Nature 299,165-167.
McGinnis, W., and Krumlauf, R. (1992). Homeobox genes and axial
patterning. Cell 68, 283-302.
McGinnis, W., Garber, R. L., Wirz, J., Kuriwa, A., and Gehring, W., J.
(1984a). A homologous protein-coding sequence in Drosophila homeotic
genes and its conservation in other Metazoans. Cell 37,403-408.
McGinnis, W., Hart, C. P., Gehring, W. J., and Ruddle, F. H. (1984b).
Molecular cloning and chromosome mapping of a mouse DNA sequence
homologous to homeotic genes of Drosophila. Cell 38, 675-680.
McLain, K., Schreiner, C., Yager, K. L., Stoch, J. L., and Potter, S. S. (1992).
Ectopic expression of Hox-2.3 induces craniofacial and skeletal
malformations in transgenic mice. Mechanisms of Development 39, 3-16.
McLeod, M. J., Harris, M. J., Chemoff, G. F., and Miller, J. R. (1980). First
arch malformation: a new craniofacial mutant in the mouse. J. Heredity 71,
331-335.
McNeish, J. D., Thayer, J., Walling, K., Sulik, K. K., Potter, S. S., and Scott,
W. J. (1990). Phenotypic characterization of the transgenic mouse insertions!
mutation, legless. J. Exp. Zool. 253,151-162.
Meisler, M. H. (1992). Insertional mutation of'classical' and novel genes in
transgenic mice. Trends in Genetics 8, 341-344.
Miller, J. R. (1964). Mouse News Lett. 30,16.
Miyatani, S., Copeland, N. G., Gilbert, D. J., Jenkins, N. A., and Takeichi, M.
(1992). Genomic structure and chromosomal mapping of the mouse N-
cadherin gene. Proc. Natl. Acad. Sci. USA 89, 8443-8447.
139
permission of the copyright owner. Further reproduction prohibited without permission.
Moens, C. B., Auerbach, A. B., Conlon, R. A., Joyner, A. L., and Rossant, J.
(1992). A targeted mutation reveals a role for N-myc in branching
morphogenesis in the embryonic mouse lung. Genes & Dev. 6,691-704.
Monaghan, A. P., Davidson, D. R., Sime, C., Graham, E., Baldock, R.,
Bhattacharya, S. S., and Hill, R. E. (1991). The Msh-like homeobox genes
define domains in the developing vertebrate eye. Development 112, 1053-
1061.
Mugrauer, G., Alt, F. W., and Ekblom, P. (1988). N-myc proto-oncogene
expression during organogenesis in the developing mouse as revealed by in
situ hybridization. J. Cell. Biol. 107,1325-1335.
Murphy, S. P., Garbern, J., Odenwald, W. F., Lazzarini, R. A., and Linney, E.
(1988). Differential expression of the homeobox gene Hox-1.3 in F9
embryonal carcinoma cells. Proc. Natl. Acad. Sci. USA 85, 5587-5591.
Nichols, D. H. (1981). Neural crest formation in the head of the mouse
embryo as observed using a new histological technique. J. Embryol. exp.
Morph. 64,105-120.
Nichols, D. H. (1986). Formation and distribution of neural crest
mesenchyme to the first pharyngeal arch region of the mouse embryo. Am. J.
Anatomy 176, 221-231.
Nichols, D. H. (1987). Ultrastructure of neural crest formation in the
midbrain/rostral hindbrain and preotic hindbrain regions of the mouse
embryo. Am. J. Anatomy 179,143-154.
Nocka, K., Tan, J. C., Chiu, E., Chu, T. Y., Ray, P., Traktman, P., and
Besmer, P. (1990). Molecular bases of dominant negative and loss of
function mutations at the murine c-kit/whrte spotting locus: l/V 3 7 , W , W4 1 , and
W. EMBO J. 9, 1805-18113.
Noden, D. M. (1982). Pattern and Organization of Craniofacial Skeletogenic
and Myogenic Mesenchyme: a Perspective Factors and Mechanisms
Influencing Bone Growth, pp. 167-203. New York, Alan R. Liss.
Noden, D. M. (1983a). The role of the neural crest in patterning of avian
cranian skeletal, connective and muscle tissues. Devi. Biol. 96,145-165.
Noden, D. M. (1983b). The embryonic origins of avian craniofacial muscles
and associated connective tissues. Am. J. Anat. 168,257-276.
140
permission of the copyright owner. Further reproduction prohibited without permission.
Noden, D. M. (1986). Patterning of avian craniofacial muscles. Devi. Biol.
116, 347-356.
Odenwald, W. F., Taylor, C. F., Palmer-Hill, F. J., Friedrich, V., Tani, M., and
Lazzarini, R. A. (1987). Expression of a homeo domain protein in noncontact-
inhibited cultured cells and postmitotic neurons. Genes & Dev. 1,482-496.
O'Kane, C. J., and Gehring, W. J. (1987). Detection in situ of genomic
regulatory elements in Drosophila. Proc. Natl. Acad. Sci. USA 84, 9123-
9127.
Opstelton, D. J. E., Vogels, R., Benort, R., Kalkhave, E., Zwartokeruls, F., de
Laaf, L., Destree, O. H., Deschamps, J., Larson, K. A., and Meijlink, F.
(1991). The mouse homeobox gene, S8, is expressed during embryogenesis
predominantly in mesenchyme. Mech. Dev. 34, 29-42.
Osumi-Yamashita, N., Noji, S., Nohno, T., Koyama, E., Doi, H., Eto, K., and
Taniguchi, S. (1990). Expression of retinoic acid receptor genes in neural
crest-derived cells during mouse facial development. FEBS-Lett. 246, 71-4.
Overbeek, P. A., Lai, S.-P., Van Quill, K. R., and Westphal, H. (1986).
Tissue-specific expression in transgenic mice of a fused gene containing
RSV terminal sequences. Science 231,1574-1577.
Palmiter, R. D., and Brinster, R. L. (1986). Germ-line transformation of mice.
Annu. Rev. Genet. 20, 465-499.
Pei, Y. F., and Rhodin, J. A. G. (1970). The prenatal development of the
mouse eye. Anat. Rec. 168,105-126.
Radice, G., Lee, J. J., and Costantini, F. (1991). Hb58, an insertional
mutation affecting early postimplantation development of the mouse embryo.
Development 111, 801 -811.
Readhead, C., Popko, B., Takahashi, N., Shine, H. D., Saavedra, R. A.,
Sidman, R. L., and Hood, L. (1987). Expression of a myelin basic protein in
transgenic sheerer mice: Correction of the dysmyelinating phenotype. Cell
48, 703-712.
Reith, A. D., and Bernstein, A. (1992). Molecular basis of mouse
developmental mutants. Genes and Dev. 5,1115-1123.
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
Rubin, M. R., King, W., Toth, L. E., Sawczuk, I. S., Levine, M. S.,
D'Eustachio, P., Nguyen-Huu, C. M. (1987). Murine Hox-1.7 homeo-box
gene: cloning, chromosomal location, and expression. Mol. Cell. Biol. 7,
3836-3841.
Rubin, R. R., Toth, L. E., Patel, M. D., D'Eustachio, P. D., and Nguyen-Huu,
C. M. (1986). A mouse hoeobox gene is expressed in spermatocytes and
embryos. Science 233, 663-667.
Ruddle, H. F., Hart, C., Awguiewitsch, A., Fainsod, A., Utset, M., Dalton, D.,
Kerk, N., Rabin, M., Ferguson-Smith, A., Fienberg, A. and McGinnis, W.
(1985). Mammalian homeo box genes. Cold Spring Harbor Symp. quant.
Biol. 50, 277-284.
Russell, E.S. and McFarland, E.C. (1977). Cystic kidneys, ck. Mouse News
Lett. 56, 40.
Schnieke, A., Harbers, K., Jaenisch, R. (1983). Embryonic lethal mutation in
mice induced by retrovirus insertion into the a1(l) collagen gene. Nature 304,
315-320
Scott, M. P., Tamkun, J. W., and Hartzell, G. W. (1989). The structure and
function of the homeodomain. Biochem. et Biophysica Acta 989, 25-48.
Scott, M. P., and Weiner, A. J. (1984). Structural relationships among genes
that control development: sequence homology between the Antennapedia,
Ultrabithorax, and fushi tarazu loci of Drosophila. Proc. Natl. Acad. Sci. USA
81,4225-4119.
Serbedzija, G. N., Bronner-Fraser, M, and Fraser, S. E. (1992). Vital dye
analysis of cranial neural crest cell migration in the mouse embryo.
Development 116, 297-307.
Shani, M. (1986). Tissue-specific and developmentaily regulated expression
chimeric actin/globin gene in transgenic mice. Mol. Cell. Biol. 6, 2624-2431.
Shiraishi, A., Sakumi, K., Nakatsu, Y., Hayakawa, H., and Sekiguchi, M.
(1992). Isolation and characterization of cDNA and genomic sequences for
mouse 0 6 -methylguanine-DNA methyltransferase. Carcinognesis 13, 289-
296.
Simeone, A., Acampora, D., Arcioni, L., Andrews, P. W., Boncinelli, E., and
Mavillo, F.(1990). Sequential activation of HOX2 homeobox genes by retinoic
acid in human embryonal carcinoma cells. Nature 346, 763-766.
142
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
Simeone, A., Acampora, D., Nigro, V., Fajella, A., D'Esposito, M., Storaluolo,
A., Mavillo, F., and Boncinelli, E. (1991). Differential regulation by retinoic
acid of the homeobox genes of the four Hox loci in human embryonal
carcinoma cells. Mech. Dev. 33, 215-228.
Singh, G., Supp, D. M., Schreiner, C., McNeish, J., Merker, H.-J., Copeland,
N. G., Jenkins, N. A., Potter, S. S., and Scott, W. (1991). Genes & Dev. 5,
2245-2255.
Skarnes, W. C., Auerbach, B. A., and Joyner, A. L. (1992). A gene trap
approach in mouse embryonic stem cells: the lacZ reporter is activated by
splicing, reflects endogenous gene expression, and is mutagenic in mice.
Genes & Dev. 6, 903-918.
Soriano, P., Gridley, T., and Jaenisch, R. (1987). Retroviruses and
insertional mutagenesis in mice: Proviral integration at the Mov-34 locus
leads to early embryonic death. Genes & Dev. 1, 366-375.
Takahashi, Y., Bontoux, M., and Le Douarin, N. M. (1991). Epithelio-
mesenchymal interactions are critical for Quox7 expression and membrane
bone differentiation in the neural crest derived mandibular mesenchyme.
EMBO J. 10, 2387-2393.
Takahashi, Y., and Le Douarin, N. M. (1990). cDNA cloning of a quail
homeobox gene and its expression in neural crest-derived mesenchyme and
lateral plate mesoderm. Proc. Natl. Acad. Sci. USA 87, 7482-7486.
Takahashi, Y., Monsoro-Burq, A.-H., Bontoux, M., and Le Douarin, N. M.
(1992). A role for Quox-8 in the establishment of the dorsoventral pattern
during vertebrate development. Proc. Natl. Acad. Sci. USA 89,10237-10241.
Tan, S.-S. (1991). Liver-specific and position-effect expression of a retinol-
binding protein-lacZ fusion gene (RBP-lacZ) in transgenic mice. Dev. Biol.
146, 24-37.
Tani, M., Odenwald, W. F., Lazzarini, R. A., and Friederich, V. L. (1989).
Progressive restriction in the distribution of Hox-1.3 homeodomain protein
during embryogenesis. J. Neruosci. 24,457-469.
Terao, M., Studer, M., Gianni, M., and Garattini, E. (1990). Isolation and
characterization of the mouse liver/bone/kidney-type alkaline phosphatase
gene. Biochem. J. 268, 641-648.
Theiler, K. (1972). The House Mouse, p. 143. New York: Springer-Verlag.
143
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
Tuggle, C. 1 C , Zakany, J., cianetti, L., Peschle, C., and Nguyen-Huu, M. C.
(1990). Region-specific enhancers near two mammalian homeo box genes
define adjacent rostrocaudal domains in the central nervous system. Genes
& Dev. 4,180-189.
Wagner, E. F., Covarrubias, L., Stewart, T. A., and Mintz, B. (1983). Prenatal
lethalities in mice homozygous for human growth hormone gene sequences
integrated in the germ line. Cell 35,647-55.
Wagner, E. F., Stewart, T. A., and Mintz, B. (1981). The human b-globin
gene and a functional viral thymidine kinase gene in developing mice. Proc.
Natl. Acad. Sci. USA 78, 5016-5020.
Wagner, T. E., Hoppe, P. C., Jollick, J. D., Scholl, D. R., Hodinka, R. L., and
Gault, J. B. (1981). Microinjection of a rabbit b-globin gene into zygotes and
its subsequent expression in adult mice and their offspring. Proc. Natl. Acad.
Sci. USA 78, 6376-6380.
Wang, Y., Macke, J. P., Merbs, S. L., Zack, D. J., Klaunberg, B., Bennett, J.,
Gearhart, J., and Nathans, J. (1992). A locus control region adjacent to the
human red and green visual pigment genes. Neuron 9, 429-440.
Weiher, H., Noda, T., Gray, D. A., Sharpe, A. H., Jaenisch, R. (1990).
Trnasgenic mouse model of kidney disease: Insertional inactivaton of
ubiquitously expressed gene leads to nephrotic syndrome. Cell 62,425-434.
Weis, J., Fine, S. M., David, C., Savarirayan, S., and Sanes, J. (1991).
Integration site-dependent expression of a transgene reveals specialized
features of cells associated with neuromuscular junctions. J. Cell Biol. 113,
1385-1397.
Wilkie, T. M., and Palmiter, R. D. (1987). Analysis of the integrant in Myk-103
trnasgenic mice in which males fail to transmit the integrant. Mol. Cell. Biol.
7, 1646-1655.
Wilkinson, D. G., Bhatt, S., and Herrmann, B. G. (1990). Expression pattern
of the mouse 7 " gene and its role in mesoderm formation. Nature 343,657-
659.
Williams, D. E., Eisenman, J., Baird, A., Rauch, C., Ness, V. K., March, C. J.,
Park, L. S., Martin, U., Mochizuki, D. Y., boswell, H. S., Burgess, G. S.,
Cosman, D., and Lyman, S. D. (1990). Identification of a ligand for the c-kit
proto-oncogene. Cell 63,167-174.
144
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
Woychik, R. P., Stewart, R. A., Davis, L. G., D'Eustachio, P., and Leder, P.
(1985). An inherited limb deformity created by insertional mutagenesis in a
transgenic mouse. Nature 318, 36-40.
Woychik, R. P., Generoso, W. M., Russell, L. B., Cain, K. T., Cacheiro, N. L.
A., Bultman, S. J., Selby, P. B., Dickinson, M. E., Hogan, B. L. M., and
Rutledge, J. C. (1990a). Molecular and genetic characterization of a
radiation-induced structural rearrangement in mouse chromosome 2 causing
mutations at the limb deformity and agouti loci. Proc. Natl. Acad. Sci. USA
87, 2588-2592.
Woychik, R. P., Maas, R. L., Zeller, R., Vogt, T. F., and Leder, P. (1990b).
'Formins': proteins deduced from the alternative transcripts of the limb
deformity gene. Nature 346, 850-853.
Xiang, X., Benson, K. F., and Chada, K. (1990). Mini-mouse: Disruption of
the pygmy locus in a transgenic insertional mutant. Science 247, 967-969.
Yanagisawa, K. O., Fujimoto, H., and Urushihara, H. (1981). Effects of the
Brachyury (7) mutation on morphogenetic movement in the mouse embryo.
Dev. Biol. 87, 242-248.
Yoshida, H., Hayashi, S.-l., Kunisada, T., Ogawa, M., Nishikawa, S.,
Okamura, H., Sudo, T., Shultz, L. D., and Nishikawa, S.-l. (1990). The
murine mutation osteopetrosis is in the coding region of the macrophage
colony stimulating factor gene. Nature 345,442-443.
Zakany, J., Tuggle, C. K., Patel, M., and Nguyen-Huu, M. C. (1988). Spaatial
regulation of homeobox gene fusions in the embryonic central nervous
system of transgenic mice. Neuron 1,679-691.
Zeller, R., Jackson-Grusby, L., and Leder, P. (1989). The limb deformity
gene is required for apical ectodermal ridge differentiation and
anteroposterior limb pattern formation. Gene & Dev. 3,1481-1492.
Zsebo, K. M., Williams, D. A., Geissler, E. N., Broudy, V. C., Martin, F. H.,
Atkins, H. L., Hsu, R.-Y., Birkett, N. C., Okino, K. H., Murdock, D. C.,
Jacobsen, F. W., Langley, K. E., Smith, K. A., Takeishi, T., Cattanach, B. M.,
Galli, S. J., and Suggs, S. V. (1990b). Stem cell factor is encoded at the SI
locus of the mouse and is the ligand for the c-kit tyrosine kinase receptor.
Cell 63, 213-224.
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
Zsebo, K. M., Wypych, J., McNeice, I. K., Lu, H. S., Smith, K. A., Karkare, S.
B., Sachdev, R. K., Yuschenkoff, V. N., Birkett, N. C., Williams, L. R.,
Satyagel, V. N., Tung, W., Bosselman, R. A., Mendiaz, E. A., and Langley, K.
E. (1990a). Identification, purification and biological characterisation of
hemopoietic stem cell factor from Buffalo rat liver-conditioned medium. Cell
63, 195-201.
146
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.

Linked assets

University of Southern California Dissertations and Theses

Conceptually similar

PDF

Identification of oncogenes cooperating in murine mammary tumorigenesis and transgenic mouse models of breast cancer

PDF

A new model for hepatitis delta virus transcription and replication

PDF

Expression of the RGR opsin and its function in the photic visual cycle

PDF

Immunogenicity of acute lymphoblastic leukemia: In vivo and in vitro studies of Bcr -Abl specific immune responses

PDF

Different roles of p160 coregulators in myogenesis

PDF

A tale of two tails: Role of histone methyltransferases in transcriptional regulation

PDF

Gene therapy for motor neuron degeneration in murine tissue culture and transgenic mouse models of familial amyotrophic lateral sclerosis

PDF

A POU gene expressed in the early sea urchin embryo: Structure, evolution and requirement for embryonic development

PDF

Identification of genes that positively and negatively regulate life span and stress resistance in Drosophila melanogaster

PDF

Characterization of the EWS -FLI1 fusion protein in the tumorigenesis of Ewing's family of tumors

PDF

Functional analysis of MSX2 and its role in skull patterning

PDF

Cloning and characterization of Grb4: A novel adapter protein interacting with BCR -Abl

PDF

Coactivator synergy for nuclear receptors: Regulatory roles of arginine methyltransferase activity in transcription

PDF

An E2F-independent mechanism in transcriptional control of the hamster histone H3.2 gene expression

PDF

Identifying susceptibility genes for complex diseases by accounting for epistasis in studies of candidate genes

PDF

Effect of genetic factors in the development of childhood lymphocytic leukemia (ALL)

PDF

Identification of the biochemical pathways affected by the anticancer agents Motexafin Gadolinium and Sapphyrin through gene expression profiling

PDF

Cloning, characterization, anti -apoptotic molecular mechanism, transgenic and protein binding studies of mouse TOSO gene

PDF

Development of novel adenovirus-retroelement vectors and their applications beyond gene therapy

PDF

Development of replication -competent retroviral vectors for efficient, targeted gene therapy of cancer

Asset Metadata

Creator Liu, Yi-Hsin (author)

Core Title Identification and cloning of developmentally regulated genetic loci in transgenic mice by screening for novel expression pattern of the lacZ reporter gene

School Graduate School

Degree Doctor of Philosophy

Degree Program Microbiology

Publisher University of Southern California (original), University of Southern California. Libraries (digital)

Tag biology, genetics,biology, molecular,OAI-PMH Harvest

Language English

Contributor Digitized by ProQuest (provenance)

Advisor Weiner, Leslie P. (committee chair), Hinton, David (committee member), Maxson, Robert E. (committee member), Tahara, Stanley (committee member)

Permanent Link (DOI) https://doi.org/10.25549/usctheses-c16-222230

Unique identifier UC11334815

Identifier 3073807.pdf (filename),usctheses-c16-222230 (legacy record id)

Legacy Identifier 3073807.pdf

Dmrecord 222230

Document Type Dissertation

Rights Liu, Yi-Hsin

Type texts

Source University of Southern California (contributing entity), University of Southern California Dissertations and Theses (collection)

Access Conditions The author retains rights to his/her dissertation, thesis or other graduate work according to U.S. copyright law. Electronic access is being provided by the USC Libraries in agreement with the au...

Repository Name University of Southern California Digital Library

Repository Location USC Digital Library, University of Southern California, University Park Campus, Los Angeles, California 90089, USA