University of Southern California Dissertations and Theses

Immunogenicity of acute lymphoblastic leukemia: In vivo and in vitro studies of Bcr -Abl specific immune responses

(USC Thesis Other)

Immunogenicity of acute lymphoblastic leukemia: In vivo and in vitro studies of Bcr -Abl specific immune responses

PDF

Download a page range

Download transcript

Copy asset link

Request this asset

Transcript (if available)

Content INFORMATION TO USERS This manuscript has been reproduced from the microfilm master. UM I films the text directly from the original or copy submitted. Thus, some thesis and dissertation copies are in typewriter face, while others may be from any type of computer printer. The quality of this reproduction is dependent upon the quality of the copy submitted. Broken or indistinct print, colored or poor quality illustrations and photographs, print bleedthrough, substandard margins, and improper alignment can adversely affect reproduction. In the unlikely event that the author did not send UM I a complete manuscript and there are missing pages, these will be noted. Also, if unauthorized copyright material had to be removed, a note w ill indicate the deletion. Oversize materials (e.g., maps, drawings, charts) are reproduced by sectioning the original, beginning at the upper left-hand comer and continuing from left to right in equal sections with small overlaps. ProQuest Information and Learning 300 North Zeeb Road, Ann Arbor. Ml 48106-1346 USA 800-521-0600 Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. NOTE TO USERS This reproduction is the best copy available. IJMJ Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. IMMUNOGENICITY OF ACUTE LYMPHOBLASTIC LEUKEMIA: IN VIVO AND IN VITRO STUDIES OF BCR-ABL SPECIFIC IMMUNE RESPONSES by Tanja Andrea Gruber A Dissertation Presented to the FACULTY OF THE GRADUATE SCHOOL UNIVERSITY OF SOUTHERN CALIFORNIA In Partial Fulfillment of the Requirements for the Degree DOCTOR OF PHILOSOPHY (MOLECULAR MICROBIOLOGY AND IMMUNOLOGY) December 2001 Copyright 2001 Tanja Andrea Gruber Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. U M I Number. 3065791 Copyright 2001 by Gruber, Tanja Andrea A ll rights reserved. UMI’ U M I Microform 3065791 Copyright 2002 by ProQuest Information and Learning Company. All rights reserved. This microform edition is protected against unauthorized copying under Tide 17, United States Code. ProQuest Information and Learning Company 300 North Zeeb Road P.O. Box 1346 Ann Arbor, M l 48106-1346 Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. UNIVERSITY OF SOUTHERN CALIFORNIA The G raduate School U n iversity Park LOS ANGELES, CALIFORNIA 900891695 This dissertation, w ritten b y Tania A ndrea G ruber_____________________ U nder the d irectio n o f h js x . D issertation Com m ittee, and approved b y all its members, has been p resen ted to and accepted b y The Graduate School, in p a rtia l fulfillm en t o f requirem ents fo r th e degree o f DOCTOR O F PHILOSOPHY D ISSE R T A T IO N C O M M ITTE E n r , n i Chairperson - 1. J J\ A \ W lri I O . if J\ A \ K lri I O . If l * ^ »»■ ■ i s > r Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. Dedication To my mother and father for all of their love and support and to Dianne C. Skelton for all her hard w ork Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. Acknowledgments Special thanks to Dianne Skelton who provided both technical assistance and friendship. Completion of this work would not have been possible without her support. I cannot fully express the extent of my gratitude, thank you so much Dianne. I would like to thank Lora Barsky for her love and friendship which are so important to me. Thanks to Leo Mascarenhas for getting patient samples and of course for commiserating with me - we outlived her! I would also like to thank Lydia Stem for her advice and friendship. She was always kind enough to take the time to help me out whenever she could, even though it wasn't in her job description! Thank you to Dr. Parkman and the entire Division of Research Immunology/Bone Marrow Transplantation at Childrens Hospital of Los Angeles for providing the best work environment a graduate student could hope for. Everyone was so helpful during my graduate studies, it was a joy to come to work. Thanks to Dr. Parkman and all of the Pis, this division became m y second home. For the animal experiments I would like to thank Sally Worttman and the entire animal facility at CHLA for taking care of my critters. Thanks Marcia for always placing my last minute orders and being so sweet to me. iii Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. Thanks to Albert Lam for spending the summer w ith me working on the RankL project. He was of great help and will make a wonderful doctor. I'd like to thank Mo Dao for her help with the bone m arrow samples and all her advice on Westerns. The cookies and chocolate were much appreciated as well ©. I'd like to thank Ken Weinberg for being so generous with his time, advice, and resources. Thank you to Dapeng from Ken's lab for helping me with the antibody work. Finally, my utmost gratitude to Donald B. Kohn for his guidence and mentorship. I was priviledged enough to spend time with him clinically and in the lab, learning the true meaning of physidan-sdentist. I will never forget my four years in his laboratory. Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. Table of Contents Page DEDICATION ii ACKNOWLEDGEMENTS iii LIST OF TABLES vii LIST OF FIGURES ix ABSTRACT xii INTRODUCTION 1 MATERIALS AND METHODS 20 CHAPTER Part I: Murine Studies I Construction of the MFGmCD40L Retroviral Vector and Generation of BM185 Cell Lines 36 n Live Challenge of BM185 Cell Lines in Balb/c Mice 48 m Mechanism of CD40L Mediated Protection 58 IV Immunologic Memory in Long Term Survivors 76 V Vaccination Pre-Challenge 81 VI Vaccination Post-Challenge 93 VII Conclusions and Future Directions 103 Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. Page Part II: Human Studies Vni Dendritic Cell Cultures and Transduction Conditions 112 IX Bcr-Abl Vector Construction and Characterization 128 X Bcr-Abl Specific Immune Responses 140 XI Conclusions and Future Directions 158 BIBLIOGRAPHY 163 vi Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. LIST OF TABLES Page Introduction Table 1 Tumor Antigens 5 Chapter I Table 1 Comparison of Retro and Adeno-Viral Based Vectors 44 Chapter II Table 1 Challenge with BM185 Cell Lines: Mean Survival 50 Chapter m Table 1 Survival of Balb/c and Balb/c nu/nu Mice 60 Challenged with BM185 Cell Lines Chanter IV Table 1 Immunologic Memory Against BM185wt Cells in Long 77 Term Survivors Chapter V Table I CTL Induction: p values between cohorts 85 Table 2 Antitumoral Effects of Gene Modified Tumor Cells 90 vii Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. Page Chapter VIII Table 1 CD34* Differentiated Dendritic Cell Phenotypes 114 Chapter IX Table 1 MHC Class I Restricted Bcr-Abl2 1 0 Epitopes 137 Table 2 MHC Class II Restricted Bcr-Abl2 1 0 Epitopes 139 Chapter X Table 1 Dendritic Cell Phenotype of Bcr-Abl Transduced 142 Cultures Table 2 Autologous Mixed Lymphocyte Culture Responses 143 Table 3 Comparison of Dendritic Cell Based Vaccines 157 Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. LIST OF FIGURES Page Introduction Figure 1 Five-Year Relative Survival Rates for ALL 2 Figure 2 Hypothesized Effect of CD80 Expression on BM185 13 Cells Figure 3 Function of CD40L 14 Figure 4 Hypothesized Effect of CD40L Expression on BM185 Cells 15 Chapter I Figure 1 Subcloning mCD40L into MFG 37 Figure 2 CD80 Upregulation on A20 cells in Response to CD40L 38 Figure 3 CD40L and CD80 Expression in BM185 Cell Lines 39 Figure 4 MHC Class I, MHC Class n, and B220 Expression in BM185 Cell Lines 40 Figure 5 CD19, CD54, and CD86 Expression in BM185 Cell Lines 41 Figure 6 BM185 Cell Line Growth Rates 42 Chapter II Figure I Survival of Balb/c Mice Following Challenge with BM185 Cell Lines 49 Figure 2 RT/PCR for Bcr-Abl in Long Term Survivors 52 Figure 3 Cytotoxic T Lymphocyte Assay of Long Term Survivors 53 ix Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. Page Chapter m Figure 1 Depletion of NK Cells Prior to BM185/CD40L 62 Challenge In Nude Mice Figure 2 Immunodepletion in Balb/c Mice Prior to BM185/CD40L 63 Challenge Figure 3 Postulated Mechanism of BM185/CD40L M ediated 65 Immune Responses Figure 4 Mechanisms of Antitumor Immune Responses by CD40L 74 Chapter IV Figure 1 Potential Role of Cytotoxic T Cells in the 79 Elimination of Leukemic Blasts after Relapse Chapter v Figure 1 Survival of Vaccinated Mice BM185 Following 82 BM185wt Challenge Figure 2 CTL Induction in Balb/c Mice Following Vaccination 84 with BM185 Cell Lines Figure 3 CTL Induction Correlates with Survival Post Vaccination 86 Chapter VI Figure 1 Vaccination in Mice with Established Leukemia 95 Figure 2 Recombinant IL-12 Administration in Conjunction 96 with Vaccination Eradicates Pre-established Leukemia Figure 3 IL-12 is Not Directly Toxic to BM185wt Cells In Vitro 97 Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. Chapter V m Figure 1 Phenotype of Day 14 Dendritic Cells 115 Figure 2 Wreight Giemsa Stain of Day 14 Dendritic Cells 116 Figure 3 Phase-Contrast Microscopic View of Day 14 Cultures 116 Figure 4 Allogeneic Mixed Lymphocyte Reaction with Day 14 Dendritic Cells 117 Figure 5 eGFP Transduction of Dendritic Cells 119 Figure 6 Fluorescent Microscopy of an eGFP Positive Dendritic Cell 120 Figure 7 Differentiation of Dendritic Cells from Hematopoietic Progenitors 123 Charter IX Figure 1 Bcr-Abl Constructs 129 Figure 2 Expression of Bcr-Abl Constructs by Western Blot Analysis 130 Figure 3 Transduction of 293A Cells with Bcr-Abl Viral Supernatants 131 QiaptenX Figure 1 Autologous Mixed Lymphocyte Responses to Bcr-Abl Positive Dendritic Cells 144 Figure 2 Enhanced Proliferation in Response to Bcr-Abl Positive Dendritic Cell Stimulators upon Repeated Stimulations 145 Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. ABSTRACT Philadelphia chromosome positive acute lymphoblastic leukemia (Ph+ ALL) is a highly malignant cancer refractory to current chemotherapy protocols. The presence of the Bcr-Abl oncogene in this type of leukemia makes it an attractive candidate for immunotherapy due to exclusive expression of the oncogene in the leukemia clone. Additionally, the oncogene results from the fusion of two cellular genes, BCR and abl, generating a unique junctional region not present in normal cells. It may, therefore, function as a tumor specific antigen and prime tumor specific immune responses if presented to the immune system w ith the appropriate stimulation. Several approaches have proved successful in the initiation of antitumor immune responses. These studies involve the investigation of two of these approaches for the treatment of Ph+ ALL. In the first approach, we utilized a murine model of Ph+ ALL to look at the ability of gene-modified leukemia cells to initiate antileukemic immune responses. Leukemia cells engineered to express CD40 Ligand (CD40L), CD80, GM-CSF, or a combination of these genes demonstrated enhanced immunogenidty. Protection mediated by CD40L was dependent on Natural Killer cells, while CD80 expression led to T cell-mediated responses. Vaccination with leukemia cells expressing all three immunomodulators, along with the administration of systemic IL-12, led to the elimination of established disease. The ability of CD40L to act in a T xii Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. cell-independent manner may be an important factor in tumor cell vaccines as patients have depressed cellular immunity following chemotherapy. Experiments conducted in vitro were done with an alternative approach in which Bcr-Abl transduced dendritic cells were generated. Bcr- Abl expressing dendritic cells were analyzed for their ability to stimulate proliferation of autologous T lymphocytes. CD34* hematopoietic progenitors from three of fifteen umbilical cord blood samples gave rise to Bcr-Abl positive dendritic cells which were able to stimulate proliferation of autologous T lymphocytes. This is supportive of the hypothesis that Bcr- Abl has the potential to initiate antileukemic immune responses. These studies demonstrate the feasibility of utilizing antileukemic immune responses in the design of novel therapies for Ph+ ALL. Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. Introduction Acute Lymphoblastic Leukemia Acute Lymphoblastic Leukemia (ALL) is the most frequent type of leukemia in children and represents roughly 30% of all childhood malignancies (1). With current intensive therapy, including CNS prophylaxis (pre-emptive radiation a n d /o r chemotherapy to the brain and spinal cord to eliminate any potential leukemic reservoirs), event free survival in children with ALL has reached 75%, a great improvement from that seen in the 1950s when single agent chemotherapy was employed resulting in 0% event free survival (1) (Figure 1). The 25% of ALL patients who will subsequently relapse can often be predicted, based on certain prognostic factors including infants less than one year of age a n d /o r the presence of the Philadelphia chromosome (Ph+) (2). Ph+ results from a translocation between chromosomes 9 and 22 which causes fusion between the cellular genes BCR and abl, creating a chimeric 190 kDa protein not found in normal cells. The Bcr-Abl oncogene protein has abnormal protein kinase activity with enhanced autokinase and transkinase activity (3). Children with Ph+ ALL represent a subgroup at very high risk for treatment failure; the Childrens Cancer Group (CCG) has found that event free survival was significantly worse for Ph+ patients (20.1%) when I Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. compared to Ph- patients (75.8%) with current intensive chemotherapy programs (4). Clearly, alternative treatment strategies for this subgroup of ALL patients are needed. i I I ■ m 1170 Vi Figure 1. Five-Year Relative Survival Rates for ALL. End Results Group, National Cancer Institute Surveillance. Epidemiology and End Results Program, 19%. Adapted from Kersey (182). Tumor Antigens Tumors arise from normal cells by a process of multiple mutations in various growth regulators such as proto-oncogenes and tumor suppressor genes, and hence tumor cells m ay be immunologically distinct from the normal precursor cells. In the treatment of cancers, a cure requires that all of the cancerous cells are removed or destroyed without undue toxicity to the patient, the limit of current chemotherapy protocols. Toxic chemotheraputic agents are administered at a sublethal dose with the goal of eliminating the cancer cells without causing the patient excessive 2 Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. toxicity. A n attractive alternative or adjuvant therapy would be the elimination of the tumor cells by the immune system via the induction of an immune response, which discriminates between tumor cells and their normal cellular counterparts. Early studies in mice have indicated that some tum ors express antigenic peptides that are able to stimulate tumor specific T cell responses. These early models utilized tumors induced by a cancer-causing agent, e.g. methylcholanthrene, ultraviolet radiation, and virus induced tumors (5). In contrast, spontaneous mouse tumors appeared to be nonimmunogenic upon initial observation. Later, however, experiments with turn* variants demonstrated otherwise (5-6). Turn* variants w ere obtained by treating nonimmunogenic mouse tumor cell lines in vitro with a mutagen. The mutagen treatment rendered the tumor cell line immunogenic and mice were able to reject the tumors. More importantly, mice that were able to reject turn* variants were also able to reject subsequent challenge with the original nonimmunogenic mouse tumor cell line, indicating that the tumors that were not immunogenic were nevertheless antigenic. This observation underlies the approaches of tum or immunotherapy in which immunization with a modified tumor cell or dendritic cell presenting tum or antigen, induces immune responses to the antigens on nonmodified tum or cells in vivo. More recently, tumor antigens have been classified into two categories: Tumor Associated Antigens (TAA) and Tumor Specific 3 Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. Antigens (TSA) (Table 1). TAA are antigens from normal proteins that are upregulated in the tumor cells, or from proteins with abnormal patterns of expression. Examples of upregulated antigens include gplOO and MART 1, which are melanosomal proteins upregulated in melanoma. The MAGE family of antigens are derived from proteins that are normally expressed only in the testis, an immunologically privileged site, but aberrantly expressed in some malignant melanomas. Immunization to TAA entails the risk of generating autoimmunity if the immune system recognizes not only the tumor but the normal cells that express this protein as well (7). An example is the development of vitiligo in melanoma patients who receive immunotherapy w ith whole tumor cells or tumor-cell extracts. TSA are different from TAA in that they are exclusively expressed in the cancer and are not present in normal cells of the body. Examples include viral transforming gene products such as the E6 and E7 proteins of HPV serotype 16 in cervical carcinomas. Mutations in tumor suppressor genes and oncogenes are also included in this category. Some mutations can result in an am ino-add change that enables the peptide to bind a dass I or dass II epitope where the wild type peptide cannot. Other mutations create a new epitope not present on the normal counterpart. An additional potential source of new antigenic peptides are the junctional regions of fusion genes often found in cancers. An example of such a potential antigenic fusion region is in the Bcr-Abl protein found in ALL and Chronic Myeloid Leukemia (CML). 4 Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. Reproduced w ith permission o f th e copyright owner. Further reproduction prohibited without permission. Table 1. Tumor Antigens3 Tumor Antigen Malignancy Activated oncogene products • mutant p21ra s • 10% of human tumors • Bcr-Abl • Chronic Myelogenous Leukemia and Acute Lymphoblastic Leukemia Tumor suppressor gene products • mutant p53 • 50% of human tumors Reactivated embryonic gene products • MAGE-1, MAGE-3, BAGE, GAGE, RAGE • Melanomas, carcinomas, sarcomas, others Tissue-specific differentiation antigens • MART-1, gplOO, tyrosinase • Melanomas • Prostate-specific antigen (PSA) • Prostate carcinoma Viral gene products • HPV E6 and E7 proteins • Cervical carcinoma • Epstein-Barr virus EBNA-1 proteins • Hodgkin's disease, nasopharyngeal carcinoma Idiotypic epitopes • Immunoglobulin idiotypes • B-cell lymphomas, multiple myelomas • T-cell receptor idiotypes I . J _ _ _ _i _ _ _1 C_ _ _ _ _ _ _T*_ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ 0 I _ _ _ _ _ _ _ _/OV • T-cell lymphomas “ adapted from Timmerman & Levy (8). Bcr-Abl Tumor Antigen Bcr-Abl derived peptides are hypothesized to be true "tumor specific antigens" because a) they contain a novel amino a d d sequence at the junction of BCR and abl and b) they are exclusively expressed in the leukemia done. The immunogenirity of the Bcr-Abl oncogene has been extensively studied in leukemia cells of CML patients that contain a 210 kDa form of the oncogene. Peptides spanning the breakpoint junction have been shown to bind various MHC Class I alleles including HLA-A3, HLA- A ll, HLA-B8, and HLA-A2.1 (9-12). These peptides have also been shown to elidt peptide-spedfic cytotoxic T cell responses in normal individuals, and in some patients with CML (10-13). Class II restricted peptides have also been found which elidt proliferation of CD4* T cell lines and dones (13-17). Further evidence for the immunogenidty of the Bcr-Abl oncogene includes a study which took CD34* Bcr-Abl positive progenitors from a CML patient, differentiated them into dendritic cells, and used them to stimulate a CD8* T cell-mediated cytotoxiaty against autologous leukemia cells (18). In another study, CD8~ Bcr-Abl spedfic cytotoxic effedor cells were also generated from normal peripheral blood using autologous dendritic cells pulsed with a junctional peptide. These CD8* cells were shown to have cytotoxic activity against both peptide-pulsed autologous targets as well as HLA-matched fresh CML leukemic blasts (19). Bcr-Abl CTLs have also been detected in vim in 5/21 CML patients (25). 6 Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. More recently, a phase I dose-escalation trial was done to evaluate the safety and immunogenidty of the b3a2 breakpoint peptides found in patients with CML (20). 5 peptides were mixed with an adjuvant and injected into a total of 12 patients. Each patient received 5 vaccinations over a 10-week period. In 3 of the 6 patients who were treated with the 2 highest dose levels, peptide specific T-cell proliferative responses were detected ex vivo and two of these patients also had positive delayed type hypersensitivity (DTH) responses to the peptide. The study found that vaccination with Bcr-Abl derived peptides was safe and capable of eliciting an immune response. The clinical efficacy will be evaluated in future phase II trials. An alternative approach was taken in a study by Falkenburg and colleagues, whereby leukemia-reactive cytotoxic T lymphocyte lines were generated from the bone marrow donor of a CML patient who had been treated in blast crisis with a bone marrow transplant and had relapsed (21). The T cells were infused at 5-week intervals, and shortly after the third infusion, complete eradication of the leukemia cells was seen. This approach is feasible for the treatment of accelerated phase CML after allogeneic bone marrow transplant. Clearly, much work has been done with the p210 Bcr-Abl oncogene demonstrating its immunogenidty. Little is known, however, about the immunogenidty of the pl90 oncogene that is found in leukemia cells of Ph+ ALL patients. 7 Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. Dendritic Cells Dendritic cells are potent antigen presenting cells of the immune system. They constitutively express high levels of MHC Class I and II molecules as well as costimulatory molecules, which are important for initiating an immune response by naive T cells. Dendritic cells pulsed with tumor peptides, tumor lysates, or total tumor RNA have been shown to elicit strong immune responses against the associated tumor cells (21-24). More recently, studies have shown that dendritic cells transduced with tumor antigen genes are also effective in initiating an immune response (25). We hypothesize that transduction of dendritic cells with the pl90 Bcr- Abl oncogene will allow antigenic determinants of the Bcr-Abl protein to be presented to the immune system and elicit an autologous antileukemic response in vitro with Ph+ ALL patient T cells. Furthermore we hypothesize that these stimulated T cells will demonstrate cytotoxicity against the patient's own leukemic blasts. Tumor Cell Vaccines An alternative strategy to dendritic cell-based vaccines is tumor cell vaccines. While irradiated tumor cells may not be sufficient to initiate an antitumor response, tumor immunogenidty can often be enhanced by transduction of tumor cells w ith immunomodulators (26-29). As stated previously, tumors arise from normal cells by a process of multiple Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. mutations in various growth regulators such as proto-oncogenes and tumor suppressor genes and hence can be considered immunologically distinct from the normal precursor cells. The persistence of tumors requires an absence of immunological recognition. Despite the presence of tumor antigens on m any carcinomas, tumors escape immune surveillance. Many explanations for tumor escape have been proposed: tolerance induced by the tumor cell due to a lack of costimulatory signals, the emergence of antigen loss variants of the tumor which do not express the tum or antigen, the secretion of soluble inhibitory factors such as TGFp and IL-10, and MHC downregulation on the tumor cell (30). In order to circumvent these mechanisms of tumor escape, genetic modification of the tumor cells themselves and their reintroduction to the host as a vaccine may allow immune recognition of the tumor. Genes used to modify the tumor cells include MHC class I and II genes, costimulatory molecules such as CD80 and CD86, and various cytokines such as IL-2, IL-3, IL-4, IL-6, IL-7, IL-12, IFNy, G-CSF, TNFa, Flt3Ligand, and GM-CSF. The local delivery of cytokines by genemodified tumor cells allows the enhancement or elicitation of anti-tumor immune responses while circumventing the toxicity of systemic levels of cytokine, which are required for an effective response (31). Murine tumor models have allowed these types of "imm une gene therapy" strategies to be evaluated with the three main objectives being: a) the abrogation of tumor establishment, b) the ability to immunize naive 9 Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. animals against wild type tumor, and c) treatment of animals with established tumors. GM-CSF, IL-2, and CD80 are commonly used immunomodulators, with their efficacy varying depending on the tumor model used. Dranoff et al demonstrated the successful use of GM-CSF transduced irradiated melanoma cells in eliciting antitumor immunity in the B16 m urine melanoma model and translated these results into a phase I clinical trial (32-33). The vaccinations were well tolerated and induced measurable antitum or responses (although not clinical responses), demonstrating the feasibility of such a therapy in the treatment of cancer. Murine Model of ALL Our lab in conjunction with Owen Witte at UCLA has developed a murine model of Ph+ ALL in which to test the efficacy of gene modified leukemia cells as a potential antitumor therapy (34). Bone marrow from a male Balb/c mouse was transduced with a retroviral vector containing the pl90 Bcr-Abl oncogene. A transformed cell line, BM185, with pre-B cell characteristics was isolated from the transduced bone marrow. When injected into syngeneic male Balb/c mice, as few as lxlO3 BM185 cells resulted in 100% mortality within three weeks. The survival time of mice injected w ith BM185 was inversely proportional to the challenge dose. Upon sacrifice, mice had high white blood cell counts, acute infiltration of the spleen and bone marrow by lymphoblasts, as well as the presence of blasts in the peripheral blood. 10 Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. Initial studies compared the BM185 cell line transduced with three immunomodulators: GM-CSF, IL-2, and CD80 (34). The m ain function of GM-CSF is to increase the production of granulocytes, macrophages, and dendritic cells in the bone marrow. GM-CSF also acts to upregulate migration, maturation, and the antigen capturing, processing and presenting pathways of antigen presenting cells. IL-2 is a T lymphocyte growth factor, which induces proliferation of activated T cells and their differentiation into armed effector T cells. CD80 is a thymocyte co stimulatory molecule. Clonal expansion of naive T cells requires a co stimulatory signal along with antigen presentation. When expressed in the BM185 cells, IL-2 and GM-CSF delayed the development of leukemia but did not allow rejection of the leukemia. Mice challenged w ith live BM185 cells expressing CD80 demonstrate prolonged survival, and on average, allowed 50% of mice to reject the leukemia completely (34). Mice rejecting the leukemia had strong cyototoxic T cell responses against both the CD80 expressing BM185 cell line and the wild type BM185 cell line. In addition, long term survivors were able to reject subsequent rechallenge with the parental wild type leukemia. Nude mice given BM185/CD80 died at the same rate as ones given wild type BM185 demonstrating the requirement for T cells in the antileukemic response and that manipulating the tumor cells by introducing CD80 did not alter the virulence of the leukemia. Immunodepletion of either CD4* or CD8* T cells resulted in 100% mortality indicating that both subsets are involved in immune protection. In 11 Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. addition, mice given the irradiated CD80-expressing BM185 cells were protected against subsequent challenge with sublethal doses of wild type BM185 compared to unvaccinated mice. It is hypothesized that the protection mediated by CD80 expression is due to the ability of the leukemia cell itself to provide the second signal required for T cell activation (Figure 2). T cells require two signals to become activated, the first being antigen recognition by the T cell receptor. The second signal is a costimulatory signal that is provided by ligation of CD28 by CD80. In the absence of the second signal, T cells which recognize antigen become anergic, a state of immune unresponsiveness. Thus leukemia cells expressing CD80 are able to provide the second signal for T cells, reversing the state of anergy. Subsequently, combinations of these three cytokines were evaluated: CD80/IL-2, and CD80/GM-CSF (35). CD80/GM-CSF proved the most efficacious with 13/20 mice surviving when compared to CD80 alone (2/19). This translated into enhanced protection when mice were vaccinated with irradiated cells and subsequently challenged with a lethal dose of the wild type leukemia (1/10 survived in CD80 vaccination compared to 5/10 in the CD80/GM-CSF cohort). It is hypothesized that GM-CSF production by the leukemia cells recruits antigen presenting cells to the site of leukemia thus enhancing the response by allowing cross presentation of BM185 antigens to CD4* helper T cells. CD80 expression 12 Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. Killer T Ceil K iller T Cell A ct i v at e d L TLs Figure 2. H ypothesized Effect o f CD80 Expression on BM185 C ells. BM185wt cells present antigen complexed with MHC I providing signal 1 but in the absence of costimulation there is no activation. CD80 expression on BM185 provides the second costimulatory signal required to generate activated cytotoxic T lymphocytes. directly on the BM185 cells is thought to help activate naive T cells, which interact directly with the leukemia cells as mentioned in the prior paragraph (Figure 2). CD40L CD40L is expressed on T cells and interaction w ith its receptor, CD40, expressed on antigen presenting cells, induces activation of the antigen presenting cell (Figure 3) (36). Antigen presenting cell activation leads to upregulation of costimulatory molecules as well as cytokine 13 Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. expression and release. This activation in turn allows subsequent activation of naive T cells resulting in initiation of the cellular immune response. Cytoldne Receptor Cytokines & Peptide MHC n Cytokines K 1 1 / ' ^ lytoldne Receptor Figure 3. Function of CD40L. T cells recognize peptide complexed with MHC on antigen presenting cells (AFC); this interaction is strengthened by adhesion molecules. Antigen recognition upregulates CD40L on the T cell which then interacts with its receptor, CD40. Triggering of CD40 receptor activates the APC to upregulate costimulatory molecules such as B7 and to secrete cytokines. These in turn activate the T cell, which then secretes cytokines such as IL-2 that further stimulate the T cell in an autocrine manner, as well as other cytokines which act in a paracrine m anner to further stimulate the APC . CD40L expression on solid tumors such as mastocytomas and neuroblastomas has been shown to elicit antitumor responses in murine models (37-38). We hypothesize that CD40L expression by BM185 cells will initiate antitumor responses in our murine model of Ph+ ALL (Figure 4). If such an effect is seen, we will determine the mechanism by which 14 Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. CD40L expression confers protection. Furthermore, we will determine if expression of multiple immunomodulators in BM185 cells will initiate a greater antitumor response than expression of a single immunomodulator. Specifically, the following combinations will be evaluated: CD80/CD40L, CD40L/ GM-CSF, and CD80/CD40L/GM-CSF. The combinations, along with CD40L alone will be compared to CD80 and CD80/GM-CSF, which were previously found to be the most effective in our model (34-35). Figure 4. H ypothesized Effect of CD40L Expression on BM185 C ells. CD40L expression on BM185 cells allows interaction with the CD40 receptor on host antigen presenting cells, activating them to upregulate costimulatory molecules and to secrete cytokines which in turn activate Natural Killer cells and CD4" T cells. 15 Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. Feasibility of Immunotherapy Providing Clinical Benefit to Patients Clinical efficacy of various immunotherapy protocols vary depending on the carcinoma and strategy used. Perhaps the most impressive clinical trial to date was done by Kwak and colleagues in patients with B cell lymphoma (39). The variable region of the B-cell receptor immunoglobulin heavy and light chains form a unique tumor specific antigen that is distinct in each patient. The B-cell receptor immunoglobulin has determinants, called idiotypes, w hich are themselves recognized as antigens. Vaccination strategies utilizing these antigens are commonly referred to as anti-idiotype vaccines. Patients included in the study all had follicular lymphomas with half of them (11/ 20) having a translocation between chromosomes 14 and 18 [t(14;18)] detectable by PCR. This translocation was used as a marker to detect minimal residual disease. Patients received anti-idiotype vaccinations tailored specifically to them by isolating immunoglobulin protein from their tumor and conjugating it to an adjuvant. Patients were induced into clinical remission by chemotherapy, and 6 months later received four monthly subcutaneous vaccinations with the imm unoglobulin/adjuvant mixed with free GM-CSF. In patients who had achieved clinical remission after chemotherapy prior to vaccination and who were positive for the translocation, all had detectable minimal residual disease by PCR. Eight of 11 patients, however, converted to PCR- negative after vaccination, thereby clearing residual cells as a consequence 16 Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. of the vaccination. After vaccination treatments, 95% of the 20 patients (those w ith and without the translocation) had cytokine release in vitro in response to autologous follicular lymphoma targets with the cytokine released at the highest levels being tumor necrosis factor. Lower levels of GM-CSF and gamma interferon were also secreted. In all of the six patients tested, there were positive CTL responses against autologous lymphoma targets. Eighteen of twenty patients remained in continuous first clinical remission 42+ months from completion of chemotherapy. This trial demonstrates the feasibility of clearing minimal residual disease using an immunotherapy approach. The success of this trial, in part, is most likely due to the low tumor burden in these patients, in contrast to many other clinical trials of immunotherapy wherein patients are enrolled who have failed other treatments and w ho have high tumor burdens. These high tumor burdens most likely overwhelm the immune system and preclude clearance of the cancer. Future clinical trials would benefit from following this example, using patients with low tumor burdens and aiming to prevent relapse rather than eliminating the tumor after routine treatment has failed. Success in im m unotherapy will result from its use as an adjuvant therapy rather than as a sole method of treatment or last ditch effort in patients with advanced disease. Treatment for ALL with intensive chemotherapy is successful in approximately 75% of cases. Of the patients who relapse, large portions are Philadelphia chromosome positive. To date, relapsing Ph+ ALL patients Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. often undergo Bone Marrow Transplantation (BMT). While this strategy is often effective, the toxicity and risk are high. Patients who do not have an HLA matched sibling or relative undergo matched unrelated donor BMT which is associated with a higher risk of Graft vs. Host disease (GVHD). GVHD occurs as a result of donor immune cells recognizing the recipient as foreign. These cells m ount an immune response against the recipient. GVHD can be severe and often fatal. There is evidence that the Bcr-Abl oncogene is immunogenic in CML patients and this may also be the case in ALL patients. Initiating an immune response against the oncogene by the patients' own immune system, after remission has been achieved by chemotherapy, may allow the rejection of minimal residual disease and thereby decrease the high incidence of relapse. While the immune system is depressed following chemotherapy and/or BMT, if sufficient time is given for immune reconstitution, generating an antileukemic immune response m ay be feasible. In murine experiments, one month post allogeneic BMT, mice challenged with leukemia and subsequently vaccinated with irradiated tumor cells rejected the pre-established leukemia in 80% of cases (40). Similar findings were seen in an autologous bone marrow transplant setting where mice were given syngeneic BMTs, challenged with tumor at various time points following the transplant, and then vaccinated with GM- CSF secreting irradiated tum or cells five days following transplant (41). Interestingly, a greater percentage of mice rejected the leukemia when mice 18 Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. were challenged 3 weeks following transplant, then mice that were not transplanted at all. In addition to the feasibility of generating immune responses following chemotherapy and/or transplant, die approach has support from in vitro data demonstrating the ability to generate T cell lines from the bone marrow of patients with pre B ALL, which proliferate in response to tumor cell stimulation and are able to lyse autologous tumor cells in vitro. These results show the existence of antileukemic CTL precursors in these patients and provide rationale for an immunotherapy approach (42). Use of an immunotherapy treatment in high risk ALL patients who have achieved clinical remission may provide a less toxic alternative than BMT and thus be more advantageous in the treatment of Ph+ ALL. If ineffective, and relapse occurs, these patients would still be able to undergo BMT. The strategies outlined in this proposal can be easily translated to a clinical setting. Bone m arrow aspirates from patients in remission can be used as a CD34+ hematopoietic progenitor source, transduced with Bcr-Abl, differentiated into dendritic cells, irradiated, and returned to the patient as a vaccine. Alternatively tumor cells obtained from the diagnostic bone marrow aspirate can be transduced with the most effective immunomodulator combination and cryopreserved. Upon the induction of remission in the patient, these cells can be thawed, irradiated, and administered as a vaccine. 19 Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. Materials and Methods Mice 6-8 week old male Balb/ c mice were purchased from Jackson Laboratories (Bar Harbor, Maine) and maintained in our animal care facility under standard conditions. Balb/c nu/nu mice were purchased from Harlan Bioproducts for Science (Indianapolis, Indiana). Experiments involving mice were all reviewed and approved by the Animal Care Committee (Childrens Hospital Los Angeles, Los Angeles, CA). Cloning of MFGmCD40L Retroviral Vector The pcDNA3.1mCD40L expression plasmid was kindly provided by Dr. Malcolm Brenner (Baylor College of Medicine, Houston, TX). Ncol and Xhol restriction sites were added to the 5' and 3' ends respectively of the CD40L encoding sequences by PCR amplification of the gene with the following primers: 5' GCTCC ACC ATGGT AG AAAC AT ACAGCC AAC 3' and 5' CCGAATGAGTTTGAGACTGAGCTCCGCATG 3'. The amplified product was gel purified and directly ligated into the pGEM-T vector (Promega, Madison, WI). mCD40L was isolated with Ncol and Xhol restriction enzymes, gel purified, and ligated into the MFG retroviral vector (43), which had been cut with Ncol and Xhol, and dephosphorylated with 20 Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. calf intestinal alkaline phosphatase. The ligated construct was transfected into competent DH5a bacterial cells (Gibco-BRL, G rand Island, NY), which were selected on ampidllin, and colonies were analyzed by restriction enzyme analysis. A single clone with the desired construct was sequenced to verify the intactness of the gene. Generation of GPEmCD40L MFGmCD40L was co-transfected into the packaging cell line PA317 with pSV2neo using DOTAP according to manufacturer's instructions (Roche Diagnostics Corporation, Indianapolis, IN). Cells were selected in G418 (500/zg/ml) for two weeks. The pool of G418 resistant cells was seeded at 2x10" cells per 10cm plate in DIO and kept at 32° C overnight. Supernatant was collected on three subsequent days, filtered with a .45 pm filter and stored at -80°C. Supernatant from the MFGmCD40L transfected PA317 cells was used to transduce the ecotropic packaging cell line GP+E-86. Briefly, 105 GPE cells were plated on a 10 cm plate and on the following day, vector supernatant and protamine sulfate (6 pg/m l) were added. Cells were then incubated at 37°C overnight. The transduction was repeated on two subsequent days for a total of three hits. GP+E-86 cells were stained for mCD40L using a Phycoerythrin (PE) conjugated ham ster anti-mouse CD 154 monoclonal antibody clone MR1 (BDPharmingen, San Diego, CA). A CD40L positive pool of cells was obtained with a Flurorescent Activated 21 Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. Cell Sorter (FACS) (Bectin Dickinson, San Diego, CA). This pool was used as a source for MFGmCD40L vector supernatant, harvested as described above. Cell Lines The BM185 cell line has been previously described (34). All BM185 cell lines were maintained in RPM I1640 medium supplemented w ith 5% Fetal Calf Serum, 2mM L-glutamine, 1C5 M 2-mercaptoethanol, and 100 Units/m l penicillin/streptomycin. The A20 murine B cell lymphoma cell line was obtained from the American Type Culture Collection (ATCC, Rockville, MD) and maintained in RPMI 1640 with 10% Fetal Calf Serum, 5x1 O^M 2-mercaptoethanol, and 100 Units/m l penicillin/streptomycin. The amphotropic packaging cell line PA317 (44), ecotropic packaging cell line GP+E-86 (GPE) (43), and NIH3T3 cell lines were maintained in DMEM supplemented with 10% Fetal Calf Serum, 2mM L-glutamine, and 100 Units/m l penicillin/streptomycin (D10). PA317 and NIH3T3 w ere obtained from the ATCC. GP+E-86 was kindly provided by Dr. Arthur Bank (Columbia University, New York, NY). NIH3T3 cells expressing murine CD40 Ligand (mCD40L), were generated by transfecting the pcDNA3.1mCD40L expression plasmid using the 22 Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. transfection reagent DOTAP. A transfected pool was obtained by selection in DIO supplemented w ith G418 (500 ^g/ml) for 2 weeks. NIH3T3 cells expressing human CD40L (NIH3T3hCD40L), were kindly provided by Dr. Angelo Cardossa (Dana Farber Cancer Institute, New York, NY). NIH3T3 cells expressing murine CD40L from the retroviral vector, MFGmCD40L, (NIH3T3mCD40L) were generated by transduction of NIH3T3 cells with supernatant from the GPEmCD40L packaging cell line, and selecting a mCD40L positive pool by Fluorescent Activated Cell Sorter (FACS) (Bectin Dickinson). Hybridoma cell lines producing antibodies to m urine CD4 and murine CD8 (GK1.5 and 53-6.72, respectively) were both obtained from the ATCC. GK1.5 was maintained in RPMI 1640 supplemented with 10% Fetal Calf Serum and 100 Units/ml penicillin/streptomycin. 53-6.72 was maintained in IMDM with 1.5 g/L sodium bicarbonate supplemented with 20% Fetal Calf Serum and 100 U nits/m l penicillin/streptomycin. All cell lines were incubated at 37° C in 5% C 0 2 . Generation of BM185 Cell Lines Expressing CD40L BM185 cells were seeded at 3x10s cells per well in a 6 well Costar tissue culture plate (Coming, Coming, NY) and incubated overnight at 37°C in 5% C 0 2 . The following day supernatant obtained from the GPEmCD40L Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. cell line was added to the cells with 6/ig/m l protamine sulfate. Cells were spinoculated at 32°C for 2 hours, lO OOxg. After spinoculation, the cells were incubated at 37°C overnight. The spinoculation was repeated with fresh supernatant on two subsequent days. Transduced cells were expanded and a mCD40L positive pool selected by FACS. Cones were obtained from the mCD40L positive pool by an Automated Cell Distributor Unit (ACDU) on the FACS Vantage sorter (Bectin Dickinson). BM185/CD80, BM185/GM-CSF, and BM185/CD80/GM-CSF had been previously generated (34-35). These clonal cell lines were engineered to express mCD40L as described above. CD80 expression was determined by FACS analysis using Fluorescein Isothiocyanate (FITC) - conjugated hamster anti-mouse monoclonal antibody clone 16-10A1 (BDPharmingen, San Diego, CA). GM-CSF expression was confirmed using the Quantikine murine GM-CSF kit (R&D Systems, Minneapolis, MN). Leukemia Challenges and Vaccinations BM185 cell lines were harvested, washed twice in Hanks Balanced Salt Solution (HBSS) and resuspended in HBSS with 50 U nits/m l heparin. Leukemia challenges w ere administered by injecting 100/d volume containing live cells into the tail vein of mice. Cells used for vaccinations were washed twice in HBSS, resuspended in HBSS supplemented w ith 50 U nits/m l heparin, and irradiated at 3000 Rads in a 1 J 7 Cs y irradiator (JL 24 Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. Shepherd & Associates, San Fernando, CA). Vaccinations of 100/xl volume were delivered by subcutanous injection in the inguinal region of mice. nnIL-12 Administration Mice were administered 25 /xg recombinant murine IL-12 (rmIL-12) (R&D Systems) subcutaneously in the inguinal region daily for 5 serial days on days 0-4 and 14-18 after intravenous challenge with BM185 cells. In Vivo Depletions Balb/c and N ude Balb/c mice were depleted of CD4' T cells (hybridoma GK1.5; ATCC) or CD8* T cells (hybridoma 53-6.72; ATCC) by intraperitoneal injections of 0.5 mg antibody. Mice were depleted of NK cells by intravenous injection of 50#d Anti asialo GM1 (Wako Pure Chemical Industries, Ltd., Osaka, Japan). Mice in the control group were given 0.5 mg polyclonal rat IgG (Rockland, Gilbertsville, PA). Injections were administered on days - 6, -3, +1, +4, and twice weekly thereafter to maintain depletion. One mouse per cohort was sacrificed on day - 1, +15, +30, +45, and +60 to verify in vivo depletion. A portion of the splenocytes taken from sacrificed mice were analzyed for CD4, CD8 and B220 subpopulations by flow cytometry, and the remaining splenocytes were used in a NK assay against YAC-1 targets to test for NK function. Antibodies used to verify depletions by flow cytometry include PE 25 Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. conjugated Rat antimouse CD8a done 53-6.7, PE conjugated Rat antimouse CD4 done H129.19, and PE conjugated Rat antimouse CD45R/B220 done RA3-6B2 (BDPharmingen). Cytotoxic T Lymphocyte Assays Spleens w ere harvested from mice and single cell suspensions of splenocytes were made and co-cultured in vitro with irradiated (2500 Rads) BM185/CD80 cells for 5 days. Cultures were supplemented with 4 U/ml recombinant murine IL-2 (rmIL-2) (R&D Systems). Stimulated splenocytes were incubated with BM185 cells labeled with M Cr (sodium chromate; New England N udear, Boston, MA) at various effector to target ratios and incubated for 4 hours to determine their ability to lyse w ild type target and release M Cr into the supernatant, measured in a scintillation counter. Percent specific lysis was calculated with the following equation: Percent sperific lysis = (experimental lysis - spontaneous lysis) / (total lysis - spontaneous lysis) x 100. Natural Killer Cell Assays Spleens were harvested from mice and single cell suspensions of splenocytes were made and co-cultured with 5 1 Cr labeled YAC-1 cells (ATCC, Rockville, MD) at 100:1 effedor to target ratio for 10-12 hours. YAC-1 lysis was determined by chromium rdease into the supernatant as 26 Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. measured by a scintillation counter. Percent specific lysis w as calculated as described in Cytotoxic T Lymphocyte Assays, above. RT/PCR RNA was isolated from total bone m arrow with RNA Stat-60 (Tel-Test, Inc., Friendswood, TX) according to m anufacture's instructions. 1 M g total RNA was reverse transcribed with oligo dT primers using an RT-for-PCR Kit (Clontech, Palo Alto, CA) according to manufacture's instructions. cDNA was amplified with ALL E and ALL F oligonucleotide prim ers as previously described (34). PCR products were run on a 2% agarose gel, blotted onto nitrocellulose and probed with ALL G oligonucleotide as previously described (34). Murine beta actin detection w as used as an internal control for each sample as previously described (34). Dendritic Cell Culture CD34 hematopoietic progenitor cells were isolated from cord blood and bone marrow using the MACS* CD34 Progenitor Cell Isolation Kit according to manufacturers instructions (Miltenyi Biotec, Inc., Auburn, CA). CD34* cells were placed in X-VTVO 15 serum free m edium (Biowhittaker, Walkersville, MD) supplemented with 2mM L-glutamine, 100 Units/ml penicillin/streptomycin, 0.5 ng/m l TGF01,50 U /m l TNFa, 27 Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. 100 ng/m l GM-CSF, 20 ng/m l Stem Cell Factor (SCF) and 100 ng/m l Flit3Ligand (R&D Systems) for two weeks at 37°C in 5% COz. CD34 Transduction CD34* cells were seeded onto 6 well plates coated with fibronectin. To coat plates, 2ml of 50 jig/m l recombinant CH-296 (Retronectin®, TaKaRa, Otsu, Japan) was added to each well for one hour at room temperature. Fibronectin was removed and replaced with 2% BSA solution (Fraction V, Sigma, St. Louis, MO) for an additional fifteen minutes at room temperature to block nonspecific sites. Plates were rinsed in phosphate- buffered saline (PBS) and used directly. CD34 cells were added in Basal Bone Marrow Medium (BBMM) and supplemented with 50 U/m l rhIL-6, 10 ng/m l rhIL-3, and 50 ng/m l rhSCF (Growth Factor Media [GFM]). BBMM contains Iscove's Modified Dulbecco's Medium (Irvine Scientific, Santa Ana, CA) with 20% fetal calf serum (Biowhittaker), 1% deionized BSA (Fraction V, Sigma, St. Louis, MO), 100 U nits/m l penicillin/streptomycin, 2mM L-glutamine, 10“ * M 2-mercaptoethanol, and 10" 6 M hydrocortisone (Sigma, St. Louis, MO). Retroviral supernatant was thawed at 37°C and added to the cells. Plates were incubated at 37°C in 5% COz overnight. Transduction w as repeated twice more on two subsequent days with fresh supernatant. O n the fourth day cells were placed in GFM for two days to expand cell num bers and subsequently were used for experiments. 28 Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. Flow Cytometry Dendritic cell cultures were analyzed by Flow Cytometry. Cells were washed and blocked with MsIgG (Coulter) for ten minutes on ice. Directly conjugated antibodies were added for 20 minutes on ice, cells were washed once, and resuspended in a small volume of PBS for analysis. Antibodies include anti-HLA-DR clone L243, anti-CD19 clone H1B19, anti-CD3 clone UCHT1, anti-CD14 clone M5E2, anti-CD80 clone BB1, anti-CDla clone HI149, anti-CD40 clone 5C3, anti-CD86 clone 2331, anti-CD58 clone 1C3, and anti-CD83 clone HB15e. All antibodies were obtained from BDPharmingen. Western Blot Analysis Approximately 107 cells were collected and lysed in 1ml of ice cold RIPA buffer (.1% SDS, .5% Sodium Deoxycholate, .1% Triton X) with ImM PMSF and 10 Mg/ml Aprotinin. Cells were incubated on ice for 30 minutes. Fresh protease inhibitors were added (10 Mg/ml Aprotinin and ImM PMSF) and cells were incubated an additional 30 minutes on ice. Cells were centrifuged at 10,000 xg for 20 minutes at 4°C. Supernatant was removed and stored at -20°C for up to 3 weeks. 20-80/ig total protein lysates were run on 7.5% Tris-HCL polyacrylamide gels (Bio Rad, Hercules, CA) and transferred to nitrocellulose membranes (Bio Rad). Membranes were blocked with 5% nonfat powdered milk reconstituted in TBS-T (20mM Tris 29 Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. pH7.5,500mM NaCl, .05% Tween-20) for 2 hours at room temperature, washed three times, 10 minutes per wash in TBS-T. Primary antibodies (c- Abl [ Ab-3], Calbiochem, Cambridge, MA) were added at a concentration of 0.8/ig/ml in TBS-T and incubated overnight at 4°C. The following day blots were washed three times and secondary anti-mouse antibody labeled with horseradish peroxidase (Santa Cruz Biotechnology Inc., Santa Cruz, CA) at a dilution of 1:10,000 was added for thirty m inutes at room temperature. Blots were washed three times, and bands were detected by ECL as per manufacturers instructions (Amersham Pharmacia Biotech). Cloning of MNDBcr-Abl Retroviral Vectors p i90 Bcr-Abl wild type and pl90 Bcr-Abl triple mutant constructs were kindly provided by Dr. Owen Witte in the pSRaMSVTKneo backbone (46). Both genes were excised with Eco-RI and Cla I restriction enzymes, gel purified, and ligated into the MND backbone which had been previously cut with the same enzymes and dephosphorylated with calf intestinal alkaline phosphatase. Transient Transfections MNDBcr-Ablwt and MNDBcr-Abl triple m utant retroviral vectors (as described above) were produced by transient transfections as previously described (47). Briefly, 293T cells were transfected with 10 fig vector 30 Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. plasmid, 10 /zg packaging plasmid (pHIT60), and 10 /zg Gibbon A pe Leukemia Viral envelope by C aG 2 overnight at 37°C. The following day cells were treated with Sodium Butyrate for 8 hours and supernatants were collected 12 hours later (12 hour harvest) and 24 hours thereafter (36 hour harvest). Prior to their use in experiments, aliquots of undiluted supernatant were used to transduce 293A cells w ith two hits on tw o subsequent days in the presence of 8 Mg/ml polybrene (Sigma). Three days following transduction, protein was isolated and Western blots w ere run to verify the presence of the Bcr-Abl protein as described above. Autologous Mixed Lymphocyte Reactions CD34’ cells were isolated from cord blood or bone marrow as described above. From the CD34 negative fraction, T lymphocytes were isolated using the MACS® CD3 Isolation Kit (Samples A thru K) or the Pan T Cell Isolation Kit (Samples L thru Q) as per manufacturers instructions. CD34 negative T cell negative fractions were frozen in hum an AB serum supplemented with 10% DMSO for subsequent HLA analysis and T cells were frozen in hum an AB serum supplemented w ith 10% DMSO for later use in Autologous MLR. CD34 positive fractions w ere transduced and subsequently differentiated into dendritic cells as described above. M ature dendritic cells were harvested, irradiated at 3000 Rads and plated at a concentration of 2x 10s cells per well in 96 well plates. Samples from the 31 Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. dendritic cell cultures were taken for protein isolation and subsequent Western Blot analysis (see above), or DNA isolation and subsequent PCR analysis (see below). Autologous T cells were thaw ed and co-cultured with dendritic cells at 2x10s cells per well in RPMI supplemented with 4% human AB serum in a 37° C incubator with 5% C 02. After four days of co cultivation, exogenous IL-2 was added to samples A thru F and L thru Q at a concentration of 10 units per ml. After 7 days supernatants were removed for ELISA, and half of the wells were pulsed w ith thymidine for 24 hours. Thymidine incorporation was measured in a scintillation counter. The other remaining wells were restimulated with an additional 2x10s irradiated dendritic cells for an additional 7 days after which supernatants were removed for ELISA, half the cultures were pulsed with thymidine, and the remainder were stimulated once more as was done in the second stimulation. Isolation of Genomic DNA Approximately 107 cells were collected and lysed in PK Buffer (0.15 M NaCl, 0.01 M Tris-HCL pH 7.4,0.01 M EDTA pH 8.0, and .08% SDS) supplemented with lu g /u l proteinase K (Gibco BRL). Lysates were incubated in a 37° C water bath overnight. The following day nucleic a d d was extracted with an equal volume of Phenol-Chloroform-Isoamyl 32 Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. Alcohol (25:24:1) and spun at 14,000 rpm for 10 minutes at 4° C. The top aqueous layer was transferred to a new tube and the extraction was repeated. Following the second extraction l/lO * volume of 10M NH4 AC was added to the aqueous phase along with 25 volumes of ice-cold absolute ethanol. DNA was precipitated at -20° C overnight. To isolate precipitate, tubes were spun for 10 minutes at 14,000 rpm at 4° C, washed once in 70% ethanol, and resuspended in TE. PCR for Bcr-Abl from Genomic DNA 500 ng genomic DNA was added to 1.2 mM each dNTPs, 1.5 mM MgCl2 , 2 units Amplitaq DNA Polymerase (Biosystems by Roche Molecular Systems Inc., Branchburg, New Jersey), and 0.8% PCR Buffer II (Biosystems by Roche Molecular Systems Inc.). 50 pmol of each specific primer was added for a total reaction volume of 100^1. Bcr-Abl specific primers were used as described above (RT/PCR) and human beta actin control primers were used as previously described (48) in separate reaction tubes. Both reactions yield 300 bp products. The reaction underwent thirty rounds of amplification under the following conditions: [94° C (2 min), 59° C (1 min), 72° C (1 min)] 1 cycle, [94° C (30 sec), 59° C (1 min), 72° C (30 sec)] 30 cycles, and [94° C (1 min), 59° C (1 min), 72° C (6 min)] 1 cycle. Products were run on a 2% agarose gel. 33 Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. ELISA for IL-4 and IFNy Supernatants were collected from autologous mixed lymphocyte reactions and m ultiple samples from a given cohort were pooled. Samples were diluted 1:10 in PBS and measured for IL-4 and IFN-y using human IL-4 Quantikine and human IFN-y Quantikine kits per manufacturers instructions (R&D Systems). 34 Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. Parti: Murine Studies Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. Chapter I: Construction of the MFGmCD40L Retroviral Vector and Generation of BM185 Cell Lines Introduction To look at the immunogenitity of ALL cells expressing genes, we utilized our murine model of Ph+ ALL (34). The BM185wt leukemia cell line, and BM185 cell lines expressing CD80 a n d /o r GM-CSF have been previously described (34-35). To look at leukemia cells expressing CD40L, we constructed a retroviral vector expressing the m urine CD40L gene and transduced clonal cell lines with the construct. We analyzed all the cell lines for cell surface markers and growth rates to verify that CD40L expression did not alter the virulence or phenotype of the leukemia. Results To conduct studies on the immunogenidty of CD40L expressing leukemia cells, mCD40L was cloned from the expression plasmid pcDNA3.1mCD40L into the MFC retroviral vector and packaged into the GPE ecotropic packaging cell line (Figure 1). To ensure biologically active mCD40L was transferred to cells transduced with the MFGmCD40L vector, NIH3T3 cells were transduced and co-cultivated w ith the A20 murine lymphoma cell line. CD80 has been previously shown to be upregulated in A20 cells when activated by CD40 Ligand (49). Briefly, retroviral 36 Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. mCD40L7 pMFG SD SA LTR LTR m CD40L Figure 1: Subcloning mCD40L into MFG. mCD40L gene was amplified from an expression plasmid using PCR with N col and Xhol sites added at the 5' and 3' ends respectively. PCR product was subdoned into pGEM-T, a plasmid specifically designed for subdoning PCR products. The gene was then excised from pGEM-T with the restriction enzymes Ncol and Xhol and ligated into MFG which had been digested with Ncol and Xhol as well. supernatant was harvested, used to transduce the NIH3T3 cell line, and a positive pool was selected by FACS. As a positive control, pcDNA3.1mCD40L was transfected into the NIH3T3 cell line and a positive pool was obtained by selection in G418. These two cell lines, along with the parental NIH3T3 cell line were co-cultured with the A20 murine lymphoma 37 Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. C M * I M 1 o o o o 10 10u 101 102 103 10 ANTICD80FITC ANTIC080FrrC ANTI CD80 FITC NIH3T3 MIH3T3 NIH3T3 pcDNA3.1mCD40L MFGmCD40L ► FITC conjugated a-mCD80 Figure 2: CD80 Upregulation on A20 cells in Response to CD40L. A20 cells were cocultured with NIH3T3 cells, NIH3T3 cells transfected with pcDNA3.1mCD40L, or NIH3T3 cells transduced with MFGmCD40L for three days. mCD80 expression was then analyzed on the A20 cells by FACS. Dotted curve donates A20 cells cultured alone; bold curve donates A20 cells cultured with the indicated NIH3T3 cell line. cell line for two days. Following co-cultivation w ith the cell lines, CD80 was upregulated in A20 cells co-cultured with NIH3T3 pcDNA3.1mCD40L and NIH3T3 MFGmCD40L, but not with NIH3T3 cells, indicating our vector was expressing functional product (Figure 2). BM185, BM185/CD80, BM185/GM-CSF, and BM185/CD80/GM- CSF cell lines have been previously described (34-35). These cell lines were transduced with MFGmCD40L retroviral supernatant and high expressing positive clones were isolated by FACS ACDU (Figure 3). Growth rates and phenotype as determined by flow cytometry and trypan blue exclusion were not altered by CD40L expression in these cells (Figures 4-6). 38 Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. Reproduced w ith permission o f th e copyright owner. Further reproduction prohibited without permission. *-TG051101.050 O ' 8 TG051101.057 FL 1-Height rTG051101.058 ■ - y FL 1-Height V TG051101.059 O■ 5rT<3051101.053 o >1— T I 2 1 1 / --------- I © ” 1 ^ r " ' ■ • ' I o T 1 0 c, « « W 1 0 10°^ 1 0 1 0 1 FL1-Height FLI-Height FLI-Height FLI-Height 01.054 TG051 01.055 H ~ io ® 10 FLI-Height r TG051101.060 O ' FLI-Height rTG051101.061 FLI-Height rTG051101.002 TG051 01.056 "itip IA FLI-Height E s S f — I S F I — I • J H y E I FLI-Height 10 10° 10 10w 10* 10w 10' 10' FLI-Height FLI-Height FLI-Height FLI-Height FLI-Height TQ051 3 0 01.063 IftW (A FLI-Height BM185wt BM185/CD80 BM185/CD40L BM185/CD80 BM185/CD80 BM185/CD40L BM185/CD80 CD40L GM-CSF GM-CSF CD40L/GM-CSF Figure 3. CD40L and CD80 Expression in BM185 Cell Lines. Cell lines were stained for the indicated markers and with isotype controls (data not shown). Quadrant locations are based on isotype control staining. u > so V TG051101.008 © ■ r TG051101.009 * s= £. . 9 n- TQ051101.010 o -TG0511010I1 10v 10 MIC Class I ^-10051101.015 o i f 3. 10v 10 MIC Class I t TG051101.016 O ' 10w 10 MIC Class I I L p ***** 1 0 10w 10 MIC Class I t T<3051101.017 o t TQ051101.012 O ' -TG051101013 £ * £ ' f Sc o A - MIC Class I I m ' i i F i t MK Class I I 10w 10 M 1C Class I t TG0S110I.018 o — ■ v o 10w 10 MIC Class I TO051101.019 V 10° 1< t TG0S 1101.014 O ' rTG051101.020 1 0 w 1 0 ^ MIC Class I I % * 2= 10w 10 MK Class I I 10w I0n MIC Class I rTG051101.021 10w 10 MK Class I I 10w 10 MIC Class I I t TG05 1101.036 o rTGOS 1101.037 o ■ ■TG051101.039 10w 10 FLI-Height BM185wt 1 0 w 1 0 ^ FLI-Height BM185/CD80 1 FLI-Height r TG051101.039 o o * 10u 10 FLI-Height BM185/CD40L BM185/CD80 CD40L <rTG051101.040 Ol TG051101.041 10w 10 FLI-Height BM185/CD80 GM-CSF n * ■ 10u 10 FLI-Height rTG051101.042 o © ■ r 10u 10 FLI-Height BM185/CD40L BM185/CD80 GM-CSF CD40L/GM-CSF Figure 4. MHC Class I, MHC Class II, and B220 Expression in BM185 Cell Lines. Cell lines were stained for the indicated markers and with isotype controls (data not shown). Quadrant locations are based on isotype control staining. Reproduced with permission o f th e copyright owner. Further reproduction prohibited without permission. V TG051101.043 o TG051101.044 TG051101.045 rTG051101.046 rTG051101.047 "4 10v 10 FL1 -Height 10w 10 FLI-Height 4 ' m vTG051101.048 rTGOS1101.049 TG051 TG051101.065 © o FLI-Height FLI-Height rTG051101.066 rrTG051101.067 k 1, 4A FLI-Height V-TG051101.029 Ol FLI-Height FLI-Height rTG051101.030 V TG051101.031 FLI-Height rTGOS 1101.032 FLI-Htighl FLI-Htight FLI-Htight 01.070 TG051101.068 o TG051 01.069 - T T 10 10° °io' FLI-Htight TG051101.033 10w 10 CD86 1 0 ° ^ f. 4 ' . 1 ( CD86 CD86 CD86 to ©• “ 10 10w 10 FLI-Htight tTGOSI 101.034 o FLI-Htight rTGOS 1101.035 CD86 10w 10 CD86 1 0 w 1 0 ^ CD86 BM185wt BM185/CD80 BM185/CD40L BM185/CD80 CD40L BM185/CD80 BM185/CD40L BM185/CD80 GM-CSF GM-CSF CD40L/GM-CSF Figure 5. CD19, CD54, and CD86 Expression in BM185 Cell Lines. Cell lines were stained for the indicated markers and with isotype controls (data not shown). Quadrant locations are based on isotype control staining. 1.00E+08 1.00E+07 1.00E+06 1.00E+05 D ay 1 D ay 3 □ay 0 D ay 2 Day 4 BM185wt BM185/CD80 * BM185/CD40L -k- BM185/CD80/CD40L -m- BM185/CD40L/GM-CSF BM185/CD80/GM-CSF - 4 - BM185/CD80/CD40L/GM-CSF Figure 6. BM185 Cell Line Growth Rates. BM185 cell lines were seeded in flasks at a concentration of 2x10s cells per 10 ml RIO media (day 0). Total viable cell counts were determined by trypan blue exclusion daily for 4 days. Discussion The cloning of mCD40L into the MFG retroviral vector backbone allowed the transfer of this gene into the BM185 cell lines. Expression of the transgene did not alter the surface phenotype of BM185 cells and did not alter growth characteristics in vitro (Figures 3-6). 42 Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. Gene therapy applications utilize multiple methods to transfer the gene of interest into a given target cell. Two of the most common vectors utilized include adenoviral and retroviral vectors. Each has their unique advantages and limitations (Table 1). Retroviral vectors stably integrate into the genome allowing long-term gene expression. Different envelope proteins can be utilized to optimize transduction levels of a certain cell type. Limitations to this vector, however, include low frequencies of transduction in slowly dividing or non-dividing cells, low titers, and a limited use for in vivo applications due to the inactivation by complement (50). Adenoviral vectors in contrast, have high frequencies of transduction in a large number of cell types due to their ability to transduce non dividing cells, and yield high titers, high levels of transgene expression, and efficient in vivo gene delivery (50). Limitations include the high immunogenidty of the vector and transient expression due to a lack of integration into the target cell. The immunogenidty of adenoviral vectors is well documented. MHC dass I restricted CD8* cytotoxic T lymphocytes are activated in response to antigens presented in adenoviral infected cells, leading to their destruction in vivo (51). Furthermore CD4 mediated responses contribute to the formation of neutralizing antibodies which prevent re-administration of the vector (51). These studies were done with first generation adenoviral vectors that only lack two of the early viral gene products, E la and Elb. 43 Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. Reproduced with permission o f th e copyright owner. Further reproduction prohibited without permission. Table 1. Comparison of Retro and Adeno-Viral Based Vectors* Vector Advantages Limitations Retrovirus • Wide range of target cells and • Low frequency of transduction, cell multiple envelopes division required • Stable integration / long term • Low titers expression • Inactivation by complement, hence limited in vivo application Adenovirus • High frequency of transduction, • Transient expression cell division not required • Neutralizing antibody in humans may • High titers prevent re-administration • High level of transgene expression • Vector highly immunogenic • Efficient in vivo gene delivery • Low transduction of lymphocytic cells "reviewed in Blaese et al (50). * Subsequent generations of adenoviral vectors have deleted increased numbers of genes including El, E4, E2a, and E3 in an attem pt to make the vector less immunogenic (52). In some studies these subsequent generation vectors demonstrated less immunogenidty and toxitity accompanied by longer transgene expression, yet in other studies they had little or no benefit to the first generation vectors (52). Indeed, a later generation adenoviral vector, deleted of El and E4 in addition to E la and Elb, led to the death of a patient with ornithine transcarbamylase defidency who received an intrahepatic arterial injection of this vector with the wild type ornithine transcarbamylase gene. There has been development of "gutless" adenoviral vectors, deleted of all viral genes that are much less immunogenic, allowing the persistence of transduced cells in vivo. Yet experiments done to explain the death of the ornithine transcarbamylase defident patient indicate that the virus induced the activation of the innate arm of the immune system causing the release of toxic levels of pro- inflammatory cytokines in response to the capsid protein, which is present on the gutless vectors as well (53). The immune response to adenoviral vectors, while in many cases is a limitation, can be seen as an advantage in applications such as cancer gene therapy where the aim is to kill cancer cells. For example, in vivo administration of the vector encoding the thymidine kinase gene allows tumor cell death with the subsequent administration of ganddovir, a pro- drug that is activated when phosphorylated by this gene (52). The 45 Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. generation of an immune response, which targets transduced cells, would aid in tumor cell destruction and hence be beneficial. Additionally, the imm une response against adenoviral transduced tumor cells expressing an immunostimulatory molecules may act as an adjuvant in the elicitation of tum or specific immune responses. Indeed, the use of adenoviral vectors for delivery of CD40L to tumor cells has been documented in multiple m urine tumor models (45,54). In a colon adenocarcinoma model, it is interesting to note that tum or cells transduced with a control adenoviral vector, irradiated, and given as a vaccine elicited tumor specific CTL responses in vitro at levels similar to CD40L transduced tumor cells. Furthermore, splenocytes adoptively transferred from these vaccinated mice into naive tumor bearing recipients allowed 20% of these recipients to eliminate the established tum ors (compared to 60% rejection in CD40L transduced tumors and 0% rejection in mice receiving untransduced cells) (45). Clearly the empty adenoviral vector enhanced the immune response to this tumor in vivo, and although it did not inhibit any antitumor immune responses, we were interested in studying the effect of CD40L expression and its ability to stimulate antitum or immune responses on its own without the complication of dissecting out CD40L induced immune responses and adenoviral induced imm une responses. The choice of a retroviral backbone w as chosen for several reasons in this model. As discussed above, a primary goal of the study w as to 46 Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. determine the immune response generated by CD40L expression, without the complicating feature of an antiviral immune response. Additionally, the retroviral vector allowed us to generate stably transduced clonal cell lines expressing high levels of the transgene, which could be frozen down and hence readily available for experiments. The requirement for a high expressing clone was defined in previous work demonstrating that titrating in BM185 wild type cells with a clonal, cytokine producing BM185 cell line, led to the decline of the antitumor immune response (35). Whether this is due to a requirement for 100% of the cells to express the transgenes, or alternatively due to a requirement for a given absolute num ber of transgene expressing leukemia cells, is not known. Regardless, a study involving the use of CD40L to stimulate antitumor responses and the mechanism whereby it does this, clearly requires a high expressing clonal cell line in this model. With the generation of stable, CD40L expressing leukemia cell lines, we went on to test the immunogenidty of these cell lines compared to the parental wild type leukemia cell line, in mice. 47 Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. Chapter II: Live Challenge of BM185 Cell Lines in Balb/c Mice Introduction Generation of stable, CD40L expressing leukemia cell lines, allowed us to proceed with live challenge experiments in our murine model. In this assay, mice are given live leukemia cells expressing a single gene or combinations of genes, and survival is compared to mice receiving the wild type leukemia. This allows us to assess the ability of a single gene or combination of genes to render the leukemia immunogenic. Results Mice challenged with BM185 cells expressing CD80 alone, or CD80 in combination with GM-CSF have been shown previously in our lab to stimulate tumor specific T lymphocyte responses allowing a delay in the development of leukemia, and in a percentage of mice, allowing rejection of the leukemia (34-35). To determine if CD40L expression alone, and in combination with CD80 and or GM-CSF confers greater protection, cohorts of mice were challenged intravenously with SxlO3 live cells and followed for survival (Figure 1, Table 1). All cell lines conferred protection compared to mice challenged with wild type cells (p=0.000000). BM185/CD80/CD40L/GM-CSF challenged mice demonstrated the greatest protection with 76.1% of mice surviving challenge. BM185/CD40L, 48 Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. >60 * days & 60 60 e JS U 50 (A o c* — 40 (8 > E s Q /5 30 < A >s £ 20 i Q 10 BM185wt BM185 BM185 CD40L CD80 BM185 BM185 BM185 BM185 CD80 CD40L CD80 CD80/CD40L CD40L GM-CSF GM-CSF GM-CSF Figure 1. Survival of Balb/c Mice Following Challenge with BM185 Cell Lines. Balb/c mice were challenged intravenously with SxlO3 cells of the indicated cell lines and followed for survival. Results are a composite of 12 independent experiments. Each symbol represents one mouse. 49 Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. Reproduced with permission o f th e copyright owner. Further reproduction prohibited without permission. Table 1. Challenge with BM185 Cell Lines: Mean Survival* BM185zvt BM185 CD40L BM185 CD80 BM185 CD80 CD40L BM185 CD40L GM-CSF BM185 CD80 GM-CSF BM185 CD80/CD40L GM-CSF # LTS" 1/59 8/35 10/35 5/23 16/24 35/70 35/46 % LTSC 1.7 22.9 28.6 21.7 70.8 50.0 76.1 MST* 18.02 39.31 39.29 39.65 59.88 54.16 64.89 SEM* 0.96 3.01 3.48 3.50 3.68 2.18 1.97 “All cohorts differed statistically from BM185wt as determined by the log rank test (p=0.000000) '’ Number of long term survivors as determined by survival past 60 days 'Percentage of long term survivors dMean survival time in days of mice within the cohort 'Standard error of the mean values for mean survival times BM185/CD80, and BM185/CD80/CD40L offered the least protection, with 22.9,28.6, and 21.7 percent of mice surviving, respectively. Interestingly, the combination of CD80 and CD40L did not provide protection above those cell lines expressing only one of these genes, while CD40L expression along with GM-CSF, and CD80 expression with GM-CSF did provide greater protection than cell lines expressing only one of the genes. All mice that developed leukemia and were sacrificed had lymphoblasts in the peripheral blood and enlarged spleens (data not shown). To determine if the leukemia had been eradicated in mice surviving challenge, RT/PCR for the Bcr-Abl oncogene mRNA was done on 1 mouse surviving BM185/CD40L challenge and two mice surviving BM185/CD80 challenge (Figure 2). As controls, bone marrow from naive mice and mice who had died from BM185wt challenge were also used. Minimal residual disease, as indicated by the Bcr-Abl transcript, was undetectable in long term survivors. In contrast, mice receiving BM185wt cells had large amounts of Bcr-Abl transcript in the bone marrow, demonstrating the presence of leukemia in these mice. Spleens from these same long term survivors were also used in a cytotoxic T lymphocyte assay to determine if tumor specific T lymphocyte responses were present. Splenocytes were co-cultivated with irradiated BM185/CD80 stimulators for one week and subsequently co-cultured with chromium labeled BM185wt cells. Both long term survivors from the CD80 51 Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. Bcr-Abl Beta Actin Figured RT/PCR for Bcr-Abl in Long Term Survivors. Bone marrow from long term survivors (LTS), two naive mice, and two mice who died from BM185 wt challenge was harvested and RNA was extracted. RNA from the BM185 wt cell line was used as a positive control. cDNA was generated by reverse transcription using oligo dT primers and used as a template for PCR. Primers specific for the Bcr-Abl fusion product and the fl-actin housekeeping gene were used during amplification. cohort had strong cytotoxic T lymphocyte responses to the wild type leukemia whereas the long term survivor from the CD40L cohort had a low to intermediate response (Figure 3). 52 Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. 100 - CD40LLTS • - CD80LTS 1 — * — ■ CD80LTS2 - Naive 1 ---- M ---- Naive 2 80 • 6 0 - I 4 0 - 2 0 - 10:1 3 0:1 1:1 3:1 Effector: Target Figure 3: Cytotoxic T Lymphocyte Assay of Long Term Survivors. Spleens from long term survivors (LTS) and from two naive mice were harvested and co-cultured in the presence of irradiated BM185/CD80 cells for 4 days. Effector cells were then incubated with chromium labeled BM185 wt target cells for 4 hours. Supernatants were harvested and measured for chromium release. Specific lysis was calculated by the following equation: [ ( experimental lysis - spontaneous lysis) / ( total lysis - spontaneous ly sis) ] x 100 D iscussion All BM185 cell lines expressing one or more immunomodulators had enhanced survival compared to mice challenged with BM185wt cells (pc.0001) (Figure 1, Table 1). The percent of long term survivors was dependent on the combination of immunomodulators expressed within the 53 Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. cells. Efficacy of the gene combinations from most efficacious to least is as follows: CD80/CD40L/GM-CSF > CD40L/GM-CSF = CD80/GM-CSF, > CD80 > CD40L = CD80/CD40L. Other genes previously evaluated in this model include GM-CSF alone, IL-2 alone, and CD80/IL-2 in combination (34-35). In live challenge experiments with these cells lines, GM-CSF alone and IL-2 alone both delay the onset of leukemia but did not allow mice to survive tumor challenge (34). CD80 in combination with IL-2 allowed 27% of mice to reject the leukemia, similar to CD80, CD80/CD40L and CD40L (35) (Figure 1). Hence, taken together the data indicate the following hierarchy: CD80/CD40L/GM-CSF > CD40L/GM-CSF = CD80/GM-CSF, > CD80 > CD40L = CD80/CD40L = CD80/IL-2 > GM-CSF = IL-2. This hierarchy is likely to be specific for our model, as different genes confer different levels of protection depending on the tumor model. For example, Dranoff and colleagues found GM-CSF to be superior in the B16 melanoma model when ten genes were analyzed (IL-2, IL-4, IL-5, IL-6, IFNy, IL-1RA, ICAM, CD2, TNFa, and GM-CSF) (32). This is in contrast to our model where GM-CSF expression alone performed poorly. The reason for these discrepancies among different tumor models is likely to be a reflection of the tumor cells themselves and the antigens available for immune recognition. Assuming that the immune system is a constant, with the various components having defined functions, the differences lie not in the genes used to transduce the tumor cells themselves, but rather in the different tumor cell types and the antigens they are presenting. 54 Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. Antigens can be classified into two types: those that bind MHC Class I and those that bind MHC Class II. Antigens bound by Class II molecules present to CD4 T lymphocytes while Class I peptides are presented to CD8 T lymphocytes. CD4 T lymphocytes are important in driving the immune response to be either Thl dominated (cell mediated) or Th2 dominated (humoral). The factors that determine whether the CD4 T lymphocyte will differentiate into a Thl or Th2 type cell are not fully understood. Factors thought to be important include 1) cytokines elicited by the immune system in response to the tumor cell or infectious agent, 2) cytokines secreted by the tumor cell or infectious agent, 3) costimulators used by the antigen presenting cells in the immune response, and 4) the nature of the peptide:MHC ligand complex. For example, IL-12 and IFNy favor Thl type responses and inhibit Th2 immunity. In contrast, IL-10 inhibits Thl cells and favors Th2 immune responses. IL-4 and IL-6 also favor Th2 mediated responses. Some tumors have been found to secrete large amounts of IL-10 and hence inhibit Thl immune responses allowing them to evade the immune system. The nature of the antigen involves m any aspects, including the density of the antigen on the cell surface (low density favors Th2 responses, high density favors Thl responses), and the T cell receptor avidity for the antigen MHC complex. Humoral immunity is largely thought to be ineffective in eliminating tum or cells whereas cell mediated immunity, specifically tum or specific cytotoxic T lymphocytes (CTLs), are thought to be crucial in protection 55 Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. from tumors. Hence tumor cells expressing antigen which tend to drive Th2 dominated responses would benefit from Thl directing cytokines such as IL-12 and IFNy. Induction of immune responses against tumor cells expressing Thl type antigens would benefit from expression of costimulatory molecules such that tumor cells can directly stimulate naive T lymphocytes rather than indirect activation mediated through antigen presenting cells via cross presentation. The antigens presented in our BM185 cells are unknown. We postulate that Bcr-Abl, the gene responsible for transforming the Balb/c bone marrow and allowing us to isolate a fast growing pre B cell, is one of the antigens recognized by the immune system in our model as the junction between the BCR and abl genes result in a novel amino a d d sequence not seen in normal cells. Additionally it is highly expressed in BM185 cells as demonstrated by Western Blot analysis (data not shown) and hence would be expected to be presented at a high frequency on the cell surface. Because BM185wt cells grow progressively in immunocompetent Balb/c mice and eventually kill all mice injected, the leukemia cells are not recognized by the immune system. Hence the unknown antigens are insuffident to elidt immune recognition. We looked at a wide spectrum of imm une modulators alone and in combination and found that while the leukemia cells are not immunogenic, they are nonetheless antigenic, as cells transduced with genes that stimulate the immune system elidt tumor spedfic immune responses. The lower cytotoxic T lymphocyte response 56 Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. seen in long term survivors of BM185/CD40L challenge suggests that CTLs are not the primary effector in the protection mediated by this ligand, in contrast to CD80 protection, which has been shown to be mediated by CD4 and CD8 T lymphocytes (34). We next sought to identify the components of the immune system involved in CD40L induced tum or specific immune responses. 5 7 Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. Chapter III: Mechanism of CD40L Mediated Protection Introduction While it has been shown that CD80 mediates protection by CD4 and CD8 T lymphocytes, the mechanism of CD40L mediated protection in our murine model is unknown. To identify cellular effectors involved in CD40L protection, we repeated live challenge experiments in two settings: 1) Balb/c nu/nu mice which lack CD4 and CD8 T lymphocytes, and 2) Balb/c mice depleted of either CD4, CD8, or Natural Killer cells. The knowledge of which effector cells are involved in antileukemic immune responses can aid us in selecting other genes to use in combination with CD40L in future studies. Results To determine the mechanism of protection seen in mice challenged with BM185 cell lines, cohorts of Balb/c nu/nu (Nude) mice which lack a thymus and therefore functional T lymphocytes, in parallel with cohorts of Balb/c mice, were given intravenous challenges with SxlO3 live cells. As expected, a large portion of Balb/c mice receiving BM185/CD80/GM-CSF rejected the leukemia, whereas this protection was absent in N ude mice (Table 1). This is in accordance with what has been previously seen in our lab (35). Balb/c and Nude mice receiving BM185/CD40L, however, had 58 Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. similar survival indicating protection mediated by a non T lymphocyte population such as Natural Killer (NK) cells. In light of this data, we expected to see survival of Nude mice receiving any BM185 cell line expressing CD40L. This is the case with BM185/CD80/CD40L and BM185/CD80/CD40L/GM-CSF; surprisingly, Nude mice receiving BM185/CD80/CD40L had enhanced survival compared to Balb/c mice (Table 1). This was not the case, however, for Nude mice receiving BM185/CD40L/GM-CSF, as the protection seen in Balb/c mice was absent in Nude mice. Although some protection was lost in Nude mice receiving BM185/CD80 compared to Balb/c mice, there was not a complete loss of protection as previously reported (34). More extensive depletion studies with BM185/CD80, however, have in fact established a requirement for both CD4 and CD8 T lymphocytes in Balb/c mice in order to survive challenge (34). The greater survival of Nude mice compared to Balb/c mice receiving BM185/CD80/CD40L suggested that an immune effector, such as NK cells, was more abundant in Nudes than Balb/c. Therefore we looked at absolute numbers of NK cells in Nude mice compared to Balb/c mice. We found absolute NK cell numbers, however, to be similar in Nude and Balb/c mice (data not shown). 59 Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. Reproduced with permission o f th e copyright owner. Further reproduction prohibited without permission. Table 1. Survival of Balb/c and nu/nu Mice Challenged with PM185 Cell Lines* Cell line Balb/c nu/nu Number Surviving % LTSb M ST (days) P Value* Number Surviving % LTSb M ST (days) P Valud1 BM185wt 1/20 5 20.5*/ 12.2 NA 1/22 5 23.4*/ 13.5 NA BM185/CD40L 6/10 60 53.8’'21.1 <.0001 9/12 75 59.0*'20.4 <.0001 BM185/CD80 4/10 40 44.3*/ 23.3 .0007 3/12 25 34.4*' 21.6 .0116 BM185/CD80/CD40L* 2/8 25 40.5*'18.6 .0005 8/10 80 63.5*/ 14.1 <.0001 BM185/CD40L/GM-CSF* 5/9 56 52.2’/ 22.8 .0005 0/9 0 15A*'-2.l .0192 BM185/CD80/GM-CSF* 8/10 80 62.8*' 15.4 <.0001 0/10 0 22.4*/ 2.6 .2193 BM185/CD80/CD40L/GM-CSF 8/10 80 66.6''7.7 <.0001 6/7 86 63.0*/ 18.5 <.0001 Data is compiled from 4 separate experiments with similar results ^Challenge dose, 5xl03 cells b LTS, long term survivors. C MST, mean survival time. d p values represent survival of BM185 cell lines within mice cohorts compared to BM185wt as determined by the log rank test analysis, statistically significant p values are in bold. ’Cohorts with statistically significant difference in survival of Balb/c mice compared to nu/nu mice, p values are as follows: BM185/CD80/CD40L - .0153, BM185/CD40L/GM-CSF - .0023, BM185/CD80/GM-CSF - .0001. s To test the hypothesis that protection from BM185/CD40L challenge in Nude mice was mediated by NK cells, Nude mice were depleted of NK cells and challenged intravenously with BM185/CD40L. As expected, mice depleted of NK cells no longer demonstrated protection from BM185/CD40L challenge (Figure 1). BM185 cells were also found to be susceptible to lysis by NK cells at levels similar to YAC-1 cells, as determined in vitro lending further support to this hypothesis (data not shown). Nude mice were protected from BM185/CD40L challenge by NK cells as NK depletion in N ude mice led to a loss of protection. To determine if NK cells also m ediated the protection seen in immunocompetent Balb/c mice, cohorts of mice were depleted of either CD4 T lymphocytes, CD8 T lymphocytes, or NK cells and followed for survival following BM185/CD40L challenge (Figure 2). Mice depleted of CD4 lymphocytes demonstrated protection similar to mice treated with control antibody and untreated mice, indicating a lack of requirement for the CD4 subset of cells. In contrast, mice depleted of CD8 lymphocytes lost much of the protection mediated by CD40L. In addition to CD8 lymphocytes, there was also a requirement for NK cells as mice depleted of NK cells did not survive BM185/CD40L challenge, supporting the results seen in N ude mice. 61 Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. 1 2 0 Untreated Control Antibody NK Depleted 1 0 0 (S > t a c a c £ c* lontrol Antibod' 5 1 21 11 3 1 4 1 Days Post BM 185/CD40L Challenge Figure 1. Depletion of NK cells Prior to BM185/CD40L Challenge in N ude Mice. Nude mice were depleted of NK cells by intravenous injection of anti asialo GM1 twice weekly. A second cohort received nonspecific control antibody injections in the peritoneum, twice weekly. All mice were challenged with SxlO3 BM185/CD40L cells. Discussion CD80 mediated protection has been previously determined to be CD4 and CD8 mediated in our model (34). The mechanism of GM-CSF has not been elucidated as mice receiving BM185/GM-CSF in the absence of other immunomodulators do not reject the leukemia but rather only show 62 Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. 1 20 > 3 (/) A r t e v £ w Q m 100 80 60 40 20 -Untreated -Control Antibody -CD4 Depleted -CD8 Depleted -NK Depleted Untreated AfinliBfa C M npnlphwi NK S s s t s z k 1 1 1 2 1 3 1 41 5 1 6 1 7 1 8 1 9 1 1 0 1 1 1 1 Days Post BM185/CD40L Challenge Figure 2. Immunodepletion in Balb/c Mice Prior to BM185/CD40L Challenge. Mice were depleted of either CD4, CD8, or NK cells by administration of anti CD4, anti CD8, and anti asialo GM1 antibodies respectively. Depletions were done twice weekly prior to challenge and following challenge throughout the duration of die experiment. CD4 and CD8 antibodies were given intraperitoneal and anti asialo antibodies were given intravenously. All mice were challenged with SxlO3 BM185/CD40L cells. delays in the onset. Much of the focus of these current studies was to elucidate the mechanism whereby CD40L confers protection. Initial studies in Nudes determined that T cells did not solely mediate protection, while NK cells were crucial. This was confirmed in Balb/c mice, although CD8 T cells were also shown to be involved in the imm une response of these 63 Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. immunocompetent mice. Although CTL effectors can act alone when killing target cells, their differentiation from naive CDS lymphocytes often requires help from CD4 lymphocytes. In order for this priming to occur, both the CDS and CD4 lymphocytes must recognize antigen on the same antigen presenting cell. More recently, however, it has been show n that signaling through the CD40 receptor on the antigen presenting cells can replace the requirement for the CD4 T helper cells, which may explain the lack of requirement for CD4 lymphocytes in our antitumor response (55-56). Based on our date, we propose that in our model, antigen presenting cells within the host take up apoptotic or necrotic BM185 cells and cross present leukemia associated antigens to the immune system (Figure 3). This cross presentation pathway has been shown in experiments that demonstrated dendritic cells can acquire antigen and stimulate MHC Class I restricted CTLs by phagocytosing apoptotic cells (57). Heat shock proteins within apoptotic cells may direct antigen to this class I pathw ay (58). Live leukemia cells expressing CD40L then activate these antigen presenting cells allowing upregulation of costimulatory and adhesion molecules resulting in direct CD8 T cell activation. In addition, activated APCs release cytokines such as IL-12, which can directly stimulate NK cells. Both BM185wt cells and BM185/CD40L were found to be susceptible to NK lysis in vitro at levels similar to YAC-1 targets, supporting this hypothesis (data not shown). 64 Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. The lack of survivors in N ude mice receiving BM185/CD40L/GM- CSF challenge is puzzling. In Nudes, challenge with all other BM185 cell lines expressing CD40L allowed a percentage of mice to reject the leukemia. This cell line, however, did have the lowest expression of CD40L, and it may be that this level of expression was insufficient to activate NK cells (Chapter I, Figure 3). Figure 3. Postulated M echanism of BM185/CD40L M ediated Immune Responses. Engulfment of apoptotic BM185 cells by antigen presenting cells and their subsequent activation by CD40L lead to helper independent CTLs and IL-12 secretion. IL-12 secretion activates NK cells. \ r < cumuli'. \ i >< > | >1 < > 1 1 c 11 \ 1 i s ( t il 65 Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. Similar studies have been done in other murine models (59,37-38). Examples include the P815 cell line, which is a Balb/c derived murine mastocytoma cell line (37). Similar to our results, tumors transfected with CD40L were rejected in both Balb/c and Nude mice. Balb/c mice depleted of CD4 or CDS lymphocytes still rejected the tumor whereas mice depleted of NK cells did not. When antibodies were administered to inhibit IL-12, there was no protection indicating that the mechanism through which CD40L offers protection is mediated through IL-12 secretion and its activation of NK cells. The tum or cells in this model were inoculated subcutaneously, and tumor growth was local. The protection mediated by CD40L was limited to the local area as mice challenged simultaneously with P815/CD40L at one site and P815 at a distant site were not protected. There was, however, memory in that survivors of a primary challenge with P815/CD40L were resistant to subsequent challenge with P815wt cells. This memory was lost upon depletion of CD4 T lymphocytes although local rejection of the primary challenge was not. These studies elegantly demonstrated that there was local NK mediated protection through IL-12 production, and that the systemic memory response was CD4 dependent. While CD4 cells were required to elicit a memory response, CD8 T cells were the actual effectors in the rejection of the secondary challenge with P815wt cells. Thus CD4, CD8, and NK cells were all involved in the immune response elicited by CD40L expression on the tum or cells. 66 Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. Another study in mice looked at a neuroblastoma tumor model (38). Similarly, cells transduced with CD40L elicited antitumor immune responses. The protection required CD8 but not CD4 T cells as determined by depletion studies. Mice were not, however, depleted of NK cells and studies were not done in N ude mice; hence the role of NK cells was not determined. Thus the mechanism of CD40L in our model is similar to these previous observations in that CD8 T cells are involved in the protection as well as NK cells. The lack of CD4 T cell requirement was found in our model and the neuroblastoma model while they were required for P815 tumor immunity. It may be that the Class II negative P815 contains Class II restricted tumor associated antigens which are processed by host antigen presenting cells that stimulate CD4 responses. These CD4 cells may then go on to activate CD8 cells which target class I presented antigens on the tumor cells themselves. The lack of CD4 requirement in our model m ay indicate that Class I restricted epitopes are dominant, or simply sufficient and in the presence of CD40L, APCs may be able to be activated in the absence of CD4 T cells. The above studies looked at ex vivo transduced tumor cells, in contrast two reports have looked at in vivo gene transfer using intratumoral injection of adenoviral vectors carrying the CD40L gene (53-54). Kikuchi et al found that intratumoral injection of live adenoviral vector carrying the CD40L gene allowed complete rejection of 9 day established subcutaneous colon adenocarcinoma tumor. The in vivo treatments were more effective in 67 Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. this model than ex vivo transduced tumor cells that were irradiated and given as a single vaccination prior to challenge. Increased vaccinations, however, increased the benefit of this therapy. This mode of treatment renders itself to solid subcutaneous tumors, but may be less effective in a model such as ours, where the tumor cells are systemic and not confined to a given region of the body. A further report using this same methodology and tumor model found that rejection of tumor by in vivo injection of CD40L expressing adenoviral vector required CD8 T lymphocytes, although NK cells were not evaluated and hence their involvement was not determined (54). Similar to our model, the rejection of tumor occurred in the absence of CD4 T lymphocytes. In mice that had rejected tumor via CD40L adenoviral treatments, and were subsequently rechallenged w ith a lethal dose of tumor, both CD4 and CD8 cells were found to be involved although depletion of either subset individually did not decrease survival. Hence the development of memory required both CD4 and CD8 lymphocytes in contrast to the elimination of established tumor, which only required CD8 lymphocytes. CD40L expression on tumor cells is not required to elicit antitumor effects in vivo, as systemic administration of stimulatory anti-CD40 antibody can elicit therapeutic benefit (60-63). This mode of antitumor therapy resulted in CD8 T lymphocyte mediated antitumor effects in murine models (61-63) as well as NK mediated antitumor effects (60). Turner et al. demonstrated that stimulatory anti-CD40 antibody stimulated 68 Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. NK mediated tumor lysis indirectly by induction of Thl cytokines, as the protection from the antibody was also seen in CD40L deficient mice and hence upregulated CD40 expression on host APCs could not be directly activating the CD40L expressed on NK cells (60). While expression of CD40L on tumor cells can initiate antitum or responses, CD40L has been shown to be involved in many aspects of antitumor immunity. Apart from CD40L expression within tum or cells, endogenous CD40L expression has been shown to be critical for antitumor responses in vivo (64-65). When m urine MCA105 tumor cells were irradiated and used as a vaccine, draining lymph nodes were found to express IFNy and IL-2. If, however, antibodies to CD40L were given prior to vaccination, there were undetectable levels of these Thl cytokines. This led the authors to conclude that CD40L was required for T cell priming of antitumor responses. If mice were given systemic recombinant IL-12 in addition to antibodies to CD40L, there was a partial bypass of the requirement for CD40L, indicating the importance of this cytokine in the effects of CD40L. CD40L activation of antigen presenting cells has been shown to activate them leading to IL-12 secretion among other things (66). Although MCA105 has been shown to require CD4 and CD8 for the antitumor responses, the role of NK cells has not been investigated and the authors note that IL-12 has profound effects on NK cells in addition to its role in T cell mediated immunity. 69 Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. CD40L has also been shown to directly act on T lymphocytes, costimulating proliferation of activated T cells (67). Activation of T cells with CD40L in the absence of a costimulation was shown to induce CD25 and CD40L expression on resting T cells. It was also shown to induce proliferation and enhanced CD69 expression following activation with PHA or CD3 mAb. Hence its antitumor effect may be in part mediated by direct T cell stimulation in addition to indirect stimulation through cytokines. In contrast to its stimulatory capacity, CD40L has also been shown to induce apoptotic cell death in transformed cells of mesenchymal and epithelial origin (68). This was shown in the human cell lines SV80 and HeLa, as well as in murine A9 fibroblasts. This has profound implications in that tumor infiltrating lymphocytes which are activated may use this mechanism to eliminate tumor cells in vivo which are CD40 positive. Many tumors have been shown to express CD40 including bladder, breast, ovarian cancer, and melanomas (69-70). Demonstration of this concept was recently published in a report on human breast carcinoma, which looked at the effects of soluble CD40L on breast cancer cells in vitro and in vivo (71). Of the three breast cancer cell lines studied, two expressed low levels of CD40. Upon treatment with IFNy, both cell lines upregulated CD40 expression. When cultured with sCD40L in vitro, proliferation of these cell lines was inhibited and this inhibition was found to be in part due to the induction of apoptosis and necrosis in the carcinoma cells. When these cell 70 Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. lines were injected into immunodefident SCID mice, treatment with sCD40L increased survival significantly. This mechanism of antitumor response does not seem to be the case in our model, however, as BM185 cells are CD40 negative and growth of BM185/CD40L is similar to BM185wt cells (Chapter I, Figure 5). This does not, however, predude its importance in other carcinomas. Several studies have been done in mice and hum ans with tumors expressing CD40, focusing not on inducing tumor cell death, but rather enhandng their ability to elidt tumor assodated/spedfic immune responses by upregulating costimulatory and adhesion molecules. Follicular lymphoma cells isolated from patients were found to be ineffident at inducing allogeneic T cell proliferation, whereas these same cells when activated in vitro with CD40L became effident stimulators for allogeneic T cells (72). Flow cytometry demonstrated upregulation of CD80, CD86, MHC Class I, MHC Class II, ICAM-1, and LFA-3. It was further determined that adhesion molecules were necessary for this stimulation, as CD28 stimulation in trans was not suffident to induce proliferation. Further studies demonstrated that CD40L activated follicular lymphoma cells were able to activate follicular lymphoma spedfic tumor infiltrating T lymphocytes in the presence of exogenous IL-2 (73). Once activated, these T cells demonstrated follicular lymphoma directed cytotoxidty. 71 Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. Similar studies have also been done in a murine model of T cell lymphoma. A20 is a T cell lymphoma cell line derived from Balb/c mice and is CD40\ When given as a vaccination in combination with a fibroblast cell line expressing CD40L and IL-2,25% of mice reject the pre- established A20 tumor cells given prior to vaccination (49). In vitro cultures demonstrate that CD40L expressed within the fibroblast cell line upregulates CD80, MHC Class I, and MHC Class II. This was not the case in vivo, however, when A20 cells were removed from mice following vaccination. Similar studies using a CD40 negative tumor, however, found that CD40L expression in the fibroblasts did not enhance the response seen with IL-2 alone. From this the authors concluded that the CD40 activated A20 cells in vivo are rapidly eliminated and that it is not host derived APCs and T cells which are activated. There is no direct proof provided, however, for this hypothesis. The effectors involved in the antitumor response were found involve CD4, CD8 and NK cells. Combining this strategy where CD40L enhances tum or cell antigen presentation, along with one of inducing tumor immunity by gene transfer is seen in chronic lymphocytic leukemia B cells which are CD40* (74). Tumor cells transduced with an adenovirus encoding CD40L were found to trans-activate noninfected bystander leukemia B cells. Transduced cultures were better able to stimulate allogeneic mixed T cell reactions than lacZ transduced control CLL cells. CD40L transduced leukemia cells also elicited autologous T cell response and the generation of CTLs. This CTL 72 Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. response was specific for the CLL ceils and partially inhibited by addition of antibody to HLA Class I. This and other studies were the basis for a phase I dose-escalation study on the safety of administering a single intravenous infusion of autologous CD40L transduced leukemia cells to patients with B-cell CLL (75). Patients tolerated the infusion and an increase in the numbers of leukemia-specific T cells were found, along with reductions in leukemia cell counts and lymph node size. Importantly, no adverse effects were seen supporting further clinical studies with this approach. Taken together, all of these studies can be summarized in the following two scenarios (Figure 4). In tumor cells expressing CD40 such as chronic lymphocytic leukemia (CLL), ligation of this receptor with either CD40 antibody, soluble CD40L, or CD40L transduced tum or cells lead to enhanced tumor antigen presentation and cytokine secretion from the tumor cell itself. These events lead to T cell and or NK cell stimulation, which in turn result in tumor cell lysis. Alternatively, in tum or cells such as breast cancer that also express CD40, rather than stimulation, ligation of the receptor can lead to apoptosis of the tumor cell. In the second scenario, tumor cells do not express the CD40 receptor. In this case, ligation of CD40 on host antigen presenting cells can lead to their activation and subsequent costimulatory molecule upregulation and cytokine secretion. In conjunction with cross presentation this can lead to tumor specific T cell responses. Alternatively, cytokine expression such as IL-12, can result in 73 Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. NK cell stimulation and subsequent tumor cell lysis if the tumor cells themselves are susceptible to NK cells. The ability of CD40L to act in a T cell-independent manner may be an important factor in tumor cell vaccines Tumor with surface CD40 •CM Andbodjr •sCMCL •CDML Transduced Tumor Cells T Cell and NK Cefl Stimulation J ^0prCytoUne production g ^ ^ ^ •D irect T C cD Lysis »T Cefl and NK Cell Stimulation Cron Presentation Of Tumor Antigen Tumor without surface CD40 Figure 4. Mechanisms of Antitum or Immune Responses by CD40L. In the absence of CD40 expression by tumor cells, CD40L activation of endogenous antigen presenting cells in conjunction with tumor antigen cross presentation lead to NK and T cell stimulation. CD40L activation of tumor cells expressing the CD40 receptor can lead to enhanced antigen presentation function allowing them to directly activate T cells. Adapted from Schultze and Johnson (76). 74 Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. as patients have depressed cellular immunity following chemotherapy a n d /o r Bone Marrow Transplant (BMT). In a BMT setting, NK cells are among the first cells to recover after transplantation (77), reaching normal activity within one month in contrast to cellular immunity, which may take a year o r more to reach normal function. The role of T lymphocytes, however, is critical in many tumor models. One of the advantages of T lymphocytes over NK cells is the specificity and long lived memory that can be induced. Thus established immunologic memory against tumor cells can prevent re-occurrence or relapse of tumor cells that have escaped either chemotherapy treatment or lysis by the immune system. To investigate if we are able to induce tumor specific memory responses in our model, we looked at mice w ho had rejected initial live challenge with either BM185/CD80/GM-CSF or BM185/CD80/CD40L/GM-CSF to see if they were able to reject subsequent rechallenge with the wild type tumor. 75 Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. Chapter IV: Immunologic Memory in Long Term Survivors Introduction Live challenge experiments are able to assess the induction of an antitumor immune response, but do not assess the establishment of immunologic memory against the tumor cells. To determine if mice who rejected live leukemia challenge with BM185/CD80/GM-CSF and BM185/CD80/CD40L/GM-CSF had established a memory response sufficient to eliminate wild type leukemia cells, we rechallenged long term survivors with a lethal dose of BM185wt cells and assessed survival. Results To determine if mice develop immunologic memory against wild type BM185 cells following challenge with transduced BM185 cells, we challenged mice with SxlO3 BM185/CD80/GM-CSF or BM185/CD80/CD40L/GM-CSF cells; long term survivors were rechallenged with SxlO3 BM185wt cells (Table 1). 70% of mice that had survived a primary challenge with BM185/CD80/GM-CSF rejected subsequent challenge with BM185wt, while 50% of mice that had survived a primary challenge with BM185/CD80/CD40L/GM-CSF rejected subsequent challenge with BM185wt cells. There was no statistical difference in the memory response between these cohorts. 76 Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. Reproduced with permission o f th e copyright owner. Further reproduction prohibited without permission. Table 1. Immunologic Memory Against BM185wt Cells in Long Term Survivors Cell line Primary Challenge* Secondary Challenge Number Surviving Percent LTS1 ’ P Valu& Number Surviving Percent LTSh P Value* Naive (no primary challenge) NA NA NA 0/9 0% NA BM185wt 0/10 0% NA NA NA NA BM185/CD80/GM-CSF* 25/47 53% <.0001 14/20 70% .0003 BM185/CD80/CD40L/GM-CSF* 26/32 81% <.0001 13/26 50% .0024 Data is compiled from 2 separate experiments with similar results '‘ Primary challenges consisted of 5x10* of the indicated cell line; all secondary challenges consisted of 5x10s BM185wt cells. b LTS - long term survivors; mice surviving past 60 days post challenge c p values represent survival of mice compared to those treated with BM185wt cells as determined by the Fisher's Exact test, statistically significant p values are in bold. *Mean survival times of BM185/CD80/GM-CSF and BM185/CD80/CD40L/GM-CSF are statistically different in the primary challenge (p =.0016) but not the secondary challenge (p =.2916). D iscussion Mice surviving BM185/CD80/GM-CSF and BM185/CD80/CD40L/GM-CSF demonstrated immunologic memory against BM185wt cells. Thus in this model, future tumor burdens in immune mice can be eliminated. This has important implications in that vaccination with leukemia cells expressing immunomodulators has the ability to eliminate, or keep in check, minimal residual disease. Minimal residual disease in the clinical course of leukemia can be defined as the presence of leukemia cells at undetectable levels, which can lead to relapse. The generation of antileukemic immune responses has an advantage over chemotherapy treatment in that immunologic memory, if initiated, can persist throughout the lifetime of the patient. Immunologic memory allows the immune system to rapidly eliminate pathogens that have previously been encountered and reflects the pre-existence of a donally expanded population of antigen specific lymphocytes. This can be advantageous in the scenario where the existence of minimal residual disease leads to relapse. Memory lymphocytes can expand in response to antigenic restimulation and eliminate any residual leukemia cells. Conversely, while not completely eliminating the leukemia, the immune system's memory lymphocytes may keep the leukemia in check, expanding in number as the leukemia expands to lower the tumor burden until small amounts remain and then decreasing in number again until the next resurgence of leukemic proliferation (Figure 1). Thus, the establishment of 78 Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. e at *s 3 C Q u Cytotoxic T Cell Effectors Kill Leukemic Blasts £ at 3 at t t Disease Onset Minimal Residual Disease t t Relapse Elimination of Disease e at ■ H 3 C O v •Ml £ at * 3 at Cytotoxic T Cell Effectors Kill Leukemic Blasts Proliferation of Memory 1 T Cells Proliferation . of Memory \ T Cells T Disease Onset T t Minimal Relapse Residual Disease t Relapse t Minimal Residual Disease Figure 1. Potential Role of Cytotoxic T C ells in the Elim ination of Leukemic Blasts after Relapse. The upper panel donates the ability of memory T cells to differentiate into arm ed effectors and eliminate minimal residual disease. The lower panel depicts an alternate scenario where these effector cells merely keep the residual disease in check. 79 Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. memory in the anti-leukemic immune response is potentially a critical component in its effectiveness as an adjuvant therapy to chemotherapy. It is still not clearly established whether memory lymphocytes consist of a long lived population of specialized memory cells, or whether memory is dependent on undetectable levels of antigen that continuously restimulate antigen specific lymphocytes. Regardless, it is known that two populations of memory lymphocytes exist: memory B cells and memory T cells. As humoral immune responses are largely thought to be ineffective in anti-tumor immunity, this discussion will focus on memory T cells. Both CD4 and CD8 memory T cells exist. In the case of CD8 T cells, long term protective immunity is derived from a distinct population of memory CD8 T cells that can be defined in a standard cytotoxic T lymphocyte assay. Studies also suggest that naive CD4 T cells can differentiate into armed effector T cells or into memory T cells although whether the effector cells can persist in vivo and whether they can differentiate into T cells is not yet dear. Protection induced by either CD80 or CD40L expression on BM185 cells has been shown to involve CD8 T cells. To further investigate the significance of establishing CD8 memory T cells and their importance in survival of mice challenged with wild type leukemia, we moved onto an alternative assay in our leukemia model whereby mice were vaccinated with irradiated leukemia cells expressing one to three immunomodulators and subsequently challenged with a lethal dose of wild type leukemia. 80 Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. Chapter V: Vaccination Pre-Challenge Introduction Gene-modified leukemia cells were able to initiate antileukemic immune responses in live challenge studies (Chapter II). While this assay is necessary in determining if a gene can enhance the im m unogenidty of a tumor cell line, it is unrealistic in a clinical setting to administer live tumor cells to a patient. A more stringent and applicable method, is the irradiation of gene-modified leukemia cells and their administration as a vaccine. Therefore we did experiments in a vaccination pre-challenge model in which mice are vaccinated with gene-modified leukemia cells prior to challenge with a lethal dose of BM185wt cells. Results BM185 cells expressing one or more immunomodulators demonstrate increased immunogenidty. To more dosely mimic a clinical setting where patients would receive irradiated tumor cells expressing immune stimulating genes, cohorts of Balb/c mice were vaccinated twice with 5x10“ irradiated cells (3000 cGy) one week apart and subsequently challenged one week later with SxlO3 wild type BM185 cells (Figure 1). BM185/CD40L/GM-CSF, BM185/CD80/CD40L/GM-CSF, BM185/CD80/GM-CSF, and BM185/CD80 cohorts had a percentage of 81 Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. mice able to reject intravenous challenge, whereas BM185wt, BM185/CD40L, and BM185/CD80/CD40L cohorts did not show protection compared to unvaccinated mice. When mice were analyzed for cytotoxic T 3 C /3 e g £ 2 5 20 1 5 10 i n i n i n Naive BM185wt BM185 BM185 BM185 BM185 BM185 BM185 CD40L CD80 CD40L CD80/CD40L CD80 CD80 CD40L GM-CSF GM-CSF GM-CSF Figure 1. Survival of Vaccinated M ice Following BM185wt Challenge. Balb/c mice were vaccinated with SxlO6 irradiated cells of the indicated cell lines. Naive mice were not vaccinated. Vaccinations were given on days -14, -7 and mice were subsequently challenged with SxlO3 BM185wt cells on day 0. Total num bers of mice surviving challenge in each cohort are listed in the graph. Data are compiled from 2 separate experiments with similar results. 82 Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. lymphocytes (CTLs) specific for BM185wt cells, cohorts of mice that demonstrated protection from vaccinations had statistically higher levels of tumor specific CTL responses compared to mice that did not have significant protection conferred by vaccination (Figure 2). BM185/CD40L/GM-CSF, BM185/CD80/CD40L/GM-CSF, BM185/CD80/GM-CSF, and BM185/CD80 cohorts had CTL levels that were not statistically different from each other, but differed statistically to BM185wt, BM185/CD40L, BM185/CD80/CD40L, and naive cohorts with p values ranging from .000098 to .054158 (Table 1). Survival of mice vaccinated and subsequently challenged with wild type BM185 cells was significantly correlated with the level of CTL induction in the different cohorts (R=.66) (Figure 3). Discussion As demonstrated in Chapter II, the CD80/ GM-CSF/ CD40L combination was highly protective in live challenge experiments (Figure 2, Chapter II). This cell line also induced high levels of CTL activation comparable to that of CD80 alone (Figure 2). The enhanced survival of mice receiving the combination in live experiments most likely reflects the ability of these immunomodulators to recruit multiple arms of the imm une system including CD4, CD8, and NK cells. In vaccination experiments whereby mice were pre-vaccinated and subsequently challenged with wild type 83 Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. IA 50 N aive BM185wt BM 185 BM185 CD40L CD80 CD40L BM185 BM185 BM185 BM185 CD40L CD80/CD4OL CD80 CD80 GM-CSF GM-CSF GM-CSF Figure 2. CTL Induction in Balb/c Mice Following Vaccination with BM185 Cell Lines. Balb/c mice were vaccinated with SxlO6 irradiated cells of the indicated cell lines. Naive mice were not vaccinated. Vaccinations were given on days -14, -7. On day 0 mice were sacrificed and splenocytes were stimulated with irradiated BM185/CD80 cells for 5 days and subsequently tested for their ability to lyse BM185wt cells at an effector to target ratio of 100:1. Percent lysis is shown as the mean value of five mice per cohort. Data shown are a representative experiment of two. 8 4 Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. Reproduced with permission o f th e copyright owner. Further reproduction prohibited without permission. Table 1. CTL Induction; p values between cohorts* BM 185wt BM 185/CD40L BM 185/CD80/CD40L B M 185/CD40L/GM -CSF 0.0006009 0.014445 0.054158 BM 185/CD80/CD40L/GM -CSF 0.001199 0.003041 0.012975 BM 185/CD80/GM -CSF 0.000125 0.000325 0.001516 BM185/CD80 0.000098 0.000256 0.001199 ap values given at 95% confidence as determined by Scheffe's Multiple - Comparison Test 00 L f l 0 > E s s 60 e o - j c a 0) 0* 2 5 BM185 aCD8CVCD40L ♦ GM-CSF 20 BM185 CD40L GM-CSF BM185 CD80 ♦ GM-CSF 15 BM185 CD80 10 Naive BM185 C D 4 0 L 5 BM1S5 CD80 CD40L BM185wt 0 0 20 10 40 50 60 3 0 Percent Specific Lysis of BM185wt Targets Figure 3. CTL Induction Correlates with Survival Post Vaccination. Mean values from figures 1 and 2 were used as mean values to plot the percentage of long term survivors as a function of percent specific lysis of BM185wt targets. Survivorship correlated with percent spedfic lysis as indicated by the linear regression line (R=.66). leukemia, BM185/CD80/CD40L/GM-CSF protected mice at a similar level as BM185/CD80, BM185/CD80/GM-CSF, and BM185/CD40L/GM-CSF. These four cell lines were also found to induce the greatest CTL responses, 86 Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. indicating that in this setting, where antileukemic im m unity is established prior to leukemia challenge, CTL memory cells are a critical component in antitumor immunity. While current investigations in the field of tum or immunology focus on T cell mediated responses, the humoral immune response was originally thought to be beneficial in antitumor immune responses (78). Tumor specific antibodies w ere hypothesized to eradicate tum ors in the following manner: complement activation and subsequent lysis, opsonization of the tumor cell and subsequent phagocytosis of the cell by macrophages, and finally antibody dependent cellular cytotoxicity (79). Cytotoxicity, however, is not guaranteed. One way whereby the tum or cell can evade this response is by antigenic modulation, in which the tumor cell down regulates antigen expression after monoclonal antibody binding occurs, thus leading to tumor resistance. Secondly, antibodies binding antigen on the surface of tumor cells can lead to internalization of the antigen preventing complement and effector cell activation. Finally, antigen shedding from the surface of tumor cells can lead to the formation of circulating immune complexes and rapid clearance of antibodies from the serum. Administration of naked monoclonal antibodies into cancer patients, however, was found to be ineffective by the mid 1980s (80). In contrast, antibodies linked to either radionuclides or immunotoxins, which allow localization of the toxin to the cancer cells, have proven to have anti-cancer 87 Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. effects (79). Another strategy employs coupling monoclonal antibodies that react with tumor cells to monoclonal antibodies that bind and activate other cells of the immune system. An example is die antibodies that activate T cells by binding to the CD3-TCR complex or die antibodies that bind the CD16-FcRIII receptor on NK cells (79). While administration of modified antibodies can be beneficial, evidence exists for a detrimental effect of humoral responses directed at cancer cells. Studies in murine tumor models have looked at the progressive growth of tumor cells despite the presence of an immune response against the tumor cells (81). It was found that during the progressive growth of the tumor cells, cytotoxic cells isolated from the mice were able to lyse cultured targets from the cultures used to inoculate the mice, but that targets obtained from the ascites tumors were resistant to lysis. It was later discovered that the resistant tumor cells w ere coated with IgM antibody. This phenomenon was seen in two different tum or models and the phenomenon was confirmed by other investigators in experiments that looked at giving antisera to mice, which allowed tumor growth to occur even in a histo-incompatible host. These antibodies were termed "enhancing antibodies" since they enhanced the growth of the tumor. Another study has demonstrated the detrimental effects of antitumor humoral responses in a murine model of rhabdomyosarcoma. In this model, administration of cyclophosphamide followed by IL-15 resulted in significant prolongation of life. NK cells and tumor specific T lymphocytes 88 Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. mediated the immune response. Interestingly, prolongation of life was significantly improved even further in B cell deficient mice suggesting that B cells appear to suppress the antitumor effects of the therapy (82). Additional studies in a murine model of mammary adenocarcinoma demonstrate that immunization with irradiated tumor cells elicits a humoral response, which is non-protective, as 100% of mice bear tumors following challenge (83). The same immunization, however, in B cell deficient mice resulted in 80% of mice to be tumor free. When B cells were adoptively transferred back to the B cell deficient mice and mice were subsequently immunized and challenged, once again 0% of mice were tumor free. The rejection of the tumor cells in the absence of B cells was CD4 and CD8 dependent, and it was determined that the B cells inhibited the CD4 T lymphocytes in the priming of the immune response, and that in vitro CTL responses were enhanced in B cell deficient mice. In contrast to early studies showing a lack of efficacy of in vivo generated humoral immune responses in eliminating cancer, much evidence now exists for the beneficial effects of eliciting anti-cancer cellular immune responses (Table 2). It has been established in multiple murine tumor models that the manipulation of T cell responses by certain cytokines a n d /o r immunomodulatory proteins provides benefit in these models. Hence the field has shifted toward the analysis of T cell responses and their role in antitumor immunity (78). Recognition of a tumor by specific CTLs requires the following: antigens capable of T cell recognition, presentation 89 Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. Reproduced with permission o f th e copyright owner. Further reproduction prohibited without permission. Table 2. Anti tumoral Effects of Gene Modified Tumor Cellsa Cytokine M urine Model Major Effector Cell(s) Decreased Tumorigenicity Elimination of Established Tumors M emory Reference 1 L-2 Colon carcinoma CD8 Yes No Yes 84 IFNy Sarcoma CD8 Yes No Yes 85 IL-7 Plasmocytoma CD4 Yes No NT*’ 86 TNFa Sarcoma CD8 CD4 Yes No Yes 87 GM-CSF Melanoma CD8CD4 Toxicc Yes N T 32 CD80 Acute Leukemia CD8 Yes Yes NT*’ 26 “adapted from Tepper & Mul£ (88) and Vieweg & Gilboa (89). b NT - not tested Toxic - live GM-CSF expressing cells caused systemic, fatal toxicity 8 of these antigens on the cell surface at sufficient frequency to induce an immune response, ability of the antigen to bind MHC allele(s) present in the host, and the T cell recognition m ust be accompanied by "help" either in the form of costimulatory signals or by exogenous help from accessory immune system cells (90). In our studies, vaccination w ith CD40L expressing cells were no more effective than wild type leukemia in eliciting CTL responses, providing further evidence that protection mediated by CD40L is mainly mediated through NK cells (Chapter ID). The expression of CD80 alone, however elicits statistically higher levels of CTLs (Figure 2, Table 1). This effective CTL priming has been hypothesized to be due to the presence of the costimulatory molecule on the tum or cell surface, allowing the tumor cell to effectively act as a mature antigen presenting cells, providing both antigen in the complex of MHC, and a costimulatory signal (34). The presence of additional cytokines, including GM-CSF and CD40L, or GM-CSF alone did not generate a greater response than that seen by CD80 alone (Figure 2, Table 1). It may be that these cytokines provide no further added benefit in the CTL response but rather enhance survival in live challenge experiments by alternate means. Alternatively, there may be a maximal level of cytotoxicity given the number of CTL precursors, which is reached by CD80 expression alone. An interesting result is that seen by the combination of CD80 and CD40L. Despite the presence of CD80 in these cells, low levels of CTLs were induced and this cell line performed poorly in vaccination experiments (Figure 1). One potential explanation for 91 Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. this result is the ability of CD40L to activate NK cells. It may be that NK cells eliminate the majority of the cells before they are able to effectively stimulate T lymphocytes in vivo. This may not be true in the triple combination due to the presence of GM-CSF w hich can recruit large num bers of antigen presenting cells, and combined with CD40L stimulation, these mature cells may be able to stim ulate larger CTL responses despite the activation of NK cells and the subsequent elimination of tum or cells. Similarly, this would explain the higher CTL levels and enhanced survival of mice receiving the CD40L/GM-CSF combination despite the lack of CD80 expression. In the pre-vaccination setting, the triple combination did not provide much added benefit to the CD80/GM-CSF combination (Figure 1), however this scenario favors a cell line's ability to induce m em ory CTLs. A more clinically applicable model, is that of pre-existing disease. In this setting, the ability of NK cells to act at an earlier time point, before the elicitation of CTLs, may allow the combination to succeed at prolonging survival of mice with an existing tumor burden. Hence we m oved on to experiments involving antileukemic vaccinations following BM185wt challenge. 92 Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. Chapter VI: Vaccination Post Challenge Introduction Following chemotherapy, the majority of patients with Ph+ ALL relapse due to the presence of residual blasts in the body. To more closely mimic this clinical setting, we tested our gene-modified leukemia cell vaccines in the most stringent assay: the eradication of pre-established disease. To establish disease, we gave mice the minimal lethal dose of lxlO 3 BM185wt cells and looked at the ability of our vaccinations to delay or prevent death in mice with these tumor burdens. Results Previous studies in our lab have shown that mice which were first intravenously challenged with a sublethal dose of BM185 cells and then vaccinated with BM185/CD80/GM-CSF were not protected compared to unvaccinated mice, despite the development of cytotoxic T lymphocytes (35). If challenged subcutaneously, however, 3 /5 mice subsequently vaccinated with BM185/CD80/GM-CSF were able to reject the pre- established leukemia. Thus, although systemic im m une responses were generated, mice were unable to eradicate pre-established systemic leukemia. We hypothesize this to be due to the high malignancy of our 93 Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. model. Because CD40L mediates protection in part by NK cells in our model, we hypothesized that this immediate innate immunity m ay be able to keep the tumor burden low until CD80 and GM-CSF expression is able to initiate tumor specific systemic T cell immunity. Thus we challenged mice with 1000 BM185 cells intravenously and subsequently vaccinated mice on days +1, +5, and +12 with irradiated BM185/CD60/CD40L/GM-CSF cells. Unfortunately, vaccinated mice were not protected and all succumbed to the leukemia at the same rate as mice vaccinated with BM185/CD80/GM- CSF and as untreated mice (Figure 1). A recent report demonstrated a delay in the development of leukemia with systemic IL-12 treatments in a murine model of Acute Myeloid Leukemia (AML) (91). In order to determine if this w as the case in our murine model of ALL, we gave cohorts of mice subcutaneous IL-12 injections following intravenous challenge w ith lxlO3 BM185 cells. Surprisingly, 80% of mice treated with rmIL-12 alone following BM185wt challenge survived (Figure 2). Upon rechallenge, however, all the mice succumbed to the leukemia, indicating a lack of immunologic memory (Figure 2). When IL-12 treatments were combined with BM185/CD80/CD40L/GM-CSF vaccination following BM185 challenge, 100% of mice survived. In addition, these mice rejected subsequent rechallenge with BM185wt cells suggesting long term memory (Figure 2). 94 Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. 120 100 No Treatment BM185/CD80/GM-CSF Vaccination BM185/CD80/CD40L7GM- CSF Vaccination 6 21 16 1 11 ▲ Vacc Vacc Vacc Days Post BM185wt Challenge * Figure 1. Vaccination in Mice with Established Leukemia. Mice were challenged w ith lxlO 3 BM185wt cells on day 0 and subsequently vaccinated with either lxlO 6 irradiated BM185/CD80/GM-CSF or lxlO6 irradiated BM185/CD80/CD40L/GM-CSF on days 1,5, and 12. One cohort of mice was left untreated. This is the first demonstration of eradication of established systemic leukemia in our murine model of ALL. To determine if IL-12 w as directly toxic to BM185 cells, BM185 cells were cultured in mtro with IL-12 present at increasing doses (Figure 3). Cell viability was assessed daily by trypan 95 Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. 120 100 t t 80 > 60 s e a 0- 20 No Treatment Vacc -No Treatment -IL-12 •Vacc ■IL-12 + Vacc ■ L .lS n t iY lK IL-12 11 21 31 41 51 61 71 81 91 101 111 Primary Challenge Secondar y Challenge Days Post BM185wt Challenge Figure 2. Recombinant IL-12 Adm inistration in Conjunction w ith Vaccination Eradicates Pre-established Leukemia. Mice were challenged with lxlO3 BM185wt cells on day 0 and subsequently vaccinated with either BM185/CD80/CD40L/GM-CSF (Vacc), recombinant m urine IL-12 (IL-12), BM185/CD80/CD40L/GM-CSF in combination with rmIL-12 treatments (IL-12 + Vacc), or were given no treatments at all (No Treatment). Cell vaccinations consisted of lxlO6 irradiated cells on days 1,5, and 12. IL-12 treatments consisted of subcutaneous injection of 2.5 /tg rmIL-12 on days 0, 1,2,3,4,14,15,16,17, and 18. Long term survivors were rechallenged with lxlO3 BM185wt cells on day 61. 96 Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. blue exclusion and total live cell counts were recorded. IL-12 was not toxic to BM185 cells in vitro, indicating that its effects in vivo were mediated by the immune system. -♦-0.0 ng/ml rmIL-12 ♦ — 10 ng/ml rmIL-12 * 50 ng/ml rmIL-12 i t - 100 ng/ml rmIL-12 ♦ — 500 ng/ml rmIL-12 U £ Day 0 Day 1 Day 3 Day 2 Day 4 Figure 3. IL-12 is Not Directly Toxic to BM185wt Cells In Vitro. BM185wt cells were grown in the presence of increasing amounts of rmIL-12 as indicated in the figure legend. Total viable cell counts were determined by trypan blue exclusion. 97 Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. Discussion The CD80/GM-CSF/CD40L combination was highly protective in live challenge experiments. This cell line was more beneficial in live challenge experiments despite having similar CTL activation to BM185 cells expressing CD80 alone. The enhanced survival of the mice receiving the combination in this setting most likely reflects the ability of these immunomodulators to recruit multiple arms of the imm une system including CD4, CD8, and NK cells, NK cells being effective immediately upon challenge and keeping the tumor burden down while the adaptive T cell response is generated. Previously, it has been shown that vaccination with CD80/GM-CSF was insufficient to protect against pre-established leukemia in our model (35). We hypothesized that the NK recruitment provided by CD40L expression would keep the tumor burden low until sufficient CTLs developed to eradicate the leukemia. W hen mice with pre- established leukemia were vaccinated with the CD80/ GM-CSF/ CD40L combination, however, there was no delay in the development of the leukemia and all mice succumbed to the disease. This likely reflects the malignancy of our model. As few as 103 BM185 cells results in 100% mortality within two to three weeks. Mice dying of this challenge dose demonstrate massive infiltration of lymphoblasts in the spleen, bone marrow, and peripheral blood. The kinetics between tum or cell growth and the generation of tumor specific immune responses have been shown to be a critical factor in the rejection of tumor cells in m urine models (92). 98 Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. The doubling time of BM185 cells is approximately 12 hours, and hence by the time cytotoxic T lymphocytes develop 7 days post vaccination, the tumor burden in the mice can be estimated to be as high as 1.6xl07 cells if challenged with lxlO3 cells. CD40L can activate NK cells indirectly by stimulating antigen presenting cells to secrete IL-12 (8). This indirect stimulation was hypothesized to be inadequate in mice with these large tumor burdens. The addition of recombinant murine IL-12 as an adjuvant with the vaccinations, however, allowed mice with pre-established systemic leukemia to survive and reject subsequent rechallenge with the wild type strain. Surprisingly, mice given rmIL-12 alone, also rejected pre-established leukemia although these mice lacked immunologic m em ory as determined by subsequent rechallenge. The mechanism of IL-12 protection has not yet been determined in our model although IL-12 is not likely to be directly toxic to BM185 cells in vivo, as in vitro growth rates w ere not inhibited by IL-12 concentrations as high as 0.5 /xg/ml. Previous studies have shown systemic recombinant IL-12 induced tumor regression to be CD8, NK or Va14 NKT (NKT) cell mediated responses depending on the tumor model used (93-96). Due to the lack of immunologic memory in our system, we hypothesize the effect to be mediated by either NK or NKT cells. NKT cells share characteristics of both T cells and NK cells, yet are a distinct cell lineage defined by the expression of an invariant T cell receptor (TCR) ( V ^ J ^ l in mice and V ^ Jo Q in humans) (97). This TCR 99 Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. recognizes glycolipid antigen complexed with the MHC class I like molecule C D ld. They are either CD4* or CD4 CD&, express numerous NK cell surface markers such as NK1.1, DX5, and Ly49a, and are absent in CD1 knockout mice and L281' mice. This population of cells should be distinguished from CD8+ T cells which can be stimulated by Thl type cytokines to upregulate NK markers (98). These CD8VNK marker* cells have a polyclonal TCR repertoire and do not recognize antigen complexed with CD1. They are present in both CD1 knockout mice and J^& Y'' mice. Their function is not clear but it is suggested that they are responsible for the non MHC restricted killing often seen in vitro by CD8* cells. The role of NKT cells in the immune system is thought to be regulatory, as they can produce large amounts of pro-inflammatory Thl cytokines as well as anti inflammatory Th2 cytokines in response to TCR ligation. Many reports have demonstrated their role in antitumor immunity, while other reports have shown them to suppress autoimmunity. Recently, it was shown that NKT cells were responsible for down regulating the antitumor response in a Balb/c fibroblast tumor model through the cytokine IL-13 (99). A report comparing the relative effects of NK and NKT cells by IL-12 induced tumor responses found that the dose and schedule of exogenous IL-12 administration was an important factor (100). High dose IL-12 (defined by a total of 2500 units over 10 days starting treatment 5 days before tumor inoculation) preferentially employed NK cells while low doses (500 units over 10 days) resulted in a greater role of NKT cells. High 100 Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. dose IL-12 treatment that was delayed until three days after tumor inoculation also favored a greater role for NKT cells suggesting the tumor burden may also influence the relative role of NK and NKT cells. Hence the dose and scheduling, along with the tumor model employed all contribute to the mechanism of IL-12 induced antitum or immunity. In addition to the dose and scheduling of IL-12 administration, die method of delivery can alter the effector mechanisms (94). A report by Cavallo and colleagues found that tumor cells engineered to express IL-12 elicited antitumor immune responses mediated by CD8 T lymphocytes whereas systemic recombinant IL-12 treatments elicited NK cells, polymorphonuclear leukocytes, and CD8 T lymphocytes. These different modes of IL-12 deliveries also differed in their ability to eradicate established tumors. In mice with one day established tumors, recombinant IL-12 (rIL-12) was twice as effective as irradiated tum or cells expressing IL- 12. In mice with 7 day established tumors, tumor cells expressing IL-12 were ineffective whereas rIL-12 cured 24/30 mice. It may be the natural immunity recruited by the recombinant IL-12 administration allows this mode of therapy to be more effective in established tumors as they immediately act upon tumor cell eradication keeping the tumor burden low, whereas CD8 mediated tumor responses take time to develop. The ability of IL-12 in combination with our cellular vaccine is encouraging as this is the first demonstration of eradication of established leukemia in our highly malignant model of Philadelphia chromosome 101 Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. positive ALL. The use of a recombinant cytokine as an adjuvant to vaccines is not novel. More specifically, GM-CSF has been previously found to augment antigen-specific CTL responses to whole cell vaccines (101). In our model, the ability of IL-12 to be effective in the absence of the vaccine indicates it has a function on its own rather than acting solely as an adjuvant to enhance the response generated by the irradiated tumor cells. This combination m ay be potent enough to provide therapeutic benefit for patients in remission following chemotherapy. The induction of an adequate immune response in patients in remission may allow the immune system to eradicate minimal residual disease and thereby decrease the rate of relapse in Philadelphia chromosome positive ALL patients. Furthermore, the ability of CD40 Ligand to act in a T cell-independent manner may be an important factor in this type of vaccine as patients have depressed cellular immunity following chemotherapy. 102 Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. Chapter VII: Conclusions and Future Directions Mechanism o f IL>12 Protection Recombinant IL-12 was found to have significant antileukemic effects in this m urine model. Future experiments im portant in the development of this type of therapy should include the mechanism of protection mediated by IL-12. The most beneficial route of delivery of this cytokine is also important. IL-12 m ay function best w hen given as an adjuvant to the cellular vaccine as shown in the previous chapter. Alternatively, transduction of leukemic blasts with IL-12 may not only stimulate innate immune responses but also long term T cell mediated memory in a superior fashion and thus be more advantageous. If optimal in transduced leukemic blasts, the most beneficial combinations should also be considered to induce maximal antileukemic immune responses, as was done for CD40 Ligand in these studies. While immediate, innate immunity was critical in our model in the setting of minimal residual disease, long term memory is also critical in the generation of a cellular vaccine for ALL. Immediate imm unity may decrease the tum or burden, or if potent enough, may eliminate the tumor burden. In all likelihood, however, residual blasts will remain and thus the establishment of long term memory is important in maintaining the state of 103 Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. clinical remission. Periodic immunizations may prove useful in maintaining this remission and preventing relapse. In Vitro Culture o f Primary ALL Blasts In order to translate these experiments into a clinical setting additional studies are required. Optimal vaccination dose, route, and frequency are studies that can be done in mice to determine the most efficacious setting for a tumor vaccine. In addition, the culture of primary ALL blasts and the transduction of these cells must be established in vitro. Despite their ability to rapidly divide in vivo and generate large tumor burdens, primary ALL blasts do not proliferate readily in xntro and die rapidly by apoptosis. Studies on culture conditions for primary blasts have most often analyzed the cytokines CD40L, IL-3, IL-4, IL-7, and SCF. In one set of experiments 21 samples of primary leukemic blasts were analyzed for CD40 expression (102). All samples expressed the receptor CD40 and 8/10 samples were found to proliferate by the addition of CD40 Ligand, especially in the presence of IL-3. IL-4 alone inhibited spontaneous proliferation but was found to stimulate proliferation in conjunction with CD40 ligation. IL-7 did not contribute to proliferation. It has been previously demonstrated that leukemic B cell precursors express functional IL-3 receptors (103). From these data the authors concluded that CD40 crosslinking is anti-apoptotic and in some cases induces proliferation, especially in the presence of IL-3. Subsequently similar studies were done 104 Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. looking at soluble CD40L, IL-3, IL-7, and SCF alone and in combination in leukemia cell cultures (104). These studies elegantly demonstrated the upregulation of receptors for IL-3, IL-7, and SCF in the presence of soluble CD40L. While proliferation was minimal in the presence of sCD40L alone, it's combination with either IL-3, IL-7, SCF or all three stimulated proliferation in 7 /7 primary leukemic samples. From these experiments, they drew the conclusion that sCD40L was effective due to its ability to upregulate receptors for other cytokines such as IL-3, IL-7, and SCF and allow proliferation in response to these cytokines. The most effective combination was sCD40L, IL-3, and SCF. Interestingly, in one patient sample for which proliferation was maintained by this combination, the withdrawal of IL-3 was found to have the most profound effect on the ability of these cells to be maintained in culture, indicating that proliferation was mediated by IL-3 and that the role of CD40L was primarily in the upregulation of the IL-3 receptor. Another growth factor studied is the low-molecular-weight B-cell growth factor (lmw-BCGF) that is derived from cultures of phytohemagglutinin-stimulated peripheral blood lymphocytes whose main component is IL-4 (105). lmw-BCGF as well as IL-3 and IL-7 cytokines were compared in 17 patient samples. Each growth factor was able to induce proliferation in certain samples, although lmw-BCGF seemed to be the most stimulating growth factor on proliferation. An important observation in these experiments was the fact that while a given cytokine was 105 Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. stimulatory in one patient sample, it was inhibitory in other samples. This brings to the forefront a common characteristic in all of these studies: the heterogeneity in the proliferative response to cytokine combinations, which exists between different samples. Even in patient samples that respond to the cocktails, proliferative responses are slow, with minimal expansion of the cultures. Perhaps one of the most successful culture methods is that used by Nishigaki et al (106). In these experiments the author used hum an stromal cells to support the leukemic blasts. In 51 of 108 B-lineage ALL samples, bone marrow-derived stroma inhibited apoptosis of ALL cells and supported their proliferation in serum-free medium without the addition of exogenous cytokines as determined by total cell numbers after 7 days of culture. One interesting aspect of the studies involved the tim e frame of the analysis. In the majority of experiments assessment of cultures was delayed for as long as 5 months, in contrast to periods of 1 to 2 weeks in conventional tests. This amount of time may have allowed quiescent leukemic stem cells to enter the cell cycle. In sorting experiments where single clones were analyzed, doubling times differed, supporting the concept of delayed stem cell activity. Hence, in a clinical setting, leukemic blasts isolated at diagnosis could be grown in this culture system to pull out the leukemic stem cell and once this clone was established, transduced, irradiated, and returned to the patient. This would immunize the patient against antigens present on the leukemic stem cell and not other antigens 106 Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. that may arise in the progeny, thus increasing the likelihood of eliminating the source of the leukemic blasts. Transduction o f Primary ALL Blasts One way to overcome the growth limitations of blasts in vitro is in the use of vectors that do not require cell division. Lentiviral vectors have been shown to stably transduce nondividing cells such as terminally differentiated neurons and cell lines blocked in the cell cycle (107). When tested in primary leukemia blasts cultured on human stroma, transduction frequencies with VSV pseudotyped lenti viral vector expressing eGFP ranged from 2.2% to 43.35% (108). Further studies using a vector expressing CD80 resulted in transduction frequencies between 40.3 and 90.3 when an MOI of 10 was used. Cell viability, however was only 10-20% and transduced phenotype was difficult to distinguish in the report as total counts by flow cytometry only reached 10 and data was reported as histograms rather than dot blots (109). Another vector tested in prim ary ALL blasts is the Herpes Based Vector system (DISC-HSV) (110). In this system the herpes virus lacks the glycoprotein-H gene that is an essential component for the infectivity of HSV. In place of the protein one can put in the gene of choice. The particles are made in a complementary cell line, which supplies glycoprotein-H in trans. The packaged vector that is generated has the gene of interest and can infect cells, but is unable to replicate and produce viable 107 Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. virus. The DISC-HSV vector was found to transduce primary ALL blasts at levels between 85 and 100% in five samples. A major limitation of this system, however, is that the transferred gene is only expressed for a limited time, which most likely reflects the failure of the vector to stably integrate into the genome. A second limitation involves the possibility of an immune response generated against viral protein products produced by expression of the vector genome, as is the case with adenoviral vectors. Although this type of response may be immunodominant and mask the effects of the tumor vaccine, it may in contrast act as an adjuvant enhancing the antitumor immune response. In vitro studies would need to be done to determine the effects of antiviral immune responses on the antitumor responses. A vector which has not been tested in primary leukemia cells, is the adenoviral vector. This vector is able to transduce non-dividing cells and therefore may be an ideal candidate for further studies comparing the efficiency of various vectors in transduction of primary leukemic blasts. Alternative Approaches If these obstacles are insurmountable, alternative approaches may be utilized. Based on the results in our m urine model, systemic IL-12 alone is sufficient to eradicate existing disease. While vaccination w ith unmodified irradiated BM185wt cells is non-protective in a pre-vaccination setting, it may be that these cells are sufficient to induce a memory response. If this 108 Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. proves to be the case, in our mouse model, IL-12 treatments in conjunction with BM185wt vaccination should be as effective as IL-12 and BM185/CD80/CD40L/GM-CSF treatments. This would suggest that simply mixing irradiated unmodified patient leukemia cells w ith recombinant IL-12 could be an effective vaccine. This would bypass difficulties in the culture and transduction of primary leukemia cells. Another alternative receiving much attention in the field of tumor immunology involves the utilization of dendritic cells, potent antigen presenting cells of the immune system. In a murine model of leukemia, mice vaccinated with irradiated GM-CSF and IL-4 expressing tum or cells induced antileukemic immune responses which could be transferred to naive tumor bearing mice by dendritic cells from the bone m arrow of vaccinated mice (111). This underlies the potency of dendritic cells in their ability to induce antitumor immune responses. Furthermore, in a murine model of melanoma, dendritic cells presenting tumor antigen were more effective in a vaccination setting than GM-CSF transduced tum or cells (112). Hence dendritic cells may provide a more potent immune-stimulating alternative to cytokine expressing tumor cells. Dendritic cells manipulated to present tumor associated or tumor specific antigens have been shown to elicit tum or specific immune responses both in murine models and in in vitro human experiments. The mode by which dendritic cells are manipulated to express tum or antigen are numerous and varied. Most commonly, cells can be pulsed with whole 109 Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. tumor lysates or tumor specific peptides whereby the dendritic cells phagocytose and cross present the antigens. Another strategy utilizes RNA extracts from tumor cells to pulse the cells. Alternatively, dendritic cells can be transduced with a gene encoding a given tum or antigen. This has the advantage in that the protein product is naturally processed and presented on the cell surface, allowing multiple MHC restricted epitopes to be expressed on the cell surface rather than a single epitope (as is the case with peptide pulsing). This is the basis for the second portion of these studies: Analysis of Bcr-Abl transduced dendritic cells and their ability to elicit autologous antitumor imm une responses in vitro. 110 Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. Part II: Human Studies Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. Chapter VIII: Dendritic Cell Cultures and Transduction Conditions Introduction To evaluate the ability of Bcr-Abl transduced dendritic cells to elicit autologous T cell proliferation, we initially established culture conditions to generate dendritic cells from CD34* hematopoietic progenitors. We looked at the phenotype of these dendritic cell cultures by flow cytometry for cell surface markers characteristic of the dendritic cell phenotype, and we assessed their ability to stimulate allogeneic mixed lymphocyte responses as an indicator of function. Furthermore, we utilized pre-established CD34* progenitor cell transduction conditions to deliver a reporter gene, eGFP, and looked at the ability of differentiated dendritic cells to maintain expression of this gene. Results Initial experiments established conditions for generating dendritic cells from CD34" hematopoietic progenitor cells. This protocol was adapted from a report describing serum free culture conditions for dendritic cells (113). CD34* cells were isolated from hum an cord blood and placed in X-VTVO15, a serum free medium, with the following cytokine cocktail to differentiate them into dendritic cells: GM-CSF, TNFa, TGF0, SCF, and Flt3L. 112 Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. Unlike other cell types of hematopoietic origin, there is no single cell surface marker seen only on dendritic cells. The definition of a dendritic cell is mainly one of exclusion from other bone marrow derived cell lineages. Characteristics of dendritic cells include a characteristic morphology, low phagocytic activity, positivity for MHC Class II (HLA- DR) molecules, costimulatory molecules, and accessory molecules, and a strong capacity to stimulate allogeneic T cells. A population w ith a few or all of these characteristics and the absence of lineage markers for T cells, B cells, Granulocytes, Macrophages, and NK cells are defined as dendritic cells (114). By flow cytometry, we analyzed our population for the absence of B, T, and monocyte lineage markers, the presence of HLA-DR, the presence of various costimulatory molecules (CD40, CD80 and CD86), as well as the presence of CDla, a marker seen on dendritic cells and cortical thymocytes. In addition, we looked at morphology by microscopy, and the ability to stimulate allogeneic T cells. Dendritic cells were cultured from CD34 progenitors in the afore mentioned cytokine supplemented medium, and analyzed for morphology and by flow cytometry at 7,10,14,17, and 21 days. Day 14 was found to be optimal as total yields peaked at this time point and the HLA-DR/costimulatory molecule bright population percentage had plateaued (Table 1, Figures 1-3). To verify functionality of the generated dendritic cells, day 14 dendritic cells were tested for their ability to stimulate proliferation of allogeneic T lymphocytes. Dendritic cells were irradiated and cultured in 113 Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. Reproduced with permission o f th e copyright owner. Further reproduction prohibited without permission. Table 1. CD34+ Differentiated Dendritic Cell Phenotypes Days in Total Cell Lineage Neg*1 Lineage Neg? Lineage Neg” Lineage Neg” Dendritic Yield1 H LA D R P os H L A D R P os H L A D R P os H LA D R Pos Cell M edium CD 86 Pos C D 80 Pos C D 40 Pos C D la Pos Day 7 1.64x10" 6.58% 3.15% 5.95% 19.92% Day 10 4.93x10" 18.73% 13.3% 19.14% 23.27% Day 14 7.54x10" 51.6% 48.94% 51.7% 26.31% Day 17 4.64x10" 56.04% 50.57% 57.47% 29.54% Day 21 2.58x10" 58.61% 57.7% 55.32% 42.35% Starting CD34 cell number per time point is 4.16xl0\ ’ ’Lineage Neg donates population negative for CD3, CD14, and CD19. a 1X3071498. 003 0 200 400 600 8001000 FSC-Heght R 1 Lineage Neg Gate Based on ASC Control TG071498.003 10' 1(T 10J CD 86FITC 51.0'7 HLA-DR/C DXO Positive TG071498.004 - , . . .f— . i.. iou io1 i<r 10J 10* C D 80FITC 4S.l)4'7 HLA-DR/CD80 Positi\e TG071498.005 " " " l- J " « T . io 1 n r ioJ 1 0 ^ C040FITC 5 1.7'( HL.A-DR/CD40 Positive ▼ TG 071498.006 O ' ■ n —> 1 1 0 u 1 0' CDUFITC 26.31 ri HLA-DR/CDIa Positive Figure 1. Phenotype of Day 14 Dendritic Cells. Cells were harvested at day 14 and stained with PE labeled anti lineage markers, HLA-DR, and one of four FITC conjugated antibodies: CD86, CD80, CD40, and C D la. Lineage negative cells were gated (a) and are shown in lb -le (gate selected based on ASC controls). 115 Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. Figure 2. Wright Giemsa Stain o f D ay 14 Dendritic C ells. Figure 3. Phase-Contrast Microscope V iew of Day 14 Cultures. Reproduced with permission of the copyright owner. Further reproduction prohibited without permission the presence of allogeneic peripheral blood mononuclear cell (PBMC) responders. In parallel, irradiated allogeneic PBMCs w ere cultured with PBMC responders and PBMC responders were cultured alone. Responders were assayed for thymidine incorporation after one week of co-cultivation (Figure 4). The dendritic cell cultures stimulated proliferation of allogeneic T lymphocytes similar to allogeneic PBMCs, confirming that our dendritic cells were functional with potent antigen presenting capabilities. E Q . C .o s o o u c H 5 E > » 90000 j 40000 30000 | 20000 10000 ■ Dendnbc Ce*s * Responders Only »AKogenec PBMCs 2000 4000 0000 8000 10000 APCs per well Figure 4. Allogeneic Mixed Lymphocyte Reaction w ith Day 14 Dendritic Cells. Peripheral Blood Mononuclear Cells (PBMC) were incubated alone, in the presence of irradiated allogeneic PBMCs, or in the presence of irradiated day 14 dendritic cells for one week. Cultures were then pulsed for eight hours with thymidine and incorporation was m easured on a beta counter overnight. 117 Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. To generate dendritic cells expressing our gene of choice, we transduced CD34 progenitors with retroviral vectors in the presence of IL-3, IL-6, and SCF (growth factor media) and subsequently differentiated them into dendritic cells using our cytokine supplemented serum free media. Transduction conditions for CD34* progenitor cells w ere used as previously described (115). A retroviral vector containing the reporter gene eGFP was used for initial transduction studies. CD34* cells were transduced w ith three "hits" of retroviral vector on three subsequent days and then maintained in the growth factor media for two days. Subsequently transduced cells were sorted for expression of the eGFP reporter gene and then placed in dendritic cell media for 14 days. Cultures were analyzed by flow cytometry for the expression of the reporter construct and the dendritic cell phenotype (Figures 5-6). When HLA-DR bright and CD86 positive cells, indicative of the dendritic cell phenotype, were gated, 68.4% of the cells m aintained eGFP expression (Figure 5). In this cord blood sample, 15.1% of the culture expressed the mature dendritic cell phenotype and hence 10.3% of the total culture was eGFP positive dendritic cells (data not shown). 118 Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. Y-TG042198. 001 ~io° "io1 lo 2 "ip* 10" FLI+teight Mock Y-TG042198.002 Jm . 10u 101 102 10J 10" eGFP eGFP Transduction mock cells cultured for 10 days in dendritic cell media eGFP+ cells sorted and cultured for 10 days in dendritic cell media TG050198.004 FSC-Height TG050198.018 o 0 200 400 600 8001000 FSC-Height Figure 5. eGFP Transduction of Dendritic Cells. CD34 progenitors were isolated and transduced on fibronectin in the presence of IL-3, IL-6, and SCF (GFM) with three hits of vector or media (mock) on three subsequent days. Cells were allowed to expand in fresh GFM for two days and then placed in dendritic cell medium for ten days. 119 Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. Figure 6. Fluorescent M icroscopy of an eGFP Positive Dendritic C ell. Discussion In order to generate dendritic cell cultures transduced with a transgene, we utilized pre-established CD34 transduction conditions (115) and combined them w ith a culture system that generates dendritic cells from hematopoietic progenitors (113). Culture of CD34 progenitors for 14 days yielded optimal results, with mature dendritic cell phenotypes 120 Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. ranging from 13 to 70 percent of total cell numbers depending on the cord blood sample (data not shown). Dendritic cells are derived from hematopoietic stem cells and are present in low num bers in the lymphatics, lymph nodes, and various tissues. They are widely distributed in the skin (where they are called Langerhan cells), the cortical zone of the lymph nodes and spleen, as well as in other tissues. Their ability to respond to antigen requires the migration of tissue dendritic cells that have taken up antigen via the lymphatics to the lymph nodes where antigen presentation occurs. Epidermal or skin dendritic cells (Langerhan cells) are C D la positive and specialized for antigen uptake and processing. As they migrate to the lymph nodes they mature and lose this ability as CDla expression turns off; concurrently, they upregulate costimulatory molecules and MHC expression as they gain antigen presentation function. TGF-Pl is crucial for this subset of dendritic cells as in TGFfl deficient mice there is a lack of epidermal dendritic cells whereas other dendritic cell compartments develop normally (116). The culture system utilized in these studies was adapted from a previous report and progeny have characteristics of Langerhan cells (113). TGFf) and GM-CSF are present in the culture conditions to prom ote differentiation of CD34 progenitors to Langerhan cells. The maturation of these dendritic cells, which results in costimulatory molecule upregulation an d antigen presentation, is due to 121 Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. the presence of TNFa in the cytokine cocktail. Flt3L and SCF are present to expand cultures and increase the yield. The differentiation of dendritic cells from CD34 hematopoietic progenitors is not clearly defined. In vitro differentiation studies have revealed many different pathways of differentiation and the ability of differentiated cells to revert to the dendritic cell phenotype under certain conditions. Whether the disparate developmental pathways have physiological relevance, or whether they simply represent in vitro artifacts is unknown. The num erous developmental pathways, however, may indicate the central and crucial role that these cells play in the immune system. The various pathways of development that have been shown in multiple studies in vitro are summarized in Figure 7. CD34 progenitors give rise to both myeloid progenitors and common lymphoid progenitors. The myeloid progenitors can directly give rise to Langerhan cells, or differentiate into monocytes and polymorphonuclear cells which can both give rise to dendritic cells as well as other cell types such as macrophages, neutrophils, and granulocytes (117-118). The common lymphoid progenitor can give rise to NK cells, T cells, lymphoid dendritic cells, or pro-B cells which can either differentiate into B cells or lymphoid dendritic cells (119-120). 122 Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. HSC L C CLP M P DC NK Pro-B PMN M < t > DC DC Neu Gran Figure 7. Differentiation of Dendritic Cells from Hem atopoietic Progenitors. Evidence exists for dendritic cells that are both myeloid and lymphoid in origin. HSC, hematopoietic stem cell; MP, myeloid progenitor; CLP, common lymphoid progenitor; T, T cell; NK, natural killer cell; DC, dendritic cell; Pro-B, Pro-B cell progenitor; B, B cell; LC, langerhan cell; MO, monocyte; M4>, macrophage; PMN, polymorphonuclear cell; Gran, granulocyte; and Neu, neutrophil. The existence of human dendritic cells of lymphoid origin was first described by Galy and colleagues (120). CD45RA+ CD10+ Thy-1- human precursor cells were isolated from adult bone marrow, and were capable of 123 Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. differentiating into T, B, NK and DC under certain culture conditions. The dendritic cells generated from these cultures were positive for MHC Class II and CDla, and were effective aliostimulatory cells. Studies have also been done in mice where a lymphoid DC was defined with some T cell attributes (121). Early CD4lo “ T cell progenitors could give rise to B, NK, and DC upon adoptive transfer into irradiated mice. These dendritic cells expressed the CD8a homodimer and Thy-1, along with the DC antigens C D llc, MHC class II, and DEC205. This subset of DCs were found to limit the proliferation of CD4* T cells in xntro by Fas mediated apoptosis (122). It has been suggested from these and other studies that CD8a+ cells could play a role in peripheral tolerance whereas the conventional CD8a- myeloid derived DCs would initiate immune responses. However, CD8a+ cells were found to produce IL-12, a Thl type cytokine, and functional studies of these two E X T subtypes have suggested that CD8a+ cells play a role in Thl immune responses while CD8a - cells skew the immune response to be Th2 dominated (123). Recent evidence, however, has indicated that myeloid derived dendritic cells which are initially CD8a-, acquired CD8a expression on migration to the draining lymph nodes (124), and that CD8a- cells as well as CD8a+ cells can be derived from lymphoid committed precursors (125). Thus CD8a may not be a distinguishing marker for the two dendritic cell populations. Clearly, the roles of these two types of dendritic cells and their distinguishing markers have not been fully elucidated. 124 Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. In order to present tumor antigens to the immune system, dendritic cells can be pulsed with whole tumor lysates, tumor peptides, tum or mRNA or transduced with tumor antigen encoding genes (discussed in greater detail in Chapter X). Introducing genes of tumor specific antigens allows the protein product to be translated and multiple peptide determinants to be presented, and hence was the strategy chosen in these studies. This increases the chance that an individual with their MHC alleles will be able to present one or many of the peptides. There are many approaches to genetically modifying dendritic cells including adenoviral mediated transduction and physical methods such as lipofection, electroporation, and C aP04 precipitation (126). In a comparison of these methods whereby fully mature dendritic cells were targeted, adenoviral vectors resulted in the highest levels of gene expression (126). High MOIs were required (1000:1) for 90% or greater transduction efficiency. Lower levels of transduction (20%) were seen in another study using an MOI of 5000:1 when immature dendritic cells were transduced and subsequently matured with the addition of TNFa to the media (127). Transduction efficiencies of 90% were achieved when adenovirus was combined with liposomes. A confounding variable, however, with the adenoviral vector is the virus itself, which can initiate immune responses. Alternatively, the immunogenidty of the vector can have an adjuvant effect and enhance the immune response elidted by tumor antigens. 125 Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. Retroviral vectors have not been shown to generate antiviral immune responses, however they require cell division in order to integrate their genome into the host cell. Thus fully mature, non-replicating dendritic cells are not susceptible to retroviral mediated transduction in contrast to adenoviral vectors, which can transduce non-dividing cells. One way to overcome this, however, is to transduce precursors of dendritic cells that are actively dividing and differentiating into dendritic cells. This has been demonstrated in a previous report where CD34 progenitors were co cultured with a retroviral packaging cell line producing virus, in the presence of cytokines that induce differentiation into dendritic cells (128). Mean transduction levels varied between 11.5 and 21.2% of cells expressing CDla, a marker seen on immature dendritic cells. These transduced dendritic cells were found to express normal levels of accessory molecules and had normal T cell stimulatory capacity in presenting allogeneic, tetanus toxoid, and bacterial superantigens. Similar methods yielded similar transduction levels as published by Bello-Femandeze and colleagues (129). Retroviral vectors have also been shown to transduce proliferating cultures of PBMC derived dendritic cells when transductions were done early in the culture period with IL-4 and GM-CSF to ensure active division of cultures (130). In these experiments, we used pre-established transduction conditions for CD34 progenitors on fibronectin using GALV pseudotyped retroviral vector containing the eGFP reporter gene. Transduction of bulk 126 Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. CD34 cultures typically yielded 50% reporter gene expression (data not shown). When transduced cells were sorted and differentiated into dendritic cells, 68.4% of cells maintained expression of the reporter gene. With these conditions established, we went on to construct retroviral vectors carrying the Bcr-Abl oncogene. 127 Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. Chapter IX: Bcr-Abl Vector Construction and Characterization Introduction Transduction of CD34* progenitors and subsequent differentiation of these ceils into dendritic cells, yield dendritic cell cultures positive for the transgene. With these conditions established, we next went on to construct retroviral vectors containing the Bcr-Abl oncogene and examined the ability of these vectors to transfer the gene into 293A cells. R esults In order to conduct studies on the cell vaccine potential of Bcr-Abl positive dendritic cells, the oncogene was cloned into a retroviral vector (Figure 1). A Bcr-Abl triple mutant was also cloned in the event that the wild type gene prevents differentiation of CD34’ cells to dendritic cells. The mutant has three mutations: one in the SHI dom ain of abl, one in the SH2 domain of abl, and one in the GRB2 dom ain of BCR (46). Murine bone marrow was not transformed when transduced with this triple mutant w hen compared to the wild type Bcr-Abl gene (46). Marker genes such as neo and eGFP were left out of the construct to eliminate their chance of eliciting an immune response. The neomycin m arker gene when present in retroviral vectors has been shown to result in NK - mediated lysis while eGFP has been shown to elicit CTLs in mice (131-132). 128 Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. To verify protein expression by the vectors, 293T cells were transiently transfected with the constructs and then total protein was isolated for Western Blot analysis (Figure 2). Subsequently these vectors were co-transfected with a plasmid containing die retroviral envelope GALV, and a plasmid containing retroviral packaging products into 293T cells. Following 24 hours incubation, supernatants containing packaged retroviral vector were harvested and used to transduce 293A cells twice on two subsequent days. After 48 hours of incubation, cells were harvested and total protein was isolated for Western Blot analysis as well as total NH2 COOH SH3 SH2 SHI Bcr Abl SH3 SH2 SHI COOH NH2 Bcr Abl MND MND MND MND Figure 1: Bcr-Abl Vector Constructs. Both genes were cloned into the retroviral vector MND (133-134). a) wild type Bcr-Abl b) triple m utant Bcr- Abl, amino add changes introduced are indicated. The tyrosine residue in the GRB2 domain of BCR and in the SHI domain of c-abl were m utated to phenylalanine residues. An arginine was mutated to a leucine residue in the SH2 domain of c-abl (46). Both genes were obtained from Dr. Owen Witte at UCLA. 129 Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. pl90 Bcr-Abl pl20 c-Abl Figure 2: Expression of Bcr-Abl Constructs by Western Blot A nalysis. 293T cells were transiently transfected with the MND vector constructs shown in Figure 1 using CaCl2 . Two days post transfection total protein was extracted from the cells, along with the BM185 cell line, which was used as a positive control. Samples were run under denaturing conditions and blotted with a c-abl clone 24-21. DNA for PCR of the retroviral vector (Figure 3). Using primers specific for the junction of BCR and abl in die oncogene, mock transduced cells were negative for the vector, while 293A cells transduced with the vector containing the mutant Bcr-Abl as well as the cells transduced with the wild type vector were positive for the oncogene (Figure 3A). Furthermore, the Bcr-Abl protein was detectable by Western Blot analysis (Figure 3B), demonstrating that the vectors were transferring the oncogene and expressing the protein. 130 Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. u. 4 > " O • a n < 2 a o 2 T3 £ cn (3 El < iL in ao c m 3 2 293A Transduced B 293 T Transfected 293 A Transduced 300bp Bcr-Abl Junction pl90 Bcr-Abl pl20 c-Abl pl90 Bcr-Abl pl20 c-Abl Figure 3. Transduction o f 293A C ells with Bcr-Abl Viral Supernatants. MND Bcr-Abl constructs were co-transfected into 293T cells with envelope and packaging plasmid and supernatant was used to transduce 293A cells. A) PCR of genomic DNA from 293A cells transduced with the vectors. Bcr-Abl plasmid, MND Bcr-Abl vector DNA; Mock, mock transduced 293A cells; BM185, BM185 cell line; Mutant, 293A cells transduced with the Bcr- Abl m utant construct; Wt, 293A cells transduced with the Bcr-Abl wild type construct. B) Western blot analysis of transfected 293T cells used for supernatant production and 293A cells transduced with this supernatant. BM185, BM185 cell line; Mock, mock transfected/transduced cells; eGFP #1 and #2, two samples transfected/transduced with the MNDeGFP reporter vector; Mutant #1 and #2, two samples transfected/transduced with the Bcr-Abl mutant construct; Wt #1 and #2, two samples transfected/transduced w ith the Bcr-Abl wild type construct. 131 Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. Discussion Expression of the Bcr-Abl oncogene in hematopoietic progenitors) is thought to be critical for the pathogenesis of both CML and Ph+ ALL. In the fusion oncogene, the BCR portion contributes an oligomerization domain, a serine-threonine kinase domain, a GRB2 binding site, a Dbl homology domain, and a PH domain (135). The abl gene contributes an SH3 domain which may regulate transformation, a SH2 domain which binds phosphotyrosine, a nuclear localization signal, an actin binding domain, a DNA binding dom ain, and a SHI domain which is the tyrosine kinase domain essential for transformation (135). The pl90 and p210 constructs differ in the am ount of BCR that exists in the fusion gene, the pl90 product lacking the Dbl and PH domains present in the p210 product. Normal cellular abl (c-abl) is primarily located in the nucleus, whereas Bcr- Abl is localized in the cytoplasm, and combined with its greater tyrosine kinase activity induces the formation of multimeric protein complexes that may affect cellular proliferation, adhesion, and apoptosis which eventually leads to transformation (136). The transforming potential of the gene has been well studied and it is dearly involved in the pathogenesis of its associated leukemias. For the p210 construct, transduction of m urine bone marrow with a retroviral vector encoding the oncogene leads to transformation, and injection of these cells into mice causes chronic leukemia in all recipients w ith symptoms evident by 21-31 days (135). It was possible to transfer this myeloproliferative disease in serial 132 Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. transplantation experiments, and in one case it was transferred to three generations of mice (135). Perhaps more striking, are studies done by Huettner and colleagues with a mouse transgenic for die p210 gene under an inducible promoter (137). Transgenic mice with the p210 gene under the control of a tetracycline responsive promoter were found to develop lethal leukemia upon withdrawal of tetracycline in their drinking water. These leukemia cells, which were arrested at a late stage of pro-B cell development, could be adoptively transferred into syngeneic non irradiated recipients. Remarkably, the authors were able to cure mice at an advanced stage of disease by re-administering tetracycline. This reversion was permanent in animals, but subsequent withdrawal of the antibiotic once again induced leukemia. These studies elegantly demonstrate that the leukemic phenotype in these animals was dependent on continuous expression of Bcr-Abl, and clearly demonstrates its ability to transform cells. The p i90 construct has been consistently associated with a more aggressive form of leukemia, which is distinct from CML. It is seen in some cases of pediatric ALL, and can arise in CML patients undergoing blast crisis. In vitro experiments have shown a greater transforming activity of the pl90 protein compared to the p210 protein, in both hematopoietic cells and fibroblasts. Hence the loss of BCR sequences leads to a more profound activation of the abl tyrosine kinase (138). 133 Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. Further substantiating the importance of Bcr-Abl in leukemic pathogenesis, is the efficacy of the Bcr-Abl tyrosine kinase inhibitor in a phase I clinical trial (139-140). The drug had significant antileukemic activity in patients with CML in die chronic phase in w hom treatment with IFNa had failed. Complete hematologic responses were observed in 53 of 54 patients treated with daily drug doses of 300 mg or more. Similarly, it was beneficial in CML patients in blast crisis and ALL patients with the Philadelphia chromosome. 21 of 38 patients with myeloid blast crisis had responses, and 14 of 20 patients with lymphoid blast crisis or ALL responded. Clearly the transforming potential of the oncogene has been established. Our construct was obtained from Witte and colleagues who demonstrated the gene to transform Balb/c bone marrow, from which our murine leukemia cell line is derived (34,46). The strategy utilized in these studies involves transducing hematopoietic progenitors with the oncogene and subsequently differentiating them into dendritic cells for die stimulation of an immune response. The differentiation process may, however, be inhibited by the oncogene. This was not the case, however, in several reports, which derived dendritic cells positive for Bcr-Abl from either peripheral blood or CD34 cells in CML patients (18,141-143). Similarly, dendritic cells could be generated from AML and ALL blasts (144-147). Yet the possibility exists that the presence of the oncogene may prevent differentiation. Therefore we also cloned a m utant version of the 134 Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. oncogene into our retroviral vector, which is non-transforming, in the event that the wild type oncogene prevents the differentiation of transduced CD34 hematopoietic progenitors into dendritic cells. Peptides derived from the p210 Bcr-Abl protein, which are able to generate immune responses in vitro, have been identified from studies done in both normal individuals, and in CML patients in remission. One of the earliest indicators that CML cells could induce cytotoxic T cell effectors came from in vitro studies using autologous leukemia cells as stimulators for PBMCs from five CML patients (148). Bocchia and colleagues later identified four peptides derived from the junctional region of the Bcr-Abl protein that could bind MHC Class I molecules HLA-A3, HLA-A11, HLA- B 8, and a peptide that could bind both HLA-A3 and HLA-A11 (9) (Table 1). Two peptides binding HLA-A3 and HLA-A3/All were able to induce peptide specific CTLs in vitro from HLA-matched normal peripheral blood donors (13). Yotnda et al. later demonstrated peptide specific CTLs for the A ll and B 8 restricted peptides (12). Greco and colleagues found that if they took the same A3 peptide and modified two anchor residues they increased the peptides capacity to prime peptide specific CTLs in vitro (10). Yotnda et al. identified yet another junctional peptide which was able to bind HLA-A2.1, the most frequent class I allele in the human population (12). Similarly, this peptide was able to prime peptide specific CTLs (Table 1). 135 Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. While the junctional region is thought to be immunogenic due to its absence in non-leukemic cells, evidence also exists for Bcr-Abl's role as a tumor associated antigen. Buzyn and colleagues identified 3 peptides outside the junctional region which primed peptide specific CTLs from normal HLA-matched donors (11) (Table 1). Additionally, one peptide was found to prime CTLs from the peripheral blood of a CML patient in remission. Hence normal peptides from the BCR and abl sequences should be considered as potential targets in a manner similar to other tumor associated antigens. Further support arises from studies looking at the naturally processed peptides bound by HLA Class I and II molecules in CML blasts (149). It was found that peptides from the BCR and abl portions of the protein had equal or greater affinity for MHC molecules than junctional peptides. They were unable to demonstrate junctional region-derived peptides o n the surface of these blasts. They did identify many other potential targets including a proteinase 3-derived peptide that bound on the surface of blast cells with high copy number. Other studies have shown that CTLs specific for proteinase 3 peptide were able to inhibit CML colony-forming units (150). Taken together, it can be conduded that Bcr-Abl may be acting as a tum or assotiated antigen in addition to its potential role as a tumor spedfic antigen. Of course the existence of other antigens in CML is likely, as was shown for proteinase 3. This is m ost certainly the case for ALL blasts as well. 136 Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. Table 1. MHC Class I Restricted Bcr-Abl2 1 0 Epitopes Peptide Residues Sequence HLA Restriction Peptide Responsive CTLs Reference BCR 693-701 TPRRQSMTV B 7 Yes 11 BCR 714-722 FMVELVEGA A2 Yes 11 BCR 817-825 KLSEQESLL A2 Yes 11 BCR 881-889 MLTNSCVKL A2 Yes li b3a2 Junction4 918-928 HSATGFKQSSK1 ’ A3/A11 Yes 9,13 b3a2 Junction4 920-928 ATGFKQSSK” A ll Yesc 9,13 b3a2 Junction4 922-930 g f k q s s k ' a l B8 Yesc 9,13 b3a2 Junction4 924-932 KQSSK'ALQR A3 Yes 9,13 b3a2 Junction4 926-934 SSKb ALQRPV A2 Yes 12 4 Junctional region of the p210 Bcr-Abl protein, in individuals with the b3a2 exon junction. b Bold and underlined residue indicates the novel amino acid introduced by the fusion. cPeptide responsive CTLs were not identified in Bocchia et al (11) where the peptide was first described, but found in a subsequent paper by Yotnda et al (12). In addition to the Class I associated peptides, Class II associated peptides have also been identified (Table 2). These include DR2, DR4, DR11, and DR1 restricted peptides (13-17). Similar to the class I peptides which were able to prime peptide specific CTLs, these peptides were all found to elicit functional responses as determined by their ability to prime proliferation of CD4 T lymphocytes. The ability of p210 Bcr-Abl derived peptides to prime immune responses raises the possibility that pl90 derived sequences may do so as well. While this question could be answered by the synthesis of synthetic peptides spanning the junctional region and their use in PBMC cultures, we took an alternate route using dendritic cells transduced with the gene for pl90 Bcr-Abl. This allows professional antigen presenting cells to naturally process and present potential epitopes present in the oncogene to T lymphocytes. To test this hypothesis, we subsequently used our retroviral Bcr-Abl constructs to transduce CD34 progenitors, differentiate them into dendritic cells, and use these cells to stimulate autologous T lymphocytes from normal donors. 138 Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. Reproduced w ith permission o f th e copyright owner. Further reproduction prohibited without permission Table 2. MHC Class II Restricted Bcr-Abl2 1 0 Epitopes Peptide Residues Sequence HLA Restriction Peptide Responsive CD 4 Proliferation Reference b2a2 Junction* 920-936 IPLTINKEIb ALQRPVAS DR2 Yes 17 b3a2 Junction1 916-935 I v h s a t g f k q s s k ' a l q r p v a s d f e p D Rll Yes 13 b3a2 Junction0 920-936 a t g f k q s s jC a l q r p v a s DR4 Yes 15 b3a2 Junction0 922-932 GFKQSSK’ALQR DR1 Yes 16 functional region of the p210 Bcr-Abl protein, in individuals with the b2a2 exon junction. b Bold and underlined residue indicates the junctional amino acid introduced by the fusion. ^Junctional region of the p210 Bcr-Abl protein, in individuals with the b3a2 exon junction. u > V O Chapter X: Bcr-Abl Specific Immune Responses Introduction While the goal of these studies is to generate anti-Bcr-Abl immune responses in patients with Ph+ ALL, we initially examined the ability to stimulate responses in non-leukemic samples to determine the feasibility of this approach. Bcr-Abl retroviral vectors, as described in the previous chapter, were used to transduce CD34* progenitors, and they were subsequently differentiated into dendritic cells. These dendritic cell cultures were irradiated and used as stimulators for autologous T lymphocytes. After one week of culture, proliferation was measured as an indicator of an immune response. Results To determine if Bcr-Abl transduced dendritic cells can elicit autologous immune responses in normal individuals, a series of 11 samples from individuals without leukemia were examined. 10 of these samples were derived from umbilical cord blood (Samples A thru J) and one was obtained from bone marrow (Sample K). CD34 hematopoietic progenitor cells as well as CD3 positive T lymphocytes were isolated from these samples. CD34 progenitor cells were either mock transduced, transduced with the Bcr-Abl mutant vector, or transduced with the Bcr-Abl wild type Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. vector as described in Chapter VIII, and subsequently differentiated into dendritic cells. Autologous T lymphocytes were frozen in hum an AB serum for the duration of differentiation. The percentage of dendritic cells in the cultures differed between samples, however they did not differ significantly within each cohort indicating the presence of the Bcr-Abl wild type vector did not prevent differentiation (Table 1). Dendritic cell cultures were subsequently analyzed for Bcr-Abl by PCR and Western blot analysis (Table 2). 8 /9 samples analyzed for the mutant Bcr-Abl vector were positive by PCR whereas only 4 /9 samples analyzed for the wild type Bcr- Abl vector w ere positive by PCR. These same dendritic cell cultures were used as stimulators in an autologous mixed lymphocyte reaction (Table 2, Figures 1-2). Three out of 11 samples had enhanced proliferation in the presence of Bcr-Abl transduced dendritic cells compared to mock transduced cells and T cell proliferation alone. In one sample, this enhanced proliferation was seen throughout three rounds of stimulation in the absence of exogenous IL-2 (Figure 2). To determine if enhanced proliferation could be blocked by presence of antibodies to either MHC Class I or MHC Class II, autologous mixed lymphocyte cultures were done on an additional 6 samples (Samples L thru Q) in the following conditions: in the presence of antibodies to MHC Class I, in the presence of antibodies to MHC Class II, in the presence of antibodies to both MHC Class I and Class II, and in the absence of either 141 Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. Reproduced with permission o f th e copyright owner. Further reproduction prohibited without permission. Table 1. Dendritic Cell Phenotype of Bcr-Abl Transduced Cultures Sample A Sample B Sample C Mock Mutant Wild Type Mock Mutant Wild Type Mock Mutant Wild Type % DC* 35.6 37.7 31.7 36.1 36.7 38 55 42.4 57.4 Sample D Sample E Sample F Mock Mutant Wild Type Mock Mutant Wild Type Mock Mutant Wild Type % DC* 46.1 59.5 68.9 19.4 21.1 21.1 43.9 44.1 42.6 Sample G Sample H Sample I Mock Mutant Wild Type Mock Mutant Wild Type Mock Mutant Wild Type % DC' 12.7 2.7 10.6 15.7 12.6 15 26.7 3.2 38.4 Sample J Sample K Mock Mutant Wild Type Mock Mutant Wild Type %DC* 43.6 6 26.7 13.6 18.9 18.4 'Percentage of culture with dendritic cell phenotype as described in Chapter VIII (Lin, DR*, and CD86*) Reproduced with permission o f th e copyright owner. Further reproduction prohibited without permission. Table 2. Autologous Mixed Lymphocyte Culture Responses Sample A Sample B Sample C M ock1 1 Mutant' W ild TypS M ock? Mutant' W ild TypS M ock* Mutant' W ild Typt? +PC R * - +++ ++ - + + + . . - + + +Westemb - + - - - - - -- - +M LR‘ — — — " " — " -- Sample D Sample E Sample F M ock? Mutantr W ild T yp e* M ock* M utant? W ild T yp e* M ock* Mutanf W ild Type * +PCR* — + + ND* ND* ND" ND* ND" ND" ♦Western1 1 - - - ND* ND* ND" ND* ND* ND" +MLR‘ " + + " - -- - " — Sample G Sample H Sample 1 M ock* Mutanf W ild TypiJ M ock* Mutant' W ild T yp e? M ock* Mutant' W ild TypS +PCR* ~ +++ ~ - + + + - - +++ - +Westemb - + - — - - ND* - - +MLR‘ -- + — — + -- — — — Sample J Sample K M ock* Mutant' W ild T yp e* M ock? Mutant' W ild TypS +PCR* - +++ — — + + +Westemb - - - - ND * - +MLR‘ - - - - - - "Dendritic cell cultures positive for the Bcr-Abl gene by PCR; ^Dendritic cell cultures positive for Bcr-Abl protein by Western 'Enhanced proliferation of autologous T cells co-cultured with dendritic cells d mock transduced cultures; "Bcr-Abl triple mutant transduced cultures; 'Bcr-Abl wild type transduced cultures *not determined 1 ■ ■ ■ ■ I T Mo n a M ock O C a M u t an t OCa W t D C a Figure 1. Autologous Mixed Lymphocyte Responses to Bcr-Abl Positive Dendritic Cells. Dendritic cells were co-cultured for one week with autologous T lymphocytes. A) Sample D, both mutant and wild type DCs were positive for Bcr-Abl by PCR. B) Sample H, mutant DCs were positive for Bcr-Abl by PCR while wild type DCs were negative for Bcr-Abl by PCR. Sample D was cultured in the presence of exogenous IL-2 while sample H was cultured in the absence of exogenous IL-2. 144 Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. ♦ 0 0 0 » T alone G-1st Stim G-2nd Slim G-3rd Stim Figure 2. Enhanced Proliferation in Response to Bcr-Abl Positive Dendritic Cell Stimulators upon Repeat Stimulations. Dendritic cells were co-culhired with autologous T lymphocytes at a stim ulator to responder ratio of 1:1 in the absence of IL-2. Cells were stimulated for one week, and then half the cultures were assayed for thymidine incorporation while the other half were restimulated with additional dendritic cells. This cycle was repeated once more for a total of three stimulations. antibodies. This was done for autologous T cells co-cultured with all three dendritic cell cohorts (mock transduced, Bcr-Abl mutant transduced, and Bcr-Abl wild type transduced). Of the 6 samples, 4 of the m utant 145 Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. transduced cohorts were positive for the Bcr-Abl mutant gene, but none were positive for the wild type construct (data not shown). Unfortunately, all 4 of these positive cord blood samples were non-responsive to the Bcr- Abl mutant gene and hence the ability of MHC antibodies to inhibit proliferation could not be determined (data not shown). D iscussion Transduction of CD34 progenitors with the m utant Bcr-Abl construct and their subsequent differentiation into dendritic cells yielded 12/13 cultures to be positive for the gene. In the Bcr-Abl wild type cohort, however, only 4/13 samples were positive for the construct despite the ability of these same supernatants to transduce 293A cells as efficiently as the mutant construct (data not shown). It may be that progenitors transduced with the wild type construct have an increased rate of cell death, yielding fewer positive cultures. Analysis of Bcr-Abl transduction was done on bulk cultures (cells with the dendritic cell phenotype and cells without). Hence it is unlikely that the presence of the oncogene transformed some progenitors and prevented their differentiation into dendritic cells, as in this scenario the cultures would still be positive for Bcr-Abl by PCR. It seems more likely that the wild type oncogene was toxic and caused significant cell death of the transduced cells leading to fewer cultures with this gene present. 146 Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. Three of thirteen Bcr-Abl positive samples demonstrated enhanced proliferation of T cells in the presence of irradiated dendritic cell cultures expressing the oncogene. In sample D, both m utant and wild type cohorts were positive for the Bcr-Abl gene, and both enhanced proliferation of T cells compared to mock transduced cells after one week of co-culture (Figure 1), indicating that the m utant gene was equally effective at inducing an immune response as the wild type gene. Samples G and H were both positive for the mutant construct and negative for the wild type construct, and accordingly, the enhanced proliferation was only seen in the m utant cohorts (Figures 1 and 2). Thus the dendritic cell cultures expressing the mutant oncogene were able to elicit anti-Bcr-Abl imm une responses in normal individuals, encouraging further experiments to determine if this response can also be seen in leukemia patients in remission. The potency of dendritic cells has been well documented. In a murine system looking at immune responses to the antigen human a,- antitrypsin, it was found that a single injection of 500-1000 transfected dendritic cells was able to produce an immune response comparable to genetic immunization in the skin of mice by a biolistic gene gun (151). This small amount of dendritic cells was more potent than fibroblasts transfected with the antigen, despite the 50-fold greater transfection efficiency of fibroblasts. The dendritic cells were able to initiate both humoral and cellular immune responses demonstrating their potency. This 147 Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. report is one among many, which dearly shows die advantages of utilizing dendritic cells in eliciting an immune response. The examples of dendritic based elidtation of antitumor immune responses are numerous and encompass a variety of approaches. Among these approaches indude pulsing with whole tumor lysates, proteins, peptides, tumor RNA, and transducing dendritic cells with tumor antigens. All can elirit antitumor immune responses. Some of the first studies looked at peptide pulsed dendritic cells. One of the initial reports used bone marrow-generated dendritic cells pulsed with a MHC class I-restricted peptide, ovalbumin (OVA), to evaluate the ability of peptide pulsed dendritic cells to initiate antitumor responses (152). A plasmid encoding the ovalbumin protein was transfected into the m urine T cell lymphoma EL4. When mice were given intravenous injection of bone marrow derived dendritic cells pulsed with the OVA peptide, they were found to have generated OVA specific cytotoxic T lymphocyte responses. These findings were supplemented with later studies demonstrating that mice given subcutaneous vaccination w ith OVA pulsed dendritic cells were able to induce antigen-specific CTL- mediated protection against a lethal challenge of OVA expressing tumor cells (153-154). Similar results have been seen with other peptide antigens including MUT1, (HPV-16)E7, HER-2/neu, and WT1 (154-156). These studies require the presence of a defined peptide antigen. To circumvent this requirement, others have used unfractionated add-eluted 148 Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. peptides from tumors. This approach has been effective in the murine models MCA205 (fibrosarcoma), TS/A (mammary adenocarcinoma), and C3 (HPV+ fibroblasts) as well as in the in vitro study that generated antileukemic T cell clones using dendritic cells pulsed with peptides eluted from AML blasts (157-158). Peptide pulsing experiments were later followed by other variations including soluble protein pulsing (159-160), and whole tumor lysate pulsing (161-163). Whole tumor lysate pulsing has the advantage in that a defined tumor antigen need not be known, and that multiple tumor- associated antigens in the form of both helper and CTL-defined epitopes can be presented to the immune system. A disadvantage, however, is the induction of an immune response that cross-reacts with self in response to dendritic cell processing of non-tumor specific antigens. This delicate balance between antitum or responses and autoimmunity was elegantly shown in experiments using dendritic cells pulsed with peptide for a tumor antigen that was also present in pancreatic P islet cells, the insulin producing cells of the body (164). In mice immunized with these peptide pulsed dendritic cells, growing tumors were controlled or prevented, but this was accompanied by fatal autoimmune diabetes in all mice. While pulsing dendritic cells with peptide and protein can allow antigen presentation by dendritic cells, this can also be accomplished by pulsing dendritic cells with either total cellular RNA or mRNA specific for a tumor antigen (23). This was initially demonstrated with the OVA 149 Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. antigen in a murine melanoma model. When in vitro CTLs were assessed, dendritic cell stimulators previously pulsed with OVA mRNA elicited greater lysis than OVA peptide. Total RNA from an OVA positive tumor and mRNA from an OVA positive tumor had the same level of CTLs as OVA peptide pulsed dendritic cells. The study went on to use RNA pulsed dendritic cells to immunize mice prior to tumor challenge and found that the immunization decreased tum or size and even prevented tumors in some mice. OVA mRNA was more efficacious than plain irradiated tumor cells, but total RNA and total mRNA provided the same level of protection as irradiated, unmodified tumor cells. Unfortunately, the authors did not compare dendritic cells pulsed with OVA peptide in the immunization and tumor challenge experiments. Although there was a clear benefit from the vaccinations, the relatively poor performance of total RNA and total mRNA indicates that this may not prove to be the best method. In general, irradiated nonmodified tumor cells are not sufficient in the majority of murine models to protect mice against tumor challenge or an existing tumor burden, indicating that RNA pulsed dendritic cells may not be potent enough. Further experiments by this group compared the efficacy of dendritic cells pulsed with whole tumor lysate, dendritic cells pulsed with tumor mRNA, and GM-CSF expressing irradiated tum or cells, as vaccinations prior to tumor challenge in the B16 melanoma model. The authors found all three methods effective with no statistical differences between the number of long term survivors, although tum or pulsed 150 Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. vaccinations yielded 61% long term survivors compared to 40% in the RNA pulsed vaccinations, and 33% in the GM-CSF expressing tumor cells (165). The number of mice per cohort, however, was small and it may be that further analysis of greater numbers of mice would define a hierarchy of these vaccination methods. It is interesting to note that in the more stringent experiment in which animals were challenged and subsequently vaccinated, they only presented results with tum or lysate pulsed dendritic cells and not RNA pulsed dendritic cell or GM-CSF expressing tumor cell vaccines. This may indicate that the later two methods were not protective, although this is purely speculation. An interesting alternative to the pulsing of dendritic cells is the fusion of dendritic cells with tumor cells to allow efficient presentation of a wide array of tumor antigens (166). The tum or/D C fusion hybrids were able to process and present tumor associated antigens and elicit tumor reactive cytotoxic T lymphocytes in a murine melanoma model and a murine T cell lymphoma model. The vaccinations induced partial protective immunity against subsequent tumor challenge, and additionally, were able to prime T cells in vitro for adoptive immunotherapy. The transfer of these ex vivo expanded vaccine primed T cells reduced the number of metastases in the melanoma model and eradicated a disseminated leukemia cell line in mice. Similar efficacy was seen in an adenocarcinoma model and the antitumor effect was found to be mediated by both CD4 and CD8 T lymphocytes (167). 151 Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. Although limited in its application, yet another strategy involves the differentiation of cancer cells into dendritic cells by in vitro culturing with a dendritic cell inducing cytokine cocktail (147). In this study, acute myelomonocytic leukemia cells from 19 patients were tested for their ability to acquire dendritic cell like characteristics in the presence of GM-CSF, IL-4, and either TNFa or CD40L. In all but one case, AML cells acquired the morphology, phenotypic characteristics, and T-cell stimulatory properties of dendritic cells. Autologous lymphocytes co-cultured w ith these AML derived dendritic cells were able to lyse autologous leukemia cells in vitro, but there was little cytotoxicity against autologous normal cells. A similar approach was taken by Cignetti and colleagues who differentiated CD34+ AML and ALL blasts with the use of cytokines and these cells induced better allogeneic T-cell responses than parental leukemic blasts (146). This group, however, did not look at the ability of these cells to prime autologous leukemia specific CTLs or CD4 proliferation. While this unique approach is effective in these two reports, it is limited to carcinomas that retain the ability to differentiate into dendritic cells, and as such, most likely limit it to carcinomas of hematopoetic origin. The most recent method of modifying dendritic cells with tumor antigens involves their transduction with the relevant tum or antigen gene. In P-galactosidase expressing colon carcinoma murine models, both adenoviral and retroviral vectors have been used to deliver the gene for fi- galactosidase to bone marrow derived dendritic cells (168-169). In both 152 Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. reports with either vector, gene transduced dendritic cells could be used to treat mice w ith established pulmonary metastases to decrease the num ber of lesions w hen compared to untreated mice. Similarly both human dendritic cells and murine bone marrow derived dendritic cells when transduced w ith the MART-1 antigen could elicit in vitro specific autologous CTLs and mediate murine MART-1 positive fibrosarcoma protection respectively (170-171). An alternative to in vitro transduction of dendritic cells, is the in vivo transfection of dendritic cells using cutaneous genetic immunization (172). This report demonstrated that cutaneous genetic immunization resulted in transfection of skin derived dendritic cells, which w ere able to induce antigen specific protection against OVA expressing B16 melanoma when immunizations were given prior to challenge. Few reports directly compare the different modes of modifying dendritic cells to present tumor antigen. In one report, Osterroth et al compare the efficacy of protein pulsing monocyte derived dendritic cells with idiotype protein to transducing them, in the ability to elicit idiotype specific CTL responses from the peripheral blood of lymphoma patients in clinical remission (173). They found that CTLs stimulated with idiotype- loaded dendritic cells had specific CD8-mediated, Class I restricted cytotoxicity against autologous heavy and light chain idiotype. In contrast, transduced dendritic cells resulted in little CTL mediated toxicity and only moderate NK cell activity. The experimental design, however, was less 153 Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. than optimal as transduced dendritic cells were transduced with either the light chain or heavy chain from the idiotype whereas protein pulsed dendritic cells received the entire idiotype protein in its native protein folded structure. Hence processed protein in the pulsed dendritic cells could potentially yield m ultiple epitopes for the generation of immune responses whereas the transduced dendritic cells were limited to either chain. The importance of multiple epitope presentation has been clearly shown in murine experiments looking at dendritic cells transduced with the OVA antigen (174-175). De Veerman et al. found that dendritic cells transduced with the entire native OVA cDNA presented both class I and class II restricted epitopes, induced antigen specific CTL responses, and rejection of OVA expressing tumor cells. When transduced with a cytosolic form of OVA, however, only class I epitopes were presented which failed to elicit CTL responses or protective immunity in vivo. This underscores the importance of simultaneous delivery of T cell help in the context of class II epitopes. In contrast, T cell help could perhaps be administered by the systemic administration of stimulatory anti-CD40 antibodies, although the authors did not test this. The second report, however did look at this possibility. In similar experiments, dendritic cells transduced with the cDNA for OVA and were found to be more potent than dendritic cells pulsed with the class I restricted peptide SHNFEKL in eliciting antitumor immune responses to OVA expressing melanoma, due to their 154 Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. simultaneous presentation of both class I and class II epitopes (174). Class II negative dendritic cells transduced with the gene, however, were no longer effective in establishing protective antitumor immunity, and the same result was seen in CD4 deficient mice underscoring the importance of CD4 T cell help. If class II negative transduced dendritic cells were treated with stimulatory anti-CD40 antibody, however, a moderate increase in OVA-specific CTL activity was observed, but this was not sufficient to protect against tumor challenge. Whether or not systemic anti-CD40 administration would provide greater help was not evaluated. In summary, the authors conclude that dendritic cells transduced with genes encoding class I and class II epitopes are potent, yet caution against the use of dendritic cells which present only class I epitopes. The different modes of dendritic cell modification and their advantages and limitations are listed in Table 3. Each method has its ow n unique advantage and the method used for a particular cancer should be determined based on properties of the cancer. For example, if the tum or antigens are unknown, then pulsing dendritic cells with tumor lysates or tumor mRNA are two methods that can be utilized. If a particular tum or antigen is being targeted, then transduction of dendritic cells with the relevant gene, or pulsing them with a cocktail of peptides are two applicable methods. In our system, we wished to utilize dendritic cell transduction with a tumor specific gene, in order to minimize the likelihood of presenting potentially autoreactive antigens. The relevant epitopes, 155 Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. however, are unknown for the pl90 Bcr-Abl protein. For these reasons we chose transduction of dendritic cells with the pl90 Bcr-Abl oncogene. While the wild type Bcr-Abl gene seemed to cause toxicity to CD34 hematopoietic progenitors, the mutant gene was well tolerated and able to initiate proliferation of autologous T cells when expressed by dendritic cell cultures. The ability of Bcr-Abl transduced dendritic cells to induce increased proliferation in autologous T cells in 3/13 samples is encouraging and warrants further investigation. 156 Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. Reproduced with permission o f th e copyright owner. Further reproduction prohibited without permission. Table 3. Comparison of Dendritic Cell Based Vaccines DC Modification Method Advantages Limitations Peptide pulsed (single or combination) RNA pulsed Tumor lysate pulsed and DC/Tumor fusion Transduction Peptide restricted response decreases incidence of autoreactive immune responses Ease of DC modification by simple co cultivation with synthetic peptides • Can prime against unknown tumor antigens • Knowledge of patient's HLA type not required • Presentation of multiple epitopes • Tumor RNA can be amplified from a small number of tumor cells • RNA subtractive hybridization technique from normal cells can decrease potentially autoreactive antigens « Can prime against unknown tumor antigens • Knowledge of patient's HLA type not required • Presentation of multiple epitopes • Can prime against unknown tumor antigens • Knowledge of patient's HLA type not required • Presentation of multiple epitopes • Knowledge of patient's HLA type • Knowledge of relevant tumor antigen • Transient antigen presentation due to variation in peptide binding affinity, peptide-MHC complex dissociation and MHC turnover • RNA difficult to work with due to rapid degradation Broad array of tumor-derived epitopes increases the likelihood of potentially autoreactive antigens Transduction efficiencies of vector used iy i - J Chapter XI: Conclusions and Future Directions Bcr-Abl transduced dendritic cell cultures were found to enhance proliferation, compared to mock transduced dendritic cells, in three of thirteen Bcr-Abl positive umbilical cord blood samples. This is suggestive of Bcr-Abl's ability to initiate antileukemic immune responses. Clearly the proliferation is an indirect indicator of the gene's immimogenidty, yet the data does warrant further investigation. Specifically, larger numbers of cord blood samples should be processed to determine their ability to respond to this construct and the ability of MHC Class I and II antibodies to inhibit this response. These experiments should also be repeated in samples from leukemia patients in remission, to determine if they too are able to respond to the oncogene. Ideally, any T cell proliferation in patient samples would be tested for the ability to lyse autologous Philadelphia chromosome positive ALL blasts. Unfortunately, in our hands, we were unable to label primary leukemia blasts with chromium for cytotoxic T lymphocyte assays due to their high rate of cell death and poor chromium uptake (data not shown). However, indirect assays of cytotoxic T cell effector function can be developed for this system, such as the ELISPOT assay which measures the frequency of T cell secreting cytokines in a culture stimulated with antigen. Additionally, it will be critical to compare T cell responses in vitro to different leukemia stimulators. Specifically gene 158 Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. modified leukemia cells, gene modified dendritic cells, and tumor lysate pulsed dendritic cells should all be compared in order to determine the optimal method to bring to a clinical trial. As the epitopes are unknown for the pl90 Bcr-Abl protein, another avenue to explore is which peptides derived from this gene, are able to bind to MHC molecules and initiate the response. To do this, in samples where the transduced dendritic cells stimulate T cell proliferation, libraries of peptides can be added to the proliferating T cells in the presence of autologous peripheral blood mononuclear cells. Then cultures can be monitored for the continued proliferation or loss of proliferation in the presence of a given library of peptides. Initially multiple peptide fragments can be added to a well, and as wells are identified that demonstrate proliferation in response to the peptides, the potential peptide candidates can be separated into smaller libraries and the process repeated until single peptides are identified. Once sequences in the pl90 protein are identified which can prime an immune response, the ability of the T cells to lyse targets presenting these peptides can be tested by pulsing chromium labeled target cells with the peptide prior to incubation with the effector T cells. The ability of Bcr-Abl positive dendritic cells to prime T cell responses can be translated into a clinical trial whereby bone m arrow derived dendritic cells from a patient are transduced with the Bcr-Abl oncogene and then returned, irradiated, during first remission to the 159 Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. patient after their immune system has recovered from chemotherapy. Three limitations to this scenario are as follows: Low dendritic cell yields due to low numbers of CD34 progenitors present in patients after chemotherapy; Low numbers of dendritic cells expressing the oncogene due to low transduction levels; and low immunity of the Bcr-Abl oncogene. A possible solution is to increase the dendritic cells ability to induce an immune response so that even a small num ber of dendritic cells carrying the oncogene have therapeutic benefit. Soluble CD40L (sCD40L) and soluble RankL (sRankL), when present in cultures have been shown to render dendritic cells more potent in stimulating T cells in mixed lymphocyte reactions (MLRs) and cytotoxic T lymphocyte responses (CTLs) (176). Transduction of dendritic cells with RankL or CD40L m ay enhance their ability to stimulate allogeneic immune responses and CTLs similar to co-cultivation with the soluble forms. If this is found to be true, co transduction of the genes along with the Bcr-Abl oncogene m ay overcome the above limitations. Indeed a study found that dendritic cells expressing CD40L were more potent in inhibiting tumor growth in CT26-bearing Balb/c mice than dendritic cells transduced with a null vector (177). The dendritic cells were not, however, engineered to express tumor antigens as well, but instead were administered directly to the subcutaneous tumors. This is clearly effective in the case of non-metastatic solid tumors, which allow for the locally administered dendritic cells to phagocytose tumor cells and cross 160 Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. present their antigens. In a setting of leukemia, however, where the tumor is not localized and contained, it may provide more benefit if the dendritic cell was engineered to express both the tumor antigen and the immunomodulator. This would bypass the requirement for effective antigen uptake by the dendritic cell in vivo. CD40L and RankL are both small genes, with cDNA sizes of only 1 kb. Hence it would be possible to construct retroviral vectors expressing both the Bcr-Abl gene and the immunomodulator by the insertion of an internal ribosome entry site between the two genes. CD40L expression w ould also provide a convenient marker to monitor transduction of dendritic cells, rather then Western blot analysis for the Bcr-Abl protein. Along with CD40L, dendritic cells have been successfully engineered to express many other genes, including IL-2, IL-7, and IL-12, all of which have proven to induce potent antitumor immunity (178-180). Dendritic cells gene modified to express cytokines can represent a more potent vaccine as they are continually secreting the cytokine, similar to an activated dendritic cell. Dendritic cells constitutively expressing IL-12 were found to induce a profound antitumor response (180). The amount of tumor growth inhibition correlated with the am ount of IL-12 produced, yet this correlation was not solely dependent the m ere presence of high levels of IL-12, as fibroblasts expressing IL-12 had little effect on tumor growth. Similarly, immunization of naive mice with IL-12 gene-modified dendritic cells pulsed with Leishmania antigens provided greater protection than 161 Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. unmodified dendritic cells pulsed with antigen (181). Hence dendritic cells can be gene-modified to render them even more potent in their ability to prim e immune responses. In conclusion, there is great potential for the ability of dendritic cells to be utilized in the design of antileukemic vaccines specifically targeted for Philadelphia chromosome positive ALL. The mutant Bcr-Abl construct, and its inability to transform cells, allows for the safe administration of the oncogene to cells in order to present antigenic epitopes, and their subsequent use in vaccination protocols. 162 Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. Bibliography 1815. S. Ahuja et al., J. Immunol. 163,3890 (1999). 130 A . Aicher et al., Exp. Hematol. 25,39 (1997). 57. M. L. Albert, B. Sauter, N. Bhardwaj, Nature 392,86 (1998). 176.D. M. Anderson et al., Nature 390,175 (1997). 40. L.D. Anderson, C. A. Savary, C. A. Mullen, Blood 95,2426 (2000). 67. R. J. Armitage et al., Eur. f. Immunol. 23,2326 (1993). 126.J. F. Arthur et al, Cancer Gene Ther. 4,17 (1997). 87. A. L. Asher et al., }. Immunol. 146,3227 (1991). 165.D. M. Ashley et al., J. Exp. Med. 186,1177 (1997). 98. E. Assarsson et al., /. Immunol. 165,3673 (2000). 36. J. Banchereau et al., Annu. Rev. Immunol. 12,881 (1994). 129.C. Bello-Femandez et al., Hum. Gene Ther. 8,1651 (1997). 39. M. Bendandi et al., Nature Med. 5,1171 (1999). 55. S. R. M. Bennett et al., Nature 393,478 (1998). 66. R. Bianchi et al., /. Immunol. 163,2517 (1999). 116.P. Bjork, Clin. Immunol. 92,119 (1999). 119.P. Bjork, P.W. Kincade, /. Immunol. 161,5795 (1998). 50. M. Blaese et al., Cancer Gene Ther. 2,291 (1995). 13. M. Bocchia et al., Blood 87,3587 (19%). 9. M. Bocchia et al., Blood 85,2680 (1995). 163 Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. 23. D. Boczkowski, S. K. Nair, D. Snyder, E. Gilboa, /. Exp. Med. 184,465 (1996). 6. T. Boon, J. C. Cerottini, B. Van den Eynde, P. van der Bruggen, A. Van Pel, Annu. Rev. Immunol. 12,337 (1994). 41.1 . Borrello et al., Blood 95,3011 (2000). 155.P. Bossart et al.. Blood 96,3102 (2000). 29. S. E. Braun et al., Hum. Gene Tim. 10,2141 (1999). 52. M. Brenner, Blood 94,3965 (1999). 93. M. J. Brunda et al., J. Exp. Med. 178,1223 (1993). 11. A. Buzyn et al., Eur. J. Immunol. 27,2066 (1997). 42. A. A. Cardoso et al., Blood 90,549 (1997). 48. S. S. Case et al., Proc. Natl. Acad. Sci. U.S.A. 96,2988 (1999). 118.C. Caux et al., J. Exp. Med. 184,695 (19%). 94. F. Cavallo et al.,}. Natl. Cancer Inst. 89,1049 (1997). 153.C. M. Celluzzi, J. I. Mayordomo, W. J. Storkus, M. T. Lotze, L. D. Falo, J. Exp. Med. 183,283 (19%). 162.N. G. Chakraborty et al.. Cancer Immunol. Immunother. 47,58 (1998). 82. A. I. Chapoval, J. A. Fuller, S. G. Kremlev, S. J. Kamdar, R. Evans, /. Immunol. 161,6977 (1998). 18. A. Choudhury et al., Blood 89,1133 (1997). 147.A. Choudhury et al., Blood 93,780 (1999). 144.A. Choudhury et al., Crit. Rev. Immunol. 18,121 (1998). 146.A. Cignetti et al., Blood 94,2048 (1999). 172.C. Codon, S. C. Watkins, C. M. Celluzzi, K. Thompson, L. D. Falo, Nature Med. 2,1122 (19%). 164 Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. 25. C. Codon, S. C. Watkins, C. M. Celluzzi, K. Thompson, L. D. Falo, Nature Med. 2,1122 (1996). 59. B. Couderc et al, Cancer Gene Ther. 5,163 (1998). 95. J. Cui et al., Science 278,1623 (1997). 115.M. A. Dao, K. Hashino, J. A. Nolta, Blood 92,4612 (1998). 175.M. De Veerman et al, J. Immunol. 162,144 (1999). 62. L. A. Diehl et al, Nature Med. 5,774 (1999). 127.A. B. Dietz, S. Vuk-Pavlovic, Blood 91,392 (1998). 49. D. Dilloo et al, Blood 90,1927 (1997). 110.D. Dilloo et al, Blood 89,119 (1997). 32. G. Dranoff et al, Proc. Natl Acad. Sci. U.S.A. 90,3539 (1993). 139.B. J. Druker et al, N. E ngl}. Med. 344,1038 (2001). 140.B. J. Druker et al, N. Engl J. Med. 344,1031 (2001). 28. K. Dunussi-Joannopoulos et al, Blood 91,222 (1998). 91. K. Dunussi-Joannopoulos et al., Blood 94,4263 (1999). 26. K. Dunussi-Joannopoulos et al., Blood 87,2938 (19%). 105.A. E. J. Duyn et al, Annu. Hematol. 78,163 (1999). 143.B. Eibl et al, Genes Chromosomes Cancer 20,215 (1997). 21. J. H. F. Falkenburg et al, Blood 94,1201 (1999). 84. E. R. Fearon et al., Cell 60,3539 (1990). 161.R. C. Fields, K. Shimizu, J. J. Mule, Proc. Natl. Mad. Sci. U.S.A. 95, 9482 (1998). 61. R. R. French, H. T. C. Chan, A. L. Tutt, M. J. Glennie, Nature Med. 5, 548 (1999). 165 Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. 1115. Fujii, H. Hamada, K. Fujimoto, T. Shimomura, M. Kawakita, Blood 93,4328 (1999). 120.A. Galy, M. Travis, D. Cen, B. Chen, Immunity 3,459 (1995). 85. B. Gansbachar et al., Cancer Res. 50,7820 (1990). 46. A. Goga, J. Mdaughlin, D. E. H. Afar, D. C. Saffran, O. N. Witte, Cell 182,981 (1995). 167.J. Gong, D. Chen, M. Kashiwaba, D. Kufe, Nature Med. 3,558 (1997). 10. G. Greco et al., Leukemia 10,693 (19%). 38. M. E. Grossman, M. P. Brown, M. K. Brenner, Hum. Gene Ther. 8,1935 (1997). 77. T. Guillaume, D. B. Rubinstein, M. Symann, Blood 92,1471 (1998). 178.Y. Gunji et al., Mol. Ther. 1, S269 (2000). 92. H. L. Hanson et al., Immunity 13,265 (2000). 145.B. D. Harrison, J. A. Adams, M. Briggs, M. L. Brereton, J. A. Liu Yin, Blood 97,2764 (2001). 114.D. N. J. Hart, Blood 90,3245 (1997). %. W. Hashimoto et al., J. Immunol. 154,4333 (1995). 141.M. Heinzinger, C. F. Waller, A. von den Berg, A. Rosenstiel, W. Lange, Blood 78,181 (1999). 90. H. E. Heslop, Bailliere’ s Clin. Haematol. 7,135 (1994). 68. S. Hess, H. Engelmann, f. Exp. Med. 183,159 (19%). 71. A. Hirano et al., Blood 93,2999 (1999). 86. H. Hock, M. Dorsch, T. Diamantstein, T. Blankenstein, /. Exp. Med. 174,1291 (1991). 160.F. J. H su et al., Nature Med. 2,52 (19%). 166 Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. 137.C. S. Huettner, P. Zhang, R. A. Van Etten, D. G. Tenen, Nature Genet. 24,57 (2000). 5. C. A. Janeway, P. Travers, Immunobiology: The Immune System in Health and Disease, (Garland Publishing Inc, New York, ed. 3,1997), p. 2:46. [third edition]. 79. J. G. Jurric, D. A. Scheinberg, A. N. Houghton, in Cancer Chemotherapy and Biological Response Modifiers, H. M. Pinedo, D. L. Longo, B. A. Chabner, Eds. (Elsevier, New York, annual 15,1994), pp. 152-175. 74. K. Kato, M. J. Cantwell, S. Sharma, T. J. Kipps, /. Clin. Invest. 101, 1133(1998). 182.J. H. Kersey, Blood 90,4243 (1997). 45. T. Kikuchi, R. G. Crystal, Hum. Gene Ther. 10,1375 (1999). 177.T. Kikuchi, M. A. S. Moore, R. G. Crystal, Blood 96,91 (2000). 80. A. Klausner, Biotechniques 4,185 (19%). 112.C. Klein, H. Bueler, R. C. Mulligan, J. Exp. Med. 191,1699 (2000). 43. W. J. Krall et al., Gene Ther. 3,37 (19%). 131 .C. Liberatore et al.,}. Exp. Med. 189,1855 (1999). 164.B. Ludewig et al., J . Exp. Med. 191,795 (2000). 138.T. G. Lugo, A. M. Pendergast, A. J. Muller, O. N. Witte, Science 247, 1079 (1990). 65. M. F. Mackey et al.,}. Immunol. 161,2094 (1998). 64. M. F. Mackey et al., Cancer Res. 57,2569 (1997). 123.R. Maldonado-Lopez et al., f. Exp. Med. 189,587 (1999). 16. S. I. Mannering, J. L. McKenzie, D. B. Feamley, D. N. J. Hart, Blood 90,290 (1997). 81. L. A. Manson, Clin. Immunol. Immunopathol. 72,1 (1994). 167 Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. 44. D. Markowitz, S. Goff, A. Bank, J. Virol. 62,1120 (1988). 125P . Martin et al., Blood 96,2511 (2000). 108.L. Mascarenhas et al., Blood 92,3537 (1998). 27. U. A. Matulonis et al., Blood 85,2507 (1995). 154.J. I. Mayordomo et al., Nature Med. 1,1297 (1995). 22. J. I. Mayordomo et al., Nature Med. 1,1297 (1995). 136.J. V. Melo, Blood 88,2375 (1996). 124.M. Merad, L. Fong, J. Bogenberger, E. G. Engleman, Blood 96,1865 (2000). 150.J. J. Molldrem et al., Blood 90,2529 (1997). 37. A. Nakajima et al., J. Immunol. 161,1901 (1998). 107.L. Naldini et al., Science 272,263 (19%). 24. F. O. Nestle et al., Nature Med. 4,328 (1998). 19. M. Nieda et al., Blood 91,977 (1998). 112.C. M. Niemeyer, S. E. Sallan, in Hematology of Infancy and Childhood, D. G. Nathan, F. A. Oski, Eds. (W. B. Saunders, Philadelphia, PA, ed. 5,1998), vol. 2, chap. 35. 106.H. Nishigaki et al., Blood 89,3735 (1997). 180.Y. Nishioka, M. Hirao, P. D. Robbins, M. T. Lotze, H. Tahara, Cancer Res. 59,4035 (1999). 117.L. Oehler et al.,}. Exp. Med. 187,1019 (1998). 156.H. Ohminami, M. Yasukawa, S. Fujita, Blood 95,286 (2000). 158.M. Ostankovitch et al., Blood 92,19 (1998). 173.F. Osterroth, A. Garbe, P. Fisch, H. Veelken, Blood 95,1342 (2000). 7. W. W. Overwijk et al., Proc. Natl. Acad. Sci. U.S.A. 96,2982 (1999). 168 Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. 159.P. Paglia, C. Chiodoni, M. Rodolfo, M. P. Colombo, /. Exp. Med. 183, 317(19%). 149.K. P. Papadopoulos et al., Blood 90,4938 (1997). 163.A. B. Pawlowska et al., Blood 97,1474 (2001). 135. W. S. Pear et al., Blood 92,3780 (1998). 20. J. Pinilla-Ibarz et al., Blood 95,1781 (2000). 31. B. Pippen, M. Lotze, in Human Cytokines: Their Role in Disease and Therapy, B. B. Aggarwal, R. K. Puri, Eds. (Blackwell Science, Boston, MA, 1995), pp. 675-687. 102.E. V. Planken, N. H. Dijkstra, M. Bakkus, R. Willemze, J. C. Kluin- Nelemans, Br. J. Haematol. 95, 319 (1996). 152.A. Porgador, E. Gilboa, /. Exp. Med. 182,255 (1995). 83. Z. Qin et al., Nature Med. 4,627 (1998). 170.M. E. Reeves, R. E. Royal, J. S. Lam, S. A. Rosenberg, P. Hwu, Cancer Res. 56,5672 (19%). 171.A. Ribas et al., Cancer Gene Ther. 6,523 (1999). 134.P. B. Robbins et al., Proc. Natl. Acad. Sci. U.S.A. 95,10182 (1998). 133.P. B. Robbins et al.,}. Virol. 71,9466 (1997). 78. C. Roth, C. Rochlitz, P. P. Kourilsky, Adv. Immunol. 57,281 (1994). 2. C. M. Rubin, J. D. Rowley, in Hematology of Infancy and Childhood, D. G. Nathan, F. A. Oski, Eds. (W. B. Saunders, Philadelphia, PA, ed. 5, 1998), vol. 2, chap. 32. 56. S. P. Schoenberger, R. E. M. Toes, E. I. H. van der Voort, R. Offringa, C. J. M. Melief, Nature 393,480 (1998). 174.S. Schnell, J. W. Young, A. N. Houghton, M. Sadelain, /. Immunol. 164,1243 (2000). 72. J. L. Schultze et al., Proc. Natl. Acad. Sci. U.S.A. 92,8200 (1995). 169 Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. 76. ]. Schultze, P. Johnson, Lancet 354,1225 (1999). 73. J. L. Schultze, M. J. Seamon, S. Michalak, J. G. Gribben, L. M. Nadler, Blood 89,3806 (1997). 142.W. M. Smit et al., Hum. Immunol. 53,216 (1997). 97. M. J. Smyth, D. I. Godfrey, Nature Immunol. 1,459 (2000). 100.M. J. Smyth, M. Taniguchi, S. E. A. and Street, J. Immunol. 165,2665 (2000). 33. R. Soiffer et al., Proc. Natl. Acad. Sci. U.S.A. 95,13141 (1998). 148.R. Somasundaram, S. H. Advani, S. G. Gangal, Cancer Immunol. Immunother. 27,183 (1988). 47. Y. Soneoka et al., Nuc. Acid. Res. 23,628 (1995). 169.W. Song et al., J. Exp. Med. 186,1247 (1997). 63. E. M. Sotomayor et al., Nature Med. 5,780 (1999). 168.J. M. Specht et al., J. Exp. Med. 186,1213 (1997). 53. D. M. Spencer, Trends Genet. 17,183 (2001). 69.1 . Stamenkovic, E. A. G ark, B. Seed, EMBO /. 8,1403 (1989). 109.R. Stripecke et al.. Blood 96,1317 (2000). 34. R. Stripecke et al., Hum. Gene Ther. 9,2049 (1998). 35. R. Stripecke et al., Hum. Gene Ther. 10,2109 (1999). 132.R. Stripecke et al., Gene Ther. 6,1305 (1999). 113.H. Strobl et al., J. Immunol. 157,1499 (1996). 54. Y. Sun et al., Gene Ther. 7,1467 (2000). 122.G. Suss, K. Shortman, /. Exp. Med. 183,1789 (19%). 58. R. Suto, P. K. Srivastava, Science 269,1585 (1995). 170 Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. 128.P. Szabolcs, H. F. Gallardo, D. H. Ciocon, M. Sadelain, J. W. Young, Blood 90,2160 (1997). 15. G. J. A. ten Bosch, A. M. Joosten, J. H. Kessler, C. J. M. Melief, O. C. Leeksma, Blood 88,3522 (1996). 17. G. J. A. ten Bosch et al., Blood 94,1038 (1999). 14. G. J. A. ten Bosch, A. C. Toomvliet, T. H. Friede, C. J. M. Melief, O. C. Leeksma, Leukemia 9,1344 (1995). 88. R. I. Tepper, J. J. Mule, Hum. Gene Ther. 5,153 (1994). 99. M. Terabe et al., Nature Immunol. 1,515 (2000). 70. W. D. Thomas, M. J. Smith, Z. Si, P. Hersey, Int. J. Cancer 68,795 (2000). 151 .L. Timares, A. Takashima, S. A. Johnston, Proc. Natl. Acad. Sci. U.S.A. 95,13147 (1998). 8. J. M. Timmerman, R. Levy, Annu. Rev. Med. 50,507 (1999). 60. J. G. Turner et al., J. Immunol. 166,89 (2001). 4. F. M. Uckun et al., Cancer 83, 2030 (1998). 89. J. Vieweg, E. Gilboa, Cancer Invest. 13,193 (1995). 121.D. Vremec et al.,}. Exp. Med. 176,47 (1992). 166.J. Wang, S. Saffold, X. Cao, J. Krauss, W. Chen, J. Immunol. 161,5516 (1998). 101.J. S. Weber, J. J. Mule, /. Clin. Invest. 107,553 (2001). 179.J. Westermann et al., Gene Ther. 5,264 (1998). 75. W. G. Wierda et al., Blood 96,2917 (2000). 3. O. N. Witte, Cancer Res. 53,485 (1993). 103.B. Wormann, T. G. Gesner, R. A. Mufson, T. W. LeBien, Leukemia 3, 399 (1989). 171 Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. 51. Y. Yang, Q. Li, H, C. J. Ertl, J. M. Wilson, /. Virol. 69,2004 (1995). 12. P. Yotnda et al., /. Clin. Invest. 101,2290 (1998). 104.M. Zhou, L. Gu, J. Holden, A. M. Yeager, H. W. Findley, Leukemia 14, 403 (2000). 30. K. Zier, B. Gansbacher, S. Salvadori, Immunol. Today 17,39 (19%). 157.L. Zitvogel et al., J. Exp. Med. 183,87 (19%). Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.

Linked assets

University of Southern California Dissertations and Theses

Conceptually similar

PDF

Identification of oncogenes cooperating in murine mammary tumorigenesis and transgenic mouse models of breast cancer

PDF

Cloning and characterization of Grb4: A novel adapter protein interacting with BCR -Abl

PDF

A new model for hepatitis delta virus transcription and replication

PDF

Expression of the RGR opsin and its function in the photic visual cycle

PDF

Endogenous regulatory factors in the inhibition and down-regulation of immune responses

PDF

Discovery of a novel role of vasopressin in astrocytes: Vasopressin-induced cytoplasmic and nuclear calcium and kinases signaling cascade and modulation of astrocytes immune function

PDF

Analysis of multistep mammary tumorigenesis in Wnt1 transgenic mice: The role of fibroblast growth factor-8 in oncogenesis and apoptosis

PDF

Cellular factors involved in mouse hepatitis virus replication

PDF

Identification and cloning of developmentally regulated genetic loci in transgenic mice by screening for novel expression pattern of the lacZ reporter gene

PDF

Characterization of the physiological ligand and function of a novel opsin RGR from the retinal pigment epithelium

PDF

The androgen receptor: Its role in the development and progression of cancers of the prostate and breast

PDF

A case/parental/sibling control study of Ewing's sarcoma/peripheral primitive neuroectodermal tumor (pPNET)

PDF

Functional analysis of MSX2 and its role in skull patterning

PDF

Identifying hematopoietic stem cell proliferation genes for bone marrow transplantation

PDF

Cloning, characterization, anti -apoptotic molecular mechanism, transgenic and protein binding studies of mouse TOSO gene

PDF

Biochemical characterization of hydrogen,potassium-ATPase-rich membranes from the gastric parietal cell

PDF

The role of tumor-associated and normal human brain endothelial cells in angiogenesis

PDF

Investigation of the role of epigenetic modification of DNA and chromatin in aberrant gene silencing in cancer cells

PDF

Studies of hepatitis B virus and hepatitis C virus infection

PDF

Detection of anti-Hu antibodies, a possible key to early diagnosis of small cell lung cancer

Asset Metadata

Creator Gruber, Tanja Andrea (author)

Core Title Immunogenicity of acute lymphoblastic leukemia: In vivo and in vitro studies of Bcr -Abl specific immune responses

School Graduate School

Degree Doctor of Philosophy

Degree Program Molecular Microbiology and Immunology

Publisher University of Southern California (original), University of Southern California. Libraries (digital)

Tag health sciences, immunology,health sciences, oncology,OAI-PMH Harvest

Language English

Contributor Digitized by ProQuest (provenance)

Advisor Kohn, Donald B. (committee chair), [illegible] (committee member), Tahara, Stanley (committee member), Weber, Jeffrey S. (committee member)

Permanent Link (DOI) https://doi.org/10.25549/usctheses-c16-193339

Unique identifier UC11334733

Identifier 3065791.pdf (filename),usctheses-c16-193339 (legacy record id)

Legacy Identifier 3065791.pdf

Dmrecord 193339

Document Type Dissertation

Rights Gruber, Tanja Andrea

Type texts

Source University of Southern California (contributing entity), University of Southern California Dissertations and Theses (collection)

Access Conditions The author retains rights to his/her dissertation, thesis or other graduate work according to U.S. copyright law. Electronic access is being provided by the USC Libraries in agreement with the au...

Repository Name University of Southern California Digital Library

Repository Location USC Digital Library, University of Southern California, University Park Campus, Los Angeles, California 90089, USA