University of Southern California Dissertations and Theses

Morphogenesis of epithelial organs, liver and skin appendage

(USC Thesis Other)

Morphogenesis of epithelial organs, liver and skin appendage

PDF

Download

Open document

Flip pages

Download a page range

Download transcript

Copy asset link

Request this asset

Transcript (if available)

Content MORPHOGENESIS OF EPITHELIAL ORGANS, LIVER AND SKIN APPENDAGE
by
Sanong Suksaweang
A Dissertation Presented to the
FACULTY OF THE GRADUATE SCHOOL
UNIVERSITY OF SOUTHERN CALIFORNIA
In Partial Fulfillment of the
Requirements for the Degree
DOCTOR OF PHILOSOPHY
(PATHOBIOLOGY)
May 2005
Copyright 2005 Sanong Suksaweang
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
UMI Number: 3180312
Copyright 2005 by
Suksaweang, Sanong
All rights reserved.
INFORMATION TO USERS
The quality of this reproduction is dependent upon the quality of the copy
submitted. Broken or indistinct print, colored or poor quality illustrations and
photographs, print bleed-through, substandard margins, and improper
alignment can adversely affect reproduction.
In the unlikely event that the author did not send a complete manuscript
and there are missing pages, these will be noted. Also, if unauthorized
copyright material had to be removed, a note will indicate the deletion.
®
UMI
UMI Microform 3180312
Copyright 2005 by ProQuest Information and Learning Company.
All rights reserved. This microform edition is protected against
unauthorized copying under Title 17, United States Code.
ProQuest Information and Learning Company
300 North Zeeb Road
P.O. Box 1346
Ann Arbor, Ml 48106-1346
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
ACKNOWLEDGEMENTS
I would like to take this opportunity express my gratitude to my wonderful and
graceful PI, Dr. Chuong, for his endless guidance and being so resourceful and
encouraging in any situation. He always reminded me to maintain a high standard and
never compromise when it comes to the quality of data. I want to thank him also for
being a wonderful boss and peer.
I would also like to thank all of my committee, Dr. Widelitz, Dr. Tsukamoto, Dr.
Ou, and Dr. Kaplowitz for guiding me throughout the program. Thank you for then-
invaluable constructive suggestions. I want to single out one committee member, Dr.
Widelitz, for being so kind, generous and helpful in assisting me in my writing.
I would never be here today without any help from all the past and present
Chuong lab members including Janet, John, Joe, Zhicao, Chih-Min, Ping, Mingke,
Michael, Max, Julie, Jeff, Maji, Paul and Pho.
Last, but no least, I would like to thank Thai government for supporting me
financially and my parents and friends in Thailand and America for mental support.
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
TABLE OF CONTENTS
Acknowledgements........................................................................................................... ii
List of figures................................................................................................................... v
List of tables....................................................................................................................vii
Dissertation abstract....................................................................................................... viii
Chapter 1. Introduction.......................................................................................................1
1.1 References................................................................................................................... 4
Chapter 2. Morphogenesis of chicken liver: identification of localized growth zones and
the role of P-catenin / Wnt in size regulation
Abstract.............................................................................................................................. 8
2.1 Introduction................................................................................................................. 9
2.2 Materials and Methods.............................................................................................. 11
2.3 Results....................................................................................................................... 15
2.3.1 The development of chicken liver and expression of molecular markers..............15
2.3.2 Identification of proliferative zones during liver development............................. 19
2.3.3 Molecular profile of the LoGZ...............................................................................24
2.3.4 Overexpression of P-catenin produces enlarged livers with an expanded pool of
hepatocyte precursors......................................................................................................29
2.3.5 Suppression of P-catenin / Wnt pathway leads to small livers with under
developed hepatocytes.....................................................................................................35
2.4 Discussion................................................................................................................ 38
2.4.1 Identifying the dynamically shifting growth zones during chicken liver
development.................................................................................................................... 38
2.4.2 P-Catenin maintains the activity of the LoGZ that modulates the liver size......... 40
2.4.3 Micro-environment of localized growth zone and histogenesis of the liver........42
2.5 Acknowledgement....................................................................................................46
2.6 References................................................................................................................47
Chapter 3. BMP-4 signalling is involved in the endothelial-hepatocyte interaction
during histogenesis organization of the hepatic cords
Abstract.........................................................................................................................51
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
3.1 Introduction................................................................................................................52
3.2 Materials and methods............................................................................................... 54
3.3 Results........................................................................................................................57
3.3.1 The scaffold of liver is a network of endothelial cells........................................... 57
3.3.2 The expression patterns of the BMP pathway members during the liver
morphogenesis.................................................................................................................58
3.3.3 Development of mesenchymal sinusoidal endothelial cells (MSEC) and their
interaction with hepatocytes........................................................................................... 59
3.3.4 Inhibition study: Effect of Noggin in avian hepatogenesis...................................64
3.3.5 Over-expression study: Effect of BMP in avian hepatogenesis............................64
3.4 The discussion.......................................................................................................... 75
3.4.1 Hepatic cord histogenesis required a series of epithelial morphogenetic events. 75
3.4.2 MSEC-hepatocyte interaction accelerate the differentiation................................76
3.5 Conclusion............................................................................................................... 81
3.6 References............................................................................................................... 83
Chapter 4. Ephrin B1 in feather morphogenesis and
the boundary establishment between epidermal domains
Abstract.......................................................................................................................... 85
4.1 Introduction.............................................................................................................. 86
4.2 Materials and Methods..............................................................................................89
4.3 Results.......................................................................................................................91
4.3 .1 Expression of ephrin / Eph during feather morphogenesis....................................91
4.3.2 Ephrin-Bl-Fc on placode boundary and mesenchymal condensation................. 101
4.3.3 Ephrin-Bl-Fc on follicle formation...................................................................... 106
4.3.4 Ephrin-Bl-Fc on barb ridges formation...............................................................112
4.3.5 FGF induces ephrin-Bl is in progress..................................................................112
4.3.6 Ephrin-Bl and chicken skin cells behavior in vitro is in progress..................... 118
4.4 Discussion............................................................................................................... 119
4.5 References............................................................................................................... 124
Chapter 5 Reflection and Perspective...........................................................................129
Bibliography................................................................................................................. 134
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
V
LIST OF FIGURES
Fig. 2-1. Development of the chicken liver..................................................................... 18
Fig. 2-2. Identification of the LoGZ during liver development......................................21
Fig. 2-3. Use of Dil labeling to trace the lineages of cells in the localized growth
zones................................................................................................................................ 23
Fig. 2-4. Molecular expression during hepatogenesis.....................................................28
Fig. 2-5. Effects of over-expressing P-catenin in developing chicken liver..................31
Fig. 2-6. Effects of over-expressing P-catenin on cell morphology, proliferation and
differentiation.................................................................................................................. 34
Fig. 2-7. Effects of blocking P-catenin activity by DKK and DNLEF1 in developing
chicken liver.................................................................................................................... 37
Fig. 2-8. P-catenin in the morphogenesis and histogenesis of the liver........................ 45
Figure 3-1. Endothelial cells serve as a scaffold for the liver........................................61
Figure 3-2. The expression of BMPs pathway and ephrin-Bl.......................................63
Figure 3-3. The inhibition study using RCAS-Noggin...................................................66
Figure 3-4. The misexpression of BMP-4 study.............................................................68
Figure 3-5. The analysis of affected liver..................................................................... 71
Figure 3-6. MSECs was increased in BMP-4 over-expressing livers.............................73
Figure 3-7. MSECs need BMP-4 to maintain their vascular network integrity............. 74
Figure 3-8. The model of hierarchical formation of the hepatic cords........................... 79
Figure 4-1A. Expression of ephrin pathway members during feather morphogenesis...94
Figure 4-IB. Ephrin pathway expression in the older stages of feathers...................... 96
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
Figure 4-1C. The comparison of ephrin-Bl and EphB3 to Shh.....................................97
Figure 4-2A. Section in situ of ephrin-Bl and EphB3...................................................99
Figure 4-2B. The expression of proteins levels........................................................... 100
Figure 4-3. Blocking study in reconstitution assay...................................................... 104
Figure 4-4. The boundary set up is not complete in treated skin............................... 109
Figure 4-5 A. Barb ridge abnormality of the blockage of reverse ephrin signaling. ..114
Figure 4-5B. Shh expression was diminished in treated skin...................................... 115
Figure 4-6. The study of upstream signals that can up regulate ephrin-Bl............... 117
Figure 4-7. The repulsion study (in progress)........................................................... 118
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
LIST OF TABLES
Table 2-1. Molecular expression in localized growth zone of the liver
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
DISSERTATION ABSTRACT
In the past 10 years, molecular genetic and tissue engineering has played an
important role in understanding molecular organogenesis. We assume that some events
occurring in cancer would recapitulate events occurring during different developmental
stages. Therefore, a better understanding of the developmental progression may lead us
to find the way of controlling cancer in the future. Here, the studies of epithelial
organogenesis of the liver and skin appendage in chicken embryos were examined.
We identified the localized growth zone (LoGZ) in the chicken liver that
enriched the proliferative regulating factor called p-catenin. Expression of constitutively
active P-catenin caused an expansion of the liver precursor cell population, resulting in
hepatomegaly. In contrast, inhibition of Wnt signaling with the universal antagonist,
Dkk, caused a dramatic reduction in liver mass.
We then examined the role of BMP-4 and found that this signal from the
mesenchymal sinusoidal endothelial cells (MSECs) is important for the differentiation
and formation of hepatic cords. By over-expressing BMP-4, the liver cells were
accelerated and enhanced their differentiation, forming the hepatic cord precociously.
Blocking the BMP signal with its antagonist, Noggin slowed the process and led to the
accumulation of premature hepatic cords.
In addition, we looked into cell shape and size changes that are essential for
boundary formation during feather development. We found that ephrin-Bl, which is a
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
cell membrane-bound molecule, is involved in this process. By using the soluble ephrin-
B l/ Fc recombinant we were able to block the reverse signal, generated through ephrin-
Bl which resulted in immature invagination of the epithelium due to interrupted cell
shape changes.
Taken together, interactions between epithelial and mesenchymal cells are very
important for epithelial organ to form properly. There are three steps during the process:
initiation, morphogenesis, and differentiation. A better understanding of these processes
would enhance our understanding of tumor biology and aid in finding a way to control
or prevent cancer in the future.
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
1
Chapter 1. Introduction
In the last 10 years, molecular genetics became one of the most prolific topics in
science. We started to understand how tissue engineering could be a major tool for the
medical treatment in the near future. We heard a lot about gene therapy but still there is
no real successful story using such an approach. However, one possible way to turn
modern research into a magic medicine is still appealing. All the organs in our body are
derived from a simple true stem cell, resulting from the mixture of sperm and egg. Then
the cell divides and increases the number of cells and ultimately forms different types of
tissues and organs. Studying the process of organ development therefore has become
essential to understand the messages generated throughout.
To understand the formation of the epithelial organs in particular, I, in
collaboration with many colleagues, took state-of-the-art developmental biology
approaches to study how the liver and skin appendages can be formed. Developmental
biology (DB) has become a major source of data and one of the many major players in
research during the last 10-15 years. The human genome project is completed and a
tremendous amount of work is waiting to be accomplished in the near future.
Meanwhile the genomes of many more species soon will be mapped and the chicken
genome project, the model system used here, was just completed (Hillier et al., 2004).
We have been using chickens as a model to study the formation of epithelial
appendages, such as feathers on the skin and liver on the gastrointestinal tract. In
modern science, the molecular level approach is essential and probably is one of the
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
2
best ways to answer some biological questions underlying cancer formation. We assume
that some events occurring in cancer would recapitulate events occurring during
different developmental stages. Therefore, a better understanding of the developmental
progression may lead us to find a way to control cancer in the future.
Epithelial organs, such as hair, feathers, horns, whiskers, eyes, mouths, genitalia,
stomachs, intestines, and livers for instance are the result of communication between
epithelial and mesenchymal cells. Most organs in the body, except muscle, bone and
blood cells, consist of epithelial and mesenchymal cells suggesting ongoing interactions
between these two cells type are essential for their proper formation and function.
This interaction can be through either direct contact using cell adhesion
molecules and/or membrane-bound proteins or close proximity communication using
multiple secreted factors including activator(s) and/or inhibitors). During development
of the embryo, layers of three cell types, ectoderm, mesoderm, and endoderm emerge
and rearrange themselves into multi-cellular and/or multi-layer organs. Three important
steps have to occur sequentially and properly in order to generate a proper organ
(functionable); induction, morphogenesis and differentiation (Pispa and Thesleff, 2003).
Each step may be the same or different in these organs. Therefore, studying different
organs in the same aspect would allow us to further our knowledge of developmental
biology and cancer biology as well.
Here, I looked into the developmental stages of the liver and feather using the
chicken as a model to understand the fundamental morphogenetic processes. The liver
is an endodermal organ and the feather is an epidermal organ, but both involve
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
3
topological epithelial folding to form complex architectures. I hope that comparing and
contrasting these two models will help us to decipher fundamental principles in
morphogenesis, which may guide us in the future of tissue engineering, which may be
applied to liver regeneration.
In the initiation stage, liver development was known to involve induction factors
secreted by the cardiac mesoderm, such as FGF1, 2, 4 (Jung et al., 1999) and the septum
transversum, BMP-4 for instance (Rossi et al., 2001). Then shortly after the induction, a
massive production of liver precursor cells takes place in order to build up the proper
number of cells. This process involves P-catenin (Suksaweang et al., 2004). The details
are explained in Chapter 2. The induction of the feather was shown as an orchestration
of several initiation molecules, P-catenin (Widelitz et al., 2000) and BMP-7 (Harris et
al., 2004), for example.
Information has just started to emerge regarding morphogenesis and
differentiation stages. The importance of endothelial cells and secreted factors and/or
other factors on cell membranes may be involved. The details of our finding are
delineated in Chapter 3. During these two stages, proper cell sorting and arrangement
into different compartments of the organ are critical. We examined these processes in
boundary formation of the feather. We are aiming to investigate how the hepatic cord
hierarchical formation is achieved in the near future. Our findings so far are discussed
in Chapter 4. The implications of the work that I have done and my reflections as a
Ph.D. student at USC are detailed in Chapter 5.
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
4
1.1 References
Harris, M.P., Linkhart, B.L., Fallon, J.F., 2004. Bmp7 mediates early signaling events
during induction of chick epidermal organs. Dev Dyn. 231, 22-32.
Hillier, L.W., Miller, W., Birney, E., Warren, W., Hardison, R.C., Ponting, C.P., Bork,
P., Burt, D.W., Groenen, M.A., Delany, M.E., Dodgson, J.B., Chinwalla, A.T., Cliften,
P.F., Clifton, S.W., Delehaunty, K.D., Fronick, C., Fulton, R.S., Graves, T.A.,
Kremitzki, C., Layman, D., Magrini, V., McPherson, J.D., Miner, T.L., Minx, P., Nash,
W.E., Nhan, M.N., Nelson, J.O., Oddy, L.G., Pohl, C.S., Randall-Maher, J., Smith,
S.M., Wallis, J.W., Yang, S.P., Romanov, M.N., Rondelli, C.M., Paton, B., Smith, J.,
Morrice, D., Daniels, L., Tempest, H.G., Robertson, L., Masabanda, J.S., Griffin, D.K.,
Vignal, A., Fillon, V., Jacobbson, L., Kerje, S., Andersson, L., Crooijmans, R.P., Aerts,
J., van der Poel, J.J., Ellegren, H., Caldwell, R.B., Hubbard, S.J., Grafham, D.V.,
Kierzek, A.M., McLaren, S.R., Overton, I.M., Arakawa, H., Beattie, K.J., Bezzubov,
Y., Boardman, P.E., Bonfield, J.K., Croning, M.D., Davies, R.M., Francis, M.D.,
Humphray, S.J., Scott, C.E., Taylor, R.G., Tickle, C., Brown, W.R., Rogers, J.,
Buerstedde, J.M., Wilson, S.A., Stubbs, L., Ovcharenko, I., Gordon, L., Lucas, S.,
Miller, M.M., Inoko, H., Shiina, T., Kaufman, J., Salomonsen, J., Skjoedt, K., Wong,
G.K., Wang, J., Liu, B., Wang, J., Yu, J., Yang, H., Nefedov, M., Koriabine, M.,
Dejong, P.J., Goodstadt, L., Webber, C., Dickens, N.J., Letunic, I., Suyama, M.,
Torrents, D., von Mering, C., Zdobnov, E.M., Makova, K., Nekrutenko, A., Elnitski, L.,
Eswara, P., King, D.C., Yang, S., Tyekucheva, S., Radakrishnan, A., Harris, R.S.,
Chiaromonte, F., Taylor, J., He, J., Rijnkels, M., Griffiths-Jones, S., Ureta-Vidal, A.,
Hoffman, M.M., Severin, J., Searle, S.M., Law, A S., Speed, D., Waddington, D.,
Cheng, Z., Tuzun, E., Eichler, E., Bao, Z., Flicek, P., Shteynberg, D.D., Brent, M.R.,
Bye, J.M., Huckle, E.J., Chatteiji, S., Dewey, C., Pachter, L., Kouranov, A.,
Mourelatos, Z., Hatzigeorgiou, A.G., Paterson, A.H., Ivarie, R., Brandstrom, M.,
Axelsson, E., Backstrom, N., Berlin, S., Webster, M.T., Pourquie, O., Reymond, A.,
Ucla, C., Antonarakis, S.E., Long, M., Emerson, J.J., Betran, E., Dupanloup, I.,
Kaessmann, H., Hinrichs, A.S., Bejerano, G., Furey, T.S., Harte, R.A., Raney, B.,
Siepel, A., Kent, W.J., Haussler, D., Eyras, E., Castelo, R , Abril, J.F., Castellano, S.,
Camara, F., Parra, G., Guigo, R , Bourque, G., Tesler, G., Pevzner, P. A., Smit ,A.,
Fulton, L.A., Mardis, E.R., Wilson, R.K.; 2004. International Chicken Genome
Sequencing Consortium. Sequence and comparative analysis of the chicken genome
provide unique perspectives on vertebrate evolution. Nature 432, 695-716.
Jung, J., Zheng, M., Goldfarb, M., Zaret, K.S., 1999. Initiation of mammalian liver
development from endoderm by fibroblast growth factors. Science 284, 1998-2003.
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
5
Pispa, J., Thesleff, I., 2003. Mechanisms of ectodermal organogenesis. Dev Biol. 262,
195-205.
Rossi, J.M., Dunn, N.R., Hogan, B.L., Zaret, K.S., 2001. Distinct mesodermal signals,
including BMPs from the septum transversum mesenchyme, are required in
combination for hepatogenesis from the endoderm. Genes Dev. 15, 1998-2009.
Widelitz, R.B., Jiang, T.X., Lu, J., Chuong, C.M., 2000. Beta-catenin in epithelial
morphogenesis: conversion of part of avian foot scales into feather buds with a mutated
beta-catenin. Dev Biol. 219, 98-114.
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
6
Chapter 2. Morphogenesis of chicken liver: identification of localized growth zones and
the role of P-catenin / Wnt in size regulation
Sanong Suksaweang, Chih-Min Lin, Ting-Xin Jiang,
Michael W. Hughes, Randall Widelitz, and Cheng-Ming Chuong*.
Department o f Pathology,
Keck School o f Medicine,
University o f Southern California.
Los Angeles, CA 90033
*Author for correspondence
Cheng-Ming Chuong, M.D., Ph.D.
Department of Pathology
University of Southern California
2011 Zonal Ave
Los Angeles, CA 90033
TEL 323 442 1296
FAX 323 442 3049
chuong@pathfmder.usc.edu
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
7
Key words: hepatocyte progenitor cells, hepatogenesis, stem cell, gene therapy, and
regeneration
Footnote
Abbreviations:
LoGZ = Localized growth zones
RCAS = Replication competent avian sarcoma
PCNA = Proliferating cell nuclear antigen
L-CAM = Liver cell adhesion molecule
AER = Apical dermal ridge
FGFs = Fibroblast growth factors
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
8
Abstract
During development and regeneration, new cells are added and incorporated to
the liver parenchyma. Regulation of this process contributes to the final size and shape
of the particular organs, including the liver. We identified the distribution of liver
growth zones using an embryonic chicken model because of its accessibility to
experimentation. Hepatocyte precursors were first generated all over the primordia
surrounding the vitelline blood vessel at embryonic day 2 (E2), then became limited to
the peripheral growth zones around E6. Differentiating daughter cells of the peripheral
hepatocyte precursors were shown by Dil microinjection to be laid inward and were
subsequently organized to form the hepatic architecture. At E8, hepatocyte precursor
cells were further restricted to limited segments of the periphery, called localized
growth zones. Adhesion and signaling molecules in the growth zone were studied.
Among them, P-catenin and Wnt 3 a were highly enriched. We over-expressed
constitutively active P-catenin using replication competent avian sarcoma (RC AS)
virus. Liver size increased about three fold with an expanded hepatocyte precursor cell
population. In addition, blocking P-catenin activity by either over-expression of
dominant negative LEF1 or over-expression of a secreted Wnt inhibitor Dickkopf
(DKK) resulted in decreased liver size with altered liver shape. Our data suggests: (1)
the duration of active growth zone activity modulates the size of the liver; (2) a shift in
the position of the localized growth zone helps to shape the liver; and (3) P-catenin /
Wnt are involved in regulating growth zone activities during liver development.
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
9
2.1 Introduction
Epithelial-mesenchymal interactions are essential for induction, morphogenesis,
differentiation, and regeneration in all epithelial organs (review in Chuong, 1998;
Hogan, 1999). This holds true for the liver. During induction, the future hepatic
endoderm (ventral gut endoderm) is specified by several growth factors produced by the
cardiac mesoderm, such as fibroblast growth factor 1 (FGF1), FGF2, and possibly
FGF8 (Jung et al., 1999). Recently, this specification was also found to require bone
morphogenetic proteins (BMPs) in the cardiac mesoderm and septum transversum
(Rossi et al., 2001). However, the mechanism regulating the size and shape of the liver
after induction has not been clearly elucidated.
After the induction stage, hepatocytes and biliary cells form from multipotent
endodermal hepatoblasts (reviewed in Vessy and Hall, 2001; Zaret, 2000; Zaret, 2002).
The specified hepatic endoderm proliferates and forms hepatic cords (Carlson, 1999;
Zaret, 2002, Fig. 1). These cords constitute the liver parenchyma after differentiation
and acquisition of liver-specific gene expression. The hepatic cord is the building unit
of the liver and its formation is pivotal to chemical processing, metabolism, and serum
protein-production functions of the liver.
The liver is made of lobes with specific shapes and sizes. The size of the liver is
tightly controlled during development through adulthood. The size can be restored after
injury or loss (for example, partial hepatectomy) by regenerative processes within 10
days (Michalopoulos, 1990; Monga et al., 2001). During medical intervention,
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
10
repopulation of hepatocytes may be achieved by hepatocyte transplantation, bone
marrow transplantation (Wang et al., 2002), or stem cell transplantation. Understanding
the regulation of morphogenesis and hepatocyte repopulation is important but the
mechanisms have not been evaluated yet.
The Wnt/ P-catenin pathway has been shown to regulate multiple cell properties
controlling morphogenesis, such as growth, axial polarity determination, and apoptosis.
The accumulation of P-catenin leads to uncontrolled cell growth implicated in a broad
range of tumors, such as hepatocellular carcinoma (HCC), breast cancer, lung cancer,
ovarian cancer, colon cancer, synovial carcinoma etc. (Polakis, 2000, Saito et al., 2000).
P-catenin plays a central role mediating the canonical Wnt/ P-catenin signaling pathway
(Jeng et al., 2000). A chicken P-catenin homolog was cloned (Lu et al., 1997) and
ectopic expression of constitutively active P-catenin caused avian foot scale epidermis
to grow feathers (Widelitz et al., 2000). This suggests its possible role in specifying
cellular fates. Furthermore, alterations (missense mutations or interstitial deletions) of
this gene are associated with hepatoblastoma (Wei, 2000). However, the fundamental
function of P-catenin in early liver growth has not been established. During liver
regeneration it is one of the earliest affected genes, induced within 5 minutes (Monga et
al., 2001). Therefore, it is important to investigate its expression and function during
early liver development.
To study this, we chose the chicken liver as a model because of its remarkable
accessibility to experimentation, in which molecules or chemicals can be added in ovo.
At early developmental stages, embryos are transparent facilitating microinjections. We
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
11
hypothesize that regulation of localized growth zone activities during liver
morphogenesis gives rise to the mass and shape of the liver. To test this, we examined
the location of proliferating cells in embryonic livers by staining for proliferating cell
nuclear antigen (PCNA) at various times during liver development. We sought to study
the molecular microenvironments that orchestrate the activity of the growth zone. In
this study, we showed that P-catenin played a crucial role. Its dynamic expression
pattern coincides with that of the LoGZ. Over-expression of a constitutively active P-
catenin resulted in an expanded population of hepatocyte precursors and increased liver
size. Furthermore, blocking its activity by over-expressing a dominant-negative LEF1
led to a decreased liver size. In addition, blockage of the canonical pathway by
administration of DKK (Glinka et al., 1998) dramatically changed the size and shape of
the liver. Understanding the molecular regulation of early liver development may help
gain new insights into liver pathogenesis and aid in identifying potential targets for
future therapy to curtail liver diseases.
2.2 Materials and Methods
Histology and Immunohistochemistry and in situ hybridizations
Embryos were sectioned to 5-6 pm and stained for H&E and
immunohistochemistry as described (Jiang et al., 1998) with a few modifications.
Immunohistochemistry was done using the automated Ventana Discovery™ system.
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
12
Blocking solution contained 10% FBS/ 0.5% BSA in PBS. Antibody dilution solution
contained 2 % FBS/ 0.1% BSA. The antibodies were anti-|3-catenin (Sigma), anti-L-
CAM, anti-PCNA (Chemicon), anti-Tenascin-C (M1B4), anti-pl9 (AMV-3C2) and
anti-Vimentin (H5) (developed by Fambrough and obtained from the Developmental
Studies Hybridoma Bank developed under the auspices of the NICHD and maintained
by The University of Iowa, Department of Biological Sciences, Iowa City, IA 52242),
anti-c-Myc (Research Diagnostic), and anti-HA (Santa Cruz).
Whole mount in situ hybridization (WISH) and section in situ hybridizations
(SISH) were used to detect mRNA levels from chicken embryos at different H&H
stages (Hamburger and Hamilton, 1951). The WISH protocol was performed as
described (Jiang et al., 1998). Some SISH was performed using the automated
Discovery™ system (Ventana Medical System) with recommended protocols.
Reverse transcription-polymerase chain reaction (RT-PCR)
mRNA was extracted with the RNeasy Protection kit (Qiagen). AMV reverse
transcriptase (Roche Diagnostics) was used for reverse transcription and PCR was
performed using the protocol recommended by the manufacturer (Panvera). Primers
used in Fig. 5 are as follows; RCAS (a = sense: AGCCTGAAAGCAGAATA; b =
antisense: GCAAGACTACAACAGTA), (3-catenin (c = sense:
ATGGCAATCAAGAAAGTAAGC; d = antisense:
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
13
GTACAACAACTGCACAAATAG), and GAPDH (e = sense:
GGCGAGATGGTGAAAGTCG; f = antisense: CAGTTGGTGGTGCACGATG).
Dil injection
To trace liver cell movement during morphogenesis, E4 and E5 embryos were
exposed. Lipophilic dye (l-2pl) was micro-injected into the surface of liver buds of
different embryos in a reproducible way (checked by examining sections at time 0).
Livers were isolated every 6 hours after labeling. The isolated livers were fixed in 4%
PFA at 4°C for 16 - 18 hours, washed in PBS twice for 5 minutes. The livers were kept
in the dark until their fluorescence was monitored by confocal microscopy (The
Microscopy Sub core at the USC Center for Liver Diseases (NIH 1 P03 DK48522)).
Each time point presents a representative liver from 3 or 4 specimens.
Periodic acid Shiff (PAS) staining
To verify hepatocyte differentiation status, glycogen was detected using the PAS
method (Warren and Hamilton, 1981) as recommended by the manufacturer (Sigma).
Briefly, sections were deparaffxnized, rehydrated, immersed in Periodic Acid Solution
for 5 minutes at room temperature (18-25 °C). Slides were then rinsed and immersed in
SchifPs reagent for 15 minutes, counterstained with Hematoxylin Solution (Gill No. 3),
dehydrated, cleared, and mounted.
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
14
RCAS viral production
RC AS - truncated Xenopus P-catenin lacking the amino and carboxy termini
was provided by Dr. Johnson (Capdevila et al., 1998). Virus was prepared as described
(Jiang et al., 1998). Increased viral titers were obtained from supernatants after
centrifugation at 12,000 rpm for 30 minutes prior to the injection. RCAS-DKK was
constructed using the RCAS Gateway system (Loftus et al., 2001).
In ovo microinjection
Each egg was sterilized with 70% ethanol and a 15-20mm diameter window was
made. Stage 20-21 embryos were microinjected with 5-10 pi of virus into the body
cavity between the developing heart and gizzard. The windows were closed with scotch
tape and the eggs were placed back into the humidified incubator for 3 or more days.
Luciferase reporter gene assays
E6 liver cells (50,000) were plated in 24-well plates 16-18 hrs prior to
transfection. Transfections were performed as described with Targefect F2 (Targeting
systems) following the procedures recommended by the manufacturer. P-catenin
activity was assessed using a TCF-4 binding element (TBEs) directing expression of
luciferase (He et al., 1998).
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
15
2.3 Results
2.3.1 The development of chicken liver and expression of molecular markers
Stages of liver development from E4 to E7 are shown in schematic
representations (Fig. 2-1 A). We examined the livers from E4 to E7 (Fig. 2-1B). At E4
(H&H stage 24) the newly formed liver primordium was identified microscopically as a
small, yellow-white bud adjacent to the heart and gizzard, situated to the right of the
spinal cord. This liver primordium was composed of loosely arranged hepatocyte
precursor cells (Fig. 2-IB, H&E). The parenchymal cells expressed extremely low
levels of albumin, undetectable by in situ hybridization (Fig. 2-IB, Albumin), but
detectable by RT-PCR (not shown). Glycogen was also undetected (Fig. 2-1B,
glycogen).
By E5 (H & H stage 26), the second lobe began to form (Fig. 2-IB, isolated
liver, arrow). At this stage, the unorganized hepatocyte precursors formed groups of
tightly adhered cells surrounded by spindle shaped endothelial cells (Fig. 2-1B, arrow in
H&E). The loosely organized hepatocyte precursors then arranged to become acini and
eventually organized into tube-like hepatic cords (Fig. 2-1B, H&E, also see Fig. 2-8B).
At the center of the liver lobe, moderate albumin expression surrounding the vitelline
blood vessel started to be observed. Albumin was not detected in the periphery at this
stage (Fig. 2-IB, albumin).
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
16
By E6 (H&H stage 28), the second lobe had formed and hepatocytes became
more organized, forming smaller sinusoidal spaces close to the vitelline blood channel
(Fig. 2-IB, H&E and arrowhead). Larger sinusoidal spaces remained at the periphery
and growing tip (Fig. 2-1B, H&E and asterisk). More tightly organized parenchymal
cells were observed, possibly through interactions with the spindle shape endothelial
cells (Fig. 2-IB, H&E and arrow). Albumin expression levels increased and expanded
but still remained low at the growing tip and the periphery (Fig. 2-IB, albumin, and
arrow). Glycogen was not detected at the periphery yet, but started to become positive
at the center (Fig. 2-IB, glycogen, E6).
By E7 (H & H stage 29), the third lobe formed as a tiny bud, ventral to the
second lobe (not shown). Histologically, the structure was similar to that seen at E6 but
the number of hepatocytes was markedly increased. The hepatic cords were more
organized than at E6 (Fig. 2-IB, H&E). Albumin levels were higher, particularly at the
center of the liver lobe (Fig. 2-1B, albumin). However, at the growing tip, albumin
expression levels remained low. The level of glycogen at the center of liver lobe was
increased by E8 and became ubiquitous in the liver lobe at E l5 (Fig. 2-IB, glycogen).
These data suggest that differentiation started at the center of the liver lobe and
gradually expanded to the periphery.
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
17
Fig. 2-1. Development of the chicken liver. (A) Schematic drawing of chicken liver
development. (B) Liver morphology shown in the isolated livers, the H&E sections at
lOx (H&E left column) and lOOx (H&E right column) from E4 to E7, the in situ
hybridized of albumin-mRNA of corresponding stages at 20x (Albumin), and the
glycogen expression detected by PAS staining from E4, E6, E8, and E l5 respectively
(Glycogen). The H&E staining shows the progression of the hepatocytes forming the
hepatic cords as the liver grows. E5, isolated liver, arrow indicates newly formed
second lobe. E5, H&E, arrow indicates endothelium. E6, H&E, asterisk indicates large
sinusoids in growing tip. Arrowhead indicates smaller sinusoids. Arrow indicates
endothelium. E6, Albumin, arrow indicates liver periphery.
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
Differentiation Morphogenesis Induction
18
B
E2
E3
E4
E5
Isolated livers H&E H&E Albumin (mRNA) Glycogen
Flat sheet ventral
endoderm
Diverticulum
Liver bud
First lobe
First & Second
lobes
First Second & Ui
Third lobes
200pm 20pm 80pm 40pm
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
2.3.2 Identification of proliferative zones during liver development
19
The distribution of growth zones was next examined using a cell proliferative
marker, PCNA. Interestingly, it shows a reciprocal expression pattern to that of albumin
/ glycogen. The antibody to PCNA first showed nuclear positive cells throughout the
liver lobe at E4 (Fig. 2-2, E4). By E6, PCNA gradually became negative in the center of
the liver and proliferating cells were detected at the periphery and growing tip of the
liver lobe (Fig. 2-2, E6). By E8, the peripheral growth zone started fragmenting with
some segments devoid of proliferating cells (Fig. 2-2, Peri2) and others with more
proliferating cells (Fig. 2-2, Peril, Apex).
To trace the lineage of cells in the growth zone, Dil was used. Dil was injected
into the surface of the developing liver primordia at E4 or E5 in ovo. At different times,
livers were removed and examined by confocal microscopy. While some labeled cells
remain at the injection site, most labeled cells shift positions toward the center, resulting
from a possible combination of cell proliferation and migration (Fig. 2-3). It is
consistent with the thought that cells in the peripheral growth zone give rise to cells in
the parenchyma, although it does not rule out that parenchymal cells can also be
generated elsewhere.
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
20
Fig. 2-2. Identification of the LoGZ during liver development. Immunohistochemistry
of PCNA staining at E4, E6, and E8. PCNA is all over in early liver stages but become
restricted to several localized growth zones in the periphery and apex at later stages.
Schematic drawings show the locations of the panel taken. Peri (periphery) 1 represents
localized growth zones. Peri 2 represents regions without growth zone activity. Scale
bars, 20pm.
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
21
Cehter
* •/!
S r 4 *
* v,-ir
Center
Peri2|
Peril
Apex,
! I
Perit * Peri2 *
*
?
M
3H.
% »
20(xm
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
22
Fig. 2-3. Use of Dil labeling to trace the lineages of cells in the localized growth zones.
E4 and E5 embryo livers were labeled with lipophilic-fluorescent dye Dil and the livers
were isolated at specified time points. Specimens were collected at time zero, (TO), 6,
12, 24, 30 h, and 72h respectively. The live specimens were observed with a confocal
microscope. The pictures represent the maximum projection, in which all the planes (X,
Y, and Z) are combined by computerization. Injection sites were marked with a yellow
arrow and the surface of the liver lobe with green lines. As time progresses labeled cells
become more widely and inwardly distributed. Note that a few labeled cells remains at
the injection site. Size bar is 25 pm for E4 and 100 pm for E5. The micro-injection
diagram was not drawn to the scale.
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
23
E4, T O
E4, 6h
E4, 12ft.
E4, 24 h
© -
%
E4, 30h
25 nm
E5, T O
E5, 72h
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
24
2.3 .3 Molecular profile of the LoGZ
Next, in situ hybridization and immunostaining were used to see what molecules
are expressed in the growth zones. L-CAM, vimentin, tenascin-C and |3-catenin were
expressed in interesting patterns. At E4, L-CAM (E-cadherin) was detected in the
cytoplasm and cell membrane of the parenchyma. At E6, L-CAM was seen in the cell
membrane and was more intense in the periphery than the center of the liver (Gallin et
al., 1983). At E8, staining continued to be more intense in the periphery than in the
center and almost absent in the non-LoGZ (Fig. 2-4A). In general, in LoGZ, L-CAM is
present in higher amount and is in both cytoplasm and cell membrane. In the
parenchyma and in the non-LoGZ periphery, L-CAM is present in membrane form and
more in the inter-cellular junctions.
Livers were then stained with mesenchymal cell markers to test their
involvement in LoGZ activity. Interestingly, the growth zone hepatocyte precursors
were sandwiched by two layers of mesenchymal cells that stain with vimentin and
tenascin-C. At E4, vimentin was intense in the peripheral mesenchyme. At E6 and E8,
vimentin is present in some intra-hepatic flattened mesenchymal cells surrounding the
parenchyma, including putative endothelial cells. It is absent in the peripheral
mesenchyme where the localized growth zone disappeared at E8 (Fig. 2-4A). Tenascin-
C, at E4, was weak and random, but absent in the peripheral mesenchyme that was
positive for vimentin. At E6, tenascin-C clearly demarcated the peripheral growth zone
by being present as a lamina on the side of the hepatocyte precursors that face the liver
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
25
center (Fig. 2-4A). Tenascin-C was absent in the endothelium and other central areas.
At E8, the characteristic tenascin-C expression pattern remained only in the
mesenchymal cells of localized growth zone regions, but was completely negative in
non-growth zone regions (Fig. 2-4A). At later stages, such as E l5, the expression was
absent in both growth and non-growth zones. Fibronectin was present in both the
peripheral and inward mesenchymal cells. However, its presence was more ubiquitous
and was present in both growth zone and non-growth zone regions (Table. 2-1).
Table 2-1. Molecular expression in localized growth zone of the liver.
beta- Vimenti L- Fibronectin
Catenin n CAM Tn-C* *
Outermost
mesenchyme + + - - +
Growth zone cells + +
Intrahepatic
mesenchyme - + - + +
* Fibronection was also present in the non-growth zones, but tenascin-C was only in the
localized growth zones.
Among the many molecules analyzed by in situ hybridization, (3-catenin was the
major species that co-localizes and co-shifts with the localized growth zones. At E4,13-
Re produced with permission of the copyright owner. Further reproduction prohibited without permission.
26
catenin mRNA was detected uniformly throughout the liver bud (Fig. 4B). At E5, the
expression pattern gradually decreased in the center but remained at high levels in the
periphery of the liver lobe (Fig. 4B). At E7, P-catenin expression was strongly localized
to the periphery particularly at the growing tip when compared to the center area (Fig.
4B, small rectangular for center).
(3-catenin protein was next detected by immunostaining (Fig. 4C). At E4, |3-
catenin was throughout the liver lobe. At E6, 3-catenin was detected strongly in the
periphery but became negative in the center. At E8, P-catenin was expressed in parts of
the periphery, enriched in the apex and some of the periphery regions, but negative in
some other periphery regions. Sub-cellularly, P-catenin is present in the membrane,
cytoplasmic and nuclear regions. The diffuse cytoplasmic staining has dampened the
nuclear staining appearance. Although not present in every cell, nuclear staining was
observed (Fig. 4C, inset). In some regions, membrane staining is more intense between
cells than on free cell surfaces, similar to L-CAM at this stage.
As P-catenin is downstream to some Wnt members, we also examined their
expression. We detected Wnt 3a and Wnt 8b in the localized growth zone (Wnt 3a is
shown in Fig. 4D. Wnt 8b has similar pattern and is not shown). The activity of these
Wnts is known to be mediated through the canonical pathway (Kengaku et al., 1998;
Saitoh et al., 2002). On the other hand, Wnt 5a and Wnt 11 are also detected in the
developing liver, but diffusely in both the periphery and center (not shown). The
activities of Wnt 5a and 11 are known to be mediated through the non-canonical
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
27
pathways (Weeraratna et al, 2002; Pandur et al., 2002). Thus, (3-catenin and some of the
Wnts, which induce the canonical pathway member, are co-localized with the LoGZ.
Fig. 2-4. Molecular expression during hepatogenesis. (A) Immuno-histochemical
localization of L-CAM, vimentin, and tenascin-C at E4, E6, and E8. (B) The expression
of (3-catenin transcripts at E4, E5, and E7. The inset in (B) at E7 was a higher
magnification view of the center of the liver lobe from the left column. (C) The
expression pattern of p-catenin proteins at E4, E6, and E8 respectively. The nuclear
staining was observed (inset). (D) The expression of Wnt 3a transcripts at E7. Each of
these micrographs was chosen as representative from at least three independent
samples. Panels A and C are immunohistochemistry and brown colors are positive. B
and D are in situ hybridization and blue colors are positive. Peril represents localized
growth zones and Peri2 represents regions without growth zone activity as shown in the
schematic drawing. Note the difference in the expression patterns in the parenchymal
center, peril and peri2. Scale bar, 20 and 100 pm.
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
28
A LCAM Vimentin
4 ?' *«" At > . -
3 & f , V >
V > ^ V e'-. h *
A - ., * * . ■ . y %
liS' * < • *«
... f-r
* i *
L #*“i J * * , i .
C D . >.*. ,
ui> „ 7 4 ‘ j, *
TN B (3-Catenin transcripts (mRNA]
* i '- *
% •
*> t* T
P
P e ril * ' Peri2
* 4
• < Peri2 Peril Peri2
t *
* * > 3 **' ^
(5-Catenin proteins
* . i * 2 * V
" D r * ■ * * %
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
29
2.3.4 Overexpression of p-catenin produces enlarged livers with an expanded pool of
hepatocyte precursors
To test the role of P-catenin in liver growth, p-catenin function was examined by
introducing an exogenous, constitutively active P-catenin to chicken embryos using the
RCAS retroviral vector (Fig. 2-5A, B). Virus was injected into the body cavity between
the heart and gizzard where the liver starts at E3. The presence of virus introduced into
the livers as confirmed by RT-PCR in isolated affected livers (Fig. 2-5C, D) and by
staining for anti-AMV-3C2 (similar result as Fig. 2-7B, 3C2).
The major phenotype observed is the enlargement of the liver at both E10 and
E l5 (Fig. 2-5A). The livers from the affected embryos contained more mass than the
controls (Fig. 2-5E). The approximate weight increase was between 1.5-5 fold with p
< 0.05. Some embryos with high infection show severe phenotypes and die prematurely
before E15.
Next, the effects of ectopic P-catenin expression on hepatocyte morphology, cell
proliferation and differentiation were determined. E l5 affected livers were analyzed
(Fig. 6A). Similar results were obtained from other stages examined. Morphologically,
the transduced hepatocytes resembled those cells from normal livers at earlier stages
(E4 or E5) and cells in the LoGZ later (E7, E8). The cells were either round or cuboidal,
and the nucleus to cytoplasm ratio (vol: vol) increased compared to controls. They were
arranged loosely and not well organized. While there were no signs of tumor formation,
the accumulation of these cells disrupted normal hepatic cord formation. PCNA staining
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
30
Fig. 2-5. Effects of over-expressing p-catenin in developing chicken liver. (A) RCAS-
control and RCAS-p-catenin transduced livers were isolated at E10 (upper row) and
E l5 (lower row) respectively. Scale bar, 1mm. (B) Upper diagram of wildtype with
phosphorylation sites (light grey, PPP), armadillo repeats (grey), and cytoplasmic tail
(blank) and lower diagram of constitutively active P-catenin, lacking N- and C-termini.
(C) RT-PCR of P-catenin and glyceraldehydes 3-phosphate dehydrogenase (GAPDH)
for the control (1) and affected (2) livers. (D) Transduction of RCAS-P-catenin was
further verified by two sets of RT-PCR experiments. cDNAs in lanes 2-5 were
amplified with RCAS primers. cDNAs in lanes 6-7 were amplified with sense-RCAS
and antisense-p-catenin primers. The size of the PCR products from the wild type and
truncated P-catenin are indicated (arrows). Lane 1, molecular weights markers; Lane 2,
wild type liver cDNA; Lane 3, RCAS-P-catenin plasmid; Lane 4, affected liver cDNA;
Lane 5, affected limb cDNA; Lane 6, affected liver cDNA; Lane 7, RCAS-P-catenin
plasmid. The inset is a diagram representing the RCAS-P-catenin plasmid and the
primers used for PCR. (E) The change of liver weights was quantified. The means of
the liver weights at E7 (n = 3), E 10 (n = 4), and E l5 (n=T) were graphed (p < 0.05;
Paired-t-test).
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
31
B
RCAS RCAS-p-catenin
N l P PP
Primer a, b Primer a, d
1 1 I ------1
2 3 4 5 6 7
■ ' H I "
2.3
*1/7
IGAPDH
2.3Kb
1.7Kb
250
237
■ Wildtype
o RCAS-p-catenin
200
S ? 150
86.75
S Z
O )
© 100
79
35.75
50
25
E7 E10 E15
Embryonic Day
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
32
showed proliferation localized to the periphery of control livers, but more widely
distributed in both the periphery and the parenchyma of transduced livers. Similarly, 0-
catenin is now present not only in the periphery but also as patches in regions of the
parenchyma. The staining pattern changed from higher in the membrane to higher in the
cytoplasm and nucleus.
L-CAM expression was also changed from a membrane-staining pattern to a
cytoplasmic expression pattern, similar to those observed in undifferentiated
hepatocytes at earlier times, such as E4 (Fig. 2-4A). cMyc, normally present very
weakly in the periphery now was strongly expressed in patchy regions of both the
periphery and parenchyma. cMyc is known to be downstream to 0-catenin (Ishigaki et
al., 2002). Vimentin expressing mesenchymal/ endothelial cells were increased, but they
were not as well organized as the controls, which formed nice sinusoidal spaces (Fig. 2-
6A). Tenascin-C expression persisted in the periphery but become more diffusely
expressed (Fig. 2-6A). Glycogen was diminished in affected livers compared to controls
(Fig. 2-6A), suggesting that differentiation is inhibited in livers ectopically expressing
constitutively active 0-catenin. These results imply that hepatocytes may remain at an
early precursor stage and do not differentiate appropriately in the presence of excess 0-
catenin activity.
To determine whether the canonical 0-catenin signaling pathway was active in
these transduced cells, a TCF binding element (TBE) promoter - luciferase reporter
construct was used (He et al., 1998). The results showed much higher activity in RCAS
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
33
p-catenin-transduced specimens (Fig. 2-6B). Together these data suggest that ectopic P-
catenin expression increased the proliferation potential of transduced cells, and the
characteristics of these cells are similar to that of the LoGZ.
Fig. 2-6. Effects of over-expressing P-catenin on cell morphology, proliferation and
differentiation. (A) Sections from control (left) and RCAS-P-catenin over expressing
livers (right) were stained by H&E and with antibodies against PCNA, P-catenin, L-
CAM, c-Myc, vimentin, and tenascin-C. Glycogen was detected by PAS staining. The
architecture of the affected livers was disrupted, and the well-organized hepatic cords in
controls were not observed. Cells become rounder and less differentiated. The border of
the liver is marked by a yellow dotted line. (B) The constitutive activity of P-catenin
was tested with TCF-4 binding element (TBE)-linked luciferase. The plasmids were
transfected into liver cells with or without RCAS-P-catenin. The constitutively active P-
catenin was given a markedly high expression level of luciferase. Mut-TBE + LacZ =
the liver cells transfected with mutant TCF-luciferase and the control RCAS-LacZ
plasmids; and WT-TBE + LacZ = liver cells transfected with wild type TCF-luciferase
and the control RCAS-LacZ plasmids. Mut-TBE + P-Cat = liver cells transfected with
mutant TCF-luciferase and RCAS-P-catenin plasmids; WT-TBE + P-Cat = the liver
cells transfected with wild type TCF-luciferase and RCAS-P-catenin plasmids.
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
WT RCAS-p-catenin
No Mut-TBE MutTBE WT-TBE WT-TBE
Construct ♦ LacZ + p-Cat + LacZ + p-Cat
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
35
2.3 .5 Suppression of P-catenin / Wnt pathway leads to small livers with under
developed hepatocytes
In contrast, in the loss of function studies, the affected livers showed the
opposite results. Both RCAS-DNLEF1 and RCAS-DKK dramatically decreased the size
and altered the shape of the livers (Fig. 2-5F; n = 9 and 6). The weights of affected
embryos were compared at E l3 (Fig. 2-7A, diagram; n = 3 and 2, respectively).
The liver cells in both RCAS-DNLEF1 and RCAS-DKK affected livers seemed
to have disruption of hepatic cord structure and failed to form sinusoidal spaces (Fig. 2-
7B). Both affected livers showed decreased cell proliferation (judged by PCNA
staining) and increased TUNEL positive cells. This is consistent with the report that
DNLEF1 was shown to induce caspase expression and apoptosis (Chen et al., 2003).
The hepatocytes show reduced L-CAM expression. They do differentiate to express
glycogen, but the staining was not as uniform as in the control. Therefore, blocking the
canonical P-catenin activity may have depleted hepatocyte precursor cell pools by a loss
of balance among proliferation, differentiation, and apoptosis (Zechner et al., 2003),
which resulted in smaller and unusual shaped liver lobes.
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
36
Fig. 2-7. Effects of blocking p-catenin activity by DKK and DNLEF1 in developing
chicken liver. (A) Livers from controls, RCAS-DNLEF1 and RCAS-DKK. The
diagram on the right shows the comparison of weights (n = 5). (B) Effects of blocking
P-catenin on cell morphology, proliferation and differentiation. Sections from control
(left), RCAS-DNLEF1 (middle), and RCAS-DKK (right) were analyzed with H&E and
stained with antibodies against PCNA, P-catenin, and L-CAM. Presence of glycogen
and TUNEL were also analyzed. To verify viral transduction, the same areas analyzed
for RCAS-DNLEF1 and RCAS-DKK were also stained with antibody 3C2 to viral
protein, and antibodies to HA tag on RCAS-DKK (Fig. 7)
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
TU N E L Glycogen L C A M p-catenin P C N A H&E
37
RCAS-DNLEF1
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
38
2.4 Discussion
Liver development can be studied at the level of morphogenesis and
histogenesis. Initially all liver cells had a high proliferation rate, presumably to generate
cells for liver primordia formation. In mice, the primordia invade the surrounding
mesenchymal cells of the septum transversum and expand (Le Douarin, 1975; Rossi et
al., 2001). In zebra fish, the liver cells aggregate and proliferate to form a liver bud
(Field et al., 2003). In this work, we set out to study how new cells are added to the
developing liver, and what molecular pathways may be involved using the chicken
model. The study is consistent with the hypothesis that newly generated hepatocyte
precursors are added to the outer layer of the primordia and later, at places where LoGZ
activities remain. With both over-expressing and functional blocking studies, we
showed P-catenin plays a critical role in keeping the LoGZ active, i.e., keeping the
hepatocyte precursors in a proliferative and undifferentiated status longer, and thereby
enlarging liver mass in those loci. Indeed, blocking P-catenin activity resulted in much
smaller sized livers with a depletion of the hepatocyte precursors.
2.4.1 Identifying the dynamically shifting growth zones during chicken liver
development
In general, organ morphogenesis relies on the temporal and spatial distribution
of cell proliferation, cell adhesion, cell death, cell differentiation, and cell organization.
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
39
For example, the localized growth zone in the limb bud is in the distal limb bud and the
duration of its activity determines the length of the limb (Johnson and Tabin, 1997;
Tickle and Wolpert, 2002). In feathers, the growth zones are first localized in the distal
feather bud, then become proximally located in the follicle, and finally reside in the
barb ridge. Thus LoGZ helps to build the shape of skin appendages by adding cells at
specific locations at specific times (Chuong et al., 2000; Chodankar et al., 2003).
The liver has a peculiar but reproducible shape and size (Gumucio et al., 1996).
If all cells in the developing liver have the same proliferative rate, the liver would end
up with a ball-like morphology, as seen in some hepatomas. Since this is not the case,
there must be some differential growth based on the LoGZ in the developing liver. The
liver LoGZ has not been identified or characterized. Therefore, we focused on
identifying these LoGZ and characterizing their molecular basis and roles in liver
development. At particular stages during liver development, the liver mass seems to be
controlled precisely and tightly (reviewed in Michalopoulos, 1990, our unpublished data
for chicken). However, some regions grow unevenly, producing the characteristic shape
of liver lobes. In regions where LoGZ activity is maintained, a layer of proliferating
hepatocytes is left at the periphery and the liver lobe will expand in this locus. By E7,
the LoGZ became “segmented” and was more prominent in the ventral versus the dorsal
surface. These results support the model that the spatial and temporal positioning of the
LoGZ in the developing liver primordia helps to define the final shape and size of the
liver.
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
40
2.4.2 p-Catenin maintains the activity of the LoGZ that modulates the liver size
p-Catenin regulates cell proliferation (Orford et al., 1999, Monga et al., 2003).
The expression pattern of P-catenin was initially all over the liver, then became limited
to the periphery, and finally became restricted to the liver lobe tips. This parallels the
shifting LoGZ activity (Fig. 2-8A). Therefore, it is reasonable to hypothesize that the p-
catenin pathway is involved in the function of the LoGZ. We postulate that P-catenin
acts as an activator of proliferation during early hepatogenesis to establish the liver
mass. In the LoGZ, immunostaining showed that P-catenin protein is localized in the
cell membrane, cytoplasm, and nucleus. They appear to reach equilibrium without
dominant nuclear staining, suggesting that the role of P-catenin here is both adhesion
and transcriptional. In the more mature liver parenchyma cells toward the center, P-
catenin protein was much stronger in the cell membrane, suggesting the predominant
function here may be related to cell adhesion, such as the re-arrangement of
hepatoblasts into liver cords. In the most mature hepatocytes, P-catenin staining
disappears. At E8, regions of strong P-catenin expression became restricted to the tip
and some segments of the developing lobes.
In the present work, we were able to test the specific roles of P-catenin using the
chicken model. Overall, the liver can increase three fold in weight by over-expressing
P-catenin. In some cases, it leads to the formation of an expanded lobe. Analyses
showed that expanded cell populations are highly positive for PCNA, c-Myc, but lack
glycogen. These data combined with the enhanced expression of L-CAM suggest that
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
41
these cells may represent an expanded pool of early hepatocyte precursors. These cells
did not resemble tumor cells because they did not show abnormal mitosis, locus
formation, or invasion.
The ability of P-catenin to increase cell proliferation has been shown. In the
mouse, suppression of p-catenin reduced liver cell proliferation (Monga et al., 2003). P-
Catenin in conjunction with a LEF/Tcf co-transcription activator induces c-Myc and
cyclin-Dl expression (Utsunomiya et al., 2001), hence increasing cell number.
Transgenic mice, expressing a stabilized P-catenin form from an endolase promoter,
gave rise to hepatomegaly (Cadoret et al., 2001). Additionally, P-catenin expressed
from adenovirus was shown to cause hepatomegaly (Harada et al., 2002). During liver
regeneration, P-catenin promotes proliferation required to restore liver mass after partial
hepatectomy (Monga et al., 2001). Indeed, liver cell proliferation was shown to be
dependent on the expression of P-catenin in vitro (Monga et al., 2003). While p-catenin
may be important for liver growth, the deregulation of its activity can lead to
carcinogenesis. Mis-regulation of P-catenin has been shown to lead to transformation
and tumorigenesis (Polakis, 2000). In contrast, reducing P-Catenin activity by DN-
LEF1 or DKK led to a reduction in liver size. Pathological analyses showed reduced
cell proliferation, and affected cells are defective in their control of growth, apoptosis,
and differentiation.
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
2.4.3 Micro-environment of localized growth zone and histogenesis of the liver
42
Hepatocyte precursor cells proliferate in the growth zone, and are sandwiched
by the mesothelial cell on the outside and tenascin-C positive mesenchymal cells inside
(Fig. 2-8B). When a certain threshold is reached, cells start to arrange themselves and
progress toward differentiated hepatocytes, while cells remaining in the growth zone
still express higher P-catenin levels, retain their high proliferation rate and possible
pluripotentiality. Thus new cells are added to the outer layer of the primordia, and the
whole liver lobe continues to grow in size.
How are cell fates in the growth zone regulated? We contend that growth control
is regulated by epithelial-mesenchymal interactions between the growth zone
hepatocytes and the adjacent two types of mesenchymal cells. When ready, hepatocyte
precursors generate cells that may leave the growth zone and displaced inward. Our Dil
labeled experiments are consistent with this proposed transition. These early
hepatoblasts are progressively organized first into acini, then into a cord configuration
(Fig. 2-8B). This must involve changes in adhesion molecules. For example, tenascin C
positive mesenchymal cells are selectively high beneath the growth zone cells but are
absent in regions where growth has subsided. Tenascin has been shown to be a de
adhesion molecule and may play a role to allow cell re-arrangement and active
morphogenesis (Murphy-Ullrich, 2001).
L-CAM (chicken E cadherin; Gallin et al., 1983) is detected in both the
cytoplasm and cell membrane of hepatocyte precursors in the LoGZ. Since the
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
43
cytoplasmic E-cadherin domain can bind P-catenin, it is possible that L-CAM
expression also helps to regulate the level of P-catenin by binding to its cytoplasmic
tail, hence modulating the P-catenin pool. In the parenchymal cells immediately
subjacent to the growth zone, both L-CAM and P-catenin become intensified at sites
with cell - cell surface interactions and reduced in free cell surfaces. This change of cell
adhesion allows cells to move from a homogenous adhesive environment to one with
enhanced adhesion in polarized sub-cellular regions (Sorkin et al., 1991). It is probably
a prelude to cellular re-arrangements required to build the liver architecture (Jamora et
al., 2003). Indeed, over-expressing DN-LEF1 or DKK could turn off the expression of
L-CAM and resulted in a lack of hepatic cord formation.
The elongations of the limb and feather are driven by specific localized growth
zones. In this work we show that the expansion of the liver is also driven by temporally
and spatially specific growth zone activity. We further showed the activity of p-catenin
is critical for this activity. However, there are likely to be more molecules involved in
regulating this growth zone activity. The current work sets the groundwork for these
future studies.
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
44
Fig. 2-8. [3-catenin in the morphogenesis and histogenesis of the liver. (A)
Morphogenesis. Schematic showing the distribution of P-catenin corresponds to the
LoGZ. P-catenin expression was up-regulated where the liver was induced at E2 (a),
increased throughout the liver bud at E4 (b), shifted to the periphery at about E6 (c), and
then became restricted to specific growth zones at about E8 (d). The strategic location
of LoGZ can influences the shape and size of the liver (e). Elevated expression of p-
catenin leads to overall enlarged livers (f) or an expanded growth tip (g, less frequency).
Blocking P-catenin activity leads to a reduction in size of the liver (h). (B) Histogenesis.
Schematic diagram show the arrangement of hepatocytes and precursors (blue color)
from the periphery to the center of the liver (in the indicated rectangular area from A).
At the periphery in the LoGZ, the proliferating hepatocyte precursors are not yet
organized and are flanked by an outside layer of flat layer cells (green) and an inside
layer of mesenchymal cells (red color) (a). At stage (b), cell clusters begin to form and
are organized into acini in the subperipheral area (c). Toward the center the liver, the
hepatocytes are organized into hepatic cords and the cords are sandwiched by
endothelial cells (d).
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
Histogenesis Morphogenesis
45
v = Growth zones
Normal
increase
B-catenin
increase
P-catenin
Block
P-catenin
r S & S ;
. v . ; <
siva
Global E xpanded
H epatom egaly Lobe Tip
R educed
Liver size
sinusoi
endothelium
Growth Cell Acini-like
zone cells clusters arrangements
Hepatocyte Early Late
Precursor Hepatocyte Hepatocyte
Stem Cells
Hepatic cords
Differentiated
Hepatocyte
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
46
2.5 Acknowledgements
We thank Mr. David Huang for help in this work and Ms. Maji Ramos and Fiona
McCulloch for the preparation of the manuscript; Dr. Neil Kaplowitz and Dr. Hide
Tsukamoto for constructive comments and support; and Joe Lin and Zhicao Yue for
discussions in solving technical problems. We are grateful to Dr. Randy Johnson for
RCAS (3-catenin, Dr. Tabin for DN-LEF1, Dr. Andrew Lassar and Dr. Sarah Millar for
DKK, and Dr. William Pavan for RCAS Gateway cloning vector. This study was
supported by grants from NIDDK P30 DK048522 (the USC Research Center for Liver
Diseases), NIH AR42177, AR47364 (CMC) and NCI CA83716 (RW). Sanong
Suksaweang is supported by the Royal Thai Government Scholarship from Thailand.
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
47
2.6 References
Cadoret, A., Ovejero, C., Saadi-Kheddouci, S., Souil, E., Fabre, M., Romagnolo, B.,
Kahn, A., 2001. Hepatomegaly in transgenic mice expressing an oncogenic form of (3 -
Catenin. Cancer Res. 61, 3245-3249.
Capdevila, J., Tabin, C., Johnson, R.L., 1998. Control of dorsoventral somite patterning
by Wnt-1 and (3-Catenin. Dev. Biol. 193, 182-194.
Carlson, B.M., 1999. Formation of the liver. In “Human embryology & developmental
biology”, pp. 337-347. Mosby, Missouri.
Chen, T., Yang, I., Irby, R., Shain, K.H., Wang, H.G., Quackenbush, J., Coppola, D.,
Cheng, J.Q., Yeatman, T.J., 2003. Regulation of caspase expression and apoptosis by
adenomatous polyposiscoli. Cancer Res.63, 4368-4374.
Chodankar, R., Chang, C.H., Yue, Z., Jiang, T.X., Suksaweang, S., Burrus, L.W.,
Chuong, CM., Widelitz, R.B., 2002. Shift of Localized Growth Zones Contributes to
Skin Appendage Morphogenesis: Role of the Wnt/-catenin Pathway. JID. 120, 20-26.
Chuong, C.M., 1998. Morphogenesis of epithelial appendages: Variations on top of a
common theme and implications in regeneration. In “Molecular basis of epithelial
appendage Morphogenesis” (C M. Chuong, Ed), pp. 1-13. R.G. Landes company,
Texas.
Chuong, C M., Chodankar, R., Widelitz, R.B., Jiang, T.X., 2000. Evo-devo of feathers
and scales: building complex epithelial appendages. Curr. Opin. Genet. Dev. 10, 449-
456.
Field, H.A., Ober, E.A., Roeser T., Stainier, D.Y., 2003. Formation of digestive system
in zerafish. I. Liver morphogenesis. Dev. Biol. 253, 279-290.
Gallin, W.J., Edelman, G.M., Cunningham, B.A., 1983. Characterization of L-CAM, a
major cell adhesion molecule from embryonic liver cells. Proc. Natl. Acad. Sci. 80,
1038-1042.
Glinka, A., Wu, W., Delius, H., Monaghan, A.P., Blumenstock, C., Niehrs, C., 1998.
Dickkopf-1 is a member of a new family of secreted proteins and functions in head
induction. Nature 391, 357-362.
Gumucio, J.J., Berkowitz, C.M.,Webster, S.T., Thornton, A.J., 1996. In “Liver and
biliary diseases” (N. Kaplowitz, Ed), pp. 3-19. Williams & Wilkins, Maryland,.
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
48
Hamburger, V., Hamilton, H.L., 1951. A series of normal stages in the development of
the chick embryo. J. Morphol. 88, 49-92 (reprinted in Dev. Dyn. 1992. 195, 231-272).
Harada, N., Miyoshi, H., Murai, N., Oshima, H., Tamai, Y., Oshima, M., Taketo, M.M.,
2002. Lack of tumorigenesis in the mouse liver after adenovirus-mediated expression of
a dominant stable mutant of (3-Catenin. Cancer Res. 62, 1971-1977.
He, T-C., Sparks, A.B., Rago, C., Hermeking, H., Zawel, L., Costa, L.T., Morin, P.J.,
Vogelstein, B ., Kinzler, K.W., 1998. Identification of c-Myc as a target of the APC
pathway. Science 281, 1509-1512.
Hogan, B.L.M., 1999. Morphogenesis. Cell 96, 225-233.
Ishigaki, K., Namba, H., Nakashima, M., Nakayama, T., Mitsutake, N., Hayashi, T.,
Maeda, S., Ichinose, M., Kanematsu, T., Yamashita, S., 2002. Aberrant localization of
beta-catenin correlates with overexpression of its target gene in human papillary thyroid
cancer. J. Clin. Endocrinol. Metab. 87, 3433-3440.
Jamora, C., DasGupta, R., Kocieniewski, P., Fuchs, E., 2003. Links between signal
transduction, transcription and adhesion in epithelial bud development. Nature 422,
317-322.
Jeng, Y.M., Wu, M.Z., Mao, T.L., Chang, M.H., Hsu, H.C., 2000. Somatic mutations of
p-catenin play a crucial role in the tumorigenesis of sporadic hepatoblastoma. Cancer
Lett. 152, 45-51.
Jiang, T.X., Stott, N.S., Widelitz, R.B., Chuong, C.M., 1998. Current methods in the
study of avian skin appendages. In “Molecular basis of epithelial appendage
Morphogenesis” (C.M. Chuong, ed), pp. 395-408. R.G. Landes company, Texas.
Johnson, R.L., Tabin, C.J., 1997. Molecular models for vertebrate limb development.
Cell 90, 979-990.
Jung, J., Zheng, M., Goldfarb, M., Zaret, K.S., 1999. Initiation of mammalian liver
development from endoderm by fibroblast growth factors. Science 284, 1998-2002.
Kengaku, M., Capdevila, J., Rodriguez-Esteban, C., De La Pena, J., Johnson, R.L.,
Belmonte, J.C.I., Tabin, C.J. 1998. Distinct WNT pathways regulating AER formation
and dorsoventral polarity in the chick limb bud. Science 280, 1274-1277.
Le Douarin, N.M., 1975. An experimental analysis of liver development. Med. Biol. 53,
427-455.
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
49
Loftus, S.K., Larson, D.M., Watkins-Chow, D., Church, D.M., Pavan, W.J. 2001.
Generation of RCAS vectors useful for functional genomic analyses. DNA Res. 8, 221-
226.
Lu, J., Chuong, C.M., Widelitz, R.B., 1997. Isolation and characterization of chicken (3 -
Catenin. Gene 196, 201-207.
Michalopoulos, G.K., 1990. Liver regeneration: molecular mechanisms of growth
control. FASEB J. 4, 176-87.
Monga, S.P., Pediaditakis, P., Mule, K., Stolz, D.B., 2001. Michalopoulos GK. Changes
in Wnt/p-Catenin pathway during regulated growth in rat liver regeneration. Hepatology
33,1098-1109.
Monga, S.P., Monga, H.K., Tan, X., Mule, K., Pediaditakis, P., Michalopoulos, G.K.,
2003. (3-Catenin antisense studies in embryonic liver cultures: Role in proliferation,
apoptosis, and lineage specification. Gastroenterology 124, 202-216.
Murphy-Ullrich, J.E., 2001. The de-adhesive activity of matricellular proteins: is
intermediate cell adhesion an adaptive state? J. Clin. Invest. 107, 785-790.
Orford, K., Orford, C.C., Byers, S.W., 1999. Exogenous expression of P-catenin
regulates contact inhibition, anchorage-independent growth, anoikis, and radiation-
induced cell cycle arrest. J. Cell Biol. 146, 855-867.
Pandur, P., Lasche, M., Eisenberg, L.M., Kuhl, M., 2002. Wnt-11 activation of a non-
canonical Wnt signalling pathway is required for cardiogenesis. Nature 418, 636-641.
Polakis, P., 2000. Wnt signaling and cancer. Genes Dev. 14, 1837-1851.
Rossi, J.M., Dunn, N.R., Hogan, B.L.M., Zaret, K.S., 2001. Distinct mesodermal
signals, including BMPs from the septum transversum mesenchyme, are required in
combination for hepatogenesis from the endoderm. Genes & Dev. 15, 1998-2009.
Saito, T., Oda, Y., Sakamoto, A., Tamiya, S., Kinukawa, N., Hayashi, K., Iwamoto, Y.,
Tsuneyoshi, M., 2000. Prognostic value of the preserved expression of the E-cadherin
and catenin families of adhesion molecules and of P-Catenin mutations in synovial
sarcoma. J. Pathol. 192, 342-350.
Saitoh, T., Mine, T., Katoh, M., 2002. Expression and regulation of WNT8A and
WNT8B mRNAs in human tumor cell lines: up regulation of WNT8B mRNA by beta-
estradiol in MCF-7 cells, and down-regulation of WNT8A and WNT 8B mRNAs by
retinoic acid inNT2 cells. Int. J. Oncol. 20, 999-1003.
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
50
Sorkin, B.C., Gallin, W.J., Edelman, G.M., Cunningham, B.A., 1991. Genes for two
calcium-dependent cell adhesion molecules have similar structures and are arranged in
tandem in the chicken genome. Proc. Natl. Acad. Sci. 88, 11545-11549.
Tickle, C., Wolpert, L., 2002. The progress zone -- alive or dead? Nat. Cell. Biol. 4,
E216-217.
Utsunomiya, T., Doki, Y., Takemoto, H., Shiozaki, H., Yano, M., Sekimoto, M.,
Tamura, S., Yasuda, T., Fujiwara, Y., Monden, M., 2001. Correlation ofbeta-catenin
and cyclin D1 expression in colon cancers. Oncology 61, 226-233.
Vessey, C.J., Hall, P.M., 2001. Hepatic stem cells: A review. Pathology, 33, 130-141.
Wang, X., Montini, E., Al-Dhalimy, M., Lagasse, E., Finegold, M., Grompe, M., 2002.
Kinetics of liver repopulation after bone marrow transplantation. Am. J. Pathol. 161,
565-574.
Warren, M.F., Hamilton, P.B., 1981. Glycogen storage disease type X caused by
ochratoxin A in broiler chickens. Poult. Sci. 60, 120-123.
Weeraratna, A.T., Jiang, Y., Hostetter, G., Rosenblatt, K., Duray, P., Bittner, M., Trent,
J.M., 2002. Wnt5a signaling directly affects cell motility and invasion of metastatic
melanoma. Cancer Cell 1, 279-288.
Wei, Y., Fabre, M., Branchereau, S., Gauthier, F., Perilongo, G., Buendia, M.A., 2000.
Activation ofbeta-catenin in epithelial and mesenchymal hepatoblastomas. Oncogene
19, 498-504.
Widelitz, R.B., Jiang, T.X., Lu, J., Chuong, C.M., 2000. p-Catenin in epithelial
morphogenesis: Conversion of part of avian foot scales into feather buds with a mutated
P-Catenin. Dev. Biol. 219, 98-114.
Zaret, K.S., 2000. Liver specification and early morphogenesis. Mech. Dev. 92, 83-88.
Zaret, K.S., 2002. Regulatory phases of early liver development: paradigms of
organogenesis. Nat. Rev. Genet. 3, 499-512.
Zechner, D., Fujita, Y., Hulsken, J., Muller, T., Walter, I., Taketo, M. M., Crenshaw,
III, E.B., Birchmeier, W., Birchmeier, C., 2003. P-Catenin signals regulate cell growth
and the balance between progenitor cell expansion and differentiation in the nervous
system. Dev. Biol. 258, 406-418.
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
51
Chapter 3
BMP-4 signaling is involved in the endothelial-hepatocyte interaction during
histogenesis organization of the hepatic cords:
Abstract:
It has been shown that endothelial cells can promote liver organogenesis. However, the
molecules that may guide the formation of the hepatic cords have never been examined.
We showed here that BMP-4, one of the signals from endothelial cells is pivotal for the
formation of the liver cords. In over-expression studies, we showed that increased levels
of BMP-4 protein enhanced the differentiation of the liver cells and led to the
precocious formation of the hepatic cords. In contrast, inhibiting the BMP signal by
over-expressing noggin, a BMP-antagonist delayed hepatic cord formation, resulting in
premature hepatic cords accumulation. In vitro studies suggest that BMP-4 may be
needed to maintain the integrity of the endothelial network. Therefore, we conclude that
BMP-4 is one of the essential signals from endothelial cells to that help liver cells form
the mature hepatic cords.
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
52
3.1 Introduction
The liver, in some form, is present in all vertebrates from the primitive
cyclostomes and is composed of broad sheets of cells (hepatic cords) which are
connected with each other tightly in particular structures called “a muralium” (Hamilton
et al., 1976). The cord is carefully organized at each step during liver organogenesis. It
is seen under the microscope as a labyrinth of cells covered almost throughout the liver
by the flattened mesenchymal sinusoidal endothelial cells, MSECs (Fig. 1 A, E6-arrow
and E5-QE-arrow) but not at the periphery of the liver where new liver cells are being
generated (Fig. 1A-E4Q or 12Q) during embryogenesis. These two cell types are
closely associated with each other and are necessary for the formation of these unique
liver cords. Many studies have widely examined the induction of the liver or
regeneration (Michalopoulos and DeFrances, 1997; Jung et al., 1999; Zhang et al.,
2004,). However, detailed information regarding the development of the hepatic cord
has not been clearly investigated at the molecular level.
Bone morphogenetic proteins, BMPs, have been shown to be involved in the
induction of the liver primordium (Rossi et al., 2001). The process recently has unveiled
the functions of Hex and BMP-2 during hepatoblast induction (Zhang et al., 2004).
However, the detailed signal(s) that may continue to help create the functional unit of
the liver, the hepatic cord, during histogenesis are not clear. The role of endothelial cells
in promoting liver organogenesis prior to vascular function has been reported
(Matsumoto et al., 2001). But the question is what signals existing in the endothelium
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
53
help the formation of the hepatic cords during later organogenesis? Many studies will
reveal the mechanism underlying liver morphogenesis of different organisms in the near
future (Lemaigre and Zaret, 2004).
The formation of the hepatic cords is the process of rearranging unorganized
liver cells into the organized cluster of cells including both hepatic cells and
mesenchymal cells. In this case, we think that MSECs represent mesenchymal cells.
The functional units serve as the metabolism factory producing proteins for liver
function as well as sites of major storage for glycogen and the place for detoxification.
Recently, we have just shown that p-catenin controls liver size by managing the
shift of localized growth zones (LoGZ) during organogenesis (Suksaweang et al., 2004;
Chapter 2). The expanded precursor cells then gradually form the hepatic cords when
they are situated within the differentiated area. It would be very interesting to know
how these cells were organized into such a characteristic arrangement found only in the
liver. What molecule(s) are the organizer(s), trigger(s), or guide? What molecule(s)
control the process of positioning each cell type into the cord? It is conceivable that the
liver cells communicate with each other at the LoGZ and with the MSEC through some
signals and manage to build the liver unit afterward.
We hypothesize that a BMP-4 signal from the endothelium may inhibit the
proliferation of the liver cells and instead, promote their specialized processes,
migration, organization, and differentiation. Therefore, evaluating the developmental
process would provide insights as to how we may apply this knowledge to create a
functional artificial liver or help us to better understand the pathology of liver diseases.
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
54
Indirectly, therefore it is possible to postulate that the endothelial cells act as the
organizer and interact with the unorganized group of liver cells to guide them to form
functional hepatic cords, properly. To investigate the role of BMP-4 during the process,
we took advantage of using the RCAS vector to deliver BMP-4 exogenously and
constitutively during chicken embryogenesis. We found the prominent effect of BMP-4
was an enhancement of liver differentiation. In contrast, differentiation was suppressed
when BMP activity was blocked using its inhibitor, Noggin.
3.2 Materials and methods
In situ hybridization
Whole mount and section in situ hybridization was used to detect the
distribution of mRNA from chicken embryos at different H&H stages (Hamburger and
Hamilton, 1951-16). Both protocols were performed using the whole mount in situ
hybridization protocol as described (Jiang et al., Chapter 20, 1998-17) with the
following modification for the section in situ hybridization. Washes were reduced to 2-5
minutes before the hybridization step and 30 minutes after the hybridization. Treatment
with proteinase K was increased up to 20 minutes for older stage embryos.
Histology and Immunohistochemistry
In order to observe microscopic phenotypes, the embryos were sectioned to 5-6
pm and H&E and immunohistochemistry staining were performed as described (Jiang
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
55
et al., Chapter 20, 1998-17). The antibodies, anti-(3-catenin (Sigma, St. Luis, MO), anti-
LCAM, anti-PCNA, anti-QE (QH-1) and anti-Vimentin were obtained from the
Developmental Studies Hybridoma Bank developed under the auspices of the NICHD
and maintained by The University of Iowa, Department of Biological Sciences, Iowa
City, IA 52242.
Reverse Transcription Polymerase Chain Reaction (RT-PCR)
The mRNA was extracted with the RNeasy Protection kit (Qiagen, Valencia,
CA). AMV reverse transcriptase (Roche, Indianapolis, IN) was used for reverse
transcription and PCR was performed using the protocol recommended by the
manufacturer (Panvera, Madison, WI). The final PCR products were electrophoresed on
1% polyacrylamide gels for one hour. The bands were visualized by adding 10 pg/ml
ethidium bromide into the gel and observed under UV light.
Primers:
BMP-4 (288 bps)
BMP-4 sense primer, CCAAAGCCATGAACTCTTGC
BMP-4 antisense primer, GCTGAGGTTGAAGACGAAGC
GAPDH (466 bps)
GAPDH sense primer, GGCGAGATGGTGAAAGTCG
GAPDH antisense primer, CAGTTGGTGGTGCACGATG
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
56
RCAS Viral Production
E7 chicken embryonic fibroblasts (CEFs) were plated onto 10 cm dishes. RCAS
- BMP-4 or Noggin was transfected into the cells at 70% confluence using calcium-
phosphate precipitation and virus was prepared as described (Jiang et al., 1998-17).
However, to increase the viral titer, virus containing supernatants were centrifuged at
12,000 rpm for 30 minutes and kept on ice prior to injection.
In Ovo microinjection
For experimental manipulation in ovo, eggs were incubated in a humidified
chamber at 38°C for three days. The eggs were sterilized with 70% ethanol and a 15-
20mm diameter window was made. Stage 20-21 embryos were microinjected with 5-10
pi of virus into the body cavity between the developing heart and the gizzard where the
liver starts. The windows were closed with scotch tape and the eggs were placed back in
the humidified incubator as described (Jiang et al, 1998-17). The virus was tested for
exogenous-induced BMP activity by injection to the beak and observing a change in the
FNM process (Wu et al., 2004).
Periodic Acid Shiff (PAS) staining
To verify hepatocyte differentiation status, glycogen was detected using the PAS
method (Warren and Hamilton, 1981-19) as recommended by the manufacturer (Sigma,
St. Luis, MO). Briefly, sections were deparaffinized, rehydrated, immersed in Periodic
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
57
Acid Solution for 5 minutes at room temperature (18-25 °C), rinsed through several
changes of distilled water and immersed in SchifFs reagent for 15 minutes at room
temperature. The slides were washed in running tap water for 5 minutes, counterstained
with Hematoxylin Solution, Gill No. 3 for 90 seconds, rinsed again, dehydrated, cleared
and mounted.
3.3 Results
3.3.1 The scaffold of the liver consists of a network of endothelial cells:
The chicken liver starts as a small bud engulfing the vitelline blood vessel (Fig.
3-1A) and gradually grows outward increasing its size overtime (Fig. 3-1B-D). The
formation of hepatic cords is also hierarchically arranged according to developmental
stage (Fig. 3-1 A’-D’). We searched for something that can reveal the network of the
endothelial cells and found that anti-quail endothelial antigen (QE) stained the
endothelial cells nicely. The maximum projection of whole-mount shows the big blood
vessels and the sprouting of the endothelial scaffold (Fig. 3-1E-G). The empty space is
actually the surrounded liver cells (Fig. 3-1G, inset and arrowhead). These endothelial
cells are also positive for fibronectin (FN) and vimentin (Vim) as seen in Fig. 1H and
II. The liver cells were revealed when the nuclei were stained with red fluorescent-PI
(Fig. 3-1 J, K, N, and O). The hepatocyte differentiated marker, albumin, was negative
in the LoGZ (Fig. 3-1P-Q) and positive toward the center of the liver (Fig. 3-1R). The
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
58
late differentiation marker, glycogen, was found to be positive slightly later than
albumin (Fig. 3-1S-U).
3.3.2 The expression patterns of the BMP pathway members during liver
morphogenesis
To search for possible important signal(s) that may influence hepatic cord
formation we looked for genes expressed along the hierarchical arrangement of the
hepatic cords. By using in situ hybridization, we were able to identify the expression of
the BMP-4 transcript in an early liver bud (Fig. 3-2, upper row E4-7). The expression of
BMP-4 was significantly high in newly formed liver buds (Fig. 3-2, E6-*). The
expression pattern gradually decreased, as the liver grew bigger, particularly at the
differentiated region. To look at the cellular level, we performed section in situ
hybridization or cut the sections from wholemount specimens. BMP-4 was found to be
positive strongly in both mesenchymal cells and liver cells in the LoGZ (Fig. 3-2, BMP-
4 left and middle). In the non-LoGZ or differentiated center, however, the expression
was gradually decreased and disappeared in the liver cells but remained high in the
mesenchymal-sinusoidal-endothelial cells (MSEC, Fig. 3-2, and BMP-4 right).
The expression of BMP receptors was also found on both mesenchymal cells
and liver cells in the LoGZ whereas the non-LoGZ regions remained only in the
mesenchymal cells. Some of its known downstream signals, Msx-1, Msx-2 were found
to have a similar expression pattern (data not shown). On the other hand, the known-
BMP antagonist, Noggin is found in the mesenchyme (Fig. 3-2, Noggin). Gremlin and
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
59
follistatin were also found exclusively in mesenchymal cells (data not shown). In
addition, we observed the expression of the Eph receptor tyrosine kinase member,
ephrin-Bl (Fig. 3-2, ephrin-Bl).
3.3.3 Development of mesenchymal sinusoidal endothelial cells (MSECs) and their
interaction with hepatocytes
In early liver bud formation, the spindle cells with bulging nuclei are lined up
around the hepatic cords from level a (LoGZ) to b (nascent cords) and to c (mature
cords). This cell type is important for the formation of the functional unit acting as the
fundamental scaffold of the livers. By using antibody against the endothelial specific
antigen for quail, we were able to show the scaffold of these endothelial cells as a
continuous network of MSEC (Fig. 3-1, QEs). The liver cells were arranged into a cord
like structure once they are surrounded by the MSEC (Fig. 3-1, Red nuclei).
Between the sheets of MSECs, the narrow path of the blood vessel like space
was created. The hematopoietic cells travel through this channel (Fig. 3-1).
Interestingly, the MSECs were absent in the LoGZ or periphery of the liver. It is
possible that the origin of the outermost mesenchymal cells was derived from a
different source of MSECs. However, we are not quite sure if this cell also contributes
to the hepatic stellate cells (HSC) in the chicken. These cells express, desmin, GFAP
(Cassiman et al., 2002) and vimentin as well (Fig. 3-1, E5Vim).
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
60
Figure 3-1. Endothelial cells serve as a scaffold for the liver
(A-D, A’-D’) the H&E staining of livers at low and high magnification were taken from
E3-E6 embryos respectively. Note the hierarchical formation of hepatic cord from
unorganized (E3) to organized (E6). (E-G) the wholemount immuno-fluorescent
staining of quail endothelial (QE) specific antigen pictured from E4, E5 and E6. Green
is the FITC signal viewed by confocal microscopy. (H) a section immuno-fluorescent
staining of FN at E3. (J-K, N) the QEs of E5 and E6 viewed with the nuclei stained red
(propidium iodide, PI). (O) a wholemount QE of El 2 liver. (L, M) are the section of
E3.5 quail embryo stained with QE. (P-R) are the albumin mENA of E4, E5 and E6
respectively. (S-U) are the glycogen staining of the corresponding ages (P-R).
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
Glycogen Albumin Q E Q E Q E H&E
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
Figure 3-2. The expression of BMP pathway members and ephrin-Bl
62
The first row is WISH of BMP-4 mRNA at E4-7. The second row is SISH of BMP-4
mRNA of E7 at low magnification (left), high magnification of the periphery (middle)
and high magnification of the center (right) respectively. The third row is SISH of
Noggin, BMP antagonist, at low magnification (left), high magnification of the
periphery (middle) and high magnification of the center (right). The forth row is SISH
of BMPR-I at low and high magnification. The fifth row is SISH of ephrin-Bl at low
and high power.
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
ephrin-B1 BMPR-I Noggin BMP-4 BMP-4
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
3.3.4 Inhibition study: Effect of Noggin on avian hepatogenesis
64
To suppress the BMP pathway, we over-expressed exogenous Noggin using
RCAS-Noggin injected into embryonic day 3 embryos as previously described (Jiang et
al., 1998). The enlargement of the liver was observed 75% of the time (9 out of 12
samples). Often times, the embryos died before E l5. Therefore, we used earlier staged
injected embryos for this analysis. The livers from over-expressing samples were
enlarged (Fig. 3-3, whole-mount). The H&E section showed that the hepatic cords
could be observed (Fig. 3-3, overview and Peri), but the cord seemed premature
compared to the control, especially at the center of the liver, lacking thickened
mesenchymal cells and a bile duct as well (Fig. 3-3, center). Moreover, in the severe
phenotype, we observed that a large number of liver precursor cells (high ratio of N to
C with glycogen negative) remained high and not well organized compared to the
control (Fig. 3-3, inset).
3.3.5 Over-expression study: Effect of BMP-4 on avian hepatogenesis
The function of BMP has been shown to be threshold concentration dependent
(Jones and Smith, 1998). Therefore, to keep the levels of BMP-4 high throughout the
duration of the experiment we injected RCAS vector carrying BMP-4 into E3 chicken
embryos (see method). In parallel studies, we also administered BMP-2/4 protein
soaked beads to hepatogenic epithelial cells of E2 embryos. The H&E section showed
that the hepatic cords could be clearly observed (Fig. 3-4, overview and Peri), but the
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
65
cord seemed arranged tighter than the control especially at the center of the liver.
Thickened of mesenchymal cells was also evident (Fig. 3-4, center).
Figure 3-3. The inhibition study using RCAS-Noggin
The first row is whole-mount views of control and RCAS-Noggin mis-expressing
dissected livers. The overview of H&E staining is shown on the second row. The higher
magnification of H&E staining is also shown at two different locations, Periphery (Peri)
and at the center of the liver (Center).
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
Center Peri Overview Whole-mount
66
Ctrl RCAS-Noggin
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
67
Figure 3-4. The mis-expression of BMP-4 study
The first row is the whole-mount views of control and livers over-expressing BMP-4,
respectively. The overview of H&Els shown on the next row. The corresponding
higher magnifications are shown below from the periphery (Peri) and center of the liver
(Center).
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
Ctrl RCAS-BMP-4
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
69
The results for the bead studies paralleled the retroviral BMP-4 over-expression studies,
producing over-differentiation (data not shown). Staining with AMV-3C2 showed the
distribution of the virus (Fig. 3-6). In contrast to the RCAS-Noggin samples, BMP-4
over-expressing samples showed that the proliferative activity was halted with low level
of (3-catenin and LCAM (remained only in the cell membrane: Fig.3-5, LCAM and p-
catenin). More importantly, the level of glycogen was markedly increased in the BMP-4
over-expression specimens compared to control and Noggin over-expression specimens
(Fig. 3-5, glycogen).
We also examined the distribution of mesenchymal cells in over-expressing
livers. We observed that the number of vimentin positive cell layers surrounding big
blood vessels was markedly increased compared to the control (Fig. 3-5, Vim).
However, we did not see any change in albumin expression (Fig. 3-5, Alb). This may be
because virus production starts later than the induction of the albumin gene. The size of
the liver in Noggin samples is much bigger than controls but of a smaller size in BMP-4
over-expressing samples (Fig. 3-6, liver weight). It is conceivable that BMP-4 can block
the mass production of the liver by maximizing the level of differentiation of the liver
cells by increasing the amount of glycogen.
In addition, more importantly, the integrity of the endothelial scaffold was
maintained nicely by BMP-4 during the liver explant cultures. The arrangement of
endothelial cells was observed until, at least, after 48 hours of culturing. However, the
derangement happened swiftly if we added Noggin beads instead compared to the
control (Fig. 3-7).
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
Figure 3-5. The analysis of affected liver
70
Left panels were taken from control sections, middle panels were taken from RCAS-
BMP-4 over-expressing sections and right panels were taken from RCAS-Noggin mis-
expressing sections respectively. Vimentin staining is shown as an overview, at the
periphery (peri) and the center. Staining for LCAM (brown), p-catenin (brown),
glycogen (pink) and albumin (blue) are also shown.
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
71
E
£
a)
< D
>
o
E
0) ^
Q. • • # ■ -
Control RCAS-BMP-4 RCAS-Noggin
lill * ?
£ * 4 f_
Ii
V
•* a
% ^
» u = 3#-
r>
V ^
%
. " C
■ > • i .’ ’ V~. -
" " *
f* . . . : - ' 1
•v*-
i
r
^ f if§j
v*., /
* f**
" 1 si
P;:a^
■ # I L
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
Figure 3-6. MSECs were increased in BMP-4 over-expressing livers
72
(A) The left diagram shows the ratio of endothelial cells to liver cells per field of the
control, RCAS-BMP-4 and RCAS-Noggin affected livers respectively. The right
diagram shows the liver weight taken from control (n = 3), RCAS-BMP-4 (n = 3) and
RCAS-Noggin (n = 3) respectively. (B) The virus distribution is shown using both
RCAS-GFP and AMV-3C2 staining.
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
R atio value (E/H)
73
RCAS-Noggin
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
74
Figure 3-7. MSECs need BMP-4 to maintain their vascular network integrity
Several beads were put surrounding and adjacent to the LoGZ. Left panel are BSA
dissected livers stained with QE antibody and visualized with FITC conjugated
secondary anti-mouse antibodies. Red colors are nuclei stained with PI. Middle and
right panels are taken from BMP-4 and Noggin beads treated samples respectively.
BSA BMP-4 Noggin
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
75
3.4 Discussion
The hepatic cords are crucial for liver functions, such as detoxification, protein
production and sugar level control (Sage et al., 1999). Liver cancer and hepatitis are the
major causes of death from liver diseases due to severe liver failure. There is one way
that could cure the diseases effectively, that is liver transplantation. However, the
availability of livers for this purpose is very scant. Therefore, it would be invaluable if
we could provide artificial organs “to-go” in the future for patients who are really in
need.
The study of molecular mechanisms controlling the organogenesis thus is
inevitably in high demand. The question is how can we reproduce this structure in
vitro? One investigation studied- liver histogenesis, which provided the structure of the
parenchyma called hepatic cords in hepatic organoid cultures (Michalopoulos et al.,
2003). It has been shown that FGFs and BMP-4 are important for the initiation of the
liver (Rossi et al., 2002; Zhang et al., 2004). However, subsequent histogenetic
processes have never been addressed in detail.
3.4.1 Hepatic cord histogenesis requires a series of epithelial morphogenetic events.
During careful examination of the H&E sections of different staged livers, we
observed an intriguing phenomenon of epithelial cells changing their morphology. This
is the typical process involved in building the classical characteristic architecture of the
liver, the hepatic lobule (Ekataksin and Wake, 1991). As reported in our earlier work,
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
76
the precursor cells exercise high proliferative activity in order to generate the liver mass
(Suksaweang, et al., 2004, Chapter 2). These newly divided cells accumulate and
congregate at the periphery of the liver in localized growth zones {LoGZ). They are not
well organized (Fig. 3-8, a). Right next to this group of cells, the spheroid-like structure
of an early-organized hepatic cord can be seen with the beginning of MSEC attachment
(Fig. 3-8, b). Finally, these cells will rearrange themselves into well-organized hepatic
cords, always surrounded by MSECs (Fig. 3-8, c). It is very interesting to see that once
hepatocytes in “a” are exposed to the MSEC they begin to form hepatic cords. We
would therefore hypothesize that some important signal(s) might be generated by this
contact. Then the reciprocal interaction might lead to the formation of a more mature
structure. A detailed study in the future would help us understand the process in much
more detail.
3.4.2 MSEC-hepatocyte interactions accelerate the differentiation
Hepatocyte precursor cells transiently express BMP-4 in the LoGZ. This may
involve the autocrine activity of hepatocytes as seen in BMP-2 expression (Zhang et al.,
2004). However, details of the BMP-4 signal in the LoGZ remain to be examined
further. In the LoGZ, we would imagine that the interaction would be between the
outermost mesenchymal cells and liver precursor cells and among liver precursor cells
(Hepatic-hepatic, H-H). Then in the next step, the MSECs express high levels of BMP-4
all along the histogenesis of the hepatic cord. We reported that BMP-4 helps
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
77
mesenchymal precursor cells expand their mass in beak formation (Wu et al., 2004).
The effect of BMP-4 may be different in either mesenchymal cells or epithelial cells. In
fact, there are two different promoter regions that control the expression of BMP-4 in
different cell types. The region between 0.26 kb to 1.1 kb of the BMP-4 promoter
controlled the expression of BMP-4 in epithelium-derived ameloblasts. By contrast, the
domains controlling BMP-4 expression in mesenchyme-derived odontoblasts and pulp
cells exist in the other regions (Feng et al., 1994). Thus, the expression of BMP-4 can
be shifted from one cell type to another. In different organs, this molecule may play
different roles. As expected, we found the expression of this molecule shifted from both
epithelial cells and mesenchymal cells in the LoGZ to only mesenchymal cells in the
center, differentiated region.
Sequential and reciprocal epithelial-mesenchymal interactions are the key for
organogenesis (Chuong, 1998). Cardiac mesenchymal cells give FGFs and the septum
transversum mesenchymal cells generate the BMP-4 signal that can be coordinated to
induce the albumin gene in the hepatic endoderm (Rossi et al., 2001; Kiefer 2003).
Once the hepatoblast or liver stem cells are initiated, these cells have to proliferate and
generate liver mass in which p-catenin plays a part by keeping this population expanded
(Monga et al., 2003; Suksaweang et al., 2004). However, if these cells were not directed
to become functional cells the liver would bear useless cells and never become a
functioning organ. The next important step for the cells is to obtain specialized
functions through the differentiation process. To achieve this, liver cells may be guided
and arranged into a proper functionable unit, the mature hepatic cord. This hierarchical
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
78
process, therefore, involves at least two types of cells, endothelial cells and liver cells
(Hepatic-endothelial, H-E). The maintenance of endothelial-endothelial cell contact as a
scaffold network would also not be less important (Endothelial-endothelial, E-E).
Figure 3-8. The model of hierarchical formation of the hepatic cords
Histogenesis: (a) The precursor or hepatoblast that is attached to the flattened
mesenchymal cells, (b) The early hepatocyte, which is starting to form immature cords,
nascent cords, (c) The late hepatocytes form mature cords covered by the MSECs.
Hepatocytes: The tentative sequence of examined genes expressed particularly on liver
cells. Endothelium: The tentative expression sequence of several genes stained on
MSECs.
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
Endothelium Hepatocytes H istogenesis
79
P-Catenin
BMP-4
Ephrin-B1
Alb
Glycogen
BMP4
m
sinusoi
(a)
Growth
Zone
Noggin
ndothelium
(MSEC)
(b)
Nascent
Cords
(c)
Mature
Cords
BMP-4
Noggin
Vimentin
Quail endo Ag
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
80
One of the important functions of hepatic cord cells is to become glycogen-
storing cell. We found that the process could be accelerated with high levels of BMP-4.
The intensity of glycogen staining was observed to be about 2-3 times higher than the
highest level staining in the control (Fig. 3-5). Also, when we blocked the BMP-4 signal
with its antagonist, Noggin, these cells remained at the precursor stage or early
hepatocytes, which remained negative of glycogen (Fig. 3-5). Taken together, we would
propose that the BMP-4 signal somehow enhances the unknown mechanism that can
help hepatocytes to hasten their differentiation. However, the process may not be
complete by having only the BMP pathway activated. Other molecules may be
involved. We have examined some of these factors by in situ hybridization and found
that ephrin-Bl is also expressed sequentially from the LoGZ to non-LoGZ areas. The
expression is very high in the LoGZ but gradually decreases in subLoGZ and disappears
in the center-mature hepatic cords.
We also would like to note that the level of bile in the BMP-4 over-expressing
livers seemed to be higher than the control (Fig. 3-4, whole-mount). In addition, the size
of the liver was reduced, which in turn gave a much lower liver weight compared to the
control. Therefore, it is possible that BMP-4 accelerates the liver differentiation process
causing liver organogenesis to stop prematurely and produce a smaller liver.
However, to fully understand the regulation of this process the following
questions have to be carefully examined. What contribution may have come from the
MSEC to the hepatic cord? Do MSECs send the signal to the associated liver cells to
mature? What kind of signal(s) do the MSECs use to communicate with liver cells
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
81
telling them to form hepatic cords? How can signals from the MSEC reach the right
target?
It has been shown in the human cell line that BMP-6, one member of the BMP
family is found to be associated with the liver endothelial cells (Zhong et al., 2004).
This evidence is just to affirm the importance of endothelial cells in liver development
or tumorigenesis. The expression of BMP-4 from cardiac mesoderm and the septum
transversum is to induce the liver stem cell hepatic endoderm to become hepatocytes
(Rossi et al., 2002). In this study, this protein can enhance the level of differentiated
markers, such as glycogen. In contrast, if we prolong exposing precursor cells with
Noggin at an early stage, those precursor cells will never become mature or late
hepatocytes but remain as hepatoblasts or early hepatocytes for a long time (Fig. 3-5).
However, in vivo study showed that liver cells are still able to express albumin as a
hepatocyte lineage marker. An explanation of this would be that most liver cells have
turned on the albumin gene when the over-expression of Noggin was effective.
3.5 Conclusion
Taken together, we would like to propose that the BMP-4 signal from the
sinusoidal endothelial cells is important for the maturation of the hepatic cord in avians.
Too much of the BMP-4 can hasten liver differentiation. In contrast, prolonged blocking
of the BMP signal can slow down the maturation process. Therefore, we would be very
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
82
interested in applying this information to study stem cells in order to produce high
quality mature hapatocytes for therapeutic purposes in the near future.
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
83
3.6 References
Cassiman, D., Libbrecht, L., Desmet, V., Denef, C., Roskams, T 2002. Hepatic stellate
cell/myofibroblast subpopulations in fibrotic human and rat livers. J Hepatol. 36, 200-
209.
Chuong, C.M., 1998. Morphogenesis of epithelial appendages: Variations on top of a
common theme and implications in regeneration. In “Molecular basis of epithelial
appendage Morphogenesis” (C.M. Chuong, Ed), pp. 1-13. R.G. Landes company,
Texas.
Ekataksin, W., Wake, K., 1991. Liver units in three dimensions: I. Organization of
argyrophilic connective tissue skeleton in porcine liver with particular reference to the
"compound hepatic lobule". Am J Anat. 191, 113-153.
Feng, J.Q., Harris, M.A., Ghosh-Choudhury, N., Feng, M., Mundy, G.R., Harris, S.E.,
1994. Structure and sequence of mouse morphogenetic protein-2 gene (BMP-2):
comparison of the structures and promoter regions of BMP-2 and BMP-4 genes.
Biochim. Biophys. Acta 1218, 221-224
Hamburger, V., and Hamilton, H.L., 1951. A series of normal stages in the development
of the chick embryo. J. Morphol. 88, 49-92 (reprinted in Dev. Dyn. 1992. 195, 231-
272).
Hamilton, Boyd, and H.W. Mossman. Human Embryology. Cambridge: Macmillan,
1976.
Jiang, T.X., Stott, N.S., Widelitz, R.B., Chuong, C.M., 1998. Current methods in the
study of avian skin appendages. In “Molecular basis of epithelial appendage
Morphogenesis” (C.M. Chuong, ed), pp. 395-408. R.G. Landes company, Texas.
Jones, C.M., Smith, J.C., 1998. Establishment of a BMP-4 morphogen gradient by long-
range inhibition. Dev Biol. 194, 12-17.
Jung, J., Zheng, M., Goldfarb, M., Zaret, K.S., 1999. Initiation of mammalian liver
development from endoderm by fibroblast growth factors. Science 284:1998-2002.
Kiefer, J.C., 2003. Molecular mechanisms of early gut organogenesis: a primer on
development of the digestive tract. Developmental Dynamics 228, 287-291.
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
84
Lemaigre, F., Zaret, K.S., 2004. Liver development update: new embryo models, cell
lineage control, and morphogenesis. Curr Opin Genet Dev. 14, 582-590.
Matsumoto, K., Yoshitomi, H., Rossant, J., Zaret, K., 2001. Liver organogenesis
promoted by endothelial cells prior to vascular function. Science, 294: 559-563.
Michalopoulos, G.K., DeFrances, M.C., 1997. Liver regeneration. Science 276, 60-66.
Michalopoulos, G.K., Bowen, W.C., Mule, K., Luo, J., 2003. HGF-, EGF-, and
dexamethasone-induced gene expression patterns during formation of tissue in hepatic
organoid cultures. GeneExpr. 11, 55-75.
Monga, S.P., Monga, H.K., Tan, X., Mule, K., Pediaditakis, P., Michalopoulos, G.K.,
2003. Beta-catenin antisense studies in embryonic liver cultures: role in proliferation,
apoptosis, and lineage specification. Gastroenterology 124, 202-216.
Rossi, J.M., Dunn, N.R., Hogan, B.L., Zaret, K.S., 2001. Distinct mesodermal signals,
including BMPs from the septum transversum mesenchyme, are required in
combination for hepatogenesis from the endoderm. Genes Dev. 15, 1998-2009.
Sage, P.B ., Bail, B.L., Balabaud, C., 1999 Oxford textbook of Clinical Hepatology
second edition volume 1 section 1-13 (J. Bircher, ed), pp 13-21. Oxford Medical
Publication, NY.
Suksaweang, S., Lin, C.M., Jiang, T.X., Hughes, M.W., Widelitz, R.B., Chuong, C.M.,
2004. Morphogenesis of chicken liver: identification of localized growth zones and the
role of beta-catenin/Wnt in size regulation. Dev. Biol. 266,109-122.
Warren, M.F., Hamilton, P.B., 1981. Glycogen storage disease type X caused by
ochratoxin A in broiler chickens. Poult. Sci. 60, 120-123.
Wu, P., Jiang, T.X., Suksaweang, S., Widelitz, R.B., Chuong, C.M., 2004. Molecular
shaping of the beak. Science 305, 1465-1466.
Zhang, W., Yatskievych, T.A., Baker, R.K., Antin, P.B., 2004. Regulation of Hex gene
expression and initial stages of avian hepatogenesis by Bmp and Fgf signaling. Dev
Biol. 268, 312-326.
Zhong, X., Ran, Y.L., Lou, J.N., Hu, D., Yu, L., Zhang, Y.S., Zhou, Z., Yang, Z.H.,
2004. Construction of human liver cancer vascular endothelium cDNA expression
library and screening of the endothelium-associated antigen genes. World J
Gastroenterol. 10, 1402-1408.
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
85
Chapter 4
Ephrin-Bl in feather morphogenesis:
The boundary establishment between epidermal domains
Abstract
The ephrin pathway has been shown to be involved in boundary formation in
tissue morphogenesis. Here we found that ephrin pathway members are expressed in
different stages of feather morphogenesis. We found ephrin-Bl is co-expressed with
one of its receptors, EphB3 during feather bud formation. Ephrin-Bl is expressed in
both epithelium and mesenchyme and EphB3 is restricted to the epithelium. Both take a
"de novo" mode of expression, appearing later than Shh in feather buds. They are then
expressed in feather filament epithelia and barb ridges at later stages. We explore their
roles with ephrin-Bl/Fc in blocking the reverse signaling of ephrin-Bl. We observed
three categories of phenotypes: blurred placode boundaries with loose dermal
condensations, incomplete follicle invagination with less compacted dermal papillae,
and irregular periodic barb ridge patterning. FGF can induce the expression of ephrin-
Bl. Thus, while suppression of ephrin-Bl does not inhibit the initial emergence of a
new epithelial domain (e.g., placodes, follicle wall, and barb ridges), the ephrin-Bl
pathway is required for its proper completion. We propose that the ephrin pathway is
involved in converting the reversible cellular equilibrium into stable tissue boundaries
during feather morphogenesis.
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
86
4.1 Introduction
During feather morphogenesis, a succession of new domains is generated
through interactions between epithelial and mesenchymal cells or among epithelial
cells, leading to the building of complex feather forms. In the beginning, the feather
field is composed of p-catenin positive competent epithelium and homogeneously
distributed NCAM positive mesenchyma (Jiang et al., 1999; Noramly et al., 1999;
Widelitz et al., 2000). Reaction diffusion involving FGF and BMP as activators and
inhibitors leads to the periodic arrangements of feather primordia (Widelitz et al., 1996;
Jung et al., 1998; Jiang et al., 1999). This process leads to the segregation of the
epidermal stem cells into the placode and inter-placode epidermal domain, each favored
by FGF (Mandler and Neubuser, 2004) and EGF (Atit et al., 2003) signaling. However,
careful analyses showed that periodic patterning is a process of competitive
equilibrium: cells initially can move reversibly in and out of the feather primordia
domains (Serras et al., 1993; Jiang et al., 1999). Gradually, the inter-mixing was
decreased, coinciding with the appearance of sharper placode boundaries.
Following the consolidation of feather primordia, a new epidermal domain is
generated between the bud and interbud domain. This new domain invaginates into the
dermis, leading to the formation of the feather follicle, a critical component of skin
appendages (Chuong et al., 2003; Maderson, 2004). Subsequently, the apparently
homogenous feather filament cylinder starts to generate periodically arranged barb
ridges (Prum, 1999; Harris et al., 2002). They form alternatively arranged growth and
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
87
apoptotic epidermal domains, leading to the formation of feather branches and spaces in
between (Chang et al., 2004). Thus, the epidermis is transformed from a two-
dimensional sheet into a complex three-dimensional structure. During this process, new
domains emerge and new boundaries have to be drawn repetitively. Failure to form a
sharp tissue boundary leads to inter-mixing of cell types and improper morphogenesis.
While we have learned molecules such as FGF and BMP (Jiang et al., 2004, Harris et
al., 2004) are involved in the initiation of feather buds, and Shh is involved in
subsequent feather growth, we have not learned much about the molecules involved in
consolidation of tissue boundaries during feather morphogenesis.
Ephrin and its receptor, Eph, are cell membrane molecules involved in adhesion
and repulsion among cells (Patan, 2004). Ephs and Ephrins belong to the receptor
tyrosine kinase family. The Ephs serve the forward signal and ephrins serve the reverse
signal (Davy et al., 2004). Two types of ligands have been identified. Ephrin-A is linked
to the membrane through glycosylphosphatidylinositol (GPI) and ephrin-B is a
transmembrane protein (Noren and Pasquale, 2004; Poliakov et al., 2004). Each type is
composed of multiple members. Ephrin-A usually binds to the EphA receptor, and
ephrin-B normally binds to the EphB receptor. However, cross-species binding can
occur (Noren and Pasquale 2004; Leckmann et al., 1997; Beckmann et al., 1994). This
pathway was found to be crucial for several important physiological phenomena
including axon pathfinding (Covan et al., 2004; Oster et al., 2004; Gallo and
Letoumeau, 2004; Cooper 2002; Imondi and Kaprielian, 2001), cell proliferation
(Steinle et al., 2003), cell differentiation (Aoki et al., 2004; Moody 2004; Wang et al.,
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
88
2004; Lawson et al., 2001), cell migration (Vindis et al., 2004; Poliakov et al., 2004;
Sturz et al., Bogenrieder et al., 2003; Steinle et al., 2003; Gu and Park 2003; McLennan
and Krull 2002), angiogenesis, (Patan, 2004 ) skeletal patterning (Compagni et al.,
2003), etc. Among them, the formation of a boundary is frequently observed as the role
of the ephrin pathway. For example, the formation of skull sutures is marked by ephrin-
B1 (Davy et al., 2004). Mutations of ephrin-Bl cause craniofrontonasal syndrome in
humans (Twigg et al., 2004). The mixing of different cell types was observed in the area
where the compartmentalization should occur (Cooke and Moens 2002). In general,
ephrin-A is more involved in adhesion, while ephrin-B is more involved in repulsion
(Poliakov et al., 2004).
EphA4 was reported to be expressed in the posterior part of growing feather
buds (Patel et al., 1999). We also found ephrin-Bl is co-expressed with one of its
receptors, EphB3 during feather morphogenesis. Here we set to study their expression
sequence and perturb the feather morphogenetic process with soluble recombinant
ephrin-Bl/Fc that blocks the reverse signaling of ephrin-Bl (Santiago and Erickson,
2002). The phenotypes include the blurred border of the early feather placodes,
incomplete follicle invagination and formation of a weak feather bud base, suppressed
feather bud elongation and uneven segregation of barb ridges. We propose that ephrin-
Bl is involved in boundary formation during feather morphogenesis.
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
89
4.2 Materials and methods
Immunohistochemistry and in situ hybridizations
Chicken embryos were staged according to H&H staging (Hamburger and
Hamilton, 1951). The whole mount in situ protocol was performed as described (Jiang
et al., 1998). For sections, fixed embryos were embedded in paraffin and sectioned at 5-
6 pm. After de-paraffinization, sections were stained for H&E, subject to in situ
hybridization or immunohistochemistry (Chang et al., 2004). Blocking solution
contained 10% FBS/ 0.5% BSA in PBS. Antibody dilution solution contained 2 % FBS/
0.1% BSA. Some section in situ hybridization was performed using the automated
Discovery™ system (Ventana Medical System) with recommended protocols. The
antibodies used were anti-ephrin-Bl (gifts from Dr.Pasquale, Burnham Institute), or
anti-ephrin-Bl (R&D, Minneapolis) and anti-ephrin-A2 and A4 (R&D, Minneapolis),
anti-L-CAM, anti-NCAM (Chuong andEdelman, 1985), anti-fibronectin, and anti-
Tenascin-C (M1B4) (Developmental Studies Hybridoma Bank developed under the
auspices of the NICHD and maintained by The University of Iowa, Department of
Biological Sciences, Iowa City, LA 52242). Finally, Alk-P secondary antibodies were
added, and substrates of Alk-P were used to visualize the molecular localization. In
some cases, we used StrepAvidin-Cye3 to visualize the signal.
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
Whole-mount immunofluorescent staining
90
Cultured explants were fixed in a 4:1 ratio of methanol: DMSO at 4°C for 16-
18h. The skins were washed with PBT (Phosephate buffer saline and 0.1% Tween-20)
three times, at lOmin each. Non-specific binding was then blocked with blocking
solution (10%FBS and 0.5%BSA). Antibodies were diluted in 2%FBS and 0.1%BSA),
added and incubated at 4°C for 16-18h. After washing, fluorescence-conjugated
secondary antibody was added to visualize molecular localization. We then examine the
results using confocal microscopy (Nikon), located in the microscopy core at the USC
Center for Liver Diseases (NIH 1 P03 DK48522). Each time point was collected from at
least 3 samples.
Perturbation with ephrin-B 1-Fc in a feather reconstitution assay
Feather reconstitution assays were prepared according to Jiang et al., 1999. For
perturbation, 1 to 200 mesenchymal cells were labeled with Dil before incubation with
10-20 (ig/ml of ephrin-Bl-Fc or 0.1% BSA in case of the control for an hour. Following
reconstitution with an epithelial sheet, the feather explants were cultured with ephrin-
Bl-Fc (10-20 pg/ml) containing culture medium. Explants were harvested at designated
time points and 3-5 specimens at each time point were collected.
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
91
Perturbation with protein coated beads
Affigel blue beads were coated with 50 pg/ml of FGF (R&D, Minneapolis), 100
pg/ml of BMP-4 (R&D Minneapolis), 250 pg/ml of noggin (R&D, Minneapolis),
Wnt3a, or 40 pg/ml of ephrin-Bl-Fc (R&D, Minneapolis). The control beads were
coated with 0.1% BSA. They were prepared as described in (Ting-Berreth and Chuong,
1996). Beads were placed on the explants or injected into feather follicles. Specimens
were harvested at designated times. Four days after the application, we harvested the
entire feather and cut sections examining the histological phenotype.
4.3 Results
4.3.1 Expression of ephrin / Eph during feather morphogenesis
We examined and observed the expression of mRNAs of several ephrin
members, such as ephrin-Bl, ephrin-B2, EphB2, EphB3, EphA2, and EphA6 . Among
them, ephrin-Bl and one of its receptor, EphB3 have strong and interesting expression
patterns. For this paper, we focused more on ephrin-Bl. We examined different
developmental stages of skin by whole mount and section in situ hybridizations and
immunostaining.
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
At stage 27 (embryonic day 6, E6), ephrin-Bl and EphB3 were absent (Fig. 4-
1 A). At stage 32 (E7.5), ephrin-Bl and EphB3 started to appear as small dots in the
center of feather primordia (Fig. 4-1 A). At stage 34-35 (E8), they appeared bigger and
covered almost the entire feather placodes. Interestingly, the expression of EphB3 was
restricted to the posterior part (Fig. 1 A). On the spinal tract at the dorsal surface of stage
36 (E9) embryos; there are feather buds of different developmental stages with
advanced ones near the midline and newly formed ones in the lateral positions. The
ephrin-Bl expression pattern expanded from the center to cover the entire primordia.
The expression became accentuated at the border of the placode appearing as a ring
(Fig. 4-1B). At stage 38 (E10), feather buds elongate and the ephrin-Bl expression
domain expands but remains strong at the base where invagination will occur (Fig. 4-
1B).
Section in situ shows that the ephrin-Bl transcript is positive in the bud domain,
but absent in the inter-bud domains. It is present in both epithelium and mesenchyme
with a stronger message in the mesenchyma in the placode stage. Expression levels
became equal in epithelium and mesenchyme by the short bud stage. The expression in
the mesenchyme recedes to the distal mesenchyme and eventually disappears, leaving
strong expression in the epidermis at the junction between the bud and interbud domain
at the long bud stage (Fig. 4-2A). The expression of ephrin B1 protein was also detected
by antibodies. The expression patterns were similar to that of the transcript. In the short
bud stage, ephrin-Bl protein appeared to be higher in the posterior buds. In the feather
filament, ephrin B1 can be seen in the barb ridge epidermis (Fig. 4-2B). At the tip of the
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
93
feather, the expression remained high only in the barb ridge epidermis (Fig. 4-2B,
inset).
The expression of receptor EphB3 was observed with in situ hybridization. It
was first expressed in posterior primordia and gradually expanded to appear in a half
moon pattern (Fig. 4-1A). Section in situ showed that the expression of EphBl is
limited to the placode epithelium. Later, it is more concentrated in the junctional
epidermis between the bud and interbud domains (Fig. 4-2A).
Figure 4-1 A. Expression of ephrin pathway members during feather morphogenesis
These are schematic drawings and the actual pictures taken from in situ hybridization of
E6, E7.5, and E8 chicken embryos hybridized with ephrin-Bl or EphB3 probes.
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
i n situ
ephrin-B1 EphB3
CD
LU
T J LU
CO
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
Figure 4-1B. Ephrin pathway expression in the older stages of feathers
95
These are schematic drawings and the pictures taken from in situ hybridization of E9
and E10 embryos hybridized with either ephrin-Bl or EphB3 as indicated. Note, the
inset locates where the picture was taken. The schematic is not drawn to scale or actual
stage.
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
I n situ hybridization
96
E phB 3 hrin-B1
*
9 m - —
0 5 ^
i # 7
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
97
Figure 4-1C. The comparison of ephrin-Bl and EphB3 to Shh
The expression pattern of ephrin-Bl and EphB3 compared to Shh of E8 embryos
femoral tract
ephrin-B1 E phB 3 S h h
J t» , lAts*;
w ;, *
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
98
Figure 4-2 A. Section in situ of ephrin-Bl and EphB3
Left column is showing H&E of three different stages of E9 feathers. The mRNA of
ephrin-Bl was shown in the middle column. The right column is the expression of
EphB3 performed by section in situ hybridization. Note the expression of EphB3 is
detected much weaker than its ligand, ephrin-Bl. This also true compared to Figure IB.
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
99
EphB3
gOOpn*
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
I n situ hybridization
100
Figure 4-2B. The expression of proteins levels
Left column, pictures of sections stained with anti-ephrin-Bl. The immunostaining of
ephrin-A2 is shown in the middle column and ephrin- A4 in the right column.
ephrin-B1 ephrin-A2 ephrin-A4
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
101
Earlier we showed that molecules such as P-catenin appear earliest during
feather bud formation in a restrictive mode. Molecules such as Shh appear later in a de
novo mode (Jiang et al., 2004). Here we compared the order of appearance of ephrin-
Bl, EphB3 and Shh in femoral tracts in which feather buds form earlier in the lateral
margin and spread toward the medial side. The results showed Shh appears earlier than
ephrin- Bl, which in turn is earlier than EphB3 (Fig. 4-1C).
We also examined other Ephrins. Ephrin A2 immunostaining is expressed in the
feather epidermis in both the bud and interbud. Ephrin-A4 immunostaining is present in
both epithelium and mesenchyme and showed peculiar nuclear co-localization (Fig. 4-
2B).
4.3.2 Ephrin-Bl-Fc on placode boundary and mesenchymal condensation formation
During induction of feather primordia, cell re-arrangements occur to convert
cells in feather fields from a homogenously distributed state to periodically arranged
feather primordia, including both placode epithelium and the dermal condensation
beneath it. To investigate the possible role of ephrin-Bl in cell arrangements, we added
the recombinant ephrin-Bl and Fc portion of human IgG to the feather reconstitution
assay (Jiang et al., 1999). The formation of feather primordia was delayed compared to
the control. Although feather primordia eventually formed, they were bigger, less dense
(judged by optical trans-illumination), and did not elongate well even at day 6 in culture
(Fig. 4-3A, A’). The specimens were prepared with whole mount L-CAM staining and
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
102
viewed by confocal microscopy from the bottom side. A ring like expression pattern
was observed around each feather base. In the ephrin-Bl/ Fc treated specimen, the L-
CAM staining ring is weaker, more diffuse, and bigger in diameter (Fig. 4-3B, B’).
There are blurred placode boundaries compared to the control (Fig. 4-3C, C’). We also
noted that primordia at day 2 have a bigger diameter and more discrete boundaries (Fig.
4-3C, C’, white arrows). These were supposed to mature into smaller primordia (Fig. 4-
3D). They failed to do so in ephrin-Bl/ Fc treated specimens (Fig. 4-3D’).
We examined the behavior of mesenchymal cells. Mesenchymal condensation
occurred in a less efficient way. This was visualized with the help of wholemount
NCAM immunofluorescent staining. In the control, mesenchymal cells form tight
clusters of dermal condensation beneath each placode. In the ephrin-Bl/ Fc treated
specimen, mesenchymal condensation cells are loosely arranged (Fig. 4-3E, E’). The
condensations were bigger because they were not tightly packed (Fig. 4-3F, F’).
During the emergence of feather primordia, the size of feather primordia is
reduced in size, concomitant with the increase of cell density (as judged by optical
trans-illumination). This can be seen in Fig. 4-3F. We surmise this reflects the sorting
out of primordia and inter-primordia cells. Our earlier preliminary data suggest that
cells initially can move back and forth between bud and inter-bud domains, in both
epidermis and mesenchyme. Using Dil to label cells (mesenchyme), we now
demonstrate that this inter-mixing gradually reduces and cells do not mix in mature
feather buds, reflecting the establishment of a mature feather bud boundary. On the
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
103
other hand, the intermixing continues to be high in ephrin-Bl/ Fc treated specimens
(Fig. 4-3G, on progress).
Figure 4-3. Blocking study in reconstitution assay
(A, A’) pictures of whole mount taken with visible light from a confocal microscope of
the control skin and ephrin-Bl/Fc treated respectively. (B, B’) bottom view of the L-
CAM whole-mount immunofluorescent staining of (A) and (A’) skin. (C, C’) higher
magnification of individual feather bud taken with visible light of the control and
ephrin-Bl/Fc treated skin respectively. The white arrows indicating the size of the
dermal papilla. (D, D’) magnified pictures showing a “donut” ring of L-CAM staining
from insets in B and B \ Note that the size of the dermal papilla changes overtime from
C to D. (E, E’) NCAM whole mount immunofluorescent staining of the control and
treated skin. The higher magnification is shown in F and F’ respectively. (G) Dil
labeling study of mesenchymal cells movement.
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
104
Control
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
105
Control
ephrir>B1/ Fc
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
4.3.3 Ephrin-Bl/ Fc on follicle formation
106
Tissue sectioning showed that the ephrin-Bl/ Fc treated feather buds are
abnormal. The loosely organized mesenchymal cells led to a broader “foundation” of
the feather bud base, and the mesenchymal cell density remained lower, closer to that of
the inter-bud mesenchyme (Fig. 4-4A). The ring we observed in Fig. 4-3 A’ is due to the
invagination of the feather buds that create the hinge (ring) region around the feather. In
sections, we can see that this bud-interbud did not form successfully and did not
invaginate into the dermis as it should (Fig. 4-4B). The feather buds also did not
elongate into long feather buds, but remained wide and short. The bases of the feather
buds are much wider (Fig. 4-4A, arrow). The density of mesenchymal cells in treated
skin is lower than the control (50 to 66 ± 4 nuclei per field, n = 60). We can also
observe the unusual multi-layer organization of the epithelial cells (see the propidium
iodide and LCAM staining, Fig. 4-4A inset).
We characterized the molecular expression of these buds further. The fact that
mesenchymal cell condensations are not well developed can also be seen by the weak
staining of FN (Fig. 4-4B). Tenascin-C (Tn-C) was known to be expressed in the
mesenchyme beneath the invaginating epidermis when feather buds grow into feather
follicles (Jiang and Chuong, 1992). In this case, Tn-C expression is much less in ephrin
Bl-Fc treated specimens (Fig. 4-4B). The expression ofNCAM was markedly
decreased in the dermal papilla of ephrin-Bl/ Fc specimens, compared to the control
(Fig. 4-4B). While the formation of the follicle is retarded, feather bud epithelia were
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
107
able to differentiate and express feather keratin, albeit abnormal in configuration (Fig.
4-4C).
The invagination of the epithelial sheet involves cell rearrangements. Specimens
were stained with propidium iodide and L-CAM to help visualize cell arrangement and
cell shape (Fig. 4-4D, E). Three regions, the hinge, interbud and elongated bud regions
were analyzed. In the hinge region, a zone of epidermal cells became elongated in a
circumferential orientation surrounding the buds, and also already formed a groove
invaginating into the mesenchyme. Cells in ephrin-Bl/ Fc treated specimens remained
polygonal shaped and randomly aligned. The groove did not form well (Fig. 4-4D, E,
white arrow and D” , E” ). In the interbud region, cells in control and ephrin-Bl/ Fc
treated specimens were polygonal shaped and irregularly arranged; though ephrin-Bl/
Fc treated cells appeared to be smaller in size at the apical surface (Fig. 4-4D’, E’). In
the bud region, control cells showed an elongated shape, with the long axis of the cell in
parallel with the proximal - distal axis of the feather buds (Fig. 4-4D’” , E’” ).
We quantified the changing cell shape by measuring the aspect ratio (the ratio of
cell length and width. A nearly round cell will have an aspect ratio =1, and an elongated
cell will have a number much larger than 1.) As long feather buds grow, we found that
aspect ratios in the invagination and bud region become higher, reflecting the formation
of follicles and elongation of feather buds. The aspect ratio of the interbud region
remained the same. In the ephrin-Bl/ Fc treated samples, aspect ratios failed to increase
particularly in the hinge region (Fig. 4-4F, n = 90).
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
Figure 4-4. The boundary set up is not complete in treated skin
108
(A) shows the control skin (left) and treated feather sectioned longitudinally (right). The
green color represents L-CAM staining and red dots are the propidium iodide stained
nuclei. (B) sections of the control (left) and treated skin (right) subjected to either H&E
or immunohistochemistry staining. Dotted lines are marked for the invagination of the
epidermal cells. The brown color is the positive signal using DAB as a substrate for Tn-
C and FN. (C) in situ hybridization of feather keratin of control (left) and treated skin
(right). (D) a panel of control skin stained with L-CAM (green) and propidium iodide
(red). As indicated with the inset D’ is the interbud region, D” , the hinge region and
D’” , the elongated bud region, respectively. (E) treated skin stained with L-CAM and
arranged according to the control. (F) diagram of aspect ratios of area 1 (interbud), area
2 (hinge), and area 3 (bud) comparing the control and treated skin. Arrows indicate the
longest length used for the aspect ratio calculation. Yellow bar is a control (BSA) and
light blue bar is ephrin-Bl/ Fc treated skin (ephrin-Bl/ Fc).
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission
F-Keratin
C Control eprhin-B1/Fc
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
Aspect Ratio (L/W)
|aBSAB»91?c]
8
7
6
S
4
3
2
1
Spl
Areal
0
Area2
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
4.3.4 Ephrin-Bl/ Fc on barb ridges formation
112
When ephrin-Bl/ Fc coated beads were implanted into growing feather follicles,
we observed changes in barb ridge formation (Fig. 4-5 A). The process of barb
formation involved several steps of epithelial cell arrangement (Lucas and Stettenheim,
1972; Chang et al., 2004). Normally, epithelial cells in the stratified epidermis rearrange
to form periodically arranged barb ridges, and then keratinocytes within each barb ridge
rearrange to form two stacked rows of barbule plates. In ephrin-Bl/ Fc treated
specimens, sections of feather follicles show that barb ridges were unevenly formed.
Furthermore, barbule plate keratinocytes lose their organization to form a swirl of
“keratinocyte pearls” (Fig. 4-5A).
Molecular staining showed that Shh expression in the control was positive at the
boundary between barb ridges, but disappeared in the treated follicle. Feather keratin
staining showed that the barbule plate cells still can keratinize (Fig. 4-5B).
4.3.5 FGF-4 induces and Wnt3a inhibits ephrin-Bl expressions (in progress)
We explore which signaling molecules may be able to regulate the expression of
ephrin-Bl. Growth factor coated beads were placed on E8 skin explant cultures (Ting-
Berreth and Chuong, 1996a). After 18 hrs, FGF-4 beads were shown to induce the
expression of ephrin-Bl, while BSA, BMP-2/4, and Noggin were no induction but
inhibition was observed with Wnt3a beads (Fig. 4-6).
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
113
Figure 4-5 A. Barb ridge abnormality from the blockage of reverse ephrin signaling
(A, A’) histological analysis of control and treated skin sections at the lower level close
to the base of adult feathers. The higher magnification was shown in B and B’,
respectively (indicated with the insets). (C, C’) cross section at a higher level of the
control and treated skins. The higher magnification indicated with the insets are shown
in D and D’, respectively.
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
A BSA ephrin-B1/Fc
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
Figure 4-5B. Shh expression was diminished in treated skin.
B BSA ephrin-B1/Fc
co
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
116
Figure 4-6. The study of upstream signals that can up regulate ephrin-Bl (in progress)
The mRNA expression of ephrin-Bl was up regulated by FGF-4 but not induced by
BMP-4 or Noggin. The control experiment was replaced with BSA coated beads and
there was no induction of ephrin-Bl.
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
Noggin BMP-4 FGF-4 B SA
117
ephrin-B1
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
118
4.3.6 Ephrin-Bl and chicken skin cell behavior in vitro
We also examine the repulsion (de-adhesion) effect of keratinocytes by using
RCAS-ephrin-Bl-GFP over-expressing cells in keratinocyte culture. The results are in
progress (Fig. 4-7).
Figure 4-7. The repulsion study (in progress)
Left panel is keratinocytes cultured with the control cells (RCAS-GFP embryonic
fibroblast). Right panel is keratinocytes cultured with ephrin-Bl-GFP expressing cells.
Red color is the Dil-labeled keratinocytes. Need to be repeated in the future.
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
119
4.4 Discussion
In this work we demonstrate for the first time that proper function of the ephrin
pathway is essential for feather morphogenesis. Specifically, the function of ephrin-Bl
is blocked by soluble ephrin-Bl/ Fc, which has been used to block the migration of
neural crest cells (Santiago and Erickson, 2002). When it was added to the
reconstituted feather cultures, the formation of the feather was partially halted and
deranged. Feather formation remained altered for the rest of the developmental stage.
This resulted in an incomplete invagination, disrupted elongation and a dramatically
altered dermal condensation. Therefore, we postulate that the ephrin pathway may be
involved in proper feather development. However, more detailed studies should be
continued to fully understand the significance of the pathway in feather development.
Although the formed feathers are abnormal, the feather was initiated and did
induce the placode suggesting that the action of ephrin takes place in later stages of
morphogenesis. During the formation of feather buds, we have proposed that there are
two categories of molecules: the activator and inhibitor as one team and the ephrin is
another team effort. It is possible that ephrin-Bl is essential for epithelial rearrangement
in order to form the barb ridge during bud formation (Fig. 4-5).
Several molecules were detected as early as before the feather bud is formed. A
uniform stripe of follistatin expression normally precedes feather formation (Patel et al.,
1999). FGFs are also expressed during early placode formation. FGF-2 and FGF-4 can
induce and promote feather bud formation (Widelitz et al., 1996). Here, FGF-4 from
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
120
soaked beads can up-regulate the expression of ephrin-Bl (Fig. 4-6). However, we
detected the expression of ephrin-Bl at E8 slightly later than Shh, which is the early
marker for feather placodes (Chuong et al., 2000). Together, we would propose that
ephrin-Bl is required for the later stage of feather development.
Downstream of the ephrin pathway, cells have been shown to exhibit shape
change and repulsion (de-adhesion) involving the turnover of the filamentous-actin (F-
acitn) during exon-guidance. If turnover is blocked, the repulsion will not occur (Gallo
et al., 2002). Once the feather placodes are formed, the next important step is to set up
the permanent and secure foundation of the feather base. During this process
invagination of the epithelial cells occurs. Therefore, we postulate that the invagination
should, at least, involve cell shape change. The shape of the cell will not change if the
arrangement of the F-actin is interrupted. The failure of invagination of the feather base
may, therefore, be due to a failure to change cell shape. Here, we found that the shape
of epidermal cells slightly or hardly changes at all and there is no change of the aspect
ratio (Fig. 4-4F). Together, these results lead us to propose that ephrin-Bl is required
for skeletal rearrangement during epidermal invagination.
In another model, it has been shown that ephrin-Eph action restricts cell
movement (Compagni et al., 2003). In the feather, the expression of ephrin-Bl that
covers the entire bud but not interbud area may influence the movement of those cells
that are committed to the bud fate and remain only in the bud forming zone.
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
121
In order to generate the feather, epithelial cells have to be rearranged and
their shape changed to suit a three dimensional structure. One layer of epithelial cells
will thicken and arrange into two or more layers between E5 and E7 (Sengel and
Mauger, 1976). At E5, epithelial cells arrange as an epithelial sheet of continuous
hexagonal cells. At this stage the epithelial cells are homogeneously arranged as a
simple field with no bud-forming zone yet. We think those cells are primordia.
Interaction between ephrin-Eph expressing cells turned out to be the
important event for cell arrangement and shape change during the establishment of the
somite boundary and suture of the brain (Cooke and Moens, 2002; Twigg et al., 2004).
The feather boundary would not be less important for the feather to maintain its
integrity throughout development. The invagination precedes the formation of the
dermal papilla. We would propose that invagination is a way to set up the boundary
confining mesenchymal cells within the feather to obtain and perform specific
functions. At the same time this boundary prevents more mesenchymal cells from the
interbud to migrate into the dermal papilla area. If the boundary is interrupted, mixing
of cells will be easily achieved. In fact, we found that shallow or incomplete
invagination of the epithelial cells could alter the boundary integrity, thereby allowing
more cells to come in to the dermal papilla and eventually disrupt the next process of
feather development.
The tight aggregation of mesenchymal cells under the epithelium cells was
observed as early as E6 (Jiang et al., 1999). The dermal condensation will not be
permanent if the epithelium is not introduced to the system (Widelitz and Chuong,
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
122
1999). They must work closely together and communicate with each other throughout
the process in order to keep the order effective. The hierarchical event of these
molecules has to be orchestrated precisely for proper feather formation. Somehow
blockage of the reverse signal can inhibit the packed condensation of the mesenchymal
cells within the chamber. We would be interested to investigate in the future what
signal(s) have been interfered with and how they can be regulated.
It is quite clear that the communication between E and M required both
forward and reverse signals (Davy et al., 2004). The consequence of having only a
forward signal (according to the expression of the receptor, EphB3) on the epithelium is
that a clear boundary was not established until 12h after the control (Fig. 4-3C, C’). Do
these cells commit to the pulp lineage? We don’t know yet.
Barb ridge formation is a later step during feather development that gives
rise to the sophisticated structure of the mature feather. The arrangement of epithelial
cells into the “bulge” structure of the barb ridge would most likely involve cell shape
changes and cell arrangements. The barb ridge later develops into the barbule of an
adult feather (Prum, 1999) BMPs were linked to the process because over-expression of
BMP-2 or BMP-4 enhanced the branching. Whereas blocking the process with the BMP
antagonist, Noggin promoted the opposite results (Yu et al., 2002). Here, we found that
blockage of ephrin reverse signaling could alter the process as well (Fig. 4-5). However,
the phenotype was not similar. Together, these results suggest that ephrin-Bl is
involved the maturation of the feather.
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
123
In summary, we show that ephrin-Bl is functionally involved in feather
morphogenesis. More work is required to study how ephrin-Bl expression is regulated
upstream and how ephrin cross talks to other cellular behavior pathways downstream. It
is also important to evaluate the role of other ephrin members. The distinct feather
forms serve as an excellent model to study the role of the ephrin pathway in the
formation and maintenance of tissue boundaries.
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
124
4.5 References
Aoki, M., Yamashita, T., Tohyama, M., 2004. EphA receptors direct the differentiation
of mammalian neural precursor cells through a mitogen-activated protein kinase-
dependent pathway. J Biol Chem. 279, 32643-32650.
Atit, R., Conlon, R. A , Niswander, L., 2003. EGF signaling patterns the feather array by
promoting the interbud fate. Developmental Cell 4, 231-240.
Baker, R. K., Antin, P. K., 2003. Ephs and ephrins during early stages of chick
embryogenesis. Dev. Dyn. 228, 128-142.
Batlle E., Henderson JT., Beghtel H., Van den Born MMW., Sanjo E., Huls G, Meeidijk
J., Robertson J., Van de Wetering M., Pawson T., Clevers H., 2002. (3-Catenin and TCF
mediate cell positioning in the intestinal epithelium by controlling the expression of
Eph/EphrinB. Cell 111, 251-263.
Beckmann, M.P., Cerretti, D.P., Baum, P., Vanden Bos, T., James, L., Farrah, T.,
Kozlosky, C., Hollingsworth, T., Shilling, H., Maraskovsky, E., et al., 1994. Molecular
characterization of a family of ligands for eph-related tyrosine kinase receptors. EMBO
J. 13, 3757-3762.
Bogenrieder, T., Herlyn, M., 2003. Axis of evil: molecular mechanisms of cancer
metastasis. Oncogene. 22, 6524-6536.
Bossing, T., Brand, A. H., 2002. Dephrin, a transmembrane ephrin with a unique
structure, prevents intemeuronal axons from exiting the Drosophila embryonic CNS.
Development 129, 4205-4218.
Chang, C H., Jiang, T.X., Lin, CM., Burras, L.W., Chuong, C.M., Widelitz, R.B.,
2004. Distinct Wnt members regulate the hierarchical morphogenesis of skin regions
(spinal tract) and individual feathers. Mech Dev. 121, 157-171.
Chuong, C.M., Edelman, G.M., 1985. Expression of cell-adhesion molecules in
embryonic induction. I. Morphogenesis of nestling feathers. J Cell Biol. 101, 1009-
1026.
Chuong, C.M., Patel, N., Lin, J., Jung, H.S., Widelitz, R.B., 2000. Sonic hedgehog
signaling pathway in vertebrate epithelial appendage morphogenesis: perspectives in
development and evolution. Cell Mol. Life Sci. 57,1672-1681.
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
125
Chuong, C.M., Homberger, D.G., 2003. Development and evolution of the amniote
integument: current landscape and future horizon. J Exp Zoolog B Mol Dev Evol. 298,
1 - 11 .
Compagni, A., Logan, M., Klein, R , Adams, R.H., 2003. Control of skeletal patterning
by ephrinBl-EphB interactions. Developmental Cell 5, 217-230.
Cooke, J.E., Moens, C.B., 2002. Boundary formation in the hindbrain: Eph only it were
simple. TRENDS in Neurosciences 25, 260-267.
Cooper, H.M., 2002. Axon guidance receptors direct growth cone pathfinding: rivalry at
the leading edge. Int J Dev Biol. 46, 621-631.
Davy, A., Aubin, J., Soriano, P., 2004. Ephrin-Bl forward and reverse signalings are
required during mouse development. Genes & Development 18, 572-583.
Gallo, G., Yee, H.F. Jr., Letoumeau, P.C. (2002) Actin turnover is required to prevent
axon retraction driven by endogenous actomyosin contractility. J Cell Biol. 158, 1219-
1228.
Gallo, G., Letoumeau, P C., 2004. Regulation of growth cone actin filaments by
guidance cues. JNeurobiol. 58, 92-102.
Gu, C., Park, S., 2003. The pi 10 gamma PI-3 kinase is required for EphA8-stimulated
cell migration. FEBS Lett. 540, 65-70.
Hamburger, V., Hamilton, H.L., 1951. A series of normal stages in the development of
the chick embryo. J. Morphol. 88, 49-92 (reprinted in Dev. Dyn. 1992. 195, 231-272).
Harris, M.P., Fallon, J.F., Prum, R.O., 2002. Shh-Bmp2 signaling module and the
evolutionary origin and diversification of feathers. J Exp Zool. 294,160-176.
Harris, M.P., Linkhart, B.L., Fallon, J.F., 2004. Bmp7 mediates early signaling events
during induction of chick epidermal organs. Dev Dyn. 231, 22-32.
Imondi, R., Kaprielian, Z., 2001. Commissural axon pathfinding on the contralateral
side of the floor plate: a role for B-class ephrins in specifying the dorsoventral position
of longitudinally projecting commissural axons. Development. 128, 4859-4871.
Jiang, T.X., Chuong, C.M., 1992. Mechanism of skin morphogenesis. I. Analyses with
antibodies to adhesion molecules tenascin, N-CAM, and integrin. Dev Biol. 150, 82-98.
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
126
Jiang, T.X., Stott, N.S., Widelitz, R.B., Chuong, C.M., 1998. Current methods in the
study of avian skin appendages. In “Molecular basis of epithelial appendage
Morphogenesis” (C.M. Chuong, ed), pp. 395-408. R.G. Landes company, Texas.
Jiang, T.X., Jung, H-S., Widelitz, R. B., Chuong, C.M., 1999. Self-organization of
periodic patterns by dissociated feather mesenchymal cells and the regulation of size,
number and spacing of primordia. Development 126, 4997-5009.
Jiang, T.X., Widelitz, R.B., Shen, W.M., Will, P., Wu, D.Y., Lin, C.M., Jung, H.S.,
Chuong, C.M., 2004. Integument pattern formation involves genetic and epigenetic
controls: feather arrays simulated by digital hormone models. Int J Dev Biol. 48, 117-
135.
Jung, H.S., Francis-West, P.H., Widelitz, R.B., Jiang, T.X., Ting-Berreth, S., Tickle, C.,
Wolpert, L., Chuong, C.M., 1998. Local inhibitory action of BMPs and their
relationships with activators in feather formation: implications for periodic patterning.
Dev Biol. 196, 11-23.
Lawson, N.D., Scheer, N., Pham, V.N., Kim, C.H., Chitnis, A.B., Campos-Ortega, J.A.,
Weinstein, B.M., 2001. Notch signaling is required for arterial-venous differentiation
during embryonic vascular development. Development. 128, 3675-3683.
Lucas, A.M., Stettenheim, P.R., (eds) (1972). Avian anatomy - Integument.
Agricultural handbook 362: Agricultural research services (US Department of
Agriculture, Washington DC).
McLennan, R , Krull, C.E., 2002. Ephrin-as cooperate with EphA4 to promote trunk
neural crest migration. Gene Expr. 10, 295-305.
Maderson, P.F., 2004. Bom in a follicle-a historical perspective. Differentiation. 72,
466-73.
Mandler, M., Neubuser, A., 2004. FGF is required for initiation of feather placodes
development.
Moody, S.A., 2004. To differentiate or not to differentiate: regulation of cell fate
decisions by being in the right place at the right time. Cell Cycle. 3, 564-566.
Noramly, S., Freeman, A., Morgan, B.A., 1999. beta-catenin signaling can initiate
feather bud development. Development. 126, 3509-3521.
Noren, N.K., Pasquale, E.B., 2004. Eph receptor-ephrin bidirectional signals that target
Ras and Rho proteins. Cellular Signalling 16, 655-666.
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
127
Ogawa, K., Pasqualini, R , Lindberg, R.A., Kain, R., Freeman, A.L., Pasquale, E.B.,
2000. The ephrin-Al ligand and its receptor, EphA2, are expressed during tumor
neovascularization. Oncogene 19, 6043-6052.
Ogita, H., Kunimoto, S., Kamioka, Y., Sawa, H., Masuda, M., Mochizuki, N., 2003.
EphA4-mediated Rho activation via Vsm-RhoGEF expressed specifically in vascular
smooth muscle cells. Circ. Res. 93, 23-31.
Oike, Y., Ito, Y., Hamada, K., Zhang, X-Q., Miyata, K., Arai, F., Inada, T., Araki, K.,
Nakagata, N., Takeya, M., Kizanuki, Y. Y., Yanagisawa, M., Gale, N. W., Suda, T.,
2002. Regulation of vasculogenesis and angiogenesis by EphB/ephrin-B2 signaling
between endothelial cells and surrounding mesenchymal cells. Blood 100, 1326-1333.
Oster, S.F., Deiner, M., Birgbauer, E., Sretavan, D.W., 2004. Ganglion cell axon
pathfinding in the retina and optic nerve. Semin Cell Dev Biol. 15, 125-136.
Patan, S., 2004. Vasculogenesis and angiogenesis as mechanisms of vascular network
formation, growth and remodeling. JNeurooncol. 50, 1-15.
Patel, K., Makarenkova, H., Jung, H.S., 1999. The role of long range, local and direct
signnalling molecules during chick feather bud development involving the BMPs,
Follistatin and the Eph receptor tyrosine kinase Eph-A4. Mechanisms of Development
86, 51-62.
Poliakov, A., Cotrina, M., Wilkinson, D.G., 2004. Diverse roles of Eph receptors and
ephrins in the regulation of cell migration and tissue assembly. Developmental Cell 7,
465-480.
Prum, R.O., 1999. Development and evolutionary origin of feathers. J Exp Zool. 285,
291-306.
Santiago, A., and Erickson, C. A., 2002. Ephrin-B ligands play a dual role in the control
of neural crest cell migration. Development 129, 3621-3632.
Sengel, P., and Mauger, A., 1976. Peridermal cell patterning in the feather-forming skin
of the chick embryo. Dev Biol. 51, 166-171.
Serras, F., Fraser, S., Chuong, C.M., 1993. Asymmetric patterns of gap junctional
communication in developing chicken skin. Development. 119, 85-96.
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
128
Stein, E., Lane, A. A., Cerretti, D.P., Schoecklmann, H.O., SchrofF, A.D., Van Etten,
R.L., Daniel, T O., 1998. Eph receptors discriminate specific ligand oligomers to
determine alternative signaling complexes, attachment, and assembly responses. Genes
& Development 12, 667-678.
Steinle, J.J., Meininger, C.J., Chowdhury, U., Wu, G., Granger, H.J., 2003. Role of
ephrin B2 in human retinal endothelial cell proliferation and migration. Cell Signal. 15,
1011-1017.
Sturz, A., Bader, B., Thierauch, K.H., Glienke, J., 2004. EphB4 signaling is capable of
mediating ephrinB2-induced inhibition of cell migration. Biochem Biophys Res
Commun. 313, 80-88.
Ting-Berreth, S.A., Chuong, C.M., 1996. Local delivery of TGF beta2 can substitute for
placode epithelium to induce mesenchymal condensation during skin appendage
morphogenesis. Dev Biol. 179, 347-359.
Twigg, S.R.F., Kan, R , Babbs, C., Bochukova, E.G., Robertson, S.P., Wall, S.A.,
Morriss-Kay, G.M., Wilkie, A.O.M., 2004. Mutations of ephrin-Bl (EFNB1), a marker
of tissue boundary formation, cause craniofrontonasal syndrome. Proc. Natl. Acad. Sci.
101, 8652-8657.
Vindis, C., Teli, T., Cerretti, D.P., Turner, C.E., Huynh-Do, U., 2004. EphBl-mediated
cell migration requires the phosphorylation of paxillin at Tyr-31/Tyr-l 18. J Biol Chem.
279, 27965-27970.
Wang, Z., Cohen, K., Shao, Y., Mole, P., Dombkowski, D., Scadden, D.T., 2004.
Ephrin receptor, EphB4, regulates ES cell differentiation of primitive mammalian
hemangioblasts, blood, cardiomyocytes, and blood vessels. Blood. 103, 100-109.
Widelitz, R.B., Jiang, T.X., Noveen, A., Chen, C.W., Chuong, C M., 1996. FGF induces
new feather buds from developing avian skin. J Invest Dermatol. 107, 797-803.
Widelitz, R.B., Chuong, C.M., 1999. Early events in skin appendage formation:
induction of epithelial placodes and condensation of dermal mesenchyme. J Investig
Dermatol Symp Proc. 4, 302-306.
Widelitz, R.B., Jiang, T.X., Lu, J., Chuong, C.M., 2000. beta-catenin in epithelial
morphogenesis: conversion of part of avian foot scales into feather buds with a mutated
beta-catenin. Dev. Biol. 219, 98-114.
Yu, M., Wu, P., Widelitz, R.B., Chuong, C.M., 2002. The morphogenesis of feathers.
Nature. 420, 308-312.
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
Chapter 5 Reflection and Perspective
129
A reflection of my career as a Ph.D. student at the USC Keck School of Medicine
I have been here since Sep. 1998 (two weeks after the school started). I have
learnt a great deal and earned a tremendous amount of experience and would like to
reflect to you upon these. My adaptation to USC took place particularly in the first
semester. I had to work harder than other students in order to keep up with classes
because I was two weeks behind. However, I managed to survive quite remarkably.
Thanks to my teachers in Thailand who taught me some details in those classes.
In the second semester of my first year, I was fortunate to have a chance to join
Dr. Chuong’s laboratory in the spring of 1998 and learned how to do basic scientific
experiments, such as mini-preparation for plasmids, generating probes and performing
in situ hybridization and immunostaining, manually. At that time those were very new
things to me. I was taught by Dr. Janet Chen, who is now a teacher at Pasadena City
College, and I failed for the first try, but I never failed again since then. My philosophy
is SLOW BUT SURE. I like taking everything very slow at the beginning by making
sure that everything has been looked at thoroughly.
I came from the area of the world that has the highest incidence of
hepatocellular carcinoma. When things started clicking, I decided to put my energy into
one project that serves my best interest, which is anything pertinent to the liver. I was
taking a risk becoming a groundbreaker for the liver morphogenesis study using the
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
130
chicken liver model. The project turned out to be one of the important things I have
done in my life. During the study, so many failures have occurred and recurred but
those really helped shape my thinking and taught me how to become a world-class
scientist. I learned how to manage my time and strategy to overcome so many hurdles.
My PI, Dr Chuong was very helpful in trying to push me to the upper limit as mush as
he could. I pushed myself really hard in order to keep myself focused and fulfill the
assignments. The outcome eventually satisfied both of us. The process of doing the
experiment is also one of the ways to enjoy life. I like to create the environment that
yields a positive atmosphere in the laboratory. I also like to create new ways of doing
experiments and doing the experiment that can turn my heart and soul on. The first two
years are the most critical time for graduate students to gain experience and confidence
in their abilities in order to become a true scientist. To be acquainted to all the necessary
materials and methods will save time and resources. I had to be very careful and
thorough in designing the experiments. Even though sometimes the experiment was
viewed as primitive and/or of poor design, the outcome produced clues toward the right
answer.
I think the most important thing to be considered before starting to do
experiments is choosing appropriate controls. Positive and negative controls have to be
incorporated into each and every experiment. If a problem occurred, the solution was
drawn quickly by comparing the result to the control. One more factor that one needs to
be aware of is the consistency of the results. Is the data repeatable? I always keep all the
results, no matter how good or bad they are for future reference. Sometimes, a clear
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
131
interpretation conies from re-examining the old data. Repeating the experiment is also
one of the important factors that solidify my confidence in the results.
The second stage of graduate student life is the development of in depth and
critical thinking to make experiments unique but pertinent and useful to the field. The
contribution of the data to the field is invaluable. The way to think in depth would be
divided into three major categories. First of all, ask the right question(s). This step can
be either by reading the published journals, books, or listening to seminars to identify
the gaps or interesting ideas. Secondly, hypothesize or propose a possible theory and
predicted results. Third, test the hypothesis.
As described in chapter 2-4,1 gained a lot of experience in studying examples of
how the major signaling molecules are used in constructing the liver and feather. I
would like to apply the knowledge I obtained to further study how the liver cells
aggregate and form the hepatic cords properly. One molecule that I found in the
preliminary data that may serve this purpose is ephrin-Bl. I want to examine how
ephrin-Bl influences the migration and budding out of the acini and forming hepatic
cord. Another observation from staining endothelial cells in quail livers gave me very
interesting insights that endothelial cells are an essential contributor toward forming a
functional liver. I want to develop this line of study in my future research to determine
how the endothelia become MSEC and how to reproduce the liver as an artificial organ
from stem cells.
Through these, I think I am reasonably prepared to enter the next stage of my
career.
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
My goals when I am back in Thailand are as follows:
132
First, my priority is to set up the department of Clinical Pathology and
Laboratory of Medicine at the Institute of Medicine of the Suranaree University of
Technology (SUT), Nakhon Ratchasima, where I was appointed as a lecturer. My first
duty is teaching medical students and graduate students.
Second, I want to set up a research laboratory. On this line, I will coordinate
with others to lay down the graduate programs as well. I would like to continue working
on the liver project collaborating with either Dr. Chuong’s laboratory and/or others, if
applicable. However In the long term, I would like to have the first molecular genetic
and genetic engineering center for the Northeast region of Thailand. I would also like to
be involved with stem cell research in Thailand. In addition, if time is available, I would
like to participate in bird-flu vaccine development in Thailand.
Third, I would like to set up a self-learning library for my hometown at the
Khoketakian High School, Surin. I would like to encourage kids in the proximity to
congregate and exchange ideas and learn at a first computer-built-in library.
Fourth, I would like to help my hometown build tennis courts for the good-
health program, specifically for the elderly. Every month I would like to meet with the
retirees helping them to keep up their physical and mental health.
Fifth, I would like to write several books regarding scientific interest and some
unique experiences I acquired while I was in the US. I have spent more than a half a
decade in big cities like Philadelphia and Los Angeles and have met many important
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
133
people at unusual situations, beyond my imagination. For example, President Bill and
Hillary Clinton (in Thailand-1996, pre-entering the US), Steve Jobs (Toy story 2
premier in SF-2000), John Lasseter Director, Tom Schumacher, Tim Engel, Peter
Schneider, Ming Na, Roy Disney at the Treasure Planet premier-2002, Sir Elton John at
the Oscar’s party and David Baltimore on Jan. 11,2005 at HIV and Stem cells meeting
for the Institute of Medicine. In addition, I was fortunate having an opportunity to
attend the 2000 Academy Awards ceremony. I have learnt a lot from being a graduate
student at the University of Southern California and as an alien resident at Los Angeles
County.
Memorable moments, even though I want to forget some
I spent one year at a bankrupted university in Philadelphia, 1997.
I met an American woman, Dorothy, who loved and accepted me as her son.
I rode a free taxi when I went to the Wnt-meeting in NY because I am Thai.
I remember all the retreats put up by the Department of Pathology.
I remember Christmas and New Year’s Parties at Dr.Chuong’s house.
I remember SMGSA events that I participated in as a board member.
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
134
BIBLIOGRAPHY
Aoki, M., Yamashita, T., Tohyama, M., 2004. EphA receptors direct the differentiation
of mammalian neural precursor cells through a mitogen-activated protein kinase-
dependent pathway. J Biol Chem. 279, 32643-32650.
Atit, R., Conlon, R.A., Niswander, L., 2003. EGF signaling patterns the feather array by
promoting the interbud fate. Developmental Cell 4, 231-240.
Baker, R. K., Antin, P. K., 2003. Ephs and ephrins during early stages of chick
embryogenesis. Dev. Dyn. 228, 128-142.
Batlle E., Henderson JT., Beghtel H , Van den Bom MMW., Sanjo E., Huls G, Meeidijk
J., Robertson J., Van de Wetering M., Pawson T., Clevers H., 2002. P-Catenin and TCF
mediate cell positioning in the intestinal epithelium by controlling the expression of
Eph/EphrinB. Cell 111, 251-263.
Beckmann, M.P., Cerretti, D.P., Baum, P., Vanden Bos, T., James, L., Farrah, T.,
Kozlosky, C., Hollingsworth, T., Shilling, H., Maraskovsky, E., et al., 1994. Molecular
characterization of a family of ligands for eph-related tyrosine kinase receptors. EMBO
J. 13, 3757-3762.
Bogenrieder, T., Herlyn, M., 2003. Axis of evil: molecular mechanisms of cancer
metastasis. Oncogene. 22, 6524-6536.
Bossing, T., Brand, A. H., 2002. Dephrin, a transmembrane ephrin with a unique
structure, prevents intemeuronal axons from exiting the Drosophila embryonic CNS.
Development 129, 4205-4218.
Cadoret, A., Ovejero, C., Saadi-Kheddouci, S., Souil, E., Fabre, M., Romagnolo, B.,
Kahn, A., 2001. Hepatomegaly in transgenic mice expressing an oncogenic form of P-
Catenin. Cancer Res. 61, 3245-3249.
Capdevila, J., Tabin, C., Johnson, R.L., 1998. Control of dorsoventral somite patterning
by Wnt-1 and P-Catenin. Dev. Biol. 193, 182-194.
Carlson, B.M., 1999. Formation of the liver. In “Human embryology & developmental
biology”, pp. 337-347. Mosby, Missouri.
Cassiman, D., Libbrecht, L., Desmet, V., Denef, C., Roskams, T., 2002. Hepatic stellate
cell/myofibroblast subpopulations in fibrotic human and rat livers. J Hepatol. 36, 200-
209.
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
135
Chang, CH., Jiang, T.X., Lin, CM., Burras, L.W., Chuong, C M., Widelitz, R.B.,
2004. Distinct Wnt members regulate the hierarchical morphogenesis of skin regions
(spinal tract) and individual feathers. MechDev. 121, 157-171.
Chen, T., Yang, I., Irby, R , Shain, K.H., Wang, H.G., Quackenbush, J., Coppola, D.,
Cheng, J.Q., Yeatman, T.J., 2003. Regulation of caspase expression and apoptosis by
adenomatous polyposiscoli. Cancer Res.63, 4368-4374.
Chodankar, R., Chang, C.H., Yue, Z., Jiang, T.X., Suksaweang, S., Burras, L.W.,
Chuong, CM., Widelitz, R.B., 2002. Shift of Localized Growth Zones Contributes to
Skin Appendage Morphogenesis: Role of the Wnt/-catenin Pathway. JID. 120, 20-26.
Chuong, CM., Edelman, G.M., 1985. Expression of cell-adhesion molecules in
embryonic induction. I. Morphogenesis of nestling feathers. J Cell Biol. 101, 1009-
1026.
Chuong, C.M., 1998. Morphogenesis of epithelial appendages: Variations on top of a
common theme and implications in regeneration. In “Molecular basis of epithelial
appendage Morphogenesis” (C.M. Chuong, Ed), pp. 1-13. RG. Landes company,
Texas.
Chuong, C M., Chodankar, R , Widelitz, RB., Jiang, T.X., 2000. Evo-devo of feathers
and scales: building complex epithelial appendages. Curr. Opin. Genet. Dev. 10, 449-
456.
Chuong, C.M., Patel, N., Lin, J., Jung, H.S., Widelitz, R.B., 2000. Sonic hedgehog
signaling pathway in vertebrate epithelial appendage morphogenesis: perspectives in
development and evolution. Cell Mol. Life Sci. 57, 1672-1681.
Chuong, C.M., Homberger, D.G., 2003. Development and evolution of the amniote
integument: current landscape and future horizon. J Exp Zoolog B Mol Dev Evol. 298,
1- 11.
Compagni, A., Logan, M., Klein, R., Adams, R.H., 2003. Control of skeletal patterning
by ephrinBl-EphB interactions. Developmental Cell 5, 217-230.
Cooke, J.E., Moens, C.B., 2002. Boundary formation in the bindbrain: Eph only it were
simple. TRENDS in Neurosciences 25, 260-267.
Cooper, H.M., 2002. Axon guidance receptors direct growth cone pathfinding: rivalry at
the leading edge. Int J Dev Biol. 46, 621-631.
Davy, A., Aubin, J., Soriano, P., 2004. Ephrin-Bl forward and reverse signalings are
required during mouse development. Genes & Development 18, 572-583.
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
136
Ekataksin, W., Wake, K., 1991. Liver units in three dimensions: I. Organization of
argyrophilic connective tissue skeleton in porcine liver with particular reference to the
"compound hepatic lobule". Am J Anat. 191, 113-153.
Feng, J.Q., Harris, M. A., Ghosh-Choudhury, N., Feng, M., Mundy, G.R., Harris, S.E.,
1994. Structure and sequence of mouse morphogenetic protein-2 gene (BMP-2):
comparison of the structures and promoter regions of BMP-2 and BMP-4 genes.
Biochim. Biophys. Acta 1218, 221-224
Field, H.A., Ober, E.A., Roeser T., Stainier, D.Y., 2003. Formation of digestive system
in zerafish. I. Liver morphogenesis. Dev. Biol. 253, 279-290.
Gallin, W.J., Edelman, G.M., Cunningham, B.A., 1983. Characterization of L-CAM, a
major cell adhesion molecule from embryonic liver cells. Proc. Natl. Acad. Sci. 80,
1038-1042.
Gallo, G., Yee, H.F. Jr., Letoumeau, P.C. (2002) Actin turnover is required to prevent
axon retraction driven by endogenous actomyosin contractility. J Cell Biol. 158, 1219-
1228.
Gallo, G., Letoumeau, P.C., 2004. Regulation of growth cone actin filaments by
guidance cues. JNeurobiol. 58, 92-102.
Glinka, A., Wu, W., Delius, H., Monaghan, AP., Blumenstock, C., Niehrs, C., 1998.
Dickkopf-1 is a member of a new family of secreted proteins and functions in head
induction. Nature 391, 357-362.
Gu, C., Park, S., 2003. The pi 10 gamma PI-3 kinase is required for EphA8-stimulated
cell migration. FEBS Lett. 540, 65-70.
Gumucio, J.J., Berkowitz, C.M.,Webster, S.T., Thornton, A.J., 1996. In “Liver and
biliary diseases” (N. Kaplowitz, Ed), pp. 3-19. Williams & Wilkins, Maryland,.
Hamburger, V., Hamilton, H.L., 1951. A series of normal stages in the development of
the chick embryo. J. Morphol. 88, 49-92 (reprinted in Dev. Dyn. 1992. 195, 231-272).
Hamilton, Boyd, and H.W. Mossman. Human Embryology. Cambridge: Macmillan,
1976.
Harada, N., Miyoshi, H., Murai, N., Oshima, H., Tamai, Y., Oshima, M., Taketo, M.M.,
2002. Lack of tumorigenesis in the mouse liver after adenovims-mediated expression of
a dominant stable mutant of |3-Catenin. Cancer Res. 62, 1971-1977.
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
137
Harris, M.P., Fallon, J.F., Prum, R.O., 2002. Shh-Bmp2 signaling module and the
evolutionary origin and diversification of feathers. J Exp Zool. 294,160-176.
Harris, M.P., Linkhart, B.L., Fallon, J.F., 2004. Bmp7 mediates early signaling events
during induction of chick epidermal organs. Dev Dyn. 231,22-32.
He, T-C., Sparks, A.B., Rago, C., Hermeking, H., Zawel, L., Costa, L.T., Morin, P.J.,
Vogelstein, B., Kinzler, K.W., 1998. Identification of c -Myc as a target of the APC
pathway. Science 281, 1509-1512.
Hillier, L.W., Miller, W., Birney, E., Warren, W., Hardison, R.C., Ponting, C.P., Bork,
P., Burt, D.W., Groenen, M. A., Delany, M.E., Dodgson, J.B., Chinwalla, A.T., Cliften,
P.F., Clifton, S.W., Delehaunty, K.D., Fronick, C., Fulton, R.S., Graves, T.A.,
Kremitzki, C., Layman, D., Magrini, V., McPherson, J.D., Miner, T.L., Minx, P., Nash,
W.E., Nhan, M.N., Nelson, J.O., Oddy, L.G., Pohl, C.S., Randall-Maher, J., Smith,
S.M., Wallis, J.W., Yang, S.P., Romanov, M.N., Rondelli, C.M., Paton, B., Smith, J.,
Morrice, D., Daniels, L., Tempest, H.G., Robertson, L., Masabanda, J.S., Griffin, D.K.,
Vignal, A., Fillon, V., Jacobbson, L., Kerje, S., Andersson, L., Crooijmans, R.P., Aerts,
J., van der Poel, J.J., Ellegren, H., Caldwell, R.B., Hubbard, S.J., Grafham, D.V.,
Kierzek, A.M., McLaren, SR., Overton, I.M., Arakawa, H , Beattie, K.J., Bezzubov,
Y., Boardman, P.E., Bonfield, J.K., Croning, M.D., Davies, R.M., Francis, M.D.,
Humphray, S.J., Scott, C.E., Taylor, R.G., Tickle, C., Brown, W.R., Rogers, J.,
Buerstedde, J.M., Wilson, S.A., Stubbs, L., Ovcharenko, I., Gordon, L., Lucas, S.,
Miller, M.M., Inoko, H., Shiina, T., Kaufman, J., Salomonsen, J., Skjoedt, K., Wong,
G.K., Wang, J., Liu, B., Wang, J., Yu, J., Yang, H., Nefedov, M., Koriabine, M.,
Dejong, P.J., Goodstadt, L., Webber, C., Dickens, N.J., Letunic, I., Suyama, M.,
Torrents, D., von Mering, C., Zdobnov, E.M., Makova, K., Nekrutenko, A., Elnitski, L.,
Eswara, P., King, D.C., Yang, S., Tyekucheva, S., Radakrishnan, A., Harris, R.S.,
Chiaromonte, F., Taylor, J., He, J., Rijnkels, M., Griffiths-Jones, S., Ureta-Vidal, A.,
Hoffman, M.M., Severin, J., Searle, S.M., Law, A.S., Speed, D., Waddington, D.,
Cheng, Z., Tuzun, E., Eichler, E., Bao, Z., Flicek, P., Shteynberg, D.D., Brent, M.R.,
Bye, J.M., Huckle, E.J., Chatteiji, S., Dewey, C., Pachter, L., Kouranov, A.,
Mourelatos, Z., Hatzigeorgiou, A.G., Paterson, A.H., Ivarie, R., Brandstrom, M.,
Axelsson, E., Backstrom, N., Berlin, S., Webster, M.T., Pourquie, O., Reymond, A.,
Ucla, C., Antonarakis, S.E., Long, M., Emerson, J.J., Betran, E., Dupanloup, I.,
Kaessmann, H., Hinrichs, A. S., Bejerano, G., Furey, T.S., Harte, R.A., Raney, B.,
Siepel, A., Kent, W.J., Haussler, D., Eyras, E., Castelo, R , Abril, J.F., Castellano, S.,
Camara, F., Parra, G., Guigo, R., Bourque, G., Tesler, G., Pevzner, P.A., Smit ,A.,
Fulton, L.A., Mardis, E.R., Wilson, R.K.; 2004. International Chicken Genome
Sequencing Consortium. Sequence and comparative analysis of the chicken genome
provide unique perspectives on vertebrate evolution. Nature 432, 695-716.
Hogan, B.L.M., 1999. Morphogenesis. Cell 96, 225-233.
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
138
Imondi, R., Kaprielian, Z., 2001. Commissural axon pathfinding on the contralateral
side of the floor plate: a role for B-class ephrins in specifying the dorsoventral position
of longitudinally projecting commissural axons. Development. 128, 4859-4871.
Ishigaki, K., Namba, H., Nakashima, M., Nakayama, T., Mitsutake, N., Hayashi, T.,
Maeda, S., Ichinose, M., Kanematsu, T., Yamashita, S., 2002. Aberrant localization of
beta-catenin correlates with overexpression of its target gene in human papillary thyroid
cancer. J. Clin. Endocrinol. Metab. 87, 3433-3440.
Jamora, C., DasGupta, R., Kocieniewski, P., Fuchs, E., 2003. Links between signal
transduction, transcription and adhesion in epithelial bud development. Nature 422,
317-322.
Jeng, Y.M., Wu, M.Z., Mao, T.L., Chang, M.H., Hsu, H.C., 2000. Somatic mutations of
P-catenin play a crucial role in the tumorigenesis of sporadic hepatoblastoma. Cancer
Lett. 152, 45-51.
Jiang, T.X., Chuong, C.M., 1992. Mechanism of skin morphogenesis. I. Analyses with
antibodies to adhesion molecules tenascin, N-CAM, and integrin. Dev Biol. 150, 82-98.
Jiang, T.X., Stott, N.S., Widelitz, R.B., Chuong, C.M., 1998. Current methods in the
study of avian skin appendages. In “Molecular basis of epithelial appendage
Morphogenesis” (CM. Chuong, ed), pp. 395-408. R.G. Landes company, Texas.
Jiang, T.X., Jung, H-S., Widelitz, R. B., Chuong, C.M., 1999. Self-organization of
periodic patterns by dissociated feather mesenchymal cells and the regulation of size,
number and spacing of primordia. Development 126, 4997-5009.
Jiang, T.X., Widelitz, R.B., Shen, W.M., Will, P., Wu, D.Y., Lin, C M., Jung, H.S.,
Chuong, C.M., 2004. Integument pattern formation involves genetic and epigenetic
controls: feather arrays simulated by digital hormone models. Int J Dev Biol. 48, 117-
135.
Johnson, R.L., Tabin, C.J., 1997. Molecular models for vertebrate limb development.
Cell 90, 979-990.
Jones, C.M., Smith, J.C., 1998. Establishment of a BMP-4 morphogen gradient by long-
range inhibition. Dev Biol. 194, 12-17.
Jung, H.S., Francis-West, P.H., Widelitz, R.B., Jiang, T.X., Ting-Berreth, S., Tickle, C.,
Wolpert, L., Chuong, C.M., 1998. Local inhibitory action of BMPs and their
relationships with activators in feather formation: implications for periodic patterning.
Dev Biol. 196, 11-23.
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
139
Jung, J., Zheng, M., Goldfarb, M., Zaret, K.S., 1999. Initiation of mammalian liver
development from endoderm by fibroblast growth factors. Science 284, 1998-2002.
Kengaku, M., Capdevila, J., Rodriguez-Esteban, C., De La Pena, J., Johnson, R.L.,
Belmonte, J.C.I., Tabin, C.J. 1998. Distinct WNT pathways regulating AER formation
and dorsoventral polarity in the chick limb bud. Science 280, 1274-1277.
Kiefer, J.C., 2003. Molecular mechanisms of early gut organogenesis: a primer on
development of the digestive tract. Developmental Dynamics 228, 287-291.
Lawson, N.D., Scheer, N., Pham, V.N., Kim, C.H., Chitnis, A.B., Campos-Ortega, J.A.,
Weinstein, B.M., 2001. Notch signaling is required for arterial-venous differentiation
during embryonic vascular development. Development. 128, 3675-3683.
Le Douarin, N.M., 1975. An experimental analysis of liver development. Med. Biol. 53,
427-455.
Lemaigre, F., Zaret, K.S., 2004. Liver development update: new embryo models, cell
lineage control, and morphogenesis. Curr Opin Genet Dev. 14, 582-590.
Loftus, S.K., Larson, D.M., Watkins-Chow, D., Church, D.M., Pavan, W.J. 2001.
Generation of RCAS vectors useful for functional genomic analyses. DNA Res. 8, 221-
226.
Lu, J., Chuong, CM., Widelitz, R.B., 1997. Isolation and characterization of chicken P-
Catenin. Gene 196, 201-207.
Lucas, A.M., Stettenheim, P R , (eds) (1972). Avian anatomy - Integument.
Agricultural handbook 362: Agricultural research services (US Department of
Agriculture, Washington DC).
Maderson, P.F., 2004. Bom in a follicle-a historical perspective. Differentiation. 72,
466-73.
Mandler, M., Neubuser, A., 2004. FGF is required for initiation of feather placodes
development.
McLennan, R., Krull, C.E., 2002. Ephrin-as cooperate with EphA4 to promote trank
neural crest migration. Gene Expr. 10, 295-305.
Matsumoto, K., Yoshitomi, H., Rossant, J., Zaret, K., 2001. Liver organogenesis
promoted by endothelial cells prior to vascular function. Science, 294: 559-563.
Michalopoulos, G.K., 1990. Liver regeneration: molecular mechanisms of growth
control. FASEB J. 4, 176-87.
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
140
Michalopoulos, G.K., DeFrances, M.C., 1997. Liver regeneration. Science 276, 60-66.
Michalopoulos, G.K., Bowen, W.C., Mule, K., Luo, J., 2003. HGF-, EGF-, and
dexamethasone-induced gene expression patterns during formation of tissue in hepatic
organoid cultures. GeneExpr. 11, 55-75.
Monga, S.P., Pediaditakis, P., Mule, K., Stolz, D.B., 2001. Michalopoulos GK. Changes
in Wnt/p-Catenin pathway during regulated growth in rat liver regeneration. Hepatology
33, 1098-1109.
Monga, S.P., Monga, H.K., Tan, X , Mule, K., Pediaditakis, P., Michalopoulos, G.K.,
2003. P-Catenin antisense studies in embryonic liver cultures: Role in proliferation,
apoptosis, and lineage specification. Gastroenterology 124, 202-216.
Moody, S. A., 2004. To differentiate or not to differentiate: regulation of cell fate
decisions by being in the right place at the right time. Cell Cycle. 3, 564-566.
Murphy-Ullrich, J.E., 2001. The de-adhesive activity of matricellular proteins: is
intermediate cell adhesion an adaptive state? J. Clin. Invest. 107, 785-790.
Noramly, S., Freeman, A., Morgan, B.A., 1999. beta-catenin signaling can initiate
feather bud development. Development. 126, 3509-3521.
Noren, N.K., Pasquale, E.B., 2004. Eph receptor-ephrin bidirectional signals that target
Ras and Rho proteins. Cellular Signalling 16, 655-666.
Ogawa, K., Pasqualini, R , Lindberg, R.A., Kain, R., Freeman, A.L., Pasquale, E.B.,
2000. The ephrin-Al ligand and its receptor, EphA2, are expressed during tumor
neovascularization. Oncogene 19, 6043-6052.
Ogita, H., Kunimoto, S., Kamioka, Y., Sawa, H., Masuda, M., Mochizuki, N., 2003.
EphA4-mediated Rho activation via Vsm-RhoGEF expressed specifically in vascular
smooth muscle cells. Circ. Res. 93, 23-31.
Oike, Y., Ito, Y., Hamada, K., Zhang, X-Q., Miyata, K., Arai, F., Inada, T., Araki, K.,
Nakagata, N., Takeya, M., Kizanuki, Y. Y., Yanagisawa, M., Gale, N. W., Suda, T.,
2002. Regulation of vasculogenesis and angiogenesis by EphB/ephrin-B2 signaling
between endothelial cells and surrounding mesenchymal cells. Blood 100, 1326-1333.
Orford, K., Orford, C.C., Byers, S.W., 1999. Exogenous expression of P-catenin
regulates contact inhibition, anchorage-independent growth, anoikis, and radiation-
induced cell cycle arrest. J. Cell Biol. 146, 855-867.
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
141
Oster, S.F., Deiner, M., Birgbauer, E., Sretavan, D.W., 2004. Ganglion cell axon
pathfinding in the retina and optic nerve. Semin Cell Dev Biol. 15, 125-136.
Pandur, P., Lasche, M., Eisenberg, L.M., Kuhl, M., 2002. Wnt-11 activation of a non-
canonical Wnt signalling pathway is required for cardiogenesis. Nature 418, 636-641.
Patan, S., 2004. Vasculogenesis and angiogenesis as mechanisms of vascular network
formation, growth and remodeling. JNeurooncol. 50, 1-15.
Patel, K., Makarenkova, H., Jung, H.S., 1999. The role of long range, local and direct
signnalling molecules during chick feather bud development involving the BMPs,
Follistatin and the Eph receptor tyrosine kinase Eph-A4. Mechanisms of Development
86, 51-62.
Pispa, J., Thesleff, I , 2003. Mechanisms of ectodermal organogenesis. Dev Biol. 262,
195-205.
Polakis, P., 2000. Wnt signaling and cancer. Genes Dev. 14, 1837-1851.
Rossi, J.M., Dunn, N.R., Hogan, B.L.M., Zaret, K.S., 2001. Distinct mesodermal
signals, including BMPs from the septum transversum mesenchyme, are required in
combination for hepatogenesis from the endoderm. Genes & Dev. 15, 1998-2009.
Poliakov, A., Cotrina, M., Wilkinson, D.G., 2004. Diverse roles of Eph receptors and
ephrins in the regulation of cell migration and tissue assembly. Developmental Cell 7,
465-480.
Prum, R.O., 1999. Development and evolutionary origin of feathers. J Exp Zool. 285,
291-306.
Rossi, J.M., Dunn, N.R., Hogan, B.L., Zaret, K.S., 2001. Distinct mesodermal signals,
including BMPs from the septum transversum mesenchyme, are required in
combination for hepatogenesis from the endoderm. Genes Dev. 15, 1998-2009.
Sage, P.B., Bail, B.L., Balabaud, C., 1999 Oxford textbook of Clinical Hepatology
second edition volume 1 section 1-13 (J. Bircher, ed), pp 13-21. Oxford Medical
Publication, NY.
Saito, T., Oda, Y., Sakamoto, A., Tamiya, S., Kinukawa, N., Hayashi, K., Iwamoto, Y.,
Tsuneyoshi, M., 2000. Prognostic value of the preserved expression of the E-cadherin
and catenin families of adhesion molecules and of (3-Catenin mutations in synovial
sarcoma. J. Pathol. 192, 342-350.
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
142
Saitoh, T., Mine, T., Katoh, M., 2002. Expression and regulation of WNT8A and
WNT8B mRNAs in human tumor cell lines: up regulation of WNT8B mRNA by beta-
estradiol in MCF-7 cells, and down-regulation of WNT8A and WNT 8B mRNAs by
retinoic acid inNT2 cells. Int. J. Oncol. 20, 999-1003.
Santiago, A., and Erickson, C. A., 2002. Ephrin-B ligands play a dual role in the control
of neural crest cell migration. Development 129, 3621-3632.
Sengel, P., and Mauger, A., 1976. Peridermal cell patterning in the feather-forming skin
of the chick embryo. Dev Biol. 51, 166-171.
Serras, F., Fraser, S., Chuong, C.M., 1993. Asymmetric patterns of gap junctional
communication in developing chicken skin. Development. 119, 85-96.
Sorkin, B.C., Gallin, W.J., Edelman, G.M., Cunningham, B.A., 1991. Genes for two
calcium-dependent cell adhesion molecules have similar structures and are arranged in
tandem in the chicken genome. Proc. Natl. Acad. Sci. 88, 11545-11549.
Stein, E., Lane, A.A., Cerretti, D.P., Schoecklmann, H.O., Schroff, A.D., Van Etten,
R.L., Daniel, T.O., 1998. Eph receptors discriminate specific ligand oligomers to
determine alternative signaling complexes, attachment, and assembly responses. Genes
& Development 12, 667-678.
Steinle, J.J., Meininger, C.J., Chowdhury, U., Wu, G., Granger, H.J., 2003. Role of
ephrin B2 in human retinal endothelial cell proliferation and migration. Cell Signal. 15,
1011-1017.
Sturz, A., Bader, B., Thierauch, K.H., Glienke, J., 2004. EphB4 signaling is capable of
mediating ephrinB2-induced inhibition of cell migration. Biochem Biophys Res
Commun. 313, 80-88.
Suksaweang, S., Lin, C.M., Jiang, T.X., Hughes, M.W., Widelitz, R.B., Chuong, C.M.,
2004. Morphogenesis of chicken liver: identification of localized growth zones and the
role of beta-catenin/Wnt in size regulation. Dev. Biol. 266, 109-122.
Tickle, C., Wolpert, L., 2002. The progress zone — alive or dead? Nat. Cell. Biol. 4,
E216-217.
Ting-Berreth, S.A., Chuong, C.M., 1996. Local delivery of TGF beta2 can substitute for
placode epithelium to induce mesenchymal condensation during skin appendage
morphogenesis. Dev Biol. 179, 347-359.
Twigg, S.R.F., Kan, R., Babbs, C., Bochukova, E.G., Robertson, S.P., Wall, S.A.,
Morriss-Kay, G.M., Wilkie, A.O.M., 2004. Mutations of ephrin-Bl (EFNB1), a marker
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
143
of tissue boundary formation, cause craniofrontonasal syndrome. Proc. Natl. Acad. Sci.
101, 8652-8657.
Utsunomiya, T., Doki, Y., Takemoto, H., Shiozaki, H., Yano, M., Sekimoto, M.,
Tamura, S., Yasuda, T., Fujiwara, Y., Monden, M., 2001. Correlation of beta-catenin
and cyclin D1 expression in colon cancers. Oncology 61, 226-233.
Vessey, C.J., Hall, P.M., 2001. Hepatic stem cells: A review. Pathology, 33, 130-141.
Vindis, C., Teli, T., Cerretti, D.P., Turner, C.E., Huynh-Do, U., 2004. EphBl-mediated
cell migration requires the phosphorylation of paxillin at Tyr-31/Tyr-l 18. J Biol Chem.
279, 27965-27970.
Wang, X., Montini, E., Al-Dhalimy, M., Lagasse, E., Finegold, M., Grompe, M., 2002.
Kinetics of liver repopulation after bone marrow transplantation. Am. J. Pathol. 161,
565-574.
Wang, Z., Cohen, K., Shao, Y., Mole, P., Dombkowski, D., Scadden, D.T., 2004.
Ephrin receptor, EphB4, regulates ES cell differentiation of primitive mammalian
hemangioblasts, blood, cardiomyocytes, and blood vessels. Blood. 103,100-109.
Warren, M.F., Hamilton, P.B., 1981. Glycogen storage disease type X caused by
ochratoxin A in broiler chickens. Poult. Sci. 60, 120-123.
Weeraratna, A.T., Jiang, Y., Hostetter, G., Rosenblatt, K., Duray, P., Bittner, M., Trent,
J.M., 2002. Wnt5a signaling directly affects cell motility and invasion of metastatic
melanoma. Cancer Cell 1, 279-288.
Wei, Y., Fabre, M., Branchereau, S., Gauthier, F., Perilongo, G., Buendia, M.A., 2000.
Activation of beta-catenin in epithelial and mesenchymal hepatoblastomas. Oncogene
19, 498-504.
Widelitz, R.B., Jiang, T.X., Noveen, A., Chen, C.W., Chuong, C.M., 1996. FGF induces
new feather buds from developing avian skin. J Invest Dermatol. 107, 797-803.
Widelitz, R.B., Chuong, C.M., 1999. Early events in skin appendage formation:
induction of epithelial placodes and condensation of dermal mesenchyme. J Investig
Dermatol Symp Proc. 4, 302-306.
Widelitz, R.B., Jiang, T.X., Lu, J., Chuong, C.M., 2000. beta-catenin in epithelial
morphogenesis: conversion of part of avian foot scales into feather buds with a mutated
beta-catenin. Dev. Biol. 219, 98-114.
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
144
Wu, P., Jiang, T.X., Suksaweang, S., Widelitz, R.B., Chuong, C.M., 2004. Molecular
shaping of the beak. Science 305, 1465-1466.
Yu, M., Wu, P., Widelitz, R.B., Chuong, C.M., 2002. The morphogenesis of feathers.
Nature. 420, 308-312.
Zaret, K.S., 2000. Liver specification and early morphogenesis. Mech. Dev. 92, 83-88.
Zaret, K.S., 2002. Regulatory phases of early liver development: paradigms of
organogenesis. Nat. Rev. Genet. 3, 499-512.
Zechner, D., Fujita, Y., Hulsken, J., Muller, T., Walter, I., Taketo, M. M., Crenshaw,
III, E.B., Birchmeier, W., Birchmeier, C., 2003. P-Catenin signals regulate cell growth
and the balance between progenitor cell expansion and differentiation in the nervous
system. Dev. Biol. 258, 406-418.
Zhang, W., Yatskievych, T.A., Baker, R.K., Antin, P.B., 2004. Regulation of Hex gene
expression and initial stages of avian hepatogenesis by Bmp and Fgf signaling. Dev
Biol. 268, 312-326.
Zhong, X., Ran, Y.L., Lou, J.N., Hu, D., Yu, L., Zhang, Y.S., Zhou, Z., Yang, Z.H.,
2004. Construction of human liver cancer vascular endothelium cDNA expression
library and screening of the endothelium-associated antigen genes. World J
Gastroenterol. 10, 1402-1408.
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.

Linked assets

University of Southern California Dissertations and Theses

Conceptually similar

PDF

Molecular basis of early liver development: A study focused on the role of beta-catenin

PDF

Mechanisms of strain-dependent angiogenesis

PDF

Molecular classification, diagnosis and prognosis of pediatric rhabdomyosarcoma by oligonucleotide microarray analyses

PDF

Studies of two factors, osteopontin expression and timing of androgen ablation, in prostate tumor progression

PDF

Mechanisms of acquisition of molecular genetic changes during tumor development and progression

PDF

Adaptation of a novel electrochemical detection methodology to immunochemical -based assays

PDF

Post-translational modification of nucleolin by monoubiquitylation in human ovarian carcinoma cells

PDF

Progesterone signaling in ovarian epithelial tumors

PDF

T regulatory cell based immunotherapy for the treatment of cancer

PDF

Role of intestinal hormone glucagon -like peptide-1 (GLP-1) in glycemic regulation

PDF

Molecular mechanisms of androgen independence in prostate cancer

PDF

Oxygen metabolism, chromosome breaks, and cell death: The role of the nonhomologous DNA end joining pathway in maintaining genomic stability

PDF

Cytokine regulation of retinal pigment epithelial cell function and behavior

PDF

The clinical significance, detection and biological characteristics of occult metastasis in breast cancer

PDF

Structure-function studies on the mammalian intestinal dipeptide transporter hPEPT1

PDF

Regulation of cell cycle G(1) phase progression by the EWS-FLI1 fusion gene

PDF

Physiological energetics during the larval and metamorphic stages of marine invertebrates

PDF

Potential factors contributing to diaphragm myopathy in congestive heart failure

PDF

Replication -competent retroviral vectors for highly efficient and tumor -selective gene delivery

PDF

B7.1 fusion proteins for cancer immunotherapy

Asset Metadata

Creator Suksaweang, Sanong (author)

Core Title Morphogenesis of epithelial organs, liver and skin appendage

Degree Doctor of Philosophy

Degree Program Pathobiology

Publisher University of Southern California (original), University of Southern California. Libraries (digital)

Tag biology, animal physiology,health sciences, pathology,OAI-PMH Harvest

Language English

Contributor Digitized by ProQuest (provenance)

Permanent Link (DOI) https://doi.org/10.25549/usctheses-c16-334364

Unique identifier UC11335715

Identifier 3180312.pdf (filename),usctheses-c16-334364 (legacy record id)

Legacy Identifier 3180312.pdf

Dmrecord 334364

Document Type Dissertation

Rights Suksaweang, Sanong

Type texts

Source University of Southern California (contributing entity), University of Southern California Dissertations and Theses (collection)

Access Conditions The author retains rights to his/her dissertation, thesis or other graduate work according to U.S. copyright law. Electronic access is being provided by the USC Libraries in agreement with the au...

Repository Name University of Southern California Digital Library

Repository Location USC Digital Library, University of Southern California, University Park Campus, Los Angeles, California 90089, USA