University of Southern California Dissertations and Theses

The role of endoplasmic reticulum chaperones in adipogenesis, liver cancer and mammary gland development

(USC Thesis Other)

The role of endoplasmic reticulum chaperones in adipogenesis, liver cancer and mammary gland development

PDF

Download a page range

Download transcript

Copy asset link

Request this asset

Transcript (if available)

Content
THE ROLE OF ENDOPLASMIC RETICULUM CHAPERONES IN ADIPOGENESIS,
LIVER CANCER AND MAMMARY GLAND DEVELOPMENT

by

Genyuan Zhu

A Dissertation Presented to the
FACULTY OF THE USC GRADUATE SCHOOL
UNIVERSITY OF SOUTHERN CALIFORNIA
In Partial Fulfillment of the
Requirements for the Degree
DOCTOR OF PHILOSOPHY
(GENETIC, MOLECULAR AND CELLULAR BIOLOGY)

May 2015

Copyright 2015 Genyuan Zhu

ii
DEDICATION

To all my family members, who have been supporting me all the way here with their
understanding and love.

iii
ACKNOWLEDGEMENTS
First and foremost, I would like to express my sincere appreciation to my mentor,
Dr. Amy Lee, for her passionate support throughout my Ph.D. study. Under her excellent
guidance, Lee l a b became a n academically enriched and pleasurable environment to
work in, which turned me to be a co nfid ent and compe t ent scient i st .
I owe my deepest gratitude to my wonderful committee members. Dr. Louis
Dubeau for his many insightful suggestions, helpful consultations on histology and
pathology and the tremendous amount of inspiration and support. Dr. Young Hong for the
helpful discussions, insightful ideas and supportive encouragement. I would also like to
thank Dr. Jason K. Kim for the wonderful collaboration, inspiring discussions and
resource support, which cont rib u ted to th e c o ntent in Ch apter 2. Dr. Bangyan Stiles, Dr.
Gary Kanel and Dr. Chengyu Liang for their supportive opinions and resource support,
which contributed to the content in Chapter 3. Dr. Si-Yi Chen and Dr. Peter Gray for
significant collaboration and contribution to the content in Chapter 4. Lastly, Dr. Yvonne
Lin and her lab for the meaningful discussions and advices regarding experiments.
I am grateful to be able to conduct my work on the foundation built by previous
Lee lab members: Shengzhan Luo, Changhui Mao, Jianze Li, Peter Baumeister, Yong Fu,
Min Ni, Shiuan Wey, Risheng Ye, Miao Wang, Kyle Pfaffenbach, Hui Zhou, Dezheng
Dong, Michelle Pong and Kate Ott. I also greatly appreciate the academic support and
iv
personal companion from my current Lee lab members: Chun-Chih Tseng, Wan-Ting
Chen, Jieli Shen, Yi Zhang, Yuan-Li Tsai, Daisy Flores, Dat Ha and John Johnson.
This dissertation would not have been possible without the generous technical
support and advice from Denis Alexander Trana and Mo-Li Chen from the USC Norris
Comprehensive Cancer Center Translational Pathology Core, Ernesto Barron, Douglas
Hauser and David R. Hinton from the USC Norris Comprehensive Cancer Center Cell
and Tissue Imaging Core, Michelle Mac Veigh from the Cell and Tissue Imaging Core of
the USC Research Center for Liver Diseases, Dae Young Jung, Randall H. Friedline, and
Vivian M. Benoit from the University of Massachusetts Medical School, Shanshan He
form Dr. Chengyu Liang’s lab and Sung-Hyung Lee from Dr Si-Yi Chen’s lab in USC.
Finally, I would like to thank my parents and other family members in China and
my boyfriend, who have always been there for me and provided me with unconditional
love and support throughout the adventures and experiences of my life.

v
TABLE OF CONTENTS
DEDICATION ii
ACKNOWLEDGEMENTS iii
LIST OF TABLES vii
LIST OF FIGURES viii
ABSTRACT x

Chapter 1: Overview and Introduction 1
1.1 Endoplasmic reticulum (ER) 1
1.1.1 End o pl asmic r e t i cul u m homeost a sis 1
1.1.2 GRP78 and its functions 3
1.1.3 GRP94 and its functions 5
1.2 A d ipose t i ss u e 7
1.2.1 A d ipose t i ss u e 7
1.2.2 ER and ad i p o se t issu e 9
1.3 Liver cancer 11
1.3.1 Li v e r and l i pid me t a bol i sm 11
1.3.2 ER st r ess and l i pid me t a bol i sm of l i v e r 12
1.3.3 Li v e r canc er and GRP7 8 13
1.4 Mammary gland 14
1.4.1 Mammary gland development 14
1.4.2 Regulation of mammary gland 15
1.4.3 ER and mammary gland 16

Chapter 2: GRP78 plays an essential role in adipogenesis and postnatal
growth in mice

18

2.1 Introduction 18
2.2 Materials and methods 20
2.3 Results 26
2.3.1 GRP78 is required for adipocyte differentiation in vitro 26
2.3.2 Adipose deletion of Grp78 gene leads to lipodystrophy
(aP2-Cre; c78
f/f
)
30
2.3.3 Residual white adipose tissue (WAT) from aP2-Cre;
c78
f/f
mice shows reduced lipid accumulation and grossly
dilated ER
32
2.3.4 aP2 mediated inactivation of the Grp78 gene results in
growth retardation, bone reduction and early mortality
34
2.3.5 Conditional knockout of the Grp78 gene by aP2-Cre 38
vi
recombinase alters glucose homeostasis and adipokine
secretion
2.4 Discussion 40

Chapter 3: GRP78 as a regulator of liver steatosis and cancer progression
mediated by loss of the tumor suppressor PTEN

45
3.1 Introduction 45
3.2 Materials and methods 47
3.3 Results 50
3.3.1 Creation of the mouse model with biallelic deletion of
GRP78 and PTEN in the liver (cPten
f/f
Grp78
f/f
)
50

3.3.2 GRP78 reduction in PTEN-null livers promote liver
steatosis, liver injury and bile duct proliferation
55
3.3.3 cPten
f/f
Grp78
f/f
livers showed increased proliferation,
progenitor cell expression and GRP78 re-expression in bile
duct cells Context-dependent expression of Ms4a3 in LSK cells
58

3.3.4 Perturbation of selective signaling pathways in
cPten
f/f
Grp78
f/f
livers
60

3.3.5 Accelerated HCC and CC development and
repopulation of GRP78-positive cells in cPten
f/f
Grp78
f/f
livers
62
3.4 Discussion 65

Chapter 4: Differential requirement of GRP94 and GRP78 in mammary
gland development

72
4.1 Introduction 72
4.2 Materials and methods 74
4.3 Results 80
4.3.1 Generation of MMTV-Cre mediated GRP94 knockout
mouse model (cGrp94
f/f
)
80
4.3.2 cGrp94
f/f
mammary glands displayed normal pubertal
and post-pubertal ductal morphogenesis
83
4.3.3 MMTV-Cre; Grp78
f/f
mammary glands showed only
slight reduction of GRP78 expression (cGrp78
f/f
)
86
4.3.4 cGrp78
f/f
mammary glands showed normal pubertal and
post-pubertal ductal morphogenesis
88
4.3.5 78
f/f
and cGrp78
f/f
mammary glands exhibited similar
distribution of different sub-lineages and outgrowth in
mammary transplant
91
4.3.6 GRP78 is required for mammary gland regeneration 93
4.4 Discussion 94

Chapter 5: Conclusions and Perspectives

BIBLIOGRAPHY
100

116
vii
LIST OF TABLES
Table 1.1: Primer sequences for Realtime PCR using extracts from MEFs

23
Table 2.1: Primer sequences for Realtime PCR using extracts from livers

50

viii
LIST OF FIGURES
Figure 1.1: GRPs in the unfolded protein response and the stress response

4
Figure 2.1: GRP78 is required for adipogenesis from embryonic fibroblasts.

28
Figure 2.2: Knockdown of GRP78 suppresses adipocyte differentiation in 3T3-
L1 preadipocytes

29
Figure 2.3: The mating strategy for the knockout mice

30
Figure 2.4: Adipose deletion of Grp78 leads to lipoatrophy

31
Figure 2.5: Residual white adipocytes from c78
f/f
mice display reduced lipid
accumulation and dilated endoplasmic reticulum

33
Figure 2.6: aP2-Cre mediated knockout of Grp78 results in developmental
defects

35
Figure 2.7: Expression level of GRP78 in organs of aP2-Cre; Grp78
f/f
mice

37
Figure 2.8: aP2-Cre mediated knockout of Grp78 alters glucose homeostasis
and adipokine secretion

39
Figure 3.1: Breeding scheme for generation of the 5 groups of mouse cohorts

51
Figure 3.2: Enhanced fat accumulation, bile-duct proliferation, injury and
apoptosis in cP
f/f
78
f/f
livers

52
Figure 3.3: Age-dependent reduction of GRP78 in cP
f/f
78
f/f
and c78
f/f
livers

53
Figure 3.4: Decreased gonadal fat in cP
f/f
78
f/f
mice

54
Figure 3.5: Enhanced fat accumulation, bile-duct proliferation, injury and
apoptosis in cP
f/f
78
f/f
livers

56
Figure 3.6: Analysis of unfolded protein response markers in mouse livers

57
Figure 3.7: cP
f/f
78
f/f
livers exhibited increased proliferation, progenitor cell
expansion and GRP78 expression in bile duct cells

59
Figure 3.8: Perturbation of selective signaling pathways in cP
f/f
78
f/f
livers

61
Figure 3.9: p-S6K and S6K expression analysis in mouse livers

62

ix
Figure 3.10: Accelerated HCC and CC formation and GRP78 re-expression in
cP
f/f
78
f/f
livers

64
Figure 3.11: GRP78 was upregulated in cP
f/f
liver tumors

68
Figure 3.12: P62 expression analysis in mouse livers

71
Figure 4.1: Breeding scheme for generation of Grp94
f/f
(94
f/f
) and MMTV-Cre,
Grp94
f/f
(c94
f/f
) mice

80
Figure 4.2: Generation of MMTV-Cre mediated GRP94 knockout mouse model

82
Figure 4.3: Ductal morphogenesis of c94
f/f
mammary glands

84
Figure 4.4: Morphology and proliferation of c94
f/f
mammary epithelium

85
Figure 4.5: Breeding scheme for generation of Grp78
f/f
(78
f/f
) and MMTV-Cre,
Grp78
f/f
(c78
f/f
) mice

86
Figure 4.6: Generation of MMTV-Cre, Grp78
f/f
mouse model

87
Figure 4.7: Ductal morphogenesis of c78
f/f
mammary glands

88
Figure 4.8: Morphology of c78
f/f
mammary epithelium

90
Figure 4.9: Analysis of sub-lineages of c78
f/f
mammary glands and efficiency of
conditional gene recombination

92
Figure 4.10: GRP78 is required for mammary gland regeneration

94

x
Abstract
The endoplasmic reticulum (ER) is an essential cellular compartment for protein
folding and secretion, and lipid synthesis and transport. Recent studies show that the
function of ER chaperone proteins is not limited to simply folding nascent peptides, but
they are also involved in mammalian development and several human diseases, such as
diabetes, obesity, cancer progression, and tumor immunity. To establish the direct link
between ER chaperones and human disease, several transgenic mouse models where the
gene encoding for the ER chaperone protein was conditionally deleted have been
constructed in this dissertation. The two ER chaperone we studied are glucose regulated
protein 78 (GRP78) and glucose regulated protein 94 (GRP94).
To investigate the role of GRP78 in adipogenesis and metabolic homeostasis, we
knocked down GRP78 in mouse embryonic fibroblasts and 3T3-L1 preadipocytes
induced to undergo differentiation into adipocytes. We also created an adipose Grp78
knockout mouse utilizing the aP2 (fatty acid binding protein 4) promoter driven Cre-
recombinase. Adipogenesis was monitored by molecular markers and histology. Tissues
were analyzed by micro-CT and electron microscopy. Glucose homeostasis and cytokine
analysis were performed. Our results indicate that GRP78 is essential for adipocyte
differentiation in vitro. aP2-cre mediated GRP78 deletion leads to lipoatrophy with about
90% reduction in gonadal and subcutaneous white adipose tissue and brown adipose
tissue, severe growth retardation, and bone defect. Despite severe abnormality in adipose
xi
mass and function, adipose Grp78 knockout mice showed normal plasma triglyceride
levels, and plasma glucose and insulin levels were reduced by 40~60% compared to wild-
type mice, suggesting enhanced insulin sensitivity. The endoplasmic reticulum is grossly
expanded in the residual mutant white adipose tissue. Thus, these studies establish that
GRP78 is required for adipocyte differentiation, glucose homeostasis and balanced
secretion of adipokines. Unexpectedly, the phenotypes and metabolic parameters of the
mutant mice, which showed early postnatal mortality, are uniquely distinct from
previously characterized lipodystrophic mouse models.
To further study the roles of GPR78 and ER in metabolic diseases, we
investigated another lipid processing organ: liver. Genetic knockout models of GRP78
revealed that GRP78 maintains homeostasis of metabolic organs, including liver,
pancreas and adipose tissues. Hepatocellular carcinoma (HCC) and cholangiocarcinoma
(CC) are the most common liver cancers. There is a lack of effective therapeutics for
HCC and CC, highlighting the need to further understand liver tumorigenic mechanisms.
PTEN, a tumor suppressor that antagonizes the PI3K/AKT pathway, is inactivated in a
wide range of tumors, including 40-50% of human liver cancers. To elucidate the role of
GRP78 in liver cancer, we created a mouse model with biallelic liver-specific deletion of
Pten and Grp78 mediated by Albumin-Cre-recombinase (cP
f/f
78
f/f
). Interestingly, in
contrast to PTEN, deletion of GRP78 was progressive but incomplete. At 3 months,
cP
f/f
78
f/f
livers showed hepatomegaly, activation of lipogenic genes, exacerbated steatosis
xii
and liver injury, implying that GRP78 protects the liver against PTEN-null mediated
pathogenesis. Furthermore, in response to liver injury, we observed increased
proliferation and expansion of bile duct and liver progenitor cells in cP
f/f
78
f/f
livers.
Strikingly, bile duct cells in cP
f/f
78
f/f
livers maintained wild-type (WT) GRP78 level while
adjacent areas showed GRP78 reduction. Analysis of signaling pathways revealed
selective JNK activation, β-catenin downregulation, along with PDGFR α upregulation,
which was unique to cP
f/f
78
f/f
livers at 6 months. Development of both HCC and CC was
accelerated and evident in cP
f/f
78
f/f
livers at 8-9 months, coinciding with intense GRP78
expression in the cancer lesions, and GRP78 expression in adjacent normal areas reverted
back to the WT level. In contrast, c78
f/f
livers showed no malignancy even at 14 months.
These studies reveal GRP78 is a novel regulator for PTEN-loss mediated liver injury and
cancer progression.
In parallel with the study on GRP78 in metabolic organs, this dissertation also
revealed mammary gland specific requirements for GRP94 and GRP78, including
selection for allele retention of Grp78. Here we report the consequences of mammary-
targeted knockout of these GRPs. Our studies revealed that MMTV-Cre, Grp94
f/f

mammary glands, despite GRP94 deficiency, exhibited normal proliferation and ductal
morphogenesis. Interestingly, MMTV-Cre, Grp78
f/f
mammary glands displayed only
slightly reduced GRP78 protein levels, associating with the retention of the non-
recombined Grp78 floxed alleles in isolated mammary epithelial cells and displayed
xiii
phenotypes comparable to wild-type glands. In contrast, transduction of isolated Grp78
f/f

mammary epithelial stem/progenitor cells with adenovirus expressing GFP and Cre-
recombinase was successful in GRP78 ablation, and the GFP sorted cells failed to give
rise to repopulated mammary glands in de-epithelialized recipient mice. These studies
imply GRP78, but not GRP94, is required for mammary gland development.
In summary, studies in this dissertation disclosed the comprehensive roles of ER
chaperone GRP78 in regulating homeostasis of metabolic organs, namely adipose tissue
and liver, and mammary gland development. In addition, GRP94 is not required for
mammary gland development in mice.
1
Chapter 1
Overview and Introduction
1.1 Endoplasmic reticulum
1.1.1 Endoplasmic reticulum homeostasis
The endoplasmic reticulum (ER) is a specialized perinuclear organelle where
secretory and membrane proteins, as well as lipids, are synthesized. Protein folding in the
ER follows same principles that govern cytosol protein folding. During or after
translation, A predominately hydrophobic signal sequence directs nascent polypeptides
transverse the ER membrane into the ER. Within the lumen of the ER, protein chaperones
assist in folding of newly synthesized polypeptides and prevent aggregation of unfolded
or misfolded protein (Ni and Lee 2007). In the lumen of ER, transmembrane and
secretory proteins undergo a series of processes, including folding into native
conformation and posttranslational modification, which are carried out by foldase,
molecular chaperones and lectins (Schröder and Kaufman 2005).
Delicate quality control exists in the ER to avoid accumulation of misfolded
protein and unfolded proteins. Abnormal protein conformations are a major cause for
disturbed homeostasis; therefore perturbations in the ER are thought to be the origin of
many diseases and development abnormalities (Schröder and Kaufman 2005). ER stress
occurs when there is an excess influx of nascent and unfolded polypeptides or impaired
2
folding machinery. Signal transduction cascades, termed the unfolded protein response
(UPR), are activated to recover the ER to its normal physiological state. In both yeast and
mammalian systems, ER stress can be induced by pharmacologic agents which cause
misfolded proteins and underglycosylated proteins. In higher eukaryotes there are other
unique stress inducers, including microenvironment of solid tumor (glucose starvation,
low pH and hypoxia), embryonic development and mood-altering drugs (alcohol,
valproate) (A S Lee 2001). To overcome these barriers, the UPR provides elaborate and
complicated mechanisms to increase the biosynthetic capacity and decrease the burden of
ER to restore homeostasis. However, if ER stress is too severe to be rescued, the UPR can
also induce apoptotic pathways.
In addition to secreted and membrane protein synthesis and secretion, the ER is a
critical site for maintaining all aspects of lipid metabolism, including lipid synthesis,
modification and export (S. Fu, Watkins, and Hotamisligil 2012). For example, under low
ER cholesterol, cholesterol and fatty acid synthesis is initiated via release of Sterol
Regulatory Element-Binding Protein (SREBP) from the ER membrane to nucleus. When
cells are exposed to excess fatty acids, the formation of lipid droplets from esterified fatty
acid also occurs within the ER membrane (Brasaemle and Wolins 2012). ER proteins are
also required for lipid trafficking and secretion.

3
1.1.2 GRP78 and its functions
The most abundant ER chaperone and UPR master regulator is glucose regulated
protein 78 (GRP78/BiP), which is responsible for maintaining the permeability barrier of
the ER during protein translocation, guiding protein folding and assembly and targeting
misfolded proteins for degradation (Ma and Hendershot 2004). Through interaction with
exposure of hydrophobic region on surface of unfolded protein, GRP78 recognizes and
binds to the unfolded protein with low affinity. Therefore, GRP78 has a broad substrate
spectrum and interacts with early folding intermediates starting from their translocation
across the ER membrane. To prevent malfolded protein produced in the ER from
secretion, a quality control process guided these malfolded protein for degradation by
cytosolic proteasomes through ER associated degradation system (ERAD). GRP78 and
ERdj5 were found in a ERAD complex, which recognizes and unfolds malfolded proteins
for their efficient retrotranslocation to cytosol (Ushioda et al. 2008).
GRP78 is also important for storing ER calcium, sensing conditions of ER stress
and activating the mammalian UPR. As shown in Fig 1.1 (A. Lee 2014), it is thought that
all three UPR pathways converge at the point of GRP78 association with the ER-resident
stress sensors inositol-requiring kinase 1 (IRE1), activating transcription factor 6 (ATF6)
and PKR-like eukaryotic initiation factor 2 αkinase (PERK). Accumulated unfolded
proteins titrate GRP78 away from associations with these proteins, freeing them for
activation and the induction of the UPR (Rutkowski and Kaufman 2004). The net effect
4
of the activation of these three molecules is to decrease the load of proteins entering the
ER by attenuating translation, and increase the efflux of nascent proteins by either
facilitating their folding through augmented chaperone synthesis or stimulating their
degradation (Rutkowski and Kaufman 2004).

Figure 1.1 GRPs in the unfolded protein response and the stress response (A. Lee 2014). ER luminal
GRP78 functions as a UPR signaling regulator by binding to and maintaining the ER stress sensors PERK,
ATF6 and IRE1 in inactive forms. Upon ER stress, GRP78 is titrated away through binding to misfolded
proteins. This triggers the UPR, as exemplified by the dimerization of PERK and IRE1, and triggers the
activation of their downstream signaling pathways, which leads to arrest of translation and ERAD. The
UPR also generates the active nuclear form of ATF6 (ATF6(N)), as well as ATF4 and the spliced form of X
box-binding protein 1 (XBP1s). Nonetheless, UPR can also induce transcription of the pro-apoptotic
5
transcription factor CHOP; and following release from GRP78, caspase 7 and caspase 12 are activated,
thereby triggering apoptosis.
Accumulating evidence indicates that a subfraction of GRP78 localizes at the cell
surface under pathological conditions, such as in cancer cells (Pfaffenbach and Lee 2011;
Lee 2007). Cell surface GRP78 acts as a multifunctional receptor to regulate signaling
pathways, such as activating the PI3K/AKT signaling for cancer survival and
proliferation (Gonzalez-Gronow et al. 2009; Ni, Zhang, and Lee 2011).
In summary, GRP78 is not only critical for protein quality control in the ER and
regulation of the UPR, but also, important regulator of various signaling pathways via
surface subfraction. Therefore, GRP78 is required for many essential cellular processes,
such as stress-induced autophagy (Li et al. 2008), cell proliferation, protecting the inner
cell mass from apoptosis during early mouse embryonic development (S Luo et al. 2006)
and maintenance of hematopoietic homeostasis (Wey, Luo, and Lee 2012).
1.1.3 GRP94 and its functions
Another important ER chaperone is glucose regulated protein 94 (GRP94), which
is the most abundant glycoprotein in the ER. GRP94 is instrumental in the initiation of
both the innate and adaptive immune response (Yang and Li 2005). Recently there are
accumulating data that show the role of GRP94 in chaperoning protein folding,
interacting with other components of the ER protein folding machinery, storing calcium
and assisting in the targeting of misfolded proteins to ERAD (Eletto, Dersh, and Argon
6
2010). Unlike GRP78, GRP94 directs folding and assembly of secreted and membrane
proteins with a selective client list (Eletto, Dersh, and Argon 2010). The clients of GRP94
are beginning to emerge, such as histocompatability class I (MHC I), Insulin-like growth
factor II (IGF II), Toll like receptor I (TLR1) and a subset of integrins (Eletto et al. 2010;
Liu and Li 2008). Recently, a study showed that the vaccination of mice with the tumor-
derived stress proteins GRP94 elicited antitumor immune responses, which yield a
marked suppression of tumor growth and metastasis. This was due to the involvement of
GRP94 in the cellular pathways responsible for the generation, processing, and/or
assembly of peptide antigens onto nascent major MHC I (Nicchitta, Carrick, and Baker-
lepain 2004). Using proteomic studies, investigators observed that GRP94 is suppressed
in circulating tumor cells indicating its possible role in cancer progression (Howard et al.
2008). Acute elimination of GRP94 in the hematopoietic system caused an increase in
hematopoietic stem cell (HSC) and granulocyte-monocyte progenitors in bone marrow, as
well as the failure of the Grp94-knockout HSCs to expression intergin 4 on cell surface,
associating niche detachment (Biquan Luo et al. 2011). Hyperproliferation of liver
progenitor cells was also observed in a liver-specific GRP94 knockout mouse model,
correlating with disruption of cell-cell/cell-matrix interaction (Wan-Ting Chen et al.
2013).
Taken together, the ER is a crucial command center in terms of its participation in
diverse essential cellular activities and potential influences on function of various organs.
ER chaperones including GRP78 and GRP94 are critical components for ER integrity and
7
their functions could be tissue-specific. Therefore, targeting GRP78 or GRP94 in
different organs using transgenic mouse models would extend our understanding of the
ER, which provides basic knowledge for treating a wide variety of diseases due to ER
perturbation.
1.2 Adipose tissue
1.2.1 Adipose tissue
Adipose tissue evolved to meet the need to store excess energy in mammals. In
addition to regulating fat mass and nutrient homeostasis, adipocytes participate in the
immune response, blood pressure control, bone mass and reproductive function through
synthesis and release of hormones (Rosen and Spiegelman 2006). There are two types of
adipose tissues, white adipose tissue (WAT) and brown adipose tissue (BAT) in mammals.
WAT acts mainly to store excess energy in the form of triglycerides (TG) and serves as a
major energy reservoir in mammals. Additionally, WAT functions as an endocrine organ,
as it integrates metabolic signals and regulates energy balance by secreting adipokines
such as leptin, adiponectin, resistin, and tumor necrosis factor α (TNF α) (Rosen and
Spiegelman 2006). Mature white adipocytes have a unique structure in which most
cytoplasm is occupied by one single large lipid droplet. In contrast, BAT mainly plays a
thermoregulatory role by generating non-shivering body heat from metabolism of lipids
(Park, Halperin, and Tontonoz 2008). Brown adipocytes contain multiple small lipid
8
vacuoles and are rich in mitochondria, which is the main organelle to create heat at the
expense of ATP.
Adipose tissues have profound influence on glucose homeostasis. Obesity, which
is rapidly becoming a major health disorder in the developed world, is characterized by
increased mass of WAT and high risk to develop into type 2 diabetes and cardiovascular
disease. However, the mechanism by which obesity causes these disease is elusive.
Previous literature demonstrates resistin, which is a unique signaling molecule secreted
by adipocytes, could potentially links obesity to diabetes (Steppan et al. 2001). In contrast,
lipodystrophy is a rare disease with syndromes of adipose tissue degeneration, which is
also associated with insulin resistance and hyperglycaemia. The metabolic features of
human and mouse lypodystrophy also include fatty liver, dyslipidaemia and elevated
metabolic rate (Savage 2009). Due to reduced numbers of mature adipocytes in
lipodystrophic mice, the defect of adipose tissues as lipid storage is associated with
ectopic lipid accumulation such as liver, which leads to non-alcoholic fatty liver disease
(NAFLD) (Savage 2009). Therefore, revealing the mechanism in lypodystrophic disease
can also shed light on glucose, lipid and protein metabolism, which is important towards
the development of effective preventive and therapeutic strategies to combat the obesity
pandemic.

9
1.2.2 ER and adipose tissue
Adipose tissue derives from the embryonic mesoderm and early developing fat
pad is constituted of fibroblastic-like cells with abundant ER (Gimble and Guilak 2003).
To study molecular regulation in adipogenesis, various celluar models of inducible
adipocyte differentiation have been established, including multipotent stem cell line
(C3H10T1/2), preadipocyte cell line (3T3-L1) and mouse embryonic fibroblasts (MEF)
(Otto and Lane 2005). It is well established that the differentiation to mature adipocytes is
mainly controlled by two transcription families: peroxisome proliferator activated
receptor (PPAR ) and CCAAT/enhancer binding proteins (C/EBPs) (Otto and Lane 2005).
PPAR is a lipid-activated nuclear hormone receptor that heterodimerizes with retinoid X
receptor (RXR) and regulates downstream target gene expression leading to
differentiation into adipocytes (Rosen et al. 1999). C/EBP is a pleiotropic
transcriptional activator of adipogenesis genes by binding to their C/EBP regulatory
consensus, while C/EBP and C/EBPparticipate in the feedback loop to regulate PPAR 
expression. (Park et al. 2008; Cowherd, Lyle, and McGehee 1999; Otto and Lane 2005).
Many other factors have also been shown to contribute to the regulation of adipogenesis,
including components in UPR pathways. 3T3-L1 cells with XBP1 or IRE1  knockdown
demonstrated profound defects in adipogenesis and only spliced form of XBP1 can
rescue the impairment of adipogenesis (Sha et al. 2009). The differentiation of MEFs
into adipocytes induced by transduction with Myc-SREBP1 was attenuated by loss of
10
PERK, with reduced expression of lipogenic enzymes (Bobrovnikova-Marjon et al. 2008).
In the C3H10T1/2 cell line induced to adipogenesis, reduction of ATF6  expression led
to decrease of key adipogenic genes and reduced lipid accumulation (Lowe et al. 2011).
Therefore, all three branches of UPR are indispensible for adipogenesis process.
The specific functions of ER in adipocytes include adipokines synthesis and
secretion, triglyceride (TG) droplet synthesis, and cholesterol and nutrient sensing. Cells
that are specialized for high secretory capacity, such as pancreatic β-cells and plasma
cells, are known to expand their ER capacities to adapt to the increased demand
(Reimold et al. 2001; Federovitch, Ron, and Hampton 2005; Ye et al. 2010). Fibroblast-
like preadipocytes differentiate into mature adipocytes which produce and secrete
abundant adipokines (Rosen and Macdougald 2006; Gregor and Hotamisligil 2007).
Therefore, adipocyte ER may be enhanced to accommodated the increased demand
(Gregor and Hotamisligil 2007). The formation of triglyceride from three fatty acids and
one glycerol is catalyzed by enzymes resident in the ER. These triglyceride and
cholesterol are stored as a form of lipid droplet, which is a spherical structure surrounded
by a single phospholipid membrane layer and associated proteins (Gregor and
Hotamisligil 2007). In addition, ER is very sensitive to nutrient and energy deprivation,
or the excess of nutrients. The nutrient fluctuation may be recognized by the ER via ER
stress and subsequent UPR. Thus, ER plays a major role in cholesterol and nutrient
sensing, which are important functions of adipocytes.
11
In summary, investigating impact of the ER in adipocyte biology can increase our
knowledge regarding adipose tissue on whole body metabolic health.
1.3 Liver cancer
1.3.1 Liver and lipid metabolism
The liver is a central organ for whole body homeostasis due to its various functions,
including carbohydrate metabolism, glycogen storage, biosynthesis of amino acids and
nucleotides, production of plasma proteins and hormones, and lipid metabolism (Tanaka
et al. 2011). Diet fat, carbohydrate and protein are digested to fatty acids, glucose and
amino acids respectively. The fatty acids transported to liver are converted to acyl-CoA,
which are shuttled to mitochondria for -oxidation to generate acetyl-CoA. Acetyl-CoA is
oxidized through citric acid cycle to yield energy or exits to cytosol for production of
triglycerides and cholesterol (Wakil and Abu-Elheiga 2009). The generation of
triglycerides from acetyl-CoA is catalyzed by Acetyl-coenzyme A carboxylase 1 (ACC1)
and fatty acid synthase (FAS) subsequently. Triglycerides and cholesterol are stored or
secreted into the circulation as constituents of very low density lipoproteins (VLDL).
Apolipoprotein B 100 (apoB100) is a major protein component of VLDL, which
undergoes hydrolysis by lipoprotein lipase (Skogsberg et al. 2008). The resulting free
fatty acids are taken up by peripheral organs such as adipose tissue.

12
1.3.2 ER stress and lipid metabolism of liver
The level of triglyceride in liver are regulated by diverse mechanisms such as de novo
synthesis, lipolysis, dietary lipid uptake, and delivery/secretion of lipoprotein particles
(Jo et al. 2013). As mentioned previously, ER is the primary organelle for lipid
metabolism, due to the residence of many of the enzymes involved in intermediary and
complex lipid metabolism (S. Fu, Watkins, and Hotamisligil 2012). ER stress and UPR
signaling have been well established to linked to the excessive accumulation of
triglyceride in the liver, which is termed as hepatic steatosis. ER stress in liver can be
induced by oxidative stress, chemical toxicity, hepatic viral infection, metabolic disorders,
and abuse of drug and alcohol (J. Liu et al. 2009). When ER cannot restore the
functionality timely under these conditions, the ER will gradually lose control over
metabolism and its own membrane and folding homeostasis, resulting in pathological
states. This ER stress in turn further deteriorates lipid profile by reducing fatty acid
oxidation, promoting lipolysis, and stimulating de novo lipogenesis (S. Fu, Watkins, and
Hotamisligil 2012). Some major components of UPR are also involved in the regulation
of lipid in liver. Conditional knockout of Xbp1 in the liver resulted in reduced plasma
triglyceride, cholesterol and free fatty acids in mice (Lee and Glimcher 2008). Targeted
deletion of Perk in mammary epithelium revealed that PERK is a physiologically relevant
regulator of the lipogenesis through C/EBP , PPAR , and SREBP1 (Bobrovnikova-
Marjon et al. 2008). When mice were burdened with pharmacological ER stress, wild-
13
type mice can recover from the insult, whereas ATF6 -knockout mice demonstrated liver
dysfunction and steatosis (Yamamoto et al. 2010).
1.3.3 liver cancer and GRP78
Primary liver cancer, which consists predominantly of hepatocelluar carcinoma (HCC)
and cholangiocarcinoma (CC), is the fifth most common cancer worldwide (El-Serag and
Rudolph 2007). Most liver cancers occur in the setting of chronic liver injury and the risk
factors include hepatitis, chronic alcohol abuse, nonalcoholic steatohepatitis (NASH) and
other metabolic liver diseases (Satdarshan Pal Singh Monga 2011). Under normal
conditions, hepatocytes and cholangiocytes are mitotically dormant, while adult liver has
a potential to regenerate under conditions of severe parenchymal loss (Tanaka et al. 2011).
An expansion of a potential stem cell compartment in the periportal area, referred to as
oval cells, are induced in liver with severe or chronic damage (Tanaka et al. 2011).
GRP78 plays a crucial role in carcinogenesis and is strongly induced in various tumor,
including colon cancer, lung cancer and breast cancer (Amy S Lee 2007). With regard to
hepatocellular carcinoma, GRP78 was found to be constitutively overexpressed in liver
tumor samples from patients compared to surrounding non-tumor regions (Su et al. 2010).
Overexpression of GRP78 in hepatocellular carcinoma cells promoted invasion of cancer
cells in vitro and in vivo (Su et al. 2010). As mentioned previously, UPR is involved with
the metabolic liver disease and GRP78 is the master regulator of UPR. Therefore,
investigating the role of GRP78 in liver diseases will provide new therapeutic
14
possibilities for treatment.
1.4 Mammary gland
1.4.1 Mammary gland development
As an organ that produces milk to feed young offsprings, the mammary gland is the organ
distinguishes mammals for all other animals. The mammary gland is composed of
different cell types, including epithelial cells that form a branched structure, adipocytes,
vascular endothelial cells, fibroblasts and immune cells (Macias and Hinck 2012). Three
major stages of mammary gland development are: embryonic, pubertal and reproductive.
The murine mammary gland, which is derived from ectoderm and mesoderm, starts at
embryonic day 10 under control of signals from mesenchyme (Hennighausen and
Robinson 2005). Before mice are born, the mammary gland develops rudimentary ducts
and a nipple structure and continues growing after birth. Upon puberty, expansive ductal
morphogenesis occurs that fills the fat pad with the epithelial mammary tree. At the end
of growing ducts, a single layer of cap cells at the tip of the terminal end buds (TEBs)
drive the penetration of ducts to the fat pad. Cap cells of TEB differentiate into
myoepithelial cells which is outer layer of the epithelium, while body cells give rise to
luminal epithelial cells (Hennighausen and Robinson 2005). With onset of pregnancy, the
mammary gland go through numerous changes to get ready for lactation. These
transformations are increase in secondary and tertiary ductal branching, followed by
15
alveolar development (Richert et al. 2000). Interstitial adipose tissue disappears as the
proliferating epithelial cells progressively differentiate and expand into alveoli, which
synthesis and secrete milk during lactation. At weaning, involution is initiated to remodel
the lactating mammary gland back to pre-pregnancy stage. Two phases of involution have
been defined: 1) reversible: cell death and limited proteolysis of the extracellular matrix
(ECM); 2) irreversible: alveolar collapse and adipocyte differentiation (Stein, Salomonis,
and Gusterson 2007). Although not yet explicitly identified, mammary epithelial stem
cells are thought to be responsible for expansion of mammary epithelium during puberty
and pregnancy, and regenerative capacity during successive reproductive cycles
(Gudjonsson et al. 2005).
1.4.2 Regulation of mammary gland
The mammary gland development and function are regulated under different and
interrelated compartments, such as growth factors, hormones, adipose tissue and ECM
(Schedin and Hovey 2010). The dysregulation of these compartments could lead to breast
cancer. The postnatal growth of mammary gland is influenced by growth hormone (GH),
estrogen and insulin-like growth factor-1 (IGF1). The alveologenesis during pregnancy is
induced by prolactin (PRL) together with progesterone, and PRL stimulation continues in
lactating mammary glands (Macias and Hinck 2012). Mammary adipose tissues serve as
a source of paracrine and endocrine molecules, such as prolactin, IGF-1 and hepatocyte
growth factor (HGF) (Hovey and Aimo 2010). Additionally, it is highly possible that
16
mammary adipose tissues provide a local sources of lipids and metabolites for the
mammary epithelium (Hovey and Aimo 2010). Mammary gland branching
morphogenesis is partially dependent on the ECM, ECM receptors and ECM degrading
enzymes, which influence many processes such as cell survival, polarity, proliferation,
differentiation and adhesion (Fata, Werb, and Bissell 2004).
1.4.3 ER and mammary gland
Many client proteins of GRP94 participate in the network that regulates mammary gland
development, such as IGF-1 and a subset of integrins (Eletto, Dersh, and Argon 2010).
Since GRP78 is a central regulator of ER homeostasis, GRP78 has been shown to be
critical for many cellular processes. Furthermore, GRP78 is significantly up-regulated in
response to the absence of -casein, indicating its involvement in the assembly of the
casein micelle (Kolb et al. 2011). GRP78 also contributes to the regulation of Cripto
signaling in mammary stem cells (Kelber et al. 2009). Previous evidence show ER stress
induces autophagy and defective autophagy induces ER stress in mammary tumor cells in
vitro and allograft mammary tumors in vivo (Kongara et al. 2010). Additionally, GRP78
is highly upregulated in human breast tumors and autophagy-deficient mammary tumors
(Kongara et al. 2010). PERK, which is the sensor of one branch of UPR, is also involved
in mammary gland function. As shown in a mammary epithelium-targeted Perk deletion
mouse model, sustained expressions of lipogenic enzymes FAS, ACL and SCD1 were
inhibited in mutant mammary gland, which resulted in reduced lipid content and altered
17
lipid composition in the milk (Bobrovnikova-Marjon et al. 2008). PERK was also further
demonstrated to facilitate survival of ECM-detached cells by concomitantly promoting
autophagy, ATP production and an antioxidant response, which may lead to ductal
carcinomas in situ (DCIS) (Avivar-Valderas et al. 2011).
In summary, studying the role of ER chaperones in mammary gland is particularly
valuable to delve further into the many aspects of mammary gland growth and function,
leading to development of cure for breast cancer.

18
Chapter 2
GRP78 plays an essential role in adipogenesis
and postnatal growth in mice
2.1 Introduction
Adipose tissue plays a significant role in energy balance and glucose homeostasis as it
responds to nutrient, neural and hormonal signals, and secretes adipokines that influence
feeding, thermogenesis, immunity, and neuroendocrine function (Rosen and Spiegelman
2006). There are two types of adipose tissues, white adipose tissue (WAT) and brown
adipose tissue (BAT). WAT acts mainly to store excess energy in the form of triglycerides
(TG) and serves as a major energy reservoir in mammals. In addition, WAT functions as
an endocrine organ, as it integrates metabolic signals and regulates energy balance by
secreting large amounts of peptides and inflammatory mediators such as leptin,
adiponectin, resistin, and tumor necrosis factor α (TNF α) (Rosen and Spiegelman 2006).
In contrast, BAT plays a thermoregulatory role by generating non-shivering body heat.
Obesity, which is rapidly becoming a major health disorder in the developed world, is
characterized by increased mass of WAT due to imbalance between energy expenditure
and uptake. Thus, understanding the molecular moieties required for adipogenesis will be
important towards the development of effective preventive and therapeutic strategies to
combat the obesity pandemic.
19
The ER is a specialized perinuclear organelle where secretory and membrane proteins,
as well as lipids, are synthesized. Within the lumen of the ER, protein chaperones assist
in folding of newly synthesized polypeptides and prevent aggregation of unfolded or
misfolded protein (Ni and Lee 2007). In addition to chaperoning proteins, GRP78 is
required for the integrity of the ER structure (Miao Wang et al. 2010). GRP78 also serves
as a master regulator of the UPR that senses ER stress and mounts adaptive responses
(Miao Wang et al. 2009). During ER stress when the protein load exceeds the protein
folding capacity of the ER, GRP78 is induced and assists in transporting misfolded
proteins in the ER lumen to the cytosol for proteasome-mediated degradation (Ushioda et
al. 2008). Professional secretory cells expand their ER capacities to adapt to the increased
demand in protein folding (Reimold et al. 2001; Federovitch, Ron, and Hampton 2005;
Ye et al. 2010). Differentiated adipocytes, as potent endocrine cells, exhibit high
secretory activity (Rosen and Spiegelman 2006; Gregor and Hotamisligil 2007).
Biosynthesis and secretion of large amounts of adipocytokines require molecular
chaperones and folding enzymes in the ER. Thus, GRP78 may be a key determinant for
adipocyte differentiation and a potential therapeutic target for obesity.
To directly investigate the function of GRP78 in vivo, we created mouse models
with knockout and floxed alleles of Grp78. Previous studies suggest that in adult mice,
the requirement of GRP78 for cell survival appears to be cell type specific and content
dependent, although this remains to be determined (S Luo et al. 2006; Miao Wang et al.
20
2010; Y. Fu et al. 2008). In the present study, towards understanding the role of GRP78
in adipogenesis, we knocked down GRP78 expression in MEFs and 3T3-L1 cells induced
to undergo adipocyte differentiation. We also created Grp78 floxed mice harboring the
aP2-Cre-recombinase gene, which has been extensively used to generate conditional
adipose selective inactivation of genes in both WAT and BAT during mouse
development (He et al. 2003). We report here that GRP78 function is essential for
adipogenesis and production and secretion of adipokines. Unexpectedly, we observed
phenotypes and metabolic parameters of the aP2-Cre; Grp78
f/f
mice, referred to below as
the c78
f/f
mice, uniquely distinct from previously characterized lipodystrophic mouse
models. The implications of these results on the specificity of the aP2-Cre system and
novel requirement of GRP78 function in the affected tissues will be discussed.
2.2 Materials and methods
Cell cultures and induction of adipocyte differentiation
Primary MEFs were prepared from E12.5-E14.5 embryos of Grp78
f/f
and
Grp78
+/+
mice following standard protocol (Baerga and Zhang 2009). The primary
Grp78
f/f
or wild type Grp78
+/+
MEFs of passage 3 were seeded into multiwell culture
plates and infected with Ad5-CMV-Cre-GFP (Vector Development Lab) when reached
95% confluency. The next day (day 0), the infected cells were induced to adipocytes with
stimulation medium which is Dulbecco’s Modified Eagle’s Medium (DMEM, glucose at
21
4.5 g/l) supplemented with 10% FBS, 1% penicillin-streptomycin, 0.5 mM 3-isobutyl-1-
methylxanthine (IBMX, Sigma-Aldrich), 1 m dexamethasone (Sigma-Aldrich), 10
g/ml insulin (Sigma-Aldrich) and 5 m Rosiglitazone (Cayman Chemical). On day 2
the medium was replaced by post-stimulation medium (DMEM supplemented with 10%
FBS, 1% penicillin-streptomycin, 5 g/ml insulin and 5 m Rosiglitazone). Fresh post-
stimulation medium was replaced every two days thereafter.
3T3-L1 preadipocytes (passage 7, gift of Dr. My Chouinard, University of
Massachusetts Medical School) were cultured in complete medium (DMEM with 10%
FBS and 1% penicillin-streptomycin). 3T3-L1 preadipocytes were induced to
differentiate into adipocytes as described (Burkart et al. 2011). Briefly, 3 days after full
confluency (Day 0), 3T3-L1 preadipocytes were cultured in complete medium
supplemented with 0.5 mM IBMX, 0.25 m dexamethasone and 10 g/ml insulin for two
days. On Day 2 the medium was replaced by insulin medium (complete medium with 10
g/ml insulin). Fresh insulin medium was replaced every two days thereafter.
Oil Red O staining
Cells were fixed with 10% buffered formalin for 1h, washed 3 times by dH
2
O and
incubated with 60% isopropanol for 5 minutes. The cells were then air dried and stained
with freshly prepared Oil Red O working solution [0.3% Oil red O (Sigma-Aldrich), 60%
isopropanol] for 3 minutes, and washed with water for three times.
22
Lentiviral shRNA infection
Non-silencing-GIPZ lentiviral shRNAmir control (Open Biosystems) and GRP78
shRNA (h2) lentivirus (Santa Cruz catalog number sc-44261-V) were used to infect 3T3-
L1 cells. The GRP78 shRNA (h2) lentivirus particles consist of a pool of three sequences
targeting human Grp78 mRNA, one of which crossreacts with mouse Grp78 mRNA.
3T3-L1 cells in passage 7 were seeded into 48 well plates at 50% confluency. The next
day the cells were pretreated with 250 l DMEM with polybrene (4 g/ml, Sigma-
Aldrich) for 5 minutes. Then the medium was replaced by fresh DMEM, followed by
addition of lentivirus (MOI=2). After 24 hours, the medium was replaced with complete
medium. The infected cells were cultured in 48 wells for 2 days and reached 100%
confluency. Three days after 100% confluency (Day 0), 3T3-L1 preadipocytes were
induced to differentiate as described above.
Realtime PCR
Total RNA was isolated from MEFs using Trizol reagent (Invitrogen) following
the manufacturer’s instructions. First-strand cDNA was synthesized with SuperScript II
(Invitrogen) as described (Ni et al., 2009). Primer sequences are listed in Table 1.1.

23
SREBP-1c Forward 5’-GTTACTCGAGCCTGCCTTCAGG-3’
SREBP-1c Reverse 5’-CAAGCTTTGGACCTGGGTGTG-3’
PPAR- 2 Forward 5’-TCTGGGAGATTCTCCTGTTGA-3’
PPAR- 2 Reverse 5’-GGTGGGCCAGAATGGCATCT-3’
aP2 Forward 5’-GAATTCGATGAAATCACCGCA-3’
aP2 Reverse 5’-CTCTTTATTGTGGTCGACTTTCCA-3’
18S rRNA Forward 5’-ACGGCCGGTACAGTGAAAC-3’
18S rRNA Reverse 5’-GAGGGAGCTCACCGGG-3’
Table 1.1 Primer sequences for Realtime PCR.
Generation of adipose conditional knockout mice
The generation of Grp78
f/f
mice was described previously (S Luo et al. 2006; Y.
Fu et al. 2008). The aP2-Cre transgenic mouse line was obtained from the Jackson
Laboratory. The mating strategy to generate the aP2-Cre; Grp78
f/f
mice and sibling
controls was summarized in Figure 2.3. All protocols for animal use and dissection were
reviewed and approved by the University of Southern California Institutional Animal
Care and Use Committee. Genotyping of Grp78 WT, floxed and KO alleles was
performed with genomic DNA extracted from mouse tails, adipose tissue and liver as
described (Y . Fu et al. 2008).
Tissue processing and histological analysis
Mouse tissues or organs were isolated and fixed in 10% buffered formalin for at
least 24 hours before embedding. Paraffin embedded tissue were sectioned and stained
with hematoxylin and eosin for histological evaluation. Tissues for immunoblotting were
put into liquid nitrogen immediately after isolation and stored at -80°C.
24
Immunoblotting
Tissues or cells were homogenized in ice-cold RIPA buffer containing cocktails of
proteinase inhibitors and phosphatase inhibitors (Pierce), following protocol as described
previously (Ye et al., 2010). Western blot was performed by standard protocol (Ye et al.,
2010). Primary antibodies used were mouse monoclonal anti-GRP78 antibody (1:1000;
gift of Dr. Parkash Gill, Keck School of Medicine of USC), mouse monoclonal anti- β-
actin antibody (1:5000; Sigma-Aldrich) and rabbit polyclonal anti-XBP-1 antibody
(1:500; Santa Cruz Biotechnology).
Electron microscopy and analysis
Fresh tissue was fixed in half strength Karnovsky’s fix (2% paraformaldehyde and
2.5% gluteraldehyde) for 24 hours at 4°C, then postfixed in 1% osmium tetroxide for 2
hours on ice as previously described (Ye et al. 2010). The samples were dehydrated in
serial graded ethanol and then infiltrated in Eponate prior to embedding. Ultrathin
sections were cut at a thickness of 70 nm and stained with uranyl acetate and lead citrate.
The sections were examined on a JEOL JEM 2100 (Peabody) and photographed with the
Orius SC1000B digital camera (Gatan).
Micro-CT imaging of femurs and fat
Micro-CT scanning of femurs was performed with Inveon CT scanner (Siemens).
The preparation of femurs and scanning procedure have been described previously
25
(Verdelis et al. 2011). For fat imaging, mice under deep anesthesia were scanned in the
CT scanner with optimized scan energy and voxel size as described (Bastie et al. 2007;
Luu, Y. K. 2010). Scanning a freshly harvested WAT and BAT identified the upper and
lower thresholds that separated adipose tissue from tissues with different density and
fluids (Bastie et al. 2007). Fat compartments in the abdominal region (lumbar 1 to lumbar
5）were separated and quantified using Amira Software (Luu, Y . K. 2010).
Measurement of body composition and plasma parameters
The following studies were performed at the University of Massachusetts Medical
School and approved by the Institutional Animal Care and Use Committee of the
University of Massachusetts Medical School. Blood was collected from retro-orbital
bleeding in Microtainer Plasma Separator tubes with Lithlium Heparin (Becton
Dickinson) and plasma was prepared. Plasma hormones, cytokines, and lipid levels were
measured using Luminex and Cobas Clinical Chemistry Analyzer (Roche Diagnostics).
Statistical analysis
A two-tailed Student’s t test was applied for all pairwise comparisons. Data are
expressed as mean ± S.E.M. Cochran-Armitage test for trend was performed to examine
the association between the percentage of embryos and postnatal progenies carrying the
aP2-Cre; Grp78
f/f
genotype and age.

26
2.3 Results
2.3.1 GRP78 is required for adipocyte differentiation in vitro
To examine the role of GRP78 in adipogenesis in vitro, several approaches were
used. First, we compared the ability of GRP78 knockout MEFs and wild-type MEFs to
differentiate into adipocytes. To achieve this, we infected MEFs carrying either the wild-
type Grp78
+/+
alleles or the Grp78 floxed alleles with adenovirus containing the Cre-
recombinase gene (Adeno-Cre). MEFs carrying the Grp78
+/+
alleles were not affected by
the Adeno-Cre, and as the cells differentiated into adipocytes upon hormonal stimulation,
a gradual increase in GRP78 protein level was observed (Figure 2.1a and 2.1b). In
contrast, when the Grp78 alleles were deleted from the genome of the Grp78
f/f
MEFs by
Adeno-Cre, the GRP78 protein level was nearly depleted and the GRP78 deficient MEFs
showed significant repression of adipocyte differentiation under the same conditions
(Figure 2.1a and 2.1b). In parallel with GRP78 induction, Grp78
+/+
MEFs showed
gradual increase in a transcription factor, the spliced form of X-box binding protein 1
(XBP-1s) protein level, consistent with the previous finding that XBP-1s is essential for
adipocyte differentiation (Sha et al. 2009). Correspondingly, XBP-1s level was reduced in
the GRP78 deficient MEFs with impaired adipogenesis (Figure 2.1a). We noted that after
Day 10 of Adeno-Cre treatment, a low level of GRP78 and more XBP-1s were detected
in the Grp78
f/f
MEFs, likely due to proliferation of cells that escaped Cre-recombination.
27
Second, to exclude the possibility that the differences in adipocyte differentiation
may be due to intrinsic differences between the Grp78
+/+
and Grp78
f/f
MEFs, the
induction experiment was repeated by comparing Grp78
f/f
MEFs with and without
infection of Adeno-Cre, or the same MEFs infected with an inactive Adeno-Cre. As
shown in Figure 2.1c and 2.1d, Grp78
f/f
MEFs with intact GRP78 were able to
differentiate into adipocytes, in parallel with an increased GRP78 level. In the Adeno-Cre
infected cells, GRP78 was efficiently knocked out, and as observed above, by Day 10, a
low level of GRP78 reappeared. The GRP78 deficient MEFs showed greatly attenuated
differentiation into adipocytes, as compared to non-infected cells or cells infected with
inactive Adeno-Cre (Figure 2.1d and data not shown). In agreement with impairment of
adipogenesis, the transcript levels of adipogenesis markers such as aP2, PPAR- 2 and
SREBP1-c were all reduced in the GRP78 deficient MEFs at Day 4 following hormonal
stimulation (Figure 2.1e). Thus, GRP78 is required for the induction of adipocyte
differentiation in MEFs.

28

Figure 2.1 GRP78 is required for adipogenesis from embryonic fibroblasts. (a) Grp78
+/+
and Grp78
f/f

MEFs were infected with Adenovirus-Cre (Ad-Cre) and induced to differentiate into adipocytes at Day 0.
Western blots were performed to detect the levels of GRP78 and XBP-1s, with β-actin serving as loading
control. (b) Oil Red O staining of MEFs treated in panel A on Day 0 and Day 16. (c) Western blot detection
of GRP78 and β-actin levels in Grp78
f/f
MEFs either non-infected or infected with Ad-Cre. (d) Oil Red O
staining of MEFs treated in panel C on the days indicated. (e) Real time-PCR analysis of adipocyte marker
genes aP2, PPAR- 2, and SREBP1-c in MEFs treated in panel c. Expression levels of each gene were
normalized to the levels of 18S rRNA. The experiment was repeated twice, in duplicate each time. Data are
presented as the means ± S.E. * p<0.05; ** p<0.01. Scale bar shows 50 m and is applicable to all sections.
Third, we examined the effect of GRP78 knockdown on adipocyte differentiation
in cells already committed to the adipocyte lineage. To test this, 3T3-L1 preadipocytes
were infected with either lentivirus targeting GRP78 (sh-GRP78) or lentivirus sh-control
(sh-CON), followed by induction of adipocyte differentiation. As shown in Figure 2.2a,
GRP78 level was gradually upregulated with the differentiation of 3T3-L1 preadipocytes
into adipocytes. 3T3-L1 infected with sh-GRP78 exhibited around 70% lower level of
a b
c e
d
29
GRP78 compared to sh-CON treated cells (Figure 2.2b and 2.2c). We observed
prominent attenuation of adipogenesis with reduced number of both small and large fat
droplets on Day 4 in the sh-GRP78 treated cells; and the reduction in large fat droplets
persisted through Day 8 (Figure 2.2d and 2.2e). Thus, these experiments demonstrate
that knockdown of GRP78 significantly delayed adipocyte differentiation from
preadipocytes in vitro.

Figure 2.2 Knockdown of GRP78 suppresses adipocyte differentiation in 3T3-L1 preadipocytes. (a) 3T3-
L1 cells were induced to differentiate into adipocytes on Day 0 and GRP78 and β-actin levels were
analyzed by Western blot for the days indicated. (b) 3T3-L1 cells infected with either lentivirus sh-control
(sh-CON) or sh-GRP78. The levels of GRP78 and β-actin were detected by Western blot on Day 8 after
induction of differentiation. (c) Quantitation of GRP78 level after normalization to the β-actin level in the
lentivirus infected 3T3-L1 cells in panel B. The data shown are the means ± S.E, * p<0.05. (d) Morphology
of the lentivirus infected 3T3-L1 cells undergoing adipogenesis was examined by light microscopy (Nikon
Eclipse TS100) on the days indicated. Fat droplets were visible starting from Day 4. Scale bar shows 100
a b
c
d e
30
m and is applicable to all sections. (e) Quantitation of number of small (S) and large (L) lipid droplets in
differentiating 3T3-L1 cells at Day 4 and Day 8. The mean level in each group was determined by 4
randomly selected areas on the image. The data are presented as the means ± S.E. * p<0.05; **** p<0.0001.
2.3.2 Adipose deletion of Grp78 gene leads to lipodystrophy
To examine the role of GRP78 in adipogenesis in vivo, we created an adipose
knockout mouse model of GRP78. This was achieved by crossing the Grp78 floxed mice
with the aP2-Cre; Grp78
f/+
mice to generate the aP2-Cre; Grp78
f/f
(c78
f/f
) mice, with
sibling Grp78
f/f
(78
f/f
) mice without the Cre-transgene serving as wild-type controls
(Figure 2.3).

Figure 2.3 The mating strategy for the knockout mice. aP-2-Cre; Grp78
+/+
mice was purchased from the
Jackson Laboratory. The expected ratio of the indicated genotype among the offspring is labeled under each
genotype.
The Cre recombinase mediated GRP78 knockout in adipose tissue was confirmed
by genotyping. Using the genomic DNA extracted from tissues of 78
f/f
and c78
f/f
mice, the
31
Grp78 knockout alleles were detected in WAT and BAT of the c78
f/f
mice, but not in the
liver of the same mice or the same tissues in the 78
f/f
mice (Figure 2.4a). Compared to
the 78
f/f
mice, the c78
f/f
mice displayed about 50% smaller body size and 90% reduction
in the amount of gonadal WAT and BAT (Figure 2.4b). Micro-CT scan analysis further
revealed severe reduction of WAT located in the abdomen and beneath the skin and BAT
located in the lower neck (Figure 2.4c). Quantification of volume of WAT between
abdominal L1 to L5 of the c78
f/f
and 78
f/f
mice (69 and 724 mm
3
respectively) showed a
90% reduction in the c78
f/f
mice (Figure 2.4c).

Figure 2.4 Adipose deletion of Grp78 leads to lipoatrophy. (a) Representative PCR genotyping results from
white (gonadal) and brown adipose tissues (WAT and BAT) and liver isolated from the 78
f/f
and c78
f/f
mice,
using the tail DNA from the indicated genotypes as controls. (b) Representative pictures of 78
f/f
and c78
f/f

mice at postnatal Day 10. Representative pictures of gonadal WAT and BAT from the 78
f/f
and c78
f/f
mice at
postnatal Day 16. Scale bars shows 5 mm. (c) Micro-CT scout views comparing the adiposity of 78
f/f
and
c78
f/f
mice at postnatal Day 23. The WAT was visualized as yellow dots (upper panels) and BAT as red dots
(lower panels). White arrows indicate the locations of subcutaneous WAT and black arrows locations of
abdominal WAT. Scale bar shows 3 mm and is applicable to all sections.
a
b
c
32
2.3.3 Residual WAT from c78
f/f
mice shows reduced lipid accumulation and grossly
dilated ER
As noted above, postnatal c78
f/f
mice only had about 10% the amount of WAT and
BAT compared to the 78
f/f
mice. Western blot analysis of the residual WAT and BAT
showed GRP78 was knocked down in the c78
f/f
mice and the reduction was about 60%
for both types of adipose tissues (Figure 2.5a). Histological examination using H&E
staining revealed that the subcutaneous WAT between skin and muscle layer was about
70% to 80% thinner in the c78
f/f
mice compared to the 78
f/f
control (Figure 2.5b).
Histological analysis of gonadal WAT showed a decrease in lipid accumulation in the
residual adipocytes from the c78
f/f
mice compared to the 78
f/f
mice, suggesting that
GRP78 depletion blunted lipogenic capacity in adipose tissue (Figure 2.5c). Since
GRP78 is a major ER chaperone protein, we next examined the morphology of the ER in
the residual gonadal WAT of c78
f/f
mice. We observed that the WAT of the c78
f/f
mice
showed grossly expanded ER lumen structure, indicative that GRP78 is required for the
integrity of ER in WAT (Figure 2.5d).

33

Figure 2.5 Residual white adipocytes from c78
f/f
mice display reduced lipid accumulation and dilated
endoplasmic reticulum. (a) Left panels: representative Western blot detection of GRP78 level in residual
WAT and BAT isolated from 78
f/f
and c78
f/f
mice, with β-actin serving as loading control. Right panel:
Quantitation of GRP78 level after normalization to the β-actin level (n=3 for each genotype). The data
shown are the means ± S.E. * p<0.05. (b) H&E staining of subcutaneous WAT tissues in 78
f/f
and c78
f/f
mice
at postnatal Day 23 at low magnification (panels a and c) and at high magnification (panels b and d) for the
boxed regions. Scale bars shows 200 m. Arrows denote the boundaries of subcutaneous WAT. (c) H&E
staining of gonadal WAT from 78
f/f
and c78
f/f
mice at postnatal Day 16 at low magnification (panels a and c)
and at high magnification (panels b and d) for the boxed regions. Scale bars show 50 m and apply to all
panels. (d) Representative electron micrographs of white adipocytes from WAT in 78
f/f
mice (panel a) and
c78
f/f
mice (panel b) at postnatal Day 16. In panel a, an enlarged view was included showing normal ER
a
b
c
d
34
structure indicated by white arrows. In panel b, black arrows indicate examples of expanded ER lumen in
the adipocytes of c78
f/f
mice. L denotes the lipid droplet. Scale bars show 0.5 m in all panels.
2.3.4 aP2 mediated inactivation of the Grp78 gene results in growth retardation,
bone reduction and early mortality
While the aP2-Cre transgene is highly expressed in both WAT and BAT, selective
expression in non-adipogenic tissues has been reported (Urs, Harrington, and Liaw 2006;
Martens, Bottelbergs, and Baes 2010). In the course of generating the c78
f/f
mice, we
noted that the birth ratio of the c78
f/f
mice was about 20% (Figure 2.6a), which is only
slightly lower than the expected 25% from the breeding scheme. These data suggest that
deletion of the Grp78 gene by aP2-Cre recombination only had minor effect, if any, on
mouse embryonic survival. The weight at birth of the c78
f/f
mice was about 90% of the
78
f/f
mice, however, the c78
f/f
pups showed minimal gain in body weight after birth and
early mortality (Figure 2.6a and 2.6b). By postnatal Day 3 and 15, the percent of live
c78
f/f
mice dropped to 10.5% and 5.0%, respectively, and by Day 28, none of the c78
f/f

mice was viable (Figure 2.6a and 2.6b). Biostatistics analysis confirmed that the
percentage of embryos and postnatal progenies carrying the aP2-Cre; Grp78
f/f
genotype
decreased with age (Cochran-Armitage Trend Test p<0.001).
In view of the reported gene inactivation in bone and cartilage by the aP2-Cre
recombinase (23), we performed micro-CT scan of the mouse femurs and observed a
60% reduction in the bone volume of the c78
f/f
mice compared to the 78
f/f
mice (Figure
35
2.6c). The pancreas, spleen, liver, kidney, lung and heart exhibited reduced organ size in
proportion to the reduced overall body size of the c78
f/f
mice (Figure 2.6c). These organs
showed similar histological morphology in both genotypes (Figure 2.6e).

Figure 2.6 aP2-Cre mediated knockout of Grp78 results in developmental defects. (a) Summary chart
showing percentage of embryos/mice with the c78
f/f
genotype from embryonic stage E9.5 to E18.5 (n=61)
to postnatal Day 2 to Day 28 (n= 41-181 as indicated for each group). The expected percentage according
to the breeding scheme was 25%. (b) Growth curves of 78
f/f
mice (n=3-7) and c78
f/f
mice (n=2-9) mice from
postnatal Day 3 to 24. Data are expressed as means ± S.E. # denotes p<0.01, and *p<0.05. (c) Quantitation
of Micro-CT scan of femurs from 78
f/f
and c78
f/f
mice at postnatal Day 16. The percent of bone volume (BV)
over total volume (TV) are presented as means ± S.E. (d) Comparison of various organs isolated from 78
f/f

a
b
c d
e
36
and c78
f/f
mice at postnatal Day 10. The cerebellum in the brain was indicated by the arrow. Scale bars
show 2 mm. (e) Representative H&E staining of various organs and the cartilage from 78
f/f
and c78
f/f
mice
at postnatal Day 10. Scale bars show 200 m and apply to all panels.
Western blot analysis of GRP78 level showed minimal difference in the liver and
lung however we observed about 30% reduction (p=0.04) in the kidney of the c78
f/f
mice
(Figure 2.7a). The cerebellum was disproportionally reduced in the brain of the c78
f/f

mice (Figure 2.6d), corresponding with a reduction (about 50%) of GRP78 in brain and
some Purkinje cells in the c78
f/f
mice (Figure 2.7b and 2.7c). Thus, in addition to severe
lipoatrophy, c78
f/f
mice exhibit other developmental defects that could be related to
ectopic aP2-Cre-recombination. These growth abnormalities, coupled with severe
lipoatrophy, may be contributing factors to the early mortality of the c78
f/f
mice.

37

Figure 2.7 Expression level of GRP78 in organs of aP2-Cre; Grp78
f/f
mice. Mice from postnatal Day 21 to
26 were analyzed. (a) Left panels: representative Western blot detection of GRP78 level in liver, lung, and
kidney from 78
f/f
and c78
f/f
mice, with β-actin serving as loading control. Right panels: quantitation of
GRP78 level after normalization to the β-actin level. (b) Western blot detection of GRP78 level in brain
from 78
f/f
and c78
f/f
mice and quantitation. For panels A and B, the data shown are the means ± S.E, *
p<0.05. Statistical significant reduction of GRP78 was detected in the kidney and brain of the c78
f/f
mice.
(c) Immunofluorescence staining for GPR78 in the Purkinje cells of 78
f/f
and c78
f/f
mice. GRP78 staining
was denoted in green. PL denotes Purkinje cell layer. White brackets indicate regions of the PL showing
lower expression of GRP78.

a b
c
38
2.3.5 Conditional knockout of the Grp78 gene by aP2-Cre recombinase alters glucose
homeostasis and adipokine secretion
Adipose tissue is an important endocrine organ which secretes multiple hormones
and cytokines that regulate nutrient environment. We examined whether aP2-Cre
mediated GRP78 knockout leads to perturbations in the plasma profile of metabolic
parameters. Plasma glucose and insulin levels were significantly lower in c78
f/f
mice
compared to 78
f/f
mice, suggesting that c78
f/f
mice are more insulin sensitive (Figure 2.8a
and 2.8b). Circulating C-peptide levels were also reduced by approximately 70% in c78
f/f
mice, suggesting that lower insulin levels are due to reduced insulin secretion, as opposed
to altered insulin clearance, in c78
f/f
mice (Figure 2.8c). Plasma glucagon levels were
significantly lower in c78
f/f
mice, consistent with lower basal glucose levels and enhanced
insulin sensitivity in these mice (Figure 2.8d). Plasma triglyceride levels were normal in
c78
f/f
mice, contrary to other lipodystrophic mouse models that showed elevated plasma
lipid profiles (Figure 2.8e). Plasma leptin levels were very low in c78
f/f
mice, which was
consistent with their lipodystrophic phenotypes (Figure 2.8f). However, leptin level
normalized by the volume of WAT showed minimal difference between c78
f/f
and 78
f/f
mice, consistent with the notion that the reduced leptin level was mostly due to less WAT
(Figure 2.8f). Plasma adiponectin level was not altered in c78
f/f
mice, but resistin level
was markedly lower in c78
f/f
mice (Figure 2.8f and 2.8g). In that regard, resistin is a
well-studied adipokine that negatively regulates insulin action (Steppan et al. 2001).
39
These data indicate that lower resistin levels might be responsible for increased insulin
sensitivity in c78
f/f
mice. Circulating levels of inflammatory cytokines, such as TNF α and
MCP-1, were not affected in the c78
f/f
mice (Figure 2.8g). Plasma GLP-1 levels were not
affected in c78
f/f
mice (Figure 2.8g).

Figure 2.8 aP2-Cre mediated knockout of Grp78 alters glucose homeostasis and adipokine secretion.
Blood parameters of 78
f/f
(n=5-9) and c78
f/f
mice (n=4-11) at postnatal Day 16 to 26. (a) Feeding glucose
level of 78
f/f
and c78
f/f
mice. (b) Insulin level. (c) C-peptide 2 level. (d) Glucagon level. (E) Triglyceride
level. (f) Leptin and Adiponectin levels, both of which are hormones secreted by adipose tissue.
Normalization of leptin to the WAT volume showed minimal difference between the two genotypes. (g)
Resistin, TNF α, MCP-1 (monocyte chemotactic protein-1) and GLP-1 (Glucagon-like peptide-1) levels.
Data are presented as the means ± S.E. *p< 0.05; ** p<0.01; ***p< 0.001; ****p< 0.0001.

a b c
d
e
f
g
40
2.4 Discussion
GRP78 is a major chaperone in the ER and is also a regulator of ER stress
signaling (Ni and Lee 2007; Rutkowski and Kaufman 2004; Pfaffenbach and Lee 2011;
Biquan Luo and Lee 2012), however, its role in adipogenesis is not known. In the present
study, we used both cell culture and conditional knockout mouse models to directly
investigate the requirement of GRP78 in adipogenesis. In the tissue culture systems, we
observed that depletion of GRP78 in MEFs through deletion of the Grp78 floxed alleles
by Adeno-Cre led to impaired adipocyte differentiation and lower expression level of
adipogenic genes. This, coupled with the attenuation of adipogenesis in 3T3-L1
preadipocytes treated with lenti-shGRP78 particles, demonstrate that GRP78 is required
for adipocyte differentiation from MEFs, as well as 3T3-L1 preadipocytes which have
already committed to be adipocytes. Recently, it was reported that a reduction in the
expression of the transcription factor ATF6α in the adipogenic cell line (C3H10T1/2)
resulted in impaired expression of key adipogenic genes and reduced lipid accumulation
following the induction of adipogenesis (Lowe et al. 2011). Since GRP78 is a major
downstream target of ATF6 α (Shengzhan Luo and Lee 2002), GRP78 reduction may be a
contributing factor. Depletion of GRP78 in MEFs induced to differentiate into adipocytes
also correlated with a reduction of the expression of transcription factor XBP-1s. In
agreement, XBP1-deficient MEFs and 3T3-L1 cells exhibited defects in adipogenesis
(Sha et al. 2009). To further examine the role of GRP78 in adipogenesis and whole
41
organism metabolism homeostasis, we created an adipose knockout mouse model of
GRP78, utilizing the aP2-Cre transgene which is highly expressed in WAT and BAT and
has been widely used for creation of adipose-specific knockout mouse models (He et al.
2003).
The novel mouse model reveals that conditional knockout of the Grp78 alleles
using the aP2-Cre-recombinase system caused severe lipoatrophy, growth retardation,
and early mortality. These effects were associated with reduced adipocyte size and lipid
accumulation, and dilated ER lumen in adipocytes of c78
f/f
mice. Growth retardation was
accompanied by overall developmental defects, and severe hypoglycemia in some c78
f/f

mice that appeared sickly (data not shown) could lead to early mortality. Despite severe
lipoatrophy, c78
f/f
mice maintained normal plasma triglyceride levels which contrast with
other lipodystrophic or lipoatrophic mouse models (Ross, Graves, and Spiegelman 1993;
Moitra et al. 1998; Shimomura et al. 1998). Human and animal models of lipodystrophy
have consistently shown profound alterations in lipid metabolism and glucose
homeostasis. HAART-associated lipodystrophic subjects develop ectopic fat
accumulation and type 2 diabetes (Flint et al. 2009). Lipodystrophic mice also develop
marked hypertriglyceridemia, fatty liver, insulin resistance, and type 2 diabetes (Ross,
Graves, and Spiegelman 1993; Moitra et al. 1998; Shimomura et al. 1998). Mice with
targeted expression of an attenuated diphtheria toxin A chain progressively develop
adipocyte atrophy and necrosis from 5 months old and generalized lipodystrophy, insulin
42
resistance, hyperglycemia, dyslipidemia, low leptin levels, and hyperphagia by the age of
9 months (Ross, Graves, and Spiegelman 1993). A-ZIP/F-1 transgenic mice express a
dominant negative protein that prevents the DNA binding of B-ZIP transcription factors
of both the C/EBP and Jun families. As a result, these mice displayed dramatically
reduced WAT from birth, and developed severe hyperglycemia, hyperlipidemia, and
hepatomegaly as early as at 3-4 weeks of age (Moitra et al. 1998). In aP2-SREBP-1c
transgenic mice, which overexpress nSREBP-1c in adipose tissue under the control of the
aP2 promoter, showed immature and smaller white adipocytes, marked insulin resistance,
hyperglycemia, hyperlipidemia, and fatty liver (Shimomura et al. 1998).
In contrast, in the present study lipoatrophic c78
f/f
mice did not develop
hypertriglyceridemia or hyperglycemia. In fact, c78
f/f
mice maintained normal plasma
lipid levels and lower glucose levels. Lower insulin levels indicate enhanced insulin
sensitivity in c78
f/f
mice. These findings suggest that ectopic accumulation of lipids
observed in previous lipodystrophic mouse models may not be simply due to lack of
adipose tissue, but other factors/hormones might be involved in lipid partitioning to non-
adipose organs in these mice. Since ectopic fat accumulation in liver was largely
responsible for insulin resistance in these lipodystrophic mouse models, our findings of
normal liver and plasma lipid profile are consistent with insulin sensitive phenotypes of
c78
f/f
mice. Alternatively, ectopic fat accumulation in other lipodystrophic mice may be
partly due to elevated insulin levels and their role in lipogenesis. Consistent with this
43
notion, c78
f/f
mice showed markedly lower insulin levels which might suppress de novo
lipogenesis in liver. Lower glucagon levels in c78
f/f
mice further suggest that ablation of
GRP78 in adipose tissues may also affect pancreatic islets, thereby reducing both insulin
and glucagon levels.
There are a number of tissue or organ defects outside of WAT and BAT that likely
contribute to the early death of our mouse model. While it is well-established that the
aP2-Cre transgene is highly expressed in both WAT and BAT, it has also been
demonstrated to be active in the trigeminal ganglia, dorsal root ganglia, cartilage
primordia, and vertebrae of developing embryos (Urs, Harrington, and Liaw 2006).
Further, a recent study demonstrated that the aP2 promoter drives gene inactivation in the
ganglia of the peripheral nervous system, adrenal medulla, and neurons throughout the
central nervous system including Purkinje cells in the cerebellum of 4 week old mice
(Martens, Bottelbergs, and Baes 2010). Consistent with these reports, there was a
moderate but detectable reduction of GRP78 level in the kidney in the c78
f/f
mice. GRP78
is required for Purkinje cell survival and function and integrity of the cerebellum (M
Wang et al. 2010). Interestingly, we observed reduction of GRP78 expression in the brain
and some Purkinje cells in the c78
f/f
mice. Another mouse model where aP2-Cre was used
to knockout acetyl-CoA carboxylase 1 exhibited growth retardation and bone defects (J.
Mao et al. 2009). Thus, it is possible that ectopic expression of aP2 in non-adipose tissues
and the critical role of GRP78 for survival and development of those tissues contributed
44
to the bone defects and early mortality of our mouse model. In view of this, ectopic
expression of aP2-Cre should be taken into consideration when it is used to establish
conditional knockout models to study potential regulators of adipose tissue. A novel 5.4
kb adiponectin promoter fragment conveying adipocyte-specific expression of passenger
genes has recently been developed, and this may be useful in generating greater adipose
tissue specificity in transgenic and knockout mouse models (Z. V Wang et al. 2010).
In summary, depletion of GRP78 blocks adipocyte differentiation in vitro and
leads to dramatic decrease in adipose tissues in the conditional knockout model. Despite
severe lipoatrophy, the mutant mice do not exhibit dyslipidemia, fatty liver or type 2
diabetes phenotypes. Rather they exhibit normal plasma triglyceride levels with lower
glucose and insulin levels, which contrast with other lipodystrophic mouse models. Due
to the pleiotrophic expression of the aP2 driven Cre-recombinase in the bone, we
uncovered a novel role of GRP78 in bone development, which warrants further
investigation. The identification of GRP78 as a critical player for adipogenesis suggests
that it could be targeted in adipocyte tissues to reduce adiposity to combat the obesity.

45
Chapter 3
GRP78 as a regulator of liver steatosis and cancer progression
mediated by loss of the tumor suppressor PTEN
3.1 Introduction
GRP78 is commonly upregulated in various tumors due to intrinsic alterations of
cancer cell metabolism and hyperproliferation, as well as extrinsic factors in the tumor
microenvironment, such as glucose deprivation and hypoxia leading to ER stress (Amy S
Lee 2007; Hendershot 2004). In view of previous studies, GRP78 might be required for
PTEN-loss driven tumorigenesis (Y. Fu et al. 2008; Wey et al. 2012). However, several
recent studies suggest that in metabolic organs, the effect of GRP78 deletion is complex
with both primary and compensatory consequences resulting from partial loss of GRP78.
For example, Grp78 heterozygosity protects against high fat diet-induced obesity, type 2
diabetes and pancreatitis in the exocrine pancreas through compensatory mechanisms (Ye
et al. 2009; Ye et al. 2010). In the case of adipose tissues, GRP78 is required for
adipogenesis and glucose homeostasis (Zhu et al. 2013). liver-specific Grp78 knockout
mice, which showed incomplete deletion of GRP78, exhibited impaired insulin signaling
and exacerbated liver injury resulting from alcohol and high fat diet, and were sensitized
to a variety of acute and chronic hepatic disorders (Ji et al. 2011). Taken together, the
effects of GRP78 deletion could be tissue-specific and complex.
46
Hepatocellular carcinoma (HCC) and cholangiocarcinoma (CC) are the most
common primary liver cancers and are associated with poor prognosis. Currently, a
paucity of effective treatments for advanced liver cancers highlights the need to
understand liver tumorigenic mechanisms. Loss of tumor suppressor PTEN activates
PI3K/AKT pathway, leading to cancer progression in a wide variety of human cancers.
Liver-specific PTEN knockout in mice causes fatty liver and liver injury which activates
progenitor cells to become tumor-initiating cells and over time (~12 months) leads to
both HCC and CC development (Stiles et al. 2004; Galicia et al. 2010). The role of
GRP78 on PTEN-loss driven liver cancer development has yet to be determined. Thus,
for the present study, we created a liver-specific biallelic (Pten
f/f
Grp78
f/f
) deletion mouse
model mediated by Alb-Cre, referred to below as cP
f/f
78
f/f
. Previous reports demonstrated
that Alb-Cre is activated at embryonic day 9.5 in fetal hepatoblasts which are common
progenitors of hepatocytes and bile duct cells. However, postnatally, Alb-Cre activity is
maintained in hepatocytes and liver progenitor cells but not in adult bile duct cells (Postic
et al. 1999; Tanaka et al. 2011). Here we characterized the phenotypes of cP
f/f
78
f/f
mice.
Our studies revealed that in the context of PTEN deletion, concomitant GRP78 reduction
in hepatocytes led to increased hepatomegaly, steatosis, liver injury and progenitor cell
proliferation. GRP78 expression in bile duct cells was intact in these mice and bile duct
proliferation was readily observed. At 6 months, we detected selective JNK activation, β-
catenin downregulation, along with PDGFR α upregulation in cP
f/f
78
f/f
livers. At 8-9
months, HCC and CC were clearly identified in cP
f/f
78
f/f
livers, associating with strong
47
GRP78 re-expression. In contrast and despite the development of fatty liver and
inflammation, there was no malignancy detected in livers of Alb-Cre; Grp78
f/f
(c78
f/f
)
mice even at 12-14 months. Overall, these results reveal a novel role of GRP78 in
regulating PTEN-loss mediated liver injury and cancer progression.
3.2 Materials and methods
Mice
Grp78
f/f
mice on a mixed C57BL/6;129/Sv background (Y. Fu et al. 2008; S Luo
et al. 2006) and Pten
f/f
Grp78
f/f
mice on a C57BL/6;6xDBA2;129 background were
previously described (Y. Fu et al. 2008). Pten
f/f
Grp78
f/f
mice were crossed with the
transgenic Alb-Cre; Pten
f/f
(cP
f/f
) mice on a C57BL/6;J129svj background (Galicia et al.
2010) to generate Alb-Cre; Pten
f/f
Grp78
f/f
(cP
f/f
78
f/f
) and Alb-Cre; Pten
f/f
Grp78
f/+

(cP
f/f
78
f/+
) mice. Grp78
f/f
mice were crossed with cP
f/f
78
f/f
mice to generate Alb-Cre;
Grp78
f/f
(c78
f/f
) mice (Figure 3.1). Littermates that were negative for the Cre transgene
were used as WT controls. Male mice were used in all experiments. Genotyping was
performed by PCR using genomic DNA extracted from mouse tails and liver biopsies as
previously described (Y. Fu et al. 2008). Blood samples were collected through retro-
orbital bleeding prior to tissue collection. All protocols for animal use were reviewed and
approved by the USC Institutional Animal Care and Use Committee.

48
Histology
Mice were euthanized and their livers were removed and rinsed in PBS. Samples
collected from the livers were immediately frozen for RNA and protein extraction, fixed
in 10% zinc formalin, or frozen in OCT compound (Tissue-Tek Sakura). Formalin-fixed
tissue samples were embedded in paraffin, sectioned at 4 μm and stained with H&E for
morphology analysis. Frozen tissue samples were sectioned at 10 μm for Oil Red O
staining.
Immunohistochemistry staining
The staining procedures of paraffin sections were performed as described (Y. Fu et al.
2008). Polyclonal rabbit anti-GRP78 (H-129, 1:100, Santa Cruz) antibody was used to
determine GRP78 levels in the liver. Cell proliferation was evaluated by Ki67 staining
(Ab-4, 1:200, Thermo Scientific).
Oil Red O staining
Frozen liver sections were briefly fixed in cold 10% formalin. Slides were stained in Oil
Red O solution (3 mg/ml) and hematoxylin for counterstain.
Plasma alanine aminotransferase (ALT) quantitation
Plasma ALT was determined using ALT Reagent (Raichem).
49
TUNEL assay
Apoptosis was determined using TUNEL staining (Roche Diagnostics).
Western blot analyses
Western blot analyses were performed as described (Y. Fu et al. 2008). Liver samples
were homogenized in RIPA buffer with added protease and phosphatase inhibitor cocktail
(Pierce) and 25 µg cell lysate was subjected to SDS-PAGE. The immunoblot membranes
were incubated with primary antibodies at 4°C overnight and the protein signals were
detected with ECL reagent or SuperSignal West Femto stable peroxide buffer (Pierce)
after reacting with HRP-conjugated secondary antibodies (Santa Cruz). The primary
antibodies used are as follows: Monoclonal mouse anti-GRP78 (1:2000) is a gift of
Parkash Gill (Keck School of Medicine of USC). Monoclonal rat anti-GRP94 (1:5000) is
from Enzo Life Sciences. Mouse anti-PTEN (26H9, 1:1000), rabbit anti-AKT (1:1000),
rabbit anti-p-AKT(Ser473) (1:1000), rabbit anti-ERK1/2 (1:1000) and mouse anti-p-
ERK1/2 (Thr202/Tyr204) (E10, 1:1000) are from Cell Signaling. Rabbit anti-JNK (FL,
1:1000), rabbit anti-p-JNK (G-7, 1:1000) and rabbit anti- β-catenin (H-102, 1:3000) are
from Santa Cruz Biotechnology. Rabbit anti-PDGFR α (N2C2, internal, 1:1000) is from
GeneTex. Mouse anti- β-actin (1:5000) is from Sigma.

50
Real-time quantitative PCR
RNA was extracted from mouse livers and reverse-transcription and real-time
PCR were performed as previously described (Ni et al. 2009). Primers used for AFP,
EpCAM, CK19 and 18S RNA have been described (Galicia et al. 2010; Biquan Luo et al.
2011). The primers were used for lipogenic genes are listed in Table 2.1.
SREBP-1c Forward 5’-GTTACTCGAGCCTGCCTTCAGG-3’
SREBP-1c Reverse 5’-CAAGCTTTGGACCTGGGTGTG-3’
ACC1 Forward 5’- GGACAGACTGATCGCAGAGAAAG -3’
ACC1 Reverse 5’- TGGAGAGCCCCACACACA -3’
FAS Forward 5’- GCTGCGGAAACTTCAGGAAAT -3’
FAS Reverse 5’- AGAGACGTGTCACTCCTGGACTT -3’
Table 2.1 Primer sequences for Realtime PCR.
Statistical analysis
Statistical significance was assayed by 2-tailed Student’s t test, and the error bars reflect
standard error (S.E.).
3.3 Results
3.3.1 Creation of the mouse model with biallelic deletion of GRP78 and PTEN in the
liver
The breeding scheme for the generation of the following five groups of mouse
cohorts is shown in Figure 3.1. They include: 1) single homozygous knockout of Pten
with Alb-Cre

(cP
f/f
); 2) homozygous knockout of Pten and heterozygous knockout of
51
Grp78 with Alb-Cre (cP
f/f
78
f/+
); 3) homozygous knockout of Pten and Grp78 with Alb-
Cre (cP
f/f
78
f/f
); 4) single homozygous knockout of Grp78 with Alb-Cre (c78
f/f
); and 5)
WT derived from littermates without the Alb-Cre transgene serving as normal controls. In
this set of breeding, a different strain of Alb-Cre mice was used from a previous study (Ji
et al. 2011). This allowed us to test if the residual GRP78 observed in c78
f/f
livers was
due to variability of the Cre activity among different transgenic mouse strains.

Figure 3.1 Breeding scheme for generation of the 5 groups of mouse cohorts. The genotypes indicated with
the gray shade were used in this study. All experiments were performed on male mice.
PCR performed with genomic DNA extracted from the livers of the mouse
cohorts validated that the various alleles were excised accordingly. We detected a Pten
knockout band in cP
f/f
mice, a Grp78 knockout band in c78
f/f
mice, and both Pten and
Grp78 knockout bands in cP
f/f
78
f/+
and cP
f/f
78
f/f
mice but not in WT mice (Figure 3.2a).
Western blot analysis of liver lysates isolated from 6 month-old mice showed that PTEN
52
knockout was efficient in cP
f/f
, cP
f/f
78
f/+
and cP
f/f
78
f/f
mice (around 95% reduction
compared to the WT) (Figure 3.2b).

Figure 3.2 Liver-specific PTEN deletion and GRP78 reduction accelerated hepatomegaly. (a)
Representative PCR genotyping results from livers isolated from wild-type (WT, littermates without the
Cre transgene such as P
f/f
78
f/+
and P
f/f
78
f/f
mice), cP
f/f
, cP
f/f
78
f/+
, cP
f/f
78
f/f
and c78
f/f
mice. (b) Western blot
analysis of PTEN, GRP78 and GRP94 levels in livers from mice of the indicated genotypes, with β-actin
serving as the loading control. (c) Representative liver pictures from the indicated genotypes aged from 3 to
14 months. Arrowheads point to nodules on the liver surface. (d) Liver weight to body weight (percentage)
in five types of mice (n=4 to 11) at the age indicated. Data are presented as mean ± S.E. *p<0.05; **p<0.01;
***p<0.001.

a b
c
d
53
As observed previously study (Ji et al. 2011), GRP78 level only decreased
gradually. At 3 months, we detected about 50% reduction of GRP78 in cP
f/f
78
f/f
and c78
f/f

livers and about 70% reduction by 6 months, compared to the WT (Figure 3.3). cP
f/f
78
f/+
livers showed intermediate GRP78 level (Figure 3.2b). In all the mouse cohorts, no
compensatory upregulation of the ER chaperone GRP94 was observed.

Figure 3.3 Age-dependent reduction of GRP78 in cP
f/f
78
f/f
and c78
f/f
livers. (a) Western blot analysis of
GRP78 levels in livers from WT and cP
f/f
78
f/f
mice at 3 and 6 months. (b) Same as a except WT and c78
f/f

livers were analyzed. β-actin was used as the loading control and the experiments were repeated two to
three times. Quantifications of each blot were shown on the right. n=3 for each genotype. Data are
presented as mean ± S.E. **p<0.01.
Morphologically, the size of livers with PTEN deficiency increased significantly
over WT and c78
f/f
livers (Figure 3.2c and d). This is likely due in part to enhanced
a
b
54
insulin signaling in PTEN-null livers resulting in redistribution of body fat to the liver as
previously reported (Stiles et al. 2004). Indeed, fat redistribution was also observed in our
mouse cohorts, with cP
f/f
78
f/f
mice exhibiting even lower body (gonadal) fat than cP
f/f

mice (Figure 3.4a and b).

Figure 3.4. Decreased gonadal fat in cP
f/f
78
f/f
mice. (a) Representative pictures from dissection of mice of
the indicated genotypes at 6-7 months and 8-9 months. The contour of the liver was outlined in white and
gonadal fat in blue. (b) The percentage of gonadal fat weight to body weight in the mice of the indicated
genotypes (n=4-11) at the age of 6-7 months. Data are presented as mean ± S.E. * p<0.05; ** p<0.01.
Livers of cP
f/f
78
f/f
mice exhibited multiple nodules on the surface as early as 6-7
months, while cP
f/f
and cP
f/f
78
f/+
mice started from 8-9 months and c78
f/f
mice from 12-14
months (Figure 3.2c). At 6-7 months, the weight of cP
f/f
78
f/f
livers normalized over body
weight, increased 5-fold compared to WT livers, and 2.5-fold compared to PTEN-null
livers (Figure 3.2d). We observed that cP
f/f
78
f/f
mice were not viable beyond 9 months. In
contrast, the normalized liver weight of c78
f/f
mice remained similar to the WT and these
mice were fully viable. Therefore, hepatic GRP78 reduction accelerated PTEN-null
a
b
55
driven hepatomegaly and abnormal nodule growth.
3.3.2 GRP78 reduction in PTEN-null livers promoted liver steatosis, liver injury and
bile duct proliferation
Consistent with previous reports study (Stiles et al. 2004; Ji et al. 2011),
histological analysis of livers showed mild lipid accumulation in both cP
f/f
and c78
f/f
mice
at 3 months (Figure 3.5a). In contrast, fat droplets were readily evident in cP
f/f
78
f/+
and
cP
f/f
78
f/f
livers (Figure 3.5a). Oil Red O staining further confirmed more severe steatosis
in cP
f/f
78
f/f
livers (Figure 3.5b). Additionally, bile duct proliferation was detected in 2 out
5 cP
f/f
78
f/f
livers at 3 months (Figure 3.5a). In agreement with increased lipid
accumulation, mRNA levels of lipogenic genes SREBP-1c, ACC1 and FAS were
upregulated in cP
f/f
78
f/f
livers, compared to WT and cP
f/f
mice (Figure 3.5c).

56

Figure 3.5. Enhanced fat accumulation, bile-duct proliferation, injury and apoptosis in cP
f/f
78
f/f
livers. (a)
H&E staining of livers from the indicated genotypes at 3 months. Scale bar shows 50 µm. PV: portal vein.
Black arrowheads denote examples of bile ducts. (b) Oil Red O staining of livers from the indicated
genotypes at 3 months. Scale bar shows 100 µm. (c) Real-time quantitative PCR analysis of lipogenic
genes SREBP-1c, ACC1 and FAS in livers of the indicated genotypes at 3 months (n=3 to 7 per genotype
per gene). Expression levels of each gene were normalized to the levels of 18S RNA. (d) Liver injury of
mice aged 3 months and 6 months was measured by plasma ALT test (n=3 to 5). (e) Quantification of
TUNEL-positive cells on liver sections of the indicated genotypes at 3 months. Data are presented as mean
± S.E. *p<0.05, **p<0.01, ***p<0.001.
a
b
c
e d
57
Recent evidence suggests that the transcription factor XBP-1 is a regulator of
hepatic lipogenesis (A.-H. Lee et al. 2008). In the present study, we observed mild Xbp-1
mRNA splicing in c78
f/f
livers which was consistent with previous data (Ji et al. 2011).
However, Xbp-1 splicing was minimal in cP
f/f
78
f/f
livers (Figure 3.6a). ATF4 has also
been implicated in lipogenic gene expression (Chunxia Wang et al. 2010), but we did not
detect increased ATF4 protein level in cP
f/f
78
f/f
livers (Figure 3.6b).

Figure 3.6. Analysis of unfolded protein response markers in mouse livers. (a) The mRNA levels of Xbp-1
in livers of the indicated genotypes at 3 months. Xbp-1(u) and Xbp-1(s) indicate the unspliced and spliced
form of Xbp-1, respectively. The mRNA isolated from mouse embryonic stem cells untreated (-), or treated
with 300 nM thapsigargin (Tg) for 16 hours were used as the negative and positive controls, respectively. (b)
Western blot analysis of ATF4 in livers of the indicated genotypes at 6 months. (c) Western blot analysis of
CHOP in livers of the indicated genotypes at 6 months. The last two lanes are cell lysates from HCT116
cells untreated (-), or treated with 300 nM thapsigargin (Tg) for 16 hours, serving as the negative and
a
c
b
58
positive control, respectively.
We measured liver injury by examining plasma ALT. cP
f/f
78
f/f
mice displayed 1.7-
and 2.3-fold increase in ALT level compared to cP
f/f
mice at 3 and 6 months, respectively,
whereas the ALT level remained at the WT level for c78
f/f
mice (Figure 3.5d). Consistent
with high level of injury, cP
f/f
78
f/f
livers exhibited a 4-fold increase in apoptosis compared
to other genotypes (Figure 3.5e). Nonetheless, the percentage of apoptosis only reached
2% in cP
f/f
78
f/f
livers, thus, overall apoptosis in all genotypes was mild at 3 months.
Furthermore, none of the genotypes analyzed showed an increase in hepatic expression of
the transcription factor CHOP (Ron and Walter 2007), which is often used as an indicator
of ER stress induced apoptosis (Figure 3.6c). This result was consistent with the recent
observation that PTEN deletion inhibits thapsigargin-induced CHOP induction in
hepatocytes isolated from these mice (Zeng et al. 2011).
3.3.3 cP
f/f
78
f/f
livers showed increased proliferation, progenitor cell expansion and
GRP78 re-expression in bile duct cells
Liver injury generally elicits regeneration through proliferation (Roskams 2006).
To ascertain liver proliferation, we examined Ki67 expression in mouse livers. We
observed substantial increase in Ki67-positive cells in cP
f/f
78
f/f
livers, compared to cP
f/f

and c78
f/f
mice at both 3 and 6 months, whereas Ki67-positive cells were absent in WT
livers (Figure 3.7a). Additionally, some Ki67-positive cells with liver progenitor cell
morphology were detected around bile ducts in cP
f/f
78
f/f
livers (Figure 3.7a). Liver
59
progenitor markers EpCAM, CK19 and AFP were also upregulated in cP
f/f
78
f/f
livers
compared to WT, cP
f/f
and c78
f/f
livers, which further suggested proliferation (Figure
3.7b).

Figure 3.7 cP
f/f
78
f/f
livers exhibited increased proliferation, progenitor cell expansion and GRP78
expression in bile duct cells. (a) Immunohistochemistry staining of cell proliferation marker Ki67 (brown
nuclei) on livers of the indicated genotypes at 3 and 6 months. (b) Real-time quantitative PCR analysis of
liver progenitor markers EpCAM, AFP and CK19 in livers of the indicated genotypes at 3 months.
Expression levels of each gene were normalized to 18S RNA levels. Data are presented as mean ± S.E.
*p<0.05. (c) Immunohistochemistry staining of GRP78 on livers from the indicated genotypes aged 3 and 6
a
b
c
60
months. Far right panels represent higher magnification of the boxed regions in cP
f/f
78
f/f
livers. Black
arrowheads in panels a and c denote examples of bile ducts. Scale bars show 100 µm and are applicable to
all panels.
As demonstrated by Western blot, there was residual GRP78 in cP
f/f
78
f/f
livers.
Thus, to gain insight into the distribution pattern of GRP78 in cP
f/f
78
f/f
mice, we
performed immunohistochemical (IHC) staining of the liver sections. Consistent with our
Western blot results (Figure 3.2b and Figure 3.3a), GRP78 expression progressively
decreased between 3 and 6 months of age. Strikingly, the cells of the expanded bile ducts
in cP
f/f
78
f/f
livers showed robust GRP78 staining at both 3 and 6 months (Figure 3.7c).
This suggests that some hepatoblasts with incomplete Cre-mediated recombination
differentiated into bile ducts, where Alb-Cre was inactive. Moreover, some GRP78-
positive cells around bile ducts resembled liver progenitors morphologically (Figure
3.7c).
3.3.4 Perturbation of selective signaling pathways in cP
f/f
78
f/f
livers
GRP78 deficiency has been demonstrated to suppress PI3K/AKT signaling (Y. Fu
et al. 2008; Wey et al. 2012). As expected, p-AKT(S473) was highly activated in cP
f/f
mice, consistent with the established role of PTEN as a negative regulator of PI3K/AKT
(Figure 3.8a). At 6 months, both p-AKT(S473) and total AKT were dramatically reduced
in cP
f/f
78
f/f
livers, and cP
f/f
78
f/+
livers were also partially affected (Figure 3.8a). Because
of the reduction in total AKT, the functional reduction in p-AKT was not statistically
61
captured through the ratio p-AKT/AKT (Figure 3.8a).

Figure 3.8 Perturbation of selective signaling pathways in cP
f/f
78
f/f
livers. (a) Representative Western blots
of p-AKT(S473), total AKT, p-ERK1/2(T202/Y204) and total ERK1/2 levels from livers of the indicated
genotypes at 6 months. (b) Representative Western blots of p-JNK (p54, T183/Y185) and total JNK (p54)
levels. (c) Representative Western blots of β-catenin and PDGFR α expression. β-actin was used as the
loading control and corresponding quantifications were shown on the right. n=3 for each genotype. Data are
presented as mean ± S.E. *p<0.05, ***p<0.001.
We also detected similar decrease in both p-S6K and S6K, downstream of AKT
pathway, in cP
f/f
78
f/f
livers (Figure 3.9). In the case of ERK, similar levels of p-ERK1
and total ERK1 were observed in all the genotypes, whereas the levels of p-ERK2 and
a
b
c
62
total ERK2 decreased in cP
f/f
78
f/f
livers. The level of p-JNK was moderately elevated in
cP
f/f
78
f/f
livers, whereas total JNK level was slightly decreased in cP
f/f
78
f/+
and cP
f/f
78
f/f
livers (Figure 3.8b). In contrast, β-catenin level was significantly reduced in cP
f/f
78
f/f
livers (Figure 3.8c). It has been reported that in vitro suppression of β-catenin in
hepatoma cells leads to PDGFR α upregulation (Zhang XF, hepatology, 2010), which is
associated with liver tumorigenesis (Stock et al. 2007). Consistent with this finding, we
detected elevated PDGFR α expression in cP
f/f
78
f/f
livers (Figure 3.8c).

Figure 3.9 p-S6K and S6K expression analysis in mouse livers. Representative Western blots of p-S6K
(p70/T389), total S6K(p70), from livers of the indicated genotypes at 6 months. β-actin was used as the
loading control.
3.3.5 Accelerated HCC and CC development and repopulation of GRP78-positive
cells in cP
f/f
78
f/f
livers
In following liver morphology of the mouse cohorts, at the time of sacrifice, all
cP
f/f
78
f/f
mice developed visible tumor-like nodules by 6 months whereas for
cP
f/f
78
f/+
mice, 50% exhibited nodules by 9 months and 100% by 13 months, and for cP
f/f

mice, liver nodules were not apparent until 12 months (Figure 3.10a). c78
f/f
livers
displayed very few and small nodules at 12-14 months (Figure 3.2c) and H&E staining
63
showed fatty liver accompanied by inflammation with no sign of malignancy (data not
shown). While cP
f/f
78
f/f
livers showed extensive bile duct proliferation at 6 months
(Figure 3.7c), H&E staining revealed no malignancy (data not shown), however, both
HCC and CC were evident starting from 8-9 months (Figure 3.10b). Intense GRP78
staining was detected in HCC and CC areas in cP
f/f
78
f/f
livers and GRP78 level in
adjacent normal areas was comparable to the WT level (Figure 3.10b). We further
observed that both cP
f/f
and cP
f/f
78
f/+
mice developed HCC and CC starting from 12
months (Figure 3.10c). Taken together, these results suggest that cP
f/f
78
f/f
mice had
accelerated HCC and CC development. Furthermore, HCC and CC areas in the liver were
associated with the repopulation with GRP78-positive cells, which may confer selective
advantage for the cancer cells.

64

Figure 3.10 Accelerated HCC and CC formation and GRP78 re-expression in cP
f/f
78
f/f
livers. (a) Kaplan-
Meier plot of WT, cP
f/f
, cP
f/f
78
f/+
and cP
f/f
78
f/f
mice showing tumor nodule-free percentage over time. n=3 to
11 for each genotype at each time point. (b) Upper: H&E staining of liver sections from WT and cP
f/f
78
f/f

mice at 8-9 months. cP
f/f
78
f/f
mice showed histological features of HCC and CC. Lower:
immunohistochemistry staining of GRP78 on liver sections of WT mice and tumor sections from cP
f/f
78
f/f

mice aged 8-9 months. (c) H&E staining of liver tumor sections from cP
f/f
and cP
f/f
78
f/+
mice at 12 months,
a b
c
d
65
which showed the presence of both HCC and CC. Scale bars show 100 µm and are applicable to panels b
and c. (d) Schematic model of tumor development in cP
f/f
78
f/f
mice. Hepatic GRP78 expression level at
each stage corresponds to the color gradient bar on the upper left corner. The major phenotypes at each
stage are indicated below. BD: bile duct; PV: portal vein.
3.4 Discussion
Mutation or deletion of PTEN is commonly observed in liver cancer and GRP78
is required for tumorigenesis in a variety of cancers (B Luo and Lee 2013). In studying
the role of GRP78 in liver cancer development using the loss of PTEN as a model system,
we made several unexpected discoveries which expand our understanding on how GRP78
regulates tumorigenesis in a metabolic organ. In the case of liver, injury leads to
hepatocyte death that in turn activates proliferation of residual hepatocytes and/or liver
progenitor cells, which may eventually promote liver cancer (Galicia et al. 2010;
Roskams 2006). We noted that unlike other tissue-specific knockout models where
GRP78 can be nearly completely eliminated (Y. Fu et al. 2008; Miao Wang et al. 2010;
Wey, Luo, and Lee 2012), the c78
f/f
and cP
f/f
78
f/f
livers maintained about 30% of WT
level of GRP78. This is consistent with a previous study using a different Alb-Cre
transgenic mouse strain (Ji et al. 2011). Interestingly, both residual white and brown
adipose tissues maintain 40% GRP78 expression in adipose Grp78 knockout mice (Zhu
et al. 2013). This suggests that GRP78 may be indispensable for survival in liver and
adipose tissues. While male c78
f/f
mice maintained in these studies for 14 months showed
no malignancy, GRP78 reduction combined with loss of PTEN led to onset of HCC and
66
CC at 8-9 months. Based on our findings, we propose the following model which is
summarized in Figure 3.10d. In a normal liver, GRP78 is constitutively expressed and
maintains liver homeostasis. However, in cP
f/f
78
f/f
livers, there is loss of PTEN and
gradual depletion of GRP78 following Alb-Cre-mediated recombination at 3 months. The
loss of GRP78 protection at this stage exacerbates fat accumulation caused by PTEN
deficiency. Fatty liver leads to liver injury, which activates bile duct and liver progenitor
cell proliferation. At 6 months, JNK activation, coupled with β-catenin loss and PDGFR α
upregulation could also contribute to liver injury (Nikolaou, Sarris, and Talianidis 2013;
Nejak-Bowen and Monga 2011). At the same time, GRP78 cannot be ablated completely
in hepatocytes. Bile duct and progenitor cells that escape Cre exhibit growth advantage
and repopulate the liver with GRP78-positive cells. At 8-9 months, HCC and CC growth
is evident in cP
f/f
78
f/f
livers, correlating with strong GRP78 expression, and GRP78 level
in adjacent normal areas is comparable to the WT level. While the molecular mechanisms
leading to these events await future investigations, our results raise several interesting
questions.
First, why does GRP78 reduction combined with PTEN deletion in the liver
accelerate liver tumorigenesis, whereas GRP78 knockout in other tissues usually inhibits
tumor formation? Liver cancer is unique in that cancer arises as a result of injury and
regeneration. In the context of PTEN loss, we observed that GRP78 reduction fueled liver
steatosis, apparently via a mechanism independent of XBP-1, which led to injury that
67
induced progenitor cell proliferation. If GRP78 expression is eliminated in the tumor
cells, tumor development may be arrested as seen in the other cancer models. However,
in the case of cP
f/f
78
f/f
livers, GRP78-positive bile duct and progenitor cells that escaped
Alb-Cre repopulated the liver, thus the developed liver tumors were not handicapped by
the lack of GRP78. Consistent with this explanation are the findings that β-catenin-
positive cells repopulate β-catenin-null livers due to a progressive loss of Alb-Cre
expression (Thompson et al. 2011), and GRP78-positive cells rapidly repopulate the
intestinal epithelium upon genetic knockout in AhCre1-Grp78
f/f
mice (Heijmans et al.
2013).
With regard to the origin of the HCC and CC in cP
f/f
78
f/f
livers, HCC and CC
could be derived from liver progenitor cells (Roskams 2006). Our immunohistochemistry
data indicated strong GRP78 expression in HCC and CC tissues, and that some cells
around proliferating bile ducts exhibited liver progenitor cell morphology and also
expressed GRP78. These observations suggest the possibility that liver progenitor cell is
the origin of malignancies. Interestingly, transdifferentiation of hepatocytes to bile duct
epithelial cells has been demonstrated (Michalopoulos, Barua, and Bowen 2005).
Conversely, some biliary epithelial cells appear capable of differentiating to hepatocytes
(Desmet, Roskams, and Van Eyken 1995). Thus, future studies will be required to address
whether the GRP78-positive bile duct cells give rise to GRP78-positive liver cancers.

68
GRP78 overexpression has been reported in various tumors, including HCC (Luk
et al. 2006; Su et al. 2010). As the major chaperone with potent anti-apoptotic properties
and a signaling regulator, GRP78 protects tumor cells from ER stress and host cell
defense, thereby promoting tumor growth. This is consistent with our observation that
GRP78 was upregulated in cP
f/f
liver tumors (Figure 3.11).

Figure 3.11 GRP78 was upregulated in cP
f/f
liver tumors. Immunofluorescence staining of GRP78 (green)

Figure 3.11 GRP78 was upregulated in cP
f/f
liver tumors. Immunofluorescence staining of GRP78 (green)
of of liver sections from WT mice and liver tumor sections from cP
f/f
mice. Lower panels show higher
magnification of the boxed regions in upper panels. Scale bars show 100 µm.
GRP78 has been reported to protect liver cancer cells from ER stress-induced
apoptosis and promote their invasion in a metastasis model (Su et al. 2010; Cun Wang et
al. 2013). Thus, robust GRP78 expression may indeed be required for liver cancer
progression. Since several therapeutics against GRP78 are in development (B Luo and
Lee 2013), it will be interesting to treat liver cancer with these agents to see if they can
block the re-expression of GRP78 and suppress liver cancer progression, while
maintaining essential liver functions. In treatment of other cancers with anti-GRP78
agents, since the adult liver can function normally with partial GRP78 level whereas
69
cancer requires high level of GRP78, the damage to normal liver may be limited. As
reported recently, antibodies against cell surface GRP78 were well tolerated in
pharmacokinetic/toxicology studies in mice, monkeys and patients (Hensel et al. 2013; R.
Liu et al. 2013).
JNK signaling pathway has been linked to the growth of carcinogen-induced HCC
and about 50-60% of human HCC shows strong activation of JNK1 (Nakagawa and
Maeda 2012). The function of sustained JNK activation in hepatocyte death and
subsequent inflammation and carcinogenesis is recapitulated in various genetic mouse
models developing HCC (Nikolaou, Sarris, and Talianidis 2013). Our results revealed
that p-JNK was moderately elevated in cP
f/f
78
f/f
livers at 6 months, accompanied by
increased inflammation (data not shown) prior to HCC and CC formation, suggesting that
JNK might partially contribute to accelerated liver tumorigenesis. While this requires
validation, the extent of apoptosis remained low (below 2%) in cP
f/f
78
f/f
livers at 6
months (data not shown), thus moderate activation of JNK in these livers did not majorly
affect apoptosis linked to sustained activation of JNK.
β-catenin signaling, the central effector of canonical Wnt signaling pathway and a
recognized oncogene, is also implicated in HCC. However, overexpressing β-catenin in
transgenic mouse models has not exhibited spontaneous HCC (Nejak-Bowen and Monga
2011). Paradoxically, hepatic β-catenin loss impairs the ability of the liver to counteract
DEN-induced oxidative stress and enhances HCC through PDGFR α/PI3K/AKT(Thr308
70
phosphorylation) signaling (X.-F. Zhang et al. 2010). Furthermore, hepatic β-catenin
deletion increases fatty liver and steatohepatitis under diet-induced metabolic stress
(Behari et al. 2010). These results suggest that β-catenin loss can sensitize livers to injury
and eventually tumorigenesis, which mimics the predominant scenario of human HCC
where tumors often occur in steatohepatitis or cirrhosis background (Nejak-Bowen and
Monga 2011). cP
f/f
78
f/f
livers exhibited enhanced injury compared to cP
f/f
livers, and we
observed β-catenin downregulation along with PDGFR α upregulation and significantly
increased p-AKT(Thr308) (data not shown) in the liver at 6 months. Oxidative stress and
overexpression of PDGF have been reported in PTEN-null livers (Galicia et al. 2010). In
combination, these factors might promote PDGFR α activation. Therefore, it is tempting
to speculate that increased PDGFR α may be one of the mechanisms in our model to
accelerate liver tumors, and hepatic β-catenin loss might also sensitize the liver to the
injury induced by PTEN and GRP78 double knockout, further promoting tumorigenesis.
Liver fat accumulation, injury and tumorigenesis can be also promoted by loss of
autophagy, which can be monitored by increase in P62 (Ding 2010). Interestingly, we
observed a trend of increased P62 level in cP
f/f
78
f/f
livers, suggesting perturbation of
autophagy (Figure 3.12).

71

Figure 3.12 P62 expression analysis in mouse livers. Representative Western blots of P62 in livers of the
indicated genotypes at 6 months, with β-actin as the loading control. The experiments were repeated three
times and the quantification was shown on the right. n=3 for each genotype. Data are presented as mean ±
S.E.
Future studies are required to address whether these altered pathways are
causative factors for the HCC and CC formation in cP
f/f
78
f/f
livers. In summary, our
studies reveal new mechanisms affected by GRP78 reduction in PTEN-null induced
tumorigenesis. The role of GRP78 in different forms of liver cancer and other metabolic
cancers warrants further investigation.

72
Chapter 4
Differential requirement of GRP94 and GRP78 in mammary
gland development
4.1 Introduction
Mouse mammary gland development starts during embryogenesis and grows at
the similar rate as other organs after birth (Macias and Hinck 2012; Hennighausen and
Robinson 2005). Mammary glands undergo extension of ductal system, extensive ductal
elaboration, alveoli development during pregnancy and lactation, and involution process
after weaning (Macias and Hinck 2012; Hennighausen and Robinson 2005). All stages of
mammary development are intricately regulated by the extracellular matrix (ECM)
environment and diverse hormones (Muschler and Streuli 2010; Lambert, Ozturk, and
Thiagalingam 2012; J. Chen et al. 2002; Gallego et al. 2001; Silberstein and Daniel 1994;
Ruan and Kleinberg 1999). A mammary gland is composed of stroma and a bilayered
epithelium with inner luminal cells and outer myoepithelial cells (Muschler and Streuli
2010). As sensors and transducers of ECM signals, integrins expressed in epithelial cells
of the mammary gland play critical roles in regulation of mammary gland development
(Lambert, Ozturk, and Thiagalingam 2012; J. Chen et al. 2002). Pubertal mammary gland
growth is also influenced by growth hormone (GH), estrogen and insulin-like growth
factor-1 (IGF-1) (Gallego et al. 2001; Silberstein and Daniel 1994; Ruan and Kleinberg
73
1999).
The function of these developmental regulators depends on a number of upstream
processes that ensure their proper presentation and function. Protein folding quality
control exists in the ER to avoid accumulation of misfolded and unfolded proteins.
Important contributors to this quality control system are the glucose regulated proteins
(GRPs) (Ni and Lee 2007; A. Lee 2014). GRP94 directs the folding and assembly of a
selective class of secreted and membrane proteins, such as major histocompatibility class
II (MHC II), IGF-1, multiple toll like receptors (TLRs) and a subset of integrins (Eletto,
Dersh, and Argon 2010; B. Liu and Li 2008; Yang and Li 2005). Some client proteins of
GRP94 participate in the normal developmental process of mouse mammary gland, such
as 2 integrin and IGF-1 (Staron et al. 2010; Barton et al. 2012). GRP94 was essential for
the expression of 2 integrin of the hematopoietic system (Staron et al. 2010). Ablation
of GRP94 in murine striated muscle caused smaller skeletal muscles by inhibiting local
IGF-1 production (Barton et al. 2012). Another ER chaperone GRP78 has been
demonstrated to be essential for many cellular processes including embryogenesis (S Luo
et al. 2006), adipogenesis (Zhu et al. 2013), maintenance of hematopoietic homeostasis
(Wey, Luo, and Lee 2012), as well as protection from neuronal apoptosis (Miao Wang et
al. 2010). In contrast, GRP78 is not required for morphology, growth or function (Y . Fu et
al. 2008). This raises the interesting question whether GRP78 is required for the
development and function of other epithelial cell types, such as those of the mammary
glands. Previous studies showed that cell surface GRP78 is a necessary mediator of
74
Cripto signaling in mammary epithelial and embryonic stem cells (Kelber et al. 2009).
We recently observed that IGF-1 receptor signaling regulates GRP78 expression via the
PI3K/AKT/mTORC1 axis (Pfaffenbach et al. 2012), suggesting that IGF-1 may influence
mammary gland development via GRP78 regulation.
To test directly whether GRP94 and GRP78 are pivotal for postnatal mammary
gland development and function, we created GRP94 and GRP78 conditional knockout
mouse models in the mouse mammary epithelium directed by the mouse mammary tumor
virus (MMTV)-Cre recombinase system and examined their phenotypes. The MMTV-Cre
recombinase of the transgenic strain (line D) used in this study shows activation by
postnatal day 22 and has been commonly used to delete genes in both luminal epithelial
and myoepithelial cells of mammary gland (Wagner et al. 2001; Wagner et al. 1997).
Additionally, we used adenoviral Cre-recombinase to deplete GRP78 in isolated
mammary epithelial stem/progenitor cells followed by transplant assays. Our studies
reveal some unexpected results and provide new evidence that the GRPs are differentially
required for mammary gland development.
4.2 Materials and methods
Mouse models
All protocols for animal use and euthanasia were reviewed and approved by the
University of Southern California Institutional Animal Care and Use Committee. All
75
experiments were performed in accordance with the approved guidelines. MMTV-Cre
mouse (line D, Jackson Laboratories) was mated with 94
f/f
mice to generate c94
f/+

offspring (Wagner et al. 2001; C. Mao et al. 2010). Breeding between 94
f/f
and c94
f/+

mice yielded c94
f/f
mice used in the experiments. c94
f/f
and littermate control 94
f/f
mice
were expanded through the mating between 94
f/f
and c94
f/f
mice. The generation and
characterization of 78
f/f
mice were described previously (S Luo et al. 2006). c94
f/f
mice
were bred with 78
f/f
mice to generate c94
f/+
78
f/+
mice. Breeding between c94
f/+
78
f/+
and
78
f/f
mice yielded c78
f/f
mice used in this study. The c78
f/f
and littermate control 78
f/f
mice
were expanded through the mating between c78
f/f
and 78
f/f
mice. Genotyping was carried
out as previously described for various Grp94, Grp78 and Cre alleles (S Luo et al. 2006;
C. Mao et al. 2010). Virgin mice were used except where indicated. To synchronize the
estrous cycle, pregnant mare’s serum gonadotropin (PMSG) was injected 48 hours before
euthanasia of mice to synchronize estrous cycle, if indicated in figure legends. For
lactation, female mice were mated with male mice and mammary glands were collected 7
days after the pups were born.
H&E, immunofluorescent and immunohistochemical staining
Mouse mammary glands were isolated and fixed overnight in 10% buffered
formalin followed by embedding in paraffin. Paraffin-embedded tissues were sectioned
and stained with hematoxylin and eosin (H&E). The immunofluorescent and
immunohistochemical staining were performed as described previously (Fu yong, pnas,
76
2008). Paraffin sections were incubated at 4°C overnight with primary antibodies against
GRP94 (Enzo Life Sciences, 1:200), GRP78 (H-129, Santa Cruz, 1:100), PCNA (BD
BioScience, 1:100), E-cadherin (BD BioScience, 1:150) or -SMA (Sigma, 1:2000). For
immunofluorescent staining, the slides were mounted with VECTASHIELD mounting
medium with DAPI (Vector Laboratories).
Tissue extracts, cell transfection and immunoblotting
Mammary epithelial cells were isolated for whole cell extracts as previously
described (Grimm SL, j biol chem., 2005). Mammary glands (#3 and #4) were collected,
minced and digested at 37°C for 2 hours in DMEM/F-12 media containing collagenase
(Roche Applied Science, 2 mg/ml) and hyaluronidase (Sigma, 100 units/ml), followed by
washes with DMEM/F-12 media.
HBL100-HER2 cells were maintained in DMEM media and A549 cells were
maintained in F-12K media, and both media were supplemented with 10% FBS and 1%
penicillin/streptomycin. For knockdown of GRP94, the siRNA against Grp94 (si-94) is
5’-aucugggacaagcgaguuuuu-3’; for knockdown of GRP78, the siRNA against Grp78 (si-
78) is 5’-ggagcgcauugauacuagatt-3’; the control siRNA (si-ctrl) is 5’-
aaggagacguauagcaacggu-3’. HBL100-HER2 cells were transfected with si-ctrl or si-94
using Lipofectamine 2000 transfection reagent (Invitrogen) for 48 hours, according to the
manufacturer’s instructions. A549 cells were transfected with si-ctrl or si-78 using
77
Lipofectamine RNAiMAX transfection reagent (Invitrogen), following the
manufacturer’s instructions. Seventy-two hours after transfection of siRNA, A549 cells
were treated with 1.5 g/ml DMSO or tunicamycin for 16 hours before harvesting.
Tissues or cells were homogenized in ice-cold RIPA buffer containing cocktails of
proteinase inhibitors and phosphatase inhibitors (Pierce) and Western blotting were
performed by standard protocol (chen WT, oncogene, 2014). Primary antibodies used
were rat monoclonal anti-GRP94 (Enzo Life Sciences, 1:2000), rabbit polyclonal anti-
GRP78 (H-129, Santa Cruz, 1:1000), mouse monoclonal anti-GPR78 (BD BioScience,
1:1000) and mouse monoclonal anti- -actin (Sigma, 1:5000). Rabbit polyclonal anti-
GRP78 (H-129) antibody was used in the Western blotting for validating the GRP78
antibody for immunostaining.
Whole-mount staining, ductal distance and number measurement
Inguinal mouse mammary glands were extracted from female virgin mice at
different ages. The detailed protocol about whole-mount hematoxylin staining of
mammary glands was described previously (Brantley et al. 2001). In brief, glands were
fixed in 10% neutral buffered formalin for 24 hours, followed by 48 hours acetone
treatment. Tissues were then washed in 100% and 95% ethanol for 1 hour before the
overnight staining with the hematoxylin staining solution. After that, tissues were washed
with distilled H
2
O, 70%, 95%, 100% ethanol (three times) and xylene (three times) for 1
78
hour sequentially. Alternatively, glands were stained according to a similar procedure
using carmine aluminum sulfate (Sigma). Finally, the stained tissues were placed in glass
vials with methyl salicylate for permanent storage. For ductal distance measurement, the
ductal length was determined by measuring the distance between the center of the lymph
node and the end of the longest duct (Fiore et al. 2009). At various time intervals, the
number of ducts in the mammary glands was measured from three random fields per
section at 40X magnification for each genotype.
Mammary cell preparation, flow cytometric analysis and mammary transplant
Adult mammary glands were obtained from 3-month old nulliparous 78
f/f
and
c78
f/f
mice. Minced adult mammary glands were digested for 14 hours at 37°C in
EpiCult-B media containing B supplement, collagenase and hyaluronidase. All reagents
were purchased from Stem Cell Technologies (SCT) unless otherwise specified.
Mammary organoids resulting from overnight digestion were processed as previously
described (Spike et al. 2012). Adult single cells were incubated with the following
antibodies: Fc receptor antibody, biotinylated CD31, biotinylated CD45, biotinylated
TER119, streptavidin-PerCP-Cy5.5 (BD Biosciences), CD24-PE (M1/69) and CD49f-
FITC (GoH3). Cell sorting was carried out on FACS ARIA II cell sorter (Becton
Dickinson). The surgical technique to clear the mammary fat pads and to conduct
mammary transplantation has been well established (Deome et al. 1959). Briefly, the
inguinal mammary glands of 21 day-old CB17-SCID recipients were surgically removed
79
and the cleared (epithelial-free) mammary fat pads left behind served as the
transplantation sites. Transplants were carried out using 1,000 cells in the inoculum.
Transplanted glands were removed from the recipients 12 weeks post-surgery for
mammary repopulation evaluation unless otherwise noted for mammary repopulation
evaluation. The excised glands were laid onto slides as whole-mounts or processed as
above for FACS. Ductal structures extending through ≥50% of the fat pad in whole-
mounts or flow cytometric profiles containing both luminal and myoepithelial
populations were scored as positive for mammary repopulation.
Where viral transduction is indicated, DAPI-Lin-CD24 +CD49f+ mammary
epithelial cells isolated from 78
f/f
mice were sorted and transduced by 60 min
spinoculation with adenoviral vectors expressing Ad-GFP-Cre or Ad-GFP-Con (MOI=5).
After overnight culture in DMEM/F12 media supplemented with 5% horse serum, 10
g/ml insulin, 20 ng/ml EGF, 100 ng/ml cholera toxin, 0.5 g/ml hydrocortisone and 10
g/ml Ciprofloxacin, the cells were sorted for GFP expression and transplanted into de-
epithelialized recipients as above. The excised glands were processed for whole-mounts
or flow cytometric analyses as described above in combination with rabbit anti-GRP78
antisera produced previously (Spike et al. 2014) and APC conjugated anti-rabbit
secondary antibodies.

80
Statistical analyses
A 2-tailed Student’s t-test was applied for all pairwise comparisons. Data are
expressed as mean ± S.E.
4.3 Results
4.3.1 Generation of MMTV-Cre mediated GRP94 knockout mouse model
To generate mammary epithelium-specific GRP94 knockout mice, Grp94
f/f
(94
f/f
)
mice bearing floxed (f) alleles were crossed with the MMTV-Cre transgenic mice (C. Mao
et al. 2010; Wagner et al. 1997). The resulting MMTV-Cre, Grp94
f/+
(c94
f/+
) mice were
bred with 94
f/f
mice to generate c94
f/f
mice, with sibling 94
f/f
mice devoid of the Cre-allele
serving as wild-type controls (Figure 4.1)

Figure 4.1 Breeding scheme for generation of Grp94
f/f
(94
f/f
) and MMTV-Cre, Grp94
f/f
(c94
f/f
) mice. Female
mice with genotypes indicated in gray were used in this study.
The genotypes of mice harboring the Grp94 floxed alleles and the MMTV-Cre
allele were determined by PCR using genomic DNA extracted from tails of 94
f/f
and c94
f/f

mice (Figure 4.2a). c94
f/f
mice were born with expected Mendelian ratio and
81
phenotypically normal compared with their 94
f/f
littermates. Corresponding to knockout
of GRP94, the epithelial cells isolated from the c94
f/f
mammary glands showed 70%
reduction in GRP94 protein level, compared to 94
f/f
glands (Figure 4.2b). The GRP94
protein band was also substantially reduced in human breast HBL100-HER2 cells treated
with siRNA against GRP94, validating the specificity of the monoclonal antibody used
for GRP94 detection (Figure 4.2c). Immunofluorescent (IF) staining showed efficient
knockdown of GRP94 expression in the epithelial cells lining the c94
f/f
mammary ducts
(Figure 4.2d). Immunohistochemical (IHC) staining further confirmed the IF staining
results and showed reduction of GRP94 expression persisted at least up to 10 months in
the c94
f/f
mammary glands (Figure 4.2d).

82

Figure 4.2 Generation of MMTV-Cre mediated GRP94 knockout mouse model. (a) Representative PCR
genotyping results from tails of 94
f/f
and c94
f/f
mice. The alleles are indicated. (b) Representative Western
blot detection of GRP94 levels in mammary epithelial cells isolated from 94
f/f
and c94
f/f
glands at 2.5
months, with -actin serving as loading control. Quantitation of GRP94 level after normalization to the -
actin level is shown on right (n=2 per genotype). Data are presented as mean ± S.E. p<0.001. (c) Western
blot analysis of HBL100-HER2 cells transfected with either si-control (si-ctrl) or si-Grp94 (si-94) for
detection of GRP94, with -actin as loading control. (d) Immunofluorescent (IF) and immunohistochemical
(IHC) staining of GRP94 in mammary glands from 94
f/f
and c94
f/f
mice at the indicated ages. PMSG was
injected two days before euthanasia of 4 and 10 month old mice to synchronize estrous cycle. Green or
brown color depicts GRP94 staining. Blue color depicts DAPI staining. Scale bars show 50 m and are
applicable to all sections.

a b
c
d
83
4.3.2 c94
f/f
mammary glands displayed normal pubertal and post-pubertal ductal
morphogenesis
Mammary glands from 94
f/f
and c94
f/f
mice at different time points were whole-
mounted to examine ductal morphogenesis. Around the onset of puberty (1 month), we
noticed comparable ductal outgrowth in 94
f/f
and c94
f/f
mammary glands (Figure 4.3a).
There are similar numbers of TEBs at the ductal tips in 94
f/f
and c94
f/f
glands at 1 and 1.5
months (Figure 4.3a, b). Similar to control glands, the ducts in mutant glands completely
filled the mammary fat pad by 2.5 months (Figure 4.3a). Following post-pubertal
growth, we observed formation of tertiary branches and gradual ductal elaboration in
both 94
f/f
and c94
f/f
mammary glands from 4 to 11 months (Figure 4.3a). Measurement of
ductal distance demonstrated that c94
f/f
mammary glands exhibited normal branching
from 1.5 to 11 months (Figure 4.3b).

84

Figure 4.3 Ductal morphogenesis of c94
f/f
mammary glands. (a) Representative whole-mount staining of
mammary glands from 94
f/f
and c94
f/f
mice at 1, 1.5, 2.5, 4, 7 and 11 month old as indicated on top. White
bars denote the length between center of the lymph node and distal end of the longest ducts in 94
f/f
and
c94
f/f
glands. LN, lymph node. Scale bars show 2 mm and are applicable to all sections. (b) Quantitation of
TEB number and ductal length of 94
f/f
and c94
f/f
mammary glands at times indicated. For each genotype, n
varies from 2 to 11. Data are presented as mean ± S.E. PMSG was injected two days before euthanasia of 4,
7 and 11 month old mice.
Hematoxylin and eosin (H&E) staining confirmed histoarchitecture of TEBs at
1.5 months and mammary ducts at 4, 7 and 11 months were indistinguishable between the
94
f/f
and c94
f/f
mice (Figure 4.4a). As shown by PCNA staining, c94
f/f
mammary
epithelium showed equivalent proliferation compared to WT mammary epithelium at 1.5
and 4 months (Figure 4.4b, c). Furthermore, the c94
f/f
mice gave birth to normal numbers
a
b
85
of pups and fed their pups properly. H&E staining demonstrated normal secretory
alveolar structures in lactating c94
f/f
mammary glands (Figure 4.4a).

Figure 4.4 Morphology and proliferation of c94
f/f
mammary epithelium. (a) H&E staining of 94
f/f
and c94
f/f

mammary glands from 1.5, 4, 7 and 11 month old virgin mice and 5 month old lactating mice on day 7 after
parturition. Arrows denote TEBs. Scale bars show 200 m and are applicable to all sections. (b) IHC
staining of cell proliferative marker PCNA (brown nuclei) in mammary glands from 94
f/f
and c94
f/f
mice at
1.5 and 4 months. Scale bars show 100 m and are applicable to all sections. Arrow heads point to PCNA
positive cells. (c) Quantitation of percentage of PCNA positive epithelial cells in panel b. For each
genotype, n varies from 2 to 4. PMSG was injected two days before euthanasia of 4, 7 and 11 month old
mice.
a
b c
86
4.3.3 MMTV-Cre, Grp78
f/f
mammary glands showed only slight reduction of GRP78
expression
The breeding scheme to generate the MMTV-Cre, Grp78
f/f
mouse model (c78
f/f

mice) was shown in Figure 4.5.

Figure 4.5 Breeding scheme for generation of Grp78
f/f
(78
f/f
) and MMTV-Cre, Grp78
f/f
(c78
f/f
) mice. Female
mice with genotypes indicated in gray were used in this study.
Using the genomic DNA extracted from tails, we detected the MMTV-Cre allele
in c78
f/f
mice, but not 78
f/f
mice (Figure 4.6a). Western blot analysis showed around 30%
reduction of GRP78 protein level in mammary epithelial cells isolated from c78
f/f
glands,
compared with 78
f/f
glands (Figure 4.6b). To validate specificity of the anti-GRP78
antibody for subsequent staining, we showed that as expected, the antibody detected basal
GRP78 expression which was elevated in A549 cells treated with the ER stress inducer
tunicamycin, and in cells treated with siRNA against GRP78, both the basal and induced
level of GRP78 was nearly eliminated (Figure 4.6c). As revealed by IF and IHC staining,
GRP78 expression was detectable in the 78
f/f
mammary epithelium (Figure 4.6d).
Corresponding to Western blot results, we only observed slight reduction of GRP78
87
expression in the c78
f/f
mammary epithelium at various time points (1.5, 2 and 4 months)
after the reported activation time span for the MMTV-Cre recombinase (Figure 4.6d).

Figure 4.6 Generation of MMTV-Cre, Grp78
f/f
mouse model. (a) Representative PCR genotyping results
from tails of 78
f/f
and c78
f/f
mice. The alleles are indicated. (b) Representative Western blot detection of
GRP78 levels in mammary epithelial cells isolated from 78
f/f
and c78
f/f
glands at 2.5 months, with -actin
serving as loading control. Quantitation of GRP78 level after normalization to the -actin level is shown on
right (n=3 per genotype). Data are presented as mean ± S.E. (c) Western blot analysis of lysates from A549
cells transfected with either si-control (si-ctrl) or si-Grp78 (si-78), followed by DMSO (-) or tunicamycin
(Tu) treatment for 16 hours. (d) IF staining of GRP78 on 2 month old mammary glands from 78
f/f
and c78
f/f

mice. The green and blue colors depict GRP78 and DAPI staining, respectively. IHC staining of GRP78 on
1.5 and 4 month old mammary glands from 78
f/f
and c78
f/f
mice. Brown color depicts GRP78 staining. Scale
bars show 50 m and are applicable to all sections.
a b c
d
88
4.3.4 c78
f/f
mammary glands showed normal pubertal and post-pubertal ductal
morphogenesis
Whole-mounted 78
f/f
and c78
f/f
mammary glands were examined for ductal
morphogenesis. Examining mammary glands at the onset of puberty (1 month),
maturation (2 months) or post-pubertal ages (4 and 7 months), we observed normal
branch morphology in both c78
f/f
and 78
f/f
mammary glands (Figure 4.7a). Comparable
numbers of TEBs were observed at the ductal tips in 78
f/f
and c78
f/f
mammary glands at 1
and 2 months (Figure 4.7a, b). From 2 to 7 months, c78
f/f
mammary glands exhibited
similar ductal distance as 78
f/f
glands at all the time points examined (Figure 4.7b).

Figure 4.7 Ductal morphogenesis of c78
f/f
mammary glands. (a) Mammary glands from 78
f/f
and c78
f/f
mice
at 1, 2, 4 and 7 months were whole-mounted and representative mammary glands for each time point was
presented. White bars denote the length between center of the lymph node and distal end of the longest duct
a
89
in 78
f/f
and c78
f/f
glands. LN, lymph node. Scale bars show 2 mm and are applicable to all sections. (b)
Quantitation of TEB number and ductal length of 78
f/f
and c78
f/f
mammary glands at indicated times. For
each genotype, n varies from 3 to 6. Data are presented as mean ± S.E.
H&E staining also showed comparable histoarchitecture of TEBs at 1 month and
mammary ducts at 2, 4 and 5.5 months in the 78
f/f
and c78
f/f
mice (Figure 4.8a). IHC
staining of a luminal cell maker (E-cadherin) and a myoepithelial cell marker ( -SMA,
-smooth muscle actin) further demonstrated normal TEB structure in c78
f/f
mammary
glands at 1 month (Figure 4.8b). Similar numbers of ducts were also observed in 78
f/f
and
c78
f/f
mammary glands at 2, 4 and 5.5 months (Figure 4.8c). Similar to the c94
f/f
mice,
c78
f/f
female mice were fertile, gave birth to normal number of pups, and exhibited
normal secretory alveolar structures in lactating c78
f/f
mammary glands (Figure 4.8a).

90

Figure 4.8 Morphology of c78
f/f
mammary epithelium. (a) H&E staining of 78
f/f
and c78
f/f
mammary glands
from 1, 2, 4 and 5.5 month old virgin mice and 2.5 month old lactating mice on day 7 after parturition.
Arrows denote TEBs. Scale bars show 200 m and are applicable to all sections. (b) IHC staining of E-
cadherin and -smooth muscle actin ( -SMA) on serial sections from mammary glands of 1 month old 78
f/f

and c78
f/f
mice, with corresponding H&E staining. Brown color depicts E-cadherin or -SMA staining.
Arrows denote positive cells. Scale bars show 50 m and are applicable to all sections. (c) Quantitation of
numbers of ducts from 78
f/f
and c78
f/f
mammary glands at 2, 4 and 5.5 months. For each genotype, n varies
from 3 to 4.

a
b
c
91
4.3.5 78
f/f
and c78
f/f
mammary gland exhibited similar distribution of different sub-
lineages and outgrowth in mammary transplant
To better understand the basis for the phenotypic similarities observed between
c78
f/f
and 78
f/f
glands, we isolated mammary epithelial cells from virgin c78
f/f
and 78
f/f

mice and analyzed their cellular content by flow cytometry. Representative flow
cytometric analyses showed similar distribution of myoepithelial cells (MYO), mammary
repopulating unit (MRU) and luminal epithelial cells enriched fractions (Figure 4.9a, b).
Both isolated 78
f/f
and c78
f/f
mammary epithelial cells were able to repopulate glands
upon transplantation into de-epithelialized hosts in multiple attempts (Figure 4.9c).
Furthermore, flow cytometric analysis of isolated cells from repopulated c78
f/f
mammary
glands demonstrated reconstitution of differentiated mammary lineages (Figure 4.9d).
Genotyping of the MYO, MRU and luminal colony forming cells (CFC) enriched
fractions from re-isolated c78
f/f
mammary transplant revealed retained Grp78 floxed
alleles whose proportion was variable among the different cell types analyzed, with the
highest rate of retention in the MRU and lowest in the MYO fraction (Figure 4.9e).

92

Figure 4.9 Analysis of sub-lineages of c78
f/f
mammary glands and efficiency of conditional gene
recombination. (a) Representative flow cytometric analyses of virgin mammary glands in 78
f/f
(top panel)
and c78
f/f
mice (bottom panel) for surface markers (CD24  and CD49f) that distinguish myoepithelial
(MYO, red circle), mammary repopulating unit (MRU, blue circle) and luminal epithelial cells (green circle)
enriched fractions from stroma cells (pink circle). (b) Percentage of MYO, MRU and luminal epithelial
cells (luminal) fractions in 78
f/f
and c78
f/f
mammary epithelial cells (n=3 per genotype). (c) Representative
pictures of mammary transplant outgrowths from epithelial cells isolated from 78
f/f
and c78
f/f
glands. There
were outgrowths of both groups (n=3 per genotype). Scale bar shows 1 cm and is applicable to all sections.
(d) Flow cytometric analysis of re-isolated epithelial cells from c78
f/f
mammary transplant. Red dots: MYO;
Blue dots: MRU; Green dots: luminal colony forming cells (CFC). (e) Genotyping of Grp78 knockout and
floxed alleles in the MYO, MRU and CFC enriched fractions shown in panel d. The relative ratios of signal
intensities for the non-recombined (floxed) vs. recombined (KO) Grp78 allele were shown on right.

a b c
d e
93
4.3.6 GRP78 is required for mammary gland regeneration
Since in vivo deletion of Grp78 in the mammary gland using MMTV-Cre in the
transgenic setting was ineffective, we subsequently employed adenoviral-Cre as an
alternative strategy to ablate Grp78 in isolated mouse epithelium cells followed by
transplantation (Figure 4.10a). Briefly, isolated 78
f/f
mammary epithelial stem/progenitor
cells were transduced with viruses expressing GFP and Cre recombinase (Ad-GFP-Cre)
or GFP alone (Ad-GFP-Con), cultured overnight and sorted for GFP prior to
transplantation into de-epithelialized recipient mice (Figure 4.10a, b). Surface GRP78
positive cells were dramatically reduced in cells transduced with Ad-GFP-Cre, compared
to Ad-GFP-Con, as confirmed by flow cytometry (Figure 4.10c). All Ad-GFP-Con
transduced samples (n=3) gave rise to repopulated mammary glands after 6 weeks,
whereas none of the Ad-GFP-Cre samples (n=9) repopulated to mammary glands (Figure
4.10d).

94

Figure 4.10 GRP78 is required for mammary gland regeneration. (a) Schematic of adenovirus-Cre
mediated recombination of Grp78 floxed alleles and mammary transplantation. (b) Sorted adult mammary
epithelial stem and progenitor cells population (red) isolated by FACS from 78
f/f
adult glands were
transduced ex vivo with adenoviral vectors carrying GFP (Ad-GFP-Con) or GFP and Cre recombinase (Ad-
GFP-Cre). GFP positive cells were sorted 16 hours later and used to inoculate de-epithelialized recipient
glands. (c) Quantitation of flow cytometric analysis of surface GRP78 positive cells from transplanted Ad-
GFP-Con and Ad-GFP-Cre mammary epithelial cells following 12 weeks outgrowth. (d) Representative
whole mount mammary glands 6 weeks after transplantation of 78
f/f
mammary epithelial cells transduced
with Ad-GFP-Con or Ad-GFP-Cre. Ad-GFP-Con: n=3; Ad-GFP-Cre: n=9. Scale bar shows 1 cm and is
applicable to all sections.
4.4 Discussion
While the functions of GRP94 and GRP78 have been examined in various cell lines and
tissues (Ni and Lee 2007), little is known about the requirement of these GRPs in
mammary gland development and function. In this report, we created two novel mouse
models bearing the MMTV-Cre recombinase transgene, coupled with either the Grp94
f/f

a
b c d
95
or the Grp78
f/f
alleles and examined the phenotypes of the compound mice. Additionally,
we tested whether knockdown of GRP78 in isolated mammary epithelial stem/progenitor
cells affected mammary gland regeneration. Our studies reveal several unexpected
findings such that GRP94 may be dispensable for mammary gland development and that
efficient genetic depletion of GRP78 in the mammary epithelial cells may not be
achievable using the MMTV-Cre recombinase system in the transgenic setting.
Nonetheless, GRP78 surface expression can be ablated in mammary epithelial cells
following adenoviral-Cre transduction in vitro, which provides an alternative strategy to
establish its role in mammary gland development in transplantation assays.
With regard to GRP94, as expected from the reported activity of the MMTV-Cre
recombinase system in mammary epithelial cells starting from postnatal day 22 and
becoming fully active by week 5 (Wagner et al. 1997), GRP94 expression was
substantially decreased in these cells in both 3 and 10 month old c94
f/f
mice. However,
despite the loss of GRP94 expression, no developmental defects in terms of ductal length
and branching patterns were detected up to 11 months, nor did we observe any defect in
TEB formation. Additionally, c94
f/f
glands showed normal alveolar development during
lactation. The implication that GRP94 is not required for the developmental regulation of
the mammary gland is intriguing since GRP94 is essential for IGF-1 secretion and 2
integrin expression on the cell surface, both of which are known to influence mammary
development. IGF-1 null female mice showed significant mammary development defect
and IGF-1 mediated the action of GH in this process (Ruan and Kleinberg 1999). The 2
96
integrin subunit-deficient mice had impaired mammary branching morphogenesis (J.
Chen et al. 2002). Possible explanations include the ability of circulating IGF-1 produced
by liver, muscle and mammary stroma to compensate for the loss of IGF-1 production in
the c94
f/f
mammary epithelium, and other integrins that may compensate for 2 integrin
activity in vivo, as previously reported (J. Chen et al. 2002). Furthermore, we observed
that GRP94 deficiency in the mammary epithelium did not affect cellular proliferation.
In previous findings, acute elimination of GRP94 in the hematopoietic system caused
an increase in hematopoietic stem cell (HSC) and granulocyte-monocyte progenitors in
bone marrow, as well as the failure of the Grp94-knockout HSCs to express integrin 4
on the cell surface, associating with niche detachment (Biquan Luo et al. 2011).
Hyperproliferation of liver progenitor cells was also observed in liver-specific GRP94
knockout mouse model, correlating with disruption of cell-cell/cell-matrix interaction
(Wan-Ting Chen, Tseng, et al. 2014). Knockout of GRP94 in the intestinal epithelium led
to decrease in Wnt signaling and gut proliferation defect and postnatal death (B. Liu et al.
2013). On the other hand, GRP94 is dispensable for the growth of embryonic stem cells
(C. Mao et al. 2010), the viability of Purkinje cells in the mouse cerebellum (Miao Wang
et al. 2010) and B-cell development (B. Liu and Li 2008). Tissue specific modes of action
or requirements for GRP94 may have significant clinical implications. Expression of
GRP94 in human breast carcinoma samples is significantly higher than that in normal
breast tissue (Hodorova et al. 2008). Recently, it was reported that GRP94 is important in
regulating plasma membrane HER2 signaling in HER2-overexpressed breast cancer cell
97
lines (Patel et al. 2013). This suggests that GRP94 could be a new target in treatment of
patients with HER-2 overexpression and results of our genetic knockout model imply that
targeting GRP94 in breast cancer treatment may not affect normal breast tissue.
Unexpectedly, GRP78 expression in the c78
f/f
mammary epithelium was only slightly
diminished compared to wild-type level. Correspondingly, no development or functional
abnormalities were detected in virgin c78
f/f
glands up to 7 months of age or lactating c78
f/f

mammary glands. MYO, MRU and luminal epithelial cells enriched fractions isolated
from 78
f/f
and c78
f/f
mammary glands showed no difference in distribution of these sub-
lineages. Mammary transplants of epithelial cells isolated from 78
f/f
and c78
f/f
glands
displayed similar take-rates, corresponding with incomplete and differential excision of
the Grp78 floxed alleles in various lineages of epithelial cells re-isolated from c78
f/f

mammary outgrowth. This raises the important question of whether the deletion of
GRP78 was unsuccessful in the c78
f/f
glands. While we cannot formally rule out the
MMTV-Cre recombinase is specifically inefficient in deleting the Grp78
f/f
alleles in the
mammary epithelium, this is unlikely since the same Cre system was able to knockout the
Grp94
f/f
alleles in parallel experiments, and the same Grp78
f/f
alleles had been deleted in
the many different cell types and organs in previous studies (Zhu et al. 2013; Y. Fu et al.
2008; Wey et al. 2012; W-T Chen et al. 2013). An alternative explanation is that the
intrinsic efficiency of MMTV-Cre may be similar in the Grp78
f/f
and Grp94
f/f
contexts
but that selective pressure against GRP78 loss leads to repopulation of the epithelium by
cells that retain the un-recombined alleles in c78
f/f
mice. In support of this possibility, in
98
an intestine-specific GRP78 knockout mouse model, recombination efficiency was high
at day 1 post-induction of Cre recombinase, but there was increasing presence of non-
recombined cells from day 3 (Heijmans et al. 2013). Repopulation of non-recombined
cells was also observed in an oesophagus knockout model of GRP78 (Rosekrans et al.
2014). Additionally, in a mouse model with conditional c-Myc knockdown in intestines,
a similar pattern of repopulation was observed (Muncan et al. 2006). Although we cannot
infer exact ratios between recombined and non-recombined alleles in our study due to
potential differences in PCR efficiency using different primers, the changing ratios
indicate a differing excision rate in the various mammary epithelial cell sub-populations.
While it is not possible to conclude that mammary epithelial cells tolerate bi-allelic
Grp78 deletion, these data suggest this is more likely in myoepithelial cells than
mammary stem cells.
As an alternative strategy, we transduced isolated 78
f/f
mammary epithelial
stem/progenitor cells with Ad-GFP-Cre or Ad-GFP-Con and performed transplantation
assays. Cells transduced with Ad-GFP-Cre failed to regenerate the mammary glands,
associating with the loss of GRP78 surface expression. These data suggest that GRP78
plays an important role in stem cell function and homeostasis in the mammary gland.
These findings are consistent with our recent discovery that cell surface GPR78 is a
functional marker of fetal and adult mammary stem cells that mediates their
responsiveness to the stem cell-associated factor Cripto (Spike et al. 2014). In summary,
we demonstrated here that although both GRP78 and GPR94 are key chaperones in the
99
ER, they serve non-overlapping functions in the mouse mammary epithelial cells and that
GRP78 , but not GPR94, is critical for mammary gland development and regeneration.

100
Chapter 5
Conclusions and Perspectives
Since ER plays important role in many essential cellular processes, the disorder of
ER homeostasis and stress are involved intensively with in functions of different tissues
and diverse diseases, such as embroygenesis, maintenance of hematopoietic homeostasis,
neurodegenerative disorders, inflammation, cancer and diabetes mellitus. (Ni and Lee
2007; Yoshida 2007; S Luo et al. 2006; Wey, Luo, and Lee 2012; Biquan Luo et al.
2011). In this dissertation, we set forth to investigate the roles of ER in adipogenesis,
liver steatosis and cancer progression mediated by loss of the tumor suppressor PTEN, as
well as mammary gland development, through creation of conditional knockout mouse
models of ER chaperones. Additionally, the roles of UPR components and GRPs in
homeostasis of other organs are discussed.
In Chapter 2, we found that GRP78 is required for adipocyte differentiation in two in
vitro cell model: MEFs and 3T3-L1 cells. We cannot exclude the possibility that the
death of MEFs observed upon knockdown of GPR78 could lead to reduced adipogenesis,
but GRP78 knockdown in 3T3-L1 cell line also impaired adipogenesis without noticeable
cell death. Ap2-cre mediated GRP78 knockout in mice not only caused reduced adipose
tissue with 40% residual GRP78 level, but also growth retardation, bone reduction, early
mortality, altered profile of glucose homeostasis and adipokines secretion. Furthermore,
we did not detect dyslipidemia, fatty liver or type 2 diabetes phenotypes, compared with
101
lipodystrophic mouse models. Although the study of our mouse model was confounded
by ectopic expression of aP2-cre in other tissues, our results indicate GRP78 plays
essential role in survival and differentiation of adipose tissue, of which mechanism
requires further investigation.
Chapter 3 of the dissertation focuses on the study of GRP78 in the liver steatosis and
cancer progression. Albumin-cre mediated GRP78 knockout mice showed increased lipid
accumulation in hepatocytes, without progression to malignancy up to 14 month old in
mice. When GRP78 reduction was combined with PTEN deletion in mice liver, we
observed greater lipid accumulation in hepatocytes than that in GRP78 and PTEN single
knockout mice. Liver injury caused by liver steatosis could further induce expansion of
the liver progenitor cells, which may lead to accelerated liver tumorigenesis with
occurrence both HCC and CC. were detected. For mechanistic study, p-JNK was
moderately upregulated and -catenin was downregulated with increase of PDGFR  in
liver of GRP78 and PTEN double knockout mice.
The ER is one vital organelle for triglyceride (TG) synthesis, lipid droplet formation
with ER membranes as integral components, triglyceride export from liver and
cholesterol sensing. (Gregor and Hotamisligil 2007). Both liver and adipose tissue are
major organs for lipid metabolism and they have similar cellular processes, such as
lipogenesis, lypolysis, and lipid transport. These two organs are also closely connected in
regulation of whole body lipid homeostasis and share multiple regulation mechanisms.
102
We showed that knockdown of GRP78 inhibit lipogenesis in adipocytes in chapter 2,
while we demonstrated that knockdown of GRP78 increase lipid accumulation in
hepatocytes in chapter 3. The contradictory can be explained by interaction between
GRP78 and autophagy, and different roles of autophagy played in adipose tissue and
liver. Previous study shows that GRP78 is required for ER integrity and stress-induced
autophagy, since ER is a putative membrane source for generating autophagosomal
double membrane (Li et al. 2008). In residual adipose tissue of aP2-cre, Grp78
f/f
mice, we
observed dilated ER, suggesting the disrupted ER integrity. As demonstrated previously,
atg7-/- and atg5-/- MEFs induced to adipocytes initially appeared to differentiate
normally, but ultimately failed to undergo further morphological transformation and
eventually died, likely through apoptosis (Y. Zhang et al. 2009; Baerga and Zhang 2009).
In consistent with these findings, adipose tissue targeted deletion of atg5 in mice
developed without any apparent defects, but die on postnatal day 1 due to failure to cope
with neonatal starvation (Baerga and Zhang 2009). Additionally, adipose tissue targeted
deletion of atg7 in mice led to reduced fat, increased insulin sensitivity, and decreased
leptin in plasma but not adiponectin (Y. Zhang et al. 2009). The atg7-/- and our aP2-cre,
Grp78
f/f
mouse model showed similar metabolic parameters such as insulin, leptin,
adiponectin and plasma triglyceride, which are unique compared with other lipoatrophic
mouse model. This indicates that impairment of adipogenesis caused by knockdown of
GRP78 may be meditated through disturbed autophagy, which warrants further
investigation. Increased P62 was detected in liver of albumin-cre, Pten
f/f
Grp78
f/f
mice,
103
which indicates perturbation of autophagy. However, in contrast with adipocytes,
inhibition of autophagy in cultured hepatocytes and mouse liver increased triglyceride
storage in lipid droplets, with decrease in triglyceride -oxidation and decay (Singh et al.
2009). Futhermore, mice with systemic mosaic deletion of atg5 and liver-specific atg7-/-
mice both developed benign liver adenomas, which originate from autophagy-deficient
hepatocyes (Takamura et al. 2011). Thus, the autophagy pathway could be a universal
mechanism through which GRP78 regulate lipid accumulation in hepatocytes and
adipocytes.
ER stress and UPR signaling have been also implicated in regulation of lipid
metabolism. XBP1 had been shown to be a novel transcription factor required for both
adipogenesis and hepatic lipogenesis, through directly regulation of lipogenic genes (Sha
et al. 2009; A.-H. Lee et al. 2008). Knockdown of GRP78 in MEFs induced to adipocytes
led to decrease of XBP-1s protein level, whereas in liver of albumin-cre, Grp78
f/f
mice
led to increase, which is consistent with the function of XBP1 in adipose tissue and liver.
Interestingly, albumin-cre, Pten
f/f
Grp78
f/f
livers did not show splicing of XBP1,
indicating that the lipid accumulation may be regulated by other pathways. As previously
demonstrated, ER stress with increased p-eIF2  repressed adipocyte differentiation in
3T3-L1 cells, while impaired eIF2 α phosphorylation enhanced adipocyte differentiation
in MEFs and mice. Furthermore, forced production of CHOP, a downstream target of
eIF2 α phosphorylation, inhibited adipogenesis in 3T3-L1 cells (Chikka et al. 2013). In
104
the case of liver, induction of eIF2 α and CHOP under ER stress contributes to
suppression of metabolic genes during endoplasmic stress. Therefore, the diminished
adipogenesis in GRP78-deficient MEFs could be partially due to increased CHOP protein
level. In livers of albumin-cre, Pten
f/f
Grp78
f/f
mice, loss of Pten significantly attenuates
the induction of CHOP, which may further explain the severe lipid accumulation (Zeng et
al. 2011). For ATF6 pathway, ATF6 -knockout mice failed to recover from tunicamycin
induced insult and exhibited liver dysfunction and steatosis, while reduction of ATF6 
expression impaired expression of key adipogenic genes and reduced lipid accumulation
following the induction of adipogenesis in C3H10T1/2 cell line (Lowe et al. 2011;
Yamamoto et al. 2010). In summary, the disturbance of ER homeostasis could eventually
led to fatty liver with increased triglyceride storage and decreased storage in adipose
tissue. This may be intuitively results from the difference in the basic function of these
two cell types, where adipocytes normally store lipid and hepatocytes do not.
In murine adipose tissue, the lipid storage come from two major sources: de novo
lipogenesis and lipid transfer from liver. These two organs closely interacted with each
other to regulate whole body lipid homeostasis. Our albumin-cre, Pten
f/f
Grp78
f/f
mice
demonstrated leaner body mass than albumin-cre, Pten
f/f
mice, indicating the role of
GRP78 in redistribution of body fat from adipose tissue to the liver. There are two
possibilities: 1) the failure of transport of lipid from liver to adipose tissue; 2) increased
de novo lipogenesis from glucose in the liver, which led to deficient lipogenesis in
105
adipose tissue. The triglyceride transport from liver to adipose tissue is mediated by
VLDL with apolipoprotein B100 (apoB100) as a key component. The synthesis rate of
apoB100 in the ER controls the overall rate of VLDL production (Nguyen et al. 2008).
Previous study identified both GRP94 and GRP78 participate in early folding events
occurring cotranslationally while apoB is membrane-bound, as well as release of the
lapidated intermediate from the membrane (Pagliassotti 2012). Unresolved ER stress in
response to increased hepatic lipids may decrease the ability of the liver to secrete
triglycerides by inducing degradation of apoB (J. Zhang and Herscovitz 2003). Thus,
knockdown of GRP78 in the liver may block the secretion of VLDL via the suppressed
apoB processing. Preliminary measurement of apoB100 in mice plasma did not exhibit
consistent difference among difference genotypes, but more n number and control of
fasting status are needed for further investigation. Increased lipogenesis in albumin-cre,
Pten
f/f
Grp78
f/f
livers was confirmed by induction of lipogeneic genes. Recent study
suggests ER stress induces the maturation of SREBP-1c by a proteolytic mechanism
initiated in the ER (Ferré and Foufelle 2010). Another investigation shows that GRP78
expression inhibits ER stress–induced SREBP-1c activation and reduces hepatic steatosis
in mice, indicating GRP78 deficiency contribute to activation of SREBP-1c and its
downstream genes: ACC1 and FAS (Kammoun et al. 2009).
In the case of GRP94, depletion of GRP94 in the liver by Alb-cre was more efficient
compared to GRP78. Livers of the young Grp94
f/f
; Alb-Cre mice showed minor liver
106
injury and focal steatosis, but strikingly, liver progenitor cells expansion and
disorganization of cell adhesion molecules were evident, which is consistent with the role
of GRP94 in maintaining cell-cell interaction (Wan-Ting Chen, Tseng, et al. 2014).
Grp94
f/f
; Alb-Cre livers developed abnormal small nodules at 15 months, and HCC and
ductular reactions (DRs) by 21 months (Wan-Ting Chen, Ha, et al. 2014). Strikingly,
Grp94
f/f
; Alb-Cre livers were gradually repopulated with GRP94-positive hepatocytes,
while the DRs maintained GRP94-negative (Wan-Ting Chen, Ha, et al. 2014). In the
context of double knockout of GRP94 and PTEN in the liver, accelerated development of
HCC and CC was observed, with selective activation of the ERK pathway, disruption of
cell adhesion and activation of liver progenitor cells at the premalignant stage (Wan-Ting
Chen, Tseng, et al. 2014). Nonetheless, heterogeneous GRP94 expression from very low
to wild type level was observed in the HCC formed in the double GRP94 and PTEN
knockout mice, whereas the CC cells remained mostly GRP94 negative (Amy S Lee and
Chen 2014). Thus, while GRP94 maintains cell adhesion and stem cell quiescence which
are tumor suppressing factors, it can also support tumorigenesis as a stress chaperone and
regulator of pro-oncogenic signaling pathways. Recently, in another model of liver
specific knockout of GRP94, elevation of long chain ceramides and upregulation of
several enzymes in the biogenesis of ceramides were observed, indicating a novel role of
GRP94 in sphingolipid homeostasis (Rachidi et al. 2014). This same study also showed
repopulation of the liver with GRP94-positive hepatocytes as the mice aged, and upon
107
treatment with carcinogen, the knockout mice developed hepatic hyperplasia and cancer
that are GRP94-positive.
In Chapter 4, we demonstrated that GRP78 not GRP94 is require for mammary gland
development. GRP94 deficiency in mammary epithelium did not affect the normal
development of mammary gland of mice, while GRP78 ablation in mammary epithelial
cells suppressed regeneration of mammary gland in mice. Additional study showed
CRIPTO and its cell surface receptor GRP78 served as regulators of stem cell behavior in
isolated fetal and adult mammary epithelial cells (Spike et al. 2014). CD24 positive
mammary epithelial cells with either high (GRP78
high
) or low (GRP78
low
) levels of cell
surface GRP78 were isolated from wild type mice. GRP78
high
population overlapped
most precisely with the stem cell-enriched MRU fraction and were much more likely to
give rise to organoids, which indicates that the GRP78
high
population is enriched for
bipotent stem/progenitor cells (Spike et al. 2014). Taken together, these findings
demonstrated that GRP78 plays an important role in stem cell function and homeostasis
in the mammary gland.
As a chaperone, GRP78 participates in the early intermediates of protein folding with
abundant client proteins, including growth factor secretion and/or the maturation of
growth factor receptors. GRP78 is required for proliferation of multiple cell types, and
therefore normal development and homeostasis of various organs and tissues. As a
multifunctional receptor, cell surface GRP78 is expressed in selected cell types, notably
108
cancer cells. Cell surface GRP78 was demonstrated to be a receptor for activated 2-
macroglobulin, which is postulated to promote proliferation, survival, and metastasis of
prostate cancer cells (Gonzalez-Gronow et al. 2009). Cell surface GRP78 is also reported
to maintain adult hematopoietic stem cells in the hypoxic endosteal niche in the bone
marrow, via forming a complex with CRIPTO (B Luo and Lee 2013). In contrast to
GRP78, the chaperone function of GRP94 is cell/tissue type-dependent. GRP94 is
essential for particular clients that are needed for cell-cell interactions (Eletto, Dersh, and
Argon 2010). For example, liver-specific knockout of GRP94 in mice disrupted cell
adhesion, activated liver progenitor Cells, and accelerated liver tumorigenesis (Wan-Ting
Chen et al. 2013). The function of surface GRP94 is so far limited in innate and adaptive
immune system, including triggering MyD88-dependent systemic autoimmune diseases
and escorting antigenic peptides into the MHC class I cross-presentation pathway
(Jockheck-Clark et al. 2010). Due to these unique functions of GRP78 and GRP94, it is
not hard to conceive that the differential requirement of these two chaperones in
mammary gland development.
In these three mouse models, it is worth to note that repopulation of GRP78 was
observed in all three organs we studied: adipose tissue, liver and mammary gland. In
MEFs induced to adipocytes, adenovirus-cre mediated GRP78 knockdown was efficient
on day 4 of differentiation, but GRP78 protein level gradually increased on day 10 and
16. Residual adipose tissue in aP2-cre, Grp78
f/f
mice showed only 60% knockdown of
109
GRP78 protein. In both albumin-cre, Grp78
f/f
and albumin-cre, Pten
f/f
Grp78
f/f
livers,
GRP78 level demonstrated 50% reduction at 3 months and 70% reduction at 6 months.
However, GRP78 level in normal areas of these livers at 9 months returned back to wild-
type level, and HCC and CC areas exhibited stronger GRP78 expression. Interestingly,
while GRP78 cannot be completely ablated in hepatocytes of albumin-cre, Pten
f/f
Grp78
f/f

livers, cholangiocytes and some putative liver progenitor cells maintained wild-type
GRP78 level at all time points we monitored. In MMTV-cre, Grp78
f/f
mammary glands,
we did not detect reduction of GRP78 protein level using either western blotting or
immunostaining. Therefore, no abnormalities that mimic the impaired mammary gland
regeneration with GRP78 deficient epithelial cells were observed in the MMTV-cre,
Grp78
f/f
mice. In Ctnnb1
loxp/loxp
; Alb-Cre mice, gradual repopulation with -catenin-
positive hepatocytes occurred following 3,5-diethoxycarbonyl-1,4-dihydrocollidine
(DDC) injury and coincided with a progressive loss of hepatic cre-recombinase
expression (Thompson et al. 2011).
Besides these knockout mouse models using non-inducible cre recombinase
promoter, similar repopulation patter of GRP78 was also observed in mouse models
mediated by inducible cre recombinase. In a polyinosine-polycitidine (pIpC) inducible
Mx-1-cre, Grp78
f/f
mice, GRP78 can be acutely deleted in the hematopoietic system
(Wey, Luo, and Lee 2012). At later timepoints after administration of pIpC, Mx-1-cre,
Grp78
f/f
mice started to gain weight toward normal growth rate and increase of
110
lymphocytes back to normal level. Repopulation of GRP78 wild-type oesophageal
epithelial cells or intestinal stem cells was observed in Ah1Cre, Grp78
f/f
mice after
induction of cre recombinase (Heijmans et al. 2013; Rosekrans et al. 2014). Similar
pattern of repopulation was also identified in knockout mouse models of other proteins,
such as c-Myc and -cateinin. Induced deletion of c-Myc in adult intestine crypts led to
loss of c-Myc-deficient crypts, which was replaced by c-Myc-proficient crypts (Muncan
et al. 2006). This could be a consequence of incomplete efficiency of cre recombinase
and cells that escaped gene deletion have greater survival advantage than mutant cells,
which led to the expansion and repopulation of wild-types cells in the long run.
UPR components and GRPs are also very important for pancreas homeostasis. The
bulk of the pancreas is composed of exocrine tissue, which is highly specialized for the
production and secretion of digestive enzymes. In response to meal stimulation, acinar
cells of the exocrine pancreas exhibit the highest protein synthesis rate among human
tissues (Case 1978). Acinar cells adapt to these functions by expansion of the ER.
Additionally, ER stress caused by misfolding of mutant digestive enzymes has been
linked to hereditary chronic pancreatitis in human, suggesting the UPR and ER
chaperones are important for maintaining pancreatic homeostasis (Kereszturi et al. 2009).
In agreement with this, inducible conditional knockout of Perk in adult pancreata resulted
in hyperglycemia associated with loss of islet and cell architecture, intracellular
accumulation of proinsulin and Glut 2, massive ER expansion and onset of adaptive UPR
111
in pancreatic tissue (Gao et al. 2012). Thus, PERK is essential for secretory homeostasis
and -cell survival in adult mice, implying that development of PERK inhibitor in human
subjects need to be cautiously pursued (Atkins et al. 2013). Diet-induced obese ATF6 -/-
mice exhibited glucose intolerance due to pancreatic -cell failure, associating swollen
ER structure, but are partially resistant to diet-induced insulin resistance (Usui et al.
2012). Conditional knockout of XBP1 in adult pancreatic acinar cells induced extensive
apoptosis, followed by pancreas regeneration of acinar cells from the surviving XBP1
positive cells (Hess et al. 2011).
For ER chaperones, while Grp78+/- acinar cells exhibited a slightly more dilated ER
lumen and fared worse in cerulein-induced pancreatitis associated with CHOP induction,
interestingly, with the HFD regimen, Grp78+/- mice triggered compensatory
upregulation of other ER chaperones in the pancreas, corresponding with mitigated
pancreatitis upon cerulein treatment (Ye et al. 2010). However, these responses are
dependent on the genetic background of the mice, underscoring the complexity of these
physiological adaptations. In human and murine models of pancreatic cancer, GRP78
expression is highly elevated in the ductal structures of pre-cancer, as well as in
pancreatic adenocarcinoma. In the mouse lesions, GRP78 is present in both the cytoplasm
and the membranes, where it co-localized with activated AKT (Hill et al. 2012). These
studies suggest that GRP78 could have the dual function of maintaining ER integrity as
well as mediating PI3K/AKT oncogenic signaling at the cell surface in pancreatic cancer.
112
In the case of muscle, PERK is important in maintaining muscle calcium homeostasis
such that muscle cells isolated from Perk-/- mice showed high levels of ER stress and
disruption of the calcium signaling complex (Huang et al. 2006). GRP94 has been studied
extensively in muscle physiology. GRP94 is essential for muscle differentiation such that
Grp94-/- embryonic stem cells cannot differentiate into any of the muscle sublineages
(Wanderling et al. 2007). In skeletal and cardiac muscle, GRP94 is completely contained
within the sarcoplasmic reticulum lumen (Vitadello, Colpo, and Gorza 1998), and
reduction in GRP94 levels in skeletal myoblasts leads to loss of myocyte fusion
competence (Ostrovsky et al. 2010). GRP94 functions as a protective stress protein in
muscle, such that GRP94 level is transiently increased in fibrillating atrial myocytes, and
cell death of stressed cardiomyocytes can be rescued through overexpression of GRP94
(Vitadello et al. 2003). IGF-I and IGF-II are essential for development and growth of
skeletal muscles and their production is dependent on GRP94. Ablation of GRP94 in
striated muscle of Grp94
f/f
; MCK-Cre mice resulted in smaller skeletal muscles with
decreased IGF contents, and growth defect associating with diminished circulating IGF-1
(Barton et al. 2012).
Neurodegenerative diseases are often associated with dysfunction in protein quality
control, leading to accumulation of misfolded proteins that triggers ER stress (Rao and
Bredesen 2004). The function and potential of GRP78 as a therapeutic target for
neurodegenerative disorders have been previously reviewed (Muchowski and Wacker
113
2005; Miao Wang et al. 2009; Gorbatyuk et al. 2012). ER protein quality control is
critical for cerebellar Purkinje cell (PC) survival, and is linked to the Marinesco-Sjogren
syndrome in humans (Anttonen et al. 2005). PCs are a class of GABAergic neurons
located in the cerebellum and they send inhibitory projections to the deep cerebellar
nuclei, and constitute the sole output of all motor coordination in the cerebellar cortex. In
a mouse model where GRP78 was specifically eliminated in the PCs, reduction of
cytosolic ubiquitin and prominent dilatation of the ER were observed, accompanied by
the activation of the UPR and compensatory upregulation of other ER chaperones (Wang,
et al. 2010). These mice exhibited growth retardation, severe motor coordination defect
and cerebellar atrophy. In contrast, PC deficient in GRP94 showed none of these
cerebellar degeneration phenotypes, underscoring the specific requirement of GRP78 for
the integrity of this organ (Wang, et al. 2010). In agreement with these findings, a
knockin mouse model expressing heterozygous mutant GRP78 also revealed motor
disabilities in aging and degeneration of some motoneurons in the spinal cord (Jin et al.
2014). In another model with knockin of a mutant Grp78 gene, the mice exhibited
disordered cerebral cortex and cerebellum, and smaller brain (Mimura et al. 2008). In
mice harboring a hypomorph mutant of GRP78, neonatal respiratory failure, abnormal
cerebellum and decrease in axon projection (Favero et al. 2013).
Since GRP78 and GRP94 has been shown to be key factors in various cancer and
other human diseases, the agents targeting GRPs at different levels and locations are
114
emerging and demonstrate promising therapeutic effect (A. Lee 2014). The systemic
administration of a dual double-targeted phage using the RGD4C tumor homing ligand
and Grp78 promoter for transcriptional targeting and carrying Herpes simplex virus-1
thymidine kinase (HSVtk) plus ganciclovir produces marked regression of large and
therapy-resistant tumors in vivo (Kia et al. 2012). Similarly, LacZ transgene expression
driven by the grp94 promoter was strongly activated in spontaneous and diverse
chemically induced tumors, indicating GRP94 could be a future candidate for directing
transcription of therapeutic agents to tumors (Reddy et al. 2002). SubAb is a bacterial
toxin that cleaves and inactivate GRP78 protein. An engineered fusion protein that
combines epidermal growth factor (EGF) and SubAb exhibits highly toxicity to growing
and confluent EGFR–expressing cancer cells through rapid cleavage of GRP78. Systemic
delivery of the EGF-SubA fusion protein significantly inhibit human breast and prostate
tumor xenografts in mouse models (Backer et al. 2009). A peptide derived from the
cochaperone Bag-1 interacts with and inhibits the refolding activity of GRP78 and
prostate cancer cells stably expressing this peptide showed reduced growth and increased
apoptosis in xenograft tumor models (Maddalo et al. 2012). PU-WS13, which is one
GRP94-selective compounds due to its insertion into a new allosteric pocket of GRP94,
was particularly efficacious in HER2-overexpressing breast cancers (Patel et al. 2013).
Recent report identified a high affinity GRP78-specific monoclonal IgG antibody,
MAb159, which specifically recognized cell surface GRP78, triggered GRP78
endocytosis and inhibited PI3K signaling without compensatory MAPK pathway
115
activation. MAb159 administration suppressed tumor progression in PTEN-loss-driven
prostate and leukemia tumor models and halted xenograft tumor metastasis in mice.
Furthermore, the humanized form of this antibody had desirable pharmacokinetics and
was not toxic in mice (R. Liu et al. 2013).
In summary, UPR components and ER chaperones GRP78 and GRP94 are crucial for
ER homeostasis and emerging evidences show they are also functional on cell surface,
hence they are central for many cellular processes and signaling pathways. In this
dissertation, we unveiled the important roles of GRP78 in adipose tissue, PTEN-null
induced liver cancer progression and mammary stem cells. We also discover that GRP94
is not required for normal development of mammary glands. Our findings indicate that
GRP78 is a critical connection between ER homeostasis and multiple cellular
processes/signaling pathways, such as survival of cells in different organs, autophagy and
lipid metabolism mediated by UPR signaling pathways. In addition to adipose tissue,
liver and mammary gland, the functions of UPR components and GRPS in hematopoietic
system, intestine, esophagus, pancreas, muscle and cerebellum are elegantly
demonstrated by knockout mouse models. UPR and ER chaperones are not only
leverages for basic research on different cellular process, but also future targets for
designing therapeutic agents.

116
BIBLIOGRAPHY
Anttonen, Anna-Kaisa, Ibrahim Mahjneh, Riikka H Hämäläinen, Clotilde Lagier-
Tourenne, Outi Kopra, Laura Waris, Mikko Anttonen, et al. 2005. “The Gene
Disrupted in Marinesco-Sjögren Syndrome Encodes SIL1, an HSPA5
Cochaperone.” Nature Genetics 37 (12): 1309–11. doi:10.1038/ng1677.
Atkins, Charity, Qi Liu, Elisabeth Minthorn, Shu-Yun Zhang, David J Figueroa,
Katherine Moss, Thomas B Stanley, et al. 2013. “Characterization of a Novel PERK
Kinase Inhibitor with Antitumor and Antiangiogenic Activity.” Cancer Research 73
(6): 1993–2002. doi:10.1158/0008-5472.CAN-12-3109.
Avivar-Valderas, Alvaro, Eduardo Salas, Ekaterina Bobrovnikova-Marjon, J Alan Diehl,
Chandandeep Nagi, Jayanta Debnath, and Julio a Aguirre-Ghiso. 2011. “PERK
Integrates Autophagy and Oxidative Stress Responses to Promote Survival during
Extracellular Matrix Detachment.” Molecular and Cellular Biology 31 (17): 3616–
29. doi:10.1128/MCB.05164-11.
Backer, Joseph M, Arcadius V Krivoshein, Carl V Hamby, John Pizzonia, Kenneth S
Gilbert, Yonaton S Ray, Harrison Brand, Adrienne W Paton, James C Paton, and
Marina V Backer. 2009. “Chaperone-Targeting Cytotoxin and Endoplasmic
Reticulum Stress – Inducing Drug Synergize to Kill Cancer Cells.” Neoplasia (New
York, N.Y.) 11 (11): 1165–73. doi:10.1593/neo.09878.
Baerga, Rebecca, and Yong Zhang. 2009. “Targeted Deletion of Autophagy-Related 5
(atg5) Impairs Adipogenesis in a Cellular Model and in Mice.” Autophagy 5 (8):
1118–30.
Barton, Elisabeth R, Soohyun Park, Jose K James, Catherine a Makarewich, Anastassios
Philippou, Davide Eletto, Hanqin Lei, et al. 2012. “Deletion of Muscle GRP94
Impairs Both Muscle and Body Growth by Inhibiting Local IGF Production.”
FASEB Journal : Official Publication of the Federation of American Societies for
Experimental Biology, May, 1–12. doi:10.1096/fj.11-203026.
Bastie, Claire C, Haihong Zong, Jun Xu, Bhavin Busa, Stefan Judex, Irwin J Kurland,
and Jeffrey E Pessin. 2007. “Integrative Metabolic Regulation of Peripheral Tissue
Fatty Acid Oxidation by the SRC Kinase Family Member Fyn.” Cell Metabolism 5
(5): 371–81. doi:10.1016/j.cmet.2007.04.005.
Behari, Jaideep, Tzu-Hsuan Yeh, Lindsay Krauland, Wade Otruba, Benjamin Cieply,
Beth Hauth, Udayan Apte, Tong Wu, Rhobert Evans, and Satdarshan P S Monga.
117
2010. “Liver-Specific Beta-Catenin Knockout Mice Exhibit Defective Bile Acid and
Cholesterol Homeostasis and Increased Susceptibility to Diet-Induced
Steatohepatitis.” The American Journal of Pathology 176 (2): 744–53.
doi:10.2353/ajpath.2010.090667.
Bobrovnikova-Marjon, Ekaterina, Georgia Hatzivassiliou, Christina Grigoriadou,
Margarita Romero, Douglas R Cavener, Craig B Thompson, and J Alan Diehl. 2008.
“PERK-Dependent Regulation of Lipogenesis during Mouse Mammary Gland
Development and Adipocyte Differentiation.” Proceedings of the National Academy
of Sciences of the United States of America 105 (42): 16314–19.
doi:10.1073/pnas.0808517105.
Brantley, D M, C L Chen, R S Muraoka, P B Bushdid, J L Bradberry, F Kittrell, D
Medina, L M Matrisian, L D Kerr, and F E Yull. 2001. “Nuclear Factor-kappaB
(NF-kappaB) Regulates Proliferation and Branching in Mouse Mammary
Epithelium.” Molecular Biology of the Cell 12 (5): 1445–55.
Brasaemle, Dawn L, and Nathan E Wolins. 2012. “Packaging of Fat: An Evolving Model
of Lipid Droplet Assembly and Expansion.” The Journal of Biological Chemistry
287 (4): 2273–79. doi:10.1074/jbc.R111.309088.
Burkart, Alison, Xiarong Shi, My Chouinard, and Silvia Corvera. 2011. “Adenylate
Kinase 2 Links Mitochondrial Energy Metabolism to the Induction of the Unfolded
Protein Response.” The Journal of Biological Chemistry 286 (6): 4081–89.
doi:10.1074/jbc.M110.134106.
Case, R Maynard. 1978. “SYNTHESIS, INTRACELLULAR TRANSPORT AND
DISCHARGE OF EXPORTABLE PROTEINS IN THE PANCREATIC ACINAR
CELL AND OTHER CELLS.” Biological Reviews, no. 53: 211–354.
Chen, Jianchun, Thomas G. Diacovo, David G. Grenache, Samuel a. Santoro, and Mary
M. Zutter. 2002. “The α2 Integrin Subunit-Deficient Mouse.” The American Journal
of Pathology 161 (1). American Society for Investigative Pathology: 337–44.
doi:10.1016/S0002-9440(10)64185-5.
Chen, Wan-Ting, Dat Ha, Gary Kanel, and Amy S Lee. 2014. “Targeted Deletion of ER
Chaperone GRP94 in the Liver Results in Injury, Repopulation of GRP94-Positive
Hepatocytes, and Spontaneous Hepatocellular Carcinoma Development in Aged
Mice.” Neoplasia (New York, N.Y.) 16 (8). Elsevier B.V.: 617–26.
doi:10.1016/j.neo.2014.07.005.
118
Chen, Wan-Ting, Chun-Chih Tseng, Kyle Pfaffenbach, Gary Kanel, Biquan Luo,
Bangyan L Stiles, and Amy S Lee. 2013. “Liver-Specific Knockout of GRP94 in
Mice Disrupts Cell Adhesion, Activates Liver Progenitor Cells, and Accelerates
Liver Tumorigenesis.” Hepatology (Baltimore, Md.), August, 1–40.
doi:10.1002/hep.26711.
———. 2014. “Liver-Specific Knockout of GRP94 in Mice Disrupts Cell Adhesion,
Activates Liver Progenitor Cells, and Accelerates Liver Tumorigenesis.”
Hepatology (Baltimore, Md.) 59 (3): 947–57. doi:10.1002/hep.26711.
Chen, W-T, G Zhu, K Pfaffenbach, G Kanel, B Stiles, and a S Lee. 2013. “GRP78 as a
Regulator of Liver Steatosis and Cancer Progression Mediated by Loss of the Tumor
Suppressor PTEN.” Oncogene, no. August (October). Nature Publishing Group: 1–9.
doi:10.1038/onc.2013.437.
Chikka, Madhusudana R, Diane DeZwaan McCabe, Heather M Tyra, and D Thomas
Rutkowski. 2013. “C/EBP Homologous Protein (CHOP) Contributes to Suppression
of Metabolic Genes during Endoplasmic Reticulum Stress in the Liver.” The Journal
of Biological Chemistry 288 (6): 4405–15. doi:10.1074/jbc.M112.432344.
Cowherd, R M, R E Lyle, and R E McGehee. 1999. “Molecular Regulation of Adipocyte
Differentiation.” Seminars in Cell & Developmental Biology 10 (1): 3–10.
Deome, K B, L J Faulkin, Howard A Bern, and Phyllis B Blair. 1959. “Development of
Mammary Tumors from Hyperplastic Alveolar Nodules Transplanted into Gland-
Free Mammary Fat Pads of Female C3H Mice.” Cancer Research 19: 515.
Desmet, V., T. Roskams, and P. Van Eyken. 1995. “Ductular Reaction in the Livers.”
Pathology - Research and Practice 191 (6). Gustav Fischer
Verlag · Stuttgart · Jena · New York: 513–24. doi:10.1016/S0344-0338(11)80870-8.
Ding, Wen-xing. 2010. “Role of Autophagy in Liver Physiology and Pathophysiology.”
World Journal of Biological Chemistry 1 (70).
Eletto, Davide, Devin Dersh, and Yair Argon. 2010. “GRP94 in ER Quality Control and
Stress Responses.” Seminars in Cell & Developmental Biology 21 (5). Elsevier Ltd:
479–85. doi:10.1016/j.semcdb.2010.03.004.
El-Serag, Hashem B, and K Lenhard Rudolph. 2007. “Hepatocellular Carcinoma:
Epidemiology and Molecular Carcinogenesis.” Gastroenterology 132 (7): 2557–76.
doi:10.1053/j.gastro.2007.04.061.
119
Fata, Jimmie E, Zena Werb, and Mina J Bissell. 2004. “Regulation of Mammary Gland
Branching Morphogenesis by the Extracellular Matrix and Its Remodeling
Enzymes.” Breast Cancer Research : BCR 6 (1): 1–11. doi:10.1186/bcr634.
Favero, Carlita B, Rasha N Henshaw, Cynthia M Grimsley-myers, Ayushma Shrestha,
David R Beier, and Noelle D Dwyer. 2013. “Mutation of the BiP/GRP78 Gene
Causes Axon Outgrowth and Fasciculation Defects in the Thalamocortical
Connections of the Mammalian Forebrain.” Journal of Comparative Neurology 521
(3): 677–96. doi:10.1002/cne.23199.Mutation.
Federovitch, Christine M, David Ron, and Randolph Y Hampton. 2005. “The Dynamic
ER: Experimental Approaches and Current Questions.” Current Opinion in Cell
Biology 17 (4): 409–14. doi:10.1016/j.ceb.2005.06.010.
Ferré, P, and F Foufelle. 2010. “Hepatic Steatosis: A Role for de Novo Lipogenesis and
the Transcription Factor SREBP-1c.” Diabetes, Obesity & Metabolism 12: 83–92.
doi:10.1111/j.1463-1326.2010.01275.x.
Fiore, Frédéric, Bruno Estebe, Patrick Gibier, Jean-christophe Orsoni, Jean-remy
Courbard, Lewis A Chodosh, Daniel Birnbaum, and Odile Delapeyrière. 2009.
“Abnormal Mammary Gland Development in MMTV-CBLC Transgenic Mouse.”
In Vivo 228: 225–28.
Flint, Oliver P, Mustafa a Noor, Paul W Hruz, Phil B Hylemon, Kevin Yarasheski,
Donald P Kotler, Rex a Parker, and Aouatef Bellamine. 2009. “The Role of Protease
Inhibitors in the Pathogenesis of HIV-Associated Lipodystrophy: Cellular
Mechanisms and Clinical Implications.” Toxicologic Pathology 37 (1): 65–77.
doi:10.1177/0192623308327119.
Fu, Suneng, Steven M. Watkins, and Gökhan S. Hotamisligil. 2012. “The Role of
Endoplasmic Reticulum in Hepatic Lipid Homeostasis and Stress Signaling.” Cell
Metabolism 15 (5): 623–34. doi:10.1016/j.cmet.2012.03.007.
Fu, Yong, Shiuan Wey, Miao Wang, Risheng Ye, Chun-peng Liao, Pradip Roy-burman,
and Amy S Lee. 2008. “Pten Null Prostate Tumorigenesis and AKT Activation Are
Blocked by Targeted Knockout of ER Chaperone GRP78 / BiP in Prostate
Epithelium.” Sciences-New York 105 (49).
Galicia, Vivian a, Lina He, Hien Dang, Gary Kanel, Christopher Vendryes, Barbara a
French, Ni Zeng, et al. 2010. “Expansion of Hepatic Tumor Progenitor Cells in
Pten-Null Mice Requires Liver Injury and Is Reversed by Loss of AKT2.”
Gastroenterology 139 (6): 2170–82. doi:10.1053/j.gastro.2010.09.002.
120
Gallego, M I, N Binart, G W Robinson, R Okagaki, K T Coschigano, J Perry, J J
Kopchick, T Oka, P a Kelly, and L Hennighausen. 2001. “Prolactin, Growth
Hormone, and Epidermal Growth Factor Activate Stat5 in Different Compartments
of Mammary Tissue and Exert Different and Overlapping Developmental Effects.”
Developmental Biology 229 (1): 163–75. doi:10.1006/dbio.2000.9961.
Gao, Yan, Daniel J Sartori, Changhong Li, Qian-Chun Yu, Jake a Kushner, M Celeste
Simon, and J Alan Diehl. 2012. “PERK Is Required in the Adult Pancreas and Is
Essential for Maintenance of Glucose Homeostasis.” Molecular and Cellular
Biology 32 (24): 5129–39. doi:10.1128/MCB.01009-12.
Gimble, Jeffrey M, and Farshid Guilak. 2003. “Differentiation Potential of Adipose
Derived Adult Stem (ADAS) Cells.” Current Topics in Developmental Biology 58
(225): 137–60.
Gonzalez-Gronow, Mario, Maria Angelica Selim, John Papalas, and Salvatore V Pizzo.
2009. “GRP78: A Multifunctional Receptor on the Cell Surface.” Antioxidants &
Redox Signaling 11 (9): 2299–2306. doi:10.1089/ARS.2009.2568.
Gorbatyuk, Marina S, Arseniy Shabashvili, Weijun Chen, Craig Meyers, Layla F Sullivan,
Max Salganik, Jonathan H Lin, Alfred S Lewin, Nicholas Muzyczka, and Oleg S
Gorbatyuk. 2012. “Glucose Regulated Protein 78 Diminishes Α-Synuclein
Neurotoxicity in a Rat Model of Parkinson Disease.” Molecular Therapy : The
Journal of the American Society of Gene Therapy, March. doi:10.1038/mt.2012.28.
Gregor, Margaret F, and Gökhan S Hotamisligil. 2007. “Thematic Review Series:
Adipocyte Biology. Adipocyte Stress: The Endoplasmic Reticulum and Metabolic
Disease.” Journal of Lipid Research 48 (9): 1905–14. doi:10.1194/jlr.R700007-
JLR200.
Gudjonsson, Thorarinn, Melissa C Adriance, Mark D Sternlicht, Ole W Petersen, and
Mina J Bissell. 2005. “Myoepithelial Cells: Their Origin and Function in Breast
Morphogenesis and Neoplasia.” Journal of Mammary Gland Biology and Neoplasia
10 (3): 261–72. doi:10.1007/s10911-005-9586-4.
He, Weimin, Yaacov Barak, Andrea Hevener, Peter Olson, Debbie Liao, Jamie Le,
Michael Nelson, Estelita Ong, Jerrold M Olefsky, and Ronald M Evans. 2003.
“Adipose-Specific Peroxisome Proliferator-Activated Receptor {gamma} Knockout
Causes Insulin Resistance in Fat and Liver but Not in Muscle.” Proceedings of the
National Academy of Sciences of the United States of America 100 (26): 15713.
121
Heijmans, Jarom, Jooske F van Lidth de Jeude, Bon-Kyoung Koo, Sanne L Rosekrans,
Mattheus C B Wielenga, Marc van de Wetering, Marc Ferrante, et al. 2013. “ER
Stress Causes Rapid Loss of Intestinal Epithelial Stemness through Activation of the
Unfolded Protein Response.” Cell Reports 3 (4): 1128–39.
doi:10.1016/j.celrep.2013.02.031.
Hendershot, Linda M. 2004. “The ER Function BiP Is a Master Regulator of ER
Function.” The Mount Sinai Journal of Medicine 71 (5): 289–97.
Hennighausen, Lothar, and Gertraud W Robinson. 2005. “Information Networks in the
Mammary Gland.” Nature Reviews. Molecular Cell Biology 6 (9): 715–25.
doi:10.1038/nrm1714.
Hensel, Frank, Miriam Eckstein, Andreas Rosenwald, and Stephanie Brändlein. 2013.
“Early Development of PAT-SM6 for the Treatment of Melanoma.” Melanoma
Research 23 (4): 264–75. doi:10.1097/CMR.0b013e328362cbc8.
Hess, David A, Sean E Humphrey, Jeff Ishibashi, Barbara Damsz, Ann-hwee Lee, Laurie
H Glimcher, and Stephen F Konieczny. 2011. “Extensive Pancreas Regeneration
Following Acinar-Specific Disruption of Xbp1 in Mice.” Gastroenterology 141 (4):
1463–72. doi:10.1053/j.gastro.2011.06.045.Extensive.
Hill, Reginald, Yunfeng Li, Linh M Tran, Sarah Dry, Joseph Hargan Calvopina,
Alejandro Garcia, Christine Kim, et al. 2012. “Cell Intrinsic Role of COX-2 in
Pancreatic Cancer Development.” Molecular Cancer Therapeutics 11 (10): 2127–37.
doi:10.1158/1535-7163.MCT-12-0342.
Hodorova, I, S Rybarova, P Solar, J Vecanova, L Prokopcakova, P Bohus, Z Solarova, Y
Mellova, and K Schmidtova. 2008. “Gp96 and Its Different Expression in Breast
Carcinomas.” Neoplasma 55 (1): 31–35.
Hovey, Russell C, and Lucila Aimo. 2010. “Diverse and Active Roles for Adipocytes
during Mammary Gland Growth and Function.” Journal of Mammary Gland
Biology and Neoplasia 15 (3): 279–90. doi:10.1007/s10911-010-9187-8.
Howard, Edward W, Steve C L Leung, H F Yuen, Chee Wai Chua, Davy T Lee, K W
Chan, Xianghong Wang, and Yong Chuan Wong. 2008. “Decreased Adhesiveness,
Resistance to Anoikis and Suppression of GRP94 Are Integral to the Survival of
Circulating Tumor Cells in Prostate Cancer.” Clinical & Experimental Metastasis 25
(5): 497–508. doi:10.1007/s10585-008-9157-3.
122
Huang, Guojin, Jian Yao, Weizhong Zeng, Yusuke Mizuno, Kristine E Kamm, James T
Stull, Heather P Harding, David Ron, and Shmuel Muallem. 2006. “ER Stress
Disrupts Ca2+-Signaling Complexes and Ca2+ Regulation in Secretory and Muscle
Cells from PERK-Knockout Mice.” Journal of Cell Science 119 (Pt 1): 153–61.
doi:10.1242/jcs.02731.
Ji, Cheng, Neil Kaplowitz, Mo Yin Lau, Eddy Kao, Lydia M Petrovic, and Amy S Lee.
2011. “Liver-Specific Loss of Glucose-Regulated Protein 78 Perturbs the Unfolded
Protein Response and Exacerbates a Spectrum of Liver Diseases in Mice.”
Hepatology 54 (1): 229–39. doi:10.1002/hep.24368.
Jin, Hisayo, Naoya Mimura, Makiko Kashio, Haruhiko Koseki, and Tomohiko Aoe. 2014.
“Late-Onset of Spinal Neurodegeneration in Knock-In Mice Expressing a Mutant
BiP.” PloS One 9 (11): e112837. doi:10.1371/journal.pone.0112837.
Jo, Hyunsun, Sung Sik Choe, Kyung Cheul Shin, Hagoon Jang, Jae Ho Lee, Je Kyung
Seong, Sung Hoon Back, and Jae Bum Kim. 2013. “ER Stress Induces Hepatic
Steatosis via Increased Expression of the Hepatic VLDL Receptor.” Hepatology 57
(4): 1366–77. doi:10.1002/hep.26126.
Jockheck-Clark, Angela R, Edith V Bowers, Mariam B Totonchy, Julie Neubauer,
Salvatore V Pizzo, and Christopher V Nicchitta. 2010. “Re-Examination of CD91
Function in GRP94 (glycoprotein 96) Surface Binding, Uptake, and Peptide Cross-
Presentation.” Journal of Immunology 185 (11): 6819–30.
doi:10.4049/jimmunol.1000448.
Kammoun, Hélène L, Hervé Chabanon, Isabelle Hainault, Serge Luquet, Christophe
Magnan, Tatsuro Koike, Pascal Ferré, and Fabienne Foufelle. 2009. “GRP78
Expression Inhibits Insulin and ER Stress – Induced SREBP-1c Activation and
Reduces Hepatic Steatosis in Mice.” Molecular Neurobiology 119 (5): 1201–15.
doi:10.1172/JCI37007DS1.
Kelber, J a, a D Panopoulos, G Shani, E C Booker, J C Belmonte, W W Vale, and P C
Gray. 2009. “Blockade of Cripto Binding to Cell Surface GRP78 Inhibits Oncogenic
Cripto Signaling via MAPK/PI3K and Smad2/3 Pathways.” Oncogene 28 (24).
Nature Publishing Group: 2324–36. doi:10.1038/onc.2009.97.
Kereszturi, Eva, Richárd Szmola, Zoltán Kukor, Peter Simon, Frank Ulrich Weiss,
Markus M Lerch, and Miklós Sahin-Tóth. 2009. “Hereditary Pancreatitis Caused by
Mutation-Induced Misfolding of Human Cationic Trypsinogen: A Novel Disease
Mechanism.” Human Mutation 30 (4): 575–82. doi:10.1002/humu.20853.
123
Kia, Azadeh, Justyna M Przystal, Nastasia Nianiaris, Nicholas D Mazarakis, Paul J Mintz,
and Amin Hajitou. 2012. “Dual Systemic Tumor Targeting with Ligand-Directed
Phage and Grp78 Promoter Induces Tumor Regression.” Molecular Cancer
Therapeutics, October. doi:10.1158/1535-7163.MCT-12-0587.
Kolb, Andreas F, Reinhard C Huber, Simon G Lillico, Ailsa Carlisle, Claire J Robinson,
Claire Neil, Linda Petrie, Dorte B Sorensen, I Anna S Olsson, and C Bruce a
Whitelaw. 2011. “Milk Lacking Α-Casein Leads to Permanent Reduction in Body
Size in Mice.” PloS One 6 (7): e21775. doi:10.1371/journal.pone.0021775.
Kongara, Sameera, Olga Kravchuk, Irina Teplova, Fred Lozy, Jennifer Schulte, Dirk
Moore, Nicola Barnard, Carola a Neumann, Eileen White, and Vassiliki Karantza.
2010. “Autophagy Regulates Keratin 8 Homeostasis in Mammary Epithelial Cells
and in Breast Tumors.” Molecular Cancer Research : MCR 8 (6): 873–84.
doi:10.1158/1541-7786.MCR-09-0494.
Lambert, Arthur W, Sait Ozturk, and Sam Thiagalingam. 2012. “Integrin Signaling in
Mammary Epithelial Cells and Breast Cancer.” ISRN Oncology 2012 (January):
493283. doi:10.5402/2012/493283.
Lee, A S. 2001. “The Glucose-Regulated Proteins: Stress Induction and Clinical
Applications.” Trends Biochem. Sci. 26: 504–10.
Lee, Amy. 2014. “Glucose-Regulated Proteins in Cancer: Molecular Mechanisms and
Therapeutic Potential.” Nature Reviews. Cancer 14 (4). Nature Publishing Group:
263–76. doi:10.1038/nrc3701.
Lee, Amy S. 2007. “GRP78 Induction in Cancer: Therapeutic and Prognostic
Implications.” Cancer Research 67 (8): 3496–99. doi:10.1158/0008-5472.CAN-07-
0325.
Lee, Amy S, and Wan-Ting Chen. 2014. “The Yin and Yang of GRP94 in Liver
Tumorigenesis.” Hepatology (Baltimore, Md.) 1 (August): 2–3.
doi:10.1002/hep.27405.
Lee, Ann-Hwee, Erez F. Scapa, David E. Cohen, and Laurie H. Glimcher. 2008.
“Regulation of Hepatic Lipogenesis by the Transcription Factor XBP1.” Science 320
(5882): 1492–96. doi:10.1126/science.1158042.Regulation.
Li, J, M Ni, B Lee, E Barron, and A S Lee. 2008. “The Unfolded Protein Response
Regulator GRP78 / BiP Is Required for Endoplasmic Reticulum Integrity and Stress-
124
Induced Autophagy in Mammalian Cells.” Cell Death and Differentiation, 1460–71.
doi:10.1038/cdd.2008.81.
Liu, Bei, and Zihai Li. 2008. “Endoplasmic Reticulum HSP90b1 ( gp96 , grp94 )
Optimizes B-Cell Function via Chaperoning Integrin and TLR but Not
Immunoglobulin.” Blood 1: 1223–30. doi:10.1182/blood-2008-03-143107.
Liu, Bei, Matthew Staron, Feng Hong, Bill X Wu, Shaoli Sun, Crystal Morales, Craig E
Crosson, et al. 2013. “Essential Roles of grp94 in Gut Homeostasis via Chaperoning
Canonical Wnt Pathway.” Proceedings of the National Academy of Sciences of the
United States of America 110 (17): 6877–82. doi:10.1073/pnas.1302933110.
Liu, Jiang, Xi Jin, Chao-hui Yu, Shao-hua Chen, Wei-ping Li, and You-ming Li. 2009.
“Endoplasmic Reticulum Stress Involved in the Course of Lipogenesis in Fatty
Acids-Induced Hepatic Steatosis.” Journal of Gastroenterology and Hepatology, 1–
6. doi:10.1111/j.1440-1746.2009.06086.x.
Liu, Ren, Xiuqing Li, Wenming Gao, Yue Zhou, Shiuan Wey, Satyajit K Mitra, Valery
Krasnoperov, et al. 2013. “Monoclonal Antibody against Cell Surface GRP78 as a
Novel Agent in Suppressing PI3K/AKT Signaling, Tumor Growth, and Metastasis.”
Clinical Cancer Research : An Official Journal of the American Association for
Cancer Research 19 (24): 6802–11. doi:10.1158/1078-0432.CCR-13-1106.
Lowe, C E, R J Dennis, U Obi, S O Rahilly, and J J Rochford. 2011. “Investigating the
Involvement of the ATF6a Pathway of the Unfolded Protein Response in
Adipogenesis.” International Journal of Obesity, no. March: 1–4.
doi:10.1038/ijo.2011.233.
Luk, John M, Chi-Tat Lam, Annie F M Siu, Brian Y Lam, Irene O L Ng, Mei-Yu Hu,
Chi-Ming Che, and Sheung-Tat Fan. 2006. “Proteomic Profiling of Hepatocellular
Carcinoma in Chinese Cohort Reveals Heat-Shock Proteins (Hsp27, Hsp70, GRP78)
up-Regulation and Their Associated Prognostic Values.” Proteomics 6 (3): 1049–57.
doi:10.1002/pmic.200500306.
Luo, B, and Lee, Amy S. 2013. “The Critical Roles of Endoplasmic Reticulum
Chaperones and Unfolded Protein Response in Tumorigenesis and Anticancer
Therapies.” Oncogene 32 (7). Nature Publishing Group: 805–18.
doi:10.1038/onc.2012.130.
Luo, Biquan, Ben S Lam, Sung Hyung Lee, Shiuan Wey, Hui Zhou, Miao Wang, Si-Yi
Chen, Gregor B Adams, and Amy S Lee. 2011. “The Endoplasmic Reticulum
Chaperone Protein GRP94 Is Required for Maintaining Hematopoietic Stem Cell
125
Interactions with the Adult Bone Marrow Niche.” PloS One 6 (5): e20364.
doi:10.1371/journal.pone.0020364.
Luo, Biquan, and Amy S Lee. 2012. “The Critical Roles of Endoplasmic Reticulum
Chaperones and Unfolded Protein Response in Tumorigenesis and Anticancer
Therapies.” Oncogene, no. February (April): 1–14. doi:10.1038/onc.2012.130.
Luo, S, C Mao, B Lee, and A S Lee. 2006. “GRP78/BiP Is Required for Cell Proliferation
and Protecting the Inner Cell Mass from Apoptosis during Early Mouse Embryonic
Development.” Mol. Cell. Biol. 26: 5688–97.
Luo, Shengzhan, and Amy S Lee. 2002. “Requirement of the p38 Mitogen-Activated
Protein Kinase Signalling Pathway for the Induction of the 78 kDa Glucose-
Regulated Protein/immunoglobulin Heavy-Chain Binding Protein by Azetidine
Stress: Activating Transcription Factor 6 as a Target for Stress-I.” Biochemical
Journal 366: 787–95.
Luu, Y. K., S. Judex. 2010. “In Vivo Quantification of Subcutaneous and Visceral
Adiposity by Micro Computed Tomography in a Small Animal Model.” In Vivo 31
(1): 34–41. doi:10.1016/j.medengphy.2008.03.006.In.
Ma, Yanjun, and Linda Hendershot. 2004. “THE ROLE OF THE UNFOLDED
PROTEIN RESPONSE IN TUMOUR DEVELOPMENT : FRIEND OR FOE.” In
Vitro 4 (December): 966–77. doi:10.1038/nrc1505.
Macias, Hector, and Lindsay Hinck. 2012. “Mammary Gland Development.” Wiley
Interdisciplinary Reviews. Developmental Biology 1 (4): 533–57.
doi:10.1002/wdev.35.
Maddalo, Danilo, Antje Neeb, Katja Jehle, Katja Schmitz, Claudia Muhle-Goll, Liubov
Shatkina, Tamara Vanessa Walther, et al. 2012. “A Peptidic Unconjugated
GRP78/BiP Ligand Modulates the Unfolded Protein Response and Induces Prostate
Cancer Cell Death.” PloS One 7 (10): e45690. doi:10.1371/journal.pone.0045690.
Mao, Changhui, Miao Wang, Biquan Luo, Shiuan Wey, Dezheng Dong, Robin
Wesselschmidt, Stephen Rawlings, and Amy S Lee. 2010. “Targeted Mutation of
the Mouse Grp94 Gene Disrupts Development and Perturbs Endoplasmic Reticulum
Stress Signaling.” PloS One 5 (5): e10852. doi:10.1371/journal.pone.0010852.
Mao, Jianqiang, Tao Yang, Ziwei Gu, William C Heird, Milton J Finegold, Brendan Lee,
and Salih J Wakil. 2009. “Carboxylase 1 Causes Growth Retardation and Reduced
Lipid Accumulation in Adipose Tissues” 106 (41): 1–6.
126
Martens, Katrin, Astrid Bottelbergs, and Myriam Baes. 2010. “Ectopic Recombination in
the Central and Peripheral Nervous System by aP2/FABP4-Cre Mice: Implications
for Metabolism Research.” FEBS Letters 584 (5). Federation of European
Biochemical Societies: 1054–58. doi:10.1016/j.febslet.2010.01.061.
Michalopoulos, George K, Lindsay Barua, and William C Bowen. 2005.
“Transdifferentiation of Rat Hepatocytes Into Biliary Cells After Bile Duct Ligation
and Toxic Biliary Injury.” Hepatology 41 (3): 535–44.
Mimura, Naoya, Shigeki Yuasa, Miho Soma, Hisayo Jin, Keita Kimura, Shigemasa Goto,
Haruhiko Koseki, and Tomohiko Aoe. 2008. “Altered Quality Control in the
Endoplasmic Reticulum Causes Cortical Dysplasia in Knock-in Mice Expressing a
Mutant BiP.” Molecular and Cellular Biology 28 (1): 293–301.
doi:10.1128/MCB.00473-07.
Moitra, Jaideep, Mark M Mason, Michelle Olive, Dmitry Krylov, Oksana Gavrilova,
Bernice Marcus-samuels, Lionel Feigenbaum, et al. 1998. “Life without White Fat :
A Transgenic Mouse Life without White Fat : A Transgenic Mouse.” Genes &
Development, 3168–81. doi:10.1101/gad.12.20.3168.
Muchowski, Paul J, and Jennifer L Wacker. 2005. “Modulation of Neurodegeneration by
Molecular Chaperones.” Nature Reviews. Neuroscience 6 (1): 11–22.
doi:10.1038/nrn1587.
Muncan, Vanesa, Owen J Sansom, Leon Tertoolen, Toby J Phesse, Harry Begthel, Elena
Sancho, Alicia M Cole, et al. 2006. “Rapid Loss of Intestinal Crypts upon
Conditional Deletion of the Wnt/Tcf-4 Target Gene c-Myc.” Molecular and Cellular
Biology 26 (22): 8418–26. doi:10.1128/MCB.00821-06.
Muschler, John, and Charles H Streuli. 2010. “Cell-Matrix Interactions in Mammary
Gland Development and Breast Cancer.” Cold Spring Harbor Perspectives in
Biology 2 (10): a003202. doi:10.1101/cshperspect.a003202.
Nakagawa, Hayato, and Shin Maeda. 2012. “Molecular Mechanisms of Liver Injury and
Hepatocarcinogenesis: Focusing on the Role of Stress-Activated MAPK.” Pathology
Research International 2012 (January): 172894. doi:10.1155/2012/172894.
Nejak-Bowen, Kari Nichole, and Satdarshan P S Monga. 2011. “Beta-Catenin Signaling,
Liver Regeneration and Hepatocellular Cancer: Sorting the Good from the Bad.”
Seminars in Cancer Biology 21 (1). Elsevier Ltd: 44–58.
doi:10.1016/j.semcancer.2010.12.010.
127
Nguyen, P, V Leray, M Diez, S Serisier, J Le Bloc’h, B Siliart, and H Dumon. 2008.
“Liver Lipid Metabolism.” Journal of Animal Physiology and Animal Nutrition 92
(3): 272–83. doi:10.1111/j.1439-0396.2007.00752.x.
Ni, Min, and Amy S Lee. 2007. “ER Chaperones in Mammalian Development and
Human Diseases.” FEBS Letters 581: 3641–51. doi:10.1016/j.febslet.2007.04.045.
Ni, Min, Yi Zhang, and Amy S Lee. 2011. “Beyond the Endoplasmic Reticulum:
Atypical GRP78 in Cell Viability, Signalling and Therapeutic Targeting.” The
Biochemical Journal 434 (2): 181–88. doi:10.1042/BJ20101569.
Ni, Min, Hui Zhou, Shiuan Wey, Peter Baumeister, and Amy S Lee. 2009. “Regulation of
PERK Signaling and Leukemic Cell Survival by a Novel Cytosolic Isoform of the
UPR Regulator GRP78/BiP.” PloS One 4 (8): e6868.
doi:10.1371/journal.pone.0006868.
Nicchitta, Christopher V, Deanna M Carrick, and Julie C Baker-lepain. 2004. “The
Messenger and the Message : gp96 ( GRP94 ) -Peptide Interactions in Cellular
Immunity.” Cell Stress & Chaperones 9: 325–31.
Nikolaou, Kostas, Michalis Sarris, and Iannis Talianidis. 2013. “Molecular Pathways:
The Complex Roles of Inflammation Pathways in the Development and Treatment
of Liver Cancer.” Clinical Cancer Research : An Official Journal of the American
Association for Cancer Research 19 (11): 2810–16. doi:10.1158/1078-0432.CCR-
12-1961.
Ostrovsky, Olga, Davide Eletto, Catherine Makarewich, Elisabeth R Barton, and Yair
Argon. 2010. “Glucose Regulated Protein 94 Is Required for Muscle Differentiation
through Its Control of the Autocrine Production of Insulin-like Growth Factors.”
Biochimica et Biophysica Acta 1803 (2). Elsevier B.V.: 333–41.
doi:10.1016/j.bbamcr.2009.11.005.
Otto, Tamara C, and M Daniel Lane. 2005. “Adipose Development : From Stem Cell to
Adipocyte.” Critical Reviews in Biochemistry, 229–42.
doi:10.1080/10409230591008189.
Pagliassotti, Michael J. 2012. “Endoplasmic Reticulum Stress in Nonalcoholic Fatty
Liver Disease.” Annual Review of Nutrition 32 (August): 17–33.
doi:10.1146/annurev-nutr-071811-150644.
128
Park, Kye Won, Daniel S Halperin, and Peter Tontonoz. 2008. “Minireview Before They
Were Fat : Adipocyte Progenitors Minireview.” Cell Metabolism 8 (6). Elsevier Inc.:
454–57. doi:10.1016/j.cmet.2008.11.001.
Patel, Pallav D, Pengrong Yan, Paul M Seidler, Hardik J Patel, Weilin Sun, Chenghua
Yang, Nanette S Que, et al. 2013. “Paralog-Selective Hsp90 Inhibitors Define
Tumor-Specific Regulation of HER2.” Nature Chemical Biology, September, 1–56.
doi:10.1038/nchembio.1335.
Pfaffenbach, Kyle T, and Amy S Lee. 2011. “The Critical Role of GRP78 in Physiologic
and Pathologic Stress.” Current Opinion in Cell Biology 23 (2). Elsevier Ltd: 150–
56. doi:10.1016/j.ceb.2010.09.007.
Pfaffenbach, Kyle T, Michelle Pong, Todd E Morgan, Hongjun Wang, Kate Ott, Beiyun
Zhou, Valter D Longo, and Amy S Lee. 2012. “GRP78/BiP Is a Novel Downstream
Target of IGF-1 Receptor Mediated Signaling.” Journal of Cellular Physiology, no.
March (March): 1–41. doi:10.1002/jcp.24090.
Postic, C., M. Shiota, K. D. Niswender, T. L. Jetton, Y. Chen, J. M. Moates, K. D.
Shelton, J. Lindner, a. D. Cherrington, and M. a. Magnuson. 1999. “Dual Roles for
Glucokinase in Glucose Homeostasis as Determined by Liver and Pancreatic Cell-
Specific Gene Knock-Outs Using Cre Recombinase.” Journal of Biological
Chemistry 274 (1): 305–15. doi:10.1074/jbc.274.1.305.
Rachidi, Saleh, Shaoli Sun, Bill X Wu, Elizabeth Jones, Richard R Drake, Besim
Ogretmen, Ashley Cowart, et al. 2014. “Endoplasmic Reticulum Heat Shock Protein
gp96 Maintains Liver Homeostasis and Promotes Hepatocellular Carcinogenesis.”
Journal of Hepatology, November. European Association for the Study of the Liver.
doi:10.1016/j.jhep.2014.11.010.
Rao, Rammohan V, and Dale E Bredesen. 2004. “Misfolded Proteins, Endoplasmic
Reticulum Stress and Neurodegeneration” 16 (6): 653–62.
doi:10.1016/j.ceb.2004.09.012.Misfolded.
Reddy, Ramachandra K, Louis Dubeau, Heather Kleiner, Tyler Parr, Peter Nichols,
Bryce Ko, Dezheng Dong, et al. 2002. “Cancer-Inducible Transgene Expression by
the Grp94 Promoter : Spontaneous Activation in Tumors of Various Origins and
Cancer-Associated Macrophages.” Cancer Research, 7207–12.
Reimold, a M, N N Iwakoshi, J Manis, P Vallabhajosyula, E Szomolanyi-Tsuda, E M
Gravallese, D Friend, M J Grusby, F Alt, and L H Glimcher. 2001. “Plasma Cell
129
Differentiation Requires the Transcription Factor XBP-1.” Nature 412 (6844): 300–
307. doi:10.1038/35085509.
Richert, M M, K L Schwertfeger, J W Ryder, and S M Anderson. 2000. “An Atlas of
Mouse Mammary Gland Development.” Journal of Mammary Gland Biology and
Neoplasia 5 (2): 227–41. http://www.ncbi.nlm.nih.gov/pubmed/11149575.
Ron, David, and Peter Walter. 2007. “Signal Integration in the Endoplasmic Reticulum
Unfolded Protein Response.” Nature Reviews. Molecular Cell Biology 8 (7): 519–29.
doi:10.1038/nrm2199.
Rosekrans, Sanne L, Jarom Heijmans, Nikè V J a Büller, Jessica Westerlund, Amy S Lee,
Vanesa Muncan, and Gijs R van den Brink. 2014. “ER Stress Induces Epithelial
Differentiation in the Mouse Oesophagus.” Gut, April, 1–8. doi:10.1136/gutjnl-
2013-306347.
Rosen, Evan D, and Ormond A Macdougald. 2006. “Adipocyte Differentiation from the
inside out.” Group 7 (December): 885–96. doi:10.1038/nrm2066.
Rosen, Evan D, Pasha Sarraf, Amy E Troy, Gary Bradwin, Kathryn Moore, David S
Milstone, Bruce M Spiegelman, Richard M Mortensen, and Dana Farber. 1999.
“PPAR Gamma Is Required for the Differentiation of Adipose Tissue In Vivo and In
Vitro” 4: 611–17.
Rosen, Evan D, and Bruce M Spiegelman. 2006. “Adipocytes as Regulators of Energy
Balance and Glucose Homeostasis.” Nature 444 (December): 847–53.
doi:10.1038/nature05483.
Roskams, T. 2006. “Liver Stem Cells and Their Implication in Hepatocellular and
Cholangiocarcinoma.” Oncogene 25 (27): 3818–22. doi:10.1038/sj.onc.1209558.
Ross, S R, R a Graves, and B M Spiegelman. 1993. “Targeted Expression of a Toxin
Gene to Adipose Tissue: Transgenic Mice Resistant to Obesity.” Genes &
Development 7 (7b): 1318–24. doi:10.1101/gad.7.7b.1318.
Ruan, W, and D L Kleinberg. 1999. “Insulin-like Growth Factor I Is Essential for
Terminal End Bud Formation and Ductal Morphogenesis during Mammary
Development.” Endocrinology 140 (11): 5075–81.
Rutkowski, D.Thomas, and Randal J. Kaufman. 2004. “A Trip to the ER: Coping with
Stress.” Trends in Cell Biology 14 (1): 20–28. doi:10.1016/j.tcb.2003.11.001.
130
Satdarshan Pal Singh Monga, M.D. 2011. “Role of Wnt/Beta-Catenin Signaling in Liver
Metabolism and Cancer.” International Journal Biochemistry Cell Biology 43 (7):
1021–29. doi:10.1016/j.biocel.2009.09.001.Role.
Savage, David B. 2009. “Mouse Models of Inherited Lipodystrophy.” Disease Models &
Mechanisms 562: 554–62. doi:10.1242/dmm.002907.
Schedin, Pepper, and Russell C Hovey. 2010. “Editorial: The Mammary Stroma in
Normal Development and Function.” Journal of Mammary Gland Biology and
Neoplasia 15 (3): 275–77. doi:10.1007/s10911-010-9191-z.
Schröder, Martin, and Randal J Kaufman. 2005. “The Mammalian Unfolded Protein
Response.” Annual Review of Biochemistry 74 (January): 739–89.
doi:10.1146/annurev.biochem.73.011303.074134.
Sha, Haibo, Yin He, Hui Chen, Cindy Wang, Anna Zenno, Hang Shi, Xiaoyong Yang,
and Xinmin Zhang. 2009. “Short Article The IRE1a-XBP1 Pathway of the Unfolded
Protein Response Is Required for Adipogenesis.” Cell Metabolism 9 (6). Elsevier
Ltd: 556–64. doi:10.1016/j.cmet.2009.04.009.
Shimomura, I, R E Hammer, J A Richardson, S Ikemoto, Y Bashmakov, J L Goldstein,
and M S Brown. 1998. “Insulin Resistance and Diabetes Mellitus in Transgenic
Mice Expressing Nuclear SREBP-1c in Adipose Tissue: Model for Congenital
Generalized Lipodystrophy.” Genes Dev. 12: 3182–94.
Silberstein, Gary B, and Charles W Daniel. 1994. “Essential Role of Endogenous
Estrogen in Directly Stimulating Mammary Growth Demonstrated by Implants
Containing Pure Antiestrogens.” Endocrinology, no. March: 84–90.
Singh, Rajat, Susmita Kaushik, Yongjun Wang, Youqing Xiang, Inna Novak, Masaaki
Komatsu, Keiji Tanaka, Ana Maria Cuervo, and Mark J Czaja. 2009. “Autophagy
Regulates Lipid Metabolism.” Nature 458 (7242). Nature Publishing Group: 1131–
35. doi:10.1038/nature07976.
Skogsberg, Josefin, Andrea Dicker, Mikael Rydén, Gaby Aström, Roland Nilsson,
Hasanuzzaman Bhuiyan, Sigurd Vitols, et al. 2008. “ApoB100-LDL Acts as a
Metabolic Signal from Liver to Peripheral Fat Causing Inhibition of Lipolysis in
Adipocytes.” PloS One 3 (11): e3771. doi:10.1371/journal.pone.0003771.
Spike, Benjamin T, Dannielle D Engle, Jennifer C Lin, and Samantha K Cheung. 2012.
“A Mammary Stem Cell Population Identified and Characterized in Late
131
Embryogenesis Reveals Similarities to Human Breast Cancer” 10 (2): 183–97.
doi:10.1016/j.stem.2011.12.018.A.
Spike, Benjamin T, Jonathan a Kelber, Evan Booker, Madhuri Kalathur, Rose Rodewald,
Julia Lipianskaya, Justin La, et al. 2014. “CRIPTO/GRP78 Signaling Maintains
Fetal and Adult Mammary Stem Cells Ex Vivo.” Stem Cell Reports 2 (4). Elsevier:
427–39. doi:10.1016/j.stemcr.2014.02.010.
Staron, Matthew, Yi Yang, Bei Liu, Janet Li, Yuankai Shen, Juan Carlos Zúñiga-Pflücker,
Hector L Aguila, Irving Goldschneider, and Zihai Li. 2010. “gp96, an Endoplasmic
Reticulum Master Chaperone for Integrins and Toll-like Receptors, Selectively
Regulates Early T and B Lymphopoiesis.” Blood 115 (12): 2380–90.
doi:10.1182/blood-2009-07-233031.
Stein, Torsten, Nathan Salomonis, and Barry a Gusterson. 2007. “Mammary Gland
Involution as a Multi-Step Process.” Journal of Mammary Gland Biology and
Neoplasia 12 (1): 25–35. doi:10.1007/s10911-007-9035-7.
Steppan, C M, S T Bailey, S Bhat, E J Brown, R R Banerjee, C M Wright, H R Patel, R S
Ahima, and M a Lazar. 2001. “The Hormone Resistin Links Obesity to Diabetes.”
Nature 409 (6818): 307–12. doi:10.1038/35053000.
Stiles, Bangyan, Ying Wang, Andreas Stahl, Sara Bassilian, W Paul Lee, Yoon-Jung Kim,
Robert Sherwin, et al. 2004. “Liver-Specific Deletion of Negative Regulator Pten
Results in Fatty Liver and Insulin Hypersensitivity [corrected].” Proceedings of the
National Academy of Sciences of the United States of America 101 (7): 2082–87.
doi:10.1073/pnas.0308617100.
Stock, Peggy, Dulabh Monga, Xinping Tan, Amanda Micsenyi, Nick Loizos, and
Satdarshan P S Monga. 2007. “Platelet-Derived Growth Factor Receptor-Alpha: A
Novel Therapeutic Target in Human Hepatocellular Cancer.” Molecular Cancer
Therapeutics 6 (7): 1932–41. doi:10.1158/1535-7163.MCT-06-0720.
Su, Rongjian, Zhen Li, Hongdan Li, Huijuan Song, Cuifen Bao, Jia Wei, and Liufang
Cheng. 2010. “Grp78 Promotes the Invasion of Hepatocellular Carcinoma.” BMC
Cancer 10 (January): 20. doi:10.1186/1471-2407-10-20.
Takamura, Akito, Masaaki Komatsu, Taichi Hara, Ayako Sakamoto, Chieko Kishi,
Satoshi Waguri, Yoshinobu Eishi, Okio Hino, Keiji Tanaka, and Noboru Mizushima.
2011. “Autophagy-Deficient Mice Develop Multiple Liver Tumors.” Genes &
Development 25 (8): 795–800. doi:10.1101/gad.2016211.
132
Tanaka, Minoru, Tohru Itoh, Naoki Tanimizu, and Atsushi Miyajima. 2011. “Liver
Stem/progenitor Cells: Their Characteristics and Regulatory Mechanisms.” Journal
of Biochemistry 149 (3): 231–39. doi:10.1093/jb/mvr001.
Thompson, Michael D, Emily D Wickline, William B Bowen, Amy Lu, Sucha Singh,
Amalea Misse, and Satdarshan P S Monga. 2011. “Spontaneous Repopulation of Β-
Catenin Null Livers with Β-Catenin-Positive Hepatocytes after Chronic Murine
Liver Injury.” Hepatology (Baltimore, Md.) 54 (4): 1333–43. doi:10.1002/hep.24506.
Urs, Sumithra, Æ Anne Harrington, and Æ Lucy Liaw. 2006. “Selective Expression of an
aP2 / Fatty Acid Binding Protein4-Cre Transgene in Non-Adipogenic Tissues during
Embryonic Development.” Transgenic Research, 647–53. doi:10.1007/s11248-006-
9000-z.
Ushioda, Ryo, Jun Hoseki, Kazutaka Araki, Gregor Jansen, David Y Thomas, and
Kazuhiro Nagata. 2008. “ERdj5 Is Required as a Disulfide Reductase for
Degradation of Misfolded Proteins in the ER.” Science (New York, N.Y.) 321 (5888):
569–72. doi:10.1126/science.1159293.
Usui, Masahiro, Suguru Yamaguchi, Yasuhiro Tanji, Ryu Tominaga, Yasushi Ishigaki,
Manabu Fukumoto, Hideki Katagiri, Kazutoshi Mori, Yoshitomo Oka, and
Hisamitsu Ishihara. 2012. “Atf6 α-Null Mice Are Glucose Intolerant due to
Pancreatic Β-Cell Failure on a High-Fat Diet but Partially Resistant to Diet-Induced
Insulin Resistance.” Metabolism: Clinical and Experimental 61 (8). Elsevier Inc.:
1118–28. doi:10.1016/j.metabol.2012.01.004.
Verdelis, K, L Lukashova, E Atti, P Mayer-Kuckuk, M G E Peterson, S Tetradis, a L
Boskey, and M C H van der Meulen. 2011. “MicroCT Morphometry Analysis of
Mouse Cancellous Bone: Intra- and Inter-System Reproducibility.” Bone 49 (3).
Elsevier Inc.: 580–87. doi:10.1016/j.bone.2011.05.013.
Vitadello, Maurizio, Pierangelo Colpo, and Luisa Gorza. 1998. “Rabbit Cardiac and
Skeletal Myocytes Differ in Constitutive and Inducible Expression of the Glucose-
Regulated Protein GRP94” 359: 351–59.
Vitadello, Maurizio, Daniele Penzo, Valeria Petronilli, Genny Michieli, Selena Gomirato,
Roberta Menabò, Fabio Di Lisa, and Luisa Gorza. 2003. “Overexpression of the
Stress-Protein Grp94 Reduces Cardiomyocyte Necrosis due to Calcium Overload
and Simulated Ischemia.” The FASEB Journal, no. 3.
133
Wagner, K U, K McAllister, T Ward, B Davis, R Wiseman, and L Hennighausen. 2001.
“Spatial and Temporal Expression of the Cre Gene under the Control of the MMTV-
LTR in Different Lines of Transgenic Mice.” Transgenic Research 10 (6): 545–53.
Wagner, K U, R J Wall, L St-Onge, P Gruss, A Wynshaw-Boris, L Garrett, M Li, P A
Furth, and L Hennighausen. 1997. “Cre-Mediated Gene Deletion in the Mammary
Gland.” Nucleic Acids Research 25 (21): 4323–30.
Wakil, Salih J, and Lutfi a Abu-Elheiga. 2009. “Fatty Acid Metabolism: Target for
Metabolic Syndrome.” Journal of Lipid Research 50 Suppl (April): S138–43.
doi:10.1194/jlr.R800079-JLR200.
Wanderling, Sherry, Birgitte B Simen, Olga Ostrovsky, Noreen T Ahmed, Shawn M
Vogen, Tali Gidalevitz, and Yair Argon. 2007. “GRP94 Is Essential for Mesoderm
Induction and Muscle Development Because It Regulates Insulin-like Growth Factor
Secretion □.” Molecular Biology of the Cell 18 (October): 3764–75.
doi:10.1091/mbc.E07.
Wang, Chunxia, Zhiying Huang, Ying Du, Ying Cheng, Shanghai Chen, and Feifan Guo.
2010. “ATF4 Regulates Lipid Metabolism and Thermogenesis.” Cell Research 20
(2). Nature Publishing Group: 174–84. doi:10.1038/cr.2010.4.
Wang, Cun, Kai Jiang, Dongmei Gao, Xiaonan Kang, Chun Sun, Qinle Zhang, Yan Li, et
al. 2013. “Clusterin Protects Hepatocellular Carcinoma Cells from Endoplasmic
Reticulum Stress Induced Apoptosis through GRP78.” PloS One 8 (2): e55981.
doi:10.1371/journal.pone.0055981.
Wang, M, R Ye, E Barron, P Baumeister, C Mao, S Luo, Y Fu, et al. 2010. “Essential
Role of the Unfolded Protein Response Regulator GRP78/BiP in Protection from
Neuronal Apoptosis.” Cell Death and Differentiation 17 (3): 488–98.
doi:10.1038/cdd.2009.144.
Wang, Miao, Shiuan Wey, Yi Zhang, Risheng Ye, and Amy S Lee. 2009. “Role of the
Unfolded Protein Response Regulator GRP78/BiP in Development, Cancer, and
Neurological Disorders.” Antioxidants & Redox Signaling 11 (9): 2307–16.
doi:10.1089/ARS.2009.2485.
Wang, Miao, Risheng Ye, Ernesto Barron, Peter Baumeister, Changhui Mao, Yong Fu,
Biquan Luo, Louis Dubeau, David R Hinton, and Amy S Lee. 2010. “Essential Role
of the Unfolded Protein Response Regulator GRP78/ BiP in Protection from
Neuronal Apoptosis.” Cell Death and Differentiation 17 (3): 1–20.
doi:10.1038/cdd.2009.144.Essential.
134
Wang, Zhao V, Yingfeng Deng, Qiong a Wang, Kai Sun, and Philipp E Scherer. 2010.
“Identification and Characterization of a Promoter Cassette Conferring Adipocyte-
Specific Gene Expression.” Endocrinology 151 (6): 2933–39. doi:10.1210/en.2010-
0136.
Wey, Shiuan, Biquan Luo, and Amy S Lee. 2012. “Acute Inducible Ablation of GRP78
Reveals Its Role in Hematopoietic Stem Cell Survival, Lymphogenesis and
Regulation of Stress Signaling.” PloS One 7 (6): e39047.
doi:10.1371/journal.pone.0039047.
Wey, Shiuan, Biquan Luo, Chun-chih Tseng, Min Ni, Hui Zhou, Yong Fu, Deepa
Bhojwani, et al. 2012. “Inducible Knockout of GRP78 / BiP in the Hematopoietic
System Suppresses Pten-Null Leukemogenesis and AKT Oncogenic Signaling.”
Blood, 817–25. doi:10.1182/blood-2011-06-357384.
Yamamoto, Keisuke, Kazuna Takahara, Seiichi Oyadomari, Tetsuya Okada, Takashi Sato,
Akihiro Harada, and Kazutoshi Mori. 2010. “Induction of Liver Steatosis and Lipid
Droplet Formation in ATF6{alpha} -Knockout Mice Burdened with
Pharmacological Endoplasmic Reticulum Stress.” Molecular Biology of the Cell 21:
2975–86. doi:10.1091/mbc.E09.
Yang, Yi, and Zihai Li. 2005. “Roles of Heat Shock Protein gp96 in the ER Quality
Control : Redundant or Unique Function ?” 20 (2): 173–82.
Ye, Risheng, Dae Young Jung, John Y Jun, Jianze Li, Shengzhan Luo, Hwi Jin Ko, Jason
K Kim, and Amy S Lee. 2009. “Grp78 Heterozygosity Promotes Adaptive Unfolded
Protein Response and Attenuates Diet-Induced Obesity and Insulin Resistance.”
Diabetes 59 (1): 6–16.
Ye, Risheng, Olga a Mareninova, Ernesto Barron, Miao Wang, David R Hinton, Stephen
J Pandol, and Amy S Lee. 2010. “Grp78 Heterozygosity Regulates Chaperone
Balance in Exocrine Pancreas with Differential Response to Cerulein-Induced Acute
Pancreatitis.” The American Journal of Pathology 177 (6). American Society for
Investigative Pathology: 2827–36. doi:10.2353/ajpath.2010.100368.
Yoshida, Hiderou. 2007. “ER Stress and Diseases.” The FEBS Journal 274 (3): 630–58.
doi:10.1111/j.1742-4658.2007.05639.x.
Zeng, Ni, Yang Li, Lina He, Xiaoling Xu, Vivian Galicia, Chuxia Deng, and Bangyan L
Stiles. 2011. “Adaptive Basal Phosphorylation of eIF2 α Is Responsible for
Resistance to Cellular Stress-Induced Cell Death in Pten-Null Hepatocytes.”
135
Molecular Cancer Research : MCR 9 (12): 1708–17. doi:10.1158/1541-7786.MCR-
11-0299.
Zhang, Jianying, and Haya Herscovitz. 2003. “Nascent Lipidated Apolipoprotein B Is
Transported to the Golgi as an Incompletely Folded Intermediate as Probed by Its
Association with Network of Endoplasmic Reticulum Molecular Chaperones,
GRP94, ERp72, BiP, Calreticulin, and Cyclophilin B.” The Journal of Biological
Chemistry 278 (9): 7459–68. doi:10.1074/jbc.M207976200.
Zhang, Xu-Feng, Xinping Tan, Gang Zeng, Amalea Misse, Sucha Singh, Youngsoo Kim,
James E Klaunig, and Satdarshan P S Monga. 2010. “Conditional Beta-Catenin Loss
in Mice Promotes Chemical Hepatocarcinogenesis: Role of Oxidative Stress and
Platelet-Derived Growth Factor Receptor Alpha/phosphoinositide 3-Kinase
Signaling.” Hepatology 52 (3): 954–65. doi:10.1002/hep.23747.
Zhang, Yong, Scott Goldman, Rebecca Baerga, Yun Zhao, Masaaki Komatsu, and
Shengkan Jin. 2009. “Adipose-Specific Deletion of Autophagy-Related Gene 7
(atg7) in Mice Reveals a Role in Adipogenesis.” Proceedings of the National
Academy of Sciences of the United States of America 106 (47): 19860–65.
doi:10.1073/pnas.0906048106.
Zhu, Genyuan, Risheng Ye, Dae Young Jung, Ernesto Barron, Randall H Friedline, M
Vivian, David R Hinton, Jason K Kim, and Amy S Lee. 2013. “GRP78 Plays an
Essential Role in Adipogenesis and Postnatal Growth in Mice.” FASEB Journal 27:
955–64.

Abstract (if available)

Abstract The endoplasmic reticulum (ER) is an essential cellular compartment for protein folding and secretion, and lipid synthesis and transport. Recent studies show that the function of ER chaperone proteins is not limited to simply folding nascent peptides, but they are also involved in mammalian development and several human diseases, such as diabetes, obesity, cancer progression, and tumor immunity. To establish the direct link between ER chaperones and human disease, several transgenic mouse models where the gene encoding for the ER chaperone protein was conditionally deleted have been constructed in this dissertation. The two ER chaperone we studied are glucose regulated protein 78 (GRP78) and glucose regulated protein 94 (GRP94). ❧ To investigate the role of GRP78 in adipogenesis and metabolic homeostasis, we knocked down GRP78 in mouse embryonic fibroblasts and 3T3-L1 preadipocytes induced to undergo differentiation into adipocytes. We also created an adipose Grp78 knockout mouse utilizing the aP2 (fatty acid binding protein 4) promoter driven Cre-recombinase. Adipogenesis was monitored by molecular markers and histology. Tissues were analyzed by micro-CT and electron microscopy. Glucose homeostasis and cytokine analysis were performed. Our results indicate that GRP78 is essential for adipocyte differentiation in vitro. aP2-Cre mediated GRP78 deletion leads to lipoatrophy with about 90% reduction in gonadal and subcutaneous white adipose tissue and brown adipose tissue, severe growth retardation, and bone defect. Despite severe abnormality in adipose mass and function, adipose Grp78 knockout mice showed normal plasma triglyceride levels, and plasma glucose and insulin levels were reduced by 40~60% compared to wild-type mice, suggesting enhanced insulin sensitivity. The endoplasmic reticulum is grossly expanded in the residual mutant white adipose tissue. Thus, these studies establish that GRP78 is required for adipocyte differentiation, glucose homeostasis and balanced secretion of adipokines. Unexpectedly, the phenotypes and metabolic parameters of the mutant mice, which showed early postnatal mortality, are uniquely distinct from previously characterized lipodystrophic mouse models. ❧ To further study the roles of GPR78 and ER in metabolic diseases, we investigated another lipid processing organ: liver. Genetic knockout models of GRP78 revealed that GRP78 maintains homeostasis of metabolic organs, including liver, pancreas and adipose tissues. Hepatocellular carcinoma (HCC) and cholangiocarcinoma (CC) are the most common liver cancers. There is a lack of effective therapeutics for HCC and CC, highlighting the need to further understand liver tumorigenic mechanisms. PTEN, a tumor suppressor that antagonizes the PI3K/AKT pathway, is inactivated in a wide range of tumors, including 40-50% of human liver cancers. To elucidate the role of GRP78 in liver cancer, we created a mouse model with biallelic liver-specific deletion of Pten and Grp78 mediated by Albumin-Cre-recombinase (cPᶠ⁄ᶠ78ᶠ⁄ᶠ). Interestingly, in contrast to PTEN, deletion of GRP78 was progressive but incomplete. At 3 months, cPᶠ⁄ᶠ78ᶠ⁄ᶠ livers showed hepatomegaly, activation of lipogenic genes, exacerbated steatosis and liver injury, implying that GRP78 protects the liver against PTEN-null mediated pathogenesis. Furthermore, in response to liver injury, we observed increased proliferation and expansion of bile duct and liver progenitor cells in cPᶠ⁄ᶠ78ᶠ⁄ᶠ livers. Strikingly, bile duct cells in cPᶠ⁄ᶠ78ᶠ⁄ᶠ livers maintained wild-type (WT) GRP78 level while adjacent areas showed GRP78 reduction. Analysis of signaling pathways revealed selective JNK activation, β-catenin downregulation, along with PDGFRα upregulation, which was unique to cPᶠ⁄ᶠ78ᶠ⁄ᶠ livers at 6 months. Development of both HCC and CC was accelerated and evident in cPᶠ⁄ᶠ78ᶠ⁄ᶠ livers at 8-9 months, coinciding with intense GRP78 expression in the cancer lesions, and GRP78 expression in adjacent normal areas reverted back to the WT level. In contrast, c78ᶠ⁄ᶠ livers showed no malignancy even at 14 months. These studies reveal GRP78 is a novel regulator for PTEN-loss mediated liver injury and cancer progression. ❧ In parallel with the study on GRP78 in metabolic organs, this dissertation also revealed mammary gland specific requirements for GRP94 and GRP78, including selection for allele retention of Grp78. Here we report the consequences of mammary-targeted knockout of these GRPs. Our studies revealed that MMTV-Cre, Grp94ᶠ⁄ᶠ mammary glands, despite GRP94 deficiency, exhibited normal proliferation and ductal morphogenesis. Interestingly, MMTV-Cre, Grp78ᶠ⁄ᶠ mammary glands displayed only slightly reduced GRP78 protein levels, associating with the retention of the non-recombined Grp78 floxed alleles in isolated mammary epithelial cells and displayed phenotypes comparable to wild-type glands. In contrast, transduction of isolated Grp78ᶠ⁄ᶠ mammary epithelial stem/progenitor cells with adenovirus expressing GFP and Cre-recombinase was successful in GRP78 ablation, and the GFP sorted cells failed to give rise to repopulated mammary glands in de-epithelialized recipient mice. These studies imply GRP78, but not GRP94, is required for mammary gland development. ❧ In summary, studies in this dissertation disclosed the comprehensive roles of ER chaperone GRP78 in regulating homeostasis of metabolic organs, namely adipose tissue and liver, and mammary gland development. In addition, GRP94 is not required for mammary gland development in mice.

Linked assets

University of Southern California Dissertations and Theses

Conceptually similar

PDF

The roles of endoplasmic reticulum chaperones in regulating liver homeostasis and tumorigenesis

PDF

Role of endoplasmic reticulum chaperones GRP78 and GRP94 in regulating unfolded protein response and cell survival

PDF

The role of endoplasmic reticulum chaperones in regulating hematopoietic stem cells and hematological malignancies

PDF

The role of glucose-regulated proteins in endometrial and pancreatic cancers

PDF

The role of endoplasmic reticulum chaperone glucose-regulated 78-kilodalton (GRP78) in lung cancer

PDF

The role of endoplasmic reticulum protein GRP78 in normal hematopoeises and PTEN-null leukemogenesis

PDF

The role of endoplasmic reticulum proteins GRP78 and IP3R1 in regulation of glucose homeostasis and acute pancreatitis

PDF

The role of endoplasmic reticulum chaperone protein GRP78 in breast cancer

PDF

The role of GRP78 in the regulation of apoptosis and prostate cancer progression

PDF

Molecular mechanisms of chemoresistance in breast cancer

PDF

Cell surface translocation mechanism of stress-inducible GRP78 in human cancer

PDF

Utilizing novel small molecules to modulate GRP78 expression and activity in cancer

PDF

Cell surface translocation and therapeutic targeting of GRP78

PDF

The role of nuclear GRP78 in regulation of EGFR expression in lung cancer

PDF

The transcriptional regulation of the pro-survival protein Grp78 by activating transcription factors and chromatin-modifying enzymes: its upregulation in response to HDAC-inhibitor treatment and ...

PDF

Creating a multiple micrornia expression vector to target GRP78, an ER chaperone and signaling regulator in cancer

PDF

Role of GRP78 and its novel cytosolic isoform GRP78va in regulating the unfolded protein response in cancer

PDF

Examination of the effect of the ecPlexin-B1 on MDA-MB-231 cells

PDF

Exploration of the roles of cancer stem cells and survivin in the pathogenesis and progression of prostate cancer

PDF

Maf1 is a novel target of the tumor suppressor PTEN and a negative regulator of lipid metabolism

Asset Metadata

Creator Zhu, Genyuan (author)

Core Title The role of endoplasmic reticulum chaperones in adipogenesis, liver cancer and mammary gland development

School Keck School of Medicine

Degree Doctor of Philosophy

Degree Program Genetic, Molecular and Cellular Biology

Publication Date 01/30/2015

Defense Date 07/14/2014

Publisher University of Southern California (original), University of Southern California. Libraries (digital)

Tag adipose tissue,endoplasmic reticulum,GRP78,GRP94,liver cancer,mammary gland,OAI-PMH Harvest,transgenic mouse model

Format application/pdf (imt)

Language English

Contributor Electronically uploaded by the author (provenance)

Advisor Lee, Amy S. (committee chair), Dubeau, Louis (committee member), Hong, Young-Kwon (committee member)

Creator Email gzhu@usc.edu,huamaogy@gmail.com

Permanent Link (DOI) https://doi.org/10.25549/usctheses-c3-528266

Unique identifier UC11298583

Identifier etd-ZhuGenyuan-3153.pdf (filename),usctheses-c3-528266 (legacy record id)

Legacy Identifier etd-ZhuGenyuan-3153.pdf

Dmrecord 528266

Document Type Dissertation

Format application/pdf (imt)

Rights Zhu, Genyuan

Type texts

Source University of Southern California (contributing entity), University of Southern California Dissertations and Theses (collection)

Access Conditions The author retains rights to his/her dissertation, thesis or other graduate work according to U.S. copyright law. Electronic access is being provided by the USC Libraries in agreement with the a...

Repository Name University of Southern California Digital Library

Repository Location USC Digital Library, University of Southern California, University Park Campus MC 2810, 3434 South Grand Avenue, 2nd Floor, Los Angeles, California 90089-2810, USA