University of Southern California Dissertations and Theses

Role of a novel transmembrane protein, TMEM56, in tumorigenic growth of human PC3 prostate cancer cell line

(USC Thesis Other)

Role of a novel transmembrane protein, TMEM56, in tumorigenic growth of human PC3 prostate cancer cell line

PDF

Download a page range

Download transcript

Copy asset link

Request this asset

Transcript (if available)

Content ROLE OF A NOVEL TRANSMEMBRANE PROTEIN, TMEM56, IN TUMORIGENIC GROWTH OF HUMAN PC3 PROSTATE CANCER CELL LINE by Kiarash Mashayekhi A Thesis Presented to the FACULTY OF THE USC GRADUATE SCHOOL UNIVERSITY OF SOUTHERN CALIFORNIA In Partial Fulfillment of the Requirements for the Degree MASTER OF SCIENCE (Molecular Microbiology and Immunology) December 2014 Copyright 2014 Kiarash Mashayekhi ii TABLE OF CONTENTS LIST OF FIGURES…………………………….……………………………………………...…iv ABSTRACT……...…………………………………………………………………………..…..vi CHAPTER I: INTRODUCTION .................................................................................................... 1 1.1 Prostate Cancer (PCa) ........................................................................................................... 1 1.2 Mitochondria and cancer ....................................................................................................... 4 1.3 The ATP synthase ................................................................................................................. 6 1.4 Membrane proteins ................................................................................................................ 8 1.5 Transmembrane (TMEM) protein family ............................................................................. 9 CHAPTER II: HYPOTHESIS ...................................................................................................... 11 CHAPTER III: MATERIALS and METHODS ........................................................................... 12 3.1 Cell culture Conditions........................................................................................................ 12 3.2 Stablishment of stable PC3 cell lines .................................................................................. 12 3.3 RNA extraction and Real Time RT-PCR for TMEM56 expression levels ......................... 13 Table 1: List of primers used in q PCR and RT-PCR…………………………………....13 3.4 In-vivo analysis in nude mice……………………………………………………………...14 3.5 RNA extraction from the tumors ......................................................................................... 15 3.6 Immunohistochemistry using ATPase β ............................................................................. 15 3.7 Analysis of ATPase β stained tissues .................................................................................. 15 CHAPTER IV: RESULTS ............................................................................................................ 16 4.1 Relative TMEM56 basal expression level in different cell lines ........................................ 16 4.2 stablishment of PC3 stable cell lines ................................................................................... 17 4.3 In-vivo tumor studies in nude mice ..................................................................................... 19 iii 4.4 Immunohistochemistry using ATPase β ............................................................................. 28 CHAPTER V: DISCUSSION and CONCLUSIONS ................................................................... 31 REFERENCES ............................................................................................................................. 35 iv LIST OF FIGURES Figure1: Prostate gland anatomy and its adjacent structures…………………………….......……...1 Figure 2: Digital Rectal Examination (DRE)………………………………………………..………3 Figure 3: Transrectal biopsy………………………………….……………………………….…….3 Figure 4: Mitochondrial ATP Synthase…………………………………………………………......7 Figure 5: Human Transmembrane Protein 56 (TMEM56)………………………………………...10 Figure 6: Relative basal level of TMEM56 expression in PC3 and HEK 293T cell lines……...…16 Figure 7: Relative TMEM56 expression in PC3 stable cell lines…………………….………..…..17 Figure 8: First round tumor growth…………………………………………………….………….20 Figure 9: Second round tumor growth………………………………………….…………...……..20 Figure 10: First round of SubQ inoculation of PC3 stable cell lines……….……………...………21 Figure 11: Second round of SubQ inoculation of PC3 stable cell lines ………..………………….22 Figure 12: Second round of SubQ inoculation of PC3 stable cell lines ……………………..….....22 Figure 13: First round tumors……………………………………………………………..……….23 Figure 14: Second round tumors ………………………………………………………….…...…..23 v Figure 15: Second round tumors ………………………………………….…………………...…..23 Figure 16: Higher magnification of the tumor isolated from shRNA-TM………………….……..23 Figure 17: Average tumor volume of the first and second round isolated masses ………………..24 Figure 18: Relative TMEM56 expression level in the first and second round tumors………...…..25 Figure 19: H&E stained slides from the tumors of the four stable PC3 cell lines.………….……..27 Figure 20: Immunostaining using anti-ATPase β antibody………………………………………..29 Figure 21: Measurement of the total intensity of the strong positive signal.………………..……..30 vi ABSTRACT A novel transmembrane protein, TMEM56, was identified in Dr. Ebrahim Zandi’s lab as an IKK-β interacting protein using co-immunoprecipitation and mass spectrometry. Previous studies in the lab have shown that this protein has a strong association with mitochondrial ATP synthase. Further analysis showed that this protein localizes to mitochondria and has a probable role in regulating ATP synthesis by interacting with ATP synthase α and β subunits. Prior in- vivo studies in nude mice illustrated that knocking down TMEM56 in HEK 293T cells resulted in faster and larger tumor growth while over-expression of TMEM56 had a potential tumor suppressor effect. Research has shown that mitochondrial dysfunction plays a pivotal role in cancer initiation and progression. In this study, we investigated the role of TMEM56 in regulating mitochondrial abundance and its subsequent role in tumor regulation using human PC3 cancer cell line. Our in- vivo xenograft experiments in nude mice as well as the immunohistochemistry utilizing anti- ATPase β antibody all together has shown that a decrease in the expression of the TMEM56 protein in the PC3 stable cancer cell line led to a faster development of the tumors which showed malignant properties such as tight adhesions to the surrounding tissues, and well-developed tumor vascularity. Since these features had a logical correlation with the data from our immuunostaining on the mitochondrial ATP synthase and with the current literature data in this field of cancer research, further investigations should be done to unwrap the mechanisms behind these interesting adaptations. 1 CHAPTER I INTRODUCTION 1.1 Prostate Cancer (PCa) Prostate gland, part of the male’s reproductive system, is located below the bladder and in front of the rectum. The prostate encloses the urethra, the urine passage tube, and when healthy is about the size of a walnut. The seminal fluid is partially made by this gland and will help to transport sperm cells during ejaculation as a part of the semen[1]. The growth of this gland started at the early development and increases rapidly during puberty. This growth is under the influence of dihydrotestosterone(DHT) which is produced from the testosterone by the enzyme 5-alpha-reductase.[2] Figure 1: Prostate gland anatomy and its adjacent structures. [1] 2 After skin cancer, prostate cancer (PCa) is the second most common cancer in males in the United States. American Cancer Society’s estimates on PCa for 2014 are about 233,000 newly diagnosed cases and 29,480 deaths. There are different cell types in the prostate but almost all the cancers of the prostate arise from glandular cells. As a result, prostate cancer is a type of adenocarcinoma[2]. PCa’s clinical behavior ranges from a microscopic and well-differentiated tumor that never metastasize to an aggressive and poorly-differentiated tumor that metastasize and cause death[3]. There are several risk factors that were postulated to play a role in PCa such as age, ethnicity, family history, genes, diet, smoking, obesity, prostatitis, sexually transmitted disease, and vasectomy. Among these, there is a great correlation between the increase in age and the chance of development of PCa. Aafter age of 50 the chance of developing prostate cancer increases rapidly. African-Americans are also more likely to develop PCa probably due to their life-long higher level of androgens. Even though there is a positive correlation between smoking, obesity, diet, genetic factors and the development of PCa, current data cannot support any correlation between chronic inflammation (due to STDs or Prostatitis) of the gland and PCa[2]. There could be some early symptoms indicating a background PCa like changes in the urination habits (frequency, urgency & decreased caliber of urine), blood in the urine (hematuria), impotence, pain in the back or bones due to the metastasis of the PCa, and numbness in the legs and loss of control of the bowels and bladder due to the cancer’s mass effect on the spine. It is important to keep in mind that the changes in the urine are not always due to PCa, rather it could be due to other benign problems like benign prostatic hyperplasia (BPH)[2]. After introduction of Prostate-Specific Antigen (PSA) in 1980 as a screening test, the frequency of diagnosis of PCa has been increased. Another screening method for PCa is the digital rectal examination (DRE) and the combination of these two screening methods increase the chance of detection 3 of a possible PCa earlier in its course. Any abnormality in either PSA or DRE warrants the transrectal biopsy under the guide of the ultrasound[3]. Figure 2: Figure 3: Digital Rectal Examination (DRE). [1] Transrectal Biopsy. [1] Under the guide of transrectal ultrasound, a needle would be inserted into different parts of the gland to take samples, and this action is repeated 8 to 18 times, but most urologist do it for 12 times. The samples will be analyzed by a pathologist, and a grade will be assigned to each sample according to the Gleason system. Based on the similarity of the samples to the normal prostate tissue, Grade 1 is the well- differentiated tumor; grade 5 is the poorly differentiated tumor, and the rest will be in between of these two extremes. PCa often has areas with different grades; therefore the two higher grades out of the samples will be summed together to make the Gleason Score (Sum) which is a number between 2 and 10. A Gleason score of 6 or lower indicates a well-differentiated or low-grade cancer, a score of 7 is a moderately-differentiated or intermediate-grade cancer, and a score of 8 or above indicates poorly- differentiated or a high-grade cancer. A cancer with a higher Gleason score will grow and spread more quickly, therefore, will need rapid and invasive treatments[2]. 4 Apart from the biopsy, other imaging modalities such as CT scan, MRI, Bone Scan and ProstaScint scan will also be used to look for cancer invasion, lymph node involvement and metastasis. Staging of the PCa follows the TNM system which is based on the tumor size (T), lymph node involvement (N), and metastasis (M)[2]. After diagnosis, there are varieties of treatment options to choose from such as surgery, cryosurgery, radiotherapy, chemotherapy, hormone therapy (in the case that the cancer is hormone (androgen) sensitive), vaccine treatment, and bone directed treatment. There are several factors that affect the type of therapy provided, such as age and expected life expectancy of the patient, stage and grade of the cancer, side effects of the treatment modality, and the likelihood that a treatment can cure the cancer. 1.2 Mitochondria and Cancer Acting as gatekeepers of eukaryote’s cells, mitochondria, play a pivotal role in regulating programmed cell death (apoptosis), controlling nuclear functions via balancing calcium levels and reactive oxygen species (ROS) production, and regulating small molecule metabolites trafficking. Therefore, not surprisingly, inappropriate communication between mitochondria and the rest of the cell can lead to imbalanced cellular homeostasis, which can result in variety of pathologic conditions such as muscular and neurodegenerative disorders, cardiovascular abnormalities, and cancer[4-6]. Almost ninety years ago Otto Warburg hypothesized that cancer cells use high rates of glycolysis followed by lactic acid fermentation, namely anaerobic respiration, to produce energy for their growth, contrasting to the healthy cells that use lower rate of glycolysis followed by oxidative phosphorylation, namely aerobic respiration[7]. This elevated rate of glycolysis is seen both in the presence and absence of the oxygen, and it was shown by Busk et al. that almost 60 percent of the ATP in most cancers is produced via this pathway[8]. 5 On one hand, hypoxia in the tumor environment is an inhibitor of the oxidative phosphorylation pathway. Hypoxia inducible factors, HIFs, are a family of transcriptional factors that in a healthy cellular environment are maintained at a lower level due to constant degradation. However, in a hypoxic tumor environment, their degradation is inhibited, and they remain at high levels. Two major metabolic enzymes, pyruvate dehydrogenase (PDH) and lactate dehydrogenase (LDH) are regulated by HIFs. These two enzymes are important determinants of the fate of pyruvate, which could be either cytosolic reduction to lactate or oxidative phosphorylation in mitochondria. HIFs induce LDH and inhibit PDH activity, which results in inhibition of translocation and oxidation of pyruvate in mitochondria. On the other hand, phosphofructokinase-1 (PFK-1), an important enzyme in the glycolysis pathway, is induced by the decrease in the amount of the cellular ATP, which itself is caused by hypoxia induced decrease in oxidative phosphorylation[9]. Mutations causing mitochondrial dysfunction can be either in the nuclear DNA (nDNA) or in the mitochondrial DNA (mtDNA). Tricarboxylic cycle (TCA) enzymes are encoded by nDNA and have been recently under investigation of so many oncological researchers. These enzymes are located in the mitochondrial matrix except for the enzyme succinate dehydrogenase which is embedded in the inner membrane of the mitochondria. In the past few years, mutations in several enzymes of the TCA cycle such as citrate synthase, succinate dehydrogenase, malic enzyme and others have been found and linked to variety of cancers. Mitochondrial DNA is a circular DNA of about 16,596 base pairs, which encodes 37 genes that are translated to different subunits of the respiratory chain, 22 tRNAs, 12S and 16S ribosomal RNAs, and ATPase complexes. Among the most common mutations in the mtDNA that plays an important role in cancer initiation and progression are those involved in the complex I of the mitochondrial respiratory chain. Mutations in other complexes of the respiratory chain like complex III (Coenzyme Q), Complex IV, and complex V (ATP synthase) are all found in variety of cancers such as prostate, thyroid, pancreatic, bladder, colorectal, breast, and etc.[10]. 6 Another protective function of the mitochondria is its important role in apoptosis. Several pro and anti-apoptotic proteins are located in the membranes of the mitochondria. Often in cancers, there are mutations that suppress the pro-apoptotic proteins and induce the anti-apoptotic ones. Bcl-2 (B-cell lymphoma 2) is one of the most important anti-apoptotic (oncogenic) proteins known so far. It stabilizes the mitochondrial membrane and preventing the leakage of the cytochrome c and activation of the caspase cascade, thereby inhibiting apoptosis. On the other hand, pro-apoptotic proteins such as the well-known tumor protein p53 (p53) play a pivotal role in induction of apoptosis hence preventing cancer development. P53 does so by increasing BAX (Bcl-2 like protein 4) which antagonizes Bcl-2 resulting in the leakage of cytochrome c, activation of caspases and apoptosis[11]. 1.3 The ATP synthase The mitochondrial ATP synthase is a crucial enzyme responsible for the production of ATP, the cell’s energy currency. This enzyme consists of two major components, the Fo and F1. Fo component consists of three subunits; one subunit “a”, two subunit “b”, and 8-15 subunit “c” which varies depending on the organism. It is embedded in the inner mitochondrial membrane and acts as a channel through which the proton ions, produced by electron transport chain, traverse from the intermembrane space to the mitochondrial matrix down their electrochemical gradient hence providing energy for ATP synthesis. F1 component on the other hand, is projected into the mitochondrial matrix and is consists of 9 subunits; 3α, 3β, γ, δ, ε. As the hydrogen ions pass through the Fo component its subunit “c” will rotate, and this rotation is passed to the F1 component via the” ε” subunit which mainly makes up the stalk of the enzyme. This rotation enables the 3β subunit of F1 component to have different conformational states with distinctive ADP and ATP binding affinities. At its “open” conformation, the β subunits, bind ADP and Pi bind to the active site. At its “loose” conformation it encloses the ADP and Pi, and lastly at its “tight” conformation ADP and Pi are forced together producing ATP that is bound with a high affinity. 7 By moving from the “tight” to the “open” conformation, the β subunit, releases the synthesized ATP. Afterwards, the β subunit is available again to bind new ADP and Pi molecules[12, 13]. Figure 1: Figure 4: Mitochondrial ATP Synthase. [14] Apart from the well-known mitochondrial ATPase there are several other ATPases that have crucial functions in maintaining the normal cellular functions. Na+/K+ ATPase is a member of the family of P-ATPase which are cation transporters and play an important role in maintaining the normal membrane potential[15]. Additionally, proton pumps (H+/K+ ATPase) which are a family member of V- type ATPase are found in the organelles such as lysosomes, endosomes, Golgi complex, and in gastric parietal cells. These ATPases are key players in providing an acidic environment which is needed by cells to pursue their normal function. 8 1.4 Membrane Proteins As one of the most important classes of proteins, membrane proteins, have significant diversity; both functionally and structurally. They play a key role in enabling the cells to convey the signals from their surrounding environment into the cells which will result in their appropriate responses to the extra- cellular milieu. Based on their interaction with the biological membranes, membrane proteins are classified as integral or peripheral proteins. Integral proteins traverse the membrane, therefore, they mainly consist of hydrophobic amino acids. The hydrophobic chain of the integral proteins usually spans the entire membrane and the most common structure of the membrane spanning domain is the α-helix. Integral proteins can also be covalently linked to certain hydrocarbon groups which permanently link them to the lipid bilayer[16, 17]. On the other hand, peripheral proteins lack this hydrophobic domain to lodge them in the membrane, but they stay in contact with biological membranes via their interaction with hydrophilic part of the membranes or integral proteins[17]. Integral proteins have several substantial biological functions. They are significantly important in neuronal and hormonal signal transduction, which makes them a perfect target for therapeutic interventions. They can function as channels in the membranes conveying hydrophilic or larger molecules which by themselves cannot cross the membrane. They can act as receptors binding different ligands such as the enormous family of the G-protein coupled receptors (GPCR). Moreover, all the proteins that participate in the electron transport chain (ETC) and the Fo subunit of the ATPase are all integral proteins of the inner membrane of the mitochondria[17, 18]. 9 1.5 Transmembrane (TMEM) Protein family TMEM protein family was first discovered from Xenopous oocye, murine eyes, and bronchial epithelial cells. One of the well-studied of these proteins is TMEM16A (Anoctamine-1 (ANO-1))[19]. TMEM16A protein spans the membrane eight times, and both of the amino and carboxyl termini are in the intracellular region. TMEM16A acts as a calcium-activated chloride channel which in humans is highly expressed in the intestinal cells of Cajal that are a key player in intestinal motility by production of the slow waves. Studies have shown that the ANO-1 knock-out mice have difficulty in producing slow waves, hence difficulty generating intestinal motility[20]. Another TMEM protein, TMEM237, has four transmembrane domains and similar to TMEM16A, it’s carboxyl and amino termini face the intracellular region. This protein is important in the biogenesis of the cilium and its mutation is in relation with Joubert syndrome, which is a rare genetic disease affecting the cerebellum causing difficulties in the coordination and keeping balance[21, 22]. TMEM56, an IKK-β interacting protein, was first discovered in Dr. Ebrahim Zandi’s laboratory by mass spectrometry and immunoprecipitation. It has 263 amino acids and an approximate molecular weight of 30KDa. Its gene is located on chromosome 1 (1p21.3) and codes for this integral membrane protein with six α-helix domains. Based on the previous studies in Dr.Zandi’s laboratory it was shown that TMEM56 has a strong association with mitochondrial ATP synthase. It was also shown that Flag-TMEM56 co-localized with the ATP synthase using anti-Flag and anti-ATPase antibodies. Moreover, in-vivo xenograft assay studies using nude mice and stable HEK 293T cells have shown that those injected with TMEM56-overexpressed 293T stable cells had slower tumor growth and lower tumor volume compared to those injected with TMEM56-knockdown 293T stable cells[23, 24]. 10 Human Transmembrane protein 56 (TMEM56) A. Amino acid sequence of TMEM56 1 MEINTKLLIS VTCISFFTFQ LLFYFVSYWF SAKVSPGFNS LSFKKKIEWN SRVVSTCHSL 61 VVGIFGLYIF LFDEATKADP LWGGPSLANV NIAIASGYLI SDLSIIILYW KVIGDKFFIM 121 HHCASLYAYY LVLKNGVLAY IGNFRLLAEL SSPFVNQRWF FEALKYPKFS KAIVINGILM 181 TVVFFIVRIA SMLPHYGFMY SVYGTEPYIR LGVLIQLSWV ISCVVLDVMN VMWMIKISKG 241 CIKVISHIRQ EKAKNSLQNG KLD B. Predicted Structure (Unitprot KB database) Figure 5: A. The amino acid sequence of TMEM56 from NCBI (NP_001186608.1) http://www.ncbi.nlm.nih.gov/protein/NP_001186608.1 B. Predicted Structure of TMEM56 from UnitprotKB database (Q96MV1) http://www.uniprot.org/uniprot/Q96MV1 11 CHAPTER II HYPOTHESIS Prior studies in Dr.Zandi’s laboratory have shown that TMEM56 has a strong association with ATP synthase. Moreover, in vivo xenograft assays also have revealed that reducing TMEM56 expression in HEK 293T cells results in a greater tumor growth and tumor volume. [23] Correspondingly, we hypothesize that TMEM56 may have a tumor suppressor effect. In this study we tried to investigate the potential role of the TMEM56 protein in the tumorigenic growth of the human PC3 prostate cancer cell line. Based on the potential tumor suppressor role of the TMEM56, we hypothesize that cancer cells may decrease the expression of TMEM56. At last, according to the strong association between ATP synthase and TMEM56, we hypothesize that the expression level of TMEM56 will correspond to the ATP synthase expression. 12 CHAPTER III MATERIALS and METHODS 3.1 Cell Culture Conditions PC3 cells are human prostate cancer cell line established from lumbar metastasis of the prostate cancer, and are androgen insensitive. This cell line was purchased from ATCC, and the cells were cultured in Roswell Park Memorial Institute medium (RPMI) supplemented with 10% fetal bovine serum and 1% antibiotics (penicillin and streptomycin). All cells were maintained at 37°C and in humidified 5% CO2 atmosphere. The cells were trypsinized and passaged at 80% confluence, in a 100mm x 200mm culture dish every 4 to 5 days. 3.2 Establishment of stable PC3 cell lines Using transfection, four stable PC3 cell lines: GFP-Ctrl, GFP-TM, shRNA-Ctrl, and shRNA-(1- 228) were constructed. Respectively, the plasmids for GFP-Ctrl, GFP-TM, shRNA-Ctrl, and shRNA-(1- 228) were pCMV6-AC-GFP vector (OriGene Technologies, Rockville, MD, US), pCMV6-AC-GFP-TM (OriGene Technologies, Rockville, MD, US), mission non-target shRNA control vector (Sigma Aldrich, St. Louis, MO, US), and TMEM56 mission shRNA plasmid DNA (Oligo Name: TRCN0000141547, Sigma Aldrich, St. Louis, MO, US). TMEM56 was inserted at Sgf I and Mlu I restriction site of pCMV6- AC-GFP vector. PC3 cells were transfected at 80% confluency using Lipofectamine® LTX Reagent (Life technologies, Grand Island; NY, US).Transfection was done using the following procedure: 0.5ug of plasmid was incubated with 100ul PLUS reagent and OPTI-MEM, the mix was added to 100ul 13 lipofectamine and MEM medium and then left at room temperature for 30 minutes. After 30 minutes, cell medium was replaced with 1ml OPTI-MEM. Afterwards, the plasmid-reagent-lipofectamine mix was added to the cell plate and the cells were incubated at 37°C with 5% CO2 for 5 to 6 hours. Subsequently, the medium was changed to the RPMI culture medium. This protocol was used for all of the four different plasmids. Based on the selection tag on the plasmids, 0.8ug/ml puromycin was used to select knockdown (shRNA) cell lines, and 400ng/ml Geneticin-418 was used to select over-expressed cell lines. Under this high antibiotic concentration pure cells were selected. The antibiotic concentrations were consequently reduced to 0.1ug/ml for puromycin and 50ng/ml for Geneticin-418 to maintain the cell lines. Since GFP- Ctrl and GFP-TM contained the GFP tag gene they could be monitored under the fluorescent microscope for their purity. 3.3 RNA extraction and Real Time RT-PCR for TMEM56 expression levels Total RNA was extracted from PC3 cells following the protocol in RNeasy Mini Kit (QiaGen, USA). 75ng of the total RNA from the four different PC3 stable cell lines: GFP-Ctrl, GFP-TM, shRNA- Ctrl, and shRNA-(1-228) were used to do the Real time RT-PCR. Reagents used were one-step fast master mix, EVA-GREEN, and fast RT enzyme all of which were purchased from Quanta Bioscience. For each reaction tube 250ηM of the forward and reverse primers was used. Beta actin was used as an internal control. FORWARD PRIMER (5’-3’) REVERSE PRIMER (5’-3’) TMEM56 TTTCCAGCCCGTTTGTGAATCAGC CATTGAGGCAATCCGCACGATGAA Beta Actin GGCACCCAGCACAATGAAG GCCGATCCACACGGAGTA Table 1: List of primers used for qPCR and RT-PCR. 14 3.4 In-vivo analysis in nude mice Nude mice are genetically mutated animals that are deficient in their immune system (thymus is either absent or nonfunctional); therefore, a popular model used to study tumor development. The four different stable PC3 cell lines, GFP-Ctrl, GFP-TM, shRNA-Ctrl, and shRNA-(1-228), were injected into the nude mice (from Jackson Laboratories) to measure tumor growth. Two rounds of in-vivo xenograft assays were performed.For the first round of our subcutaneous injection, six mice were used. Three were injected by the GFP-Ctrl (on the left flank) and GFP-TM (on the right flank), and three by shRNA-Ctrl (on the left flank) and shRNA (1-228) (on the right flank). To perform injection, the mice were anaesthetized intra-peritoneally using Xylazine and Ketamine. From each of the four cell lines, one million cells suspended in 100ul PBS and Matrigel, basement membrane matrix supporting tumor propagation in mice, were injected on each flank side of the mice as mentioned above. Injections were done in three mice for each group to make a triplicate, and all the mice were closely observed post injection. The mice were well maintained and monitored regularly in their special housing by Department of Animal Resources (DAR)’s staff. Tumor size (length and width) was measured every 2 to 3 days by a caliper and the tumor volume was calculated using this formula: Width² × length/2. Thirty eight days after inoculation, the mice were euthanized using CO2 followed by cervical dislocation exactly following the USC protocols on animal experiments. Tumors from each mouse were dissected and cut into three pieces and stored separately in formalin, cell freezing medium and a blank tube. All the animal procedures were strictly followed by the USC protocols on animal experiments. For the second round of the injection, the same procedure mentioned above was followed. For this round, however, five mice were used for each group, and the mice were euthanized thirty four days following subcutaneous inoculation of the cancer cells. 15 3.5 RNA extraction from the tumors The excised tumors were disrupted and homogenized using specific beads, buffer RLT, and β-ME (2-Mercaptoethanol). Afterwards, total RNA was extracted from each tumor (GFP-Ctrl, GFP-TM, shRNA-Ctrl, and shRNA-(1-228)) following the protocol in RNeasy Mini Kit (QiaGen, USA). 75ng of total RNA was used to do the Real time RT-PCR to measure the relative expression level of the TMEM56. 3.6 Immunohistochemitry using ATPase β Tissue sections were made by Norris Cancer Center pathology laboratory from the tumor samples that were fixed in 10% formaldehyde. A number of slides from each tumor sample were stained using hematoxylin and eosin (H&E staining) while several other slides were immunostained using anti-ATPase β antibody (BD Biosciences-San Jose, CA) to examine the level of expression of ATP synthase β subunit. 3.7 Analysis of ATPase β stained tissues With the help of USC’s Cell and Tissue Imaging Core, digital slides were made using the Aperio ScanScope. Utilizing the Aperio ImageScope software the total intensity of strong positive signal in the four samples, GFP-Ctrl, GFP-TM, shRNA-Ctrl, and shRNA-(1-228), was quantified and compared. 16 CHAPTER IV RESULTS 4.1 Relative TMEM 56 basal expression level in different cell lines Previous studies on TMEM56 at Dr.Zandi’s lab have shown that this protein is located in the mitochondria and has an interaction with ATP Synthase. Furthermore, studies done in HEK 293T cells indicate that TMEM56 may have a role as a tumor suppressor and therefore, regulate the rate of tumor growth and progression[23]. Most of our previous data on the function of the TMEM56 came from the studies done in HEK 293T cells which are not a cancer cell line. Therefore, to investigate the role of TMEM56 in cancer, we designed this study to explore the function of this protein in PC3 cell line, which is an androgen insensitive human prostate cancer cell line. As modifying expression level of TMEM56 in HEK293 cells resulted in phenotypic changes (23, 24), we first examined the mRNA expression level of TMEM56 by Real Time RT-PCR to gain an understanding of the basal level of this protein in PC3 cells. Expression level of TMEM56 in HEK 293T cell line was used for comparison in this study. The mRNA expression of TMEM56 is about 50% lower in PC3 than HEK 293T cells (See Figure 6). Figure 6. Relative basal level of TMEM56 expression in PC3 and HEK 293T cell lines. 0 1 2 3 PC-3 293T Relative TMEM56 Expression Relative TMEM56 Expression 17 4.2 Establishment of PC3 stable cell lines To examine if increased or decreased expression of TMEM56 has any effect on the tumorigenic growth of PC3 cells, we used stable transfection to generate knockdown and over-expressed stable PC3 cell lines. The stable cell lines were produced by transfecting plasmids with a positive selection marker containing either puromycin or Geneticin-418 resisting genes. PC3 cells were transfected with TMEM56 mission shRNA plasmid with puromycin resistance to knock down TMEM56 expression. To over- express TMEM56, PC3 cells were transfected with pCMV4-AC-GFP-TM vector with G418 resistance. PC3 cells expressing vector controls, GFP-Ctrl and shRNA-Ctrl were generated as well. These stable cell lines were used for two rounds of in-vivo xenograft studies in nude mice (see section 4.3). Figure 7 shows the Real-time RT-PCR data for the relative TMEM56 expression in PC3 stable cell lines. Expression of beta-actin mRNA was used to normalize expression of TMEM56. As the figure shows, for the first round of our experiment, the level of TMEM56 in GFP-TM cell line is more than two-folds compared to its control and more than about five-folds compared to untransfected PC3 cells. On the other hand, the level of TMEM56 in shRNA-TM (1-228) is lower (less than two- folds) compared to its control and untransfected PC3 cells. Figure 7. Relative TMEM56 expression in PC3 stable cell lines (used in the first and second round of subcutaneous injection). RNA from different cell lines was extracted by RNeasy Mini Kit. The Real-time RT-PCR was done with 75ng RNA template in triplicates. Expression of TMEM56 mRNA was normalized by beta-actin mRNA. 0 1 2 3 4 5 6 PC3 GFP-Ctrl GFP-TM shRNA-Ctrl shRNA-TM(1-228) Relative TMEM56 Expression Relative TMEM56 Expression(fisrt round) Relative TMEM56 Expression(second round) 18 Between the first and second round of our in-vivo xenograft studies (almost three months), these cell lines were maintained in the cell culture with antibiotics, 0.1ug/ml of puromycin for the shRNA cell lines and 50ng/ml of Geneticin-418 for GFP cell lines. To perform the second round in-vivo xenograft studies, the concentration of puromycin was increased from 0.1ug/ml to 0.5ug/ml to reselect the shRNA- Ctrl and shRNA-TM cell lines, and the concentration of the G418 was increased from 50ng/ml to 200ng/ml to reselect the GFP-Ctrl and GFP-TM cell lines. As figure 7 shows, for the second round there was not a significant difference in TMEM56 expression between GFP-Ctrl, GFP-TM and untransfected PC3 cells. For the GFP-TM and GFP-Ctrl cell lines we monitored the GFP expressing cells using a fluorescence microscope. Qualitatively, the fluorescence content in GFP-TM and GFP-Ctrl cell lines in the first round of our in-vivo studies were high, indicating that the majority of selected cells expressed the GFP-TM protein. On the other hand, we could not obtain the same population of selected green cells (as in the first round) for the GFP-tagged cell lines in the second round of our in-vivo experiments. 19 4.3 In-vivo tumor studies in nude mice To investigate the possible tumor suppressor effects of TMEM56, based on prior studies at Dr.Zandi’s laboratory, the stable PC3 cell lines were used as a cancer cell line to examine this hypothesis using in-vivo xenograft assays. Nude mice (from Jackson Laboratories) were used for the SubQ injection of the four generated stable PC3 cell lines. For the first round of our in-vivo xenograft studies, six nude mice were divided into two groups where the first three were injected with PC3 cells expressing GFP-Ctrl on the left flank and the GFP-TM on the right flank, and the other group of three received shRNA-Ctrl on the left flank and shRNA-TM (1-228) on the right flank. For the second round of in-vivo xenograft studies, ten mice were used, five for each group which were subcutaneously injected in the same way as in the first round. Each injection contained a suspension of one million cells in100ul of Matrigel, the basement membrane matrix supporting the tumor propagation in mice, and PBS. Post injection, we closely monitored the mice for tumor development. In the first round of the study, after two weeks, the visible tumors started to grow, and the dimensions of the growing masses were measured every two to three days using a caliper. Finally, at day thirty eight post inoculation, the mice were euthanized and the tumors were excised. On the other hand, in the second round of the study, the tumors started to grow sooner, after three days, and finally at day thirty four post inoculation the mice were euthanized and the tumors were excised. We calculated the tumor volume based on this formula: Width² × length/2. Figure 8 shows the tumor volume as a function of time (days post inoculation) in the first round of in-vivo studies. During the first twenty days post inoculation, all four different cell lines showed almost the same tumor volume and growth rate. After day twenty, shRNA-TM (1-228) showed a rapid increase in its tumor volume while the 20 other three cell lines continued their tumor growth in a similar rate. Figure 9 shows the tumor volume as a function of time (days post inoculation) in the second round of in-vivo studies. As it is seen in figure 9, tumors started to grow at day three post inoculation, and the rate of tumor growth in this round of SubQ injection was remarkably higher in all of the four stable PC3 cell lines compared to the first round. Finally, in the second round we obtained larger tumors from each of the cell lines compared to the corresponding cell line from the first round. Figure 8. First round tumor growth. Tumor volume in nude mice as a function of time for four different stable PC3 Cell lines. . Figure 9. Second round tumor growth. Tumor volume in nude mice as a function of time for four different stable PC3 Cell lines. 0 100 200 300 400 500 600 700 800 0 15 17 20 22 24 27 29 31 34 38 TUMOR VOLUME (mm3) DAYS AFTER INOCULATION GFP-TMEM shRNA-TM(1-228) GFP-CTRL shRNA-CTRL 0 200 400 600 800 1000 1200 1400 0 3 8 10 14 17 21 24 29 34 TUMOR VOLUME (mm 3 ) DAYS AFTER INOCULATION GFP-TMEM shRNA-TM(1-228) GFP-CTRL shRNA-CTRL 21 Thirty eight days post inoculation of the first round, and thirty four days post inoculation of the second round, according to USC guidelines for animal research; all the mice were euthanized using CO2 inhalation followed by cervical dislocation. In the first round of the in-vivo studies, as it is shown in Figure 10, no remarkable difference is seen between the tumors from GFP-Ctrl, GFP-TM, and shRNA- Ctrl cell lines while tumors from shRNA-TM (1-228) cell line were larger and multi-nodular. Similar to the first round, in the second round of the in-vivo studies, no remarkable difference is seen between the tumors from GFP-Ctrl, GFP-TM, and shRNA-Ctrl cell lines while tumors from shRNA-TM (1-228) cell line showed larger, and multi-nodular masses ( Figure 11 and 12). Nevertheless, the difference between the tumors formed by the four stable PC3 cell lines is less remarkable than it was in the first round of the SubQ inoculation. Figure 10. First Round of SubQ inoculation of PC3 stable cell lines. Top three mice were injected with GFP-Ctrl on the left and GFP-TM on the right. Lower three mice were injected with shRNA-Ctrl on the left and the shRNA-TM on the right. 22 When dissecting the tumors from the mice, in both first and second round of the SubQ injections, the tumors formed by GFP-Ctrl, GFP-TM, and shRNA-Ctrl cell lines were covered by a loose fibrinous connective tissue and were easily taken out with minimal surrounding adhesions and vascularity. On the other hand, tumors that were excised from shRNA-TM, were larger, multinodular, more vascular, and were tightly attached to the surrounding tissues; specifically to the skin which made it hard to dissect completely (Figure 13-16). Figure 12. Second Round of SubQ inoculation of PC3 stable cell lines. The five mice were injected with shRNA-Ctrl on the left and shRNA-TM on the right. Figure 11. Second Round of SubQ inoculation of PC3 stable cell lines. The five mice were injected with GFP-Ctrl on the left and GFP-TM on the right. 23 Figure 17 provides a comparison between the tumor volume in the excised tumors from the first and second rounds of the SubQ injections. In the first round, there was no significant difference between the tumors from GFP-Ctrl, GFP-TM, and shRNA-Ctrl cell lines while tumors developed from shRNA- GFP-Ctrl GFP-TM shRNA-Ctrl shRNA-TM Figure 13. First round tumors. Morphology of thee isolated tumors from four PC3 stable cell lines. Figure 14. Second round tumors. Morphology of the isolated tumors from GFP-Ctrl on the left and GFP-TM on the right. Figure 15. Second round tumors. Morphology of the isolated tumors from shRNA-Ctrl on the left and shRNA-TM on the right. Figure 16. Higher magnification of the tumor isolated from shRNA-TM (on the right) showing remarkable vascularity of the tumor. 24 TM cell line were remarkably larger. On the other hand, in the isolated tumors from the second round, the general tumor sizes from each of the four cell lines were larger comparing to their corresponding tumors from the first round. Moreover, the prominent difference that was seen in the first round between the tumors from the GFP-TM and shRNA-TM cell lines was lost in the second round. Figure 17. Average tumor volume of the first and second round’s isolated masses developed from four PC3 stable cell lines. Each isolated tumor from the first and second round of these studies were cut into three pieces; one was kept in 10% formaldehyde for future tissue slide preparation; the other piece was kept in the lysis buffer from which the RNA was extracted, and the last piece was frozen for further analyses in the future. Relative expression of TMEM56 mRNAs in the tumors developed in the first and second round of the in- vivo experiments were determined by Real Time RT-PCR. As it is shown in figure 18, in the first round of the in-vivo experiment, the over-expression of the TMEM56 in GFP-TM cell line was lost during the 0 200 400 600 800 1000 1200 1400 GFP-TMEM GFP-CTRL shRNA-CTRL shRNA-TM A VERAGE TUMOR VOLUME AVERGE TUMOR VOLUME(first round) AVERGE TUMOR VOLUME(second round) 25 tumor growth in the mice while the relative expression level of TMEM56 in the GFP-Ctrl and shRNA- Ctrl remained approximately the same as in the corresponding cell lines (before SubQ inoculation, figure 7). Interestingly, the level of TMEM56 mRNA expression in the tumors from shRNA-TM knocked down cells is lower than shRNA-Ctrl cells (more than two-folds) compared to the corresponding cell lines (see figure 7). Figure 18. Relative TMEM56 expression in the first and second round tumors developed from the four different PC3 stable cell lines. On the other hand, as depicted in figure 18, in the second round of in-vivo experiments the relative TMEM56 expression level in the tumors from GFP-Ctrl, GFP-TM, and shRNA-Ctrl remained approximately the same as in their corresponding cell lines (before SubQ inoculation, figure 7). The expression level in the shRNA-TM-grown tumors was knocked down as it was in the shRNA-TM (1-228) cell line (before SubQ inoculation). (See section 4.2) 0 0.2 0.4 0.6 0.8 1 1.2 PC3 GFP-Ctrl GFP-TM shRNA-Ctrl shRNA-TM RELATIVE TMEM56 EXPRESSION Relative TMEM56 Expression(first round) Relative TMEM56 Expression(second round) 26 To explore the effects of TMEM56 in cancer to a greater extent, tissue sections were made by Norris Cancer Center pathology laboratory from the tumor samples of the first round of in-vivo studies, which enabled us to analyze the effects of this protein at a histological level. Several slides from each tumor sample were stained using hematoxylin and eosin (H&E). (See Figure 19). All the slides were examined by, Dr. Christina Day, a USC faculty at the department of Pathology. Based on her comments, the slides from the GFP-Ctrl, GFP-TM, and shRNA-Ctrl showed same features without any remarkable difference between them. On the other hand, the slide from shRNA-TM (1-228) showed higher levels of mitosis, higher nuclear to cytoplasmic ratio (N/C ratio), prominent nucleoli, more necrosis, and more nuclear polymorphism and hyperchromasia. All of these data show the more malignant feature in the tumors that arose from shRNA-TM cell line. 27 A. B. C. D. Figure 19. H & E stained slides from the tumors arose from four stable PC3 cell lines. A.GFP-Ctrl / B. GFP-TM / C. shRNA.Ctrl / D. shRNA-TM (1-228) 28 4.4 Immunohistochemitry using ATPase β Prior studies in our lab on HEK 293T cells have shown that TMEM56 has a strong interaction with mitochondrial ATP synthase. These studies also showed that there was less mitochondrial abundance in the tumors developed from TMEM56-knockdown HEK 293T cells[23]. Moreover, many studies in the literature have shown a strong relationship between the mitochondria and cancer. Therefore, to explore the TMEM56 function in the mitochondrial abundance in cancer we used immunohistochemistry, and compared the mitochondrial ATP synthase β expression in tumor tissue sections from the first round of SubQ injections. Figure 20 shows that expression of ATP synthase β is very similar in tumor sections from PC3 cells expressing GFP-Ctrl, GFP-TM, and shRNA-Ctrl while it is significantly lower in the tumor section from shRNA-TM. 29 A. B. C. D. Figure 20. Immunostaining using anti-ATPase β antibody. Slides from the tumors arose from four different PC3 cell lines after first round of SubQ injection. A.GFP-Ctrl / B. GFP-TM / C. shRNA.Ctrl / D. shRNA-TM (1-228) 30 Quantification of immunohistochemistry of these data shows that expression of ATP synthase β in shRNA-TM is almost forty-folds lower than the three other samples. This data suggests that tumors developed from shRNA-TM have either lower number of mitochondria or their mitochondria express lower levels of ATP synthase β. (Figure 21) Figure 21. Measurement of the total intensity of the strong positive signal, using Aperio ImageScope software, in the slides prepared by the tumors arose from four different PC3 cell lines after first round of SubQ injection. 0 50,000,000 100,000,000 150,000,000 200,000,000 250,000,000 300,000,000 350,000,000 400,000,000 450,000,000 500,000,000 shRNA-Ctrl shRNA-TM GFP-Ctrl GFP-TM Total Intensity of Strong Positive Signal of Anti-ATPase β-synthase staining Total Intensity of Strong Positive 31 CHAPTER V DISCUSSION and CONCLUSIONS The novel transmembrane protein, TMEM56, was firstly identified in Dr. Ebrahim Zandi’s laboratory as an IKK-β interacting protein using co-immunoprecipitation and mass spectrometry. Employing immuunostaining, it was also shown that this protein has a strong association with mitochondrial ATP synthase. Moreover, in prior studies in our lab, it was illustrated that knocking down TMEM56 in HEK 293T cells resulted in faster and larger tumor growth while over-expression of TMEM56 had a potential tumor suppressor effect in nude mice experimental system. HEK 293T cells are not a cancer cell line; therefore, this study was designed to investigate the effects of TMEM56 in cancer cells. PC3 cell line, which is an androgen insensitive human prostate cancer cell line was used to investigate our hypothesis. Since prior studies in our lab showed the potential tumor suppressor effect of TMEM56, examining the effect of over-expression and knocking down of this protein in PC3 cell line may shed more light on the possible function of TMEM56 and cancer development. In addition, we also examined the correlation of TMEM56 down regulation with the mitochondrial ATP synthase. Using transfection to knockdown and over-express TMEM56 we established four stable PC3 cell lines, namely, GFP-Ctrl, GFP-TM, shRNA-Ctrl, and shRNA-TM (1-228). The over-expression and knockdown of the gene were confirmed by Real Time RT-PCR. (Figure 7) After establishing the stable PC3 cell lines, for the first round of our in-vivo xenograft assay, we used six nude mice in which three of them were subcutaneously inoculated by GFP-Ctrl (on the left flank) and GFP-TM (on the right flank) while the other three were subcutaneously injected by shRNA-Ctrl (on 32 the left flank) and shRNA-TM (1-228) (on the right flank). While monitoring the tumor development post injection, the tumors that formed by the shRNA-TM started to grow faster and demonstrated a multinodular appearance while there was not a significant difference between the tumors that developed from the other three cell lines (Figure 7-9). Interestingly, while dissecting the tumors those tumors that were developed from shRNA-TM showed prominent attachments to the surrounding tissues, more vascularity compared to the tumors from the other three cell lines, and had an irregular border. Being poorly circumscribed, fixed to the surrounding tissues, rapidly growing, and having higher vascularity all together demonstrates the more malignant feature of the shRNA-TM-grown tumors. To confirm these observations, microscopic slides were produced from each tumor sample. Based on the pathologist’s comments, tumors grown from shRNA-TM have shown higher nuclear to cytoplasmic (N/C) ratio, higher mitotic activity, higher nuclear atypia, more necrosis, more prominent neucleoli, and more nuclear polymorphism and hyperchromasia. All of these indicate that the tumors arose from shRNA-TM were more malignant while there were no such noticeable differences in the slides from the tumors of the other three cell lines. Moreover, as it is shown in figure 7 and 17, the over-expression of TMEM56 is lost during the tumor growth in the nude mice indicating that these cells do not maintain the high levels of this protein and will therefore, suppress it for their growth. To confirm the findings from the first round the same in-vivo xenograft assays was repeated for the second time and this time ten mice, five for each group, were used. The four PC3 cell lines were reselected by increasing the concentration of the selective antibiotics. In contrast to the first round of our SubQ injection, we were unable to over-express TMEM56 for our second round of SubQ injection. Stable expression of TMEM56 for long periods under cell culture condition appeared to be toxic for PC3 cells, and as a result cells were selected for low or none TMEM56 expression. The overall tumor volumes of the second round of SubQ injection were larger, indicating that longer maintenance of the cells in the culture has resulted in phenotypic changes. (Figure 7, 17) 33 The second round of SubQ inoculation was mostly done to retest the effect of TMEM56 knockdown (shRNA-TM cell line) on the tumor growth. As figure 12, 15, and 16 depict, tumors from shRNA-TM cells showed a prominent tumor vascularity compared to the tumors from their corresponding controls and two other stable cell lines. In the second round of our SubQ injection, the tight attachment of the shRNA-TM-grown tumors to their surrounding tissues was again seen as it was in the first round. In addition to these in-vivo characteristics shown by shRNA-TM, interestingly, we saw a tight attachment of the cells from this cell line to the Petri dish which made the trypsinization of this cell line significantly harder than the other three. All of these findings suggest the production of factors and proteins by this cell line, shRNA-TM, that enabled these cells to attach tightly to their surrounding environment, either a Petri dish or subcutaneous tissue. Furthermore, the effect of lengthy maintenance of these cells in the culture medium under the pressure of the antibiotics should also be considered for these phenotypic changes. Prior studies in Dr.Zandi’s laboratory illustrated the strong interaction of TMEM56 with mitochondrial ATP synthase. The microscopic slides provided from the tumor samples formed in the first round of the in-vivo experiments were immunostained using anti-ATPase β antibody to examine the expression of ATP synthase in PC3 cell lines. As depicted in figure 20 and 21, the level of mitochondrial abundance is remarkably lower in the shRNA-TM sample compared to other three cell lines. This significant difference in mitochondrial abundance in tumors from shRNA-TM cell line, in which the expression level of TMEM56 is knocked down, agrees with our hypothesis and also to the previous studies that were done in Dr.Zandi’s laboratory. Based on these data, it can be inferred that a decrease in the level of TMEM56 plays a role in the tumorigenic growth of the PC3 cells, and the mitochondrial abundance in the tumors arose from this cell line. Moreover, it is possible that the decrease in the level of TMEM56 expression could play a role in the highly-developed tumor vascularity based on its interactions with mitochondria. Mitochondria play an extremely crucial role in the cancer development. As one of the master regulators of apoptosis, mitochondria are extremely important in prevention of cancer development by 34 induction of apoptosis. On the other hand, as it was described by Warburg effect, tumors tend to use glycolysis, occurring mostly in cytosol, as their main method of energy production instead of oxidative phosphorylation, which takes place in mitochondria. By this energy shift, tumor cells make themselves able to shift the important metabolites in the glycolytic pathway, such as essential amino acids and ribose sugars, toward other biosynthesis pathways, which are in need by the rapidly proliferating tumor cells.[25] Hypoxia-inducible factor 1 alpha (HIF1α) is the master regulator of angiogenesis, activation of which results in suppression of mitochondrial function and upregulation of glycolysis. Moreover, it has recently been shown that activation of mitochondrial signaling can also directly inhibit HIF1α. Mitochondria may regulate HIF1α using different ways such as; (a) mitochondria-derived reactive oxygen species (ROS) like H 2 O 2 which can directly act on redox-sensitive units of HIF1α , (b) prolylhydroxylases (PHDs), which hydroxylate HIF1α and signal it to be ubiquinated and degraded, and (c) indirect activation of p53, which is a known inhibitor of HIF1α.[25] Since both higher rate of tumor growth and markedly increased vascularity were seen in our in- vivo experiments using the knockdown level of TMEM56 (shRNA-TM cell line), it seems logical to conduct further investigations to decipher the mechanisms behind these effects. In conclusion, our in-vivo xenograft experiments in nude mice as well as the immunohistochemistry utilizing anti-ATPase β antibody all together has shown that a decrease in the expression of the TMEM56 protein in the PC3 stable cancer cell line led to a faster development of the tumors which showed malignant properties such as tight adhesions to the surrounding tissues, and well- developed tumor vascularity. Since these features had a logical correlation with the data from our immuunostaining on the mitochondrial ATP synthase and with the current literature data in this field of cancer research; it would be reasonable to plan for further investigations to unscramble the mechanisms behind these interesting adaptations. 35 REFERENCES 1.National Cancer Institute. Prostate Cancer. 2012 September,9 2014]; Available from: http://www.cancer.gov/cancertopics/wyntk/prostate. 2.American Cancer Society. Prostate Cancer. 2014 September,9 2014]; Available from: http://www.cancer.org/cancer/prostatecancer/detailedguide/index. 3.Marion, D., Clinical presentation and diagnosis of prostate cancer.: In: UpToDate, Post TW (Ed), UpToDate, Waltham, MA. (Accessed onSeptember,9 2014). 4.Frezza, C., The role of mitochondria in the oncogenic signal transduction. The international journal of biochemistry & cell biology, 2014. 48: p. 11-17. 5.Koonin, E. and L. Aravind, Origin and evolution of eukaryotic apoptosis: the bacterial connection. Cell death and differentiation, 2002. 9(4): p. 394-404. 6.Rizzuto, R., et al., Mitochondria as sensors and regulators of calcium signalling. Nature Reviews Molecular Cell Biology, 2012. 13(9): p. 566-578. 7.Warburg, O., On the origin of cancer cells. Science, 1956. 123(3191): p. 309-314. 8.Busk, M., et al., Aerobic glycolysis in cancers: Implications for the usability of oxygen ‐responsive genes and fluorodeoxyglucose ‐PET as markers of tissue hypoxia. International journal of cancer, 2008. 122(12): p. 2726-2734. 9.Frezza, C. and E. Gottlieb. Mitochondria in cancer: not just innocent bystanders. in Seminars in cancer biology. 2009. Elsevier. 10.Gaude, E. and C. Frezza, Defects in mitochondrial metabolism and cancer. Cancer & metabolism, 2014. 2(1): p. 10. 11.Scatena, R., Mitochondria and cancer: a growing role in apoptosis, cancer cell metabolism and dedifferentiation, in Advances in Mitochondrial Medicine. 2012, Springer. p. 287-308. 12.Nakamoto, R.K., J.A. Baylis Scanlon, and M.K. Al-Shawi, The rotary mechanism of the ATP synthase. Archives of biochemistry and biophysics, 2008. 476(1): p. 43-50. 36 13.Fernandez-Moran, H., et al., A macromolecular repeating unit of mitochondrial structure and function correlated electron microscopic and biochemical studies of isolated mitochondria and submitochondrial particles of beef heart muscle. The Journal of cell biology, 1964. 22(1): p. 63-100. 14.Oster, G. and H. Wang, Reverse engineering a protein: the mechanochemistry of ATP synthase. Biochimica et Biophysica Acta (BBA)-Bioenergetics, 2000. 1458(2): p. 482-510. 15.Jiang, W., J. Hermolin, and R.H. Fillingame, The preferred stoichiometry of c subunits in the rotary motor sector of Escherichia coli ATP synthase is 10. Proceedings of the National Academy of Sciences, 2001. 98(9): p. 4966-4971. 16.Wallin, E. and G.V. Heijne, Genome ‐wide analysis of integral membrane proteins from eubacterial, archaean, and eukaryotic organisms. Protein Science, 1998. 7(4): p. 1029-1038. 17.Almén, M.S., et al., Mapping the human membrane proteome: a majority of the human membrane proteins can be classified according to function and evolutionary origin. BMC biology, 2009. 7(1): p. 50. 18.von Heijne, G., Membrane-protein topology. Nature reviews Molecular cell biology, 2006. 7(12): p. 909-918. 19.Fuller, C.M., Time for TMEM? The Journal of physiology, 2012. 590(23): p. 5931-5932. 20.Sanders, K.M., et al., Anoctamins and gastrointestinal smooth muscle excitability. Experimental physiology, 2012. 97(2): p. 200-206. 21.Valente, E., B. Dallapiccola, and E. Bertini, Joubert syndrome and related disorders. Handbook of clinical neurology, 2012. 113: p. 1879-1888. 22.Huang, L., et al., < i> TMEM237</i> Is Mutated in Individuals with a Joubert Syndrome Related Disorder and Expands the Role of the TMEM Family at the Ciliary Transition Zone. The American Journal of Human Genetics, 2011. 89(6): p. 713-730. 23.Poornima Murali, Role of a novel transmembrane protein, MTTS1 in mitochondrial regulation and tumor suppression. USC Master Thesis.2012. 37 24.Hsiao-Fan WEI, Studies on the expression and function of the human TMEM56 protein. USC Master Thesis.2011. 25.Sutendra, G., et al., Mitochondrial activation by inhibition of PDKII suppresses HIF1a signaling and angiogenesis in cancer. Oncogene, 2012. 32(13): p. 1638-1650.

Abstract (if available)

Abstract A novel transmembrane protein, TMEM56, was identified in Dr. Ebrahim Zandi’s lab as an IKK-β interacting protein using co-immunoprecipitation and mass spectrometry. Previous studies in the lab have shown that this protein has a strong association with mitochondrial ATP synthase. Further analysis showed that this protein localizes to mitochondria and has a probable role in regulating ATP synthesis by interacting with ATP synthase α and β subunits. Prior in-vivo studies in nude mice illustrated that knocking down TMEM56 in HEK 293T cells resulted in faster and larger tumor growth while over-expression of TMEM56 had a potential tumor suppressor effect. Research has shown that mitochondrial dysfunction plays a pivotal role in cancer initiation and progression. ❧ In this study, we investigated the role of TMEM56 in regulating mitochondrial abundance and its subsequent role in tumor regulation using human PC3 cancer cell line. Our in-vivo xenograft experiments in nude mice as well as the immunohistochemistry utilizing anti-ATPase β antibody all together has shown that a decrease in the expression of the TMEM56 protein in the PC3 stable cancer cell line led to a faster development of the tumors which showed malignant properties such as tight adhesions to the surrounding tissues, and well-developed tumor vascularity. Since these features had a logical correlation with the data from our immuunostaining on the mitochondrial ATP synthase and with the current literature data in this field of cancer research, further investigations should be done to unwrap the mechanisms behind these interesting adaptations.

Linked assets

University of Southern California Dissertations and Theses

Conceptually similar

PDF

Studies on the expression and function of the human TMEM56 protein

PDF

Role of a novel transmembrane protein, MTTS1 in mitochondrial regulation and tumor suppression

PDF

Studies on the role of a novel protein, TMEM 56 in tumorigenic growth for MCF-7 cells

PDF

Decreased levels of expression of transmembrane protein 56 (TMEM56) in breast cancer tissues

PDF

Studies on the role of TMEM56 in tumorigenesis by using PTEN knockout mouse model

PDF

Role of cancer-associated fibroblast secreted annexin A1 in generation and maintenance of prostate cancer stem cells

PDF

Exploration of the roles of cancer stem cells and survivin in the pathogenesis and progression of prostate cancer

PDF

Development of immunotherapy for small cell lung cancer using novel modified antigens

PDF

The noncanonical role of telomerase in prostate cancer cells: exploring a non-telomeric signaling role for telomerase protein (TERT) in a cancer cell line

PDF

Optimization of circulating tumor cells isolation for gene expression analysis

PDF

Identify Werner protein molecular partners in S phase alt cell

PDF

Novel approaches of mobilizing human iNKT cells for cancer immunotherapies

PDF

Homologous cell systems for the study of progression of androgen-dependent prostate cancer to castration-resistant prostate cancer

PDF

The role of ErbB signaling in dendritic cells during inflammatory bowel disease

PDF

Study of bone morphogenetic protein-2 and stromal cell derived factor-1 in prostate cancer

PDF

Study of the mechanism by which hypoxia-inducible-factor-1 alpha (HIF-1α) regulates heat shock protein-90 alpha (Hsp90α) secretion in breast cancer

PDF

Study of the role of bone morphogenetic proteins in prostate cancer progression

PDF

The role of GRP78 in the regulation of apoptosis and prostate cancer progression

PDF

Developing a bioluminescence tracking system targeting on tumor cells and T cells for cancer immunotherapy

PDF

Tri-specific T cell engager immunotherapy targeting tumor initiating cells

Asset Metadata

Creator Mashayekhi, Kiarash (author)

Core Title Role of a novel transmembrane protein, TMEM56, in tumorigenic growth of human PC3 prostate cancer cell line

School Keck School of Medicine

Degree Master of Science

Degree Program Molecular Microbiology and Immunology

Publication Date 11/07/2014

Defense Date 10/09/2014

Publisher University of Southern California (original), University of Southern California. Libraries (digital)

Tag OAI-PMH Harvest,PC3 cells,prostate cancer,TMEM56,transmembrane proteins

Format application/pdf (imt)

Language English

Contributor Electronically uploaded by the author (provenance)

Advisor Zandi, Ebrahim (committee chair)

Creator Email dr.kia.mash@gmail.com,kmashaye@usc.edu

Permanent Link (DOI) https://doi.org/10.25549/usctheses-c3-515438

Unique identifier UC11298423

Identifier etd-Mashayekhi-3072.pdf (filename),usctheses-c3-515438 (legacy record id)

Legacy Identifier etd-Mashayekhi-3072.pdf

Dmrecord 515438

Document Type Thesis

Format application/pdf (imt)

Rights Mashayekhi, Kiarash

Type texts

Source University of Southern California (contributing entity), University of Southern California Dissertations and Theses (collection)

Access Conditions The author retains rights to his/her dissertation, thesis or other graduate work according to U.S. copyright law. Electronic access is being provided by the USC Libraries in agreement with the a...

Repository Name University of Southern California Digital Library

Repository Location USC Digital Library, University of Southern California, University Park Campus MC 2810, 3434 South Grand Avenue, 2nd Floor, Los Angeles, California 90089-2810, USA