University of Southern California Dissertations and Theses

Molecular aspects of skin early morphogenesis

(USC Thesis Other)

Molecular aspects of skin early morphogenesis

PDF

Download a page range

Download transcript

Copy asset link

Request this asset

Transcript (if available)

Content

MOLECULAR ASPECTS OF SKIN EARLY MORPHOGENESIS

by

Xueyuan Jiang

A Thesis Presented to
FACULTY OF THE GRADUATE SCHOOL
UNIVERSITY OF SOUTHERN CALIFORNIA
In Partial Fulfillment of the
Requirements for the Degree
MASTER OF SCIENCE
(EXPERIMENTAL AND MOLECULAR PATHOLOGY)

August 2015

2

Table of Contents
List of Figures 3
Abstract 4
Introduction 4
Materials and Methods 6
Results 9
1. Genes selected from RNA-seq 9
2. Molecular expression pattern in embryonic chicken skin 10
3. Functional study of Sox18 and Ascl4 13
Discussion 15
Future directions 18
References 29

3

List of Figures
Figure 1.Chicken feather development
Figure 2.Whole mount in situ hybridization
a.Sox18
b.Snai2
c.Rspo1
d.Ascl4
Figure 3. Section of whole mount in situ hybridization
Figure 4. Schematic drawing of sections
Figure 5. Sox18 natural mutant and dominant negative design
Figure 6. Immunohistochemistry of virus infected chicken embryos
a. Sox18
b. Ascl4

4

Abstract
Skin regional specificity allows for the effective use of the animal integumentary surface. Chickens show
high diversity of skin regional specificity. Feathers and scales in particular are easily distinguished and
are distributed in a characteristic pattern. We use chicken feathers and scales as a model system to
study molecular aspects of regional specificity during skin embryonic development. Genes differentially
expressed in those two regions are profiled by RNA-seq. A subset of these genes were chosen and
characterized here as part of a larger project. Whole mount in situ hybridization is then applied to show
the gene expression pattern on embryos of different stages. Sox18, a transcription factor, is exclusively
expressed on feather buds at E9. Mutated Sox18 has been shown to act in a dominant negative way to
cause severe hair follicle defects in mice and humans. Sox18 RCAS vectors are constructed to either
over-express or knock-down Sox18 in chicken skin mesenchyme. Ascl4 is mainly expressed in scale
region at a E11. It was injected in the feather forming region to validate its determinant role in scale
morphogenesis. Rspo1 is exclusively expressed at distal wing interbud region on E9. It may be involved
in bud boundary formation. Snai2 is present along the digit bone at early stage and then in feather bud
mesenchyme all over the body on E9.

Introduction
Skin and its appendages play a role in protection, thermoregulation, displays for mating, etc. These
functions are achieved through specialized skin and its regional specific appendages
1
. Humans grow fine,
almost invisible hairs in many parts of the body. The scalp hair and beard hair is long and thick,
functioning primarily as a way of communication between individuals. Skin regional specificity is an
interesting topic. Research on human skin has been compromised due to limited access to specimens
2
.
5

Mice are not an ideal model because of the homogeneity of hair on their bodies. Chickens have feather-
covered skin on the body and scale-covered skin on the lower leg and feet. Feathers alone can be
divided into several categories based on the different characteristics they display and different functions
they serve
3
. For example, flight feathers are long and asymmetrically shaped on the wing and tail, in
order to enable flight. Downy feathers grow on the breast to prevent heat loss thus are fine and
symmetric. The great diversity makes chicken feather/scale patterning an ideal model in which to study
regional specificity.

Feather skin development starts with tract formation. Periodic patterning established within those tracts
divide skin into bud and interbud regions
4
. Feather bud precursors form as the circular cluster of
epithelial placode cells proliferate along with underlying dermal cells
5
. This process is regulated by the
differential expression of molecules/pathways, like SHH which promotes feather bud formation and
BMP2/4 that modulates feather track size by suppressing bud formation
6, 7
.It first happens on the dorsal
tract along the midline and then spreads out bilaterally over time. Later, anterior-posterior polarity
emerges and leads to bud elongation in the rostral- caudal direction
8
. Epithelial cell proliferation in the
feather bud is a major factor that contributes to elongation. The proliferating region shifts proximally as
growth progress. The feather bud epithelium then wraps around the dermal papilla and invaginates into
the underlying mesenchyme to form the feather follicle
8
(Figure 1).

Avian scutate scale morphogenesis starts with an epidermal placode as well
9
. The two layered epidermis
elongates slightly along the proximal-distal direction and forms the definitive scale ridge. The definitive
scale ridge continues to elongate and gives rise to overlapping chick scales
10
. The inter-placode region
epidermis generates placode cells, which become the outer surface of the definitive scale ridge
10
.

6

Epithelial structures of the skin demonstrate remarkable morphogenic plasticity during early embryonic
development (E7 feather and E9 scale). While signaling from both the epithelium and dermis are
required for skin formation, recombination experiments demonstrated that the feather/scale patterning
on skin epidermis is highly dependent on dermis, suggesting that developmental decisions result from
dermal signaling
11-13
. The molecular mechanisms controlling embryonic feather and scale skin
specification are not fully understood yet. Here we use RNA-seq to analyze genes differentially
expressed in feather forming skin versus scale forming skin at different development stages, trying to
identify key factors during this process. At the later stage (E9 feather and E11 scale) we are looking at,
the epithelium plasticity declines and gains regional specificity. The genes that show up are more likely
to be involved in differentiation. We examine their expression pattern by in situ hybridization to make a
conjecture about the possible functions they may have. Then we created pseudo-transgenic chickens
with RCAS, an avian specific retrovirus to verify the effects of our candidate genes.

The data show that Sox18 is mainly in the mesenchyme at short bud stage and Ascl4 in epithelium of the
scutate scale on E11, which is consistent with the prediction made by RNA-seq. Snai2 is abundant in
distal limbs on E7. Rspo1 has a peculiar pattern in the interbud regions at distal wing on E9.

Materials and Methods
Embryos
All the chicken eggs were incubated in 38.5 ℃ incubator. Chicken embryos were staged
14
before use.
Charles River pathogen-free eggs were used in virus experiments while local farm eggs for other
purposes.
7

Primer Design
NCBI primer design tools were used to design and blast primers. The promoter sequence of T7 and T3
RNA polymerase were added to the 5’ end of antisense primer and sense primer respectively.
Probes
Selected genes were cloned from chicken embryonic cDNA using primers with T7 or T3 promoter
sequence. The purified PCR products were transcribed with T7 RNA polymerase for antisense probe, or
T3 RNA polymerase for sense probe. The probes were labeled with digoxigenin.
Sample Processing
Local farm chicken embryos were collected at different developmental stages. The samples were fixed in
4% paraformaldehyde (PFA) at 4 ℃ overnight. The embryo samples then went through sequential
dehydration in 25%, 50%, 75%, and 100% methanol. Dehydrated samples were stored at -20 ℃.
Whole mount in situ Hybridization
Whole mount samples were rehydrated in 75%, 50%, 25% methanol and PBS for one hour each. Sample
pre-treatment include 3% H
2
O
2
, 20µg/mL Proteinase K, and 0.25% glutaraldehyde in 4% PFA solution.
The samples were normalized in hybridization buffer, and then incubated with digoxigenin-labeled
probe at 65 ℃ overnight. The samples were washed with 2X SSC, 0.2X SSC and PBT buffer before they
were blocked with 20% heat inactivated goat serum. Antibody against digoxigenin is then applied at 4 ℃
overnight. The samples were washed with PBT and NTMT (100mMNaCl, 100mMTris-HCl, 50mMMgCl
2
,
and 0.1% Tween 20). NBT/BCIP substrates were used for color development. When the desired signal
intensity was reached, the samples were washed with PBS to stop the reaction.

8

Culturing Chicken Embryonic Fibroblasts
DF-1 chicken embryo fibroblasts were thawed from liquid nitrogen, plated on 10cm plates and cultured
in DMEM with 10% bovine serum and 2% chicken serum. Cells were kept in a 37 ℃ incubator with 5%
CO
2
. DF-1 cells were passaged 1:4 when they were confluent.
Virus Collection
Once DF-1 cells reached 70% confluence they were transfected with RCAS vectors. They were passaged
at 1:4 when confluent. The culture media was changed to DMEM with 2% bovine serum and 0.2%
chicken serum. Every 24 hours for 72 hours, the media was collected, filtered through 0.45µm filter and
ultracentrifuged at 26,000 g. The supernatant was removed from the pellet. 200µl DMEM was added to
the pellet. Then they were mixed thoroughly and stored in 40µl aliquots at -80 ℃.
Virus Injection
40µl virus aliquot was thawed at 37 ℃ and mixed with 5 µl FastGreen. Approximately 5 µl virus was
injected into E3 chicken embryo.
Virus tittering
DF-1 cells were seeded on Millicell 8-well glass and infected with virus on the next day. Virus was diluted
at 10
-4
, 10
-5
and 10
-6
, representing 10
7
, 10
8
, 10
9
infectious unit (IU)/ml respectively. After 48 hours
incubation, cells were fixed with 4% PFA and treated with H
2
O
2
to inactivate endogenous hydrogen
peroxide. Primary antibody against viral protein was applied. The ABC Elite kit and AEC kit were used for
signal amplification and staining. The semi-quantitative method shows the range of virus titer.

9

Immunohistochemistry(IHC)
The virus infected embryos were collected at E9. They were fixed in 4% PFA, dehydrated and rehydrated
through a methanol series. They were then blocked with 20% goat serum and treated with primary
antibody against viral protein at 4 ℃ overnight. The samples were incubated with biotin-linked
secondary antibody and streptavidin-horseradish peroxidase. The AEC kit was applied for color
development.

Results
1.Genes selected from RNA-seq
To compare genes differentially expressed during feather and scale development, RNA-seq was
performed on skin samples from the chicken back and leg, the feather forming and scale forming area,
respectively. The morphogenesis of chicken feathers and scales begin at different embryonic ages.
Therefore, to use equivalent stages of appendage development we used different ages to represent the
beginning and later stages of morphogenesis. Feather development begins on embryonic day 7 (E7)and
scale starts on E9. The feather development stage we are looking at is E9, with E11 scale as its
counterpart. The RNA-seq and data analysis was carried out by Dr. Wu and Dr. Lai. We set several
parameters to select genes for in situ hybridization. The conditions include fold change >2.0, or fold
change <0.3, Max. RPKM>30, min. RPKM>10, ANOVA, P value with FDR correction < 0.05
15, 16
. (Table 1
Genes selected from RNA-seq)
Gene Origin Fold change Max. PRKM Min. PRKM P value
Sox18 E9 feather mesenchyme 9.06 75.64 7.40 0.01
10

Snai2 E9 feather mesenchyme 2.43 242.09 89.06 0.02
Rspo1 E11 scale mesenchyme 0.30 57.11 16.18 0.01
Ascl4 E11 scale epithelium 0.15 64.11 N/A 0.04
Table 1. Genes selected from RNA-seq

2.Molecular expression pattern in embryonic chicken skin
Gene expression pattern can imply its functions. To get a hint of what role the selected gene products
may play during feather/scale development, we first mapped the distribution of their RNAs. This was
done by designing probes against their mRNA and performing whole mount in situ hybridization (Table 2
Whole Mount in situ Hybridization primers and RCAS virus cloning primers). Although the initial screen
was performed on E9 feathers and E11 scales, we performed in situ hybridization on E7, E9 and E11
feathers and scales to more completely document their expression. To further illustrate the expression
pattern within feather bud, dorsal skin of whole mount samples were sectioned.
Gene Forward primer Backward primer
Sox18 AATTAACCCTCACTAAAGGGAGAACTATGGCTTGCCAACTCCC

TAATACGACTCACTATAGGGAGAGGCGGATATCAAGCTGCTCT

Snai2 AATTAACCCTCACTAAAGGGAGACCCAGTCCCTATCATACCGC

TAATACGACTCACTATAGGGAGATGTGCCCTTGAAGTAGCCAG

Rspo1 AATTAACCCTCACTAAAGGGAGAGCAGCTTGGACTGTTTGTGG

TAATACGACTCACTATAGGGAGAAGCCACACAGCTTCCTCTTC

Ascl4 AATTAACCCTCACTAAAGGGAGATTGCATTTGCAGGAGCGATG

TAATACGACTCACTATAGGGAGATGTAGGGGGATGAGGCTGAG

Sox18-FL-RCAS GGGGACAAGTTTGTACAAAAAAGCAGGCTTCACCATGAATATA
TCTGAGTCAAACTAC

GGGGACCACTTTGTACAAGAAAGCTGGGTCCTAGCCGGTGATGC
ATGGGCT

11

Sox18-PT-1-
RCAS
GGGGACAAGTTTGTACAAAAAAGCAGGCTTCACCATGAATATA
TCTGAGTCAAACTAC

GGGGACCACTTTGTACAAGAAAGCTGGGTCCTAGTGGTGACTCA
TGCTGAAGT

Sox18-PT-2-
RCAS
GGGGACAAGTTTGTACAAAAAAGCAGGCTTCACCATGAATATA
TCTGAGTCAAACTAC

GGGGACCACTTTGTACAAGAAAGCTGGGTCCTAGACATCTCGGG
AGTTGGCAA

Sox18-PT-2-
RCAS
GGGGACAAGTTTGTACAAAAAAGCAGGCTTCACCATGAATATA
TCTGAGTCAAACTAC

GGGGACCACTTTGTACAAGAAAGCTGGGTCCTAGGCTCGGTCTG
TTCCAAGAC

Sox18-NT-
RCAS
GGGGACAAGTTTGTACAAAAAAGCAGGCTTCACCATGAATATA
TCTGAGTCAAACTAC

GGGGACCACTTTGTACAAGAAAGCTGGGTCCTATCTTGATTTTCT
TGGCTTGC

Ascl4-RCAS GGGGACAAGTTTGTACAAAAAAGCAGGCTTCACCATGGGGGTT
CCCCTGAGAGAACCC

GGGGACCACTTTGTACAAGAAAGCTGGGTCCTAGCTACCCACCT
CCTCAAA

Table 2. Whole Mount in situ Hybridization primers and RCAS virus cloning primers
Sox18
The RNA expression of Sox18 is both stage dependent and region specific. There is faint signal on the
potential bud regions on E7. On E9, Sox18 is exclusively expressed on feather buds. In regions with
longer feather buds, the signal is stronger. For individual feather buds, Sox18 is mainly expressed in the
mesenchyme as assessed by whole mount in situ hybridization. On E11, Sox18 can still be seen on the
feather, only with a weaker signal. The longer buds show staining at their base while shorter buds
demonstrate signal all over the bud mesenchyme, just like on E9.At a single bud level, Sox18 is present
at the early stage of bud development. The signal goes away as feather bud grow longer. This transient
expression fashion is consistent with a previous study of Sox18 on mice vasculature and hair follicle
development
17
(Figure 2-a).
12

The sections show Sox18’s presence as early as pre-placode stage. In feather placode, Sox18 is in
epidermis. The signal is stronger in inte-placode regions compared with placode. When it comes to
feather bud stage, Sox18 is intensively expressed in epidermal-mesenchyme boarder, especially the
posterior side. There is staining in the outer layer of epidermis as well. The long bud has Sox18 in
epidermis mainly and a little in the underlying dermis (Figure 3, 4).
Snai2
The expression level of Snai2 is particularly high in distal limbs (both forelimb and hind limb) on E7.
Although Snai2 is detected on the skin, it basically depicts the edge of the digit bone. On E9, Snai2 is
expressed on feather bud mesenchyme and not on scale. AtE11, Snai2 expression is still in feather bud
mesenchyme. The signal is present in short feather buds while absent in longer ones (Figure 2-b).
Sections reveal Snai2’s expression at both pre-placode and placode stages. In the placode stage, the
level is higher in the placode than inter-placode. At later stages, Snai2 is in the feather bud, both
epithelium and mesenchyme (Figure 3, 4).
Rspo1
Rspo1 shows interesting regional patterns during feather morphogenesis. It is absent on E7. On E9, the
gene is expressed at inter-bud regions on the distal wing. It forms a ring shape pattern due to the
absence of gene expression on the central bud. The “rings” show up at the wing tip and end right before
the carpal joint. On E11, the gene is no longer expressed on the feather forming region. The signal is at
the inter-scale region. It outlines the shape of individual scales on the leg. The expression patterns of
Rspo1 indicate its involvement in boundary formation (Figure 2-c). Sections of the whole mount sample
are consistent with the overall staining pattern. Rspo1 is present in inter-placode region on E7. In
feather buds, there is slight expression in the epithelium (Figure 3, 4).
13

Ascl4
On E7 Ascl4 is present on the dorsal tract and thigh. There is no staining on the scale forming region. On
E9, Ascl4 expression is detected on both feather buds and scales. A closer examination reveals that Ascl4
is on the epithelial layer of the feather bud tip. It also stains the scutate scales. When it comes to E11,
Ascl4 is mainly expressed on the scutate scales. Feather buds on the lower thigh, the transition area
between feathers and scales, are also stained (Figure 2-d). Ascl4 sections show its expression in
epithelium at the pre-placode stage. At the placode stage, Ascl4 is densely expressed in the placode.
Then in feather buds, Ascl4 is only expressed in the epithelium layer (Figure 3, 4).

3.Functional study of Sox18 and Ascl4
Sox18 is characterized by a HMG DNA binding domain and a C-terminal transcription tran-activation
domain
18
. The mutations in Sox18 are the underlying cause of profound cardiovascular and hair follicle
defects in ragged (Ra) mice
5,19
.The mutations introduce missense coding in the ORF region, which lead
to premature truncation in the trans-activation domain of the protein product. The mice, depending on
the specific mutation site, show thin, compromised guard hairs and pelage hairs. The detailed
histological study demonstrates their reduced hair follicle number as well as arrested follicle
development. Sox18 knockout mice, however, are viable and display a mild coat defect
20
. The
contrasting phenotypes of Ra and Sox18
-/-
mice indicate that mutant SOX18 protein in Ra mice acts in a
trans-dominant-negative manner, interfering with other functionally redundant SOXF subfamily
proteins( which include Sox7, Sox17 and Sox18)
21
. SOX18 mutations in humans cause hypotrichosis-
lymphedema-telangiectasia, suggesting SOX18’s role in the development and maintenance of blood
vessels, hair and lymphatic vessels
22
. The early onset of hypotrichosis is present in all Sox18 mutation
14

patients, with an absence of eyelashes and eyebrows. The mutated forms mirror the mice Sox18
mutation, lacking part of its trans-activation domain
19
.
The chicken Sox18 amino acids show 51% homology to mouse Sox18. The trans-activation domain
shows 62% homology. Based on the similarity between chicken and mouse Sox18, we designed an avian
specific RCAS viral vector carrying 4 dominant negative forms of chicken Sox18 to disrupt Sox18
function. The first construct, Sox18-NT lacks the trans-activation domain completely. The other three,
Sox18-PT-1, Sox18-PT-2, and Sox18-PT-3, each have a portion of the trans-activation domain. With a
complete HMG DNA binding domain, they can bind to DNA like normal transcription factors. Absence of
the trans-activation domain then prohibits their interaction with other factors that might play a role in
feather morphogenesis. The truncated Sox18 should compete with endogenous Sox18 for binding to
DNA. Hence, it should act in a dominant-negative capacity. The severity of phenotype in mice differs
depending on the levels of competition and the ability of endogenous levels to function
23
. To investigate
the behavior of chicken Sox18, Sox18-PT-1, Sox18-PT-2, and Sox18-PT-3 are designed to mimic naturally
occurring mouse Sox18 mutations. What would be expected is that the injection of dominant negative
virus would cause compromised feather development in chicken embryos. The possibly different
outcomes from mis-expressing the four constructs can indicate which region of the trans-activation
domain plays a bigger role here. (Figure 5, natural mutant and dominant negative design)
Ascl4 is mainly expressed on the scale of E11 embryos. To understand the function of Ascl4, we
overexpressed Ascl4 in the feather forming region of the limb bud. If Ascl4 functions to direct scale
development, then ectopic expression of Ascl4 will disrupt feather development and convert it into a
scale like structure.
The RCAS virus was made and titered. The virus titer is higher than 10
9
, which should be enough to
infect tissue. Pathogen free embryos were injected with RCAS on E3, and harvested on E9. Antibody
15

against viral protein was applied on virus infected embryos to show successful infection (Figure4.Virus
infected embryos). We also did whole mount in situ hybridization to verify abnormal gene expression
(Figure4. Virus infected embryos).
For Sox18-NT infected embryos, there’s no obvious phenotype. Viral protein staining is positive all over
the body yet the in situ hybridization shows a similar pattern with control embryo staining. Ascl4 over-
expression embryos have viral staining as well. The in situ hybridization of Ascl4 is in patch-like fashion.
Feather buds are all well stained while only part of interbud region is stained. The feather buds are of
normal size and shape, leaving a question mark in the roles Ascl4 play during scale morphogenesis.

Discussion
Chicken skin regional specificity is a grand topic. There are multiple layers which may contribute to the
mechanism (genetics, epigenetic, etc) involved to determine whether feathers of scales should be
formed in certain regions. To reproduce the whole symphony orchestrated by nature might be
ambitious. This project is a small portion of the big picture. Here we used RNA-seq to compare genes
that are differentially expressed at a later development stage of feather/scale morphogenesis, trying to
identify candidate genes for further study. In order to characterize them at different stages, we did in
situ hybridization at E7, E9 and E11 respectively. For Sox18 and Ascl4, we tried to manipulate their
expression level by RCAS virus.
Sox18 belongs to a large Sox family of transcription factors. In mice, Sox18 expression is consistently
and transiently related to sites of developing vasculature
17, 24
. Expression is reactivated during adult
neovascularization associated with wound healing
25
. Sox18 is expressed in the mesenchyme subjacent
to the epithelial follicle placode at 14 d.p.c., and persists in mesenchymal cells surrounding the
16

invaginating epithelium till birth
5
. Chicken Sox18hasrevealed a transient pattern of endothelial
expression equivalent to that seen in the mouse embryos. Strong expression of chicken SOX18 was
observed in the developing feather buds across the entire embryo. Chicken Sox18 expression is
associated with the internal and underlying undifferentiated mesenchymal cells
26
. Our in situ
hybridization is consistent with previous literature as well as RNA-seq. Chicken Sox18 emerges on E9 and
gradually disappear as feather buds develop. The temporal pattern indicates that Sox18 may work as a
molecular switch as it does in mouse lymphatic vasculature
27
to induce organ (in this case, feather bud)
development. The functional study doesn’t fit the original hypothesis well. Since the in situ hybridization
after viral infection is not satisfactory; there is still room to improve the viral injection technique and
titering.

Snai2 is a member of the Snail family of zinc-finger transcription factors. Snail genes are best known for
inducing a phenotypic change, the so-called epithelial-mesenchymal transition (EMT)
28
. Snai1-induced
EMT converts epithelial cells into mesenchymal cells with migratory properties that contribute to the
formation of many tissues during embryonic development and to the acquisition of invasive properties
in epithelial tumors
29
. Based on RNA-seq, it should be located in feather mesenchyme. The actual
presence of Snai2 there implies its mesodermal origin. Why it is expressed along the digit bone is not
known yet.

Roof plate-specific spondin (R-spondin) proteins have conserved cysteine-rich furin-like and
thrombospondin domains
30, 31
.R-spondins activate the canonical WNT signaling pathway, which plays a
key role in cell proliferation, differentiation, and embryonic morphogenesis
32
. R-spondins interact with
membrane receptors like lipoprotein receptor-related protein 5 (LRP5) and LRP6, Frizzled 8, and
RNF43/ZNRF3
33, 34
. R-spondins were also reported to bind to the orphan receptors, LGR4 and LGR5, to
17

mediate R-spondin-induced β-catenin signaling pathways
35
.R-spondin1 was identified as a gene
expressed in the developing neural tube, especially in boundary regions between roof plate and
neuroepithelium
36
. The “ring” shape pattern on wing feather is consistent with the boundary defining
role. It keeps individual feather buds separate from each other. The fact that Rspo1 expression only
exists on the distal wing is truly intriguing. It is possible that different regions have their own way of
drawing borders. There’s no significant expression detected on E9 feather mesenchyme from the RNA-
seq data. It’s possible that its expression is limited to the distal wing. However, RNA-seq was performed
on the whole embryonic skin and its expression level may be averaged out. It also has been shown that
injection of human R-spondin1 into mice demonstrated a proliferative effect on intestinal epithelial
crypt cells
37
. If Rspo1 also has proliferative effect on chicken skin, it may contradict the fact that it exists
on interbud regions. However, there could be other mechanisms to promote cell migration from the
interbud region into feather buds. The interbud region may also provide cell sources for bud elongation.

The achaete-scute complex (AS-C) is a group of four genes (achaete, scute, lethal of scute, and asense) in
the Drosophila. These genes encode basic helix-loop-helix transcription factors that have been best
studied in their regulation of nervous system development. However, the AS-C has non-proneural
functions, such as specifying muscle and gut progenitors
38
. Homologues of AS-C in other animals,
including humans and other vertebrates, have similar functions. Genes of the AS-C interact with
the Notch pathway in both their proneural functions as well as their specification of gut and muscle
cells.Ascl4 has been found in human fetal skin
39
.Ascl4 is expressed in scale epithelium as indicated by
RNA-seq data. The increased expression level from E9 to E11 implies that it is constantly required for
scale development. The over-expression in the feather forming region doesn’t have an obvious effect,
possibly due to unsuccessful RCAS infection.

18

The in situ hybridization data show that Sox18 expression is both region specific and stage dependent. It
is intensely expressed in feather bud mesenchyme on E9, the bud stage. The signal level in scale area is
basically beneath detection. Snai2 is in the mesenchyme of distal limb along the digit bone on E7. Rspo1
appears at the interbud region of wing on E9. Ascl4 is expressed on the feather from E7 to E9, and on
the scale from E9 to E11. It is present at the earlier stage of feather development. The expression level
of Ascl4 increase on the scale as time goes by. The attempt to disrupt Sox18 and Ascl4 function with
RCAS virus hasn’t been successful. The possible reason would be failed virus delivery or inaccurate virus
titering.

Future Directions
The current functional data needs to be repeated. Ideally, virus staining should be positive only at the
site of injection, which is the right forelimb in this scenario. In fact the viral staining in both Sox18-NT
and Ascl4 over-expression embryos is all over the body, indicating its diffusion into circulation. The
scattered viral injection not only decreased the infection efficiency but also minimized the distinction at
different body regions. Forelimb bud at E3 is so tiny that it is pretty difficult to target precisely. What can
be done here is to inject in dorsal areas, where skin is well formed and easy to find. The blood vessel
along the spinal cord is visible and thus can be avoided if one is careful.

Virus titering is another technical issue that can be fixed. High titer virus is a prerequisite to successful
infection. Although viral staining shows infection at some level, ascertaining the virus titer is necessary
to prove the desired efficiency of infection.

19

Figure1. Chicken feather development
Feather skin development starts with tract formation. Periodic patterning established within those tracts
divide skin into bud and interbud regions. Feather bud precursors form as the circular cluster of
epithelial placode cells proliferate along with underlying dermal cells. Later, anterior-posterior polarity
emerges and leads to bud elongation in the rostral- caudal direction. Epithelial cell proliferation in the
feather bud is a major factor that contributes to elongation. The proliferating region shifts proximally as
growth progress. The feather bud epithelium then wraps around the dermal papilla and invaginates into
the underlying mesenchyme to form the feather follicle.

20

Figure 2-a. Whole mount in situ hybridization-Sox18
Sox18 is mainly expressed in the feather bud. Each scale bar represents 200mm, except the third lane,
which represents 100mm.
21

Figure 2-b. Whole mount in situ hybridization-Snai2
Each scale bar represents 200mm, except the third lane, which represents 100mm.

22

Figure 2-c. Whole mount in situ hybridization-Rspo1
Each scale bar represents 200mm, except the third lane, which represents 100mm.

23

Figure 2-d. Whole mount in situ hybridization-Ascl4
Each scale bar represents 200mm, except the third lane, which represents 100mm.

24

Figure3. Section of whole mount in situ hybridization

The scale bar represents 0.1mm.

25

Figure 4. Schematic drawing of sections

26

Figure5. Natural mutant and dominant negative design

27

Figure6-a. IHC and ISH of virus infected chicken embryos-Sox18
Each scale bar represents 200mm.

28

Figure6-b. IHC and ISH of virus infected chicken embryos-Ascl4
Each scale bar represents 200mm, except the third lane, which represents 100mm.

29

Reference
[1] Prin F, Dhouailly D: How and when the regional competence of chick epidermis is established:
feathers vs. scutate and reticulate scales, a problem en route to a solution. The International journal of
developmental biology 2004, 48:137-48.
[2] Chuong CM: Homeobox genes, fetal wound healing, and skin regional specificity. The Journal of
investigative dermatology 2003, 120:9-11.
[3] Chang KW, Huang NA, Liu IH, Wang YH, Wu P, Tseng YT, Hughes MW, Jiang TX, Tsai MH, Chen CY,
Oyang YJ, Lin EC, Chuong CM, Lin SP: Emergence of differentially regulated pathways associated with the
development of regional specificity in chicken skin. BMC genomics 2015, 16:22.
[4] Lin CM, Jiang TX, Widelitz RB, Chuong CM: Molecular signaling in feather morphogenesis. Current
opinion in cell biology 2006, 18:730-41.
[5] Sengel P, Mauger A: Peridermal cell patterning in the feather-forming skin of the chick embryo.
Developmental biology 1976, 51:166-71.
[6] Noramly S, Morgan BA: BMPs mediate lateral inhibition at successive stages in feather tract
development. Development 1998, 125:3775-87.
[7] McKinnell IW, Turmaine M, Patel K: Sonic Hedgehog functions by localizing the region of proliferation
in early developing feather buds. Developmental biology 2004, 272:76-88.
[8] Chen CF, Foley J, Tang PC, Li A, Jiang TX, Wu P, Widelitz RB, Chuong CM: Development, regeneration,
and evolution of feathers. Annual review of animal biosciences 2015, 3:169-95.
[9] Sawyer RH, Knapp LW: Avian skin development and the evolutionary origin of feathers. Journal of
experimental zoology Part B, Molecular and developmental evolution 2003, 298:57-72.
[10] Sawyer RH, Abbott UK: Defective histogenesis and morphogenesis in the anterior shank skin of the
scaleless mutant. The Journal of experimental zoology 1972, 181:99-110.
30

[11] Rawles ME: Tissue Interactions in Scale and Feather Development as Studied in Dermal-Epidermal
Recombinations. Journal of embryology and experimental morphology 1963, 11:765-89.
[12] Hughes MW, Wu P, Jiang TX, Lin SJ, Dong CY, Li A, Hsieh FJ, Widelitz RB, Chuong CM: In search of the
Golden Fleece: unraveling principles of morphogenesis by studying the integrative biology of skin
appendages. Integrative biology : quantitative biosciences from nano to macro 2011, 3:388-407.
[13] Dhouailly D: Dermo-epidermal interactions between birds and mammals: differentiation of
cutaneous appendages. Journal of embryology and experimental morphology 1973, 30:587-603.
[14] Hamburger V, Hamilton HL: A series of normal stages in the development of the chick embryo.
Journal of morphology 1951, 88:49-92.
[15] Hackett NR, Butler MW, Shaykhiev R, Salit J, Omberg L, Rodriguez-Flores JL, Mezey JG, Strulovici-
Barel Y, Wang G, Didon L, Crystal RG: RNA-Seq quantification of the human small airway epithelium
transcriptome. BMC genomics 2012, 13:82.
[16] Seyednasrollah F, Laiho A, Elo LL: Comparison of software packages for detecting differential
expression in RNA-seq studies. Briefings in bioinformatics 2015, 16:59-70.
[17] Pennisi D, Gardner J, Chambers D, Hosking B, Peters J, Muscat G, Abbott C, Koopman P: Mutations
in Sox18 underlie cardiovascular and hair follicle defects in ragged mice. Nature genetics 2000, 24:434-7.
[18] Wegner M: From head to toes: the multiple facets of Sox proteins. Nucleic acids research 1999,
27:1409-20.
[19] Downes M, Francois M, Ferguson C, Parton RG, Koopman P: Vascular defects in a mouse model of
hypotrichosis-lymphedema-telangiectasia syndrome indicate a role for SOX18 in blood vessel
maturation. Human molecular genetics 2009, 18:2839-50.
[20] Pennisi D, Bowles J, Nagy A, Muscat G, Koopman P: Mice null for sox18 are viable and display a mild
coat defect. Molecular and cellular biology 2000, 20:9331-6.
31

[21] Milivojevic M, Petrovic I, Kovacevic-Grujicic N, Popovic J, Mojsin M, Stevanovic M: Construction and
functional analysis of novel dominant-negative mutant of human SOX18 protein. Biochemistry
Biokhimiia 2013, 78:1287-92.
[22] Irrthum A, Devriendt K, Chitayat D, Matthijs G, Glade C, Steijlen PM, Fryns JP, Van Steensel MA,
Vikkula M: Mutations in the transcription factor gene SOX18 underlie recessive and dominant forms of
hypotrichosis-lymphedema-telangiectasia. American journal of human genetics 2003, 72:1470-8.
[23] James K, Hosking B, Gardner J, Muscat GE, Koopman P: Sox18 mutations in the ragged mouse alleles
ragged-like and opossum. Genesis 2003, 36:1-6.
[24] Downes M, Koopman P: SOX18 and the transcriptional regulation of blood vessel development.
Trends in cardiovascular medicine 2001, 11:318-24.
[25] Darby IA, Bisucci T, Raghoenath S, Olsson J, Muscat GE, Koopman P: Sox18 is transiently expressed
during angiogenesis in granulation tissue of skin wounds with an identical expression pattern to Flk-1
mRNA. Laboratory investigation; a journal of technical methods and pathology 2001, 81:937-43.
[26] Olsson JE, Kamachi Y, Penning S, Muscat GE, Kondoh H, Koopman P: Sox18 expression in blood
vessels and feather buds during chicken embryogenesis. Gene 2001, 271:151-8.
[27] Francois M, Caprini A, Hosking B, Orsenigo F, Wilhelm D, Browne C, Paavonen K, Karnezis T, Shayan
R, Downes M, Davidson T, Tutt D, Cheah KS, Stacker SA, Muscat GE, Achen MG, Dejana E, Koopman P:
Sox18 induces development of the lymphatic vasculature in mice. Nature 2008, 456:643-7.
[28] Savagner P, Yamada KM, Thiery JP: The zinc-finger protein slug causes desmosome dissociation, an
initial and necessary step for growth factor-induced epithelial-mesenchymal transition. The Journal of
cell biology 1997, 137:1403-19.
[29] Cobaleda C, Perez-Caro M, Vicente-Duenas C, Sanchez-Garcia I: Function of the zinc-finger
transcription factor SNAI2 in cancer and development. Annual review of genetics 2007, 41:41-61.
32

[30] Kamata T, Katsube K, Michikawa M, Yamada M, Takada S, Mizusawa H: R-spondin, a novel gene
with thrombospondin type 1 domain, was expressed in the dorsal neural tube and affected in Wnts
mutants. Biochimica et biophysica acta 2004, 1676:51-62.
[31] Yoon JK, Lee JS: Cellular signaling and biological functions of R-spondins. Cellular signalling 2012,
24:369-77.
[32] Kim KA, Wagle M, Tran K, Zhan X, Dixon MA, Liu S, Gros D, Korver W, Yonkovich S, Tomasevic N,
Binnerts M, Abo A: R-Spondin family members regulate the Wnt pathway by a common mechanism.
Molecular biology of the cell 2008, 19:2588-96.
[33] Nam JS, Turcotte TJ, Smith PF, Choi S, Yoon JK: Mouse cristin/R-spondin family proteins are novel
ligands for the Frizzled 8 and LRP6 receptors and activate beta-catenin-dependent gene expression. The
Journal of biological chemistry 2006, 281:13247-57.
[34] Hao HX, Xie Y, Zhang Y, Charlat O, Oster E, Avello M, Lei H, Mickanin C, Liu D, Ruffner H, Mao X, Ma
Q, Zamponi R, Bouwmeester T, Finan PM, Kirschner MW, Porter JA, Serluca FC, Cong F: ZNRF3 promotes
Wnt receptor turnover in an R-spondin-sensitive manner. Nature 2012, 485:195-200.
[35] Carmon KS, Gong X, Lin Q, Thomas A, Liu Q: R-spondins function as ligands of the orphan receptors
LGR4 and LGR5 to regulate Wnt/beta-catenin signaling. Proceedings of the National Academy of
Sciences of the United States of America 2011, 108:11452-7.
[36] Knight MN, Hankenson KD: R-spondins: novel matricellular regulators of the skeleton. Matrix
biology : journal of the International Society for Matrix Biology 2014, 37:157-61.
[37] Zhao J, Kim KA, De Vera J, Palencia S, Wagle M, Abo A: R-Spondin1 protects mice from
chemotherapy or radiation-induced oral mucositis through the canonical Wnt/beta-catenin pathway.
Proceedings of the National Academy of Sciences of the United States of America 2009, 106:2331-6.
[38] Garcia-Bellido A, de Celis JF: The complex tale of the achaete-scute complex: a paradigmatic case in
the analysis of gene organization and function during development. Genetics 2009, 182:631-9.
33

[39] Jonsson M, Bjorntorp Mark E, Brantsing C, Brandner JM, Lindahl A, Asp J: Hash4, a novel human
achaete-scute homologue found in fetal skin. Genomics 2004, 84:859-66.

Abstract (if available)

Abstract Skin regional specificity allows for the effective use of the animal integumentary surface. Chickens show high diversity of skin regional specificity. Feathers and scales in particular are easily distinguished and are distributed in a characteristic pattern. We use chicken feathers and scales as a model system to study molecular aspects of regional specificity during skin embryonic development. Genes differentially expressed in those two regions are profiled by RNA-seq. A subset of these genes were chosen and characterized here as part of a larger project. Whole mount in situ hybridization is then applied to show the gene expression pattern on embryos of different stages. Sox18, a transcription factor, is exclusively expressed on feather buds at E9. Mutated Sox18 has been shown to act in a dominant negative way to cause severe hair follicle defects in mice and humans. Sox18 RCAS vectors are constructed to either over-express or knock-down Sox18 in chicken skin mesenchyme. Ascl4 is mainly expressed in scale region at a E11. It was injected in the feather forming region to validate its determinant role in scale morphogenesis. Rspo1 is exclusively expressed at distal wing interbud region on E9. It may be involved in bud boundary formation. Snai2 is present along the digit bone at early stage and then in feather bud mesenchyme all over the body on E9.

Linked assets

University of Southern California Dissertations and Theses

Conceptually similar

PDF

Roles of Hox B genes in the development of chicken skin

PDF

Exploring the molecular and cellular underpinnings of organ polarization using feather as the model system

PDF

Epigenetic and genetic reprogramming during embryonic chicken feather bud morphogenesis, hair morphogenesis, and de novo hair regeneration

PDF

The role of insulin-like growth factors in size regulation during embryonic feather development

PDF

Implications of constitutively active bone morphogenetic protein (BMP) signaling in skin morphogenesis and skin postnatal homeostasis

PDF

Shifting topology of stem cells and molecular expression during feather regenerative cycling

PDF

Characterizing the role of Dnmt1 and its downstream factors in progressive alopecia

PDF

Canonical and non-canonical Wnt signaling in the patterning of multipotent stem cells during feather development

PDF

Connexins in feather morphogenesis

PDF

Skin appendage growth control by hormones and morphogens

PDF

Constitutively active canonical BMP signaling in the apical ectodermal ridge disrupts dorsal-ventral and anterior-posterior axes resulting in impaired development of the distal (autopod) limb domain

PDF

Regulation of matrix metalloproteinase-9 in cutaneous wound healing

PDF

Adaptive patterning during skin formation: assembly of vasculature and adipose tissue

PDF

The mechanisms for skin regional specificity determination

PDF

The role of Prkci in stem cell maintenance and cell polarity using a 3-D culture system

PDF

Bone marrow-derived mesenchymal stromal cells in the tumor microenvironment of neuroblastoma

PDF

Characterization of the progenitor cell zone in feather follicles

PDF

Macroenvironmental regulation of hair follicle stem cells

PDF

Insights from mouse models on the origin of ovarian cancer and its predisposing mechanisms

PDF

Tissue interactions & molecular pathways in specification of the ectomesenchyme from cranial neural crest

Asset Metadata

Creator Jiang, Xueyuan (author)

Core Title Molecular aspects of skin early morphogenesis

School Keck School of Medicine

Degree Master of Science

Degree Program Experimental and Molecular Pathology

Publication Date 07/23/2015

Defense Date 06/11/2015

Publisher University of Southern California (original), University of Southern California. Libraries (digital)

Tag chicken,embryonic morphogenesis,feather,OAI-PMH Harvest,skin,Sox18

Format application/pdf (imt)

Language English

Contributor Electronically uploaded by the author (provenance)

Advisor Chuong, Cheng-Ming (committee chair), Maxson, Robert E., Jr. (committee member), Widelitz, Randall B. (committee member)

Creator Email jiangxysharon@gmail.com,xueyuanj@usc.edu

Permanent Link (DOI) https://doi.org/10.25549/usctheses-c3-603983

Unique identifier UC11300114

Identifier etd-JiangXueyu-3683.pdf (filename),usctheses-c3-603983 (legacy record id)

Legacy Identifier etd-JiangXueyu-3683.pdf

Dmrecord 603983

Document Type Thesis

Format application/pdf (imt)

Rights Jiang, Xueyuan

Type texts

Source University of Southern California (contributing entity), University of Southern California Dissertations and Theses (collection)

Access Conditions The author retains rights to his/her dissertation, thesis or other graduate work according to U.S. copyright law. Electronic access is being provided by the USC Libraries in agreement with the a...

Repository Name University of Southern California Digital Library

Repository Location USC Digital Library, University of Southern California, University Park Campus MC 2810, 3434 South Grand Avenue, 2nd Floor, Los Angeles, California 90089-2810, USA