University of Southern California Dissertations and Theses

Regulation of acute KSHV infection by SIRT1

(USC Thesis Other)

Regulation of acute KSHV infection by SIRT1

PDF

Download a page range

Download transcript

Copy asset link

Request this asset

Transcript (if available)

Content 1 | P a g e

Regulation of acute KSHV infection by SIRT1

By

Tanvee Vinod Sawant

A Thesis Presented to the
FACULTY OF THE USC GRADUATE SCHOOL
UNIVERSITY OF SOUTHERN CALIFORNIA
In Partial Fulfillment of the
Requirements for the Degree
MASTER OF SCIENCE
(MOLECULAR MICROBIOLOGY AND IMMUNOLOGY)

AUGUST 2015
2 | P a g e

Acknowledgement

I wish to express sincere thanks to my adviser Dr. Shou-Jiang Gao, for
giving me an opportunity to work in his lab and guiding me through my
research and thesis. Your advice on both research as well as my career has
been very important for me. I would also like to thank my committee
members for their valuable insights and thoughtful suggestions.
Next I would like to thank my lab members for their constant support in
these two years. Also, special thanks to Dr. Fan Cheng and Dr. Suzane
Ramos for investing their valuable time in mentoring me throughout this
journey.
Lastly I would like to thank my family and friends for the unceasing
encouragement, support and attention. Thank You.

3 | P a g e

Contents
Acknowledgement .............................................................................................................. 2
List of tables ........................................................................................................................ 5
List of figures ...................................................................................................................... 6
Abbreviations ...................................................................................................................... 7
Abstract ............................................................................................................................... 8
Introduction ......................................................................................................................... 9
1. Kaposi’s sarcoma associated herpesvirus ............................................................................ 9
1.1 Classification and structure ................................................................................................ 9
2. KSHV life-cycle................................................................................................................. 10
3. KSHV associated malignancies ......................................................................................... 11
3.1 Kaposi’s sarcoma ............................................................................................................. 11
3.2 Primary effusion lymphoma and multicentric Castleman’s disease ................................ 12
4. KS pathogenesis ................................................................................................................. 13
5. Sirtuins ............................................................................................................................... 14
5.1 SIRT1 ............................................................................................................................... 15
Aim of this project ............................................................................................................ 17
Materials and methods ...................................................................................................... 18
1. Antibodies and reagents ..................................................................................................... 18
2. Cell lines and cell culture ................................................................................................... 18
3. Immunofluorescence assay ................................................................................................ 19
4. KSHV virus preparation .................................................................................................... 20
5. RT-qPCR ........................................................................................................................... 20
6. shRNA knock down ........................................................................................................... 21
7. Western blot analysis ......................................................................................................... 22
Results ............................................................................................................................... 23
1. Knock down of SIRT1 suppresses KSHV lytic replication during KSHV primary
infection of HUVEC cells. ......................................................................................................... 23
2. SIRT inhibitor Tenovin-6 decreases viral lytic gene expression as well as infectious
virion production. ....................................................................................................................... 25
4 | P a g e

3. Tenovin-6 has no effect on virus infectivity or virus entry, and trafficking during
primary KSHV infection. ........................................................................................................... 27
4. Transcription factor AP-1 was involved in SIRT1 mediated regulation of KSHV
lytic replication. ......................................................................................................................... 29
Discussion ......................................................................................................................... 31
References ......................................................................................................................... 34

5 | P a g e

List of tables

Table 1: Classification of HDAC. ..................................................................................... 15
Table 2: qPCR Primers. .................................................................................................... 21

6 | P a g e

List of figures

Figure 1 shRNA knock down of SIRT1 in HUVEC and primary KSHV infection. ....... 24
Figure 2 Effect of Tenovin-6 on KSHV lytic gene expression and infectious virion
production. ........................................................................................................................ 26
Figure 3 Effect of Tenovin-6 on KSHV infectivity, entry and trafficking. ..................... 28
Figure 4 AP-1 transcription factor expression in Tenovin-6 treated and SIRT1 knock
down cells. ........................................................................................................................ 30
7 | P a g e

Abbreviations

PBS Phosphate Buffered Saline
HIV Human Immunodeficiency Virus
HBV Hepatitis B Virus
KSHV Kaposi’s Sarcoma-associated Herpesvirus
HDAC Histone Deacetylase
NAD Nicotinamide Adenine Dinucleotide
IFA Immunofluorescence Assay
SIRT Sirtuins
AP-1 Activator Protein 1
8 | P a g e

Abstract

Sirtuin 1 (SIRT1) is a class III histone deacetylase (HDAC) and an important epigenetic
regulator of gene expression and cell proliferation. A recent study investigating SIRT1’s
role in KSHV infection showed its importance in maintenance of viral latency in KSHV-
PEL cells. SIRT1 suppressed the expression of viral lytic gene RTA, which is necessary
and sufficient to reactivate KSHV from latency. This study mainly focused on
understanding the role of SIRT1 during primary KSHV infection and the mechanism by
which it regulates KSHV lytic replication. To investigate the role of SIRT1, we knocked
down SIRT1 gene in primary human umbilical vein endothelial cells (HUVEC) and
observed down-regulation of viral lytic gene expression. These results were further
supported by SIRT inhibitor (Tenovin-6), which also down-regulated viral lytic gene
expression and infectious virion production. To investigate the mechanism by which
SIRT1 regulates KSHV lytic replication, we checked the expression of transcription
factor AP-1; previously described in the transcription of KSHV lytic genes. Both SIRT1
knock down and Tenovin-6 treatment down-regulated the expression levels of c-Fos, a
subunit in AP-1 transcription factor complex during primary KSHV infection. Our results
suggested that, SIRT1 promotes viral lytic replication during primary KSHV infection via
c-Fos. These results indicated a different role of SIRT1 in primary KSHV infection.

9 | P a g e

Introduction

Viruses are obligatory parasites that require host cells for their propagation. They have
evolved to exploit the physiology of host cells for their successful infection and
replication.
1. Kaposi’s sarcoma associated herpesvirus

Kaposi’s sarcoma-associated herpesvirus (KSHV) or Human herpesvirus 8 (HHV8) was
first discovered in 1994, from Kaposi’s sarcoma tissues obtained from acquired
immunodeficiency syndrome (AIDS) patients (Chang Y 1994). They used
representational difference analysis to compare DNA from KS tumor cells and healthy
tissue and found a novel DNA sequence, later confirmed as KSHV.
1.1 Classification and structure

KSHV belongs to the Herpesviridiae family and is further classified as gammaherpes-
virus. It can establish lifelong persistent infection in the host cells. KSHV belongs to the
rhadinovirus genus and has a large double stranded DNA (170-kb) genome. The genome
has centrally placed long unique coding region (LUR), flanked by multiple, non-coding
terminal repeats (Russo JJ 1996). The LUR consists of approximately 90 open reading
frames (ORFs), 12 microRNAs and several ncRNAs (Toth Z 2013). The virus has co-
evolved with its host and has several cellular host genes homologs in its genome. These
viral proteins modulate KSHV oncogenic properties and escape from the host immune
responses.
10 | P a g e

Structurally, the KSHV genome is enclosed in an icosahedral capsid, which is surrounded
with a layer of amorphous proteinaceous matrix called tegument. The outer most layer of
the virus is a lipid bilayer envelope, which is acquired by the virus on its way out from
the host cell. A complete viral particle with capsid and envelope is approximately 150-
200 nm in diameter (Fukumoto H 2011)
2. KSHV life-cycle

Following primary infection, KSHV can undergo two distinct phases of life cycle: lytic
and latent. They are distinguished on the basis of viral DNA replication and gene
expression. During latency, the viral genome is maintained as a circular episome tethered
to the host chromosome by latency-associated nuclear antigen (LANA) (Ballestas ME
1999). The viral protein expression is highly restricted by epigenetic suppression of viral
lytic genes to maintain the viral genome in the dividing cells and to limit host immune
responses (Cai Q 2010). Also, there is no production of new virus. The viral latent genes
are ubiquitously expressed during both lytic and latent phase of virus life cycle and they
mainly consist of LANA, vFLIP (viral FADD-like IL-1β-converting enzyme), vCyclin,
cluster of microRNAs and Kaposin. These latent proteins promote cell growth and
survival and maintain viral latency by host cell transcription remodeling (Mercier A
2014). The virus can be reactivated from its latency to undergo lytic phase of life cycle
by several factors such as hypoxia, pro-inflammatory cytokines and co-infection with
other virus.
The de novo lytic phase of the viral life cycle is characterized by gene expression in a
timely fashion and extensive viral DNA replication. There is a global mRNA shutoff in
11 | P a g e

the host cells, followed by new virus production and host cell death (Covarrubias S
2009). Lytic genes are classified in three groups: immediate-early (IE), early (E) and late
(L) as expressed during KSHV replication. The expression of replication and
transcription activator (RTA) (IE) is necessary and sufficient for KSHV lytic replication,
as it acts as a trans-activator for other lytic genes (Ye F 2011). Early gene ORF59
encodes for viral DNA polymerase, which promotes viral DNA replication. Late genes
such as ORF65 encodes for viral structural proteins and its expression often depends on
viral genome replication (Jenner RG 2001). During reactivation, the epigenetic
suppression of viral lytic genes maintained during latency is removed. This leads to
expression of IE gene RTA followed by viral gene expression as in de novo lytic phase.
3. KSHV associated malignancies

3.1 Kaposi’s sarcoma

Kaposi’s sarcoma (KS) was first described by Moritz Kaposi in 1872, as an aggressive
“idiopathic multiple pigmented sarcomas of the skin”. It is a vascular neoplasm, with
characteristic histological features such as proliferating spindle–shaped tumor
surrounding hyperemic slits with inflammatory cells infiltration (Roth 1992). There are
four clinical forms of KS.
Classical KS is mostly seen in elderly men of Mediterranean and Eastern European
region. It is much more common in men than in women (15:1). Recent studies have
shown that classical KS is ubiquitously associated with high level of inflammation and
oxidative stress caused due to aging (M. 2009).
12 | P a g e

Another clinical form of KS is found to be endemic in Africa. KSHV infection is
common in Africa than other parts of the world. One of the major causes of African
endemic KS is thought to be the high iron exposure from the local soils coupled with bare
foot walking (Simonart T 1998). This is a possible cofactor that induces inflammation
and oxidative stress leading to KS. Another factor that may play a role is the weaken
immune system due to diseases like malaria, chronic infections and malnutrition.
In transplantation-related KS (iatrogenic KS), inflammation and oxidative stress are
common because of immune-suppression and organ rejection (Laubach VE 2009).
Stopping the immunosuppressive drugs help the KS lesions to get smaller and eventually
disappear.
AIDS-related KS (AIDS-KS) is the most common type of KS in United States. AIDS
patients have lower CD4 cells count, so the host has no defense against any pathogen.
Patients suffer from high levels of chronic inflammation and oxidative stress, which
contribute to KSHV establishment and progression of KS (Gil L 2003).
3.2 Primary effusion lymphoma and multicentric Castleman’s disease

KSHV is also associated with two rare lymphoproliferative disorders of B-cell origin:
primary effusion lymphoma (PEL), and a subset of multicentric Castleman’s disease
(MCD) (Du MQ 2007). PEL is often co-infected with both KSHV and Epstein Barr
Virus, which leads to the formation of malignant effusion without tumor mass (Fan W
2005). MCD is a group of uncommon lymphoproliferative disorder that share common
lymph node histological features. Angiofollicular lymph node hyperplasia is a subtype of
MCD, caused by KSHV infection of B cells in lymph nodes.
13 | P a g e

4. KS pathogenesis

Following primary infection, KSHV establishes persistent latent infection in healthy
individuals without any symptoms for disease. In KS tumors, most cells are latently
infected by KSHV, with a small portion undergoing spontaneous lytic infection. This
spontaneous reactivation can occur due to several physiological factors such as pro-
inflammatory and pro-angiogenic cytokines (Chang J 2000), hypoxia (Davis DA 2001),
HIV and its product Tat (Varthakavi V 2002), co-infection with human cytomegalovirus
(Vieira J 2001). Latent infection of KSHV is necessary for Kaposi’s sarcoma
development, whereas lytic life cycle leads production of new infectious virions. These
new infectious virus particles are important for spread of the infection as well as help in
tumorigenesis by promoting cell proliferation, invasion, angiogenesis, inflammation and
vascular permeability (Greene W 2007).
KSHV infects a variety of in vitro target cells, such as human B cells, endothelial cells,
epithelial cells and fibroblasts (Akula 2001). Primary human dermal microvascular
endothelial (HMVEC-d) cells and human foreskin fibroblasts (HFF) are characterized by
undergoing latent life cycle, upon primary KSHV infection (Sadagopan S 2007).
Whereas, primary human umbilical vein endothelial cells (HUVEC) cell provides ideal
acute infection features such as high primary infection efficiency, active and productive
viral lytic replication at early stage of infection; induction of a large number of cell
deaths in the permissive phase and conversion of primary HUVECs into KS-like spindle
cells (Yoo SM 2005).
14 | P a g e

5. Sirtuins

Sirtuins (SIRTs) are homologs of yeast silent information regulator 2 (Sir2) in humans. In
yeast, Sir2 controls yeast lifespan by transcriptionally silencing mating-type loci,
telomerase and ribosomal DNA (Kaeberlein M 1999) . In humans, SIRTs are classified as
class III histone deacetylase. HDACs are classified in four classes depending on their
structural homology (Table 1). Class I and II HDACs are Zinc dependent and their role in
cancer is very well studied (Santiago R 2007). SIRT family consists of 7 isoforms
(SIRT1 to SIRT7), who share a common catalytic domain of 275 amino acids. SIRTs are
NAD+ dependent deacetylase and hence their activities are controlled by NAD+/NADH
ratio. Sirtuins catalyze the deacetylation of acetyl-lysine residues by cleaving NAD+,
generating O-acetyl-ADP-ribose, nicotinamide (NAM), and the deacetylated substrate.
When active SIRTs consume NAD, they release nicotinamide which is a negative
feedback inhibitor of SIRTs and the main precursor of NAD+ in mammalian cells (AA
2008).

15 | P a g e

Table 1: Classification of HDAC. (Adapted from TRENDS in Microbiology)

5.1 SIRT1

SIRT1 is the most studied SIRT. It plays an important role in regulation of many cellular
functions, including stress responses, cell proliferation, DNA repair and apoptosis
(Michan S 2007), and carcinogenesis (Chen J 2011). In addition to its enzymatic activity
on histone substrates, SIRT1 deacetylates various non-histone proteins, such as p53
(Vaziri H 2001), Ku70 (Cohen HY 2004), nuclear factor kB (NFkB) (Bouras T 2005),
and forkhead transcription factor (FOXO) (Haigis MC 2010).

Emerging evidence suggests that SIRT1 is involved in virus infections. A recent study
showed that HIV-1 TAT protein is a substrate for the deacetylase activity of SIRT1, thus
regulating TAT-induced HIV-1 transactivation (Pagans S 2005). In HBV infected cells,
16 | P a g e

SIRT1 was found to enhance HBV core promoter activity through transcription factor
AP-1 (Ren JH 2014).
Dual phase of KSHV lifecycle allows the virus to undergo either lytic or latent phase, on
primary infection of the host cell. In latency, the viral genome is epigenetically modified
to limit viral gene expression to latent genes. In a recent study, SIRTs have been shown
to be important for the maintenance of KSHV latency in KSHV-infected PEL cells. This
study showed that inhibitors of SIRTs were able to reactivate KSHV and specific knock
down of SIRT1 was sufficient to induce epigenetic remodeling and KSHV lytic
replication. It was further found that SIRT1 can bind to RTA promoter as well as RTA to
inhibit its transactivation function and preventing the expression of its downstream genes
(Li Q 2014).

17 | P a g e

Aim of this project

In this study our main goal was to investigate the role of SIRT1 in primary KSHV
infection. We used permissive HUVEC that undergo lytic KSHV replication on primary
infection, as an acute infection model for our study. Using lentiviruses, we knocked down
SIRT1 gene in primary HUVEC and investigated its role during acute KSHV infection.
We also used SIRT inhibitor (Tenovin-6) to monitor viral lytic gene expression and
replication. To deduce the mechanism behind SIRT1 mediated virus lytic gene
replication, we observed the expression pattern of transcription factor AP-1 subunits c-
Fos and c-Jun by RT-qPCR.

18 | P a g e

Materials and methods

1. Antibodies and reagents

A monoclonal antibody isotype IgG2a (clone 6A) to KSHV small capsid protein
(ORF65) was used to stain KSHV particles (Gao SJ 2003). A rat anti-LANA monoclonal
antibody was purchased from Abcam (Canbridge, MA). Primary monoclonal-mouse
antibody against SIRT1 was purchased from Cell Signaling technology (Danvers, MA).
An antibody to β-tubulin was purchased from Sigma-Aldrich (St. Louis, Mo.). Alexa
Fluor 568-conjugated goat anti-rabbit immunoglobulin G (IgG), horseradish peroxidase
(HRP)-conjugated goat anti-mouse and HRP-conjugated goat anti-rabbit antibodies were
obtained from Santa Cruz Biotechnology.
Sirtuin inhibitor Tenovin-6 was purchased from Cayman Chemical Company (Ann
Arbor, MI). A stock solution of 10mM/mL was prepared in DMSO and stored at -20
0
C.
2. Cell lines and cell culture

Primary human umbilical vein endothelial cells (HUVEC) were cultured in Vasculife
VEGF complete media (Lifeline Cell Technology, Frederic, MD). iSLK BAC-16 cells
were described previously (Brulois KF 2012). They were cultured in Dulbecco’s
modified Eagle’s medium (DMEM) supplemented with 10% fetal bovine serum (FBS),
1% Penicillin-Streptomycin solution (Genesee Scientific, San Diego, CA), 1μg/mL
puromycin, 250μg/mL G418 (Sigma-Aldrich), and 1,200μg/mL hygromycin B. 293T
cells where maintained in DMEM media supplemented with 10% FBS and 1% Penicillin-
Streptomycin solution.
19 | P a g e

3. Immunofluorescence assay

To examine virus entry and trafficking, HUVEC cells were seeded on a cover slip in 24
well plates. These cells were first pre-treated with Tenovin-6 and then inoculated with
virus for 6 hours. The infected cells were then fixed using 2% para-formaldehyde at room
temperature for 10 minutes. Following three washes with PBS, the cells were incubated
with a mouse anti-ORF65 antibody at a 1:500 dilution for 60 minutes at room
temperature. The cells were washed three times with PBS followed by incubation with an
Alexa Fluor 586-conjugated goat anti-mouse immunoglobulin G secondary antibody for
60 minutes at room temperature. The cells were again washed with PBS three times and
stained with 4’,6’-diamidino-2phenylindole (DAPI) (Sigma-Aldrich) (Greene W 2012).
The cover slip was then placed on glass slide with FluoSave protectant. Images were
visualized with a Zeiss Epi fluorescence microscope (Carl Zeiss, Thornwood, NY).
For KSHV LANA protein detection similar procedure was followed except for few
modifications (Gao SJ 1996). At 48-h post-infection, KSHV-infected cells were fixed in
methanol at room temperature for 10 min. Following three washes with PBS, the cells
were incubated with a rat anti-LANA monoclonal antibody at a 1:500 dilution for 60
minutes at room temperature. The cells were then washed three times with PBS followed
by incubation with an Alexa Fluor 568-conjugated goat anti-rat immunoglobulin G
secondary antibody for 60 minutes at room temperature. The cells were again washed
with PBS three times and stained with DAPI.

20 | P a g e

4. KSHV virus preparation

To induce KSHV lytic replication and infectious virion production, iSLK BAC-16 cells
were treated with induction media containing 1μg/mL doxycycline and 1mM sodium
butyrate. Two days after induction the media was replaced by DMEM with 10% FBS and
1% Penicillin-Streptomycin solution. The supernatant was collected after two days and
centrifuged for 10 minutes at 3,000 rpm and filtered through 0.45-μm-pore-size filter to
remove the cell debris. To further concentrate the virus, the filtered supernatant was ultra-
centrifuged at 24,000 rpm, for 3 hours. To ensure high quality of concentrated virus, a
20% sucrose layer was placed at the bottom of the centrifuge tubes. After ultra-
centrifugation, the virus was re-suspended in culture media overnight. Fresh virus
preparations were titrated by infecting HUVEC. Two days post infection the number of
GFP-positive cells was quantified, which represented the relative virus titers in the
supernatant. Infectious units (IUs) were calculated based on the number of GFP-positive
cells observed with 1 ml virus preparation.
5. RT-qPCR

The expression levels of viral genes and cellular transcription factors were analyzed by
RT-qPCR (Yoo SM 2005). Total RNA form KSHV infected cells was prepared with TRI
reagent as recommended by the manufacturer (Sigma). The RNA was then extracted
using chloroform and isopropanol treatment. Total RNA was further purified with 70%
ethanol and was re-suspended in 20μl of RNA-free water and quantified. The RNA was
treated with RNase-free DNase (Thermo Fisher Scientific, Inc, Waltham, WA). 1μg of
the total RNA from each sample was then used for reverse transcription polymerase
21 | P a g e

reaction (RT-PCR), by using random primers. The cDNA obtained from RT-PCR was
then used to perform quantitative polymerase chain reaction (q-PCR), by using gene-
specific PCR primers described in Table 2. α Tubulin was used as internal control.
GENE FORWARD PRIMER REVERSE PRIMER
SIRT1
5’TCGCAACTATACCCAGAACATA
GACA3’
5’CTGTTGCAAAGGAACCATGACA3’
α-Tubulin
5'AGATCATTGACCTCGTGTTGGA3' 5'AGATCATTGACCTCGTGTTGGA3'
RTA
5'CACAAAAATGGCGCAAGATGA3' 5'TGGTAGAGTTGGGCCTTCAGTT3'
ORF65
5'ATATGTCGCAGGCCGAATAC3' 5'CCACCCATCCTCCTCAGATA3'
LANA
5'CCAGGAAGTCCCACAGTGTT3' 5'AGACACAGGATGGGATGGAG3'
c-Fos
5’CCGGGGATAGCCTCTCTTACT3’ 5’CCAGGTCCGTGCAGAAGT3’
Table 2: qPCR Primers.

6. shRNA knock down

shRNA plasmids were constructed by inserting annealed oligonucleotides containing the
shRNA sequences specific for the target genes into EcoR1 and Agel sites downstream of
the U6 promoter in pLKO.1 vector (Addgene, Cambridge, MA). These shRNA plasmids
were then co-transfected in 293T cells with mixture of plasmid DNA consisting p8.74
(Gag/Pol/Rev) and p.MDG (VSV-g envelope) using Lipofectmine 2000 reagent (Life
technologies, Grand Island, NY), as previously described (He M 2012). The virus-
containing culture supernatant was collected 3 days after transfection. The supernatant
was then concentrated using ultra centrifuge.
22 | P a g e

Lentivirus titer was calibrated by infecting MM cells at different concentration in
presence of 10μg/mL polybrene (Sigma-Aldrich) and centrifuging for 1 hour. The
infected cells were selected by culturing the cells in presence of 1μg/mL puromycin
(Calbiochem, La Jolla, CA). Live cells were counted to determine the titer of the
lentivirus. Knock down with shRNAs in HUVEC cells was performed similarly with
different lentivirus and MOI 1. The sequences for SIRT1 shRNAs were:
GCGGGAATCCAAAGGATAATT for shRNA1 and GCTTGATGGTAATCAGTATCT
for shRNA2. The specificity of the shRNA was previously checked in the lab.

7. Western blot analysis

At specific time points, KSHV infected cells were first washed with ice-cold PBS and
total protein was extracted using SDS lysis buffer (62.5 mM Tris-HCl at pH 6.8, 2% SDS
(w/v), 10% glycerol, 50mM DTT, 0.01% Bromophenol blue (w/v), and protease and
phosphatase inhibitor). Total protein was then separated using SDS-PAGE and
transferred to nitrocellulose membrane (GE Healthcare) using semi-dry transfer method.
Blots were incubated with primary and secondary antibodies, and developed using
Luminata Crescendo Western HRP Substrate (Millipore, #WBLUR0500) followed by
imaging with a UVP Biospectrum 510 imaging system (UVP).

23 | P a g e

Results

1. Knock down of SIRT1 suppresses KSHV lytic replication
during KSHV primary infection of HUVEC cells.

To understand the role of SIRT1 in KSHV primary infection, we performed shRNA
knock down of SIRT1. RT-qPCR results showed that SIRT 1 expression was reduced by
over 60% in cells transduced with SIRT1-specific shRNA lentivirus 1(shRNA1) and 50%
in SIRT1-specific shRNA lentivirus 2 (shRNA2) compared to scrambled control (Fig.
1A). These results were further confirmed by Western blotting (Fig. 1B)
During primary KSHV infection of HUVEC, both latent and lytic genes are actively
transcribed with most of them peaking at 48-72 hours post-infection (Yoo SM 2005). To
test the roles of SIRT1 in KSHV viral lytic gene expression during primary infection, we
monitored several representative KSHV lytic genes by RT-qPCR. Knock down of SIRT1
inhibited over 50% of the expression of IE genes RTA. We also observed 50% inhibitory
effect with shRNA1 and 30% inhibitory effect with shRNA2 of E gene ORF59 and over
60% of L gene ORF65 (Fig. 1C-1E). The effect of SIRT1 knock down on LANA was not
significant as shRNA1 had 60% inhibitory effect and shRNA2 had no effect (Fig. 1F).

24 | P a g e

Figure 1 shRNA knock down of SIRT1 in HUVEC and primary KSHV infection.
(A) SIRT1 levels in SIRT1 knock down primary HUVEC by RT-qPCR (normalized with
tubulin) (B) SIRT1 knock down confirmed by western-blot. mRNA expression of KSHV
lytic genes such as (C) RTA, (D) ORF59, (E) ORF65 and (F)latent gene LANA in SIRT1
knock down primary HUVEC by RT-qPCR.

25 | P a g e

2. SIRT inhibitor Tenovin-6 decreases viral lytic gene
expression as well as infectious virion production.

Next to support the knock down data, we determined whether chemical inhibitor of
SIRT1 was sufficient to decrease viral lytic gene expression. Tenovin-6 inhibits the
protein deacetylase activity and is specific for SIRT1, SIRT2, and SIRT3. Following pre-
treatment with 10μM Tenovin-6, we infected HUVEC with KSHV in presence of the
inhibitor. Tenovin-6 decreased the expression level of KSHV lytic genes such as IE gene
RTA by 150-fold at 48hrs (Fig. 2A). Similar effect was observed on early gene ORF59
(Fig. 2B), with more than 200 fold decrease at 48hpi and more than 800-fold decrease in
late gene ORF65 (Fig. 2C). Tenovin-6 had much weaker effect on the latent gene LANA
expression, with 10-fold decrease in expression (Fig. 2D). These results were consistent
with the SIRT1 knock down data.
To further confirm the effect of Tenovin-6 on virus lytic replication, supernatant from the
infected cells was collected for titration of infectious virion. The inhibitor treated and
KSHV infected cells were thoroughly washed 48hpi and new media was added to each
well. At day 4 post-infection, the supernatant was collected and was place on new
HUVEC. Infection with KSHV does not cause plaque formation, however the
recombinant KSHV BAC-16 has GFP cassette, which allows tracking of KSHV infected
cells (Brulois KF 2012). By counting the GFP-positive cells, we determined the relative
titers of the virus in supernatants. Inhibition of SIRT1 by Tenovin-6 reduced the virus
titer by 5 folds (Fig 2E-2F). These results indicated SIRT1 played an important role in
KSHV lytic replication and virion production during primary infection.
26 | P a g e

Figure 2 Effect of Tenovin-6 on KSHV lytic gene expression and infectious virion
production.
mRNA expression of KSHV lytic genes such as (A) RTA, (B) ORF59, (C) ORF65 and
(D) latent gene LANA in Tenovin-6 treated and non-treated cells. (E) Tenovin-6 effect on
infectious virion formation. (F) Percentage of GFP-positive cells in Tenovin-6 treated and
non-treated samples.
27 | P a g e

3. Tenovin-6 has no effect on virus infectivity or virus entry,
and trafficking during primary KSHV infection.

Productive KSHV lytic replication during primary infection depends and various steps
including virus entry, trafficking, and viral gene expression. To identify whether
Tenovin-6 mediated inhibition of lytic gene expression and infectious virion formation
was due to its effect on one of these steps, we first examined role of Tenovin-6 in KSHV
infectivity. Because LANA is the major KSHV latent protein that binds to the viral
genome to maintain its persistence, detection of LANA protein, which is manifested as a
punctate staining pattern, would indicate successful viral infection. HUVEC treated with
Tenovin-6 were infected with KSHV and stained for LANA protein at 48hpi. Tenovin-6
showed no effect on the number of punctate dots per cell, and the percentage of LANA-
positive cells (Fig. 3A-3B). This indicates that Tenovin-6 has no effect on KSHV
infectivity.
To determine whether Tenovin-6 affects virus entry and trafficking, pre-treated HUVEC
cells where infected with KSHV and 6hpi were stained for ORF65. Staining for ORF65
allows direct visualization of the viral capsids that had successfully trafficked to the
perinuclear region and docked on the nucleus. It was observed that similar number of
virus particles have successfully reached the nucleus in both control and Tenovin-6
treated cells (Fig. 3C-3D). These results indicate that Tenovin-6 has no effect on KSHV
entry and trafficking as well as its infectivity.
28 | P a g e

Figure 3 Effect of Tenovin-6 on KSHV infectivity, entry and trafficking.
(A) Immunofluorescence assay (IFA) for LANA in primary KSHV infected HUVEC
with and without Tenovin-6 Treatment. (B) Percent LANA positive cells in primary
KSHV infected HUVEC with and without Tenovin-6 treatment. (C) IFA for ORF-65 in
primary KSHV infected HUVEC with and without Tenovin-6 Treatment. (D)
Distribution of number of virus particles docked at the nucleus of Tenovin-6 treated and
non-treated cells.

29 | P a g e

4. Transcription factor AP-1 was involved in SIRT1
mediated regulation of KSHV lytic replication.

The previous results excluded the effect of Tenovin-6 on virus infectivity and entry and
trafficking on viral lytic gene expression. Viruses are known to hijack cellular pathways
to facilitate their own infection and replication. A previous study in latently infected PEL
cells has shown that transcription factor AP-1 has binding sites in the promoter region of
RTA, RAP and MTA (Wang SE 2004). To investigate whether SIRT1 mediates
regulation of KSHV lytic replication via AP-1, we checked the expression pattern of c-
Fos and c-Jun in Tenovin-6 treated HUVEC infected with KSHV. The expression levels
of c-Fos where down-regulated by more than 10 fold (Fig. 4A) but no significant change
in c-Jun expression pattern was observed (Fig. 4B). These results were consistent with
SIRT1 knock down cells, where 48phi there was increase in c-Fos levels of scramble
control cells, but more than 5 fold decrease in SIRT1 knock down cells as compared to
scramble (Fig. 4C). No significant change in c-Jun expression level was observed (Fig.
4D). These results indicate that SIRT1 regulation of KSHV lytic replication might be
mediated by c-Fos component of AP-1 transcription factor.
30 | P a g e

Figure 4 AP-1 transcription factor expression in Tenovin-6 treated and SIRT1
knock down cells.
Expression levels of c-Fos (A) and c-Jun (B) in primary KSHV infection, with and
without Tenovin-6 treatment. Expression levels of c-Fos (C) and c-Jun (D) in SIRT1
knock down cells compared to scramble control (normalized by tubulin).
31 | P a g e

Discussion

Primary infection of KSHV is a critical stage, which determines the fates of the virus and
the infected cells. During primary infection, KSHV hijacks host cellular pathways to
either favor its replication and produce viral progeny or lead the virus into latency by
differential regulation of its gene expression. Studying primary infection provides an
insight into viral replication and latency and their regulation by cellular pathways.
SIRT1 has different functions in the cell due to its diverse substrates such as H3K9
(histone target), NFĸB and p53 (non-histone target). SIRT1’s role during latent infection
has been previously described (Li Q 2014). In latently infected cells SIRT1 is involved in
maintaining KSHV latency by epigenetically silencing RTA promoter, thus avoiding
reactivation. The study also provides evidence for direct interaction between SIRT1 and
RTA, explaining further possibilities of regulation. In this study we examined the role of
SIRT1 during primary KSHV infection and its mechanism in regulating viral lytic gene
expression.
To understand the role of SIRT1 during primary KSHV infection, we observed viral lytic
gene expression in SIRT1 knock down cells. The results indicated suppression of lytic
genes compared to the control. Latent gene (LANA) did not show any significant change
in its mRNA expression (Fig. 1F). These results suggest that SIRT1 only promotes viral
lytic gene expression and does not affect latent gene expression during primary infection.
These findings contradict to the previous reactivation studies.
To further support knock down data, we examined the effect of SIRT inhibitor Tenovin-6
on primary KSHV infection. Tenovin-6 is a chemical inhibitor of SIRTs specific for
32 | P a g e

SIRT1, SIRT2 and SIRT3. It blocks the protein deactlyation activity of the SIRTs, thus
allowing monitoring function of these SIRTs in primary KSHV infection. Tenovin-6
inhibition of the SIRTs showed similar, but more dramatic results as SIRT1 knock down
on viral lytic gene expression. This suggests that SIRT1 may play a partial role in
regulation of KSHV lytic replication and SIRT2 and SIRT3 might have an effect too. The
Tenovin-6 inhibition of SIRTs further affects the infectious virion production. These
results indicate that, SIRTs play important role in regulating viral lytic gene expression,
further affecting its replication and ability to form new virus particles.
To further dissect the mechanism by which Tenovin-6 regulate viral lytic gene
expression, we checked its effect on virus entry, trafficking and infectivity. The inhibitor
had no effect on virus entry, trafficking and KSHV infectivity (Fig. 3) indicating that
SIRT1 might directly regulate viral gene expression during primary infection.
Viruses are known to use cellular transcription factors to facilitate their own genes
expression and replication. AP-1 complexes are commonly activated during viral
infection (Panteva 2003) and are ubiquitous heterodimeric transcriptional factors of Jun
(c-Jun, Jun B, and Jun D) and Fos (c-Fos, FosB, Fra-1 and Fra-2) subfamilies. Their main
function is to positively regulate cell proliferation by controlling the expression of
essential cell cycle proteins (Shaulian 2002). AP-1 is also important for cellular
transformation. Both c-jun and c-fos themselves are cellular retroviral oncogenes (Angel
1991).Viral attachment and entry into the host cells activates signaling pathways in the
host cells. Previous study has shown that KSHV activates AP-1 complexes during
primary infection. This activation is mediated by multiple MAPK pathways, including
ERK, JNK and p38 signal transduction cascaded (Xie J 2005). Activation of ERK
33 | P a g e

pathway, leads to its translocation in the nucleus and direct phosphorlylation of c-Fos and
its ternary complex, which further binds and activate the fos promoter (Monje 2003). .
The promoter regions of several key KSHV lytic genes, encoding RTA, RAP and MTA
contain AP-1 consensus element, indicating its role in regulating viral lytic gene
expression (Wang SE 2004). On the other hand, during viral latency the viral latent gene
vFLIP activates NFĸB pathway, which suppresses AP-1 pathway essential for viral lytic
replication (Ye FC 2008).
We checked whether SIRT1 mediated suppression of viral lytic gene expression via AP1
transcription factor, by monitoring mRNA levels of c-Fos and c-Jun in Tenovin-6 treated
and SIRT1 knock down HUVEC infected with recombinant KSHV BAC-16. Both
conditions suppressed the c-Fos mRNA expression levels, indicating its role in KSHV
lytic replication. Recent study in HBV infection indicated SIRT1 regulating HBV
transcription and replication by targeting transcription factor AP-1 (Ren JH 2014). Also
ORF45-mediates a prolonged c-Fos accumulation during the late stage of lytic
replication of KSHV and helps to accelerate viral transcription (Li X 2015).
In summary, we examined the role of SIRT1 in primary KSHV infection and found that
SIRT1 promotes viral lytic gene expression and replication. This contradicts the role of
SIRT1 during reactivation. Also, our data suggest that SIRT1 regulates viral lytic gene
expression and replication via AP-1 transcription factor subunit c-Fos.

34 | P a g e

References

AA, S. (2008). "NAD+ and vitamin B3: from metabolism to therapies. ." The Journal of
pharmacology and experimental therapeutics 324: 883-893.

Akula, S. M., F. Z. Wang, J. Vieira, and B. Chandran. (2001). "Human herpesvirus interaction with
target cells involves heparan sulfate. ." Virology 282: 245–255.

Angel, P., and M. Karin. (1991). "The role of Jun, Fos and the AP-1 complex in cell-proliferation
and transformation. ." Biochim. Biophys. Acta 1072: 129–157.

Ballestas ME, C. P., Kaye KM (1999). "Efficient persistence of extra chromosomal KSHV DNA
mediated by latency-associated nuclear antigen." Science 284: 641-644.

Bouras T, F. M., Sauve AA, Wang F, Quong AA, Perkins ND, Hay RT, Gu W, Pestell RG. (2005).
"SIRT1 deacetylation and repression of p300 involves lysine residues within the cell cycle
regulatory domain 1. ." J. Biol. Chem. 280: 1020-1024.

Brulois KF, C. H., Lee AS, Ensser A, Wong LY, Toth Z, Lee SH, Lee HR, Myoung J, Ganem D, Oh TK,
Kim JF, Gao SJ, and Jung JU (2012). "Construction and manipulation of a new Kaposi's sarcoma-
associated herpesvirus bacterial artificial chromosome clone. ." J virol 86: 9708-9720.

Cai Q, V. S., Lu J, Robertson ES (2010). "Molecular biology of Kaposi's sarcoma-associated
herpesvirus and related oncogenesis." Adv Virol. Res. 78: 87-142.

Chang J, R. R., Dittmer D, Ganem D (2000). "Inflammatory cytokines and the reactivation of
Kaposi’s sarcoma-associated herpesvirus lytic replication. ." Virology 266: 17–25.

Chang Y, C. E., Pessin MS, Lee F, Culpepper J, Knowles DM, Moore PS (1994). "Identification of
herpesvirus-like DNA sequences in AIDs-associated Kaposi's sarcoma." Science 266: 1865-1869.

Chen J, Z. B., Wong N, Lo AW, To KF, Chan AW, Ng MH, Ho CY, Cheng SH, Lai PB, Yu J, Ng HK, Ling
MT, Huang AL, Cai XF, Ko BC. (2011). "Sirtuin 1 is upregulated in a subset of hepatocellular
carcinomas where it is essential for telomere maintenance and tumor cell growth. ." Cancer Res.
71: 4138–4149.

Cohen HY, M. C., Bitterman KJ, Wall NR, Hekking B, Kessler B, Howitz KT, Gorospe M, de Cabo R,
Sinclair DA. (2004). "Calorie restriction promotes mammalian cell survival by inducing the SIRT1
deacetylase." Science 305: 390–392.
35 | P a g e

Covarrubias S, R. J., Clyde K, Lee YJ, Glaunsinger BA. (2009). "Host shutoff is a conserved
phenotype of gammaherpesvirus infection and is orchestrated exclusively from the cytoplasm."
J Virol 83: 9554-9566.

Davis DA, R. A., Zoeteweij JP, Aoki Y, Read-Connole EL, et al. (2001). "Hypoxia induces lytic
replication of Kaposi sarcoma-associated herpesvirus. ." Blood 97: 3244–3250.

Du MQ, B. C., Isaacson PG (2007). "Kaposi sarcoma-associated herpesvirus/human herpesvirus 8
and lymphoproliferative disorders." J. Clin. Pathol. 60: 1350 –1357.

Fan W, B. D., Chadburn A, Harrington WJ, Ceasrman K, Knowles DM. (2005). "Distinct subsets of
primary effusion lymphoma can be identified based on their cellular gene expression profile and
viral association. ." J Virol 79 (2): 1244-1251.

Fukumoto H, K. T., Hasegawa H, Katano H (2011). "Pathology of Kaposi's sarcoma-associated
herpesvirus infection." Front Microbiology 2: 175.

Gao SJ, D. J., and Zhou FC (2003). "Productive lytic replication of a recombinant Kaposi's
sarcoma-associated herpesvirus in efficient primary infection of primary human endothelial
cells." J Virol 77: 9738-9749.

Gao SJ, K. L., Li M, Zheng W, Parravicini C, Ziegler J, Newton R, Rinaldo CR, Saah A, Phair J, Detels
R, Chang Y, and Moore PS. (1996). "KSHV antibodies among Americans, Italians and Ugandans
with and without Kaposi's sarcoma." Nat med 2: 925-928.

Gil L, M. G., Gonzalez I, Tarinas A, Alvarez A, et al. (2003). "Contribution to characterization of
oxidative stress in HIV/AIDS patients. ." Pharmacol Res 47: 217–224.

Greene W, K. K., Ye F, Chen J, Zhou F, et al. (2007). "Molecular biology of KSHV in relation to
AIDS-associated oncogenesis. ." Cancer Treat Res 133: 69–127.

Greene W, Z. W., He M, Witt C, Ye F, and Gao SJ. (2012). "The ubiquitin/proteasome system
mediates entry and endosomal trafficking of Kaposi's sarcoma-associated herpesvirus in
endothelial cells." PLoS pathogens. 8: e1002703.

Haigis MC, S. D. (2010). "Mammalian sirtuins: biological insights and disease relevance." Annu.
Rev. Pathol. 5: 253–295.

36 | P a g e

He M, Z. W., Bakken T, Schutten M, Toth Z, Jung JU, Gill P, Cannon M, and Gao SJ. (2012).
"Cancer angiogenesis induced by Kaposi sarcoma-associated herpesvirus is mediated by EZH2. ."
Cancer research 72: 3582-3592.

Jenner RG, A. M., Boshoff C, Kellam P (2001). "Kaposi's sarcomma-associated herpesvirus latent
and lytic gene expression as revealed by DNA arrays." J Virol 75(2): 891-902.

Kaeberlein M, M. M., Guarente L (1999). "The SIR2/3/4 complex and SIR2 alone promote
longevity od Saccharomyces cerevisiae by two different mechanisms." Gene Dev 13: 2570-2580.

Laubach VE, K. I. (2009). "Pulmonary inflammation after lung transplantation. ." Surgery 146: 1–
4.

Li Q, H. M., Zhou F, Ye F, Gao SJ. (2014). "Activation of Kaposi’s sarcoma-associated herpesvirus
(KSHV) by inhibitors of class III histone deacetylases: identification of sirtuin 1 as a regulator of
the KSHV life cycle." J Virol 88: 6355-6367.

Li X, D. S., Avey D, Li Y, Zhu F, Kuang E. (2015). "ORF45-mediated prolonged c-Fos accumulation
accelerates viral transcription during the late stage of lytic replication of KSHV. ." J Virol. 89:
6895-6906.

M., K. (2009). "Inflammation, aging, and cancer: tumoricidal versus tumorigenesis of immunity:
a common denominator mapping chronic diseases. ." Cell Biochem Biophys 55: 55–79.

Mercier A, A. C., Madrid AS, Holdorf MM, Ganem D. (2014). "Site-specific association with host
and viral chromatin by Kaposi's sarcoma-associated herpesvirus LANA and its reversal during
lytic reactivation." J Virol 88: 6762-6777.

Michan S, S. D. (2007). "Sirtuins in mammals: insights into their biological function." Biochem. J.
404: 1–13.

Monje, P., M. J. Marinissen, and J. S. Gutkind. (2003). "Phosphorylation of the carboxyl-terminal
transactivation domain of c-Fos by extracellular signal regulated kinase mediates the
transcriptional activation of AP-1 and cellular transformation induced by platelet-derived growth
factor. ." Mol. Cell. Biol. 23: 7030–7043.

Pagans S, P. A., North BJ, Kaehlcke K, Marshall BL, Dorr A, Hetzer-Egger C, Henklein P, Frye R,
McBurney MW, et al. (2005). "SIRT1 regulates HIV transcription via Tat deacetylation. ." PLoS
Biol 3: e41.

37 | P a g e

Panteva, M., H. Korkaya, and S. Jameel. (2003). "Hepatitis viruses and the MAPK pathway: is this
a survival strategy? ." Virus Res. 92: 131–140.

Ren JH, T. Y., Zhang ZZ, Chen WX, Cai XF, Chen K, Ko BC, Song CL, Ran LK, Li WY, et al. (2014).
"Sirtuin 1 regulates hepatitis B virus transcription and replication by targeting transcription
factor AP-1." J Virol 88: 2442-2451.

Roth, W. K., H. Brandstetter, and M. Sturzl. (1992). "Cellular and molecular features of HIV-
associated Kaposi's sarcoma." AIDS 6: 895-913.

Russo JJ, B. R., Chien MC, Chen J, Yan M, Maddalena D, Parry JP, Peruzzi D, Edelman IS, Chang Y
(1996). "Nucleotide sequence of the Kaposi sarcoma-associated herpesvirus (HHV8)." Natl. Acad.
Sci. USA. 93: 14862-14867.

Sadagopan S, S.-W. N., Veettil MV, Raghu H, Sivakumar R, Bottero V, and Chandran B (2007).
"Kaposi's sarcoma-associated herpesvirus induces sustained NFkappaB activation during de
novo infection of primary human dermal microvascular endothelial cells that is essential for viral
gene expression." J. Virol 81: 3949-3968.

Santiago R, M. E. (2007). "The role of histone deacetylases (HDACs) in human cancer." Molecular
Oncology 1(1): 19-25.

Shaulian, E., and M. Karin. (2002). "AP-1 as a regulator of cell life and death. ." Nat. Cell Biol. 4:
E131–E136.

Simonart T, N. J., Andrei G, Parent D, Van Vooren JP, et al. (1998). "Iron as a potential co-factor
in the pathogenesis of Kaposi’s sarcoma? Int J Cancer 78:720–726." Int J Cancer 78: 720–726.

Toth Z, B. K., Jung JU (2013). "The Chormatin landscape of Kaposi's sarcoma-associated
herpesvirus." Viruses 5: 1346-1373.

Varthakavi V, S. R., Deng H, Sun R, Spearman P (2002). "Human immunodeficiency virus type-1
activates lytic cycle replication of Kaposi’s sarcoma-associated herpesvirus through induction of
KSHV Rta." Virology 297: 270–280.

Vaziri H, D. S., Ng Eaton E, Imai SI, Frye RA, Pandita TK, Guarente L, Weinberg RA. (2001).
"hSIR2(SIRT1) functions as an NADdependent p53 deacetylase." Cell 107: 149–159.

38 | P a g e

Vieira J, O. H. P., Kimball L, Chandran B, Corey L. (2001). "Activation of Kaposi’s sarcoma-
associated herpesvirus (human herpesvirus 8) lytic replication by human cytomegalovirus. ." J
Virol 75: 1378–1386.

Wang SE, W. F., Chen H, Shamay M, Zheng Q,and Hayward GS. (2004). "Early Activation of the
Kapasi’s Sarcoma-Associated Herpesvirus RTA, RAP, and MTA Promoters by the Teradecanoyl
Phorbol Acetate- Induced AP1 Pathway. ." J Virol 78(8): 4248-4267.

Xie J, P. H., Yoo S and Gao SJ. (2005). "Kaposi’s Sarcoma-Associated Herpesvirus Induction of AP-
1 and Interlukin 6 during primary infection mediated by multiple mitogen-activated protein
kinase pathways. ." J. Virol.. 79(24): 15027-15037

Ye F, L. X., and Gao SJ. (2011). "Mechanisms of Kaposi's Sarcoma-Associated Herpesvirus Latency
and Reactivation. ." Adv Virol.(193860): 19.

Ye FC, Z. F., Xie JP, Kang T, Green W, Kuhne K, Lei XF, Li QH, Gao SJ (2008). "Kaposi’s Sarcoma-
Associated Herpesvirus Latent Gene vFLIP Inhibits Viral Lytic Replication through NF-B Mediated
Suppression of the AP-1 Pathway: a Novel Mechanism of Virus Control of Latency." J Virol 82(9):
4235-4249.

Yoo SM, Z. F., Ye FC, Pan HY, and Gao SJ (2005). "Early and sustained expression of latent and
host modulating genes in coordinated transcriptional program of KSHV productive primary
infection of human primary endothelial cells." Virology 343: 47 64.

Abstract (if available)

Abstract Sirtuin 1 (SIRT1) is a class III histone deacetylase (HDAC) and an important epigenetic regulator of gene expression and cell proliferation. A recent study investigating SIRT1’s role in KSHV infection showed its importance in maintenance of viral latency in KSHV-PEL cells. SIRT1 suppressed the expression of viral lytic gene RTA, which is necessary and sufficient to reactivate KSHV from latency. This study mainly focused on understanding the role of SIRT1 during primary KSHV infection and the mechanism by which it regulates KSHV lytic replication. To investigate the role of SIRT1, we knocked down SIRT1 gene in primary human umbilical vein endothelial cells (HUVEC) and observed down-regulation of viral lytic gene expression. These results were further supported by SIRT inhibitor (Tenovin-6), which also down-regulated viral lytic gene expression and infectious virion production. To investigate the mechanism by which SIRT1 regulates KSHV lytic replication, we checked the expression of transcription factor AP-1

Linked assets

University of Southern California Dissertations and Theses

Conceptually similar

PDF

Regulation of inflammation and angiogenesis by Kaposi’s sarcoma-associated herpesvirus

PDF

FoxO1 suppresses Kaposi's sarcoma-associated herpesvirus lytic replication and controls viral latency

PDF

Viral and cellular N⁶-methyladenosine and N⁶,2'-O-dimethyladenosine epitranscriptomes in the Kaposi’s sarcoma‐associated herpesvirus life cycle

PDF

Modulation of host antigen presentation by herpes simplex virus 1

PDF

Lymphatic cell environment promotes sustained KSHV lytic replication and viral maintenance

PDF

Role of a novel transmembrane protein, MTTS1 in mitochondrial regulation and tumor suppression

PDF

Epigenomic analyses of Kaposi's sarcoma-associated herpesvirus

PDF

Kaposi's sarcoma associated herpes-virus induces cellular proxi expression to modulate host gene expression that benefits viral infection and oncogenesis

PDF

Protein deamidation mediated metabolic reprogramming during KSHV lytic replication

PDF

Selective innate immune activation by murine gamma-herpesvirus 68 (ɣHV68)

PDF

Virus customization of host protein machinery for efficient propagation

PDF

Kaposi's sarcoma‐associated herpesvirus‐Bcl-2 mediated regulation of NM23-H2 is required for KSHV lytic replication

PDF

Molecular strategies towards inhibition of KSHV-associated malignancies

PDF

Characterization of invariant natural killer T cells in a novel humanized HBV-transgenic model

PDF

Modeling SynGAP1 truncating mutations in neurodevelopmental disease using iPSC-derived neurons

PDF

Molecular mechanism for the immune evasion of CD1d antigen presentation by herpes simplex virus-1 UL56 protein

PDF

A functional genomic approach based on shRNA-mediated gene silencing to delineate the role of NF-κB and cell death proteins in the survival and proliferation of KSHV associated primary effusion l...

PDF

Modulation of KIF3A function by herpes simplex virus-1 US3 kinase in viral immune evasion

PDF

Infection by herpes simplex virus type 1 increases human papillomavirus type 16 uptake and infection through the annexin A2/S100A10 heterotetramer

PDF

The role of amphisomes and Rab11 protein in release of mature hepatitis B viral particles and analysis of the arginine-rich C-terminal domain of HBV precore protein

Asset Metadata

Creator Sawant, Tanvee Vinod (author)

Core Title Regulation of acute KSHV infection by SIRT1

School Keck School of Medicine

Degree Master of Science

Degree Program Molecular Microbiology and Immunology

Publication Date 07/28/2015

Defense Date 06/15/2015

Publisher University of Southern California (original), University of Southern California. Libraries (digital)

Tag KSHV,OAI-PMH Harvest,SIRT1

Format application/pdf (imt)

Language English

Contributor Electronically uploaded by the author (provenance)

Advisor Gao, Shou-Jiang (committee chair), Schönthal, Axel H. (committee member), Yuan, Weiming (committee member)

Creator Email tanusawant@gmail.com,tanveevs@usc.edu

Permanent Link (DOI) https://doi.org/10.25549/usctheses-c3-608452

Unique identifier UC11299536

Identifier etd-SawantTanv-3712.pdf (filename),usctheses-c3-608452 (legacy record id)

Legacy Identifier etd-SawantTanv-3712.pdf

Dmrecord 608452

Document Type Thesis

Format application/pdf (imt)

Rights Sawant, Tanvee Vinod

Type texts

Source University of Southern California (contributing entity), University of Southern California Dissertations and Theses (collection)

Access Conditions The author retains rights to his/her dissertation, thesis or other graduate work according to U.S. copyright law. Electronic access is being provided by the USC Libraries in agreement with the a...

Repository Name University of Southern California Digital Library

Repository Location USC Digital Library, University of Southern California, University Park Campus MC 2810, 3434 South Grand Avenue, 2nd Floor, Los Angeles, California 90089-2810, USA