University of Southern California Dissertations and Theses

RNA viruses and cell membrane: Hepatitis C virus and coronavirus

(USC Thesis Other)

RNA viruses and cell membrane: Hepatitis C virus and coronavirus

PDF

Download

Open document

Flip pages

Download a page range

Download transcript

Copy asset link

Request this asset

Transcript (if available)

Content

RNA VIRUSES AND CELL MEMBRANE:
HAPATITIS C VIRUS AND CORONAVIRUS

by

Guann-Yi Yu

A Dissertation Presented to the
FACULTY OF THE GRADUATE SCHOOL
UNIVERSITY OF SOUTHERN CALIFORNIA
In Partial Fulfillment of the
Requirements for the Degree
DOCTOR OF PHILOSOPHY
(MOLECULAR MICROBIOLOGY AND IMMUNOLOGY)

December 2005

Copyright 2005 Guann-Yi Yu

UMI Number: 3237105
3237105
2006
UMI Microform
Copyright
All rights reserved. This microform edition is protected against
unauthorized copying under Title 17, United States Code.
ProQuest Information and Learning Company
300 North Zeeb Road
P.O. Box 1346
Ann Arbor, MI 48106-1346
by ProQuest Information and Learning Company.
ii
DEDICATION

To my beloved father, mother and sisters
And
To my heavenly brother

iii
ACKNOWLEDGEMENTS
Early morning in the lab, I am writing the last section of this dissertation. One strong
feeling is I could not have gone this far without the help from the people I met in this
country during these years. I feel so blessed to have the chance to write this section
showing my appreciation. Without them, I could not have had such a wonderful and
fruitful journey here.
Dr. Michael Lai is the most important person in these years. I thank Dr. Lai for
accepting me as a graduate student at the very beginning, teaching me in various aspects
during these years, and revising my dissertation in his extremely busy schedule these
days. I felt lucky to have the opportunity to learn from Dr. Lai, a great scientist in such
close way. From hardly responding to other’s question to completing my defense, I could
feel my progression. I would not progress this much without Dr. Lai. I appreciate
everything I have learned from Dr. Lai, and will do my best with what I have learned in
the future.
The other important factor making this journal possible was the strong support from
my family in Taiwan. My parents, Wen-Hsiung Yu and Chen-May Yu, and sisters are
always there for me. Without their encouragements, I could not go through the ups and
downs in these years.
The name list for the acknowledgment was about two-pages long. They were
labmates in Dr. Lai’s lab and also friends at USC. Without listing their names here, I
would like to show my appreciation here at once. I will always remember and appreciate
the help and the friendships from these people I have met in this country.

iv
TABLE OF CONTENTS
Dedication ii
Acknowledgments iii
List of Tables vii
List of Figures viii
Abstract xi
Chapter 1: RNA Virus Replication: Hepatitis C Virus and Coronavirus 1
1.1 Abstract 1
1.2 Cell membranes and virus replication 2
1.2.1 Plasma membrane and Virus Entry 3
1.2.2 Cytoplasmic membrane and virus replication 5
1.3 Hepatits C virus 7
1.3.1 HCV RNA genome and classification 8
1.3.2 HCV polyprotein processing and the functions of viral
proteins
9
1.3.3 HCV Replication cycle: 12
1.4 Coronaviruses 15
1.4.1 RNA genome and Classification 15
1.4.2 Viral proteins of Coronavirus 16
1.4.3 Replication cycle 18
Chapter 2: HCV NS4B 20
2.1 Abstract 20
2.2 Introduction 21
2.2.1 HCV Subgenomic replicon 21
2.2.2 HCV replication complex and subcellular microdomain 22
2.2.3 NS4B and HCV replication 24
2.3 Materials and Methods 26
2.3.1 Cell cultures, viruses and antibodies 26
2.3.2 Plasmids 26
2.3.3 Metabolic Labeling and Immunoprecipitation. 27
2.3.4 Protein purification, trypsin digestion and mass spectrometry 28
2.3.5 Colony formation assay 28
2.3.6 Membrane Flotation assay 29
2.3.7 Polymerization assay 30
2.3.8 Co-immunoprecipitation 30
2.3.9 GFP protein examination and lipid droplet staining. 31
2.4 Results 32
2.4.1 NS4B subdomains responded similarly to the detergent
treatments.
32
2.4.2 NS4B is palmitoylated. 34
2.4.3 NS4B plamitoylation is insensitive to BFA treatment. 36
v
2.4.4 The palmitoylation sites of NS4B are located on the
cytoplasmic region of C-terminus.
37
2.4.5 Cystein 257 and Cystein 261 are two palmitoylation sites on
NS4B.
38
2.4.6 PEG-mal treatment of NS4B cyteine residues. 40
2.4.7 Cystein257 and Cystein261 are well conserved in various
genotypes.
42
2.4.8 Mass spectrometry of NS4B 43
2.4.9 Lipid modification and subcellular localization. 45
2.4.10 The NS4B lipid modifications are important for protein-
protein interaction and replication site targeting.
48
2.4.11 Cys257 residue but not Cys261 of NS4B is dispensable for
subgenomic replicon replication.
50
2.4.12 2-Bromopalmitate inhibited HCV RNA replication 52
2.4.13 NS4B has polymerization activity, and the polymerization
determinants are distributed on the both cytoplasmic ends
of NS4B.
54
2.4.14 The lipid modifications of Cys257 and Cys261 contribute to
the polymerization activity at the C-terminus of NS4B.
55
2.4.15 The polymerization determinants of NS4B N-terminus are
scattered in the N-terminus.
57
2.5 Discusions 59
Chapter 3: NS4B-interacting proteins: Rab1B 62
3.1 Abstract 62
3.2 Introduction 64
3.2.1 Host factors and HCV replication. 64
3.2.2 Rab1B protein. 65
3.2.3 Geranylgeranylation and HCV RNA replication. 67
3.3 Materials and Methods 68
3.3.1 DNA constructions and reagents 68
3.3.2 Co-immunoprecipitation 69
3.3.3 Immunofluorescence staining 69
3.3.4 Rab siRNA and real time PCR 70
3.3.5 Transient replicon replication 71
3.3.6 VSV-G Assay 71
3.4 Results
3.4.1 Host factors identified by mass spectrometry.
72
72
3.4.2 The Interaction between Rab1B and NS4B. 75
3.4.3 Colocalization of Rab1B and NS4B. 78
3.4.4 Rab siRNAs and RNA replication. 82
3.4.5 Rab1B mutants and RNA replication 83
3.4.6 The effect of NS4B on Rab1B function. 87
3.5 Discusions 91

vi
Chapter 4: NS4B-interacting proteins: ALDH10 94
4.1 Abstract 94
4.2 Introduction 95
4.2.1 ALDH family. 95
4.2.2 FALDH. 96
4.2.3 The metabolic role of FALDH. 97
4.2.4 FALDH and Sjogren-Larsson syndrome. 97
4.2.5 The detoxification role of FALDH 98
4.3 Materials and Methods 100
4.3.1 DNA constructs and reagents. 100
4.3.2 Coimmunoprecipitation 100
4.3.3 Immunofluorescence staining 101
4.3.4 FALDH siRNA and real time PCR 101
4.3.5 FALDH recombinant protein expression, purification and
animanl immunization.
102
4.3.6 Immmunoprecipitation 102
4.4 Results 103
4.4.1 The interaction between FALDH and HCV viral proteins. 103
4.4.2 Subcellular localization of FALDH in the presence of NS4B. 105
4.4.3 FALDH siRNAs and HCV RNA replication. 110
4.4.4 FALDH recombinant protein purification and antiserum
production.
111
4.4.5 Endogenous FALDH expression in replicon cell. 114
4.5 Discusions 116
Chapter 5: Coronavirus and the Ubiquitin-Proteasome system
118
5.1 Abstract 118
5.2 Introduction 119
5.3 Materials and Methods 123
5.3.1 Cell, virus, and reagents.
5.3.2 Plaque assay
123
124
5.3.3 Internalization assay 124
5.3.4 Sucrose Flotation gradient 125
5.3.5 Percoll gradient 125
5.4 Results 127
5.4.1 The Proteasome inhibitors blocked MHV (JHM) replication. 127
5.4.2 The proteasome-ubiquitin system is involved in an early
step of virus replication.
130
5.4.3 The proteasome inhibitor does not block virus internalization. 131
5.4.4 Some viruses were accumulated in early endosomes and late
endomes in the presence of proteasome inhibitor.
133
5.4.5 The proteasome inhibitor directed viruses to the lysosomes 135
5.5 Discusions 138
Bibiliography 141
vii

LIST OF TABLES
Table2-1. The variation of NS4B protein sequence (257-261 residues) between
different HCV genotypes.

43
Table3-1. Factors identified from protein preparation of NS4B and mutants by
Mass Spectrometry.

72
Table3-2 Peptides of Rab1B, FALDH and ERGIC35 present in NS4B protein
preparation.

74

viii
LIST OF FIGURES
Fig. 2-1 The replication of subgenomic replicon inside cells. 22
Fig. 2-2 The topology of HCV NS4B protein. 24
Fig. 2-3 Detergent sensitivity test of NS4B mutants. 33
Fig. 2-4 Palmitoylation of NS4B. 35
Fig. 2-5 Palmitoylation of NS4B is insensitive to Brefedin A. 36
Fig. 2-6 Palmitoylation of NS4B deletion mutants. 37
Fig. 2-7 NS4B is palmitoylated on Cys 257 and Cys261 residue. 38
Fig. 2-8. The PEGylation of NS4B. 41
Fig. 2-9. Mass spectormetry of NS4B. 44
Fig. 2-10. Extracted Ion Chromatography of theoretical palmitoylated peptide m/z
values (+2, +3).
45
Fig. 2-11 Subcellular localization of GFP-NS4B with various cysteine mutations. 46
Fig. 2-12 The bright dots of GFP-NS4B C257,261A double mutant is not related
to lipid droplet.
47
Fig. 2-13 NS4B mutants and protein-protein interaction. 49
Fig. 2-14 NS4B mutations in HCV subgenomic replicon. 51
Fig. 2-15 The palmitoylation inhibiotor (2-bormopalmitate,2-BP) interferes HCV
RNA replicaiton.
53
Fig. 2-16 Polymerization assay of NS4B. 54
Fig. 2-17NS4B cystein residues contribute to the polymerization activity. 56
ix
Fig. 2-18 N-terminal polymerization determinants mapping (I). 57
Fig. 2-18 N-terminal polymerization determinants mapping (II). 58
Fig. 3-1 The interaction between Rab1B and viral proteins 76
Fig. 3-2 Colocalization of NS4B and Rab1B 79
Fig. 3-3 Subcellular localization of Rab1B and NS4B. 80
Fig. 3-4. The Rab1B distribution in replicon cells 81
Fig. 3-5 The effect of Rab1B siRNAs on subgenomic RNA replication. 83
Fig. 3-6 Rab1B mutants and subgenomic replicon replication. 84
Fig. 3-7 Rab1B mutants and NS4B interaction 86
Fig. 3-8 The effect of NS4B to the Rab1B function in VSV-G processing. 88
Fig.4-1 The interaction of FALDH10 and NS4B 104
Fig.4-2 Co-localization of NS4B and ALDH10 106
Fig.4-3 Co-localization of GFP-NS4B(197-261) and FALDH. 107
Fig.4-4 Overexpression of FALDH and NS4B in Huh7 cell. 108
Fig.4-5 Subcellular loccalization of FALDH in Replicon cell. 110
Fig.4-6 The effect of FALDH siRNAs on subgenomic RNA replication 111
Fig.4-7 The production of FALDH antiserum 112
Fig.4-8 The expression of FALDH expression in Huh7 and replicon cell 114
Fig.5-1 The proteasome inhibitors blocked MAV-JHM replication. 127
x
Fig.5-2 The proteasome inhibitors blocked MHV replication. 129
Fig.5-3 Kinetics of virus replication (MHV-JHM after pulse treatment with MG132 130
Fig.5-4 The effect of MG132 on virus internalization. 132
Fig.5-5 Endosome purification by flotation gradient. 134
Fig.5-6 Detection of viruses in the dense lysosome fractions. 135

xi
ABSTRACT
In eukaryotes, cell membranes are important in separating cell into various
compartments for various biological functions. To replicate inside cell, viruses have
developed various strategies to penetrate the membrane boundaries or to utilize the
membrane system for replication. In this dissertation, we will see how two RNA viruses,
Hepatitis C Virus (HCV) and Coronavirus, involve cellular membranes.
HCV is an enveloped positive-stranded RNA virus. Similar to other RNA viruses,
HCV replication also induces membrane alteration (membranous web) which could be an
important replication platform for RNA replication in cell. HCV nonstructural protein
4B (NS4B) is involved in this membrane alteration, and is also crucial for maintaining
the replication complex in detergent-resistant membrane, suggesting a structural role of
NS4B in replication. First part of this dissertation (Chapter 2) focuses on the
characterization of NS4B protein in order to reveal the mechanism by which NS4B could
execute its functions. Mainly, the lipid modification and polymerization activity of
NS4B were identified. NS4B palmitoylation is on cysteine 257 residue and Cysteine 261
at the C-terminal end of NS4B. The lipid modification of NS4B is involved in protein
stability, protein interaction and replication site targeting. Also, 2-bromopalmitate, the
palmitoylation inhibitor, could inhibit HCV RNA replication, suggesting that NS4B lipid
modification could be important for RNA replication. The polymerization activity of
NS4B on the N-terminal cytoplasmic region was in a scattered pattern. The NS4B
palmitoylation also contributes to the polymerization activity. The lipid modification and
polymerization activity could be two important properties for NS4B to induce specialized
structure and to maintain the virus RNA replication in detergent-resistant membrane.
xii
Along with the NS4B study, several NS4B-interacting proteins were identified by
mass spectrometry. Two of these NS4B-interacting candidates, Rab1B and FALDH, are
included in this dissertation (in Chapter 2 and 3, respectively). Rab1B belongs to the Rab
GTPase family and has GTPase activity and geranylgeranyl modification at its C-
terminal end. Rab1B is involved in the directing of vesicle transport between ER to
Golgi. Our results suggest that Rab1B could specifically interact with NS4B in single
protein expression or in the context of subgenomic replicon. Also, Rab1B subcellular
localization was changed in the presence of NS4B protein, and Rab1B is partially
colocalized with NS5A in replicon cell. Other than protein-protein interaction, Rab1B
siRNAs reduced the HCV RNA replication in replicon cell, and Rab1B mutants could
lower RNA replication in transient replication system. Taken together, Rab1B might
directly participate in HCV RNA replication through the interaction with NS4B.
The second NS4B-interacting factor studied was FLADH (fatty aldehyde
dehydrogenase). FALDH is a microsomal enzyme catalyzing the conversion of fatty
aldehyde to the corresponding fatty acids. Our results show that FLADH could
specifically interact with NS4B via the C-terminal half of NS4B, and that the localization
of FLADH could be changed from a reticular distribution to a perinuclear distribution
when FALDH was coexpressed with cytoplasmic portion of NS4B. Strikingly, a
specialized structure was induced by the overexpression of FALDH, which was also seen
when NS4B was overexpressed by mRNA transfection. The colocalization of FALDH
with viral protein and the induced structure were also seen in replicon cell. Moreover,
FALDH siRNA treatment could reduce HCV RNA replication. These results suggest
that FALDH might be involved in HCV replication by membrane alteration.
xiii
In the last part, the other RNA virus, coronavirus, was examined to see how the RNA
virus deals with cell membrane. Mouse hepatitis Virus (MHV), one member of
Coronavirus family, is also an enveloped positive-stranded RNA virus. The ubiquitin-
proteasome system is involved in cellular endocytosis and maturation of some viruses. In
Chpter 5, we found that the proteasome inhibitors blocked mouse hepatitis virus
replication at an early step of viral life cycle. In the presence of MG132, the entering
viruses accumulated in both the endosome and the denser lysosome, suggesting that the
ubiquitin-proteasome system is involved in the virus release from the endosome to the
cytosol during the virus entry step.
These researches not only help to understand how viruses complete their replication
cycle, but also give the new roles for these cellular factors and machinery. These new
findings may extend our knowledge in biological science.

1
Chapter 1: Viruse Replication: Hepatitis C Virus and Coronavirus
1.1 Abstract
In eukaryotes, cell membranes are important in separating cell into various
compartments for various biological functions. To replicate inside the cell, viruses have
developed various strategies to penetrate the membrane boundaries or to utilize the
membrane system for replication. All the research work included in this dissertation was
related to how virus involves cellular membranes, especially in the entry step and
intracellular membrane alterations. Virus entry is initiated by the recognition by the viral
protein of the receptor present on the plasma membrane. The delivery of virus genetic
material into cells happens on the plasma membrane or on the eodosome after the virus
particle is internalized by endocytosis through clathrin-mediated pathway, caveolin-
dependent pathway or other pathways. After internalization, most positive-stranded RNA
viruses utilized cellular membrane as platform for RNA replication. Each virus has its
unique replication site, such as ER membrane, endosome, lysome or even mitochondria.
Hepatitis C Virus and Coronavirus are both enveloped positive-stranded RNA viruses.
Although these two viruses are different in RNA genome size, genome organization,
translation model, transcription, and replication mechanism, they all use cellular
membranes as the bases for replication and release their mature virus particles from
secretory pathway.

2
1.2 Cell membranes and virus replication
Viruses are intracellular parasites. In eukaryotic cell, membrane is important in
compartmentalizing cell into various environments for various biological functions. For
example, plasma membrane separates cell from outside of the enviroment, whereas
nuclear membrane encloses genetic materials from cytoplasm. To replicate inside the
cell, viruses have developed various strategies to penetrate the membrane boundaries or
to utilize the membrane system for replication. Therefore, the researches related to
cellular membranes have been an important field in virology research.
In chapter 2, I describe that HCV NS4B is a membrane protein and has the membrane
alteration ability. In chapter 3, Rab1B protein, the NS4B-interacting protein, is involved
in vesicle transport. FLADH, another NS4B-interacting protein, has a role in lipid
metabolism (chapter 4). Finally, in the MHV study, the ubiquitin-proteasome system
might be involved in virus entry step. All the research work included in this dissertation
is related to how virus involves cellular membrane. Therefore, in this chapter, other than
the overviews for HCV and MHV (Section 1.3 and 1.4), I will briefly introduce how cell
membrane is involved in each step of virus replication, especially on virus entry and virus
membrane alterations induced by virus.
Virus entry, replication and virus particle assembly are three major events in a
simplified virus replication cycle. All these main steps are membrane-related. Virus
particle has to penetrate the first border of a cell, the plasma membrane, and transport its
genetic material to initiate the replication cycle. Therefore, different viruses have applied
various ways to pass the gate (Section 1.3). Then, the replication of the viral genetic
material takes place in the cytoplasm or in the nucleus. For all positive-sense RNA
3
viruses, the replication takes place in the cytoplasm and is associated with cytoplasmic
membranes of infected cells. For example, picornavirses replicate on ER membrane,
togaviruses utilize endosome and lysosome, and nodaviruses hijack the mitochodria for
replication. On the other hand, for most DNA viruses including pavovaviruses,
adenoviruses, and herpesviruses, and for some negative stranded RNA viruses, such as
orthomyxoviruses, the replication takes place in the nucleus. Each intracellular
compartment has its unique environment. Viruses take the advantage of each unique
environment for their replication. At the final step, the newly synthesized viral genomes
and viral components are assembled into mature virus particles. Viruses may be released
from the cellular secretory pathway, or take some membrane with them as viral envelope.
Hence, even the final step is related to cell membrane.

1.2.1 Plasma membrane and Virus Entry
The virus entry step includes receptor binding and virus internalization. Virus entry
is initiated by the recognition by the viral protein of the receptor present on the plasma
membrane. The delivery of virus genetic material happens on the plasma membrane or
on the eodosome after the virus particles is internalized by endocytosis (Sieczkarski and
Whittaker, 2002).
Receptors used by viruses could be proteins, carbohydrates, or lipids (Baranowski et
al., 2001). Receptors can be the main, but not only, determinant for virus tropism. Other
than the specific receptor for virus binding, some viruses require coreceptors for
productive infection. For example, CD4 is main receptor for human immunodeficiency
virus -1 (HIV-1). The interaction between CD4 and HIV-1 gp120 is not sufficient to
4
mediate fusion of the cell membrane and the viral envelope. The coreceptor, CXCR4 or
CCR5, is also required for the induction the conformational change of viral glycoprotein
for membrane fusion (Berger et al., 1999).
For enveloped viruses, in order to release the viral components into cell, the viral
membrane needs to fuse with cell membrane. The fusion process could happen on the
plasma membrane or on the endocytic vesicles. Paramyxovirueses (Lamb, 1993) and
herpesviruses (Spear and Longnecker, 2003) are the examples that virus enters cell
through the plasma membrane. Unlike the acidic environment in the endosome, the
direct entry on the plasma membrane is usually pH-independent.
Endocytosis has been the main route of entry for the majority of viruses (Sieczkarski
and Whittaker, 2002). The first advantage for internalization through endocytosis is that
the endosome often carriers out the critical function of acidification, needed for triggering
of membrane fusion. Also, the endosome can provide a specific chemical environment,
such as ion concentration and redox state needed to allow penetration. Moreover,
endocytotic traffic may deliver the genome deep into the interior of the cell, close to the
nucleus, which could be beneficial for the viruses that replicate in the nucleus
(Sieczkarski and Whittaker, 2002).
Endocytosis can be divided into clathrin-mediated pathway, caveolin-dependent
pathway, macropinocytosis, and non-clathrin, non-caveolin pathway. Individual viruses
within a family, or the same virus in different cell types, may use different internalization
routes. However, clathrin have been shown to play a major role in the internalization
process of many viruses, including influenza virus (Matlin et al., 1982), and Semiliki
forest virus (Marsh and Helenius, 1980). The acidic environment of clathrin-mediated
5
endocytosis usually induces membrane fusion. Other than enveloped viruses, some
naked viruses, such as adenoviruses, also can be internalized by clathrin-dependent
pathway. Some viruses are internalized through clathrin- and pH-independent pathways,
such as, caveolae-dependent endocytosis. The best study example is simian virus 40
(SV40). The entry of SV40 is through caveolin-dependent endocytosis, and the incoming
SV40 virions accumulate in the smooth ER. The SV40 transport is not through the
traditional endosome/lysosome pathway (Pelkmans et al., 2001; Pelkmans et al., 2002)

1.2.2 Cytoplasmic membrane and virus replication
After being delivered to into cell, viral RNA or DNA will be transported into the
replication site for replication. All positive-sense RNA viruses replicate their RNA on
intracellular membranes in association with vesicles or other membrane (Schwartz et al.,
2002). The RNA replication complexes of many virus families are associated with ER
membrane, for example, piconaviruses (Suhy et al., 2000), flaviviruses (Westaway et al.,
1997), arteriviruses, and bromoviruses (Schwartz et al., 2002). Other than ER membrane,
Togaviruses utilize endosomes and lysosomes (Fenteany et al., 1995), tombusviruses rely
on peroxisome and chloroplasts, and nodaviruses hijack mitochondria.
Semliki Forest virus (a togavirus) replication induces cytopathic vacuoles derived
endosomes and lysosomes. The surface of the vacuoles consists of small vesiclular
invaginations or spherules with a diameter of about 50nm (Froshauer et al., 1988).
Theses small spherules are the sites of RNA replication (Kujala et al., 2001). The other
well-characterized example is poliovirus. The poliovirus starts replication on specific
perinuclear sites and produces rosettelike structure. The rosettelike structures consist of
6
clusters of vesicles of 70-400 nm. COPII coat vesicles are the primary source for these
replication vesicles (Egger and Bienz, 2002). The replication vesicles also undergo an
autophagocytosis-like process to double the membrane vesicles and large rosettes
containing proteins from ER, Golgi, and lysosomes (Schlegel et al., 1996; Suhy et al.,
2000). These membrane alterations induced by virus replication are commonly seen for
many other viruses and may involve different membrane sources. The membrane
association provides a structural framework for replication. It fixes the RNA replication
process to a specially confined place, increasing the local concentration of necessary
components, and it also offers protection for the viral RNA against host defense
mechanism.

7
1.3 Hepatits C virus
Hepatitis C was recognized as a distinct form of liver disease in the mid-1970s with
the advent of diagnostic tests for hepatitis A and B virus infection. The genome of
hepatitis C virus was first cloned in 1989 by screening a λgt11 cDNA expression library,
derived from the plasma of a persistently infected chimpanzee, with hepatitis C patient
serum (Choo et al., 1989). Since then, it was established that hetitis C is caused by a
virus infection.
Around 2% of the world populations are infected by hepatitis C virus. HCV infection
is most often transmitted by percutaneous exposure to blood. HCV accounts for about
20% of acute hepatitis in the US. Acute HCV infection is subclinical or mild in 65-75%
of patients (Alter and Mast, 1994). Following acute infection, only about 15-20% of
patients will clear the virus. About 70% of infected individuals develop persistent
infection, and chronic infection is often associated with serious liver disease (Hoofnagle,
2002). The major long-term complications of chronic hepatitis C are cirrhosis, end-stage
liver disease, and hepatocellular carcinoma, which develop only in a proportion of
patients and only after many years or decades of infection (Hoofnagle, 2002).
The rapidity of viral replication and the lack of error proofreading of the viral
polymerase probably account for the fact that the HCV RNA genome mutates frequently.
As a result, HCV circulates in serum not as a single species but as a population of
quasispecies with individual viral genomes differing by 1% to 5% in nucleotide sequence.
(Martell et al., 1992) Six major genotypes (1 to 6) and more than 50 subtypes of HCV
have been described (Bukh et al., 1995). In the United States, genotypes 1a and 1b
account for approximately 75% of cases of chronic hepatitis C (Lau et al., 1996).
8
Differences in nucleotide sequence could result in differential activity of HCV proteins,
which could alter the rate of HCV replication, and the host’s interferon response to HCV
infection, and the pathogenicity of the virus (Dusheiko et al., 1994; Simmonds, 1995;
Simmonds et al., 1994).
Current treatment for HCV infection is the combination of interferon α and Ribavirin.
The combination therapy yields a response rate of 54-56% (Feld and Hoofnagle, 2005).
Patients with genotype 1 were still relatively resistant to therapy with only 25% of those
treated for 48 weeks exhibiting a sustained response compared to nearly 70% of those
with other genotypes (Feld and Hoofnagle, 2005).

1.3.1 HCV RNA genome and classification
HCV has a positive-sense RNA genome of 9.6kb in length. The RNA genome
contains only one open-reading frame which encodes one large polyprotein. The open
reading frame is flanked by untranlated reiongs (5’UTR and 3’UTR). Both 5’UTR and
3’UTR contain unique secondary structures which are important for translation and viral
RNA replication.
HCV 5’UTR is typically 341 nt in length and serves as internal ribosome entry site
(IRES). The secondary structure of the 5’UTR appears to be highly conserved among
HCV, GBV-B and pestiviruses. The IRES is required for the HCV protein translation. In
contrast to the IRES of EMCV (a piconavirus), HCV IRES-mediated translation does not
require any of the canonical eukaryotic initiation factors (Pestova et al., 1998), although it
appears to be enhanced by specific interaction of stem-loop III with eIF3 (Sizova et al.,
1998). Other cellular proteins shown to bind to the 5’UTR include PTB (Ali and
9
Siddiqui, 1995), hnRNP L, La (Ali and Siddiqui, 1997) and unknown proteins of
approximately 25kDa and 87 kDa (Fukushi et al., 1997).
The full-length HCV 3’UTR consists of a poorly conserved sequence of
approximately 40 nt and an internal poly(U/C) tract, followed by a highly conserved 98-
nt sequence. The last 45nt of 3’UTR form a highly stable stem-loop structure (Blight and
Rice, 1997). Specific interaction of PTB with HCV 3’UTR has been reported and may
be involved in RNA replication. (Gontarek et al., 1999; Ito and Lai, 1997) Other than
PTB, other cellular factors might also interact with HCV 3’UTR, including La, hnRNPC,
GAPDH, HuR (Luo, 1999; Petrik et al., 1999; Spangberg et al., 1999).
Based on the properties of HCV genome, HCV was classified into a separate genus,
Hepacivirus, of the family Flaviviridae, which includes two other members, Flavivirus
and Pestivirus. HCV is more closely related to pestiviruses than to flaviviruses, based on
the extent of similarity in the nucleotide sequences and secondary structures of their
5’UTR. HCV appears to be even more closely related to a group of recently cloned
viruses GBV-A and GBV-B and GBV-C/ hepatitis G virus, known as GB agents.

1.3.2 HCV polyprotein processing and the functions of viral proteins
The polyprotein is processed into at least 10 individual proteins (Core-E1-E2-p7-
NS2-NS3-NS4A-NS3-NS4A-NS4B-NS5A-NS5B). Core to p7 proteins are structural
proteins and are cleaved by cellular proteases. NS2 to NS5B are nonstructural proteins
cleaved by viral proteases (Bartenschlager and Lohmann, 2000). Two viral proteases
were identified from the polyprotein. One is Zinc-stimulated NS2-3 protease and NS3
serine protease. The NS2-3 protease cleaves the junction between NS2 and NS3 by an
10
autolcatalytic mechanism (Grakoui et al., 1993; Hijikata et al., 1993). NS3 protease
cleave the junctions between NS3-NS4A, NS4A-NS4B, NS4B-NS5A and NS5A-NS5B.
Core protein is the viral capsid for RNA genome encapsidation. The size of core
protein is 21kDa; a further maturation process might happen to produce core proteins
with smaller size (Hussy et al., 1996a; Santolini et al., 1994). As a capsid protein, Core
protein has RNA-binding ability, and oligomerization activity, and interacts with E1
protein, which might be important for virus assembly (Lo et al., 1996; Matsumoto et al.,
1996; Santolini et al., 1994). Other than these structural roles, core protein also interacts
with 60S ribosomal subunits, associates with lipid droplet, colocalizes with
apolipoprotein II, and interacts with lymphotoxin- β receptor and tumor necrosis factor
(Barba et al., 1997; Chen et al., 1997; Matsumoto et al., 1997; Santolini et al., 1994; Zhu
et al., 1998). Since core protein has multiple functions in cell, many research reports
have provided evidence that core protein has a profound effect on HCV pathogenesis.
E1 (37kDa) and E2 (71 kDa) proteins are glycoproteins on the surface of virus
particle, and are key components for receptor binding and cell fusion. Both E1 and E2
have a C-terminal hydrophobic domain for membrane retention (Hussy et al., 1996b).
Both E1 and E2 are sensitive to endoglycosidase H digestion and lack sialic acid,
suggesting that both glycoproteins are localized in ER membrane. (Spaete et al., 1992)
The C-terminal domain of E2 is required for the formation of E1-E2 complex (Cocquerel
et al., 1998; Michalak et al., 1997). N-terminal region of E2 protein exhibits a high
degree of variability in different HCV genotypes, which is called hypervariable region 1
(HVR1). The variation of HVR1 may be a result of the antibody selection of immune-
escape variants (Ogata et al., 1991; Shimizu et al., 1996). E2 could be the main protein
11
to interact with receptor on the cell surface during the infection process. In addition, E2
has been shown to inhibit the activity of PKR, the double-stained RNA-activated
RNAase, which may contribute to the HCV pathogenesis. (Taylor et al., 1999)
P7 protein functions as an ion channel (Griffin et al., 2003; Pavlovic et al., 2003), but
its function in virus replication is still unclear. NS2 protein is a hydrophobic protein. As
mentioned previously, the main function of NS2 is to cleave NS2-NS3 junction. NS2 is
dispensable for virus replication.
NS3 (72kDa), relatively hydrophilic, has an N-terminal serine protease domain and a
C-terminal RNA helicase/NTPase domain (Penin et al., 2004). Therefore, NS3 is
important not only for polyprotein processing but also for RNA replication. NS4A (6kDa)
is a cofactor for NS3 protease activity and anchors NS3 to cellular membranes through an
N-terminal hydrophobic peptide (Wolk et al., 2000). The DExH/D-box RNA helicase of
NS3 uses the energy of NTP hydrolysis to unwind double-stranded RNA (Tai et al.,
2001). These enzyme activities may be involved in unwinding the double–stranded
replication intermediate or regions of secondary structure for RNA replication. Since
NS3 has multiple enzyme activities for viral replication, it has been a potential target for
HCV inhibitors. Other than its crucial role in replication, NS3/4A has been shown to be
involved in interfering with host defense to viral replication, which has drawn a lot of
attention in HCV research.
NS4B (27kDa), a membrane protein with four transmembrane domains, is essential
for virus replication. The main function identified for NS4B is the membrane alteration
activity which may produce the platform for HCV replication (Egger et al., 2002).
12
NS5A (58kDa), similar to NS3, is relatively hydrophilic, but NS5A itself has a
amphiphathic helix at its N-terminus for membrane association (Brass et al., 2002)
(Fig.1-1B). NS5A has at least two forms from differential phosphorylation on serine
residues. Although the exact function of NS5A is not well understood, NS5A has an
RNA-binding domain, and the mutations on NS5A affect the RNA replication rate,
suggesting an important role of NS5A in RNA replication (Blight et al., 2000;
Tellinghuisen et al., 2004; Tellinghuisen et al., 2005). The mutation of NS5A on the so-
called interferon sensitivity-determining region (ISDR) is linked to the responsiveness of
patient to the interferon treatment (Enomoto et al., 1995; Enomoto et al., 1996). Indeed,
NS5A can inhibit to PKR activation through the NS5A amino acid sequence in the ISDR
region (Gale et al., 1998).
NS5B (68kDa) is the RNA-dependent RNA polymerase (RdRP), the driving force for
RNA replication. The NS5B transmembrane domain is located on the C-terminal 21
amino acid residues (Schmidt-Mende et al., 2001). The enzyme has typical right-handed
“finger-palm-thumb” domain of the polymerase. (Penin et al., 2004).
Other than the large polyprotein, HCV RNA also encodes a small protein produced
by ribosomal frame shifting with the size of 17kDa, called F (frame shift) or ARFP
(alternative reading frame protein) (Walewski et al., 2001; Xu et al., 2001). Whether F
protein is involved in RNA replication or HCV pathogenesis is still unclear.

1.3.3 HCV Replication cycle:
The main obstacles for HCV study for a long time were the lack of a productive cell
culture system and the lack of a small animal model. Most of the HCV knowledge was
13
derived from the characterization of clinical samples and viral proteins in exogenous
expression systems. Therefore, the development o the HCV replicon system has been a
critical breakthrough for HCV research (Lohmann et al., 1999) (Chapter2 for more
details). The replicon system has become an important tool for RNA replication studies.
More excitingly, based on the replicon system derived from HCV JFH-1 strain, a
productive cell culture system for infectious HCV particles has been developed
(Lindenbach et al., 2005; Zhong et al., 2005). With the newly developed system, the
understanding of HCV replication cycle will become more clear in the near future.
The HCV replication cycle might start from the interaction between viral
glycoproteins and the receptor on the cell surface. E2 protein interacts specifically with
CD81 (Pileri et al., 1998), and the HCV entry might be CD81-dependent, based on
studies on the retrovirus pseudoparticles system. However, CD81 is not sufficient for
HCV virus entry, and other factors may be required for virus entry (Cormier et al., 2004b;
McKeating et al., 2004). Other than CD81, Several receptor candidates have been
proposed, including low-density lipoprotein receptor, scavenger receptor class-B type-I
(SR-BI), L-SIGN and DC-SIGN (Agnello et al., 1999; Cormier et al., 2004a; Scarselli et
al., 2002). The exact mechanism for HCV entry may need more evidences to clarify.
After virus and receptor binding, the virus internalization step may take place by
endocytosis through a pH-dependent pathway (Hsu et al., 2003). Then, the RNA genome
is released into the cytoplasm for translation and RNA replication. Since HCV has a
positive-stand RNA genome, the RNA can be used for translation directly. The
polyprotein encoded from the RNA genome is processed into mature viral proteins,
leading to RNA replication. Finally, the virus assembly and budding might happen on
14
ER membrane, and the mature virus particle might be released through the secretory
pathway (Lindenbach and Rice, 2005).

15
1.4 Coronaviruses
1.4.1 RNA genome and Classification
Coronaviruses, a genus in the family of Coronaviridae, are enveloped positive-
stranded RNA viruses. Coronaviruses are unique in their virion morphology with large,
petal-shaped spikes around the virus particle and the nucleocapsid are long, flexible
helices. Other than Mouse hepatitis virus (Chapter5), human coronavirus (HcoV), avian
infectious bronchitis virus (IBV), bovine coronavirus (BCoV), porcine transmissible
gastroenteritis (TGEV), and the emerging virus, the severe acute respiratory syndrome
virus (SARS-CoV) are some members in the Coronaviruses genus. Their lengths of
RNA genome range from 27kb for HCoV-229E to 31kb for the mouse hepatitis virus-
A59, establishing the coronavirus genome as the largest known among RNA viruses.
(Brian and Baric, 2005; Holmes and Lai, 1996)
In Fig.1-2 A, Mouse hepatitis virus is used as an example to show the basic
organization of the coronavirus genome. The RNA genome is capped and polyadenylated
with 8 to 9 open reading frames (ORF). Two-thirds of the genome (~ 20kb) consists of
two overlapping ORF (1a and 1b) encoding one large polyprotein. The polyprotein is
processed into 14-16 nonstructural proteins involved in proteolytic processing, genome
replication, and subgenimic mRNA synthesis. The rest of one-third of the genome
encodes major structural proteins, including hemaglutinin-esterase protein (HE), spike
protein (S), small envelope protein (sM, or E protien), membrane protein (M) and
nucleocapsid protein (N) and some nonstructural proteins (gene 2,4,5) (Holmes and Lai,
1996).
16
The 5’UTR of MHV (A59) RNA genome is 209 nt in length containing an AUG-
initiated ORF which potentially encodes peptides of 8 amino acid. The small ORF is
universally seen in other coronaviruses. The short ORF may have a regulatory role in the
translation of the downstream ORF (Morris and Geballe, 2000). 5’UTR also contains a
leader sequence of 60nt in length; this leader sequence is also present in all subgenomic
mRNA. In front of ORF2 to ORF7, there is an intergenic sequence (UCUAAAC, the
vertical line in Fig1-2A) which is the recognition site for leader sequence in the
subgenomic mRNA transcription. The 3’UTR of MHV is 324 nt, and has a conserved
octameric sequence upstream of the poly(A) tail (Lai et al., 1994; Lin et al., 1994). Both
5’UTR and 3’UTR contain secondary structures for cellular factor interaction and RNA
replication (Brian and Baric, 2005; Shi and Lai, 2005). Moreover, the extremely large
gene 1 of coronavirus is translated as ORF1a and 1b, with 1ab resulting from
pseudoknot-induced -1 ribosomal frame shifting event at a slippery sequence of
UUUAAAC at the ORF 1a /1b junction (Bredenbeek et al., 1990; Brierley et al., 1987).

1.4.2 Viral proteins of Cornnavirus
ORF1 polyprotein could be processed into 14-16 mature proteins form the replication
complex or replicase. These nonstructural proteins include papain-like cystein proteases
(PLPs), a chymotrypsin/picornaviral 3C-like protease (3CLP), membrane-associated
proteins (MP1 and MP2), RNA-dependent RNA polymerase (RdRp), NTPase/helicase,
and some proteins with unknown functions. Some enzyme activities, which are rarely
found in other RNA viruses, have been predicted from the coronavirus replicase,
including putative sequence-specific endoribonuclease, 3'-to-5' exoribonuclease, 2'-O-
17
ribose methyltransferase, ADP ribose 1"-phosphatase and, in a subset of group 2
coronaviruses, cyclic phosphodiesterase activities. The functions of these putative
enzyme activities are still unclear (Ziebuhr, 2005).
Structural proteins are components of virus particles, including HE, S, E, M, and N
proteins for MHV. HE protein is found in only some coronaviruses, and is not required
for infectivity (Yokomori et al., 1991). The HE protein may permit the initial adsorption
of the virus to cell membranes, but the subsequent interaction of S protein with cellular
receptor is crucial for virus entry. S protein forming the petal-shaped protruding on the
surface of viral envelope is the main protein interacting with receptor on the cell surface.
S protein is cotranslationally inserted into RER and transported to Golgi and also plasma
membrane. S protein is heavily modified with glycosylation, actylation and disulfide
bounds, and the mature S protein is as homotrimeric form (Opstelten et al., 1993;
Schmidt, 1982; Sturman et al., 1985). S proteins of some coronaviruses (e.g. MHV) are
cleaved near the center by cellular proteases, and become two separate proteins, S1 and
S2 (Sturman et al., 1985). Other than the role in the virus entry step, S protein also plays
a role in cell-cell fusion during the virus infection (Vennema et al., 1990) (Holmes and
Lai, 1996).
sM or E protein is a small hydrophobic protein (12kDa) present in the virus particle.
The function of E protein is still unclear (Gorbalenya et al., 1989). M protein, another
hydrophobic membrane protein, penetrates the lipid bilayer three times with N-termial
glycosylated, and a large C-terminal domain toward cytosolic face (Armstrong et al.,
1984; Locker et al., 1992). M protein interacts with the nucleocapsid protein, which may
be important for virus assembly process (Sturman et al., 1980). N protein binds viral
18
genomic RNA to form helical nucleocapsid. Other than the structural role, N protein
plays a role in replication process. N protein binds tightly to the intergenic sequence and
may influence the translation rate (Holmes and Lai, 1996; Nelson et al., 2000; Tahara et
al., 1998).

1.4.3 Replication cycle
As shown in Fig.1-2B, the first step for virus infection is mediated by the interaction
of S protein with receptor on the cell surface. The MHV S protein recognizes MHV
receptor (MHVR), a biliary glycoprotein which is a member of the carcinoembryonic
antigen family of glucoproteins in the immunoglobulin superfamily. Splicing variants of
MHVR and another allele of MHVR, mmCGM2, can also serve as MHV receptors.
(Dveksler et al., 1993; Dveksler et al., 1991; Williams et al., 1991; Yokomori and Lai,
1992) After binding, virus penetration occurs by S protein-mediated fusion of viral
envelope with the plasma membrane or with the endosomal membrane for some strains
(Gallagher et al., 1991; Kooi et al., 1991). The genomic RNA can be used as the
template for ORF 1 translation; then the products from ORF1 form replication complexes
to support the replication of negative-sense genomic and subgenomic mRNAs (Fig.1-2B).
Then, these negative sense RNAs serve as templates for the more positive-sense RNA
production. The posive-sense subgenomic RNA are used as the templates for the
translation of structural proteins and some nonstructural proteins. The positive-sense
genomic RNAs will be packed by these structural proteins to form mature virus particles
(Holmes and Lai, 1996; Sawicki and Sawicki, 2005).
19
Similar to other positive-sense RNA viruses, the RNA replication of coronaviruses
also takes place on the membrane. The replication complex has known markers for ER
and Golgi and the late endosome (Gosert et al., 2002). The replication complex is
intimately associated with double membrane structures and the anchored proteins are the
hydrophobic sequence-containing intermediate cleavage products p290, p150, and p210
and p44 of ORF1a. (Brian and Baric, 2005; Gosert et al., 2002; Shi et al., 1999; Sims et
al., 2000) Two populations of membrane-associated replication complexes are separated
by isopycnic sedimentation. In MHV the less dense fraction was found to contain p65
and p1a-22, whereas the denser fraction contained p28 and helicase from ORF1b and N.
(Sims et al., 2000) The difference between these two population is not yet fully
understood. At the final step, the budding process might happen between RER and Golgi,
and the mature virus particles will be released through the secretory pathway for the next
round of infection (Gosert et al., 2002; Tooze and Tooze, 1985).

HCV and coronavirus are very different in various aspects, but both of their
replication cycles are tightly linked to cell membrane. In the following chapters, we will
see the how HCV membrane protein NS4B possesses some properties for its function,
and how NS4B-interacting proteins are involved in HCV replication. In the last chapter,
we will see the coronavirus deals with plasma membrane through a ubiquitin-proteasome
dependent pathway.

20
Chapter 2: HCV NS4B
2.1 Abstract
Hepatitis C Virus NS4B induces specialized membrane structure (Egger et al., 2002),
which could be an important replication platform for HCV replication. NS4B is also
crucial for maintaining the replication complex in detergent-resistant fractions. The
present studies mainly focus on the characterization of NS4B protein in order to reveal
the mechanism by which NS4B could execute its functions. Several conclusions have
been made from this research. (1) Subdomains of NS4B respond similarly to the
detergent treatment. (2) NS4B is palmitoylated, and the plamitoylation is insensitive to
Brefeldin A treatment, suggesting that the modification occurs in a pre-Golgi
compartment. (3) NS4B palmitoylation is mainly on cysteine 257 residue and partially
on Cysteine 261 at the C-terminal end of NS4B. (4) The NS4B with dual cysteine
mutations has higher protein expression level, suggesting that the NS4B lipid
modification might have negative regulatory effect on NS4B protein stability. (5) The
NS4B lipid modification is important for protein-protein interaction and replication site
targeting. (6) The palmitoylation inhibitor, 2-bromopalmitate, inhibits HCV RNA
replication, suggesting that NS4B lipid modification could be important for RNA
replication. (7) NS4B has polymerization activity, and the polymerization determinants
are distributed on the both cytoplasmic ends of NS4B. (8) The NS4B palmitoylation of
C-terminal end contributes to the polymerization activity. (9) The polymerization
determinants of NS4B N-terminus are scattered in the N-terminus. The lipid
modification and polymerization activity could be two important properties for NS4B to
induce specialized structure maintaining virus RNA replication.
21
2.2 Introduction
2.2.1 HCV Subgenomic replicon
The understanding of replication cycle of HCV had been hampered by the lack of
proper cell culture system for years. In 1999, the discovery of HCV subgemonic replicon
system had provided a great tool for the studies of HCV replication complex (Lohmann et
al., 1999). The intensive subgenomic-based researches have made tremendous
progresses in understanding HCV replication, and have prompted the discovery of
replicon-based cell culture system which produces infectious virus particles (Lindenbach
et al., 2005; Wakita et al., 2005; Zhong et al., 2005).
The subgenomic replicon contains all the essential components for RNA replication
inside cell, including the cis elements which are 5’ and 3’ untranslated region (UTR) and
trans element which is NS3-NS5B polyprotein (Fig.2-1). Neomycin phosphotransferase
gene is included in the replicon as a selection marker for replicon-containing cells. Other
than the HCV IRES (internal ribosome entry site) at the 5’ end, an exogenous EMCV
IRES is placed between neomycin gene and NS3-5B gene to drive the NS3-5B
expression. When the in vitro transcribed replicon RNAs are introduced into cells, the
replicon replicates inside cells. Under the G418 (neomycin sulfate) selection pressure,
only cells harboring replicating replicons could survive (Fig.2-1). The subgenomic
replicon has been an important tool to study how cis and trans elements contribute to
HCV RNA replication.

22
3 4A 4B 5A 5B Neo
RNA transfection
G418 selection
5’ UTR 3’ UTR
E-IRES
Fig.2-1 The replication of subgenomic replicon inside cells. Subgenomic replicon RNA contains HCV 5’
and 3’ untranslated regions (UTR) which are essential for RNA replication. The RNA encodes two open
reading frames: one is Neomycin selection marker driven by HCV IRES ( internal ribosome entry site); the
other one is NS3-NS5B polyprotein driven by exogenous EMCV-IRES. The NS3-NS5B polyprotein support
the constitutively replication of subgenomic RNA inside cells.

2.2.2 HCV replication complex and subcellular microdomain
Based on the subgenimic replicon system, the HCV RNA replication complex has
gradually been characterized. Most of the viral proteins expressed in the context of
subgenomic replicon are localized exclusively in the cytoplasm, with a reticular
distribution and more intensive in the perinuclear area as shown by the
immunofluorescence staining (Mottola et al., 2002). The HCV-specific plus-strand RNA
is distributed as bright dots in the cytoplasm, with some accumulation in the perinuclear
region by fluorescence in situ hybridization (FISH) (Gosert et al., 2003). By electron
microscope examination, the subgenomic RNA replication was shown to disrupted the
special organization of the rough ER and, more dramatically, induced a membranous web
23
in the cell. The membranous web contains HCV nonstructural proteins and newly
synthesized RNA, suggesting that the membranous web could be the HCV replication
complex (Gosert et al., 2003).
Other than microscope examination, several biochemical methods have been
established to characterize the HCV replication complex (Aizaki et al., 2004; Gao et al.,
2004; Shi et al., 2003; Waris et al., 2004). Recently, Shi et al. from our lab has shown
that the HCV RNA replication occurs on a lipid raft membrane structure. This
specialized membrane structure is resistant to nonionic detergent (NP40) treatment and
co-fractionated with caveolin-2, a lipid-raft associated intracellular membrane protein.
Lipid rafts, the microdomains of the biological membrane, are enriched in cholesterol
and glycosphingolipid. The saturated acyl chains of glycolipids are tightly compacted in
the presence of cholesterol. The tight packing organization of lipid rafts confers their
resistance to some detergents, such as the nonionic detergent Triton X-100 at low
temperature, and allows their purification from low density fractions after flotation in a
sucrose gradient. The membrane microdomains have been linked to various biological
processes, such as signal transduction pathways, protein sorting pathways and virus
replication (Chazal and Gerlier, 2003; Helms and Zurzolo, 2004; Ikonen, 2001).
HCV replication complexes are concentrated in the NP40-resistant fraction after
flotation in the sucrose gradient, providing a biochemical method to characterize the
specific microenvironment of HCV RNA replication. The molecular driving forces that
carry the constituent proteins of the replication complex to the specialized membrane
domain could involve either viral proteins or cellular factors or both. Gao et al. from our
lab has provided evidence that NS4B and the cellular protein hVAP-33 (human
24
homologue of VAMP-associates protein of 33 kDa) could be the two main players to
bring the entire replication complex together in the detergent-resisitant membrane.

2.2.3 NS4B and HCV replication
NS4B protein is a relative hydrophobic membrane protein with a protein size of 27-
kDa. According to a topology study (Lundin et al., 2003), NS4B has 4 transmembrane
segments, with the N and C termini located in the cytoplasm. The amino acid
composition of cytoplamic N-terminus is very hydrophobic; a fifth transmembrane
domain has been proposed in this region (Lundin et al., 2003). However, it is still
unknown whether the flipping of the fifth transmembrane domain exists or not. A
putative amphipathic helix on 1-26 amino acid residues of NS4B N-terminus is crucial
for virus replication (Elazar et al., 2004). A nucleotide binding motif located between the
second and third transmembrane domains of NS4B was identified recently (129-135
amino acid residues of NS4B) (Einav et al., 2004).

Fig.2-2 The topology of HCV NS4B protein. NS4B protein has four transmembrane domains
NS4B has 4 transmembrane segments with the N and C termini located in the cytoplasm (Lundin
et al., 2003). A putative amphipathic helix on 1-26 amino acid residues of NS4B N-terminus is
crucial for virus replication (Elazar et al., 2004). A nucleotide binding motif located between
second and third transmembrane domain of NS4B was identified recently (129-135 amino acid
residues of NS4B)(Einav et al., 2004).

25
Although the function of NS4B in virus replication is still unclear, the most striking
finding is that the expression of NS4B alone or in the context of HCV polyprotein
induces a specialized membranous web, which has been proposed as the HCV RNA
replication complex (Egger et al., 2002). As mentioned before, NS4B has a crucial role
in maintaining the replication complex in the detergent-resistant membrane. The
induction of membranous web and the central role in lipid raft targeting have implicated
the structural role of NS4B in the virus replication. Therefore, in the present study, we
have tried to further define the characters of NS4B protein by which NS4B executes its
structural role in HCV RNA replication.

26
2.3 Materials and Methods
2.3.1 Cell cultures, viruses and antibodies
Huh7 cells were grown in Dulbecco’s modified Eagle medium supplemented with
10% fetal bovine serum and non-essential amino acids. Huh7 cells harboring HCV
subgenomic replicon were maintained in D-MEM containing 0.5 mg/ml of G418 (Gibco-
BRL, Gaithersburg, MD). The recombinant vaccinia virue encoding T7 RNA
polymerase (Wyatt et al., 1995) was amplified in HeLa cells. The mouse monoclonal
antibody against NS5A was purchased from Biodesign (Saco, ME). The rabbit anti-Flag
antibody was purchased from Sigma (St. Louis, MO). The rabbit anti-GFP antibody was
purchased from CHEMICON (Temecula, CA).

2.3.2 Plasmids
The NS4B (genotype 1a, isolate H77) and NS4B truncation mutants were PCR-
generated with Flag sequence at the N-terminus and stop codon at the C-terminus, and
the fragments were ligated into pcDNA3.1/V5-His expression vector (Invitrogene,
Carlsbad, CA) by TA cloning. The stop codon was designed on the reverse primer, such
that these proteins do not have the V5 and His tag on the C-terminus end. All of the
deletion mutants were PCR amplified by primers (containing flag-tag sequences) and
cloned into pcDNA3.1 vector by TA cloning. The vector provides a CMV promoter for
expression in mammalian cells and a T7 promoter recognized by T7 RNA polymerase.
The cysteine mutantation on Flag-NS4B (C257A, C261A, and double mutant) and
replicon pUC-Rep/S1179I (Lee et al., 2004) (C257A, C261T, and double mutants) were
generated by using the Quickchange mutagenesis kit, according to the manufacturer’s
27
instruction. (Stratagene, La Jolla, CA). The mutation sites were confirmed by sequencing.
By the TA cloning strategy, NS4B and mutants containing various cysteine mutations
were amplified by PCR and fused to pcDNA3.1/NT-GFP-TOPO vector (Invitrogene,
Carlsbad, CA). The mutation sites were confirmed by sequencing. The NS4B 1-71 and
191-261 amino acid residues were amplified by PCR with BamHI cutting site on both
ends; then the fragments were cloned into the BamHI site of pEGFP-N1 vector
(CLONTECH, . Palo Alto, CA).

2.3.3 Metabolic Labeling and Immunoprecipitation.
Huh7 cells were transfected with various constructs by using Fugene 6 reagent
(Roche, Penzberg, Germany), and then, infected with vaccinia virus carrying T7
polymerase (mio = 10). The infected cells were incubated in labeling medium (D-MEM,
2% FBS, non-essential amino acid, 5mM sodium pyruvate) containing 0.33 mCi/ml
[9,10-
3
H(N) ]- palmitic acid (PerkinElmer, Boston, MA) at 37°C for 12 hours. For
protein expression detection, another set of infected cells was incubated in the same
labeling medium containing 15 µCi/ml of
35
S-Translabel (ICN, Costa Mesa, CA). After
incubation, the cells were washed once with ice-cold PBS and lysed in RIPA buffer [50
mM Tris-HCl pH7.5, 150 mM NaCl, 5mM EDTA, 1% NP40, 0.5 % Sodium
deoxycholate, 0.1% SDS, 1mM PMSF, 1X Complete Protease Inhibitors (Roche,
Mannheim, Germany) ]. The cell lysate was collected and centrifuged at 1000 xg for 10
min; the supernatant was collected for immunoprecipitation. Flag-tagged proteins were
purified from the supernatant by using anti-FLAG M2 affinity gel (Sigma, Sant Louis,
MO). After overnight incubation with the supernatant at 4°C, the gel was washed with
28
RIPA buffer three times. SDS-PAGE sample buffer without DTT was added to the
washed agarose gel, and the samples were heated at 65°C for 5 min and run on the tricine
gel. The signals from the gel were detected by autoradiography.

2.3.4 Protein purification, trypsin digestion and mass spectrometry
NS4B proteins were expressed in Huh7 cells by plasmid DNA transfection and the
VV-T7 infection. Cell lysate was prepared in PIPA buffer, and the NS4B proteins were
purified by anti-Flag argarose gel. After wishing with RIPA buffer and PBS three times
respectively, the proteins were eluted from the argarose gel with 1% acetic acid and dried
by speed-vac. The eluted protein was dissolved in 20 µl 8M urea and 0.4M NH
4
HCO
3
,
and then, incubated in 50°C 15 min after 5 µl 45mM DTT was added to reduce the
protein. After cooling to room temperature, alkylation was performed by adding 5 µl
100mM iodoacetamide to the reaction and incubating at room temrature for 15 min. The
final trypsin digestion step was performed in 2M urea, 0,1M NH
4
HCO
3
with 1 µg trypsin
at 37°C for 24hr. The digested protein was frozen and ready for mass spectrometry
analysis.

2.3.5 Colony formation assay
To address the role of NS4B Cys257 and Cys261 in replicon replication, the
replication activity of pUC-Rep containing C257A, C261T or double mutation
(C257A,C261T) were tested by colony formation assay (Guo et al., 2001). The plasmids
were linearized with Sca I, and used as templates for in vitro RNA transcription by using
MEGAscript kit (Ambion, Austin, TX). The in vitro transcribed RNAs (40 µg) were
29
transfected into Huh7 cells (4 ×10
6
cells in 400 µl serum-free D-MEM) by eletroporation
with Gene Pulser II (Bio-rad, Hercules, CA) set to 220V and 975 µF. One-fourth of the
eletroporated cells were plated onto one 10-cm plate in D-MEM containing 1.25%
DMSO. After overnight incubation, the medium was changed to D-MEM containing 500
µg/ml of G418 (Gibco-BRL, Gaithersburg, MD). The G418-resistant colonies were
stained with 0.1 % crystal violet (in 20% ethanol) after 4 weeks of selection.

2.3.6 Membrane Flotation assay
The membrane flotation assay was performed as previously described (Shi et al.,
2003). Cells were incubates in 500 µl hypotonic buffer (10 mM Tris-HCl pH7.5, 10mM
KCl and 5mM MgCl
2
) on ice for 20 min. The swollen cells were passed through 25-
Gauge needle 20 times to disrupt the cells, followed by 1000 ×g centrifugation (4°C) to
remove nuclear fraction. Cell lysate was treated with 1% NP40 on ice for one hour and
mixed with 3 ml 72% sucrose in low salt buffer (LSB, comprising 50mM Tris-HCl pH7.5,
25mM KCl, 5mM MgCl
2
). The lysate was placed at the bottom of SW41Ti tube, and 4
ml 55% sucrose and 1.5 ml 10% sucrose (in LSB) were overlaid on top of the lysate
sequentially. The sucrose gradient was centrifuged at 38,000 rpm in a Beckman SW41Ti
rotor at 4°C for 14 hours. After centrifugation, 1ml-fractions were collected from the top
of the gradient, and subjected to either immunoprecipitation or immunobloting after the
samples were concentrated by Centricon YM-10 filter unit.

30
2.3.7 Polymerization assay (Matsumoto et al., 1996)
After DNA transfection and VV-T7 infection, the cells were washed with PBS once
and collected by scraping into PBS. After centrifugation, the cell pellet was resuspended
in hypotonic buffer (10 mM Tris-HCl pH7.5, 10mM KCl and 5mM MgCl
2
), and
incubated on ice for 20 min. The swollen cells were passed through a 25-Gauge needle
20 times to disrupt the cells, followed by 1000 ×g centrifugation to remove nuclear
fraction. The supernatant was incubated with glutaraldehyde (Sigma, Sant Louius, MO)
at a final concentration of 0.01% at room temperature for various time periods. The
reaction was stopped by adding SDS-sample buffer; the samples were subjected to
Western blotting.

2.3.8 Co-immunoprecipitation
Co-immunoprecipitation was used to characterize whether exogenous NS4B or NS4B
mutants could be targeted to the replication site. The Huh7 cells harboring subgenomic
replicon were transfected with various constructs and infected with VV-T7 at 24hr post-
transfection. The infected cells were washed with PBS once and scraped into PBS. After
brief centrifugation, the cell pellet was resuspended in buffer A (10mM HEPES-KOH
pH7.8, 10mM KCl, 1.5mM MgCl
2,
20% glycerol) containing 1% NP40, 1 × Complete
protease inhibitor and 1 mM PMSF, incubated on ice fro 20 min. After centrifugation at
1000×g, 4°C for 5 min, the supernatant was collected and mixed with an equal volume of
2× TM10 buffer (100 mM Tris-HCl pH

7.9, 200 mM KCl, 50 mM MgCl
2
, 2 mM EDTA,
20% glycerol, 0.2% NP40). The cell lysate was incubated with anti-FLAG M2 affinity
gel at 4°C overnight. Then, the agarose gel was washed with 1x TM10 buffer three times,
31
and eluted with 3 × FLAG peptide. The eluents were subjected to immunobloting by
using HCV patient serum or NS5A antibody.

2.3.9 GFP protein examination and lipid droplet staining.
After DNA trasfection with GFP-NS4B constructs, the cells were fixed in 4%
paraformaldehyde at 4°C for 30min and then mounted in VECTASHIELD mounting
medium (VECTOR, Burlinggame, CA). For lipid droplet staining (Shi et al., 2002), the
cells were fixed in 4% paraformaldehyde and permeablized in 0.1% Triton X-100 in PBS
at 4°C for 30min. Cells were rinsed with 60% isopropanol once and stained with 1% Oil
Red in 60% isopropanol for 2 min at room temperature. Then, the slides were rinsed
with 60% isopropanol and PBS to remove excess dye and mounted in mounting medium.
Confocal microscopy was performed on a Zeiss Confical Laser Scanning Microscope
LSM510.

32
2.4 Results
2.4.1 NS4B subdomains responded similarly to the detergent treatments.
It has been shown that HCV replication complex is in detergent-resistant membrane
and NS4B is crucial for maintaining the replication complex in the raft microdomain.
The first question I have tried to address was whether I could identify specific domain on
NS4B protein to perform this function. TMAP (Persson and Argos, 1994) and TMHMM
program (Krogh et al., 2001) were used to predict the transmembrane domains of NS4B
protein. Both programs predicted four transmembranes from NS4B protein sequence
(genotype 1a) with variations on the exact sites of transmembrane regions. To define the
lipid raft targeting domain, a series of NS4B deletion mutants were designed by
following the TMAP prediction map. As shown in Fig.2-3, four predicted
transmembrane segments are 72-92, 101-121, 136-156, 172-197 amino acid residues of
NS4B. M1, M2, M5, M7 and M9 were designed with deletion of various portions of
NS4B.
M1(NS4B1-197) lacks the C-terminal cytoplasmic portion of NS4B. M2 and M5 are
N-terminal and C-terminal half, respectively, of NS4B. M7 has the four transmembrane
domains of NS4B. M9 has the third and fourth transmembrane domains of NS4B. These
mutants were transiently expressed in Huh7 cells and characterized with regard to their
sensitivity to the NP40 treatment. Similar to the previous results (Gao et al., 2004), full-
length NS4B was in the detergent-resistant fractions, and NS5B was in the detergent-
sensitive fractions (as negative control) (Fig.2-3). Surprisingly, all of the NS4B mutants
analyzed including M9, were resistant to NP40 treatment.

33

Full-length NS4B
M1
M2
M5
M7
M9
GFP-NS4B(1-71)
GFP-NS4B(191-261)
GFP
NS5B
1 2 3 4 5 6 7 8 9
Top Bottom
1 72 92 101 121 136 156 172 197 261
Fig.2-3 Detergent sensitivity test of NS4B mutants. HuH7 cells were transfected with various Flag-tagged
constructs (Full-length NS4B, NS4B deletion mutants and NS5B). After 24hr post-transfection,the cells were
labeled with 35S-Met for 6hours. The labeled cells were harvested, treated with 1% NP40 (4C , 1 hr) and
performed flotation gradient fractionation. Each fraction from flotation gradient was subjected for
immunoprecipitation by anti-flag agarose gel, and the precipitants were analyzed by SDS-PAGE and
autoradiography. For GFP-related constructs, the cells were harvested, treated with 1% NP40 (4C , 1 hr) and
performed flotation gradient directly after 24hr-transfection. The GFP or GFP fusion proteins were detected
by Western Blotting by using anti-GFP antibody.

To characterize the cytoplasmic regions of NS4B (both N-terminus and C-terminus),
we have tried to express these two small fragments in Huh7 cell. Due to the limitation of
detection method or the stability of the small fragments, no specific protein was detected.
Therefore, the two portions of NS4B were fused with GFP and tested by flotation assay.
As shown in Fig.2-3, both of these two fragments relocated GFP protein from sensitive
fractions to resistant fractions. The results suggest that various segments of NS4B have
very similar property to target the protein to the top fractions of the sucrose gradient in
the presence of NP40 treatment. We also have tested other detergents which are
commonly applied for purification of raft microdomains to attempt to differentiate these
NS4B mutants (Schuck et al., 2003). However, these mutants tend to respond to these
34
detergents in a similar ways. For example, the fragments were sensitive to Triton X-100,
Brij98, and partially resistant to Saponin (data not shown). This result also supports the
possibility that amino acid composition throughout NS4B protein gives the protein a high
tendency to target the protein to a specific microenvironment.

2.4.2 NS4B is palmitoylated.
Three common protein modifications in the lipid-raft resident proteins are GPI
(glycosylphosphatidylinositol) modification, N-terminal myristoylation plus
palmitoylation (Met-Gly-Cys motif), and dual palmitoylated Cys residues (Melkonian et
al., 1999). The NS4B protein sequence contains a potential lipid modification site in the
two cysteine residues of the C-terminus. Only three cysteine residues (Cys187, 257 and
261) are found in the NS4B amino acid sequence (genotype 1a). Cys 257 and Cys 261
are located at the very C-terminal end of NS4B protein (Cys 261 is the last acid residue
of NS4B).
To test whether NS4B has lipid modification, the transient expression system was
applied to address the issue. NS4B gene was amplified from H77 isolate (genotype 1a)
with Flag sequence on the forward primer, and, then, the amplified fragments were
cloned into pcDNA3.1 vector. To express NS4B in the cells transiently, the vaccinia
virus carrying T7 polymerase (VV-T7) was introduced into the expression system since
the expression plasmids contain a T7 promoter in front of the coding region. The flag-
tagged protein was purified by using Flag-tag affinity gel.
35

Fig. 2-4 Palmitoylation of NS4B. HuH7 cells were transfected with various constructs. After 24 hr post-
transfection, the cells were infected with recombinant Vaccinia Virus expressing T7 RNA polymerase. The
infected cells were incubated in D-MEM overnight in the presence of [9,10-
3
H(N)]-palmitic acid or
35
S-
Methionine. The labeled cells were harvested and subjected for immunoprecipitation by anti-flag agarose gel,
and the immunoprecipitated proteins were analyzed by SDS-PAGE and autoradiography.
54
48
35
24
GFP
Flag-NS4B
Flag-NS5B
NS4B
3
H-Palmitic acid
GFP
Flag-NS4B
Flag-NS5B
73
NS4B
NS5B
35
S-Methionine
54
48
35
24
73
NS4B
(Dimer)

As shown in Fig.2-4, only Flag-NS4B but not Flag-NS5B or GFP control was
palmitoylated. The palmitoylation signal was not only seen on the expected size of
NS4B (around 30 kDa) but also present as the NS4B dimer (around 60 kDa). Since the
reducing agent was eliminated from Laemmli sample buffer to prevent the disruption of
palmitoylation signal from the labeled protein, it was not surprising that some proteins
still remained in a partially denatured status. Since the vaccinia virus was applied in the
expression system, a control virus carrying S protein gene of Mouse Hepatitis Virus was
also tested in parallel to rule out the possibility that the NS4B palmitoylation was due to
the introduction of vaccinia virus system. NS4B protein was not palmitoylated by using
this control virus (data not shown). We also have tried to express NS4B protein by poly-
36
A tailed mRNA transfection. The NS4B protein could be labeled by
3
H-palmitic acid in
this expression condition (data not shown).
2.4.3 NS4B plamitoylation is insensitive to BFA treatment.
BFA - + BFA - +
3
H-palmitic acid
35
S-Methionine
73
54
48
35
24
16
73
54
48
35
24
16
Dimer
Monomer
Dimer
Monomer
Fig. 2-5 Palmitoylation of NS4B is insensitive to Brefeldin A (BFA) . HuH7 cells were transfected with
Flag-NS4B constructs. After 24 hr post-transfection, the cells were infected with recombinant Vaccinia
Virus expressing T7 RNA polymerase. The labeling medium was with or without BFA. The labeled cells
were harvested and subjected for immunoprecipitation by anti-flag agarose gel, and the immunoprecipitated
proteins were analyzed by tricine gel and autoradiography.
In mammalian cells, protein palmitoylation is performed by the palmitoyl
actylatransferases. Palmitoyl acyltransferase activity has been found in fractions
containing plasma membrane, Golgi and mitochondrial membrane (Dunphy et al., 1996).
The enzyme activity is also enriched in sphigomyolin- and cholesterol-rich membrane
microdomains (Dunphy et al., 2001). In the case of vesicular stomatitis virus
glycoprotein and influenza virus hemaglutinin, palmitylation occurs on the intermediate
compartment between ER and cis-Golgi (Bonatti et al., 1989). To test whether the Golgi
apparatus or post-Golgi compartments are important for NS4B palmitoylation, the Golgi
37
cisternae disruption agent, Brefeldin A (BFA) (Klausner et al., 1992) was applied in
palmitoylation labeling experiment. As in Fig.2-5, BFA treatment did not affect NS4B
expression (35S-Methinone labeling) nor palmitoylation, suggesting that palmitoylation
site of NS4B could happen on a pre-Golgi compartment which is similar to VSV-G
protein and hemaglutinin of influenza virus (Bonatti et al., 1989; Veit and Schmidt, 1993).

2.4.4 The palmitoylation sites of NS4B are located on the cytoplasmic region of C-
terminus.
3
H-palmitic acid
35
S-Methionine
5B 4B M1 M2 M5 M7 5B 4B M1 M2 M5 M7
Fig.2-6 Palmitoylation of NS4B deletion mutants. HuH7 cells were transfected with various NS4B deletion
mutants. After 24 h post-transfection, the cells were infected with VV-T7. The infected cells were incubated
in D-MEM overnight in the presence of [9,10-
3
H(N)]-palmitic acid or
35
S-methionine. The labeled cells were
harvested and subjected for immunoprecipitation by anti-flag agarose gel, and the immunoprecipitated
proteins were analyzed by tircine gel and autoradiography.
NS4B
M1
M2
M5
M7
54
48
35
24
73
16
54
48
35
24
73
16
1 72 92 101 121 136 156 172 197 261

To identify NS4B palmitoylation sites, NS4B deletion mutants (M1, M2, M5, and M7)
were applied for the metabolic labeling. As shown in Fig2-6, in these four NS4B
38
deletion mutants, only M5 retained the palmitoylation modification signal. M5 has two
transmembrane segments which are also present in M7. Since M7 is not palmitoylated, I
conclude that the main palmitoylation sites are within the cotyplasmic region (198-261
amino acid residues) of the C-terminal end.

2.4.5 Cystein 257 and Cystein 261 are two palmitoylation sites on NS4B.

1 72 92 101 121 136 156 172 197 261
……………CTTPC
257 261
NS4B
WT
C257A
C261A
C257,261A
WT
C257A
C261A
C257,261A
3
H-palmitic acid
35
S-Methionine
73
54
48
35
24
16
73
54
48
35
24
16
Dimer
Monomer
Dimer
Monomer
1 0.29 1.1 0.00003
Fig.2-7 NS4B is palmitoylated on Cys 257 and Cys261 residue . HuH7 cells were transfected with Flag-
NS4B wild type or cysteine mutants. After 24 hr post-transfection, the cells were infected with VV-T7. The
infected cells were incubated in D-MEM overnight in the presence of [9,10-
3
H(N)]-palmitic acid or 35S-
methionine. The labeled cells were harvested and subjected for immunoprecipitation by anti-flag agarose gel,
and the immunoprecipitated proteins were analyzed by tricine gel and autoradiography. The
3
H signals on the
file were quantified and the relative ratio was shown on the bottom of left penal.

The cysteine residues are the common palmitoylation sites (Bijlmakers and Marsh,
2003; Linder and Deschenes, 2003; Resh, 1999). There are three cysteine residues
39
(Cys187, 257 and 261) in the NS4B amino acid sequence (genotype 1a). M5 mutant
contains all three cysteine residues. Cys187 is also present in M1, M5 and M7, but M1
and M7 did not have strong palmitic acid labeling signals. Therefore, Cys 257 and
Cys261 located at the very end of NS4B protein (Cys 261 is the last acid residue of NS4B)
are the potential palmitoylation sites. To address whether these two cysteine residues are
truly the modification sites, we performed site-directed mutagenesis to replace cysteine
by alanine.
NS4B protein either with single cysteine mutations (C257A orC261A) or dual
mutations (C257,261A) were applied for palmitic acid labeling. As shown in Fig.2-7, the
main palmitoylation site is on Cys275 residue since the C257A mutation dramatically
reduced the palmitoylation signal; on the other hand, the C261A mutant retained the
plamitoylation signal as strong as that of wild type. Although Cys257 is the main
palmitoylation site, Cys257A mutant still retained some signals as compared to the
signals of the double mutant (C257,261A). The protein expression level of these mutants
(
35
S-methionine labeling) was almost the same; therefore, the difference in palmitic acid
labeling was not due to the differences in protein expression level. Interestingly, wild
type, C257A and C261A mutants form dimer, trimer in the tricine gel. On the other hand,
the dual-cysteine mutant did not form dimer or trimer. This phenotype might be related
to the lipid modification of NS4B protein. The polymerization activity will be addressed
in Section 2.4.13.
Several acylated proteins have been shown to incorporate other long chain fatty acid,
including stearate, oleate and arachidonate (Liang et al., 2002; Liang et al., 2004; Resh,
1999; Veit et al., 1996). Since NS4BC257A was weakly labeled by palmitic acid, is it
40
possible that Cys261 is labeled by other type of lipid modification that uses palmitic acid
as precursor? Instead of
3
H-palmitic acid (C16:0), I tried
3
H-stearic acid (C18:0) and
3
H-
myristic acid (C14:0) for metabolic labeling. In the myristic acid labeling, both wild type
NS4B and C261A mutant had week labeling signals. These signals could have been due
to the possibility that the exogenous myristic acid was used for palmitic aic biosythesis.
In the case of stearic acid labeling, there was no obvious labeling signal. However, it is
not certain whether cells could take uo long chain fatty acid easily. I did not further
pursue the stearic acid labeling experiment, but had tried to utilize mass spectrometry to
solve the problem (see below).

2.4.6 PEG-mal treatment of NS4B cyteine residues.
The next question addressed was the extent of the lipid modification status in NS4B?
Are both cycteine residues fully modified or only partially modified by palmitic acid? Is
NS4B C257A mutant modified by other lipid species than palmitate? To answer these
questions, I tried other the biochemical methods to define the modification of the cyteine
residues of NS4B. Recently, O’Mally and Lanzinski have developed a method to
quantify the extent of farnesylation of cyeteine residue located at the C-terminal end of
hepatitis delta virus(HDV) large delta Antigen (L δAg) by using polyethylene glycol
5000-maleimide (PEG-Mal). As PEG-mal reacts to free sulfate group of cysteine
residues, the reagent might be a useful tool to examine the NS4B lipid modification status
on both cysteine residues. If cysteine residue is in not modified, the PEG-mal will react
with the free cysteine and increase the molecular weight by 5k-PEG. In this assay, the
41
cell lysate was pretreated with DTT before PEG-Mal reaction, so disulfide bond, if there
is any, will not affect the PEG-mal reaction. As shown in Fig2-8, full-length NS4B with
cysteine mutations were subjected to PEG-mal (5kDa) reaction and detected by western
blot. After PEG-mal reation, two protein sizes (30 and 40 kDa) were detected on the gel.
The smaller protein is the original size of the full-length NS4B (representing the protein
with modified cysteine residues); the larger protein should be the protein with one 5k-
PEG modification (representing the protein with at least one free cysteine residue).

48
35
24
Full-length
WT
C257A
C261A
C257,261A
Fig2-8. The PEGylation of NS4B. The Flag-NS4B with various cysteine mutations were overexpressed in
Huh7 cells. The cell lysate was incubated with PEG-maleimide (5kDa) which interacts with free cysteine
residue. The Flag-tagged protein was detected by Western blot. .
NS4B (Lipid modified )
NS4B – PEG (5K) (Free cysteine)

Under the steady-state expression condition, half of NS4B was modified and half of
the proteins had at least one free cysteine residue. NS4B with two free cysteines (two
5k-PEG labeled species) was not detected in the gel. This could be due to either of the
two possibilities that NS4B always has one of the two cysteine residues modified or that
42
the first 5k-PEG modification might affect the subsequent PEG modification on the
adjacent free cysteine residue. In the C257A mutant, most of the Cys261 residues were
in free status and were modified by PEG. On the other hand, the C261A mutant had a
similar modification ratio as the wild type did. The double cysteine mutant does not
have free cysteins at the C-terminal end; therefore, the proteins remained as the original
protein size. Although there is another cysteine residue (Cys187) in transmembrane
domain 4 in all four constructs, this cysteine residue appeared not accessible to the PEG-
mal reagent. The ratio of modified NS4B protein between wild type and mutants is
consistent with the relative ratio determined by palmitic acid labeling (Fig.2-7). These
results suggest that Cys261 has only palmitic acid modification but not a mixed
modification. The result also suggests that NS4B was only partially modified by
palmitic acid under this expression condition. Whether the modification status of NS4B
is affected by RNA replication or other factors remained to be addressed.

2.4.7 Cystein257 and Cystein261 are well conserved in various genotypes.
Since we have determined that NS4B is lipid modified on Cystein257 and Cystein261
residues, it is important to look whether these two cysteine residues are conserved among
different HCV genotypes. The NS4B sequences from 257 to 261 residues from various
genotypes are listed in Table2-1. Cysteine 261 is well conserved partly because
Cystein261 is also the recognition site for NS3 protease cleavage. Cystein257, the main
palmitoylation site, is well conserved in genotype1,2 and 4.
43

TATPC 6a
YSTPC 5a
CSTPC 4a
YPSPC 3a
CPVPC 2c
CPVPC 2b
CPIPC 2a
CIAPC or CTAPC 1c
CSTPC 1b
CTTPC 1a
NS4B Sequence (257-261) Genotype
Table2-1. The variation of NS4B protein sequence (257-261 residues)
between different HCV genotypes.

In genotype 3, 5 6, the amino acid 257 residue is tyrosine or threonine. Both tyrosine
and threonine have hydorxyl group. Other than cysteine resideue, palmitoylation may
happen on serine or threonine residues to form an acyl oxyester (Turner, 1992). It will
be interesting to determine whether the NS4B protein from these genotypes also has lipid
modification on this position.
2.4.8 Mass spectrometry of NS4B.
Previously, we have found that NS4B is palmitoylated on two cysteine residues
(Cys257 and Cys261) at the C-terminal end. In the metabolic labeling experiment, the
Cys257 was more extensively labeled by
3
H-palmitic acid than Cys261 is. To confirm
the metabolic labeling data, the Flag-NS4B was transiently overexpressed and purified
from Huh7 cells for mass spectrometry analysis.
44

1 2 3 1 2 3
NS4B BSA
1. Urea and NH
4
HCO
3
2. DTT+IAA treatment
3. Trypsine digestion
Fig 2-9. Mass spectormetry of NS4B.(A) Trypsine digestion of NS4B. Purified Flag-NS4B protein was
subjected to trypsin digestion. Small portions from each digestion steps were subjected to silver staining. (B)
Peptide fragments identified in mass spectrometry profile. The NS4B trypsin-digested pepteides which
could be identified in mass spectrometry profile were shown in bold.
A.
B.
SQHLPYIEQG MMLAEQFKQK ALGLLQTASR QAEVITPAVQ TNWQKLEVFW
AKHMWNFISG IQYLAGLSTL PGNPAIASLM AFTAAVTSPL TTGQTLLFNI
LGGWVAAQLA APGAATAFVG AGLAGAAIGS VGLGKVLVDI LAGYGAGVAG
ALVAFKIMSG EVPSTEDLVN LLPAILSPGA LVVGVVCAAI LRRHVGPGEG
AVQWMNRLIA FASRGNHVSP THYVPESDAA ARVTAILSSL TVTQLLRRLH
QWISSECTTP C
NS4B sequence (Genotype 1a):

As shown in Fig.2-9(A), the trypsin digestion step was complete, probably due to the
hydrophobicity of NS4B protein. Although we have tried to optimize the digestion
conditions, some cleavage sites were not accessible to trypsin. We have collaborated
with Dr. Lu Gao at UCSD and Dr. Allise Chien at Stanford University for Mass analysis.
Most of the fragments detected in the mass profile were located at the both ends of NS4B
protein, probably as a result of the incomplete trypsin digestion. The target peptide
fragment containing lipid modification sites is located at the very C-terminal end of
NS4B. The peptide fragment (VTAILSSLTVTQLLRR) next to the target fragment was
detected in the mass profile, suggesting that the this cleavage sites neighboring the target
fragment were accessible to trypsin. However, the target C-terminal fragment was either
missing from the mass profile or present with carboxymethylated cysteines (representing
the fragment without modification).
45
RLHQWISSECTTPC
RLHQWISSECTTPC
LHQWISSECTTPC
LHQWISSECTTPC
Base peak
Fig2-10. Extracted Ion Chromatography of theoretical palmitoylated peptide m/z values (+2, +3).

In one experiment (Fig.2-10), the ions with the theoretical palmitoylated peptides mass
were extracted from the total ion spectrum (Fig.2-10 base peak). The intensity of these
extracted ion chromatography was very week; thus, we could not determine with
certainty the nature of these peptides. Therefore, the mass spectrometry method gave
only equivocal results.

2.4.9 Lipid modification and subcellular localization.
Lipid modification is an important signal for membrane targeting or lipid raft
targeting (Bijlmakers and Marsh, 2003; Resh, 1999). To examine whether the lipid
modification of NS4B affects the subcellular localization, green fluorescence protein was
46
fused with NS4B which contains various cysteine mutations. To prevent any interference
on the lipid modification, GFP was fused at the N-terminal end of NS4B.

GFP-NS4B GFP-NS4B (C257A)
GFP-NS4B (C261A ) GFP-NS4B(C257, 261A)
Fig. 2-11 Subcellular localization of GFP-NS4B with various cysteine mutations. (A) Huh7 cells were
transfeted with GPF-NS4B wild type or GFP-NS4B with various Cysteine mutations. After 24-hour
incubation, the cells fixed and examined directly by confocal microscopy. (B) The protein expression was
also detected by Western blot ( anti-GFP antibody). The beta-acitn detected on the same blot was served as
loading control.
A.
B.
72
55
WT
C257A
C261A
C257,261A
Anti-GFP
Anti-Actin

As shown in Fig.2-11, the distribution of GFP-NS4B wild-type was in reticular
distribution which was a typical ER distribution as previous reports (Hugle et al., 2001;
Lundin et al., 2003). The distribution of single cysteine mutants, either C257A or C261A,
was similar to that of the wild type NS4B. On the other hand, the distribution pattern was
47
different when both cysteines were changed to alanine simultaneously. The dual cysteine
mutant was concentrated to distinct granules (Fig.2-11A).
The overall green fluorescence from the dual mutant was much brighter than the other
three constructs. To confirm whether the expression level of these constructs is the same,
the expression of GFP-fusion proteins was detected by Western blotting. As shown in
Fig.2-11B, the expression of GFP-NS4B double mutant was much higher that the other
three constructs. The results suggest that lipid modification of NS4B might have a
negative effect on protein stability, and single cysteine mutation did not abolish this
property. The brighter green fluorescence and granule distribution of double cysteine
mutant could be due to accumulation of the over-expressed protein. How the lipid
modification affects NS4B stability and whether this phenotype is linked to the
microdomain targeting are some interesting questions to pursue.

Fig. 2-12 The bright dots of GFP-NS4B C257,261A double mutant is not related to lipid droplet. HuH7
cells were transfeted with GPF-NS4B (C257,261A) double mutant. After 24-hour incubation, the cells fixed
and stained with Oil Red.

48
Some of the HCV viral proteins are partially colocolized with lipid droplet
(McLauchlan et al., 2002; Shi et al., 2002). Because the double cysteine mutant forms
bright dots, it was interesting to test whether these bright dots are related to lipid droplet.
The cells expressing GFP-NS4B double mutant were stained with Oil Red for lipid
droplet staining after. Apparently, these bright dots were not related to lipid droplet
(Fig.2-12).

2.4.10 The NS4B lipid modifications are important for protein-protein interaction
and replication site targeting.
The next question that I tried to address was whether the lipid-modification affects
NS4B functions. HCV nonstructural proteins interact with each other and form
multisubunit complexes for RNA replication (Dimitrova et al., 2003; Gao et al., 2004). If
lipid modification is important for NS4B function, it might affect the interaction between
NS4B and other viral proteins.
To test whether lipid modification affects protein-protein interaction, NS5A was
coexpressed with the various NS4B mutants in Huh7 cell and precipitated with Flag
antibody. The precipitated NS5A was detected by NS5A antiserum. As shown in Fig.2-
13(A), single cysteine mutations did not affect the interaction between NS5A and NS4B.
However, dual cysteine mutant has a lower interacting ability with NS5A. As replicon
cells have most of the nonstructural proteins and also have active RNA replication, Flag-
NS4B was introduced into the replicon cells. As shown in Fig2-13(C), the NS4B wild
type and single cysteine mutants could pull down NS5A and another vial protein with a
49
larger protein size which may represent NS3, NS5B or another viral protein. This larger
viral protein and NS5A could not be pulled-down by the dual cysteine mutant.

100
72
55
40
33
24
17
NC
Flag-NS4B Flag-M5
WT
C257A
C261A
DM
WT
C257A
C261A
DM
Fig. 2-13 NS4B mutants and protein-protein interaction. (A) NS5A and NS4B deletion mutants (Flag-
tagged) were cotransfected into HuH7 cells. The protein expression was driven by VV-T7 in the cell. The
flag-tagged proteins were pulled down by anti-Flag antibody, and NS5A protein was detected by anti-NS5A
antibody.. NC, negative control, the cells were transfected with cotransfected with NS5A and the empty
vector. (B) Flag-tagged NS4B and M5 with various cysteine mutation were overexpressed in replicon cells in
the presence of VV-T7. The viral proteins interacting with NS4B mutants were detected by a HCV patient
serum.
A. B.
100
72
55
NC
WT
C257A
C261A
DM
Flag-NS4B
NS5A
NS5A
Exogenous M5
Exogenous NS4B

Since M5 mutant has the same lipid modification as wild type, we also applied this
mutant for the IP-WB experiments. As shown in Fig.2-13(B) left panel, the result was the
same as the full-length NS4B. Only double cysteine mutant lost the ability to pull down
other viral proteins. As the HCV patient serum was applied for viral protein detection,
the antibody can also recognized the exogenous NS4B and M5. In Fig.2-13 (B), the
expression of M5 mutants seems to be different from each other. However, the
expression level of these constructs is similar when the Flag antibody was used for
50
western blot (data not shown). Therefore, the decreased interaction between the double
cysteine mutant and other viral proteins was not due to lower protein expression.
What is the mechanism by which lipid modification affects the protein-protein
interaction between NS4B and other viral proteins? If the function of NS4B lipid
modification is mainly for lipid-raft targeting, the NS4B without lipid modification could
not be targeted to the right compartment and could not have the chance to interact with
other viral protein. The other possibility is that the lipid modification may somehow
change NS4B conformation which might be important for protein-protein interaction; as
a result, the double mutant does not have the right conformation and loses the interaction
ability. More experiments are required to distinguish these possibilities.

2.4.11 Cys257 residue but not Cys261 of NS4B is dispensable for subgenomic
replicon replication.
To examine the importance of NS4B lipid modification in HCV RNA replication, the
NS4B subgenomic replicon was used to address this issue. Fig.2-14(A) shows the design
of NS4B cysteine mutations. As in the previous design for single protein expression,
cystein257 was mutated to alanine. However, the Cys261 of NS4B is the amino acid
residue adjacent to the first amino acid of NS5A in the context of the NS3-5B
polyprotein. This cystein261 residue is crucial for NS3 protease cleavage for the
production of mature NS4B and NS5A (Bartenschlager et al., 1995). Other than cysteine,
threonine is another amino acid residue that could be recognized by NS3 protease at this
position. Therefore, the Cystein261 residue of NS4B is mutated to threonine.
51
Fig.2-14 NS4B mutations in HCV subgenomic replicon. (A) The NS4B cystein mutations were designed
on subgenomic replicon. (B) HuH7 cells were transfected with DNA constructs containing HCV subgenomic
replicon (either with wild type NS4B or mutants). After 24hr incubation, the cells were infected with VV-T7
RNA polymerase. The protiens were harvested after 24hr incubation and NS5A protein were detected by
Western blot. (C) In vitro transcribed replicon RNAs (containing wild type NS4B or Cystein mutants) were
transfected into HuH7 cells by electroporation. The transfected cells were cultured under G418 selection for
four weeks. The surviving cells were stained by crystal violet.
WT
C257A
C261T
C257A,C261T
NS5A
NS5A+NS4B
100
72
55
A.
B.
3 4A 4B 5A 5B Neo
……………CSTPC
……………ASTPC
……………CSTPT
……………ASTPT
Wild-Type
C257A
C261T
C257A,C261T
C.

We first examined the cleavage efficiency of NS4B-NS5A junction of these replicon
mutants. The DNA constructs (containing T7 promoter) were transfected into Huh7 cell,
followed by VV-T7 infection. If the NS3 protease cleaves NS4B-NS5A junction, the
mature NS5A could be seen as the 55kDa protein by western blot. If the junction could
not be cleaved, the NS4B-NS5A fusion protein would be detected as 85kDa protein. In
Fig.2-14B, All NS5A protein detected in wild type and C257A mutant replicon were in
mature form (55 kDa). In the case of C261T and double-mutant replicons, the junction
between NS4B-NS5A could be cleaved by NS3 protease since the mature NS5A could be
detected. However, the cleavage efficiency was not as high as the wild type since some
NS4B-NS5A intermediates (85kDa) were also detected in the lysate. Nevertheless, a
majority of NS4B-NS5A was cleaved under this condition.
52
Colony formation assay was performed on the mutants to test whether these two
potential lipid modification sites are important for replication. As shown in Fig.2-14C,
the replicon containing C257A mutation (the main palmitolylation site) forms as many
colonies as wild type replicon. On the other hand, the replicons containing Cys261
mutation (C261T single mutation, and C257A and C261T double mutations) did not form
any colony after G418 selection. As the subgenomic RNA might produce mutation
during RNA replication, the C257A replicon RNA was recovered from the G418-resistant
cells and checked by sequencing. The C257A mutation still remained in replicon of the
surviving cells suggesting that this cysteine is not crucial for RNA replication.
Regarding the importance of Cystein261 to RNA replication, the replicon system
could not provide a clear answer because this cysteine also is involved in protease
cleavage process. Although the majority of C261T mutant (or C257A,C261T double
mutant) was cleaved to produce mature NS4B and NS5A proteins, the cleavage
efficiency may not be enough. Alternatives, the cysteine residues per ce, may be crucial
for RNA replication.

2.4.12 2-Bromopalmitate inhibited HCV RNA replication.
NS4B has been suggested to have a crucial role in RNA replication. As we have
found that NS4B protein is palmitoylated, one important question is whether the NS4B
palmitoylation is important for RNA replication. A specific palmitoylation inhibitor, 2-
bromopalmitate (2-BP), has been utilized for palmitoylation-related studies (Webb et al.,
2000). I used this inhibitor to address the role of NS4B palmitoylation in HCV RNA
replication.
53

0 50 100 200 ( µM)
1 0.85 0.52 0.36
HCV
GAPDH
0 50 100 200 ( µM)
NS5A
Β-Actin
Fig.2-15 The palmitoylation inhibiotor (2-bormopalmitate,2-BP) interferes HCV RNA replicaiton.
Subgenomic replicon cells were treated with different concentrations of 2-BP for 48 hours. (A) The total
RNA were extracted and the same amount of total RNA (5µg) was subjected to Northern blot. The HCV
RNAs were detected by HCV specific DNA probe. GAPDH was also detected by specific DNA probe to
served as internal control. The quantification of HCV signals normalized by GAPDH signals was shown on
the bottom. (B) The cell lysate (20 µg) was subjected to Western blot. NS5A was and beta-actin detected
with specific antibodies.
A.
B.

As shown in Fig.2-15(A), in the presence of the palmitoylation inhibitor, the HCV
RNA replication was inhibited in a dose-dependent manner. The viral protein (NS5A)
expression was also correspondingly decreased (Fig.2-15 B). This result suggests an
important role of palmitoylation of NS4B in subgenomic RNA replication. However, the
cellular mRNA GAPDH was also slightly decreased by at high concentration (200µM) of
2-BP, the inhibitory effect of 2BP on HCV RNA replication might have been contributed
partially from the non-specific effects on host factors.

54
2.4.13 NS4B has polymerization activity, and the polymerization determinants are
distributed on the both cytoplasmic ends of NS4B.
The polymerization is important for the function of scaffolding proteins such as
Caveolin-1 (Cohen et al., 2004). NS4B could form dimer in the non-reducing gel (Fig.2-
7). Therefore, NS4B may have polymerization activity which may contribute to the
function of NS4B in membranous web formation.
Fig.2-16 Polymerization assay of NS4B. HuH7 cells were transfected with Flag-NS4B DNA or Flag
tagged NS4B deletion mutants. After 24 hr post-transfection, the cells were infected with VV-T7. After
overnight incubation, cells were harvested and lysed in hypotonic buffer. The post-nuclear supernatant
was incubated with 0.01% glutaraldehyde to crosslink protein polymers for various incubation time. The
Laemmli’s sample buffer was used to stop the cross-linking reaction. The proteins were analyzed by
Western blotting by using anti-Flag antibodies.
0 10 20 30 min
NS4B
monomer
dimer
trimer
M2
0 10 20 30 min
M5 M7
monomer
dimer
monomer
non-specific
0 10 20 30 ( min) 0 10 20 30 ( min)
non-specific
1 72 92 101 121 136 156 172 197 261
Wild type
Mut 2
Mut 5
Mut 7
monomer
dimer
trimer
100
72
55
40
33
24
17
10
130
170
100
72
55
40
33
24
17
10
130
170
100
72
55
40
33
24
17
10
130
170
100
72
55
40
33
24
17
10
130
170

To test this hypothesis, a crosslinking reagent, glutaraldehyde, was used to test
whether NS4B has the polymerization ability (Matsumoto et al., 1996; Xia and Lai, 1992).
After glutaraldehyde treatment, full-length NS4B could form dimmer, trimer and even
larger polymer, as shown in Fig.2-16. Since the NS4B expression was at an extremely
55
high level, the monomer did not decrease even after extensive polymer formation. The
amount of monomer was reduced when lesser amount of the sample was used for analysis
(data not shown).
To identify which element was required for NS4B polymerization activity, the
various NS4B deletion mutants were subjected to polymerization assay (Fig.2-16, lower
panel). The M2 mutant which contains the N-terminal half of NS4B (1-136 amino acid
residues) could form polymers as much as the full-length NS4B. The M5 mutant
containing the C-terminal half of NS4B (137-261 amino acid residues), could form only
dimer under the same condition. In the case of M7 (72-197 residues of NS4B), no dimer
or polymer was detected. Based on this result, I concluded that approximately 70 amino
acid residues at both the N-terminal and C-terminal ends of NS4B have polymerization
ability.

2.4.14 The lipid modifications of Cys257 and Cys261 contribute to the
polymerization activity at the C-terminus of NS4B.
The important feature on C-terminus of NS4B is the lipid modification that we found
in the first part. Therefore, we reasoned that the lipid modification could be one of the
driving forces at the C-terminal end of NS4B for polymerization. To test this hypothesis,
full-length NS4B with cysteine mutations were examined by polymerization assay. Since
the N-terminus also has a polymerization activity, to differentiate the polymerization
activity of these mutants, the glutaraldehyde treatment was shortened.
56
0 30‘’ 1‘ 2’
C257,261A
monomer
dimer
0 30‘’ 1‘ 2’
WT
0 30‘’ 1‘ 2’
C257A
0 30‘’ 1‘ 2’
C261A
0 30‘’ 1‘ 10’
M5 (C257,261A )
monomer
dimer
0 30‘’ 1‘ 10’
M5
0 30‘’ 1‘ 10’
M5(C257A)
0 30‘’ 1‘ 10’
M5(C261A)
Fig.2-17NS4B cystein residues contribute to the polymerization activity. (A) HuH7 cells were
transfected with Flag-NS4B or NS4B with cysteine mutants . After 24 hr post-transfection, the cells were
infected with VV-T7. After overnight incubation, cells were harvested and lysed in hypotonic buffer. The
post-nuclear supernatant was incubated with 0.01% glutaraldehyde to crosslink protein polymers for
various incubation time. The Laemmli’s sample buffer was used to stop the cross-linking reaction. The
proteins were analyzed by Western blotting by using anti-Flag antibodies. (B) The M5 and M5 with
cysteine mutants were applied for the polymerization assay.
A.
B.
1 72 92 101 121 136 156 172 197 261
Wild type
Mut 5

As shown in Fig.2-17(A), the dimer formation of the wild type protein could be seen
even at time zero, and the amount of dimer increased along the treatment time in the wild
type panel. The NS4B(C257A) and NS4B(C261A), which have single cysteine
mutantion, had similar polymerization activities to that of wild type. However,
NS4B(C257,261A) had a slightly lower polymerization activity than the other tree
proteins.
To establishe that the lipid modification contributed to the polymerization activity,
the polymerization activity of M5 with various cysteine mutations was subjected to
polymerization assay. In these mutants, the polymerization activity resulting from N-
terminus of NS4B was deleted. As shown in Fig.2-17(B), the result was very similar to
57
Fig.2-17(A). M5, M5(C257A) and M5(C261A) had similar polymerization activities.
The significant difference was that M5(C257,261A) had almost no polymerization
activity during the 10-min incubation time. This result suggested that lipid modification
contributes to the polymerization activity in the C-terminal end of NS4B.

2.4.15 The polymerization determinants of NS4B N-terminus are scattered in the N-
terminus.
0 30‘’ 1‘ 10’
M13
0 30‘’ 1‘ 10’
M2
0 30‘’ 1‘ 10’
M11
0 30‘’ 1‘ 10’
M12
M11
M12
M13
(23-135)
(35-135)
(55-135)
M2 (1-135)
Fig.2-18 N-terminal polymerization determinants mapping (I). HuH7 cells were transfected with
various mutant. After 24 hr post-transfection, the cells were infected with VV-T7. After overnight
incubation, cells were harvested and lysed in hypotonic buffer. The post-nuclear supernatant was
incubated with 0.01% glutaraldehyde to crosslink protein polymers for various incubation time. The
Laemmli’s sample buffer was used to stop the cross-linking reaction. The proteins were analyzed by
Western blotting by using anti-Flag antibodies.
1 72 92 101 121 135
72
55
40
33
24
17
10
40
33
24
17
10

To narrow down the exact determinants on the N-terminal end of NS4B protein, a
series of truncation mutants (M11-M13) were constructed for the polymerization analysis.
As shown in Fig.2-18, M11 (23-135 amino acid residues of NS4B) had comparable
58
polymerization activity to that of M2 (1-135 amino acid residues of NS4B). M12 and
M13 (35-135 and 55-135 amino acid residues of NS4B, respectively) also retained the
polymerization activity, even though the expression level of M13 was very low as
compared to the other mutants (Fig.2-18).
0 30‘’ 1‘ 10’
0 30‘’ 1‘ 10’
1 72 92 101 121 136 156 172 197 261
NS4B
M14
M15
A A
M14 M15
55
Fig.2-19 N-terminal polymerization determinants mapping (II). HuH7 cells were transfected with
various mutant. After 24 hr post-transfection, the cells were infected with VV-T7. After overnight
incubation, cells were harvested and lysed in hypotonic buffer. The post-nuclear supernatant was
incubated with 0.01% glutaraldehyde to crosslink protein polymers for various incubation time. The
Laemmli’s sample buffer was used to stop the cross-linking reaction. The proteins were analyzed by
Western blotting by using anti-Flag antibodies.

To test whether the polymerization determinant resided between exclusively in the
55-76 amino acid residues of NS4B, the mutant with 55-76 residues deletion (M14) was
constructed and used for polymerization assay (Fig.2-19). To eliminate the interference
from lipid modification at the C-terminus, another mutant (M15) containing the same
deletion mutation with additional Cys257,261A mutation was made. As shown in Fig.2-
19, the M14 mutants still had the polymerization activity even with the two cysteines
replaced by alanines. The result suggests that the polymerization activity of NS4B N-
59
terminus is not limited to a small stretch but scatted throughout in this region. This
property may suggest the amino acid composition in this region is very hydrophobic.
Because of the lack of sensitive NS4B antibodies, whether the polymerization
activity exists in the context of HCV polyprotein remains unclear. The HCV patient
serum which can recognize NS4B protein have been used to address this question in
subgenomic replicon cells. After the crosslinking reagent treatment, the high molecular
weight proteins showed a smear pattern instead of discreet protein polymer (data
nonshown). These signals might have come from the crosslink between various non-
structural proteins. Therefore, a better biochemical analysis is required for this issue.

2.5 Discussions
In the present study, I have provided evidence that NS4B has lipid modification on
two cysteine residues (Cysteine 256 and 261 residues) located at the C-terminal end. The
lipid modifications on these two cysteines on NS4B are important for NS4B protein-
protein interaction and RNA replication. All of the NS4B fragments are resistant to NP40
treatment and have similar sensitivity to other detergent, suggesting that the whole
protein contributes to lipid rafts targeting. The polymerization activity also was found in
NS4B protein; and the main polymerization determinants are scattered in the N-terminal
cytoplasmic region of NS4B protein. Moreover, the lipid modification also facilitates the
polymerization process.
Most plus-strand RNA viruses induce distinct membrane alterations, which provide
the necessary structural scaffold for RNA replication (Ahlquist et al., 2003). The
membrane alterations have been seen in the cells containing HCV subgenomic replicon
60
and in HCV-infected liver tissue (Egger et al., 2002; Pfeifer et al., 1980). NS4B itself
could induce membrane alteration, suggesting the structural role of NS4B in HCV RNA
replication. How are NS4B lipid modification and oligomerization linked to structural
role of NS4B or to the replication complex assembly? In the context of HCV polyprotein,
NS4B is expressed as part of polyprotein. Other viral proteins may be anchored on the
membranous web through protein-protein interactions between viral proteins and host
factors (Dimitrova et al., 2003; Gao et al., 2004). The lipid-modifications of NS4B might
target the protein complexes to a special membrane domain. Other than the lipid
modification, the recently identified N-terminal amphipathic helix of NS4B could also be
involved in the targeting process. Other than passive targeting, NS4B could also possibly
have a positive role to induce a microdomain on the membrane. Since most of NS4B
subdomains have similar property responding to various detergent treatments, NS4B
primary sequence may have the affinity to specific lipid species such as cholesterol or
sphingolipid and induce the formation of certain lipid shell (Anderson and Jacobson,
2002). Then, the polymerization activity of NS4B protein could cluster these dynamic
small subunits to a firm structure to supporting viral RNA replication. The process is
very similar to the clustering of small raft into larger micordomain in responding to
receptor-ligand binding (Simons and Toomre, 2000). In signal transduction, this
clustering process might bring together signaling components previously scattered in the
small domains for the activation of signal transductions. In the HCV replication complex,
the clustering not only can gather the viral proteins but also the host factors which are
important for RNA replication or virus particle assembly. Other than our in vitro
polymerization assay, Dimitrova et al, also have identified a week NS4B-NS4B
61
interaction by GST pull-down assay and the two-hybrid system (Dimitrova et al., 2003.)
In the process of membranous web formation, host membrane proteins might be involved
in membrane alteration through interacting with viral proteins.
At the structural and function levels, the role of NS4B in the membranous web
formation is very similar to the role of caveolin-1 in caveolae formation. Although they
have different protein topology, both of NS4B and caveolin-1 have lipid modifications
and oligomerization activity (Cohen et al., 2004; Sargiacomo et al., 1995); and these
properties are related to their scaffolding function in the induction of specialized
membrane structures. Therefore, the role of caveolin-1 in caveolae formation could be a
useful model to decipher how NS4B induces membranous web.
When examining the sequences among different HCV genotypes, the Cys257 is
conserved in genotype 1, 2 and 4. In genotype 3, 5 and 6, the corresponding amino acid
residue is threonine or tyrosine. Palmitoylation can occur on serine and/or threnine
residues to form an acyl oxylester, but, in most case, palmitate is linked to a cycteinyl
residue as an acyl thioester. It would be interesting to clarify whether the palmitoylation
happens when the amino acid residues are tyrosine or threonine. Moreover, the
biological function of palmitoylation in virus life cycle and whether the palmitoylation is
associated with the pathogenic differences between different genotypes are some
interesting questions. NS4B has GTPase activity and induces the ability to induce
membranous web; whether lipid modifications and polymerization activity of NS4B are
crucial for these activities is an interesting question to address.

62

Chapter 3: NS4B-interacting proteins: Rab1B
3.1 Abstract
Some host factors were co-purified with NS4B protein and identified by mass
spectrometry. These factors were Rab1B, Myosin Villin, Tubulin, Annexin II, ubiquitin
ERGIC53 and FALDH. This chapter mainly focuses on the Rab1B including NS4B-
Rab1B interaction, the role of Rab1B in HCV RNA replication and the interference of
Rab1b function by NS4B.
Rab1B belongs to the Rab GTPase family and has GTPase activity and
geranylgeranyl modification at its C-terminal end. By coimmunoprecipitation method,
Rab1B was shown to specifically interact with NS4B; the interaction was affected by
NS4B lipid modification. The Rab1B- interacting domain of NS4B was mainly located
on the cytoplasmic region of C-terminal end. Rab1B could interact with NS4B in the
context of HCV polyprotein. The subcellular localization was changed in the presence of
NS4B protein and partially colocalized with NS5A in replicon cell.
Rab1B-specific siRNAs could knock down Rab1B protein expression and reduce
HCV RNA replication in replicon cell, suggesting the role of Rab1B in RNA replication
process. Two Rab1B mutants were made to test the role of Rab1B in RNA replication.
Rab1B (delCC) is the Rab1B protein without geranylgeranylation sites and lost the
membrane association ability. Rab1B(N121I) is an inactive form of Rab1B with
impaired guanine nucleotide binding. Both Rab1B delCC and N121I mutants reduced
RNA replication in transient replication system, also suggesting that Rab1B has a
positive role in HCV RNA replication.
63
VSV-G processing was used as an indicator of Rab1B function in the ER-to-Golgi
trafficking. The NS4B-Rab1B interaction did not affect the VSV-G processing. The
result suggests that the NS4B-Rab1B interaction does not affect the normal function of
Rab1B. The interaction between NS4B and Rab1B could be very dynamic, so that
Rab1B still could execute its normal function.
It has been shown that HCV RNA replication could be disrupted through inhibition
of host protein geranylgeranylation (Ye et al., 2003). As geranylgeranylation is essential
for Rab1B function, Rab1B could be one of the factors which was important for HCV
RNA replication and affected by the geranylgeranylation inhibitor. Rab1B is the first
NS4B-interacting protein identified.

.

. .
64
3.2 Introduction
3.2.1 Host factors and HCV replication.
Among RNA viruses, as small as flock house virus (4.5kb RNA genome) or as large
as coronavirus (31kb RNA genome), all of them rely on various cellular machinery to
complete the virus life cycle (Ahlquist et al., 2003; Lai, 1998). The host machinery may
utilized by viruses for virus entry, transcription, replication or assembly, or virus release.
On the other hand, virual proteins may play an active role in controlling host machinery
in order to develop a better environment for replication. The HCV replication also relies
on virus-host interactions. Host factors interacting with HCV RNA genome or viral
proteins have been identified by various methods. For example, eIF3 (Sizova et al.,
1998), PTB (Ali and Siddiqui, 1995) , La (Ali and Siddiqui, 1997), hnRNP L (Hahm et
al., 1998) and poly(C)-binding protein (PCBP) (Spangberg and Schwartz, 1999) have
been reported to interact with HCV 5’UTR which contain IRES for HCV translation.
The knowledge from these studies has improved the understanding of cap-independent
translation not only for HCV, but also for other viruses and some cellular mRNAs.
As discussed in Chapter 2, NS4B plays a structural role to form a platform to
support HCV replication. NS4B protein, the poorly characterized HCV viral protein, has
gradually drawn more attention because of its fundamental function for RNA replication.
The identification of NS4B-interacting factors may help to understand how NS4B
induces membrane alteration in cell. However, due to its hydrophobic nature and low
expression level, there is no NS4B-interacting host factor identified so far.
As shown in Chapter 2 (Section2.4.8), mass spectrometry has been applied for
NS4B lipid modification study. Some host factors were identified from NS4B
65
preparation. This chapter will mainly focus on Rab1B protein, one of the factors
identified by mass spectrometry.

3.2.2 Rab1B protein.
Rab1B is a member of the Rab GTPase family (Plutner et al., 1991). Rab GTPases
are a group of proteins belonging to the Ras superfamily. Their main function is to
regulate vesicle transport between different compartments in cell. Different Rab
GTPases are localized to the cytosolic face of different intracellular membranes, where
they function as regulators of distinct steps in membrane traffic pathways (Stenmark and
Olkkonen, 2001). Rab1 and 2 play a role in ER-to-Golgi trafficking (Plutner et al., 1991).
Rab6 has been implicated in intra-Golgi transport and in Golgi-to-ER retrograde
transport (Goud et al., 1994; White et al., 1999). Further outward, Rab3 is associated
with secretory vesicles and has a role in regulated secretion of hormones and
neurotransmitters (Fischer von Mollard et al., 1994). In the endocytic pathway, Rab5 is
involved in the assembly of clathrin-coated vesicles at the plasma membrane and in
homotypic fusion between endosomes (van der Bliek, 2005). Rab7 functions in EE-to-
LE and EE-to-lysosome transport (Feng et al., 1995; Meresse et al., 1995). Rab9 has a
role in LE-to-TGN transport (Lombardi et al., 1993). Rab4 is involved in direct
recycling of receptors from sorting, early endosomes to plasma membrane (Daro et al.,
1996). These Rabs function in constitutive and regulated exocytic, endocytic and
transcytic pathways. Usually, they act as positive regulators, and their depletion leads to
blocked or reduced transport in vitro or in vivo (Segev, 2001).
66
How do these Rab small GTPases work? Rabs are all posttranslationally modified at
C-terminal cysteines by geranylgeranylation. This lipid modification mediates
membrane association when the Rab is in the GTP-bound state on specific vesicle. In its
GTP-bound form, Rab is free to associate with its specific effectors, which can, in turn,
trigger events leading to the fusion of the vesicle with a target membrane. After GTP is
hydrolyzed to GDP, the GDP-bound Rab is extracted from the membrane upon forming a
complex with a cytosolic GDP-dissociation inhibitor (GDI). This cytosolic intermediate
is then recycled onto a newly formed vesicle, through a secondary factor, a GDI
dissociation facor (GDF), which displaces GDI. After the Rab becomes membrane-
bound, a guanidine nucleotide exchange factor (GEF) promotes release of GDP and the
subsequent loading of GTP. The specificity of each Rab depends on specific effectors of
each Rab. Some Rab effectors preferentially bind to GTP-bound Rab proteins. Rab
GTPases and their effectors facilitate vesicular transport by tethering donor vesicles to
their target membranes. (Gonzalez and Scheller, 1999; Stenmark and Olkkonen, 2001)
Two Rab1 effectors are the tethering factor P115 and GM130 (Allan et al., 2000;
Moyer et al., 2001). P115 is involved in vesicle docking process between ER-to-Golgi
compartments. Rab1B recruits the tethering factor p115 to coat protein complex II
(COPII) vesicles during budding from ER, where it interacts with a select set of COPII
vesicle-associated SNARE to form a cis-SNARE complex that promotes targeting to the
Golgi apparatus (Allan et al., 2000). On the target membrane of Rab1, the cis-Golgi
tethering protein GM130 forms a novel Rab1 effector complex with other factors. The
effector complex could interact with Rab1-GTP and direct COPII vesicle tareting and
fusion with cis-Golgi. This Rab-GM130 mediated targeting is in a p115-independent
67
manner (Moyer et al., 2001). Therefore, Rab1 could be director of the vesicles from ER
membrane to the target membrane once the proper effectors are present on the target
membrane. Then, the subsequent fusion could happen with SNARE protein complexes.

3.2.3 Geranylgeranylation and HCV RNA replication.
Recently, Ye at al. showed that HCV RNA replication could be disrupted through
inhibition of host protein geranylgeranylation (Ye et al., 2003). In this research report,
lovastatin (an inhibitor of 3-hydroxy-3-methyglutaryl CoA reductase) or protein
geranylgeranyl trransferase I inhibitor could disrupt HCV RNA replication. Therefore,
Ye at al suggested that geranylgeranylated host factors might be involved in HVC
replication. Geranylgeranylation is a critical post-translational modification for Rab
GTPases to execute their function in the cell. Whether the NS4B-interacting candidate,
Rab1B, is one of the factors affected by these drug treatments would be a interesting
question to address.

68
3.3 Materials and Methods
3.3.1 DNA constructs and reagents.
Rab1B gene was amplified from Huh7 cell line by RT-PCR. The primer design
was based on NCBI nucleotide sequence (AL136635). The forward primer sequence
contains a myc tag sequence (5’ GCCACCATGGAACAAAAACTTATTTCTGAAGAA
GATCTGATGAACCCCGAATATGAC 3’). The reverse primer contains stop coden (5’
CTAGCAACAGCCACCGCC 3’). The PCR products were cloned into pcDNA3.1/V5-
His expression vector by TA cloning (Invitrogen, Carlsbad, CA). The recombinant
Rab1B was Myc-tagged and had no V5-His tag at the C-terminal end from
pcDNA3.1/V5-His vector because the stop coden was placed on the reverse primer. The
Rab1B sequence was confirmed by sequencing, and the Rab1B gene amplified from
Huh7 cell was the same as the sequence from the NCBI database.
Flag-tagged Rab1B was amplified by PCR with a forward primer containing Flag tag
sequence and cloned into the same vector. Myc-Rab1B ∆CC was also made by the
similar approach with the different reverse primer. Myc-Rab1B (N121I) was made by
site-directed mutagenesis using the Quickchange mutagenesis kit according to the
manufacture’s instruction (Stratagene, La Jolla, CA).
Plasmid (GFP/pcDNA3.1 or Flag-NS4B/pcDNA3.1) digested with PmeI was used as
template for the Poly A-tailed mRNA synthesis by using mMESSAGE mMACHINE T7
Ultra (Ambion, Austin TX). Fugene 6 (Roche, Branchburg,NJ) was used for DNA
transfection. Lipofectamine 2000 was used for DNA and RNA cotransfection, and for
siRNA transfection.
69
The Myc monoclonal antibody was purchased from Invitrogen, Rabbit-anti-Rab1B
antibody was from Santa Cruz Biotechnology (Paso Roblees, CA) and HCV NS5A
monoclonal antibody was from Biodesign (Saco, MA). Anti -Flag M2 antibody and anti-
Flag M2 affinity gel, β-acitn monoclonal antibody and VSV-G monoclonal antibody
were from Sigma (St. Luis, MO).

3.3.2 Co-immunoprecipitation
Myc-Rab1B and various Flag-tagged NS4B constructs were coexpressed in Huh7
cells. The co-immunoprecipitation method was the same as described in Chapter2. To
detect the Rab1B interaction with viral proteins in the replicon cells, Flag-Rab1B was
overexpressed in replicon cells and co-immunoprecipitation was performed.

3.3.3 Immunofluorescence staining
Cells were fixed in 4% formaldehyde in PBS at 4°C overnight. After washing with PBS
once, cells were permeablized by 0.1% Triton X-100 at room temperature for 10min. To
prevent the non-specific protein binding, cells were incubated in blocking buffer (3%
BSA and 0.1% Triton X-100 in PBS) at room temperature for 30min. After washing with
wash buffer (0.1% Triton X-100 in PBS) twice, cells were incubated with primary
antibody diluted with blocking buffer at 37°C for one hour. Then, cells were washed
three times with wash buffer and incubated with Flourescein (FITC) or Rhodamine
conjugated secondary antibody (Jakson ImmunoResearch,West Grove, PA) at 37°C for
one hour. Cells were washed with wash buffer three times, and then mounted in
70
VECTASHIELD mounting medium (VECTOR, Burlinggame, CA). Confocal
microscopy was performed on a Zeiss Confocal Laser Scanning Microscope LSM510.

3.3.4 Rab siRNA and real time PCR
The Rab1B siRNAs were predicted by siRNA Target Finder program on Ambion website.
Three selected siRNA sequences from the program are only against Rab1B coding region
but not any other celluar RNA. The sequences are as following. Rab1B siRNA #1: sense:
(5’rUrGrUrGrUrCrCrCrArGArUrCrUrGrArArGrUTT3’), antisense (3’TTrArCrArCrA
rGrGrGrUrCrUrArGrArCrUrUrCrA5’). Rab1B siRNA #2: sense (5’rCrArCrCrArGrGrA
rGrCrUrUrArUrUrGrArCrGTT3’), antisense (3’TTrGrUrGrGrUrCrCrUrCrGrArArUrA
rArCrUrGrC5’). Rab1B siRNA #3: sense (5’rArArArCrUrCrCrUrUrGrGrCrUrGrUrGrG
rUrGTT3’) antisense (3’TTrUrUrUrGrArGrGrArArCrCrGrArCrArCrCrArC5’).
Nonspecific siRNA: sense (5’rCrArUrUrUrGrGrGrGrGrArGrCrCrGrGrArCrCTT3’),
antisense (3’ TTGUAAACCCCCUCGGCC UGG5’). Nonspecific siRNA does not
target any cellular RNA and served as negative control for siRNA transfection
experiments. All the siRNAs are composed of 19 RNA bases and 2 DNA bases.
Real-time RT-PCR was applied to determine the quantity of subgenomic RNA(Aizaki
et al., 2004). The primers are from HCV 5 ′ non-coding region (5 ′ GAG TGT CGT GCA
GCC TCC A 3 ′ and 5 ′ CAC TCG CAA GCA CCC TAT CA 3 ′) of the HCV 1b sequence,
and a fluorescent probe [5 ′ (FAM) CCC GCA AGA CTG CTA GCC GAG TAG TGT
TGG (TAMRA) 3′] was used for the reation with the TaqMan EZ RT-PCR Core
Reagents (Applied Biosystems, Foster City, CA). The RT step was performed at 60 °C
71
for 50 min, followed by 1 min at 50 °C. The amplification condition was as follows: 95
°C for 5 min and 50 cycles of denaturation at 94 °C for 15 s, annealing at 55 °C for 10 s,
and extension at 69 °C for 1 min. The real-time RT-PCR was performed by using the
ABI Prism 7900 program. Values were normalized to that of GAPDH (Applied
Biosystems). Each test was done in triplicate and averages were obtained.
3.3.5 Transient replicon replication
To test the effects of Rab1B and Rab1B mutants on RNA replication, plasmids (25µg)
and in vitro transcribed replicon RNAs (5µg) were cotransfected into the 400 µl of Huh7
cells (4 ×10
6
cells in serum-free D-MEM) by eletroporation with Gene Pulser II (Bio-rad,
Hercules, CA) set to 220V and 975 µF. The protein and RNA were collected at various
time points for Western blot and Northern.

3.3.6 VSV-G Assay
The Poly-A tailed GFP or NS4B mRNAs were cotransfected with plasmid encoding
VSV-G to Huh7 cells. After 24hr incubation, cells were washed with Cystein, Methinine
free D-MEM once and incubated in the same washing medium for 20 min. Then, cells
were pulsed with
35
S-Translabel (ICN Biologicals, Irvine, CA) for 15min. Cells were
washed with complete D-MEM three times to remove free isotope, and then chased for
various periods of time. VSV-G protein was pulled down from the cell by
immunoprecipitaion with VSV-G monoclonal antibody. To test the endoH (Biolabs,
Beverly, MA) sensitivity, VSV-G protein precipitated by antibody and protein A agarose
was denatured in 1X denaturing buffer and heated at 100°C for 10 min. Then, the
72
denatured protein was digested with endoH in 1X reaction buffer at 37°C overnight.
Then, proteins were analyzed by SDS-PAGE and autoradiography.

3.4 Results
3.4.1 Host factors identified by mass spectrometry.
As mentioned in Chapter 2, the mass spectrometry was applied to confirm the NS4B
lipid modification. NS4B wild type and cysteine mutants were purified from cells by
Flag-affinity agarose gel and analyzed for peptide mapping by mass spectrometry.
After the MS/MS analysis, in addition to the peptides from purified NS4B protein, some
fragments of cellular proteins were also present in the MS profiles. Table3-1 is the list of
the cellular factors present in the protein preparations.
NS4B(C257 261A)
NS4B(C261A)
FALDH NS4B(C257A)
Rab1B
Myosin
Villin
Tubulin
Annexin
Ubiquitin
ERGIC53, FALDH NS4B
Factors in all 4
samples
Factors only in parts of
samples
Sample
Table3-1. Factors identified from protein preparation of NS4B and
mutants by Mass Spectrometry.

73
Some proteins were present in all four protein preparations, for example, Rab1B,
Myosin Villin, Tubulin, Annexin II, ubiquitin. On the other hand, some proteins were
present only in some of the protein preparations. For example, ERGIC53 was found only
in wild type NS4B sample; FALDH was detected in both wild type and NS4B(C257A)
sample preparations. The sensitivity of the mass spectrometry can reaches to subpicomol
level (Pandey et al., 2000); so the important issue was the specificity of the interactions
of these proteins to NS4B proteins. Some proteins are commonly seen in routine mass
spectrometry analysis; so these proteins could be nonspecific binding to agarose gel or
antibody in the purification process. For example, tubulin myosin and villin, the
cytoskeleton proteins are common contaminants in protein preparations for mass
spectrometry (personal communication with Dr. Lu Gao). The interesting proteins that
might be specific for NS4B include ERGIC53 and FALDH.
ERGIC53 (the ER-Golgi intermediate compartment marker ERGIC53) is a mannose-
specific membrane lectin. The ERGIC53 peptide identified in mass profile is listed in
Table 3-2. ERGIC53 functions as a cargo receptor of glycoprotein from the ER to the
ERGIC (Hauri et al., 2000). Because the membrane source for membranous web
formation of HCV is still unclear, the presence of ERGIC53 in NS4B preparation is an
interesting finding. FALDH (aldehyde dehydrogenase) is a microsomal enzyme with
high activity for oxidation of long chain aliphatic aldehydes to fatty acid (Chang and
Yoshida, 1997). The peptide fragment of FALDH identified is shown in Table 3-2. As
shown in Chapter 2, NS4B has lipid modifications on its C-terminal end. The presence of
FALDH in only wild type and C257A mutant NS4B preparation implied a link between
74
FALDH and cystein261 of NS4B. Therefore, we pursued more tests to see the potential
role FALDH in HCV replication in Chapter 4.
Table3-2 Peptides of Rab1B,FALDH and ERGIC35 present in NS4B protein preparation.
GPHLVQSDGTVPFWAHAGNAIPSSD
QIR
VMQEEIFGPILPIVPVK
NATNVEQAFMTMAAEIK
Sequence
2956.46
1908.08
1867.88
Mass
54-81 P49257 Ergic-53 protein
precursor
327-343 P51648 Fatty aldehyde
dehydrogenase
154-170 Q9H0U4 Rab-1b
Position NCBI no. Genes Name
Among these cellular proteins present in all four protein preparations, the most
interesting protein was Rab1B protein. The peptide fragment of Rab1B shown in the
NS4B MS profile is listed in Table3-2. As mentioned in Introduction, Rab1B belongs to
the Rab GTPase family and has GTPase activity and geranylgeranyl modification at its
C-terminal end. Several reasons have suggested that Rab1B could be the potential
protein to pursue. First of all, Ye at al has suggested that geranylgeranylated host factors
might be involved in HCV replication and geranlygeranylation is the essential
modification for Rab1B. Secondly, the biological function of Rab1B is involved in
vesicle targeting from ER to Golgi and in cis-to-medial Golgi. Whether Rab1B is the
75
cellular factor to help the membranous web formation was a very attractive direction to
pursue. Finally, TC21 (also known as R-Ras-2) has been identified as a potential NS4B-
interacting protein by yeast-two-hybrid screening. TC21 also belongs to small GTPase
family and has prenyl modification (Ehrhardt et al., 2002). However, TC21 could only
interact with NS4B in vitro but not in vivo. This could be due to the fact that TC21 is
localized on plasma membrane) while NS4B targets to ER membrane protein. Since
TC21 and Rab1B belong to the same superfamily, whether Rab1B is the real NS4B
partner was an interesting question. Based on all these reasons, we proceeded to test the
specificity of the interaction of Rab1B with NS4B and the potential role of Rab1B in
HCV replication.
For other cellular factors (e.g. Myosin, villin, tubulin, annexin, and ubiquitin),
because of the lack of obvious relevance to NS4B function and the concerns of
nonspecific binding, we did not perform further experiments for these factors. However,
the results in Chapter2 suggested that lipid modification might play a role in NS4B
protein stability. Whether the ubiquitin-proteasome system is involved in NS4B stability
is still a potential direction to pursue.

3.4.2 The Interaction between Rab1B and NS4B.
To address whether Rab1B interacts with NS4B, the Rab1B gene was amplified from
Huh7 cell line by RT-PCR (with myc tag), and the expression of Myc-Rab1B was tested
in Huh7 cell. As shown in Fig.3-1A, the Myc-Rab1B could be recognized by either anti-
Myc antibody or anti-Rab1B antibody. The size of the detected proteins (Myc-Rab1B)
76
was the same as expected (23kDa), which is slightly larger than the endogenous Rab1B
(because of myc tag).
Fig.3-1 The interaction between Rab1B and viral proteins. (A) The expression of myc-Rab1B in Huh7
cell was detected by Western blot (myc or Rab1B specific antibody). (B) Flag-NS4B (or Flag-NS4B with
various cysteine mutations) and Myc-Rab1B were coexpressed in Huh7 cell. The interaction between
NS4B and Rab1B was identified by immunoprecipitation (anti-Flag)-Western blot (anti-Myc). Flag-
hnRNPA/B was the Flag-tagged negative control (NC). Myc-TC21 was the Myc-tagged negative control.
(C) Flag-tagged NS4B deletion mutants were conexpressed with Myc-Rab1B in HuH7 to determine the
Rab1B-binding site on NS4B. The interaction was identified by IP (anti-Flag)-WB (anti-Myc). (D) Flag-
tagged Rab1B or CtBP (negative control) were overexpressed in replicon cell. The viral proteins
interacting with Rab1B was detected by HCV patient serum after immunoprecipitaion with anti-Flag
antibody. .
Flag
Myc-Rab1B + + + + +
4B
M2
M5
M7
IP: anti-Flag
WB:anti- Myc
NC
Flag
Myc-Rab1B + + + + + -
4B
C257A
C261A
DM
NC
4B
Myc-TC21 - - - - - +
Flag-CtBP
Flag-Rab1B
100
72
55
40
33
24
17
IP: anti-Flag
WB: anti-HCV
A. B.
HuH7
HuH7 + myc-Rab1B
Anti- Myc
Anti- Rab1B
C.
D.

The first question I asked was whether Rab1B could interact with NS4B specifically.
The co-immunoprecipitaiton method was used to address this issue. Myc-Rab was pulled
down by Flag-NS4B wild type but not Flag-hnRNPA/B (as a negative control) as shown
in fig.3-1 B. This result suggests that Rab1B specifically interacts with NS4B. We also
used Myc-TC21 as another negative control. No significant interaction was seen
between Myc-TC21 and Flag-NS4B. We also tested whether Rab1B could interact with
NS4B mutants. NS4B (C257A) and NS4B(C261A) could interact with Rab1B to the
same extent as wild-type NS4B. However, only trace amount of Myc-Rab1B was pulled
77
down by the Flag-NS4B (C25,261A) mutant. The results suggest that the presence of a
single cystein residue was sufficient for the interaction between NS4B and Rab1B.
However, the interaction was disrupted when these two cysteins were removed
simultaneously. This interaction pattern is similar to the interaction between NS4B and
NS5A (Chapter2, Fig2-13A), in which wild type and the single cysteine mutants were
able to interact efficiently. The interaction was dramatically reduced with the double
cysteine mutant.
Using the same method, we also have mapped the Rab1B-ineraction site on NS4B
protein by using NS4B deletion mutants. As shown in Fig.3-1C, Rab1B mainly
interacted with M5 (the C-terminal half of NS4B with two transmembrane segments).
As there was almost no interaction between Rab1B and M7 (the four transmembrane
domains of NS4B), the main interacting domain was mapped to the cytoplasmic region
of C-terminal end, which is consistent with the conclusion that the lipid modification
status of NS4B affects the interaction between NS4B and Rab1B. There was a slight
interaction between NS4B and M2 mutant (the C-terminal half of NS4B with two
transmembrane segments). It is not clear whether N-terminal cytoplasmic region is also
involved in the interaction with NS4B.
The next question would be whether Rab1B interacts with NS4B or whether Rab1B
interacts with other viral proteins through Rab1B-NS4B interaction in the replicon
system. The Flag-Rab1B protein was overexpressed in replicon cell, and the interaction
was tested by IP (by anti-Flag) and WB (by an HCV patient serum). The reason for
using HCV patient serum for Western blot detection instead of other specific antibodies
(for example, NS4B or NS5A antibodies) was that the HCV patient serum has higher
78
sensitivity than other specific antibodies, especially for NS4B antibody, and that all of
the viral proteins pulled down by Flag-Rab1B could be detected at the same time by
using HCV patient serum. Moreover, the secondary antibody for human antibody has less
cross reaction to the mouse antibody used for immunoprecipitation. As shown in Fig.3-
1D, several viral proteins could be pulled down by Flag-Rab1B. Based on the size of
these proteins, NS4B was the protein between 24 kDa to 33kDa protein markers, and
NS5A was the protein between 55 kDa to 73 kDa protein markers. The viral proteins
with the size larger than NS5A could be either NS3 or NS5B or intermediate of
uncleaved fusion proteins. The result suggests Rab1B interacts with NS4B in the
context of HCV polyprotein and with other viral proteins through the interaction with
NS4B.

3.4.3 Colocalization of Rab1B and NS4B.
To see whether the interaction between Rab1B and NS4B might alter the subcellular
localization of Rab1B, the immunofluorescence staining and confocal microscopy were
performed. At first, the subcellular localization of Rab1B was examined in Huh7 cell in
the absence of NS4B. The Myc-Rab1B was expressed in Huh7cells and the subcellular
localization of Myc-Rab1B was examined by staining with anti-Myc antibody or anti-
Rab1B antibody (Fig.3-2A). The Myc antibody detects Myc-tagged Rab1B, but the
Rab1B antibody could detect both exogenous Myc-Rab1B and endogenous Rab1B in
Huh7 cell. The Rab1B was found in both ER and Golgi compartment (concentrated
area); this distribution pattern was very similar to the published report (Plutner et al.,
1991).
79

Fig.3-2 Colocalization of NS4B and Rab1B. (A) Huh7 cells were transfected with myc-Rab1B DNA. The
subcelluarlocalization of myc-Rab1B was detected by myc or Rab1B specific antibody (followed by FITC-
secondary antibody). (B) Huh7 cells were cotransfected with Myc-Rab1B and GFP-NS4B. Myc-Rab1B was
detected by mouse anti-mycantibody and Rhodamine-conjugated secondary antibody.

In the presence of GFP-NS4B, the subcellular localization of Rab1B shows more
diffuse and reticular distribution (Fig.3-2B). Especially, the Golgi distribution of Rab1B
was not as obvious as when the Myc-Rab1B was expressed alone (Fig3-2A). The
relocation of Rab1B could be due to the interaction with NS4B (the merge image).
The expression of NS4B by DNA transfection is always very low for the
immunofluorescence staining. Therefore, GFP-NS4B was used for NS4B tracing (Fig.3-
2). Similar results were obtained. Recently, we have found that in vitro transcribed
polyA-tailed mRNA of NS4B could increase the NS4B expression level as high as that
achieved by the VV-T7 polymerase system. Therefore, in order to confirm the result
80
from the coexpression of Myc-Rab1B and GFP-NS4B, we used the Flag-NS4B mRNA
transfection method for the colocalization experiment.
Flag-NS4B Rab1B
Merge
Fig.3-3 Subcellular localization of Rab1B and NS4B. Huh7 cell was transfected with in vitro trascribed
mRNA of Flag-NS4B. The NS4B was detected by mouse anti-Flag antibody , followed by anti-mouse-
rhodamine antibody. Endogenous Rab1B was detected by rabbit anti-Rab1B antibody, followed by anti-
rabbit-FITC antibody. .

As shown in Fig3-3 upper panel., by mRNA transfection, Flag-NS4B could be easily
detected by immunostaining. Since the NS4B was expressed to a very high level, NS4B
concentrated at certain area, in contrast to the pattern from the GFP-NS4B DNA
transfection (Fig3-2B). Under such conditions, the pattern of distribution of endogenous
Rab1B was dramatically changed. The cell in the lower panel of Fig.3-3 was a cell
without NS4B expression from the same culture slide. This result suggests that the
NS4B could interact with Rab1B and change the Rab1B subcellular localization.
81
The next question we tried to address was whether Rab1B localization is changed in
replicon cell. Because of the lack of a sensitive NS4B antibody, we were not able to
stain replicon cell with NS4B antibody directly. It has been shown that NS5A directly
interacts with NS4B (Gao et al., 2004); and Rab1B could pull down other nonstructural
proteins including NS5A from the replicon cells (Fig. 3-1 D). Therefore, NS5A was used
as a marker for active HCV replication.
Fig3-4. The Rab1B distribution in replicon cells. Replicon cells were directly stained with Rab1B ( rabbit
anti-Rab1B, followed by anri-rabbit- FITC) and NS5A (mouse anti-NS5A, followed by anti-mouse-
Rhodamine) antibodies.
NS5A Rab1B Merge

As shown in Fig3-4, Rab1B and NS5A were stained in replicon cells. There are two
cells with higher expression of NS5A in the field. The expression pattern of NS5A was
exclusively in cytoplasm and distributed as reticular patter. In the merge image (Fig.3-4,
right panel), Rab1B is partially colocalized with NS5A in perinuclear region. In replicon
82
cell, not all of the nonstructural proteins are involved in replication. In BrUTP labeling
experiment, the active replication sites are always present in perinuclear area. Whether
these Rab1B-NS5A colocalization locations are the active replication would be an
interesting question to address.

3.4.4 Rab siRNAs and RNA replication.
To check whether Rab1B is involved in the HCV RNA replication, three Rab1B-
specific siRNAs were designed to knock down endogenous Rab1B in replicon cell. To
confirm the ability of these Rab1B siRNA, the endogenous Rab1B protein was detected
by Western blot (Fig.3-5A). All three siRNAs could knock down the Rab1B expression
in replicon cells with different efficiency. R1 and R3 siRNAs had better knocking-down
efficiency, especially on Day3. As shown in Fig.3-5B, the HCV subgenomic RNA was
detected by real-time RT-PCR in order to see the effects of Rab1B siRNAs to RNA
replication. The HCV RNA level was decreased when the replicon cell were transfected
with Rab1B-specific siRNAs, as compared to the cells with nonspecific siRNA
transfection, suggesting that Rab1B is required for subgenomic RNA replication.
Although the HCV RNA replication was decreased in the presence of Rab1B siRNA, the
best inhibitory effect was only 50% reduction. This could be due to the possibility that
Rab1B protein was not completely knocked down, or that the Rab1B isoform, Rab1A,
might substitute Rab1B function in HCV RNA replication. Second siRNA transfection
to completely knock down Rab1B protein expression or knocking-down Rab1A and
Rab1B simultaneously would be two possible directions to see more dramatic reduction
83
of RNA replication. However, the inhibitory effect seen in the presence of Rab1B
siRNAs still suggests a role of Rab1B in HCV RNA replication.
NS R1 R2 R3
ß-actin
Rab1B
Day 2
Day 3
Fig.3-5 The effect of Rab1B siRNAs on subgenomic RNA replication. Replicon cells were transfected
with 200nM Rab1B siRNAs (R1,R2 or R3) or Non-specific siRNA (NS). Protein and RNA were harvested at
day2 or day3 post-transfection for Western blot (anti –Rab1B or anti- β-actin) (A) ,or Real-time PCR (B).
A. B.
Rab1B siRNA and HCV RNA replication
0
100000
200000
300000
400000
500000
600000
700000
800000
900000
D2 D3
Post-siRNA transfection (day)
HCV RNA cpopies / 10 ng
total RNA
NS
R1
R2
R3
ß-actin
Rab1B
NS R1 R2 R3
3.4.5 Rab1B mutants and RNA replication
To determine the role of Rab1B in RNA replication, another approach to address this
issue is to see whether Rab1B mutants could affect RNA replication. Rab1B is a small
GTP-binding protein; geranylgeranylation of the last two cysteine residues of Rab1B is
essential for Rab1B to function. Therefore, we designed a Rab1B mutant with these two
cysteine residues deleted (delCC), which does not have membrane binding ability. We
also designed another Rab1B mutant with N121I mutation. The Rab1B(N121I) mutant is
an inactive form of Rab1B with impaired guanine nucleotide binding (Alvarez et al.,
2003). Rab1B (N121I) blocks foreword transport of cargo and induces Golgi disruption.
84
1 2 3
Vector
1 2 3
Myc-Rab1B
1 2 3
Del CC
1 2 3
N121I
Day(s)
(anti-Myc)
Vector
Myc-Rab1B
Del CC
N121I
HCV probe
GAPDH probe
A. B.
WT
WT
Fig.3-6 Rab1B mutants and subgenomic replicon replication. Huh7 cells were tansfected with with
subgenomic replicon (5µg) and various DNA constructs (25µg) by eletroporation. (A) Protein samples were
harvested on day1 for Western blot. (B) Total cellular RNA were collected from day1 to day 3 post-
transfection. 5µg was sujected to Northern blot. Replicon replication was detected by HCV specific probe.
GAPDH was used as a internal control. The signals of HCV and GAPDH from Northern blot were quantified
by Image Quant program. The HCV signals were normalized by GAPDH siganls,then plot in (C). Day1
sample of vector control was set as 100% in the graph. .
C.
Rab1B Mutants and Transient Replication
40
80
120
160
200
12 3
Post-Transfection (Days)
HCV RNA(%)
Vector
WT
delCC
N121I

These wild type Rab1B or Rab1B mutants were cotransfected with in vitro
transcribed replicon RNA into Huh7 cells to test the effect of the Rab1B mutants on
transient replicon replication. These two Rab1B mutants were myc-tagged, so that the
expression of these two mutants could be detected by western blot by using anti-myc
antibody (Fig.3-6A). The expression level of these two mutants was much lower than
wild type Myc-Rab1B.
Fig.3-6B shows the transient RNA replication in the presence of Rab1B and mutants.
Under this condition, most of the in vitro transcribed RNA would be degraded, only small
amount of RNAs starts to replicate, the replication would last for only a few days in the
absence of selection pressure. In vector control, pcDNA3.1 vector was cotransfected
85
with replicon RNA. The replicon continuously replicates on Day2 and Day3. The
amount of replicating RNAs of vector control on Day1 was quantified and set as 100% in
Fig.3-6C. On Day2 and Day3, the RNA increased to 160% and 165% respectively. In
the presence of Myc-Rab1B overexpression, the replication was faster than vector control
(131% on Day1), then decreased on Day3. The positive effect was seen only on Day1
but not on Day2 and Day3. The RNA replication may activate host defense to viral RNA
replication, so that the RNA replication lasts only a few days in this system. Although
the Myc-Rab1B increased the replication on day1, the host defense could be triggered
earlier than the vector control group. So, the replication started to decrease on Day3 in
the presence of Rab1B overexpression (Fig.3-6C).
The HCV RNA replication was inhibited by Rab1B mutants, even though the protein
expression level of these mutants was very low. In the presence of Rab1B delCC mutant,
the replication was only 50.6% of vector control on day1 and 109.9 % and 108.2% on
Day2 and Day3 respectively. Rab1B delCC had more inhibitory effect on Day1; then,
the replication gradually increased, but not as high as vector control. In the presence of
Rab1B N121I mutant, the replication was 61.3% of vector control on day1 and 81.1 %
and 81.4% on Day2 and Day3, respectively. Compared to delCC mutant, the N121I
mutant has less inhibitory effect on Day1; however, the RNA level remained at a lower
level on Day 2 and Day3. These results suggest that Rab1B is important for HCV RNA
replication since the Rab1B mutants (delCC and N121I) could disturb the RNA
replication. Although the reduced level may be vary in different experiments, the
inhibitory effect of Rab1B mutants was reproducible.
86
What is the possible mechanism by which Rab1B del CC and N121I mutants affect
RNA replication? In order to address this issue, the interaction between Rab1B mutants
and NS4B was examined by coimmunoprecipitation method. In this assay system, VV-
T7 was applied to increase Flag-NS4B expression. Because the vector used for Myc-
Rab1B and mutants also contains T7 promoter, the expression of Rab1B and mutants
were also increased in the presence of VV-T7.

Input (WB) IP-WB
Del CC
N121I
WT
Fig. 3-7 Rab1B mutants and NS4B interaction. Flag-NS4B and Myc-Rab1B wild type or mutants were
co-expressed in Huh7 cell with VV-T7 polymerase induction. The interaction between NS4B and rab1B
was identified by immunoprecipitation (anti-Flag)-Western blot (anti-Myc). .
Del CC
N121I
WT

The wild type Rab1B and N121I mutant could interact with NS4B, but not delCC
mutant ( Fig.3-7). N121I mutant had stronger interaction than wild type. Therefore, the
mechanism by which delCC and N121I mutants to affect RNA replication might be
different. Rab1B delCC mutant did not interact with NS4B; so the inhibitory effect
might be through the interference of other Rab1B-interacting factors. On the other hand,
87
N121I mutant possessed a stronger interaction ability with NS4B. The Rab1B(N121I)
mutant is a inactive form of Rab1B with impaired guanine nucleotide binding (Alvarez et
al., 2003). It has been shown that Rab1B N121I is associated with ER membrane; and
that it disrupts Golgi structure (Alvarez et al., 2003). Although N121I still has the ability
to interact with NS4B, it is possible that the GTPase activity is required for subsequent
events to happen. The main function for Rab1B is to direct cellular vesicles to the right
acceptor membrane. If the vesicle targeting events are essential for RNA replication, the
interaction between N121I and NS4B may not be functional since N121I is the inactive
form of Rab1B and could not carry vesicles to the replication site. More studies are
required to elucidate the all these possibilities and to define how Rab1B is involved in
HCV RNA replication.
As shown in Fig.3-6A, these two mutants are not very stable in cell, so the expression
level of these two mutants was very low under this condition. As shown in Fig.3-6B,
these two mutants could decrease the RNA replication but could not completely abolish
the RNA replication. We have overexpressed these two mutants in replicon cells in
which the HCV RNA is actively replicating; however, the inhibitory effect was not that
obvious as in transient replication system. This could be due to the possibility that the
expression level of these two mutant was too low to see the dramatic reduciton.

3.4.6 The effect of NS4B on Rab1B function.
Newly synthesized VSV-G which has less complex glycosylation is endoH-sensitive.
During the maturation process, VSV-G is transported from ER to Golgi, and more
complex glycosylation will be added to VSV-G protein by the Golgi resident enzyme.
88
Therefore, VSV-G changes from being endoH-sensitive to resistant when transported
from ER to Golgi. As Rab1B is important for ER-to-Golgi transport, VSV-G
glycosylation processing serves as a useful marker to test the function of Rab1B. Some
Rab1B mutants have been shown to have the ability to block the VSV-G processing
(Schwaninger et al., 1992; Tisdale et al., 1992).
Since NS4B could interact with Rab1B, whether this interaction affects Rab1B
normal function was the next question we tried to address. So, the VSV-G processing
was used as the indicator for Rab1B function. In Fig.3-7A, VSV-G processing was
determined by the endoH sensitivity test after cells were transfected with the polyA-
tailed NS4BmRNA or GFP control mRNA.
- + - + - + - + EndoH
0’ 10’ 20’ 30’ Chase ( min)
GFP mRNA
NS4B mRNA
0’ 15 30’ 45’ 0’ 15’ 30’ 45’
0’ 15’ 30’ 45’ 0’ 15’ 30’ 45’
Vector Myc-Rab1B
del CC N121I
0’ 15’ 30’ 45’ 0’ 15’ 30’ 45’
GFP mRNA
N121I
NS4B mRNA
N121I
- + - + - + - + EndoH
0’ 10’ 20’ 30’ Chase ( min)
A. B.
C.
Fig.3-8 The effect of NS4B to the Rab1B function in VSV-G processing. (A) The polyA-tailed mRNA
(NS4B or GFP) were cotransfected with VSV-G plasmid to Huh7 cells. The Endo H sensitivity of VSV-G
was tested at 24 hours posttransfection. (B) Rab1B wild type or mutants were cotransfected with VSV-G to
Huh7cells. The Endo H sensitivity of VSV-G was tested at 24 hours posttransfection. (C) The polyA-tailed
mRNA (NS4B or GFP) were cotransfected with Rab1BN121I mutant to Huh7 cells. After 24hrs incubation,
the cells were trasfected with VSV-G plasmid. The Endo H sensitivity of VSV-G was tested at 24 hours
incubation.
+ + + + + + + + EndoH
+ + + + + + + + EndoH
+ + + + + + + + EndoH

89

In the GFP control, the newly synthesized VSV-G protein was endoH sensitive (0
min chase). After 30 min incubation, about half of the VSV-G became endoH-resistant.
The VSV-G processing rate was not affected in the presence of NS4B overexpression
(Fig.3-8A). The result was the same when NS4B protein was introduced by DNA
transfection instead of mRNA transfection. The result suggests that the NS4B-Rab1B
interaction does not affect the normal function of Rab1B. The interaction could be very
dynamic, so that Rab1B still could execute its normal function.
It has been shown that Rab1BN121I mutant blocks the ER-to-Golgi traffic. To
confirm the phenotype of Rab1BN121I mutant in Huh7 cell, Rab1B wild type and
mutants were expressed in Huh7 cell and the VSV-G processing rate was examined. In
Fig.3-8B, the
35
S-methionine labeling could be too long, so that some of the VSV-G
protein has become endoH-resistant without any further incubation. Half of VSV-G has
become endoH resistant after 15 min further incubation and all the labeled VSV-G
proteins became endoH-resistant after 45-min incubation. The VSV-G processing rate
was not affected in the presence of Rab1B overexpression, suggesting that Rab1B was
not the limiting factor in this process. The processing rate was also the same in the
presence of Rab1B delCC mutant. Although the delCC mutant might affect other
Rab1B-interacting factors, the ER-to-Golgi traffic remained unaffected. The most
sticking effect was seen when the N121I mutant was expressed in cell. Even with 45 min
further incubation, less than half of VSV-G was endoH-resistant. This result is
consistent with the previous report that N121I mutant could block the ER-to-Golgi traffic;
therefore, VSV-G processing was interrupted.
90
As NS4B interacts with Rab1B N121I mutant, we wondered whether this interaction
could reverse the phenotype induced by N121I mutant. So, the N121I mutant was
coexpressed with NS4B or GFP, and VSV-G processing rate was examined. As shown
in Fig.3-8C, in the presence of GFP and N121I mutant coexpression, endoH-sensitive
VSV-G was dominant after 45min incubation, which was the same as Fig.3-8B. In the
presence of NS4B, the VSV-G processing rate was almost the same as the GFP control
group, suggesting that NS4B could not restore the ER-to-Golgi traffic. It has been shown
that the phenotype induced by N121I mutant is irreversible even with Rab1B
overexpression. N121I mutant might trap some important factors for ER-to-Golgi traffic.

91
3.5 Discussions
Based on our results, Rab1B could specifically interact with NS4B; the interaction is
NS4B is dependent on lipid modifications. The Rab1B-interacting domain was mainly
located to the cytoplasmic region of C-terminal end of NS4B. Rab1B subcellular
localization was changed in the presence of NS4B protein. Rab1B also interacts with
NS4B in the context of HCV polyprotein. Rab1B could also immunoprecipitate other
HCV viral proteins, probably through NS4B. Also, Rab1B partially colocalized with
NS5A in replicon cell. Rab1B siRNAs could knock down Rab1B proteins expression
and reduce the HCV RNA replication in replicon cell. Rab1B delCC and N121I mutants
could reduce RNA replication in transient replication system. Moreover, the NS4B-
Rab1B interaction does not affect the normal function of Rab1B by using VSV-G
processing as an indicator.
In the VSV-G processing assay, the ER-to-Golgi traffic was not affected in the
presence of NS4B overexpression. It has been shown that NS4A-4B intermediate but not
NS4B alone could interfere with ER-to-Golgi traffic (Konan et al., 2003). If Rab1B is
the main target for NS4A-4B intermediate to delay the ER-to-Golgi traffic, it would be
interesting to test whether NS4A-4B has different affinity to Rab1B than NS4B alone. In
Rab1B binding site mapping experiment (Fig.3-1C), the N-terminal cytoplasmic region
of NS4B also has low affinity to Rab1B. It is possible that another strong binding site
may be present in the NS4A-4B intermediate around the N-terminal region of NS4B.
However, more studies are required to prove this hypothesis.
Is Rab1B one of the geranygeranylated host factors required for HCV replication?
We have tried to obtain the direct evidence that Rab1B is one of the geranylgeranylated
92
targets for geranylgenranyl inhibitor in HCV replication. The results are inconclusive so
far. Interestingly, Wang et al. have identified a NS5A-interacting protein, FBL2 as the
genanylgeranylated cellular protein required for HCV replication (Wang et al.,2005).
FBL2 is a protein involved in a ubiquitination reaction with unknown substrates. How
FBL2 participates in HCV replication is still unknown. It is possible that more than one
geranylgeranylated cellular factors is involved in HCV replication. Since Rab1B has a
role in directing cellular vesicle transport, Rab1B could be directly involved in
replication in the structural level. On the other hand, the normal function of FBL2 is
related to ubiquitination process. By interacting with NS5A, FBL2 may regulate other
cellular factors or viral proteins involved in HCV RNA replication.
Although our results have suggested that Rab1B interacts with NS4B and is involved
in HCV RNA replication, the mechanism by which that Rab1B helps HCV RNA
replication is still unknown. The most important function of NS4B is membranous web
formation activity. Rab1B is involved in vesicle targeting from ER (donor membrane) to
Golgi (acceptor membrane). Our results suggested that NS4B interacts with Rab1B and
changes the subcellular distribution. It is possible that Rab1B might target the vesicles to
replication site where NS4B and other viral proteins reside through the NS4B-Rab1B
interaction. So, the replication site would be a new donor membrane for Rab1B other
than Golgi membrane. Since Rab1B is also involved in cis and medal Golgi transport, it
is possible that Rab1B might carry some vesicles derived from Golgi membrane (donor
membrane) to the HCV replication site. Therefore, the membrane source could be from
ER or Golgi membrane. This model might be able to explain why ER or Golgi origin of
the intracellular membrane system is hard to define in replicon cell. To test this model,
93
more studies are required and some possible experimental approaches could be pursued.
For example, the in vitro assay system may be a useful tool to address whether Rab1B
could target vesicles to NS4B containing membrane and to define the relationship
between NS4B and Rab1B. Also, the in vitro assay system might also help to
characterize the Rab1B and NS4B GTPase activities. Moreover, it is also important to
examine whether Rab1B is directly involved in membranous web formation process.
Rab1B is a very dynamic protein when it executes its function. GTP-bound Rab1B
is active in membrane targeting. After guanine nucleotide hydrolysis occurs, the Rab is
extracted from the membrane to cytosol and then participates in the second round
vessicle targeting. Although Rab1B interacts with NS4B, the interaction could be very
dynamic. Therefore, the overexpression of Rab1B did not affect the VSV-G processing
rate (Fig.3-8A). The Rab1B N121I mutant loses the guanine binding activity, so the
mutant does not recycle when expressed in cell. This could be the reason that NS4B has
stronger binding affinity to Rab1B N121I mutant (Fig.3-7). To prove this hypothesis, the
FRET system (Fluorescence Resonance Energy Transfer) might be a possible tool to
examine the dynamics of Rab1B-NS4B interaction or Rab1B N121I –NS4B interaction.
NS4B is a very hydrophobic membrane protein and the expression level of NS4B is
always very low either in E coli expression system or mammalian expression system. All
of the properties have made the NS4B research so difficult and, so far, no NS4B-
interacting protein has been identified. The identification of Rab1B-NS4B interaction
might help to understand HCV NS4B and to develop new approaches to against HCV
replication.

94
Chapter 4: NS4B-interacting proteins: FALDH
4.1 Abstract
FLADH (fatty aldehyde dehydrogenase) is one of the factors identified by mass
spectrometry. In this chapter, the interaction of NS4B and FALDH and the possible role
of FALDH were elucidated. FALDH is microsomal ALDH catalyzing the conversion of
aldehyde to the corresponding acids. FALDH had high activity toward saturated and
unsaturated aliphatic aldehydes ranging from 6 to 24 carbons in length. FALDH is
involved in the detoxification of aldehydic products of lipid peroxidation, and in the
oxidation of aldehydes formed during fatty alcohol metabolism.
FALDH could specifically interact with Flag-NS4B; and the NS4B-FALDH
interaction is also dependent on NS4B lipid modification. The FALDH-interacting
domain was located in the C-terminal half of NS4B containing two transmembrane
segments and the cytoplasmic portion of the C-terminal end of NS4B. By
immunostaining, NS4B and FALDH were well colocalized in Huh7 cells, and NS4B
cytoplasmic portion (GFP-NS4B 197-261) could change the FALDH from evenly
reticular pattern to a perinuclear pattern. Strikingly, a specialized structure was induced
by the overexpression of FALDH, which was also seen when NS4B was overexpressed
by mRNA transfection. The colocalization of FALDH with viral protein and the induced
structure were also seen in replicon cell. Moreover, FALDH siRNA treatment could
reduce HCV RNA replication. These results suggest that FALDH might be involved in
HCV replication. More studies are required to clarify the detailed mechanism.

95
4.2 Introduction
4.2.1 ALDH family.
As mentioned in Chapter 3, some host factors were present in NS4B protein
preparations. FALDH (fatty aldehyde dehydrogenase) was one of the factors identified by
mass spectrometry. FALDH belongs to ALDH (aldehyde dehydrogenase) family, which
is a group of enzymes catalyzing the conversion of aldehyde to the corresponding acids
by means of an NAD(P)+-dependent reaction(Yoshida et al., 1998). Aldehydes are
highly reactive molecules that are intermediates or products involved in a broad spectrum
of physiologic, biologic and pharmacologic processes. One of the most important
pathways for aldehyde metabolism is their oxidation to carboxylic acids by ALDHs.
Therefore, ALDHs have been considered as general detoxifying enzymes which
eliminate toxic biogenic and xenobiotic aldehydes (Vasiliou et al., 2000). Twelve known
human ALDH genes have been identified, including ALDH1-10 and SSDH (succinic
semialdehyde dehydrogenase) and MMSDH (methylmalonate semiadehyde
dehydrogenase). These enzymes have different tissue distribution, subcellular localization,
and substrate specificity (Sophos et al., 2001; Yoshida et al., 1998). The ALDH10 (or
name ALDH3A2) gene encodes microsomal enzyme, FALDH, with 485 amino acid
residues (Rogers et al., 1997). The FALDH tissue distribution includes liver, heart, and
muscle; and fatty and aromatic aldehydes are main substrates for FALDH (Kelson et al.,
1997). Human ALDH3 (or name ALDH3A1) is the closest family member of FALDH.
ALDH3 also has high activity for oxidation of fatty aldehydes. Although organization
and structure of ALDH3 and FALDH are very similar, ALDH3 is a cytosolic enzyme and
is constitutively expressed in cornea, stomach, esophagus, urinary bladder and lung, but
96
not in liver. ALDH3 might not supplement the role of FALDH in the synthesis of
membrane lipid (Yoshida et al., 1998).

4.2.2 FALDH.
FALDH is highly homologous (84-95% amino acid identity) to the rat microsomal
aldehyde dehydrogenase (msALDH) and the mouse microsomal aldehyde dehydrogenase
(AHD3) (Miyauchi et al., 1991; Vasiliou et al., 1996). All three ALDH isozymes are of
microsomal origin and have a hydrophobic domain at the carboxyl terminal. These
enzymes can catalyze the oxidation of long chain aliphatic aldehydes to fatty acids
(Kelson et al., 1997). A peroxisome proliferating agent, clofibrate, can induce both
mouse AHD3 and rat msALDH activity. These results suggest that these enzymes are
involved in the lipid metabolism. (Peroxisomes are the site where long-chain fatty
alcohol is incorporated into glycerol ether lipids) (Vasiliou et al., 1996)
The human FALDH enzyme has molecular weight of 54kDa, requires NAD+ as
cofacotor, has optimal activity at pH.9.8 and is thermolabile at 47°C. The active enzyme
is probably homodimer. FALDH has high activity toward saturated and unsaturated
aliphatic aldehydes ranging from 6 to 24 carbons in length, as well as dihydrophytal, a
20-carbon branched chain aldehyde. (Kelson et al., 1997) The substrate specificities of
microsomal ALDH suggests that they may be important in the detoxification of aldehydic
products of lipid peroxidation, omega-oxidation of 20-CHO-leukotriene B4, and in the
oxidation of aldehydes formed during fatty alcohol metabolism (Rizzo, 1998; Willemsen
et al., 2001).

97
4.2.3 The metabolic role of FALDH.
In mammals, digestion of dietary and endogenous lipid generates fatty acids which
are converted to fatty alcohols by two reactions catalyzed by acyl-CoA synthase and
acyl-CoA reductase. Fatty alcohols are substrates for the synthesis of wax esters and
ether lipids (Rizzo, 1998). Fatty alcohols also can be metabolized back to fatty acids by
fatty alcohol:NAD+ oxidoreductase (FAO) complex. This complex comprises at least
two distinct enzymes, one of which catalyzes the conversion of fatty alcohol to fatty
aldehyde and the other oxidizes fatty aldehyde to fatty acids (FALDH) (Rizzo, 1998). In
human liver, and also in cultured human hepatoma cells, FALDH activity was
predominantly micorsomal. This subcellualr localization correlated with the site of FAO,
in which FALDH is though to act as an integral component for catalyzing the oxidation
of fatty alcohol to fatty acid (Rizzo, 1998).

4.2.4 FALDH and Sjogren-Larsson syndrome.
The importance of FALDH has been delineated by the fact that genetic deficiency of
FALDH in human is associated with the Sjogren-Larsson syndrome (SLS), an autosomal
recessive disorder characterized by ichthyosis, mental retardation, spasticity (Willemsen
et al., 2001). SLS is caused by mutations, including deletion, insertion, and missense
mutations in the FALDH gene. A definitive diagnosis of SLS can be made by measuring
the activity of the enzyme FALDH in culture fibrobloast.
SJS patients have deficient FALDH enzyme activity that results in a concomitant
reduction of FAO activity. Affected SLS patients accumulate octadecanol and
ehxadecanol in their plasma. Although the primary enzyme deficiency is at the aldehyde
98
step in fatty alcohol oxidation, free aldehydes do not accumulate in blood or in cultured
fibroblast (Rizzo and Craft, 2000). This suggests that FALDH defect results in a
concomitant blockage of fatty alcohol dehydorgenase in the FAO complex, which limits
production of alcohol-derived fatty aldehyde, or that the aldehyde substrates are
processed into other metabolites. (Rizzo and Craft, 2000)
Although the pathogenesis of SLS is unclear, the symptoms of LS probably arise
from membrane alterations resulting from accumulation of fatty alcohol or aldehyde-
modified lipid and proteins. Furthermore, as might be predicted from the essential role
of FALDH in leucotriene B
4
metabolism, elevated urinary concentrations of LTB
4
and
20-OH- LTB
4
were found in SLS patients (Rizzo and Craft, 2000). LTB
4
is a
proinflammatory lipid mediator synthesized form arachidonic acid. FALDH deficiency
may lead to an accumulation of fatty alcohol or aldehyde-modified macromolecules with
structural consequences for cell-membrane integrity, and elevated concentration of
biologically highly active lipids (James and Zoeller, 1997). Fatty aldehydes are reactive
molecules that have the potential to form Schiff bases with free amino groups. SJS
fibroblasts and FALDH-deficient CHO cells have been shown to accumulate aldehyde–
modified PE (phosphatidylethanolamine) (Rizzo and Craft, 2000; Rizzo et al., 2000).

4.2.5 The detoxification role of FALDH
FALDH is involved in detoxification of fatty aldehydes which are from fatty alcohol
metabolism or from lipid peroxidation under oxidative stress. It has been shown that
ectopic expression of FALDH significantly decreased reactive oxygen species production
in cell treated by 4-hydroxynonenal, the major lipid peroxidation product, suggesting that
99
FALDH protects against oxidative stress associated with lipid peroxidation (Demozay et
al., 2004).
This chapter mainly focuses on FALDH research including identification of the
interaction between FALDH and NS4B, subcellular localization of FALDH in the
presence of NS4B or in the replicon cell, the effect of FALDH siRNA to HCV RNA
replication and the detection of endogenous FALDH in replicon cell.

100
4.3 Materials and Methods
4.3.1 DNA constructs and reagents.
FALDH gene was amplified from Huh7 cell line by RT-PCR. The primer design
was based on NCBI nucleotide sequence (AB208894). The forward primer sequence
contains myc tag sequence (5’ GCCACCATGGAACAAAAACTTATTTCTGAAGAA
GATCTG 3’). The reverse primer contains stop coden (5’ 3’). The PCR products were
cloned into pcDNA3.1/V5-His expression vector by TA cloning (Invitrogen, Carlsbad,
CA). The recombinant FALDH is Myc-tagged and had no V5-His tag at the C-terminal
end from pcDNA3.1/V5-His vector because the stop coden was placed on the reverse
primer. The FALDH sequence was confirmed by sequencing, and the gene amplified
from Huh7 cell was the same as the sequence from the NCBI database.

4.3.2 Coimmunoprecipitation
Myc-FALDH and various Flag tagged NS4B constructs were coexpressed in Huh7
cells and the expression of NS4B protein and related mutants was induced by VV-T7.
The co-immunoprecipitation method was the same as described in Chapter2, but the
RIPA buffer [50 mM Tris-HCl pH7.5, 150 mM NaCl, 5 mM EDTA, 1% NP40, 0.5 %
Sodium deoxycholate, 0.1% SDS, 1mM PMSF, 1X Complete Protease Inhibitors (Roche,
Mannheim, Germany) ] was used for cell lysis and immunoprecipitation. To detect the
FALDH interaction with viral proteins in the replicon cells, the Flag-FALDH was
overexpressed in replicon cells and co-immunoprecipitation was performed with TM10
buffer system.

101
4.3.3 Immunofluorescence staining
To detect the FALDH subcellular localization in Huh7cell and replicon cell, cells
were transfected with myc-FALDH DNA and the Myc-FALDH was detected by
immunostaining with Myc antibody. The staining method was the same as the myc-
Rab1B staining in Chapter3.

4.3.4 FALDH siRNA and real time PCR
The FALDH siRNAs were predicted by siRNA Target Finder program on Ambion
website. Two siRNA sequences selected from the program target FALDH coding region
but not any cellular RNA. The sequences are as follows. FALDH siRNA#1: sense
(5’rGrArUrGrGrCrCrGrUrCrArGrGrArUrArUrCrCTT3’), antisense
(3’TTrCrUrArCrCrGrGrCrArGrUrCrCrUrArUrArGrG3’). FALDH siRNA#2: sense
(5’rUrCrArCrUrCrArGrUrUrCrArGrArArGrGrCrUTT3’) antisense (3’TTrArGrUrGrA
rGrUrCrArArGrUrCrUrUrCrCGrA5’). Nonspecific siRNA is the same as the
nonspecific siRNA used in Chapter3. To determine the knocking-down efficiency of
siRNA, FALDH mRNA level was detected by RT-PCT with FALDH-specific primers
Forward: ALDH747(5’TGAAGCATCCCTCCAAAATC3’). Revese: ALDH959
(5’TCGGTAAGTACTGTTGGGGC3’). The effect of FALDH siRNAs to the HCV
RNA replication was determined by real-time RT-PCR (the same as Chapter3).

102
4.3.5 FALDH recombinant protein expression, purification and animal
immunization
FALDH gene was amplified by PCR and ligated into pTrcHisB (Invitrogen, Carlsbad, CA)
in frame. The expression of recombinant protein (His-Xpress-FALDH) was induced in
bacteria by 1 mM IPTG, at 37°C for four hours. The bacteria were lysed by equilibration
buffer (50 mM Sodium phosphate,pH8.0, 300mM Sodium Chloride, 10 mM Imidazole)
containing 0.5% Triton X-100. The recombinant proteins were purified with Ni-column
(His-Select HF, Sigma, Saint Louis, Missouri) and eluted from the column with 250 mM
imidazole in the presence of 0.5% Triton X-100. The purified protein was dialyzed
against PBS at 4°C overnight; then, the protein was used as antigen for rabbit
immunization. (ProSci, Poway,CA). The antiserum was collected from the animals after
four times immunization (one time with the recombinant protein in complete Freund’s
Adjuvant and three times in incomplete Freund’s Adjuvant).

4.3.6 Immmunoprecipitation.
Replicon cells or control cells were incubated in labeling medium (methionine and
cysteine free D-MEM, 2% FBS, non-essential amino acid) for 30 min to deplete
methionine and cysteine. Then, the cells were incubated in labeling medium containing
15µCi/ml
35
S-Translabel (ICN, Costa Mesa, CA), at 37°C for 4 hours. After incubation,
the cells were washed once with ice-cold PBS and lysed in RIPA buffer. The cell lysate
was collected and centrifuged at 1000 ×g for 10 min; the supernatant was collected for
immunoprecipitation. Endogenous FALDH was immunoprecipitated from the
supernatant by using anti-FALDH antiserum and analyzed by autoradiography.
103
4.4 Results
4.4.1 The interaction between FALDH and HCV viral proteins.
To address whether FALDH interacts with NS4B, the FALDH gene was amplified
from Huh7 cell line by RT-PCR (with myc tag) and the cDNA was checked by
sequencing. The sequence of FALDH cDNA was the same as the sequence from
GeneBank (AB208894)). The cDNA encodes 485 amino acids of FALDH with extra 10
amino acids of Myc tag; thus, the predicted protein size was 55kDa. It has been shown
that FALDH has an isoform from alternative splicing. The isoform is 508 amino acids
long with an alternative 27 amino acids replacing the 4 amino acids at the C-terminal
end of FALDH (Rogers et al., 1997). The expression of this isoform is in low abundance
in cell, and function of this isoform is unknown. In our FALDH clones, we did not find
any clone encoding the long isoform.
We first tested the expression of Myc-FALDH construct in Huh7 cell. As shown in
Fig.4-1A, the Myc-FALDH could be detected by anti-Myc antibody with the size of
55kDa. To elucidate the interaction between FALDH and NS4B, coimmunoprecipitation
was performed (Fig.4-1B). TM10 buffer containing 10% glycerol and nonionic
detergent NP40 was used as the buffer system for most of other co-immunoprecipitation
experiment in Chapters 2 and 3. However, no positive interaction was detected when
TM10 buffer system was used in for the identification of FLADH-NS4B interaction.
Since FALDH was copurified with NS4B by using RIPA buffer and identified by mass
spectrometry analysis, we attempted to use RIPA buffer instead. RIPA buffer containing
both ionic (SDS and sodium deoxycholate) and nonionic detergent (NP40) should be
more stringent than TM10 buffer. Surprisingly, by using RIPA buffer, Myc-FALDH
104
could specifically interact with Flag-NS4B but not Flag-hnRNP A/B (negative control)
(Fig.4-1B).

Fig.4-1 The interaction of FALDH10 and NS4B. (A) Huh7 cells were transfected with GFP or Myc-
FALDH expressing plasmid. Myc tagged protein was detected by Western blot with anti-Myc antibody. (B)
Co-expression of Flag-NS4B (or Flag-NS4B with various cysteine mutations) and Myc-FALDH in Huh7
cell. The interaction between NS4B and FALDH was identified by immunoprecipitation (anti-Flag)-Western
blot (anti-Myc). Flag-hnRNPA/B was the negative control (NC). (C) Flag-tagged NS4B deletion mutants
were conexpressed with Myc-FALDH in Huh7 to determine the FALDH-binding site on NS4B. The
interaction was identified by IP (anti-Flag)-WB (anti-Myc). (D) Flag-tagged FALDH or CtBP (negative
control) were overexpressed in replicon cell. The viral proteins interacting with FALDH were detected by
HCV patient serum after immunoprecipitaion with anti-Flag antibody. .
Flag
Myc-FALDH + + + +
4B
M2
M5
M7
Flag
Myc-FALDH + + + + +
WT
C257A
C261A
DM
NC
A. B.
73
54
48
24
35
Flag-CtBP
Flag-FALDH
C.
IP:Flag
WB: Myc
IP:Flag
WB: Myc
Full-length
M2
M5
M7
1 72 92 101 121 136 156 172 197 261
Anti- Myc
GFP
Myc-FALDH
D.
IP:Flag
WB: HCV

As NS4B has lipid modification on cysteines on the C-terminal end, NS4B with
various cysteine mutations were tested for the interaction ability with FALDH. Fig.4-1B
shows that NS4B(C257A) and NS4B(C261A) have the same interaction ability with
Myc-FALDH as the wild type NS4B does. The interaction was reduced when NS4B
protein had two cysteine mutations, suggesting that the NS4B-FALDH interaction is also
dependent on NS4B lipid modification.
To define the FALDH-interaction site on NS4B, NS4B deletion mutants were applied
to the coimmunoprecipitation experiment. RIPA buffer was used in this experiment. As
105
shown in Fig 4-1C, M2 (NS4B 1-135) completely lost the ability to interact with FALDH.
On the other hand, M5 (NS4B 136-261) could interact with FALDH as strong as the full-
length NS4B. M7 (NS4B 72-197), which has four transmembrane segments of NS4B,
also had a low interaction ability. The results suggest that the interaction site might be
located on both cytoplasmic portion of C-terminal end and also transmembrane domains
which are present in both M5 and M7.
As the interaction between FALDH and NS4B was identified, the next question was
whether FALDH could interact with NS4B and other viral protein in the replicon cell.
Thus, Flag-FALDH was expressed in replicon cell by DNA transfection, and
coimmunprecipitation was performed. Instead of RIPA buffer, TM10 buffer was used in
this coimmunoprecipitaion in order to increase the chance to pull down other viral
proteins through FALDH and NS4B interaction. As shown in Fig.4-1D, Flag-FALDH
could pull down HCV viral proteins including NS5A and the other viral protein with a
protein size larger than NS5A. FALDH might interact with other viral proteins through
the interaction with NS4B, although only a very small amount of NS4B was pulled down
by Flag-FALDH. The NS4B signals could be seen after a longer exposure. The
coimmunoprecipitation experiment suggests that FALDH is in the RNA replication
complex.

4.4.2 Subcellular localization of FALDH in the presence of NS4B.
FALDH in human is very similar to rat microsomal ALDH and mouse ADH3. All of
these enzymes have a hydrophobic segment at the C-terminal end. This hydrophobic
domain is responsible for binding to the ER membrane protein) (Miyauchi et al., 1991;
106
Vasiliou et al., 1996). When expressed in Huh7 cell, Myc-FALDH was localized
exclusively in the cytoplasm, and the distribution pattern was in a reticular ER
distribution (Fig.4-4). When expressed alone in cell, NS4B was also distributed in the
ER (Fig.2-11A). In order to check whether FALDH and NS4B are colocalized in cell,
Myc-FALDH and GFP-NS4B were co-expressed in Huh7 cells. As shown in Fig.4-2,
the expression of both Myc-FALDH and GFP-NS4B were exclusively in the cytoplasm,
and these two proteins were well colocalized as a reticular distribution. The result was
consistent with the coimmunoprecipitation result.
Fig.4-2 Co-localization of NS4B and ALDH10. Huh7 cells were cotransfected with Myc-ALDH and GFP-
NS4B. Myc-ALDH were detected by mouse anti-Myc and Rhodamine-conjugated secondary antibody.
As shown in Fig.4-1C, M5 (136-261amino acids of NS4B) had strong interacting
ability with FALDH; and the lipid modification status of NS4B could affect the
interaction with FALDH. The cytoplasmic portion of NS4B protein might be important
107
for the FALDH-interaction. Therefore, GFP-NS4B(197-261) fusion protein was
coexpressed with Myc-FALDH in Huh7 cell to see whether NS4B cytoplasmic region
could alter the subcellular localization of FALDH. As shown in Fig.4-3, GFP-
NS4B(197-261) had perinuclar localization, and Myc-FALDH was also concentrated
around nucleus. The expression of GFP-NS4B(197-261) might have cytotoxic effect to
the cell, so the debris of GFP-NS4B containing cell was also seen in Fig4-3. If compared
to the single FALDH expression in Huh7 cell (Fig.4-4) or coexpression with NS4B
(Fig.4-2), the FALDH distribution has been changed from a reticular pattern to a
perinuclear pattern in the presence of GFP-NS4B(197-261). The result suggests that the
cytoplasmic region of NS4B has strong interaction ability with FALDH and could
change the subcellular localization of FALDH.

Fig.4-3 Co-localization of GFP-NS4B(197-261) and FALDH. Huh7 cells were cotransfected with Myc-
FALDH and GFP-NS4B(197-261). Myc-ALDH were detected by mouse anti-Myc and Rhodamine-
conjugated secondary antibody.

108

Interestingly, it has been shown that overexpression of Rat msALDH produced large
vesicular structures which are derived from ER membrane and surrounds the nucleus in
COS-1 cells. This pattern was also seen in HeLa cells and BHK cells. When the myc-
FALDH was overexpressed in Huh7 cells, other than the reticular pattern, some cells
have Myc-FALDH concentrated at certain regions (Fig.4-4 A). The FLADH-induced
structure was also seen when Myc-FALDH was expressed in the 293 cell line (data not
shown), suggesting that the phenomenon is not cell-type dependent. The unique
structure induced by Myc-FALDH and rat msALDH-induced structure might be
produced by a similar mechanism.
Fig.4-4 Overexpression of FALDH and NS4B in Huh7 cell. (A) Huh7 cells were transfected Myc-FALDH
DNA and stained with anti-Myc antibody after 24hr incubation. (B) Huh7 cells were trnafected with Flag-
NS4B mRNA and stained with anti-flag antibody after 24hour incubation.

109
As mentioned before, the NS4B protein expression is always very low for
immunostaining experiment. Therefore, GFP-NS4B fusion was used as the alternative
option for NS4B subcellular localization detection (Fig.4-2). The expression pattern of
GFP-NS4B was a typical reticular distribution. However, when the NS4B protein was
introduced by mRNA transfection, the protein expression could reach to a very high level.
The protein (Flag-NS4B) could be detected easily by immunostaining as shown in Fig.4-
4B. Interestingly, when overexpressed, Flag-NS4B also tends to concentrate at certain
area in the cytoplasm, which is very similar to the Myc-FALDH overexpression pattern
(Fig.4-4A). Since FALDH could interact with NS4B, the FLADH might be involved in
the formation of NS4B-indeduced structure.
The next question addressed was whether the FALDH subcellular localization could
be changed in the replicon cell which has active RNA replication. Because of lack of
good FALDH antibody, we could not detect endogenous FALDH. (The antiserum
against His-Xpress-FALDH in Section 4.5.4 has high background when applied for
immunostaining.) Therefore, replicon cells were transfected with Myc-FALDH, and
stained with anti-Myc and anti-NS5A. As shown in Fig.4-5 upper panel, Myc-FALDH
and NS5A were partially colocalized in the cytoplasm. These two proteins were more
colocolizaed in the perinuclear region. The same as in Huh7 cell, the Myc-FALDH-
induced structure was also seen in replicon cell, and the viral proteins (NS5A) was
condensed in this region (Fig.4-5, lower panel). Although this was an overexpression
condition, the result suggested FALDH might be in the HCV replication complex.

110
Fig.4-5 Subcellular loccalization of FALDH in Replicon cell. Replicon cell were transfected with Myc-
FALDH, and the transfected cells were stained with myc antibody and NS5A antibody .

4.4.3 FALDH siRNAs and HCV RNA replication.
To study the possible role of FALDH in RNA replication, FALDH-specific siRNAs
were tested in replicon cell. Two FALDH siRNAs specfically against FALDH mRNA-
coding region were designed and tested in replicon cells. Since the FALDH antibody
was not available, we tested the knock-down efficiency by detecting FALDH mRNA
level by RT-PCR. As shown in Fig.4-6A, these two siRNAs could specifically knock
down FALDH mRNA level on Day2 and Day3 post-transfection. When the replicon
cells were transfected with FALDH siRNAs, the HCV RNA replication was decreased
on Day3 post-transfection (Fig. 4-6B). Although the FALDH mRNA was decreased in
111
the presence of specific siRNAs on Day2 post-transfection, the reduction of HCV RNA
was not seen until Day3 post-trasfection. This result suggests a role of FALDH in RNA
replication. In Fig.4-6A, the FALDH mRNA was detected but FALDH protein was not.
If the turn-over rate of FALDH protein in cell is very long, those existing FALDH
protein may still function for some time after siRNA treatment. This might be the reason
for the delay of reduction of HCV replication. However, more studies are required for
understanding how ALDH is involved in RNA replication.
NS A1 A2
Day 2
NS A1 A2
Day 3
Fig.4-6 The effect of FALDH siRNAs on subgenomic RNA replication. Replicon cells were transfected
with 200nM FALDH siRNAs (A1 or A2) or Non-specific siRNA (NS). The total RNA was harvested on
day2 or day3 post-transfection. (A) The FALDH and β-acitn mRNA levels were detected by RT-PCR. (B)
HCV replicon replication was detected by real-time RT-PCR.
FALDH siRNA and HCV RNA replication
0
200000
400000
600000
800000
1000000
1200000
D2 D3
Post-tranfection (Day)
HCV copies / 10 ng RNA
NS
A1
A2
A. B.
FALDH
ß-actin

4.4.4 FALDH recombinant protein purification and antiserum production.
Because the antibody for FALDH is not commercial available, we have put some
efforts on producing FALDH antiserum. ALDH gene was cloned into pTrcHis B vector,
112
and the protein was expressed with His and Xpress tags on the N-terminal end of
FALDH.
Fig.4-7 The production of FALDH antiserum. (A) FALDH was cloned into pTrcHisB vector and the His-
Xpress-FALDH recombinant protein was expressed in E. coli. Bacteria were collected before and after 4
hour IPTG induction, total cell lysate was analyzed by Coomassie Blue staining or Western blot (anti-
Xpress). (B) The His-Xpress-FALDH recombinant protein was purified by Ni-column with various
detergenr in the buffer system and the eluted proteins from different condition were ananlyzed by coomassie
blue staining. (C) The purified His-Xpress-FALDH recombinant protein was used as immunogen to
immunize rabbits for antibody production. To test the His-Xpress-ALDH10 antiserum, purified His-Xpress-
FALDH recombinant protein was subjected to Western Blot with the antiserum.

pTrcHis-FALDH is under lac operon regulation, so that the recombinant protein
expression could respond to IPTG induction. The bacterium cell culture was collected
before (T0) and after 4 hour IPTG induction (T4). The expression of His-Xpress-
FALDH was analyzed by Coomassie blue staining and Western blot. As shown in left
panel of Fig.4-7A, the expression of the FALDH recombinant protein was induced after
4 hour of IPTG induction. To confirm that the induced protein is His-Xpress-FALDH,
anti-Xpress antibody was used for the recombinant protein detection (Right panel of
Fig.4-6A). The recombinant protein was expressed in low amount without IPTG
113
induction. The large amount of the recombinant proteins was induced in the presence of
IPTG. The recombinant protein detected was about the same as the expected protein size
of about 60kDa (30 amino acid residues were from the expression vector). Other than
full length His-Xpress-FALDH, some degradation forms of the recombinant protein were
also detected in the gel (Fig.4-7A).
Since the protein could be induced in bacteria, the recombinant protein was purified
by using Ni-column. In the cell lysis process, the His-Xpress-FALDH was found in the
pellet fraction if there was no detergent included in the buffer. Since the FALDH is a
membrane protein, we tried to include the non-ionic detergent in the lysis buffer and
purification buffer system. As shown in Fig.4-7B, NP-40 and TritonX-100 or the B-per
(Pierce) could increase the protein solubility and yield dramatically if compared to the
purification without any detergent. All purification conditions in Fig.4-7B had some
other nonspecific proteins copurified from the Ni-column. However, once the non-ionic
detergent was included, FALDH recombinant protein was the dominant protein after
purification process. Although B-per increased the yield of FALDH protein, this
purification condition also increased the amount of other non-specific proteins in the
protein preparation. Therefore, NP40 and TritonX-100 are better detergent for FALDH
purification. The large scale of protein purification was performed in the presence of
Triton X-100, and the purified protein served as antigen to immunize rabbits for
antiserum production. After the complete immunization procedures, the serum was
collected from the animals and tested by Western blot. As shown in Fig.4-7C, the
antiserum can recognize the original antigen very well.

114
4.4.5 Endogenous FALDH expression in replicon cell.
Since the FALDH antiserum was made, the antiserum was applied to address whether
the antiserum could recognize the endogenous FALDH and whether the FALDH might
be changed in the presence of HCV replication. Huh7 cell, replicon cell and Huh7 cell
trasfected with myc-FALDH were subjected to Western blot by using FALDH antiserum.

72
54
45
Huh7
Replicon
Myc-FALDH
A.
Fig.4-8 The expression of FALDH expression in Huh7 and replicon cell. (A) Total cell lysate from
HuH7 cell, replicon cell and Huh7 transfected with Myc-FALDH was subjected to Western blot by using the
His-Xpress-FALDH antiserum. (B) Huh7 or replicon cells were labeled by 35S-Methionine for four hours
and the cell lysate was subjected for immunoprecipitation with preimmune serum or His-Xpress-FALDH
antiserum. The signals were detected by autoradiography. .
.
B.
72
55
40
33
Huh7
Huh7
Replicon
Replicon
Preimmune
Serum
Anti-FALDH

As shown in Fig.4-8A, the antiserum could recognize myc-FALDH expressed in
Huh7 cells, although there were some nonspecific bands. Based on the size of FALDH,
the endogenous FALDH could be the band close to 55kDa protein marker. There was no
significant difference between huh7 cell and replicon cell in terms of FALDH expression.
Since there were some nonspecific signals on the western blot, it is unclear whether the
signal close to myc-FALDH is the endogenous FALDH protein or the expression is lower
115
than the expression level. Therefore, to confirm the result from western blot, the
antiserum was also applied to the FALDH immunoprecipitation. As shown in Fig.4-8B,
one major protein immunoprecipitated by the antiserum is the protein with size between
40 and 55 kDa protein marker, which might be the endogenous FALDH (by comparing
the signals with preimmune serum set). The FLADH expression was the same between
Huh7 cell and replicon cell by the immunoprecitation ananlysis. Therefore, viral RNA
replication might not have any effect on endogenous FALDH protein expression.

116
4.5 Discussions
In this chapter, we have identified the interaction between FALDH and NS4B.
FALDH and NS4B were well colocalized together. NS4B was concentrated at
specialized region which is very similar to FALDH overexpression pattern. The
colocalization of FALDH with viral protein and the induced structure were also seen in
replicon cell. Moreover, FALDH siRNAs could reduce HCV RNA replication. All the
results suggest that FALDH could be involved in HCV RNA replication.
. How does FALDH contribute to HCV RNA replication? As FALDH has enzyme
activity and is involved in membrane alteration, it is possible that FALDH might be
recruited to the replication site through NS4B-FLADH interaction, then change the
membrane composition for RNA replication. It would be an interesting issue to see
whether FALDH is directly involved in the membranous web induction ability of NS4B.
Is enzyme activity or normal function of FALDH affected by HCV replication?
FALDH is part of fatty alcohol:NAD+ oxidoreductase complex and is involved in fatty
alcohol metabolism. Although the interaction between NS4B and FLADH was noted
when FALDH was overexpressed, it is unclear whether the endogenous FALDH is
recruited by NS4B as free form or in the enzyme complex. The expression of FALDH
was not changed in the presence of subgenomic RNA replication. If FLADH is recruited
as free form, it may not be able to perform the original function in fatty alcohol
metabolism. Fatty alcohols, instead of fatty aldehydes, are accumulated in the serum of
FALDH-deficient SLS patients. Therefore, whether FALDH enzyme activity is changed
and whether fatty alcohol is accumulated in the presence of HCV replication are
interesting questions remaining unsolved.
117
More and more evidence has suggested that ROS stress is induced by HCV
replication (Korenaga et al., 2005; Machida et al., 2004). HCV core and NS3 are two
main proteins inducing ROS in cells. The ROS stress might produce peroxidated lipids
which are toxic substances to cell. FALDH has also been shown to have a role in the
detoxification of aldehydic products of lipid peroxidation. The recruitment of FALDH to
the replication site might have a role in reducing the toxic lipids associated with HCV
replication. Then, the RNA replication can be processed in a more suitable environment
in the presence of FALDH. The recruitment of FLADH to the replication site may also
reduce the chance for FALDH to remove peroxideted lipids outside the replication
complex. Therefore, whether the ability of FALDH to lipid peroxidation stress is
affected by HCV NS4B or RNA replication could also be addressed.

118
Chapter 5: Coronavirus and the Ubiquitin-Proteasome system
5.1 Abstract
The ubiquitin-proteasome system is a cellular protein-degradation machinery and is also
involved in ubiquitin-dependent endocytosis. It has been shown that the ubiquitin-
proteasome system is essential for the replication of some viruses including human
immunodeficient virus. In this study, the proteasome inhibitors, MG132 (reversible) and
lactacystin (irreversible) were used to test whether the ubiquitin-proteasome system is
involved in the mouse hepatitis virus (MHV) replication cycle. The proteasome
inhibitors decreased viral production and viral protein synthesis in DBT cells. Kinetic
analysis showed that the inhibitor affected early steps of virus replication cycle. Our data
suggested that the inhibitors did not affect the expression of MHV receptor, virus binding
to the receptor, or virus internalization through endocytosis pathway. To further dissect
the early infection process, endosomes and lysosomes were isolated by sucrose flotation
gradient and denser lysosome by percoll gradient respectively from virus-infected cells.
When the proteasome system was blocked by MG132, viral RNAs accumulated in both
endosome and denser lysosome. In natural infection, viral RNAs were released from
endosome to cytoplasm and became ribonuclease-sensitive. In contrast, viral RNAs
stayed in the vesicles and were ribonuclease-resistant in the presence of the inhibitor. We
suggested that MHV (JHM) requires the ubiquitin-proteasome system, facilitating virus
release from the endosome to the cytosol.

119
5.2 Introduction
The ubiquitin-proteasome system is well known for its fundamental role in
regulating protein degradation within the cell. Ubiquitin is a 76-amino-acid globular
protein with a glycine at the carboxyl terminal. This glycine forms isopeptide bond with
ε-amino groups of lysines on target proteins, and this covalent conjugation is called
ubiquitination. The ubiquitination is a multistep process, involving at least three types of
enzyme. (Weissman, 2001) E1, a ubiquitin-activateing enzyme, forms a thio-ester bond
with the carboxyl-terminal glycine of ubiquitin in a ATP-dependent process. Then, E2, a
ubiquitin-conjugating enzyme, accepts ubiquitin from E1 by a transthiolation reaction.
Finally, E3, a ubiquitin protein ligase, catalyzes the transfer of ubiquitin from E2 to the ε-
amino groups of lysines on target proteins. There are more E2s than E1s, and more E3s
than E2s, and the diversity of these enzymes contribute to the specificity of ubiquitination
process. Successive rounds of ubiquitin conjugation to a lysine residue of the preceding
ubiquitin moiety usually result in the formation of long polyubiquitin chains. The
polyubiquitination serves as a signal for protein degradation by 26S proteasomes. In
eukaryotes, 26S proteasome is composed of 20S proteasome core complex and two 19S
cap complexes. 20S proteasome core complex is a cylindrical chamber containing
trypsin, chymotrypsin and peptidylglutamyl peptidase-like activities. The 26S
proteasome also degrades specific non-ubiquitinated proteins (Glickman and Maytal,
2002; Weissman, 2001).
Association with the 19S cap complex enhances the proteolytic activity of the core in
an energy-dependent manner. The 19S cap can be dissociated in vitro into defined
subcomplexs, called the base and the lid. The base contains six ATPases of the AAA
120
family that probably unfold and translocate substrate proteins into the 20S core. The lid
forms the most distal portion of the 19S cap. Proteasome missing the lid subcomplex
seems to have activity comparable to that of wild type in the degradation of non-
ubiquitinated substrates. However, the lid is required for degradation of ubiquitinated
proteins (Glickman and Maytal, 2002).
In vertebrates, the 20S core may associate with 11S complexes (11S regulator or
PA28 activator), which accelerates the degradation of peptides, but not of proteins or
ubiquitin-protein conjugates, in an energy-dependent manner. The 11S regulator is a
ring-shaped complex containing two related subunit types, α and β, which are induced by
γ-interferon and do not occure in other organism. The 11S complex has been shown to
assist in the generation of dominant T-cell epitopes, and enhance the efficiency of viral
antigen processing, suggesting a specific function in the vertebrate immune response.
Both 11S subunits appear to have originated from a third protein, referred to as PA28 γ or
Ki antigen.
One major area of proteasome function is the control of basic cellular process such as
cell cycle progression, signal transduction, and transcription via the degradation of short-
lived regulatory factors. In addition, the proteasome plays a central role in the removal of
misfolded, aberrant, or damaged proteins, which is a critical aspect of the cellular stress
response. The mammalian proteasome is responsible for the generation of antigenic
peptides presented on the cell surface by major histocaompatibility complex (MHC) class
I molecules as an integral part of the immune system. The proteasome not only destroy
proteins but also activates proteins, for example, the processing of the p105 precursor of
p50, a component of the nuclear factor (NF)-kB. After p105 is ubiquitinated within its C
121
terminus, the C-terminal domain is proteolyzed by the proteasome and the 50-kDa N-
terminal region is released as a stable and activated protein.
Other than playing the important role in protein degradation, the ubiquitin-
proteasome system is also involved in other cellular processes (Weissman, 2001),
including endocytosis (Hoege et al., 2002; Strous and Govers, 1999), protein trafficking
(Hicke, 2001), DNA repair (Hoege et al., 2002) and transcription regulation (Muratani
and Tansey, 2003). The way in which ubiquitin is linked to proteins has the potential to
alter their fate (monoubiquitination, polyubiquitination, polyubiquitination). A single
protein can be modified by single ubiquitin (monoubiquitination), with lysine-linked
chains of ubiquitin, or the combination of the two. Only multi-ubiquitin chains target
proteins for proteasome degradation (polyubiquitination). The choice of lysine is also an
important decision when building up a multi-ubiquitin because ubiquitin itself has seven
conserved lysine residues. In vivo, K11, K29, K48 and K63 all can form ubiquitn-
ubiquitin linkage. K48-linked multi-ubiquitin chains are potent targeting signal for
protein degradation. K63 linkages are not proteasome-targeting signal. K63 linkages are
implicated in DNA repair, translation regulation, I κB activation and endocytosis
(Weissman, 2001).
Viruses, as intracellular parasites, may use various components of the cellular
transcriptional and translational machineries as well as the ubiquitin-proteasome system
to complete their replication cycles. Human immunodeficiency virus (Schubert et al.,
2000), adenovirus (Galinier et al., 2002), and several other viruses (Gao et al., 2003;
Harty et al., 2001; Reichel and Beachy, 2000; Ros et al., 2002) have been reported to
involve the ubiquitin-proteasome system in various stages of the viral replication cycle.
122
Mouse Hepatitis Virus (MHV) is an enveloped virus with a positive-stranded, non-
segmented RNA genome of about 32 kb (Lai and Cavanagh, 1997). MHV belongs to the
Coronaviridae family, which includes the recently emerging virus, SARS coronavirus
(Guan et al., 2003). MHV can cause hepatitis, encephalomyelitis or other neurological
illnesses in animals (Lai and Cavanagh, 1997). Because of the large genome size, the life
cycle of MHV has been difficult to fully elucidate. MHV may utilize some of the cellular
machineries to support its replication. Since the ubiquitin-proteasome system is a
fundamental machinery in the cell, we are interested in knowing whether the ubiquitin-
proteasome system is involved in MHV replication. In the present study, we used
proteasome inhibitors to block the functions of ubiquitin-proteasome system to address
this question. The result showed that proteasome inhibitors blocked the virus replication
at an early step, interfering with the release of virus from the endosome to cytosol. This
result suggested that the ubiquitin-proteasome system is involved in the virus entry of
MHV replication cycle.

123
5.3 Materials and Methods
5.3.1 Cell, virus, and reagents.
DBT cells, a mouse astrocytoma cell line (Hirano et al, 1974) , were cultured in
Eagle’s minimal essential medium containing 7% newborn calf serum (NCS), and 10%
tryptone phosphate broth. MHV JHM-DL stain (Stohlman et al, 1982,) and A59 strain
(Robb and Bond, 1979) were propagated in DBT cells and maintained in virus growth
medium containing 1% NCS. The N protein was detected by monoclonal J3.3
(Fleming,et al,1983). Anti- β-actin (Sigma , Saint Louis, Missouri) was used as an
internal control and also used as cytosol protein marker. Rab5 antibody (Stressgen,
Victoria, Canada) was used as the early endosome marker. Grp78 was detected by anti-
KDEL antibody (Stressgen, Victoria, Canada) and was used as ER marker. Acid
phosphatase activity was analyzed by using Acid phosphatase kit (Sigma, Saint Louis,
MO) to serve as a lysosome marker. Proteasome inhibitors Lactacystin and MG132 were
both purchased from Biomol (Plymouth, PA)
The cytotoxicity of proteasome inhibitors was determined by CytoTox-One
Homogeneous Membrane Integrity Assay (Promega, Madison, WI). The average
fluorescence values of the culture medium background, maximum LDH release, and
experimental LDH were measured. The cytotoxicity was calculated by the following
formula. Percent cytotoxicity = (Experimental - Culture Medium Background)/
(Maximum LDH Release – Culture Medium Backroung) × 100.

124
5.3.2 Plaque assay
To examine the effect of proteasome inhibitors on virus replication, virus titer of
culture medium was determined by plaque assay. The culture supernatant was harvested
and diluted appropriately with serum-free MEM and used to infect confluent DBT cells
in 6-well plate. After adsorption for 1 hour, the cells were washed with serum-free
medium twice and overlaid with 1% noble agar (in MEM, 10% Tryptose phosphate broth,
1% newbone calf serum,1% penicillin/ streptomycine 1% L-glutamine). After incubation
for 48 hr, the cells were stained with 5% neutral red (sigma) for 24 hour.

5.3.3 Internalization assay
Virus internalization assay was performed as described previously (Asanaka and Lai,
1993) Briefly, viruses (m.o.i. 0.1) were adsorbed to DBT cells (pre-treated with 5µM
MG132 for two hours) at 4° C for an hour. The DBT cells were washed with PBS contain
0.5% BSA and 0.05% Tween-20 three times. The washed cells were shifted to 37 °C (1
hr) in the presence of MG132 in the medium for virus internalization. After washing with
PBS three times, the cells were treated with proteinase K (50 µg/ml in PBS) on ice for an
hour to digest away the un-internalized viruses on the cell surface. The treated cells were
resuspended in neutralizing buffer (2mM PMSF and 6% BSA in PBS) and washed with
MEM twice. The treated cells were serially diluted in 10-fold increment with untreated
DBT cells and plated onto 6-well plate. Five hours later, the media were removed and the
plates were overlaid with agar as done in plaque assay. After 48 hr incubation, plaques
were counted after neutral red staining.

125
5.3.4 Sucrose Flotation gradient
To trace the virus distribution following internalization, endosomes were purified by
sucrose floatation gradient. Cells were washed with PBS and homoginization buffer
(250mM sucrose, 3mM Imidazol pH7.4) sequecially and lysed in 0.5 ml homoginization
buffer by passing through a 21-gauge needle 10 times. The supernatant (post-nuclear
supernatant, PNS) was collected after 1000 xg cetrifugation and was adjusted to 40.6%
sucrose and 0.5 mM EDTA using 62% sucrose. The 1ml PNS in 40.6% sucrose was
loaded at the bottom of an SW55Ti tube and overlaid sequentially with 2 ml 35% sucrose,
1.5 ml 25% sucrose and 1ml homoginization buffer. After centrifugation (38000 rpm 4°C,
1 hour), samples were collected at 0.5 ml per fraction from the top to the bottom. The
early endosomes are located at the interface of 35% and 25% sucrose, and late
endosomes are located at the interface between 25% sucrose and homoginization buffer.
Total RNAs were extracted from each fraction by using TRI REAGENT-LS (Molecular
Research Center, Cincinnati, Ohio) and viral RNAs were detected by RT-PCR. The
sequences of the primers for RT-PCR were 5’ TATAAACGGCACTTCCTGCG and 3’
AACCCATCCTCCTCTGACCT which are specific for 5’ untranslated region of MHV-
JHM.

5.3.5 Percoll gradient
27% percoll gradient was used to purify denser lysosome. In brief, cells were washed
once with PBS and homoginization buffer (250 mM sucrose, 1mM EDTA, pH 7.4) and
lysed in 2ml homoginization buffer by passing through 22G needle seven times. After
centrifugation at 1000xg for 10 min, postnuclear supernatant was collected and put on the
126
top of 27% percoll gradient [1 ml cushion of 2.5M sucrose and 9 ml 27% percoll
(Amersham pharmacia) solution in 250 mM sucrose, 1mM EDTA in SW41 tube] and the
gradient was spun at 34,000 xg for 1 hour. All buffers for percoll gradient contain 1 mM
PMSF, Complete protease inhibitor (Roche), RNasin 40 u/ml (Promega) and all steps
were perfomed at 4°C. Samples were collected at 1 ml/fraction from the bottom of the
tube for RT-PCR and acid phosphatase analysis. RT-PCR was performed as the samples
from sucrose flotation gradient.

127
5.4 Results
5.4.1 The Proteasome inhibitors blocked MHV (JHM) replication.
To assess whether the proteasome-ubiquitin system plays a role in MHV replication,
two proteasome inhibitors, Lactacystin and MG132, were used to address the question.
The 20S core proteasome has chymotrypsin-like,trypsin-like and post-glutamyl peptide
hydrolyzing activities. Lactacystin is a covalent modifier of proteasome-active site; thus,
it is an irreversible inhibitor (Lee and Goldberg, 1998). Lactacystin affects all three
enzyme activities of the proteasome(Fenteany et al., 1995). The tri-peptide aldehyde
MG132 works as a transition-state analogue for chymotrypsin-like activity of the
proteasome; its inhibitory action is reversible (Lee and Goldberg, 1998; Wilk and
Orlowski, 1983).

1.00E+00
1.00E+01
1.00E+02
1.00E+03
1.00E+04
1.00E+05
1.00E+06
1.00E+07
4 8 12 16 20 24
Post-infection (hr)
Titer (PFU/ml)
DMSO
Lactacystin
MG132
4 8 12 16 20 24
DMSO
Lactacystin
MG132
N
Actin
N
Actin
N
Actin
0
2
4
6
8
10
DMSO Lactacystin MG132
Cytotoxicity(%)
A.
C.
B.
Fig.5-1 The proteasome inhibitors, Lactacystin and MG132, blocked MAV-JHM replication. (A)
Cytotoxicity of Lactacystin and MG132. DBT cells were treated with 10 µM Lactacystin or 5µM MG132
or a same volume of DMSO (vehicle control) for 16 hours and analyzed by CytoTox-One Homogeneous
Membrane Integrity Assay. (B,C) Detection of virus production and viral protein synthesis under the
proteasome inhibitors. DBT cells were pretreated with 10 µM Lactacystin or 5 µM MG132 for two hours,
infected with MHV-JHM (m.o.i. =0.1) for two hour and then incubated at 37°C for different lengths of time
in the presence or absence of Lactacystin or MG132. Viral N protein expression was determined by Western
blot using monoclonal antibody J3.3. β-actin antibody was used as an internal control.
Virus titer in the culture medium was determined by plaque assay. .

128
I first tested whether these two proteasome inhibitors affect cell viability. We used
the lactate dehydrogenase (LDH)-based assay to test the cytotoxicity of these two
proteasome inhibitors. The assay is a measure of the release of LDH from cell with a
damaged cell membrane. As shown in Fig.5-1A, the proteasome caused only slight
cytotoxicity to DBT cells. Moreover, neither of these two inhibitors affected cellular
protein synthesis within the time frame of the experiment as determined by metabolic
labeling with
35
S-methionine (data not shown).
Next, whether the proteasome inhibitors affect MHV replication was tested. When
the untreated cells were infected with MHV(JHM), the virus titer steadily increased
logarithmically throughout the experiment; in contrast, in the presence of the proteasome
inhibitors, either lactacystin or MG132, the virus production began approximately 8
hours later than the untreated cells, and the final virus titer at 24 hrs post-infection (p.i.)
was 3 logs lower (Fig.5-1B). Lactacystin and MG132 had very similar inhibitory effects
on virus production. We also examined the kinetics of intracellular viral protein
accumulation (Fig. 5-1C). The viral nucleocapsid N protein could be detected as early as
8 hr p.i. in the untreated cells; in contrast, the N protein was not detected until 16 hr p.i.
(lactacystin) and 20 hr p.i. (MG132), respectively. These data together indicated that
proteasome inhibitors significantly blocked MHV production, suggesting that the
proteasome may play an important role in MHV production.
Some MHV stains have different tropism which might be related to different receptor
usage. For example, A59 stain can use any one of many carcinoembryonic antigen
(CEA)-related molecules as receptor, is hepatotropic. The neurotropic JHM stain is more
restricted to its receptor utilization. In order to test whether this inhibitory is specific to
129
JHM stain, the sensitivity of MHV A59 stain to the proteasome inhibitors was also tested
(Fig.5-2). A59 stain was sensitive to both MG132 and lactacystin treatment. However,
A59 was less sensitive than JHM stain. Especially at 5µM Lactacystin (Fig.5-2B), A59
production was reduced only by 50%. On the other hand, no virus was detected for JHM
stain under the same condition. Therefore, the ubiquitin-proteasome system is important
for different MHV stain replication, but the sensitivity of the different virus strains to
proteasome inhibitors may be various.

MG132
1.00E+00
1.00E+01
1.00E+02
1.00E+03
1.00E+04
1.00E+05
1.00E+06
1.00E+07
1.00E+08
1.00E+09
A59 JHM
Titer (pfu/ml)
0µM
1µM
5µM
10µM
Lactacystin
1.00E+00
1.00E+01
1.00E+02
1.00E+03
1.00E+04
1.00E+05
1.00E+06
1.00E+07
1.00E+08
1.00E+09
A59 JHM
Titer (pfu/ml)
0µM
1µM
5µM
10µM
A. B.
Fig.5-2 The proteasome inhibitors, Lactacystin and MG132, blocked MHV replication. DBT cells
were pretreated with Lactacystin (A) or MG132 (B) for two hours, infected with MHV-JHM or A59 (m.o.i.
=0.1) for one hour and then incubated at 37°C for 10 hours in the presence of proteasome inhibitors. Virus
titer in the culture medium was determined by plaque assay. .
.

130
5.4.2 The proteasome-ubiquitin system is involved in an early step of virus
replication.
To elucidate the mechanism of inhibition, we took advantage of the reversible nature
of MG132 to dissect the potential targets of the proteasome inhibitor. Fig. 5-3A shows
the experimental design for defining the major target of the ubiquitin-proteasome system
by pulsing MG132 treatment (for 6 hrs) to MHV-infected cells at various time points of
viral life cycle. The media were collected at the end of each 6-hr period and fresh media
were added. The harvested media were used for plaque assays to determine the virus
yield during the previous 6-hr period.

-2 6h 12h 18h 24h
Collect supernatant
Add new medium
A.
Infection
No Treatment
Throughout
1.00E+00
1.00E+01
1.00E+02
1.00E+03
1.00E+04
1.00E+05
1.00E+06
1.00E+07
0-6h 6-12h 12-18h 18-24h
Virus-accumulation period
Titer (PFU/ml)
Pretreatment
0-6 h Treatment
6-12h Treatment
12-18h Treatment
B.
Fig.5-3 Kinetics of virus replication (MHV-JHM after pulse treatment with MG132. (A) The
experimental design for pulse treatment with MG132. The cells were treated with MG132 during different
time windows. Culture medium was collected and fresh medium was replenished at 6-hour intervals. (B)
The virus titer at each time point was detected by plaque assay. Standard variations were calculated from
triplicate of each treatment. .

131
In Fig. 5-3B, the first panel shows that the virus accumulated was produced from 0 to
6 hours p.i..; no virus was produced from the time period of 0-6 hour p.i. In the second
panel (virus accumulated from 6-12 hr p.i.), the most dramatic inhibition by MG132 was
seen with the throughout-treatment group (pretreat 2 hour to 12 hr p.i.), in which MG132
was present throughout the experiment (pretreatment for 2 hrs plus treatment for the first
12 hrs p.i.). The 0-6 hr treatment also resulted in significant reduction of virus yield (two
logs reduction as compared to the titer of the no-treatment control). The virus titer of the
6-12 hr treatment group was one log lower than the titer of the control sample. In the
third panel (virus accumulated from 12-18 hr, p.i.), the inhibitory effect was seen only in
the throughout-treatment sample. The virus titers from of the 0-6 hr, 6-12 hr and 12-18
hr treatment groups s were comparable to that of the no-treatment control during this time
window, indicating that MG132 is a reversible inhibitor and that MG132 does not have
significant effects on the later steps of viral life cycle. The fourth panel shows almost the
same result as the third panel. The 2-hr pretreatment did not have any effect. The kinetic
study results combined thus suggest that the proteasome-ubiquitin system is most likely
involved in the early step of virus life cycle since the inhibitory effect of MG132 was
seen primarily only in the 0-6hr treatment group with MG132 had a significant inhibitory
effect on virus production.

5.4.3 The proteasome inhibitor does not block virus internalization.
Since the kinetic assay result showed that the proteasome-ubiquitin system likely
works on an early step of viral replication, we dissected each step in the presence of the
proteasome inhibitor to reveal the possible mechanism of inhibition. Neither of the
132
proteasome inhibitors affect the MHV receptor expression on the cell surface, as
determined by surface staining with an MHV receptor-specific antibody and flow
cytometry analysis (data not shown). To test whether proteasome inhibitor affects virus
adsorption or virus internalization, virus internalization assay was performed (Fig.5-4).
In virus internalization assay, the virus binding step was performed at 4°C and the
internalization step was performed at 37°C. Afterwards, the cells were treated with
proteinase K to remove the viruse remaining on the cell surface. The cells were then
serially diluted and mixed with uninfected cells for infectious center assay. Once the
virus is internalized into a cell, it is expected to yield a plaque in infectious center assay
(Asanaka and Lai, 1993; Nash and Buchmeier, 1997). By this method, the virus
internalization could be quantified in the presence of proteasome inhibitor.
JHM
1.00E+00
1.00E+01
1.00E+02
1.00E+03
1.00E+04
1.00E+05
1.00E+06
4°C 37°C
Plaque forming unit
A59
1.00E+00
1.00E+01
1.00E+02
1.00E+03
1.00E+04
1.00E+05
1.00E+06
4°C 37C°
Plaque forming unit
0uM
5 uM
A. B.
Fig.5-4 The effect of MG132 on virus internalization. DBT cells incubated for 2 hrs with or without
MG132 were inoculated with virus at 4ºC for virus binding. After washing with medium, cells were either
maintained at 4ºC or shifted to 37 ºC for 1 hr for virus internalization. Afterwards, the infected cells were
treated with proteinase K (50 µg/ml) to remove uninternalized viruses. The treated cells were serially diluted
in 10-fold increment with untreated DBT cells and plated onto a 6-well plate. Five hours later, the media
were removed and the plates were overlaid with agar as done in plaque assay. After 48-hr incubation,
plaques were counted after neutral red staining. .

133
Since MHV(JHM) enters cells by both endosomal and non-endosomal pathways
(Nash and Buchmeier, 1997), and endocytosis is an energy-dependent process, very little
virus was internalized at 4
o
C and, thus, most of the virus was mostly digested away by
proteinase K (Fig. 5-4). In contrast, at 37
o
C, a significantly higher titer of viruses was
internalized into the cell and was protected from proteinase K digestion. There was no
difference in infectious center titer in the presence or absence of the proteasome inhibitor.
When A59 stain was tested by internalization assay, the proteasome inhibitor also did not
affect virus binding or internalization. These data suggest that the proteasome-ubiquitin
system is not involved in the virus internalization step. Interestingly, at the 4°C treatment,
more plaques were produced when the cells were infected by A59 strain, suggesting that
more A59 viruses can be internalized into cells through non-endosomal pathway.
Whether the difference in internalization pathways between A59 and JHM makes the
JHM more sensitive to the proteasome inhibitor is an interesting question to address.

5.4.4 Some viruses were accumulated in early endosomes and late endosomes in the
presence of proteasome inhibitor.
We next followed the fate of the internalized virus particles in the endosomes.
Endosomes from the infected cells were further purified by sucrose flotation gradient,
and the viruses were traced by RT-PCR of viral RNA (Fig.5-5A, left panel). After
centrifugation, the late endosomes floated to the interface between 8% and 25% sucrose
(fractions 1-3), and the early endosomes floated to the interface between 25% and 35%
sucrose (fractions 4-7, the early endosome marker in Fig.5-5C). Fractions 8-10 contained
the cytosol and other organelles (the cyotosol and ER markers in Fig.5-5C).
134
Significantly, more viral RNAs were detected in the early endosome fractions and late
endosome fractions in the presence of MG132 as compared to the control samples (Fig.5-
5A, left panel). Only in the presence of MG132, the viral RNAs were detected in
fractions 1-3, the reported late endosome fractions. (Due to the low sensitivity of the
antibody for late endosome marker, we could not demonstrate unequally that these
fractions represent late endosomes.) Fig. 5-5B shows the total viral RNA detected in the
lysate used for sucrose gradient sedimentation. There was more viral RNA from the
untreated cells than from the MG132-treated cells, consistent with the interpretation that
MG132 blocked virus entry and subsequent viral replication. Some of the viruses began
to replicate their viral genome by 3 hr p.i.; therefore, more viral RNAs were detected in
the homogenate. These results show that the viruses may be retained in the endosomes
in the absence of a functional ubiquitin-proteasome system.

A.
1 2 3 4 5 6 7 8 9 10
Control
MG132
Early endosome marker
(anti-Rab5)
Late endosomes
Early endosomes
B.
ER marker
(anti-KDEL)
Cytosol marker
(anti-beta-actin)
C.
Control
MG132
Bottom Top
1 2 3 4 5 6 7 8 9 10
Fig.5-5 Endosome purification by flotation gradient. DBT cells were treated with MG132 for two hours,
infected with MHV-JHM for one hour and incubated at 37 ºC for three more hours in the presence or absence
of MG132. The treated cells were collected and used for sucrose flotation assay. (A) Total RNA was
extracted from each fraction, and viral RNA was detected by RT-PCR. (B) Various organelle markers
including Rab5 (early endosome marker), Grp78 (ER marker, anti-KDELantibody), ß-actin (cytosol marker)
were detected by Western blot .

135
5.4.5 The proteasome inhibitor directed viruses to the lysosomes.
This result prompted us to purify lysosomes to determine whether the virus is
misdirected to the lysosomes when the ubiquitin-proteasome system is not functioning.
Ultracentrifuge sedimentation of cellular lysates on a 27% percoll gradient was
performed to partially purify lysosomes (Driessen et al., 1999) (Fig. 5-6). The activity of
lysosomal resident enzyme, acid phosphatase, could be detected in fractions 1 and 2 as
well as fractions 9-11 (Fig. 5-6B). Most of other organelles were localized in fractions 9-
11 (Fig. 5-6B, ER marker and cytosol marker).

MG132
A.
B.
Lysosomal Marker
( Aicd pphosphatase)
0
5
10
15
12 34 567 89 1011
Fraction no.
Activity(Units)
ER marker (anti-KDEL)
Cytosol marker (anti- -actin)
9 10* 11* 9 10* 11*
Control MG132
C.
0 µg/ml
1 µg/ml
1 2 3 4 5 6 7 8 9 10 11
Control
RNase A
Bottom Top
1 2 3 4 5 6 7 8 9 10 11
1 2 3 4 5 6 7 8 9 10 11
Fig.5-6 Detection of viruses in the dense lysosome fractions. DBT cells were treated with or without
MG132 as in Fig.4 and harvested for percoll gradient centrifugation. . (A) Viral RNA of each fraction was
detected by RT-PCR. (The arrow shows the specific RT-PCR product.) (B) Acid phosphatase activity
analyzed by using Acid phosphatase kit (Sigma, Saint Louis, MO) to serve as a lysosome marker. Other
organelle markers (Grp78, ß-actin) were detected by Western blot. (C) RNase sensitivity assay.
Fractionated samples (fractions 9, 10, and 11) from percoll gradient were treated with or without RNase A (1
µg/ml) and viral RNA was detected by RT-PCR of 5’UTR. *RNA samples from faction 10 and 11 were
diluted 100-fold for RT reaction. .

136
In the control cells, viruses were detected only in fraction 9 (Fig. 5-6A). In contrast,
viruses were also detected mostly in fractions 2 to 6 in the MG132-treated cells.
Fractions 10-11 in both treated and untreated cells also contained a large amount of the
nonspecific RNA but no distinct viral RNA. We subsequently found that viral RNA was
also present in fractions 10 and 11 in both the treated and untreated cells; however, the
presence of a large amount of cellular RNA in these two fractions interfered with the
detection of viral RNA by RT-PCR. When the RNA samples were diluted 100-fold, viral
RNAs were detected in these two fractions in both the control cells and MG132-treated
cells (Fig.5-6C). Significantly more viral RNA was present in these two fractions in the
control cells than in the MG132-treated cells.
To investigate the nature of the viral RNAs in each fraction, each fraction was treated
with RNase A and then subjected to RT-PCR detection. All of the viral RNAs in
fractions 1 through 9 from the MG132-treated cells were resistant to RNase A (data not
shown). In contrast, the viral RNAs in fractions 10 and 11 from the control cells were
sensitive to RNase A, suggesting that they were released from the organelles (Fig.5-6C).
By comparison, most of the viral RNA in fractions 10-11 from the MG132-treated cells
were resistant to RNaseA (Fig.5-6C), consistent with the interpretation that viruses
remained enclosed within vesicles. We concluded that, in the presence of MG132, most
of viruses remained in vesicles, either endosomes or lysosomes, and, thus, are protected
from RNase digestion. Therefore, even though MHV can be internalized into the cell in
the absence of a functional ubiquitin-proteasome system, the viruses within endosomes or
lysosomes cannot be released into the cytosol.
137
We have further attempted to demonstrate whether any of the viral proteins were
ubiquitinated. None of the viral proteins could be detected by immunoprecipitation by an
anti-ubiquitin antibody; nor could we detect any ubiquitinated cellular proteins
specifically associated with the MHV virion in the endosome. We also found that MHV
receptor is not ubiquitinated and the MHV receptor-ubiquitin fusion protein cannot
rescue viruses from the MG132-inhibition. Thus, precisely how the ubiquitination-
proteasome system helps to release the virion from the endosome is still unclear.

138
5.5 Discussions
This study was intended to understand whether the ubiquitin-proteasome system is
involved in MHV-JHM virus life cycle. We demonstrated that the proteasome inhibitors
strongly blocked virus replication, and the major site of action was at an early time point
of virus replication cycle. The inhibitory effect was narrowed down to 1-6 hours post-
infection by kinetic analysis. Based on the infectious center assay, MG132 did not affect
virus internalization into DBT cell. When we went a step further to purify endosome by
sucrose gradient and lysosome by percoll gradient, we found that more viruses were
detected in endosome and lysosome in the presence of MG132. In contrast, viruses
became ribonuclease-sensitive in the control cell, namely, those viruses have escaped
from endosome and viral RNAs were uncoated from viral particle. From the result, we
conclude that the ubiquitin-proteasome system might be involved in MHV-JHM life cycle
by facilitating the release of virus from endosome to cytoplasm. Once the function of
proteasome was blocked by inhibitors, viruses could not escape from endosome and were
kept in the endosome. These endosome-trapped vireuses would follow the maturation of
endosome to late endosome and lysosome. Therefore, more viruses were detected in late
endosome and lysosome in MG132-treated cells than in control cells.
Many viruses, such as HIV (Schubert et al., 2000), adenovirus (Galinier et al., 2002),
and several other viruses (Gao et al., 2003; Harty et al., 2001; Reichel and Beachy, 2000;
Ros et al., 2002), have been shown to use ubiquitin-proteasome system for virus
assembly and release. MHV , however, is the first virus to be shown to use this system for
virus entry. Whether this is generally applicable to other viruses utilizing the endocytic
pathways or not is an interesting question. Also, MHV has been shown to enter cells
139
through both membrane fusion and endocytosis process, depending on virus strain and
cell type (Nash and Buchmeier, 1997). It is likely that only the endocytic process will
require the ubiquitin-proteasome. Indeed, we found that another MHV strain (A59) is
less sensitive to the ubiquitin-proteasome inhibitors. Correspondingly, Some of MHV-
A59 viruses enter cells by an energy-independent mechanism (Fig.5-2). Thus, the
sensitivity to the ubiquitin-proteasome inhibitors may be used to distinguish the
mechanism of viral entry. The understanding of the mechanism of ubiquitin involvement
in MHV entry will thus contribute to our understanding of the early step of viral
replication.
Recent data have shown that ubiquitin is a positive sorting signal for the
multivesicular bodies (MVB) pathway (Katzmann et al., 2002). MVBs are a subset of
late endosomes and typically have a multivesicular appearance. Fusion of the outer
membrane of MVB with the lysosome membranes results in the delivery of the luminal
MVB vesicles and their contents to the hydrolytic interior of the lysosome. Both newly
synthesized cargos from the Golgi (such as lysosomal targeting enzymes) and endocytic
cargos from plasma membrane can reach lysosome through the MVB pathway. For a
productive infection, the viruses may enter cells through a ubiquitin-independent pathway
and be released from the endosome to cytosol before the virus-containing vesicles enter
the MVB pathway (Katzmann et al., 2002). In the presence of proteasome inhibitors, the
ubiquitin-dependent endocytosis may become dominant in the vesicle trafficking; thus,
the virus infection is aborted. The other possibility is that the degradation of certain
cellular factors by proteasome is required for virus release from endosome to cytosol;
thus, MHV virions remain in cellular vesicles in the absence of the functional ubiquitin-
140
proteasome system. The endosome-trapped viruses would follow the maturation of
endosome to late endosome and lysosome, where these viruses would eventually be
degraded.
It has been shown that MHV internalization is lipid-raft-dependent (Choi et al., 2005;
Thorp and Gallagher, 2004). MHV Spike protein is shift from non-raft membrane to
lipid raft membrane during the internalization process (Choi et al., 2005). Whether the
ubiquitination is involved in this shifting process could be a way to elucidate whether
these two events are related. Caveolae is involved in the lipid-raft dependent
endocytosis (Di Guglielmo et al., 2003; Felberbaum-Corti et al., 2003). In contrast,
clathrin-dependent endocytosis is not lipid-raft-dependent and ubiquitin is involved in
clathrin-dependent endocytosis (Raiborg et al., 2002; Shih et al., 2002). Endocytosis of
cellular receptor is an important step for signaling regulation. TGF- β receptor
internalization can be through either clathrin-dependent or cavaolin-dependent pathways.
Differrent internalization routs could determine whether the receptors will transduce a
signaling response or be degraded (Di Guglielmo et al., 2003; Felberbaum-Corti et al.,
2003). In MHV internalization process, the virus might be internalized into cell through
both pathways. Since the virus could be inhibited by beta-cyclodextrin which interferes
with lipid-raft dependent pathway, it is possible that only caveolae-dependent
internalization is productive for virus replication. Somehow, the endocytosis pathways
might be affected by proteasome inhibitor; and the ubiquitin-dependent pathway become
more dominant. This pathway might direct the internalized viruses to the degradation
pathway. More studies are required to support this hypothesis.

141
Bibiliography

Agnello, V., Abel, G., Elfahal, M., Knight, G.B. and Zhang, Q.X. (1999) Hepatitis C
virus and other flaviviridae viruses enter cells via low density lipoprotein receptor.
Proc Natl Acad Sci U S A 96(22), 12766-71.

Ahlquist, P., Noueiry, A.O., Lee, W.M., Kushner, D.B. and Dye, B.T. (2003) Host factors
in positive-strand RNA virus genome replication. J Virol 77(15), 8181-6.

Aizaki, H., Lee, K.J., Sung, V.M., Ishiko, H. and Lai, M.M. (2004) Characterization of
the hepatitis C virus RNA replication complex associated with lipid rafts.
Virology 324(2), 450-61.

Ali, N. and Siddiqui, A. (1995) Interaction of polypyrimidine tract-binding protein with
the 5' noncoding region of the hepatitis C virus RNA genome and its functional
requirement in internal initiation of translation. J Virol 69(10), 6367-75.

Ali, N. and Siddiqui, A. (1997) The La antigen binds 5' noncoding region of the hepatitis
C virus RNA in the context of the initiator AUG codon and stimulates internal
ribosome entry site-mediated translation. Proc Natl Acad Sci U S A 94(6), 2249-
54.

Allan, B.B., Moyer, B.D. and Balch, W.E. (2000) Rab1 recruitment of p115 into a cis-
SNARE complex: programming budding COPII vesicles for fusion. Science
289(5478), 444-8.

Alter, M.J. and Mast, E.E. (1994) The epidemiology of viral hepatitis in the United States.
Gastroenterol Clin North Am 23(3), 437-55.

Alvarez, C., Garcia-Mata, R., Brandon, E. and Sztul, E. (2003) COPI recruitment is
modulated by a Rab1b-dependent mechanism. Mol Biol Cell 14(5), 2116-27.

Anderson, R.G. and Jacobson, K. (2002) A role for lipid shells in targeting proteins to
caveolae, rafts, and other lipid domains. Science 296(5574), 1821-5.

Armstrong, J., Niemann, H., Smeekens, S., Rottier, P. and Warren, G. (1984) Sequence
and topology of a model intracellular membrane protein, E1 glycoprotein, from a
coronavirus. Nature 308(5961), 751-2.

Asanaka, M. and Lai, M.M. (1993) Cell fusion studies identified multiple cellular factors
involved in mouse hepatitis virus entry. Virology 197(2), 732-41.

Baranowski, E., Ruiz-Jarabo, C.M. and Domingo, E. (2001) Evolution of cell recognition
by viruses. Science 292(5519), 1102-5.
142
Barba, G., Harper, F., Harada, T., Kohara, M., Goulinet, S., Matsuura, Y., Eder, G.,
Schaff, Z., Chapman, M.J., Miyamura, T. and Brechot, C. (1997) Hepatitis C
virus core protein shows a cytoplasmic localization and associates to cellular lipid
storage droplets. Proc Natl Acad Sci U S A 94(4), 1200-5.

Bartenschlager, R., Ahlborn-Laake, L., Yasargil, K., Mous, J. and Jacobsen, H. (1995)
Substrate determinants for cleavage in cis and in trans by the hepatitis C virus
NS3 proteinase. J Virol 69(1), 198-205.

Bartenschlager, R. and Lohmann, V. (2000) Replication of hepatitis C virus. J Gen Virol
81(Pt 7), 1631-48.

Berger, E.A., Murphy, P.M. and Farber, J.M. (1999) Chemokine receptors as HIV-1
coreceptors: roles in viral entry, tropism, and disease. Annu Rev Immunol 17,
657-700.

Bijlmakers, M.J. and Marsh, M. (2003) The on-off story of protein palmitoylation.
Trends Cell Biol 13(1), 32-42.

Blight, K.J., Kolykhalov, A.A. and Rice, C.M. (2000) Efficient initiation of HCV RNA
replication in cell culture. Science 290(5498), 1972-4.

Blight, K.J. and Rice, C.M. (1997) Secondary structure determination of the conserved
98-base sequence at the 3' terminus of hepatitis C virus genome RNA. J Virol
71(10), 7345-52.

Bonatti, S., Migliaccio, G. and Simons, K. (1989) Palmitylation of viral membrane
glycoproteins takes place after exit from the endoplasmic reticulum. J Biol Chem
264(21), 12590-5.

Brass, V., Bieck, E., Montserret, R., Wolk, B., Hellings, J.A., Blum, H.E., Penin, F. and
Moradpour, D. (2002) An amino-terminal amphipathic alpha-helix mediates
membrane association of the hepatitis C virus nonstructural protein 5A. J Biol
Chem 277(10), 8130-9.

Bredenbeek, P.J., Pachuk, C.J., Noten, A.F., Charite, J., Luytjes, W., Weiss, S.R. and
Spaan, W.J. (1990) The primary structure and expression of the second open
reading frame of the polymerase gene of the coronavirus MHV-A59; a highly
conserved polymerase is expressed by an efficient ribosomal frameshifting
mechanism. Nucleic Acids Res 18(7), 1825-32.

Brian, D.A. and Baric, R.S. (2005) Coronavirus genome structure and replication. Curr
Top Microbiol Immunol 287, 1-30.
143
Brierley, I., Boursnell, M.E., Binns, M.M., Bilimoria, B., Blok, V.C., Brown, T.D. and
Inglis, S.C. (1987) An efficient ribosomal frame-shifting signal in the
polymerase-encoding region of the coronavirus IBV. Embo J 6(12), 3779-85.

Bukh, J., Miller, R.H. and Purcell, R.H. (1995) Genetic heterogeneity of hepatitis C virus:
quasispecies and genotypes. Semin Liver Dis 15(1), 41-63.

Chang, C. and Yoshida, A. (1997) Human fatty aldehyde dehydrogenase gene (ALDH10):
organization and tissue-dependent expression. Genomics 40(1), 80-5.

Chazal, N. and Gerlier, D. (2003) Virus entry, assembly, budding, and membrane rafts.
Microbiol Mol Biol Rev 67(2), 226-37, table of contents.

Chen, C.M., You, L.R., Hwang, L.H. and Lee, Y.H. (1997) Direct interaction of hepatitis
C virus core protein with the cellular lymphotoxin-beta receptor modulates the
signal pathway of the lymphotoxin-beta receptor. J Virol 71(12), 9417-26.

Choi, K.S., Aizaki, H. and Lai, M.M. (2005) Murine coronavirus requires lipid rafts for
virus entry and cell-cell fusion but not for virus release. J Virol 79(15), 9862-71.

Choo, Q.L., Kuo, G., Weiner, A.J., Overby, L.R., Bradley, D.W. and Houghton, M.
(1989) Isolation of a cDNA clone derived from a blood-borne non-A, non-B viral
hepatitis genome. Science 244(4902), 359-62.

Cocquerel, L., Meunier, J.C., Pillez, A., Wychowski, C. and Dubuisson, J. (1998) A
retention signal necessary and sufficient for endoplasmic reticulum localization
maps to the transmembrane domain of hepatitis C virus glycoprotein E2. J Virol
72(3), 2183-91.

Cohen, A.W., Hnasko, R., Schubert, W. and Lisanti, M.P. (2004) Role of caveolae and
caveolins in health and disease. Physiol Rev 84(4), 1341-79.

Cormier, E.G., Durso, R.J., Tsamis, F., Boussemart, L., Manix, C., Olson, W.C., Gardner,
J.P. and Dragic, T. (2004a) L-SIGN (CD209L) and DC-SIGN (CD209) mediate
transinfection of liver cells by hepatitis C virus. Proc Natl Acad Sci U S A
101(39), 14067-72.

Cormier, E.G., Tsamis, F., Kajumo, F., Durso, R.J., Gardner, J.P. and Dragic, T. (2004b)
CD81 is an entry coreceptor for hepatitis C virus. Proc Natl Acad Sci U S A
101(19), 7270-4.

Daro, E., van der Sluijs, P., Galli, T. and Mellman, I. (1996) Rab4 and cellubrevin define
different early endosome populations on the pathway of transferrin receptor
recycling. Proc Natl Acad Sci U S A 93(18), 9559-64.
144
Demozay, D., Rocchi, S., Mas, J.C., Grillo, S., Pirola, L., Chavey, C. and Van Obberghen,
E. (2004) Fatty aldehyde dehydrogenase: potential role in oxidative stress
protection and regulation of its gene expression by insulin. J Biol Chem 279(8),
6261-70.

Di Guglielmo, G.M., Le Roy, C., Goodfellow, A.F. and Wrana, J.L. (2003) Distinct
endocytic pathways regulate TGF-beta receptor signalling and turnover. Nat Cell
Biol 5(5), 410-21.

Dimitrova, M., Imbert, I., Kieny, M.P. and Schuster, C. (2003) Protein-protein
interactions between hepatitis C virus nonstructural proteins. J Virol 77(9), 5401-
14.

Driessen, C., Bryant, R.A., Lennon-Dumenil, A.M., Villadangos, J.A., Bryant, P.W., Shi,
G.P., Chapman, H.A. and Ploegh, H.L. (1999) Cathepsin S controls the trafficking
and maturation of MHC class II molecules in dendritic cells. J Cell Biol 147(4),
775-90.

Dunphy, J.T., Greentree, W.K. and Linder, M.E. (2001) Enrichment of G-protein
palmitoyltransferase activity in low density membranes: in vitro reconstitution of
Galphai to these domains requires palmitoyltransferase activity. J Biol Chem
276(46), 43300-4.

Dunphy, J.T., Greentree, W.K., Manahan, C.L. and Linder, M.E. (1996) G-protein
palmitoyltransferase activity is enriched in plasma membranes. J Biol Chem
271(12), 7154-9.

Dusheiko, G., Schmilovitz-Weiss, H., Brown, D., McOmish, F., Yap, P.L., Sherlock, S.,
McIntyre, N. and Simmonds, P. (1994) Hepatitis C virus genotypes: an
investigation of type-specific differences in geographic origin and disease.
Hepatology 19(1), 13-8.

Dveksler, G.S., Dieffenbach, C.W., Cardellichio, C.B., McCuaig, K., Pensiero, M.N.,
Jiang, G.S., Beauchemin, N. and Holmes, K.V. (1993) Several members of the
mouse carcinoembryonic antigen-related glycoprotein family are functional
receptors for the coronavirus mouse hepatitis virus-A59. J Virol 67(1), 1-8.

Dveksler, G.S., Pensiero, M.N., Cardellichio, C.B., Williams, R.K., Jiang, G.S., Holmes,
K.V. and Dieffenbach, C.W. (1991) Cloning of the mouse hepatitis virus (MHV)
receptor: expression in human and hamster cell lines confers susceptibility to
MHV. J Virol 65(12), 6881-91.

Egger, D. and Bienz, K. (2002) Recombination of poliovirus RNA proceeds in mixed
replication complexes originating from distinct replication start sites. J Virol
76(21), 10960-71.
145
Egger, D., Wolk, B., Gosert, R., Bianchi, L., Blum, H.E., Moradpour, D. and Bienz, K.
(2002) Expression of hepatitis C virus proteins induces distinct membrane
alterations including a candidate viral replication complex. J Virol 76(12), 5974-
84.

Ehrhardt, A., Ehrhardt, G.R., Guo, X. and Schrader, J.W. (2002) Ras and relatives--job
sharing and networking keep an old family together. Exp Hematol 30(10), 1089-
106.

Einav, S., Elazar, M., Danieli, T. and Glenn, J.S. (2004) A nucleotide binding motif in
hepatitis C virus (HCV) NS4B mediates HCV RNA replication. J Virol 78(20),
11288-95.

Elazar, M., Liu, P., Rice, C.M. and Glenn, J.S. (2004) An N-terminal amphipathic helix
in hepatitis C virus (HCV) NS4B mediates membrane association, correct
localization of replication complex proteins, and HCV RNA replication. J Virol
78(20), 11393-400.

Enomoto, N., Sakuma, I., Asahina, Y., Kurosaki, M., Murakami, T., Yamamoto, C.,
Izumi, N., Marumo, F. and Sato, C. (1995) Comparison of full-length sequences
of interferon-sensitive and resistant hepatitis C virus 1b. Sensitivity to interferon
is conferred by amino acid substitutions in the NS5A region. J Clin Invest 96(1),
224-30.

Enomoto, N., Sakuma, I., Asahina, Y., Kurosaki, M., Murakami, T., Yamamoto, C.,
Ogura, Y., Izumi, N., Marumo, F. and Sato, C. (1996) Mutations in the
nonstructural protein 5A gene and response to interferon in patients with chronic
hepatitis C virus 1b infection. N Engl J Med 334(2), 77-81.

Felberbaum-Corti, M., Van Der Goot, F.G. and Gruenberg, J. (2003) Sliding doors:
clathrin-coated pits or caveolae? Nat Cell Biol 5(5), 382-4.

Feld, J.J. and Hoofnagle, J.H. (2005) Mechanism of action of interferon and ribavirin in
treatment of hepatitis C. Nature 436(7053), 967-72.

Feng, Y., Press, B. and Wandinger-Ness, A. (1995) Rab 7: an important regulator of late
endocytic membrane traffic. J Cell Biol 131(6 Pt 1), 1435-52.

Fenteany, G., Standaert, R.F., Lane, W.S., Choi, S., Corey, E.J. and Schreiber, S.L. (1995)
Inhibition of proteasome activities and subunit-specific amino-terminal threonine
modification by lactacystin. Science 268(5211), 726-31.

Fischer von Mollard, G., Stahl, B., Li, C., Sudhof, T.C. and Jahn, R. (1994) Rab proteins
in regulated exocytosis. Trends Biochem Sci 19(4), 164-8.
146
Froshauer, S., Kartenbeck, J. and Helenius, A. (1988) Alphavirus RNA replicase is
located on the cytoplasmic surface of endosomes and lysosomes. J Cell Biol
107(6 Pt 1), 2075-86.

Fukushi, S., Kurihara, C., Ishiyama, N., Hoshino, F.B., Oya, A. and Katayama, K. (1997)
The sequence element of the internal ribosome entry site and a 25-kilodalton
cellular protein contribute to efficient internal initiation of translation of hepatitis
C virus RNA. J Virol 71(2), 1662-6.

Gale, M., Jr., Blakely, C.M., Kwieciszewski, B., Tan, S.L., Dossett, M., Tang, N.M.,
Korth, M.J., Polyak, S.J., Gretch, D.R. and Katze, M.G. (1998) Control of PKR
protein kinase by hepatitis C virus nonstructural 5A protein: molecular
mechanisms of kinase regulation. Mol Cell Biol 18(9), 5208-18.

Galinier, R., Gout, E., Lortat-Jacob, H., Wood, J. and Chroboczek, J. (2002) Adenovirus
protein involved in virus internalization recruits ubiquitin-protein ligases.
Biochemistry 41(48), 14299-305.

Gallagher, T.M., Escarmis, C. and Buchmeier, M.J. (1991) Alteration of the pH
dependence of coronavirus-induced cell fusion: effect of mutations in the spike
glycoprotein. J Virol 65(4), 1916-28.

Gao, L., Aizaki, H., He, J.W. and Lai, M.M. (2004) Interactions between viral
nonstructural proteins and host protein hVAP-33 mediate the formation of
hepatitis C virus RNA replication complex on lipid raft. J Virol 78(7), 3480-8.

Gao, L., Tu, H., Shi, S.T., Lee, K.J., Asanaka, M., Hwang, S.B. and Lai, M.M. (2003)
Interaction with a ubiquitin-like protein enhances the ubiquitination and
degradation of hepatitis C virus RNA-dependent RNA polymerase. J Virol 77(7),
4149-59.

Glickman, M.H. and Maytal, V. (2002) Regulating the 26S proteasome. Curr Top
Microbiol Immunol 268, 43-72.

Gontarek, R.R., Gutshall, L.L., Herold, K.M., Tsai, J., Sathe, G.M., Mao, J., Prescott, C.
and Del Vecchio, A.M. (1999) hnRNP C and polypyrimidine tract-binding protein
specifically interact with the pyrimidine-rich region within the 3'NTR of the HCV
RNA genome. Nucleic Acids Res 27(6), 1457-63.

Gonzalez, L., Jr. and Scheller, R.H. (1999) Regulation of membrane trafficking:
structural insights from a Rab/effector complex. Cell 96(6), 755-8.

147
Gorbalenya, A.E., Koonin, E.V., Donchenko, A.P. and Blinov, V.M. (1989) Coronavirus
genome: prediction of putative functional domains in the non-structural
polyprotein by comparative amino acid sequence analysis. Nucleic Acids Res
17(12), 4847-61.

Gosert, R., Egger, D., Lohmann, V., Bartenschlager, R., Blum, H.E., Bienz, K. and
Moradpour, D. (2003) Identification of the hepatitis C virus RNA replication
complex in Huh-7 cells harboring subgenomic replicons. J Virol 77(9), 5487-92.

Gosert, R., Kanjanahaluethai, A., Egger, D., Bienz, K. and Baker, S.C. (2002) RNA
replication of mouse hepatitis virus takes place at double-membrane vesicles. J
Virol 76(8), 3697-708.

Goud, B., Yang, C., Roa, M., Martinez, O. and Slepnev, V. (1994) Study of rab6, a ras-
like GTP-binding protein associated with the Golgi complex. Ann N Y Acad Sci
733, 340-3.

Grakoui, A., McCourt, D.W., Wychowski, C., Feinstone, S.M. and Rice, C.M. (1993) A
second hepatitis C virus-encoded proteinase. Proc Natl Acad Sci U S A 90(22),
10583-7.

Griffin, S.D., Beales, L.P., Clarke, D.S., Worsfold, O., Evans, S.D., Jaeger, J., Harris,
M.P. and Rowlands, D.J. (2003) The p7 protein of hepatitis C virus forms an ion
channel that is blocked by the antiviral drug, Amantadine. FEBS Lett 535(1-3),
34-8.

Guan, Y., Zheng, B.J., He, Y.Q., Liu, X.L., Zhuang, Z.X., Cheung, C.L., Luo, S.W., Li,
P.H., Zhang, L.J., Guan, Y.J., Butt, K.M., Wong, K.L., Chan, K.W., Lim, W.,
Shortridge, K.F., Yuen, K.Y., Peiris, J.S. and Poon, L.L. (2003) Isolation and
characterization of viruses related to the SARS coronavirus from animals in
southern China. Science 302(5643), 276-8.

Guo, J.T., Bichko, V.V. and Seeger, C. (2001) Effect of alpha interferon on the hepatitis
C virus replicon. J Virol 75(18), 8516-23.

Hahm, B., Kim, Y.K., Kim, J.H., Kim, T.Y. and Jang, S.K. (1998) Heterogeneous nuclear
ribonucleoprotein L interacts with the 3' border of the internal ribosomal entry site
of hepatitis C virus. J Virol 72(11), 8782-8.

Harty, R.N., Brown, M.E., McGettigan, J.P., Wang, G., Jayakar, H.R., Huibregtse, J.M.,
Whitt, M.A. and Schnell, M.J. (2001) Rhabdoviruses and the cellular ubiquitin-
proteasome system: a budding interaction. J Virol 75(22), 10623-9.

Hauri, H.P., Kappeler, F., Andersson, H. and Appenzeller, C. (2000) ERGIC-53 and
traffic in the secretory pathway. J Cell Sci 113 ( Pt 4), 587-96.
148
Helms, J.B. and Zurzolo, C. (2004) Lipids as targeting signals: lipid rafts and intracellular
trafficking. Traffic 5(4), 247-54.

Hicke, L. (2001) A new ticket for entry into budding vesicles-ubiquitin. Cell 106(5), 527-
30.
Hijikata, M., Mizushima, H., Akagi, T., Mori, S., Kakiuchi, N., Kato, N., Tanaka, T.,
Kimura, K. and Shimotohno, K. (1993) Two distinct proteinase activities required
for the processing of a putative nonstructural precursor protein of hepatitis C virus.
J Virol 67(8), 4665-75.

Hoege, C., Pfander, B., Moldovan, G.L., Pyrowolakis, G. and Jentsch, S. (2002) RAD6-
dependent DNA repair is linked to modification of PCNA by ubiquitin and
SUMO. Nature 419(6903), 135-41.

Holmes, K.V. and Lai, M.M. (1996) Coronaviridae: The Viruses and Their Replication.
In: P.M. Howley (Ed), Fields Virology. Lippincott-Raven Publishers.

Hoofnagle, J.H. (2002) Course and outcome of hepatitis C. Hepatology 36(5 Suppl 1),
S21-9.

Hsu, M., Zhang, J., Flint, M., Logvinoff, C., Cheng-Mayer, C., Rice, C.M. and
McKeating, J.A. (2003) Hepatitis C virus glycoproteins mediate pH-dependent
cell entry of pseudotyped retroviral particles. Proc Natl Acad Sci U S A 100(12),
7271-6.

Hugle, T., Fehrmann, F., Bieck, E., Kohara, M., Krausslich, H.G., Rice, C.M., Blum, H.E.
and Moradpour, D. (2001) The hepatitis C virus nonstructural protein 4B is an
integral endoplasmic reticulum membrane protein. Virology 284(1), 70-81.

Hussy, P., Langen, H., Mous, J. and Jacobsen, H. (1996a) Hepatitis C virus core protein:
carboxy-terminal boundaries of two processed species suggest cleavage by a
signal peptide peptidase. Virology 224(1), 93-104.

Hussy, P., Schmid, G., Mous, J. and Jacobsen, H. (1996b) Purification and in vitro-
phospholabeling of secretory envelope proteins E1 and E2 of hepatitis C virus
expressed in insect cells. Virus Res 45(1), 45-57.

Ikonen, E. (2001) Roles of lipid rafts in membrane transport. Curr Opin Cell Biol 13(4),
470-7.

Ito, T. and Lai, M.M. (1997) Determination of the secondary structure of and cellular
protein binding to the 3'-untranslated region of the hepatitis C virus RNA genome.
J Virol 71(11), 8698-706.

149
James, P.F. and Zoeller, R.A. (1997) Isolation of animal cell mutants defective in long-
chain fatty aldehyde dehydrogenase. Sensitivity to fatty aldehydes and Schiff's
base modification of phospholipids: implications for Sj-ogren-Larsson syndrome.
J Biol Chem 272(38), 23532-9.

Katzmann, D.J., Odorizzi, G. and Emr, S.D. (2002) Receptor downregulation and
multivesicular-body sorting. Nat Rev Mol Cell Biol 3(12), 893-905.

Kelson, T.L., Secor McVoy, J.R. and Rizzo, W.B. (1997) Human liver fatty aldehyde
dehydrogenase: microsomal localization, purification, and biochemical
characterization. Biochim Biophys Acta 1335(1-2), 99-110.

Klausner, R.D., Donaldson, J.G. and Lippincott-Schwartz, J. (1992) Brefeldin A: insights
into the control of membrane traffic and organelle structure. J Cell Biol 116(5),
1071-80.

Konan, K.V., Giddings, T.H., Jr., Ikeda, M., Li, K., Lemon, S.M. and Kirkegaard, K.
(2003) Nonstructural protein precursor NS4A/B from hepatitis C virus alters
function and ultrastructure of host secretory apparatus. J Virol 77(14), 7843-55.

Kooi, C., Cervin, M. and Anderson, R. (1991) Differentiation of acid-pH-dependent and -
nondependent entry pathways for mouse hepatitis virus. Virology 180(1), 108-19.

Korenaga, M., Wang, T., Li, Y., Showalter, L.A., Chan, T., Sun, J. and Weinman, S.A.
(2005) Hepatitis C virus core protein inhibits mitochondrial electron transport and
increases ROS production. J Biol Chem.

Krogh, A., Larsson, B., von Heijne, G. and Sonnhammer, E.L. (2001) Predicting
transmembrane protein topology with a hidden Markov model: application to
complete genomes. J Mol Biol 305(3), 567-80.

Kujala, P., Ikaheimonen, A., Ehsani, N., Vihinen, H., Auvinen, P. and Kaariainen, L.
(2001) Biogenesis of the Semliki Forest virus RNA replication complex. J Virol
75(8), 3873-84.

Lai, M.M. (1998) Cellular factors in the transcription and replication of viral RNA
genomes: a parallel to DNA-dependent RNA transcription. Virology 244(1), 1-12.

Lai, M.M. and Cavanagh, D. (1997) The molecular biology of coronaviruses. Adv Virus
Res 48, 1-100.

Lai, M.M., Liao, C.L., Lin, Y.J. and Zhang, X. (1994) Coronavirus: how a large RNA
viral genome is replicated and transcribed. Infect Agents Dis 3(2-3), 98-105.

150
Lamb, R.A. (1993) Paramyxovirus fusion: a hypothesis for changes. Virology 197(1), 1-
11.

Lau, J.Y., Davis, G.L., Prescott, L.E., Maertens, G., Lindsay, K.L., Qian, K., Mizokami,
M. and Simmonds, P. (1996) Distribution of hepatitis C virus genotypes
determined by line probe assay in patients with chronic hepatitis C seen at tertiary
referral centers in the United States. Hepatitis Interventional Therapy Group. Ann
Intern Med 124(10), 868-76.

Lee, D.H. and Goldberg, A.L. (1998) Proteasome inhibitors: valuable new tools for cell
biologists. Trends Cell Biol 8(10), 397-403.

Lee, K.J., Choi, J., Ou, J.H. and Lai, M.M. (2004) The C-terminal transmembrane
domain of hepatitis C virus (HCV) RNA polymerase is essential for HCV
replication in vivo. J Virol 78(7), 3797-802.

Liang, X., Lu, Y., Neubert, T.A. and Resh, M.D. (2002) Mass spectrometric analysis of
GAP-43/neuromodulin reveals the presence of a variety of fatty acylated species.
J Biol Chem 277(36), 33032-40.

Liang, X., Lu, Y., Wilkes, M., Neubert, T.A. and Resh, M.D. (2004) The N-terminal SH4
region of the Src family kinase Fyn is modified by methylation and heterogeneous
fatty acylation: role in membrane targeting, cell adhesion, and spreading. J Biol
Chem 279(9), 8133-9.

Lin, Y.J., Liao, C.L. and Lai, M.M. (1994) Identification of the cis-acting signal for
minus-strand RNA synthesis of a murine coronavirus: implications for the role of
minus-strand RNA in RNA replication and transcription. J Virol 68(12), 8131-40.

Lindenbach, B.D., Evans, M.J., Syder, A.J., Wolk, B., Tellinghuisen, T.L., Liu, C.C.,
Maruyama, T., Hynes, R.O., Burton, D.R., McKeating, J.A. and Rice, C.M. (2005)
Complete replication of hepatitis C virus in cell culture. Science 309(5734), 623-6.

Lindenbach, B.D. and Rice, C.M. (2005) Unravelling hepatitis C virus replication from
genome to function. Nature 436(7053), 933-8.

Linder, M.E. and Deschenes, R.J. (2003) New insights into the mechanisms of protein
palmitoylation. Biochemistry 42(15), 4311-20.

Lo, S.Y., Selby, M.J. and Ou, J.H. (1996) Interaction between hepatitis C virus core
protein and E1 envelope protein. J Virol 70(8), 5177-82.

Locker, J.K., Rose, J.K., Horzinek, M.C. and Rottier, P.J. (1992) Membrane assembly of
the triple-spanning coronavirus M protein. Individual transmembrane domains
show preferred orientation. J Biol Chem 267(30), 21911-8.
151
Lohmann, V., Korner, F., Koch, J., Herian, U., Theilmann, L. and Bartenschlager, R.
(1999) Replication of subgenomic hepatitis C virus RNAs in a hepatoma cell line.
Science 285(5424), 110-3.

Lombardi, D., Soldati, T., Riederer, M.A., Goda, Y., Zerial, M. and Pfeffer, S.R. (1993)
Rab9 functions in transport between late endosomes and the trans Golgi network.
Embo J 12(2), 677-82.

Lundin, M., Monne, M., Widell, A., Von Heijne, G. and Persson, M.A. (2003) Topology
of the membrane-associated hepatitis C virus protein NS4B. J Virol 77(9), 5428-
38.

Luo, G. (1999) Cellular proteins bind to the poly(U) tract of the 3' untranslated region of
hepatitis C virus RNA genome. Virology 256(1), 105-18.

Machida, K., Cheng, K.T., Sung, V.M., Lee, K.J., Levine, A.M. and Lai, M.M. (2004)
Hepatitis C virus infection activates the immunologic (type II) isoform of nitric
oxide synthase and thereby enhances DNA damage and mutations of cellular
genes. J Virol 78(16), 8835-43.

Marsh, M. and Helenius, A. (1980) Adsorptive endocytosis of Semliki Forest virus. J Mol
Biol 142(3), 439-54.

Martell, M., Esteban, J.I., Quer, J., Genesca, J., Weiner, A., Esteban, R., Guardia, J. and
Gomez, J. (1992) Hepatitis C virus (HCV) circulates as a population of different
but closely related genomes: quasispecies nature of HCV genome distribution. J
Virol 66(5), 3225-9.

Matlin, K.S., Reggio, H., Helenius, A. and Simons, K. (1982) The entry of enveloped
viruses into an epithelial cell line. Prog Clin Biol Res 91, 599-611.

Matsumoto, M., Hsieh, T.Y., Zhu, N., VanArsdale, T., Hwang, S.B., Jeng, K.S.,
Gorbalenya, A.E., Lo, S.Y., Ou, J.H., Ware, C.F. and Lai, M.M. (1997) Hepatitis
C virus core protein interacts with the cytoplasmic tail of lymphotoxin-beta
receptor. J Virol 71(2), 1301-9.

Matsumoto, M., Hwang, S.B., Jeng, K.S., Zhu, N. and Lai, M.M. (1996) Homotypic
interaction and multimerization of hepatitis C virus core protein. Virology 218(1),
43-51.

McHutchison, J.G., Gordon, S.C., Schiff, E.R., Shiffman, M.L., Lee, W.M., Rustgi, V.K.,
Goodman, Z.D., Ling, M.H., Cort, S. and Albrecht, J.K. (1998) Interferon alfa-2b
alone or in combination with ribavirin as initial treatment for chronic hepatitis C.
Hepatitis Interventional Therapy Group. N Engl J Med 339(21), 1485-92.
152
McKeating, J.A., Zhang, L.Q., Logvinoff, C., Flint, M., Zhang, J., Yu, J., Butera, D., Ho,
D.D., Dustin, L.B., Rice, C.M. and Balfe, P. (2004) Diverse hepatitis C virus
glycoproteins mediate viral infection in a CD81-dependent manner. J Virol 78(16),
8496-505.

McLauchlan, J., Lemberg, M.K., Hope, G. and Martoglio, B. (2002) Intramembrane
proteolysis promotes trafficking of hepatitis C virus core protein to lipid droplets.
Embo J 21(15), 3980-8.

Melkonian, K.A., Ostermeyer, A.G., Chen, J.Z., Roth, M.G. and Brown, D.A. (1999)
Role of lipid modifications in targeting proteins to detergent-resistant membrane
rafts. Many raft proteins are acylated, while few are prenylated. J Biol Chem
274(6), 3910-7.

Meresse, S., Gorvel, J.P. and Chavrier, P. (1995) The rab7 GTPase resides on a vesicular
compartment connected to lysosomes. J Cell Sci 108 ( Pt 11), 3349-58.

Michalak, J.P., Wychowski, C., Choukhi, A., Meunier, J.C., Ung, S., Rice, C.M. and
Dubuisson, J. (1997) Characterization of truncated forms of hepatitis C virus
glycoproteins. J Gen Virol 78 ( Pt 9), 2299-306.

Miyauchi, K., Masaki, R., Taketani, S., Yamamoto, A., Akayama, M. and Tashiro, Y.
(1991) Molecular cloning, sequencing, and expression of cDNA for rat liver
microsomal aldehyde dehydrogenase. J Biol Chem 266(29), 19536-42.

Morris, D.R. and Geballe, A.P. (2000) Upstream open reading frames as regulators of
mRNA translation. Mol Cell Biol 20(23), 8635-42.

Mottola, G., Cardinali, G., Ceccacci, A., Trozzi, C., Bartholomew, L., Torrisi, M.R.,
Pedrazzini, E., Bonatti, S. and Migliaccio, G. (2002) Hepatitis C virus
nonstructural proteins are localized in a modified endoplasmic reticulum of cells
expressing viral subgenomic replicons. Virology 293(1), 31-43.

Moyer, B.D., Allan, B.B. and Balch, W.E. (2001) Rab1 interaction with a GM130
effector complex regulates COPII vesicle cis--Golgi tethering. Traffic 2(4), 268-
76.

Muratani, M. and Tansey, W.P. (2003) How the ubiquitin-proteasome system controls
transcription. Nat Rev Mol Cell Biol 4(3), 192-201.

Nash, T.C. and Buchmeier, M.J. (1997) Entry of mouse hepatitis virus into cells by
endosomal and nonendosomal pathways. Virology 233(1), 1-8.

153
Nelson, G.W., Stohlman, S.A. and Tahara, S.M. (2000) High affinity interaction between
nucleocapsid protein and leader/intergenic sequence of mouse hepatitis virus
RNA. J Gen Virol 81(Pt 1), 181-8.

Ogata, N., Alter, H.J., Miller, R.H. and Purcell, R.H. (1991) Nucleotide sequence and
mutation rate of the H strain of hepatitis C virus. Proc Natl Acad Sci U S A 88(8),
3392-6.

O'Malley, B. and Lazinski, D.W. (2005) Roles of carboxyl-terminal and farnesylated
residues in the functions of the large hepatitis delta antigen. J Virol 79(2), 1142-
53.

Opstelten, D.J., de Groote, P., Horzinek, M.C., Vennema, H. and Rottier, P.J. (1993)
Disulfide bonds in folding and transport of mouse hepatitis coronavirus
glycoproteins. J Virol 67(12), 7394-401.

Pandey, A., Andersen, J.S. and Mann, M. (2000) Use of mass spectrometry to study
signaling pathways. Sci STKE 2000(37), PL1.

Pavlovic, D., Neville, D.C., Argaud, O., Blumberg, B., Dwek, R.A., Fischer, W.B. and
Zitzmann, N. (2003) The hepatitis C virus p7 protein forms an ion channel that is
inhibited by long-alkyl-chain iminosugar derivatives. Proc Natl Acad Sci U S A
100(10), 6104-8.

Pelkmans, L., Kartenbeck, J. and Helenius, A. (2001) Caveolar endocytosis of simian
virus 40 reveals a new two-step vesicular-transport pathway to the ER. Nat Cell
Biol 3(5), 473-83.

Pelkmans, L., Puntener, D. and Helenius, A. (2002) Local actin polymerization and
dynamin recruitment in SV40-induced internalization of caveolae. Science
296(5567), 535-9.

Penin, F., Dubuisson, J., Rey, F.A., Moradpour, D. and Pawlotsky, J.M. (2004) Structural
biology of hepatitis C virus. Hepatology 39(1), 5-19.

Persson, B. and Argos, P. (1994) Prediction of transmembrane segments in proteins
utilising multiple sequence alignments. J Mol Biol 237(2), 182-92.

Pestova, T.V., Shatsky, I.N., Fletcher, S.P., Jackson, R.J. and Hellen, C.U. (1998) A
prokaryotic-like mode of cytoplasmic eukaryotic ribosome binding to the
initiation codon during internal translation initiation of hepatitis C and classical
swine fever virus RNAs. Genes Dev 12(1), 67-83.

154
Petrik, J., Parker, H. and Alexander, G.J. (1999) Human hepatic glyceraldehyde-3-
phosphate dehydrogenase binds to the poly(U) tract of the 3' non-coding region of
hepatitis C virus genomic RNA. J Gen Virol 80 ( Pt 12), 3109-13.

Pfeifer, U., Thomssen, R., Legler, K., Bottcher, U., Gerlich, W., Weinmann, E. and
Klinge, O. (1980) Experimental non-A, non-B hepatitis: four types of cytoplasmic
alteration in hepatocytes of infected chimpanzees. Virchows Arch B Cell Pathol
Incl Mol Pathol 33(3), 233-43.

Pileri, P., Uematsu, Y., Campagnoli, S., Galli, G., Falugi, F., Petracca, R., Weiner, A.J.,
Houghton, M., Rosa, D., Grandi, G. and Abrignani, S. (1998) Binding of hepatitis
C virus to CD81. Science 282(5390), 938-41.

Plutner, H., Cox, A.D., Pind, S., Khosravi-Far, R., Bourne, J.R., Schwaninger, R., Der,
C.J. and Balch, W.E. (1991) Rab1b regulates vesicular transport between the
endoplasmic reticulum and successive Golgi compartments. J Cell Biol 115(1),
31-43.

Raiborg, C., Bache, K.G., Gillooly, D.J., Madshus, I.H., Stang, E. and Stenmark, H.
(2002) Hrs sorts ubiquitinated proteins into clathrin-coated microdomains of early
endosomes. Nat Cell Biol 4(5), 394-8.

Reichel, C. and Beachy, R.N. (2000) Degradation of tobacco mosaic virus movement
protein by the 26S proteasome. J Virol 74(7), 3330-7.

Resh, M.D. (1999) Fatty acylation of proteins: new insights into membrane targeting of
myristoylated and palmitoylated proteins. Biochim Biophys Acta 1451(1), 1-16.

Rizzo, W.B. (1998) Inherited disorders of fatty alcohol metabolism. Mol Genet Metab
65(2), 63-73.

Rizzo, W.B. and Craft, D.A. (2000) Sjogren-Larsson syndrome: accumulation of free
fatty alcohols in cultured fibroblasts and plasma. J Lipid Res 41(7), 1077-81.

Rizzo, W.B., Heinz, E., Simon, M. and Craft, D.A. (2000) Microsomal fatty aldehyde
dehydrogenase catalyzes the oxidation of aliphatic aldehyde derived from ether
glycerolipid catabolism: implications for Sjogren-Larsson syndrome. Biochim
Biophys Acta 1535(1), 1-9.

Robb, J.A. and Bond, C.W. (1979) Pathogenic murine coronaviruses. I. Characterization
of biological behavior in vitro and virus-specific intracellular RNA of strongly
neurotropic JHMV and weakly neurotropic A59V viruses. Virology 94(2), 352-70.

155
Rogers, G.R., Markova, N.G., De Laurenzi, V., Rizzo, W.B. and Compton, J.G. (1997)
Genomic organization and expression of the human fatty aldehyde dehydrogenase
gene (FALDH). Genomics 39(2), 127-35.

Ros, C., Burckhardt, C.J. and Kempf, C. (2002) Cytoplasmic trafficking of minute virus
of mice: low-pH requirement, routing to late endosomes, and proteasome
interaction. J Virol 76(24), 12634-45.

Santolini, E., Migliaccio, G. and La Monica, N. (1994) Biosynthesis and biochemical
properties of the hepatitis C virus core protein. J Virol 68(6), 3631-41.

Sargiacomo, M., Scherer, P.E., Tang, Z., Kubler, E., Song, K.S., Sanders, M.C. and
Lisanti, M.P. (1995) Oligomeric structure of caveolin: implications for caveolae
membrane organization. Proc Natl Acad Sci U S A 92(20), 9407-11.

Sawicki, S.G. and Sawicki, D.L. (2005) Coronavirus transcription: a perspective. Curr
Top Microbiol Immunol 287, 31-55.

Scarselli, E., Ansuini, H., Cerino, R., Roccasecca, R.M., Acali, S., Filocamo, G., Traboni,
C., Nicosia, A., Cortese, R. and Vitelli, A. (2002) The human scavenger receptor
class B type I is a novel candidate receptor for the hepatitis C virus. Embo J
21(19), 5017-25.

Schlegel, A., Giddings, T.H., Jr., Ladinsky, M.S. and Kirkegaard, K. (1996) Cellular
origin and ultrastructure of membranes induced during poliovirus infection. J
Virol 70(10), 6576-88.

Schmidt, M.F. (1982) Acylation of viral spike glycoproteins: a feature of enveloped RNA
viruses. Virology 116(1), 327-38.

Schmidt-Mende, J., Bieck, E., Hugle, T., Penin, F., Rice, C.M., Blum, H.E. and
Moradpour, D. (2001) Determinants for membrane association of the hepatitis C
virus RNA-dependent RNA polymerase. J Biol Chem 276(47), 44052-63.

Schubert, U., Ott, D.E., Chertova, E.N., Welker, R., Tessmer, U., Princiotta, M.F.,
Bennink, J.R., Krausslich, H.G. and Yewdell, J.W. (2000) Proteasome inhibition
interferes with gag polyprotein processing, release, and maturation of HIV-1 and
HIV-2. Proc Natl Acad Sci U S A 97(24), 13057-62.

Schuck, S., Honsho, M., Ekroos, K., Shevchenko, A. and Simons, K. (2003) Resistance
of cell membranes to different detergents. Proc Natl Acad Sci U S A 100(10),
5795-800.

156
Schwaninger, R., Plutner, H., Bokoch, G.M. and Balch, W.E. (1992) Multiple GTP-
binding proteins regulate vesicular transport from the ER to Golgi membranes. J
Cell Biol 119(5), 1077-96.

Schwartz, M., Chen, J., Janda, M., Sullivan, M., den Boon, J. and Ahlquist, P. (2002) A
positive-strand RNA virus replication complex parallels form and function of
retrovirus capsids. Mol Cell 9(3), 505-14.

Segev, N. (2001) Ypt and Rab GTPases: insight into functions through novel interactions.
Curr Opin Cell Biol 13(4), 500-11.

Shi, S.T. and Lai, M.M. (2005) Viral and cellular proteins involved in coronavirus
replication. Curr Top Microbiol Immunol 287, 95-131.

Shi, S.T., Lee, K.J., Aizaki, H., Hwang, S.B. and Lai, M.M. (2003) Hepatitis C virus
RNA replication occurs on a detergent-resistant membrane that cofractionates
with caveolin-2. J Virol 77(7), 4160-8.

Shi, S.T., Polyak, S.J., Tu, H., Taylor, D.R., Gretch, D.R. and Lai, M.M. (2002) Hepatitis
C virus NS5A colocalizes with the core protein on lipid droplets and interacts
with apolipoproteins. Virology 292(2), 198-210.

Shi, S.T., Schiller, J.J., Kanjanahaluethai, A., Baker, S.C., Oh, J.W. and Lai, M.M. (1999)
Colocalization and membrane association of murine hepatitis virus gene 1
products and De novo-synthesized viral RNA in infected cells. J Virol 73(7),
5957-69.

Shih, S.C., Katzmann, D.J., Schnell, J.D., Sutanto, M., Emr, S.D. and Hicke, L. (2002)
Epsins and Vps27p/Hrs contain ubiquitin-binding domains that function in
receptor endocytosis. Nat Cell Biol 4(5), 389-93.

Shimizu, Y.K., Igarashi, H., Kiyohara, T., Cabezon, T., Farci, P., Purcell, R.H. and
Yoshikura, H. (1996) A hyperimmune serum against a synthetic peptide
corresponding to the hypervariable region 1 of hepatitis C virus can prevent viral
infection in cell cultures. Virology 223(2), 409-12.

Sieczkarski, S.B. and Whittaker, G.R. (2002) Dissecting virus entry via endocytosis. J
Gen Virol 83(Pt 7), 1535-45.

Simmonds, P. (1995) Variability of hepatitis C virus. Hepatology 21(2), 570-83.

Simmonds, P., Alberti, A., Alter, H.J., Bonino, F., Bradley, D.W., Brechot, C., Brouwer,
J.T., Chan, S.W., Chayama, K., Chen, D.S. and et al. (1994) A proposed system
for the nomenclature of hepatitis C viral genotypes. Hepatology 19(5), 1321-4.
157
Simons, K. and Toomre, D. (2000) Lipid rafts and signal transduction. Nat Rev Mol Cell
Biol 1(1), 31-9.

Sims, A.C., Ostermann, J. and Denison, M.R. (2000) Mouse hepatitis virus replicase
proteins associate with two distinct populations of intracellular membranes. J
Virol 74(12), 5647-54.

Sizova, D.V., Kolupaeva, V.G., Pestova, T.V., Shatsky, I.N. and Hellen, C.U. (1998)
Specific interaction of eukaryotic translation initiation factor 3 with the 5'
nontranslated regions of hepatitis C virus and classical swine fever virus RNAs. J
Virol 72(6), 4775-82.

Sophos, N.A., Pappa, A., Ziegler, T.L. and Vasiliou, V. (2001) Aldehyde dehydrogenase
gene superfamily: the 2000 update. Chem Biol Interact 130-132(1-3), 323-37.

Spaete, R.R., Alexander, D., Rugroden, M.E., Choo, Q.L., Berger, K., Crawford, K., Kuo,
C., Leng, S., Lee, C., Ralston, R. and et al. (1992) Characterization of the
hepatitis C virus E2/NS1 gene product expressed in mammalian cells. Virology
188(2), 819-30.

Spangberg, K., Goobar-Larsson, L., Wahren-Herlenius, M. and Schwartz, S. (1999) The
La protein from human liver cells interacts specifically with the U-rich region in
the hepatitis C virus 3' untranslated region. J Hum Virol 2(5), 296-307.

Spangberg, K. and Schwartz, S. (1999) Poly(C)-binding protein interacts with the
hepatitis C virus 5' untranslated region. J Gen Virol 80 ( Pt 6), 1371-6.

Spear, P.G. and Longnecker, R. (2003) Herpesvirus entry: an update. J Virol 77(19),
10179-85.

Stenmark, H. and Olkkonen, V.M. (2001) The Rab GTPase family. Genome Biol 2(5),
REVIEWS3007.

Strous, G.J. and Govers, R. (1999) The ubiquitin-proteasome system and endocytosis. J
Cell Sci 112 ( Pt 10), 1417-23.

Sturman, L.S., Holmes, K.V. and Behnke, J. (1980) Isolation of coronavirus envelope
glycoproteins and interaction with the viral nucleocapsid. J Virol 33(1), 449-62.

Sturman, L.S., Ricard, C.S. and Holmes, K.V. (1985) Proteolytic cleavage of the E2
glycoprotein of murine coronavirus: activation of cell-fusing activity of virions by
trypsin and separation of two different 90K cleavage fragments. J Virol 56(3),
904-11.
158
Suhy, D.A., Giddings, T.H., Jr. and Kirkegaard, K. (2000) Remodeling the endoplasmic
reticulum by poliovirus infection and by individual viral proteins: an autophagy-
like origin for virus-induced vesicles. J Virol 74(19), 8953-65.

Tahara, S.M., Dietlin, T.A., Nelson, G.W., Stohlman, S.A. and Manno, D.J. (1998)
Mouse hepatitis virus nucleocapsid protein as a translational effector of viral
mRNAs. Adv Exp Med Biol 440, 313-8.
Tai, C.L., Pan, W.C., Liaw, S.H., Yang, U.C., Hwang, L.H. and Chen, D.S. (2001)
Structure-based mutational analysis of the hepatitis C virus NS3 helicase. J Virol
75(17), 8289-97.

Taylor, D.R., Shi, S.T., Romano, P.R., Barber, G.N. and Lai, M.M. (1999) Inhibition of
the interferon-inducible protein kinase PKR by HCV E2 protein. Science
285(5424), 107-10.

Tellinghuisen, T.L., Marcotrigiano, J., Gorbalenya, A.E. and Rice, C.M. (2004) The
NS5A protein of hepatitis C virus is a zinc metalloprotein. J Biol Chem 279(47),
48576-87.

Tellinghuisen, T.L., Marcotrigiano, J. and Rice, C.M. (2005) Structure of the zinc-
binding domain of an essential component of the hepatitis C virus replicase.
Nature 435(7040), 374-9.

Thorp, E.B. and Gallagher, T.M. (2004) Requirements for CEACAMs and cholesterol
during murine coronavirus cell entry. J Virol 78(6), 2682-92.

Tisdale, E.J., Bourne, J.R., Khosravi-Far, R., Der, C.J. and Balch, W.E. (1992) GTP-
binding mutants of rab1 and rab2 are potent inhibitors of vesicular transport from
the endoplasmic reticulum to the Golgi complex. J Cell Biol 119(4), 749-61.

Tooze, J. and Tooze, S.A. (1985) Infection of AtT20 murine pituitary tumour cells by
mouse hepatitis virus strain A59: virus budding is restricted to the Golgi region.
Eur J Cell Biol 37, 203-12.

Turner, A.J. (1992) The diversity of lipid modifications of proteins. Lipid modification of
proteins:a pratical approach., edited by T. A.J. Oxford ; New York : IRL Press at
Oxford University Press.
van der Bliek, A.M. (2005) A sixth sense for Rab5. Nat Cell Biol 7(6), 548-50.

Vasiliou, V., Kozak, C.A., Lindahl, R. and Nebert, D.W. (1996) Mouse microsomal Class
3 aldehyde dehydrogenase: AHD3 cDNA sequence, inducibility by dioxin and
clofibrate, and genetic mapping. DNA Cell Biol 15(3), 235-45.

Vasiliou, V., Pappa, A. and Petersen, D.R. (2000) Role of aldehyde dehydrogenases in
endogenous and xenobiotic metabolism. Chem Biol Interact 129(1-2), 1-19.
159
Veit, M., Reverey, H. and Schmidt, M.F. (1996) Cytoplasmic tail length influences fatty
acid selection for acylation of viral glycoproteins. Biochem J 318 ( Pt 1), 163-72.

Veit, M. and Schmidt, M.F. (1993) Timing of palmitoylation of influenza virus
hemagglutinin. FEBS Lett 336(2), 243-7.

Vennema, H., Heijnen, L., Zijderveld, A., Horzinek, M.C. and Spaan, W.J. (1990)
Intracellular transport of recombinant coronavirus spike proteins: implications for
virus assembly. J Virol 64(1), 339-46.

Wakita, T., Pietschmann, T., Kato, T., Date, T., Miyamoto, M., Zhao, Z., Murthy, K.,
Habermann, A., Krausslich, H.G., Mizokami, M., Bartenschlager, R. and Liang,
T.J. (2005) Production of infectious hepatitis C virus in tissue culture from a
cloned viral genome. Nat Med 11(7), 791-6.

Walewski, J.L., Keller, T.R., Stump, D.D. and Branch, A.D. (2001) Evidence for a new
hepatitis C virus antigen encoded in an overlapping reading frame. Rna 7(5), 710-
21.

Wang, C., Gale, M., Jr., Keller, B.C., Huang, H., Brown, M.S., Goldstein, J.L. and Ye, J.
(2005) Identification of FBL2 as a geranylgeranylated cellular protein required for
hepatitis C virus RNA replication. Mol Cell 18(4), 425-34.

Waris, G., Sarker, S. and Siddiqui, A. (2004) Two-step affinity purification of the
hepatitis C virus ribonucleoprotein complex. Rna 10(2), 321-9.

Webb, Y., Hermida-Matsumoto, L. and Resh, M.D. (2000) Inhibition of protein
palmitoylation, raft localization, and T cell signaling by 2-bromopalmitate and
polyunsaturated fatty acids. J Biol Chem 275(1), 261-70.

Weissman, A.M. (2001) Themes and variations on ubiquitylation. Nat Rev Mol Cell Biol
2(3), 169-78.

Westaway, E.G., Mackenzie, J.M., Kenney, M.T., Jones, M.K. and Khromykh, A.A.
(1997) Ultrastructure of Kunjin virus-infected cells: colocalization of NS1 and
NS3 with double-stranded RNA, and of NS2B with NS3, in virus-induced
membrane structures. J Virol 71(9), 6650-61.

White, J., Johannes, L., Mallard, F., Girod, A., Grill, S., Reinsch, S., Keller, P.,
Tzschaschel, B., Echard, A., Goud, B. and Stelzer, E.H. (1999) Rab6 coordinates
a novel Golgi to ER retrograde transport pathway in live cells. J Cell Biol 147(4),
743-60.

Wilk, S. and Orlowski, M. (1983) Evidence that pituitary cation-sensitive neutral
endopeptidase is a multicatalytic protease complex. J Neurochem 40(3), 842-9.
160
Willemsen, M.A., Rotteveel, J.J., de Jong, J.G., Wanders, R.J., L, I.J., Hoffmann, G.F.
and Mayatepek, E. (2001) Defective metabolism of leukotriene B4 in the Sjogren-
Larsson syndrome. J Neurol Sci 183(1), 61-7.

Williams, R.K., Jiang, G.S. and Holmes, K.V. (1991) Receptor for mouse hepatitis virus
is a member of the carcinoembryonic antigen family of glycoproteins. Proc Natl
Acad Sci U S A 88(13), 5533-6.

Wolk, B., Sansonno, D., Krausslich, H.G., Dammacco, F., Rice, C.M., Blum, H.E. and
Moradpour, D. (2000) Subcellular localization, stability, and trans-cleavage
competence of the hepatitis C virus NS3-NS4A complex expressed in
tetracycline-regulated cell lines. J Virol 74(5), 2293-304.

Wyatt, L.S., Moss, B. and Rozenblatt, S. (1995) Replication-deficient vaccinia virus
encoding bacteriophage T7 RNA polymerase for transient gene expression in
mammalian cells. Virology 210(1), 202-5.

Xia, Y.P. and Lai, M.M. (1992) Oligomerization of hepatitis delta antigen is required for
both the trans-activating and trans-dominant inhibitory activities of the delta
antigen. J Virol 66(11), 6641-8.

Xu, Z., Choi, J., Yen, T.S., Lu, W., Strohecker, A., Govindarajan, S., Chien, D., Selby,
M.J. and Ou, J. (2001) Synthesis of a novel hepatitis C virus protein by ribosomal
frameshift. Embo J 20(14), 3840-8.

Ye, J., Wang, C., Sumpter, R., Jr., Brown, M.S., Goldstein, J.L. and Gale, M., Jr. (2003)
Disruption of hepatitis C virus RNA replication through inhibition of host protein
geranylgeranylation. Proc Natl Acad Sci U S A 100(26), 15865-70.

Yokomori, K., Banner, L.R. and Lai, M.M. (1991) Heterogeneity of gene expression of
the hemagglutinin-esterase (HE) protein of murine coronaviruses. Virology
183(2), 647-57.

Yokomori, K. and Lai, M.M. (1992) Mouse hepatitis virus utilizes two carcinoembryonic
antigens as alternative receptors. J Virol 66(10), 6194-9.

Yoshida, A., Rzhetsky, A., Hsu, L.C. and Chang, C. (1998) Human aldehyde
dehydrogenase gene family. Eur J Biochem 251(3), 549-57.

Zhong, J., Gastaminza, P., Cheng, G., Kapadia, S., Kato, T., Burton, D.R., Wieland, S.F.,
Uprichard, S.L., Wakita, T. and Chisari, F.V. (2005) Robust hepatitis C virus
infection in vitro. Proc Natl Acad Sci U S A 102(26), 9294-9.

161
Zhu, N., Khoshnan, A., Schneider, R., Matsumoto, M., Dennert, G., Ware, C. and Lai,
M.M. (1998) Hepatitis C virus core protein binds to the cytoplasmic domain of
tumor necrosis factor (TNF) receptor 1 and enhances TNF-induced apoptosis. J
Virol 72(5), 3691-7.

Ziebuhr, J. (2005) The coronavirus replicase. Curr Top Microbiol Immunol 287, 57-94.

Linked assets

University of Southern California Dissertations and Theses

Conceptually similar

PDF

Studies of hepatitis B virus and hepatitis C virus infection

PDF

The interactions of host cell proteins with mouse hepatitis virus RNA

PDF

A new model for hepatitis delta virus transcription and replication

PDF

Structure and functions of hepatitis C virus core protein

PDF

The role of tumor-associated and normal human brain endothelial cells in angiogenesis

PDF

Mechanistic study of RAG -mediated initiation of V(D)J recombination

$Molecular and cellular characterization of nickel -induced C3H/10T½ Cl 8 cell transformation$

PDF

Molecular and cellular characterization of nickel -induced C3H/10T½ Cl 8 cell transformation

PDF

The androgen receptor: Its role in the development and progression of cancers of the prostate and breast

PDF

The cellular proteins that regulate hepatitis C virus RNA replication

PDF

Leukemia cell vaccine generation using lentiviral vectors

PDF

Non-stable viral and stable non-viral gene transfer to hematopoietic stem cells

PDF

Regulation of hepatitis B virus gene expression

PDF

Role of PKC-delta in deferoxamine-induced cell death in salivary epithelial Pa-4 cells

PDF

Studies on the regulation of p53 and investigation of functional significance of interactions between p53 and its binding proteins

PDF

Regulation of RNA polymerase I transcription by CK2 and TAF1

PDF

The effect of interleukin-7 and C-Kit signaling throughout the ontogeny of naive CD4+ lymphocytes from hematopoietic stem cells to maturity

PDF

The effects of progesterone on cell cycle and differentiation status of human ovarian cancer cells

PDF

Rational design of DNA epitope vaccines

PDF

Mechanisms regulating neurotrophin responsiveness during development and injury

PDF

Wnt factors: Genes, functions and cooperative signaling in mammary cell transformation

Asset Metadata

Creator Yu, Guann-Yi (author)

Core Title RNA viruses and cell membrane: Hepatitis C virus and coronavirus

Degree Doctor of Philosophy

Degree Program Molecular Microbiology and Immunology

Publisher University of Southern California (original), University of Southern California. Libraries (digital)

Tag biology, microbiology,Biology, Virology,health sciences, pathology,OAI-PMH Harvest

Language English

Contributor Digitized by ProQuest (provenance)

Permanent Link (DOI) https://doi.org/10.25549/usctheses-c16-438188

Unique identifier UC11341317

Identifier 3237105.pdf (filename),usctheses-c16-438188 (legacy record id)

Legacy Identifier 3237105.pdf

Dmrecord 438188

Document Type Dissertation

Rights Yu, Guann-Yi

Type texts

Source University of Southern California (contributing entity), University of Southern California Dissertations and Theses (collection)

Access Conditions The author retains rights to his/her dissertation, thesis or other graduate work according to U.S. copyright law. Electronic access is being provided by the USC Libraries in agreement with the au...

Repository Name University of Southern California Digital Library

Repository Location USC Digital Library, University of Southern California, University Park Campus, Los Angeles, California 90089, USA