University of Southern California Dissertations and Theses

A TNF alpha-responsive kinase activity may play a key role in IKK activation

(USC Thesis Other)

A TNF alpha-responsive kinase activity may play a key role in IKK activation

PDF

Download a page range

Download transcript

Copy asset link

Request this asset

Transcript (if available)

Content INFORMATION TO USERS
This manuscript has been reproduced from the microfilm master. UMI films
the text directly from the original or copy submitted. Thus, seme thesis and
dissertation copies are in typewriter face, while others may be from any type of
computer printer.
The quality of this reproduction is dependent upon the quality of the
copy submitted. Broken or indistinct print, colored or poor quality illustrations
and photographs, print bleedthrough, substandard margins, and improper
alignment can adversely affect reproduction.
In the unlikely event that the author did not send UMI a complete manuscript
and there are missing pages, these will be noted. Also, if unauthorized
copyright material had to be removed, a note will indicate the deletion.
Oversize materials (e.g., maps, drawings, charts) are reproduced by
sectioning the original, beginning at the upper left-hand comer and continuing
from left to right in equal sections with small overlaps.
Photographs included in the original manuscript have been reproduced
xerographically in this copy. Higher quality 6” x 9" black and white
photographic prints are available for any photographs or illustrations appearing
in this copy for an additional charge. Contact UMI directly to order.
ProQuest Information and Learning
300 North Zeeb Road, Ann Arbor, Ml 48106-1346 USA
800-521-0600
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
A TNF a -RESPONSIVE KINASE ACTIVITY
MAY PLAY A KEY ROLE IN IKK ACTIVATION
by
Yung-Kang Lee
A Thesis Presented to the
FACULTY OF THE GRADUATE SCHOOL
UNIVERSITY OF SOUTHERN CALIFORNIA
In Partial Fulfillment of the
Requirement of the Degree
MASTER OF SCIENCE
(BIOCHEMISTRY AND MOLECULAR BIOLOGY)
August 2001
Copyright 2001 Yung-Kang Lee
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
UMI Number: 1409596
Copyright 2001 by
Lee, Yung-Kang
All rights reserved.
_ _ ®
UMI
UMI Microform 1409596
Copyright 2002 by ProQuest Information and Learning Company.
All rights reserved. This microform edition is protected against
unauthorized copying under Title 17, United States Code.
ProQuest Information and Learning Company
300 North Zeeb Road
P.O. Box 1346
Ann Arbor, Ml 48106-1346
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
UNIVERSITY OF SOUTHERN CALIFORNIA
The Graduate School
University Park
LOS ANGELES. CALIFORNIA 90089-1695
This thesis, w ritte n b y
YUNG-KANG LEE
U nder th e d ire c tio n o f AJLa Thesi s
C om m i ttee, an d approved b y a ll its m em bers,
has been p resented to an d accepted b y The
G raduate School , in p a rtia l fu lfillm e n t o f
requirem ents fo r th e degree o f
MASTER OF SCIENCE
D am o f G raduat e S t udi es
D a te August 7, 2001
rS C O M M l
C h a i r p e r s o n
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
Acknowledgements
This study was conducted in the laboratory of Dr. Ebrahim Zandi at USC/Keck
School of Medicine and Norris Comprehensive Cancer Center. Therefore the
information and the reagents used and prepared in this study are the property of Dr.
Zandi’s Laboratory and (JSC.
The data in figure 5, 7, and 8 are provided by Dr. Ebrahim Zandi, and are used
in this thesis with his permission. I would like to thank Dr. Ebrahim Zandi and his lab
members, especially Cindy Yen and Dr. Beth S. Miller, for their help and suggestion
on the course of my study. I also thank Dr. Michael R. Lieber and Dr. Zoltan A. Tokes
for their advice on this thesis.
Finally I want to thank my wife and my family. Without their love and support, I
will never have this chance to complete my master’s study.
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
Table of Contents
Chapter Page
1. Acknowledgments ii
2. List of Tables iv
3. List of Figures v-vi
4. Abstract vii
5. Introduction 1-6
6. Materials and Methods 7-18
7. Results 19-35
8. Discussion 36-39
9. Bibliography 40-44
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
List of Tables
Table Title Page
1. The primer sets and templates used in PCR 9-10
2. Purification strategy and specific activity purified 33
from each step of chromatography
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
List of Figures
Figure Title
1. Construct map of the wild-type and mutants of IKK/3
C-terminus
2. IKK/3 phosphorylated its C-terminal tail weakly
3. A TNF a -responsive kinase activity specifically
phosphorylates the last four serines of IKK / 3 C-terminus
4. Phosphorylation of IKK/3 3SC S10A by XK26 Q-
Sepharose fractions and detection of IKK a and IKK £
5. Excess IKK y can decrease phosphorylation of HLH
peptides by the TNF a -responsive kinase activity
6. Phosphorylation status of the last four serines in IKK /3
C-terminus regulates its binding to IKK y
7. Serine 11 and 12 in IKK/S C-terminus are the
phosphoacceptor sites for the TNF a -responsive
kinase activity
8. MEF IKK/3-/- cells transfected with L3SAand M13
mutants of IKK /3 C-terminus exhibit an early IKK
activation upon TNF a stimulation
9. yBDK activity migrates as around 230kDa on a Superdex
200 column
Page
8
20
22
23
25
27
28
30
32
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
10. Purification of the yBDK by a mini-Q chromatography 35
11. A proposed model for IKK activation 38
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
Abstract
NF- k B is a central modulator of the immune system. Its activation is under the
delicate control of the phosphorylation-dependent proteolysis of I k B by I k B kinase
complex (IKK). How IKK is activated and regulated remains unclear. Here I describe
a TNF a -responsive kinase activity, which specifically phosphorylates two C-terminal
serines of IKK/3. This phosphorylation decreases the binding affinity of IKK/3 to its
regulatory subunit IKK 7 in vitro. Introducing an IKK j3 mutant in which these two
serines are replaced by alanines into mouse embryonic fibroblasts deficient in IKK /3
results in an early activation of IKK by TNF a . Base on the data presented, a model
for IKK activation in response to extracellular stimuli is proposed.
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
Introduction
Nuclear Factor kappa B (NF- k B) is a dimeric, sequence-specific transcription
factor (24). The mammalian NF-/cB family consists of five proteins p50/p105,
p52/p100, p65/RelA, RelB, and c-Rel, which can form homo- or hetero-dimers (2).
These five proteins share a Rel homology domain (RHD) which is responsible for the
dimerization between each members, the binding to NF- k B inhibitory proteins (I k
Bs), and the nuclear translocation of NF- / c B by the nuclear localization signal within
this domain (19). In the inactive state, NF- k B is bound to I k B which sequesters NF-
k B from translocation to nucleus by masking the nuclear localization signal. Upon
the activation usually by extracellular stimuli, two critical N-terminal serines on I k Bs
(a, P , and z) are phosphorylated (3, 8, 28). This phosphorylation provides the binding
site for a ubiquitin-ligase complex called TrCP, which ubiquitinates N-terminal lysines
of I k B (32, 4, 23, 1). This ubiquitination serves as a degradation signal recognized
by 26S proteosome. Once I k B is degraded, nuclear localization signal of NF- k B is
exposed and NF- k B translocates into the nucleus (2).
NF- k B participates in the regulation of transcription of over two hundred genes
(20). Most of these genes are involved in the immune responses to infection and
injury. Examples of NF-kB target genes include cytokines/lymphokines (e.g., IL-1,
IFN- r . TNF a ), immunoreceptors (e.g., MHC-I, T cell recptor /S chain),
immunoglobulins (e.g., immunoglobulin e heavy chain and k light chain), cell
l
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
adhesion molecules (e.g., E-selectin, ICAM-1), as well as apoptosis regulators (e.g.,
CD95, lAPs), proto-oncogenes (e.g., c-myc, c-rel) and tumor suppress genes (e.g.,
p53). It is no exaggeration to say ‘NF-/c B is the central modulator of the immune
system’. In addition to its function in immunity, NF-/cB is also activated by some
stress conditions such as oxidative stress, UV and X rays, heavy metal stress, and
hemorrhage (20). Many viruses and viral proteins can activate NF- k B to gain
benefits for their survival by manipulating the host immune system as well as the viral
gene transcription and replication (20).
As NF- k B is regulated by extracellular signals, the cellular signaling pathways
and how they are regulated are important areas of research. The extracellular-signal-
induced phosphorylation of I k B proteins on their N-terminal serines is the key signal
leading the NF-/c B activation (3). This phosphorylation is under the delicate control
by a kinase complex, IkB kinase (IKK), which consists of three subunits a, j3, and
r (7,18, 5, 32,21, 31). Notably, almost all inducers of NF- k B pass activating signal
through this complex. Since its discovery in 1997, IKK has been the focus of many
research investigations (11). Nonetheless, the mechanism of IKK regulation and how
it is activated by many extracellular stimuli remain unknown.
Gene targeting has provided some clues as to individual roles of each IKK
members. IKK a knock-out mice show limb and skin abnormality during the early
embryonic development, but otherwise IKK and NF- k B activation by TNF a and
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
IL-1 are normal (10, 26). IKK/3 knock-out mice are embryonic lethal and die
between E12.5 and E14 due to severe liver degeneration (14, 27). The tunnel assay
confirms that this lethality is because of massive hepatocyte apoptosis (14). IKKr
knock-out mice dies between E12.S and E13 (22). This phenotype is similar to
IKK3-/- and p65-/- mice. Hence IK K (3 and y should play a key role of preventing cells
from TNFa-induced apoptosis through IM F-kB and IKK activation. On the other hand,
IKKa does not seem to be required for this anti-apoptotic function because IKK
complex composed of !K K |3 homodimer and IKKy is sufficient to execute this function
(14, 15). The specific function of IKKa is yet to be determined.
The native molecular weight of IKK complex is about six hundred to nine
hundred kilodaltons as estimated by the size exclusion chromatography (7, 18, 34).
As mentioned above three core components a , /3 , and r (87, 85, and 48 kilo-
dalton in molecular weight) form this complex, and the stoichiometry for each subunit
in the complex, though it has not been well defined, is believed to be 1 :1 :2 (21, 33).
The catalytic a and 0 subunits are highly homologous (52 percent in overall
identity). From N- to C-terminus they both share three conserved domains: the
kinase domain which is similar to the MAPKK/MEK (mitogen-activated protein kinase
kinase) and contains the phosphoacceptor signature (ser-x-x-x-ser), the
leucine-zipper domain which is responsible for the homo- or hetero-dimerization
between the a and & subunits, and the helix-loop-helix domain which is required
for the IKK activity (18, 33, 34). The two critical serines of the activation loop (also
3
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
called T loop) (36) within the a and 0 kinase domain are essential for the kinase
activity (16, 6, 18). Mutation of these serines to alanines completely abolishes both
the basal and the inducible kinase activity. The purified a or 0 subunit expressed
in sf9 cells can phosphorylate itself in vitro (33, 13, 9). Overexpressing IKKa and
IKKp in mammalian cells results in a constitutively active IKK even in the absence of
stimuli (34). These evidences suggest that the autophosphorylation of IKK might
contribute in part to its full activation, and that IKK may be under negative regulation
in resting cells.
The leucine-zipper (LZ) domain of a and 0 subunits allows dimerization (34,
33). Mutation or deletion of this domain results in an inactive IKK. The helix-
loop-helix (HLH) domain is critical for the full IKK activation. When tested in a transit
transfection experiment in HeLa cells, mutation of this region significantly reduces
IKK activity (6). This suggests that the interaction between the kinase domain and
the helix-loop-helix domain may participate in regulating IKK activity. In support of
this point, recombinant IKK a and 0 with HLH mutation produced in sf9 cells are
inactive (33). In summary, the kinase, leucine-zipper, and helix-loop-helix domains
are essential for the basal level and inducible activities of IKK.
Another regulatory region is a serine-rich cluster in the C-terminus of IKKa and
IKKP (6). The C-terminus of IKK3 contains fifteen serines out of one hundred and
thirteen amino acids. It has been reported that the phosphorylation of ten serines
4
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
(from amino acid 602 to 756) in IKK $ play a pivotal role in down-regulating IKK
activity (6). In general, after TNFa stimulation IKK complex activity reaches its
maximum activity in fifteen minutes, and returns gradually to its basal level in an hour
(7, 18, 34). This transient activation and deactivation kinetics of IKK is one of the
mechanisms that allows animals to respond to immune and environmental stresses
without suffering from physiological shock, because a number of NF-kB target genes
(e.g., TNF and IL-1) are toxic to animals if continuously produced at high levels (29,
30).
Within the C-terminal serine-rich cluster of IKKa and 8, a six-amino-acid motif
LDWSWL, which is termed as IKK 7 binding domain ( 7 BD), has been identified as
the minimal fragment required for binding to IKK 7 (17). Interfering with this
interaction by a membrane-permeable polypeptide containing the 7 BD in cell lines
and animals reduces the activation of NF-kB and IKK. This suggests that interaction
of IKKy with 7 BD of IKKa and/or IKKP is required for the activation of IKK complex.
In agreement with this observation, NF-kB and IKK are not activated by stimuli in
mice or cell lines deficient in IKKy, though the basal level of IKK activity is not
affected (22). Many cellular and viral proteins also target IKKy to activate IKK (25).
Here I describe a partially purified TNF a -responsive kinase activity that
specifically phosphorylates two serines (residues 733 and 739) in the C-terminus of
IKK/3. One of these two serines is within the 7 BD of IKK/S. An in vitro binding
5
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
assay showed that phosphorylation of these two serines in IKK £ C-terminus
reduces the binding of IKK/3 to IKKr- Furthermore, mouse embryonic fibroblasts
transfected with the alanine mutants of the last four serines in IKK0 C-terminus
exhibit an early IKK activation in response to TNFa. Based on these findings, a
model for IKK activation is proposed.
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
Materials and Methods
Plasmid construction of IKK B C-temninus wild-tvpe. S10A. S12A. S10L2A. S14A
The ONA corresponding to HLH or 3SC peptides of IKK/3 C-terminus (see
figure 1 for peptide map) was made by PCR using full-length IKK/3 wild-type- or
S10A- HA pRC /3 -actin plasmids (obtained from Dr. E. Zandi) as the templates. The
primer sets and the templates for PCR are listed in table 1. Heat-durable PfuTurbo
DNA polymerase was pruchased from Stratgene (La Jolla, CA) and the PCR was
carried out in the presence of 5% DMSO (v/v) in the reaction mixture and conditions
provided by the vendor. The parameters for each PCR cycle were set as: 96°C for 1
min, 60°C for 1 min, and 72°C for 45 sec. After twenty-nine cycles the reaction was
incubated for 10 min at 72°C. PCR products were then purified using Qiagene PCR
Purification Kit and the DNA was eluted in 50 [i ITE (pH 8.0). Twenty-five microliters
of DNA were then digested with 10 units each of Ncol and Notl plus 0.1 mg/ml BSA at
37 °c for 60 min. The digested DNA was then resolved by 1% agarose gel
electrophoresis. The desired inserts, 480bp for HLH and 350bp for 3SC, were
excised from gels, purified, and eluted in 50 fi I TE using Qiagene Gel Extraction Kit
according to the manufacturer’ s protocol. One microgram of bacterial expression
vector pET-Hel-N1 (obtained from Dr. I. Laird-Offringa) was digested and purified in
the same way used for the inserts. Six microliter of the inserts and 1 p . I of the vector
were then ligated by 1 unit of GibcoBRL T4 DNA ligase in 20/z I at 16°C, overnight.
7
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
KD
IKKp
IKKp c-terminal peptides
LZ HLH
-| | ---------1 k Ser rich H
|~T~Ser richH
J-Serx14-^
S10A:
S12A:
S10L2A:
S14A:
L3SA:
M13:
WT:
Alai----------Alai OSerl 1 Seri 2Ser13Ser14
Alai---------- Alai OAlal 1 Alai 2Ser13Ser14
Alai---------- Alai OSerl 1 Seri 2Ala13Ala14
Alai--------------------------------------------Ala14
Seri---------- Seri OAlal 1 Alai 2Ala13Ser14
Alai-----------Alai OSerl 1 Alai 2Ala13Ala14
Seri----------Ser 10Serl 1 Ser 12Ser13Ser14
IKKy binding domain (yBD): LDWSWL
Figure 1. Construct map of the wild-type and mutants of IKKp G-terminus.
S10A, S12A, S10L2A, and S14A were the peptides expressed in E. coli.
Constructs with HLH were named as HLH S10A, HLH S12A, etc. Constructs
without HLH were named as 3SC S10A, 3SC S12A, etc. L3SA and M13
were cloned into the full-length IKK|}-HA pRC p-actin vector for mammalian
expression. KD: kinase domain, LZ: leucine-zipper domain, HLH: helix-loop-
helix domain.
8
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
Reproduced with permission o f th e copyright owner. Further reproduction prohibited without permission.
Table 1. The primer sets and templates used in PCR
Construct name Template 5-primer 3’-primer Expected size (bp)
IKKp C-terminal peptide construction
IKK/3 HLHWT IKKp WT P1 P2 480
IKK/S 3SCWT IKKp WT P3 P2 350
IKK/3 HLHS10A IKKP S10A P1 P2 480
IKK/3 3SCS10A IKKp S10A P3 P2 350
IKK/3 HLHS12A IKKP S10A P1 P4 480
IKK/S 3SCS12A IKKP S10A P3 P4 350
IKK/3 HLH S10L2A IKKP S10A P1 P5 480
IKK/3 3SCS10L2A IKKP S10A P3 P5 350
IKK/S HLHS14A IKKp S10A P1 P6 480
IKK/3 3SCS14A IKKp S10A P3 P6 350
Mammalian expression plasmid construction
IKK/3 L3SA IKKp WT P7 P8 1150
IKK/3 M13 IKKP S10A P7 P9 1150
P1: 5’- AAACCATGGTTCAGAGCTTCGAGAAGAAAGTG -3 ’
P2: 5 - AAGCGGCCGCTGAGGCCTGCTCCAGGCAGCT -3 ’
Reproduced with permission o f th e copyright owner. Further reproduction prohibited without permission.
Table 1. The primer sets and templates used in PCR (continued)
P3: 5’- AAACCATGGAGATTGCTTGTAGCAAGGTCCGT -3 ’
P4: 5’- AAGCGGCCGCTGAGGCCTGCTCCAGGCAGCTGTGCTCTTCTTCTTCCGTCTGTAACCAGGCCCAGTCT
AGGGCCGT GAAAGC CT GGT -3’
P5: 5’- AAGCGGCCGCTGCGGCCT GCT CC AGGC AGGCGT GCT CTT CTTCTTCCGTCT GTAACCAGCT CCAGTCT
AG GGCCGT GAAACTCT GGT -3 ’
P6: 5’- AAGCGGCCGCTGCGGCCT GCTCCAGGCAGGCGT GCT CTT CTT CTT CCGT CT GTAACCAGGCCCAGTCT
AGGGCCGT GAAAGCCTGGT -3 ’
P7: 5 -AACCACACATTGGACATGGATCTTGTTTTTCTC -3’
P8: 5’- AAGCGGCCGCT CAT GAGGCCT GCT CCAGGCAGGCGT GCT CTT CTT CTT CCGTCTGTAACCAGGCCCAGT
CTAGGGCCGT GAAAGCCT GGT -3'
P9: 5’- AAGCGGCCGCT CATGCGGCCTGCT CCAGGCAGGCGT GCT CTT CTT CTTCCGT CTGTAACC AGGCCCAG
T CTAGGGCCGT GAAAGCCT GGT -3'
Note: nucleotides which carry serine-to-alanine mutations are bold-faced.
©
Seven microliters of each of the ligation mixtures were transformed into 200 y. I
competent cells XL10 (Stratgen, La Jolla, CA) as the following condition: 25 min on
ice, 3 min at 37°C, 3 min on ice, and 1 hr at 37°C with 1 m l plain LB. Transformed
bacteria was then spinned down, suspended in 100 ii I LB , plated onto LB/
100//g/ ml ampicillin/agar plates, and incubated at 37°C overnight. The colonies
were inoculated in LB/ampicillin solution overnight and the DNA was extracted. The
DNA sequences of the constructs were verified by automated sequencing
(Microchemical Core Facility, USC/Noms Cancer Center).
Plasmid construction of IKK 8 L3SA and M13 HA-pRC 8 -actin
The primer sets and templates used for PCR reaction were shown in table 1.
The PCR reactions were earned out with the same conditions as above except a
DNA extension time of 1 '45” was used for PCR cycles. PCR products were digested
with PfIMI and Notl and shuttled back to IKK 8 HA-pRC /3 -actin plasmid.
Expression of IKK£ C-terminal peptides
The DNA obtained above were retransformed into bacteria BL21 (DE3)pLysS.
One night prior to the day of protein expression, the transformed BL21 was
inoculated in 5 ml LB/ampicillin at 37c C overnight. The following day this 5 ml culture
was grown into 500 ml LB/ampicillin. A final concentration of 0.5mM IPTG was added
1 1
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
to stimulate protein expression when the OD6 0 o of the 500 ml culture reached 0.5.
After 3 hr of induction, bacteria were pelleted at 7,000 xg for 15 min at 4°C-
Purification of IKK B C-terminal peptides bv Ni-NTA Aaarose
The pET-Hel-N1 vector contains a 6xHis tag on its 3’ end of the cloning site. The
bacterial pellet from 500ml culture was first suspended in 50ml lysis buffer (1XPBS,
6M guanidine hydrochloride). The suspension was then sonicated with high power
for 3 min, frozen and thawed twice, and brought to a final concentration of 1% Triton
X-100 and 5mM 0 -mercaptoethanol. The lysate was cleared by centrifugation at
15,000 rpm, 4e C for 30 min. One milliliter of pre-equilibrated Ni-NTA Superflow
Agarose (Qiagene) was then mixed with the crude extract and incubated at 4°C for 1
hr. Unbound proteins were then washed away and the bound proteins were
renatured simultaneously with a set of 50ml urea-PBS buffers (4M, 2M, 1M, 0.5M,
and plain PBS supplemented with 10mM imidazole, 1% Triton X-100, and 5mM
0 -mercaptoethanol). The IKK 0 C-terminal peptides were eluted with 200mM
imidazole in 1ml fractions. The positive fractions were pooled and dialyzed in a
stabilization buffer (PBS with 1mM DTT and 10% glycerol).
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
Kinase assay
Kinase activity was assayed in the kinase buffer (20mM Tris, 10mM MgCI2 , pH
7.5), and 1-10//Ci r *3 2 P-ATP at 30°C for 30 min, followed by 12% SDS-PAGE.
I k B a (1-54) substrate was expressed and purified from E. coli (8). After
electrophoresis the proteins were transferred to a PVDF membrane (BioRad) at
100V for 1 h r. The membrane was then exposed to a phosphoimager (Molecular
Dynamics) for 1-24 hrs. The radioactivity was analyzed and quantified by the
software ImageQuant (Molecular Dynamics).
Lysis of and cvtosolic extraction of HeLa S3
An all-purpose-buffer (APB in abbreviation. 20mM Tris, 20mM NaF, 20mM £
-glycerophosphate, 0.5mM Na3 V 04 , 2.5mM sodium metabissulphite, 5mM
benzamidine, 1mM EDTA, 0.5mM EGTA, 10% glycerol, pH 7.6) was used to lyse and
solubilize the cytosolic proteins from HeLa S3 cells. About 101 0 cells (~1g total
proteins) were first suspended in APB together with 20mM pNPP, 2mM DTT, 10
/zg/ml aprotinin, 1 ^g/ml leupeptin, 1 n g/ml pepstatin, and 1 ^g/ml bestatin at a
volume of 100ml. Then the cells were homogenized with about 25 strokes using a
100ml glass homogenizer (Kontes) until the plasma membrane was broken down.
The cytosolic proteins were further solubilized by adding NaCI and NP40 to final
concentrations of 150mM and 0.5%. The cytosolic portion was then separated by
13
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
centrifugation at 15,000 rpm for 30 min and further cleared by ultracentrifugation at
35,000 rpm for 2 hr.
FPLC fractionation of HeLa S3 cvtosolic proteins bv Q Sepharose
The crude extract from above was first diluted 3-fold in APB to decrease the salt
concentration prior applying to Q Sepharose XK26 column (column dimension:
26mm in diameter, 15cm bed height, about 80ml bed volume, Amersham Pharmacia),
with a flow rate of 2.5 ml/min passing through twice. The fractionation proceeded
using an AKTA FPLC (Amerham Pharmacia) with two steps of salt (NaCI) gradient
(0-0.3M with 10 bed volumes and 0.3M-1M with 5 bed volumes). 10ml fractions were
collected.
Concentration of Q Sepharose fractions
The fractions which phosphorylated IKK/3 3SC S10A substrate in the kinase
assay were pooled, diluted to a salt concentration of 50mM, and passed through a
5ml HiTrap Q column (Amersham Pharmacia). A constant 0.3M NaCI was used to
elute the desired proteins into 1ml fractions.
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
FPLC fractionation of Q-Sepharose fractions bv Superose 6 column
Up to 500 ii I of Q-Sepharose fraction was applied to a Superose 6 HR10/30
column (Amersham Pharmacia). The fractionation was earned out by a 0.3 ml/min
flow rate with APB plus 0.3M NaCI and 0.1% BRIJ 35 (30% w/v original, Sigma), a
1.5 bed-volume elution length, and 1ml fractions were collected.
FPLC fractionation of Q-Sepharose fractions bv Suoerdex 200 column
Up to 5ml of Q-Sepharose fraction was applied to Superdex 200 26/60 column
(Amersham Pharmacia). The fractionation was earned out by a 2ml/min flow rate
with APB plus 0.3M NaCI and 0.1% BRIJ 35 (30% w/v original, Sigma), a 1.5
bed-volume elution length, and 10ml fractions were collected.
Concentration of Superdex 200 fractions
The positive fractions were pooled, diluted to a salt concentration of 50mM, and
passed through a 1 m l HiTrap Q column (Amersham Pharmacia). A TG buffer (20mM
Tris, 10% glycerol, and pH7.5) with 0.3M NaCI was used to elute the desired proteins
into 1ml fractions.
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
Coupling of IKK 8 HLH wild-tvpe peptide to CNBr-activated Sepharose 4B
About 4.7mg IKK/3 HLH peptide expressed from E. coli and purified by Ni-NTA
Agarose was coupled to 1ml reconstituted CNBr-activated Sepharose 4B(Amersham
Pharmacia) as manual suggested. About 4.0mg (~85% ) of the peptide were coupled
to the Sepharose.
Affinity purification of concentrated Superdex 200 fractions bv IKK 8 HLH-couoled
CNBr Seoharose 4B
Concentrated material from the Superdex 200 fractions was first diluted to a salt
concentration of 50mM with TG buffer. Then it was applied to the affinity column by
gravity. After washing with 1ml TG buffer, bounded proteins were eluted with 0.1M,
0.2M, 0.3M, 0.4M, 0.5M, and 1M NaCI stepwise in 500 fi I fractions.
Immunoblottino of IKK a . IKK 8 . c-Mvc. and Flaa-M2
After transfer of proteins (100V, 1hr at 4°C), a PVDF membrane was blocked in
the blocking buffer (TBS plus 10mM Tris pH 7.6, 0.025% Tween-20) supplemented
with 5% non-fat dry milk and 0.02% NaN3 for 30 min at room temperature. The
membrane was probed with either IKK a (Pharmingen, mouse monoclonal) or IKK 0
(Imgenex, mouse monoclonal) antibodies at a 1:500 dilution for 2 hr at 4°C • The
16
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
membrane was washed with the blocking buffer three times at room temperature,
25ml and 5 min each. The membrane was then probed with a sheep
horse-peroxidase-conjugated anti-mouse-lg antibody (Amersham Life Science) at a
1:5,000 dilution for 45 min at room temperature. The membrane was washed with the
blocking buffer three times at room temperature, 25ml and 10 min each. Then the
membrane was developed with SuperSignal chemiluminescemt substrate (Pierce)
as manual indicated, and was exposed to Kodak X-OMAT film.
Probing with mouse monoclonal c-Myc (Bioreagent Core Facility, USC/Norris
Cancer Center) and Flag-M2 antibodies (Sigma) was carried out the same way as
done with IKK a and /3, except a dilution ratio of 1:1,000 was used.
Interaction and immunoprecipitation of IKK 8 C-terminal peptide-IKK r associates
Either 150 ng or 300 ng of various IKK/3 C-terminal peptides as indicated in
figure 6 were first phosphorylated by 1 y. I of superose 6 fraction 20 (refer to the
kinase assay section for the reaction condition) with a volume of 10 ^ I. Then 1 p. I of
Flag-IKKr was added to the kinase reaction mixture and the final volume was
brought to 50 ju I with the kinase buffer plus 100mM NaCI, 0.1% Triton X-100, and 0.1
mg/ml BSA. The mixture was incubated on ice for 30 min. The mixture was mixed
with 15/il of anti-Flag-M2 agarose (Sigma) in a total 300 / / 1 washing buffer, and
incubated at 4= C for 30 min. Beads were spun down and washed briefly with the
17
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
washing buffer twice, 500ii\ each. Bound proteins were eluted in 30//I 1X SDS
sample buffer by boiling. Samples were separated on SDS-PAGE and proteins were
identified by western blot as indicated in figure 6.
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
Result
IKK 8 phosphorvlates its C-terminal serine tail weakly
Delhase et at. proposed that the C-terminus of IKK/S is autophosphorylated
upon TNFa stimulation (6). To test whether the C-terminal tail of IKK/S can be
phosphorylated by IKK/3 in trans, an in vitro kinase assay was performed using
full-length IKK(3 expressed in sf9 cells (33) as kinase, and the wild-type, the
serines-to-alanines mutant (S10A), or the serines-to-glutamates mutant (S10E) of
IKK/3 as substrates (see figure 1 for the constructs). Two sets of substrates were
used. One set contains the HLH domain and the other set lacks it (named HLH and
3SC respectively, see figure 1). IKK /3 phosphorylated the HLH-containing
fragments weakly, when compared to the phosphorylation of its natural substrate
IxBa (figure 2). The 3SC fragments were phosphorylated better than HLH-containing
fragments. However the extent of phosphorylation of 3SC fragments was still
significantly lower than that of IxBa. This suggested that other kinases might
phosphorylate the C-terminal serine-rich region of IKK/3.
A TNFa-resoonsive kinase activity phosphorvlates C-terminus of IKK 8 in vitro
To examine whether other kinases phosphorylate the serines cluster of IKK/3,
unstimulated and TNF a-stimulated cytosolic extracts from HeLa S3 cells were
19
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
IKK3 (Sf9)
IkBc c (1-54) —
+
HLH 3SC
HLH 3SC
IKKpct
< ^
o ©
< iu
o o
< L U
O O
< U J
© O
I % 5 5 5 5
% C O C O I 5 C O C OS w w
IKKp ct as
indicated above
Figure 2. IKKP phosphorylates its C-terminal tail weakly.
Full-length IK K J 3 expressed in sf9 cells was used to test its ability phos-
phorylating I KKp C-terminal serine-rich region. Wild-type, S10A, or S10E of
IKK(3 C-terminal peptide was used as the substrates, together with or without
the natural substrate of IKKp, IkBcx(1-54). S10A: serines-to-alanines mutant,
S10E: serines-to-glutamates mutant, ct: C-terminus.
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
fractionated on a mono-Q column. Fractions were tested for phosphorylation of the
S10A substrate. As shown in figure 3, the fractions 13-17 from unstimulated HeLa
cells contain a kinase activity that phosphorylates the 3SC S10A substrate. The
corresponding fractions from TNF a -treated cells show much weaker activity towards
3SCS10A.
To examine whether the first ten serines in this cluster (serine 1-10, see figure 1)
are also phosphorylated by this kinase activity, we compared the phosphorylation of
3SC WT and 3SC S10A by the Q column fractions (figure 3). The levels of phos
phorylation of 3SC WT and 3SC S1 0A are indistinguishable. This suggests that the
last four serines on IKK3 C-terminus could be the phosphoacceptor sites for this
TNFa-responsive kinase activity.
We examined whether IKK a and IKK $ co-eluted with this kinase activity in a
similar Q-Sepharose column fractions. This fractionation differed from the above in
that a large amount of extract was used, the column was scaled up, and a flatter salt
gradient was used. As a result, the fraction numbers were different from the
small-scale fractions shown in figure 3. However the activity eluted at the same salt
concentration in both fractionations. The kinase assay, using IKK3 3SC S10A as the
substrate, showed that the peak activity appeared in fraction 37, but the protein peak
for IKKa and IKK3 from western blot appeared in fraction 47 (figure 4). IKK a co-
21
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
No Substrate 3SC S10A
3SCWT
l — NS—1 | — TS—1 1 — NS—i | — TS—| I — NS—| i — TS |
111315171113151711 13151711131517 11 13151711131517
Figure 3. ATNFa-responsive kinase activity specifically phosphorylates the last four serines of
IKKf) C-terminus.
Q-Sepharose fractions of unstimulated and TNFa-stimulated HeLa S3 cytosolic extract were tested
their ability of phosphorylating IKKp C-terminus. NS: unstimulated, TS: TNFa-stimulated.
Frac#: Input FT 1 9 13 17 21 23 25 27 29 31 33 35 37
KA
IKKP 3SC S10A
IB: IKKa
IB: IKKp
Frac#:
KA
IKKp 3SC S10A
IB: IKKa
IB: IKKp
39 41 43 4547 49 5153 55 57 59 61 63
9
1
I
1
1
1
Figure 4. Phosphorylation of IKKP 3SC S10A by XK26 Q-Sepharose
fractions and detection of IKKa and IKKp.
Fractions from XK26 Q-Sepharose were used to test their ability of
phosphorylating the last four serines of IKKp C-terminus. IKKa and IKKp
were detected by western blot to show that phosphorylation was not
due to either of them. FT: flow through.
23
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
eluted to some extent with this activity. Although not conclusive, it appears that this
kinase activity is different from IKK.
Phosphorylation of the last four serines of IKKB C-terminus reduces its binding to
IKKv
When this work was in progress, May and colleagues reported that a
six-amino-acid motif LDWSWL (termed y-binding-domain, yBD) in C-terminus of
IKK/3 was the minimum region required for IKK/3 binding to IKK y (17). Hence, we
considered whether the phosphorylation of the serines in and around the y BD
would regulate this interaction. First, Or. Zandi examined whether binding of IKK y to
the C-terminus of IKK/3 would interfere with the kinase accessing the target serines.
The 3SC wild-type (WT) and S10A were preincubated with increasing amounts of
purified IKK y prior to the kinase reaction. As shown in figure 5, increasing amounts
of IKK r completely abolished the phosphorylation of both substrates. IKK y itself
was not phosphorylated by this kinase activity. This data indicates that either IKK y
inhibits this kinase activity or prevents this kinase to access the target serines.
Second, we examined the interaction between non-phosphorylated or
phosphorylated IKK3 C-terminal peptides with full-length IKKy by a pull-down
experiment. The Myc-tagged HLH WT, HLH S10A, HLH S14A, 3SC WT, 3SC S10A,
and 3SC S14A were or were not phosphorylated and they were mixed with Flag-IKKy.
IKKy was immunoprecipitated using anti-Flag (M2) antibody and co-immuno-
24
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
■ 1 / 1 / / X o o o g § o o O §
IKKy(ng) 0 “> g g § £ 0 “»gg«
IB: IKKy
Kinase
Assay
i
substrate: HLH-wt - HLH-S10A
Figure 5. Excess IKKy can decrease phosphorylation of HLH peptides
by the TNFa-responsive kinase activity
Increasing amount of IKKy in the kinase assay reaction decreased phos
phorylation of IKK( 3 HLH WT and S10A peptides by the TNFa-responsive
kinase activity. Courtesy of Dr. E. Zandi.
25
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
precipitation of IKKp C-terminal peptides was analyzed by immunoblotting using
anti-Myc antibody. As shown in figure 6, phosphorylation of HLH WT and HLH S10A
decreased their interaction with IKKy. The interaction of HLH S14A was unchanged
with IKKy regardless of whether it was phosphorylated or not. None of the 3SC
fragments co-immunoprecipitated with IKKy regardless of their phosphorylation
states. This indicates that HLH may be required for a stable interaction of the
C-terminus of IKKP with IKKy.
Replacing this activity with a large amount of non-kinase protein
glutathione-s-transferase (1.5pg per reaction) did not affect the binding between the
wild-type peptide and IKKy (12). Thus this attenuation in binding was not caused by
non-specific interaction but by a specific phosphorylation. Taken together, the data
above suggests that this kinase activity phosphorylates serines within and around
the yBD in IKKP, and the phosphorylation of the yBD reduced its interaction with
IKKy. In the light of these data we named this kinase activity the “ y-binding-domain
kinase1 1 (yBDK).
The TNFa-resoonsive kinase activity specifically phosphorvlates two serines of IKKB
To further identify which of the last four serines of IKKp C-terminus are the
phosphoacceptor sites for yBDK, these four serines were mutated to alanines (S12A
and S10L2A as shown in figure 1). As shown in figure 7 by Dr. Zandi, the fraction 15
of mono-Q column of untreated cell extract phosphorylated the S10A substrate with
26
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
WB: c-Myc + Flag M2
= 3
Q.
£
IKK ct peptide: —
L O
HLH
<
o
<
) r
3SC
<
O
n
<
IKKy
IKKP HLHC
n s ^
IKKP 3SCC
Super6 f20: —
IP: Flag M2
Figure 6. Phosphorylation status of the last four serines on IKKp
C-terminus regulates its binding to IKKy.
Phosphorylated HLH WT and S10A peptides of IKKp C-terminus by
fraction 20 of Superose 6 chromatography reduced their binding to IKKy.
ct: C-terminus, ns: non-specific.
27
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
4? 4? &
q fraction: _s* o o* o* NS q15
TS q15
substrate: no 3SC
substrate S10A
HLH
Co C o C q C o C^C o C o C q
ft n - . - 4 .4 l
H * la p •sM ' v -is -
S H I
**$
IHLH
I3SC
P S
IHLH
I3SC
Figure 7. Serine 11 and 12 in IKK(3 C-terminus are the phospho-
acceptor sites for the TNFa-responsive kinase activity.
The serine-to-alanine mutants on the last four serines of IKKp C-
terminus were tested to identify the phosphoacceptor sites by the
TNFa-responsive kinase activity. KA: kinase assay, PS: Ponceau S
staining. NS: untreated, TS: TNFa-treated. Courtesy of Dr. E. Zandi.
28
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
highest efficiency when compared to S12A, S10L2A, and S14A. The S10L2A was
phosphorylated to some degree, which is stronger than S12A and S14A but weaker
than S10A. Using yBDK purified from a gel-filtration chromatography, similar results
were obtained (12). The data suggests that serine eleven and twelve are the major
sites for this phosphorylation. This result further supports our observation that
phosphorylation status of serine twelve in the yBD may regulate the interaction of
IKKp with IKKy.
IKKB-deficient mouse embryonic fibroblasts (MER transfected with IKKB L3SA and
M13 mutant exhibit an early IKK activation upon TNFa stimulation.
(This experiment was performed entirely by O r. Zandi. Yung-Kang Lee made IKKp
L3SAand M13 constructs.)
To examine whether phosphorylation of the last four serines of IKKp C-terminus
plays a role in IKK responsiveness to TNF a , mouse embryonic fibroblasts (MEF)
deficient in IKK/3 were transfected with HA-tagged IKK/3 wild-type, M10, L3SA, or
M13 DNA. The positions of serine-to-alanine mutations are described in figure 1.
Stable pool of cells was selected by G418 treatment (35). Cells were treated with
TNFa from 5 to 120 minutes as indicated in figure 8. The IKK activity was
determined by immune kinase complex assay (7). Wild-type IKK / S was activated by
15 minutes and down-regulated to the basal level by 30 minutes. The IKK/3 M10
mutant showed a very similar pattern of activation like wild-type IKK/3. This result is
29
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
Reproduced w ith permission o f th e copyright owner. Further reproduction prohibited without permission.
VEC HA-IKKbwI HA-IKKrM10 HA-IKKq L3SA HA-IKKqM13
TNF - 15 - 5 15 30 60120 - 5 15 3060120 - 5 15 3060120 - 5 15 30 60 120 min
kinase activity
towards Gst-lkBa * * * # * » < * m m ,
Anti-HA
western blot
immunoprecipitate: anti-HA
Figures. MEF IKKp -/- cells transfected with L3SA and M13 mutants of IKKp C-terminus exhibited an
early IKK activation upon TNFa stimulation.
MEF IKKp -/- cells transfected with IKKp L3SA and M13 which possessed serines-to-alanines mutations over
the last 4 serines of IKKpc-terminus exhibited an early IKK activation at 5 minutes from a TNFa stimulation
profile of IKK activity. VEC: empty vector, ns: non-specific. Courtesy of Dr. E. Zandi.
U J
O
contrary to the published data by Delhase and colleagues where the activity of this
mutant was prolonged up to 120 minutes when overexpressed in HeLa cells (6).
On the other hand, mutation of last three serines in the C-terminus of IKK £ ,
regardless of the mutation of the first ten serines in the C-terminus, allowed a faster
activation of IKK/3 by TNFa (mutants L3SA and M13 in figure 8, see figure 1 for
constructs). This data indicates that serine eleven, twelve, and thirteen (see figure 1)
may play a role in regulating the kinetics of IKK activation. Furthermore, this data
provides support for our hypothesis that the serines within and around y BD are
involved in IKK regulation in cells.
Purification of r -bindino-domain kinase ( r BDK1
In vitro and in cell culture data above indicate that the serines within and around
r BD may be subject to regulation by phosphorylation by y SDK. Therefore, we
have tried to purify the y BDK for peptide sequence identification and further
analysis. The active fractions of mono-Q chromatography were applied to a
Superdex 200 gel filtration column. As shown in figure 9, the activity was recovered
in fractions 12-14, which indicated a native molecular weight of about 230
kilodaltons for 7 BDK. The active fractions were concentrated and applied to a
substrate affinity column as described in the Materials and Methods. The efficiency of
the substrate affinity column for the purification of y BDK is about 10-20% (table 2).
31
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
C M
C O
C O C O protein standard(kDa): cm
t t t
fraction#: 10111213141516 171819 2021 2223 242526
IKKP ,
3SC S10A
Figure 9. yBDK activity migrates as around 230kDa on a Supredex 200
column.
Fractions of Superdex 200 chromatography were tested for their kinase
acitivity using IKKp 3SC S10A as the substrate. The activity landed in
around 230kDa.
32
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
Reproduced with permission o f th e copyright owner. Further reproduction prohibited without permission.
Table 2. Purification strategy and specific activity purified from each step of chromatography.
Step Protein retained (mg) Activity retained (au) Specific activity purified (au/mg) Note
Starting HeLa 1,000 200,000 200
Anion exchange,
Q Sepharose, XK26
50 85,000 1,700
Anion exchange,
HiTrap Q 5ml
ND ND ND C&BE
Gil filtration,
Superdex 200 26/60
5 51,000 10,200
Anion exchange,
HiTrap Q Iml
ND ND ND C&BE
Affinity purification
CNBr-IKK|) HLH affinity
0.7 13,650 19,500
ND: not determined, au: arbitrary unit, C&BE: concentration and butler exchange.
U l
U >
The active fractions from the substrate affinity chromatography were further purified
on a mini-Q column (Figure 10). As judged by silver staining of the active fractions,
r BDK co-eluted with a number of proteins. These proteins are being analyzed for
peptide sequence determination.
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
Lft NaCI gradient
‘ f
nr
silver
stain
gel
fiff-fc ; • ' ' S * * ! • * *
' < * - i iB . - '. t * ,> . :. ■ J j
*4
' I , ; -
riT*
? ? ■ ? . *
kinase g i .
assay B p |
- -_v w>- £
S i’-l &->: a & a
Figure 10. Purification of 76OK by a mini-Q chromatography.
Active fractions from the CNBr-IKKp HLH affinity column were applied
to a mini-Q PE column. INP: input.
35
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
Discussion
IKK regulates the activation of NF- k B in response to a large number of diverse
stimuli (19). As NF- k B is involved in the pathogenesis of a number of human
diseases and cancers, a better understanding of the signaling mechanism that leads
to its activation will provide insights for potential therapeutics.
IKK is a multisubunit protein complex (11). Since its discovery in 1997, a large
number of publications describe that IKK involves in numerous signaling cascades (2,
11). However, how different signaling pathways connect to IKK and more importantly
the inter- and intra-molecular mechanisms of IKK regulation remain unclear. In this
study, a biochemical approach was taken to understand the molecular mechanism of
IKK regulation. We identified important regulatory serine residues in the C-terminal
portion of IKK/3, and purified a kinase activity (rBDK) that phosphorylates these
serines.
The rBDK is TNF a -responsive and appears to regulate the interaction of
IKK r , the essential regulatory subunit of the IKK complex, with the C-terminus of
IKK/3. We also show that mutation of the identified serines in the C-terminus of
IKK/3 to alanines allows a faster activation of IKK complex by TNF a . This supports
the notion that these serines play a regulatory role for IKK activation. More in vivo
studies are required to determine the role of phosphorylation of these serines in IKK
36
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
regulation. Nonetheless based on the observation made in this study, we propose a
model in which 7 BD and its phosphorylation status play key roles in IKK activation.
By this model as shown in figure 11, in the inactive state of IKK, IKK/3 is in a
resting conformation in which kinase and HLH domains are apart. IKK 7 remains
associated with IKK complex through an interaction with other regions of IKK/3, but
its interaction with 7 BD is either completely hindered or in a very low affinity state.
This is because serine twelve within 7 BD, and possibly serine eleven and thirteen,
are continuously hyperphosphorylated by 7 BDK. Once cells are stimulated (e.g., by
TNF a ), 7 BDK is inactivated and these three serines are dephosphorylated
(presumably by a phosphatase). This allows high affinity interaction of 7 BD with
IKK 7 . This interaction induces a conformational change in IKK /3, which brings HLH
and kinase domains of IKK 0 into close proximity. This proximity allows two critical
serines in the activation loop (also called T loop) in the kinase domain of IKK/3 to be
either autophosphorylated, or to be phosphorylated by upstream kinases. IKK is
activated by this process.
A prediction of this model is that IKK 7 interacts with more than one region of
IKK a and/or IKK 0 . This is contrary to the published data, which indicates that
7 BD of IKK/3 is the only interaction region for IKK7 (17). The other IKK7
interaction region of IKK a and IKK 0 needs to be determined. A potential
interaction region may be the HLH domain of IKKa and/or IKK/3. Data in figure 6
37
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
IKK in inactive state
extracellular
stimuli
Upstream kinase or IKKp
Vv
\ 5 E ^
\ KD
LZ
LZ
— ^
0
yBD- i
Phosphatase1
IKK in active state 0
Figure 11. A proposed model for IKK activation.
A proposed model for IKK activation and the roles of 7 BDK
and yBD-phosphatase in this mechanism. yBDK: y-binding-
domain kinase, K D: kinase domain, LZ: leucine-zipper domain,
HLH: helix-loop-helix domain, P: phosphate, y IKKy. 3 8
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
indicates that the lack of HLH diminishes, or reduces significantly, the formation of a
stable complex between the C-terminal fragment of IKK/3 and IKK7 . Thus, HLH
may be the second interaction domain of IKKa and/or IKK/S with IKK7 .
HLH has been shown to be involved in signal-induced IKK activation (6), though
the mechanism is still unknown. Interaction of HLH with IKK 7 may explain the role
of HLH in IKK activation. It would be interesting to examine the binding affinity of
IKK 7 to IKK 3 where HLH is mutated or deleted.
This model also predicts the involvement of a or a class of phosphatases in IKK
activation. As 7 BDK phosphorylates serine residues, the phosphatase could be a
serine-specific phosphatase. The hypothetical 7 BD-phosphatase cannot be PP2A
because okadaic acid (a specific inhibitor to PP2A) is a potent activator of IKK and
NF-/cB (12, 7).
Taken together, this model presents a novel mechanism for IKK activation. The
7 BDK and the 7 BD-phosphatase are novel immediate signaling molecules
upstream of IKK. The upcoming molecular identification will allow a better
understanding of signaling pathways that activate IKK and NF-/c B.
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
Bibliography
1. Alkalay I, Yaron A, Hatzubai A, Orian A, Ciechanover A, Ben-Neriah Y . 1995.
Stimulation-dependent 1/cBa phosphorylation marks the NF- k B inhibitor for
degradation via the ubiquitin-proteasome pathway. Proc. Natl. Acad. Sci. USA
92(23): 10599-603
2. Baldwin AS Jr. 1996. The NF-/cB and I k B proteins: new discoveries and
insights. Annu. Rev. Immunol. 14:649-83
3. Brown K , Gerstberger S, Carlson L, Franzoso G Siebenlist U. 1995. Control of
k B a proteolysis by site-specific, signal-induced phosphorylation. Science
267(5203): 1485-8
4. Chen ZJ, Hagler J, Palombella VJ, Melandri F , Scherer 0, Ballard D, and
Maniatis T. 1995. Signal-induced site-specific phosphorylation targets l/cBa to
the ubiquitin-proteasome pathway. Genes Dev. 9:1586-1597
5. Chen ZJ, Parent L, Maniatis T. 1996. Site-Specific Phosphorylation of I / c B a by
a novel ubiquitination-dependent protein kinase activity. Cell 84: 853
6. Delhase M, Hayakawa M, Chen Y , Karin M. 1999. Positive and negative
regulation of I k B kinase activity through IKK £ subunit phosphorylation.
Science 284(5412):309-13
7. DiDonato JA, Hayakawa M, Rothwarf DM, Zandi E, Karin M. 1997. A
cytokine-responsive I k B kinase that activates the transcription factor NF- k B.
Nature 388(6642):548-54
8. DiDonato JA, Mercurio F , Rosette C, Wu-Li J, Suyang H, Ghosh S, and Karin M.
1996. Mapping of the inducible I k B phosphorylation sites that signal its
ubiquitination and degradation. Mol. Cell. Biol. 16:1295-1304
40
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
9. Heilker R, Freuler F , Pulfer R, Di Padova F , Eder J. 1999. All three I k B isoforms
and most Rel family members are stably associated with the I k B kinase 1/2
complex. Eur. J. Biochem. 259(1-2):253-61
10. Hu Y , Baud V, Delhase M, Zhang P , Deerinck F , Ellisman F , Johnson R, Karin M.
1999. Abnormal morphogenesis but intact IKK activation in mice lacking the IK K ct
subunit of I k B kinase. Science 284:316-320
11. Karin M, Ben-Neriah Y . 2000. Phosphorylation meets ubiquitination: the control of
NF-/c B activity. Annu. Rev. Immunol. 18:621-63
12. Lee YK, Zandi E. unpublished data.
13. L i J, Peet GW, Pullen SS, Schembri-King J, Warren TC, Marcu KB, Kehry MR,
Barton R, and Jakes S. 1998. Recombinant l/cB kinases a and/3 are direct
kinases of I k B a . J. Biol. Chem. 273:30736-30741
14. L i Q, Van Antwerp D, Mercurio F , Lee KF, Verma IM. 1999. Severe liver
degeneration in mice lacking the I k . B kinase 2 gene. Science 284(5412):321 -5
15. Li ZW, Chu W, Hu Y , Delhase M, Deerinck T, Ellisman M, Johnson R, Karin M.
1999. The IKK/3 subunit of I it B kinase (IKK) is essential for nuclear factor k B
activation and prevention of apoptosis. J. Exp. Med. 189(11): 1839-45
16. Ling L, Cao Z, Goeddel DV. 1998. NF- k B-inducing kinase activates IKK a by
phosphorylation of Ser-176. Proc. Natl. Acad. Sci. USA 95(7):3792-7
17. May MJ, D'Acquisto F , Madge LA, Glockner J, Pober JS, Ghosh S. 2000.
Selective inhibition of NF- k B activation by a peptide that blocks the interaction of
NEMO with the I k B kinase complex. Science 289(5484):1550-4
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
18. Mercurio F , Zhu H, Murray BW, Shevchenko A, Bennett BL, Li J, Young DB,
Barbosa M, Mann M, Manning A, Rao A. 1997. IKK-1 and IKK-2:
cytokine-activated I k B kinases essential for NF- k B activation. Science
278(5339):860-6
19. Miyamoto S, Verma IM. 1995. Rel/NF- k B/l k B story. Adv. Cancer Res.
66:255-92
20. Pahl HL. 1999. Activators and target genes of Rel/NF- k B transcription factors.
Oncogene 18(49):6853-66
21. Rothwarf DM, Zandi E, Natoli G , Karin M. 1998. IKKr is an essential regulatory
subunit of the I k B kinase complex. Nature 395(6699):297-300
22. Rudolph D, Yeh WC, Wakeham A, Rudolph B , Nallainathan D, Potter J, Elia AJ,
Mak TW. 2000. Severe liver degeneration and lack of NF-kappaB activation in
NEMO/IKK 7 -deficient mice. Genes Dev. 14(7):854-62
23. Scherer DC, Brockman JA, Chen Z, Maniatis T , Ballard DW. 1995. Signal-
induced degradation of 1/cBa requires site-specific ubiquitination. Proc. Natl.
Acad. Sci. U S A 92(24):11259-63
24. Sen R, Baltimore D. 1986. inducibility of kappa immunoglobulin enhancer-binding
protein NF-/c B by a posttranslational mechanism. Cell 47(6):921-8
25. Sun SC, Ballard DW. 1999. Persistent activation of NF- k B by the tax
transforming protein of HTLV-1: hijacking cellular I k B kinases. Oncogene
18(49):6948-58
26. Takeda K , Takeuchi O, Tsujimura T, Itami S, Adachi O, Kawai T, Sanjo H,
Yoshikawa K, Terada N, Akira S. 1999. Limb and skin abnormalities in mice
lacking IKK a . Science 284(5412):313-6
42
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
27. Tanaka M, Fuentes ME, Yamaguchi K , Durnin MH, Dalrymple SA, Hardy KL,
Goeddel DV. 1999. Embryonic lethality, liver degeneration, and impaired NF-/c B
activation in IKK /3 -deficient mice. Immunity 10(4):421-9
28. Traenckner EB, Pahl HL, Henkel T, Schmidt KN, Wilk S, Baeuerle PA. 1995.
Phosphorylation of human l/cBa on serines 32 and 36 controls l/cBa
proteolysis and NF-/cB activation in response to diverse stimuli. EMBO J.
14(12):2876-83
29. Wallach D, Boldin M, Varfolomeev E, Beyaert R, Vandenabeele P , Fiers W. 1997.
Cell death induction by receptors of the TNF family: towards a molecular
understanding. FEBS Lett. 410(1):96-106
30. Wallach D, Varfolomeev EE, Malinin NL, Goltsev YV, Kovalenko AV, Boldin MP.
1999. Tumor necrosis factor receptor and Fas signaling mechanisms. Annu. Rev.
Immunol. 17:331-67
31. Yamaoka S, Courtois G Bessia C, Whiteside ST, Weil R, Agou F , Kirk HE, Kay RJ,
Israel A. 1998. Complementation cloning of NEMO, a component of the l/cB
kinase complex essential for NF-/c B activation. Cell 93(7):1231-40
32. Yaron A, Hatzubai A, Davis M, Lavon I, Amit S, Manning AM, Andersen JS, Mann
M, Mercurio F , Ben-Neriah Y . 1998. Identification of the receptor component of
the I k B a -ubiquitin ligase. Nature 396(6711):590-4
33. Zandi E, Chen Y , Karin M. 1998. Direct phosphorylation of l/cB by IKK a and
IKK /3: discrimination between free and NF- k B-bound substrate. Science
281 (5381): 1360-3
34. Zandi E, Rothwarf DM, Delhase M, Hayakawa M, Karin M. 1997. The I k B kinase
complex (IKK) contains two kinase subunits, IKK a and IKK/3, necessary for I k
B phosphorylation and NF-/c B activation. Cell 91(2):243-52
43
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
35. Zandi E. unpublished data.
36. Zheng CF, Guan KL. 1994. Activation of MEK family kinases requires
phosphorylation of two conserved Ser/Thr residues. EMBO J. 13(5): 1123-31
44
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.

Linked assets

University of Southern California Dissertations and Theses

Conceptually similar

PDF

Biochemical analysis of somatic mutations in steroid 5alpha-reductase type II in prostate cancer

PDF

Detection of anti-Hu antibodies, a possible key to early diagnosis of small cell lung cancer

PDF

A model for the mechanism of agonism and antagonism in steroid receptors

PDF

Amelogenin domains in a self-assembly process

PDF

Functional analysis of single nucleotide polymorphisms (SNPs) in the 5' regulatory region on the SRD5A2 gene

PDF

Expression of matrix metalloproteinases and their inhibitors in the muscles of amyotrophic lateral sclerosis and control patients

PDF

Clathrin associated protein (AP) binding motifs in AD5 penton

PDF

Construction and characterization of RRP6 deletion in Saccharomyces cerevisiae

PDF

Association between single nucleotide polymorphisms in the 3'untranslated region of the SRD5A2 gene and prostate cancer risk

PDF

Generation of mutant tissue inhibitor of metalloproteinases-2 (TIMP-2) in the baculovirus expression system

PDF

Establishment and properties of a stable transfected epicardial cell line expressing a dominant negative retinoic acid receptor

PDF

Analysis of the HSD3B2 gene in prostate cancer

PDF

Cyclophilin C is a candidate protein to interact with saposin B using the yeast two-hybrid system

PDF

Analysis of the ALOX5 gene in atherosclerosis

PDF

A coactivator complex among GRIP1, CARM1, and TIF1alpha contributes to gene activation directed by androgen receptor

PDF

Purification and sequence study of platelet aggregation inhibitor from snake venom

PDF

Development and secretions of salivary glands using mouse models

PDF

A review of molecular conjugates and their use in gene therapy with the presentation of a model experiment: Gene therapy with novel fusion proteins that target breast cancer cells

PDF

A transgenic mouse model for small cell lung cancer

PDF

Anomalies at NGX6 locus: Potential involvement in feline lymphomas

Asset Metadata

Creator Lee, Yung-Kang (author)

Core Title A TNF alpha-responsive kinase activity may play a key role in IKK activation

School Graduate School

Degree Master of Science

Degree Program Biochemistry and Molecular Biology

Publisher University of Southern California (original), University of Southern California. Libraries (digital)

Tag chemistry, biochemistry,OAI-PMH Harvest

Language English

Contributor Digitized by ProQuest (provenance)

Advisor Tokes, Zoltan A. (committee chair), Lieber, Michael (committee member), Zandi, Ebrahim (committee member)

Permanent Link (DOI) https://doi.org/10.25549/usctheses-c16-42832

Unique identifier UC11342069

Identifier 1409596.pdf (filename),usctheses-c16-42832 (legacy record id)

Legacy Identifier 1409596.pdf

Dmrecord 42832

Document Type Thesis

Rights Lee, Yung-Kang

Type texts

Source University of Southern California (contributing entity), University of Southern California Dissertations and Theses (collection)

Access Conditions The author retains rights to his/her dissertation, thesis or other graduate work according to U.S. copyright law. Electronic access is being provided by the USC Libraries in agreement with the au...

Repository Name University of Southern California Digital Library

Repository Location USC Digital Library, University of Southern California, University Park Campus, Los Angeles, California 90089, USA