University of Southern California Dissertations and Theses

Anomalies at NGX6 locus: Potential involvement in feline lymphomas

(USC Thesis Other)

Anomalies at NGX6 locus: Potential involvement in feline lymphomas

PDF

Download a page range

Download transcript

Copy asset link

Request this asset

Transcript (if available)

Content ANOMALIES AT NGX6 LOCUS:
POTENTIAL INVOLVEMENT IN FELINE LYMPHOMAS
by
Chun-Peng Liao
A Thesis Presented to the
FACULTY OF THE GRADUATE SCHOOL
UNIVERSITY OF SOUTHERN CALIFORNIA
In Partial Fulfillment of the
Requirements for the Degree
M ASTER OF SCIENCE
(BIOCHEMISTRY AND M OLECULAR BIOLOGY)
May 2005
Copyright 2005 Chun-Peng Liao
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
UMI Number: 1427951
INFORMATION TO USERS
The quality of this reproduction is dependent upon the quality of the copy
submitted. Broken or indistinct print, colored or poor quality illustrations and
photographs, print bleed-through, substandard margins, and improper
alignment can adversely affect reproduction.
In the unlikely event that the author did not send a complete manuscript
and there are missing pages, these will be noted. Also, if unauthorized
copyright material had to be removed, a note will indicate the deletion.
®
UMI
UMI Microform 1427951
Copyright 2005 by ProQuest Information and Learning Company.
All rights reserved. This microform edition is protected against
unauthorized copying under Title 17, United States Code.
ProQuest Information and Learning Company
300 North Zeeb Road
P.O. Box 1346
Ann Arbor, Ml 48106-1346
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
DEDICATION
This w ork is dedicated to my family, for their unconditional love, support and
encouragements through the years.
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
ACKNOWLEDGEMENTS
I would like to thank my mentor, Dr. Pradip Roy-Burman, for welcome me into his
lab and for his patience, encouragements and guidance.
I also thank m y committee members, Dr. Michael Stallcup and Dr. Robert Stellwagen,
for their time and efforts in helping me prepare this thesis.
Thanks also m ust go to each member in R oy’s lab for his or her supports. They are:
Judong Pan, Yasuhito Fujino, Chen Zhong, Shangxin Yang, Ani Khodavirdi, Gohar,
and KumKum. I could not have done this without their help.
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
TABLE OF CONTENTS
D edication ....................................................................................................... ii
A cknowledgem ents. ............................................................................................. iii
List o f Tables and Figures...................................... ................................................... vi
A bstract................................................. viii
I. Introduction................................................................................................................. 1
1.1 Retroviral insertional m utagenesis................................................................ 1
1.2 Feline Leukemia Virus..................................................................................... 1
1.3 FeLV common integration sites..................................................................... 2
1.4 Methods for searching common retroviral integration sites.....................4
II. Material and M ethods............................................................................................ 5
2.1 M aterial ................................................................ ....................................... 5
2.1.1 Cell lines...................................................................................................... 5
2.1.2 Genomic DNA sam ples............................................................................ 5
2.2 M ethods............................................................................................... ............... 5
2.2.1 Genome walking........................................................................................7
2.2.2 Cloning....................................................................................................... 9
2.2.4 Blast searching.......................................................................................... 9
2.2.5 R N A isolation........................................................................................... 10
2.2.6 First-Strand cD N A synthesis ................................ 10
2.2.7 RNA Ligase Mediated Rapid A m plication. ................................. 10
2.2.8 Genomic DNA isolation......................................................................... 11
2.2.9 Probe labeling................................................................. ......................... 12
2.2.10 Southern Blot Hybridrization........................ ...................................... 12
m . Results ........................................................................................................ 14
3.1 Genome Walking identified several integration sites............................. . 14
3.2 Further analyses o f the flanking sequences identified A m ll and NGX6
sites.................................................................................................................. 18
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
3.3 RNA expression analyses revealed alteration of NGX6 expression in
tum or cells and in tum ors. ...................... 19
3.4 Southern Blot hybridization ....... 24
IV. D iscussions............................. 37
4.1 The novel utility o f Genome Walking in identifying retroviral
integration sites ....... 37
4.2 The adjoining region near feline NGX6 gene may be linked to
lymphomagenesis....................................... 38
4.3 LOH o f feline NGX6 leads to tum origenesis................ 42
4.4 Future studies........................... 42
V. Reference................................................................................................................... 43
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
LIST OF TABLES AND FIGURES
Table 1. Sequences o f primers used in this study................................. ............... 6
Figure 1. Genome Walking procedure in this study. .............................. 8
Figure 2. Fragments amplified from feline lymphoma No. 5022 by Genome
walking.................................................. 15
Figure 3. Fragments amplified from feline lymphoma No. 5023 by Genome
w alking............................................. 16
Figure 4. Fragments amplified form feline lymphoma No. 5051 by Genome
walking.................................................. 17
Figure 5. BLAST-search results of clone 233-4.21............................................... 20
Figure 6. BLAST-search results o f clone 515-2.14.................................................. 22
Figure 7. The feline NGX6 expression results by RT-PCR............... 25
Figure 8. Feline NGX6 cDNA fragments amplified by RLM -RACE................ 26
Figure 9. The large Feline NGX6 cDNA fragm ent. ..................................... 27
Figure 10. Southern blot hybridization o f BamHl-digested normal and 29
Japanese tumor DNAs with 515#1 probe............................. ................ 28
Figure 11. Southern blot hybridization o f H indM -EcoRl double digested
normal and 9 Japanese tum or DNAs with 515#1........... probe.......... 30
Figure 12. Southern blot hybridization o f i/mcOH-digested DNA samples
w ith 515# 1 probe.......................... 31
vi
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
Figure 13. Southern blot hybridization o f ffmrflll-digested placenta and cell
line DNAs with 515#1 p r o b e ......................................................... 32
Figure 14. Southern blot hybridization o f Psd-digested normal and tumor
DNA sam ples. ............................................................... 33
Figure 15. Southern blot hybridization o f iscoifl-digested DNA samples with
515#1 probe.............................................................. 34
Figure 16. Southern blot hybridization o f Pfrl-digested genomic DNAs from
cat 3641................ 35
Figure 17. Restriction enzyme sites on the two bands............................................ 40
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
ABSTRACT
Retroviral insertions have been used to identify genes associated with carcinogenesis,
especially in leukemia and lymphoma models. Common integration sites in the
tumors are likely to represent pathogenetic signatures. Historically, the approach for
identifying such genes has involved the inefficient processes o f generating phage
libraries o f the tum or DNA, containing pro virus-linked subfragments, and cloning
and sequencing o f DNA adjacent to the proviral sequences. In this study, we describe
a simplified genome walking scheme that can be used for identifying the cellular
DNA sequences adjacent to an integrated pro virus. We utilized Feline Leukemia
Virus (FeLV) -induced lymphomas as a model, which represents a natural and
common disease in the domestic cat. In this technique, two primers in the U3 region
o f the long terminal repeat (LTR) were combined with two adapter primers to
perform nested PCR with the £eoi?I-digested genomic DNA templates from FeLV
induced thymic lymphomas. The EcoRl site was selected because it is absent in the
proviral sequence. Although there were several sequences that could not be evaluated
or matched with known mammalian genomic sequence provided in databases, we
validated the approach by identifying the integration sites, fit-1, c-myc and flvi-2,
which are known to be commonly affected in FeLV-lymphomas. Additionally, a new
site was uncovered, NGX6. NG X6 has been previously reported as a tumor suppressor
gene associated w ith nasopharyngeal carcinoma (NPC). This novel insertion site is
on the upstream region o f NGX6, which was found to be heterozygous with respect
viii
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
to restriction fragment sizes. W hile the normal feline DNA samples tested are found
to indicate two different alleles, there is a distinct propensity for loss o f one allele in
feline lymphomas. The RNA analysis also detected one FeLV positive T-cell
lymphoma cell line and two tumors that contain the apparent LOH correlating with
decreased NG X6 mRNA expression level. Further analyses are required to define
the observed genotypic changes at an upstream region o f NGX6 gene with respect to
the potential role o f NGX6 tum or suppressor gene in feline lymphomagenesis.
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
I. INTRODUCTION
1.1 Retroviral insertional mutagenesis
Retroviruses appear to induce cancer by insertional mutagenesis which leads to
deregulation of nearby genes. Proviral integration into the host genome is a
natural step of the life cycle of retroviruses, and most insertions are thought to be
random and not causally related to disease. However, proviruses isolated from
different tumors have been found frequently inserted around or within the same
genes (35). The specificity of the viral insertion in tumors suggests that there has
been selection for outgrowth of cells carrying specific insertions, and insertional
mutagenesis is involved in the multistep process of retroviral pathogenesis.
Therefore, common integration sites have been used as molecular tags to identify
proto-oncogenes, tumor suppressor genes, and the oncogenic pathways.
1.2 Feline Leukemia Virus
A Feline Leukemia Virus (FeLV), first isolated in Scotland in 1964(8), is a
naturally occurring transmitted type C retrovirus found in the domestic cat
population. Many studies have shown that FeLV induced neoplastic diseases of
the lymphoid and hematopoietic systems are particularly frequent in cats and
occur predominantly as lymphomas, including thymic, multicentric and
alimentary forms(21).
Three horizontally transmitted FeLV subgroups have been known as FeLV-A, B,
and C, which were defined by the genetic sequence variations in the surface
glycoprotein (SU), part of the envelope (env) gene(30, 31). FeLV-A is an
1
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
ecotropic virus, whereas FeLV-B and C are polytropic viruses. FeLV-A is present
in all natural isolates. FeLV-B, always found along with FeLV-A, is
over-represented in feline lymphomas relative to its occurrence in infected but
otherwise healthy cats(7). FeLV-C is commonly associated with FeLV-A or
FeLV-A plus FeLV-B, and also a causative agent for degenerative disorders such
as aplastic anemia and immunosuppressive disease(28, 29). There is evidence that
FeLV-B and FeLV-C viruses are generated from recombination between FeLV-A
and endogenous FeLV-like sequences of the genome of the domestic cat(9, 33, 34)
(3,27).
1.3 FeLV common integration sites
Five FeLV common integration sites have been identified in naturally occurring
and experimentally induced feline lymphomas, which are c-myc, flvi-1, flvi-2,
fit-1 and pim-1.
Early studies show that c-myc gene has frequently been affected by FeLV
insertion(5, 15, 22, 24) or transduction(23, 24) in feline T-cell tumors and thymic
lymphomas, c-myc is a nuclear phosphoprotein belonging to a family of
transcription factors which contain basic helix-loop-helix domains and related
DNA-binding motifs(12, 23, 24). Virus integration can disrupt the normal
chromosomal locus and cause overexpression of c-myc(5, 22, 39). The expression
of c-myc is a feature of proliferating cells of many lineages. Induction of its
expression by viral insertion predisposes tissues of diverse origin to
tumorigenesis process.(18) Actually, a significant and fundamental role of c-myc
in feline thymic lymphomas was revealed by the capacity of the
2
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
Myc-transducing viruses to rapidly induce the disease (12 to 14 weeks) after
inoculation into neonatal cats(ll).
flvi-1 has been recognized as a common integration site since 1990(10), but no
evidence showing that flvi-1 can influence the proto-oncogene adjacent to it has
been provided.
By examining the sites of proviral insertion in FeLN-myc virus-induced tumors,
two common insertion loci were determined. One of them is flvi-2(\3), which
was subsequently proven to be the feline homologue of bm i-l(\3-\5, 39), a
mye-collaborating gene previously identified as a common proviral insertion site
in B-cell lymphomas of myc transgenic mice (Eju-myc) infected with Moloney
murine leukemia virus (42).
The other is fit-1(42). It was initially identified as a common insertion site in
feline T-cell lymphomas induced by strains carrying a transduced v-myc gene,
suggesting that this locus harbors a gene that collaborates with myc in T-cell
neoplasia. This locus was mapped to feline chromosome B2, which carries
several known oncogenes including pim-1 and MYB(40). Restriction mapping
indicated that fit-1 has no close linkages to these genes, and the northern blot
analysis of RNA from tumors rearranged at fit-1 revealed no evidence of
long-range activation(2, 40). Recently, fit-1 has been shown to be closely linked
to approximately 100 kb upstream of MYB in the human genome(2). Another
known myc-collaborating gene, pim-1, also placed in chromosome B2, was
discovered to be a common FeLV proviral insertion position in a lower number of
field cases and FeLV-wyc-induced lymphomas. Flowever, RNA analysis showed
3
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
no evidence of long-range activation of pim-1 in tumors (39).
1.4 Methods for searching common retroviral integration sites
Traditionally, the approach for identifying such genes has involved the inefficient
processes of generating phage libraries of tumor DNA, containing
provirus-linked subffagments, and labor-intensive drill of cloning and sequencing
of DNA adjacent to the proviral sequences, followed by Southern blot to identify
which integration sites are common among various independently derived tumors.
Although inverse PCR (IPCR) (16, 37, 38, 41)was used to improve the processes
recently, this technique is still not very efficient and not applicable to large inserts.
Lately, fluorescent in situ hybridization (FISH) was also employed to detect
chromosomal proviral insertions such as Murine Leukemia Virus (MLV)(1),
human T-cell leukemia virus type 1(25), and FeLV(6), but the innate low
resolution of this method can identify only the approximate positions of proviral
integration and is not applicable to obtain flanking fragments. Here we describe a
simplified genome walking scheme that can be used for recognizing the cellular
DNA sequences adjacent to an integrated provirus
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
II. MATERIAL AND METHODS
2.1 Material
2.1.1 Cell lines
Three feline T-lymphoma cell lines, FT-1, FL74 and 3201B, and one normal
fibroblast cell line, H927, were used to examine the mRNA expression levels of
NGX6 and DNA rearrangements in the area nearby feline NGX6. FT-1 was
established from a spontaneous thymic lymphoma, while FL74 is a laboratory
cell line form experimentally induced lymphoma. 3201B was derived from feline
T-lymphoma, and H927 was established from feline fetal fibroblasts.
2.1.2 Genomic DNA samples
For detecting DNA rearrangements, genomic DNAs were extracted from three
feline placentas from FeLV-free cats and forty tumor samples. Feline placentas
were used as the source of normal feline DNA. Twenty nine of forty tumor
samples were from Japan, and these tumors were present in cats which were
naturally infected by FeLV. The others were experimental cases induced by FeLV
inoculation. DNA samples (No: 5022, 5023, and 5051) isolated from
experimental feline lymphoma induced by inoculation of a cloned FeLV viral
DNA were specifically used to explore novel FeLV common integration sites.
2.2 Methods
The sequences of all primers used in this study are shown in Table 1.
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
Name Sequence (5’ to 3’)
NuRB62 GTAATACGACTCACTATAGGGC
NuH20R AACCCTGGTCAACTGGGGAGCCTGGAGA
NuRB62L GGTGCCATTTCACAAGGCATGGAAAATTAC
NuH20L TCTCCAGGCTCCCCAGTTGACCAGGGTT
API GTAATACGACTCACTATAGGGGC
AP2 ACTATAGGGC ACGCGT GGT
N6RG-3I CACACTTCTGCTCTGCCTGA
N6RG-30 C AGAT GCGCTC ACTTAT GGA
N6RG-5I AGGCATCCGAACACTGTCAC
N5RG-50 TCCATAAGTGAGCGCATCTG
515GP1F TCAAGAGTCAACAGTAAAGG
515GP1R AGTTAGTCGGGTTTGAGGGA
B-actin-5’ C ACGGC ATT GTAACC AACT G
B-actin-3 ’ AGGGCAACATAGCACAGCTT
Table 1 Sequences of primers used in this study.
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
2.2.1 Genome walking
This method is for finding unknown genomic DNA sequences adjacent to a
known sequence(36). The genomic DNAs (2.5 ug) extracted from lymphomas
were digested with a restriction enzyme at 37 °C. After overnight reaction,
Klenow (DNA polymerase I) was used to fill in both sticky ends at 37°C for one
hour. Samples were purified by phenol/chloroform extraction followed by alcohol
precipitation in the presence of 20 ug of glycogen. Afterward, 20 ul of TE buffer
was used to dissolve the pellets. From each tube, purified DNA (4 ul) was
transferred to a tube containing Genome Walker Adaptor (Invitrogen), 10X
ligation Buffer, and T4 DNA ligase. The reactions were incubated at 16°C
overnight, and TE buffer (72 ul) were added into each tube.
For amplifying the 5’-flanking genomic DNA fragments outside proviral
insertions, primers NuH2QR and API were used in the primary PCR, and primers
NuRB62 and AP2 were used in the secondary PCR. Moreover, for amplifying the
3’-flanking genomic DNA fragments outside proviral insertions, primers
NuRB62L and API were used in the primary PCR, and primers NuH20L and AP2
were used in the secondary PCR (Fig. 1). Touchdown PCR and Nested PCR
techniques were used to reduce the background and nonspecific amplification
products. Touchdown PCR involves using an annealing/extension temperature
that is several degrees higher then the Tm of the primers during the initial PCR
cycles. The initial annealing temperature used for the first PCR cycle was 72 °C,
then gradually decreased one degree per cycle until 68 °C, which is the ideal
extension temperature for DNA polymerase. In every cycle, the denaturing
temperature was 94 °C for 30 sec, as well as the annealing and elongation
7
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
mQ M T T C
“ c t t m q "
M T i C „
G
E § L Y
*
' ' A +
M GAATTC
CTTAAG
S
"C T T A A
EcoRI digests
genome DNA
fills in
the stick ends
A P1
AP2
I
M T T C
AATTG ‘
U3
GTTAA |
’ C T T A A I
Adaptor Adaptor
NuRB62L
U3
NuH20R
NuH20L
U3 U3
NuRB62
with Adaptors
Primary PCR
A P 1
Secondary PCR
AP2
Figure 1 Genome Walking procedure in this study. Genomic DNA was digested
with EcoRl and then filled in sticky ends using Klenow. After ligated with
Adaptor, different primers located on U3 region of FeLV proviral LTR are
utilized to amplify 5’or 3’ flanking fragments of proviral insertions in Nested
PCR.
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
temperature was 68 °C for 20 min. The product of primary PCR, after 50 times
dilution, was used as the template of the secondary PCR. The reaction cycles
performed in the PCR were 32 for the primary, and 20 for the secondary PCR.
Elongase Enzyme Mix (Invitrogen) was used in PCR reaction as the DNA
polymerase.
2.2.2 Cloning
After electrophoresis of products of the PCR reactions in 1.5% agarose gel,
DNAs from several bright and clear bands were purified from the gel using Gel
extraction kit (Qiagen). These DNA fragments were then ligated into TA cloning
vector pCR2.1 (Invitrogen). Reactions were incubated at 14 °C for at least 16 hr.
The products were then transformed into Top 10 competent cells (Invitrogen) and
separated on LB agar plate containing X-gal and ampicillin (50 ug/ml). Plasmids
from white colonies were extracted, and EcoRI digestion was used to select for
colonies with the correct insert. The selected plasmids were sent to sequence with
either M13reverse or M13forward primers.
2.2.4 Blast searching
The sequences of the fragments obtained by Genome Walking were then input to
NCBI blast search, (http://www.ncbi.nlm.nih.gov/BLAST/). Discontiguous
BLAST and Nucleotide-nucleotide BLAST methods were used to obtain the
homologous sequence. Due to the lack of complete feline genome database,
human, mouse, and rat genome databases were used to identify homologous
regions among species.
9
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
2.2.5 RNA isolation
RNA was extracted from tumor tissues or cultured cells by using
RNAqueous-4PCR from Ambion, and then stored in -80 °C.
2.2.6 First-Strand cDNA synthesis
Total RNA (2 to5 ug) was mixed with 50 ng of random hexamers, 1 ul of 10 mM
dNTP, and DEPC-treated buffer in a RNAse-free tube at a total volume of 10 ul.
The tube was incubated at 65 °C for 5 min and then placed on ice for at least 1
min. RNase inhibitor (40U), Superscript III RT (200U), 2 ul of 10X RT buffer, 4
ul of 25 mM MgCE and 2 ul of 0.1 M DTT were then added to the tube, and
incubated at 25 °C for 10 min, followed by 50 °C for 50 min. To terminate the
reaction, the tube was placed at 85 °C for 5 min. Finally, lul of RNase H was
added to this tube and incubated at 37 °C for 20 min. Random hexamers,
Superscript III RT, RNase inhibitor, buffer and RNaseH were provided in the
Superscript II first-Strand Systhesis System from Invitrogen.
2.2.7 RNA Ligase M ediated Rapid Amplication
RACE is a polymerase chain reaction-based technique that facilitates the cloning
of full-length cDNA sequence when only a partial cDNA sequence is available.
Ambion’s FirstChoice RLM-RACE kit was used in this study to smooth the
process of getting the 5’ and 3’ end of cDNA sequence of feline NGX6.
RLM-RACE is abbreviated from of cDNA ends. Total RNA was treated with Calf
Intestine Alkaline Phosphatase (CIP) to remove free 5’-phosphates from
molecules such as ribosomal RNA, fragmented mRNA, tRNA, and
contaminating genomic DNA. The cap structure found on intact 5’ends of
10
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
mRNA was not affected by CIP. The RNA was then treated with Tobacco Acid
Pyrophosphatase (TAP) to remove the cap structure from full-length mRNA,
leaving a 5 ’monophosphate. A RNA adaptor was ligated to the RNA population
using T4 RNA ligase. The adaptor could not be linked to dephosphorylated RNA
since these RNAs lack the 5’phosphate necessary for ligation. In the ligation
reaction, the majority of the full length decapped mRNA acquired the adapter
sequence as its 5’end. A random-primed reverse transcription reaction and nested
PCR then amplified the 5’end of the transcript of feline NGX6. RLM-RACE was
used to amplify and clone the sequence also at the 3’end. First strand cDNA was
synthesized from total RNA, using the 3’RACE adopter. The cDNA was then
subjected to PCR using one of the 3’RACE primers that are complimentary to the
anchored adapter, and a primer for feline NGX6. The secondary PCR then
amplified the 3’end of the transcript of feline NGX6. The PCR condition was 94
°C for 3 min, followed by 94 °C for 30 sec, 60 °C for 30 sec, and 68 °C for 3 min,
35 cycles in both primary and secondary RLM-RACE PCR procedures. Elongase
Enzyme Mix (Invitrogen) was used to reduce the risk of base pair mismatch.
2.2.8 Genomic DNA isolation
Genomic DNAs were extracted from small pieces of tumor tissues or a collection
of cultured cells. The tissue was grinded in liquid nitrogen. Soon afterward, the
tissue powder was placed in 15 ml tube and mixed with 7 ml of lysis buffer (10
mM Tris.Cl pH8.0, 0.1 M EDTApH 8.0, 0.5% SDS) and 700 ug of Proteinase K.
For cells, the lysis buffer was used directly to lyse the cells. The tube was
incubated at 55 °C for overnight. Following lysis, the DNA was extracted by
phenol/chloroform purification method. One volume isopropanol and 1/10
1 1
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
volume of 3M NaOAC (pH 5.2) were used to precipitate genomic DNA. The
DNA pallet was washed with 70% alcohol, air dried and then dissolved in 1 to 2
ml TE buffer.
2.2.9 Probe labeling
DNA fragment (100 ng) was mixed with buffer and nuclease free water in a
1.5ml tube until the total volume equaled to 40 ul. The tube was incubated at 100
°C for 10 min. dATP, dTTP, dGTP, p32-labeled dCTP, and 10 unit of Klenow
were added into the tube. The reaction was incubated at 37 °C for 15 min.
Afterward lul of 0.5M EDTA (pH 8.0) was used to stop this reaction. The
solution was purified via ProbeQuant G-50 Micro columns (Amersham) to
remove unlabeled p32-dCTP and fragments that are smaller than lOnt.
2.2.10 Southern Blot Hybridrization
High-molecular-weight cellular DNAs extracted from tumors or cell lines were
analyzed by Southern blot hybridization to detect the abnormalities adjacent to
feline NGX6 gene. DNAs were first digested by restriction enzymes and then
subjected to electrophoresis in 0.7% agarose gel. Transfer to positive charge
nylon membranes was done for overnight using alkaline transferring buffer (0.4
N NaOH and 1 M NaCl) and neutralized by Neutralization buffer (0.5 M Tris.Cl
pH 7.2 and 1 M NaCl). The membranes were then prehybridized with 15 ml
Amersham Rapid-hyb buffer for 30 min at 65 °C. 3 2 P-labelled DNA probe and
100 mg of sonicated salmon sperm DNA were mixed together, heated for 5 min at
100 °C, and then added into the reaction buffer after prehybridization. For 1 ml of
hybridization buffer, 1 x 106 cpm of probe was added. After 18hr hybridization,
12
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
the membranes were washed with washing solution I (2X SSC, 0.1% SDS) at 36
°C for 10 min and washing solution II (IX SSC, 0.1% SDS) at 65 °C for 10 min.
Next, washing solution III (0.5X SSC, 0.1% SDS) was used to soak the
membranes at 65 °C for 5 min and exposed to X-ray films at -80 °C overnight.
In order to reprobe the membranes with other DNA probes, stripping is necessary.
Membranes were treated with 50ml of 0.4 N NaOH at 42 °C for 30 min.
Subsequently, the membranes were treated with washing solution (0.1X SSC,
0.1% SDS and 0.2 M Tris.Cl pH7.6) at 42 °C for 30 min. After the stripping
process, membranes were reused for probe hybridization.
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
III. RESULTS
3.1 Genome Walking identified several integration sites.
In this study, Genome Walking method was used to search for FeLV integration
sites in three thymic lymphomas: No. 5022, 5023 and 5051, which were induced
by FeLV experiments in cats. In order to generate DNA libraries, genomic DNAs
extracted from these samples were digested with EcoRI. Nested PCR and
touchdown PCR were employed to reduce the number of non-specific bands, and
the concentration of Mg2+ in PCR reaction was also adjusted for different tumor
libraries to help increase the intensity of bands.
The DNA fragments obtained from PCR reactions were cloned, sequenced and
then sent to BLAST web sites to search for homologys. Since the genomic
database of Feline has not been completed yet, these sequences were compared
with known vertebrate databases, such as human or mouse, in BLAST. When a
sequence has matches, it was sent to individual database to identify its location.
Although several DNA fragments could not be evaluated or were identified as
FeLV pro viruses, others were found to be in or around some known common
integration sites, or some previously unimplicated sites.
DNA fragments obtained from sample 5022 include a 1.5 kb DNA fragment from
the 5’-flanking region of a proviral insertion and a 0.7 kb DNA fragment from the
3’-flanking region both which indicate a proviral insertion next to flvi-2 (Fig. 2).
A 0.3kb DNA fragment of a proviral insertion from 5023 was found inside c-myc
(Fig. 3). With 5051, a 0.9 kb DNA fragment was found to be fit-1 (Fig. 4).
14
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
Kb M 5‘ end M 3‘ end
0.9 K
SLC17A1
Figure 2 Fragments amplified from feline lymphoma No. 5022 by Genome
walking. A 0.9 kb fragment obtained from the 3’flanking regions of proviral
insertions has a homology to SLC17A1 gene (Sodium Phosphate Cotransporter,
member 1) mapped on human chromosome 6p23. Both the 1.5 kb fragment from
the 5’flanking region and the 0.7 kb fragment from the 3’flanking regions of
proviral insertions were indicated to a provirus next to flvi-2. (M: 1 kb ladder
from Invitrogen; 5’end: the 5’flanking fragments of proviral insertions; 3’end: the
3’flanking fragments of proviral insertions).
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
0.6 K
* (15q26)
U - 0.3 K
c-myc
I I
• * — 1.1 K
AML-1
M m
Figure 3 Fragments amplified from feline lymphoma No. 5023 by Genome
walking. A 0.3 kb fragment obtained from the 5’flanking regions of pro viral
insertions was found inside c-myc. A 0.6 kb fragment in the 5’flanking region of a
proviral insertion has a homology to human chromosome 15q25, and a 1.1 kb
fragment in the 3’flanking region of a proviral insertion has a homology to AML1
gene. (M: 1 kb ladder from Invitrogen; 5’end: the 5’flanking fragments of
proviral insertions; 3’end: the 3’flanking fragments of proviral insertions).
16
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
Kb M 5‘ end M 3 * end
0.6 K
NGX6
Figure 4 Fragments amplified form feline lymphoma No. 5051 by Genome
walking. A 0.9 kb fragment from the 3’flanking region of a proviral insertion was
evaluated to be nearby fit-1. The 1.6 kb fragment obtained from the 5’flanking
region and the 0.8 k fragment obtained from the 3’flanking region were found to
have homologys to human chromosome 22, but their relationship is not clear yet.
A 0.6 kb fragments has a homology to the upstream of human NGX6 gene. (M: 1
kb ladder from Invitrogen; 5’end: the 5’flanking fragments of proviral insertions;
3’end: the 3’flanking fragments of proviral insertions).
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
A 0.9kb DNA fragment located the 3’-flanking region of a proviral insertion in
5022 showed homology to SLCJ7A1, which is in human chromosome 6p23.
Another 0.6kb fragment of the 5’-flanking region of a proviral insertion in 5023
has a homology to human chromosome 15q26 where no genes are close by. Two
bands (1.6 kb and 0.8kb) from 5051 were found to have homologys to human
chromosome 22, but the relationship between them is not clear yet.
Most interestingly, Genome walking revealed two potential loci; (1) a 1.1 kb
DNA fragment was found to be inside AML1 (Fig. 3), a region previously
described to be involved in human lymphomas. (2) A 0.6 kb DNA fragment was
identified as locating in the upstream of NGX6 (Fig. 4), a tumor suppressor gene
which has been known to be down-regulated in human nasopharyngeal
carcinomas (NPC) and colorectal carcinomas.
3.2 Further analyses of the flanking sequences identified A m ll and NGX6
sites.
From the cases analyzed, two integration sites were of interest: one is within
AML1 gene, and the other one is proximal to NGX-6 gene. Gene AML1 encodes a
DNA-binding alpha subunit of the heterodimeric core-binding factor which is
expressed in a variety of myeloid and lymphoid lineages. The AML1 gene is a
frequent mutational target in human leukemia, where a wide spectrum of
chromosomal translocations result in truncation and fusion of AML1 to other
proteins(4, 26). AML1 also has been identified as a common integration site of
MLV(16). The BLAST search found hits in the first intron of AML1, which is at
21q22.3 in human genome, and this clone was named 233-4.21. Though the real
18
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
situation in feline genome is not yet known, it may be similar to human, because
of the similarity among human, rat, and mouse in this area (Fig. 5). NGX6 is a
novel tumor suppressor gene discovered from NPC in 1999(17, 43). The flanking
fragment close to NGX6 gene is named 515-2.14, because this DNA fragment is
outside the 5’end LTR of FeLV provirus in tumor 5051. The fragment showed
homology to a position at 9pl3.3 in human, located between HINT2 and
C9orfl27, also known as NGX6. HINT2 encodes a histidine triad nucleotide
binding protein. Though the hit is close to HINT2 in human genome, the distance
between these two genes is shorter in mouse and rat than in human. Therefore,
this provirus will have potential influence on NGX6 (Fig. 6).
3.3 RNA expression analyses revealed alteration of NGX6 expression in
tumor cells and in tumors
The provirus usually influences RNA expression level of genes around its
insertion locus. Therefore, the RNA expression levels of feline NGX6 were
examined before testing DNA rearrangements. We used RT-PCR to analyze
mRNA expression. Because feline NGX6 cDNA sequence has not yet been
published, two primers, NGX6-2R and NGX6-2F, were chosen from the
conserved region of the NGX6 gene sequences between human and rat. While
using the H927 cDNA as the template, a DNA fragment in length of 678bp was
amplified by PCR. This fragment was named NGX6-3. Thereupon we used
RT-PCR and these two primers to examine the NGX6 gene expression levels
inside H927, 3201B, FL74, FT-1 cells and 9 lymphoma samples. The results
showed that NGX6 expression varied between cell lines. For examples, in 3201B
expression was less then in FL74 cells, and there was almost no detectable
19
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
(A )
Color Key for Rlignnenb Scores
1.6519
'ado' 1 ' 'X ' T T " r
r-p— , r ~
6 100 goo
(B )
Rat
M
m u f
21q223
j l m .
Jg
i
Blast hit f
Figure 5 BLAST-search results of clone 233-4.21. (A) The distribution of 2
Blast hits on the query sequence. The arrow denotes the homologous hit, which is
part of a human 959 kb contig (Genbank accession No. AJ229043). (B) This
homology (blast hit) is inside the first intron of AML1 gene mapped on human
20
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
chromosome 21q22.3. The arrow of the blast hit shows the orientation of the
integrated provirus (5’->35 ). Here also demonstrates the orientations of AML1 in
different species.
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
(A)
Color Key for Bllgnnent Scores
1. 20171b
50 100 150 200 250 300 350 400
(B)
Mouse Rat Human
" t -
; i
}. i
t "
j?
V *
; * . ■ < w
. t \ r
t t -
$ * * * « « * .<
*
j*
m-tm*
• ' -
■
L
* *
i
1
l& sj > * H
a n < 5 * 21*12
STAGS < % I1 3
HSKT2 1 9p 1 .3.3
I M M f
5± c£.27 i 9*13.3
N o r n
Figure 6 BLAST-search results of clone 515-2.14. (A) The distribution of 9
Blast hits on the query sequence. The arrows denote the homologous hits with the
highest scores. Hit no.l is part of a human DNA sequence (Genbank accession
No. AF334830); hit no.2 is part of a human sequence (Genbank accession No.
22
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
BX648702); hit no.3 is part of a human DNA clone (RP11-112J3). All of them
are indicated to the same locus. (B) This locus (blast hit) is between HINT2 and
C9orfl27/AGA6 mapped on human chromosome 9p 13.3. The arrow of the blast
hit shows the orientation of the integrated provirus (5’->3’). Here also
demonstrates the orientations of genes in different species. (NPR2: natriuretic
peptide receptor B; SPAG8: sperm associated antigen 8; HINT2: histidine triad
nucleotide binding protein 2; C9orfl27: Chromosome 9 open reading frame 127).
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
expression in FT-1 cells. Six out of these lymphomas provided RNA of satisfying
quality, and two (No. 5022 and 5024) of the six lymphomas have almost no
detectable NGX6 expression. In this analysis, beta-actin was utilized as the
control using primers B-actin-5’ and B-actin-3 ’ (Fig. 7).
After NGX6-3 was sequenced, four new primers were designed based on its
sequence data: N6RG-50, N6RG-5I, N6RG-30, and N6RG-3I. These primers
were subsequently utilized in RLM-RACE to clone the two ends of NGX6 cDNA.
The 5’end fragment of NGX6 cDNA is named 5’-l, and 3 ’end fragment is named
3’-l (Fig. 8). The large sequence of feline NGX6 cDNA (1745 bp) was assembled
from these three fragments (Fig. 9).
3.4 Southern Blot hybridization
In order to understand whether the area nearby NGX6 is a FeLV common
integration site, we performed Southern blot hybridization to verify the DNA
rearrangements in tumors. Four probes were used to investigate this locus,
including a genome probe 515#1, and three NGX6 cDNA fragments: 5’-l,
NGX6-3, and 3’-l. The genome probe, which was amplified with two primers
(515GP1F and 515GP1R) from 515-2.14, does not contain any vector or FeLV
LTR sequences.
The genomic DNAs extracted from 3 placentas, 4 cell lines, and 29 FeLV induced
tumors from Japan were digested with BamHl, Hindlll, or Hindlll + EcoRl and
then hybridized with 515#1 respectively. The samples digested with BamHl
showed only one band that is bigger than 23 kb (Fig. 10), which is too big to
24
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
Cel lines Tumors
320IB
NGX6
Figure 7 The feline NGX6 expression results by RT-PCR. NGX6 mRNA
expressions were almost no detectable in the two cell lines (3201B and FT-1) and
two tumors ( No. 5022 and 5024) by RT-PCR analysis. Because tumor tissues
have been stored in -80°C for many years, three of them cannot provide RNAs of
satisfying quality.
25
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
K b M 5s end 3‘ end
f l H r
Figure 8 Feline NGX6 cDNA fragments amplified by RLM-RACE. The 5’ and
3 ’ ends of feline NGX6 cDNA fragments were amplified from NGX6-3 clone by
RLM-RACE. One 0.8 kb fragment was obtained by using 5’RLM-RACE, and
three fragments were obtained by using 3’RLM-RACE. These fragments were
cloned and sequenced. The three 3’ fragments have the same sequence, but with
different length. (M: 1 kb ladder from Invitrogen).
26
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
(A)
Clones
Fragm ents
5' ■ ■
5‘-l
7 6 7 ks
NGX6-3
678 fep
3‘-l
658 tyj
N G X 6 c I M A 1745 hp
3'
(B)
1 CTGGTTATCG CCGGTCCAGC GCAGCCCGGA GTCGCCCAGG CCTGAACTCC
51 TACCCAGGTC CCGGGCCTGG CCTCAGCCGG CCCGACCCCA GCCCCGGGCC
101 CACAAGGACA CCGAAAGCCA CCCCCCGGGG GTGGGGAGCG GAGCCGTGGC
1 5 1 CTCGACTCAG GTCTGGGCTC CAGCTGCCGC CCGCCTTATT GCTGCTGTTG
2 0 1 CTGTTCTCTG TCCTTGGCCC AGGGGCTGGG TCTCCAGGAT GAGTGTCAGT
2 5 1 ACCTCCTTCA GCCGCAGCTG ATTGTCCGGC GTTTGCTGGA TGTTGCTGTG
3 01 CTGGTGCCTG GCCGTCCCTC AGAGCAAACC CTCTCCCCGC ACAATCGCTC
3 5 1 AGCCCTGTAC AAAGTGCCCG CAGCCCAGCC TGTCCCGTGT CCTGGTCCCT
4 0 1 GGAGCTGCCA TGAACATGCC CCAGTCACTG GGCAACCAAC CACTGCCCCC
4 5 1 AGAGCCGCCA TCCCTGGGGG CCTCTCCTGA GGGGCCTGGG GCCACATCTC
5 0 1 CACCAGAGCA CTGCTGGCCA GTGCGCCCAA CGCTGCGTAA TGAACTGGAT
5 5 1 ACCTTCTCTG TCCACTTCTA CATCTTCTTT GGCCCGAGCG TGGCCCTCCC
6 0 1 CCCTGAGCGC CCGGCAGTGT TTGCCCTGAG GCTGCTGCCA GTGCTGGAGA
6 5 1 GTGGGGGCGT CCTCAGCCTG GAGCTCCAGC TCAATGTGAG CTCCCTGQGC
7 0 1 CAGGAAAACG TGACAGTGTT CGGATGCCTG ACTCACGAGG TGCCCTTGAG
7 5 1 CCTGGGGGAT GCAGCAGTGA CCTGTTCTAA AGAGTCCCTG GCTGGCTTCC
8 0 1 TCCTCTCCGT CAGTGCCACT TCCAGAGTGG CCAGGCTGCG AATCCCCTTC
8 5 1 CCACAGACTG GGACCTGGTT CCTGACCCTC CGCTCTCTGT GCGGCGTGGG
9 0 1 GCCTCGGTAC GTGCGGTGGC GGAACGCGAC GGCTGAGGTG CGGCTGCGCA
9 5 1 CTTTCCTGTC CCCTTGCGTG GACGACTGCG GGCCCTATGG CCAGTGCAAG
1 0 0 1 CTGCTGCGCA CGCACAACTA CCTGTACGCG GCCTGCGAGT GCAAGGCCGG
1 0 5 1 GTGGAGGGGC TGGGGCTGCA CTGACAGTGC AGNTGCGCTC ACTTATGGAT
1 1 0 1 TCCAGCTGCT GTCCACACTT CTGCTCTGCC TGACACACTT CTGCTCTGCC
1 1 5 1 TGAGCAACCT DATGTTTTTG CCACCCGTGG TCCTGGCCAT TCGGAGCCGA
1 2 0 1 TATGTGCTGG AGGCTGCTGT CTACACCTTC ACCATGTTCT TCTCCACGGT
1 2 5 1 ATGCGGTGCA TCTGTGTCTT CACCAAGTCC TTATTTCATG GTGATGGGCG
1 3 0 1 AGGGTCTGCA TTTCCACCGT GTTTTCCACG GATGTGGGGA TGTCTACACC
1 3 5 1 TTCATCATAT GAGGATGTCT CCTTTTCAAC GATGTCTTCT ACAGCAGTGT
1 4 0 1 CATGGCATGC GAAGACTATA GTAATTTTTG TAAGGCACAT TGGGATAAAT
1 4 5 1 TAACAAGGCC GTTTGTAACT TAAGATAAGC AACAGCCACT AGAAACAGTG
1 5 0 1 TGTTCTCCAG CTGTGTCACA CCCCAGGGGC CAAGGAGACC TTTACTTAAA
1 5 5 1 CACCCTGGCT GTTTTATGGT ATGGAACGGT GTCCACAGCT TCACCTTTCC
1 6 0 1 ACTCTGAACG GTGGCAAGGG ATCTGCACTT TCTCCCATGT CTCTGTACGG
1 6 5 1 AGTCTCCACT TCTCATGATG TGAGGGCTAG GTACACTGTG TTCATGTTCC
1 7 0 1 TCATTGTCCT GGGGACTTGT GCATGTTCAA CATGTTCTTA TGGTA
Figure 9 The large Feline NGX6 cDNA fragment. (A) This cDNA (1745 1
was assembled from three clones. (B) Sequence of Feline NGX6 cDNA.
27
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
Japanese Samples
P H927 1-1 2 5 6-1 8-1 9-2 10 11
23.1 kb~*
9.4 kb-*
6.5 kb— ►
23.1 kb-*.
I ■ ■ M M i
jPj|i§
Japanese Samples
1 2 14 16 17-2 20 22-1 22-4 23 24 25
Japanese Samples
27-1 28 29 30 33 36-1 36-2 39 40 41 45-2
23.1 kb-*
9,4 kb— *
n«sH
Figure 10 Southern blot hybridization of Urwiffl-digested normal and 29
Japanese tumor DNAs with 515#1 probe. A band larger than 23kb was shown in
every sample. ( P: placenta)
28
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
determine whether there is heterogeneity of bands. One fragment of 2.0 kb was
found in all Hindlll+EcoRl digested genomic DNAs (Fig. 11). Coincidently, all
normal Hindlll digested DNAs (n=4) revealed two fragments of 6.5 kb and 7.0
kb; on the contrary, only 37% of tumor Hindlll-digested DNAs (n=30) showed
this pattern (Fig. 12). When these Hindlll-digested genomic DNAs were reprobed
with 5’-l, a feline NGX6 cDNA probe, all samples showed a fragment of 6.0 kb
(Fig. 13).
The genomic DNAs from another set of nine tumors were examined also with the
DNAs form three placentas and cells from two cell lines, FL74 and FT-1. They
were digested with Pstl or EcoRl and probed with 515#1. The results of Pstl
digested DNAs showed two fragments of 2.0 kb and 2.5 kb in all normal placenta
DNAs. Two cell lines and most of the tumor samples (7 out of 9), however,
showed only the 2.0 kb band. When these Psil-digested genomic DNAs were
reprobed with three feline NGX6 cDNA probes, 5’-l, NGX6-3, and 3’-l, the
results were the same for normal and tumor samples (Fig. 14). When the genomic
DNAs were cut with EcoRl and then hybridized with 515#1, a 2.0 kb band was
shown in all samples (Fig. 15). It is possible that the two EcoRl cutting sites are
inside two Pstl sites in this region.
Interestingly, a different pattern was observed between normal and cancerous
tissues from the same animal. As shown in Figure 16, both 2.5 kb and 2.0 kb
fragments were detected in the normal sample, whereas only the 2.0 kb fragment
was present in the tumor samples (Fig. 16).
29
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
Japanese Samples
H927 1-1 2 5 6-1 8-1 9-2 11 10 12
6.5 kb-*-
2.3 kb-*- ^
2 - 0 k b ^ m i M U i r m i ' m . 1 , i H i-
Figure 11 Southern blot hybridization of Hindlll-EcoRl double digested normal
and 9 Japanese tumor DNAs with 515#! probe. A 2.0 kb band was shown in
every sample.
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
Placentas Ceil Lines
PQ 32481.......... H92? FL74
P0E0431 P0428 320IB FT-1
6.5 Kb— *.
mm
Japanese Sam ple
P H92?l-1 2 5 « 8-1 9 2 1, “ 12
6.5 kb” *
’ ***
6.5 kb~*
Japanese Samples
14 20 22-4 24
p i?_? ??. 95
Japanese Samples
16 30 36-1 39 41
HS27 27-1 33 36-2 40 45-2
6.5 kb-**
Figure 12 Southern blot hybridization of f?wJIII-digested DNA samples with
515#1 probe. Two bands (7.0 kb and 6.5 kb) were shown in all normal samples
(placentas and H927) and 11 out of 27 tumors. Three T-lymphoma cell lines and
15 tumors showed the 6.5 kb band. The rest of tumors presented the7.0 kb band.
(P: placenta)
31
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
Placenta Ceil lines
P0428 W 27 3201B FL74 FT-1
23.1
9.4 kb-*- ■ . .
6.5 k b -*
2.3 kb— *
.C -
2 .0 k b - * < :
Figure 13 Southern blot hybridization of Hindlll-digested placenta and cell line
DNAs with 515#1 probe. Only a 6.0kb fragment was hybridized. (DNAs from
placenta and H927 cells were used as the normal controls.)As probing with 515#1,
the approximate size difference between the two Mntdll-fragments of normal
DNAs is 0.5 kb, as same as the size difference between the two PM-fragments of
normal DNAs. Since the two patterns are similar, it is very possible that the two
bands shown in PM digested normal samples are part of the corresponding bands
in Hindlll digested normal samples. Therefore, when combining the results of
Southern blot hybridization of Hindlll and Pstl digested DNAs probed with
515#1, 100% of normal samples revealed two bands (n=5). Only a small number
(n=13) of the 40 tumors showed the
32
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
(A )
Placentas Cell lines Tamars
P0804S1 P0428 FT-1 4535 4539 5024 ™ 5036
P032481 FL74 3315 4545 5022 5035 5042
2
■ H M
2.0kts— * •
(B)
6.0 kb-*
2.3 kb— *
(C)
Placentas Cell lines Tumors
P080481 F0428 FT-1 4535 4539 . . . . 5024 5036
P032481 FL74 3315 4545 5022 5035 5042
2.3 kb-
Figure 14 Southern blot hybridization of PM-digested normal and tumor DNA
samples. (A) Samples were probed with 515#1. All placenta samples showed two
fragments of 2.5 kb and 2.0 kb. Tumor sample No. 4535 and 4539 also presented
the two fragments. Seven out of night tumors and the T-leukemia cell lines
showed only the 2.0 kb fragment. (B) Samples were reprobed with the feline
NGX6 5’ end cDNA fragment, 5’-l. Every sample showed two fragments of 2.3
kb and 6.0 kb. (C) Samples were hybridized with two probes, NGX6-3 and 3’-l,
at the same time. Only one fragment of 6.5 kb was presented in every sample.
33
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
Placentas C ell lines Tum ors
P080481 P G 4 2 8
P 032481
3 2 0 IB ,
Figure 15 Southern blot hybridization of Acoffl-digested DNA samples with
515#1 probe. Only band was shown at 2.0 kb in every sample. (DNAs from
placentas and H927 cells were used as the normal controls.)
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
2.0 kb-i* •
Figure 16 Southern blot hybridization of PM-digested genomic DNAs from cat
3641. This result presented the difference of the genomic DNAs extracted from
the normal liver and the FeLV positive lymphoma of cat 3641. Samples were
digested with Pstl and probed with 515#1. (N: the normal liver; T: the FeLV
positive lymphoma.)
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
normal pattern (32.5%); in the rest of them (n=27), the incidence of the presence
of the smaller fragment is 85.2%, and the rate of the larger fragment is 14.8%.
The larger fragment seems to be frequently lost in tumor samples.
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
IV. DISCUSSIONS
4.1 The novel utility of Genome Walking in identifying retroviral integration
sites.
In our study, this procedure easily identified three of the five known FeLV
common integration sites. Because it is sequence based, other aspects of virus
integration can be analyzed at the same time, for example, the insertional
direction and exact position of the FeLV proviral insertion. Genome Walking has
been previously used to study HIV integration hot spots in cell lines(32).
However, ours is the first attempt to extend the principle of the method to identify
retroviral integration sites in tumor tissues.
Proviral insertional sites uncovered form different tumor samples can be
compared with each other for potential common integration events, or sent to
BLAST search for locus identification. Without a complete feline genomic
sequence database, it is, however, difficult to evaluate and match all of the
fragments generated from this method. So far, we have relied on other
mammalian sequence databases.
When combining Genome Walking with DNA mapping, numerous tumor
samples could be checked at the same time in a rapid manner. As an example, in
this study, the flanking fragment upstream of NGX6 gene, obtained form Genome
Walking, was used as a probe for DNA mapping to detect DNA rearrangements in
40 different samples of tumors and cell lines. Once determined to be a common
event, many questions can be asked, such as, is the gene truly involved in
37
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
tumorigenesis process? If so, what is its function? Is it linked to known cancer
pathways?
4.2 The adjoining region near feline NGX6 gene may be linked to
lymphomagenesis.
NGX6, located at 9pl3, the short arm of human chromosome 9, was discovered
as a tumor suppressor gene in human cancer. Since the loss of heterozygosity
(LOH) on this arm happened frequently in many cancers, this arm is thought to
contain multiple tumor suppressor genes. NGX6 was found to be located in the
minimal LOH region that was associated with NPC(43). The length of human
NGX6 cDNA (Genbank accession No. AF188239) is 2134bp, and the gene
encodes a putative protein of 338 amino acids. The putative NGX6 protein is
predicted to be a transmembrane protein including two transmembrane domains
and one EGF (epidermal growth factor)-like domain. It also has three potential
N-glycosylation sites and a tyrosine residue that is a potential phosphorylation
site by tyrosine kinases in the cytoplasmic region. The expression levels of NGX6
have been known to be high in normal nasopharyngeal epithelial tissues, but low
in nasopharynegeal carcinoma biopsies and cancerous cell lines. It is also shown
to be down-regulated in colorectal carcinomas(44). NGX6 has also been found to
regulate the expression of many proteins involved in cell cycles and oncogenic
pathways (17). Overexpression of NGX6 results in delaying the cell cycle Go-Gi
progression in NPC cells(19). Its mRNA expression levels have been inversely
correlated with NPC lymph node metastasis status(17, 19, 20, 44).
In our study, two hypotheses may explain how the different patterns between
38
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
normal and lymphoma samples can affect the expression level of feline NGX6.
(1) There are enhancers in the upstream of NGX6. (2) LOH of feline NGX6.
When probed with 515#1, all normal samples show two bands (2.5 kb and 2.0 kb
in Pstl digestion; 7.0 kb and 6.5 kb in Hindlll digestion). While in tumor samples,
only a small percentage of samples showed this pattern. Specifically, in the case
of cat 3641, the same two bands were detected in the normal liver sample; on the
contrary, only one band (2.0 kb) was seen in the tumor sample from the same
animal.
All the samples were probed again with 5’-l, NGX6-3, and 3 1 which are all
based on feline NGX6 cDNA sequence. There was no difference between normal
and tumor samples. The DNA mappings reveal that there are two EcoRl sites
outside the 515# 1-hybridized area, followed by two Pstl sites, and then two
Hindlll sites. Meanwhile, since the BamHl-fragment probed by 515#1 is more
than 23 kb, there should be two BamHl sites outside two Hindlll sites. The size
difference of the two fragments hybridized with probe 515#1 in normal samples
is about 0.5 kb, irrespective of whether the genomic DNA was digested with
Hindlll or Pstl, which suggests that the larger fragment would become the
smaller fragment when it loses 0.5 kb. The region which could be lost in the
larger //mcflll-fragment or PM-fragment might be placed between EcoRl and
Pstl sites (Fig. 17).
In 3201B and FT-1 cells and two tumors (No. 5022 and 5024), the expression
level of NGX6 was shown to be decreased compared with FL74 cells.
39
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
B .
J
B
7.0 kb
Larger fragments
2.5 kb
K-
2.0 kb
t
H
0.5 kb
J
516#1 \ /
v
t f 515#1 11
PE EP
2.0 kb
-a
2.0 kb
S.5 kb
I
Smaller fragments
Figure 17 Restriction enzyme sites on the two bands. E: EcoRl; P: Pstl; H:
Hindlll; B: BamHl. The distance between an EcoRl site and its adjacent Pstl site
is about 0.5 kb in the larger fragment, but it is approximately only few base pairs
in the smaller fragment. The genome probe 515# 1 is located inside two EcoRl
sites. Hindlll and Pstl sites are outside these two EcoRl sites, and two BamHl
sites are outside all the other restriction sites.
40
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
Hybridization of genomic DNAs from these samples with 515#1 only revealed
one band. Combined with the data of Southern blot hybridization using different
probes, this result indicated that the upstream region of NGX6 might be correlated
to tumorigenesis. Conceivably, the upstream region of feline NGX6 may play a
role as a regulating factor for feline NGX6, for examples, as enhancers.
According to the human gene map, the probe 515#1 has a homology to the 10 kb
upstream of human NGX6. Considering the relatively long distance between the
cDNA and the upstream region, 515#1 might be located in part of the enhancers.
More specifically, this locus might be within two repeats which have
approximately 0.5 kb size difference when digested with Hindlll. During the
cancer progression, one repeat may be lost, for example, from genomic instability
or sister chromatid recombinations. These repeats could enhance the RNA
expression of feline NGX6. Loss of one repeat would deprive the ability to
enhance or form a structural barrier leading to down- regulation of feline NGX6.
This contention remains to be tested by direct sequencing of the region.
Although genomic DNA extracted from FL74 cells showed only the lower
fragment, the NGX6 expression in FL74 is higher than in other T-lymphoma cells
as indicated by the RT-PCR analysis. The NGX6 expression in 3201B cells is also
not totally silent. The possibility could be: the rearrangement of this locus in
FL74 cells did not somehow compromise the enhancer function, potentially
because of varied DNA rearrangements in this region.
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
4.3 LOH of feline NGX6 leads to tumorigenesis
The results may also be interpreted to suggest two common alleles for NGX6
gene, one of which is lost during tumorigenesis. From our observations, the larger
band is more prone for loss than the small band. This result leads to the
hypothesis that the allele designated by the smaller band may already have
mutations or predisposed to mutations and thus more frequently selected in the
process of tumorgenesis through LOH. The product of the mutant allele may be
unstable. This can explain why there is no detectable expression of NGX6 in
some samples, such as, in FT-1 cell line and two feline lymphomas.
4.4 Future studies
To further establish the relationship between the upstream region of feline NGX6
and tumorigenesis process, a few experiments should be done. First, although this
study revealed the difference in the markers between normal tissues and tumors
in the upstream region of feline NGX6, the number of normal tissues tested is not
large enough to determine whether this two-bands phenomenon is caused by two
repeats or LOH. Hence more normal samples should be examined in Southern
blotting analysis, and normal feline T-cell lines should be used in RNA analyses
for examining the normal feline NGX6 expression levels. Secondly, since the
RT-PCR is not an accurate assay to quantitate the difference of mRNA expression
of feline NGX6 in cells or tumors, northern blot analysis is required for a more
quantitative assessment. Furthermore, the two Pstl-fragments of 2.0kb and 2.5kb
should be cloned and sequenced for a better understanding of the relation
between these fragments.
42
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
V. REFERENCE
1. Acar, H., N. G . Copeland, D. J. Gilbert, N. A. Jenkins, and D. A.
Largaespada. 2000. Detection of integrated murine leukemia viruses in a
mouse model of acute myeloid leukemia by fluorescence in situ
hybridization combined with tyramide signal amplification. Cancer Genet
Cytogenet 121:44-51.
2. Barr, N. I., M. Stewart, C. Tsatsanis, R. Fulton, M. Hu, H. Tsujimoto, and
J. C. Neil. 1999. The fit-1 common integration locus in human and mouse
is closely linked to MYB. Mamm Genome 10:556-9.
3. Chakrabarti, R., F. M. Hofman, R. Pandey, L. E. Mathes, and P.
Roy-Burman. 1994. Recombination between feline exogenous and
endogenous retroviral sequences generates tropism for cerebral
endothelial cells. Am J Pathol 144:348-58.
4. Downing, J. R., M. Higuchi, N. Lenny, and A. E. Yeoh. 2000. Alterations
of the AML1 transcription factor in human leukemia. Semin Cell Dev
Biol 11:347-60.
5. Forrest, D., D. Onions, G. Lees, and J. C. Neil. 1987. Altered structure and
expression of c-myc in feline T-cell tumours. Virology 158:194-205.
6. Fujino, Y., H. Satoh, M. Hisasue, K. Masuda, K. Ohno, and H. Tsujimoto.
2003. Detection of the integrated feline leukemia viruses in a cat
lymphoid tumor cell line by fluorescence in situ hybridization. J Hered
94:251-5.
7. Jarrett, O., W. D. Hardy, Jr., M. C. Golder, and D. Hay. 1978. The
frequency of occurrence of feline leukaemia virus subgroups in cats. Int J
Cancer 21:334-7.
8. Jarrett, W. F., E. M. Crawford, W. B. Martin, and F. Davie. 1964. A
Virus-Like Particle Associated with Leukemia (Lymphosarcoma). Nature
202:567-9.
43
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
9. Kumar, D. V., B. T. Berry, and P. Roy-Burman. 1989. Nucleotide
sequence and distinctive characteristics of the env gene of endogenous
feline leukemia pro virus. J Virol 63:2379-84.
10. Levesque, K. S., L. Bonham, and L. S. Levy. 1990. flvi-1, a common
integration domain of feline leukemia virus in naturally occurring
lymphomas of a particular type. J Virol 64:3455-62.
11. Levy, L. S., R. E. Fish, and G. B. Baskin. 1988. Tumorigenic potential of a
myc-containing strain of feline leukemia virus in vivo in domestic cats. J
Virol 62:4770-3.
12. Levy, L. S., M. B. Gardner, and J. W. Casey. 1984. Isolation of a feline
leukaemia provirus containing the oncogene myc from a feline
lymphosarcoma. Nature 308:853-6.
13. Levy, L. S., and P. A. Lobelle-Rich. 1992. Insertional mutagenesis of
flvi-2 in tumors induced by infection with LC-FeLV, a myc-containing
strain of feline leukemia virus. J Virol 66:2885-92.
14. Levy, L. S., P. A. Lobelle-Rich, and J. Overbaugh. 1993. flvi-2, a target of
retroviral insertional mutagenesis in feline thymic lymphosarcomas,
encodes bmi-1. Oncogene 8:1833-8.
15. Levy, L. S., P. A. Lobelle-Rich, J. Overbaugh, J. L. Abkowitz, R. Fulton,
and P. Roy-Burman. 1993. Coincident involvement of flvi-2, c-myc, and
novel env genes in natural and experimental lymphosarcomas induced by
feline leukemia virus. Virology 196:892-5.
16. Li, J., H. Shen, K. L. Flimmel, A. J. Dupuy, D. A. Largaespada, T.
Nakamura, J. D. Shaughnessy, Jr., N. A. Jenkins, and N. G. Copeland.
1999. Leukaemia disease genes: large-scale cloning and pathway
predictions. Nat Genet 23:348-53.
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
17. Li, J., C. Tan, Q. Xiang, X. Zhang, J. Ma, J. R. Wang, J. Yang, W. Li, S. R.
Shen, S. Liang, and G . Li. 2001. Proteomic detection of changes in protein
synthesis induced by NGX6 transfected in human nasopharyngeal
carcinoma cells. J Protein Chem 20:265-71.
18. Luscher, B., and R. N. Eisenman. 1990. New light on Myc and Myb. Part
I. Myc. Genes Dev 4:2025-35.
19. Ma, J., J. Li, J. Zhou, X. L. Li, K. Tang, M. Zhou, J. B. Yang, Q. Yan, S. R.
Shen, G. X. Hu, and G. Y. Li. 2002. Profiling genes differentially
expressed in NGX6 overexpressed nasopharyngeal carcinoma cells by
cDNA array. J Cancer Res Clin Oncol 128:683-90.
20. Ma, J., J. Zhou, S. Fan, L. Wang, X. Li, Q. Yan, M. Zhou, H. Liu, Q.
Zhang, H. Zhou, K. Gan, Z. Li, C. Peng, W. Xiong, C. Tan, S. Shen, J.
Yang, J. Li, and G. Li. 2004. Role of a novel EGF-like domain containing
gene NGX6 in cell adhesion modulation in nasopharyngeal carcinoma
cells. Carcinogenesis.
21. MacVean, D. W., A. W. Monlux, P. S. Anderson, Jr., S. L. Silberg, and J. F.
Roszel. 1978. Frequency of canine and feline tumors in a defined
population. Vet Pathol 15:700-15.
22. Miura, T., H. Tsujimoto, M. Fukasawa, T. Kodama, M. Shibuya, A.
Hasegawa, and M. Hayami. 1987. Structural abnormality and
over-expression of the myc gene in feline leukemias. Int J Cancer
40:564-9.
23. Mullins, J. I., D. S. Brody, R. C. Binari, Jr., and S. M. Cotter. 1984. Viral
transduction of c-myc gene in naturally occurring feline leukaemias.
Nature 308:856-8.
24. Neil, J. C., D. Hughes, R. McFarlane, N. M. Wilkie, D. E. Onions, G. Lees,
and O. Jarrett. 1984. Transduction and rearrangement of the myc gene by
feline leukaemia virus in naturally occurring T-cell leukaemias. Nature
308:814-20.
45
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
25. Ohshima, K., A. Ohgami, M. Matsuoka, K. Etoh, A. Utsunomiya, T.
Makino, M. Ishiguro, J. Suzumiya, and M. Kikuchi. 1998. Random
integration of HTLV-1 pro vims: increasing chromosomal instability.
Cancer Lett 132:203-12.
26. Okuda, T., J. van Deursen, S. W. Hiebert, G . Grosveld, and J. R. Downing.
1996. AML1, the target of multiple chromosomal translocations in human
leukemia, is essential for normal fetal liver hematopoiesis. Cell
84:321-30.
27. Pandey, R., A. K. Ghosh, D. V. Kumar, B. A. Bachman, D. Shibata, and P.
Roy-Burman. 1991. Recombination between feline leukemia vims
subgroup B or C and endogenous env elements alters the in vitro
biological activities of the viruses. J Virol 65:6495-508.
28. Riedel, N., E. A. Hoover, R. E. Domsife, and J. I. Mullins. 1988.
Pathogenic and host range determinants of the feline aplastic anemia
retrovirus. Proc Natl Acad Sci U S A 85:2758-62.
29. Riedel, N., E. A. Hoover, P. W. Gasper, M. O. Nicolson, and J. I. Mullins.
1986. Molecular analysis and pathogenesis of the feline aplastic anemia
retrovirus, feline leukemia vims C-Sarma. J Virol 60:242-50.
30. Sarma, P. S., and T. Log. 1973. Subgroup classification of feline leukemia
and sarcoma vimses by viral interference and neutralization tests.
Virology 54:160-9.
31. Sarma, P. S., and T. Log. 1971. Viral interference in feline
leukemia-sarcoma complex. Virology 44:252-8.
32. Schroder, A. R., P. Shinn, H. Chen, C. Berry, J. R. Ecker, and F. Bushman.
2002. HIV-1 integration in the human genome favors active genes and
local hotspots. Cell 110:521-9.
33. Sheets, R. L., R. Pandey, W. C. Jen, and P. Roy-Burman. 1993.
Recombinant feline leukemia vims genes detected in naturally occurring
feline lymphosarcomas. J Virol 67:3118-25.
46
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
34. Sheets, R. L., R. Pandey, V. Klement, C. K. Grant, and P. Roy-Burman.
1992. Biologically selected recombinants between feline leukemia virus
(FeLV) subgroup A and an endogenous FeLV element. Virology
190:849-55.
35. Shih, C. C., J. P. Stoye, and J. M. Coffin. 1988. Highly preferred targets
for retrovirus integration. Cell 53:531-7.
36. Siebert, P. D., A. Chenchik, D. E. Kellogg, K. A. Lukyanov, and S. A.
Lukyanov. 1995. An improved PCR method for walking in uncloned
genomic DNA. Nucleic Acids Res 23:1087-8.
37. Silver, J., and V. Keerikatte. 1989. Novel use of polymerase chain reaction
to amplify cellular DNA adjacent to an integrated provirus. J Virol
63:1924-8.
38. Sorensen, A. B., M. Duch, P. Jorgensen, and F. S. Pedersen. 1993.
Amplification and sequence analysis of DNA flanking integrated
proviruses by a simple two-step polymerase chain reaction method. J
Virol 67:7118-24.
39. Tsatsanis, C., R. Fulton, K. Nishigaki, H. Tsujimoto, L. Levy, A. Terry, D.
Spandidos, D. Onions, and J. C. Neil. 1994. Genetic determinants of
feline leukemia virus-induced lymphoid tumors: patterns of proviral
insertion and gene rearrangement. J Virol 68:8296-303.
40. Tsujimoto, H., R. Fulton, K. Nishigaki, Y . Matsumoto, A. Hasegawa, A.
Tsujimoto, S. Cevario, S. J. O'Brien, A. Terry, and D. Onions. 1993. A
common proviral integration region, fit-1, in T-cell tumors induced by
myc-containing feline leukemia viruses. Virology 196:845-8.
41. Valk, P. J., M. Joosten, Y. Vankan, B. Lowenberg, and R. Delwel. 1997. A
rapid RT-PCR based method to isolate complementary DNA fragments
flanking retrovirus integration sites. Nucleic Acids Res 25:4419-21.
47
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
42. van Lohuizen, M., S. Verbeek, B. Scheijen, E. Wientjens, H. van der
Gulden, and A. Berns. 1991. Identification of cooperating oncogenes in E
mu-myc transgenic mice by provirus tagging. Cell 65:737-52.
43. Yang, J., X. Tang, and L. Deng. 1999. [Detailed deletion mapping of
chromosome 9p21-22 in nasopharyngeal carcinoma], Zhonghua Zhong
Liu Za Zhi 21:419-21.
44. Zhang, X. M., X. Y. Wang, S. R. Sheng, J. R. Wang, and J. Li. 2003.
Expression of tumor related genes NGX6, NAG-7, BRD7 in gastric and
colorectal cancer. World J Gastroenterol 9:1729-33.
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.

Linked assets

University of Southern California Dissertations and Theses

Conceptually similar

PDF

A coactivator complex among GRIP1, CARM1, and TIF1alpha contributes to gene activation directed by androgen receptor

PDF

A model for the mechanism of agonism and antagonism in steroid receptors

PDF

Development and secretions of salivary glands using mouse models

PDF

An in vivo study of G protein coupled receptor mediated signaling

PDF

Biochemical factors determining tumor response to 5,10-dideazatetrahydrofolate, a folate antimetabolite inhibitory to de novo purine biosynthesis

PDF

Dual functions of Vav in Ras-related small GTPases signaling regulation

PDF

Identification of the biochemical pathways affected by the anticancer agents Motexafin Gadolinium and Sapphyrin through gene expression profiling

PDF

A transgenic mouse model for small cell lung cancer

PDF

Different roles of p160 coregulators in myogenesis

PDF

EPR analysis of soluble and membrane -bound annexin A2

PDF

Amelogenin domains in a self-assembly process

PDF

Characterization of target cell entry by murine leukemia viruses

PDF

Characterizing the function of murine epididymal secretory protein 1 (ME1) in hematopoietic stem cells

PDF

An E2F-independent mechanism in transcriptional control of the hamster histone H3.2 gene expression

PDF

A TNF alpha-responsive kinase activity may play a key role in IKK activation

PDF

Clathrin associated protein (AP) binding motifs in AD5 penton

PDF

Functional analysis of single nucleotide polymorphisms (SNPs) in the 5' regulatory region on the SRD5A2 gene

PDF

The Human 3 Beta-Hydroxysteroid Dehydrogenase Type Ii Gene And Genetic Predisposition To Prostate Cancer

PDF

Construction and characterization of RRP6 deletion in Saccharomyces cerevisiae

PDF

Development of replication -competent retroviral vectors for efficient, targeted gene therapy of cancer

Asset Metadata

Creator Liao, Chun-Peng (author)

Core Title Anomalies at NGX6 locus: Potential involvement in feline lymphomas

School Graduate School

Degree Master of Science

Degree Program Biochemistry and Molecular Biology

Publisher University of Southern California (original), University of Southern California. Libraries (digital)

Tag biology, animal physiology,biology, molecular,Biology, Veterinary Science,OAI-PMH Harvest

Language English

Contributor Digitized by ProQuest (provenance)

Advisor Roy-Burman, Pradip (committee chair), Stallcup, Michael R. (committee member), Stellwagen, Robert H. (committee member)

Permanent Link (DOI) https://doi.org/10.25549/usctheses-c16-323952

Unique identifier UC11328969

Identifier 1427951.pdf (filename),usctheses-c16-323952 (legacy record id)

Legacy Identifier 1427951.pdf

Dmrecord 323952

Document Type Thesis

Rights Liao, Chun-Peng

Type texts

Source University of Southern California (contributing entity), University of Southern California Dissertations and Theses (collection)

Access Conditions The author retains rights to his/her dissertation, thesis or other graduate work according to U.S. copyright law. Electronic access is being provided by the USC Libraries in agreement with the au...

Repository Name University of Southern California Digital Library

Repository Location USC Digital Library, University of Southern California, University Park Campus, Los Angeles, California 90089, USA