University of Southern California Dissertations and Theses

Optimization of genetically engineered monoclonal antibody and antibody /cytokine fusion proteins for the detection and immunotherapy of solid malignancies

(USC Thesis Other)

Optimization of genetically engineered monoclonal antibody and antibody /cytokine fusion proteins for the detection and immunotherapy of solid malignancies

PDF

Download

Open document

Flip pages

Download a page range

Download transcript

Copy asset link

Request this asset

Transcript (if available)

Content INFORMATION TO USERS
This manuscript has been reproduced from the microfilm master. UM I films
the text directly from the original or copy submitted. Thus, some thesis and
dissertation copies are in typewriter face, while others may be from any type of
computer printer.
The quality of this reproduction is dependent upon the quality of the
copy submitted. Broken or indistinct print, colored or poor quality illustrations
and photographs, print bleedthrough, substandard margins, and improper
alignment can adversely affect reproduction.
In the unlikely event that the author did not send U M I a complete manuscript
and there are missing pages, these w ill be noted. Also, if unauthorized
copyright material had to be removed, a note w ill indicate the deletion.
Oversize materials (e.g., maps, drawings, charts) are reproduced by
sectioning the original, beginning at the upper left-hand comer and continuing
from left to right in equal sections with small overlaps.
Photographs included in the original manuscript have been reproduced
xerographically in this copy. Higher quality 6" x 9” black and white
photographic prints are available for any photographs or illustrations appearing
in this copy for an additional charge. Contact U M I directly to order.
ProQuest Information and Learning
300 North Zeeb Road, Ann Arbor, M l 48106-1346 USA
800-521-0600
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
NOTE TO USERS
Page(s) not included in the original manuscript
are unavailable from the author or university. The
manuscript was microfilmed as received.
122 -124
This reproduction is the best copy available.
UMT
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
©2000
O ptim iza tio n o f G e n e tic a ll y E n g in eered
M o n o clo n a l antibody a n d A n tib o d y/ cytokine
FUSION PROTEINS FOR THE DETECTION AND
IMMUNOTHERAPY OF SOLID MALIGNANCIES
by
Myra Michiko Mizokami
A Dissertation Presented to the
FACULTY OF THE GRADUATE SCHOOL
UNIVERSITY OF SOUTHERN CALIFORNIA
in Partial Fulfillment of the
Requirements for the Degree
DOCTOR OF PHILOSOPHY
(PATHOBIOLOGY)
December 2000
Myra Michiko Mizokami
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
UM I Number: 3041499
Copyright 2000 by
Mizokami, Myra Michiko
A ll rights reserved.
_______ (f t
UMI
UM I Microform 3041499
Copyright 2002 by ProQuest Information and Learning Company.
All rights reserved. This microform edition is protected against
unauthorized copying under Title 17, United States Code.
ProQuest Information and Learning Company
300 North Zeeb Road
P.O. Box 1346
Ann Arbor, M l 48106-1346
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
UNIVERSITY OF SOUTHERN CALIFORNIA
THE GRADUATE SCHOOL
UNIVERSITY PARK
LOS ANGELES. CALIFORNIA 90007
This dissertation, written by
Mizokami...................
under the direction of h&c Dissertation
Committee, and approved by all its members,
has been presented to and accepted by The
Graduate School, in partial fulfillment of re
quirements for the degree of
DOCTOR OF PHILOSOPHY
Dean of Graduate Studies
Date December is, 2000
DISSERTATION COMMITTEE
. / Chair per so n
M ic h a e l P r e s s
Hide Tsukamoto
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
Myra M. Mizokami Alan L. Epstein
ABSTRACT
OPTIMIZATION OF GENETICALLY ENGINEERED MONOCLONAL ANTIBODY AND
ANTIBODY/CYTOKINE FUSION PROTEINS FOR THE DETECTION AND
IMMUNOTHERAPY OF SOLID MALIGNANCIES
Despite the significant strides made in antibody-based therapy in oncology, there remains
significant room for improvement. In addition to proper localization of the antibody to tumor
foci, the molecule must have sufficient antitumor properties. In this dissertation, new strategies
to optimize antibody-based therapies are presented.
First, the issue of physicochemical properties of optimal antibodies for tumor targeting is
addressed via the generation of a new recombinant Tumor Necrosis Therapy (TNT) antibody and
comparison with other TNT antibodies. While the TNT antibodies demonstrate similar physical
properties, their behavior in vivo differs dramatically, indicating that interactions with other
molecules in the circulation are important in determining physiologic behavior.
New approaches to improve the antitumor efficacy of antibody-based therapy were
discussed in the next three chapters. The antibody-cytokine fusion protein approach was utilized
to stimulate specific antitumor immunity for three different molecules, interferon-gamma,
interleukin-?, and monocyte chemoattractant protein-1 . Antibody-targeted interferon-gamma
demonstrated improved tumor rejection in a syngeneic mouse model of metastatic renal cell
carcinoma. Amino acid substitution analogs of antibody-interleukin-2 demonstrated that this
approach allows the selection of desired properties, inducing either immunologic activity or local
vasopermeability, further increasing the therapeutic index of the normally toxic interleukin-2
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
molecule in tumor therapy. However, the antibody-monocyte chemoattractant protein-1 did not
retain chemokine activity, demonstrating the main limitation of this approach, mainly that the
biological response modifier must tolerate the appending of the targeting antibody to its amino-
or carboxy-terminus.
The experiments presented in this dissertation provide further support for the potential of
recombinant antibody targeted therapy of human malignancies, as well as new perspectives for
the understanding of human immunology. Continuing investigation is needed to further
elaborate upon the evidence presented herein to take full advantage of the potential of the human
immune system’s innate ability to fight disease.
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
ACKNOW LEDGEM ENTS
I am deeply indebted to my mentor, Alan L. Epstein, for his guidance and support over
the years, and, more importantly, his friendship. I would also like to extend my deepest
gratitude to Peisheng Hu and Leslie A. Khawli, two gifted researchers who were always
willing to tackle new problems with seamless ease. Special thanks to my labmates and
collaborators, past and present—Jason L Homick, John Sharifi, Barbara H. Biela,
Jennifer M. Ruoff, Maggie Yun, Aaron Epstein, Thomas Bai, Sarah Lee, Jiali Li, and
Michael Wilson. For their academic support, sincere thanks to my guidance and
dissertation committee members, Minnie McMillan, Michael F. Press, Michael Stallcup,
Hidekazu Tsukamoto, and Alan L. Epstein
Last, but by no means least, I would like to thank my friends and family for their
unequivocal support through countless years of schooling, especially my parents for
instilling within me true compassion and appreciation for knowledge, and my brothers for
showing me what family really means.
Special thanks to my personal doc, Mark E. Miller, II.
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
TABLE O F CO NTENTS
ACKNOWLEDGEMENTS........................... ii
LIST OF FIGURES................................................................................... vi
LIST OF TABLES................................................................................... viii
CHAPTER 1. INTRODUCTION..............................................................I
REFERENCES.........................................................................................12
CHAPTER 2. DEVELOPMENT OF NEW TUMOR NECROSIS
TREATMENT ANTIBODIES FOR DIAGNOSIS AND
TARGETED THERAPY OF SOLID TUMORS................17
ABSTRACT............................................................................................. 17
INTRODUCTION....................................................................................18
MATERIALS AND METHODS............................................................ 21
Reagents ............................................................................................... 21
Antibodies and cell lines.......................................................................... 22
Construction o f expression vector...........................................................23
Expression and purification ofchTNT-I, chTNT-2, and chTNT-3 24
EUSA ............................................................................................... 25
Isoelectric Focusing Electrophoresis......................................................26
Indirect Immunofluorescence...................................................................26
Pharmacokineitc Clearance and Biodistribution....................................27
Macroautoradiography Studies............................................................... 28
RESULTS ..............................................................................................29
Construction, expression, and purification o f chTNT-2........................ 29
Immunobiochemical analysis...................................................................31
Antigenic characterization.......................................................................34
Immunofluorescence analysis................................................................. 34
in vivo pharmacokinetic and biodistribution studies..............................38
Tissue localization studies.......................................................................41
Effect o f chemical modification............................................................... 43
DISCUSSION......................................................................................... 47
REFERENCES........................................................................................ 51
CHAPTER 3. CHIMERIC TNT-3 ANTIBODY-MURINE
INTERFERON-y FUSION PROTEIN FOR THE
IMMUNOTHERAPY OF SOLID MALIGNACIES 57
ABSTRACT.......................................................................................... 57
INTRODUCTION.................................................................................58
iii
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
MATERIAL AND METHODS............................................................. 6 1
Reagents ...............................................................................................61
Antibodies and cell lines.......................................................................... 62
Construction o f expression vector...........................................................63
Expression and purification o f chTNT-3/muIFN- y.................................64
EUSA ...............................................................................................65
Radiolabeling............................................................................................< 5 6
Determination o f avidity.......................................................................... 66
muIFN-yactivity assays........................................................................... 67
Pharmacokinetic studies.......................................................................... 68
Biodistribution study.................................................................................69
Histologic study........................................................................................ 69
Immunotherapy study................................................................................70
RESULTS ............................................................................................. 70
Construction, expression, and purification o f chTNT-3/muIFN-y 70
Immunobiochemical analysis................................................................... 74
Interferon activity o f chTNT-3/muIFN-y................................................ 74
in vivo pharmacokinetic and biodistribution studies..............................76
Histology ...............................................................................................82
Immunotherapy studies............................................................................ 84
DISCUSSION......................................................................................... 86
REFERENCES........................................................................................90
CHAPTER 4. OPTIMIZATION OF chTNT-3/IL-2 BASED
IMMUNOTHERAPY OF CANCER..................................95
ABSTRACT............................................................................................ 95
INTRODUCTION...................................................................................96
MATERIALS AND METHODS...........................................................100
Reagents ............................................................................................. 100
Cell lines ............................................................................................101
Leukocyte preparation............................................................................101
Antibodies and antibody fusion proteins............................................ 101
Expression and purification o f chTNT-3/IL-2 and chTNT-3/lL-2
analogs................................................................................ 103
ELISA ............................................................................................. 103
IL-2 receptor binding studies.................................................................104
Secondary cytokine induction................................................................. 1 05
IL-2 proliferation activity assays.......................................................... 106
Lymphokine-activated killer cell activity generation...........................107
Vasopermeability assays / 08
RESULTS ............................................................................................109
Construction, expression, and purification o f chTNT-3/IL-2 analogs 109
IL-2 receptor binding studies............................................................... 112
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
IL-2 bioactivity studies............................................................................ 112
Vasopermeability assays.........................................................................119
DISCUSSION.............................................................................................125
REFERENCES............................................................................................130
CHAPTER 5. TARGETED DELIVERY OF CHEMOKINES USING
MONOCLONAL ANTIBODY/CHEMOKINE FUSION
PROTEINS FOR THE ADOPTIVE IMMNOTHERAPY
OF CANCER____________________________________135
ABSTRACT........................................................................................... 135
INTRODUCTION..................................................................................136
MATERIALS AND METHODS........................................................... 141
Reagents ..............................................................................................141
Antibodies and cell lines.........................................................................142
Construction o f expression vector..........................................................143
Expression and purification o f chTNT-3/huMCP-1 and muTNT-3/
muMCP-1............................................................................ 144
ELISA ..............................................................................................145
Chemotactic activity assays....................................................................146
RESULTS ............................................................................................ 147
Construction, expresion, and purification of chTNT-3/huMCP-1 and
muTNT-3/muMCP-l...........................................................147
Immunobiochemical analysis................................................................. 150
Chemoattractive activity ofchTNT-3/huMCP-l and muTNT-3/muMCP-l
..............................................................................................153
DISCUSSION........................................................................................ 156
REFERENCES....................................................................................... 163
CHAPTER 6. SUMMARY OF RESULTS AND FUTURE
DIRECTIONS...................................................................... 170
BIBLIOGRAPY......................................................................................174
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
LIST OF FIGURES
Figure 2-1. Construction of chTNT-2 expression vectors.........................30
Figure 2-2. SDS-polyacrylamide gel electrophoretic analysis of
chTNT-1, chTNT-2, and chTNT-3........................................ 32
Figure 2-3. Determination of the pis of chTNT-1, chTNT-2, and
chTNT-3 ............................................................................. 33
Figure 2-4. Binding patterns of TNT antibodies (HUVECs).....................36
Figure 2-5. Binding patterns of TNT antibodies (LS174T human
colorectal carcinoma).............................................................. 37
Figure 2-6. Pharmacokinetic clearance of l2 5 I-labeled chTNT-1,
chTNT-2, and chTNT-3 in B ALB/c mice..............................39
Figure 2-7. Five day biodistribution of chTNT-1, chTNT-2, and
chTNT-3 in Madison 109 murine lung adenocarcinoma
model........................................................................................ 40
Figure 2-8. Tissue localization of chTNT-1, chTNT-2, chTNT-3, and
chLym-l in vivo.......................................................................42
Figure 2-9. Pharmacokinetic clearance of biotinylated chTNT-2.............44
Figure 2-10. Five day biodistribution of biotinylated chTNT-2.................45
Figure 2-11. Determination of the pi of biotinylated chTNT-2.................. 46
Figure 3-1. Schematic diagram depicting the chimeric TNT-3 heavy
chain/cytokine fusion genes.................................................... 72
Figure 3-2. SDS-PAGE and Western blot analysis of recombinant
antibody and antibody/cytokine fusion protein.....................73
Figure 3-3. Competition ELISA against ssDNA: Verification of
antigenic specificity................................................................ 75
Figure 3-4. Upregulation of MHC class II molecule expression in the
WEHI-3 murine myelomonocytic cell line............................ 77
vi
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
Figure 3-5.
Figure 3-6.
Figure 3-7.
Figure 4-1.
Figure 4-2.
Figure 4-3.
Figure 4-4.
Figure 4-5.
Figure 5-1.
Figure 5-2.
Figure 5-3.
Figure 5-4.
Figure 5-5.
Figure 5-6.
Production of nitric oxide by RAW 264.7 murine
macrophage cells.................................................................... 78
Pharmacokinetic clearance of chTNT-3 and chTNT-3/
muIFN-y...................................................................................80
Tissue biodistribution of chTNT-3 and chTNT-3/muIFN-y in
Madison 109 murine lung adenocarcinoma-bearing BALB/c
mice.......................................................................................... 81
Chimeric antibody-IL-2 analog fusion proteins................ 110
SDS-PAGE analysis of recombinant antibody and antibody-
IL-2 fusion proteins.............................................................111
Secondary cytokine secretion by stimulated peripheral blood
mononuclear cells................................................................ 114
Lymphokine-activated killer (LAK) cell activity.............. 115
Relative induction of vasopermeability............................. 1 20
chTNT-3/huMCP-l expression vectors...............................148
muTNT-3/muMCP-l expression vectos..............................149
SDS-PAGE and Western blot analysis of chTNT-3
recombinant antibody and chTNT-3/huMCP-l
antibody/chemokine fusion protein..................................... 151
SDS-PAGE and Western blot analysis of chTNT-3
recombinant antibody and muTNT-3/muMCP-l
antibody/chemokine fusion protein..................................... 152
ELISA analysis of recombinant antibody and antibody-
chemokine fusion proteins..................................................154
Chemotactic migration of THP-l cells in response to
antibody-chemokine fusion proteins.................................. 155
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
riST OF TABLES
Table 2-1.
Table 3-1.
Table 3-2
Table 4-1
Table 4-2
Antigenic specificity of chTNT antibodies.............................35
Immunohistologic characterization of leukocyte infiltration
into Madison 109 tumors in mice treated with targeted
muIFN-y..................................................................................... 83
Efficacy of targeted muIFN-y therapy against pulmonary
metastases..................................................................................85
Relative binding of chTNT-3/IL-2 and chTNT-3/IL-2 analog
fusion proteins to the MT-1 and YT-2C2 cell lines..............113
Summary of the relative properties of chTNT-3 compared to
the chTNT-3/IL-2 and chTNT-3/IL-2 analog fusion proteins...
121
viii
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
Chapter 1. Introduction
Although the first evidence of the existence of antibodies was discovered in
the early 1890’s with the discovery of the protective effect of cow pox exposure *
and the foundations of the modern model for the humoral immune system and role of
antibody production was proposed by Paul Ehrlich at the turn of the century-, it took
more than 50 years until substantive understanding of antibody structure and
function began to be elucidated (reviewed in ^ 4). The establishment of
physicochemical methods of isolation allowed investigators to further determine how
the actual structure of antibodies related to their function and how humoral immunity
interacted with the overall immune system. However, the initial excitement about
the potential of these “magic bullets” to prevent and/or eradicate disease soon waned,
as naked antibodies demonstrated little to no efficacy in the treatment of most
diseases and indirectly only with limited exceptions, such as vaccination against
certain viruses and treatment for exotoxins.
In the 1950’s Pressman and Komgold developed the concept of utilizing
antibodies to target selectively disease with the goal of specific delivery of
therapeutic molecules. In their seminal paper^, the authors described the selective
delivery in vivo of a radioisotope to murine osteogenic sarcoma via the use of rabbit-
derived antisera against the neoplasm. This approach generated new hope for the
treatment of disease as one could combine the targeting ability of the antibody with a
therapeutic moiety and no longer had to rely on the limited efficacy of the naked
1
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
antibody. Thus, the concept of antibody-directed drug targeting was developed, with
accompanying proof of concept, although the approach remained limited due to the
low yields of usable material and less than optimal targeting specificity secondary to
the use of polyclonal antisera.
The development of the hybridoma technique in the 1970’s by Kohler and
Milstein^ rekindled hope for this approach, as investigators were now able purify
large quantities of a monoclonal antibody with a singular, defined target. Early
reports demonstrated the improved specificity of monoclonal antibodies over
polyclonal antibodies in the delivery of isotopes and drugs (reviewed in^). However,
as with any developing field, the approach still had significant obstacles/considerable
challenges to overcome, as there remained only a fledgling understanding of
immunology.
The primary concern in antibody-directed tumor targeting is selection of
antigenic target. The ideal antigen would be a uniquely tumor-specific antigen—a
moiety that is highly expressed on the surface of all tumor cells and neither
expressed on normal tissues nor shed into the circulation. In reality, the majority of
antigens currently targeted by antibodies and other immunotherapeutic approaches
are tumor-associated antigens. These are antigens that are either upregulated in
expression (such as oncogenes like her2/neu in breast and ovarian carcinoma**),
aberrantly/paradoxically expressed (normally expressed only during development,
such as a-fetoprotein^ and C E A ^ in colorectal carcinoma), or even merely tissue
i
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
specific (CD20 in non-Hodgkin’s lymphoma * ^ rather than new antigens. The
targeting of these tumor-associated antigens generates only selective localization
(less than optimal specific delivery) with significant side effects due to the
inadvertent targeting of normal tissues. In the case of point mutated proteins, which
represent new epitopes and thus true tumor-specific antigens 13, an active immune
response sufficient for tumor eradication is not usually generated. Thus, the
generation of antibodies specifically reactive against these tumor-associated antigens
has proven difficult^. While hybridoma technology and the more recently
developed phage display technology^ allow the artificial generation of diverse
antibody panels derived from a target such as a tumor cell, the actual mutations are
so varied as to limit the commercial development of such “designer ‘ therapies,
causing investigators interested in these unique antigens to pursue the more
comprehensive vaccine a p p r o a c h ^ . ^ for these truly tumor-specific antigens.
Another significant problem associated with the early monoclonal antibodies
used in cancer therapy was the development of an immune response against the
foreign protein. The original monoclonal antibodies were murine-derived and thus
generated human-anti-mouse-antibody (HAMA) responses when administered to
patients, which not only decreased the degree of tumor localization by rapidly
clearing the administered antibody, but limited the number of times the reagent could
be administered 18-20
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
Additionally, the initial studies illuminated more issues of consideration,
including the problem of limited tumor uptake secondary to their large size and
decreased tumor penetrance^*’ 22 lack of host-responsive Fc regions which would
enable the host’s immune system to respond via antibody-dependent cellular
cytotoxicity23, and the loss of functional activity of the targeted moiety following
chemical conjugation^. Further investigations provided insight into the factors
important to intratumoral localization of antibodies, including the seminal discovery
by Colcher et al that improvement in tumor localization could be obtained via the use
of second generation monoclonal antibodies with enhanced affinity for these tumor
associated surface antigens^. While little can be done to alter certain properties
such as vascular volume and antigen expression, tumor perfusion can be improved
by increasing the vasopermeability of tumor microvasculature by local delivery of
vasoactive mediators, such as interleukin-2 (IL-2)— 26-29
The development of molecular biology technology has allowed investigators
to improve upon some of the limitations of the original monoclonal antibody
approach. First, high level expression systems have been developed to produce
recombinant proteins at high levels in both prokaryotic and eukaryotic expression
s y s t e m s 2 4 , 30 Secondly, genetic manipulation has allowed investigators to design
proteins that retain the original targeting moiety of the antibody but have
modifications to improved their overall therapeutic capacity. Such alterations include
the replacement of the murine constant regions with human analogs, which result in
4
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
both decreased immunogenicity and improved ability to activate the host immune
s y s t e m ^ , 3 1 Furthermore, antibody-derived fragments with altered avidity and
size, and thus altered pharmacokinetic properties, could be generated to increase
tumor uptake and increase whole body c l e a r a n c e 3 2 . Multifunctional fusion proteins
could also be developed, eliminating the need for chemical conjugation methods for
bioactive p r o t e i n s 2 4 , 2 9 , 3 3 Finally, the development of phage display technology
has allowed the rapid generation of large antibody panels based on affinity to
multiple epitopes on a single antigen. Thus, genetic engineering has allowed us to
address some of the important factors/issues in antibody-targeted therapy.
Nevertheless, only limited progress has been demonstrated with regard to antigen
selection.
Traditional monoclonal antibodies used for immunotherapy target tumor-
associated antigens expressed on the surface of tumor cells. In addition to the
problems mentioned earlier regarding lack of tumor specific expression (i.e.,
expressed on normal as well as diseased tissues), many of these antigens are shed
into the circulation, providing a sink for antibody diversion and a resulting decrease
in tumor l o c a l i z a t i o n 3 4 , 3 5 Furthermore, antigen expression is heterogeneous and
may be modulated, either innately or in response to treatment. Therefore, an antigen
that was only expressed on a fraction of the tumor population may further decrease
its overall expression as antigen-expressing cells are selected against by therapeutic
intervention. These issues are put into perspective when considering reports that
5
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
estimate that approximately 400-750 antibody-toxin fusion proteins need to bind and
internalize within each tumor cell for complete killing^, which may necessitate the
use of multiple antibody-toxin fusion proteins that recognize separate epitopes to
prevent immunologic escape through insufficient expression and antigenic
modulation-^. However, this “cocktail” approach is still limited by the overall
systemic exposure to the effector moiety., not to mention the prohibitive costs of
getting such a therapeutic approach through the FDA.
In response to these difficulties, our laboratory has developed a novel tumor
targeting method that exploits a pathologic trait of the vast majority of solid tumors,
rather than a specific tumor-associated antigen. This approach, designated Tumor
Necrosis Therapy (TNT), targets intracellular antigens made accessible in dead and
dying cells in the central necrotic region of tumors^S. Once cells begin degeneration
due to inadequate oxygen or other nutrients, they lose their membrane integrity and
become leaky. Because of this, loose, soluble proteins and organelles exit the cells,
leaving behind a cell ghost consists of insoluble constituents such as nucleic acids
and cytoskeletal remains. These “universal antigens” which have now become
accessible are an abundant source of antigen residing in degenerating regions of the
tumor. By contrast, physiologic cell death occurs through the process of apoptosis.
in which all cellular contents are processed into apoptotic bodies and rapidly
phagocytized. Furthermore, the central distribution of necrosis within tumors
circumvents the development of the “binding-site barrier” encountered with surface
antigen-targeting antibodies, which bind quickly and thoroughly upon first
6
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
encountering antigen and forming a physical barrier that prevents penetration of
subsequent antibody to the tumor c o r e ^ 40
Continued investigation into this approach has demonstrated the efficacy of
this approach in targeting a wide array of tumor types and delivery therapeutic
moieties such as radionuclides and cytokines^, 41-44 However, there remains
significant uncertainty as to what factors specifically affect a TNT antibody’s
potential as a tumor targeting agent. To address this issue, a new tumor necrosis
targeting antibody, chTNT-2, was generated recombinantly and compared against
two previously characterized TNT antibodies, as presented in Chapter 2.
Additionally, the effect of a specific chemical modification on the in vitro and in vivo
behavior of the antibody is presented. Our laboratory and others have previously
demonstrated that chemical modification via biotin- or succinimidyl 2-(2-
pyridyldithio)propionate (SPDP) conjugation of antibodies can lead to an improved
pharmacokinetic clearance and biodistribution profile by downwardly shifting their
isoelectric points and thus disrupting normally significant interactions with the
negatively charged cell surface, which normally contribute to undesirable levels of
background binding to normal t i s s u e s 4 5 - 4 7 However, the chemical modification of
chTNT-2 did not produce significant alterations in the pharmacokinetic behavior,
and illustrates the multi-factorial nature of this parameter.
Antibody-directed targeting is not limited to directly toxic molecules such as
drugs, radioisotopes, and toxins. Indeed, the specific localization capability of the
antibody moiety has the potential allow the administration of therapeutic molecules
7
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
that would otherwise be too toxic if administered systemically at the dosages
required to generate the appropriate local therapeutic levels. Previous work by our
laboratory and others has demonstrated the ability of the antibody moiety to target
successfully cytokines and other biologic response modifiers (BRM) to disease
sites24, 33 jn Chapter 3 we describe the generation of a chTNT-3/murine
interferon-y (chTNT-3/ muIFN-y) fusion protein and its characterization in vitro and
in vivo. Interferon-y (IFN-y) is a potent cytokine with many functions, including
activation of phagocytosis and stimulation of antigen presentation by professional
antigen presenting cells, stimulation of macrophage, natural killer (NK) and
lymphokine-activated killer (LAK) cell-mediated cytotoxicity, direct anti-tumor
effects, and inhibition of angiogenesis48-50 Systemic administration of this
cytokine has been limited in efficacy due to dose-limiting side effects and an
inability to generate adequate intratumoral concentrations^ f 52 Both effector
moieties of chTNT-3/muIFN-y remain functional as assessed via in vitro
characterization. Additionally, in vivo studies demonstrate that the fusion protein
directs tumor localization successfully and generates sustained intratumoral levels, in
contrast to “free” IFN-y. Preliminary therapy studies demonstrate the potential of
this therapeutic modality in the treatment of a murine model of metastatic disease.
These studies indicate that this approach may have significant potential in the
treatment of human metastatic disease.
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
Antibody-directed cytokine delivery still has unintended side effects.
Because significant time is required to allow intratumoral localization, normal tissues
are exposed to the cytokine. Interleukin-2 (IL-2) is a potent cytokine that is vital to
the activation of the cellular and humoral arms of the immune system. While
essential to the generation of functional antibody responses, its primary role is in the
activation of T lymphocytes and NK cells as part of the specific immune response to
pathogens and neoplasia. Because of these potent stimulatory effects, it was the first
cytokine studied for its anti-tumor potential and has been approved for the treatment
of metastatic renal ceil carcinoma and melanoma. It has also been studied as a
potential immunoconjugate for the targeted therapy of c a n c e r ^ L 53 a n £ j j t s efficacy
is currently being evaluated in clinical trials^. However, the dose limiting toxicity
of IL-2, vascular leak syndrome, limits the administration of IL-2 and. accordingly,
its efficacy, even when administered as a fusion protein, although lower doses of the
targeted cytokine are required to obtain equipotent intratumoral concentrations. In
Chapter 4, we describe the generation of fusion proteins consisting of chTNT-3 and
interleukin-2 analogs bearing single amino-acid mutations and characterize them
both in vitro and in vivo to evaluate their potential as therapeutic agents with reduced
toxicity. Binding studies performed with the fusion proteins on IL-2 receptor-
bearing cells demonstrate similar binding properties as the free cytokine analogs.
However, because of the presence of the antibody moiety, we can also evaluate their
relative ability to cause local vasopermeability in a tumor model as an indicator of
possible toxicity in vivo. Based upon these parameters, we have identified two
9
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
molecules, chTNT-3/R38W and chTNT-3/F42K, with potential in antitumor therapy.
chTNT-3/R38W is a selective immunologic activator with decreased activity in
inducing vasopermeability. In direct contrast, chTNT-3/F42K displays a dramatic
reduction in immunologic function, yet retains the full activity of the wild type IL-2
fusion protein in vasopermeabilility induction. chTNT-3/R38W should stimulate the
host antitumor response with decreased toxicity, thus improving the therapeutic
index of targeted IL-2. chTNT-3/F42K, on the other hand, may serve as a pure
pretreatment molecule than chTNT-3/IL-2 for the subsequent delivery of therapeutic
molecules.
While cytokines have been known for many years, the chemokines are a
more recently described subgroup of the cytokine family of protein. These small
molecular weight proteins are involved in the direction of chemotaxis—migration of
target cells along a concentration gradient. A recent insight into the necessary
cascade of events for the generation of a successful anti-tumor response was
provided when Dilloo and colleagues performed combination gene therapy for the
murine pre-B cell tumor line A20^5. ex vivo lymphotactin gene therapy on these
tumor cells caused significant CD4+ cell infiltration; however, this infiltration alone
was insufficient to cause significant anti-tumor immunity. In contrast, combination
ex vivo lymphotactin and IL-2 gene therapy caused CD4+ and CD8+ cell infiltration
and was associated with a substantial delay in the growth of established tumors as
well as increased survival. Consequently, the combination of an antibody/
10
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
chemokine fusion protein with a corresponding antibody/cytokine fusion protein may
produce a significantly improved anti-tumor response.
In Chapter 5 we describe the generation of chTNT-3/human monocyte
chemoattractant protein-1 (chTNT-3/huMCP-1) and muTNT-3/murine monocyte
chemoattractant protein-1 (muTNT-3/muMCP-l) antibody-chemokine fusion
proteins for the induction of intratumoral infiltration of leukocytes. The fusion
proteins were generated in a fashion similar to other antibody-cytokine fusions
produced by our laboratory. However, while both the murine and chimeric fusion
proteins retained antigen-binding activity, the engineered configuration caused the
chemokine moieties to lose the ability to direct chemoattraction. Recent studies have
illuminated the importance of the amino termini of chemokines in binding to their
specific receptors and inducing chemotactic migration. This rather exquisite
sensitivity to modification illustrates one of the limitations of the antibody-fusion
protein approach to the in vivo targeting of therapeutic molecules—the peptide
molecule must remain functional in the absence of a free amino or carboxy terminus.
If this requirement is not satisfied, the molecule will not remain active after being
fused to the targeting antibody and will be of no therapeutic value. Currently, these
fusion proteins are being re-engineered in the reverse orientation, in the hope of
generating bifunctional molecules to direct successful intratumoral leukocyte
localization.
II
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
In addition to improving our basic understanding of immunologic signaling,
these studies provide important preclinical information necessary for the continued
development of antibody- and antibody-cytokine based therapy of solid tumors.
REFERENCES
1. von Behring E, Kitasato S. Dtsch. Med. Wochenschr 1890: 16:1113.
2. Ehrlich P. On immunity with special reference to cell life. Proc. Roy. Soc.
London 1906; 66:424.
3. Bellanti JA. Immunology. Philadelphia: W.B. Saunders Company, 1971.
4. Silverstein AM. A History of Immunology. San Diego: Academic Press. Inc.,
1989:422.
5. Pressman D, Komgold L. The in vivo localization of anti-Wagner-osteogenic-
sarcoma antibodies. Cancer 1953; 6:619-623.
6. Kohler G, Milstein C. Continuous cultures of fused cells secreting antibody
of predefined specificity. Nature 1975; 256:495-497.
7. Larson S. Clinical radioimmunodetection, 1978-1988: overview and
suggestions for standardization of clinical trials. Cancer Res 1990: 50:892s-
898s.
8. Dill man R. Perceptions of Herceptin: a monoclonal antibody for the
treatment of breast cancer. Cancer Biother Radiopharm 1999: 14:5-10.
9. Ishii N, Nakata, K, Muro T, et al. Radioimmunodetection of cancer using
antibodies to alpha-fetoprotein and carcinoembryonic antigen. Ann N Y Acad
Sci 1983;417:270-6.
10. Sharkey RM, Pykett MJ, Siegel JA, Alger EA, Primus FJ, Goldenberg DM.
Radioimmunotherapy of the GW-39 human colonic tumor xenograft with
1311- labeled murine monoclonal antibody to carcinoembryonic antigen.
Cancer Res 1987;47:5672-7.
12
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
11. Maloney DG, Liles TM, Czerwinski DK, et al. Phase I clinical trial using
escalating single-dose infusion of chimeric anti-CD20 monoclonal antibody
(IDEC-C2B8) in patients with recurrent B-cell lymphoma. Blood 1994;
84:2457-2466.
12. Maloney D, Press O. Newer treatments for non-Hodgkin's lymphoma:
monoclonal antibodies. Oncology (Huntingt) 1998; 12:63-76.
13. Lavieille J, Righini C, Reyt E, Brambilla C, Riva C. Implications of p53
alterations and anti-p53 antibody response in head and neck squamous cell
carcinomas. Oral Oncol 1998; 34:84-92.
14. Boyer CM, Lidor Y, Lottich C. ast RC. Antigenic cell surface markers in
human solid tumors. Antibody Immunoconj Radiopharm 1988: 1:105-11 .
15. Clackson T, Hoogenboom H, Griffiths A, Winter G. Making antibody
fragments using phage display libraries. Nature 1991: 352:624-8.
16. Pardoll DM. Cancer vaccines. Immunology Today 1993: 14:310-316.
17. Urban J, Schreiber H. Tumor antigens. Annu Rev Immunol 1992: 10:617-44.
18. Schroff RW, Foon KA, Beatty SM, Oldham RK, Morgan Jr. AC. Human
anti-murine immunoglobulin responses in patients receiving monoclonal
antibody therapy. Cancer Research 1985; 45:879-885.
19. Shawler DL, Bartholomew RM, Smith LM. Dillman RO. Human immune
response to multiple injections of murine monoclonal IgG. Journal of
Immunology 1985; 135:1530-1535.
20. Khazaeli MB, Conry RM, LoBuglio AF. Human immune response to
monoclonal antibodies. Journal of Immunotherapy 1994; 15:42-52.
21. Epenetos AA, Snook D, Durbin H, Johnson PM, Taylor-Papadimitriou J.
Limitations of radiolabeled monoclonal antibodies for localization of human
neoplasms. Cancer Research 1986; 46:3183-3191.
22. Jain RK. Delivery of molecular medicine to solid tumors. Science 1996:
27:1079-1080.
23. Haga Y, Sivinski C, Woo D, Tempero M. Dose-related comparison of
antibody-dependent cellular cytotoxicity with chimeric and native murine
monoclonal antibody 17-1 A. Improved cytolysis of pancreatic cancer cells
with chimeric 17-1 A. Int J Pancreatol 1994; 15:43-50.
13
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
24. Hu P, Homick JL, Glasky MS, et al. A chimeric Lym- 1/interleukin 2 fusion
protein for increasing tumor vascular permeability and enhancing antibody
uptake. Cancer Research 1996; 56:4998-5004.
25. Colcher D, Minelli MF, Roselli M, Muraro R, Simpson-Milenic D, Schlom J.
Radioimmunolocalization of human carcinoma xenografts with B72.3 second
generation monoclonal antibodies. Cancer Research 1988; 48:4597-4603.
26. Khawli LA, Miller GK, Epstein AL. Effect of seven new vasoactive immuno-
conjugates on the enhancement of monoclonal antibody uptake in tumors.
Cancer 1994; 73:824.
27. Khawli LA, Epstein AL. Exploration of novel strategies to enhance
monoclonal antibodies targeting. Quarterly Journal of Nuclear Medicine
1997;41:25-35.
28. Khawli LA, Homick JL, Sharifi J, Epstein AL. Improving the
chemotherapeutic index of lUdR using a vasoactive immunoconjugate.
Radiochimica Acta 1997; 79:83-86.
29. Hornick JL, Khawli LA, Hu P, Sharifi J, Khanna C, Epstein AL. Pretreatment
with a Monoclonal Antibody/Interleukin-2 Fusion Protein Directed against
DNA Enhances the Delivery of Therapeutic Molecules to Solid Tumors.
Clinical Cancer Research 1999; 5:51-60.
30. Hu P, Glasky MS, Yun A, et al. A human-mouse chimeric Lym-1
monoclonal antibody with specificity for human lymphomas expressed in a
baculovirus system. Human Antibodies and Hybridomas 1995: 6:57-67.
31. Steplewski Z, Sun LK, Shearman CW, Ghrayeb J, Daddona P. Koprowski H.
Biological activity of human-mouse IgGl, IgG2, IgG3, and IgG4 chimeric
monoclonal antibodies with antitumor specificity. Proceedings of the
National Academy of Sciences USA 1988; 85:4852-4856.
32. Colcher D, Goel A, Pavlinkova G, Beresford G, Booth B. Batra S. Effects of
genetic engineering on the pharmacokinetics of antibodies. Q J Nucl Med
1999; 43:132-9.
33. Homick JL, Khawli LA, Hu P, Lynch M, Anderson PM, Epstein AL.
Chimeric CLL-1 Antibody Fusion Proteins Containing Granulocyte
Macrophage Colony-Stimulating Factor or Interleukin-2 With Specificity for
B-Cell Malignancies Exhibit Enhanced Effector Functions While Retaining
Tumor Targeting Properties. Blood 1997: 89:4437-4447.
14
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
34. Blumenthal RD, Sharkey RM, Kashi R, Natale AM, Goidenberg DM.
Physiological factors influencing radioantibody uptake: a study of four
human colonic carcinomas. Int. J. Cancer 1992; 51:935-941 .
35. Langmuir VK, Mendonca HL, Woo DV. Comparisons between Two
Monoclonal Antibodies That Bind to the Same Antigen but Have Differing
Affinities: Uptake Kinetics and 1251-Antibody Therapy Efficacy in Multicell
Spheroids. Cancer Research 1992; 42:4728-4734.
36. Kreitman R, Pastan I. Accumulation of a recombinant immunotoxin in a
tumor in vivo: fewer than 1000 molecules per cell are sufficient for complete
responses. Cancer Res 1998; 58:968-75.
37. Rosenblum M, Cheung L, Kim S, Mujoo K, Donato N, Murray J. Cellular
resistance to the antimelanoma immunotoxin ZME-gelonin and strategies to
target resistant cells. Cancer Immunol Immunother 1996:42:115-21.
38. Epstein AL, Chen F-M, Taylor CR. A Novel Method for the Detection of
Necrotic Lesions in Human Cancers. Cancer Research 1988:48:5842-5848.
39. van Osdol W, Fujimore K, Weinstein JN. An analysis of monoclonal
antibody distribution in microscopic tumor nodules: consequences of a
"binding site barrier.". Cancer Res 1991; 51:4776-4784.
40. Adams GP. Improving the Tumor Specificity and Retention of Antibody-
Based Molecules, in vivo 1998; 12:11-22.
41. Epstein AL, Chen D, Ansari A, et al. Radioimmunodetection of necrotic
lesions in human tumors using 1-131 labeled TNT-1 F(ab')2 monoclonal
antibody. Antibody, Immunoconjugates, and Radiopharmaceuticals 1991:
4:151-161.
42. Epstein AL, Khawli LA, Chen F-M, Hu P, Glasky MS, Taylor CR. Tumor
necrosis imaging and treatment of solid tumors. In: Torchilin VP. ed.
Handbook of Targeted Delivery of Imaging Agents. Boca Raton. FL: CRC
Press, 1995:259-288.
43. Epstein AL. New approaches to improved antibody targeting. In: Henkin RE.
ed. Nuclear Medicine. St. Louis: Mosby-Year Book, 1996:516-533.
44. Homick JL, Sharifi J, Khawli LA, et al. A new chemically modified chimeric
TNT-3 monoclonal antibody directed against DNA for the
radioimmunotherapy of solid tumors. Cancer Biotherapy &
Radiopharmaceuticals 1998; 13:255-268.
15
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
45. Khawli LA, Glasky MS, Alauddin MM, Epstein AL. Improved tumor
localization and radioimaging with chemically modified monoclonal
antibodies. Cancer Biotherapy & Radiopharmaceuticals 1996: 11:203-215.
46. Homick JL, Hu P, Khawli LA, et al. chTNT-3/B, a new chemically modified
chimeric monoclonal antibody directed against DNA for the tumor necrosis
treatment of solid tumors. Cancer Biotherapy and Radiopharmaceuticals
1998; 13:255-268.
47. Sharifi J, Khawli LA, Homick JL, Epstein AL. Improving monoclonal
antibody pharmacokinetics via chemical modification. Q J Nucl Med 1998:
42:242-9.
48. De Maeyer E, De Maeyer-Guignard J. Interferons. In: Thomson A. ed. The
Cytokine Handbook. Vol. 1. San Diego: Academic Press, Inc.. 1994:265-288.
49. Talmadge JE, Tribble HR, Pennington RW, Phillips H, Wiltrout RH.
Immunomodulatory and Immunotherapeutic Properties of Recombinant y-
Interferon and Recombinant Tumor Necrosis Factor in Mice. Cancer
Research 1987; 47:2563-2570.
50. Sato N, Nariuchi H. Tsuruoka N, et al. Actions of TNF and IFN-gamma on
angiogenesis in vitro. J Invest Dermatol 1990: 95:85S-89S.
5 1. Kurzrock R, Rosenblum MG, Sherwin SA, et al. Pharmacokinetics, Single-
Dose Tolerance, and Biological Activity of Recombinant y-Interferon in
Cancer Patients. Cancer Research 1985; 45:2866-2872.
52. Kurzrock R, Quesada JR, Rosenblum MG, Sherwin SA, Gutterman JU. Phase
I Study of iv Administrated Recombinant Gamma Interferon in Cancer
Patients. Cancer Treatment Reports 1986; 70:1357-1364.
53. Gillies SD, Reilly EB, Lo K-M, Reisfeld RA. Antibody-targeted interleukin 2
stimulates T-cell killing of autologous tumor cells. Proceedings of the
National Academy of Sciences USA 1992; 89:1428-1432.
54. Ostendorf AM, Albertini MR, Gan J, Hank JA, Gillies SD, Sondel PM.
Development of an Assay to Detect an anti-Hu 14.18-IL2 Response
Following in vivo Therapy with anti-GD2 Fusion Protein, Hu 14.18-IL2.,
American Association for Cancer Research 91st Annual Meeting, San
Francisco, CA, USA, 4/2/00, 2000.
55. Dilloo D, Bacon K, Holden W, et al. Combined chemokine and cytokine
gene transfer enhances antitumor immunity. Nature Medicine 1996: 2:1090-
1095.
16
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
Chapter 2. Development of New Tumor Necrosis Treatment
Antibodies for Diagnosis and Targeted Therapy of Solid Tumors
ABSTRACT
In spite of the considerable development of the field, there still remain
considerable challenges with antibody-directed immunotherapy. In particular,
disagreement over the choice of appropriate target antigen as well as the current
incomplete understanding of cell signaling engenders difficulty in the selection of
antibodies that may have innate active anti-tumor properties. Nevertheless, the
antibody remains an important tool for the targeted delivery of therapeutic moieties.
Traditional monoclonal antibody-based targeting approaches are hindered by the
difficulty of finding truly tumor-specific antigens that are not shed or modulated, yet
are expressed in all tumor cells at sufficient concentrations. In contrast, our
laboratory has developed an approach known as Tumor Necrosis Therapy (TNT) in
which antibodies target intracellular antigens accessible only in dead and/or dying
cells. This method allows the effective delivery of therapeutic molecules to all solid
tumors with appreciable necrosis.
We have previously described the development of two mouse-human
chimeric antibodies for the clinical targeting of malignant disease. Currently, we
describe the production of a third TNT reagent, chTNT-2, with potential for the
detection of tumor foci as well as targeting of therapeutic molecules. chTNT-2 is a
17
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
murine-human chimeric monoclonal antibody that binds to heterochromatic DNA, a
nuclear antigen accessible to immunoglobulin only in permeable, dying cells as well
as the surrounding debris, in vitro studies illustrate the differences in antibody
binding, as chTNT-l, -2, and -3 all demonstrate markedly different histologic
distributions/patterns and intensity upon immunofluorescent staining of fixed cells.
While this molecule demonstrates similar prolonged in vivo pharmacokinetic
clearance as chTNT-3 compared to chTNT-l. its intermediate intratumoral uptake
indicates that successful localization of TNT antibodies are not merely due to
sustained presence in the circulation, but are multi factorial in nature. Further studies
are being performed to elucidate further upon these findings.
INTRODUCTION
Because of their unique specificity of binding, monoclonal antibodies
(MAbs) have been used in many diverse applications including diagnosis, imagine,
and therapy. The development of molecular biology techniques to create
recombinant proteins has served to improve the potential of monoclonal antibodies
by generating high level expression of these recombinant antibodies The
immunogenicity of antibodies has been reduced by chimerization (replacement of the
murine constant regions with human constant regions) and humanization (grafting of
complementarity determining regions, or CDRs, onto human framework regions with
human constant regions), thus reducing the “foreign’* content of the molecule as low
18
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
as 5%3*6 These alterations of formerly murine monoclonal antibodies prevents (or
at least reduces the incidence) of the development of the human-anti-mouse antibody
(HAMA) response, thus allowing greater time for tumor localization of the molecule
and therapeutic effects to occur as well as the utilization of multiple dosage
regimens. Genetic engineering allows the control over fragment size to optimize in
vivo pharmacokinetics and tumor penetrance^. Furthermore, an improved
understanding of the immune system and the molecules involved therein has allowed
us to select better potential candidates for immunotherapy.
Antibody-based tumor immunotherapy is a field that is only starting to realize
some of its early promise, as evidenced by the recent FDA approval of the first two
antibodies for clinical therapy, Rituximab and Herceptin, which are indicated for the
treatment of low-grade non-Hodgkin’s lymphoma and breast cancer, respectively®-
* 1. However, with only these rare but notable exceptions, naked antibodies have
shown only limited efficacy in tumor therapy, and a limited understanding of the cell
signaling induced by the rare antibodies that possess direct tumor cytotoxic or
cytostatic effects have precluded the rapid development of an expanded repertoire of
like agents. Nevertheless, the potential of antibodies in tumor immunotherapy
remains significant, as they provide an invaluable tool for specific delivery of
chemically conjugated or genetically fused therapeutic agents such as radioisotopes,
drugs, toxins, and biologic response modifiers 12-16 While these agents have
demonstrated significant direct and/or indirect innate antitumor potential when
19
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
delivered as free molecules, their use has been limited by their toxicity in vivo when
administered systemically and, in the case of external radiation, inability to localize
to disseminated disease. By utilizing antibodies to transport specifically these
reagents to disease sites, a reduction in toxicity and an improved therapeutic profile
can be achieved.
As an alternative to traditional tumor-associated antigen targeting, which is
limited by antigenic heterogeneity, modulation, and shedding^, our laboratory has
developed a novel approach (Tumor Necrosis Therapy) that instead targets a
universal feature of solid tumors. As described above, this approach uses antibodies
recognizing abundant intracellular antigens made accessible to large molecules only
in dead or dying cells found in the central necrotic region of tumors Because the
nuclear antigens that the TNT antibodies target are found in all tissues and. therefore,
all tumors, this approach allows the use of this approach to target virtually all solid
tumors 19. Furthermore, multiple rounds of therapy can be administered effectively
without the development of resistance to the antibody as the antigenic target is not
downregulated nor selected against; rather, subsequent courses of therapy should
have increased efficacy as previous courses of therapy would have augmented the
absolute amount of tumor necrosis. Finally, because TNT antibodies bind to
antigens at the core of the tumor, this approach circumvents the problem of the
“binding site barrier” formed by surface antigen targeting antibodies after binding to
the superficial areas of the tu m o r^ 21 This barrier prevents the penetration of
20
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
ensuing antibodies into the deep areas of the tumor, thus prohibiting the delivery of
therapeutic moieties to the core of the tumor and increasing systemic exposure.
To design better therapeutic molecules for tumor immunotherapy, including
diagnostic reagents, radioimmunotherapy treatments, and adoptive immunotherapy
via antibody-cytokine fusion proteins, we chose to investigate the properties of TNT
antibodies which contribute to effective in vivo tumor localization. In this study, we
describe the generation of a new chimeric TNT monoclonal antibody. chTNT-2, and
compare it to two previously described chimeric TNT antibodies. Furthermore, we
describe the effects of chemical modification via biotin conjugation to chTNT-2.
These studies will provide preliminary insight into the utility of the chimeric TNT-2
protein in the immunotherapy of human solid malignancies.
MATERIALS AND METHODS
Reagents:
The Glutamine Synthase Gene Amplification System, including the
expression plasmids pEE6/hCMV-B and pEE12 as well as the NSO murine myeloma
expression cell line, were purchased from Lonza Biologies (Slough, UK). Restriction
endonucleases, T4 DNA ligase, Vent polymerase, and other molecular reagents were
purchased from either New England Biolabs (Beverly, MA) or Boehringer
Mannheim (Indianapolis, IN). Dialysed fetal bovine serum, 4-chIoro-l-naphthol
tablets, crude DNA from salmon testes, single-stranded DNA from calf thymus, and
21
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
2,2’-azino-bis(3-ethylbenzthiazoline-6-sulfonic acid) diammonium salt (ABTS) were
purchased from Sigma Chemical Co. (St. Louis, MO). Sulfosuccinimidyl 6-
(biotinamido) Hexanoate (Sulfo-NHS-LC Biotin) was purchased from Pierce
(Rockford, IL). HRPO-conjugated secondary reagents (goat-anti-human IgG (FcSp)
and streptavidin) were purchased from CalTag (Burlingame, CA). FITC-conjugated
secondary reagents (goat-anti-human IgG F(ab’)2 goat-anti-mouse IgG + IgA + IgM
F(ab’)2 ) were purchased from ICN Biomedicals (Costa Mesa, CA).
Antibodies and cell lines:
The murine TNT-1, TNT-2, andTNT-3 antibodies were produced as
described p r e v i o u s l y ^ , 18,22 jh e chimeric MAb TNT-1 (chTNT-l. lgG,.ic) and
biotinylated chTNT-l (chTNT-l/B) were produced as described p r e v i o u s l y ^ , 23
The chimeric MAb TNT-3 (chTNT-3, IgG,,K) and biotinylated chTNT-3
(chTNT-3/B) were produced as described p r e v i o u s l y ^ .
The NSO murine myeloma cell line was obtained from Lonza Biologies. The
LS174T human colon a d e n o c a r c i n o m a ^ and RENCA murine renal cell
c a r c i n o m a ^ were obtained from the American Type Culture Collection (Manassas,
VA). The Madison 109 murine lung adenocarcinoma-^ was obtained from the
National Cancer Institute (Frederick, MD).
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
Construction o f expression vector.
Generation of chTNT-2 was performed as described previously *3. Briefly,
total RNA was isolated from the TNT-2 hybridoma line using the TRIzol reagent
(Life Technologies, Rockville, MD), followed by purification of the polyadenylated
mRNA fraction using the Oligotex mRNA Kit (QIAGEN, Valencia, CA). A panel
of degenerate 5’ primers corresponding to the known leader sequences of murine
heavy or light chains and 3’ primers corresponding to the appropriate constant
regions (murine p heavy or k light chain) were used to PCR amplify the variable
region genes 27. The heavy chain PCR product was digested with Saif and EcoRI
while the light chain PCR product was digested with Sail and BamHl and cloned into
the Bluescript cloning vector. Following automated DNA sequencing of the variable
regions, chimeric genes were constructed by PCR amplification of the variable
regions with oligonucleotide primers (primer pairs 5’-
ACTGGTATACAGCTGCAGCAGTCTGGA-3’ and 5 -
CAGTGCTAGCTGAGGAGACGGTGACTGAGGT-3’ for the heavy chain variable
region and 5 ’ -ATACTGTCGCGAGGACAAATTGTTCTCACCCAGTCTCC A-3' and 5 -
CAGTCGTACGTTTTATTTCCAGCTTGGTCCCCCCTCCGAA-3’ for the light chain
variable region) to introduce appropriate restriction endonucleases sites followed by
ligation into expression vectors containing the appropriate heavy and light chain
leader sequences and human constant regions (y 1 and k) under the control of the
cytomegalovirus (CMV) promoters provided in the GS vectors.
23
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
Expression and purification o f chTNT-l, chTNT-2, and chTNT-3:
The recombinant antibodies chTNT-I, chTNT-2, and chTNT-3 were
expressed from NSO murine myeloma cells for long term stable expression according
to the manufacturer’s protocol (Lonza Biologies). The highest producing clone for
each construct was scaled up for incubation in a 3 L stir flask bioreactor and the
fusion protein purified from the spent culture medium by sequential Protein A
affinity chromatography and ion-exchange chromatography, as described
p r e v i o u s l y ^ . The recombinant protein was analyzed by sodium dodecyl sulfate
polyacrylamide gel electrophoresis (SDS-PAGE) under reducing conditions and
stained with Coomassie blue to demonstrate proper assembly and purity of the
chimeric antibody. To further demonstrate purity of the purified protein, the
antibodies were analyzed with a Beckman High Performance Liquid
Chromatography Gold System (Beckman Instruments, Fullerton. CA) equipped with
two 110B solvent pumps, a 210A valve injector, a 166 programmable UV detector,
and a 406 analog interface module. Size exclusion chromatography was performed
on a 25 cm Zorbax bioseries GF-250 column, 9.4 mm ID (DuPont, Wilmington.
DE), with 0.1 M PBS, pH 7.2 as the solvent system, eluting at a flow rate of I
mL/min. The UV absorbance of the HPLC eluate was detected at 280 nm. To study
the effect of chemical modification, antibodies were biotinylated as described
previously by incubation with sulfosuccinimidyl 6-(biotinamido) hexanoate (EZ-
Link SuIfo-NHS-LC biotin) The actual amount of conjugated biotin per antibody
molecule was determined as described previously 13, 29. Briefly, biotinylated
24
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
chTNT-2 was digested with 1% protease for 4 h at 37°C and the amount of biotin
released determined by measuring the change in absorbance at 500 nm in an avidin-
HABA solution. Actual biotin release was calculated from a standard curve based
on known biotin concentrations. Approximately 5 and 10 molecules of biotin were
conjugated to each molecule of chTNT-2 for chTNT-2/5B and chTNT-2/10B.
respectively.
ELISA:
chTNT-2 secreting clones were initially identified by indirect ELISA analysis
of supernatants using microtiter plates coated with goat-anti-human IgG (H+L)
antibody at 100 pg/mL. For production rate assays, lxlO6 cells were incubated in 1
mL of selective medium and incubated for 24 hours, after which the supernatants
were analyzed by indirect ELISA analysis using microtiter plates coated with goat-
anti-human IgG (H+L) antibody. For verification of original antigenic reactivity
(immunologic retention), the relative ability of chTNT-2 to compete against the
parent antibody, muTNT-2 for binding to antigen was investigated. Briefly,
dilutions of chTNT-2 and chLym-1, an irrelevant chimeric antibody of the same
isotype that binds to a discontinuous epitope on HLA-DRlCpO, 31 were co_
incubated with a fixed concentration of muTNT-2 in microtiter plates coated with
nucleohistone from calf thymus. Detection of muTNT-2 bound to the antigen was
accomplished with horse-radish-peroxidase-conjugated goat-anti-murine IgM
followed by color development produced by enzymatic cleavage of ABTS. Antigen
25
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
binding ability was compared by indirect ELISA analysis of purified antibody
against antigen. Various binding substrates, including single stranded DNA,
nucleohistone, crude DNA, and nucleoside-linked bovine serum albumin (prepared
as described p r e v i o u s l y ^ , 33 were C O ated on microtiter plates at 100 pg/mL to
capture dilutions of purified antibodies. Bound antibody was detected by probing
with horse-radish-peroxidase-conjugated goat anti-human IgG (FcSp) antibody
followed by color development produced by enzymatic cleavage of ABTS.
Isoelectric Focusing Electrophoresis
The pis of the chimeric TNT antibodies were determined by isoelectric
focusing analysis. Antibodies and standard markers with pi values ranging from
4.1—9.5 were electrofocused on gels using a Model 111 Mini 1EF Cell (Bio-Rad.
Hercules, CA) following the manufacturer’s protocol. After staining the gels with
Coomassie Blue R250 and crocein scarlet to reveal protein bands, the pi values of
the antibodies were determined by comparing their bands to the standard bands of
known pi.
Indirect Immunofluorescence
The binding patterns of chTNT-l, chTNT-2, and chTNT-3 to bind to fixed
cells were examined in indirect immunoflurorescence studies as described
p r e v io u s ly 18’ 22 Briefly, various normal and tumor cell lines were grown on multi
well glass slides (Cel-Line Associates, Neufield, NJ) to confluence and fixed with
26
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
2% paraformaldehyde (Polysciences, Warrington, PA) for 10 minutes at room
temperature and acetone for 3 minutes at -20°C. After rinsing the slides in PBS,
muTNT-1, muTNT-2, and muTNT-3 hybridoma supernatants, chTNT-1. chTNT-2.
and chTNT-3-containing supernatants, and conditioned media from the non
transfected cell line were applied to the wells and allowed to incubate for one hour in
a humidified 37°C chamber. The slides were then washed and bound antibody
detected with fluorescein-conjugated detection antibody (goat-anti-human IgG
F(ab’)2 or goat-anti-mouse immunoglobulin F(ab’):). The slides were again washed
and then examined under a UV epifluorescent microscope (Leitz, Rockleigh. NJ).
Images were obtained with the Optronics Magnafire digital camera and image
analysis software (Optronics, Goleta, CA).
Pharmacokinetic Clearance and Biodistribution
It has previously been demonstrated that half-life values of IgG clearance
from mice determined by whole body dosimetry are statistically indistinguishable
from those calculated by blood sa m p lin g ^ . Whole body dosimetry was therefore
performed for this pharmacokinetic study. Six week-old BALB/c mice were given
potassium iodide ad libitum for one-week in drinking water to block thyroid uptake
of radioiodine and then injected intravenously with i:5I-labeled antibody. Whole
body activity immediately post-injection and at selected timpoints thereafter was
measured with aCRC-7 microdosimeter (Capintec, Inc., Pittsburgh, PA). The data
were analyzed and half-lives determined as described p r e v i o u s l y ^ . 35
2 7
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
Six-week old BALB/c mice were inoculated subcutaneously in the left flank
with approximately lxlO7 Madison 109 murine lung adenocarcinoma cells. Five
days later, when the tumors had reached approximately 0.5-1.0 cm in diameter, the
mice were injected intravenously with aO.lmL inoculum of l2 5 I-chTNT-l, ,2 5 I-
chTNT-2, or l2 5 I-chTNT-3 (n=5/group). On day 5 post-injection, the animals were
sacrificed via sodium pentobarbital overdose and blood, tumor, and various organs
were removed, weighed, and assayed for radioactivity in a gamma counter. The data
for each mouse were expressed as median percent injected dose/gram (%lD/g) and
median tumor:organ ratio (cpm per gram tumor/cpm per gram organ). Wilcoxon
rank sum analysis was performed to detect statistically significant differences in the
biodistribution of the two molecules (p < 0.05).
Macroautoradiography Studies
The in vivo localization patterns of the chimeric TNT antibodies were
examined through macroautoradiography studies as previously described * 3. Briefly,
animals bearing subcutaneously implanted Madison 109 and RENCA tumors
approximately 1 cm in diameter were injected intravenously with 10 pCi 1 2 5 I-labeled
chTNT-l, chTNT-2, chTNT-3, or chLym-1. After three days, the animals were
sacrificed and the tumors, kidneys, and liver removed and fixed overnight in 10%
neutral buffered formalin. The tissues were then embedded in paraffin, cut into 4 pm
sections, and stained with hematoxylin and eosin. The slides were encased in Saran
wrap and exposed to a phosphor storage screen in a light-tight cassette for at least 7
28
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
days. The screen was read using a Phosphorimager SI with ImageQuaNT software
(Molecular Dynamics, Sunnyvale, CA). Digitized images of the H&E slides were
obtained for comparison by scanning the tissue sections with a Umax Astra 2 100U
scanner (UMAX Technologies, Inc., Fremont, CA).
RESULTS
Construction, expression, and purification o f chTNT-2
The heavy and light chain variable regions were cloned from the muTNT-2
hybridoma and inserted into previously constructed expression vectors containing the
appropriate leader sequences and constant regions (human yl and k. respectively)
under the control of the hCMV promoter (Figure 2-1). The resulting expression
vectors pEE6/chTNT-2 HC and pEE12/chTNT-2 LC were co-transfected into the
NSO murine myeloma cell line for stable, long-term expression. Antibody producing
clones were selected in glutamine-free hybridoma media and screed for maximal
secretion via ELISA. The highest producing clone, producing approximately 3 1.3
pg/mL/106 cells /24 hours in static culture, was scaled up in a 10-L bioreactor. The
fusion protein was purified by sequential Protein A affinity and ion-exchange
chromatography, yielding > 60 pg/mL. Reducing SDS-polyacrylamide gel
electrophoresis revealed two discrete and focused bands at approximately 55 and 25
kDa, corresponding to the predicted molecular weights of the chimeric
29
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
Figure 2-1: Construction of chTNT-2 expression vectors. A Schematic diagram
illustrating the insertion of the TNT-2 heavy chain variable region between an
appropriate leader sequence and the human yl constant region in the glutamine
synthase (GS) pEE6 expression vector. B Schematic diagram illustrating the
insertion of the TNT-2 light chain variable region between an appropriate leader
sequence and the human k constant region in the GS pEE12 expression vector.
A H u m a n 71
GGT GTC GAG TGT "GCT AGO ACC A AG
Gly Val Gin Cys Ala Ser Thr Lys
Human yl
B
H u m a n K
ATG TOG CGA GGA
Met S er Arg Gy
Human K
AAA CGT ACGIGTG GOT GCA CCA*
Lys Arg T h rJV al Ala Ala Pro
30
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
immunoglobulin heavy and light chains (Figure 2-2). HPLC analysis demonstrated a
single sharp peak for each antibody, retention times of 9.8 minutes for chTNT-l, 9.8
minutes for chTNT-2, and 9.7 minutes for chTNT-3 (data not shown). Isoelectric
focusing gel electrophoresis of chTNT-2 demonstrated the highly charged nature of
this molecule with pi > 9.6 (Figure 2-3), similar to the results reported previously
with chTNT-l and chTNT-3.
Immunobiochemical analysis
Immunoreactivity of chTNT-2 with the target antigen of the parent antibody,
muTNT-2, was assessed by comparing its ability to compete for immobilized
antigen. Increasing concentrations of chTNT-2 or an irrelevant monoclonal antibody
(chLym-1) were evaluated for their ability to inhibit the binding of muTNT-2 to
nucleohistone-coated microtiter plates. As predicted, chTNT-2 was able to compete
successfully with muTNT-2 for its antigen (data not shown). chLym-1 . however,
failed to compete with muTNT-2 for nucleohistone, consistent with its selective
affinity for the tumor associated HLA-DR10 molecule^ U 36, 37
Fixed Raji cells were incubated with l2 5 I-labeled antibody and bound
radioactivity determined to calculate the avidity constant. chTNT-2 was determined
to have a binding constant of 1.2 x 109 M'1 , which is comparable to 1.4 x 109 M '.the
avidity constant of chTNT-338, but approximately one log lower than the avidity
constant of chTNT-1, 1.0 x 10'° M 1 .
31
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
Figure 2-2: SDS-polyacrylamide gel electrophoretic analysis of chTNT-l, chTNT-2,
and chTNT-3. Purified chTNT-l, chTNT-2, and chTNT-3 were analyzed by SDS-
PAGE under reducing conditions. Lane I: chTNT-l; lane 2: chTNT-2: lane 3:
chTNT-3; lane 4: low molecular weight standards.
3 2
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
Figure 2-3: Determination of the pi of chTNT-l, chTNT-2, and chTNT-3. IEF gel
electrophoresis was performed on the three antibodies to determine their respective
pis. Lane 1: IEF Standards (4-10); Lane 2: chTNT-l; Lane 3: chTNT-2; Lane 4:
chTNT-3. As previously reported, chTNT-l and chTNT-3 demonstrated highly
charged pis > 9.6. chTNT-2 also demonstrated similarly charged pi > 9.6.
33
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
Antigenic characterization
The relative abilities of the chimeric TNT antibodies to bind various nucleic
acid preparations in indirect ELISA were compared to characterize the repertoire of
TNT targeting. As shown in Table 2-1, chTNT-l was able to bind to the three DNA
preparations tested, while chTNT-3 was able to bind to both DNA and RNA.
Interestingly, chTNT-3 was unable to bind nucleohistone, under the conditions
tested, suggesting that chTNT-3’s antigen is inaccessible in this tightly compressed
form of DNA. Further characterization of chTNT-3 indicated that it specifically
binds to guanosine residues, as the antibody was able to bind specifically to bovine
serum albumin (BSA) conjugated guanosine. In contrast, chTNT-2 appeared unable
to bind to single stranded nucleic acids and instead bound two forms of duplex DNA
(nucleohistone and crude DNA).
Immunofluorescence analysis
Intracellular patterns of chimeric TNT antibody binding were analyzed via
indirect immunofluorescence. Various normal and tumor cell lines were used as
targets for evaluation and staining was similar between normal and malignant tissues
(Figures 2-4 and 2-5). chTNT-l produced a uniform nuclear staining pattern in all
tissues analyzed. chTNT-2, produced a nuclear rim staining pattern in virtually all
cell lines analyzed and an intense chromosomal staining pattern for mitotic cells in
particular. While chTNT-3 demonstrated primarily nuclear staining pattern, in
particular samples the antibody produced a cytoplasmic and nucleolar staining
34
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
Table 2-1: Antigenic specificity of chTNT Abs. The relative abilities of chTNT-1,
chTNT-2, and chTNT-3 to bind to a panel of nucleic acid species were analyzed by
indirect ELISA analysis.
Antigen chTNT-1 chTNT-2 chTNT-3
nucleohistone +++ ++ -
crude DNA +++ ++ +++
ssDNA +++ +/- ++•
total RNA - - -H-
G-BSA - n.d. +++
G-BSA = guanosine-BSA; n.d. = not done
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
Figure 2-4: Binding patterns of TNT antibodies. Indirect immunofluorescent
analysis was used to determine the binding patterns of the murine and chimeric TNT
antibodies to fixed human umbilical vein cells.
Murine Antibodies Chimeric Antibodies
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
Figure 2-5: Binding patterns of TNT antibodies. Indirect immunofluorescent
analysis was used to determine the binding patterns of the murine and chimeric TNT
antibodies to fixed LS174T human colon carcinoma cells.
Murine Antibodies Chimeric Antibodies
TNT-1
TNT-2
TNT-3
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
pattern, consistent with previous reports^. This observation can be explained by
interaction of chTNT-3 with single stranded nucleic acids and exposed guanosine
residues in these two intracellular locations (messenger RNA in the cytoplasm and
ribosomal RNA in the nucleoli).
In vivo pharmacokinetic and biodistribution studies
As shown in Figure 2-6, whole body clearance studies were performed in
non-tumor-bearing mice to establish differences in the pharmacokinetics of
chTNT-I, chTNT-2, and chTNT-3. BALB/c mice were injected with i:5I-labeled
chTNT-2 or biotinylated chTNT-2 antibody and whole body activity measured at
various timepoints thereafter in a microdosimeter. Because whole-body dosimetry
was used, only the terminal P phase of clearance could be calculated. Data from 8 h
onward were used to minimize contributions of the a phase. Previous studies
utilizing this method have determined the whole-body half-life of chTNT-1 and
chTNT-3 to be 29 ± 1 h and 134 ± 4 h, respectively^. In comparison, the whole-
body half-life of chTNT-2 was determined to be significantly increased to 172 ± 9 h.
The tumor and normal organ biodistribution of intravenously administered
l2 5 I-labeled chTNT-l, chTNT-2, and chTNT-3 were compared in Madison 109
murine lung adenocarcinoma-bearing BALB/c mice (Figure 2-7). The
pharmacokinetic effect of the rapid clearance of chTNT-I is reflected in the
relatively low retention of antibody in the tumor (median level 0.78% ID/g) by day
five. In comparison, the overall tumor uptake of chTNT-2 and chTNT-3, which
38
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
Figure 2-6: Pharmacokinetic clearance of l2 5 I-labeled chTNT-1, chTNT-2. and
chTNT-3 in BALB/c mice. Whole body clearance of recombinant antibodies were
determined using non-tumor bearing BALB/c mice. Groups of mice (n=5) injected
i.v. with l2 5 I-labeled chTNT-l, chTNT-2, and chTNT-3. Whole body activity at
injection and at selected times thereafter measured with microdosimeter. Data
analyzed and half-lives determined using RSTRIP pharmacokinetic program
(MicroMath, Inc., Salt Lake City, UT).
1
0.1
150 50 100 200 250 0
Time (hours)
39
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
Figure 2-7: Five Day Biodistribution of chTNT-1, chTNT-2, and chTNT-3. Six-week
old BALB/c mice bearing established Madison 109 murine lung adenocarcinoma
tumors in the left thigh were injected intravenously with 30 jug of l25I-labeled
chTNT-1, chTNT-2, or chTNT-3. The mice were sacrificed 120 hours later and the
organs harvested for biodistribution analysis to determine the percent injected
dose/gram for each time point (n=5 per group).
Q 1 chTNT-I 5 chTNT-2 El chTNT-3
80
4 0
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
demonstrate slower clearance, are significantly increased (median levels 5.78 and
8.46%ID/g, respectively, p<0.05). However, the preponderance of tumor to organ
ratios, which reflect the specificity of tumor binding and provide an indication of
possible toxicity due to the conjugated reagents, are comparable between all three
antibodies. Although the immunofluorescence studies indicated positive reactivity
of fixed normal tissues with the chimeric TNT antibodies, it is significant to note that
there remains specificity of binding to tumor tissues and no significant accumulation
of antibody occurred in normal tissues in vivo.
Tissue localization studies:
Macroautoradiography and histologic analyses were performed to evaluate
the microscopic distribution of antibody in vivo. Tumor bearing mice were injected
intravenously with I2 5 I-!abeled chTNT-1, chTNT-2, chTNT-3, and chLym-l
(irrelevant control antibody). Three days later, animals were sacrificed by sodium
pentobarbitol overdose and tumor, liver, and kidneys removed and prepared for
histologic examination. Tissue slices (4 pm thickness) were stained with
hematoxylin and eosin and exposed to a phosphor storage screen to determine tissue
localization. As seen in Figure 2-8, chTNT-1, chTNT-2, and chTNT-3 all display
similar intratumoral distribution, with the majority of label accumulating in areas of
frank necrosis. Normal tissue localization is only observed in areas of significant
blood accumulation. In contrast, no significant localization of chLym-1 is observed,
consistent with the lack of its antigen expression in the tumor and normal organs.
41
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
Figure 2-8: Tissue localization of chTNT-1, chTNT-2, chTNT-3, and chLym-1 in
vivo. A H&E-stained sections of tumor, kidney, and liver harvested from Madison
109 murine lung adenocarcinoma-bearing BALB/c mice injected three days prior
with ,2 5 I-labeled antibody. B Autoradiographic images of the same sections
produced using a storage phosphor screen.
4 2
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
Effect o f chemical modification
Biotin modification of chTNT-2 performed to increase whole body clearance
of the antibody. Avidity constant determination was performed with biotinylated
chTNT-2 against fixed Raji cells to evaluate effects of the chemical modification on
antigen binding. chTNT-2/5B and chTNT-2/10B had avidity constants of 1.2 x 10°
and 1.0 x 109 M '\ respectively, compared to that of unmodified chTNT-2 (1.2 x 109
M 1 ), confirming that biotin-conjugated chTNT-2 retains the immunoreactivity of
chTNT-2 and this modification does not impair antigen-antibody interactions.
In contrast to previous work that demonstrated enhanced whole body
clearance of antibodies following biotin modification, biotinylated chTNT-2 retained
essentially the same clearance profile as unmodified chTNT-2, with whole-body
half-lives of 187 ± 14 and 231 ± 7 h, respectively, for chTNT-2/5B and chTNT-2/
10B (Figure 2-9). Biodistribution analysis demonstrated some reduction in blood
level of the biotinylated antibody with no alteration in tumor uptake, thus producing
improved tumor:organ ratios compared to chTNT-2 (Figure 2-10). However, the
dramatic results seen with chemical modification of chTNT-3 ^ were not replicated
with chTNT-2. Isoelectric focusing determination of the pis of biotinylated
chTNT-2 demonstrates the insensitivity of chTNT-2 to charge modification in this
manner (Figure 2-11). In contrast to a previous study that demonstrated significant
reduction in the isoelectric point of chTNT-3 following conjugation with 2-3 biotin
molecules per antibody^, conjugation with five biotin molecules per chTNT-2
antibody did not change the isoelectric point. Significant alteration in isoelectric
43
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
Figure 2-9: Pharmacokinetic clearance of biotinylated chTNT-2. Whole body
clearance of recombinant antibodies were determined in BALB/c mice. Groups of
mice (n=5) injected i.v. with l2 5 I-labeled chTNT-2, chTNT-2/5B, and chTNT-2/10B.
Whole body activity at injection and at selected times thereafter measured with
microdosimeter. Data analyzed and half-lives determined using RSTRIP
pharmacokinetic program (MicroMath, Inc., Salt Lake City, UT).
100
T S
300 100 200 400 n
Time (hours)
Molecule
Tw
♦
chTNT-2
172 ± 9 h
A
chTNT-2/5B 187 ± 14 h
■
chTNT-2/1 0B
231 ±7 h
4 4
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
Figure 2-10: Five day biodistribution of biotinylated chTNT-2. Six-week old
BALB/c mice bearing established Madison 109 murine lung adenocarcinoma tumors
in the left flank were injected intravenously with 30 |ig of l2 5 I-labeled chTNT-2/5B
or chTNT-2/10B. The mice were sacrificed 120 hours later and the organs harvested
for biodistribution analysis to determine the percent injected dose/gram tissue for
each time point (n = 5 per group).
chTNT-2 ID chTNT-2/5B 0 chTNT-2/l0B
1 ,
T
4 5
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
Figure 2-11: Determination of the pi of biotinylated chTNT-2. Isoelectric focusing
gel electrophoresis was performed on chTNT-2 biotinylated at two different levels
(chTNT-2/5B and chTNT-2/10B have an average of five and ten molecules of biotin
per antibody, respectively) to determine their respective pi. Both unmodified
chTNT-2 and chTNT-2/5B and chTNT-3 demonstrated very highly charged pis >
9.6. chTNT-2 also demonstrated similarly charged pi > 9.6.
..v’T X .*-v . *. ' • ? . : - ' * + * >
si' few ‘ V
L d r t e i . v * • ’ ;*■ V V
4 6
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
point was not achieved until 10 biotin molecules were attached per chTNT-2;
however, the observed alteration in pi (7.1-8.6) did not accompany an alteration in
whole body clearance or biodistribution of chTNT-2.
DISCUSSION
We have previously generated two human-mouse chimeric antibodies with
potential in Tumor Necrosis Treatment and demonstrated their utility in the in vivo
targeting of solid tumors. In this study, a new human-mouse chimeric antibody,
chTNT-2, was generated as a third potential reagent in TNT-based immunotherapy.
The glutamine synthase (GS) expression system was used for high level expression
of the recombinant antibody from NSO murine myeloma cells. Biochemical analysis
of the protein revealed retention of antigen binding characteristics as evidenced by
competition ELISA and radioimmunoassay; however indirect immunofluorescence
analysis on paraformaldehyde-fixed normal and tumor cells revealed slightly altered
binding patterns. This difference may be due to the isotype switch from murine IgM.
k to human IgG,, K , which may have increased the accessibility to specific antigen
for the chTNT-2 antibody compared to the larger murine IgM. The intensity of
chTNT-2 immunofluorescent staining was moderately decreased in comparison to
that of muTNT-2; however, no absolute difference can be definitively concluded due
to the different secondary antibodies used for detection.
Despite virtually identical size (Figure 2-2 and HPLC results) and charge
(Figure 2-4) observed for each of the antibodies in the TNT panel, the three chimeric
4 7
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
antibodies displayed markedly distinct behavior in vivo. The whole-body half-lives
of chTNT-1, chTNT-2, and chTNT-3 are significantly different at 30. 172, and 134
hours, respectively (Figure 2-6). Previous work by our lab and others indicated that
observed differences in the pharmacokinetic behavior of antibodies and antibody-
derivatives could be attributed to alterations in size^ 39 charge-3,40,41
However, our current study indicates that these factors are not the sole determinants
of this parameter.
A likely possibility is that these antibodies are interacting with factors in the
circulation that either increase or decrease its systemic persistence. Specific binding
to the antigen variable regions could lead to formation of aggregates, which clear
more rapidly from the body. By contrast, non-specific binding to antibody residues
could alter the overall charge of the antibody and mask the innate charge of the
protein. Direct negative charge modification would increase the rate of clearance by
interrupting the normal electrostatic forces which are responsible for background
binding^I. Positive charge modification increases cell surface interaction non-
specifically, which increases background uptake in normal tissues^. Other forms of
chemical modification produce differential effects by masking charged residues,
decreasing uptake by the reticuloendothelial system, or increasing the size of the
molecule, as has been observed with synthetic conjugation with oligosaccharide,
polymers, biotin, or succinimidyl 3-(2-pyridyldithio)propionate (SPDP) * 3,42-49 ^
serendipitous finding was the interaction of chTNT-2 with determinants on the
48
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
Sephadex column that caused increased retention time on the HPLC column (data
not shown), which was eliminated by extensive washing of the column with 6 M
guanidine. We are currently investigating possible interaction with serum
constituents to determine if interactions with serum constituents are responsible for
the extensive in vivo persistence of this antibody.
Previous work indicated a possible association between tumor uptake and
blood clearance, with enhanced specific tumor accretion observed with prolonged
blood presence, although at the expense of greater systemic exposure and decreased
tumor:organ ratios at early time p o i n t s ^ , 35 [ndeed, this phenomenon is seen in the
behavior of chTNT-1 and chTNT-3. While chTNT-l displayed the strongest binding
to Raji cells and a wide array of nucleic acid based targets, it displays only moderate
tumor uptake due to its rapid clearance from the body. chTNT-3, on the other hand,
has a prolonged serum persistence and significantly increased tumor accretion.
However, our current work demonstrates that this phenomenon is not an absolute
predictor. Indeed, chTNT-2, which displayed the longest whole-body half-life, had
only intermediate tumor uptake between chTNT-l and chTNT-3. Tumor and normal
tissue localization studies by macroautoradiographic analysis demonstrated similar
localization patterns, with the selective accumulation observed primarily in areas of
frank necrosis. Normal organ localization was seen only in areas of significant blood
presence.
One possible explanation is variable presence of antigens in different tumors.
It is highly likely that not all necrosis is the same with regards to tumor necrosis
49
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
antigens. Although the TNT antibodies developed thus far all bind nucleic acid
based intracellular antigens, the character of this binding and the individual targets
are vastly different between the particular antibodies. Furthermore, differences in
antigen accessibility could affect tumor accretion. Cell membrane damage is a
critical step in the irreversible injury of cells leading to necrosis. This injury allows
intracellular penetration by antibodies and access to cytoplasmic antigens such as the
single stranded nucleic acid target of chTNT-3. In contrast, purely nuclear antigen
binding antibodies may not be able to successfully affix their targets until total cell
disruption has occurred. As the vast quantity of antigen present in fixed cells has
prevented accurate quantification of chimeric TNT antibody binding sites thus far
(unpublished observations), we cannot yet compare the relative amounts of
accessible antigen present in various tumor cells. Further macroautoradiographic
studies are in progress to characterize this feature in various tumor models in vivo.
Biotin modification was utilized in an attempt to decrease the
pharmacokinetic half-life of chTNT-2. Although no alteration in antigen binding
ability was observed following chemical modification, unlike past results with
chTNT-1 and chTNT-3, which demonstrated significant reductions in serum
persistence upon biotinylation 50^ conjugation with up to ten molecules of biotin
was not sufficient to alter in vivo behavior. These results indicate that, at least for
certain antibodies, other parameters, such as interaction with serum factors, are more
important than protein charge. Accordingly, the efficacy of biotin modification is
limited by factors intrinsic to the antibody and, thus, chemical modification may not
50
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
necessarily represent a universally applicable method of altering pharmacokinetic
behavior of proteins.
In summary, in vivo behavior of Tumor Necrosis Treatment antibodies in
influenced by multiple factors that are not yet fully understood. Consequently,
appropriate selection of therapeutic TNT antibodies remains empiric and requires the
careful consideration of several parameters, including choice of antigenic target (in
terms of intracellular distribution, quantity, and in vivo accessibility), antibody size
and charge, and antibody interactions (both specific and non-specific) with serum
factors. Continuing work will focus primarily on antigen distribution in various
tumor models as well as characterizing the antibody-serum factor interactions to
determine the most efficacious antibodies for use in tumor immunotherapy.
REFERENCES
1. Hasemann C, Capra J. High-level production of a functional immunoglobulin
heterodimer in a baculovirus expression system. Proc Natl Acad Sci U S A
1990; 87:3942-6.
2. Bebbington CR, Renner G, Thomson S, King D, Abrams D, Yarranton GT.
High-level expression of a recombinant antibody from myeloma cells using a
glutamine synthetase gene as an amplifiable selectable marker.
Bio/Technology 1992; 10.
3. Boulianne GL, Hozumi N, Shulman MJ. Production of functional chimaeric
mouse/human antibody. Nature 1984; 312:643-646.
4. Morrison SL, Johnson MJ, Herzenberg LA, Oi VT. Chimeric human
antibody molecules: mouse antigen-binding domains with human constant
region domains. Proceedings of the National Academy of Sciences USA
1984;81:6851-6855.
51
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
5. Liu AY, Robinson RR, Hellstrom KE, E.D. M, Chang C, Hellstrom I.
Chimeric human-mouse IgGl antibody that can mediate lysis of cancer cells.
Proceedings of the National Academy of Sciences USA 1987; 84:3439-3443.
6. LoBuglio AF, Wheeler RH, Trang J, et al. Mouse/human chimeric
monoclonal antibody in man: kinetics and immune response. Proceedings of
the National Academy of Sciences USA 1989; 86:4220-4224.
7. Adams GP. Improving the Tumor Specificity and Retention of Antibody-
Based Molecules. in vivo 1998; 12:11-22.
8. McLaughlin P, White C, Grillo-Lopez A, Maloney D. Clinical status and
optimal use of rituximab for B-cell lymphomas. Oncology (Huntingt) 1998:
12:1763-9; discussion 1769-70, 1775-7.
9. Brenner T, Adams V. First MAb approved for treatment of metastatic breast
cancer. J Am Pharm Assoc (Wash) 1999; 39:236-8.
10. Weiner L. Monoclonal antibody therapy of cancer. Semin Oncol 1999;
26:43-51.
11. Dillman R. Perceptions of Herceptin: a monoclonal antibody for the
treatment of breast cancer. Cancer Biother Radiopharm 1999: 14:5-10.
12. Epstein AL, Khawli LA, Chen F-M, Hu P, Glasky MS, Taylor CR. Tumor
necrosis imaging and treatment of solid tumors. In: Torchilin VP. ed.
Handbook of Targeted Delivery of Imaging Agents. Boca Raton, FL: CRC
Press, 1995:259-288.
13. Hornick JL, Sharifi J, Khawli LA, et al. A new chemically modified chimeric
TNT-3 monoclonal antibody directed against DNA for the
radioimmunotherapy of solid tumors. Cancer Biotherapy &
Radiopharmaceuticals 1998; 13:255-268.
14. Lundberg B, Griffiths G, Hansen H. Conjugation of an anti-B-cell lymphoma
monoclonal antibody, LL2, to long-circulating drug-carrier lipid emulsions. J
Pharm Pharmacol 1999; 51:1099-105.
15. Rosenblum MG, Marks JW, Cheung LH. Comparative cytotoxicity and
pharmacokinetics of antimelanoma immunotoxins containing either natural or
recombinant gelonin. Cancer Chemother Pharmacol 1999:44.
52
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
16. Homick JL, Khawli LA, Hu P, Lynch M, Anderson PM, Epstein AL.
Chimeric CLL-1 Antibody Fusion Proteins Containing Granulocyte
Macrophage Colony-Stimulating Factor or Interleukin-2 With Specificity for
B-Cell Malignancies Exhibit Enhanced Effector Functions While Retaining
Tumor Targeting Properties. Blood 1997; 89:4437-4447.
17. Epenetos AA, Snook D, Durbin H, Johnson PM, Taylor-Papadimitriou J.
Limitations of radiolabeled monoclonal antibodies for localization of human
neoplasms. Cancer Research 1986; 46:3183-3191.
18. Epstein AL, Chen F-M, Taylor CR. A Novel Method for the Detection of
Necrotic Lesions in Human Cancers. Cancer Research 1988: 48:5842-5848.
19. Epstein AL, Chen D, Ansari A, et al. Radioimmunodetection of necrotic
lesions in human tumors using 1-131 labeled TNT-1 F(ab')2 monoclonal
antibody. Antibody, Immunoconjugates, and Radiopharmaceuticals 1991;
4:151-161.
20. Weinstein J, van Osdol W. Early intervention in cancer using monoclonal
antibodies and other biological ligands: micropharmacology and the "binding
site barrier". Cancer Res 1992; 52:2747s-275Is.
21. Saga T, Neumann R, Heya T, et al. Targeting cancer micrometastases with
monoclonal antibodies: a binding-site barrier. Proc Natl Acad Sci U S A
1995; 92:8999-9003.
22. Miller GK, Naeve GS, Shaik AG, Epstein AL. Immunologic and biochemical
analysis of TNT-1 and TNT-2 monoclonal antibodies binding to histones.
Hybridoma 1993; 12:689-698.
23. Sharifi J, Khawli LA, Homick JL, Epstein AL. Improving monoclonal
antibody pharmacokinetics via chemical modification. Q J NucI Med 1998:
42:242-9.
24. Tom BH, Rutzky LP, Jakstys MM, Oyasu R, Kaye Cl, Kahan BD. Human
colonic adenocarcinoma cells. I. Establishment and description of a new line.
In Vitro 1976; 12:180-191.
25. Murphy GP, Hrushesky WJ. A murine renal cell carcinoma. Journal of the
National Cancer Institute 1973; 50:1013-1025.
26. Marks TA, Woodman RJ, Geran RI, Billups LH, Madison RM.
Characterization and Responsiveness of the Madison 109 Lung Carcinoma to
Various Antitumor Agents. Cancer Treatment Reports 1977; 6 1:1459-1470.
53
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
27. Jones ST, Bendig MM. Rapid PCR-cloning of full-length mouse
immunoglobulin variable regions. Bio/Technology 1991; 9:88-89.
28. Hu P, Homick JL, Glasky MS, et al. A chimeric Lym- 1/interleukin 2 fusion
protein for increasing tumor vascular permeability and enhancing antibody
uptake. Cancer Research 1996; 56:4998-5004.
29. Green NM. Spectrophotometric determination of avidin and biotin. Methods
inEnzymology 1970; 18A:418-424.
30. Hu P, Glasky MS, Yun A, et al. A human-mouse chimeric Lym-1
monoclonal antibody with specificity for human lymphomas expressed in a
baculovirus system. Human Antibodies and Hybridomas 1995: 6:57-67.
31. Rose LM, Gunasekera AH, DeNardo SJ, DeNardo GL, Meares CF.
Lymphoma-selective antibody Lym-1 recognizes a discontinuous epitope on
the light chain of HLA-DR10. Cancer Immunology Immunotherapy 1996:
43:26-30.
32. Erianger BF, Beiser SM. Antibodies Specific for Ribonucleosides and
Ribonucleotides and Their Reaction with DNA. Proc Natl Acad Sci U S A
1964; 52:68-74.
33. Munns TW, Liszewski MK, Tellam JT, Ebling FM, Hahn BH. Antibody-
Nucleic Acid Complexes. Identification of the Antigenic Determinant of a
Murine Monoclonal Antibody Specific for Single-Stranded Nucleic Acids.
Biochemistry 1982; 21:2929-2936.
34. Zuckier LS, Georgescu L, Chang CJ, Scharff MD, Morrison SL. The use of
severe combined immunodeficiency mice to study the metabolism of human
immunoglobulin G. Cancer 1994; 73:794-799.
35. Hornick JL, Sharifi J, Khawli LA, et al. Single Amino Acid Substitution in
the Fc Region of Chimeric TNT-3 Antibody Accelerates Clearance and
Improves Immunoscintigraphy of Solid Tumors. Journal of Nuclear Medicine
2000;41:355-362.
36. Epstein AL, Marder RJ, Winter JN, et al. Two new monoclonal antibodies,
Lym-1 and Lym-2, reactive with human B-lymphocytes and derived tumors,
with immunodiagnostic and immunotherapeutic potential. Cancer Research
1987; 47:830-840.
37. Rose L, Deng C, Scott S, et al. Critical Lym-1 binding residues on
polymorphic HLA-DR molecules. Mol Immunol 1999; 36:789-97.
5 4
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
38. Homick JL, Khawli LA, Hu P, Sharifi J. Khanna C, Epstein AL. Pretreatment
with a Monoclonal Antibody/Interleukin-2 Fusion Protein Directed against
DNA Enhances the Delivery of Therapeutic Molecules to Solid Tumors.
Clinical Cancer Research 1999; 5:51-60.
39. Colcher D, Goel A, Pavlinkova G, Beresford G, Booth B, Batra S. Effects of
genetic engineering on the pharmacokinetics of antibodies. Q J Nuci Med
1999;43:132-9.
40. Partridge WM, Triguero D, Buciak J, Yang J. Evaluation of cationized rat
albumin as a potential blood-brain barrier drug transport vector. J Pharmacol
Exp Ther 1990; 255:893-9.
41. Narula J, Petrov A, Bianchi C, et al. Noninvasive localization of experimental
atherosclerotic lesions with mouse/human chimeric Z2D3 Ftab'b specific for
the proliferating smooth muscle cells of human atheroma. Imaging with
conventional and negative charge-modified antibody fragments. Circulation
1995; 92:474-484.
42. Abuchowski A, McCoy J, Palczuk T, Davis E. Effect of covalent atachment
of polyethylene glycol on immunogenicity and circulating life of bovine liver
catalase. J Biol Chem 1977; 252:3582-6.
43. Fagnani R, Hagan M, Bartholomew R. Reduction of immunogeneicity by
covalent modification of murine and rabbit immunoglobulin with oxidized
dextran of low molecular weight. Cancer Res 1990; 50:3638-45.
44. Takashina K, Kitamura K, Yamaguchi T, Noguchi A, Noguchi A. Tsurumi
Hea. Comparitive pharmacokinetic properties of murine monoclonal antibody
A7 modified with neocarzinostatin, dextran, and polyethylene glycol. Jpn J
Cancer Res 1991; 82:1145-50.
45. Kitamura K, Takahashi T, Yamaguchi T, Noguchi A, Noguchi A. Takashina
Kea. Chemical engineering of the monoclonal antibody A7 by polyethylene
glycol for targeting cancer chemotherapy. Cancer Res 1991; 51:4310-5.
46. Klibanov AL, Marynov AV, Slinkin MA, Sakharov I, Smirnov MD,
Muzykantov VRea. Blood clearance of radiolabeled antibody: enhancement
by lactosamination and treatment with biotin-avidin or anti-mouse IgG
antibodies. J Nucl Med 1988; 29:1951-6.
47. Chapman AP, Antoniw P, Spitali M, West S, Stephens S, King DJ.
Therapeutic antibody fragments with prolonged in vivo half-lives. Nature
Biotechnology 1999; 17:780-783.
55
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
48. Wadsley JJ, Watt RM. The effect of pH on the aggregation of biotinylated
antibodies and on the signal-to-noise observed in immunoassays utilizing
biotinylated antibodies. Journal of Immunological Methods 1987: 103:1-7.
49. Khawli LA, Glasky MS, Alauddin MM, Epstein AL. Improved tumor
localization and radioimaging with chemically modified monoclonal
antibodies. Cancer Biotherapy & Radiopharmaceuticals 1996: 11:203-215.
50. unpublished results.
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
Chapter 3. Chimeric TNT-3 Antibody-Murine Interferon-y Fusion
Protein for the Immunotherapy of Solid Malignancies
ABSTRACT
Interferon-y (IFN-y) has been used in the experimental treatment of cancer
with limited success. Despite direct cytotoxic effects on tumor cells and the ability
to stimulate the antitumor activities of a variety of effector cells, therapeutic response
has been less than impressive due to the toxicity of high systemic concentrations as
well as inadequate sustained intratumoral concentrations. An alternative to systemic
infusion is targeted delivery of IFN-y through the use of an antibody-cytokine fusion
protein approach, in which the cytokine localizes specifically to tumors using the
specific antigen-binding moiety of the antibody. In this fashion, high local
concentrations of IFN-y may be achieved in the tumor microenvironment while
minimizing systemic levels.
In the current studies, we have developed a chimeric antinuclear antibody-
murine IFN-y fusion protein (chTNT-3/muIFN-y) and begun its characterization both
in vitro and in vivo in a syngeneic murine tumor model. The fusion protein retains
both its antigen targeting and cytokine activities, as assessed by in vitro assays.
Pharmacokinetic and biodistribution studies demonstrate a sustained in vivo half-life
and significant intratumoral accretion. Preliminary immunotherapeutic studies in a
syngeneic murine model of lung carcinoma demonstrate significant intratumoral
57
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
infiltration by leukocytes, primarily by macrophages and CD4'CD8Thy-1.2*
lymphocytes. Additionally, intravenous administration of fusion protein
significantly decreases the number of metastatic foci in an experimental model of
pulmonary metastasis. These studies demonstrate that the use of chTNT-3/muIFN-y
fusion protein approach effectively delivers the cytokine into the tumor environment
and represents a promising strategy for the targeted immunotherapy of solid
malignancy.
INTRODUCTION
The interferons (IFNs) are a family of cytokines named for their ability to
render sensitive cells resistant to viruses by inducing them into an antiviral state. In
actuality, the IFNs are actually multipotent biological response modifiers involved in
a myriad of immunological functions, including activation of a host response against
microbial agents (reviewed in *) and natural tumor resistance by both direct and
indirect mechanisms.
The type I interferons, IFN-a, IFN-P, IFN-to, and IFN-t (limited to sheep and
cattle), are derived from a single ancestral gene, localize to the same chromosome,
and share sufficient homology to bind to the same cell-surface receptor (IFN-ot/p R).
In contrast, the sole type II interferon, IFN-y, has no significant sequence homology
with type I IFNs and binds to a unique cell surface receptor (IFN-yR). The type I
IFNs have been used for the treatment of disease, particularly in cancer, because of
58
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
their potential in enhancing the anti-tumor response. Specifically, the type I IFNs
modulate MHC antigen expression, enhance FcR-mediated phagocytosis by
mononuclear cells, enhance specific cytotoxicity of sensitized cytotoxic T-cells
against tumor cells, activate natural killer (NK) cells, and have direct effects on
tumor cells (antiproliferative effects, alteration of oncogene expression, and
stimulation of differentiation)!. Similarly, IFN-y has been investigated for its anti
tumor potential because it is even more potent than type IIFN in enhancing
phagocytosis by mononuclear cells via stimulation of FcR expression, enhancing the
expression of HLA class II molecules on antigen presenting cells (monocytes and
macrophages), stimulation of NK and lymphokine-activated killer (LAK) cell-
mediated cytotoxicity, and augmentation of cytotoxicity mediated by macrophages
in addition to similar direct anti-tumor effects. Additionally, much work has been
focused on the intriguing ability of IFN-y to inhibit angiogenesis. Although the exact
mechanism of this process remains unknown, recent evidence has suggested the
involvement of direct effects on endothelial cell proliferation 3, inhibition of the
synthesis of extracellular matrix components and metalloproteinases 3. or indirect
effects mediated by other factors induced by IFN-y, such as the interferon-y-
inducible protein-10 (IP-10) and monokine induced by y-IFN (MIG) 5.
While type I IFNs have demonstrated efficacy in the treatment of
malignancies and have been clinically approved for these indications. IFN-y has
produced less than optimal results. Randomized trials failed to discern any
59
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
significant difference in outcome between patients with metastatic renal cell
carcinoma receiving IFN-y compared with placebo 6. Single-dose Phase I trials
demonstrated the limitations of intravenous bolus therapy, primarily due to the short
pharmacological half-life of the recombinant protein (ranging from 25 to 35 minutes)
with significant dose limiting toxicity including fever and granulocytopenia 7. 8.
Indeed, previous in vitro work has demonstrated the necessity of prolonged
incubation with IFN-y to elicit MHC molecule upregulation and immune activation^.
Thus, traditional routes of administration require toxic plasma levels in order to
achieve effective sustained intratumoral concentrations of IFN-y.
Recent studies have demonstrated the efficacy of either ex vivo or in vivo
IFN-y gene transduced tumor cells in initiating potent anti-tumor responses 10-14
Currently, gene therapy is not a feasible approach for widespread use due to
technical difficulties involving efficient and specifically targeted delivery, as well as
the effect of cytokines and other biological response modifiers on durable expression
from these vectors due to promoter attenuation 1 5 > 16. Alternatively, monoclonal
antibodies (MAbs) can be utilized as targeting vehicles for the selective delivery to
the tumor microenvironment. Thus far, this approach has been used to deliver
therapeutic agents such as radionuclides, drugs, toxins, and cytokines * 7-20 one
limitation of this approach is the difficulty in finding tumor specific antigens that are
uniformly expressed on a variety of tumors but are not modulated at the cell surface
or shed into the circulation. To circumvent this obstacle, our laboratory has
60
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
developed a novel approach to tumor targeting in which antibodies to intracellular
antigens are used to direct localization by exploiting the presence of degenerating
and necrotic cells within tumors 21. This strategy, designated Tumor Necrosis
Therapy (TNT), has the potential to target the majority of malignancies I ^ and has
been used to successfully image a variety of solid tumors.
In the present study, we describe a fusion protein consisting of chTNT-3 and
murine IFN-y (muIFN-y). In this study, we examine the ability of this fusion protein
designated chTNT-3/muIFN-Yto deliver selectively active muIFN-y to the tumor
microenvironment with the aim of activating an effective anti-tumor response.
These studies will provide preliminary insight into the usefulness of antibody
targeted IFN-y protein in the immunotherapy of transplantable experimental tumor
models and, ultimately, human solid malignancies.
MATERIALS AND METHODS
Reagents
The Glutamine Synthase Gene Amplification System, including the
expression plasmids pEE6/hCMV-B and pEE12 as well as the NSO murine myeloma
expression cell line, were purchased from Lonza Biologies (Slough, UK). The
plasmid pmslO, containing the murine interferon-y(muIFN-y) cDNA. was purchased
from American Type Culture Collection (Manassas, VA). Restriction
endonucleases, T4 DNA Iigase, Vent polymerase, and other molecular reagents were
61
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
purchased from either New England Bioiabs (Beverly, MA) or Boehringer
Mannheim (Indianapolis, IN). Dialysed fetal bovine serum, 4-chloro-1 -naphthol
tablets, crude DNA from salmon testes, single-stranded DNA from calf thymus,
chloramine T, and 2,2’-azino-bis(3-ethylbenzthiazoline-6-sulfonic acid)
diammonium salt (ABTS) were purchased from Sigma Chemical Co. (St. Louis.
MO). Recombinant mouse interferon-y was purchased from Endogen (Woburn.
MA). The Griess Reagent System, containing sulfanilamide solution. N-l-
napthylethylenediamine dihydrochloride solution, and nitrite standards, was
purchased from the Promega Corporation (Madison, WI). 1 2 5 1 was obtained from
DuPont New England Nuclear (North Billerica, MA) as sodium iodide in 0.1 N
sodium hydroxide. BALB/c mice were obtained from Harlan Sprague-Dawley
(Indianapolis, IN). Sulfosuccinimidyl 6-(biotinamido) Hexanoate (Sulfo-NHS-LC
Biotin) was purchased from Pierce (Rockford, IL).
Antibodies and cell lines
The chimeric MAb TNT-3 (chTNT-3, IgG,,ic) and biotinyiated chTNT-3
(chTNT-3/B) were produced as described previously ^ . Biotinyiated antibodies
recognizing CD4, CD8, CD45R, CD90.2 (Thy-1.2), Ly-6G. and CD1 lb were
purchased from BD Pharmingen (San Diego, CA), CalTag (Burlingame, CA), and
Endogen (Woburn, MA). HRPO-conjugated secondary reagents (goat-anti-human
IgG (FcSp) and streptavidin) were purchased from CalTag (Burlingame. CA).
62
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
Fluorescein-conjugated sheep anti-mouse IgG F(ab’)2 was purchased from Sigma
Chemical Co. (St. Louis, MO).
The NSO murine myeloma cell line was obtained from Lonza Biologies. The
MK-D6 cell line (citation), Raji cell line (derived from an African Burkitt’s
lymphoma) 22, MK-D6 hybridoma 23, RAW 267.4 murine macrophage cell line 24
RENCA murine renal cell carcinoma 25, and WEHI-3 murine myelomonocytic cell
line 26 were obtained from the American Type Culture Collection (Manassas, VA).
The Madison 109 murine lung adenocarcinoma 22 obtained from the National
Cancer Institute (Frederick, MD).
Construction o f expression vector
The fusion expression gene was produced by single step insertion of the
muIFN-y cDNA into a Notl site in pEE12/chTNT-3 HC expression vector 28.
Primary PCR was performed with the 5' and 3’ primers
GGTAAAGCGGCCGCAGGAGGTGGTAGCTGTTACTGCCACGGCACAGTC and
TCATGTGGCCGCTCAGCAGCGACTCCTTTTCCG, respectively, to append a Notl
restriction site and codons for a polypeptide linker to the 5' end of the muIFN-y
cDNA and a stop codon and Notl site at the 3’ end. Following Notl restriction
endonuclease digestion of the PCR product and pEE 1 2/chTNT-3 HC expression
vector, the modified muIFN-y sequence was then inserted into pEE12/chTNT-3 HC.
resulting in the expression vector pEE!2/chTNT-3 HC/muIFN-y. The expression
63
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
vector for the chTNT-3 LC, pEE6/chTNT-3 LC, was constructed as described
previously ^ .
Expression and purification o f chTNT-3/mulFN-y
chTNT-3/muIFN-y was expressed from NSO murine myeloma cells for long
term stable expression according to the manufacturer’s protocol (Lonza Biologies).
The highest producing clone was scaled up for incubation in a 3 L stir flask
bioreactor and the fusion protein purified from the spent culture medium by
sequential Protein A affinity chromatography and ion-exchange chromatography, as
described previously 29_ The fusion protein was analyzed by sodium dodecyl sulfate
polyacrylamide gel electrophoresis (SDS-PAGE) under reducing conditions and
stained with Coomassie blue to demonstrate proper assembly and purity. After
transfer to nitrocellulose. Western blot analysis was performed with biotinyiated rat-
anti-mu IFN-y (Endogen, Woburn, MA) and horseradish-peroxidase conjugated
streptavidin to detect the presence of the muIFN-y moiety on the heavy chain fusion
protein. Additionally, the fusion protein was analyzed with a Beckman High
Performance Liquid Chromatography Gold System (Beckman Instruments,
Fullerton, CA) equipped with two 110B solvent pumps, a 210A valve injector, a 166
programmable UV detector, and a 406 analog interface module. Size exclusion
chromatography was performed on a G4000SW column (TosoHaas.
Montgomeryville, PA) with 0.1 M PBS, pH 7.2 as the solvent system, eluting at a
64
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
flow rate of 1 mL/min. The UV absorbance of the HPLC eluate was detected at
280 nm.
ELISA
chTNT-3/muIFN-y-secreting clones were initially identified by indirect
ELISA analysis of supernatants using microtiter plates coated with crude DNA
preparations from calf thymus at 50 jig/mL. For production rate assays. 1 x 1 06 cells
were incubated in I mL of selective medium and incubated for 24 hours, after which
the supernatants were analyzed by indirect ELISA analysis using microtiter plates
coated with single-stranded DNA preparations from salmon testes at 100 pg/mL.
Dilutions of chTNT-3 were used to generate a standard curve using a 4-parameter fit
by an automated ELISA reader (Bio-Tek Instruments. Winooski. VT). from which
concentrations of unknowns were estimated and expressed as pg/mL/10'1 cells/24 hr.
For verification of original antigenic reactivity (immunologic retention), the relative
ability of chTNT-3/muIFN-y to compete against the parent antibody. chTNT-3 for
binding to antigen was investigated. Briefly, dilutions of chTNT-3, chTNT-3/
muIFN-y, and chTV-1, an irrelevant chimeric antibody of the same isotype that binds
to an isoform of fibronectin 30, were co-incubated with a fixed concentration of
biotinyiated chTNT-3 (chTNT-3/B) in microtiter plates coated with single stranded
DNA from salmon testes. Detection of chTNT-3/B bound to the antigen was
accomplished with horse-radish-peroxidase-conjugated streptavidin followed by
color development produced by enzymatic cleavage of ABTS.
65
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
Radiolabeling
Radioiodination of MAb was accomplished through a modified chloramine T
method as previously described 3 1 . Briefly, 1 mCi of l2 5 I and 20 pL of an aqueous
solution of chloramine T (2 mg/mL) were added to a 5 mL test tube containing 100
pg MAb in 100 pL PBS. The solution was quenched after 2 min with 20 pL of an
aqueous solution of sodium metabisulfite. Each reaction mixture was purified using
a Sephadex G-25 column and typically recovered 90-95% yield. The radiolabeled
antibodies were diluted with PBS for injection, stored at 4°C, and administered
within 2 h after labeling. Radioiodinated antibodies were analyzed using an
analytical ITLC system consisting of silica gel impregnated glass fiber (Gelman
Sciences, Ann Arbor, MI). Strips (2 x 20 cm) were activated by heating at 110°C for
15 min prior to use, spotted with I pL of sample, air dried and eluted with methanol/
HX> (80:20) for approximately 10 cm, again air dried, cut in half, and counted to
determine protein bound and free radioiodine.
Determination o f avidity
A fixed- cell RIA was performed using the method of Frankel and Gerhard
3- to determine the avidity constant of chTNT-3/muIFN-y. Briefly, target Raji
lymphoma cell suspensions previously fixed and permeabilized with 2%
paraformaldehyde containing 106 cells/mL were incubated with 10 to 100 ng of l2 5 l-
labeled chTNT-3/muIFN-Y in 200 to 500 pL PBS for 1 hr at room temperature with
constant mixing. Unbound antibody was removed by washing the cells three times
66
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
in PBS containing 1% bovine serum albumin and the samples were then counted in a
gamma counter. The amount of bound fusion protein was then determined from the
remaining cell-bound radioactivity (cpm) in each tube and the specific activity
(cpm/ng) of the radiolabeled antibody preparation. Scatchard plot analysis was used
to obtain the slope. The equilibrium or avidity constant K ., was calculated by the
equation lC=-(slope/n), where n is the valence of the antibody (2 for IgG).
mulFN-yactivity assays
The activity of the chTNT-3/muIFN-y fusion protein was assayed by two
functional assays: upregulation of MHC class II antigen 33 ancj induction of the
iNOS expression 34. For MHC antigen upregulation, 8 x I05 WEHI-3 murine
myelomonocytic cells were plated in RPMI supplemented with 10% FBS, glutamine,
and penicillin-streptomycin in 12-well tissue culture dishes in the presence of serial
dilutions of recombinant murine interferon-y standard (Endogen, Woburn. MA).
chTNT-3, or chTNT-3/muIFN-y at 37°C, 5% C 0 2 . After 48 hours, the cells were
removed with a rubber policeman and washed with phosphate buffered saline (PBS).
The cells were then incubated with PBS with 1% heat-inactivated normal mouse
serum to prevent binding of the detection antibodies to cellular Fc receptors and then
probed with antibody produced by the MK-D6 hybridoma. which recognizes the I-Ad
MHC class II haplotype. The cells were washed with PBS and then incubated with
FITC-conjugated sheep anti-mouse IgG F(ab’)2 . The cells were washed three times
with PBS and cellular fluorescence quantitated with a flow cytometer.
67
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
In the second assay, 10s RAW264.7 murine macrophage cells were incubated
in RPMI supplemented with dilutions of rmuIFN-y, chTNT-3, or chTNT-3/muIFN-y
for 24 hours followed by analysis of the supernatant for nitrite (NO: ). a stable
breakdown product of NO, using the Griess Reagent System (Promega, Madison
WI).
Pharmacokinetic studies
Blood sampling was used to examine the stability of the chTNT-3/muIFN-y
fusion protein in vivo. Six-week old female BALB/c mice were injected
intravenously with 25 pg chTNT-3/muIFN-y (n = 4). Blood samples were obtained
via arterial sampling at one, three, five, and seven days post-injection. Sera prepared
from these samples were analyzed by ELISA to determine presence of intact fusion
protein. Specifically, chimeric antibody was captured on microtiter plates coated
with goat-anti-human IgG (H+L) antibodies and then probed with biotinyiated rat-
anti-muIFN-y and streptavidin-HRPO.
It has previously been demonstrated that half-life values of IgG clearance
from mice determined by whole body dosimetry are statistically indistinguishable
from those calculated by blood sampling 35. Because stability of the fusion protein
could be demonstrated in vivo, whole body dosimetry was performed for this study.
Six-week old female BALB/c mice were injected intravenously with i:?I-chTNT-3 or
l2 5 -chTNT-3/muIFN-y (n = 4-5 / group). Whole body activity immediately post
injection and at selected timepoints thereafter was measured with a CRC-7
68
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
microdosimeter (Capintec, Inc., Pittsburgh, PA). The data were analyzed and half-
lives were determined as described previously 36.
Biodistribution study
Six-week old BALB/c mice were inoculated subcutaneously in the left flank
with approximately 1 x 107 Madison 109 murine lung adenocarcinoma cells. Five
days later, when the tumors had reached approximately 0.5-1.0 cm in diameter, the
mice were injected intravenously with a 0.1 mL inoculum containing i:5I-chTNT-3 or
l2 5 -chTNT-3/muIFN-Y(n = 4-5 / group). Animals were sacrificed by sodium
pentobarbital overdose three and seven days post-injection and blood, tumor, and
various organs were removed and weighed. The radioactivity in the samples was
then measured in a gamma counter and the data for each mouse were expressed as
median percent injected dose/gram (% ID/g) and median tumor:organ ratio (cpm per
gram tumor/cpm per gram organ). Wilcoxon rank sum analysis was performed to
detect statistically significant differences in the biodistribution of the two molecules
(p < 0.05).
Histologic study
Six-week old female BALB/c mice bearing subcutaneously implanted
Madison 109 murine lung adenocarcinoma tumors in the left flank were given daily
intraperitoneal injections of 100 pg chTNT-3 or chTNT-3/muIFN-y. One animal per
treatment group was sacrificed at one, three, five, and seven days post therapy
69
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
initiation. Tumors were resected whole, embedded in OCT compound (Lab-Tek
Products, Naperville, IL), and quick-frozen in liquid nitrogen. Frozen tissue sections
were then probed with a panel of biotinyiated anti-mouse leukocyte antibodies,
followed by Elite ABC reagent (Vector Laboratories, Burlingame. CA). developed
with diaminobenzidine tetrahydrochloride (Sigma), and counterstained with
hematoxylin (Ventana, Tuscon, AZ).
Immunotherapy study
Experimental pulmonary metastases were obtained by injection of RENCA
renal cell carcinoma cells (2 x 10s in experiment I or 1 x 105 in experiment 2) into
the lateral tail veins of six-week old female BALB/c mice. On days five through
nine post-implantation, animals were given daily injections of chTNT-3 or chTNT-3/
muIFN-Y. Route of administration was intraperitoneal for the first trial and
intravenous or the second trial. Approximately three weeks post-implantation,
animals were sacrificed and lungs removed for enumeration of metastatic foci with
visualization aided by India ink counterstaining 37. Differences were analyzed by
two-tailed Wilcoxon rank-sum analysis (p < 0.05).
RESULTS
Construction, expression, and purification of ch.TNT-3/muIFN-y
A PCR product consisting of a seven amino acid linker peptide and the
murine IFN-y sequence was inserted into a Notl site previously appended
70
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
immediately downstream of the human yl terminal codon, producing a TNT-3
VH/human yl/murine interferon fusion gene (Figure 3-1) under the control of the
hCMV promoter. The resulting expression vector pEE12/chTNT-3 HC/muIFN-y
encodes the fusion protein consisting of murine IFN-y coupled to carboxy-terminus
of chTNT-3 heavy chain via a non-cleavable seven amino acid linker. This final
vector was co-transfected into the NSO murine myeloma cell line with the light chain
expression vector, pEE6/chTNT-3 LC, for expression. Antibody producing clones
were selected in glutamine-free media and screened for maximal secretion via
ELISA. The highest producing clone, producing approximately 1.5 pg/mL/10'' cells/
24 hours in static culture, was scaled up in a 3-L bioreactor. The fusion protein
waspurified by sequential Protein A affinity chromatography and ion-exchange
chromatography, yielding > 15 pg/mL.
The chimeric heavy chain fusion protein was intact and properly assembled
as demonstrated by reducing SDS-PAGE (Figure 3-2A) and Western blot analysis
(Figure 3-2B). Two bands were resolved for chTNT-3/ muIFN-yat approximately
Mr 25,000 and Mr 70,000, corresponding the predicted molecular weights of the
immunoglobulin light chain and heavy chain/cytokine fusion. HPLC analysis
demonstrated a retention time of 8.7 minutes for the chTNT-3/muIFN-y fusion
protein as opposed to 12.0 minutes for the chTNT-3 antibody.
71
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
Figure 3-1: Schematic diagram depicting the linker containing the Notl cloning
site between the human yl and murine IFN-y cDNA in the chimeric TNT-3 heavy
chain/cytokine fusion genes.
Murine lnterferon-7
Not I
G (J 6 d t t G t A G GA G G T G G T A G C
Ala Ala Ala Gy Gy Gy Ser
linker peptide
Human C Murine Interferon-y
7 2
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
Figure 3-2: SDS-PAGE and Western blot analysis of recombinant antibody and
antibody/cytokine fusion protein. A. Electrophoretic identification of chTNT-3/
muIFN-y fusion protein. Coomassie Blue-stained 10% polyacrylamide tris-glycine
reduced gel of purified biotinyiated chTNT-3 (lane I), chTNT-3/muIFN-Y(lane 2),
and molecular weight markers (lane 3). B. Western blot of chTNT-3. Biotinyiated
chTNT-3 (lane 1), chTNT-3/muIFN-y (lane 2), and biotinyiated molecular weight
markers (lane 3) were transferred to nitrocellulose membrane and analyzed using
biotinyiated rat-anti-mouse IFN-y MAb followed by horseradish peroxidase-
conjugated streptavidin. The Western blots were developed by conversion of the
substrate 4-chloro-l-naphthol to an insoluble precipitate directly on the nitrocellulose
blot.
73
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
Immunobiochemical analysis
Immunoreactivity of chTNT-3/muIFN-Y with the target antigen of chTNT-3
was assessed by determining its binding to immobilized antigen. Increasing
concentrations of chTNT-3, chTNT-3/muIFN-Y, or an irrelevant monoclonal
antibody (chTV-1) were evaluated for their ability to inhibit the binding of
biotinyiated chTNT-3 (chTNT-3/B) to single-stranded DNA-coated microtiter plates
(Figure 3-3). chTNT-3/muIFN-Ywas able to bind competitively to the antigen in
the same fashion as chTNT-3. In contrast, chTV-l was unable to compete with
chTNT-3/B for antigen, consistent with its selective affinity for an isoform of
fibronectin 30.
Fixed Raji cells were incubated with l2 5 I-Iabeled chTNT-3/muIFN-y and
bound radioactivity determined to calculate the avidity constant. chTNT-3/muIFN-Y
was determined to have a binding constant of 1.2 x 109 M'1 , which is comparable to
1.4 x 109 M ‘,the affinity constant of chTNT-3 28. These studies confirm that the
fusion protein retains the immunoreactivity of chTNT-3 as the presence of the
cytokine at the carboxy-terminus of the heavy chain does not affect antigen-antibody
interactions.
Interferon-yactivity o f chTNT-3/muIFN-y
Although the muIFN-y moiety of the fusion protein was demonstrated by
Western blot analysis, functional assays were performed to demonstrate the
biological activity of chTNT-3/muIFN-Y. The first assay examined the ability of
74
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
Figure 3-3: Competition ELISA Against ssDNA: Verification of Antigenic
Specificity. chTNT-3 and chTNT-3/muIFN-Y inhibited the binding of chTNT-3/B to
antigen (ssDNA). The irrelevant antibody chTV-1, which recognizes an isoform of
fibronectin, was unable compete with chTNT-3/B. These results confirm that the
fusion protein maintains the immunoreactivity of chTNT-3.
0 0
Q Q
5
m
I
f-
Z
E-
JS
C J
c
u
a
6
Q .
10
7 chTNT-3
chTNT-3/muIFN-V
5
chTV-
0
1
Relative Competitor Antibody Concentration (molar)
75
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
IFN-y to affect the expression of MHC class II molecules. As shown in Figure 3-4,
both recombinant muIFN-y (rmuIFN-y) and chTNT-3/muIFN-y induced the
upregulation of MHC class II molecules in the WEHI-3 murine myelomonocytic
cells. In contrast, chTNT-3 treatment had no effect on MHC class II expression,
resulting in expression levels similar to untreated cells (data not shown). By this
method, the specific activity of the fusion protein was 430 U/pg. The second assay
investigated the ability of the fusion protein to induce nitric oxide production by
macrophages. While chTNT-3 was unable to induce nitric oxide production, both
rmuIFN-y and chTNT-3/muIFN-ywere able to induce nitric oxide production in a
dose-dependent manner (Figure 3-5). By this method, the specific activity of the
chTNT-3/muIFN-y fusion protein was calculated to be approximately 450 U/pg.
which is consistent with the results obtained in the MHC upregulation assay.
Together, these data confirm that the fusion protein retains the functional activity of
the muIFN-y moiety and that the fusion protein displays approximately 40% of the
molar activity of a recombinant muIFN-y standard.
In vivo pharmacokinetic and biodistribution studies
Serum clearance studies were performed to demonstrate the stability of the
fusion protein in vivo. BALB/c mice were injected with cold chTNT-3/muIFN-y and
serum samples were obtained at various timepoints post-injection. The presence of
fusion protein could be demonstrated up to 24 hours but not beyond that due to the
limited sensitivity of the detection method (data not shown).
76
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
Figure 3-4: Upregulation of MHC class II molecule expression in the WEHI-3
murine myelomonocytic cell line. Cells were grown in complete media
supplemented with rmuIFN-Y, chTNT-3, or chTNT-3/muIFN-y for 48 hours and then
assayed for MHC class II molecule expression by flow cytometry. By this method,
the specific activity of the fusion protein was determined to be 430 U/pg. In
contrast, chTNT-3 was unable to induce MHC class II upregulation (data not
shown).
A. Unstimulated cells
8 i
8 - 1
1000
B. rmuIFN-y-treated cells
JS
E
3
z
"3
U
u
>
C O “
CM ”
1000
C. chTNT-3/muIFN-y-treated cells
CM ”
1000
Fluorescence Intensity (log)
77
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
Figure 3-5: Production of nitric oxide (NO) by the RAW 264.7 murine macrophage
ceil line. Cells were grown in complete media supplemented with rmuIFN-y, chTNT-
3, or chTNT-3/muIFN-Y for 24 hours followed by analysis of the supernatant for
nitrite (NO,), a breakdown product of NO, using the Griess reagent. By this
method, the specific activity of the chTNT-3/muIFN-Y fusion protein was calculated
to be approximately 450 U/pg. chTNT-3 was unable to produce significant NO.
rmuIFN-y
chTNT-3/muIFN-Y
10-
chTNT-3
0.001 0.01 0.1 100 1 0
Relative Molar Concentration
78
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
As shown in Figure 3-6, whole body clearance studies were performed in
non-tumor-bearing mice to establish differences in the pharmacokinetics of
chTNT-3/muIFN-y compared to chTNT-3. BALB/c mice were injected with l2 5 I-
labeled chTNT-3/ muIFN-y and whole body activity measured at various timepoints
thereafter in a microdosimeter. Because whole-body dosimetry was used, only the
terminal P phase of clearance could be calculated. Data from 8 h onward were used
to minimize contributions of the a phase. Previous studies utilizing this method
have determined the whole-body half-life of chTNT-3 to be 134.2 ± 4.0 h1 ?. In
comparison, the whole-body half-life of chTNT-3/muIFN-y was determined to be
46.0 ± 1.5 hr.
The pharmacokinetic effect of the rapid clearance of the fusion protein is
evident when the tumor and normal organ biodistribution of i:5I-labeled chTNT-3
and 1 2 5 I-labeled chTNT-3/muIFN-y are compared in Madison 109 murine lung
adenocarcinoma-bearing BALB/c mice (Figure 3-7). The overall tumor uptake of
the fusion protein is significantly lower than that of chTNT-3 at both three and seven
days post-injection (2.4±0.3 vs. 13.5±0.2 on day three and I.2±0.2 vs. 7.3±0.5 on
day seven, respectively). However, the tumor to organ ratios, which reflect normal
organ uptake/binding and provide and indication of possible toxicity due to the
cytokine, are either comparable or even slightly higher for chTNT-3/mu IFN-y.
7 9
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
Figure 3-6: Pharmacokinetic Clearance of chTNT-3 vs. chTNT-3/muIFN-y in
BALB/c Mice. Groups of mice (n=4) were injected i.p. with l25I-labeled chTNT-3 or
l25I-labeled chTNT-3/muIFN-y. Whole body activity at injection and at selected
times thereafter were measured with microdosimeter and the half-lives determined
using RSTRIP pharmacokinetic program (MicroMath, Inc., Salt Lake City, UT).
100
eo
c
'c
* 3
s
< u
0 £
u
o
G
•a
4)
o
u
'E1
80-
60-
40-
chTNT-3
20 -
chTNT-3/muIFN-Y
20 40 80 0 60
Time (h)
8 0
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
Figure 3-7: Tissue biodistribution of chTNT-3 and chTNT-3/muIFN-y in Madison
109 lung adenocarcinoma-bearing BALB/c mice. BALB/c mice bearing established
syngeneic Madison 109 murine lung adenocarcinoma tumors in the left thigh were
injected with 30 fig of l2 5 I-labeled chTNT-3 or l2 5 I-labeled chTNT-3/ muIFN-y
immunoconjugates. The mice were sacrificed 72 and 144 hours later and the organs
harvested for biodistribution analysis to determine the % injected dose/gram for each
time point (n=3-4). Similar results were seen with a modified Lewis lung carcinoma
model (data not shown).
H
E
C 3
u -
o
CL
O
a
"8
8
c
< u
a
CL
( 3
p o
o
£
3
chTNT-3 day 3
chTNT-3 day 7
FI chTNT-3/muIFNY day 3
H chTNT-3/muIFNf day 7
I
F
1 ^
1 S
r
n
4 v
I T
81
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
Histology
Immunohistologic analysis was performed on tissues obtained from untreated
and chTNT-3/muIFN-Y treated animals to determine the effect of the targeted
delivery of muIFN-y. In contrast to untreated animals, which demonstrated
essentially no infiltrating leukocytes, treated animals displayed significant infiltration
with CD4+ T lymphocytes and macrophages and limited infiltration with CD8+ T
lymphocytes (Table 3-1). At day one, tissue macrophages were clustered around the
tumor periphery in an area of tumor destruction. By day three and onward,
macrophages were again associated with tumor destruction. This infiltration,
however, had progressed further into the central portions of the tumors. In contrast,
CD4+ T lymphocyte infiltration was consistently observed in and around the tumor
mass throughout the observed period. Interestingly, staining with an anti-Thy 1.2
antibody revealed the infiltration of cells into the tumor from day three onward, such
that by day seven, there was uniform distribution of Thy-1.2+ cells throughout the
entire tumor mass. This distribution pattern cannot be entirely accounted for by
CD4+ and CD8+ T lymphocytes and most likely represents natural killer (NK) cell
migration, since Thy-1.2 or CD 90 is expressed on a variety of non-B cell
lymphocytes including T lymphocytes and large granular lymphocytes (LGL) NK
cells. Because histochemical markers for mouse NK are currently not available,
definitive identification of this infiltrating population is not yet possible.
8 2
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
Table 3-1: Immunohistoiogic characterization of leukocyte infiltration into
Madison 109 tumors in mice treated with targeted muIFN-y1
CD4*T- CDS" T- Macrophages Thy-1.2 cells
lymphocytes2 lymphocytes__________________________
Untreated - - -/+
chTNT-3/muIFN-Y 1 day ++ - + -/+
3 days -/+ + ++ ++
5 days ++ -/+ ++ ++
__________________ 7 days_________ ++____________-/+____________ ++____________+++
T u m o r - b e a r i n g m i c e w e r e t r e a t e d w i t h d a i l y d o s e s o f 2 5 p g o f f u s i o n p r o t e i n i . p . O n t h e i n d i c a t e d
d a y , a n i m a l s w e r e s a c r i f i c e d a n d t u m o r s r e s e c t e d f o r h i s t o l o g i c a n a l y s i s . F r o z e n s e c t i o n s w e r e
p r o b e d w i t h a p a n e l o f a n t i b o d i e s r e c o g n i z i n g m o u s e l e u k o c y t e p o p u l a t i o n s .
± , a f e w s c a t t e r e d c e l l s : + i n f i l t r a t i o n a r o u n d t u m o r . + + . i n f i l t r a t i o n i n t o a n d a r o u n d t u m o r : + + +
a b u n d a n t i n f i l t r a t i o n t h r o u g h o u t t u m o r
83
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
Immunotherapy studies
Preliminary immunotherapy studies were performed to determine potential
efficacy of targeted interferon in a pulmonary metastasis model of renal cell
carcinoma. In the first experiment, animals were treated with intraperitoneal
injections of chTNT-3 (50 - 100 pg/dose), chTNT-3/muIFN-y (100 - 200 pg/dose)
or mock saline injections. Although insufficient numbers of animals were used per
group to achieve statistical significance, there was a dramatic difference in the
number of metastatic foci in animals treated with 100 pg doses of antibody-cytokine
fusion protein compared to animals treated with either saline or the chTNT-3
antibody (Table 3-2). Because phase I studies of the pharmacokinetics of
parenterally administered rIFN-y demonstrated measurable loss of activity as
compared to intravenous administration, we investigated the potential of intravenous
administration of chTNT-3/muIFN-Y compared to either antibody alone or antibody
with an equivalent dose of rmuIFN-y. In the second experimental protocol, treatment
with daily doses of chTNT-3/muIFN-y significantly decreased the number of
metastatic foci compared to treatment with antibody alone or antibody with
equivalent free cytokine. In both experiments, the chTNT-3/muIFN-y treated mice
showed no toxicity with respect to activity, weight loss, or overall appearance.
8 4
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
Table 3-2: Efficacy of targeted mufFN-y therapy on pulmonary metastases
Treatment (daily dosage)
Experiment 1 (i.p.)1
saline >400, >400, > 400, N.A.
>400, >400, > 400, N.A.
>400, >400, N.A., N.A.
>400, 179, 173, 135
No. of foci
chTNT-3 (50 pg)
chTNT-3 (200 pg)
chTNT-3/mufFN-y (100 pg)
Experiment 2 (i.v.)2
chTNT-3 (25 pg) >400,>400, >400, 254. 241
>400,>400, >400, 295. 164 chTNT-3 (25 pg) + muIFN-y
equivalent
chTNT-3/mufFN-y (25 pg) 106, 75, 65, 62. 39
Pulmonary metastases were induced by i.v. injection o f 2x10 5 RENCA
cells in experiment 1 and IxlO5 RENCA cells in experiment 2.
Treatment was initiated five days after and consisted o f daily injections
o f saline, chTNT-3, chTNT-3 + free muIFN-y, or chTNT-3/muIFN-y as
indicated for 5 consecutive days.
1 All groups in experiment I started with 4 animals; N.A. = animal found
dead before the planned date o f sacrifice and not included in the
evaluation
2 All groups in experiment 2 started with 5 animals.
* Differences in numbers o f metastatic foci between chTNT-3/m ulFN-y
25 pg treatment group and chTNT-3 with or without free muIFN-y are
statistically significant (p = 0.004) by two-tailed Wilcoxon rank-sum
analysis
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
DISCUSSION
In this study, a recombinant fusion protein consisting of the chimeric TNT-3
monoclonal antibody and murine IFN-y has been generated, retaining both the tumor
targeting and cytokine activities to study to the potential of antibody-targeted IFN-y
in the immunotherapy of neoplasia. The GS gene amplification system was used for
high level of expression of the fusion protein from murine myeloma cells.
Biochemical analysis of the fusion protein indicates the presence of two mu IFN-y
moieties per antibody molecule, as evidenced by the increase in the molecular weight
of the heavy chain (Figure 3-2). The immunoreactivity of chTNT-3/muIFN-y was
retained, as demonstrated by its ability to compete successfully with biotinylated
chTNT-3 to immobilized antigen by ELISA and the avidity constant. The muIFN-y
moiety, appended to the carboxy-terminus of the heavy chain constant region via a
short, non-degradable linker peptide to enable proper folding of both antibody and
cytokine, retains immunologic activity, as demonstrated by MHC class II
upregulation and induction of NO production by macrophage-like cells.
Despite a markedly reduced whole body half-life compared to chTNT-3 (46.0
± 1.5 h vs. 134.2 ± 4.0 hours), biodistribution analysis demonstrates selective tumor
uptake of the fusion protein and retention up to seven days post-injection. The latter
finding is significant in light of the knowledge that prolonged exposure to IFN-y as
well as other biological response modifiers (BRM) is required for activation of
immunologic function 2. 9 and it is this requirement that may be limiting the clinical
86
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
efficacy of recombinant human IFN-y (rhuIFN-y). While it has been reported that
single doses of approximately 2.5 mg/m2 rhuIFN-y were fairly well tolerated through
both the intravenous and intramuscular routes, the pharmacologic clearance of
intravenously administered rhuIFN-y (approximately 30 minutes) appears to be too
rapid to generate a therapeutic immune response 7. In contrast, intramuscularly
administered rhuIFN-y has been shown to clear less rapidly, with a half-life of
3.7—7.7 h, although there appears, however, to be significant loss of immunologic
activity during the absorption of the material into the plasma as tested by a viral
protection bioassay, in spite of dose-limiting toxicides similar to intravenous
administration. Clinically, prolonged intravenous infusion produces similar toxicity
to bolus administration, although the maximum tolerated doses were significantly
reduced in comparison (0.16 mg/m2 for 6 h infusion regimen and 0.01 mg/m2 /day for
a 24 h infusion regimen).
Immunotherapy studies with an experimental model of pulmonary metastasis
demonstrated the efficacy of targeted IFN-y. Intraperitoneal administration appeared
to decrease the number of pulmonary metastases compared to antibody alone,
although statistical significance was not achieved due to the small sample size used.
In contrast, intravenous administration of the fusion protein significantly reduced the
number of metastatic foci compared to either chTNT-3 or chTNT-3 plus and
equivalent amount of rmuIFN-y. The antibody-cytokine fusion protein approach
may improve IFN-y tumor therapy by two separate but related mechanisms. The
increased half-life of the chTNT-3/ muIFN-y fusion protein allows increased time for
87
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
localization and activation of immune effector cells. It is interesting to note,
however, that sustained in vivo presence of IFN-y is not sufficient to induce
rejection. Approximation of antigenic and IFN-y stimulation is also imperative for
the generation of maximal antitumor response, since Sadanaga et al 1 ^ demonstrated
that treatment with IFN-y transduced tumor cells is insufficient to completely prevent
metastasis formation by an unrelated tumor cell line. The antibody, as a targeting
moiety, achieves this approximation by directing effective tumor delivery and
accretion. Indeed, tumor retention of the fusion protein is seen up to one week post
injection, and the immunologic effects are apparent in the significant leukocyte
infiltration into tumor tissue. Previous work with murine tumor models treated with
either recombinant muIFN-y or gene-transduction of tumor cells have consistently
observed macrophage infiltration into the tumors of immunocompetent mice I ^ *3
In contrast, CD4+ and CD8+ T lymphocyte infiltration has been inconsistent and may
in fact be tumor-dependent. Our observations are consistent with these studies, as
migration of macrophages, the primary immunologic target of IFN-y therapy, into
the tumor tissue is seen as early as 24 hours post-injection and remains consistent for
at least one week. CD4+ T lymphocyte migration is observed in combination with
limited CD8+ T lymphocyte infiltration. Importantly, the striking infiltration of CD4
,CD8\ Thy-1.2+ LGL into the tumor tissue suggests vigorous response to the tumor
by NK cells. Indeed, gene therapy studies in mice with muIFN-y-gene transfected
tumor cells have demonstrated that effective rejection of pulmonary metastases are
primarily mediated by NK cells and can be prevented by administration of rabbit-
88
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
anti-asialoganglioside GM, antibodies in nude mice Furthermore, recent data
indicate that recruitment of NK cells may be an important mechanism for IFN-y
mediated inhibition of angiogenesis. Yao et al 38 demonstrated that neutralization of
NK cell function reverses the antiangiogenic effect of treatment with IL-12. a potent
inducer of IFN-y, in an in vivo model of basis fibroblast growth factor-induced
angiogenesis. Mechanistically, their studies suggest that IL-12 treatment of tumors
induces IFN-y expression by rare local NK cells, which, in turn, induce the
expression of IP-10 and other chemokines by resident endothelial and immune cells.
These chemokines then recruit NK and other immune cells, which secrete cytokines
and activate NK activity against both tumor cells and the local endothelium. While
our studies here focused on recruitment of immunologic cells to the tumor
microenvironment mediated by targeted interferon rather than its antiangiogenic
potential, studies in our laboratory are currently addressing this issue.
To our knowledge, this is the first time in which IFN-y has been targeted
specifically to tumors in vivo by an antibody-fusion protein approach. Because
species-specific IFN-y was utilized, we will be able to characterize further the in vivo
efficacy of this approach in murine models. Previously, Xiang and colleagues 39-42
reported the development of myeloma cell lines that stably secrete fusion proteins
consisting of either a single-chain antibody fragment or F(ab’)2 and human IFN-y. In
vitro characterization confirmed bifunctional activity of the fusion proteins, while in
vivo characterization demonstrated that this genetic modification induces the
89
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
rejection of both the transfected and parental cell lines in previously immunized
mice. However, these results are in direct contradiction to previous studies that show
that, despite 65% overall nucleotide homology and 40% overall protein homology,
human IFN-y is particularly species specific and does not display significant cross
reactivity in murine and other rodent models. Furthermore, the investigators did not
demonstrate the in vivo targeting abilities of these constructs, which, due to the
utilization of smaller antibody derivatives, may be decreased compared to our intact
antibody-cytokine construct.
Targeted delivery of IFN-y using the chTNT-3 antibody-cytokine approach is
a novel approach for the immunotherapy of solid malignancies. Because chTNT-3 is
expected to localize to any tumor that contains degenerating cells and necrosis, this
approach can be utilized in a wide spectrum of human malignancies. Furthermore,
the specific localization of cytokine to the tumor microenvironment appears to be
essential in evoking maximal antitumor response. Continuing studies will address
the efficacy of this approach in the treatment of a variety of murine models of
malignancy and will focus on the possible synergism between IFN-y and other
cytokines in the generation of a potent anti-tumor immune response.
REFERENCES
1. De Maeyer E, De Maeyer-Guignard J. Interferons. In: Thomson A, ed. The
Cytokine Handbook. Vol. 1. San Diego: Academic Press, Inc.. 1994:265-288.
90
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
2. Talmadge JE, Tribble HR, Pennington RW, Phillips H, Wiltrout RH.
Immunomodulatory and Immunotherapeutic Properties of Recombinant y-
Interferon and Recombinant Tumor Necrosis Factor in Mice. Cancer
Research 1987; 47:2563-2570.
3. Sato N, Nariuchi H, Tsuruoka N, et al. Actions of TNF and IFN-gamma on
angiogenesis in vitro. J Invest Dermatol 1990; 95:85S-89S.
4. Brunda MJ, Luistro L, Hendrzak JA, Fountoulakis M, Garotta G. Gately MK.
Role of interferon-g in mediating the antitumor efficacy of interleukin-12.
Journal of Immunother Emphasis Tumor Immunol 1995; 17:71-77.
5. Voest E, Kenyon B, O'Reilly M, Truitt G, D'Amato R, Folkman J. Inhibition
of angiogenesis in vivo by interleukin 12. J Natl Cancer Inst 1995; 87:581-6.
6. Gleave ME, Elhilali M, Fradet Y, et al. Interferon gamma-lb compared with
placebo in metastatic renal-cell carcinoma. N Engl J Med 1998: 338:1265-71.
7. Kurzrock R, Rosenblum MG, Sherwin SA, et al. Pharmacokinetics. Single-
Dose Tolerance, and Biological Activity of Recombinant y-Interferon in
Cancer Patients. Cancer Research 1985; 45:2866-2872.
8. Kurzrock R, Quesada JR, Rosenblum MG, Sherwin SA, Gutterman JU. Phase
I Study of iv Administrated Recombinant Gamma Interferon in Cancer
Patients. Cancer Treatment Reports 1986; 70:1357-1364.
9. Dianzani F, Salter L, Fleischmann WR, Jr., Zucca M. Immune interferon
activate cell smore slowly than does virus-induced interferon. Proc Soc Exp
Biol Med 1978; 159:97-97.
10. Gansbacher B, Bannerji R, Daniels B, Zier K, Cronin K, Gilboa E. Retroviral
Vector-mediated y-Interferon Gene Transfer into Tumor Cells Generate
Potent and Long Lasting Antitumor Immunity. Cancer Research 1990:
50:7820-7825.
11. Hock H, Dorsch M, Kunzendorf U, Qin Z, Diamantstein T, Blankenstein T.
Mechanisms of rejection induced by tumor cell-targeted gene transfer of
interleukin 2, interleukin 4, interleukin 7. tumor necrosis factor, or interferon
y. Proc Natl Acad Sci USA 1993; 90:2774-2778.
12. Yanagihara K, Seyama T, Watanabe Y. Antitumor Potential of Interferon-y:
Retroviral Expression of Mouse Interferon-y cDNA in Two Kinds of Highly
Metastatic Mouse Tumor Lines Reduces Their Tumorigeneicity. Natural
Immunity 1994; 13.
9 1
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
13. Sadanaga N, Nagoshi M, Lederer J, Joo H-G, Eberlein TJ, Goedegebuure PS.
Local Secretion of IFN-y Induces and Antitumor Response: Comparison
Between T cells Plus IL-2 and IFN-y Transfected Tumor Cells. Journal of
Immunotherapy 1999; 22:315-323.
14. Sun WH, Burkholder JK, Sun J, et al. In vivo cytokine gene transfer by gene
gun reduces tumor growth in mice. Proc Natl Acad Sci USA 1995:92:2889-
2893.
15. Qin L, Ding Y, Pahud DR, Chang E, Imperiale MJ, Bromberg JS. Promoter
attenuation in gene therapy: interferon-y and tumor necrosis factor-a inhibit
transgene expression. Human Gene Therapy 1997; 8:2019-2029.
16. Ghazizadeh S, Carroll JM, Taichman LB. Repression of retrovirus-mediated
transgene expression by interferons: implications for gene therapy. Journal
of Virology 1997;71:9163-9169.
17. Homick JL, Sharifi J, Khawli LA, et al. A new chemically modified chimeric
TNT-3 monoclonal antibody directed against DNA for the
radioimmunotherapy of solid tumors. Cancer Biotherapy &
Radiopharmaceuticals 1998; 13:255-268.
18. Lundberg B, Griffiths G, Hansen H. Conjugation of an anti-B-cell lymphoma
monoclonal antibody, LL2, to long-circulating drug-carrier lipid emulsions. J
Pharm Pharmacol 1999; 51:1099-105.
19. Rosenblum MG, Marks JW, Cheung LH. Comparative cytotoxicity and
pharmacokinetics of antimelanoma immunotoxins containing either natural or
recombinant gelonin. Cancer Chemother Pharmacol 1999; 44.
20. Hornick JL, Khawli LA, Hu P, Lynch M, Anderson PM, Epstein AL.
Chimeric CLL-1 antibody fusion proteins containing granulocyte-
macrophage colony-stimulating factor or interleukin-2 with specificity for B-
cell malignancies exhibit enhanced effector functions while retaining tumor
targeting properties. Blood 1997; 89:4437-4447.
21. Epstein AL, Chen F-M, Taylor CR. A Novel Method for the Detection of
Necrotic Lesions in Human Cancers. Cancer Research 1988; 48:5842-5848.
22. Ohsugi Y, Gershwin ME, Owens RB, Nelson-Rees WA. Tumorigenicity of
human malignant lymphoblasts: comparative study with unmanipulated nude
mice, antilymphocyte serum-treated nude mice, and X-irradiated nude mice.
Journal of the National Cancer Institute 1980; 65:715-718.
9 2
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
23. Kappler J, Skidmore B, White J, Marrack P. Antigen-inducible. H-2-
restricted, interleu kin-2-producing T cell hybridomas. Lack of independent
antigen and H-2 recognition. J Exp Med 1981; 153:1198-1214.
24. Ralph P, Nakoinz I. Antibody-dependent killing of erythrocyte and tumor
targets by macrophage-related cell lines: enhancement by PPD and LPS. J
Immunol 1977; 119:950-954.
25. Murphy GP, Hrushesky WJ. A murine renal cell carcinoma. Journal of the
National Cancer Institute 1973; 50:1013-1025.
26. Ralph P, Moore M, Nilsson K. Lysozyme synthesis by established human
and murine histiocytic lymphoma cell lines. J Exp Med 1976: 143:1528-
1533.
27. Marks TA, Woodman RJ, Geran RI, Billups LH, Madison RM.
Characterization and Responsiveness of the Madison 109 Lung Carcinoma to
Various Antitumor Agents. Cancer Treatment Reports 1977: 61:1459-1470.
28. Homick JL, Khawli LA, Hu P, Sharifi J, Khanna C, Epstein AL. Pretreatment
with a Monoclonal Antibody/Interleukin-2 Fusion Protein Directed against
DNA Enhances the Delivery of Therapeutic Molecules to Solid Tumors.
Clinical Cancer Research 1999; 5:51-60.
29. Hu P, Homick JL, Glasky MS, et al. A chimeric Lym- l/interleukin 2 fusion
protein for increasing tumor vascular permeability and enhancing antibody
uptake. Cancer Research 1996; 56:4998-5004.
30. Epstein AL, Khawli LA, Homick JL, Taylor CR. Identification of a
Monoclonal Antibody, TV-1, Directed against the Basement Membrane of
Tumor Vessels, and Its Use to Enhance the Delivery of Macromolecules to
Tumors after Conjugation with Interleukin-2. Cancer Res. 1995: 55:2673-
2680.
31. Hu P, Glasky MS, Yun A, et al. A human-mouse chimeric Lym-1
monoclonal antibody with specificity for human lymphomas expressed in a
baculovirus system. Human Antibodies and Hybridomas 1995: 6:57-67.
32. Frankel ME, Gerhard W. The rapid determination of binding constants for
antiviral antibodies by a radioimmunoassay: an analysis of the interaction
between hybridoma proteins and influenza virus. Molecular Immunology
1979; 16:101-106.
93
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
33. Schreiber RD. Measurement of Mouse and Human Interferon y. In: Colligan
JE, ed. Current Protocols in Immunology. Vol. I. New York: John Wiley &
Sons, Inc., 1994:6.8.1-6.8.8.
34. Kim Y-M, Son K. A nitric oxide production bioassay for interferon-y.
Journal of Immunological Methods 1996; 198:203-209.
35. Zuckier LS, Georgescu L, Chang CJ, Scharff MD, Morrison SL. The use of
severe combined immunodeficiency mice to study the metabolism of human
immunoglobulin G. Cancer 1994; 73:794-799.
36. Homick JL, Sharifi J, Khawli LA, et al. Single Amino Acid Substitution in
the Fc Region of Chimeric TNT-3 Antibody Accelerates Clearance and
Improves Immunoscintigraphy of Solid Tumors. Journal of Nuclear Medicine
2000;41:355-362.
37. Wexler H. Accurate Identification of Experimental Pulmonary Metastases. J
Natl Cancer Inst 1966; 36:641-645.
38. Yao L, Sgadari C, Furuke K, Bloom E, Teruya-Feldstein J. Tosato G.
Contribution of natural killer cells to inhibition of angiogenesis by
interleukin-12. Blood 1999; 93:1612-1621.
39. Xiang J, Qi Y, Luo X, Liu E. Recombinant bifunctional molecule FV/IFN-y
possess the anti-tumor FV as well as the gamma interferon activities. Cancer
Biotherapy 1993;8:327-337.
40. Qi Y, Chen Y, Xiang J. Mouse myeloma cell line secreting bifunctional
fusion protein RM4/IFN-y elicits antitumor CD8 MHC Class I-restricted T
cells that are cytolytic in vitro and tumoricidal in vivo. Journal of Interferon
and Cytokine Research 1996; 16:771-776.
41. Qi Y, Moyana T, Chen Y, Xiang J. Characterization of anti-tumor immunity
derived from the inoculation of myeloma cells secreting the fusion protein
RM4/IFN-y. Human Antibodies and Hybridomas 1996; 7:21-26.
42. Xiang J, Qi Y, Cook D, Moyana T. Targeting gamma interferon to tumor
cells by a genetically engineered fusion protein secreted from myeloma cells.
Human Antibodies and Hybridomas 1996; 7:2-10.
94
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
Chapter 4. Optimization of chTNT-3/IL-2 Based Immunotherapy of
Cancer
ABSTRACT
Because of its tremendous potential to stimulate the specific immune
response, interleukin-2 (EL-2) has been studied extensively for the adoptive
immunotherapy of cancer. While systemic administration of this biologic response
modifier has been shown to stimulate anti-tumor responses in vivo, its efficacy in
clinical use has been limited by the development of its dose limiting toxicity,
vascular leak syndrome. We have previously constructed monoclonal
antibody/interleukin-2 fusion proteins for use in the immunotherapy of both solid
and lymphoid malignancy. Additionally, we have demonstrated the efficacy of
nuclear antigen targeting mouse-human chimeric monoclonal antibody chTNT-3/
interleukin-2 fusion protein as a pretreatment reagent to increase local vascular
permeability as well as the enhanced delivery of subsequently administered
therapeutic reagents.
In this study, we have constructed fusion proteins consisting of the nuclear
antigen targeting mouse-human chimeric monoclonal antibody chTNT-3 and single
amino acid substitution mutants of IL-2 to reduce further the toxicity associated with
the therapeutic administration of IL-2 and describe their preliminary characterization
in ' itro and in vivo. Specific alterations in immunologic function and
95
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
vasopermeability behavior were generated in this manner. Furthermore, these two
activities are distinct properties of the IL-2 molecule that can be artificially separated
and are thus not fundamentally linked. These data suggest that modification of the
IL-2 molecule can generate reagents with different spectra of activity, each with its
own specific clinical utility.
INTRODUCTION
Since the discovery in the late 19lh century by William Coley of a protective
factor produced by inflammatory lesions ^ 2, medical science has looked the
immune system for a cure for cancer. Because of its important involvement in both
the cellular and humoral arms of the immune system, interleukin-2 (IL-2) has been
investigated extensively for a potential role the treatment of malignant disease. Its
primary function is to stimulate the growth and proliferation of T lymphocytes. It
has also been shown to have diverse stimulatory effects on a variety of immune cells,
including natural killer (NK) cells, lymphokine-activated killer (LAK) cells,
monocytes, and macrophages 3. Although IL-2 has been approved for the clinical
treatment of metastatic renal cell carcinoma and melanoma, its efficacy has been
restricted by the relatively severe toxicities associated with therapeutic dosages,
including capillary leak syndrome, myocardial infarction, renal failure requiring
dialysis, and neuropathy 4. Direct application approaches have been somewhat more
effective and have resulted in different levels of therapeutic efficacy, including
96
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
control of malignant effusions, prevention of the growth of established tumors, and
even a reduction in the size of established tumors 5. Because this technique is not
feasible for certain anatomic locations nor disseminated disease, our laboratory has
focused on the targeted delivery of therapeutic molecules such as IL-2 to tumor sites
with a two-fold aim: achieve increased local concentrations of effector molecules at
the tumor site to maximize therapeutic potential and decrease systemic
concentrations of the reagent to minimize toxicities associated with treatment. To
accomplish these goals while circumventing the limitations of direct application
approaches, we have developed an antibody-fusion protein approach in which the
genetic sequence of IL-2 has been cloned into expression vectors for the recombinant
antibody. The resulting fusion protein is then able to direct the migration of IL-2
toward a tumor-associated antigen 6-8. In this manner, we should be able to achieve
therapeutic intratumoral concentrations while avoiding significant systemic
exposure.
In addition to local stimulation of anti-tumor immunity, a novel use of
antibody-targeted IL-2 is to alter the physiology of tumor vessels in order to enhance
the uptake of macromolecules. This unique approach to cancer therapy stems from
the observations that tumor blood flow and vascular permeability are two important
parameters that control the uptake of macromolecules in tumors Although the
mechanism of extravasation for macromolecules is only partially known, it is well
established that the tumor capillary bed is leaky and easier to exit than the vascular
97
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
bed of normal tissues 1 *. This leakiness can be enhanced by the administration of
vasoactive agents, such as IL-2. As a free agent, IL-2 causes generalized
inflammatory changes in all organs including the tumor *2, 13, leading to the
development of dose limiting capillary leak syndrome *4. However, when localized
to the tumor microenvironment via carrier antibodies, IL-2 exerts its effects only at
the tumor site by selectively inducing changes in the vascular permeability of tumor
vessels in a nitric oxide (NO) dependent manner. Effective intratumoral
accumulation of therapeutic molecules can thus be enhanced by chemical
conjugation or genetic fusion of IL-2 to tumor targeting antibodies 6. 8. 12. 15, 16
Based upon these findings, the principle of tumor-localized vasopermeability
represents a mechanism for enhancement of the delivery of reagents to tumors.
Based upon the increased tumor:normal organ ratios achieved, vasoconjugate
pretreatment can significantly improve the therapeutic index of chemotherapeutic
drugs while decreasing their systemic toxicity. Not only should this approach
decrease the severity and frequency of side effects, but it may also allow the use of
lower doses of these drugs to achieve the same effects on the tumor.
Previous reports have described the generation of IL-2 analogues with
specific amino acid substitutions for the purpose of determining specific residues
necessary for proper assembly and interaction with IL-2 receptor subunits ^-2 0 [n
addition to providing basic information about the structure of IL-2 and its receptors
as wells as the biochemical pathways involved in initiating IL-2 induced functions,
98
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
examination of these analogs allowed the dissection of the interactions required for
immunologic activity. These studies demonstrated that the substitution mutants of
IL-2 could have altered activity in specific functions but not others, which has
tremendous significance in the development of therapies with reduced toxicity and
thus improved therapeutic indices. In particular, there has been some evidence that
at least some indicators of IL-2 toxicity may be improved in these derivative
molecules, specifically by the reduction of secondary cytokine release by IL-2-
stimulated peripheral blood mononuclear cells (PBMC) 21-23
In the current study, we describe the generation of a panel of genetically
engineered fusion proteins consisting of the chimeric TNT-3 monoclonal antibody
and single amino acid substitution analogs of human interleukin-2. This mouse-
human chimeric antibody recognizes single-stranded DNA exposed in degenerating
and necrotic cells found in the solid tumors and thus has the potential to target the
majority of solid tumors 8’ 24, 25 in these studies, we characterized the effect of
amino acid substitution in chTNT-3/IL-2 analog fusion proteins on immunologic
function. Furthermore, because these reagents can be localized within solid tumor
xenografts via chTNT-3, we were able to evaluate the efficacy of these reagents in
inducing local microvascular permeability. This experimental parameter may be
utilized as an indicator of the potential toxicity of IL-2 derivatives.
9 9
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
MATERIAL AND METHODS
Reagents
The Glutamine Synthase Gene Amplification System, including the
expression plasmids pEE6/hCMV-B and pEE12 as well as the NSO murine myeloma
expression cell line, were purchased from Lonza Biologies (Slough, UK).
Restriction endonucleases, T4 DNA ligase, Vent polymerase, and other molecular
biology reagents were purchased from either New England Biolabs (Beverly. MA) or
Boehringer Mannheim (Indianapolis, IN). Dialysed fetal bovine serum, crude DNA
from salmon testes, single-stranded DNA from calf thymus, chloramine T. and 2.2*-
azino-bis(3-ethyIbenzthiazoline-6-sulfonic acid) diammonium salt (ABTS) were
purchased from Sigma Chemical Co. (St. Louis, MO). Recombinant human
interleukin-2 was purchased from Chiron (Emeryville, CA). The Griess Reagent
System, containing sulfanilamide solution, N-l-napthylethylenediamine
dihydrochloride solution, and nitrite standards, was purchased from the Promega
Corporation (Madison, WI). I2 5 I was obtained from DuPont New England Nuclear
(North Billerica, MA) as sodium iodide in 0.1 N sodium hydroxide. BALB/c mice
were obtained from Harlan Sprague-Dawley (Indianapolis, IN). Sulfosuccinimidyl
6-(biotinamido) hexanoate (Sulfo-NHS-LC biotin) was purchased from Pierce
(Rockford, IL). HRPO-conjugated secondary reagents (goat-anti-human IgG (FcSp)
and streptavidin) were purchased from CalTag (Burlingame. CA).
100
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
Cell lines
The NSO murine myeloma cell line was obtained from Lonza Biologies. The
Daudi lymphoma cell line 26, HT-2 lymphoma line 27, ls 174T human colorectal
carcinoma 28 were obtained from the American Type Culture Collection (Manassas,
VA). The Madison 109 murine lung adenocarcinoma 29 was obtained from the
National Cancer Institute (Frederick, MD). The MT-1 human T lymphotropic virus-
I-transformed T cell line 3® and YT-2C2 cell line, a subclone of the acute
lymphoblastic lymphoma cell line YT 31, were generous gifts of Thomas L.
Ciardelli (Dartmouth Medical School).
Leukocyte preparation
Peripheral blood mononuclear cells (PBMC) were obtained from normal,
healthy volunteers via leukopheresis. The cells were fractionated on Histopaque
1077 (Sigma Chemical Co., St. Louis, MO) by centrifugation at 450xg for 30
minutes. The cells were washed three times in PBS (Sigma Chemical Co.) prior to
resuspension in AIM-V serum free leukocyte media (Life Technologies) and counted
for use in the assays.
Antibodies and antibody fusion proteins
The chimeric MAb TNT-3 (chTNT-3, IgG,,tc) and antibody/cytokine fusion
protein chTNT-3/IL-2 were produced as described previously 8, 24 The chTNT-3/
101
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
IL-2 analog fusion proteins were constructed in a single step cloning method. IL-2
analog cDNA was prepared by site-directed mutagenesis to mutate aspartic acid20,
arginine38, methionine39 phenylalanine42, & histidine55 using the following 5* and
3’ primer pairs, respectively: D20K - (EP 526 & 527) 5'-
TT ACTGCTGAA ATT AC AG ATG-3 ’ and 5’-CATCTGTAAnTCAGCAGTAA-3
R38G/W - (EP 425 & 424) 5’-AAACTCACC(TG)GGATGCTCACA-3' & 5 -
TGTGAGCATCC(AC)GGTGAGTTT-3’; M39V/L - (EP 423 & 420) 5'-
CTCACCAGG(CG)TGCTCACATTT-3 ’ & 5’-AAATGTGAGCA(GC)CCTGGTGAG-3':
F42K - (EP 568 & EP567) 5’ - ATGCTC AC A A AG A AGTTTT AC-3 ’ & 5 -
GTAAAACTTCTTTGTGAGCAT-3’; and H55Y - (EP 422 & 421) 5 -
GAACTGAAATAATCTTCAGTGT-3 ’ & 5 ’ -ACACTGAAGATATTTCAGTTC-3 * .
The full-length IL-2 analog was then amplified by PCR with the 5’ and 3’
primers EP 238 5’-
GGTAAAGCGGCCGCAGGAGGTGGTAGCGCACCTACTTCAAGTTCTACA-3' and
EP 239/523 5’-TCATGCGGCCGCTCAAGTTAGTGTTGAGATGATGCT-3'
respectively, to append a Notl restriction site and codons for a polypeptide linker to
the 5’ end of the IL-2 cDNA and a stop codon and Notl site at the 3' end. Following
Notl restriction endonuclease digestion of the PCR product and pEE12/chTNT-3 HC
expression vector, the modified IL-2 analog sequence was then inserted into
pEE12/chTNT-3 HC, resulting in the expression vector pEE12/chTNT-3 HC/IL-2
analog. The expression vector for the chTNT-3 LC, pEE6/chTNT-3 LC. was
constructed as described previously 24, The chTNT-3/D20K fusion analog has a
102
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
lysine residue substituted for aspartic acid 20. Likewise, the chTNT-3/R38G and
chTNT-3/R38W fusion analogs have glycine and tryptophan residues substituted for
arginine 38, respectively. The chTNT-3/M39V and chTNT-3/M39L fusion proteins
have valine and leucine residues substituted for methionine 39. The chTNT-3/F42K
fusion analog has a lysine residue substituted for phenylalanine 42, while the
chTNT-3/H55Y has a tyrosine residue substituted for histidine 55.
Expression and purification o f chTNT-3/IL-2 and chTNT-3/IL-2 analogs
chTNT-3/IL-2 and chTNT-3/IL-2 analogs were expressed from NSO murine
myeloma cells for long term stable expression according to the manufacturer's
protocol (Lonza Biologies). The highest producing clone was scaled up for
incubation in a 3 L stir flask bioreactor and the fusion protein purified from the spent
culture medium by sequential Protein A affinity chromatography and ion-exchange
chromatography, as described previously 6. The fusion protein was analyzed by
sodium dodecyl sulfate polyacrylamide gel electrophoresis (SDS-PAGE) under
reducing conditions and stained with Coomassie blue to demonstrate proper
assembly and purity.
ELISA
chTNT-3/IL-2 analog-secreting clones were initially identified by indirect
ELISA analysis of supernatants using microtiter plates coated with crude DNA
preparations from calf thymus at 50 pg/mL. Following this initial screening,
103
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
production rate assays were performed by incubating ixlO6 ceils in 1 mL of selective
medium for 24 hours, after which the supernatants were analyzed by indirect ELISA
analysis using microtiter plates coated with single-stranded DNA preparations from
salmon testes at 100 pg/mL. Detection of chTNT-3 and chTNT-3 fusion proteins
bound to antigen was accomplished with horse-radish-peroxidase-conjugated goat-
anti-human IgG (FcSp) followed by color development produced by enzymatic
cleavage of ABTS. Dilutions of chTNT-3 were used to generate a standard curve
using a 4-parameter fit by an automated ELISA reader (Bio-Tek Instruments.
Winooski, VT), from which concentrations of unknowns were estimated and
expressed as pg/mL/106 cells/24 hours.
IL-2 Receptor Binding Studies
Relative binding studies were performed on MT-1 and YT-2C2 cell lines
using the method of Frankel and Gerhard 32 to determine the avidity constant of the
analogs to the low and intermediate IL-2 receptors, respectively. The MT-1 cell line
is an HTLV-I-transformed T cell line that lacks IL-2RP expression (i.e.. only
expresses IL-2Ra and y) 33. [n contrast, the YT-2C2 cell line, a subclone of the
acute lymphoblastic lymphoma YT cell line, is an NK-like cell line that lacks
DL-2Ra expression and thus only expresses IL-2RP and y 31, 34 Briefly, target cells
were incubated with 10 to 100 ng of l2 5 I-labeled chTNT-3/IL-2 or analog in PBS for
30 minutes at room temperature with constant mixing. This short incubation period
allows sufficient time for the binding and internalization of the IL-2 containing
104
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
proteins, but insufficient time for metabolism. To minimize contribution of the
antibody moiety to fusion protein binding to the target cells, a 10-fold molar excess
of cold antibody was used to prevent binding to the cells. Additionally, any dead
cells were removed from the freshly harvested cell lines by Ficoll-Hypaque density
centrifugation and the purified cells were used within one hour. The activity in the
supernatants were then measured in a gamma counter and the amount of bound
radioactivity (cpm) determined by subtractive analysis. The amount of bound fusion
protein was then calculated from the cell-bound radioactivity and the specific activity
(cpm/ng) of the radiolabeled antibody preparation. Scatchard plot analysis was used
to obtain the slope. The equilibrium or avidity constant K .a was calculated by the
equation K=-(slope/n), where n is the valence of the fusion protein (2 for IgG fusion
protein).
Secondary cytokine induction
The relative tendency of chTNT-3/IL-2 and chTNT-3/lL-2 analogs to induce
the expression of the cytokines interleukin- ip (IL-lp). interferon-y (IFN-y). and
tumor necrosis factor-a (TNF-a) from human peripheral blood mononuclear cells
(PBMC) were measured by indirect ELISA analysis. Freshly purified human PBMC
were isolated from healthy normal donors by Ieukopheresis and fractionated on
Histopaque 1077 (Sigma-Aldrich, St. Louis, MO) by centrifugation at 450^ for 30
minutes. Cells were stimulated with 1 nM chTNT-3, chTNT-3/IL-2 (WT). or
chTNT-3/IL-2 analog at IxlO6 cells/mL in a 5% C 0 2 humidified 37°C incubator.
105
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
AIM-V serum-free lymphocyte media (Life Technologies, Rockville. MD) was
utilized to eliminate the effect of serum on cytokine induction. Supernatants were
collected after one, three, five, and seven days, centrifuged to remove remaining
cells, and cytokine concentrations determined by ELISA detecting interleukin-1 ( 3
(IL-1P), interferon-y (IFN-y), and tumor necrosis factor-a (TNF-a) following the
maufacturer's protocol (Endogen, Inc., Wobum, MA). Briefly, supernatants were
obtained from stimulated peripheral blood mononuclear cells (PBMC) on the
indicated day and centrifuged at 90g for five minutes to remove any cells. These
supernatants were incubated in duplicate in antibody-coated wells of the supplied
microtiter plates. A second distinct cytokine-specific antibody-enzyme conjugate
was then added to each well followed by addition of the appropriate chromogenic
substance. Absorbance was detected by spectrophotometry, and the concentration of
cytokine was determined from a standard curve mean cytokine secretion was
determined by standardizing the analog-stimulating cytokine secretion as a
percentage of the mean rhuIL-2-induced secretion for each day in each individual
experiment. The sensitivity of each ELISA varied from 3-10 pg/mL.
IL-2 Proliferation Activity Assays
The relative ability of the fusion proteins to stimulate proliferation was
determined in cell-based assay utilizing the murine IL-2-dependent cell line HT-2
35, 36 Briefly, freshly harvested HT-2 cells were washed three times with sterile
PBS to remove residual IL-2. After the final wash, the cells were incubated in
106
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
duplicate at 1x10s cells/mL with complete RPMI or RPMI supplemented with a
recombinant IL-2 standard, chTNT-3, chTNT-3/IL-2 or chTNT-3/IL-2 analog in
sterile 96-well flat-bottomed tissue culture plates in a 5% C 0 2 , 37°C humidified
atmosphere. After 72 hours, relative IL-2-dependent cellular proliferation was
determined utilizing the CellTiter 96® AQueous One Solution Cell Proliferation
Assay (Promega, Madison, WI), a one-step colorimetric method that determines the
relative conversion of the tetrazolium compound MTS to a colored formazan
product. The absorbance of each sample at 490 nm were determined using a Bio-
Tek plate reader and the results were graphed to determine the specific activities
(IU/mg) of the fusion proteins.
Lymphokine-activated killer (LAK) cell activity generation
PBMC were cultured at IxlO6 cells/mL in AIM-V medium in the presence of
1 nM chTNT-3, rhIL-2, chTNT-3/IL-2, or chTNT-3/IL-2 analog and incubated at
37°C in a humidified 5% C02 atmosphere. AIM-V (Life Technologies, Inc..
Rockville, MD) is a chemically defined serum-free media designed to support the
growth of lymphocytes in the absence of serum, thereby avoiding the serum-induced
activation of PBMC. After 72 hours, the cells were harvested, washed, and incubated
with Daudi lymphoma cells in four hour cytotoxicity assays. Lactate dehydrogenase
(LDH) release was measured with the Promega CytoTox96 Non-Radioactive
Cytotoxicity Assay. Spontaneous LDH release from target and effector cells were
107
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
both subtracted from the measured values and the final results were expressed in
percent specific cytotoxicity.
Vasopermeability assays
Six-week old BALB/c nu/nu mice were inoculated subcutaneously in the left
flank with approximately 1 x 107 LS174T human colorectal carcinoma cells.
Approximately 10 days later, when the tumors had reached approximately 0.5-1.0
cm in diameter, the mice were injected intravenously with a 0.1 mL inoculum
containing 25 pg of chTNT-3, chTNT-3/IL-2, or chTNT-3/IL-2 analog (n = 5 /
group). Two hours later, the animals were injected with a 0.1 mL inoculum of i:T-
B72.3, an antibody that recognizes TAG-72, a tumor associated glycoprotein highly
expressed on human colorectal carcinoma. Animals were sacrificed by sodium
pentobarbital overdose three days post-injection and blood, tumor, and various
organs were removed and weighed. The radioactivity in the samples was then
measured in a gamma counter and the data for each mouse were expressed as median
percent injected dose/gram (% ID/g) and median tumor:organ ratio (cpm per gram
tumor/cpm per gram organ). The ability to induce vasopermeability was expressed
as ?ne percent of chTNT-3/IL-2-pretreatment-mediated increase in B72.3 uptake
(%ID/g) over chTNT-3 pretreatment. Wilcoxon rank sum analysis was performed to
detect statistically significant differences in the biodistribution of the molecules (p <
0.05).
108
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
RESULTS
Construction, expression, and purification ofchTNT-3/IL-2 analogs
Site-directed mutagenesis was utilized to generate PCR products consisting
of a seven amino acid linker peptide and single amino acid substitution analogs of
human IL-2. These PCR products were inserted into a Notl site previously appended
immediately downstream of the human yl terminal codon, producing TNT-3
VH/human yl/human IL-2 analog fusion genes (Figure 4-1) under the control of the
hCMV promoter. The resulting expression vector. pEEI2/chTNT-3 HC/huIL-2 or
huIL-2 analog, encodes a fusion protein consisting of human IL-2 or IL-2 analog
coupled to the carboxy-terminus of chTNT-3 heavy chain via a non-cleavabie seven
amino acid linker. These final vectors were co-transfected into the NSO murine
myeloma cell line with the light chain expression vector, pEE6/chTNT-3 LC. for
expression. Antibody producing clones were selected in glutamine-free media and
screened for maximal secretion via ELISA. The highest producing clones, producing
approximately 6 to 40 pg/mL/106 cells/24 hours in static culture, were scaled up in 3-
L bioreactors. The fusion proteins were purified by sequential Protein A affinity
chromatography and ion-exchange chromatography, yielding > 15 pg/mL. The
chimeric heavy chain fusion proteins were intact and properly assembled as
demonstrated by reducing SDS-PAGE (Figure 4-2). Two bands were resolved for
chTNT-3/huIL-2 at approximately Mr 25,000 and Mr 70,000, corresponding to the
109
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
Figure 4-1: Chimeric antibody-IL-2 analog fusion proteins. Schematic diagram
depicting the linker containing the Notl cloning site between the human yl and
human IL-2 analog cDNA in the chimeric TNT-3 heavy chain/cytokine fusion genes.
y 1 Not I
IL-2
V H
G G T AAA
Gly Lys
G C G G C C G C A G G A G G T G G T A G C G C A C C
Ala Ala Gly Gly Gly S e r ^ J A I a Pro
linker
Human C
Human IL-2
HO
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
Figure 4-2: SDS-PAGE analysis of recombinant antibody and antibody-IL-2 fusion
proteins. Electrophoretic identification of chTNT-3/IL-2 WT and IL-2 analog fusion
proteins. Coomassie Blue-stained 10% polyacrylamide tris-glycine reduced gel of
purified biotinylated chTNT-3 (lane 1), chTNT-3/IL-2 (lane 2), chTNT-3/D20K
(lane 3), chTNT-3/R38G(lane 4), chTNT-3/R38W (lane 5), chTNT-3/M39V (lane 6),
chTNT-3/M39L (lane 7), chTNT-3/F42K (lane 8), chTNT-3/H55Y (lane 9), and
molecular weight markers (lane 10).
I ll
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
predicted molecular weights of the immunoglobulin light chain and heavy
chain/cytokine fusion.
IL-2 receptor binding studies:
The avidity constants of the chTNT-3/IL-2 and chTNT-3/IL-2 analogs were
determined through binding studies with low- and intermediate-affinity IL-2
receptors (IL-2R) found on the MT-l and YT-2C2 cell lines, respectively, and are
summarized in Table 4-1. The majority of chTNT-3/IL-2 analogs demonstrated
similar binding profiles with minor variability compared to the wild-type fusion
protein, although the tendency was toward small increases in affinity. chTNT-3/
D20K and chTNT-3/F42K both displayed decreased ability to bind the intermediate-
affinity receptor and increased affinity to IL-2Ra relative to the wild type fusion
protein, hi comparison, chTNT-3/ H55Y demonstrated a reduction in IL-2Ra
binding with minimal alteration in intermediate-affinity 1L-2R binding.
IL-2 bioactivity studies:
IL-2 immunologic activity was assessed in three different tests—the tendency
of the fusion proteins to induce the secretion of the secondary cytokines IL-1 p, IFN-
y, and TNF-a from human PBMC as evaluated by ELISA (Figure 4-3), the ability to
support the proliferation of the IL-2-dependent HT-2 murine T cell lymphoma cell
line, and the ability to generate LAK cell activity against Daudi lymphoma cells
(Figure 4-4). These data are summarized in Table 4-2. The receptor binding and
112
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
Table 4-1: Relative binding of chTNT-3/IL-2 and chTNT-
3/IL-2 analog fusion proteins to the MT-1 and
YT-2C2 cell lines.
Molecule MT-1 YT-2C2
chTNT-3/IL-2 WT 1.18 X 109 1.18 X 1 0 9
chTNT-3/D20K 1.61 X to9 0.57 X 1 0 9
chTNT-3/R38G 1.35 X 109 1.56 X 1 0 9
chTNT-3/R38W 1.20 X 109 1.63 X 1 0 “
chTNT-3/M39V 1.18 X 109 1.37 X 1 0 9
chTNT-3/M39L 1.02 X 109 1.43 X 1 0 9
chTNT-3/F42K 1.50 X 109 0.90 X 1 0 "
chTNT-3/H55Y 0.90 X 109 1.34 X 1 0 9
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
Figure 4-3: Secondary cytokine secretion by stimulated peripheral blood
mononuclear cells (PBMC). Cells were incubated with antibody, antibody-lL-2, or
antibody-IL-2 analog fusion proteins in serum free media and analyzed by indirect
ELISA after one, three, five, and seven days for cytokine production. Results shown
are representative for the two PBMC donors tested. A Interleukin-1 p (IL-IP); B
Interferon-y (IFN-y); C Tumor necrosis factor-a (TNF-a).
3 0 •
4 0 ■
i: i m f l
-=C E T
/ / ' / ^
/
✓ / ■
/ / / / /
1 6 0 0
1 4 0 0
1200
1000
6 0 0
4 0 0
QDsy I
2 5 0
£ 200
1 1 5 0
s i ix i
• 5 0
c\
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
Figure 4-4: Lymphokine-activated killer (LAK) cell activity. LAK cell activity
generated by activation of peripheral blood mononuclear cells with chTNT-3, rhuIL-
2, chTNT-3/IL-2, or chTNT-3/IL-2 analogs was evaluated in four hour cytotoxicity
activity assays against Daudi lymphoma cells. A R38 analogs; B M39 analogs, C
D20, F42, H55 analogs.
A
100
O
*
K J
X
9 1
v
V
# • 40
a
i 20
50:1 25:1 12.5:1 6 .3:1
EffectonTumor
♦ — c h T N T - 3 — m — r h u I L - 2 c h T N T - 3 / h u I L - 2 - - - c h T N T - 3 / R 3 8 G — • — c h T N T - 3 / R 3 8 W
B
100
a
a
I
s
&
n
• >
f c j
£
50:1 25:1 12.5:1 6.3:1
EffectonTumor
| ■ » c h T N T - 3 — - ■ — r h u I L - 2 c h T N T - 3 / h u l L - 2 - - X - - - c h T N T - 3 / M 3 9 V — — c h T N T - 3 / M 3 9 L
115
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
Figure 4-4: Lymphokine-activated fuller (LAK) cell activity. LAK cell activity
generated by activation of peripheral blood mononuclear cells with chTNT-3. rhulL-
2, chTNT-3/IL-2, or chTNT-3/IL-2 analogs was evaluated in four hour cytotoxicity
activity assays against Daudi lymphoma cells. A R38 analogs; B M39 analogs, C
D20, F42, H55 analogs.
ioo
It 80
I .
£
£. 40
0 1
2
§
£
12.5:1 50:1 25:1 6.3:1
EffectonTumor
- • c h T N T - 3
— c h T N T - 3 / F 4 2 K
■ r h u I L - 2
— • — c h T N T - 3 / D 2 0 K
chTNT-3/hulL-2
-chTNT-3/H55Y
116
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
proliferation results for chTNT-3/huIL-2 and chTNT-3/D20K are consistent with
previously published data obtained with free wild-type IL-2, and D20K * 7, 20,37-39
and thus support the validity of these two assays in our hands. Both free D20K and
chTNT-3/D20K demonstrate the inability to bind to the intermediate-affinity IL-2R
(IL-2RP) on YT-2C2 cells, and, associated with this observation, lack the ability to
support IL-2 dependent proliferation and stimulate PBMC intermediate-affinity IL-
2R (IL-2RP) on YT-2C2 cells, and, associated with this observation, lack the ability
to support IL-2 dependent proliferation and stimulate PBMC cytokine secretion.
However, while the cTNT-3/F42K fusion protein demonstrated similar proliferation
bioactivity as the free F42K protein 21, the fusion protein displayed a diametric
binding profile, indicating increased binding to the low affinity receptor and
decreased selectivity for the intermediate-affinity IL-2R. There appeared to be an
association between binding to the intermediate affinity receptor and IL-2
immunologic bioactivity, with a significant degree of binding being necessary for
immunologic function. chTNT-3/D20K and chTNT-3/ F42K, the two analogs with
significant reduction in binding to the intermediate affinity receptor demonstrating
little to no activity in stimulation of proliferation, LAK activity generation, and
secondary cytokine generation.
The effect of amino acid substitution is dependent on both the particular
residue being altered and the choice of replacement amino acid. Indeed, different
amino acid substitutions produce different cytokine profiles, as demonstrated by the
results of substitution of R38, M39, and H55. While chTNT-3/R38G and chTNT-3/
117
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
R38W display similar induction of secondary cytokine secretion as previously
reported with a free R38A analog, the IL-2-dependent proliferation activities of these
analogs vary considerably. The chTNT-3/R38W fusion retains approximately 60%
of wild-type activity in an IL-2-dependent proliferation assay, in contrast to the 5-
15% activity of R38E ^ , 37-150% activity of R38A and approximately 11% of
wild-type activity possessed by chTNT-3/R38G as assessed in leukemia cell
proliferation assays. However, not all attributes are affected differentially, as these
results and published data display similar abilities of R38 analogs to generate LAK
cell activity 22, 23
The differential effect of amino acid substitution is seen with other residues.
Both free F42K and chTNT-3/F42K display a remarkable loss of proliferation
inducing activity, in contrast to a F42A mutant described previously that retained 75-
100% activity 40. Furthermore, while both free M39Q and H55D have been
reported to possess wild-type activity in supporting [L-2-dependent proliferation ^ .
our studies with chTNT-3/M39V, chTNT-3/M39L, and chTNT-3/H55Y
demonstrated significant decreases in activity. Although the difference in activities
could be accounted for by the presence of the antibody moiety, it is unlikely that this
would be the primary reason, as the wild-type IL-2, D20K, and F42K fusion proteins
all demonstrated conservation of this behavior compared to published results
obtained with the free analogs. An additional source of variation is the specific
activity associated with different batches of product; however, in our experience, this
118
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
has not been demonstrated to be a significant source of variation and does not seem
to be a likely explanation for the loss of greater than 50% bioactivity.
The fusion proteins chTNT-3/D20K and chTNT-3/F42K were unable to elicit
the production of the cytokines IL-ip, IFN-y, and TNF-a, while chTNT-3/R38G,
chTNT-3/ R38W, chTNT-3/M39V, chTNT-3/M39L, and chTNT-3/H55Y retained >
50% of the activity of the wild type IL-2 fusion molecule.
Vasopermeability assays:
The ability of the wild type and IL-2 analog fusion proteins to increase
micovascular permeability was examined in a pretreatment model. The relative
increase in selective uptake of l2 5 I-labeled B72.3 monoclonal antibody, which
recognizes the tumor associated glycoprotein-72 (TAG72), by LS174T human colon
adenocarcinoma xenographs in vivo was compared following pretreatment with
antibody or antibody-fusion protein. Results were expressed as the percent of wild
type fusion protein-induced increase in uptake compared to chTNT-3 pretreatment
(Figure 4-5). These data are summarized in Table 4-2.
Not surprisingly, chTNT-3/D20K, which lacked immunologic activity by all
parameters investigated, displayed complete loss of vasopermeability inducing
activity. However, both of the R38 substitution fusion proteins demonstrated
complete lack of this activity, which was unexpected considering that at least
chTNT-3/R38 retained the majority of wild-type immunologic function. The effect
of substitution at M39 on vasopermeability induction depended upon the choice of
119
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
Figure 4-5: Relative induction of vasopermeability. The ability of the chTNT-3/IL-
2 analog fusion proteins were examined in a local vasopermeability assay.
Biodistribution of 1 2 5 I-labeled B72.3 in BALB/c nu/nu mice bearing LSI74T human
colon carcinoma xenografts were determined following pretreatment with 25 pg of
chTNT-3, chTNT-3/IL-2, or chTNT-3/IL-2 analog (n=5/group). Results are
expressed as the percentage of chTNT-3/IL-2 (WT) increase in l2 5 l-B72.3 uptake by
xenograft compared to chTNT-3 pretreatment.
Relative Induction of Vasopermeability
a
120
100
Cl
8 .
80
i ! 60
Z p l,
u 40
u rn
•> c l
C U r * > 20
j j C Q
%
0
&
-20
-40
■ chTNT-3
DchTNT-3/R38W
D chTNT-3/D20K
P r e t r e a t m e n t M o l e c u l e
■ chTNT-3/IL-2 WT
□ chTNT-3/M39 V
□ chTNT-3/H55Y
□ chTNT-3/R38G
□ chTNT -3/M39L
BchTNT-3/F42K
120
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
Reproduced with permission o f th e copyright owner. Further reproduction prohibited without permission.
Table 4-2: Summary of the relative properties of the chTNT-3 compared to the chTNT-3/IL-2 and chTNT-3/IL-2 analog
fusion proteins.
Secondary Cytokine HT-2 Proliferation Vasopermeability
Production
Molecule IL -ip IFN-y T N F -a Activity Induction (% ± sd)
chTNT-3 - - - - 0 ± 5
chTNT-3/IL-2 WT ++++ ++++ ++++ ++++ 100± 15
chTNT-3/D20K -/+ -/+ -/+ - -28 ± 6
chTNT-3/R38G ++ ++ ++ + - 7 ± 15
chTNT-3/R38W ++ ++++ ++ +++ 4 ± 16
chTNT-3/M 39V +++ +++ +++ + 99 ± 2 7
chTNT-3/M 39L ++ +++ ++ + 52 ± 23
chTNT-3/F42K -/+ + - + 97 ± 3 1
chTNT-3/H55Y ++ ++++ ++ + -6 ± 6
Secondary cytokine production and stimulation of HT-2 proliferation expressed as percent of wild-type activity: - = no
activity, + = less than 25% activity, ++ = 25-50% activity, +++ = 50-75% activity, ++++ = 75-100%.
to
NOTE TO USERS
Page(s) not included in the original manuscript
are unavailable from the author or university. The
manuscript was microfilmed as received.
122 -124
This reproduction is the best copy available.
IJM I
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
replacement amino acid. While chTNT-3/M39V retained almost wild type activity,
chTNT-3/M39L displayed only 52% activity. Similar to the R38 analogs, the effect
of substitution at H55, generating a fusion protein that demonstrates decreased
binding to the IL-2Ra subunit on MT-1 cells, significantly reduced potency in the
HT-2 proliferation assay, but notable secondary cytokine induction, results in
complete loss of vasopermeability induction. Of particular note, chTNT-3/F42K. an
analog that demonstrated virtual absence of immunologic function by all three
functional assays, retained wild type level of vasopermeability inducing activity.
These results indicate that the downstream effector functions of IL-2 are not
necessarily co-dependent and the mechanism of vascular leak syndrome is not
merely in response to release of cytokine mediators from peripheral blood
mononuclear cells. However, there was no obvious predictor of vasopermeability
induction.
DISCUSSION
Because of the serious toxicity of systemically administered IL-2 observed in
clinical practice 41, our laboratory and others have been investigating the use of the
antibody-fusion protein approach in the selective intratumoral delivery of IL-2 and
other biologic response modifiers. Previous work has demonstrated the efficacy of
this approach at generating bifunctional molecules that effectively target IL-2 to
tumors and activate antitumor responses 42,43 Additionally, our laboratory has
developed a novel used of targeted IL-2, which takes advantage of its
125
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
vasopermeability inducing property to selectively induce capillary leakage within the
tumor vasculature 6.8, 15,44 Toward this end, we have previously demonstrated
that pretreatment with antibody-IL-2 chemical immunoconjugates or fusion proteins
enhances specific tumor uptake of therapeutic molecules including radiolabeled
monoclonal antibodies (MAbs) and chemotherapeutic drugs without affecting
normal tissue uptake 8, 15,44
Because of these two divergent uses of targeted IL-2, our aim was to
determine whether it was possible to generate targeted IL-2 molecules that
specifically retain individual activities of the parent molecule (specific immunologic
or vasopermeability inducing function). In this study, we have constructed a panel of
fusion proteins consisting of the chTNT-3 monoclonal antibody and single amino
acid substitution analogs of human IL-2 and performed preliminary characterization
of these molecules in vitro and in vivo. Specific amino acid substitutions produced
alterations in IL-2 receptor binding and immunologic activity, ranging from almost
complete retention to virtual lack of specific cytokine activity. The fusion proteins
behaved in a similar manner as has been reported for the limited number of identical
free substitution analogs described in the literature in various assays of cytokine
function. In particular, the chTNT-3/D20K and chTNT-3/F42K both behaved as
predicted in IL-2-dependent proliferation assays and generation of LAK cell activity
against Daudi lymphoma cells 21-23 Furthermore, chTNT-3/F42K demonstrated
reduced secondary cytokine induction compared to the chTNT-3/IL-2 fusion protein,
similar to the free protein analogs.
126
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
In addition to the alterations to immunologic function caused by the amino
acid substitutions, we wanted to ascertain the effect on the induction of
microvascular vasopermeability. Reduction in vasopermeability activity could
indicate reduced toxicity for immunologically active molecules, while retention of
this ability in an immunologically inactive fusion protein would be optimal for
pretreatment approaches to tumor therapy. This behavior was examined in a
pretreatment model for enhanced uptake of radiolabeled B72.3 antibody in a
xenograft model of LS174T human colon adenocarcinoma. These studies indicated
that vasopermeability induction is not a simple response to the release of cytokine
mediators from PBMC, as certain fusion proteins (chTNT-3/R38G, chTNT-3/R38W,
and chTNT-3/H55Y) that caused significant release of IL-ip, IFN-y. and TNF-a
nevertheless demonstrated no more ability to induce local vasopermeability than the
parent antibody alone. In contrast, chTNT-3/F42K. a fusion protein that
demonstrated complete lack of activity in supporting IL-2 dependent proliferation or
induction of secondary cytokine secretion, generated the same degree of
vasopermeability induction as the wild type fusion protein.
Based upon these results, we have identified two molecules that display
potential for improved targeted therapy of solid tumors. The first molecule.
chTNT-3/R38G, retains immunologic stimulatory activity as assessed by stimulation
of IL-2 dependent proliferation, induction of secondary cytokine secretion, and
generation of LAK cell activity. However, it demonstrates decreased ability to
induce vasopermeability in an in vivo assay, and may therefore have an increased
127
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
therapeutic index by a reduction in the tendency to cause capillary leak syndrome.
The second molecule, chTNT-3/F42K, in contrast, may have increased potential
compared to chTNT-3/IL-2 not as an immunostimulatory agent, as a universal
pretreatment to enhance the delivery of therapeutic reagents to solid tumors.
chTNT-3/F42K retains near complete vasopermeability inducing activity compared
to chTNT-3/IL-2 WT, but is almost completely lacking in immunostimulatory
activity as determined by an inability to support HT-2 cell proliferation, induce
IL-ip, IFN-y, and TNF-a production by PBMC, and LAK cell activation. By
separating these two activities (immunostimulation and vasopermeability induction),
we can hopefully decrease the incidence of undesireable toxicity which can
compromise the efficacy of treatment.
If the phenomenon of vascular leak syndrome is truly an extension of the
local vasopermeability induction observed with targeted IL-2, these results indicate
that the mechanism of this toxicity is not a simple response to release of cytokine
mediators, as has been proposed 21. Extensive research into the underlying
mechanism and pathology of IL-2 generated vascular leak syndrome has produced
conflicting results. In addition to the generalized cytokine mediated toxicity
hypothesis, other proposed mechanisms of action include direct damage to
endothelial cells by IL-2 generated LAK cells 45,46 cytokine mediated alterations
in endothelial architecture 47, and upregulation, either directly or indirectly, of the
inducible form of nitric oxide synthase (iNOS). This increase in iNOS expression
produces a corresponding increase in nitric oxide (NO), a free radical second
128
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
messenger that mediates a variety of physiological functions but is toxic for
endothelial cells. In addition to direct damage to the vasculature, NO causes
systemic hypotension via intrinsic vasodilator activity, which can lead to secondary
pulmonary hypertension and pulmonary edema. Supporting evidence for this
hypothesis comes from investigators who observed that treatment with IL-2 causes
an increase in serum nitrites, stable breakdown products of NO 48. Furthermore,
several groups have demonstrated that one can prevent or reduce the severity of
capillary leak syndrome through the use of inducible nitric oxide synthase inhibitors
such as Nc-methyl-L-arginine (L-NMA) and NG -nitro L-arginine methyl ester
(L-NAME) 48-50.
We previously demonstrated that the generation of enhanced tumor
vasopermeability involves iNOS, as the effect of chTNT-3/IL-2 pretreatment could
be abrograted by the administration of L-NMA. Regardless of the specific
biochemical mechanism of IL-2 toxicity, if indeed the signal transduction pathways
of IL-2 induced vasopermeability increase and capillary leak syndrome are the same.
iNOS appears to be vital to these activities. More importantly, our new data
regarding vasopermeability inducing ability indicate that selective amino acid
substitution can effectively eliminate this activity. We are currently determining
whether the degree of vasopermeability induction correlates with in vivo toxicity. If
so, the mouse pretreatment model, along with immunologic efficacy assays, would
be an important clinical predictor therapeutic index. However, from the data
collected thus far, there appears to be no obvious predictor of this behavior.
129
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
REFERENCES
1. Coley WB. Late results of the treatment of inoperable sarcoma by the mixed
toxins of erysipelas and bacillus prodigiosus. Am J Med Sci 1906: 131:375-
430.
2. Coley WB. The treatment of malignant tumors by repeated inoculations of
erysipelas: with a report of ten original cases. Am J Med Sci 1893: 105:487-
511.
3. Smith KA. Lowest dose interleukin-2 immunotherapy. Blood 1993; 81:1414-
1423.
4. Atkins MB, Lotze MT, Dutcher JP, et al. High-dose recombinant interleukin
2 therapy for patients with metastatic melanoma: analysis of 270 patients
treated between 1985 and 1993. J Clin Oncol 1999; 17:2105-2116.
5. Sone S, Ogura T. Local interleukin-2 therapy for cancer, and its effect
induction mechanisms. Oncology 1994; 51:170-176.
6. Hu P, Homick JL, Glasky MS, et al. A chimeric Lym-l/interleukin 2 fusion
protein for increasing tumor vascular permeability and enhancing antibody
uptake. Cancer Research 1996; 56:4998-5004.
7. Hornick JL, Khawli LA, Hu P, Lynch M, Anderson PM, Epstein AL.
Chimeric CLL-1 Antibody Fusion Proteins Containing Granulocyte
Macrophage Colony-Stimulating Factor or Interleukin-2 With Specificity for
B-Cell Malignancies Exhibit Enhanced Effector Functions While Retaining
Tumor Targeting Properties. Blood 1997; 89:4437-4447.
8. Homick JL, Khawli LA, Hu P, Sharifi J, Khanna C, Epstein AL. Pretreatment
with a Monoclonal Antibody/Interleukin-2 Fusion Protein Directed against
DNA Enhances the Delivery of Therapeutic Molecules to Solid Tumors.
Clinical Cancer Research 1999; 5:51-60.
9. Jain RK. Determinants of tumor blood flow: A review. Cancer Res. 1988:
48:2641.
10. Sands H. Experimental studies of radioimmunodetection of cancer: an
overview. Cancer Research (Supplement) 1990.
11. Cobb LM. Intratumor factors influencing the access of antibody to tumor
cells. Cancer Immunol. Immunother. 1988; 28:235.
130
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
12. LeBerthon B, Khawli LA, Alauddin M, et al. Enhanced tumor uptake of
macromolecules induced by a novel vasoactive interleukin 2
immunoconjugate. Cancer Research 1991; 51:2694-2698.
13. Cotran RS, Pober JS, Gimbrone MA, Springer TA, Wiebke EA, Gaspari A A.
Endothelial activation during interleukin 2 immunotherapy: A possible
mechanism for the vascular leak syndrome. J. Immunol. 1988: 140:1883.
14. Rosenstein M, Ettinghausen SE, Rosenberg SA. Extravasation of
intravascular fluid mediated by the systemic administration of recombinant
interleukin 2. Immunology 1986; 137:1735-1742.
15. Khawli LA, Miller GK, Epstein AL. Effect of seven new vasoactive immuno-
conjugates on the enhancement of monoclonal antibody uptake in tumors.
Cancer 1994; 73:824.
16. Epstein AL, Khawli LA, Homick JL, Taylor CR. Identification of a
Monoclonal Antibody, TV-1, Directed against the Basement Membrane of
Tumor Vessels, and Its Use to Enhance the Delivery of Macromolecules to
Tumors after Conjugation with Interleukin-2. Cancer Res. 1995; 55:2673-
2680.
17. Ju G, Collins L, Kaffka K, et al. Structure-function analysis of human
ir.rerleukin-2. Identification of amino acid residues required for biological
activity. J Biol Chem 1987; 262:5723-31.
18. Ciardelli TL, Landraf B, Gadski R, Stranad J, Cohen FE, Smith KS. A design
approach to the structural analysis of interleukin-2. J Molecular Recognition
1988; 1:42-7.
19. Weir MP, Chaplin MA, Wallace BM, Dykes CW, Hobden AN. Structure
activity relationships of human interleukin-2. Biochemistry 1988; 27:6883-
92.
20. Collins L, Tsien W, Seals C, et al. Identification of specific residues of
human interleukin 2 that affect binding to the 70-kDa subunit (p70) of the
interleukin 2 receptor. Proc Natl Acad Sci U S A 1988; 85:7709-13.
21. Heaton KM, Ju G, Grimm E. Human Interleukin 2 Analogues That
Preferentially Bind the Intermediate-Affinity Interleukin 2 Receptor Lead to
Reduced Scondary Cytokine Secretion: Implications for the Use of These
Interleukin 2 Analogues in Cancer Immunotherapy. Cancer Research 1993:
53:2597-2602.
131
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
22. Heaton KM, Ju G, Morris DK, Delisio K, Bailon P, Grimm EA.
Characterization of Lymphokine-Activated Killing by Human Peripheral
Blood Mononuclear Cells Stimulated with Interleukin 2 (IL-2) Analogs
Specific for the Intermediate Affinity IL-2 Receptor. Cellular Immunology
1993; 147:167-179.
23. Heaton KM, Ju G, Grimm E. Induction of Lymphokine-Activated Killing
with Reduced Secretion of Interleukin-Ip, Tumor Necrosis Factor-a, and
Interferon-y by Interleukin-2 Analogs. Annals of Surgical Oncology 1994;
1:198-203.
24. Homick JL, Sharifi J, Khawli LA, et al. A new chemically modified chimeric
TNT-3 monoclonal antibody directed against DNA for the
radioimmunotherapy of solid tumors. Cancer Biotherapy &
Radiopharmaceuticals 1998; 13:255-268.
25. Homick JL, Sharifi J, Khawli LA, et al. Single Amino Acid Substitution in
the Fc Region of Chimeric TNT-3 Antibody Accelerates Clearance and
Improves Immunoscintigraphy of Solid Tumors. Journal of Nuclear Medicine
2000;41:355-362.
26. Ohsugi Y, Gershwin ME, Owens RB, Nelson-Rees WA. Tumorigenicity of
human malignant lymphoblasts: comparative study with unmanipulated nude
mice, antilymphocyte serum-treated nude mice, and X-irradiated nude mice.
Journal of the National Cancer Institute 1980; 65:715-718.
27. Shipley G, RT A, BM S, YE M, Handwerger B. Regulation of growth of an
interleukin 2 (IL-2)-dependent murine T-cell clone (HT-2) in a defined
serum-free medium. Cell Immunol 1985; 93:459-66.
28. Tom BH, Rutzky LP, Jakstys MM, Oyasu R. Kaye Cl. Kahan BD. Human
colonic adenocarcinoma cells. I. Establishment and description of a new line.
In Vitro 1976; 12:180-191.
29. Marks TA, Woodman RJ, Geran RI, Billups LH. Madison RM.
Characterization and Responsiveness of the Madison 109 Lung Carcinoma to
Various Antitumor Agents. Cancer Treatment Reports 1977: 61:1459-1470.
30. Tsudi M, Karasuyama H, Kitamura F, Nagasaka Y. Tanaka T. Miyasaka M.
Reconstitution of a functional IL-2 receptor by the beta-chain cDNA. A
newly acquired receptor transduces negative signal. J Immunol 1989:
143:4039-43.
132
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
31. Yodoi J, Tshigawara K, Nikaido T, et al. TCGF (II 2)-Receptor Inducing
Factor(s): Regulation of IL 2 Receptor on a Natural Killer-like Cell Line (YT
Cells). Journal of Immunology 1985; 134:1623-1630.
32. Frankel ME, Gerhard W. The rapid determination of binding constants for
antiviral antibodies by a radioimmunoassay: an analysis of the interaction
between hybridoma proteins and influenza virus. Molecular Immunology
1979; 16:101-106.
33. Oda K, Asao h, Higuchi M, et al. Inudction of IL-1 ^-converting enzyme-
independent apoptosis by IL- in human T cell lines. International
Immunology 1997;9:1303-1310.
34. Famer N, Voss S, Leary T, et al. Distinction between gamma c detection and
function in YT lymphoid cells and in the granulocyte-macrophage colony-
stimulating factor-responsive human myeloid cell line, Tf-1. Blood 1995;
8:4568-78.
35. Buttke T, McCubrey J, Owen T. Use of an aqueous soluble
tetrazolium/formazan assay to measure viability and proliferation of
lymphokine-dependent cell lines. J Immunol Methods 1993: 157:233-40.
36. Gieni R, Li Y, HayGlass K. Comparison of [3Hlthymidine incorporation
with MTT- and MTS-based bioassays for human and murine IL-2 and IL-4
analysis. Tetrazolium assays provide markedly enhanced sensitivity. J
Immunol Methods 1995; 187:85-93.
37. Weigel U, Meyer M, Sebald W. Mutant proteins of human interleukin 2.
Renaturation yield, proliferative activity and receptor binding. Eur J Biochem
1989; 180:295-300.
38. Arima N, Kamio M, Okuma M, Ju G, Uchiyama T. The IL-2 receptor alpha-
chain alters the binding of IL-2 to the beta-chain. J Immunol 1991; 147:3396-
401.
39. Flemming C, Russell S, Collins M. Mutation of Asp20 of human interleukin-
2 reveals a dual role of the p55 alpha chain of the interleukin-2 receptor. Eur
J Immunol 1993; 23:917-21.
40. Grant A, Roessler E, Ju G, Tsudo M, Sugamura K, Waldmann T. The
interleukin 2 receptor (IL-2R): the IL-2R alpha subunit alters the function of
the IL-2R beta subunit to enhance IL-2 binding and signaling by mechanisms
that do not require binding of IL-2 to IL-2R alpha subunit. Proc Natl Acad
Sci U S A 1992; 89:2165-9.
133
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
41. Rosenberg SA, Lotze MT, Muul LM, et al. A progress report on the treatment
of 157 patients with advanced cancer using lymphokine activated killer cells
and interleukin-2 or high dose interleukin-2 alone. New England Journal of
Medicine 1987;316:889-905.
42. Becker JC, Pancook JD, Gillies SD, Furukawa K, Reisfeld RA. T cell-
mediated eradication of murine metastatic melanoma induced by targeted
interleukin 2 therapy. J Exp Med 1996; 183:2361-6.
43. Lode HN, Xiang R, Varki NM, Dolman CS, Gillies SD, Reisfeld RA.
Targeted Interleukin-2 Therapy for Spontaneous Neuroblastoma Metastases
to Bone Marrow. Journal of the National Cancer Institute 1997: 89:1 586-
1594.
44. Khawli LA, Homick JL, Sharifi J, Epstein AL. Improving the
chemotherapeutic index of IUdR using a vasoactive immunoconjugate.
Radiochimica Acta 1997; 79:83-86.
45. Kotasek D, Verceilotti G, Ochoa A, et al. Mechanisms of cultured endothelial
injury induced by Iymphokine-activated killer cells. Cancer Research 1988:
48:5528-5532.
46. Ettinghausen SE, Puri RK, Rosenberg SA. Increased vascular permeability in
organs mediated by the systemic administration of Iymphokine-activated
killer cells and recombinant interleukin-2 in mice. Journal of the National
Cancer Institute 1988;80:177-188.
47. Montesano R, Orci L, Vassalli P. Human endothelial cell cultures:
Phonotypic modulation by leukocyte interleukins. J Cell Physiol 1985:
122:424-434.
48. Orucevic A, Hearn S, Lala PK. The role of active inducible nitric oxide
synthase expression in the pathogenesis of capillar)' leak syndrome resulting
from interleukin-2 therapy in mice. Laboratory Investigation 1997; 76:53-65.
49. Orucevic A, Lala PK. Role of nitric oxide in IL-2 therapy-induced capillary
leak syndrome. Cancer Metastasis Rev 1998; 17:127-42.
50. Shahidi H, Kilboum RG. The role of nitric oxide in interleukin-2 therapy
induced hypotension. Cancer Metastasis Rev 1998; 17:119-26.
134
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
Chapter 5. Targeted Delivery of Chemokines Using Monoclonal
Antibody/Chemokine Fusion Proteins for the Adoptive
Immunotherapy of Cancer
ABSTRACT
Chemokines have been used in the experimental treatment of cancer with
limited success. While their ability to direct leukocyte chemotaxis makes them a
promising candidate for antitumor therapy, the current inability to generate near
physiologic distribution limits their use as systemically administered free proteins.
In contrast, selective localization of these molecules within tumors appears to
generate the necessary expression pattern for active immunologic recruitment. By
engineering tumor cells to express certain chemokines, various groups have shown
increased expression of these chemokines in the tumor mass results in various levels
of therapeutic efficacy, including prevention of tumor formation, prevention of the
growth of established tumors, and even a reduction in the size of established tumors.
As an alternative approach to selective delivery of these therapeutic moieties, we
have generated fusion proteins consisting of either a human-mouse chimeric TNT-3
antibody or murine TNT-3 antibody and human or mouse monocyte chemotactic
protein-1 (MCP-1) for the targeted immunotherapy of solid tumors. While proper
assembly of the fusion proteins could be demonstrated by both polyacrylamide gel
electrophoresis and ELISA analysis, the recombinant fusion molecules failed to
135
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
activate specific chemoattraction in in vitro assays. This loss of activity is likely due
to the recently described sensitivity of the MCP-1 amino terminus to modification
(particularly by extension) of this chemokine. This study illuminates a particularly
poignant limitation of the antibody fusion protein approach to targeted delivery of
biologic response modifiers to tumors.
INTRODUCTION
Chemokines are a recently identified group of small molecular weight
proteins (8-12 kDa) in the cytokine superfamily specifically involved in cellular
chemotaxis (reviewed in 1). They are divided into at least four known categories
based on the arrangement of two highly conserved cysteine residues in the N-termini
of these proteins, which form disulfide bridges with two other cysteine residues
within the mature protein.
The “CXC” or a family of chemokines represents the subset that has the first
two conserved cysteines separated by a single amino acid. The genes for these
molecules are located on chromosome 14 with the exception of SDF-la. which is
located on chromosome 10. This subset is further divided into those that possess
(interleukin-8, GRO-a) and those that lack (platelet factor 4, interferon-y-inducible
protein) the ELR motif (glutamate-leucine-arginine). The ELR motif is believed to
endow members in this group with the ability to chemoattract endothelial cells,
which may play a role in angiogenesis, and neutrophils It is believed that the
136
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
balance between ELR and non-ELR CXC chemokines may be a major mediator in
angiogenesis stimulation (reviewed in 3). Interferon-y-inducible protein-10 (IP-10)
has been associated with the ability to chemoattract NK cells 4 as well as T and B
lymphocytes 5. Additionally, it has been demonstrated to cause in vivo tumor
necrosis and an inhibition of angiogenesis 6. 7 ancj tumor necrosis in vivo 8. possibly
in a related manner. IP-10 does not appear to alter endothelial cell growth,
attachment, or migration, but appears to affect the differentiation process.
In contrast, the “CC” family of chemokines represents the subset of
chemokines whose first two conserved cysteines are located directly adjacent to one
another. Most members of this family share the ability to chemoattract monocytes
and/or macrophages, although many of the repertoires of molecules in this group are
quite extensive. In particular, MCP-1 (monocyte chemoattractant protein-1. also
known as JE or MCAF (monocyte chemotactic and activating factor), lymphocyte-
derived chemotactic factor (LCDF), glioma-derived chemotactic factor (GDCF)) and
its murine homoiog JE I are able to chemoattract monocytes 9-12 t lymphocytes
13, 1 4 ^ basophils, NK cells ^ 13-16 hematopoietic progenitors, and dendritic
cells 11. It also has a stimulatory effect on cytotoxic T lymphocytes (CTL), NK cells
13, I4f ^ monocytes 12. Macrophage inflammatory protein (M IP-la). another C-
C chemokine, appears to have properties similar to MCP-1, stimulating CTL and NK
cell cytolysis, proliferation, and lymphokine production 14 attracting monocytes 9
137
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
and neutrophils ^ . However, M IP-la is also able to attract neutrophils, which may
play an important role in tumor rejection
The sole member of the C family of chemokines is lymphotactin (also known
as ATAC or SCM-l). This molecule appears to lack the first cysteine residue of
either the CXC or CC motif along with its corresponding disulfide partner. This
molecule has a more limited repertoire and is able to chemoattract lymphocytes and
NK cells but not monocytes and neutrophils 19-21
The final chemokine family, the CX,C family, also has a solitary member
known as fractalkine or neurotactin 22. Unlike the other chemokines. this molecule
is expressed in both a secreted form or as an integral membrane protein. It is
particularly expressed in brain inflammation and induces the migration of T
lymphocytes and mononuclear cells.
Because of their particular influence over specific leukocyte migration, the
potential of chemokines as therapeutic agents for the adoptive immunotherapy of
cancer, in which immunological reagents possessing direct and/or indirect antitumor
reactivity are administered to tumor-bearing hosts
23 1 1 Rosenberg, 1991 #66. was
considered quite promising. Indeed, early histological evidence showed direct
relationships between the level of intratumoral chemokine expression and the pattern
of monocyte recruitment (intratumoral infiltration, rather than peritumoral
accumulation) 24. Furthermore, previous studies involving systemic administration
138
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
of cytokines and other biologic response modifiers demonstrated their ability to
stimulate specific immune responses against tumor xenografts.
However, this approach often requires that large doses be administered
systemically in order to achieve effective concentrations at the disease site, and these
doses have been associated with toxic side effects and high mortality 25. In the case
of chemokine-based therapies, systemic administration of chemokines may actually
antagonize the effects of locally expressed chemokines * . The systemic
administration of IL-8 to rabbits prevents local neutrophil accumulation following
induction of acute inflammation 26, 27 Additionally, transgenic mice
overexpressing MCP-1 under the control of the MMTV-LTR demonstrated elevated
serum levels of MCP-1 and were unable to induce monocytic infiltration into tissues
expressing MCP-1. Functionally, these animals were highly susceptible to infection
by intracellular pathogens 28. Accordingly, chemokine-based adoptive
immunotherapies need to be designed such that appropriate local levels of the agents
can be achieved to produce the physiologic concentration gradients required to direct
effective cellular migration without significant systemic accumulation. This
situation can be achieved in by two approaches: chemokine gene therapy or
antibody-targeted chemokine fusion proteins. The first method involves the ex vivo
or in vivo transduction of autologous tumor cells or fibroblasts with chemokine
expression vectors. Investigations into this approach have demonstrated that
antitumor responses can be achieved through ex vivo gene therapy with several
139
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
different chemokines, including MCP-l 29,30 M IPla 3 *, and RANTES 32
However, gene therapy is not currently a feasible approach for widespread use due to
the cumbersome techniques used for ex vivo therapy and the current inability to
achieve safe and efficient specifically targeted delivery for in vivo gene therapy.
Furthermore, a greater understanding of the effect of cytokines and other biological
response modifiers on transgene expression in vivo is needed, as the phenomenon of
promoter attenuation has been demonstrated to limit durable expression of the target
proteins from these vectors 33, 34 jn contrast, therapy via the antibody-chemokine
fusion protein approach involves the direct injection of a single agent into the
patient, taking advantage of the specific targeting ability of the antibody moiety to
direct the ensuing immune response. This method has been used successfully by our
laboratory and others to target cytokines such as IL-2, IL-8, and GM-CSF to both
solid and lymphoid malignancies 35-37
One of the limitations of traditional monoclonal antibody based targeting
approaches is the difficulty in finding truly tumor-specific antigens that are not shed
or modulated, yet are expressed in all tumor cells at sufficient concentrations. To
circumvent this problem, our laboratory has developed the Tumor Necrosis Therapy
(TNT) approaches, which allows the effective delivery of therapeutic molecules to
all solid tumors with appreciable necrosis. Advances in molecular biology has
allowed further enhancement of this technology, permitting generation of
recombinant chimeric antibodies possessing the variable regions of the parent murine
140
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
antibody joined to human constant regions. This modification appears to prevent the
development of a human-anti-mouse antibody (HAMA) response), in which the
tumor-bearing host rapidly generates anti-mouse antibodies that clear the murine
protein rapidly. Chimerization thus allows the utilization of multiple dosage
regimens; additionally, it provides greater time for tumor localization of the
molecule and therapeutic effects to occur.
In the present study, we describe the generation of fusion proteins consisting
of either human or murine TNT-3 antibody and the analogous monocyte
chemoattractant protein-1 (MCP-1) and their in vitro characterization to determine
the utility of this approach to induce intratumoral chemotaxis of leukocytes and their
potential in the treatment of solid malignancies.
MATERIALS AND METHODS
Reagents
The Glutamine Synthase Gene Amplification System, including the
expression plasmids pEE6/hCMV-B and pEE12 as well as the NSO murine myeloma
expression cell line, were purchased from Lonza Biologies (Slough. UK). The
phagemid or plasmid clones pGEM-hJE34 and pcJE-1 containing the cDNAs for
human monocyte chemotactic protein-1 (huMCP-1) and murine monocyte
chemotactic protein-1 (muMCP-1) respectively, were purchased from American
Type Culture Collection (Manassas VA). Restriction endonucleases. T4 DNA
141
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
ligase, Vent polymerase, and other molecular biology reagents were purchased from
either New England Biolabs (Beverly, MA) or Boehringer Mannheim (Indianapolis,
IN). Dialysed fetal bovine serum, 4-chloro-l-naphthol tablets, crude DNA from
salmon testes, single-stranded DNA from calf thymus, and 2,2’-azino-bis(3-
ethylbenzthiazoline-6-sulfonic acid) diammonium salt (ABTS) were purchased from
Sigma Chemical Co. (St. Louis, MO). Recombinant huMCP-1 and muMCP-I were
purchased from Peprotech (Rocky Hill, NJ). Sulfosuccinimidyl 6-(biotinamido)
Hexanoate (Sulfo-NHS-LC Biotin) was purchased from Pierce (Rockford. IL).
Antibodies and cell lines
The chimeric MAb TNT-3 (chTNT-3, IgG,,K) was produced as described
previously 39. Mouse monoclonal anti-huMCP-1 and biotinylated goat anti-muJE/
MCP-1 antibodies were purchased from Peprotech (Rocky Hill, NJ) and R&D
Systems (Minneapolis, MN), respectively. HRPO-conjugated secondary reagents
(goat-anti-human IgG (FcSp), goat-anti-mouse IgG, and streptavidin) were
purchased from CalTag (Burlingame, CA).
The NSO murine myeloma cell line was obtained from Lonza Biologies. The
RAW 267.4 murine macrophage cell line 40, RENCA murine renal cell
carcinoma^l, THP-I human acute monocytic leukemia cell line^^. and WEHI-3
murine myelomonocytic cell line^S were obtained from the American Type Culture
Collection (Manassas, VA).
1 4 2
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
Construction o f expression vector
The fusion expression gene for chTNT-3 HC/huMCP-1 was produced by
single step insertion of the huMCP-l cDNA into a NotI site in pEE12/chTNT-3 HC
expression vector 44. Primary PCR was performed with the 5’ and 3' primers
GGT AAAGCGGCCGC AGG AGGTGGT AGCC AGCC AG AT GC A AT C A ATGCC
and TCCTGCGGCCGCTTT ACCCGAGTCAC ACT AAGTCTTCGG AGTTTGGGT
TTG, respectively, to append a Notl restriction site and codons for a polypeptide
linker to the 5’ end of the huMCP-l cDNA and a stop codon and Notl site at the 3 *
end. Following Notl restriction endonuclease digestion of the PCR product and
pEE12/chTNT-3 HC expression vector, the modified huMCP-l sequence was then
inserted into pEE12/chTNT-3 HC, resulting in the expression vector pEE12/chTNT-
3 HC/huMCP-1. The fusion expression gene for muTNT-3 HC/muMCP-1 was
produced in two steps, insertion of the chemokine cDNA into the muTNT-3 HC
expression cassette in pSK+ followed by transfer of the muTNT-3 HC/muMCP-1
expression cassette into the pEE12 expression vector. Primary PCR was performed
with the 5’ and 3’ primers
GGGACTAGTGGTGGC AGCGCCCC ACTC ACCTGCTGCTAC and
ATAGTTTAGAATTCTTTACCCTGGTTTTAGTTCACTGTCACACTGGTCAC,
respectively, to append a Spel restriction site and codons for a flexible polypeptide
linker to the 5’ end of the muMCP-1 cDNA and a stop codon and an EcoRI site at
the 3’ end. The expression vector for the chTNT-3 LC, pEE6/chTNT-3 LC, was
constructed as described previously 39. The expression vector for the muTNT-3 LC.
143
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
pEE6/muTNT-3 LC, was constructed by PCR assembly. The primer pair 5’-
GCTCTAGAGCCGCCACCATGGTATCCACAGCTCAGTTC-3’ and 5*-
GACGCCGCCGTACGTTTTATTTCCAGCTTGGTCCC-3’ was used to amplify
the TNT-3 light chain variable region while the primer pair 5’-
GGATGCAGTTGGTGCAGCATC-3’ and 5 -GATGCTGCACCAACTGTATCC-3'
was used to amplify the murine kappa chain sequence. The two PCR products were
assembled by PCR amplification of the entire expression cassette using the outer
primers, digested with Xbal and EcoRI, and inserted into the pEE6 vector polylinker.
Expression and purification of chTNT-3/huMCP-1 and mTNT-3/miiMCP-I
chTNT-3/huMCP-l and muTNT-3/muMCP-l were expressed from NSO
murine myeloma cells for long term stable expression according to the
manufacturer’s protocol (Lonza Biologies). The highest producing clones were
scaled up for incubation in a 3 L stir flask bioreactor and the fusion protein purified
from the spent culture medium by sequential Protein A affinity chromatography and
ion-exchange chromatography, as described previously 45. The fusion protein was
analyzed by sodium dodecyl sulfate polyacrylamide gel electrophoresis (SDS-
PAGE) under reducing conditions and stained with Coomassie blue to demonstrate
proper assembly and purity. After transfer to nitrocellulose. Western blot analysis
was performed with mouse monoclonal anti-huMCP-l antibody or biotinylated goat
polyclonal anti-muMCP-1 antibody followed by horseradish-peroxidase (HRPO)
144
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
conjugated goat-anti-mouse IgG antibody or HRPO conjugated streptavidin to detect
the presence of the chemokine moiety on the heavy chain fusion proteins.
ELISA:
chTNT-3/huMCP-l and mTNT-3/muMCP-1 secreting clones were initially
identified by indirect ELISA analysis of supernatants using microtiter plates coated
with crude DNA preparations from calf thymus at 50 pg/mL. For production rate
assays, lxlO6 cells were incubated in 1 mL of selective medium and incubated for 24
hours, after which the supernatants were analyzed by indirect ELISA analysis using
microtiter plates coated with single-stranded DNA preparations from salmon testes at
100 pg/mL. Bound antibody was detected with either horse-radish peroxidase-
conjugated goat-anti-human IgG antibody or horse-radish peroxidase-conjugated
goat-anti-mouse IgG antibody followed by color development produced by
enzymatic cleavage of ABTS. Dilutions of chTNT-3 or muTNT-3 were used to
generate a standard curve using a 4-parameter fit by an automated ELISA reader
(Bio-Tek Instruments, Winooski, VT), from which concentrations of unknowns were
estimated and expressed as pg/mL/106 cells/24 hours.
Proper assembly of the intact fusion protein was determined by indirect
ELISA analysis of purified protein using microtiter plates coated with crude DNA at
100 pg/mL. Fused chemokine was detected on antigen-captured antibody by
probing with either mouse monoclonal anti-huMCP-1 or biotinylated goat anti-
muJE/MCP-l antibodies followed by HRPO-conjugated secondary reagents (goat-
145
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
anti-mouse IgG or streptavidin, respectively) and quantified by the degree of color
development produced by enzymatic cleavage of ABTS.
Chemotactic activity assays:
The activity of the chTNT-3/huMCP-l and mTNT-3/muMCP-i fusion
proteins were assayed by a modified Boyden chamber assay Briefly, media
controls or dilutions of chemokine, antibody, or antibody fusion protein were added
to the lower chamber of either a microchemotaxis chamber (Neuroprobe.
Gaithersberg, MD) or a Transwell plate (Corning, Cambridge, MA). Freshly
purified human PBMC or cell lines were added to the upper chamber, which was
separated from the lower chamber by an 8.0 pm polycarbonate filter (PVPF free).
Freshly purified peripheral mononuclear cells (PBMC), THP-1 46, 0r WEHI-3 cells
were added to the upper chamber. After incubation for at least 90 minutes in a 5%
C 02 humidified incubator, the cells in the upper chamber were aspirated. Cells that
had migrated to the lower well were detected by lysing the cells and measuring the
resulting LDH release with the Cytotox96 kit (Promega, Madison, WI).
146
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
RESULTS
Construction, expression, and purification o f chTNT-3/huMCP-1 and muTNT-3 /
muMCP-1
A PCR product consisting of a seven amino acid linker peptide and the
mature human MCP-1 sequence was inserted into a Not/ site previously appended
immediately downstream of the human yl terminal codon, producing a TNT-3
VH/human yl/human MCP-1 fusion gene (Figure 5-1) under the control of the
hCMV promoter. The resulting expression vector, pEE 1 2/chTNT-3 HC/huMCP-1.
encodes the fusion protein consisting of human MCP-1 coupled to carboxy-terminus
of chTNT-3 heavy chain via a non-cleavabie seven amino acid linker. This final
vector was co-transfected into the NSO murine myeloma cell line via electroporation
with the light chain expression vector, pEE6/chTNT-3 LC. for expression. The
expression vector for the murine antibody-chemokine fusion protein was constructed
in a two step process. A PCR product consisting of a five amino acid linker peptide
and the murine MCP-1 sequence was inserted between an Spel site previously
appended immediately downstream of the murine y2 ; i terminal codon and an EcoRl
site in the vector pSK7mTNT-3 HC, producing a TNT-3 VH/murine y2 ./murine
MCP-1 fusion gene (Figure 5-2). The entire expression cassette was excised from
the cloning vector via restriction endonuclease digestion with Xbal and EcoRl and
inserted into the pEE12 expression vector, where subsequent expression would be
147
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
Figure 5-1: A Schematic diagram depicting the chimeric TNT-3 heavy chain/human
MCP-1 expression vector. B Schematic diagram depicting the chimeric TNT-3 light
chain expression vector. C Schematic diagram depicting the linker containing the
Notl cloning site between the human yl and human MCP-1 cDNA in the chimeric
TNT-3 heavy chain/chemokine fusion gene.
pEE12/TNT-3 HC/hMCP-1 pEE6/ChTNT-3 LC
L V ^
JLL
Not
HumanC
Y1
l-tman MCP-1
GGT AAA G C G G C C GC A G GA G G T G G T A G C I GAG CCA
O y Lys Ala Ala « a G y G y Gly SerJ Gn Rd
linker peptide
148
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
Figure 5-2: A Schematic diagram depicting the murine TNT-3 heavy chain/murine
MCP-1 expression vector. B Schematic diagram depicting the murine TNT-3 light
chain expression vector. C Schematic diagram depicting the linker containing the
Notl cloning site between the murine 7 2a and murine MCP-1 cDNA in the murine
TNT-3 heavy chain/chemokine fusion gene
pSK+/m TNT-3 HC/mMCP-1 pEE12/m TN T-3 HC/mMCP-1
SV40E
pEE6/chTNT-3 LC
Spe
A lo
» — ■
149
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
driven by the hCMV promoter. The resulting expression vector. pEE !2/muTNT-3
HC/muMCP-1, encodes the fusion protein consisting of murine MCP-1 coupled to
carboxy-terminus of muTNT-3 heavy chain via a non-cleavable five amino acid
linker. The light chain expression vector, pEE6/muTNT-3 LC, was constructed by
PCR assembly using cDNAs prepared from the TNT-3 hybridoma. These two
vectors were co-transfected via electroporation into the NSO murine myeloma cell
line with the light chain expression vector, pEE6/mTNT-3 LC, for expression.
Antibody producing clones were selected in glutamine-free media and
screened for maximal secretion via ELISA. The highest producing clones, producing
approximately 1.5 and 23 pg/mL/106 cells/24 hours in static culture, respectively for
chTNT-3/huMCP-l and muTNT-3/muMCP-l, were scaled up in 3-L bioreactors.
The fusion proteins were purified by sequential Protein A affinity chromatography
and ion-exchange chromatography, yielding > 15 pg/mL.
Immunobiochemical analysis
The chimeric heavy chain fusion protein was intact and properly assembled
as demonstrated by reducing SDS-PAGE (Figures 5-3A and 5-4A). Two bands were
resolved for both chTNT-3/huMCP-l and muTNT-3/muMCP-l at approximately Mr
25,000 and Mr 70,000, corresponding the predicted molecular weights of the
immunoglobulin light chain and heavy chain/cytokine fusion. However. Western blot
analysis failed to detect the presence of the chemokine moiety on the heavy chain
(Figures 3B and 4B).
150
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
Figure 5-3: SDS-PAGE and Western blot analysis of recombinant antibody and
antibody-chemokine fusion protein. A Electrophoretic identification of chTNT-
3/huMCP-l fusion protein. Coomassie Blue-stained 10% polyacrylamide tris-
glycine reduced gel of purified chTNT-3 (lane 1), biotinylated chTNT-3 (lane 2),
chTNT-3/huMCP-l (lane 3), and molecular weight markers (lane 4). B Western blot
of chTNT-3/huMCP-l fusion protein. chTNT-3 (lane 1), biotinylated chTNT-3 (lane
2), chTNT-3/huMCP-l (lane 3), and biotinylated molecular weight markers (lane 4)
were transferred to nitrocellulose membrane and analyzed using biotinylated mouse-
anti-huMCP-l MAb followed by horseradish peroxidase-conjugated streptavidin.
The Western blots were developed by conversion of the substrate 4-chloro-1-
naphthol to an insoluble precipitate directly on the nitrocellulose blot.
A B
1 2 3 4 1 2 3 4
200
— — 6 6
45
31
151
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
Figure 5-4: SDS-PAGE and Western blot analysis of recombinant antibody and
antibody-chemokine fusion protein. A Electrophoretic identification of muTNT-
3/muMCP-l fusion protein. Coomassie Blue-stained 10% polyacrylamide tris-
glycine reduced gel of purified chTNT-3 (lane I), biotinylated chTNT-3 (lane 2),
muTNT-3/muMCP-l (lane 3), and molecular weight markers (lane 4). B Western
blot of mTNT-3/muMCP-l fusion protein. chTNT-3 (lane 1), biotinylated chTNT-3
(lane 2), muTNT-3/muMCP-l (lane 3), and biotinylated molecular weight markers
(lane 4) were transferred to nitrocellulose membrane and analyzed using rabbit-anti-
muMCP-1 Ab followed by horseradish peroxidase-conjugated goat-anti-rabbit IgG
and horseradish peroxidase-conjugated streptavidin. The Western blots were
developed by conversion of the substrate 4-chloro-l-naphthoI to an insoluble
precipitate directly on the nitrocellulose blot.
B
12 3 4
12 3 4
200
6 6
45
31
152
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
Immunoreactivity and proper assembly of the chTNT-3/huMCP-l and muTNT-3/
muMCP-1 fusion proteins were also studied simultaneously via indirect ELISA.
Microtiter plates coated with crude DNA at 100 pg/mL were used to capture the
fusion protein through its antibody moiety and presence of fused chemokine was
detected specifically by probing with a specific antibody and the appropriate horse
radish peroxidase-conjugated secondary (Figure 5-5). These preliminary studies
confirm that the fusion proteins retain the immunoreactivity of the parent TNT-3
antibody and the presence of the chemokine at the carboxy-terminus of the heavy
chain does not appear to affect antigen-antibody interactions.
Chemoattractive activity o f chTNT-3/huMCP-l and muTNT-3/muMCP-I
Although the chemokine moiety was demonstrated to be present on both
fusion proteins by ELISA analysis, functional assays were performed to assess
whether the molecule retained functional biological activity. Standard chemotactic
assays were performed in modified Boyden microchemotaxis chambers using 8 pm
polycarbonate filters. For the chTNT-3/huMCP-l fusion protein, the ability of the
fusion protein to chemoattract a variety of target cells including the THP-1 human
myelomonocytic cell line and freshly purified peripheral blood mononuclear cells
(PBMC) was examined. For the muTNT-3/muMCP-l fusion protein, the THP-1 cell
line, RAW267.4 murine macrophage cell line, and WEHI-3 murine myelomonocytic
cell line were used to determine test the ability of the fusion protein to induce
chemotactic migration. As shown in Figure 5-6, recombinant huMCP-l (rhuMCP-1)
153
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
Figure 5-5: ELISA analysis of recombinant antibody and antibody-chemokine fusion
proteins. Recombinant proteins were captured on crude DNA-coated microtiter
plates and then probed specifically for the presence of the chemokine moiety. Results
were expressed as percent of maximal color development. A Detection of huMCP-1
on the antigen-bound antibody. B Detection of muMCP-l on the antigen-bound
antibody.
too
« >
U
§
— A—chTNT-3
— chTNT-3/huMCP-1 60
*
40
X
I
p
to 20
0.1 10 100 1000
Antibody Concentration (|ig/mL)
100
80
muTNT-3
muTNT-3/muMCP-1
40
X
1
1000 0.1 100 1 0
Antibody Concentration (pg/mL)
154
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
Figure 6: Chemotactic migration of THP-1 cells in response to antibody-chemokine
fusion proteins. Specific migration of cells toward a chemoattractant was measured
in a modified Boyden microchemotaxis chamber. Results were expressed as percent
of maximum cell migration.
120
100
rhuMCP-l
chTNT-3/huMCP-1
S S
1
•»
IX
0.0)01 0.001 0.01 100
-20
Relative Concentration (molar)
155
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
was able to cause the migration of THP-1 cells. In contrast, chTNT-3/huMCP-l
was unable to induce the migration, even at more than two logs greater molar
concentration. Similar results were observed with recombinant muMCP-1 and the
muTNT-3/muMCP-l fusion protein (data not shown).
DISCUSSION
Chemokines have been used in the experimental treatment of cancer with
limited success. As commonly seen in most adoptive immunotherapy approaches,
the anti-tumor potential of the chemokine is mitigated by the lack of targeting to the
tumor microenvironment when administered systemically. Animal models involving
gene modified tumor cells have demonstrated the importance of co-localization of
the chemokine and malignant cells for proper initiation of the anti-tumor response
29, 30,47
In this study, two recombinant fusion proteins were generated as an
alternative method of directing intratumoral leukocyte chemoattraction for the
immunotherapy of neoplasia. The first fusion protein consisted of the chimeric
TNT-3 monoclonal antibody and human MCP-1, chTNT-3/huMCP-l. while the
second fusion protein consisted of the murine TNT-3 monoclonal antibody and
murine MCP-1, muTNT-3/muMCP-l. The GS gene amplification system was used
for high level of expression of the fusion protein from murine myeloma cells.
Biochemical analysis of the fusion proteins indicate the presence of two chemokine
156
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
moieties per antibody molecule, as evidenced by the increase in the molecular weight
of the heavy chain (Figures 5-3A and 5-4A). The ability of both fusion proteins to
bind antigen was retained, as demonstrated by ability to bind successfully to crude
and single-stranded DNA-coated plates in indirect ELISA analysis. However,
indirect ELISA and Western blot analysis failed to detect the presence of the
chemolcine moiety on the heavy chain (Figures 5-3B and 5-4B). Although the
inability to detect the huMCP-l moiety could be explained by the use of a
monoclonal antibody for detection, previous studies have reported the similar
inability of rabbit anti-MCP-1 serum to detect of amino terminal deletion and amino
terminal point mutations by western blot analysis 48. The presence of the
chemokines on the fusion molecules was, however, detected specifically by indirect
ELISA analysis (Figure 5-5).
The chemolcine moieties, appended to the carboxy-terminus of the heavy
chain constant region via a short, non-degradable linker peptide, were, however,
unable to direct chemotactic migration, as evidenced by chemotactic assays (Figure
5-6). These results support the conclusion that while the antibody moiety remains
able to bind antigen, the chemokine moiety, in its current position, does not retain the
ability to direct chemotactic migration. Because the ultimate goal of this study was to
generate fusion proteins to specifically direct chemotactic migration for targeted
immunotherapy, we did not examine whether the antibody-chemokine fusion
proteins retained other properties of MCP-1, namely, the abilities to bind the
chemokine receptors, induce Ca2 + flux or stimulate the respiratory burst in monocytes
157
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
12. While these activities are still important for immunologic activity, unless the
leukocytes are specifically targeted to the tumor microenvironment, activation of
these functions may be counterproductive, as chemokines have been linked to
inflammatory disease pathogenesis 49.
The particular arrangement of the antibody-chemokine fusion (i.e., with the
chemokine moiety appended to the carboxy-terminus of the heavy chain constant
region via a short flexible peptide linker) was designed expressly to minimize
potential effects of the chemokine on the antigen binding and has been successful in
the generation of several bifunctional antibody-cytokine fusion proteins 35. 44
While the vast majority of published antibody-cytokine fusion proteins have been
constructed successfully in a similar fashion (i.e., biologic response modifier at the
carboxy-terminus of the antibody heavy chain), this approach does not seem to be
suitable for fusion proteins involving the chemokine family. Indeed, the two
published reports of antibody-chemokine fusion proteins 50, 5 1 have engineered
these recombinant molecules with the chemokine fused to the amino terminus of the
antibody heavy chain or single chain (scFv). Recent reports have begun to elucidate
the biochemical basis for the loss of chemotactic activity of antibody-chemokine
fusion protein.
Early studies indicated the particular importance of the amino terminus of
MCP-1 and other chemokines in signaling, as deletion of amino acids 1-8 or 2-8 of
MCP-1 eliminated chemotactic activation and calcium influx indu ion 48. 52
158
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
However, a synthetic peptide composed of the first ten amino acids of the mature
protein lacked intrinsic chemotactic activity and was unable to inhibit the activity of
wild type MCP-1 48. Point mutation of amino terminal residues does not
significantly alter the activity of the mutated protein, as multiple groups have
demonstrated that these mutants are still able to activate both Ca2 + and chemotaxis
52-54 Furthermore, retention of the secondary structure seen in the wild type amino
terminus is not an absolute requirement, as disruption of the a-helix via introduction
of a proline residue in place of isoleucine5 yielded a functional protein with only a
modest decrease in signal transduction and migration commensurate with its altered
receptor binding ability. Binding studies performed with the amino terminally
truncated MCP-1 analogues have yielded variable results, with one group
demonstrated mildly reduced binding to CCR1- and CCR2-bearing cell lines 54. anci
another group demonstrating increased binding 52. Nevertheless, functional studies
demonstrate a significant reduction in the ability of these substitution variants to
stimulate calcium flux and chemotactic migration.
Studies involving extension of the MCP-1 amino terminus yielded even more
extreme results. The addition of a single amino acid residue or even an acetyl group
dramatically reduces the affinity of the chemolcine to CCR2 expressed on THP-1
cells (approximately 100-fold reduction in binding) and a corresponding reduction in
chemotaxis induction (approximately 300-fold loss in potency) 52, 54, 55 T h u s ,
while mutation of MCP-1 residues may affect its ability to bind CCR2 and induce
159
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
downstream events, it is the length of its amino terminus that is of prime importance
of this chemokine and the most likely explanation for the absence of chemotactic
activity in the antibody-chemokine fusion protein. Still, the exact biochemical basis
of this alteration remains highly controversial.
Based on the initial studies involving amino terminal truncation and
computer modeling of the three-dimensional structure of the MCP-1. Zhang and
Rollins hypothesized that the effect of the genetic modification was a structural
modification that either rendered the protein unable to bind to cellular receptors or
prevented dimerization of otherwise inactive monomeric subunits. Indeed, in later
studies 56, these investigators determined that 1) MCP-1 formed dimers at
physiologically relevant concentrations, 2) chemically cross-linked MCP-1 dimers
attracted mononuclear cells with the identical activity as non-cross-linked MCP-1, 3)
an N-terminal deletion variant of MCP-1 ([l+9-76]MCP-l) forms heterodimers with
wild-type MCP-l, and 4) [l+9-76]MCP-l inhibits MCP-I but not chemically cross
linked MCP-1-mediated monocyte chemotaxis. From these studies, they concluded
that the truncation mutant functioned as a dominant negative inhibitor. These results
were supported by the results of Reckless and Grainger 46^ which showed that a
peptide derivative of the amino terminus (amino acids 1-13 of the mature protein)
inhibited MCP-l-induced chemotaxis when co-incubated with the chemoattractant,
but not with the target cells. By contrast, they also reported that a peptide derived
from the carboxy-terminal region (amino acids 51-62) inhibited chemotaxis only
when incubated with the target cells and not the chemoattractant. Their results
160
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
would suggest that the amino terminus directs the dimerization of MCP-1, which is
necessary for signaling, and this association can be inhibited by the amino terminal
peptide derivative. In contrast, the carboxy-terminus of MCP-1 is more important
for signaling, and the carboxy-terminal peptide derivative inhibits chemotaxis by
interacting directly with cellular receptors and thus antagonizing the interaction of
MCP-1 with CCR2.
Recently, however, Paavola et al 57 presented a study in direct contradiction
to this hypothesis. In their work, they demonstrated that amino acid substitution
mutants that do not dimerize, even at extremely high concentrations (100 pM). are
nevertheless fully functional in both binding and chemotaxis activity assays.
Furthermore, binding studies pointed to a competitive inhibition mechanism for the
antagonistic effect of the deletion mutant [l+9-76]MCP-l on the binding of wild-
type MCP-1 to CCR2. Their collective data thus argue against dimerization of
MCP-1 facilitating binding to CCR2 and subsequent signal transduction. Instead,
they offer two possible roles for dimerization: I) regulation of chemokine action at
high concentration, which could account for the inhibitory phase of chemotaxis
assays seen in the characteristic bell-shaped chemotaxis versus concentration graphs,
or 2 ) retention and presentation of chemokines by surface glycosaminoglycans in
order to facilitate formation of the surface concentration gradients required for
haptotaxis. In any case, these studies and the additional reports of the isolation of
naturally truncated forms of MCP-1 and other chemokines from PBMC-derived
161
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
conditioned medium give further support for a physiologic role of post-translational
modification in the regulation of chemokine activity 58, 59
The question of whether dimerization is necessary for chemotactic activity is
not a trivial issue. We are currently reconstructing the fusion protein in the reverse
orientation (i.e., with the chemokine moiety fused to the amino terminus of the
antibody heavy chain) such that the amino terminal portion of the chemokine will be
freely able to bind and trigger chemotaxis. Although each fully formed fusion
protein will have two chemokine molecules per antibody, these two chemokine
molecules may not be in close enough proximity to dimerize intramolecularly. and
the presence of the antibody moiety may not allow intermolecular dimerization. An
additional consideration is whether or not MCP-1 will retain activity when appended
to the antibody heavy chain amino terminus. While extension of MCP-1 at the
carboxy terminus has not been shown to be detrimental to chemotactic activity ^ 8
and the results obtained by Challita-Eid et al 50 and Biragyn et al 51 indicate that
active and fully functional chemokines can be expressed successfully as an antibody-
chemokine fusion protein for at least RANTES, IP-10. and MCP-3, it is important to
consider that not all chemokines are equally responsive or sensitive to mutation and
modulation. In fact, while amino terminal extension or chemical modification
virtually eliminated binding of MCP-1 to its receptor 52, 54, 55 similar modification
of RANTES produced a receptor antagonist that retained high affinity binding but
162
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
loss of chemotactic activity 60* 61. Furthermore, modification of chemokines can
even result in proteins with increased potency 62.
Nevertheless, should the reconstructed antibody-chemokine fusion protein
retain the functional activities of both moieties, this product would serve to enhance
further antibody-directed antitumor therapies. Combination therapy involving
chemokine and cytokine gene therapy have already demonstrated synergistic potency
in generating antitumor responses and rejection 63, 64 through the recruitment of NK
and CD4+ and CD8+ T cells. Similarly, the combination of an antibody-chemokine
fusion protein with one or more corresponding antibody-cytokine fusion proteins
should improve the overall therapeutic response.
REFERENCES
1 . Rollins BJ. Chemokines. Blood 1997; 90:909-928.
2. Clark-Lewis I, Schumacher S, Baggiolini M, Moser B. Structure-activity
relationships of interleukin-8 determined using chemically synthesized
analogs: Critical role of NH2 -terminal residues and evidence for uncoupling
of neutrophil chemotaxis, exocytosis, and receptor binding activities. Journal
of Biological Chemistry 1991; 266:23128.
3. Strieter RM, Polverini PJ, Arenberg DA, et al. Role of C-X-C chemokines as
regulators of angiogenesis in lung cancer. Journal of Leukocyte Biology
1995; 57:752-762.
4. Taub DD, Sayers TJ, Carter CRD, Ortaldo JR. a and P Chemokines Induce
NK Cell Migration and Enhance NK-Mediated Cytolysis. The Journal of
Immunology 1995; 155:3877-3888.
163
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
5. Taub DD, Longo DL, Murphy WJ. Human interferon-inducible protein-10
induces mononuclear cell infiltration in mice and promotes the migration of
human T lymphocytes into the peripheral tissues and human peripheral blood
lymphocytes in SCID mice. Blood 1996; 87:1423.
6 . Allavena F, Bianchi G, Zhou D, et al. Induction of natural killer cell
migration by monocyte chemotactic protein-1 , -2, and -3. European Journal
of Immunology 1994; 24:3233-3236.
7. Arenberg DA, Kunkel SL, Polverini PJ, et al. Interferon-y-inducible Protein
10 (IP-10) Is an Angiostatic Factor That Inhibits Human Non-small Cell
Lung Cancer (NSCLC) Tumorigenesis and Spontaneous Metastasis. Journal
of Experimental Medicine 1996; 184:981-992.
8 . Sgadari C, Angiolillo AL, Chemey BW, et al. Interferon-inducible protein-10
identified as a mediator of tumor necrosis in vivo. Proceedings of the
National Academy of Sciences, USA 1996; 93:13791-13796.
9. Uguccioni M, D'Apuzzo M, Loetscher M, Dewald B, Baggiolini M. Actions
of the chemotactic cytokines MCP-1, MCP-2, MCP-3, RANTES, M IP-la
and MIP-ip on human monocytes. European Journal of Immunology 1995;
25:64-68.
10. Yamashiro S, Takeya M, Nishi T, et al. Tumor-Derived Monocyte
Chemoattractant Protein-1 Induces Intratumoral Infiltration of Monocyte-
Derived Macrophage Subpopulation in Transplanted Rat Tumors. American
Journal of Pathology 1994; 145:856-867.
11. Xu LL, Warren MK, Rose WL, Gong W, Wang JM. Human recombinant
monocyte chemotactic protein and other C-C chemokines bind and induce
directional migration of dendritic cells in vitro. Journal of Leukocyte Biologv
1996;60:365-371.
12. Rollins BJ, Walz A, Baggiolini M. Recombinant Human MCP- 1/JE Induces
Chemotaxis, Calcium Flux, and the Respiratory Burst in Human Monocytes.
Blood 1991;78:1112-1116.
13. Loetscher P, Seitz M, Clark-Lewis I, Baggiolini M, Moser B. Activation of
NK Cells by CC Chemokines: Chemotaxis, Ca-+ Mobilization, and Enzyme
Release. The Journal of Immunology 1996; 156:322-327.
14. Taub DD, Ortaldo JR, Turcovski-Corrales SM, Key ML, Longo DL. Murphy
WJ. p-Chemokines costimulate lymphocyte cytolosis, proliferation, and
lymphokine production. Journal of Leukocyte Biology 1996; 59:81-89.
164
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
15. Maghazachi AA, Al-Aoukaty A, Schall TJ. C-C Chemokines Induce the
Chemotaxis of NK and IL-2-Activated NK Cells. The Journal of
Immunology 1994; 153:4969-4977.
16. Taub DD, Proost P, Murphy WJ, Anver M, Longo DL, Van Damme J.
Monocyte Chemotactic Protein-1 (MCP-1), -2, and -3 Are Chemotactic for
Human T Lymphocytes. Journal of Clinical Investigation 1995: 95:1370-
1376.
17. Schall TJ. The Chemokines. In: Thomson A, ed. The Cytokine Handbook.
Vol. 1. San Diego: Academic Press, Inc., 1994:419-460.
18. Hirose K, Hakozaki M, Nyunoya Y, et al. Chemokine gene transfection into
tumour cells reduced tumorigenicity in nude mice in association with
neutrophilic infiltration. British Journal of Cancer 1995; 72:708-714.
19. Kelner GS, Kennedy J, Bacon KB, et al. Lymphotactin: A Cytokine That
Represents a New Class of Chemokine. Science 1994; 266:1395-1399.
20. Kennedy J, Kelner GS, Kleyensteuber S, et al. Molecular Cloning and
Functional Characterization of Human Lymphotactin. The Journal of
Immunology 1995; 155:203-209.
21. Giancarlo B, Silvano S, Zlotnik A, Alberto M, Paola A. Migratory reponse of
human natural killer cells to lymphotactin. European Journal of Immunology
1996; 26:3238-3241.
22. Bazan JF, Bacon KB, Hardiman G, et al. A new class of membrane-bound
chemokine with a CX3C motif. Nature 1997; 385:640-644.
23. Coumoyer D. Gene Therapy of the Immune System. Annual Review of
Immunology 1993; 11:297-329.
24. Zhang L, Khayat A, Cheng H, Graves DT. The Pattern of Monocyte
Recruitment in Tumors is Modulated by MCP-1 Expression and Influences
the Rate of Tumor Growth. Laboratory Investigation 1997; 76:579-590.
25. Rosenberg SA, Lotze MT, Muul LM, et al. A progress report on the treatment
of 157 patients with advanced cancer using lymphokine activated killer cells
and interleukin-2 or high dose interleukin-2 alone. New England Journal of
Medicine 1987;316:889-905.
26. Hechtman DD, Cybulsky MI, Fuchs HJ, Baker JB, Gimbrone MA.
Intravascular IL-8 : Inhibitor of polymorphonuclear leukocyte accumulation
at sites of acute inflammation. The Journal of Immunology 1991: 147:883.
165
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
27. Ley K, Baker JB, Cybulsky MI, Gimbrone MA, Luscinskas FW. Intravenous
interleukin-8 inhibits granulocyte emigration from rabbit mesenteric vessels
without altering L-selectin expression or leukocyte rolling. The Journal of
Immunology 1993; 151:6347.
28. Rutledge BJ, Rayburn H, Rosenberg R, et al. High level monocyte
chemoattractant protein-1 expression in transgeneic mice increases their
susceptibility to intracellular pathogens. The Journal of Immunology 1995;
155:4838.
29. Manome Y, Wen PY, Hershowitz A, et al. Monocyte chemoattractant
protein-1 (MCP-1) gene transduction: an effective tumor vaccine strategy for
non-intracranial tumors. Cancer Immunology and Immunotherapy 1995:
41:227-235.
30. Huang S, Singh RK, Xie K, et al. Expression of the JE/MCP-1 gene
suppresses metastatic potential in murine colon carcinoma cells. Cancer
Immunology and Immunotherapy 1994; 39:231-238.
3 1. Nakashima E, Oya A, Kubota Y, et al. A Candidate for Cancer Gene
Therapy: M IP-la Gene Transfer to an Adenocarcinoma Cell Line Reduced
Tumorigenicity and Induced Protective Immunity in Immunocompetent
Mice. Parmaceutical Research 1996; 13:1896-1901.
32. Mule JJ, Custer M, Averbook B, et al. RANTES Secretion by Gene-Modified
Tumor Cells Results in Loss of Tumorigenicity In Vivo: Role of Immune
Cell Subpopulations. Human Gene Therapy 1996; 7:1545-1553.
33. Qin L, Ding Y, Pahud DR, Chang E, Imperiale MJ, Bromberg JS. Promoter
attenuation in gene therapy: interferon-y and tumor necrosis factor-a inhibit
transgene expression. Human Gene Therapy 1997; 8:2019-2029.
34. Ghazizadeh S, Carroll JM, Taichman LB. Repression of retrovirus-mediated
transgene expression by interferons: implications for gene therapy. Journal
of Virology 1997; 71:9163-9169.
35. Hornick JL, Khawli LA, Hu P, Lynch M, Anderson PM, Epstein AL.
Chimeric CLL-1 Antibody Fusion Proteins Containing Granulocyte
Macrophage Colony-Stimulating Factor or Interleukin-2 With Specificity for
B-Cell Malignancies Exhibit Enhanced Effector Functions While Retaining
Tumor Targeting Properties. Blood 1997; 89:4437-4447.
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
36. Lode HN, Xiang R, Varki NM, Dolman CS, Gillies SD, Reisfeld RA.
Targeted Interleukin-2 Therapy for Spontaneous Neuroblastoma Metastases
to Bone Marrow. Journal of the National Cancer Institute 1997; 89:1586-
1594.
37. Holzer W, etersen F, Strittmatter W, Matzku S, von Hoegen I. A Fusion
Protein of IL-8 and a Fab Antibody Fragment Binds to IL-8 Receptors and
Induces Neutrophil Activation. Cytokine 1996; 8:214-221.
38. Epstein AL, Chen F-M, Taylor CR. A Novel Method for the Detection of
Necrotic Lesions in Human Cancers. Cancer Research 1988:48:5842-5848.
39. Homick JL, Sharifi J, Khawli LA, et al. A new chemically modified chimeric
TNT-3 monoclonal antibody directed against DNA for the
radioimmunotherapy of solid tumors. Cancer Biotherapy &
Radiopharmaceuticals 1998; 13:255-268.
40. Ralph P, Nakoinz I. Antibody-dependent killing of erythrocyte and tumor
targets by macrophage-related cell lines: enhancement by PPD and LPS. J
Immunol 1977; 119:950-954.
41. Murphy GP, Hrushesky WJ. A murine renal cell carcinoma. Journal of the
National Cancer Institute 1973; 50:1013-1025.
42. Tsuchiya S, Yamabe M, Yamaguchi Y, Kobayashi Y. Konno T. Tada K.
Establishment and characterization of a human acute monocytic leukemia cell
line (THP-1). Int J Cancer 1980; 26:171-6.
43. Ralph P, Moore M, Nilsson K. Lysozyme synthesis by established human
and murine histiocytic lymphoma cell lines. J Exp Med 1976: 143:1528-
1533.
44. Homick JL, Khawli LA, Hu P, Sharifi J, Khanna C, Epstein AL. Pretreatment
with a Monoclonal Antibody/Interleukin-2 Fusion Protein Directed against
DNA Enhances the Delivery of Therapeutic Molecules to Solid Tumors.
Clinical Cancer Research 1999; 5:51-60.
45. Hu P, Homick JL, Glasky MS, et al. A chimeric Lym- 1/interleukin 2 fusion
protein for increasing tumor vascular permeability and enhancing antibody
uptake. Cancer Research 1996; 56:4998-5004.
46. Reckless J, Grainger DJ. Identification of oligopeptide sequences which
inhibit migration induced by a wide range of chemokines. Biochem J 1999;
340:803-811.
167
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
47. Huang S, Xie K, Singh RK, Gutman M, Bar-Eli M. Suppresion of Tumor
Growth and Metastasis of Murine Renal Adenocarcinoma by Syngeneic
Fibroblasts Genetically Engineered to Secrete the JE/MCP-1 Cytokine.
Journal of Interferon and Cytokine Research 1995; 15:655-665.
48. Zhang YJ, Rutledge BJ, Rollins BJ. Structure/Activity Analysis of Human
Monocyte Chemoattractant Protein-1 (MCP-1) by Mutagenesis. The Journal
of Biological Chemistry 1994; 269:15918-15924.
49. Furie MB, Randolph GJ. Chemokines and tissue injury. Am. J. Pathol. 1995;
146:1287-1301.
50. Challita-Eid PM, Abboud CN, Morrison SL, et al. A RANTES-Antibody
Fusion Protein Retains Antigen Specificity and Chemokine Function. Journal
of Immunology 1998; 161:3729-3736.
51. Biragyn A, Tani K, Grimm MC, Weeks S, Kwak LW. Genetic fusion of
chemokines to a self tumor antigen induces protective. T-cell dependent
antitumor immunity. Nature Biotechnology 1999; 17:253-258.
52. Gong J, Clark-Lewis I. Antagonists of moncyte chemoattractant protein 1
identified by modification of functionally critical NH2-terminal residues. J
Expmed 1995; 181:631-40.
53. Beall CJ, Mahajan S, Kuhn DE, Kolattukudy PE. Site-directed mutagenesis
of monocyte chemoattractant protein- 1 identifies two regions of the
polypeptide essential for biologic activity. Biochem. J. 1999: 313:633-640.
54. Jarnagin K, Grunberger D, Mulkins M, et al. Identification of Surface
Residues of the Monocyte Chemotactic Protein 1 That Affect Signaling
through the Receptor CCR2. Biochemistry 1999; 38:16167-1 6177.
55. Hemmerich S, Paavola C, Bloom A, et al. Identification of Residues in the
Monocyte Chemotactic Protein-1 That Contact the MCP-1 Receptor, CCR2.
Biochemistry 1999; 38:13013-13025.
56. Zhang Y, Rollins BJ. A Dominant Negative Inhibitor Indicates that
Monocyte Chemoattractant Protein 1 Functions as a Dimer. Molecular and
Cellular Biology 1995; 15:4851-4855.
57. Paavola CD, Hemmerich S, Grunberger D, et al. Monomeric Monocyte
Chemoattractant Protein-1 (MCP-1) Binds and Activates the MCP-1
Receptor CCR2B. Journal of Biological Chemistry 1998; 273:33157-33165.
168
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
58. Proost P, Struyf S, Couvreur M, et al. Posttranslational Modifications Affect
the Activity of the Human Monocyte Chemotactic Proteins MCP-1 and
MCP-2: Identification of MCP-2(6-76) as a Natural Chemokine Inhibitor.
Journal of Immunology 1998; 160:4034-4041.
59. Oravecz T, Pall M, Roderiquez G, et al. Regulation of the Rceptor Specificity
and Function of the Chemokine RANTES (Regulated on Activation, Normal
T Cell Expressed and Secreted) by Dipeptidyl Peptidase IV (CD26)-mediated
Cleavage. Journal of Experimental Medicine 1997; 186:1865-1782.
60. Simmons G, Clapham P, Picard L, et al. Potent inhibition of HIV- 1
infectivity in macrophages and lymphocytes by a novel CCR5 antagonist.
Science 1997; 276:276-9.
61. Proudfoot A, Power C, Hoogewerf A, et al. Extension of recombinant human
RANTES by the retention of the initiating methionine produces a potent
antagonist. J Biol Chem 1996; 271:2599-603.
62. Wuyts A, D'Haese A, Cremers V, et al. NH2- and COOH-Terminal
Truncations of Murine Granulocyte Chemotactic Protein-2 Augment the In
Vitro and In Vivo Neutrophil Chemotactic Potency. J Immunol 1999;
163:6155-6163.
63. Dilloo D, Bacon K, Holden W, et al. Combined chemokine and cytokine
gene transfer enhances antitumor immunity. Nature Medicine 1996: 2:1090-
1095.
64. Narvaiza I, Mazzolini G, Barajas M, et al. Intratumoral Coinjection of Two
Adenoviruses, One Encoding the Chemokine IFN-g-Inducible Protein-10 and
Another Encoding IL-12, Results in Marked Antitumoral Synergy. J
Immunol 2000; 164:3112-3122.
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
Chapter 6. Summary and Future Directions
The field of antibody-based therapy is starting to come of age, with the recent
FDA approval of Rituxan and Herceptin, the first two genetically engineered
antibodies for the treatment of human disease. However, despite the significant
progress made in understanding both the mechanisms of immunologic function as
well as tumor pathogenesis, the “magic bullet” cure for cancer remains elusive. In
particular, there remains significant difficulty in regards to selection of appropriate
antibodies for optimal sensitivity and specificity. Furthermore, the majority of
antibodies reported thus for do not have significant antitumor activity when
administered as naked molecules. However, because of their effective ability to
localize to tumor foci, these molecules can be utilized as delivery vehicles to reduce
the toxicity of therapeutic reagents. In the preceeding chapters, optimization of
current therapy as well as new approaches for tumor therapy are presented.
A new mouse-human chimeric antibody, chTNT-2, has been generated for
use in the Tumor Necrosis Treatment of solid tumors. This antibody, although of the
same size and charge as two previously characterized chimeric TNT antibodies,
displayed significantly different behavior in vivo. Thus, while the TNT antibodies
all localize successfully to tumor necrosis, there are important differences in
behavior that need to be addressed in order to select the optimal antibody for
particular indications. Continuing work will focus on addressing some of these
parameters, such as interaction with serum and tissue proteins, as well as
170
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
characterizing relative amounts of accessible antigen within different types and sizes
of tumors.
The main limitation of tumor immunotherapy has been the difficulty in
generating sufficient immunologic responses without toxicity. To circumvent this
problem, we have developed an antibody-cytokine fusion protein approach for
selective localization of these therapeutic moieties within tumors. A fusion protein
consisting of the tumor targeting antibody chTNT-3 and murine interferon-'/,
chTNT-3/muIFN-Y was generated to determine the potential efficacy of selective
intratumoral delivery of IFN-y for the treatment of human solid tumors. This
molecule demonstrated significant ability to reduce the number of metastatic foci in
a syngeneic pulmonary metastatsis model of renal carcinoma with no observed
toxicity. In view of these promising results, an analogous human fusion protein,
chTNT-3/huIFN-Y, has been generated and is in preclinical investigation for use in
the treatment of human disease.
While no toxic reactions were observed with the chTNT-3/muIFN-Y fusion
protein, other molecules, such as antibody-IL-2 fusion proteins, have been observed
to retain significant toxicity. To reduce further the incidence of deleterious effects,
we have generated a panel of fusion proteins consisting of the chTNT-3 antibody and
single amino acid substitution analogs of IL-2. Along with preliminary
characterization of their immunologic function, the tendency of these new proteins to
induce local vasopermeability was examined in an assay that takes advantage of the
ability of the antibody moiety to localize within a specific region in vivo. However,
171
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
in our striving to generate molecules with reduced toxicity, we have opened the door
to new questions and new avenues of exploration. Instead of resolving the endlessly
debated questions regarding IL-2 physiology and pathology, we have added a new
quirk to the already complicated puzzle. There was no consistently observed
relationship between vasopermeability induction and either IL-2 receptor binding,
stimulation of lymphocyte proliferation, generation of LAK cell activity, or
secondary cytokine release, which is in direct contradiction to published theories of
the mechanism of IL-2 toxicity. We are currently generating additional antibody-
IL-2 analog fusion proteins in order to clarify the actual mechanism.
Finally, in order to stimulate intratumoral leukocyte recruitment to augment
antibody-cytokine immunotherapy, antibody-chemokine fusion proteins were
generated. However, these constructs were non-functional in assays of
chemoattraction, likely owing to the sensitivity of MCP-1 to amino terminal
modification. Nevertheless, these studies provide insight to the limitations of the
antibody fusion protein approach to targeted immunotherapy. Currently, these
fusion proteins are being reconstructed in the reverse orientation such that the
MCP-1 is joined to the antibody heavy chain via the carboxy terminus and the amino
terminus of MCP-1 is exposed freely. Furthermore, because this amino terminal
sensitivity to modification appears to be specific to individual chemokines, fusion
proteins are being constructed with other members of the chemokine family.
The experiments presented in this dissertation provide further support for the
potential of recombinant antibody targeted therapy of human malignancies, as well
172
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
as new perspectives for the understanding of human immunology. Continuing
investigation is needed to further elaborate upon the evidence presented herein to
take full advantage of the potential of the human immune system's innate ability to
fight disease.
173
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
BIBLIOGRAPHY
Abuchowski, A., McCoy, J., Palczuk, T., & Davis, E. (1977). Effect of covalent
atachment of polyethylene glycol on immunogenicity and circulating life of bovine
liver catalase. J Biol Chem, 252,3582-3586.
Adams, G. P. (1998). Improving the Tumor Specificity and Retention of Antibody-
Based Molecules, in vivo, 12, 11-22.
Allavena, P., Bianchi, G., Zhou, D., van Damme, J., Jilek, P., Sozzani, S., &
Mantovani, A. (1994). Induction of natural killer cell migration by monocyte
chemotactic protein-1, -2, and -3. European Journal o f Immunology, 24, 3233-3236.
Arenberg, D. A., Kunkel, S. L., Polverini, P. J., Morris, S. B., Burdick, M. D., Glass,
M. C., Taub, D. D., Iannettoni, M. D., Whyte, R. I., & Strieter, R. M. (1996).
Interferon-y-inducible Protein 10 (IP-10) Is an Angiostatic Factor That Inhibits
Human Non-small Cell Lung Cancer (NSCLC) Tumorigenesis and Spontaneous
Metastasis. Journal o f Experimental Medicine, 184,981-992.
Atkins, M. B., Lotze, M. T., Dutcher, J. P., Fisher, R. I., Weiss, G., Margolin, K.,
Abrams, J., Sznol, M., Parkinson, D., Hawkins, M., Paradise, C., Kunkel, L., &
Rosenberg, S. A. (1999). High-dose recombinant interleukin 2 therapy for patients
with metastatic melanoma: analysis of 270 patients treated between 1985 and 1993.
J Clin Oncol, 17, 2 105-2116.
Bazan, J. F., Bacon, K. B„ Hardiman, G., Wang, W„ Soo, K., Rossi. D., Greaves, D.
R., Zlotnik, A., & Schall, T. J. (1997). A new class of membrane-bound chemokine
with a CX3C motif. Nature, 385,640-644.
Beall, C. J., Mahajan, S., Kuhn, D. E., & Kolattukudy, P. E. (1999). Site-directed
mutagenesis of monocyte chemoattractant protein- 1 identifies two regions of the
polypeptide essential for biologic activity. Biochem. J., 313, 633-640.
Bebbington. C. R., Renner, G., Thomson, S., King, D., Abrams, D., & Yarranton, G.
T. (1992). High-level expression of a recombinant antibody from myeloma cells
using a glutamine synthetase gene as an amplifiable selectable marker.
Bio/Technology, 70(169-175).
Bellanti, J. A. (1971). Immunology. Philadelphia: W.B. Saunders Company.
Biragyn, A., Tani, K., Grimm, M. C., Weeks, S., & Kwak, L. W. (1999). Genetic
fusion of chemokines to a self tumor antigen induces protective, T-cell dependent
antitumor immunity. Nature Biotechnology, 17(3), 253-258.
174
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
Blumenthal, R. D., Sharkey, R. M., Kashi, R., Natale, A. M., & Goidenberg, D. M.
(1992). Physiological factors influencing radioantibody uptake: a study of four
human colonic carcinomas. Int. J. Cancer, 51,935-941.
Boulianne, G. L., Hozumi, N., & Shulman, M. J. (1984). Production of functional
chimaeric mouse/human antibody. Nature, 312, 643-646.
Boyer, C. M., Lidor, Y., Lottich, C., & ast, R. C. (1988). Antigenic cell surface
markers in human solid tumors. Antibody Immunoconj Radiophami, /. 105- 111.
Brenner, T., & Adams, V. (1999). First MAb approved for treatment of metastatic
breast cancer. J Am Pharm Assoc (Wash), 39(2), 236-238.
Brunda, M. J., Luistro, L„ Hendrzak, J. A., Fountoulakis, M., Garotta, G., & Gately.
M. K. (1995). Role of interferon-g in mediating the antitumor efficacy of interleukin-
12. Journal o f Immunother Emphasis Tumor Immunol, 17(2), 71-77.
Challita-Eid, P. M., Abboud, C. N., Morrison, S. L., Penichet, M. L.. Rosell, K. E..
Poles, T„ Hilchey, S. P., Planelles, V., & Rosenblatt, J. D. (1998). A RANTES-
Antibody Fusion Protein Retains Antigen Specificity and Chemokine Function.
Journal o f Immunology, 161, 3729-3736.
Chapman, A. P., Antoniw, P., Spitali, M., West, S., Stephens, S., & King, D. J.
(1999). Therapeutic antibody fragments with prolonged in vivo half-lives. Nature
Biotechnology, 17, 780-783.
Ciardelli, T. L., Landraf, B., Gadski, R., Stranad, J., Cohen, F. E., & Smith. K. S.
(1988). A design approach to the structural analysis of interleukin-2. J Molecular
Recognition, 1, 42-47.
Clackson, T., Hoogenboom, H., Griffiths, A., & Winter, G. (1991). Making antibody
fragments using phage display libraries. Nature, 552(6336), 624-628.
Clark-Lewis, I., Schumacher, S., Baggiolini, M., & Moser, B. (1991). Structure-
activity relationships of interleukin-8 determined using chemically synthesized
analogs: Critical role of NH2-terminal residues and evidence for uncoupling of
neutrophil chemotaxis, exocytosis, and receptor binding activities. Journal of
Biological Chemistry, 266, 23128.
Cobb, L. M. (1988). Intratumor factors influencing the access of antibody to tumor
cells. Cancer Immunol. Immunother., 28, 235.
Colcher, D., Goel, A., Pavlinkova, G., Beresford, G., Booth, B., & Batra. S. (1999).
Effects of genetic engineering on the pharmacokinetics of antibodies. Q J Nad Med,
43(2), 132-139.
175
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
Colcher, D., Minelli, M. F., Roselli, M., Muraro, R., Simpson-Milenic, D., &
Schiom, J. (1988). Radioimmunolocalization of human carcinoma xenografts with
B72.3 second generation monoclonal antibodies. Cancer Research, 48,4597-4603.
Coley, W. B. (1893). The treatment of malignant tumors by repeated inoculations of
erysipelas: with a report of ten original cases. Am J Med Sci, 105,487-511.
Coley, W. B. (1906). Late results of the treatment of inoperable sarcoma by the
mixed toxins of erysipelas and bacillus prodigiosus. Am J Med Sci, 131, 375-430.
Collins, L., Tsien, W., Seals, C., Hakimi, J., Weber, D., Bailon, P., Hoskings, J.,
Greene, W., Toome, V., & Ju, G. (1988). Identification of specific residues of human
interleukin 2 that affect binding to the 70-kDa subunit (p70) of the interleukin 2
receptor. Proc Natl Acad Sci USA, 85(20), 7709-7713.
Cotran, R. S., Pober, J. S., Gimbrone, M. A., Springer, T. A., Wiebke. E. A.. &
Gaspari, A. A. (1988). Endothelial activation during interleukin 2 immunotherapy:
A possible mechanism for the vascular leak syndrome. J. Immunol., 140, 1883.
Coumoyer, D. (1993). Gene Therapy of the Immune System. Annual Review o f
Immunology, 77,297-329.
De Maeyer, E., & De Maeyer-Guignard, J. (1994). Interferons. In A. Thomson (Ed.),
The Cytokine Handbook (Second Edition ed.. Vol. 1, pp. 265-288). San Diego:
Academic Press, Inc.
Dianzani, F., Salter, L., Fleischmann, W. R„ Jr., & Zucca, M. (1978). Immune
interferon activate cell smore slowly than does virus-induced interferon. Proc Soc
Exp Biol Med, 159,97-97.
Dillman, R. (1999). Perceptions of Herceptin: a monoclonal antibody for the
treatment of breast cancer. Cancer Biother Radiopharm, 14( 1), 5-10.
Dilloo, D., Bacon, K., Holden, W„ Zhong, W„ Burdach, S., Zlotnik, A.. & Brenner,
M. (1996). Combined chemokine and cytokine gene transfer enhances antitumor
immunity. Nature Medicine, 2(10), 1090-1095.
Ehrlich, P. (1906). On immunity with special reference to cell life. Proc. Roy. Soc.
London, 6 6 ,424.
Epenetos, A. A., Snook, D., Durbin, H., Johnson, P. M., & Taylor-Papadimitriou, J.
(1986). Limitations of radiolabeled monoclonal antibodies for localization of human
neoplasms. Cancer Research, 46, 3183-3191.
176
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
Epstein, A. L. (1996). New approaches to improved antibody targeting. In R. E.
Henkin (Ed.), Nuclear Medicine (pp. 516-533). St. Louis: Mosby-Year Book.
Epstein, A. L., Chen, D., Ansari, A., Najafi, A., Siegel, M., Lee, K.. Hu, E„ Rosen,
P., Watkins, K., Stain, S., Weaver, F., & Taylor, C. R. (1991).
Radioimmunodetection of necrotic lesions in human tumors using 1-131 labeled
TNT-1 F(ab')2 monoclonal antibody. Antibody, Immunoconjugates. and
Radiopharmaceuticals, 4, 151-161.
Epstein, A. L., Chen, F.-M., & Taylor, C. R. (1988). A Novel Method for the
Detection of Necrotic Lesions in Human Cancers. Cancer Research, 4 8.5842-5848.
Epstein, A. L., Khawli, L. A., Chen, F.-M., Hu, P., Glasky, M. S., & Taylor. C. R.
(1995a). Tumor necrosis imaging and treatment of solid tumors. In V. P. Torchilin
(Ed.), Handbook o f Targeted Delivery o f Imaging Agents (pp. 259-288). Boca Raton,
FL: CRC Press.
Epstein, A. L., Khawli, L. A., Homick, J. L., & Taylor, C. R. (1995b). Identification
of a Monoclonal Antibody, TV-1, Directed against the Basement Membrane of
Tumor Vessels, and Its Use to Enhance the Delivery of Macromolecules to Tumors
after Conjugation with Interleukin-2. Cancer Res., 55, 2673-2680.
Epstein, A. L., Marder, R. J., Winter, J. N., Stathopoulos, E., Chen, F.-M.. Parker. J.
W., & Taylor, C. R. (1987). Two new monoclonal antibodies, Lym-l and Lym-2.
reactive with human B-lymphocytes and derived tumors, with immunodiagnostic and
immunotherapeutic potential. Cancer Research, 47, 830-840.
Erlanger, B. F., & Beiser, S. M. (1964). Antibodies Specific for Ribonucleosides and
Ribonucleotides and Their Reaction with DNA. Proc Natl Acad Sci USA, 52. 6 8 -
74.
Fagnani, R., Hagan, M., & Bartholomew, R. (1990). Reduction of immunogeneicity
by covalent modification of murine and rabbit immunoglobulin with oxidized
dextran of low molecular weight. Cancer Res, 50, 3638-3645.
Frankel, M. E., & Gerhard, W. (1979). The rapid determination of binding constants
for antiviral antibodies by a radioimmunoassay: an analysis of the interaction
between hybridoma proteins and influenza virus. Molecular Immunology, 16. 101-
106.
Furie, M. B., & Randolph, G. J. (1995). Chemokines and tissue injury. Am. J.
Pathol., 146, 1287-1301.
177
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
Gansbacher, B., Bannerji, R., Daniels, B., Zier, K., Cronin, K., & Gilboa, E. (1990).
Retroviral Vector-mediated y-Interferon Gene Transfer into Tumor Cells Generate
Potent and Long Lasting Antitumor Immunity. Cancer Research, 50, 7820-7825.
Ghazizadeh, S., Carroll, J. M., & Taichman, L. B. (1997). Repression of retrovirus-
mediated transgene expression by interferons: implications for gene therapy.
Journal o f Virology, 7I( 12), 9163-9169.
Giancarlo, B„ Silvano, S., Zlotnik, A., Alberto, M.. & Paola, A. (1996). Migratory
reponse of human natural killer cells to lymphotactin. European Journal of
Immunology, 26, 3238-3241.
Gillies, S. D., Reilly, E. B., Lo, K.-M., & Reisfeid, R. A. (1992). Antibody-targeted
interleukin 2 stimulates T-cell killing of autologous tumor cells. Proceedings o f the
National Academy o f Sciences USA, 89, 1428-1432.
Gleave, M. E., Elhilali, M., Fradet, Y., Davis, I„ Venner, P., Saad. F.. Klotz. L. H..
Moore, M. J„ Paton, V., Bajamonde, A., Bell, D., Ernst, S., Ramsey. E.. Chin. J..
Morales, A., Martins, H., & Sanders, C. (1998). Interferon gamma- lb compared with
placebo in metastatic renal-cell carcinoma. N Engl J Med, 338( 18), 1265-1271.
Gong, J., & Clark-Lewis, I. (1995). Antagonists of moncyte chemoattractant protein
I identified by modification of functionally critical NH2-terminal residues. J Exp
med, 181(2), 631-640.
Green, N. M. (1970). Spectrophotometric determination of avidin and biotin.
Methods in Enzymology, I8A, 418-424.
Haga, Y„ Sivinski, C., Woo, D., & Tempero, M. (1994). Dose-related comparison of
antibody-dependent cellular cytotoxicity with chimeric and native murine
monoclonal antibody 17-1 A. Improved cytolysis of pancreatic cancer cells with
chimeric 17-1 A. Int J Pancreatol, 75(1), 43-50.
Hasemann, C., 8c Capra, J. (1990). High-level production of a functional
immunoglobulin heterodimer in a baculovirus expression system. Proc Natl Acad Sci
USA, 87(10), 3942-3946.
Hechtman, D. D., Cybulsky, M. I„ Fuchs, H. J., Baker, J. B., & Gimbrone. M. A.
(1991). Intravascular IL-8 : Inhibitor of polymorphonuclear leukocyte accumulation
at sites of acute inflammation. The Journal o f Immunology, 147, 883.
178
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
Hemmerich, S., Paavola, C., Bloom, A., Bhakta, S., Freedman, R., Grungerger, D.,
Krstenansky, J., Lee, S., McCarley, D., Mulkins, M., Wong, B., Pease. J.. Mizoue,
L., Mirzadegan, T., Polsky, I., Thompson, K., Handel, T. M., & Jamagin. K. (1999).
Identification of Residues in the Monocyte Chemotactic Protein-1 That Contact the
MCP-1 Receptor, CCR2. Biochemistry, 38, 13013-13025.
Hirose, K., Hakozaki, M., Nyunoya, Y., Kobayashi, Y., Matsushita, K.. Takenouchi,
T., Mikata, A., Mukaida, N., & Matsushima, K. (1995). Chemokine gene
transfection into tumour cells reduced tumorigenicity in nude mice in association
with neutrophilic infiltration. British Journal o f Cancer, 72, 708-714.
Hock, H., Dorsch, M., Kunzendorf, U., Qin, Z., Diamantstein, T., & Blankenstein. T.
(1993). Mechanisms of rejection induced by tumor cell-targeted gene transfer of
interleukin 2, interleukin 4, interleukin 7, tumor necrosis factor, or interferon y. Proc
Natl Acad Sci USA, 90, 2774-2778.
Holzer, W., etersen, F., Strittmatter, W., Matzku, S., & von Hoegen. I. (1996). A
Fusion Protein of IL-8 and a Fab Antibody Fragment Binds to IL-8 Receptors and
Induces Neutrophil Activation. Cytokine, 8(3), 214-221.
Hornick, J. L., Khawli, L. A., Hu, P., Lynch, M., Anderson, P. M., & Epstein. A. L.
(1997). Chimeric CLL-l Antibody Fusion Proteins Containing Granulocyte
Macrophage Colony-Stimulating Factor or Interleukin-2 With Specificity for B-Cell
Malignancies Exhibit Enhanced Effector Functions While Retaining Tumor
Targeting Properties. Blood, 89( 12), 4437-4447.
Hornick, J. L., Khawli, L. A., Hu, P., Sharifi, J., Khanna, C., & Epstein. A. L.
(1999). Pretreatment with a Monoclonal Antibody/Interleukin-2 Fusion Protein
Directed against DNA Enhances the Delivery of Therapeutic Molecules to Solid
Tumors. Clinical Cancer Research, 5, 51-60.
Homick, J. L., Sharifi, J., Khawli, L. A., Hu, P., Bai, W. G., Alauddin. M. M..
Mizokami, M. M., & Epstein, A. L. (2000). Single Amino Acid Substitution in the
Fc Region of Chimeric TNT-3 Antibody Accelerates Clearance and Improves
Immunoscintigraphy of Solid Tumors. Journal o f Nuclear Medicine, 41. 355-362.
Hornick, J. L., Sharifi, J., Khawli, L. A., Hu, P., Biela, B. H., Mizokami, M. M.,
Yun, A., Taylor, C. R., & Epstein, A. L. (1998). A new chemically modified
chimeric TNT-3 monoclonal antibody directed against DNA for the
radioimmunotherapy of solid tumors. Cancer Biotherapy & Radiopharmaceuticals,
13(4), 255-268.
179
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
Hu, P., Glasky, M. S., Yun, A., Alauddin, M. M., Homick, J. L„ Khawli, L. A., &
Epstein, A. L. (1995). A human-mouse chimeric Lym-I monoclonal antibody with
specificity for human lymphomas expressed in a baculovirus system. Human
Antibodies and Hybridomas, 6 ,57-67.
Hu, P., Homick, J. L., Glasky, M. S., Yun, A., Milkie, M. N., Khawli, L. A.,
Anderson, P. M., & Epstein, A. L. (1996). A chimeric Lym-1/interleukin 2 fusion
protein for increasing tumor vascular permeability and enhancing antibody uptake.
Cancer Research, 56, 4998-5004.
Huang, S., Singh, R. K., Xie, K., Gutman, M., Berry, K. K., Bucana, C. D.. Fidler. I.
J., & Bar-Eli, M. (1994). Expression of the JE/MCP-1 gene suppresses metastatic
potential in murine colon carcinoma cells. Cancer Immunology and Immunotherapy,
59,231-238.
Huang, S., Xie, K., Singh, R. K., Gutman, M., & Bar-Eli, M. (1995). Suppresion of
Tumor Growth and Metastasis of Murine Renal Adenocarcinoma by Syngeneic
Fibroblasts Genetically Engineered to Secrete the JE/MCP-1 Cytokine. Journal of
Interferon and Cytokine Research, 15, 655-665.
Ishii, N., Nakata, K, Muro, T., Furukawa, R., Kono, K., Kusumoto. Y., Munehisa, T.,
Koji, T., Nagataki, S., Nishi, S., & al, e. (1983). Radioimmunodetection of cancer
using antibodies to alpha-fetoprotein and carcinoembryonic antigen. Ann N Y Acad
Sci, 417, 270-276.
Jain, R. K. (1988). Determinants of tumor blood flow: A review. Cancer Res.. 48,
2641.
Jain, R. K. (1996). Delivery of molecular medicine to solid tumors. Science, 27.
1079-1080.
Jarnagin, K., Grunberger, D., Mulkins, M., Wong, B„ Hemmerich. S.. Paavola. C..
Bloom, A., Bhakta, S., Diehl, F., Freedman, R., McCarley, D., Polsky. I., Ping-Tsou,
A., Kosaka, A., & Handel, T. M. (1999). Identification of Surface Residues of the
Monocyte Chemotactic Protein 1 That Affect Signaling through the Receptor CCR2.
Biochemistry, 38, 16167-16177.
Jones, S. T., & Bendig, M. M. (1991). Rapid PCR-cloning of full-length mouse
immunoglobulin variable regions. Bio/Technology, 9, 88-89.
Ju, G„ Collins, L., Kaffka, K., Tsien, W., Chizzonite, R., Crowl, R.. Bhatt. R.. &
Kilian, P. (1987). Structure-function analysis of human interleukin-2. Identification
of amino acid residues required for biological activity. J Biol Client, 262( 12). 5723-
5731.
180
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
Kappler, J., Skidmore, B., White, J., & Marrack, P. (1981). Antigen-inducible, H-2-
restricted, interleukin-2-producing T ceil hybridomas. Lack of independent antigen
and H-2 recognition. J Exp Med, 153(5), 1198-1214.
Kelner, G. S., Kennedy, J., Bacon, K. B., Kleyensteuber, S., Largaespada, D. A.,
Jenkins, N. A., Copeland, N. G., Bazan, J. F., Moore, K. W„ Schall. T. J.. & Zlotnik.
A. (1994). Lymphotactin: A Cytokine That Represents a New Class of Chemokine.
Science, 266, 1395-1399.
Kennedy, J., Kelner, G. S., Kleyensteuber, S., Schall, T. J., Weiss, M. C., Yssel. H..
Schneider, P., Cocks, B. G., Bacon, K. B., & Zlotnik, A. (1995). Molecular Cloning
and Functional Characterization of Human Lymphotactin. The Journal of
Immunology, 155, 203-209.
Khawli, L. A., & Epstein, A. L. (1997). Exploration of novel strategies to enhance
monoclonal antibodies targeting. Quarterly Journal o f Nuclear Medicine. 41. 25-35.
Khawli, L. A., Glasky, M. S., Alauddin, M. M., & Epstein, A. L. (1996). Improved
tumor localization and radioimaging with chemically modified monoclonal
antibodies. Cancer Biotherapy & Radiopharmaceuticals, 11. 203-215.
Khawli, L. A., Homick, J. L., Sharifi, J., & Epstein, A. L. (1997). Improving the
chemotherapeutic index of IUdR using a vasoactive immunoconjugate.
Radiochimica Acta, 79, 83-86.
Khawli, L. A., Miller, G. K., & Epstein, A. L. (1994). Effect of seven new vasoactive
immuno-conjugates on the enhancement of monoclonal antibody uptake in tumors.
Cancer, 73, 824.
Khazaeli, M. B., Conry, R. M„ & LoBuglio, A. F. (1994). Human immune response
to monoclonal antibodies. Journal o f Immunotherapy, 15, 42-52.
Kim, Y.-M., & Son, K. (1996). A nitric oxide production bioassay for interferon-g.
Journal o f Immunological Methods, 198, 203-209.
Kitamura, K., Takahashi, T., Yamaguchi, T., Noguchi, A., Noguchi, A., &
Takashina, K. e. a. (1991). Chemical engineering of the monoclonal antibody A7 by
polyethylene glycol for targeting cancer chemotherapy. Cancer Res, 51. 4310-4315.
Klibanov, A. L., Marynov, A. V., Slinkin, M. A., Sakharov, I., Smirnov. M. D.. &
Muzykantov, V. R. e. a. (1988). Blood clearance of radiolabeled antibody:
enhancement by lactosamination and treatment with biotin-avidin or anti-mouse IgG
antibodies. J Nucl Med, 29, 1951-1956.
181
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
Kohler, G., & Milstein, C. (1975). Continuous cultures of fused cells secreting
antibody of predefined specificity. Nature, 256,495-497.
Kreitman, R., & Pastan, I. (1998). Accumulation of a recombinant immunotoxin in a
tumor in vivo: fewer than 1000 molecules per cell are sufficient for complete
responses. Cancer Res, 58(5), 968-975.
Kurzrock, R., Quesada, J. R., Rosenblum, M. G., Sherwin, S. A., & Gutterman, J. U.
(1986). Phase I Study of iv Administrated Recombinant Gamma Interferon in Cancer
Patients. Cancer Treatment Reports, 70(12), 1357-1364.
Kurzrock, R., Rosenblum, M. G., Sherwin, S. A., Rios, A., Talpaz. M., Quesada. J.
R., & Gutterman, J. U. (1985). Pharmacokinetics, Single-Dose Tolerance, and
Biological Activity of Recombinant y-Interferon in Cancer Patients. Cancer
Research, 45, 2866-2872.
Langmuir, V. K., Mendonca, H. L., & Woo, D. V. (1992). Comparisons between
Two Monoclonal Antibodies That Bind to the Same Antigen but Have Differing
Affinities: Uptake Kinetics and ,25I-Antibody Therapy Efficacy in Multicell
Spheroids. Cancer Research, 4 2 ,4728-4734.
Larson, S. (1990). Clinical radioimmunodetection, 1978-1988: overview and
suggestions for standardization of clinical trials. Cancer Res, 50((3 Suppl)). 892s-
898s.
Lavieille, J., Righini, C., Reyt, E., Brambilla, C., & Riva, C. (1998). Implications of
p53 alterations and anti-p53 antibody response in head and neck squamous cell
carcinomas. Oral Oncol, 34(2), 84-92.
LeBerthon, B., Khawli, L. A., Alauddin, M., Miller, G. K., Charak, B. S..
Mazumder, A., & Epstein, A. L. (1991). Enhanced tumor uptake of macromolecules
induced by a novel vasoactive interleukin 2 immunoconjugate. Cancer Research. 51.
2694-2698.
Ley, K., Baker, J. B., Cybulsky, M. I., Gimbrone, M. A., & Luscinskas, F. W.
(1993). Intravenous interleukin-8 inhibits granulocyte emigration from rabbit
mesenteric vessels without altering L-selectin expression or leukocyte rolling. The
Journal o f Immunology, 151, 6347.
Liu, A. Y., Robinson, R. R., Hellstrom, K. E., E.D., M., Chang, C., & Hellstrom, I.
(1987). Chimeric human-mouse IgGl antibody that can mediate lysis of cancer cells.
Proceedings o f the National Academy o f Sciences USA, 84, 3439-3443.
182
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
LoBuglio, A. F„ Wheeler, R. H., Trang, J., Haynes, A., Rogers, K.. Harvey, E. B.,
Sun, L., Ghrayeb, J., & Khazaeli, M. B. (1989). Mouse/human chimeric monoclonal
antibody in man: kinetics and immune response. Proceedings o f the National
Academy o f Sciences USA, 86,4220-4224.
Lode, H. N., Xiang, R., Varki, N. M., Dolman, C. S., Gillies, S. D., & Reisfeld, R. A.
(1997). Targeted Interleukin-2 Therapy for Spontaneous Neuroblastoma Metastases
to Bone Marrow. Journal o f the National Cancer Institute, 89(21), 1 586-1594.
Loetscher, P., Seitz, M., Clark-Lewis, I., Baggiolini, M., & Moser, B. (1996).
Activation of NK Cells by CC Chemokines: Chemotaxis, Ca^+ Mobilization, and
Enzyme Release. The Journal of Immunology, 156, 322-327.
Lundberg, B., Griffiths, G., & Hansen, H. (1999). Conjugation of an anti-B-cell
lymphoma monoclonal antibody, LL2, to long-circulating drug-carrier lipid
emulsions. J Pharm Pharmacol, 5/(10), 1099-1105.
Maghazachi, A. A., Al-Aoukaty. A., & Schall, T. J. (1994). C-C Chemokines Induce
the Chemotaxis of NK and IL-2-Activated NK Cells. The Journal of Immunology,
153,4969-4977.
Maloney, D., 8c Press, O. (1998). Newer treatments for non-Hodgkin's lymphoma:
monoclonal antibodies. Oncology (Huntingt), I2( 10 Suppl 8 ), 63-76.
Maloney, D. G., Liles, T. M., Czerwinski, D. K., Waldichuk, C., Rosenberg, J.,
Grillo-Lopez, A., & Levy, R. (1994). Phase I clinical trial using escalating single
dose infusion of chimeric anti-CD20 monoclonal antibody (IDEC-C2B8) in patients
with recurrent B-cell lymphoma. Blood, 84, 2457-2466.
Manome, Y., Wen, P. Y., Hershowitz, A., Tanaka, T„ Rollins, B. J., Kufe. D. w.. &
Fine, H. A. (1995). Monocyte chemoattractant protein-1 (MCP-1) gene transduction:
an effective tumor vaccine strategy for non-intracranial tumors. Cancer Immunology
and Immunotherapy, 41, 227-235.
Marks, T. A., Woodman, R. J., Geran, R. I., Billups, L. H.. & Madison. R. M.
(1977). Characterization and Responsiveness of the Madison 109 Lung Carcinoma to
Various Antitumor Agents. Cancer Treatment Reports, 6 /( 8 ), 1459-1470.
McLaughlin, P., White, C., Grillo-Lopez, A., & Maloney, D. (1998). Clinical status
and optimal use of rituximab for B-cell lymphomas. Oncology (Huntingt), 12(12),
1763-1769; discussion 1769-1770, 1775-1767.
183
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
Miller, G. K., Naeve, G. S., Shaik, A. G., & Epstein, A. L. (1993). Immunologic and
biochemical analysis of TNT-1 and TNT-2 monoclonal antibodies binding to
histones. Hybridoma, 72(9), 689-698.
Morrison, S. L., Johnson, M. J., Herzenberg, L. A., & Oi, V. T. (1984). Chimeric
human antibody molecules: mouse antigen-binding domains with human constant
region domains. Proceedings o f the National Academy o f Sciences USA. 81. 6851-
6855.
Mule, J. J., Custer, M., Averbook, B., Yang, J. C., Weber, J. S., Goeddel, D. V.,
Roseberg, S. A., & Schall, T. (1996). RANTES Secretion by Gene-Modified Tumor
Cells Results in Loss of Tumorigenicity In Vivo: Role of Immune Cell
Subpopulations. Human Gene Therapy, 7, 1545-1553.
Munns, T. W., Liszewski, M. K., Tellam, J. T., Ebling, F. M., & Hahn. B. H. (1982).
Antibody-Nucleic Acid Complexes. Identification of the Antigenic Determinant of a
Murine Monoclonal Antibody Specific for Single-Stranded Nucleic Acids.
Biochemistry, 21,2929-2936.
Murphy, G. P., & Hrushesky, W. J. (1973). A murine renal cell carcinoma. Journal
o f the National Cancer Institute, 50, 1013-1025.
Nakashima, E., Oya, A., Kubota, Y., Kanada, N., Matsushita, R., Takeda, K.,
Ichimura, F., Kuno, K., Mukaida, N., Hirose, K., Nakanishi, I., Ujiie. T„ &
Matsushima, K. (1996). A Candidate for Cancer Gene Therapy: MIP- la Gene
Transfer to an Adenocarcinoma Cell Line Reduced Tumorigenicity and Induced
Protective Immunity in Immunocompetent Mice. Parmaceutical Research. 13( 12).
1896-1901.
Narula, J., Petrov, A., Bianchi, C., Ditlow, C. C., Lister, B. C.. Dillev. J.. Pieslak. I..
Chen, F. W., Torchilin, V. P., & Khaw, B.-A. (1995). Noninvasive localization of
experimental atherosclerotic lesions with mouse/human chimeric Z2D3 Ftab'b
specific for the proliferating smooth muscle cells of human atheroma. Imaging with
conventional and negative charge-modified antibody fragments. Circulation. 92,
474-484.
Narvaiza, I., Mazzolini, G., Barajas, M., Duarte, M., Zaratiegui, M.. Qian, C.,
Melero, I., & Prieto, J. (2000). Intratumoral Coinjection of Two Adenoviruses, One
Encoding the Chemokine IFN-g-Inducible Protein-10 and Another Encoding IL-12,
Results in Marked Antitumoral Synergy. J Immunol, 164, 3112-3122.
184
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
Ohsugi, Y., Gershwin, M. E., Owens, R. B., & Nelson-Rees, W. A. (1980).
Tumorigenicity of human malignant lymphoblasts: comparative study with
unmanipulated nude mice, antilymphocyte serum-treated nude mice, and X-
irradiated nude mice. Journal o f the National Cancer Institute, 65(4). 7 1 5-718.
Oravecz, T., Pall, M., Roderiquez, G., Gorrell, M. D., Ditto, M., Nguyen, N. Y..
Boykins, R., Unsworth, E., & Norcross, M. A. (1997). Regulation of the Rceptor
Specificity and Function of the Chemokine RANTES (Regulated on Activation,
Normal T Cell Expressed and Secreted) by Dipeptidyl Peptidase IV (CD26)-
mediated Cleavage. Journal o f Experimental Medicine, 186( 1), 1865-1782.
Ostendorf, A. M„ Albertini, M. R., Gan, J., Hank, J. A., Gillies, S. D.. & Sondel. P.
M. (2000,4/2/00). Development o f an Assay to Detect an anti-Hul4.I8-IL2
Response Following in vivo Therapy with anti-GD2 Fusion Protein, HuI4.l8-IL2.
Paper presented at the American Association for Cancer Research 91st Annual
Meeting, San Francisco, CA, USA.
Paavola, C. D., Hemmerich, S., Grunberger, D., Polsky, I., Bloom, A., Freedman, R.,
Mulleins, M., Bhakta, S., McCarley, D., Wiesent, L., Wong, B„ Jarnagin. K.. &
Handel, T. M. (1998). Monomeric Monocyte Chemoattractant Protein-1 (MCP-1)
Binds and Activates the MCP-1 Receptor CCR2B. Journal o f Biological Chemistry,
275(50), 33157-33165.
Pardoll, D. M. (1993). Cancer vaccines. Immunology Today, 14, 310-316.
Partridge, W. M., Triguero, D„ Buciak, J., 8c Yang, J. (1990). Evaluation of
cationized rat albumin as a potential blood-brain barrier drug transport vector../
Pharmacol Exp Ther, 255, 893-899.
Pressman, D., & Komgold, L. (1953). The in vivo localization of anti-Wagner-
osteogenic-sarcoma antibodies. Cancer, 6 ,619-623.
Proost, P., Struyf, S., Couvreur, M., Lenaerts, J.-P., Conings, R., Menten, P.,
Verhaert, P., Wuyts, A., & Van Damme, J. (1998). Posttranslational Modifications
Affect the Activity of the Human Monocyte Chemotactic Proteins MCP-1 and MCP-
2: Identification of MCP-2(6-76) as a Natural Chemokine Inhibitor. Journal o f
Immunology, 760,4034-4041.
Proudfoot, A., Power, C., Hoogewerf, A„ Montjovent, M., Borlat, F., Offord, R., &
Wells, T. (1996). Extension of recombinant human RANTES by the retention of the
initiating methionine produces a potent antagonist. J Biol Chem, 27/(5), 2599-2603.
185
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
Qi, Y., Chen, Y., & Xiang, J. (1996a). Mouse myeloma cell line secreting
bifunctional fusion protein RM4/IFN-y elicits antitumor CD8 MHC Class I-restricted
T cells that are cytolytic in vitro and tumoricidal in vivo. Journal o f Interferon and
Cytokine Research, 16, 771-776.
Qi, Y., Moyana, T., Chen, Y., & Xiang, J. ( 1996b). Characterization of anti-tumor
immunity derived from the inoculation of myeloma cells secreting the fusion protein
RM4/IFN-Y. Human Antibodies and Hybridomas, 7, 21-26.
Qin, L., Ding, Y., Pahud, D. R., Chang, E., Imperiale, M. J., & Bromberg, J. S.
(1997). Promoter attenuation in gene therapy: interferon-y and tumor necrosis
factor-a inhibit transgene expression. Human Gene Therapy, 8, 2019-2029.
Ralph, P., Moore, M., & Nilsson, K. (1976). Lysozyme synthesis by established
human and murine histiocytic lymphoma cell lines. J Exp Med, 143{6 ), 1528-1533.
Ralph, P., & Nakoinz, I. (1977). Antibody-dependent killing of erythrocyte and
tumor targets by macrophage-related cell lines: enhancement by PPD and LPS. J
Immunol, 779(3), 950-954.
Reckless, J., & Grainger, D. J. (1999). Identification of oligopeptide sequences
which inhibit migration induced by a wide range of chemokines. Biochem J, 340.
803-811.
Rollins, B. J. (1997). Chemokines. Blood, 90(3), 909-928.
Rollins, B. J., Waiz, A., & Baggiolini, M. (1991). Recombinant Human MCP-l/JE
Induces Chemotaxis, Calcium Flux, and the Respiratory Burst in Human Monocytes.
Blood, 78(4), 1112-1116.
Rose, L., Deng, C., Scott, S., Xiong, C., Lambom, K.. Gumerlock. P.. DeNardo. G..
& Meares, C. (1999). Critical Lym-I binding residues on polymorphic HLA-DR
molecules. Mol Immunol, 56(11-12), 789-797.
Rose, L. M., Gunasekera, A. H., DeNardo, S. J., DeNardo, G. L., & Meares. C. F.
(1996). Lymphoma-selective antibody Lym-1 recognizes a discontinuous epitope on
the light chain of HLA-DR 10. Cancer Immunology Immunotherapy, 43, 26-30.
Roseblum, M. G., Cheung, L., Murray, J. L., & Bartholomew, R. (1991). Antibody-
mediated delivery of tumor necrosis factor (TNF-a): Improvement of cytotoxicity
and reduction of cellular resistance. Cancer Conun., 3 ,21.
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
Rosenberg, S. A., Lotze, M. T., Muul, L. M., Chang, A. E., Avis, F. P., Leitman, S.,
Linehan, W. M., Robertson, C. N., Lee, R. E., Rubin, J. T., Seipp, C. A.. Simpson. C.
G., & White, D. E. (1987). A progress report on the treatment of 157 patients with
advanced cancer using lymphokine activated killer cells and interleukin-2 or high
dose interleukin-2 alone. New England Journal o f Medicine, 316, 889-905.
Rosenblum, M., Marks, J., & Cheung, L. ( 1999a). Comparative cytotoxicity and
pharmacokinetics of antimelanoma immunotoxins containing either natural or
recombinant gelonin. Cancer Chemother Pharmacol; 44., 44.
Rosenblum, M. G., Marks, J. W., & Cheung, L. H. (1999b). Comparative
cytotoxicity and pharmacokinetics of antimelanoma immunotoxins containing either
natural or recombinant gelonin. Cancer Chemother Pharmacol. 44(343-348).
Rosenstein, M., Ettinghausen, S. E., & Rosenberg, S. A. (1986). Extravasation of
intravascular fluid mediated by the systemic administration of recombinant
interleukin 2. Immunology, 137, 1735-1742.
Rutledge, B. J., Rayburn, H., Rosenberg, R., North, R. J., Gladue, R. P.. Corless. C.
L., & Rollins, B. J. (1995). High level monocyte chemoattractant protein-1
expression in transgeneic mice increases their susceptibility to intracellular
pathogens. The Journal o f Immunology, 155,4838.
Sadanaga, N„ Nagoshi, M., Lederer, J., Joo, H.-G., Eberlein. T. J.. & Goedegebuure.
P. S. (1999). Local Secretion of IFN-y Induces and Antitumor Response:
Comparison Between T cells Plus IL-2 and IFN-y Transfected Tumor Cells. Journal
o f Immunotherapy, 22(4), 315-323.
Saga, T., Neumann, R., Heya, T., Sato, J., Kinuya, S., Le, N., Paik, C.. & Weinstein,
J. (1995). Targeting cancer micrometastases with monoclonal antibodies: a binding-
site barrier. Proc Natl Acad Sci USA, 92{ 19), 8999-9003.
Sands, H. (1990). Experimental studies of radioimmunodetection of cancer: an
overview. Cancer Research (Supplement)(809s-813s).
Sato, N., Nariuchi, H., Tsuruoka, N., Nishihara, T., Beitz, J., Calabresi. P.. &
Frackelton, A. J. (1990). Actions of TNF and IFN-gamma on angiogenesis in vitro. J
Invest Dermatol, 95(6 Suppl), 85S-89S.
Schall, T. J. (1994). The Chemokines. In A. Thomson (Ed.), The Cytokine Handbook
(Second Edition ed., Vol. 1, pp. 419-460). San Diego: Academic Press, Inc.
Schreiber, R. D. (1994). Measurement of Mouse and Human Interferon y. In J. E.
Colligan (Ed.), Current Protocols in Immunology (Vol. 1. pp. 6 .8 .1-6.8.8 ). New
York: John Wiley & Sons, Inc.
187
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
Schroff, R. W., Foon, K. A., Beatty, S. M., Oldham, R. K., & Morgan Jr.. A. C.
(1985). Human anti-murine immunoglobulin responses in patients receiving
monoclonal antibody therapy. Cancer Research, 45, 879-885.
Sgadari, C., Angiolillo, A. L., Chemey, B. W., Pike, S. E., Farber, J. M.. Koniaris. L.
G., Vanguri, P., Burd, P. R., Sheikh, N., Gupta, G., Teruya-Feldstein, J., & Tosato,
G. (1996). Interferon-inducible protein-10 identified as a mediator of tumor necrosis
in vivo. Proceedings o f the National Academy o f Sciences, USA, 93. 13791-13796.
Sharifi, J., Khawli, L. A., Homick, J. L., & Epstein, A. L. (1998). Improving
monoclonal antibody pharmacokinetics via chemical modification. Q J N ad Med,
42(4), 242-249.
Sharkey, R. M., Pykett, M. J., Siegel, J. A., Alger, E. A., Primus. F. J.. &
Goldenberg, D. M. (1987). Radioimmunotherapy of the GW-39 human colonic
tumor xenograft with 1311- labeled murine monoclonal antibody to
carcinoembryonic antigen. Cancer Res, 47(21), 5672-5677.
Shawler, D. L., Bartholomew, R. M., Smith, L. M., & Dillman, R. O. (1985). Human
immune response to multiple injections of murine monoclonal IgG. Journal of
Immunology, 135, 1530-1535.
Silverstein, A. M. (1989). A History o f Immunology. San Diego: Academic Press.
Inc.
Simmons, G., Clapham, P., Picard, L., Offord, R., Rosenkilde, M.. Schwartz. T..
Buser, R., Wells, T., & Proudfoot, A. (1997). Potent inhibition of HIV-1 infectivity
in macrophages and lymphocytes by a novel CCR5 antagonist. Science. 276(5310).
276-279.
Smith, K. A. (1993). Lowest dose interleukin-2 immunotherapy. Blood, SI, 1414-
1423.
Sone, S., & Ogura, T. (1994). Local interleukin-2 therapy for cancer, and its effect
induction mechanisms. Oncology, 51(2), 170-176.
Steplewski, Z., Sun, L. K., Shearman, C. W„ Ghrayeb, J., Daddona. P.. &
Koprowski, H. (1988). Biological activity of human-mouse IgGl, IgG2, lgG3. and
IgG4 chimeric monoclonal antibodies with antitumor specificity. Proceedings of the
National Academy o f Sciences USA, 85, 4852-4856.
Strieter, R. M., Polverini, P. J., Arenberg, D. A., Walz, A., Opdenakker. G.. Van
Damme, J., & Kunkel, S. L. (1995). Role of C-X-C chemokines as regulators of
angiogenesis in lung cancer. Journal o f Leukocyte Biology, 57. 752-762.
188
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
Sun, W. H., Burkholder, J. K., Sun, J., Culp, J., Turner, J., Lu, X. G., Pugh, T. D.,
Ershler, W. B., & Yang, N.-S. (1995). In vivo cytokine gene transfer by gene gun
reduces tumor growth in mice. Proc Natl Acad Sci USA, 92, 2889-2893.
Takashina, K., Kitamura, K., Yamaguchi, T., Noguchi, A., Noguchi, A.. & Tsurumi.
H. e. a. (1991). Comparitive pharmacokinetic properties of murine monoclonal
antibody A7 modified with neocarzinostatin, dextran, and polyethylene glycol. Jpn J
Cancer Res, 82, 1145-1150.
Talmadge, J. E., Tribble, H. R., Pennington, R. W., Phillips, H.. & Wiitrout. R. H.
(1987). Immunomodulatory and Immunotherapeutic Properties of Recombinant y-
Interferon and Recombinant Tumor Necrosis Factor in Mice. Cancer Research, 47,
2563-2570.
Taub, D. D., Longo, D. L., & Murphy, W. J. ( 1996a). Human interferon-inducible
protein-10 induces mononuclear cell infiltration in mice and promotes the migration
of human T lymphocytes into the peripheral tissues and human peripheral blood
lymphocytes in SCID mice. Blood, 87, 1423.
Taub, D. D., Ortaldo, J. R., Turcovski-Corrales, S. M., Key, M. L.. Longo, D. L.. &
Murphy, W. J. (1996b). P-Chemokines costimulate lymphocyte cytolosis.
proliferation, and lymphokine production. Journal o f Leukocyte Biology. 59. 81-89.
Taub, D. D., Proost, P., Murphy, W. J., Anver, M., Longo, D. L., & Van Damme, J.
(1995a). Monocyte Chemotactic Protein-1 (MCP-1), -2, and -3 Are Chemotactic for
Human T Lymphocytes. Journal o f Clinical Investigation, 95, 1370-1376.
Taub, D. D., Sayers, T. J., Carter, C. R. D., & Ortaldo, J. R. ( 1995b). a and p
Chemokines Induce NK Cell Migration and Enhance NK-Mediated Cytolysis. The
Journal o f Immunology, 155, 3877-3888.
Tom, B. H., Rutzky, L. P., Jakstys, M. M.. Oyasu, R., Kaye. C. I., & Kahan. B. D.
(1976). Human colonic adenocarcinoma cells. I. Establishment and description of a
new line. In Vitro, 12, 180-191.
Tsuchiya, S., Yamabe, M., Yamaguchi, Y., Kobayashi, Y., Konno, T., & Tada, K.
(1980). Establishment and characterization of a human acute monocytic leukemia
cell line (THP-l). IntJ Cancer, 26(2), 171-176.
Uguccioni, M., D'Apuzzo, M., Loetscher, M., Dewald, B., & Baggiolini. M. (1995).
Actions of the chemotactic cytokines MCP-1, MCP-2, MCP-3, RANTES. M IP-la
and M IP-lp on human n.enocytes. European Journal o f Immunology, 25. 64-68.
Urban, J., & Schreiber, H. (1992). Tumor antigens. Annu Rev Immunol, 10, 617-644.
189
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
van Osdol, W., Fujimore, K., & Weinstein, J. N. (1991). An analysis of monoclonal
antibody distribution in microscopic tumor nodules: consequences of a "binding site
barrier.". Cancer Res, 5 1,4776-4784.
Voest, E., Kenyon, B., O’ Reilly, M., Truitt, G., D'Amato, R., & Folkman, J. (1995).
Inhibition of angiogenesis in vivo by interleukin 12. J Natl Cancer Inst, 87(8). 5 8 1 -
586.
von Behring, E., & Kitasato, S. (1890). Dtsch. Med. Wochenschr, 16. 1113.
Wadsley, J. J., & Watt, R. M. (1987). The effect of pH on the aggregation of
biotinylated antibodies and on the signal-to-noise observed in immunoassays
utilizing biotinylated antibodies. Journal o f Immunological Methods, 103. 1-7.
Weiner, L. (1999). Monoclonal antibody therapy of cancer. Semin Oncol, 26(5
Suppl 14), 43-51.
Weinstein, J., & van Osdol, W. (1992). Early intervention in cancer using
monoclonal antibodies and other biological ligands: micropharmacology and the
"binding site barrier". Cancer Res, 52(9 Suppl), 2747s-2751s.
Weir, M. P., Chaplin, M. A., Wallace, B. M., Dykes, C. W.. & Hobden. A. N.
(1988). Structure activity relationships of human interleukin-2. Biochemistry, 27.
6883-6892.
Wexler, H. (1966). Accurate Identification of Experimental Pulmonary Metastases. J
Natl Cancer Inst, 36(4), 641-645.
Wuyts, A., D'Haese, A., Cremers, V., Menten, P., Lenaerts, J.-P., De Loof, A..
Heremans, H., Proost, P., & Van Damme, J. (1999). NH2- and COOH-Terminal
Truncations of Murine Granulocyte Chemotactic Protein-2 Augment the In Vitro and
In Vivo Neutrophil Chemotactic Potency. J Immunol, 163, 6155-6163.
Xiang, J., Qi, Y., Cook, D., & Moyana, T. (1996). Targeting gamma interferon to
tumor cells by a genetically engineered fusion protein secreted from myeloma cells.
Human Antibodies and Hybridomas, 7, 2-10.
Xiang, J., Qi, Y., Luo, X., & Liu, E. (1993). Recombinant bifunctional molecule
FV/IFN-y possess the anti-tumor FV as well as the gamma interferon activities.
Cancer Biotherapy, 5(4), 327-337.
Xu, L. L., Warren, M. K., Rose, W. L., Gong, W„ & Wang, J. M. (1996). Human
recombinant monocyte chemotactic protein and other C-C chemokines bind and
induce directional migration of dendritic cells in vitro. Journal of Leukocyte Biology,
60,365-371.
190
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
Yamashiro, S., Takeya, M., Nishi, T., Kuratsu, J.-i., Yoshimura, T.. Ushio, Y.. &
Takahashi, K. (1994). Tumor-Derived Monocyte Chemoattractant Protein-1 Induces
Intratumoral Infiltration of Monocyte-Derived Macrophage Subpopulation in
Transplanted Rat Tumors. American Journal o f Pathology, 145(4), 856-867.
Yanagihara, K., Seyama, T., & Watanabe, Y. (1994). Antitumor Potential of
Interferon-y: Retroviral Expression of Mouse Interferon-y cDNA in Two Kinds of
Highly Metastatic Mouse Tumor Lines Reduces Their Tumorigeneicity. Natural
Immunity, 75(103-112).
Yao, L., Sgadari, C., Furuke, K., Bloom, E., Teruya-Feldstein, J., & Tosato, G.
(1999). Contribution of natural killer cells to inhibition of angiogenesis by
interleukin-12. Blood, 95(5), 1612-1621.
Zhang, L., Khayat, A., Cheng, H., & Graves, D. T. (1997). The Pattern of Monocyte
Recruitment in Tumors is Modulated by MCP-1 Expression and Influences the Rate
of Tumor Growth. Laboratory Investigation, 76(4), 579-590.
Zhang, Y., & Rollins, B. J. (1995). A Dominant Negative Inhibitor Indicates that
Monocyte Chemoattractant Protein 1 Functions as a Dimer. Molecular and Cellular
Biology, 15(9), 4851-4855.
Zhang, Y. J., Rutledge, B. J., & Rollins, B. J. (1994). Structure/Activity Analysis of
Human Monocyte Chemoattractant Protein-1 (MCP-1) by Mutagenesis. The Journal
o f Biological Chemistry, 269(22), 15918-15924.
Zuckier, L. S., Georgescu, L., Chang, C. J., Scharff, M. D., & Morrison. S. L.
(1994). The use of severe combined immunodeficiency mice to study the metabolism
of human immunoglobulin G. Cancer, 73, 794-799.
191
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.

Linked assets

University of Southern California Dissertations and Theses

Conceptually similar

PDF

Engineering antibodies and antibody /cytokine fusion proteins for the treatment of human malignancies

PDF

Antibody-cytokine/chemokine fusion proteins in the immunotherapy of solid tumors

PDF

Imaging and prodrug -activating derivatives of chTNT-3 (tumor necrosis therapy) monoclonal antibody

PDF

B7.1 fusion proteins for cancer immunotherapy

PDF

T regulatory cell based immunotherapy for the treatment of cancer

PDF

Mechanisms of acquisition of molecular genetic changes during tumor development and progression

PDF

Regulation of cell cycle G(1) phase progression by the EWS-FLI1 fusion gene

PDF

The clinical significance, detection and biological characteristics of occult metastasis in breast cancer

PDF

The HER-2/neu oncogene in human breast cancer: From molecular mechanisms to targeted therapies

PDF

Molecular classification, diagnosis and prognosis of pediatric rhabdomyosarcoma by oligonucleotide microarray analyses

PDF

Replication -competent retroviral vectors for highly efficient and tumor -selective gene delivery

PDF

Studies of two factors, osteopontin expression and timing of androgen ablation, in prostate tumor progression

PDF

Breast cancer in the multiethnic cohort study: Genetic (prolactin pathway genes) and environmental (hormone therapy) factors

PDF

Downstream targets of the Ewing's sarcoma EWS /FLI -1 fusion gene

PDF

Post-translational modification of nucleolin by monoubiquitylation in human ovarian carcinoma cells

PDF

Progesterone signaling in ovarian epithelial tumors

PDF

Mechanisms contributing to inflammatory cell entry into the central nervous system during neurotropic mouse hepatitis virus induced encephalomyelitis

PDF

HER-2/neu-mediated cell migration and invasion

PDF

Monoamine oxidase A: (1) As one of many candidate genes for preeclampsia and (2) as a candidate gene for tobacco addiction

PDF

The androgen receptor: Its role in the development and progression of cancers of the prostate and breast

Asset Metadata

Creator Mizokami, Myra Michiko (author)

Core Title Optimization of genetically engineered monoclonal antibody and antibody /cytokine fusion proteins for the detection and immunotherapy of solid malignancies

Contributor Digitized by ProQuest (provenance)

Degree Doctor of Philosophy

Degree Program Pathobiology

Publisher University of Southern California (original), University of Southern California. Libraries (digital)

Tag health sciences, immunology,health sciences, medicine and surgery,health sciences, oncology,OAI-PMH Harvest

Language English

Permanent Link (DOI) https://doi.org/10.25549/usctheses-c16-132202

Unique identifier UC11329214

Identifier 3041499.pdf (filename),usctheses-c16-132202 (legacy record id)

Legacy Identifier 3041499-0.pdf

Dmrecord 132202

Document Type Dissertation

Rights Mizokami, Myra Michiko

Type texts

Source University of Southern California (contributing entity), University of Southern California Dissertations and Theses (collection)

Access Conditions The author retains rights to his/her dissertation, thesis or other graduate work according to U.S. copyright law. Electronic access is being provided by the USC Libraries in agreement with the au...

Repository Name University of Southern California Digital Library

Repository Location USC Digital Library, University of Southern California, University Park Campus, Los Angeles, California 90089, USA