University of Southern California Dissertations and Theses

Essential and non-essential helicases maintain genome stability in Schizosaccharomyces pombe

(USC Thesis Other)

Essential and non-essential helicases maintain genome stability in Schizosaccharomyces pombe

PDF

Download a page range

Download transcript

Copy asset link

Request this asset

Transcript (if available)

Content

ESSENTIAL AND NON-ESSENTIAL HELICASES MAINTAIN GENOME
STABILITY IN SCHIZOSACCHAROMYCES POMBE

By

Lin Ding

__________________________________________________________

A Dissertation Presented to the
FACULTY OF THE USC GRADUATE SCHOOL
UNIVERSITY OF SOUTHERN CALIFORNIA
In Partial Fulfillment of the
Requirements for the Degree
DOCTOR OF PHILOSOPHY
(MOLECULAR BIOLOGY)

May 2014

Copyright 2014 Lin Ding

ii

Signature Page

iii

Acknowledgments
It has been a great journey for me!
I would like to thank my mentor Susan Forsburg for her continuous support and
guidance. She encouraged me to think independently yet guided me when I got stuck or
lost focus. She taught me to think outside the box and look at the big picture when I got
trapped by confusing experimental results. She encouraged me to get out of my comfort
zone, and let me know that good scientists don’t just do experiments; rather they do
experiments to find an answer. She is a role model for me. Her enthusiasm and devotion
to science always inspires me.
I would like to thank my current and past committee members: Oscar Aparicio,
Steven Finkel, Mark Thompson, John Tower and Steven Goodman for their time and
helpful advice.
I would also like to thank Oscar Aparicio and Myron Goodman for encouraging
me to attend USC, sharing their equipment, and letting me rotate in their labs. The
knowledge and techniques I learned there have made a solid foundation for my research.
I thank the College Doctoral Fellowship and CBM Training Grant for financial support.
I would like to thank the Forsburg lab. I had a lot of fun working with Angel
Tabancay, Douglas Dalle Luche, Jiping Yuan, Paochen Li, Rebecca Nugent, and Ruben
Petreaca. Each of them contributed a lot to my intellectual development in different
aspects. They not only gave me help to deal with research and personal difficulties, but
also made the lab such a nice place to work. Ruben Petreaca gave me enormous help. He
is a great friend and a big brother to me. Yanji Li, Yedi Sun, Yuan Zhong, Yunxing Mu,

iv

and Pan Wang were always there for me when I needed. I would like to thank all my
friends for their kindness and support in all these years.
Finally, I would like to thank my family for the unconditional love and support. I
cannot get this done without the constant encouragement from my parents.

v

Table of Contents

Signature Page ii

Acknowledgments iii

List of Figures vi

List of Tables ix

Abstract x

Chapter 1: Introduction 1
1.1 Replication Fork Establishment 2
1.2 Replication Fork Impediments 6
1.3 Replication Fork Restart 8

Chapter 2: Schizosaccharomyces pombe Minichromosome Maintenance
Binding Protein (MCM-BP) antagonizes MCM helicase 22
2.1 Introduction 22
2.2 Results 25
2.3 Discussion 55
2.4 Materials and Methods 62

Chapter 3: S. pombe Rad8-mediated PCNA-ubiquitination contributes to
replication fork recovery 72
3.1 Introduction 72
3.2 Results 75
3.3 Discussion 100
2.4 Materials and Methods 106

References 116

Appendix A: SpChk1-P470L, an ortholog of SjChk1-P470L, is not active 142

Appendix B: Anchor Away technique in S. pombe 148

vi

List of Figures
Figure 1.1 Interactions between Mcm2-7 3
Figure 1.2 A simplified model for replisome assembly and activation 5
Figure 1.3 A summary of PCNA posttranslational modifications and their roles 18
Figure 2.1 Analysis of mcb1+/Δmcb1::ura4+ tetrads 26
Figure 2.2 Spore germination of Δmcb1 spores 28
Figure 2.3 Mcb1 expression level in asynchronous cells 29
Figure 2.4 Localization of Mcb1HA 31
Figure 2.5 Fractionation of Mcb1-HA 32
Figure 2.6 Mcb1 localization and its association to MCM 33
Figure 2.7 Cell-cycle effects on levels of Mcb1 35
Figure 2.8 Structure and function analysis of Mcb1 39
Figure 2.9 N-terminal deletion mutants (mcb1D2 and mcb1D22) are
hypomorphic 40
Figure 2.10 Characterization of Mcb1 overexpression (dominant negative)
allele 42
Figure 2.11 Overproducing Mcb1 causes DNA damages 44
Figure 2.12 Mcb1 overproducer cells actively repress nmt promoter 46
Figure 2.13 Chk1 is activated in Mcb1 overproducing cells 48
Figure 2.14 Overproducing Mcb1 causes dissociation of Mcm2 from other
MCM proteins 50
Figure 2.15 Protein level of Mcb1 truncation mutants 52

vii

Figure 2.16 Overproducing Mcb1 causes dissociation of chromatin-bound
MCM proteins 54
Figure 2.17 Model for Mcb1 interaction with MCMs 60
Figure 3.1 Rad8 is required for response to MMS induced damage 77
Figure 3.2 Nuclear localization is necessary but not sufficient for Rad8
function 80
Figure 3.3 The Ring finger is essential for Rad8 damage response 82
Figure 3.4 Rad8 functions in the PRR pathway and may play a role in
recovery from HU exposure 85
Figure 3.5 rad8 genetically interacts with genes involved in homologous
recombination 87
Figure 3.6 Fml1 and Rad8 are functionally redundant 89
Figure 3.7 Rad8 ligase activities may facilitate resection 91
Figure 3.8 Rad8 may contributes to RPA removal 93
Figure 3.9 Rad8 works in parallel with replication checkpoint, and fork
protection complex to maintain fork stability 96
Figure A.1 Schematic representation of Chk1 domain structure 143
Figure A.2 Overproduction of SpChk1-P470L is not toxic to S. pombe 144
Figure A.3 chk1-P470L is a hypomorph of chk1 in S. pombe 145
Figure A.4 Overproduction of Chk1-P470L does not cause cell elongation 146
Figure A.5 Chk1-P470L phosphorylation is abolished 147
Figure B.1 A schematic of anchor-away (AA) system in S. pombe 149

viii

Figure B.2 Rapamycin inactivates RPA-FRB-GFP, and MCM4-FRB-GFP 150
Figure B.3 Rapamycin causes rapid translocation of Rpa1-FRB-GFP 151
Figure B.4 Rapamycin causes rapid translocation Mcm4-FRB-GFP 153

ix

List of Tables

Table 1.1 Common DNA damaging treatments or drugs 8

Table 1.2 Annotated S. pombe ATP-dependent DNA or RNA helicases 10

Table 2.1 Yeast strains used in this study 70

Table 3.1: An analysis of the drug sensitivity of non-essential helicase mutants 99

Table 3.2. An analysis of rad8 genetic interaction with other helicase mutants 100

Table 3.3 Yeast strains used in this study 109

Table 3.4 Plasmids used in this study 115

Table B.1 Yeast strains used in this study 155

Table B.2 Plasmids used in this study 156

x

Abstract

A healthy cell needs to accurately duplicate its genome and pass one copy to each of its
daughter cells. The DNA double helix is accessed by replication machinery once per cell
cycle during S phase and regulated unwinding of this molecule is essential for replication.
However, unwinding can make the DNA vulnerable to damage or breakage. Therefore,
the process of unwinding must be carefully regulated.
The conserved proteins Mcm2-7 form the MCM complex, which is the replicative
helicase responsible for unwinding the DNA duplex during replication. The MCM
complex also plays an important role in replication fork establishment. During S phase,
replication fork stability is challenged by many natural impediments or environmental
stresses, and control of the unwinding is essential to prevent fork collapse and DNA
damage. The focus of my thesis is to gain deeper understanding of how helicase activities
are regulated to preserve replication fork integrity
In chapter 2, I investigate a new factor that regulates the essential replicative
helicase, MCM complex. Mcb1 is the ortholog of human MCM binding protein in S.
pombe, and I found that Mcb1 antagonizes MCM helicase function by disrupting the
association of Mcm2 with other MCM proteins.
In chapter 3, I examined another conserved but non-essential helicase, Rad8. I
investigated whether Rad8’s fork regression helicase domain is involved in replication
fork restart during HU treatment. Using a genetic approach, I demonstrated that the

xi

ubiquitin ligase domain instead of helicase domain is required for Rad8 to promote fork
recovery.____________________________________________________________

1

Chapter 1: Introduction

Faithful transmission of genetic information from one generation to the next is vital for
living organisms. Encoded in guanine (G), adenine (A), thymine (T), and cytosine (C),
genetic information is zipped in a double helix, wrapped around a histone octamer,
assembled into a solenoid structure, and ultimately coiled into a chromosomal matrix and
packaged into the nucleus. Access to the genetic material is highly controlled both
temporally and spatially. In order for the replicative machinery to access the DNA strands,
the double helix has to be unwound and separated into single stranded DNA regions. This
function is carried out by specialized enzymes known as helicases that use the energy of
ATP to open the double helix. Under normal condition, the conserved MCM complex
helps establish the replication fork, and then carries out the unwinding process as the
major replicative helicase. In the presence of lesions or genotoxins, the replication forks
are stalled and the MCM complex is uncoupled from the major replicative machinery.
This leads to an accumulation of single-stranded DNA (ssDNA) in a gap that forms
between the MCM complex and polymerases. In this case, the replication fork needs to
recover from the stalled state to finish DNA synthesis. Specialized helicase activities
contribute to fork recovery and restart.

2

1.1 Replication Fork establishment

1.1.1The MCM proteins
The MCM genes were first identified from a screen in budding yeast that failed to
support the replication of plasmids that carry a single replication origin (Maine et al.,
1984). They were given this name because they are defective in minichromosome
maintenance. Since then, several MCM proteins were identified and it was observed that
they are highly conserved across eukaryotes (reviewed in(Forsburg, 2004)
The MCM proteins belong to the AAA (ATPase associated with various cellular
activities) family of ATPases. The major replicative MCM helicase is composed of
Mcm2-7. Mcm2-7 shares a characteristic ATPase domain called the MCM box, featuring
a Walker A motif (P-loop), a Walker B motif and an Arginine finger (SRF). Mcm4,
Mcm6 and Mcm7 associate with each other with higher affinity and form the “core
complex” that has helicase activity in vitro (Ishimi, 1997; Xu et al., 2013). The core
complex lacks an NLS (nuclear localization sequence) and must associate with Mcm2
which bears two NLSes, to enter the nucleus (Pasion and Forsburg, 1999). Mcm3 which
also has a copy of NLS forms a dimer with Mcm5 and together enter the nucleus, where
the heterohexameric MCM complex is formed through the interaction between the
adjacent Walker A and Arginine finger (Figure 1.1). The MCM complex is loaded onto
the chromatin in late M and early G1 phase through the putative Mcm2/5 gate (Bochman
and Schwacha, 2010). Although in vitro the Mcm4/6/7 core complex is sufficient for
helicase activity in vitro, all the MCM proteins are essential in vivo for DNA replication.

3

Figure 1.1 Interactions between Mcm2-7 (modified from Forsburg, 2004).
Mcm4, Mcm6, and Mcm7 form the core complex (outlined in red). Mcm3 and Mcm5
form a dimer (outlined in blue). Together with Mcm2, they form the heterohexameric
MCM complex through the interaction between P-loop in Walker A motif and SRF motif
in arginine finger. The MCM complex is loaded onto the chromatin via the putative
Mcm2/5 gate.

Several additional MCM family members have been found in metazoa and plants,
including Mcm8 that has all the classic MCM motifs (Gozuacik et al., 2003; Johnson et
al., 2003) and Mcm9 that shares weak homology to Mcm2-7 (Lutzmann et al., 2005;
Yoshida, 2005). Interestingly, MCM10 (cds23
+
in S. pombe) was isolated from the
original screen. However, it shares no homology with other MCM proteins, but it serves
as a scaffold during replication, and plays a role in replication initiation and elongation
(reviewed in Thu and Bielinsky, 2013). Recently, a novel component of the MCM
complex, MCM Binding Protein (MCM-BP), was discovered in human and plant cells

4

(Sakwe et al., 2007; Takahashi et al., 2008; Takahashi et al., 2010). We have found a S.
pombe ortholog of MCM-BP, which will be described in Chapter 2. (Thu and Bielinsky,
2013)

1.1.2 DNA replication
DNA replication is critical to cell division and viability, and therefore requires a
series of tightly coordinated sequential loadings and activation of replication factors
(reviewed in Forsburg, 2004). Replication initiates from regions known as replication
origins. S. cerevisiae has defined replication origins comprised of conserved 11 bp
autonomously replicating sequences (ARS) consensus sequence (ACS) (Bell and
Stillman, 1992; Wyrick et al., 2001). However, similar to metazoa, S. pombe has
replication origins with more degenerate sequences of AT-rich stretches up to 1kb in
length (Dai et al., 2005; Heichinger et al., 2006; Segurado et al., 2003). The replication
origins are recognized by a complex of proteins known as the Origin Recognition
Complex (ORC). In S. pombe, although the replication process occurs in S phase, the
binding of ORC to the replication origins starts during the M phase (Wu and Nurse,
2009). ORC then recruits Cdc18 (ScCdc6) and Cdt1 to the origin (Figure 1.2). In turn,
these recruit the MCM helicase and load it onto the DNA. This results in the formation of
the pre-RC (pre-replicative complex). Interestingly, there are large amounts of remote
MCMs that far exceed the number of replication origins. This is known as the “the MCM
paradox” (Hyrien et al., 2003; Laskey and Madine, 2003). Studies suggest that the
“remote MCMs” are very important for origin distribution, highlight unreplicated regions,

5

or contribute to activate “dormant” origins during replication stress (Blow and Ge, 2009;
Chuang et al., 2010; Edwards et al., 2002; Ge et al., 2007; Woodward et al., 2006).

Figure 1.2 A simplified model for replisome assembly and activation (Courtesy of
Dr. Susan Forsburg).
Assembly of the replisome is a highly ordered process. ORC (Origin recognition complex)
recognizes the replication origin followed by recruitment of Cdc18 and Cdt1. In turn,
they recruit the MCM complex to form preRC (pre-Replicative Complex). Dbf4-
dependent kinase (DDK) and Cyclin-dependent kinase (CDK) activate the origin and
allow sequential recruitment of replication factors, such as Drc1 and Rad4. Cdc45, GINS
and MCM complex formed the IC (initiation complex), which is able to unwind double-
stranded DNA. The exposed single-stranded DNA is coated by RPA (Replication Protein
A). Cdc18 is phosphorylated by CDK and destroyed to prevent re-replication. The
formation of the RPC (Replisome Progression Complex) is completed following the
recruitment of PCNA and polymerases.

The pre-RC is activated by the collective effort of two kinases: CDK (cyclin-
dependent kinase; SpCdc2, ScCdc28, CDK1) and DDK (Dbf4-dependent kinase;
SpHsk1, ScCdc7) (Nishitani and Lygerou, 2002). The CDK phosphorylates SpDrc1
(ScSld2) (Noguchi et al., 2002). SpRad4 (ScDpb11/hTopBP1) binds to phosphorylated
SpDrc1 and recruits Cdc45 and the heterotetrameric GINS (Go, Ichi, Nii, San) complex
(Dolan et al., 2004; Kanemaki and Labib, 2006; Labib and Gambus, 2007), consisting of

6

Sld5, Psf1, Psf2 and Psf3, bind to the MCM complex and forms the IC (initiation
complex or CMG: Cdc45-MCM-GINS (Ilves et al., 2010; Moyer et al., 2006)). Cdc45
seems to function as a limiting factor, and locates at the early and efficient origins
(Aparicio et al., 1997; Edwards et al., 2002; Wu and Nurse, 2009). The CDK
phosphorylates Cdc18 to prevent re-replication (Brown et al., 1997; Jallepalli et al., 1997).
The IC, the active replicative helicase, begins to unwind the DNA helix (Ilves et al., 2010;
Moyer et al., 2006). Finally, the IC then recruits PCNA (processivity factor of
polymerase) and polymerases and other replication-related proteins to form the RPC
(replisome progression complex) or replisome (Gambus et al., 2006). This completes the
establishment of replication forks that travel bidirectionally at each activated origin.

1.2 Replication fork impediments
As replication progresses through S phase, the movement of the replisome can be
impeded by a variety of endogenous or drug-induced stresses. Failure to relieve these
stresses could contribute to genome instability. Replication-associated stresses are
thought to be a primary contributor to cancer (Bartek et al., 2012; Burrell et al., 2013;
Halazonetis et al., 2008).
The endogenous impediments are naturally occurring. They could be protein-
DNA complexes, such as centromeres in S. cerevisiae (Greenfeder and Newlon, 1992), or
transcription active zones such as the tRNA (Deshpande and Newlon, 1996) and rDNA
(Ivessa et al., 2000) regions. They could be programmed replication pausing sites such as
RTS1 (replication termination sequence 1) at the S. pombe mating locus (Dalgaard and

7

Klar, 1999), other non-B forms of double helical DNA structures such as G-quadruplexes,
triplex DNA and DNA hairpins formed by trinucleotide repeat sequences (Voineagu et al.,
2009), or common fragile sites (CFSs) that are poorly defined gap regions in
chromosomes (Pelliccia et al., 2010).
The exogenous impediments are caused by genotoxins or endogenous chemicals
(listed in Table 1.1). They could be ultraviolet (UV) irradiation that generates
cyclobutane pyrimidine dimers (such as thymine dimers) and oxidative base damage
(Kvam and Tyrrell, 1997; Rastogi et al., 2010), or ionizing irradiation (IR) which
produces ROS (reactive oxygen species) that cause double stranded breaks (DSBs
(Dainton, 1948)). They could be DNA-modifying agents. MMS (methyl
methanesulfonate) alkylates guanine (causing mis-basepairing) and adenine (causing
replication blocks) (Beranek, 1990; Lundin et al., 2005). Bleomycin and phleomycin
mimic ionizing radiation (Baber-Furnari et al., 2000; Kostrub et al., 1997; Rhind and
Russell, 2001). Cisplatin, mitomycin C, and nitrogen mustard cause interstrand crosslinks
in DNA (Noll et al., 2006; Scharer, 2005). And topoisomerase poisons, such as CPT,
immobilize topoisomerase I and causes S phase specific one-ended DSBs (Covey et al.,
1989; Wan et al., 1999). Besides these short range DNA damaging drugs/treatments,
there are agents that target the replication fork globally, such as HU (hydroxyurea) that
depletes the deoxynucleoside triphosphates (dNTPs) necessary for DNA synthesis, e.g.
(Enoch et al., 1992) or Aphidicolin that inhibits DNA polymerase α (Krokan et al., 1981).
Interestingly, recent studies suggest that there are dosage dependent phenotypes for the
DNA damaging agents (Hishida et al., 2009; Huang et al., 2013), such that the local

8

damage inducers could have a global effect on replication progression at high dosage.
These genotoxins simulate and amplify some natural occurring impediments, and
therefore providing invaluable tools to study the repair mechanisms under physiological
conditions.

Table 1.1 Common DNA damaging treatments or drugs.

Treatment/Drug Effect
Ultraviolet
irradiation (UV)
generates cyclobutane pyrimidine dimmers and
oxidative base damage
Ionizing
irradiation
(IR)
produces ROS (reactive oxygen species) that
cause double stranded breaks
Methyl methane-
sulfonate (MMS)
alkylates guanine and causes mis-basepairing
alkylates adenine and causes replication blocks
Bleomycin mimics ionizing radiation
Phleomycin mimics ionizing radiation
Cisplatin causes interstrand crosslink in DNA
Mitomycin C
(MMC)
causes interstrand crosslink in DNA
Nitrogen mustard causes interstrand crosslink in DNA
Camptothecin
(CPT)
immobilizes topoisomerase I and causes S phase
specific one-ended DSBs
Hydroxyurea
(HU)
depletes deoxynucleoside triphosphates and leads
to an S-phase arrest
Aphidicolin inhibits DNA polymerase α

1.3 Replication fork restart
A typical mammalian cell encounters up to 100,000 spontaneous DNA lesions daily
(Hoeijmakers, 2009). In replicating cells, these lesions threaten the stability and
progression of the replication forks. Cells utilize many tools to ensure faithful replication.

9

1.3.1 Specialized DNA helicases
DNA Helicases are defined as motor proteins that are able to utilize ATP (Adenosine
triphosphate) hydrolysis to disrupt base pairs between complementary strands. DNA
helicases can be classified by their preferred direction along the strand it interacts with: 3’
to 5’ or 5’ to 3’. Or they can be classified into two larger superfamilies according to their
amino acid sequence homology in the ATPase core domain (SF1 and SF2), and four
smaller superfamilies, SF3-6 (Singleton et al., 2007). There are an estimated 31 DNA
helicases encoded in the human genome (Umate et al., 2011). Many of them have roles in
DNA repair (reviewed in Brosh, 2013). In S. pombe, there are 34 annotated helicases (23
non-essential and 11 essential genes which include the 6 MCM proteins). Most S. pombe
DNA helicases have human orthologs (Table 1.2). While the replicative helicase MCM
complex is heterohexameric and falls into superfamily 6, most helicases work as
monomers, with the N-terminal portion providing Walker A and Walker B domains, and
C-terminal portion providing the Arginine finger (Fairman-Williams et al., 2010). The
ATP-binding sequence in the Walker A motif contains a conserved 3 amino acid motif:
glycine-lysine-threonine (GKT) (Tuteja and Tuteja, 2004). The lysine and threonine
residues are important for the ATP binding activity through the phosphatyl group or the
Mg
2+
ion, respectively (Rocak and Linder, 2004; Walker et al., 1982). Mutation of the
conserved lysine or both lysine and threonine appeared to abolish all ATP-binding and
hydrolytic activity of the ATPases (Nandi and Whitby, 2012; Pause and Sonenberg,
1992). (Brosh, 2013)

10

Some well-conserved helicases can actually tolerate these mutations, leading to
the conclusion that they do not actually function in ATP hydrolysis. For example, the
Forsburg lab found examples of this with MCM helicase mutants (Gómez et al., 2002),
finding that Mcm6 in particular can tolerate these changes. This was discussed in detail in
the Forsburg 2004 review, and is probably a feature of the heterohexamer where not all
the subunits are equally involved in hydrolysis (Bochman and Schwacha, 2010).
Table 1.2 Annotated S. pombe ATP-dependent DNA or RNA helicases

Non-essential DNA helicase
Name Human
orthologs
S. cerevisiae
ortholog
Direction
SPAC144.05 SHPRH Irc20
SPBC582.10C Rad16
SPBC15C4.05# DHX29
SPBC3B8.12*
(SPBC11C11.11c)
Irc3
SPAC694.02* DDX60,
hDDX60L

SPCC737.07c IGHMBP2 Hcs1
Chl1 FANCJ Chl1 5’-3’
Fbh1 FBXO18 3’-5’
Fml1 FANCM Mph1 3’-5’
Fml2 FANCM Mph1 3’-5’
Hrp1 CHD1, 2 Chd1
Hrp3 CHD1, 2 Chd1
Rad8 HLTF, SHPRH
Rdh54 RAD54B Rdh54
Rhp54 RAD54L Rad54
Rhp55 RAD51B Rad55
Rhp57 XRCC3 Rad57
Rhp26 XRCC3 Rad26
Rqh1 WRN, BLM Sgs1 3’-5’
Rrp1 TTF2 Uls1
Rrp2 HLTF Uls1
Snf22 SMARCA4 Sth1, Snf2
Srs2 Srs2 3’-5’
Swr1 EP400, hSRCAP Swr1

11

Tlh1 NA
Tlh2 NA

Essential DNA helicase
Name Human
orthologs
S. cerevisiae
ortholog
Direction
Dna2 DNA2 Dna2 5’-3’
Ino80 INO80 Ino80 3’-5’
Hrq1 RECQL4 3’-5’
Pfh1 PIF1 Pif1, Rrm3 5’-3’
Snf21 SMARCA4 Sth1, Snf2
Mcm2 MCM2 Mcm2
Mcm3 MCM3 Mcm3
Mcm4 MCM4 Mcm4
Mcm5 MCM5 Mcm5
Mcm6 MCM6 Mcm6
Mcm7 MCM7 Mcm7

# RNA/DNA helicase
* RNA helicase

Many helicases contribute to replication fork stability and ensure accurate genome
duplication by overcoming natural impediments and targeting homologous recombination
intermediates. In S. cerevisiae, the Rrm3 (SpPif1) helicase moves along with the
replication forks by interacting with DNA polymerase epsilon (Azvolinsky et al., 2006)
and facilitate its progress through tRNAs and chromatin complexes (Ivessa et al., 2003).
It also collaborates with Srs2 (SpSrs2) and Sgs1 (SpRqh1) to mediate the resolution of
recombination intermediates in rDNA, a highly repetitive region. S. pombe has only one
Rrm3 related helicase, Pfh1. It facilitates replication through telomeric regions and
mitochondrial DNA (Bochman et al., 2010). In S. pombe, Srs2 and Fbh1 work together to
counteract Rad51-mediated recombination at blocked forks (Lorenz et al., 2009). Two

12

helicases, ScRad5 (SpRad8) and ScMph1 (SpFml1, SpFml2) facilitate replication fork
reversal in vitro (LiefshitzBlastyak et al., 2007; Nandi and Whitby, 2012; Sun et al., 2008;
Zheng et al., 2011), to promote error free repair and restart.

1.3.2 The replication fork protection complex
The replisome is a large protein complex with more than 20 replication-related proteins
(Gambus et al., 2006). The fork protection complex (FPC), as its name suggested, plays a
very important role in maintaining fork integrity. The FPC consists of Swi1 (ScTof1/
hTimeless), Swi3 (ScCsm3/hTipin), and Mrc1 (ScMrc1/hClaspin) (Katou et al., 2003;
Noguchi et al., 2003) (Noguchi et al., 2004; Tanaka et al., 2010). Swi1 associates with
chromatin through its DDR domain and recruits Swi3 (Noguchi et al., 2012) and together
they facilitate Mrc1 chromatin association (Tanaka et al., 2010). In the absence of
Swi1/Swi3, S. pombe cells accumulate Holliday junction-like structures and Rad52 DNA
repair foci during S phase (Noguchi et al., 2004). In S. cerevisiae, Tof1 and Csm3 are
required for maintaining replication fork integrity during pausing at rDNA loci (Mohanty
et al., 2006). Tof1 is also required for fork pausing at tRNAs and centromeres (Hodgson
et al., 2007). Swi1 and Mrc1 directly interact with the MCM-Cdc45 helicase in S.
cerevisiae (Katou et al., 2003), and Xenopus egg extracts (Errico et al., 2007). In S.
cerevisiae, Mrc1 is required for replication fork progression under normal conditions
(Szyjka et al., 2005). In S. pombe, the Mrc1 fork protection function is involved in
maintaining the normal replication program of early firing origins (Hayano et al., 2011).
In fission yeast, the origins in the centromeres fire early (Hayashi et al., 2007; Heichinger

13

et al., 2006; Kim et al., 2003; Xu et al., 2012). Interestingly, Mrc1 was also found to
contribute to centromere integrity (Li et al., 2013). In addition to the fork protection
function, Mrc1 is also a checkpoint mediator that is essential for Rad3-dependent
phosphorylation of the Cds1 (ScRad53, hChk2) kinase in S. pombe (Xu et al., 2006), and
is required for Rad53-independent Mec1 accumulation at the stalled forks in S. cerevisiae
(Naylor et al., 2009).

1.3.3 Single-strand DNA binding protein
In order for replication to occur, single-stranded DNA (ssDNA) needs to be
exposed to the DNA polymerases. Naked ssDNA is vulnerable to damage. To protect
ssDNA from damage, cells utilize single-strand binding protein, RPA (Replication
Protein A). RPA is a heterotrimeric protein complex consisting of RPA1, RPA2, and
RPA3 (Wold, 1997). It binds ssDNA with high affinity, and physically interacts with
replication fork components (Nakaya et al., 2010).
In addition to the role in replication and DNA checkpoint activation, RPA is also
involved in repair of double strand breaks (DSBs), the most deleterious lesion. DSBs are
recognized by the MRN (Mre11-Rad50-Nbs1) and CtIP (SpCtp1/ScSae) complex which
resects short stretches of DNA (Limbo et al., 2007). This recruits Exo1 which is more
processive and can extend the stretch of ssDNA up to several kilobases (Mimitou and
Symington, 2008). RPA coordinates 3’ resection by preventing degradation or hairpin
formation (Chen et al., 2013a). The 3’ end of ssDNA can be processed through Rad51-
mediated HR. Rad51 is required for homology search and strand invasion, a function that

14

RPA cannot perform. Beside the function in DSB repair, MRN also functions in
stabilizing replication forks. MRN is associated with chromatin and colocalized with
PCNA throughout S phase (Mirzoeva and Petrini, 2003). It is also colocalized with RPA
at the stalled replication forks at a higher level (Robison et al., 2004). Moreover, MRN
genetically interacts with the replisome components in a checkpoint-independent way and
works with SCC (sister chromatid cohesion) to maintain fork integrity (Tittel-Elmer et al.,
2009).
RPA also mediates the postreplication repair (PRR) pathway by directly
interacting with Rad18, the ubiquitin E3 ligase that is responsible for the mono-
ubiquitination of PCNA (Davies et al., 2008). RPA itself is a target of checkpoint kinases
under genotoxic stress (Brush and Kelly, 2000).

1.3.4 DNA integrity Checkpoints
When fork stalling or DNA lesions reach a certain threshold, the abnormal structure will
transmit a signal to activate the DNA integrity checkpoints including replication (intra-S
phase, S/M) checkpoint or DNA damage (G2) checkpoint. The checkpoint transduces a
cascade of phosphorylation events. Ultimately, cell cycle progression is delayed to allow
replication fork restart or damage repair. Both checkpoints are dependent on ATRIP
(SpRad26, ScDdc2) that senses the accumulation of RPA-ssDNA complexes and recruits
ATR (SpRad3, ScMec1). ATR autophosphorylation is promoted by multiple loading of
ATRIP-ATR complex (Liu et al., 2011b). This is followed by loading of a PCNA-like
heterotrimeric checkpoint clamp (Rad1-Rad9-Hus1, 9-1-1 complex) at the junctions of

15

single-stranded to double-stranded DNA (Caspari and Carr, 1999) by the pentameric
checkpoint clamp loader (Rad17-RFC2-5) (Majka et al., 2006).
In S phase, replication stress is transmitted through the mediator protein Mrc1
(Tanaka and Russell, 2001). The phosphorylated Rad3 consensus sites in Mrc1 interact
with the FHA domain of effector kinase Cds1. This interaction brings Cds1 into
proximity with Rad3 for initial phosphorylation. The primed Cds1 is activated by
dimerization and autophosphorylation (Xu et al., 2006). The activated Cds1 stabilizes
replication forks by phosphorylating Mcm4 (Bailis et al., 2008), and delays S phase
progression by inhibiting late origin firing through phosphorylation of Hsk1 (Cdc7)
(Snaith et al., 2000; Takeda et al., 2001). Cds1 phosphorylates and dissociates Mus81, a
structure specific endonuclease, from chromatin to prevent cleavage of stalled replication
forks (Boddy et al., 2000; Kai et al., 2005). If all these measures fail to restart the stalled
fork, Cds1 eventually will phosphorylate Cdc25, a phosphatase, to inactivate Cdc2 kinase
and delay the mitotic entry. This allows time for other mechanisms to restart forks or
arrest the cell cycle progression permanently.
In response to DNA lesions in G2 phase, S. pombe activates the DNA damage
checkpoint through Chk1 and its mediator Crb2. Rad3 phosphorylates subunits of the 9-
1-1 clamp, which recruit Rad4 (ScDpb11, hTopBP1) through Rad9 (Furuya et al., 2004;
Lee et al., 2007). This association is required for Chk1 damage checkpoint but not the
Cds1 replication checkpoint (Taricani and Wang, 2006). Crb2 (ScRad9, h53BP1)
interacts with Rad3 phosphorylated Rad4 (ScRad9, h53BP1) (Mochida et al., 2004; Saka
et al., 1997; Siam et al., 2007), and recruits Chk1 to the proximity of Rad3. This allows

16

Rad3 to activate Chk1 by phosphorylation at Serine 345 (Lopez-Girona et al., 2001). The
activated Chk1 dissociates from the complex and arrests the cell cycle in G2 to prevent
premature mitosis. In vertebrates, Chk1 activation does not require 53BP1, but rather
Claspin (Mrc1) is involved (Kumagai et al., 2004). In the presence of DSBs, histone H2A
is phosphorylated by Rad3. The phos-H2A recruits Crb2 and promotes its dimerization
(Du et al., 2004; Nakamura et al., 2004).

1.3.5 Homologous recombination
Homologous recombination (HR) is a conserved mechanism that promotes exchange of
genetic information between DNA molecules. The molecular components of HR have
been intensively characterized in the context of repairing double-strand breaks (DSBs)
(reviewed in(Mimitou and Symington, 2009). The repair processes is homology-directed
DNA repair (HDR), including double Holliday Junction (dHJ), synthesis-dependent
strand annealing (SDSA), and break-induced replication (BIR) (Hastings et al., 2009b).
The first two models repair two-ended DSBs, while the last one repairs one-ended DSBs
generated by collapsed or broken replication forks. All these processes start from
generating or processing 3’ ssDNA. RPA coats the ssDNA tails and Rad52 mediates the
exchange of an RPA-ssDNA filament to a Rad51-ssDNA filament (Sugiyama and
Kowalczykowski, 2002). Rad55 and Rad57, paralogs of Rad51, form a heterodimer that
functions with RPA to promote DNA strand exchange and stabilize Rad51 (Liu et al.,
2011a; Sung, 1997). Swi5 and Sfr1 are other mediators that promote and stabilize the
Rad51 filament (Akamatsu et al., 2007; Haruta et al., 2006). The Rad51-ssDNA

17

nucleofilaments act in concert with Rad54 to perform a homology search by invading
intact double stranded DNA and creating D-loop intermediates. These can be resolved as
dHJ, SDSA or BIR (Ceballos and Heyer, 2011). dHJ can be resolved to create crossover
(CO) or non-crossover (NCO) products. The SDSA and BIR give non-crossover.
The classic idea of prolonged replication stalling generating DSBs that can be
repaired by HR, has been challenged by recent studies that HR mediated fork restart does
not work through a DSB (Lambert et al., 2010; Mizuno et al., 2009).
It may be worth pointing out at this point that there are non-HR mediated repair
mechanisms that depend on microhomology, such as Fork Stalling and template
switching (FoSTeS) and microhomology-mediated BIR (MMBIR) (reviewed in (Hastings
et al., 2009a; Hastings et al., 2009b). Both models start with a 3’ end due to fork collapse.
In FoSTeS, an exposed ssDNA region in the lagging strand may form a secondary
structure that blocks the fork progression. As a result, the 3’ of the daughter strand may
be released and anneal to the single stranded template sequence on another fork that
shares microhomology. In MMBIR, the 3’ tail of the one-ended break may anneal to any
exposed ssDNA that shares microhomology without the need of Rad51. We can imagine,
these two mechanisms are sources for many rearrangements.

1.3.6 Post-replication repair pathways
Damaged DNA can be repaired in many ways. Base excision repair (BER) and nucleotide
excision repair (NER) are used in G1 phase to remove the lesion from the DNA. BER
processes DNA damage caused by oxidative stress, hydrolysis, deamination, or chemical

18

damage, such as MMS. NER primarily deals with damage caused by UV irradiation.
Unrepaired damage or lesions arising during S phase are prone to cause replication fork
stalling. To overcome this challenge, cells will initiate the post-replication repair pathway
(PRR). These pathways work to bypass or tolerate damage during S phase, and allow
repair after the completion of DNA synthesis. PRR consists of two sub-pathways: error-
prone and error-free PRR, both of which work through modification of PCNA.
PCNA is the processivity factor of DNA polymerases, and plays an indispensable
role in DNA replication. Remarkably, its posttranslational modification is also central to
determining which sub-pathways of PRR to initiate (Summarized in Figure 1.4).

Figure 1.3 A summary of PCNA posttranslational modifications and their roles.
S. pombe PCNA (Pcn1) can be posttranslationally modified at two lysine (K) residues
(K107 and K164). Different modification channels repair to different pathways.

19

PCNA can be ubiquitinated or sumoylated (reviewed in(Chen et al., 2011; Das-
Bradoo et al., 2010a). Ubiquitination occurs at lysine 164 (K164) by the action of Rad6
(SpRhp6, E2 conjugation enzyme) and Rhp18 (SpRhp18, E3 ubiquitin ligase). Rad18 is
recruited to the stalled fork first, since Rad18 is capable of binding ssDNA or fork
structures in vitro (Bailly et al., 1997; Tsuji et al., 2008). PCNA monoubiquitination leads
to a polymerase switch from the highly processive and accurate polymerases to the non-
essential low fidelity polymerases which carry the replication machinery over the
damaged template. Hence they are named translesion synthesis (TLS) polymerases
(Johnson et al., 1999; Nelson et al., 1996; Prakash et al., 2005b). There are 5 specialized
polymerases in humans (reviewed in(Sharma et al., 2012). Four of them are Y family
members: Polη (Eta), Polι (Iota), Polκ (Kappa), and Rev1 and one is a B family member:
Polξ (Rev3 as catalytic subunit, Rev7 as the accessory factor). Polι is missing from the S.
pombe genome. Polι and Polκ are both missing from the S. cerevisiae genome. After
random incorporation of a few bases, the normal polymerases will be switched back after
de-ubiquitinating enzyme (DUB), such as Ubp10, remove ubiquitin (Gallego-Sanchez et
al., 2012). This completes the error-prone PRR.
Monoubiquitinated PCNA can be further ubiquitinated by Ubc13/Mms2 (E2
heterodimer) and ScRad5 (E3 ligase) to form lysine 63-linked ubiquitin chain. This leads
to error-free PRR, in which S. cerevisiae ScRad5 helicase activity is required for
regressing the stalled replication forks to bypass the lesion, hence allowing the replication
machinery to use the lesion free nascent strand as template (LiefshitzBlastyak et al.,
2007).

20

Surprisingly, the presence of ScRad5, but not its enzymatic activities is needed for
Polξ-dependent TLS in S. cerevisiae (Pages et al., 2008). The S. pombe ortholog Rad8
functions to polyubiquitinate PCNA on lysine 164 to recruit and stimulate TLS in S.
pombe (Coulon et al., 2010). In mammals, TLS polymerases can be recruited to DNA
damage in the absence of PCNA-ub (Hendel et al., 2011). This suggests complexity of
the conserved yet diverged PRR across eukaryotes.
PCNA has more than one lysine residue. It can be ubiquitinated in a Rad18-
independent way at lysine 107 (K107) triggered by accumulation of nicks created by
unligated Okazaki fragments (Das-Bradoo et al., 2010b; Nguyen et al., 2013) in S.
cerevisiae. Cells that lack PCNA ubiquitination at K107 are unable to activate the Rad53
response in DNA ligase I-deficient cells. The PCNA ubiquitin chain can be extended
through lysine 29 (K29) on the ubiquitin, but it is not required for checkpoint activation.
It might actually promote PCNA degradation (Mastrandrea et al., 1999; Peng et al., 2003).
Interestingly, the ubiquitination is carried out by the action of Mms2/Ubc4 (E2) and
ScRad5 (E3) (Das-Bradoo et al., 2010b).
PCNA modification is not limited to ubiquitination. It can also be sumoylated by
Ubc9 (SpHus5, sumo-specific E2) and Siz1 (SpPil1, sumo-specific E3) primarily on
lysine 164 and to a lesser extent on lysine 127 in S. cerevisiae (Branzei et al., 2004;
Hoege et al., 2002; Papouli et al., 2005; Windecker and Ulrich, 2008). Sumoylation
suppresses recombination at the replication forks by recruiting Srs2 to antagonize Rad51
filaments to present unwanted crossover events (Le Breton et al., 2008; Papouli et al.,
2005; Pfander et al., 2005; Veaute et al., 2003).

21

In this dissertation I tried to understand how essential and non-essential helicases
maintain S. pombe genome stability. I started looking at how the essential replicative
helicase, MCM complex, is regulated by a novel factor, Mcb1. I found that Mcb1
antagonizes MCM helicase function by affecting the accessibility of MCM complex to
the chromatin through disrupting the association of Mcm2 with other MCM proteins.
This work will be presented in Chapter 2. Next, I investigated whether fork regression,
carried out by a non-essential helicase, Rad8, contributes to replication fork restart.
Surprisingly, my results suggest that the ubiquitin ligase domain is the essential function
of Rad8 in response to replication stress. This will be presented in Chapter 3.

22

Chapter 2
Schizosaccharomyces pombe MCM binding protein (MCM-BP) antagonizes MCM
helicase
Lin Ding and Susan L Forsburg. Journal of Biological Chemistry. 2011, 286:32918-
32930 (Ding and Forsburg, 2011)

The Mini-Chromosome Maintenance (MCM) complex, a replicative helicase, is a
heterohexamer essential for DNA duplication and genome stability. We have identified S.
pombe mcb1
+
(Mcm binding protein 1), an apparent orthologue of the human MCM-BP
which associates with a subset of MCM complex proteins. mcb1
+
is an essential gene.
Deletion of mcb1
+
causes cell cycle arrest after several generations with a cdc phenotype
and disrupted nuclear structure. Mcb1 is an abundant protein, constitutively present
across the cell cycle. It is widely distributed in cytoplasm, nucleoplasm and also bound to
chromatin. Co-immunoprecipitation suggests Mcb1 interacts robustly with Mcm3-7 but
not Mcm2. Overproducing Mcb1 disrupts the association of Mcm2 with other MCM
proteins, resulting in inhibition of DNA replication, DNA damage, and activation of the
checkpoint kinase Chk1. Thus, Mcb1 appears to antagonize the function of MCM
helicase.

2.1 Introduction
DNA replication requires a series of tightly coordinated events to ensure that each
daughter cell receives one complete copy of genetic information (Kelly et al., 1993b;

23

Masai et al., 2010). In response to damage, generated by mutations in the replication
machinery or by exogenous damaging agents, eukaryotic cells activate checkpoint
responses that arrest S phase progression and activate DNA repair (Branzei and Foiani,
2008; Hartwell and Weinert, 1989). Defects either in replication or the checkpoint
responses generate genome instability and increase cancer susceptibility (Hartwell et al.,
1994; Jackson and Bartek, 2009).
The MCM (Mini-Chromosome Maintenance) complex is a replicative helicase
conserved in eukaryotes and archaea (reviewed in(Bochman and Schwacha, 2009;
Forsburg, 2004). The complex consists of six distinct yet structurally related subunits,
Mcm2-7, assembled into a heterohexameric ring. MCM proteins are members of the
AAA+ ATPase family sharing several distinctive protein sequences that define the family.
In metazoa and plants, there are several additional MCM family members, Mcm8 and
Mcm9 (Gozuacik et al., 2003; Lutzmann et al., 2005; Shultz et al., 2007; Yoshida, 2005),
as well as developmentally specific versions of the MCMs (Sible et al., 1998), all of
which contain the characteristic MCM-specific protein sequence motifs. The fission yeast
genome encodes just the six core MCMs, which assemble into a complex that is
constitutively located in the nucleus throughout cell cycle (Adachi et al., 1997; Pasion
and Forsburg, 1999; Sherman and Forsburg, 1998; Sherman et al., 1998). In late M and
early G1 phases, the MCM complex is recruited onto chromatin, as part of the preRC
(pre-Replication Complex) and also on unreplicated DNA; this chromatin localization is
dislodged as replication proceeds (Kearsey et al., 2000). MCM proteins are abundant and
exceed the number of replication origins (Hyrien et al., 2003; Laskey and Madine, 2003;

24

Lei et al., 1996). Each of the six MCM proteins is essential for viability, with a similar
deletion phenotype (Coxon et al., 1992; Forsburg and Nurse, 1994; Liang and Forsburg,
2001; Liang et al., 1999; Miyake et al., 1993; Sherman and Forsburg, 1998; Takahashi et
al., 1994). Reduction of MCM protein levels causes genome instability in fission yeast,
due to replication fork collapse and DNA damage (Bailis et al., 2008; Liang et al., 1999).
A novel component of the human MCM complex was discovered in human cells
using tandem affinity purification (Sakwe et al., 2007). Human MCM Binding Protein
(hMCM-BP) shares no homology to MCM proteins or AAA ATPases. Biochemical
analysis suggests that MCM-BP replaces Mcm2 and forms an “alternative” MCM
complex with Mcm3-7. Similar to the MCM proteins, hMCM-BP localizes primarily in
the nucleus and associates with chromatin in most of the cell cycle except early M phase.
Recently, a hMCM-BP orthologue, ETG1, was isolated from plants (Takahashi et al.,
2008; Takahashi et al., 2010). Depletion of ETG1 activates a G2 cell cycle checkpoint,
resulting in a late G2 cell arrest, and also plays a role in establishing cohesion.
Interestingly, hMCM-BP orthologues were found in fruit flies, frogs, zebra fish, and two
fission yeasts, but not in budding yeast.
Here, we report the identification and characterization of the hMCM-BP ortholog
in S. pombe, mcb1
+
(Mcm binding protein 1). We show that mcb1
+
encodes an essential
gene. Spores lacking mcb1
+
arrest after several divisions with a G2 DNA content and a
cdc phenotype, similar to MCM deletion mutants. We epitope tagged Mcb1 and show
that Mcb1 is an abundant protein constitutively expressed through the cell cycle. Mcb1 is
distributed in all cellular compartments including a substantial chromatin-bound fraction.

25

Mcb1 associates robustly with Mcm3-7, but not Mcm2. Overproduction of Mcb1 (OP-
Mcb1) is toxic to cells, creating a dominant negative phenotype that resembles the
initiation defect observed in cdc18-shutoff cells. OP-Mcb1 cells accumulate Rad22 foci
and activate Chk1 kinase, indicating DNA damage has occurred. Mutant analysis
indicates that only the full length and Mcb1 and a truncated form lacking the N-terminus
are capable of dissociating Mcm2 from other MCMs. Our data suggest that high levels of
Mcb1 inhibit Mcm2 from interacting with other MCM proteins, and disrupt normal
MCM function during replication initiation. We propose that Mcb1 contributes to MCM
regulation, possibly by controlling the accessibility of MCM complex to chromatin.

2.2 Results
2.2.1 Identification and deletion of S. pombe mcb1
+

Human MCM binding protein (hMCM-BP) was first identified as a novel component of
Minichromosome Maintenance Complex (MCM) (Sakwe et al., 2007). Although there is
no obvious Saccharomyces cerevisiae orthologue (See Yeast Orthology Table Version
2.15), we found a putative orthologue of hMCM-BP gene in Schizosaccharomyces pombe,
SPAC1687.04, and named it mcb1
+
for MCM binding protein 1. The mcb1
+
gene is
highly conserved in eukaryotes. It has two exons and one intron, and encodes a protein
with 501 amino acid and a predicted molecular weight of 56.6 kD. Similar to the hMCM-
BP protein, Mcb1p has no obvious sequence motifs, and shares no obvious homology
with S. pombe MCMs or AAA+ ATPases.

26

We created a heterozygous diploid mcb1
+
/Δmcb1::ura4
+
. for tetrad analysis. All
tetrads displayed a 2:2 segregation of viable:inviable spores, and all viable colonies were
Ura- (Figure S3A). The inviable colonies were Δmcb1::ura4
+
spores, which managed to
complete a few cell divisions and form micro-colonies of 8-16 cells (Figure 2.1). Ectopic
expression of mcb1
+
under its own promoter from a plasmid was able to rescue the
lethality in spores, confirming the phenotype arises from disruption of this gene (data not
shown).

Figure 2.1 Analysis of mcb1+/Δmcb1::ura4+ tetrads.
(A) Heterozygous diploids: mcb1+/Δmcb1::ura4+ (FY3747) were sporulated and
dissected on YES plate. The spores were allowed to grow at 32°C for 3 days, and replica-
plated onto solid media lacking uracil. The plates were scanned 3 days after incubation at
32°C.

27

(B) Δmcb1::ura4+ spores form micro-colonies on YES plate. Four inviable spores were
visualized under the light microscope.

We analyzed a population of Δmcb1 spores by a bulk spore germination assay
using Δmcb1::ura4
+
/ mcb1
+
diploid cells and wild-type ura4
+
/ ura4-D18 diploid cells as
a control. The spores were inoculated into liquid media lacking uracil, which ensures that
only the Δmcb1::ura4
+
or ura4
+
spores can germinate. In contrast to Δmcm spores
(Forsburg and Nurse, 1994; Liang and Forsburg, 2001), Δmcb1::ura4
+
spores show no
obvious delays in their first S phase compared to the wild-type (Figure 2A). However,
similar to Δmcm spores, the terminal phenotype of germinated Δmcb1::ura4
+
spores was
an elongated cdc morphology, and in most cases, a single nucleus. About 10% of cells
have an abnormally shaped nucleus, either tear-drop shaped or cut (Figure 2B 16h). Thus,
mcb1
+
is an essential gene.

28

Figure 2.2 Spore germination of Δmcb1 spores.
(A) Spores prepared from wild-type ura4
+
/ura4D-18 (FY261x11) and heterozygous
disruption mutant mcb1
+
/Δmcb1::ura4
+
(FY3747) were inoculated into medium lacking
uracil at 32°C. The populations were sampled every 2 hours for 16 hours, and analyzed
by flow cytometry to monitor S phase entry and DNA replication progression.
(B) Photomicrographs of DAPI-stained spores after 12, 14 and 16 hours at 32°C.
Arrowheads indicate cells with abnormal nucleus. Arrow indicates cells with normal
nucleus. Scale Bar: 10 µm.

29

2.2.2 Characterization of Mcb1 protein
In fission yeast, MCM proteins are localized in the nucleus throughout the cell cycle by
nuclear localization sequences on Mcm2 and Mcm3 (Pasion and Forsburg, 1999). Human
MCM-BP is also a nuclear protein (Sakwe et al., 2007). We constructed a C-terminally
HA tagged Mcb1 (mcb1HA) to replace the wild-type copy in the genome. Mcb1HA cells
showed normal growth, indicating that the tagged copy is functional. When compared to
a strain expressing Mcm2HA, we observed that Mcb1HA is expressed at higher level,
indicating that it is a very abundant protein (Figure 2.3).

Figure 2.3 Mcb1 expression level in asynchronous cells.
Equal amount (40μg) of total cell lysates generated from asynchronous mcb1HA (FY4041)
and mcm2HA (FY2558) cells, were separated by 8% SDS-PAGE gel, and blotted for
Mcb1-HA, and PCNA (a loading control).

Because human MCM-BP is chromatin-associated (Sakwe et al., 2007), we
examined Mcb1HA localization by immunofluorescence, using a mcb1HA mcm2V5
strain, for in situ chromatin binding assay (Figure 2.4). Consistent with previous studies
(Namdar and Kearsey, 2006; Pasion and Forsburg, 1999) Mcm2V5 stays in the nucleus

30

(Figure 2.4A), and remains chromatin-bound in bi-nucleated (S phase) cells (Figure 2.4B).
However, we were unable to detect Mcb1HA cytologically (Figure 2.4), suggesting that
the epitope tag is inaccessible or occluded. Similar results were observed for N-
terminally HA tagged Mcb1 (HAmcb1; data not shown). We also tagged Mcb1 with GFP
and mCherry at the C terminus. Although these tags were easily detected on Western
blots, we were not able to detect any fluorescence in live cells (data not shown).

31

Figure 2.4 Localization of Mcb1HA.
mcb1HA mcm2V5 (FY4122) and un-tagged (FY11) cells were grown asynchronously and
harvested for an in situ chromatin binding assay. Mcb1HA and Mcm2V5 localization was
detected in untreated cell (A) and Triton-treated (B).

32

Therefore, we took a biochemical approach to examine localization and
performed a cell fractionation assay. Asynchronous cells were treated to release different
cellular compartments in subsequent fractions (Figure 2.5). Equal volumes of each
fraction were separated by SDS-PAGE gel and blotted for Mcm2V5, Mcm7, and
Mcb1HA (Figure 2.6). Fib1 (Nop1) is involved in pre-rRNA processing, and is a marker
for the chromatin fraction, while alpha-tubulin is a predominantly but not exclusively
cytoplasmic (Matsuyama et al., 2006; Radcliffe et al., 1998). Consistent with previous
studies, Mcm2V5 and Mcm7 are nuclear proteins. Mcm2V5 is mainly in the nucleoplasm,
whilst the majority of Mcm7 is chromatin-bound. In contrast, Mcb1HA is present
throughout the cells, but strongly enriched in the nuclear fractions.

Figure 2.5 Fractionation of Mcb1-HA.
(A) A schematic of cell fractionation assay. Cells were permeabilized with Zymolyase,
resuspended in Ficoll Buffer and lysed with glass beads. Total lysate was separated from
debris after a slow-speed centrifugation, and further separated to Cytoplasm and Whole

33

Nuclei after high-speed centrifugation. The Whole Nuclei fraction was treated with high
concentration of detergent, and separated to the Nucleoplasm and Chromatin fractions.
(B) A Coomassie staining of the membrane. A loading control.

Figure 2.6 Mcb1 localization and its association to MCM.
(A) Cellular fractions were prepared from mcb1HA mcm2V5 (FY4122) according to
Figure 2A. Equal volume (10 µl) of each fraction was separated by 8% or 15% SDS-
PAGE gel, and immunoblotted for Mcb1-HA, Mcm2-V5, Mcm7, alpha-tubulin (marker
for cytosol and nucleoplasm), and Fib1 (~Nop1; marker for chromatin).
(B) Mcb1 interacts with all other MCM proteins except Mcm2. Lysate was prepared from
asynchronous mcb1HA mcm2V5 (FY4122) cells with B88 buffer. Twenty micrograms
soluble protein was loaded as input (Lane 1). Identical amounts of lysate were pre-cleared
and immunoprecipitated with the antibodies shown. Ten microliters of
immunoprecipitated sample (1/7 v:v) was used for each immunoblot. Samples were
separated by 8% SDS-PAGE gels. Soluble lysate was immunoprecipitated with no
antibody, anti-HA, anti-V5, anti-Mcm4, and anti-Mcm7, and immunoblotted for Mcm2-
V5, Mcb1-HA, Mcm4, Mcm6, Mcm7, Mcm3, or Mcm5.

The levels of mcm2
+
mRNA (Forsburg and Nurse, 1994; Rustici et al., 2004) and
protein level (Forsburg et al., 1997) are constant throughout cell cycle. Studies suggest all
MCM subunit levels are comparable (Namdar and Kearsey, 2006; Sherman et al., 1998).

34

To investigate whether levels of Mcb1 protein level fluctuate in the cell cycle, we used a
cdc25-22 mcb1HA mcm2V5 strain to synchronize and release the cells by controlling
temperature. We observed no cell cycle-dependent change in total protein level or
mobility (Figure 2.7). Mcb1HA migrated as a doublet in this experiment, but that was not
apparent in soluble lysate (Figure 2.6, lane 1).

35

36

Figure 2.7 Cell-cycle effects on levels of Mcb1.
(A) Cell cultures FY4090 (cdc25-22 mcb1HA), and FY4092 (cdc25-22 mcm2HA) were
synchronized at G2 phase (t=0’), and released for 4 hours (t=240’). Forty micrograms of
total protein for each strain at each time point was separated by 10% SDS-PAGE gel and
immunoblotted for Mcb1HA, Mcm2HA, and PCNA (a loading control).
(B) cdc25-22 mcb1HA mcm2V5 (FY4238) cells were grown asynchronously to early
exponential phase at permissive temperature 25°C, arrested at by shifting to restrictive
temperature of 36°C for 4 hours, and released to 25°C at time = 0. Aliquots were
harvested every 15 minutes up to 255 minutes, ethanol-fixed and analyzed by flow
cytometry. DNA profile of this time course is shown here.
(C) Level of Mcb1 in synchronized cells. Aliquots were harvested every 15 minutes and
monitored for septation index, and percentage of bi-nucleate cells. Total cell extracts
were prepared for each timepoint. Twenty micrograms of lysate from each sample was
loaded on 8% SDS-PAGE gels for separation, and immunoblotted for Mcb1HA,
Mcm2V5, and PCNA (a loading control).

2.2.3 Mcb1 complex formation
The six MCM subunits form a heterohexameric protein complex (reviewed in(Bochman
and Schwacha, 2009; Forsburg, 2004). The relative affinities among members vary
(Adachi et al., 1997; Lee and Hurwitz, 2000; Liang and Forsburg, 2001; Sherman et al.,
1998), suggesting that there are several sub-complexes: Mcm3 and Mcm5 form a dimer;
Mcm4, 6, and 7 form a high-affinity core complex; and Mcm2 connects the two sub-
complexes (Pasion and Forsburg, 1999). This is consistent with observations of MCM
organization in other systems, which suggest that Mcm2 forms a “gate” to open the
MCM complex, possibly to encircle DNA (Bochman and Schwacha, 2009, 2010;
Hingorani and O'Donnell, 1998). Human MCM-BP is proposed to replace the Mcm2
subunit (Sakwe et al., 2007). Using a strain mcb1HA mcm2V5, we performed separate
immunoprecipitations of Mcb1HA, Mcm2V5, Mcm4, and Mcm7 and blotted for other
MCM proteins. Mcb1HA immunoprecipitated Mcm4, 6, 7, and 3, but not Mcm2 (Figure

37

2.6B, lane 3). Conversely, Mcm2V5 associated with Mcm4, 6, 7, and 3, but not Mcb1
(Figure 2.6B, lane 4). This suggests that there are at least two MCM complexes: one
with Mcm2, and one with Mcb1. We found no significant association between Mcb1HA
and Mcm2V5 in this experiment (Figure 2.6B, lane 3, 4). Antibodies to Mcm4 or Mcm7
precipitated both Mcb1 and Mcm2, as well as the other MCMs. Interestingly, the Mcb1
association was extremely robust, and it was immunoprecipitated at higher levels than
Mcm2 in the Mcm4 and Mcm7 experiments. We performed chromatin
immunoprecipitation (ChIP) to see if Mcb1 was located at replication origins, but were
unable to detect it under conditions where we could observe Mcm2 (data not shown).

2.2.4 Isolation of Mcb1 mutants
To identify the functional regions of Mcb1, we constructed a series of deletions within
the protein, arbitrarily defining 5 domains: Exon 1: 2-54aa, A region: 55-230aa, B region:
231-414, and C region: 415-501aa (Figure 2.8A). Constructs lacking these domains were
cloned into episomal plasmids under the high strength nmt1 promoter (Maundrell, 1990).
The resulting plasmids were transformed into wild-type cells. We controlled expression
by the levels of thiamine. In the presence of thiamine (low amount of protein expression
from the nmt1
+
promoter (Forsburg, 1993)), all the transformed cells were viable (Figure
2.8B). However, in the absence of the thiamine (overexpression), we found cells
transformed with full length Mcb1 (mcb1, and mcb1g) were unable to form colonies
(Figure 2.8B). Interestingly, cells that overexpress mcb1-D2 and mcb1-D22 were viable,
but generated notably smaller colonies than the vector control. Both of these mutants

38

lack the N-terminal exon, with D22 having an additional point mutation introduced
during PCR at (E423G). This suggests that D2 and D22 have residual Mcb1 activity.
We tested each mutant for complementation of mcb1∆, by integrating the
constructs into the leu1-32 locus under nmt1 promoter in the diploid
∆mcb1::ura4
+
/mcb1
+
. Following sporulation, we screened haploids for Ura+ Leu+ clones
containing both the deletion and the insertion alleles, in the presence of thiamine.
Full length mcb1
+
and mcb1-D2 and mcb1-D22 rescued mcb1∆ with comparable
levels of expression (Figure 2.8A, 2.9A). None of the other mutants were recovered,
indicating that they are non-functional. We observed that both mcb1-D2 and mcb1-D22
cells showed elongated cells, with a 2C DNA content (Figure 2.9B), suggesting they are
hypomorphs of mcb1
+
. Their elongated cell morphology suggests that they have activated
a checkpoint that delays the cell cycle. We crossed these mutants into strains lacking the
S phase checkpoint (cds1∆), the damage checkpoint (chk1∆), or the upstream regulator of
both checkpoints (rad3∆), and determined that deletion of either chk1 or rad3 relieved
the cell elongation phenotype. Thus, we conclude that the damage checkpoint is
responsible for their cell cycle delay.

39

Figure 2.8 Structure and function analysis of Mcb1.
(A) A schematic of Mcb1 truncations made with a summary of their toxicity to wild-type
cells, complementation of Δmcb1, and interaction with Mcm4.
(B) Wild-type cells (FY254) transformed with plasmids encode Mcb1 truncations were
streaked on EMM-leucine with (left) or without (right) thiamine plate to repress or induce
nmt1 promoter.

40

41

Figure 2.9 N-terminal deletion mutants (mcb1D2 and mcb1D22) are hypomorphic.
(A) Wild-type (FY11), mcb1HA (FY4041), mcm2V5 mcb1HA (FY4122), Δmcb nmt1-
mcb1HA (FY4596), Δmcb nmt1-mcb1gHA (FY5417), Δmcb nmt1-mcb1D2HA (FY5419),
and Δmcb nmt1-mcb1D22HA (FY5421) cells were asynchronously in media containing
thiamine. Equal number of cells was collected and alkaline lysed. Equal volume of total
protein was loaded on an 8% SDS-PAGE gel for separation, and immunoblotted for
Mcb1-HA, and PCNA (a loading control).
(B) Left: photomicrographs of DAPI-stained asynchronous wild-type (FY11), Δmcb
nmt1-mcb1HA (FY4596), Δmcb nmt1-mcb1gHA (FY5417), Δmcb nmt1-mcb1D2HA
(FY5419) and Δmcb nmt1-mcb1D22HA (FY5421) cells. Scale Bar: 10 µm. Right: flow
cytometry of the strains.
(C) Left: Photomicrographs of DAPI-stained wild-type (FY11), Δmcb nmt1-mcb1HA
(FY4596), Δmcb nmt1-mcb1D2HA in Δchk1, Δcds1, or Δrad3 background (FY5499,
5501, or 5505) and Δmcb nmt1-mcb1D22HA in Δchk1, Δcds1, or Δrad3 background
(FY5500, 5503, or 5506) cells. Scale Bar: 10 µm. Right: flow cytometry of the strains.

2.2.5 Mcb1 overexpressing cells inhibits S phase and activates the damage
checkpoint
We next investigated the lethality associated with overexpression of full length mcb1
+
.
We expressed nmt1-mcb1HA integrated at the leu1-32 locus in mcb1
+
or mcb1∆
backgrounds. In the presence of thiamine, both strains were healthy and produced
colonies with normal sizes (Figure 2.10A, top left). In the absence of thiamine, the
overproducing strain in mcb1∆ was completely inviable (Figure 2.10A, bottom d).
Surprisingly, the overproducing strain that also contains one copy of wild-type mcb1
+

had a few surviving colonies (Figure 2.10A, bottom c).

42

Figure 2.10 Characterization of Mcb1 overexpression (dominant negative) allele.
(A) Cells were streaked on EMM-leucine +/- thiamine plate to repress or induce nmt1
promoter. a: wild-type (FY11); b: leu1-32::nmt1-GFP-lacZ-leu1+ (FY838); c: mcb1+
leu1-32::nmt1-mcb1HA-leu1+ (FY4594); d: Δmcb1 leu1-32::nmt1-mcb1HA-leu1+
(FY4596).
(B) Cells grew in EMM-leucine with low thiamine to low OD, were washed and
inoculated into –leucine –thiamine media. Aliquots were collected and fixed in 70%
ethanol every one hour from the 8 hours to 17 hours (A sample was also collected at 26
hours). Cells were rehydrated and counted. Relative growth curves were plotted using
wild-type cell number at 8 hours as reference. At each time point, 10 μL of cell cultures
were serial diluted, plated on YES plates, and incubated at 30°C for 4 days. The number
of colonies were counted and averaged at each time point. Relative survival curves were
plotted using wild-type colony number at 0 hour as reference.

43

We followed the cells during promoter induction and found that the overall cell
number, was similar in both strains, however the viability (plating efficiency) of the mcb1
overproducers began to drop by 9 hours (Figure 2.10B). Whilst the number of Δmcb1
nmt1-mcb1HA survivors continued dropping, the viability of mcb1
+
nmt1-mcb1HA cells
plateaued at 13 hours, and started to increase again around 17 hours. The survivor class
that emerges by 26 hours in mcb1
+
nmt1-mcb1HA showed normal 2C DNA content
(Figure 2.11A, c), while Δmcb1 nmt1-mcb1HA is lethal at the same time point (Figure
2.11A, d). The levels of ectopically produced Mcb1HA protein dropped significantly at
26 hours (Figure 2.12). We conclude that under the selective pressure of toxic
overproduction, the survivors have escaped by down-regulating the nmt1 promoter.
Because the endogenous mcb1
+
gene is still intact, the cells can survive repression of the
dominant negative (nmt1-mcb1HA) transgene. For the strain in which the transgene is the
only source of mcb1
+
, there are no survivors.
However, at early timepoints there is no difference in the phenotypes or behavior
of the overproducer strains. By 13 hours, both strains accumulated significant numbers of
cells with DNA contents less than 1C (Figure 2.11A). This phenotype is reminiscent of
cells with defects in replication initiation. For example, shutting off the cdc18
+

replication initiation gene leads to accumulation of cells with less than 1C DNA and
abnormal nuclear morphology (Kelly et al., 1993a). Indeed, consistent with the behavior
of a cdc18-shutoff allele (see below; (Kelly et al., 1993a)), we observed a mixture of long
and short cells in nmt1-mcb1HA (Figure 2.11B). By 14 hours, 26% of mcb1
+
nmt1-
mcb1HA cells and 33% of Δmcb1 nmt1-mcb1HA have abnormal nuclear morphology,

44

including anucleate, fragmented nuclei or cut cells. At 17 hours, the abnormal cells
increased to 64% and 66% respectively (Figure 2.11B). A similar phenotype was
observed in strains overexpressing untagged Mcb1 from plasmids (data not shown).

45

Figure 2.11 Overproducing Mcb1 causes DNA damages.
(A) Samples at each timepoint were processed for flow cytometry analysis. Arrowheads
indicate starved 1C population. Arrow indicates 2C population. Unfilled histograms
outlined with dotted lines, indicates FACS profiles of standard S. pombe cells processed
at the same time.
(B) Representative pictures of sample at each time point were stained with DAPI (Left).
Arrowheads indicate short cells with abnormal nuclear morphology. Arrows indicate
elongated cells with or without abnormal nuclear morphology. Scale Bar: 10 µm.
Quantification of cells with different nuclear morphology (Right). Cells were counted for
mono-nucleate, bi-nucleate, and abnormal nucleus categories.
(C) Rad22-YFP foci formation in Mcb1 overproducing cells rad22-YFP

leu1-32::nmt1-
mcb1HA-leu1
+
cells (FY4591) grew in –leucine with low thiamine to low OD, were
washed and inoculated into –leucine with –thiamine or +thiamine media. 14 and 16 hours
after thiamine removal, cells were harvested and washed twice in DAPI-containing media.
Representative photomicrographs of FY4591 at 14 hours with or without thiamine (Left).
Scale Bar: 10 µm. Cells were counted for Rad22-YFP foci (0 focus, 1 focus, and more
than 1 focus). Quantification of cells counts averaged from two experiments (Right).

46

Figure 2.12 Mcb1 overproducer cells actively repress nmt promoter.
mcb1+ leu1-32::nmt1-mcb1HA-leu1+ (FY4594) and Δmcb1 leu1-32::nmt1-mcb1HA-
leu1+ (FY4596) grew in thiamine-containing media were inoculated into thiamine free
media at t=0’. Cells were harvested every hour from 7 hours after induction. After 17
hours after induction, cells were inoculated into thiamine free media, and collected 9
hours later. Equal number of cells was alkaline lysed. Equal volume of total proteins was
separated by 10% SDS-PAGE gel and immunoblotted for Mcb1HA and PCNA (a loading
control).

The presence of elongated cells in the population suggested that some sort of
checkpoint was activated in Mcb1HA overproducers (OP-Mcb1). DNA damage during
replication can be visualized by formation of repair foci containing the homologous
recombination protein Rad22 (ScRad52)(e.g., (Bailis et al., 2008)). We observed an
increase in the formation of Rad22 foci in cells overproducing Mcb1HA (Figure 2.11C).
Cells with Rad22-YFP foci increased to 37% by 14 hour, and 13% cells had more than 1
focus, compared to about 10% for the cells were grown in repressing (thiamine)
conditions.

47

We reasoned that these repair foci might accompany activation of the DNA
damage checkpoint, so we combined the overproducer strain with cds1∆, chk1∆, or
rad3∆. After growing in thiamine-free media for 16 hours, only the Δcds1 nmt1-mcb1HA
cells showed elongated cells, while the other strains had small cells and abnormal nuclear
structure (Figure 2.13A, bottom row). This suggests that the DNA damage checkpoint is
activated in some of the cells. Finally, we examined the phosphorylation status of Chk1
as a measure of Chk1 activation (Walworth and Bernards, 1996). Because detection of
Chk1 relies on an HA epitope tag, we transformed a plasmid (Maundrell, 1993)
overexpressing Mcb1V5 under the nmt1 promoter into a strain containing chk1HA
integrated at the native locus. Induction of Mcb1V5 was detectable 12 hours after
induction, and continued increasing to the last time point, 17 hours (Figure 2.13B).
Phosphorylation of Chk1HA was observed at 14 hours after induction. Together, these
results suggest that Mcb1 overproduction causes DNA damage that activates Chk1 kinase.

48

Figure 2.13 Chk1 is activated in Mcb1 overproducing cells.
(A) Photomicrographs of DAPI-stained mcb1HA (FY4041), nmt1-mcb1HA (FY4594),
Δcds1 nmt1-mcb1HA (FY4734), Δchk1 nmt1-mcb1HA (FY4736), Δcds1 Δchk1 nmt1-
mcb1HA (FY4739), and Δrad3 nmt1-mcb1HA (FY4740) cells 0 and 16 hour after
inoculated into –thiamine media. Scale Bar: 10 µm.
(B) chk1HA (FY4610) cells were transformed with plasmid expressing Mcb1V5 (pLD18)
or empty vector (pSLF972). Equal number of cells was collected at indicated timepoint
after inoculated into –thiamine media, and alkaline lysed. Equal volume of protein was
loaded on SDS-PAGE gel for separation, and immunoblotted for Chk1HA, Mcb1V5, and
alpha-tubulin (a loading control). Lane 1: total lysate of untreated chk1HA cells; lane 2,
and 3: total lysates of chk1HA cells treated with 0.1% MMS for 4 hours and 1 hour
(phosphorylated-Chk1HA migrates slower). Lane 4-8: total lysates of pLD18 transformed
chk1HA cells from different timepoints after thiamine removal. Lane 9-13: total lysates of
empty vector (pSLF972) transformed chk1HA cells from different timepoints after
thiamine removal.

49

2.2.6 Overproduction of Mcb1 disrupts Mcm2 from the MCM complex
Because Mcb1 and Mcm2 form alternative MCM complexes, we speculated that
overproduced Mcb1 sequesters Mcm3-7 away from Mcm2 and thus blocks replication.
To test our hypothesis, we examined MCM complex formation in the overproducer
(Figure 2.14A). In these experiments, we examined the structure of the MCM complex by
immunoprecipitating Mcm2V5 or Mcm4GFP, and detected Mcb1 or other MCM
subunits.
As we predicted, when we immunoprecipitated Mcm4GFP, we observed
increased association between Mcm4GFP and Mcb1HA, and decreased interaction
between Mcm4GFP and Mcm2V5 (Figure 7A, compare lanes 3 and 4). Interestingly,
however, Mcm4GFP also showed reduced association with Mcm6 and Mcm7, suggesting
that the MCM complex overall is disrupted by this level of Mcb1 expression. If excess
Mcb1 sequesters Mcm4 away from the other MCMs, increased dosage of Mcm4 might
attenuate this phenotype. We transformed nmt1-mcm4HA cells with pLD18 (nmt1-
mcb1V5) or empty vector. We found overproducing Mcm4HA, but not Mcm2HA,
partially rescues the lethality of Mcb1 accumulation (Figure 2.14B).
When we precipitated Mcm2V5 in the overproducers, we were unable to detect
other MCM proteins (Figure 2.14A, compare lanes 5 and 6). This suggests that the
normal MCM complex is disrupted. Surprisingly, under these conditions, we detected an
interaction between Mcb1HA and Mcm2V5 (Figure 2.14A, lane 6). This suggests that
Mcb1 and Mcm2 are capable of interacting directly, although not as efficiently as Mcb1

50

with the other subunits. Thus, high levels of Mcb1 don’t simply replace Mcm2 in the
complex, but the Mcb1 protein may interact with individual MCM subunits.

Figure 2.14 Overproducing Mcb1 causes dissociation of Mcm2 from other MCM
proteins.
(A) nmt1-mcb1HA mcm2V5 mcm4GFP (FY4961) overnight culture grew in low thiamine
was inoculated into –thiamine and +thiamine media and grown at 32°C for 14 hours.
Cells were harvested and lysed in B88 buffer. Soluble lysates were immunoprecipitated

51

with anti-GFP (lane 3, 4) and anti-V5 (lane 5, 6). Immunoprecipitated samples were
separated by SDS-PAGE gel and blotted for Mcm2V5, Mcm4GFP, Mcm7, Mcm6, and
Mcb1HA.
(B) Wild-type (FY254), nmt1-mcm4HA (FY1602), and nmt1-mcm2HA (FY861) were
transformed with plasmids overexpressing Mcb1 (pLD18 or pLD10) and empty vectors
(pSLF972 or pSGP72). Transformants were restreaked on –thiamine and +thiamine
plates and incubated at 32°C.
(C) mcm2V5 mcm4GFP cells carrying full length mcb1 (FY4961 and FY5407) and mcb1
deletion mutants (FY5408-5415) at the leu1-32 locus were grown in thiamine containing
media, then harvested and lysed in B88 buffer. Soluble lysates were immunoprecipitated
with anti-GFP. Immunoprecipitated samples were separated by 12% SDS-PAGE gel. We
used 8% gel to separate bigger Mcb1 truncations from IgG (bottom panel). We blotted
for Mcm4GFP, and Mcb1HA. The data are summarized in Fig 3A.
(D) mcm2V5 mcm4GFP cells carrying six mcb1 deletion mutants at the leu1-32 locus:
nmt1-mcb1D2HA (FY5408), nmt1-mcb1D5HA (FY5411), nmt1-mcb1D6HA (FY5412),
nmt1-mcb1D78HA (FY5413), nmt1-mcb1D9HA (FY5414), and nmt1-mcb1D22HA
(FY5415) were grown in –thiamine media, then harvested and lysed in B88 buffer.
Soluble lysates were immunoprecipitated with anti-GFP. Fifteen micrograms soluble
proteins (lane 1-8), and immunoprecipitated samples (lane 9-14) were separated by SDS-
PAGE gel and blotted for Mcm4GFP, Mcm2V5, Mcm6, Mcm7, and Mcb1HA.

Next, we examined the effect of our deletion mutants on MCM complex
formation, using the same strategy. In the presence of thiamine, protein levels of most
Mcb1 truncation mutants were comparable to full length Mcb1 (Figure 2.15).
Surprisingly, we observed that Mcb1-D5, Mcb1-D6, and Mcb1-D9 associated with
Mcm4 when expressed at near normal level, even though they are unable to complement
the null, and are not toxic when overproduced (Figure 2.8B, 2.14C). However, when
overproduced, these mutants did not dissociate the interaction between Mcm4 and the
other MCMs (Figure 2.14D), leading us to conclude that they do not replace Mcm2. In
contrast, the two N-terminal truncation mutants (Mcb1-D2, Mcb1-D22) did reduce

52

association of Mcm4 with other MCMs, including Mcm2 (Figure 2.14D, lane 9, 14).
Thus, there is a clear correlation between three phenotypes: Mcb1, Mcb1-D2, and Mcb1-
D22 are the only constructs that are able to complement mcb1∆, are toxic when
overproduced, and disrupt association between Mcm2 and Mcm4 upon overproduction.

Figure 2.15 Protein level of Mcb1 truncation mutants.
mcm2V5 mcm4GFP cells carrying full length mcb1 (FY4961 and FY5407) and mcb1
deletion mutants (FY5408-5415) at the leu1-32 locus were grew in thiamine containing
media, then harvested and lysed in B88 buffer. Fifteen micrograms soluble protein was
loaded as input.

In fission yeast, as in most eukaryotes, MCM proteins are found predominantly in
the nucleus throughout the cell cycle, but their chromatin association is cell cycle

53

regulated (reviewed in(Forsburg, 2004). Chromatin binding depends on activation of the
pre-Replication complex including the initiator protein, Cdc18 (Kearsey et al., 2000).
Previously, we showed that mutations that disrupt the MCM complex such as mcm4ts
cause all the subunits to exit the nucleus (Pasion and Forsburg, 1999). Thus, complex
assembly is required for nuclear retention. We hypothesized the overexpression of Mcb1,
which disrupts the normal MCM complex, therefore would also disrupt chromatin
binding and nuclear localization of the MCMs.
We used indirect immunofluorescence in an in situ chromatin binding assay
(Kearsey et al., 2000; Namdar and Kearsey, 2006). Proteins located on the chromatin are
resistant to Triton, while proteins located in the nucleoplasm but not on the chromatin are
removed by Triton treatment. This method allows the S phase subset of chromatin-bound
MCMs (on the bi-nucleate cells) to be distinguished from the abundant unbound MCM
protein in the nucleus (Kearsey et al., 2000; Namdar and Kearsey, 2006). As a control,
we used a cdc18-shutoff strain that blocks MCM binding to the chromatin. Importantly,
both of these phenotypes depend on thiamine, although in opposite directions. For Mcb1
overproducers (OP-Mcb1), lethality is caused by removing thiamine from the media to
induce nmt1-mcb1HA (minus-thiamine condition). In the case of the cdc18-shutoff cells,
lethality is caused by adding thiamine to the media to repress nmt1-cdc18+ expression
(Kelly et al., 1993a).
As shown in Figure 2.16, under permissive conditions, both Mcm4GFP and
Mcm2V5 are found in the nucleus (-Triton) and are chromatin-bound in S phase (bi-
nucleates +Triton). When Mcb1HA was overexpressed in the absence of thiamine,

54

nuclear localization of both MCM proteins was reduced and chromatin binding (+Triton)
was abolished. Similar results were observed if cdc18
+
was shut off by addition of
thiamine. These data suggest that the toxic effect associated with Mcb1 expression results
in delocalization of the MCM subunits to the cytoplasm and inhibition of replication.

Figure 2.16 Overproducing Mcb1 causes dissociation of chromatin-bound MCM
proteins.
nmt1-cdc18 mcm2V5 mcm4GFP (FY4958), nmt1-mcb1HA mcm2V5 mcm4GFP
(FY4961), and wild-type (FY11) overnight cultures were grown in low thiamine then

55

inoculated into –thiamine or +thiamine media, grew at 32°C for 14 hours, and harvested
for an in situ chromatin binding assay. Mcb1HA and Mcm2V5 localization was detected
in untreated cells and Triton treated cells with specific antibodies. Scale Bar: 10 µm.

2.3 Discussion
MCM proteins are members of the AAA+ ATPase family and share a unique motif, the
MCM box, which is important for MCM complex formation and ATP hydrolysis
(reviewed in(Bochman and Schwacha, 2009; Forsburg, 2004). Recent studies identified a
novel component of the MCM complex in human, as well as plants, MCM binding
protein (MCM-BP) (Sakwe et al., 2007; Takahashi et al., 2008; Takahashi et al., 2010).
Evidence from these systems suggests that MCM-BP is a component of the replisome,
and replaces the Mcm2 subunit. Recent work suggests MCM-BP may contribute to sister
chromatid cohesion and DNA repair (Takahashi et al., 2010). Although no orthologue has
been found in budding yeast, we identified a putative orthologue of human MCM-BP that
we named Mcb1. Similar to other MCM-BPs, Mcb1 shares no homology to S. pombe
MCM proteins and lacks the MCM box.
Disruption of mcb1
+
is lethal. However, disrupted spores manage to germinate
and complete several cell cycles before arresting with an elongated, cdc morphology.
Most of the cells have a single nucleus of normal appearance; a few have a disordered
nucleus or evidence of mitosis. This delayed lethality is likely to reflect the abundance of
the maternal protein packaged in the spores. For example, mcm4∆ cells complete S phase
prior to arresting with a 2C DNA content; only if the residual maternal Mcm4 protein is

56

inactivated with a temperature sensitive mutation, do the mcm4∆ cells arrest prior to S
phase (Liang et al., 1999). Therefore, while we can conclude that Mcb1 is essential for
viability and cell cycle progression, we cannot conclude at what stage(s) of the cell cycle
it works.
We found Mcb1 to be amenable to epitope tagging and detection by Western blot.
Comparison of Mcb1HA to Mcm2HA with the same antibody shows that the proteins are
expressed at similar levels, with Mcb1 appearing somewhat more abundant even than
Mcm2. MCM proteins are estimated at around 10
4
molecules per cell (Namdar and
Kearsey, 2006), so Mcb1 is a very abundant protein. Mcb1 is levels are constant
throughout the cell cycle with no evidence for periodic modifications. Curiously, we were
unable to visualize either Mcb1GFP in live cells, nor HA-tagged Mcb1 in fixed cells
using immunofluorescence, even though they are readily detected by Western blot. It is
possible that the tags are blocked in some way in its normal environment, and only
available upon denaturation. We used cell fractionation to examine Mcb1 localization and
found it ubiquitously distributed through the entire cell but enriched in the nucleus.
Similar to observations in humans (Sakwe et al., 2007), we found that Mcb1
normally associates with Mcm3, 4, 6 and 7, but not Mcm2, thus forming an alternative
MCM complex. The canonical MCM complex consists of Mcm2-7 with 1:1:1:1:1:1
stoichiometry (Davey et al., 2003; Lee and Hurwitz, 2000, 2001; Schwacha and Bell,
2001). Mcm4, 6, 7 form a trimeric sub-complex known as “the MCM core”. Mcm2 binds
to the core and a dimer formed by Mcm3 and Mcm5. The MCMs interdigitate with one
another in a ring structure, in which the arginine finger of one MCM meets with the P-

57

loop in the Walker A motif of its neighbor to form an ATP binding site (Bochman and
Schwacha, 2010; Davey et al., 2003). Coordinated ATP hydrolysis occurs at a subset of
sites (Bochman and Schwacha, 2010; Davey et al., 2003; Schwacha and Bell, 2001).
Mcm2 is thought to be the “gate” of the ring, and the site at which the ring opens to
encircle chromatin (Bochman and Schwacha, 2010). Mcb1 lacks these sequences so is
unlikely to contribute to the ATP-dependent structure. It is possible that Mcb1 bound to
Mcm3-7 forms an open structure, not a ring.
We were not able to detect Mcb1 at replication origins using ChIP under
conditions that detect Mcm2, suggesting that Mcb1 is not a component of the core
replisome, or at least not as closely bound as the MCMs. We hypothesize that the Mcm3-
7 bound to Mcb1 is not active as a helicase in vivo. There is good biochemical evidence
that all six canonical MCMs participate as a helicase in vivo, with Cdc45 and GINS as
cofactors (Bauerschmidt et al., 2007; Bochman and Schwacha, 2010; Ilves et al., 2010).
Mcm2 is required to recruit Mcm4, 6, and 7 into the nucleus, where an intact MCM
complex is necessary to retain them (Pasion and Forsburg, 1999). Moreover, the
phenotypes associated with mcm2 mutations are indistinguishable from mutations in
other MCM subunits; if it were not a core constituent of the helicase, this would not be
expected. We find no evidence that Mcb1 expression can substitute for Mcm2. Therefore,
the interaction between Mcb1 and the other MCMs is likely to have some other, possibly
regulatory function.
In the absence of a tight conditional allele, we used two approaches to examine
Mcb1 activity. We constructed a series of deletion/truncation mutations in Mcb1 and

58

assessed their ability to function. Most of these mutants were unable to complement an
mcb1∆ mutant. However, two mutants containing a truncation of the N-terminus were
apparent hypomorphs; the growing cells were elongated, and this elongation depended
upon the damage checkpoint. DNA content, however, was normal and cells formed
colonies with similar timing to wild type. We conclude that attenuating Mcb1 function
leads to some genome instability, which is similar to the phenotypes associated with
attenuation of MCM function (e.g, (Liang and Forsburg, 2001; Liang et al., 1999)).
We also found that overexpression of Mcb1 generates a dominant lethal
phenotype. OP-Mcb1 cells show evidence of an initiation defect, characterized by an
increase of cells with a sub-1C DNA content. This phenotype is reminiscent of cells with
mutations in the essential replication initiation factors orc1 (Grallert and Nurse, 1996;
Muzi-Falconi and Kelly, 1995), cdc18 (Kelly et al., 1993a) or rad4/cut5 (Saka and
Yanagida, 1993). The general model is that cells that do not initiate replication have no
way to activate a checkpoint, or register that S phase has not occurred. Thus, the cells
proceed through mitosis and tear apart the unreplicated genome. We observed that OP-
Mcb1 shows a modest increase in Rad22 foci, indicative of DNA damage, and activation
of the Chk1 damage checkpoint kinase which has seen in many mutants defective in
DNA replication initiation (Yin et al., 2008). This may occur in the subset of cells in the
population that are elongated.
This initiation-defective phenotype is likely to result from inactivation of the
MCM complex. In strains overproducing Mcb1, association between the canonical MCM
proteins is disrupted. This is most strikingly observed by the failure of Mcm4 to associate

59

with Mcm2, but interaction between Mcm4 and the core MCMs is also reduced.
Interestingly, the overproduced Mcb1 is able to bind to Mcm2, suggesting that when
expressed at high enough levels, this protein can interact with all MCM subunits
When we examined the truncation/deletion mutants for overproduction
phenotypes, we found that only the two hypomorphic mutants, which contain a short N-
terminal truncation, were toxic upon overexpression. Although they were still able to
form small colonies (unlike expression of the full length protein which is lethal), they
also reduced association between the canonical MCM proteins.
Several of the non-functional mutants were able to bind the MCMs but showed no
evidence for complex disruption (Mcm2 and Mcm4 remained associated, for example).
We conclude that there are three modes of interaction between Mcb1 and the MCM
complex (Figure 2.17). The first is a normal “functional” mode, in which Mcb1 replaces
the Mcm2 subunit. The second interaction is a “sticky” mode in which Mcb1 appears to
bind non-specifically to all the MCM subunits. This is not toxic, does not replace Mcm2,
and does not disrupt the MCM complex. Finally, the third is the overproduction toxicity.
Only proteins capable of “functional” interactions can disrupt the complex when
overproduced, leading to toxicity and an appparent arrest of DNA replication initiation.
Although it remains a formal possibility that the inhibitory effect Mcb1 has on the MCM
complex is exacerbated by overexpression and not a representation of its true phenotype,
we consider this unlikely given the correlation of functional Mcb1 with complex
disassembly. We conclude that OP-Mcb1 causes a dramatic inhibition of replication

60

initation similar to that caused by mutations in the genes required for formation of the
pre-replication complex (preRC).

Figure 2.17 Model for Mcb1 interaction with MCMs.

MCMs in most eukaryotes exist in three populations within the nucleus: (1) the
replisome MCMs bound to chromatin at the replication fork, which are detectable by
ChIP; (2) “remote” MCMs bound on unreplicated DNA during S phase, which can be
visualized cytologically (Kearsey et al., 2000; Krude et al., 1996; Madine et al., 1995;
Namdar and Kearsey, 2006), but not by ChIP, and (3) a soluble pool, not bound to
chromatin. The large amount of remote MCMs creates a puzzle known as “the MCM
paradox” (Hyrien et al., 2003; Laskey and Madine, 2003). These “remote MCMs” are
very important for distributing origins, marking unreplicated chromatin for replication, or

61

reserving dormant replication origins to complete replication under replication stress
(Blow and Ge, 2009; Chuang et al., 2010; Edwards et al., 2002; Ge et al., 2007;
Woodward et al., 2006). Formally, Mcb1 could contribute to the formation of any of
these pools, possibly by disrupting the intact hexamer to change the distribution between
them. This could be by promoting removal of MCMs from the chromatin, particularly the
remote MCMs. Since the Arabidopsis ETG1 protein has been linked to sister chromatid
cohesion (Takahashi et al., 2010), another possibility is that Mcb1 changes the
composition of the MCM complex to facilitate binding of cohesin assembly proteins at
the fork.
It is interesting that budding yeast does not have an obvious orthologue of Mcb1,
which is readily identified in other eukaryotes. In this regard, it may be worth noting that
a significant difference between budding yeast behavior in S. cerevisiae compared to
other systems is regulated nuclear localization. In budding yeast, MCMs cycle in and out
of the nucleus during the cell cycle in a CDK-dependent pathway (Labib et al., 1999;
Nguyen et al., 2000). Newly synthesized MCMs are preferentially transported into the
budding yeast nucleus (Braun and Breeden, 2007). By contrast, in other eukaryotes
including S. pombe, MCMs are located constitutively in the nucleus and only their
chromatin association is regulated. Dissociation of MCM complex causes chromatin
dissociation and crm1
+
-dependent nuclear export (Pasion and Forsburg, 1999). We see
reduced MCM on chromatin in OP-Mcb1 cells, and there is a reduction in the overall
nuclear signal of Mcm4 compared to Mcm2. It is possible that Mcb1 functions to regulate
the MCMs at the level of chromatin association, to prevent binding or activation outside

62

of S phase. This could be a regulator function that is not needed in budding yeast. This is
consistent with data from other systems; in the process of preparing this work, a new
study has shown that Xenopus MCM-BP unloads MCM complex from the chromatin in
late S pahse to prevent rereplication by dissociating Mcm2-7 from chromatin (Nishiyama
et al., 2011). Our data support a model in which the abundant Mcb1 protein contributes to
redistirbution of the MCM proteins at the conclusion of S phase.

2.4 Methods and materials
2.4.1 Fission yeast strains, plasmids and manipulation:
All S. pombe strains (Table 2.1) were constructed and maintained in yeast extract plus
supplement (YES) media or under selection in Edinburgh minimal media (EMM) with
appropriate supplements using standard techniques (Forsburg and Rhind, 2006; Moreno
et al., 1991; Sabatinos and Forsburg, 2010). Transformation was performed by
electroporation. Unless noted, asynchronous cultures were grown at 32°C. In cell cycle
block and release experiment, cells were grown at 25°C (permissive temperature) to early
exponential phase and shifted to 36°C for 4 hours (restrictive temperature). HA tagged
Mcb1 at endogenous locus was generated by using the pFA6a series of plasmids with
primers: 5’-
CGAAGAGTTTCGGTCGTCAACTGGTTTCAAGAATTGATTTTGAGGCTGCCCGT
AGTCTAATCAATCATTGGACTGTCAACCGGATCCCCGGGTTAATTAA-3’ and
5’-CTTGGAAATTCCAAAAA
GACATGAAAAGTAATTTCTAACATTGGTTAAATGATGTTGATTATAAGAAAA

63

TATGCGATCAAGAATTCGAGCTCGTTTAAAC-3’ (Bahler et al., 1998). Doubly-
tagged strains were isolated by mating and from tetrad analysis. The mcb1
+
gene was
cloned using cDNA as template and was inserted into REP based expression plasmids to
generate: pLD10 (nmt1-mcb1HA) and pLD18 (nmt1-mcb1V5), which were used for
ectopic expression (Maundrell, 1993). The mcb1g gene was amplified using genomic
DNA. To generate stable Mcb1HA overproducing cells (OP-Mcb1), we made pLD14 by
inserting the nmt1-mcb1HA fragment from pLD10 into pJK210. NruI linearized pLD14
was integrated it at leu1-32 locus, as described (Keeney and Boeke, 1994). The strains for
the mutation analysis were generated with the same approach. The nmt1 promoter-
containing strains were maintained on YES agar (for integrants) or EMM with
supplements and thiamine. To perform overproduction/induction experiments, liquid
cultures were grown in the presence of 2.5 µg/mL thiamine to early exponential phase
were washed twice with equal volume of EMM before inoculating into no thiamine
(overproduction state) or in the presence of 5 µg/mL thiamine (strong repression state)
(Basi et al., 1993; Maundrell, 1990).

2.4.2 Construction of mcb1
+
deletion
To delete the mcb1
+
gene (SPAC1687.04), we removed the entire coding sequence
according to the Gene Deletion Protocol from
(http://mendel.imp.ac.at/Pombe/deletion_protocol.html) using upstream primers: 5’-
GAGATCTAGACAGGACGATTGGACGATACT-3’; 5’-
GAGACTCGAGATTATAAATATATAAT TTTATCCTTTAAACC-3’, and

64

downstream primers 5’-GAGAGCGGCCGCTTGATCGCATAT TTTCTTATAATC-3’
and 5’- GAGATCTAGAGTCGCTTTAGTACATTCTAAAC-3’. The resulting plasmid
(pLD21) was amplified, linearized at XbaI, and transformed into a fresh mated wild-type
diploid strain. Stable Ura+ integrated diploids were selected and confirmed by PCR. The
deletion was also confirmed by tetrad analysis, and complementation. Bulk spore
germination was performed as previously described (Forsburg and Nurse, 1994).

2.4.3 Complementation
A heterozygous diploid strain (mcb1
+
/Δmcb1::ura4
+
) was transformed with linearized
leu1
+
integration plasmids that express HA tagged mcb1 deletion mutants cloned from
cDNA, and plated on thiamine containing selective media. Random spore analysis
(Forsburg and Rhind, 2006) was used to recover haploids that were Ura+ and Leu+. The
resulting haploids were confirmed by PCR, and Western blot.

2.4.4 Flow cytometry
Flow cytometry was performed as described (Sabatinos and Forsburg, 2009; Sazer and
Sherwood, 1990) with minor modifications. Briefly, cells were fixed in 70% ice cold
ethanol, rehydrated with 50mM sodium citrate, and treated with 0.1 mg/mL RNaseA.
Cells were stained with 1 µM Sytox Green (Invitrogen) in 50 mM sodium citrate.
Macintosh BD CellQuest
TM
Pro 5.2.1 software (BD Biosciences) was used to analyze and
organize the data acquired by the FACScan cytometer (Becton Dickinson).

65

2.4.5 Cell fractionation assay
Cell fractionation protocol was derived from (Liang and Stillman, 1997; Mason and
Mellor, 1997). Cells were washed with ice-cold stop buffer (0.9% NaCl, 10 mM EDTA,
0.2% NaN
3
). The pellet was incubated at 36°C for 15 minutes in CSE buffer (20 mM
citric acid, 20 mM Na
2
HPO
4
, 40 mM EDTA, 1.2 M sorbitol, pH5.6) with the addition of
7.2 mM β-mercaptoethanol (β-ME) and 12.5 mg/mL zymolyase-20T. The protoplasted
cells were washed twice with ice-cold CSE buffer with 1:100 (v/v) protease inhibitor
cocktail (P-8215, Sigma) and resuspended in ice-cold Nuclei Buffer (20 mM Tris pH 7.0,
20 mM potassium acetate, 1 mM magnesium chloride) with the addition of 18% Ficoll, 1
mM ATP, 0.05% NP-40, and 1:100 (v/v) protease inhibitor cocktail. Glass bead lysates
were cleared twice by spinning at 2,700 g for 3 minutes at 4°C. The cytoplasm fraction
and the whole nuclei fraction were separated by spinning at 21,000 g for 20 minutes. To
permeabilize the nuclear envelope, the pelleted whole nuclei fraction was resuspended in
ice-cold NB with the addition of 0.2 M sorbitol, 1 mM ATP, 1 mM dithiothreitol (DTT),
0.5% NP-40, and 1:100 (v/v) protease inhibitor cocktail. The nucleoplasm fraction and
chromatin-bound fraction were separated by spinning at 21,000 g for 20 minutes. The
chromatin-bound fraction was resuspend in ice-cold NB with the addition of 0.2 M
sorbitol, 1 mM ATP, 1 mM DTT, 0.5% NP-40, and 1:100 (v/v) protease inhibitor
cocktail. Equal volume of each fraction was boiled in 2X sample buffer (100 mM Tris,
pH 6.8, 20% glycerol, 4% SDS, 200 mM DTT, and 0.02% bromophenol blue), and
loaded on 8% or 15% SDS-PAGE gels for separation.

66

2.4.6 Protein extracts, immunoprecipitation, and immunoblotting
Total protein extracts were prepared either by glass bead lysis using trichloroacetic acid
(TCA) extraction as described (Catlett and Forsburg, 2003) or alkaline (NaOH) lysis
protein extraction (Matsuo et al., 2006). The concentrations of TCA extracted protein
samples were quantified by BCA protein assay (Pierce). Twenty micrograms of total
protein was separated by an 8% SDS-PAGE gel. For alkaline lysis protein extraction,
equal numbers of cells were collected, resuspended in 0.3 M NaOH, and incubated at
room temperature for 10 minutes. Permeabilized cells were centrifuged at 1,700 g for 3
minutes. The cells pellets were resuspended in 30 µL of 2X sample buffer, and boiled for
10 minutes. Ten microliters were loaded on SDS-PAGE gel for separation.
Soluble lysates and immunoprecipitates were prepared as described (Sherman et
al., 1998). Cell cultures were grown to mid-log phase, collected by centrifugation, and
lysed in cell lysis (B88) buffer (50 mM HEPES, pH 7.0, 50 mM potassium acetate, 5 mM
magnesium acetate, 100 mM sorbitol, and freshly added 1 mM ATP, 1 mM DTT, 1:100
(v/v) protease inhibitor cocktail (P-8215, Sigma), and 1:100 (v/v) phosphatase inhibitor
cocktail set II (524625, Calbiochem). Soluble protein concentration was determined by
Bradford protein assay (BioRad).
Immunoprecipitations (IPs) were performed with 750 µg of pre-cleared soluble
protein overnight at 4°C. Fifty microliters of Immobilized rProtein A (IPA300, RepliGen,
1:1 in lysis buffer) were added and incubated for 2 hours at 4°C. Beads were spun down
and washed four times with 1 mL of cold lysis buffer. After the final wash, beads were

67

resuspended in 2X sample buffer, and boil for 5 minutes. Equal volume was loaded on an
8% SDS-PAGE gel for separation.
For immunoblotting, samples separated by SDS-PAGE gels were transferred to
Immobilon-P membrane (Millipore). ECL Western Blotting Substrate (Pierce) and the
Blue Ultra Autorad Film (BioExpress) were used to detect signals.

2.4.7 Antibodies
Mcm-specific antibodies were purified from rabbit antisera using the methods described
previously (Liang and Forsburg, 2001; Sherman and Forsburg, 1998; Sherman et al.,
1998); Mcm3p from serum 6178, Mcm4 (Cdc21) from serum 5898, Mcm5 (Nda4) from
serum 5897, Mcm6 (Mis5) from serum 5899, and Mcm7 from serum 6184. We also used
commercially available primary antibodies: anti-HA (16B12, Covance), anti-GFP
(abcam290, Abcam), mouse anti-V5 (R960-25, Invitrogen), rabbit anti-V5 (abcam15828,
Abcam), anti-Nop1 (28F2, EnCor Biotech), anti-α-tubulin (T5168, Sigma), anti-PCNA
(PC10, Delta Biolabs), and secondary antibodies: anti-mouse::HRP (Millipore) and anti-
rabbit::HRP (BD BioSciences). Most primary and secondary antibodies were diluted
1:2000. Mouse anti-V5 and anti-Nop1 antibodies were diluted 1:1000.

2.4.8 Viability assays
Cells (FY11, FY838, FY4594, and FY4596) were grown overnight at 32°C to early
exponential phase (OD
600
~ 0.2-0.3) in EMM lacking leucine (EMM-L) with 2.5 µg/mL
thiamine. Cells were washed twice with EMM-L, and inoculated into EMM-L. At each

68

time point, cultures were serially diluted in YES (1:100, 1:1,000, and 1:10,000). Equal
volumes of each dilution were plated on YES plates for viability testing and incubated at
30°C for 4 days. The number of colonies was averaged from different dilutions. Relative
viability at time T was calculated as: (averaged number of colonies at time T)/ (averaged
number of colonies at time zero). At each time point, cells were also fixed in 70% ethanol.
Cellular DNA content was analyzed by flow cytometry. Rehydrated cells were counted
twice for cell growth analysis. Relative growth at time T was defined as: (averaged
number of cells at time T)/ (averaged number of cells at time zero).

2.4.9 In situ chromatin binding assay and fluorescence microscopy
In situ chromatin binding assay was performed as described in (Kearsey et al., 2000) with
modification as described in (Gómez et al., 2002). Proteins were detected using rabbit
anti-V5 (1:300 volume), or rabbit anti-GFP (1:200 volume) and chicken anti-rabbit
AlexaFluor 488 (Invitrogen). Cells were mixed with poly-L-lysine (Sigma), heat-fixed on
microscope slides, and mounted in 50% glycerol-phosphate-buffered saline (PBS) for
visualization.
DAPI staining for rehydrated cells was performed by mounting the heat-fixed
cells with 1 µg/mL of DAPI containing anti-fade mount (50% glycerol in water with 0.1%
p-phenylenediamine dihydrochloride (PPD).
To examine Rad22-YFP foci in live cells, cells were washed twice in EMM
containing 10 μg/mL DAPI, air-dried on ColorFrost Plus Microscope slides (Fisher
Scientific), and mounted in 50% glycerol-phosphate-buffered saline (PBS). All pictures

69

were taken on a Leica DMR florescence microscope using 63X oil-immersion objective
(Leica Plan Apochromat; Numerical Aperature: 1.32) and recorded with OpenLab
software (Improvision).

2.4.10 Digital image manipulation
All the plates and films were electronically scanned using a ScanJet IIcx scanner
(Hewlett-Packard). Digitized pictures/photos were analyzed and contrast enhanced by
ImageJ software (NIH), and assembled in Canvas software (ACD System).

2.4.11 Sequence alignments
Sequence alignments were done in BioEdit version 7.0.9.0 software with the ClustalW
function.

70

Table 2.1 Yeast strains used in this study

Strain Genotype Source
FY11 h- ade6-M210 Our stock
FY254 h- ura4-D18 leu1-32 ade6-M210 can1-1 Our stock
FY261 h+ ura4-D18 leu1-32 ade6-M210 can1-1 Our stock
FY838 h- leu1-32::p[leu1+ nmt1-GFP-lacZ ]ura4-294 ade6-
704
This study
FY861 h+Δcdc19::his3+ ade6- M210 ura4-D18 leu1-32 his3-
D1 [pSLF176(nmt1-cdc19-HA) ]
Our stock
FY1602 h- leu1-32::[pJK148nmt1-cdc21HA leu1+] ura4-D18
ade6-M210 can1-1
Out stock
FY2558 h+Δcdc19::[cdc19-HA::leu1+] ura4-D18 leu1-32
ade6-M210
Our stock
FY3747 h+ Δmcb1::ura4+ ura4-D18 leu1-32 ade6-M210 can1-
1
h- mcb1+ ura4-D18 leu1-32 ade6-M210 can1-1
This study
FY4041 h+ mcb1-HA::kanMX6 ura4-D18 leu1-32 ade6-M216 This study
FY4090 h+ cdc25-22 mcb1-3HA::kanMX6 ura4-D18 leu1-32
ade6-M210
This study
FY4092 h+ cdc25-22 Δcdc19::[cdc19HA::leu1+] ura4-D18
leu1-32 ade6-M210
This study
FY4122 h+ Δcdc19::[cdc19V5::leu1+] mcb1-3HA::kanMX6
ura4-D18 leu1-32 ade6-M216
This study
FY4238 h+ cdc25-22 mcb1-HA::kanMX
Δcdc19::[cdc19V5::leu1+] ura4-D18 leu1-32 ade6-
M216
This study
FY4591 h- rad22:YFP:kanMX4 leu1::nmt1-mcb1HA-leu1+
ura4-D18 leu1-32 ade6-M210
This study
FY4594 h- mcb1+ leu1-32::nmt1-mcb1HA-leu1+ ura4-D18
leu1-32 ade6-M210
This study
FY4596 h- Δmcb1::ura4+ leu1::nmt1-mcb1HA-leu1+ ura4-D18
leu1-32 ade6-M216
This study
FY4610 h+ chk1HA(ep) ura4-D18 leu1-32 ade6-M216 Our stock
FY4734 h- mcb1+ leu1-32::nmt1-mcb1HA-leu1+ Δcds1::ura4+
ura4-D18 leu1-32 ade6+
This study
FY4736 h- mcb1+ leu1-32::nmt1-mcb1HA-leu1+ Δchk1::ura4+
ura4-D18 leu1-32 ade6-M216
This study
FY4739 h- mcb1+ leu1-32::nmt1-mcb1HA-leu1+ Δrad3::ura4+
ura4-D18 leu1-32 ade6-M210
This study
FY4740 h+ mcb1+ leu1-32::nmt1-mcb1HA-leu1+
Δcds1::ura4+ Δchk1:: ura4+ ura4-D18 leu1-32 ade6-
M216
This study

71

FY4958 h+ cdc21-GFP::ura4+ Δcdc19::[cdc19V5::leu1+]
Δcdc18::p[nmt1-cdc18+-LEU2] ade6-M216
This study
FY4961 h- cdc21-GFP::ura4+ Δcdc19::[cdc19V5::leu1+] leu1-
32::nmt1-mcb1HA-leu1+ ade6-M216
This study
FY5407 h- cdc21-GFP::ura4+ Δcdc19::[cdc19V5::leu1+] leu1-
32::nmt1-mcb1gHA-leu1+ ade6+
This study
FY5408 h- cdc21-GFP::ura4+ Δcdc19::[cdc19V5::leu1+] leu1-
32::nmt1-mcb1D2HA-leu1+ ade6+
This study
FY5409 h- cdc21-GFP::ura4+ Δcdc19::[cdc19V5::leu1+] leu1-
32::nmt1-mcb1D3HA-leu1+ ade6+
This study
FY5410 h+ cdc21-GFP::ura4+ Δcdc19::[cdc19V5::leu1+]
leu1-32::nmt1-mcb1D4HA-leu1+ ade6+
This study
FY5411 h- cdc21-GFP::ura4+ Δcdc19::[cdc19V5::leu1+] leu1-
32::nmt1-mcb1D5HA-leu1+ ade6+
This study
FY5412 h- cdc21-GFP::ura4+ Δcdc19::[cdc19V5::leu1+] leu1-
32::nmt1-mcb1D6HA-leu1+ ade6+
This study
FY5413 h- cdc21-GFP::ura4+ Δcdc19::[cdc19V5::leu1+] leu1-
32::nmt1-mcb1D78HA-leu1+ ade6+
This study
FY5414 h- cdc21-GFP::ura4+ Δcdc19::[cdc19V5::leu1+] leu1-
32::nmt1-mcb1D9HA-leu1+ ade6+
This study
FY5415 h- cdc21-GFP::ura4+ Δcdc19::[cdc19V5::leu1+] leu1-
32::nmt1-mcb1D22HA-leu1+ ade6+
This study
FY5417 h- Δmcb1::ura4+ leu1::nmt1-mcb1gHA-leu1+ ura4-
D18 leu1-32 ade6-M216
This study
FY5419 h- Δmcb1::ura4+ leu1::nmt1-mcb1D2HA-leu1+ ura4-
D18 leu1-32 ade6-M216
This study
FY5421 h- Δmcb1::ura4+ leu1::nmt1-mcb1D22HA-leu1+ ura4-
D18 leu1-32 ade6-M216
This study
FY5499 h- Δmcb1::ura4+ leu1::nmt1-mcb1D2HA-leu1+
Δchk1::ura4+ ura4-D18 leu1-32 ade6-M216
This study
FY5500 h- Δmcb1::ura4+ leu1::nmt1-mcb1D22HA-leu1+
Δchk1::ura4+ ura4-D18 leu1-32 ade6-M216
This study
FY5501 h- Δmcb1::ura4+ leu1::nmt1-mcb1D2HA-leu1+
Δcds1::ura4+ ura4-D18 leu1-32 ade6-M216
This study
FY5503 h+ Δmcb1::ura4+ leu1::nmt1-mcb1D22HA-leu1+
Δcds1::ura4+ ura4-D18 leu1-32 ade6-M216
This study
FY5505 h- Δmcb1::ura4+ leu1::nmt1-mcb1D2HA-leu1+
Δrad3::ura4+ ura4-D18 leu1-32 ade6-M216
This study
FY5506 h- Δmcb1::ura4+ leu1::nmt1-mcb1D22HA-leu1+
Δrad3::ura4+ ura4-D18 leu1-32 ade6-M216
This study

72

Chapter 3

S. pombe Rad8-mediated PCNA-ubiquitination contributes to replication fork
recovery

3.1 Introduction
DNA synthesis requires helicases to unwind the double-stranded DNA ahead of the
replication fork. The primary replicative helicase is the MCM complex, which travels
with the replication fork (reviewed in(Bochman and Schwacha, 2009; Forsburg, 2004). In
the presence of hydroxyurea (HU), which depletes the nucleotide pool, cells experience
increased DNA unwinding resulting in elevation of single-strand DNA (ssDNA), which
attracts replication protein A (RPA) (Nedelcheva et al., 2005; Nitani et al., 2008; Pacek et
al., 2006). The intra-S checkpoint is triggered by Rad3 phosphorylating Cds1 through
Mrc1 (Tanaka and Russell, 2004; Xu et al., 2006). Activated Cds1 stabilizes the
replication fork through Mcm4 (Bailis et al., 2008; Nitani et al., 2008), and inhibits Hsk1
(ScCdc7) function in activating late origin firing (Patel et al., 2008; Snaith et al., 2000;
Takeda et al., 2001).
In the absence of the normal checkpoint response, the MCM-helicase and
polymerases are uncoupled (Byun et al., 2005; Lopes et al., 2006). HU treated cds1∆
cells show a dramatic increase of RPA signal, corresponding to high levels of ssDNA.
Abnormal DNA synthesis continues until fork collapse. This leads to DNA double strand

73

breaks featured by increased level of phosphorylated histone H2A (X), and ultimately
activation of Chk1 (Sabatinos et al., 2012).
In response to DNA damage, such as alkylating agent methyl methanesulfonate
(MMS), cells slow down the rate of DNA synthesis (Willis and Rhind, 2009, 2010). Cds1
is responsible for the damage checkpoint signaling activation that contributes to the DNA
synthesis slows down, which likely reflects both reduced replication fork rate and
reduced origin firing (Merrick et al., 2004; Tercero and Diffley, 2001). Depending on the
density of the lesion (concentration of treatment), the checkpoint response could act
globally to all replication forks or locally to slow forks at the sites of the damage.
Stalled replication forks must resume movement and the blockage must be
removed to complete DNA replication. For HU treated wild type cells, a burst of RPA
foci followed by foci of HR protein Rad52 appears after the release from the drug (Carr
and Lambert, 2013; Meister et al., 2005; Sabatinos et al., 2012). Rad52 mediates the
exchange between RPA and the Rad51 nucleofilament (Lisby et al., 2001; Mortensen et
al., 2009; Symington, 2002). This is consistent with the involvement of HR in fork restart
(Bailis et al., 2008; Lambert et al., 2010; Meister et al., 2005). The HR intermediate at the
stalled forks needs to be resolved before normal replication resumes. This requires
specific helicase and nucleases. Srs2 helicase displaces Rad51 recombinase from the
nucleofilament (Krejci et al., 2003). Rqh1 (ScSgs1/BLM) helicase forms a complex with
the DNA topoisomerase, Top3, to resolve the double Holliday junctions resulting from
Rad51-mediated strand exchange (Ahmad and Stewart, 2005; Doe et al., 2000; Stewart et
al., 1997). The structure-specific endonuclease Mus81 is a Holliday junction resolvase

74

and is required to process stalled replication forks (Doe et al., 2002). Mus81 and Rqh1
appear to function collectively to eliminate toxic homologous intermediates (Dehe et al.,
2013; Willis and Rhind, 2009).
There is good evidence that one form of fork restart works through a fork
regression pathway, which facilitates template switching and recovery through formation
of a Holliday junction-like structure (reviewed in(Atkinson and McGlynn, 2009). The
essential enzymes are ATPases that can be classified as helicases or DNA translocases,
which contribute to both the initial regression and the restoration of the fork structure.
Evidence suggests that accumulation of RPA on ssDNA regulates this reaction (Betous et
al., 2013a; Sirbu et al., 2013).
The S. cerevisiae ScRad5 has helicase-related fork reversal and restart activity
(LiefshitzBlastyak et al., 2007; Minca and Kowalski, 2010). Its human orthologue HLTF
facilitates fork regression via its double-stranded DNA translocation activity (Blastyak et
al., 2010). Interestingly, S. cerevisiae that lacks ScRAD5 is HU sensitive (Kapitzky et al.,
2010; Kats et al., 2009). Moreover, HLTF is capable of displacing RPA and PCNA from
a replication fork model structure in vitro (Achar et al., 2011). Collectively, the evidence
suggests that fork regression activity from the helicase domain of this protein family
provides an important mechanism for fork restart.
Similar to ScRad5 and HLTF, Rad8 not only has a helicase domain, but also has
E3 ubiquitin ligase activity, which extends the ubiquitin chain on mono-ubiquitinated
PCNA on K164 (Frampton et al., 2006). This modification is proposed to channel post-
replication repair (PRR) through the error-free pathway by inhibiting translesion

75

synthesis (TLS) and promoting template switching (TS), or fork regression with its
helicase activity. Interestingly, both activities are required to bypass DNA damage at
stalled replication forks in S. cerevisiae (Minca and Kowalski, 2010). The modification
of PCNA by the PRR pathway is linked to completion of replication (Branzei et al.,
2004). The PRR pathway is also invoked to suppress gross chromosome rearrangements
and repeat associated expansions in budding yeast (Daee et al., 2007; Motegi et al., 2006;
Putnam et al., 2010). At least in the former case, this requires ScRad5 helicase domain.
These studies suggested that SpRad8 is a good candidate for fork regression and
template switching in response to replication stress in fission yeast. I performed a detailed
structure-functional analysis of Rad8 and identified its essential domains. Surprisingly,
and in contrast to data from budding yeast, I found no evidence for a role of the Rad8
helicase domain in the response to replication stress in S. pombe. Instead, its ubiquitin
ligase domain is required for Rad8 to promote restart in a variety of treatments. Genetic
studies suggest that the Fml1/2 helicase may contribute to fork restart in fission yeast.
Finally, an analysis of the drug sensitivity of a panel of nonessential helicase mutants
allows identification of distinct groups, suggesting specialized functions for specific
types of damage.

3.2 Results
3.2.1 Rad8 is required for response to MMS
rad8
+
is a non-essential gene. To understand how rad8
+
contributes to the damage
response, I tested rad8 ∆ sensitivity to different genotoxins (Figure 3.1A), and compared

76

this to using a commonly used rad8 truncation allele, rad8-190, that encodes a protein
product with a premature stop codon at amino acid 315. I also used a non-ubiquitinable
mutant of pcn1 (pcn1-K164R) as controls.
rad8 ∆ has no growth defect in the absence of drug, and no evidence for a meiotic
defect. It is very sensitive to MMS, and slightly sensitive to UV (ultraviolet, causes
thymine dimers and a range of inter- and intra-strand lesions). Surprisingly, and in
contrast to S. cerevisiae ScRad5, I observed no sensitivity to HU.
rad8∆ MMS sensitivity is not as severe as pcn1-K164R, probably because the
error-prone pathways are still functional in rad8∆ (Frampton et al., 2006). I also tested
rad8∆ sensitivity on CPT, a topoisomerase toxin that causes replication-fork collapse in S
phase (Wan et al., 1999). rad8∆ show no sensitivity on CPT (Figure 1A), while pcn1-
K164R is very sensitive, possibly due to a sumoylation mediated pathway involving the
same residue (Kai et al., 2007).
Interestingly, h
-
∆rad8 has increased sensitivity compared to h
+
∆rad8 when
exposed to MMS. (h
-
and h
+
are heterothallic strains with opposite mating types. They
can only mate with each other.) Similarly, mutants in homologous recombination genes
often are less viable in an h
-
than h
+
configuration, which is presumed to reflect the
absence of a template for repair of the mating type imprint and break required for
switching in the h
-
strain (Khasanov et al., 1999). This could suggest a role for Rad8 in
aspects of HR repair (discussed below). I used h
-
cells throughout the remainder of this
study.

77

S. pombe Rad8 was first identified as a member of SNF2 helicase family based on
sequence homology (Doe et al., 1993). Rad8 also has ubiquitin E3 ligase activity that
poly-ubiquitinates Pcn1 (ScPol30, hPCNA) together with the Mms2/Ubc13 E2
heterodimer (Frampton et al., 2006). To date, several domains have been identified in
Rad8 (Figure 3.1B), based on homology to ScRad5 and HLTF (Minca and Kowalski,
2010; Unk et al., 2010). Near the N-terminus is an uncharacterized HIRAN domain, a
motif shared by members of this family (HIP116, Rad5p N-terminal domain) (Iyer et al.,
2006). There is a SNF2 helicase domain including an ATP binding site. Importantly,
mutations that change the lysine and threonine to alanine (K538A T539A) in the ATP
binding site abolish helicase activity in ScRad5 (Chen et al., 2005; Minca and Kowalski,
2010). Rad8 also has a RING-type Zinc finger domain that confers ubiquitin E3 ligase
activity. A point mutation from isoleucine to alanine (I916A) in the RING-type Zinc
finger motif in ScRad5 abolished the E3 ubiquitin ligase activity by eliminating its
interaction with Ubc13 (Ulrich, 2003). I constructed mutations in these conserved
domains to assess their function in S. pombe.

78

Figure 3.1 Rad8 is required for response to MMS induced damage.
(A) Strains were grown overnight at 32 ℃, 1:5 serially diluted (right to left) and spotted
onto plain YES rich media (Control) and YES with indicated drugs. Plates were
incubated at 32 ℃ for 3 days if not indicated. bx=backcrossed to wildtype.(B) Schematic
representation of Rad8 functional domains. *represents the protein product of rad8-190,
where a premature stop codon at amino acid 315.

3.2.2 Structure-function analysis of Rad8
I looked at the localization of Rad8 first. I tagged endogenous Rad8 with GFP at its C-
terminus by replacing the rad8
+
stop codon with a GFP fragment. Although I detected
the tagged protein by Western blotting, I did not observe the GFP signal in vivo (data not
shown). This may reflect low protein levels. I integrated a linearized plasmid that carries

79

rad8-GFP under the nmt1 promoter in the rad8 ∆ strain at the leu1 locus. This promoter is
repressed in the presence of thiamine (Maundrell, 1993) When I overproduced Rad8-GFP
by growing the culture for 16 hours in thiamine free media, a distinctive nuclear localized
Rad8-GFP signal was observed (Figure 3.2A). I did not see any defect or growth
inhibition related to the overproduction of Rad8-GFP.
HIRAN stands for HIP116, Rad5p N-terminal domain. It has been suggested that
this domain recognizes specific DNA damage (Iyer et al., 2006), but it has never been
analyzed in vivo or in vitro. The Rad8 HIRAN domain spans amino acids 206 to 319 and
contains a potential NLS (nuclear localization signal) RKKSK between amino acids 245
and 251. The rad8-190 truncation allele expresses most of the HIRAN domain (amino
acid 1-314). I created a new 3’ truncation allele, rad8-HIRAN mutant that expresses only
the N terminus of Rad8 up to the end of the HIRAN domain, and a HIRAN deletion
mutant (rad8- ∆HIRAN) that precisely deletes amino acids 206-319. I found Rad8-
HIRAN-GFP (integrated into the leu1 locus under the nmt1 promoter in the rad8 ∆ strain)
localized in the nucleus (Figure 3.2B), while Rad8-∆HIRAN-GFP remains in the
cytoplasm (Figure 3.2C). This suggests that nuclear localization information resides in
the HIRAN domain.

80

Figure 3.2 Nuclear localization is necessary but not sufficient for Rad8 function.
(A)- (F) Localization of overproduced GFP proteins (A) Rad8-GFP (Bar: 10 μm) (B)
Rad8-HIRAN-GFP (C) Rad8- ∆HIRAN (D) Rad8- ∆HIRAN::SV40NLS (E) Rad8-
∆HIRAN::rad8NLS and (F) Rad8- ∆NLS (with schematic representations of Rad8
HIRAN related constructs on the right; not drawn to scale) (G) Drug sensitivity of
indicated strains with mutations at their native loci. Strains were grown overnight at 32 ℃,
1:5 serially diluted (right to left) and spotted to plain YES rich media (Control) and YES
with indicated drugs. Plates were incubated at 32 ℃ for 3 days.

Next, I replaced the entire HIRAN domain with SV40NLS (MAPKKKRKV),
and this restored the nuclear localization of Rad8 (Figure 3.2D). However, inserting the
putative Rad8NLS (RKKSK) in the same configuration restored the nuclear localization
poorly (Figure 3.2E). Finally, I created a smaller deletion (amino acids 246 to 250),
removing the RKKSK sequence (Rad8-∆NLS). This protein localized properly,
indicating this is not the primary NLS (Figure 3.2F).

81

To test the drug sensitivity of these mutants, I integrated them without GFP, and
under their own promoter, at the native locus using the Cre recombinase-mediated
cassette exchange (RMCE) system (Watson et al., 2008). I found rad8-HIRAN and rad8-
∆HIRAN phenocopy rad8 ∆ (Figure 3.2G). Importantly, restoration of nuclear localization
with SV40NLS did not rescue the drug sensitivity. Interestingly, the Rad8-∆NLS strains
was modestly sensitive (Figure 3.2G). Taken together, I show that nuclear localization
signal is necessary but not sufficient for Rad8 function and demonstrated the importance
of the HIRAN domain.
Using the same strategies, I looked at localization and drug sensitivity of Rad8
proteins containing point mutations in the putative helicase or ring finger domains. The
point mutants correspond to the separation-of-function mutants in S. cerevisiae (Chen et
al., 2005; Minca and Kowalski, 2010). I found that similar to rad8
+
, the helicase-dead
mutant rad8-K535A, T536A (rad8-AA), ubiquitin ligase-dead mutant rad8-I879A (rad8-
IA), and the mutant with all three mutations rad8-K535A, T536A, I879A (rad8-AAA) were
all nuclear localized (Figure 3.3A-D). Surprisingly, and different from S. cerevisiae
(Minca and Kowalski, 2010), the rad8 helicase-dead (rad8-AA) mutant did not affect the
damage response in chronic or acute treatment with MMS (Figure 3.3E, F) nor other
treatments (Figure 3.3E). On the other hand, Rad8 ubiquitin ligase is essential for MMS
damage response (Figure 3.3E, F). The protein levels of the mutants are similar (Figure
3.3G), so loxp insertion in front of the rad8 start codon did not contribute to the
phenotype difference. Interestingly, both no ligase (rad8-IA) and the double mutant

82

(rad8-AAA) show less drug sensitivity compared to rad8 ∆. This suggests that Rad8 may
play some other functions, perhaps structural.

Figure 3.3 The Ring finger is essential for Rad8 damage response.
(A)- (D) Localization of overproduced GFP proteins (A) Rad8-GFP (Bar: 10 μm) (B)
Rad8-AA-GFP, helicase dead (C) Rad8-IA-GFP, ubiquitin ligase dead and (D) Rad8-
AAA-GFP, double mutant (E) Drug sensitivity of indicated strains with mutations at their
native loci. Strains were grown overnight at 32 ℃, 1:5 serially diluted (right to left) and
spotted to plain YES rich media (Control) and YES with indicated drugs. Plates were

83

incubated at 32 ℃ for 3 days. (F) Relative survival curves of indicated mutants to acute
drug exposure. HU (left), MMS (right) (G) Protein level of rad8 mutants. rad8 mutants
were tagged with 5FLAG C terminally. Mcm7 was used as a loading control. loxp
insertion in front of the rad8 start codon.

3.2.3 Epistasis analysis with genes in postreplication repair (PRR) pathways
The PRR pathways play an important role in repair of DNA alkylation damage
(Figure 1.4) (reviewed in(Ghosal and Chen, 2013). Rad8 has been implicated in
antagonizing error-prone translesion synthesis polymerases Kpa1 (missing in S.
cerevisiae/Polκ), Rev3 and Rev7 (ScRev3 and ScRev7/Polξ), and Eso1 (ScRad30/Polη).
It channels the PRR to the error-free sub-pathway by poly-ubiquitinating Pcn1
(ScPol30/PCNA) and promoting fork reversal (LiefshitzBlastyak et al., 2007;
Ramasubramanyan et al., 2010; Unk et al., 2010). I combined rad8 ∆ with different PRR
mutants and examined their sensitivity to MMS, UV, HU and CPT. As expected, rad8 is
in a common epistasis group with rhp18 and mms2 (Figure 3.4A). The double mutant of
pcn1-K164R and rad8 ∆ shows increased MMS sensitivity, while the pcn1-K164R rad8-
AA double mutant is dramatically sensitive to MMS. In contrast, loss of rad8 or its
ubiquitin ligase activity (rad8-IA) partially suppressed pcn1-K164R CPT sensitivity
(Figure 3.4B). Deletion of the SUMO ligase, pli1, also rescues pcn1-K164R CPT
sensitivity (Kai et al., 2007). Our results suggest that rad8 may contribute to the SUMO
pathway.
Srs2 promotes fork reversal in repetitive sequences (Kerrest et al., 2009), and
contributes to fork restart and template switching at stalled forks (Lambert et al., 2010).
In budding yeast, Srs2 is recruited by sumoylated PCNA to prevent recombination during

84

S phase and PRR (Papouli et al., 2005; Pfander et al., 2005). The Scsrs2 mutant
suppresses the damage sensitivity of rad18 mutant, possibly by opening up a
recombination-based pathway for repair (Papouli et al., 2005). In contrast, in S. pombe,
deletion of srs2 does not rescue rph18∆ CPT sensitivity, possibly because of overlapping
mechanisms that repress recombination (Kai et al., 2007). I observed no change in MMS
sensitivity but increased CPT sensitivity of the srs2∆ rad8 ∆ double mutant (Figure 3.4b),
suggesting they overlap in CPT response. Unexpectedly, deletion of rad8 rescues srs2 ∆
HU sensitivity, suggesting it operates in opposition to its function in CPT induced
response.
TLS polymerases promotes the error-prone subpathway of PRR. rad8 ∆ was less
viable to MMS and UV treatments compared to strains missing the TLS pols (Figure
3.4C). A multiple deletion mutant showed increased sensitivity compared to the parents,
consistent with mutation in both arms of the pathway. These are consistent with the
model that the PRR pathways are the major mechanism to respond to MMS and UV
damage, and the error-free pathway is preferred.

85

Figure 3.4 Rad8 functions in the PRR pathway and may play a role in recovery
from HU exposure
Strains were grown overnight at 32 ℃, 1:5 serially diluted (right to left) and spotted to
plain YES rich media (Control) and YES with indicated drugs. Plates were incubated at
32℃ for 3 days if not indicated.

3.2.4 rad8 interacts with recombination genes
Homologous Recombination (HR) proteins provide an alternative mechanism for fork
restart (reviewed in(Carr and Lambert, 2013; Lambert and Carr, 2013). In typical HR,
Rad52 interacts with Rad51 and RPA to catalyze the exchange of RPA for Rad51
(reviewed in(Mortensen et al., 2009). Rad51 coats ssDNA nucleoprotein filaments then
invades duplex DNA and search for homology (reviewed in(San Filippo et al., 2008).
Rad54 is a helicase that interacts with Rad51 and is required for Rad51-dependent strand
invasion (Muris et al., 1996) (Tsutsui et al., 2001) (Maki et al., 2011) and also promotes

86

branch migration (Bugreev et al., 2007; Bugreev et al., 2006). Rad51 and Rad54
cooperatively stimulate fork regression (Bugreev et al., 2011). Rad55 and Rad57,
paralogs of Rad51, form a heterodimer that functions with RPA to promote DNA strand
exchange and stabilize Rad51, overlapping with the alternative Swi5/Sfr1 complex
(Akamatsu et al., 2007; Dziadkowiec et al., 2013; Haruta et al., 2008; Liu et al., 2011a;
Sung, 1997).
Consistent with observations from others (Frampton et al., 2006), a rad8∆ rad51 ∆
mutant is severely growth-impaired even without genotoxins (Figure 3.5A). This suggests
that in the absence of rad8, some toxic structures or rearrangements became rad51-
dependent, and vice-versa. This may depend on PCNA modification, since rph18∆
rph51 ∆ also shows a synthetic growth defect (Kai et al., 2007). In contrast, rad8∆
actually suppressed rad52-H6 CPT sensitivity (Figure 3.5B).
In contrast to rad51∆ rad8∆, the rad54 ∆ rad8 ∆ double mutant has only a slight
defect in growth, indicating that the rad51∆ synthetic phenotype is independent of strand
invasion via Rad54. There is no striking change in MMS or CPT sensitivity, but the
rad54∆ rad8∆ strain is significantly impaired even on low doses of HU (Figure 3.5C).
Increased sensitivity on MMS in the rad55 ∆rad8 ∆ and the rad57 ∆rad8 ∆ strains is
consistent with HR being a parallel pathway to PRR.

87

Figure 3.5 rad8 genetically interacts with genes involved in homologous
recombination.
Strains were grown overnight at 32 ℃, 1:5 serially diluted (right to left) and spotted to
plain YES rich media (Control) and YES with indicated drugs. (B) Plates were incubated
at 25℃ for 5 days. (A)(C) Plates were incubated at 32 ℃ for 3 days.

3.2.5 Do FML proteins provide the fork reversal function?
The absence of an HU-associated phenotype, and the apparent lack of requirement of the
Rad8 helicase domain for damage response, suggests that some other helicase/translocase
is responsible for the fork regression activity that has been associated with ScRad5, when
cells are exposed to MMS or HU. A good candidate is Fml1 (ScMph1/FANCM), which
is capable of fork reversal and promotes recombination at stalled replication forks

88

(Blackford et al., 2012; Gari et al., 2008; Nandi and Whitby, 2012; Prakash et al., 2005a;
Schurer et al., 2004; Sun et al., 2008; Zheng et al., 2011). S. pombe has two Fml proteins:
Fml1 and its paralog, Fml2. Fml2 plays a minor role (Sun et al., 2008). I investigated
whether Rad8 is functionally redundant with the Fml proteins by testing the drug
sensitivity of double and triple mutants (Figure 3.6A).
The mutants showed no growth defect in plate assays in the absence of replication
stress, although the triple mutant was slightly elongated and grew more slowly in liquid
media (data not shown) compared to in plate assays. fml1 ∆ rad8 ∆ shows an increased
sensitivity to MMS, UV, CPT, and HU, relative to the parents, indicating that they are not
in a simple epistatic pathway. The triple mutant fml1 ∆ fml2 ∆ rad8 ∆ is hypersensitive to
MMS, UV, and HU, indicating a role for Rad8 in HU response when the Fml proteins are
missing.
pcn1-K164R fml1 ∆ fml2 ∆ phenocopies fml1 ∆ fml2 ∆ rad8 ∆ (Figure 3.6A, C).
Moreover, the rad8-AA (helicase dead) mutant rescues the drug sensitivity of the fml1 ∆
fml2 ∆ rad8 ∆ triple mutant, and this suppression is abolished by pcn1-K164R, indicating
that it is dependent upon PCNA modification (Figure 3.6B). Taken together, it suggests
that the drug-sensitive phenotype of rad8 in all these cases is linked to ubiquitylation of
PCNA.

89

Figure 3.6 Fml1 and Rad8 are functionally redundant Strains were grown overnight
at 32 ℃, 1:5 serially diluted (right to left) and spotted to plain YES rich media (Control)
and YES with indicated drugs. Plates were incubated at 32 ℃ for 3 days.

90

3.2.6 Evidence for a role in resection
Fork reversal is counteracted by resection (Cotta-Ramusino et al., 2005). The MRN
(Mre11-Rad50-Nbs1) complex plays a major role in recognizing DNA double-strand
breaks (DSBs) and promoting resection (reviewed in(Stracker and Petrini, 2011). The
initial stages of resection work through an MRN-Ctp1 complex (Limbo et al., 2007). In
turn, this initial event promotes Exo1 mediated bulk resection (Mimitou and Symington,
2008). Dna2 has overlapping function with Exo1 to promote resection and prevent fork
regression (Hu et al., 2012; Karanja et al., 2012). This function of Dna2 mainly depends
on its nuclease domain (Hu et al., 2012), since the substrates of Dna2 helicase domain are
destroyed by its nuclease activity (Levikova et al., 2013). Recent work shows that the
single-stranded DNA binding protein RPA plays a significant role in promoting resection
(Chen et al., 2013a). In its absence, the 3’ strand loss and generation of hairpin structures
may lead to a destabilized genome. PCNA promotes processive Exo1 resection by
tethering Exo1 to the DNA substrate (Chen et al., 2013b). The human orthologue HLTF
is capable of displacing RPA and PCNA from a replication fork model structure in vitro
(Achar et al., 2011).
Given the requirement for PCNA in resection, I investigated whether Rad8
interacts genetically with resection-associated genes. I found no significant synthetic
phenotypes with MRN components (Figure 3.7A). However, rad8 ∆ shows a substantial
synthetic phenotype with exo1 ∆ on MMS, which phenocopies the mre11∆ exo1 ∆ double
mutant (Tsubouchi and Ogawa, 2000). This effect depends on the Rad8 ubiquitin ligase
domain (Figure 3.7B). This suggests that Rad8 modification of PCNA is in an epistasis

91

group with the MRN complex and may be required for short-range resection.
Interestingly, similar to pcn1-K164R rad8-IA (Figure 3.4B), loss of ubiquitin ligase
activity partially suppressed the CPT sensitivity of exo1 ∆ (Figure 3.7B), implicating
PCNA modification in a distinct process.

92

Figure 3.7 Rad8 ligase activities may facilitate resection
Strains were grown overnight at 32 ℃, 1:5 serially diluted (right to left) and spotted to
plain YES rich media (Control) and YES with indicated drugs. (A, B, D) Plates were
incubated at 32 ℃ for 3 days. (C) Plates were incubated at 25 ℃ for 5 days

I next examined additional components. rad8 ∆ dna2-K961T double mutant
became sensitive to HU and even more so to MMS and UV (Figure3.7D). dna2-K961T
lacks helicase activity (Hu et al., 2012), and the single mutant is not sensitive to DNA
damaging drugs at the dosages I used. In contrast, a dna2
ts
rad8 ∆ double mutant is
sensitive to UV and shows only slight sensitivity to MMS while not being sensitive to
HU at all. dna2
ts
has defective nuclease activity, and dna2-K961T could complement its
growth (Hu et al., 2012). Dna2 helicase activity is thus required for damage response in
the absence of Rad8.
In S. pombe, rad11
+
is the essential gene that encodes the largest subunit of the
trimeric RPA (Parker et al., 1997) I found rad11A
ts
is sensitive to genotoxic drugs at
permissive temperature (Figure 3.8A). rad8 ∆ increased rad11A
ts
MMS and UV
sensitivity, yet rescued its HU sensitivity. In asynchronous cells, rad8 ∆ accumulated a
similar amount of RPA foci as untreated growing wild type cells (Figure 3.8B).

93

Figure 3.8 Rad8 may contributes to RPA removal
(A) Strains were grown overnight at 32 ℃, 1:5 serially diluted (right to left) and spotted to
plain YES rich media (Control) and YES with indicated drugs. Plates were incubated at
25℃ for 5 days. (B) A representative distribution of nuclei containing 0, 1, or ≥2 RPA-
CFP foci in asynchronous untreated cells. More than 150 cells were counted for each
strain.

94

3.2.7 Rad8 contributes to fork stability
Finally, I examined activities known to be involved with stabilization of the replication
fork and resolution of stalled structures. Mus81 is a structure-specific endonuclease that
cleaves stalled forks and prevents gross chromosomal rearrangement (Boddy et al., 2001;
Chen et al., 2001; Doe et al., 2002; Osman and Whitby, 2007; Regairaz et al., 2011).
Studies suggested that Cds1 physically interacts with Mus81 at aberrant DNA structures,
such as collapsed forks, and regulates its function by phosphorylation-induced chromatin
dissociation (Boddy et al., 2000; Kai et al., 2005). Unregulated Mus81 is thought to cause
the breaks associated with fork collapse ((Froget et al., 2008)). Both Mus81 and Cds1
contribute to slowing replication in the presence of MMS (Willis and Rhind, 2009). I
found that both mus81 ∆ rad8 ∆ and cds1∆ rad8 ∆ showed increased sensitivity to MMS
plates (Figure 3.9A, B). Using my rad8 point mutants combined with cds1∆, I examined
viability loss during acute MMS exposure. cds1∆ rad8∆ and cds1∆ rad8-IA (ligase
mutant) showed a similar drop in viability, indicating that the E3 activity is particularly
important. The inactivation of Rad8 ligase activity, not rad8 ∆ and rad8-AA (no helicase),
partially rescued cds1 ∆ CPT and HU sensitivity (Figure 3.9B). This suggests that both
Cds1 and the Rad8 ligase domain inhibit the Rad8 helicase domain (Figure 3.9D).
Mrc1, Swi1 and Swi3 form the Fork Protection Complex (FPC) which stabilizes
the replication fork in the presence of stress and is required for the MMS response
(Noguchi et al., 2004; Sommariva et al., 2005). In addition to the function in fork
protection, Mrc1 is also a replication checkpoint adaptor protein that facilitates Cds1
activation by Rad3-Rad26 (Tanaka and Russell, 2001; Zhao and Russell, 2004; Zhao et

95

al., 2003). The replication checkpoint activity of Mrc1 is abolished in mrc1-AQ mutant
(Xu et al., 2006). Deletion of rad8 increased the sensitivity of swi1 ∆, swi3 ∆, and mrc1 ∆
to MMS and UV (Figure 3.9EF). Loss of Rad8 ubiquitin ligase activity was the major
contributor of this phenotype (Figure 3.9F). I saw a strong synthetic phenotype of pcn1-
K164R swi1 ∆ (Figure 3.9F).

96

97

Figure 3.9 Rad8 works in parallel with replication checkpoint, and fork protection
complex to maintain fork stability.
(ABDE) Strains were grown overnight at 32 ℃, 1:5 serially diluted (right to left) and
spotted to plain YES rich media (Control) and YES with indicated drugs. Plates were
incubated at 25℃ for 5 days. (C) Relative survival curves of indicated mutants to acute
MMS exposure.

3.2.8 An analysis of the drug sensitivity of nonessential helicase mutants
Together, these results indicate a central role for PCNA poly-ubiquitylation in response
to a variety of responses. However, none of these data convincingly demonstrate a role
for the Rad8 helicase domain. I hypothesized that Rad8 might be redundant with other
helicases in S. pombe, which has 23 annotated non-essential helicases (Table 1.1), many
of them are not characterized. I isolated the deletion mutants from the Bioneer S. pombe
Deletion Mutant Library and challenged them with commonly used DNA damaging
drugs or treatment, along with the other deletion mutants in our lab collection. I identified
five distinct groups (I-V) based on their pattern of drug sensitivity (Table 3.1). These
results suggest that the specific types of damage require specialized helicase to function,
and provides a fingerprint for each helicase.
Next, to find out if there are helicases that are functionally redundant to Rad8, I
combined rad8 ∆ with deletion mutants of non-essential helicases or conditional mutants
of essential helicases, and screened for synthetic growth defects and drug sensitivity
(Table 3.2). I categorized the double mutants into three groups: 1) no synthetic defects; 2)
increased drug sensitivity, and 3) mixed drug sensitivity. I found Rad8 is mostly
redundant to the helicases in group III (helicases those regulate HR), group IV (helicases

98

those are HR-associated) and group V (helicase that is MMS specific). Some interesting
double mutants have been presented in the results section. The double mutant drug
sensitivity fingerprint is a very powerful tool. One example: SpChl1 is the ortholog of
human FANCJ, which belongs to the same epistasis group as SpFml1 (hFANCM). Using
the fingerprint, I found the chl1 ∆ rad8∆ double mutant in the same group as the fml1 ∆
fml2 ∆ rad8 ∆ triple mutant. It is worth pointing out that the double mutant fingerprints do
not rule out a contribution of Rad8 ubiquitin ligase domain. Ideally, a Rad8 helicase dead
mutant should be used instead.

99

Table 3.1: An analysis of the drug sensitivity of non-essential helicase mutants
Group genotype orthologs growth HU MMS UV CPT

I: no
phenotype
∆hrp3 hCHD1, 2
ScChd1
- - - - -
∆fml2 hFANCM
ScMph1
- - - - -
∆rrp1 hTTF2
ScUls1
- - - - -
∆rrp2 hHLTF
ScUls1
- - - - -
∆SPBC3B8.12* ScIrc3 - - - - -
∆SPBC582.10C ScRad16 - - - - -
∆rdh54 hRAD54B
ScRdh54

-

-

-

-

-
∆SPCC737.07c hIGHMBP2
ScHcs1
- - - - -
∆tlh2 NA - - - - -
∆SPAC144.05 hSHPRH
ScIRC20
- - - - -
∆rhp55 hRAD51B
ScRad55
- - - - -

II:
response
to protein
barriers
∆snf22 hSMARCA4
ScSth1, ScSnf2

-

-

-

-

↓
∆hrp1 hCHD1, 2
ScChd1
- - - - ↓↓
∆swr1 hEP400, hSRCAP
ScSwr1

-

-

-

-

↓↓
∆SPBC15C4.05# hDHX29 - - - - ↓↓↓
III:
regulates
HR
∆srs2 ScSrs2 - ↓ - - ↓↓
∆SPAC694.02* hDDX60
hDDX60L
- ↓↓ - - ↓↓↓

IV:
HR-
associated

∆chl1 hFANCJ
ScChl1
- ↓ ↓ ↓ ↓
∆fml1 hFANCM
ScMph1
- ↓ ↓↓ ↓ ↓
∆fbh1 hFBXO18 - ↓ ↓↓ ↓↓ ↓
∆rqh1 hWRN, hBLM
ScSgs1
- ↓↓ ↓↓ ↓↓↓ ↓↓↓
∆rhp54 hRAD54L
ScRad54
↓ ↓↓ ↓↓↓ ↓↓ ↓↓↓
∆rhp57 hXRCC3
ScRad57
- ↓ ↓↓ ↓ ↓↓↓

V:
MMS
specific
∆rhp26 hXRCC3
ScRad26
- - ↓ - -
∆rad8 HLTF, SHPRH
ScRad8
- - ↓↓ ↓ -
The level of sensitivity is scored by the fitness on the drug plates. No difference from wildtype is labeled as
“-”. The level of growth defect is scored by number of “↓”. NA = not available. h = Homo sapiens. Sc =
Saccharomyces cerevisiae. HR = Homologous recombination. # RNA/DNA helicase. * RNA helicase

100

Table 3.2. An analysis of rad8 genetic interaction with other helicase mutants
Group genotype growth HU MMS UV CPT
1)
no synthetic
defects
∆hrp3 ∆rad8 - - - - -
∆tlh2 ∆rad8 - - - - -
∆hrp1 ∆rad8 - - - - -
∆swr1 ∆rad8 - - - - -
∆rdh54 ∆rad8 - - - - -
∆snf22 ∆rad8 - - - - -
∆rrp1 ∆rad8 - - - - -
∆rrp2 ∆rad8 - - - - -
∆SPBC3B8.12 ∆rad8 - - - - -
∆SPBC15C4.05 ∆rad8 - - - - -
∆SPBC582.10C ∆rad8 - - - - -
∆SPAC694.02 ∆rad8 - - - - -
∆ SPCC737.07c ∆rad8 - - - - -
∆SPAC144.05 ∆rad8 - - - - -
cdc21-M68 ∆rad8 - - - - -
cdc21-C84 ∆rad8 - - - - -

2)
Increased
drug
sensitivity
∆rhp26 ∆rad8 - - ↓↓ - -
∆fbh1 ∆rad8 - - ↓ ↓ -
∆rqh1 ∆rad8 - ↓ ↓↓ ↓ ND
∆rhp54 ∆rad8 ↓ ↓↓↓ - ↓ -
∆rhp55 ∆rad8 ↓ ↓↓ ↓↓ ↓↓ ↓↓
∆rhp57 ∆rad8 - ↓ ↓ ↓ ↓
pfh1-R20 ∆rad8 - ↓ ↓ - -
dna2-K961T ∆rad8 - ↓ ↓↓ ↓ ND
dna2-ts ∆rad8 - - ↓ ↓ -
∆fml1 ∆rad8 - ↓↓ ↓↓ ↓↓ ↓↓
∆fml2 ∆rad8 - - ↓ - -
3)
mixed drug
sensitivity
∆fml1 ∆fml2 ∆rad8 -
elongated
↓↓ ↓↓↓ ↓↓ ↑
∆chl1 ∆rad8 - - ↓↓ - ↑
∆srs2 ∆rad8 - ↑ ↓ - ↓↓

The level of sensitivity is scored by the fitness on the drug plates. No difference from the either of the
single mutants is labeled as “-”. The level of increased drug sensitivity is scored by number of “↓”. The
level of reduced drug sensitivity is scored by number of “↑”. ND = not determined.

3.3 Discussion
There are many essential and non-essential DNA helicases in the cell. They are motor
proteins that use ATP hydrolysis as an energy source to unwound DNA. In the presence
of replication stress, such as due to HU exposure, the replicative helicase encoded by the

101

MCM complex partly uncouples from polymerases and creates ssDNA regions
(Nedelcheva et al., 2005; Nitani et al., 2008; Pacek et al., 2006). In the presence of a
DNA damaging drug, replication forks slow down (Willis and Rhind, 2009, 2010). Fork
restart can be facilitated by many mechanisms, including fork regression, which is
mediated by specialized, often non-essential DNA helicases, such as ScRad5 and SpFml1
(LiefshitzBlastyak et al., 2007; Minca and Kowalski, 2010; Sun et al., 2008). These
enzymes may function as DNA translocases; the human ortholog of Rad8 (HLTF) is
capable of displacing RPA and PCNA from a replication fork model structure in vitro
(Achar et al., 2011). Helicase activity associated with ScRad5 is also linked to
suppression of duplication-associated rearrangements (Putnam et al., 2010). Other
helicases in the SNF2 family in mammals, e.g., SMARCAD and SMARCAL1 proteins
(both missing from S. pombe), are also implicated in fork regression and restart (Betous
et al., 2013b; Costelloe et al., 2012; Couch et al., 2013).
S. pombe rad8
+
is a nonessential gene known to be involved in postreplication
repair following MMS damage, and contributes to polyubiquitylation of PCNA
(Frampton et al., 2006). I hypothesized that Rad8 is a helicase required for fork
regression. Surprisingly, I found that rad8∆ mutants have no sensitivity to HU in S.
pombe (unlike the case in S. cerevisiae). I created separation-of-function alleles by
mutating the three different domains in Rad8: the HIRAN domain, associated with
members of this family (Iyer et al., 2006), the helicase domain, and the ubiquitin ligase
domain. I showed that the HIRAN domain is essential for Rad8 localization; however,

102

nuclear localization is not sufficient for Rad8 function in the absence of other elements of
this domain. An effect of this deletion mutation on protein structure cannot be eliminated.
I constructed point mutations in highly conserved residues in both the helicase
and ubiquitin ligase domains, the equivalent of which are shown in the S. cerevisiae
orthologue, ScRad5, to specifically target those activities. Mutations in the ubiquitin
ligase domain abolished Rad8 function in MMS, similar to S. cerevisiae, and consistent
with its role in poly-ubiquitylation of PCNA. However, there was no phenotype
associated with the helicase mutation in the PRR pathway, leading to the conclusion that
any helicase function is associated with the helicase mutation. Either Rad8 does not
function as a helicase, or is redundant with another helicase in the response to MMS and
HU.
I took a candidate approach to examine other proteins that may overlap with Rad8,
particularly in fork restart following HU treatment. The FANCM homologues Fml1 and
Fml2 are good candidates (Nandi and Whitby, 2012; Sun et al., 2008). In budding yeast,
the related ScMPH1 protein is linked to a recombination-related PRR pathway (Schurer
et al., 2004). rad8∆ or the rad8-IA ligase mutant shows a synthetic phenotype on MMS
combined with fml1∆ fml2∆, which is consistent with an overlapping pathway. I found
that the fml1∆ fml2 ∆ rad8 ∆ triple mutant is sensitive to HU. However, the phenotype is
associated with the loss of ubiquitin ligase or its target PCNA site, instead of the helicase
activity of Rad8 and may be related to observations suggesting that PCNA ubiquitylation
is involved in replication termination or ligase stress (Branzei et al., 2004; Das-Bradoo et
al., 2010b; Nguyen et al., 2013).

103

Four mutants showed increased HU sensitivity in combination with rad8∆,
suggesting a redundant or overlapping activity in replication fork stabilization or restart.
The rad54∆ and rad55∆ mutants are both HR proteins, and HR is linked to fork restart
(Bugreev et al., 2011; Lambert et al., 2010; Meister et al., 2005). exo1∆ is required for
resection. The dna2-K961T mutant lacks the helicase activity associated with dna2.
(Experiments are in progress to determine whether this is linked to Rad8 helicase domain.)
This suggests that Rad8 is required for an alternative pathway when the primary fork
restart mechanism is absent.
Unlike rad8 ∆ rad54 ∆ double mutant, fml1 ∆ rad54∆ double mutant showed no
reduction in viability or additional drug sensitivity relative to the rad54∆ single mutant
(Sun et al., 2008). This indicates that the Fml proteins may participate with Rad54-
mediated HR pathways, which is parallel to Rad8 function. Interestingly, I found rad8∆
decreases the HU sensitivity associated with srs2 ∆, which suggest that Rad8 may create
structures that need Srs2 to resolve. rad8 ∆ also decreases the HU sensitivity of rad11A
ts
.
This suggests that Rad8 may antagonize Rad11, so removing Rad8 helps stabilize Rad11.
The rad8 ∆ rad51∆ double mutant show dramatic reduction of viability in the
absence of any stress at all, which suggests that Rad8 and Rad51 overlap in the resolution
of abnormal structures associated with normal replication. The lack of such a phenotype
with other HR proteins suggests that Rad51 has unique activities that do not require the
typical HR pathway. rad8 ∆ rad54 ∆ double mutant show dramatic increased HU
sensitivity. This is consistent with the evidence that both Rad51 and Rad54 contribute to
fork regression (Bugreev et al., 2011).

104

The loss of Rad8 ligase activity rescues pcn1-K164R CPT sensitivity.
Interestingly, deletion of pli1, a sumo ligase, also rescues pcn1-K164R CPT sensitivity
(Kai et al., 2007). This suggests a possible involvement of Rad8 in sumo pathway, which
can be easily tested by testing CPT sensitivity in the triple mutant.
I observe that rad8∆ mutants do not enhance the MMS phenotype associated with
MRN mutants, suggesting that they are in a common epistasis group. MRN with Ctp1
initiates the initial short-term resection (Limbo et al., 2007). In contrast, rad8∆ enhances
the phenotype associated with exo1∆, similar to that observed in double mutants between
exo1 and MRN strains. PCNA functions as a processivity factor for Exo1 (Chen et al.,
2013b). These data suggest that the initial MRN-dependent step may require PCNA
modification.
The loss of Rad8 ligase activity rescues the exo1 ∆ CPT sensitivity. Consistently, I
found that deletion of rad8 or removal of the ligase activity also rescues the CPT
sensitivity of pcn1-K164R, suggesting a link between resection and the CPT response.
These data suggest that Rad8 may participate in Exo1-mediated long range resection by
enhancing the interaction of Exo1 and its processivity factor PCNA via its ligase function.
The rad8 helicase dead allele shows almost no sensitivity to genotoxins. I found
two conditions in which the Rad8 helicase domain contributed to a phenotype. First, there
was heightened MMS sensitivity in pcn1-K164R mutant cells that retain Rad8 ligase
domain. This may be an indirect effect due to a dominant negative phenotype, or it may
reflect that the normal helicase is needed upon ubiquitylation of PCNA at K107 by Rad8
ubiquitin ligase activity (Das-Bradoo et al., 2010b), although that residue is not strictly

105

conserved in fission yeast. The second phenotype was a partial rescue of HU sensitivity
in cds1∆ cells that lacks Rad8 ligase domain. This indicates that Rad8 helicase domain is
suppressed by both Cds1 and Rad8 ligase domain.
In budding yeast, ScRad5 and PCNA ubiquitination are involved in suppression
of the GCRs and expansion of trinucleotide repeats (Daee et al., 2007; Motegi et al., 2006;
Putnam et al., 2010). Putnam and colleagues suggest that the helicase activity is required
to prevent GCRs. Daee and colleagues suggest that error-free PRR is involved in
resolving the stalled replication fork at the hairpin formed by short CAG or CTG repeats.
It is possible the Rad8 helicase domain is needed when PRR is absent, and PCNA K107
is ubiquitinated. Contrarily, Shishkin and colleagues found the expansion rates of long
GAA repeats were decreased in knockouts of ScRad5 (Shishkin et al., 2009). HLTF is
capable of removing RPA and PCNA from a replication fork model structure in vitro
(Achar et al., 2011), while RPA prevents formation of DNA hairpins (Chen et al., 2013a).
It is possible that the Rad8 helicase domain is involved in removing the RPA and
promotes hairpin formation, which is prone to FoSTeS (Fork stalling and template
switching) and GCRs (Mizuno et al., 2009; Mizuno et al., 2013). Further analysis needs
to be done to investigate the effect of Rad8 helicase mutant using these assays.
This study of Rad8 function in replication fork recovery is an example of how
non-essential helicases contribute to genome stability in S. pombe. Detailed analysis of
other non-essential helicases and double mutants based on their fingerprint of drug
sensitivity will likely uncover other mechanisms.

106

3.4 Methods and materials

3.4.1 Cloning of rad8+ gene and plasmid construction
The rad8+ gene was cloned in two steps. First two independent fragments from ATG to a
naturally occurring SpeI site within the ORF (rad8A) and from the SpeI site to the TAA
codon (rad8B) were amplified by PCR and cloned into a pBluescript vector. The
complete rad8
+
ORF was generated by ligating the rad8A fragment into rad8B
containing plasmid at XhoI and SpeI. Mutations were introduced separately in rad8A or
rad8B containing plasmids prior to generation of the full gene. Phusion Site-Directed
Mutagenesis Kit (Finnzymes) was used.

3.4.2 Strain construction
The ∆rad8::kanMX-Bioneer (FY5132) deletion was isolated from the Bioneer S.
pombe Deletion Mutant Library (V2-11-F11). It was backcrossed twice with a laboratory
wildtype strain, and both mating types were retained (FY5216: h
+
or FY5217: h
-
).
∆rad8::hphMX (FY5625: h
+
or FY5627: h
-
) was generated by replacing the kanamycin
resistant fragment of the Bionner deletion with hygromycin B resistant marker (Hentges
et al., 2005). ∆rad8::hphMX or backcrossed ∆rad8::kanMX-Bioneer was used to
construct double mutants. Strains were generated by tetrad dissection or random spore
analysis. LioAc-SDS extracted genomic DNA was used to confirm the genotypes as
needed (Looke et al., 2011). All S. pombe strains (Table 3.2) were constructed and
maintained in yeast extract plus supplement (YES) media or under selection in Edinburgh

107

minimal media (EMM) with appropriate supplements using standard techniques
(Forsburg and Rhind, 2006; Moreno et al., 1991; Sabatinos and Forsburg, 2010).

3.4.3 Constructing rad8 mutants at its endogenous locus
The rad8 mutants were created as described (Watson et al., 2008). The base strain
(FY5622: h
-
Δrad8::loxP-ura4
+
-loxM3 ura4-D18 leu1-32 ade6-M210 can1-1) was
constructed by replacing the entire rad8
+
ORF (from start to stop codon) with the loxP-
ura4
+
-loxM3 cassette that was amplified from the pAW1 plasmid (EUROSCARF-
P30537) using
primersTATACATGTTATTTTATATTTCTACAGTTTTTGGTAGCTTAAAGTTTGGATAAG
CAAACATTACCAAGAAACTCAATAAACGGATCCCCGGGTTAATTAA and
GTAGCAATTGCATTTCATATGCATAATATGAAAATACTTTTTTTTTACGATAGCTTTTA
ATCGGCTTGGTGAAACCGTTGGAATTCGAGCTCGTTTAAAC. Bold sequences
indicate the sequences homologous to pAW1. The wild type (pLD35) and mutated
plasmids (pLD36, pLD37, pLD38 and pLD39) were digested with XhoI and SacI, and
cloned into the pAW8-XhoI plasmid (EUROSCARF-P30585). The resulting plasmids
(pLD45: rad8
+
, pLD46: rad8- ∆HIRAN, pLD47: rad8-K535AT536A (rad8-AA), pLD48:
rad8-I879A, and pLD49: rad8-K535AT536AI879A (rad8-AAA)) were transformed into
the base strain and selected on EMM + Ade + thiamine plates. Transformants were grown
in nonselective thiamine-free media at 32 ℃ for 1 day, plated onto 5’-FOA plates and
incubated at 32 ℃ for 4 days. The 5-FOA resistant and leu
-
candidates were confirmed by
PCR (Looke et al., 2011) and verified by sequencing.

108

3.4.4 Serial dilution assays
Cells were grown to mid-log phase in YES. Five-fold serial dilutions were prepared and
spotted on drug containing rich media. The plates were incubated 5 days at 25 ℃, or 3
days at 32 ℃, if not otherwise indicated. Experiments were repeated at least twice to
ensure reproducible results.

3.4.5 Protein Extracts and immunoblotting
Total protein extracts were prepared using trichloroacetic acid (TCA) extraction as
described (Catlett and Forsburg, 2003). Protein samples were separated using 6% SDS-
PAGE. Western Blotting was carried out with anti-FLAG M2 (Sigma) used as primary
antibody followed by anti-mouse-IgG-HRP (Sigma) secondary antibody.

3.4.6 Microscopy
All images were taken on a DeltaVision core microscope using a GFP/mCherry
polychroic mirror and oil-immersion Olympus 60X lens with Numerical Aperture of 1.4.
Fifteen z-sections at 0.3 μm were taken and the projected images were reconstructed in
softWoRx 5.5, and assembled in Canvas 12.

109

Table 3.3 Yeast strains used in this study

Strain Genotype Source
FY11 h- ade6-M210 Our
stock
FY528 h+ his3-D1 ade6-M210 ura4-D18 leu1-32 Our
stock
FY527 h
-
his3-D1 ura4-D18 leu1-32 ade6-M216 Our
stock
FY5627 h- ∆rad8::hphMX his3-D1 ura4-D18 leu1-32 ade6-M210 This
study
FY5698 h- ∆rad8::hphMX leu1-32 ura4-D18 ade6-M210 his3-D1 This
study
FY5625 h+ ∆rad8::hphMX leu1-32 ura4-D18 ade6-M216 his3-D1 This
study
FY5699 h+ ∆rad8::hphMX leu1-32 ura4-D18 ade6-M210 his3-D1 This
study
FY444 h+ rad8-190 ade6.704 ura4-D18 leu1-32 Our
stock
FY1884 h- smt-0 ∆rhp51::ura4+ ura4-D18 leu1-32 ade6-M210 Our
stock
FY6785 h- smt-0 ∆rhp51::ura4+ ∆rad8::hphMX ura4-D18 leu1-32
ade6-M210
This
study
FY2452 h- rad22-H6-ts ura4-D18 leu1-32 ade6-M210 Our
stock
FY6799 h- rad22-H6-ts ∆rad8::hphMX ura4-D18 leu1-32 ade6-
M210
This
study
FY1866 h- smt-0 ∆rhp54::ura4+ ura4-D18 leu1-32 ade6-M216 Our
stock
FY6868 h- smt-0 ∆rhp54::ura4+ ∆rad8::hphMX ura4-D18 leu1-32
ade6-M216
This
study
FY1389 h- smt-0 ∆rhp55::ura4+ ura4-D18 Our
stock
FY6809 h- smt-0 ∆rhp55::ura4+ ∆rad8::hphMX ura4-D18 ade6-
M216
This
study
FY3770 h- smt-0 ∆rhp57::ura4+ his3-D1 ura4-D18 leu1-32
ade6-M210
Our
stock
FY6790 h- smt-0 ∆rhp57::ura4+ ∆rad8::hphMX his3-D1 ura4-D18
leu1-32 ade6-M210
This
study
FY6397 h- loxP-dna2-K961T-loxM3 ura4-D18 leu1-32 ade6-
704
(Hu et
al.,

110

2012)
FY6428 h- loxP-dna2- K961T-loxM3 ∆rad8::hphMX his3-D1
ura4-D18 leu1-32 ade6-M216
This
study
FY6452 h- dna2ts:ura4 ura4-D18 (Hu et
al.,
2012)
FY6505 h- dna2ts:ura4 ∆rad8::hphMX his3-D1 ura4-D18
ade6-M216
This
study
FY254 h- leu1-32 ade6-M210 ura4-D18 can1-1 Our
stock
FY6314 h- loxP-rad8
+
-loxM3 leu1-32 ade6-M210 ura4-D18 can1-1 This
study
FY6322 h- loxP-∆rad8-loxM3 leu1-32 ade6-M210 ura4-D18 can1-1 This
study
FY6316 h- loxP-rad8-∆HIRAN-loxM3 leu1-32 ade6-M210 ura4-D18
can1-1
This
study
FY6514 h- loxP-rad8∆HIRAN::SV40NLS-loxM3 leu1-32 ade6-M210
ura4-D18 can1-1
This
study
FY6516 h- loxP-rad8∆HIRAN::rad8NLS-loxM3 leu1-32 ade6-
M210 ura4-D18 can1-1
This
study
FY6518 h- loxP-rad8-∆NLS-loxM3 leu1-32 ade6-M210 ura4-D18
can1-1
This
study
FY6520 h- loxP-rad8-HIRAN-loxM3 leu1-32 ade6-M210 ura4-D18
can1-1
This
study
FY6314 h- loxP-rad8
+
-loxM3 leu1-32 ade6-M210 ura4-D18 can1-1 This
study
FY6322 h- loxP-∆rad8-loxM3 leu1-32 ade6-M210 ura4-D18 can1-1 This
study
FY6318 h- loxP-rad8-K535AT536A-loxM3 leu1-32 ade6-M210 ura4-
D18 can1-1
This
study
FY6320 h- loxP-rad8-I879A-loxM3 leu1-32 ade6-M210 ura4-D18
can1-1
This
study
FY6284 h- loxP-rad8-K535AT536AI879A-loxM3 leu1-32 ade6-M210
ura4-D18 can1-1
This
study
FY7012 h- loxP-rad8
+
-5FLAG::KanMX6 leu1-32 ade6-M210 ura4-
D18 can1-1
This
study
FY6905 h- loxP-rad8-K535AT536A-5FLAG::KanMX6 leu1-32 ade6-
M210 ura4-D18 can1-1
This
study
FY6959 h- loxP-rad8-I879A- 5FLAG::KanMX6 leu1-32 ade6-M210
ura4-D18 can1-1
This
study

111

FY5904 h
-
rad8-5FLAG::kanMX6 ade6-M216 ura4-D18 leu1-32
his3-D1
This
study
FY3123 h- ∆rhp18::ura4+ ura4-D18 leu1-32 ade6-704 Our
stock
FY6617 h- ∆rhp18::ura4+ ∆rad8::hphMX his3-D1 ura4-D18 leu1-
32 ade6-M704
This
study
FY6628 h- ∆mms2::leu2 his3-D1 ura4-D18 leu1-32 ade6-M210 Our
stock
FY6619 h- ∆mms2::leu2 ∆rad8::hphMX his3-D1 ura4-D18 leu1-
32 ade6-M210
This
study
FY6929 h- pcn1-K164R::ura4+ his3-D1 ura4-D18 leu1-32 ade6-
M210
This
study
FY6115 h- pcn1-K164R::ura4+ ∆rad8::hphMX his3-D1 ura4-D18
leu1-32 ade6-M210
This
study
FY6816 h- pcn1-K164R::ura4+ loxP-rad8-K535AT536A-loxM3
his3-D1 ura4-D18 leu1-32 ade6-M210
This
study
FY6875 h- pcn1-K164R::ura4+ loxP-rad8-I879A-loxM3
his3-D1 ura4-D18 leu1-32 ade6-M210
This
study
FY5128 h- ∆srs2::kan his3-D1 ura4-D18 leu1-32 ade6-M210 Our
stock
FY5744 h- ∆srs2::kan ∆rad8::hphMX his3-D1 ura4-D18 leu1-32
ade6-M210
This
study
FY4841 h- eso1::kanMX6 kpa1::bleMX6 rev3::hphMX6 his3-D1
ura4-D18 leu1-32 ade6-M216
Our
stock
FY6863 h- eso1::kanMX6 kpa1::bleMX6 rev3::hphMX6
∆rad8::hphMX his3-D1 ura4-D18 leu1-32 ade6-M216
This
study
FY5555 h- ∆fml1::natMX4 his3-D1 ura4-D18 leu1-32 This
study
(Sun et
al.,
2008)
FY6436 h- ∆fml1::natMX4 ∆rad8::hphMX his3-D1 ura4-D18 leu1-
32 ade6-M216

This
study
FY5587 h- ∆fml2:kanMX6-Bioneer leu1-32 ura4-D18 ade6-M216
his3-D1
This
study
FY5726 h- ∆fml2:kanMX6-Bioneer ∆rad8::hphMX his3-D1 ura4-
D18 leu1-32 ade6-M216
This
study
FY6936 h- ∆fml1::natMX4 ∆fml2::KanMX6 his3-D1 ura4-D18 This

112

leu1-32 study
(Sun et
al.,
2008)
FY5717 h- ∆fml1::natMX4 ∆fml2::KanMX6 ∆rad8::hphMX his3-D1
ura4-D18 leu1-32
This
study
FY6764 h- ∆fml1::natMX4 ∆fml2::KanMX6 loxP-rad8-
K535AT536A-loxM3 ura4-D18 leu1-32
This
study
FY6759 h- ∆fml1::natMX4 ∆fml2::KanMX6 loxP-rad8-
K535AT536AI879A-loxM3 ura4-D18 leu1-32 ade6-M210
This
study
FY6766 h- ∆fml1::natMX4 ∆fml2::KanMX6 loxP-rad8-I879A-
loxM3 his3-D1 ura4-D18 leu1-32
This
study
FY6825 h- pcn1-K164R::ura4+ ∆fml1::natMX4 ∆fml2::KanMX6
loxP-rad8-K535AT536A-loxM3 his3-D1 ura4-D18 leu1-32
ade6-M210
This
study
FY6826 h- pcn1-K164R::ura4+ ∆fml1::natMX4 ∆fml2::KanMX6
∆rad8::hphMX his3-D1 ura4-D18 leu1-32 ade6-M210
This
study
FY6257 h- ∆fml1::natMX4 his3-D1 ura4-D18 leu1-32 ade6-M216 This
study
(Sun et
al.,
2008)
FY6941 h- pcn1-K164R::ura4+ ∆fml1::natMX his3-D1 ura4-D18
leu1-32 ade6-M210
This
study
FY6948 h- ∆fml2::KanMX6 ura4-D18 leu1-32 ade6-M210 This
study
(Sun et
al.,
2008)
FY6946 h- pcn1-K164R::ura4+ ∆fml2::KanMX6 his3-D1 ura4-D18
leu1-32 ade6-M210
This
study
FY6932 h- pcn1-K164R::ura4+ ∆fml1::natMX4 ∆fml2::KanMX6
his3-D1 ura4-D18 leu1-32 ade6-M210
This
study
FY2732 h- ∆rad32::kanMX ura4-D18 leu1-32 ade6-M210 Our
stock
FY5892 h- ∆rad32::kanMX ∆rad8::hphMX his3-D1 ura4-D18
leu1-32 ade6-M216
This
study
FY2733 h- ∆rad50::kanMX ura4-D18 leu1-32 ade6-M210 Our
stock
FY5888 h- ∆rad50::kanMX ∆rad8::hphMX ura4-D18 leu1-32 This

113

ade6-M216 study
FY2734 h- ∆nbs1::kanMX ura4-D18 leu1-32 Our
stock
FY5895 h- ∆nbs1::kanMX ∆rad8::hphMX his3-D1 ura4-D18
leu1-32 ade6-M216
This
study
FY5428 h- ∆exo1::ura4+ ura4-D18 ade6-M210 Our
stock
FY6141 h- ∆exo1::ura4+ ∆rad8::hphMX ura4-D18 ade6-M210 This
study
FY6820 h- ∆exo1::ura4+ loxP-rad8-K535AT536A-loxM3
his3-D1 ura4-D18 leu1-32 ade6-M216
This
study
FY6879 h- ∆exo1::ura4+ loxP-rad8-I879A-loxM3 his3-D1 ura4-
D18 leu1-32 ade6-M216
This
study
FY790 h- rad11A-ts ura4-D18 leu1-32 ade6-M216 Our
stock
FY6797 h- rad11A-ts ∆rad8::hphMX his3-D1 ura4-D18 leu1-32
ade6-M210
This
study
FY3288 h- ∆mus81::KanMX ura4-D18 ade6-M210 Our
stock
FY6118 h- ∆mus81::KanMX ∆rad8::hphMX his3-D1 ura4-D18
ade6-M210
This
study
FY865 h- ∆cds1::ura4 ura4-D18 leu1-32 Our
stock
FY5739 h- ∆cds1::ura4+ ∆rad8::hphMX ura4-D18 leu1-32 This
study
FY6906 h- ∆cds1::ura4 loxP-rad8-K535AT536A-loxM3
ura4-D18 leu1-32 ade6-M216
This
study
FY6897 h- ∆cds1::ura4 loxP-rad8-I879A-loxM3
ura4-D18 leu1-32 ade6-M216
This
study
FY4685 h- ∆mrc1::kanMX6-Bioneer
his3-D1 ura4-D18 leu1-32 ade6-?
Our
stock
FY5742 h- ∆mrc1::kanMX6-Bioneer ∆rad8::hphMX
his3-D1 ura4-D18 leu1-32 ade6-M210

This
study
FY3529 h+ ∆mrc1::ura4+ leu1+::(mrc1(all S/TQ to AQ)-3HA)
ura4-D18 ade6?
Our
stock
FY5885 h- ∆mrc1::ura4+ leu1+::(mrc1(all S/TQ to AQ)-3HA)
∆rad8::hphMX his3-D1 ura4-D18 ade6-M210
This
study
FY3229 h- ∆swi3::KanMX ura4-D18 leu1-32 ade6-M210 Our

114

stock
FY5784 h- ∆swi3::KanMX ∆rad8::hphMX
his3-D1 ura4-D18 leu1-32 ade6-M210
This
study
FY3226 h- ∆swi1::kanMX his3-D1 ura4-D18 leu1-32 ade6-M210 Our
stock
FY5783 h- ∆swi1::KanMX ∆rad8::hphMX
his3-D1 ura4-D18 leu1-32 ade6-M210
This
study
FY6812 h- ∆swi1::KanMX loxP-rad8-K535AT536A-loxM3
his3-D1 ura4-D18 leu1-32 ade6-M210
This
study
FY6871 h- ∆swi1::KanMX loxP-rad8-I879A-loxM3
ura4-D18 leu1-32 ade6-M210
This
study
FY6821 h- ∆swi1::kanmx pcn1-K164R::ura4 his3-D1 ura4-D18
leu1-32 ade6-M210
This
study
FY6400 h- ∆rad8::hphMX leu1-32::[nmt1-rad8+-GFP-leu1+ ]
ura4-D18 ade6-M210 his3-D1
This
study
FY6370 h- ∆rad8::hphMX leu1-32::[nmt1-rad8-K535AT536A-
GFP-leu1+ ] ura4-D18 ade6-M210 his3-D1
This
study
FY6372 h- ∆rad8::hphMX leu1-32::[nmt1-rad8-I879A-GFP-
leu1+ ] ura4-D18 ade6-M210 his3-D1
This
study
FY6374 h- ∆rad8::hphMX leu1-32::[nmt1-rad8-K535AT536I879A-
GFP-leu1+ ] ura4-D18 ade6-M210 his3-D1
This
study
FY6402 h- ∆rad8::hphMX leu1-32::[nmt1-rad8-∆HIRAN-GFP-
leu1+ ] ura4-D18 ade6-M210 his3-D1
This
study
FY6522 h- ∆rad8::hphMX leu1-32::[nmt1-
rad8∆HIRAN::SV40NLS-GFP-leu1+ ] ura4-D18 ade6-
M210 his3-D1
This
study
FY6524 h- ∆rad8::hphMX leu1-32::[nmt1-
rad8∆HIRAN::rad8NLS-GFP-leu1+ ] ura4-D18 ade6-
M210 his3-D1
This
study
FY6526 h- ∆rad8::hphMX leu1-32::[nmt1-rad8-no-NLS-GFP-
leu1+ ] ura4-D18 ade6-M210 his3-D1
This
study
FY6528 h- ∆rad8::hphMX leu1-32::[nmt1-rad8-HIRAN-GFP-
leu1+ ] ura4-D18 ade6-M210 his3-D1
This
study

115

Table 3.4 Plasmids used in this study

Plasmid Purpose Source
pAW1 To construct lox-Cre base strain for rad8 FY5622 EUROSCA
RF: P30537
pAW8-
XhoI
To make swap the loxP loxM3 flanked region in the
genome of FY5622
EUROSCA
RF: P30585
pLD45 To make swap the loxP loxM3 flanked region in
FY5622 with rad8
+

This study
pLD46 To make swap the loxP loxM3 flanked region in
FY5622 with rad8-∆HIRAN
This study
pLD47 To make swap the loxP loxM3 flanked region in
FY5622 with rad8-K535AT536A
This study
pLD48 To make swap the loxP loxM3 flanked region in
FY5622 with rad8-I879A
This study
pLD49 To make swap the loxP loxM3 flanked region in
FY5622 with rad8-K535AT536AI879A
This study
pLD99 To make swap the loxP loxM3 flanked region in
FY5622 with rad8- ∆HIRAN::SV40NLS
This study
pLD100 To make swap the loxP loxM3 flanked region in
FY5622 with rad8- ∆HIRAN::Rad8NLS
This study
pLD101 To make swap the loxP loxM3 flanked region in
FY5622 with rad8- ∆NLS
This study
pLD102 To make swap the loxP loxM3 flanked region in
FY5622 with rad8-HIRAN
This study
pJK148 Integration at leu1 locus Our stock
pLD52 To integrate rad8
+
-GFP into leu1 locus This study
pLD54 To integrate rad8-K535AT536A-GFP into leu1 locus This study
pLD55 To integrate rad8-I879A-GFP into leu1 locus This study
pLD56 To integrate rad8- K535AT536AI879A-GFP into leu1
locus
This study
pLD53 To integrate rad8- ∆HIRAN-GFP into leu1 locus This study
pLD96 To integrate rad8- ∆HIRAN::SV40NLS-GFP into leu1
locus
This study
pLD96 To integrate rad8- ∆HIRAN::Rad8NLS-GFP into leu1
locus
This study
pLD97 To integrate rad8- ∆NLS-GFP into leu1 locus This study
pLD98 To integrate rad8-HIRAN-GFP into leu1 locus This study

116

References

Achar, Y.J., Balogh, D., and Haracska, L. (2011). Coordinated protein and DNA
remodeling by human HLTF on stalled replication fork. Proc Natl Acad Sci 108, 14073-
14078.
Adachi, Y., Usukura, J., and Yanagida, M. (1997). A globular complex formation by
Nda1 and the other five members of the MCM protein family in fission yeast. Genes
Cells 2, 467-479.
Ahmad, F., and Stewart, E. (2005). The N-terminal region of the Schizosaccharomyces
pombe RecQ helicase, Rqh1p, physically interacts with Topoisomerase III and is required
for Rqh1p function. Molecular genetics and genomics : MGG 273, 102-114.
Akamatsu, Y., Tsutsui, Y., Morishita, T., Siddique, M.S., Kurokawa, Y., Ikeguchi, M.,
Yamao, F., Arcangioli, B., and Iwasaki, H. (2007). Fission yeast Swi5/Sfr1 and
Rhp55/Rhp57 differentially regulate Rhp51-dependent recombination outcomes. EMBO
J 26, 1352-1362.
Aparicio, O.M., Weinstein, D.M., and Bell, S.P. (1997). Components and dynamics of
DNA replication complexes in S. cerevisiae: redistribution of MCM proteins and Cdc45p
during S phase. Cell 91, 59-69.
Atkinson, J., and McGlynn, P. (2009). Replication fork reversal and the maintenance of
genome stability. Nucleic Acids Res 37, 3475-3492.
Azvolinsky, A., Dunaway, S., Torres, J.Z., Bessler, J.B., and Zakian, V.A. (2006). The S.
cerevisiae Rrm3p DNA helicase moves with the replication fork and affects replication of
all yeast chromosomes. Genes Dev 20, 3104-3116.
Baber-Furnari, B.A., Rhind, N., Boddy, M.N., Shanahan, P., Lopez-Girona, A., and
Russell, P. (2000). Regulation of mitotic inhibitor Mik1 helps to enforce the DNA
damage checkpoint. Mol Biol Cell 11, 1-11.
Bahler, J., Wu, J.Q., Longtine, M.S., Shah, N.G., McKenzie, A., 3rd, Steever, A.B.,
Wach, A., Philippsen, P., and Pringle, J.R. (1998). Heterologous modules for efficient
and versatile PCR-based gene targeting in Schizosaccharomyces pombe. Yeast 14, 943-
951.
Bailis, J.M., Luche, D.D., Hunter, T., and Forsburg, S.L. (2008). Minichromosome
maintenance proteins interact with checkpoint and recombination proteins to promote s-
phase genome stability. Mol Cell Biol 28, 1724-1738.

117

Bailly, V., Lauder, S., Prakash, S., and Prakash, L. (1997). Yeast DNA repair proteins
Rad6 and Rad18 form a heterodimer that has ubiquitin conjugating, DNA binding, and
ATP hydrolytic activities. J Biol Chem 272, 23360-23365.
Bartek, J., Mistrik, M., and Bartkova, J. (2012). Thresholds of replication stress signaling
in cancer development and treatment. Nature structural & molecular biology 19, 5-7.
Basi, G., Schmid, E., and Maundrell, K. (1993). TATA box mutations in the
Schizosaccharomyces pombe nmt1 promoter affect transcription efficiency but not the
transcription start point or thiamine repressibility. Gene 123, 131-136.
Bauerschmidt, C., Pollok, S., Kremmer, E., Nasheuer, H.P., and Grosse, F. (2007).
Interactions of human Cdc45 with the Mcm2-7 complex, the GINS complex, and DNA
polymerases delta and epsilon during S phase. Genes Cells 12, 745-758.
Bell, S.P., and Stillman, B. (1992). ATP-dependent recognition of eukaryotic origins of
DNA replication by a multiprotein complex. Nature 357, 128-134.
Beranek, D.T. (1990). Distribution of methyl and ethyl adducts following alkylation with
monofunctional alkylating agents. Mutation research 231, 11-30.
Betous, R., Couch, F.B., Mason, A.C., Eichman, B.F., Manosas, M., and Cortez, D.
(2013a). Substrate-selective repair and restart of replication forks by DNA translocases.
Cell reports 3, 1958-1969.
Betous, R., Glick, G.G., Zhao, R., and Cortez, D. (2013b). Identification and
characterization of SMARCAL1 protein complexes. PloS one 8, e63149.
Blackford, A.N., Schwab, R.A., Nieminuszczy, J., Deans, A.J., West, S.C., and
Niedzwiedz, W. (2012). The DNA translocase activity of FANCM protects stalled
replication forks. Human molecular genetics 21, 2005-2016.
Blastyak, A., Hajdu, I., Unk, I., and Haracska, L. (2010). Role of double-stranded DNA
translocase activity of human HLTF in replication of damaged DNA. Mol Cell Biol 30,
684-693.
Blow, J.J., and Ge, X.Q. (2009). A model for DNA replication showing how dormant
origins safeguard against replication fork failure. EMBO Rep 10, 406-412.
Bochman, M.L., Sabouri, N., and Zakian, V.A. (2010). Unwinding the functions of the
Pif1 family helicases. DNA repair 9, 237-249.
Bochman, M.L., and Schwacha, A. (2009). The Mcm complex: unwinding the
mechanism of a replicative helicase. Microbiol Mol Biol Rev 73, 652-683.

118

Bochman, M.L., and Schwacha, A. (2010). The Saccharomyces cerevisiae Mcm6/2 and
Mcm5/3 ATPase active sites contribute to the function of the putative Mcm2-7 'gate'.
Nucleic Acids Res.
Boddy, M.N., Gaillard, P.H., McDonald, W.H., Shanahan, P., Yates, J.R., 3rd, and
Russell, P. (2001). Mus81-Eme1 are essential components of a Holliday junction
resolvase. Cell 107, 537-548.
Boddy, M.N., Lopez-Girona, A., Shanahan, P., Interthal, H., Heyer, W.D., and Russell, P.
(2000). Damage tolerance protein Mus81 associates with the FHA1 domain of checkpoint
kinase Cds1. Mol Cell Biol 20, 8758-8766.
Branzei, D., and Foiani, M. (2008). Regulation of DNA repair throughout the cell cycle.
Nat Rev Mol Cell Biol 9, 297-308.
Branzei, D., Seki, M., and Enomoto, T. (2004). Rad18/Rad5/Mms2-mediated
polyubiquitination of PCNA is implicated in replication completion during replication
stress. Genes Cells 9, 1031-1042.
Braun, K.A., and Breeden, L.L. (2007). Nascent transcription of MCM2-7 is important
for nuclear localization of the minichromosome maintenance complex in G1. Mol Biol
Cell 18, 1447-1456.
Brosh, R.M., Jr. (2013). DNA helicases involved in DNA repair and their roles in cancer.
Nature reviews. Cancer 13, 542-558.
Brown, G.W., Jallepalli, P.V., Huneycutt, B.J., and Kelly, T.J. (1997). Interaction of the
S phase regulator cdc18 with cyclin-dependent kinase in fission yeast. Proc Natl Acad Sci
U S A 94, 6142-6147.
Brush, G.S., and Kelly, T.J. (2000). Phosphorylation of the replication protein A large
subunit in the Saccharomyces cerevisiae checkpoint response. Nucleic Acids Res 28,
3725-3732.
Bugreev, D.V., Hanaoka, F., and Mazin, A.V. (2007). Rad54 dissociates homologous
recombination intermediates by branch migration. Nature structural & molecular biology
14, 746-753.
Bugreev, D.V., Mazina, O.M., and Mazin, A.V. (2006). Rad54 protein promotes branch
migration of Holliday junctions. Nature 442, 590-593.
Bugreev, D.V., Rossi, M.J., and Mazin, A.V. (2011). Cooperation of RAD51 and RAD54
in regression of a model replication fork. Nucleic Acids Res 39, 2153-2164.

119

Burrell, R.A., McClelland, S.E., Endesfelder, D., Groth, P., Weller, M.C., Shaikh, N.,
Domingo, E., Kanu, N., Dewhurst, S.M., Gronroos, E., et al. (2013). Replication stress
links structural and numerical cancer chromosomal instability. Nature 494, 492-496.
Byun, T.S., Pacek, M., Yee, M.C., Walter, J.C., and Cimprich, K.A. (2005). Functional
uncoupling of MCM helicase and DNA polymerase activities activates the ATR-
dependent checkpoint. Genes Dev 19, 1040-1052.
Carr, A.M., and Lambert, S. (2013). Replication Stress-Induced Genome Instability: The
Dark Side of Replication Maintenance by Homologous Recombination. Journal of
molecular biology.
Caspari, T., and Carr, A.M. (1999). DNA structure checkpoint pathways in
Schizosaccharomyces pombe. Biochimie 81, 173-181.
Catlett, M.G., and Forsburg, S.L. (2003). Schizosaccharomyces pombe Rdh54 (TID1)
acts with Rhp54 (RAD54) to repair meiotic double-strand breaks. Mol Biol Cell 14,
4707-4720.
Ceballos, S.J., and Heyer, W.D. (2011). Functions of the Snf2/Swi2 family Rad54 motor
protein in homologous recombination. Biochim Biophys Acta 1809, 509-523.
Chen, H., Lisby, M., and Symington, L.S. (2013a). RPA coordinates DNA end resection
and prevents formation of DNA hairpins. Mol Cell 50, 589-600.
Chen, J., Bozza, W., and Zhuang, Z. (2011). Ubiquitination of PCNA and its essential
role in eukaryotic translesion synthesis. Cell biochemistry and biophysics 60, 47-60.
Chen, S., Davies, A.A., Sagan, D., and Ulrich, H.D. (2005). The RING finger ATPase
Rad5p of Saccharomyces cerevisiae contributes to DNA double-strand break repair in a
ubiquitin-independent manner. Nucleic Acids Res 33, 5878-5886.
Chen, X., Paudyal, S.C., Chin, R.I., and You, Z. (2013b). PCNA promotes processive
DNA end resection by Exo1. Nucleic Acids Res.
Chen, X.B., Melchionna, R., Denis, C.M., Gaillard, P.H., Blasina, A., Van de Weyer, I.,
Boddy, M.N., Russell, P., Vialard, J., and McGowan, C.H. (2001). Human Mus81-
associated endonuclease cleaves Holliday junctions in vitro. Mol Cell 8, 1117-1127.
Chuang, C.H., Wallace, M.D., Abratte, C., Southard, T., and Schimenti, J.C. (2010).
Incremental genetic perturbations to MCM2-7 expression and subcellular distribution
reveal exquisite sensitivity of mice to DNA replication stress. PLoS Genet 6.
Costelloe, T., Louge, R., Tomimatsu, N., Mukherjee, B., Martini, E., Khadaroo, B.,
Dubois, K., Wiegant, W.W., Thierry, A., Burma, S., et al. (2012). The yeast Fun30 and

120

human SMARCAD1 chromatin remodellers promote DNA end resection. Nature 489,
581-584.
Cotta-Ramusino, C., Fachinetti, D., Lucca, C., Doksani, Y., Lopes, M., Sogo, J., and
Foiani, M. (2005). Exo1 processes stalled replication forks and counteracts fork reversal
in checkpoint-defective cells. Mol Cell 17, 153-159.
Couch, F.B., Bansbach, C.E., Driscoll, R., Luzwick, J.W., Glick, G.G., Betous, R.,
Carroll, C.M., Jung, S.Y., Qin, J., Cimprich, K.A., et al. (2013). ATR phosphorylates
SMARCAL1 to prevent replication fork collapse. Genes Dev 27, 1610-1623.
Coulon, S., Ramasubramanyan, S., Alies, C., Philippin, G., Lehmann, A., and Fuchs, R.P.
(2010). Rad8Rad5/Mms2-Ubc13 ubiquitin ligase complex controls translesion synthesis
in fission yeast. EMBO J 29, 2048-2058.
Covey, J.M., Jaxel, C., Kohn, K.W., and Pommier, Y. (1989). Protein-linked DNA strand
breaks induced in mammalian cells by camptothecin, an inhibitor of topoisomerase I.
Cancer research 49, 5016-5022.
Coxon, A., Maundrell, K., and Kearsey, S.E. (1992). Fission yeast cdc21+ belongs to a
family of proteins involved in an early step of chromosome replication. Nucleic Acids
Res 20, 5571-5577.
Daee, D.L., Mertz, T., and Lahue, R.S. (2007). Postreplication repair inhibits CAG.CTG
repeat expansions in Saccharomyces cerevisiae. Mol Cell Biol 27, 102-110.
Dai, J., Chuang, R.Y., and Kelly, T.J. (2005). DNA replication origins in the
Schizosaccharomyces pombe genome. Proc Natl Acad Sci U S A 102, 337-342.
Dainton, F.S. (1948). On the existence of free atoms and radicals in water and aqueous
solutions subjected to ionizing radiation. The Journal of physical and colloid chemistry
52, 490-517.
Dalgaard, J.Z., and Klar, A.J. (1999). Orientation of DNA replication establishes mating-
type switching pattern in S. pombe. Nature 400, 181-184.
Das-Bradoo, S., Nguyen, H.D., and Bielinsky, A.K. (2010a). Damage-specific
modification of PCNA. Cell Cycle 9, 3674-3679.
Das-Bradoo, S., Nguyen, H.D., Wood, J.L., Ricke, R.M., Haworth, J.C., and Bielinsky,
A.K. (2010b). Defects in DNA ligase I trigger PCNA ubiquitylation at Lys 107. Nat Cell
Biol 12, 74-79; sup pp 71-20.

121

Davey, M.J., Indiani, C., and O'Donnell, M. (2003). Reconstitution of the Mcm2-7p
heterohexamer, subunit arrangement, and ATP site architecture. J Biol Chem 278, 4491-
4499.
Davies, A.A., Huttner, D., Daigaku, Y., Chen, S., and Ulrich, H.D. (2008). Activation of
ubiquitin-dependent DNA damage bypass is mediated by replication protein a. Mol Cell
29, 625-636.
Dehe, P.M., Coulon, S., Scaglione, S., Shanahan, P., Takedachi, A., Wohlschlegel, J.A.,
Yates, J.R., 3rd, Llorente, B., Russell, P., and Gaillard, P.H. (2013). Regulation of
Mus81-Eme1 Holliday junction resolvase in response to DNA damage. Nature structural
& molecular biology 20, 598-603.
Deshpande, A.M., and Newlon, C.S. (1996). DNA replication fork pause sites dependent
on transcription. Science 272, 1030-1033.
Ding, L., and Forsburg, S.L. (2011). Schizosaccharomyces pombe minichromosome
maintenance-binding protein (MCM-BP) antagonizes MCM helicase. J Biol Chem 286,
32918-32930.
Doe, C.L., Ahn, J.S., Dixon, J., and Whitby, M.C. (2002). Mus81-Eme1 and Rqh1
involvement in processing stalled and collapsed replication forks. J Biol Chem 277,
32753-32759.
Doe, C.L., Dixon, J., Osman, F., and Whitby, M.C. (2000). Partial suppression of the
fission yeast rqh1(-) phenotype by expression of a bacterial Holliday junction resolvase.
EMBO J 19, 2751-2762.
Doe, C.L., Murray, J.M., Shayeghi, M., Hoskins, M., Lehmann, A.R., Carr, A.M., and
Watts, F.Z. (1993). Cloning and characterisation of the Schizosaccharomyces pombe rad8
gene, a member of the SNF2 helicase family. Nucleic Acids Res 21, 5964-5971.
Dolan, W.P., Sherman, D.A., and Forsburg, S.L. (2004). Schizosaccharomyces pombe
replication protein Cdc45/Sna41 requires Hsk1/Cdc7 and Rad4/Cut5 for chromatin
binding. Chromosoma 113, 145-156.
Du, L.L., Moser, B.A., and Russell, P. (2004). Homo-oligomerization is the essential
function of the tandem BRCT domains in the checkpoint protein Crb2. J Biol Chem 279,
38409-38414.
Dziadkowiec, D., Kramarz, K., Kanik, K., Wisniewski, P., and Carr, A.M. (2013).
Involvement of Schizosaccharomyces pombe rrp1+ and rrp2+ in the Srs2- and Swi5/Sfr1-
dependent pathway in response to DNA damage and replication inhibition. Nucleic Acids
Res 41, 8196-8209.

122

Edwards, M.C., Tutter, A.V., Cvetic, C., Gilbert, C.H., Prokhorova, T.A., and Walter, J.C.
(2002). MCM2-7 complexes bind chromatin in a distributed pattern surrounding the
origin recognition complex in Xenopus egg extracts. J Biol Chem 277, 33049-33057.
Enoch, T., Carr, A.M., and Nurse, P. (1992). Fission yeast genes involved in coupling
mitosis to completion of DNA replication. Genes Dev 6, 2035-2046.
Errico, A., Costanzo, V., and Hunt, T. (2007). Tipin is required for stalled replication
forks to resume DNA replication after removal of aphidicolin in Xenopus egg extracts.
Proc Natl Acad Sci U S A 104, 14929-14934.
Fairman-Williams, M.E., Guenther, U.P., and Jankowsky, E. (2010). SF1 and SF2
helicases: family matters. Curr Opin Struct Biol 20, 313-324.
Forsburg, S.L. (1993). Comparison of Schizosaccharomyces pombe expression systems.
Nucleic Acids Res 21, 2955-2956.
Forsburg, S.L. (2004). Eukaryotic MCM proteins: beyond replication initiation.
Microbiol Mol Biol Rev 68, 109-131.
Forsburg, S.L., and Nurse, P. (1994). The fission yeast cdc19+ gene encodes a member of
the MCM family of replication proteins. J Cell Sci 107, 2779-2788.
Forsburg, S.L., and Rhind, N. (2006). Basic methods for fission yeast. Yeast 23, 173-183.
Forsburg, S.L., Sherman, D.A., Ottilie, S., Yasuda, J.R., and Hodson, J.A. (1997).
Mutational analysis of Cdc19p, a Schizosaccharomyces pombe MCM protein. Genetics
147, 1025-1041.
Frampton, J., Irmisch, A., Green, C.M., Neiss, A., Trickey, M., Ulrich, H.D., Furuya, K.,
Watts, F.Z., Carr, A.M., and Lehmann, A.R. (2006). Postreplication repair and PCNA
modification in Schizosaccharomyces pombe. Mol Biol Cell 17, 2976-2985.
Froget, B., Blaisonneau, J., Lambert, S., and Baldacci, G. (2008). Cleavage of stalled
forks by fission yeast Mus81/Eme1 in absence of DNA replication checkpoint. Mol Biol
Cell 19, 445-456.
Furuya, K., and Niki, H. (2010). The DNA damage checkpoint regulates a transition
between yeast and hyphal growth in Schizosaccharomyces japonicus. Mol Cell Biol 30,
2909-2917.
Furuya, K., and Niki, H. (2012). Hyphal differentiation induced via a DNA damage
checkpoint-dependent pathway engaged in crosstalk with nutrient stress signaling in
Schizosaccharomyces japonicus. Curr Genet 58, 291-303.

123

Furuya, K., Poitelea, M., Guo, L., Caspari, T., and Carr, A.M. (2004). Chk1 activation
requires Rad9 S/TQ-site phosphorylation to promote association with C-terminal BRCT
domains of Rad4TOPBP1. Genes Dev 18, 1154-1164.
Gallego-Sanchez, A., Andres, S., Conde, F., San-Segundo, P.A., and Bueno, A. (2012).
Reversal of PCNA ubiquitylation by Ubp10 in Saccharomyces cerevisiae. PLoS Genet 8,
e1002826.
Gambus, A., Jones, R.C., Sanchez-Diaz, A., Kanemaki, M., van Deursen, F., Edmondson,
R.D., and Labib, K. (2006). GINS maintains association of Cdc45 with MCM in
replisome progression complexes at eukaryotic DNA replication forks. Nat Cell Biol 8,
358-366.
Gari, K., Decaillet, C., Delannoy, M., Wu, L., and Constantinou, A. (2008). Remodeling
of DNA replication structures by the branch point translocase FANCM. Proc Natl Acad
Sci U S A 105, 16107-16112.
Ge, X.Q., Jackson, D.A., and Blow, J.J. (2007). Dormant origins licensed by excess
Mcm2-7 are required for human cells to survive replicative stress. Genes Dev 21, 3331-
3341.
Ghosal, G., and Chen, J. (2013). DNA damage tolerance: a double-edged sword guarding
the genome. Transl Cancer Res 2, 107-129.
Gómez, E.B., Catlett, M.G., and Forsburg, S.L. (2002). Different phenotypes in vivo are
associated with ATPase motif mutations in Schizosaccharomyces pombe
minichromosome maintenance proteins. Genetics 160, 1305-1318.
Gozuacik, D., Chami, M., Lagorce, D., Faivre, J., Murakami, Y., Poch, O., Biermann, E.,
Knippers, R., Brechot, C., and Paterlini-Brechot, P. (2003). Identification and functional
characterization of a new member of the human Mcm protein family: hMcm8. Nucleic
Acids Res 31, 570-579.
Grallert, B., and Nurse, P. (1996). The ORC1 homolog orp1 in fission yeast plays a key
role in regulating onset of S phase. Genes Dev 10, 2644-2654.
Greenfeder, S.A., and Newlon, C.S. (1992). Replication forks pause at yeast centromeres.
Mol Cell Biol 12, 4056-4066.
Halazonetis, T.D., Gorgoulis, V.G., and Bartek, J. (2008). An oncogene-induced DNA
damage model for cancer development. Science 319, 1352-1355.
Hartwell, L., Weinert, T., Kadyk, L., and Garvik, B. (1994). Cell cycle checkpoints,
genomic integrity, and cancer. Cold Spring Harb Symp Quant Biol 59, 259-263.

124

Hartwell, L.H., and Weinert, T.A. (1989). Checkpoints: controls that ensure the order of
cell cycle events. Science 246, 629-634.
Haruki, H., Nishikawa, J., and Laemmli, U.K. (2008). The anchor-away technique: rapid,
conditional establishment of yeast mutant phenotypes. Mol Cell 31, 925-932.
Haruta, N., Akamatsu, Y., Tsutsui, Y., Kurokawa, Y., Murayama, Y., Arcangioli, B., and
Iwasaki, H. (2008). Fission yeast Swi5 protein, a novel DNA recombination mediator.
DNA repair 7, 1-9.
Haruta, N., Kurokawa, Y., Murayama, Y., Akamatsu, Y., Unzai, S., Tsutsui, Y., and
Iwasaki, H. (2006). The Swi5-Sfr1 complex stimulates Rhp51/Rad51- and Dmc1-
mediated DNA strand exchange in vitro. Nat Struct Mol Biol 13, 823-830.
Hastings, P.J., Ira, G., and Lupski, J.R. (2009a). A microhomology-mediated break-
induced replication model for the origin of human copy number variation. PLoS Genet 5,
e1000327.
Hastings, P.J., Lupski, J.R., Rosenberg, S.M., and Ira, G. (2009b). Mechanisms of change
in gene copy number. Nat Rev Genet 10, 551-564.
Hayano, M., Kanoh, Y., Matsumoto, S., and Masai, H. (2011). Mrc1 marks early-firing
origins and coordinates timing and efficiency of initiation in fission yeast. Mol Cell Biol
31, 2380-2391.
Hayashi, M., Katou, Y., Itoh, T., Tazumi, A., Yamada, Y., Takahashi, T., Nakagawa, T.,
Shirahige, K., and Masukata, H. (2007). Genome-wide localization of pre-RC sites and
identification of replication origins in fission yeast. EMBO J 26, 1327-1339.
Heichinger, C., Penkett, C.J., Bahler, J., and Nurse, P. (2006). Genome-wide
characterization of fission yeast DNA replication origins. EMBO J 25, 5171-5179.
Hendel, A., Krijger, P.H., Diamant, N., Goren, Z., Langerak, P., Kim, J., Reissner, T.,
Lee, K.Y., Geacintov, N.E., Carell, T., et al. (2011). PCNA ubiquitination is important,
but not essential for translesion DNA synthesis in mammalian cells. PLoS Genet 7,
e1002262.
Hentges, P., Van Driessche, B., Tafforeau, L., Vandenhaute, J., and Carr, A.M. (2005).
Three novel antibiotic marker cassettes for gene disruption and marker switching in
Schizosaccharomyces pombe. Yeast 22, 1013-1019.
Hingorani, M.M., and O'Donnell, M. (1998). Toroidal proteins: running rings around
DNA. Curr Biol 8, R83-86.

125

Hishida, T., Kubota, Y., Carr, A.M., and Iwasaki, H. (2009). RAD6-RAD18-RAD5-
pathway-dependent tolerance to chronic low-dose ultraviolet light. Nature 457, 612-615.
Hodgson, B., Calzada, A., and Labib, K. (2007). Mrc1 and Tof1 regulate DNA
replication forks in different ways during normal S phase. Mol Biol Cell 18, 3894-3902.
Hoege, C., Pfander, B., Moldovan, G.L., Pyrowolakis, G., and Jentsch, S. (2002). RAD6-
dependent DNA repair is linked to modification of PCNA by ubiquitin and SUMO.
Nature 419, 135-141.
Hoeijmakers, J.H. (2009). DNA damage, aging, and cancer. N Engl J Med 361, 1475-
1485.
Hu, J., Sun, L., Shen, F., Chen, Y., Hua, Y., Liu, Y., Zhang, M., Hu, Y., Wang, Q., Xu,
W., et al. (2012). The intra-S phase checkpoint targets Dna2 to prevent stalled replication
forks from reversing. Cell 149, 1221-1232.
Huang, D., Piening, B.D., and Paulovich, A.G. (2013). The preference for error-free or
error-prone postreplication repair in Saccharomyces cerevisiae exposed to low-dose
methyl methanesulfonate is cell cycle dependent. Mol Cell Biol 33, 1515-1527.
Hyrien, O., Marheineke, K., and Goldar, A. (2003). Paradoxes of eukaryotic DNA
replication: MCM proteins and the random completion problem. Bioessays 25, 116-125.
Ilves, I., Petojevic, T., Pesavento, J.J., and Botchan, M.R. (2010). Activation of the
MCM2-7 helicase by association with Cdc45 and GINS proteins. Mol Cell 37, 247-258.
Ishimi, Y. (1997). A DNA helicase activity is associated with an MCM4, -6, and -7
protein complex. J Biol Chem 272, 24508-24513.
Ivessa, A.S., Lenzmeier, B.A., Bessler, J.B., Goudsouzian, L.K., Schnakenberg, S.L., and
Zakian, V.A. (2003). The Saccharomyces cerevisiae helicase Rrm3p facilitates
replication past nonhistone protein-DNA complexes. Mol Cell 12, 1525-1536.
Ivessa, A.S., Zhou, J.Q., and Zakian, V.A. (2000). The Saccharomyces Pif1p DNA
helicase and the highly related Rrm3p have opposite effects on replication fork
progression in ribosomal DNA. Cell 100, 479-489.
Iyer, L.M., Babu, M.M., and Aravind, L. (2006). The HIRAN domain and recruitment of
chromatin remodeling and repair activities to damaged DNA. Cell Cycle 5, 775-782.
Jackson, S.P., and Bartek, J. (2009). The DNA-damage response in human biology and
disease. Nature 461, 1071-1078.

126

Jallepalli, P.V., Brown, G.W., Muzi-Falconi, M., Tien, D., and Kelly, T.J. (1997).
Regulation of the replication initiator protein p65cdc18 by CDK phosphorylation. Genes
Dev 11, 2767-2779.
Johnson, E.M., Kinoshita, Y., and Daniel, D.C. (2003). A new member of the MCM
protein family encoded by the human MCM8 gene, located contrapodal to GCD10 at
chromosome band 20p12.3-13. Nucleic Acids Res 31, 2915-2925.
Johnson, R.E., Prakash, S., and Prakash, L. (1999). Efficient bypass of a thymine-
thymine dimer by yeast DNA polymerase, Poleta. Science 283, 1001-1004.
Kai, M., Boddy, M.N., Russell, P., and Wang, T.S. (2005). Replication checkpoint kinase
Cds1 regulates Mus81 to preserve genome integrity during replication stress. Genes Dev
19, 919-932.
Kai, M., Furuya, K., Paderi, F., Carr, A.M., and Wang, T.S. (2007). Rad3-dependent
phosphorylation of the checkpoint clamp regulates repair-pathway choice. Nat Cell Biol 9,
691-697.
Kanemaki, M., and Labib, K. (2006). Distinct roles for Sld3 and GINS during
establishment and progression of eukaryotic DNA replication forks. EMBO J 25, 1753-
1763.
Kapitzky, L., Beltrao, P., Berens, T.J., Gassner, N., Zhou, C., Wuster, A., Wu, J., Babu,
M.M., Elledge, S.J., Toczyski, D., et al. (2010). Cross-species chemogenomic profiling
reveals evolutionarily conserved drug mode of action. Molecular systems biology 6, 451.
Karanja, K.K., Cox, S.W., Duxin, J.P., Stewart, S.A., and Campbell, J.L. (2012). DNA2
and EXO1 in replication-coupled, homology-directed repair and in the interplay between
HDR and the FA/BRCA network. Cell Cycle 11, 3983-3996.
Katou, Y., Kanoh, Y., Bando, M., Noguchi, H., Tanaka, H., Ashikari, T., Sugimoto, K.,
and Shirahige, K. (2003). S-phase checkpoint proteins Tof1 and Mrc1 form a stable
replication-pausing complex. Nature 424, 1078-1083.
Kats, E.S., Enserink, J.M., Martinez, S., and Kolodner, R.D. (2009). The Saccharomyces
cerevisiae Rad6 postreplication repair and Siz1/Srs2 homologous recombination-
inhibiting pathways process DNA damage that arises in asf1 mutants. Mol Cell Biol 29,
5226-5237.
Kearsey, S.E., Montgomery, S., Labib, K., and Lindner, K. (2000). Chromatin binding of
the fission yeast replication factor mcm4 occurs during anaphase and requires ORC and
cdc18. EMBO J 19, 1681-1690.

127

Keeney, J.B., and Boeke, J.D. (1994). Efficient targeted integration at leu1-32 and ura4-
294 in Schizosaccharomyces pombe. Genetics 136, 849-856.
Kelly, T.J., Martin, G.S., Forsburg, S.L., Stephen, R.J., Russo, A., and Nurse, P. (1993a).
The fission yeast cdc18+ gene product couples S phase to START and mitosis. Cell 74,
371-382.
Kelly, T.J., Nurse, P., and Forsburg, S.L. (1993b). Coupling DNA replication to the cell
cycle. Cold Spring Harb Symp Quant Biol 58, 637-644.
Kerrest, A., Anand, R.P., Sundararajan, R., Bermejo, R., Liberi, G., Dujon, B.,
Freudenreich, C.H., and Richard, G.F. (2009). SRS2 and SGS1 prevent chromosomal
breaks and stabilize triplet repeats by restraining recombination. Nature structural &
molecular biology 16, 159-167.
Khasanov, F.K., Savchenko, G.V., Bashkirova, E.V., Korolev, V.G., Heyer, W.D., and
Bashkirov, V.I. (1999). A new recombinational DNA repair gene from
Schizosaccharomyces pombe with homology to Escherichia coli RecA. Genetics 152,
1557-1572.
Kim, S.M., Dubey, D.D., and Huberman, J.A. (2003). Early-replicating heterochromatin.
Genes Dev 17, 330-335.
Klar, A.J. (2013). Schizosaccharomyces japonicus Yeast Poised to Become a Favorite
Experimental Organism for Eukaryotic Research. G3 3, 1869-1873.
Kosoy, A., and O'Connell, M.J. (2008). Regulation of Chk1 by its C-terminal domain.
Mol Biol Cell 19, 4546-4553.
Kostrub, C.F., al-Khodairy, F., Ghazizadeh, H., Carr, A.M., and Enoch, T. (1997).
Molecular analysis of hus1+, a fission yeast gene required for S-M and DNA damage
checkpoints. Molecular & general genetics : MGG 254, 389-399.
Krejci, L., Van Komen, S., Li, Y., Villemain, J., Reddy, M.S., Klein, H., Ellenberger, T.,
and Sung, P. (2003). DNA helicase Srs2 disrupts the Rad51 presynaptic filament. Nature
423, 305-309.
Krokan, H., Wist, E., and Krokan, R.H. (1981). Aphidicolin inhibits DNA synthesis by
DNA polymerase alpha and isolated nuclei by a similar mechanism. Nucleic Acids Res 9,
4709-4719.
Krude, T., Musahl, C., Laskey, R.A., and Knippers, R. (1996). Human replication
proteins hCdc21, hCdc46 and P1Mcm3 bind chromatin uniformly before S-phase and are
displaced locally during DNA replication. J Cell Sci 109 ( Pt 2), 309-318.

128

Kumagai, A., Kim, S.M., and Dunphy, W.G. (2004). Claspin and the activated form of
ATR-ATRIP collaborate in the activation of Chk1. J Biol Chem 279, 49599-49608.
Kvam, E., and Tyrrell, R.M. (1997). Induction of oxidative DNA base damage in human
skin cells by UV and near visible radiation. Carcinogenesis 18, 2379-2384.
Labib, K., Diffley, J.F., and Kearsey, S.E. (1999). G1-phase and B-type cyclins exclude
the DNA-replication factor Mcm4 from the nucleus. Nat Cell Biol 1, 415-422.
Labib, K., and Gambus, A. (2007). A key role for the GINS complex at DNA replication
forks. Trends in cell biology 17, 271-278.
Lambert, S., and Carr, A.M. (2013). Replication stress and genome rearrangements:
lessons from yeast models. Curr Opin Genet Dev 23, 132-139.
Lambert, S., Mizuno, K., Blaisonneau, J., Martineau, S., Chanet, R., Freon, K., Murray,
J.M., Carr, A.M., and Baldacci, G. (2010). Homologous recombination restarts blocked
replication forks at the expense of genome rearrangements by template exchange. Mol
Cell 39, 346-359.
Laskey, R.A., and Madine, M.A. (2003). A rotary pumping model for helicase function
of MCM proteins at a distance from replication forks. EMBO Rep 4, 26-30.
Le Breton, C., Dupaigne, P., Robert, T., Le Cam, E., Gangloff, S., Fabre, F., and Veaute,
X. (2008). Srs2 removes deadly recombination intermediates independently of its
interaction with SUMO-modified PCNA. Nucleic Acids Res 36, 4964-4974.
Lee, J., Kumagai, A., and Dunphy, W.G. (2007). The Rad9-Hus1-Rad1 checkpoint clamp
regulates interaction of TopBP1 with ATR. J Biol Chem 282, 28036-28044.
Lee, J.K., and Hurwitz, J. (2000). Isolation and characterization of various complexes of
the minichromosome maintenance proteins of Schizosaccharomyces pombe. J Biol Chem
275, 18871-18878.
Lee, J.K., and Hurwitz, J. (2001). Processive DNA helicase activity of the
minichromosome maintenance proteins 4, 6, and 7 complex requires forked DNA
structures. Proc Natl Acad Sci U S A 98, 54-59.
Lei, M., Kawasaki, Y., and Tye, B.K. (1996). Physical interactions among Mcm proteins
and effects of Mcm dosage on DNA replication in Saccharomyces cerevisiae. Mol Cell
Biol 16, 5081-5090.
Levikova, M., Klaue, D., Seidel, R., and Cejka, P. (2013). Nuclease activity of
Saccharomyces cerevisiae Dna2 inhibits its potent DNA helicase activity. Proc Natl Acad
Sci U S A 110, E1992-2001.

129

Li, P.C., Petreaca, R.C., Jensen, A., Yuan, J.P., Green, M.D., and Forsburg, S.L. (2013).
Replication fork stability is essential for the maintenance of centromere integrity in the
absence of heterochromatin. Cell reports 3, 638-645.
Liang, C., and Stillman, B. (1997). Persistent initiation of DNA replication and
chromatin-bound MCM proteins during the cell cycle in cdc6 mutants. Genes Dev 11,
3375-3386.
Liang, D.T., and Forsburg, S.L. (2001). Characterization of Schizosaccharomyces pombe
mcm7(+) and cdc23(+) (MCM10) and interactions with replication checkpoints. Genetics
159, 471-486.
Liang, D.T., Hodson, J.A., and Forsburg, S.L. (1999). Reduced dosage of a single fission
yeast MCM protein causes genetic instability and S phase delay. J Cell Sci 112, 559-567.
LiefshitzBlastyak, A., Pinter, L., Unk, I., Prakash, L., Prakash, S., and Haracska, L.
(2007). Yeast Rad5 protein required for postreplication repair has a DNA helicase
activity specific for replication fork regression. Mol Cell 28, 167-175.
Limbo, O., Chahwan, C., Yamada, Y., de Bruin, R.A., Wittenberg, C., and Russell, P.
(2007). Ctp1 is a cell-cycle-regulated protein that functions with Mre11 complex to
control double-strand break repair by homologous recombination. Mol Cell 28, 134-146.
Lisby, M., Rothstein, R., and Mortensen, U.H. (2001). Rad52 forms DNA repair and
recombination centers during S phase. Proc Natl Acad Sci U S A 98, 8276-8282.
Liu, J., Renault, L., Veaute, X., Fabre, F., Stahlberg, H., and Heyer, W.D. (2011a). Rad51
paralogues Rad55-Rad57 balance the antirecombinase Srs2 in Rad51 filament formation.
Nature 479, 245-248.
Liu, S., Shiotani, B., Lahiri, M., Marechal, A., Tse, A., Leung, C.C., Glover, J.N., Yang,
X.H., and Zou, L. (2011b). ATR autophosphorylation as a molecular switch for
checkpoint activation. Mol Cell 43, 192-202.
Looke, M., Kristjuhan, K., and Kristjuhan, A. (2011). Extraction of genomic DNA from
yeasts for PCR-based applications. BioTechniques 50, 325-328.
Lopes, M., Foiani, M., and Sogo, J.M. (2006). Multiple mechanisms control chromosome
integrity after replication fork uncoupling and restart at irreparable UV lesions. Mol Cell
21, 15-27.
Lopez-Girona, A., Tanaka, K., Chen, X.B., Baber, B.A., McGowan, C.H., and Russell, P.
(2001). Serine-345 is required for Rad3-dependent phosphorylation and function of
checkpoint kinase Chk1 in fission yeast. Proc Natl Acad Sci U S A 98, 11289-11294.

130

Lorenz, A., Osman, F., Folkyte, V., Sofueva, S., and Whitby, M.C. (2009). Fbh1 limits
Rad51-dependent recombination at blocked replication forks. Mol Cell Biol 29, 4742-
4756.
Lundin, C., North, M., Erixon, K., Walters, K., Jenssen, D., Goldman, A.S., and Helleday,
T. (2005). Methyl methanesulfonate (MMS) produces heat-labile DNA damage but no
detectable in vivo DNA double-strand breaks. Nucleic Acids Res 33, 3799-3811.
Lutzmann, M., Maiorano, D., and Mechali, M. (2005). Identification of full genes and
proteins of MCM9, a novel, vertebrate-specific member of the MCM2-8 protein family.
Gene 362, 51-56.
Madine, M.A., Khoo, C.Y., Mills, A.D., Musahl, C., and Laskey, R.A. (1995). The
nuclear envelope prevents reinitiation of replication by regulating the binding of MCM3
to chromatin in Xenopus egg extracts. Curr Biol 5, 1270-1279.
Maine, G.T., Sinha, P., and Tye, B.K. (1984). Mutants of S. cerevisiae defective in the
maintenance of minichromosomes. Genetics 106, 365-385.
Majka, J., Binz, S.K., Wold, M.S., and Burgers, P.M. (2006). Replication protein A
directs loading of the DNA damage checkpoint clamp to 5'-DNA junctions. J Biol Chem
281, 27855-27861.
Maki, K., Inoue, T., Onaka, A., Hashizume, H., Somete, N., Kobayashi, Y., Murakami, S.,
Shigaki, C., Takahashi, T.S., Masukata, H., et al. (2011). Abundance of prereplicative
complexes (Pre-RCs) facilitates recombinational repair under replication stress in fission
yeast. J Biol Chem 286, 41701-41710.
Masai, H., Matsumoto, S., You, Z., Yoshizawa-Sugata, N., and Oda, M. (2010).
Eukaryotic chromosome DNA replication: where, when, and how? Annu Rev Biochem
79, 89-130.
Mason, J.A., and Mellor, J. (1997). Isolation of nuclei for chromatin analysis in fission
yeast. Nucleic Acids Res 25, 4700-4701.
Mastrandrea, L.D., You, J., Niles, E.G., and Pickart, C.M. (1999). E2/E3-mediated
assembly of lysine 29-linked polyubiquitin chains. J Biol Chem 274, 27299-27306.
Matsuo, Y., Asakawa, K., Toda, T., and Katayama, S. (2006). A rapid method for protein
extraction from fission yeast. Bioscience, biotechnology, and biochemistry 70, 1992-
1994.
Matsuyama, A., Arai, R., Yashiroda, Y., Shirai, A., Kamata, A., Sekido, S., Kobayashi,
Y., Hashimoto, A., Hamamoto, M., Hiraoka, Y., et al. (2006). ORFeome cloning and

131

global analysis of protein localization in the fission yeast Schizosaccharomyces pombe.
Nature biotechnology 24, 841-847.
Maundrell, K. (1990). nmt1 of fission yeast. A highly transcribed gene completely
repressed by thiamine. J Biol Chem 265, 10857-10864.
Maundrell, K. (1993). Thiamine-repressible expression vectors pREP and pRIP for
fission yeast. Gene 123, 127-130.
Meister, P., Taddei, A., Vernis, L., Poidevin, M., Gasser, S.M., and Baldacci, G. (2005).
Temporal separation of replication and recombination requires the intra-S checkpoint. J
Cell Biol 168, 537-544.
Merrick, C.J., Jackson, D., and Diffley, J.F. (2004). Visualization of altered replication
dynamics after DNA damage in human cells. J Biol Chem 279, 20067-20075.
Mimitou, E.P., and Symington, L.S. (2008). Sae2, Exo1 and Sgs1 collaborate in DNA
double-strand break processing. Nature 455, 770-774.
Mimitou, E.P., and Symington, L.S. (2009). Nucleases and helicases take center stage in
homologous recombination. Trends in biochemical sciences 34, 264-272.
Minca, E.C., and Kowalski, D. (2010). Multiple Rad5 activities mediate sister chromatid
recombination to bypass DNA damage at stalled replication forks. Mol Cell 38, 649-661.
Mirzoeva, O.K., and Petrini, J.H. (2003). DNA replication-dependent nuclear dynamics
of the Mre11 complex. Molecular cancer research : MCR 1, 207-218.
Miyake, S., Okishio, N., Samejima, I., Hiraoka, Y., Toda, T., Saitoh, I., and Yanagida, M.
(1993). Fission yeast genes nda1+ and nda4+, mutations of which lead to S-phase block,
chromatin alteration and Ca2+ suppression, are members of the CDC46/MCM2 family.
Mol Biol Cell 4, 1003-1015.
Mizuno, K., Lambert, S., Baldacci, G., Murray, J.M., and Carr, A.M. (2009). Nearby
inverted repeats fuse to generate acentric and dicentric palindromic chromosomes by a
replication template exchange mechanism. Genes Dev 23, 2876-2886.
Mizuno, K., Miyabe, I., Schalbetter, S.A., Carr, A.M., and Murray, J.M. (2013).
Recombination-restarted replication makes inverted chromosome fusions at inverted
repeats. Nature 493, 246-249.
Mochida, S., Esashi, F., Aono, N., Tamai, K., O'Connell, M.J., and Yanagida, M. (2004).
Regulation of checkpoint kinases through dynamic interaction with Crb2. EMBO J 23,
418-428.

132

Mohanty, B.K., Bairwa, N.K., and Bastia, D. (2006). The Tof1p-Csm3p protein complex
counteracts the Rrm3p helicase to control replication termination of Saccharomyces
cerevisiae. Proc Natl Acad Sci U S A 103, 897-902.
Moreno, S., Klar, A., and Nurse, P. (1991). Molecular genetic analysis of fission yeast
Schizosaccharomyces pombe. Methods Enzymol 194, 795-823.
Mortensen, U.H., Lisby, M., and Rothstein, R. (2009). Rad52. Curr Biol 19, R676-677.
Motegi, A., Kuntz, K., Majeed, A., Smith, S., and Myung, K. (2006). Regulation of gross
chromosomal rearrangements by ubiquitin and SUMO ligases in Saccharomyces
cerevisiae. Mol Cell Biol 26, 1424-1433.
Moyer, S.E., Lewis, P.W., and Botchan, M.R. (2006). Isolation of the Cdc45/Mcm2-
7/GINS (CMG) complex, a candidate for the eukaryotic DNA replication fork helicase.
Proc Natl Acad Sci U S A 103, 10236-10241.
Muris, D.F., Vreeken, K., Carr, A.M., Murray, J.M., Smit, C., Lohman, P.H., and Pastink,
A. (1996). Isolation of the Schizosaccharomyces pombe RAD54 homologue, rhp54+, a
gene involved in the repair of radiation damage and replication fidelity. J Cell Sci 109,
73-81.
Muzi-Falconi, M., and Kelly, T.J. (1995). Orp1, a member of the Cdc18/Cdc6 family of
S-phase regulators, is homologous to a component of the origin recognition complex.
Proc Natl Acad Sci U S A 92, 12475-12479.
Nakamura, T.M., Du, L.L., Redon, C., and Russell, P. (2004). Histone H2A
phosphorylation controls Crb2 recruitment at DNA breaks, maintains checkpoint arrest,
and influences DNA repair in fission yeast. Mol Cell Biol 24, 6215-6230.
Nakaya, R., Takaya, J., Onuki, T., Moritani, M., Nozaki, N., and Ishimi, Y. (2010).
Identification of proteins that may directly interact with human RPA. J Biochem 148,
539-547.
Namdar, M., and Kearsey, S.E. (2006). Analysis of Mcm2-7 chromatin binding during
anaphase and in the transition to quiescence in fission yeast. Exp Cell Res 312, 3360-
3369.
Nandi, S., and Whitby, M.C. (2012). The ATPase activity of Fml1 is essential for its roles
in homologous recombination and DNA repair. Nucleic Acids Res 40, 9584-9595.
Naylor, M.L., Li, J.M., Osborn, A.J., and Elledge, S.J. (2009). Mrc1 phosphorylation in
response to DNA replication stress is required for Mec1 accumulation at the stalled fork.
Proc Natl Acad Sci U S A 106, 12765-12770.

133

Nedelcheva, M.N., Roguev, A., Dolapchiev, L.B., Shevchenko, A., Taskov, H.B.,
Shevchenko, A., Stewart, A.F., and Stoynov, S.S. (2005). Uncoupling of unwinding from
DNA synthesis implies regulation of MCM helicase by Tof1/Mrc1/Csm3 checkpoint
complex. Journal of molecular biology 347, 509-521.
Nelson, J.R., Lawrence, C.W., and Hinkle, D.C. (1996). Thymine-thymine dimer bypass
by yeast DNA polymerase zeta. Science 272, 1646-1649.
Nguyen, H.D., Becker, J., Thu, Y.M., Costanzo, M., Koch, E.N., Smith, S., Myung, K.,
Myers, C.L., Boone, C., and Bielinsky, A.K. (2013). Unligated Okazaki Fragments
Induce PCNA Ubiquitination and a Requirement for Rad59-Dependent Replication Fork
Progression. PloS one 8, e66379.
Nguyen, V.Q., Co, C., Irie, K., and Li, J.J. (2000). Clb/Cdc28 kinases promote nuclear
export of the replication initiator proteins Mcm2-7. Curr Biol 10, 195-205.
Nishitani, H., and Lygerou, Z. (2002). Control of DNA replication licensing in a cell
cycle. Genes Cells 7, 523-534.
Nishiyama, A., Frappier, L., and Mechali, M. (2011). MCM-BP regulates unloading of
the MCM2-7 helicase in late S phase. Genes Dev 25, 165-175.
Nitani, N., Yadani, C., Yabuuchi, H., Masukata, H., and Nakagawa, T. (2008). Mcm4 C-
terminal domain of MCM helicase prevents excessive formation of single-stranded DNA
at stalled replication forks. Proc Natl Acad Sci U S A 105, 12973-12978.
Noguchi, C., Rapp, J.B., Skorobogatko, Y.V., Bailey, L.D., and Noguchi, E. (2012). Swi1
associates with chromatin through the DDT domain and recruits Swi3 to preserve
genomic integrity. PloS one 7, e43988.
Noguchi, E., Noguchi, C., Du, L.L., and Russell, P. (2003). Swi1 prevents replication
fork collapse and controls checkpoint kinase Cds1. Mol Cell Biol 23, 7861-7874.
Noguchi, E., Noguchi, C., McDonald, W.H., Yates, J.R., 3rd, and Russell, P. (2004).
Swi1 and Swi3 are components of a replication fork protection complex in fission yeast.
Mol Cell Biol 24, 8342-8355.
Noguchi, E., Shanahan, P., Noguchi, C., and Russell, P. (2002). CDK phosphorylation of
Drc1 regulates DNA replication in fission yeast. Curr Biol 12, 599-605.
Noll, D.M., Mason, T.M., and Miller, P.S. (2006). Formation and repair of interstrand
cross-links in DNA. Chemical reviews 106, 277-301.
Osman, F., and Whitby, M.C. (2007). Exploring the roles of Mus81-Eme1/Mms4 at
perturbed replication forks. DNA repair 6, 1004-1017.

134

Pacek, M., Tutter, A.V., Kubota, Y., Takisawa, H., and Walter, J.C. (2006). Localization
of MCM2-7, Cdc45, and GINS to the site of DNA unwinding during eukaryotic DNA
replication. Mol Cell 21, 581-587.
Pages, V., Bresson, A., Acharya, N., Prakash, S., Fuchs, R.P., and Prakash, L. (2008).
Requirement of Rad5 for DNA polymerase zeta-dependent translesion synthesis in
Saccharomyces cerevisiae. Genetics 180, 73-82.
Papouli, E., Chen, S., Davies, A.A., Huttner, D., Krejci, L., Sung, P., and Ulrich, H.D.
(2005). Crosstalk between SUMO and ubiquitin on PCNA is mediated by recruitment of
the helicase Srs2p. Mol Cell 19, 123-133.
Parker, A.E., Clyne, R.K., Carr, A.M., and Kelly, T.J. (1997). The Schizosaccharomyces
pombe rad11+ gene encodes the large subunit of replication protein A. Mol Cell Biol 17,
2381-2390.
Pasion, S.G., and Forsburg, S.L. (1999). Nuclear localization of Schizosaccharomyces
pombe Mcm2/Cdc19p requires MCM complex assembly. Mol Biol Cell 10, 4043-4057.
Patel, P.K., Kommajosyula, N., Rosebrock, A., Bensimon, A., Leatherwood, J.,
Bechhoefer, J., and Rhind, N. (2008). The Hsk1(Cdc7) replication kinase regulates origin
efficiency. Mol Biol Cell 19, 5550-5558.
Pause, A., and Sonenberg, N. (1992). Mutational analysis of a DEAD box RNA helicase:
the mammalian translation initiation factor eIF-4A. EMBO J 11, 2643-2654.
Pelliccia, F., Bosco, N., and Rocchi, A. (2010). Breakages at common fragile sites set
boundaries of amplified regions in two leukemia cell lines K562 - Molecular
characterization of FRA2H and localization of a new CFS FRA2S. Cancer letters 299,
37-44.
Peng, J., Schwartz, D., Elias, J.E., Thoreen, C.C., Cheng, D., Marsischky, G., Roelofs, J.,
Finley, D., and Gygi, S.P. (2003). A proteomics approach to understanding protein
ubiquitination. Nature biotechnology 21, 921-926.
Pfander, B., Moldovan, G.L., Sacher, M., Hoege, C., and Jentsch, S. (2005). SUMO-
modified PCNA recruits Srs2 to prevent recombination during S phase. Nature 436, 428-
433.
Prakash, R., Krejci, L., Van Komen, S., Anke Schurer, K., Kramer, W., and Sung, P.
(2005a). Saccharomyces cerevisiae MPH1 gene, required for homologous recombination-
mediated mutation avoidance, encodes a 3' to 5' DNA helicase. J Biol Chem 280, 7854-
7860.

135

Prakash, S., Johnson, R.E., and Prakash, L. (2005b). Eukaryotic translesion synthesis
DNA polymerases: specificity of structure and function. Annu Rev Biochem 74, 317-353.
Putnam, C.D., Hayes, T.K., and Kolodner, R.D. (2010). Post-replication repair suppresses
duplication-mediated genome instability. PLoS Genet 6, e1000933.
Radcliffe, P., Hirata, D., Childs, D., Vardy, L., and Toda, T. (1998). Identification of
novel temperature-sensitive lethal alleles in essential beta-tubulin and nonessential alpha
2-tubulin genes as fission yeast polarity mutants. Mol Biol Cell 9, 1757-1771.
Ramasubramanyan, S., Coulon, S., Fuchs, R.P., Lehmann, A.R., and Green, C.M. (2010).
Ubiquitin-PCNA fusion as a mimic for mono-ubiquitinated PCNA in
Schizosaccharomyces pombe. DNA repair 9, 777-784.
Rastogi, R.P., Richa, Kumar, A., Tyagi, M.B., and Sinha, R.P. (2010). Molecular
mechanisms of ultraviolet radiation-induced DNA damage and repair. Journal of nucleic
acids 2010, 592980.
Regairaz, M., Zhang, Y.W., Fu, H., Agama, K.K., Tata, N., Agrawal, S., Aladjem, M.I.,
and Pommier, Y. (2011). Mus81-mediated DNA cleavage resolves replication forks
stalled by topoisomerase I-DNA complexes. J Cell Biol 195, 739-749.
Rhind, N., and Russell, P. (2001). Roles of the mitotic inhibitors Wee1 and Mik1 in the
G(2) DNA damage and replication checkpoints. Mol Cell Biol 21, 1499-1508.
Robison, J.G., Elliott, J., Dixon, K., and Oakley, G.G. (2004). Replication protein A and
the Mre11.Rad50.Nbs1 complex co-localize and interact at sites of stalled replication
forks. J Biol Chem 279, 34802-34810.
Rocak, S., and Linder, P. (2004). DEAD-box proteins: the driving forces behind RNA
metabolism. Nat Rev Mol Cell Biol 5, 232-241.
Rustici, G., Mata, J., Kivinen, K., Lio, P., Penkett, C.J., Burns, G., Hayles, J., Brazma, A.,
Nurse, P., and Bahler, J. (2004). Periodic gene expression program of the fission yeast
cell cycle. Nat Genet 36, 809-817.
Sabatinos, S.A., and Forsburg, S.L. (2009). Measuring DNA content by flow cytometry
in fission yeast. Methods Mol Biol 521, 449-461.
Sabatinos, S.A., and Forsburg, S.L. (2010). Molecular genetics of Schizosaccharomyces
pombe. Methods Enzymol 470, 759-795.
Sabatinos, S.A., Green, M.D., and Forsburg, S.L. (2012). Continued DNA synthesis in
replication checkpoint mutants leads to fork collapse. Mol Cell Biol 32, 4986-4997.

136

Saka, Y., Esashi, F., Matsusaka, T., Mochida, S., and Yanagida, M. (1997). Damage and
replication checkpoint control in fission yeast is ensured by interactions of Crb2, a
protein with BRCT motif, with Cut5 and Chk1. Genes Dev 11, 3387-3400.
Saka, Y., and Yanagida, M. (1993). Fission yeast cut5+, required for S phase onset and
M phase restraint, is identical to the radiation-damage repair gene rad4+. Cell 74, 383-
393.
Sakwe, A.M., Nguyen, T., Athanasopoulos, V., Shire, K., and Frappier, L. (2007).
Identification and characterization of a novel component of the human minichromosome
maintenance complex. Mol Cell Biol 27, 3044-3055.
San Filippo, J., Sung, P., and Klein, H. (2008). Mechanism of eukaryotic homologous
recombination. Annu Rev Biochem 77, 229-257.
Sazer, S., and Sherwood, S.W. (1990). Mitochondrial growth and DNA synthesis occur
in the absence of nuclear DNA replication in fission yeast. J Cell Sci 97, 509-516.
Scharer, O.D. (2005). DNA interstrand crosslinks: natural and drug-induced DNA
adducts that induce unique cellular responses. Chembiochem : a European journal of
chemical biology 6, 27-32.
Schurer, K.A., Rudolph, C., Ulrich, H.D., and Kramer, W. (2004). Yeast MPH1 gene
functions in an error-free DNA damage bypass pathway that requires genes from
Homologous recombination, but not from postreplicative repair. Genetics 166, 1673-1686.
Schwacha, A., and Bell, S.P. (2001). Interactions between two catalytically distinct MCM
subgroups are essential for coordinated ATP hydrolysis and DNA replication. Mol Cell 8,
1093-1104.
Segurado, M., de Luis, A., and Antequera, F. (2003). Genome-wide distribution of DNA
replication origins at A+T-rich islands in Schizosaccharomyces pombe. EMBO Rep 4,
1048-1053.
Sharma, S., Helchowski, C.M., and Canman, C.E. (2012). The roles of DNA polymerase
zeta and the Y family DNA polymerases in promoting or preventing genome instability.
Mutat Res 743, 97-110.
Sherman, D.A., and Forsburg, S.L. (1998). Schizosaccharomyces pombe Mcm3p, an
essential nuclear protein, associates tightly with Nda4p (Mcm5p). Nucleic Acids Res 26,
3955-3960.
Sherman, D.A., Pasion, S.G., and Forsburg, S.L. (1998). Multiple domains of fission
yeast Cdc19p (MCM2) are required for its association with the core MCM complex. Mol
Biol Cell 9, 1833-1845.

137

Shishkin, A.A., Voineagu, I., Matera, R., Cherng, N., Chernet, B.T., Krasilnikova, M.M.,
Narayanan, V., Lobachev, K.S., and Mirkin, S.M. (2009). Large-scale expansions of
Friedreich's ataxia GAA repeats in yeast. Mol Cell 35, 82-92.
Shultz, R.W., Tatineni, V.M., Hanley-Bowdoin, L., and Thompson, W.F. (2007).
Genome-wide analysis of the core DNA replication machinery in the higher plants
Arabidopsis and rice. Plant Physiol 144, 1697-1714.
Siam, R., Gomez, E.B., and Forsburg, S.L. (2007). Schizosaccharomyces pombe
Rad4/Cut5 protein modification and chromatin binding changes in DNA damage. DNA
Cell Biol 26, 565-575.
Sible, J.C., Erikson, E., Hendrickson, M., Maller, J.L., and Gautier, J. (1998).
Developmental regulation of MCM replication factors in Xenopus laevis. Curr Biol 8,
347-350.
Singleton, M.R., Dillingham, M.S., and Wigley, D.B. (2007). Structure and mechanism
of helicases and nucleic acid translocases. Annu Rev Biochem 76, 23-50.
Sirbu, B.M., McDonald, W.H., Dungrawala, H., Badu-Nkansah, A., Kavanaugh, G.M.,
Chen, Y., Tabb, D.L., and Cortez, D. (2013). Identification Of Proteins At Active, Stalled,
And Collapsed Replication Forks Using Isolation Of Proteins On Nascent DNA (iPOND)
Coupled With Mass Spectrometry. J Biol Chem 288, 31458-31467.
Snaith, H.A., Brown, G.W., and Forsburg, S.L. (2000). Schizosaccharomyces pombe
Hsk1p is a potential cds1p target required for genome integrity. Mol Cell Biol 20, 7922-
7932.
Sommariva, E., Pellny, T.K., Karahan, N., Kumar, S., Huberman, J.A., and Dalgaard, J.Z.
(2005). Schizosaccharomyces pombe Swi1, Swi3, and Hsk1 are components of a novel
S-phase response pathway to alkylation damage. Mol Cell Biol 25, 2770-2784.
Stewart, E., Chapman, C.R., Al-Khodairy, F., Carr, A.M., and Enoch, T. (1997). rqh1+, a
fission yeast gene related to the Bloom's and Werner's syndrome genes, is required for
reversible S phase arrest. EMBO J 16, 2682-2692.
Stracker, T.H., and Petrini, J.H. (2011). The MRE11 complex: starting from the ends. Nat
Rev Mol Cell Biol 12, 90-103.
Sugiyama, T., and Kowalczykowski, S.C. (2002). Rad52 protein associates with
replication protein A (RPA)-single-stranded DNA to accelerate Rad51-mediated
displacement of RPA and presynaptic complex formation. J Biol Chem 277, 31663-
31672.

138

Sun, W., Nandi, S., Osman, F., Ahn, J.S., Jakovleska, J., Lorenz, A., and Whitby, M.C.
(2008). The FANCM ortholog Fml1 promotes recombination at stalled replication forks
and limits crossing over during DNA double-strand break repair. Mol Cell 32, 118-128.
Sung, P. (1997). Yeast Rad55 and Rad57 proteins form a heterodimer that functions with
replication protein A to promote DNA strand exchange by Rad51 recombinase. Genes
Dev 11, 1111-1121.
Symington, L.S. (2002). Role of RAD52 epistasis group genes in homologous
recombination and double-strand break repair. Microbiol Mol Biol Rev 66, 630-670,
table of contents.
Szyjka, S.J., Viggiani, C.J., and Aparicio, O.M. (2005). Mrc1 is required for normal
progression of replication forks throughout chromatin in S. cerevisiae. Mol Cell 19, 691-
697.
Takahashi, K., Yamada, H., and Yanagida, M. (1994). Fission yeast minichromosome
loss mutants mis cause lethal aneuploidy and replication abnormality. Mol Biol Cell 5,
1145-1158.
Takahashi, N., Lammens, T., Boudolf, V., Maes, S., Yoshizumi, T., De Jaeger, G.,
Witters, E., Inze, D., and De Veylder, L. (2008). The DNA replication checkpoint aids
survival of plants deficient in the novel replisome factor ETG1. EMBO J 27, 1840-1851.
Takahashi, N., Quimbaya, M., Schubert, V., Lammens, T., Vandepoele, K., Schubert, I.,
Matsui, M., Inze, D., Berx, G., and De Veylder, L. (2010). The MCM-binding protein
ETG1 aids sister chromatid cohesion required for postreplicative homologous
recombination repair. PLoS Genet 6, e1000817.
Takeda, T., Ogino, K., Tatebayashi, K., Ikeda, H., Arai, K., and Masai, H. (2001).
Regulation of initiation of S phase, replication checkpoint signaling, and maintenance of
mitotic chromosome structures during S phase by Hsk1 kinase in the fission yeast. Mol
Biol Cell 12, 1257-1274.
Tanaka, K., and Russell, P. (2001). Mrc1 channels the DNA replication arrest signal to
checkpoint kinase Cds1. Nat Cell Biol 3, 966-972.
Tanaka, K., and Russell, P. (2004). Cds1 phosphorylation by Rad3-Rad26 kinase is
mediated by forkhead-associated domain interaction with Mrc1. J Biol Chem 279, 32079-
32086.
Tanaka, T., Yokoyama, M., Matsumoto, S., Fukatsu, R., You, Z., and Masai, H. (2010).
Fission yeast Swi1-Swi3 complex facilitates DNA binding of Mrc1. J Biol Chem 285,
39609-39622.

139

Tapia-Alveal, C., Calonge, T.M., and O'Connell, M.J. (2009). Regulation of chk1. Cell
Div 4, 8.
Taricani, L., and Wang, T.S. (2006). Rad4TopBP1, a scaffold protein, plays separate
roles in DNA damage and replication checkpoints and DNA replication. Mol Biol Cell 17,
3456-3468.
Tercero, J.A., and Diffley, J.F. (2001). Regulation of DNA replication fork progression
through damaged DNA by the Mec1/Rad53 checkpoint. Nature 412, 553-557.
Thu, Y.M., and Bielinsky, A.K. (2013). Enigmatic roles of Mcm10 in DNA replication.
Trends in biochemical sciences 38, 184-194.
Tittel-Elmer, M., Alabert, C., Pasero, P., and Cobb, J.A. (2009). The MRX complex
stabilizes the replisome independently of the S phase checkpoint during replication stress.
EMBO J 28, 1142-1156.
Tsubouchi, H., and Ogawa, H. (2000). Exo1 roles for repair of DNA double-strand
breaks and meiotic crossing over in Saccharomyces cerevisiae. Mol Biol Cell 11, 2221-
2233.
Tsuji, Y., Watanabe, K., Araki, K., Shinohara, M., Yamagata, Y., Tsurimoto, T.,
Hanaoka, F., Yamamura, K., Yamaizumi, M., and Tateishi, S. (2008). Recognition of
forked and single-stranded DNA structures by human RAD18 complexed with RAD6B
protein triggers its recruitment to stalled replication forks. Genes Cells 13, 343-354.
Tsutsui, Y., Khasanov, F.K., Shinagawa, H., Iwasaki, H., and Bashkirov, V.I. (2001).
Multiple interactions among the components of the recombinational DNA repair system
in Schizosaccharomyces pombe. Genetics 159, 91-105.
Tuteja, N., and Tuteja, R. (2004). Unraveling DNA helicases. Motif, structure,
mechanism and function. European journal of biochemistry / FEBS 271, 1849-1863.
Ulrich, H.D. (2003). Protein-protein interactions within an E2-RING finger complex.
Implications for ubiquitin-dependent DNA damage repair. J Biol Chem 278, 7051-7058.
Umate, P., Tuteja, N., and Tuteja, R. (2011). Genome-wide comprehensive analysis of
human helicases. Communicative & integrative biology 4, 118-137.
Unk, I., Hajdu, I., Blastyak, A., and Haracska, L. (2010). Role of yeast Rad5 and its
human orthologs, HLTF and SHPRH in DNA damage tolerance. DNA repair 9, 257-267.
Veaute, X., Jeusset, J., Soustelle, C., Kowalczykowski, S.C., Le Cam, E., and Fabre, F.
(2003). The Srs2 helicase prevents recombination by disrupting Rad51 nucleoprotein
filaments. Nature 423, 309-312.

140

Voineagu, I., Surka, C.F., Shishkin, A.A., Krasilnikova, M.M., and Mirkin, S.M. (2009).
Replisome stalling and stabilization at CGG repeats, which are responsible for
chromosomal fragility. Nature structural & molecular biology 16, 226-228.
Walker, J.E., Saraste, M., Runswick, M.J., and Gay, N.J. (1982). Distantly related
sequences in the alpha- and beta-subunits of ATP synthase, myosin, kinases and other
ATP-requiring enzymes and a common nucleotide binding fold. EMBO J 1, 945-951.
Walworth, N.C., and Bernards, R. (1996). rad-dependent response of the chk1-encoded
protein kinase at the DNA damage checkpoint. Science 271, 353-356.
Wan, S., Capasso, H., and Walworth, N.C. (1999). The topoisomerase I poison
camptothecin generates a Chk1-dependent DNA damage checkpoint signal in fission
yeast. Yeast 15, 821-828.
Wan, S., and Walworth, N.C. (2001). A novel genetic screen identifies checkpoint-
defective alleles of Schizosaccharomyces pombe chk1. Curr Genet 38, 299-306.
Watson, A.T., Garcia, V., Bone, N., Carr, A.M., and Armstrong, J. (2008). Gene tagging
and gene replacement using recombinase-mediated cassette exchange in
Schizosaccharomyces pombe. Gene 407, 63-74.
Weisman, R., and Choder, M. (2001). The fission yeast TOR homolog, tor1+, is required
for the response to starvation and other stresses via a conserved serine. J Biol Chem 276,
7027-7032.
Willis, N., and Rhind, N. (2009). Mus81, Rhp51(Rad51), and Rqh1 form an epistatic
pathway required for the S-phase DNA damage checkpoint. Mol Biol Cell 20, 819-833.
Willis, N., and Rhind, N. (2010). The fission yeast Rad32(Mre11)-Rad50-Nbs1 complex
acts both upstream and downstream of checkpoint signaling in the S-phase DNA damage
checkpoint. Genetics 184, 887-897.
Windecker, H., and Ulrich, H.D. (2008). Architecture and assembly of poly-SUMO
chains on PCNA in Saccharomyces cerevisiae. Journal of molecular biology 376, 221-
231.
Wold, M.S. (1997). Replication protein A: a heterotrimeric, single-stranded DNA-
binding protein required for eukaryotic DNA metabolism. Annu Rev Biochem 66, 61-92.
Woodward, A.M., Gohler, T., Luciani, M.G., Oehlmann, M., Ge, X., Gartner, A., Jackson,
D.A., and Blow, J.J. (2006). Excess Mcm2-7 license dormant origins of replication that
can be used under conditions of replicative stress. J Cell Biol 173, 673-683.

141

Wu, P.Y., and Nurse, P. (2009). Establishing the program of origin firing during S phase
in fission Yeast. Cell 136, 852-864.
Wyrick, J.J., Aparicio, J.G., Chen, T., Barnett, J.D., Jennings, E.G., Young, R.A., Bell,
S.P., and Aparicio, O.M. (2001). Genome-wide distribution of ORC and MCM proteins
in S. cerevisiae: high-resolution mapping of replication origins. Science 294, 2357-2360.
Xu, J., Yanagisawa, Y., Tsankov, A.M., Hart, C., Aoki, K., Kommajosyula, N.,
Steinmann, K.E., Bochicchio, J., Russ, C., Regev, A., et al. (2012). Genome-wide
identification and characterization of replication origins by deep sequencing. Genome
Biol 13, R27.
Xu, M., Chang, Y.P., and Chen, X.S. (2013). Expression, purification and biochemical
characterization of Schizosaccharomyces pombe Mcm4, 6 and 7. BMC biochemistry 14,
5.
Xu, Y.J., Davenport, M., and Kelly, T.J. (2006). Two-stage mechanism for activation of
the DNA replication checkpoint kinase Cds1 in fission yeast. Genes Dev 20, 990-1003.
Yin, L., Locovei, A.M., and D'Urso, G. (2008). Activation of the DNA damage
checkpoint in mutants defective in DNA replication initiation. Mol Biol Cell 19, 4374-
4382.
Yoshida, K. (2005). Identification of a novel cell-cycle-induced MCM family protein
MCM9. Biochem Biophys Res Commun 331, 669-674.
Zhao, H., and Russell, P. (2004). DNA binding domain in the replication checkpoint
protein Mrc1 of Schizosaccharomyces pombe. J Biol Chem 279, 53023-53027.
Zhao, H., Tanaka, K., Nogochi, E., Nogochi, C., and Russell, P. (2003). Replication
checkpoint protein Mrc1 is regulated by Rad3 and Tel1 in fission yeast. Mol Cell Biol 23,
8395-8403.
Zheng, X.F., Prakash, R., Saro, D., Longerich, S., Niu, H., and Sung, P. (2011).
Processing of DNA structures via DNA unwinding and branch migration by the S.
cerevisiae Mph1 protein. DNA repair 10, 1034-1043.

142

Appendix A: chk1-P470L is a hypomorph of chk1 in S. pombe
Saccharomyces cerevisiae and Schizosaccharomyces pombe are the two most frequently
used eukaryotic model organisms. Diverging ~ 1.1 billion years ago, the two yeasts have
many differences beyond their distinctive shapes. For example, the S. cerevisiae MCM
complex cycles in and out the nucleus depending on CDK activity, while the MCM
complex in S. pombe and other eukaryotes stays in the nucleus and chromatin association
is regulated. S. cerevisiae has well defined replication origins and point centromeres,
while S. pombe and metazoans have more degenerated origins and large centromeres with
many repetitive sequences. However, they exist as single cells in both diploid and haploid
forms. They are very easy to culture and are genetically tractable. They share many genes
that are conserved in humans, hence providing invaluable tools to understand basic
biological processes. Recently, Schizosaccharomyces japonicus, a cousin of S. pombe,
has become a very attractive eukaryotic model as well (Klar, 2013). S. japonicus is a non-
pathogenic dimorphic fission yeast, which grows invasively on solid culture media. This
transition between yeast and hyphal growth is regulated by the DNA damage checkpoint,
which is conserved in S. pombe (Furuya and Niki, 2010, 2012).
We found that camptothecin induces the transition between unicelluar to hyphal
transition in S. japonicus (data not shown). Other groups showed that S. japonicus hyphal
differentiation pathway depends on its DNA damage checkpoint genes (Furuya and Niki,
2010, 2012). Moreover, a gain-of-function mutation of SjChk1 (P470L) induces invasive
growth in the absence of damage (Furuya and Niki, 2010). Chk1 Proline 470 residue is
conserved among yeasts, but not higher eukaryotes (Figure A.1).

143

In S. pombe, Chk1 is highly regulated, especially through its Regin 2 in the C-
terminal domain (Kosoy and O'Connell, 2008; Tapia-Alveal et al., 2009; Wan and
Walworth, 2001). We found that chk1-P470L is not phosphylated in the presence of
damage. It is a hypomorph of chk1
+
in S. pombe.

Figure A.1 Schematic representation of Chk1 domain structure.
Top: S. pombe Chk1. Amino acid 1-279: kinase domain; S345: activating
phosphorylation site. Amino acid 468-477 (blue): region 2 of the C-terminal domain
(Kosoy and O'Connell, 2008).
Bottom: sequence alignment of Chk1 orthologs. S. pombe Chk1 that contains a single
amino acid substitution (Glu472 to Asp) is “Superactive” (Kosoy and O'Connell, 2008).
This residue is conserved in all listed orthologs. S. japonicus Chk1 that contains a single
amino acid substitution (Pro470 to Leu) is the product of chk1-hyp. SjChk1-P470L
causes S. japonicus to grow invasively (Furuya and Niki, 2010).

144

Figure A.2 Overproduction of SpChk1-P470L is not toxic to S. pombe
(A) chk1 ∆ cells transformed with plasmids that overexpress indicated each chk1 alleles
under nmt1 promoter (Pnmt1). Transformants were restreaked on +thiamine (repression)
and –thiamine (induction) and incubated at 32 ℃ for 3 days.
(B) wild type cells transformed with plasmids that overexpress indicated each chk1
alleles under nmt1 promoter (Pnmt1). Transformants were restreaked on +thiamine
(repression) and –thiamine (induction) and incubated at 32℃ for 3 days.

145

Figure A.3 chk1-P470L is a hypomorph of chk1 in S. pombe
(A) Transformants (from Figure A.2) were grown overnight at 32 ℃in EMM-Leu +
thiamine overnight. Cells were washed twice in thiamine-free media before 1:5 serially
diluted (right to left) and spotted onto EMM-Leu with indicated with or without thiamine.
Plates were incubated at 32 ℃ for 2 days.
(B) Transformants (from Figure A.2) were grown overnight at 32 ℃ in EMM-Leu +
thiamine overnight. Cells were washed twice in thiamine-free media before 1:5 serially
diluted (right to left) and spotted onto EMM-Leu+ thiamine with indicated MMS. Plates
were incubated at 32 ℃ for 2 days. SpChk1-P470L partially rescues chk1 ∆ at low MMS
concentration.

146

Figure A.4 Overproduction of Chk1-P470L does not cause cell elongation
Transformants (from Figure A.2) were grown overnight at 32 ℃ in EMM-Leu + thiamine
overnight. Cells were washed twice in thiamine-free media before inoculated into
indicated EMM-Leu with or without thiamine. Cells grew for 16 hours before stained
with DAPI. Leica DMR florescence microscope with 63X oil immersion objective was
used to take pictures.

147

Figure A.5 Chk1-P470L phosphorylation is abolished
Transformants (from Figure A.2) and a chk1-HA strain were grown overnight at 32°C in
EMM-Leu + thiamine overnight. Cells were treated with 0.1%MMS for 1 hour. Whole
cell lysate was made using TCA extraction. Proteins were detected using Western blot.
Tubulin was used as a loading control.

148

Appendix B: Developing Anchor Away technique in S. pombe
The fission yeast Schizosaccharomyces pombe is a tractable eukaryotic model organism.
It is intensively used in deciphering complicated processes such as cell cycle regulation,
genome stability, and aging. Owing to its well-established genetic, molecular,
biochemical and imaging tools, S. pombe provides a simplified environment to study
fundamental functions of many conserved eukaryotic proteins. However, a mechanism of
rapid nuclear proteins inactivation is missing so far.
We developed the anchor-away (AA) system in S. pombe by using a similar
approach as the budding yeast system (Haruki et al., 2008). We demonstrate a rapid
nuclear depletion and cytoplasm enrichment of abundant proteins Rpa1 and Mcm4 as
proof-of-principle experiments.

149

Figure B.1 A schematic of anchor-away (AA) system in S. pombe
The cytoplasmic anchor is Rpl13, a ribosomal 60S subunit protein. It is C-terminally
tagged with 2 copies of FKBP12 in an integration plasmid. The plasmid is linear and
inserted ectopically in the leu1 locus in a tor1SE:KanMX ∆fkh1::ura
+
background. Your
favorite protein is tagged with FRB (FKBP12-rapamycin binding). Addition of
rapamycin promotes rapid translocation of your favorite protein from the nucleus to the
cytoplasm.

150

Figure B.2 Rapamycin inactivates RPA-FRB-GFP, and MCM4-FRB-GFP
(A)(B) Strains were grown overnight at 32 ℃, 1:5 serially diluted (right to left) and
spotted onto plain YES rich media with or without rapamycin. In the presence of
rapamycin, rad11-frb-gfp and mcm4-frb-grp lost viability. Plates were incubated at 32 ℃
for 2 days.
(C)(D) Strains were grown overnight at 32 ℃, 1:5 serially diluted (right to left) and
spotted onto EMM-LEU with or without thiamine. In the absence of thiamine, the anchor
Rpl13-2FKBP12 is overexpressed. The overexpression of Rpl13-2FKBP12 is not toxic to
cells. Plates were incubated at 32 ℃ for 2 days.

151

152

Figure B.3 Rapamycin causes rapid translocation of Rpa1-FRB-GFP
(A) Culture grew overnight in YES, and splitted to three. At T=0, rapamycin was added
to one culture. DMSO was added to another. The third one was left untreated. Rpa1-
FRB-GFP signal was recorded every hour for 5 hours in the rapamycin treated culture.
Rpa1 signal was recorded at the end of the time-course for the DMSO treated culture and
untreated culture.
(B) The distribution of Rpa1-FRB-GFP signal from (A). One hour after the treatment, 65%
of the population exhibited GFP signal in the cytoplasm, 35% was nuclear void. In two
hours, the nuclear void population was a predominant 67%. There are about 5% of cells
with punctate nuclear and cytoplasmic GFP signal. By the end of the time course, 89% of
cells showed this phenotype. n>100.

153

154

Figure B.4 Rapamycin causes rapid translocation Mcm4-FRB-GFP
(A) Culture grew overnight in YES, and splitted to three. At T=0, rapamycin was added
to one culture. DMSO was added to another. The third one was left untreated. Mcm4-
FRB-GFP signal was recorded every hour for 5 hours in the rapamycin treated culture.
Rpa1 signal was recorded at the end of the time-course for the DMSO treated culture and
untreated culture.
(B) The distribution of cell length of Mcm4-FRB-GFP from (A). Cells grew longer, and
show a cdc phenotype over the time. n>50.

155

Table B.1 Yeast strains used in this study

Strain Genotype Source
FY11 h- ade6-M210 Our stock
FY1107 h- ∆rad3::ura4+ ura4-D18 leu1-32 ade6-M216 Our stock
FY6554 h+ pma1-2FKBP12::hph his3-D1 ura4-D18 leu1-32
ade6-M210
This study
FY6555 h+ pma1-2FKBP12::hph his3-D1 ura4-D18 leu1-32
ade6-M210
This study
FY6609 h- fkh1::ura+ ura4 -D18 leu1-32 ade6-M210 TA96 (Weisman
and Choder,
2001)
FY6641 h+ tor1SE:KanMX ura4 -D18 leu1-32 TA1463
FY6652 h- rad11-FRB-GFP::kan tor1SE:KanMX
fkh1::ura+ his3-D1 ura4 -D18 leu1-32
This study
FY6653 h- tor1SE:KanMX fkh1::ura+ ura4 -D18 leu1-
32 ade6-M210
This study
FY6792 h+ tor1SE:KanMX leu1-32::[nmt1-rpl13-
2FKBP12-leu1+ ] ura4-D18
This study
FY6793 h+ tor1SE:KanMX leu1-32::[nmt1-rpl13-
2FKBP12-leu1+ ] ura4-D18
This study
FY6962 h- rad11-FRB-GFP::kan leu1-32::[nmt1-rpl13-
2FKBP12-leu1+ ] tor1SE:KanMX fkh1::ura+
his3-D1 ura4 -D18 leu1-32
This study
FY6964 h- rad11-FRB-GFP::kan leu1-32::[pJK148-
leu1+ ] tor1SE:KanMX fkh1::ura+ his3-D1 ura4
-D18 leu1-32
This study
FY6976 h+ mcm4-FRB-GFP::kan tor1SE:KanMX
fkh1::ura+ ura4-D18 leu1-32 ade6-M210
This study
FY6991 h+ mcm4-FRB-GFP::kan leu1-32::[nmt1-rpl13-
2FKBP12-leu1+ ] tor1SE:KanMX fkh1::ura+
ura4-D18 leu1-32 ade6-M210
This study
FY6992 h+ mcm4-FRB-GFP::kan leu1-32::[nmt1-rpl13-
2FKBP12-leu1+ ] tor1SE:KanMX fkh1::ura+
ura4-D18 leu1-32 ade6-M210
This study
FY6964 h+ mcm4-FRB-GFP::kan leu1-32::[pJK148-
leu1+ ] tor1SE:KanMX fkh1::ura+ ura4-D18
leu1-32 ade6-M210
This study

156

Table B.2 Plasmids used in this study

Plasmid Purpose Source
pFA6a-FRB-
KanMX6
EUROSCARF:
P30578
pFA6a-FRB-
GFP-KanMX6
pFA6a-FRB-(XhoI)-GFP-kanMX6

EUROSCARF:
P30580
pFA6a-
2xFKBP12-
His3MX6
EUROSCARF:
P30583
pJK148 Integration at leu1 locus Our stock
pLD103 pFA6a-2xFKBP12-hph This study
pLD1672/
pLD105
Tag with FRB at C terminus, express under
Pnmt1
This study
pLD106 FRB-XhoI-GFP from pFA6a-FRB-GFP-
KanMX6 to pBluescript
This study
pLD1772/
pLD107
C-FRB-XhoI-GFP This study
pLD108 FRB-GFP with silence XhoI from pLD106 This study
pLD1872/
pLD109
C-FRB-GFP, ura4+, This study
pLD1972/
pLD113
C-FRB, LEU2 This study
pLD2072/
pLD114
C-FRB-GFP, LEU2 This study
pLD115 pFA6a-FRB-natMX6: to tag gene of interests
with FRB at endogenous locus
This study
pLD116 pFA6a-FRB-(XhoI)-GFP-natMX6: to tag gene
of interests with FRB-GFP at endogenous locus
This study
pLD121 pLD114-pob3: Pob3-FRB-GFP This study
pLD122 pLD114-mcb1: Mcb1-FRB-GFP This study
pLD2272/
pLD133
C-2FKBP12 This study
pLD134 Pnmt1-rpl13-2FKBP12 This study
pLD136 Int Pnmt-FRBc-Tnmt This study
pLD137 Int Pnmt-FRB-GFPc- This study
pLD138 Int Pnmt-2FKBP12c- This study
pLD140 Int Pnmt-mcb1-FRB-GFP This study
pLD141 Int Pnmt-rpl13-2FKBP12 This study

Abstract (if available)

Abstract A healthy cell needs to accurately duplicate its genome and pass one copy to each of its daughter cells. The DNA double helix is accessed by replication machinery once per cell cycle during S phase and regulated unwinding of this molecule is essential for replication. However, unwinding can make the DNA vulnerable to damage or breakage. Therefore, the process of unwinding must be carefully regulated. ❧ The conserved proteins Mcm2-7 form the MCM complex, which is the replicative helicase responsible for unwinding the DNA duplex during replication. The MCM complex also plays an important role in replication fork establishment. During S phase, replication fork stability is challenged by many natural impediments or environmental stresses, and control of the unwinding is essential to prevent fork collapse and DNA damage. The focus of my thesis is to gain deeper understanding of how helicase activities are regulated to preserve replication fork integrity. ❧ In chapter 2, I investigate a new factor that regulates the essential replicative helicase, MCM complex. Mcb1 is the ortholog of human MCM binding protein in S. pombe, and I found that Mcb1 antagonizes MCM helicase function by disrupting the association of Mcm2 with other MCM proteins. ❧ In chapter 3, I examined another conserved but non-essential helicase, Rad8. I investigated whether Rad8’s fork regression helicase domain is involved in replication fork restart during HU treatment. Using a genetic approach, I demonstrated that the ubiquitin ligase domain instead of helicase domain is required for Rad8 to promote fork recovery.

Linked assets

University of Southern California Dissertations and Theses

Conceptually similar

PDF

The role of Cdc7 in replication fork progression in response to DNA damage

PDF

The intra-S phase checkpoint and its effect on replication fork dynamics in saccharomyces cerevisiae

PDF

Structure and function of archaeal McM helicase

PDF

Different alleles of fission yeast mcm4 uncover different roles in replication

PDF

Mechanism study of SV40 large tumor antigen atpase and helicase functions in viral DNA replication

PDF

Forkhead transcription factors control genome wide dynamics of the S. cerevisiae replication timing program

PDF

Maintenance of genome stability at fragile sites in Schizosaccharomyces pombe

PDF

New tools for whole-genome analysis of DNA replication timing and fork elongation in saccharomyces cerevisiae

PDF

Structural and biochemical studies of large T antigen: the SV40 replicative helicase

PDF

Biochemical characterization and structural analysis of two hexameric helicases for eukaryotic DNA replication

PDF

Structural and biochemical studies of DNA helicase complexes: conformational diversity of archaeal MCM

PDF

Biochemical mechanism of TopBP1 recruitment to sites of DNA damage

PDF

Destabilization of the replication fork protection complex is associated with meiotic defects in fission yeast

PDF

The S. pombe Mst1 histone acetyltransferase is required for genome stability

PDF

Structural and biochemical studies of two DNA transaction enzymes

PDF

Unraveling the molecular mechanisms of heterochromatic double strand break repair in Drosophila cells

PDF

Simulating the helicase motor of SV40 large tumor antigen

PDF

Measuring, modeling and identifying factors that influence eukaryotic DNA replication

PDF

Computational analysis of DNA replication timing and fork dynamics in S. cerevisiae

PDF

The role of the proteasome & its regulators in adaptation to oxidative stress

Asset Metadata

Creator Ding, Lin (author)

Core Title Essential and non-essential helicases maintain genome stability in Schizosaccharomyces pombe

School College of Letters, Arts and Sciences

Degree Doctor of Philosophy

Degree Program Molecular Biology

Publication Date 01/14/2014

Defense Date 11/14/2013

Publisher University of Southern California (original), University of Southern California. Libraries (digital)

Tag fork recovery,fork regression,helicases,homologous recombination,MCM,OAI-PMH Harvest,replication fork,S. pombe,ubiquitin ligase

Format application/pdf (imt)

Language English

Contributor Electronically uploaded by the author (provenance)

Advisor Forsburg, Susan L. (committee chair), Aparicio, Oscar M. (committee member), Finkel, Steven E. (committee member), Thompson, Mark E. (committee member)

Creator Email dinglin.m@gmail.com,linding@usc.edu

Permanent Link (DOI) https://doi.org/10.25549/usctheses-c3-360582

Unique identifier UC11296534

Identifier etd-DingLin-2229.pdf (filename),usctheses-c3-360582 (legacy record id)

Legacy Identifier etd-DingLin-2229.pdf

Dmrecord 360582

Document Type Dissertation

Format application/pdf (imt)

Rights Ding, Lin

Type texts

Source University of Southern California (contributing entity), University of Southern California Dissertations and Theses (collection)

Access Conditions The author retains rights to his/her dissertation, thesis or other graduate work according to U.S. copyright law. Electronic access is being provided by the USC Libraries in agreement with the a...

Repository Name University of Southern California Digital Library

Repository Location USC Digital Library, University of Southern California, University Park Campus MC 2810, 3434 South Grand Avenue, 2nd Floor, Los Angeles, California 90089-2810, USA