University of Southern California Dissertations and Theses

The mechanism by which extracellular Hsp90α promotes cell migration: implications in wound healing and cancer

(USC Thesis Other)

The mechanism by which extracellular Hsp90α promotes cell migration: implications in wound healing and cancer

PDF

Download a page range

Download transcript

Copy asset link

Request this asset

Transcript (if available)

Content

THE MECHANISM BY WHICH EXTRACELLULAR HSP90α PROMOTES CELL
MIGRATION: IMPLICATIONS IN WOUND HEALING AND CANCER
PROGRESSION

by

Shao-Hung Fred Tsen

A Dissertation Presented to the
FACULTY OF THE USC GRADUATE SCHOOL
UNIVERISTY OF SOUTHERN CALIFORNIA
In Partial Fulfillment of the
Requirements for the Degree
DOCTOR OF PHILOSOPHY
(GENETIC, MOLECULAR, AND CELLULAR BIOLOGY)

May 2013

Copyright 2013 Shao-Hung Fred Tsen

ii

“The Lord is my rock, my fortress and my deliverer; my God is my rock, in whom I
take refuge, my shield and the horn of my salvation, my stronghold.”

Palms 18:2

iii

DEDICATION

I dedicate this doctorial dissertation to my family whose unwavering support and
love has carried me through this long but rewarding journey. To my father,
Andrew Tsen, my mother Sandra Tsen, my sister Magrith Keck, and my wife
Cerina Tsen: Thank you for always being there for me.

iv

ACKNOWLEDGEMENTS

Many have devoted their time and have supported me tremendously
throughout the duration of my graduate education. I would like to take this
opportunity to acknowledge my mentor, Dr. Wei Li, for his commitment and
guidance through my doctorial training and to whom I am forever in debt for the
knowledge and experience his has conferred me during my tenure at his
laboratory. I’m grateful for our many hours of stimulating discussion over results
and theories, which pushed me to develop a critical mind and mature as a
scientist. His attention to detail, keen scientific mind and passion for research are
second to none and those are the legacies that will remain with me for the rest of
my professional career.
I also would like to express my gratitude towards Dr. David Woodley for
his leadership, vision, and for creating an environment that nurtures exploration
and scientific discovery. His commitment to research as the Department of
Dermatology chair has echoed down to both faculty and students alike, leading
the way to achieve significant landmark discoveries in the field.
Dr. Mei Chen has also played an essential role in the success of my
graduate studies providing her scientific knowledge and making sure that we had
our materials for each experiment. She took time from her own research to
attend to our concerns and for that I am extremely grateful.
To the members of my committee, Dr. Young Kwon Hong, Dr. Agnieszka
Kobielak and Dr. Cheng-Ming Chuong, I am indebted for their advice and council

v

throughout my Ph.D. training. Their dedication and commitment to serve on my
committee were essential for the completion of my degree.
I also want to thank current and past members of both Dr. Mei Chen’s and
Dr. Wei Li’s laboratories. In particular, Chieh-Fang (Jack) Cheng was
instrumental in getting me to join the laboratory and teaching me the
experimental techniques. I want to acknowledge Jianhua Fan for her willingness
to share her exceptional laboratory expertise and Kathryn O’Brien for significant
contributions in the animal work and protein production.
I also would like to extend my appreciation to Dr. Debbie Johnson, Dr. Ite
Laird-Offringa, Marisela Zuniga, Dawn Burke and Raquel Gallardo for making
sure all the administrative work pertaining to the graduate program, including
rotations, class enrollment, examination, and stipend were properly submitted
and processed throughout the years.
I am thankful for my mom and dad, Andrew and Sandra Tsen, who taught
me to be persistent and to continue to pursue my dreams no matter what
difficulties I encountered. Their support knows no boundaries and their love
carries me through daily. They are compassionate when I need encouragement
and demanding when I procrastinate. I honestly could not have asked for a better
set of parents.
My grandparents are constant source of inspiration for their perseverance
and hard work through life. I continually seek to emulate after them, in the way
they approach challenges and carry themselves with dignity and compassion for
others.

vi

To my sister, Magrith Keck, who consistently provided me with great
advice on work and life, I would like to express my gratitude. Without her support
growing up in Brazil and later in the United States, life would not have been as
carefree as it was otherwise.
To my father and mother in law, Sue Pink Yuen and Timothy Yuen for
their love and unconditional support since the first day I met them. Their
presence and words of encouragement have been a tremendous source of
strength.
My wife Cerina has given me tremendous support and love on a daily
basis, listening to my frustrations and sharing our accomplishments. There has
not been a more understanding and patient person in my life. I am incredibly
thankful that God has brought such a special person into my life.
Lastly, I would like to acknowledge my Lord and Saviour, Jesus Christ for
His provisions and care throughout my life. Without Him, I would not have had
the strength and confidence necessary to reach the goals He has set for me.

vii

TABLE OF CONTENTS

Epigraph ii

Dedication iii

Acknowledgements iv

List of Tables ix

List of Figures x

Abstract xi

Chapter One: Introduction
1.1 Heat shock protein-90 1
1.2 Implications on wound healing 3
1.3 Implications on Cancer 5
1.4 Low density lipoprotein receptor-related protein 1 8
1.5 Hypothesis and experimental strategies 9
References 14

Chapter Two: A fragment of secreted Hsp90α carries properties
that enable it to effectively accelerate both acute and diabetic
wound healing in mice.
2.1 Abstract 18
2.2 Introduction 19
2.3 Material and methods 23
2.4 Results 28
2.5 Discussion 38
References 54

Chapter Three: The non-chaperone action by secreted Heat Shock
Protein-90alpha (eHsp90α) through the NPVY motif and Akt pathway
in skin wound repair.
3.1 Abstract 60
3.2 Introduction 60
3.3 Material and methods 62
3.4 Results 67
3.5 Discussion 77
References 88

Chapter Four: Conclusions and Remarks About Future Studies
4.1 Conclusions 91
4.2 Future studies 92
References 95

viii

Bibliography 96

Appendix: Abbreviations 105

ix

LIST OF TABLES

Table 1-1: Cancer cell lines that secrete Hsp90. 6

x

LIST OF FIGURES

Figure 2-1: F-5 peptide retains the full promotility activity of 44
full-length Hsp90α.

Figure 2-2: F-5 is superior to FDA-approved becaplermin/PDGF-BB 45
in acute wound healing.

Figure 2-3: Measurements of F-5 versus becaplermin in acute 46
wound healing.

Figure 2-4: F-5 promotes reepithelialization of the wound. 47

Figure 2-5: F-5 shortens the time in promoting diabetic wound 48
closure by two-third.

Figure 2-6: F-5 is superior to becaplermin PDGF-BB in recruiting 49
dermal cells in diabetic wound healing.

Figure 2-7: F-5 is a common promotility factor that overrides 50
TGF-β inhibition.

Figure 2-8: F-5 rescues cell migration under hyperglycemia. 51

Figure 2-9: Hsp90α–LRP-1 signaling is critical to skin cell migration 52
in vitro and wound healing in vivo.

Figure 2-10: A model of how released Hsp90α, but not conventional 53
growth factors, promotes reepithelialization and recruits
dermal cells into the wound during wound healing.

Figure 3-1: Both the expression the LRP-1 receptor and binding 79
of its ligand are essential for eHsp90α to promote
HDF migration in vitro and normal wound healing in mice.

Figure 3-2: Locating the extracellular domain of LRP-1 that 80
mediates eHsp90α pro-motility signal.

Figure 3-3: NPVY, but not NPTY, motif in the cytoplasmic tail 81
of LRP-1 mediates eHsp90 signaling.

Figure 3-4: NPVY motif connects eHsp90α signals to the Akt 82
pathway.

Figure 3-5: Akt1 and Akt2 work together to mediate eHsp90α 83
signaling.

xi

Figure 3-6: Akt-1 and Akt-2 KO mice delayed wound healing 84
cannot be rescued by eHsp90α.

Figure 3-1sA: eHs90α activates the Akt pathway via S437 85
phosphorylation

Figure 3-1sB: ERK
1/2
is another major target in HDFs for eHs90α 86
stimulation.

Figure 3-2s: eHsp90α activates Akt and ERK
1/2
pathways 87
to promote cell migration.

xii

ABSTRACT

Extracellular heat shock protein-90 (eHsp90) proteins, which include the
membrane-bound, released and secreted forms were first cited in scientific
literature late in the 70s. It was not until the recent decade that researchers
began to understand the role of exported Hsp90 in normal and tumor cells. In
normal cells, Hsp90 is secreted in response to tissue injury. Tumor cells, on the
other hand, have managed to constitutively secrete Hsp90 for the purpose of
tissue invasion. Cells abundantly store Hsp90 in their cytoplasm, insuring a
sufficient supply of extracellular Hsp90 at a moment’s notice. A well-
characterized function of secreted Hsp90α is to promote cell motility, a crucial
event in both wound healing and cancer. One of the primary targets for
extracellular Hsp90α is the cell surface LRP-1 receptor. The promotility activity of
secreted Hsp90α resides within a fragment at the boundary between linker region
and middle domain. Inhibiting Hsp90α secretion, neutralizing its extracellular
function or blocking its signaling through the LRP-1 receptor prevent wound
healing and tumor invasion both in vitro and in vivo.

In regards to wound healing, topical application of F-5 promotes acute and
diabetic wound healing far more effectively than US FDA-approved conventional
growth factor therapy in mice. Moreover we demonstrated that, mechanistically,
eHsp90α functions as signaling molecule to promote wound closure. eHsp90α
binds to the subdomain II of the LRP-1 receptor and transmits the promotility
signal through its NPVY motif located in its cytoplamic tail. The NPVY motif then

xiii

relays the eHsp90α signal to the Akt1 and Akt2 kinases. We confirmed our
findings using cross-rescuing experiments that suggest Akt1 and Akt2 work
cooperatively to create a threshold of Akt kinase activity and promote cell
migration. In vivo, eHsp90α accelerated wound closure in wild type mice, but not
in its Akt1- and Akt2- knockout counterparts.

In cancer, despite extensive efforts in the clinical and research fronts over
the lasts two decades, it is still not clear why cancer cells are more susceptible to
the toxicity of Hsp90 inhibitors compared to normal cells. We also do not
understand why all cancer cell lines do not share this heightened sensitivity to
Hsp90 inhibitors. Based on recent findings, we reason that the selected
sensitivity of cancer cells to Hsp90 inhibitors, like17-AAG, is likely due to
inhibition of the extracellular Hsp90 rather than intracellular Hsp90 action. Since
not all tumor cells utilize eHsp90 for motility, invasion and metastasis, only
eHsp90 dependent cancer cells display sensitivity to Hsp90 inhibitors. Based on
this notion, pharmaceutical agents that specifically target eHsp90 function should
be more effective on treating tumor cells and less toxic on normal cells than
current inhibitors that do not discriminate between the extracellular Hsp90
promotility action from its intracellular ATPase dependent function.

1

CHAPTER ONE: INTRODUCTION

1.1 Heat shock protein-90

The 90-kDa heat-shock protein (Hsp90) was first identified as an
intracellular protein whose cellular level increases in response to heat (1). Hsp90
is ubiquitously expressed in most cells where it functions as an intracellular
molecular chaperone. It assists the conformational activation of over a hundred
client proteins in an ATPase-dependent manner under both physiological and
stress conditions (2, 3). Outside the cell, secreted Hsp90α acts as a promotility
factor driving cell migration for wound healing (4). The Hsp90 structure is
composed by a N-terminal ATPase domain that is important for its chaperone
function; a linker region (LR) followed by the middle domain (M) that is involved
in client protein recognition; and finally a carboxyl tail that contains the
dimerization domain. Vertebrates express two distinct isoforms of Hsp90 proteins,
Hsp90α and Hsp90β, which share 86% in amino acid identity. In addition, there
exists two organelle-residing isoforms, the Grp94 and TRAP1, which are also
members of the Hsp90 family (5).

Hsp90α and Hsp90β are generally thought to function in a redundant
fashion (6). Yet there is mounting evidence that this notion may not be entirely
accurate due to technical limitations associated with earlier experimental
approaches. Saribek and colleagues reported that Hsp90β mediates the
signaling of prolactin to trigger apoptosis (7). Because the geldanamycin (GA)
that was used in this study is not a specific inhibitor for the ATPase of Hsp90α,

2

these results do not distinguish Hsp90α from Hsp90β contributions. A study by
Kunisawa and Shastri demonstrated that Hsp90α, but not Hsp90β, was required
to interact with the C-terminally extended proteolytic intermediates, an early
stage in antigen processing, even with a partial down-regulation of the Hsp90α
proteins (8). The reverse was true for CpG-B oligodeoxynucleotide’s anti-
apoptotic signaling in macrophages and dendritic cells. Using RNAi technology,
Kuo et al reported that Hsp90β, but not Hsp90α, is involved in the CpG-B
oligodeoxynucleotide signaling (9). Bouchier-Hayes et al proposed a possible
mechanism for how Hsp90 participates in anti-apoptosis. Using an RNAi
approach, they showed that Hsp90α is a key negative regulator of heat shock-
induced caspase-2 activation (10). This study again did not account for whether
Hsp90α acts alone or in collaboration with Hsp90β. Finally Chatterjee and
colleagues recently showed that Hsp90β plays a more important role than
Hsp90α in the control of multiple myeloma cell survival (11). It is suffice to state
that in light of these findings, the independent roles of Hsp90α and Hsp90β
warrant further scientific investigation.

Another important distinction within the roles of Hsp90 is the intracellular
versus extracellular functional dichotomy. Apart from its role as a intracellular
chaperone, extracellular Hsp90 (eHsp90) has been reported to participate in
various physiological and pathophysiological processes, such as wound healing
(12), angiogenesis (13), cell rearrangements in cranial mesenchyme during
neurulation (14), activation of monocytes, macrophages and dendritic cells (15)

3

and tumor invasion and metastasis (16, 17). Normal cells do not secrete Hsp90
unless they are confronted with environmental stresses. Several laboratories
reported that non-cancerous cells under optimized culture conditions do not
secrete Hsp90 unless exposed to acute environmental changes like reactive
oxygen species (ROS), heat, gamma-irradiation, hypoxia, injury-released growth
factors, serum starvation and virus-infection (18). In wounded tissue, the injured
area becomes hypoxic due to the ischemic environment created after the
severance of blood capillaries. Hypoxia then triggers the stabilization of hypoxia
inducible factor-1α (HIF-1α) leading to the secretion of Hsp90α (12) via the non-
conventional exosomal pathway (19).

1.2 Implications on wound healing

After the discovery of epidermal growth factor (EGF) by Cohen et al in the
early 70s, local growth factors have been considered the main driving force for
wound healing. Growth factors, such as TGFα and KGF (FGF7) for keratinocytes
(HKCs), PDGF-BB for dermal fibroblasts (HDFs) and VEGF-A for dermal
microvascular endothelial cells (HDMECs), often appear only when skin is
wounded or their concentrations rise significantly from basal level in response to
injury. The complex process of wound healing involves the lateral migration and
proliferation of epidermal HKCs over the wound bed to close the wound, followed
by the inward migration of HDFs and HDMECs into the wound bed to remodel
the injured tissue and build a new vascularized neodermis (24-26). However,
following two decades of extensive studies and clinical trials involving multiple
growth factors (25, 26), only recombinant human platelet-derived growth factor-

4

BB (PDGF-BB) has received FDA approval for topical application on diabetic
ulcers (Regranex/becaplermin gel, 0.01%, Ortho-McNeil Pharmaceutical, Raritan,
NJ) (27-29). The modest efficacy, high cost and risk of causing cancer
associated with PDGF-BB have limited its use in the clinical setting. While these
disappointing clinical outcomes clearly implicated that conventional growth
factors are not the driving force of wound closure, the lack of an alternative
strategy has forced researchers to continue to search for a growth factor-based
solution.

In 2006, Badyopadhay and colleagues made a surprising observation that
ultimately led to the discovery of an unconventional wound-healing factor, the
eHsp90α. Having noticed that fetal bovine serum (FBS) has been used to culture
human cells for years, the researchers argued that human cells are never in
contact with FBS in reality and, instead, it is the human serum that represents the
main soluble environment in wounded skin. They compared the effect of FBS
versus human serum on migration of three major human skin cell types,
epidermal keratnocytes and dermal fibroblasts and microvascular endothelial
cells. They found that FBS non-discriminatively stimulated migration of all three
types of human skin cells, as expected. However, they were surprised to find that
human serum only promoted keratinocyte migration, whereas halted migration of
the two dermal cell types. They further revealed that the blocking signal in human
serum comes from TGFβ3 (not TGFβ1 or TGFβ2) and the selective sensitivity of
the human dermal cells to TGFβ3 is due to their 7–15 fold higher levels of TβIIR
compared to epidermal keratinocytes (30). More importantly, this finding

5

indicates that conventional growth factors may not be able to induce proliferation
and migration of dermal fibroblasts and microvascular endothelial cells in vivo, as
they do in vitro, due to the presence of TGFβ3 in human serum. These authors
speculated that this defect in growth factors represents a reason for why the
majority of the growth factor trials in the past failed to show any promising
efficacy.

If not the action of growth factors, then what is the factor that drives
dermal cell migration against TGFβ3 inhibition in the wound and where does it
originate from? Li et al proposed that the factor, primarily responsible for
promoting the initial wound closure, comes from the secretion by stressed skin
cells at the wound edge. From the secreted proteins of primary human
keratinocytes and human dermal fibroblasts, these authors found that secreted
Hsp90α promotes wound closure in mice far more effectively than the
becaplermin gel (4, 12, 22).

1.3 Implications on cancer

In contrast to normal cells, various turmor cells have been found to
constitutively secrete Hsp90 (Table 1-1). Since Hsp90 does not exhibit the
conventional traits of an oncogene, it was not initially recognized as a tumor-
specific target for therapeutics. However, during the early 90s this view of Hsp90
began to shift. Anti-cancer drugs targeting a single oncogene faced the common
problem of cancer plasticity and drug resistance. It was observed that cancer
drug resistance was due to either additional mutations in the target gene or the

6

activation of an independent pathway(s) in the same cells (31). Therefore, it
became desirable to search for a single drug target with combined effects, where
the inhibition of this target simultaneously would shut down multiple cellular
signaling pathways related to the established hallmarks of cancer (32).
Meanwhile, the Hsp90 field was rapidly expanding along with its list of client
proteins. Proteins like ERKB2, MET, RAF, AKT, BCR-ABL, CDK4, and HIF-1α
play a critical role in cell survival, migration, proliferation, differentiation and
apoptosis (33). A consensus arose that Hsp90 acts as the hub in a multi-
molecular complex formation required for oncogene-mediated transformation
(34). This finding laid the foundation for the concept that inhibiting the ATPase of
Hsp90 would lead to simultaneous collapse of multiple signaling pathways in
cancer cells. This new strategy was thought to be able to better cope with the
plasticity and drug resistance found in cancer cells.
Table 1-1. Cancer cell lines that secrete Hsp90.

Name Cell type Citation
SH-76 hybridoma cells Kuroita et al, 1992
HT-1080 fibrosarcoma cells Eustace et al, 2004
MDA-MB-231 breast cancer cells Wang et al. 2009
MCF-7 breast cancer cells Wang et al. 2009
HCT-8 colorectal cancer cells Chen et al, 2010
T24 bladder cancer cells Tsutsumi et al, 2008
B16 melanoma cells Tsutsumi et al, 2008
PC3 prostate cancer cells Tsutsumi et al, 2008
SKBR3 breast cancers Wang et al, 2010
MDA-MB-453 breast cancers Wang et al, 2010
MDA-MB-468 breast cancers Wang et al, 2010
CaoV-3 ovarian cancer McCready et al, 2010
HepG2 hepatoma McCready et al, 2010
A172 glioblastoma McCready et al, 2010
SUM159 breast cancer McCready et al, 2010
MG63 osteocarcinoma Suzuki et al, 2010

7

Many cancer cell lines were reported to express 2-10 fold higher levels of
Hsp90 than their normal counterparts, providing an additional support for
targeting Hsp90 in cancers (33). Even in some cancer cells that do not have an
elevated level of Hsp90, Hsp90 in these cells appeared to be more active than in
normal cells (35). Pharmacokinetic and pharmacodynamic studies revealed that
17-DMAG, a water-soluble form of 17-AAG, was retained longer in MDA-MB-213
human breast cancer xenografts than in normal tissues (Eiseman et al. 2005),
suggesting that multiple Hsp90-client protein complexes are found in tumor cells
that exhibit higher biochemical activity and increased binding affinity to 17-AAG.
These results were interpreted as the reason for why tumor cells are more
sensitive to the ansamycin inhibitors.

Despite these encouraging preclinical results, the therapeutic effects of
the GA-derived anti-Hsp90 inhibitors in anti-cancer clinical trials proved less
promising than originally predicted. The stability and solubility of the ansamycin
inhibitors in patients were found to be among those intrinsic problems. Perhaps
more importantly, there was a deficiency in understanding the biology of Hsp90,
including differences between Hsp90α and Hsp90β isoforms, and the role of
extracellular Hsp90 (eHsp90) in cancer (16, 17, 18). These studies raised a
provocative and previously unrecognized possibility that the GA inhibitors in
clinical trials simultaneously targeted both intracellular and extracellular Hsp90
proteins. Furthermore, the anti-cancer effect of these GA inhibitors was in fact
due to their inhibition of the eHsp90, instead of intracellular Hsp90 chaperone.

8

Therefore it has become critical to understand the functional distinction between
intracellularly and extracellularly localized Hsp90 molecules.

1.4 Low density lipoprotein receptor-related protein 1

If eHsp90α is indeed a secreted promotility factor that plays a critical role
in both wound healing and cancer progression, then what is its cellular receptor?
Low density lipoprotein receptor-related protein 1 (LRP-1) belongs to a family
containing seven members related to the LDL receptor. Structurally, LRP-1
consists of a 515-kDa extracellular ligand-binding subunit and a membrane-
anchoring 85-kDa subunit, derived from the proteolytic product of a 600-kDa
precursor protein (20). Deletion of the LRP-1 gene leads to embryonic lethality in
mice (21). LRP-1 is expressed in several types of normal as well as tumor cells
and has been reported to bind a wide variety of extracellular ligands, including
lipoproteins, proteases and growth factors. LRP-1 expression is altered in certain
cancer cells and this alteration influences the invasiveness of the cancer cells
(22). Cheng et al provided direct evidence that the LRP-1 receptor mediates
eHsp90-stimulated human skin cell migration in vitro and wound healing in vivo.
Their study showed that neutralizing antibodies against LRP-1’s ligand binding
domain blocked recombinant Hsp90-induced cell migration. Lentiviral vector-
mediated shRNA expression and down-regulation of LRP-1 abolished normal
and cancer cell migration as well as cancer cell invasion in response to
recombinant Hsp90α (22). Blocking the signaling of LRP-1 by receptor-associate
protein (RAP) dramatically delayed wound healing in mice (4). Breast cancer cell
migration and invasion in vitro and tumor formation in vivo were greatly reduced

9

by down-regulation of LRP-1 in these cells (23). LRP-1 has therefore been
shown in vitro and in vivo to play an essential role in mediating eHsp90 signaling,
but how is this signal propagated inside the cell? This is the central question
surrounding this thesis and the implications of this underlying mechanism would
provide new insight in both wound healing and cancer progression therapeutics.

1.5 Hypothesis and experimental strategies

Over the years conventional wisdom has dictated that conventional growth
factors were the main driving force of wound healing. Following over two
decades of research and clinical trials only one growth factor, PDGF-BB, has
received US FDA approval for use in the treatment of diabetic wound.
Furthermore, the disappointing low efficacy, high cost, and increased risk for
cancer associated with the treatment suggested to us that growth factors might
not have been the intended wound-healing factor responsible for promoting
wound healing. We reasoned that due to the inhibitory effects of TGF-β3, present
abundantly at the wound bed following tissue injury, growth factors could not be
responsible for driving wound healing. We then proposed that secreted Hsp90α,
not conventional growth factor, is the primary driving force of wound closure
during the early stages of wound healing. In order to address this question, our
experimental design required the production of highly pure recombinant Hsp90α
that could unequivocally demonstrate that extracellular Hsp90α was more potent
at promoting the migration of the three primary skin cell types, could overcome
the inhibitory effects of TGF-β3 in vitro, and more effective at accelerating wound
closure in vivo, when compared to conventional growth factor PDGF-BB. In other

10

to achieve this level of purity and at the same time avoid bacterial endotoxins, we
employed a Ni+ affinity column to pull down E Coli expressed His-tagged
recombinant Hsp90α and followed by fast protein liquid chromatography (FPLC)
driven size exclusion chromatography purification. We then utilized this
recombinant Hsp90α to test our hypothesis on three in vitro migration assays: (a)
the colloidal gold salt migration assay that detects migration of individual cells,
(b) the in vitro wound healing (scratch) assay that measures migration of a cell
population, and (c) the transwell assay that tests 3-dimensional chemotaxis.
These three independent migration assays allowed us to establish that Hsp90α,
more specifically the F-5 fragment and not growth factor PDGF-BB, is able to
drive the cell migration of the three major skin cell types and overcome TGF-β3
inhibition in vitro.

Moreover we were able demonstrate the superior efficacy of recombinant
Hsp90α in the treatment of chronic diabetic wounds by employing the well-
established type II diabetic mouse model. The db/db mice, which harbor a
mutation in their leptin receptor, gain weight and display hyperglycemia by 6 to 8
weeks of age compared to their wild type counterparts. A 1.5 x 1.5 cm full-
thickness wound on this strain of mice only heals after 30-50 days, compared to
15-20 days on normal mice, emulating the delayed wound healing observed in
human diabetic patients. H&E and immunostaining using anti-bodies specifically
to detect re-epithelialization (anti-pan keratin), blood vessel formation (anti-
PECAM-1), and wound contraction (anti-SMA) were used to demonstrate that
Hsp90α accelerates wound closure by promoting epidermal re-epithelialization

11

while retaining re-vascularization and low contraction (scaring) characteristics
associated with proper wound healing.

In order to understand the mechanism by which eHsp90α functions, we
raised three critical questions: (a) where does the promotility region resides
within the eHsp90a protein, (b) where does this region bind on the LRP-1
receptor, and (c) how is this information transmitted downstream of LRP-1
receptor? We used series of subcloning and purification techniques along with
the previously described functional migration assays to systematically dissect the
region within Hsp90α responsible for its promotility function. We reasoned that as
a ligand extracellular Hsp90α must have a binding region recognized by its
receptor LRP-1. Furthermore, we speculated that the promotility function of
Hsp90α might not required certain domains of the protein, such as the N-terminal
ATPase function and dimerization domain that are critical for its intracellular
chaperone activity. We were able to locate a 115 amino acid fragment, residing
in the border of the linker region and the middle domain of Hsp90α, which
contains the full promotility activity of the full-length protein. Next we took
advantage of the mini LRP-1 receptors generated by Bu et al to create
overexpression lentiviral-based vector constructs (pRRLsin.MCS-Deco) and
thereby identify the binding domain of LRP-1 responsible for recognizing the F-5
region of Hsp90α. In order to test this in vitro, we generated a FG-12 based
shRNA delivered by lentivirus to downregulate the endogenous LRP-1 receptor
already present in primary skin cells. We reasoned that performing a more
routine transient overexpression system without properly removing the

12

endogenously expressed wild type full-length LRP-1 receptor would yield
confounding and likely incorrect results. Furthermore, because these mini LRP-1
receptors contained the full 85kDa signaling transmembrane subunit fused to one
of the 4 binding subdomains of LRP-1, we were able to specifically test each of
binding regions of the LRP-1 receptor without compromising its overall
functionality. This knockdown and replacement technique allowed us to identify
that eHsp90α is recognized by LRP-1’s binding region II. We then applied a
similar lentiviral-based down-regulation of the endogenous LRP-1 receptor
followed by replacement with the manipulated mini LRP-1 receptor to answer our
third question. We used site-directed mutagenesis to abolish one or both of the
NPXY signaling motif found in the carboxyl tail of our mini LRP-1 receptor
containing the binding subdomain II (mLRP1-II). We then subjected human
dermal fibroblasts that expressed one of the mLRP1-II mutant constructs to
arrive at the conclusion that Hsp90α promotility signaling goes through the distal
NPVY, but not the proximal NPTY, motif of LRP-1. To further delineate the
downstream promotility signal of Hsp90α, we employed a commercially available
Human Phospho-Kinase Antibody Array that is spotted with antibodies
recognizing the 47 distinct protein kinase pathways. We took this approach to
help us screen through multiple activation pathways and narrow down the
signaling partners downstream of the NPVY motif. Through this technique we
were able to show that the NPVY motif connects to an important downstream
effector, the Akt pathway. We also confirmed our findings by performing Western
blot analysis using monoclonal antibodies. In order to distinguish between the

13

contributions of Akt1, Akt2 and Akt3 in the propagation of the Hsp90α promotility
signal, we generated specific individual FG-12 based knockout HDFs of each Akt
isoform and demonstrated that down-regulation of one Akt isoform did not affect
the other two. We speculated that each Akt kinase may either have individual
downstream targets or they may collaboratively act to create a threshold Akt
activity. We demonstrated that in HDFs, Akt1 and Akt2 work in concert to
generate an Akt activity threshold critical for downstream signaling. Finally in
order to understand the in vivo contributions of Atk1 and Akt2 kinases, we
performed full-thickness wound healing experiment on the backs of Akt1 (in
collaboration with Hay et al) and Akt2 (in collaboration with Stilles et al) knockout
mice. These in vivo experiments led us to conclude that both Akt1 and Akt2 are
critical for Hsp90α mediated wound healing.

14

References

1. Ritossa F. Discovery of the heat shock response. Cell Stress Chaperones.
1996; 1:97-8.

2. Young JC, Moarefi I, Hart FU. Hsp90: a specialized but essential protein-
folding tool. J Cell Biol. 2001; 154:267-73.

3. Whitesell L, Lindquist SL. HSP90 and the chaperoning of cancer. Nat Rev
Cancer. 2005; 5:761-72.

4. Cheng CF, Sahu D, Tsen F, Zhao Z, Fan J, Kim R, Wang X, O'Brien K, Li
Y, Kuang Y, Chen M, Woodley DT, Li W. A fragment of secreted Hsp90α
carries properties that enable it to accelerate effectively both acute and
diabetic wound healing in mice. J Clin Invest. 2011:121:4348-61.

5. Sreedhar AS, Kalmár E, Csermely P, Shen YF. Hsp90 isoforms: functions,
expression and clinical importance. FEBS Lett. 2004; 562:11-5.

6. Kajiwara, C, Kondo S, Uda S, Dai L, Ichiyanagi T, Chiba T, Ishido S, Koji
T, Udono H. Spermatogenesis arrest caused by conditional deletion of
Hsp90α in adult mice. Biology Open. 2012; 1:977-982

7. Saribek B, Jin Y, Saigo M, Eto K, Abe S. HSP90beta is involved in
signaling prolactin-induced apoptosis in newt testis. Biochem Biophys Res
Commun. 2006; 349:1190-7.

8. Kunisawa J, Shastri N. Hsp90alpha chaperones large C-terminally
extended proteolytic intermediates in the MHC class I antigen processing
pathway. Immunity. 2006; 24:523-34.

9. Kuo CC, Liang CM, Lai CY, Liang SM. Involvement of heat shock protein
Hsp 90 beta but not Hsp90 alpha in antiapoptotic effect of CpG-B
oligodeoxynucleotide. J Immunol. 2007; 178:6100-8.

10. Bouchier-Hayes L, Oberst LA, McStay GP, Connell S, Tait SW, Dillon CP,
Flanagan JM, Beere HM, Green DR. Characterization of cytoplasmic
caspase-2 activation by induced proximity. Mol Cell. 2009; 35:830-40.

11. Chatterjee M, Jain S, Stühmer T, Andrulis M, Ungethüm U, Kuban RJ,
Lorentz H, Bommert K, Topp M, Krämer D, Müller-Hermelink HK, Einsele
H, Greiner A, Bargou RC. STAT3 and MAPK signaling maintain
overexpression of heat shock proteins 90alpha and beta in multiple
myeloma cells, which critically contribute to tumor-cell survival. Blood.
2007; 109:720-8.

15

12. Li W, Li Y, Guan S, Fan J, Cheng CF, Bright AM, Chinn C, Chen M,
Woodley DT. Extracellular heat shock protein-90alpha: linking hypoxia to
skin cell motility and wound healing. EMBO J. 2007; 26:1221-33.

13. Song X, Wang X, Zhuo W, Shi H, Feng D, Sun Y, Liang Y, Fu Y, Zhou D,
Luo Y. The regulatory mechanism of extracellular Hsp90{alpha} on matrix
metalloproteinase-2 processing and tumor angiogenesis. J Biol Chem.
2010; 285:40039-49

14. Sarkar AA, Zohn IE. Hectd1 regulates intracellular localization and
secretion of Hsp90 to control cellular behavior of the cranial mesenchyme.
J Cell Biol. 2012; 196:789-800.

15. Cecchini P, Tavano R, Polverino de Laureto P, Franzoso S, Mazzon C,
Montanari P, Papini E. The soluble recombinant Neisseria meningitidis
adhesin NadA Δ351-405 stimulates human monocytes by binding to
extracellular Hsp90. PLoS One. 2011; 6:e25089.

16. Eustace BK, Sakurai T, Stewart JK, Yimlamai D, Unger C, Zehetmeier C,
Lain B, Torella C, Henning SW, Beste G, Scroggins BT, Neckers L, lag LL,
Jay DG. Functional proteomic screens reveal an essential extracellular
role for hsp90 alpha in cancer cell invasiveness. Nat Cell Biol. 2004;
6:507-14.

17. Tsutsumi S, Scroggins B, Koga F, Lee MJ, Trepel J, Felts S, Carreras C,
Neckers L. A small molecule cell-impermeant Hsp90 antagonist inhibits
tumor cell motility and invasion. Oncogene. 2008; 27:2478-87.

18. Li W, Sahu D, Tsen F. Secreted heat shock protein-90 Hsp90 in wound
healing and cancer. Biochim Biophys Acta. 2012; 1823:730-41.

19. Clayton A, Turkes A, Navabi H, Mason MD, Tabi Z. Induction of heat
shock proteins in B-cell exosomes. J Cell Sci. 2005; 118:3631-8.

20. Strickland DK, Ashcom JD, Williams S, Burgess WH, Migliorini M,
Argraves WS. Sequence identity between the alpha 2-macroglobulin
receptor and low density lipoprotein receptor-related protein suggests that
this molecule is a multifunctional receptor. J Biol Chem. 1990; 265:17401-
4.

21. Herz J, Strickland DK. LRP: a multifunctional scavenger and signaling
receptor. J Clin Invest. 2001; 108:779-84.

22. Cheng, CF, Fan J, Fedesco M, Guan S, Li Y, Bandyopadhyay B, Bright
AM, Yerushalmi C, Liang M, Chen M, Han YP, Woodley DT, Li W..
Transforming growth factor alpha (TGFalpha)-stimulated secretion of

16

HSP90alpha: using the receptor LRP-1/CD91 to promote human skin cell
migration against a TGFbeta-rich environment during wound healing. Mol
Cell Biol, 2008; 28:3344-58.

23. Sahu D, Zhao Z, Tsen F, Cheng CF, Park R, Situ AJ, J. Dai, Eginli A,
Shams S, Chen M, Ulmer TS, Conti P, Woodley DT, Li W. A potentially
common peptide target in secreted heat shock protein-90α for hypoxia-
inducible factor-1-α positive tumors. Mol Biol Cell. 2012; 23:602-13.

24. Martin P. Wound healing--aiming for perfect skin regeneration. Science.
1997; 276:75–81.

25. Singer AJ, Clark RA. Cutaneous wound healing. N Engl J Med. 1999;
341:738–746.

26. Werner S, Grose R. Regulation of wound healing by growth factors and
cytokines. Physiol Rev. 2003; 83:835–870.

27. LeGrand EK. Preclinical promise of becaplermin (rhPDGF-BB) in wound
healing. Am J Surg. 1998; 176:48S–54S.

28. Steed DL. Clinical evaluation of recombinant human platelet-derived
growth factor for the treatment of lower extremity diabetic ulcers. Diabetic
Ulcer Study Group. J Vasc Surg. 1995; 21:71–78. discussion 79–81.

29. Wieman TJ, Smiell JM, Su Y. Efficacy and safety of a topical gel
formulation of recombinant human platelet-derived growth factor-BB
(becaplermin) in patients with chronic neuropathic diabetic ulcers. A phase
III randomized placebo-controlled double-blind study. Diabetes Care.
1998; 21:822–827.

30. Bandyopadhyay B, Fan J, Guan S, Li Y, Chen M, Woodley DT, Li W. A
“traffic control” role for TGFbeta3: orchestrating dermal and epidermal cell
motility during wound healing. J Cell Biol. 2006; 172:1093–1105.

31. Neckers L, Neckers K. Heat-shock protein 90 inhibitors as novel cancer
chemotherapeutic agents. Expert Opin Emerg Drugs. 2002; 7:277-88.

32. Hanahan D, Weinberg RA. Hallmarks of cancer: the next generation. Cell.
2011; 144:646-74.

33. Isaacs JS, Xu W, Neckers L. Heat shock protein 90 as a molecular target
for cancer therapeutics. Cancer Cell, 2003; 3:213-7.

17

34. McClellan AJ, Xia Y, Deutschbauer AM, Davis RW, Gerstein M, Frydman
J. Diverse cellular functions of the Hsp90 molecular chaperone uncovered
using systems approaches. Cell, 2007; 131:121-35.

35. Kamal A, Thao L, Sensintaffar J, Zhang L, Boehm MF, Fritz LC, Burrows
FJ. A high-affinity conformation of Hsp90 confers tumour selectivity on
Hsp90 inhibitors. Nature. 2003; 425:407-10.

18

CHAPTER TWO: A FRAGMENT OF SECRETED HSP90α CARRIES
PROPERTIES THAT ENABLE IT TO ACCELERATE EFFECTIVELY BOTH
ACUTE AND DIABETIC WOUND HEALING IN MICE

2.1 Abstract

Wounds that fail to heal in a timely manner, such as diabetic foot ulcers,
impose a significant health, economic, and social problem worldwide. For many
decades, conventional wisdom has dictated that growth factors were the main
driving force of wound healing; thus, growth factors have become the primary
focus for therapeutic developments. To date, becaplermin (recombinant human
PDGF-BB) remains the only US FDA-approved growth factor therapy, and it
shows modest efficacy, is costly, and has the potential to cause cancer in
patients. As a result alternative molecules that can effectively promote wound
healing without the carcinogenic potential have seen sought after. In this context,
it has been observed that wounds do not heal without the participation of
secreted Hsp90α. Here, we report that a 115-aa fragment of secreted Hsp90α
(denoted as F-5) acts as an unconventional wound-healing agent in mice.
Topical application of the F-5 peptide promoted acute and diabetic wound
closure in mice far more effectively than PDGF-BB. The greater efficacy of F-5
was attributed to 3 properties absent in conventional growth factors: (i) the ability
to recruit both epidermal and dermal cells; (ii) the fact that this ability to promote
dermal cell migration was not inhibited by TGF-β; and (iii) the ability to override
the inhibitory effects of hyperglycemia on cell migration due to diabetes. The
discovery of F-5 challenges the long-standing paradigm of wound healing factors

19

and reveals a potentially more effective and safer agent for healing acute and
diabetic wounds.

2.2 Introduction

According to the Wound Healing Society, approximately 15% of older
adults in the US suffer from some form of chronic wounds: predominantly venous
stasis ulcers, pressure ulcers (bedsores), and diabetic (neuropathic) foot ulcers
(1, 2). Every year, 2 to 3 million more Americans are diagnosed with various
types of chronic wounds. For instance, an estimated 18% of diabetic patients
over the age of 65 in the US have non-healing foot ulcers (3). In this particular
patient population, the number of wound infection-caused leg amputations is
approaching 100,000 per year. Worldwide, it is estimated that a lower limb is lost
every 30 seconds as result of diabetic wound infection (2). The cost associated
with the surgical procedure, hospitalization, and wound care amounts to
$100,000 per patient (in a 24-month period) on the US taxpayer’s bill and, not to
mention, compromises in the quality of the patient’s livelihood. The collective
health care cost of the various chronic wounds exceeds $25 billion annually, a
rapid increase due to increasing health care cost, an aging population, and a rise
in the incidence of diabetes and obesity in the US. On top of these already
staggering, the prolonged absence of effective treatments for chronic wounds
further contributed to the scope of this devastating problem.
Following the discovery of the first growth factor in the early 1970s, it has
become conventional wisdom that locally released growth factors in an injured
tissue constitute the main driving force during the wound healing process (4, 5).

20

Specifically, under this assumption, growth factors are responsible for promoting
the lateral migration of epidermal keratinocytes to close the wound, the inward
migration of dermal fibroblasts to remodel the damaged tissue, and migration of
microvascular endothelial cells to rebuild vascularized neodermis in the wounded
space (6, 7). Since the first report of the EGF clinical trial on wound healing in
1989 (8), more than a dozen growth factor based trials have been conducted.
The list includes (i) EGF treatment on partial-thickness wounds of skin grafts (8),
traumatic corneal epithelial defects (9), tympanic membrane with chronic
perforation (10), and advanced diabetic foot ulcers (11, 12); (ii) bFGF application
on partial-thickness burn wounds of children (13), second-degree burns (14), and
diabetic ulcers (15); (iii) acidic FGF on partial-thick- ness burns and skin graft
donor sites (16); (iv) GM-CSF plus bFGF on pressure ulcers (17); and (v) PDGF-
BB on chronic pressure and diabetic ulcers (18–22). Despite the fact that most of
these double- blinded trials reported promising clinical efficacies in humans, only
the human recombinant PDGF-BB has received US FDA approval for treatment
of limb diabetic ulcers (Regranex, becaplermin gel 0.01%, Ortho-McNeil
Pharmaceutical) (20). After its approval in 1997, multicenter, randomized, parallel
trials showed that becaplermin, at 100 µg/g of PDGF-BB achieved a modest 15%
improvement in wound closure over control (50% treated versus 36% placebo)
(19–22). These results were not considered to be a cost-effective approach for
the clinical setting (23, 24). In addition, the US FDA added a black box warning
regarding increased risks for cancer mortality in patients who may require
extensive treatments (≥3 tubes) of becaplermin gel in 2008. This significant side

21

effect may not have surprised cancer researchers, as it was already known,
years before the FDA approval of becaplermin gel, that overexpression of PDGF-
BB (c-sis) or autocrine of its viral form, v-sis, causes cell transformation (25). Yet
the recommended dosage of PDGF-BB in becaplermin gel is more than 1,000-
fold higher than the range of the physiological PDGF-BB levels in human
circulation (26).
So, what was against the conventional wisdom? Initially, in an entirely
isolated study in our laboratory, we noticed that FBS or its equivalent has been
widely used in studies of human skin cells and wound healing. However, these
human cells are never in contact with FBS in reality, instead they are bathed in
human serum within the wound. We challenged the assumption that FBS and
human serum share completely interchangeable factors for human skin cell
migration. Results of our experiments showed that, while FBS equally stimulated
migration of human epidermal and dermal cells; human serum only promoted
human keratinocyte (HK) migration, but halted human dermal fibroblast (HDF)
and human microvascular endothelial cell (HDMEC) migration (27, 28). We
further identified TGF-β3 (not TGF-β1 or TGF-β2) in human serum as the primary
molecule responsible for the inhibitory effect of human serum on migration of
human dermal cells, which express 7- to 18-fold higher levels of the type II TGF-
β receptor (TβRII) than human epidermal keratinocytes (28). In this case
however, TGF-β3 is not the troublemaker per say; instead it controls the “traffic”
of epidermal and dermal cells to orchestrate the highly ordered and systematic
recruitment of cells required for proper wound closure (28). An important

22

implication of these findings is that conventional growth factors, such as PDGF-
BB for dermal fibroblasts and VEGF-A for endothelial cells, may not be able to do
the job as they had hoped for, in human wounds, because of the co-presence of
TGF-β3.
We speculated that the source of the molecule driving wound closure
comes from proteins secreted by human skin cells at the wound edge in
response to injury. Using protein separation and purification techniques allowed
us to discover a novel wound healing-promoting factor, the secreted form of
Hsp90α, from both HDFs and HKs (29, 30). It is now clear that normal cells do
not secrete Hsp90α in the absence of tissue stress (31). However, when cells
encounter pathophysiological conditions, such as cancer (32) or stress cues from
the environment: including hypoxia (29), heat shock (33, 34), reactive oxygen
species (35), gamma-irradiation (36), or injury-released cytokines (30); they
respond by secreting their abundantly stored Hsp90α for tissue repair or tissue
invasion (in the case tumor cells) via the exosomal pathway (31). In this study,
we take Hsp90α secreted during wound healing to a new preclinical level by
systematically analyzing secreted Hsp90α fragments versus FDA-approved
conventional growth factor treatment on acute and diabetic wounds in mice. More
importantly, we provide 3 justifications as to why a 115-aa fragment from
secreted Hsp90α (F-5) represents the bona fide driving force for the initial wound
closure and a new generation of treatment for diabetic wounds.

23

2.3 Material and Methods

Primary human neonatal HKs, HDFs, and HDMECs were purchased from
Clonetics. HKs were cultured in EpiLife medium with added HKGS growth
supplements. HDFs were cultured in DMEM supplemented with 10% FBS.
HDMECs were cultured in growth factor-supplemented Medium 131 (Cascade
Biologics). The third or fourth passages were used in cell migration assays.
rhPDGF-BB, rhTGF- α, and rhTGF- β3 were purchased from R&D Systems.
Regranex (becaplermin 0.01% gel, Ortho-McNeil Pharmaceutical) was
prescribed and purchased from USC Medical Plaza Pharmacy solely for this
study. Antibodies against PDGFR α and PDGFR β were from Santa Cruz
Biotechnology Inc. (SC-338) and Genzyme (1263-00), respectively. Anti-
LRP1/CD91 antibody was purchased from Progen Biotechnik. Mouse
monoclonal antibody (pan) against Keratin (ab8068) was from Abcam Inc.
PECAM-1 (M-20) goat polyclonal antibody (sc-1506) was from Santa Cruz
Biotechnology Inc. Monoclonal mouse anti-mouse SMA antibody was from Dako
Denmark A/S. Biotinylated rabbit anti-goat IgG and biotinylated horse anti-mouse
IgG were from Vector Laboratories. Chromagon system, Dako Liquid DAB+
substrate, was from Dako Denmark A/S. Mouse antibody on mouse tissues
(mouse- on-mouse) detection system, VECTOR M.O.M. Immunodetection Kit,
and the Immunoperoxidase System, VECTORSTAIN Elite ABC Kit, were from
Vector Laboratories. Carboxymethylcellulose (CMC) sodium salt (C5678) (pH
measured at 7.14) was from Sigma-Aldrich. Rat type I collagen was purchased
from BD Biosciences. Anti- β-actin antibody and anti-GAPDH antibody were from

24

Cell Signaling Technology. The RAP construct in bacteria was a gift of Guojun
Bu (University of Washington, St. Louis, Missouri, USA). XL-10 Gold Ultra
competent cells were from Stratagene. Stat Strips (adhesive bandages) were
from Notro Max Products. 3M Coban (self-adhesive wrap) was from 3M.
Subcloning, production, and purification of Hsp90 α fragments. The
cDNAs encoding the full-length and various fragments (F-1 to F-6) of Hsp90 α
were generated by PCR using human Hsp90 α cDNA as the template. PCR
fragments were subcloned into the His-tag pET15b vector (EMD Biosciences
Inc.) at BamH1 or Bam H1 and NdeI sites. DNA sequences of the fragments
were verified by DNA sequencing. The pET15b-Hsp90 α constructs were
transformed into BL21-codonPlus (DE3)-RP competent cells (Stratagene)
following a manufacturer-provided protocol. Protein production and purification
were described previously (30). Proteins were confirmed by Western blots
concentrated in Centricons YM (10 to 50) to a final concentration of 1 mg/ml, and
stored in 10% glycerol in DPBS at –80°C.
Cell migration assays. The colloidal gold migration assay, the in vitro
wound healing (scratch) assay, and the transwell assay were as modified and
described previously by us (37, 38). Data from independent experiments (n ≥ 3)
were averaged and calculated as percentage, OD reading, or fold increase in
response to corresponding stimulus over the baseline control (mean ± SD; P <
0.05).

25

The FG-12 lentiviral system, RNAi against LRP-1, lentiviral
production, and infection. Details regarding these methods have been
published by our labora- tory and by others (29, 46, 63).
Preparation of CMC gel with Hsp90α peptides. CMC powder (viscosity
50–200 cps, purity 99.5%, sodium salt) was dissolved in double-distilled H2O in a
tissue culture hood at 5% concentration (w/v), heated for 4 hours at 37°C, placed
in a shaker for 24 hours at 4°C, and brought back to room temperature. This
CMC solution was mixed in a 1:1 ratio (vol/vol) with a desired concentration of
FPLC-purified and filtered (0.22 µm) Hsp90α peptide (in DPBS). The CMC gel
diluted with DPBS or mixed with DPBS containing Hsp90α peptides was applied
topically to the wounds.
Wound healing in mice. Thymic hairless (Foxn1) mice and BKS.Cg-
m+/+Leprdb/J mice were obtained from The Jackson Laboratory and housed 4
per cage prior to or 1 per cage during experiments. Athymic hairless mice of 8 to
10 weeks of age were anesthetized with isoflurane prior to the wound-creating
surgery. Full-thickness excision wounds (1 cm × 1 cm) were created by marking
the area of the wound in the mid-back with a fine marker and a ruler, lifting the
skin with a pair of a forceps and excising the full-thick- ness skin along the lines
with a pair of surgical scissors. The db/db mice of 6 weeks of age were subjected
to the similar procedure (but with back shaved) to create 1.2 cm × 1.2 cm
wounds. Immediately after the surgery on day 0, the wounds were topically
treated with 100 µl of either 5% CMC gel (placebo) or the same gel containing an
Hsp90α peptide or becaplermin gel (100 µg/g PDGF-BB) at its clinically

26

recommended dosage. Each wound was covered with a bandage and a self-
adherent wrap (Coban) to prevent desiccation and infection while the wound was
exposed. Bandages and Cobans were changed every 3 days after the initial 4
days. Standardized digital photographs were taken of the wounds, with the same
distance between camera and preanesthetized animal for each animal. The
photo- graphs were examined using planimetry for objective evaluation for
degree of wound healing (28, 62). The open wound areas were determined with
an image analyzer (AlphaEase FC version 4.1.0, Alpha Innotech Corporation).
The total pixels that cover the unhealed areas were drawn onto the digital
photographs using a pattern overlay in ImageJ (http://rsbweb.nih.gov/ij/). The
number of pixels covering an open wound area on a given day was divided by
the number of pixels spreading over the initial wound on day 0 to obtain the
percentage of closure.
Percentage, rather than actual distance (e.g., mm), of wound closure
was calculated from the measured wound areas (pixel density). This method
allows more accurate measurements of the wounds, considering the fact that
certain margin of errors during surgical procedures may exist among different
experimental groups or even among the 3 mice within the same group. The
percentage of wound healing was based on changes in the same wound on the
same mouse for indicated time points, instead of changes among different mice.
Thus, the calculated mean for the wound healing (percentage) among the 3 mice
in a group was independently obtained, and the statistics of 3 groups of 3
independent experiments were calculated. We defined and presented the healing

27

in 2 ways: (a) the open area of the healing wound on a given day/the open area
of the original wound × 100 for the indicated days and (b) comparison between
the healed area of the wounds with Hsp90α treatment with the healed areas of
the wounds with placebo treatment on each specific day.
H&E and IHC staining. The F-5-treated or untreated mice were
euthanized either 7 (nude mice) or 14 days (db/db mice) after the surgery
(wounding). The wounds, together with unwounded skin margins, were excised
and put into 10% formaldehyde. The H&E staining was carried out as previously
described (26). In order to show the wound of placebo- treated mice compared
with that of F-5–treated mice, multiple overlapping pictures were taken under a
microscope (Nikon, Eclipse TE2000-U, ×4) and used to reconstitute the entire
wound (64). Standard IHC staining procedure was carried out (65). All antibodies
were used in 1:100 dilutions. The M.O.M. kit was used for mouse antibodies
(pan-keratin and SMA) on mouse tissues to control background staining.
Statistics. Data are presented as mean ± SD. Statistical significance for
comparisons was determined by the Student’s 2-tailed t test. A P value of equal
or less than 0.05 was considered statistically significant (64).
Study approval. All animal studies were conducted using protocols
approved, prior to initiation of this study, by the University of Southern California
Institutional Animal Use Committee.

28

2.4 Results

Identification of the minimum promotility epitope in secreted Hsp90α,
within its linker region and middle domain

In order to gain further insights into how secreted Hsp90α heals wounds,
we attempted to identify the minimum size of the therapeutic peptide in secreted
Hsp90α that still retains the full promotility activity of the full-length Hsp90α in
vitro and its full capability of promoting wound healing in vivo. Deletion
mutagenesis, as schematically summarized in Figure 1A, was used to obtain the
various fragments of human Hsp90α largely according to its previously defined
domains (37). Recombinant proteins were produced in the pET15b protein
expression system, purified sequentially by Ni+ affinity column chromatography
and fast protein liquid chromatography (FPLC), and confirmed on SDS-PAGE
(Figure 1B). In cell motility assays, with full-length Hsp90α and PDGF-BB as
positive controls (Figure 1C), we found that F-2 (Figure 1D) and F-5 (Figure 1E)
stimulated HDF migration as effectively as the full-length Hsp90α protein (Figure
1C), although higher concentrations of F-2 and F-5 were needed. However, as
the 115-aa F-5 fragment continued to shorten, we observed declines in
promotility activity in those peptides. For instance, the 54-aa peptide, F-6,
showed a significantly reduced promotility activity (Figure 1F). The F-1, F-3, and
F-4 peptides, which represent the N-terminal, middle (alone), and C-terminal
regions of Hsp90α, respectively, showed low to negligible stimulation of cell
migration. Note that we initially reported a moderate promotility activity from both
the middle and C-terminal domain fragments on HKs (30), which now appears to
be due to differences in protein purity between that and the current study.

29

Moreover, the current results were confirmed in 3 independent cell migration
assays: (a) the colloidal gold migration assay that detects migration of individual
cells; (b) the in vitro wound healing (scratch) assay that measures migration of a
cell population; and (c) the transwell assay that tests 3-dimensional chemotaxis
(38). Similar results were also obtained from cell migration assays with HKs and
HDMECs (see below). We therefore concluded that F-5 is the smallest peptide,
which retains an equivalent promotility activity as the full-length Hsp90α protein.

F-5 fragment of Hsp90α accelerates acute wound closure more strongly
than becaplermin/PDGF-BB in mice

Next, we tested how these peptides translate their in vitro promotility
activity to their ability to promote wound healing in vivo. In these experiments, we
compared the Hsp90α peptides against the only FDA-approved growth factor
therapy, becaplermin gel (PDGF-BB), in athymic hairless mice. The primary
reasons for selecting athymic hairless mice are two-fold: (a) to minimize the
innate immune response of the murine host to a human peptide and subsequent
immune response-induced wound contraction and (b) to minimize potentially
confounding effects due to inflammatory response after tissue injury and to
detect the specific effect of the topically applied peptide. We first carried out
large-scale screening tests (4 concentrations of each peptide) in mice to identify
the optimal concentration for each peptide that demonstrated the strongest
promotion of full-thickness excisional wound closure after a single application at
day 0 (data not shown). The peptides, in their optimized concentrations, were
directly compared to becaplermin gel for their abilities to promote wound closure

30

over time. Representative images of the wounds are depicted in Figure 2.
Treatment with full-length Hsp90α (Figure 2A), 392-aa F-2 (Figure 2B), and 115-
aa F-5 (Figure 2C) all strongly accelerated the wound closure, in comparison with
placebo. Among these peptides, interestingly, F-5 showed the strongest effect. In
contrast, the shorter 54-aa F-6 started showing a dramatic decline in promoting
wound healing (Figure 2D). Nonetheless, these in vivo results are consistent with
their in vitro promotility activities. To our surprise, we found that the becaplermin
gel treatment showed limited acceleration of the acute wound closure (Figure 2E).
Computer-assisted planimetry of 3 independent experiments confirmed a
superior effect of the Hsp90α peptides to that of becaplermin gel in promoting
acute wound closure (Figure 3). When promotion of wound closure was
compared on the same day, it was observed that F-5 showed the strongest effect
(Figure 3C vs. Figure 3, A and B). F-6 (Figure 3D) and becaplermin gel (Figure
3E) showed a comparable, but significantly smaller, effect than the full-length
Hsp90α, F-2, and F-5. Using the previously described methodology (39), we also
estimated the percentage of the unhealed areas of the F-5–treated wounds
versus that of placebo-treated wounds on each day over that of the wounds on
day 0. F-5 treatment shortened the time of complete wound closure from
approximately 17 days (placebo) to 10 days (Figure 3F). We examined the
possibility that multiple treatments would further shorten the time of complete
wound closure. However, repeated treatments of the wounds with F-5 did not
show significant advantage over a single treatment. The possible reasons, albeit
technical, will be discussed (see Discussion).

31

It is arguable that mouse skin wounds heal largely via contraction, due to
the nature of loose skin with dense hair follicles. Whereas, human skin wounds
heal through lateral migration of keratinocytes, i.e., reepithelialization, followed by
inward migration of the dermal cells (40). To examine F-5–treated wounds,
wedge biopsies of the day 7 wounds were subjected to H&E stain- ing,
microscopic analyses, and measurements. The boundary between unwounded
skin and newly healed skin is marked with a green arrow (Figure 4). The F-5–
treated wound (Figure 4B) showed a much smaller, unhealed area overall in
comparison with that of the placebo-treated wound (Figure 4A, dotted red lines).
Moreover, the F-5–treated wound exhibited substantially more reepithelialization
than the placebo-treated wound (Figure 4, dotted yellow lines). The
reepithelialized tongue (ReT) can be clearly visualized in the enlarged images on
both ends. These results suggest that promotion of reepithelialization is a
mechanism of action by F-5.

F-5 is superior to becaplermin gel/PDGF-BB in promoting diabetic wound
healing

A critical question is whether F-5 promotes chronic wounds as well.
Among the 3 major types of chronic ulcers, pressure, venous, and diabetic ulcers,
animal models are only available for studying wound healing in diabetes-
equivalent conditions. Among a handful of murine models for diabetes, the db/db
mouse is a commonly used model for type II diabetes, with a plasma glucose
level of 300–500 mg/dl by 6 to 8 weeks of age (in humans, >180 mg/dl is diabetic
hyperglycemia). These mice were reported to take more than 50 days to heal a

32

1.5 cm × 1.5 cm full-thickness wound, in comparison with 20 days of similar
wounds in normal littermates (41). Moreover, healed wounds in db/db mice show
a considerably higher degree of reepithelialization rather than wound contraction
than that of nondiabetic mice (42). Therefore, we tested whether F-5 promotes
diabetic wound healing using the db/db mouse model. A single treatment with F-
5 on day 0 led to a complete closure of the wounds between the 14th and 18th
days (Figure 5A, left column), in comparison with approximately the 35th day
closure of placebo- treated wounds (Figure 5A, right column). Two ways of
measuring by computer-assisted planimetry were used to quantify the
effectiveness of F-5. When wound closure was compared on each given day in
reference to their own day 0 control wound, as shown in Figure 5B, a 50%–90%
faster rate of wound healing was recorded for F-5 treatment over that of the
placebo. When percentages of the wound closure on different days were
calculated from those of the wounds on day 0, as shown in Figure 5C, F-5
shortened the time of wound closure from approximately 35 days to 14 to 18
days. H&E staining of the day 14 wounds revealed that F-5 treatment promoted a
greater degree of epidermal reepithelialization (Figure 5E) over that of placebo
treatment (Figure 5D), in which ReT could be clearly seen from the enlarged
images at both ends. These results show that F-5 has an even more prominent
effect on diabetic wounds than acute wounds.
To confirm the H&E results and, moreover, to analyze the endothelial cell
(blood vessel formation) and myofibroblast (wound contraction) activities in
wounds treated with either placebo or F-5, we carried out immunostaining assays

33

with 3 anti- bodies. Anti–pan keratin antibody staining clearly revealed the ReT
(Figure 6A, red lines and arrows, left panels). Anti–PECAM-1 antibody staining of
the newly healed tissue showed that there was little detectable difference in the
numbers of endothelial cells and blood vessels (Figure 6A, arrows) between
placebo-treated wounds and F-5–treated wounds, suggesting that F-5 does not
cause any excessive recruitment of endothelial cells to the wound (Figure 6A,
middle panels). Interestingly, anti-SMA antibody staining of the wounds showed
visibly fewer myofibroblasts in F-5–treated wounds than in the placebo-treated
wounds (Figure 6A, circles, right panels). These data suggest that F-5 promotes
dia- betic wound healing not by abnormally increasing wound angio- genesis or
wound contraction.
While PDGF-BB was reported to cause little improvement in acute wound
healing in mice (43), it accelerates wound healing in db/db mice (39). Therefore,
we made a side-by-side comparison of placebo, F-5, and becaplermin on full-
thickness wound healing in db/db mice. While becaplermin gel is recommended
for daily use on diabetic ulcers in humans, we continued to use it with our single
treatment protocol for the reasons previously mentioned (also see Discussion)
and measured the rate of the wound closure for up to 18 days. The F-5–treated
wounds showed complete closure between 14 and 18 days (Figure 6B, left
panels). The placebo-treated wounds healed at a much slower rate, with more
than 25% unhealed area on day 18 (Figure 6B, middle panels). Becaplermin gel
treatment caused faster wound closure than the placebo (Figure 6B, right panels).
However, the effect of becaplermin gel was substantially weaker than that of F-5,

34

with a significant unhealed area on day 18. Quantitation of the data from 3
independent experiments is shown in Figure 6C. We conclude that F-5 is a more
effective agent for both acute and diabetic wounds than conventional growth
factor therapy in mice.

Three unique properties of F-5: a common motility factor, a TGF-β-resistant
factor, and a hyperglycemia-resistant factor, which are all absent from
conventional growth factors

Having demonstrated the superior effect of the F-5 fragment in secreted
Hsp90α over that of FDA-approved conventional growth factor therapy on both
acute and diabetic wound healing, we asked what made F-5 more effective than
conventional growth factors, such as PDGF-BB. First, we reasoned that, ideally,
a single factor-based wound healing agent should be a molecule that is able to
recruit both epidermal and dermal cells into the wound bed. In contrast, if an
agent only selectively acts on some, but not all, the skin cell types, it might be
less effective in the wound healing process that requires multiple cell types of
wound healing. Thus, we analyzed the effect of F-5 on migration of the 3 major
human skin cell types, HKs, HDFs, and HDMECs. In the absence of any stimulus,
all 3 types of skin cells exhibited limited levels of motility (Figure 7A, first column).
Interestingly, PDGF-BB was only able to promote migration of HDFs but not HKs
or HDMECs (Figure 7A, second column). In contrast, F-5 was able to promote
migration of all 3 types of cells (Figure 7A, third column). A computer-assisted
quantitation of the cell migration is shown in Figure 7B (bars 4–9 vs. bars 1–3).
Thus, the first unique property of F-5 is that it is a common promotility factor for
skin cells.

35

What is the molecular basis for the difference between F-5 and PDGF-
BB? We focused on the presence or absence of the receptors for PDGF-BB (i.e.,
PDGFRα and PDGFRβ) and secreted Hsp90α (i.e., LDL receptor-related protein-
1 [LRP-1]). We found out that the lack of response to PDGF-BB from HKs and
HDMECs was due to the total absence of both PDGFRα and PDGFRβ on these
cells (Figure 7C). As expected, only HDFs expressed the 2 PDGFRs. In contrast
to the selective expression of PDGFRs in HDFs, HKs, HDFs, and HDMECs all
express comparable levels of LRP-1, the receptor for secreted Hsp90α signaling
to promote cell motility (30, 44). If we extrapolate these in vitro findings to
equivalent wound healing events in mice, it suggests that PDGF-BB cannot have
a direct role in recruitments of HKs for wound re-epithelialization and HDMECs
for wound neovascularization.
Second, we have previously shown that TGF-β3 that is present in human
serum (the main soluble environment of an acute wound) selectively blocks
growth factor-induced HDF and HDMEC migration, due to the higher levels of
TβRII expression on these dermal cells than the epidermal cells (28). This finding
suggests that conventional growth factors might not even be able to recruit the
dermal cells to the wound, which contains an abundant amount of TGF-β
throughout the healing process. Therefore, we tested whether or not F-5 could
override the inhibition of TGF-β to promote dermal cell migration. In the presence
of TGF-β3, the PDGF-BB– induced migration of HDF was completely inhibited
(Figure 7A, forth column, arrows). Intriguingly, however, even in the presence of
TGF-β3 (Figure 7A, far right column), F-5 remained equally effective on

36

stimulation of migration of all 3 cell types. Quantitation of these results is shown
in Figure 7B (bars 10–15). This second unique property of F-5 provides another
explanation for why F-5 heals wounds faster than becaplermin.
Third, we asked what made F-5 more effective in promoting diabetic
wound healing. It is known that all forms of diabetes are characterized by chronic
hyperglycemia in circulation, which is blamed for delayed healing of diabetic
wounds (44). Reportedly, hyperglycemia was able to destabilize HIF-1α protein
(45), the key regulator of Hsp90α secretion in HKs and HDFs (29, 46). We
specifically tested whether hyperglycemia blocks hypoxia-induced HDF motility
and whether F-5 is able to bypass the blockage of hyperglycemia and res- cue
HDF migration. Hypoxia strongly promoted HDF migration under normal glucose
(5 mmol/l) medium, and hypoxia plus F-5 showed a slightly higher stimulation of
cell migration (Figure 8A, top row). However, hypoxia failed to do the same under
hyperglycemia (25 mmol/l glucose) (Figure 8A, middle bottom panel). We also
found that hyperglycemia even blocked PDGF-BB–stimulated HDF migration
(data not shown). However, the addition of F-5 “rescued” the cell migration under
hyperglycemia (Figure 8A, bottom right panel). Quantitation of the migration data
is shown in Figure 8B. This finding provides the third explanation for why F-5
showed a stronger effect on accelerating diabetic wounds healing.

The secreted Hsp90 action is essential for normal wound healing

We followed a two-step approach to study the critical question of whether
secretion of Hsp90α in wounds is intrinsically required for wound healing. First, to
prove the universal importance of LRP-1 in mediating F-5 signaling in HKs, HDFs,

37

and HDMECs, we used the lentiviral shRNA delivery system, FG-12, to
permanently downregulate LRP-1 (30, 46). The FG-12 system, as shown in
Figure 9A, yielded more than 95% gene transduction efficiency in these cell
types, as indicated by expression of a GFP gene in the same vector (but under a
CMV promoter) that also carries the shRNA (under a U-6 promoter). This system
enabled us to achieve nearly complete downregulation of LRP-1 proteins in all 3
types of cells (Figure 9B, lanes 2 vs. lanes 1). In the absence of LRP-1, all 3
types of cells were no longer able to migrate in response to F-5 stimulation, in
comparison with the cells infected with a control empty vector (Figure 9C, bars
7–9 vs. bars 4–6). The blockage of F-5–induced motility is specifically due to
LRP-1 downregulation, since a mini–LRP-1 receptor was able to rescue the
migration of endogenous LRP-1–downregulated cells, as we previously reported
(30, 46).
The above results provided us with a target, LRP-1, and to further
investigate the importance of the “secreted Hsp90α–LRP-1” signaling in normal
(acute) wound healing in vivo, we took advantage of LRP-1–associated protein
(RAP), which binds to the extracellular domain of LRP-1 and blocks LRP-1
signaling (47). We chose to use day 5 acute wounds to test the effect of RAP,
since (a) the most prominent effect of F-5 was detected between days 4 and 7
and (b) the effectiveness of a single treatment may decrease over time. Topically
applied F-5 strongly promoted wound healing in nude mice by day 5 (Figure 9D,
left panels, arrows), consistent with previous observations. In contrast, the
addition of purified RAP protein dramatically delayed the naturally occurring

38

acute wound healing process (Figure 9D, right panels, arrows). Quantitation of
these data is shown in Figure 9E, which clearly revealed the delayed wound
healing by RAP (Figure 9E, bar 8). This finding indicates that the LRP-1 signaling
plays a critical role in normal wound healing.

2.5 Discussion

For more than 3 decades, the conventional wisdom has been that serum
factors, collectively called growth factors, represent the primary force in wound
healing (6, 7, 48). These often cell-type specific growth factors either appear only
when tissue is wounded or rise significantly from their basal concentrations in
response to injury, such as TGF-α and KGF (FGF7) for HKs, PDGF-BB for HDFs,
and VEGF-A for HDMECs. Since the mid 1970s, more than 30 growth factors
have been subjected to extensive in vitro, preclinical, and clinical studies alone or
in combinations (5). Despite enormous efforts, in vivo functions for many of these
growth factors remained unconfirmed, and their efficacy in human trials fell short
of providing significant clinical benefits (4, 6). These rather unexpected statistics
argue against the long-standing paradigm that growth factors are the critical
driving force of wound closure. We speculated that there must be fundamental
reasons underlining the ineffectiveness of conventional growth factors in wound
healing. We have since undertaken 2 mutually complementary approaches to (a)
examine the physiological barriers for conventional growth factor actions and (b)
identify a new generation of wound healing factors. In this study, we have
provided several lines of evidence for why conventional growth factor therapies,
such becaplermin/PDGF-BB, could not have been as effective as they were

39

hoped to be. First, not all skin cell types express a common receptor for a given
growth factor. For example, HKs and HDMECs completely lack the PDGFR and,
therefore, do not respond to becaplermin. Second, the abundant presence of the
TGF-β family cytokines throughout the early phase of wound healing blocks any
growth factor-stimulated migration of the dermal cells (note, not epidermal cells;
see ref. 28) and, therefore, their recruitment into the wound bed (28, 49–53).
Third, additional pathophysiological conditions, such as hyperglycemia in
diabetes, add layers that block the effectiveness of growth factors in diabetic
wounds (44, 45). More importantly, we have identified a more effective wound
healing agent, F-5, a fragment from secreted Hsp90α. In contrast to conventional
growth factors, F-5 equally promotes migration of all 3 types of human skin cells
that are essential for wound healing; F-5 overrides the inhibition of human dermal
cell migration by TGF-β; and F-5 resists hyperglycemia to promote cell migration.
Topical treatment of acute and diabetic wounds with F-5 greatly accelerates
wound closure through increased re-epithelialization. Based on these findings,
we propose a new paradigm for what drives epidermal and dermal cell migration
to close the wound, as schematically shown in Figure 10. Prior to injury, cell
motility remains undetected in intact skin (Figure 10, step 1). Within hours after
skin injury, HKs start to migrate laterally across the wound (possibly induced by
hypoxia-driven Hsp90α autocrine signaling or TGF-α; see ref. 44) and to secrete
Hsp90α. At the same time, however, HDFs and HDMECs at the wound edge are
not able to immediately move into the wound bed due to the presence of TGF-β3
(Figure 10, step 2). Once the secreted Hsp90α reaches the threshold

40

concentration of 100 nM (29, 30), it triggers the dermal cells to migrate into the
wound bed from the surrounding wound edge, even in the presence of TGF-β3
(Figure 10, step 3). Finally, the migrating HKs completely close the wound, and
the newly moved-in HDFs start to remodel the wounded tissue and HDMECs to
rebuild new blood vessels. We propose here that injury-induced secretion of
Hsp90α, instead of the conventional growth factors, is the initial driving force of
wound closure. After the initial wound closure, the dermal remodeling
neovascularization processes would take many months to complete. Many other
factors, including conventional growth factors, may play roles in the later events
of wound healing, when the TGF-β levels decrease (54).
The capability of F-5 to strongly accelerate diabetic wound closure is
consistent with previous studies on a recognized cause for diabetic wounds,
hyperglycemia. One of the critical environmental stimuli for wound healing is
relative hypoxia (54–57). HIF-1α is a master transcription factor that regulates
tissue adaptive responses to environmental hypoxia (58) and is expressed
throughout the multistage processes of acute wound healing. Impaired response,
i.e., lack of HIF-1α accumulation in the cells, to hypoxia in diabetic ulcers is a
known contributor to the delayed wound healing (45). In vivo, lower levels of HIF-
1α protein were reported in foot ulcer biopsies in patients with diabetes (59). In
vitro studies showed that hyperglycemia impairs HIF-1α protein stability and
function via the von Hippellindau pathway (45, 59–61). Botusan et al. have
demonstrated that forced stabilization of HIF-1α was necessary and sufficient to
resume diabetic wound healing (45). In parallel, we have previously shown that

41

HIF-1α is a key upstream regulator of Hsp90α secretion. The secreted Hsp90α in
turn promotes human epidermal and der- mal cell migration via a novel “HIF-1α >
Hsp90α secretion > LRP-1” signaling pathway (29, 46). Results of these 2
previously unrelated studies together point out the possibility that hyperglycemia
destabilizes HIF-1α, blocks hypoxia-driven Hsp90α secretion and delays diabetic
wound healing. The addition of F-5 bypasses the hyperglycemia-caused damage
at HIF-1α and jump-starts migration of the cells that otherwise cannot respond to
the environmental hypoxia.
Our data indicated that F-5 is more effective than the full-length Hsp90α in
vivo, but requires higher concentrations to maintain that effect. Our current
understanding of this phenomenon is largely at the level of speculation. It is
conceivable that without possibly steric interferences by the 235-aa N-terminal
domain and the 381-aa C-terminal domain, F-5 can fully reveal its effect of
promoting cell motility. On the other hand, without the N-terminal and C-terminal
domains, the shorter peptide may compromise on binding affinity and even
stability and, therefore, show the requirement for higher concentration to maintain
an equivalent promotility activity as the full-length protein. Our experiments show
that even a single application of F-5 could lead to a remarkable acceleration of
the wound closure in db/db mice. If both such efficacy and duration of the F-5
action could translate into humans, it may significantly improve patient life and
help to reduce the overall cost of diabetic wound clinic as well. The high cost of
the currently available care mostly comes from home visits by physicians with
various specialties and daily passive assistance of nurses, due to unavailability of

42

effective treatments (51, 62). On the other hand, we expect that multiple
treatments with F-5 should result in more prominent healing effects. Becaplermin
gel, for instance, is recommended for daily applications to achieve its clinical
effect. In the current study, we focused on a single treatment in our animal
experiments for 2 technical reasons. First, for experiments that involve a large
number of mice, it is hard to ensure that the procedures on all wounds are
performed universally. Second, frequent opening and closing a healing wound for
new treatments will risk damaging the on-going healing tissue (the newly
generated epidermal layer in particular) and add extra stress and discomfort to
the animals. Nonetheless, there have been reported options to deal with these
technical limitations. Covering the wound with Tegaderm and multiple
applications of the tested agent by injecting it through the Tegaderm with a
gauge needle was reported as a way to minimize these technical concerns (63).
The fact that extracellular Hsp90α is a motogen but not a mitogen (i.e., it
does not stimulate cell proliferation) makes physiological sense (29, 30). First,
keratinocyte migration occurs almost immediately after skin injury and plays a
critical role in closing the wound. After the initial epidermal closure, completion of
the subsequent dermal neovascularization and remodeling processes would take
many months. Second, when a cell is migrating toward the wound area, it cannot
proliferate at the same time. In addition, growth factor-stimulated proliferation of
both epidermal and dermal cells would be inhibited by TGF-β that appears in the
injured skin (28). Third, cell migration precedes cell proliferation during wound
healing. While the cells at the wound edge are moving toward the wound bed,

43

they leave behind “empty space” between themselves and the cells behind them.
The cells that are located behind the migrating cells start to proliferate after
losing contact inhibition with the front moving cells. The stimuli of the cell
proliferation likely come from plasma growth factors in the surrounding
unwounded blood vessels, in which TGF-β levels are low or undetectable. Thus,
cell proliferation appears to refill the space generated by the front-migrating cells.
The role of secreted Hsp90α appears to promote the initial wound closure as
quickly as possible.
Finally, proof of the relevance of animal model research to humans is the
ultimate standard, especially considering the fact that many animal models for
human diseases do not exactly reflect the genetic setting in humans. Many
believe that this is the main reason for the majority of the therapeutic agents in
the past, which show great promise in animal studies, to have ultimately failed in
humans. For instance, human diabetes is a polygenic disease, whereas the
db/db mouse is a monogenic (i.e., mutation in a single gene) diabetic model.
Therefore, whether or not F-5 has similar effect on human diabetic wounds
remains to be seen.

44

Figure 2-1. F-5 peptide retains the full promotility activity of full-length Hsp90α.
(A) A schematic representation of 7 human Hsp90α proteins/peptides (wild
type and mutants). Each cDNA fragment by PCR was subcloned into pET15b
and expressed in BL-21 bacteria, according to the manufacturer’s protocol.
Protein was sequentially purified by Ni+ column and finally FPLC, prior to in
vitro motility assays and in vivo wound healing assays. (B) A Coomassie Blue-
stained SDS-PAGE gel to show the proteins after FPLC (~3 µg/lane). The first
lane on far left is the molecular weight marker. Mr, molecular weight. (C–F)
Data of colloidal gold migration assay of serum-starved HDFs in response to
PDGF-BB (15 ng/ml) and the full-length and the various fragments of Hsp90α,
with the indicated concentrations, are presented. The negative results of F-1,
F-3, and F-4 are not shown. Only the migration index (see ref. 38) of the
migration experiments (n = 4, *P < 0.05) is shown. Similar results were
observed when in vitro wound healing scratch and the transwell assays were
used. FL, full length.

45

Figure 2-2. F-5 is superior to FDA-approved becaplermin/PDGF-BB in acute
wound healing. Full-thickness skin wounds (1 cm × 1 cm) in athymic nude
mice were treated with either placebo (10% CMC gel) or the gel containing an
optimized concentration of (A) full-length Hsp90α, (B) F-2, (C) F-5, (D) F-6 (n =
3 mice per peptide, per experiment), or (E) becaplermin (100 µg /g of PDGF-
BB). Plus signs indicate treated mice, and minus signs indicate placebo mice.
The images of 1 representative experiment are shown.

46

Figure 2-3. Measurements of F-5 versus becaplermin in acute wound healing.
(A–E) Percentage of the accelerated wound closure at days 0, 4, 7, 10, 12,
and 14 after treatments of the various Hsp90α fragments or becaplermin
versus placebo (mean ± SD). (F) A single treatment with F-5 shortened the
wound closure time from 17 days to 10 days. *P ≤ 0.05, compared with
placebo.

47

Figure 2-4. F-5 promotes reepithelialization of the wound. On day 7, wedge
biopsies of full-thickness wounded skin (i.e., including a portion of unwounded
skin), with either (A) placebo or (B) the F-5 peptide treatment, were H&E
stained and photographed under a light microscope. Independently
photographed images with identical magnifications were reconstituted to show
the unhealed areas of the wounds. Red dotted lines indicate unhealed wound
space. Yellow dotted lines mark the newly reepithelialized epidermis. Green
lines with arrows point out unwounded skin areas. The fronts of newly
reepithelialized epidermis were enlarged, as shown in higher-magnification
images. Scale bars: 0.33 mm; 0.01 mm (left and right).

48

Figure 2-5. F-5 shortens the time in promoting diabetic wound closure by two-
third. (A) Full-thickness excision wounds (1.2 cm × 1.2 cm) were created on
the backs of db/db mice and treated with either placebo (10% CMC gel) or the
same gel containing an optimized concentration of F-5 (~1 mM) (n = 3 mice
per group, per experiment). The images of 1 out of 4 representative
experiments are shown from day 0 to the day of complete closure of F-5–
treated wounds. (B) Percentage of the accelerated wound closure on days 0,
5, 10, 14, and 18, with or without F-5 treatment (mean ± SD).
*P ≤ 0.05. (C) A single treatment with F-5 on day 0 shortened the wound
closure time from 35 days to 14 to 18 days. *P ≤ 0.05, compared with
placebo. (D and E) H&E-stained sections of day 14 full-thickness wounds with
either (D) placebo or (E) F-5 treatment were analyzed. Independently
photographed images with identical magnifications were reconstituted to show
the unhealed areas of the wounds. Red dotted lines
with arrows indicate unhealed wound space. Yellow dotted lines mark the
newly reepithelialized epidermis. The front of newly reepithelialized
epidermis was enlarged to show ReT. Note that since the size of the wound
biopsy was the same as that of the original wound (1.2 cm × 1.2 cm),
we did not expect to visualize any significant portion of the unwounded skin
from the H&E staining. Scale bars: 0.25 mm (D and E, center); 0.063 mm
(D and E, left and right).

49

Figure 2-6. F-5 is superior to becaplermin PDGF-BB in recruiting dermal cells
in diabetic wound healing. (A) Immunostaining with anti-pan keratin
(epidermis), anti–PECAM-1 (endothelial cells), and anti-SMAα
(myofibroblasts) antibodies of sections of day 14 full-thickness wounds with
either placebo or F-5 treatment. Nine totally randomly selected images per
condition from 3 independent experiments were analyzed for consensus. The
representative images are shown.
Scale bars: 0.3 mm (left columns);
1.5 µm (middle columns); 7.5 µm
(right columns). In the left column,
arrows point to keratin-stained
ReT; in the middle column, the
arrows point to sections of blood
vessels; in right column, the circles

50

Figure 2-7. F-5 is a common promotility factor that overrides inhibition TGF-β.
Primary HKs, HDMECs, and HDFs were serum-starved overnight and
subjected to colloidal gold migration assays and either untreated or treated
with indicated growth factors (15 ng/ml of PDGF-BB) or F-5 (2.3 µM) in the
absence or presence of TGF-β3 (1.5 ng/ml). (A) Comparisons of F-5 peptide
with PDGF-BB on stimulation of HK, HDMEC, and HDF migration in either the
absence (second and third columns versus the first column) or presence (forth
and fifth columns) of TGF-β3). Images of cell migration from 1 representative
experiment are shown. The dotted circles point out the averaged migration
tracks under indicated conditions. The arrows point to cell migration inhibited
by the presence of TGF-β3. Original magnification, ×40. (B) Migration index of
the tracks is shown (n = 3; *P < 0.05, compared with serum-free control).
Arrow indicates Tβ3-inhibited cell migration. (C) Lysates of HKs, HDMECs,
and HDFs were analyzed by Western blot with anti-PDGFRα, anti-PDGFRβ,
or anti–LRP-1 antibodies as indicated. Equal sample loading control is
indicated by anti-GAPDH antibody blot.

51

Figure 2-8. F-5 rescues cell migration under hyperglycemia. (A) Primary HDFs
were cultured in medium containing either 5 mmol/l glucose (normal glycemia)
or 25 mmol/l glucose (hyperglycemia) for 2 weeks, serum-starved overnight,
and subjected to colloidal gold migration assay under either normoxia (21%
O2) or hypoxia (1% O2) in the presence or absence of F-5 (2.3 µM). Images of
cell migration from 1 representative experiment are shown. The circles point
out the averaged migration tracks under the indicated conditions. Original
magnification, ×40. (B) Migration index of the cell migration tracks is shown (n
= 3; *P < 0.05, compared with serum-free control).

52

Figure 2-9. Hsp90α–LRP-1 signaling is critical to skin cell migration in vitro
and wound healing in vivo. (A) A more than 95% lentiviral gene transduction
efficiency is achieved by lentiviral infection, as indicated by GFP expression in
HKs, HDMECs, and HDFs and quantified by FACS analysis. Original
magnification, ×40. (B) The same vector-mediated shRNA expression and
downregulation of endogenous LRP-1 was confirmed by anti–LRP-1 antibody
blot (A, C, and E; lanes 2 versus lanes 1). (C) Parental (bars 1–6) and LRP-1–
downregulated (bars 7–9) HKs, HDMECs, and HDFs were subjected to
colloidal gold migration assays in response to F-5. The migration was
quantitated as migration index (n = 3, *P ≤ 0.03). (D) Full-thickness skin
wounds (1 cm × 1 cm) in athymic nude mice (n = 3 mice per peptide, per
experiment) were treated with either the vehicle containing optimized
concentration of F-5 (1 mM) or F-5 plus RAP (0.3 mM) or vehicle alone.
Images of 1 representative experiment are shown here. (E) Percentage of the
wound size at days 0 and 5 of F-5– or RAP-treated wounds versus that of
vehicle-treated wounds (mean ± SD). *P ≤ 0.05, compared with vehicle-
treated.

53

Figure 2-10. A model of how released Hsp90α, but not conventional growth
factors, promotes reepithelialization and recruits dermal cells into the wound
during wound healing. Step 1 shows uninjured, intact skin with little detectable
TGF-β, cell migration, or stress, and step 2 shows that injury triggers release
of TGF-β from several sources, the immotile to motile transition of
keratinocytes, and release conventional growth factors. However, the growth
factors will not be able to recruit the dermal cells at the wound edge to the
wound bed due to the presence of TGF-β. Step 3 shows that when the
keratinocytes are migrating, they release/secrete Hsp90α. When the secreted
Hsp90α reaches the threshold concentration of >0.1 µM, it will drive inward
migration of HDFs and HDMECs. Step 4 shows that the HKs are about to
close the wound and the moved-in HDFs will start to remodel the wound and
HDMECs to build new blood vessels.

54

References

1. Crandall MA. Wound Care Markets: Volume I: Skin Ulcers. In: Heffner S,
ed. Wound Care Markets. New York, New York, USA: Kalorama
Information; 2003

2. Sen CK, et al. Human skin wounds: a major and snowballing threat to
public health and the economy. Wound Repair Regen. 2009; 17:763-771.

3. Falanga V, Wound healing and its impairment in the diabetic foot. Lancet.
2005; 366:1736-1743.

4. Werner S, Grose R. Regulation of wound healing by growth factors and
cytokines. Physiol Rev. 2003; 83:835-870.

5. Grose R, Werner S. Wound-healing studies in transgenic and knockout
mice. Mol Biotechnol. 2004; 28:147-166.

6. Martin P, Wound healing--aiming for perfect skin regeneration. Science.
1997; 276:75-81.

7. Singer AJ, Clark RA. Cutaneous wound healing. N Engl J Med. 1999;
341:738-746.

8. Brown GL, et al. Enhancement of wound healing by topical treatment with
epidermal growth factor. N Engl J Med. 1989; 321:76-79.

9. Pastor JC, Calonge M. Epidermal growth factor and corneal wound
healing. A multicenter study. Cornea. 1992; 11:311-314.

10. Ramsay HA, Heikkonen EJ, Laurila PK. Effect of epidermal growth factor
on tympanic membranes with chronic perforations: a clinical trial.
Otolaryngol Head Neck Surg. 1995; 113:375-379.

11. Fernandez-Montequin JI, et al. Intralesional injections of Citoprot-P
(recombinant human epidermal growth factor) in advanced diabetic foot
ulcers with risk of amputation. Int Wound J. 2007; 4:333-343.

12. Mohan VK. Recombinant human epidermal growth factor (REGEN-D 150):
effect on healing of diabetic foot ulcers. Diabetes Res Clin Pract. 2007;
78:405-411.

13. Greenhalgh DG, Rieman M. Effects of basic fibroblast growth factor on the
healing of partial-thickness donor sites. A prospective, randomized,
double-blind trial. Wound Repair Regen. 1994; 2:113-121.

55

14. Fu X, et al. Randomised placebo-controlled trial of use of topical
recombinant bovine basic fibroblast growth factor for second-degree burns.
Lancet. 1998; 352:1661-1664.

15. Uchi H, et al. Clinical efficacy of basic fibroblast growth factor (bFGF) for
diabetic ulcer. Eur J Dermatol. 2009; 19:461-468.

16. Ma B, et al. Randomized, multicenter, double-blind, and placebo-
controlled trial using topical recombinant human acidic fibroblast growth
factor for deep partial-thickness burns and skin graft donor site. Wound
Repair Regen. 2007; 15:795-799.

17a. Robson MC, et al. Sequential cytokine therapy for pressure ulcers: clinical
and mechanistic response. Ann Surg. 2000; 231:600-611.

17b. Robson MC, Phillips LG, Thomason A, Robson LE, Pierce GF. Platelet-
derived growth factor BB for the treatment of chronic pressure ulcers.
Lancet. 1992; 339:23-25.

18. Pierce GF, Tarpley JE, Yanagihara D, Mustoe TA, Fox GM, Thomason A.
Platelet-derived growth factor (BB homodimer), transforming growth
factor-beta 1, and basic fibroblast growth factor in dermal wound healing.
Neovessel and matrix formation and cessation of repair. Am J Pathol.
1992; 140:1375-1388.

19. Steed DL. Clinical evaluation of recombinant human platelet-derived
growth factor for the treatment of lower extremity diabetic ulcers. Diabetic
Ulcer Study Group. J Vasc Surg. 1995; 21:71-78; discussion 79-81.

20. LeGrand EK. Preclinical promise of becaplermin (rhPDGF-BB) in wound
healing. Am J Surg. 1998; 176:48S-54S.

21. Smiell JM, Wieman T.J., Steed D.L., Perry B.H., Sampson A.R., Schwab
B.H. Efficacy and safety of becaplermin (recombinant human platelet-
derived growth factor-BB) in patients with nonhealing, lower extremity
diabetic ulcers: a combined analysis of four randomized studies. Wound
Repair Regen. 1999; 7:335-346

22. Wieman TJ, Smiell JM, Su Y. Efficacy and safety of a topical gel
formulation of recombinant human platelet-derived growth factor-BB
(becaplermin) in patients with chronic neuropathic diabetic ulcers. A phase
III randomized placebo-controlled double-blind study. Diabetes Care.
1998; 21:822-827.

56

23. Nagai MK, Embil JM. Becaplermin: recombinant platelet derived growth
factor, a new treatment for healing diabetic foot ulcers. Expert Opin Biol
Ther. 2002; 2:211-218.

24. Mandracchia VJ, Sanders SM, Frerichs JA. The use of becaplermin
(rhPDGF-BB) gel for chronic nonhealing ulcers. A retrospective analysis.
Clin Podiatr Med Surg. 2001; 18:189-209.

25. Bejcek BE, et al. The v-sis oncogene product but not platelet-derived
growth factor (PDGF) A homodimers activate PDGF alpha and beta
receptors intracellularly and initiate cellular transformation. J Biol Chem.
1992; 267:3289-3293.

26. van den Dolder J., Mooren R., Vloon A.P., Stoelinga P.J., Jansen J.A.
Platelet-rich plasma: quantification of growth factor levels and the effect on
growth and differentiation of rat bone marrow cells. Tissue Eng. 2006;
12:3067-3073.

27. Henry G, Li W, Garner W, and Woodley DT. Human serum (but not
plasma) promotes humans keratinocyte migration. Lancet. 2003; 361:574-
576

28. Bandyopadhyay B, et al. A "traffic control" role for TGFbeta3:
orchestrating dermal and epidermal cell motility during wound healing. J
Cell Biol. 2006; 172:1093-1105.

29. Li W, et al. Extracellular heat shock protein-90alpha: linking hypoxia to
skin cell motility and wound healing. EMBO J. 2007; 26:1221-1233.

30. Cheng CF, et al. Transforming growth factor alpha (TGFα)-stimulated
secretion of Hsp90α: using the receptor LRP-1/CD91 to promote human
skin cell migration against a TGFbeta-rich environment during wound
healing. Mol Cell Biol. 2008; 28:3344-3358.

31. Cheng CF, Fan, J., Zhao, Z., Woodley, D. T., Li, W. Secreted Heat Shock
Protein-90alpha: A More Effective and Safer Target for Anti-Cancer
Drugs? Current Signal Transduction Therapy. 2010; 5:121-127.

32. Tsutsumi S, Neckers L. Extracellular heat shock protein 90: a role for a
molecular chaperone in cell motility and cancer metastasis. Cancer Sci.
2007; 98:1536-1539.

33. Hightower LE, Guidon PT, Jr. Selective release from cultured mammalian
cells of heat-shock (stress) proteins that resemble glia-axon transfer
proteins. J Cell Physiol. 1989; 138:257-266.

57

34. Clayton A, Turkes A, Navabi H, Mason MD, Tabi Z. Induction of heat
shock proteins in B-cell exosomes. J Cell Sci. 2005; 118:3631-3638.

35. Liao DF, et al. Purification and identification of secreted oxidative stress-
induced factors from vascular smooth muscle cells. J Biol Chem. 2000;
275:189-196.

36. Yu X, Harris SL, Levine AJ. The regulation of exosome secretion: a novel
function of the p53 protein. Cancer Res. 2006; 66:4795-4801.

37. Lindquist S, Craig EA. The heat-shock proteins. Annu Rev Genet. 1988;
22:631-677.

38. Li W, et al. Signals that initiate, augment, and provide directionality for
human keratinocyte motility. J Invest Dermatol. 2004; 123:622-633.

39. Greenhalgh DG, Sprugel KH, Murray MJ, Ross R. PDGF and FGF
stimulate wound healing in the genetically diabetic mouse. Am J Pathol.
1990; 136:1235-1246.

40. Coulombe PA. Wound epithelialization: accelerating the pace of discovery.
J Invest Dermatol. 2003; 121:219-230.

41. Olerud JE. Models for diabetic wound healing and healing into
percutaneous devices. J Biomater Sci Polym Ed. 2008; 19:1007-1020.

42. Gibran NS, et al. Diminished neuropeptide levels contribute to the
impaired cutaneous healing response associated with diabetes mellitus. J
Surg Res. 2002; 108:122-128.

43. Lynch SE, Nixon JC, Colvin RB, Antoniades HN. Role of platelet-derived
growth factor in wound healing: synergistic effects with other growth
factors. Proc Natl Acad Sci U S A. 1987; 84:7696-7700.

44. Brownlee M. Biochemistry and molecular cell biology of diabetic
complications. Nature. 2001; 414:813-820.

45. Botusan IR, et al. Stabilization of HIF-1alpha is critical to improve wound
healing in diabetic mice. Proc Natl Acad Sci U S A. 2008; 105:19426-
19431.

46. Woodley DT, et al. Participation of the lipoprotein receptor LRP1 in
hypoxia-Hsp90α autocrine signaling to promote keratinocyte migration. J
Cell Sci. 2009; 122:1495-1498.

58

47. Bu G, Rennke S. Receptor-associated protein is a folding chaperone for
low density lipoprotein receptor-related protein. J Biol Chem. 1996;
271:22218-22224.

48. Heldin CH, Westermark B. Role of Platelet-Derived Growth Factor In Vivo.
In: Clark RAF, ed. The Molecular and Cellular Biology of Wound Repair.
New York, New York,USA: Plenum Press; 1996:249-273.

49. O'Kane S, Ferguson MW. Transforming growth factor beta s and wound
healing. Int J Biochem Cell Biol. 1997; 29:63-78.

50. Eskild-Jensen A, et al. Endogenous TGF-beta 1 and TGF-beta 2 are not
essential for epithelialization and neovascularization in the hairless mouse
ear wound model. Ann Chir Gynaecol. 1997; 86:248-254.

51. Harrington C, Zagari MJ, Corea J, Klitenic J. A cost analysis of diabetic
lower-extremity ulcers. Diabetes Care. 2000; 23:1333-1338.

52. Roberts AB, Sporn MB. Transforming Growth Factor-beta. In: Clark RAF,
ed. The Molecular and Cellular Biology of Wound Repair. New York, New
York,USA: Plenum Press; 1996:275-308.

53. Brown RL, Ormsby I, Doetschman TC, Greenhalgh DG. Wound healing in
the transforming growth factor-beta-deficient mouse. Wound Repair
Regen. 1995; 3:25-36.

54. Hocevar BA, Brown TL, Howe PH. TGF-beta induces fibronectin synthesis
through a c-Jun N-terminal kinase-dependent, Smad4-independent
pathway. EMBO J. 1999; 18:1345-1356.

55. Knighton DR, Silver IA, Hunt TK. Regulation of wound-healing
angiogenesis-effect of oxygen gradients and inspired oxygen
concentration. Surgery. 1981; 90:262-270.

56. Elson DA, Ryan HE, Snow JW, Johnson R, Arbeit JM. Coordinate up-
regulation of hypoxia inducible factor (HIF)-1alpha and HIF-1 target genes
during multi-stage epidermal carcinogenesis and wound healing. Cancer
Res. 2000; 60:6189-6195.

57. Tandara AA, Mustoe TA. Oxygen in wound healing--more than a nutrient.
World J Surg. 2004; 28:294-300.

58. Semenza GL. Life with oxygen. Science. 2007; 318:62-64.

59

59. Catrina SB, Okamoto K, Pereira T, Brismar K, Poellinger L.
Hyperglycemia regulates hypoxia-inducible factor-1alpha protein stability
and function. Diabetes. 2004; 53:3226-3232.

60. Fadini GP, et al. Diabetes impairs progenitor cell mobilisation after
hindlimb ischaemia-reperfusion injury in rats. Diabetologia. 2006; 49:3075-
3084.

61. Gao W, et al. High glucose concentrations alter hypoxia-induced control of
vascular smooth muscle cell growth via a HIF-1alpha-dependent pathway.
J Mol Cell Cardiol. 2007; 42:609-619.

62. Association for the Advancement of Wound Care (AAWC) Statement on
Comprehensive Multidisciplinary Wound Care at:
www.aawconline.org/pdf/AAWCMulti-disciplinarystatement.pdf

63. Woodley DT, et al. Intravenously injected human fibroblasts home to skin
wounds, deliver type VII collagen, and promote wound healing. Mol Ther.
2007; 15:628-635.

64. Qin XF, An DS, Chen IS, Baltimore D. Inhibiting HIV-1 infection in human
T cells by lentiviral-mediated delivery of small interfering RNA against
CCR5. Proc Natl Acad Sci U S A. 2003; 100:183-188.

65. Sullivan, SR, et al. Validation of a Model for the Study of Multiple Wounds
in the Diabetic Mouse (db/db). Plastic & Reconstructive Surgery. 2004;
113:953-960.

60

CHAPTER THREE: THE NON-CHAPERONE ACTION OF SECRETED HEAT
SHOCK PROTEIN-90ALPHA (eHSP90α) THROUGH THE NPVY MOTIF AND
AKT PATHWAY IN SKIN WOUND REPAIR

3.1 Abstract

In response to injury, skin cells at the wound edge begin secreting the
preemptively accumulated heat shock protein-90alpha (Hsp90α) into the wound
bed. This secreted Hsp90α then triggers the migration of both dermal and
epidermal cells from the wound edge to promote wound closure. However, the
mechanism by which extracellular Hsp90α (referred to as eHsp90α) action
occurs remained elusive. Here, we demonstrate that eHsp90α acts as the bona
fide signaling molecule responsible for promoting wound closure. eHsp90α binds
to the subdomain II of the cell surface low-density lipoprotein receptor-related
protein 1 (LRP-1) and transmits the pro-motility signal through its NPVY motif
located in the cytoplamic tail of the receptor. The NPVY motif, in turn, connects
the eHsp90α signal to Akt1 and Akt2 kinases, both of which are essential for
eHsp90α signaling. Cross-rescuing experiments indicated that Akt1 and Akt2
work in tandem, rather than individually, to mount a threshold of Akt kinase
activity in cells. In vivo, eHsp90α accelerated wound closure in normal, but failed
to do so in Akt1-

and Akt2- knockout, mice.

3.2 Introduction

The cytosolic heat shock protein-90 (Hsp90) family, including Hsp90α and
Hsp90β, are among the most abundantly present proteins in the cells.
Intracellular Hsp90 acts as an ATPase-dependent chaperone protein that binds

61

and protects more than 100 client proteins from misfolding, structural damage
and protease degradation potentially triggered by various environmental stress
cues and pathological conditions (1-4). However, recent studies have
demonstrated that the same stress signals also trigger Hsp90, mostly Hsp90α, to
localize at the cell surface and be secreted into the culture media in a variety of
normal and tumor cells (5-7). Outside the cells, Hsp90α acts as a promotility
factor for both normal and tumor cells (7). Normal cells secrete Hsp90 only under
environmental stress and its function is to repair damaged tissues, such as skin
wounds. Topical application of recombinant Hsp90α protein accelerates both
acute and diabetic skin wound healing more effectively than a conventional
growth factor therapy (8, 9). Tumor cells have acquired the ability of constitutively
secreting Hsp90. More importantly, the tumor-secreted Hsp90 has been shown
to play a critical role in invasion and metastasis of the tumor cells in vitro and
nude mice (10-13). In this study we focus on the promotiliy function of
extracellular Hsp90, or eHsp90 in reference to both surface-bound and secreted
Hsp90 proteins (7, 14).

Since the elucidation of eHsp90α’s promotility function and its role in
cancer progression and metastasis, the central debate has been focused on
whether eHsp90 is still acting as a chaperone protein outside the cell, where it
binds and assists folding, activation and function of other proteins, such as
MMPs HER2 and ECMs (10, 15, 16) or it executes its promotility signaling by an
entirely distinct mechanism (16, 17, 18). In our present study, we provide
evidence for a novel eHsp90α-signaling mechanism involving the extracellular

62

sub-domain II and the distal cytoplamic NPVY motif of the LRP-1 receptor,
leading to activation of Akt1 and Ak2 kinases. Interruption of this pathway at any
level blocks the function of eHsp90α in vitro and in vivo. The results of our study
establish a clear the foundation for potential therapeutic interventions in wound
healing and tumor progression targeting eHsp90α.

3.3 Material and Methods

Primary human neonatal HDFs were purchased from Clonetics and
cultured in DMEM supplemented with 10% FBS and 1% Penicillin-Streptomycin
(Gibco/Invitrogen Corp, Carisbad, CA). The third or fourth passages fo the cells
were used in in vitro cell assays. Mouse antibody against the p85 subunit of
LRP1/CD91 was purchased from Invitrogen Co (#37-7600). Rabbit anti-human
Akt1 (C73H10) Akt2 (D6G4), and Akt3 (62AB) antibodies were purchased from
Cell Signaling Technology (Danvers, MA). Antibody that specifically recognizes
the dually phosphorylated form of p44/ERK1 and p42/ERK2 (#V8031) was from
Promega (Madison, WI). Rat type I collagen was purchased from BD Biosciences
(San Jose, CA). Anti–β-actin and anti-GAPDH antibodies were from Cell
Signaling Technology. The mini LRP-1 receptor constructs (mLRP1I to IV) were
gifts of Dr. Guojun Bu (Mayo Clinic, Jacksonville, FL, USA). The ProFection
Mammalian Transfection System (#E1200) was purchased from Promega.
QuikChange Site-Directed Mutagenesis Kit (#200519) and the XL-10 Gold Ultra
competent cells were from Stratagene (La Jolla, CA). Akt1- and Akt2- knockout
mice were provided by Dr. Nissim Hay and Dr. Bangyan Stiles, respectively.
Carboxymethylcellulose (CMC) sodium salt (C5678, pH at 7.14) was from Sigma-

63

Aldrich (St. Louis, MO). The Stat Strips (adhesive bandages) were from Notro
Max (Edgewood, MD). 3M Coban (self-adhesive wrap) was from 3M (St. Paul,
MN). Unless indicated, all other reagents were purchased from Sigma-Aldrich or
VWR (Radnor, PA).

Designing, testing and cloning shRNAs against human LRP-1, Akt-1,
Akt-2, and Akt-3 into lentiviral vector, FG12. Target sequences for shRNAs
were selected against LRP-1, Akt-1, Akt-2, and Akt-3 by using an RNA
interference (RNAi) selection program, as previously described (Guan et al,
2007). The effectiveness of the synthetic double-stranded shRNAs in down-
regulation of their target genes were first tested by transfecting these shRNAs in
293T cells and, following 48 hours of incubation, the cell lysates blotted with
antibodies against the corresponding gene targets. The most effective sequence
of shRNAs against a target gene was then cloned into the lentiviral RNAi delivery
vector, FG-12 (Guan et al. 2007). The selected siRNA sense sequences for
human LRP-1 were GGAGTGGTATTCTGGTATA; human Akt-1 was
TCACACCACCTGACCAAGA; for human Akt-2 was GGGCTAA
AGTGACCATGAA; and for Akt-3 was GCAGGCACGTTAACTCGAA. Lentiviral
production, infection and biochemical analyses were as previously described
(Cheng et al, 2008).

Cell migration assays. The colloidal gold migration assay and the in vitro
wound-healing (scratch) assay were conducted as described in details previously

64

(Li et al, 2004). Data from independent experiments (n ≥ 3) were averaged and
calculated (mean ± SD, p < 0.05).

Production and purification of recombinant Hsp90α.The cDNA
encoding the full-length of Hsp90α was generated by PCR and cloned into
pET15b vector (EMD Biosciences Inc., Darmstadt, Germany) at BamH1 or
BamH1 and NdeI sites, respectively. The cloned cDNA sequence was verified by
DNA sequencing. pET15b-Hsp90α construct was transformed into BL21-
codonPlus (DE3)-RP competent cells (Stratagene) following the manufacture’s
instruction. Protein production and purification using pET15b system was
described previously (Cheng et al. 2011). Briefly, Hsp90α protein synthesis was
induced by the addition of 0.25mM IPTG (isopropyl-β-D-thiogalactopyranoside) to
the bacterium culture (O.D., 0.8-1) followed by ~5 hour incubation at 25°C. The
His-tagged Hsp90 protein was purified via a nickel-nitrilotriacetic acid (Ni-NTA)
column containing HisBind resin according to the manufacturer’s procedure
(EMD Biosciences, Inc.). The purified protein was concentrated in Millipore’s
Amicon Ultra 10K centrifugal filters (Millipore, Billerica, MA) to 1-2 mls and
loaded onto a Superdex 200 HiLoad gel filtration column (GE Healthcare,
Piscataway, NJ) and further purified by a fast protein liquid chromatography
(FPLC) (AKTApurifier 10, GE Pharmacia). Proteins were eluted with Dulbecco’s
phosphate-buffered saline buffer (DPBS) at a flow rate of 1 ml/min. The fractions
with Hsp90α were collected and concentrated in a Amicon Ultra 10K centrifugal
filter to achieve a final concentration of 1 mg/ml. Proteins were stored in 10%

65

glycerol–Dulbecco’s phosphate-buffered saline at -80°C. We constantly achieved
~20 mg of Hsp90α from 1 liter of the bacterium culture.

Site-directed mtageneses on LRP-1 receptor. Mutageneses on the
proximal NPXY motif from
4470
NPTY to AATA were carried out using the following
sense and anti-sense primers,
CCATGAACGTGGAGATTGGAGCCGCCACCGCCAAGATGTACGAAGGCGGA
G and
CTCCGCCTTCGTACATCTTGGCGGTGGCGGCTCCAATCTCCACGTTCATGG,
respectively. Mutageneses on the distal NPXY motif from
4504
NPVY to AAVA was
carried out using the following primers:
AAGCCCACCAACTTCACCGCCGCCGTGGCTGCCACACTCTACATGGG and
CCCATGTAGAGTGTGGCAGCCACGGCGGCGGTGAAGTTGGTGGGCTT. The
entire process followed the instruction for the QuikChange Site-Directed
Mutagenesis Kit (Stratagene). Selections for positive clones were carried out
using the XL-10 Gold Ultra competent cells (Stratagene, La Jolla, CA).

Preparation of CMC gel with Hsp90α protein. To prepare the topical
wound healing formula, CMC powder (viscosity 50–200 cps, purity 99.5%,
sodium salt) was dissolved in double-distilled H2O in a tissue culture hood at 5%
concentration (w/v), incubated for 4 hours at 37°C, placed on a shaker for 24
hours at 4°C, and brought back to room temperature. This CMC solution was
mixed in 1:1 ratio (vol/vol) with indicated concentrations of FPLC-purified and

66

filtered (0.22 µm) Hsp90α protein. This mix of CMC gel containing Hsp90α was
applied topically to the skin wounds in mice.

Wound healing in mice. Thymic hairless (Foxn1) mice and BKS.Cg-
m+/+Leprdb/J mice were obtained from The Jackson Laboratory. Akt-1
-/-
and Akt-
2
-/-
mice were made available in the laboratories of Dr. Nissm Hay and Dr.
Banyan Stiles, respectively. Mice were housed 4 per cage for maintenance and 1
mouse per cage during experiments at the animal facilities of the University of
Southern California, under protocols approved by the University of Southern
California Institutional Animal Use Committee. Mice were anesthetized with
Nembutal (Sodium Pentobarbital, 50mg/ml stock solution, murine dosage at 35-
50mg/kg) and isoflurane (as needed) prior to the wound-creating surgery. Full-
thickness excision wounds (1cm × 1cm) were created by marking the area of the
wound in the mid-back with a marker pen and a ruler, lifting the skin with a pair of
a forceps and excising the full-thickness skin along the lines with a pair of
surgical scissors. Each wound was dressed with a bandage and a self-adherent
wrap (Coban) to prevent desiccation and infection for the duration of experiments.
Bandages and Coban wraps were changed every 3 days after an initial 4-day
post-operation recovery period. Standardized digital photographs were taken of
the wounds, with a metric ruler. The photographs were examined using
planimetry for objective evaluation for degree of wound closure. The open wound
areas were determined with an image analyzer (AlphaEase FC version 4.1.0,
Alpha Innotech Corporation). The total pixels that cover the unhealed areas were
drawn onto the digital photographs using a pattern overlay in ImageJ

67

(http://rsbweb.nih.gov/ij/). The number of pixels covering an open wound area on
a given day was divided by the number of pixels spreading over the initial wound
on day 0 to obtain the percentage of closure.

Statistics. Data are presented as mean ± SD. Statistical significance for
comparisons was determined by the Student’s 2-tailed t test. A p value of equal
or less than 0.05 was considered statistically significant.

Acknowledgement. Goujun Bu’ s mini-LRP constructs

3.4 Results

eHsp90α requires LRP-1 receptor to promote human skin cell migration
and accelerate skin wound healing.

In order to investigate the mechanism by which eHsp90α functions, we
focused on the cell surface LRP-1 receptor, based on our previous findings (9,
17). We selected primary human dermal fibroblasts (HDFs) as the cell culture
model for the following reasons: 1) HDFs are essential for proper skin wound
healing (19); 2) HDFs secrete Hsp90α in response to skin wounding signals,
such as hypoxia (9)

and 3) HDFs exhibit increased motility in response to
recombinant eHsp90α (17). To recapitulate the important role of LRP-1 in
eHsp90α function in HDFs, we used the lentiviral shRNA-delivering system, FG-
12, to down-regulate the endogenous LRP-1 of HDFs. As shown in Figure 1A,
the infection with control LacZ-shRNA did not appreciably affect the LRP-1
protein levels in the cells (panel a, lane 1); where as, in the shRNA-LRP-1
infected HDFs, levels of the LRP-1 protein was dramatically down-regulated
(panel a, lane 2). When these cells were subjected to colloidal gold migration

68

assays, as shown in Figure 1B, the LacZ-shRNA-infected HDFs exhibited
enhanced migration in response to both eHsp90α stimulation (panel b vs. panel
a) and PDGF-BB stimulation (an established promotility stimulus) (panel c).
However, we were unable to detect any increased migration in FG-12-shRNA-
LRP-1 infected HDFs treated with eHsp90α (panel e vs. panel d). As expected,
this defect was specifically restricted to eHsp90α signaling and the LRP-1 down-
regulation, since the same cells still exhibited increased migration in response to
PDGF-BB (panel f vs. panel c). Quantitation (migration index) of these data is
shown in Figure 1C.

To further confirm the importance for LRP-1 in wound healing in vivo, we
utilized a specific LRP-1 inhibitor, the receptor-associated protein (RAP), which
blocks the eHsp90α function in vitro (17). As clearly shown in Figure 1D, topical
application of recombinant RAP protein dramatically delayed the wound closure
in mice (right wound vs. left wound in panels a through d). The quantitation of the
data (% of the closed wound area over time) from multiple experiments is shown
under the wound images.

The extracellular sub-domain II of LRP-1 mediates eHsp90α signaling.

The cDNA for LRP-1 encodes for a 515-kDa extracellular α subunit and a
membrane-anchoring 85-kDa β subunit containing a 100-amino acid cytoplasmic
tail for signaling (18). The LRP-1’s extracellular domain consists of four
independent ligand-binding sub-domains (I through IV), as schematically shown
in Figure 2A. To examine which sub-domain mediates the eHsp90α signaling, we

69

made use of four HA-tagged mini-LRP-1 receptors (mLRP1-I through mLRP1-IV).
The extracellular part of each of the mini-LRP-1 receptors represents one of the
four sub-domains fused to the ubiquitous p85 subunit gene (19). Prior to testing
these mini-LRP-1 receptors, we first down-regulated the endogenous LRP-1 in
HDFs. Each of mini-LRP-1 receptor genes was then introduced into the LRP-1-
downregulated cells using an overexpression lentiviral-based vector,
pRRLsin.MCS-DEco. As shown in Figure 2B (an independent experiment from
figure 1A), almost a complete down-regulation of the endogenous LRP-1 was
achieved (panel a, lane 2). In these cells, we then used the lentiviral over-
expression system to express each of the mLRP-1 cDNAs. Expression of the
exogenous mLRP-1 genes was verified via Western blot using and anti-HA
antibody. As shown in Figure 2C, vector alone infected LRP-1-downregulated
HDFs showed little expression of LRP-1-related proteins (panel a, lane 1). The
pRRLsin-mLRP1-infected HDFs, however, showed comparable expression levels
of the mLRP1-I (lane 2), mLRP1-II (lane 3), mLRP1-III (lane 4) and mLRP1-IV
(lane 5).

Using these cells, we tested the hypothesis of whether one of the four
mLRP-1 receptors could rescue the cell migration defect of the LRP-1 down-
regulated HDFs, in response to eHsp90α stimulation. As demonstrated on Figure
2D, down-regulation of the endogenous LRP-1 completely blocked eHsp90α-
stimulated migration (bar 3). Expression of the mLRP1-I (bar 6), mLRP1-III (bar
12) or mLRP1-IV (bar 15) was unable to rescue this phenotype. Interestingly,
expression of mLRP1-II significantly rescued the migration of the LRP-1-

70

downregulated HDFs in response to eHsp90α (bar 9 vs. bar 3). The defect was
specifically due to LRP-1 down-regulation, since PDGF-BB-stimulated migration
remained unaffected in the same cells regardless of the LRP-1 or mLRP-1 status
(bars 2, 5, 8, 11, 14). We therefore concluded that the sub-domain II in the α
subunit of LRP-1 mediates the eHsp90α signaling.

eHsp90α engages the intracellular NPVY motif in LRP-1 for signaling.

To study whether eHsp90α still functions as a chaperone protein outside
the cell or a bona fide signaling molecule that triggers cross-membrane signaling
through the LRP-1 receptor, we generated mutations at the two NPxY signaling
motifs,
4470
NPTY and
4504
NPVY, in the cytoplasmic tail of the mLRP1-II either
alone or in combination and tested if abrogation of these signaling motifs
interferes with the eHsp90α signaling. As schematically shown in Figure 3A, we
substituted the three conserved amino acids in both of the NPxY motifs with
alanines to create single (AAVA or AATA) and double (AAVA/AATA) mutant
variants of the mLRP1-II receptor. The wt and mutant cDNAs of the mLRP-1-II
were then individually introduced into LRP-1-downregulated HDFs, as previously
described. As shown in Figure 3B, expression of the wt (lane 2) and the NPxY
mutant mLRP-1-II proteins were confirmed by an antibody against the p85
subunit of LRP-1 (lanes 2 to 5 vs. lane 1). When these cells were subjected to
migration assays in response to eHsp90, as shown in Figure 3C, the wt mLRP1-
II was able to rescue the cell migration defect in the endogenous LRP-1-
downregulated HDFs in response to eHsp90 stimulation (bar 4 vs. bar 2).
Interestingly, mRLP1-II with the AATA mutation also rescued the migration of the

71

cells (bar 6). However, the mLRP1-II that bears either the AAVA single or
AATA/AAVA double mutations was unable to rescue the motility defect of the
cells (bars 8 and 10). These findings indicated that the eHsp90α signal travels
through LRP-1 via the NPVY, but not the NPTY, motif, as schematically depicted
in Figure 3D.

The NPVY motif connects eHsp90α signaling to Akt, but not Erk
1/2
, pathway.

To obtain further confirmation that eHsp90α utilizes a cross-membrane
signaling mechanism to execute its function, we subjected the parental and LRP-
1-downregulated HDFs to a Human Phospho-Kinase Antibody Array that
includes antibodies against the activated forms of 47 distinct protein
kinases/pathways (see Material and Methods). As shown in Figure 1sA (in
Supplemental Data), eHsp90α stimulation caused increased phosphorylation of
Akt in serine-437 (S437) (panel b vs. panel a, dotted rectangles) in parental
HDFs, but not in another reported phosphorylation site, threonine-308 (T308,
dotted circles), (panel b’ vs. panel a’), suggesting that eHsp90α specifically
activates the kinase that phosphorylates S437 in Akt. Interestingly, the eHsp90α-
stimulated phosphorylation of Akt in S437 was undetectable in the LRP-1-
downregulated HDFs (panel d vs. panel c, dotted rectangles), but no changes in
T308 phosphorylation were detected in the same cells (panel d’ vs. panel c’).
Under a shorter exposure period for the same blot, we also detected a dramatic
increase in eHsp90α-stimulated phosphorylation of Erk
1/2
, (Figure 1sB, panels b
vs. panel a, dotted circles). Down-regulation of LRP-1 also blocked eHsp90α-

72

induced increase in Erk
1/2
phosphorylation (panel d vs. panel c, dotted circles).
The relative intensity difference between phospho-Akt and phospho-Erk
1/2

signals may not necessarily reflect their actual degrees of activation by eHsp90α
due to differences in antibody affinities. Densitometry-based quantitation of the
data is shown in Figure 1sC. We concluded that eHsp90 stimulation
predominantly activates the Akt and Erk
1/2
pathways in HDFs.

Having narrowed down the possible downstream pathways to Akt and
Erk
1/2
, we tested whether the NPVY motif participates in the eHsp90α signaling
to Akt or Erk
1/2
or both. As shown in Figure 4A, down-regulation of endogenous
LRP-1 in HDFs blocked eHsp90α-stimulated activation of both Akt (panel a, lane
2) and Erk
1/2
(panel c, lane 2), as expected. Re-introduction of either the wt
mLRP1-II or the mLRP1-II-AATA mutant was able to rescue the eHsp90α-
stimulated Akt activation in the LRP-1-downregulated HDFs (panel a, lanes 4 and
6 vs. lane 2). However, the mLRP1-II-AAVA single and mLRP1-II-AATA/AAVA
double mutants were unable to rescue eHsp90α-induced Akt phosphorylation
(lanes 8 and 10). These data suggest that the NPVY, but not the NPTY, motif
connects eHsp90α signaling to the Akt pathway. Interestingly, all the mLRP1-II
constructs, both the wt or mutants, were able to rescue the eHsp90α-stimulated
ERK
1/2
activation in LRP-1-downregualted HDFs (panel c, lanes 4, 6, 8, 10 vs.
lane 2), suggesting that eHsp90α stimulates Erk
1/2
activation via an NPxY motif-
independent mechanism.

73

Akt1 and Akt2, but not Akt3, play a critical role in eHsp90α signaling.

We then tested whether the NPVY-Akt pathway indeed mediates the
eHsp90α-stimulated HDF migration. Since there are three reported mammalian
Akt genes (Akt1, Akt2 and Akt3), we studied each of the three Akt kinases for
their individual contributions. As shown in Figure 4B, the FG-12 lentiviral system
allowed us to use Akt isoform-specific shRNAs for effective down-regulation of
endogenous Akt1 (panel a, lane 2), Akt2 (panel c, lane 2) and Akt3 (panel e, lane
2) in HDFs. Since the Western blot signal for Akt3 (panel e, lane 1) was
significantly weaker than those of Akt1 and Akt2 (panels a and c, lanes 1), we
asked whether the weaker signal of Akt3 reflected its actual expression level in
HDFs or due to weaker affinity of the anti-Akt3 antibody used. As shown in
Figure 4C, the same antibody was able to detect a strong expression of Akt3
protein (panel a, lane 1 vs. lane 2) in rat brain extract, even its amount of loading
was just a fraction of the loading of HDF lysates based on the GAPDH levels
(panel b, lane 1 vs. lane 2). Therefore, we concluded that Akt3 expression is
intrinsically lower than Ak1 and Akt2 in HDFs. The down-regulation of Akt1, Aklt2
and Akt3 was isoform-specific, since the three shRNAs did not cross-react with
the other the Akt isoforms, respectively. As shown in Figure 4D, Akt1 was only
knocked down by the shRNA against Akt1 (panel a, lane 2), but not the shRNAs
against Akt2 (panel a, lane 3) or Atk3 (panel a, lane 4). Akt2 was down-regulated
only by the shRNA against Akt2 (panel c, lane 3), but not by the shRNA against
Akt1 (panel c, lane 2) or Atk3 (panel c, lane 4). Similarly, Akt3 was selectively
down-regulated by the shRNA against Akt3 (panel e, lane 4), but not the shRNAs

74

against Akt1 (panel e, lane 2) or Atk2 (panel e, lane 3). As indicated in this
experiment, four times more total cell lysate was used for Akt3 detection
compared to both Akt1 and Akt2 detection, in order to allow for the proper
visualization of the Akt3 expression (panels e and f).

Using the colloidal gold migration assay, we tested motility of the Akt-
down-regulated cells. As shown in Figure 4E, both eHsp90α and PDGF-BB
stimulation greatly enhanced the control shLacZ-transduced HDF migration, as
expected (panels b, c vs. panel a). However, down-regulation of Akt1 (panels d,
e, f) completely blocked eHsp90α-stimulated migration (panel f vs. panel c), while
the PDGF-BB-stimulated migration remained unaffected (panels e vs. panel b).
Down-regulation of Akt2 showed a similar inhibitory effect on eHsp90α-
stimulated cell migration (panel g vs. panel c). Interestingly, the PDGF-BB-
stimulated cell migration again remained unaffected (panel h vs. panel b). Down-
regulation of Akt3, however, showed significantly less inhibition of the eHsp90α-
stimulated migration (panel l vs. panel c) and had little effect on the PDGF-BB-
stimulated migration (panel k vs. panel b). Quantitation of the migration data is
shown in Figure 4F. We concluded that Akt1 and Akt2 work either independently
or in concert to mediate the eHsp90α signal coming from the NPVY motif.

Akt1 and Akt2 work in concert to mediate eHsp90α signaling.

There are two possible mechanisms of action by Akt1 and Akt2. First, they
may act via two distinct downstream pathways, where each Akt carries a distinct
yet mutually important role. Second, they act in concert to collectively build an

75

Akt kinase threshold activity that communicates with a common downstream
effector. To determine which of the two mechanisms Akt1 and Akt2 use to
mediate eHsp90α signaling, we carried out reciprocal rescue experiments using
Akt1 and Akt2 kinases. We reasoned that, if Akt1 and Akt2 act independently, re-
expression of Akt1 should only rescue eHsp90α-stimulated cell migration in Akt1-
downregulated cells, but not in Akt2-downregulated cells. However, if Akt1 and
Akt2 work in concert, re-expression of Akt1 should rescue migration of both Akt1-
and Akt2- down-regulated cells. Similarly re-expression of the Akt2 gene in Akt1-
or Akt2- down-regulated cells would allow us to further delineate the relationship
between Akt1 and Akt2. As shown in Figure 5A, exogenous expression of Akt2
(panel c, lane 2) compensated for the absence of Akt1 in Akt1-downregulated
cells (panel a, lane 2). Reciprocally, as shown in Figure 5C, exogenous
expression of Akt1 (panel g, lane 2) was able to replace the Akt2, absent in Akt2-
down-regulated cells (panel e, lane 2).

When these cells were subjected to colloidal gold migration assays, we
found that exogenous expression of Akt2 was sufficient to rescue the motility
defect of the Akt1-downregulated cells in response to eHsp90α stimulation (B,
bar 9 vs. bar 6). The reverse was also true. Exogenous expression of Akt1 was
able to rescue the motility defect of the Akt2-downregulated cells in response to
eHsp90α stimulation (D, bar 9 vs. bar 6). These data suggest that Akt1 and Akt2
work cooperatively, instead of independently, to mediate the eHsp90α signaling.
However, the absence of either Akt1 or Akt2 had little effect on PDGF-BB-
stimulated migration of the same cells (B and D, bares 2, 5, 8), suggesting that

76

the PDGF-BB signaling requires a much lower threshold activity of the Akt
pathway. At the same time, Akt is still essential for PDGF-BB-stimulated HDF
migration, as we have previously demonstrated (19).

Both Akt1 and Akt2 are essential for eHsp90α mediated wound healing in
mice.

To further confirm the importance of Akt1 and Akt2 in carrying out the
eHsp90α signal, we tested the effect of topically applying recombinant eHsp90α
protein on skin wounds made on the back of Akt1- and Akt2- null mice. We
reasoned that, if Akt1 and Akt2 are critical downstream signaling molecules for
eHsp90α signaling, eHsp90α would no longer able to promote wound closure in
these mice. In the control mice shown in Figure 6A, eHsp90α treatment
significantly accelerated the wound closure (panel b vs. panel a). In contrast,
eHsp90α was unable to promote wound closure in Akt1-knockout mice (panel d
vs. panel c). Similar observations were made for wounds in Akt2-knockout mice.
As demonstrated by Figure 6B, eHsp90α treatment greatly accelerated wound
closure in the control mice (panel b vs. panel a), but showed negligible
acceleration of wound closure in the Akt2-knockout mice. Figure 6C summarizes
the quantitation of the wound areas from three independent experiments. In order
to determine if the lack of effect for eHsp90α was due to a reduction in re-
epithelialization or contraction of the wounds, we performed Hematoxylin and
eosin (H&E) staining of the wound sections. As observed in Figure 6D and E,
eHsp90α treatment dramatically promotes wound re-epithelialization, seen by the
extent of the keratinocyte migration in the epithelial layer, in the normal control

77

mice (panel a vs. panel c). However, wounds from Akt1-knockout or Akt2-
kncokout (panel b vs. panel d) mice showed pronounced reduction in re-
epithelialization in response to topically added eHsp90α protein.

3.5 Discussion

Following recent findings both in our laboratory and others, it is now
recognized that Hsp90α has two distinct functions: inside and outside the cell.
Both the intracellular and extracellular roles act in response to environmental
stress signals, such as tissue ischemia, heat, UV, gamma-irradiation, and
reactive oxygen species (ROS) (7). In this study, we have provided direct
evidence that eHsp90α does not function as a protein chaperone outside the cell.
Instead, it employs a trans-membrane signaling mechanism to promote skin cell
migration and accelerate skin wound healing. Here we propose a sequence of
steps from the newly elucidated signaling mechanism that includes: i) eHsp90α
engages the sub-domain II among the four extracellular sub-domains in LRP-1;
ii) the NPVY motif in the intracellular part of LRP-1 receives the outside-in
eHsp90α signal; iii) NPVY motif mediates eHsp90α-stimulated activation of Akt1
and Akt2 to execute eHsp90-stimulated cell motility in vitro and wound healing in
vivo.

Our findings challenge the currently existing theory that Hsp90
(intracellular or extracellular) only functions as a protein chaperone and
demonstrate that eHsp90, in fact, represents a new family of bona fide
extracellular promotility factors, which suit better in tissue repair than

78

conventional growth factors (7). Furthermore, three recent studies demonstrated
that Hsp90α-knockout mice developed normally (26-28), suggesting that Hsp90α
may not be essential for life and Hsp90α in particular may not even be the crucial
intracellular chaperone. It is plausible that Hsp90β provides the full intracellular
chaperone function required for sustaining life.

If our hypothesis is correct, then why do cells still accumulate Hsp90α in
their cytoplasm? We reason that the purpose cells preemptively store Hsp90α
protein in such large quantity is to enable them to mount an immediate eHsp90α
response to counter the prospect of tissue damage. Failure to repair tissue
damages results in chronic inflammation and further catastrophic consequences.
Therefore promoting wound closure in a timely manner is essential for the overall
integrity and functionality of the tissue. We are currently testing this hypothesis
by using TALENs-based Hsp90α-knockout cell lines and Hsp90α-knockout mice.
Moreover in regards to tumor therapeutics targeting Hsp90α, it may be time to
shift our focus away from intracellular Hsp90α strategies for anti-cancer drugs.
Instead we should specifically target the extracellular function of Hsp90α, or
eHsp90α, in the tumor environment.

79

Figure 3-1. Both the expression the LRP-1 receptor and binding of its ligand
are essential for eHsp90α to promote HDF migration in vitro and normal
wound healing in mice. (A) Primary HDF permanently down regulated for
endogenous LRP-1 using the FG-12 lentivirus system to deliver a shRNA
against human LRP-1. (B) Control shRNA-LacZ and shRNA-LRP-1
transduced HDFs were incubated overnight with serum-free media and
subjected to colloidal gold migration assay in the presence of either full length
Hsp90α (10ug/ml) or PDGF-BB (15ng/ml). (C) Migration index (%) of their
respective tracks is shown (n = 3; *P < 0.05, compared with serum-free
control). Black arrow indicates that down regulation of endogenous LRP-1
inhibits Hsp90α-induced cell migration, but not PDGF-BB. (D) Full-thickness
skin wounds (1 cm × 1 cm) in athymic nude mice were treated with either
placebo (10% CMC gel) or gel containing RAP (0.3mM). Images of 1
representative experiment are shown here. Percentage of the wound closure
at days 4-12 compared to day 0 respectively for both placebo and RAP-
treated wounds (mean ± SD). P ≤ 0.05, compared with vehicle-treated.

80

Figure 3-2. Locating the extracellular domain of LRP-1 that mediates eHsp90α
pro-motility signal. (A) Schematic of the four extracellular ligand-binding
subdomains I to IV, which represent the four LRP-1 mini-receptor constructs
(Bu et al. 2000) used for the FG12 lentiviral overexpression system. (B)
Primary HDFs were first transduced with lentiviurs expressing shRNA against
LRP-1 in order to downregulate endogenous LRP-1. (C) HDF cells which were
dowregulated for endogenous LRP-1were subsequently transduced a second
time now with lentivirus overexpressing mLRP-1 I, II, III or IV. Western blot
using anti-HA detecting the newly expressed N-terminus HA-tagged mini
receptors. (D) HDFs expressing each of the LRP-1 mini receptors were
cultured overnight under serum-free media and subjected to colloidal gold salt
migration in the presence of either PDFG-BB (15ng/ml) or Hsp90α (10ug/ml).
Migration index of the tracks is shown (n = 3; *P < 0.05, compared with serum-
free control). Black arrow indicates rescued migration by the expression of
mLRP-1-II.

81

Figure 3-3. NPVY, but not NPTY, motif in the cytoplasmic tail of LRP-1
mediates eHsp90 signaling. (A) Diagram depicting the two NPXY sites in the
85kDa cytoplasmic subunit of LRP-1 and their respective amino acid
mutations. Mutations at one (AATA or AAVA) or both (AATA-AAVA) NPXY
sites were generated and delivered via a FG12 lentiviral system. (B) Lysates
from HDFs, which have been down regulated for their endogenous LRP-1, and
subsequently transduced with either mock (GFP), mLRP1-II wild type receptor,
or mLRP1-II harboring the single or double NPXY mutations were analyzed by
Western blot with anti-LRP-1 antibody. (C) Primary HDFs, which have been
down regulated for their endogenous LRP-1 and subsequently transduced
with lentivirus expressing wild type or mutant mLRP-1-II receptors were
subjected to colloidal gold salt migration in the presence of Hsp90α (10ug/ml).
Mutation in the AAVA and double mutant (AATA-AAVA) abrogates Hsp90
driven cell migration. Migration index of the tracks is shown (n = 3; *P < 0.05,
compared with serum-free control). (D) Binding of eHsp90α to the LRP-1
receptor signals through the NPTY motif.

82

Figure 3-4. NPVY motif connects eHsp90α signals to the Akt pathway. (A)
Lystates of HDF that had their endogenous LRP-1 receptor replaced with wt
mLRP1-II mini receptor, AATA, AAVA or AATA-AAVA double mutant mLRP1-
II receptors were analyzed by Western blot using anti-pAkt. Mutation at NPVY
motif (AAVA) and the double mutant (AATA-AAVA) abrogated the activation of
Akt. (B) Primary HDFs were transduced with lentivirus expressing specific
shRNA against Akt-1, Akt-2 or Akt-3. Total cell lysates were analyzed by
Western blot using anti-Akt-1, anti-Akt-2, or anti-Akt-3 (each specific anti-Akt
antibody do not cross react with the other Akt isoforms). (C) Levels of Akt-3
expression in HDFs are significantly lower than Akt-1 and Akt-2, and
compared to Akt-3 rich rat brain cells. HDF and Rat brain cell lysates were
analyzed by Western blot using anti-Akt-3. (D) Western blot confirming the
specificity of the lentiviral shRNA targeting specifically only one of the Akt
isoforms individually and also demonstring the specificity of the antibodies. (E)
Colloidal gold salt migration assay of each of the Akt-isoform knockdown
HDFs after stimulation by either PDGF-BB (15ng/ml) or recombinant F5
fragment of Hsp90α (30ug/ml). (F) Quantitation indicates that down-regulation
of Akt-1 and Akt-2, but to a much lesser extent Akt-3, abrogates eHsp90α
driven migration. Note that down-regulation of any of the three isoforms of Akt
kinases does not affect growth factor induced cell migration (lanes e, h, and k).

83

Figure 3-5. Akt1 and Akt2 work together to mediate eHsp90α signaling. (A)
Western blot confirming the specificity of the lentiviral shRNA targeting
specifically Akt-1 and not its respective Akt-2 isoform. (B) Colloidal gold salt
migration assay showing the Akt-1 down-regulated HDFs rescued by Akt-2
lentiviral transduced over-expression after stimulation by either PDGF-BB
(15ng/ml, black bar) or recombinant F5 fragment of Hsp90α (30ug/ml, gray
bar). (C) Western blot confirming the specificity of the lentiviral shRNA
targeting specifically Akt-2 and not its respective Akt-1 isoform. (D) Colloidal
gold salt migration assay showing the Akt-2 down-regulated HDFs rescued by
Akt-1 lentiviral transduced over-expression after stimulation by either PDGF-
BB (15ng/ml, black bar) or recombinant F5 fragment of Hsp90α (30ug/ml, gray
bar).

84

Figure 3-6. Akt-1 and Akt-2 KO mice delayed wound healing cannot be
rescued by eHsp90α. (A) Wt and Akt-2 -/- mice were subjected to full-
thickness excision wounds (1 cm x 1 cm) and treated with either carboxy-
methyl cellulose (CMC) vehicle or recombinant F5 fragment of Hsp90α. (B) Wt
and Akt-1 -/- mice were subjected to full-thickness excision wounds (0.75 cm x
0.75 cm) and treated with either carboxy-methyl cellulose (CMC) vehicle or
recombinant F5 fragment of Hsp90α. (C) Quantitation showing percentage of
wound closure at day 14. Single asterisk denotes wound closure percentage
(compared to the original wound area) of Hsp90α-treated wound on a wt mice
(2%), where as the double asterisks shows delayed wound healing in both
Akt-1 and Akt-2 KO mice that cannot be rescued by Hsp90α treatment. (D and
E) H&E-stained sections of day-14 of wt mice treated with CMC vehicle (a)
and Akt-1 (d) or Akt-2 KO (d) mice treated with Hsp90α. Note that in the
absence of Akt-1 or Akt-2, wound healing is delayed compared to wt mice (c)
and it cannot be rescued by Hsp90α. Red dotted lines with arrows indicate
unhealed wound space. Yellow dotted lines mark the newly reepithelialized
epidermis.

85

Figure 3-1sA. eHs90α activates the Akt pathway via S437 phosphorylation.
Primary wild type or endogenous LRP-1 down-regulated HDF cells serum
starved overnight using DMEM plus pen/strep in the absence of FBS (serum)
and treated with Hs90α F-5 (100ug/ml) for 10 minutes. Total cell lysate were
prepared of each of the representative conditions and their relative protein
concentrations were quantitated using a Bradford standard curve. The Human
Phospho-Kinase Antibody Array was used to screen through multiple activated
phosphor-kinase pathways. Total amount of lysate was added according the
manufacturer’s protocol. Panels a, a’, c and c’ are the serum-free DMEM
treated negative control cells. Panels b, b’, d and d’ represent the cells treated
with serum-free DMEM containing 100ug/ml of Hs90α F-5. The square boxes
denote Akt phosphorylation at S437, where as the circles indicate Akt
phosphorylation at T308. The diamonds represent phosphorylation of ERK-
1/2.

86

Figure 3-1sB. ERK
1/2
is another major target in HDFs for eHs90α stimulation.
Results from the previous experiment shown at lower exposure to depict
changes in the ERK
1/2
phosphorylation. Circles indicate the detection of
phosphorylation of ERK
1/2
. Asterisk (*) indicate significance of P<0.05.

87

Figure 3-2s. eHsp90α activates Akt and ERK
1/2
pathways to promote cell
migration. (A) Time course experiment tracking Akt and ERK activation at 0, 5,
15, 45, and 120min following Hsp90α stimulation. HDF lysates were analyzed
by Western blot using anti-pAkt or anti-pERK1/2. eHsp90α-stimulated Akt
activation was rapid and sustained event (panel a), in comparison to a weaker
and transient activation of ERK1/2 (panel b). (B) Total cell lysates from primary
HDF cells that were transduced via lentivirus with either control, Akt-1wt or
Akt-1DN (dominant negative) were analyzed by Western blot using anti-Akt1.
(C) The same HDF cells were also serum-starved overnight and subjected to
colloidal gold salt migration assay under Hsp90α (10ug/ml) stimulation. Black
arrow indicates that the expression of the dominant negative form of Akt-1
blocks eHsp90α driven migration.

88

References

1. Horwich AL, Neupert W, Hartl FU. Protein-catalysed protein folding.
Trends Biotechnol 1990; 8:126-31.

2. Young JC, Moarefi I, Hartl FU. Hsp90: a specialized but essential protein-
folding tool. J Cell Biol 2001; 154:267-73.

3. Csermely P, Schnaider T, Soti C, Prohaszka Z, Nardai G. The 90-kDa
molecular chaperone family: structure, function, and clinical applications.
A comprehensive review. Pharmacol Ther 1998; 79:129-68.

4. Whitesell L, Lindquist SL. HSP90 and the chaperoning of cancer. Nat Rev
Cancer 2005; 5:761-72.

5. Eustace BK, Jay DG. Extracellular roles for the molecular chaperone,
hsp90. Cell Cycle 2004; 3:1098-100.

6. Tsutsumi S, Neckers L. Extracellular heat shock protein 90: a role for a
molecular chaperone in cell motility and cancer metastasis. Cancer Sci
2007; 98:1536-9.

7. Li W, Sahu D, Tsen F. Secreted heat shock protein-90 eHsp90 in wound
healing and cancer. Biochim Biophys Acta 2012; 1823:730-41.

8. Li W, Tsen F, Sahu D, Bhatia A, Chen M, Multhoff G, and Woodley DT.
Extracellular Hsp90 (eHsp90) as the Actual Target in Clinical Trials:
Intentionally or Unintentionally. Int Rev Cell Mol Biol 2013; 303:203-235.

9. Gopal U, Bohonowych JE, Lema-Tome C, Liu A, Garrett-Mayer E, Wang
B, Isaacs JS. A novel extracellular Hsp90 mediated co-receptor function
for LRP1 regulates EphA2 dependent glioblastoma cell invasion. PLoS
One 2011; 6:e17649.

10. Li W, Li Y, Guan S, Fan J, Cheng CF, Bright AM, Chinn C, Chen M,
Woodley DT. Extracellular heat shock protein-90alpha: linking hypoxia to
skin cell motility and wound healing. EMBO J 2007; 26:1221-33.

11. Cheng CF, Sahu D, Tsen F, Zhao Z, Fan J, Kim R, Wang X, O'Brien K, Li
Y, Kuang Y, Chen M, Woodley DT, Li W. A fragment of secreted
Hsp90alpha carries properties that enable it to accelerate effectively both
acute and diabetic wound healing in mice. J Clin Invest 2011; 121:4348-61.

12. Eustace BK, Sakurai T, Stewart JK, Yimlamai D, Unger C, Zehetmeier C,
Lain B, Torella C, Henning SW, Beste G, Scroggins BT, Neckers L, Ilag LL,

89

Jay DG. Functional proteomic screens reveal an essential extracellular
role for hsp90 alpha in cancer cell invasiveness. Nat Cell Biol 2004; 6:507-
14.

13. Tsutsumi S, Scroggins B, Koga F, Lee MJ, Trepel J, Felts S, Carreras C,
Neckers L. A small molecule cell-impermeant Hsp90 antagonist inhibits
tumor cell motility and invasion. Oncogene 2008; 27:2478-87.

14. Sahu D, Zhao Z, Tsen F, Cheng CF, Park R, Situ AJ, Dai J, Eginli A,
Shams S, Chen M, Ulmer TS, Conti P, Woodley DT, Li W. A potentially
common peptide target in secreted heat shock protein-90α for hypoxia-
inducible factor-1α-positive tumors. Mol Biol Cell 2012; 23:602-13.

15. Stellas D, El Hamidieh A, Patsavoudi E. Monoclonal antibody 4C5
prevents activation of MMP2 and MMP9 by disrupting their interaction with
extracellular HSP90 and inhibits formation of metastatic breast cancer cell
deposits. BMC Cell Biol 2010; 11:51.

16. Sims,JD, McCready J, Jay DG. Extracellular heat shock protein Hsp 70
and Hsp90α assist in matrix metalloproteinase-2 activation and breast
cancer cell migration and invasion. PLoS One, 2011; 6:e18848.

17. Cheng CF, Fan J, Fedesco M, Guan S, Li Y, Bandyopadhyay B, Bright AM,
Yerushalmi D, Liang M, Chen M, Han YP, Woodley DT, Li W.
Transforming growth factor alpha (TGFalpha)-stimulated secretion of
HSP90alpha: using the receptor LRP-1/CD91 to promote human skin cell
migration against a TGFbeta-rich environment during wound healing. Mol
Cell Biol 2008; 28:3344-58.

18. Woodley DT, Fan J, Cheng CF, Li Y, Chen M, Bu G, Li W. Participation of
the lipoprotein receptor LRP1 in hypoxia-HSP90alpha autocrine signaling
to promote keratinocyte migration. J Cell Sci 2009; 122:1495-8.

19. Chen JS, Hsu YM, Chen CC, Chen LL, Lee CC, Huang TS. Secreted heat
shock protein 90alpha induces colorectal cancer cell invasion through
CD91/LRP-1 and NF-kappaB-mediated integrin alphaV expression. J Biol
Chem 2010; 285:25458-25466.

20. Singer AJ, Clark RA. Cutaneous wound healing. N Engl J Med 1999;
341:738-746.

21. Lillis AP, Mikhailenko I, Strickland DK. Beyond endocytosis: LRP function
in cell migration, proliferation and vascular permeability. J Thromb
Haemost 2005; 3:1884-93.

90

22. Herz J, Strickland DK. LRP: a multifunctional scavenger and signaling
receptor. J Clin Invest 2001; 108:779-84.

23. Obermoeller-McCormick LM, Li Y, Osaka H, FitzGerald DJ, Schwartz AL,
Bu G. Dissection of receptor folding and ligand-binding property with
functional minireceptors of LDL receptor-related protein. J Cell Sci 2001;
114:899-908.

24. Li W, Fan J, Chen M, Guan S, Sawcer D, Bokoch GM, Woodley DT.
Mechanism of human dermal fibroblast migration driven by type I
collagen and PDGF-BB. Mol Biol Cell 2004; 15:294-309.

25. Bandyopadhyay B, Fan J, Guan S, Li Y, Chen M, Woodley DT, Li W. A
"traffic control" role for TGFbeta3: orchestrating dermal and epidermal cell
motility during wound healing. J Cell Biol 2006; 172:1093-105.

26. Grad I, Cederroth CR, Walicki J, Grey C, Barluenga S, Winssinger N, De
Massy D, Nef DS, Picard D. The molecular chaperone Hsp90α is required
for meiotic progression of spermatocytes beyond pachytene in the mouse.
PLoS One 2010; 5:e15770.

27. Imai T, Kato Y, Kajiwara C, Mizukami S, Ishige I, Ichiyanagi T, Hikida M,
Wang JY, Udono H. Heat shock protein 90 (HSP90) contributes to
cytosolic translocation of extracellular antigen for cross-presentation by
dendritic cells. Proc Natl Acad Sci 2011; 108:16363-8.

28. Kajiwara C, Kondo S, Uda S, Dai L, Ichiyanagi T, Chiba T, Ishido S, Koji T,
Udono H. Spermatogenesis arrest caused by conditional deletion of
Hsp90α in adult mice. Biology Open 2012; 1:977-982

91

CHAPTER FOUR: CONCLUSIONS AND REMARKS ABOUT FUTURE
STUDIES

4.1 Conclusions

Following the recent line of evidence, it has become apparent that Hsp90
proteins hold two independent yet equally critical functions. They act as
intracellular chaperones, as well as extracellular tissue-repair promoting factors.
Despite the apparent functional dichotomy, both actions are designed to allow
cells to cope with environmental changes, such as tissue injury. At the same time,
tumor cells have taken advantage of both functions for invasion and metastasis.
A central controller of Hsp90 secretion inside the cells, HIF-1α, is overexpressed
in more than 40% solid tumors in humans. LRP-1 is essential for eHsp90
signaling to promote cell migration and tumor invasion. We have provided direct
evidence that eHsp90α signaling is carried out by the LRP-1 receptor. eHsp90α
engages the sub-domain II of LRP-1, transmits this promotility signal via the
NPVY motif, and finally activates Akt1 and Akt2 to promote cell motility in vitro
and wound healing in vivo.

Not until recent years, have we come to recognize that Hsp90α is not
essential for development in mammals (1), indicating that Hsp90α may not be
performing a critical role inside the cell. Instead, Hsp90α might be accumulated
inside cells in order to supply the eHsp90α that protects and promotes repairs
against extracellular tissue damages, an essential task during adulthood and
aging. Consequently the observed effects of GM inhibitors in cancer clinical trials
might come from the inhibition of eHsp90, whereas their penetrations into normal

92

cells are attributed to their limited effectiveness. GM inhibitors that penetrate into
cells might actually be targeting Hsp90β, which may be responsible for the
intracellular toxicity associated with the inhibition of the ATPase chaperone
function.

Taken together, this line of evidence suggests that eHsp90α is a novel
promotility factor critical for wound healing and that this function is utilized by
tumor cells for cancer progression. Moreover, the recognition that eHsp90 plays
a critical role in tissue repair and cancer invasion provides clear advantages in
utilizing eHsp90 over conventional growth factors for wound healing and reveals
a new avenue for developing more effective therapeutic tumor interventions.
Predicted advantages from targeting eHsp90 over intracellular Hsp90 in the
prevention of tumor progression remain to be tested, upon the availability of
specific inhibitors that exclusively targets eHsp90α without affecting intracellular
Hsp90β function. A promising strategy for future studies involves the
development of inhibitors that specific target the F-5 region of eHsp90 for both in
vitro and in vivo experiments. Meanwhile, for the foreseeable future, important
questions concerning the detail mechanism of Hsp90 secretion and eHsp90
action will continue challenge researchers in the field.

4.2 Future studies

During the course of our investigation on the mechanism by which eHsp90
promotes cell migration, new questions arise. An important point to address is to
identify the promotility region of eHsp90α down to the amino acid level. Which

93

amino acids are involved in the pro-migration activity and which ones are
responsible for its recognition and binding? We are currently addressing this
question by further truncating the 115 amino acid F-5 fragment down to 27 amino
acids using subcloning techniques. Due to the size of the fragment, we have
fused the 27-aa peptide to a GST epitope to aid in the initial purification and
stability of the protein during in vivo experiments (Tsen and Li unpublished data).
Functionally, we have successfully tested the activity of these peptides in vitro
using the colloidal gold salt migration assay, as well as, in vivo using a wound
healing porcine model being developed by our laboratory (Tsen and Li
unpublished data). We plan on testing these GST-fused peptides in db/db mouse
model to further substantiate their efficacy in promoting wound healing not only in
acute, but chronic wounds as well. In order to reach down to the amino acid level,
we took advantage of the previously reported observation that Hsp90β does not
promote cell migration and utilized the sequence disparity between Hsp90α and
Hsp90β to guide our mutagenesis studies. We have preliminarily identified two
key amino acids within the F-5 region of eHsp90α and are currently testing their
role in vitro and in vivo. The throughout characterization of the promotility site of
Hsp90α will undoubtedly further our understanding of the mechanism behind
eHsp90α driven cell migration and at the same open new avenues for therapeutic
strategies involving both wound healing and cancer treatment.

In regards to the eHsp90α signaling pathway, we must also identify and
understand which downstream effectors of Akt1 and Akt2 propagate this
promotility signal, presumably down to the cell nucleus. We speculate that a well

94

known downstream effector of the Akt pathway is involved, the serine/threonine-
protein kinase called mammalian target of rapamycin (mTOR). Our laboratory is
currently exploring the involvement of this key cytosolic signaling molecule.

Although we have made significant progress in the signaling mechanism
of eHsp90α driven cell migration and wound healing, the mechanism underlining
the secretion of Hsp90α remains to be sorted. Our understanding of eHsp90α
secretion is limited to fact that Hsp90α does not possess a classical signal-
peptide at its N-terminus and therefore has been reported to exit cells via the
unconventional exosomal pathway. Yet how this process occurs and which
molecules are involved remain unknown. Further scientific advancement in this
area is needed if we as researchers are to more fully comprehend the role of
eHsp90α in wound healing and cancer progression.

95

References

1. Grad I, Cederroth CR, Walicki J, Grey C, Barluenga S, Winssinger N, De
Massy B, Nef S, Picard D. The molecular chaperone Hsp90α is required
for meiotic progression of spermatocytes beyond pachytene in the mouse.
PLoS One. 2010; 5:e15770.

2. Voss AK, Thomas T, Gruss P. Mice lacking HSP90beta fail to develop a
placental labyrinth. Development. 2000; 127:1-11.

96

BIBLIOGRAPHY

Bandyopadhyay B, Fan J, Guan S, Li Y, Chen M, Woodley DT, Li W. A “traffic
control” role for TGFbeta3: orchestrating dermal and epidermal cell motility
during wound healing. J Cell Biol. 2006; 172:1093–1105.
Banerji U. Heat shock protein 90 as a drug target: some like it hot. Clin Cancer
Res. 2009; 15:9-14.
Basu S, Binder RJ, R. Suto R, Anderson KM, Srivastava PK. Necrotic but not
apoptotic cell death releases heat shock proteins, which deliver a partial
maturation signal to dendritic cells and activate the NF-kappa B pathway. Int
Immunol. 2000; 12:1539-46.
Basu S, Srivastava PK. Heat shock proteins: the fountainhead of innate and
adaptive immune responses. Cell Stress Chaperones. 2000; 5:443-51.
Binder RJ, Vatner R, Srivastava P. The heat-shock protein receptors: some
answers and more questions. Tissue Antigens. 2004; 64:442-51.
Bouchier-Hayes L, Oberst A, McStay GP, Connell S, Tait SW, Dillon CP,
Flanagan JM, Beere HM, Green DR. Characterization of cytoplasmic caspase-2
activation by induced proximity. Mol Cell, 2009; 35:830-40.
Cecchini P, Tavano R, Polverino de Laureto P, Franzoso S, Mazzon C,
Montanari P, Papini E. The soluble recombinant Neisseria meningitidis adhesin
NadA Δ351-405 stimulates human monocytes by binding to extracellular Hsp90.
PLoS One. 2011; 6:e25089.
Chatterjee M, Jain S, Stühmer T, Andrulis M, Ungethüm U, Kuban RJ, Lorentz H,
K. Bommert, Topp M, Krämer D, Müller-Hermelink HK, Einsele H, Greiner A,
Bargou RC. STAT3 and MAPK signaling maintain overexpression of heat shock
proteins 90alpha and beta in multiple myeloma cells, which critically contribute to
tumor-cell survival. Blood. 2007; 109:720-8.
Chen, JS, Hsu YM, Chen CC, Chen LL, Lee CC, Huang TS. Secreted heat shock
protein 90alpha induces colorectal cancer cell invasion through CD91/LRP-1 and
NF-kappaB-mediated integrin alphaV expression. J Biol Chem, 2010; 285:25458-
66.
Cheng, CF, Fan J, Fedesco M, Guan S, Li Y, Bandyopadhyay B, Bright AM,
Yerushalmi C, Liang M, Chen M, Han YP, Woodley DT, Li W.. Transforming
growth factor alpha (TGFalpha)-stimulated secretion of HSP90alpha: using the
receptor LRP-1/CD91 to promote human skin cell migration against a TGFbeta-
rich environment during wound healing. Mol Cell Biol, 2008; 28:3344-58.

97

Cheng CF, Fan J, Zhao Z, Woodley DT, Li W. Secreted Heat Shock Protein-90:
A More Effective and Safer Target for Anti-Cancer Drugs? Current Signal
Transduction Therapy. 2010; 5:121-127.
Cheng CF, Sahu D, Tsen F, Zhao Z, Fan J, Kim R, Wang X, O'Brien K, Li Y,
Kuang Y, Chen M, Woodley DT, Li W. A fragment of secreted Hsp90α carries
properties that enable it to accelerate effectively both acute and diabetic wound
healing in mice. J Clin Invest. 2011:121:4348-61.
Chung YL, Troy H, Banerji U, Jackson LE, Walton MI, Stubbs M, Griffiths JR,
Judson IR, Leach MO, Workman P, Ronen SM. Magnetic resonance
spectroscopic pharmacodynamic markers of the heat shock protein 90 inhibitor
17-allylamino, 17-demethoxygeldanamycin (17AAG) in human colon cancer
models. J Natl Cancer Inst. 2003; 95:1624-33.
Clayton A, Turkes A, Navabi H, Mason MD, Tabi Z. Induction of heat shock
proteins in B-cell exosomes. J Cell Sci. 2005; 118:3631-8.
Csermely P, Schnaider T, Soti C, Prohászka Z, Nardai G. The 90-kDa molecular
chaperone family: structure, function, and clinical applications. A comprehensive
review. Pharmacol Ther. 1998; 79:129-68.
Didelot C, Lanneau D, Brunet M, Bouchot A, Cartie J, Jacquel A, Ducoroy P,
Cathelin S, Decologne N, Chiosis G, Dubrez-Daloz L, Solary E, Garrido C.
Interaction of heat-shock protein 90 beta isoform (HSP90 beta) with cellular
inhibitor of apoptosis 1 (c-IAP1) is required for cell differentiation. Cell Death
Differ. 2008; 15:859-866.
Drysdale MJ, Brough PA, Massey A, Jensen MR, Schoepfer J. Targeting Hsp90
for the treatment of cancer. Curr Opin Drug Discov Devel, 2006; 9:483-95.
Egorin MJ, Rosen DM, Wolff JH, Callery PS, Musser SM, Eiseman JL.
Metabolism of 17- allylamino-17-demethoxygeldanamycin (NSC 330507) by
murine and human hepatic preparations. Cancer Res. 1998; 58:2385-96.
Eiseman JL, Lan J, Lagattuta TF, Hamburger DR, Joseph E, Covey JM, Egorin
MJ. Pharmacokinetics and pharmacodynamics of 17-demethoxy 17-[[(2-
dimethylamino)ethyl]amino] geldanamycin (17DMAG, NSC 707545) in C.B-17
SCID mice bearing MDA-MB-231 human breast cancer xenografts. Cancer
Chemother Pharmacol. 2005; 55:21-32.
Eustace BK, Jay DG. Extracellular roles for the molecular chaperone, hsp90. Cell
Cycle. 2004; 3:1098-100.
Eustace BK, Sakurai T, Stewart JK, Yimlamai D, Unger C, Zehetmeier C, Lain B,
Torella C, Henning SW, Beste G, Scroggins BT, Neckers L, Ilag LL, Jay DG.
Functional proteomic screens reveal an essential extracellular role for hsp90
alpha in cancer cell invasiveness. Nat Cell Biol. 2004; 6:507-14.

98

Ferrarini M, Heltai S, Zocchi MR, Rugarli C. Unusual expression and localization
of heat-shock proteins in human tumor cells. Int J Cancer. 1992; 51:613-9.
Fredly H, Reikvam H, Gjertsen BT, Bruserud O. Disease-stabilizing treatment
with all-trans retinoic acid and valproic acid in acute myeloid leukemia: serum
hsp70 and hsp90 levels and serum cytokine profiles are determined by the
disease, patient age, and anti-leukemic treatment. Am J Hematol. 2012; 87:368-
76.
Février B, Raposo G. Exosomes: endosomal-derived vesicles shipping
extracellular messages. Curr Opin Cell Biol. 2004; 16:415-21.
Gopal U, Bohonowych JE, Lema-Tome C, Liu A, Garrett-Mayer E, Wang B,
Isaacs JS. A novel extracellular Hsp90 mediated co-receptor function for LRP1
regulates EphA2 dependent glioblastoma cell invasion. PLoS One. 2011;
6:e17649.
Grad I, Cederroth CR, Walicki J, Grey C, Barluenga S, Winssinger N, De Massy
B, Nef S, Picard D. The molecular chaperone Hsp90α is required for meiotic
progression of spermatocytes beyond pachytene in the mouse. PLoS One. 2010;
5:e15770.
Hacker S, Lambers C, Hoetzenecker K, Pollreisz A, Aigner C, Lichtenauer M,
Mangold A, Niederpold T, Zimmermann M, Taghavi S, Klepetko W, Ankersmit HJ.
Elevated HSP27, HSP70 and HSP90 alpha in chronic obstructive pulmonary
disease: markers for immune activation and tissue destruction. Clin Lab. 2009;
55:31-40.
Hanahan D, Weinberg RA. Hallmarks of cancer: the next generation. Cell, 2011;
144:646-74.
Herz J, Strickland DK. LRP: a multifunctional scavenger and signaling receptor. J
Clin Invest. 2001; 108:779-84.
Hightower LE, Guidon PT. Selective release from cultured mammalian cells of
heat-shock stress proteins that resemble glia-axon transfer proteins. J Cell
Physiol. 1989; 138:257-66.
Horwich AL, Neupert W, Hartl FU. Protein-catalysed protein folding. Trends
Biotechnol. 1990; 8:126-31.
Houlihan JL, Metzler JJ, Blum JS. HSP90alpha and HSP90beta isoforms
selectively modulate MHC class II antigen presentation in B cells. J Immunol.
2009; 182:7451-8.
Hung CY, Tsai MC, Wu YP, Wang RY. Identification of heat-shock protein 90
beta in Japanese encephalitis virus-induced secretion proteins. J Gen Virol.
2011; 92:2803-9.

99

Imai, T., Y. Kato, C. Kajiwara, S. Mizukami, I. Ishige, T. Ichiyanagi, M. Hikida, J.
Y. Wang & H. Udono., 2011. Heat shock protein 90 HSP90 contributes to
cytosolic translocation of extracellular antigen for cross-presentation by dendritic
cells. Proc Natl Acad Sci U S A, 108, 16363-8.
Isaacs JS, Xu W, Neckers L. Heat shock protein 90 as a molecular target for
cancer therapeutics. Cancer Cell. 2003; 3:213-7.
Kajiwara C, Kondo S, Uda S, Dai L, Ichiyanagi T, Chiba T, Ishido S, Koji T,
Udono H. Spermatogenesis arrest caused by conditional deletion of Hsp90α in
adult mice. Biology Open. 2012; 1:977-982
Kamal A, Thao L, Sensintaffar J, Zhang L, Boehm MF, Fritz LC, Burrows FJ. A
high-affinity conformation of Hsp90 confers tumour selectivity on Hsp90 inhibitors.
Nature. 2003; 425:407-10.
Kunisawa J, Shastri N. Hsp90alpha chaperones large C-terminally extended
proteolytic intermediates in the MHC class I antigen processing pathway.
Immunity. 2006; 24:523-34.
Kuo CC, Liang CM, Lai CY, Liang SM. Involvement of heat shock protein Hsp 90
beta but not Hsp90 alpha in antiapoptotic effect of CpG-B oligodeoxynucleotide.
J Immunol. 2007; 178:6100-8.
Kuroita T, Tachibana H, Ohashi H, Shirahata S, Murakami H. Growth stimulating
activity of heat shock protein 90 alpha to lymphoid cell lines in serum-free
medium. Cytotechnology. 1992; 8:109-17.
Lee EJ, Lim JY, Lee SY, Lee SH, In KH, Yoo SH, Sul D, Park S. The expression
of HSPs, anti-oxidants, and cytokines in plasma and bronchoalveolar lavage fluid
of patients with acute respiratory distress syndrome. Clin Biochem. 2012; 45:493-
8.
Li W, Li Y, Guan S, Fan J, Cheng CF, Bright AM, Chinn C, Chen M, Woodley DT.
Extracellular heat shock protein-90alpha: linking hypoxia to skin cell motility and
wound healing. EMBO J. 2007; 26:1221-33.
Li Y, Li S, Hoshino M, Ishikawa R, Kajiwara C, Gao X, Zhao Y, Ishido S, Udono
H, Wang JY. HSP90α deficiency does not affect Ig gene hypermutation and class
switch but causes enhanced MHC class II antigen presentation. Int Immunol.
2012a. [Epub ahead of print]
Li W, Sahu D, Tsen F. Secreted heat shock protein-90 Hsp90 in wound healing
and cancer. Biochim Biophys Acta. 2012; 1823:730-41.
Liao DF, Jin ZG, Baas AS, Daum G, Gygi SP, Aebersold R, Berk BC.
Purification and identification of secreted oxidative stress-induced factors from
vascular smooth muscle cells. J Biol Chem. 2000; 275:189-96.

100

Lillis AP, Mikhailenko I, Strickland DK. Beyond endocytosis: LRP function in cell
migration, proliferation and vascular permeability. J Thromb Haemost. 2005;
3:1884-93.
Lillis AP, Van Duyn LB, Murphy-Ullrich JE, Strickland DK. LDL receptor-related
protein 1: unique tissue-specific functions revealed by selective gene knockout
studies. Physiol Rev. 2008; 88:887-918.
Majmundar AJ, Wong WJ, Simon MC. Hypoxia-inducible factors and the
response to hypoxic stress. Mol Cell, 2010; 40:294-309.
Mandracchia VJ, Sanders SM, Frerichs JA. The use of becaplermin rhPDGF-BB
gel for chronic nonhealing ulcers. A retrospective analysis. Clin Podiatr Med Surg,
2001; 18:189-209, viii.
Martin P. Wound healing--aiming for perfect skin regeneration. Science. 1997;
276:75-81.
McClellan AJ, Xia Y, Deutschbauer AM, Davis RW, Gerstein M, Frydman J.
Diverse cellular functions of the Hsp90 molecular chaperone uncovered using
systems approaches. Cell. 2007; 131:121-35.
McCready J, Sims JD, Chan D, Jay DG. Secretion of extracellular hsp90alpha
via exosomes increases cancer cell motility: a role for plasminogen activation.
BMC Cancer. 2010; 10:294.
Metchat A, Akerfelt M, Bierkamp C, Delsinne V, Sistonen L, Alexandre H,
Christians ES. Mammalian heat shock factor 1 is essential for oocyte meiosis
and directly regulates Hsp90alpha expression. J Biol Chem. 2009; 284:9521-8.
Modi S, Stopeck A, Linden H, Solit D, Chandarlapaty S, Rosen N, D'Andrea G,
Dickler M, Moynahan ME, Sugarman S, Ma W, Patil S, Norton L, Hannah AL,
Hudis C. HSP90 inhibition is effective in breast cancer: a phase II trial of
tanespimycin 17-AAG plus trastuzumab in patients with HER2-positive
metastatic breast cancer progressing on trastuzumab. Clin Cancer Res. 2011;
17:5132-9.
Multhoff G, Hightower LE. Cell surface expression of heat shock proteins and the
immune response. Cell Stress Chaperones. 1996; 1:167-76.
Musiał K, Szczepańska M, Szprynger K, Zwolińska D. The impact of dialysis
modality on serum heat shock proteins in children and young adults with chronic
kidney disease. Kidney Blood Press Res. 2009a; 32:366-72.
Musiał K, Szprynger K, Szczepańska M, Zwolińska D. Heat shock proteins in
children and young adults on chronic hemodialysis. Pediatr Nephrol. 2009b;
24:2029-34.

101

Nagai MK, Embil JM. Becaplermin: recombinant platelet derived growth factor, a
new treatment for healing diabetic foot ulcers. Expert Opin Biol Ther. 2002;
2:211-8.
Neckers L, Neckers K. Heat-shock protein 90 inhibitors as novel cancer
chemotherapeutic agents. Expert Opin Emerg Drugs. 2002; 7:277-88.
Obermann WM, Sondermann H, Russo AA, Pavletich NP, Hartl FU. In vivo
function of Hsp90 is dependent on ATP binding and ATP hydrolysis. J Cell Biol,
1998; 143:901-10.
Picard D. Preface to hsp90. Biochim Biophys Acta, 2012; 1823:605-606.
Powers MV, Workman P. Targeting of multiple signalling pathways by heat shock
protein 90 molecular chaperone inhibitors. Endocr Relat Cancer. 2006; 13 Suppl
1:S125-35.
Ritossa F. Discovery of the heat shock response. Cell Stress Chaperones. 1996;
1:97-8.
Sahu D, Zhao Z, Tsen F, Cheng CF, Park R, Situ AJ, J. Dai, Eginli A, Shams S,
Chen M, Ulmer TS, Conti P, Woodley DT, Li W. A potentially common peptide
target in secreted heat shock protein-90α for hypoxia-inducible factor-1-α positive
tumors. Mol Biol Cell. 2012; 23:602-13.
Saribek B, Jin Y, Saigo M, Eto K, Abe S. HSP90beta is involved in signaling
prolactin-induced apoptosis in newt testis. Biochem Biophys Res Commun. 2006;
349:1190-7.
Sarkar AA, Zohn IE. Hectd1 regulates intracellular localization and secretion of
Hsp90 to control cellular behavior of the cranial mesenchyme. J Cell Biol. 2012;
196:789-800.
Savina A, Furlán M, Vidal M, Colombo MI. Exosome release is regulated by a
calcium-dependent mechanism in K562 cells. J Biol Chem. 2003; 278:20083-90.
Schmitt E, Gehrmann M, Brunet M, Multhoff G, Garrido C. Intracellular and
extracellular functions of heat shock proteins: repercussions in cancer therapy. J
Leukoc Biol. 2007; 81:15-27.
Semenza GL. Evaluation of HIF-1 inhibitors as anticancer agents. Drug Discov
Today. 2007; 12:853-9.
Semenza GL. Hypoxia-inducible factors in physiology and medicine: Cell. 2012a;
148:399-408.
Semenza GL. Molecular mechanisms mediating metastasis of hypoxic breast
cancer cells: Trends Mol Med. 2012b; 18:534-43.

102

Sidera K, Samiotaki M, Yfanti E, Panayotou G, Patsavoudi E. Involvement of cell
surface HSP90 in cell migration reveals a novel role in the developing nervous
system. J Biol Chem. 2004; 279:45379-88.
Sims JD, McCready J, Jay DG. Extracellular heat shock protein Hsp 70 and
Hsp90α assist in matrix metalloproteinase-2 activation and breast cancer cell
migration and invasion. PLoS One. 2011; 6:e18848.
Song X, Wang X, Zhuo W, Shi H, Feng D, Sun Y, Liang Y, Fu Y, Zhou D, Luo Y.
The regulatory mechanism of extracellular Hsp90{alpha} on matrix
metalloproteinase-2 processing and tumor angiogenesis. J Biol Chem. 2010;
285:40039-49.
Sreedhar AS, Kalmár E, Csermely P, Shen YF. Hsp90 isoforms: functions,
expression and clinical importance. FEBS Lett. 2004; 562:11-5.
Stellas D, El Hamidieh A, Patsavoudi E. Monoclonal antibody 4C5 prevents
activation of MMP2 and MMP9 by disrupting their interaction with extracellular
HSP90 and inhibits formation of metastatic breast cancer cell deposits. BMC Cell
Biol 2010; 11:51.
Stellas, D., A. Karameris & E. Patsavoudi., 2007. Monoclonal antibody 4C5
immunostains human melanomas and inhibits melanoma cell invasion and
metastasis. Clin Cancer Res, 13, 1831-8.
Stoorvogel W, Kleijmeer MJ, Geuze HJ, Raposo G. The biogenesis and functions
of exosomes. Traffic. 2002; 3:321-30.
Strickland DK, Ashcom JD, Williams S, Burgess WH, Migliorini M, Argraves WS.
Sequence identity between the alpha 2-macroglobulin receptor and low density
lipoprotein receptor-related protein suggests that this molecule is a
multifunctional receptor. J Biol Chem. 1990; 265:17401-4.
Sun Y, Zang Z, Xu X, Zhang Z, Zhong L, Zan W, Zhao Y, Sun L. Differential
proteomics identification of HSP90 as potential serum biomarker in
hepatocellular carcinoma by two-dimensional electrophoresis and mass
spectrometry. Int J Mol Sci. 2010; 11:1423-33.
Suzuki S, Kulkarni AB. Extracellular heat shock protein HSP90beta secreted by
MG63 osteosarcoma cells inhibits activation of latent TGF-beta1. Biochem
Biophys Res Commun. 2010; 398:525-31.
Théry C, Zitvogel L, Amigorena S. Exosomes: composition, biogenesis and
function. Nat Rev Immunol, 2002; 2:569-79.
Tsutsumi S, Mollapour M, Graf C, Lee CT, Scroggins BT, Xu W, Haslerova L,
Hessling M, Konstantinova AA, Trepel JB, Panaretou B, Buchner J, Mayer MP,
Prodromou C, Neckers L. Hsp90 charged-linker truncation reverses the

103

functional consequences of weakened hydrophobic contacts in the N domain.
Nat Struct Mol Biol. 2009; 16:1141-7.
Tsutsumi S, Neckers L. Extracellular heat shock protein 90: a role for a molecular
chaperone in cell motility and cancer metastasis. Cancer Sci. 2007; 98:1536-9.
Tsutsumi S, Scroggins B, Koga F, Lee MJ, Trepel J, Felts S, Carreras C,
Neckers L. A small molecule cell-impermeant Hsp90 antagonist inhibits tumor
cell motility and invasion. Oncogene. 2008; 27:2478-87.
Ullrich SJ, Robinson EA, Law LW, Willingham M, Appella E. A mouse tumor-
specific transplantation antigen is a heat shock-related protein. Proc Natl Acad
Sci U S A. 1986; 83:3121-5.
Vilenchik M, Solit D, Basso A, Huezo H, Lucas B, He H, Rosen N, Spampinato C,
Modrich P, Chiosis G. Targeting wide-range oncogenic transformation via
PU24FCl, a specific inhibitor of tumor Hsp90. Chem Biol. 2004; 11:787-97.
Voss AK, Thomas T, Gruss P. Mice lacking HSP90beta fail to develop a
placental labyrinth. Development. 2000; 127:1-11.
Wang, X., D. M. Heuvelman, J. A. Carroll, D. R. Dufield & J. L. Masferrer., 2010.
Geldanamycin-induced PCNA degradation in isolated Hsp90 complex from
cancer cells. Cancer Invest, 28, 635-41.
Wang X, Song X, Zhuo W, Fu Y, Shi H, Liang Y, Tong M, Chang G, Luo Y. The
regulatory mechanism of Hsp90alpha secretion and its function in tumor
malignancy. Proc Natl Acad Sci U S A. 2009; 106:21288-93.
Whitesell L, Lindquist SL. HSP90 and the chaperoning of cancer. Nat Rev
Cancer. 2005; 5:761-72.
Whitesell L, Mimnaugh EG, De Costa B, Myers CE, Neckers LM. Inhibition of
heat shock protein HSP90-pp60v-src heteroprotein complex formation by
benzoquinone ansamycins: essential role for stress proteins in oncogenic
transformation. Proc Natl Acad Sci U S A. 1994; 91:8324-8.
Woodley DT, Fan J, Cheng CF, Li Y, Chen M, Bu G, Li W. Participation of the
lipoprotein receptor LRP1 in hypoxia-HSP90alpha autocrine signaling to promote
keratinocyte migration. J Cell Sci. 2009; 122:1495-8.
Workman P. Altered states: selectively drugging the Hsp90 cancer chaperone.
Trends Mol Med, 2004; 10:47-51.
Workman P, Burrows F, Neckers L, Rosen N. Drugging the cancer chaperone
HSP90: combinatorial therapeutic exploitation of oncogene addiction and tumor
stress. Ann N Y Acad Sci, 2007; 1113:202-16.
Yang C, Robbins PD. The roles of tumor-derived exosomes in cancer
pathogenesis. Clin Dev Immunol. 2011, 842849.

104

Young JC, Moarefi I, Hartl FU. Hsp90: a specialized but essential protein-folding
tool. J Cell Biol. 2001; 154:267-73.
Yu X, Harris SL, Levine J. The regulation of exosome secretion: a novel function
of the p53 protein. Cancer Res. 2006; 66:4795-801.
Zagouri F, Sergentanis TN, Provatopoulou X, Kalogera E, Chrysikos D, Lymperi
M, Papadimitriou CA, Zografos E, Bletsa G, Kalles VS, Zografos GC, Gounaris A.
Serum levels of HSP90 in the continuum of breast ductal and lobular lesions. In
Vivo. 2011; 25:669-72.
Zurawska A, Urabnski J, Bieganowski P. Hsp90n - An accidental product of a
fortuitous chromosomal translocation rather than a regular Hsp90 family member
of human proteome. Biochim Biophys Acta. 2008; 1784:1844-6.

105

APPENDIX: ABBREVIATIONS

17-AAG – 17-N-Allylamino-17-demethoxygeldanamycin
17-DMA – 17-Dimethylaminoethylamino-17-demethoxygeldanamycin
bFGF – Basic fibroblast growth factor
EGF – Epidermal growth factor
FGF – Fibroblast growth factor
GA – Geldanamycin
GM – Geldanamyclin
HDFs – Human dermal fibroblasts
mLRP1 – Mini low-density lipoprotein receptor-related protein 1
PDGF-BB – Platelet derived growth factor
RAP – Receptor-associated protein
RNAi – RNA interference

Abstract (if available)

Abstract Extracellular heat shock protein-90 (eHsp90) proteins, which include the membrane-bound, released and secreted forms were first cited in scientific literature late in the 70s. It was not until the recent decade that researchers began to understand the role of exported Hsp90 in normal and tumor cells. In normal cells, Hsp90 is secreted in response to tissue injury. Tumor cells, on the other hand, have managed to constitutively secrete Hsp90 for the purpose of tissue invasion. Cells abundantly store Hsp90 in their cytoplasm, insuring a sufficient supply of extracellular Hsp90 at a moment’s notice. A well-characterized function of secreted Hsp90α is to promote cell motility, a crucial event in both wound healing and cancer. One of the primary targets for extracellular Hsp90α is the cell surface LRP-1 receptor. The promotility activity of secreted Hsp90α resides within a fragment at the boundary between linker region and middle domain. Inhibiting Hsp90α secretion, neutralizing its extracellular function or blocking its signaling through the LRP-1 receptor prevent wound healing and tumor invasion both in vitro and in vivo. ❧ In regards to wound healing, topical application of F-5 promotes acute and diabetic wound healing far more effectively than US FDA-approved conventional growth factor therapy in mice. Moreover we demonstrated that, mechanistically, eHsp90α functions as signaling molecule to promote wound closure. eHsp90α binds to the subdomain II of the LRP-1 receptor and transmits the promotility signal through its NPVY motif located in its cytoplamic tail. The NPVY motif then relays the eHsp90α signal to the Akt1 and Akt2 kinases. We confirmed our findings using cross-rescuing experiments that suggest Akt1 and Akt2 work cooperatively to create a threshold of Akt kinase activity and promote cell migration. In vivo, eHsp90α accelerated wound closure in wild type mice, but not in its Akt1- and Akt2- knockout counterparts. ❧ In cancer, despite extensive efforts in the clinical and research fronts over the lasts two decades, it is still not clear why cancer cells are more susceptible to the toxicity of Hsp90 inhibitors compared to normal cells. We also do not understand why all cancer cell lines do not share this heightened sensitivity to Hsp90 inhibitors. Based on recent findings, we reason that the selected sensitivity of cancer cells to Hsp90 inhibitors, like17-AAG, is likely due to inhibition of the extracellular Hsp90 rather than intracellular Hsp90 action. Since not all tumor cells utilize eHsp90 for motility, invasion and metastasis, only eHsp90 dependent cancer cells display sensitivity to Hsp90 inhibitors. Based on this notion, pharmaceutical agents that specifically target eHsp90 function should be more effective on treating tumor cells and less toxic on normal cells than current inhibitors that do not discriminate between the extracellular Hsp90 promotility action from its intracellular ATPase dependent function.

Linked assets

University of Southern California Dissertations and Theses

Conceptually similar

PDF

Extracellular heat shock protein-90alpha (eHsp90α): mechanisms of secretion, quantitation and function

PDF

Characterization of a fragment in secreted Hsp90α with potential therapeutic benefits in wound healing and cancer

PDF

Extracellular Hsp90α in diabetic wound healing: structure, function, and mechanism of action

PDF

Mechanism of secretion and function of heat shock protein-90 (Hsp90) family genes

PDF

Study of the mechanism by which hypoxia-inducible-factor-1 alpha (HIF-1α) regulates heat shock protein-90 alpha (Hsp90α) secretion in breast cancer

PDF

The role of secreted Hsp90α in tissue repair and cancer

PDF

Molecular mechanism of transforming growth factor-beta signaling in skin wound healing

PDF

Mechanisms of human skin cell migration and wound healing

PDF

The role of α-catlulin during tumor progression and early mouse development

PDF

Study of the role of bone morphogenetic proteins in prostate cancer progression

PDF

Exploration of the roles of cancer stem cells and survivin in the pathogenesis and progression of prostate cancer

PDF

The roles of type VII collagen in wound healing and scar reduction

PDF

The role of endoplasmic reticulum chaperones in adipogenesis, liver cancer and mammary gland development

Asset Metadata

Creator Tsen, Shao Hung Fred (author)

Core Title The mechanism by which extracellular Hsp90α promotes cell migration: implications in wound healing and cancer

School Keck School of Medicine

Degree Doctor of Philosophy

Degree Program Genetic, Molecular and Cellular Biology

Publication Date 04/15/2013

Defense Date 03/22/2013

Publisher University of Southern California (original), University of Southern California. Libraries (digital)

Tag and LRP-1,cancer progression,cell motility,OAI-PMH Harvest,secreted Hsp90,wound healing

Format application/pdf (imt)

Language English

Contributor Electronically uploaded by the author (provenance)

Advisor Li, Wei (committee chair), Chuong, Cheng-Ming (committee member), Hong, Young-Kwon (committee member), Kobielak, Agnieszka (committee member)

Creator Email f9xtudios@gmail.com,stsen@usc.edu

Permanent Link (DOI) https://doi.org/10.25549/usctheses-c3-236027

Unique identifier UC11295314

Identifier etd-TsenShaoHu-1550.pdf (filename),usctheses-c3-236027 (legacy record id)

Legacy Identifier etd-TsenShaoHu-1550.pdf

Dmrecord 236027

Document Type Dissertation

Format application/pdf (imt)

Rights Tsen, Shao Hung Fred

Type texts

Source University of Southern California (contributing entity), University of Southern California Dissertations and Theses (collection)

Access Conditions The author retains rights to his/her dissertation, thesis or other graduate work according to U.S. copyright law. Electronic access is being provided by the USC Libraries in agreement with the a...

Repository Name University of Southern California Digital Library

Repository Location USC Digital Library, University of Southern California, University Park Campus MC 2810, 3434 South Grand Avenue, 2nd Floor, Los Angeles, California 90089-2810, USA